Food & Function, Vol 02, No 02, February 2011

View Online

Food & Function

EICC-1: First EuCheMS Inorganic Chemistry Conference

Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90001C

11 - 14 April 2011 University of Manchester, UK

Linking the chemistry and physics of food with health and nutrition

The Dalton Division of the RSC is joining together with the EuCheMS Inorganic Division (EID) to host the first edition in a new European conference series in Inorganic Chemistry.

www.rsc.org/foodfunction

Volume 2 | Number 2 | February 2011 | Pages 93–144

Inorganic Chemistry is a buoyant subject area with major developments being seen in all branches of the subject and common themes emerging; this timely conference arranged across parallel sessions brings all these themes together.

Themes and Plenary Speakers Supramolecular and co-ordination chemistry Paul Beer University of Oxford, UK Organometallic and catalysis Sylviane Sabo-Etienne Laboratoire de Chimie de Coordination du CNRS, Toulouse, France Reaction mechanisms Pablo Espinet University of Valladolid, Spain Inorganic materials Reshef Tenne Weizmann Institute of Science, Israel

Energy and photochemistry Leif Hammarström Uppsala University, Sweden Bioinorganic and metallic enzymes Claudio Luchinat University of Florence, Italy Main group Markku Räsänen University of Helsinki, Finland Solid state chemistry Martin Jansen Max Planck Institute for Solid State Research, Germany

Key Deadlines Poster abstract submission 4 February 2011 Early bird registration 4 February 2011 Standard registration 4 March 2011

Submit your abstract NOW and register early to take advantage of discounts

www.rsc.org/EICC1

ISSN 2042-6496

Registered Charity Number 207890

COVER ARTICLE Vincenzo Fogliano and Francisco J. Morales Estimation of dietary intake of melanoidins from coffee and bread

2042-6496(2011)2:2;1-A

View Online

Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90002A

Food & Function

The RSC Drug Discovery Series

Linking the chemistry and physics of food with health and nutrition

Emerging Drugs and Targets for Alzheimer’s Disease Edited by Ana Martinez | Medicinal Chemistry Institute–CSIC, Spain ISBN: 9781849730457 Price: £220.00

www.rsc.org/foodfunction

A comprehensive 2-volume set that collects some of the most outstanding examples of new drugs currently in pharmaceutical development or new targets currently under the validation process that will reach the Alzheimer’s market in the next few years as disease-modifying therapeutics.

Volume 2 | Number 2 | February 2011 | Pages 93–144

Metabolism, Pharmacokinetics and Toxicity of Functional Groups: Impact of Chemical Building Blocks on ADMET Edited by Dennis A Smith | Pfizer Global R & D, UK ISBN: 9781849730167 Price: £144.99 Written by medicinal chemists and ADMET scientists with a combined experience of 300 years this aid to discovering drugs provides detailed coverage on absorption, distribution, metabolism, excretion and toxicity issues associated with new drugs.

The RSC Drug Discovery Series is a suite of professional reference books that will encourage learning in a range of different topics and provide understanding to scientists working outside of their own areas of expertise. The competitive advantage o the series is that of it w wililll fo follllow ow aan n id idea ea through to totality with an emphasis on learning and critical evaluation.

Accounts in Drug Discovery Case Studies in Medicinal Chemistry

New Frontiers in Chemical Biology Enabling Drug Discovery

Editor-in-Chief: Professor David Thurston London School of Pharmacy UK

Edited by Joel Barrish, Percy Carter, Robert Zahler, Peter Cheng Bristol-Myers-Squibb, USA ISBN: 9781849731263 Price: £132.99

Edited by Mark Bunnage Pfizer Global R & D, UK ISBN: 9781849731256 Price: £132.99

Series Editors: Dr David Fox Pfizer Global R & D UK

This book describes recent case studies in medicinal med dicinal chemistry emphasis with a particular particulaar em emph ph has asis is o on n how inevitable h ho ow w th the inev evit itab it a le problems that arise project aris ar isee during any nyy p rojectt can c be ssurmounted su rm mou ount nted ed or overcome. overcom me.

Highlights new frontiers in chemical biology and describes their impact potential in the fiel field aand an d future fu ld of drug d dr ug discovery. disco cove very ve ry. ry

Professor Ana Martinez M icinal Chemistry Institute–CSIC Med Spain Sp

New for 2011 Pharmaceutical Process Development: Current Chemical and Engineering Challenges

Animal Models for Neurodegenerative Disease Price: £132.99 | ISBN 9781849731843

Neurodegeneration: Metallostasis and Proteostasis Price: £121.99 | ISBN 9781849730501

Price: £121.99 | ISBN 9781849731461 This book is aimed at both graduates and postgraduates interested in a career in the pharmaceutical industry and informs them about the breadth of the work carried out in chemical research and development departments. It is also of value to academics wishing to advise students on the merits of careers in chemical development versus discovery.

This book provides up-to-date information on the use of transgenic mouse models in the study of neurodegenerative disorders such as Alzheimer’s and Huntington’s disease The editors have extensive knowledge and experience in this field and the book is aimed at undergraduates, postgraduates and academics.

This exemplary new book provides an up-date perspective on the latest developments in this fast moving field. Traditional views concerning the relationship between the physiopathological cycles of copper, zinc, iron, aluminium and the evolution of life, are compared with emerging ideas in the neuroscience of metal ions. Essential reading for neuroscientists working in both industry and academia.

Professor Salvatore Guccione University of Catania Italy

Dr David Rotellaa Northe t astern Universiity th USA A Advisor to the Board: Pro Pr P ofes fessor sor Ro Robin R bin b Ga G nel nellin lin Uniiver ersit siity College Londo sit ndon d n UK UK

Whilst Wh Whi Whil st every every eff effort ort was made to en ensure nsu urre tthese hese h ese prices p pric i es es w were e correct ere corr or ect at the the time time of o going goin o to pre oing press, allll information informat info rm ion iss ssubject rmat ubject ubje ct to to ch change hange ang w wi without witho hou out notice. not notice ce.

To o order order any of these titles tiitless please please e eemail mail b [email protected] [email protected] o orr vvisit isit tthe he w website! ebsite! ISSN 2042-6496

www.rsc.org/drugdiscovery Registered Charity Number 207890

COVER ARTICLE Joshua D. Lambert et al. (−)-Epigallocatechin-3-gallate increases the expression of genes related to fat oxidation in the skeletal muscle of high fat-fed mice

View Online

Food & Function www.rsc.org/foodfunction RSC Publishing is a not-for-profit publisher and a division of the Royal Society of Chemistry. Any surplus made is used to support charitable activities aimed at advancing the chemical sciences. Full details are available from www.rsc.org

IN THIS ISSUE

Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90003J

ISSN 2042-6496 CODEN FFOUAI 2(2) 93–144 (2011) Cover See Vincenzo Fogliano and Francisco J. Morales, pp. 117–123. Image reproduced by permission of Laura Gennaro from Food Funct., 2011, 2, 117.

Inside cover See Sudathip Sae-tan, Kimberly A. Grove, Mary J. Kennett and Joshua D. Lambert, pp. 111–116. Image reproduced by permission of Joshua D. Lambert from Food Funct., 2011, 2, 111.

REVIEW 101 Multistage carcinogenesis process as molecular targets in cancer chemoprevention by epicatechin-3-gallate Min-Hsiung Pan,* Yi-Siou Chiou, Yin-Jen Wang, Chi-Tang Ho and Jen-Kun Lin* ECG may block multiple stages carcinogenesis via regulating intracellular signaling transduction pathways.

PAPERS 111 ( )-Epigallocatechin-3-gallate increases the expression of genes related to fat oxidation in the skeletal muscle of high fat-fed mice Sudathip Sae-tan, Kimberly A. Grove, Mary J. Kennett and Joshua D. Lambert* ( )-Epigallocatechin-3-gallate (EGCG) enhances skeletal muscle expression of genes related to b-oxidation in high fat-fed mice.

This journal is ª The Royal Society of Chemistry 2011

Food Funct., 2011, 2, 95–100 | 95

View Online

EDITORIAL STAFF Editor Sarah Ruthven Deputy editor Kathleen Too

Linking the chemistry and physics of food with health and nutrition www.rsc.org/foodfunction

Senior publishing editor Gisela Scott

Food & Function provides a dedicated venue for research relating to the chemical and physical properties of food components and their nutritional and health benefits in humans.

Development editor Anna Simpson Publishing editors Mary Badcock, David Barden, Emma Eley, David Parker, Helen Potter, Michael Townsend

Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90003J

Food & Function

Publishing assistants Juliet Palmer, Rachel Blakeburn Publisher Emma Wilson For queries about submitted articles please contact Gisela Scott, Senior publishing editor, in the first instance. E-mail [email protected]

EDITORIAL BOARD Editor-in-Chief Professor Gary Williamson, University of Leeds, UK Associate Editors Cesar Fraga, University of Buenos Aires, Argentina & University of California, Davis, USA Steven Feng Chen, The University of Hong Kong, China

For pre-submission queries please contact Sarah Ruthven, Editor. E-mail [email protected] Food & Function (print: ISSN 2042-6496; electronic: ISSN 2042-650X) is published 12 times a year by the Royal Society of Chemistry, Thomas Graham House, Science Park, Milton Road, Cambridge, UK CB4 0WF. All orders, with cheques made payable to the Royal Society of Chemistry, should be sent to RSC Distribution Services, c/o Portland Customer Services, Commerce Way, Colchester, Essex, UK CO2 8HP. Tel +44 (0)1206 226050; E-mail [email protected] 2011 Annual (print + electronic) subscription price: £1260; US$2344. 2011 Annual (electronic) subscription price: £1134; US$2108. Customers in Canada will be subject to a surcharge to cover GST. Customers in the EU subscribing to the electronic version only will be charged VAT. If you take an institutional subscription to any RSC journal you are entitled to free, site-wide web access to that journal. You can arrange access via Internet Protocol (IP) address at www.rsc.org/ip. Customers should make payments by cheque in sterling payable on a UK clearing bank or in US dollars payable on a US clearing bank. Periodicals postage paid at Rahway, NJ, USA and at additional mailing offices. Airfreight and mailing in the USA by Mercury Airfreight International Ltd., 365 Blair Road, Avenel, NJ 07001, USA. US Postmaster: send address changes to Food & Function, c/o Mercury Airfreight International Ltd., 365 Blair Road, Avenel, NJ 07001. All despatches outside the UK by Consolidated Airfreight. Advertisement sales: Tel +44 (0) 1223 432246; Fax +44 (0) 1223 426017; E-mail [email protected] For marketing opportunities relating to this journal, contact [email protected]

Members Aedin Cassidy, University of East Anglia, UK Kevin Croft, University of Western Australia, Australia Eric Decker, University of Massachusetts, USA Alejandro Marangoni, University of Guelph, Canada

Reinhard Miller, Max Planck Institute of Colloids & Interfaces, Germany Paul Moughan, Riddet Institute, Massey University, New Zealand Johan Ubbink, The Mill, Food Concept & Physical Design, Switzerland Fons Voragen, Wageningen, The Netherlands

ADVISORY BOARD Hitoshi Ashida, Kobe University, Japan Junshi Chen, Chinese Centre of Disease Control & Prevention, China E. Allen Foegeding, North Carolina State University, USA Vincenzo Fogliano, University of Napoli Federico II, Italy Mike Gidley, University of Queensland, Australia Chi-Tang Ho, Rutgers University, USA Richard Hurrell, ETH Zurich, Switzerland Peter Lillford, University of York, UK Rui Hai Liu, Cornell University, USA

Julian McClements, University of Massachusetts, USA Clare Mills, Institute of Food Research, UK John A. Milner, National Cancer Institute, National Institutes of Health, USA Brent Murray, University of Leeds, UK Patricia Oteiza, University of California at Davis, USA Augustin Scalbert, INRA, France Helmut Sies, University of Dusseldorf, Germany Leif Skibsted, University of Copenhagen, Denmark

David Stuart, The Hershey Company, USA Arthur Tatham, University of Wales Institute, Cardiff, UK Junji Terao, University of Tokushima, Japan George van Aken, NIZO Food Research, The Netherlands Erik van der Linden, TI Food & Nutrition, The Netherlands Jose Vina, University of Valencia, Spain Peter Wood, Agriculture and Agri-Food Canada, Canada

INFORMATION FOR AUTHORS Full details on how to submit material for publication in Food & Function are given in the Instructions for Authors (available from http://www.rsc.org/authors). Submissions should be made via the journal’s homepage: http://www.rsc.org/foodfunction. Authors may reproduce/republish portions of their published contribution without seeking permission from the RSC, provided that any such republication is accompanied by an acknowledgement in the form: (Original Citation)–Reproduced by permission of The Royal Society of Chemistry. This journal is © The Royal Society of Chemistry 2011. Apart from fair dealing for the purposes of research or private study for non-commercial purposes, or criticism or review, as permitted under the Copyright, Designs and

Patents Act 1988 and the Copyright and Related Rights Regulation 2003, this publication may only be reproduced, stored or transmitted, in any form or by any means, with the prior permission in writing of the Publishers or in the case of reprographic reproduction in accordance with the terms of licences issued by the Copyright Licensing Agency in the UK. US copyright law is applicable to users in the USA. The Royal Society of Chemistry takes reasonable care in the preparation of this publication but does not accept liability for the consequences of any errors or omissions. ∞ The paper used in this publication meets the  requirements of ANSI/NISO Z39.48–1992 (Permanence of Paper). Royal Society of Chemistry: Registered Charity No. 207890.

View Online

PAPERS 117 Estimation of dietary intake of melanoidins from coffee and bread Vincenzo Fogliano and Francisco J. Morales*

Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90003J

Melanoidins are widely distributed in the human diet and daily intake was calculated from its main contributors (coffee and cereals).

124 Normalization genes for quantitative RT-PCR in differentiated Caco-2 cells used for food exposure studies Robert A. M. Vreeburg,* Shanna Bastiaan-Net and Jurriaan J. Mes A set of normalization genes for Caco-2 cells is validated, and is used to detect changes in gene expression upon exposure to apple, tomato, broccoli and mushroom.

130 Function of Plectranthus barbatus herbal tea as neuronal acetylcholinesterase inhibitor Pedro L. V. Fale, Paulo J. Amorim Madeira, M. Helena Flor^encio, Lia Ascensa˜o and Maria Luısa M. Serralheiro* Herbal tea containing rosmarinic acid and other phenolic acid derivatives can reach the brain and act as low acetylcholinesterase inhibitors.

137 Interaction of dietary flavonoids with gamma-globulin: molecular property-binding affinity relationship aspect Fan Yang, Yaru Zhao, Guoyin Kai and Jianbo Xiao* The quenching effects of flavonoids on gamma-globulin fluorescence depended on the structures of the flavonoids.

This journal is ª The Royal Society of Chemistry 2011

Food Funct., 2011, 2, 95–100 | 97

Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90003J

Top Science…New Journal Free Access Catalysis Science & Technology - focusing

MedChemComm - focusing on medicinal

on both the fundamental science and technological aspects of catalysis. www.rsc.org/catalysis

chemistry research, including new studies related to biologically-active chemical or biochemical entities that can act as pharmacological agents with therapeutic potential or relevance. www.rsc.org/medchemcomm

Chemical Science - presents findings of exceptional significance from across the chemical sciences. www.rsc.org/chemicalscience

Food & Function - linking the chemistry and physics of food with health and nutrition. www.rsc.org/foodfunction

Polymer Chemistry - publishing advances in polymer chemistry covering all aspects of synthetic and biological macromolecules, and related emerging areas. www.rsc.org/polymers

Highest Quality, Highest Impact

For more details and to register for free access, visit www.rsc.org/free_access_registration

www.rsc.org/journals Registered Charity Number 207890

w al Ne rn u Jo

Food & Function Linking the chemistry and physics of food with health and nutrition

Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90003J

www.rsc.org/foodfunction

Volume 1 | Number 1 | 2010 | Pages 1–100

ISSN 2042-6496

Food & Function Linking the chemistry and physics of food with health and nutrition Food science and nutrition is a highly multidisciplinary area. We know it can be difficult to keep abreast of each other’s work, especially when there is not enough time in the day and the pile of work keeps growing. Wouldn’t it be great if there was a journal which pulled together high impact chemical and physical research linking to human health and nutrition? Just one platform to find what you need in the field, and reach exactly the right audience when you publish your work. Food & Function provides a dedicated venue for physicists, chemists, biochemists, nutritionists and other health scientists focusing on work related to the interaction of food components with the human body.

Go to the website now to submit your research and register for free access!

www.rsc.org/foodfunction Registered Charity Number 207890

MC10 2011 Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90003J

Tenth International Conference on Materials Chemistry (MC10) | 4 - 7 July 2011 | Manchester, UK

Poster and early bird deadline – 6 May 2011 The ‘MC’ conference series has provided a showcase for materials chemistry for almost two decades, and is the flagship event of the RSC’s Materials Chemistry Division. Recent editions of the MC series have been very successful: MC7, held in Edinburgh in 2005, attracted over 450 delegates; and MC8 saw 500 scientists present their work and network in central London. In 2009, the RSC was proud to incorporate MC9 into the scientific programme of the 42nd IUPAC World Congress (IUPAC 2009). Comprising 16 symposia across 5 of the congress’ 17 parallel sessions, MC9 reached an audience of over 2000 delegates. The series returns in 2011 to its traditional format as a standalone conference over four days, beginning at lunchtime on Monday 4 July and ending at lunchtime on Thursday 7 July. MC10 will appeal to academic and industrial scientists working on the chemistry, physics and materials science of functional materials.

Themes

Student participation is strongly encouraged; as well as the opportunity to give oral presentations we place a particular emphasis on poster presentations. Bursaries will also be made available to support the attendance of students and recent graduates.

•  Advanced technologies and nanomaterials

One day registrations will be available for those wishing to focus on one particular subject.

•  Energy and sustainability •  Life and health •  Soft matter •  Crystalline solids

Plenary Speakers Professor Joanna Aizenberg Harvard University, USA Professor Andre Geim University of Manchester, UK (Winner of the Nobel Prize in Physics 2010) Professor Michael Graetzel, EPFL Lausanne, Switzerland Professor Jean-Marie Lehn TBC Université de Strasbourg, France Professor Seth Marder Georgia Institute of technology, Atlanta, USA Professor Omar Yaghi University of California, Los Angeles, USA (Winner of the RSC Centenary Prize 2010)

Key Deadlines Poster abstract submission 6 May 2011 Early bird registration 6 May 2011 Standard registration 10 June 2011

Submit your abstract NOW and register early to take advantage of discounts

www.rsc.org/MC10 Registered Charity Number 207890

Food & Function

View Online

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 101

REVIEW

www.rsc.org/foodfunction

Multistage carcinogenesis process as molecular targets in cancer chemoprevention by epicatechin-3-gallate

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

Min-Hsiung Pan,*a Yi-Siou Chiou,ab Yin-Jen Wang,b Chi-Tang Hoc and Jen-Kun Lin*d Received 6th December 2010, Accepted 22nd December 2010 DOI: 10.1039/c0fo00174k The consumption of green tea has long been associated with a reduced risk of cancer development. ()-Epicatechin-3-gallate (ECG) or ()-epigallocatechin-3-gallate (EGCG) are the major antioxidative polyphenolic compounds of green tea. They have been shown to exert growth-inhibitory potential of various cancer cells in culture and antitumor activity in vivo models. ECG or EGCG could interact with various molecules like proteins, transcription factors, and enzymes, which block multiple stages of carcinogenesis via regulating intracellular signaling transduction pathways. Moreover, ECG and EGCG possess pharmacological and physiological properties including induction of phase II enzymes, mediation of anti-inflammation response, regulation of cell proliferation and apoptosis effects and prevention of tumor angiogenesis, invasion and metastasis. Numerous review articles have been focused on EGCG, however none have been focused on ECG despite many studies supporting the cancer preventive potential of ECG. To develop ECG as an anticarcinogenic agent, more clear understanding of the cell signaling pathways and the molecular targets responsible for chemopreventive and chemotherapeutic effects are needed. This review summarizes recent research on the ECG-induced cellular signal transduction events which implicate in cancer management.

1. Introduction Tea beverages are brewed from the Camellia sinensis plant (leaves) and have been consumed in China for nearly 5000 years.1 Of the total amount of tea undergone different manufacturing processes produced and consumed globally, 78% is black tea, 20% is green tea, and <2% is oolong tea.2 Black tea is consumed primarily in Western and some Asian countries, whereas green tea is consumed primarily in China, Japan, India, and a few countries in North Africa and the Middle East. The production and consumption of oolong tea and pu-erh tea are confined to southeastern China and Taiwan.3 In recent years, many studies from our and other laboratories have shown that green tea, oolong tea, black tea and pu-erh tea contains several tea catechin components; the major catechins in tea are ()-epicatechin (EC), ()-epicatechin-3-gallate (ECG), ()-epigallocatechin (EGC), a Department of Seafood Science, National Kaohsiung Marine University, No.142, Haijhuan Rd., Nanzih District, Kaohsiung, 81143, Taiwan. E-mail: [email protected]; Fax: (+886)-7-361-1261; Tel: (+886)-7-361-7141 ext. 3623 b Department of Environmental and Occupational Health, National Cheng Kung University Medical College, Tainan, 704, Taiwan c Department of Food Science, Rutgers University, New Brunswick, New Jersey, 08901-8520, USA d Graduate Institute of Biochemistry and Molecular Biology, College of Medicine, National Taiwan University, No. 1, Section 1, Jen-ai Road, Taipei, Taiwan. E-mail: [email protected]; Fax: (+886)-2-23918944; Tel: (+886)-2-2356-2213

This journal is ª The Royal Society of Chemistry 2011

and ()-epigallocatechin-3-gallate (EGCG).4–7 It is generally agreed that much of the cancer chemopreventive effects of green tea are due to its catechin compounds. Besides tea leaves, litchi (Litchi chinensis Sonn.) peel also contains a large amount of catechins, such as EGC, EC and ECG.8,9 Several studies indicated that litchi had good antioxidant10 and anticancer activities.11,12 Although these studies did not give a direct link between the activities of ECG and litchi peel, however, there was a strong possibility that ECG might be a major contributor to the cancer preventive efficacy in litchi peel. Vaidyanathan et al.13 have reported that ECG is absorbed by monocarboxylate transporter (MCT) resulting in accumulation of ECG in the lumen (75–300 mM) and this accumulated concentration is higher than EGCG or other catechins. It is known that only 0.1% of EGCG is bioavailable (absorbed) after an intragastric administration of green tea;14 on the other hand, ECG has higher hydrophobicity and preferentially accumulates in various cells compared with EGCG. Additionally, compared to EGCG, ECG is less cytotoxic, and relatively stable at the intracellular level.15 Thus, ECG may be more potent than EGCG in bioavailability and anti-cancer potential. Both EGCG and ECG are the most concentrated catechins in green tea, and are believed to be responsible for the anti-inflammatory/antioxidant activities of green tea.16 Green tea catechins have anticancer potential with multi-targets and multi-functions, and are nontoxic.17 Ravindranath et al. showed that the ECG inhibited the growth of human tumor cells with an equal or more potency than Food Funct., 2011, 2, 101–110 | 101

View Online

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

EGCG in gender-based carcinomas.18,19 On the other hand, ECG has been shown to be more susceptible to degradation than EGCG during storage of tea leaves20 and studies showed that ECG was not detected or detected at a very low level in human plasma and urine samples,21 suggesting that ECG could be conjugated with glucuronic acid and/or sulfate in plasma22,23 in animal models.24 Many literature and reviews display the cancer preventive effects of EGCG; only a few studies discussed the usefulness of ECG. Therefore, in this review, we focus on the potential anticarcinogenic and chemopreventive abilities of ECG, and discuss mechanisms on the modulation of cellular signaling events by ECG.

2. Chemopreventive potential of ECG in multi-stage carcinogenesis Cancer is generally considered as uncontrolled cell division that results in the aggregation of cells to form tumors. There are many factors which are involved in the pathogenesis of cancer, such as: (1) individuals that engaged in risk-taking behaviors or lifestyles (e.g. smoking, use of snuff, and lack of proper diet like high in meat and low in fruits and vegetables);25 (2) exposure to known carcinogens (e.g. heavy metals of chromium);26 and (3) genetic mutations to the development of cancer (e.g. familial adenomatous polyposis,27 etc.) On this basis, cancer results from a multistage carcinogenesis process in which distinct molecular and cellular alterations that involves three stages: initiation (normal cell / transformed or initiated cell), promotion (initiated cell / preneoplastic cell), and progression (preneoplastic cell / neoplastic cell). Initiation is a result of rather rapid and irreparable process to the cell, which includes the uptake of a carcinogenic agent and its distribution and transport to organs and tissues by its metabolic activation and the subsequent covalent interaction with target cell DNA, leading to stable genotoxic damage. The transformed cells undergo many changes to form preneoplastic cells. In contrast to initiation, tumor promotion process is not rapid, and oxidative stress and chronic inflammatory are key components in promoting tumor proliferation and angiogenesis which is necessary for solid tumor growth.28 Progression involves the gradual conversion of tumor cells to the invasive cells, leading to increase metastatic potential. Each of these progression processes (angiogenesis/ invasion/ metastasis) involves rate-limiting steps that are influenced by non-malignant cells of the tumour microenvironment.29 Tumour microenvironment involved many factors such as the reactive oxygen and nitrogen species (ROS and RNS), hypoxia, cytokines, growth factors, vascular endothelial growth factor (VEGF) and matrix metalloproteinase (MMP). The microenvironmental factors were produced by cancer cells, endothelial cells, stoma fibroblasts and a variety of bone marrow-derived cells (BMDCs).29,30 It can be suggested that three major types of chemopreventive agents are: (1) inhibitors for the formation of various carcinogens; (2) blocking agents to activate detoxification, to induce antioxidant enzymes, to reduce inflammatory responses and to decrease tumor cell growth by inducing apoptosis and/or cell cycle arrest; (3) suppressing agents to restrain the tumor cells from promotion and progression by destroying one or more cell signaling pathways. Therefore, 102 | Food Funct., 2011, 2, 101–110

Fig. 1 Chemoprevention and chemotherapy effect of ECG.

chemopreventive agent in addition to known mechanism of action, it should have the following characteristics of little or no toxic effects; high efficiency; capability of oral administration; and low cost.31 Overall, ECG is an ideal chemopreventive agent (Fig. 1) which is known to reverse various intracellular signal transduction pathways by blocking or modulating the molecular expression during carcinogenesis processes (Fig. 2).

3. ECG block initiation stage in carcinogenesis process Inhibition of metabolic and induction of phase II detoxifying/ oxidant enzymes Chemicals from dietary and environmental sources undergo oxidative metabolism by phase I enzymes, a major part of the cytochrome P450 monooxygenases superfamily, to get converted to polar (water-soluble) metabolites, which are subsequently excreted via conjugation reactions catalyzed by phase II detoxifying enzymes, such as glutathione-S-transferase (GST), glutathione peroxidase (GSH-Px), superoxide dismutase (SOD), heme oxygenase-1 (HO-1) and NAD(P)H:quinone oxidoreductase 1 (NQO1), thus preventing carcinogens attacking cellular DNA and initiating tumorigenesis.32 In the absence of phases II enzymes, the metabolically active carcinogens can form a covalent adduct with DNA, resulting irreversible genotoxic damages. Irreparable damage leads to mutations in critical genes involved in growth, proliferation, and apoptosis, resulting in initiation and subsequent development of cancer. Several studies have demonstrated that ECG inhibited CYP450 isoforms implicated in rat CYP1A1/2,33 and human CYP3A4, CYP2A6, CYP2C19 and CYP2E134 in PB- or 3-methylcholanthrene-treated and B[a]P, PhIP and AFB1-treated CYP enzymes. Besides blocking the activation of CYP enzymes, ECG was shown to abrogate up to 50% benzo[a]pyrene (B[a]P)-diol epoxide-DNA adduct formation in B[a]P-treated BEAS-2B cells; inhibiting ODC activity and 20– 30% free radical generation in 12-O-tetradecanoylphorbol-13acetate (TPA)-stimulated 2C5 cells and HL-60 cells, respectively; increasing GST and NQO1 activity which could contribute to the inhibition of B[a]P-induced cell transformation ability in the anchorage-independent growth assay.35 In hydrogen peroxide (H2O2)-stimulated human bladder urothelial cells (TCCSUP and T24 BlCa), ECG could protect against oxidative stress/damage This journal is ª The Royal Society of Chemistry 2011

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

View Online

Fig. 2 Schematic represents of chemopreventive targets and efficiency of ECG on multiple stage carcinogenesis.

and cell death by reducing ROS production.36 Moreover, ECG also inhibited H2O2 production and ERK phosphorylation that preventing UVA-induced damage in keratinocytes (HaCaT cells).37 Besides, Chen et al. demonstrated that co-treatment with ECG and EGCG showed a synergistically protective effect compared to nongalloylated catechins by significantly increased cell viability, decreased lipid peroxidation and protected cell membrane against damage in lead-exposed HepG2 cells.38 These data indicated that ECG would potentiate antioxidant and antiageing capability. Protecting cells from oxidative damage not only can directly scavenge reactive oxygen species (ROS) but also enhance the body’s antioxidant enzymes by inducing de novo expression of genes that encode detoxifying/antioxidant enzymes. Recent studies have demonstrated that ECG suppressed cellular lipid peroxidation through decreased thiobarbituric acid reactive substances (TBARS) accumulation, glutathione peroxidase (GSH-Px) activity and GSSG content, and increased GSH level, as well as reduced cytotoxicity in tert-butylated hydroperoxide (t-BOOH)-exposed HepG2 cells.39 It has been shown that the reduced oxidative stress by activation of nuclear factor erythroid 2 p45 (NF-E2)-related factor 2 (Nrf2) signaling could regulate antioxidant enzyme expression.40 Therefore, Nrf2 signaling is considered as an important molecular target for cancer prevention.41 Although, ECG can increase phase II enzymes, it is not clear whether this effect is due to the modulation of Nrf2 signaling.

4. ECG block promotion stage in carcinogenesis process Anti-inflammation efficacy Chronic inflammation and infection are causally linked to multistage carcinogenic process.42 The inflammation processes This journal is ª The Royal Society of Chemistry 2011

lead to the up-regulation of a series of enzymes and signaling proteins in infected tissues and cells. These proinflammatory enzymes include the inducible forms of nitric oxide synthase (iNOS) and cyclooxygenase (COX-2), responsible for elevated levels of nitric oxide (NO) and prostaglandins (PGE2), respectively, and pro-inflammatory cytokines such as interleukin-1 (IL1), IL-6 and tumor necrosis factor-a (TNF-a), have been known to be involved directly or indirectly in carcinogenesis, especially in the promotion and progression stages.43,44 In addition, more and more evidence suggests the role for chemokines in cancer development, such as the expression of adhesion molecules, the secretion of proteinases, inhibition of apoptosis, and angiogenesis.45 Thus, blocking inflammation signaling is usually recognized as potential mode for chemoprevention. Hong et al. have reported that ECG suppresses COX-2 and LOX activity, PGE2 production, and TBX and HHT formation in human colonic mucosa and tumor tissues.46 ECG revealed anti-inflammatory effects by decreasing H2O2-induced intracellular ROS generation and impeding the phosphorylation of EGFR and ERK1, and suppressing MUC5AC overexpression.47 ECG inhibited phosphorylation of p38 MAPK and ERK, and attenuated IL-17 receptor expression which results in preventing IL-17A-mediated CCL20 production.48 Besides inhibiting 12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammation (edema) in mouse ears,49 ECG was also shown to significantly reverse interleukin-6 (IL-6) and to reduce transthyretin (TTR) and retinol binding protein (RBP) synthesis and secretion that could also be dependent on their antioxidant activities in human hepatoma cell line HepG2.50 IL-6 is believed to modulate the acute-phase protein synthesis and to down-regulate the negative acute-phase protein levels (TTR and RBP) in various inflammatory states.51,52 Studies have shown that antioxidants may attenuate the acute-phase response. The acute-phase response is Food Funct., 2011, 2, 101–110 | 103

View Online

a collective term referring to the constellation of host defense mechanisms induced in response to inflammation and infection.53 Therefore, the inhibitory activity of ECG toward inflammation may include the activation of Nrf2 signaling pathways.

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

Cell cycle regulation and growth inhibition The progression of the cell cycle is regulated by cyclin-dependent kinase (CDK) molecules and cyclins, Cdk inhibitors (CDKIs), and check point kinases (Chk 1 and Chk 2), which drive the cell from one phase to the next and maintenance of cell growth and differentiation.54 Uncontrolled cell proliferation is characteristic of transformed and malignant cells. Therefore, the modulation of cell cycle progression is one of the important strategies for chemoprevention in the multistage carcinogenesis. Most of earlier literature indicates that ECG treatment inhibited cell growth in various transformed cancer cell lines including prostate, pancreas, colon, liver, lung, breast, melanoma and tongue in a dose- and time-dependent manner.18,55–61 ECG has been reported to suppress abnormal cell growth and survival of lung tissues from B[a]P-induced lung carcinogenesis by blocking growth factor or inducing apoptosis-associated signal transduction molecular such as p53 and its downstream target genes such as Bcl-2, Bax, CDKI (p21 and p27), along with H-ras, cmyc, cyclinD1, at different time points.62 The anti-proliferation ability of ECG comes from arrest in G1 phase of the cell cycle progression via down-regulation of the b-catenin/T-cell factor (TCF)-mediated cyclin D1 gene transcription in SCC7cells.63 ECG has been reported to inhibit proliferation and growth of cancerous cells by down-regulating NUDT6 and hnRNP B1 mRNA expression in HCT11664 and A549 cells,65 respectively. Additionally, ECG may also inhibit 5 a-reductase66 and fatty acid synthase (FAS)67,68 activity that are important enzymes involved in cellular metabolism and growth regulation. The antiproliferation effect not only modulates by proliferative gene, but also regulates through growth factor stimulation.69 Most growth factors bind to specific receptors, like PDGF (platelet derived growth factor), fibroblast growth factor-2 (FGF-2) and epidermal growth factor (EGF), that can act, besides stimulation of many types of cells to divide, also stimulate cell growth, survival, differentiation, or migration, depending on the environment and the cell type.70,71 Studies indicate that estrogen receptor (ER) cross-talks with growth factor resulting in induced tumor growth and survival via mediating intracellular kinase cascades and activating downstream transcription factors, which act coordinately to regulated target genes expression involved in multiple carcinogenesis processes.72–74 ECG has been shown to inhibit ER-dependent breast cancer cell proliferation (MCF-7) and retarded tumor growth in immature female C57BL/6 mice by blocking ER activity.75 Moreover, ECG may also inhibit the PDGF-BBinduced tyrosine phosphorylation of PDGF b receptor (PDGFRb) and colony formation on the anchorage-independent growth of A172 glioblastoma cells.76 Recent reports indicated that activator protein 1 (AP-1) transcriptional activity can be stimulated by various signaling pathways that include external signals (i.e., growth factors and tyrosine kinase receptors) and cellular downstream kinase pathways such as mitogen-activated protein kinases (MAPKs) of the extracellular-signal-regulated kinase 104 | Food Funct., 2011, 2, 101–110

(ERK), p38 and JUN amino-terminal kinase (JNK) families.77 AP-1 transcription factor regulates variety of genes that play a critical role in various cellular functions including inflammation, proliferation, transformation, survival and cell death; AP-1 activity has been associated with tumorigenesis of various types of cancers.78 Recently, ECG was shown to decrease AP-1 activity and cell proliferation in ras-transformed 30.7b cells.79 Furthermore, recent data suggested that ECG might exert anti-proliferation effects by inhibiting P-glycoprotein (P-gp) efflux pump activity and enhancing intracellular accumulation of P-gp substrates (e.g. daunorubicin and rhodamine-123) in the multidrug-resistant cell lines CH(R) C5,80 BEL-7404/DOX81 and KBC2,82 and thereby increased anticancer efficiency. Apoptosis mediation Apoptosis (programmed cell death) is a multi-step, multipathway and highly ordered process that is a necessary part of the development and homeostasis of multicellular organisms. Apoptosis pathways can be initiated by a variety of stimuli, including genotoxic compounds and various environmental stresses (e.g. oxidative stress and irradiation) at the plasma membrane by death receptor ligation (extrinsic pathway) or at the mitochondria (intrinsic pathway). In both pathways, induction of apoptosis leads to activation of initiator caspases and then activate executioner caspases, which cleave the death substrates (like poly(ADP-ribose) polymerase (PARP)) and eventually result in DNA fragmentation.83,84 Induction of apoptosis serves as a protective mechanism against the development of diseases such as cancer by eliminating genetically damaged cells or unwanted cells that have improperly been induced to divide.85 Cancerous cells escape from apoptosis through the overexpression of growth-promoting oncogenes and anti-apoptotic proteins such as Ras and Bcl-2 or by downregulation or mutation of pro-apoptotic proteins such as p53 that promote neoplastic cell proliferation and tumorigenesis.86 Therefore, the activation of pro-apoptotic protein in cancer cells is one of the important strategies for cancer prevention. ECG has been reported to induce apoptosis in NCI-H460 cells by increasing the expression of p53 and reducing the expression of Bcl-2, but protein levels of H-ras and c-Myc remained unchanged.87 Several reports revealed that non-steroidal anti-inflammatory drug (NSAID) activated gene (NAG-1) is a pro-apoptotic and antitumorigenic gene,88 which regulated by several transcription factors such as p53,89,90 activating transcription factor 3 (ATF3)91 and early growth response gene-1 (EGR-1).92 In HCT116 cells, ECG enhanced NAG-1 expression via mediated ATF3 transcriptional activity and induced TSP1 expression resulting in PARP cleavage and apoptosis, suggesting that ECG acted by a p53-independent pathway.93 Previous reports also indicated that EGR-1 acted as a tumor suppressor gene by directly binding to p53,94 NAG-195 and phosphatase and tensin homolog (PTEN)96 promoters. Interestingly, ATF3 promoter activity is regulated by a variety of transcription factors, including NF-kB,97 EGR-198 and ATF/CRE.99 Similarly, ECG may also induce ATF3 and NAG-1 expression by increased EGR-1 transcriptional capability, these results displayed that ROS participated in the ECG-induced ATF3 expression but not This journal is ª The Royal Society of Chemistry 2011

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

View Online

ECG-induced NAG-1 expression.100 Simon et al. have shown that intracellular accumulation of ROS induced apoptosis by stimulating cytochrome c release to the cytosol that triggered caspase activation in many biological systems.101 Accordingly, ROS and mitochondria play an important role in proapoptotic activity. Previously studies showed that ECG could increased ROS formation and mitochondrial depolarization, thereby inducing apoptosis in DU145 cells.102 Moreover, ECG also induced caspase-3 activity, DNA fragmentation, H2O2 generation and apoptosis in the carcinoma HSC-2 cells.103 Therefore, recent studies suggested that ECG contributed to pro-oxidative activity which played an important role in proapoptotic pathways. In another study, ECG effectively suppressed the growth and survival of KATO III cells by blocking okadaic acid-induced tumor necrosis factor-a (TNF-a) release and initiating apoptosis by inducing DNA fragmentation.104 Accumulating studies exhibited that activation of TNF-a signaling pathway might lead to cell proliferation and anti-apoptosis through activated downstream MAPK kinase and transcription factors such as NF-kB and AP-1.105 Although ECG may induce apoptosis by triggering various molecules, this beneficial efficacy is still deficient in solid molecular mechanism and requires further investigation.

5. ECG blocks progression stage in carcinogenesis process Anti-metastasis ability Cancer cells migrate from the primary tumor to distant organs and proliferate at the metastatic sites, are not only promoting cancer progression but also the major cause of death for cancer patients.106 At each metastatic step, the tumor cells can be modulated by microenvironmental factors, including interactions with variety of proteolytic enzymes (e.g. matrix metalloproteinases), growth factors (e.g. EGF), and cell-cell and cellsubstrate adhesion molecules (e.g. ECM protein).29 Therefore, prevention of cancer metastasis is considered novel targets for therapy in common malignancies. Collagenases (e.g. MMP-1, MMP-13) and gelatinases (e.g. MMP-2, MMP-9) are known as matrix metalloproteinases (MMPs), which act as important mediators of ECM degradation involved in controlling tumor invasion.107,108 ECG has been reported to inhibit HT1080 cells invasion by blocking matrix metalloproteinases activity-9 (MMP-9) and -2 (MMP-2) activities in the absence of cytotoxicity.109 Likewise, ECG also reduced thrombin-induced activation of MMP-2 by direct inhibiting membrane-type matrix metalloproteinases-1 (MT1-MMP) activity, which led to the inhibition of invasion of vascular smooth muscle cells (VSMCs).110 Moreover, ECG has stronger inhibitory effect than EGCG on both eukaryotic and prokaryotic cell-derived collagenase111 and MMP-7 (Matrilysin)112 activities. Numerous laboratories have demonstrated that hepatocyte growth factor (HGF) plays a crucial role in cancer cell migration, matrix adhesion, invasion, proliferation and angiogenesis, via the phosphorylation of the c-met tyrosine kinase and activation of downstream signaling molecules including AKT, Ras/MAPK and the JAK/STAT pathway.113–115 ECG has been shown to inhibit HGF-induced cell motility and scattering by blocking This journal is ª The Royal Society of Chemistry 2011

HGF-stimulated Met, ERK and AKT phosphorylation.116,117 According to a recent reports, EGCG may be more effective than ECG in preventing tumor cell angiogenesis through abolish nucleoside diphosphate kinase (NDPK-B)118 and ribonuclease A (RNase A)119 activities, which are associated with tumor-induced metastatic process.120,121 Additionally, ECG could impair the adhering and/or spreading of mouse lung carcinoma 3LL and melanoma B16F10 cells to the fibronetin and endothelial cells,122,123 which play a critical role in the process of metastatic tumor dissemination.124 Taken together, these findings suggest that ECG possesses anti-metastasis property by regulating multiple intracellular signaling molecules.

6. Discussion Table 1 summarizes various molecular targets of ECG as a cancer chemopreventive agent. The efficacy of ECG is also compared to EGCG in various systems. Several studies have demonstrated that EGCG and ECG reduced the carcinogenic formation by interacting with microsomal cytochrome P450 enzyme proteins and impairing electron transfer. The inhibition of carbon monoxide-reduced cytochrome P450 binding by EGCG was higher than ECG. Furthermore, EGCG and ECG were potent inducer of phase II enzymes. Activation of these enzymes was accompanied by significant attenuation of lipid peroxidation and against oxidative stress. However, ECG strongly protected the cell damage, cytotoxicity and chronic inflammatory, induced by H2O2 and UVA. Adachi et al.125 have reported that EGCG could suppress epidermal growth factor receptor (EGFR) activation by induce internalization of EGFRs into endosomes in colon cancer cells. In contrast, ECG may inhibit the dimerization or intracellular kinase phosphorylation and endocytosis of EGFR at the cell surface of NHNE cells, but does not change the number of cell surface-associated EGFR. Previous reports indicate that ECG has strong inhibitory effect on arachidonic acid metabolism in human colon mucosa and colon tumors, and prevention of inflammation-induced carcinogenesis. In inflammatory processes, EGCG treatment more effectively suppressed production of proinflammatory cytokines and phosphorylation of p38 and ERK compared to ECG treatment. In addition, EGCG can also potently enhance negative acute-phase protein (TTR and RBP) secretions and achieve anti-inflammation actions. Several in vivo and in vitro studies revealed that EGCG and ECG could regulate growth inhibition and induce apoptosis via modulation of different mechanisms. EGCG and ECG has been shown to reduce H-ras, c-myc, cyclinD1 and Bcl-2 gene expression and increase p53 level in B[a]P-induced lung carcinogenesis, but no significant influence on H-ras and c-Myc expressions in a highly metastatic human lung cancer cell line NCI-H460. Moreover, some reports indicated that EGCG and ECG induced apoptosis was mediated via production of ROS (e.g. H2O2). Although ECG has been shown to generate less H2O2 than EGCG, it is still found to have greater cytotoxicity to carcinoma HSC-2 cells than the normal HGF-2 fibroblasts. Comparisons with ECG, EGCG showed higher inhibition of cell growth and AP-1 activity due to the presence of a galloyl structure on the B ring. In other research, EGCG more markedly suppressed the Food Funct., 2011, 2, 101–110 | 105

View Online

Table 1 Molecular targets of ECG as an anticarcinogenic agent Experimental models Molecular targets CYP enzymes YCYP45 activity

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

YCYP1A1/2, CYP3A4, CYP2A6, CYP2C19, and CYP2E1 activity Phase II detoxification and antioxidant enzymes YB[a]P DNA adduct formation;YODC activity; [NADPH:QR (NQO1);[GST activity;YFree radical YROS (oxidative stress/damage) YHydrogen peroxide (H2O2) production; YERK1/2 phosphorylation YGSH-Px activity;YGSSG and TBARS level;[GSH content Pro-inflammatory mediators YCOX and LOX activity;YPGE2 production; YTBX and HHT formation YROS production;Yp-EGFR (tyr1068,1048,992 and 845); YExpression of protein and mRNA MUC5AC;Yp-ERK1/2 [TTR and RBP levels YEdema YChemokine CCL20 production;YIL-17R expression Yp38 and p-ERK Growth inhibition and cell cycle arrest YNUDT6 expression YhnRNP B1 mRNA level YAP-1 activity YH-ras, c-myc, cyclinD1 and Bcl-2 expression; [p21, p27, p53 and Bax expression YP-glycoprotein (P-gp) efflux pump activity YCyclinD1 expression;Yb-catenin activity YPDGF-Rb tyrosine kinase activity YERb activity;[Uterine peroxidase activity Y5 a-reductase activity YFatty acid synthase (FAS) activity Molecules of the apoptotic signaling pathway [p53 expression;YBcl-2 expression [Caspase-3 activity;[H2O2 production [NAG-1 and ATF3 expression;[Egr-1 activity [Expression of NAG-1 and TSP-1 protein and mRNA; [ATF3 activity;[cleavage of PARP [ROS production;[mitochondrial depolarization YTNF-a release Invasion and metastatic progression YMMP-2 and MMP9 activity YMMP-2 and MT1-MMP activity

106 | Food Funct., 2011, 2, 101–110

Studied type

Dose

Reference

f Outcomes

PB- or 3-methylcholanthrenetreated rats B[a]P, PhIP and AFB1 treated human CYP enzymes

0.2–100 mM

33

EGCG > ECG

IC50 ¼ 20, 35, 30 mM

34

EGCG > ECG

BEAS-2B cells; 2C5 cells; HL-60 cells, A427, RTE

0.0001–1 mM

35

EGCG ¼ ECG

H2O2-treated human bladder urothelial cells UVA-induced HaCaT keratinocyte

10–40 mg ml1

36

ECG > EGCG

1–100 mM

37

ECG > EGCG

t-BOOH-treated HepG2 cells

10–25 mM

39

EGCG > ECG

Colon mucosa and tumor from human

30 mg ml1

46

ECG > EGCG

H2O2–induced Passage-2 NHNE cells

100 mM

47

ECG

IL-6-stimulated HepG2 cells TPA-treated mouse ear IL-17A-stimulated HGF cells

25 mM 1 mmol 50 mg ml1

50 49 48

EGCG > ECG EGCG > ECG EGCG > ECG

HCT-116 cells A549 cells 30.7b Ras 12 cells B[a]P-induced lung carcinogenesis

50 mM IC50 ¼ 50 mM IC50 ¼ 15 mM 4 mg

64 65 79 62

EGCG > ECG EGCG > ECG EGCG > ECG EGCG ¼ ECG

BEL-7404/DOX; CHRC5 cells; KB-C2 cells SCC7 cells

50–100 mM

80–82

EGCG > ECG

50 mM

63

ECG > EGCG

A172 glioblastoma cells

50 mM

76

ECG S EGCG

MCF-7, C57BL/6 mice

1 mM

75

ECG S EGCG

Rat liver and rat-1A cells chicken liver FAS

IC50 ¼ 12 mM IC50 ¼ 42 mM

66 67,68

EGCG > ECG ECG > EGCG

NCI-H460 cells HSC-2 cells

125 mM

87 103

ECG > EGCG

HCT-116 cells

50 mM

100

EGCG ¼ ECG

HCT-116 cells

50 mM

93

ECG > EGCG

DU145 cells

100 mM

102

ECG > EGCG

KATO III cells

26–500 mM

104

ECG > EGCG

HT1080 cells Thrombin-induced VSMCs

100 mg ml1 30 mM

109 110

ECG > EGCG ECG > EGCG

This journal is ª The Royal Society of Chemistry 2011

View Online

Table 1 (Contd. ) Experimental models Molecular targets

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

YMMP-7 activity YYphosphorylation of Met, ERK and Akt YPhosphorylation of ERK and Akt YNDP kinase activity YAdhesion and/or spreading YRibonuclease A (RNase A) enzymatic activity YCollagenase activity

Studied type

Dose

Reference

f Outcomes

MCF10A cells

IC50 ¼ 0.47 mM 0.65 mM

132 116

ECG > EGCG EGCG > ECG

DU145 cells MDA-MB-435 cells 3LL or B16F10 cells Cu(II)-ECG complex

110 mM 3.5 log M

EGCG ¼ ECG EGCG > ECG

46.7 mM

117 118 122,123 119

Prokaryotic and eukaryotic cell

100 mg ml1

111

ECG > EGCG

proliferation and growth than ECG via decreasing the proliferative gene NUDT6 level in HCT116 cells. However, ECG showed more effective in inducing apoptosis of DU145 and KATO III cells than EGCG by increasing ROS formation and TNFa release, respectively. Besides, ECG seems to better inhibit cell growth by blocking b-catenin, PDGF-Rb, ERb and FAS activity in different experimental systems. In HCT116 cells, ECG showed stronger antitumorigenic activity than EGCG by activating transcription factors (e.g. Egr-1, ATF-3) mediated anti-cancer gene expression, including TSP-1 and NAG-1. Nevertheless, EGCG-induced NAG-1 expression is regulated by p53. Recently studies also indicate that ECG had the strongest anti-invasion activity by reducing MMP-2 and MMP-9 activity and their activation by a direct inhibition of MT1-MMP.

EGCG > ECG

These studies suggest that ECG may be biologically more active than EGCG, and EGCG was not always the most potent chemopreventive agent among green tea catechins. While EGCG has been well studied and is known to have chemopreventive property in several cancer cells, but molecular mechanisms of ECG have not been well investigated. Therefore, research on the function of ECG is important for understanding its anti-tumor effect. Previous studies found that ECG more effective than EGCG induced apoptosis and increased cell cycle arrest by inhibiting bcatenin signaling and cyclin D1 expression in SSC-7 cells.63 Interestingly, EGCG may affect anti-tumorigenic activity in a cyclin D1-independent manner.126 EGCG induced apoptosis through increasing H2O2 generation, but not found in ECGinduced apoptosis in HSC-2 cells.103 It has been found that

Fig. 3 Schematic representation of ECG mediated intracellular signaling transduction pathways on carcinogenesis processes. : Induction of signaling cascades by ECG-regulated; ; inhibition of signaling cascades by ECG-regulated.

This journal is ª The Royal Society of Chemistry 2011

Food Funct., 2011, 2, 101–110 | 107

View Online

treatment with EGCG caused G1 arrest and apoptosis in LoVo cells, whereas ECG triggers just the former process.127 Another study displayed that ECG induced apoptosis of HCT116 cells by mediating NAG-1 expression via ATF3 in a p53-independent manner, but EGCG is involved in p53-induced NAG-1 expression.93 These are suggested by resent results, ECG seems to better modulate cell apoptosis in p53 mutant tumor cells. Therefore, these results suggest that ECG and EGCG display differences in anti-tumor mechanisms.

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

7. Conclusions In green tea extract, the percentages of the main catechins are EGCG 10–15%, EGC 6–10%, and ECG 2–3%.128 However, high ECG (537.14 mg mL1) occurs in some pu-erh tea129 and pu-erh green tea (EGCG 7.689% and ECG 9.890%, respectively).130 It is clear that ECG can interfere with multiple cell signaling pathways and has multiple targets within the cells, which are likely to interact together to reduce the risk of carcinogenesis (initiation, promotion and progression stages). These mechanisms include (a) inhibition of phase 1 CYP enzymes, (b) induction of phase II detoxification and antioxidant enzymes, (c) anti-inflammatory efficacy (d) arrest of cell cycle progression, (e) regulation of proapoptotic properties and (f) mediation of metastasis processes (Fig. 2 and 3). Many of the anti-carcinogenic affects of ECG may be due to its direct and/or indirect interaction with numerous molecular targets,131 such as NAG-1, AP-1, 5a-reductase and PDGF. Importantly, these growth inhibitions of ECG have been shown to sensitize cancer cells, but not in normal cells. Despite the regulation of intracellular signaling pathways, ECG may also inhibit RNase A and MMPs enzymatic activity via chelating copper and zinc metals, which are important cofactors for angiogenesis and metastasis. Furthermore, structure function analysis revealed that the gallate moiety of ECG is important for mediating these inhibitory effects which these acts may enhance chemoprevention ability.

Abbreviations AP-1 ATF3 BMDCs CAMs CDK CDKIs Chk COX-2 EC ECG EGCG EGC EGF EGFR EGR-1 ER ERK FAS FGF-2

Activator protein-1 Activating transcription factor 3 Bone marrow-derived cells Cell adhesion molecules Cyclin-dependent kinase Cdk inhibitors Check point kinases Cyclooxygenase-2 ()-Epicatechin Epicatechin-3-gallate ()-Epigallocatechin-3-gallate ()-Epigallocatechin Epidermal growth factor Epidermal growth factor receptor Early growth response gene-1 Estrogen receptor Extracellular-signal-regulated kinase Fatty acid synthase Fibroblast growth factor-2

108 | Food Funct., 2011, 2, 101–110

GSH-Px GST HGF hnRNPB1 HO-1 H2O2 IL iNOS JNK MAPK MCT MMP MT1-MMP NAG-1

Glutathione peroxidase Glutathione-S-transferase Hepatocyte growth factor Heterogeneous nuclear ribonucleoprotein B1 Heme oxygenase-1 Hydrogen peroxide Interleukin Inducible nitric oxide synthase Jun amino-terminal kinase Mitogen activated protein kinase Monocarboxylate transporter Matrix metalloproteinase Membrane-type matrix metalloproteinases-1 Non-steroidal anti-inflammatory drug (NSAID) activated gene-1 Nucleoside diphosphate kinase Nuclear factor-kB Nitric oxide NAD(P)H:quinone oxidoreductase 1 Nuclear factor erythroid 2 p45 (NF-E2)related factor 2 Nudix (nucleoside diphosphate linked moiety X)-type motif 6 Platelet-derived growth factor Phosphatidylinositol-3-kinase Prostaglandins P-Glycoprotein Poly(ADP-ribose) polymerase Phosphatase and tensin homolog Retinol binding protein Reactive oxygen species Reactive nitrogen species Ribonuclease A Superoxide dismutase Thiobarbituric acid reactive substances tert-Butylated hydroperoxide T-cell factor Transforming growth factor- b Tissue inhibitor of metalloproteinase Tumor necrosis factor- a 12-O-Tetradecanoyl-phorbol-acetate Transthyretin Vascular endothelial growth factor Vascular smooth muscle cells

NDPK-B NF-kB NO NQO1 Nrf2 NUDT6 PDGF PI3K PGs P-gp PARP PTEN RBP ROS RNS RNase A SOD TBARS t-BOOH TCF TGF-b TIMP TNF-a TPA TTR VEGF VSMCs

References 1 D. L. McKay and J. B. Blumberg, J. Am. Coll. Nutr., 2002, 21, 1. 2 J. Ju, G. Lu, J. D. Lambert and C. S. Yang, Semin. Cancer Biol., 2007, 17, 395. 3 C. Han and Y. Gong, Wei Sheng Yan Jiu, 1999, 28, 343. 4 M. H. Ravindranath, V. Ramasamy, S. Moon, C. Ruiz and S. Muthugounder, Evid. Based. Complement Alternat. Med., 2009, 6, 523. 5 T. Ohe, K. Marutani and S. Nakase, Mutat. Res., Genet. Toxicol. Environ. Mutagen., 2001, 496, 75. 6 K. M. Ku, J. Kim, H. J. Park, K. H. Liu and C. H. Lee, J. Agric. Food Chem., 2010, 58, 345. 7 T. D. Way, H. Y. Lin, D. H. Kuo, S. J. Tsai, J. C. Shieh, J. C. Wu, M. R. Lee and J. K. Lin, J. Agric. Food Chem., 2009, 57, 5257.

This journal is ª The Royal Society of Chemistry 2011

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

View Online

8 T. Kuzuhara, M. Suganuma and H. Fujiki, Cancer Lett., 2008, 261, 12. 9 P. C. Q. J. M. G. Donglin Zhang, Postharvest Biol. Technol., 2000, 19, 165. 10 X. Duan, G. Wu and Y. Jiang, Molecules, 2007, 12, 759. 11 X. Wang, Y. Wei, S. Yuan, G. Liu, Y. L. Zhang and W. Wang, Cancer Lett., 2006, 239, 144. 12 A. H. Xiong, W. J. Shen, L. Y. Xiao and J. H. Lv, Zhong Yao Cai, 2008, 31, 1533. 13 J. B. Vaidyanathan and T. Walle, J. Pharmacol. Exp. Ther., 2003, 307, 745. 14 L. Chen, M. J. Lee, H. Li and C. S. Yang, Drug Metab Dispos., 1997, 25, 1045. 15 Y. Kawai, H. Tanaka, K. Murota, M. Naito and J. Terao, Biochem. Biophys. Res. Commun., 2008, 374, 527. 16 H. K. Na and Y. J. Surh, Food Chem. Toxicol., 2008, 46, 1271. 17 S. B. Moyers and N. B. Kumar, Nutr. Rev., 2004, 62, 204. 18 M. H. Ravindranath, T. S. Saravanan, C. C. Monteclaro, N. Presser, X. Ye, S. R. Selvan and S. Brosman, Evid. Based. Complement Alternat. Med., 2006, 3, 237. 19 M. H. Ravindranath, V. Ramasamy, S. Moon, C. Ruiz and S. Muthugounder, Evid. Based. Complement Alternat. Med., 2009, 6, 523. 20 M. Friedman, C. E. Levin, S. U. Lee and N. Kozukue, J. Food Sci., 2009, 74, H47. 21 M. J. Lee, Z. Y. Wang, H. Li, L. Chen, Y. Sun, S. Gobbo, D. A. Balentine and C. S. Yang, Cancer Epidemiol. Biomarkers Prev., 1995, 4, 393. 22 M. J. Lee, P. Maliakal, L. Chen, X. Meng, F. Y. Bondoc, S. Prabhu, G. Lambert, S. Mohr and C. S. Yang, Cancer Epidemiol. Biomarkers Prev., 2002, 11, 1025. 23 P. G. Pietta, P. Simonetti, C. Gardana, A. Brusamolino, P. Morazzoni and E. Bombardelli, BioFactors, 1998, 8, 111. 24 M. L. Mata-Bilbao, C. Andres-Lacueva, E. Roura, O. Jauregui, E. Escribano, C. Torre and R. M. Lamuela-Raventos, Br. J. Nutr., 2008, 100, 496. 25 V. J. de, D. S. Jonker-Termont, E. M. van Lieshout, M. B. Katan and M. R. van der, Carcinogenesis, 2005, 26, 387. 26 E. T. Snow, Pharmacol. Ther., 1992, 53, 31. 27 R. B. van der Luijt, C. M. Tops and H. F. Vasen, Ned. Tijdschr. Geneeskd., 2000, 144, 2007. 28 L. M. Coussens and Z. Werb, Nature, 2002, 420, 860. 29 J. A. Joyce and J. W. Pollard, Nat. Rev. Cancer, 2009, 9, 239. 30 J. A. Cook, D. Gius, D. A. Wink, M. C. Krishna, A. Russo and J. B. Mitchell, Semin. Radiat. Oncol., 2004, 14, 259. 31 M. A. Morse and G. D. Stoner, Carcinogenesis, 1993, 14, 1737. 32 A. N. Kong, E. Owuor, R. Yu, V. Hebbar, C. Chen, R. Hu and S. Mandlekar, Drug Metab. Rev., 2001, 33, 255. 33 Z. Y. Wang, M. Das, D. R. Bickers and H. Mukhtar, Drug Metab Dispos., 1988, 16, 98. 34 S. Muto, K. Fujita, Y. Yamazaki and T. Kamataki, Mutat. Res., Fundam. Mol. Mech. Mutagen., 2001, 479, 197. 35 V. E. Steele, G. J. Kelloff, D. Balentine, C. W. Boone, R. Mehta, D. Bagheri, C. C. Sigman, S. Zhu and S. Sharma, Carcinogenesis, 2000, 21, 63. 36 C. H. Coyle, B. J. Philips, S. N. Morrisroe, M. B. Chancellor and N. Yoshimura, Life Sci., 2008, 83, 12. 37 C. C. Huang, J. Y. Fang, W. B. Wu, H. S. Chiang, Y. J. Wei and C. F. Hung, Arch. Dermatol. Res., 2005, 296, 473. 38 L. Chen, X. Yang, H. Jiao and B. Zhao, Toxicol. Sci., 2002, 69, 149. 39 C. Murakami, Y. Hirakawa, H. Inui, Y. Nakano and H. Yoshida, Biosci., Biotechnol., Biochem., 2002, 66, 1559. 40 A. K. Jaiswal, Free Radical Biol. Med., 2004, 36, 1199. 41 J. S. Lee and Y. J. Surh, Cancer Lett., 2005, 224, 171. 42 H. Ohshima and H. Bartsch, Mutat. Res., Fundam. Mol. Mech. Mutagen., 1994, 305, 253. 43 C. Santangelo, R. Vari, B. Scazzocchio, B. R. Di, C. Filesi and R. Masella, Ann. Ist. Super. Sanita, 2007, 43, 394. 44 K. S. Zaenker, Contrib. Microbiol., 2006, 13, 232. 45 P. Proost, A. Wuyts and D. J. van, Int. J. Clin. Lab Res., 1996, 26, 211. 46 J. Hong, T. J. Smith, C. T. Ho, D. A. August and C. S. Yang, Biochem. Pharmacol., 2001, 62, 1175. 47 H. J. Kim, J. H. Ryu, C. H. Kim, J. W. Lim, U. Y. Moon, G. H. Lee, J. G. Lee, S. J. Baek and J. H. Yoon, Am. J. Respir. Cell Mol. Biol., 2009.

This journal is ª The Royal Society of Chemistry 2011

48 Y. Hosokawa, I. Hosokawa, K. Ozaki, T. Nakanishi, H. Nakae and T. Matsuo, Cell. Physiol. Biochem., 2009, 24, 391. 49 M. T. Huang, C. T. Ho, Z. Y. Wang, T. Ferraro, T. Finnegan-Olive, Y. R. Lou, J. M. Mitchell, J. D. Laskin, H. Newmark and C. S. Yang, Carcinogenesis, 1992, 13, 947. 50 M. A. el-Saadany, H. M. Rawel, J. Raila, M. S. el-Dashloty and F. J. Schweigert, Cell Biochem. Funct., 2008, 26, 95. 51 J. V. Castell, M. J. Gomez-Lechon, M. David, R. Fabra, R. Trullenque and P. C. Heinrich, Hepatology, 1990, 12, 1179. 52 P. C. Heinrich, J. V. Castell and T. Andus, Biochem. J., 1990, 265, 621. 53 F. Ceciliani, A. Giordano and V. Spagnolo, Protein Pept. Lett., 2002, 9, 211. 54 I. Collins and M. D. Garrett, Curr. Opin. Pharmacol., 2005, 5, 366. 55 X. Tan, D. Hu, S. Li, Y. Han, Y. Zhang and D. Zhou, Cancer Lett., 2000, 158, 1. 56 L. Chen, X. Yang, H. Jiao and B. Zhao, Toxicol. Sci., 2002, 69, 149. 57 C. Chen, R. Yu, E. D. Owuor and A. N. Kong, Arch. Pharmacal Res., 2000, 23, 605. 58 T. M. Elattar and A. S. Virji, Anticancer Res., 2000, 20, 3459. 59 G. Y. Yang, J. Liao, K. Kim, E. J. Yurkow and C. S. Yang, Carcinogenesis, 1998, 19, 611. 60 S. Okabe, M. Suganuma, M. Hayashi, E. Sueoka, A. Komori and H. Fujiki, Jpn. J. Cancer Res., 1997, 88, 639. 61 S. Valcic, B. N. Timmermann, D. S. Alberts, G. A. Wachter, M. Krutzsch, J. Wymer and J. M. Guillen, Anti-Cancer Drugs, 1996, 7, 461. 62 S. Manna, S. Mukherjee, A. Roy, S. Das and C. K. Panda, J. Nutr. Biochem., 2009, 20, 337. 63 Y. C. Lim, S. H. Lee, M. H. Song, K. Yamaguchi, J. H. Yoon, E. C. Choi and S. J. Baek, Eur. J. Cancer, 2006, 42, 3260. 64 M. Sukhthankar, C. K. Choi, A. English, J. S. Kim and S. J. Baek, J. Nutr. Biochem., 2010, 21, 98. 65 N. Fujimoto, N. Sueoka, E. Sueoka, S. Okabe, M. Suganuma, M. Harada and H. Fujiki, Int. J. Oncol., 2002, 20, 1233. 66 S. Liao and R. A. Hiipakka, Biochem. Biophys. Res. Commun., 1995, 214, 833. 67 W. X. Tian, Curr. Med. Chem., 2006, 13, 967. 68 X. Wang, K. S. Song, Q. X. Guo and W. X. Tian, Biochem. Pharmacol., 2003, 66, 2039. 69 T. Kondo, S. Ezzat and S. L. Asa, Nat. Rev. Cancer, 2006, 6, 292. 70 R. D. Stanzel, S. Lourenssen, D. G. Nair and M. G. Blennerhassett, Am. J. Physiol Cell Physiol, 2010, 299, C805. 71 P. M. Comoglio, M. F. Di Renzo, G. Gaudino, C. Ponzetto and M. Prat, Am. Rev. Respir. Dis., 1990, 142, S16. 72 R. Schiff, S. A. Massarweh, J. Shou, L. Bharwani, S. K. Mohsin and C. K. Osborne, Clin. Cancer Res., 2004, 10, 331S. 73 H. Lu, J. Li, D. Zhang, G. D. Stoner and C. Huang, Nutr. Cancer, 2006, 54, 69. 74 D. P. Edwards and V. Boonyaratanakornkit, Mol. Interventions, 2003, 3, 12. 75 M. G. Goodin, K. C. Fertuck, T. R. Zacharewski and R. J. Rosengren, Toxicol. Sci., 2002, 69, 354. 76 A. Sachinidis, C. Seul, S. Seewald, H. Ahn, Y. Ko and H. Vetter, FEBS Lett., 2000, 471, 51. 77 R. Eferl and E. F. Wagner, Nat. Rev. Cancer, 2003, 3, 859. 78 E. Shaulian, Cell. Signalling, 2010, 22, 894. 79 J. Y. Chung, C. Huang, X. Meng, Z. Dong and C. S. Yang, Cancer Res., 1999, 59, 4610. 80 J. Jodoin, M. Demeule and R. Beliveau, Biochim. Biophys. Acta, Mol. Cell Res., 2002, 1542, 149. 81 G. Liang, A. Tang, X. Lin, L. Li, S. Zhang, Z. Huang, H. Tang and Q. Q. Li, Int. J. Oncol., 2010, 37, 111. 82 S. Kitagawa, T. Nabekura and S. Kamiyama, J. Pharm. Pharmacol., 2004, 56, 1001. 83 M. O. Hengartner, Nature, 2000, 407, 770. 84 S. Elmore, Toxicol. Pathol., 2007, 35, 495. 85 N. N. Danial and S. J. Korsmeyer, Cell, 2004, 116, 205. 86 G. Klein, Cell Death. Differ., 2004, 11, 13. 87 C. Ganguly, P. Saha, C. K. Panda and S. Das, Asian Pac. J. Cancer Prev., 2005, 6, 326. 88 S. J. Baek, K. S. Kim, J. B. Nixon, L. C. Wilson and T. E. Eling, Mol. Pharmacol., 2001, 59, 901. 89 P. X. Li, J. Wong, A. Ayed, D. Ngo, A. M. Brade, C. Arrowsmith, R. C. Austin and H. J. Klamut, J. Biol. Chem., 2000, 275, 20127.

Food Funct., 2011, 2, 101–110 | 109

Downloaded on 09 February 2011 Published on 18 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00174K

View Online

90 S. J. Baek, L. C. Wilson and T. E. Eling, Carcinogenesis, 2002, 23, 425. 91 S. H. Lee, K. Yamaguchi, J. S. Kim, T. E. Eling, S. Safe, Y. Park and S. J. Baek, Carcinogenesis, 2006, 27, 972. 92 J. H. Lim, J. W. Park, D. S. Min, J. S. Chang, Y. H. Lee, Y. B. Park, K. S. Choi and T. K. Kwon, Apoptosis, 2007, 12, 411. 93 S. J. Baek, J. S. Kim, F. R. Jackson, T. E. Eling, M. F. McEntee and S. H. Lee, Carcinogenesis, 2004, 25, 2425. 94 P. Nair, S. Muthukkumar, S. F. Sells, S. S. Han, V. P. Sukhatme and V. M. Rangnekar, J. Biol. Chem., 1997, 272, 20131. 95 S. J. Baek, J. S. Kim, S. M. Moore, S. H. Lee, J. Martinez and T. E. Eling, Mol. Pharmacol., 2005, 67, 356. 96 T. Virolle, E. D. Adamson, V. Baron, D. Birle, D. Mercola, T. Mustelin and I. de B, Nat. Cell Biol., 2001, 3, 1124. 97 W. Kaszubska, H. R. Hooft van, P. Ghersa, A. M. Raemy-Schenk, B. P. Chen, T. Hai, J. F. DeLamarter and J. Whelan, Mol. Cell Biol., 1993, 13, 7180. 98 F. G. Bottone, Jr., Y. Moon, B. ston-Mills and T. E. Eling, J. Pharmacol. Exp. Ther., 2005, 315, 668. 99 K. Tamura, B. Hua, S. Adachi, I. Guney, J. Kawauchi, M. Morioka, M. Tamamori-Adachi, Y. Tanaka, Y. Nakabeppu, M. Sunamori, J. M. Sedivy and S. Kitajima, EMBO J., 2005, 24, 2590. 100 K. N. Cho, M. Sukhthankar, S. H. Lee, J. H. Yoon and S. J. Baek, Eur. J. Cancer, 2007, 43, 2404. 101 H. U. Simon, A. Haj-Yehia and F. Levi-Schaffer, Apoptosis., 2000, 5, 415. 102 L. Y. Chung, T. C. Cheung, S. K. Kong, K. P. Fung, Y. M. Choy, Z. Y. Chan and T. T. Kwok, Life Sci., 2001, 68, 1207. 103 H. Babich, M. E. Krupka, H. A. Nissim and H. L. Zuckerbraun, Toxicol. in Vitro, 2005, 19, 231. 104 S. Okabe, Y. Ochiai, M. Aida, K. Park, S. J. Kim, T. Nomura, M. Suganuma and H. Fujiki, Jpn. J. Cancer Res., 1999, 90, 733. 105 U. Gaur and B. B. Aggarwal, Biochem. Pharmacol., 2003, 66, 1403. 106 P. S. Steeg, Nat. Rev. Cancer, 2003, 3, 55. 107 M. Egeblad and Z. Werb, Nat. Rev. Cancer, 2002, 2, 161. 108 L. A. Liotta, U. P. Thorgeirsson and S. Garbisa, Cancer Metastasis Rev., 1982, 1, 277. 109 M. Maeda-Yamamoto, H. Kawahara, N. Tahara, K. Tsuji, Y. Hara and M. Isemura, J. Agric. Food Chem., 1999, 47, 2350. 110 B. J. El, M. H. Oak, P. Anglard and V. B. Schini-Kerth, Cardiovasc. Res., 2005, 67, 317.

110 | Food Funct., 2011, 2, 101–110

111 M. Makimura, M. Hirasawa, K. Kobayashi, J. Indo, S. Sakanaka, T. Taguchi and S. Otake, J. Periodontol., 1993, 64, 630. 112 H. Oneda, M. Shiihara and K. Inouye, J. Biochem., 2003, 133, 571. 113 C. Parr, G. Davies, T. Nakamura, K. Matsumoto, M. D. Mason and W. G. Jiang, Biochem. Biophys. Res. Commun., 2001, 285, 1330. 114 H. Y. Zhou, Y. L. Pon and A. S. Wong, Endocrinology, 2007, 148, 5195. 115 U. S. Kammula, E. J. Kuntz, T. D. Francone, Z. Zeng, J. Shia, R. G. Landmann, P. B. Paty and M. R. Weiser, Cancer Lett., 2007, 248, 219. 116 R. L. Bigelow and J. A. Cardelli, Oncogene, 2006, 25, 1922. 117 D. Duhon, R. L. Bigelow, D. T. Coleman, J. J. Steffan, C. Yu, W. Langston, C. G. Kevil and J. A. Cardelli, Mol. Carcinog., 2010, 49, 739. 118 I. L. Buxton, Proc. West Pharmacol. Soc., 2008, 51, 30. 119 K. S. Ghosh, T. K. Maiti, A. Mandal and S. Dasgupta, FEBS Lett., 2006, 580, 4703. 120 S. M. Rumjahn, M. A. Javed, N. Wong, W. E. Law and I. L. Buxton, Br. J. Cancer, 2007, 97, 1372. 121 G. F. Hu, J. Protein Chem., 1997, 16, 669. 122 M. Isemura, Y. Suzuki, K. Satoh, K. Narumi and M. Motomiya, Cell Biol. Int., 1993, 17, 559. 123 K. Ogata, N. Mukae, Y. Suzuki, K. Satoh, K. Narumi, T. Nukiwa and M. Isemura, Planta Med., 1995, 61, 472. 124 T. Kawaguchi, Curr. Drug Targets. Cardiovasc. Haematol. Disord., 2005, 5, 39. 125 S. Adachi, T. Nagao, S. To, A. K. Joe, M. Shimizu, R. MatsushimaNishiwaki, O. Kozawa, H. Moriwaki, F. R. Maxfield and I. B. Weinstein, Carcinogenesis, 2008, 29, 1986. 126 J. W. Kim, A. R. Amin and D. M. Shin, Cancer Prev. Res., 2010, 3, 900. 127 X. Tan, D. Hu, S. Li, Y. Han, Y. Zhang and D. Zhou, Cancer Lett., 2000, 158, 1. 128 T. Kuzuhara, M. Suganuma and H. Fujiki, Cancer Lett., 2008, 261, 12. 129 G. Xie, M. Ye, Y. Wang, Y. Ni, M. Su, H. Huang, M. Qiu, A. Zhao, X. Zheng, T. Chen and W. Jia, J. Agric. Food Chem., 2009, 57, 3046. 130 D. Wang, R. Xiao, X. Hu, K. Xu, Y. Hou, Y. Zhong, J. Meng, B. Fan and L. Liu, J. Agric. Food Chem., 2010, 58, 1350. 131 T. Kuzuhara, M. Suganuma and H. Fujiki, Cancer Lett., 2008, 261, 12. 132 H. Oneda, M. Shiihara and K. Inouye, J. Biochem., 2003, 133, 571.

This journal is ª The Royal Society of Chemistry 2011

Food & Function

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 111

PAPER

www.rsc.org/foodfunction

Downloaded on 09 February 2011 Published on 04 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00155D

()-Epigallocatechin-3-gallate increases the expression of genes related to fat oxidation in the skeletal muscle of high fat-fed mice Sudathip Sae-tan,a Kimberly A. Grove,a Mary J. Kennettb and Joshua D. Lambert*a Received 15th October 2010, Accepted 10th December 2010 DOI: 10.1039/c0fo00155d ()-Epigallocatechin-3-gallate (EGCG), the major polyphenol in green tea, has been shown to prevent the development of obesity in rodent models. Here, we examined the effect of EGCG on markers of fat oxidation in high fat-fed C57bl/6J mice. High fat-fed mice treated with 0.32% dietary EGCG for 16 weeks had reduced body weight gain and final body weight (19.2% and 9.4%, respectively) compared to high fat-fed controls. EGCG-treatment decreased fasting blood glucose, plasma insulin, and insulin resistance by 18.5%, 25.3%, and 33.9%, respectively. EGCG treatment also reduced markers of obesityrelated fatty liver disease in high fat-fed mice. Gene expression analysis of skeletal muscle showed that EGCG increased mRNA levels of nuclear respiratory factor (nrf)1, medium chain acyl coA decarboxylase (mcad), uncoupling protein (ucp)3, and peroxisome proliferator responsive element (ppar)a by 1.4–1.9-fold compared to high fat-fed controls. These genes are all related to mitochondrial fatty acid oxidation. In addition, EGCG increased fecal excretion of lipids in high fat-fed mice. In summary, it appears that EGCG modulates body weight gain in high fat-fed mice both by increasing the expression of genes related fat oxidation in the skeletal muscle and by modulating fat absorption from the diet.

1.0 Introduction ()-Epigallocatechin-3-gallate (EGCG, Fig. 1) is the most abundant and widely-studied catechin in green tea (Camellia sinensis, Theaceae).1 Previous studies have shown that green tea and EGCG inhibit the development of obesity in laboratory animal models, and may modulate body weight in human subjects [reviewed in 2]. Treatment of C57bl/6J mice with 0.32% dietary EGCG for 16 wk has been shown to reduce high fat diet induced body weight gain, markers of Type II diabetes, and severity of obesity-related fatty liver disease (ORLFD).3 Analysis of fecal lipid content showed that EGCG treatment increased fecal lipid excretion, and that these increases strongly correlated with decreased body weight gain. Pancreatic lipase is the major digestive enzyme responsible for the cleavage of triglycerides in the small intestine.4 EGCG has previously been shown to inhibit pancreatic lipase in vitro.5,6 We have recently found that EGCG-mediated inhibition of pancreatic lipase is non-competitive with respect to substrate concentration (Grove et al., unpublished results). Other recent studies have suggested that EGCG and green tea may modulate expression of genes related to lipid a Department of Food Science, The Pennsylvania State University, 332 Food Science Building, University Park, PA, 16802, USA. E-mail: [email protected]; Fax: (+814)863-6132 b Department of Veterinary and Biomedical Science, The Pennsylvania State University, University Park, PA, 16802, USA

This journal is ª The Royal Society of Chemistry 2011

metabolism. For example, Klaus et al. have reported that treatment of New Zealand black mice with 1% dietary EGCG for 4 wks reduced high fat diet-induced increases in body weight and body fat mass.7 Analysis of fecal energy content showed that EGCG-treated mice had higher energy levels in the feces than high fat-fed controls indicating that EGCG caused malabsorption of dietary energy intake. The authors also

Fig. 1 Chemical structure of EGCG.

Food Funct., 2011, 2, 111–116 | 111

Downloaded on 09 February 2011 Published on 04 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00155D

reported that EGCG increased the mRNA expression of uncoupling protein (ucp)2 and ucp3 in the liver and skeletal muscle, respectively. These genes are related to fatty acid oxidation and increased expression may explain some of the effects of EGCG on body weight gain. EGCG treatment also down-regulated several genes related to fatty acid synthesis and storage in the liver and white adipose tissue including: stearoyl coA dehydrogenase 1, malic enzyme, and glucokinase. Similar effects on gene expression in adipose tissue were also observed in EGCG-treated, high fat-fed C57bl/6J mice.8 Comparatively little has been reported on the effect of EGCG on the expression of genes related to obesity in skeletal muscle. Treatment of obese beagle dogs with 80 mg kg1, p.o. green tea extract prior to feeding for 12 wks had no significant effect on body weight or body fat mass, but did reduce plasma triglyceride levels and improve insulin sensitivity. Gene expression analysis showed that green tea treatment increased the mRNA expression of peroxisome proliferator-activated receptor (ppar)a and lipoprotein lipase in the muscle. No significant effect on the mRNA levels of the glucose transporter 4 was observed.9 By contrast, Chen et al., found no significant effect of EGCG of green tea on the expression of ppara or ucp3 in the skeletal muscle of high fatfed rats treated for 27 wks.10 The differences between effects observed in the dog and those observed in the rat may be the result of differences in the bioavailability of tea polyphenols in these species.11,12 The absolute oral bioavailability of EGCG in the rat is only 1.6%, whereas in the dog oral bioavailability is much higher. Our previous studies showing that the mouse is more similar to humans than the rat in terms of biotransformation and bioavailability of EGCG.13,14 For this reason and due to the widespread use of mouse models for the study of obesity prevention, we examined the expression of several genes related to lipid oxidation in the skeletal muscle of high fat-fed mice. We compared these changes to observed effects on physiological markers of obesity, type II diabetes and ORLFD. Herein, we report the results of our study.

2.0 Experimental 2.1 Chemicals and diet EGCG (93% pure) was purchased from Taiyo Green Power Company (Jiangsu, China). Diets were prepared by Research Diets, Inc. (New Brunswick, NJ) and the formulations have been previously reported.3 Primers for real-time PCR were synthesized by the Genomics Core Facility at The Pennsylvania State University (University Park, PA). All other chemicals were of the highest grade commercially-available. 2.2 Animals and treatment Male C57BL/6J mice (5 wk old) were purchased from Jackson Laboratories (Bar Harbor, ME) and maintained on 12 h light/ dark with access to food and water ad libitum. Mice were housed in shoebox cages on corn cob bedding. All experiments were approved by the Institutional Animal Care and Use Committee at The Pennsylvania State University (IACUC #28962). After a two wk acclimatization period, mice were divided into 3 treatment groups: low fat (LF, 10% kcal fat, n ¼ 112 | Food Funct., 2011, 2, 111–116

16), high fat (HF, 60% kcal fat, n ¼ 22) and high fat plus 0.32% EGCG (HFE, n ¼ 22). Mice were maintained on experimental diets for 15 wk, and body weight and diet consumption were recorded weekly. Rate of body weight gain was calculated by subtracting initial body weight from final body weight and dividing the difference by 15 weeks. Fecal samples (24 h total cage sample) were collected during weeks 10, 12 and 14 of the study. At the end of the study, mice were fasted for 7 h and blood was taken by cardiac puncture from anesthetized mice. Plasma samples were isolated by centrifugation at 700  g for 15 min and stored at 80  C for later analysis. Livers were harvested, rinsed and weighed. Sections of livers were fixed in 10% formalin. The remaining liver sample was frozen at 80  C for biochemical analysis. Muscle samples were collected from the rear leg, washed with saline, and frozen at 80  C for biochemical analysis.

2.3 Fasting blood glucose, plasma insulin, and insulin resistance Fasting blood glucose measurements were recorded at weeks 0, 4, 8, 10, 12 and 14 for each treatment group using a hand-held Contour glucose monitor (Bayer Healthcare, Tarrytown, NY). Mice were fasted for 7 h after the cage bedding was changed (to prevent copraphagy) and blood was sampled from the tail vein. Fasting plasma insulin was determined at the completion of the experiment using an ELISA for Rat/Mouse Insulin (Millipore, Billerica, MA) according to the manufacturer’s protocol. Insulin resistance was estimated from the final blood glucose and insulin values by the Homeostasis model assessment of insulin resistance (HOMA-IR):15     mmol mU  insulin glucose L L HOMA-IR ¼ 22:5

2.4 Analysis of obesity-related fatty liver disease ORFLD was assessed using both biochemical and histopathological methods. Hepatic triglycerides were determined by homogenizing liver tissue (50–100 mg) in 2 mL isopropanol. The homogenate was centrifuged at 2000  g for 10 min and the supernatant was analyzed with L-Type Triglyceride M kit (Wako Diagnostics, Richmond, VA). Lipid concentrations were normalized to tissue wet weight. Plasma alanine aminotransferase (ALT) levels were determined using a spectrophotometric method (Catachem, Inc., Bridgeport, CT). For histopathological diagnosis, formalin-fixed liver sections were dehydrated and embedded in paraffin blocks. Sections (6 mm) were cut and stained with hematoxylin and eosin. Samples were blinded and read by a board-certified laboratory animal veterinarian with expertise in rodent pathology (MJK). Hepatic lipidosis, vacuolization and focal necrosis were determined as criteria for liver disease. Severity of lipidosis was determined semiquantitatively based on the degree of lipid accumulation and the area of involvement. Lipidosis was scored on a scale of 0 ¼ no significant lesions, 1 ¼ minimal (1–20%), 2 ¼ slight (21–40%), 3 ¼ moderate (41–60%), 4 ¼ marked (61–80%), 5 ¼ severe (81–100%). This journal is ª The Royal Society of Chemistry 2011

Table 1 Primer sequences used for real-time PCR analysis of gene expression in the skeletal muscle of high fat-fed mice Gene

Forward primer

Reverse primer

mcad

GAGCCTGGGAA CTCGGCTTGA TGCAGCAGGG AGCCACTGTC GAGCGGACCA CTCCAGCGTC ATCGGCCTGGC CTTCTAAAC

GCCAAGGCCACC GCAACTTT ATGGGCGGC AGCTTCACTGT TCACCACATC CGTGGGCTGG TCCCCTCCTG CAACTTCTCA

nrf1

Downloaded on 09 February 2011 Published on 04 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00155D

ucp3 ppara

Table 2 Effect of EGCG treatment on biological markers of obesity and Type II in high fat-fed C57BL/6J mice fed a high fat diet.a LF (n ¼ 16) HF (n ¼ 22) HFE (n ¼ 22) Initial Body Weight (g) Final Body Weight (g) Rate of Weight Gain (g/wk) Blood Glucose (mg/dl) Plasma Insulin (ng mL1) HOMA-IR

19.1  0.3a 31.8  0.7a 0.9  0.1a 119.1  5.1a 1.2  0.1a 6.5  0.8a

18.8  0.2a 49.6  0.5b 2.3  0.1b 206.7  6.9b 6.6  0.3b 57.2  3.2b

18.8  0.3a 44.9  1.1c 1.8  0.1c 168.6  6.1c 4.9  0.5c 37.8  4.4c

a Values represent the mean  SEM. Values with different superscripts are statistically significantly different by one-way ANOVA with Tukey’s post-test, P < 0.05. Biomarkers of Type II diabetes were collected in the fasted state.

2.5 Real-time PCR analysis of gene expression Total RNA was isolated from leg muscle samples by using Tri reagent (Sigma) according to the manufacturer’s instruction. Isolated RNA was quantified using the NanoDrop ND-1000 spectrophotometer and cDNA was synthesized using reverse transcriptase. After cDNA synthesis, Real Time PCR was performed by using the SYBR Green PCR Master Mix according to the manufacturer’s protocol and amplified on the ABI Prism 7000 sequence detection system. mRNA levels were normalized to b-actin. Standard curves were made by using serial dilutions from pooled cDNA samples. The sequences for the primers used are listed in Table 1. 2.6 Fecal lipid analysis Fecal samples were combined with deionized water (1 : 2, w : v) and incubated overnight at 4  C. The samples were vortexed and extracted twice with equal volume of methanol:cholorform (2 : 1, v : v). The organic phase was filtered through 0.45 mm PTFE membrane and dried under vacuum. The residue was weighed and normalized to fecal weight. 2.7 Statistical analysis All plots show the mean  standard error of the mean (SEM). One-way ANOVA with Tukey’s post-test was used to compare BW gain, insulin, HOMA-IR, liver triglycerides, ALT, fecal lipids and hepatomegaly. Two-way ANOVA with Bonferroni’s post-test was used for BW and blood glucose over the course of the study. Statistical significance was achieved at p < 0.05. All analyses were performed using GraphPad Prism (San Diego, CA).

3.0 Results and discussion In the present study, we examined the effect of dietary EGCG on markers of obesity, insulin resistance and fat oxidation in high fat-fed mice. The dose of EGCG used in the study (0.32%) corresponds to human consumption of approximately 10 cups of green tea per day (assuming a 200 mL cup and 2 g of green tea leaves) based on allometric scaling.16 Overall, there was no significant difference in the food intake between the treatment groups (data not shown). HF treatment significantly increased final body weight and rate of body weight gain compared to LFfed mice (Table 2). By contrast high fat-fed mice treated with EGCG showed a 21.7% reduction in the rate of body weight gain This journal is ª The Royal Society of Chemistry 2011

and a 9.4% decrease in final body weight (p < 0.05, Table 1). Interestingly, there was no significant effect of EGCG on the weight of retroperitoneal and epididymal fat pads (data not shown). These effects on final body weight and body weight gain are similar to previously reported results, although not as dramatic in magnitude.3 The reasons for the differences are unclear, but it may be due to the relatively large standard deviation observed in experiments with this model. Neither the intestinal nor subcutaneous fat depots were examined, so it is possible that the observed changes in body weight correlate with changes in those fat depots. High fat diet significantly increased fasting blood glucose values at week 4 and continued for the rest of the treatment (Table 2, p < 0.05). HF mice had a 42.4% increase in final fasting blood glucose compared to LF mice. EGCG treatment blunted the high fat diet-mediated hyperglycemia. At the end of the experiment, the fasting blood glucose of HFE mice was 18.5% lower than HF mice. Treatment with EGCG also significantly decreased fasting plasma insulin (25.3% decrease) compared to HF (Table 2). To estimate insulin resistance, HOMA-IR was calculated with final fasting insulin and blood glucose values. HF mice had an 88.6% increase in insulin resistance compared to LF fed mice. This increase in insulin resistance was blunted in HFE mice (33.9% decrease compared to HF mice) (Table 2, p < 0.05). ORFLD was assessed both biochemically and histopathologically (Fig. 2). Plasma ALT values were measured to assess liver damage. Average plasma ALT levels in LF and HF mice were 3.3 and 100.1 U/L, respectively (Fig. 2A). Plasma ALT levels were decreased by 50% in HFE compared to HF control mice. In HF mice, liver weight was increased by 26.1% compared to LF mice (Fig. 2B). EGCG treatment blunted the effects of the high fat diet and the mean liver weight of the EGCG treated mice was 22% less than the high fat-fed mice. Liver triglycerides were reduced by 27% in HFE compared to HF (Fig. 2C). Histopathological analysis confirmed the biochemical diagnosis of ORFLD (Fig. 2D). The HF mice had severe centrilobular hepatic lipidosis with focal necrosis. HFE mice had visibly less fat accumulation and smaller areas of involvement. Semi-quantitative analysis of hepatic lipidosis showed a reduction in severity score from 4.8  0.1 to 3.5  0.5 in HFE mice (p < 0.05). These changes in biochemical and histological parameters of obesity, diabetes and ORFLD are similar to those previously reported in the high fat diet-fed mouse model (reviewed in ref. 2). Food Funct., 2011, 2, 111–116 | 113

Downloaded on 09 February 2011 Published on 04 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00155D

Fig. 2 Effect of EGCG on ORFLD in high fat-fed C57bl/6J mice. EGCG supplementation reduced plasma ALT (A), hepatomegaly (B), and liver triglycerides (C) after 15 wk treatment compared to HF control mice. Bars represent the mean of n ¼ 16–22. Error bars represent the SEM. Different superscripted letters indicate statistically significant differences by one-way ANOVA with Tukey’s post-test. Histopathological analysis (D) showed that EGCG treatment reduced the severity and area of hepatic lipidosis. Photo micrographs of representative liver samples are shown at 100 magnification.

Although previous studies have examined the role of EGCGmediated gene expression changes in the liver and adipose tissue in the prevention of obesity, the skeletal muscle had largely been ignored. Green tea consumption has been shown in both humans and animal models to increase energy expenditure and decrease respiratory quotient.7,17,18 In the present study, we assessed the impact of EGCG treatment on the expression in the skeletal muscle of several genes related to fat oxidation. We found that, compared to high fat-fed controls, EGCG-treated mice had higher expression of mcad (1.4-fold increase), nrf1 (1.5-fold increase), ucp3 (1.9-fold increase) and ppara (1.9-fold increase) (Fig. 3). These four genes are all related to fatty acid oxidation or mitochondrial gene expression. Mutations in ucp3 have been associated with decreased fat oxidation and increased risk of morbid obesity and diabetes.19 Heilbronn et al. have also shown that expression of ucp3 and nrf1 are decreased in the skeletal muscle of overweight and obese insulin-resistant individuals.20 Deficiency in mcad is a serious genetic metabolic disorder that prevents utilization of fatty acids. Based on the key biological function that these genes play in the metabolism of fatty acids, it seems clear that enhanced expression might be an effective means of increasing fat oxidation and ameliorating the effects of a high fat-diet. The present results suggest that EGCG enhances basal metabolism and increases lipid oxidation. Such gene changes may help explain the effect of EGCG on body weight gain in high fat-fed mice. Similar results were for the effect the expression of ppara in the skeletal muscle of green tea extract-supplemented obese Beagle dogs.9 The authors do not report whether the green tea used in the study contained caffeine, which represents a potential confounder. By contrast, 114 | Food Funct., 2011, 2, 111–116

Fig. 3 Effect of EGCG on the expression of genes related to lipid oxidation in the skeletal muscle of high fat-fed C57bl/6J mice. EGCG treatment enhanced the mRNA expression of mcad, nrf1, ppara, and ucp3 in the skeletal muscle compared to HF control mice. Values represent the mean  SEM (n ¼ 22). ** indicates statistical difference (p < 0.01) from HF group by Student’s T-test.

This journal is ª The Royal Society of Chemistry 2011

Downloaded on 09 February 2011 Published on 04 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00155D

a previous study in rats found no effect of EGCG on the expression of ucp3 or ppara.10 To our knowledge, the present data is the first report of pure EGCG enhancing the expression of genes related to fatty oxidation in the skeletal muscle. The underlying mechanisms for these changes in gene expression are unclear, but may be related to direct stimulation or indirect effects that modulate energy homeostasis. For example, EGCG has been reported to potently inhibit catecholO-methyltransferase activity, and may therefore enhance sympathetic nervous system output.21,22 Increased sympathetic signaling results in increased adenosine monophosphate-activated protein (AMP) kinase signaling and enhanced fatty acid oxidation in the mitochondria.23 EGCG and green tea have been shown in other models to stimulate activity of AMPK, but the underlying mechanisms have not been reported.24 AMPK activation has been shown to increase expression of mcad via increased PPARa.25 It is possible that EGCG works via this mechanism in the present study, but additional work is needed to test this hypothesis. Alternatively, the observed changes in gene expression may be a compensatory response to changes in dietary nutrient absorption. Starvation state decreases adipogenesis and increases b-oxidation.26 Although treatment with EGCG clearly does not induce starvation in the present study, it does modulate lipid absorption as discussed below, which may in turn increase b-oxidation. Again, such a hypothesis needs to be tested in the present system. Previous studies have shown that long-term treatment with EGCG can increase fecal excretion of lipids. We determined fecal lipid content gravimetrically and found an average fecal lipid concentration of 8.6 and 10.8 mg g1 in HF and HFE, respectively. The average fecal lipid content significantly increased by 20.4% with EGCG treatment compared to HF control group (p < 0.05). This shows that in addition to the gene changes reported above, EGCG treatment affects lipid absorption. Overall the changes observed in body weight gain and markers of hyperglycemia by EGCG-treatment are likely a combination of modulation of energy absorption and fat oxidation. In summary, in the present study we demonstrate for the first time that EGCG-mediated changes in body weight gain and markers of Type II diabetes in high fat-fed mice are associated with increased expression of fatty acid oxidation-related genes in the skeletal muscle. These changes may explain the effect of green tea on respiratory quotient and energy expenditure observed in human subjects. Further studies are needed to assess the relative impact on body weight of EGCG-mediated changes in gene expression versus EGCG-mediated changes in nutrient absorption in human subjects.

4.0 Conclusions Here we observed that the green tea polyphenol, EGCG, increases the skeletal muscle expression of several genes related to fatty acid oxidation in the high fat-fed C57bl/6J mouse model. This increased expression, in conjunction with the ability of EGCG to reduce dietary fat absorption from the intestine, may underlie the observed modulation of body weight gain, severity of hyperglycemia/hyperinsulinemia, and ORFLD in this model. This journal is ª The Royal Society of Chemistry 2011

Abbreviations ALT EGCG HF HFE HOMA-IR LF mcad nrf1 ORFLD ppara ucp

alanine aminotransferase ()-epigallocatechin-3-gallate high fat diet high fat diet supplemented with 0.32% EGCG homeostasis model assessment of insulin resistance low fat diet medium chain acyl coA dehydrogenase nuclear respiratory factor 1 obesity-related fatty liver disease peroxisome proliferator-activated receptor a uncoupling protein

5.0 Acknowledgements This work was supported by NIH grant AT004678 (to JDL).

6.0 References 1 D. A. Balentine, S. A. Wiseman and L. C. Bouwens, The chemistry of tea flavonoids, Crit. Rev. Food Sci. Nutr., 1997, 37, 693–704. 2 K. A. Grove and J. D. Lambert, Laboratory, epidemiological, and human intervention studies show that tea (Camellia sinensis) may be useful in the prevention of obesity, J. Nutr., 2010, 140, 446–453. 3 M. Bose, J. D. Lambert, J. Ju, K. R. Reuhl, S. A. Shapses and C. S. Yang, The major green tea polyphenol, ()-epigallocatechin3-gallate, inhibits obesity, metabolic syndrome, and fatty liver disease in high-fat-fed mice, J Nutr, 2008, 138, 1677–1683. 4 R. B. Birari and K. K. Bhutani, Pancreatic lipase inhibitors from natural sources: unexplored potential, Drug Discov Today, 2007, 12, 879–889. 5 I. Ikeda, K. Tsuda, Y. Suzuki, M. Kobayashi, T. Unno, H. Tomoyori, H. Goto, Y. Kawata, K. Imaizumi, A. Nozawa and T. Kakuda, Tea catechins with a galloyl moiety suppress postprandial hypertriacylglycerolemia by delaying lymphatic transport of dietary fat in rats, J Nutr, 2005, 135, 155–159. 6 M. Nakai, Y. Fukui, S. Asami, Y. Toyoda-Ono, T. Iwashita, H. Shibata, T. Mitsunaga, F. Hashimoto and Y. Kiso, Inhibitory effects of oolong tea polyphenols on pancreatic lipase in vitro, J. Agric. Food Chem., 2005, 53, 4593–4598. 7 S. Klaus, S. Pultz, C. Thone-Reineke and S. Wolfram, Epigallocatechin gallate attenuates diet-induced obesity in mice by decreasing energy absorption and increasing fat oxidation, International Journal of Obesity, 2005, 29, 615–623. 8 S. Wolfram, D. Raederstorff, Y. Wang, S. R. Teixeira, V. Elste and P. Weber, TEAVIGO (epigallocatechin gallate) supplementation prevents obesity in rodents by reducing adipose tissue mass, Ann. Nutr. Metab., 2005, 49, 54–63. 9 S. Serisier, V. Leray, W. Poudroux, T. Magot, K. Ouguerram and P. Nguyen, Effects of green tea on insulin sensitivity, lipid profile and expression of PPARalpha and PPARgamma and their target genes in obese dogs, Br. J. Nutr., 2008, 99, 1208–1216. 10 N. Chen, R. Bezzina, E. Hinch, P. A. Lewandowski, D. CameronSmith, M. L. Mathai, M. Jois, A. J. Sinclair, D. P. Begg, J. D. Wark, H. S. Weisinger and R. S. Weisinger, Green tea, black tea, and epigallocatechin modify body composition, improve glucose tolerance, and differentially alter metabolic gene expression in rats fed a high-fat diet, Nutr. Res., 2009, 29, 784–793. 11 L. Chen, M. J. Lee, H. Li and C. S. Yang, Absorption, distribution, elimination of tea polyphenols in rats, Drug Metab Dispos, 1997, 25, 1045–1050. 12 I. M. Kapetanovic, J. A. Crowell, R. Krishnaraj, A. Zakharov, M. Lindeblad and A. Lyubimov, Exposure and toxicity of green tea polyphenols in fasted and non-fasted dogs, Toxicology, 2009, 260, 28–36.

Food Funct., 2011, 2, 111–116 | 115

Downloaded on 09 February 2011 Published on 04 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00155D

13 H. Lu, X. Meng, C. Li, S. Sang, C. Patten, S. Sheng, J. Hong, N. Bai, B. Winnik, C. T. Ho and C. S. Yang, Glucuronides of tea catechins: enzymology of biosynthesis and biological activities, Drug Metab. Dispos., 2003, 31, 452–461. 14 J. D. Lambert, M. J. Lee, H. Lu, X. Meng, J. J. Hong, D. N. Seril, M. G. Sturgill and C. S. Yang, Epigallocatechin-3-gallate is absorbed but extensively glucuronidated following oral administration to mice, J Nutr, 2003, 133, 4172–4177. 15 B. Mlinar, J. Marc, A. Janez and M. Pfeifer, Molecular mechanisms of insulin resistance and associated diseases, Clin. Chim. Acta, 2007, 375, 20–35. 16 K. Schneider, J. Oltmanns and M. Hassauer, Allometric principles for interspecies extrapolation in toxicological risk assessment–empirical investigations, Regul. Toxicol. Pharmacol., 2004, 39, 334–347. 17 A. G. Dulloo, C. Duret, D. Rohrer, L. Girardier, N. Mensi, M. Fathi, P. Chantre and J. Vandermander, Efficacy of a green tea extract rich in catechin polyphenols and caffeine in increasing 24-h energy expenditure and fat oxidation in humans, Am J Clin Nutr, 1999, 70, 1040–1045. 18 M. Boschmann and F. Thielecke, The effects of epigallocatechin-3gallate on thermogenesis and fat oxidation in obese men: a pilot study, J Am Coll Nutr, 2007, 26, 389S–395S. 19 G. Argyropoulos, A. M. Brown, S. M. Willi, J. Zhu, Y. He, M. Reitman, S. M. Gevao, I. Spruill and W. T. Garvey, Effects of mutations in the human uncoupling protein 3 gene on the respiratory quotient and fat oxidation in severe obesity and type 2 diabetes, J. Clin. Invest., 1998, 102, 1345–1351.

116 | Food Funct., 2011, 2, 111–116

20 L. K. Heilbronn, S. K. Gan, N. Turner, L. V. Campbell and D. J. Chisholm, Markers of mitochondrial biogenesis and metabolism are lower in overweight and obese insulin-resistant subjects, J. Clin. Endocrinol. Metab., 2007, 92, 1467–1473. 21 H. Lu, X. Meng and C. S. Yang, Enzymology of methylation of tea catechins and inhibition of catechol-O-methyltransferase by ()-epigallocatechin gallate, Drug Metab. Dispos., 2003, 31, 572–579. 22 A. G. Dulloo, J. Seydoux, L. Girardier, P. Chantre and J. Vandermander, Green tea and thermogenesis: interactions between catechin-polyphenols, caffeine and sympathetic activity, International Journal of Obesity, 2000, 24, 252–258. 23 D. Carling, M. J. Sanders and A. Woods, The regulation of AMPactivated protein kinase by upstream kinases, International Journal of Obesity, 2008, 32(Suppl. 4), S55–59. 24 D. K. Singh, S. Banerjee and T. D. Porter, Green and black tea extracts inhibit HMG-CoA reductase and activate AMP kinase to decrease cholesterol synthesis in hepatoma cells, J. Nutr. Biochem., 2009, 20, 816–822. 25 R. S. Meng, Z. H. Pei, R. Yin, C. X. Zhang, B. L. Chen, Y. Zhang, D. Liu, A. L. Xu and Y. G. Dong, Adenosine monophosphateactivated protein kinase inhibits cardiac hypertrophy through reactivating peroxisome proliferator-activated receptor-alpha signaling pathway, Eur. J. Pharmacol., 2009, 620, 63–70. 26 J. Kerner, W. K. Parland, P. E. Minkler and C. L. Hoppel, Rat liver mitochondrial carnitine palmitoyltransferase-I, hepatic carnitine, and malonyl-CoA: effect of starvation, Arch. Physiol. Biochem., 2008, 114, 161–170.

This journal is ª The Royal Society of Chemistry 2011

Food & Function

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 117

PAPER

www.rsc.org/foodfunction

Estimation of dietary intake of melanoidins from coffee and bread Downloaded on 09 February 2011 Published on 14 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00156B

Vincenzo Foglianoa and Francisco J. Morales*b Received 18th October 2010, Accepted 10th December 2010 DOI: 10.1039/c0fo00156b Melanoidins are defined as polymeric high molecular weight, brown-coloured Maillard reaction end-products, containing nitrogen. They escape digestion and pass through the upper gastrointestinal tract and can interact with the different microbial species present in the colon. Major dietary sources of melanoidins are coffee and bread crust. Both coffee and bread crust melanoidins can be fermented by the human hindgut microflora thus sharing some of the properties attributed to dietary fibre. Despite the emerging positive physiological properties of such dietary constituents their intake has not been estimated yet. To this aim melanoidin content in different type of coffee brews, bread and dry biscuits was determined by sequential ultrafiltration and enzymatic digestion. Despite some drawbacks and limiting steps in the calculation, such as the lack of a reference material, an educated guess on the dietary intake of melanoidins has been put forward. Data indicated that the intake of coffee melanoidins ranged between 0.5 to 2.0 g per day for moderate and heavy consumers, respectively. For bread and dry biscuits an intake in the ranges of 1.8–15.0 and 3.2–8.5 g per day has been calculated. These figures suggest that a realistic estimation of melanoidins dietary intake for general population would be close to 10 g per day considering all the possible alimentary sources.

Introduction Melanoidins are widely distributed in thermally processed food and they are defined as polymeric high molecular weight, browncoloured Maillard reaction (MR) end-products, containing nitrogen.1,2 Their chemical structure is complex and still remains largely unknown.3–6 However, four main proposals of the structure have been put forward: (i) low-molecular weight coloured substances crosslinked to free amino groups of lysine or arginine in proteins,7 (ii) units of furan and/or pyrroles that, through polycondensation reactions, form melanoidin repeating units,8 (iii) skeleton mainly built up from sugar degradation products formed in the early stages of the MR, polymerized and linked by amino compounds,5 (iv) skeleton mainly built up form proteins crosslinked by MR products (i.e. the melanoproteins).9 The absence of a known molecular structure and the strict dependence of its concentration on processing conditions in the final products have hampered an estimation of the dietary intake of melanoidins thus far. However, mounting evidence suggests that melanoidins are not an inert material and they can exert some physiological action. The main sources of dietary melanoidins are definitely coffee and bakery products; however other processed foods such as a Dipartimento di Scienza degli Alimenti University of Napoli ‘‘Federico II’’, via Universit a 100, 80055 Portici, Italy b Instituto de Ciencia y Tecnologıa de Alimentos y Nutrici on-ICTAN, Consejo Superior de Investigaciones Cientıficas (CSIC), Jos e Antonio Novais 10, 28040 Madrid, Spain. E-mail: [email protected]; Fax: +34 91 549 3627; Tel: +34 91 549 2300

This journal is ª The Royal Society of Chemistry 2011

cocoa,9 malt,10 roasted barley,11 black beer,12 roasted potatoes,13 roasted pulses and seeds,14 meat15 soy sauces,16 balsamic vinegar,17 sweet wine,18 processed tomatoes,19 also contain melanoidins. Besides being the main dietary source, coffee and bread melanoidins are also representative of the two main typologies of melanoidins. The principal constituent of coffee melanoidins is polysaccharides. However, in bread the main structure is a proteinaceous material and these melanoidins are referred to as melanoproteins as well.9,20 During the roasting of coffee green beans chemical and structural changes taken place where polysaccharides, galactomannan-like and arabinogalactan-like carbohydrates,6,21,22 proteins,23,24 and phenolic compounds, mainly hydroxycinnamates,2,25–29 contribute to the formation of coffee melanoidins.30 Recently, it was also demonstrated that phenolic compounds can also be non-covalently linked to coffee melanoidins and melanoidins could acts as carriers of low molecular weight substances.31 In bakery products melanoidins are formed by gluten proteins cross-linked by coloured Maillard Reaction Products (MRPs),32 while other small molecular weight coloured MR products are entrapped in the gluten network.20 Melanoidins are present only in the crusts and can be considerably enhanced by the use of a browning agent that can be added on the surface of the dough. Bread melanoidins concentration depends on the intensity of the thermal input: the higher the treatment the higher the concentration. Bread melanoidins are mainly water insoluble therefore they can be efficiently extracted only after extensive enzymatic digestion.33 Food Funct., 2011, 2, 117–123 | 117

Downloaded on 09 February 2011 Published on 14 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00156B

Melanoidins, and coffee melanoidins in particular, have different functional properties apart from their contribution to colour and technological properties, being able to bind flavours,34 exerting antioxidant capacity to foods31 and suppressing oxidative stress in cells,35 metal-chelating properties,36 antimicrobial activity,37 suppressing Helicobacter pylori adhesion,38 modulating chemopreventive enzymes,39 among others. In the last ten years many studies suggested that they can have a relevant role in the gastrointestinal tract since melanoidins are fermented in the colon, and act as dietary fibre, modulating their bacterial population.33,40–42 Recently, Alexander43 in the base on previous knowledge stated that melanoidins should be considered as antioxidant dietary fibre44,45 which play a role in the prevention of cardiovascular disease and control of colorectal cancer.46 This statement is strengthened by the observation that a coffee melanoidin–rich ingredient, the coffee silverskin, is able to promote Bifidobacteria growth,47 and by the fact that the degradability of the carbohydrate part of the coffee brew melanoidins by human faecal microbiota was demonstrated.48 On the other hand it should be considered that most of the melanoidins are recovered in the faeces39 and that faecal antioxidant activity showed a direct correlation with coffee intake.49 Despite the emerging physiological role highlighted for food melanoidins, their dietary intake has never been calculated. This consideration prompted us to provide an educated guess on the dietary intake of melanoidins from two major sources, coffee and bakery products. Data on the amount of melanoidins in processed foods represent an essential pre-requisite to put in the appropriate context their possible role as dietary fibre. The estimation of melanoidin dietary intake will be of interest to assess the relationship between consumption patterns and epidemiological studies due to the relevance of melanoidins for gastrointestinal health.

Isolation of biscuits melanoidins by sequential ultrafiltration Biscuit melanoidins were prepared in a similar way than coffee ones, although a sample solubilization was carried out as described by Borrelli and Fogliano33 with some modifications as described by Martın et al.51 Briefly, homogenized biscuit samples (500 mg) were diluted in 25 mL of a Pronase E solution containing 0.375 mg of Pronase E (7.5 units mg1, SigmaAldrich) in 0.1 M sodium-borate at pH 8.2 buffer, vigorously stirred, and incubated at 37  C for 40 h under shaking. The reaction was stopped by cooling in an ice-water bath followed by addition of 100 mL of trichloroacetic acid solution (40%, w/v) and centrifugation at 4500 g for 10 min at 4  C. At the end of each enzymatic digestion, samples were dialysed using a membrane with a nominal molecular weight ‘‘cut-off’’ of 3000 Da. The melanoidins content (g per 100 g biscuit) was determined by the weight of the freeze-dried product after ultrafiltration. Isolation of melanoidins from bread crust Bread crust was obtained from commercial sliced bread and baguettes. Sourdough loaves were pieces of 1 kg obtained by sour dough fermentation and cooked at 220  C for 90 min. The bread crust was separated from the crumb with a kitchen knife than it was freeze-dried and ground in a mill. Samples were enzymatically digested by adding 3 ml of 20 mM Tris-HCl buffer (pH ¼ 8), containing 0.1 mg mL1 of Pronase E (7.5 U mg1, SigmaAldrich), to 250 mg of the samples, and after a vigorous mixing the samples were incubated at 37  C for different periods (up to 7 days). The reaction was stopped by cooling in an ice-water bath followed by addition on 100 mL of trichloroacetic acid solution (40%, w/v) and centrifugation at 4500 g for 10 min at 4  C. At the end of each enzymatic digestion, samples were dialysed using a membrane with a nominal molecular weight ‘‘cut-off’’ of 3000 Da. The melanoidins content (g/100 g bread) was determined by the weight of the freeze-dried product after ultrafiltration.

Methods Isolation of coffee melanoidins Roasted coffee beans (Coffea arabica) samples were obtained from local stores. Roasted coffee beans were ground on a 0.43 mm mesh. Italian (moka coffee pot), filter (drop electric coffeemaker) and espresso (food service industry coffee maker) procedures were applied for coffee brew preparation as described by Sanchez-Gonzalez et al.50 Isolation of coffee melanoidins was as described by Borrelli et al.28 and DelgadoAndrade and Morales.31 Briefly, the coffee brew (7 g coffee per 100 mL water) was filtered (Whatman Filter Paper number 40, ashless, Whatman, U.K.) and defatted with dichloromethane (2  200 mL). The coffee brew was then subjected to ultrafiltration using an Amicon ultrafiltration cell model 8400 (Amicon, Beverly, MA), equipped with a 10 kDa nominal molecular mass cut-off membrane. The retentate was filled up to 200 mL with water and washed again. This washing procedure was repeated at least 3 times. The high-molecular-weight (HMW) fraction was freeze-dried and stored in a desiccator at 4  C until analysis. The melanoidins content (g per 100 g coffee) was determined by the weight of the freeze-dried product after ultrafiltration. 118 | Food Funct., 2011, 2, 117–123

Consumption databases Dietary intake of melanoidins from coffee and bread were taken from different food consumption databases. Data from coffee consumption were taken from an exposure study carried out from the latest worldwide coffee consumption in 2007 as provided by the Spanish Federation of Coffee;52 those for bread and dry biscuits were taken from the database of Italian consumption (INRAN). An average body weight (bw) of 70 kg was used to estimate the total daily intake of melanoidins to total population and expressed as mg kg(bw)1 day1.

Results and discussion Estimation of dietary intake of coffee melanoidins Coffee is one of the most popular beverages around the world as about 400 000 million cups of coffee are consumed every year. The amount of melanoidin in the cup varies with the coffee roasting and coffee brew preparation. To date, there is no evidence about the contribution of the coffee variety (arabica or robusta) on the occurrence of melanoidin regardless the roasting process applied. It is known that the darker the roasting degree, This journal is ª The Royal Society of Chemistry 2011

Downloaded on 09 February 2011 Published on 14 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00156B

the higher the amount of melanoidins and their complexity will vary with the degree of roast.28 Type of extraction, strength of the brew (the higher the ratio powder/water the higher the melanoidins amount), pressure and serving size (extracting the same amount of powder with more water increases the amount of melanoidins) influence the final melanoidin intake from a cup of coffee. To ascertain the effect of the extraction type, the overall extraction yield achievable with four coffee brew preparations is listed in Table 1. These values have been obtained using always the same amount of coffee powder, while in the daily consumption an important role is played by the powder/water ratio used for the extraction. Obviously, for soluble coffee the yield is near the 100% and in this case the only variable to take into consideration is the amount of coffee powder per serving. The bottleneck of melanoidins quantitation is the lack of a validated and well-established procedure to calculate its content. In addition, a standard reference material for such a purpose or even common procedures for isolation of melanoidins are not available which make the goal very challenging. In this respect, a step forward was done by COST Action 91953 that proposed a reference melanoidin derived from a glucoseglycine model system to unify further investigation on the structural and functional characteristics of food melanoidins. Unfortunately, the composition of coffee beans is far more complex than a single model system of sugar and amino acid, so only references specifically dealing with the isolation of coffee melanoidins have been used in this estimation. Three main approaches for isolation of coffee melanoidins from the coffee brew are described in the literature. The most extended one is based in the high molecular weight of these polymeric structures by applying dialysis tubing, ultrafiltration with 10 kDa cut-off membranes (tangential flow, static-cells, centrifugation devices), and column gel-permeation for molecular exclusion separation of melanoidins and subsequent gravimetric estimation.2 Two more rapid procedures based on the colour potency of MRPs,7 or by measuring the absorption at wavelengths or extinctions coefficients higher than 400 nm54 have been also proposed. There are some discrepancies among authors on the yield reached for each isolation procedure since, as suggested by Hofmann,55 low molecular coffee compounds might react during dialysis yielding higher molecular weight structures and increasing the final melanoidin content. This fact has recently been demonstrated by Bekedam et al.2 On the other hand, the application of gel permeation chromatography (e.g. Shephadex G-25) could underestimate the levels of melanoidin due to dead volume and the low amount of sample analysed which it is inherent to the technique. Table 2 summarized the information of coffee melanoidins published thus far. When available, only values from medium

Table 1 Extraction yield (w/w) of roasted coffee as function of the procedure to prepare the coffee brew

Espresso Filter Italian Soluble

Table 2 Literature survey reporting the amount of melanoidins calculated for filter coffee brew preparations Procedurea

Coffee : water ratio

Melanoidinsb g kg1

Melanoidinsc g per 100 mL

Reference

GF GF Dialysis UF-T Dialysis UF–C UF–C UF-T

0.070 0.050 0.070 0.070 0.050 0.070 0.070 0.050

70 53 51 36 76 81 115 90

0.49 0.25 0.39 0.25 0.38 0.57 0.81 0.45

28 34 36 2 6 37 31 42

a Procedure for melanoidin isolation. b Melanoidin content per kg of roasted coffee powder. c Melanoidin content per 100 mL of coffee brew.Gel-filtration (GF), ultrafiltration-tangential (UF-T), ultrafiltration-centrifugation (UF–C).

roasted coffee beans were used to avoid the dependence of melanoidins levels with the degree of roasting. Since filtered coffee has been the major source for the preparation of coffee melanoidins in scientific literature, further calculations will be related to this coffee brew preparation. All in all, a mean melanoidins content of 7.2 g per 100 g of roasted coffee was obtained with a standard deviation of 2.97 g per 100 g (min ¼ 36, max ¼ 115). Combining these data with those of Table 1, determined that the amount of melanoidins in the brew is much higher in espresso coffee as it is more concentrated. As far as the soluble coffee is concerned, the higher amount of melanoidins depends on the peculiar process which is able to solubilise polysaccharides which usually remained unsolubilised. Melanoidins content per serving cup of coffee is summarised in Table 3. The data take into account the average melanoidin content in medium roasted coffee (7.2 g per 100g), the usual serving size for each coffee preparation and the proportion of coffee : water used for the extraction. These data are further used to calculate the dietary intake of melanoidins taking into account the data of consumption for different countries. These data are not always available, clear and in some cases they are simply based on the data of roasted coffee sold in the country, but are useful as an approximation. In addition, the variability among coffee drinkers should be considered as well and will be another source of variation. Low, moderate and heavy coffee drinkers were classified as the consumers of 2, 4, and 6 coffee cups per day, respectively.56 From this data it can be derived that the intake of coffee melanoidins is in the order of magnitude of 1 g of coffee melanoidins per day reaching a peak of 2 g per day for the heavy drinkers. Obviously, dietary intake of coffee melanoidins is related to the habit of consumption both modality of brew preparation and the number of cups per day. Fig. 1 depicted the estimated dietary Table 3 Estimated melanoidins content per serving size for different preparations of coffee brew

Coffee/water ratio

Soluble Fraction (%)

Coffee Brew Melanoidins Serving Coffee : water Amount preparation g per 100 g coffee size mL ratio serving mg

0.171 0.081 0.080 0.020

31.7 30.9 28.8 95.0

Espresso Filter Italian Soluble

This journal is ª The Royal Society of Chemistry 2011

7.2 7.2 7.2 22.8

50 130 60 100

0.031 0.025 0.023 0.019

111.6 233.9 99.3 433.2

Food Funct., 2011, 2, 117–123 | 119

Downloaded on 09 February 2011 Published on 14 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00156B

Fig. 1 Estimation of the dietary intake of coffee melanoidins as distributed by countries. Black bars represent average values for European Union, United Estates of America and Japan for reference.

intake of melanoidins in basis of the 2007 worldwide databases of coffee consumption. Estimation of coffee melanoidins intake was calculated by combining the mean level of consumption in each country with a weighed estimation of coffee melanoidins content in filtered coffee. Data of melanoidins were extrapolated to a coffee brew preparation by filtering since it is not possible to ascertain the type of coffee brew preparation chosen by citizens in any database. Results showed a range of melanoidin intake between 200 mg to 2600 mg per capita per day which is in good agreement with the values calculated taking into account the daily cup consumption. It is worth noting that Scandinavian countries reached levels higher than 2 grams of coffee melanoidins per capita per day, although the higher intake was estimated for Luxemburg. Taking into consideration the population, values estimated for the European Union (984 mg coffee melanoidins per capita per day, 14.1 mg coffee melanoidins per kg(bw) per day) and United States of America (807 mg coffee melanoidins per capita per day, 11.5 mg coffee melanoidins per kg(bw) per day), it can be concluded that the estimated worldwide intake of coffee melanoidins is about 900 mg per capita per day. But those levels could be much higher for heavy coffee drinkers and for soluble coffee drinkers. Heavy coffee drinkers can easily reach more than 5 g per day of coffee melanoidins intake. In summary, data from the worldwide coffee consumption57 are depicted in Table 4. Interestingly, similar results can be obtained considering the data of green coffee consumption in each country. For the higher coffee consumption an intake of about 2.0 g per day can be calculated considering 80% of consumers among adults and calculating a 17% water loss during roasting and an average presence of 7.2 mg of melanoidins per 100 g of coffee. Estimation of dietary intake of bread crust melanoidins All bakery products contain a relevant part of melanoidins as can be appreciated by simply considering the amount of brown material present on the surface. In this paper bread and biscuits, representing a significant fraction of the intake of all bakery 120 | Food Funct., 2011, 2, 117–123

Table 4 Estimation of the dietary intake of coffee melanoidins (CM) in different world regions for different scenarios

World region Europe North America Central America South America Asia Middle-East/North Africa Sub-Sahara Africa Oceania a

mg CM per day per capitaa

mg CM per day per capitab

mg CM per day per capitac

596.3 695.7 231.9 513.5 49.7 115.9

1192.6 1391.4 463.8 1027.1 99.4 231.9

2683.4 3130.6 1043.5 2310.7 223.6 521.8

49.7 381.0

99.4 762.0

223.6 1714.4

All population is considered as coffee drinkers. coffee drinkers. c At 95th percentile.

b

Half population as

products, have been considered to perform an estimation of melanoidins intake. In bread, melanoidins are mostly present in the crust; while in dry biscuits they are homogeneously distributed in the products. In comparison with coffee, the calculation of dietary melanoidins in bread is complicated by the poor water extractability of bread and biscuit melanoidins. In this work, it was decided to consider the soluble high molecular weight fraction remaining after in vitro starch and protein hydrolysis by a cocktail of enzymes resembling those acting in the human gastro intestinal tract. Different approaches have been proposed in the literature based on the use of various proteases and digestion protocols.58 Enzymatic digestion of the bread crust allows about 50% of the crust to solubilise and a significant part of this material is constituted by high molecular weight material (i.e. retained in a dialysis tube, not passing through membranes at different cut-offs by centrifugation or eluted in the first peak using gel filtration columns). In Table 5 the amount of melanoidins recovered in different kinds of bread and biscuits using the enzymatic digestion protocol followed by the dialysis procedure as described in the method session are reported. In this work only common wheat, This journal is ª The Royal Society of Chemistry 2011

Downloaded on 09 February 2011 Published on 14 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00156B

Table 5 Percentage of the crust on the total weight and amount of melanoidins measured in different type of bread and in dry biscuits

Product type

Percentage of crusta

Amount of melanoidinsa (g per 100g of crust)

Sourdough loaves Sliced bread Baguette Dry biscuits

20  1 91 35  2 100

30  18  14  12 

2 1 2 1

a Standard deviation refers to 3 measures performed on the same bread type.

which is the most common grain used for the manufacture of bread was considered, no data are available about the role of type of cereal flour (wheat, rye, oat, barley, rice) to the formation of the crust or even of the melanoidins content. The percentage weight of the crust in the considered bread samples ranged from 35% for a baguette to 8% for the sliced bread. This interval can be representative of most of the commercial bread typologies present in the Western markets. Data reported in Table 5 showed that the amount of melanoidins in the bread crusts ranges between 30 to 14 g per 100 g of crust for sourdough loaves and baguette bread, respectively. These data are in agreement with previous observation on bread33,58 and in line with values reported for other similar bakery products.51,59 The amount of melanoidins found in dry biscuits was 12 g per 100 g of whole product and this is also in agreement with the previous observation from Martin et al.51 An amount of about 4.5 g can be obtained summing the fractions at high molecular weight obtained by gel filtration by these authors; this value is lower than the 12 g found in this work, however it is expected that dialysis provide a higher amount of melanoidins than gel filtration. Concentration of melanoidins in the same order of magnitude was also found in different bakery products, such as Spanish muffins59 where about 14 g of melanoidins per 100 g of whole product was reported. To provide the estimation of melanoidin dietary intake, data for bread and biscuit consumption should be taken into account and they are also very heterogeneous among countries. Considering the data calculated on the basis of the wheat flour market, the consumption of bread in Western countries is in the range of 41–303 kg per year per capita,60 that means 112– 830 g day per capita. However, starting from the flour market is not a reliable approach as it can be used for many purposes and the waste of bread (manufactured but not consumed) is very high; on the other hand a precise estimation can be obtained by a food consumption survey using individual questionnaires about dietary habits. A very recent one was published by the National Institute of Nutrition – INRAN61 and it reported that the average bread consumption among Italian bread consumers is 112 g per day while the 95th percentile has a daily intake of 250 g. The same survey found for biscuits an average intake of 27 g and 71 g for 95th percentile. This data are in agreement with those reported in Spain.62 Average bread intake was of 112 g per day while sweet cookie consumption was 21.2 g per day. Similar data also come from the Swiss Federal Office for Agriculture showed in the years 1998 to 2007 a constant intake of 130 g of bread and 18 g of biscuits per day (www.blw.admin.ch/index.html?lang¼en). This journal is ª The Royal Society of Chemistry 2011

Therefore for further calculation these data were used as it can be considered representative of general consumption at least in Western countries. Combining the consumption data with the content of melanoidins in bread and biscuits reported in Table 5 the dietary intake of melanoidins from bread and biscuits have been calculated and the results are shown in Table 6. The calculation was made with the approximation that consumers always eat the same type of bread. So a subject consuming an average amount of sliced bread (i.e. 112 g per day) will have an intake of 1.6 g of melanoidins, while a subjects consuming 250 g of sourdough loaves (95th percentile) have a daily intake of 15 g of melanoidins. All in all, it can be concluded that, considering a mixed consumption of different types of bread and biscuits, a reasonable estimation of the intake of melanoidins is around 6–7 g per day for average consumers and 12–15 g per day for the 95th percentile. The educated guess performed in this paper demonstrated that it is possible to make a reliable estimation of the dietary intake of melanoidins from coffee and bread, which is of 1.5 and 6 g, respectively for average consumers and can be roughly double for high consumers of these foods. It is known that melanoidins escape digestion and pass through the upper gastrointestinal tract and then can interact with the different microbial species present in the hindgut.63 Specific evidence showing that both coffee and bread crust melanoidins can be metabolized/fermented by the human hindgut microflora selectively enhancing the growth of desirable bacteria in the gut has been demonstrated (all references above). Moreover, melanoidins have been demonstrated to develop antimicrobial activity37 which could complement the prebiotic effect if this inhibition of the bacterial growth could be exerted over pathogenic bacteria. Melanoidins share some of the properties attributed to dietary fibre. Similarly to dietary fibre they can differ in water holding capacity, viscous properties, solubility, antioxidant capacity and fermentability. All these aspects are worth investigating also for melanoidins considering their relevant daily dietary intake, which is in the same order of magnitude of that reported for the dietary fibre. In particular coffee melanoidins, which are mainly constituted by polysaccharides quite similar to those constituting the classical soluble dietary fibre, could represent a significant part of the whole intake of soluble dietary fibre. An interesting parallel can be performed about the physiological functions of coffee melanoidins possessing a high antioxidant capacity due to the presence of chlorogenic acid fragments and cereal dietary fibre which is rich of phenolic compounds64 and increase the intake of antioxidants.65

Table 6 Dietary intake of melanoidins (g per person per day) from bread and biscuits. Values were calculated considering the content of melanoidins and the percentage of crusts as reported in Table 5 and the bread and biscuits consumption for average and 95th percentile, respectively

Product type Sourdough loaves Sliced bread Baguette Dry biscuits

Melanoidins intake (Average)

Melanoidins intake (95th)

6.7  0.4

15.0  1.0

1.8  0.1 5.5  0.3 3.2  0.2

4.1  0.3 12.3  0.7 8.5  0.6

Food Funct., 2011, 2, 117–123 | 121

Downloaded on 09 February 2011 Published on 14 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00156B

On the other hand, the enzyme-solubilised fraction of bread melanoidins is mainly made up of crosslinked protein and starch, a material quite different from dietary fibre. The evidence about the biological properties of this material are scarce and somehow contradictory; in any case the presence of a relevant moiety of proteins in the material reaching the lower gut is considered not beneficial.66,67 Finally, it should be remarked that although melanoidins from coffee and bread represent the major part of melanoidins intake in Western diets, other sources of melanoidins mentioned in the introduction can give a relevant contribution. In some cases the alternative source can even be predominant for peculiar dietary regimen. Considering an estimated daily intake close to 10 g per day (from all the possible sources) and the several different biological actions described for melanoidins, it is time to gain more insights in the biological functions of these compounds.

Acknowledgements This research was partly supported by Scientific Research program from Comunidad de Madrid (ANALISYC-II Program S2009/AGR - 1464).

References 1 F. J. Morales, Food Chem., 2002, 76, 363. 2 E. K. Bekedam, H. A. Schols, M. A. J. S. van Boekel and G. Smith, J. Agric. Food Chem., 2006, 54, 7658. 3 H. Kato and H. Tsuchida, Prog. Food Nutr. Sci., 1981, 5, 147. 4 T. Hofmann, Eur. Food Res. Technol., 1998, 206, 251. 5 B. Cammerer and L. W. Kroh, Food Chem., 1995, 53, 55. 6 F. M. Nunes and M. Coimbra, J. Agric. Food Chem., 2007, 55, 3967. 7 T. Hofmann, J. Agric. Food Chem., 1998, 46, 3891. 8 R. Tressl, G. T. Wondrak, L. A. Garbe, R. P. Kruger and D. Rewicki, J. Agric. Food Chem., 1998, 46, 1765. 9 T. Hofmann, W. Bors and K. Stettmaier, J. Agric. Food Chem., 1999, 47, 391. 10 T. D. Obretenov, M. J. Kuntcheva, S. C. Mantchev and G. D. Valkova, J. Food Biochem., 1991, 15, 279. 11 B. L. Milic, B. Grujic-Injac, M. V. Piletic, S. Lajgic and L. A. Kolarov, J. Agric. Food Chem., 1975, 23, 960. 12 R. J. Kuntcheva and T. D. Obretenov, Zeitschrift f?r LebensmittelUntersuchung und -Forschung, 1996, 202, 238. 13 R. Ponnampalam and N. I. Mondy, J. Food Sci., 2006, 48, 1613. 14 O. Ac¸ar, V. G€ okmen, N. Pellegrini and V. Fogliano, Eur. Food Res. Technol., 2009, 229, 961. 15 T. D. Obretenov, S. D. Ivanova, M. J. Kuntcheva and G. T. Somov, J. Agric. Food Chem., 1993, 41, 653. 16 H. Sakurai, H. Hashiba and A. Okuhara, J. Agric. Chem. Soc. Japan, 1981, 55, 7. 17 P. Giudici, M. Gullo, L. Solieri and P. M. Falcone, Adv. Food Nutr. Res., 2009, 58, 137. 18 M. Ortega-Heras and M. L. Gonzalez-Sanjose, Food Sci. Technol., 2009, 42, 1729. 19 A. Adams, R. C. Borrelli, V. Fogliano and N. De Kimpe, J. Agric. Food Chem., 2005, 53, 4136. 20 V. Fogliano, S. M. Monti, T. Musella, G. Randazzo and A. Ritieni, Food Chem., 1999, 66, 293. 21 H. G. Maier, W. Dietmair and J. Ganssman, Zeitschrift f€ ur Lebensmittel-Untersuchung und -Forschung, 1968, 137, 282. 22 F. M. Nunes, A. Reis, M. R. M. Domingues and M. A. Coimbra, J. Agric. Food Chem., 2006, 54, 3428. 23 H. E. Maier and H. Buttle, Zeitschrift f?r Lebensmittel-Untersuchung und -Forschung, 1973, 150, 331. 24 P. Montavon, A. F. Mauron and E. Duruz, J. Agric. Food Chem., 2003, 51, 2335.

122 | Food Funct., 2011, 2, 117–123

25 L. Henrich and W. Baltes, Zeitschrift f?r Lebensmittel-Untersuchung und -Forschung, 1962, 185, 366. 26 M. Takenaka, N. Sato, H. Asakawa, X. Wen, M. Murata and S. Homma, Biosci., Biotechnol., Biochem., 2005, 69, 26. 27 N. Terasawa, M. Murata and S. Homma, J. Food Sci., 1996, 61, 669. 28 R. C. Borrelli, A. Visconti, C. Mennella, M. Anese and V. Fogliano, J. Agric. Food Chem., 2002, 50, 6527. 29 A. D’Agostina, G. Boschin, F. Bacchini and A. Arnoldi, J. Agric. Food Chem., 2004, 52, 7118. 30 A. Illy, and R. Viani, Espresso Coffee. The Chemistry of Quality; Academic Press, 1995, London. 31 C. Delgado-Andrade and F. J. Morales, J. Agric. Food Chem., 2005, 53, 1403. 32 M. Lindenmeier, V. Faist and T. Hofmann, J. Agric. Food Chem., 2002, 50, 6997. 33 R. C. Borrelli and V. Fogliano, Mol. Nutr. Food Res., 2005, 49, 673. 34 T. Hofmann and P. Schieberle, J. Agric. Food Chem., 2002, 50, 319. 35 L. Goya, C. Delgado-Andrade, J. A. Rufian-Henares, L. Bravo and F. J. Morales, Mol. Nutr. Food Res., 2007, 51, 536. 36 F. J. Morales, C. Fernandez-Fraguas and S. Jimenez-Perez, Food Chem., 2005, 90, 821. 37 J. A. Rufian-Henares and F. J. Morales, Food Chem., 2008, 111, 1069. 38 S. Hiramoto, K. Itoh, S. Shizuuchi, Y. Kawachi, Y. Morishita, M. Nagase, Y. Suzuki, Y. Nobuta, Y. Sudou, O. Nakamura, I. Kagaya, H. Goshima, Y. Kodama, F. C. Icatro, W. Koizumi, K. Saigenji, S. Miura, T. Sugiyama and N. Kimura, Helicobacter, 2004, 9, 429. 39 V. Somoza, Mol. Nutr. Food Res., 2005, 49, 663. 40 J. M. Ames, A. Wynne, A. Hofmann, S. Plos and G. R. Gibson, Br. J. Nutr., 1999, 82, 489. 41 C. Dell’Aquila, J. M. Ames, G. R. Gibson and A. G. Wynne, Eur. Food Res. Technol., 2003, 217, 382. 42 D. Gniechwitz, N. Reichardt, E. Meiss, J. Ralph, H. Steinhart, M. Blaut and M. Bunzel, J. Agric. Food Chem., 2008, 56, 5960. 43 C. Alexander, Food Eng. Ingredients, 2007, 32, 18. 44 J. Dıaz-Rubio and F. Saura-Calixto, J. Agric. Food Chem., 2007, 55, 1999. 45 V. G€ okmen, A. Serpen and V. Fogliano, Trends Food Sci. Technol., 2009, 20, 278. 46 C. L. Vecchia and A. Taviani, Eur. J. Cancer Prev., 2007, 16, 385. 47 R. C. Borrelli, F. Esposito, A. Napolitano, A. Ritieni and V. Fogliano, J. Agric. Food Chem., 2004, 52, 1338. 48 D. Gniechwitz, N. Reichardt, M. Blaut, H. Steinhart and M. Bunzel, J. Agric. Food Chem., 2007, 55, 6989. 49 M. Garsetti, N. Pellegrini, C. Baggio and F. Brighenti, Br. J. Nutr., 2000, 84, 705. 50 I. Sanchez-Gonzalez, A. Jimenez-Escrig and F. Saura-Calixto, Food Chem., 2005, 90, 133. 51 M. A. Martın, S. Ramos, R. Mateos, J. A. Rufian-Henares, F. J. Morales, L. Bravo and L. Goya, J. Agric. Food Chem., 2009, 57, 7250. 52 Federaci on Espa~ nola del Cafe (FEC) (2009) Informaci on estadıstica sectorial 2008, Seville, Spain. 53 COST. (1998) Melanoidins in Food and Health; COST Action 919; European Union, Brussels, Belgium. 54 S. I. F. Martins and M. A. J. S. Van Boekel, Food Chem., 2003, 83, 135. 55 T. Hofmann, In: Melanoidins in food and health – Cost Action 919 Berlin, Germany and Prague, Czech Republic, 2000, pp. 1–21. 56 A. D’Amicis, C. Scaccini, G. Tomassi, M. Anaclerio, R. Stornelli and A. Bernini, Int. J. Epidemiol., 1996, 25, 513. 57 International Coffee Organisation (ICO) (2009) Database 2009. London, England. http://www.ico.org/. 58 R. C. Borrelli, C. Mennella, F. Barba, M. Russo, G. L. Russo, K. Krome, H. Erbersdobler, V. Faist and V. Fogliano, Food Chem. Toxicol., 2003, 41, 1367. 59 S. Gonzalez-Mateo, M. L. Gonzalez-SanJose and P. Mu~ niz, Food Chem. Toxicol., 2009, 47, 2798. 60 B. Spencer, British. Baker, 1974, 176, 19. 61 C. Leclercq, D. Arcella, R. Piccinelli, S. Sette, C. Le Donne and A. Turrini, Public Health Nutrition, 2009, 1–29, DOI: 10.1017/ S1368980009005035. 62 MAPA. Ministerio de Agricultura, Pesca y Alimentaci on, 2009, Madrid, Spain. 63 V. Faist and H. F. Erbersdobler, Ann. Nutr. Metab., 2001, 45, 1.

This journal is ª The Royal Society of Chemistry 2011

66 K. M. Tuohy, D. J. S. Hinton, S. Davies, M. J. C. Crabbe, G. R. Gibson and J. Ames, Mol. Nutr. Food Res., 2006, 50, 847. 67 D. J. S. Mills, K. Tuohy, J. Booth, M. Buck, M. J. C. Crabbe, G. R. Gibson and J. M. Ames, J. Appl. Microbiol., 2008, 105, 706.

Downloaded on 09 February 2011 Published on 14 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00156B

64 P. Vitaglione, A. Napolitano and V. Fogliano, Trends Food Sci. Technol., 2008, 19, 451. 65 R. Pulido, M. Hernandez-Garcia and F. Saura-Calixto, European Journal of Clinical Nutrition, 2003, 57, 1275.

This journal is ª The Royal Society of Chemistry 2011

Food Funct., 2011, 2, 117–123 | 123

View Online

Food & Function

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 124

PAPER

www.rsc.org/foodfunction

Normalization genes for quantitative RT-PCR in differentiated Caco-2 cells used for food exposure studies

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00068J

Robert A. M. Vreeburg,* Shanna Bastiaan-Net and Jurriaan J. Mes Received 10th July 2010, Accepted 26th November 2010 DOI: 10.1039/c0fo00068j Exposure of food products to small-intestinal-like Caco-2 cells, combined with a gene expression based response analysis can be a valuable tool to classify potential bioactive effects of food homogenates. In order to study changes in gene expression upon food exposure, a robust set of stably expressed genes is required for normalization. Here we present a set of reference genes suitable for RT-qPCR that has been validated for exposure studies with the intestinal-like Caco-2 cell line. This study identified ribosomal phosphoprotein P0 (RPLP0) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as best reference genes. The set can be extended with b-2-microglobulin (B2M), splicing factor 3A, subunit 1 (SF3A1), and mitochondrial ribosomal protein L19 (MRPL19). Food homogenates did provoke responses in the Caco-2 cells, as was demonstrated by changed expression of NAD(P)H Quinone dehydrogenase 1 (NQO1), Claudin 4 (CLDN4), Nitric Oxide Synthase 2 (NOS2), and ATP-binding cassette, subfamily B, member 1 (ABCB1) in the same experiment. Results indicate that: i) natural food homogenates can exert effects in Caco-2 cells, and ii) stability in expression of the reference genes is not due to a lack of response of the Caco-2 cells.

Introduction Fruit and vegetables are considered a healthy food choice and are under intensive study to identify the compounds responsible for the effects on human physiology and the underlying mechanisms. This type of research has led to the identification of many potential health promoting compounds from fruits and vegetables like sulforaphane from broccoli, and quercetin as a health compound from apples and onions.1–3 However, fruit and vegetables are more than just a carrier of a single compound, they are complex products with a wide array of compounds that interact.4 Moreover, most products we consume are processed, prepared at home, or contain all kinds of additives, so we aimed to develop a tool to analyse potential bioactivity of food products instead of individual bioactive compounds. The gut is exposed to food we consume. These intestinal cells are important for e.g. uptake of food components, provide a barrier to unwanted pathogens and compounds, modification of compounds, and local immune responses.5 It has been shown that these intestinal functions can be modulated by food compounds and that in vitro cell lines can be used to mimic the response.5 One of such small intestine representing cell cultures is the human, colon derived, Caco-2 culture.6,3 Although originating from a colon carcinoma,7

Wageningen University and Research centre, Food & Biobased Research, P.O. Box 17, 6700 AA Wageningen, The Netherlands. E-mail: robert. [email protected]; Fax: +0031 (0)317 483 011; Tel: +0031 (0)317 487612

124 | Food Funct., 2011, 2, 124–129

Caco-2 cells show high morphological and physiological homology with small intestinal cells when allowed to differentiate after having formed a confluent monolayer; as they then exhibit villi and express brush border enzymes such as sucrase-isomaltase, alkaline phosphatase, and aminopeptidase N.8,9 The most versatile readout for detecting responses of cells is to determine changes in mRNA abundance, as has been studied with microarrays.10,11 Exposure of Caco-2 cells to food compounds, like quercetin or glycoalkaloids, has resulted in detectable differences in gene expression.11,12 However, analysing bioactive effects of crude food mixtures will urge for a more robust and sensitive method than microarrays, which can be found in a good controlled quantitative RT-qPCR approach with a well validated set of biomarker genes and highly stable reference genes for normalization.13,14 Sets of normalization genes have been published for use with Caco-2 cells, but these are focused on differentiation processes,15 leaving a requirement for a gene set that can be used in food exposure studies. A common way of deciding on reference genes for RTqPCR is to compare the quantification cycles (Cq values, sometimes indicated as Ct or Cp13) of a gene in different samples, assuming that the genes with most constant Cq value has the most constant expression. This method however, results in a selection of genes which abundance is constant relative to the total amount of RNA used for cDNA synthesis, instead of having a constant expression per se. An improved method has been proposed by Vandesompele et al.,14 which is based on selecting genes having a constant ratio of expression. This method is independent of the amount of mRNA or This journal is ª The Royal Society of Chemistry 2011

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00068J

View Online

cDNA used, and will thus give good reference genes when changes in total RNA are expected. In this study we tested several genes that have been proposed as useful reference genes in Caco-2 cells, like the generally applied bactin (ACTB),14,15 glyceraldehyde-3-phosphate dehydrogenase (GAPDH),14 b-2-microglobulin (B2M),16 and ribosomal phosphoprotein P0 (RPLP0).16 A further expansion of the tested set comes from genes found by Szabo et al.,17 who used public microarray data to find stably expressed genes like proteasome (prosome, macropain) 26S subunit ATPase 4 (PSMC4), mitochondrial ribosomal protein L19 (MRPL19), Pumilio homologue 1 (PUM1), and splicing factor 3A, subunit 1 (SF3A1). In order to ensure that food based effects can indeed be monitored using the designed exposure and response read out system, a selection of homogenates of crude natural foods were used. Candidate responsive genes were selected and were subsequently used in the RT-qPCR approach to study whether the used food homogenates can still provoke effects in Caco-2 cells. The observed changes in gene expression support the hypothesis that exposure to natural food homogenates did result in responses of the Caco-2 cells and that the selection of stably expressed reference genes is not caused by a lack of response of the cells to food homogenates. The changed expression of the response genes in reaction to the used food homogenates is discussed.

Materials and methods Cell culture Caco-2 cells were grown in 12-well tissue culture plates (Greiner bio-one, Alphen a/d Rijn, The Netherlands). Cells were seeded with 8  104 cells cm2 per well, and grown in Dulbecco’s Modified Eagles Medium (DMEM, with 4.5 g l1 glucose, 4 mM L-glutamine and 25 mM HEPES, Invitrogen, Paisley, UK) supplemented with 9.1% heat inactivated fetal bovine serum (FBS, Invitrogen, Paisley, UK), at 37  C and 5% CO2. The cells in the wells reached confluence after 4 days of growth, growth was continued for 25 days when at which they showed increased expression of sucrase-isomaltase and alkaline phosphatase RNA. Medium was replaced three times a week. Sample preparation and cell exposure Broccoli, apples, tomatoes, and mushrooms were obtained from a local supermarket. The edible parts were mashed, clear supernatant was taken and diluted 1 : 1 with DMEM + FBS medium. pH was adjusted with 1 M NaOH using the phenol red pH indicator in the DMEM. Samples were filter sterilized through 0.45 and 0.2 mm and samples were diluted further to a total of 3 or 5 times. DMEM only and water controls were included. For exposure, medium was removed from the well, and sample/DMEM mixtures were added, cells were incubated at growing conditions for 24 h. Every fruit and vegetable sample was added to three different wells which were subsequently processed and analysed separately, and are therefore considered as biological replicates. Cell and monolayer morphology did not differ between treatments and control samples, as checked by microscopic examination. MTT viability tests were performed under similar conditions as used for the RT-qPCR samples. This journal is ª The Royal Society of Chemistry 2011

RNA extraction and cDNA synthesis Medium was removed and cells were harvested with 0.5 ml TriZol (Invitrogen, Paisley, UK). RNA was extracted with TriZol, DNaseI treated (Sigma-Aldrich, Steinheim, Germany), and purified with RNeasy mini columns (Qiagen, Hilden, Germany), all according to the manufacturers protocols. cDNA was synthesized in a volume of 20ml with iScript (Bio-Rad, Hercules, USA), using 0.2 mg total RNA as determined spectrophotometrically with a NanoDrop (NanoDrop, Wilmington, USA). cDNA was diluted 20x before being quantified by qPCR.

Primer design and qPCR Primers were designed with Clone Manager Professional 9 and checked in silico for specificity with the NCBI primer design tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/) and UCSC in silico PCR (http://genome.ucsc.edu/). Primer efficiency and gene expression analysis were conducted on a BioRad iCycler iQ1 Real Time PCR machine, with SYBR-Green Supermix (BioRad, Hercules, USA). Primer concentrations were optimized per primer pair and are stated in Table 1 and 2. Primer specificity was tested by examining the dissociation curve made with 1  C temperature steps, and by running the PCR products on agarose gel. All PCR’s used 58  C as annealing temperature. Every sample was run with technical replicates, and the average was used for calculations with the ddCt method18 and geNorm.14 Expression values of NQO1, CLDN4, NOS2, and ABCB1 were normalized using the geometric average of the Cq values of RPLP0 and GAPDH.

Statistical analysis Differences in gene expression were analysed on Cq values, with univariate ANOVAs. Dunnett two-sided post-hoc testing was used to identify expression levels different from DMEM control at p < 0.05.

Results Reference gene primer quality Reference genes with corresponding primer sequences were selected from literature and were analyzed for their specificity and PCR efficiency (see Table 1). Primer sequences were taken from literature and tested for use at 58  C annealing temperature to allow all analyses under similar PCR conditions. New primers were developed for B2M due to the formation of two products by the published sequences (data not sown). The primer pairs for the reference genes were expected to give products ranging from 89 to 196 bp, with melting temperatures between 58 and 65  C. Impact of a potential contamination of the samples with genomic DNA was determined by running in silico PCRs against the human genome. Melting curves showed only one peak, and one band was observed for each primer pair when the qPCR products were run on agarose gel. PCR amplification efficiencies of all primer pairs were between 89.8 and 101.4%. Food Funct., 2011, 2, 124–129 | 125

View Online

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00068J

Table 1 Primer sequences and characteristics of the reference genes testeda Name

RNA ID

Sequence (50 -30 )

Tm ( C)

Am. (bp)

AE (%)

Conc. (mM)

gDNA

Ref.

RPLP0

NM_001002.3

93.5

0.1

none

16

NM_181861.1

92

89.8

0.1

none

N

ACTB

NM_001101

140

93.2

0.1

var.

14

GAPDH

NM_02046

87

96.5

0.1

87-3750

14

PSMC4

NM_006503.2

190

97.3

0.1

5279

17

MRPL19

NM_005877.4

182

96.2

0.4

2260

17

PUM1

NM_005877.4

187

98

0.4

3487

17

SF3A1

NM_005877.4

61 60 62 60 64 64 65 65 59 60 61 58 62 60 61 60

142

B2M

GCAATGTTGCCAGTGTCTG GCCTTGACCTTTTCAGCAA TGCCGTGTGAACCATGTG GCGGCATCTTCAAACCTC CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAATGCA TGCACCACCAACTGCTTAGC GGCATGGACTGTGGTCATGAG GGCATGGACATCCAGAAG CCACGACCCGGATGAAT GGGATTTGCATTCAGAGATCAG GGAAGGGCATCTCGTAAG TGAGGTGTGCACCATGAAC CAGAATGTGCTTGCCATAGG GGAGGATTCTGCACCTTCTAA GCGGTAGTAGGCATGGTAA

196

101

0.4

6627

17

a Abbreviations: RNA ID: NCBI mRNA identifier of the sequence used for designing primer. Tm: melting temperature, as calculated by Clone Manager software. Am: amplicon size expected from cDNA, in base pairs. AE: amplification efficiency. Conc.: concentration of primer in reaction mixture. gDNA: length of product expected to result from genomic DNA. Ref.: Source of primer sequence; N-newly designed by authors.

Table 2 Primer sequences and characteristics of the response genes used to verify effect of exposures to Caco-2 cellsa Name

RNA ID

Sequence (50 -30 )

Tm ( C)

Am. (bp)

RE (%)

Conc. (mM)

gDNA

Ref.

NQO1

NM_000903.2

90.4

0.1

1880

19

NM_000625.3

118

89.8

0.1

1408

N

CLDN4

NM_001305.3

92

94.3

0.1

92

N

ABCB1

NM_000927.3

67 66 62 62 64 62 62 62

134

NOS2

GGGATCCACGGGGACATGAATG ATTTGAATTCGGGCGTCTGCTG CATCCTCTTTGCGACAGAGAC GCAGCTCAGCCTGTACTTATC TTGTCACCTCGCAGACCATC CAGCGAGTCGTACACCTTG GCTCGTGCCCTTGTTAGAC CAGGGCTTCTTGGACAACC

96

98.2

0.1

1543

N

a

See Table 1 for explanation of abbreviations.

Reference gene selection Homogenates of broccoli, apple, tomato, and mushroom were used for determining the best set of reference genes for normalizing qPCR data when analysing responses of Caco-2 cells to food products, with a 3 times dilution, and a 5 times dilution. Cq values of the eight tested reference genes are shown in Fig. 1. GAPDH is the gene with the highest gene abundance, resulting in the lowest Cq values (average 19.7), and PSMC4 had the highest Cq value (average 27.0). MRPL19 had the highest difference between maximum and minimum average Cq values (3.25), SF3A1 had the lowest difference between the extreme Cq values (1.25). Expression data was analyzed using geNorm,14 which calculates the stability of expression (M), and a measure for pairwise variation (V). Gene stability (M) is calculated by determining the ratios of the expression of the indicated gene with all the other genes, and the average standard deviation of the logarithmically transformed ratios is computed. Good reference genes are expected to have a constant expression, so the ratio of the expression of two good reference genes is expected to be constant. The variation of the ratios of these two genes over treatments will therefore be low. By repetitively removing the worst performing gene from the gene pool, and recalculating M, the best performing, least variable pair of genes can be selected. Fig. 2 shows the gene stability measure M for the studied reference genes, using the cyclic approach described. PSMC4 had the 126 | Food Funct., 2011, 2, 124–129

highest variation in expression compared to the other genes. Expression of RPLP0 and GAPDH were most similar to each other (Fig. 2).

Fig. 1 Box plot showing the quantification cycles (Cq) of tested reference genes in Caco-2 cells upon exposure to different food products homogenates. The boxes represent the median with the 25 and 75 percentiles, the whiskers indicate the 5 and 95 percentiles, outliers are represented by dots, extreme outliers (more than three times the height of the box) are indicated with an asterisk. Dark boxes represent the Cq values for 3 times diluted samples, open boxes represent the Cq values for 5 times diluted samples.

This journal is ª The Royal Society of Chemistry 2011

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00068J

View Online

Fig. 2 Average expression stability (M) of tested reference genes, with stepwise exclusion of the least stable gene. The least stable gene in each group is indicated below the axis. The genes are thus ranked in order of increasing stability of expression.

Fig. 3 Variation in normalization factor when different number of genes are included, comparing the normalization factor composed of n genes with the normalization composed of n + 1 (next best gene).

Using multiple reference genes for normalization gives a more accurate normalization factor, which is calculated as the geometric mean of the Cq values. A method to determine the number of reference genes to be used is based on how much the normalization value changes by adding an extra (next best) gene to the set. Comparing a reference group of 3 genes (RPLP0, GAPDH, and B2M) with a group of 2 genes (GAPDH and RPLP0) showed a difference in the corresponding normalization factor that resulted in a standard deviation of 0.11 (Fig. 3), a value that is within the same range as has been found for other validated sets of reference genes.14,15 Expression of response genes will be normalized using GAPDH and RPLP0 as reference genes. Addition of extra genes to the set results in more stable normalization factors, as indicated by the descending line in Fig. 3, with the least variation between a set consisting of five genes (RPLP0, GAPDH, B2M,SF3A, and MRPL19) compared with a set of six genes. This set might be used in larger experiments such as RT-qPCR-arrays. Effect of exposure Primers were designed for genes which expression was be expected to change in Caco-2 cells upon exposure to different foods (see Table 2). Similar quality parameters were met as used for the primes of the reference genes (see above). Altered expression of these genes served as a positive control to show that the cells did indeed react to the different food homogenates. Genes were selected based on reported responsiveness to individual bioactive compounds, since data on whole products is scarce. NAD(P)H Quinone dehydrogenase 1 This journal is ª The Royal Society of Chemistry 2011

(NQO1) was selected to be responsive for broccoli as it is generally accepted that broccoli contains glucoraphanin, a glucosinolate that is converted to sulforaphane, which in turn induces NQO1 gene expression.1,20 CLDN4 was selected to be responsive to exposure to apple, since apples contain quercetin-glycosides, a phytochemical that has been shown to induce CLDN4 expression.2,21 Nitric Oxide Synthase 2 (NOS2), and ATP-binding cassette, subfamily B member 1 (ABCB1) were selected as general responsive genes, involved in nitric oxide signalling and xenobiotic transport. Exposure of Caco-2 cells to broccoli extract induced an 8-fold increase in NQO1 mRNA abundance compared with medium only (Fig. 4A). Mushroom induced a 2-fold increase in NQO1 expression, with a lower induction at higher dilution. Different dilutions of broccoli did not result in different induction. Exposure to apple and tomato did not result in a changed NQO1 expression indicating that changes in gene expression are not a general exposure response but specific for a food product. CLDN4 expression in Caco-2 cells was enhanced by all food products tested except tomato, with the highest induction by apple and broccoli (Fig. 4B). A dose dependent induction of CLDN4 was observed for apple and mushroom. Expression of NOS2 was enhanced by apple and mushroom in a dose dependent manner, and was reduced by the highest ‘concentration’ of broccoli (Fig. 4C). Expression of ABCB1 in Caco-2 cells was induced by broccoli and mushroom (Fig. 4D). Cell viability was tested in a separate experiment for the 3 times diluted samples, and did not change upon exposure to food homogenates, except for broccoli which induced a decrease in MTT conversion (data not shown). However, total amount of RNA extracted from broccoli exposed cells was similar to the control samples, and reference genes showed exact the same Cq values as for other exposures, arguing that no severe induction of cell death could be held responsible for all effects seen for broccoli.

Discussion Reference gene selection Eight putative reference genes were selected from literature and tested for their suitability to be used in systematic Caco-2 exposure studies, including the widely used ACTB and GAPDH. All primers developed and used in this study were specific as they amplified only a single fragment and the PCR efficiency was close to 100%. The expression of 18S was not considered in this study, since that gene is much more abundant than most response genes and the Cq value will not be in the same range. Samples will thus need extra dilution which might be a source of variation. RPLP0 and GAPDH were selected as the best reference couple, using the method as described by VanderSompele et al.14 Since the method is based on finding genes with the best co-expression, care has to be taken not to end up with a gene-set that is part of one biological signalling pathway or that their expression is regulated by a common factor. RPLP0 is a ribosomal protein, and as such involved in protein synthesis.22 GAPDH is part of the glycolysis pathway, another major cellular process, and not likely to be closely regulated with RPLP0. Expression patterns of both genes are similar to the other tested reference genes, making it unlikely that this set of reference genes is selected solely based on coregulation. GAPDH and RPLP0 can be used as reference genes Food Funct., 2011, 2, 124–129 | 127

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00068J

View Online

Fig. 4 Relative gene expression of A. NAD(P)H Quinone dehydrogenase 1 (NQO1), B. Claudin 4 (CLDN4), C. Nitric Oxide Synthase 2 (NOS2), and D. ATP-binding cassette, sub-family B, member 1 (ABCB1), in Caco-2 cells upon exposure to different fruit and vegetables homogenates. Expression levels in cells exposed to medium alone (Dulbecco’s modified eagle medium, DMEM) was set as 1. Solid bars indicate the relative gene expression of 3 times diluted samples, open bars represent the relative gene expression of 5 times diluted samples. Values mean  standard error, n ¼ 3. Values that are significantly different from the DMEM control are indicated with *, for p < 0.05.

when studying a small number of genes of interest. When larger gene sets are analysed, one might consider to include SF3A1, B2M and MEPL19. Exposure to broccoli might have resulted in toxic stress, but even so, this did not result in large difference in Cq values of the reference genes (Fig. 1). The tested selected normalization genes might therefore also be candidates for conditions where adverse effects are expected. Preliminary results show that RPLP0 and GAPDH can be used as stable reference genes in exposure studies with in vitro digested homogenates and Caco-2 cells grown in transwells as well (data not shown). Effect of exposure The 3 and 5 times diluted homogenate of fresh broccoli exposed to the Caco-2 cells induced an 8-fold increase in NQO1 mRNA abundance (Fig. 4A). The lack of concentration dependent response might be indicative that the NQO1 induction has reached a plateau already at the 5 times dilution. Besides exposure to broccoli, exposure to button mushroom extract induced an increase in NQO1 mRNA abundance as well, showing that induction of the phase II detoxification system might be induced by more food products than those in the group of brassica vegetables. Broccoli and button mushroom incited an increased 128 | Food Funct., 2011, 2, 124–129

expression of CLDN4 as well, together with apple (Fig. 4B). CLDN4 is a gene coding for a protein that is part of the tight junction complex between cells23 and its expression is known to be induced by polyphenols such as quercetin.21 To our knowledge, this is the first time that it is shown that a food homogenate, containing all phytochemicals at diluted levels and in combination with the food matrix, can up-regulate CLDN4 expression, and that intake of certain food products might regulate the tight junction or barrier function of the gut epithelium like suggested for quercetin.21 Since we aim at studying bioactive effects of whole food products, no attempts have been made at this stage to correlate these cell responses to concentrations of a certain phytochemicals. The responsiveness of Caco-2 cells to the fruit and vegetable homogenates implies that active compounds are present in high enough concentrations to exert an effect, and that the stability in expression of the reference genes is not due to a lack of response of the Caco-2 cells. Induction of gene expression by apple and mushroom is higher for the 3 times diluted sample than for the 5 times diluted samples, which would be expected for a concentration dependent effect. Induction of genes by broccoli showed a reverse effect on the expression of CLDN4 and ABCB1. These contradicting effects can be explained by taking into account the effect of This journal is ª The Royal Society of Chemistry 2011

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00068J

View Online

broccoli homogenates on cell viability, since a 3 times diluted homogenate resulted in a reduced MTT reduction. The higher induction of certain genes with a more diluted sample might be the result of an interplay of product-induced effects, and toxicityinduced effects, of which the latter will be more alleviated at lower concentrations. Exposure of cells to tomato homogenates did not incite a response for any of the tested genes. As only a very limited set of response genes have been studied here, it is not unlikely that crude tomato homogenate can regulates other functional genes in Caco-2 cells. This study shows, however, that whole food homogenates can be used to study effect on gene expression level, but that enough marker genes should be included to be able to analyze the full responses. We would like to state at this point it that a single cell model will never result in a complete bioactivity signature for a food product since different products might effect different organs.

PUM1 RT-qPCR RPLP0 SF3A1

nitric oxide synthase 2 proteasome (prosome, macropain) 26S subunit, ATPase4 pumilio homologue 1 quantitative reverse transcriptase polymerase chain reaction ribosomal phosphoprotein P0 splicing factor 3A, subunit 1.

Acknowledgements The authors declare that there is no conflict of interest. This work was supported by the Wageningen University and Research Centre IPOP systems biology program.

Literature cited

Applications A good set of reference genes has been selected to be used for normalizing qPCR gene expression analysis in Caco-2 cells upon exposure to food products. The set of response genes, as shown in this paper, can be used for quantifying the effect upon exposure to food homogenates for a very limited number of cellular processes of the small intestinal cells. The set of response genes can be extended to develop a RT-qPCR-array, having indicator genes for many physiological functions that are relevant for intestinal cells, like barrier function, uptake and transporters of food compounds, immune function, contraction, cell proliferation and apoptosis and many more. RT-qPCR analysis allowed the detection of small differences in expression, which might be indicative of a physiological effect induced by a food product. When the expression of multiple genes is quantified upon exposure of Caco-2 cells to homogenates of different food products, a so called food signature can be obtained. Such a signature has already been presented for different small drug based compounds,24 which allowed linkage of gene expression signatures of cultured cells upon exposure to small compounds to the mode of action of tested small drug molecules and diseases. A similar strategy using fruit and vegetables will result in a database with gene expression signatures obtained from Caco-2 cells exposed to a variety of food products. Such an approach might detect similar or different biological effects of food products allowing the classification of products in bioactivity classes. This can facilitate product choice in human or animal intervention studies.

Abbreviations ACTB B2M CLDN4 Cq DMEM GAPDH ABCB1 MRPL19 NQO1

NOS2 PSMC4

b-actin b-2-microglobulin claudin 4 quantification cycle Dubelco’s Modified Eagles Medium glyceraldehyde-3- phosphate dehydrogenase ATP-binding cassette, sub-family B, member 1 mitochondrial ribosomal protein L19 NAD(P)H quinone dehydrogenase 1

This journal is ª The Royal Society of Chemistry 2011

1 J. W. Fahey, Y. Zhang and P. Talalay, Proc. Natl. Acad. Sci. U. S. A., 1997, 94, 10367–10372. 2 J. Boyer and R. H. Liu, Nutr. J., 2004, 3, 5. 3 J. Boyer, D. Brown and R. H. Liu, Nutr. J., 2005, 4, 1. 4 J. Parada and J. M. Aguilera, J. Food Sci., 2007, 72, R21–R32. 5 M. Shimizu, Biosci., Biotechnol., Biochem., 2010, 74, 232–241. 6 R. P. Glahn, O. A. Lee, A. Yeung, M. I. Goldman and D. D. Miller, J Nutr., 1998, 128, 1555–1561. 7 J. Fogh, J. M. Fogh and T. Orfeo, J Natl Cancer Inst., 1977, 59, 221– 225. 8 M. Pinto, S. Robine-Leon, M. D. Appay, M. Kedinger, N. Triadou, E. Dussaulx, B. Lacroix, P. Simon-Assmann, K. Hafen, J. Fogh and A. Zweibaum, Biol Cell., 1983, 47, 323–330. 9 A. Zweibaum, H. P. Hauri, E. Sterchi, I. Chantret, K. Haffen, J. Bamat and B. Sordat, Int. J. Cancer, 1984, 34, 591–598. 10 M. Traka, A. V. Gasper, J. A. Smith, C. J. Hawkey, Y. Bao and R. F. Mithen, J Nutr., 2005, 135, 1865–1872. 11 A. A. Dihal, C. Tilburgs, M. J. van Erk, I. M. C. M. Rietjens, R. A. Woutersen and R. H. Stierum, Mol. Nutr. Food Res., 2007, 51, 1031–1045. 12 T. Mandimika, H. Baykus, Y. Vissers, P. Jeurink, J. Poortman, C. Garza, H. Kuiper and A. Peijnenburg, J. Agric. Food Chem., 2007, 55, 10055–10066. 13 S. A. Bustin, V. Benes, J. A. Garson, J. Hellemans, J. Huggett, M. Kubista, R. Mueller, T. Nolan, M. W. Pfaffl, G. L. Shipley, J. Vandesompelel and C. T. Wittwer, Clin. Chem., 2009, 55, 4. 14 J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe and F. Speleman, GenomeBiology, 2002, 3, R34.1– 34.11. 15 C. Piana, M. Wirth, S. Gerbes, H. Vierstein, F. Gabor and S. Toegel, Eur. J. Pharm. Biopharm., 2008, 69, 1187–1192. 16 A. B. Dydensborg, E. Herring, J. Auclair, E. Tremblay and J. F. Beaulieu, Am. J. Physiol.: Gastrointest. Liver Physiol., 2006, 290, 1067–1074. 17 A. Szabo, C. M. Perou, M. Karaca, L. Perreard, J. F. Quackenbush and P. S. Bernard, GenomeBiology, 2004, 5, R59. 18 K. J. Livak and T. D. Schmittgen, Methods, 2001, 25, 402–408. 19 F. Pattyn, F. Speleman, A. De Paepe and J. Vandesompele, Nucleic Acids Res., 2003, 31, 122–123. 20 T. A. Shapiro, J. W. Fahey, K. L. Wade, K. K. Stephenson and P. Talalay, Cancer Epidemiol. Biomark. Prev., 2003, 7, 1091–1100. 21 M. Amasheh, S. Schlichter, S. Amasheh, J. Mankertz, M. Zeitz, M. Fromm and J. D. Schulzke, J Nutr., 2008, 138, 1067–1073. 22 M. Tch orzewski, D. Krokowski, W. Rzeski, O. G. Issingen and N. Grankowski, Int. J. Biochem. Cell Biol., 2003, 35, 203–211. 23 C. M. Van Itallie and J. M. Anderson, Annu. Rev. Physiol., 2006, 68, 403–429. 24 J. Lamb, E. D. Crawford, C. Peck, J. W. Modell, I. C. Blat, M. J. Wrobel, J. Lerner, J. P. Brunet, A. Subramanian, K. N. Ross, M. Reich, H. Hieronymus, G. Wei, S. A. Armstrong, S. J. Haggarty, P. A. Clemons, R. Wei, S. A. Carr, E. S. Lander and T. R. Golub, Science, 2006, 313, 1329–1935.

Food Funct., 2011, 2, 124–129 | 129

Food & Function

View Online

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 130

PAPER

www.rsc.org/foodfunction

Function of Plectranthus barbatus herbal tea as neuronal acetylcholinesterase inhibitor Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00070A

Pedro L. V. Fale,ab Paulo J. Amorim Madeira,a M. Helena Flor^encio,ac Lia Ascensa˜obd and Maria Luısa M. Serralheiro*ac Received 14th July 2010, Accepted 21st November 2010 DOI: 10.1039/c0fo00070a This study aims to determine the function of Plectranthus barbatus (Lamiaceae) herbal tea as inhibitor of the brain acetylcholinesterase (AChE) activity. To accomplish this objective the herbal tea as well as its main component, rosmarinic acid were administered to laboratory animals (rats) and the effect on the brain AChE activity was evaluated. The study of the herbal tea metabolites in the plasma and also in the brain was undertaken. The herbal water extract was administered intragastrically and also intraperitoneally. When the plant extract was intragastrically administered, vestigial amounts of metabolites from P. barbatus extract compounds were present in rat plasma, but none were found in brain, although inhibition of brain acetylcholinesterase activity was detected. However, when P. barbatus extract was administered intraperitoneally, all its compounds were found in plasma, and rosmarinic acid was found in brain. The highest concentrations of compounds/metabolites were found 30 min after administration. An inhibition of 29.0  2.3% and 24.9  3.7% in brain acetylcholinesterase activity was observed 30 and 60 min after intraperitoneal administration, respectively. These values were higher than those expected, taking into account the quantity of rosmarinic acid detected in the brain, which suggests that other active extract compounds or metabolites may be present in nondetectable amounts. These results prove that the administration of P. barbatus aqueous extract can reach the brain and act as AChE inhibitor.

Introduction Herbal teas may be considered as functional drinks,1 as indeed almost all of the chemical components of these water extracts possess some biological function in the human body. Some of the ethnobotanical uses of these herbs can be explained through the biochemical activities found and described in the literature either for the complete extracts or for the isolated compounds. Leaves of Plectranthus barbatus (Lamiaceae) that are used to prepare herbal teas to treat a wide range of diseases in South America, Africa and world Eastern regions,2 were studied previously concerning the antiacetylcholinesterase as well as the antioxidant activity.3,4 The inhibition of the referred enzyme is the most effective pharmacotherapy for the symptomatic treatment for the Alzheimer disease (AD)5 and the antioxidant activity has been connected with the capacity to scavenge the free radicals that are

a

Centro de Quımica e Bioquımica, Faculdade de Ci^ encias da Universidade de Lisboa, Campo Grande, 1749-016 Lisboa, Portugal. E-mail: [email protected]; Tel: +351 21 750 0925 b Centro de Biotecnologia Vegetal (IBB), Faculdade de Ci^ encias da Universidade de Lisboa, Campo Grande, 1749-016 Lisboa, Portugal c Departamento de Quımica e Bioquımica, Faculdade de Ci^ encias da Universidade de Lisboa, Campo Grande, 1749-016 Lisboa, Portugal d Departamento de Biologia Vegetal, Faculdade de Ci^ encias da Universidade de Lisboa, Campo Grande, 1749-016 Lisboa, Portugal

130 | Food Funct., 2011, 2, 130–136

formed during the inflammation processes.6 The activities found in the P. barbatus herbal tea could be attributed to the main constituent of this tea, rosmarinic acid, together with other compounds, although present in much lesser quantity, abietane diterpenoids and flavonoid glucuronides.3,4 The function of the herbal teas depends on the metabolism that the compounds present in the extract may be subject to during the gastro-intestinal digestion process. The compounds may be transformed into metabolites with different biological activity compared to the one initially determined. In the case of P. barbatus, some of the active compounds found were transformed when the extract was submitted to in vitro conditions simulating the gastrointestinal tract, what caused a small decrease in the biological activity.4 The fact that the herbal tea could pass the digestive tract and keep some of its function lead to an in vivo experiment in order to see if the compounds present in the water extract could reach the brain and still be active there. Recently, for instance, an ethanol extract of Tabernaemontana divaricata proved to be effective in inhibiting neuronal acetylcholinesterase when administered to rats.7 The quantification of the metabolites of the herbal tea components in the blood stream, and the study of the remaining biological activity in the target organ, especially on what concerns the acetylcholinesterase activity, are topics that are seldom referred to in scientific papers. Therefore, the aim of this study was to investigate if the active compounds present in the This journal is ª The Royal Society of Chemistry 2011

View Online

herbal tea of P. barbatus, or their derivatives, when administered to rats were found in the blood stream and in the brain, and if the neuronal acetylcholinesterase activity was affected by the herbal tea administration.

Experimental

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00070A

Plant material and extract preparation Leaves of Plectranthus barbatus Andr. were collected during September of 2008 from plants cultivated in the Botanical Garden of The University of Lisbon. A voucher specimen was deposited in the Herbarium of this Botanical Garden (LISU:214625). The aqueous plant extract was prepared as a decoction, 10 g of ground fresh leaves boiled for 10 min at 100  C, in 100 ml of distilled water and filtered through grade 1 Whatman paper. The extract was lyophilised and the yield of extraction was approximately 140 mg of extract per g of plant. Chemicals 5,50 -Dithiobis[2-nitrobenzoic acid] (DTNB), acetylthiocholine iodide (AChI), dimethylsulfoxide (DMSO), b-glucuronidase type IX-A from E.coli 1 134 600 U g1, 3 660 000 U g1 protein, sulfatase from Helix pomatia 14400 U g1, HEPES buffer, cathecol o-methyltransferase (COMT) from porcine liver, Sadenosylmethionine (SAM), L-cystein non-animal source, rosmarinic acid (RA), quercetin, luteolin and apigenin were obtained from Sigma, St. Louis, USA. Methanol and acetonitrile, both HPLC grade, and trifluoroacetic acid were obtained from Merck, Darmstadt, Germany. Animals All experiments were carried out in accordance with the guidelines of the European Communities Council Directive of 24th November 1986 (86/609/ECC). Adult male Sprague–Dawley rats (3–4 months old) were obtained from Instituto de Investigac¸a˜o Cientıfica Bento da Rocha Cabral (Lisbon, Portugal). Two rats per cage were maintained in a room at 22  C under 12 h dark/ light cycling and ad libitum access to water and regular chow. In vitro conjugation studies for metabolites identification Preparation of cell-free extracts. A cell-free liver extract was prepared, essentially as described by Justino and co-workers,8 to obtain the hepatic enzymes that metabolize flavonoids. In brief, rat livers were collected and homogenized in ice-cold 10 mM phosphate buffer, pH 7.4, containing 10 mM 2-mercaptoethanol (1 g wet tissue/2.5 mL buffer). The homogenate was then centrifuged for 90 min at 12 000 g at 4  C. The protein content of the supernatant was immediately determined by the Lowry method9 and the remainder supernatant was lyophilized and stored at 20  C until required. Glucuronidation assay. The standard assay mixture contained 0.5 mg mL1 P. barbatus extract, or 40 mM rosmarinic acid, or 50 mM flavonoid standards, 2 mM UDPGA, and cell-free extract (5 mg mL1) in 10 mM potassium phosphate buffer, pH 7.4, in This journal is ª The Royal Society of Chemistry 2011

a final volume of 1 mL.8 The reaction was initiated by addition of the cytosolic fraction extracted and the mixture was incubated for 30 min at 37  C without shaking. The reaction was stopped and the metabolites were extracted as described in the HPLC analysis section below. Synthesis and identification of methyl rosmarinic acid. The methylation of rosmarinic acid was done by the porcine liver enzyme catechol-o-methyl-transferase (COMT), using the cofactor S-adenosylmethionine (SAM), with an adaptation of the method described by Baba and co-workers.10 Briefly, 20 U of COMT were dissolved in 200 ml of deoxygenated 10 mM Kphosphate buffer, 20 mM L-cystein, 2 mM MgCl2, pH 7.4 and pre-incubated at 37  C for 10 min under inert atmosphere. Five hundred microlitres of 7.1 mM SAM and 100 ml of rosmarinic acid, both dissolved in the reaction buffer, were added. Two hundred microlitres of 7.1 mM were added every two hours, and the reaction was stopped at 6 h by the process described in the section for HPLC analysis. The compounds were isolated by HPLC, collected and analyzed by electrospray ionization mass spectrometry (ESI-MS). All experiments were performed using a LCQ Duo ion trap mass spectrometer from Thermo Scientific (San Jose, CA, USA) equipped with an ESI source. Samples were introduced, via a syringe pump (flow rate of 5 mL min1), into the stainless steel capillary of the ESI source. The applied spray voltage in the source was 4.5 kV, the capillary voltage was 10 V and the capillary temperature was 220  C. All the mass spectrometer parameters were adjusted in order to optimize the signal-to-noise ratios for the ions of interest. Nitrogen was used as nebulising and auxiliary gas in the source. All mass spectrometry data were acquired in the negative ion mode, the full scan spectra were recorded in the range m/z 100–1000 and three micro-scans were averaged. CID and MS/MS experiments were performed with helium as collision gas.

In vivo studies protocol Intragastric and intraperitoneal administration. P. barbatus herbal tea was administered to rats through intragastric procedure (600 mg kg1, equivalent to 150 mmol RA kg1) or intraperitoneal injection (1000 mg kg1, equivalent 250 mmol RA kg1). For each experiment, twelve adult male Sprague–Dawley rats weighing approximately 400 g and 16 h fasted were randomly divided into two groups. Rosmarinic acid standard was administered dissolved in ethanol saline solution (20% ethanol, 0.9% NaCl solution) in a concentration of 550 mmol kg1. The high dose administered is justified by the need of obtaining high levels of the different metabolites for analytical purposes. To control animals only the ethanol saline solution was administered. Blood was withdrawn from three rats, thirty minutes and 1 h after administration, by cardiac punction into K3EDTA tubes and kept on ice. The brains were than collected in ice cold K-phosphate buffer 10 mM pH 7.4 10 mM mercaptoethanol and also kept on ice. Plasma and brain sample preparation. Plasma was separated from red blood cells by centrifugation at 5000 g for 5 min at 4  C and samples were stored at 80  C until further studies. Food Funct., 2011, 2, 130–136 | 131

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00070A

View Online

Each rat brain was weighed and homogenized in 5 ml 10 mM K-phosphate buffer pH 7.4 10 mM mercaptoethanol. The homogenate was then centrifuged for 90 min at 12 000 g, at 4  C and the supernatant (brain extract) stored at 80  C until further studies.

Statistical analysis

Determination of glucuronated and sulfated metabolites. An adaptation of the method described by Justino and co-workers8 was used. To determine the amounts of glucuronated, sulfated and glucuronated-sulfated compounds sets comprised one assay with b-glucuronidase, one assay with sulfatase, one assay with both enzymes and a control with no addition of enzymes were prepared. To 500 ml of sample were added 1000 U of b-glucuronidase, and/or 25 U sulfatase and incubated at 37  C for 1 h. The samples were then processed as described in the HPLC analysis section.

Results and discussion

HPLC analysis Methanol was added to 500 ml of plasma or brain extract to 1 ml solution and the mixture was vortexed, left to precipitate for one hour at 4  C, and centrifuged for 10 min at 10 000 g, at 4  C. The supernatant was recovered, left to precipitate another hour and centrifuged in the same conditions prior to HPLC analysis. Controls were done using rosmarinic acid and caffeic acid as internal standards added to plasma and brain extracts to determine the losses related to this purification process. This protocol showed negligible loss of the standard compounds (less than 10%) and the yield was taken into account for the concentration calculations. The HPLC analysis was carried out in Liquid Chromatograph Finnigan Surveyor Plus Modular LC System, Thermo-Finningan, Germany equipped with a LiChroCART 250-4 LiChrospher 100 RP-18 (5 mm) column, from Merck, Darmstadt, Germany, and Xcalibur software. The extracts were analysed by HPLC injecting 25 ml with an auto injector, and using a linear gradient composed of solution A (0.05% trifluoroacetic acid), solution B (acetonitrile) and solution C (methanol) as following: 0 min, 70% A, 5% B, 20% C; 20 min 10% A, 10% B, 80% C; 25 min, 10% A, 10% B, 80% C. The detection was carried out between 200 and 600 nm with a diode array detector.

Determination of acetylcholinesterase activity Acetylcholinesterase enzymatic activity was measured using an adaptation of the method described by Chattipakorn and coworkers.7 Four hundred microlitres of 50 mM HEPES buffer pH 8 and 50 ml brain extract were mixed in spectrophotometer cuvette and left to incubate for 15 min at 25  C. Subsequently, 75 ml of a solution of AChI (0.023 mg ml1) and 475 ml of 3 mM DTNB in Hepes 50 mM pH 8 were added. The absorbance at 405 nm was read during the first five minutes of the reaction and the initial velocity was calculated as mAU min1 mg1 and converted into nmole min1 mg1 of tissue mass. A control reaction was carried out using the brain extract from the control rats, and it was considered 100% activity for calculations of enzymatic inhibition. 132 | Food Funct., 2011, 2, 130–136

All results are presented as mean  standard deviation and the software used was Microsoft  Excel 2007. Additionally analysis of variance was performed with p ¼ 0.05.

P. barbatus herbal tea proved to have antiacetylcholinesterase activity in previous studies, with an IC50 of 1.02  0.02 mg of dry leaves ml1 and this activity was kept constant after in vitro gastric digestion and lost approximately 50% after the in vitro pancreatic studies.3,4 Rosmarinic acid, luteoline 7-O-glucuronide, apigenine 7-O-glucuronide, two abietane diterpenoid, acacetin 7-O-glucuronide and (16S)-coleon E, were the compounds identified in the water extract,4 being rosmarinic acid the main component. Although all the compounds demonstrated inhibition activity relatively to AChE, an IC50 of 0.44 mg ml1 for the main component was determined.3 Inhibition studies demonstrated that the process was reversible (unpublished studies). Due to these previous results, the study was continued by analysing the action of P. barbatus herbal tea in vivo. In the present work the metabolism of the herbal tea after intragastric and intraperitoneal administration to laboratory animals was analysed. Intragastric administration of P. barbatus extract Plasma. After intragastric administration of P. barbatus extract, the plasma was analysed by HPLC and rosmarinic acid was the only compound detected. In order to confirm if this was indeed the only compound present in the plasma or if some metabolites could be present but in a low amount that was beneath the detection limit of the system, b-glucuronidase and sulfatase were added and allowed to react under the conditions described in the Experimental section. The plasma was analysed once again by HPLC, and this time the rosmarinic acid showed an increase in its area and the aglycons from the flavonoid derivatives were also detected. The results from this study confirmed that not only the presence of rosmarinic acid glucoronide and sulfo-derivatives, but also the presence of the flavonoid glucoronide derivatives in the plasma. The concentration of these rosmarinic acid metabolites found in the plasma are shown in Table 1. It can be seen that the derivatives of rosmarinic acid in circulation in the blood stream decrease after 30 min. This study indicated that, in fact, the flavonoid derivatives found initially in the herbal tea could pass through the gastro-intestinal barrier and appear in the plasma (Table 1). A vestigial peak with retention time corresponding to acacetin was also found. The quantity of total rosmarinic acid found in the plasma relatively to the amount of rosmarinic acid administered in the extract can be calculated, assuming that a male Sprague-Dawley rat contains 4.12 ml plasma per 100 g body weight,11 as 0.009% and 0.005% for 30 and 60 min, respectively. Rosmarinic acid was also intragastrically administered, in a higher quantity than that found in the herbal extract, and analysed under the same conditions. Rosmarinic acid was present in the plasma 30 min and 60 min after the intragastric administration. The quantities found (Table 1) corresponded to 0.036% and 0.015% of the amount of rosmarinic acid This journal is ª The Royal Society of Chemistry 2011

View Online

Table 1 Concentration of rosmarinic acid, its metabolites and flavonoid glucuronide derivatives in the plasma and in the brain, 30 and 60 min after the intragastric and intraperitoneal administration of P. barbatus extract Concentration in the brain

Concentration in plasma

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00070A

P. barbatus extract

Rosmarinic acid standard

Intragastric administration/nM

Intraperitoneal administration/mM

Compound

30 min

60 min

30 min

60 min

30 min

60 min

Rosmarinic acid (RA) RA glucuronides RA sulfates RA methyl Luteolin glucuronide Apigenin glucuronide RA RA methyl

<0.5 112.1 210.4 — 1.9 6.5 4.9  103 —

10.1 87.8 77.3 — — — 1.9  103 —

1440  144 — — 17.8  2.3 40.5  5.9 20.0  3.4 1042.3  192.1 16.7  5.6

745  282 — — 11.1  3.6 29.9  8.0 3.7  0.3 — —

24.1  1.1 — — — — — 25.4  0.9 —

20.4  0.4 — — — — — — —

administered to rats, 30 and 60 min after administration, respectively. The results one hour after administration showed a decrease in the rosmarinic acid concentration in circulation. The test with b-glucuronidase was also carried out, but an increase in the rosmarinic acid area in the HPLC chromatogram was not detected. This means that there were no glucoronated metabolites of this phenolic acid formed in the plasma. It seems that rosmarinic acid, as pure compound or inside the herbal tea, behaves differently. Brain AChE. When rat brains were analysed by HPLC no compounds or metabolites of P. barbatus extract or rosmarinic acid were found. However, when the brain acetylcholinesterase activity was measured, a decrease of 10.0  1.8% and 5.5  1.7% of the enzymatic activity was observed, 30 and 60 min after the extract administration, respectively (Table 2), from the control value of activity of 0.149  0.002 nmol min1 mg1. In the case of rosmarinic acid injection a 13.5% decrease in AChE activity was detected after 30 min. When standard rosmarinic acid was administered intragastrically the concentration of rosmarinic acid found in blood showed values in the same magnitude of those found in other studies.10,12 However, in the present work, when rosmarinic acid was present within the extract, a lower quantity of this acid was found in plasma, suggesting that the other extract components may

Table 2 Brain acetylcholinesterase inhibition (%) 30 and 60 min after administration (intragastric and intraperitoneal) of rosmarinic acid and P. barbatus extract. Results significantly different from the control are marked with * (P < 0.05) and ** (P < 0.1). Values that are not significantly different (P < 0.05) are marked from a to d Brain acetylcholinesterase inhibition (%)

P. barbatus Rosmarinic acid

Intragastric administration

Intraperitoneal administration

30 min 60 min 30 min

10.0  1.8*a 5.5  1.7**b 13.5  1.7*a

29.0  2.3*c 24.9  3.7*d 10.7  5.0**ab

60 min

12.8  2.4*a

—

This journal is ª The Royal Society of Chemistry 2011

Intraperitoneal administration/mM

interfere in the gut permeation of rosmarinic acid. Previous pharmacokinetic studies also reported that the highest concentration of rosmarinic acid was reached in less than 30 min after intragastric administration.10,12 The present study also observed a decrease in the rosmarinic acid concentration after 30 min. The methylated, sulfated and hydrolysed forms of rosmarinic acid into simpler hydroxycinnamic acids forms were observed.10,12,13 In the present work, the methylated form of rosmarinic acid was not detected. This suggests that when rosmarinic acid is administered alone, it can pass the intestinal barrier without undergoing metabolization by the intestinal cells, but it can be glucoronated and sulfated as confirmed by the action of bglucuronidase and sulfatase. Taking into account that the amount of rosmarinic acid in the extract was approximately one third of the rosmarinic acid standard, it is seen that the decrease in the enzyme activity is not linearly correlated with the rosmarinic acid concentration. This is due to the fact that the extract contains other compounds besides rosmarinic acid. These compounds also inhibit acetylcholinesterase4 and the present study indicates that they can also reach the brain and act together with rosmarinic acid as enzyme inhibitors. This fact is corroborated by the analysis of the rosmarinic acid concentration in the plasma (less than 0.5 nM when the herbal tea is administered and 4.9 mM when the standard is given to the laboratory animals) and the enzyme inhibitory activity, which is similar in both situations. These results can only be explained with the inhibitory activity of all the compounds, including the rosmarinic acid derivatives, towards AChE.

Intraperitoneal administration of P. barbatus extract Plasma. After intraperitoneal administration of P. barbatus aqueous extract, rat plasma was analysed by HPLC, Fig. 1a. With the exception of the diterpenoid 6, all the extract compounds were present in rat plasma in higher amount at 30 min than 60 min after injection (Fig. 1a). The abietane diterpenoid 4 has a structure similar to the abietane diterpenoid 6, and is present in the extract as a minor compound. Previous studies reported that it may be formed from abietane diterpenoid 6 in the small intestine conditions,4 this suggests that abietane Food Funct., 2011, 2, 130–136 | 133

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00070A

View Online

Fig. 1 HPLC analysis, 30 and 60 min after intraperitoneal administration of P. barbatus extract, of (a) plasma and (b) brain. 1: luteolin 7-Oglucuronide (retention time 9.6 min); 2: rosmarinic acid (RT: 10.4); 3: apigenin 7-O-glucuronide (RT: 11.2); 4: abietane diterpenoid (RT: 13.8); 5: acacetin 7-O-glucuronide (RT: 15.1); 2m: monomethylated rosmarinic acid; 1g: luteolin glucuronide derivative; 30 : apigenin.

diterpenoid 6 might have been completely transformed into abietane diterpenoid 4 under the biological blood-circulation conditions. Rosmarinic acid, compound 2, is the major compound found in the chromatogram, Fig. 1a. The amount of rosmarinic acid present in the plasma was calculated to be 1439.8  144.0 mM and 744.5  282.3 mM for 30 and 60 min after the extract administration, respectively, Table 1. The amount of rosmarinic acid found in the plasma corresponded to 23.7  2.4% and 12.3  4.3% of the administered amount. In the chromatogram, a peak of methylated rosmarinic acid, 2m, could be detected. According to a standard previously developed by using a commercial COMT from porcine liver and SAM as cofactor in a methodology described in the Experimental section, it was possible to prove the formation of a methylated derivative from rosmarinic acid. The amount of methyl rosmarinic acid was 17.8  2.3 mM and 11.1  3.6 mM for the same administration time-points, Table 1. The search for glucuronated/sulfated metabolites was carried out by reacting b-glucuronidase and sulfatase with the plasma. The only increase in area was observed for flavonoid aglycons, corresponding to the decrease in the corresponding of area of the respective glucuronide peaks. The fact that no significant amounts of glucuronated/sulfated rosmarinic acid metabolites were found after intraperitoneal administration could be explained by the predominance of methylation occurring in the liver over other metabolization reactions, such as sulfation and glucuronidation. This situation was also reported by O’Leary and co-workers.14 In the chromatogram shown in Fig. 1a, a different glucoronide of luteolin than the one initially present in the water extract 134 | Food Funct., 2011, 2, 130–136

(compound numbered 1g) could be detected. Compound 1g was identified after preparing, in vitro, the glucoronidation derivatives according to Experimental section. In this chromatogram the aglycon apigenin (compound numbered 30 ) could also be seen. No luteolin or acacetin aglycons were detected in the plasma samples. These results suggest that the deglucuronation of plasma apigenin glucuronide may be the main reaction occurring to this compound. Studies concerning the oral administration of luteolin suggested that the presence of the unconjugated luteolin in plasma might be due to the permeation of the aglycon without undergoing conjugation by the intestinal cells.15 However, in the present study apigenin was already administrated in its glucuronated form, and so the high amount of aglycon found in plasma must be due to deglucuronation of the apigenine glucuronide. The deglucuronidation of flavonoid glucuronides by the liver was previously reported by O’Leary and co-workers,14 who remarked that the conversion of the quercetin7- and quercetin-3-glucuronide to the mono-sulfate conjugate showed an intermediate step of deglucuronidation by b-glucuronidase activity, allowing transient contact of the free aglycon with the cellular environment. The detection only of the apigenin aglycon in plasma may be due to a higher deglucuronidation of the apigenine glucuronide, comparatively to the other flavonoids and/or to a lower re-glucuronidation of apigenin by the liver. The in vitro glucuronidation assay showed a lower rate of glucuronidation for apigenin than for luteolin, which may explain the existence of apigenin aglycon relatively to luteolin. This hypothesis is also supported by the appearance of a luteolin glucuronide, that could only be produced by deglucuronidation of the extract’s luteoline 7-O-glucuronide, followed by glucuronidation in a different position (Fig. 1a). Little is known about these de-conjugation and re-conjugation reactions in flavonoids, especially when they are administered in their glucuronated forms. The present study differs from the majority of the in vivo flavonoid administration reports in the fact that the several flavonoids were simultaneously administered as glucuronide derivatives, as they are commonly found in herbal teas, instead of their aglycons. All extract compounds showed a decrease from 30 to 60 min after extract administration, with rates of elimination ranging from 25% to 85% (Table 3), the lowest value for the luteolin glucuronide with retention time 13.8 min, numbered 1g (24.4  6.9%), and the highest value for the apigenin glucuronide, numbered 3 (84.5%  4.6%). Only the aglycon from apigenin (retention time of 17.3 min, numbered 30 ) (Fig. 1a) was seen. No luteolin or acacetin aglycons were detected in the plasma. Brain AChE. After intraperitoneal administration of P. barbatus extract, brains from rats were also analysed after 30 and 60 min by HPLC, Fig. 1b. The chromatograms showed only the presence of unconjugated rosmarinic acid, the other extract compounds or their metabolites were not detected (Fig. 1b). No increase of the rosmarinic acid peak area or the aglycons from the flavonoid derivatives were observed after the reactions with bglucuronidase or sulfatase. The amount of rosmarinic acid in rat brains was quantified and a relationship with the amount of rosmarinic acid in the plasma was calculated (Table 1). The amount of rosmarinic acid found in the brain was 0.40  0.02% and 0.34  0.01% of the administered amount, for 30 and 60 min after This journal is ª The Royal Society of Chemistry 2011

View Online

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00070A

Table 3 Retention time of compounds from the P. barbatus extract found in plasma and their decrease from 30 to 60 min after the extract intraperitoneal administration

Luteolin 7-O-glucuronide Rosmarinic acid Apigenin 7-O-glucuronide Monomethylated rosmarinic acid Abietane diterpenoid Luteolin glucuronide Acacetin 7-O-glucuronide Apigenin

Compound

Retention time/min

Decrease from 30 to 60 min (%)

(1) (2) (3) (2m)

9.7 10.5 11.3 12.0

44.91  13.48 51.66  15.60 84.57  4.59 41.7  14.5

(4) (1g) (5) (30 )

13.5 13.8 15.2 17.3

36.33  15.61 24.36  6.88 56.75  0.10 33.4  12.8

administration, respectively. Although the plasma rosmarinic acid concentration showed a decrease from 30 to 60 min (around 52%, Table 3) the brain rosmarinic acid concentration decreased around 15% (14.90  7.11%, Table 1). This difference is reflected in the ratio of brain/plasma rosmarinic acid concentration, which is higher 60 min after the extract administration than at 30 min (0.027 at 60 min and 0.016 at 30 min). The brain/plasma concentration ratio reflects the permeability of the compounds from the plasma to the brain, which may be restricted primarily by the blood brain barrier, and ranges from 0 (no permeability) to 1 (total permeability).16 These ratios indicate that rosmarinic acid has the ability to pass to the brain, but the permeability is low. Rosmarinic acid diffuses slowly to the brain, but it is retained there longer than in the plasma, where a higher decrease was observed from 30 to 60 min. Brains of rats to which standard rosmarinic acid was administered, (results not shown) showed the same concentration of rosmarinic acid as when rosmarinic acid was given within the extract, leading to the conclusion that the other extract compounds do not interfere with the permeability of rosmarinic acid in the blood-brain barrier, in opposition to the gut barrier where a interference of the other extract compounds was observed in the permeability of rosmarinic acid. Thirty minutes after the extract administration the rat brain showed an inhibition in acetylcholinesterase activity of 29.0  2.3%, and after 60 min an inhibition of 24.9  3.7% (Table 2), in comparison with the control rats, where the activity was 0.145  0.012 nmol min1 mg1. Brains of rats where standard rosmarinic acid was administered showed the same concentration of rosmarinic acid as that detected when the extract was administered, but demonstrated to have less acetylcholinesterase inhibition (10.7  5.0% after 30 min). This confirms the inhibition of AChE by the other extract components, although they were not detected by HPLC. The percentages of acetylcholinesterase inhibition achieved were of the same magnitude of the ones reported to galanthamine in the rat model, however the amounts of interaperitoneal injection of galanthamine were lower: 3 mg kg1 for 10% inhibition17 and 10 mg kg1 for 28% inhibition.7 Higher inhibitions can be obtained with lower amounts of donepezil, 39% with 3 mg kg1,17 however this inhibitor may present a higher incidence of adverse effects in high amounts. The dosage/activity in humans for galanthamine is 16–24 mg day1 to 30–40% brain acetylcholinesterase inhibition,18 and for donepezil is 10 mg day1 to 19–27% inhibition.19 As there is an interest in decreasing the adverse This journal is ª The Royal Society of Chemistry 2011

peripheral effects of acetylcholinesterase inhibition, mostly related to gastrointestinal and hepatic disturbances, herbal teas may offer an alternative for mild treatments of Alzheimer’s disease. P. barbatus water extracts are traditionally prepared as decoctions (as in the present report) and taken by people and those secondary effects were not reported.2 In fact, the use of this plant extract to treat gastrointestinal and hepatic conditions is widely reported.2 Rosmarinic acid when administered in low doses seems to act as an axiolytic-like compound, only when administered in high doses it seem to act on the peripheral nervous system.20 Several recent reports showed that flavonoids, such as quercetin and its metabolites, have the ability to reach the brain.21 Coleta and co-workers22 demonstrated that intragastrically-administered luteolin, or its metabolites, should reach the brain, causing anxiolytic-like effects. Gujinski and co-workers23 reported that ethanolic extracts from Melissa officinalis, a Lamiaceae species, and its main component rosmarinic acid, when administered to rats produced dose-related antinociception in several models of chemical pain, through mechanisms that involved cholinergic systems. Other studies also show that rosmarinic acid, when administered through intraperitoneal injection (2–8 mg kg1), induced neurobehavioral changes in rats.20 Although rosmarinic acid in the brain was not quantified in those studies, its presence in the brain was suggested by the activities it exerted in vivo. The bioavailability of the currently used acetylcholinesterase inhibitors is highly variable, depending mostly to the structure of the compounds, their metabolization and elimination, and their ability to permeate the intestinal and blood-brain barriers.24 Their time of action also depends on the mode of acetylcholinesterase inhibition. Donepezil, for instance, has a peak plasma level 4 h after administration and a half-life of over 70 h, while tacrine shows low bioavailability when taken orally and has a half-life in plasma of 1.4 h.24 However, tacrine reaches a brain concentration that is 10-fold that of plasma, its dosage and brain bioavailability are not proportional, and so higher doses and multiple dosing are used to increase bioavailability and the half-life.24 In the present case rosmarinic acid and the other components of the extract also do not seem to follow a direct relation between dose and response. First, because the intestinal absorption and metabolization of rosmarinic acid is influenced by the presence of the other extract compounds. Also, although the concentration of rosmarinic acid was always much lower in brain than in the plasma, the relationship between plasma and brain rosmarinic acid concentrations does not seem to be linear, as a decrease of more than 50% in plasma rosmarinic acid concentration corresponded just to a slight decrease in the brain (Table1). However, the amount of detected rosmarinic acid and the activity seem to be related, as the decrease in the brain acethylcholinesterase inhibition was similar to the decrease in the content in rosmarinic acid. As the phenolic compounds from the plant extract seem to act in the brain in very low concentrations, and their amount in brain has less fluctuations than the amount in the plasma, taking a large volume of herbal tea during a long amount of time, and several times per day, as it is usually taken, may be the correct way of increasing its effects. Apart from the beneficial effect of increasing the acetylcholinemediated neuronal tansmission, the treatment of Alzheimer’s disease with acetylcholinesterase inhibitors also seems to protect free radical toxicity, b-amyloid injury and to attenuate cytokine Food Funct., 2011, 2, 130–136 | 135

View Online

release from microglial cells.25 Apart from this ‘‘cholinergic antiinflamatory pathway’’, rosmarinic acid is also a well-known antioxidant and free radical scavenger.3 As far as we know, this is the first report confirming the neurologic activity of rosmarinic acid by the quantification its amount in the brain.

Downloaded on 09 February 2011 Published on 13 December 2010 on http://pubs.rsc.org | doi:10.1039/C0FO00070A

Conclusion In this work it was demonstrated that the rosmarinic acid, present in herbal teas, may, in fact, cross the intestinal barrier, as well as the blood brain barrier, and be detected in the brain. There, it inhibits the enzyme AChE. The metabolization and bioavailability of the herbal tea components is different from the administration of pure compounds.

11

12 13 14

15

Acknowledgements The authors thank Fundac¸a˜o para a Ci^encia e Tecnologia, FCT, for financial support (REDE/1501/REM/2005). Pedro L. V. Fale and Paulo J. A. Madeira thank FCT for the PhD Grant SFRH/ BD/37547/2007 and SFRH/BD/27614/2006, respectively.

References 1 S. S. Percival, R. E. Turner. Applications of Herbs to Functional Foods. In: Handbook of Nutraceuticals and Functional Foods, 2nd Ed. (Edited by R. E. C. Wildman), CRC Press, 2007, pp 269–284. 2 C. W. Lukhoba, M. S. J. Simmond and A. J. Paton, Plectranthus: A review of ethnobotanical uses, J. Ethnopharmacol., 2006, 103, 1–24. 3 P. L. Fale, C. Borges, P. J. A. Madeira, L. Ascensa˜o, M. E. M. Ara ujo, M. H. Flor^encio and M. L. M. Serralheiro, Rosmarinic acid, scutellarein 40 -methyl ether 7-O-glucuronide and (16S)-coleon E are the main compounds responsible for the antiacetylcholinesterase and antioxidant activity in herbal tea of Plectranthus barbatus (‘‘falso boldo’’), Food Chem., 2009, 114, 798– 805. 4 S. Porfirio, P. L. V. Fale, P. J. A. Madeira, H. Flor^encio, L. Ascensa˜o and M. L. M. Serralheiro, Antiacetylcholinesterase and antioxidant activities of Plectranthus barbatus tea, after in vitro gastrointestinal metabolism, Food Chem., 2010, 122, 798–805. 5 M. Heinrich and H. L. Teoh, Galanthamine from snowdrop – the development of a modern drug against Alzheimer’s disease from local Caucasian knowledge, J. Ethnopharmacol., 2004, 92, 147–162. 6 A. Gomes, E. Fernandes, J. F. C. Lima, L. Mira and M. L. Corvo, Molecular mechanisms of anti-inflammatory activity mediated flavonoids, Curr. Med. Chem., 2008, 15, 1586–1605. 7 S. Chattipakorn, A. Pongpanparadorn, W. Pratchayasakul, A. Pongchaidacha, K. Ingkaninan and N. Chattipakorn, Tabernaemontana divaricata extract inhibits neuronal acetylcholinesterase activity in rats, J. Ethnopharmacol., 2007, 110, 61–68. 8 G. C. Justino, M. R. Santos, S. Canario, C. Borges, M. H. Flor^encio and L. Mira, Plasma quercetin metabolites: structure–antioxidant activity relationships, Arch. Biochem. Biophys., 2004, 432, 109–121. 9 O. H. Lowry, N. J. Rosebrough, A. L. Farr and R. J. Randall, Protein measurement with the Folin phenol reagent, J. Biol. Chem., 1951, 193, 265–275. 10 S. Baba, N. Osakabe, M. Natsume and J. Terao, Orally administered rosmarinic acid is present as the conjugated and/or methylated forms

136 | Food Funct., 2011, 2, 130–136

16

17

18

19

20 21

22 23

24 25

in plasma, and is degraded and metabolized to conjugated forms of caffeic acid, ferulic acid and m-coumaric acid, Life Sci., 2004, 75, 165–178. R. J. Probst, J. M. Lim, D. N. Bird, G. L. Pole, A. K. Sato and J. R. Claybaugh, Gender differences in the blood volume of conscious Sprague-Dawley rats, J. Am. Assoc. Lab. Anim. Sci., 2006, 45, 49–52. Y. Konishi, Y. Hitomi, M. Yoshida and E. Yoshioka, Pharmacokinetic Study of Caffeic and Rosmarinic Acids in Rats after Oral Administration, J. Agric. Food Chem., 2005, 53, 4740–4746. T. Nakazawa and K. Ohsawa, Metabolism of rosmarinic acid in rats, J. Nat. Prod., 1998, 61, 993–996. K. A. O’Leary, A. J. Day, P. W. Needs, F. A. Mellon, N. M. O’Brien and G. Williamson, Metabolism of quercetin-7- and quercetin-3glucuronides by an in vitro hepatic model: the role of human bglucuronidase, sulfotransferase, catechol-O-methyltransferase and multi-resistant protein 2 (MRP2) in flavonoid metabolism, Biochem. Pharmacol., 2003, 65, 479–491. K. Shimoi, H. Okada, M. Furugori, T. Goda, S. Takase, M. Suzuki, Y. Hara, H. Yamamoto and N. Kinae, Intestinal absorption of luteolin and luteolin 7-O-beta-glucoside in rats and humans, FEBS Lett., 1998, 438, 220–224. G. Z. Zheng, P. Bhatia, T. Kolasa, M. Patel, O. F. El Kouhen, R. Chang, M. E. Uchic, L. Miller, S. Baker, S. G. Lehto, P. Honore, J. M. Wetter, K. C. Marsh, R. B. Moreland, J. D. Brioni and A. O. Stewart, Correlation between brain/plasma ratios and efficacy in neuropathic pain models of selective metabotropic glutamate receptor 1 antagonists, Bioorg. Med. Chem. Lett., 2006, 16, 4936–4940. H. Geerts, P.-O. Guillaumat, C. Grantham, W. Bode, K. Anciaux and S. Sachak, Brain levels and acetylcholinesterase inhibition with galantamine and donepezil in rats, mice, and rabbits, Brain Res., 2005, 1033, 186–193. A. Kadir, T. Darreh-Shori, O. Almkvist, A. Wall, M. Grut, B. Strandberg, A. Ringheim, B. Eriksson, G. Blomquist, B. L angstr€ om and A. Nordberg, PET imaging of the in vivo brain acetylcholinesterase activity and nicotine binding in galantaminetreated patients with AD, Neurobiol. Aging, 2008, 29, 1204–1217. N. I. Bohnen, D. I. Kaufer, R. Hendrickson, L. S. Ivanco, B. J. Lopresti, R. A. Koeppe, C. C. Meltzer, G. Constantine, J. G. Davis, C. A. Mathis, S. T. DeKosky and R. Y. Moore, Degree of inhibition of cortical acetylcholinesterase activity and cognitive effects by donepezil treatment in Alzheimer’s disease, J. Neurol., Neurosurg. Psychiatry, 2005, 76, 315–319. P. Pereira, D. Tysca, P. Oliveira, L. F. S. Brum, J. N. Picada and P. Ardenghi, Neurobehavioral and genotoxic aspects of rosmarinic acid, Pharmacol. Res., 2005, 52, 199–203. P. Huebbe, A. E. Wagner, C. Boesch-Saadatmandi, F. Sellmer, S. Wolffram and G. Rimbach, Effect of dietary quercetin on brain quercetin levels and the expression of antioxidant and Alzheimer’s disease relevant genes in mice, Pharmacol. Res., 2010, 61, 242–246. M. Coleta, M. G. Camposa, M. D. Cotrim, M. C. T. Lima and A. P. Cunha, Assessment of luteolin (3_,4_,5,7-tetrahydroxyflavone) neuropharmacological activity, Behav. Brain Res., 2008, 189, 75–82. G. Guginski, A. P. Luiz, M. D. Silva, M. Massaro, D. F. Martins, J. Chaves, R. D. Mattos, V. M. Ferreira, J. B. Calixto and A. R. Santos, Mechanisms involved in the antinociception caused by ethanolic extract obtained from the leaves of Melissa officinalis (lemon balm) in mice, Pharmacol., Biochem. Behav., 2009, 93, 10–16. B. M. McGleenon, K. B. Dynan and A. P. Passmore, Acetylcholinesterase inhibitors in Alzheimer’s disease, Br. J. Clin. Pharmacol., 2001, 48, 471–480. N. Tabet, Acetylcholinesterase inhibitors for Alzheimer’s disease: anti-inflammatories in acetylcholine clothing!, Age Ageing, 2006, 35, 336–338.

This journal is ª The Royal Society of Chemistry 2011

View Online

Food & Function

C

Dynamic Article Links <

Cite this: Food Funct., 2011, 2, 137

PAPER

www.rsc.org/foodfunction

Interaction of dietary flavonoids with gamma-globulin: molecular property-binding affinity relationship aspect

Downloaded on 09 February 2011 Published on 12 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00092B

Fan Yang, Yaru Zhao, Guoyin Kai and Jianbo Xiao* Received 22nd July 2010, Accepted 13th December 2010 DOI: 10.1039/c0fo00092b The molecular property-affinity relationship of dietary flavonoids for bovine gamma-globulin (g-globulin) was investigated by fluorescence titration analysis. The quenching effects of flavonoids on g-globulin fluorescence depended on the structures of flavonoids. The magnitudes of binding constants between flavonoids and g-globulin were within the range of 103–105 L mol1. These data were much smaller than the affinities between flavonoids and purified bovine and human serum albumins. The affinities of flavonoids for g-globulin were strongly influenced by the structural differences of the compounds under study. The affinities for g-globulin decreased with increasing partition coefficients and increased with increasing hydrogen bond acceptor numbers of flavonoids, which suggested that the binding interaction was mainly caused by hydrogen bond forces.

Introduction Dietary flavonoids are most important polyphenols in plant foods.1–3 They are of great interest for their bioactivities, which are basically related to their antioxidative properties.4,5 The different structures of flavonoids come from various patterns of substitution through hydroxylation, methoxylation, sulfonation, acylation, prenylation, or glycosylation.6 The structural differences significantly affect their absorption, metabolism, and bioactivities in vivo.7–9 Flavonoids in plasma are bound to plasma proteins such as human serum albumin (HSA), a1-acid glycoprotein (AAG), lipoproteins and globulins, to some degree. The flavonoidsprotein interaction is reversible in that the flavonoids-complex can dissociate and release the free flavonoids. According to the free drug hypothesis,10 the drug distribution within the body is generally held to be driven by the free concentration of unbound drug in the circulating plasma. Gamma-globulin (g-globulin) is a fraction from liquid human serum, containing the antibodies (primarily IgG) of normal adults. Gamma-globulin is capable of binding an extraordinarily diverse range of metabolites, drug, organic compounds and relevant antigens.11 Fluorescence spectroscopy is an appropriate method to determine the interaction between drugs and proteins.11–13 By means of analysis of the fluorescence parameters, much information concerning the structural changes in serum albumins can be obtained. Recently, the interactions between flavonoids with immunoglobulin have attracted great interest.14,15 Few reports, however,

Department of Biology, College of Life & Environment Science, Shanghai Normal University, 100 Guilin Rd, Shanghai, 200234, PR China. E-mail: [email protected]; Fax: +86 (021)64321291; Tel: +86 13611600163

This journal is ª The Royal Society of Chemistry 2011

have focused on the structure-affinity relationship of flavonoids on the affinities for g-globulin. The present work concerns the relationship between the molecular properties of dietary flavonoids and their affinities for g-globulin. Thirty-five flavonoids (Table 1) were studied.

Materials and methods Apparatus and reagents The fluorescence spectra were recorded on a JASCO FP-6500 fluorometer (Tokyo, Japan). g-Globulin (99%, lyophilized powder) and 7-hydroxyflavone (99.5%) was purchased from Sigma Co. (MO, USA). Biochanin A, genistein, apigenin, puerarin, catechin (C), epicatechin (EC), and luteolin (99.0%) were purchased from Aladin Co. Ltd. (Shanghai, China). Flavone, chrysin, and baicalein (99.5%) were obtained commercially from Wako Pure Chemical Industries (Osaka, Japan). Kaempferide, kaempferol, tangeretin, nobiletin, quercetin, myricetin, daidzein, baicalin, hispidulin, kaempferitrin, galangin, fisetin, genistin, dihydromyricetin, (-)-epigallocatechin (EGC), (-)-epicatechin gallate (ECG), (-)-epigallocatechin gallate (EGCG), gallocatechin gallate (GCG), tectorigenin, and formononetin (>98.0%) were obtained commercially from Shanghai Tauto Biotech Co. Ltd (Shanghai, China). The working solutions of the flavonoids (1.0  103 mol L1) were prepared by dissolving each flavonoid with methanol. Tris-HCl buffer (0.20 M, pH 7.4) containing 0.10 mol L1 NaCl was selected to keep the pH value and maintain the ionic strength of the solution. The working solution of g-globulin (1.0  105 mol L1) was prepared with tris-HCl buffer and stored in refrigerator prior to use. All other reagents and solvents were of analytical grade and all aqueous solutions were prepared using newly double-distilled water. Food Funct., 2011, 2, 137–141 | 137

View Online

Fluorescence spectra

Downloaded on 09 February 2011 Published on 12 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00092B

The fluorescence spectra were recorded in the wavelength range of 310–450 nm upon excitation at 295 nm when g-globulin samples were titrated with flavonoids. In each titration, the fluorescence spectrum was collected with the concentrations of gglobulin at 1.0  105 mol L1. Each fluorescence intensity determination was repeated and found to be reproducible within experimental errors. The binding experiments for determination of binding constants for protein were repeated three times. The experimental errors were less than 4.0%.

Results and discussion Effect of flavonoids on g-globulin fluorescence As representative examples, the fluorescence spectra of g-globulin after addition of apigenin, galangin, formononetin, and genistein were shown in Fig. 1 (the fluorescence spectra of g-globulin quenched by other flavonoids are not given here). Except for EC, EGC, and C, all flavonoids tested can quench the fluorescence of g-globulin remarkably with increasing concentration of flavonoids. There are no obvious shifts of the maximum lem of g-globulin fluorescence for flavonoids tested, which is different with the data of recent similar studies for bovine serum albumin.16–19 The quenching percentages (((F0  F)/F0)  100%) of g-globulin fluorescence emission at 332.8 nm for all flavonoids at 8.0 mmol L1 were shown in Fig. 2. The quenching percentages were determined as: EC < catechin < EGC < genistin < dadzein < formononetin < EGCG < GCG < puerarin < narirutin < dihydromyricetin < ECG < 7ohflavone < naringin < galangin < rutin < naringenin < biochanin A < fisetin < myricetin < apigenin < kaempferide < genistein < tectorigenin < flavone;

< baicalein < kaempferitrin < chrysin < hispidulin < kaempferol < quercetin < luteolin < baicalin < tangeretin < nobiletin. These results indicated that the quenching effects of flavonoids on g-globulin fluorescence depended on the structures of the flavonoids. Some of the structural elements that influence the quenching effects of flavonoids for g-globulin are the following: (i) one or more hydroxyl groups in the rings A and B (e.g. 30 ,40 dihydroxylatedcatechol group) of flavonoids enhanced the quenching effects on g-globulin fluorescence. (ii) presence or absence of an unsaturated 2,3-bond in conjugation with a 4-carbonyl group, characteristic of flavonols structure, has been associated with stronger quenching effects on g-globulin fluorescence; (iii) glycosylation of flavonoids affected the quenching effects on g-globulin fluorescence depending on the conjugation site and the class of sugar moiety; (iv) galloylated catechins exhibited higher quenching effects on g-globulin fluorescence than non-galloylated forms. Quenching constants Fluorescence quenching was described by the Stern–Volmer equation:14–20 F0/F ¼ 1 + Kqs0 [Q] ¼ 1 + KSV [Q]

(1)

where F0 and F represent the fluorescence intensities of g-globulin in the absence and in the presence of flavonoids, Kq is the quenching rate constant, KSV is the dynamic quenching constant, s0 is the average lifetime, and [Q] is the concentration of flavonoids. Fig. 3 showed the Stern–Volmer plots for g-globulin fluorescence quenched by apigenin, galangin, formononetin, and genistein. As seen from Fig. 3, the Stern–Volmer plots for genistein are linear. A linear Stern–Volmer plot is generally indicative of

Fig. 1 The quenching effects of apigenin (A), galangin (B), formononetin (C), and genistein (D) on g-globulin fluorescence spectra at 300.15 K. lex ¼ 280 nm; g-globulin, 10.00 mmol L1; a–i: 0.00, 1.00, 2.00.. 8.00 (106 mol L1) of flavonoids.

138 | Food Funct., 2011, 2, 137–141

This journal is ª The Royal Society of Chemistry 2011

View Online

which demonstrated by the fact that the Stern–Volmer plots slightly deviated from linearity toward the y-axis at higher flavonoid concentrations. In the linear range of Stern–Volmer regression curve, the average quenching constants (KSV) for formononetin, galangin, apigenin and genistein (having the lowest quenching effect, figure not shown) at 300.15 K were determined as 2.12, 2.52, 2.99 and 3.69  104 mol1, respectively. The binding constants (Ka) and the number of binding sites (n)

Downloaded on 09 February 2011 Published on 12 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00092B

The binding constants were calculated according to the doublelogarithm equation:16–20 lg[(F0  F)/F] ¼ lgKa + nlg[Q]

Fig. 2 The quenching percentages ((F0  F/F0)  100%) of g-globulin fluorescence emission at 340 nm for all flavonoids at 8.0 mmol L1. The quenching percentages were determined as increasing follow: 1, EC; 2, catechin; 3, EGC; 4, genistin; 5, dadzein; 6, formononetin; 7, EGCG; 8, GCG; 9, puerarin; 10, narirutin; 11, dihydromyricetin; 12, ECG; 13, 7ohflavone; 14, naringin; 15, galangin; 16, rutin; 17, naringenin; 18, biochanin A; 19, fisetin; 20, myricetin; 21, apigenin; 22, kaempferide; 23, genistein; 24, tectorigenin; 25, flavone; 26, baicalein; 27, kaempferitrin; 28, chrysin; 29, hispidulin; 30, kaempferol; 31, quercetin; 32, luteolin; 33, baicalin; 34, tangeretin; 35, nobiletin.

a single class of fluorophores, all equally accessible to the quencher. In many instances, the fluorophore can be quenched both by collision and by complex formation with the same quencher. In this case, the Stern–Volmer plot exhibits an upward curvature, concave towards the y-axis at high [Q], and F0/F is related to [Q] by the modified form of the Stern–Volmer equation: F0/F ¼ (1 + KD[Q]) (1 + KS[Q]) where KD and KS are the dynamic and static quenching constants, respectively. It was found that both dynamic and static quenching were involved for apigenin and galangin on g-globulin fluorescence,

Fig. 3 The Stern–Volmer plots for g-globulin fluorescence quenching by flavonoids at 300.15 K.

This journal is ª The Royal Society of Chemistry 2011

(2)

where F0 and F represent the fluorescence intensities of g-globulin in the absence and in the presence of flavonoids, Ka is the binding constant, n is the number of binding sites per g-globulin, and [Q] is the concentration of free flavonoids. Because the free concentration of drug is usually much higher than the bound concentration of drug, the double-logarithm equation used total flavonoid concentration instead of free concentration. Fig. 4 showed the typical double-logarithm curves of flavonoids quenching g-globulin fluorescence at 300.15 K. Table 1 summarized the results and correspondingly calculated results according to eqn (2). The values of lgKa are proportional to the number of binding sites (n) (Fig. 5), which indicates that eqn (2) used here is suitable to study the interaction between flavonoids and g-globulin. The magnitudes of apparent binding constants for g-globulin were almost in the range of 103–105 M1, which was similar to recent report for g-globulin by He et al.12 However, these data were much smaller than the affinities of flavonoids for BSA and HSA from our previous reports (104–108 M1).16–19 Structure-affinity relationship of flavonoids- g-globulin interactions As seen from Table 1, some of the structural information that affected the flavonoids-g-globulin binding affinities is summarized as: (i) one or more hydroxyl groups in the rings A and B enhanced the binding affinity for g-globulin. (ii) presence of an

Fig. 4 Double-logarithm curves of flavonoids quenching g-globulin fluorescence at 300.15 K.

Food Funct., 2011, 2, 137–141 | 139

View Online

Downloaded on 09 February 2011 Published on 12 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00092B

unsaturated 2,3-bond in conjugation with a 4-carbonyl group is associated with stronger affinity for g-globulin;(iii) glycosylation affected the affinities for g-globulin depending on the conjugation site and the class of sugar moiety; (iv) methylation of hydroxyl groups on flavonoids weakened the affinities for gglobulin; (v) galloylated catechins exhibited higher binding affinities for g-globulin than non-galloylated. We will analyze the structure-affinity relationship of flavonoids for g-globulin in detailed in future.

Relationship of partition coefficient and the affinity for gglobulin The lipophilicity of the compounds under study was assessed by their partition coefficient values (XLogP3) according to PubChem Public Chemical Database.21 There is a relationship between the XlogP3 values and lgKa values for flavonoids (Fig. 6). The linear regression equation using the Origin 7.5 software was XlogP3 ¼ 5.5864  0.8704lgKa (R ¼ 0.2920). The affinities of flavonoids for g-globulin decreased with increasing partition coefficient. From this point, the binding interaction between flavonoids and g-globulin was not mainly caused by hydrophobic forces. These results also illustrated that the methylation of hydroxyl group in flavonoids weakened the binding affinities for g-globulin. As shown in Table 1, the

Table 1 The affinities of flavonoids for g-globulin Flavonoids

lgka

n

Flavone 7-Ohflavone Chrysin Baicalein Baicalin Apigenin Luteolin Hispidulin Tangeretin Nobiletin Kaempferide Kaempferol Kaempferitrin Quercetin Myricetin Galangin Fisetin Rutin Daidzein Formononetin Genistein Genistin Biochanin A Tectorigenin Puerarin Naringenin Naringin Narirutin Dihydromyricetin GCG EGCG ECG EC EGC C

4.26 4.31 4.38 4.73 4.30 4.32 4.84 3.99 5.00 4.79 4.32 4.40 4.63 4.47 4.75 3.86 4.13 4.92 4.85 3.28 4.93 4.49 4.11 4.17 4.77 3.76 4.50 4.42 4.17 3.13 4.14 4.32 — — —

0.926 0.973 0.954 1.022 0.917 0.966 1.021 0.869 1.026 0.983 0.965 0.948 1.005 0.957 1.041 0.888 0.926 1.083 1.110 0.797 1.073 1.051 0.927 0.920 1.083 0.869 1.007 0.997 0.952 0.767 0.998 0.978 — — —

140 | Food Funct., 2011, 2, 137–141

Fig. 5 The relationship between the affinities (lgKa) and the number of binding sites (n) between flavonoids and g-globulin.

methylation of hydroxyl groups on flavonoids weakened the affinities for g-globulin. To further investigate whether or not the hydrogen bond force plays an important role in binding flavonoids to g-globulin, the relationships of the hydrogen bond acceptor/donor numbers (N, data were from ref. 21) of flavonoids with the affinities for gglobulin were shown in Fig. 7. The affinities for g-globulin obviously increased with increasing hydrogen bond acceptor numbers of flavonoids. These results illustrated that the hydrogen bond force is the main force to bind flavonoids to gglobulin. Relationship of topological polar surface area and the affinity for g-globulin The topological polar surface area (TPSA) is defined as the sum of surfaces of polar atoms in a molecule. TPSA has been shown to be a very good descriptor characterizing drug absorption, including intestinal absorption, bioavailability, Caco-2

Fig. 6 Relationship of apparent binding constants (lgKa) with partition coefficient (XLogP3) of flavonoids. The partition coefficient values (XLogP3) were taken from PubChem Public Chemical Database.21

This journal is ª The Royal Society of Chemistry 2011

View Online

Downloaded on 09 February 2011 Published on 12 January 2011 on http://pubs.rsc.org | doi:10.1039/C0FO00092B

Acknowledgements The authors are grateful for financial sponsored by Natural Science Foundation of Shanghai (10ZR1421700), ‘‘Chen Guang’’ project supported by Shanghai Municipal Education Commission and Shanghai Education Development Foundation (09CG46), National Transgenic Organism New Variety Culture Key Project (2009ZX08012-002B), National Natural Science Fund (30900110), Project from Ministry of Science and Technology of China (NC2010AE0075, NC2010AE0372), Leading Academic Discipline Project of Shanghai Municipal Education Commission (J50401), Innovation Program of Shanghai Municipal Education Commission (10YZ68), and Program of Shanghai Normal University (SK201006).

Fig. 7 Relationships of the hydrogen bond acceptor/donor number of flavonoids (N) with the affinities for g-globulin. The hydrogen bond acceptor/donor numbers were taken from PubChem Public Chemical Database.21

Fig. 8 Relationship of TPSA with the affinities of flavonoids for g-globulin. The TPSA values were obtained online (www.molinspiration.com/cgi-bin/ properties).

permeability and blood-brain barrier penetration. The compounds with high TPSA are transported while those with low TPSA are not. A strong correlation between TPSA and transport properties (Km) was also found. In our present study, the relationship between TPSA and the binding affinity of flavonoids for g-globulin was studied. The TPSA values were obtained from PubChem Public Chemical Database.21 It was found that there is no direct relationship between the TPSA values and lgKa values for flavonoids (Fig. 8). However, TPSA values were found to decrease with the increasing lgKa flavonoids for HSA.19

This journal is ª The Royal Society of Chemistry 2011

References 1 D. Ghosh and A. Scheepens, Mol. Nutr. Food Res., 2009, 53, 322–331. 2 M. Rosenblat, N. Volkova, J. Attias, R. Mahamid and M. Aviram, Food Funct., 2010, 1, 99–109. 3 M. Ueda, T. Furuyashiki, K. Yamada, Y. Aoki, I. Sakane, I. Fukuda, K. Yoshida and H. Ashida, Food Funct., 2010, 1, 167–173. 4 M. R. Ahn, K. Kunimasa, S. Kumazawa, T. Nakayama, K. Kaji, Y. Uto, H. Hori, H. Nagasawa and T. Ohta, Mol. Nutr. Food Res., 2009, 53, 643–651. 5 N. Krafczyk, F. Woyand and M. A. Glomb, Mol. Nutr. Food Res., 2009, 53, 635–642. 6 M. H. Pan, C. S. Lai and C. T. Ho, Food Funct., 2010, 1, 15–31. 7 W. Brand, B. Padilla, P. J. van Bladeren, G. Williamson and I. M. C. M. Rietjens, Mol. Nutr. Food Res., 2010, 54, 851–860. 8 N. Bando, N. Muraki, K. Murota, J. Terao and R. Yamanishi, Mol. Nutr. Food Res., 2010, 54, S261–S267. 9 M. Monagas, M. Urpi-Sarda, F. Sanchez-Patan, R. Llorach, I. Garrido, C. G omez-Cordoves, C. Andres-Lacueva and B. Bartolome, Food Funct., 2010, 1, 233–253. 10 I. Buxton, Pharmacokinetics and pharmacodynamics: the dynamics of drug absorption, distribution, action and elimination, in Goodman & Gilman’s The Pharmacological Basis of Therapeutics ed. L. Brunton, pp 1–39, 2005, McGraw-Hill, Chicago. 11 L. Ying, W. Chao and L. Guanghua, J. Mol. Struct., 2010, 980, 108– 113. 12 J. B. Xiao, T. T. Chen, L. S. Chen, H. Cao, F. Yang and Y. L. Bai, J. Inorg. Biochem., 2010, 104, 1148–1155. 13 J. B. Xiao, L. S. Chen, F. Yang, C. X. Liu and Y. L. Bai, J. Hazard. Mater., 2010, 82, 696–703. 14 W. He, Z. Hu, X. Yao and G. Chen, Aata Chim. Sin., 2010, 68, 679– 688. 15 Y. Liu, W. He, W. Gao, Z. Hu and X. Chen, Int. J. Biol. Macromol., 2005, 37, 1–11. 16 J. B. Xiao, H. Cao, Y. F. Wang, K. Yamamoto and X. L. Wei, Mol. Nutr. Food Res., 2010, 54, S253–S260. 17 J. B. Xiao, M. Suzuki, X. Y. Jiang, X. Q. Chen, K. Yamamoto, F. L. Ren and M. Xu, J. Agric. Food Chem., 2008, 56, 2350–2356. 18 J. B. Xiao, H. Cao, Y. F. Wang, J. Y. Zhao and X. L. Wei, J. Agric. Food Chem., 2009, 57, 6642–6648. 19 J. B. Xiao, T. T. Chen, H. Cao, L. S. Chen and F. Yang, Mol. Nutr. Food Res., 2010, DOI: 10.1002/mnfr.201000208. 20 J. R. Lakowicz, Principles of fluorescence spectroscopy, 2nd ed., Kluwer Academic/Plenum Publishers, New York, 1999. 21 PubChem Public Chemical Database. http://pubchem.ncbi.nlm.nih.gov/.

Food Funct., 2011, 2, 137–141 | 141

View Online

Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90004H

Food & Function

The RSC Drug Discovery Series

Linking the chemistry and physics of food with health and nutrition

Emerging Drugs and Targets for Alzheimer’s Disease Edited by Ana Martinez | Medicinal Chemistry Institute–CSIC, Spain ISBN: 9781849730457 Price: £220.00

www.rsc.org/foodfunction

A comprehensive 2-volume set that collects some of the most outstanding examples of new drugs currently in pharmaceutical development or new targets currently under the validation process that will reach the Alzheimer’s market in the next few years as disease-modifying therapeutics.

Volume 2 | Number 2 | February 2011 | Pages 93–144

Metabolism, Pharmacokinetics and Toxicity of Functional Groups: Impact of Chemical Building Blocks on ADMET Edited by Dennis A Smith | Pfizer Global R & D, UK ISBN: 9781849730167 Price: £144.99 Written by medicinal chemists and ADMET scientists with a combined experience of 300 years this aid to discovering drugs provides detailed coverage on absorption, distribution, metabolism, excretion and toxicity issues associated with new drugs.

The RSC Drug Discovery Series is a suite of professional reference books that will encourage learning in a range of different topics and provide understanding to scientists working outside of their own areas of expertise. The competitive advantage o the series is that of it w wililll fo follllow ow aan n id idea ea through to totality with an emphasis on learning and critical evaluation.

Accounts in Drug Discovery Case Studies in Medicinal Chemistry

New Frontiers in Chemical Biology Enabling Drug Discovery

Editor-in-Chief: Professor David Thurston London School of Pharmacy UK

Edited by Joel Barrish, Percy Carter, Robert Zahler, Peter Cheng Bristol-Myers-Squibb, USA ISBN: 9781849731263 Price: £132.99

Edited by Mark Bunnage Pfizer Global R & D, UK ISBN: 9781849731256 Price: £132.99

Series Editors: Dr David Fox Pfizer Global R & D UK

This book describes recent case studies in medicinal med dicinal chemistry emphasis with a particular particulaar em emph ph has asis is o on n how inevitable h ho ow w th the inev evit itab it a le problems that arise project aris ar isee during any nyy p rojectt can c be ssurmounted su rm mou ount nted ed or overcome. overcom me.

Highlights new frontiers in chemical biology and describes their impact potential in the fiel field aand an d future fu ld of drug d dr ug discovery. disco cove very ve ry. ry

Professor Ana Martinez M icinal Chemistry Institute–CSIC Med Spain Sp

New for 2011 Pharmaceutical Process Development: Current Chemical and Engineering Challenges

Animal Models for Neurodegenerative Disease Price: £132.99 | ISBN 9781849731843

Neurodegeneration: Metallostasis and Proteostasis Price: £121.99 | ISBN 9781849730501

Price: £121.99 | ISBN 9781849731461 This book is aimed at both graduates and postgraduates interested in a career in the pharmaceutical industry and informs them about the breadth of the work carried out in chemical research and development departments. It is also of value to academics wishing to advise students on the merits of careers in chemical development versus discovery.

This book provides up-to-date information on the use of transgenic mouse models in the study of neurodegenerative disorders such as Alzheimer’s and Huntington’s disease The editors have extensive knowledge and experience in this field and the book is aimed at undergraduates, postgraduates and academics.

This exemplary new book provides an up-date perspective on the latest developments in this fast moving field. Traditional views concerning the relationship between the physiopathological cycles of copper, zinc, iron, aluminium and the evolution of life, are compared with emerging ideas in the neuroscience of metal ions. Essential reading for neuroscientists working in both industry and academia.

Professor Salvatore Guccione University of Catania Italy

Dr David Rotellaa Northe t astern Universiity th USA A Advisor to the Board: Pro Pr P ofes fessor sor Ro Robin R bin b Ga G nel nellin lin Uniiver ersit siity College Londo sit ndon d n UK UK

Whilst Wh Whi Whil st every every eff effort ort was made to en ensure nsu urre tthese hese h ese prices p pric i es es w were e correct ere corr or ect at the the time time of o going goin o to pre oing press, allll information informat info rm ion iss ssubject rmat ubject ubje ct to to ch change hange ang w wi without witho hou out notice. not notice ce.

To o order order any of these titles tiitless please please e eemail mail b [email protected] [email protected] o orr vvisit isit tthe he w website! ebsite! ISSN 2042-6496

www.rsc.org/drugdiscovery Registered Charity Number 207890

COVER ARTICLE Joshua D. Lambert et al. (−)-Epigallocatechin-3-gallate increases the expression of genes related to fat oxidation in the skeletal muscle of high fat-fed mice

View Online

Food & Function

EICC-1: First EuCheMS Inorganic Chemistry Conference

Downloaded on 09 February 2011 Published on 09 February 2011 on http://pubs.rsc.org | doi:10.1039/C1FO90004H

11 - 14 April 2011 University of Manchester, UK

Linking the chemistry and physics of food with health and nutrition

The Dalton Division of the RSC is joining together with the EuCheMS Inorganic Division (EID) to host the first edition in a new European conference series in Inorganic Chemistry.

www.rsc.org/foodfunction

Volume 2 | Number 2 | February 2011 | Pages 93–144

Inorganic Chemistry is a buoyant subject area with major developments being seen in all branches of the subject and common themes emerging; this timely conference arranged across parallel sessions brings all these themes together.

Themes and Plenary Speakers Supramolecular and co-ordination chemistry Paul Beer University of Oxford, UK Organometallic and catalysis Sylviane Sabo-Etienne Laboratoire de Chimie de Coordination du CNRS, Toulouse, France Reaction mechanisms Pablo Espinet University of Valladolid, Spain Inorganic materials Reshef Tenne Weizmann Institute of Science, Israel

Energy and photochemistry Leif Hammarström Uppsala University, Sweden Bioinorganic and metallic enzymes Claudio Luchinat University of Florence, Italy Main group Markku Räsänen University of Helsinki, Finland Solid state chemistry Martin Jansen Max Planck Institute for Solid State Research, Germany

Key Deadlines Poster abstract submission 4 February 2011 Early bird registration 4 February 2011 Standard registration 4 March 2011

Submit your abstract NOW and register early to take advantage of discounts

www.rsc.org/EICC1

ISSN 2042-6496

Registered Charity Number 207890

COVER ARTICLE Vincenzo Fogliano and Francisco J. Morales Estimation of dietary intake of melanoidins from coffee and bread

2042-6496(2011)2:2;1-A