New technologies in aquaculture
Related titles: Improving farmed fish quality and safety (ISBN 978-1-84569-299-5)
Fish farming enables greater control of product quality, but there have been concerns about the levels of contaminants found in farmed products. Their sensory and nutritional quality can also not equal that of wild-caught fish. This important collection reviews potential negative safety and quality issues in farmed fish and presents methods to improve product characteristics. The first part of the book discusses contaminants, such as persistent organic pollutants and veterinary drug residues and methods for their reduction and control. The second part addresses important quality issues, such as genetic control of flesh characteristics and the effects of feed on product nutritional and sensory quality. Improving seafood products for the consumer (ISBN 978-1-84569-019-9)
Consumer health and well-being may potentially be improved by consumption of health promoting, safe seafood products of high eating quality. This book provides a convenient review of significant findings in key areas of seafood research, with chapters authored by experts in the field. Consumer attitude to seafood products is first discussed, followed by chapters analysing important advances in the area of the health benefits of seafood, for example the relationship between omega-3 fatty acids and heart disease. Subsequent parts of the book discuss key topics in seafood safety, advances in processing technologies and methods to improve the quality of farmed fish. Shellfish safety and quality (ISBN 978-1-84569-152-3)
Shellfish are a very popular and nutritious food source worldwide and their consumption has risen dramatically. Because of their unique nature as compared to beef and poultry, shellfish have their own distinct aspects of harvest, processing and handling. Edited by leading authorities in the field, this collection reviews issues of current interest and outlines steps that can be taken by the shellfish industry to improve shellfish safety and eating quality. Opening chapters consider microbial, biotoxin, metal and organic contaminants of shellfish. Techniques to reduce contamination are then discussed, such as mitigation of the effects of harmful algal blooms. Chapters also address approaches to managing disease and other methods to improve quality, such as improved packaging methods and reduction of biofouling. Details of these books and a complete list of Woodhead’s titles can be obtained by: • visiting our web site at www.woodheadpublishing.com • contacting Customer Services (e-mail:
[email protected]; fax: +44 (0) 1223 893694; tel.: +44 (0) 1223 891358 ext.130; address: Woodhead Publishing Limited, Abington Hall, Granta Park, Great Abington, Cambridge CB21 6AH, UK)
New technologies in aquaculture Improving production efficiency, quality and environmental management Edited by Gavin Burnell and Geoff Allan
Oxford
Cambridge
New Delhi
Published by Woodhead Publishing Limited, Abington Hall, Granta Park, Great Abington, Cambridge CB21 6AH, UK www.woodheadpublishing.com Woodhead Publishing India Private Limited, G-2, Vardaan House, 7/28 Ansari Road, Daryaganj, New Delhi – 110002, India Published in North America by CRC Press LLC, 6000 Broken Sound Parkway, NW, Suite 300, Boca Raton, FL 33487, USA First published 2009, Woodhead Publishing Limited and CRC Press LLC © Woodhead Publishing Limited, 2009, except Chapters 26 and 27 which are © The State of Queensland (through the Department of Primary Industries and Fisheries), 2009 The authors have asserted their moral rights. This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with permission, and sources are indicated. Reasonable efforts have been made to publish reliable data and information, but the authors and the publishers cannot assume responsibility for the validity of all materials. Neither the authors nor the publishers, nor anyone else associated with this publication, shall be liable for any loss, damage or liability directly or indirectly caused or alleged to be caused by this book. Neither this book nor any part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, microfilming and recording, or by any information storage or retrieval system, without permission in writing from Woodhead Publishing Limited. The consent of Woodhead Publishing Limited does not extend to copying for general distribution, for promotion, for creating new works, or for resale. Specific permission must be obtained in writing from Woodhead Publishing Limited for such copying. Trademark notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation, without intent to infringe. British Library Cataloguing in Publication Data A catalogue record for this book is available from the British Library. Library of Congress Cataloging in Publication Data A catalog record for this book is available from the Library of Congress. Woodhead Publishing ISBN 978-1-84569-384-8 (book) Woodhead Publishing ISBN 978-1-84569-647-4 (e-book) CRC Press ISBN 978-1-4398-0109-3 CRC Press order number: N10010 The publishers’ policy is to use permanent paper from mills that operate a sustainable forestry policy, and which has been manufactured from pulp which is processed using acid-free and elemental chlorine-free practices. Furthermore, the publishers ensure that the text paper and cover board used have met acceptable environmental accreditation standards. Typeset by SNP Best-set Typesetter Ltd., Hong Kong Printed by TJ International Limited, Padstow, Cornwall, UK
Contents
Contributor contact details......................................................................... xix Preface.......................................................................................................... xxix
Part I 1
2
Genetic improvement and reproduction ...................................
Genome-based technologies useful for aquaculture research and genetic improvement of aquaculture species .................................. Z. Liu, Auburn University, USA 1.1 Introduction.............................................................................. 1.2 DNA marker technologies ..................................................... 1.3 DNA sequencing technologies .............................................. 1.4 Gene discovery technologies ................................................. 1.5 Genome mapping technologies ............................................. 1.6 Genome expression analysis technologies ........................... 1.7 Acknowledgements ................................................................. 1.8 References ................................................................................ Genetic improvement of finfish ........................................................ G. Hulata, Agricultural Research Organization, Israel, and B. Ron, Israel Oceanographic & Limnological Research Ltd, Israel 2.1 Introduction: current status of aquaculture genetics ......... 2.2 Key drivers for genetic improvement of finfish .................. 2.3 Case studies – risks associated with selective breeding programs ...................................................................................
1
3 3 4 18 26 28 35 41 41 55
55 56 69
vi
Contents 2.4 2.5 2.6 2.7
3
4
5
6
Future trends ............................................................................ Sources of further information and advice .......................... Acknowledgement................................................................... References ................................................................................
Genetic variation and selective breeding in hatchery-propagated molluscan shellfish ........................................ P. Boudry, Ifremer, France 3.1 Introduction.............................................................................. 3.2 Monitoring genetic diversity and risks related to inbreeding ................................................................................. 3.3 Inheritance of traits important for aquaculture .................. 3.4 Current status of established molluscan shellfish breeding programs................................................................... 3.5 Present needs and future trends: use of marker assisted selection and genomics ........................................................... 3.6 References ................................................................................ Controlling fish reproduction in aquaculture ................................. C. Mylonas, Hellenic Center for Marine Research, Greece, and Y. Zohar, University of Maryland Biotechnology Institute, USA 4.1 Introduction.............................................................................. 4.2 The fish reproductive cycle and its control .......................... 4.3 Reproductive strategies and dysfunctions in captivity ....... 4.4 Hormonal therapies for the control of reproduction ......... 4.5 Induction of oocyte maturation and ovulation ................... 4.6 Induction of spermiation ........................................................ 4.7 Spontaneous spawning versus artificial insemination ........ 4.8 Future trends ............................................................................ 4.9 Sources of further information and advice .......................... 4.10 References ................................................................................ Producing sterile and single-sex populations of fish for aquaculture .......................................................................................... T. Benfey, University of New Brunswick, Canada 5.1 Introduction.............................................................................. 5.2 Sterile populations................................................................... 5.3 Single-sex populations ............................................................ 5.4 Future trends and further reading ........................................ 5.5 References ................................................................................ Chromosome set manipulation in shellfish ..................................... X. Guo, Y. Wang, Z. Xu, Rutgers University, USA, and H. Yang, Louisiana State University Agriculture Center, USA 6.1 Introduction..............................................................................
71 72 72 72 87 87 88 90 92 97 100 109
110 110 116 118 122 126 127 128 130 130 143 143 144 154 157 159 165
165
Contents 6.2 6.3 6.4 6.5 6.6 6.7 6.8
Part II 7
8
9
vii
Principles and methods of chromosome set manipulation ............................................................................ Triploid shellfish....................................................................... Tetraploid shellfish .................................................................. Gynogensis, androgenesis and aneuploids ........................... Summary and perspectives ..................................................... Acknowledgements ................................................................. References ................................................................................
166 174 183 187 187 188 188
Health ...........................................................................................
195
Advances in disease diagnosis, vaccine development and other emerging methods to control pathogens in aquaculture .......................................................................................... A. Adams, University of Stirling, UK 7.1 Introduction.............................................................................. 7.2 Key drivers to improve disease diagnosis and vaccine development ............................................................................. 7.3 Limitations of current diagnostic methods .......................... 7.4 Advances in methods of disease diagnosis (mainly for bacterial diseases) ............................................................. 7.5 Advances in vaccine development ........................................ 7.6 Other emerging methods to control pathogens .................. 7.7 Future trends ............................................................................ 7.8 Sources of further information and advice .......................... 7.9 References ................................................................................ Controlling parasitic diseases in aquaculture: new developments .............................................................................. C. Sommerville, University of Stirling, UK 8.1 Introduction.............................................................................. 8.2 Effects of parasitic disease in aquaculture........................... 8.3 Advances in the understanding of parasite biology and host–parasite interactions ............................................... 8.4 Advances in methods of identifying parasites..................... 8.5 Advances in methods of controlling parasites .................... 8.6 Future trends ............................................................................ 8.7 References ................................................................................ Controlling viral diseases in aquaculture: new developments...... T. Renault, Ifremer, France 9.1 Introduction.............................................................................. 9.2 Overview of viral diseases in aquaculture ........................... 9.3 Limitation of current management techniques ...................
197 197 198 198 199 203 207 208 209 211
215 215 216 218 220 221 237 237 244 244 245 248
viii
Contents 9.4 9.5 9.6
10
Diet and husbandry techniques to improve disease resistance: new technologies and prospects .................................... F. J. Gatesoupe, INRA-Ifremer, France 10.1 Introduction.............................................................................. 10.2 Fighting the pathogens............................................................ 10.3 Improving welfare ................................................................... 10.4 Improving feed......................................................................... 10.5 Concluding remarks ................................................................ 10.6 Sources of further information and advice .......................... 10.7 References ................................................................................
Part III 11
12
Advances in understanding of immunity of aquacultured species to viral diseases .................................. New methods to control viral diseases in aquaculture and future trends ..................................................................... References ................................................................................
249 254 259
267 267 268 273 276 289 290 291
Diet and husbandry ..................................................................
313
Fish larvae nutrition and diet: new developments ......................... S. Kolkovski, Dept of Fisheries, Australia, J. Lazo, Fish Nutrition Laboratory, Mexico, D. Leclercq, ACUI-T, France, and M. Izquierdo, Grupo de Investigación en Acuicultura, Spain 11.1 Introduction.............................................................................. 11.2 Determination of nutritional requirements of larvae ........ 11.3 Nutritional requirements of fish larvae ................................ 11.4 Feed identification and ingestion .......................................... 11.5 Ontogeny of digestive capacity in marine fish larvae .................................................................................. 11.6 Digestive system capacity ....................................................... 11.7 Diet manufacturing methods ................................................. 11.8 Microdiet characteristics......................................................... 11.9 Feeding system ......................................................................... 11.10 Dosage system ......................................................................... 11.11 Future directions ..................................................................... 11.12 References ................................................................................
315
Aquaculture feeds and ingredients: an overview ........................... R. Hardy, University of Idaho, USA 12.1 Introduction.............................................................................. 12.2 Sustainability of feed ingredients .......................................... 12.3 Safety of farmed fish products from harmful residues and pollutants...........................................................................
315 319 322 332 336 343 346 349 354 355 359 360 370 370 371 374
Contents 12.4
12.5 12.6 12.7 12.8
13
14
15
Categories of environmental pollutants and residues comprising risks to the safety of farmed fish products .................................................................................... Alternate protein and lipid sources ...................................... Future trends ............................................................................ Sources of further information and advice .......................... References ................................................................................
Ingredient evaluation in aquaculture: digestibility, utilisation and other key nutritional parameters ........................... B. Glencross, CSIRO Marine and Atmospheric Research, Australia 13.1 Introduction.............................................................................. 13.2 Characterisation and preparation of ingredients ................ 13.3 Defining ingredient digestibility ............................................ 13.4 Ingredient palatability............................................................. 13.5 Defining effects on growth and utilisation........................... 13.6 Ingredient functionality and feed technical qualities ......... 13.7 Frontier technologies for ingredient evaluation.................. 13.8 References ................................................................................
Quantifying nutritional requirements in aquaculture: the factorial approach ........................................................................ I. Lupatsch, Swansea University, UK 14.1 Introduction.............................................................................. 14.2 Quantification of nutritional requirements .......................... 14.3 Feed ingredient evaluation..................................................... 14.4 Feed formulation and feeding strategies .............................. 14.5 Future trends ............................................................................ 14.6 References ................................................................................
Advances in aquaculture nutrition: catfish, tilapia and carp nutrition ...................................................................................... D. Davis, Auburn University, USA, T. Nguyen, Nong Lam University, Vietnam, M. Li, National Warmwater Aquaculture Center, USA, D. M. Gatilin III, Department of Wildlife and Fisheries Sciences, USA, and T. O’Keefe, Aqua-Food Technologies, Inc., USA 15.1 Introduction.............................................................................. 15.2 Nutrient requirements ............................................................ 15.3 Sources of further information and advice .......................... 15.4 References ................................................................................
ix
375 378 383 383 384
387
388 390 393 399 402 408 408 410
417 417 419 431 433 437 438
440
440 443 456 456
x 16
17
18
19
Contents Advances in aquaculture feeds and feeding: basses and breams .... M. Booth, New South Wales Department of Primary Industries, Australia 16.1 Introduction.............................................................................. 16.2 Asian seabass ........................................................................... 16.3 Red sea bream and gilthead sea bream ............................... 16.4 Grouper .................................................................................... 16.5 Future trends ............................................................................ 16.6 References ................................................................................
459
Advances in aquaculture feeds and feeding: salmonids ................ S. Refstie, Nofima Marin and Aquaculture Protein Centre (APC), Norway, and T. Åsgård, Nofima Marin, Norway 17.1 Introduction.............................................................................. 17.2 Feed technology and formulation ......................................... 17.3 Digestive physiology ............................................................... 17.4 Nutritional requirements ........................................................ 17.5 Nutrition and health................................................................ 17.6 Dietary additives ..................................................................... 17.7 Species differences .................................................................. 17.8 Practical formulations ............................................................. 17.9 Feeding and feeding systems ................................................. 17.10 Future trends ............................................................................ 17.11 References ................................................................................
498
Monitoring viral contamination in shellfish growing areas ...................................................................................... F. S. Le Guyader and M. Pommepuy, Ifremer, France, and R. L. Atmar, Baylor College of Medicine, USA 18.1 Introduction.............................................................................. 18.2 Source of pollution .................................................................. 18.3 Methods .................................................................................... 18.4 Input and flux ........................................................................... 18.5 Strategies for reducing contamination ................................. 18.6 Other issues .............................................................................. 18.7 Future trends ............................................................................ 18.8 References ................................................................................ Impacts of harmful algal bloom on shellfisheries aquaculture .......................................................................................... Y. Matsuyama, National Research Institute of Fisheries and Environment of Inland Sea, Japan, and S. Shumway, University of Connecticut, USA 19.1 Introduction.............................................................................. 19.2 Global increase of harmful algal blooms (HAB) ...............
459 461 466 476 483 484
498 500 501 506 507 511 514 515 517 518 522
542
542 544 550 553 562 565 568 569
580
580 581
Contents 19.3 19.4 19.5 19.6 19.7 20
Advances in microalgal culture for aquaculture feed and other uses ............................................................................................. M. R. Tredici, N. Biondi, E. Ponis, L. Rodolfi, Università degli Studi di Firenze, Italy, and G. Chini Zittelli, Istituto per lo Studio degli Ecosistemi, Italy 20.1 Introduction.............................................................................. 20.2 Current status and new techniques for microalgae culture ....................................................................................... 20.3 Microalgae for aquaculture feed ........................................... 20.4 Microalgae as dietary supplements, animal feed and nutraceuticals ........................................................................... 20.5 Microalgae as source of pharmaceuticals and probiotics .................................................................................. 20.6 Wastewater reclamation and biofuel production by algae–bacteria consortia ......................................................... 20.7 Future trends ............................................................................ 20.8 Sources of further information and advice .......................... 20.9 References ................................................................................
Part IV 21
Impact of harmful algal bloom species on shellfisheries industries ........................................................... Prevention of harmful algal bloom threats .......................... Conclusions .............................................................................. Acknowledgements ................................................................. References ................................................................................
Environmental issues ................................................................
Predicting and assessing the environmental impact of aquaculture .......................................................................................... C. Crawford and C. MacLeod, University of Tasmania, Australia 21.1 Introduction.............................................................................. 21.2 Interactions between aquaculture and the environment ............................................................................. 21.3 Site selection and carrying capacity ...................................... 21.4 Considerations in developing an environmental monitoring and assessment program .................................... 21.5 Monitoring and assessment techniques ................................ 21.6 Recent technological advances and future trends .............. 21.7 Sources of further information and advice .......................... 21.8 References ................................................................................
xi
587 595 601 601 602
610
610 611 621 635 643 653 657 658 659
677
679
679 681 684 686 690 696 699 700
xii
Contents
22
Spatial decision support in aquaculture: the role of geographical information systems and remote sensing ................. L. G. Ross, N. Handisyde, D.-C. Nimmo, University of Stirling, Scotland 22.1 The spatial planning context .................................................. 22.2 Database construction and project methodology ............... 22.3 Decision support systems and tools ...................................... 22.4 Selected applications and examples of geographical information systems in aquaculture............... 22.5 Case study: climate change .................................................... 22.6 Case study: multi-site coastal zone planning ....................... 22.7 Summary and future trends ................................................... 22.8 Acknowledgements ................................................................. 22.9 References ................................................................................
23
Zooremediation of contaminated aquatic systems through aquaculture initiatives ........................................................................ S. Gifford, G. R. MacFarlane, C. E. Koller, R. H. Dunstan, The University of Newcastle, Australia, and W. O’Connor, NSW Department of Primary Industries, Australia 23.1 Introduction.............................................................................. 23.2 Zooremediation of pollutants ................................................ 23.3 Zooremediation and pearl aquaculture: a case study .............................................................................. 23.4 Future trends ............................................................................ 23.5 Sources of further information and advice .......................... 23.6 References ................................................................................
Part V 24
Farming new species ...................................................................
Farming cod and halibut: biological and technological advances in two emerging cold-water marine finfish aquaculture species ............................................................................ V. Puvanendran and A. Mortensen, Nofima Marin, Norway 24.1 Introduction.............................................................................. 24.2 Atlantic cod .............................................................................. 24.3 Atlantic halibut ........................................................................ 24.4 Future trends ............................................................................ 24.5 Sources of further information and advice .......................... 24.6 Acknowledgements ................................................................. 24.7 References ................................................................................
707
707 711 718 720 726 739 745 746 747
750
750 751 758 761 764 764
769
771 772 774 789 794 797 798 798
25
26
27
28
Contents
xiii
Cobia cultivation................................................................................. E. McLean, Ministry of Fisheries Wealth, Sultanate of Oman, G. Salze, Virginia-Maryland Regional College of Veterinary Medicine, USA, M. H. Schwarz, Virginia Seafood AREC, USA, and S. R. Craig, Virginia Cobia Farms LLC, USA 25.1 Introduction.............................................................................. 25.2 Broodstock and spawning ...................................................... 25.3 Larval rearing........................................................................... 25.4 Juveniles and on-growing ....................................................... 25.5 Emerging issues and future trends........................................ 25.6 References ................................................................................
804
804 805 807 812 816 818
Advances in the culture of lobsters ................................................. C. M. Jones, Northern Fisheries Centre, Australia 26.1 Introduction.............................................................................. 26.2 Current situation and constraints .......................................... 26.3 Advances in culture ................................................................ 26.4 Production systems .................................................................. 26.5 Product issues: markets........................................................... 26.6 Future trends ............................................................................ 26.7 Sources of further information and advice .......................... 26.8 References ................................................................................
822
Advances in the culture of crabs ...................................................... B. D. Paterson, Queensland Department of Primary Industries and Fisheries, Australia 27.1 Introduction.............................................................................. 27.2 Current situation ..................................................................... 27.3 Product issues........................................................................... 27.4 Production systems .................................................................. 27.5 Future trends ............................................................................ 27.6 Sources of further information and advice .......................... 27.7 References ................................................................................
845
Aquaculture and the production of pharmaceuticals and nutraceuticals ...................................................................................... K. Benkendorff, Flinders University of South Australia, Australia 28.1 Introduction.............................................................................. 28.2 Marine pharmaceuticals ......................................................... 28.3 Marine nutraceuticals ............................................................. 28.4 Diversifying the aquaculture industry .................................. 28.5 Current case studies ................................................................
822 823 827 832 835 835 836 836
845 848 848 851 859 860 860
866
866 870 872 874 875
xiv
Contents 28.6 28.7 28.8 28.9
Steps towards commercialisation .......................................... Future trends ............................................................................ Acknowledgements ................................................................. References ................................................................................
884 886 887 887
Part VI Aquaculture systems design .....................................................
893
29
895
30
31
Opportunities and challenges for off-shore farming ..................... R. Langan, University of New Hampshire, USA 29.1 The context for off-shore farming ......................................... 29.2 Characterization and selection of off-shore sites ................ 29.3 Finfish species cultivated in off-shore cages ........................ 29.4 Off-shore mollusc culture ....................................................... 29.5 Environmental concerns ......................................................... 29.6 Future trends ............................................................................ 29.7 References ................................................................................ Advances in technology for off-shore and open ocean aquaculture .......................................................................................... A. Fredheim, SINTEF Fisheries and Aquaculture, Norway, and R. Langan, University of New Hampshire, USA 30.1 Introduction: historical development of fish farming technology ................................................................................ 30.2 Floating fish farm design ........................................................ 30.3 Current status and technical limitations............................... 30.4 Novel fish farm systems .......................................................... 30.5 Supporting technologies for off-shore and open ocean fish farming ............................................................................... 30.6 Sources of further information and advice .......................... 30.7 References ................................................................................ Advances in technology and practice for land-based aquaculture systems: tank-based recirculating systems for finfish production ................................................................................ T. Losordo, D. DeLong and T. Guerdat, North Carolina State University, USA 31.1 Introduction.............................................................................. 31.2 Components in recirculating systems design ....................... 31.3 Types of particulate waste solids ........................................... 31.4 Tank, water input manifolds, and drain design.................... 31.5 Settleable solids capture components................................... 31.6 Suspended solids capture components ................................. 31.7 Biological filtration .................................................................. 31.8 Oxygenation components and processes .............................
895 897 899 901 904 909 910
914
914 918 924 930 941 942 942
945
945 947 948 948 955 957 962 970
Contents 31.9 Sterilization components and processes ............................... 31.10 Comparing freshwater and marine systems design ............ 31.11 An example of a modern approach to a complete systems design .......................................................................... 31.12 References ................................................................................ 32
33
34
Advances in technology and practice for land-based aquaculture systems: ponds for finfish production......................... C. E. Boyd, Auburn University, USA, and S. Chainark, Phuket Rajabhat University, Thailand 32.1 Introduction.............................................................................. 32.2 Hydrologic types of ponds ..................................................... 32.3 Production methodology ........................................................ 32.4 Liming and fertilization .......................................................... 32.5 Feeds and feed management ................................................. 32.6 Dissolved oxygen management ............................................. 32.7 Pond amendments ................................................................... 32.8 Pond bottom treatments ......................................................... 32.9 Water quality monitoring ....................................................... 32.10 Pond effluents........................................................................... 32.11 Future trends ............................................................................ 32.12 References ................................................................................ Superintensive bio-floc production technologies for marine shrimp Litopenaeus vannamei: technical challenges and opportunities ............................................................ C. L. Browdy, J. A. Venero, A. D. Stokes and J. Leffler, Marine Resources Research Institute, USA 33.1 Introduction.............................................................................. 33.2 Superintensive bio-floc-based shrimp production systems .... 33.3 Components of superintensive bio-floc-based shrimp production systems .................................................................. 33.4 Current research priorities ..................................................... 33.5 Conclusions .............................................................................. 33.6 Acknowledgements ................................................................. 33.7 References ................................................................................ Traditional Asian aquaculture .......................................................... P. Edwards, Asian Institute of Technology, Thailand 34.1 Introduction.............................................................................. 34.2 Definitions and principles ...................................................... 34.3 Traditional aquaculture systems ............................................ 34.4 Recent changes to traditional practice ................................. 34.5 Research and development for improved traditional practice ......................................................................................
xv 973 975 977 979
984
984 985 988 989 992 994 997 1002 1003 1004 1006 1006
1010
1010 1011 1013 1017 1024 1025 1026 1029 1029 1030 1034 1037 1041
xvi
Contents 34.6 34.7 34.8 34.9 34.10
35
36
37
Recent development of semi-intensive aquaculture........... Bridging traditional and modern practice............................ Future trends ............................................................................ Sources of further information and advice .......................... References ................................................................................
1047 1050 1054 1056 1056
Use of information technology in aquaculture .............................. J. Bostock, University of Stirling, UK 35.1 Introduction.............................................................................. 35.2 Information and communications technology (ICT) for productivity and effectiveness ......................................... 35.3 ICT for quality and customer service ................................... 35.4 ICT in aquaculture innovation and learning ....................... 35.5 Conclusions .............................................................................. 35.6 Acknowledgements ................................................................. 35.7 Sources of further information and advice .......................... 35.8 References ................................................................................
1064
Inland saline aquaculture .................................................................. G. L. Allan and D. S. Fielder, New South Wales Department of Primary Industries, Australia, K. M. Fitzsimmons, University of Arizona, USA, S. L. Applebaum, Jacob Blaustein Institute for Desert Research BGU, Israel, and S. Raizada, Central Institute of Fisheries Education Rohtak Centre (ICAR), India 36.1 Introduction.............................................................................. 36.2 Saline groundwater from interception schemes to protect agriculture ................................................................... 36.3 Coal bed methane waste water ............................................. 36.4 Chemistry and remediation.................................................... 36.5 Case studies .............................................................................. 36.6 Future trends ............................................................................ 36.7 References ................................................................................
1119
Urban aquaculture: using New York as a model ........................... M. P. Schreibman and C. Zarnoch, City University of New York, USA 37.1 Introduction.............................................................................. 37.2 Goals ......................................................................................... 37.3 Technology................................................................................ 37.4 Potential urban aquaculture programs ................................. 37.5 The economics: siting, processing, and marketing for economic success ............................................................... 37.6 Marketing and competition.................................................... 37.7 The role of the university .......................................................
1148
1064 1067 1088 1098 1104 1105 1105 1116
1119 1121 1123 1126 1128 1144 1145
1148 1151 1152 1153 1157 1158 1159
Contents
xvii
37.8 Future trends ............................................................................ 1159 37.9 Acknowledgements ................................................................. 1161 37.10 References ................................................................................ 1161
Index ............................................................................................................. 1163
Contributor contact details
(* = main contact)
Chapter 1
Editors
Zhanjiang Liu The Fish Molecular Genetics and Biotechnology Laboratory Department of Fisheries and Allied Aquacultures and Program of Cell and Molecular Biosciences Aquatic Genomics Unit Auburn University Auburn AL 36849 USA
Gavin Burnell Director Aquaculture and Fisheries Development Centre University College Cork Cork Ireland E-mail:
[email protected] Geoff L. Allan Port Stephens Fisheries Institute New South Wales Department of Primary Industries Locked Bag 1 Nelson Bay NSW 2315 Australia E-mail:
[email protected]. gov.au
E-mail:
[email protected]
Chapter 2 Gideon Hulata* Head, Institute of Animal Science Agricultural Research Organization The Volcani Center PO Box 6, Bet Dagan 50250 Israel E-mail:
[email protected]
xx
Contributor contact details
Tetsuzan (Benny) Ron Aquaculture Program Coordinator Office of the Vice Chancellor for Research and Graduate Education University of Hawaii at Manoa 1960 East-West Road Biomed T-701A Honolulu HI 96822 Hawaii
Chapter 5
E-mail:
[email protected]
Chapter 6
Chapter 3 Pierre Boudry Ifremer – UMR M100 Physiologie et Ecophysiologie des Mollusques Marins 29280 Plouzané France E-mail:
[email protected]
Tillmann J. Benfey Department of Biology University of New Brunswick PO Box 4400 Fredericton New Brunswick E3B 5A3 Canada E-mail:
[email protected]
Ximing Guo,* Yongping Wang, Zhe Xu Haskin Shellfish Research Laboratory Institute of Marine and Coastal Sciences Rutgers University 6959 Miller Avenue Port Norris NJ 08349 USA
Chapter 4
E-mail:
[email protected]
Constantinos C. Mylonas* Institute of Aquaculture Hellenic Center for Marine Research PO Box 2214 Heraklion 71003 Crete Greece
Huiping Yang Aquaculture Research Station Louisiana State University Agriculture Center 2410 Ben Hur Road Baton Rouge LA 70820 USA
E-mail:
[email protected] Yonathan Zohar Center of Marine Biotechnology University of Maryland Biotechnology Institute 701 E. Pratt Baltimore MD 21202 USA E-mail:
[email protected]
Chapter 7 Alexandra Adams Institute of Aquaculture University of Stirling Stirling FK9 4LA Scotland UK E-mail:
[email protected]
Contributor contact details
Chapter 8 Christina Sommerville Institute of Aquaculture University of Stirling Stirling FK9 4LA Scotland UK E-mail:
[email protected]
Juan Pablo Lazo Fish Nutrition Laboratory Centro de Investigación Científica y de Educación Superior de Ensenada BC Organismo Descentralizado de Interés Público Km. 107 Carr. Tijuana-Ensenada Mexico
Chapter 9
E-mail:
[email protected]
T. Renault Ifremer Laboratoire de Génétique et Pathologie 17390 La Tremblade France
Didier Leclercq ACUI-T 129 Bd St Aignan 44100 Nantes France
E-mail:
[email protected]
Chapter 10 F. J. Gatesoupe INRA-Ifremer UMR1067 Nutrition Aquaculture et Génomique BP 70 F-29280 Plouzané France
E-mail:
[email protected] Marisol Izquierdo Grupo de Investigación en Acuicultura ULPGC & ICCM PO Box 56 35200 Telde Las Palmas de Gran Canaria Spain E-mail:
[email protected]
E-mail:
[email protected]
Chapter 12 Chapter 11 Sagiv Kolkovski* Department of Fisheries Western Australia PO Box 20 North Beach WA 6920 Australia E-mail:
[email protected]. gov.au
xxi
Ronald W. Hardy Director Aquaculture Research Institute University of Idaho 3059F National Fish Hatchery Road Hagerman ID 83332 USA E-mail:
[email protected]
xxii
Contributor contact details
Chapter 13 Brett D. Glencross CSIRO Marine and Atmospheric Research PO Box 120 Cleveland QLD 4163 Australia E-mail:
[email protected]
Chapter 14 Ingrid Lupatsch Centre for Sustainable Aquaculture Research Swansea University Singleton Park Swansea SA2 8PP UK E-mail:
[email protected]
Chapter 15 Donald Allen Davis* Department of Fisheries and Allied Aquacultures Auburn University 203 Swingle Hall Auburn AL 36849-5419 USA E-mail:
[email protected] Tri N. Nguyen Faculty of Fisheries Nong Lam University Thu Duc District Ho Chi Minh City Vietnam E-mail:
[email protected]
Menghe Li National Warmwater Aquaculture Center 127 Experiment Station Road PO Box 197 Stoneville MS 38776-0197 USA E-mail:
[email protected] Delbert M. Gatlin III Department of Wildlife and Fisheries Sciences 216 Heep Laboratory Building 2258 TAMUS College Station TX 77843-2258 USA E-mail:
[email protected] Tim O’Keefe Aqua-Food Technologies, Inc. 3192 Matecumbe Key Road Punta Gorda FL 33955 USA
Chapter 16 Mark Booth New South Wales Department of Primary Industries Port Stephens Fisheries Institute Taylors Beach NSW 2316 Australia E-mail:
[email protected]. au
Contributor contact details
xxiii
Chapter 17
Chapter 19
S. Refstie* and T. Åsgård Nofima Marin NO-6600 Sunndalsøra Norway
Yukihiko Matsuyama* Harmful Algal Bloom Division National Research Institute of Fisheries and Environment of Inland Sea Maruishi Hatsukaichi Hiroshima 7390452 Japan
S. Refstie Aquaculture Protein Centre (APC), CoE Norway E-mail:
[email protected] [email protected]
Chapter 18 Françoise S. Le Guyader* Laboratoire de Microbiologie Ifremer BP 21105 44311 Nantes cedex 03 France
E-mail:
[email protected] Sandra E. Shumway Department of Marine Sciences University of Connecticut 1080 Shennecossett Road Groton CT 06340 USA E-mail: sandra.shumway@uconn. edu
E-mail:
[email protected] Monique Pommepuy Laboratoire de Microbiologie Ifremer BP 70 29280 Plouzané France E-mail:
[email protected] Robert L. Atmar Departments of Medicine and Molecular Virology & Microbiology Baylor College of Medicine 1 Baylor Plaza MS BCM280 Houston TX 77030 USA E-mail:
[email protected]
Chapter 20 Mario R. Tredici,* Natascia Biondi, Emanuele Ponis, Liliana Rodolfi Dipartimento di Biotecnologie Agrarie Università degli Studi di Firenze Piazzale delle Cascine 24 50144 Firenze Italy E-mail:
[email protected] Graziella Chini Zittelli Istituto per lo Studio degli Ecosistemi CNR Via Madonna del Piano 10 50019 Sesto Fiorentino Firenze Italy
xxiv
Contributor contact details
Chapter 21 Christine Crawford* and Catriona MacLeod Tasmanian Aquaculture and Fisheries Institute University of Tasmania Nubeena Crescent Taroona Tasmania 7053 Australia E-mail: Christine.Crawford@utas. edu.au
[email protected]
Chapter 22 Lindsay G Ross,* Neil Handisyde, Donna-Claire Nimmo Institute of Aquaculture University of Stirling Stirling FK9 4LA Scotland UK E-mail:
[email protected]
Chapter 23 Scott Gifford, Geoff R. MacFarlane, Claudia E. Koller and R. Hugh Dunstan* School of Environmental and Life Sciences The University of Newcastle Callaghan NSW 2308 Australia E-mail: Hugh.Dunstan@newcastle. edu.au
Wayne O’Connor NSW Department of Primary Industries Port Stephens Fisheries Centre Private Bag 1 Nelson Bay NSW 2315 Australia E-mail: wayne.o’
[email protected]. gov.au
Chapter 24 Velmurugu Puvanendran* and Atle Mortensen Nofima Marin Muninbakken 9-13 9291 Tromsø Norway E-mail: Velmurugu.puvanendran@ nofima.no
[email protected]
Chapter 25 Ewen McLean* Ministry of Fisheries Wealth Marine Science and Fisheries Center PO Box 427 PC 100 Muscat Sultanate of Oman E-mail:
[email protected] Guillaume Salze Virginia-Maryland Regional College of Veterinary Medicine Duck Pond Drive Blacksburg VA 24061-0442 USA
Contributor contact details Michael H. Schwarz Virginia Seafood AREC 102 S. King St Hampton VA 23669 USA Steven R. Craig Virginia Cobia Farms LLC 108 Battleground Road Saltville VA 24370 USA E-mail:
[email protected]
Chapter 26 Clive M. Jones Department of Primary Industries and Fisheries Queensland Northern Fisheries Centre PO Box 5396 Cairns QLD 4870 Australia
xxv
Chapter 28 Kirsten Benkendorff School of Biological Sciences Flinders University of South Australia GPO Box 2100 Adelaide SA 5001 Australia E-mail: Kirsten.benkendorff@ flinders.edu.au
Chapter 29 Richard Langan Atlantic Marine Aquaculture Center University of New Hampshire Gregg Hall, Suite 130 35 Colovos Road Durham NH 03824 USA E-mail:
[email protected]
E-mail:
[email protected]
Chapter 30 Chapter 27 Brian D. Paterson Bribie Island Aquaculture Research Centre Queensland Department of Primary Industries and Fisheries PO Box 2066 Woorim Bribie Island 4507 Australia E-mail:
[email protected]. gov.au
Arne Fredheim* SINTEF Fisheries and Aquaculture Aquaculture Technology 7465 Trondheim Norway E-mail:
[email protected]
xxvi
Contributor contact details
Richard Langan Atlantic Marine Aquaculture Center University of New Hampshire Gregg Hall, Suite 130 35 Colovos Road Durham NH 03824 USA E-mail:
[email protected]
Chapter 31 Thomas M. Losordo, PhD,* Dennis P. DeLong, MSM, and Todd C. Guerdat, MS Department of Biological and Agricultural Engineering Campus Box 7625 North Carolina State University Raleigh NC 27695 USA
Chapter 33 Craig L. Browdy* Novus International 5 Tomotley Court Charleston South Carolina 29407 USA E-mail: craig.browdy@novusint. com Jesus A. Venero, Alvin D. Stokes and John W. Leffer Waddell Mariculture Center Marine Resources Research Institute South Carolina Department of Natural Resources 217 Ft Johnson Road Charleston South Carolina 29407 USA
E-mail:
[email protected]
Chapter 34
Chapter 32
Peter Edwards 593 Lat Prao Soi 64 Bangkok Thailand 10310
Claude E. Boyd* Department of Fisheries and Allied Aquacultures Auburn University AL 36849 USA E-mail:
[email protected] Suwanit Chainark Phuket Rajabhat University Faculty of Fisheries Technology 21 Tepknasatree Road Amphor Muang Phuket Province 83000 Thailand E-mail:
[email protected]
E-mail:
[email protected]
Chapter 35 John Bostock Senior Consultant Institute of Aquaculture University of Stirling Stirling FK9 4LA Scotland UK E-mail:
[email protected]
Contributor contact details
Chapter 36 Geoff L. Allan* and D. Stewart Fielder Port Stephens Fisheries Institute New South Wales Department of Primary Industries Locked Bag 1 Nelson Bay NSW 2315 Australia E-mail:
[email protected] Kevin M. Fitzsimmons Department of Soil, Water and Environmental Science University of Arizona 2601 E. Airport Drive Tucson AZ 85706 USA Samuel L. Applebaum Albert Katz Department of Dryland Biotechnologies The Bengis Center for Desert Aquaculture Jacob Blaustein Institute for Desert Research BGU Sede Boqer Campus Midreshet Ben-Gurion 84990 Israel
xxvii
Sudhir Raizada Central Institute of Fisheries Education Rohtak Centre (ICAR) Lahli Via Anwal Rohtak – 124 411 Haryana India
Chapter 37 M.P. Schreibman* Aquatic Research and Environmental Assessment Center (AREAC) Brooklyn College City University of New York 2900 Bedford Avenue Brooklyn New York NY 11210 USA E-mail:
[email protected]. edu C.B. Zarnoch Baruch College City University of New York One Bernard Baruch Way Department of Natural Science 17 Lexington Avenue, Box A-0506 New York NY 10010 USA
Preface
Global aquaculture remains the fastest growing food industry with growth since 1970 of 8.8 % per annum.1 This growth compares with 1.2 % and 2.8 % for capture fisheries and terrestrial farmed meat production, respectively.1 Total global aquaculture production reached 59.4 million tonnes in 2004, worth an estimated US$ 70.3 billion, including 46 million tonnes of aquaculture product consumed for food. Global demand for seafood has continued to rise, fuelled by global population growth and an increase in per capita consumption due to increasing protein consumption in many developing countries and an increase in relative preference for seafood protein in many developed countries. Global population was estimated at 6.72 billion in November 2008 and, while growth has halved from the peak in around 1963, it is predicted to reach 9 billion by 2040.2 Seafood consumption has increased to 16.6 kg/person/y, the highest on record.1 To cater for global demands in 2020, an estimated 70 million tonnes of seafood will be required from aquaculture.1 Past production increases have come from new industries, new areas for production and intensification of production, mainly in developing countries. Since the early practice of capturing and holding animals, aquaculture has become much more sophisticated with most animals being bred in purpose-built hatcheries, cultured in ponds, cages or tanks, often with some control over the environment, harvested for a specific market and often processed to add value to the product. The massive production increase
1
FAO (2007) The State of World Fisheries and Aquaculture 2006, Rome, Food and Agriculture Organization of the United Nations. 2 http://www.census.gov/ipc/www/idb/worldpopinfo.html
xxx
Preface
(from approximately 1 million tonnes in the 1950s to 59.4 million tonnes in 2004) arose from increases in the area under culture and the number of species cultured and from a shift in the reliance on natural feeds to the greater use of formulated feeds that increasingly met the species’ nutritional requirements. Improvements in other aspects of husbandry, such as health management, and better technology, such as cage and tank systems, also contributed. New technology is now needed to boost production, protect fragile environments and supply the highest quality product. The easy gains in production increase have now mostly been made and that to increase production in the next decade and a half to 70 million tonnes or beyond will require a major new improvement in technology. This is the subject of this book, Aquaculture: New Technologies. We have divided the contents of this book into six parts and selected international experts to contribute individual chapters. The first four parts deal with developments in new technologies for genetic improvement and reproduction, health, diet and husbandry and aquaculture system design. Aquaculture has lagged behind agriculture in applying genetic improvement techniques, but this is a rapidly changing field. We present chapters that detail advances in genetic improvement for finfish, shrimp and molluscs, controlling reproduction and gender, and sterility and genomics. Stress and disease accompany intensive animal production for all species, and managing health is a fundamental requirement for all aquaculture producers. We are regularly discovering new diseases for aquatic animals but, fortunately, we are also developing new treatments and therapies. In the Health part, advances in diagnosis, vaccine development and new methods to control viruses, parasites and other pathogens are presented. The major operating cost for all aquaculture species that are fed is diets and feeding costs. In the Diet and Husbandry part of the book, we have selected chapters that document advances in larval marine fish nutrition, challenges and opportunities with selection of dietary ingredients, bioenergetic modelling to estimate nutritional requirements and specific advances in nutritional science for salmonids; catfish, carps and tilapia; and seabasses and breams. There is also a chapter on microalgal culture – used as a feed for molluscs and other organisms and as a product for human and animal nutrition, in cosmetics and pharmaceutics, and for environmental applications. This part also has a chapter on the impact of harmful algal blooms on shellfish aquaculture. In the fourth part of the book, chapters describing the latest technology for off-shore and open ocean aquaculture, tank-based recirculating systems, land-based finfish and shrimp pond culture systems are presented. Chapters on inland saline aquaculture, urban aquaculture and traditional Asian aquaculture are also included. To conclude this section of the book we have included a chapter on the use of information technology in aquaculture.
Preface
xxxi
The final two parts of the book look at environmental issues and new species for aquaculture. Sustainability can be interpreted in many ways but, whatever your definition, there is universal agreement that all human activities should have a minimal impact on the environment. Therefore in the environmental part of the book, chapters are included on prediction and assessments of environmental impacts, advances in effluent treatment, reducing the impacts of escapees, the role of geographical information systems (GIS) in aquaculture and aquaculture for zooremediation. The new species part examines the latest developments for high-value species including cod, halibut and wolfish; cobia; lobsters; and the aquaculture of pharmaceuticals and nutraceuticals. Several figures from the book have additionally been included as colour plates in an eight-page section which appears between pages 576 and 577. An analysis of past advances in aquaculture gives optimism for the future. While the challenges are great, the adoption of new technology will facilitate rapid future increases in production. The potential of genetic improvement is still largely untapped, new health management strategies will reduce production costs and, while there are considerable constraints with the supply of feed ingredients, advances in our understanding of nutritional requirements will improve feed efficiency. New production systems will also allow production to increase and take production closer to the market for high-value species. The world is facing increasing challenges with food security, and aquatic protein will continue to play a major role in both the developing and developed world. Aquaculture is critical for the future supply of seafood and other aquatic products. Gavin Burnell and Geoff Allan
1 Genome-based technologies useful for aquaculture research and genetic improvement of aquaculture species Z. Liu, Auburn University, USA
Abstract: In spite of the relatively late start of aquaculture genome research, significant progress has been made in aquaculture genomics. Many of the genomic resources, tools, and technology developed from genomics have wide applications for aquaculture research and genetic improvements of aquaculture species. The major genome technologies include DNA marker technologies, novel sequencing technologies, gene discovery technologies, genome mapping technologies, and technologies for analysis of genome expression. This chapter was written to provide basic information such as theories behind the technologies, principles of the technologies, and potential applications of each of these genome technologies relevant to aquaculture. In some cases, research and technology development trends are discussed such that the readers are aware of the direction of future research. For instance, single nucleotide polymorphisms (SNP) are clearly the markers of choice in the future even though microsatellites are currently the predominant type of markers in aquaculture research and applications; the next generation of sequencing technologies will not only play a dominant role in sequencing, but also may replace the traditional genome expression analysis technologies such as microarrays. Key words: genome, amplified fragment length polymorphism (AFLP), microsatellites, single nucleotide polymorphisms (SNP), marker, quantitative trait loci (QTL), expressed sequence tag (EST), next generation sequencing technology, microarray, linkage mapping, radiation hybrid, comparative mapping, sequence tag.
1.1 Introduction Aquaculture, like animal husbandry, has a long history dating back some 3000 years when the Chinese began culturing carp. However, whereas genetic selection of animal livestock has been conducted for thousands of years, until very recently, most cultured aquatic animals were essentially
4
New technologies in aquaculture
wild. For thousands of years, aquaculture was limited to the harvesting of immature fish or shellfish and transferring them to an artificially created environment favorable to their growth. In spite of much earlier aquaculture practices in China, the documented artificial production of aquaculture seed was first introduced in 1733 when a German farmer successfully gathered fish eggs, fertilized them, and raised the fish that hatched. Initially this kind of aquaculture was limited to freshwater fish. In the 20th century, new techniques were developed to successfully breed saltwater species. Most brood stocks used in aquaculture were not genetically selected until the late 20th century. Since around the 1970s, major progress has been made in the genetic enhancement programs of many aquaculture species by using traditional selective breeding techniques, and it is only since the late 1990s that large-scale genome research of aquaculture species started to take off. Genomics, as a new field, has its own technologies and requires new sets of resources. To clarify the term used in the title of this chapter, genomebased technologies; this term is used to include technologies required to conduct genome research and technologies derived as a result of genome research for genetic improvement programs in aquaculture. As such, this chapter will include DNA marker technologies, sequencing technologies, genome mapping technologies, gene discovery technologies, and genome expression analysis technologies. This chapter will briefly introduce these technologies and discuss their applications in genome research and genetic improvements of aquaculture species. Readers with an interest in technical details of these technologies are referred to a recently published book, Aquaculture Genome Technologies (Liu, 2007a).
1.2 DNA marker technologies 1.2.1 Historical perspectives The genome compositions of each individual of the same species are similar but different at the level of DNA sequences and its encoding capacity, and thereby have different transcriptional activities, biological characteristics and performance. The entire task of DNA marker technologies is to provide the means to reveal such DNA level differences of genomes among individuals of the same species, as well as among various related taxa. Historically, these measurements relied on phenotypic or qualitative markers. Morphological differences such as body dimensions, size, and pigmentation are some examples of phenotypic markers. Genetic diversity measurements based on phenotypic markers are often indirect, and inferential through controlled breeding and performance studies (Parker et al., 1998; Okumus and Çifci, 2003). Because these markers are polygenically inherited and have low heritability, they may not represent the true genetic differences (Smith and Chesser, 1981). It is only when the genetic basis for these phenotypic markers is known, that some of them can be used to measure
Genome-based technologies useful for aquaculture research
5
genetic diversity. Molecular markers including protein markers and DNA markers were developed to overcome problems associated with phenotypic markers. Much before the discovery of DNA markers, allozyme markers were used to identify broodstocks in fish and other aquaculture species (Kucuktas and Liu, 2007). Allozymes are different allelic forms of the same enzymes encoded at the same locus (Hunter and Markert, 1957; Parker et al., 1998; May, 2003). Genetic variations detected in allozymes may be the result of point mutations, insertions or deletions (indels). Allozymes have had a wide range of applications in fisheries and aquaculture, including population analysis, mixed stock analysis, and hybrid identification (May, 2003). However, they are becoming a marker type of the past due to the limited number of loci that in turn prohibits genome-wide coverage for the analysis of complex traits (Kucuktas and Liu, 2007). In addition, mutation at the DNA level that causes a replacement of a similarly charged amino acid may not be detected by allozyme electrophoresis. Another drawback is that the most commonly used tissues in allozyme electrophoresis are the muscle, liver, eye, and heart, the collection of which is lethal. Two specific technological advances, the discovery and application of restriction enzymes in 1973 and the development of DNA hybridization techniques in 1975, set the foundation for the development of the first type of DNA markers, restriction fragment length polymorphism (RFLP – for a recent review, see Liu, 2007b). Restriction endonucleases cut DNA wherever their recognition sequences are encountered. Therefore, changes in the DNA sequence due to insertions/deletions (indels), base substitutions, or rearrangements involving the restriction sites can result in the gain, loss, or relocation of a restriction site. Digestion of DNA with restriction enzymes results in fragments whose number and size can vary among individuals, populations, and species. Two approaches are widely used for RFLP analysis. The first involves the use of Southern blot hybridization (Southern, 1975), while the second involves the use of polymer chain reaction (PCR). Traditionally, fragments were separated using Southern blot analysis, in which genomic DNA is digested, subjected to electrophoresis through an agarose gel, transferred to a solid support such as a piece of nylon membrane, and visualized by hybridization to specific probes. Most recent analysis replaces the tedious Southern blot analysis with techniques based on PCR. If flanking sequences are known for a locus, the segment containing the RFLP region is amplified via PCR. If the length polymorphism is caused by a deletion or insertion, gel electrophoresis of the PCR products should reveal the size difference. However, if the length polymorphism is caused by base substitution at a restriction site, PCR products must be digested with a restriction enzyme to reveal the RFLP. The major strength of RFLP markers is that they are codominant markers, i.e., both alleles in an individual are observed in the analysis. The major disadvantage of RFLP is the relatively low level of polymorphism.
6
New technologies in aquaculture
In addition, either sequence information (for PCR analysis) or a molecular probe (for Southern blot analysis) is required, making it difficult and timeconsuming to develop markers in species lacking known molecular information. Due to these disadvantages, the application of RFLP markers in aquaculture and fisheries has been, and will be, limited. Mitochondrial genome evolves more rapidly than the nuclear genome. The rapid evolution of the mtDNA makes it highly polymorphic within a given species. The polymorphism is especially high in the control region (D-loop region), making the D-loop region highly useful in population genetic analysis. The analysis of mitochondrial markers is mostly RFLP analysis, or direct sequence analysis (Liu and Cordes, 2004). Due to the high levels of polymorphism and the ease of mitochondrial DNA analysis, mtDNA has been widely used as markers in aquaculture and fisheries settings. However, mtDNA is maternally inherited in most cases, and this non-Mendelian inheritance greatly limits the applications of mtDNA for genome research. In addition, most aquaculture-related traits are controlled by nuclear genes. For most aquaculture finfish species, their nuclear genome is at the level of a billion base pairs while their mitochondrial genomes are usually tens of thousands of times smaller than the nuclear genome. Clearly, in spite of their usefulness for the identification of aquaculture stocks, mitochondrial DNA markers will not be tremendously useful for aquaculture genome research and genetic improvement programs in aquaculture. However, some recent studies suggested that mitochondrial DNA could influence performance traits such as growth (Steele et al., 2008). When the Human Genome Project was launched in the mid-1980s, the capacity and capabilities of available DNA marker technologies seriously limited genome research. Such severe limits gave rise to pressure to develop more efficient marker systems for analysis of complex traits and genome organizations. At the end of the 1980s, the simple sequence repeats (SSR) or microsatellites were discovered; and they have since been used as one of the most preferred marker types because of their high levels of polymorphism, abundance, roughly even genome distribution, codominant inheritance, and small locus size that facilitate PCR-based genotyping (Tautz, 1989). Because of the importance of microsatellites for aquaculture genome research and genetic improvement programs, they will be discussed in more detail below. At the beginning of 1990s, efforts were also devoted to develop multiloci, PCR-based fingerprinting techniques. Such efforts resulted in the development of two marker types that were highly popular for a while: RAPD (random amplified polymorphic DNA, Welsh and McClelland 1990; Williams et al., 1990) and AFLP (amplified fragment length polymorphism, Vos et al., 1995). RAPD is a multi-locus DNA fingerprinting technique using PCR to randomly amplify anonymous segments of nuclear DNA with a single short
Genome-based technologies useful for aquaculture research
7
PCR primer (8–10 bp in length) (for a recent review, see Liu, 2007c). Because the primers are short, relatively low annealing temperatures (often 36–40 ºC) must be used. Once different bands are amplified from related species, population, or individuals, RAPD markers are produced. RAPD markers thus are differentially amplified bands using a short PCR primer from random genome sites. Genetic variation and divergence within and between the taxa of interest are assessed by the presence or absence of each product, which is dictated by changes in the DNA sequence at each locus. RAPD polymorphisms can occur due to base substitutions at the primer binding sites or to insertions or deletions (indels) in the regions between the two close primer binding sites. The potential power for detection of polymorphism is reasonably high as compared to RFLP, but much lower than microsatellites; typically, 5–20 bands can be produced using a given primer, and multiple sets of random primers can be used to scan the entire genome for differential RAPD bands. Because each band is considered a bi-allelic locus (presence or absence of an amplified product), polymorphic information content (PIC) values for RAPDs fall below those for microsatellites. The major advantages of RAPD markers are their applicability to all species regardless of known genetic, molecular or sequence information, relatively high level of polymorphic rates, simple procedure, and a minimal requirement for both equipment and technical skills. RAPD has been widely used in genetic analysis of aquaculture species, but its further application in genome studies is limited by its lack of high reproducibility and reliability. In addition, RAPD is inherited as dominant markers and transfer of information with dominant markers among laboratories and across species is difficult.
1.2.2 Amplified fragment length polymorphism (AFLP) Alternatives to RAPD that overcome the major problems such as its low reproducibility have been actively sought, and AFLP (Vos et al., 1995) was the outcome of such efforts. AFLP is based on the selective amplification of a subset of genomic restriction fragments using PCR (for a recent review, see Liu, 2007d). Genomic DNA is digested with restriction enzymes, and double-stranded DNA adaptors with known sequences are ligated to the ends of the DNA fragments to generate primer binding sites for amplification. The sequence of the adaptors and the adjacent restriction site serve as primer binding sites for subsequent amplification of the restriction fragments by PCR. Selective nucleotides extending into the restriction sites are added to the 3′ ends of the PCR primers such that only a subset of the restriction fragments is recognized. Only restriction fragments in which the nucleotides flanking the restriction site match the selective nucleotides will be amplified. The subset of amplified fragments is then analyzed by denaturing polyacrylamide gel electrophoresis to generate the fingerprints.
8
New technologies in aquaculture
AFLP analysis is an advanced form of RFLP. Therefore, the molecular basis for RFLP and AFLP are similar. First, any deletions and/or insertions between the two restriction enzymes, e.g., between Eco RI and Mse I that are most often used in AFLP analysis, will cause shifts of fragment sizes. Second, base substitution at the restriction sites will lead to loss of restriction sites and thus a size change. However, only base substitutions in all Eco RI sites and roughly 1/8 of Mse I sites are detected by AFLP since only the Eco RI primer is labeled and AFLP is designed to analyze only the Eco RI–Mse I fragments. Third, base substitutions leading to new restriction sites may also produce AFLP. Once again, gaining Eco RI sites always leads to production of AFLP, gaining Mse I sites must be within the Eco RI–Mse I fragments to produce new AFLP. In addition to the common mechanisms involved in polymorphism of RFLP and AFLP, AFLP also scans for any base substitutions at the first three bases immediately after the two restriction sites. Considering large numbers of restriction sites for the two enzymes (250 000 Eco RI sites and 500 000 Mse I sites immediately next to Eco RI sites for a typical fish genome with one billion base pairs), a complete AFLP scan would also examine over two million bases immediately adjacent to the restriction sites. The potential power of AFLP in the study of genetic variation is enormous. In principle, any combination of a 6-bp cutter with a 4-bp cutter in the first step can be used to determine potential fragment length polymorphism. For each pair of restriction enzymes used in the analysis, e.g., Eco RI and Mse I, a total of approximately 500 000 Eco RI–Mse I fragments would exist for a genome with a size of 1 × 109 bp. Theoretically, 4096 primer combinations compose a complete genome-wide scan of the fragment length polymorphism using the two restriction enzymes if three bases are used for selective amplification. As hundreds of restriction endonucleases are commercially available, the total power of AFLP for analysis of genetic variation can not be exhausted. However, it is probably never necessary to perform such exhaustive analysis. Since over 100 loci can be analyzed by a single primer combination, a few primer combinations should display thousands of fingerprints. For genetic resource analysis, the number of primer combinations required for construction of phylogenetic trees/dendrograms depends on the level of polymorphism in the populations, but probably takes no more than five to ten primer combinations. AFLP combines the strengths of RFLP and RAPD. It is a PCR-based approach requiring only a small amount of starting DNA; it does not require any prior genetic information or probes; and it overcomes the problem of low reproducibility inherent to RAPD. AFLP is capable of producing far greater numbers of polymorphic bands than RAPD in a single analysis, significantly reducing costs and making possible the genetic analysis of closely-related populations. It is particularly well adapted for stock identification because of the robust nature of its analysis. The other
Genome-based technologies useful for aquaculture research
9
advantage of AFLP is its ability to reveal genetic conservation as well as genetic variation. In this regard, it is superior to microsatellites for applications in stock identification. Microsatellites often possess large numbers of alleles, too many to obtain a clear picture with small numbers of samples. Identification of stocks using microsatellites, therefore, would require large sample sizes. For instance, if ten fish are analyzed, each of the ten fish may exhibit distinct genotypes at a few microsatellite loci, making it difficult to determine relatedness without any commonly conserved genotypes. In closely related populations, AFLP can readily reveal commonly shared bands which define the common roots in a phylogenetic tree, and polymorphic bands that define branches in the phylogenetic tree. The major weakness of AFLP markers is their dominant nature of inheritance. Genetic information is limited with dominant markers because essentially only one allele is scored; and at the same time, since the true alternative allele is scored as a different locus, AFLP also inflates the number of loci under study. As dominant markers, information transfer across laboratories is difficult. In addition, AFLP is more technically demanding, requiring special equipment such as automated DNA sequencers for optimal operations. AFLP has been widely used in aquaculture in areas such as analysis of population structures, migration, hybrid identification, strain identification, parentage identification, genetic resource analysis, genetic diversity, reproduction contribution, and endangered species protection (Jorde et al., 1999; Seki et al., 1999; Sun et al., 1999; Cardoso et al., 2000; Chong et al., 2000; Kai et al., 2002; Mickett et al., 2003; Whitehead et al., 2003; Mock et al., 2004; Campbell and Bernatchez, 2004; Simmons et al., 2006). AFLP has also been widely used in genetic linkage analysis (Kocher et al., 1998; Liu et al., 1998, 1999; Griffiths and Orr, 1999; Agresti et al., 2000; Robison et al., 2001; Rogers et al., 2001; Liu et al., 2003; Li et al., 2003), and analysis of parental genetic contribution involving interspecific hybridization (Young et al., 2001) and meiogynogenesis (Felip et al., 2000). In a study of the black rockfish (Sebastes inermis), Kai et al. (2002) used AFLP to distinguish three color morphotypes, in which diagnostic AFLP loci were identified as well as loci with significant frequency differences. In such reproductive isolated populations, it is likely that ‘fixed markers’ of AFLP can be identified to serve as diagnostic markers. Fixed markers are associated most often with relatively less migratory, reproductive isolated populations (Kucuktas et al., 2002). With highly migratory fish species, fixed markers may not be available. However, distinct populations are readily differentiated by difference in allele frequencies. For instance, Chong et al. (2000) used AFLP for the analysis of five geographical populations of Malaysian river catfish (Mystus nemurus) and found that AFLP was more efficient for the differentiation of sub-populations and for the identification of genotypes within the populations than RAPD although similar clusters of the populations were concluded with either analysis.
10
New technologies in aquaculture
In spite of its popularity, AFLP has two fundamental flaws that prohibit its wider applications in the future: the dominance inheritance and lack of information to link it to genome sequence information. In some cases, AFLP can be used as a rapid screening tool, and useful markers can then be converted to SCAR (sequence characterized amplified region) markers. However, genome scale applications of SCAR markers are unlikely.
1.2.3 Microsatellites Microsatellites are simple sequence repeats (SSRs) of 1–6 base pairs. The advantages of microsatellites as molecular markers include their abundance in genomes, even distribution, small locus size facilitating PCR-based genotyping, codominant nature of Mendelian inheritance, and high levels of polymorphism (for a recent review, see Liu, 2007e). Microsatellites are highly abundant in various eukaryotic genomes including all aquaculture species studied to date. In most of the vertebrate genomes, microsatellites make up a few percent of the genome in terms of the involved base pairs, depending on the compactness of the genomes. Generally speaking, more compact genomes tend to contain smaller proportion of repeats including simple sequence repeats, but this generality is not always true. For example, the highly compact genome of Japanese pufferfish contains 1.29 % of microsatellites, but its closely related Tetraodon nigroviridis genome contains 3.21 % of microsatellites (Crollius et al., 2000). During a genomic sequencing survey of channel catfish, microsatellites were found to represent 2.58 % of the catfish genome (Xu et al., 2006; Liu, 2007g). In fugu, one microsatellite was found for every 1.87 kb of DNA. For comparison, in the human genome, one microsatellite was found for every 6 kb of DNA (Beckmann and Weber, 1992). It is reasonable to predict that in most aquaculture fish species, one microsatellite should exist every 10 kb or less of the genomic sequences, on average. Dinucleotide repeats are the most abundant forms of microsatellites. For instance, in channel catfish, 67.9 % of all microsatellites are present in the form of dinucleotide repeats; 18.5 % are present as trinucleotide repeats; and 13.5 % as tetranucleotide repeats, excluding mononucleotide repeats which are not nearly as useful for molecular markers. Generally speaking, dinucleotide microsatellites are the most abundant, followed by tri-, or tetranucleotide repeats but, in some cases, tetranucleotide repeats can be more frequent than the trinucleotide repeats. Of the dinucleotide repeat types, (CA)n is the most common dinucleotide repeat type, followed by (AT)n, and then (CT)n (Toth et al., 2000; Xu et al., 2006). (CG)n type of repeat is relatively rare in the vertebrate genomes, partially because the vertebrate genomes are often A/T-rich. Of the trinucleotide repeats and tetranucleotide repeats, relatively A/T-rich repeat types are generally more abundant than G/C-rich repeat types. Microsatellites longer than tetranucleotide repeats (penta- and hexanucluotides) are much less abundant and
Genome-based technologies useful for aquaculture research
11
therefore, are less important as molecular markers (Toth et al., 2000). It is important to point out that the definition of microsatellites limiting to repeats of six bases long is quite arbitrary. Technically speaking, repeats with seven bases or longer sequences are also microsatellites but, because they become rarer as the repeats are longer, they are less relevant as molecular markers. Microsatellites are distributed in the genome on all chromosomes and all regions of the chromosome. They have been found inside gene coding regions (e.g. Liu et al., 2001), introns, and in the non-gene sequences (Toth et al., 2000). The best known examples of microsatellites within coding regions are those causing genetic diseases in humans, such as the CAG repeats that encode the polyglutamine tract, resulting in mental retardation. In spite of their wide distribution in genes, microsatellites are predominantly located in non-coding regions (Metzgar et al., 2000). Only about 10–15 % of microsatellites reside within coding regions (Moran, 1993; van Lith and van Zutphen, 1996; Edwards et al., 1998; Serapion et al., 2004). This distribution should be explained by negative selection against frameshift mutations in the translated sequences (Metzgar et al., 2000; Li et al., 2004). Because the majority of microsatellites exist in the form of dinucleotide repeats, any mutation by expansion or shrinking would cause frameshift of the protein encoding open frames if they reside within the coding region. This also explains why the majority of microsatellites residing within coding regions have been found to be trinucleotide repeats, though the presence of dinucleotide repeats and their mutations within the coding regions do occur. Most microsatellite loci are relatively small, ranging from a few to a few hundred repeats. The relatively small size of microsatellite loci is important for PCR-facilitated genotyping. Generally speaking, within a certain range, microsatellites containing a larger number of repeats tend to be more polymorphic, though polymorphism has been observed in microsatellites with as few as five repeats (Karsi et al., 2002). For practical applications, microsatellite loci must be amplified using PCR. For best separations of related alleles that often differ from one another by as little as one repeat unit, it is desirable to have small PCR amplicons, most often within 200 bp. However, due to the repetitive nature of microsatellites, their flanking sequences can be quite a simple sequence as well, prohibiting the design of PCR primers for the amplification of microsatellite loci within a small size limit. Microsatellites are highly polymorphic as a result of their hypermutability and thereby the accumulation of various forms in the population of a given species. Microsatellite polymorphism is based on size differences due to varying numbers of repeat units contained by alleles at a given locus. Microsatellite mutation rates have been reported as high as 10−2 per generation (Weber and Wong, 1993; Crawford and Cuthbertson, 1996; Ellegren, 2000), which are several orders of magnitude greater than that of
12
New technologies in aquaculture
non-repetitive DNA (10−9; Li, 1997). In several fish species, the mutation rates of microsatellites were reported to be at the level of 10−3 per locus per generation: 1.3 × 10−3 in common carp (Zhang et al., 2008), 2 × 10−3 in pipefish (Jones et al., 1999), 3.9–8.5 × 10−3 in salmon (Steinberg et al., 2002) and 2 × 10−3 in dollar sunfish (MacKiewicz et al., 2002). Microsatellites are inherited in a Mendelian fashion as codominant markers. This is one of the strengths of microsatellite markers in addition to their abundance, even genomic distribution, small locus size, and high polymorphism. Genotyping of microsatellite markers is usually straightforward. However, due to the presence of null alleles (alleles that can not be amplified using the primers designed), complications do exist. As a result, caution should be exercised to ensure that the patterns of microsatellite genotypes fit the genetic model under application. The disadvantages of microsatellites as markers include the requirement for existing molecular genetic information, a large amount of upfront work for microsatellite development, and the tedious and labor-intensive nature of microsatellite primer design, testing, and optimization of PCR conditions. Each microsatellite locus has to be identified and its flanking region sequenced for the design of PCR primers. Technically, the simplest way to identify and characterize a large number of microsatellites is through the construction of microsatellite-enriched small-insert genomic libraries (Ostrander et al., 1992; Lyall et al., 1993; Kijas et al., 1994; Zane et al., 2002). In spite of the variation in techniques for the construction of microsatelliteenriched libraries, the enrichment techniques usually include selective hybridization of fragmented genomic DNA with a tandem repeat-containing oligonucleotide probe and further PCR amplification of the hybridization products. In spite of the simplicity in the construction of microsatelliteenriched libraries and thereby the identification and characterization of microsatellite markers, for a large genome project, direct microsatellite marker development may not be the wisest approach. Recent progress in sequencing technologies with the next generation of sequencers will allow large numbers of genomic sequence tags to be generated that would include numerous microsatellites. Microsatellites can be identified and sequenced directly from genome sequence surveys such as bacterial artificial chromosome (BAC) end sequencing (Xu et al., 2006; Somridhivej et al., 2008), and from expressed sequence tag (EST) analysis from which many microsatellites can be developed into type I markers (Liu et al., 1999; Serapion et al., 2004). Caution has to be exercised, however, on microsatellites developed from ESTs. First, due to the presence of introns, one has to be careful not to design primers at the exon–intron boundaries. Second, the presence of introns would make allele sizes unpredictable. Finally, many microsatellites exist at the 5′- or 3′-untranstated region (UTR), making flanking sequences insufficient for the design of PCR primers. While introns are not a problem for microsatellites derived from BAC end sequencing, sequencing reactions often terminate immediately after the microsatellite
Genome-based technologies useful for aquaculture research
13
repeats, which also makes flanking sequences insufficient for the design of PCR primers. Microsatellites have recently become an extremely popular marker type in a wide variety of genetic investigations, as evidenced by the launch of the journal Molecular Ecology Notes, dedicated almost entirely to publishing primer and allele frequency data for newly-characterized microsatellite loci in a wide range of species. Since the late 1990s, microsatellite markers have been used extensively in fisheries research including studies of genome mapping, parentage, kinships, and stock structure. The major application of microsatellite markers is for the construction of genetic linkage and quantitative trait loci (QTL) maps. This is because of the high polymorphic rate of microsatellite markers. When a resource family is produced, the male and female fish parents are likely to be heterozygous in most microsatellite loci. The high polymorphism of microsatellites makes it possible to map many markers using a minimal number of resource families. There are other reasons for the popularity of microsatellites, one of which is that microsatellites are sequence-tagged markers that allow them to be used as probes for the integration of different maps including genetic linkage and physical maps. Communication using microsatellite markers across laboratories is easy, and the use of microsatellite across species borders is sometimes possible if the flanking sequences are conserved (FitzSimmons et al., 1995; Rico et al., 1996; Cairney et al., 2000; Leclerc et al., 2000). As a result, microsatellites can be also used for comparative genome analysis. If microsatellites can be tagged to gene sequences, their potential for use in comparative mapping is greatly enhanced. In spite of the popularity and great utilization of microsatellites, recent advances in molecular markers will have a major impact on the choice of DNA markers. In particular, the rapid progress in SNP, including its rapid identification and automation in genotyping, makes SNP the far more preferred marker system for genome studies as detailed below.
1.2.4 Single nucleotide polymorphism (SNP) SNP describes polymorphisms caused by point mutations that give rise to different alleles containing alternative bases at a given nucleotide position within a locus (for a recent review, see Liu, 2007f). Such sequence differences due to base substitutions have been well characterized since the beginning of DNA sequencing in 1977, but genotyping SNPs for large numbers of samples was not possible until several major technological advances in the late 1990s. SNPs are again becoming a focal point of molecular markers since they are the most abundant polymorphism in any organism, adaptable to automation, and reveal hidden polymorphism not detected with other markers and methods. SNP markers have been regarded by many as the markers of choice in the future.
14
New technologies in aquaculture
Theoretically, a SNP within a locus can produce as many as four alleles, each containing one of four bases at the SNP site: A, T, C, and G. Practically, however, most SNPs are usually restricted to one of two alleles (quite often either the two pyrimidines C/T or the two purines A/G) and have been regarded as bi-allelic. They are inherited as codominant markers in a Mendelian fashion. In spite of its increasing popularity as the choice of markers for the future, SNP discovery is a daunting task. As defined by its definition, SNP discovery depends on sequencing. Several approaches have been used for the discovery of SNPs in humans and animals. Earlier efforts used approaches such as single-strand conformation polymorphism (SSCP) analysis (Gonen et al., 1999), heteroduplex analysis (Sorrentino et al., 1992), and direct DNA sequencing. However, several recently developed approaches provide greater efficiencies, two of which are described here in detail. The first and the simplest one is to conduct deep sequencing of reduced representation libraries (Altshuler et al., 2000; Van Tassel et al., 2008). In this method, genomic DNA from multiple individuals is mixed and digested with restriction endonuclease and subjected to electrophoresis through an agarose gel. The idea is that the allelic fragments from these individuals (with potential SNPs) should all migrate to the same gel location. The gel slice is cut and the DNA extracted for the construction of the reduced representation library. The reduced representation library is deeply sequenced to generate coverage of 20–30X using next generation DNA sequencers. The generated sequences can then be assembled for the identification of SNPs. Solexa sequencing can be used for species in which a draft genome sequence exists where assembly of the short sequence tags can be achieved. Longer sequences would be needed if a draft genome sequence is not yet available. In most aquaculture species, draft genome sequences are not yet available, and therefore 454 sequencing should be considered. The second strategy involves data mining from EST projects, if EST libraries were constructed using multiple individuals (each individual contains two sets of chromosomes so it is possible also to use just one individual, but a greater level of polymorphism is provided by multiple individuals). This approach is realistic because EST resources already exist, or are to be developed for the majority of important aquaculture species. In addition, EST-derived SNPs are coming from genes and therefore are type I markers. Mapping of gene-associate SNPs would allow analysis of association of SNPs with traits for the discovery of the ‘causing SNPs’ for the traits (Bader, 2001; Marnellos, 2003; Halldorsson et al., 2004; Stram, 2004). However, this approach has major limitations. Because of evolutionary restraint on mutations in coding regions, SNP rates are generally much lower in coding regions than in non-coding regions. The major problem of EST-derived SNPs could be related high sequence errors in EST sequenc-
Genome-based technologies useful for aquaculture research
15
ing resulting in pseudo-SNPs (Wang et al., 2008b). In order to avoid pseudoSNPs, two factors appeared to be crucial: the contig sizes and the lower sequence allele frequency. Contigs larger than four sequences with the minor sequence being represented at least twice seem to provide a high level of SNP validation rates (Wang et al., 2008). SNP genotyping requires special equipment. Many methods have been developed through the years to differentiate the alleles of SNPs. A lot of the earlier methods, in spite of being adaptable to individual laboratory situations, are not suitable for large-scale genome-wide applications. These include direct sequencing, single base sequencing (reviewed by Cotton, 1993), allele-specific oligonucleotide (ASO, Malmgren et al., 1996), heteroduplex analysis, denaturing gradient gel electrophoresis (DGGE, Cariello et al., 1988), single strand conformational polymorphism assays (SSCP, Suzuki et al., 1990), and ligation chain reaction (LCR, Kalin et al., 1992). Large-scale analysis of SNP markers, however, depends on the availability of expensive, cutting-edge equipment. Several options are available for efficient genotyping using the state of the art equipment. Particularly popular are methods involving MALDI– TOF (Matrix-assisted laser desorption ionization – time of flight) mass spectrometry (Ross et al., 1998; Storm et al., 2003), and the BeadArray technology developed by Illumina. The latter, as it can be adapted for largescale genome studies, is becoming the most popular SNP genotyping method. The BeadArray technology is based on 3-micron silica beads that self assemble in microwells on either of two substrates: fiber optic bundles or planar silica slides. When randomly assembled on one of these two substrates, the beads have a uniform spacing of ∼5.7 microns. Each bead is covered with hundreds of thousands of copies of a specific oligonucleotide that act as the capture sequences in one of Illumina’s assays (Fig. 1.1). The manufacturing process includes a sequential hybridization of every single array element (bead with oligos). This process, called decoding, allows validation of every feature of every array to ensure that each array element is present and functional. The allele discrimination at each SNP locus is achieved by using three oligos (P1, P2, and P3, Fig. 1.2), of which P1 and P2 are allele-specific and are Cy3- and Cy5-labeled. P3 is locus-specific designed several bases downstream from the SNP site. Upon allele-specific extension and ligation, the artificial, allele-specific template is created for PCR using universal primers. If the template DNA is homozygous, either P1 or P2 will be extended to meet P3; if the template is heterozygous, both P1 and P2 will be extended to meet P3, allowing ligation to happen (Fig. 1.2). P3 contains a unique address sequence that targets a particular bead type with complementary sequence to the address sequence. After downstream-processing, the single-stranded, dye-labeled DNAs are hybridized to their complement bead type through their unique address sequences. After hybridization, the BeadArray Reader is used to analyze fluorescence signal on the beadchip,
16
New technologies in aquaculture Optical fiber bundle Bead library each with a distinct oligonucleotide capture probe
cataaatattctggcaagga
cactatgaccttctggata cggcatcagtggactgggct atacaaaggcttgtactttt gaagggacttgcactgttgc tgcacaggtgaccaataccc
Fig. 1.1 Schematic illustration of the BeadArray technology.
which is in turn analyzed using software for automated genotype clustering and calling (http://www.illumina.com/). The Illumina platform is highly cost-effective and has been widely used for large-scale SNP analysis in the Human Genome Project. Among all the factors, the relatively low cost of the Illumina genotyping platform is the key for selection of an SNP genotyping platform. Currently, Illumina offers two platforms for the BeadArray technology: the GoldenGate® Platform for up to 7600 SNPs, and the iSelect® platform for 7600–60 000 SNPs. On the basis of cost per sample, the iSelect® platform is the most efficient with a cost of several cents per sample. In spite of its current low levels of application in aquaculture genome research, SNP markers should gain in popularity as more and more sequence information becomes available in aquaculture species. Equally important, once the genetic linkage maps are well constructed, genome scans for QTLs are expected to follow to study traits important to aquaculture, which then depends on the use of well-defined association analysis. As SNP markers are great markers for the analysis of trait–genotype associations, their application to aquaculture will become essential. It is clear that SNPs will
Genome-based technologies useful for aquaculture research
17
A/G P1 P2 P1 P2
T C
Address P3
P3
Allele-specific extension and ligation PCR with P1, P2, and P3
Homozygous A/A Homozygous G/G Heterozygous A/G
Fig. 1.2 Allele discrimination using BeadArray technology. The allele discrimination at each SNP locus is achieved by using three oligos (P1, P2, and P3, of which P1 and P2 are allele-specific and are Cy3- and Cy5-labeled. P3 is locus-specific designed several bases downstream from the SNP site. Upon allele-specific extension and ligation, the artificial, allele-specific template is created for PCR using universal primers. If the template DNA is homozygous, either P1 or P2 will be extended to meet P3; if the template is heterozygous, both P1 and P2 will be extended to meet P3, allowing ligation to happen, generating templates for successful PCR. By measurements of red, green, or yellow of the fluorescence, the genotypes can be readily called.
become the major markers of choice for genome research and genetic improvement programs in aquaculture.
1.2.5 Trends in DNA marker technologies DNA marker technologies have become essential for aquaculture genetics research and the genetic improvement of aquaculture species. As a matter of fact, DNA markers, both the quality and quantity, have always been a limiting factor for in-depth genome research. Throughout the years, aquaculture geneticists have used various markers including allozyme markers, mitochondrial markers, RFLP markers, RAPD, AFLP, microsatellites, and SNPs. The overall trend, however, has been driven by: (i) the need for large numbers of markers for high-density coverage of the genomes, and (ii) the need for sequence-tagged markers for comparative genome analysis. Such demands have driven aquaculture genetic research away from using systems that do not offer a great number of markers such as RFLP and allozyme markers, and away from anonymous dominant markers such as RAPD and AFLP. Microsatellites, being codominant and sequence-tagged, have recently become very popular. However, with the draft genome sequence
18
New technologies in aquaculture
very soon becoming available for major aquaculture species, microsatellites are not without limitations. Their genotyping can be multiplexed, but the extent of multiplexing is limited. Automation of microsatellite genotyping is limited, thus prohibiting large-scale genome-wide applications. Mapping of thousands of microsatellites to the genome involves a lot of work, and analysis using tens or hundreds of thousands of microsatellites would be a daunting task, if not technically impossible for repeated analysis. This only leaves the SNP marker system to be viable. SNPs are the most abundant markers in genomes when compared to any other types of markers; SNPs are sequence-tagged and therefore would allow comparative mapping analysis; SNP genotyping is highly automated and therefore is adaptable to large-scale genome-wide analysis. Therefore, it is clear that SNP markers are the choice marker of the future. In spite of the current lack of draft whole genome sequences for aquaculture species, it is anticipated that they will soon become available for major aquaculture species. In addition, the availability of next generation sequencing technologies (see below) makes it unnecessary to have the whole genome draft sequences in order to develop a large number of SNP markers.
1.3 DNA sequencing technologies Two independent DNA sequencing technologies were originally invented in 1977, and they have been referred to as Sanger’s enzymatic method and Maxam-Gilbert chemical method (Maxam and Gilbert, 1977; Sanger et al., 1977). Since the 1980s, most DNA has been sequenced by the enzymatic method as the chemical method never gained popularity because of its use of toxic chemicals in the reactions. However, the Sanger’s method, once the golden standard, is rapidly losing ground as the next generation DNA sequencers are now emerging. As the principles and applications of original DNA sequencing technologies, especially those of the Sanger’s DNA sequencing technology, were well documented and most readers are familiar with them, this section will focus on the next generation of DNA sequencing technologies. Readers who are interested in the basic principles of the traditional Sanger’s sequencing are referred to a chapter in Aquaculture Genome Technologies (Liu, 2007i,j). Several major new sequencing platforms have been adopted recently, and they are collectively referred to as the next generation DNA sequencers. A common feature among the new generation of sequencing procedures is the elimination of the need to clone DNA fragments and the subsequent amplification and purification of DNA templates prior to sequencing. Instead, sequence templates are handled in bulk, and massively parallel sequencing allows the generation of numerous sequences simultaneously. Readers need to know that many sequencing platforms are being developed, and this field is one of the most active areas in technology
Genome-based technologies useful for aquaculture research
19
Table 1.1 Comparison of three next generation sequencing platforms Platform
SOLiD
454
Solexa
Vendor Sequence tags per run Bases per run Potential applications
Applied Biosystems 240 million
454 Life Sciences 500 000
Illumina >20 million
6 × 109 bp Resequencing, gene expression analysis, microRNA discovery, chromatin immune-precipitation (ChIP)
1.2 × 108 bp Resequencing, gene expression analysis, microRNA discovery, ChIP, whole genome de novo sequencing
1 × 109 bp Resequencing, gene expression analysis, microRNA discovery, ChIP
development. The next section will focus only on the principles of three sequencing platforms: the SOLiDTM sequencing platform, and the Solexa sequencing platform, and the 454 sequencing platform (Table 1.1).
1.3.1 The SOLiD sequencing platform The SOLiD (Sequencing by Oligonucleotide Ligation and Detection) method utilizes ligation of fluorescently labeled 8-mer primers containing random bases at six of its eight positions and specific dinucleotides at the remaining two positions (the earliest version was the fourth and the fifth, but it can be the first and second, and that will be used for explanation here). The primers are fluorescently labeled with four specific dyes with each dye corresponding to four specific dinucleotides. Note that at each DNA base position, there are four base possibilities: A, C, G, or T. For dinucleotide at two consecutive base positions, a total of 16 dinucleotides (AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, and TT) should cover all possibilities. In order to make each of the four fluorescent dyes uniquely represent one specific nucleotide, a two-step decoding process is required. A random primer is ligated to the template only when the first and second nucleotides on the primer are complementary to those on the template. After visualizing the color, the fluorescent tag is removed by cleaving the primer between the fifth and sixth positions, removing bases 6, 7, and 8. The process is repeated; and in the second round of ligation, a new primer is ligated, with the new first and second nucleotides on the primer being complementary to those on the template, counting from the end of the previously ligated primer after cleavage (base 6 and 7 of the previous primer). Repeat this process and every first and second position is recorded. Next, the system is reset to generate the recording for every n − 1, n − 2, n − 3, and n − 4 position (Kate Marusina, http://www.
20
New technologies in aquaculture
genengnews.com/articles/chitem.aspx?aid=1946) such that each base included in the dinucleotide is ‘sequenced’ twice to allow base calling. For example, the base at position 4 is sequenced in the dinucleotide base 3 and base 4, and it is sequenced again in the dinucleotide base 4 and base 5. As with all next generation sequencing platforms, the SOLiD sequencing does not require cloning of genomic DNA. It starts with the creation of a ‘library’ by ligation of two adaptors to sheared genomic DNA (Fig. 1.3). Once the adapters are ligated to the library, emulsion PCR is conducted using the common primers to generate ‘bead clones’ in which each contains a single nucleic acid species. Each bead is then attached to the surface of a flow cell (microscope slide) via 3′ modifications to the DNA strands (Fig. 1.4). Each microbead can be considered a separate sequencing reaction which is monitored simultaneously via sequential digital imaging.
Shear DNA
Ligate adaptors, P1 and P2
Fig. 1.3
Making ‘libraries’ of sheared segments by ligating to two adaptors as the first step of SOLiD sequencing.
+
P1 P2
+
Polymerase
Clonal PCR
+ P1 coated beads
Fig. 1.4 Clonal amplification of genomic DNA in SOLiD sequencing. Each genomic DNA segment with adaptors is absorbed to beads and amplified by using the adaptor primers to generate numerous clones ready for sequencing.
Genome-based technologies useful for aquaculture research
21
SOLiD sequencing chemistry depends on specific ligation of a random primer to the existing primer only when the random primer harbors the specific dinucleotide that is complementary to the template DNA being sequenced. The actual base detection is no longer done by the polymerasedriven incorporation of labeled dideoxy terminators. Instead, SOLiD uses a mixture of labeled oligonucleotides and queries the input strand with ligase. In the early version, each oligo has degenerate nucleotide at positions 1–3 (N′s at 3′ first three bases), one of 16 specific dinucleotide at positions 4–5, and degenerate nucleotide at positions 6–8 that are fluorescently labeled (demonstrated in Fig. 1.3 with the first and second nucleotide being specific, and the remaining bases being degenerate). The sequencing reaction involves: (i) hybridization and ligation of a specific oligo whose 4th and 5th bases match that of the template; (ii) detection of the specific fluor associated with the specific dinucleotide; (iii) cleavage of bases 6–8; (iv) repeat, this time querying the 9th and 10th bases. Seven cycles of ligation would allow putative nucleotide identities at positions 4 and 5, 9 and 10, 14 and 15, 19 and 20, 24 and 25, 29 and 30, and 34 and 35 to be recorded. After seven cycles of this, a ‘reset’ is performed in which the initial primer and all ligated portions are melted from the template and discarded. Next a new initial primer is used that is N−1 in length. Repeating the initial cycling (steps 1–4) now generates an overlapping data set. In this manner, ligations using primer N generate sequences for bases 4 and 5, 9 and 10, 14 and 15, 19 and 20, 24 and 25, 29 and 30, and 34 and 35; ligations using primer N−1 generate sequences for bases 3 and 4, 8 and 9, 13 and 14, 18 and 19, 23 and 24, 28 and 29, and 33 and 34, and so on. After use of primers N, N−1, N−2, N−3, and N−4, every base is ‘sequenced’ twice using two primers (Table 1.2). Base calling is dependent on a two-step encoding procedure with known nucleotides in every fourth and fifth position of the primer (Fig. 1.5). For example, the dinucleotides CA, AC, TG, and GT are all encoded by the green dye. Because each base is queried twice, it is possible, using the two colors, to determine which bases were at which positions. For instance, if the sequence is TCGAACGTA . . . blue label is detected for the first ligation reaction using primer N that determines base composition at Table 1.2 Schematic illustration of the base positions sequenced by each ligation and using various primers. Each black bar represents the two bases sequenced by each ligation, and the numbers above the bars indicate the base positions to be sequenced. The primers N, N−1, N−2, N−3, and N−4 are indicated in the first column 0 1 2 3 4 5 6 7 8 9 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 N –1 –2 –3 –4
22
New technologies in aquaculture n–1
3′ A-T-n-n-n-z-z-z
1st base
2nd base A C G T
A-A-n-n-n-z-z-z
A
Ligase 3′
C G T
3′ Bead …… 5′
3′ 7x Ligation
Use n–1, n–2, n–3, and n–4 primers
3′
Primer
p5′
A-C-n-n-n-z-z-z
Adapter sequence
3′
A-G-n-n-n-z-z-z
Template sequence Record fluorescence
Primer A-C-n-n-n-z-z-z
Bead …… 5′
TG Adapter sequence Cleavage
3′
Primer
Template sequence
z-z-z
A-C-n-n-n p5′ Bead …… 5′
TG Adapter sequence
Template sequence
Fig. 1.5 Chemistry of SOLiD sequencing platform. The SOLiD sequencing utilizes ligation of fluorescently labeled 8-mer primers containing random bases at six of its eight positions. Shown here the first two bases are specific dinucleotide that are specifically labeled as displayed by the dotted circles, e.g., AA: blue, AC: green, AG: yellow, and AT: red. A random primer is ligated to the template only when the first and second nucleotides on the primer are complementary to those on the template. After visualizing the color, the fluorescent tag is removed by cleaving the primer between the fifth and sixth positions, removing bases 6, 7, and 8. The process is repeated; and in the second round of ligation, a new primer is ligated with the new first and second nucleotides on the primer being complementary to those on the template, counting from the end of the previously ligated primer after clevage (base 6 and 7 of the previous primer). Next, the system is reset to generate the recording for every n−1, n−2, n−3, and n−4 positions by using N−1, N−2, N−3, and N−4 primers.
base 4 and 5. There are still four possibilities with blue label: AA, CC, GG, and TT. However, in the first ligation reaction of primer N−1, yellow label is detected, which effectively calls the base at position 4 to be ‘A’. Similarly, with the second ligation reaction using N−4 primer (that determines base compositions at base 5 and 6), green should be detected that effectively calls the base at position 5 to be ‘A’ as well. Repeating this decoding process to include ‘sequencing’ of each base with two primers will provide unambiguous base callings.
Genome-based technologies useful for aquaculture research
23
As with any other type of technology, SOLiD sequencing technology is making rapid improvements allowing greater throughput and more applications. Several areas are under intense scrutiny to increase the efficiency and accuracy of the technology including: increasing the bead density, read lengths, and ability of multiplexing. Currently, SOLiD read length is around 35 bases, and it is anticipated to be 50 bases in 2009. The SOLiD sequencing technology has wide applications including, but not limited to, targeted resequencing, gene expression analysis by digital counting of sequence tags (e.g., Cloonan et al., 2008), microRNA discovery, chromatin immune-precipitation (ChIP), and whole genome sequencing. Due to its short read length, it is anticipated that its application to whole genome sequencing will be mostly applicable to whole genome resequencing. However, it is less amenable to de novo whole genome sequencing projects because the assembly of whole genome based on short sequence tags has proven to be a great challenge. Because the technology is quite new, there are no publications covering the use of the SOLiD sequencing platform in aquaculture species, to the author’s best knowledge.
1.3.2 The Solexa sequencing platform The Solexa sequencing platform depends on two of its core technologies: the Clonal Single Molecule ArrayTM technology that allows simultaneous analysis of hundreds of millions of individual molecules, and the reversible terminator technology that allows specific base calling based on sequencing by synthesis. Solexa sequencing starts with sheering of genomic DNA to small segments to which different adaptor sequences are ligated to either end. Upon binding single-stranded template DNA fragments with adaptors randomly to the inside surface of the flow cell channels, template DNA is amplified clonally through bridge PCR. DNA is sequenced by detection of fluorescently labeled dideoxynucleotide terminators. These specially created nucleotides, which also possess a reversible termination property, allow each cycle of the sequencing reaction to occur simultaneously in the presence of all four nucleotides (ddA, ddC, ddT, ddG). In the presence of all four nucleotides, the polymerase is able to select the correct base to incorporate, with the natural competition between all four alternatives leading to higher accuracy than methods where only one nucleotide is present in the reaction mix at a time (which require the enzyme to reject an incorrect nucleotide). Sequences where a particular base is repeated one after another (‘homopolymer repeats’) are dealt with as for any other sequence and with high accuracy; this avoids the problems of measuring intensity and deducing how many bases were present in the repeat that are the cause of uncertainty seen with ‘one base per reaction’ methods, as described with the 454 sequencing platform. Solexa sequencing technology achieves an unparalleled data density with highly accurate results. A typical Solexa sequencing run generates millions
24
New technologies in aquaculture
of sequence tags with the capability to generate over a billion bases of DNA sequence per run. Currently, the read length is limited to about 35 bp. Like the SOLiD sequencing technology, the Solexa sequencing technology has wide applications including, but not limited to, gene expression analysis by digital counting of sequence tags, microRNA discovery, epigenetic studies, ChIP, and whole genome sequencing (Bentley, 2006; Butler et al., 2008; Chen et al., 2008; Cokus et al., 2008; Dolan and Denver, 2008; Glazov et al., 2008; Hillier et al., 2008). However, due to its short read length, it is anticipated that its application to whole genome sequencing will be mostly applicable to whole genome re-sequencing. As Solexa technology is also quite new, its application in aquaculture species is still limited, but the potential is tremendous. One of the earliest applications of the Solexa technology was actually conducted in oysters. Dennis Hedgecock’s group used the Solexa technology for the study of genes involved in heterosis of pacific oysters (Hedgecock et al., 2007).
1.3.3 The 454 sequencing platform 454 sequencing is based on pyrosequencing. During DNA synthesis, a pyrophosphate (PPi) is released when each base is incorporated. The released pyrophosphate can be converted to adenosine triphosphate (ATP) that generates a fluorescent signal upon the actions of luciferase in the presence of its substrates. Measurement of the light signal after sequential injection of A, C, G, and T would allow the determination of the base composition. After each base addition, the whole sequencing reaction system is reset by cleaning out all existing ATP and nucleotides with apyrase. When mononucleotide repeats are encountered in the sequence, the pyrosequencing reaction continuously incorporates the repeated nucleotide until it reaches a different nucleotide. The light signal produced is proportional to the number of mononucleotides incorporated–up to eight bases. Mononucleotide repeats greater than 8 bp cannot be accurately sequenced by pyrosequencing. The 454 sequencing platform uses microfabricated high-density picolitre reactors (Margulies et al., 2005). No cloning is necessary for 454 sequencing. The clonal DNA used for sequencing is obtained by clonal PCR amplification of a single molecule in emulsified water-in-oil microreactors. Preparation of the DNA library consists of a few simple steps. Genomic DNA is fractionated into smaller fragments (300–500 bp) that are subsequently filled in to polished ends (blunted), allowing ligation of adaptors to the genomic DNA for PCR amplification. In order to prevent intermolecular ligation of the genomic DNA fragments, the DNA fragments are dephosphorylated. Short adaptors (A and B) are then ligated onto the ends of the fragments. After ligation, the gap needs to be repaired, presumably using a DNA ligase. The adaptors provide priming sequences for both amplification and sequencing of the sample-library fragments. The two adaptors are
Genome-based technologies useful for aquaculture research
25
different. Adaptor B contains a 5′-biotin tag that enables immobilization of one strand of the library onto streptavidin coated beads. The nonbiotinylated strand is released and used as a single-stranded template DNA library. The single-stranded template DNA library is immobilized onto beads carrying short primers complementary to the adaptor A sequences by base pairing. The key element here is attaining the correct proportion of beads to DNA molecules such that only one molecule is captured by each bead. The beads containing a single molecule of the single-stranded template are emulsified with the amplification reagents in a water-in-oil mixture. Each bead is captured within its own microreactor where PCR amplification occurs. This results in bead-immobilized, clonally amplified DNA fragments. The single strand template DNA library beads are added to the DNA bead incubation mix (containing DNA polymerase) and are layered with enzyme beads (containing sulfurylase and luciferase) onto the PicoTiterPlate device. The device is centrifuged to deposit the beads into the wells. The layer of enzyme beads ensures that the DNA beads remain positioned in the wells during the sequencing reaction. Due to the size of the wells in relation to the beads, only one bead containing a specific clonally amplified genomic DNA segment should be placed into each well of the PicoTiterPlate device. The loaded PicoTiterPlate device is placed into the ‘454 sequencer’, the Genome Sequencer 20 Instrument or the FLX generation systems, which performs pyrosequencing-like reactions. Unlike a traditional pyrosequencing reaction, hundreds of thousands of beads, each with millions of copies of clonally amplified DNA, are sequenced in parallel. Each well of the PicoTiterPlate device is a separate pyrosequencing reaction. If a nucleotide complementary to the template strand is flowed into a well, the polymerase extends the existing DNA strand by adding a nucleotide(s). Addition of one (or more) nucleotide(s) results in a reaction that generates a light signal that is recorded by the CCD camera in the instrument. The signal strength is proportional to the number of nucleotides incorporated in a single nucleotide flow. Typically, over 200 000 reads can be achieved in a single run. Assuming generation of 250 bp by a single reaction, each run should generate 50 million bp or more of sequence in several hours using a single instrument. This is approximately a 10X coverage of a bacterial genome! The 454 sequencing platform holds much potential for its great applications such as gene expression profiling, epigenetic analysis, and whole genome sequencing (Patrick, 2007; Bekal et al., 2008; Hafner et al., 2008; Vera et al., 2008). The 454 sequencing platform is probably the most promising technology for de novo whole genome sequencing among the next generation sequencers as it produces sequences of approximately 250 bp, that is significantly shorter than the traditional Sanger sequencing (800– 1000 bp), but much longer those generated by SOLiD or Solexa sequencing
26
New technologies in aquaculture
platforms. The current major problems prohibiting its application for the sequencing of complex genomes are its relatively short sequencing reads and difficulties in accurate determination of homopolymeric runs in the DNA. The short reads complicate genome sequence assembly, while the inability to determine the number of bases within a long homopolymeric run prohibits accurate sequencing of genomes. These problems are more significant for complex genomes with high levels of repeat structure. However, the technologies’ high throughput and low costs are very attractive, especially for aquaculture species. As the technology is perfected to minimize these drawbacks, the 454 sequencing platform will show even greater promise.
1.4 Gene discovery technologies Performance and production traits are controlled by genes, environments, and gene–environment interactions. In order to gain detailed understanding of performance and production traits, understanding the genes in aquaculture genomes become essential. Sequencing of ESTs has been the primary approach for the discovery of genes in aquaculture species, although several other approaches are also available such as serial analysis of gene expression (SAGE). Recently, however, the adoption of several novel sequencing platforms using next generation sequencers has allowed generation of expressed sequence tags through de novo sequencing of whole transcriptomes.
1.4.1 Expressed sequence tags and gene discovery ESTs are single pass sequences of random cDNA clones. They are partial cDNA sequences corresponding to mRNAs generated from randomly selected cDNA library clones (for recent reviews, see Liu, 2006, 2007h). EST analysis has traditionally been conducted by sequencing random cDNA clones from cDNA libraries. Such an approach is efficient at initial stages of gene discovery, but has proven to be inefficient in the gene discovery of rarely expressed genes. The rate of gene discovery usually drops precipitously soon after reaching a level of several thousand ESTs. By using regular cDNA libraries, the most abundantly expressed genes would have been sequenced many times before the most rarely expressed genes are sequenced just once. Clearly, EST sequencing from non-normalized libraries is inefficient for gene discoveries of rarely expressed genes. Normalization decreases the prevalence of clones representing abundant transcripts and dramatically increases the efficiency of random sequencing and rare gene discovery. Normalized cDNA libraries are cDNA libraries that have been equalized in representation to reduce the representation of abundantly expressed
Genome-based technologies useful for aquaculture research
27
genes and to increase the representation of rarely expressed genes. While the details of how the subtraction is conducted may differ greatly, the basic principles behind normalization are the same, i.e. they all depend on the faster hybridization kinetics of abundantly expressed genes to form doublestranded complexes that can be removed by various means, whereas it takes a long time for the rarely expressed genes to reassociate. Several strategies have been developed for the normalization of cDNA libraries, but the fundamental principles behind all the normalization procedures are the same. We have used a strategy utilizing the Evrogen Trimmer-Direct Kit (http://www.evrogen.com/p3_2.shtml). This system is specially developed to normalize cDNA enriched with full length sequences (Zhulidov et al., 2004). The method involves denaturation–reassociation of cDNA, degradation of ds-fraction formed by abundant transcripts, and PCR amplification of the equalized ss-DNA fraction. The key element of this method is degradation of ds-fraction formed during reassociation of cDNA using duplex-specific nuclease (DSN) enzyme (Shagin et al., 2002). A number of specific features of DSN make it ideal for removing ds-DNA from complex mixtures of nucleic acids. DSN displays a strong preference for cleaving ds-DNA in both DNA–DNA and DNA–RNA hybrids, compared to ss-DNA and RNA, irrespective of the sequence length. Moreover, the enzyme remains stable over a wide range of temperatures and displays optimal activity at 55–65 ºC. Consequently, degradation of the ds-DNAcontaining fraction by this enzyme occurs at elevated temperatures, thereby decreasing loss of transcripts due to the formation of secondary structures and non-specific hybridization involving adapter sequences. EST analysis is one of the most rapid approaches for gene discovery. A small collection of ESTs in a species without any genome information can result in the rapid identification of a large number of genes. Gene discovery and identification is, therefore, the primary function of EST analysis. Because of the exceptionally high gene discovery rate of the EST approach, EST analysis has been extremely popular. The EST database dbEST has been one of the fastest growing databases at NCBI. As of May 30, 2008, there are 52 858 766 entries in the NCBI’s public EST database dbEST (dbEST release 053008, http://www.ncbi.nlm.nih.gov/dbEST/dbEST_ summary.html). Large EST resources are available for several major aquaculture species including Atlantic salmon, rainbow trout, catfish, oysters, and shrimps. ESTs provide the information and material basis for the development of microarrays for the analysis of genome expression as discussed below.
1.4.2 de novo sequencing of whole transcriptomes and gene discovery As detailed under sequencing technologies, all next generation sequencing platforms have the ability to generate hundreds of thousands (the 454 platform) to millions of expressed sequence tags (SOLiD and Solexa
28
New technologies in aquaculture
sequencing platforms) using RNA as the starting material. Clearly, such sequencing projects not only allow many genes to be identified, but, importantly, also allow expression profiling through digital counting of sequence tags, as will be further discussed in Section 1.6. As compared to traditional EST analysis, the next generation sequencing technologies can rapidly produce a large number of expressed sequence tags. They probably provide a much greater power in terms of expression profiling, as accurate estimation can be made based on the number of sequenced tags. In addition, relatively accurate counting of tags from various exons may also provide information concerning alternative splicing and alternative polyadenylation. However, it may be more difficult for the identification of short sequence tags for less conserved genes as no draft genome sequences are yet available from aquaculture species. This problem will soon be alleviated when the draft genome sequences become available. In comparison, the 454 sequencing platform perhaps provides a greater power for sequence identification because of its longer sequence reads, but at the expense of the number of sequence tags to be generated that would otherwise offer greater accuracy for expression profiling based on tag counting.
1.5 Genome mapping technologies Genome mapping and sequencing is the core of structural genomics. While no whole genome draft sequences are yet available for aquaculture species, genomes of many aquaculture species have been subjected to mapping. Genome mapping can be classified into several categories based on resource needs, technology requirement, and principles used in mapping, i.e., genetic linkage mapping, QTL mapping, physical mapping, cytogenetic mapping, radiation hybrid mapping, and comparative mapping (Liu, 2007a). While cytogenetic mapping is highly useful for the identification of chromosomes and physical mapping of genes to chromosomes, its resolution is low for large-scale genome-wide mapping analysis (this is covered in Chapter 2). Limited work has been conducted in comparative mapping of aquaculture species. A recent chapter in Aquaculture Genome Technologies provided excellent coverage on comparative mapping and positional cloning (Lee and Kocher, 2007). Interested readers are referred to the chapter for details on comparative mapping.
1.5.1 Genetic linkage mapping Genetic linkage mapping is an old technology. It is purely based on cosegregation of markers within a well-defined segregating population that is often referred to as the reference family or mapping population. Genetic mapping requires two major resources: the segregating population, and the molecular markers. The segregating population can be F2 population, back-
Genome-based technologies useful for aquaculture research
29
cross progenies, or higher generation of intercrosses. In some cases, F1 can be used and treated as a pseudo-backcross because heterozygous markers are segregating in F1 population. However, for best results, three generation pedigrees are needed to provide non-ambiguous linkage phases. The number of individuals used for mapping analysis depends on the desired resolution. A population of 100 individuals can resolve markers that are 1 cM away (1 out of 100 are recombinant). If higher resolution is needed to detect rare recombinants, larger numbers of the mapping population can be used. Any molecular markers that are polymorphic and segregating in the mapping population in a Mendelian fashion can be used for linkage mapping. However, sequence tagged markers provide codominance and transferability across laboratories and possibly also across species borders allowing comparative mapping analysis (see below). The most often used marker type for linkage mapping is microsatellite, although SNP markers may soon dominate on linkage maps. As the advantages and disadvantages of various types of markers are detailed above, we will not repeat them here. Genetic linkage maps can be constructed upon analysis of marker segregation data within the mapping population. This is achieved by use of various software packages. Linkage maps have been constructed in over 30 major aquaculture species (Table 1.3). A recent review by Danzmann and Gharbi provided excellent details on linkage mapping, and summarized recent progress of linkage mapping in aquaculture species (Danzmann and Gharbi, 2007). It is clear, however, that the marker densities on the genetic linkage maps of aquaculture species are too low currently to provide sufficient coverage for efficient QTL analysis. The use of more markers, in particular the SNPs to be developed, should very soon change the situation.
1.5.2 Quantitative trait loci (QTL) mapping Most performance and production traits are controlled by multiple genes, and simple Mendelian genetic analysis is not therefore sufficient to provide answers as to how many genes are controlling the traits, and how they function. The multigene controlled traits are defined as quantitative traits and the loci controlling the traits are defined as QTL. QTLs can be mapped genetically by correlation of segregating markers with the traits, and such a process is referred to as QTL mapping. QTL mapping starts with creation of a population in which the traits and the markers are segregating. For instance, fish resistant to a particular disease can be crossed with susceptible fish to produce F1 fish. F2 fish can be produced from the F1 fish in which the disease trait is segregating. In a sense, QTL mapping is not any different from genetic linkage mapping except that the proper mapping population is needed in which the trait of interest is segregating along with DNA markers. QTL mapping is the core
Inter-population hybrids Interspecific haploids Interspecific hybrids Outcross
Walking catfish Japanese flounder European sea bass
Ayu Common carp Yellowtails Black tiger shrimp
Channel catfish
Brown trout Arctic charr Tilapia
AFLP, SSR SSR, genes SSR, genes SSR, AFLP, genes AFLP, SSR AFLP, SSR SSR, genes SSR, genes AFLP AFLP AFLP, SSR SSR, genes microsatellites AFLP, SSR SSR, genes, RAPD SSR AFLP
SSR, AFLP, genes
Inter-strain backcross
Outcross Inter-strain backcross Inter-strain backcross Inter-strain backcross Haploids Interspecific 3-way cross Interspecific F2 intercross Outcross Interspecific backcross Haploids Inter-strain hybrids Outcross
Atlantic salmon
AFLP, SSR, genes
Marker type(s)
Double haploids
Mapping panel(s)
Current status of linkage maps in aquaculture species
Rainbow trout
Table 1.3
527 64 302 327 174 292 552 293 506 146 463 174 369 195 272 200 673
1439
1359
Markers
Young et al., 1998 Nichols et al., 2003 Sakamoto et al., 2000 Danzmann et al., 2005 Moen et al., 2004 Gilbey et al., 2004 Gharbi et al., 2006 Woram et al., 2004 Kocher et al., 1998 Agresti et al., 2000 Lee et al., 2005 Waldbieser et al., 2001 Liu et al., 2003 Poompuang and Na-Nakorn, 2004 Coimbra et al., 2003 Chistiakov et al., 2005 Volckaert et al., 2007 Watanabe et al., 2004 Sun and Liang, 2004 Ohara et al., 2005 Wilson et al., 2002
Reference
Outcross Outcross Outcross Inter-population hybrids Outcross Inter-line double hybrids Inter-strain backcross Inter-population hybrids Inter-population hybrids Inter-population hybrids Interspecific hybrids
AFLP AFLP AFLP AFLP AFLP, SSR, genes SSR AFLP AFLP AFLP AFLP, RAPD, SSR AFLP AFLP, SSR AFLP, SSR SSR AFLP SSR
246 401 394 231–241 133–158 102 349 545 503 384 324–339 293 375 204 350 150
Moore et al., 1999 Li et al., 2003 Pérez et al., 2004 Li et al., 2006 Yu and Guo, 2003 Hubert and Hedgecock, 2004 Li and Guo, 2004 Li et al., 2005 Wang et al., 2005 Liu et al., 2006 Zhou et al., 2006 Shen et al., 2007 Ning et al., 2007 Bargelloni et al., 2007 Reith et al., 2007 Morishima et al., 2007
AFLP = amplified fragment length polymorphism, RAPD = random amplified polymorphic DNA, SSR = simple sequence repeats. Source: modified and amended from Danzmann and Gharbi, 2007.
Pacific abalone Sea urchin Guppy Yellow croaker Gilthead sea bream Atlantic halibut Loach
Zhikong scallop
White shrimp Chinese shrimp Eastern oyster Pacific oyster
Kuruma prawn
32
New technologies in aquaculture
of aquaculture genomics as the ultimate practical goal of aquaculture genomic research is to provide tools for genetic improvements. Much progress has been made in QTL mapping in aquaculture species. A recent review by Korol et al. (2007) covered many of the examples of QTL mapping studies in aquaculture species, and interested readers are referred to this review. As a whole, QTL mapping in aquaculture species has fallen behind, and greater efforts should be devoted to this area. The practical application of QTL mapping is marker-assisted selection. There are only few examples of marker-assisted selection in aquaculture species (e.g., Fuji et al., 2007). Before the wider applications of markerassisted selection are developed, the trend is that selection will soon become whole genome-based (Meuwissen et al., 2001), as has already occurred in terrestrial livestock species. With whole genome selection, selection is performed on estimates of associations of phenotype with largest possible markers across the genome. This contrasts with the traditional markerassisted selection which is based on a small number of significant markers, thus limiting overall effectiveness. The application of whole genome selection involves using ‘training data’ to estimate ‘breeding values’ of SNP haplotypes or alleles.
1.5.3 Radiation hybrid mapping The concept of radiation hybrid mapping was initially derived from somatic cell hybrids. Back in the 1970s, technology was developed to fuse different types of cells to form hybrid cell lines. In 1990, Cox et al., resurrected the technology by fusing X-ray radiated cells (donor cells) with normal cells (recipient cells) (Cox et al., 1990). As the chromosomes of the X-ray radiated cells were broken, the cells cannot survive by themselves. However, upon fusion with a recipient cell, broken chromosomal segments from the donor cells can be fused into the recipient cells. In order to have a selection marker for the hybrid cells, a drug-resistant gene (e.g., neo) can be first inserted into the donor cell’s genome. Upon fusion of the cells, the selection drug G418 can be applied to select for hybrid cells as the recipient cells do not have the drug resistance and should be killed by the antibiotic. Fusion cells containing the neo gene would be selected for growth. Clonal expansion of such fused hybrid cells would create a panel of radiation hybrid cell lines with each containing a different segment of the broken chromosomes, along with the chromosomal segments containing the neo gene. Because radiation causes random chromosomal breakage, various chromosomal segments contained within the panel of radiated cell lines would collectively cover the entire genome, with some portions of the chromosomal segments overlapping one another. Such radiation panels are used to map the genome through radiation hybrid (RH) mapping.
Genome-based technologies useful for aquaculture research
33
RH mapping is based on co-retention of markers. A recent chapter in Aquaculture Genome Technologies written by Dr Caird Rexroad provides an excellent explanation for RH mapping (Rexroad, 2007), in which he wrote: ‘RH mapping strategies are based on the concept that markers which are close together on chromosomes will frequently be co-retained in the same hybrids – the probability that irradiation will induce a chromosome break between two markers decreases as the physical distance between the two markers decreases’. To provide adequate statistical support for mapping, marker retention frequencies – the percentage of times a marker is scored positive in a RH panel – is critical. Optimal retention is 20–50 % (Walter and Goodfellow, 1993). RH mapping is calculated based on the co-retention of markers in fragments across the panel. The estimated frequency of breakage between two markers is θ, which ranges from 0 to 1 and is analogous to recombination frequencies (r) used in genetic mapping. A θ value of 0 means two markers are always co-retained, a value of 1 means they are co-retained at random. This raw value is then included in multipoint analyses and transformed into centiRays (cR) – the RH map unit – using map functions similar to those of Haldane or Kosambi which are used in genetic map construction. Hence, observation of chromosome breaks between two markers in RH mapping is analogous to observing recombination between two markers in genetic mapping. In fact, the term ‘linkage’ is often used in RH mapping. The frequency of chromosome breaks between two markers is not only due to their physical distance, but also to the intensity of the radiation used to create the panel. Siden and colleagues conducted experiments to observe the effects of different dosages of radiation on a segment of the human X chromosome (Siden et al., 1992). At 5000 rad 10 % of the clones retained the entire chromosome arm, 40 % had fragments of 3–30 MB, and 50 % had fragments less than 3 MB. At 25 000 rad only 6 % had fragments larger than 3 Mb. Therefore the radiation hybrid map–distance unit is annotated with a subscript stating the dosage used to create the panel in rads, i.e. cR3000. Retention of multiple fragments from a single chromosome in a hybrid cell line complicates analyses; therefore 100–300 cell lines must be scored for a panel to construct statistically significant maps. RH mapping was initially created to map the non-polymorphic markers. Back in the mid-1990s, polymorphic markers were limiting in most species. By fusing cells of the interest species to a rodent cell line, the background genes are usually not amplified by using PCR primers designed from the genes of the species of interest. Thus ESTs were mapped to the genome maps. Later, however, it was found that RH maps were critically important for guiding the whole genome assembly as they are essentially physical linkage maps. RH mapping was mostly applied to mammalian genome mapping, but less so in aquatic species. However, it has been used for the zebrafish, an
34
New technologies in aquaculture
aquatic model organism used to study the genetics of development, growth, reproduction, and disease resistance (Kwok et al., 1999; Geisler et al., 1999; Hukriede et al., 1999). To date, the only aquaculture species in which RH maps have been constructed is the gilthead sea bream (Senger et al., 2006; Sarropoulou et al., 2007). One reason is that higher resolution can be achieved by BAC-based physical maps. In addition, the need to map nonpolymorphic markers is drastically reduced as many polymorphic markers have now become available, especially the SNP markers. Therefore, the application of RH mapping in aquaculture species is limited.
1.5.4 Bacterial artificial chromosome (BAC)-based physical mapping BAC-based physical maps are important for the understanding of genome structure and organization, and for position-based cloning of economically important genes. A well characterized physical map can often be an important foundation for whole genome sequencing. A BAC-based physical map would also allow exploitation of existing genomic information from maprich species using comparative mapping, thus accelerating genome research in the species of interest. The first step of BAC-based physical mapping is the construction of large-insert BAC libraries. BAC libraries are large-insert genomic libraries. A recent chapter in Aquaculture Genome Technologies (He et al., 2007) provided excellent technical details on construction and characterization of BAC libraries, and related chapters by Davidson (2007) and Xu et al. (2007a) had a great coverage on details of physical mapping. Interested readers are referred to these chapters. Briefly, large inserts contained in a BAC library were derived from multiple copies of the genome broken randomly by partial restriction enzyme digest. Therefore, the BAC library can be viewed as multiple genome copies broken randomly into segments that are overlapping one another. Because the genomic segments originally from the same genome locations harbor the same restriction sites, overlapping genome segments can be aligned by the presence of the same sets of restriction fragments. A set of overlapping genome segments aligned by overlapping restriction fingerprints are then defined as a contig [a contig (from contiguous) is a set of overlapping DNA segments derived from a single genetic source], and many contigs make up the entire genome, possibly with gaps (or short overlapping segments, not supporting statistical overlapping status). The efforts to make BAC contig-based physical maps in aquaculture species are a recent event. As a result, physical maps have been only constructed in Atlantic salmon (Ng et al., 2005), tilapia (Katagiri et al., 2005), and channel catfish (Quiniou et al., 2007; Xu et al., 2007b), and a physical map is under construction in rainbow trout (Yniv Palti, USDA ARS, personal communication). It is expected that physical maps will soon be constructed in many of the important aquaculture species.
Genome-based technologies useful for aquaculture research
35
1.6 Genome expression analysis technologies The development of high throughput technologies for global or genomewide measurements of gene expression requires the availability of genome resources. Most often, such genome resources come in the form of whole gene sequencing or the availability of a large resource of expressed sequence tags such that the major fraction of the transcriptome is represented. Once the sequences representing all the genes of an organism or the vast majority of the genes of the organism are known, global or genome-wide measurements of gene expression can be made using either microarray technologies or sequence tag-based technologies.
1.6.1 Microarray technology While microarrays utilize several recent technological innovations, they are, at their core, simply a high-density dot blot. There are two primary approaches to microarrays, differing both in their construction and their sample labeling. Spotted arrays are constructed by spotting long oligos or cDNAs using a printing robot, whereas in situ arrays are constructed by synthesizing short oligos directly onto the slide by photolithography (for a detailed review, see Peatman and Liu, 2007). Spotted array technology encapsulates the printing of either PCR products or long oligos (60–70 mers). Traditionally referred to as cDNA arrays, spotted arrays are today just as likely to be long oligos, as the cost of synthesizing oligos continues to decline, and because the parallel PCR required to prepare for cDNA arrays is labor-intensive, costly, and requires having clones on hand. While these cDNA-associated difficulties can be overcome through hard work and collaboration among members of a species group, the printing of long oligos offers advantages in startup time, the purity of commercial oligo synthesis, easier clone tracking, and the ability to utilize all available sequences in public genetic databases for array construction. Readers are referred to Whitfield et al.’s (2002) EST sequencing and microarray research on honey bee using spotted cDNAs; Rise et al., (2004a) and von Schalburg et al. (2005) describe considerations taken in construction of salmonid spotted cDNA arrays; and Zhao et al. (2005) report validation of a porcine spotted oligo array. Operon Biotechnologies (http://www.operon.com/) is a leading provider of sets of synthetic oligos for microarray spotting, and their website provides an excellent resource for criteria used in gene selection and long oligo design. Additionally, The Institute for Genomic Research (TIGR), well known for its EST indices, provides 70-mer oligo predictions for genes in each of its indices that have been utilized by some groups (Zhao et al., 2005). Researchers should also decide in the design phase their array layout, feature duplication, and the controls to be spotted on the slide (Whitfield et al., 2002; Smyth et al., 2005).
36
New technologies in aquaculture
A variety of microarray slides are available for printing, most are polyL-lysine and amino silane-coated (see Hessner et al., 2004 for surfacechemistry comparisons). Telechem (http://www.arrayit.com/Products/ Substrates/) and Erie Scientific (http://www.eriemicroarray.com/index. aspx) are leading providers of microarray slides. The actual robotic printing of microarrays is increasingly being outsourced to large university core labs or private companies which now have years of experience in the field. For groups that anticipate printing multiple array designs and batches and want increased printing flexibility, purchasing a spotting robot may be a good choice. Perkin Elmer (http://las.perkinelmer.com/) and Genomic Solutions (http://www.genomicsolutions.com) offer popular printing systems. In situ array technology relies on photolithography for microarray construction (Lipshutz et al., 1999), a technique often used in computer chip fabrication. In contrast to spotting nucleotide products on the slide surface, oligonucleotides are synthesized directly on the surface of the array, one base at a time. To achieve sufficient feature densities, unique physical lithographic masks are created for each array design, to either block or allow light to reach the slide. In the places the mask does not cover, light deprotects, or converts, a special protective group to a hydroxyl group. This allows the binding of a single oligo at that specific site by its phosphate group. This oligo also bears a protective group that must be deprotected before an additional oligo can be coupled to it. Through repeated cycles of deprotection and coupling, 25-mer oligos are synthesized directly on the slide at densities currently as high as 1.3 million features per array. Affymetrix (http://www.affymetrix.com/) is recognized as the developer and industry leader for in situ arrays. While their technology made genome-wide arrays a reality for model species and continues to expand the horizons of microarray research in biomedical fields, the technology has been prohibitively expensive for the smaller species groups including aquaculture species. Nimblegen Systems (http://www.nimblegen.com) has recently developed a ‘maskless’ version of the Affymetrix technology that uses digital mirrors to achieve the same effect (Nuwaysir et al., 2002) at a significantly lower startup cost, now making in situ arrays a feasible choice for aquaculture genomic research. The majority of array design considerations for in situ arrays overlap with those of spotted arrays. EST analysis, clustering, quality control, and probe selection are still necessary steps to arrive at the set of genes that will be synthesized on the array. The higher feature density allowed with in situ arrays means that more genes, duplicates, and/or controls may be included on the array, if desired. Because the per array cost is significantly higher for in situ arrays and project flexibility considerably less than for spotted arrays, researchers usually attempt to maximize the information that can be gained from each slide. Usually, desired sequences for the array are sent electronically to the company, which then carries out oligo probe selection (23–25 mers) and designs the array layout. Both Affymetrix and
Genome-based technologies useful for aquaculture research
37
Nimblegen use a perfect match (PM) and mismatch (MM) system that accounts for the majority of the features on in situ arrays. Mismatch probes, as their name suggests, contain one or more mismatched nucleotides in the PM probe sequence and are used to detect and screen out false background fluorescence resulting from non-specific cross-hybridization. Commonly, 10 PM and 10 MM probes are synthesized for each gene included on the array, and are believed to significantly increase the accuracy and sensitivity of gene expression detection (see Irizarry et al., 2003; Han et al., 2004; Chen et al., 2005 for more information on PM and MM probe theory). Spotted and in situ microarrays differ not only in their array construction but also in the procedures used to label and hybridize experimental samples (probes in the traditional sense) to them. Both array platforms require that you start with RNA sources. The RNA is extracted from the samples of interest. Each RNA sample is reverse transcribed to cDNA, after quantification and quality-checking by spectrophotometer measurement and agarose gel electrophoresis. From this step, differences in the procedure arise between the two microarray platforms. The cDNA samples for spotted arrays are labeled with two different fluorescent dyes, Cy3 and Cy5, which fluoresce ‘green’ and ‘red’, respectively, under two different wavelengths of light (633 nm and 543 nm). The control sample is labeled with one dye and the treatment sample with the other. Dye assignments should be swapped in replicates to avoid dyeassociated bias of hybridization (Churchill, 2002). Dye labeling is most commonly done either directly or through indirect aminoallyl labeling (see Manduchi et al., 2002; Badiee et al., 2003 for a comparison of labeling methods). The two labeled samples are hybridized simultaneously in equal amounts to the same array for 16–20 h. The hybridized array, after washing to remove unhybridized probes, is scanned under a laser scanner (e.g. Molecular Devices/Axon Instruments’ Axon 4000B) at both fluorescent wavelengths (or channels) for the two dyes. A digital image is acquired for both channels and, by overlaying the two images, a fluorescent signal ratio for each array feature is obtained. This fluorescent signal ratio indicates gene expression levels. Using the Cy3/Cy5 labeling system, yellow spots indicate approximately equal levels of mRNA from both the control and treatment samples (equal signals from the green Cy3 and the red Cy5). Features that appear red or green have hybridized a majority of mRNA from only one sample. Fluorescent intensity data for each feature are recorded, and the scanned image and data can be linked back to gene feature identities through programs such as Molecular Devices/Axon Instruments’ GenePix ProTM software. Background subtraction and normalization is customarily carried out at this point, followed by microarray analysis and validation of genes determined to be significantly differentially expressed after treatment. For in situ arrays, the RNA samples are reverse transcribed using a T7 promoter oligo-dT primer. The resulting cDNA is converted to a
38
New technologies in aquaculture
double-stranded template by a second strand synthesis reaction. After purification, these double-stranded cDNA samples (again control and treatment) are converted by in vitro transcription to biotin-labeled cRNA using a T7 RNA polymerase. The cRNA from each sample is fragmented and hybridized to its own slide (note: no mixing of samples). Streptavidinphycoerithryn is added as the fluorescent dye for both the control and treatment samples. To clarify, each biological sample for in situ arrays is hybridized to a different slide and labeled with a single dye. Differential expression is measured by comparing the fluorescent intensity measurement of a given gene on the control slide with a separate measurement for the same gene from the treatment slide. Labeling reactions and hybridizations of in situ arrays are commonly carried out by the array provider or core lab. Several groups have experimentally compared the precision and accuracy of the two platforms using the same biological samples. Their studies may prove helpful to those considering which system to implement in their own research (see Woo et al., 2004; Yauk et al., 2004; Meijer et al., 2005). Microarray research has advanced dramatically in recent years in aquaculture or aquatic species (summarized in Table 1.4). However, the field is still in its infancy and distribution of resources remains uneven. A number of microarrays have been developed from a variety of aquaculture species that has led to the publication of a special issue in the Journal of Fish Biology devoted entirely to the description of microarrays in aquatic species (Table 1.4). Interested readers are referred to this special issue (Journal of Fish Biology, Volume 72, issue 9, 2008). To date, most published microarray studies have used PCR-amplified spotted cDNA clones to fabricate the array. However, as microarray research typically takes several years from its inception to reach publication, the recent trends toward spotted oligos and in situ microarrays may not be reflected in the aquaculture literature for several years. A welldesigned microarray can be a valuable asset to an aquaculture species group, especially if the cost per slide can be minimized to the extent that researchers can integrate transcriptomic approaches into their already established research. Microarray studies are most successful when they are just one of several approaches used to answer biological questions. For example, salmonid researchers have implemented array technology in their study of reproductive development, toxicology, physiology, and repeat structures (Rise et al., 2004b; Ewart et al., 2005; Krasnov et al., 2005; Tilton et al., 2005; Vornanen et al., 2005; Martin et al., 2006; von Schalburg et al., 2006; Roberge et al., 2007; Eichner et al., 2008; Gahr et al., 2008; Jørgensen et al., 2008; Schiøtz et al., 2008; Wynne et al., 2008; Vanya et al., 2008; Young et al., 2008). In a similar effort, microarrays have been used to identify defense related genes in enteric septicemia of catfish (ESC)resistant blue catfish and ESC-susceptible channel catfish (Peatman et al., 2007, 2008).
Genome-based technologies useful for aquaculture research
39
Table 1.4 Current status of microarray development in various aquaculture and aquatic species Species
Microarray platform
Reference
Salmonids
GRASP 3.5K cDNA GRASP 16K cDNA INRA 9K cDNA cGRASP 32K cDNA cGRASP 22K oligo (70) 16 950 cDNA 660 cDNA nylon 19K in situ oligo 28K in situ oligo
Rise et al., 2004a von Schalburg et al., 2005 Bonnet et al., 2007 Koop, in progress Koop, in progress Taggart et al., 2008 Ju et al., 2002 Li et al., 2006 Peatman et al., 2007, 2008; Liu et al., 2008 Jenny et al., 2007 Gracey et al., 2004 Williams et al., 2008 Douglas et al., 2008 Salem et al., 2008 Olohan et al., 2008 Geoghegan et al., 2008 Klaper et al., 2008; Kane et al., 2008 Villeneuve et al., 2008 Gracey, 2008 Diab et al., 2008 Garcia-Reyero et al., 2008 Sarropoulou et al., 2005 de la Vega et al., 2008; Robalino et al., 2007 Wang et al., 2006
Catfish
Oysters Carp Atlantic halibut Rainbow trout Three-spined stickleback Fathead minnow Goby European flounder Largemouth bass Sea bream Shrimps
5K cDNA 13.4K cDNA 13K–26K cDNA 9277 50mer oligo 37K oligo 21 500 oligo 9692 cDNA 15 000 oligo 4105 oligo 2000 oligo 12 661 cDNA 3336 cDNA 15 950 oligo 10K cDNA 3853 cDNA 2469 cDNA 3136
Due to low funding levels and a relatively small research community, aquaculture genomics stands today where the model species did almost ten years ago in the 1990s. In the same way, microarray research in aquaculture species is only in its infancy. Like researchers of humans and mice ten years ago, we are currently using microarrays to accelerate gene expression analysis under varied experimental conditions, to reveal novel functions in genes, and to discover possible gene interactions and networking through cluster analysis. To find future directions for microarray research in aquaculture species, we need only to observe microarray studies in model species today. The future looks especially promising for using microarrays for SNP analysis and QTL mapping to make tangible progress towards widespread marker-assisted selection (MAS) in aquaculture. In particular, merging positional candidate genes with expression candidate genes from microarray information may reveal QTL genes responsible for important performance traits (see Drake et al., 2006). Microarrays have, furthermore, evolved to allow studies of metabolomics and proteomics that will be
40
New technologies in aquaculture
important in development of fish vaccines (Cretich et al., 2006). A Veterinary Immune Reagent Network has already been established in the USA toward development of a set of antibodies for use in agricultural research including aquaculture (http://www.avma.org/onlnews/javma/jun06/060615b. asp). Microarrays are also being utilized in livestock disease diagnostics, a use easily adapted for detection of outbreaks of aquaculture pathogens (Schmitt and Henderson, 2005; Baxi et al., 2006). Much of the groundwork for practical microarray research has already been laid. It is up to the aquaculture community to exploit and adapt these advances for the advantage of their respective species. In spite of the bright outlook of microarray research, emerging next generation sequencing technologies may soon replace, at least in part, the capacity of microarrays. This is because sequence-based gene expression profiling can provide not only gene identities without any ambiguity, but also more accurate assessment of genome expression based on sequence tag counting.
1.6.2 Sequence tag-based technology Tag profiling is a revolutionary approach to gene expression analysis that generates expression profiles for any transcript from any organism. Using Solexa or SOLiD sequencing technologies, millions of expressed sequence tags can be generated from a single run allowing gene expression profiles to be accurately characterized based on sequence tag counting. The major advantage of tag profiling is its high ability to identify, quantify, and annotate expressed genes on the level of the whole genome without prior sequence knowledge. Because sequence tag-based genome expression analysis does not require any existing genome resources, it is much more adaptable to aquaculture species where whole genome sequences are lacking.
1.6.3
Comparison of the microarray technology with tag- or sequence-based technology In microarray experiments, hybridization signal intensities are used to generate abundance measurements that correspond to the amount of target mRNA that has hybridized to a specific probe; and relative measurements are determined by a comparison of two samples. Tag-based technologies measure the expression level of a gene by counting the abundance of a specific transcript in a sample. This count provides an abundance measure of each gene’s expression level within the sample. Recently, some studies have compared microarray and massively parallel signature sequencing (MPSS) technology. Their results suggested a moderate correlation between the two platforms. However, one platform often detects expression for some genes that are not measured by the other platform (Coughlan et al., 2004; Oudes et al., 2005; Liu et al., 2007), suggesting that using a combina-
Genome-based technologies useful for aquaculture research
41
tion of transcription profiling technologies would provide more complete coverage of gene expression measurements. It is likely that different technology platforms will provide significant differences in the measurements of gene expression. Chen et al. (2007) recently found that RNA samples exhibited higher correlations within the technology platform used to measure RNA abundance rather than expected similarities due to the biological nature of the samples. In particular, the tag- or sequence-based platforms may be more variable in measuring RNA abundance than Affymetrix or Agilent microarray platforms. Therefore, comparison of RNA abundance across technology platforms requires exercise of caution. However, when relative expression between samples with different biological treatment is at issue, which most often is the most important question for aquaculture research settings, the samples were more closely clustered according to their biological nature than the technology platform (Chen et al., 2007).
1.7 Acknowledgements Research in my laboratory is supported by grants from USDA NRI Animal Genome and Genetic Mechanisms Program, USDA NRI Basic Genome Reagents and Tools Program, Mississippi-Alabama Sea Grant Consortium, Alabama Department of Conservation, USAID, National Science Foundation, and BARD. The author would like to thank Dr Huseyin Kucuktas for helping with drawings of the figures, and to thank Dr Hong Liu for her assistance with the references.
1.8 References agresti j j, seki s, cnaani a, poompuang s, hallerman e m, umiel n, hulata g, gall g a e and may b (2000) Breeding new strains of tilapia: development of an artificial center of origin and linkage map based on AFLP and microsatellite loci, Aquaculture, 185, 43–56. altshuler d, pollara v j, cowles c r, van etten w j, baldwin j, linton l and lander e s (2000) An SNP map of the human genome generated by reduced representation shotgun sequencing, Nature, 407, 513–16. bader j s (2001) The relative power of SNPs and haplotype as genetic markers for association tests, Pharmacogenomics, 2, 11–24. badiee a, eiken h g, steen v m and lovlie r (2003) Evaluation of five different cDNA labeling methods for microarrays using spike controls, BMC Biotechnol, 3, 23. bargelloni l, franch r, patarnello t, tsalavouta m, sarropoulou e, magoulas a, kotoulas g, chatziplis d, georgoudis a, louro b and power d m (2007) A genetic linkage map of the hermaphrodite teleost fish Sparus aurata L. Aquaculture, 272, Supplement 1, 243. baxi m k, baxi s, clavijo a, burton k m and deregt d (2006) Microarray-based detection and typing of foot-and-mouth disease virus, Vet J, 172, 473–81.
42
New technologies in aquaculture
beckman j s and weber j l (1992) Survey of human and rat microsatellites, Genomics, 12, 627–31. bekal s, craig j p, hudson m e, niblack t l, domier l l and lambert k n (2008) Genomic DNA sequence comparison between two inbred soybean cyst nematode biotypes facilitated by massively parallel 454 micro-bead sequencing, Mol Genet Genomics, 279, 535–43. bentley d r (2006) Whole-genome re-sequencing, Curr Opin Genet Dev, 16, 545–52. bonnet e, fostier a and bobe j (2007) Microarray-based analysis of fish egg quality after natural or controlled ovulation, BMC Genomics, 8, 55. butler j, maccallum i, kleber m, shlyakhter i a, belmonte m k, lander e s, nusbaum c and jaffe d b (2008) ALLPATHS: de novo assembly of wholegenome shotgun microreads, Genome Res, 18, 810–20. cairney m, taggart j b and hoyheim b (2000) Characterization of microsatellite and minisatellite loci in Atlantic salmon (Salmo salar L.) and cross-species amplification in other salmonids, Mol Ecol, 9, 2175–8. campbell d and bernatchez l (2004) Generic scan using AFLP markers as a means to assess the role of directional selection in the divergence of sympatric whitefish ecotypes, Mol Biol Evol, 21, 945–56. cardoso s r, eloy n b, provan j, cardoso m a and ferreira p c (2000) Genetic differentiation of Euterpe edulis Mart. populations estimated by AFLP analysis, Mol Ecol, 9, 1753–60. cariello n f, scott j k, kat a g, thilly w g and keohavong p (1988) Resolution of a missense mutant in human genomic DNA by denaturing gradient gel electrophoresis and direct sequencing using in vitro DNA amplification: HPRT Munich, Am J Hum Genet, 42, 726–34. chen d t, chen j j and soong s j (2005) Probe rank approaches for gene selection in oligonucleotide arrays with a small number of replicates, Bioinformatics, 21, 2861–6. chen j, agrawal v, rattray m, west m a, st clair d a, michelmore r w, coughlan s j and meyers b c (2007) A comparison of microarray and MPSS technology platforms for expression analysis of Arabidopsis, BMC Genomics, 8, 414–26. chen w, kalscheuer v, tzschach a, menzel c, ullmann r, schulz m h, erdogan f, li n, kijas z, arkesteijn g, pajares i l, goetz-sothmann m, heinrich u, rost i, dufke a, grasshoff u, glaeser b, vingron m and ropers h h (2008) Mapping translocation breakpoints by next-generation sequencing, Genome Res, 18, 1143–9. chistiakov d a, hellemans b, haley c s, law a s, tsigenopoulos c s, kotoulas g, bertotto d, libertini a and volckaert f a (2005) A microsatellite linkage map of the European sea bass Dicentrarchus labrax L, Genetics, 170, 1821–6. chong l k, tan s g, yusoff k and siraj s s (2000) Identification and characterization of Malaysian river catfish, Mystus nemurus (C&V): RAPD and AFLP analysis, Biochem Genet, 38, 63–76. churchill g a (2002) Fundamentals of experimental design for cDNA microarrays, Nat Genet, 32 Supplement, 490–95. cloonan n, forrest a r, kolle g, gardiner b b, faulkner g j, brown m k, taylor d f, steptoe a l, wani s, bethel g, robertson a j, perkins a c, bruce s j, lee c c, ranade s s, peckham h e, manning j m, mckernan k j and grimmond s m (2008) Stem cell transcriptome profiling via massive-scale mRNA sequencing, Nat Methods, 5, 613–19. coimbra m r m, kobayashi k, koretsugu s, hasegawa o, ohara e, ozaki a, sakamoto t, naruse k and okamoto n (2003) A genetic linkage map of the Japanese flounder, Paralichthys olivaceus, Aquaculture, 220, 203–18. cokus s j, feng s, zhang x, chen z, merriman b, haudenschild c d, pradhan s, nelson s f, pellegrini m and jacobsen s e (2008) Shotgun bisulphite sequencing
Genome-based technologies useful for aquaculture research
43
of the Arabidopsis genome reveals DNA methylation patterning, Nature, 452, 215–19. cotton r g (1993) Current methods of mutation detection, Mutat Res, 285, 125–44. coughlan s j, agrawal v and meyers b (2004) A comparison of global gene expression measurement technologies in Arabidopsis thaliana, Comp Funct Genomics, 5, 245–52. cox d r, burmeister m, price e r, kim s and myers r m (1990) Radiation hybrid mapping: a somatic cell genetic method for constructing high-resolution maps of mammalian chromosomes, Science, 250, 245–50. crawford a m and cuthbertson r p (1996) Mutations in sheep microsatellites, Genome Res, 6, 876–9. cretich m, damin f, pirri g and chiari m (2006) Protein and peptide arrays: recent trends and new directions, Biomol Eng, 23, 77–88. crollius r h, jaillon o, dasilva c, ozouf-costaz c, fizames c, fischer c, bouneau l, billault a, quetier f, saurin w, bernot a and weissenbach j (2000) Characterization and repeat analysis of the compact genome of the freshwater pufferfish Tetraodon nigroviridis, Genome Res, 10, 939–49. danzmann r g and gharbi k (2007) Linkage mapping in aquaculture species, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 139–67. danzmann r g, cairney m, davidson w s, ferguson m m, gharbi k, guyomard r, holm l e, leder e, okamoto n, ozaki a, rexroad c e, 3rd, sakamoto t, taggart j b and woram r a (2005) A comparative analysis of the rainbow trout genome with 2 other species of fish (Arctic charr and Atlantic salmon) within the tetraploid derivative Salmonidae family (subfamily: Salmoninae), Genome, 48, 1037–51. davidson w s (2007) Bacterial artificial chromosome libraries and BAC-based physical mapping of aquaculture genomes, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 245–59. de la vega e, o’leary n a, shockey j e, robalino j, payne c, browdy c l, warr g w and gross p s (2008) Anti-lipopolysaccharide factor in Litopenaeus vannamei (LvALF): a broad spectrum antimicrobial peptide essential for shrimp immunity against bacterial and fungal infection, Mol Immunol, 45(7), 1916–25. diab a m, williams t d, sabine v s, chipman j k and george s g (2008) The GENIPOL European flounder Platichthys flesus L. toxicogenomics microarray: application for investigation of the response to furunculosis vaccination, J Fish Biol, 72, 2154–69. dolan p c and denver d r (2008) TileQC: a system for tile-based quality control of Solexa data, BMC Bioinformatics, 9, 250. douglas s e, knickle l c, williams j, flight r m and reith m e (2008) A first generation Atlantic halibut Hippoglossus hippoglossus (L.) microarray: application to developmental studies, J Fish Biol, 72, 2391–406. drake t a, schadt e e and lusis a j (2006) Integrating genetic and gene expression data: application to cardiovascular and metabolic traits in mice, Mamm Genome, 17, 466–79. edwards y j, elgar g, clark m s and bishop m j (1998) The identification and characterization of microsatellites in the compact genome of the Japanese pufferfish, Fugu rubripes: perspectives in functional and comparative genomic analyses, J Mol Biol, 278, 843–54. eichner c, frost p, dysvik b, jonassen i, kristiansen b and nilsen f (2008) Salmon louse (Lepeophtheirus salmonis) transcriptomes during post molting maturation and egg production, revealed using EST-sequencing and microarray analysis, BMC Genomics, 9, 126. ellegren h (2000) Microsatellite mutations in the germline: implications for evolutionary inference, Trends Genet, 16, 551–8.
44
New technologies in aquaculture
ewart k v, belanger j c, williams j, karakach t, penny s, tsoi s c, richards r c and douglas s e (2005) Identification of genes differentially expressed in Atlantic salmon (Salmo salar) in response to infection by Aeromonas salmonicida using cDNA microarray technology, Dev Comp Immunol, 29, 333–47. felip a, martinez-rodriguez g, piferrer f, carrillo m and zanuy s (2000) AFLP analysis confirms exclusive maternal genomic contribution of meiogynogenetic sea bass (Dicentrarchus labrax L.), Mar Biotechnol (NY), 2, 301–6. fitzsimmons n n, moritz c and moore s s (1995) Conservation and dynamics of microsatellite loci over 300 million years of marine turtle evolution, Mol Biol Evol, 12, 432–40. fuji k, hasegawa o, honda k, kumasaka k, sakamoto t and okamoto n (2007) Marker-assisted breeding of a lymphocystis disease-resistant Japanese flounder (Paralichthys olivaceus), Aquaculture, 272, 291–5. gahr s a, vallejo r l, weber g m, shepherd b s, silverstein j t and rexroad c e, 3rd (2008) Effects of short-term growth hormone treatment on liver and muscle transcriptomes in rainbow trout (Oncorhynchus mykiss), Physiol Genomics, 32, 380–92. garcia-reyero n, griffitt r j, liu l, kroll k j, farmerie w g, barber d s and denslow n d (2008) Construction of a robust microarray from a non-model species largemouth bass, Micropterus salmoides (Lacêpede), using pyrosequencing technology, J Fish Biol, 72, 2354–76. geisler r, rauch g j, baier h, van bebber f, bross l, dekens m p, finger k, fricke c, gates m a, geiger h, geiger-rudolph s, gilmour d, glaser s, gnugge l, habeck h, hingst k, holley s, keenan j, kirn a, knaut h, lashkari d, maderspacher f, martyn u, neuhauss s, neumann c, nicolson t, pelegri f, ray r, rick j m, roehl h, roeser t, schauerte h e, schier a f, schonberger u, schonthaler h b, schulte-merker s, seydler c, talbot w s, weiler c, nusslein-volhard c and haffter p (1999) A radiation hybrid map of the zebrafish genome, Nat Genet, 23, 86–9. geoghegan f, katsiadaki i, williams t d and chipman j k (2008) A cDNA microarray for the three-spined stickleback, Gasterosteus aculeatus L., and analysis of the interactive effects of oestradiol and dibenzanthracene exposures, J Fish Biol, 72, 2133–53. gharbi k, gautier a, danzmann r g, gharbi s, sakamoto t, hoyheim b, taggart j b, cairney m, powell r, krieg f, okamoto n, ferguson m m, holm l e and guyomard r (2006) A linkage map for brown trout (Salmo trutta): chromosome homeologies and comparative genome organization with other salmonid fish, Genetics, 172, 2405–19. gilbey j, verspoor e, mclay a and houlihan d (2004) A microsatellite linkage map for Atlantic salmon (Salmo salar), Anim Genet, 35, 98–105. glazov e a, cottee p a, barris w c, moore r j, dalrymple b p and tizard m l (2008) A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach, Genome Res, 18, 957–64. gonen d, veenstra-vanderweele j, yang z, leventhal b and cook e h, jr (1999) High throughput fluorescent CE-SSCP SNP genotyping, Mol Psychiatry, 4, 339–43. gracey a y (2008) The Gillichthys mirabilis Cooper array: a platform to investigate the molecular basis of phenotypic plasticity, J Fish Biol, 72, 2118–32. gracey a y, fraser e j, li w, fang y, taylor r r, rogers j, brass a and cossins a r (2004) Coping with cold: An integrative, multitissue analysis of the transcriptome of a poikilothermic vertebrate, Proc Natl Acad Sci U S A, 101, 16970–75. griffiths r and orr k (1999) The use of amplified fragment length polymorphism (AFLP) in the isolation of sex-specific markers, Mol Ecol, 8, 671–4.
Genome-based technologies useful for aquaculture research
45
hafner m, landgraf p, ludwig j, rice a, ojo t, lin c, holoch d, lim c and tuschl t (2008) Identification of microRNAs and other small regulatory RNAs using cDNA library sequencing, Methods, 44, 3–12. halldorsson b v, istrail s and de la vega f m (2004) Optimal selection of SNP markers for disease association studies, Hum Hered, 58, 190–202. han e s, wu y, mccarter r, nelson j f, richardson a and hilsenbeck s g (2004) Reproducibility, sources of variability, pooling, and sample size: important considerations for the design of high-density oligonucleotide array experiments, J Gerontol A Biol Sci Med Sci, 59, 306–15. he l, du c, li y, scheuring c and zhang h b (2007) Construction of large-insert bacterial clone libraries and their applications, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 215–44. hedgecock d, lin j z, decola s, haudenschild c d, meyer e, manahan d t and bowen b (2007) Transcriptomic analysis of growth heterosis in larval Pacific oysters (Crassostrea gigas), Proc Natl Acad Sci U S A, 104, 2313–18. hessner m j, meyer l, tackes j, muheisen s and wang x (2004) Immobilized probe and glass surface chemistry as variables in microarray fabrication, BMC Genomics, 5, 53. hillier l w, marth g t, quinlan a r, dooling d, fewell g, barnett d, fox p, glasscock j i, hickenbotham m, huang w, magrini v j, richt r j, sander s n, stewart d a, stromberg m, tsung e f, wylie t, schedl t, wilson r k and mardis e r (2008) Whole-genome sequencing and variant discovery in C. elegans, Nat Methods, 5, 183–8. hubert s and hedgecock d (2004) Lingkage maps of microsatellite DNA markers for the Pacific oyster Crassostrea gigas, Genetics, 168, 351–62. hukriede n a, joly l, tsang m, miles j, tellis p, epstein j a, barbazuk w b, li f n, paw b, postlethwait j h, hudson t j, zon l i, mcpherson j d, chevrette m, dawid i b, johnson s l and ekker m (1999) Radiation hybrid mapping of the zebrafish genome, Proc Natl Acad Sci U S A, 96, 9745–50. hunter r l and markert c l (1957) Histochemical demonstration of enzymes separated by zone electrophoresis in starch gels, Science, 125, 1294–5. irizarry r a, hobbs b, collin f, beazer-barclay y d, antonellis k j, scherf u and speed t p (2003) Exploration, normalization, and summaries of high density oligonucleotide array probe level data, Biostatistics, 4, 249–64. jenny m j, chapman r w, mancia a, chen y a, mckillen d j, trent h, lang p, escoubas j m, bachere e, boulo v, liu z j, gross p s, cunningham c, cupit p m, tanguy a, guo x, moraga d, boutet i, huvet a, de guise s, almeida j s and warr g w (2007) A cDNA microarray for Crassostrea virginica and C. gigas, Mar Biotechnol (NY), 9, 577–91. jones a g, rosenqvist g, berglund a and avise j c (1999) Clustered microsatellite mutations in the pipefish Syngnathus typhle, Genetics, 152, 1057–63. jorde p e, palm s and ryman n (1999) Estimating genetic drift and effective population size from temporal shifts in dominant gene marker frequencies, Mol Ecol, 8, 1171–8. jørgensen sm, afanasyev s, krasnov a (2008) Gene expression analyses in Atlantic salmon challenged with infectious salmon anemia virus reveal differences between individuals with early, intermediate and late mortality, BMC Genomics, 9, 179. ju z, dunham r and liu z j (2002) Differential gene expression in the brain of channel catfish (Ictalurus punctatus) in response to cold acclimation, Mol Genet Genomics, 268, 87–95. kai y, nakayama k and nakabo t (2002) Genetic differences among three colour morphotypes of the black rockfish, Sebastes inermis, inferred from mtDNA and AFLP analyses, Mol Ecol, 11, 2591–8.
46
New technologies in aquaculture
kalin i, shephard s and candrian u (1992) Evaluation of the ligase chain reaction (LCR) for the detection of point mutations, Mutat Res, 283, 119–23. kane m d, sringer j a, iannotti n v, gough e, johns s m, schlueter s d and sepulveda m s (2008) Identification of development and tissue-specific gene expression in the fathead minnow Pimephales promelas, Rafinesque using computational and DNA microarray methods, J Fish Biol, 72, 2341–53. karsi a, cao d, li p, patterson a, kocabas a, feng j, ju z, mickett k d and liu z (2002) Transcriptome analysis of channel catfish (Ictalurus punctatus): initial analysis of gene expression and microsatellite-containing cDNAs in the skin, Gene, 285, 157–68. katagiri t, kidd c, tomasino e, davis j t, wishon c, stern j e, carleton k l, howe a e and kocher t d (2005) A BAC-based physical map of the Nile tilapia genome, BMC Genomics, 6, 89. kijas j m, fowler j c, garbett c a and thomas m r (1994) Enrichment of microsatellites from the citrus genome using biotinylated oligonucleotide sequences bound to streptavidin-coated magnetic particles, Biotechniques, 16, 656–60, 662. klaper r, carter b j, richter c a, drevnick p e, sandheinrich m b and tillitt d e (2008) Use of a 15 k gene microarray to determine gene expression changes in response to acute and chronic methylmercury exposure in the fathead minnow Pimephales promelas Rafinesque, J Fish Biol, 72, 2207–80. kocher t d, lee w j, sobolewska h, penman d and mcandrew b (1998) A genetic linkage map of a cichlid fish, the tilapia (Oreochromis niloticus), Genetics, 148, 1225–32. korol a, shirak a, cnaani a and hallerman e (2007) Detection and analysis of quantitative trait loci (QTLs) for economic traits in aquatic species, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 169–97. krasnov a, koskinen h, afanasyev s and molsa h (2005) Transcribed Tc1-like transposons in salmonid fish, BMC Genomics, 6, 107. kucuktas h and liu z (2007) Allozyme and mitochondrial markers, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 73–85. kucuktas h, wagner b k, shopen r, gibson m, dunham, r a and liu z j (2002) Genetic analysis of Ozark Hellbenders (Cryptobranchus alleganiensis bishopi) utilizing RAPD markers, Proc Ann Conf SEAFWA 55, 126–37. kwok c, critcher r and schmitt k (1999) Construction and characterization of zebrafish whole genome radiation hybrids, Methods Cell Biol, 60, 287–302. leclerc d, wirth t and bernatchez l (2000) Isolation and characterization of microsatellite loci in the yellow perch (Perca flavescens), and cross-species amplification within the family Percidae, Mol Ecol, 9, 995–7. lee b-y and kocher t (2007) Comparative genomics and positional cloning, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 323–35. lee b y, lee w j, streelman j t, carleton k l, howe a e, hulata g, slettan a, stern j e, terai y and kocher t d (2005) A second-generation genetic linkage map of tilapia (Oreochromis spp.), Genetics, 170, 237–44. li l and guo x (2004) AFLP-based genetic linkage maps of the pacific oyster Crassostrea gigas Thunberg, Mar Biotechnol (NY), 6, 26–36. li b, kadura i, fu d j and watson d e (2004) Genotyping with TaqMAMA, Genomics, 83, 311–20. li y, byrne k, miggiano e, whan v, moore s, keys s, crocos p, preston n and lehnert s (2003) Genetic mapping of the kuruma prawn Penaeus japonicus using AFLP markers, Aquaculture, 219, 143–56. li l, xiang j, liu x, zhang y, dong b and zhang x (2005) Construction of AFLPbased genetic linkage map for Zhikong scallop, Chlamys farreri Jones et Preston and mapping of sex-linked markers, Aquaculture, 245, 63–73.
Genome-based technologies useful for aquaculture research
47
li z, li j, wang q, he y and liu p (2006) AFLP-based genetic linkage map of marine shrimp Penaeus (Fenneropenaeus) chinensis, Aquaculture, 261(2), 463–72. lipshutz r j, fodor s p, gingeras t r and lockhart d j (1999) High density synthetic oligonucleotide arrays, Nat Genet, 21, 20–24. liu z j (2006) Transcriptome characterization through the generation and analysis of expressed sequence tags: Factors to consider for a successful EST project, Israel Journal of Aquaculture-Bamidgeh, 58, 328–41. liu z j (2007a) Aquaculture Genome Technologies, Blackwell, Ames, IA. liu z j (2007b) Marking the genome: Restriction fragment length polymorphism (RFLP), in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 11–20. liu z j (2007c) Random amplified polymorphic DNA (RAPD), in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 21–28. liu z j (2007d) Amplified fragment length polymorphism (AFLP), in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 29–42. liu z j (2007e) Microsatellite markers and assessment of marker utility, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 43–58. liu z j (2007f) Single nucleotide polymorphism (SNP), in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 59–72. liu z j (2007g) Genomescape: characterizing the repeat structure of the genome, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 277–90. liu z j (2007h) Transcriptome characterization through the analysis of expressed sequence tags, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 301–56. liu z j (2007i) DNA sequencing technologies, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 465–76. liu z j (2007j) Sequencing the genome, in Liu (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 477–90. liu z j and cordes j f (2004) DNA marker technologies and their applications in aquaculture genetics, Aquaculture, 238, 1–37. liu z, nichols a, li p and dunham r a (1998) Inheritance and usefulness of AFLP markers in channel catfish (Ictalurus punctatus), blue catfish (I. furcatus), and their F1, F2, and backcross hybrids, Mol Gen Genet, 258, 260–68. liu z, li p, kucuktas h, nichols a, tan g, zheng x, argue b j and dunham r a (1999) Development of amplified fragment length polymorphism (AFLP) markers suitable for genetic linkage mapping of catfish, Trans Am Fish Soc, 128, 317–27. liu z, li p, kocabas a, karsi a and ju z (2001) Microsatellite-containing genes from the channel catfish brain: evidence of trinucleotide repeat expansion in the coding region of nucleotide excision repair gene RAD23B, Biochem Biophys Res Commun, 289, 317–24. liu z, karsi a, li p, cao d and dunham r (2003) An AFLP-based genetic linkage map of channel catfish (Ictalurus punctatus) constructed by using an interspecific hybrid resource family, Genetics, 165, 687–94. liu x, liu x, guo x, gao q, zhao h and zhang g (2006) A preliminary genetic linkage map of the Pacific abalone Haliotis discus hannai Ino, Mar Biotechnol (NY), 8, 386–97. liu f, jenssen t k, trimarchi j, punzo c, cepko c l, ohno-machado l, hovig e and kuo w p (2007) Comparison of hybridization-based and sequencing-based gene expression technologies on biological replicates, BMC Genomics, 8, 153. liu z, li r w and waldbieser g c (2008) Utilization of microarray technology for functional genomics in ictalurid catfish, J Fish Biol, 72, 2377–90. lyall j e, brown g m, furlong r a, ferguson-smith m a and affara n a (1993) A method for creating chromosome-specific plasmid libraries enriched in clones
48
New technologies in aquaculture
containing [CA]n microsatellite repeat sequences directly from flow-sorted chromosomes, Nucleic Acids Res, 21, 4641–2. mackiewicz m, fletcher d e, wilkins s d, dewoody j a and avise j c (2002) A genetic assessment of parentage in a natural population of dollar sunfish (Lepomis marginatus) based on microsatellite markers, Mol Ecol, 11, 1877–83. malmgren h, gustavsson j, tuvemo t and dahl n (1996) Rapid detection of a mutation hot-spot in the human androgen receptor, Clin Genet, 50, 202–5. manduchi e, scearce l m, brestelli j e, grant g r, kaestner k h and stoeckert c j, jr. (2002) Comparison of different labeling methods for two-channel highdensity microarray experiments, Physiol Genomics, 10, 169–79. margulies m, egholm m, altman w e, attiya s, bader j s, bemben l a, berka j, braverman m s, chen y j, chen z, dewell s b, du l, fierro j m, gomes x v, godwin b c, he w, helgesen s, ho c h, irzyk g p, jando s c, alenquer m l, jarvie t p, jirage k b, kim j b, knight j r, lanza j r, leamon j h, lefkowitz s m, lei m, li j, lohman k l, lu h, makhijani v b, mcdade k e, mckenna m p, myers e w, nickerson e, nobile j r, plant r, puc b p, ronan m t, roth g t, sarkis g j, simons j f, simpson j w, srinivasan m, tartaro k r, tomasz a, vogt k a, volkmer g a, wang s h, wang y, weiner m p, yu p, begley r f and rothberg j m (2005) Genome sequencing in microfabricated high-density picolitre reactors, Nature, 437, 376–80. marnellos g (2003) High-throughput SNP analysis for genetic association studies, Curr Opin Drug Discov Devel, 6, 317–21. martin s a, blaney s c, houlihan d f and secombes c j (2006) Transcriptome response following administration of a live bacterial vaccine in Atlantic salmon (Salmo salar), Mol Immunol, 43, 1900–911. maxam a m and gilbert w (1977) A new method for sequencing DNA, Proc Natl Acad Sci U S A, 74, 560–64. may b (2003) Allozyme variation, in Hallerman E M (ed.), Population Genetics: Principles and Applications for Fisheries Scientists, American Fisheries Society, Bethesda, MD, 23–36. meijer a h, verbeek f j, salas-vidal e, corredor-adamez m, bussman j, van der sar a m, otto g w, geisler r and spaink h p (2005) Transcriptome profiling of adult zebrafish at the late stage of chronic tuberculosis due to Mycobacterium marinum infection, Mol Immunol, 42, 1185–203. meuwissen t h e, hayes b j and goddard m e (2001) Prediction of total genetic value using genome-wide dense marker maps, Genetics, 157, 1819–29. metzgar d, bytof j and wills c (2000) Selection against frameshift mutations limits microsatellite expansion in coding DNA, Genome Res, 10, 72–80. mickett k, morton c, feng j, li p, simmons m, cao d, dunham r a and liu z (2003) Assessing genetic diversity of domestic populations of channel catfish (Ictalurus punctatus) in Alabama using AFLP markers, Aquaculture, 228, 91–105. mock k e, brim-box j c, miller m p, downing m e and hoeh w r (2004) Genetic diversity and divergence among freshwater mussel (Anodonta) populations in the Bonneville Basin of Utah, Mol Ecol, 13, 1085–98. moen t, hoyheim b, munck h and gomez-raya l (2004) A linkage map of Atlantic salmon (Salmo salar) reveals an uncommonly large difference in recombination rate between the sexes, Anim Genet, 35, 81–92. moore s s, whan v, davis g p, byrne k, hetzel d j s and preston n (1999) The development and application of genetic markers for the Kuruma prawn Penaeus japonicus, Aquaculture, 173, 19–32. moran c (1993) Microsatellite repeats in pig (Sus domestica) and chicken (Gallus domesticus) genomes, J Hered, 84, 274–80. morishima k, arias-rodriguez l, nakayama i and arai k (2007) A genetic linkage map of the loach Misgurnus anguillicaudatus (Teleostei: Cobitidae), Aquaculture, 272, Supplement 1, 291.
Genome-based technologies useful for aquaculture research
49
ng s h, artieri c g, bosdet i e, chiu r, danzmann r g, davidson w s, ferguson m m, fjell c d, hoyheim b, jones s j, de jong p j, koop b f, krzywinski m i, lubieniecki k, marra m a, mitchell l a, mathewson c, osoegawa k, parisotto s e, phillips r b, rise m l, von schalburg k r, schein j e, shin h, siddiqui a, thorsen j, wye n, yang g and zhu b (2005) A physical map of the genome of Atlantic salmon, Salmo salar, Genomics, 86, 396–404. nichols k m, young w p, danzmann r g, robison b d, rexroad c, noakes m, phillips r b, bentzen p, spies i, knudsen k, allendorf f w, cunningham b m, brunelli j, zhang h, ristow s, drew r, brown k h, wheeler p a and thorgaard g h (2003) A consolidated linkage map for rainbow trout (Oncorhynchus mykiss), Anim Genet, 34, 102–15. ning y, liu x, wang z y, guo w, li y and xie f (2007) A genetic map of large yellow croaker Pseudosciaena crocea, Aquaculture, 264, 16–26. nuwaysir e f, huang w, albert t j, singh j, nuwaysir k, pitas a, richmond t, gorski t, berg j p, ballin j, mccormick m, norton j, pollock t, sumwalt t, butcher l, porter d, molla m, hall c, blattner f, sussman m r, wallace r l, cerrina f and green r d (2002) Gene expression analysis using oligonucleotide arrays produced by maskless photolithography, Genome Res, 12, 1749–55. ohara e, nishimura t, nagakura y, sakamoto t, mushiake k, okamoto n (2005) Genetic linkage maps of two yellowtails (Seriola quinqueradiata and Seriola lalandi), Aquaculture, 244, 41–8. okumus¸ i and çiftci y (2003) Fish population genetics and molecular markers: II. Molecular markers and their applications in fisheries and aquaculture, Turkish J Fish Aquat Sci, 3, 51–79. olohan l a, li w, wulff t, jarmer h, gracey a y and cossins a r (2008) Detection of anoxia-responsive genes in cultured cells of the rainbow trout Oncorhynchus mykiss (Walbaum), using an optimized, genome-wide oligoarray, J Fish Biol, 72, 2170–86. ostrander e a, jong p m, rine j and duyk g (1992) Construction of small-insert genomic DNA libraries highly enriched for microsatellite repeat sequences, Proc Natl Acad Sci U S A, 89, 3419–23. oudes a j, roach j c, walashek l s, eichner l j, true l d, vessella r l and liu a y (2005) Application of affymetrix array and massively parallel signature sequencing for identification of genes involved in prostate cancer progression, BMC Cancer, 5, 86. parker p g, snow a a, schug m d, booton g c and fuerst p a (1998) What molecules can tell us about populations: choosing and using a molecular marker, Ecology, 79, 361–82. patrick k (2007) 454 life sciences: illuminating the future of genome sequencing and personalized medicine, Yale J Biol Med, 80, 191–4. peatman e and liu z j (2007) Microarray fundamentals: Basic principles and application in aquaculture, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 357–70. peatman e, baoprasertkul p, terhune j, xu p, nandi s, kucuktas h, li p, wang s, somridhivej b, dunham r and liu z j (2007) Expression analysis of the acute phase response in channel catfish (Ictalurus punctatus) after infection with a Gramnegative bacterium, Dev Comp Immunol, 31, 1183–96. peatman e, terhune j, baoprasertkul p, xu p, nandi s, wang s, somridhivej b, kucuktas h, li p, dunham r, liu z j (2008) Microarray analysis of gene expression in the blue catfish liver reveals early activation of the MHC class I pathway after infection with Edwardsiella ictaluri, Mol Immunol, 45, 553–66. pérez f, erazo c, zhinaula m, volckaert f and calderón j (2004) A sex-specific linkage map of the white shrimp Penaeus (Litopenaeus) vannamei based on AFLP markers, Aquaculture, 242, 105–18.
50
New technologies in aquaculture
poompuang s and na-nakorn u (2004) A preliminary genetic map of walking catfish (Clarias macrocephalus), Aquaculture, 232, 195–203. quiniou s m, waldbieser g c and duke m v (2007) A first generation BAC-based physical map of the channel catfish genome, BMC Genomics, 8, 40. reith m, reid d, smith c, blanchard b and martin-robichaud d (2007) A genetic linkage map for Atlantic halibut (Hippoglossus hippoglossus), Aquaculture, 272, Supplement 1, 304. rexroad iii c e (2007) Radiation hybrid mapping in aquatic species, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 313–22. rico c, rico i and hewitt g (1996) 470 million years of conservation of microsatellite loci among fish species, Proc R Soc Lond B Biol Sci, 263, 549–57. rise m l, von schalburg k r, brown g d, mawer m a, devlin r h, kuipers n, busby m, beetz-sargent m, alberto r, gibbs a r, hunt p, shukin r, zeznik j a, nelson c, jones s r, smailus d e, jones s j, schein j e, marra m a, butterfield y s, stott j m, ng s h, davidson w s and koop b f (2004a) Development and application of a salmonid EST database and cDNA microarray: data mining and interspecific hybridization characteristics, Genome Res, 14, 478–90. rise m l, jones s r, brown g d, von schalburg k r, davidson w s and koop b f (2004b) Microarray analyses identify molecular biomarkers of Atlantic salmon macrophage and hematopoietic kidney response to Piscirickettsia salmonis infection, Physiol Genomics, 20, 21–35. robalino j, almeida j s, mckillen d, colglazier j, trent h f, 3rd, chen y a, peck m e, browdy c l, chapman r w, warr g w and gross p s (2007) Insights into the immune transcriptome of the shrimp Litopenaeus vannamei: tissue-specific expression profiles and transcriptomic responses to immune challenge, Physiol Genomics, 29, 44–56. roberge c, paez d j, rossignol o, guderley h, dodson j and bernatchez l (2007) Genome-wide survey of the gene expression response to saprolegniasis in Atlantic salmon, Mol Immunol, 44, 1374–83. robison b d, wheeler p a, sundin k, sikka p and thorgaard g h (2001) Composite interval mapping reveals a major locus influencing embryonic development rate in rainbow trout (Oncorhynchus mykiss), J Hered, 92, 16–22. rogers s m, campbell d, baird s j, danzmann r g and bernatchez l (2001) Combining the analyses of introgressive hybridisation and linkage mapping to investigate the genetic architecture of population divergence in the lake whitefish (Coregonus clupeaformis, Mitchill), Genetica, 111, 25–41. ross p, hall l, smirnov i and haff l (1998) High level multiplex genotyping by MALDI-TOF mass spectrometry, Nat Biotechnol, 16, 1347–51. sakamoto t, danzmann r g, gharbi k, howard p, ozaki a, khoo s k, woram r a, okamoto n, ferguson m m, holm l e, guyomard r and hoyheim b (2000) A microsatellite linkage map of rainbow trout (Oncorhynchus mykiss) characterized by large sex-specific differences in recombination rates, Genetics, 155, 1331–45. salem m, kenney p b, rexroad c e and yao j (2008) Development of a 37 k highdensity oligonucleotide microarray: a new tool for functional genome research in rainbow trout, J Fish Biol, 72, 2187–206. sanger f, nicklen s and coulson a r (1977) DNA sequencing with chain-terminating inhibitors, Proc Natl Acad Sci U S A, 74, 5463–7. sarropoulou e, kotoulas g, power d m and geisler r (2005) Gene expression profiling of gilthead sea bream during early development and detection of stress-related genes by the application of cDNA microarray technology, Physiol Genomics, 23, 182–91. sarropoulou e, franch r, louro b, power d m, bargelloni l, magoulas a, senger f, tsalavouta m, patarnello t, galibert f, kotoulas g and geisler r (2007) A
Genome-based technologies useful for aquaculture research
51
gene-based radiation hybrid map of the gilthead sea bream Sparus aurata refines and exploits conserved synteny with Tetraodon nigroviridis, BMC Genomics, 8, 44. schiøtz bl, jørgensen sm, rexroad c, gjøen t, krasnov a (2008) Transcriptomic analysis of responses to infectious salmon anemia virus infection in macrophagelike cells, Virus Res, 36, 65–74. schmitt b and henderson l (2005) Diagnostic tools for animal diseases, Rev Sci Tech, 24, 243–50. seki s, agresti j j, gall gae, taniguchi n and may b (1999) AFLP analysis of genetic diversity in three populations of ayu Plecoglossus altivelis, Fish Sci, 65, 888–92. senger f, priat c, hitte c, sarropoulou e, franch r, geisler r, bargelloni l, power d and galibert f (2006) The first radiation hybrid map of a perch-like fish: the gilthead seabream (Sparus aurata L), Genomics, 87, 793–800. serapion j, kucuktas h, feng j and liu z (2004) Bioinformatic mining of type I microsatellites from expressed sequence tags of channel catfish (Ictalurus punctatus), Mar Biotechnol (NY), 6, 364–77. shagin d a, rebrikov d v, kozhemyako v b, altshuler i m, shcheglov a s, zhulidov p a, bogdanova e a, staroverov d b, rasskazov v a and lukyanov s (2002) A novel method for SNP detection using a new duplex-specific nuclease from crab hepatopancreas, Genome Res, 12, 1935–42. shen x, yang g, liu y, liao m, wang x, zhu m, song w, zou g, wei q, wang d and chen d (2007) Construction of genetic linkage maps of guppy (Poecilia reticulata) based on AFLP and microsatellite DNA markers, Aquaculture, 271, 178–87. siden t s, kumlien j, schwartz c e and rohme d (1992) Radiation fusion hybrids for human chromosomes 3 and X generated at various irradiation doses, Somat Cell Mol Genet, 18, 33–44. simmons m, mickett k, kucuktas h, li p, dunham r and liu z j (2006) Comparison of domestic and wild catfish populations provide no evidence for genetic impact, Aquaculture, 252, 133–46. smith m h and chesser r k (1981) Rationale for conserving genetic variation of fish gene pools, in Ryman N (ed.), Fish Gene Pools, Ecological Bulletin, Stockholm, 34, 13–20. smyth g k, michaud j and scott h s (2005) Use of within-array replicate spots for assessing differential expression in microarray experiments, Bioinformatics, 21, 2067–75. somridhivej b, wang s, sha z, liu h, quilang j, xu p, li p and liu z j (2008) Characterization, polymorphism assessment, and database construction for microsatellites from BAC end sequences of catfish: a resource for integration of linkage and physical maps, Aquaculture, 275, 76–80. sorrentino r, potolicchio i, ferrara g b and tosi r (1992) A new approach to HLA-DPB1 typing combining DNA heteroduplex analysis with allele-specific amplification and enzyme restriction, Immunogenetics, 36, 248–54. southern e m (1975) Detection of specific sequences among DNA fragments separated by gel electrophoresis, J Mol Biol, 98, 503–17. steele c a , wheeler p a and thorgaard g h (2008) Mitochondrial and maternal effects on growth in clonal rainbow, Plant and Animal Genomes XVI Conference, 12–16 January, San Diego, CA, abstract, http://www.intl-pag.org/16/ abstracts/PAG16_P05p_619.html, accessed December 2008. steinberg e k, lindner k r, gallea j, maxwell a, meng j and allendorf f w (2002) Rates and patterns of microsatellite mutations in pink salmon, Mol Biol Evol, 19, 1198–202. storm n, darnhofer-patel b, van den boom d and rodi c p (2003) MALDI-TOF mass spectrometry-based SNP genotyping, Methods Mol Biol, 212, 241–62.
52
New technologies in aquaculture
stram d o (2004) Tag SNP selection for association studies, Genet Epidemiol, 27, 365–74. sun x w and liang l q (2004) A genetic linkage map of common carp (Cyprinus carpio L.) And mapping of a locus associated with cold tolerance, Aquaculture, 238, 165–72. sun y, song w, zhong y, zhang r, abatzopoulos t j and chen r (1999) Diversity and genetic differentiation in Artemia species and populations detected by AFLP markers, Int J Salt Lake Res, 8, 341–50. suzuki y, orita m, shiraishi m, hayashi k and sekiya t (1990) Detection of ras gene mutations in human lung cancers by single-strand conformation polymorphism analysis of polymerase chain reaction products, Oncogene, 5, 1037–43. taggart j b, bron j e, martin s a m, seear p j, hoyheim b, talbot r, carmichael s n, villeneuve l a n, sweeney g e, houlihan d f, secombes c j, tocher d r and teale a j (2008) A description of the origins, design and performance of the TRAITS-SGP Atlantic salmon Salmo salar L. cDNA microarray, J Fish Biol, 72, 2071–94. tautz d (1989) Hypervariability of simple sequences as a general source for polymorphic DNA markers, Nucleic Acids Res, 17, 6463–71. tilton s c, gerwick l g, hendricks j d, rosato c s, corley-smith g, givan s a, bailey g s, bayne c j and williams d e (2005) Use of a rainbow trout oligonucleotide microarray to determine transcriptional patterns in aflatoxin B1-induced hepatocellular carcinoma compared to adjacent liver, Toxicol Sci, 88, 319–30. toth g, gaspari z and jurka j (2000) Microsatellites in different eukaryotic genomes: survey and analysis, Genome Res, 10, 967–81. van lith h a and van zutphen l f (1996) Characterization of rabbit DNA microsatellites extracted from the EMBL nucleotide sequence database, Anim Genet, 27, 387–95. van tassell c p, smith t p l, matukumalli l k, taylor j f, schnabel r d, lawley c t, haudenschild c d, moore s s, warren w c and sonstegard t s (2008) SNP discovery and allele frequency estimation by deep sequencing of reduced representation libraries, Nat Meth, 5, 247–52. vanya ewart k, williams j, richards r c, gallant j w, melville k and douglas s e (2008) The early response of Atlantic salmon (Salmo salar) macrophages exposed in vitro to Aeromonas salmonicida cultured in broth and in fish, Dev Comp Immunol, 32, 380–90. vera j c, wheat c w, fescemyer h w, frilander m j, crawford d l, hanski i and marden j h (2008) Rapid transcriptome characterization for a nonmodel organism using 454 pyrosequencing, Mol Ecol, 17, 1636–47. villeneuve d l, knoebl i, larkin p, miracle a l, carter b j, denslow n d and ankley g t (2008) Altered gene expression in the brain and liver of female fathead minnows Pimephales promelas Rafinesque exposed to fadrozole, J Fish Biol, 72, 2281–340. volckaert f a m j, batargias c, chatziplis d, chistiakov d, guo y, haley c s, hellemans b, kotoulas g, law a, libertini a, mcandrew b j, tsigenopoulos c and whitaker h a (2007) A second generation linkage map of European sea bass, Aquaculture, 272, Supplement 1, 316. von schalburg k r, rise m l, cooper g a, brown g d, gibbs a r, nelson c c, davidson w s and koop b f (2005) Fish and chips: various methodologies demonstrate utility of a 16 006-gene salmonid microarray, BMC Genomics, 6, 126. von schalburg k r, mccarthy s p, rise m l, hutson j c, davidson w s and koop b f (2006) Expression of morphogenic genes in mature ovarian and testicular tissues: potential stem-cell niche markers and patterning factors, Mol Reprod Dev, 73, 142–52.
Genome-based technologies useful for aquaculture research
53
vornanen m, hassinen m, koskinen h and krasnov a (2005) Steady-state effects of temperature acclimation on the transcriptome of the rainbow trout heart, Am J Physiol Regul Integr Comp Physiol, 289, R1177–84. vos p, hogers r, bleeker m, reijans m, van de lee t, hornes m, frijters a, pot j, peleman j, kuiper m et al. (1995) AFLP: a new technique for DNA fingerprinting, Nucleic Acids Res, 23, 4407–14. waldbieser g c, bosworth b g, nonneman d j and wolters w r (2001) A microsatellite-based genetic linkage map for channel catfish, Ictalurus punctatus, Genetics, 158, 727–34. walter m a and goodfellow p n (1993) Radiation hybrids: irradiation and fusion gene transfer, Trends Genet, 9, 352–6. wang l l, song l s, chang y q, xu w, ni d j and guo x m (2005) A preliminary genetic map of Zhikong scallop (Chlamys farreri Jones et Preston 1904), Aquaculture Res, 36, 643–53. wang b, li f, dong b, zhang x, zhang c and xiang j (2006) Discovery of the genes in response to white spot syndrome virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray, Mar Biotechnol, 8, 491–500. wang b, li f, luan w, xie y, zhang c, luo z, gui l, yan h and xiang j (2008a) Comparison of gene expression profiles of Fenneropenaeus chinensis challenged with WSSV and Vibrio, Mar Biotechnol (NY), 10, 644–75. wang s, sha z, sonstegard t s, liu h, xu p, somridhivej b, peatman e, kucuktas h and liu z j (2008b) Quality assessment parameters for EST-derived SNPs from catfish, BMC Genomics, 9, 450. watanabe t, fujita h, yamasaki k, seki s and taniguchi n (2004) Preliminary study on linkage mapping based on microsatellite DNA and AFLP markers using homozygous clonal fish in ayu (Plecoglossus altivelis), Mar Biotechnol (NY), 6, 327–34. weber j l and wong c (1993) Mutation of human short tandem repeats, Hum Mol Genet, 2, 1123–8. welsh j and mcclelland m (1990) Fingerprinting genomes using PCR with arbitrary primers, Nucleic Acids Res, 18, 7213–18. whitehead a, anderson s l, kuivila k m, roach j l and may b (2003) Genetic variation among interconnected populations of Catostomus occidentalis: implications for distinguishing impacts of contaminants from biogeographical structuring, Mol Ecol, 12, 2817–33. whitfield c w, band m r, bonaldo m f, kumar c g, liu l, pardinas j r, robertson h m, soares m b and robinson g e (2002) Annotated expressed sequence tags and cDNA microarrays for studies of brain and behavior in the honey bee, Genome Res, 12, 555–66. williams j g, kubelik a r, livak k j, rafalski j a and tingey s v (1990) DNA polymorphisms amplified by arbitrary primers are useful as genetic markers, Nucleic Acids Res, 18, 6531–5. williams d r, li w, hughes m a, gonzalez s f, vernon c, vidal m c, jeney z, jeney g, dixon p, mcandrew b, bartfai r, orban l, trudeau v, rogers j, matthews l, fraser e j, gracey a y and cossins a r (2008) Genomic resources and microarrays for the common carp Cyprinus carpio L, J Fish Biol, 72, 2095–117. wilson k, li y, whan v, lehnert s, byrne k, moore s, pongsomboon s, tassanakajon a, rosenberg g, ballment e, fayazi z, swan j, kenway m and benzie j (2002) Genetic mapping of the black tiger shrimp Penaeus monodon with amplified fragment length polymorphism, Aquaculture, 204, 297–309. woo y, affourtit j, daigle s, viale a, johnson k, naggert j and churchill g (2004) A comparison of cDNA, oligonucleotide, and Affymetrix GeneChip gene expression microarray platforms, J Biomol Tech, 15, 276–84.
54
New technologies in aquaculture
woram r a, mcgowan c, stout j a, gharbi k, ferguson m m, hoyheim b, davidson e a, davidson w s, rexroad c and danzmann r g (2004) A genetic linkage map for Arctic char (Salvelinus alpinus): evidence for higher recombination rates and segregation distortion in hybrid versus pure strain mapping parents, Genome, 47, 304–15. wynne j w, o’sullivan m g, cook m t, stone g, nowak b f, lovell d r and elliott n g (2008) Transcriptome analyses of amoebic gill disease-affected Atlantic salmon (Salmo salar) tissues reveal localized host gene suppression, Mar Biotechnol (NY), 10, 388–403. xu p, wang s, liu l, peatman e, somridhivej b, thimmapuram j, gong g and liu z (2006) Channel catfish BAC-end sequences for marker development and assessment of syntenic conservation with other fish species, Anim Genet, 37, 321–6. xu p, wang s and liu z (2007a) Physical characterization of aquaculture genomes through BAC end sequencing, in Liu Z (ed.), Aquaculture Genome Technologies, Blackwell, Ames, IA, 261–74. xu p, wang s, liu l, thorsen j, kucuktas h and liu z (2007b) A BAC-based physical map of the channel catfish genome, Genomics, 90, 380–88. yauk c l, berndt m l, williams a and douglas g r (2004) Comprehensive comparison of six microarray technologies, Nucleic Acids Res, 32, e124. young w p, wheeler p a, coryell v h, keim p and thorgaard g h (1998) A detailed linkage map of rainbow trout produced using doubled haploids, Genetics, 148, 839–50. young w p, ostberg c o, keim p and thorgaard g h (2001) Genetic characterization of hybridization and introgression between anadromous rainbow trout (Oncorhynchus mykiss irideus) and coastal cutthroat trout (O. clarki clarki), Mol Ecol, 10, 921–30. young n d, cooper g a, nowak b f, koop b f and morrison r n (2008) Coordinated down-regulation of the antigen processing machinery in the gills of amoebic gill disease-affected Atlantic salmon (Salmo salar L.), Mol Immunol, 45, 2581–97. yu z and guo x (2003) Genetic linkage map of the eastern oyster Crassostrea virginica Gmelin, Biol Bull, 204, 327–38. zane l, bargelloni l and patarnello t (2002) Strategies for microsatellite isolation: a review, Mol Ecol, 11, 1–16. zhao s h, recknor j, lunney j k, nettleton d, kuhar d, orley s and tuggle c k (2005) Validation of a first-generation long-oligonucleotide microarray for transcriptional profiling in the pig, Genomics, 86, 618–25. zhang y, liang l, jiang p, li d, lu c and sun x (2008) Genome evolution trend of common carp (Cyprinus carpio L.) as revealed by the analysis of microsatellite loci in a gynogentic family, J Genet Genomics, 35, 97–103. zhou z, bao z, dong y, wang s, he c, liu w, wang l and zhu f (2006) AFLP lingkage map of sea urchin constructed using an interspecific cross between Strongylocentrous nudus (Venus) and S. intermedius (Mars), Aquaculture, 259, 56–65. zhulidov p a, bogdanova e a, shcheglov a s, vagner l l, khaspekov g l, kozhemyako v b, matz m v, meleshkevitch e, moroz l l, lukyanov s a and shagin d a (2004) Simple cDNA normalization using kamchatka crab duplexspecific nuclease, Nucleic Acids Res, 32, e37.
2 Genetic improvement of finfish G. Hulata, Agricultural Research Organization, Israel, and B. Ron, Israel Oceanographic & Limnological Research Ltd, Israel
Abstract: This chapter focuses on the major genetic approaches, technologies and methodologies that have shaped the aquaculture industry in recent years. Classic selective breeding programs (cross-breeding and hybridization) are the mainstream of finfish genetic improvement, and will continue to be the main engine driving the global finfish aquaculture industry forward. Breeding programs have been expanded, their design optimized and many new ones initiated since the late 1990s. Advances in application of biotechnology to fishes have provided tools that can be used to genetically change (improve) cultured populations using non-selective breeding methods through manipulations of genes and chromosomes (mainly triploidy). Cytological methodologies are useful tools helping with chromosomal gene mapping and with validation of aquacultured finfish species and hybrids. Modern technology has brought new types of molecular markers into play, and their application has allowed rapid progress into many aquaculture investigations. These include quantification of genetic variability and inbreeding, parentage assignments, species and strain identification, construction of high-resolution genetic linkage maps for aquaculture species and the detection of quantitative trait loci. They also offer the opportunity to include genomic information in breeding programmes (marker assisted selection; MAS). Advances have been made in developing genomic and bioinformatic tools. Although gene transfer technology has yielded promising products, their future is questionable due to severe controversies over public health and environmental issues. Use of embryonic stem (ES) cell lines is being investigated and may prove to be an alternative approach for gene transfer. Key words: Breeding programs, biotechnology, manipulations of genes and chromosomes, cytogenetics, quantitative trait loci (QTL), marker assisted selection (MAS), genomic and bioinformatic tools, gene transfer, embryonic stem cells.
2.1 Introduction: current status of aquaculture genetics The status and prospects of aquaculture genetics have been repeatedly reviewed during the last decade for specific groups of fish or for the industry in general (e.g., Gjedrem, 2000, 2002; Knibb, 2000; Lymbery et al., 2000;
56
New technologies in aquaculture
Dunham et al., 2001; Hulata, 2001; Myers et al., 2001; Fjalestad et al., 2003; Okamoto, 2005; Hershberger, 2006; Mair, 2007). A few relevant books, each covering a specific aspect of the field, have also been published (Hallerman, 2003; Dunham, 2004; Gjedrem, 2005; Liu, 2007a). Although classic selective breeding methods as well as emerging technologies are available and contribute to the progress of the industry, their application is not yet evenly spread over globally cultured species and culture areas (Hulata, 2001). How much of the nearly 48 million tonnes cultured globally (2005 estimate; FAO, 2007) stems from genetically improved stocks is hard to tell. Some five years ago, Gjedrem (2002) estimated that genetically improved stocks accounted for no more than 10 % of aquaculture production. ‘This figure is undoubtedly rising in developed countries, as the benefits of genetic improvement become apparent, but it is almost certainly much lower in most developing countries’ (Mair, 2007). With major producers such as China and other south-eastern Asian countries (FAO, 2007) lagging behind in application of genetic technologies in their aquaculture industries, it is unlikely to be more than 20 % at present. It is not our intention to duplicate the above-mentioned reviews, but rather to focus on the new approaches, technologies and methodologies that have shaped the field in recent years.
2.2 2.2.1
Key drivers for genetic improvement of finfish
Improving growth rate, disease resistance and other quality traits by selective breeding and other methods Classical breeding programs (selective breeding, cross-breeding and hybridization) are the mainstream of finfish genetic improvement (Bartley et al., 2001; Gjedrem, 2005). The impact of selective breeding programs on the aquaculture industry can be exemplified by the wide global distribution of the Donaldson strain of rainbow trout (Parsons, 1998), the success of the Norwegian Atlantic salmon breeding program (Gjedrem, 2000) and the progressing dissemination of the selectively bred Nile tilapia, known as genetically improved farmed tilapia – GIFT (Pullin, 2007). Breeding programs have been expanded, and many new ones initiated during the last decade – see examples in Table 2.1. The breeding goal in most of these programs was improving growth rate. Whereas in the past improving growth rate was the most common breeding goal, new traits have been incorporated more recently in breeding programs (Table 2.2). As fish welfare is becoming a crucial issue for the aquaculture industry (Ashley, 2007), attention has also been given recently to selection for sustainability and animal welfare-related traits (Olesen et al., 2000, 2003; Bentsen and Olesen, 2002). Attention is also given to the possible effects of selection on the social behaviour and growth pattern of the fish (Brännäs
Genetic improvement of finfish
57
Table 2.1 Examples of recent breeding programmes Species
Reference
Atlantic cod (Gadus morhua) Atlantic salmon (Salmo salar) Common carp (Cyprinus carpio) Gilthead seabream (Sparus aurata) Hybrid striped bass (Morone chrysops × M. saxatilis) Lake Malawi tilapia (Oreochromis shiranus) Mediterranean sea bass (Dicentrarchus labrax L.) Nile tilapia (O. niloticus) Red sea bream (Pagrus major) Rohu carp (Labeo rohita)
Gjerde et al., 2004 Quinton et al., 2005; Kolstad et al., 2006 Vandeputte, 2003; Kocour et al., 2007 Gorshkov et al., 2004 Garber and Sullivan, 2006 Maluwa and Gjerde, 2006a,b, 2007; Maluwa et al., 2006 Saillant et al., 2006 Ponzoni et al., 2005; Li et al., 2006 Murata et al., 1996 Gjerde et al., 2002; Reddy et al., 2002
Table 2.2 Examples of production- and consumer-related breeding-goal traits in recent breeding programmes Trait Production-related Age at maturity Eliminating vertebral deformity Feed efficiency Reproductive traits Stress, disease and parasite resistance
Consumer-related Appearance Body composition Carcass quality
Species
Reference
Rainbow trout (On. mykiss) Atlantic salmon (S. salar) Atlantic cod (Gadus morhua) Atlantic salmon (S. salar) Coho salmon (On. kisutch) Rainbow trout (On. mykiss) Atlantic salmon (S. salar)
Kause et al., 2003a
Rainbow trout (On. mykiss) Rainbow trout (On. mykiss) Coho salmon (On. kisutch)
Kause et al., 2003b, 2004
Gjerde et al., 2005 Kolstad et al., 2006 Kolstad et al., 2004, 2005b; Kause et al., 2006b; Quinton et al., 2007 Gall and Neira, 2004; Gallardo et al., 2004a Pottinger and Carrick, 1999; Henryon et al., 2005 Kolstad et al., 2005a; Ødegård et al., 2006, 2007a,b
Tobin et al., 2006; Kause et al., 2007; Quillet et al., 2007 Neira et al., 2004
et al., 2005). Improvements have also been made in breeding programs through the introduction of new methodology for measuring complex traits, such as flesh color or feed efficiency [in rainbow trout (On. mykiss) – Helge Stien et al., 2006; Kause et al., 2006a].
58
New technologies in aquaculture
Advances in designing breeding programs in aquaculture Because broodstocks are limited in size, inbreeding is an inherent problem in many breeding programs (Gjedrem, 2005). Efforts have been made recently to optimize mating designs for reducing effects of inbreeding in breeding programs (Gjerde et al., 1996; Villanueva et al., 1996; Sonesson and Meuwissen, 2000, 2002; Sonesson et al., 2003; Gallardo et al., 2004b; Dupont-Nivet et al., 2006; Holtsmark et al., 2006, 2008; D’Agaro et al., 2007), and in improving the experimental designs and statistical models to enhance genetic gains (Sonesson et al., 2005; Hinrichs et al., 2006; Martinez et al., 2006a,b). In addition, emerging technologies based on molecular markers and genomic approaches are progressively rising in importance, and efforts are being made to involve molecular approaches in breeding programs (Fjalestad et al., 2003; Silverstein et al., 2006). A step further towards improving the design of breeding program was taken by Hayes et al. (2006) in their comparison of different strategies for using molecular marker information in order to maximize genetic diversity in the base population. Combining available phenotypic information for the traits of interest with marker data, they propose, would ‘ensure that as much genetic variance as possible, for as many traits as possible, is captured in the base population’.
2.2.2
Improving performance and other traits by non-selective breeding methods Advances in application of biotechnology to fishes (reviewed by Melamed et al., 2002) have provided tools that can be used to genetically change (improve) cultured populations using non-selective breeding methods through manipulations of genes and chromosomes (Rasmussen and Morrissey, 2007). The different approaches will be discussed in more detail below. Chromosome set manipulations (gynogenesis, androgenesis and polyploidy) Although chromosome-set manipulations, which have been heavily investigated since the 1970s, have not resulted in many commercial applications to advance the aquaculture industry (Khan et al., 2000; Hulata, 2001), these manipulations still attract interest (Arai, 2001; Felip et al., 2001a; Gomelsky, 2003; Komen and Thorgaard, 2007), and research has expanded to more species with emphasis on newly-cultured species (Table 2.3). The physiological effects of polyploidy are also being investigated (e.g., Peruzzi et al., 2005; Taylor et al., 2007; Maxime, 2008). The most common applications of these procedures are production of triploids to prevent reproduction and improve growth rate (reviewed by Tiwary et al., 2004), and cloning through gynogenesis and androgenesis (reviewed by Pandian and Kirankumar, 2003; Komen and Thorgaard, 2007). Triploidy is also used
Genetic improvement of finfish
59
Table 2.3 Examples of chromosome manipulations in newly culture species Species
Reference
European sea bass (Dicentrarchus labrax) Sunshine bass (M. chrysops × M. saxatilis) Largemouth bass (Micropterus salmoides) Turbot (Scophthalmus maximus)
Felip et al., 2001a,b, 2002; Peruzzi et al., 2004; Bertotto et al., 2005 Kerby et al., 2002
Barfin flounder (Verasper moseri) Sturgeon (Acipenser sp.) Atlantic halibut (Hippoglossus hippoglossus)
Gomelsky et al., 2004; Neal et al., 2004 Piferrer et al., 2000, 2003, 2004; Cal et al., 2006 Mori et al., 2006 Flynn et al., 2006; Grunina et al., 2005, 2006 Tvedt et al., 2006
for genetic mapping (Nomura et al., 2006). Although resulting in high degree of sterility, triploidy does not always confer significant improvement of growth (e.g., Mori et al., 2006). Production of triploids would be more efficient by mating induced tetraploids with normal diploids; this has so far been restricted to rainbow trout, since in no other commercial finfish species have viable and fertile tetraploids been obtained (Arai, 2001; Babiak et al., 2002a,b). For other species, triploids are produced as all-female populations by using spermatozoa of artificially sex-reversed (often gynogenetic) males, so as to assure their complete sterility (e.g., Arai, 2000; Rothbard et al., 2000; Rothbard, 2006 and Fig. 2.1). This is because triploid males sometimes show gonadal development and often are not completely sterile (e.g., Pandian and Koteeswaran, 1998; Arai, 2000, 2001; Felip et al., 2001a; Oshima et al., 2005; Sousa-Santos et al., 2007). Commercial production and culture of (all-female) triploid fish is so far limited to brown trout, rainbow trout, Atlantic and Chinook salmon and European sea bass. Additionally, commercial production of triploid grass carp is carried out for stocking native bodies of water to control vegetation. Cytogenetics During the 1990s, the number of cytogenetic studies of marine fishes has increased. Its main application, however, has been in solving systematic and taxonomy issues rather than genetic improvement. Cytogenetic studies can help in predicting the success of inter-specific hybridization between species; successful hybridization occurs predominantly between closely-related species having identical chromosome structure and numbers, or at least identical number of chromosome arms (e.g., Kim et al., 1995). Resulting F1 are often reproductively viable, although in some cases they are sterile (in most cases due to being triploids).
60
New technologies in aquaculture ♂ Albino grass carp (XY)
♀ Wild-type grass carp (XX)
♀ Albino grass carp (XX)
♂ Common carp (XY)
Sperm (X & Y)
UV-irradiated eggs
Eggs (X)
UV-irradiated sperm
Fertilization
Fertilization
Shock Lateshock
♀♀ XX Female monosex (2nd Task)
♂♂ ♀♀ (YY) (XX) Homozygous progeny
MT sexinversion ♂♂ XX Gynogenetic males
Fertilization
Sperm bank
Sperm bank
Early-shock
♂♂ XY Male monosex (1st Task)
♀♀ XXX Female triploids (3rd Task)
Lateshock
♀♀ XXXX 4N-females (4th Task) 2N gametes Fertilization
♀♀ XXX Female triploids (5th Task)
Fig. 2.1 Schematic presentation of ploidy manipulations on grass carp to produce XXX female triploids (reproduced with permission from Rothbard, 2006).
Genetic improvement of finfish
61
Another area where cytogenetics has played an important role is studies of sex determination (reviewed by Ezaz et al., 2006). Knowledge on sex determination may contribute to efficient production of monosex populations, which in turn may contribute to improved production efficiency in various cultured species (e.g., tilapias). Cytogenetics is also playing an important role in the verification of chromosome-set manipulations as well as for gene mapping (Gorshkova, 2006). Study of sex chromosomes: Ten sex-determination systems are known among fishes. The unusual cytology and exceptional evolution of sex chromosomes lead to numerous basic questions related to why and how sex chromosomes evolved. This was the source of a century-long debate from the time when H.J. Muller suggested that sex chromosome pairs evolved eventually from a pair of autosomes (Muller, 1914). With regard to cytological examination of sex chromosome evolution, fishes are the most fascinating of vertebrate groups. Fishes represent the largest vertebrate group which displays the widest diversity of sex determination and sex chromosomal systems, including gonochorism (separate sexes), hermaphroditism (individuals displaying both sexes) and unisexuality (all female-species). Using cytogenetic methodologies, among others, it was revealed that in gonochoristic fishes, the gender may be determined genetically – ranging from a single-allele determination to chromosomal sex determination. In addition, it was shown that polygenic sex determination and sex determination by genotype–environment interaction take place in fishes (see reviews by Devlin and Nagahama, 2002 and Ezaz et al., 2006). Cytogenetic studies play an important role in the identification of the various sturgeon species and hybrids. Inter-specific hybridization is well known in Acipenseriformes and can be advantageous in aquaculture (Steffens et al., 1990; Gorshkova et al., 1996; Fontana, 2002; Gorshkova, 2006). Lately, Fopp-Bayat et al. (2007) performed cytogenetic analysis by preparing chromosomes from the gill epithelium of Acipenser baeri × (Huso huso × Acipenser ruthenus) hybrids in both diploid and triploid states. Karyological inspection of Russian imported sturgeons, reared at the Kibbutz Dan fish farm, Israel, were conducted on hybrids of Russian sturgeon (Acipenser guldenstadti) and great (beluga) sturgeon (Huso huso). Results showed that the consistent mode of 2N was 181–190 and the karyotype consisted of 78 metacentric and submetacentric, 16 acrocentric, and about 88 micro-chromosomes. The intermediate origin of the imported sturgeon hybrid confirmation, based on different number of chromosomes, points at the polyploidy origin of the Acipenseridae, and allowed the geneticists to formulate recommendations concerning conservation and genetic management of cultured sturgeon stocks in Israel (Gorshkova et al., 1996; Gorshkova, 2006). During 1992–1995, Groshkova and co-workers conducted chromosome set manipulation research using the economically important marine finfish, gilthead seabream (Gorshkova et al., 1995; Knibb et al., 1998a, b). These
62
New technologies in aquaculture
studies led to the establishment of a protocol that provided gilthead sea bream gynogenetic and triploid progenies. In addition, these researchers achieved the production of meiotic gynogenetic sea bass progeny using heat shocks to eggs fertilized with UV-irradiated sperm (Gorshkova et al., 1995; Knibb et al., 1998a, b). As a result, a direct karyological confirmation concerning the hybrid nature and triploid origin of the offspring were described using karyotypes of chromosomally-manipulated forms with ‘marker’ chromosomes (Gorshkov et al., 1998). Another study was done during 1999, when Gorshkova and co-workers commenced cytogenetic inspection of white grouper (E. aeneus) early embryonic development (Gorshkova et al., 2002b). Although one of the most valuable fishes in the Mediterranean basin, white grouper has a severe limitation in commercial culture as a result of the unpredictable and often low quality of spawned eggs, embryos with low survival rates and escalating larvae mortality. The percentage of cytogenetically abnormal embryos carrying diverse types of chromosomal aberrations varied significantly amongst spawnings and ranged from 35.5–79 %. Continuous examination of subsequent spawning of different parental fishes using cytogenetic monitoring of the early embryonic stages would be of immediate interest for future genetic broodstock management of the white grouper (Gorshkova et al., 2002a). Aid in gene mapping: Cytological methodologies have been employed in chromosomal gene mapping of some aquacultured finfish species. This technique has been used mainly as a complementary approach to identify particular chromosomes (Phillips and Reed, 1996; Cnaani et al., 2007a, b; Phillips et al., 2006). Using fluorescence in situ hybridization (FISH) and linkage mapping, Cnaani and co-workers showed that in tilapia the sox2 and sox14 genes are on separate chromosomes. The rainbow trout (On. mykiss) genetic linkage groups have been assigned to specific chromosomes in the OSU (2N = 60) strain using FISH with bacterial artificial chromosomes (BAC) probes containing genes mapped to each linkage group. The set of BACs compiled for this research will be especially useful in construction of genome maps and identification of quantitative trait locus/loci (QTL) for important traits in other salmonid fishes (Phillips et al., 2006; see further discussion below). Molecular markers Since the 1960s, electrophoretic studies of proteins (allozymes, or allelic forms of isozymes) have provided the primary tool for studying genetic diversity in fisheries and aquacultured stocks (Liu and Cordes, 2004; Verspoor et al., 2005; Kucuktas and Liu, 2007). The main uses of allozyme electrophoresis have been for stock identification and management (in the wild as well as aquaculture), analysis of population genetics processes such as inbreeding and genetic drift, molecular tagging and parentage analysis and, to a much lesser extent, for genetic mapping (Liu and Cordes, 2004).
Genetic improvement of finfish
63
The major drawbacks of allozymes, apart from the need for fresh or frozen samples of relatively large quantities, are the limited variability and poor coverage of the genome. Nevertheless, allozyme analysis has made a significant contribution to our understanding of the genetic diversity and the structure of wild genetic resources in many species, and especially the Atlantic salmon (Verspoor et al., 2005). Since the mid-1980s, DNA-based analyses (e.g., Artamonova, 2007) that are characterized by higher genetic variation and polymorphism, as well as higher genome coverage, have gradually substituted for allozymes. Modern biotechnology has introduced into play new types of molecular markers, as well as other techniques that will be discussed below (see Chapter 1 in this volume for a detailed account). The new platform technologies have opened up vast possibilities to the aquacultural biotechnologist (Melamed et al., 2002).The various types of DNA markers – mitochondrial DNA, restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), microsatellite, single nucleotide polymorphisms (SNP) and expressed sequence tag (EST) markers – have been described in detail by Liu and Cordes (2004) and in Chapters 2–8 in Liu (2007a). The application of DNA markers has allowed rapid progress in aquaculture investigations of genetic variability and inbreeding, parentage assignments, species and strain identification and construction of high-resolution genetic linkage maps for aquaculture species (Liu and Cordes, 2004), as well as detection of QTL and enabling the use of genomic information in breeding programs (viz MAS). Chistiakov et al. (2006) state that in aquaculture research, microsatellites are the ‘workhorse markers’ and review the genomic distribution, function, evolution and practical applications of microsatellites to fish genetics and aquaculture. Gradually, SNPs are becoming the future markers of choice (Liu, 2007b), mainly because of the need for very high densities of genetic markers (SNPs by far exceed microsatellites in this respect), and the recent progress in genotyping techniques and detection of polymorphism. Genomic resources continue to be developed (e.g., Hayes et al., 2007; Somridhivej et al., 2008). These and the other new marker types paved the way for various applications that are re-shaping aquaculture breeding programs. Parental assignment and molecular pedigrees: DNA markers, notably microsatellites, have solved one of the major obstacles in breeding programs, namely the ability to individually mark small fish. In order to utilize maximum information available on relatives, and increase the accuracy of selection, fish should be marked individually so that pedigrees can be tracked across generations (Villanueva et al., 2002). Since newborn fish are too small to be physically tagged, families must be reared separately until the fish reach the size at which they can be safely tagged individually (Doyle and Herbinger, 1994; Herbinger et al., 1995). Apart from limiting the
64
New technologies in aquaculture
number of families that can be used, and the extra expenses incurred by rearing each family separately, this also introduces common-environment correlations that reduce the accuracy of selection. Furthermore, it allows applying family selection to fish species that are not easily reproduced by single-pair matings (e.g., gilthead sea bream; Knibb, 2000). The development of DNA markers has enabled solution of this problem, when it was shown that by using a series of polymorphic markers, each individual in a mix of several or many families can be uniquely assigned to its parents with nearly complete accuracy (e.g., Herbinger et al., 1995, 1999; Estoup et al., 1998; O’Reilly et al., 1998; Perez-Enriquez et al., 1999; Norris et al., 2000). The pioneering study by Herbinger et al. (1995) was designed to ‘assess the feasibility of establishing pedigrees in mixed aquaculture populations and of selection programs for commercial aquaculture operations based on genetic profiling data from microsatellite markers’, and in fact paved the way for the application of DNA markers in breeding programs. The Herbinger et al. (1995) study ‘showed that the pedigree of a mixed rainbow trout population could be satisfactorily determined using as few as four microsatellite markers even though the fish could have originated from 100 possible pairs (ten sires × ten dams). The ability to establish the pedigree of completely mixed fish from their single locus DNA profile means that this pilot study was able to take place in a production farm with practically no interference with the normal routine’. Using this approach, families produced separately can be mixed and reared communally from hatching, or pools of males and females can be bred in the same pond or tank and their progeny reared together, until a posteriori parentage assignment at a later stage, even just before selection of breeding candidates. Villanueva et al. (2002) attempted to answer the key questions related to this application – the number of loci and the level of information (i.e., the numbers of alleles per loci and their relative frequency) required for accurate assignment. Application to breeding programs is already under way, e.g., in the estimation of heritability with a microsatellite parentage assignment-based pedigree in common carp cultured under traditional pond conditions as demonstrated by Kocour et al. (2007). Another application of DNA markers that is becoming of major importance is for tracing live fish or fish products at any stage along the production chain. Hayes et al. (2005) compare and discuss three alternate traceability schemes using DNA markers. Linkage maps: Since the late 1990s, linkage maps have been developed for most commercially important finfish species (Table 2.4; see also Table 10.2 in Danzmann and Gharbi, 2007). Work is also underway to develop the necessary genomic resources to develop maps of barramundi (Lates calcarifer – Zhu et al., 2006) and striped bass (Morone saxatilis – Rexroad et al., 2006). Some maps are quite preliminary, although for a few species more advanced maps have already been
Genetic improvement of finfish
65
Table 2.4 Examples of linkage maps for commercially important species. Those already listed in Danzmann and Gharbi (2007) are marked in bold face Species
Reference
American catfish (Ictalurus punctatus ¥ I. furcatus) Arctic char (S. alpinus) Atlantic salmon (S. salar) Ayu (Plecoglosus altivelis) Baramundi (Lates calcarifer) Bighead carp (Aristichthys nobilis) Brown trout (S. trutta) Common carp (C. carpio) European sea bass (Dicentrarchus labrax) Gilthead sea bream (Sparus aurata)
Liu et al., 2003
Japanese flounder (Paralichthys olivaceus) Rainbow trout (On. mykiss) Silver carp (Hypophthalmichthys molitrix) Thai catfish (Clarias macrocephalus) Tilapia (O. niloticus ¥ O. aureus; F2) Yellowtail (Seriola spp.)
Woram et al., 2004 Moen et al., 2004 Watanabe et al., 2004 Wang et al., 2007 Liao et al., 2007 Gharbi et al., 2006 Sun and Liang, 2004 Chistiakov et al., 2005 Franch et al., 2006; Senger et al., 2006; Sarropoulou et al., 2007a,b; 2008 Coimbra et al., 2003 Nichols et al., 2003; Danzmann et al., 2005 Liao et al., 2007 Poompuang and Na-Nakorn, 2004 Lee et al., 2005 Ohara et al., 2005
obtained. The number of markers mapped range from 146 (C. Macrocephalus – Poompuang and Na-Nakorn, 2004) to over 1400 (On. mykiss – Danzmann et al., 2005) in the more advanced maps, and some contain genes as well (those of rainbow trout, brown trout, Atlantic salmon, Arctic charr, channel catfish, European sea bass, common carp and tilapia – for details see Table 10.2 in Danzmann and Gharbi, 2007). Apart from the Danzmann et al. (2005) map of rainbow trout and the preliminary map of common carp (Sun and Liang, 2004), all other maps have either more or less linkage groups (LG) than the haploid number of chromosomes (N) in the species. As long as no commercially important species has its genome fully sequenced, linkage maps constitute the basic prerequisite for detection of QTL (Korol et al., 2007) and fine mapping of genes through comparative mapping to sequenced genomes of model species, and for positional cloning (Lee and Kocher, 2007; Sarropoulou et al., 2008). QTL detection: A QTL is a segment of a chromosome with a significant effect on the expression (phenotype) of a trait of interest; this issue was recently reviewed by Korol et al. (2007). The chapter presents an overview of QTL detection, lists the four steps in the detection of QTL, and outlines their application in MAS; see below) – marker development; development
66
New technologies in aquaculture
of a linkage map of at least moderate density; mapping of QTL using genetic markers placed on the map, with development of a model for inheritance and expression of the trait; and finally, use of the identified association between marker(s) and QTL in practical breeding program (i.e., MAS). It then discusses recent advances in detection of QTL, and presents a list of traits for which QTL have been detected in various aquacultured species. Among the traits are growth rate and body shape traits, resistance to stress, pathogens and diseases, coloration, sex determination. These have been detected in Atlantic salmon, rainbow trout, coho salmon, Arctic char, tilapias and common carp (see references in Korol et al., 2007 and Sonesson, 2007a). Most recently, a QTL for early maturation was identified in rainbow trout (Haidle et al., 2008). Moen et al. (2004) present a testing strategy for detection of QTL affecting disease resistance in Atlantic salmon. Sonesson (2007a) reviewed the efforts to detect QTL in aquaculture species. Such studies yield knowledge of marker–QTL linkages and estimates of the effects of QTL alleles on the trait in the population. Komen and Thorgaard (2007) discuss the advantage of using double haploids for QTL mapping and present case studies for rainbow trout, but also mention the obstacles to implementation of this approach (related to yield, survival, fertility, quality control and sustained commitment of resources). They conclude that the biggest challenge is the extremely low yields of doubled haploids in experiments with a variety of fish species. MAS: The development of large numbers of genetic markers and genetic maps for many aquacultured species (as mentioned above), which enables detection of QTL, has further led to search for genes associated with commercial traits. Opportunities that were proposed about 25 years ago (Soller and Beckmann, 1982; Beckmann and Soller, 1983), namely the use of genetic markers for selection, are finally becoming a reality. And yet, ‘only a handful of cases demonstrating practical usefulness of MAS’ have been reported in livestock (Rothschild and Ruvinsky, 2007) and even fewer in aquacultured species. The most remarkable application so far is the breeding of a lymphocystis disease-resistant Japanese flounder (Paralichthys olivaceus) (Fuji et al., 2006, 2007; Sakamoto et al., 2006), although this is not a real selective breeding program. They identified a major locus that is mapped to LG15 of the Japanese flounder linkage map, which is highly associated with resistance to the lymphocyctis disease (LD). Specifically, one allele of this marker is tightly linked to LD resistance. LD resistance and the marker are inherited in a Mendelian fashion, with LD resistance behaving as a dominant trait. This inference enabled selection of resistant parents for establishing an LD-resistant stock. With the many projects of marker development, QTL and linkage mapping in progress (see for examples Liu, 2007a; Martinez, 2007), it is anticipated that the industry will adopt the MAS strategy in the near future (Rothschild and Ruvinsky, 2007). Sonesson (2007a) and Martinez (2007) reviewed the current status of aqua-
Genetic improvement of finfish
67
culture breeding schemes and evaluated the possibilities for applying MAS. So far, MAS schemes have been mostly developed for livestock. Sonesson (2007b) is developing and optimizing models for combining MAS with the classical aquaculture breeding schemes using the best linear unbiased prediction (BLUP) model. Genomics Wenne et al. (2007) reviewed the current development of genomic technologies and their potential applications and implications for fisheries management and aquaculture. Full genome sequences are so far available only for a few model fish species such as zebrafish Danio rerio (http://www.sanger.ac.uk/ Projects/D_rerio/), fugu Takifigu rubripes (http://www.fugu-sg.org/), puffer fish Tetraodon nigroviridis (http://www.genome.gov/11008305), medaka Oryzias latipes (http://dolphin.lab.nig.ac.jp/medaka/index.php) and stickleback Gasterosteus aculeatus (http://www.genome.gov/12512292). A Tilapia Genome Sequencing Project is currently underway at the Broad Institute [a research collaboration involving the Massachusetts Institute of Technology (MIT) and Harvard University], and the release of a first high-coverage genome is expected before the end of 2009 (TD Kocher, University of Maryland, USA, pers comm). Sequenced genomes of the model species have been well exploited so far with bioinformatics analyses and molecular biology techniques. It is anticipated that integration of more traditional disciplines such as biochemistry and physiology and expanding the study to additional species such as carp, catfish, salmon, trout or tilapia will further exploit the potential of fish genomics. This will be accompanied by applications to environmental biology and aquaculture (Crollius and Weissenbach, 2007). Various aspects of fish genomics have recently been reviewed in great detail in a book edited by Liu (2007a). Therein, Davidson (2007) and Xu et al. (2007) discuss the importance and utility of BAC libraries as the key genomic resource required for building genetic maps and integrating them with the respective physical maps. Guo et al. (2007) reviewed the utility of FISH as a tool in genome mapping. Many FISH studies have been published, but the full potential of this tool for gene and genomic mapping as well as for comparative genomic analysis in aquacultured species has not yet been realized. Rexroad (2007) reviewed the construction of radiation hybrids (RH) and discuss the perspective of RH mapping for aquaculture species. Apart from zebrafish, the only RH map reported so far for an aquacultured species is for the gilthead sea bream (Senger et al., 2006; Sarropoulou et al., 2008). Lee and Kocher (2007) presented an example of how comparative mapping and positional cloning were employed in an attempt to identify the gene(s) underlying a QTL for sex determination identified on LG1 of Nile tilapia. Their conclusion is that ‘conservation of gene order among fish at scales of several Mbs allows the use of the relatively complete sequences of model fish species to accelerate gene discovery and positional cloning of these genes’.
68
New technologies in aquaculture
Bioinformatic tools already available and those that will be further developed enable prediction of genes in important aquaculture species using the genome sequences of the model fishes. The sequencing of the genome of Nile tilapia, expected to be completed during 2009 (TD Kocher, University of Maryland, USA, pers comm), will further boost the use of comparative mapping of aquacultured species. Chapters 20–24 in Liu (2007a) review and discuss the status and perspective of analyzing genome expression and gene function in fish using expressed sequence tags (EST) and microarrays. More details on the status of genome mapping and genomics in salmonids, cyprinids, catfish, tilapias, European sea bass and Japanese flounder can be found in the recently published book Genome Mapping and Genomics in Fishes and Aquatic Animals (Kocher and Kole, 2008). Transgenesis Gene transfer technology leading to the production of genetically modified organisms (GMOs) is probably the most controversial issue dealt with in this chapter. On one hand, its successful application in several aquaculture species has produced stocks with improved traits, such as enhanced growth rate. The most notable of these are in salmonids, e.g., Devlin et al. (2004) and Fletcher et al. (2004), mud loach, e.g., Nam et al. (2001, 2002, 2004), and tilapia, e.g., Martínez et al. (2000), Maclean et al. (2002) and Caelers et al. (2005). Another case is increased cold tolerance through expression of an antifreeze polypeptide that might potentially expand culture range of salmon (Devlin et al., 2004). Gene transfer also has the potential to contribute to disease resistance [e.g., enhanced bacterial disease resistance of cecropin-transgenic channel catfish (Ictalurus punctatus) – Dunham et al. (2002) – and resistance to Aeromonas hydrophila infection in human lactoferrin-transgenic grass carp (Ctenopharyngodon idellus) – Mao et al. (2004)] and other traits. On the other hand, GMOs pose environmental threats and have raised public concerns that, so far, prevent their commercial use by the aquaculture industry (e.g., Kapuscinski and Hallerman, 1990; Levy et al., 2000; NRC, 2002; Pew, 2003; Myhr and Dalmo, 2005; Rasmussen and Morrissey, 2007). Galli (2002) presented a quite comprehensive overview of the current status of modern biotechnology research in aquaculture. Directed to policy and decision makers, it highlights issues relevant to research and the potential for commercialization of genetically modified (GM) aquacultured organisms. Teufel et al. (2002) reviewed the research on transgenic trout and salmon, their potential and the constraints for implementation. The issues of public concerns and implications to the aquaculture industry have been further discussed by several scientists, e.g., Aerni (2004), Maclean (2003) and Millar and Tomkins (2007). A special volume (Kapuscinski et al., 2007) published recently has focused on the potential environmental risks (threats to biodiversity and natural ecosystems) and
Genetic improvement of finfish
69
benefits of uses of aquacultured GMOs. It covers all aspects from the development of transgenic fish, through assessment of environmental risks from their use, to suggestions for risk management of transgenic fish. The main conclusion and message of the book is that the risks ‘must be honestly and accurately analysed and understood by society’ in order to allow the potential benefits of transgenic aquaculture research to be realized. It further suggests that ‘using this book’s chapters for guidance, countries can begin to approach the task of creating effective, scientifically sound and socially responsible biosafety policies for transgenic fish and other aquatic organisms’. Commercialization of transgenic fish, however, poses not only ecological, food safety and regulatory issues, but also animal welfare concerns. Hallerman et al. (2007) reviewed the effects of growth hormone transgenes on the welfare and behavior of four species: Atlantic salmon, coho salmon, tilapia and common carp. Various morphological, physiological and behavioral alternations occur in GH-transgenics that seem to negatively affect, among other traits, swimming ability and reproductive behavior. Possible means for reducing the welfare issues that arise are discussed, such as the use of weaker promoters in expression vectors and selection of transgenic lines with physiologically appropriate levels of GH expression. Furthermore, since GH-transgenic animals have higher energy demands than non-transgenic fish, optimizing their formulated diets may improve production potential of transgenic animals and help maintain their welfare. The production of transgenics in itself has met with various difficulties, one of which is lack of control over integration of a single copy of a transgene and its proper expression. In recent years, use of embryonic stem (ES) cell lines has been investigated as an alternative approach for gene transfer. Hong et al. (2000) have reviewed the status and perspectives of using ES for transgenesis in fish. Since then, more studies have focused on the model fishes medaka (Bubenshchikova et al., 2005) and zebrafish (e.g., Ma et al., 2001; Fan et al., 2004; Hong and Schartl, 2006; Alvarez et al., 2007; Chen et al., 2007), and in recent years, a few attempts have also been made in aquacultured species (Holen and Hamre, 2003; Parameswaran et al., 2007).
2.3 Case studies – risks associated with selective breeding programs Species or strains of many fish species have been translocated from their place of origin, or from places to which they have been introduced, and deliberately released for stocking or escaped from culture facilities, thereby affecting wild stocks (Cross, 2000). A few outstanding examples will be discussed.
70
New technologies in aquaculture
The farming of Atlantic salmon (Salmo salar), which has greatly expanded in the last 50–60 years, resulted in large numbers of escaped farm salmon invading native salmon populations throughout the North Atlantic (e.g., Fleming et al., 2000; Gilbey et al., 2005; Carr and Whoriskey, 2006; Hindar et al., 2006; O’Reilly et al., 2006). The nature of this interaction has been investigated by McGinnity et al. (2003, 2004), Weir et al. (2004, 2005) and others. Naylor et al. (2005) presented a thorough analysis of the problem in their assessment of the risks of escaped salmon from net-pen aquaculture, and listed various potential biological consequences of farm salmon escapes: risk of feral stock establishment; risks of competition with wild fish for mates, space and prey; risk of pathogen transmission; and, most relevant to this review, risks associated with genetic interactions with wild stocks. These were further discussed in the framework of the EU GENIMPACT project: Evaluation of genetic impact of aquaculture activities on native populations (Verspoor et al., 2006). Moreover, the culture of Atlantic salmon has been shown to genetically affect wild populations of other salmonids as well, e.g., sea trout (Salmo trutta) (Coughlan et al., 2006). Of even greater concern are the risks associated with the Atlantic salmon selective breeding programs. Since the 1980s, a series of corporate merger and spin-off through purchase and sale of Atlantic salmon breeding and/or growing companies has resulted in translocations of stocks among countries in Europe as well as North America and Chile. For example, the origin of Donegal Silver Irish salmon lies in the MOWI Norwegian broodstock, eggs from which were introduced at Fanad Fisheries in 1982. Marine Harvest, one of the largest salmon companies in the world resulting from these mergers, with branches in Ireland, Norway, Scotland, Canada and Chile, has moved stocks within Europe as well as from Europe to North and South America (A. Norris, Marine Harvest, pers comm; http://www. marineharvest.com/). The effects of cultured species on their respective wild populations is visible in the last two or three decades also with the Mediterranean gilthead sea bream (Sparus aurata) and sea bass (Dicentrarchus labrax). These effects include interaction and competition for resources by accidentally escaping fish (whose numbers are increasing according to the records) and contribution of escaped fish to reproduction in the wild. Data suggest that the contribution of escaped spawners ‘is not negligible’ and that a decrease in mean size of fish caught in the longline fishery in Greek coastal lagoons has already been detected (Dimitriou et al., 2007). Naylor et al. (2005) predict that the rising production of two new marine species – cod and halibut – may lead to similar processes. Escaped hybrid catfish (female Thai walking catfish, Clarias macrocephalus × male African catfish, C. gariepinus) from farms in central Thailand may interbreed with C. macrocephalus individuals in the wild. Senanan et al. (2004) assessed genetic introgression of C. gariepinus genes into four wild and two broodstock populations of C. macrocephalus.
Genetic improvement of finfish
71
Tilapias are a group of fish that have been widely spread around the world since the 1950s (Pullin et al., 1997). More recently, stocks of Nile tilapia (O. niloticus) were introduced from various regions in Africa into the Philippines and mixed with cultured (earlier – introduced) strains to form the base population for the GIFT breeding program carried out by the WorldFish Center (formerly ICLARM) and collaborators (Eknath et al., 1993, 2007; Eknath, 1995). Improved descendants from this program were disseminated to several countries in Southeast Asia for evaluation against local stocks, eventually leading to commercial culture of this introduced strain, which showed superior growth rate and survival relative to that of other strains used by farmers (De Silva, 2003). Since no native wild populations of tilapia existed in those countries, escapement did not result in any damage to wild populations. Upon termination of the GIFT research program, sub-samples were transferred to several countries in the region and served as founders for separate, parallel, further breeding programs (Gupta and Acosta, 2004). According to Ponzoni (2007, WorldFish Center, pers comm), the WorldFish policy has been not to transfer GIFT to Africa because of biodiversity considerations, namely, due to concerns that the fish could escape and cross with wild populations in Africa, thus contaminating their gene pool. Consequently, countries from which wild fish were sampled to initiate the breeding program (Egypt, Ghana, Kenya and Senegal) did not benefit from the genetic gain made, and have received nothing in return for their collaboration. The issue has been raised by some African representatives and it has re-kindled the debate on the matter. This has resulted in a recommendation to allow controlled introduction followed by a properly designed comparison of GIFT with relevant local strains to ascertain that there is a productivity advantage exhibited by GIFT. At present, WorldFish is finalizing the policy document that will define the circumstances under which the introduction of GIFT to an African country will be authorized. ‘Given a favorable outcome for GIFT from the above comparison, multiplication and dissemination of GIFT will be authorized. The multiplication and dissemination programs will be accompanied by a package of measures attempting to minimize the risk of escapes and to mitigate the impact in case these should occur’ (Ponzoni, 2007, WorldFish Center, pers comm).
2.4 Future trends Conventional breeding programs will continue to be the main engine driving the global finfish aquaculture industry forward. Efforts will persist to increase efficiency and optimize the design of breeding programs by maximising the use of pedigree information while using both established and cutting-edge technologies mentioned above. However, since these methods are less suitable for economically important traits that are
72
New technologies in aquaculture
difficult to measure on candidates for selection (such as carcass and disease traits), alternative approaches will have to be further developed and optimized. Here is where incorporation of recent biotechnological tools may come into play. The potential for accelerating breeding programs expected from applying these tools has yet to be realized in the aquaculture industry. Nevertheless, MAS and gene-assisted selection (GAS) methodologies, when mature, may eventually become practical in efforts towards identifying genes that underlie economically-important traits and towards combining quantitative and molecular data in breeding programs. A potential alternative breakthrough may arise from solving containment problems currently limiting the use of GM aquacultured organisms; once the public prefers education to regulation, antagonism to the use of GM may fade out.
2.5 Sources of further information and advice Several books devoted to various aspects and methodologies discussed in this chapter were published in recent years. These will obviously serve as the main sources for further information for the near future. Among them are Fingerman and Nagabhushanam’s (2000) Recent Advances in Marine Biotechnology: Aquaculture – Fishes, Beaumont and Hoare’s (2003) Biotechnology and Genetics in Fisheries and Aquaculture; Hallerman’s (2003) Population Genetics: Principles and Applications for Fisheries Scientists; Dunham’s (2004) Aquaculture and Fisheries Biotechnology: Genetic Approaches; Gjedrem’s (2005) Selection and Breeding Programs in Aquaculture; Liu’s (2007a) Aquaculture Genome Technologies; and Kocher and Kole’s (2008) Genome Mapping and Genomics in Fishes and Aquatic Animals.
2.6 Acknowledgement The authors would like to thank Eric Hallerman for his valuable comments and suggestions that helped shape the view-point expressed in the paper and improved its prose. This paper is contribution No. 526/08 from the ARO, The Volcani Center, Bet Dagan, Israel.
2.7 References aerni p (2004) Risk, regulation and innovation: the case of aquaculture and transgenic fish, Aquat Sci, 66, 327–41. alvarez m c, béjar j, chen s and hong y (2007) Fish ES cells and applications to biotechnology, Mar Biotechnol, 9(2), 117–27.
Genetic improvement of finfish
73
arai k (2000) Chromosome manipulation in aquaculture: recent progress and perspective, Suisanzoshoku, 48, 295–303. arai k (2001) Genetic improvement of aquaculture finfish species by chromosome manipulation techniques in Japan, Aquaculture, 197(1–4), 205–28. artamonova v s (2007) Genetic markers in population studies of Atlantic salmon Salmo salar L.: analysis of DNA sequences, Russ J Genet, 43(4), 341–53. ashley p j (2007) Fish welfare: current issues in aquaculture, Appl Anim Behav Sci, 104, 199–235. babiak i, dobosz s, goryczko k, kuzminski h, brzuzan p and ciesielski s (2002a) Androgenesis in rainbow trout using cryopreserved spermatozoa: the effect of processing and biological factors, Theriogenology, 57(4), 1229–49. babiak i, dobosz s, kuzminski h, goryczko k, ciesielski s, brzuzan p, urbányi b, horváth a, lahnsteiner f and piironen j (2002b) Failure of interspecies androgenesis in salmonids, J Fish Biol, 61(2), 432–47. bartley d m, rana k and immink a j (2001) The use of inter-specific hybrids in aquaculture and fisheries, Rev Fish Biol Fish, 10, 325–37. beaumont a r and hoare k (eds) (2003) Biotechnology and Genetics in Fisheries and Aquaculture, Oxford, Blackwell. beckmann j s and soller m (1983) Restriction fragment length polymorphisms in genetic improvement: methodologies, mapping and costs, Theor Appl Genet, 67(1), 35–43. bentsen h b and olesen i (2002) Designing aquaculture mass selection programs to avoid high inbreeding rates, Aquaculture, 204(3–4), 349–59. bertotto d, cepollaro f, libertini a, barbaro a, francescon a, belvedere p, barbaro j and colombo l (2005) Production of clonal founders in the European sea bass, Dicentrarchus labrax L., by mitotic gynogenesis, Aquaculture, 246(1–4), 115–24. brännäs e, chaix t, nilsson j and eriksson l o (2005) Has a 4-generation selection programme affected the social behaviour and growth pattern of Arctic charr (Salvelinus alpinus)?, Appl Anim Behav Sci, 94, 165–78. bubenshchikova e, ju b, pristyazhnyuk i, niwa k, kaftanovskaya e, kinoshita m, ozato k and wakamatsu y (2005) Generation of fertile and diploid fish, medaka (Oryzias latipes), from nuclear transplantation of blastula and four-somite-stage embryonic cells into nonenucleated unfertilized eggs, Clon Stem Cells, 7(4), 255–64. caelers a, maclean n, hwang g, eppler e and reinecke m (2005) Expression of endogenous and exogenous growth hormone (GH) messenger (m) RNA in a GH-transgenic tilapia (Oreochromis niloticus), Transgenic Res, 14, 95–104. cal r m, vidal s, gómez c, álvarez-blázquez b, martínez p and piferrer f (2006) Growth and gonadal development in diploid and triploid turbot (Scophthalmus maximus), Aquaculture, 251(1), 99–108. carr j w and whoriskey f g (2006) The escape of juvenile farmed Atlantic salmon from hatcheries into freshwater streams in New Brunswick, Canada, ICES J Mar Sci, 63(7), 1263–8. chen s-l, sha z-x, ye h-q, liu y, tian y-s, hong y and tang q-s (2007) Pluripotency and chimera competence of an embryonic stem cell line from the sea perch (Lateolabrax japonicus), 9(1), 82–91. chistiakov d a, hellemans b, haley c s, law a s, tsigenopoulos c s, kotoulas g, bertotto d, libertini a and volckaert f a m (2005) A microsatellite linkage map of the European sea bass Dicentrarchus labrax L., Genetics, 170(4), 1821–6. chistiakov d a, hellemans b and volckaert f a m (2006) Microsatellites and their genomic distribution, evolution, function and applications: a review with special reference to fish genetics, Aquaculture, 255(1–4), 1–29.
74
New technologies in aquaculture
cnaani a, lee b-y, ozouf-costaz c, bonillo c, baroiller j-f, d’cotta h and kocher t d (2007a) Mapping of sox2 and sox14 in tilapia (Oreochromis spp.), Sex Dev, 1, 207–10. cnaani a, lee b-y, zilberman n, ozouf-costaz c, hulata g, ron m, d’hont a, baroiller j-f, d’cotta h, penman d j, tomasino e, coutanceau j-p, pepey e, shirak a and kocher t d (2007b) Genetics of sex determination in tilapiine species, Sex Dev, 2, 43–54. coimbra m r m, kobayashi k, koretsugu s, hasegawa o, ohara e, ozaki a, sakamoto t, naruse k and okamoto n (2003) A genetic linkage map of the Japanese flounder, Paralichthys Olivaceus Aquacuture, 220, 203–18. coughlan j, mcginnity p, o’farrell b, dillane e, diserud o, de eyto e, farrell k, whelan k, stet r j m and cross t f (2006) Temporal variation in an immune response gene (MHC I) in anadromous Salmo trutta in an Irish river before and during aquaculture activities, ICES J Mar Sci, 63, 1248–55. crollius h r and weissenbach j (2005) Fish genomics and biology, Genome Res, 15(12), 1675–82. cross t f (2000) Genetic implications of translocation and stocking of fish species, with particular reference to Western Australia, Aquac Res, 31(1), 83–94. d’agaro e, woolliams j a, haley c s and lanari d (2007) Optimizing mating schemes in fish breeding. Ital J Anim Sci, 6(Suppl. 1), 795–6. danzmann r g and gharbi k (2007) Linkage mapping in aquaculture species, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 139–67. danzmann r g, cairney m, davidson w s, ferguson m m, gharbi k, guyomard r, holm l-e, leder e, okamoto n, ozaki a, rexroad iii c e, sakamoto t, taggart j b and woram r a (2005) A comparative analysis of the rainbow trout genome with 2 other species of fish (Arctic charr and Atlantic salmon within the tetraploid derivative Salmonidae family (subfamily: Salmoninae), Genome, 48, 1037–51. davidson w s (2007) Bacterial artificial chromosome libraries and BAC-based physical mapping of aquaculture genomes, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 245–59. de silva s s (2003) Tilapias as Exotics in the Asia-Pacific: a Review. FAO Fisheries Technical Paper, No. 450, Rome, Food and Agriculture Organization of the United Nations. devlin r h, nagahama y (2002) Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences, Aquaculture, 208, 191–364. devlin r h, biagi c a and yesaki t y (2004) Growth, viability and genetic characteristics of GH transgenic coho salmon strains, Aquaculture, 236(1–4), 607–32. dimitriou e, katselis g, moutopoulos d k, akovitiotis c and koutsikopoulos c (2007) Possible influence of reared gilthead sea bream (Sparus aurata, L.) on wild stocks in the area of the Messolonghi lagoon (Ionian Sea, Greece), Aquac Res, 38(4), 398–408. doyle r w and herbinger c (1995) The use of DNA fingerprinting for high-intensity, within-family selection in fish breeding, Proceedings of the Fifth World Congress on Genetic Applications to Livestock Production, University of Guelph, Guelph, ONT, 19, 364–70. dunham r a (ed.) (2004) Aquaculture and Fisheries Biotechnology: Genetic Approaches, Oxford, CABI. dunham r a, majumdar k, hallerman e, bartley d, mair g, hulata g, liu z, pongthana n, bakos j, penman d, gupta m, rothlisberg p and hoerstgenschwark g (2001) Review of the status of aquaculture genetics, in Subasinghe R P, Bueno P, Phillips M J, Hough C, McGladdery S E and Arthur J R (eds), Aquaculture in the Third Millenium, Technical Proceedings of the Conference on
Genetic improvement of finfish
75
Aquaculture in the Third Millenium, 20–25 February 2000, Bangkok, Bangkok NACA and Rome, FAO, 129–57. dunham r a, warr g w, nichols a, duncan p l, argue b, middleton d and kucuktas h (2002) Enhanced bacterial disease resistance of transgenic channel catfish Ictalurus punctatus possessing cecropin genes, Mar Biotechnol, 4(3), 338–44. dupont-nivet m, vandeputte m, haffray p and chevassus b (2006) Effect of different mating designs on inbreeding, genetic variance and response to selection when applying individual selection in fish breeding programs, Aquaculture, 252(2–4), 161–70. eknath a e (1995) Managing aquatic genetic resources. Management Example 4: The Nile tilapia, in Thorpe J (ed.), Conservation of Fish and Shellfish Resources: Managing Diversity, London, Academic Press, 176–94. eknath a e, tayamen m m, palada-de vera m s, danting j c, reyes r a, dionisio e e, capili j b, bolivar h l, abella t a, circa a v, bensten h b, gjerde b, gjedrem t and pullin r s v (1993) Genetic improvement of farmed tilapias: the growth performance of eight strains of Oreochromis niloticus tested in different farm environments, Aquaculture, 111, 171–88. eknath a e, bentsen h b, ponzoni r w, rye m, nguyen n h, thodesen j and gjerde b (2007) Genetic improvement of farmed tilapias: composition and genetic parameters of a synthetic base population of Oreochromis niloticus for selective breeding, Aquaculture, 273, 1–14. estoup a, gharbi k, sancristobal m, chevalet c, haffray p and guyomard r (1998) Parentage assignment using microsatellites in turbot (Scophthalmus maximus) and rainbow trout (Oncorhynchus mykiss) hatchery populations, Can J Fish Aquat Sci, 55, 715–25. ezaz t, stiglec r, veyrunes f and marshall graves j a (2006) Relationships between vertebrate ZW and XY sex chromosome systems – review, Curr Biol, 16, R736–R743. fan l, crodian j and collodi p (2004) Production of zebrafish germline chimeras by using cultured embryonic stem (ES) cells, Meth Cell Biol, 77, 113–19. fao (2007) The State of World Fisheries and Aquaculture 2006, Rome, Food and Agriculture Organization of the United Nations. felip a, piferrer f, carrillo m and zanuy s (2002) Growth, gonadal development and sex ratios of meiogynogenetic diploid sea bass, J Fish Biol, 61(2), 347–59. felip a, zanuy s, carrillo m and piferrer f (2001a) Induction of triploidy and gynogenesis in teleost fish with emphasis on marine species, Genetica, 111(1–3), 175–95. felip a, piferrer f, zanuy s and carrillo m (2001a) Comparative growth performance of diploid and triploid European sea bass over the first four spawning seasons, J Fish Biol, 58, 76–88. fingerman m and nagabhushanam r (2000) Recent Advances in Marine Biotechnology, Volume 4 Aquaculture, Part B Fishes, Enfield, Science Publishers. fjalestad k t, moen t and gomez-raya l (2003) Prospects for genetic technology in salmon breeding programmes, Aquac Res, 34(5), 397–406. fleming i a, hindar k, mjolnerod i b, jonsson b, balstad t and lamberg a (2000) Lifetime success and interactions of farm salmon invading a native population, Proc Royal Soc – Biol Sci (Ser B), 267(1452), 1517–23. fletcher g l, shears m a, yaskowiak e s, king m j and goddard s v (2004) Gene transfer: Potential to enhance the genome of Atlantic salmon for aquaculture, Aust J Exp Agric, 44(11), 1095–100. flynn s r, matsuoka m, reith m, martin-robichaud d j and benfey t j (2006) Gynogenesis and sex determination in shortnose sturgeon, Acipenser brevirostrum Lesuere, Aquaculture, 253(1–4), 721–7.
76
New technologies in aquaculture
fontana f (2002) A cytogenetic approach to the study of taxonomy and evolution in sturgeons, J Appl Ichthyol, 18(4–6), 226–33. fopp-bayat d, jankun m, woznicki p and kolman r (2007) Viability of diploid and triploid larvae of Siberian sturgeon and bester hybrids, Aquac Res, 38, 1301–4. franch r, louro b, tsalavouta m, chatziplis d, tsigenopoulos c s, sarropoulou e, antonello j, magoulas a, mylonas c c, babbucci m, patarnello t, power d m, kotoulas g and bargelloni l (2006) A genetic linkage map of the hermaphrodite teleost fish Sparus aurata L., Genetics, 174(2), 851–61. fuji k, kobayashi k, hasegawa o, coimbra m r m, sakamoto t and okamoto n (2006) Identification of a single major genetic locus controlling the resistance to lymphocystis disease in Japanese flounder (Paralichthys olivaceus), Aquaculture, 254(1–4), 203–10. fuji k, hasegawa o, honda k, kumasaka k, sakamoto t and okamoto n (2007) Marker-assisted breeding of a lymphocystis disease-resistant Japanese flounder (Paralichthys olivaceus), Aquaculture, 272(1–4), 291–5. gall g a e and neira r (2004) Genetic analysis of female reproduction traits of farmed coho salmon (Oncorhyncus kisutch), Aquaculture, 234(1–4), 143–54. gallardo j a, garcía x, lhorente j p and neira r (2004a) Inbreeding and inbreeding depression of female reproductive traits in two populations of coho salmon selected using BLUP predictors of breeding values, Aquaculture, 234(1–4), 111–22. gallardo j a, lhorente j p, garcía x and neira r (2004b) Effects of nonrandom mating schemes to delay the inbreeding accumulation in cultured populations of coho salmon (Oncorhynchus kisutch), Can J Fish Aquat Sci, 61(4), 547–53. galli l (2002) Genetic Modification in Aquaculture – A Review of Potential Benefits and Risks, Canberra, Bureau of Rural Sciences. garber a f and sullivan c v (2006) Selective breeding for the hybrid striped bass (Morone chrysops, Rafinesque × M. saxatilis, Walbaum) industry: status and perspectives, Aquac Res, 37(4), 319–38. garbey k, gautier a, danzmann r g, gharbi s, sakamoto t, høyheim b, taggart j b, cairney m, powell r, krieg f, okamoto n, ferguson m m, holm l-e and guyomard r (2006) A linkage map for brown trout (Salmo trutta): chromosome homeologies and comparative genome organization with other salmonid fish, Genetics, 172, 2405–19. gilbey j, knox d, o’sullivan m and verspoor e (2005) Novel DNA markers for rapid, accurate, and cost-effective discrimination of the continental origin of Atlantic salmon (Salmo salar L.), ICES J Mar Sci, 62(8), 1609–16. gjedrem t (2000) Genetic improvement of cold-water fish species, Aquac Res, 31(1), 25–33. gjedrem t (2002) Selective breeding – essential for further productivity, sustainability in aquaculture, Global Aquac Advocate, Feb., 46–7. gjedrem t (2005) Selection and Breeding Programs in Aquaculture, Dordrecht, Springer. gjerde b, gjøen h m and villanueva b (1996) Optimum designs for fish breeding programmes with constrained inbreeding mass selection for a normally distributed trait, Livest Prod Sci, 47(1), 59–72. gjerde b, reddy p v g k, mahapatra k d, saha j n, jana r k, meher p k, sahoo m, lenka s, govindassamy p and rye m (2002) Growth and survival in two complete diallele crosses with five stocks of rohu carp (Labeo rohita), Aquaculture, 209(1– 4), 103–15. gjerde b, terjesen b f, barr y, lein i and thorland i (2004) Genetic variation for juvenile growth and survival in Atlantic cod (Gadus morhua), Aquaculture, 236(1–4), 167–77.
Genetic improvement of finfish
77
gjerde b, pante m j r and baeverfjord g (2005) Genetic variation for a vertebral deformity in Atlantic salmon (Salmo salar), Aquaculture, 244(1–4), 77–87. gomelsky b (2003) Chromosome set manipulation and sex control in common carp: a review, Aquat Living Resour, 16(5), 408–15. gomelsky b, dabrowski k, garcia-abiado m a, stilwell w, tidwell j h and coyle s d (2004) Ploidy of backcross hybrids of largemouth bass and smallmouth bass, N Amer J Aquac, 66(2), 133–6. gorshkova g (2006) Practical use of cytogenetics in fish biology and aquaculture, Isr J Aquac – Bamidgeh, 58(4), 280–5. gorshkova g, gorshkov s, hadani a, gordin h and knibb w (1995) Chromosome set manipulations in marine fish, Aquaculture, 137, 157–8. gorshkova g, gorshov s, gordin h and knibb w (1996) Karyological studies in hybrids of beluga Huso huso (L.) and the Russian sturgeon Acipenser guldenstaedti Brant, Isr J Aquac – Bamidgeh, 48, 35–9. gorshkov s, gorshkova g, hadani a, gordin h and knibb w (1998) Chromosome set manipulations and hybridization experiments in gilthead seabream (Sparus aurata). I. Induced gynogenesis and intergeneric hybridization using males of the red seabream (Pagrus major), Isr J Aquac – Bamidgeh, 50(3), 99–110. gorshkova g, gorshkov s and golani d (2002a) Karyotypes of Barbus canis and Capoeta damascina (Pisces, Cyprinidae) from the Middle East, Ital J Zool, 69, 191–4. gorshkova g, protas y, ben-atia s and gorshkov s (2002b) Cytogenetic examination of early embryonic development in the white grouper, Epinephelus aeneus (Pisces, Serranidae), J Appl Ichthyol, 18, 29–34. gorshkov s, gorshkova g, meiri i and gordin h (2004) Culture performance of different strains and crosses of the European sea bass (Dicentrarchus labrax) reared under controlled conditions in Eilat, Israel, J Appl Ichthyol, 20, 194–203. grunina a s and recoubratsky a v (2005) Induced androgenesis in fish: obtaining viable nucleocytoplasmic hybrids, Russ J Dev Biol, 36(4), 208–17. grunina a s, recoubratsky a v, tsvetkova l i and barmintsev v a (2006) Investigation on dispermic androgenesis in sturgeon fish: The first successful production of androgenetic sturgeons with cryopreserved sperm, Int J Refrig, 29(3), 379–86. guo x, wang y and xu z (2007) Genomic analyses using fluorescence in situ hybridization, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 289–311. gupta m v and acosta b o (2004) From drawing board to dining table: the success story of the GIFT project, NAGA, 27(3&4), 4–14. haidle l, janssen j e, gharbi k, moghadam h k, ferguson m m and danzmann r g (2008) Determination of quantitative trait loci (QTL) for early maturation in rainbow trout (Oncorhynchus mykiss), Mar Biotechnol, 10, 579–92. hallerman e m (2003) Population Genetics: Principles and Application for Fisheries Scientists, American Fisheries Society, Bethesda, MD. hallerman e m, mclean e and fleming i a (2007) Effects of growth hormone transgenes on the behavior and welfare of aquacultured fishes: a review identifying research needs, Appl Anim Behav Sci, 104(3–4), 265–94. hayes b, sonesson a k and gjerde b (2005) Evaluation of three strategies using DNA markers for traceability in aquaculture species, Aquaculture, 250(1–2), 70–81. hayes b, he j, moen t and bennewitz j (2006) Use of molecular markers to maximise diversity of founder populations for aquaculture breeding programs, Aquaculture, 255(1–4), 573–8. hayes b, laerdahl j k, lien s, moen t, berg p, hindar k, davidson w s, koop b f, adzhubei a and hoyheim b (2007) An extensive resource of single nucleotide
78
New technologies in aquaculture
polymorphism markers associated with Atlantic salmon (Salmo salar) expressed sequences, Aquaculture, 265, 82–90. helge stien l, manne f, ruohonene k, kause a, rungruangsak-torrissen k and kiessling a (2006) Automated image analysis as a tool to quantify the colour and composition of rainbow trout (Oncorhynchus mykiss W.) cutlets, Aquaculture, 261(2), 695–705. henryon m, berg p, olesen n j, kjær t e, slierendrecht w j, jokumsen a and lund i (2005) Selective breeding provides an approach to increase resistance of rainbow trout (Onchorhynchus mykiss) to the diseases, enteric redmouth disease, rainbow trout fry syndrome, and viral haemorrhagic septicaemia, Aquaculture, 250(3–4), 621–36. herbinger c m, doyle r w, pitman e r, paquet d, mesa k a, morris d b, wright j m and cook d (1995) DNA fingerprint based analysis of paternal and maternal effects on offspring growth and survival in communally reared rainbow trout, Aquaculture, 137, 245–56. herbinger c m, o’reilly p t, doyle r w, wright j m and o’flynn b (1999) Early growth performance of Atlantic salmon full-sib families reared in single family tanks versus in mixed family tanks, Aquaculture, 173(1–4), 105–16. hershberger w k (2006) What can history tell us about the future of aquaculture genetics?, Isr J Aquac – Bamidgeh, 58(4), 223–9. hindar k, fleming i a, mcginnity p and diserud o (2006) Genetic and ecological effects of salmon farming on wild salmon: modelling from experimental results, ICES J Mar Sci, 63(7), 1234–47. hinrichs d, wetten m and meuwissen t h e (2006) An algorithm to compute optimal genetic contributions in selection programs with large numbers of candidates, J Anim Sci, 84(12), 3212–18. holen e and hamre k (2003) Towards obtaining long term embryonic stem cell like cultures from a marine flatfish, Scophtalmus maximus, Fish Physiol Biochem, 29(3), 245–52. holtsmark m, sonesson a k, gjerde b and klemetsdal g (2006) Number of contributing subpopulations and mating design in the base population when establishing a selective breeding program for fish, Aquaculture, 258(1–4), 241–9. holtsmark m, klemetsdal g, sonesson a k and woolliams j a (2008) Establishing a base population for a breeding program in aquaculture, from multiple subpopulations, differentiated by genetic drift: I. Effects of the number of subpopulations, heritability and mating strategies using optimum contribution selection, Aquaculture, 274(2–4), 232–40. hong y and schartl m (2006) Isolation and differentiation of medaka embryonic stem cells, Meth Molec Biol, 329, 3–16. hong y, chen s and schartl m (2000) Embryonic stem cells in fish: current status and perspectives, Fish Physiol Biochem, 22(2), 165–70. hulata g (2001) Genetic manipulations in aquaculture: a review of stock improvement by classical and modern technologies, Genetica, 111, 155–73. kapuscinski a r and hallerman e m (1990) Transgenic fish and public policy. Anticipating environmental impacts of transgenic fish, Fisheries 15(1), 2–11. kapuscinski a r, hayes k r, li s, dana g, hallerman em and schei p (2007) Environmental Risk Assessment of Genetically Modified Organisms, Volume 3. Methodologies for Transgenic Fish, Oxford CABI. kause a, ritola o and paananen t (2004) Breeding for improved appearance of large rainbow trout in two production environments, Aquac Res, 35(10), 924–30. kause a, ritola o, paananen t, mäntysaari e and eskelinen u (2003a) Selection against early maturity in large rainbow trout Oncorhynchus mykiss: the quantitative genetics of sexual dimorphism and genotype-by-environment interactions, Aquaculture, 228(1–4), 53–68.
Genetic improvement of finfish
79
kause a, ritola o, paananen t, eskelinen u and mäntysaari e (2003b) Big and beautiful? Quantitative genetic parameters for appearance of large rainbow trout, J Fish Biol, 62(3), 610–22. kause a, tobin d, dobly a, houlihan d, martin s, mäntysaari e a, ritola o and ruohonen k (2006a) Recording strategies and selection potential of feed intake measured using the X-ray method in rainbow trout, Genet Sel Evol, 38(4), 389–409. kause a, tobin d, houlihan d f, martin s a m, mäntysaari e a, ritola o and ruohonen k (2006b) Feed efficiency of rainbow trout can be improved through selection: Different genetic potential on alternative diets, J Anim Sci, 84(4), 807–17. kause a, tobin d, mäntysaari e a, martin s a m, houlihan d f, kiessling a, rungruangsak-torrissen k, ritola o and ruohonen k (2007) Genetic potential for simultaneous selection of growth and body composition in rainbow trout (Oncorhynchus mykiss) depends on the dietary protein and lipid content: phenotypic and genetic correlations on two diets, Aquaculture, 271(1–4), 162–72. kerby j h, everson j m, harrell r m, geiger j g, starling c c and revels h (2002) Performance comparisons between diploid and triploid sunshine bass in fresh water ponds, Aquaculture, 211(1–4), 91–108. khan t a, bhise m p and lakra w s (2000) Chromosome manipulation in fish – a review, Ind J Anim Sci, 70(2), 213–21. kim d s, nam y k and park i-s (1995) Survival and karological analysis of reciprocal diploid and triploid hybrids between mud loach (Misgurnus mizolepis) and cyprinid loach (Misgurnus anguillicaudatus) Aquaculture, 135, 257–65. knibb w (2000) Genetic improvement of marine fish – which method for industry?, Aquac Res, 31(1), 11–23. knibb w, gorshkova g and gorshkova s (1998a) Genetic improvement of cultured marine finfish: case studies, in De Silva S S (ed.), Tropical Mariculture, London, Academic Press, 111–49. knibb w, gorshkova g and gorshkova s (1998b) Selection and crossbreeding in Mediterranean cultured marine fish, in Bartley D and Basurco B (eds), Genetics and Breeding of Mediterranean Aquaculture Species, Zaragoza, CIHEAM, 47–60. kocher t d and kole c (2008) Genome Mapping and Genomics in Fishes and Aquatic Animals, Springer, Berlin/Heidelberg. kocour m, mauger s, rodina m, gela d, linhart o and vandeputte m (2007) Heritability estimates for processing and quality traits in common carp (Cyprinus carpio L.) using a molecular pedigree, Aquaculture, 270, 43–50. kolstad k, grisdale-helland b and gjerde b (2004) Family differences in feed efficiency in Atlantic salmon (Salmo salar), Aquaculture, 241(1–4), 169–77. kolstad k, heuch p a, gjerde b, gjedrem t and salte r (2005a) Genetic variation in resistance of Atlantic salmon (Salmo salar) to the salmon louse Lepeophtheirus salmonis, Aquaculture, 247(1–4), 145–51. kolstad k, meuwissen t h e and gjerde b (2005b) Efficient design for doing genetic studies of feed efficiency in Atlantic salmon (Salmo salar), Aquaculture, 247(1–4), 153–8. kolstad k, thorland i, refstie t and gjerde b (2006) Genetic variation and genotype by location interaction in body weight, spinal deformity and sexual maturity in Atlantic cod (Gadus morhua) reared at different locations off Norway, Aquaculture, 259(1–4), 66–73. komen h and thorgaard g h (2007) Androgenesis, gynogenesis and the production of clones in fishes: a review, Aquaculture, 269(1–4), 150–73. korol a, shirak a, cnaani a and hallerman e m (2007) Detection and analysis of quantitative trait loci (QTL) for economic traits in aquatic species, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 169–97.
80
New technologies in aquaculture
kucuktas h and liu z (2007) Allozyme and mitochondrial DNA markers, in Liu Z (ed.), Aquaculture Genome Technologies, Oxford, Blackwell, 73–85. lee b-y and kocher t d (2007) Comparative genomics and positional cloning, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 323–35. lee b-y, lee w-j, streelman j t, carleton k l, howe a e, hulata g, slettan a, stern j e, terai y and kocher t d (2005) A second-generation genetic linkage map of tilapia (Oreochromis spp.), Genetics, 170, 237–44. levy j a, marins l f and sanchez a (2000) Gene transfer technology in aquaculture, Hydrobiologia, 420, 91–4. li s-f, he x-j, hu g-c, cai w-q, deng x-w and zhou p-y (2006) Improving growth performance and caudal fin stripe pattern in selected F6–F8 generations of GIFT Nile tilapia (Oreochromis niloticus L.) using mass selection, Aquac Res, 37(12), 1165–71. liao m, zhang l, yang g, zhu m, wang d, wei q, zou g and chen d (2007) Development of silver carp (Hypophthalmichthys molitrix) and bighead carp (Aristichthys nobilis) genetic maps using microsatellite and AFLP markers and a pseudotestcross strategy, Anim Genet, 38(4), 364–70. liu z (2007a) Aquaculture Genome Technologies, Ames, IA, Blackwell. liu z (2007b) Single nucleotide polymorphism (SNP), in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 59–72. liu z j and cordes j f (2004) DNA marker technologies and their applications in aquaculture genetics, Aquaculture, 238(1–4), 1–37. liu z, karsi a, li p, cao d and dunham r (2003) An AFLP-based genetic linkage manp of channel catfish (lctalurus punctatus) constructed by using an interspecific hybrid resourse family, Genetics, 165, 687–94. lymbery a j, doupé r g, jenkins g and thorne t (2000) Genetics in the aquaculture industry, Aquac Res, 31(1), 1–2. ma c, fan l, ganassin r, bols n and collodi p (2001) Production of zebrafish germline chimeras from embryo cell cultures, Proc Nat Acad Sci USA, 98(5), 2461–6. maclean n (2003) Genetically modified fish and their effects on food quality and human health and nutrition, Trends Food Sci Technol, 14, 242–52. maclean n, rahman m a, sohm f, hwang g, iyengar a, ayad h, smith a and farahmand h (2002) Transgenic tilapia and the tilapia genome, Gene, 295(2), 265–77. mair g c (2007) Genetics and breeding in seed supply for inland aquaculture, in Bondad-Reantaso M G (ed.), Assessment of Freshwater Fish Seed Resources for Sustainable Aquaculture, FAO Fisheries Technical Paper, No. 501, Rome, Food and Agriculture Organization of the United Nations, 519–47. maluwa a o, gjerde b (2006a) Genetic evaluation of four strains of Oreochromis shiranus for harvest body weight in a diallel cross, Aquaculture, 259(1–4), 28–37. maluwa a o, gjerde b (2006b) Estimates of the strain additive, maternal and heterosis genetic effects for harvest body weight of an F2 generation of Oreochromis shiranus, Aquaculture, 259(1–4), 38–46. maluwa a o and gjerde b (2007) Response to selection for harvest body weight of Oreochromis shiranus, Aquaculture, 273, 33–41. maluwa a o, gjerde b and ponzoni r w (2006) Genetic parameters and genotype by environment interaction for body weight of Oreochromis shiranus, Aquaculture, 259(1–4), 47–55. mao w, wang y, wang w, wu b, feng j and zhu z (2004) Enhanced resistance to Aeromonas hydrophila infection and enhanced phagocytic activities in human lactoferrin-transgenic grass carp (Ctenopharyngodon idellus), Aquaculture, 242(1–4), 93–103.
Genetic improvement of finfish
81
martínez r, juncal j, zaldívar c, arenal a, guillén i, morera v, carrillo o, estrada m, morales a and estrada m p (2000) Growth efficiency in transgenic tilapia (Oreochromis sp.) carrying a single copy of an homologous cDNA growth hormone, Biochem Biophys Res Comm, 267, 466–72. martinez v (2007) Marker-assisted selection in fish and shellfish breeding schemes, in Guimarães E, Ruane J, Scherf B, Sonnino A and Dargie J (eds), MarkerAssisted Selection, Current Status and Future Perspectives in Crops, Livestock, Forestry and Fish, Rome, Food and Agriculture Organization of the United Nations, 309–28. martinez v, kause a, mäntysaari e and mäki-tanila a (2006a) The use of alternative breeding schemes to enhance genetic improvement in rainbow trout (Oncorhynchus mykiss): I. One-stage selection, Aquaculture, 254(1–4), 182–94. martinez v, kause a, mäntysaari e and mäki-tanila a (2006b) The use of alternative breeding schemes to enhance genetic improvement in rainbow trout: II. Two-stage selection, Aquaculture, 254(1–4), 195–202. maxime v (2008) The physiology of triploid fish: current knowledge and comparisons with diploid fish, Fish Fish, 9, 67–78. mcginnity p, prodöhl p, ferguson a, hynes r, maoiléidigh n o, baker n, cotter d, o’hea b, cooke d, rogan g, taggart j and cross t (2003) Fitness reduction and potential extinction of wild populations of Atlantic salmon, Salmo salar, as a result of interactions with escaped farm salmon, Proc Royal Soc London – Biol Sci, 270(1532), 2443–50. mcginnity p, prodöhl p, maoiléidigh n o, hynes r, cotter d, baker n, o’hea b and ferguson a (2004) Differential lifetime success and performance of native and non-native Atlantic salmon examined under communal natural conditions, J Fish Biol, 65(Suppl. A), 173–87. melamed p, gong z, fletcher g and hew c l (2002) The potential impact of modern biotechnology on fish aquaculture, Aquaculture, 204(3–4), 255–69. millar k and tomkins s (2007) Ethical analysis of the use of GM fish: emerging issues for aquaculture development, J Agric Environ Ethics, 20(5), 437–53. moen t, fjalestad k t, munck h and gomez-raya l (2004) A multistage testing strategy for detection of quantitative trait loci affecting disease resistance in Atlantic salmon, Genetics, 167(2), 851–8. mori t, saito s, kishioka c and arai k (2006) Aquaculture performance of triploid barfin flounder Verasper Moseri, Fish Sci, 72, 270–77. muller h j (1914) A gene for the fourth chromosome of Drosophila, J Exp Zool, 17, 325–36. murata o, harada t, miyashita s, izumi k, maeda s, kato k and kumai h (1996) Selective breeding for growth in red sea bream, Fish Sci, 62(6), 845–9. myers j m, heggelund p o, hudson g and iwamoto r n (2001) Genetics and broodstock management of coho salmon, Aquaculture, 197, 43–62. myhr a i and dalmo r a (2005) Introduction of genetic engineering in aquaculture: ecological and ethical implications for science and governance, Aquaculture, 250(3–4), 542–54. nam y k, noh j k, cho y s, cho h j, cho k-n, kim c g and kim d s (2001) Dramatically accelerated growth and extraordinary gigantism of transgenic mud loach Misgurnus mizolepis, Transgenic Res, 10, 353–62. nam y k, cho y s, cho h j and kim d s (2002) Accelerated growth performance and stable germ-line transmission in androgenetically derived homozygous transgenic mud loach, Misgurnus mizolepis, Aquaculture, 209(1–4), 257–70. nam y k, park i-s and kim d s (2004) Triploid hybridization of fast-growing transgenic mud loach Misgurnus mizolepis male to cyprinid loach Misgurnus anguillicaudatus female: the first performance study on growth and reproduction of transgenic polyploid hybrid fish, Aquaculture, 231(1–4), 559–72.
82
New technologies in aquaculture
nrc (2002) Animal Biotechnology: Science-Based Concerns, Washington, DC, National Academy Press. naylor r, hindar k, fleming i a, goldburg r, williams s, volpe j, whoriskey f, eagle j, kelso d and mangel m (2005) Fugitive salmon: assessing the risks of escaped fish from net-pen aquaculture, BioScience, 55(5), 427–37. neal j w, neal d m, noble r l and mcgee m v (2004) Artificial propagation and induction of triploidy in largemouth bass Micropterus salmoides and ploidy discrimination using erythrocyte length, J World Aquac Soc, 35(1), 46–54. neira r, lhorente j p, araneda c, díaz n, bustos e and alert a (2004) Studies on carcass quality traits in two populations of coho salmon (Oncorhynchus kisutch): phenotypic and genetic parameters, Aquaculture, 241(1–4), 117–31. nicols k m, young w p, danzmann r g, robinson b d, rexroad c, noakes m, phillips r b, bentzen p, spies i, knudsen k, allendorf f w, cunningham b m, brunelli j, zhang h, ristow s, drew r, brown k h, wheeler p a and thorgaard g h (2003) A consolidated linkage map for rainbow trout (Oncorhynchus mykiss), Anim Genet, 34, 102–15. nomura k, morishima k, tanaka h, unuma t, okuzawa k, ohta h and arai k (2006) Microsatellite-centromere mapping in the Japanese eel (Anguilla japonica) by half-tetrad analysis using induced triploid families, Aquaculture, 257, 53–67. norris a t, bradley d g and cunningham e p (2000) Parentage and relatedness determination in farmed Atlantic salmon (Salmo salar) using microsatellite markers, Aquaculture, 182(1–2), 73–83. ødegård j, olesen i, gjerde b and klemetsdal g (2006) Evaluation of statistical models for genetic analysis of challenge test data on furunculosis resistance in Atlantic salmon (Salmo salar): prediction of field survival, Aquaculture, 259(1–4), 116–23. ødegård j, olesen i, gjerde b and klemetsdal g (2007a) Evaluation of statistical models for genetic analysis of challenge-test data on ISA resistance in Atlantic salmon (Salmo salar): prediction of progeny survival, Aquaculture, 266(1–4), 70–76. ødegård j, olesen i, gjerde b and klemetsdal g (2007b) Positive genetic correlation between resistance to bacterial (furunculosis) and viral (infectious salmon anaemia) diseases in farmed Atlantic salmon (Salmo salar), Aquaculture, 271(1– 4), 173–7. ohara e, nishimura t, nagakura y, sakamoto t, mushiake k and okamoto n (2005) Genetic linkage maps of two yellow tails (seriola quinqueradiala) and (Seriola lalande), Aquaculture, 244, 41–8. okamoto n (2005) Recent progress in molecular genetic and breeding of fish and shellfish for aquaculture, Bull Japan Soc Sci Fish, 71(3), 286–9. olesen i, groen a f and gjerde b (2000) Definition of animal breeding goals for sustainable production systems, J Anim Sci, 78(3), 570–82. olesen i, gjedrem t, bentsen h b, gjerde b and rye m (2003) Breeding programs for sustainable aquaculture, J Appl Aquac, 13(3–4), 179–204. o’reilly p, herbinger c and wright j (1998) Analysis of parentage determination in Atlantic salmon (Salmo salar) using microsatellites, Anim Genet, 29, 363–70. o’reilly p t, carr j w, whoriskey f g and verspoor e (2006) Detection of European ancestry in escaped farmed Atlantic salmon, Salmo salar L., in the Magaguadavic River and Chamcook Stream, New Brunswick, Canada, ICES J Mar Sci, 63(7), 1256–62. oshima k, morishima k, yamaha e and arai k (2005) Reproductive capacity of triploid loaches obtained from Hokkaido island, Japan, Ichthyol Res, 52, 1–8. pandian t j and kirankumar s (2003) Androgenesis and conservation of fishes, Curr Sci, 85(7), 917–31.
Genetic improvement of finfish
83
pandian t j and koteeswaran r (1998) Ploidy induction and sex control in fish, Hydrobiologia, 384, 167–243. parameswaran v, shukla r, bhonde r and hameed a s s (2007) Development of a pluripotent ES-like cell line from Asian sea bass (Lates calcarifer) – an oviparous stem cell line mimicking viviparous ES cells, Mar Biotech, 9(6), 766–75. parsons j (1998) Status of genetic improvement in commercially reared stocks of rainbow trout, World Aquac, 29, 44–7. perez-enriquez r, takagi m and taniguchi n (1999) Genetic variability and pedigree tracing of a hatchery-reared stock of red sea bream (Pagrus major) used for stock enhancement, based on microsatellite DNA markers, Aquaculture, 173(1– 4), 413–23. peruzzi s, chatain b, saillant e, haffray p, menu b and falguière j-c (2004) Production of meiotic gynogenetic and triploid sea bass, Dicentrarchus labrax L.: 1. Performances, maturation and carcass quality, Aquaculture, 230(1–4), 41–64. peruzzi s, varsamos s, chatain b, fauvel c, menu b, falguière j-c, sévère a and flik g (2005) Haematological and physiological characteristics of diploid and triploid sea bass, Dicentrarchus labrax L., Aquaculture, 244(1–4), 359–67. pew initiative on food and biotechnology (2003) Future Fish? Issues in Science and Regulation of Transgenic Fish, Cambridge, MA, The Pew Charitable Trusts, www.pewtrust.org/our_work_report_detail.aspx?id=33350, accessed February 2009. phillips r b and reed k m (1996) Application of fluorescence in situ hybridization (FISH) techniques to fish genetics: a review, Aquaculture, 140(3), 197–216. phillips r b, nichols k m, dekoning j j, morasch m r, keatley k a, rexroad iii c, gahr s a, danzmann r g, drew r e and thorgaard g h (2006) Assignment of rainbow trout linkage groups to specific chromosomes, Genetics, 174, 1661–70. piferrer f, cal r m a, álvarez-blázquez b, sánchez l and martínez p (2000) Induction of triploidy in the turbot (Scophthalmus maximus). I. Ploidy determination and the effects of cold shocks, Aquaculture, 188(1–2), 79–90. piferrer f, cal r m, gómez c, bouza c and martínez p (2003) Induction of triploidy in the turbot (Scophthalmus maximus): II. Effects of cold shock timing and induction of triploidy in a large volume of eggs, Aquaculture, 220(1–4), 821–31. piferrer f, cal r m, gómez c, álvarez-blázquez b, castro j and martínez p (2004) Induction of gynogenesis in the turbot (Scophthalmus maximus): effects of UV irradiation on sperm motility, the Hertwig effect and viability during the first 6 months of age, Aquaculture, 238(1–4), 403–19. ponzoni r w, hamzah a, tan s and kamaruzzaman n (2005) Genetic parameters and response to selection for live weight in the GIFT strain of Nile tilapia (Oreochromis niloticus), Aquaculture, 247(1–4), 203–10. poompuang s and na-nakorn u (2004) A preliminary genetic map of walking catfish (Clarias macrocephalus), Aquaculture, 232(1–4), 195–203. pottinger t g and carrick t r (1999) Modification of the plasma cortisol response to stress in rainbow trout by selective breeding, Gen Comp Endocrinol, 116, 122–32. pullin r s v (2007) Genetic resources for aquaculture: status and trends, in Bartley D M, Harvey B J and Pullin R S V (eds), Workshop on Status and Trends in Aquatic Genetic Resources: a Basis for International Policy, FAO Fisheries Proceedings, No. 5, Rome, Food and Agriculture Organization of the United Nations, 109–43. pullin r s v, palomares m, casal c, dey m and pauly d (1997) Environmental impacts of Tilapia, in Fitzsimmons K (ed.), Tilapia Aquaculture: Proceedings of the Fourth International Symposium on Tilapia in Aquaculture, Publication No.
84
New technologies in aquaculture
NRAES-106, Ithaca, NY, Northeast Regional Aquacultural Engineering Services, 554–70. quillet e, leguillou s, aubin j, labbé l, fauconneau b and médale f (2007) Response of a lean muscle and a fat muscle rainbow trout (Oncorhynchus mykiss) line on growth, nutrient utilization, body composition and carcass traits when fed two different diets, Aquaculture, 269(1–4), 220–31. quinton c d, mcmillan i and glebe b d (2005) Development of an Atlantic salmon (Salmo salar) genetic improvement program: genetic parameters of harvest body weight and carcass quality traits estimated with animal models, Aquaculture, 247(1–4), 211–17. quinton c d, kause a, koskela j and ritola o (2007) Breeding salmonids for feed efficiency in current fishmeal and future plant-based diet environments, Genet Sel Evol, 39(4), 431–46. rasmussen r s and morrissey m t (2007) Biotechnology in aquaculture: transgenics and polyploidy, Comp Rev Food Sci Food Safe, 6(1), 2–16. reddy p v g k, gjerde b, tripathi s d, jana r k, mahapatra k d, gupta s d, saha j n, sahoo m, lenka s, govindassamy p, rye m and gjedrem t (2002) Growth and survival of six stocks of rohu (Labeo rohita, Hamilton) in mono and polyculture production systems, Aquaculture, 203(3–4), 239–50. rexroad c e iii (2007) Radiation hybrid mapping in aquatic species, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 313–22. rexroad c, vallejo r, coulibaly i, couch c, garber a, westerman m and sullivan c (2006) Identification and characterization of microsatellites for striped bass from repeat-enriched libraries, Cons Genet, 7(6), 971–82. rothbard s (2006) A review of ploidy manipulations in aquaculture: the Israeli experience, Isr J Aquac – Bamidgeh, 58(4), 266–79. rothbard s, shelton w l, rubinshtein i, hinits y and david l (2000) Induction of all-female triploids in grass carp (Ctenopharyngodon idella) by integration of hormonal sex inversion and ploidy manipulation, Isr J Aquac – Bamidgeh, 52(4), 133–50. rothschild m f and ruvinsky a (2007) Marker-assisted selection for aquaculture species, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 199–213. saillant e, dupont-nivet m, haffray p and chatain b (2006) Estimates of heritability and genotype-environment interactions for body weight in sea bass (Dicentrarchus labrax L.) raised under communal rearing conditions, Aquaculture, 254(1–4), 139–47. sakamoto t, fuji k, kobayashi k, hasegawa o, ozaki a and okamoto n (2006) Marker-assisted breeding for viral disease resistance in Japanese flounder (Paralichthys olivaceus), Isr J Aquac – Bamidgeh, 58(4), 384–6. sarropoulou e, kotoulas g, bargelloni l, power d m, franch r, louro b, magoulas a, patarnello t, senger f, galibert f and geisler r (2007a) A gene-based radiation hybrid map of the gilthead sea bream Sparus aurata, Aquaculture, 272(Suppl. 1), S308. sarropoulou e, franch r, louro b, power d m, bargelloni l, magoulas a, senger f, tsalavouta m, patarnello t, galibert f, kotoulas g and geisler r (2007b) A gene-based radiation hybrid map of the gilthead sea bream Sparus aurata refines and exploits conserved synteny with Tetraodon nigroviridis, BMC Genom, 8, 44–58. sarropoulou e, nousdili d, magoulas a and kotoulas k (2008) Linking the genomes of nonmodel teleosts through comparative genomics, Mar Biotechnol, 10(3), 227–33. sausa-santos c, collares-pereira m j and almada v (2007) Fertile triploid males – an uncommon case among hybrid vertebrates, J Exp Zool, 307A, 220–25.
Genetic improvement of finfish
85
senanan w, kapuscinski a r, na-nakorn u, miller l m (2004) Genetic impacts of hybrid catfish farming (Clarias macrocephalus × C. gariepinus) on native catfish populations in central Thailand, Aquaculture, 235, 167–84. senger f, priat c, hitte c, sarropoulou e, franch r, geisler r, bargelloni l, power d and galibert f (2006) The first radiation hybrid map of a perch-like fish: the gilthead seabream (Sparus aurata L), Genomics, 87(6), 793–800. silverstein j t, weber g m, rexroad iii c e and vallejo r l (2006) Genetics and genomics – integration of molecular genetics into a breeding program for rainbow trout, Isr J Aquac – Bamidgeh, 58(4), 231–7. soller m and beckmann j s (1982) Restriction fragment length polymorphisms and genetic improvement, Proc. 2nd World Congress Genetics Applied to Livestock Production, VI, Madrid, Editorial Garsi, 396–404. somridhivej b, wang s, sha z, liu h, quilang j, xu p, li p, hu z and liu z (2008) Characterization, polymorphism assessment, and database construction for microsatellites from BAC end sequences of catfish: a resource for integration of linkage and physical maps, Aquaculture, 275, 76–80. sonesson a k (2007a) Possibilities for marker-assisted selection in aquaculture breeding schemes, in Guimarães E, Ruane J, Scherf B, Sonnino A and Dargie J (eds), Marker-Assisted Selection, Current Status and Future Perspectives in Crops, Livestock, Forestry and Fish, Rome, Food and Agriculture Organization of the United Nations, 309–28. sonesson a k (2007b) Within-family marker-assisted selection for aquaculture species, Genet Sel Evol, 39(3), 301–17. sonesson a k and meuwissen t h e (2000) Mating schemes for optimum contribution selection with constrained rates of inbreeding, Genet Sel Evol, 32(3), 231–48. sonesson a k and meuwissen t h e (2002) Non-random mating for selection with restricted rates of inbreeding and overlapping generations, Genet Sel Evol, 34(1), 23–39. sonesson a k, janss l l g and meuwissen t h e (2003) Selection against genetic defects in conservation schemes while controlling inbreeding, Genet Sel Evol, 35(4), 353–68. sonesson a k, gjerde b and meuwissen t h e (2005) Truncation selection for BLUPEBV and phenotypic values in fish breeding schemes, Aquaculture, 243(1–4), 61–8. steffens w, jähnichen h and fredrich f (1990) Possibilities of sturgeon culture in Central Europe, Aquaculture, 89, 101–22. sun x w and liang l q (2004) A genetic linkage map of common carp (Cyprinus carpio L.) and mapping of a locus associated with cold tolerance, Aquaculture, 238, 169–72. taylor j f, needham m p, north b p, morgan a, thompson k and migaud h (2007) The influence of ploidy on saltwater adaptation, acute stress response and immune function following seawater transfer in non-smolting rainbow trout, Gen Comp Endocrinol, 152(2–3), 314–25. teufel j, pätzold f and potthof c (2002) Scientific Research on Transgenic Fish With Special Focus on the Biology of Trout and Salmon, Berlin, Federal Environmental Agency. tiwary b k, kirubagaran r and ray a k (2004) The biology of triploid fish, Rev Fish Biol Fish, 14(4), 391–402. tobin d, kause a, mäntysaari e a, martin s a m, houlihan d f, dobly a, kiessling a, rungruangsak-torrissen k, ritola o and ruohonen k (2006) Fat or lean? The quantitative genetic basis for selection strategies of muscle and body composition traits in breeding schemes of rainbow trout (Oncorhynchus mykiss), Aquaculture, 261(2), 510–21.
86
New technologies in aquaculture
tvedt h b, benfey t j, martin-robichaud d j, mcgowan c and reith m (2006) Gynogenesis and sex determination in Atlantic halibut (Hippoglossus hippoglossus), Aquaculture, 252(2–4), 573–83. vandeputte m (2003) Selective breeding of quantitative traits in the common carp (Cyprinus carpio): a review, Aquat Liv Res, 16(5), 399–407. verspoor e, beardmore j a, consuegra s, garcía de leániz c, hindar k, jordan w c, koljonen m-l, mahkrov a a, paaver t, sánchez j a, skaala ø, titov s and cross t f (2005) Population structure in the Atlantic salmon: Insights from 40 years of research into genetic protein variation, J Fish Biol, 67(Suppl. 1), 3–54. verspoor e, olesen i, bentsen h b, glover k, mcginnity p and norris a (2006) Atlantic salmon – Salmo salar, in Crosetti D, Lapègue S, Olesen I and Svaasand T (eds), Genetic Effects of Domestication, Culture and Breeding of Fish and Shellfish, and Their Impacts on Wild Populations, GENIMPACT project: evaluation of genetic impact of aquaculture activities on native populations, A European network WP1 workshop, Viterbo, Italy, 12–17th June. villanueva b, woolliams j a and gjerde b (1996) Optimum designs for breeding programmes under mass selection with an application in fish breeding, Anim Sci, 63(3), 563–76. villanueva b, verspoor e and visscher p m (2002) Parental assignment in fish using microsatellite genetic markers with finite numbers of parents and offspring, Anim Genet, 33(1), 33–41. wang c m, zhu z y, lo l c, feng f, lin g, yang w t, li j and yue g h (2007) A microsatellite linkage map of barramundi, Lates calcarifer, Genetics, 175, 907–15. watanabe t, fujita h, yamasaki k, seki s and taniguchi n (2004) Preliminary study on linkage mapping based on microsatellite DNA and AFLP markers using homozygous clonal fish in ayu (Plecoglossus altivelis), Mar Biotechnol, 6(4), 327–34. weir l k, hutchings j a, fleming i a and einum s (2004) Dominance relationships and behavioural correlates of individual spawning success in farmed and wild male Atlantic salmon, Salmo salar, J Anim Ecol, 73(6), 1069–79. weir l k, hutchings j a, fleming i a and einum s (2005) Spawning behaviour and success of mature male Atlantic salmon (Salmo salar) parr of farmed and wild origin, Can J Fish Aquat Sci, 62(5), 1153–60. wenne r, boudry p, hemmer-hansen j, lubieniecki k p, was a and kause a (2007) What role for genomics in fisheries management and aquaculture?, Aquat Living Resour, 20, 241–55. woram r a, mcgowan c, stout j a, gharbi k, ferguson m m, hoyheim b, davidson e a, davidson w s, rexroad c and danzmam r g (2004) A genetic map for Arctic char (Salvelinus alpinus): evidence for higher recombination rates and segregation distortion in hybrid versus pure strain mapping parents, Genome, 47, 304–15. xu p, wang s and liu z (2007) Physical characterization of genomes through BAC end sequencing, in Liu Z (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 261–74. zhu z y, wang c m, lo l c, feng f, lin g and yue g h (2006) Isolation, characterization, and linkage analyses of 74 novel microsatellites in barramundi (Lates calcarifer), Genome, 49(8), 969–76.
3 Genetic variation and selective breeding in hatchery-propagated molluscan shellfish P. Boudry, Ifremer, France
Abstract: This chapter presents the current status of molluscan shellfish domestication and research made to plan and implement efficient breeding programs for the improvement of characters of aquaculture interest, notably yield-related and disease resistance traits. It presents the features of molluscan reproduction and hatchery rearing that have a bearing on the genetic composition of artificially bred and non-native populations, showing how they may hinder improvement but also offer possibilities for selection. The major mollusc breeding programs are reviewed with the methods they employ and progress achieved. Finally, recent developments in genomics and marker assisted selection are presented with their potential applications in the future improvement of molluscan shellfish. Key words: selective breeding, oysters, aquaculture, bivalves, genetics.
3.1 Introduction Despite the high proportion of world aquaculture production that molluscan shellfish represent, this group has benefited little from genetic improvement methods compared with other types of farmed species (Hulata, 2001). Unlike most finfish and shrimp production, molluscan shellfish aquaculture is largely based on the on-growing of wild seed. This is probably the main reason why there have only been small advances made in the development and adoption of genetically superior broodstock. Hatchery production is limited overall and relatively little investment has been made in genetics as a result. Among molluscan shellfish, oysters are the group of species where the most progress has been made so far in this respect (Sheridan, 1997). The first genetic improvements were initiated in countries where collection
88
New technologies in aquaculture
of wild seed is limited by environmental factors (e.g. Pacific oyster on the west coast of North America), or over-harvesting and subsequent low recruitment (e.g. abalone in New Zealand). It is easy to see how the demand for seed motivated the development of hatchery technology, offering in turn the possibility of controlled reproduction and planned breeding. Disease-related production constraints also strongly encourage work towards genetic improvement for disease resistance. The main genetic improvement made so far in marine molluscs has been based on polyploidy and, more specifically, the production of triploids (Chapter 6). Considering the results of quantitative genetics studies published since the mid-1990s, one might be led to think that selective breeding could vastly improve molluscan shellfish production in the near future. Several selective breeding programs for oysters have been initiated in recent years and have started to benefit the industry, notably in USA, Australia and New-Zealand (a review of these is made below). Selective breeding is indeed a slower way to genetically improve molluscan shellfish than the single-step improvement achieved with triploidy. It should, however, be seen as a logical long-term complement rather than as an alternative option, especially as it can target traits that cannot be modified by triploidisation. When selective breeding programs are correctly planned and well managed genetic gain is cumulative over successive generations, while triploidy is a single-step improvement. Triploidy presents the advantage of a relatively rapid return on investment but might limit or slow down further progress. Selective breeding of tetraploid broodstocks, commonly used in oysters to produce triploids by crossing with diploid parents (Guo et al., 1996), is known to be slower and more complex than for diploids because of the larger number and order of genetic interactions, as illustrated in many autotetraploid crop species (Gallais, 1981). Combining selective breeding and triploidy would therefore be a promising but challenging direction for genetic improvement (McCombie et al., 2005).
3.2 Monitoring genetic diversity and risks related to inbreeding One of the main characteristics of molluscan shellfish is their very high fecundity, highlighted by Williams in his ‘Elm-Oyster Model’ of reproductive strategy in evolution (Williams, 1975). An adult female Pacific oyster commonly produces more than 50 million eggs (Kang et al., 2003). As a result, a very small number of genitors can potentially produce huge numbers of offspring. However, populations based on small numbers of parents will have low effective sizes and inbreeding will occur in subsequent generations. Such loss of genetic diversity can be estimated from the decrease in mean number of alleles per locus, decrease in heterozygosity and/or genetic differentiation between populations (i.e. Fst estimates) (Li
Genetic variation and selective breeding in molluscan shellfish
89
et al., 2004). More interestingly, effective population size (N(e)) can be estimated from temporal changes in the frequencies of selectively neutral alleles in isolated populations (Waples, 1989). This approach also makes it possible to obtain accurate estimates of present genetic effective population size in the wild for abundant species such as prawns (Ovenden et al., 2007) and oysters (Hedgecock et al., 2007a). Loss of genetic diversity due to genetic drift is a well known phenomenon in non-native species introduced into new geographic areas. Such introductions have frequently been made for the production of new species of molluscan shellfish. Several cases of inbreeding depression have been documented following introductions, especially for scallop species (for review see Beaumont, 2000). The bay scallop (Argopecten irradians) was introduced from USA to China in 1982. Only 26 individuals survived transportation and led to a commercial production of 200 000 metric tonnes in 1990 (Guo et al., 1999). The genetic effect of this bottleneck was documented using mitochondrial restriction fragment length polymorphism (RFLP) (Blake et al., 1997), allozyme (Xue et al., 1999) and microsatellite markers (Wang et al., 2007). Despite several recent introductions of new stocks aimed at expanding the gene pool, the genetic diversity remains limited, and clear effects of inbreeding depression have been demonstrated (Zhang et al., 2005). The Japanese scallop (Patinopecten yessoensis) was also introduced to China from Japan in 1982. Using six microsatellite loci, Li et al. (2007) showed that after about two decades of hatchery propagation, effective population sizes ranged from 26 to 70. Contrastingly, in several cases of unintentional introduction of non-native oyster species, little or no reduction of genetic variability was noted. This is the case for the Pacific oyster (Crassostrea gigas) following its introduction from Japan into Australia (English et al., 2000; Appleyard and Ward, 2006), New Zealand (Smith et al., 1986) and France (Huvet et al., 2004a). The same was observed for the Portuguese oyster thought to have been introduced from Taiwan into Portugal and then France (Huvet et al., 2001, 2004a). Similarly, feral populations of the Manila clam (Ruditapes philippinarum), introduced from Asia into Europe during the 1970s show similar levels of genetic variability to native clam species (Borsa and Thiriot-Quievreux, 1990; Moraga, 1986). Hatchery propagation can be a major cause of reduction in effective population size, mainly due to the practice of using a small number of parents to make crosses. Many shellfish broodstocks have been shown to have small effective size (i.e. low genetic variation due to random genetic drift), using either allozymes (Hedgecock et al., 1992) or microsatellite markers (Launey et al., 2001). Although the use of limited numbers of highly fecund genitors is the major reason for reduced effective size in hatchery-propagated molluscan shellfish, additional reasons have been identified. Gametic incompatibility (Gaffney et al., 1993) and differential survival during larval stage (Boudry et al., 2002; Taris et al., 2006) also
90
New technologies in aquaculture
contribute significantly to increasing variance in reproductive success between genitors. Reduction of effective population size leads to inbreeding in such isolated populations, resulting in a limited response to selection. In molluscan shellfish, inbreeding depression is much better documented than lack of genetic variance (Zheng et al., 2006). This is mainly due to the ease of comparing inbred progenies with outbred ones and the limited number of multi-generation selective breeding studies that have been made (see below). Inbreeding depression is due to unmasking of recessive deleterious alleles (i.e. genetic load). Very high levels of genetic load, revealed by high and frequent distortion of marker segregation ratios, have been reported in oysters (Bierne et al., 1998; Launey and Hedgecock, 2001). Culling, a common practice in shellfish hatcheries and nurseries, may contribute to masking inbreeding by selecting the fast-growing, more heterozygous genotypes (Taris et al. 2007). As a result, the development of homozygous lines, by making crosses between relatives, will be slower than in species with lower genetic load (homozygote disadvantage), as the most heterozygous individuals survive and grow better.
3.3 Inheritance of traits important for aquaculture With the increased interest in the potential for selective breeding in molluscs, much work has been focused on a variety of traits in these animals. The extent of the genetic basis of traits such as growth or disease resistance provides a direct indication of the potential for their improvement by selection. Such evaluations need to be considered in the context of environmental variation, so as to assess the extent of genotype × environment interaction and thus indicate what value a selected group could have under differing rearing environments of varied geographical areas. Selective breeding requires that observed phenotypic variation be partly due to genetic components, and the demonstration of this genetic basis is a prerequisite for any breeding program. Heritability estimates, genetic correlations between traits and genotype × environment interactions are commonly listed as essential information needed to set up a breeding program (Falconer and Mackey, 1996). There are, however, numerous examples of farmed molluscan shellfish species in which these key elements are still unknown, although some genetic information may be available. On one hand, some studies based on comparison between progenies reared in a common environment suggest local population adaptation (e.g. Ibarra et al., 1997; Soletchnik et al., 2002) or different levels of genetic variability (Zheng et al., 2004). Many published studies are based on a small number of families over just one or a limited number of generations (e.g. Ernande et al., 2003), limiting the validity of the genetic parameters estimated. On the other hand, a large number of studies report very encouraging results,
Genetic variation and selective breeding in molluscan shellfish
91
showing that significant improvement could be obtained by selective breeding, even though these fail to provide heritability estimates, e.g. Bonamia ostreae resistance in the European flat oyster, Ostrea edulis (Naciri-Graven et al., 1998; Culloty et al., 2004), and resistance to Haplosporidium nelsoni (‘MSX’) (Ford and Haskin, 1987; Ford et al., 1990), Perkinsus marinus (‘Dermo’) (Encomio, et al., 2005) and Roseovarius crassostreae (Juvenile Oyster Disease) (Barber et al., 1998) in the American oyster, Crassostrea virginica (Farley et al., 1998). In these cases, resistant ‘lines’ or ‘strains’ have been produced, but the benefit for shellfish production has been lower than initially expected, either due to technical difficulties at the hatchery and/or nursery stages, or because the shellfish industry itself has not become involved. Among the numerous papers reporting heritability estimates for traits of aquacultural interest in farmed molluscan shellfish, two main types appear: (i) studies based on response to individual selection over one (e.g. Ibarra et al., 1999) or several generations (e.g. Zheng et al., 2006), and (ii) studies based on families using nested or diallel crossing designs. A few papers also report response to family selection (Langdon et al., 2003) and midparent–offspring regressions (Evans and Langdon, 2006a). The magnitude of interactions have been examined in several studies (Evans and Langdon, 2006b; Swan et al., 2007) and were limited in most cases. However, high plasticity of genetic correlations between reproductive effort and both survival and growth have been reported, underlining the influence of environmental conditions on genetic correlation estimations (Ernande et al., 2004). Heritability estimates of larval traits, such as growth or size at particular ages, have been made for mussel (Mallet and Haley, 1984; Toro and Paredes, 1996; Toro et al., 2004), oyster (Losee, 1978; Ernande et al., 2003) and scallop (Jones et al., 1996). Although such studies are relatively easy to perform due to the short time required to record these traits, they are often of limited aquacultural interest, and genetic correlations between larval and postlarval traits are usually low (Ernande et al., 2003). Additionally, heritability estimates often increase with age, e.g. in abalone (Jonasson et al., 1999), although it is not always the case as reported in mussel by Alcapan et al. (2007). Most molluscan on-growing is performed under extensive aquacultural conditions (relative to most finfish or agricultural species) along tidal or shallow coastal areas. As a result, artificial rearing conditions at early stages in the hatchery and nursery (where food availability and water temperature are controlled) might act as efficient domestication forces. The potential of strong (intentional or unintentional) selection at these early stages is therefore important in highly fecund molluscan species (Taris et al., 2007). Further research is needed to determine genetic correlations between traits recorded at spat size and in market size shellfish, which would allow us to gain a deeper understanding of what such approaches could offer (see Hedgecock and Davis, 2007).
92
New technologies in aquaculture
One of the most extensive heritability studies that has been conducted was made by Ward et al. (2005) on Pacific oyster. Based on a partially hierarchical crossing design (31 males by 31 females to produce 62 families), results provided estimates of heritabilities and genetic correlations for several traits: growth (total, shell, fresh and dry flesh weights), ornamentation and shell colour (from photographs), shell morphology (height, length and depth) and shape (flat, convex, concave or undulating, and presence/ absence of a hook). Estimates of genetic parameters showed a medium to high additive genetic basis for the studied traits and no dominance. In contrast, Hedgecock and Davis (2007) found strong evidence of heterosis for yield (i.e. growth, as the mortality component of yield was negligible in their experiments). To conclude, it is likely that most traits show significant additive but also non-additive variance in the Pacific oyster and many other molluscan shellfish. Special attention has been given to the heritability of resistance to summer mortality in oysters (Samain and McCombie, 2008). Following studies conducted in the USA in the early 1980s (Beattie et al., 1980; Hershberger et al., 1984), high heritability estimates of 0.83 ± 0.40 (Dégremont et al., 2007) were confirmed by the response of this trait to divergent selection (Boudry et al., 2008). Interestingly, broad-sense (Evans and Langdon, 2006b) and narrow-sense (Dégremont et al., 2007) heritability estimates for growth in C. gigas are lower than those for survival (see also Ernande et al., 2004).
3.4 Current status of established molluscan shellfish breeding programs Main work on genetic improvement has so far focussed on oyster species and green-lipped mussel. Although a number of breeding programs that have now been initiated for other molluscan shellfish, e.g. for the scallop Argopecten purpuratus in Chile and for the abalone Haliotis laevigata in Australia (Kube et al., 2007), these are not sufficiently established and/or documented to be described here. The breeding programs that are well described in the literature, and which have already led to significant transfer to industry, provide examples of methods followed and resources required. These selection schemes concern the Pacific oyster C. gigas in the USA, Australia and New Zealand, the Sydney rock oyster Saccostrea glomerata in Australia and the green-lipped mussel Perna canaliculus in New Zealand (Table 3.1). Common points between these programs are the collaboration of industry (farmers and/or hatcheries) and government (institutions, organising structures and funding), and the need for financial support to sustain the programs, at least though their early stages that may span several years.
CSIRO followed by ASI / Thoroughbred oysters New South Wales Department of Primary Industries, Select Oyster Company
Growth
Growth and quality
Growth and quality Resistance to diseases, growth
Pacific oyster
Pacific oyster, green lipped mussel Pacific oyster
Sydney rock oyster
Cawthron Institute
Yield
Pacific oyster
Molluscan Broodstock Program Taylor Shellfish Farms
Main targeted traits
Name of the organisation and/or operating company
New South Wales
Tasmania
New Zealand
West coast of USA West coast of USA
Location
Major selective breeding programs of molluscan shellfish
Species
Table 3.1
1990
1996
1998
1996
Starting year
http://www.oysterssa.com.au/ media/files/734.pdf http://www.dpi.nsw.gov.au/ research/updates/issues/ june-2006/ disease-resistant-oysters
http://www.cawthron.org.nz/ aquaculture/selective-breeding. html
http://hmsc.oregonstate.edu/ projects/mbp/index.htm http://www.fish.washington.edu/ wrac/pdfs/crossbreed_ completion.pdf
Dedicated website or information available on internet
Ward et al., 2005 Nell and Perkins, 2006
Langdon et al., 2003 Hedgecock and Davis, 2007 King et al., 2004
Main reference
94
New technologies in aquaculture
3.4.1 Selection of C. gigas in the USA Two major C. gigas breeding programs are in operation on the west coast of the USA. The Molluscan Broodstock Program (MBP) was initiated in 1996 (Hedgecock et al., 1996a). This is a collaborative program between Hatfield Marine Science Center, Newport (University of Oregon and USDA) and several commercial companies. Cohorts of 50–60 full-sib families are produced in Newport and evaluated at intertidal and subtidal commercial sites along the west coast. The main initial objective of the MBP was to improve yield (i.e. the combination of survival and growth) by selecting the heaviest 30 % of oysters in the 10 % of families with the best yield. Such a high among-family selective pressure scheme obviously requires a large number of families to be produced per generation (in this case 200–240 families corresponding to four cohorts), and hence the infrastructure necessary to achieve this. The first results published from the MBP concerned gain in yield, and showed an improvement of ≈10 % after one generation of selection (Langdon et al., 2003). More recently genotype × environment was studied in greater depth (Evans and Langdon, 2006b): separating survival and growth, and estimating their coheritability (Evans and Langdon, 2006a). High heritability estimates of mantle and shell pigmentation were also reported (Brake et al., 2004). The USDA Western Regional Aquaculture Center (WRAC) project is examining the potential of hybrid vigour (i.e. heterosis) for yield improvement, by cross-breeding inbred lines. A large genetic load (Launey and Hedgecock, 2001) both explains the frequently observed distortions of Mendelian ratios in inheritance studies (Bierne et al., 1998) and supports the dominance theory of heterosis in oysters (Hedgecock et al., 1996b). Inbred lines (with inbreeding coefficients ranging from f = 0.375 to 0.5) are obtained by mating within full-sib families produced by the MBP or from wild stocks. The oyster lines are reared and maintained by Taylor Resources, Inc., and field performance monitored by Taylor Shellfish Farms and Baywater, Inc. Diallel mating experiments allowed general and specific combining abilities (GCA, SCA) of the tested lines to be estimated (Hedgecock and Davis, 2007). Such an approach requires the production and testing of numerous inbred lines, a time- and labour-intensive process. Recent physiological (Pace et al., 2006) and transcriptomic (Hedgecock et al., 2007b) approaches could ease the selection of elite inbred lines for commercial seed production in the future. Although heterosis is now clearly demonstrated in C. gigas, the potential of cross-breeding relative to other breeding strategies based on additive genetic variance still remains to be explored in depth (see Ryan et al., 2006).
3.4.2 The Australian oyster selection programs Selection is performed on two different cupped oyster species in Australia: the native Sydney rock oyster (Saccostrea glomerata) and the non-native
Genetic variation and selective breeding in molluscan shellfish
95
Pacific oyster (C. gigas). Research on C. gigas was initiated in 1993, with an initial phase aiming to estimate heritability and the magnitude of genotype × environment interactions for a number of traits. The value of different selection methods was also evaluated. An individual selection method with mass spawning and 20 % selection pressure, assisted by genetic fingerprinting, was compared with a family selection method based on the production of 40 families per generation using one male × two females. This research work was carried out at the TAFI (Tasmanian Aquaculture and Fisheries Institute) at the University of Tasmania and CSIRO (Commonwealth Scientific and Industrial Research Organization), in partnership with farmers in Tasmania and South Australia. In the second phase of this research (2000), the South Australian Oyster Growers’ Association (SAOGA), the Tasmanian Oyster Research Council and South Australian Oyster Research Council (SAORC), created the Australian Seafood Industry (ASI), a non-profit-making organisation to continue selection and rearing. In 2004, 20 % of Australian production benefited from this program. The first four generations (1996–2000) of individual selection for growth led to a gain of 60 % in live weight and a 50 % reduction in its heterogeneity (Ward and Thompson, 2005; Ward et al., 2005). These changes were accompanied by a 41 % decrease in allelic diversity at eight microsatellite markers, but none at 10 enzymatic loci studied nor in the observed heterozygocity (Appleyard and Ward, 2006). Family selection was initiated in 1997 (40–60 families per generation using one male × two females). Among the numerous results from this study (see Ward et al., 2005a), genotype × environment interactions were generally found to be low, with low genetic correlations between farms. The different selective breeding strategies were analysed, and it was concluded that the combination of moderate interfamily and strong intrafamily selection should maximise genetic gains. The native Sydney rock oyster (S. glomerata) commonly shows slower growth than introduced C. gigas, and its production is strongly affected by mortalities caused by two parasites Mikrocytos roughleyi (winter mortality) and, since 1994, Martelia sydneyi (QX disease). With the aim of improving this situation, researchers at the New South Wales (NSW) Department of Primary Industries initiated two breeding programs, selecting to improve growth and resistance to parasites in the Sydney rock oyster (Nell et al., 2000). These breeding programs started in 1990, formed part of the strategic plan for oyster farming development established through cooperation between the NSW Oyster Farmer’s Association and the Oyster Research Advisory Committee (ORAC). Australian oyster farmers reared the first selected S. glomerata in 2004. The first selection program, initiated in 1990 in Port Stephens, NSW, Australia, aimed to improve growth rate by individual selection of four independent lines. For each generation, each line was reproduced with a mass spawning of about 350 genitors. An overall pressure of 7 % was
96
New technologies in aquaculture
applied on each generation, and response to selection was estimated after each generation (Nell et al., 1996, 1999; Nell and Perkins, 2005). In 2001, after four generations of selection, the four lines were compared with two control lines at three sites. A mean weight gain of 40 % was observed by the fourth generation (i.e. +10 % per generation). No line × site interaction was observed either for growth (weight and length) or mortality (23 % on average over the whole cycle). The increase in growth rate allowed the rearing time to harvest to be reduced from 41 to about 29 months. The combined effect of selection for growth and triploidisation by cytochalasin B treatment was evaluated after two generations of selection (Hand et al., 2004). The results showed that growth improvements from selective breeding and triploidy were ‘at least additive’, as a positive interaction was observed between triploidy and improvement by selection. A parallel set of breeding lines was also established in 1990 at Georges River, NSW, to select for resistance to Mikrocytos roughleyi. This programme was reorganised and expanded following the outbreak of QX disease in 1994 (Nell et al., 2000; Nell and Hand, 2003). The evaluation of the third generation of selection at three sites (Nell and Perkins, 2006) showed that the three selected lines, which had been subjected to different disease pressures, had improved performances, but that genetic coheritability between resistances to the two diseases was low. Estimates of genetic correlation between resistance to parasites and growth are now needed to establish whether these traits can be improved together by individual selection or if a more complex breeding program is needed.
3.4.3
Selective breeding of Pacific oyster and green-lipped mussel in New Zealand In 1998, a prospective study concluded that it would be beneficial to the shellfish industry in New Zealand to develop selective breeding programs for its major commercial species. The Cawthron Institute undertook this task and is presently the sole hatchery in New Zealand, supplying the entire industry with hatchery seed. As in the MBP in the USA, the Cawthron Institute produces families of oysters (C. gigas), which are then reared on commercial farms and evaluated for their growth performances and quality (i.e. shell shape and uniformity). Following an initial cohort of nine families in 1999 (Janke et al., 2004), 60-family cohorts were then produced every two years from 2001 onwards (King et al., 2004). High within-family selective pressures were applied (20 oysters selected out of 1000), although results remain to be published. Using a similar strategy, cohorts of green-lipped mussel, Perna canaliculus (55–75 full-sib families) have been produced since 2002. The improvement objective in this species is to produce more uniform mussels with better growth rates for a number of different markets (whole live, ½ shell,
Genetic variation and selective breeding in molluscan shellfish
97
fresh, frozen or processed). Because of the high influence that mussel density has on growth performance, a mixed family approach is being used, with external identity tags glued to the shells of the mussels from the age of nine months. As these tags are frequently lost during growth and harvest, genetic identification using microsatellite marker is now being considered (McAvoy et al., 2008).
3.5 3.5.1
Present needs and future trends: use of marker-assisted selection and genomics
Mixed-family approaches: the use of DNA fingerprinting for parentage assignment Practical limitations, including space constraints and the management demands of maintaining large numbers of rearing vessels at one time, increase the cost of breeding large numbers of families and represent major drawbacks to family-based selective breeding of molluscan shellfish. Highdensity flow-through larval rearing systems can, however, facilitate the development of such breeding programs (Janke et al., 2004). A mixedfamily approach, using physical tags or genetic markers and sorting, represents an alternative more practical strategy. Physical tagging is impossible at early stages in aquatic species and highly polymorphic polymer chain reaction (PCR)-based markers provide a suitable alternative for species where they are available. Typically, 10–20 variable genetic markers are needed to assign >95 % of individuals to single pairs of parents (e.g. Vandeputte et al., 2006). The very high levels of polymorphism observed at microsatellite markers in bivalves should theoretically make parentage assignment easier. However, high frequencies of null alleles are also commonly observed (Hedgecock et al., 2004), which can lead to difficulties in such analyses. Microsatellites are currently the type of marker most commonly used for parentage assignment (e.g. Herbinger et al., 1995; Fishback et al., 2002; Vandeputte et al., 2004), but amplified fragment length polymorphisms (AFLPs) have also been considered (Gerber et al., 2000). Single nucleotide polymorphisms (SNPs) are considered as a powerful tool for parentage inference that will potentially become important in the near future (Anderson and Garza, 2006), but which can be expensive to analyse and will therefore require the development of cost-efficient high-throughput genotyping methods (Hayes et al., 2005). As mean SNP density is very high in oysters (Curole and Hedgecock, 2005; Sauvage et al., 2007), and likely to be of a similar level in many other marine bivalves, the number of potential SNP markers is extremely high. Parentage assignment studies have been made using microsatellite markers in several mollusc species on an experimental level involving
98
New technologies in aquaculture
a limited number of genitors (Boudry et al., 2002; Li and Kijima, 2006; Taris et al., 2006; McAvoy et al., 2008). Microsatellites are also used on a routine basis to confirm parentage and pedigree of oyster broodstock (e.g. Hedgecock and Davis, 2007). However, the suitability of such approaches for mixed-family breeding programs remains to be demonstrated, despite the large number of markers already available (Li et al., 2003a). Other potential applications are walk-back selection (Li et al., 2003b; Sonesson, 2005) and pedigree-assisted selection methods (such as animal model-based methods (Lynch and Walch, 1998)). Walk-back selection is especially promising in species for which resources are limited (because the amount of genotyping is considerably lower than for the animal model-based breeding schemes), or for species were controlled reproduction is not optimised (i.e. species for which maturation techniques and/or strip-spawning are not yet well developed).
3.5.2 Quantitative trait loci mapping Mapping chromosome regions that influence phenotypic traits (i.e. quantitative trait loci; QTL) requires linkage maps of medium to high density. Maps are already available for some molluscan shellfish (Table 3.2), but to date only a few published papers report the identification of QTLs in these species. Yu and Guo (2006) identified QTLs for resistance to Perkinsus marinus in the American oyster C. virginica by comparing AFLP genotype frequency before and after mortality in two full-sib families. This method does not, however, evaluate the proportion of phenotypic variance associated with the identified QTLs. The other study described QTLs for shell, muscle, gonad, digestive gland and gill weight in Pacific abalone Haliotis discus hannai (Liu et al., 2007). In addition to these two published studies, positive results have recently been obtained in European Flat oyster Ostrea edulis for Bonamia ostreaea resistance (Lallias et al., 2009), and in the Pacific oyster C. gigas for summer mortality resistance (Sauvage, 2008) and heterosis for growth (Hedgecock et al., 2004b). Several other studies are currently in progress. This work will contribute to an improved understanding of genetic architecture of the studied traits and provide a basis for marker-assisted selection (MAS) programs (Sonesson, 2007; Wenne et al., 2007).
3.5.3 Candidate genes, genomics and marker-assisted selection The availability of molluscan shellfish selected for traits of aquacultural importance provides the opportunity to search for markers and/or assays indicative of different desirable traits. Such markers represent complementary or alternative phenotying tools and could subsequently be used in gene-assisted selection (GAS). For example, phenoloxidase assays have shown that oysters bred for QX resistance have significantly higher activi-
Genetic variation and selective breeding in molluscan shellfish
99
Table 3.2 Published linkage maps for molluscan shellfish
Species
Number of linkage groups (LG), Number of markers, Total length (L), Mean distance between markers (D) Male
Crassostrea 10 LG 96 markers gigas L = 758 cM (n = 10) D = 9 cM 10 LG 88 markers L = 616 cM D = 8 cM Crassostrea 12 LG virginica 114 markers L = 647 cM (n = 10) D = 6 cM 9 LG Ostrea 104 markers edulis1 L = 471 cM (n = 10) D = 5 cM 14 LG Mytilus 116 markers edulis L = 825 cM, (n = 14) D = 8 cM 23 LG 166 markers L = 2468 cM D = 15 cM 20 LG Chlamys 197 markers farreri L = 1631 cM (n = 19) D = 9 cM 18 LG Haliotis 167 markers discus L = 702 cM hannai D = 5 cM (n = 18)
Type and number of markers scored (male / female)
Experimental Reference design
349 AFLP
2 F1 families
Female 11 LG 119 markers L = 1031 cM D = 9 cM 10 LG 86 markers L = 770 cM D = 10 cM 12 LG 84 markers L = 904 cM D = 13 cM 10 LG 117 markers L = 450 cM D = 4 cM 14 LG 121 markers L = 862.8 cM D = 8 cM 25 LG 198 markers L = 3130 cM D = 15 cM 19 LG 166 markers L = 1504 cM D = 10 cM 19 LG 160 markers L = 888 cM D = 6 cM
Li and Guo, 2004
115 microsatellites 3 F2 families
Hubert and Hedgecock, 2004
153 / 129 AFLP 3 microsatellites 1 / 2 EST
1 F1 family
Yu and Guo, 2003
235 AFLP 16 microsatellites
1 F2 family
Lallias et al., 2007a
791 AFLP
1 F1 family
Lallias et al., 2007b
603 AFLP
1 F1 family
Wang et al., 2005
667 AFLP
1 F1 family
Li et al., 2005
180 microsatellites 3 F1 families
Sekino and Hara, 2007
1
male and female parents could not be determined in the cross. AFLP = amplified fragment length polymorphism, EST = expressed sequence tag.
ties than the non-selected population, indicating that phenoloxidase may represent a specific QX disease resistance factor (Newton et al., 2004). Direct association between gene polymorphism and phenotypic variation in certain traits has recently been reported in oysters. (Prudence et al., 2006) showed that oyster genotypes with different alleles at the two Amylase
100
New technologies in aquaculture
gene loci had significant differences in growth. Physiological causes of such differences have also been investigated in relationship with feeding-related traits and specific amylase activity (Huvet et al., 2008). Differential mortality of genotypes at candidate genes have revealed an association between specific alleles of both glutamine synthetase (amino-acid metabolism) and delta-9 desaturase (lipid metabolism) genes with resistance to summer mortality (David et al., 2007). In addition to these a priori approaches, differential gene expression studies can provide new ‘candidate genes’. Differential gene expression between oysters selected to be resistant or sensitive to summer mortality (Huvet et al., 2004b) or exposure to pollutants (Boutet et al., 2004; Tanguy et al., 2005) has led to the identification of large numbers of candidate expressed sequence tags (ESTs). Until now, suppression subtractive hybridisation (SSH) has been the method most frequently used to identify genes differentially expressed between contrasting individuals. However, novel high-throughput transcriptome analysis methods such as microarrays (Jenny et al., 2007), massively parallel signature sequencing (MPSS) (Hedgecock et al., 2007b) or serial analysis of gene expression (SAGE) (Bachère, pers. comm.) are likely to increasingly contribute to the identification of genes of interest in the near future. The non-neutrality of allozyme markers has been strongly debated in bivalves, in relation to heterozygote deficiencies frequently observed in wild populations using these tools (Raymond et al., 1997) and the relationship between heterozygosity and fitness-related traits (Bierne et al., 2000). Evidence of departure from neutrality has been specifically shown for certain markers, both indirectly in a study examining patterns of isolation by distance (Launey et al., 2002) and more directly by measurements of specific activity of given enzymes (Pogson, 1991). However, contrasting results were found by Gardner and Lobkov (2005) and Wood and Gardner (2006). Although cross-breeding is currently proposed as an efficient method of commercial improvement in diploid oysters (Hedgecock and Davis, 2007) and higher multi-locus heterozygocity is associated with better performance in meiosis I triploids when compared with meiosis II (Magoulas et al., 2000), I am not aware of any selective breeding program targeting specific enzyme heterozygocity in any bivalve molluscs. The co-localisation of QTLs and candidate genes should be a mutual reinforcement of both approaches (Carlborg et al., 2005) that would benefit the ultimate progression of molluscan shellfish improvement programs based on such knowledge.
3.6 References alcapan a c, nespolo r f and toro j e (2007) Heritability of body size in the Chilean blue mussel (Mytilus chilensis Hupe 1854): effects of environment and ageing, Aquac Res, 38, 313–20.
Genetic variation and selective breeding in molluscan shellfish
101
anderson e c and garza j c (2006) The power of single-nucleotide polymorphisms for large-scale parentage inference, Genetics, 172, 2567–82. appleyard s a and ward r d (2006) Genetic diversity and effective population size in mass selection lines of Pacific oyster (Crassostrea gigas), Aquaculture, 254, 148–59. barber b j, davis c v and crosby m a (1998) Cultured oysters, Crassostrea virginica, genetically selected for fast growth in the Damariscotta River, Maine, are resistant to mortality caused by Juvenile Oyster Disease (JOD), J Shellfish Res, 17, 1171–5. beattie j h, chew k k and hershberger w k (1980) Differential survival of selected strains of Pacific oysters (Crassostrea gigas) during summer mortality, Proc Natl Shellfish Ass, 70, 184–9. beaumont a (2000) Genetic considerations in transfers and introductions of scallops, Aquac Int, 8, 493–512. bierne n, launey s, naciri-graven y and bonhomme f (1998) Early effect of inbreeding as revealed by microsatellite analyses on Ostrea edulis larvae, Genetics, 148, 1893–906. bierne n, tsitrone a and david p (2000) An inbreeding model of associative overdominance during a population bottleneck, Genetics, 155, 1981–90. blake s g, blake n j, oesterling m j and graves j e (1997) Genetic divergence and loss of diversity in two cultured populations of the bay scallop, Argopecten irradians (Lamarck, 1819), J Shellfish Res, 16, 55–8. borsa p and thiriot-quievreux c (1990) Karyological and allozymic characterization of Ruditapes philippinarum, R aureus and R decussatus (Bivalvia, Veneridae), Aquaculture, 90, 209–27. boudry p, collet b, cornette f, hervouet v and bonhomme f (2002) High variance in reproductive success of the Pacific oyster (Crassostrea gigas, Thunberg) revealed by microsatellite-based parentage analysis of multifactorial crosses, Aquaculture, 204, 283–96. boudry p, dégremont l and haffray p (2008) The genetic basis of summer mortality in Pacific oyster spat and potential for improving survival by selective breeding in France, in Summer mortality of Pacific oyster Crassostrea gigas. The Morest Project, Quae Editions, Versailles, 153–96. boutet i, tanguy a and moraga d (2004) Response of the Pacific oyster Crassostrea gigas to hydrocarbon contamination under experimental conditions, Gene, 329, 147–57. brake j, evans f and langdon c (2004) Evidence for genetic control of pigmentation of shell and mantle edge in selected families of Pacific oysters, Crassostrea gigas, Aquaculture, 229, 89–98. carlborg o, de koning d j, manly k f, chesler e, williams r w and haley c s (2005) Methodological aspects of the genetic dissection of gene expression, Bioinformatics 21(10), 2383–93. culloty s c, cronin m a and mulcahy m f (2004) Potential resistance of a number of populations of the oyster Ostrea edulis to the parasite Bonamia ostreae, Aquaculture, 237, 41–58. curole j p and hedgecock d (2005) High frequency of SNPs in the Pacific oyster genome Plant and Animal Genomes XIII Conference, January 15–19, San Diego, CA, http://intl-pag.org/13/abstracts/PAG13_W026.html, accessed January 2009. david e, boudry p, dégremont l, tanguy a, quere n, samain j f and moraga d (2007) Genetic polymorphism of glutamine synthetase and delta-9 desaturase in families of Pacific oyster Crassostrea gigas and susceptibility to summer mortality, J Exp Mar Biol Ecol, 349, 272–83.
102
New technologies in aquaculture
dégremont l, ernande b, bedier e and boudry p (2007) Summer mortality of hatchery-produced Pacific oyster spat (Crassostrea gigas). I. Estimation of genetic parameters for survival and growth, Aquaculture, 262, 41–53. encomio v g, stickler s m, allen s k jr, and chu f-l (2005) Performance of ‘natural dermo-resistant’ oyster stocks-survival, disease, growth, condition and energy reserves, J Shellfish Res, 24, 143–55. english l j, maguire g b and ward r d (2000) Genetic variation of wild and hatchery populations of the Pacific oyster, Crassostrea gigas (Thunberg) in Australia, Aquaculture, 187, 283–98. ernande b, clobert j, mccombie h and boudry p (2003) Genetic polymorphism and trade-offs in the early life-history strategy of the Pacific oyster, Crassostrea gigas (Thunberg, 1795): a quantitative genetic study, J Evol Biol, 16, 399–414. ernande b, boudry p, clobert j and haure j (2004) Plasticity in resource allocation based life history traits in the Pacific oyster, Crassostrea gigas. I. Spatial variation in food abundance, J Evol Biol, 17, 342–56. evans s and langdon c (2006a) Direct and indirect responses to selection on individual body weight in the Pacific oyster (Crassostrea gigas), Aquaculture, 261, 546–55. evans s and langdon c (2006b) Effects of genotype x environment interactions on the selection of broadly adapted Pacific oysters (Crassostrea gigas), Aquaculture, 261, 522–34. falconer d s and mackay t f c (1996) Introduction to Quantitative Genetics, Longman, Harlow. farley c a, lewis e j, relyea d, zahtila j and rivara g (1998) Resistance studies for juvenile oyster disease (JOD) 1997: Some early insights into genetic aspects, J Shellfish Res, 17, 352–3. fishback a g, danzmann r g, ferguson m m and gibson j p (2002) Estimates of genetic parameters and genotype by environment interactions for growth traits of rainbow trout (Oncorhynchus mykiss) as inferred using molecular pedigrees, Aquaculture, 206, 137–50. ford s e and haskin h h (1987) Infection and mortality patterns in strains of oysters Crassostrea virginica selected for resistance to the parasite Haplosporidium nelsoni (MSX), J Parasitol, 73, 368–76. ford s e, figueras a j and haskin h h (1990) Influence of selective breeding, geographic origin, and disease on gametogenesis and sex-ratios of oysters, Crassostrea virginica, exposed to the parasite Haplosporidium nelsoni (MSX), Aquaculture, 88, 285–301. gaffney p m, bernat c m and allen s k (1993) Gametic incompatibility in wild and cultured populations of the eastern oyster, Crassostrea virginica (Gmelin), Aquaculture, 115, 273–84. gallais a (1981) Quantitative genetics and breeding theory of autoploid plants, Eucarpia Proc Quant Genetics and Breeding Methods, 189–216. gardner j p a and lobkov l (2005) A test for overdominance at the phosphoglucomutase-2 locus in Pacific oysters (Crassostrea gigas) from New Zealand, Aquaculture, 244, 29–39. gerber s, mariette s, streiff r, bodenes c and kremer a (2000) Comparison of microsatellites and amplified fragment length polymorphism markers for parentage analysis, Mol Ecol, 9, 1037–48. guo x m, debrosse g a and allen s k (1996) All-triploid pacific oysters (Crassostrea gigas Thunberg) produced by mating tetraploids and diploids, Aquaculture, 142, 149–61. guo x, ford s e and zhang f (1999) Molluscan aquaculture in China, J Shellfish Res, 18, 19–31.
Genetic variation and selective breeding in molluscan shellfish
103
hand r e, nell j a and thompson p a (2004) Studies on triploid oysters in Australia XIII. Performance of diploid and triploid Sydney rock oyster, Saccostrea glomerata (Gould, 1850), progeny from a third generation breeding line, Aquaculture, 233, 93–107. hayes b, sonesson a k and gjerde b (2005) Evaluation of three strategies using DNA markers for traceability in aquaculture species, Aquaculture, 250, 70–81. hedgecock d and davis j (2007) Heterosis for yield and crossbreeding of the Pacific oyster Crassostrea gigas, Aquaculture, 272, S17–S29. hedgecock d, chow v and waples r s (1992) Effective population numbers of shellfish broodstocks estimated from temporal variance in allelic frequencies, Aquaculture, 108, 215–32. hedgecock d, langdon c, blouin m and allen s (1996a) Genetic improvement of cultured oysters by selection, Coastal Marine Experiment Station Annual Report, Agricultural Experimental Station, Oregon State University, Corvallis, OR. hedgecock d, mcgoldrick d j, manahan d t, vavra j, appelmans n and bayne b l (1996b) Quantitative and molecular-genetic analyses of heterosis in bivalve mollusks, J Exp Mar Biol Ecol, 203, 49–59. hedgecock d, li g, hubert s, bucklin k and ribes v (2004a) Widespread null alleles and poor cross-species amplification of microsatellite DNA loci cloned from the Pacific oyster, Crassostrea gigas, J Shellfish Res, 23, 379–85. hedgecock d, li g m-l and voigt m l (2004b) Mapping heterosis QTL in the Pacific oyster Crassostrea gigas, Plant and Animal Genomes II Conference, January 10–14, San Diego, CA, http://www.intl-pag.org/12/abstracts/W06_ PAG12_19.html, accessed January 2009. hedgecock d, launey s, pudovkin a i, naciri y, lapegue s and bonhomme f (2007a) Small effective number of parents (N-b) inferred for a naturally spawned cohort of juvenile European flat oysters Ostrea edulis, Mar Biol, 150, 1173–82. hedgecock d, lin j z, decola s, haudenschild c d, meyer e, manahan d t and bowen b (2007b) Transcriptomic analysis of growth heterosis in larval Pacific oysters (Crassostrea gigas), Proc Natl Acad Sci USA, 104, 2313–18. herbinger c m, doyle r w, pitman e r, paquet d, mesa k a, morris d b, wright j m and cook d (1995) DNA fingerprint based analysis of paternal and maternal effects on offspring growth and survival in communally reared rainbow trout, Aquaculture, 137, 245–56. hershberger w k, perdue j a and beattie j h (1984) Genetic selection and systematic breeding in Pacific oyster culture, Aquaculture, 39, 237–45. hubert s and hedgecock d (2004) Linkage maps of microsatellite DNA markers for the Pacific oyster Crassostrea gigas, Genetics, 168, 351–62. hulata g (2001) Genetic manipulations in aquaculture: a review of stock improvement by classical and modern technologies, Aquaculture, 111, 155–73. huvet a, lapegue s, magoulas a and boudry p (2001) Mitochondrial and nuclear DNA phylogeography of Crassostrea angulata, the Portuguese oyster endangered in Europe, Mar Biotechnol, 1, 251–62. huvet a, fabioux c, mccombie h, lapegue s and boudry p (2004a) Natural hybridization between genetically differentiated populations of Crassostrea gigas and C. angulata highlighted by sequence variation in flanking regions of a microsatellite locus, Mar Ecol – Prog Ser, 272, 141–52. huvet a, herpin a, degremont l, labreuche y, samain j f and cunningham c (2004b) The identification of genes from the oyster Crassostrea gigas that are differentially expressed in progeny exhibiting opposed susceptibility to summer mortality, Gene, 343, 211–20. huvet a, jeffroy f, fabioux c, daniel j y, quillien v, van wormhoudt a, moal j, samain j f, boudry p and pouvreau s (2008) Association among growth, food
104
New technologies in aquaculture
consumption-related traits and amylase gene polymorphism in the Pacific oyster Crassostrea gigas, Anim Genet, 39, 662–5. ibarra a m, ramirez j l and garcia g a (1997) Stocking density effects on larval growth and survival of two Catarina scallop, Argopecten ventricosus (equals circularis) (Sowerby II, 1842), populations, Aquac Res, 28, 443–51. ibarra a m, ramirez j l, ruiz c a, cruz p and avila s (1999) Realized heritabilities and genetic correlation after dual selection for total weight and shell width in catarina scallop (Argopecten ventricosus), Aquaculture, 175, 227–41. janke a, king n, roberts r and kaspar h (2004) Selective breeding of the Pacific oyster Crassostrea gigas in New Zealand, Aquaculture 2004, Book of Abstracts, 311. jenny m j, chapman r w, mancia a, chen y a, mckillen d j, trent h, lang p, escoubas j m, bachere e, boulo v, liu z j, gross p s, cunningham c, cupit p m, tanguy a, guo x, moraga d, boutet i, huvet a, de guise s, almeida j s and warr g w (2007) A cDNA Microarray for Crassostrea virginica and C. gigas, Mar Biotechnol, 9, 577–91. jonasson j, stefansson s e, gudnason a and steinarsson a (1999) Genetic variation for survival and shell length of cultured red abalone (Haliotis rufescens) in Iceland, J Shellfish Res, 18, 621–5. jones r, bates j a, innes d j and thompson r j (1996) Quantitative genetic analysis of growth in larval scallops (Placopecten magellanicus), Mar Biol, 124, 671–7. kang s g, choi k s, bulgakov a a, kim y and kim s y (2003) Enzyme-linked immunosorbent assay (ELISA) used in quantification of reproductive output in the pacific oyster, Crassostrea gigas, in Korea, J Exp Mar Biol Ecol, 282, 1–21. king n, janke a, roberts r and kaspar h (2004) New Zealand oyster-breeding program seeks genetic improvements, Global Aquac Advocate, 7(3), 59–60. kube p d, appleyard s a and elliot n g (2007) Selective breeding greenlip abalone (Haliotis laevigata): Preliminary results and issues, J Shellfish Res, 26, 821–4. lallias d, beaumont a r, haley c s, boudry p, heurtebise s and lapègue s (2007a) A first-generation genetic linkage map of the European flat oyster Ostrea edulis (L.) based on AFLP and microsatellite markers. Anim Genet, 38, 560–8. lallias d, lapegue s, hecquet c, boudry p and beaumont a r (2007b) AFLP-based genetic linkage maps of the blue mussel (Mytilus edulis), Anim Genet, 38, 340–9. lallias d, gomez-raya l, haley c s, arzul i, heurtebise s, beaumont a r, boudry p and lapègue s (2009) Combining two-stage testing and interval mapping strategies to detect QTL for resistance to bonamiosis in the European flat oyster Ostrea edulis, Mar Biotechnol (in press). langdon c, evans f, jacobson d and blouin m (2003) Yields of cultured Pacific oysters Crassostrea gigas Thunberg improved after one generation of selection, Aquaculture, 220, 227–44. launey s and hedgecock d (2001) High genetic load in the Pacific oyster Crassostrea gigas, Genetics, 159, 255–65. launey s, barre m, gerard a and naciri-graven y (2001) Population bottleneck and effective size in Bonamia ostreae-resistant populations of Ostrea edulis as inferred by microsatellite markers, Genet Res, 78, 259–70. launey s, ledu c, boudry p, bonhomme f and naciri-graven y (2002) Geographic structure in the European flat oyster (Ostrea edulis L.) as revealed by microsatellite polymorphism, J Hered, 93, 331–8. li l and guo x m (2004) AFLP-based genetic linkage maps of the Pacific oyster Crassostrea gigas Thunberg, Mar Biotechnol, 6, 26–36. li q and kijima a (2006) Microsatellite analysis of gynogenetic families in the Pacific oyster, Crassostrea gigas, J Exp Mar Biol Ecol, 331, 1–8.
Genetic variation and selective breeding in molluscan shellfish
105
li g, hubert s, bucklin k, ribes v and hedgecock d (2003a) Characterization of 79 microsatellite DNA markers in the Pacific oyster Crassostrea gigas, Mol Ecol Notes, 3, 228–32. li x, field c and doyle r (2003b) Estimation of additive genetic variance components in aquaculture populations selectively pedigreed by DNA fingerprinting, Biom J, 45, 61–72. li q, park c, endo t and kijima a (2004) Loss of genetic variation at microsatellite loci in hatchery strains of the Pacific abalone (Haliotis discus hannai), Aquaculture, 235, 207–22. li l, xiang j h, liu x, zhang y, dong b and zhang x j (2005) Construction of AFLPbased genetic linkage map for Zhikong scallop, Chlamys farreri Jones et Preston and mapping of sex-linked markers, Aquaculture, 245, 63–73. li q, xu k f and yu r h (2007) Genetic variation in Chinese hatchery populations of the Japanese scallop (Patinopecten yessoensis) inferred from microsatellite data, Aquaculture, 269, 211–19. liu x d, liu x and zhang g f (2007) Identification of quantitative trait loci for growth-related traits in the Pacific abalone Haliotis discus hannai Ino, Aquac Res, 38, 789–97. losee e (1978) Influence of Heredity on Larval and Spat Growth in Crassostrea virginica, Atlanta, GA, Louisiana State University Division of Continuing Education, Baton Rouge, LA. lynch m and walch b (1998) Genetics and Analysis of Quantitative Traits, Sunderland, MA, Sinauer Associates Inc. magoulas a, kotoulas g, gerard a, naciri-graven y, dermitzakis e, hawkins a j s and ll a (2000) Comparison of genetic variability and parentage in different ploidy classes of the Japanese oyster Crassostrea gigas, Genet Res, 76, 261–72. mallet a l and haley l e (1984) General and specific combining abilities of larval and juvenile growth and viability estimated from natural oyster populations, Mar Biol, 81, 53–9. mcavoy e s, wood a r and gardeur j n (2008) Development and evaluation of microsatellite markers for identification of individual GreenshellTM mussels (Perna canaliculus) in a selective breeding programme, Aquaculture, 274, 41–8. mccombie h, ledu c, phelipot p, lapegue s, boudry p and gerard a (2005) A complementary method for production of tetraploid Crassostrea gigas using crosses between diploids and tetraploids with cytochalasin B treatments, Mar Biotechnol, 7, 318–30. moraga d (1986) Genetic-polymorphism of cultivated populations of the Manila clam, Tapes philippinarum, Comptes Rendus Acad Sci Ser III-Sci Vie-Life Sci, 302, 621–4. naciri-graven y, martin a g, baud j p, renault t and gerard a (1998) Selecting the flat oyster Ostrea edulis (L) for survival when infected with the parasite Bonamia ostreae, J Exp Mar Biol Ecol, 224, 91–107. nell j a and hand r e (2003) Evaluation of the progeny of second-generation Sydney rock oyster Saccostrea glomerata (Gould, 1850) breeding lines for resistance to QX disease Marteilia sydneyi, Aquaculture, 228, 27–35. nell j a and perkins b (2005) Evaluation of progeny of fourth generation Sydney rock oyster Saccostrea glomerata (Gould, 1850) breeding lines, Aquac Res, 36, 753–7. nell j a and perkins b (2006) Evaluation of the progeny of third-generation Sydney rock oyster Saccostrea glomerata (Gould, 1850) breeding lines for resistance to QX disease Marteilia sydneyi and winter mortality Bonamia roughleyi, Aquac Res, 37, 693–700.
106
New technologies in aquaculture
nell j a, sheridan a k and smith i r (1996) Progress in a Sydney rock oyster, Saccostrea commercialis (Iredale and Roughley), breeding program, Aquaculture, 144, 295–302. nell j a, smith i r and mcphee c c (2000) The Sydney rock oyster Saccostrea glomerata (Gould 1850) breeding programme: progress and goals, Aquac Res, 31, 45–9. nell j a, smith i r and sheridan a k (1999) Third generation evaluation of Sydney rock oyster Saccostrea commercialis (Iredale and Roughley) breeding lines, Aquaculture, 170, 195–203. newton k, peters r and raftos d (2004) Phenoloxidase and QX disease resistance in Sydney rock oysters (Saccostrea glomerata), Dev Comp Immunol, 28, 565–9. ovenden j r, peel d, street r, courtney a j, hoyle s d, peel s l and podlich h (2007) The genetic effective and adult census size of an Australian population of tiger prawns (Penaeus esculentus), Mol Ecol, 16, 127–38. pace d a, marsh a g, leong p k, green a j, hedgecock d and manahan d t (2006) Physiological bases of genetically determined variation in growth of marine invertebrate larvae: A study of growth heterosis in the bivalve Crassostrea gigas, J Exp Mar Biol Ecol, 335, 188–209. pogson g h (1991) Expression of overdominance for specific activity at the phosphoglucomutase-2 locus in the pacific oyster, Crassostrea gigas, Genetics, 128, 133–41. prudence m, moal j, boudry p, daniel j y, quere c, jeffroy f, mingant c, ropert m, bedier e, van wormhoudt a, samain j f and huvet a (2006) An amylase gene polymorphism is associated with growth differences in the Pacific cupped oyster Crassostrea gigas, Anim Genet, 37, 348–51. raymond m, vaanto r l, thomas f, rousset f, demeeus t and renaud f (1997) Heterozygote deficiency in the mussel Mytilus edulis species complex revisited, Mar Ecol – Prog Ser, 156, 225–37. ryan f b, kube p b, parkinson s a, li x and nell j a (2006) Selection of Genetic Strategies in Pacific Oysters to Maximise Commercial Benefit, Australian Seafood Industries, Howrah, TAS. samain j f and mccombie h (2008) Summer Mortality in Pacific Oyster Crassostrea gigas, The Morest Project, Versailles, Editions Quae. sauvage c (2008) Développement de marqueurs moléculaires liés à la résistance à la mortalité estivale chez l’huître creuse Crassostrea gigas – approche QTL, Thèse de Doctorat de l’Université de La Rochelle. sauvage c, bierne n, lapegue s and boudry p (2007) Single nucleotide polymorphisms and their relationship to codon usage bias in the Pacific oyster Crassostrea gigas, Gene, 406, 13–22. sekino m and hara m (2007) Linkage maps for the Pacific abalone (genus Haliotis) based on microsatellite DNA markers, Genetics, 175, 945–58. sheridan a k (1997) Genetic improvement of oyster production-a critique, Aquaculture, 153, 165–79. smith p j, ozaki h and fujio y (1986) No evidence for reduced genetic-variation in the accidentally introduced oyster Crassostrea gigas in New Zealand, New Zea J Mar Fresh Res, 20, 569–74. soletchnik p, huvet a, le moine o, razet d, geairon p, faury n, goulletquer p and boudry p (2002) A comparative field study of growth, survival and reproduction of Crassostrea gigas, C-angulata and their hybrids, Aquat Living Resour, 15, 243–50. sonesson a k (2005) A combination of walk-back and optimum contribution selection in fish: a simulation study, Genet Sel Evol, 37, 587–99. sonesson a k (2007) Within-family marker-assisted selection for aquaculture species, Genet Sel Evol, 39, 301–17.
Genetic variation and selective breeding in molluscan shellfish
107
swan a a, thompson p a and ward r d (2007) Genotype x environment interactions for weight in Pacific oysters (Crassostrea gigas) on five Australian farms, Aquaculture, 265, 91–101. tanguy a, boutet i, laroche j and moraga d (2005) Molecular identification and expression study of differentially regulated genes in the Pacific oyster Crassostrea gigas in response to pesticide exposure, Febs J, 272, 390–403. taris n, ernande b, mccombie h and boudry p (2006) Phenotypic and genetic consequences of size selection at the larval stage in the Pacific oyster (Crassostrea gigas), J Exp Mar Biol Ecol, 333, 147–58. taris n, batista f m and boudry p (2007) Evidence of response to unintentional selection for faster development and inbreeding depression in Crassostrea gigas larvae, Aquaculture, 272(supp 1), S69–S79. toro j e and paredes l i (1996) Heritability estimates of larval shell length in the Chilean blue mussel Mytilus chilensis, under different food densities, Aquat Living Resour, 9, 347–50. toro j e, alcapan a c, vergara a m and ojeda j a (2004) Heritability estimates of larval and spat shell height in the Chilean blue mussel (Mytilus chilensis Hupe 1854) produced under controlled laboratory conditions, Aquac Res, 35, 56–61. vandeputte m, kocour m, mauger s, dupont-nivet m, de guerry d, rodina m, gela d, vallod d, chevassus b and linhart o (2004) Heritability estimates for growthrelated traits using microsatellite parentage assignment in juvenile common carp (Cyprinus carpio L.), Aquaculture, 235, 223–36. vandeputte m, mauger s and dupont-nivet m (2006) An evaluation of allowing for mismatches as a way to manage genotyping errors in parentage assignment by exclusion, Mol Ecol Notes, 6, 265–7. wang l l, song l s, chang y q, xu w, ni d j and guo x m (2005) A preliminary genetic map of Zhikong scallop (Chlamys farreri Jones et Preston 1904), Aquac Res 36, 643–53. wang l l, zhang h, song l and guo x (2007) Loss of allele diversity in introduced populations of the hermaphroditic bay scallop Argopecten irradians, Aquaculture, 271, 252–9. waples r s (1989) A generalized approach for estimating effective population size from temporal changes in allele frequency, Genetics, 121, 379–91. ward r d and thompson p a (2005) Progress in a genetic improvement program for Pacific oysters (Crassostrea gigas) in Australia, Aquaculture, 247, 32–3. ward r d, thompson p a, appleyard s a, swan a a and kube p d (2005) Sustainable genetic improvement of Pacific oysters in Tasmania and South Australia, Final Report FRDC Project 2000/2006, Hobart (Tasmania), CSIRO Marine and Atmospheric Research and Fisheries Research and Development Corporation, Hobart, TAS. wenne r, boudry p, hemmer-hansen j, lubieniecki k p, was a and kause a (2007) What role for genomics in fisheries management and aquaculture? Aquat Living Resour, 20, 241–55. williams g c (1975) Sex and Evolution, Princeton, NJ, Princeton University Press. wood a r and gardner j p a (2006) No evidence for overdominance at the phosphoglucomutase-2 locus in Pacific oysters (Crassostrea gigas) from New Zealand, Aquaculture, 259, 74–80. xue q, sheila s, zhang f and xiang j (1999) Population genetic structure at allozymes phosphoglucomutase (PGM) locus and its related in different populations of bay scallop, Argopecten irradians, Oceanol Limnol Sin, 30, 381–90. yu z n and guo x m (2003) Genetic linkage map of the eastern oyster Crassostrea virginica Gmelin, Biol Bull, 204, 327–38. yu z n and guo x m (2006) Identification and mapping of disease-resistance QTLs in the eastern oyster, Crassostrea virginica Gmelin, Aquaculture, 254, 160–70.
108
New technologies in aquaculture
zhang h b, liu x, zhang g f and zhang g z (2005) Effects of effective population size (Ne) on the F2 growth and survival of bay scallop Argopecten irradians irradians (Lamarck). Acta Oceanol Sin, 24, 114–20. zheng h p, zhang g f, liu x, zhang f s and guo x m (2004) Different responses to selection in two stocks of the bay scallop, Argopecten irradians irradians Lamarck (1819), J Exp Mar Biol Ecol, 313, 213–23. zheng h p, zhang g f, liu x a and guo x m (2006) Sustained response to selection in an introduced population of the hermaphroditic bay scallop Argopecten irradians irradians Lamarck (1819), Aquaculture, 255, 579–85.
4 Controlling fish reproduction in aquaculture C. Mylonas, Hellenic Center for Marine Research, Greece, and Y. Zohar, University of Maryland Biotechnology Institute, USA
Abstract: Industrial aquaculture is a new activity to most parts of the world and is looking for ways to establish a reliable and controlled system for the provision of seed stock for grow-out operations. Control of reproductive function can be achieved, in many fish species, by manipulating photoperiod, water temperature and spawning substrate. The reproductive cycle is separated in two phases – i.e., growth and maturation – which may be controlled by different reproductive hormones at the level of the pituitary and gonad. Although the first phase of reproductive development is concluded in captivity, the second stage of the reproductive cycle – i.e., oocyte maturation (OM) and ovulation in females, and spermiation in males – may require the employment of exogenous hormonal therapies. In some species, these hormonal manipulations are used only as a management tool to enhance the efficiency of egg production and facilitate hatchery operations, but in other fishes exogenous hormones are the only way to produce fertilized eggs at an industrial level. The reproductive cycle is controlled by the interactions of the hormones of the brain–pituitary– gonad axis. From the brain, gonadotropin releasing hormones (GnRHs) travel along neural axons and stimulate the gonadotroph cells of the pituitary to produce and secrete the two gonadotropins (GtH) follicle stimulating hormone (FSH) and luteinizing hormone (LH), which, in turn, act at the level of the gonad to induce steroidogenesis and the production of the androgens, estrogens and progestagens, which are the final effectors of reproductive function. Hormonal manipulations of reproductive function in cultured fishes have focused on the use of either exogenous LH preparations that act directly at the level of the gonad, or synthetic GnRH agonists (GnRHa) that act at the level of the pituitary to induce release of the endogenous LH stores, which, in turn act at the level of the gonad to induce steroidogenesis and the process of OM and spermiation. Key words: reproduction, induced spawning, final oocyte maturation, spermiation.
110
New technologies in aquaculture
4.1 Introduction As an industrial agricultural activity, aquaculture is quite new to most parts of the world, with the exception of the extensive carp culture (family Cyprinidae) in Asia and the more recent intensification of salmonid production (Oncorhynchus and Salmo spp) in Europe and North America. In essence, it is only since the 1970s that a truly worldwide industry has developed, lately focusing on marine fishes (Kirk, 1987), and this industry is looking for ways to establish a reliable and controlled system for the provision of seed stock for grow-out operations. Control of reproductive function can be achieved, in many fish species, by manipulating photoperiod, water temperature and spawning substrate. However, the conclusion of the final stage of the reproductive cycle – i.e., oocyte maturation and ovulation in females, and spermiation in males – may require the employment of exogenous hormonal therapies. In some species, these hormonal manipulations are used only as a management tool to enhance the efficiency of egg production and facilitate hatchery operations, but in other fishes exogenous hormones are the only way to produce fertilized eggs at an industrial level. This chapter provides a brief description of the reproductive biology of fishes, followed by a description of the major problems encountered in culture, and the hormonal methods developed in the last few decades to address these dysfunctions. Some consideration is also given to future trends in the spawning induction technologies.
4.2 The fish reproductive cycle and its control The reproductive cycle is separated in two phases – i.e., growth and maturation – which may be controlled by different reproductive hormones at the level of the pituitary and gonad (Fig. 4.1). In females, the first phase includes the growth of the primary oocytes and the accumulation of the yolk precursor, vitellogenin (vtg), in their cytoplasm (Fig. 4.2). At the completion of this phase, which is also referred to as vitellogenesis, the process of oocyte maturation (OM) includes both cytoplasmic and nuclear events that prepare the oocyte for its expulsion from the ovarian follicle (ovulation), its release to the environment during spawning and its fertilization by a single spermatozoon. In males, the growth phase is referred to as spermatogenesis and includes the mitotic proliferation of the spermatogonia into primary spermatocytes, their meiotic division into secondary spermatocytes and their differentiation to spermatids and flagellated spermatozoa. The process of maturation, better known as spermiation, includes the increase in seminal fluid production and the capacitation of the spermatozoa, which are now able to undergo forward motility once released in the water during spawning. The reproductive cycle is controlled by the interactions of the hormones of the brain–pituitary–gonad axis (Fig. 4.1). From the brain, gonadotropin releasing hormones (GnRHs) produced in specific neuroendocrine cells
Controlling fish reproduction in aquaculture
The reproductive axis in fish Environment (photoperiod, lunar cycle, temperature, rainfall)
Spermatogenesis & vitellogenesis
Follicle stimulating hormone (FSH)
Androgens Estrogens
Fully grown gametes
Brain GnRH +
Pituitary
Gonad
111
♀♂
Final maturation DA Luteinizing hormone (LH)
17,20bdihydroxy Progesterone Fertile gametes
Fig. 4.1 Schematic representation of the reproductive axis in fish, its major components and phases, and its environmental and endocrine control.
(Gothilf et al., 1996, 1997; Holland et al., 2001) travel along neural axons and are released immediately at synapses with the gonadotropic cells of the pituitary gland (Yaron et al., 2003). The synthesis and release of the GnRHs is controlled by environmental and nutritional parameters in such a way that reproduction takes place under optimal conditions (Yu et al., 1997). In response to GnRH stimulation, the gonadotrophs produce and secrete the two gonadotropins (GtH) follicle stimulating hormone (FSH) and luteinizing hormone (LH), which, in turn, act at the level of the gonad to induce steroidogenesis (Rosenfeld et al., 2007) and the production of the androgens, estrogens and progestagens, which are the final effectors of reproductive function. In addition to the primary GnRH stimulatory system, neurons secreting dopamine (DA) exert an inhibitory action on both the brain (GnRH synthesis and release) and pituitary (down-regulation of GnRH-R and interference with the GnRH signal-transduction pathways) (Peter et al., 1993; Peter and Yu, 1997; Yaron et al., 2003; Dufour et al., 2005; Levavi-Sivan et al., 2004). As a result, DA inhibits both basal LH secretion and GnRHstimulated LH secretion from the pituitary. Although a dopaminergic inhibition on LH release has been demonstrated in all vertebrates, its intensity and temporal action may differ greatly among fishes. A strong dopaminergic inhibition of reproduction has been demonstrated in salmonids, cyprinids, silurids, tilapia (Oreochromis spp.), freshwater eel (Anguilla anguilla) and grey mullet (Mugil cephalus) (Saligaut et al., 1999; Silverstein et al.,
112
New technologies in aquaculture
A
B gv gv po y
po y l C
D
ca
y
E y ca
l gv
gv
y l
H
G
F
y y
l
gv
gv
y
l l ca
Fig. 4.2 Microphotographs of histological sections from ovaries. (A) Primary oocytes (po) of striped bass, having a centrally located germinal vesicle (gv) and peripheral nucleoli. (B) Oocytes at various stages of vitellogenesis from Atlantic bluefin tuna. Vitellogenic oocytes have various amounts of lipid droplets (l) and yolk vesicles (y). (C) Vitellogenic oocyte of white bass containing small numbers of lipid droplets. (D) Vitellogenic oocyte of striped bass with a very large percentage of lipid droplets. The periphery is occupied by cortical alveoli (ca). (E) Vitellogenic oocyte of American shad (Alosa sapidissima) showing no lipid droplets. (F) Oocyte of striped bass undergoing GV migration and lipid coalescence. (G) Oocyte of striped bass at the GV breakdown stage. (H) Ovulated egg from striped bass. Photographs are not at the same scale.
Controlling fish reproduction in aquaculture
113
1999; Yaron et al., 2003; Vidal et al., 2004). In contrast, a DA inhibitory system seems to be very weak or absent in most marine fishes (Copeland and Thomas, 1989; Zohar et al., 1995; Kumakura et al., 2003a; Prat et al., 2001).
4.2.1 Vitellogenesis, oocyte maturation and ovulation At the onset of vitellogenesis, the ovigerous lamellae of the ovary contain nests of primary oocytes (Fig. 4.2a), which are arrested at prophase I (Guraya, 1986; Wallace and Selman, 1990; Selman et al., 1993). After a period referred to as primary growth, or previtellogenesis, during which the appearance of the ovarian follicle (i.e., the granulosa and theca layers) takes place, vitellogenesis, or the secondary growth, begins (Fig. 4.2b). Vitellogenesis is a hormone-dependant process and its immediate effector is the estrogen 17β-estradiol (E2), produced from the androgen testosterone (T) by the ovarian follicle in a two-cell process involving both the theca and granulosa cell layers (Nagahama, 1994). Regulation of steroidogenesis and E2 production at this time is controlled by the pituitary GtH, in some species by FSH and in others by LH (Rosenfeld et al., 2007). As the name implies, the major characteristic of vitellogenesis is the production of vitellogenin (vtg), which takes place in the liver, and its sequestration in a pinocytosis-mediated process into the developing oocyte (Mommsen and Walsh, 1988; Tyler and Sumpter, 1996). At the start of vitellogenesis, the oocytes may be 150–250 μm in diameter (Fig. 4.2b) and, depending on fish species, at the end of the process the post-vitellogenic oocytes may have a diameter of 550 μm, as in shi drum (Umbrina cirrosa) (Mylonas et al., 2004a), 850 μm, as in striped bass (Morone saxatilis) (Mylonas et al., 1997e), 1400 μm, as in wreckfish (Polyprion americanus) (Fauvel et al., 2007), or up to 4 mm, as in Salmo and Oncorhynchus species (Bromage et al., 1992). Once sequestered into the oocytes, vtg is stored in the yolk globules (or granules), until the process of OM. Another type of nutrients accumulating into the growing vitellogenic oocytes are the lipids. Depending on the species of fish, lipids may be present in the form of triglycerides, phospholipids or wax esters (Lund et al., 2000), and the amount and type of lipid class dominating the cytoplasm determines the presence (Fig. 4.2b, c and d) or absence (Fig. 4.2e), and size and number of lipid droplets (Fig. 4.2c and d) (Mylonas et al., 1997e, 2004a; Corriero et al., 2007). Thus, at the end of vitellogenesis the oocyte has a large cytoplasm filled completely with yolk globules and, in most cases, lipid droplets, a centrally located nucleus (named germinal vesicle, GV), and thick zona radiata (the future chorion) and follicular layers (Fig. 4.2c and d). Oocyte maturation is the second phase of the gametogenic cycle in females, and it is regulated by an LH surge from the pituitary and the production of the maturation inducing hormone (MIH) by the ovarian follicle (Nagahama et al., 1994; Suwa and Yamashita, 2007). The MIH is a
114
New technologies in aquaculture
progestagen, and in most fishes it is 17α,20β-dihydroxy-progesterone (DHP), whereas in others it is 17α,20β,21-trihydroxy-progesterone (20β-S). Oocyte maturation begins with the resumption of meiosis, which has been arrested in prophase I, and the migration of the GV to the animal pole of the oocyte (Fig. 4.2f), underneath the micropyle (Mylonas et al., 1997b). At the same time, and depending on fish species, coalescence of the lipid droplets takes place, resulting in the production of a single lipid droplet (Fig. 4.2g) (Mylonas et al., 1997e). As OM progresses, the GV membrane dissolves (germinal vesicle breakdown, GVBD), chromosomes condense and the first polar body is expulsed from the oocyte. During this time, there is a chemical modification of the yolk, with the proteolysis of the vtg and the production of its major components, lipovitellin, phosvitin and β-component, and free amino acids (FAA) (Cerdá et al., 2007), which is apparent in the coalescence of the yolk globules and the change in staining properties of the yolk (Fig. 4.2g and h) (Mylonas et al., 1997e). Depending on whether the eggs produced are pelagic or bethic (i.e., positively or negatively buoyant), the extent of this proteolysis varies and results in the increase in the osmotic pressure of the oocyte, which drives a drastic uptake of water (Cerdá et al., 2007) with a many-fold increase in size. After hydration, the follicular wall ruptures and the oocyte is ovulated (Fig. 4.2h) into the ovarian cavity, in most fishes, or in the abdominal in others (e.g., Salmonidae and Acipenseridae).
4.2.2 Spermatogenesis and spermiation Spermatogenesis is the process of mitotic proliferation of the spermatogonia, their meiotic division into haploid spermatocytes, and their transformation into flagellated spermatozoa (Schulz and Miura, 2002). During mitotic proliferation, each spermatogonium goes through a species-specific number of divisions, which ranges between 5 and 15. During these divisions all daughter cells maintain direct cytoplasmic bridges between them; they are all contained within an individual spermatocyst, and undergo simultaneous development and maturation from spermatogonia to spermatocytes I and II, spermatids and finally flagellated spermatozoa (Fig. 4.3). Once spermatogenesis is completed, the Sertoli cells that surround each spermatocyst rupture and the spermatozoa are released into the testicular lumen. The presence and relative abundance of spermatocysts with the above maturation stage gametes are used as an indication of the degree of testicular development in fish. With the rupture of the spermatocyst starts the period of spermiation, during which the spermatozoa undergo maturation (capacitation) as they move along the tubular lumen of the testes and are gathered in the efferent ducts. Capacitation is the process by which the spermatozoa acquire the capacity for motility once released in the water, and thus the ability to fertilize the eggs (Billard et al., 1995; Miura and Miura, 2003). At the same
Controlling fish reproduction in aquaculture
115 B
A st sc
sg
sc
sz
E sg C
D sz sz sz
sc
Fig. 4.3 Microphotographs of histological sections from testes of European sea bass at various stages of maturation. (A) Before the onset of the reproductive season, containing only spermatogonia (sg). (B) At the early stage of spermatogenesis in November, containing spermatocyst with spermatocytes I and II (sc) and spermatids (st), including some spermatozoa (sz). (C) In December when spermiation begins, showing the extensive rupture of the mature spermatocysts and the aggregation of spermatozoa in the tubules. (D) In January at the onset of the females spawning season, with the tubules containing almost exclusively spermatozoa. (E) Spent testes at the end of the season, showing residual spermatozoa, new spermatogonia and hypertrophied somatic cells. Photographs are not in the same scale.
time, the testes produce large volumes of seminal fluid, in which the spermatozoa are transported and released to the environment during spawning. During the period of spermiation, gentle abdominal pressure can result in the release of milt (seminal fluid with spermatozoa) in most fishes, and the quality of the milt (density, percentage motility and survival) can be evaluated (Suquet et al., 1994; Billard et al., 1995; Fauvel et al., 1999). The general view of the involvement of pituitary GtHs in the male reproductive cycle, as with the female, is that FSH controls mainly the early stages of gametogenesis (Ohta et al., 2007), while LH regulates the process of spermiation (Schulz and Miura, 2002). Again, the final effectors of the GtHs on reproductive function are the gonadal steroids. Estrogens seem to induce the mitotic proliferation of the spermatogonia prior to the onset of
116
New technologies in aquaculture
gametogenesis (Miura and Miura, 2003). Then androgens (T and 11-keto T, 11-KT) regulate the whole process of spermatogenesis, to the production of flagellated spermatozoa (Miura et al., 1991b; Schulz and Miura, 2002). The maturation of the spermatozoa and the acquisition of motility capacity are controlled by DHP, the same progestagen that acts as an MIH in the female. This action involves the spermatozoa themselves, in a receptormediated process that results in an increase in seminal plasma pH (Miura and Miura, 2003). 4.2.3 Spawning Spawning is the release of the mature gametes (eggs and capacitated spermatozoa) to the external environment (in the vast majority of fishes), in order to produce the zygote. As spermatozoa lose their motility within seconds or minutes after release from the testes and contact with the water (Billard et al., 1995) and eggs absorb water resulting in the closure of the micropyle (Cerdá et al., 2007), spawning must be extremely synchronous in order to result in fertilized eggs. Therefore, fish employ both breeding rituals and pheromones in order to signal to the other sex their readiness for spawning (Liley, 1983; Stacey, 1984; Stacey et al., 1994; Zabala et al., 1997; Kobayashi et al., 2002). Spawning may take place in pairs (e.g., flounder, catfish), single females with a group of males (e.g., Salmonidae, Moronidae), or large groups of males and females (e.g., Sparidae, Thunnidae). Also, the eggs produced may be pelagic, demersal or may stick to each other and various substrates, such as rocks and vegetation. All these characteristics must be known for each fish of interest and be evaluated by the aquaculturist, in order to achieve the optimum results in terms of egg fecundity and fertilization success.
4.3
Reproductive strategies and dysfunctions in captivity
Being the largest vertebrate class with more that 27 000 species and a very long evolutionary history (Nelson, 2006), fishes exhibit an amazing diversity in reproductive biology and strategies. For the purpose of broodstock management and hormonal manipulations for the induction of OM, ovulation and spawning in aquaculture operations, female fish may be separated into two classifications: sychronous spawners (synchronous and single-batch group-synchronous) and asynchronous spawners (multiple-batch groupsynchronous and asynchronous) (Tyler and Sumpter, 1996). Synchronous spawners reproduce once in their lifetime or once during an annual reproductive season, and their ovary contains a single, uniform population of developing oocytes during the reproductive season (Fig. 4.4a). On the other hand, asynchronous spawners reproduce multiple times during every reproductive period. These spawns may be numerous and regular, e.g., daily or every other day for a period of 3–4 months; or can be few and irregular in
Controlling fish reproduction in aquaculture A
117
B
Fig. 4.4 Microphotographs of histological sections from ovaries of striped bass, a synchronous fish (A), and of bluefin tuna, an asynchronous fish (B). Photographs are not in the same scale.
their timing, e.g. 3–7 spawns with an inter-spawn period of between 3 and 10 d. The ovaries of these species contain oocytes at all stages of development during the reproductive season (Fig. 4.4b), and different batches of oocytes mature during each OM, ovulation and spawning event. In terms of the males, the situation is somewhat simpler. Spermatogenesis and spermiation may be temporally separated, with spermiation occurring after the conclusion of spermatogenesis, and during the spawning season the testes may contain exclusively spermatozoa (Billard, 1986; Malison et al., 1994). In the majority of species, however, there is significant overlap between the two processes, with both spermatogenesis and spermiation taking place during the spawning season (Jackson and Sullivan, 1995; Mylonas et al., 2003; Rainis et al., 2003). Therefore, management of male reproduction in captivity and induction of spermiation utilizes very similar methods. Reproductive dysfunctions of captive fishes are often restricted to the females, since males do undergo complete maturation in captivity, albeit at times possibly producing a reduced amount of milt and of lower quality (Mylonas and Zohar, 2001a, 2007; Zohar and Mylonas, 2001b; Mañanos et al., 2008). The simplest reproductive problem in females is observed in salmonids (Onchorhynchus and Salmo spp.), which do undergo vitellogenesis, OM and ovulation, but fail to spawn their eggs when reared in captivity (Bromage and Cumaranatunga, 1988; Zohar, 1989), probably due to the
118
New technologies in aquaculture
lack of the appropriate spawning substrate to place their eggs. The most common reproductive dysfunction in captivity is the failure of OM upon completion of vitellogenesis. As a result there is no ovulation and no spawning of eggs (Berlinsky et al., 1996, 1997; Larsson et al., 1997; Mugnier et al., 2000; Mylonas and Zohar, 2001b; Barbaro et al., 2002; Duncan et al., 2003; Marino et al., 2003; Ibarra-Castro et al., 2004; Mylonas et al., 2004a; Yang and Chen, 2004; Chen, 2005; Agulleiro et al., 2006; Fauvel et al., 2007; Mylonas et al., 2007). The failure of captive females to undergo OM is due to dysfunctional release of LH from the pituitary. In striped bass, for example, the levels of various reproductive hormones were compared between cultured fish that fail to undergo OM during the spawning season and wild fish captured on their spawning grounds (Mylonas et al., 1997d, 1998b; Steven et al., 2000; Mylonas and Zohar, 2001b). In wild females, a plasma LH surge was observed during OM and ovulation, but in females reared in captivity plasma LH levels remained low at the end of vitellogenesis. However, LH was synthesized and stored in the pituitary during vitellogenesis, since levels of LH and its mRNA in the pituitary did not differ between wild and captive females, demonstrating that the problem is one of lack of release and not synthesis in captivity. In addition, mRNA levels of the pituitary receptor for the GnRH most relevant to pituitary LH synthesis were similar between wild and captive females. This suggests that the disruption in LH release from the pituitaries of captive fish is not due to a dysfunction in pituitary responsiveness, but may be related to the control of pituitary function by the reproductive brain. In fact, differences were observed between wild and captive females undergoing OM, when comparing the pituitary content of the endogenous GnRHs. The GnRH mRNA levels within the brain, however, were similar between the two groups, indicating that the altered pituitary content of GnRH in captive fish may be a result of altered release from the hypothalamus, rather than deficient synthesis (Steven, 2000; Steven et al., 2000). Similarly in males, lower plasma levels of LH during the spermiation period have been suggested as the cause of the reduced amount of milt produced by some fishes (Mylonas and Zohar, 2001b; Mañanos et al., 2002). As with females, the amount of LH in the pituitary or the ability of the pituitary to synthesize LH in response to treatment with exogenous GnRHa is not affected in these fishes, suggesting that again the reproductive dysfunction in the males may be identified in the brain control of GtH synthesis and/or release.
4.4 Hormonal therapies for the control of reproduction Based on the accumulating evidence that the failure of fishes to undergo OM and full spermiation in captivity is the result of diminished LH release
Controlling fish reproduction in aquaculture
119
♀♂
Hormonal induction of oocyte maturation & spermiation Brain
GnRH GnRHa
LH
Pituitary
LH
Gonads
Sex steroids
Oocyte maturation-spermiation
Fig. 4.5 Schematic representation of the dysfunction in the reproductive axis of cultured fishes, and the exogenous hormonal interventions for the induction of oocyte maturation and spermiation.
from the pituitary, manipulations of reproductive function in cultured fishes have focused on the use of either exogenous LH preparations that act directly at the level of the gonad, or GnRHa that acts at the level of the pituitary to induce release of the endogenous LH stores (Fig. 4.5). Endogenous LH, in turn, acts at the level of the gonad to induce steroidogenesis and the process of OM and spermiation.
4.4.1 Gonadotropin preparations Gonadotropin preparations include pituitary homogenates and pituitary extracts (PE) that contain LH (as well as other pituitary hormones), purified piscine LH or purified human chorionic gonadotropin (hCG), which has very strong LH activity (Lam, 1982; Donaldson and Hunter, 1983; Zohar, 1989; Zohar and Mylonas, 2001b). The main advantage of GtH preparations is that they act directly at the level of the gonad. Pituitary homogenates were the first type of exogenous hormonal treatments used by aquaculturists for the induction of maturation and spawning (Houssay, 1930; Von Ihering, 1937; Fontenele, 1955). Today, preparations of carp pituitary extract (CPE) and purified salmon GtH are available commercially and are used worldwide. These purified PE are more effective than the earlier pituitary homogenates, since they are purified to various extents and their activity is usually calibrated using bioassays (Yaron, 1995; Donaldson, 1973). Nevertheless, they still maintain the disadvantages of risking pathogen transmissions, as well as a high degree of species
120
New technologies in aquaculture
specificity, due to the significant differences in the primary structure of fish GtH (Rosenfeld et al., 2007). Treatments with pituitary homogenates and PE are usually split into a smaller priming dose (10–20 % of total) and a larger resolving dose given 12–24 h apart (Thalathiah et al., 1988; Parauka et al., 1991; Kucharczyk et al., 1997; Chen, 2005). Human CG has also been used extensively in hormonal manipulation of reproduction in fishes, as it has been available throughout the world for some time now, and it is purified and of clinical grade and standardized bioactivity. Unlike GtH preparations of piscine origin, hCG is most often effective in a single dose (100 and 4000 IU Kg−1), presumably due to its long residence time in circulation (Ohta and Tanaka, 1997). This is unrelated to its heterologous nature in fish, since it has been shown to have a significantly longer halflife compared to the pituitary GtHs both in fish (Fontaine et al., 1984) and humans (Ludwig et al., 2002). Recently, an hCG preparation has been approved for commercial utilization in commercial aquaculture (CHORULONTM, Intervet International bv, The Netherlands).
4.4.2 Gonadotropin-releasing hormone agonists The use of GnRHas for spawning induction therapies has important advantages over the use of GtH preparations. Firstly, being of synthetic nature, GnRHas do not pose a disease transmission threat, as pituitary homogenates or extracts may do. Secondly, GnRHa treatments are less speciesspecific than GtH ones, due to the high structural similarity of native GnRHs among fishes (Lethimonier et al., 2004). Thirdly, and perhaps most importantly, GnRHas stimulate the release of the endogenous GtHs and other necessary pituitary hormones (Le Gac et al., 1993; Weber et al., 1995; Cyr and Eales, 1996; Negatu et al., 1998), and thus they provide for a better integration of reproductive processes by acting at a higher level of the brain–pituitary–gonad axis. Although hundreds of different GnRHas are available, the only approved GnRHa for use in commercial aquaculture is Azagly-nafarelin (GONAZONTM, Intervet International bv, The Netherlands), which has so far been shown to be efficacious only in salmonids (Haffray et al., 2005). As mentioned earlier, in some fishes there is a strong inhibition of basal and GnRH-stimulated release of LH by DA. Therefore, administration of DA antagonists prior to the treatment with GnRHa removes the inhibition on the gonadotrophs and enhances the stimulatory effect of GnRHa on LH release. Currently, hormonal manipulations of reproduction using a combined GnRHa/DA antagonist treatment are used mostly in cyprinids (Yaron, 1995; Mikolajczyk et al., 2003, 2004; Kaminski et al., 2004), catfishes (Silverstein et al., 1999; Brzuska, 2001; Wen and Lin, 2004) and mullets (Glubokov et al., 1994; Arabaci and Sari, 2004; Aizen et al., 2005). There are several DA antagonists available in the market that
Controlling fish reproduction in aquaculture
121
proved to be useful for hormone treatments in aquaculture (i.e., domperidone, pimozide, reserpine and metoclopramide); these are usually administered as a liquid solution injected prior to, or at the same time as the GnRHa treatment.
4.4.3 Sustained-release delivery systems It was recognized almost from the first spawning induction experiment (Fontenele, 1955), that sustained administration of the hormone would result in improved efficacy. This is because the processes of OM and spermiation often require a prolonged treatment with exogenous hormones, given in multiple injections (Mylonas et al., 1992; Dabrowski et al., 1994; Slater et al., 1994, Carrillo et al., 1995, Pankhurst et al., 1996). Such repetitive handling of broodstock requires substantial labor, time and monitoring, and in situations where the broodfish are very large (groupers, amberjacks or tunas) or kept outdoors – in ponds or cages – it is very time-consuming and labor-intensive to crowd, capture, anaesthetize and inject the fish with hormones. Since the 1980s, a variety of hormone-delivery systems, almost exclusively for GnRHa, have been developed for use in a variety of fishes. The first such delivery system was prepared using cholesterol and was tested in Atlantic salmon (Salmo salar) (Weil and Crim, 1983). Cholesterol implants are prepared as solid, cylindrical pellets (3 mm in diameter) and are implanted intramuscularly using an implanter. The next type of GnRHadelivery system was fabricated in the form of microspheres (5–200 μm in diameter), using copolymers of lactic acid and glycolic acid (LGA) (Okada et al., 1994) or a copolymer of fatty acid dimer and sebasic acid (Fad-sa) (Mylonas et al., 1995). For treatment, the microspheres are suspended in a viscous vehicle and are injected into the muscle (Zohar, 1988; Breton et al., 1990; Chang et al., 1995; Mylonas et al., 1997c; Mylonas and Zohar, 2001b; Barbaro et al., 2002). The greatest advantage of biodegradable, microspheric delivery systems is that the same preparation can be used to treat fish with large variations in size. Also, since over time the microspheres degrade to their monomer constituents, which are all natural products – e.g., lactic acid, glycolic acid or sebasic acid – broodstock retired from production can be consumed for food without any concerns over harmful residual chemicals. Another type of GnRHa-delivery system used for spawning induction is prepared in the form of a solid implant, using a non-degradable co-polymer of ethylene and vinyl acetate (EVAc) (Zohar, 1996). In this delivery system, the GnRHa is mixed with an inert bulking agent, and the mixture is entrapped by the EVAc matrix. Upon application, the inert matrix dissolves, carrying with it the GnRHa. The EVAc implants are fabricated as disks 2 or 3 mm in diameter and are administered intramuscularly using an implanter (Mylonas et al., 2007), releasing GnRHa
122
New technologies in aquaculture
for periods from 2–5 weeks (Zohar, 1996; Mylonas et al., 1998b; Mañanos et al., 2002).
4.5 Induction of oocyte maturation and ovulation As mentioned earlier, for the purpose of broodstock management and hormonal manipulation of OM and spawning, fish are separated into two classifications: synchronous spawners (single-time and single-batch group-synchronous) and asynchronous spawners (multiple-batch groupsynchronous and asynchronous) (Tyler and Sumpter, 1996). These differences in reproductive strategies may necessitate the employment of different approaches in terms of hormonal therapy and egg acquisition. For example, single or double injections of GnRHa in liquid form may be effective in synchronous fish (Mylonas et al., 1992), which have all their oocytes developed at the same stage of maturation, but may not be the best approach to achieve maximum fecundity in asynchronous species with a long reproductive season (Zohar et al., 1995). Also, if required, strip spawning and artificial insemination is a good alternative to tank spawning in synchronous fishes, but will result in very poor fecundity in asynchronous species, since the fish ovulate only part of their total season production of vitellogenic oocytes, and the stripping process may damage the remaining oocytes. The use of GtH preparations in inducing OM, ovulation and spawning in synchronous fishes has been summarized well in previous reviews, which report also more extensive information on doses and treatment protocols (Donaldson, 1973; Lam, 1982; Donaldson and Hunter, 1983; Zohar and Mylonas, 2001a; Mañanos et al., 2008). Some more recent examples include the European catfish (Silurus glanis), which was successfully induced to ovulate using 4 mg Kg−1 CPE, though in a smaller percentage of females compared to a combined GnRHa/DA antagonist treatment (Brzuska, 2001). In the Japanese catfish (Silurus asotus), a single injection of 10 000 IU Kg−1 hCG induced OM and ovulation from June to September (Kumakura et al., 2003b). In the Brazilian catfish ‘cachara’ (Pseudoplatystoma fasciatum), both CPE and hCG were effective in inducing ovulation (Leonardo et al., 2004). Also, hCG at 1000 or 2000 IU Kg−1 was effective as a single injection in inducing ovulation in the Korean spotted sea bass (Lateolabrax maculatus) (Lee and Yang, 2002). Finally, in wild-caught ocellated puffer (Takifugu ocellatus), both single- and double-injections of 6 mg Kg−1 PE or 2500 IU Kg−1 hCG were very effective in inducing OM and ovulation (Chen, 2005), and in pikeperch (Sander lucioperca), either single or multiple injections of 200 IU Kg−1 hCG were effective in inducing ovulation (Zakes and Szczepkowski, 2004). The continued interest in the control of reproduction of the European eel has resulted in improved knowledge on the dysfunctions of this species
Controlling fish reproduction in aquaculture
123
in culture and has identified some blocks in the endocrine axis. The European eel undergoes gametogenesis during its long migration from European rivers to the Sargasso sea, off the coast of North America (Tesch, 2003). In captivity, the absence of this migration results in the complete absence of both oogenesis and spermatogenesis. Recent research has identified DA as the brain hormone responsible for the blocking of the reproductive axis and the absence of pubertal development (Vidal et al., 2004). Still, however, the only available practical method for the induction of gametogenesis in the freshwater eel is the weekly administration of fish gonadotropin extracts in the female (Ohta et al., 1997; Sato et al., 1997; Pedersen, 2003; Palstra et al., 2005) and one or two injections of the same gonadotropin or of hCG in the male (Miura et al., 1991a; Ohta et al., 1996; Ohta and Tanaka, 1997). Oocyte maturation is induced by the administration of the MIH, eggs and sperm are collected by stripping, and fertilization is accomplished artificially (Pedersen, 2004). A very promising new way to induce gametogenesis in the European eel is currently undergoing development (Guido van den Thillart and Herman Spaink, unpublished data), and employs genetically engineered zebrafish cell lines expressing the genes of zebrafish LH and FSH, controlled by a constitutive promoter. Once implanted subcutaneously to silver migrating eels, such cells are shown to produce continuously the two zf-GtHs, thus stimulating gonadogenesis. The development of this method will alleviate the need for multiple injections of heterologous hormones and will probably increase the effectiveness of maturation induction approaches in the freshwater eels. The synchronization of ovulation in salmonids was one of the very first applications of GnRHa in aquaculture (Donaldson et al., 1981; Crim and Glebe, 1984; Breton et al., 1990). The treatment is usually given in the form of two injections (10–100 μg Kg−1) spaced 3 d apart or a single application of a GnRHa-delivery system (10–50 μg Kg−1), given around two weeks before the onset of natural maturation of the broodstock. The two-injection (Van Der Kraak et al., 1985; Sullivan et al., 1989; Mylonas et al., 1992) and GnRHa-delivery system protocols (Crim et al., 1983; Crim and Glebe, 1984; Breton et al., 1990; Goren et al., 1995) induce ovulation in 100 % of the stock within two weeks after treatment. Single or multiple injections of GnRHa have also been used extensively in other synchronous fishes. When a two-injection protocol is used, GnRHa is given in a priming (5–10 %) and resolving dose (95–90 %), and if a DA antagonist is also used it is given with the priming dose. For example, in the ocellated puffer both single and double injections of 50 μg Kg−1 GnRHa were effective in inducing OM (Chen, 2005), while similar results were obtained using 2–4 injections of GnRHa in the bullseye puffer (Spoeroides annulatus) (Duncan et al., 2003). In the grey mullet, two injections of 30 μg Kg−1 GnRHa together with 15 mg Kg−1 metoclopramide were very effective in inducing spawning within 24 h (Aizen et al., 2005). Similarly, two injections of
124
New technologies in aquaculture
20 μg Kg−1 GnRHa with 5 mg Kg−1 pimozide induced ovulation in 95 % of treated common carp (Cyprinus carpio) (Mikolajczyk et al., 2004). Two injections of GnRHa in combination with a DA antagonist have been used successfully also in the koi carp (Cyprinus carpio) (Arabaci et al., 2004), lake mullet (Chalcalburnus tarichi) (Arabaci and Sari, 2004) and wild catfish (Silurus asorus) (Wen and Lin, 2004). Finally, a single injection of 20 μg Kg−1 GnRHa induced ovulation in tench (Tinca tinca) (Rodríguez et al., 2004). Sturgeon (Acipenser spp.) aquaculture for meat and caviar relies exclusively on the use of hormonal spawning induction methods and the artificial fertilization of the obtained eggs. Sturgeon females are evaluated for the completion of vitellogenesis and the extent of the migration of the nucleus (polarization index, PI) by laparoscopic (Hurvitz et al., 2007) or surgical removal of oocytes from the ovary and their in vitro processing (Williot et al., 1991; Conte et al., 1988). The selected mature females may be given sturgeon pituitary extract, carp pituitary extract or, more recently, GnRHa (Webb et al., 1999; Chebanov and Billard, 2001; Williot et al., 2001, 2002; Burtsev et al., 2002; Zhuang et al., 2002), usually in priming and resolving injections spaced 10–24 h apart, and ovulation is accomplished 24–50 h afterwards. Single treatments with carp pituitary homogenate have also been reported to be effective (Williot et al., 2005). Acquisition of eggs is done using caesarian surgery or, more recently, by inserting a scalpel into the abdominal pore and making a small incision at the basal part of the oviducts (Chebanov and Billard, 2001). Sperm can be used fresh or cryopreserved (Billard et al., 2004) and the amount of sperm produced may also be enhanced using GnRHa-based hormonal therapies (Williot et al., 2002). The greater efficacy of GnRHa-delivery systems in inducing OM in synchronous fishes has been demonstrated well since the mid-1990s (Mylonas and Zohar, 2001a, 2007). A GnRHa-delivery system was the only hormonal preparation able to induce spawning in the yaqui catfish (Ictalurus pricei), whereas combined sGnRHa/DA antagonist or catfish PE treatments were ineffective (Mylonas and Zohar, 2001a). In the tiger puffer (Takifugu rubripes), GnRHa-delivery systems (400 μg Kg−1) induced ovulation in 18 and 10 d in fish with mean oocyte diameter of 800–900 μm and 900–1000 μm, respectively (Matsuyama et al., 1997). Other examples of applications in synchronous fishes include the bullseye puffer (Duncan et al., 2003), cobia (Rachycentron canadum) (Kilduff et al., 2002), devil stinger (Inimicus japonicus) (Takushima et al., 2003) and common carp (Brzuska and Bialowas, 2002). GnRHa-delivery systems have been used in preference to liquid injections in a variety of asynchronous fishes. For example, GnRHa-delivery systems induced two consecutive spawns within 3 d in white bass (M. chrysops) (Mylonas et al., 1997b) and greater amberjack (Seriola dumenili)
Controlling fish reproduction in aquaculture
125
(Mylonas et al., 2004c), five spawns within 7 d in the barramundi (Lates calcarifer) (Almendras et al., 1988), five ovulations within two weeks in striped trumpeter (Latris lineate) (Morehead et al., 1998), one to four ovulations within 7 d in the black sea bass (Centropristis striata) (Watanabe et al., 2003) and seven ovulations within 10 d in the dusky grouper (E. marginatus) (Marino et al., 2003). The greatest potential, however, of sustained-release GnRHa-delivery systems is in the induction of OM in asynchronous fishes with a daily or almost daily ovulation/spawning frequency. For example, the red porgy (Pagrus pagrus), red seabream (P. major) and gilthead seabream (Sparus aurata) have an asynchronous mode of ovarian development and are capable of undergoing OM and spawning on a 24 h cycle for periods up to four months (Watanabe and Kiron, 1995; Zohar et al., 1995; Mylonas et al., 2004b). A single GnRHa injection in the gilthead seabream induced daily spawning in only 20 % of the stock, while a GnRHadelivery system induced daily spawning in >70 % of treated females. Similar results have been obtained with the other two sparids (Matsuyama et al., 1995; Zohar and Mylonas, 2001a). Thus, GnRHa-delivery systems result in significant increases in fecundity, by increasing the number of broodfish undergoing OM, and the number of ovulations per spawning season (Barbaro et al., 2002). The latest success of the GnRHa-delivery systems has been in the induction of OM, ovulation and spawning in cage-cultured Atlantic bluefin tuna (Thunnus thynnus) (Mylonas et al., 2007) and tankcultured Southern bluefin tuna (T. maccoyii) (M. Deichmann, Clean Seas Tuna Ltd, personal communication), which resulted in the production of fertilized eggs and viable larvae. Due to the inability of anaesthetizing bluefin tunas and the great difficulties in handling such large (60–120 Kg) and fast swimming pelagic fishes, GnRHa administration was done underwater in free swimming fish (Mylonas et al., 2007). It is expected that this method will continue to be used as the standard for the induction of spawning in captive-reared Atlantic bluefin tuna, until such time as land-based facilities are build or appropriate sea-cage sites are identified, which can reproduce the optimal environmental conditions necessary for reproductive maturation and spawning (e.g., temperature-photoperiod combination, water quality, etc.). Recently, the use of these GnRHa-delivery systems has induced spawning for four consecutive days in a captive-reared stock at Vibo Valentia, Italy, producing many millions of fertilized eggs, allowing the first larval rearing of Atlantic bluefin tuna in the Mediterranean Sea (G. Demetrio, unpublished data). Finally, GnRHa-delivery systems have been employed with great success in inducing multiple spawnings, often of improved quality compared to the few naturally spawning females, in various flatfishes. For example, GnRHadelivery systems induced daily ovulations in the greenback flounder (Rhombosolea tapirina) (Poortenaar and Pankhurst, 2000), and in wild-caught summer flounder (Paralichthys dentatus) GnRHa implants induced daily
126
New technologies in aquaculture
ovulations for 8 d (Berlinsky et al., 1997), whereas in fish maintained for more than a year in captivity the same treatment induced not only ovulation but also tank spawning (Watanabe et al., 1998). Similarly in turbot (Scophthalmus maximus), treatment with a GnRHa-delivery system induced multiple ovulations in 100 % of treated fish compared to 50 % of controls (Mugnier et al., 2000). Also, in the yellowtail flounder (Pleuronectes ferrugineus) different GnRHa-delivery systems induced an average of eight consecutive ovulations, compared to three in control fish, resulting in the production of twice as many eggs and of higher fertilization and hatching percentage than control females (Larsson et al., 1997). The same two GnRHa-delivery systems have also induced daily spawnings for up to two weeks in the Senegal sole (Solea senegalensis), though with very limited fertilization success (Agulleiro et al., 2006; Guzmán et al., 2008).
4.6 Induction of spermiation As mentioned earlier, the dysfunction observed in cultured male fishes is not the absence of any stage of testicular development, but rather a reduction in the spermiation process and the production of expressible milt. Due to the long-term nature of the process of spermatogenesis and spermiation – as opposed to OM in females – long-term hormonal therapies with GnRHa-delivery systems have proven more effective in enhancing milt production compared to acute treatments with either GtH preparations or GnRHas. For example, in the rabbitfish (Siganus guttatus) milt production increased significantly 24 h after GnRHa injection, but returned to pretreatment levels 48 h later (Garcia, 1991). Sustained elevation of sperm production was maintained for 5 d in carp by daily injections of GnRHa, but 3 d after the treatment was interrupted, milt volume decreased below pre-treatment levels (Takashima et al., 1984). In the winter flounder (Pleuronectes americanus) a single injection did not increase milt production, whereas two injections given 24 h apart induced a significant increase in total expressible milt (Harmin and Crim, 1993). Finally, in the European sea bass (Dicentrarchus labrax) a single injection of GnRHa at the end of the spawning season was effective in maintaining milt volume of stripped males for only 3 d, compared to 17 d of GnRHa implants (Rainis et al., 2003). These results underline the need for a long-term hormonal therapy, in order to induce sustained increases in milt production. Another disadvantage of single hormone injections is that they usually induce only a short-lived elevation of seminal plasma production, with a much smaller increase in spermatozoa production (Clemens and Grant, 1965; Garcia, 1991) and the increase in milt volume is accompanied with significant reductions in sperm density (Takashima et al., 1984; Garcia, 1991). In white bass, treatment with an hCG injection may restore milt
Controlling fish reproduction in aquaculture
127
release in males stripped completely of their milt, but the milt is extremely thin and contains mostly seminal fluid (Bayless, 1972). On the contrary, GnRHa-delivery systems increase milt production significantly, without any decrease in sperm density, motility or fertilizing ability of the spermatozoa (Mylonas et al., 1997a). Many different GnRHa-delivery systems have been used to enhance spermiation in cultured fishes and beginning with salmonid species such as Atlantic salmon (Zohar, 1996; Weil and Crim, 1983), rainbow trout (Oncorhynchus mykiss) (Breton et al., 1990), chinook salmon (O. tshawystcha) (Solar et al., 1995), coho salmon (O. kisutch) (Goren et al., 1995). GnRHa-delivery systems have also been very effective in basses of the Moronidae family. For example, in the European seabass at the peak of the spawning season, a single injection of GnRHa induced increases in milt production for 7 d only, whereas treatment with GnRHa-delivery systems resulted in increased milt production for 28–35 d (Mañanos et al., 2002). Also in the striped bass, GnRHa-delivery systems induced long-term increases in milt production, lasting for 14–20 d (Mylonas et al., 1997c; Mylonas et al., 1998a). GnRHa implants have also been used in Atlantic halibut (Hippoglossus hippoglossus) to enhance the quality of the sperm (Vermeirssen et al., 2003), in starry flounder (Platichthys stellatus) to increase milt volume and sperm density (Moon et al., 2003) and in greenback flounder to increase sperm volume (Lim et al., 2004). Still, in some species simple injections of GnRHa of GtH preparations have been employed for the successful enhancement of spermiation, such as the Siberian sturgeon (A. baerii) (Williot et al., 2002), the sterlet (Acipenser ruthenus) (Rzemieniecki et al., 2004), the precocious European sea bass (Schiavone et al., 2006) and the minnow (Rhynchocypris oxycephalus) (Park et al., 2002).
4.7 Spontaneous spawning versus artificial insemination Hormonal induction of OM and spermiation does not ensure spawning of the fish – i.e., release of their gametes – in a timely and synchronous way so that fertilized eggs are produced. This may be due to inappropriate tank size, lack of bottom substrate for the preparation of a nest or plant substrate for the adhesion of the eggs, and possibly other reasons that are not yet known. Therefore, for some species it is also necessary to employ artificial gamete collection and fertilization, using strip spawning. Such species include all salmonids, sturgeons and various carps, groupers and flatfishes. In these situations, it is important to establish with varying degrees of accuracy the time of ovulation after the hormonal treatment. This is because once the eggs are ovulated into the ovarian or abdominal cavity, they begin to lose their viability in a species- and temperaturedependent process that may last from minutes (e.g., Moronidae) to days
128
New technologies in aquaculture
(Salmonidae). Failure to strip the eggs within the appropriate time interval after hormonal stimulation will result in greatly reduced fertilization success. The same is not true for sperm collection, which can be done at any time after hormonal stimulation. In addition, sperm from most fishes can be kept viable without the use of cryopreservation or extenders from many hours (Rainis et al., 2003) to many days (Mylonas et al., 2003; Papadaki et al., 2008). Therefore, a typical artificial insemination protocol should plan for (i) collection and storage of sperm a few hours before the expected time of ovulation and (ii) stripping of the eggs at the appropriate time after hormonal therapy. This procedure will ensure optimal results in fertilization success.
4.8 Future trends Basic studies of fish reproductive physiology and endocrinology, in combination with functional genomics and modern tools of biotechnology, will lead to more precise and efficient control of reproduction in farmed fish and to better supplies of optimal quality seed. It is clear from the present review that GnRHs are of considerable importance to normal and induced gametogenesis in farmed fish. Understanding the environmental and endocrine regulation of GnRH gene expression is key to developing strategies for overcoming the GnRH failure that results in the lack of OM, ovulation and spawning in captive fish. More studies on the functional significance of GnRH multiplicity will lead to better tailored GnRH-based spawning induction technologies that will administer or manipulate the relevant, physiological combination of GnRH forms. In addition, the discovery and understanding of factors that control the early establishment of the GnRH system can be used to develop new approaches to induce sterility or precocious puberty in farmed fish. The introduction of zebrafish as a model for the study of the GnRH system (Steven et al., 2003; Palevitch et al., 2007) and the recent development of transgenic zebrafish expressing a green fluorescent protein (GFP) reporter gene under control of the GnRH promoter (Abraham et al., 2008) provide very powerful tools for improving our understanding of how the GnRH system is regulated in fish. Using these tools, simple manipulations of GnRH neuronal development and GnRH synthesis and release may be developed in the future to control the onset of puberty and induce oocyte maturation, ovulation and spawning. To be successful, exogenous application of GnRHa and other hormonal preparations in spawning induction therapies must be precisely synchronized with the acquisition of follicular maturational and ovulatory competence. Fish that are treated too early or too late will either not spawn or spawn unfertilizable or poor quality eggs. In most cases, prediction of
Controlling fish reproduction in aquaculture
129
‘readiness’ of the female for spawning induction is determined based on ovarian biopsy and measurement of oocyte diameter and/or microscopic observation of morphological characteristics of the oocytes, such as GV migration or occurrence of atresia. Although it has been standard practice for decades, the ovarian biopsy method is not ideal, as it is stressful to the fish, impossible to conduct on small (such as ornamental fishes) or very large (such as bluefin tuna) species, and not very accurate. The field of spawning induction needs non-invasive and more precise methods to determine the readiness of the female, as well as to predict and optimize the success of the spawning induction treatment. Many hormones and other factors are involved in the process of acquiring ovarian maturational competence, and these may be used as precise indicators of its progress (Patiño et al., 2001). Determining which factors are relevant and best suited as indicators will be greatly facilitated using genomics and proteomics information, and several recent studies have used this approach (Bobe et al., 2004; Aegerter et al., 2005; von Schalburg et al., 2005; Bonnet et al., 2007). More work needs to be done in order to fully exploit this approach in fish and develop DNA or molecule microarrays in order to efficiently and comprehensively assess spawning readiness in aquacultured species. In addition, significant effort has been devoted to developing methodologies that measure reproductive indicators, such as steroids and vtg, using mucous or muscle samples (Bridges et al., 2003; Susca et al., 2001). Application of novel and non-invasive sampling modalities, together with the development of fish ‘gene chips’ for reproductive factors, will undoubtedly lead to the future use of such approaches to optimize the timing and enhance the success of spawning manipulation in farmed fish. Finally, recent research has established a new paradigm for fish reproductive endocrinology. The simplistic partitional view of the brain– pituitary–gonadal axis has been replaced by a more complex and integrated web of endocrine interactions. The multiple brain GnRHs and their receptors were shown to be expressed locally in the pituitary (Mohamed et al., 2005) and gonads (Lin and Peter, 1996; Gray et al., 2002; Uzbekova et al., 2002; Soverchia et al., 2007). In both the ovary and testis of fish, GnRH has been demonstrated to directly affect gamete development and maturation (Habibi et al., 1988; Gazourian et al., 1997; Pati and Habibi, 2000; Soverchia et al., 2007). Likewise, the pituitary gonadotropins were shown to be expressed locally in the gonads, and this expression is regulated by GnRH (Wong et al., 2004). The occurrence of a complete GnRH–GtH–steroid axis within the fish gonads should be considered when hormonally manipulating reproduction and inducing spawning, as its balanced expression may be critical to the production of highest quality gametes and embryos. Thus, a more complete understanding of how the entire endocrine–reproductive axis is coordinated in fish is expected to lead to better application of
130
New technologies in aquaculture
spawning manipulation protocols and optimization of seed production in aquaculture.
4.9 Sources of further information and advice Further information in this subject can be obtained in recent reviews (Schulz and Miura, 2002; Miura and Miura, 2003; Mylonas and Zohar, 2007; Mañanos et al., 2008). Information on fish reproduction in general can also be obtained from the website REPROFISH (www.reprofish.eu), a website established currently in Europe, with the objective of acting as a portal for students, scientists and professionals interested in fish reproduction and its control. Through the site, the interested professional can access scientific articles and protocols related to the control of reproduction in fish under culture conditions. Also, articles related to fish reproduction and its control are published in the proceedings of the International Symposium on Fish Reproductive Physiology and the International Symposium on Fish Endocrinology, which take place once every four years. Journals such as Aquaculture, Aquaculture Research, Fish Physiology and Biochemistry, General and Comparative Endocrinology and Biology of Reproduction publish many articles related to fish reproduction.
4.10 References abraham, e, palevitch o, ijiri s, du s-j, gothilf y and zohar y (2008) Early development of gonadotrophin-releasing hormone-I neurones and the role of GnRH-I as an autocrine migration factor, J Neuroendocrinol, 20, 394–405. aegerter, s, jalabert b and bobe j (2005) Large scale-real-time PCR analysis of mRNA abundance in rainbow trout eggs in relationship with egg quality and post-ovulatory ageing, Mol Reprod Dev, 2, 377–85. agulleiro, m j, anguis v, cañavate j p, martínez-rodríguez g, mylonas c c and cerdá j (2006) Induction of spawning of captive-reared Senegal sole (Solea senegalensis) using different administration methods for gonadotropin-releasing hormone agonist, Aquaculture, 257, 511–24. aizen, j, meiri i, tzchori i, levavi-sivan b and rosenfeld h (2005) Enhancing spawning in the grey mullet (Mugil cephalus) by removal of dopaminergic inhibition, Gen Comp Endocrinol, 142, 212–21. almendras, j m, duenas c, nacario j, sherwood n m and crim l w (1988) Sustained hormone release. III. Use of gonadotropin releasing hormone analogues to induce multiple spawnings in sea bass, Lates calcarifer, Aquaculture, 74, 97–111. arabaci, m and sari m (2004) Induction of ovulation in endemic pearl mullet (Chalcalburnus tarichi), living in the highly alkaline Lake Van, using GnRHa ([d-Ser(tBu)6, Pro9-NEt]-GnRH) combined with haloperidol, Aquaculture, 238, 529–35.
Controlling fish reproduction in aquaculture
131
arabaci, m, cagirgan h and sari m (2004) Induction of ovulation in ornamental common carp (Koi, Cyprinus carpio L.) using LHRHa ([d-Ser(tBu)6, Pro9-NEt]LHRH) combined with haloperidol and carp pituitary extract, Aquac Res, 35, 10–14. barbaro, a, franceson a, bertotto d, bozzato g, di maria i, patarnello p, furlan f and colombo l (2002) More effective induction of spawning with long-acting GnRH agonist in the shi drum, Umbrina cirrosa L. (Sciaenidae, Teleostei), a valuable candidate for Mediterranean mariculture, J Appl Ichthyol, 18, 192–9. bayless, j d (1972) Artificial Propagation and Hybridization of Striped bass, Morone saxatilis (Walbaum), Columbia, SC, South Carolina Wildlife and Marine Resources Department. berlinsky, d l, king w v, smith t i j, hamilton r d, ii, holloway j, jr and sullivan c v (1996) Induced ovulation of Southern flounder Paralichthys lethostigma using gonadotropin releasing hormone analogue implants, J World Aquac Soc, 27, 143–52. berlinsky, d l, william k, hodson r g and sullivan c v (1997) Hormone induced spawning of summer flounder Paralichthys dentatus, J World Aquac Soc, 28, 79–86. billard, r (1986) Spermatogenesis and spermatology of some teleost fish species, Reprod Nutr Develop, 26, 877–920. billard, r, cosson j, crim l w and suquet m (1995) Sperm physiology and quality, in Bromage N R and Roberts R J (eds), Broodstock Management and Egg and Larval Quality, Oxford, Blackwell Science, 25–52. billard, r, cosson j, noveiri s b and pourkazemi m (2004) Cryopreservation and short-term storage of sturgeon sperm, a review, Aquaculture, 236, 1–9. bobe, j, nguyen t and jalabert b (2004) Targeted gene expression profiling in the rainbow trout (Oncorhynchus mykiss) ovary during maturational competence acquisition and oocyte maturation, Biol Reprod, 71, 73–82. breton, b, weil c, sambroni e and zohar y (1990) Effects of acute versus sustained administration of GnRHa on GtH release and ovulation in the rainbow trout, Oncorhyncus mykiss, Aquaculture, 91, 371–83. bonnet, e, fostier a and bobe j (2007) Microarray-based analysis of fish egg quality after natural or controlled ovulation, BMC Genomics, 8, 55. bridges c r, susca v, eicker j, corriero a, de metrio g, megalofonou p, de la serna j-m and kime d (2003) Fishy business in the Mediterranean – tuna, tonnara and testosterone, in Bridges C R, Gordin H and Garcia A (eds), Cahiers Options Méditerranéennes, Vol. 60: Domestication of the bluefin tuna Thunnus thynnus thynnus, CIHEAM, Zaragoza, 33–5. bromage, n r and cumaranatunga r (1988) Egg production in the rainbow trout, in Muir J F and Roberts R J (eds), Recent Advances in Aquaculture, London, Croom Helm/Timber Press Inc., 63–138. bromage, n, jones j, randall c, thrush m, springate j, duston j and barker g (1992) Broodstock management, fecundity, egg quality and the timing of egg production in the rainbow trout (Oncorhynchus mykiss), Aquaculture, 100, 141–66. brzuska, e (2001) Artificial spawning of European catfish Silurus glanis L.: differences between propagation results after stimulation of ovulation with carp pituitary and Ovopel, Aquac Int, 32, 11–19. brzuska, e and bialowas h (2002) Artificial spawning of carp, Cyprinus carpio (L.), Aqua Res, 33, 753–65. burtsev, i a, nikolaev a i, maltsev s a and igumnova l v (2002) Formation of domesticated broodstocks as a guarantee of sustainable hatchery reproduction of sturgeon for sea ranching, J Appl Ichthyol, 18, 655–8.
132
New technologies in aquaculture
carrillo, m, zanuy s, prat f, cerda j, ramos j, mañanos e and bromage n (1995) Sea bass (Dicentrarchus labrax), in Bromage N R and Roberts R J (eds), Broodstock Management and Egg and Larval Quality, Oxford, Blackwell Science, 138–68. cerdá, j, fabra m and raldúa d (2007) Physiological and molecular basis of fish oocyte hydration, in Babin P J, Cerdá J and Lubzens E (eds), The Fish Oocyte: from Basic Studies to Biotechnological Application, Dordrecht, Kluwer Academic, 349–96. chang, c f, yueh w s, lee m f and schally a v (1995) A microencapsulated analog of LH-RH accelerates maturation but without stimulating sex reversal in the protandrous black porgy, Acanthopagrus schlegeli, Reprod Nutr Develop, 35, 339–49. chebanov, m and billard r (2001) The culture of sturgeons in Russia: production of juveniles for stocking and meat for human consumption, Aquat Living Resour, 14, 375–81. chen, y f (2005) Induced ovulation and embryonic development of ocellated puffer, Takifugu ocellatus, J Appl Ichthyol, 21, 136–40. clemens, h p and grant f b (1965) The seminal thinning response in carp (Cyprinus carpio) and rainbow trout (Salmo gairdneri) after injections of pituitary extracts, Copeia, 1965, 174–7. conte, f s, doroshov s i, lutes p b and strange e m (1988) Hatchery manual for the white sturgeon (Acipenser transmontanus Richardson) with application to other North American Acipenseridae, Cooperative Extension University of California, Division of Agriculture and Natural Resources. copeland, p a and thomas p (1989) Control of gonadotropin release in the Atlantic croaker (Micropogonias undulatus): evidence for lack of dopaminergic inhibition, Gen Comp Endocrinol, 74, 474–83. corriero, a, medina a, mylonas c c, abascal f j, deflorio m, aragón l, bridges c r, santamaria c a, heinisch g, vassallo-agius r, belmonte a, fauvel c, garcia a, gordin h and de metrio g (2007) Histological study of the effects of treatment with gonadotropin-releasing hormone agonist (GnRHa) on the reproductive maturation of captive-reared Atlantic bluefin tuna (Thunnus thynnus L.), Aquaculture, 272, 675–86. crim, l w and glebe b d (1984) Advancement and synchrony of ovulation in Atlantic salmon with pelleted LHRH analog, Aquaculture, 43, 47–56. crim, l w, evans d m and vickery b h (1983) Manipulation of the seasonal reproductive cycle of the landlocked Atlantic salmon (Salmo salar) by LHRH analogues administered at various stages of gonadal development, Can J Aquat Fish Sci, 40, 61–7. cyr, d g and eales j g (1996) Interrelationships between thyroidal and reproductive endocrine systems in fish, Rev Fish Biol Fish, 6, 165–200. dabrowski, k, ciereszko a, ramseyer l, culver d and kestemont p (1994) Effects of hormonal treatment on induced spermiation and ovulation in the yellow perch (Perca flavescens), Aquaculture, 120, 171–80. donaldson, e m (1973) Reproductive endocrinology of fishes, Amer Zool, 13, 909–27. donaldson, e m and hunter g a (1983) Induced final maturation, ovulation and spermiation in cultured fishes, in Hoar W S, Randall D J and Donaldson E M (eds), Fish Physiology, Orlando, FL, Academic Press, 351–403. donaldson, e m, hunter g a and dye h m (1981) Induced ovulation in coho salmon (Oncorhynchus kisutch). II. Preliminary study of the use of LH-RH and two high potency LH-RH analogues, Aquaculture, 26, 129–41. dufour, s, weltzien f, m.e. s, le belle n, vidal b, vernier p and pasqualini c (2005) Dopaminergic inhibition of reproduction in teleost fishes, Annals of the New York Academy of Science, 1040, 9–21.
Controlling fish reproduction in aquaculture
133
duncan, n j, rodriguez m. de o. g a, alok d and zohar y (2003) Effects of controlled delivery and acute injections of LHRHa on bullseye puffer fish (Sphoeroides annulatus) spawning, Aquaculture, 218, 625–35. fauvel, c, savoye o, dreanno c, cosson j and suquet m (1999) Characteristics of sperm of captive seabass in relation to its fertilization potential, J Fish Biol, 54, 356–69. fauvel, c, suquet m, sévère a, mylonas c c and papandroulakis n (2007) Slowrelease GnRHa therapy prevented atresia during vitellogenesis and induced ovulation of captive wreckfish (Polyprion americanus), Cybium, 32, 191. fontaine, y a, dufour s, tanguy g, khan i a, cedard l and leloup-hatey j (1984) Clairances metaboliques de la gonadotropine chorionique humaine (hCG) et de la gonadotropin de carpe (cGtH) chez un poisson teleosteen, l’anguille, Colloque Physiologie des Poissons, INRA and IFREMER. fontenele, o (1955) Injecting pituitary (hypophyseal) hormones into fish to induce spawning, Prog Fish-Cult, 18, 71–5. garcia, l m b (1991) Spermiation response of mature rabbitfish, Siganus guttatus Bloch, to luteinizing hormone-releasing hormone analogue (LHRHa) injection, Aquaculture, 97, 291–9. gazourian, l, deragon k l, chase c f, pati d, habibi h r and sower s a (1997) Characteristics of GnRH binding in the gonads and effects of lamprey GnRH-I and -III on reproduction in the adult sea lamprey, Gen Comp Endocrinol, 108, 327–39. glubokov, a i, kouril j, mikodina e v and barth t (1994) Effects of synthetic GnRH analogues and dopamine antagonists on the maturation of Pacific mullet, Mugil so-iuy Bas, Aquac Fish Man, 25, 419–25. goren, a, gustafson h and doering d (1995) Field trials demonstrate the efficacy and commercial benefit of a GnRHa implant to control ovulation and spermiation in salmonids, in Goetz F W and Thomas P (eds), Reproductive Physiology of Fish, Austin, TX, Fish Symposium 95, 99–101. gothilf, y, muñoz-cueto j a, sagrillo c a, selmanoff m, chen t t, kah o, elizur a and zohar y (1996) Three forms of gonadotropin-releasing hormone in a perciform fish (Sparus aurata): complementary deoxyribonucleic acid characterization and brain localization, Biol Reprod, 55, 636–45. gothilf, y, meiri i, elizur a and zohar y (1997) Preovulatory changes in the levels of three gonadotropin-releasing hormone-encoding messenger ribonucleic acids (mRNAs), gonadotropin ß-subunit mRNAs, plasma gonadotropin, and steroids in the female gilthead seabream, Sparus aurata, Biol Reprod, 57, 1145–54. gray, s l, adams b a, warby c m, von schalburg k r and sherwood n m (2002) Transcription and translation of the salmon gonadotropin-releasing hormone genes in brain and gonads of sexually maturing rainbow trout (Oncorhynchus mykiss), Biol Reprod, 67, 1621–7. guraya, s s (1986) The cell and molecular biology of fish oogenesis, in Sauer H W (ed.), Monographs in Developmental Biology, Basel, Karger, 1–223. guzmán, j m, norberg b, ramos j, mylonas c c and mañanos e (2008) Vitellogenin, steroid plasma levels and spawning performance of cultured Senegalese sole (Solea senegalensis), Gen Comp Endocrinol, 156, 285–97. habibi, h r, van der kraak g, bulanski e and peter r e (1988) Effect of GnRH on reinitiation of oocyte meiosis in goldfish, in vitro, Am J Physiol, 255, R268–R273. haffray, p, enright w j, driancourt m a, mikolajczyk t, rault p and breton b (2005) Optimization of breeding of salmonids: GonazonTM, the first officially approved inducer of ovulation in the EU, Aquaculture Magazine, March, 52–6. harmin, s a and crim l w (1993) Influence of gonadotropin hormone-releasing hormone analog (GnRH-A) on plasma sex steroid profiles and milt production
134
New technologies in aquaculture
in male winter flounder, Pseudopleuronectes americanus (Walbaum), Fish Physiol Biochem, 10, 399–407. holland, m c, hassin s and zohar y (2001) Seasonal fluctuations in pituitary levels of the three forms of gonadotropin-releasing hormone in striped bass, Morone saxatilis (Teleostei), during juvenile and pubertal development, J Endocrinol, 169, 527–38. houssay, b a (1930) Accion sexual de la hipofisis en los peces y reptiles, Rev Soc Arg Biol, 106, 686–8. hurvitz, a, jackson k, degani g and levavi-sivan b (2007) Use of endoscopy for gender and ovarian stage determinations in Russian sturgeon (Acipenser gueldestaedtii) grown in aquauculture, Aquaculture, 270, 158–66. ibarra-castro, l, dumas s and duncan n (2004) Gonad development and LHRHa induced spawning in female rosey spotted snapper Lutjanus gutattus, 5th International Symposium on Fish Endocrinology, 5–9 September Castellon. jackson, l f and sullivan c v (1995) Reproduction of white perch: the annual gametogenic cycle, Trans Am Fish Soc, 124, 563–77. kaminski, r, kusznierz j, myszkowski l and wolnicki j (2004) The first attempt to artificially reproduce the endangered cyprinid lake minnow Eupallasella perenurus (Pallas), Aquac Int, 12, 3–10. kilduff, p, dupaul w, oesterling m, olney j, jr and tellock j (2002) Induced spawning of cobia, Rachycentron canadum, and early larval husbandry, World Aquac, 33, 35–8. kirk, r (1987) A History of Marine Fish Culture in Europe and North America, Farnham, Fishing News Books Ltd. kobayashi, m, sorensen p w and stacey n (2002) Hormonal and pheromonal control of spawning behavior in the goldfish, Fish Physiol Biochem, 26, 71–84. kucharczyk, d, kujawa r, luczynski m, glogowski j, babiak i and wyszomirska e (1997) Induced spawning in bream, Abramis brama (L.), using carp and bream pituitary extract and hCG, Aquac Res, 28, 139–44. kumakura, n, okuzawa k, gen k and kagawa h (2003a) Effects of gonadotropinreleasing hormone agonist and dopamine antagonist on hypothalamus-pituitarygonadal axis of pre-pubertal female red seabream (Pagrus major), Gen Comp Endocrinol, 131, 264–73. kumakura, n, sakai k and takashima f (2003b) Reproductive cycle and human chorionic gonadotropin-induced ovulation in hatchery reared Japanese catfish Silurus asotus, Fish Sci, 69, 495–504. lam, t j (1982) Applications of endocrinology to fish culture, Can J Aquat Fish Sci, 39, 11–137. larsson, d g j, mylonas c c, zohar y and crim l w (1997) Gonadotropin releasing hormone-analogue (GnRH-A) advances ovulation and improves the reproductive performance of a cold-water batch-spawning teleost, the yellowtail flounder (Pleuronectes ferrugineus), Can J Aquat Fish Sci, 54, 1957–64. le gac, f, blaise o, fostier a, le bail p y, loir m, mourot b and weil c (1993) Growth hormone (GH) and reproduction: a review, Fish Physiol Biochem, 11, 219–32. lee, w-k and yang s-w (2002) Relationship between ovarian development and serum levels of gonadal steroid hormones, and induction of oocyte maturation and ovulation in the cultured female Korean spotted sea bass Lateolabrax maculatus (Jeom-nong-eo), Aquaculture, 207, 169–83. leonardo, a f g, romagosa e, borella m i and batlouni s r (2004) Induced spawning of hatchery-raised Brazilian catfish, cachara Pseudoplatystoma fasciatum (Linnaeus, 1766), Aquaculture, 240, 451–61.
Controlling fish reproduction in aquaculture
135
lethimonier, c, madigou t, munoz-cueto j-a, lareyre j-j and kah o (2004) Evolutionary aspects of GnRHa, GnRH neuronal systems and GnRH receptors in teleost fish, Gen Comp Endocrinol, 135, 1–16. levavi-sivan, b, safarian h, rosenfeld h, elizur a and avitan a (2004) Regulation of gonadotropin-releasing hormone (GnRH)-receptor gene expression in tilapia: effect of GnRH and dopamine, Biol Reprod, 70, 1545–51. liley, n r (1983) Hormones and reproductive behaviour in fishes, in Hoar W S, Randall D J and Donaldson E (eds), Fish Physiology, New York, Academic Press. lim, h k, pankhurst n w and fitzgibbon q p (2004) Effects of slow release gonadotropin releasing hormone analog on milt characteristics and plasma levels of gonadal steroids in greenback flounder, Rhombosolea tapirina, Aquaculture, 240, 505–16. lin x-w and peter r e (1996) Expression of salmon gonadotropin-releasing hormone (GnRH) and chicken GnRH-II precursor messenger ribonucleic acids int he brain and ovary of goldfish, Gen Comp Endocrinol, 101, 282–96. ludwig, m, felberbaum r e, diedrich k and lunefeld b (2002) Ovarian stimulation: from basic science to clinical application, Reprod Biomed, Online, 5, 73–86. lund, e d, sullivan c v and place a r (2000) Annual cycle of plasma lipids in captive reared striped bass: effects of environmental conditions and reproductive cycle, Fish Physiol Biochem, 22, 263–75. malison, j a, procarione l s, barry t p, kapuscinski a r and kayes t b (1994) Endocrine and gonadal changes during the annual reproductive cycle of the freshwater teleost, Stizostedion vitreum, Fish Physiol Biochem, 13, 473–84. mañanos, e, carrillo m, sorbera l s, mylonas c c, asturiano j f, bayarri m j, zohar y and zanuy s (2002) Luteinizing hormone and sexual steroid plasma levels after treatment of European sea bass with sustained-release delivery systems for gonadotropin-releasing hormone analogue, J Fish Biol, 60, 328–39. mañanos, e, duncan n and mylonas c c (2008) Reproduction and control of ovulation, spermation and spawning in cultured fish, in Cabrita E, Robles V and Herráez M P, Methods in Reproductive Aquaculture: Marine and Freshwater Species, Taylor and Francis Group LLC, Boca Raton, FL, CRC Press, 1–40. marino, g, panini e, longobardi a, mandich a, finoia m g, zohar y and mylonas c c (2003) Induction of ovulation in captive-reared dusky grouper, Epinephelus marginatus (Lowe, 1834) with a sustained-release GnRHa implant, Aquaculture, 219, 841–58. matsuyama, m, takeuchi h, kashiwagi m, hirose k and kagawa h (1995) Induced gonadal development and spawning of immature red sea bream Pagrus major with LHRH-a administration in different ways during winter season, Fish Sci, 61, 472–7. matsuyama, m, chuda h, ikeda y, tanaka h and matsuura s (1997) Induction of ovarian maturation and ovulation in the cultured tiger puffer Takifugu rubripes by different hormonal treatments, Suisanzoshoku, 45, 67–73. mikolajczyk, t, chyb j, sokolowska-mikolajczyk m, enright w j, epler p, filipiak m and breton b (2003) Attempts to induce an LH surge and ovulation in common carp (Cyprinus carpio L.) by differential application of a potent GnRH analogue, azagly-nafarelin, under laboratory, commercial hatchery, and natural conditions, Aquaculture, 223, 141–57. mikolajczyk, t, chyb j, szczerbik p, sokolowska-mikolajczyk m, epler p, enright w j, filipiak m and breton b (2004) Evaluation of the potency of azagly-nafarelin (GnRH analogue), administered in combination with different formulations of pimozide, on LH secretion, ovulation and egg quality in common carp (Cyprinus
136
New technologies in aquaculture
carpio L.) under laboratory, commercial and natural conditions, Aquaculture, 234, 447–60. miura, t and miura c i (2003) Molecular control mechanisms of fish spermatogenesis, Fish Physiol Biochem, 28, 181–6. miura, T, yamauchi K, nagahama Y and takahashi H (1991a) Induction of spermatogenesis in male Japanese eel, Anguilla japonica, by a single injection of human chorionic gonadotropin, Zool Sci, 8, 63–73. miura, t, yamauchi k, takahashi h and nagahama y (1991b) Hormonal induction of all stages of spermatogenesis in vitro in the male Japanese eel (Anguilla japonica), Proc Natl Acad Sci USA, 88, 5774–8. mohamed j s, thomas p and khan i a (2005) Isolation, cloning, and expression of three prepro-GnRH mRNAs in Atlantic croaker brain and pituitary, J Comp Neurol, 488(4), 384–95. mommsen, t p and walsh p j (1988) Vitellogenesis and oocyte assembly, in Hoar W S and Randall D J (eds), Fish Physiology, San Diego, CA, Academic Press, 348–406. moon, s h, lim h k, kwon j y, lee j k and chang y j (2003) Increased plasma 17-hydroxyprogesterone and milt production in response to gonadotropinreleasing hormone analogue in captive male starry flounder, Platichthys stellatus, Aquaculture, 218, 703–16. morehead, d t, pankhurst n w and ritar a j (1998) Effect of treatment with LHRH analogue on oocyte maturation, plasma sex steroid levels and egg production in female striped trumpeter Latris lineata (Latrididae), Aquaculture, 169, 315–31. mugnier, c, gaignon j l, lebegue e, fostier a and breton b (2000) Induction and synchronisation of spawning in cultivated turbot (Scophthalmus maximus L.) broodstock by implantation of sustained-release GnRH-a pellet, Aquaculture, 181, 241–55. mylonas, c c and zohar y (2001a) Use of GnRHa-delivery systems for the control of reproduction in fish, Rev Fish Biol Fish, 10, 463–91. mylonas, c c and zohar y (2001b) Endocrine regulation and artificial induction of oocyte maturation and spermiation in basses of the genus Morone, Aquaculture, 202, 205–20. mylonas, c c and zohar y (2007) Promoting oocyte maturation, ovulation and spawning in farmed fish, in Babin P J, Cerdá J and Lubzens E (eds), The Fish Oocyte: from Basic Studies to Biotechnological Applications, Dordrecht, Kluwer Academic, 433–70. mylonas, c c, hinshaw j m and sullivan c v (1992) GnRHa-induced ovulation of brown trout (Salmo trutta) and its effects on egg quality, Aquaculture, 106, 379–92. mylonas, c c, tabata y, langer r and zohar y (1995) Preparation and evaluation of polyanhydride microspheres containing gonadotropin-releasing hormone (GnRH), for inducing ovulation and spermiation in fish, J Control Release, 35, 23–34. mylonas, c c, gissis a, magnus y and zohar y (1997a) Hormonal changes in male white bass (Morone chrysops) and evaluation of milt quality after treatment with a sustained-release GnRHa-delivery system, Aquaculture, 153, 301–13. mylonas, c c, magnus y, gissis a, klebanov y and zohar y (1997b) Reproductive biology and endocrine regulation of final oocyte maturation of captive white bass, J Fish Biol, 51, 234–50. mylonas, c c, scott a p, vermeirssen e l m and zohar y (1997c) Changes in plasma gonadotropin II and sex steroid hormones, and sperm production of striped bass after treatment with controlled-release gonadotropin-releasing hormone agonistdelivery systems, Biol Reprod, 57, 669–75.
Controlling fish reproduction in aquaculture
137
mylonas, c c, scott a p and zohar y (1997d) Plasma gonadotropin II, sex steroids, and thyroid hormones in wild striped bass (Morone saxatilis) during spermiation and final oocyte maturation, Gen Comp Endocrinol, 108, 223–36. mylonas, c c, woods l c, iii and zohar y (1997e) Cyto-histological examination of post-vitellogenesis and final oocyte maturation in captive-reared striped bass, J Fish Biol, 50, 34–49. mylonas, c c, woods l c, iii, thomas p, schulz r w and zohar y (1998a) Hormone profiles of captive striped bass (Morone saxatilis) during spermiation, and longterm enhancement of milt production, J World Aquac Soc, 29, 379–92. mylonas, c c, woods l c, iii, thomas p and zohar y (1998b) Endocrine profiles of female striped bass (Morone saxatilis) in captivity, during post-vitellogenesis and induction of final oocyte maturation via controlled-release GnRHa-delivery systems, Gen Comp Endocrinol, 110, 276–89. mylonas, c c, papadaki m and divanach p (2003) Seasonal changes in sperm production and quality in the red porgy Pagrus pagrus (L.), Aquac Res, 34, 1161–70. mylonas, c c, kyriakou g, sigelaki i, georgiou g, stephanou d and divanach p (2004a) Reproductive biology of the shi drum (Umbrina cirrosa) in captivity and induction of spawning using GnRHa, Isr J Aquac-Bamidgeh, 56, 75–92. mylonas, c c, papadaki m, pavlidis m and divanach p (2004b) Evaluation of egg production and quality in the Mediterranean red porgy (Pagrus pagrus) during two consecutive spawning seasons, Aquaculture, 232, 637–49. mylonas, c c, papandroulakis n, smboukis a, papadaki m and divanach p (2004c) Induction of spawning of cultured greater amberjack (Seriola dumerili) using GnRHa implants, Aquaculture, 237, 141–54. mylonas, c c, bridges c r, gordin h, belmonte ríos a, garcía a, de la gándara f, fauvel c, suquet m, medina a, papadaki m, heinisch g, de metrio g, corriero a, vassallo-agius r, guzmán j m, mañanos e and zohar y (2007) Preparation and administration of gonadotropin-releasing hormone agonist (GnRHa) implants for the artificial control of reproductive maturation in captive-reared Atlantic bluefin tuna (Thunnus thynnus thynnus), Rev Fish Sci, 15, 183–210. nagahama, y (1994) Endocrine regulation of gametogenesis in fish, Int J Dev Biol, 38, 217–29. nagahama, y, yoshikuni m, yamashita m and tanaka m (1994) Regulation of oocyte maturation in fish, in Sherwood N M and Hew C L (eds), Fish Physiology, San Diego, CA, Academic Press, 393–439. negatu, z, hsiao s m and wallace r a (1998) Effects of insulin-like growth factor-I on final oocyte maturation and steroid production in Fundulus heteroclitus, Fish Physiol Biochem, 19, 13–21. nelson, r j (2006), Fishes of the World, 4th ed, New York, Wiley. ohta, h and tanaka h (1997) Relationship between serum levels of human chorionic gonadotropin (hCG) and 11-ketotestosterone after a single injection of hCG and induced maturity in the male Japanes eel, Anguilla japonica, Aquaculture, 153, 123–34. ohta, h, kagawa h, tanaka h, okuzawa k and hirose k (1996) Milt production in the Japanese eel Anguilla japonica induced by repeated injections of human chorionic gonadotropin, Fish Sci, 62, 44–9. ohta, h, kagawa h, tanaka h, okuzawa k, iimura n and hirose k (1997) Artificial induction of maturation and fertilization in the Japanese eel, Anguilla japonica, Fish Physiol Biochem, 17, 163–9. ohta, h, miyake h, miura c i, kamei h, aida k and miura t (2007) Follicle-stimulating hormone induces spermatogenesis mediated by androgen production in Japanese eel, Anguilla japonica, Biol Reprod, 77, 970–7.
138
New technologies in aquaculture
okada, h, doken y, ogawa y and toguchi h (1994) Sustained suppression of the pituitary-gonadal axis by leuprorelin three-month depot microspheres in rats and dogs, Pharmaceut Res, 11, 1199–203. palevitch o, abraham e, kight k e and zohar y (2007) Ontogeny of the GnRH system in zebrafish brain: in situ hybridization and promoter-reporter expression analyses in intact animals, Cell Tissue Res, 327, 313–22. palstra, a p, cohen e g h, niemantsverdriet p r w, van ginneken v j t and van den thillart g e e j m (2005) Artificial maturation and reproduction of European silver eel: development of oocytes during final maturation, Aquaculture, 249, 533–47. pankhurst, n w, purser g j, van der kraak g, thomas p m and forteath g n r (1996) Effect of holding temperature on ovulation, egg fertility, plasma levels of reproductive hormones and in vitro ovarian steroidogenesis in the rainbow trout Oncorhynchus mykiss, Aquaculture, 146, 277–90. papadaki, m, papadopoulou m, sigelaki i and mylonas c c (2008) Egg and sperm production and quality of sharpsnout sea bream (Diplodus puntazzo) in captivity, Aquaculture, 276, 187–97. parauka, f m, troxel w j, chapman f a and mcbay l g (1991) Hormone-induced ovulation and artificial spawning of Gulf of Mexico sturgeon (Acipenser oxyrhynchus desotoi), Prog Fish-Cult, 53, 113–17. park, i s, choi g c, nam y k and kim d s (2002) The effect of exogenous hormone treatment on spermiation in Rhynchocypris oxycephalus (Sauvage and Dabry), J World Aquac Soc, 33, 494–500. pati d and habibi h r (2000) Direct action of GnRH variants on goldfish oocyte meiosis and follicular steroidogenesis, Gen Comp Endocrinol, 160, 75–88. patiño, r, yoshizaki g, thomas p and kagawa h (2001) Gonadotropic control of ovarian follicle maturation: the two-stage concept and its mechanisms, Comp Biochem Physiol, B129, 427–39. pedersen, b h (2003) Induced sexual maturation of the European eel Anguilla anguilla and fertilization of the eggs, Aquaculture, 224, 323–38. pedersen, b h (2004) Fertilization of eggs, rate of embryonic development and hatching following induced maturation of the European eel Anguilla anguilla, Aquaculture, 237, 461–73. peter, r e and yu k l (1997) Neuroendocrine regulation of ovulation in fishes: basic and applied aspects, Rev Fish Biol Fish, 7, 173–97. peter, r e, lin h r, van der kraak g and little m (1993) Releasing hormones, dopamine antagonists and induced spawning, in Muir J F and Roberts R J (eds), Recent Advances in Aquaculture, Oxford, Blackwell Scientific, 25–30. poortenaar, c w and pankhurst n w (2000) Effect of luteinising hormone-releasing hormone analogue and human chorionic gonadotropin on ovulation, plasma and ovarian levels of gonadal steroids in greenback flounder Rhombosolea tapirina, J World Aquac Soc, 31, 175–85. prat, f, zanuy s and carrillo m (2001) Effect of gonadotropin-releasing hormone analogue (GnRHa) and pimozide on plasma levels of sex steroids and ovarian development in sea bass (Dicentrarchus labrax L.), Aquaculture, 198, 325–38. rainis, s, mylonas c c, kyriakou y and divanach p (2003) Enhancement of spermiation in European sea bass (Dicentrarchus labrax) at the end of the reproductive season using GnRHa implants, Aquaculture, 219, 873–90. rodríguez, r, celada j d, saez-royuela m, carral j m, aquilera a and melendre p m (2004) Artificial reproduction in 1-year-old tench (Tinca tinca L.), J Appl Ichthyol, 20, 542–4. rosenfeld, h, meiri i and elizur a (2007) Gonadotropin regulation of oocyte development, in Babin P J, Cerdá J and Lubzens E (eds), The Fish Oocyte: from
Controlling fish reproduction in aquaculture
139
Basic Studies to Biotechnological Applications, Dordrecht, Kluwer Academic, 171–98. rzemieniecki, a, domagala j, glogowski j, ciereszko a, trzebiatowski r, kouril j, hamackova j and babiak i (2004) Induced spermiation in 3-year-old sterlet, Acipenser ruthenus L, Aquac Res, 35, 144–51. saligaut, c, linard b, breton b, anglade i, bailhache t, kah o and jego p (1999) Brain aminergic system in salmonids and other teleosts in relation to steroid feedback and gonadotropin release, Aquaculture, 177, 13–20. sato, n, kawazoe i, suzuki y and aida k (1997) Development of an emulsion prepared with the lipophilized gelatin and its application for hormone administration in the Japanese eel Anguilla japonica, Fish Physiol Biochem, 17, 171–8. schiavone, r, zilli l, vilella s and fauvel c (2006) Human chorionic gonadotropin induces spermatogenesis and spermiation in 1-year-old European sea bass (Dicentrarchus labrax): assessment of sperm quality, Aquaculture, 255, 522–31. schulz, r w and miura t (2002) Spermatogenesis and its endocrinology, Fish Physiol Biochem, 26, 43–56. selman, k, wallace r a, sarka a and qi x (1993) Stages of oocyte development in the zebrafish, Brachydanio rerio, J Morphol, 218, 203–24. silverstein, j t, bosworth b g and wolters w r (1999) Evaluation of dual injection of LHRHa and the dopamine receptor antagonist pimozide in cage spawning of channel catfish Ictalurus punctatus, J World Aquac Soc, 30, 263–8. slater, c, schreck c b and swanson p (1994) Plasma profiles of the sex steroids and gonadotropins in maturing female spring chinook salmon (Oncorhynchus tshawytscha), Comp Biochem Physiol, 109A, 167–75. solar, i i, smith j, dye h m, mackinlay d d, zohar y and donaldson e m (1995) Induced ovulation of chinook salmon using a GnRHa implant: effect on spawning, egg viability and hormone levels, in Goetz F W and Thomas P (eds), Reproductive Physiology of Fish, Austin, TX, Fish Symposium 95, 144. soverchia l, carotti m, andreu-vieyra c, mosconi g, cannella n, habibi h g and polzonetti-magni a (2007) Role of gonadotropin-releasing hormone (GnRH) in the regulation of gonadal differentiation inthe gilthead seabream (Sparus aurata), Mol Reprod Dev, 74, 57–67. stacey, n e (1984) Control of timing of ovulation by exogenous and endogenous factors, in Potts G W and Wooton R J (eds), Fish Reproduction: Strategies and Tactics, London, Academic Press, 207–22. stacey, n e, cardwell j r, liley n r, scott a p and sorenson p w (1994) Hormones as sex pheromones in fish, in Davey K G, Peter R E and Tobe S S (eds), Perspectives in Comparative Endocrinology, Ottawa, ONT, National Research Council of Canada, 438–48. steven, c (2000) Studies on the GnRH-GtH system of female striped bass (Morone saxatilis): effects of GnRH agonist therapy and comparison of reproductive endocrine parameters between wild and captive fish, Marine Estuarine and Environmental Sciences, College Park, MD, University of Maryland. steven, c, gothilf y, holland m c h, stubblefield j, mylonas c c and zohar y (2000) Differential expression of the three GnRH genes in wild and captive striped bass, Morone saxatilis, in response to natural and hormonally induced maturation, in Norberg B, Kjesbu O S, Taranger G L, Andersson E and Stefansson S O (eds), Reproductive Physiology of Fish, Bergen, University of Bergen, 66. sullivan, c v, bernard m g, hara a and dickhoff w w (1989) Thyroid hormones in trout reproduction: enhancement of GnRHa and partially purified salmon GtH-induced ovarian maturation in vivo and in vitro, J Exp Zool, 250, 188–95.
140
New technologies in aquaculture
suquet, m, billard r, cosson j, dorange g, chauvaud l, mugnier c and fauvel c (1994) Sperm features in turbot (Scophthalmus maximus): a comparison with other freshwater and marine fish species, Aquat Living Resour, 7, 283–94. susca v, corriero a, bridges c r and demetrio g (2001) Study of the sexual maturity of female bluefin tuna: purification and partial characterization of vitellogenin and its use in an enzyme-linked immunosorbent assay, J Fish Biol, 58(3), 815. suwa, k and yamashita m (2007) Regulatory mechanisms of oocyte maturation and ovulation, in Babin P J, Cerdá J and Lubzens E, The Fish Oocyte: from Basic Studies to Biotechnological Applications, Dordrecht, Kluwer Academic, 323–47. takashima, f, weil c, billard r, crim l w and fostier a (1984) Stimulation of spermiation by LHRH analogue in carp, Bull Jap Soc Sci Fish, 50, 1323–9. Takushima, M, Nozaki R, Kadomura K, Yasumoto S and Soyano K (2003) Induced ovulation using LHRHa and artificial fertilization in devil stinger, Inimicus japonicus, Fish Physiol Biochem, 28, 521–2. tesch, f-w (ed.) (2003) The eel, Oxford, Blackwell Science. thalathiah, s, ahmad a o and zaini m s (1988) Induced spawning techniques practised at Batu Berendam, Melaka, Malaysia, Aquaculture, 74, 23–33. tyler, j r and sumpter j p (1996) Oocyte growth and development in teleosts, Rev Fish Biol Fish, 6, 287–318. uzbekova s, lareyre, j-j, madigou t, davai b, jalabert b and breton b (2002) Expression of prepro-GnRH and GnRH receptor messengers in rainbow trout ovary depends on the stage of ovarian follicular development, Mol Reprod Dev, 62, 47–56. van der kraak, g, dye h m, donaldson e m and hunter g a (1985) Plasma gonadotropin, 17β-estradiol, and 17a,20β-dihydroxy-4-pregnen-3-one levels during luteinizing hormone-releasing hormone analogue and gonadotropin induced ovulation in coho salmon (Oncorhynchus kisutch), Can J Zool, 63, 824–33. vermeirssen, e l m, mazorra de quero c, shields r j, norberg b, kime d e and scott a p (2003) Fertility and motility of sperm from Atlantic halibut (Hippoglossus hippoglossus) in relation to dose and timing of gonadotropin-releasing hormone agonist implant, Aquaculture, 230, 547–67. vidal, b, pasqualini c, le belle n, holland m c h, sbaihi m, vernier p, zohar y and dufour s (2004) Dopamine inhibits luteinizing hormone synthesis and release in the juvenile European eel: a neuroendocrine lock of the onset of puberty, Biol Reprod, 71, 1491–500. von ihering, r (1937) A method for inducing spawning in fish, Prog Fish-Cult, 34, 15–16. von schalburg k r, rise m l, brown g d, davidson w s and koop b f (2005) A comprehensive survey of the genes involved in maturation and development of the rainbow trout ovary, Biol Reprod, 72, 687–99. wallace, r a and selman k (1990) Ultrastructural aspects of oogenesis and oocyte growth in fish and amphibians, J Electron Microsc Tech, 16, 175–201. watanabe, t and kiron v (1995) Red sea bream (Pagrus major), in Bromage N R and Roberts R J (eds), Broodstock Management and Egg and Larval Quality, Oxford, Blackwell Science, 398–413. watanabe, w o, ellis e p, ellis s c and feeley m w (1998) Progress in controlled maturation and spawning of summer flounder (Paralichthys dentatus) broodstock, J World Aquac Soc, 29, 393–404. watanabe, w o, smith t i j, berlinsky d l, woolridge c a, stuart k r, copeland k a and denson m r (2003) Volitional spawning of black sea bass Centropristis striata induced with pelleted luteinizing hormone releasing hormone-analogue, J World Aquac Soc, 34, 319–31.
Controlling fish reproduction in aquaculture
141
webb, m a h, van eenennaam j p, doroshov s i and moberg g p (1999) Preliminary observations on the effects of holding temperature on reproductive performance of female white sturgeon, Acipenser transmontanus Richardson, Aquaculture, 176, 315–29. weber, g m, borski r j, powell j f f, sherwood n m and grau e g (1995) In vivo and in vitro effects of gonadotropin-releasing hormone on prolactin in the tilapia Oreochromis mossambicus, Am Zool (Abstract), 34, 121A. weil, c and crim l w (1983) Administration of LHRH analogues in various ways: effect on the advancement of spermiation in prespawning landlocked salmon, Salmo salar, Aquaculture, 35, 103–15. wen, h s and lin h r (2004) Effects of exogenous neurohormone, gonadotropin (GtH) and dopaminergic drugs on the serum GtH content and ovulatory responsiveness of wild catfish, Silurus asorus (Linnaeus, 1758), Aquac Res, 35, 204–12. williot, p, brun r, rouault t and rooryck o (1991) Management of female breeders of the Siberia sturgeon, Acipenser baeri Brandt: first results, in Williot P (ed.), Acipenser, France, Cemagref Publications, 365–79. williot, p, sabeau l, gessner j, arlati g, bronzi p, gulyas t and berni p (2001) Sturgeon farming in Western Europe: recent developments and perspectives, Aquat Living Resour, 14, 367–74. williot, p, gulyas t and ceapa c (2002) An analogue of GnRH is effective for induction of ovulation and spermiation in farmed Siberian sturgeon Acipenser baerii Brandt, Aquac Res, 33, 735–7. williot, p, brun r, rouault t, pelard m, mercier d and ludwig a (2005) Artificial spawning in cultured sterlet sturgeon, Acipenser ruthenus L., with special emphasis on hermaphrodites, Aquaculture, 246, 263–73. wong, t t, gothilf y, zmora n, kight k e, meiri i, elizur a and zohar y (2004) Developmental expression of three forms of gonadotropin-releasing hormone and ontogeny of the hypothalamic-pituitary-gonadal axis in gilthead seabream (Sparus aurata), Biol Reprod, 71, 1026–35. yang, z and chen y-f (2004) Induced ovulation in obscure puffer Takifugu obscurus by injections of LHRH-a, Aquac Int, 12, 215–23. yaron, z (1995) Endocrine control of gametogenesis and spawning induction in the carp, Aquaculture, 129, 49–73. yaron, z, gur g, melamed p, rosenfeld h, elizur a and levavi-sivan b (2003) Regulation of fish gonadotropins, Int Rev Cytol, 225, 131–85. yu, k l, lin x w, da cunha bastos j and peter r e (1997) Neural regulation of GnRH in teleost fishes, in Parhar I S and Sakuma Y (eds), GnRH Neurons: Gene to Behavior, Tokyo, Brain Shuppan, 277–312. zabala, m, garcia-rubies a, louisy p and sala e (1997) Spawning behaviour of the Mediterranean dusky grouper Epinephelus marginatus (Lowe, 1834) (Pisces, Serranidae) in the Medes Islands Marine Reserve (NW Mediterranean, Spain), Sci Mar, 61, 65–77. zakes, z and szczepkowski m (2004) Induction of out-of-season spawning of pikeperch, Sander lucioperca (L.), Aquac Int, 12, 11–18. zhuang, p, kynard b, zhang l, zhang t, zhang z and li d (2002) Overview of biology and aquaculture of Amur sturgeon (Acipenser schrenckii) in China, J Appl Ichthyol, 18, 659–64. zohar, y (1988) Gonadotropin releasing hormone in spawning induction in teleosts: basic and applied considerations, in Zohar Y and Breton B (eds), Reproduction in Fish: Basic and Applied Aspects in Endocrinology and Genetics, Paris, INRA Press, 47–62. zohar, y (1989) Fish reproduction: its physiology and artificial manipulation, in Shilo M and Sarig S (eds), Fish Culture in Warm Water Systems: Problems and Trends, Boca Raton, FL, CRC, 65–119.
142
New technologies in aquaculture
zohar, y, harel m, hassin s and tandler a (1995) Gilthead sea bream (Sparus aurata), in Bromage N R and Roberts R J (eds), Broodstock Management and Egg and Larval Quality, Oxford, Blackwell Science, 94–117. zohar, y (1996) New approaches for the manipulation of ovulation and spawning in farmed fish, Bull Natl Res Inst Aquac, Suppl, 2, 43–8. zohar, y and mylonas c c (2001a) Endocrine manipulations of spawning in cultured fish: from hormones to genes, Aquaculture, 197, 99–136. zohar, y and mylonas c c (2001b) Endocrine manipulations of spawning in cultured fish: from hormones to genes, in Donaldson E M and Lee C S (eds), Reproductive Biotechnology in Finfish Aquaculture, Amsterdam, Elsevier, 99–136.
5 Producing sterile and single-sex populations of fish for aquaculture T. J. Benfey, University of New Brunswick, Canada
Abstract: Unlike terrestrial livestock, fish are highly amenable to manipulations leading to the production of single-sex and sterile populations, allowing producers to maximize output based on sex-specific characteristics of economic value while also addressing concerns about environmental impacts of fish which may escape from their farms. Induced triploidy is currently the only method available to produce commercial-scale numbers of sterile fish, and it is particularly useful when combined with all-female production. This approach, and the use of endocrine manipulations to generate broodstock capable of yielding all-female diploid offspring, are the most commonly applied manipulations for sex control used in commercial aquaculture. This chapter describes the methodology and rationale for using single-sex and sterile populations in aquaculture. Key words: androgenesis, gynogenesis, monosex, sex reversal, sterilization, triploidy.
5.1 Introduction This chapter addresses the approaches, rationale and limitations for using sterile and single-sex (i.e., all-female or all-male) populations of fish for aquaculture. Unlike traditional terrestrial livestock species, fish are remarkably amenable to such manipulations. The methods used are often very simple and, in some cases, mimic naturally-occurring exceptions to the typical vertebrate pattern of dioecious diploidy (Purdom, 1984; Devlin and Nagahama, 2002). As a result, some of the manipulations described in this chapter are already used in commercial aquaculture. There are three basic aquaculture applications for sterile populations: to prevent feral spawning of escaped farmed fish, to eliminate production losses associated with early sexual maturation and to protect investments made in developing novel genotypes. Single-sex populations can also be
144
New technologies in aquaculture
used to address concerns with the establishment of feral populations if the farmed species is not endemic to the culture location and cannot hybridize with native species. However, they are generally used to take advantage of sex-specific differences in production traits of economic value. For example, research has targeted the production of female populations of halibut (Hippoglossus hippoglossus) because of their faster growth as juveniles (Hendry et al., 2003), anguillid eels (Anguilla spp.) because of their larger ultimate size (Davey and Jellyman, 2005), and sturgeon (Acipenser spp.) and lumpfish (Cyclopterus lumpus) for the production of high-value caviar or cheaper equivalents (Flynn and Benfey, 2007, Martin-Robichaud et al., 1994, respectively).
5.2 Sterile populations The principal driving force currently behind using sterile fish in aquaculture is the mitigation of risks to wild populations associated with the escape of farmed fish. These risks can be divided into direct effects of the escaped individuals themselves (predation, displacement, disease transfer, etc.) as well as indirect effects of interbreeding between wild and farmed fish and/ or the establishment of feral populations of farmed fish. Sterilization addresses only these indirect effects, serving as a method of ‘genetic containment’ of any fish which escape from farms. Clearly, physical containment is the preferred option, both from the farmer’s standpoint and for the sake of protecting wild populations. Thus, sterilization serves as a back-up to effective physical containment. If physical containment could be assured, then there would be no need for sterile fish to address this issue. However, current aquaculture practices rarely allow for complete containment of farmed fish populations. A second important reason for using sterile fish in aquaculture is to prevent pre-harvest sexual maturation. Early maturation of farmed fish raises numerous production concerns for fish farmers because of the considerable energy invested by the fish in gamete production and spawning morphology/behaviour. Maturing fish lose flesh quality as muscle energy reserves are withdrawn for the production of gametes, especially in females. Maturing fish are also chronically stressed and, as a result, have reduced immunocompetence and are more susceptible to disease. Mature males also often show aggressive behaviour. Sterilization can effectively eliminate these problems for the fish farmer. However, they can also often be addressed through selection, as age at maturity is a heritable trait. A number of recent studies have also demonstrated photoperiod manipulation to be an effective method for delaying or suppressing maturation in a variety of fishes including salmonids (Peterson and Harmon, 2005; Unwin et al., 2005), sea bass (Dicentrarchus labrax) (Rodriguez et al., 2005; Felip et al., 2008),
Producing sterile and single-sex populations of fish for aquaculture
145
flatfish (Imsland and Jonassen, 2005; Garcia-Lopez et al., 2006) and gadoids (Davie et al., 2007a, b). Similar results have been achieved in salmonids through periodic reductions in feeding (Silverstein and Shimma, 1994; Duston and Saunders, 1999). Although such environmental manipulations do not render the fish sterile, they are likely more appealing to farmers and consumers as alternatives to the methods outlined below for permanent sterilization. A third reason for using sterile fish is to protect advances made through selection programs and ‘genetic engineering’ (by transgenesis), both of which are long-term, expensive approaches used for genetic improvement. The former is of critical importance to any type of farming, including aquaculture, whereas the latter has yet to be embraced by the fish-farming industry. In either case, having made such long-term investments in producing unique genotypes, there is clearly an interest in ensuring that producers cannot establish independent breeding programs from them. This is a classic problem in agriculture, and can be addressed through licensing agreements that establish breeding rights. However, sterilization can serve as insurance should such agreements not be possible. The fact that alternatives to sterilization exist to address problems associated with escapees, early maturation and the protection of breeding rights explains, at least to some extent, why sterile fish have not found greater use in aquaculture. However, these alternatives are not always adequate, and so there remains considerable interest in the development and use of effective sterilization techniques. Although there are a number of ways in which to sterilize fish, the use of female triploid populations is currently the only accepted method for achieving this on a commercial scale (Dunham, 2004; NRC Committee on Biological Confinement of Genetically Engineered Organisms, 2004; Johnstone, 2005; Devlin et al., 2006a).
5.2.1 Triploidy by direct induction Triploidy induction refers to the creation of individuals with three complete chromosome sets when the norm for that species would be some other number, this generally being two (i.e., diploid). Most vertebrates are diploid, with individuals inheriting one set of chromosomes from their mother and the other from their father. Individuals with an odd number of chromosome sets, such as triploids, are generally sterile, whereas those with an even number, such as diploids and tetraploids, are generally fertile. Triploidy is generally induced by interference with the completion of the second meiotic division, thereby yielding individuals with two sets of maternal chromosomes and one set of paternal chromosomes
146
New technologies in aquaculture
(Pandian and Koteeswaran, 1998). Germ cells (spermatogonia and oogonia) are the only cells which undergo meiotic division, a process necessary for reducing a cell’s chromosome complement by half (typically from diploid to haploid) so that the correct chromosome number (typically diploid) results from fertilization. Meiosis comprises two cellular divisions, and these are completed by the time of spermiation in males, yielding four haploid post-meiotic spermatozoa from each initial diploid premeiotic spermatogonium. The process is somewhat different in oocytes, which eliminate chromosomes through the production of ‘polar bodies’ that are shed as the oocytes develop, ultimately resulting in the production of a single egg from each diploid oogonium. The first meiotic division and polar body production occur early in ovarian development, but the second polar body, containing a single (haploid) set of chromosomes, is retained until after oocytes are fertilized. It is the physical penetration of the oocyte by the fertilizing spermatozoon that stimulates the oocyte’s second meiotic division to go to completion with release of the second polar body. Preventing this from happening results in triploidy (see Fig. 5.1). Thermal and pressure-induced retention of the second polar body has been used extensively for the production of triploid fish (Benfey, 1989; Pandian and Koteeswaran, 1998; Felip et al., 2001). Thermal treatments are relatively easy to apply with inexpensive equipment, but are less easily controlled, i.e., it is difficult to ensure that all eggs within a treatment batch are heated/cooled at the same rate and to the same temperature. The actual treatment temperature used is also dependent on pre-treatment incubation temperature, making it difficult to come up with a consistent, standardized treatment in the absence of adequate control of incubation temperature. These problems are avoided through the use of hydrostatic pressure treatment, which involves treating eggs within a sealed pressure vessel such that all eggs within a treatment batch are exposed to the identical treatment. Furthermore, the optimum pressure treatment is independent of incubation temperature. Systems for the hydrostatic pressure treatment of large numbers of eggs are commercially available and are used routinely by both commercial and government hatcheries for the production of triploids for aquaculture and fisheries management applications (e.g., Abiado et al., 2007). Triploidy induction by hydrostatic pressure treatment is considered to be highly reliable (Johnstone, 1993, 2005; Benfey, 2001). For instance, in an assessment of the aquaculture characteristics of triploid Atlantic salmon (Salmo salar), O’Flynn et al. (1997) applied a standard treatment of 5 minutes exposure to 65 500 kPa, beginning at 300 ºC minutes after fertilization, for triploidy induction in 86 families representing four different research strains of Atlantic salmon spawned over 5 consecutive years, as well as in 3 commercial runs over 2 consecutive years at an industry hatchery. Triploidy induction success was based on screening ten
Producing sterile and single-sex populations of fish for aquaculture
~~~~
1
147
M
P M
~~~~
2
M
P M
X3n 3
PM M
4
PMM PMM
PM
PM PM X4n
5
PM M
PM M 3n
PM PM
PM
PM
2n PPMM PPMM
6
7
PM PM
PM PM 4n
Fig. 5 1 Production of diploid (2n), triploid (3n) and tetraploid (4n) embryos. When ovulated, fish eggs are arrested at meiosis II, with one haploid maternal chromosome set (M) destined to become the egg pronucleus and another destined to become the second polar body (Step 1). The fertilizing spermatozoon carries one haploid paternal chromosome set (P). Its entry into the egg results in the completion of meiosis II with extrusion of the haploid second polar body (Step 2). This process is blocked for triploidy induction (X3n). The nuclear membrane then encloses either two (2n zygote) or three (3n zygote) chromosome sets (Step 3). The first cell division is preceded by mitotic duplication of all chromosomes within the zygote (Step 4). Cell division then occurs, giving the 2-cell embryo (Step 5). This process is blocked for tetraploidy induction (X4n). The subsequent mitotic cell division begins with a further duplication of all chromosomes (Step 6) and results in a 4n 2-cell embryo (Step 7).
148
New technologies in aquaculture
randomly selected fish from each family, and in all cases the tested fish were confirmed to be triploid. Although the number of fish tested per family was small, the uniform result across families, strains and year classes speaks to the reliability of this method. Similarly, Devlin et al. (2006b) found that triploidy induction success by hydrostatic pressure treatment in coho salmon (Oncorhynchus kisutch) can routinely exceed 99 %. The principal limitation of thermal/pressure-induced triploidy induction is that treatments are applied directly to the eggs destined to become triploid. This means that there is always the possibility for lower triploidy induction success based on inexperience and/or inadequate control over the key induction variables of pre-treatment duration (which is temperature dependent) and the duration and magnitude of the thermal/pressure treatment itself. Thus, although there is abundant evidence that triploidy induction can work with a high (effectively 100 %) rate of success, there is a need for standard operating procedures and quality assurance programs to ensure routine triploidy induction success. This is especially important for inexperienced users of this technology. Chemical inhibitors of microtubular formation, such as colchicine and cytochalasin B, have been used extensively to produce polyploid plants and bivalves, respectively. However, experiments with these chemicals have never yielded appreciable numbers of polyploid fish (Refstie et al., 1977; Allen and Stanley, 1979; Smith and Lemoine, 1979; Refstie, 1981; Bolla and Refstie, 1985). Exposure to hyperbaric nitrous oxide has shown more promise, with up to 100 % triploidy induction success in both rainbow trout (Oncorhynchus mykiss) (Shelton et al., 1986), and Atlantic salmon (Johnstone et al., 1989), but with reduced survival. This approach has not been further pursued, given the higher triploid yield obtained through hydrostatic pressure treatment (Johnstone et al., 1989). Chemical-induced triploidy suffers the same limitation as thermal and pressure-induced triploidy: treatments are applied directly to the eggs destined to become triploid, thus introducing the possibility of reduced efficacy due to inexperience and/or failure to ensure correct treatment. An additional limitation of this approach is that treating fish with chemicals known to interfere with cell division may affect consumer acceptance of the final product. The direct induction of triploidy is also possible through dispermic fertilization, whereby two spermatozoa enter a single egg to yield triploids with two sets of paternal chromosomes and one set of maternal chromosomes (Pandian and Koteeswaran, 1998). This method of triploidy induction has received far less attention than that described above for polar body retention. Polyethylene glycol and high pH/calcium solutions have been used to fuse spermatozoa prior to fertilization in rainbow trout, resulting
Producing sterile and single-sex populations of fish for aquaculture
149
in up to 33 % triploidy induction success (Ueda et al., 1986, 1988). The remaining eggs were fertilized with single (unfused) spermatozoa, yielding normal diploid offspring. The principal limitation of triploidy induction by dispermic fertilization is the high failure rate of spermatozoan fusion. These treatments have been shown to cause extensive fusion of spermatoan tails (in addition to heads), thereby affecting motility and reducing fertilization success (Araki et al., 1995). With further research it may be possible to develop a more reliable protocol to match the success rate of thermal/ pressure-induced triploidy, although this will be hampered by speciesspecific differences in optimum treatments (Araki et al., 1995). In any case, the same issues of inexperience and/or inadequate treatment control will apply.
5.2.2 Triploidy by tetraploid–diploid crosses As an alternative to the direct induction of triploidy, it is also possible to create triploids indirectly by crossing tetraploid individuals of one sex with diploids of the other (Pandian and Koteeswaran, 1998). Depending on which parent is the tetraploid, the offspring will either have two sets of maternal and one set of paternal chromosomes (tetraploid mother; similar outcome as direct induction of triploidy through retention of the second polar body) or one set of maternal and two sets of paternal chromosomes (tetraploid father; similar outcome as direct induction of triploidy through dispermic fertilization). In either case, this approach requires the direct induction of tetraploidy – rather than triploidy – and the subsequent incorporation of tetraploid broodstock into regular breeding programs. Tetraploidy is induced using the same thermal or hydrostatic pressure treatments employed for triploidy induction, but applied somewhat later after fertilization in order to block the first mitotic cell division of the zygote. Mitosis is a simpler form of cell division than meiosis, involving the duplication of all chromosomes followed by their separation into two chromosome complements of equal number, after which cell division occurs to leave the two resultant cells with one set of chromosomes each. Thus, prior to the first mitotic cell division in a normal diploid zygote, all the chromosomes have been duplicated to give it a tetraploid chromosome number for a short time. This is subsequently reduced to diploid with cell division to yield the twocell diploid embryo. Treatments that block this first mitotic cell division after chromosome duplication has occurred are effective for inducing tetraploidy (see Fig. 5.1). Although tetraploidy has been induced in numerous fish species (Solar et al., 1992; Pandian and Koteeswaran, 1998), their survival is generally very low – much lower than that of induced triploids. This has generally been related to difficulties with getting the treatment timing right to minimize mortality (e.g., Chourrout et al., 1986; Zhang et al., 2005), but there also
150
New technologies in aquaculture
appear to be inherent physiological problems with tetraploids that significantly reduce their viability (Sakao et al., 2003, 2006). However, several studies have demonstrated that it is feasible to create triploid populations of rainbow trout by crossing tetraploids with diploids (Chourrout et al., 1986; Blanc et al., 1987; Chourrout and Nakayama, 1987; Myers and Hershberger, 1991). There are a number of limitations with the use of tetraploid–diploid crosses as an approach for the production of all-triploid populations. Firstly, and critically, they do not generally yield all-triploid populations as predicted. For instance, although crosses between tetraploid male and diploid female rainbow give mostly triploid progeny, they also often yield small numbers of diploids and aneuploids (Chourrout et al., 1986). Similarly, rainbow trout crosses between tetraploid females and diploid males also yield mostly triploid offspring, but with the occasional haploids, diploids and mosaics (Chourrout and Nakayama, 1987). Similar observations have been made with mud loach (Misgurnus mizolepis) (Nam and Kim, 2004) and blunt snout bream (Megalobrama amblycephala) (Zou et al., 2004). There is some evidence from these studies that individual variation exists among tetraploids in their ability to produce triploid offspring, suggesting that careful tetraploid broodstock selection may ensure all-triploid progeny (e.g., Nam and Kim, 2004). However, based on the current level of experience with tetraploids it would be necessary to screen all the offspring from individual crosses to confirm their triploid status. Given this limitation to an otherwise theoretically ideal process for producing triploid populations, it is likely easier to use direct induction of triploidy for which treatment protocols are better defined. A second limitation of using tetraploid crosses with diploids, at least in rainbow trout, is that tetraploid females have delayed maturation (Chourrout et al., 1986) and tetraploid males have reduced fertility (Chourrout et al., 1986; Blanc et al., 1987, 1993; Myers and Hershberger, 1991). This latter effect is apparently because their relatively large spermatozoa – a consequence of increased chromosome number – have difficulty penetrating the micropyle of the egg (Chourrout et al., 1986). The micropyle is a small opening through which spermatozoa must pass to fertilize the egg in teleost fishes, and micropyle diameter is so closely matched to spermatozoan head diameter within a species that it cannot easily accommodate the 30 % increase in head width of spermatozoa from tetraploid males compared to those from diploids (Chourrout et al., 1986). A third limitation of this approach to producing triploids is that presumptive tetraploids may in fact be diploid-tetraploid mosaics. Such mosaics have been observed in several species following treatments designed to block the first mitotic division, including amago salmon (Oncorhynchus masou ishikawai) (Yamaki et al., 1999), rainbow trout
Producing sterile and single-sex populations of fish for aquaculture
151
(Zhang and Onozato, 2004a) and their hybrid (Zhang and Onozato, 2004b). Diploid–tetraploid mosaics have the potential to yield large numbers of diploid offspring (up to 100 %) when crossed to normal diploids (Yamaki et al., 1999; Yamaki and Arai, 2000; Zhang and Onozato, 2004b), and their occurrence in presumptive all-tetraploid populations may account for earlier observations of diploids and aneuploids arising from crosses between tetraploids and diploids (as described above: Chourrout et al., 1986; Chourrout and Nakayama, 1987; Nam and Kim, 2004; Zou et al., 2004). It is likely possible to overcome this limitation through refinement of tetraploidy induction protocols (e.g., Zhang and Onozato, 2004a) and screening of presumptive tetraploid broodstock before their use. However, this screening process would need to go beyond ploidy determination of presumptive tetraploid broodstock by standard techniques such as karyotyping or flow cytometric measurement of DNA content from blood cells because they may miss the existence of a mosaic genotype in the germ line. Rather, it would be necessary to screen the progeny resulting from tetraploid–diploid crosses between individual parents to confirm their all-triploid nature.
5.2.3 Genomic stability of triploids Ensuring the genomic stability of triploid individuals is critical when using induced triploidy as a means of achieving reproductive sterility. The specific concern with this is that triploid individuals do not reduce their chromosome number to diploid, either at the whole animal level or within populations of cells. Reversion to diploidy in the germ cells, whether limited to these cells alone or because of diploid reversion at the whole animal level, circumvents the reproductive sterilization aimed for through triploidy induction. Even if an animal remained triploid in all its somatic tissues, if any of the pre-meiotic germ cells (oogonia or spermatogonia) reverted to diploid they would yield viable haploid gametes as expected from a fertile diploid animal. When considering the possibility of triploid reversion to diploid, it is important to make a distinction between actual reversion from the triploid state to some other chromosomal configuration, as opposed to not having had true triploids in the first place. This latter possibility arises from the various limitations of triploidy induction protocols, and comes down to two possibilities: the direct triploidy induction process is not fully successful and results in a mix of triploid and diploid individuals, or the tetraploidy induction process is not fully successful and leads to the production of some mosaic individuals with the potential to produce diploid offspring. These limitations have been addressed above. The reversion of a truly triploid individual to the diploid state in some or all of its tissues could be envisaged to occur slowly, by the loss of one or a few chromosomes at a time, or quickly, by the loss of an entire
152
New technologies in aquaculture
haploid chromosome set at one time. The former would initially lead to aneuploidy (i.e., any chromosome number other than an exact multiple of haploid), but could ultimately lead to a reduction in chromosome number to a lower euploid state (i.e., an exact multiple of haploid – specifically diploid in this case). At the whole animal level, this would then lead to mosaic individuals, as would be the case if an entire haploid chromosome set was lost outright from individual cells. Such a scenario, which requires errors in, or modifications to, the typical processes of mitotic chromosome separation and cell division, has never been described in artificially produced triploid fish. However, concerns are frequently raised over just such a scenario, apparently based on its repeated observation in the Pacific oyster (Crassostrea gigas), where is has been seen not just in triploids (Allen et al., 1996, 1999), but also in tetraploids (McCombie et al., 2005) and even in diploids (Thiriot-Quiévreux et al., 1992; Zouros et al., 1996; Leitão et al., 2001a, b; Bouilly et al., 2005). Aneuploidy has also been observed in the pearl oyster (Pinctada martensii) (He et al., 2001, 2004). Unlike fish, oysters appear to be highly tolerant of aneuploidy and mosaicism (Wang et al., 1999; He et al., 2004). Given the greater number and longer history of publications on triploid fish compared to shellfish and the fact that reversion to diploidy has never been reported in triploid fish, it appears that it either does not happen or is lethal. Indeed, recent research by Poss et al. (2004) has demonstrated in zebrafish (Danio rerio) that vertebrate cells – and in particular germ cells – are highly sensitive to errors in chromosome separation and cell division that might lead to aneuploidy, with the result that such cells are unable to divide. Although not ‘reversion’ per se, another issue to consider is the fate of any post-meiotic germ cells that might develop in artificiallyproduced triploids. It is important to recognize that (i) artificiallyproduced triploid fish are capable of producing small numbers of post-meiotic gametes (reviewed by Benfey, 1999) and (ii) there are naturally occurring triploid ‘species’ (actually hybrids) which regularly do so because they have evolved atypical meiotic processes that allow them to circumvent triploid sterility and thereby maintain self-sustaining, reproductively viable populations (Purdom, 1984; Devlin and Nagahama, 2002). The production of gametes in artificially-produced triploids is more commonly reported in males than in females, likely for two related reasons (Benfey, 1999). Firstly, male fish typically produce far more gametes than females because spermatozoa are so much smaller than oocytes and gonads of a given size will therefore have far more pre-meiotic spermatogonia than oogonia. Thus, if a certain percentage of pre-meiotic cells are destined to complete meiosis in triploids – as appears to be the case (Benfey, 1999) – firstly, this will translate into much larger numbers of post-meiotic sperma-
Producing sterile and single-sex populations of fish for aquaculture
153
tozoa in males than post-meiotic oocytes in females. Secondly, triploid females do not produce sufficient levels of the ovarian steroid 17β-estradiol that stimulates the synthesis and uptake of yolk proteins by developing oocytes, resulting in slowed or arrested growth of those few oocytes that do progress through meiosis in triploid females (Benfey et al., 1989; Schafhauser-Smith and Benfey, 2001, 2003a, b). Although there have been occasional reports of ovulated eggs from triploid female salmonids, in no case have they yielded viable offspring (Johnstone et al., 1991; Benfey, 1996). The production of sperm (milt) by triploid males is more common (Benfey, 1999) but, as clearly demonstrated in rainbow trout, it comprises aneuploid spermatozoa with a modal DNA content halfway between haploid and diploid (Benfey et al., 1986). When used to fertilize eggs from normal diploid females, the offspring are aneuploid and do not survive (Lincoln and Scott, 1984; Ueda et al., 1987). This confirms the sterile nature of triploid fish, in the true sense of the word: an inability to produce viable offspring. Naturally occurring triploids that maintain self-sustaining populations all involve hybrids between two or more closely related species, and are called ‘allotriploids’ to distinguish them from the within-species artificial triploids (‘autotriploids’) that are the focus of this paper. Hybrid allotriploids invariably exist as all-female populations and rely on males of one of their progenitor species to provide sperm for the activation of development in their eggs (Vrijenhoek, 1994; Devlin and Nagahama, 2002). Maintaining reproductively viable populations of allotriploids is only possible through the evolution of atypical patterns of meiosis and fertilization that have never been observed in autotriploids.
5.2.4 Alternatives to triploidy for sterilization Detailed descriptions of the variety of alternatives to triploidy for producing sterile fish can be found elsewhere (e.g., Devlin and Donaldson, 1992; Maclean and Laight, 2000; Wong and Van Eenennaam, 2008), and are therefore only reviewed briefly. Surgical castration is probably the earliest technique to have been developed for sterilizing fish. It can be highly effective if no gonadal tissue remains after surgery. However, ensuring the complete removal of the gonads is difficult, especially when working with smaller fish. In any case, it is inconceivable that surgical castration can applied on a commercial scale because of the amount of time and handling involved in the procedure. High energy radiation (gamma- and X-ray) is well documented to have sterilizing effects on a wide range of organisms, including fish. However, permanent sterilization is difficult to achieve. Furthermore, the equipment used is heavy and cumbersome, and is therefore not amenable to transport
154
New technologies in aquaculture
to farm sites. Operator and environmental safety are clear concerns when using high energy radiation sources, and consumer acceptability of the final product is questionable. This technique is therefore not seen as suitable for commercial aquaculture. The use of chemicals, immunological manipulations or transgenic techniques to act upon the hypothalamic–pituitary–gonadal axis are approaches more likely to work on a commercial scale than surgical castration or high energy radiation, but as yet no effective treatments for permanent sterilization have been developed along these lines for any aquaculture species. Any approach which interferes with the production or release of gonadotropin releasing hormone (hypothalamus) or gonadotropins (pituitary) is potentially effective for ensuring sterilization. Unlike triploidy and most other sterilization approaches, one could envisage this approach as being reversible, allowing the breeding of top performing sterile fish by supplementation of the missing hormone(s) as a form of replacement therapy. This is a field of research worthy of pursuit for developing novel techniques for sterilizing fish. Lastly, androgen administration, through immersion or feeding, is well documented to be an inexpensive and effective method for the permanent sterilization of fish. It is easily applied on a commercial scale, although care must be taken to protect farm employees and the environment from exposure to high steroid doses. The steroid treatments are typically completed one or more years prior to fish reaching market size, by which time residual steroid levels have become non-detectable (Pandian and Kirankumar, 2003). The only apparent reason that this technique is not used for commercial production is because of concerns about consumer acceptance of a steroid-treated product, and this limitation is not likely to change.
5.3 Single-sex populations From a strictly production standpoint, there are often clear advantages of one sex over the other for commercial aquaculture. For most species of fish it is impossible to separate males and females as juveniles, and in many species this is even impossible as sexually mature adults. However, there are a number of different approaches that can be used to generate singlesex populations through simple genetic, endocrine or environmental manipulations.
5.3.1 Uniparental inheritance The activation of embryonic development with no contribution of the paternal genome (gynogenesis) or the maternal genome (androgenesis) is
Producing sterile and single-sex populations of fish for aquaculture
155
a simple genetic manipulation that can be used for the production of singlesex populations (Pandian and Koteeswaran, 1998; Felip et al., 2001; Komen and Thorgaard, 2007). Gynogenesis is usually accomplished by modifying or destroying the spermatozoan genome without affecting the motility of the spermatozoa and hence their ability to penetrate the egg and activate embryonic development. This is generally done using UV-irradiation, but is also possible with high energy radiation or certain chemicals. In some cases, the use of sperm from a different species has the same effect. Penetration of the treated spermatozoon into the egg stimulates the resumption of meiosis, which ends with extrusion of the haploid second polar body. The result is a haploid zygote with its genomic DNA derived solely from the egg’s pronucleus. Diploidy can be restored by using thermal or hydrostatic pressure treatments to either block extrusion of the second polar body itself, or by allowing this to occur but then blocking the first mitotic cell division after the chromosome complement has been duplicated. These treatments are identical to those used to induce triploidy or tetraploidy, respectively, after fertilization with intact spermatozoa. In this case, however, the resulting zygote has a normal diploid chromosome number but with all chromosomes inherited from the mother. Androgenesis works in the same way as gynogenesis, but requires irradiation of the eggs rather than the sperm, followed by fertilization with intact spermatozoa. Ordinarily this would yield androgenetic haploids, but again if the first mitotic cell division is blocked after pre-mitotic duplication of the paternal genome, then the result is androgenetic diploids. Considerably more research has been conducted on gynogenesis than on androgenesis in fish, principally because it is easier to effectively irradiate sperm than eggs. Gynogenesis can be used to create all-female populations but cannot yield all-male populations. For instance, in species having female homogamety, equivalent to the mammalian XX-female/XY-male system, exclusion of the paternal genome and duplication of the maternal genome through gynogenesis should result in all-female populations. This is well established for salmonid fishes (Ihssen et al., 1990) and has also been demonstrated for Atlantic halibut (Tvedt et al., 2006). In species with female heterogamety, equivalent to the avian WZ-female/ZZ-male system, gynogenesis yields populations comprising mostly normal males and ‘super-females’ (WW genotype), with the possibility of smaller number of normal females. Sex ratios recently obtained from gynogenetic populations of shortnose sturgeon (Acipenser brevirostrum) suggest that this species has male homogamety (Flynn et al., 2006). The creation of all-female populations in such cases requires the mating of normal males with super-females. Conversely, androgenesis results in all-male populations in species with male homogamety (WZ/ZZ-system) but cannot be used to make all-female populations in such species. For species
156
New technologies in aquaculture
having male heterogamety (XX/XY-system), androgenesis yields populations comprising mostly normal females and ‘super-males’ (YY genotype), with the possibility of smaller numbers of normal males. All-male populations can then be obtained by crossing normal females with super-males. Perpetuating all-female and all-male lines using such genetic manipulations is facilitated by endocrine manipulations. In species with female homogamety, functional sex reversal of gynogenetic females yields phenotypic males capable of generating all-female offspring when crossed with normal females. Similarly, in species with male homogamety, functional sex reversal of gynogenetic males yields phenotypic females capable of generating all-male offspring when crossed with normal males. Further details on the methodology for endocrine sex reversal are provided in Section 5.3.2. Uniparental inheritance results in reduced heterozygosity, an important consideration when designing breeding programs that incorporate gynogenetic or androgenetic fish. The pathways described above also assume simple (single locus) genetic control of sex determination, for which many exceptions exist among fishes (Devlin and Nagahama, 2002). Furthermore, because most fish lack discrete sex chromosomes or even much in the way of distinct sex-specific genes, the predicted sex ratio outcomes are not always realized due to segregation of recessive mutations affecting sex determination (Komen and Thorgaard, 2007). Thus, although uniparental inheritance is useful for determining the genetic basis to sex determination (e.g., Flynn et al., 2006; Tvedt et al., 2006; Komen and Thorgaard, 2007), it is not generally used for the direct production of single-sex populations of fish.
5.3.2 Endocrine sex reversal Although sex is ultimately under genetic control and is often determined – and fixed – at fertilization, the phenotypic expression of sex (i.e., gonadal differentiation into ovaries or testes) is mediated by sex steroids. Thus, estrogens and androgens have feminizing and masculinizing effects, respectively. These hormones are the natural ‘sex inducers’ in vertebrates, and their exogenous administration during gonadal differentiation can be used to change sex in fish (Devlin and Nagahama, 2002). Successful endocrine sex reversal therefore requires knowledge of the timing of gonadal differentiation. In some species this occurs prior to yolk absorption, requiring the immersion of embryos in steroid solutions. In species where gonadal differentiation occurs later in life, these steroids can be administered through the food, either via live prey such as steroid-enriched Artemia (e.g., lumpfish; Martin-Robichaud et al., 1994) or in prepared feeds (e.g., Atlantic halibut; Hendry et al., 2003).
Producing sterile and single-sex populations of fish for aquaculture
157
Despite the fact that it is possible to achieve ‘direct’ feminization or masculinization in this way, the marketability of such fish for human consumption is affected by their exposure to steroids (Pandian and Kirankumar, 2003). The preferred method for aquaculture applications is therefore ‘indirect’ feminization or masculinization. For instance, the appropriate administration of androgens to salmonid fishes results in all-male populations. If the sex-reversed genotypic females (‘neo-males’) within such populations are subsequently mated to normal females, all the resulting offspring are female but have not themselves been exposed to steroids. This method for the production of all-female populations for aquaculture is currently used for salmonid species such as rainbow trout and chinook salmon (Oncorhyncus tshawytscha) (Devlin and Nagahama, 2002), as well as for Atlantic halibut (Scotian Halibut Ltd, Nova Scotia, Canada, unpublished).
5.3.3 Environmental manipulation of sex ratio All steroid hormones are derived from cholesterol, with their biosynthesis controlled by specific steroidogenic enzymes. Chemical inhibition of such enzymes has been used to create single-sex populations of fish (Piferrer, 2001). Given that enzyme activity is sensitive to physical (e.g., temperature) and chemical (e.g., pH) conditions, it should also be possible to manipulate sex ratios in fish by manipulating the expression and/or activity of steroidogenic enzymes (Baroiller et al., 1999). The best candidate for such environmental manipulations is temperature, given the well documented effects of egg incubation temperature on sex ratios in reptiles and some species of fish. Such a protocol has obvious attractiveness for aquaculture because it represents a more consumer-friendly approach, given the absence of genetic manipulation or use of steroid hormones. Sex ratios have been altered by simple temperature manipulations in numerous aquaculture species, including Nile tilapia (Oreochromis niloticus) (Tessema et al., 2006), goldfish (Carassius auratus) (Goto-Kazeto et al., 2006) and several flatfish species (Goto et al., 1999, 2000; Yamamoto, 1999; Luckenbach et al., 2003), although not Atlantic halibut (Hughes et al., 2008). The number of fish species demonstrating temperature-sensitive sexual differentiation under experimental conditions is growing rapidly, and this may become a common approach to producing sex-biased populations for aquaculture.
5.4 Future trends and further reading As aquaculture continues to grow in importance as a source of high-quality food, there will be a greater focus on developing technologies to improve
158
New technologies in aquaculture
production efficiencies. Although aquaculture is rightly seen as an aquatic extension of terrestrial agriculture, there are some unique attributes of the animals farmed in aquaculture compared to more familiar terrestrial livestock because the latter focuses on mammals and birds, whereas in aquaculture the focus is on fish and invertebrates. The terrestrial paradigm of what is possible with respect to sex control does not apply to these aquaculture species. Given the ease with which single-sex and sterile populations of fish can be produced using simple manipulations that are not likely to be criticized by consumers, and in fact have added benefits to mitigating aquaculture impacts on the environment, it is likely that there will be widespread use of such populations in the future. The key is to not have one’s imagination constrained by what is (and is not) possible to do when farming mammals and birds. Given the fundamental differences between triploids and diploids with respect to genome size, gene dosage, cell size, etc. (Benfey, 1999), it is not surprising that triploid performance in aquaculture is not necessarily the same as for diploids. Triploid growth is, at best, generally no better than that of diploids (Benfey, 1999; Maxime, 2008), and they are less tolerant of chronic exposure to high temperature (Ojolick et al., 1995; Hyndman et al., 2003). Current research focuses on determining the limitations and best culture conditions for triploids, with respect to providing the optimum environment for letting them realize their potential (e.g., Atkins and Benfey, 2008). Through such research it should become possible to increase greatly the use of triploids in commercial aquaculture without affecting production efficiencies. At the same time, it is important to continue searching for effective alternatives to triploidy for providing sterile populations. Relevant advances made in other fields should be pursued for their applicability to aquaculture. For instance, the recent discovery of the key role of kisspeptin and its receptor (GPR54) in controlling puberty through the regulation of gonadotropin releasing hormone secretion in mammals (Dungan et al., 2006) should be investigated as a likely site for intervention for the control of gonadal development in fishes. With respect to the production of single-sex populations, the rapid increase in the number of species demonstrated to have thermal-labile sex determination – at least under culture conditions if not in nature – opens the door for widespread use of simple temperature manipulation at key stages of the life cycle as a way of altering sex ratio to the benefit of fish farmers. Advances in molecular biology will facilitate the integration of such manipulations into traditional breeding programs. For further reading on the topics covered in this chapter, the reader is recommended the comprehensive reviews by Pandian and Koteeswaran (1998), Benfey (1999), Felip et al., (2001), Devlin and Nagahama (2002), Koman and Thorgaard (2007) and Maxime (2008).
Producing sterile and single-sex populations of fish for aquaculture
159
5.5 References abiado m a g, penn m, dabrowski k, stafford j (2007) Evaluation of two commercially available pressure chambers to induce triploidy in saugeyes, N Am J Aquac, 69, 197–201. allen jr s k, stanley j g (1979) Polyploid mosaics induced by cytochalasin B in landlocked Atlantic salmon Salmo salar, Trans Am Fish Soc, 108, 462–6. allen jr s k, guo x, burreson g, mann r (1996) Heteroploid mosaics and reversion among triploid oysters, Crassostrea gigas. Fact or artifact, J Shellfish Res, 15, 514 (abstract). allen jr s k, howe a, gallivan t, guo x, debrosse g (1999) Genotype and environmental variation in reversion of triploid Crassostrea gigas to the heteroploid mosaics state, J Shellfish Res, 18, 293 (abstract). araki k, shinma h, nagoya h, nakayama i, onozato, h (1995) Androgenetic diploids of rainbow trout (Oncorhynchus mykiss) produced by fused sperm, Can J Fish Aquat Sci, 52, 892–6. atkins m e, benfey t j (2008) Effect of temperature on routine metabolic rate in triploid salmonids, Comp Biochem Physiol, 149A, 157–61. baroiller j-f, guiguen y, fostier a (1999) Endocrine and environmental aspects of sex differentiation in fish, Cell Mol Life Sci, 55, 910–31. benfey t j (1989) A bibliography of triploid fish, 1943 to 1988, Can Tech Rep Fish Aquat Sci, 1682, 1–33. benfey t j (1996) Ovarian development in triploid brook trout (Salvelinus fontinalis), in Goetz F W and Thomas P (eds), Proceedings of the 5th International Symposium on the Reproductive Physiology of Fish, Austin, TX, Fish Symposium, 95, 357. benfey t j (1999) The physiology and behavior of triploid fishes, Rev Fish Sci, 7, 39–67. benfey t j (2001) Use of sterile triploid Atlantic salmon (Salmo salar L.) for aquaculture in New Brunswick, Canada, ICES J Mar Sci, 58, 525–9. benfey t j, solar i i, de jong g, donaldson e m (1986) Flow-cytometric confirmation of aneuploidy in sperm from triploid rainbow trout, Trans Am Fish Soc, 115, 838–40. benfey t j, dye h m, solar i i, donaldson e m (1989) The growth and reproductive endocrinology of adult triploid Pacific salmonids, Fish Physiol Biochem, 6, 113–20. blanc j-m, chourrout d, kreig f (1987) Evaluation of juvenile rainbow trout survival and growth in half-sib families from diploid and tetraploid sires, Aquaculture, 65, 215–20. blanc j-m, poisson h, escaffre a m, aguirre p, vallée f (1993) Inheritance of fertilizing ability in male tetraploid rainbow trout (Oncorhynchus mykiss), Aquaculture, 110, 61–70. bolla s, refstie t (1985) Effect of cytochalasin B on eggs of Atlantic salmon and rainbow trout, Acta Zool (Stockholm), 66, 181–8. bouilly k, leitão a, chaves r, guedes-pinto h, boudry p, lapègue s (2005) Endonuclease banding reveals that atrazine induced aneuploidy resembles spontaneous chromosome loss in Crassostrea gigas, Genome, 48, 177–80. chourrout d, nakayama i (1987) Chromosome studies of progenies of tetraploid female rainbow trout, Theor Appl Genet, 74, 687–92. chourrout d, chevassus b, krieg f, happe a, burger g, renard p (1986) Production of second generation triploid and tetraploid rainbow trout by mating tetraploid males and diploid females – potential of tetraploid fish, Theor Appl Genet, 72, 193–206.
160
New technologies in aquaculture
davey ajh, jellyman d j (2005) Sex determination in freshwater eels and management options for manipulation of sex, Rev Fish Biol Fish, 15, 37–52. davie a, mazorra de quero c, bromage n, treasurer j, migaud h (2007a) Inhibition of sexual maturation in tank reared haddock (Melanogrammus aeglefinus) through the use of constant light photoperiods, Aquaculture, 270, 379–89. davie a, porter mjr, bromage n r, migaud h (2007b) The role of seasonally altering photoperiod in regulating physiology in Atlantic cod (Gadus morhua). Part I. Sexual maturation, Can J Fish Aquat Sci, 64, 84–97. devlin r h, donaldson, e m (1992) Containment of genetically altered fish with emphasis on salmonids, in Hew C L and Fletcher G L (eds), Transgenic Fish, Singapore, World Scientific, 229–66. devlin r h, nagahama y (2002) Sex determination and sex differentiation in fish: an overview of genetic, physiological, and environmental influences, Aquaculture, 208, 191–364. devlin r h, sundström l f, muir w m (2006a) Interface of biotechnology and ecology for environmental risk assessments of transenic fish, Trends Biotech, 24, 89–97. devlin r h, biagi c a, sakhrani d, eom k-w (2006b) Assessment of pressure-shock induced triploidy for containment of transgenic salmon, in MacKinlay C and Busby C (eds), Book of Abstracts, 7th International Congress on the Biology of Fish, St. John’s, Newfoundland, Bethesda, MD, American Fisheries Society, 47. dungan h m, clifton d k, steiner r a (2006) Kisspeptin neurons as central processors in the regulation of gonadotropin-releasing hormone secretion, Endocrinol, 147, 1154–8. dunham r a (2004) Aquaculture and Fisheries Biotechnology: Genetic Approaches, Cambridge, MA, CABI. duston j, saunders r l (1999) Effect of winter food deprivation on growth and sexual maturity of Atlantic salmon (Salmo salar) in sea water, Can J Aquat Sci, 56, 201–7. felip a, zanuy s, piferrer f (2001) Induction of triploidy and gynogenesis in teleost fish with emphasis on marine species, Genetica, 111, 175–95. felip a, zanuy s, muriach b, cerda-reverter j m, carrillo m (2008) Reduction of sexual maturation in male Dicentrarchus labrax by continuous light both before and during gametogenesis, Aquaculture, 275, 347–55. flynn s r, benfey t j (2007) Sex differentiation and aspects of gametogenesis in shortnose sturgeon, Acipenser brevirostrum, Lesuere, J Fish Biol, 70, 1027–44. flynn s r, matsuoka m, reith m, martin-robichaud d j, benfey t j (2006) Gynogenesis and sex determination in shortnose sturgeon, Acipenser brevirostrum, LeSuere, Aquaculture, 253, 721–7. garcia-lopez a, pascual e, sarasquete c, martinez-rodriguez g (2006) Disruption of gonadal maturation in cultured Senegalese sole Solea senegalensis Kaup by continuous light and/or constant temperature regimes, Aquaculture, 261, 789–98. goto r, mori t, kawamata k, matsubara t, mizuno s, adachi s, yamauchi k (1999) Effects of temperature on gonadal sex determination in barfin flounder Verasper moseri, Fish Sci, 65, 884–7. goto r, kayaba t, adachi s, yamauchi k (2000) Effects of temperature on sex determination in marbled sole Limanda yokohamae, Fish Sci, 66, 400–2. goto-kazeto r, abe y, masai k, yamaha e, goto-kazeto r, abe y, masai k, yamaha e, adachi s, yamauchi k (2006) Temperature-dependent sex differentiation in
Producing sterile and single-sex populations of fish for aquaculture
161
goldfish: Establishing the temperature-sensitive period and effect of constant and fluctuating water temperatures, Aquaculture, 254, 617–24. he m, lin y, shen q, hu j, jiang w (2001) Production of aneuploid Pinctada martensii Dunker in tetraploid, Mar Sci Bull, 3, 63–8. he m, jiang w, huang l (2004) Studies on aneuploid pearl oyster (Pinctada martensii Dunker) produced by crossing triploid females and a diploid male following the inhibition of PB1, Aquaculture, 230, 117–24. hendry c i, martin-robichaud d j, benfey t j (2003) Hormonal sex reversal of Atlantic halibut (Hippoglossus hippoglossus), Aquaculture, 219, 769– 81. hughes v, benfey t j, martin-robichaud d j (2008) Effect of rearing temperature on sex ratio in juvenile Atlantic halibut, Hippoglossus hippoglossus, Env Biol Fish, 81, 415–19. hyndman c a, kieffer j d, benfey t j (2003) Physiology and survival of triploid brook trout following exhaustive exercise in warm water, Aquaculture, 221, 629–43. ihssen p e, mckay l r, mcmillan i, phillips r b (1990) Ploidy manipulation and gynogenesis in fishes: cytogenetic and fisheries applications, Trans Am Fish Soc, 119, 698–717. imsland a k, jonassen t m (2005) The relation between age at first maturity and growth in Atlantic halibut (Hippoglossus hippoglossus) reared at four different light regimes, Aquac Res, 36, 1–7. johnstone r (1993) Maturity control in Atlantic salmon, in Muir J F and Roberts R J (eds), Recent Advances in Aquaculture IV, Oxford, Blackwell Scientific, 99–105. johnstone r (2005) An overview of methods of control of maturation in salmonids, in Wild and Farmed Salmon – Working Together, Edinburgh, North Atlantic Salmon Conservation Organization, 32–6. johnstone r, knott r m, macdonald a g, walsingham m v (1989) Triploidy induction in recently fertilized Atlantic salmon ova using anaesthetics, Aquaculture, 78, 229–36. johnstone r, mclay h a, walsingham m v (1991) Production and performance of triploid Atlantic salmon in Scotland, Can Tech Rep Fish Aquat Sci, 1789, 15–36. komen h, thorgaard g h (2007) Androgenesis, gynogenesis and the production of clones in fishes: A review, Aquaculture, 269, 150–73. leitão a, boudry p, mccombie h, gérard a, thiriot-quiévreux c (2001a), Experimental evidence for a genetic basis to differences in aneuploidy in the Pacific oyster (Crassostrea gigas), Aquat Living Resour, 14, 233–7. leitão a, boudry p, thiriot-quiévreux c (2001b) Evidence of differential chromosome loss in aneuploid karyotypes of the Pacific oyster, Crassostrea gigas, Genome, 44, 735–7. lincoln r f, scott a p (1984) Sexual maturation in triploid rainbow trout, Salmo gairdneri Richardson, J Fish Biol, 25, 385–92. luckenbach j a, godwin j, daniels h v, borski r j (2003) Gonadal differentiation and effects of temperature on sex determination in southern flounder (Paralichthys lethostigma), Aquaculture, 216, 315–27. maclean n, laight r j (2000) Transgenic fish: An evaluation of benefits and risks, Fish Fish, 1, 146–72. martin-robichaud d j, peterson r h, benfey t j, crim l w (1994) Direct feminization of lumpfish (Cyclopterus lumpus L.) using 17ß-oestradiol-enriched Artemia as food, Aquaculture, 123, 137–51. maxime v (2008) The physiology of triploid fish: current knowledge and comparisons with diploid fish, Fish Fish, 9, 67–78.
162
New technologies in aquaculture
mccombie h, lapègue s, cornette f, ledu c, boudry p (2005) Chromosome loss in bi-parental progenies of tetraploid Pacific oyster Crassostrea gigas, Aquaculture, 247, 97–105. myers j m, hershberger w k (1991) Early growth and survival of heat-shocked and tetraploid-derived triploid rainbow trout (Oncorhynchus mykiss), Aquaculture, 96, 97–107. nam y k, kim d s (2004) Ploidy status of progeny from the crosses between tetraploid males and diploid females in mud loach (Misgurnus mizolepis), Aquaculture, 236, 575–82. nrc committee on biological confinement of genetically engineered organisms (2004), Biological Confinement of Genetically Engineered Organisms, Washington, DC, National Academies Press. o’flynn f m, mcgeachy s a, friars g w, benfey t j, bailey j k (1997) Comparisons of cultured triploid and diploid Atlantic salmon (Salmo salar L.), ICES J Mar Sci, 54, 1160–5. ojolick e j, cusack r, benfey t j, kerr s r (1995) Survival and growth of all-female diploid and triploid rainbow trout (Oncorhynchus mykiss) reared at chronic high temperature, Aquaculture, 131, 177–87. pandian t j, kirankumar s (2003) Recent advances in hormonal induction of sexreversal in fish, J Appl Aquac, 13, 205–30. pandian t j, koteeswaran r (1998) Ploidy induction and sex control in fish, Hydrobiologia, 384, 167–243. peterson r h, harmon p r (2005) Changes in condition factor and gonadosomatic index in maturing and non-maturing Atlantic salmon (Salmo salar L.) in Bay of Fundy sea cages, and the effectiveness of photoperiod manipulation in reducing early maturation, Aquact Res, 36, 882–9. piferrer f (2001) Endocrine sex control strategies for the feminisation of teleost fish, Aquaculture, 197, 229–81. poss k d, nechiporuk a, stringer k f, lee c, keating m t (2004) Germ cell aneuploidy in zebrafish with mutations in the mitotic checkpoint gene mps1, Genes Develop, 18, 1527–32. purdom c e (1984) Atypical modes of reproduction in fish, in Clarke J R (ed.), Oxford Reviews of Reproductive Biology, Oxford, Oxford University Press, 303–40. refstie t (1981) Tetraploid rainbow trout produced by cytochalasin B, Aquaculture, 25, 51–8. refstie t, vassvik v, gjedrem t (1977) Induction of polyploidy in salmonids by cytochalasin B, Aquaculture, 10, 65–74. rodriguez l, begtashi i, zanuy s, carrillo m (2005) Long-term exposure to continuous light inhibits precocity in European male sea bass (Dicentrarchus labrax L.): hormonal aspects, Gen Comp Endocrinol, 140, 116–25. sakao s, fujimoto t, tanaka m, yamaha e, arai k (2003) Aberrant and arrested embryos from masu salmon eggs treated for tetraploidization by inhibition of the first cleavage, Nipp Suis Gakk, 69, 738–48. sakao s, fujimoto t, kimura s, yamaha e, arai k (2006) Drastic mortality in tetraploid induction results from the elevation of ploidy in masu salmon, Oncorhynchus masou, Aquaculture, 252, 147–60. schafhauser-smith d, benfey t j (2001) The reproductive physiology of three age classes of adult female diploid and triploid brook trout (Salvelinus fontinalis), Fish Physiol Biochem, 25, 319–33. schafhauser-smith d, benfey t j (2003a) In vitro steroid production by triploid ovarian follicles, Gen Comp Endocrinol, 133, 279–86.
Producing sterile and single-sex populations of fish for aquaculture
163
schafhauser-smith d, benfey t j (2003b) The effects of long-term estradiol-17β treatment on the growth and physiology of triploid brook trout (Salvelinus fontinalis), Gen Comp Endocrinol, 131, 9–20. shelton c j, macdonald a g, johnstone r (1986) Induction of triploidy in rainbow trout using nitrous oxide, Aquaculture, 58, 155–9. silverstein j t, shimma h (1994) Effect of restricted feeding on early maturation in female and male amago salmon, Oncorhynchus masou ishikawae, J Fish Biol, 45, 1133–5. smith l t, lemoine h l (1979) Colchicine-induced polyploidy in brook trout, Prog Fish-Cult, 41, 86–8. solar i i, hajen w e, donaldson e m (1992) A bibliography of tetraploidy in fish (1964–1991), Can Tech Rep Fish Aquat Sci, 1901, 1–22. tessema m, muller-belecke a, horstgen-schwark g (2006) Effect of rearing temperatures on the sex ratios of Oreochromis niloticus populations, Aquaculture, 258, 270–7. thiriot-quiévreux c, pogson g h, zouros e (1992) Genetics of growth rate variation in bivalves: aneuploidy and heterozygosity effects in a Crassostrea gigas family, Genome, 35, 39–45. tvedt h b, benfey t j, martin-robichaud d j, mcgowan c, reith m (2006) Gynogenesis and sex determination in Atlantic halibut (Hippoglossus hippoglossus), Aquaculture, 252, 573–83. ueda t, kobayashi m, sato r (1986) Triploid rainbow trouts induced by polyethylene glycol, Proc Jap Acad Ser B, 62, 161–4. ueda t, sawada m, kobayashi j (1987) Cytogenetical characteristics of the embryos between diploid female and triploid male in rainbow trout, Jap J Genet, 62, 461–5. ueda t, sato r, kobayashi j (1988) Triploid rainbow trout induced by high-pH-highcalcium, Nipp Suis Gakk, 54, 2045. unwin m j, rowe d k, poortenaar c w, boustead n c (2005) Suppression of maturation in 2-year-old Chinook salmon (Oncorhynchus tshawytscha) reared under continuous photoperiod, Aquaculture, 246, 239–50. vrijenhoek r c (1994) Unisexual fish: model systems for studying ecology and evolution, Ann Rev Ecol Syst, 25, 71–96. wang z, guo x, allen jr s k, wang r (1999) Aneuploid Pacific oyster (Crassostrea gigas Thunberg) as incidentals from triploid production, Aquaculture, 173, 347–57. wong a c, van eenennaam a l (2008) Transgenic approaches for the reproductive containment of genetically engineered fish, Aquaculture, 275, 1–12. yamaki m, arai k (2000) Ploidies of gametes produced by putative tetraploid amago salmon induced by inhibition of the first cleavage, Bull Fac Fish Hokkaido Univ, 51(3), 135–52. yamaki m, satou h, taniura k, arai k (1999) Progeny of the diploid-tetraploid mosaic amago salmon, Nipp Suis Gakk, 65, 1084–9. yamamoto e (1999) Studies on sex-manipulation and production of cloned populations in hirame, Paralichthys olivaceus (Temminck et Schlegel), Aquaculture, 173, 235–46. zhang x, onozato h (2004a) Hydrostatic pressure treatment during the first mitosis does not suppress the first cleavage but the second one, Aquaculture, 240, 101–13. zhang x, onozato h (2004b) Allo-eudiploidy of the diploid cells in diploid-tetraploid mosaic hybrids between female rainbow trout Oncorhynchus mykiss and male amago salmon O. rhodurus, Fish Sci, 70, 924–6.
164
New technologies in aquaculture
zhang x, mutsukawa k, onozato h (2005) Correlation between delay in the earlier cleavage stage and the tetraploidization rate in rainbow trout Oncorhynchus mykiss embryos treated with heat or hydrostatic pressure shock during the first cell cycle, Fish Sci, 71, 239–41. zou s, li s, cai w, zhao j, yang h (2004) Establishment of fertile tetraploid population of blunt snout bream (Megalobrama amblycephala), Aquaculture, 238, 155–64. zouros e, thiriot-quiévreux c, kotoulas g (1996) The negative correlation between somatic aneuploidy and growth in the oyster Crassostrea gigas and implications for the effects of induced polyploidization, Gen Res, 68, 109–16.
6 Chromosome set manipulation in shellfish X. Guo, Y. Wang, Z. Xu, Rutgers University, USA, and H. Yang, Louisiana State University Agriculture Center, USA
Abstract: Chromosome set manipulation may produce phenotypic changes that are useful in aquaculture. Chromosome set manipulation in shellfish has led to the production of polyploid, gynogenetic and aneuploid animals. While studies on gynogenetic and aneuploid shellfish have been largely academic, research on polyploids has made significant contributions to shellfish aquaculture. Triploids have been produced and evaluated in many species. Triploid shellfish grow significantly faster than diploids in most species studied so far. Their sterility often results in improved meat quality and provides biological containment of cultured stocks. Triploids have become an important part of the oyster farming industry and may have similar potential in other shellfish. Tetraploids have been successfully produced and used for triploid production in oysters. Tetraploid induction in other species remains a major challenge that hinders commercial production of triploids. Key words: triploidy, tetraploidy, gynogenesis, sterility, shellfish, genome adaptation.
6.1 Introduction Shellfish are major aquaculture species. Shellfish species account for more than one third of the world total aquaculture production (FAO, 2007). Common aquaculture species include oysters, clams, scallops, mussels, abalone, shrimp, crawfish and crabs. They support major aquaculture industries in many countries. Various efforts have been made to genetically improve the performance of cultured shellfish. Selective breeding has been used to produce superior strains (see Chapter 3). Increasingly, biotechnical approaches are being applied to the genetic improvement of shellfish stocks (Guo, 2004).
166
New technologies in aquaculture
Chromosome set manipulation can be used to create new chromosome constructs that are potentially useful for aquaculture. Most animals including shellfish possess two sets of chromosomes with one set from the mother and the other from the father, a condition known as diploidy. We can alter the normal process of chromosome inheritance and create a range of variations in chromosome number and composition. Variations in chromosome number may involve partial or complete sets of chromosomes. The condition where a cell or organism has incomplete sets of chromosomes is referred to as aneuploidy, and the condition of having complete sets of chromosomes is called euploidy. Euploid conditions include normal diploidy with two sets of chromosomes, as well as haploidy with one and polyploidy with three or more sets of chromosomes. Triploidy and tetraploidy are common polyploid conditions with three and four sets of chromosomes, respectively. In addition to changes in chromosome number, the parental origin of chromosomes can also be changed. Uniparental inheritance can be obtained by excluding chromosomes from one of the parents. Uniparental inheritance based on maternal and paternal chromosomes is referred to as gynogenesis and androgenesis, respectively. The diploid chromosome complement of an organism represents rigid genome organization derived from millions of years of evolution and adaptation. Chromosome number within species or genera is usually conserved. For example, all oysters have a diploid number of 20 chromosomes, and most clams and scallops have a diploid number of 38 (Thiriot-Quiévreux, 2002; Wang and Guo, 2004; Wang et al., 2004). Changes in chromosome number are serious mutations that may have profound consequences. Chromosome mutations can be lethal or result in significant changes in phenotype, but some changes in phenotype can be beneficial for aquaculture. Triploid shellfish, for example, may be sterile and grow faster than normal diploids (Nell, 2002; Guo, 2004). Gynogenesis and androgenesis can potentially be used for the rapid production of inbred lines and for sex control. Because of these and other potential benefits, chromosome set manipulation has been investigated in many shellfish species. This chapter introduces basic principles and methods of chromosome set manipulation, examines available data and provides perspectives for future research and development.
6.2 Principles and methods of chromosome set manipulation 6.2.1 Reproduction in shellfish Most shellfish species are dioecious and reproduce sexually. Sexual dimorphism is evident in most crustaceans and some molluscs. In crustaceans and gastropods, sexual dimorphism is often expressed as differences in sexual
Chromosome set manipulation in shellfish
167
organs and body size (Landau, 1992). In bivalve molluscs such as scallops and clams, female and male gonads may exhibit different colours. In the Chinese scallop Chlamys farreri, Japanese scallop Patinopecten yessoensis, Atlantic sea scallop Placopecten magellanicus, and dwarf surfclam Mulinia lateralis, female gonads are usually orange to red, while male gonads are milky white, and this ability to identify sex is advantageous in chromosome set manipulation because early and accurate separation of sexes can reduce the chance of uncontrolled fertilization or contamination. Most shellfish have exceptionally high fecundity. A two-year old female Pacific oyster Crassostrea gigas may produce 20–50 million eggs. Spawning in molluscan shellfish can be induced by thermal stimulation, feeding, ultraviolet (UV)-treated seawater and serotonin (Landau, 1992; Guo et al., 1999). During spawning, female and male shellfish release their gametes into surrounding water and fertilization takes place outside the body cavity, although there are some exceptions. Most crustaceans go through copulation, and males deposit spermatophores into females (Landau, 1992) and in this case fertilization occurs when the females release their eggs. Some molluscs such as Argopecten scallops and Ostrea oysters are hermaphrodites, although they may avoid self-fertilization by releasing sperm and eggs at different times. When released, eggs of most shellfish are resting at the prophase or metaphase of meiosis I (Gilbert, 1988). Fertilization triggers the resumption of meiosis I and II, which release polar body I (PB1) and II (PB2), respectively. Fertilized eggs go through rapid development and, depending on the temperature, develop into swimming larvae within 10–24 h. Most shellfish have a long planktonic larval stage (several weeks), during which larvae can disperse over long distances. Shellfish larvae usually go through some form of metamorphosis at the end of the larval period. High fecundity, external fertilization and free-living larvae make most shellfish good candidates for chromosome set manipulation, although some species such as crabs, freshwater shrimp and Ostrea oysters brood their eggs, making chromosome set manipulation more challenging.
6.2.2 Principles and approaches The objective of chromosome set manipulation is to create new chromosome combinations by altering the normal process of fertilization, meiosis, mitosis and zygote formation. Many types of manipulation are possible in shellfish. Unlike fish eggs that usually complete meiosis I before maturation, shellfish eggs rest at the metaphase of meiosis I (Gilbert, 1988), making both meiosis I and II accessible to manipulation. Meiosis I, II or both can be inhibited, causing the retention of polar bodies and therefore extra chromosome sets. The first mitosis of the zygote can be blocked, which may result in chromosome doubling, and gamete chromosomes from one of the sexes can be inactivated to produce uniparental inheritance which is called
168
New technologies in aquaculture
gynogenesis or androgenesis. The many types of manipulation and their combinations can produce a variety of new chromosome variants, although not all of them are viable or useful for aquaculture. Haploids, for example, can be easily created by gynogenesis, but they are not viable and of no practical benefit. Haploid embryos, however, are useful for certain genetic analysis. For shellfish genetics and breeding, the most relevant chromosome constructs are triploids, tetraploids, gynogenetic diploids and aneuploids. We will examine how these variants are created. The principles of chromosome set manipulation are illustrated in Fig. 6.1. Triploidy is produced by blocking meiosis II in normally fertilized zygotes. Blocking meiosis II retains PB2 which contains one set of chromosomes. During normal development, PB2 is released, leaving the egg with one set of maternal chromosomes. The maternal set of chromosomes unites with the paternal set from the sperm and forms a diploid zygote (Fig. 6.1). The retention of PB2 adds an extra set of maternal chromosomes to the diploid zygote, producing triploidy. Meiosis II blocking is widely used for the production of triploids in fish and shellfish species (Thorgaard, 1983; Beaumont and Fairbrother, 1991). The same process that produces triploids in normally fertilized eggs produces meiotic gynodiploids in gynogenetically activated eggs when sperm chromosomes are inactivated (Fig. 6.1). Inhibition of mitosis I leads to the doubling of chromosomes and formation of tetraploids in normally fertilized eggs or mitotic gynodiploids in gynogenetically activated eggs (Fig. 6.1). Mitotic gynodiploids, also known as double-haploids, are completely homozygous at all loci and particularly useful for the creation of inbred lines and genetic mapping (Thorgaard, 1983; Young et al., 1998). Tetraploids can also be created by blocking meiosis I and II in gynogenetically activated eggs (Fig. 6.1). Blocking meiosis I and II in normally fertilized eggs produces pentaploids (Fig. 6.1), which die before reaching D-stage (Cooper and Guo, 1989). While it is easy to understand that blocking meiosis II in normal zygotes produces triploidy (Fig. 6.1), blocking meiosis I is more complex. Blocking meiosis I was initially considered as a method for triploid induction. In the eastern oyster Crassostrea virginica, blocking meiosis I produced triploids as detected at adult stages (Stanley et al., 1981, 1984). In the Pacific oyster, however, meiosis I blocking resulted in predominantly tetraploids as detected at early embryonic stages by flow cytometry (Stephens, 1989). Chromosome counting of resultant embryos, however, revealed that blocking meiosis I produced not only triploids and tetraploids, but also high percentages of aneuploids (Guo et al., 1992a). Segregation analysis showed that blocking meiosis I significantly altered chromosome segregation during meiosis II (Guo et al., 1992b). It led to abnormal tripolar segregations in the majority of treated eggs and the formation of aneuploids (Fig. 6.2). Some studies have reported high percentages of triploids from meiosis I blocking as detected at adult stages (Stanley et al., 1984; Yang and Guo, 2006a), probably because most aneuploids are not viable and only triploids
Chromosome set manipulation in shellfish Normal fertilization
10
Gynogenesis
10
M1
M1
10
UV treated sperm
10 10
10 10 10
Blocking M1&2
PB1 M2 10
Blocking M1&2
Blocking M1 only
10
20
PB1
Abnormal segregation Aneuploids
20
10 M2
10
20 20
20 20
10 10 10
10
10 10
Blocking M2
Blocking M2 PB1
PB2
PB1
PB2
10 10
40
10
10
10
50
20
10 40
10
40
10
50
Pentaploid
20
30
40
20
Diploid
Tetraploid
Triploid
10
10
20
Blocking mitosis
Blocking mitosis
50
169
30
30
Triploid
Aneuploid
40
40
Tetraploid
10
10
Haploid
20
20
20
Meiotic Mitotic gynodiploid gynodiploid 100 % inbred Sex control
Fig. 6.1 Schematic presentation of chromosome set manipulation in shellfish. Left: in normal zygotes, blocking meiosis I (M1) and II (M2) produces pentaploids, blocking M2 produces triploids, blocking mitosis I produces tetraploids, and blocking M1 produces abnormal segregation and aneuploids. Right: in gynogenetically activated eggs, blocking M1 and M2 produces tetraploids, blocking M2 produces meiotic gynodiploids, and blocking mitosis I produces mitotic gynodiploids. Bottom: crossing diploids and tetraploids produces triploids, and crossing diploids and triploids produces aneuploids.
can survive. Because of the production of aneuploids and reduced survival, blocking meiosis I is no longer considered a good approach for triploid production. On the other hand, triploids produced from meiosis I blocking may grow faster than meiosis II triploids (Stanley et al., 1984; Beaumont and Kelly, 1989; Hawkins et al., 1994), and blocking meiosis I may produce some tetraploids (Yang et al., 2000b), which are desired for triploid production.
170
New technologies in aquaculture
10
MI
10 Blocking polar body I with cytochalasin B A
B 10 10
10 10
10
10
D
10
E
10 10 10
10 10
5
10 10
C
10 10
10 10
10
10
PB1 MII
7
20
7 10
10
10 10
20 20
10
10
= 20
PB2 10
10
5
6
10
10
10
2n Normal segregation
3n United bipolar
100 %
7%
10
13
13
14 13
15 15
10 10 10 10
10
10
10
= 13 14 13 10
= 10 15 15 10
3.7n/2.4n Randomized tripolar 68 %
4n/2.5n Unmixed tripolar
= 10/20 10/0 15 15 10
4n/3n/2n Separated bipolar 12 %
Fig. 6.2 Blocking meiosis I produces abnormal tripolar segregations of chromosomes during meiosis II and a wide range of aneuploids (from Guo et al., 1992b).
Once produced, tetraploids can be crossed with normal diploids to produce 100 % triploids, and triploids can be crossed with diploids to create aneuploids (Fig. 6.1). Gynogenetic diploids may be used to create inbred lines and monosex populations.
6.2.3 Methods for inhibiting meiosis and mitosis Meiotic and mitotic divisions can be blocked by a number of chemical and physical treatments. Cell division depends on the assembly of microtubules
Chromosome set manipulation in shellfish
171
and microfilaments, and any agent that affects their synthesis and function can potentially block cytokinesis. In general, inhibiting meiosis is easier than blocking the first mitotic division, because the latter involves the complete cleavage of eggs. Several treatments have been tested for meiosis and mitosis inhibition in shellfish, showing varying degrees of effectiveness. These include heat shock, cold shock, pressure shock, cytochalasin B (CB), 6-dimethylaminopurine (6DMAP), caffeine, colchicine and nocodazole (Beaumont and Fairbrother, 1991; Guo, 1991; Guo et al., 1994; Scarpa et al., 1994; Dunstan et al., 2007). Among physical treatments, heat shock appears to be the most effective. In blue mussel Mytilus edulis, for example, a 10 min heat shock of 32 ºC applied at 20 min post-fertilization produced 97.4 % triploids (Yamamoto and Sugawara, 1988). In the dwarf surfclam Mulinia lateralis, a 35 ºC heat shock targeting meiosis I produced 82.5–98.5 % triploids at juvenile stages (Yang and Guo, 2006a). Heat shock is also effective in shrimp. Up to 100 % triploidy has been induced using heat shock in the Chinese shrimp Penaeus chinensis (Li et al., 2003b; Xiang et al., 2006). Cold shock and pressure shock have been tested in several shellfish species (Arai et al., 1986; Yamamoto and Sugawara, 1988; Guo, 1991; Liang et al., 1994; Yang and Guo, 2006b), but they are not as effective as heat shock. Among chemical treatments, CB and 6DMAP are clearly more effective than others. CB is a specific and reversible inhibitor of microfilaments, which are required for the formation of division furrow during cytokinesis. CB does not affect chromosome movement which is controlled by microtubules (Longo, 1972; Guo et al., 1992b). CB is probably the most frequently tested and used chemical for chromosome set manipulation in molluscan shellfish. It is highly effective in blocking meioses but less so in blocking mitosis I. CB can produce 70–100 % triploids by blocking meiosis II if treatments are applied correctly (Downing and Allen, 1987; Guo and Allen, 1994b). The effective dosage for CB ranges from 0.1 to 1.0 mg/l and, since CB is not water soluble, the stock solution is made by dissolving it in dimethylsulfoxide (DMSO) at 1 mg/ml. For triploid induction, the success rate depends on how synchronized the egg development is and how precisely the treatment is applied to target meiosis II. Typically, a 10–20 min treatment with 0.5 mg/l CB, applied when 60 % of the eggs release PB1 or as soon as PB2 is observed, gives good results. While CB works well in molluscs, it is not very effective in crustaceans and finfish, probably because eggs of crustaceans and finfish have a chitinous shell, which cannot be easily penetrated by CB. While CB is effective, it is also highly toxic and poses health risks for people who handle it. Double nitrile gloves should be used when working with CB. In the USA, the FDA has banned the use of CB in commercial shellfish hatcheries. Alternatively, 6DMAP can be used for triploid induction (Desrosiers et al., 1993) as it is water soluble and less toxic than CB. It is a kinase inhibitor, probably targeting enzymes required for cytokinesis.
172
New technologies in aquaculture
High percentages (>80 %) of triploids have been produced using 6DMAP in several species including Mytilus edulis (Brake et al., 2004), Haliotis rubra (Liu et al., 2004), Haliotis laevigata (Dunstan et al., 2007) and Penaeus japonicas (Sellars et al., 2006b; Coman et al., 2008). The effective dosage of 6DMAP ranges from 75–400 μM. A direct comparison finds that CB treatment results in higher percentages of triploids and lower mortality than 6DMAP (Nell et al., 1996). In another study, heat shock was highly effective in blocking mitosis I and producing tetraploidy (up to 98 %), while 6DMAP failed (Sellars et al., 2006a). It appears that 6DMAP is almost as effective as CB in blocking meiosis II, but not in inhibiting meiosis I and mitosis I. The results for caffeine are variable. In Mytilus galloprovincialis, caffeine treatments targeting meiosis II produced only 4.7–7.5 % triploids (Scarpa et al., 1993), while in Haliotis discus hannai it produced 91–100 % triploids by blocking meiosis I (Okumura et al., 2007). It is unknown if caffeine affects meiosis I and II differently, or whether the discrepancy is due to inherent inconsistence of the treatment. Further evaluation is needed.
6.2.4 Inactivation of gamete chromosomes Gynogenesis and androgenesis require the inactivation of gamete chromosomes. Gamete chromosomes can be inactivated with several methods including UV irradiation, X-ray, γ-ray and chemicals such as toluidine blue (Thorgaard, 1983; Guo, 1991). UV irradiation is an effective and popular method for inactivating sperm chromosomes. UV light has weak penetrating power, and sperm samples should be treated in a thin layer (1 mm). The dosage of UV varies greatly among studies and may be influenced by the age of the lamp, temperature and sperm concentration. It should be empirically determined for each species and experiment. As examples, sperm chromosomes have been successfully inactivated by a 5–6 min treatment at 1080 μW/cm2/s in C. gigas (Guo et al., 1993), 2 min treatment at 620 μW/cm2/s in Mytilus galloprovincialis (Scarpa et al., 1994) and 1.5 min treatment at 1400 μW/cm2/s in Mulinia lateralis (Guo and Allen, 1994b). Toluidine blue (5 μM for 29 min) can also inactivate sperm chromosomes of C. gigas, but the treatment is sensitive to light and often produces inconsistent results (Guo, 1991). In fish, X-ray or γ-ray is commonly used for the inactivation of egg chromosomes (Thorgaard, 1983) but, because shellfish eggs are small, their chromosomes can be inactivated with UV irradiation (Li et al., 2004).
6.2.5 Identification of polyploids and uniparental inheritance A key component of chromosome set manipulation is the identification or confirmation of new chromosome variants. Positive identification is
Chromosome set manipulation in shellfish
173
essential for evaluating induction success and the performance of induced polyploids and aneuploids. Polyploids can be identified by chromosome counting, nucleus size and flow cytometry (FCM) analysis of DNA content. Chromosome counting is direct, accurate, but also labour intensive (Guo et al., 1992a). Nucleus size has also been used to identify polyploids in a few studies (Komaru et al., 1988; Utting and Child, 1994). FCM is probably the fastest and most reliable method for the identification of polyploids (Allen, 1983; Guo et al., 1996). It can accurately identify hundreds of samples in a day. However, FCM cannot detect small variations in DNA content or identify aneuploids. The identification of aneuploids requires chromosome counting. The success of inhibiting meiosis I or II can be verified with fluorescence staining of polar bodies and nuclei (Scarpa et al., 1994). Briefly, eggs are fixed in ethanol or formalin. Drops of embryos are placed on a slide and stained for 3–10 min with a fluorescence dye such as 4,6-diamidine-2phenylindole (DAPI). A coverglass is applied to the slide and gently pressed to flatten the eggs and remove excess stain. Segregation patterns and the presence of polar bodies can then be observed under an epifluorescence microscope. A fluorescence-stained egg is shown in Fig. 6.3A. Chromosome counting is easier with early embryos than with adults. Embryonic cells are actively dividing and provide abundant metaphases for analysis. With embryos, metaphases can be prepared using the squashing and orcein-staining method (Guo et al., 1992b). Since the orcein-staining method does not break cells, metaphases can be counted with confidence. More than one metaphase can be counted in most embryos (Fig. 6.3B). For adult shellfish, gill or gonad is often used for chromosome preparation. Animals are treated with colchicine (0.005 % for 4–8 h) to stop cells at metaphase (Guo et al., 2007). Tissues are dissected and treated with a hypotonic solution (0.075 M KCl) for 10–20 min before fixation in Carnoy’s fixative (3 : 1 of methanol : acetic acid). Metaphase spreads are made by airdrying and stained with Leishman’s stain. The air-drying and Leishmanstaining method produces high-quality metaphases with no or little background (Fig. 6.3C). However, the air-drying method may disrupt metaphases and create artificial chromosome loss. Care should be taken during screening, and only metaphases showing no obvious signs of chromosome loss are counted. For FCM, fresh tissue gives the best results. Fresh tissues can be frozen in the staining buffer that contains 10 % DMSO (Allen, 1983; Guo et al., 1996). When working with fresh samples is not possible, tissues can be fixed in ethanol (Yang et al., 2000a). Because FCM measures relative DNA content and fluorescence signals can vary considerably, it is important that diploids are always used as reference (Fig. 6.3D), and reference samples should be prepared in the same way as test samples. Success in gynogenesis and androgenesis must be genetically verified. Cross-contamination of experimental groups by normal gametes or larvae
174
New technologies in aquaculture
A
C
B
1200 count
D
2
1000 800 600 1
400 200
3 0 0
50
100
150
200
250
300
Fig. 6.3 Cytogenetic techniques used for the verification of chromosome set manipulation in shellfish: A, a fluorescence-stained egg of C. gigas showing only polar body I after treatment; B, a triploid embryo of C. virginica showing two triploid metaphases (3n = 30) and PB1 only; C, two metaphases of C. virginica showing trisomy (2n + 1) with 21 chromosomes; and D, flow cytometry analysis of a triploid oyster (peak 2) using a diploid as reference (peak 1).
is common, especially when the survival of gynogenetic or androgenetic animals is low. Uniparental inheritance can be confirmed with the use of multiple codominant markers such as allozymes or microsatellites (Guo and Gaffney, 1993).
6.3 Triploid shellfish Triploid shellfish were first reported in the eastern oyster by Stanley et al. (1981). Since then, triploids have been induced in dozens of shellfish species. However, many studies are limited to reporting induction success and larval survival, and adult performance of triploid shellfish is not well documented in most species. Triploid shellfish can be produced with three methods: inhibiting meiosis II, inhibiting meiosis I and crossing diploids and tetraploids, and the three
Chromosome set manipulation in shellfish
175
types of triploids may differ considerably in performance. So far, most of the performance data have been collected from triploids produced by inhibiting meiosis but, as we will see, natural triploids produced from tetraploids greatly out-perform induced triploids. Therefore, data from induced triploids may grossly underestimate the full potential of triploid shellfish.
6.3.1 Larval performance It is well documented that triploid induction reduces larval survival. Treated larvae often experience heavy mortality. For example, in Mulinia lateralis, the relative survival (with diploids as 100 %) of treated larvae to day 8 is 55.3 % (Guo and Allen, 1994b) and in C. gigas, the relative survival of treated larvae to day 2 ranges from 16.8–57.8 % depending on treatment temperature (Downing and Allen, 1987). In another study on the same species, the relative survival of the treated larvae to day 1 is 5.3 % (Guo et al., 1996), while that of natural triploids is 79.1 %. The difference in survival between natural triploids and diploids is not significant. Clearly, the reduced survival is not an inherent problem of triploidy, but is caused by induction treatments or genetic defects associated with induced triploids. Retention of PB2 may be deleterious because of homozygosity or imprinting. The larval growth of induced triploids is either faster or about the same as diploids (Downing and Allen, 1987; Guo et al., 1996). Larval growth is sensitive to culture density. As induced triploids experience high mortality, they may enjoy low culture density compared with diploid controls. Therefore, larval growth of induced triploids should be viewed with caution, unless equal densities are strictly maintained. There is no question, however, that in C. gigas, larvae of natural triploids grow significantly faster than normal diploids from day 1 (Guo et al., 1996). When reaching the eyedstage, diploid larvae are usually 250–260 μm in size, while natural triploid larvae are about 280–300 μm (Guo, unpublished).
6.3.2 Growth Post-larval growth of triploids has been evaluated in over 20 shellfish species and, in most of the species studied so far, triploids grow significantly faster than diploid controls (Table 6.1). The superior growth of triploids is most pronounced in oysters and, in fact, triploid oysters have shown superior growth in all species and studies reported to date. In early studies where triploids were produced by inhibiting meiosis I or II, triploids typically grew 10–40 % faster than diploids (Stanley et al., 1984; Allen and Downing, 1986; Barber and Mann, 1991; Maguire et al., 1995). In Saccostrea glomerata, triploids’ advantage in growth is remarkable and consistent, with four studies reporting 36–74 % growth increases in triploids, averaging 53 % (Nell et al., 1994; Hand et al., 1999, 2004; Troup et al., 2005). In C. virginica and Ostrea edulis, meiosis I triploids grow significantly faster than diploids, while
Scallop Argopecten irradians Argopecten ventricosus Chlamys farreri
Crassostrea madrasensis Crassostrea talienwhanensis Ostrea edulis Saccostrea glomerata
Crassostrea gigas
Oyster Crassostrea virginica
Species
CB, 0.05–0.10 mg/L CB, 0.5 mg/L CB, 0.5–0.9 mg/L
CB, 0.5 mg/L CB, 0.5 mg/L CB, 1.0 mg/L 4n 4n CB, 1.0 mg/L CB or 6DMAP CB, 0.5 mg/L CB, 1.0 mg/L CB, 0.5 mg/L; 4n 4n 4n 6DMAP, 100 μM Cold: 2–8 ºC CB, 1.0 mg/L CB, 0.5 mg/L CB, 1.25 mg/L CB, 1.0 mg/L CB, 1.25 mg/L
Method1
66–94 8–58 18
61–72 96 85 100 100 71–96 86 76 84 82–100 100 99–100 na 43–70 na 85 73–93 75–79 na
%3N
36, 73 (muscle) 55, 161 (muscle)3 5, 44 (muscle)
12–41 30 67 82–192 91–109 28 40 20–23 80–150 14; 26 25–51 159 128–2603 52 (length) 61 (PB1); −8 (PB2) 41 36–57 74 49
% increase2
1 1 1.2
3 2 1.4 1.3 1.5 1.5 0.8 2.3–3.2 1.5–2 1 0.8 1 1 1 1.25 2.5 2 1.3 3.2
Age (y)
Tabarini, 1984 Ruiz-Verdugo et al., 2000 Yang et al., 2000b
Stanley et al., 1984 Barber and Mann, 1991 Matthiessen and Davis, 1992 Guo et al., 2008 Allen, pers comm Allen and Downing, 1986 Garnier-Gere et al., 2002 Maguire et al., 1995 Akashige and Fushimi, 1992 Wang et al., 2002 Guo et al., 1996 Nell and Perkins, 2005 Mallia et al., 2006 Liang et al., 1994 Hawkins et al., 1994 Nell et al., 1994 Hand et al., 1999 Hand et al., 2004 Troup et al., 2005
Source
Table 6.1 Induction and post-larval growth of triploid shellfish, with growth measured as percent increase in body size (whole body weight unless otherwise noted) of triploids over diploid controls
Shrimp Fenneropenaeus chinensis Penaeus japonicus
3
2
43–100 73–93
28 Smaller
13–34 30 (tissue) −17 (length)
18–44
23–30 30–54 83 92
34, 63 (tissue) Larger (PB1)
8 0 72 −15 0 (length) 0 0 0
18, 42 (muscle) 40, 67 (muscle) −11, 13 (muscle)
83 26–67
30 62–100 21–100 44 56–85 35 50–80 70–77
75 44–90 48–95
0.5 0.5–1
0.33 3 0.5
2
1.9 0.1
4 1.5 0.3 1 0.06 1 1–3 0.25
1.2 1 1.8
Induction method: CB = cytochalasin B; 6DMAP = 6-dimethyaminopurine; 4n, tetraploid crossing with diploid. Percent increase: PB1 = blocking the release of polar body I; PB2 = blocking the release of PB2. Triploids are not verified.
Heat: 29–32 ºC 6DMAP, 150 μM
Abalone Haliotis discus hannai Haliotis laevigata Haliotis rubra
1
6DMAP, 75–150 μM 6DMAP, 100 μM CB, 0.5 mg/L
Pinctada martensii
CB, 1.0 mg/L CB, 1.0 mg/L CB, 0.5 mg/L CB, 1.0 mg/L CB, 1.0 mg/L CB, 0.5 mg/L CB CB, 0.5 mg/L
CB, 0.5 mg/L CB, 0.5 mg/L CB, 0.5–1 mg/L
6DMAP, 400 μM CB, 0.1, 0.5, 1 mg/L Heat: 25, 30 ºC CB, 0.75–1.0 mg/L
Mussel Mytilus edulis
Mulinia lateralis Mya arenaria Tapes dorsatus Tapes philippinarum
Clam Mercenaria mercenaria
Nodipecten subnodosus
Chlamys nobilis
Xiang et al., 2006 Coman et al., 2008
Zhang et al., 1998 Dunstan et al., 2007 Liu et al., 2004
Jiang et al., 1993
Brake et al., 2004 Beaumont and Kelly, 1989
Eversole et al., 1996 Yang and Guo, unpubl. Guo and Allen, 1994b Mason et al., 1988 Nell et al., 1995 Shpigel and Spencer, 1996 Ekaratne and Davenport, 1993 Utting and Child, 1994
Komaru and Wada, 1989 Lin et al., 1995 Maldonado-Amparo et al., 2004
178
New technologies in aquaculture
meiosis II triploids do not (Stanley et al., 1984; Hawkins et al., 1994). For natural triploids produced from diploid × tetraploid crosses, the increase in growth is even more impressive. Natural triploids grow up to 159 % faster than diploids in C. gigas (Nell and Perkins, 2005) and up to 190 % faster in C. virginica (Guo et al., 2008). The superior growth of natural triploids is remarkable even at three months of age (Fig. 6.4). It is also worth noting that in C. virginica natural triploids have shown significant improvements with successive generations of breeding of their tetraploid parents. Triploids produced from the first generation tetraploids grow 34 % faster
2n
3n
2n
3n
Fig. 6.4 Triploid (3n) C. virginica produced from tetraploids compares with their diploid (2n) controls at 3 (top) and 15 (bottom) months of age.
Chromosome set manipulation in shellfish
179
than diploid (Wang et al., 2005), while triploids produced from the second generation tetraploids grow 88–190 % faster than diploids (Guo et al., 2008). Superior growth has also been demonstrated for triploid scallops (Tabarini, 1984; Komaru and Wada, 1989; Lin et al., 1995; Ruiz-Verdugo et al., 2000; Yang et al., 2000b). Triploid scallops show 5 %, 18 %, 36 %, 40 % and 55 % increases in whole body weight in five separate studies (Table 6.1). In these same studies, triploids show even greater increases in adductor muscle weight, by 44 %, 42 %, 73 %, 67 % and 161 %, respectively. In Nodipecten subnodosus, triploids are 11 % smaller than diploids in whole body weight, but still 13 % bigger than diploids in adductor muscle weight (Maldonado-Amparo et al., 2004). These observations point to an interesting phenomenon that triploid scallops have greatly enlarged adductor muscles. Since adductor muscle is the marketed product for most scallops, any increases in adductor muscle mean not only higher yield, but also higher per unit price. Therefore, triploid scallops may have tremendous potential in aquaculture. Triploid mussels, abalone and shrimp have also shown increased body size or growth (Zhang et al., 1998; Brake et al., 2004; Xiang et al., 2006), although the magnitude is not as impressive as in oysters. In mussels, the highest increase is 44 % in whole body weight observed in Pinctada martensii, a pearl oyster but closely related to mussels (Jiang et al., 1993), and 63 % in tissue weight in Mytilus edulis (Brake et al., 2004). Data from clams are interesting albeit less encouraging for aquaculture. In all but one study, triploid clams are either smaller or about the same size as diploids (Table 6.1). Mulinia lateralis is an exception, where triploids are 72 % bigger than diploids and show nearly normal gonadal development (Guo and Allen, 1994b). Overall, it seems that, for some unknown reasons, triploid clams do not grow faster than diploids. This observation is interesting and deserves further investigation. The growth of triploids is strongly influenced by environmental conditions. It has been shown in several species that triploids from the same cohort may perform very differently at different locations. In general, the triploid advantage in growth is highest at warmer and more productive sites (Davis, 1989; Brake et al., 2004). This finding is not surprising, as in nutrientlimiting environments triploids may not grow faster than diploids even if they have greater potential. This may explain why triploids do not show superior growth in some of the studies. Despite the poor showing of triploids in a few clams, it is clear that triploids grow significantly faster than diploids in most shellfish species, and the cause of their increased growth or body size has been the subject of much discussion. Three hypotheses have been proposed, attributing the increased body size of triploids to increased heterozygosity, sterility or enlarged cell size (Guo and Allen, 1994b; Wang et al., 2002). The heterozygosity hypothesis suggests that the extra set of chromosomes in triploids increases heterozygosity (Stanley et al., 1984), which is often positively
180
New technologies in aquaculture
correlated with growth in diploids. Supporting the heterozygosity hypothesis, triploids produced by blocking meiosis I, which may have higher levels of heterozygosity, grow faster than triploids produced by blocking meiosis II (Stanley et al., 1984; Hawkins et al., 1994). In addition, natural triploids produced from tetraploids are more heterozygous and also grow faster than induced triploids (Wang et al., 2002, 2005). A positive correlation between heterozygosity and growth is observed among diploids and two types of triploids (Fig. 6.5). There are also observations arguing against the heterozygosity hypothesis. First, meiosis I triploids do not show superior growth in some species including Mytilus edulis (Beaumont et al., 1995) and Pinctada martensii (Jiang et al., 1993). In the latter species, meiosis II triploids are slightly larger than meiosis I triploids. Secondly, although existing at the group level, the correlation between body size and multilocus heterozygosity is absent at the individual level within groups (Jiang et al., 1993; Beaumont et al., 1995; Garnier-Gere et al., 2002; Wang et al., 2002). In the absence of a highly positive and significant correlation at the individual level, the heterozygosity hypothesis has to be viewed with caution. The sterility hypothesis argues that triploids, because of their sterility, may allocate more energy to somatic growth rather than gonad development. Normal diploids spawn in summer and expend a considerable amount of energy on reproduction, while triploids do not. The sterility hypothesis is supported by studies in which triploids grow faster than diploids only after sexual maturation (Allen and Downing, 1986; Brake et al., 2004). However, energy relocation cannot explain the observation that in many cases triploids are significantly larger than diploids long before sexual maturation (Guo and Allen, 1994b; Guo et al., 1996). In C. gigas, triploid larvae are significantly larger than diploids on day 1, and triploid juveniles are 51 % larger than diploids at eight months of age or 3–4 months prior to sexual maturation (Guo et al., 1996). In C. virginica, natural triploids are 1.6
0.6
1.4 0.4 1.2
0.3 0.2
1
Meat weight (g)
Heterozygosity
0.5
0.1 0.8
0 2n
3nCB
Heterozygosity
3nDT Meat weight (g)
Fig. 6.5 A positive correlation between meat weight and multilocus heterozygosity in diploids (2n), triploids produced by inhibiting meiosis II (3nCB) and triploids produced from tetraploids (3nDT) in the Pacific oyster (based on Wang et al., 2002).
Chromosome set manipulation in shellfish
181
165–180 % larger than diploids at 3 months of age or 8 months prior to their first reproductive season (Wang et al., 2006). In Mulinia lateralis, triploids are 72 % larger than diploids without showing signs of reduced gonadal development (Guo and Allen, 1994b). These data strongly suggest that sterility or energy relocation is not the major cause for the increased body size in triploids. Finally, the cell size hypothesis proposes that triploid cells are larger than diploids and automatically lead to increases in organ and body size (Guo and Allen, 1994b). Development in molluscs is mosaic, where increases in cell size are not compensated by a reduction in number (Gilbert, 1988). Supporting the cell size hypothesis, eggs from triploid C. gigas are about 54 % larger (Guo and Allen, 1994c), and adductor muscle cells of triploid Chlamys farreri are about 50 % larger (Yang and Guo, unpublished). The observation that natural triploids grow faster than induced triploids, seemingly against the cell size hypothesis, can be explained with potential genetic defects associated with meiosis inhibition. The cell size hypothesis also has its limitations as it cannot explain cases where triploids are more than 50 % bigger than diploids (Table 6.1), because the cell size increase in triploids should be proportional to the increase in DNA or about 50 %. Although all three hypotheses can explain some of the data, none of them can account for all the observations so a new synthesis is necessary. We propose here a unifying genome adaptation hypothesis to explain the greatly increased body size of natural triploids observed in oysters (Nell and Perkins, 2005; Guo et al., 2008). The genome adaptation hypothesis accepts that increased cell size and heterozygosity are primary and independent causes for the increased body size of triploids, and sterility contributes additional but secondary increases. Further, the hypothesis argues that newly established polyploid genomes are dynamic and have a greater potential to change and adapt. The great increase in body size of natural triploid eastern oysters (by 109–190 %, Guo et al., 2008) is the result of rapid genome adaptation, after two generations of selection on their tetraploid father. The rapid adaptation is possible because of the tremendous genetic variation created by the polyploid genome per se and possibly through non-Mendelian changes such as chromosome deletion, duplication and rearrangements due to multivalent formation (Guo and Allen, 1997) and unequal crossovers during meiosis. The genome adaptation hypothesis assumes no limits on body size increase and can explain the fact that natural triploids are larger than induced triploids, and become even larger when produced from the second generation tetraploids. In other words, natural triploid grow faster, because their tetraploid father has survived at least two generations of polyploidy (including their triploid grandmother), subjected to severe selection for growth and survival (relative to massive genetic variation in the polyploid genome), and become adapted to the polyploid condition. The genome adaptation hypothesis suggests that tetraploids can also be rapidly improved during the first few generations before reaching a new equilibrium for tetraploidy.
182
New technologies in aquaculture
6.3.3 Meat quality Because of their sterility, triploid molluscs may have improved meat quality during the spawning season (Allen and Downing, 1986). Most molluscs allocate a large portion (30–60 %) of their body to gonad production, and sexual maturation and reproduction often lead to a reduction in meat quality in normal diploids. For the half-shell oyster industry, animals with excessive gonadal material are considered as low-quality and oyster farms may have to stop or reduce production during the summer season. Because triploids have greatly reduced gonad development and are largely sterile, their meat quality is not affected by maturation and spawning during the reproductive season. Triploid molluscs therefore provide a high-quality product that can be sold year round, and it was the improved summer meat quality, not superior growth, that initially led to commercial production of triploids in the Pacific oyster (C. gigas) (Allen et al., 1989). On the negative side, triploid Pacific oyster cultured in warmer climates may develop brown spots in gonadal areas, but this phenomenon appears to be environment-specific (Nell, 2002; Davis, pers comm). Triploid Sydney rock oysters may also show brown coloration on the surface of their gonad (Hand and Nell, 1999); this coloration may be a response to aborted gametogenesis and high water temperature and it may disappear over time (Nell, 2002). We have not seen any brown coloration in triploid Pacific and eastern oysters cultured in New Jersey.
6.3.4 Survival The survival of adult triploids is variable. Triploid shellfish may have improved health or disease-resistance during reproductive seasons, and it has been shown that triploid oysters are less susceptible to summer mortalities caused by stress and energy depletion (Allen and Downing, 1986; G. Zhang, personal communication). However, there are also observations that triploids suffer from heavier mortality than diploids in summer at some locations (B. Eudeline, personal communication). Barber and Mann (1991) have shown that triploid and diploid eastern oysters are equally susceptible to Dermo, a parasitic disease caused by Perkinsus marinus. Another study has shown that triploid eastern oysters are less susceptible to MSX diseases (caused by Haplosporidium nelsoni) than diploids (Matthiessen and Davis, 1992). Similarly, in the Sydney rock oyster, mortality of triploids is two times lower than that of normal diploids under infection by the parasite, Mikrocytos roughleyi (Hand et al., 1998a,b). In the eastern oyster, triploids show better survival against ROD (Roseovarius oyster disease, caused by the bacterium Roseovarius crassostreae) than diploids (Guo et al., 2008). This improved survival is probably not due to specific resistance to Roseovarius crassostreae. ROD is a juvenile disease and primarily affects oysters smaller than 2.5 cm and, because triploids grow significantly faster, they may reach the refuge size earlier.
Chromosome set manipulation in shellfish
183
6.3.5 Sterility and genome stability Triploids have three sets of chromosomes, and theoretically they cannot go through meiosis and produce viable gametes. This is true in most fish and some shellfish where triploid females do not produce mature eggs (Thorgaard, 1983; Allen et al., 1986; Li et al., 2003a). So the use of sterile triploids in aquaculture helps to reduce the concern that cultured stocks (often selectively bred) may escape and interbreed with wild populations. If sterile, triploids can provide effective biological containment, which is especially important for culturing non-native species. Unfortunately, in most molluscs, the triploids are not completely sterile. Triploids have greatly reduced gonadal development, but they do produce some mature and viable gametes. In the Pacific oyster, the fecundity of triploid females is about 2 % of normal diploids (Guo and Allen, 1994a). The survival of triploid × triploid crosses is about 0.04 126 % of diploid × diploid crosses. The reproductive potential of triploids, assuming unlimited sperm, is therefore 0.000 008 (2 % × 0.04 126 %) or 1 in 125 000. If we consider that only 7 % of the triploid × triploid progeny are diploids (Guo and Allen, 1994a), the relative chance of triploids producing diploid offspring becomes 0.000 008 × 0.07 = 0.00 000 056 or 1 in 1.8 million. If we assume that sperm are also limiting and triploid males produce 2 % of what diploids produce, then the reproductive potential becomes 0.000 000 011 or 1 in 89 000 000. It means that when diploids produce 89 million fertile diploids, triploids would produce one, which is extremely low. This calculation is based on only one study and can be influenced by many variables. For example, another study puts the relative fecundity of triploid C. gigas at 13.4 % (Gong et al., 2004). Further, the calculation assumes that the culture population is 100 % triploids, which is not always possible (see Section 7.4). Any residual diploids can greatly change the calculation, because the survival of triploid × diploid cross is much higher than triploid × triploid crosses (Guo and Allen, 1994a; Gong et al., 2004). Even if 100 % triploids can be produced, the stability of the triploid genome presents another concern. It has been shown that some triploids may revert to mosaics, which contain some diploid cells, although it appears that reversion occurs in a small fraction (5–15 %) of triploids and is primarily restricted to somatic tissues (Allen et al., 1999). Reversion of tetraploids is more frequent (Guo, unpublished), suggesting increased genome instability of tetraploidy. Reversion is not well understood at this time and further research is needed.
6.4 Tetraploid shellfish 6.4.1 Induction of tetraploids Although triploid shellfish can be readily produced by blocking meiosis II, direct induction of triploids has several disadvantages: (i) most induction
184
New technologies in aquaculture
treatments are toxic and detrimental to larval survival; (ii) the induction is rarely 100 % effective, which complicates hatchery management; and (iii) the retention of PB2 may have deleterious effects on the survival and growth of induced triploids (Chourrout et al., 1986; Guo et al., 1990). These problems can be eliminated by producing triploids from diploid × tetraploid mating (Guo et al., 1996). Tetraploidy is typically induced by inhibiting the first mitosis in fertilized eggs (Fig. 6.1). Viable tetraploids have been produced with mitosis I inhibition in fish (Chourrout, 1982; Myers et al., 1986) and amphibians (Fischberg, 1958; Reindschmidt et al., 1979). In shellfish, we have more ways to make tetraploids because meiosis I and II are both accessible. Tetraploid shellfish can be produced with at least the following approaches: inhibition of mitosis I, inhibition of meiosis I, inhibition of meiosis I and II in gynogenetically activated eggs, fusion of two diploid cells, and inhibition of meiosis I in eggs from triploids fertilized by normal sperm. All these approaches have been tested in shellfish with variable results (Table 6.2). Mitosis I inhibition has produced high percentages of tetraploid embryos, up to 80–90 %, in several species, but no tetraploids survived beyond metamorphosis in any of those studies, despite the diverse treatments used (Table 6.2). In C. gigas, blocking meiosis I and II in gynogenetically activated eggs produced 94.6 % tetraploids, none of which survived beyond larval stages (Guo, 1991), and neither zygote nor blastomere fusion produced viable tetraploids (Guo et al., 1994). Viable tetraploids were produced by meiosis I inhibition in several species, although the number of tetraploids that survived to juvenile stage was small (3–5) and no tetraploid lines were established (Scarpa et al., 1993; Allen et al., 1994; Yang et al., 2000b; Peruzzi and Guo, 2002; Yang and Guo, 2004). The poor survival of tetraploid shellfish may be caused by many factors. In many molluscs, the first cleavage is characterized by the formation of a polar lobe. The polar lobe contains morphogenic determinants that need to be precisely distributed (Gilbert, 1988). Therefore, inhibiting mitosis I may disrupt the distribution of morphogenic determinants and normal development. In fish and amphibians where viable tetraploids were produced by mitosis I blocking (Fischberg, 1958; Reinschmidt et al., 1979; Chourrout, 1982; Myers et al., 1986), the first cleavage is an equal division, and the development is regulative. The disruption of polar lobe formation cannot explain why tetraploid produced by blocking meiosis I and II in gynogenetically activated eggs are not viable, as the process does not affect the polar lobe. Guo (1991) hypothesizes that the poor viability of the induced tetraploids is caused by a cellnumber deficiency, and this deficiency arises from the cleavage of a normal egg by a large, tetraploid nucleus and the maintenance of a given nucleus/ cytoplasm ratio. In ‘mosaic’ development, a cell’s fate is programmed by the number of divisions and distribution of morphogenic determinants (Gilbert, 1988). A reduction in cell number at the end of cleavage may stop
Chromosome set manipulation in shellfish
185
Table 6.2 Tetraploid (4n) induction in shellfish: approaches and treatments used, percent 4n embryos produced and number of viable 4n obtained after metamorphosis Approach/Species Mitosis I inhibition Crassostrea gigas
Treatment1
% 4n embryos
No. of viable 4n
Reference
Heat, 35–40 ºC Colchicine, 0.125 mM Nocodazole, 0.026 μM Heat, 35, 38 ºC Cold, 4, 7 ºC Nocodozle, 0.02–1.6 mg/L 6-DMAP CB KCI Heat, 33–34 ºC
45 5 10 63–86 23–31 0
0 0 0 0 0 0
Guo et al., 1994 Guo, 1991
50 55 80 22–90
0 0 0 0
Cui et al., 2004
Heat, 35–36 ºC Cold, 5 ºC 6-DMAP, 150 μM
33–67 15 0
0 0 0
Sellars et al., 2006a
CB, 1 mg/L
94.6
0
Guo, 1991
PEG, zygote fusion PEG, blastomere fusion PEG, sperm fusion
2.2 30
0 0
Guo et al., 1994
0
0
Meiosis I inhibition Crassostrea gigas Chlamys farreri Haliotis discus hannai Ostrea edulis
CB, 1 mg/L CB, 0.5 mg/L 6DMAP, 175–225 μM CB, 0.8 mg/L CB, 1 mg/L
28 26 20–23 25–33 40–53
0 5 0 0 0
Mulinia lateralis
CB, 0.75 mg/L
na
4
CB, 0.67 mg/L Heat, 35 ºC CB, 1 mg/L
40–90 0 18
3 0 5
Gendreau and Grizel, 1990 Perruzzi and Guo, 2002 Yang and Guo, 2004 Yang and Guo 2006a Scarpa et al., 1993
CB, 0.5 mg/L
na
3
Allen et al., 1994
Mercenaria mercenaria Eriocheir sinensis Fenneropenaeus chinensis Marsupenaeus japonicus Gynogenesis Crassostrea gigas Cell fusion Crassostrea gigas
Mytilus galloprovincialis Tapes philippinarum
Meiosis inhibition in 3n female × 2n male cross CB, 0.5 mg/L Crassostrea gigas CB, 0.5 mg/L Crassostrea gigas Crassostrea virginica CB, 1 mg/L CB, 0.25 mg/L Crassostrea ariakensis na Argopecten ventricosus CB, 0.5 mg/L Pinctada martensii 1
67 30–84 40–100 0–90
1970 – 4000 3120
Yang and Guo, 2006b
Li et al., 2003b
Guo, 1991 Yang et al., 2000b Zhang et al., 2000
Guo and Allen, 1994c Eudeline et al., 2000 Guo et al., 2002 Allen et al., 2005
na
5
Maldonado et al., 2003
17
2
He et al., 2000
CB = cytochalasin B, na = not available, PEG = polyethylene glycol, 6-DMAP = 6-dimethylaminopurine.
186
New technologies in aquaculture
development by retaining different morphogenic determinants in one cell, or by a lack of sufficient number of cells needed for further morphogenesis. The cell-number deficiency can be corrected by an increase in the egg volume. The eggs from triploids are significantly larger than that from normal diploids (Guo and Allen, 1994a). By blocking meiosis I in eggs from triploids fertilized with sperm from diploids, Guo and Allen (1994c) were able to produce a large number of viable tetraploids in C. gigas, a result that supports the cell-number deficiency hypothesis. Using the same method, viable tetraploids have been obtained in five bivalve molluscs and in three Crassostrea oysters, large numbers of tetraploids are produced and tetraploid lines established (Table 6.2). It has been shown recently that tetraploids produced by inhibiting meiosis II in eggs from diploids fertilized with sperm from tetraploids are viable (McCombie et al., 2005). This finding argues against the cell-number deficiency hypothesis, although the relative survival of tetraploids is not reported. The survival of a few tetraploids does not change the fact that the majority of tetraploids produced from eggs of diploids cannot survive. The cell-number hypothesis provides one explanation. The genome adaptation hypothesis (see Section 6.3.2) can also explain the improved survival of tetraploids derived from triploid females (Guo and Allen, 2004c) and tetraploid males (McCombie et al., 2005). By having survived at least one round of polyploidization, the triploid or tetraploid parents may have eliminated genes or gene complexes that are incompatible with polyploidy, giving their progeny an enhanced ability to survive tetraploidy.
6.4.2 Performance of tetraploids At present, large numbers of tetraploids and second generation tetraploids are only available in C. gigas (Guo and Allen, 1994c), C. virginica (Guo et al., 2002) and C. ariakensis (Allen et al., 2003). The first generation tetraploid C. gigas are larger than the diploids and triploids from the same treatment group (Guo and Allen, 1994c), but the diploids and triploids appear to be exceptionally small and possibly aneuploid. In C. virginica, the first generation tetraploids are also smaller than diploids and triploids (Guo et al., 2002). The first two to three generations of tetraploid C. virginica suffered heavy mortalities that appeared to be unique to tetraploids (Guo, unpublished data). Mortality occurred primarily in early spring when oysters are going through gonadal development. By the fourth generation, tetraploids were much healthier than in early generations and significantly larger than diploids (Guo et al., unpublished). This observation is in agreement with the genome adaptation hypothesis that tetraploids can go through rapid adaptation during the first few generations. Tetraploid oysters are fertile and have apparently normal development of gonads. The fecundity of tetraploid C. gigas is comparable to that of normal diploids (Guo and Allen, 1997), differing from the greatly reduced
Chromosome set manipulation in shellfish
187
fecundity of triploids. Tetraploids have an approximately 1 : 1 sex-ratio at one year of age. In contrast to the abnormally high frequency of hermaphrodites among triploids, tetraploids have about the same level of hermaphrodites as normal diploids. During meiosis, all chromosomes are engaged in multivalent formation (Guo and Allen, 1997). In spite of massive multivalent formation, tetraploids produce primarily diploid sperm with some aneuploids (Guo and Allen, 1997; Wang et al., 1999). All-triploid populations have been produced in all three oyster species by mating diploid females with tetraploid males. Natural triploids produced from tetraploid are practically 100 % pure, with percentages typically between 99 and 100 % (Guo et al., 1996; Wang et al., 2006). The rare diploids found among natural triploids may be gynogenetic, androgenetic (Wang et al., 1999), or due to imperfect meiosis in tetraploids. It can also be the result of contamination by a diploid group.
6.5 Gynogenesis, androgenesis and aneuploids Gynogenesis has been successfully produced in several shellfish species including Haliotis discus hannai (Arai et al., 1984; Fujino et al., 1990), Mytilus edulis (Fairbrother, 1994), Mytilus galloprovincialis (Scarpa et al., 1994), C. gigas (Guo et al., 1993; Li et al., 2000), and Mulinia lateralis (Guo and Allen, 1994b). In Mulinia lateralis, all gynodiploids are females, providing evidence for XX-female and XY-male determination of sex (Guo and Allen, 1994b). In C. gigas, meiotic gynodiploids have been used for genecentromere mapping of allozyme loci (Guo and Gaffney, 1993). The mean recombination frequency over seven loci is 0.74, which is high but not unusual. Mitotic gynodiploids are extremely valuable for genetic analysis and breeding because they are completely homozygous at all loci. However, mitotic gynodiploids have not been reported in shellfish. Haploid androgenesis has been achieved in C. gigas (Li et al., 2004). Aneuploids can be created by crossing triploids with diploids with or without inhibition of meiosis (Guo and Allen, 1994a,c). The following chromosome numbers have been observed in adult oysters, demonstrating that they are viable. They include 2n − 1, 2n + 1, 2n + 2, 2n + 3, 3n − 2, 3n − 1, 3n, 3n + 1, 3n + 2, 3n + 3, 4n − 2, 4n − 1, 4n and 4n + 1 (Guo and Allen, 1994c; Wang et al., 1999; Gong et al., 2004). Preliminary data show that most aneuploid conditions negatively affect growth including trisomy, a condition of a diploid genome having one extra chromosome (2n + 1). Trisomic families have been produced in the Pacific oyster (Guo et al., 2000), which are potentially useful in gene mapping and other genetic analyses.
6.6 Summary and perspectives Chromosome set manipulation has made significant contributions to shellfish aquaculture through the development of triploid and tetraploid oysters (Nell,
188
New technologies in aquaculture
2002). Because of their superior growth, improved meat quality and sterility, triploids have become a desired product for oyster farming, and triploid oysters are now being used for commercial production in many countries including the USA, Australia, France, Chile, China and Korea. In the USA, about one third of the Pacific oyster production is from triploids. Triploid eastern oysters are also commercially cultured in the USA. Triploid C. ariakensis have been deployed for large-scale field trials in the USA, which would not be possible for a non-native species without the use of triploids. C. ariakensis is an Asian oyster that resists two devastating diseases (MSX and Dermo) of the eastern oyster. While the introduction of diploid C. ariakensis to US waters is controversial, triploids are being evaluated and considered as an alternative species for aquaculture. Tetraploids have played a critical role in the successful use of triploids in all three oyster species. On the other hand, the full potential of chromosome set manipulation has not yet been realized in shellfish. Research on uniparental inheritance and aneuploids remains largely academic, and triploids have not entered commercial production in most shellfish. Induced triploids have already demonstrated improved performance in scallops, mussels, abalone and shrimp, and natural triploids in the future should offer even greater improvements as has been shown in oysters. However, tetraploids which are needed for the production of natural triploids are only available in three species of oysters so the development of tetraploids in other major shellfish species should be a priority for the research community. Finally, chromosome set manipulation in shellfish is not only useful for aquaculture, but also important for our understanding of shellfish genomes. The creation of various chromosome variants provides unique opportunities to study some of the basic questions in genome biology. Research in shellfish has raised some interesting questions such as why triploids grow faster, why aneuploids grow slower, and why tetraploids have limited viability. Hypotheses have been advanced, and future studies may greatly improve our understanding of shellfish genomes.
6.7 Acknowledgements We thank Alison Guo for helping with graphics. This work is partly supported by grants from NOAA Sea Grant Oyster Disease Research Program. This is publication IMCS-2009-60 and NJSG-09-900.
6.8 References akashige, s and fushimi, t (1992) Growth, survival, and glycogen-content of triploid Pacific oyster Crassostrea gigas in the waters of Hiroshima, Japan, Nippon Suisan Gakkaishi, 58, 1063–71.
Chromosome set manipulation in shellfish
189
allen, s k, jr (1983) Flow cytometry: assaying experimental polyploid fish and shellfish, Aquaculture, 33, 317–28. allen, s k, jr and downing, s l (1986) Performance of triploid Pacific oysters, Crassostrea gigas (Thunberg). I. Survival, growth, glycogen content, and sexual maturation in yearlings, J Exp Mar Biol Ecol, 102, 197–208. allen, s k, jr, hidu, h and stanley, j g (1986) Abnormal gametogenesis and sex ratio in triploid soft-shell clam Mya arenaria, Biol Bull, 170, 198–210. allen, s k, jr, downing, s l and chew, k k (1989) Hatchery Manual for Producing Triploid Oysters, Seattle, WA, University of Washington Press. allen, s k, jr, shpigel, m s, utting, s and spencer, b (1994) Incidental production of tetraploid Manila clams, Tapes philippinarum (Adams and Reeve), Aquaculture, 128, 13–19. allen, s k, jr, howe, a, gallivan, t, guo, x and debrosse, g (1999) Genotype and environmental variation in reversion of triploid Crassostrea gigas to the heteroploid mosaic state, J Shellfish Res, 18, 293. allen, s k, jr, erskine, a j, walker, e and zebal, r (2003) Production of tetraploid Suminoe oysters C. ariakensis, J Shellfish Res, 22, 317. allen, s k, jr, erskine, a j, walker, e j and debrosse, g a (2005) Production of tetraploid suminoe oysters, Crassostrea ariakensis, Aquaculture, 247, 3. arai, k f, naito, f, sasaki, h and fujino, k (1984) Gynogenesis with ultraviolet ray irradiated sperm in the Pacific abalone, Bull Jap Soc Sci Fish, 50, 2019–23. arai, k f, naito, f and fujino, k (1986) Triploidization of the Pacific abalone with temperature and pressure treatments, Bull Jap Soc Sci Fish, 52, 417–22. barber, b j and mann, r (1991) Sterile triploid Crassostrea virginica (Gmelin, 1791) grow faster than diploids but are equally susceptible to Perkinsus marinus, J Shellfish Res, 10, 445–50. beaumont, a r and fairbrother, j e (1991) Ploidy manipulation in molluscan shellfish: a review, J Shellfish Res, 10, 1–18. beaumont, a r and kelly, k s (1989) Production and growth of triploid Mytilus edulis larvae, J Exp Mar Biol Ecol, 132, 69–84. beaumont, a r, fairbrother, j e and hoare, k (1995) Multilocus heterozygosity and size: A test of hypotheses using triploid Mytilus edulis, Heredity, 75, 256–66. brake, j, davidson, j and davis, j (2004) Field observations on growth, gametogenesis, and sex ratio of triploid and diploid Mytilus edulis, Aquaculture, 236, 179–91. chourrout, d (1982) Tetraploidy induced by heat shocks in the rainbow trout (Salmo gairdneri R.), Reprod Nutr Dev, 20, 727–37. chourrout, d, chevassus, b, krieg, f, happe, a, burger, g and renard, p (1986) Production of second generation triploid and tetraploid rainbow trout by mating tetraploid males and diploid females–potential of tetraploid fish, Theor Appl Genet, 72, 193–206. coman, f e, sellars, m j, norris, b j, coman, g j and preston, n p (2008) The effects of triploidy on Penaeus (Marsupenaeus) japonicus (Bate) survival, growth and gender when compared to diploid siblings, Aquaculture, 276, 50–59. cooper, k and guo, x (1989) Polyploid Pacific oyster produced by blocking polar body I and II with cytochalasin B, J Shellfish Res, 8, 412. cui, z x, xiang, j h, zhou, l h, cai, n n and song, l s (2004) Improvement of polyploidy induction in Eriocheir sinensis, Acta Oceanol Sinica, 23, 725–32. davis, j p (1989) Growth rate of sibling diploid and triploid oysters, Crassostrea gigas, J Shellfish Res, 8, 319 (abstract). desrosiers, r r, gerard, a, peignon, j m, naciri, y, dufresne, l, morasse, j, ledu, c, phelipot, p, guerrier, p and dube, f (1993) A novel method to produce triploids in bivalve mollusks by the use of 6-dimethylaminopurine, J Exp Mar Biol Ecol, 170, 29–43.
190
New technologies in aquaculture
downing, s l and allen, s k, jr (1987) Induced triploidy in the Pacific oyster, Crassostrea gigas: Optimal treatments with cytochalasin B depend on temperature, Aquaculture, 61, 1–15. dunstan, g a, elliott, n g, appleyard, s a, holmes, b h, conod, n, grubert, m a and cozens, m a (2007) Culture of triploid greenlip abalone (Haliotis laevigata Donovan) to market size: Commercial implications, Aquaculture, 271, 130–41. ekaratne, s u k and davenport, j (1993) The relationships between the gametogenetic status of triploids or diploids of manila clams, Tapes philippinarum, and their oxygen-uptake and gill particle-transport, Aquaculture, 117, 335–49. eudeline, b, allen, s k, jr and guo, x (2000) Optimization of tetraploid induction in the Pacific oysters, Crassostrea gigas, using the first polar body as a natural indicator, Aquaculture, 187, 73–84. eversole, a g, kempton, c j, hadley, n h and buzzi, w r (1996) Comparison of growth, survival, and reproductive success of diploid and triploid Mercenaria mercenaria, J Shellfish Res, 15, 689–94. fairbrother, j e (1994) Viable gynogenetic diploid Mytilus edulis (L.) larvae produced by ultraviolet light irradiation and cytochalasin B shock, Aquaculture, 126, 25–34. fao (2007) The State of World Fisheries and Aquaculture 2006, Rome, Food and Agriculture Organization of the United Nations. fischberg, m (1958) Experimental tetraploidy in newts, J Embryol Exp Morphol, 6, 393–402. fujino, k, arai, k, iwadare, k, yoshida, t and nakajima, s (1990) Induction of gynogenetic diploid by inhibiting second meiosis in the Pacific abalone, Nippon Suisan Gakkaishi, 56, 1755–63. garnier-gere, p h, naciri-graven, y, bougrier, s, magoulas, a, heral, m, kotoulas, g, hawkins, a and gerard, a (2002) Influences of triploidy, parentage and genetic diversity on growth of the Pacific oyster Crassostrea gigas reared in contrasting natural environments, Mol Ecol, 11, 1499–514. gendreau, s and grizel, h (1990) Induced triploidy and tetraploidy in the European flat oyster, Ostrea edulis L, Aquaculture, 90, 229–38. gilbert, s f (1988) Developmental Biology, 2nd Edn, Sunderland, MA, Sinauer Associates Inc. gong, n, yang, h, zhang, g, landau, b j and guo, x (2004) Chromosome inheritance in triploid Pacific oyster Crassostrea gigas Thunberg, Heredity, 93, 408–15. guo, x (1991) Studies on Tetraploid Induction in the Pacific Oyster, Crassostrea gigas (Thunberg), Seattle, WA, University of Washington. guo, x (2004) Oyster breeding and the use of biotechnology, Bull Aquac Assoc Canada, 104(2), 26–33. guo, x and allen, s k, jr (1994a) Reproductive potential and genetics of triploid Pacific oyster, Crassostrea gigas (Thunberg), Biol Bull, 187, 309–18. guo, x and allen, s k, jr (1994b) Sex determination and polyploid gigantism in the dwarf surfclam (Mulinia lateralis Say), Genetics, 138, 1199–206. guo, x and allen, s k, jr (1994c) Viable tetraploids in the Pacific oyster (Crassostrea gigas Thunberg) produced by inhibiting polar body 1 in eggs from triploids, Mol Mar Biol Biotechnol, 3, 42–50. guo, x and allen, s k, jr (1997) Sex and meiosis in autotetraploid Pacific oyster, Crassostrea gigas (Thunberg), Genome, 40, 397–405. guo, x and gaffney, p m (1993) Artificial gynogenesis in the Pacific oyster, Crassostrea gigas: II. Allozyme inheritance and early growth, J Hered, 84, 311–15. guo, x, hershberger, w k and myers, j (1990) Growth and survival of intrastrain and interstrain triploids of rainbow trout, Oncorhynchus mykiss, J World Aquac Soc, 21, 250–56.
Chromosome set manipulation in shellfish
191
guo, x, cooper, k, hershberger, w k and chew, k k (1992a) Genetic consequences of blocking polar body I with cytochalasin B in fertilized eggs of the Pacific oyster, Crassostrea gigas: I. Ploidy of resultant embryos, Biol Bull, 183, 381–6. guo, x, hershberger, w k, cooper, k and chew, k k (1992b) Genetic consequences of blocking polar body I with cytochalasin B in fertilized eggs of the Pacific oyster, Crassostrea gigas: II. Segregation of chromosome, Biol Bull, 183, 387–93. guo, x, hershberger, w k, cooper, k and chew, k k (1993) Artificial gynogenesis with ultraviolet irradiated sperm in the Pacific oyster, Crassostrea gigas: I. Induction and survival, Aquaculture, 113, 201–14. guo, x, hershberger, w k, cooper, k and chew, k k (1994) Tetraploid induction with mitosis-I inhibition and cell-fusion in the Pacific oyster (Crassostrea gigas Thunberg), J Shellfish Res, 13, 193–8. guo, x, debrosse, g and allen, s k, jr (1996) All-triploid Pacific oysters (Crassostrea gigas Thunberg) produced by mating tetraploids and diploids, Aquaculture, 142, 149–61. guo, x, ford, s and zhang, f (1999) Molluscan aquaculture in China, J Shellfish Res, 18, 19–31. guo, x, zhang, g, landau, b j, english, l and wang, y (2000) Aneuploidy in the Pacific oyster, Crassostrea gigas Thunberg and its effects on growth, J Shellfish Res, 19, 614. guo, x, wang, j, landau, b j, li, l, debrosse, g a and krista, k d (2002) The successful production of tetraploid eastern oyster, Crassostrea virginica Gmelin, J Shellfish Res, 21, 380–81. guo, x, wang, y and xu, z (2007) Genomic analyses by fluorescent in situ hybridization, in Liu, Z J (ed.), Aquaculture Genome Technologies, Ames, IA, Blackwell, 289–311. guo, x, wang, y, debrosse, g a, bushek, d and ford, s e (2008) Building a superior oyster for aquaculture, Jersey Shoreline, 25, 7–9. hand, r e and nell, j a (1999) Studies on triploid oysters in Australia XII. Gonad discolouration and meat condition of diploid and triploid Sydney rock oysters Saccostrea commercialis in five estuaries in New South Wales, Australia, Aquaculture, 171, 181–94. hand, r e, nell, j a and maguire, g b (1998a) Studies on triploid oysters in Australia. X. Growth and mortality of diploid and triploid Sydney rock oysters Saccostrea commercialis (Iredale and Roughley), J Shellfish Res, 17, 1115–27. hand, r e, nell, j a, smith, i r and maguire, g b (1998b) Studies on triploid oysters in Australia. XI. Survival of diploid and triploid Sydney rock oysters Saccostrea commercialis (Iredale and Roughley) through outbreaks of winter mortality caused by Mikrocytos roughleyi infection, J Shellfish Res, 17, 1129–35. hand, r e, nell, j a, reid, d d, smith, i r and maguire, g b (1999) Studies on triploid oysters in Australia: Effect of initial size on growth of diploid and triploid Sydney rock oysters, Saccostrea commercialis (Iredale & Roughley), Aquac Res, 30, 35–42. hand, r e, nell, j a and thompson, p a (2004) Studies on triploid oysters in Australia: XIII. Performance of diploid and triploid Sydney rock oyster, Saccostrea glomerata (Gould, 1850), progeny from a third generation breeding line, Aquaculture, 233, 93–107. hawkins, a j s, day, a j, gerard, a, naciri, y, ledu, c, bayne, b l and heral, m (1994) A genetic and metabolic basis for faster growth among triploids induced by blocking meiosis I but not meiosis II in the larviparous European flat oyster, Ostrea edulis L, J Exp Mar Biol Ecol, 184, 21–40. he, m, lin, y, shen, q, hu, j and jiang, w (2000) Production of tetraploid pearl oyster (Pinctada martensii Dunker) by inhibiting the first polar body in eggs from triploids. J Shellfish Res, 19, 147–51.
192
New technologies in aquaculture
jiang, w, li, g, xu, g, lin, y and qing, n (1993) Growth of the induced triploid pearl oyster, Pinctada martensii (D.), Aquaculture, 111, 245–53. komaru, a and wada, k t (1989) Gametogenesis and growth of induced triploid scallops Chlamys nobilis, Nippon Suisan Gakkaishi, 55, 447–52 (in Japanese with English abstract). komaru, a, uchimura, y, ievama, h and wada, k t (1988) Detection of induced triploid scallop, Chlamys nobilis, by DNA microfluorometry with DAPI staining, Aquaculture, 69, 201–10. landau, m (1992) Introduction to Aquaculture, New York, Wiley. li, q, osada, m, kashihara, m, hirohashi, k and kijima, a (2000) Induction of gynogenetic diploids and cytological studies in the Pacific oyster, Crassostrea gigas, Suisanzoshoku, 48, 185–91. li, f, xiang, j, zhang, x, zhou, l, zhang, c and wu, c (2003a) Gonad development characteristics and sex ratio in triploid Chinese shrimp (Fenneropenaeus chinensis), Mar Biotechnol, 5, 528–35. li, f, xiang, j, zhou, l, wu, c and zhang, x (2003b) Optimization of triploid induction by heat shock in Chinese shrimp Fenneropenaeus chinensis, Aquaculture, 219, 221–31. li, q, hisatsune, t and kijima, a (2004) Induction of haploid androgenesis in Pacific oyster by UV irradiation, Mar Biotechnol, 6, 291–7. liang, y, wang, r, tian, c, yu, r and qu, x (1994) A preliminary study on the triploid oyster Crassostrea talienwhanensis, J Fish China, 18, 237–40 (in Chinese with English abstract). lin, y, he, m, qing, n and jiang, w (1995) Triploid induction in the scallop, Chlamys nobilis and growth comparisons, Tropi Oceanol, 14, 84–9 (in Chinese with English abstract). liu, w, heasman, m and simpson, r (2004) Induction and evaluation of triploidy in the Australian blacklip abalone, Haliotis rubra: a preliminary study, Aquaculture, 233, 79–92. longo, f j (1972) The effects of cytochalasin B on the events of fertilization in the surf clam, Spisula solidissima. I. Polar body formation, J Exp Zool, 182, 321–44. maguire, g b, gardner, n c, nell, j a, kent, g n and kent, a s (1995) Studies on triploid oysters in Australia. 2. Growth, condition index gonad area, and glycogen content of triploid and diploid Pacific oysters, Crassostrea gigas, from oyster leases in Tasmania, Australia, Aquaculture, 137, 355–8. maldonado, r, ibarra, a m and ramirez, j l (2003) Induction to tetraploidy in catarina scallop, Argopecten ventricosus (Sowerby II, 1842), Cienc Mar, 29, 229–38. maldonado-amparo, r, ramirez, j l, avila, s and ibarra, a m (2004) Triploid lionpaw scallop (Nodipecten subnodosus Sowerby); Growth, gametogenesis, and gametic cell frequencies when grown at a high food availability site, Aquaculture, 235, 185–205. mallia, j v, muthiah, p and thomas, p c (2006) Growth of triploid oyster, Crassostrea madrasensis (Preston), Aquac Res, 37, 718–24. mason, k m, shumway, s e, allen, s k jr and hidu, h (1988) Induced triploidy in the soft-shell clam Mya arenaria: energetic implications, Mar Biol, 98, 519–28. matthiessen, g c and davis, j p (1992) Observations on growth rate and resistance to MSX (Haplosporidium nelsoni) among diploid and triploid eastern oyster [Crassostrea virginica (Gmelin, 1791)] in New England, J Shellfish Res, 11, 449–54. mccombie, h, ledu, c and phelipot, p (2005) A complementary method for production of tetraploid Crassostrea gigas using crosses between diploids and tetraploids with cytochalasin B treatments, Mar Biotechnol, 7, 318–30. myers, j m, iwamoto, r n and hershberger, w k (1986) Tetraploid induction in salmonids, J World Aquac Soc, 17, 1–7.
Chromosome set manipulation in shellfish
193
nell, j a (2002) Farming triploid oysters, Aquaculture, 210, 69–88. nell, j a and perkins, b (2005) Studies on triploid oysters in Australia: farming potential of all-triploid Pacific oysters, Crassostrea gigas (Thunberg), in Port Stephens, New South Wales, Australia, Aquac Res, 36, 530–6. nell, j a, cox, e, smith, i r and maguire, g b (1994) Studies on triploid oyster in Australia. I. The farming potential of triploid Sydney rock oyster, Saccostrea commercialis (Iredale and Roughley), Aquaculture, 126, 243–55. nell, j a, o’connor, w a, hand, r e and mcadam, s p (1995) Hatchery production of diploid and triploid clams, Tapes dursatus (Lamark 1818): a potential new species for aquaculture, Aquaculture, 130, 389–94. nell, j a, hand, r e, goard, l j and mcadam, s p (1996) Studies on triploid oyster in Australia. Evaluation of cytochalasin B and 6-dimethylaminopurine for triploidy induction in Sydney rock oysters Saccostrea commercialis (Iredale and Roughley), Aquac Res, 126, 689–98. okumura, s i, arai, k, harigaya, y, eguchi, h, sakai, m, senobkuya, h, furukawa, s and yamamor, k (2007) Highly efficient induction of triploid Pacific abalone Haliotis discus hannai by caffeine treatment, Fish Sci, 73, 237–43. peruzzi, s and guo, x (2002) Tetraploid induction by meiosis inhibition with cytochalasin B in the dwarf surfclam, Mulinia lateralis Say: effects of temperature, J Shellfish Res, 21, 677–84. reindschmidt, d c, simon, s j, volpe, e p and tompkins, r (1979) Production of tetraploid and homozygous diploid amphibians by suppression of first cleavage, J Exp Zool, 210, 137–43. ruiz-verdugo, c a, ramirez, j l, allen, s k jr and ibarra, a m (2000) Triploid catarina scallop (Argopecten ventricosus Sowerby II, 1842): growth, gametogenesis, and suppression of functional hermaphroditism, Aquaculture, 198, 13–23. scarpa, j, wada, k t and komaru, a (1993) Induction of tetraploid mussel by suppression of polar body formation, Nippon Suisan Gakkaishi, 59, 2017–23. scarpa, j, toro, j e and wada, k t (1994) Direct comparison of six methods to induce triploidy in bivalves, Aquaculture, 119, 119–33. sellars, m j, coman, f e, degnan, b m and preston, n p (2006a) The effectiveness of heat, cold and 6-dimethylaminopurine shocks for inducing tetraploidy in the Kuruma shrimp, Marsupenaeus japonicus (Bate), J Shellfish Res, 25, 631–7. sellars, m j, degnan, b m and preston, n p (2006b) Production of triploid Kuruma shrimp, Marsupenaeus (Penaeus) japonicus (Bate) nauplii through inhibition of polar body I, or polar body I and II extrusion using 6-dimethylaminopurine, Aquaculture, 256, 337–45. shpigel, m and spencer, b (1996) Performance of diploid and triploid Manila clams (Tapes philippinarum, Adams and Reeve) at various levels of tidal exposure in the UK and in water from fish ponds at Eilat, Israel, Aquaculture, 141, 159–71. stanley, j g, allen, s k, jr and hidu, h (1981) Polyploidy induced in the American oyster, Crassostrea virginica, with cytochalasin B, Aquaculture, 23, 1–10. stanley, j g, hidu, h and allen, s k, jr (1984) Growth of American oysters increased by polyploidy induced by blocking meiosis I but not meiosis II, Aquaculture, 37, 147–55. stephens, l b (1989) Inhibition of the First Polar Body Formation in Crassostrea gigas Produces Tetraploids, Not Meiotic I Triploids, Seattle, WA, University of Washington. tabarini, c l (1984) Induced triploidy in the bay scallop, Argopecten irradians, and its effect on growth and gametogenesis, Aquaculture, 42, 151–60. thiriot-quiévreux, c (2002) Review of the literature on bivalve cytogenetics in the last ten years, Cah Biol Mar, 43, 17–26.
194
New technologies in aquaculture
thorgaard, g h (1983) Chromosome set manipulation and sex control in fish, in Hoar, W S, Randall, D J and Donaldson, E M (Eds), Fish Physiology, London, Academic Press. troup, a j, cairns, s c and simpson, r d (2005) Growth and mortality of sibling triploid and diploid Sydney rock oysters, Saccostrea glomerata (Gould), in the Camden Haven River, Aquac Res, 36, 1093–103. utting, s d and child, r d (1994) Genetic manipulation of the Manila clam Tapes philippinarum using cytochalasin B to induce triploid, Aquaculture, 120, 271–82. wang, y and guo, x (2004) Chromosomal rearrangement in Pectinidae revealed by rRNA loci and implications in bivalve evolution, Biol Bull, 207, 247–56. wang, z, guo, x, allen, s k, jr and wang, r (1999) Aneuploid Pacific oyster (Crassostrea gigas Thunberg), Aquaculture, 173, 347–57. wang, z, guo, x, allen, s k, jr and wang, r (2002) Heterozygosity and body size in triploid Pacific oysters, Crassostrea gigas Thunberg, produced from meiosis II inhibition and tetraploids, Aquaculture, 204, 337–48. wang, y, xu, z and guo, x (2004) Differences in the rDNA-bearing chromosome divide the Asian-Pacific and Atlantic species of Crassostrea (Bivalvia, Mollusca), Biol Bull, 206, 46–54. wang, y, guo, x, debrosse, g a and ford, s e (2005) Growth in natural triploid eastern oyster produced by diploid × tetraploid crosses, J Shellfish Res, 24, 1274. wang, y, guo, x, debrosse, g, karney, r, bagnall, p, blake, j, ford, s e and bushek, d (2006) Superior growth of triploid eastern oyster depends on culture environment, J Shellfish Res, 25, 675–6. xiang, j, li, f, zhang, c, zhang, x, yu, k, zhou, l, and wu, c (2006) Evaluation of induced triploid shrimp Penaeus (Fenneropenaeus) chinensis cultured under laboratory conditions, Aquaculture, 259, 108–15. yamamoto, s and sugawara, y (1988) Induced triploidy in the mussel, Mytilus edulis, by temperature shock, Aquaculture, 72, 21–9. yang, h, gallivan, t, guo, x and allen, s k, jr (2000a) A method for preserving oyster tissue samples for flow cytometry, J Shellfish Res, 19, 835–9. yang, h, zhang, f and guo, x (2000b) Triploid and tetraploid zhikong scallop, Chlamys farreri Jones et Preston, produced by inhibiting polar body I, Mar Biotechnol, 2, 466–75. yang, h and guo, x (2004) Tetraploid induction by meiosis inhibition in the dwarf surfclam Mulinia lateralis (Say 1822): effects of cytochalasin B duration, Aquac Res, 35, 1187–94. yang, h and guo, x (2006a) Polyploid induction by heat shock-induced meiosis and mitosis inhibition in the dwarf surfclam, Mulinia lateralis Say, Aquaculture, 252, 171–82. yang, h and guo, x (2006b) Tetraploid induction by inhibiting mitosis I with heat shock, cold shock, and nocodazole in the hard clam Mercenaria mercenaria (Linnaeus, 1758), Mar Biotechnol, 8, 501–10. young, w p, wheeler, p a, coryell, v h, keim, p and thorgaard, g h (1998) A detailed linkage map of rainbow trout produced using doubled haploids, Genetics, 148, 839–50. zhang, g, wang, z, chang, y, song, j, ding, j, wang, y and wang, r (1998) Triploid induction in Pacific abalone Haliotis discus hannai Ino by 6-dimethylaminopurine and the performance of triploid juveniles, J Shellfish Res, 17, 783–8. zhang, g, wang, z, chang, y, song, j, ding, j, zhao, s and guo, x (2000) Tetraploid induction in the Pacific abalone Haliotis discus hannai Ino with 6-DMAP and CB, J Shellfish Res, 19, 540–41.
7 Advances in disease diagnosis, vaccine development and other emerging methods to control pathogens in aquaculture A. Adams, University of Stirling, UK
Abstract: Disease is still regarded as a major constraint to aquaculture production globally. Rapid disease diagnosis and vaccination play a huge part in the control of bacterial diseases, and there has been significant progress in both of these areas. This chapter considers the limitations of existing methods and reviews recent advances made in pathogen detection technologies and vaccine development methodologies. Future directions are discussed, including nanotechnology and reversed vaccinology. Key words: fish disease, fish health, disease diagnosis, vaccine development, pathogen detection technologies.
7.1 Introduction Disease is still regarded as a major constraint to aquaculture production globally (Adams et al., 2005). As the industry continues to expand and diversify, the risk of new diseases emerging and old ones spreading to other geographical regions is a reality. The movement of eggs and fry between fish farms presents ideal circumstances for pathogens to adapt with their hosts and environment. Control of pathogens is complex and relies heavily on a combination of pathogen detection, disease diagnosis, treatment, prevention and general health management. Rapid disease diagnosis and vaccination play a huge part in this, and there has been significant progress in both of these areas since the 1980s. In the years since 2000 the pace has increased even more as methods developed for clinical and veterinary medicine are rapidly adapted and optimised for use in
198
New technologies in aquaculture
aquaculture. Novel diagnostic methods are published frequently and the success of vaccination in reducing the use of antibiotics has been realised, at least in some countries. Innovative alternative methods for the control of fish diseases are also being researched and applied. This chapter aims to provide a review of the recent advances made in disease diagnosis, vaccine development and other emerging methods to control pathogens in aquaculture.
7.2 Key drivers to improve disease diagnosis and vaccine development The main key driver to improve disease diagnosis and vaccine development is the continued significant losses to the industry caused by pathogens. Bacterial diseases cause a substantial economic burden to the aquaculture industry and, although antibiotics and chemotherapeutants are extensively used to control disease outbreaks, there is increasing concern about their use because of drug residues in food, the development of antimicrobial drug resistance and the detrimental effect on the aquatic microbial ecosystems and populations (Thompson and Adams, 2004). There is a concerted effort to move away from the use of antibiotics wherever possible. This was highlighted in September 2008 in Korea with the announcement that from next year the Korea Food and Drug Administration will ban the use of seven types of antibiotics in feed for livestock and fish raised in fish farms. In the UK, Norway and Japan there has already been a significant reduction in the use of antibiotics since the 1990s (Adams et al., 2005; Markestad and Grave, 1997). There is a real need to increase production of fish globally through aquaculture and therefore health and welfare must be given a high priority if targets set are to be reached. Some vaccines, in particular multivalent vaccines, have led to welfare concerns in the past few years due to the presence of adhesions on internal organs, thought to result from oil-based adjuvants in the vaccines (Berg et al., 2007). Farming of new species will play a significant role in increasing production. Persistent disease problems in cod (Vibriosis in particular) have played a large part in this new industry stagnating in Scotland. As cobia farming increases globally, and with the first farms being licensed in Brazil (Eric Routledge, Special Secretariat for Aquaculture and Fisheries, SEAP, Brazil; pers comm), there will be a need for farmers to be one step ahead of potential disease threats.
7.3 Limitations of current diagnostic methods Many of the current techniques for the detection of pathogens and diagnosis of diseases are actually very good. On the other hand, identification of
Advances in disease diagnosis and vaccine development
199
certain pathogens is difficult to achieve and some of the methods developed may be too complicated to apply or interpret. Conventional pathogen isolation and characterisation techniques, alongside pathology, still remain the methods of choice for the diagnosis of many diseases. However, these traditional methods tend to be costly, labour-intensive, and slow, and might not always lead to a definitive diagnosis being made. The rapid progress made in biotechnology since the 1990s has enabled the development and improvement of a wide range of immunodiagnostic and molecular techniques (Cunningham, 2004; Adams and Thompson, 2006, 2008), and reagents and commercial kits have become more widely available. These rapid methods both complement and enhance the traditional methods of disease diagnosis. The Manual of Diagnostic Tests for Aquatic Animals (World Organisation for Animal Health, 2006) includes a variety of standardised methods (including traditional, immunological and molecular methods) for the identification of selected pathogens (causing notifiable diseases), and these will expand as new methods are developed and validated (Adams and Thompson, 2008). Most of these are, however, for viral diseases, and Renibacteriun salmoninarum and Piscirickettsia salmonis, the causative agents of bacterial kidney disease (BKD) and ricketsiosis, respectively, are the only bacterial pathogens included. The diseases caused by these pathogens do not meet the listing criteria, but they are included because reporting requirements for non-listed diseases apply in regard to significant epidemiological events. For those diseases not included in the Animal Health Code there are no set standards. It is important that reagents and methods used for detecting bacterial pathogens are standardised and rigorously tested for specificity and sensitivity. Commercial reagents and kit development (Adams and Thompson, 2008) have gone some of the way to achieving this, but there still is not a full range of reagents or kits available for use in aquaculture. The cost, speed, specificity and sensitivity of assays are all extremely important to end-users. The highest cost is often time, although labour costs do vary considerably between countries. Many of the new technologies require specialised equipment and highly skilled staff and few of the existing methodologies are suited to field testing, or use in rudimentary laboratories.
7.4 Advances in methods of disease diagnosis (mainly for bacterial diseases) Disease diagnosis is currently made using a variety of methods, as reviewed by Adams and Thompson (2008). Traditional bacteriology, whereby the pathogen is isolated and identified biochemically (e.g. using API® strips), and observation of histological sections from diseased fish are widely used. Rapid methods that specifically identify the pathogen using antibodies
200
New technologies in aquaculture
(immunodiagnostics) or by amplifying specific sequences of DNA or RNA using polymerase chain reaction (PCR) (i.e. molecular diagnostics) are also regularly used in many laboratories. In some instances molecular diagnostics has completely taken over from other methodologies. For many of the rapid methods live and dead pathogens cannot be distinguished; therefore, the inclusion of enrichment methods and the use of live/dead kits are useful supplementary methods (Vatsos et al., 2002). Interpretation of results using rapid methods of pathogen detection should be carefully considered with all the other clinical evidence, including histology and attempted culture of the pathogen. Immunodiagnostic methods such as immunohistochemistry (IHC), the fluorescence antibody test (FAT) and indirect fluorescence antibody test (IFAT) enable rapid specific detection of pathogens in tissue samples without the need to first isolate the pathogen. The IHC method is a simple extension of histology allowing specific identification of pathogens in formalin tissue fixed sections (Adams and Marin de Mateo, 1994; Steiropoulos et al., 2002), while FAT/IFAT is extremely rapid and sensitive as well as being specific but requires a fluorescent microscope to read the results (Adams et al., 1995; Miles et al., 2003; Klesius et al., 2006). Both IHC and FAT/IFAT are technically easy to perform, and examples of the results obtained using these methods are shown in Fig. 7.1. (p. 201, see also colour section.) A variety of other antibody-based methods have also been developed for use in aquaculture. Some are very simple to use, but usually require pathogen isolation prior to use and lack in sensitivity (e.g. agglutination), while others are more complex, but with the added advantage of pathogen quantification (e.g. enzyme-linked immunosorbent assay, ELISA), or detection and characterisation of specific pathogen antigens to their molecular weight, e.g. Western blot (Rose et al., 1989; Adams and Thompson 1990; Adams, 1992, 2004). The ELISA also has the advantage of high throughput and automated equipment is available. The ELISA can also be used for serology (detecting antibodies to specific pathogens). Although serology is an essential screening tool in clinical medicine and in most control programmes for the significant diseases of domestic animals (Palmer-Densmore et al., 1998; Yuce et al., 2001; Fournier and Raoult, 2003) it has not yet been validated for any bacterial diseases in fish. Serology is used effectively for detecting exposure to fish viruses, such as koi herpesvirus (KHV) (Adkinson et al., 2005; Adams and Thompson, 2008), but bacterial pathogens pose a much more complex picture with cross reactivities likely unless specific known proteins are used to coat the ELISA plates rather than whole pathogens. The use of molecular technologies for the detection of fish bacterial pathogens is rapidly increasing and a vast array of methods has already been developed (Karunasagar et al., 1997; Cunningham, 2004; Adams and Thompson 2006, 2008; Wilson and Carson, 2003). Molecular methods
Advances in disease diagnosis and vaccine development (a)
(b)
(c)
(d)
201
Fig. 7.1 (See also Plate I) Examples of immunodiagnostic methods to detect fish pathogens in fish tissue. Detection of Renibacterium salmoninarum using indirect fluorescent antibody test, IFAT (a). Detection of Renibacterium salmoninarum using True Blue as substrate (b), Photobacterium damselae subspecies piscicida using 3,3′-diaminobenzidine (DAB) as substrate (c) and Streptococcus iniae using Fast Red as substrate (d) by immunohistochemistry, IHC. (Photographs (a)–(c) and (d) courtesy of Dr K D Thompson and Dr P Klesius, respectively)
generally have the highest sensitivity and are therefore particularly useful for detecting microorganisms that are present in low numbers or for those that are difficult to culture. In addition, molecular methods can be used for the identification of pathogens to species level (Puttinaowarat et al., 2000; Pourahmed, 2008) and in epidemiology for the identification of individual strains and differentiating closely related strains (Cowley et al., 1999). The PCR is the best known method, although there are many useful variations, including nested PCR, random amplification of polymorphic DNA (RAPD), reverse transcriptase-PCR (RT-PCR), reverse cross blot PCR (rcb-PCR) and RT-PCR enzyme hybridisation assay (Puttinaowarat et al., 2000; Wilson and Carson, 2003; Cunningham, 2004). Colony hybridisation has also been used successfully for the rapid identification of Vibrio anguillarum in fish (Aoki et al., 1989) and has the advantage of detecting both pathogenic and environmental strains (Powell and Loutit, 2004). Real-time PCR (also known as qPCR) offers quantification and high sample throughput. Real-
202
New technologies in aquaculture
time PCR methods have recently been developed for a variety of significant fish bacterial pathogens, such as Aeromonas salmonicida (Balcázar et al., 2007), Piscirickettsia salmonis (Karatas et al., 2008) Renibacterium salmoninarum (Jansson et al., 2008) and Edwardsiella ictaluri (US Patent 6951726), and it is likely that this range will expand rapidly. Polygenic sequencing following PCR of specific genes is being recommended for the identification of some pathogens where differentiation of closely related species is difficult. For example, Pourahmed (2008) found that sequencing of three different genes was necessary to classify certain mycobacteria species from fish. A variety of novel rapid diagnostic methods are currently being developed that have potential for future application in the diagnosis of aquatic animal health. These were recently reviewed by Adams and Thompson (2008), and comparisons were made between these methods and existing technologies with regard to their advantages and disadvantages. Loop-mediated isothermal amplification (LAMP) is an emerging technology with potential for detection of fish and shellfish pathogens, and research tests to detect Edwardsiella tarda, E. ictaluri, Nocardia seriolae, and Flavobacterium psychrophilum (bacterial pathogens that cause edwardsiellois, enteric septicemia of catfish and nocardiosis, respectively), Tetracapsuloides bryosalmonae (the parasite that causes proliferative kidney disease, PKD) and infectious haematopoitic necrosis virus (IHNV) in fish and white spot syndrome virus (WWSV) in shrimp have already been developed (Savan et al., 2005; Manji, 2008). A commercial LAMP test kit is available for WSSV. The LAMP is a relatively new method for amplifying DNA which relies on autocycling strand displacement DNA synthesis and, since it is carried out under isothermal conditions, it can be performed without the use of a thermocycler. The method uses Bst DNA polymerase and a set of four specially designed primers (two inner and two outer primers) to recognise a total of six distinct sequences on the template DNA (Notomi et al., 2000). The main advantages of the method are the speed with which it can be performed, its sensitivity, and the fact that the results are read by eye, and, although the test requires the use of pipettes and an incubator, it does not require any other specialised equipment. Figure 7.2 (p. 203, see also colour section) shows the results of a LAMP test carried out to identify Flavobacterium psychrophilum, where a simple colour change in the tube from orange to green indicates a positive. Simple rapid field tests using lateral flow technology are also in development, and rapid kits are currently commercially available to detect infectious salmon anaemia virus (ISAV) and WSSV in shrimp. Although there are none yet for bacterial pathogens in fish, this type of technology has been successfully developed for clinical (Gatta et al., 2004) and veterinary use (Bautista et al., 2002) and offers simple field test capabilities.
Advances in disease diagnosis and vaccine development
203
Fig. 7.2 (See also Plate II) Example of a loop-mediated isothermal amplification (LAMP) test carried out using purified Flavobacterium psychrophilum DNA. Positive samples turn green and negative ones remain orange. LAMP is highly sensitive and specific, and is performed under isothermal conditions, needing minimal instrumentation. (Photograph courtesy of F. Manji)
There is also interest in the development of multiplex tests to simultaneously detect different pathogens in a single sample. Multiplex technologies such as the Luminex xMAPTM (a bead array) and microarray both have huge potential in this area, but these are currently expensive and labourintensive as assays are still being developed and optimised (Adams and Thompson, 2008). The xMap system theoretically offers simultaneous quantitative analysis of up to 100 different analytes from a single drop of sample in an integrated, 96-well formatted system (Dunbar, 2006). This is complex technology with huge potential as it can be used for vaccine development, through epitope mapping (Costa et al., 2007), as well as pathogen detection. This is flexible technology as antibodies, protein or DNA can be bound to the bead array. A number of research groups are also currently developing DNA and oligo microarray technology for diagnostics and these also will offer simultaneous detection of pathogens for the future (González et al., 2004; Matsuyama et al., 2006).
7.5 Advances in vaccine development A wide range of commercial vaccines is available against bacterial pathogens, with most targeting salmon and trout, with additional vaccines available for channel catfish, European seabass and seabream, Japanese
204
New technologies in aquaculture
amberjack and yellowtail, tilapia and Atlantic cod (Thompson and Adams, 2004; Adams et al., 2005; Sommerset et al., 2005). The salmonid market presently uses heptavalent vaccines containing Listonella (Vibrio) anguillarum serotypes O1 and O2, V. salmonicida, Moritella viscosa, Aeromonas salmonicida, the causative agents of vibriosis, Hitra disease, winter ulcer disease, furunculosis and infectious pancreatic necrosis, respectively, and infectious pancreatic necrosis virus (IPNV). Due to environmental and control concerns in most countries only two bacterial vaccines (Edwardsiella ictaluri and Flavobacterium columnarae, causing Columnarus, for Channel catfish in the USA) and one viral vaccine (KHV for Carp in Israel) are presently commercially available as ‘live attenuated’ vaccines (Adams et al., 2005). Most of the commercial vaccines are based on inactivated bacterial pathogens, with fewer available for viral vaccines and none against parasites yet. The major producers of fish vaccines are now Intervet-Schering Plough Animal Health (The Netherlands), Novartis Animal Health (Switzerland), Pharmaq (Norway) and Microtek International Inc. (Canada). There are a number of smaller companies producing vaccines locally (e.g. autogenous vaccines), in different countries. Vaccines used in Japan are mostly developed and distributed by Japanese companies. Many new vaccines are in development (Thompson and Adams, 2004; Adams et al., 2005). The primary considerations for vaccines for aquaculture are cost-effectiveness and safety. Vaccines need to provide long-term protection against diseases on commercial fish farms. All the serotypic variants of the disease agent need to be considered, the time/age when the animal is most susceptible to disease, the route of administration and the method of vaccine preparation (i.e. inactivated whole cell, attenuated, subunit, recombinant). In order to develop an effective vaccine the protective antigens need to be identified and their protective response confirmed in the host species. The latter may be antibody mediated, cell mediated or both depending on the vaccine components. A practical method of administration and an inexpensive method of vaccine production also need to be established. It is important in vaccine development to work with the antigens that are expressed during infection rather than antigens expressed in the laboratory. Many salmon vaccines from the past are based on inactivated (whole cell) cultures of the pathogenic organism (usually inactivated in formalin) grown in vitro. In these cases the vaccines gave good protection (e.g. Vibrio vaccine); however, many pathogens appear to switch off important protective antigens when cultured in vitro. In such cases alternative methods of culture (e.g. the inclusion of an iron-chelating agent) are required so that expression of the important ‘protective’ antigens is induced (Neelam et al., 1993). This can be achieved by modifying the culture medium of the pathogen in vitro, as shown by Bakopoulos et al., (2003) and Jung et al., (2007) for Photobacterium damselae subsp. piscicida,
Advances in disease diagnosis and vaccine development kDa 201 116 80
205
kDa 201 116 80
42 33
42 33
18 7
18 7 1
(a)
2
3
4
5
6
7
8
1
2
3
4
5
6
7
8
(b)
Fig. 7.3 Western blot analysis of Photobacterium damselae subspecies piscicida after culture of the bacterium in different media (1–8), showing that different proteins are expressed under different culture conditions. Blot (a) used rabbit serum while blot (b) was performed with fish serum where many fewer antigens were recognised. (Photographs courtesy of Dr V Bakopoulos)
the pathogen that causes pasteurellosis. The effects of altering the constituents of the media for culturing P. damselae subsp. piscicida in the laboratory on antigen expression are illustrated in Fig. 7.3, where differences are observed in the antigens expressed/recognised by fish sera between media 1, 7 and 8, for example (Fig. 7.3a, b). Some antigens appear to be up-regulated whilst others are down-regulated. This also serves to highlight the difference between mammalian and fish immune systems, as fish (Fig. 7.3b) recognise many fewer antigens than rabbits (Fig. 7.3a). An alternative approach is to place the pathogen of interest inside the peritoneal cavity of fish, enclosed in sealed chambers (that permit the exchange of small molecules only), so that antigen expression in vivo can be determined (Bakopoulos et al., 2004; Poobalane, 2007; Jung et al., 2008). Figure 7.4 shows how R. salmoninarum alters the expression of surface molecules when the bacterium is cultured in vivo or in vitro. Bacterial cells appears smooth and rounded when cultured in vitro in contrast to those cultured inside the host fish. Application of sera from fish (that have been infected with the disease of interest and then recovered) in Western blot analysis on one- or two-dimensional gels (immunoprotomics) can then pinpoint potential vaccine candidates that can then be identified and vaccines produced (e.g. a recombinant vaccine against Aeromonas hydrophila, Poobalane, 2007). Of course these antigens may be expressed and the fish may respond by producing antibodies to them, but they may or may not be protective. Thus, challenge of vaccinated and nonvaccinated fish is then performed to establish if the vaccine is actually protective.
206
(a)
New technologies in aquaculture
(b)
Fig. 7.4 Electron micrographs (EM) of Renibacterium salmoninarum cultured in vitro and in vivo, illustrating the differential expression of bacterial surface molecules when bacteria are cultured in the laboratory or inside fish. (Photographs courtesy of Dr K D Thompson)
Fish vaccines have become much more sophisticated since the mid1990s. Technologies such as recombinant and DNA vaccines are powerful tools for vaccine development (Leong et al., 1997; Smith, 2000) as these enable the isolation of potential protective antigens from suppressive ones. These are being developed because the simpler approach of using inactivated whole cell vaccines did not succeed for many of the important diseases, and attempts at attenuated vaccines in general have not been encouraged from a safety point of view (Benmansour and de Kinkelin, 1997). An IPNV vaccine based on a recombinant expressed viral protein has been developed (Frost and Ness, 1997) and has been on the market for several years for use in salmon in Norway, but the licensing of other recombinant vaccines has been slow. DNA vaccines for fish have been shown to be effective when based on DNA-sequences encoding for rhabdovirus glycoproteins (Lorenzen and La Patra, 2005) and the first DNA vaccine has been licensed in Canada against IHNV. Vaccines for fish can be administered by a variety of different methods, i.e. injection (intramuscular or intra-peritoneally), immersion (bath or dipvaccination) or orally. There is much interest in developing oral vaccines as this is the most practical method of administration. In the absence of natural exposure, booster vaccination is needed to maintain immunity. Oral vaccine boosters have been used successfully and are marketed commercially. For example, oral vaccines are available against enteric red mouth (ERM) and vibriosis in rainbow trout, and against furunculosis and IPNV in salmon (Meeusen et al., 2007). These vaccines employ an antigen protection vehicle to protect vaccines from the acid environment of the fish
Advances in disease diagnosis and vaccine development
207
stomach, and improved delivery systems are currently being researched for a variety of vaccines.
7.6 Other emerging methods to control pathogens Close monitoring of stocks to ensure early detection of pathogens causing disease problems (and effective treatment) and vaccination to prevent infections are clearly not the only methods of disease control. Farmers can take a number of measures to manage the impact on healthy stocks, including improved nutrition/diet, and maintaining stocking densities at levels that optimise growth and avoid over-crowding that reduces the ability for the animal to resist infections. Immunostimmulants (e.g. glucans) added to diets have been reported to enhance the immune system of the fish in the short term, when applied either on their own or in vaccines as adjuvants, and are reported to be very affective at stimulating the nonspecific defense mechanisms of the animal (Thompson and Adams, 2004; Peddie and Secombes, 2005). Other dietary additives are also being used, sometimes to target specific diseases, e.g. addition of vitamin E to target salmon pancreas disease (SPD). A wide range of modified diets and immunostimulants is available commercially and many new products are being researched (Bricknell and Dalmo, 2005; Peddie and Secombes, 2005). In addition, probiotics are widely used in some countries (Birkbeck, 2004). Reducing the risk of exposure to, or impact on, healthy populations is also an effective alternative approach to pathogen control. Molecular methods (e.g. PCR) are ideal technologies to use for screening fish broodstock and eggs for the presence of pathogens, and as long as large enough sample sizes are tested (e.g. for eggs) this may prove to be an effective method of reducing the reservoir of specific pathogens on fish farms. Recently, Manji (2008) reported that, although the prevalence of Flavobacterium psychrophilum in rainbow trout eggs was very low (1–2.4 %) this still led to spread of disease (rainbow trout fry syndrome, RTFS) and mortalities when these eggs were grown on. In this study it was necessary to test at least 300 eggs per batch in the screening process. The long-term approach to disease control is through the selection of disease-resistant strains or families of fish, and much research is currently focused on fish genotype and disease susceptibility (Biacchesi et al., 2007). Selective breeding programs have been shown to have large beneficial effects on production and quality traits in cold-water fish species, but only a small percentage of aquaculture production is based on genetically improved fish and shellfish (Gjedrem, 2000). Resistance is a complex quantitative trait that is likely to be affected by many genes (Gjedrem
208
New technologies in aquaculture
et al., 1991; Grimholt et al., 2003). To select for disease resistance it is necessary to challenge a large number of animals and measure each family’s overall performance for the trait. Genes associated with disease and stress resistance are now being identified and their characteristics will be used as identifiers (markers) for selective breeding of disease- and/or stress-resistant individuals (Moen et al., 2004). This approach should continue to be pursued, bearing in mind that increased resistance to one pathogen can result in decreased resistance to other pathogens. As more nucleotide sequences become available for fish bacterial pathogens, this will provide opportunities to develop innovative alternative disease control methods. Recently, following the sequencing of R. salmoninarum, Sudheesh et al. (2007) described the identification of a new class of drug (phenyl vinyl sulfone) which inhibits the activity of a very important enzyme (sortase) in R. salmoninarum. Inhibition of this enzyme appears to dramatically reduce the virulence of the bacterium by interfering with the ability of the bacterium to adhere and colonise fish cells. This drug could offer a promising alternative to antibiotics to control bacterial kidney disease in fish, and this type of approach holds potential for future control of bacterial disease in general for fish.
7.7 Future trends Technologies to assist with disease control are moving at a rapid pace. Careful consideration must be given to selecting which methods to take forward and apply in aquaculture. Vaccines need to be cost-effective and safe, and pathogen detection methods should be robust yet sensitive. There are many innovative technologies that may fulfil these criteria and provide new vaccines and useful diagnostics tools. It is important, however, that the diagnostics methods already developed are standardised and fully validated, if they are considered useful, and that new technologies do not supersede these just because they are novel methods. They need to have clear advantages over the existing methods for use in aquaculture. Nanotechnology is an area being explored for the detection of pathogens in food (Kim et al., 2007) and in clinical and veterinary diagnostics, and this may prove extremely useful for application in diagnostics for aquatic animals. Nanotechnology is generally used when referring to materials of 0.1–100 nanometres; however, it is also inherent that these materials should display different properties from bulk (or micrometric and larger) materials as a result of their size. These differences include physical strength, chemical reactivity, electrical conductance, magnetism and optical effects. Such technology offers the ability to detect extremely low
Advances in disease diagnosis and vaccine development
209
levels of pathogens very quickly, and progress has already been made for the identification of foodborne pathogens (Joseph and Morrison, 2006). Recently, the focus is on different types of sensors to detect pathogens and immunomagnetic reduction (IMR) technology has been reported for the detection of low levels of the H5N1 virus that causes bird flu (Yang et al., 2008). In this method magnetic nanoparticles were coated with antibody and a high-transition-temperature superconductive quantum interference device was used to sense the immunomagnetic reduction of the reagents. Nanotechnology is also being used in conjunction with proteomics (Marko et al., 2007) and may be a useful technology to identify markers of disease and vaccine antigens. Immunoprotomics, as discussed in Section 7.5, is also known as ‘reversed vaccinology’ and has recently been successfully used for the development of a recombinant vaccine against A. hydrophila for carp (Poobalane, 2007). Other technologies with the same approach are knockout technologies, which indicate whether specific antigens are essential or important for survival of the pathogen in the host. These methods have great potential for the future and include RNA interference where expression of certain genes is blocked by antisense RNA (Melamed et al., 2002), in vivo expression technologies, IVET (Rainey and Preston, 2000), and signature tagged mutagenesis (Saenz and Dehio, 2005). The information obtained from a variety of these techniques is combined with data from existing literature to identify potential vaccine candidate antigens for cloning and for recombinant expression (Adams et al., 2005). Delivery of DNA vaccines using bacteriophages has been reported to be successful in a number of animals including fish (Skurnik and Strauch, 2006). The phage particles used are non-infectious and only grow on specialised laboratory strains of bacteria; the phage coat protects the vaccine from degradation and allows the host’s immune system to process it more efficiently (March et al., 2004; Clark and March, 2006). This technology may be extremely useful for oral delivery of DNA vaccines for fish. Gene sequencing underpins many of the new technologies being developed both for diagnostics and vaccine development and, as gene sequences become available for both pathogens and the host fish species, microarrays can be developed. These will enable very rapid progress to be made in fish health control for the future.
7.8 Sources of further information and advice In addition to the references cited there are numerous websites that provide useful information and advice. These are summarised in Table 7.1.
210
New technologies in aquaculture
Table 7.1
Sources of further information and advice
Name of organisation or project
Website address
AquaFirst AquaNet CEFAS (Centre for Environment. Fisheries and Aquaculture Science) DipNet (An EU funded project investigating disease interaction and pathogen exchange between farmed and wild aquatic animal populations) EAFP (European Association of Fish Pathologists) EPIZONE – Network of Excellence for Epizootic Disease Diagnosis and Control EUROCARP FAO (Food and Agriculture Organisation of the United Nations) FAO oneFish Community Directory Project (aquaculture/diseases) FEAP (Federation of European Aquaculture Producers) FishEggTrade (An EU funded project appraising of the zoosanitary risks associated with trade and transfer of fish eggs and sperm) Fish Health Section of the American Fisheries Society Fish Health Section of the Asian Fisheries Society Fisheries Research Services IAAAM (International Association for Aquatic Animal Medicine) IMAQUANIM (EU funded project: Improved immunity of aquaculture animals) International Database for Aquatic Animal Diseases ISAAE (International Society of Aquatic Animal Epidemiology) NACA (Network of Aquaculture Centres in Asia-Pacific) OIE Aquatic Animal Health Standards Commission OIE Designated Experts and Reference Laboratories for Aquatic Animal Diseases PANDA (Permanent Advisory Network for Diseases in Aquaculture) WAS (World Aquaculture Society)
http://aquafirst.vitamib.com http://www.aquanet.ca http://www.cefas.co.uk http://www.dipnet.info
http://www.eafp.org http://www.epizone-eu.net http://eurocarp.haki.hu http://www.fao.org http://www.onefish.org/id/10752 http://www.feap.info/feap http://cordis.europa.eu/life/src/ control/qlk2-ct-2002-01546.htm http://www.fisheries.org/units/fhs/ http://afs-fhs.seafdec.org.ph/ http://www.marlab.ac.uk/ http://www.iaaam.org http://imaquanim.dfvf.dk/info/ http://www.collabcen.net http://www.isaaepi.org/modules/news/ http://www.enaca.org http://www.oie.int/aac/eng/en_fdc.htm http://www.oie.int/fdc/eng/Diseases/ en_reflabslist.htm http://www.europanda.net http://www.was.org
Advances in disease diagnosis and vaccine development
211
7.9 References adams a (1992) Sandwich enzyme linked immunosorbent assay (ELISA) to detect and quantify bacterial pathogens in fish tissue, in Stolen J S, Fletcher T C, Kaattari S L and Rowley A F (eds), Techniques in Fish Immunology, Vol. 2, SOS Publications, Fair Haven, NJ, 177–84. adams a (2004) Immunodiagnostics in aquaculture, Bull Eur Assoc Fish Pathol, 24, 33–7. adams a and marin de mateo m (1994) Immunohistochemical detection of fish pathogens, in Stolen J S, Fletcher T C, Kaattari S L and Rowley A F (eds), Techniques in Fish Immunology, Vol. 3, SOS Publications, Fair Haven, NJ, 133–44. adams a and thompson k d (1990) Development of an ELISA for the detection of Aeromonas salmonicida in fish tissue, J Aquat Animal Health, 2, 281–8. adams a and thompson k d (2006) Biotechnology offers revolution to fish health management, Trends Biotechnol, 24, 201–5. adams a and thompson k d (2008) Recent applications of biotechnology to novel diagnostics for aquatic animals, Rev Sci Tech Off Int Epiz, 27, 197–209. adams a, thompson k d, morris d, farias c and chen s c (1995) Development and use of monoclonal antibody probes for immunohistochemistry, ELISA and IFAT to detect bacterial and parasitic fish pathogens, Fish Shellfish Immunol, 5, 537–47. adams a, aoki t, berthe f c j, grisez l and karunasagar i (2005) Recent technological advancements on aquatic animal health and their contributions towards reducing disease risks – a review, in Bondad-Reantaso M G, Mohan C N, Crumlish M and Subasinghe R P (eds), Disease in Asian Aquaculture VI, Proceedings of the sixth symposium on diseases in Asian aquaculture, Fish Health Section, Asian Fisheries Society, Manila, 71–88. adkison m a, gilad o and hedrick r p (2005) An enzyme linked immunosorbent assay (ELISA) for detection of antibodies to the koi herpesvirus (KHV) in the serum of koi Cyprinus carpio, Fish Pathol, 40(2), 53–62. aoki t, hirono i, de castro t and kitao t (1989) Rapid identification of Vibrio anguillarum by colony hybridization, J Appl Ichthyol, 5, 67–73. bakopoulos v, pearson m, volpatti d, gousmani l, adams a, galeotti m, richards r h and dimitriadis g j (2003) Investigation of media formulations promoting differential antigen expression by Photobacterium damsela ssp. piscicida and recognition by sea bass, Dicentrarchus labrax (L.), immune sera, J Fish Dis, 26, 1–13. bakopoulos v, hanif a, poulos k, galeotti m, adams a and dimitriadis g j (2004) The effect of in vivo growth on the cellular and extracellular components of the marine bacterial pathogen Photobacterium damsela subsp. piscicida, J Fish Dis, 27, 1–13. balcázar j l, vendrell d, de blas i, ruiz-zarzuela i, gironés o and múzquiz j l (2007) Quantitative detection of Aeromonas salmonicida in fish tissue by realtime PCR using self-quenched, fluorogenic primers, J Med Microbiol, 56, 323–8. bautista d a, elankumaran s, arking j a and heckert r a (2002) Evaluation of an immunochromatography strip assay for the detection of Salmonella sp. from poultry, J Vet Diagn Invest, 14, 427–30. benmansour a and de kinkelin p (1997) Live fish vaccines: history and perspectives, in Gudding R, Lillehaug A, Midtlyng P J and Brown F (eds), Fish Vaccinology Developments in Biological Standardization, Karger, Basel, 279–89. berg a, rødseth o m and hansen t (2007) Fish size at vaccination influence the development of side-effects in Atlantic salmon (Salmo Salar L.), Aquaculture, 265, 9–15.
212
New technologies in aquaculture
biacchesi s, le berre m , le guillou s, benmansour a, brémont m, quillet e and boudinot p (2007) Fish genotype significantly influences susceptibility of juvenile rainbow trout, Oncorhynchus mykiss (Walbaum), to waterborne infection with infectious salmon anaemia virus, J Fish Dis, 30, 631–6. birkbeck t h (2004) Role of probiotics in fish disease prevention, in Leung K A (ed.), Current Trends in the Study of Bacterial and Viral Fish and Shrimp Diseases. Molecular Aspects of Fish and Marine Biology, Vol. 3, World Scientific, Singapore, 390–416. bricknell i and dalmo r a (2005) The use of immunostimulants in fish larval aquaculture, Fish Shellfish Immunol, 19, 457–72. clark j r and march j b (2006) Bacteriophages and biotechnology: vaccines, gene therapy and antibacterials, Trends Biotechnol, 24, 212–18. costa j z, adams a, bron j e, thompson k d, starkey w g and richards r h (2007) Identification of B-cell epitopes on the betanodavirus capsid protein, J Fish Dis, 30, 419–26. cowley j a, dimmock c m, wongteerasupaya c, boonsaeng v, panyim s and walker p j (1999) Yellow head virus from Thailand and gill-associated virus from Australia are closely related but distinct prawn viruses, Dis Aquatic Org, 36, 153–7. cunningham c o (2004) Use of molecular diagnostic tests in disease control: making the leap from laboratory to field application, in Leung K-Y (ed.) Current Trends in the Study of Bacterial and Viral Fish and Shrimp Diseases, Molecular Aspects of Fish and Marine Biology, Vol. 3, World Scientific, Singapore, 292–312. dunbar s a (2006) Applications of Luminex® xMAPTM technology for rapid, highthroughput multiplexed nucleic acid detection, Clin Chim acta, 363, 71–82. fournier p e and raoult d (2003) Comparison of PCR and serology assays for early diagnosis of acute Q fever, J Clin Micro, 41, 5094–98. frost p and ness a (1997) Vaccination of Atlantic salmon with recombinant VP2 of infectious pancreatic necrosis virus (IPNV), added to a multivalent vaccine, suppresses viral replication following IPNV challenge, Fish Shellfish Immunol, 7, 609–19. gatta l, perna f, ricci c, osborn j f, tampieri a, bernabucci v, miglioli m and vaira d (2004) A rapid immunochromatographic assay for Helicobacter pylori in stool before and after treatment, Alim Pharmacol Therapeut, 20, 469–74. gjedrem t (2000) Genetic improvement of cold-water fish species, Aquac Res, 31, 25–33. gjedrem t, salte r and gjoen h m (1991) Genetic-variation in susceptibility of Atlantic salmon to furunculosis, Aquaculture, 97, 1–6. gonzález s f, krug m j, nielsen m e, santos y and call d r (2004) Simultaneous detection of marine fish pathogens by using multiplex PCR and a DNA microarray, J Clin Microbiol, 1414–19. grimholt u, larsen s, nordmo r, midtlyng p, kjoeglum s, storset a, saebo s and ste r j (2003) MHC polymorphism and disease resistance in Atlantic salmon (Salmo salar); facing pathogens with single expressed major histocompatibility class I and class II loci, Immunogenetics, 55, 210–19. jansson e, lindberg l, säker e and aspán a (2008) Diagnosis of bacterial kidney disease by detection of Renibacterium salmoninarum by real-time PCR, J Fish Dis, 31, 755–63. jung t s, thompson k d, volpatti d, galeotti m and adams a (2007) Variation in the molecular weight of Photobacterium damselae subsp. piscicida antigens when cultured under different conditions in vitro, J Vet Sci, 8, 255–61. jung t s, thompson k d, volpatti d, galeotti m and adams a (2008) In vivo morphological and antigenic chracateristics of Photobacterium damselae subsp. piscicida, J Vet Sci, 9, 169–75.
Advances in disease diagnosis and vaccine development
213
karunasagar i, nayak b b and karunasagar i (1997) Rapid detection of Vibrio parahaemolyticus from fish by polymerase chain reaction, in Flegel T W and MacRae L H (eds), Diseases in Asian Aquaculture III, Asian Fisheries Society, Manila, 119–22. karatas s, mikalsen j, steinum t m, taksdal t, bordevik m and colquhoun d j (2008) Real time PCR detection of Piscirickettsia salmonis from formalin-fixed paraffin-embedded tissues, J Fish Dis, 31, 747–53. kim g, om a s and mun j h (2007) Nano-particle enhanced impedimetric biosensor for detedtion of foodborne pathogens, J Phys: Conf Ser, 61, 555–9. klesius p, evans j, shoemaker c, yeh h, goodwin a e, adams a and thompson k d (2006) Rapid detection and identification of Streptococcus iniae using a monoclonal antibody-based indirect fluorescent antibody technique, Aquaculture, 258, 180–6. leong j c, anderson e, bootland l m, chiou p w, johnson m, kim c, mourich d and trobridge g (1997) Fish vaccine antigens produced or delivered by recombinant DNA technologies, in Gudding R, Lillehaug A, Midtlyng O J and Brown F (eds), Fish Vaccinology. Developments in Biological Standardization, Karger, Basel, 267–77. lorenzen n and la patra s e (2005) DNA vaccines for aquacultured fish, Rev Sci Tech Off Int Epiz, 24, 201–13. manji f (2008) Development of methods to determine prevalence of Flavobacterium psychrophillum in farm systems, PhD Thesis, University of Stirling, UK. march j b, clark j r and jepson c d (2004) Genetic immunisation against hepatitis B using whole bacteriophage lambda particles, Vaccine, 22, 1666–71. markestad a and grave k (1997) Reduction of antibacterial drug use in Norwegian fish farming due to vaccination, in Gudding R, Lillehaug A, Midtlyng O J and Brown F (eds), Fish Vaccinology. Developments in Biological Standardization, Karger, Basel, 365–9. marko n f, weil r j and toms s a (2007) Nanotechnology in proteomics, Expert Rev Proteomics, 4, 617–26. matsuyama t, kamaish t and oseko n (2006) Rapid discrimination of fish pathogenic Vibrio and Photobacterium species by oligonucleotide DNA array, Fish Pathol, 41, 105–12. meeusen e n t, walker j, peters a, pastoret p-p and jungersen g (2007) Current status of veterinary vaccines, Clinical Microbiology Reviews, 20, 489–510. melamed p, gong z, fletcher g and hew c l (2002) The potential impact of modern biotechnology on fish aquaculture, Aquaculture, 204, 255–69. miles d j c, thompson k d, lilley j h and adams a (2003) Immunofluorescence of the epizootic ulcerative syndrome pathogen, Aphanomyces invadans, using monoclonal antibodies, Dis Aquat Org, 55(1), 77–84. moen t, fjalestad k t, munck h and gomez-raya l (2004) A multistage testing strategy for detection of quantitative trait loci affecting disease resistance in Atlantic salmon, Genetics, 167, 851–8. neelam b, robinson r a, price n c and stevens l (1993) The effect of iron limitation on the growth of Aeromonas salmonicida, Microbios, 74, 59–67. notomi t, okayama h, masubuchi h, yonekawa t, watanabe k, amino n and hase t (2000) Loop-mediated isothermal amplification of DNA, Nucleic Acids Res, 28(12), 63. palmer-densmore m l, johnson a f and sabara m i (1998) Development and evaluation of an ELISA to measure antibody responses to both the nucleocapsid and spike proteins of canine coronavirus, J Immunoassay, 19, 1–22. peddie s and secombes c j (2005) An overview of fish immunostimulant research, Fish Vet J, 8, 1–31.
214
New technologies in aquaculture
poobalane s (2007) Aeromonas hydrophila vaccine development using immunoproteomics, PhD Thesis, University of Stirling, UK. pourahmed f (2008) Molecular detection and identification of aquatic mycobacteria, PhD Thesis, University of Stirling, UK. powell j l and loutit m w (2004) Development of a DNA probe using differential hybridization to detect the fish pathogen Vibrio anguillarum, Microb Ecol, 28, 365–73. puttinaowarat s, thompson k d and adams a (2000) Mycobacteriosis: detection and identification of aquatic Mycobacterium species, Fish Vet J, 5, 6–21. rainey p b and preston g m (2000) In vivo expression technology strategies: valuable tools for biotechnology, in Curr Opin Biotechnol, 11, 440–4. rose a s, ellis a e and adams a (1989) An assessment of routine Aeromonas salmonicida carrier detection by ELISA, Bull Eur Assoc Fish Pathol, 9, 65–7. savan r, kono t, itami t and sakai m (2005) Loop-mediated isothermal amplification: an emerging technology for detection of fish and shellfish pathogens, J Fish Dis, 28, 573–81. saenz h l and dehio c (2005) Signature-tagged mutagenesis: technical advances in a negative selection method for virulence gene identification, Curr Opin Microbiol, 8, 612–19. skurnik m and strauch s (2006) Phage therapy: facts and fiction, Int J Med Microbiol, 296, 5–14. smith p d (2000) Vaccines and vaccination – a widening choice, Fish Farmer, 23(6), 45–53. sommerset i, krossoy b, biering e and frost p (2005) Vaccines for fish in aquaculture, Future Drugs, Expert Review of Vaccines, 4, 89–101. steiropoulos n a, yuksel s a, thompson k d, adams a and ferguson h w (2002) Detection of Rickettsia-like organisms (RLOs) in European sea bass (Dicentrarchus labrax, L.) by immunohistochemistry, using rabbit anti-Piscirickettsia salmonis serum, Bull Eur Assoc Fish Pathol, 22(5), 428–32. sudheesh p s, crane s, cain k d and strom m s (2007) Sortase inhibitor phenyl vinyl sulfone inhibits Renibacterum salmoninarum adherence and invasion of host cells, Dis Aquat Org, 78, 115–27. thompson k d and adams a (2004) Current trends in immunotherapy and vaccine development for bacterial diseases of fish, in Leung K-Y (ed.), Current Trends in the Study of Bacterial and Viral Fish and Shrimp Diseases. Molecular Aspects of Fish and Marine Biology, Vol. 3, World Scientific, Singapore, 313–62. vatsos i n, thompson k d and adams a (2002) Development of an immunofluorescent antibody technique (IFAT) and in situ hybridisation to detect Flavobacterium psychrophilum in water samples, Aquac Rese, 33, 1087–90. wilson t and carson j (2003) Development of sensitive, high-throughput one-tube RT-PCR-enzyme hybridisation assay to detect selected bacterial fish pathogens, Dis Aquatic Org, 54, 127–34. yang s y, chieh j j, wang w c, yu c y, lan c b, chen j h, horng h e, hong c y, yang h c and huang w (2008) Ultra-highly sensitive and wash-free bio-detection of H5N1 virus by immunomagnetic reduction assays, J Virol Meth, 153, 250–2. yuce a, yucesoy m, genc s, sayan m and ucan e s (2001) Serodiagnosis of tuberculosis by enzyme immunoassay using A60 antigen, Clin Microbiol Infect, 7, 372–6. world organisation for animal health (2006) Manual of Diagnostic Tests for Aquatic Animals, 5th edn, OIE, Paris.
8 Controlling parasitic diseases in aquaculture: new developments C. Sommerville, University of Stirling, UK
Abstract: The expanding global aquaculture industry is urgently in need of more effective methods for the control of parasitic diseases. Advances in our understanding of parasite biology, host parasite interactions and improved diagnostic methods using new technologies which contribute to better management and control are highlighted in this chapter. There is an increasing volume of research pointing to effective control without the use of chemical interventions. The processes leading to increasing regulation and cost of drugs and chemicals are described. Their integration into a more sustainable pest management strategy is discussed and the imperative for the inclusion of resistance management principles in any strategy is emphasised. Key words: aquaculture, parasites, disease control, new developments, integrated pest management.
8.1 Introduction Aquatic parasites attracted little attention until the large-scale development of intensive aquaculture in the early 1970s created a surge of interest in parasitic diseases, resulting in an increase in our knowledge and understanding of parasites of aquatic organisms generally. The high fish density associated with culture intensification leads to increased chances of parasite/host encounters which inevitably results in a higher parasite prevalence and intensity. Parasitic diseases can impact on aquaculture systems in a number of ways which will determine their economic cost (Sommerville, 1998). Mortality has evident costs determined by the size and age of the fish but, more often, parasite infection causes morbidity and loss of appetite with a resultant waste of food, reduced food conversion efficiency and specific growth rate which, over a grow-out period in a population of fish, may account for a noteworthy proportion of the profits. In some cases
216
New technologies in aquaculture
parasite infections may be zoonotic, or reduce the market value owing to their large size or unaesthetic appearance, and this has been known to cause rejection of entire stocks of fish even where there was no discernible impact on the welfare of the fish; other parasitic infections may affect broodstock quality. The scarcity of taxonomists with expertise in aquatic parasites has always been a problem. It was, and is still, common to encounter undescribed parasites in fish and new methods are needed to aid non-specialists. It is necessary to underpin research into parasite control in aquaculture systems with studies on parasite biology and the host–parasite interactions for several reasons. In the first place, it is important to establish whether it is necessary to intervene as some parasites have no impact on the growth performance or wellbeing of the culture species and, secondly, what threshold level of infection is sustainable without treatment. Understanding the host–parasite interactions can lead to targets for drugs or other nonchemical treatments and knowledge of the life cycle of the parasite is key to making appropriate intervention at the right time. Many parasites have complex life cycles and knowledge of the location of transmission stages and vectors is essential for prevention of infection and management of the disease without the use of drugs or chemicals. However, commonly, the method of choice for the control of parasitic problems in fish has been chemotherapy, despite the availability of a range of non-invasive methods. The following discussion will illustrate how the potential of new methodologies to study the issues noted above may lead to more effective control.
8.2 Effects of parasitic disease in aquaculture In today’s aquaculture industry, parasite epizootics continue to have major economic consequences, and there is an urgent need to find more effective methods of control. The magnitude of the economic losses has increased as a result of the size of the operations, as in the salmon mariculture industry, and the greater part of the economic costs are currently due to only a small number of parasite pathogens. For example, the estimated cost to the industry of sea lice infections can be as high as 5 % of annual costs in growth alone (Rae, 2002). Drugs and chemical treatments have become an increasingly significant component of the production costs of aquaculture since the 1980s. Most of the early, cheaper, treatments are no longer available and the new treatments have been specifically tailored to aquaculture requirements and therefore are at higher cost. As a result of the widespread outbreaks of disease, attempts are now being made to regulate the aquaculture industry at governmental level, although this varies from country to country (Scarfe et al., 2006). The primary objective is to control the movements of fish across boundaries in a manner which minimises the risk of the spread of disease. A further major
Controlling parasitic diseases in aquaculture: new developments
217
objective is the regulation of the use of drugs and chemicals which are used to treat disease with a view to developing good practices which will protect the consumer and the environment without compromising the welfare of the fish (see below). There is now a greater awareness of biosecurity in aquaculture on a global scale (Subasinghe and Bondad-Reantaso, 2006). Legislation is now becoming widespread and is coupled with better techniques for detection of low levels of chemical/drug contamination of food products (Reimschuessel, 2008). The impact of exotic parasites on native fauna has been recognised since the spread of rainbow trout, common carps, tilapias and eels around the globe. Indigenous species often have little defence against ‘foreign’ parasites and, without the benefits from evolution, may succumb rapidly. Unfortunately little control was exercised and efforts to contain further spread have often been too little, too late; many cosmopolitan pathogenic parasites have been recognised, e.g. the ciliate Ichthyophthirius multifiliis originated in the tropics of Asia and now extends into the sub-arctic regions (Valtonen and Keränen, 1981). Plans for quarantine systems to contain parasitic diseases have been identified since the early 1980s and taken up by governments and major agencies, e.g. FAO (Arthur, 1996; Subasinghe and Arthur, 1997; Subasinghe, 2004), but implementation at country or regional level for the most part seems to have been half-hearted. Thus, the transfaunation of fish parasite pathogens across global boundaries has been largely avoidable but has been facilitated through misjudgement, often founded on lack of knowledge of the parasite pathobiology. There has, to date, not been sufficient expertise available in vulnerable countries at a high enough level to understand the need for, and to implement effectively, preventative practices into the regulatory process. Expertise has been growing rapidly since the 1970s and most countries for which fish culture is a significant source of income and/or protein now have some diagnostic and advisory personnel who make recommendations on how to treat parasite problems (Scarfe et al., 2006). Organisations responsible for protection of wild stocks have been drawn into debates on the potential introduction and spread of parasite pathogens through aquaculture activities. These can be highly controversial, as in the case of sea lice. Concentration of research efforts on these problems has been ultimately beneficial to the aquaculture industry. For example, there has been widespread concern that mariculturalists do not effectively control sea lice infections and that these are the source of lice seen on wild salmonids, currently a major issue in Canada, see for example Krkosˇek et al. (2005). This has been hotly debated and is the cause of deep political division. Some have gone so far as to blame the decline in salmon and sea trout populations on sea lice infection from the farming activities to the extent that Canada, Norway and Scotland have invested considerable research effort in trying to demonstrate conclusively whether this is the case and it is very publicly debated in these countries (McVicar, 2004; Heuch et al.,
218
New technologies in aquaculture
2005; Krkosˇek et al., 2005, 2006, 2007; Boxaspen, 2006; Hilborn, 2006; Hume, 2008; Penston et al., 2008). A benefit of this controversy is the allocation of funding to try to find new and sustainable methods of control, some of which are now the subject of legislation. Similarly, the research associated with the protection of wild salmon parr from the monogenean Gyrodactylus salaris has contributed to our understanding of host–parasite interactions, parasite virulence, epidemiology and phylogeny of this genus, many species of which are common in culture systems worldwide (Bakke et al., 2007). G. salaris is a non-virulent parasite of Baltic salmon which, when introduced into Norwegian rivers, has been associated with mass decline of Atlantic salmon stocks on which it becomes more virulent. Research in non-endemic countries has also led governments to develop risk analyses and containment policies.
8.3 Advances in the understanding of parasite biology and host–parasite interactions Knowledge of the pathogenic processes of many aquatic parasites is now well established, as is the greater impact on a host of an exotic parasite with which it has not evolved, for example, whirling disease in rainbow trout (Hedrick et al., 1999; Rose et al., 2000; Gilbert and Granath, 2003), Anguillicola crassus in European eels (Kennedy and Fitch, 1990; Würtz et al., 1998) and Myxidium leei in Mediterranean mariculture (Diamant, 1998). Perhaps less well recognised and researched are the influences and relationships a parasite has with other pathogens within the same host and their combined impact on the host. The modulated susceptibility of a host in the presence of one or more pathogens has been studied for higher animals and rates more attention in fish (Booth et al., 2008). Describing the parasite population dynamics in wild fish allows for the assessment of the influence of environmental factors which are commonly associated with temperature and season but, in cultured fish, parasite populations are also affected by husbandry factors such as stocking time, size
