Organophosphorus Chemistry

Organophosphorus Chemistry Volume 31

SPECIALIST PERIODICAL REPORTS Systematic and detailed review coverage in major ,'recisof chemical research. A unique service for the active research chemist with m n u l or biennial, in-dt pth accounts of progress in particular fields of chemistry, in print m d online.

NOW AVAILABLE ELECTRONICALLY - chapters from volumes published 1998 onwards are now available online, fully searchable by ke) Lvorti, on a pay-to-view basis. Contents pages can be viewed free of charge.

Or visit our web pages today:

www.rsc.org/spr

A Specialist Periodical Report

Organophosphorus Chemistry Volume 31 A Review of the Literature Published between July 1998 and June 1999 Senior Reporters D. W. Allen, Sheffield Hallam University, Sheffield, UK J. C. Tebby, Staffordshire University, Stoke-on-Trent, UK Reporters

N. Bricklebank, Sheffield Hallam University, Sheffield, UK C. D. Hall, King's College, London, UK N. M. Howarth, Heriot-Watt University, Edinburgh, UK R. N. Slinn, Staffordshire University, Stoke-on-Trent, UK J. C. van de Grampel, University of Groningen, The Netherlands J. S. Vyle, The Queen's University of Belfast, UK B. J. Walker, The Queen's University of Belfast, UK

RS*C ROYAL SOCIETY OF CHEMISTRY

ISBN 0-85404-329-2 ISSN 0306-07I3

43 The Royal Society of Chemistry 2001 All rights reserved Apurt from uny fuir deulingfor the purposes of research or privute study, or criticism or review us permitted under the terms of the UK Copyright, Designs und Patents Act, 1988, this publication may not be reproduced, stored or transmitted, in any form or by uny meuns without the prior permission in writing of The Royul Society of Chemistry, or in the cuse of reprogruphic reproduction only in uccordunce with the terms of the licences issued by the Copyright Licensing Agency in the UK, or in uccordunce with the terms of the licences issued by the appropriate Reproduction Rights Orgunizution outside the UK. Enquiries concerning reproduction outside the terms stuted here should be sent to The Royul Society of Chemistry ut the ucIcITL'ssprinted on this puge.

Published by The Royal Society of Chemistry, Thomas Graham House, Science Park, Milton Road, Cambridge CB4 OWF, UK Registered Charity Number 207890 For further information see our web site at www.rsc.org

Typeset by Computape (Pickering) Ltd, Pickering, North Yorkshire, UK Printed by Athenaeum Press Ltd, Gateshead, Tyne and Wear, UK

Introduction

After more than a century of activity, organophosphorus chemistry continues to be a lively area of wide international interest as judged by the increasing volume (and the origin) of the literature to be reviewed. However, for this Report, we have experienced some difficulties in securing coverage of all of the traditional areas, notably that of tervalent phosphorus acid derivatives and part of the physical methods chapter. We hope to redress these deficiencies in the next volume (Volume 32), by providing reviews covering two year’s literature. Within the broad area of organophosphine chemistry, increased interest is evident in the application of phosphine-borane adducts in synthesis, and in the structural characterisation of metallophosphides. The maturity of the low coordination number phosphorus area is reflected by the appearance of a book on the subject by Dillon, Mathey, and Nixon. There is a resurgence of interest in mechanistic and theoretical studies of the Wittig reaction and ylides. One notable ylide investigated structurally is the simplest that can be made, methylene(trimethy1)phosphorane. Linking of independent procedures into ‘tandem’ reactions is always of interest, and the latest development in the Wittig area is the first tandem Wittig-hydroformylation reaction. Controlled free-radical polymerisation is another topical area, and a number of organophosphorus compounds, including Wittig reagents, have been used to exert ‘control’ on the polymerisation process. As usual, the synthesis of an ever more complex array of biologically active compounds has been achieved using Wittig procedures. The number of publications in the field of nucleotides and nucleic acids has again risen sharply. Novel oligonucleotide analogues have continued to attract considerable attention and an increase in interest in oligonucleotides incorporating conformationally-locked sugars that have been shown to hybridise to complementary oligonucleotide targets with unprecedented affinity has also been apparent in the literature. Exciting new methodology has been developed for preparing oligoribonucleotides using alternatives to the protecting groups previously employed. The rapid increase in the number of novel modified nucleoside triphosphates can be attributed to the development of techniques for nucleic acid library construction and selection. Such libraries have been utilised in several roles: generating novel nucleic acid reactivity; probing protein-nucleic acid and nucleic acid-nucleic acid interactions; and determining metal ion binding sites. Several new reports of the incorporation of site-specific metal ion binding sites into DNA have been made utilising either novel post-synthetic methodology or a solid-phase Heck-type reaction. V

vi

Introduction

This year saw the 70th birthday and retirement of Professor Robert Holmes, distinguished for his outstanding contributions to hypervalent phosphorus and silicon chemistry, and it is a pleasure to acknowledge the tribute paid to him by the dedication of the July (1998) issue of Heteroatom Chemistry to his work. Another major contributor to phosphorus chemistry reached his seventieth birthday in 1999 and the seventh and eighth issues of Heteroatom Chemistry, Vol. 10 are fittingly dedicated to Professor Alfred Schmidpeter who provides an ‘Essay on Phosphorus Chemistry’ at the outset of a series of articles from friends and colleagues throughout the world. In a review dealing with donor interaction by N, 0 and S atoms at tri-, tetra- and pentacoordinate phosphorus Robert Holmes points out that such interactions give rise to higher coordination and may be highly relevant to enzyme activity. Specifically, phosphate substrates are displaced modestly towards pentacoordinate structures (equivalent to the ground state complex) whereas pentaoxyphosphoranes are displaced more strongly towards octahedral geometry (equivalent to the transition state complex) by a donor interaction, which results in P-0 bond weakening and, consequently, higher reaction rates. Similar reasoning leads to the conclusion that coordination of the tyranosyl carbonyl group with the pentacoordinate transition state in the activation of tyrosine by tyrosyl-tRNA synthetase enhances reactivity. Biological aspects of quinquevalent phosphorus acid chemistry, quite separate from nucleotide chemistry, continue to increase in importance. Tetracoordinate phosphorus compounds are a major source of transition state analogues for the generation of abzymes, etc. A wide variety of natural and unnatural phosphates, especially those of carbohydrates, and their phosphonate and phosphinate, particularly fluorinated, analogues have been synthesised, usually with some biologically-related purpose. The synthesis of extremely complex natural carbohydrate phosphates and unnatural analogues has rapidly developed, and the synthesis and biological properties of inositol phosphates, phosphatidylinositols and related compounds have again been particularly active areas. The interest in phosphorus analogues of all types of amino acids continues. The importance of enantiomeric and asymmetric synthesis is illustrated in many of the reports and the synthesis, and use of chiral phosphorus(V) amides as chiral catalysts, features in many publications. Interest in approaches to easier and safer nerve gas hydrolysis continues. Acylphosphonates have substantial potential as synthetic intermediates and investigations of their synthesis and reactions have increased. A number of thorough mechanistic studies of reactions involving a variety of tricoordinate phosphorus(V) compounds as reactive intermediates have appeared. The first example of a phosphide in a variation of the Staudinger reaction led to the formation of a phosphonium diylide. Intramolecular aza-Wittig reactions have facilitated heterocyclic ring extensions with reports on the use of a chiral ylide to prepare diastereomeric a-aminoesters as well as new reagents for electrophilic amination leading to pyridopyrimidines. The number and variety of applications for phosphazenes continues to expand in a remarkable manner. A number of uses for phosphazenes as bases are reported

Introdurt ion

vii

as well as for phosphazenium cations as catalysts. Several heterocubanes and some new dendrimers have been characterised. High yields of cyclophosphazenes bearing macrocyclic polyether substituents have been achieved and an example of self-assembling cyclophosphazenes is reported. Polymeric phosphazenes with useful surface properties and further examples of sols, electrolytes and membranes have been described. Such properties have found useful applications in medicine, for example fluoroalkoxy derivatives as coatings for blood contacting devices. Novel analysis of the ESR linewidth in TR-ESR experiments has been used for the measurement of addition constants and structural relationships of phosphinoyl radicals. The line width is not affected by spin-polarisation processes, easing determination of rate constant. The first examples of crystal structures of lithiated organophosphorus enamines have been reported

Contents

Chapter 1

Phosphines and Phosphonium Salts By D. W. Allen

1

1 Phosphines 1.1 Preparation 1.1.1 From Halogenophosphines and Organometallic Reagents 1.1.2 Preparation of Phosphines from Metallated Phosphines 1.1.3 Preparation of Phosphines by Addition of P-H to Unsaturated Compounds 1.1.4 Preparation of Phosphines by Reduction 1.1.5 Miscellaneous Methods of Preparing Phosphines 1.2 Reactions of Phosphines 1.2.1 Nucleophilic Attack at Carbon 1.2.2 Nucleophilic Attack at Halogen 1.2.3 Nucleophilic Attack at Other Atoms 1.2.4 Miscellaneous Reactions of Phosphines

1

12 17 17 18 19 22

2 Phosphine Oxides and Related Chalcogenides 2.1 Preparation 2.2 Reactions 2.3 Phosphine Chalcogenides as Ligands 2.4 Structural and Physical Aspects

23 23 25 27 28

1

1 5 10 11

3

Phosphonium Salts 3.1 Preparation 3.2 Reactions

28 28 30

4

p,-Bonded Phosphorus Compounds

31

5 Phosphirenes, Phospholes and Phosphinines

37 43

References Organophosphorus Chemistry, Volume 3 I ((3 The Royal Society of Chemistry, 2001

ix

Contents

X

Chapter 2

Pentacoordinated and Hexacoordinated Compounds By C.D. Hall

62

1 Introduction

62

2 Acyclic Phosphoranes

63

3 Monocyclic Phosphoranes

63

4 Bicyclic and Tricyclic Phosphoranes

67

5 Hexacoordinate Phosphorus Compounds

75

References Chapter 3

80

Quinquevalent Phosphorus Acids By B. J. Walker

82

1 Introduction

82

2 Phosphoric Acids and their Derivatives 2.1 Synthesis of Phosphoric Acids and their Derivatives 2.2 Reactions of Phosphoric Acids and their Derivatives 2.3 Selected Biological Aspects

82

3 Phosphonic and Phosphinic Acids 3.1 Synthesis of Phosphonic and Phosphinic Acids and their Derivatives 3.1.1 Alkyl, Cycloalkyl, Aralkyl and Related Acids 3.1.2 Alkenyl, Alkynyl, Aryl, Heteroaryl and Related Acids 3.1.3 Halogenoalkyl and Related Acids 3.1.4 Hydroxyalkyl and Epoxyalkyl Acids 3.1.5 Oxoalkyl Acids 3.1.6 Aminoalkyl and Related Acids 3.1.7 Sulfur- and Selenium-containing Compounds 3.1.8 Phosphorus-Nitrogen Bonded Compounds 3.1.9 Phosphorus-containing Ring Systems 3.2 Reactions of Phosphonic and Phosphinic Acids and their Derivatives 3.3 Selected Biological Aspects

82 93 100 03

03 03 05 108 109 111 112 115 1 15 116 117 124

xi

Contents

4

Chapter 4

Structure

126

References

127

Nucleotides and Nucle.: Acids By J.S. Vyle and N. M. Howarth

135

1 Introduction

135

2 Mononucleotides 2.1 Nucleoside Acyclic Phosphates 2.1.1 Mononucleoside Phosphate Derivatives 2.1.2 Polynucleoside Monophosphates 2.2 Nucleoside Cyclic Phosphates

135 135 135 140 142

3

Nucleoside Polyphosphates

4 Oligo- and Polynucleotides 4.1 DNA Synthesis 4.2 RNA Synthesis 4.3 The Synthesis of Modified Oligodeoxynucleotides and Modified Oligoribonucleotides 4.3.1 Oligonucleotides Containing Modified Phosphodiester Linkages 4.3.2 Oligonucleotides Containing Modified Sugars 4.3.3 Oligonucleotides Containing Modified Bases

154 154 161

5 Oligonucleotide Conjugates

191

6 Nucleic Acid Structures

204

References Chapter 5

145

161 161 170 178

208

Ylides and Related Species By N. Bricklebank

219

1 Introduction

219

2 Phosphonium Ylides 2.1 Theoretical and Mechanistic Studies of Phosphorus Ylides and the Wittig Reaction 2.2 Synthesis and Characterisation of Phosphonium Ylides 2.3 Ylides Coordinated to Metals

219 219 223 227

Conten ts

xii

2.4

Reactions of Phosphonium Ylides 2.4.1 Reactions with Carbonyl Compounds 2.4.2 Miscellaneous Reactions

3 The Synthesis and Reactions of Aza-Wittig Reagents

235

4 Structure and Reactivity of Lithiated Phosphine Oxide Anions

238

5 Structure and Reactivity of Phosphonate Anions

238

6 Selected Synthetic Applications of Wittig Reactions

24 1

References

Chapter 6

244

Phosphazenes By J. C. van de Grampel

249

1 Introduction

249

2 Linear Phosphazenes

249

3 Cyclophosphazenes

260

4

Polyphosphazenes

5 Crystal Structures of Phosphazenes and Related Compounds

Chapter 7

23 1 23 1 233

27 1

280

References

286

Physical Methods By R.N. Slim

295

1 Electron Paramagnetic (Spin) Resonance Spectroscopy

295

2 Vibrational and Rotational Spectroscopy 2.1 Vibrational Spectroscopy 2.2 Rotational Spectroscopy

297 297 298

3 Electronic Spectroscopy 3.1 Absorption Spectroscopy 3.2 Fluorescence and Chemiluminescence Spectroscopy

298 298 298

4 X-Ray Structural Studies

299

...

Contents

Xlll

4.1

X-Ray Diffraction (XRD) 4.1.1 Two-coordinate Compounds 4.1.2 Three-coordinate Compounds 4.1.3 Four-coordinate Compounds 4.1.4 Five- and Six-coordinate Compounds 4.2 X-Ray Absorbtion Near Edge Spectroscopy (XANES) 4.3 Electron Diffraction

302 303

5 Electrochemical Methods 5.1 Dipole Moments 5.2 Cyclic Voltammetry and Polarography 5.3 Potentiometric and Conductometric Methods

303 303 303 304

6 Thermochemistry and Thermal Methods

304

7 Mass Spectroscopy/Spectrometry

304

8 Chromatography and Related Techniques 8.1 Gas Chromatography and Gas Chromatography-Mass Spectroscopy (GC-MS) 8.2 Liquid Chromatography 8.2.1 High-performance Liquid Chromatography and LC-MS 8.2.2 Thin-layer Chromatography (TLC) 8.3 Capillary Electrophoresis (CE) and Micellar Electrokinetic Chromatography (MEKC)

305

References Author Index

299 299 299 300 302

305 305

305 306

306 306 310

Abbreviations

Benzamide adenine dinucleotide Cyclodiphospho D-glycerate Capillary electrophoresis Creatine kinase Controlled potential electrolysis 1-(Zchlorophenyl)-4-methoxylpiperidin-2-yl Cyclic voltammetry cv DETPA Di(2-ethyIhexy1)thiophosphoric acid DMAD Dimethylacetylene dicarboxylate Dimet h yl formamide DMF DMPC Dimyristoylphosphatidylcholine DRAMA Dipolar restoration at the magic angle Differential scanning calorimetry DSC Differential thermal analysis DTA Energy resolved mass spectrometry ERMS Electrospray ionization mass spectrometry ESI-MS Extended X-ray absorption fine structure EXAFS Fast atom bombardment FAB 1 -(2-fluorophenyl)-4-methoxylpiperidin-2-yl FPmP High-performance liquid chromatography HPLC LA-FTICR Laser iblation Fourier Transform ion cyclotron resonance Matrix assisted laser desorption ionization MALDI Micellar electrokinetic chromatography MCE Mass-analysed ion kinetic energy MIKE Polycyclic aromatic hydrocarbons PAH H ydroquinone-0, 0'-diacetic acid QDA 9-[2-(phosphonomethoxy)ethyl] adenine PMEA S-acyl-2-thioethyl SATE Secondary ion mass spectrometry SIMS Spermidinekpermine-N 1-acetyltransferase SSAT SSIMS Static secondary ion mass spectrometry Thiazole-4-carboxamide adenine dinucleotide TAD tert-Butyldimethylsilyl tBDMS TFA Trifluoroacetic acid Thermogravimetric analysis TGA Thin-layer chromatography TLC TOF Time of flight X-Ray absorption near edge spectroscopy XANES

BAD cDPG CE CK CPE CPmP

xiv

1 Phosphines and Phosphonium Salts BY D. W. ALLEN

1

Phosphines

1.1 Preparation. - 1.1.1 From Halogenophosphines and Organometallic Reagents. The use of organolithium reagents has dominated the field in the past year, with only a few examples of the use of Grignard reagents having been noted. A Grignard route has been used in the synthesis of the alkoxysilylfunctionalised arylphosphine ( l), treatment of which with lithium aluminium hydride gives the air-stable phosphine (2). The alkoxysilyl phosphine (1) undergoes acid-catalysed hydrolysis and condensation to form a phosphinofunctional gel, the prototype of a new family of hybrid 'inorganic-organic' gels containing phosphorus. The same group has also used a Grignard procedure for the synthesis of the alkoxysilylated alkylphosphine (3), but attempts to

form hydrogels from this resulted in cleavage of the carbon-silicon bond'. A benzylic Grignard reagent has been used in the synthesis of the phosphine (4), subsequently converted by in situ demethylation and electrochemical oxidation of its platinum complexes to related complexes of the phenolic and quinonoidal phosphines, (5) and (6), respectively2. Sequential treatment of phos-

phorus trichloride with aryl- or bulky alkyl-Grignard reagents (1 mole), followed by methylmagnesium halides and borane protection, has provided a route to the protected systems (7). Subsequent metallation at a methyl group using butyllithium in the presence of (-)-sparteine, followed by treatment with a dichlorophosphine, and final Grignard methylation provides a route to Organophosphorus Chemistry, Volume 3 I 6;: The Royal Society of Chemistry, 2001

2

Organophosphorus Chemistry

the chiral diphosphines (8), isolated in borane-protected form3. Both Grignard and organolithium reagents have been applied in the synthesis of a range of new, electron-rich, bulky phosphines, e.g., (9) and (lo), which have been

b"

BH3 Me R-P( Me (7) R = Ph, Pr', Cy or But

t

(8) R = Ph, Pr', Cy or But

(9) R = But or Cy

shown to fhcilitate the palladium-catalysed synthesis of diary1 ethers4? Organolithium routes to long-chain arylalkylphosphines, e.g., (1 l), have also been developed. These phosphines have been shown to undergo sulfonation at the terminal benzene ring to give surface-active water-soluble systems6. Lithiation of the diacetal (12) is the first step in a divergent synthetic approach to OMe

OMe

Br

tunable, expanded aldehyde-functional phosphine ligands from which chiral iminoarylphosphines may be prepared7. New iminophosphine ligands, e.g., (13)* and (14)9, have been prepared from lithiated aldimine and ketimine precursors. Aryllithium reagents have been used in the synthesis of the chiral functionalised phosphines (15)'O and (16)". A chiral alkyllithium reagent has found use in the synthesis of the new chiral ligand (17), in which the chiral group is attached to phosphorus by a non-stereogenic chiroptic centre12.

PriP-CH-C=NR3

I

R'

I

Ph2P

R2

(13) R',R2 = H or Me; R3 = But or Cy

(15) R = Me or Et

(14)

Me

Me

Ph+Ph PhM&Ph 3

(16) R' = H or OMe; R2 = Me, Ph or 2,6-Me&&

Me

Me

(17)

Ph,-P(C

F=CF2)n

(18) n + m = 3

I : Phosphines and Phosphonium Salts

3

Trifluorovinylphosphines, e.g., (18), have been prepared by lithiation of trifluoromethylfluoromethane, followed by treatment with the appropriate halogenophosphine' 3. Direct lithiation of heterocyclic systems followed by treatment with halogenophosphines is the method of choice for the synthesis of a range of new phosphines, e.g., the atropisomeric quinazolinone phosphine ( 19)14, the sydnone systems (20)' 5 , the diphosphinobis(pyrazo1-1-yl)methanes (2 1) and related diphosphinobis(imidazolyl)methanes16, and a range of 'widebite' diphosphines, e.g., (22)17918.Lithium-halogen exchange on 2-bromodiben-

(19) R = PPh2,SH or SMe

R (20) R = H or PPh2

7 fJ J J -

Ar2P =

I PPh2 (21) R = H or M%Si

(22)

zofuran is the key step in the synthesis of a range of dibenzofuran-based phosphines (23), which have been shown to undergo regiospecific sulfonation at the 7-position of the dibenzofuran ring system to give a series of watersoluble phosphineslg. Several groups have reported the synthesis of indenylphosphines via direct metallation of indene with butyllithium. With chlorodiphenylphosphine, the phosphine (24) is formed. Further metallation/ phosphination yields the diphosphine (25)20. The outcome of the reaction of

indenyllithium with dichlorophenylphosphine depends on the choice of solvent. When THF is used, the 1H-inden-3-yl system (26) is formed, whereas when toluene is used, the isomeric 1H-inden-1-yl system (27) results2*.Both isomers were isolated from the reaction conducted in diethyl ether2*. This work also reported the synthesis of the mixed fluorenyl-indenylphosphine(28) via sequential treatment of phenyldichlorophosphine with fluorenyllithium and indenyllithium. Each of (26)-(28), and the related difluorenylphenylphosphine,

Organophosphorus Chemistry

4

P-Ph

P-Ph

P-Ph

can be deprotonated to give anionic phosphine ligands from which a range of metallocene-like complexes of zirconium and hafnium have been prepared. The past year has seen a considerable number of publications describing the synthesis of new phosphines, many of which are chiral, which involve the ferrocene system as the essential core of the molecule. Access is usually via direct lithiation of the ferrocene system, followed by reaction with a chlorophosphine. Further chiral C2-symmetric ferrocenyl diphosphines, e.g., (29), have been described23-25.The aminoalkylferrocenylphosphine (30) has both

@ wN bSR @PPh2 I

Fe PPh2 I

(31) R = Me or Ph

axial and planar chiral elements26.Routes to unsymmetrically substituted 1,l'~ - ~ stannylferroce*. ferrocene systems, e.g., (3l), have also been d e ~ e l o p e d ~ The nylphosphine (32) has been transformed into the chiral dihydrooxazolinylferrocenylphosphines (33)29. Sequential lithiation and phosphination of the

Fe I @PPh2

(32)

Fe I

R

@PPh2

(33)R = Pr', But or Ph

bis(ferroceny1)phosphine (34) has given the new phosphinoferrocene systems (35)30.Sequential treatment of 1,l'-dilithioferrocene with t-butyldichlorophosphine, methylmagnesium bromide, and borane, followed by separation of the various isomeric forms, has given the chiral diphosphine (36)3'. In a similar vein, direct lithiation of bis(tetrahydroindenyl)iron, followed by treatment

1: Phosphines and Phosphonium Salts

(34)

5

(35) X = Br or PPr’2

r””‘ -P, Me Me., P-

I But

with chlorodiphenylphosphine, gave a mixture of isomeric diphosphines (37), subsequently separated by fractional crystallisation, and resolved into optically active forms by chiral HLPC32. Chiral cymantrenylphosphines (38) have been obtained by direct lithiation of the related cymantrene, followed by phosphinat i ~ n The ~ ~ aza-allylphosphine . (39) has been obtained from the reaction of chlorodiphenylphosphine with a lithiated aza-ally1 system, and used as an ~ . organointermediate in the synthesis of new heterocyclic N , P - s ~ s t e m s ~An lithium reagent derived from a dicarbaborane has been employed in the synthesis of a bis(di~arbaborany1)phosphine~~.A phenylcopper reagent is much more effective than phenyllithium in converting the 1,5,9-tri(chlorophospha)cyclododecane (40, X = C1) into the related cyclic phosphine (40, X = Ph)36 X

But Me3Si-N=C

\

CH-SiMe3

/

Ph2P

1.1.2 Preparation of Phosphines from Metallated Phosphines. The synthesis of organophosphines from the reactions of elemental phosphorus and phosphine with electrophiles in the presence of strong bases has been reviewed37. Twophase phosphination of 2,2‘-(bishalomethy1)-1,1’-binaphthyls with phosphine under aqueous base conditions has been used in the synthesis of the atropisomeric phosphines (41) and (42)38. The dilithio diphosphide reagent (43, R = Ph) has been employed in the synthesis of a range of chiral macrocyclic binaphthyl diphosphines (44).A similar approach using lithium diphenylphosphide has given the related non-cyclic chiral diphosphine (45)39. The reactions

Organophosphorus Chemistry

6

of the dilithiodiphosphide (43, R = H) with optically pure 1,3-diol cyclic sulfate esters are the basis of a synthesis of the chiral diphosphetanes (46)40. Dilithiophosphide reagents derived from 1,2-bis(phosphino)ethane have been employed in the synthesis of the chiral bisphospholanes (47)41. The new chiral

(44) R = H, Ph or 2-naphthyl

(4)

(45)

(47) R = PhCH2 or But

heterocyclic phosphines (48)42 and (49)43have been prepared via the reactions of dilithiophenylphosphide with the mesylate esters of chiral diols. Dilithioarylphosphide-cyclic sulfate combinations have also been used in the synthesis of the 'wide-bite' chiral diphosphines (50)44,and a range of chiral phosphino-

(49) Ar = Ph or 3,5-But&6H3 R=HorMe

(50) R = H or Me X = S or CMe2

phospholanes, e.g., ( 5 l)45. Side-chain elaboration of P-menthylphosphetanes, involving the use of lithium diphenylphosphide, has given the new c h i d diphosphines (52)46. In addition to the synthesis of the new heterocyclic phosphines noted above, lithiophosphide reagents have received wide application in the synthesis of acyclic phosphines, many of which are chiral and of interest as ligands in homogeneous catalyst systems. Displacement of fluoride ions from fluoroaromatic systems by lithium diarylphosphide reagents is a common approach in

7

I : Phosphines and Phosphonium Salts

the synthesis of chiral phosphinooxazolines, e.g., (53)47, the crowded diphosphines (54)48, and the phosphinoarylsulfoxide (55)49. The functionalised phosphine (56) is similarly accessible from the reaction of dilithiophenylphos-

0

PM-2

(53)

(54)R = F, Bu or Ph

PPh2 (55) Ar = 2-methoxynaphthyl

phide with a meta-fluoroarylphosphonamidate.Hydrolysis of the phosphonamidate group of (56) yields a water-soluble phosphinesO. Phosphide displacement of chloride from chloroheterocyclic systems has provided routes to a series of pyrimidylphosphines (57)s1, and the diphosphinopyridazinone (58y2. Further development of lithiophosphide routes to chiral phosphino-

oxazolines has occurred, centring around the phosphine (59) as the key intermediates3. This system is also encountered in protected form in the synthesis of phosphino-functionalisedamino acids54. New chiral phosphinothioether ligands (60) are accessible via ring-opening of chiral episulfides using

AR2

R’2P

(59)

SR3

(60)R’ = Cy or Ph, R2 = Me or Cy, R3 = Me or CH2Ar

lithiophosphide reagents? The new chiral camphor-based phosphine (61) has been obtained via the reaction of a cyclic sulfate ester with lithium diphenylp h ~ s p h i d eA ~ ~borane-protected . lithium diphenylphosphide reagent has been employed in the synthesis of the intermediate (62, R = H ) subsequently transformed into a range of highly functionalised phosphino-alcohols via oxidation and treatment with functionalised organozinc reagentss7. Two g r o ~ p s ~have * * ~described ~ lithiophosphide routes to phosphinoalkylcyclopen-

Organophosphorus Chemistry

8

tadienide ligand systems, e.g., (63)59.Among chelating diphosphines prepared using lithiophosphide reagents are the diphosphinomethylthiophene chiral diphosphines bearing both a diphenylphosphino group and a phenylcyclohexylphosphino group, e.g., (65)61,the chiral system (66)62, a range of

and the chiral diphosphine (67)64. chiral bis(dipyridylphosphin~)methanes~~, Lithiophosphide reagents have also found use in the synthesis of calix-[4]-arene systems bearing phosphino substituents at the upper rim65, phosphinocarbaboranes66,and new p o l y p h o s p h ~ r u sand ~ ~ phosphorus-silicon68 ring and cage structures. The reactions of lithium diphenylphosphide and potassium dimethylphosphide with the mesylate ester of cholesterol have been used in the synthesis of the phosphines (68)69.

(68) R = Me or Ph

Sodium- and potassium-organophosphide reagents have also found considerable use in the synthesis of new phosphines. Sodium dimethylphosphide (generated from cleavage of tetramethyldiphosphine with sodium in liquid ammonia) has been employed in the synthesis of new phosphine-thioether ligands, e.g., (69)'O. Sodium diphenylphosphide was the reagent of choice for the synthesis of the chiral amidophosphines (70)7*and the P,S-donor (71)72. The unusual salt (72), containing the diphenylbis(cyanamido)phosphonium

(70)R' = COBu', Me or CH2Ph R2 = Me or Ph X = 0 or H2

1: Phosphines and Phosphonium Salts

9

diylide anion, have been obtained from the reaction of sodium diphenylphosphide with cyanogen a ~ i d e ~ Further ~. studies have appeared of electrontransfer nucleophilic substitution processes in the photo-stimulated reactions of sodium diphenylphosphide with neopentyl halides74. Displacement of fluoride from a fluoroaromatic system is the key step in the synthesis of the chiral phosphines (73)75.The reactions of potassium diphenylphosphide with chloroalkyl or tosylate precursors have been used in the synthesis of the functionalised triphosphine (74) (which can be linked to a cross-linked Merrifield resin via the phenolic the chiral phosphinoalkylphosphaferrocene (75)77, and a series of mixed donor chiral phosphines, e.g., (76), derived from chiral cr-hydroxyacid~~~. Ring-opening of 1,2-epoxybutane with potassium diphenylphosphide, followed by addition of chlorodiphenylphosphine, are the key steps in the synthesis of the large-span ligand (77)79. A convenient route to phosphines of the type (RCH2CH2)3P (R=aryl or heteroaryl) is afforded by nucleophilic addition of potassium phosphide (generated from red phosphorus, potassium and t-butanol in liquid ammonia) to aryl- and heteroaryl-etheneseO.The silylphosphine (78) has been obtained by treatment of a bromosilyl precursor with potassium diphenylphosphide. Subsequent treatment of (78) with butyllithium results in deprotonation at the central carbon to give a planar carbanionic systeme1.Sodium and potassium phosphide reagents have also found application in the synthesis of new polyphosphorus ring and cage system^^^*^^.

+

Ph2P

(73)X = F or PPh2

Once again, interest in the synthesis and structural characterisation of new metallophosphide systems has continued at a high level. Useful reviews have a p ~ e a r e d ~Sodiosilylpolyphosphide ~9~~. reagents have been prepared and structurally characterisede6. A simple route to Group 15 anionic heterocyclic systems has been developede7.Further examples of salts involving heptaphosphide anions, R2P7 - , have appearede8. Alkali metal organophosphides obtained by intramolecular coordinatione9, and a wide range of other alkali metal organophosphide ~ y s t e m s ~have ~ - ~been ~ , structurally characterised by X-ray techniques. The reactivity of calcium and barium trialkylsilylphosphides has been exploredg6.With diphenylbutadiyne, calcium (and strontium) bis(tri-

Organophosphorus Chemistry

10

methylsily1)phosphidesgive rise to the phospholides (79), the reactions involving 1,3-Me$i A magnesium organosilylphosphide system has been structurally characterised9*.The chemistry of a l ~ m i n i u m ~ ~and - ' ~ gallium'** ' phosphide systems has continued to develop and zincIo3,copperl', tinlo5and uraniurn'O6 organophosphide systems have also been characterised.

(79) M = Ca or Sr

(80)

Interest in the reactions of phosphines metallated at carbon has also continued. Hydrolysis of the dianion obtained by treatment of 1,1'-bis(dipheny1phosphino)ethene with lithium yields the tetraphosphine (80)'07. The phosphinoaryldichlorophosphine (8 1) has been obtained from the reaction of o-lithiophenyldiphenylphosphinewith phosphorus trichloride'08. Treatment of o-lithiophenyldiphenylphosphinewith mercury(I1) chloride has given the organomercury diphosphine (82), of interest as a trans-spanning ligand' 09. Triorganostannylmethylphosphines have been used as reagents for the synthesis of new unsymmetrical diphosphinomethanes and related phosphinoarsinomethanes' lo. N-(o-phosphinoalkyl)pyrroles,e.g. (83), have been obtained by

the reactions of borane-protected lithiomethyldiphenylphosphine reagents with N-(a-bromobutyl)pyrrole, and subsequently polymerised to give phosphino-functional polypyrrole materials' I . Lithiomethylphosphines have been converted into related beryllium and magnesium systems, which have been structurally characterised' 12. Further examples of the formation of metallocenes from phosphines bearing cyclopentadienyl substituents have appeared' 13*1 14. 1.1.3 Preparation of Phosphines by Addition of P-H to Unsaturated Compounds. A new range of electronically unsymmetrical diphosphines has been obtained by base-catalysed addition of 'electron-rich' secondary arylphosphines to 'electron-poor' vinylphosphines, the reverse approach being unsuccessful. Thus, e.g., addition of diphenylphosphine to the vinylphosphine (84) has given the diphosphine (85)II5. A base-catalysed approach has also been used in the addition of diphenylphosphine to pyridyl- and pyrimidyl-alkynes, giving the new chiraI diphosphines (86)116, and also in the addition of primary or secondary phosphines to vinylpyridines' 17, and divinylsulfone' 1 8 . Radicalpromoted addition of primary and secondary silylphosphines, and phosphine, to alkenes and dienes has been investigated as a route to new organo(sily1)-

1: Phosphines and Phosphonium Salts

11

A

-P

PPh2 Ph2P PPh2 (86) R = 2- or 3-pyridyl or 2-pyrimidyl

2

(85)

phosphines, including heterocyclic systems. Thus, e.g., the reaction of trimethylsilylphosphine with trivinylphosphine yields the diphosphorinane system (87) as a mixture of isomers' 19. A range of partially fluorinated trialkylphosphines (88), with modulated electronic properties and fluorous phase affinities, has been obtained by large-scale AIBN-promoted addition of phosphine to partially fluorinated alkenes 120. The iminium salts (89) undergo addition of diphenylphosphine to form the phosphino-systems (90), capable of further elaboration via the iminium functionality, to give, e.g., (91)l2I. Further examples have

n

Pt(CHdx+2(CF&CF3]3 Me3si-pup3 (88) x = o - 2 y = 5 , 7 Or 9

(87)

Ar

flii2 NR2

2TfO-

Arflii2 NR2 '

(89)

2Tf0-

Ar'/

0 (911

(90)

appeared of the addition of secondary phosphines coordinated to transition metals to unsaturated systems, specifically dimethyl acetylenedicarboxylate'22 and ethyl d i a ~ o a c e t a t e ' ~ included ~. in a review of the reactions of 1,4- and 1,5diketones with P-H compounds is their reactions with primary phosphines which lead to phospholane and phosphorinane systems*24.A new class of very bulky diphosphines (92) is afforded by the addition of bis(phosphin0) alkanes with P-diketones. This reaction has also been applied to 1,2-bis(phosphino)benzene, which with acetylacetone yields the polycyclic system (93)125. 1.1.4 Preparation of Phosphines by Reduction. As usual, reduction of phosphine oxides using trichlorosilane continues to be the favoured approach. In the past Me

I

(92)PI = Me or CF3

(93)

Organophosphorus Chemistry

12

year, it has been used in the synthesis of a series of perfluorocarbon-soluble triarylphosphines (94)126,the trans-chelating chiral diphosphine (95)127,the new atropisomeric diphosphines (96)12* and (97)129,and a series of mixed donor atropisomeric phosphines, e.g., (98)130 and (99)131-133. Phenylsilane has Me

(97)

(98)

(99)

been applied to the reduction of some high molecular weight arylene phosphine oxide polymers' 34, and to the synthesis of a calixarene bearing 'trans-chelating' diphenylphosphino substituents' 35. Reduction of dichlorophosphines to primary phosphines using lithium aluminium hydride has been used to prepare air-stable primary phosphines, e.g., (loo), bearing a dibenzobarrelene g r o ~ p ' ~ ~Lithium ? ' ~ ~ .aluminium hydride has also been used to reduce the cyclic acylphosphine systems (101) to the diphosphine (102)13*.A new route to the chiral phospholane (103) in enantiomerically pure form involves reduction of the corresponding phosphine oxide precursor using a combination of lithium aluminium hydride with cerium(II1) chloride' 39. This reagent system has also been used in the synthesis of P-hydroxyethylphosphines,from which a new route to alkenes has been developed involving the collapse of intermediate phosphiranium salts, and providing a phosphonium analogue of the Ramberg-Backlund rearrangement Alane (AlH3) has been used for the reduction of the phosphine oxide of (104)'42. A modular route to new chiral phosphine-oxazoline ligands of the type (105) involves the reduction of a phosphine sulfide precursor using Raney nickel 143. 1407141.

1.1.5 Miscellaneous Methods of Preparing Phosphines. Much information on the synthesis of phosphino-functional dendrimers of various kinds has been summarised in a series of review^'^-'^^. Other reviews have appeared which cover synthetic approaches to chiral p h ~ s p h e t a n e s ' ~the ~ , synthesis and reactivity of medium-ring diphosphines149, the application of borane-protected phosphorus reagents in the synthesis of chiral phosphines' 50, phosphinocar-

I : Phosphines and Phosphonium Salts

13

R

(100) R = H or Ph

(101) R=Ph3C

(102) R = Ph3C

(105) R = H, Me or Ph

boranes 51,water-soluble di- and tri-phosphine~'~~, polydentate and functionalised hydroxymethylphosphines which also offer water-~olubility'~~, the uses of phosphine (PH3) in the synthesis of organophosphines and other comp o u n d ~and ~ ~ the ~ , synthesis, structure and reactivity of phosphin~carbenes'~~. Full details of the synthesis of air-stable ferrocenylmethyl primary and secondary phosphines have appearedIs6. A route to the aminoalkyl-functionalised chiral ferrocenyldiphosphine ( 106) has been described; this compound has found use in the synthesis of dendrimers containing the chiral ferrocenyl unit at the surface157.The diphosphinoferrocene (107), accessible from the reaction of 1,1'-bis(diethy1phosphonato)ferrocene with an aryllithium reagent bearing an allylsilylalky1 group, is a key building block in the synthesis of phosphinoferrocenyldendrimers which exhibit catalytic activity in the core of the SiR3

R3Si

\

R3Si'

di (107) R = ally1

dendrirnersI5*.The reaction of secondary phosphines with benzylic halides, followed by deprotonation of the phosphonium salt, is the principal method used in the synthesis of the pincer-like diphosphines (108)159.No basepromoted deprotonation is required in the reaction of dibenzotropylidene chloride with secondary phosphines ( 109)160. A route to the phosphaazabarr-

14

Organophosphorus Chemistry

(108) R = But or Ph X =OH, OMe or OEt

(112) R =

n=Oorl

elanes (1 10) has been described161. Base-promoted cyclisation of phenylbis(2mercaptoethy1)phosphine with bis(3-chloropropyl)sulfoxide has given the macrocycle (1 1 1) which, although stable in the solid state, undergoes oxygen transfer from sulfur to phosphorus in solution16*. A route to the rigid tetraphosphine ligands (1 12) has been reported163.The importance of pHcontrol in the work-up of the sulfonation of triphenylphosphine has been stressed and an improved procedure developed which gives the product free of contamination by the phosphine oxidela. A new ylide-based route to diphenylvinylphosphines (and their oxides and sulfides) has been devised165.Silylphosphine formation has been demonstrated in the titanocene-catalysed reaction between secondary phosphines and monoorganosilanes, providing the first example of heterodehydrocoupling between Si-H and P-H bonds166.The o-carboranylmethylphosphine(C2B OH ])CH2PPh2has been prepared167. The formation of arylphosphines by the palladium- (or nickel-) catalysed reactions of haloarenes or triflate esters of phenols with primary or secondary phosphines continues to be used, in particular in the synthesis of phosphines bearing other reactive functional groups. The past year has seen its application in the synthesis of arylphosphino-functional tx-cyclodextrinsl6*,water-soluble tethered polymeric p h ~ s p h i n e s ' ~the ~ , phosphonato-functional phosphines (113) (capable of hydrolysis to give water-soluble systems)'70, a range of substituted arylphosphines, e.g., ( I 14)17',and the water-soluble guanidiniumfunctionalised phosphines (1 15)' 72. The approach has also been applied to the synthesis of further chiral atropisomeric phosphines e.g., (1 16)173and (1 17)174, and the the synthesis of the vinylphosphines (1 18) from halogenoenamines and halogenoenol ethers175.A related palladium-catalysed cross-coupling reaction between haloarenes and silylphosphines has been used in the synthesis of arylphosphines bearing both donor and acceptor substituent groups 176. The formation of aminomethylphosphines in the reactions of hydroxymethylphos-

15

I : Phosphines and Phosphonium Salts

(115) R = H or Me X=CIorI

phines with primary or secondary amino compounds has received further study, having been applied in a parallel synthesis of a 96-member library of aminomethylphosphine l i g a n d ~ ' ~the ~ , phosphinomethylpiperazine (1 19)178, and chiral water-soluble phosphines, e.g., ( 120)179and ( 121)lS0,derived from

(121) R ' = H o r M e H

R2 = C02H or H

O

amino acids. The nickel(I1)-catalysed reaction of 2-(2-bromophenyl)benzothiazole with tris(hydroxymethy1)phosphine in ethanol results in the formation of the triarylphosphine (122) in 20% yield. An X-ray study reveals that in the phosphine, all three heterocyclic nitrogens are inyolved in a close approach to phosphorus, the average N-P distance (2.974 A) being significantly smaller than the sum of the Van der Waal's radii. Such apparent coordinative interactions are not so evident in the related phosphine oxide*81.Intramolecular coordination of this type in phosphorus compounds has been reviewed182, and new examples described relating to 8-dimethylamino-1naphthylphosphines and related compounds 83. A nickel-catalysed electrochemical cross-coupling reaction between aryl halides and chlorophosphines has been described, which affords tertiary phosphines in high yields. The reaction tolerates the presence of electron-withdrawing groups in the haloarene, and also can be applied to heteroaryl halides184.Arylation and alkylation of white

Organophosphorus Chemistry

16

phosphorus has been achieved in the presence of electochemically-generated samarium(H)'*~.Arylation of trivalent phosphorus esters, using aryllithium reagents, has provided a route to phosphines incorporating 2-cyanophenyl substituents186and some new chiral ferrocenylphosphine systems (123) (viathe use of chiral, borane-protected, phosphinite esters) 88. Dipropargylic phosphines combine with dicyclopentadienylzirconium to form a bicyclic organozirconiumphospholane intermediate which on protonation gives new phospholanes, e.g., (12 4 p 9 . Routes to phosphinomethylsilacyclopentenes190 879

SiMe3

R

)"

sQ

Me3siT-r

Fe @PY R

and the phosphinoaminoarylphosphine (125)19 have also been described. New heteroarylmethylphosphine ligands, (126)192and ( 127)193,have been obtained from the reactions of halogenophosphines with heteroarylmethylsilyl precursors. Pentafluoropyridine has been shown to react with trimethylsilylphosphines with elimination of trimethylsilyl fluoride, to give the phosphines ( 128)'94.Thiadiazolylphosphines have been prepared by direct phosphination of the ring system with halogenophosphines19s.

(127) R = Ph or Pr'

(128)

R = PI" or Me

A variety of new phosphines has been obtained by elaboration of functional groups already present in precursor phosphines. Acylation of aminoalkylphosphines has provided the chiral diphosphines (129)'96 and (130)197,and Nacylation of chiral pyrrolidinylphosphines has given the new mixed donor ligands (13 1)198 and a water-soluble acrylate polymer-bound system199. Further examples of Schiff's base condensation of o-diphenylphosphinobenzaldehyde have appeared, e.g., to give (1 32) from 1S,2R-norephedrine. A Schiff's base condensation has also been used by the same group for the synthesis of ( 133) from o-aminophenyldiphenylphosphine with salicylaldehyde2'? The new polynitrogen-macrocyclic functionalised system ( 134) has been obtained by reductive amination of o-diphenylphosphino benzaldehyde201. The planar-chiral P,N-ligand system ( 135) has been prepared by treatment of the chromium tricarbonyl complex of o-diphenylphosphinobenzaldehyde with 2-pyridyllithium, followed by further development of the

17

I : Phosphines and Phosphonium Salts

k I

resulting A route to the chiral system (136) has been developed from o-diphenylphosphinobenzonitrile203. Side-chain elaboration of the phosphinoferrocene (137) has given the new chiral systems (138) and (139)204.

t PPh2 N

PPh2 (1 35) R = Me, PhCH2 or panisyl

OMe

1.2 Reactions of Phosphines. - 1.2.1 Nucleophilic Attack at Carbon. The generation of reactive intermediates by the addition of phosphines to unsaturated esters, and their subsequent reactions, has continued to attract interest. Full details have now appeared of the formation of nitrogen heterocycles via phosphine-catalysed reactions of 2,3-butadienoates, 2-butyneoates and dimethyl acetylenedicarboxylate, respectively, with electron-deficient irnines2O5. Yavari's group has continued to exploit the reactivity of the 1:l adducts of triphenylphosphine with dialkyl acetylenedicarboxylates in the synthesis of heterocyclic compounds206-208and new stabilised phosphonium ylides involving heterocyclic s u b s t i t u e n t ~ ~ ~This ~ - ~ approach ' has also led to new routes

'.

Organophosphorus Chemistry

18

to cyclobutene derivatives2 and functionalised cr-pyrans2'3. Novel bismethanofullerenes and an ethenofullerene have been obtained from the reactions of methyl and ethyl propiolates with C a in the presence of triphenylph~sphine~~~. A route to vinyl-substituted furans is afforded by the phosphine-initiated reactions of enynes bearing a carbonyl group2 5. Tributylphosphine has been shown to promote [3 + 21 cycloaddition reactions between 2-alkynoate and 2,3allenoate esters with electron-deficient alkenes216and also the cyclisation of y6or &-unsaturated aldehydes to form hydroxy-cyclopentenes and -cyclohexanes2I7. ( 1-Alkoxyethenyl)diphenylphosphines are the main products of the reactions of diphenyltrimethylsilylphosphine with terminal alkoxyalkynes21*. P-Acetylenic alcohols are reduced to the related allylic alcohols on treatment with tertiary phosphines in the presence of water, the reaction proceeding via initial attack of the phosphine on the acetylenic bond2l9. The kinetics of the insertion reactions of aryl isocyanates into the C-C bond of the zwitterion formed in the addition of triisopropylphosphine to ethyl 2-cyanoacrylate in acetonitrile have been studied by a spectrophotometric technique, and a mechanism proposed220.Interest also continues in the reactions of phosphines with carbon disulfide and related cumulenes. Solvent effects have been studied for the tributylphosphine-carbon disulfide system221.The phosphinozirconaindene (140) undergoes [3 + 21 cycloadditions with carbon dioxide, carbon disulfide and isothiocyanates to form the cyclic zwitterions (14 1)222.The kinetics of quaternisation of triphenylphosphine by various benzylic halides have been studied in a range of two-phase organic solvendwater media223.

(141) X = 0, S or NR

(140)

1.2.2 Nucleophilic Attack at Halogen. A wide range of tertiary phosphinedibromine adducts has been studied and shown to adopt the ionic structure, R3PBr+ Br- in solution in deuteriochloroform. The only exception to this pattern is the adduct of tris(pentafluoropheny1)phosphine which exhibits a pentacovalent trigonal bipyramidal structure both in the solid state and in solution224.Diiodine adducts of a series of diphosphinoalkanes have also been characterised, these compounds showing the familiar 'molecular spoke' structure in the solid state, but ionising in solution in deuteriochloroform225~226. The reactions of the diphosphatricyclooctenes (142) with bromine or iodine R

R

(142) R = H or

I

Me

(143) X = hat

1: Phosphines and Phosphonium Salts

19

monochloride result in selective cleavage of the P-P bond of the diphosphirane units with formation of the related bishalogenophosphine system ( 143)227. Synthetic applications of the triphenylphosphine+xrbon tetrachloride system have continued to appear. An improved route to tertiary amines from alcohols has been developed, involving the direct reaction of the alcohol with triphenylphosphine, carbon tetrachloride, and a secondary amine in acetonitrile228.A new indoline-forming reaction has been developed by treatment of 242hydroxyethy1)aniline with the triphenylphosphine-carbon tetrachloride system229.Halogenation of carbohydrates has been achieved with the use of combinations of triphenylphosphine with carbon tetrachloride, hexachloroethane or 1,2-dibromotetrachloroethane in highly concentrated solutions in non-polar solvents, assisted by microwave irradiation230.The triphenylphosphine-carbon tetrachloride system has also been used for the dehydration of a diol to form a 1,5-diene23'. A gel-form of a cross-linked polystyryldiphenylphosphine in carbon tetrachloride has been shown to be effective for the conversion of primary alcohols into alkyl halides, and secondary and tertiary alcohols into a l k e n e ~ Attack ~ ~ ~ . of phosphine at halogen is also involved in reaction of 2,2,2-trihaloethyl esters with tributylphosphine in the presence of an alcohol or amine, which provides a useful procedure for the synthesis of esters and a m i d e ~and ~ ~ also ~ , in the reaction of perfluoroalkyl (bromomethyl) ketones with triphenylphosphine in the presence of titanium isopropoxide which forms the basis of a one-pot stereoselective synthesis of perfluoroalkylated (a-allylic alcohols234.Combination of trichloroisocyanuric acid with triphenylphosphine in anhydrous acetonitrile has been shown to convert alcohols into alkyl halides, carboxylic acids into acid chlorides, 1,3-diketones into vinyl chlorides and amides into nit rile^^^^. The triphenylphosphineiodotrimethylsilane system is an effective catalyst for the tetrahydropyranylation of aliphatic and benzylic alcohols with dihydropyran in dichloromethane at room temperature236.Combination of triphenylphosphine with dichloroselenuranes, R2SeC12,also provides a system which converts alcohols into the corresponding chloroalkanes, although the stereochemical course seems to depend on the structure of the Tertiary phosphines have been shown to react with germanium tetrachloride to give the ionic system R3 PCl+ GeC13-- 238. 1.2.3 Nucleophilic Attack at Other Atoms. Recent developments in the chemistry of phosphine-borane complexes have been reviewed239. Phosphineborane complexes have been prepared from diastereoisomerically pure monoisopinocamphenylcyanoborane, and shown to undergo SN2-displacementreactions at boron when treated with a more basic p h o ~ p h i n e A ~ ~series ~ . of ferrocenylphosphine-borane complexes has been prepared by treatment of the appropriate phosphine with calcium borohydride in the presence of copper(I) chloride in THF241. A triphenylphosphine adduct with tris(pentafluor0pheny1)borane has been ~ h a r a c t e r i s e d ~Whereas ~~. arylphosphine oxides usually undergo ortho-metallation on treatment with phenyl-lithium, it has now been shown that related arylphosphine-borane complexes undergo metal-

20

Organophosphorus Chemistry

lation at the p a r a - p ~ s i t i o nFurther ~ ~ ~ . examples of adducts of phosphines with alkyl- and aryl-aluminium hydride acceptors have been d e ~ c r i b e d ~ A ~-~~~. study of the complexation of (31,2-bis(diphenylphosphino)ethene by aluminium-, gallium-, and indium-trihalides has revealed a tendency for the phosphine to undergo isomerisation to the (a-form as a result of complexation, the extent of isomerisation depending on the Lewis acid, and the solvent247. The use of triphenylphosphine instead of trimethyl phosphite as a deoxygenating agent results in much improved yields in the Sharpless synthesis of chiral sulfinate esters from arylsulfonyl chlorides and chiral alcohols248. Methyltrioxorhenium has been shown to be an effective catalyst for the air-oxidation of p h ~ s p h i n e sand ~ ~ the ~ phosphine-promoted, stereospecific desulfurisation of e p i s ~ l f i d e s The ~ ~ ~reduction . of alkyldisulfides with tributylphosphine in the presence of water provides a practical option for the preparation of gram quantities of thiols or thioesters from the corresponding d i ~ u l f i d el s. ~Triphe~ nylphosphine-promoted desulfurisation has been utilised in the synthesis of sulfur-rich dithiolene systems252,and also for the synthesis of a cyclic disulfide from the related cyclic t e t r a s ~ l f i d e ~A~ ~ solution . calorimetric study of the reaction of phosphines with cyclooctasulfur has shown that a good correlation exists between the enthalpy of protonation of the phosphine and the enthalpy change for the reaction with sulfur. It is concluded that a-donation from phosphorus to sulfur is the principal component of a strong phosphorus to sulfur bond in a phosphine sulfide. Bond strengths in phosphine chalcogenides decrease as expected from sulfur to tellurium, but the strength of the phosphorus-tellurium bond is still significant (52 kcal mol- in tributylphosphine telluride). The reactivity of phosphine tellurides is thought to be due to additive rather than dissociative mechanisms. There is a less significant decrease in bond strength in the series triphenylphosphine sulfide - triphenylarsine sulfide - triphenylstibine sulfide, but it has been established that triphenylphosphine will desulfurise the arsine and stibine sulfides in solution254. Nucleophilic attack at nitrogen appears to be involved in the reaction of triphenylphosphine with ethyl pentacyanocyclopropanecarboxylate, which results in the formation of the phosphazene (144)255.A range of new P,Nheterodifunctional ferrocene-based coordinating ligands, e.g., (149, has been

CN CN NC*CN

(144)

(145) R = 1-4

obtained by the reactions of di- and tri-phosphines with an azidoethenylferro~ e n e Cage-structure ~ ~ ~ . phosphazides, involving the R3P=N-N=N-Ar unit, have been obtained from the reactions of tris(2-azidobenzy1)amines with the tripod-like triphosphine 1,1,1-tris[(diphenylphosphino)methyl]ethane257~258,

1: Phosphines und Phosphonium Salts

21

Phosphazene intermediates are involved in a one-pot conversion of azides to Boc-protected amines with trimethylphosphine and 2-(t-butoxycarbonyloxyimino)-2-phenylacetonitrile2s9. Interest in the Mitsunobu reaction and its applications in synthesis has continued. The use of 1,2-bis(diphenylphosphino)ethane instead of triphenylphosphine has been advocated for both Mitsunobu and Staudinger (aza-Wittig) procedures, the essential point being that the more polar diphosphine dioxide is more easily separated from the products than is triphenylphosphine oxide260.Various azodicarboxamides have been suggested as improvements on the familiar diethyl azodicarboxylate (DEAD) for use in Mitsunobu reactions. The same paper advocates the use of stabilised phosphonium ylides, e.g., cyanomethylenetributylphosphorane as alternatives to conventional Mitsunobu systems. These ylides are said to be much more versatile in promoting C-alkylation, particularly for secondary alcohols26l . A polymer-bound arylphosphine has been used for Mitsunobu reactions in combinatorial chemistry, aiding product separation262.The use of diphenyl(2-pyridy1)phosphine in Mitsunobu procedures also aids product separation, both unreacted phosphine and the phosphine oxide being acidextractable into the aqueous layer263.Use of the functionalised phosphine (146) (obtained by base-promoted addition of diphenylphosphine to t-butyl acrylate), and the azodicarboxamide (147) has enabled the development of a high 0 0 II II P ~ ~ P C H ~ C H ~ C O ~ B U ‘ Bub2CCH2NH-C-N=N-C-NHCH2C02But (146)

(147)

throughput product purification in Mitsunobu reactions. The t-butyl ester tagged reagents and byproducts are easily converted by exposure to acid into carboxylic acids which are easily removable by ion-exchange resins264.Picolinic acid has been shown to be a useful partner in Mitsunobu procedures. The resulting esters can be methanolysed under essentially neutral conditions using copper(I1) acetate in methanol265.N-Boc ethyl oxamate is a new nucleophile for use in Mitsunobu chemistry for the conversion of primary and secondary alcohols into Boc-protected amines after a mild deprotection step266.Mediation by imidazole has been employed in a Mitsunobu synthesis of alkyl t h i ~ e t h e r s ~ ~ ~ . An unusual pattern of reactivity in Mitsunobu chemistry has been recognised in the formation of 0-alkylated rather than N-alkylated products from s u h h y dantoins26x. Mitsunobu chemistry has been used in the synthesis of novel inhibitors of farnesyl t r a n ~ f e r a s e isocyanates ~~~, from alkyl- or hindered arylamines and carbon d i o ~ i d e l ~, 2-methylaminothiazolines ~~y~~ from N-(2-hydroxyethyl)-N’-methylthioureas272, t h i o n u ~ l e o t i d e s ~ and ~ ~ , N-arylpiperazinones274.A phthalimide-containing resin has been used in conjunction with the Ph,P-DEAD system in an efficient route to primary amines from the corresponding alcohols, via Mitsunobu coupling and subsequent hydrazine-induced cleavage27s.Fundamental work on the mechanism of the Mitsunobu reaction has also appeared. It was noted several years that the formation of the usual betaine in the Ph3P-DEAD system was accompanied by a low concentration of a radical species, initially thought to be (148). It has now been shown

Organophosphorus Chemistry

22

that the initially formed betaine is far too difficult to oxidise to the radical, and that the latter is almost certainly formed by attack of phosphorus at carbonyl oxygen, followed by in situ oxidation to give ( 149)277.

1.2.4 Miscellaneous Reactions of Phosphines. Further theoretical278and experimental s t ~ d i e s ~ ~ 'of - ~ the ~ ' basicity of phosphines have been published. Reviews have appeared of the synthesis of organophosphorus compounds, usually via phosphonium salts of various kinds, which are obtained from the reactions of nucleophiles with phosphonium radical cations generated by electrochemical oxidation of p h ~ s p h i n e s ~This ~ ~ .approach ~ ~ ~ . has also been applied to synthetic problems in carbohydrate chemistry284. Treatment of tributylphosphine with methylviologen salts also results in a single electrontransfer process to form the related tributylphosphonium radical cation, which has then been shown to react with a range of nucleophiles as expected285.3,5Di-t-butyl- 1,2-benzoquinone has been shown to react with triphenylphosphine to form the cyclic phosphorane (1 50). Triphenylarsine behaves similarly to give the related arsorane, but the reaction with triphenylstibine yields the stablised ylide ( 151)286. Phosphinocarbenes, e.g., (1 52), are useful intermediates in synthesis. Treatment with butyllithium gives rise to the phosphonium ylidide (153), capable of further elaboration287. Coupling of an isocyanide with a diphosphinocarbene in the coordination sphere of a manganese complex yields the reactive diphosphine (1 54), which undergoes further combination with the isocyanide to give ( 155)288. The reaction of o-hydroxyalkylphosphines with

PhN

(154) R = Ph or But

(155)

bis(dimethy1amino)dimethylsilane is the basis of a divergent route for the synthesis of organophosphine-based d e n d r i m e r ~ ~ ~ The ' . cyclisation of diallylphosphines to 3-phospholenes in the presence of a tungsten-carbene complex has been reviewed, together with related conversion of diallyl-ethers, -thioethers, and - ~ i l a n e s ~ ~Metal-promoted '. ring-contraction reactions of 1,2,3-triphospholenes, giving complexed 1,2-diphosphetenes, have been ex-

1: Phosphines and Phosphonium Salts

23

p10red~~'. The vanadacyclopropenylphosphine (156) has been obtained from the reaction of a bis(a1kyny1)phosphine with dicyclopen t a d i e n y l ~ a n a d i u m ~ ~ ~ . a-Aminomethylphosphines ( 157), containing a secondary amino group, have been shown to exist in equilibrium in solution with diphenylphosphine and an imine. They are stabilised by electron-wit hdrawing substituents, and also by coordination at phosphorus to ~ o p p e r ( 1 ) ortho-Diphenylphosphinobenzal~~~. dehyde has been transformed into the mixed donor ligand (158)294. The Ph )p":cp

CP

PhCEC-P A 'r (156) Ar = 2,4,6-But3C6H2

Ph2P-CH-NHR2 R' I

K

(157) R' = Ph or pN02C6H4 R2 = Me, Ph, CHMePh or pN02CsH4

E

-

O

H

( 158)

reactivity of non-phosphorus functional groups in the neopentyl systems (1 59) has been e x p l ~ r e d ~Interest ~ ~ , ~ in ~ ~the . synthesis and reactivity of watersoluble phosphines has continued. The first evidence of molecular-recognition between sulfonated triarylphosphines and cyclodextrins has been obtained with the isolation of inclusion complexes297. The water-soluble 'large bite' diphosphine (160) has been obtained by conventional sulfonation of the parent d i p h ~ s p h i n e An ~ ~ ~alternative . approach to the aqueous solubility problem is the introduction of polyoxyethylene and related surfactant groups into the phosphine, which then has both ligand and surfactant properties, Fdcilitating its use as a micellar catalyst. This area has now been reviewed299.The chiral monodentate phosphine (161) has been resolved via a chiral amine-palladium complex, and the absolute configuration established by NMR studies300. A novel procedure for the synthesis of labelled imines and aldazines involves a tributylphosphine-catalysed decarboxylation step"O'. Combination of triphenylphosphine with scandium triflate provides a reagent system which promotes the Reformatsky reaction of a-bromocarboxylic acids with aldehydes302.

"""* S03Na

\

0

PPh2 (159) Z = PPh2 or SR

2

PPh2

(160)

Phosphine Oxides and Related Chalcogenides

2.1 Preparation. - The first metal-catalysed, highly selective and efficient procedure for the mono-oxidation of a,o-diphosphinoal kanes has been developed, involving treatment of the diphosphine with 1,2-dibromoethane and sodium hydroxide in the presence of palladium( 11) acetate303. The diphos-

24

Organophosphorus Chemistry

phine-dioxide and -disulfide (162) have been prepared by direct reaction of the parent diphosphine with oxygen and sulfur, respectively304.Routes have also been developed to a series of multifunctional 1,2-bis(tritylated)diphosphine monoxides, e.g., (1 63)305 and the bifunctional atropisomeric diphosphine dioxide ( 164)306. Chiral p-aminophosphine oxides, e.g., (169, have been obtained by addition of a chiral secondary amine to vinylphosphine oxides307. The chiral phosphine oxides (166) are formed on addition of diphenylphosphine oxide to a chiral cyclic imine, catalysed by a lanthanide complex308. Similar additions of dimethylphosphine sulfide to the C=N bond of 3thiazolines309,and of secondary phosphine oxides to both and acyclic s u l f o n e I~, ~have ~ also been described. urtho-Metallation of a chiral amine, followed by treatment with phosphorus oxychloride, affords the chiral u(aminoalky1)arylphosphine oxide ( 167)312.Di-t-butylphosphinylbenzene(1 68, 0

WIAr2

X II

OH

PPh2 II X (162) X = O o r S

0 H, I,H ,P-P Ph3C 'CPh3

(163)

(165) R',R2 = Ph or R' = Bu', R2 = Ph

(1 64) Ar = Ph or pMe2NC6H4

(166)x = s or C H ~

(167)

R',R2 = alkyl or cycloalkyl

X = H) has been shown to undergo ortho-metallation, providing a route to a series of functionalised arylphosphine oxides3'3. Functionalised nitrogen-containing tertiary phosphine oxides have been prepared by alkylation of the sodium salts of o, m-,and p-aminophenols with chloromethyldimethylphosphine oxide314. Routes have also been developed for the synthesis of phosphinoylmethyl derivatives of N-hetero~ycles~'~, new a-amino-o-(diphenylphosphiny1)alkanoic acids3*6, and the phosphine oxide (1 69), subsequently employed in the synthesis of vitamin D systems317.

Bu'Me2Si0

OSiMe2Bu' Bu

0

1: Phosphines and Phosphonium Suits

25

A simple route to fullerene-phosphine oxides is provided by heating together a trialkylphosphine oxide and [60]-fullerene under reflux in toluene, a retro-ene mechanism having been proposed3'*. The synthesis of calix[4]arenes bearing phosphorus-containing functional groups, including phosphine oxides, has been reviewed319,and new examples reported, together with studies of their ability to selectively complex trivalent lanthanide, actinide, and other metal ions320,321,. The synthesis and reactivity of dendrimers based on phosphoryl groups has been described, together with their ability to undergo surfacefunctionalisation with chiral phosphine The phosphine oxide ( 170), prepared by hydrogen peroxide oxidation of the related phosphine, undergoes polymerisation to form a thermoset perfluorocyclobutane polymer bearing phosphine oxide f ~ n c t i o n a l i t y ~ Reports ~ ~ . of the synthesis of polyester-324, p ~ l y a m i d e and -~~~ systems incorporating phosphine oxide units have also appeared. 2.2 Reactions. - Tertiary phosphine-sulfides and -selenides are converted into the related phosphine oxides on treatment with potassium peroxymonosulfate. The reaction proceeds with predominant retention of configuration at phosp h o r ~Diphenylphosphinites ~ ~ ~ ~ . derived from cyclohexenols have been shown to rearrange on heating in toluene to form phosphine oxides. Thus, e.g., the diphosphinite (1 71) gives the bis(phosphine oxide) (172), the precursor of a chiral l i g a ~ ~The d ~ bis(phosphine ~~. oxides) (1 73) have been obtained by DielsAlder additions of 1,2- bis(diphenylphosphinoy1)ethyne to various cyclopentad i e n e ~The ~ ~ choice ~. of reaction conditions has a crucial effect on the synthesis

(173) R = H, Me, Pr or But

of phosphorylated ethers by the oxa-Michael reaction from diphenyl(hydroxymethy1)phosphine oxide and diphenylvinylphosphine oxide. In the presence of a catalytic amount of potassium hydroxide in dioxan at room temperature, the desired ether (174) is formed, whereas when the reaction is conducted in the presence of sodium hydride in THF at 50 "C the diphosphine dioxide (175) is formed, presumably via loss of formaldehyde to give diphenylphosphine oxide, which then adds to the vinylphosphine oxide33o.The phosphinoylacetic acid (176) undergoes Kolbe electrolytic coupling to form the chiral bis(phosphine oxide) ( 177)331.Methods of ring-arylation of phospholene oxides have been explored, treatment of 2-phospholene oxides, e.g., (1 78) with iodoarenes in the 0

0

0

II

tl

0 It

0 II

I1 Me**kCH2C02H

0

0

i?i II

Me

II

C8Hl7

Ph2pupph2 C 8 1 7 Me

Ph2pvoWpPh2 ( 174)

(1 75)

(176)

(177)

26

Organophosphorus Chemistry

presence of ammonium formate and a palladium acetate catalyst resulting in the arylphospholanes (179). In contrast, treatment of the related 3-phospholene oxide under modified Heck conditions with an aryldiazonium salt, again catalysed by palladium acetate, yields the arylated 2-phospholene oxide system (1 80)332. The cyclic phosphine oxide (18 1) undergoes ring-expansion to

form (182) on treatment with chloroform under alkaline conditions and in the presence of a phase-transfer catalyst333.Heating the tetrazolylsulfinylmethylphosphine oxide (183) with secondary amines in dioxane at 70 "C results in the formation of the phosphinoylcarbothioamides (1 84), probably viu initial formation of the sulfine (185)334.Methods have been explored for the selective y-functionalisation of 1-phosphanorbornadienes (186)335, and C-alkylation of and a l l e n ~ l -phosphine ~~~ oxides using cuprate reagents. An Me

efficient conversion of oximinoalkylphosphine oxides (1 87) to the p-aminoalkylphosphine oxides (1 88) has enabled routes to azadienes and (a-allylamines to be developed338. Stereospecific hydrohalogenation reactions of 1alkynylphosphine oxides have been reviewed339.Further papers on the reactivity of side-chain functionalised phosphine oxides, and their use in asymmetric synthesis, have appeared340y341,Mechanistic aspects of the deprotonation of alkylphosphine oxides using organolithium reagents have been reviewed342.A review of the regioselectivity of the reactions of heteroatom-stabilised ally1 anions with electrophiles includes material on phosphine oxide chemistry343.Interest in the generation of phosphorus-based free radicals by photolysis of acylphosphine oxides has ~ o n t i n u e d ~Interest ~~-~~~. also continues in hydrogen-bonded adducts of phosphine This

(189) n = 3 0 r 4

(190) n = Oor 1

27

1: Phosphines and Phosphonium Salts

topic has also received a theoretical treatment351. Ring-chain halotropic tautomerism between o-bromoalkylphosphine sulfides ( 189) and heterocyclic thiophosphonium salts (190) has received further s t ~ d y ~ A~ related ~ - ~ ~ ~ . study of the alkylation of phosphinothioylacetonitriles with unsymmetrical a,o-dihaloalkanes has also appeared355. The first 1:1 adducts of tertiary phosphine selenides with bromine have been characterised, and shown to have structural differences to the related diiodine complexes356.A study has also appeared of the dipole movements of iodine and iodine cyanide complexes of phosphoryl compounds357.Diphenlyphosphine oxide has been suggested to be an alternative to organotin hydrides in the radical deoxygenation of alcohols358. 2.3 Phosphine Chalcogenides as Ligands. - A series of new cavitand ligands, (191), providing phosphine oxide or sulfide donor sites, has been designed and applied to the separation of lanthamide and actinide ions359.Further triphenylphosphine oxide complexes of lanthanide salts have been investigated360.The coordination of triphenylphosphine oxide to lanthanide ions has also received a theoretical The crystal struture of the tetrakis(tripheny1phosphine 0xide)lithium bromide complex has been described362.The structural chemistry of complexes of organotin moieties with chelating bis(phosphine oxides) has received and a tin(11) complex with triphenylphosphine oxide characterised by X-ray techniques364.A study of the coordination complexes of platinum(I1) with the (pyridyloxymethy1ene)dimethylphosphine oxides ( 192) has revealed that coordination to the metal is from the pyridine ring nitrogen, rather than from the phosphine Triphenylphosphine oxide complexes of iron have been explored, and shown to exhibit antimicrobial properties366. Tertiary phosphine sulfides are effective ligands in the palladium(I1)-catalysed bis(alkoxycarbony1ation) of a l k e n e ~ The ~ ~ ~bis(diphenylthiophosphory1)pyri. dine (193) has been shown to act as a terdentate ligand in its coordination complexes with rhenium carbonyl acceptors368.Silver complexes of w-diphenylphosphinoalkydiphenylphosphine sulfides have been c h a r d c t e r i ~ e d ~ ~ ~ . Mixed phosphine sulfide (or se1enide)-thioether ligands, e.g., (194), readily coordinate to palladium(I1) and platinum(I1) acceptors370.The phosphinophosphine selenide ligdnd (195) forms complexes with a range of transition metal ions371.

(191) X = O o r S

(192)

X

X

It

Ph2P-( CH&-S--(

II

CH&-PPh2

(194) X = S or Se

28

Organophosphorus Chemistry

2.4 Structural and Physical Aspects. - Interest continues in the nature of the phosphorus oxygen bond in phosphine oxides and related compounds, and a further two theoretical treatments have a p ~ e a r e d ~A ~theoretical ~ , ~ ~ ~ approach . to the study of structural characteristics of trialicylphosphine oxides, sulfides, and selenides has produced results that agree reasonably well with published X-ray and electron-diffraction data374. A full X-ray structural study of bis(methoxycarbonylmethy1)phenylphosphine oxide has been reported375. Thermodynamic parameters associated with the formation of micelles from long-chain alkyldimethylphosphine oxides have been determined376.

3

Phosphonium Salts

3.1 Preparation. - A series of hexacoordinate phosphonium salts (1 96), involving intramolecular N -+ P coordination, has been prepared. The effects of coordination on reactivity have also been explored377.Routes to the functionalised arylphosphonium salts (197) and (198), bearing carboxylic acid and phenolic substituents, respectively, have been developed for use in Wittig reactions in aqueous media. These compounds are soluble without decomposition in dilute aqueous sodium hydroxide solution378. Quaternisation of benzylic bromide systems, e.g., ( 199), with triphenylphosphine, in the presence of dibenzo[24]crown-8, results in the formation of [2]rotaxane systems, in which the 'linear' diphosphonium salt, e.g., (200), is threaded through the Me,

f""

Ye,Me

(196) R' = H, Me or Ph R2 = H or CH2C02Et

(197)

(198) n = 1 or 2

centre of the macrocycle, the bulky phosphonium end-groups acting as 'stoppers' which prevent the separation of the components379. Conventional quaternisation reactions have also been applied in the synthesis of a series of chiral monophosphoniophosphine ligands, (e.g., 201)380, the phosphonioisoxazoles (202)3x1,the alkyltris[2-arylvinyl]phosphoniumiodides (203)382,and a range of polymer-supported phosphonium salts of value as phase-transfer ~ a t a l y s t s ~ *ion-exchange ~.~~~, systems, and antibacterial agents385. A new synthesis of arylphosphonium salts is afforded by the electrochemical oxidation of tripropylphosphine in the presence of toluene and water, the initially formed radical cation then being involved in electrophilic substitution on the

29

1: Phosphines and Phosphonium Salts

Ph2P' PPhZ I Me X-

[Ar-CH=CHkh (202) R = Me or Ar

(2011

I-

(203) Ar = Ph, 4-FC6H4,2-Fury1 or 2-Thienyl R = Bu, Pentyl or Me

arene386.A nickel(0)-catalysed route has been used for the synthesis of chiral arylphosphonium salts, e.g., (204), from the related b r o m ~ a r e n e ~ * The ~ > ~a~*. fluorovinylphosphine (205) undergoes conventional quaternisation with alkyl halides, and is converted into the related arylphosphonium salt (206) on treatment with diphenyliodonium triflate in the presence of ~ o p p e r ( 1 ) N~~~. Trichlorovinylpyridinium chloride has been shown to undergo nucleophilic attack by tributylphosphine at the 4-position of the pyridine ring, with the formation of the dihydropyridylphosphonium salt (207)390.The ylidylphosphine (208) has been converted into the zwitterionic phosphonioalkyl dithio (or seleno) phosphinates (209)39'. Betaine systems have also been obtained

A

H

A0

HN

+ P B U ~ct-

I

from the reactions of phosphines with unsaturated carboxylic acids and their derivatives392.The reactions of long-chain aliphatic aldehydes with phosphine in the presence of hydrogen chloride have given a series of tetrakis(ahydroxyalky1)phosphonium salts, in a variety of stereoisomeric forms393. Interest in the synthesis of phosphonium salts involving unusual anions has continued. A series of phosphonium cyclopentadienide salts has been obtained from the reactions of phosphonium ylides with c y ~ l o p e n t a d i e n e s ~Tetra~~. octylphosphonium triphenylmethanide has been prepared and used as a metalfree anionic initiator for the living polymerisation of met ha cry late^"^. A tetramethylphosphonium salt involving the 2,5-dimethyltetracyanoquinodi-

30

Organophosphorus Chemistry

methane radical anion has also been characterised, the salt exhibiting both ferromagnetic behaviour and high electrical conductivity at room temperat ~ r e Methyltriphenylphosphonium ~ ~ ~ . tetrahydroborate has been shown to be a stable, selective, and versatile reducing agent397.Another useful reagent is found in benzyltriphenylphosphonium peroxodisulfate, an easily prepared and stable salt, useful for the efficient oxidation of organic compounds under nonaqueous and aprotic condition^^^^,^^^. A variety of phosphonium salts bearing complex anions derived from both main g r o ~ p and ~ ~transition ~ - ~ metal ~ ~ has also been characterised.

3.2 Reactions. - Iodomethyltriphenylphosphonium tetrafluoroborate combines with chlorine to form the polyhalomethylphosphonium salt (2 The dehalogenation of chlorophosphonium ions by halide ions has been investigated in a quantum-chemical study410.Treatment of the squaric acid-triphenylphosphine betaine (2 11) with oxybis(dipheny1borane) results in the formation of (212), a new type of phosphonio-borate betaine4". Ketones and

esters have been prepared efficiently from the reactions of Grignard reagents with acyltributylphosphonium salts412.Further examples of the synthesis of heteroarylphosphonium salts from the reactions of functionalised vinylphosphonium salts have been d e ~ c r i b e d ~ ' ~ -The ~ I ~electrochemical . reduction behaviour of pentafluorophenylphosphonium salts has been compared with that of other pentafluorophenyl 'onium species by cyclic ~ o l t a m m e t r y ~ ' ~ . Ylides are among the products of electroreduction of alkyl- and benzyltriphenylphosphonium salts in acetonitrile. The related arsonium salts give triphenylarsine as the main reduction product4' 7 . The equilibrium acidities of a series of substituted benzyl-phosphonium, -arsonium, and other related 'onium salts of sulfur, selenium, and tellurium have been c ~ m p a r e d ~ The '~,~~~. phosphonio-phosphonato betaine (213) is the final product of the reaction of triphenyl( phenylethyny1)phosphonium bromide with dimethyl or trimethyl p h o ~ p h i t e ~Five~ ~ . and six- coordinate hydrido-phosphorus intermediates have been identified by3'P NMR techniques in the reduction of tetraphenylphosphonium salts with lithium aluminium hydride in THF at room temperature. Under these conditions, the phosphorus-containing products are the phosphorane Ph3PH2 and triphenylphosphine. Under reflux conditions, only triphenylphosphine is obtained. Similar room temperature reduction of benzylphosphonium salts proceeds much faster, and it is difficult to detect intermedia t e ~ A~ study ~ ~ .of the reduction of benzylphosphonium salts using lithium aluminium deuteride has provided further insight into the mechanism of such reduction reactions422.An NM R technique for determining the enantiomeric purity of chiral phosphonium ions relies on the use of the trisphate anion (214)

31

I : Phosphines and Phosphonium Salts

as a chiral shift reagent423.Further consideration has been given to the various supramolecular ‘phenyl embraces’ that are possible in crystalline systems involving tetraphenylphosphonium ions424,425.Compared with the related quaternary ammonium dication, it is much less easy to incorporate the longchain diphosphonium cation (2 15) into a - c y c l ~ d e x t r i n s ~Clay ~ ~ . containing intercalated palladium chloride and tetraphenylphosphonium bromide has

Ph + / Ph3P-CHZC ‘pp MeO’ yo

+ + Me3P-(CH2)10-PMe3

been shown to be a useful catalyst in the cross-coupling of aryl halides with arylboronic acid, giving b i a r y l ~ and ~ ~ ~also , in the arylation of alkenes, giving unsymmetrical trans-stilbenes in high yield428. Metastable Induced Electron Spectroscopy (MIES), a surface analysis technique, has been applied to the study of the surface activity of phosphonium salts in the polar solvent f ~ r m a m i d e ~Benzyltriphenyl~~. and anthracen-9-yltriphenyl-phosphonium salts have been used as photoinitiators for the polymerisation of ethyl c y a n ~ a c r y l a t e ~(Acetylmethy1)triphenylphosphonium ~~. bromide is a useful catalyst for the protection and deprotection of alcohols as alkylvinyl ethers, a strategy that can be applied to primary, secondary and tertiary alcohols, and also to phenols43’. Phosphonium tosylates, obtained by the reaction of tertiary phosphines with alkyl tosylates in refluxing toluene, have been used as ‘clean’ ionic solvents for catalytic hydrogenation reactions. The catalyst system, and the solvent, can be recovered easily, and r e - ~ s e d The ~ ~ ~synthetic . utility of fluorinated P-ketophosphonium salts has been reviewed433.Co-polymers of vinylbenzylltriphenylphosphonium chloride with various polymers have been prepared, and used for the fabrication of moisture sensitive membranes434.

4

pn- Bonded Phosphorus Compounds

The maturity of this area of organophosphorus chemistry is doubtless reflected in the publication of a book by Dillon, Mathey and N i ~ o n Other ~ ~ ~useful . reviews have also appeared, covering homonuclear multiple bonding in the heavier elements of main Groups 13, 14 and 15,436 the chemistry of P=P and P=C and the utility of cyclobutadienes and phospha-alkynes as tools for the development of phospha-organic systems and their valence isomers439. Routes to diphosphenes (and unsymmetrical dipnictenes) have been developed in which the p,-bonded system is stabilised by 2,6-diarylphenyl gro~ps~~ . ~ (2 ~ 16), ’ , which, when electron-rich diarylamino substituents e.g., are also present, raise the interesting possibility of redox-active systemsM2. Further consideration has been given to factors affecting the 3 1 P NMR

Orgunophosphor us Chemistry

32

(216) R' = Me or Pr' R2 = H or N(C6H40Me-p)2

(217) M = (q5C5Me5)(C0)2Fe Mes* = 2,4,6-But3C&

chemical shifts of diphosphenesa3. Ab initio quantum chemical investigations have been used to compare the phenyldiazonium cation and its phosphorus analogue, PhP2+ . The latter is shown to exist preferentially as phenyl bridged structure, and the results suggest that it should be stable in the gas phase and probably be accessible from the reaction between P2 and the phenyl cationw. The triphosphorus system (217) has been obtained from a cycloaddition reaction between a diphosphene bearing a complexed metallo group at phosphorus, and a p h ~ s p h a a l k y n e The ~ ~ ~chemistry . of mixed h3-h5diphosphorus systems, e.g., (218), has also continued to d e v e l ~ p ~these ~ ? com~~~, pounds having been shown to undergo a phospha-Wittig reaction with aldehydes, to form p h ~ s p h a a l k e n e s The ~ ~ ~first . stable phosphorus-containing heterofullerenes, C59P and c69P, have been prepared and identified by mass spectrometrya8. Another first is the synthesis of the para-phosphaquinone system (219), an air-stable orange solid which can be reduced using sodium in

%

Ar-P=PR3 (218) Ar = Mes or 2,4,6-BUt3C&

R=Me

T H F to form a related radical anion in which the unpaired spin is predominantly located at phosphorusa9. Routes to the functionalised phosphaalkenes (220) have also been described450.The chemistry of phosphaalkenes bearing reactive groups at phosphorus has been exploited in the synthesis of a range of new systems. On heating in vacuo, the P-trimethylsilyl system (22 1)is converted into the oxadiphosphole (222), a new heterocyclic system, from which other heterocyclic- and cage-structures have been obtained via cycloaddition reactions with alkynes or p h ~ s p h a a l k y n eI s. ~Treatment ~ of the trimethylsilylphosphaalkene (223) with pivaloyl chloride and benzoyl chloride provides a route to the acylated systems (224). It has also been shown that carbon disulfide and phenyl isothiocyanate undergo insertion into the Si-P bond of (223) to give the functionalised phosphaalkenes (225)452.The P-chlorophosphaalkene (226) has been shown to react with dialkylphosphinotrichlorosilanes to give new P-

33

1: Phosphines and Phosphonium Salts

Mesyp, OSiMe3

Me3Si-P=C

0 11 R-C-P=C

NMe2

P Y O

Mes

R (220)R = CH=NPh or 2-pyridyl

Me3SiP=C/

/

(221) /NMe2

NMe2 R(X)C-P=C

NMe2

NMe2

NMe2

(225) R(X)C = Me3SiS(S)C or Ph(Me3Si)N(S)C

(224)

(223)

dialkylphosphinophosphaalkenes(227). The P=C bond in these compounds can be reversibly protected by a [2 + 41 cycloaddition with cyclopentadiene, to give the P-phosphinophosphanorbornadienes(228)453.P-Halophosphaalkenes have also been shown to react with 1-(dialkylamino)alkynes, with the initial formation of unstable 2-phospha- 1,3-butadienes via electrophilic 1,2- addition at the alkyne triple bond with preservation of the two-coordinate phosphorus atoms. The phosphabutadienes subsequently rearrange to dihydrophosp h e t e ~ The ~~~ reactivity . of the phenylthio-functionalised phosphaalkene (229) has been investigated. This metallates normally with organolithium reagents to give (230), which, on treatment with copper(I1) undergoes oxidative coupling to give the 1,4-diphospha-1,3-butadiene(23 1)455. Metallation of bis(phosphaalkene) (232), followed by oxidative coupling with iodine, has given the bis(ph0sphabutadiene) (233)456.Dehydrofluorination of the germyl-substituted phosphaalkene (234) by tertiary butyllithium in the presence of chlorotri-

(Me3Si)2C=PCI

Me3Si

(227) R = Pr' or But

(226)

Ar,

/ \

(Me3Si)2C=P-PR2

/SPh

Ar,

/SPh P=C

P=C Br

(229) Ar = 2,4,6-But3C6H2

\

(230)

Li

SiMe3

(228)

'

phsHsph

Ar-P

P-Ar

(2311

methylsilane leads to the formation of the 1,2-bis(phosphaalkenyl)-1,2-digermacyclobutane (235), probably via head to head dimerisation of an Hydrostannylation of phosintermediate 1-pho~pha-3-germabutadiene~~~. phaalkenes has also been explored458.Phosphaalkene and related systems have also received further attention from the theoretician^^^^-^^'. The first phosphasilaallene system (236) has been obtained by dechlorination of the corresponding (chlorosily1)chlorophosphaalkene with t-butyllithium at low temperatures. In the absence of trapping agents, (236) dimerises to form two types of dimer, e.g., (237), depending on which double bonds are involved462.

34

Organophosphorus Chemistry

p+p P I

Ar,

,Cl P=C

Mes \ I

Ge-CHR2

I CI CI I Ar Ar (235) R = M e s

F'

(234) R2CH = fluorenyl Ar = 2,4,6-BUt3C6H2

A cyclic voltammetry study has shown that the monophosphaallene (238) undergoes irreversible reduction to form a monophosphaallylic radical, characterised by EPR In a similar vein, reduction of the diphosphaallene (239) is reported to give a radical anion. Oxidation of (239) gives a E-allylic radical cation464.The anionic 1,3-diphospha-2-silaallylic system (240) has been obtained from the reaction of a lithium arylphosphide with t r i c h l o r ~ s i l a n e s ~ ~ ~ .

Th Ph Ar-P=C=Si

' i P + ~ ~ ~ * '

I

\

Ph Ar-P=C=C

PAr

Ph

Tip (236) Ar = 2,4,6-BUt3C6H2 Tip = 2,4,6-Pr'&~H2

Ph

(238) Ar = 2,4,6-6Ut3C&

(237)

R

I

Ar-P-Si=P-Ar Li+

Ar-P=C=P-Ar

(239)Ar = 2,4,6-BUt3C&

(240) Ar = 2,4,6-But&H2 R = But, Mes or MesCp

A route to the arylphosphaalkyne (241) has been reported. This compound undergoes the expected cycloaddition reactions with 1,3-dienes and with (242), on the other hand, shows a ~ i d e s The ~ ~ ~trimethylsilylphosphaalkyne . unusual behaviour in its reactions with dienes, forming various phosphorus cage structures467. Sterically stabilised phosphaalkynes have been shown to

Me3

Me

/

Me (241)

Me3Si-C (242)

=P

Me3Si (243) R = But, 1-adamantyl or CMe2Et

1: Phosphines and Phosphonium Salts

35

undergo cycloaddition reactions with substituted 1,3,6-cyclooctatrienes to form phosphatricyclodecadiene systems, e.g., (243), which are then able to undergo further cycloadditions with alkynes and phosphaalkynes to form new cage structure^^^^^^^^. A route to selenophosphaalkenes is afforded by the 1,2addition reactions of phosphaalkynes with phenylselenyl halides470.Phenylphosphaethyne, PhC = P, undergoes spontaneous polymerisation in the neat state, or when in solution471. Interest in the coordination chemistry of phosphaalkynes has continued. The rare q ‘-coordination mode for ButC = P results in a shortening of the P = C triple bond relative to the uncoordinated ligand, in contrast to the more familiar q2-mode, in which the P = C bond length increases472.New aspects of the coordination chemistry of Bu‘C = P have also emerged in a study of ‘hydroosmiation’ of the p h ~ s p h a a l k y n e ~ ~ ~ . Transition metal-promoted cycloaddition and related reactions of phosphaalkynes continue to be a profitable area of s t ~ d y ~Phosphorus-aluminium ~ ~ - ~ ~ ~ . and phosphorus-gallium cage structures are formed in the reactions of phosphaalkynes with trialkyaluminium and trialkylgallium reagents478.New diphosphapolycyclic systems have been obtained from the reactions of a zirconocene-phosphaalkyne dimer The phosphaalkyne radical C H 2 C r P has been generated by a dc-glow discharge on a mixture of phosphine and acetylene, and characterised by microwave spectroscopf8*. A theoretical consideration of 1,4-diphosphabutadiyne, P = C-C = P, has concluded that it is likely to be thermodynamically stable but to have a strong tendency to polymerise. The possibility of stabilising it by coordination, e.g., to a Cr(C0)S acceptor, was also suggested481.Both the cyaphide anion, [C-PI-, and methyl isocyaphide (244), have been characterised in the coordination sphere of transition metals482.Theoretical studies of 31Pand I3C NMR chemical shifts and vibrational frequencies of phosphaalkynes have shown agreement with experimental values483.

+

+

Interest in the chemistry of phosphenium cations, R2P+, has also continued. Calculations on a series of phosphenium (and arsenium) ions support the assumed singlet ground states, and have also shed some light on bonding in their lowest triplet state, and on the course of their reactions with b ~ t a d i e n e ~ ~ ~ . Consideration has also been given to Factors affecting stabilities, electrophilicities, and carbene-like properties of phosphenium cations485. A structural comparision of the phosphenium salt (245) with the chlorophosphine (246) reveals that the former involves a 6n-delocalised aromatic phosphenium cation, whereas the latter is, as expected, covalent486.New chiral phosphenium salts involving potential coordinating groups in the vicinity of the phosphorus,

Organophosphorus Chemistry

36

e.g., (247) and (248), have been prepared and shown to form complexes with borane, in effect being phosphenium borane cations. The phosphonium cations undergo the usual cycloaddition reactions with d i e n e ~ ~Other ~~. phosphenium salts (249), which are stabilised by intramolecular donoracceptor N +P interactions, have been ~ h a r a c t e r i s e d Evidence ~~~. of a transient acylphosphenium ion (250) has been provided by trapping experiments489. Similarly, evidence for the formation of the ion (251), generated in the gas phase from trimethyl phosphite, has been obtained by trapping with 2,3dimethyl-1,3-butadiene and characterisation of the adduct (252) by mass M e0, +,0Me

spectrometry490. Dimethylzirconocene, Cp2ZrMe2, acts as a source of the methyl carbanion, converting phosphenium cations to methylph~sphines~~'. The supermesitylphosphenium ion (253) has been characterised as a transition metal complex492.The activity of phosphenium ion-me,tal complexes has also received further attention, their behaviour in cycloaddition reaction^^^^?^^^, and towards protic reagents495having been explored. A theoretical study of the correlation between structure and 31PNMR shifts of phosphenium cations has been reported496. The trapping of phosphinidenes, RP:, by carbenes, and also by transition metal acceptors has been reviewed497. The electrophilic versus nucleophilic character of transition metal-phosphinidene complexes has received a theoretical treatment498. and new phosphinidene-silver cluster systems have been described499.The bis(ph0sphinidene) complex (254) has been characterised by

t %

i-) P P

% (253)

i

\

I : Phosphines and Phosphonium Salts

37

trapping experiments500.Terminal phosphinidene complexes have been shown to react with aldimines to form complexed 1,2,3-~zadiphosphetidines, together with other P,N-heterocyclic products501.Phosphiranes and diphosphiranes bearing the supermesityl group, e.g., (255), have been prepared as anticipated precursors to phosphinidenes, and their photolyses studied by spectroscopic techniques. Phosphinidenes were not detected in these experiments, most products isolated having arisen from reactions involving the ortho-t-butyl groups502. Interest has also continued in the search for evidence of involvement of three-coordinate, pentacovalent, (03h5)-p,bonded systems in phosphorus chemistry. The ferrocenyldithioxophosphorane (256), generated by thermal decomposition of ferrocenyldithiaphosphetane disulfide, has been identified by trapping experiments with dienes, alkenes, and thioaldehydes. Thus, e.g., with norbornadiene, the tricyclic adduct (257) is formed503.Reactions of dithioxophosphoranes with phosphonate esters have also been studied504.Harger's group has provided further evidence, usually stereochemical, for the involvement of (03h5)-systems, e.g., (258), in nucleophilic displacement reactions of

certain P(V) acid derivative^^^^-^^*. A theoretical consideraton of the species H2PCH has concluded that the ground state of the molecule is best described as a phosphinocarbene rather than a h5-pho~phaacetylene~~~.

5

Phosphirenes, Phospholes and Phosphinines

The phosphirene system continues to attract the attention of the theoreticians, the past year having seen studies of insertion reactions of phosphirenium (and phosphiranium) cations with ethene and ethyne510, exchange and insertion reactions involving borane adducts of phosphirene and phosphirane5' I , and a study of the electron affinity of substituted ph~sphirenes~'~. A new and versatile approach to 1-phenyl-and 1-chlorophosphirenes (259) is offered by the reactions of titanocene complexes of various electron-poor alkynes with phenyldichlorophosphine or phosphorus trichloride513. Alkynyl-substituted phosphirenes are formed from the addition of the phenylphosphinidenetungsten pentacarbonyl complex to various diynes. Bisphosphirenes are not formed under these conditions5I4.The reaction of [bis(disopropylamino)phosphino](trimethylsilyl)carbene with t-butylphosphaalkyne gives the 2-phosphino -2H-phosphirene (260). The latter is unstable, rearranging at room temperature to the diphosphete (261). UV irradiation of (260) again results in

Organophosphorus Chemistry

38 R' Q2

P

I

R3 (259)R' = Ph, SiMe3, Bu or ferrocenyl R2 = Ph, SiM% or But R3 = Ph or CI

(260) R = NPrI2

(263)R=SiMe3

(261)

(264) R=SiMe3

the diphosphete (261) as the major product, but also gives the l-phosphino1H-phosphirene (262) in 10% yield515. A similar irradiation of the 1Hphosphirene (263) results in the formation of a 1,2-phosphasilete (264), which, on further treatment with an acid chloride, undergoes ring-expansion to form the oxaphosphasiline (265)516.New routes to 2H-azaphosphirene complexes (266) have been described,517and their reactions explored in detail. In the presence of alkynes, 1H-phosphirenes are and when heated in the presence of both an alkyne and dimethylcyanamide, 2H- 1,2-azaphospholes result520.Heating in the presence of both an alkyne and benzonitrile has given the first 7-aza- 1-phosphanorbornadiene complex (267y2I . Various diazaphosphole systems have been obtained from the reactions of 2H-azaphosphirene complexes solely with nit rile^^^*.

\ I'

Me02C

R' k (265) R = SiMe3

Cp* '[MI (266)Cp' = Me5Cp [MI = W ( W 5

Me02C' P~

(267)

The past year has again seen much activity in phosphole chemistry. A route to the 2-pyridyl-substituted phospholes (268) has been developed, and their reactivity and spectroscopic properties explored523.A series of diphospholylalkanes (269) has been prepared in a one-pot, high yield reaction by treatment of a,o-dibromoalkanes with 1-1ithi0-2,5-diphenylphosphole~~~. The dilithiophosphole (270) has been obtained by metallation of the related 2,Sdibrornophosphole, and used to prepare functionalised phosphole systems525.Further consideration has been given to the increase in aromaticity and planarisation Ph

Ph

Mw

Li I

Ph (268)

n=

Ph

Ph 1 or 2

(269)n = 2-6

Li

I Ph

(270)

39

I : Phosphines and Phosphonium Salts

of phospholes as a result of increasing the steric bulk of the substituent at phosphorus. A route to the phosphole (271) has been developed, this compound having the lowest ionisation energy ever reported for a phosphole, again consistent with decreasing pyramidality of phosphorus526.A theoretical treatment of phosphindolizine (272), as yet unknown, has indicated that the tricoordinated phosphorus is nearly planar, having a very low inversion barrier. Both five-and six-membered rings exhibit significant aromatic character, and the lone pair at phosphorus is d e l ~ c a l i s e d Structural ~~~. studies of three key intermediates in the synthesis of 2,2'-biphosphole have been reported528.The enophilic reactivity of simple phospholes has been exploited further for the synthesis of new chiral phosphine ligands. In the presence of palladium complexes of chiral ligands, v i n y l p h o ~ p h i n e s N-vinylimida~~~~~~~, ~ o l e ~2~- ~' i,n y l p y r i d i n eand ~ ~ ~other , unsaturated c o m p o ~ n d add s ~ to~ the ~ ~ ~ ~ ~ dienic system of 1-phenyl-3,4-dimethylphospholein a stereoselective manner, to give chiral complexes of new phosphorus ligands which can be isolated subsequently following decomplexation. Using this approach, a range of new chiral phosphine ligands, e.g., (273), and (274), has been characterised. In a similar vein, addition of coordinated allenylphosphines to 1-phenyl-3,4dimethylphosphole has given the diphosphines (275)535, and addition of alkynylstannanes results in the bicyclic system (276)536.The chemistry of

$' I

k2P = Ph2Por dibenzophospholyl

. ..

phospholide anions continues to be exploited. Treatment of the phospholes (277) with potassium t-butoxide in THF at 150-160 "C gives the phospholides (278) via a [1,5]-sigmatropic shift of the P-aryl substituent. These anions have then been used in the synthesis of new phosphaferrocenes, and other l i g d n d ~ ~Other ~ ~ . new phosphaferrocenes have been prepared, including (279)538,(280)539,and (28 1)540, and complexes of phosphaferrocenes with rhodium(1) and iridium(I) acceptors have also becn described541.The 1H- 1,3diphosphindolide system (282), a new delocalised, aromatic species, has been described542.Calcium543,gallium544,and l a n t h a r ~ i d ephospholides ~~~ have also been described. Studies of the coordination chemistry of simple phosphole and 2,2'-biphosphole systems also continue to appear, and it has been concluded

Organophosphorus Chemistry

40

SiMe3

I

kj I

6 Ar

Ar (277) Ar = 1-methylpyrrolP-ylor 2-(dipheny1phosphino)phenyl

K+

(278)

SiMe3 (279)

M e j,ti

9 I

(280)

(281) X = OH, Ph2P or Cy2P

that the predominant interaction between these phosphole ligands and the metal ion is o-donation from phosphorus with little n-back donation'46. Phospholes with reduced pyramidal character (283), resulting from the effect of the bulky P-aryl substituent, have been shown to form a series of platinium(I1) complexes547.Structural data on metal carbonyl complexes of 1phenyl-3,4-dimethylphosphole sulfide show that the ligand is acting as a 6electron q4-C4,q'-S chelating ligand in an unusual coordination mode548.The aromaticity of polyphosphaphosphole systems increases as the number of twocoordinate phosphorus ring-members increases, this being reflected in a decreasing pyramidality at the trico-ordinate phosphorus549.The triphosphole (284) slowly rearranges on exposure to sunlight or to a tungsten lamp to form the bicyclic system (285), which is labile in solution, undergoing a rapid

"'eR2 +Q 2

A3

(283) R1 = R2 = R3 = Pr' or But R1 = R2 = But, R3 = Me

I R

(284) R = CH(SiMe&

sigmatropic rearrangement in which the two phosphorus atoms in the fourmembered ring are exchanged550. The triphospholide-indium complex (286) has been obtained by the co-condensation of indium vapour and t-butylphosphaethyne at 77 K . It has also been prepared by a more conventional route from the potassium triphospholide salt and indium(1) iodide55'. The 1,2-

41

I : Phosphines and Phosphonium Salts

diphosphole system (287) is among the products of the reaction of allylidenetriphenylphosphorane with phosphorus t r i c h l ~ r i d eThe ~ ~ ~reaction . of a diphosphastibolyl anion with selenium- or tellurium-dithiocarbamates provides a simple route to 1,2,4- selena- and tellura-diphospholes (288)553,which have been structurally characterised by X-ray ~ r y s t a l l o g r a p h y New ~ ~ ~ .routes to the benzaphosphole system (289) have been developed5? Synthetic approaches to the 2-phosphaindolizine system (290) have been revieweds56,and new synthetic approaches d e v e l ~ p e d ~The ~ ~reactivity . ~ ~ ~ . of the two-coordinate phosphorus atom in this system has also been explored5s9~s60. Further studies of the reactivity of 1,2,3-dia~aphospholes~~~-~~, e.g., (29l), and 1,2,4=diazaphosp h o l e have ~ ~ ~been ~ reported.

(288) X = Se or Te

N R

The involvement of transition metals in the synthesis and subsequent studies of the reactivity of phosphinines has been r e ~ i e w e d ~ 2-Bromophosphi~~3~~~. nines have been transformed efficiently into the diphosphinines (292) by sequential treatment with zirconocene, a nickel(I1) diphosphine complex, and finally hexa~hloroethane~~~. Treatment of the zirconium-substituted phosphinine (293) with hex-3-yne followed by phosphorus tribomide gives the 1,4diphosphaindene (294), from which the related phosphininophospholide anion

can be generated on treatment with lithium569.Phosphinines and diphosphinines continue to attract the attention of the coordination chemistry community570-571. A theoretical comparison of the three isomeric diphosphinines and their P2(C-H)4 valence isomers has concluded that the three ‘aromatic’ planar diphosphinine isomers are the most stable572. Phosphaalkynes have been shown to undergo cyclotrimerisation in the presence of t-butylimidovanadium(V) to form 1,3,5-triphosphinines (295)573.These compounds have been shown to undergo cycloaddition reactions with phosphaalkynes, giving new tetraphosphabarrelene (296) and tetraphosphasemibullvalene (297) systems, depending on the substituents present in the ph~sphaalkyne’~~. A full struc-

42

Organophosphorus Chemistry

(296) R'=BU'

(297)

R~ = BU' or Pent'

tural study of (295, R = But) has also been reported, together with a related study of a 1,3-di~hosphinine~~~. The coordination chemistry of (295, R = But) has also been explored, this system acting as an q6-ligand towards transition metal carbonyl and related acceptors576.Further studies have been reported of the cycloaddition reactions of 1,2-dihydrophosphinine oxides (298), with the formation of 2-phosphabicyclo[2,2,2]octenesystems, e.g., (299), whose fragmentation on thermolysis or photolysis to form reactive 03h5-phosphorus intermediates is the key i s s ~ e ~Cycloaddition ~ ~ - ~ ~ ~of .phosphaalkynes to 1,3,2diaza- and 1,2-azaphosphinines has also been explored. Thus, e.g., the reaction of 4,6-di-t-butyl-1,3,2-diazaphosphinine (300) with t-butylphosphaethyne has given the diazadiphosphabarrelene (301)579.Interest in h5-phosphinine and related h5-azaphosphinine systems has also continued. The h5-triphosphinine (302)580has been prepared, and routes to 1,2h5-azaphosphinines (303)58' and 1-a~a-2,4-diphosphinines~~* have also been described.

R2*R'

&a (298) R' = Me or H

0 (299)R = Ph or OEt

R2 = H or Me R3 = Ph or OEt

References 1

2

J-P. Bezombes, C. Chuit, R. J. P. Corriu and C. Reye, J. Mut. Chem., 1998, 1749. S. B. Sembiring, S. B. Colbran and D. C. Craig, J. Chem. Soc., Dulton Trans., 1999, 1543.

I : Phosphines and Phosphonium Salts 3 4 5 6 7 8

9 10 11 12

13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33

43

Y. Yamanoi and T. I. Mamoto, J. Org. Chem., 1999,64,2988. A. Aranyas, D. W. Old, A. Kiyomori, J. P. Wolfe, J. P. Sadighi and S. L. Buchwald, J. Am. Chem. SOC.,1999,121,4369. D. W. Old, J. P. Wolfe and S. L. Buchwald, J. Am. Chem. SOC., 1998,120,9722. B. E. Hanson, H. Ding and C. W. Kohlpaintner, Catalysis Today, 1998,42,421. H. Brunner, M. Janura and S. Stefaniak, Synthesis, 1998, 1742. M. M. Kabachnik, Z. S. Novikovd, I. A. Chadnaya, A. A. Borisenko and I. P. Beletskaya, Russ. Chem. Bull., 1998,47, 332. Y. Suzuki, Y. Ogata and K. Hiroi, Tetrahedron: Asymmetry, 1999,10, 1219. J. P. Cahill, F. M. Bohnen, R. Goddard, C. Kruger and P. J. Guiry, Tetrahedron: Asymmetry, 1998,9, 3831. M. T. Powell, A. M. Porte and K. Burgess, Chem. Commun., 1998,2161. C-D. Graf, C. Malan and P. Knochel, Angew. Chem., Int. Ed. Engl., 1998, 37, 30 14. K. K. Banger, R. P Banham, A. K. Brisdon, W. I. Cross, G. Damant, S. Parsons, R. G. Pritchard and A. Sousa-Pedrares, J. Chem. SOC., Dalton Trans., 1999, 427. X . Dai and V. Scott, Tetrahedron: Asymmetry, 1999, 10, 25; Tetrahedron Lett., 1999,40, 1245. S . T. Lin, H. S. Cheo, B. I. Chen and Z. Y. Own, Heteroat. Chem., 1998,9,549. A.Antinolo, F. Carrillo-Hermosilla, E. Diez-Barra, J. Fernandez-Baeza, A. Fernandez-Lopez, A. Lard-Sanchez, A. Moreno, A. Otero, A. M. Rodriguez and J. Tejeda, J. Chem. SOC.,Dalton Trans., 1998, 3737. L. A. van der Veen, P. C. J. Kamer and P. W. N. M. van Leeuwen, Angew. Chem., Int. Ed. Engl., 1999,38, 336. L. A. van der Veen, M. D. K. Boele, F. R. Bregman, P. C. J. Kamer, P. W. N. M. van Leeuwen, K. Goubitz, J. Fraanje, H. Schenk and C. Bo, J. Am. Chem. SOC., 1998,120, 1 1 616. A. E. S. Gelpke, J. J. N. Veerman, M. S. Goedheijt, P. C. J. Kamer, P. W. N. M. van Leeuwen and H. Hiemstra, Tetrahedron, 1999,55,6657. J. J. Adams, D. E. Berry, J. Browning, D. Burth and 0.J. Curnow, J. Organomet. Chem., 1999,580,245. C. Lensink and G. J. Gainsford, Aust. J. Chem., 1998, 51, 667. H. G. Alt and M. Jung, J. Organomet. Chem., 1998,568,127. J. J. A. Perea, M. Lotz and P. Knochel, Tetrahedron:Asymmetry, 1999, 10, 375. J. Kang, J . H. Lee, S. H. Ahn and J. S. Choi, Tetrahedron Lett., 1998,39, 5523. J. J. A. Perea, A. Borner and P. Knochel, Tetrahedron Lett., 1998,39,8073. M. Widhalm, K. Mereiter and M. Bourghida, Tetrahedron: Asymmetry, 1998, 9, 2983. T-Y. Dong and C-K. Chang, J. Chin. Chem. SOC.,1998,45,577. N. L. Long, J. Martin, G. Opromolla, A. J. P. White, D. J. Williams and P. Zanello, J. Chem. SOC., Dalton Trans., 1999, 198 1 . W. B. Zhang, Y. Yoneda, T. Kida, Y. Nakatsuji and I. Ikeda, Tetrahedron: Asymmetry, 1998,9, 3371. I. R. Butler, U. Griesbach, P. Zanello, M. Fontani, D. Hibbs, M. B. Hursthouse and K. M. A. Malik, J. Organornet. Chem., 1998,565, 243. H. Tsuruta and T. Lmamoto, Tetrahedron: Asymmetry, 1999, 10, 877. M. T. Reetz, E. W. Beuttenmiiller, R. Goddard and M. Pasto, Tetrahedron Lett., 1999,40,4977. S. Kudis and G. Helmchen, Angew. Chem. Int. Ed., 1998,37,3047.

44

Organophosphorus Chemistry

34

P. B. Hitchcock, M. F. Lappert and M. Layh, J. Organomet. Chem., 1999, 580, 386. V. P. Balema, S. Blaurock and E. Hey-Hawkins, Z. Naturforsch., B: Chem. Sci., 1998,53,1273. D. J. Jones, P. G. Edwards, R. P. Tooze and T. Albers, J. Chem. SOC.,Dalton Trans., 1999, 1045. N. K. Gusarova, S. F. Malysheva, S. N. Arbuzova and B. A. Trofimov, Russ. Chem. Bull., 1998,47, 1645. F. Bitterer, 0. Herd, M. Kiihnel, 0. Stelzer, N. Weferling, W. S. Sheldrick, J. Hahn, S. Nagel and N. Rosch, Inorg. Chem., 1998,37,6408. Y-Y. Yan and M. Widhalm, Tetrahedron: Asymmetry, 1998,9, 3607. A. Marinetti, J-P. Genet, S. Jus, D. Blanc and V. Ratovelomanana-Videl, Chem.Eur. J., 1999,5, 1160. J. Holz, M. Quirmbach, U. Schmidt, D. Heller, R. Sturmer and A. Borner, J. Org. Chem., 1998,63,8031 . Z. Chen. G. Zhu, Q. Jiang, D. Xiao, P. Cao and X. Zhang, J. Org. Chem., 1998, 63, 5631. E. Vedejs and 0. Daugulis, J. Am. Chem. SOC.,1999,121,5813. P. Dierkes, S. Ramdeehul, L. Barloy, A. de Cian, J. Fischer, P. C. J. Kamer, P. W. N. M. van Leeuwen and J. A. Osborn, Angew. Chem., Int. Ed. Engl., 1998, 37, 31 16. D. Carmichael, H. Doucet and J. M. Brown, Chem. Commun., 1999,261. A. Marinetti, V. Kruger and B. Couetoux, Synthesis, 1998, 1539. B. Wiese and G. Helmchen, Tetrahedron Lett., 1998,39, 5727. S. Sasaki, Y. Tanabe and M. Yoshifuji, Bull. Chem. SOC.Jpn., 1999,72,563. K. Hiroi, Y. Suzuki and R. Kawagishi, Tetrahedron Lett., 1999,40, 71 5. M. Kant and S. Bischoff, 2. Anorg. Allg. Chem., 1999,625, 707. M. T. Reetz, R. Demuth and. R. Goddard, Tetrahedron Lett., 1998,39, 7089. N. I. Tyryshkin, N. A. Polezhaeva, A. V. Prosvirkin, V. G. Sahibullina and G. A. Chmutova, Russ. J. Gen. Chem., 1997,67, 1553. A. M. Porte, J. Reibenspies and K. Burgess, J. Am. Chem. SOC.,1998,120,9180. A. M. Porte, W. A, van der Donk and K. Burgess, J. Org. Chem., 1998,63,5262. E. Hauptman, P. J. Fagan and W. Marshall, Organometallics, 1999, 18,2061. J-0. Durand, Synthesis, 1999, 835. C. Lutz, C-D. Graf and P. Knochel, Tetrahedron, 1998,54, 10317. D. P. Krut’ko, M. V. Borozov, E. N. Veksler, E. N. Myshakin and D. A. Lemenovskii, Russ. Chem. Bull., 1998,47, 956. B. M . Trost, B. Vidal and M. Thommen, Chem.-Eur. J., 1999,5, 1055. B-L Chen, K-F. Mok and S-C. Ng, J. Chem. Soc., Dalton Trans., 1998, 2861. F. Robert, G . Oehme and D. Sinou, J. Mol. Catal. A: Chem., 1999,139, 105. J. M. Longmire, X. Zhang and M. Shang, Organometallics, 1998, 17, 4374. W. H. Hu, C. C. Pai, C. C. Chen, G. P. Xue and A. S. C. Chan, Tetrahedron: Asymmetry, 1998,9, 3241. T. Miura and T. Imamoto, Tetrahedron Lett., 1999,40,4833. I . A. Bagatin, D. Matt, H. Thonnessen and P. G. Jones, Inorg. Chem., 1999, 38, 1585. B. Wrackmeyer, A. Glockle and G . Kehr, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 131,25. D. Dou, E. N. Duesler and R. T. Paine, Inorg. Chem., 1999,38,788. M. Driess, M. Reisgys and H. Pritzkow, Z. Anorg. Allg. Chem., 1998, 624, 1886.

35 36 37 38

39 40 41 42 43 44

45 46 47 48 49 50 51 52

53 54 55 56 57 58 59 60 61 62 63

64 65 66 67 68

1: Phosphines and Phosphonium Salts 69 70 71 72

73 74 75 76 77 78 79 80 81 82 83 84 85 86 87

88 89 90 91

92 93 94 95 96

45

D. Soulivong, D. Matt and R. Ziessel, Chem. Commun., 1998. 393. K. Kashiwabara, N. Taguchi, H. D. Takagi, K. Nakajima and T. Suzuki, Polyhedron, 1998, 17, 18 17. Y. Nakagawa, M. Kanai, Y. Nagaoka and K. Tomioka, Tetrahedron, 1998, 54, 10295. J. R. Dilworth, Y. Zheng and D. V. Griffiths, J. Chem. Soc., Dalton Trans., 1999, 1877. M. Taillefer, N. Inguimbert, H. J. Cristau, L. Jager and K. Merzweiler, Chem. Commun., 1999,565. J. S . Ducca, M. H. Gallego, A. B. Pierini and R. A. Rossi, J. Org. Chem., 1999, 64,2626. S . Lee, S. H. Lee, C. E. Song and B. Y. Chung, Tetrahedron: Asymmetry, 1999, 10, 1795. P. Schober, G. Huttner, L. Zsolnai and A. Jacobi, J. Organomel. Chem., 1998, 571,279. S. Qiao and G. C. Fu, J. Org. Chem., 1998,63,4168. J. Cristoffers and U. Rossler, Tetrahedron: Asymmetry, 1999, 10, 1207. A. Bayler, A. Schier and H. Schmidbaur, Inorg. Chem., 1998,37,4353. L. Brandsma, S. Arbuzova, R-J. De Lang, N. Gusarova and B. Trofimov, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997,126, 125. A. G. Avent, D. Bonafoux, C. Eaborn, S. K. Gupta, P. B. Hitchcock and J. D. Smith, J. Chem. SOC.,Dalton Trans., 1999, 831. H. Binder, B. Schuster, W. Schwarz and K. W. Klinkhammer, 2. Anorg. Allg. Chem., 1999,625,699. H. Siegl, W. Krumlacher and K. Hassler, Monutsh. Chem., 1999, 130, 139. M. A. Beswick, M. E. G . Mosquera and D. S. Wright, J. Chem. Soc., Dalton Trans., 1998, 2437. J. D. Smith, Angew. Chem., Int. Ed. Engl., 1998,37, 2071. N. Wiberg, A. Worner, H-W. Lerner, K. Karaghiosoff and H. Noth, Z. Naturforsch., B: Chem. Sci., 1998,53, 1004. M. A. Beswick, N. Choi, A. D. Hopkins, M. McPartlin, M. E. G. Mosquera, P. R. Raithby, A. Rothenberger, D. Stalke, A. J. Wheatley and D. S. Wright, Chem. Commun., 1998,2485. S. P. Mattamana, K. Promprai, J. C. Fettinger and B. W. Eichhorn, Inorg. Chem., 1998,37,6222. W. Clegg, S. Doherty, K. Izod, H. Kagerer, P. O’Shaughnessy and J. M. Sheffield, J. Chem. SOC.,Dalton Trans., 1999, 1825. M. Driess, H. Pritzkow, M. Skipinski and U. Winkler, J. Am. Chem. Soc., 1998, 120, 10774. M. A. Beswick, A. D. Hopkins, L. C. Kerr, M. E. G. Mosquera, J. S. Palmer, P. R. Raithby, A. Rothenberger, D. Stalke, A. Steiner, A. E. H. Wheatley and D. S. Wright, Chem. Commun., 1998, 1527. C . Frenzel, P. Jorchel and E. Hey-Hawkins, Chem. Commun., 1998, 1363. G. W. Rabe, S. Kheradmandan and G. P. A. Yap, Inorg. Chem., 1998,37,6541. G. W. Rabe, H. Heise, G. P. A. Yap, L. M. Liable-Sands, I. A. Guzei and A. L. Rheingold, Inorg. Chem., 1998,37,4235. U . Englich, K. Hassler, K. Ruhlandt-Senge and F. Uhlig, Inorg. Chem., 1998,37, 3532. M. Westerhausen, M . H. Digeser, M. Krofta, N . Wiberg, H. Noth, J. Knizek, W. Ponikwar and T. Seifert, Eur. J. Inorg. Chem., 1999, 743.

46 97 98 99 100 101 102 103 104 105 I06 107 108 109 110 111 112 113 114

1 I5 116 1 I7

118

119 120 121 122

123 124 125

Organophosphorus Chemistry

M. Westerhausen, M. H. Digeser, H. Noth, W. Ponikwar, T. Seifert and K.Polborn, Inorg. Chem., 1999,38, 3207. M. Westerhausen, M. Krofta and A. Pfitzner, Inorg. Chem., 1999,38, 598. J. F. Janik, R. L. Wells and P.S. White, Orgunometallics, 1998, 17,2361. J. F. Janik, R. L. Wells and P. S. White, Inorg. Chem., 1998,37, 3561. M. Driess, C. Monse, R. Boese and D. Blaser, Angew. Chem. Int. Ed. Engl., 1998, 37, 2257. W. Uhl and M. Benter, Chem. Commun., 1999,771. M. Westerhausen, M. Wieneke and W. Schwarz, J. Organomet. Chem., 1999,572, 249. M. Faulhaber, M . Driess and K. Merz, Chem. Cornmun., 1998, 1887. G . Heckmann, H. Binder and D. Bongert, Mugn. Reson. Chem., 1998,36,250. S. M. Cendrowski-Guillaume and M. Ephritikhine, J. Organomet. Chem., 1999, 577, 161. W. Clegg, K. Izod, W. McFarlane and P. O’Shaughnessy, Organometallics, 1998, 17. 5231. T. L. Schull and D. A. Knight, Tetrahedron: Asymmetry, 1999, 10, 207. M. A. Bennett, M. Contel, D. C. R. Hockless and L. L. Welling, Chern. Commun., 1998,2401. J. Wolf, M. Manger, U. Schmidt, G . Fries, D. Barth, B. Weberndorfer, D. A. Vicic, W. D. Jones and H. Werner, J. Chem. Soc., Dalton Trans., 1999, 1867. N. Riegel, C. Darcel, 0. Stephan and S. Juge, J. Organomet Chem., 1998, 567, 219. H. H. Karsch and M. Reisky, Eur. J. Inorg. Chem., 1998,905. J. J. Adams, 0. J. Curnow, G . Huttner, S. J. Smail and M. M. Turnbull, J. Organomet. Chem., 1999,577,44. M. Hap, T. Gilles, T. Kruck and K-F. Tebbe, Z. Naturforsch., B: Chern. Sci., 1999,54,482. C. P. Casey, E. L. Paulsen, E. W. Beuttenmueller, B. R. Proft, B. A. Matter and D. R. Powell, J. Am. Chem. Soc., 1999, 121,63. J. L. Bookham and D. M. Smithies, J. Orgunomet. Chem., 1999,577, 305. N. K. Gusarova, S. F. Malysheva, N. A. Chernysheva,#N.A. Belogorlova, S. N. Arbuzova, D. V. Gendin and B. A. Trofimov, Russ. J. Org. Chem., 1997, 33, 1156. N. K. Gusarova, S. F. Malysheva, N. A. Chernysheva, N. A. Belogorlova, S. N. Arbuzova, M. Ya. Khil‘ko and B. A. Trofimov, Russ. J. Org. Chem., 1998, 34, 1056. D. M. Schubert, M. L. Hackney, P. F. Brandt and A. D. Norman, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 123, 141. L. J. Alvey, D. Rutherford, J. J. J. Juliette and J. A. Gladysz, J. Org. Chem., 1998,63,6302. J-F. C . Toro, F. Riviere, J-G. Wolf, M. Sanchez and V. D. Romanenko, Chern. Commun., 1998,2 1 83. W. Malisch, F-J. Rehmann, H. Jehle and J. Reising, J. Organoment. Chern., 1998, 570, 107. W. Malisch, K. Thirase, F. J. Rehmann, J. Reising and N. Gunzelmann, Eur. J. Inorg. Chem., 1998, 1589. V. I . Vysotskii, Russ. Chern. Bull., 1998,47, 1851. V. Gee, A. G. Orpen, H. Phetmung, P. G. Pringle and R. I. Pugh, Chern. Commun., 1999,90I .

1: Phosphines and Phosphonium Salts

126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159

47

D. Sinou, G. Pozzi and E. G. Hope, Tetrahedron Lett., 1999,40,849. R. Kuwano, T. Uemura, M. Saitoh and Y. Ito, Tetrahedron Lett., 1999,40, 1327. N. Fujie, M. Matsui and K. Achiwd, Chem. fharm. Bull., 1999,47,436. S. Ohshima, T. Matsumoto, Y. Aoki, T. Hirose, A. Miyashita and H. Nohira, Enantiomer, 1998,3, 191. K. Selvakumar, M. Valentini, M. Woerle, P. S. Pregosin and A. Albinati, Organometallics, 1999, 18, 1207. K. Ding, Y. Wang, H. Yun, J. Liu, Y. Wu, W. Terada, Y. Okubo and K. Mikami, Chem.-Eur. J., 1999,5, 1734. S. Vyskocil, M. Smrcina, V. Hanus, M. Polasek and P. Kocovsky, J. Org. Chem., 1998,63,7738. S. Vyskocil, M Smrcina and P. Kocovsky, Tetrahedron Lett., 1998,39,9289. H. Ghassemi, D. J. Riley, M. Curtis, E. Bonaplata and J. E. McGarth, Appl. Organomet. Chem., 1998, 12,781. C. Wieser-Jeunesse, D. Matt and A. De Cian, Angew. Chem., Int. Ed. Engl., 1998, 37, 2861. M. Brynda, M. Geoffroy and G. Bernardinelli, Chem. Commun., 1999,961. M. Brynda, T. Berclaz, M. Geoffroy, G. Ramakrishnan and G. Bernardinelli, J. Phys. Chem. A, 1998, 102,8245. V. Plack, J. R. Goerlich and R. Schmutzler, 2. Anorg. Allg. Chem., 1999,625,919. F. Guillen and J-C. Fiaud, Tetrahedron Lett., 1999,40,2939. N. J. Lawrence and F. Muhammad, Tetrahedron, 1998,54, 15345. N. J. Lawrence and F. Muhammad, Tetrahedron, 1998,54, 15361. D. Tanner, P. Wyatt, F. Johansson, S. K. Bertilsson and P. G. Anderson, Acta Chem. Scand., 1999,53,263. S. R. Gilbertson and C-W. T. Chang, J. Org. Chem., 1998,63,8424. J-P. Majordl and A-M. Caminade, Chem. Rev., 1999,99,845. J-P. Majoral, A-M. Caminade and R. Laurent, Bull. Pol. Acad. Sci. Chem., 1998, 46, 319. J-P. Majoral and A-M. Caminade, Top. Curr. Chem., 1998,197,79. A-M. Caminade, R. Laurent, B. Chaudret and J. P. Majoral, Coord. Chem. Rev., 1998,178-180, (Part 1) 793. A. Marinetti, V. Kruger and F-X Buzin, Coord. Chem. Rev., 1998, 178-180, (Part 1) 755. R. W. Alder and D. Read, Coord. Chem. Rev., 1998,176, 113. M. Ohff, J. Holz, M. Quirmbach and A. Borner, Synthesis, 1998, 1391. N. N . Godovikov, V. P. Balema and E. G. Rys, Usp. Khim., 1997,66,1125. M. S. Goedheijt, P. Kamer and P. Van Leeuwen, Aqueous-Phase Organomet Catal., 1998,90. K. V. Katti, H. Gali, C. J. Smith and D. E. Berning, Acc. Chem. Res., 1999,32,9. B. A. Trofimov, S. N. Arbuzova and N. K. Gusarova, Russ. Chem. Rev., 1999, 68,215. 0 .Guerret and G. Bertrdnd, Main Group Chem. News, 1998,6, 12. N . J. Goodwin, W. Henderson, B. K. Nicholson, J. Fawcett and D. R. Russell, J. Chem. Soc., Dalton Trans., 1999, 1785. C . Kollner, B. Pugin and A. Togni, J. Am. Chem. SOC.,1998, 120, 10274. G. E. Oosterom, R. J. van Haaren, J. N. H. Reek, P-C. J. Kamer and P. W. N. van Leeuwen, Chem. Commun., 1999, 11 19. M. E. van der Boom, S-Y. Liou, Y. Ben-David, L. J. W. Shimon and D. Milstein, J. Am. Chem. Sac., 1998, 120,6531.

48

Organophosphorus Chemistry

160 J . Thomaier, S. Boulmaaz, H. Schonberg, H. Ruegger, A. Currao and H. Grutzmacher, New J. Chem., 1998,22,947. 161 J. Liedtke, S. Loss, G. Alcaraz, V. Gramlich and H. Griitzmacher, Angew. Chem., Int. Ed. Eng., 1999, 38, 1623. 162 P-H. Leung, A. Liu, K. F. Mok, A. J. P. White and D. J. Williams, J. Chem. SOC.,Dalton Trans., 1999, 1277. 163 G. C. Dol, S. Garners, M. Hietikko, P. C. J. Kamer, P. W. N. van Leeuwen and R. J. Nolte, Eur. J. Inorg. Chem., 1998, 1975. 164 S. Hida, P. J. Roman, A. A. Bowden and J. D. Atwood, J. Coord. Chem., 1998, 43, 345. 165 M. Taillefer and H. J. Cristau, Tetrahedron Lett., 1998,39, 7857. 166 R. Shu, L. Hao, J. F. Harrod, H-G. Woo and E. Samuel, J. Am. Chem. Soc., 1998,120, 12988. 167 J. Park, S. Kim, J. KO, S. Cho, C-H. Lee, Y-H. Lee and S. 0. Kang, Bull Korean. Chem Soc., 1998,19,363. 168 D. Armspach and D. Matt, Chem. Commun., 1999, 1073. 169 D. E. Bergbreiter, Y-S. Liu, S. Furyk and B. L. Case, Tetruhedron Lett., 1998, 39, 8799. 170 P. Machnitzki, T. Nickel, 0. Stelzer and C. Landgrafe, Eur. J. Znorg. Chem., 1998, 1029. 171 B. H. Lipshutz, D. J . Buzard and C. S. Yun, Tetrahedron Letr., 1999,40, 201. 172 0. Herd, A. Hessler, M. Hingst, P. Machnitzki, M. Tepper and 0. Stelzer, Catalysis Today, 1998,42,4 13. 173 M. McCarthy and P. J . Guiry, Tetrahedron, 1999,553061. 174 K . Fuji, M. Sakurai, T. Kinoshita and T. Kawabata, Tetruhedron Lett., 1998, 39, 6323. 175 M. A. Kazankova, E. A. Chirkov, A. N. Kochetkov, I. V. Efimova and I. P. Beletskaya, Tetrahedron Lett., 1999,40, 573. 176 Yu. A. Veits, N. B. Karlstedt, V. L. Foss and I . P. Beletskaya, Russ. J. Org. Chem.,1998,34, 525. 177 A. M. LaPointe, J. Comb. Chem., 1999, 1, 101. 178 S-M. Kuang, Z-Z. Zhang, Q-G. Wang and T. C. W. Mak, Inorg. Chem., 1998, 37, 6090. 179 A. A. Kardsik, I. 0. Georgiev, R. I . Vasiliev and 0. G . Sinyashin, Mendeleev Commun., 1998, 140. 180 D. E. Berning, K. V. Katti, C . L. Barnes and W. A. Volkert, J. Am. Chem. SOC., 1999,121, 1658. 181 D. W. Allen, D. E. Hibbs, M. B. Hursthouse and K. M. A. Malik, J. Organomet. Chem., 1999,572,259. 182 C . Chuit and C. Reye, Eur. J. Znorg. Chem., 1998, 1847. 183 M. Chauhan, C. Chuit, A. Fruchier and C. Reye, Inorg. Chem., 1999,38, 1336. 184 Y. Budnikova, Y. Kargin, J-Y. Medelec and J. Perichon, J. Orgunomet. Chem., 1999,575, 63. 185 Yu. G. Budnikova, D. G. Yakhvarov and Yu. M. Kargin, Russ. J. Cen. Chem., 1998,68,566. 186 M. E. Elliott, T. S. Kimmerling, L. Zhu, B. N. Storhoff and J. C . Huggman, Polyhedron, 1999, 18, 1603. 187 U . Nettekoven, P. C. J. Kamer, P. W. N. M. van Leeuwen, M. Widhalm, A. L. Sepk and M. Lutz, J. Org. Chem., 1999,64,3996.

1: Phosphines and Phosphonium Salts

188

189 190 191 192 193 194 195 196 197 198 199 200 20 1 202 203 204 205 206

207 208 209 210 21 1 212 213 214 21 5 216 21 7

49

F. Maienza, M. Woerle, P Steffanut, A. Mezzetti and F. Spindler, Organometallics, 1999, 18, 1041. M. Mirza-Aghayan, R. Boukherroub, G. Oba, G. Manuel and M. Koenig, J. Organomet. Chem., 1998,564,61. P. Dufour, V. Capdevielle, M. Dartiguenave, Y. Dartiguenave, F. BelangerGariepy and A. L. Beauchamp, Organometallics, 1998, 17,2839. S. M. Aucott, A. M. Z. Slawin and J. D. Woollins, J. Organomet. Chem., 1999, 582, 83. P. Braunstein, M. D. Fryzuk, F. Naud and S. J. Rettig, J. Chem. SOC., Dalton Trans., 1999, 589. M. A. Jalil, S. Fujinami, H. Senda and H. Nishikawa, J. Chem SOC., Dalton Trans., 1999, 1655. Yu. A. Veits, E. G . Neganova and 1. P. Beletskaya, Russ. J. Org. Chem., 1997,33, 1351. G. V. Oshovskii, F. F. Tolmachev, A. S. Merkulov and A. M. Pinchuk, Chem. Heterocycl. Compd. ( N . Y . ) , 1997,33, 1242. A. Saitoh, M. Misawa and T. Morimoto, Tetrahedron: Asymmetry, 1999,10, 1025. Dalton J. E. Kingson, L. Ashford, P. D. Beer and M. G. B. Drew, J. Chem. SOC., Trans., 1999,251. K. Hiroi, Y. Suzuki and I. Abe, Chem. Lett., 1999, 149. T. Malmstrom and C. Anderson, J. Mol. Catal. A: Chem., 1999,139,259. P. Bhattacharyya, J. Parr and A. M. Z. Slawin, J. Chem. Soc., Dalton Trans., 1998,3609. S. E. Watkins, X. Yang, D. C. Craig and S. B. Colbran, J. Chem. Soc., Dalton Trans., 1999, 1539. S. U. Son, H-Y. Jang, J. W. Han, I. S. Lee and Y. K. Chung, Tetrahedron: Asymmetry, 1999,10,347. S. Schaffner, J. F. K. Miiller, M. Neuburger and M. Zehnder, Helv. Chim. Acta, 1998,81, 1223. T. Ireland, J. J. Almena Perea and P. Knochel, Angew. Chem., Int. Ed. Engl., 1999, 1457. Z. Xu and X. Lu, J. Org. Chem., 1998,63,5031. I. Yavari, S. Asghari and M. Samadi-Zadeh, Iran. J. Chem. Eng., 1998, 17, 38 (Chem. Abstr., 1999, 130, 110 123) I. Yavari, H. Djahaniani, M. T. Maghsoodlou and N. Hazeri, J. Chem. Rex (S), 1999,382. I. Yavari and M. H. Mosslemin, Tetrahedron, 1998,54,9169. I. Yavari, M. R. Islami and H. R. Bijanzadeh, Tetrahedron, 1999,55,5547. I. Yavari, M. T. Maghsoodlou, H. Djahaniani and N. Hazeri, J. Chem. Res. ( S ) , 1999,216. 1. Yavari, S. Asghari and A. A. Esmaili, J. Chem. Res. ( S ) , 1999,234. I. Yavari and A. R . Samzadeh-Kermani, Tetrahedron Lett., 1998,39,6343. A. Shaabani and F. S. Nejat, J. Chem. Res. ( S ) , 1998,584, T-Y. Hsiao, S. K. Chidambareswaren, K. Santhosh and C-H. Cheng, J. Org. Chem., 1998,63,6119. H. Kuroda, E. Hanaki and M. Kawakami, Tetmhedron Lett., 1999,40,3753. Z. Xu and X. Lu, Tetrahedron Lett., 1999,40, 549. F. Dinon, E. Richards, P. J. Murphy, D. E. Hibbs, M. B. Hursthouse and K. M. A. Malik, Tetrahedron Lett., 1999,40,3279.

50

Organophosphorus Chemistry

A. N. Kochetkov, I. V. Efimova, L. G. Trostyanskaya, M. A. Kazankova and I. P. Beletskaya, Russ. Chem. Bull., 1998,47, 1744. 219 S. K. Barsegyan, G. Ts. Gasparyan, M. Zh. Ovakimyan and M. G. Indzhikyan, Arm. Khim. Zh., 1997,50,74. 220 V. I. Galkin, Yu. V. Bakhtiyarova, Yu. G. Gololobov, N. A. Polezhaeva and R. A. Cherkasov, Heteroat. Chem., 1998,9, 665. 22 1 R. G. Makitra and Y. N. Pirig, Russ. J. Gen. Chem., 1998,68, 395. 222 V. Cadierno, M. Zablocka, B. Donnadieu, A. Igau and J-P. Majoral, Organometallics, 1999, 18, 1882. 223 R-L. Shieh, R-L. Lin, J-J. Hwang and J-J. Jo, J. Chin. Chem. SOC.,1998,45, 517. 224 S. M. Godfrey, C. A. McAuliffe, I. Mushtaq, R. G. Pritchard and J. M. Sheffield, J. Chem. SOC.,Dalton Trans., 1998, 38 15. 225 N. Bricklebank, S. M. Godfrey, C. A. McAuliffe, P. Deplano, M. L. Mercuri and J. M. Sheffield, J. Chem. Soc., Dalton Trans., 1998,2379. 226 P. T. Ndifon, C. A. McAuliffe, A. G . Mackie and R. G. Pritchard, Inorg. Chim. Acta, 1998,282,25. 227 A. Nachbauer, U. Bergstrisser, S. Leininger and M. Regitz, Synthesis, 1998,427. 228 P. Froyen and J. Skramstad, Tetrahedron Lett., 1998,39,6387. 229 T. Besson, G. Guillaumet, C. Lamazzi, C. W. Rees and V. Thiery, J. Chem. SOC. Perkin Trans. I , 1998,4057. 230 C. Limousin, A. Olesker, J. Cleophax, A. Petit, A. Loupy and G. Lukacs, Carbohydr. Res., 1998,312,23. 23 1 M. A. Ornelas and R. Romero, Synth. Commun., 1999,29, 1401. 232 A-H. Dabbagh, S. E. Mallakpour and K. Faghihi, Iran. Polym. J., 1998, 7, 149. (Chem. Abstr., 1999, 130, 197 537). 233 J. J. Hans, R. W. Driver and S. D. Burke, J. Org. Chem., 1999,64, 1430. 234 Y. Shen, Y. Zhang and Y. Zhou, J. Chem. Soc., Perkin Trans. I , 1999, 1759. 235 G . A. Hiegel, J. Ramirez and R. K. Barr, Synth. Commun., 1999,29, 1415. 236 K. H. Cha, T. W. Kang, H-W. Lee, E-N. Kim, N-H. Choi, J-W. Kim and C. I. Hong, Synth. Commun., 1998,28, 21 3 1. 237 J. Drabowicz, J. Luczak and M. Mikolajczyk, J. Org. Chem., 1998,63, 9565. 238 S. M. Godfrey, I. Mushtaq and R. G. Pritchard, J. Chem. Soc., Dalton Trans., 1999, 1319. 239 B. Carboni and L. Monnier, Tetrahedron, 1999,55, 1197. 240 P. Vedrenne, V. Le Guen, L. Toupet, T. Le Gall and C. Mioskowski, J. Am. Chem. SOC.,1999,121, 1090. 24 1 V. D. Vil’chevskaya, N. K. Baranetskaya, A. S. Peregudov, V. D. Makhaev and A. I. Krylova, Russ. J. Coord. Chem., 1998, 24, 307. 242 H. Jacobsen, H. Berke, S. Doering, G . Kehr, G. Erker, R. Froelich and 0. Meyer, Organometallics, 1999, 18, 1724. 243 0. Desponds, C. Huynh and M. Schlosser, Synthesis, 1998,983. 244 S. V. Mitrofanov and V. A. Yablokov, Russ. J. Gen. Chern., 1997,67, 1864. 245 R. L. Wells, E. E. Foos, A. L. Rheingold, G. P. A. Yap, L. M. Liable-Sands and P. S. White, Organometallics, 1998, 17,2869. 246 R. J. Wehmschulte and P. P. Power, New J. Chem., 1998,22, 1125. 247 M. Sigl, A. Schier and H. Schmidbaur, 2. Naturforsch., B: Chem. Sci., 1998, 53, 1301. 248 Y . Watanabe, N. Mase, M. Tateyama and T. Toru, Tetrahedron:Asymmetry, 1999, 10, 737. 249 M. D. Eager and J. H. Espenson, Inorg. Chem., 1999,38,2533. 218

I : Phosphines and Phosphonium Salts 250 25 1 252 253 254 255 256 257 258 259 260 26 1 262 263 264 265 266 267 268 269 270 27 1 272 273 274 275 276 277 278 279 280 28 1

51

J. Jacob and J. H. Espenson, Chem. Commun., 1999, 1003. J. T. Ayers and S. R. Anderson, Synth. Commun., 1999,29, 35 1. C. W. Rees, 0. A. Rakitin, C. F. Marcos and T. Torroba, J. Org. Chem., 1999, 64,4376. I. A. Abu-Yousef and D. N. Harpp, J. Org. Chem., 1998,63,8654. K. B. Capps, B. Wixmerten, A. Bauer and C. D. Hoff, Inorg. Chem., 1998, 37, 2861. S. Siaka, P. M. Lukin, 0. E. Nasakin, V. N. Nesterov, M. Yu. Antipin and V. N. Khrustalev, Russ. J. Org. Chem., 1998,34, 1014. P. Molina, A. Arques, A. Garcia and M. C. Ramirez de Arellano, Eur. J. Inorg. Chem., 1998, 1359. M. Alajarin, A. Vidal, C. Lopez-Leonardo, J. Berna and M. C. Ramirez de Arellano, Tetrahedron Lett., 1998,39,7807. M. Alajarin, A. Lopez-Lazaro, A. Vidal and J. Berna, Chem.-Eur. J., 1998, 4, 2558. 2. Ariza, F. Urpi, C. Viladormat and J. Vilarrasa, Tetrahedron Lett., 1998, 39, 9101. A. O’Neil, S. Thompson, C. L. Murray and S. B. Kalindjian, Tetrahedron Lett., 1998,39,7787. S. It0 and T. Tsunoda, Pure Appl. Chem., 1999,71, 1053. A. R. Tunoori, D. Dutta and G. I. Georg, Tetrahedron Lett., 1998,39,8751. M. Kiankarimi, R. Lowe, J. R. McCarthy and J. P. Whitten, Tetrahedron Lett., 1999,40,4497. G. W. Starkey, J. J. Parlow and D. L. Flynn, Bioorg. Med. Chem. Lett., 1998, 8, 2385. Sammakia and J. S. Jacobs, Tetrahedron Lett., 1999,40,2685. F. Berree, G. Michelot and M. Le Corre, Tetrahedron Lett., 1998,39, 8275. J. R. Falck, J-Y. Lai, S-D. Cho and J. Yu, Tetrahedron Lett., 1999,40,2903. G . Dewynter, S. Ubaldi, N. Voyer and L. Toupet, Tetrahedron Lett., 1998, 39, 7435. A. M. Barber, I. R. Hardcastle, M. G. Rowlands, B. P. Nutley, J. H. Marriott and M. Jarman, Bioorg. Med. Chem. Lett., 1999,9,623. M. J. Horvath, D. Saylik, P. S. Elmes, W. R. Jackson, C. G. Lovel and K. Moody, Tetrahedron Lett., 1999,40, 363. D. Saylik, M. J. Horvath, P. S. Elmes, W. R. Jackson, C. G. Lovel and K. Moody, J. Org. Chem., 1999,64,3940. H. Kim and M-H. Cha, Tetrahedron Lett., 1999,40, 3125. L. S. Jeong, S. J. Yoo, H. R. Moon, Y. H. Kim and M. W. Chun, J. Chem. SOC., Perkin Trans. I , 1998, 3325. S. A. Weissman, S. Lewis, D. Askin, R. P. Volante and P. J. Reider, Tetrahedron Lett., 1998, 39, 7459. A. M . Aronov and M. H. Gelb, Tetrahedron Lett., 1998,39,4947. D. Camp, G . R. Hanson and I. D. Jenkins, J. Org. Chem., 1995,60,2477. L. Eberson, 0. Persson and J. 0. Svensson, Acta Chem. Scund., 1998,52, 1293. 0. Mo, M. Yanez, M. Decouzon, J-F. Gal, P-C. Maria and J-C. Guillemin, J. Am. Chem. Soc., 1999,121,4653. I. E. Boldeskul, J. Mol. Struct., 1998,448, 17 1 . M. Decouzon, J. F. Gal, J. C. Guillemin and P. C. Maria, Int. J. Mass Spectrom. Ion Processes, 1998, 175, 27. M. Yanez, J. Phys. Org. Chem., 1998, 11,678.

52 282 283 284 285 286 287 288 289 290 29 1 292 293 294 295 296 297 298 299 300 30 1 302 303 304 305 306 307 308 309 310

Organophosphorus Chemistry

H. Maeda and H . Ohmori, Acc. Chem. Res., 1999,32,72. H. Ohmori and H. Maeda, New Challenges Org. Electrochem., 1998, 143. H. Maeda, S. Matsumoto, T. Koide and H. Ohmori, Chem. Pharm. Bull., 1998, 46, 939. S. Yasui, K. Shioji, M. Tsujimoto and A. Ohno, J . Chem. Soc., Perkin Trans. 2 , 1999,855. W. M. Abdou, Y. 0. Elkhoshneih and A. A. Kamel, Phosphorus, Suljiur, Silicon, Relat. Elem., 1997, 126, 75. S. Goumri-Magnet, H. Gornitzka, A. Baceiredo and G . Bertrand, Angew. Chem., Int. Ed. Engl., 1999, 38, 678. J . Ruiz, V. Riera, M. Vivanco, M. Lanfranchi and A. Tiripicchio, Organometallics, 1998, 17, 3835. M. Petrucci-Samija, V. Guillemette, M. Dasgupta and A. K. Kakkar, J. Am. Chem. Soc., 1999,121, 1968. S. Pagano, A. Mutch, F. Lefebvre and J-M. Basset, J. Mol. Catal. A : Chem., 1998, 133, 61. F. W. Heinemann, S. Kummer, U. Seiss-Brand1 and U. Zenneck, Organometallics, 1999, 18, 2021. R. Choukroun, Y. Miquel. B. Donnadieu, A. Igau, C. Blandy and J. P. Majoral, Organometallics, 1999, 18, 1795. J. Andrieu, J. Dietz, R. Pot and P. Richard, New J. Chem., 1999, 23, 581. K. Nakajima, S. Ishibashi and M. Kojima, Chem. Lett., 1998,997. P. Schober, R. Soltek, G. Huttner, L. Zsolnai and K. Heinze, Eur. J. Inorg. Chem.,1998, 1407. R . Soltek and G. Huttner, Eur. J. Inorg. Chem., 1998, 1417. E. Monflier, S. Tilloy, C . Meliet, A. Mortreux, S. Fourmentin, D. Landy and G. Surpateanu, New J. Chem., 1999,23,461. M. S. Goedheijt, P. C . J. Kamer and P. W. N. M. van Leeuwen, J. Mol. Catal. A: Chem., 1998, 134,243. G . Papadogiankis and R. A. Sheldon, Aqueous-Phase Organornet. Chem., 1998, 123. V. V. Dunina, L. G. Kuzmina, M. Yu. Rubina, Yu. K. Grishin, Yu. A. Veits and E. I. Kazakova, Tetrahedron:Asymmetry, 1999,10, 1483. D. H. R. Barton, E. Doris and F. Taran, J. Labelled Compd. Radiopharm., 1998, 41, 871. H. Kagoshima, Y. Hashimoto and K. Saigo, Tetrahedron Lett., 1998,39,8465. V. V. Grushin, J. Am. Chem. SOC.,1999, 121, 5831. M . Stradiotto, C. M. Kozak and M. J. McGlinchey, J. Organomet. Chem., 1998, 564, 101. V. Plack and R. Schmutzler, 2. Anorg. Allg. Chem., 1999, 625,497. Y. Hamashima, D. Sawada, M. Kanai and M. Shibasaki, J. Am. Chem. SOC., 1999,121,2641. A. M. Maj, K. M. Petrusiewicz, I . Suisse, F. Agbossou and A. Mortreux, Tetrahe~ron:Asymmetry,1999, 10,831 . K . Yamakoshi, S. J. Harwood, M. Kanai and M. Shibasaki, Tetruhedron Lett., 1999,40,2565. H. Groger, J . Martens, J . R. Goerlich and R. Schmutzler, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 128, 153. N . I . tvanova, N . K. Gusarova, S. F. Malysheva, N . A. Belogorlova, 0. B. Kozyreva, T. Scotcheim and B. A. Trofimov, Russ. J. Org. Chem., 1998,34,902.

I : Phosphines and Phosphonium Salts 31 1

312

313 314

315 316 317 318 319 320

32 1 322 323 324 325 326 327 328 329 330 33 1 332 333 334 335 336 337 338 339 340 34 1 342

53

S. F. Malysheva, N. K. Gusarova, N. A. Belogorlova and B. A. Trofimov, Sulfur Lett., 1998, 21, 263. V. M. Dem’yanovich, I. N. Shishkina, K. A. Potekhin, E. V. Balashova, Yu. T. Struchkov and N. S . Zefirov, Dokl. Akad. Nauk, 1998, 360, 645 (Chem. Abstr., 1998,129,290 171). M. Gray, B. J. Chapell, J. Felding, N. J. Taylor and V. Snieckus, Synlett, 1998,422. S . Varbanov, T. Tosheva and E. Russeva, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 127,27. G. L. Matevosyan and P. M. Zavlin, Russ. J. Gen. Chem., 1998,68, 1467. L. F. Rozhko, V. V. Ragulin and E. N. Tsvetkov, Russ. J. Gen. Chem., 1997, 67, 1861. C-G. Cho and G.H. Posner, Bull. Korean Chem. SOC.,1998,19,957. S-H. Wu, W-Q. Sun, D-W. Zhang, L-H. Shu, H-M. Wu, J-F. Xu and X-F. Lao, Tetrahedron Lett., 1998,39, 9233. C. Wieser-Jeunesse, D. Matt, M. R. Yaftian, M. Burgard and J. M. Harrowfield, C. R. Acad. Sci., Ser. Ilc: Chim., 1998, 1, 479. L. H. Delmau, N. Simon, M.-J. Schwing-Weill, F. Arnaud-Neu, J-F. Dozol, S. Eymard, B. Tournois, V. Bohmer, C. Gruttner, C. Musigmann and A. Tunayar, Chem. Commun., 1998, 1627. F. Arnaud-Neu, J. K. Browne, D. Byrne, D. J. Marrs, M. A. McKervey, P. O’Hagan, M. J. Schwing-Weill and A. Walker, Chem.-Eur. J., 1999,5, 175. M-L. Lartigue, A-M. Caminade and J. P. Majoral, Phosphorus, Sulfur, Silicon Relat. Elem., 1997, 123, 2 1 . D. A. Babb, H. W. Boone, D. W. Smith and P. W. Rudolf, J. Appl. Polym. Sci., 1998,69,2005. L. Rosescu, F. Popesku and 0. Petreus, Angew Mukromol. Chem., 1998,257,7. Y . Zhang, J. C. Tebby and J. W. Wheeler, Eur. Polym. J., 1999,35,209. M-D. Sha and T-S. Wang, J. Appl. Polym. Sci., 1998,68, 1397. L. A. Wozniak and W. J. Stec, Tetrahedron Lett., 1999,40,2637. S . Demay, K. Harms and P. Knochel, Tetrahedron Lett., 1999,40,4981 . Y-M. Wang, H-P. Zhang, F. Wei, J-L. Li, L. Wang and J-B. Meng, Youji Huaxue, 1998, 18, 119, (Chem Abstr., 1998, 129,41187). H. J. Cristau and D. Virieux, Tetrahedron Lett., 1999,40,703. M. Sugiya and H. Nohira, Chem. Lett., 1998,479. P. Desmazeau, J-Y. Legros and J-C. Fiaud, Tetrahedron Lett., 1998,39, 6707. G. Keglevich, H. T. T. Thanh, A. Szollosy, K. Ujszaszy and L. Toke, J. Chem. SOC.,Perkin Trans. I , 1998, 3323. M . Takeda, T. Yoshimura, T. Fujii, S. Ono, C. Shimasaki and H. Morita, Tetruhedron Lett., 1999.40, 2327. F. Robin, F. Mercier, L. Ricard and F. Mathey, Eur. J. Org. Chem., 1999, 1091. K . Afarinkia, H. M. Binch and C. Modi, Tetrahedron Lett., 1998, 39,7419. M. Ansorge, K. Polborn and T. J. J. Muller, Eur. J. Inorg. Chem., 1999, 225. F. Palacios, D. Aparicio, J. Garcia and E. Rodriguez, Eur. J. Org. Chem., 1998, 1413. X-Y. Lu and S-M. Ma, Chin. J. Chem., 1998,16,388. J. Clayden and S . Warren, J. Chem. Soc., Perkin Trans. I , 1998, 2923. C. Gueguen, P. O’Brien, H. R. Powell, P. R. Raithby and S . Warren, J. Chem. Soc.., Perkin Trans. I , 1998, 3405. D. R . Armstrong, R. P Davies, L. Dunbar, P. R. Raithby, R. Snaith and A. E. H. Wheatley, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 124-125, 5 I .

54 343 344 345 346 347 348 349 350 35 1 352

353

354

355

356 357 358 359 360 361 362 363 364 365 366 367 368 369

370

Organophosphorus Chemistry A. R. Katritzky, M. Piffl, H. Lang and E. Anders, Chem. Rev., 1999,99,665. Y . Mizuta, N. Morishita and K. Kuwata, Chem. Lett., 1999, 3 1 1 . S. Jockusch and N. J. Turro, J. Am. Chem. Soc., 1998,120, 11773. E. D. Gunersel, Y. Hepuzer and Y. Yagci, Angzw. Mukromol. Chem., 1999,264, 88. G. Smith, D. E. Lynch, C. H. L Kennard and K. A. Byriel, Aust. J. Chem., 1998, 51,437. R. V. Batt, D. P. Bullivant, K. E. Elkington, S. E. Hill, J. Hilton, T. J. Houghton, M. Hovel1 and S. C. Wallwork, Polyhedron, 1998, 17,2173. C. M. Lagier, A. C. Olivieri and R. K. Harris, J. Chem. Soc., Perkin Trans. 2 , 1998, 1791. R-H. Lee, G. H. Hsiue and R-J. Jeng, Polymer, 1999,40, 13. I. Alkorta and J. Elguero, J. Phys. Chem. A, 1999,103,272. D. I. Lobanov, I. M. Aladzheva, 0. V. Bykhovskaya, P. V. Petrovskii, K. A. Lyssenko, M. Yu. Antipin, T. A. Mastryukova and M. I. Kabachnik, fhosphorus, Sulfur, Silicon, Relut. Elem., 1997, 128, 165. 1. M. Aladzheva, I. V. Leont’eva, D. I. Lobanov, 0. V. Bykhovskaya, P. V. Petrovskii, K. A. Lysenko, T. A. Mastryukova and M. I. Kabachnik, Russ. J . Gen. Chem., 1998,68, 1352. I. M. Aladzheva, 0. V. Bykhovskaya, D. I. Lobanov, P. V. Petrovskii, K. A. Lysenko, M. Yu. Antipin, T. A. Mastryukova and M. I. Kabachnik, Russ. J. Gen. Chem., 1998,68, 1356. N . M. Vinogradova, I. L. Odinets, 0. I. Artyushin, P. V. Petrovskii, K. A. Lysenko, M. Yu. Antipin and T. A. Mastryukova, Russ. J. Gen. Chem., 1998,68, 1368. S . M. Godfrey, S. L. Jackson, C. A. McAuliffe and R. G. Pritchard, J. Chem. Soc., Dalton Trans., 1998,420 1 . T. Gramstad, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 123,241 . D. 0. Jang, D. H. Cho and J. Kim, Synth. Commun., 1998,28, 3559. H. Boerrigter, T. Tomasberger, W. Verboom and D. N. Reinhoudt, Eur. J. Org. Chew., 1999,665. J. Fawcett, A. W. G . Platt and D. R. Russell, Inorg. Chim. Acta, 1998,274, 177. F. Berny, N. Muzet, L. Troxler, A. Dedieu and G. Wipff, Inorg. Chem., 1999,38, 1244. W. Czada and U. Miiller, 2. Kristal1ogr.-New Cryst. Struct., 1999,214, 65. A. Wirth, 0. Moers, A. Blaschette and P. G. Jones, 2. Anorg. Allg. Chem., 1999, 625, 982. R. Selvaraju, K. Panchanathewsaran and V. Parthasarathi, Acta Crystallogr., Sect. C: Cryst. Struct. Commun., 1998, C54,905. N . Trendafilova, G. Bauer, I. Georgieva, S. Varbanov and E. Tashev, Spectrochim. Acta, 1998, MA, 477. D. Hudecova, 1. Ondrejkovicova, V. Vancova, J. Augustin and M. Melnik, Chem. Pap., 1998,52, 123. M. Hayashi, H. Takezaki, Y. Hashimoto, K. Takaoki and K. Saigo, Tetrahedron Lett., 1998, 39, 7529. P. J. Heard and A. E. Aliev, Polyhedron, 1998, 17, 3981. E. 1. Matrosov, Z. I. Starikova, A. I . Yanovsky, D. I. Loban, 1. M. Aladzheva, 0. V. Bykhovskaya, T. A. Mastryukova and M. I. Kabachnik, Russ. Chem. Bull., I998,47, 1702. J. Connolly, A. R. Genge, S. J . A. Pope and G. Reid, Polyhedron, 1998, 17,2331.

I : Phosphines and Phosphonium Salts

55

D. Cauzzi, C. Graiff, M. Lanfranchi, G . Predieri and A. Tiripichio, Inorg. Chim. Acta, 1998,273, 320. 372 D. B. Chesnut and A. Savin, J. Am. Chem. SOC.,1999,121,2335. 373 D. B. Chesnut, J. Am. Chem. Soc., 1998,120, 10504. 374 I . I. Patsanovskii, V. E. Kataev, E. A. Ishmaeva and A. V. Kataev, Russ. J. Gen. Chem., 1997,67,1559. 375 V. E. Kataev, E. A. Ishmaeva, I. I. Patsanovskii, A. V. Kataev, W. Wieczorek, E. G. Yarkova, K. Zygo and K. M. Petrusevich, Rum. J. Gen. Chem., 1998, 68, 1721. 376 G. C. Kresheck, J. Am. Chem. Soc., 1998,120, 10964. 377 F. Care, M. Chauhan, C. Chuit, R. J. P. Corriu and C. Reye, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 123, 181. 378 M. G. Russell and S. Warren, Tetrahedron Lett., 1998,39,7995. 379 S. J. Rowan, S. J. Cantrill and J . F. Stoddart, Org. Lett., 1999, I, 129. 380 P. Leglaye, B. Donnadieu, J-J. Brunet and R. Chauvin, Tetrahedron Lett., 1998, 39, 91 79. 38 1 A. Maestro, J. M. Banez, J. A. Lopez and M. C. Romero-Avila, Synthesis, 1998, 1 104. 382 S. F. Malysheva, E. E. Kuznetsova, N. A. Belogorlova, G. V. Kozlova, T. N. Rakhmatulina, M. L. Al’pert, N. K. Gusarova, B. A. Trofimov and N. S. Zefirov, Khim.-Farm. Zh., 1998 32, 24. 383 E-R. Kenawy, Des. Monomers Polym., 1998, I , 15. 384 E-R. Kenawy, J. Macromol. Sci., Pure Appl. Chem., 1998, A35,657. 385 V. Shevchenko and R. Engel, Heteroat. Chem., 1998,9,495. 386 A. S. Romakhin, F. M. Palyutin, V. A. Zagumennov and E. V. Nikitin, Russ. J. Gen. Chem., 1997,67, 1424. 387 K. Manabe, Tetrahedron Lett., 1998,39, 5807. 388 K. Manabe, Tetrahedron, 1998,54, 14465. 389 T. Hanamoto, Y. Kiguchi, K. Shindo, M. Matsuoka and M. Kondo, Chem. Commun., 1999, 151. 390 E. Anders, A. Opitz, K. Wermann, B. Wiedel, M. Walther, W. Imhof and H. Goerls, J. Org. Chem., 1999,64, 3 1 13. 39 1 F. Breitsameter, H-P. Schrodel and A. Schmidpeter, Heteroat. Chem., 1998, 9, 433. 392 V. I . Galkin, Yu. V. Bakhtiyarova, N. A. Polezhaeva, R. A. Shaikhutdinov, V. V. Klochkov and R. A. Cherkasov, Russ. J. Gen. Chem., 1998,68, 1052. 393 D. Albouy, A. Brun, A. Munoz and G . Etemad-Moghadam, J. Org. Chem., 1998,63,7223. 394 S. Harder, Chem.-Eur. J., 1999, 5, 1852. 395 P. Banerjee and A. M. Mayes, Macromolecules, 1998,31,7966. 396 T. Sugimoto, K. Ueda, S. Endo, N. Toyota, T. Tada, K. Nishimura, M. Kohama, K. Shiwaku, K. Yamamoto, T. Yamaguchi, Y. Suenega and M. Munakata, Chern. Phys. Lett., 1998,288, 767. 397 H. Firouzabadi and M. Adibi, Phosphorus, Sulfur, Silicon, Relat. Elem., 1998, 142, 125. 398 I . Mohammadpoor-Baltork, A. R. Hajipour and H. Mohammadi, Bull. Chem. Soc. Jpn., 1998,71, 1649. 399 I . Mohammadpoor-Baltork, A. R. Hajipoor and R. Haddadi, J. Chem. Res., ( S ) , 1999, 102. 400 H . Gruber and U. Miiller, Z. Kristallogr. New Cryst. Struct., 1998, 213, 546.

37 1

56

40 1 402 403 404 405 406 407 408 409 410 41 1 412 41 3 414 41 5 416 417 418 419 420 42 1 422 423 424 425 426 427 428 429 430 43 1 432 43 3 434 435

Organophosphorus Chemistry W. Czado, S. Rabe and U Miiller, Z. Naturforsch., B: Chem. Sci., 1999,54,288. J. Grebe, G . Geiseler, K. Harms and K. Dehnicke, Z . Naturforsch., B: Chem. Sci., 1999, 54, 140. H. Rijnberk, C.Naether and W. Bensch, Z. KrLtallogr. -New Cryst. Struct., 1998, 213, 588. H . Rijnberk, C. Nather, M. Schur, I . Jess and W. Bensch, A m Crystallogr., Sect. C: Cryst. Struct. Commim., 1998, C54, 920. A. E. Pullen, C. Faulmann, H-L. Liu, D. B. Tanner, K. A. Abboud and J . R. Reynolds, Inorg. Chim. Acta, 1998,282,90. R. Hehl and G. Thiele, 2. Anorg. Allg. Chem., 1998,624, 1736. U . Patnaik and J. Muralidhar, J. Therm. Anal. Calorim., 1998,53, 817. S. Rabe and U Miiller, Z . Kristallogr. New Cryst. Struct., 1999,214, 277. V. V. Zhdankin, J. A. C a l k s , K. J. Hanson and J . Bruno, Tetrahedron Lett., 1999,40, 1839. V. B. Kobychev, W. M. Vitkovskaya, B. V. Timokhin and A. I. Golubin, Russ. J. Gen. Chem., 1997,67, 1208. J. Grunefeld, W. Kliegel, S. J. Rettig and J. Trotter, Can. J. Chem., 1999,77,439. H. Maeda, K. Takahashi and H. Ohmori, Tetrahedron, 1998,54, 12 233. V. S. Brovarets, Russ. J. Gen. Chem., 1998,68, 156. V. S. Brovarets, Russ. J. Gen. Chem., 1998,68, 154. 0. B. Smolii, S. Y. Panchishin, L. Van. Meerwelt, N. I. Mishchenko, E. A. Romanenko and B. S. Drach, Russ. J. Gen. Chem., 1998,68, 548. S. Datsenko, N. Ignat’ev, P. Barthen, H-J. Frohn, T. Scholten, T . Schroer and D. Welting, 2. Anorg. Allg. Chem., 1998,624, 1669. K . Makita, F. Ando, Y. Ninomiya and J. Koketsu, Nippon Kagaku Kaishi, 1998, 470, (Chem. Abstr., 1998, 129, 175 719). J-P. Cheng, B. Liu, Y. Zhao and X-M. Zhang, J. Org. Chem., 1998,63,7072. J-P. Cheng, B. Liu, Y. Zhao, X-M. Zhang and Y. Lu, J. Org. Chem., 1999, 64, 604. R . A. Khachatryan, S. A. Zalinyan, A. S. Pogasyan, M. Zh. Ovakimyan and M. G . Indzhikyan, Russ. J. Cen. Chem., 1998,68, 361. N . Donoghue and M. J. Gallagher, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997,123, 169. N. Donoghue and M. J. Gallagher, Chem. Commun., 1998,1973. C. Ginglinger, D. Jeannerat, J. Lacour, S. Juge and J. Uziel, Tetruhedron Lett., 1998,39,7495. M . Scudder and I. Dance, J. Chem. Soc., Dalton Trans., 1998, 3155. M. Scudder and I. Dance, J. Chem. Soc., Dulton Trans., 1998, 3 167 A. P. Lyon, N. J. Banton and D. H. Macartney, Cun. J. Chem., 1998,76,843. R. S. Varma and K. P. Naicker, Tetrahedron Lett., 1999,40,439. R. S. Varma, K. P. Naicker and P. J. Liesen, Tetrahedron Lett., 1999,40, 2075. J. Oberbrodhage, J. Electron Spectrosc. Relat. Phenom., 1998,95, 171. A. Onen, N . Arsu and Y. Yagci, Angew. Mnkromol. Chem., 1999,264,56. Y-S. Hon and C-F. Lee, Tetrahedron Lett., 1999,40,2389. N. Karodia, S. Guise, C. Newlands and J-A. Andersen, Chem. Commun., 1998, 234 1 . Y . Shen, Acc. Chem. Res., 1998,31, 584. 0. Kim and M-S. Gong, Polymer (Korea), 1998,22,446. K . B. Dillon, F. Mathey and J. F. Nixon, Phosphorus: The Carbon Copy: From organophosphorus to Phosphu-organic Chemistry, Wiley, UK, 1998.

I : Phosphines and Phosphonium Salts

57

P.P. Power, J. Chem. SOC., Dalton Trans., 1998,2939. M. Yoshifuji, J. Chem. Soc., Dalton Trans., 1998, 3343. M. Yoshifuji, Pure Appl. Chem., 1999,71, 503. M. Regitz and U. Bergstrasser, Pol. J. Chem., 1999,73, 135. B. Twamley and P. P. Power, Chem. Commun., 1998, 1979. B. Twdmley, C. D. Sofield, M. M. Olmstead and P. P. Power, J. Am. Chem. Soc., 1999,121,3357. 442 K. Tsuji, S. Sasaki and M. Yoshifuji, Tetrahedron Lett., 1999,3203. 443 H-P. Schrodel and A. Schmidpeter, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 129,69. 444 G. Pfister-Guillouzo, A. Chrostowska, J. M. Sotiropoulos and V. D. Romaneko, Eur. J. Inorg. Chem., 1998, 1821. 445 J. Grobe, D. Le Van, T. Pohlmeyer, B. Krebs, 0. Conrad, E. Dobbert and L. Weber, Organometallics, 1998, 17, 3383. 446 H. Krautscheid, E. Matern, G . Fritz and J. Pikies, Z. Anorg. Allg. Chem., 1999, 625, 107. 447 S. Shah and J. D. Protasiewicz, Chem. Commun., 1998, 1585. 448 C . Moschel and M. Jansen, 2. Anorg. Allg. Chem., 1999,625, 175. 449 S. Sasaki, F. Murakami and M. Yoshifuji, Angew. Chem., Int. Ed. Engl., 1999, 38, 340. 450 M. van der Sluis, V. Beverwijk, A. Termaten, F. Bickelhaupt, H. Kooijman and A. L. Spek, Organometallics, 1999, 18, 1402. 45 1 A. Mack, U. Bergstriisser, G. J. Reiss and M. Regitz, Eur. J. Org. Chem., 1999, 587. 452 L. Weber, S. Uthmann, H. Boegge, A. Mueller, H-G. Stammler and B. Neumann, Organometallics, 1998, 17, 3593. 453 J. Mahnke, A. Zanin, W-W. du Mont, F. Ruthe and P. G. Jones, 2.Anorg. Allg. Chem., 1998,624, 1447. 454 A. D. Averin, P. Mukhaiimana, N. V. Lukashev, A. A. Borisenko, M. A. Kazankova and I. P. Beletskaya, Russ. J. Gen. Chem., 1998, 68, 1383. 455 S. Ito and M. Yoshifuji, Chem. Lett., 1998, 651. 456 M. Yoshifuji, N. Yamada, A. Maack and K. Toyota, Tetrahedron Lett., 1998,39, 948 1. 457 I. Pailhous, H. Ranaivonjatovo, J. Escudie, J-P. Declercq and A. Dubourg, Organometallics, 1999, 18, 1622. 458 M. Schmitz, S. Leininger, U. Bergstriker and M. Regitz, Heteroat. Chem., 1999, 9, 453. 459 B. V. Prasad, G. Grover, P. Uppal and D. Kaur, THEOCHEM, 1999,458,227. 460 W. W. Schoeller, U. Tubbesing and A. B. Rozhenko, Eur. J. Inorg. Chem., 1998, 951. 46 1 C . Widauer, G. S. Chen and H. Grutzmacher, Chem.-Eur. J., 1998,4, 1154. 462 L. Rigon, H. Ranaivonjatovo, J. Escudie, A. Dubourg and J-P. Declercq, Chem.Eur. J., 1999, 5, 774. 463 M. Chentit, H. Sidorenkova, M. Geoffroy and Y. Ellinger, J. Phys. Chem. A , 1998,102, 10469. 464 A. Alberti, M. Benaglia, M. D’Angelantonio, S. S. Emmi, M. Guerra, A. Hudson, D. Macciantelli, F. Paolucci and S. Roffia, J. Chem. Soc., Perkin Truns. 2, 1999, 309. 465 D. Lange, E. Klein, H. Bender, E. Niecke, M. Nieger, R. Pietschnig and W. W. Schoeller, Organometallics, 1998, 17, 2425. 436 437 438 439 440 441

58

Organophosphorus Chemistry

A. Mack, E. Pierron, T. Allspach, U. Bergstrisser and M. Regitz, Synthesis, 1998, 1305. 467 W. Fiedler, 0. Lober, U. Bergstrasser and M. Regitz, Eur. J. Org. Chem., 1999, 363. 468 M. A. Hofmann, A. Nachbauer, U. Bergstriker and M. Regitz, Eur. J. Org. Chem., 1999, 1041. 469 0. Lober, U. Bergstrisser and M. Regitz, Synthesis, 1999, 644. 470 M. D. Francis, C. Jones, P. C. Junk and J. L. Roberts, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 130, 23. 47 1 D. A. Loy, G . M. Jamison, M. D. McClain and T. M. Alam, J. Polym. Sci., Part A: Polym. Chem., 1999,37, 129. 472 M. F. Meidine, M. Amelia, N. D. A. Lemos, A. J. L. Pombeiro, J. F. Nixon and P. B. Hitchcock, J. Chem. Soc., Dalton Trans., 1998,3319. 473 A. F. Hill, C. Jones and J. D. E. T. Wilton-Ely, Chem. Commun., 1999,451. 474 S. E. d’Arbeloff, P. B. Hitchcock, J. F. Nixon, T. Nagasawa, H. Kawaguchi and K. Tatsumi, J. Organomet. Chem., 1998,564, 189. 475 F. G . N. Cloke, P. B. Hitchcock, J. F. Nixon, D. F. Wilson and P. Mountford, Chem. Comrnun., 1999,661 . 476 P. Binger, S. Stutzmann, J. Stannek, K. Gunther, P. Phillips, R. Mynott, J. Bruckmann and C. Kruger, Eur. J. Inorg. Chem., 1999,763. 477 M. Nowotny, B. F. G . Johnson, J. F. Nixon and S. Parsons, Chem. Commun., 1998,2223. 478 A. Hoffmann, A. Mack, R. Goddard, P. Binger and M. Regitz, Eur. J. Inorg. Chem., 1998, 1597. 479 A. Mack, U. Bergstrisser and M. Regitz, Synthesis, 1999,639. 480 I. K. Ahmad, H. Ozeki, S. Saito and P. Botschwina, J. Chem. Phys., 1998, 109, 4252. 48 1 F. M. Bickelhaupt and F. Bickelhaupt, Chem.-Eur. J., 1999,5, 162. 482 W. V. Konze, V. G. Young and R. J. Angelici, Organometallics, 1999, 18,258. 483 K. Hubler and P. Schwerdtfeger, Inorg., Chem., 1999,38, 157. 484 R. J. Boyd, N. Burford and C. L. B. Macdonald, Organometallics, 1998, 17,4014. 485 D. Gudat, Eur. J. Inorg. Chem., 1998, 1087. 486 M. K. Denk, S. Gupta and A. J. Lough, Eur. J. Inorg. Chem., 1999,41. 487 J-M. Brunel, R. Villard and G . Buono, Tetrahedron Lett., 1999,40,4669. 488 S. E. Pipko, Yu. V. Balitskii, A. N. Chernega and A. D. Sinitsa, Russ. J. Cen. Chem., 1998,68,530. 489 M. Soleilhavoup, 0. Guerret, J-L. Faure, A. Baceiredo and G . Bertrdnd, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 123, 1 6 1 . 490 S. Gevrey, M-H. Taphanel and J-P. Morizur, J . Mass Spectrom., 1998,33, 399. 49 1 J-P. Majoral and A. Igau, Coord. Chem .Rev., 1998,176, 1 . 492 W. Malisch, U-A. Hirth, K. Grun and M. Schmeusser, J. Organomet. Chem., 1999,572,207. 493 W. Malisch, K. Grun, A. Fried, W. Reich, M. Schmeusser, U. Weis, C. A. El Baky and C. Kruger, 2. Nuturfursch., B:Chem. Sci., 1998,53, 1506. 494 W. Malisch, K. Grun, A. Fried, W. Reich, H . Pfister, G . Huttner and L. Zsolnai, J. Organomet. Chem., 1998,566,271. 495 H-U. Reisacher, E. N . Duesler and R. T. Paine, J. Orgunomel. Chem., 1998, 564, 13. 496 C-J. Zhang and C-G. Zhan, Phosphorus, Sulfur, Silicon, Rekit. Elem., 1997, 126, 89. 466

I : Phosphines and Phosphonium Salts 497 498 499 500 50 1 502 503 504 505 506 507 508 509

510 51 1

512 513 514 515 516 51 7 518 519 520 52 1 522 523 524 525 526 527 528 529 530 53 1

59

A. H. Cowley, Pure Appl. Chem., 1998,70,765. G. Frison, F. Mathey and A. Sevin, J. Organornet. Chem., 1998,570,225. D. Fenske, F. Simon and A. Eichhofer, Bull. Pol. Acad Sci. Chem., 1998,46,221. N. H. T. Huy, L. Ricard and F. Mathey, J. Orgunomet. Chem., 1999,582,53. N. H. T. Huy, L. Ricard and F. Mathey, Heteroat. Chem., 1998,9,597. K. Tsuji, S. Sasaki and M. Yoshifuji, Heteroat. Chem., 1998,9,607. M. R. St.J. Foreman, A. M. Z. Slawin and J. D. Woollins, J. Chem. Soc,, Dalton. Trans., 1999, 1175. E. V. Popova, E. A. Ishmaeva, I. I. Pdtsanovskii, Y. Y. Efremov and I. Kh. Rizvanov, Russ. J. Gen. Chem., 1998,68, 240. C. D. Cox and M. J. P. Harger, J. Chem. Res., 1998, 578. M. J. P. Harger and D. K. Jones, Chem. Commun., 1999,339. M. J. Harger, Chem. Commun., 1998,2339. M. J. Harger and C. Pater, Chem. Commun., 1999,93 1 . L. Nyulaszi, D. Szieberth, J. Reffy and T. Veszpremi, THEOCHEM, 1998, 453, 91. T. I. Sslling, M. A. McDonald, S. B. Wild and L. Radom, J. Am. Chem. SOC., 1998,120,7063. T. 1. Sslling, S. B. Wild and L. Radom, J. Organomer. Chem., 1999,580, 320. L. Colombet, A. Sevin and P. Chaquin, Bull. SOC.Chim. Fr., 1997, 134, 1033. N. Mezdilles, N. Avarvari, D. Bourissou, F. Mathey and P. Le Floch, Organometallics, 1998, 17,2677. B. Wang, K. A. Nguyen, N. G. Srinivas, C. L. Watkins, S. Menzer, A. L. Spek and K. Lammertsma, Organometalfics, 1999, 18,796. M. Sanchez, R. Reau, C. J. Marsden, M. Regitz and G. Bertrand, Chem.-Eur. J., 1999,5,274. S . Haber, M. Schmitz, U. Bergstrisser, J. Hoffman and M. Regitz, Chem.-Eur. J., 1999, 5, 1581. R. Streubel, U. Rohde, J. Jeske, F. Ruthe and P. G . Jones, Eur. J. Inorg. Chem., 1998,2005. R. Streubel, H. Wilkens and P. G. Jones, Chem. Commun., 1998, 1761. R. Streubel, H. Wilkens, F. Ruthe and P. G. Jones, 2. Anorg. Allg. Chem., 1999, 625, 102. H. Wilken, F. Ruthe, P. G. Jones and R. Streubel, Chem. Commun., 1998, 1529. U. Rohde, F. Ruthe, P. G. Jones and R. Streubel, Angew. Chem. Int. Ed. Engl., 1999, 38, 215. H. Wilkens, F. Ruthe, P. G. Jones and R. Streubel, Chem.-Eur.J., 1998,4, 1542. C. Hay, D. Le Vilain, V. Deborde, L. Toupet and R. Reau, Chem. Commun., 1999,345. S. Bousquet, J-J. Brunet, T. Courcet and D. Neibecker, Phosphorus, Sulfur, Silicon, Relut. Elem., 1998, 142, 1 17. E. Deschamps and F. Mathey, C. R. Acud. Sci.,Ser Ilc: Chim., 1998, 1, 715. L. Nyulaszi, L. Soos and G. Keglevich, J. Organornet. Chem., 1998,566,29. L. Nyulaszi, U . Bergstrasser, M. Regitz and P. von R. Schleyer, New J. Chem., 1998,22, 65 1 . 0. Tissot, M . Gouygou, J-C. Daran and G . Balavoine, Acta Cryst. Sect. C: Cryst. Struct., Comrnun., 1998, C54, 676. P-H. Leung, A. Liu and K. F. Mok, Tetrahedron Asymmetry, 1999, 10, 1309. Y . Song, K . F. Mok, P-H. Leung and S-H. Chan, Inorg. Chem., 1998,37,6399. H . Lang, J. J. Vittal and P-H. Leung, J. Chem. Soc., Dulton Trans., 1998, 2109.

60 532

533 534 535 536

537 538 539 540 54 1 542 543 544 545 546 547 548 549 550 55 1 552

553 554 555

556 557 558 559 560 56 1 562

Organophosphorus Chemistry G. He, S-K. Loh, J. J. Vittal, K. F. Mok and P-H. Leung, Organometallics, 1998, 17,3931. Y . Song, J. J. Vittal, S-H. Chan and P-H. Leung, Organometallics, 1999, 18,650. P-H. Leung, H. Lang, A. J. P. White and D. J. Williams, Tetrahedr0n:Asymmetry, 1998,9,2961 . K. Maitra and J. H. Nelson, Bull, SOC. Chim. Fr., 1997,859. V. Mouries, F. Mercier, L. Ricard and F. Mathey, Eur. J. Org. Chern., 1998, 2683. S . Holand, N. Maigrot, C. Charrier and F. Mathey, Organometallics, 1998, 17, 2996. S. M. Al-Taweel, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997,130,203. C. Ganter, C. Glinsboeckel and B. Ganter, Eur. J. Inorg. Chem., 1998, 1163. L. Brassat, B. Ganter and C. Ganter, Chem. Eur. J., 1998,4,2148. X. Sava, N. Mezailles, L. Ricard, F. Mathey and P. Le Floch, Organometallics, 1999, 18, 807. N Maigrot, C . Charrier, L. Ricard and F. Mathey, Bull. SOC.Chim. Fr., 1997, 134,853. M. Westerhausen, M. H. Digeser, C. Gueckel, H. Noeth, J. Knizek and W. Ponikwar, Organometallics, 1999, 18,249 1 . A. Schnepf, G . Stosser, D. Carmichael, F. Mathey and H. Schnockel, Angew. Chem., Int. Ed. Engl., 1999,38, 1646. F. Nief, P. Riant, L. Ricard, P. Desmurs and D. Baudry-Barbier, Eur. J. Inorg. Chem., 1999, 1041. T. Kojima, K. Saeki, K. Ono and Y. Matsuda, Bull. Chem. SOC.Jpn., 1998, 71, 2885. Z. Csok, G . Keglevich, G . Petocz and L. Kollar, Inorg. Chem., 1999,38, 83 1 . B. Deschamps, L. Ricard and F. Mathey, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 123, 1 19. A. Dransfield, L. Nyulaszi and P. von R. Schleyer, Inorg. Chem., 1998,37,4413. V. Caliman, P. B. Hitchcock and J. F. Nixon, Chem. Commun., 1998, 1537. C. Callaghan, G. K. B. Clentsmith, F. G. N. Cloke, P. B. Hitchcock, J. F. Nixon and D. M. Vickers, Organometallics, 1999, 18, 793. F. Breitsameter, K. Polborn and A. Schmidpeter, Eur. J . Inorg. Chem., 1998, 1907. M. D. Francis, C. Jones and C. P. Morely, Tetrahedron Lett., 1999,40, 3815. M. D. Francis, D. E. Hibbs, P. B. Hitchcock, M. B. Hursthouse, C. Jones, T. Mackewitz, J. F. Nixon, L. Nyulaszi, M. Regitz and N. Sakarya, J. Organomet. Chem., 1999,580, 156. R. K. Bansal, N. Gupta, J. Heinicke, G. N. Nikonov, F. Saguitova and D. C. Sharma, Synthesis, 1999,264. R. K. Bansal, N. Gupta and A. Surana, J. Indian Chem. Soc., 1998,75, 648. N . Gupta, C. B. Jain, J. Heinicke, N. Bharatiya, R. K. Bansal and P. G. Jones, Heterout. Chem., 1998,9, 333. R. K. Bansal, A. Surana and N. Gupta, Tetrahedron Lett., 1999,40, 1565. N. Gupta, C. B. Jain, J. Heinicke, R. K. Bansal and P. G. Jones, Eur. J. Inorg. Chem., 1998, 1079. R. K. Bansal, N. Gupta, N . Bharatiya, G. Gupta, A. Surana, G. Hackenbracht and K. Karaghiosoff, Heteroat. Chem., 1998,9,445. M. B. Mikoluk and R. G. Cavell, Inorg. Chem., 1999,38, 1971. M. D. Mikoluk, R. McDonald and R. G. Cavell, Inorg. Chem., 1999,38,2791.

I : Phosphines and Phosphonium Salts 563 564 565 566 567 568 569 570 57 1 572 573 574 575 576 577 578 579

580 58 1 582

61

N. G. Khusainova, T. A. Zyablikkova, G . R. Reshetkova, E. A. Lamm and R. A. Cherkasov, Russ. J. Gen. Chem., 1998,68, 1411. A. A. Tolmachev, S. I. Dovgopoly, A. N. Kostyuk, 1. V. Komarov and A. M. Pinchuk, Phosphorus, Sulfur, Silicon, Relat. Elem., 1997, 123, 125. K. Polborn, A. Schmidpeter, G. MHrkl and A. Willhalm, Z. Naturforsch., B:Chem. Sci., 1999,54, 187. P. Le Floch and F. Mathey, Coord Chem. Rev.,1998,178-180 (Part l), 771. N. Avarvari, P. Rosa, F. Mathey and P. Le Floch, J. Organomet. Chew., 1998, 567, 151. P. Rose, N. Mezailles, F. Mathey and P. Le Floch, J. Org. Chem., 1998,63,4826. P. Rosa, L. Ricard, F. Mathey and P. Le Floch, Chem Commun., 1999,537. C . Elschenbroich, S. Voss and K. Harms, Z. Naturforsch., B:Chem. Sci., 1999, 54,209. P. Rosa, L. Ricard, P. Le Floch, F. Mathey, G. Sini and 0. Eisenstein, Inorg. Chem., 1998,37,3154. L. Colombet, F. Volatron, P. Maitre and P. C. Hiberty, J. Am. Chem. Soc., 1999, 121,4215. F. Tabellion, A. Nachbauer, S. Leininger, C. Peters, F. Preuss and M. Regitz, Angew. Chem., Int. Ed Engl., 1998,37, 1233. P. Binger, S. Stutzmann, J. Bruckmann, C. Kruger, J. Grobe, D. Le Van and T. Pohlmeyer. Eur. J. Inorg. Chem., 1998,2071. R. Gleiter, H. Lange, P. Binger, J. Stannek, C. Kriiger, J. Bruckmann, U. Zenneck and S. Kummer, Eur. J. Inorg. Chem., 1998, 1619. P. Binger, S. Stutzmann, J. Stannek, B. Gabor and R. Mynott, Eur. J. Inorg. Chem., 1999,83. G. Keglevich, K. Steinhauser, K. Ludanyi and L. Toke, J. Organomet. Chem., 1998,570,49. G . Keglevich, K. Steinhauser, G. M. Keseru, Z. Bocskei, K. Ujszaszy, G. Marosi, I. Ravadits and L. Toke, J. Organomet. Chem., 1999,579, 182. N. Avarvari, L. Ricard, F. Mathey, P. Le Floch, 0. Loeber and M. Regitz, Eur. J. Org. Chem., 1998,2039. G. Heckmann, S. Plank, H. Borrman and E. Fluck, Z. Anorg. Allg. Chem., 1998, 624, 11 16. H. Yamamoto, T. Kobayashi and M. Nitta, Heterocycles, 1998,48, 1903. G. Heckmann, E. Jones, E. Fluck and B. Neumuller, Z. Naturforsch., B: Chem. Sci., 1998,53,443.

2 Pentacoordinated and Hexacoordinated Compounds BY C.D. HALL

Introduction

1

This year saw the 70th birthday and retirement to the position of Professor Emeritus of Professor Robert Holmes distinguished for his outstanding contributions to hypervalent phosphorus and silicon chemistry and it is a pleasure to acknowledge the tribute paid to him by the dedication of the July (1998) issue of Heteroatom Chemistry to his work. * Another major contributor to phosphorus chemistry reached his seventieth birthday in 1999 and the seventh and eighth issues of Heteroatom Chemistry, Vol. 10 are fittingly dedicated to Professor Alfred Schmidpeter who provides an ‘Essay on Phosphorus Chemistry’ at the outset of a series of articles from friends and colleagues throughout the world.* In a review dealing with donor interaction by N, 0 and S atoms at tri-, tetraand pentacoordinate phosphorus Robert Holmes points out that such interactions may be highly relevant to enzyme a ~ t i v i t yThus . ~ it is shown that donor groups (N, 0 and S) typical of enzyme residues at active sites of phosphoryl transfer enzymes give rise to higher coordination. Specifically, phosphate substrates are displaced modestly towards pentacoordinate structures (equivalent to the ground state complex) whereas pentaoxyphosphoranes are displaced more strongly towards octahedral geometry (equivalent to the transition state complex) by donor interaction which results in P-0 bond weakening and, consequently, higher reaction rates. Similar reasoning leads to the conclusion that coordination of the tyranosyl carbonyl group with the

N3:

P =O ,I t

7

H~N-C-C<

I

-0, o , 0- o//p‘o

o ,

0-

: ;p; 0

CH2

l o

0- I

I

“J H/o

E.Tyr.ATP Ground State

Figure 1 Organophosphorus Chemistry, Volume 3 1 ( * The Royal Society of Chemistry, 200 1

62

E[Tyr-ATP] Transition State

2: Pentacoordinated and Hexacoordinated Compounds

63

pentacoordinate transition state (Figure 1) in the activation of tyrosine by tyrosyl-tRNA synthetase, enhances reactivity.

2

Acyclic Phosphoranes

Trifluorophosphoranes, (3a-c) were prepared by the oxidative addition of ( 1) to (2a-c). X-ray crystallographic structures of (3a-c) confirmed the tbp configuration with two axial fluorine atoms and 19F/31PNMR studies showed increasing shielding of phosphorus from (3a-c), decreasing difference between 6( 19Fax)and 6( 19Feq) from (3a-c), increasing difference between 'J(PF,,) and 'J(PFeq) from (3a-c) and finally increasing 2J(FaxFeq)from (3a-c). All these observations were ascribed to increasing pn-dn interactions from (3a-c) and in the cases of (3a) and (3b) an equilibrium was established with the starting materials by trapping (2a,b) typically with tetrachloro-o-benzoquinoneto form (4a,b). All three trifluorophosphoranes were remarkably stable to water and were only hydrolysed under extreme condition^.^

Semi-empirical MNDO calculations have been used to optimize the molecular geometry (tbp) of four pentacoordinate phosphorus compounds ROPC14, where R = 2,4,6-Br3C6H2, 2,6-Br2-4-C1-C6H2, CH3 or H, and to determine their atomic charges. The data suggested an anomeric effect from the lone pairs on oxygen which was used to explain the unusual features of the 35Cl NQR s p e ~ t r a . ~ In a contribution to the Cincinnati Conference, Evans et al. showed that the reaction of ( 5 ) with acyclic phosphorane (6) led to (8a,b) via (7).Subsequent treatment of the oxyphosphonium ions, (8a,b), with nucleophiles (LiX) followed by desilylation with KF gave a mixture of regioisomers, (9a,b), with (9a) predominating in all three cases.6

64

Organophosphorus Chemistry

TMSOTf/DMF

X

+

)-

TYSO

i. LiX ii, KF

TfO-

X = I. CI or N3

H’

+

TfO- Ph$O,

TMsq/ H’

HO

0

(10) a, R’ = H

b, R’ = P(O)(OEt)n

3

(Ilab)

NH R~

(12ab)

e.g. R2 = C5Hll, C C ~ H ~Ph , , or Bz

Monocyclic Phosphoranes

McClure el al. have reported the synthesis of a variety of acyclic y-amino mono- or bis-phosphonates by, for example, the hydrolysis of (10a,b) to (1 la,b) followed by reductive amination to (12a,b), the reaction occurring most readily with primary amines. The bis-phosphonates may be useful precursors to effective inhibitors of bone resorption and mineralization associated with osteoporosis and Paget’s d i ~ e a s e . ~ In a related study, reaction of (1Oa) with aryl isocyanates, (13), was shown to give (1 7) probably via (14, 15) and the diastereomeric monophosphoranes, ( 16a,b). Crossover experiments using two different isocyanates (Ar = Ph or pMeOC6H4) were used to provide evidence for the mechanism by the observation of all four possible isomers of (17) (2 x R = Ph, 2 x R =p-MeOC&4 and two isomers of R = Ph plus R =p-MeOC6H4).* Finally, schemes have been devised for the synthesis of deoxy-2- and 3-phosphonylmethyl derivatives of arabinose ( 18a,b) via pentacovalent phospholene methodology and progress towards this target has been r e p ~ r t e d . ~ 4-Ethoxy- 1,1,1-trifluoro-3-butene-2-one, ( 19), reacts with triethyl phosphite, (20), to give (21) which hydrolyses via (22)-(24) to give (25).” Phosphoranes (28a-m) include several novel phosphoranes which were prepared by the

2: Penta coordinat ed and Hexacoo rdinat ed Compounds

65

__c

fasf

HO.

reaction of a series of tricoordinate phosphorus compounds, (26a-m) with (27) include several novel phosphoranes with an isocyanate group attached to phosphorus. Exchange reactions between the trichloro(o-phenylenedioxy)phosphorane, (29) and trialkyl phosphates or dialkyl alkenylphosphonates have been observed and typically (29) reacts with triethyl phosphate to give (30) and (32), probably via (31).12 Reaction of a series of hexachlorocyclodiphosph(V)azanes (33a-e), with

66

Organophosphorus Chemistry

(%a-m)

(28a-m)

R3

-

a b C

d e f 9 h i

I m

EtO CF3CHpO CF3CH20 (CF3)zCHO PhCH20 C6F50

EtO CF3CH20 Et2N Et2N Et2N Et2N

Me Pr' Et2N OCN OCN OCN OCN Me3Si0 Et2N Et2N Et2N Et2N Et2N

I

CI, R*HN/P, CI

8'

C ,I /P~NHR~ N CI

/N,

aromatic amines, (34a-f), in acetonitrile gave a series of geminal aminocyclodiphosph(V)azanes, (35), which could be oxidized by elemental sulfur to compounds of type (36). The compounds were characterized by mass spectrometry, IR and 'H NMR and electron delocalization within the four-membered rings of the dimeric structures was discussed in terms of their ultraviolet spectra. l 3 Treatment of halophosphines, (37a,b) with tetrachloro-o-benzoquinone (TOB) gave phosphoranes (38a,b) in equilibrium with the phosphines (39a,b). Dehydrohalogenation of the product mixture gave (40) which reacted with a further equivalent of TOB to give (41). The latter was also obtained by oxidation of (37a,b) with two equivalents of TOB.14 The Zi3lP value of +2.4 ppm suggests that (41) is an example of a species in which the phosphorus atom has a sqp configuration.

2: Pentacoordinated and Hexacoordinated Compounds

67

H Trt-P

/

X

(37) a, X = F b, X = CI Trt=PhsC

+

,

I

CI TO6

4. Bicyclic and Tricyclic Phosphoranes Reactions of the diacids (43a-f) with the bicyclic phosphane, (42), gave podands (45a-f) presumably through intermediate pentacoordinate structures (Ma-f). Complexes of these ligands with Ca2+and Mg2+ were studied by IR, UV, and NMR spectroscopy and the stability constants compared with the 0

(42)

O

Y

Y

O

(43a-9 (44a-9

(45a-9

rate of transport of Ca2+ across a chloroformic membrane.15 A pentacoordinate bicyclic intermediate, (48), is alleged to be formed during the reaction of (46) with (47a,b), the ultimate products, of course, being the phosphorodiamidates, (49a,b).I 6 As part of a complex series of reactions, Mironov et al. report that the reaction of (50) with (51) leads to a mixture of (52) and (53) with the former

68

Organophosphorus Chemistry

R'

predominating by cleavage of the OCH2 group of the oxirane ring. Reaction of (50) with HCl (or HBr) also gave rise to P-cleavage of the oxirane ring with the formation of (54) which disproportionated to a mixture of ( 5 5 ) and (56).17The

reaction of tris-(trimethylsilyl)phosphine, (57), with the bis-(catecho1)chlorophosphorane, (58), formed (59) initially (with ' J p p = 395 Hz) which was converted into the more stable phosphite, (60), presumably by elimination of the (Me3SiP) fragment.18 In a study of the reactions of acetimidoyl chlorides, (61), with tricoordinate phosphorus compounds, the use of (62) gave the bicyclic phosphorane, (63), as (Me3Si)sP +

(57)

( ~ I-~ P - c-IfJ&p (aI)-P(SiMe&

(58)

(59)

0

Me3SiO (60)

2: Pentacoordinated and Hexacoordinated Compounds

69

a pair of diastereomers with tj3IP values at -24.7 and -20.5 ppm in a ratio of 2: 1 respective1y.l9 In pursuit of compounds with plant protection properties, Houalla et al. reacted a series of bicyclic phosphoranes, (64)-(71), with sulfur to produce the corresponding series of mono- and bis-sulfides, (72)-(79).20 In general, the reaction starting from (80) gave a mixture of two products, (81) and (82) but careful control of the conditions led predominantly to compounds of type (81)

Organophosphorus Chemistry

70

HO

(72)

x

HO

(73)

in which the presence of the OH group appeared to confer enhanced plant protection properties. The ylide, (83), containing the Martin ligand,2' when reacted with excess benzophenone at - 78 "C in THF gave the bicyclic oxaphosphetane (84) in 72% yield and in a similar reaction with aryl isothiocyanates, (85a7b),gave the first examples of stable pentacoordinate 172-thiaphosphetenes,(86a,b).22 During a study on phosphane-catalysed acylations Vedejs and Steck noted

71

2: Pentacoordinat ed and Hexacoo rdinat ed Compounds

NHAr -NHAr (86) a, Ar = Ph b, Ar = 1-Naph

Ph

some unexpected chemistry of (90) which was prepared as a colourless crystalline solid by conventional chemistry from (87) via (88 and 89). On heating at 95 "C in xylene, (90) gave a deep orange solution which yielded a red crystalline solid identified by X-ray crystallography as the bicyclic phosphorane, (9 1a). The orange colour in solution was attributed to a small proportion of the ylide (91b) in equilibrium with (91a). Heating (90) in absolute ethanol led to deacylation to form (92), again characterized by X-ray crystallography, together with small quantities of (91a,b) as by-product^.^^ i. Bu'Li

QCGCH OTBS

*

11, PhzPCI iii, Bu4NF

OTBS

\- + ONBU~

B;

/

PPh2

+

xylene, 95°C 4

,Q ,C

0-c, I/ Me

T\Ph Ph

Ph Ph

1,1,1,5,5,5-Hexafluoro-2-hydroxy-2-pentene-4-one (93) reacted diastereospecifically with (94a-g) in a concerted mechanism to give thermally stable tricyclicphosphoranes (95a-g). In one case (95g) hydrolysis gave the phosphonite, (96) but reaction with methanol resulted in addition to the double bond of the six-membered ring to give a mixture of two isomeric phosphoranes, (97a,b). Reaction of (94b,e-g) with 1,1, 1-trifluoro-2-hydroxy-2-pentene-4-one, (98), gave a mixture of diastereomerically pure regioselective phosphoranes (99b,e-g) and (1 OOb,e-g) which could be separated by fractional crystallization. X-ray crystallographic studies confirmed the structures of (95e), one isomer of (97) and (99g) as slightly distorted trigonal bipyramids with two

Organophosphorus Chemistry

72

a, R = Me b, R = Et c, R = Pr' d. R = But e. R = CH$3iMe3 1, R = PhCH2 g, R = Ph

CF3 (95a-g)

MeOH

I

R=Ph

-3

(97ab)

0 H,O

\

oxygen atoms in apical positions; a combination of elemental analysis, mass spectrometry and multinuclear NMR was used to characterize the remainder of the products.24 Chiral triquinphosphoranes ( 101a-d) react with trifluoroacetophenone, aromatic aldehydes and keto pentanolactone ( 102a-c) to afford diastereomeric pairs of hydroxyphosphoranes (generalized by 103) with a selectivity of up to

2: Pentacoordinated and Hexacoordinated Compounds

73

90% depending on the nature of the electrophile. With (102c) the initially formed hydroxyphosphoranes rearranged to oxyphosphoranes, (104), with the diastereomeric excess decreasing in each case. For example, with (101c) and (102c) the hydroxyphosphorane { (103), R 1= Pr’, R2,R3= CMe2CH20C(0)} rearranged to (104) with a decrease in diastereoselectivity from 90 to 50%. Xray crystallographic analysis of crystalline (104) revealed a structure which was 66% displaced from tbp along the Berry coordinate towards an sp structure and the pantolactone moiety was found to be in the R c ~ n f i g u r a t i o n . ~ ~

(SP) (101) a, R’

=H b, R’ = Me c, R’ = Pr’ d, R’ = PhCH2

R2

)=O Roluene, r.t. R3 (102) a, R2 = Ph, F? = CF3 b. R2=H, @ = P h c, R2.R3= CMe&H@C(O)

TBP (Rp-S)

TBP (Sp-S)

TBP (Rp-R)

TBP (Sp-R)

(103)

Although strictly speaking not in the realm of pentacoordinate phosphorus chemistry, the ability of phosphazatrane, (105), to act as a superbase depends, at least in part, on the ability of the bridgehead nitrogen to form a donor bond with the tetracoordinate phosphorus atom developed through bond formation with or coordination to, an electrophilic centre. Thus the active methylene compounds, (1 06a,b), were selectively monoalkylated in the presence of 1.1 equivalents of RBr and one equivalent of (105) to give (107) in yields in excess of 90Y0plus the protonated phosphazatrane, (108).26

R = Me, Et, Pr’, 6PhCHMe, , MeCHC02Et or

(2-

Organophosphorus Chemistry

74

Likewise, (105) was found to desulfurize trisulfides to disulfides, disulfides to monosulfides and propylene sulfide to propylene, each with concomitant formation of (109). Thiocyanates and triphenylphosphine sulfide were also desulfurized but N-(phenylthia)phthalimide, ( I lo), gave (1 11) in quantitative yield.27

RSR

CH2=CHMe

(111)

Deprotonation of a variety of sulfonium salts, (1 12), at R.T. by (105) to form stable and unstable sulfonium ylides without the competing [2,3] sigmatropic rearrangement, affords another example of the superbase activity of (105). The ylides, generated in solution, reacted with several aldehydes, to give the corresponding oxiranes, (1 13), in yields ranging from 8 1 to 95Y0.~*

In a paper dealing with the synthesis and structural features of novel, sterically hindered azaphosphatranes, Verkade et al. showed that the distanc: between the bridgehead nitrogen and phosphorus in (114a) was 3.152(7) A compared with 3.360(7) in (1 15) suggesting N/P interaction. In contrast, however, variable temperature 31PNMR studies failed to reveal transannulation or tautomerism in (114b).29 Aldoximes, (1 16), are catalytically dehydrated by (105) [or its isopropyl analogue, P(PriNCH2CH2)3N]to the corresponding nitriles (1 17) in good yields and under mild condition^.^^ The cationic (105) H+ can also serve as a

A

75

2: Pentacoordinated and Hexacoordinated Compounds

(114) a, Z = S b, Z = O RCH=NOH + (116) R = Ar, ArCH2,alkyl

(105)

-

RC-N (117)

+ (105)H+

procatalyst (deprotonated by NaH) in the dehydrohalogenation of alkyl halides or the debromination of vicinal dibromides. A polymer bound version of the procatalyst, (1 lS), was also shown to be effective in the same two types of r e a ~ t i o n . ~Finally ' in this series of papers, proazaphosphatranes, e.g. (1 19) in the presence of 2.2 equivalents of Mg2+ion, have been shown to catalyse the reaction of nitroalkanes with aldehydes or ketones (the Henry reaction) probably by the catalytic cycle shown in Scheme 1.32

(119) R = P r '

5

Hexacoordinate Phosphorus Compounds

The small cavity calixarene (120) reacted with BuLi in benzene to form (121) without change in coordination at phosphorus but when the reaction was carried out in ether at - 78 "C, a 1 : 1 mixture of (121) and a hexacoordinate compound ( 122) was formed.33 There follows a series of papers by Holmes et a1 on the ability of N, 0 and S to increase the coordination at phosphorus by donor action. In the first of these the pentafluorophenoxy ligand was introduced to three phosphoranes ( 123)- ( 125) and X-ray crystallography revealed hexacoordinated structures for all three by S-donor interaction with phosphorus. The P-S bond distances in

Organophosphorus Chemistry

76 R

A (120) R = BU',

PP= 112 \BW,

El&, -78°C

R-

A

A

(122) S3'P = - 9 9 ( ' J p ~ = 883 Hz)

(121) S3'P = 113

A,

(123)-(125) varied between 2.366 and 2.495 all considerably shorter than in the cyclic phosphite, (126). The that observed for the P-S bond (2.876 degree of S-P coordination and geometric displacement towards a higher coordination state suggests that the pentafluorophenoxy ligands enhance the electrophilicity of phosphorus to about the same extent as chlorine.34 Phosphites (127), (128), a phosphate (129) and two phosphoranes (130), (1 3 1) all containing pentafluorophenoxy groups have been prepared and characterized by multinuclear NMR and X-ray crystallographic studies. Each contained a potential coordinating group in the shape of sulfonyl (in 127 and 130) or sulfur (in 128, 129 and 131) capable of forming a donor bond with phosphorus to give pseudo-tbp (127, 128) tbp (129) or octahedral (130, 131) structures. In the latter two cases, the sulfur atom and the sulfonyl group showed similar coordinating ability towards pentacoordinate phosphorus. This contrasts with earlier studies in which ligands of lower electronegativity than OC6F5 resulted in sulfur affording stronger coordination with phosphorus and hence a greater displacement towards octahedral geometry. In agreement with earlier work, however, the strength of donor interaction was found to increase in the order phosphates < phosphites < oxypho~phoranes.~~ Likewise, X-ray crystallographic analysis of new phosphoranes (132)-( 134) revealed sulfonyl coordination with phosphorus to form hexacoordinate

A)

77

2: Pentaco ordinat ed and Hexa coordina t ed Compounds

A

( 125)

t-

F

(126)

structures and the data again show that the chlorine atom and the pentafluorophenoxy group (cJ: 135) promote similar degrees of coordination (P-OS(0) = 1.878 for 132 and 1.936 for 135). They also re-emphasize that sulfur and the oxygen atom of the sulfonyl group have similar coordination ability in donor action with phosphoranes containing strongly electronegative ligands. 36 As mentioned at the outset of this chapter, phosphate substrates have been proposed to form pentaoxyphosphoranes as intermediates in nucleophilic displacement reactions at active sites of phosphoryl transfer enzymes. In support of this contention, two anionic phosphates (137) and (138) have been prepared from (136) and X-ray crystallography reveals that all three show sulfur coordination at phosphorus which displaces the geomoetry from tetrahedral towards tbp to the extent of 30% for (136 P-S = 1.387 A), 23% for (1 37 P-S = 3.281 and 26% for (1 38 P-S = 3.254 A). Hydrogen bonding appears to be an important factor in enhancing the electrophilicity at phosphorus, thus promoting the sulfur coordination which is only suppressed slightly in the anionic phosphates ( 137) and (1 38) relative to (1 36).37 In the last of this series of outstanding papers by Holmes et al. the donor ability of nitrogen towards tri- and pentacoordinate phosphorus has been

A

A)

A

78

Organophosphorus Chemistry

F

CI

CI

FJ fO F

F

F

I

(130)

F

F

(131)

examined further in compounds represented by (139) and (140). Only weak Ndonor interaction at phosphorus was observed for the former but a 74-800/0 displacement towards an octahedron was estimated for (140) with a ,P-N distance of 2.143 compared to a P-N single bond covalent radius of 1.85 A.38 Analogous work has been reported using 31P NMR to demonstrate increased coordination at phosphorus from four through five to six for a series of compounds prepared from (141) and silanized amino acids (e.g. 142 from serine) and it was noted that highly coordinated phosphorus compounds were similar to ‘the active sites of the c-AMP system’.39

A

79

2: Penta coordinated and Hexacoo rdinat ed Compounds

,

c F3

(133)

(134)

P-S = 3.281(2)A ( 137)

P-S = 3.167(1)A, 3.192(1)A ( 136)

P-S = 3.254(9) A

(138)

'

Organophosphorus Chemistry

80

(139) 631P= 168.6

(140) 631P= -136

Me3SiNH-CH-COOSiMe3

I

CH20SiMe3

In conclusion, therefore, it is clear that hypervalent phosphorus chemistry is now finding increasing relevance in the field of biological activity, and structural analyses in this arena have played a highly significant role in creating a better understanding of several complex natural systems.

References 1

2 3 4

5 6

7 8 9 10

11 12

13 14

I5 16

L.D. Quin, J.A. Deiters and W.E. McEwen, Heteroat. Chem., 1998,9, 601. W.E. McEwen, Heteroat. Chem., 1999, 10, 527. a) R.R. Holmes, Acc. Chem. Res., 1998, 31, 535-542; (b) R.R. Holmes, Phosphorus, Sulfur, Silicon, Relat. Elem., 1999, 144-46, 1. V. Plack, J.R. Goerlich, H. Thonnessen, P.G. Jones and R. Schmultzer, Z. Anorg. Allgem. Chem., 1999,625, 1278. D.I. Efremov, E.S. Kozlov and G.B. Soifer, Russ. J. Gen. Chem., 1998,68, 1221. L. Scarola and S.A. Evans Jr., Phosphorus, Sulfur, Silicon, Relat. Elem., 1999, 147, 361. K.-Y. Jung, M.-Y. Lee and C.K. McClure, Phospho&s, Sulfur, Silicon, Relat. Elem., 1999,147, 141. C.K. McClure, B. Cai and L.H. Spangler, Phosphorus, Sulfur, Silicon, Relut. Elem., 1999,144-146,709. C.K. McClure, L.A. Alegria, T.P. Boehlow, T.A. Madsen and R.A. Wilkinson, Phosphorus, Sulfur, Silicon, Relat. Elem., 1999, 144-146, 177. 1.1. Gerus, M.G. Gorbunova, V.P. Kukhar and R. Schmutzler, J. Fluorine Chern., 1998,90,1. M. Gorg, U. Dieckbreder, R.-M. Schoth, G.-V. Roschenthaler and A.A. Kadyrov, Heteroat. Chem., 1998,9, 109. N.G. Khusainova, G.R. Reshetkova and R.A. Cherkasov, Russ. J. Gen. Chern., 1998,68,367. I.M. Abd-Ellak, Y. Al-Shaibi, A.A. Ba-Issd and M.S. El-Hammadi, Phosphorus, Sulfur, Silicon, Relat. Elem., 1998, 139, 29. V. Plack, J.R. Goerlich, H. Thonnessen, P.G. Jones and R. Schmutzler, Hererout. Chern., 1999, 10, 277. A. Pujo-Bouteille, L. Lamande, L. Lopez, L. Cazaux and J. Bellan, Tetrahedron, 1998,54,3817. V.I. Mironov, G.A. Ivkova, L.M. Burnaeva, T.V. Gryaznova, I.V. Konovalova,

2: Penta coordinated and Hexacoordina t ed Compounds

17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35

36 37

38 39

81

P.I. Gryaznov, A.M. Kibardin, R.Z. Musin and A.N. Pudovik, Russ. J. Gen. Chem., 1998,68,555. V.F. Mironov, Z.A. Bredikhina, V.G. Novikova, A.A. Bredikhin and A.I. Konovalova, Russ. J. Cen. Chem., 1999,69, 1155. E.V. Popova, V.F. Mironov, Y.M. Yolodina, N.M. Azancheev, E.A. Ishmaeva and 1.1. Patsonovsky, Phosphorus, Sulfur, Silicon, Relat. Elem., 1999,147,263. P.P. Onys’ko, Russ. J. Gen. Chem., 1999,69, 158. D. Houalla, C. Lopez, T. Gospodova-Ivanova and Y. Stefanovsky, Phosphorus, Sulfur, Silicon, Relat. Elem., 1998, 142,27. J.C. Martin, E.F. Perozzi, Science, 1976, 191, 154; ibid., 1983,221, 509. T . Kawashirna, T. Iijima, H. Kikuchi and R. Okazaki, Phosphorus, Sulfur, Silicon, Relat. Elem., 1999, 144-146, 149. E. Vedejs and P.L. Steck, Angew. Chem. Int. ed. Engl., 1999,38,2788. G. Bekiaris and G.-V. Roschenthaler, Heteroat. Chem., 1998,9, 173. C. Marchi and G . Buono, Tetrahedron Lett., 1999,40, 925 1 . S. Arumugam, D. McCleod and J.G. Verkade, J. Org. Chem., 1998,63,3677. Z . Yu and J.G. Verkade, Heteroat. Chem., 1999,10,544. X.-S. Fei and J.G. Verkade, Heteroat. Chem:, 1999, 10, 538, X. Liu, Y. Boi, and J.G. Verkade, J. Organomet. Chem., 1999,582, 16. X.-S. Fei and J.G. Verkade, Heteroat. Chem., 1999, 10, 541. X. Kiu and J.G. Verkade, J. Org. Chem., 1999,64,4840. P.B. Kisanga and J.G. Verkade, J. Org. Chem., 1999,64,4298. M . Fan, H. Zhang and M. Lattman, Phosphorus, Sulfur, Silicon, Relat. Elem., 1999,144-146,257. P. Sood, A. Chandrasekaran, R.O. Day and R.R. Holmes, Inorg. Chem., 1998, 37, 3747. P. Sood, A. Chandrasekaran, R.O. Day and R.R. Holmes, Inorg. Chem., 1998, 37, 6329. A. Chandrasekaran, P. Sood, R.O. Day and R.R. Holmes, Inorg. Chem., 1999, 38, 3369. A. Chandrasekaran, P. Sood, R.O. Day and R.R. Holmes, Inorg. Chem., 1999, 38, 3952. N.V. Timosheva, A. Chandrasekaran, R.O. Day and R.R. Holrnes, Inorg. Chem., 1998,37,4945. Z . Li, H. Fu, H. Gong and Y. Zhao, Phosphorus, Sulfur, Silicon, Relat. Elem., 1999,147,215.

3 Quinquevalent Phosphorus Acids BY B.J. WALKER

1

Introduction

The current review, although hopefully balanced, is again selective. Biological aspects of quinquevalent phosphorus acid chemistry, quite separate from nucleotide chemistry, continue to increase in importance and there is an attempt to reflect this. Tetracoordinate phosphorus compounds continue to be a major source of transition state analogues for the generation of abzymes, etc. A wide variety of natural and unnatural phosphates, especially those of carbohydrates and their phosphonate and phosphinate (particularly fluorinated) analogues have been synthesised, usually with some biologically-related purpose. The synthesis of extremely complex natural carbohydrate phosphates and unnatural analogues has rapidly developed, and the synthesis and biological properties of inositol phosphates, phosphatidylinositols and related compounds have again been particularly active areas. The interest in phosphorus analogues of all types of amino acids continues. The importance of enantiometric and asymmetric synthesis is illustrated in many of these reports and the synthesis, and use as chiral catalysts, of chiral phosphorus(V) amides features in many publications. Interest in approaches to easierkafer nerve gas hydrolysis continues. Acylphosphonates have substantial potential as synthetic intermediates and investigations of their synthesis and reactions have increased. A number of thorough mechanistic studies of reactions involving a variety of tricoordinate, phosphorus(V) compounds as reactive intermediates have appeared. 2

Phosphoric Acids and their Derivatives

2.1 Synthesis of Phosphoric Acids and their Derivatives. - Phosphate monoesters have been cleanly prepared from H-phosphonate monoesters (1) by conversion of the latter compounds to the silyl derivatives followed by oxidation with, for example, tertiarybutyl hydroperoxide. Reports of syntheses of cyclic phosphates include those of the novel six-membered phosphatephosphonates (2) (Scheme 1)’ and the pyridine-substituted keto cyclic phosphates (3) and (4), the latter as potential models for the precursor of molybdopterin (MTP), an important biological co-factor. The stereochemistry and Organophosphorus Chemistry, Volume 3 1 $7 The Royal Society of Chemistry, 2001 82

83

3: Quinquevalent Phosphorus Acids 0 RO, I I PH HO' (1 1

-

MeSSiO, Me3SiO'

P-OR

'BUOOH

-

0

Me3Si0, I I

Me3SiO' '-OR

0

HO, I I

HO"-OR

X

2y2ky d (2)Y = S or Se, X =

Ffl

0

Reagents: i, (Et2N)3P, 12; ii,

P(0El)z

Y=

y::;

iii, sa or Se

Ar

scheme 1

structure of compounds (2) have been investigated by NMR and X-ray methods. Aziridine analogues (5) of presqualene diphosphate have been synthesised as potential squalene synthase inhibitor^.^ A wide variety of steroid phosphates, including disteroid pyrophosphates, e.g. (6), have been prepared using four different phosphorylation procedures. Examples of new dendrimer structures reported include compounds containing P=N-P=S linkages placed at selected generations within the architecture.6 0

W

[

,

O

H

mN

//

0

\ o

Me

R2

0 OH

(3)

(5) R ' =

(4)

0I

7)

R2 = CH2CH2R' or C

0

II 5a-Androstanyl-3a- 0-P1

OR

0I

CHZ H ~ R'

0

II 0- P- 0- 3a-Androstanyl-5a I

OR

(6) R = CHPPh, H

Cyclic amides of phosphoric acid, particularly C2-symmetric examples, are being increasingly used as chiral catalysts in a variety of reactions. A recent report describes the synthesis, structure and chemistry of a series of phosphorous acid (7) and thiophosphorous acid (8) diamides derived from the reaction of C 2 diamines with phosphorus trichloride followed by treatment with water or hydrogen sulfide, re~pectively.~ Reactions of (7) and (8) provide routes to a range of phosphoric acid derivatives with potential as chiral ligands. The synthesis of a wide variety of both chiral and achiral phos-

Organophosphorus Chemistry

84

‘NHR

R

(7)Y = 0 (8) Y = S

phoramides, (e.g. 9, 10 and ll), from 1,2-diamines has been reported by Denmark and his co-workers.8 New molecular dibenz[c,h]acridine-basedreceptors for malonic acids have been synthe~ised.~ These include the phosphoramide (12) which has an association constant of 2.8 x lo5 for dibutylmalonic acid.

h Phosphoric acid derivatives of amino acids and peptides, with a wide variety of structures and with various applications, continue to be prepared. N Diisopropyl phosphoryl-protected amino acids (1 3) have been prepared in high yield and without racemisation by the addition of sodium hypochlorite to an aqueous solution of amino acid and diisopropyl phosphite at constant pH. lo An alternative method, involving phosphoramidate-amine exchange followed by oxidation with mCPBA, has been applied to the synthesis of a range of N-phosphoryl amino acids ( 14) (Scheme 2). I The phosphopeptide R

0

(R0)2PH II

+

NaOCI. H20 pH9-9-5 *

H2NAC02H

0

R

(R0&-NACO2H ti

(13)

(Bn0)2PNR2

’

R’

R’ 0

(BnO)2PNHAC02R2

ii(BnO)lb(NHI\C02R2 (1 4) R’ = CH2CH2C02R, CH2CHMe2,CH2Ph etc

R’

Reagents

I,

1H-tetrazole,H2NAC02R2;

ill

mCPBA Scheme 2

85

3: Quinquevalent Phosphorus Acids

prodrug ( 16), carrying an S-acyl-2-thioethyl phosphate protecting group, has been synthesised by introduction of the protected phosphate as the tyrosine phosphate fragment (15). l 2 Preliminary studies show that the protecting group makes (16) more stable to leucine aminopeptidase, a CNS enzyme which removes N-tyrosinyl residues of enkephaline derivatives. The total synthesis of the potent serine-threonine protein phosphatase inhibitors (+)-calyculin A (1 7) and (-)-calyculin B (18) has been reported.13The closely related clavosines A and B have been isolated from the marine sponge Myriastra cZavosa.14With a view to increasing its water solubility, the phosphorylation of the antifungal agent LY303366, a semi-synthetic analogue of the complex cyclic peptide echinocandin B, has been investigated.l 5

Y

C

Q

H H-Tyr-GIy-Gly-Phe-Leu-NH2

XNH

(15)

(16) 0 It

(17) R' =H, R 2 = C N (18) R'=CN, R 2 = H

A new approach to the construction of glycosyl phosphate diester links has been reported. l 6 The reaction of carbohydrate H-phosphonate monoesters (19) with a glycosyl donor in the presence of a promoter (e.g. TMSOTf) gives, following oxidation, moderate to good yields of the coupled product (Scheme 3). Derivatives (21) and (22) of a-and 0-D-glucosamine-1-phosphate and a-Dgalactosamine-1-phosphate derivatives have been prepared stereoselectively in

Reagents

I,

promoter, CH2CI2, ii, 12, H20/py

Scheme 3

86

Organophosphorus Chemistry CH20Ac AcO

~

~

CH~OAC 0 ~ ~ O l

(

0

CF3CONH (21)

(22)

F3C (20) 0 0 II II Reagents: i, HOP(OBn)2, CICH2C12C1, refux; ii, HOP(OBn)2,CICH2CH2CI,r.t scheme4 CH20Bn

+ o: B ;

i, ii

CH20Bn BEO+Y

PivaloylO X 0 I1 (24) X =SP(OEt)2, Y = H 0 I1 (25) X = H, Y =SP(OEt)2

(23) O

0

II Reagents: i, HSP(0Et)i ii, pivaloylGl, DMAP

Scheme 5

high yield by ring-opening of the corresponding 1,2-0xazolines, e.g. (20), with dibenzyl phosphate by careful control of the reaction temperature (Scheme 4). I7 The protected anomeric phosphorodithioates (24) and (25) have been synthesised, by an analogous method through ring-opening of the epoxide (23) (Scheme 5), and used as novel glycosylating agents through activation with methyl triflate. l 8 Various analogues of the pentasaccharide phosphate antibiotic moenomycin A have been synthesised. In a continuing investigation of SARs the analogue (26), where the NHAc group of unit E has been replaced by OH,19 and two other disaccharide analogues, e.g. (27),20 have been prepared. The analogue (28), lacking the OH group in the 4-position of the O'CONH2 H

~

o

~

OH

~

,OH O A O

0,

(26)

.. . -

0' OH

~

O

N

H

2

B

n

)

3: Quinquevalenr Phosphorus Acids

87

uronic acid moiety, has also been synthesised.2' Compound (28) does not inhibit bacterial transglycosylase, indicating the importance of the 4-OH group for enzyme binding. A number of studies of the Leishmania protozoan parasites involving synthesis of various saccharide phosphates have been reported. These include the synthesis of the immunologically important phosphodisaccharide repeat unit (29) of the lipophosphoglycan cell surface GPI molecule of Leishmania donovani,22and a phosphorylated branched heptapeptide which is a fragment of the phosphoglycocan portion of Leishmania m e x i ~ a n a .Other ~ ~ related syntheses include that of a series of phosphodisaccharides, e.g. (30), in order to study the acceptor substrate specificity of the biosynthetic enzymes of the parasite.24

H

HO

O

s Ho . OH

4

'NH4

0 I1 OR

OH OH HO!&&~o@o-p'

OH

OH OH OH (30) R = (CH&CH=CH2

I -Deoxy-D-xylulose and the corresponding phosphate (3 l), which are substrates for enzymes in the biosynthesis of vitamins B1 and B6, have been prepared.25 Synthetic approaches to structural analogues, e.g. (32), of the phytotoxin tagetitoxin have been reported, in spite of the fact that the structure of tagetitoxin has not been unequivocally established.26 0 II

.+G

(H0)zPO-

HO

Me,

OH

+NH3 OP03H-

Inositol and structurally related phosphates continue to be popular targets for synthesis. 6-Amino-3,5-deoxyinositol 1-phosphates (34) have been prepared from ( 1R,2R,4R,6S)- 1,6-epoxy-2,4-bis(benzyloxy)cyclohexane (33) by highly regio- and stereo-selective aminolysis in the presence of aqueous ytterbium triflate (Scheme 6).27The fluorogenic substrate ( 3 9 , derived from D,L-nZp-inOSitOl 1-phosphate, has been synthesised in order to assay the activity of phosphatidylinositide-specific phospholipase C.28 The inositol monophosphatase inhibitor (36) has been prepared using solid-phase methods on Merryfield resin.29A 19Fgel-phase technique was developed to monitor the

88

Orgunophosphorus Chemistry 0

I

8

OBn

OBn

OBn

(34) R = H, Me, Et

(33) Reagents: i, RNH2 Yb(OTf)3,65"C

Scheme 6

extent of fluorinated substrate binding to the resin and applied to the synthesis of (36) by observation of pentafluorophenyl phosphate ester intermediates. A new, mild method of cleaving ether-resin bonds was also developed during the work. Optically pure mono-, e.g. (37), bi- and tri-phosphate analogues of 0

OH

13

H

O

A ,,O-

v

0

L

HO

OH

(37)

deoxy-myo-inositol have been prepared from protected 6-deoxy-myo-inositol and the corresponding 1,5-epimer, c h i r o - i n o s i t ~ l . A ~ ~variety * ~ ~ of both cyclic and acyclic structural mimics of inositol monophosphates have been synthesised as potential inhibitors of myo-inositol 1-phosphate (MIP) ~ y n t h a s e . ~ ~ Most of these compounds showed low or no activity. However, the acyclic phosphonic acids (38-41) did act as inhibitors, and analysis of these and similar results provides insight into the mechanism of interaction with the enzyme and should be useful in the design of new, effective MIP synthase inhibitors. Whole cell culture of recombinant BaciZZus subtilis has been used as a catalyst in a practical, multigram synthesis of D-myo-inositol 1,2-cyclic monophosphate directly from phospholipid mixtures.33 31PNMR was used to monitor the progress of the conversion. The cyclic analogues (42) and (43) of myo-inositolmonophosphate have been prepared using a tervalent phosphorus method that involves reaction of the appropriate alcohol with the cyclic phosphoramidite (44) followed by oxidation.34 Compounds (42) and (43) were proposed as potential prodrugs of inositolmonophosphatase ligands but did

89

3: Quinquevalent Phosphorus Acids

Qo 0--p,

(38)R' (39)R' (40) R' (41) R'

OH =CHO, R2=OH = CH20H, R 2 = OH =CHO, R 2 = H =CH20H, R 2 = H

A

\

N'Pr2

X (42) X=OH (43) X = H

(44)

not show any activity. A complex pentasaccharide D-myo-inositol-1,2-cyclic phosphate has been synthesised in nine steps from a protected inosit01.~~ The compound prepared is structurally related to the inositol phosphate glycan which is implicated as an insulin second messenger. A number of reports describing the preparation of triphosphates of inositols and their analogues have appeared. These include the chemico-enzymic synthesis of the optical antipodes of ~-myo-inositol-3,4,5-trisphosphate (45) and -1,5,6-trisphosphate (46).36 The SAR to biologically active inositol phosphates was also investigated in this report. A number of adenophostin analogues, e.g. (47), lacking the adenosine group have been prepared.37 Some of these compounds show significant inhibition of the binding of D-myo-inositol 1,4,5-triphosphate (IP3) to the IP3 receptor from porcine cerebella. The closely related a-D-glucopyranoside 3,4,3'-trisphosphate (48) has also been designed and synthesised as a novel IP3 receptor ligand.38Compound (48) binds to the IP3 receptor with an

(45)

(47) R=CH20H (48) R = H

affinity comparable to that of IP3 itself. The synthesis, calcium mobilising and physicochemical properties of D-chiro-inositol 1,3,4,6-tetrakisphosphate (49), a novel ligand at the D-myo-inositol 1,4,5-trisphosphate receptor (InsP,R), have been reported.39 The first deoxy analogues (51 and 52) of myo-inositol 3,4,5,6-tetrakisphosphate(Ins3,4,5,6)P4 (50) have been synthe~ i s e d .Following ~~ conversion into membrane-permeant derivatives, the binding properties of ( 5 1) and (52) were evaluated towards intramolecular binding sites for Ins(3,4,5,6)P4. Phosphatidylinositol structures and their phosphates are involved in a variety of important biological processes and are increasingly common synthetic targets. The number of reports in this area is certain to grow as the difficulties of synthesising increasingly complex molecules are overcome. New asymmetric syntheses of phosphatidylinositol 3-phosphate (53) and the corre-

Organophosphorus Chemistry

90

0 ~ 0 ~ ~ -

"0

0 II _,..'

,O~ 0 , ~ -

'OH

2 - ~ PO' 3 *

070H)2

0

op032-

(50)R' = R2 = OH

(49)

(51) R' =OH, R 2 = H (52) R' =H, R2=OH

sponding 4-phosphate (54) derivatives have been reported.41 A number of D-3phosphorylated phosphatidyl myo-inositols (56) carrying none, one or two other phosphate groups have been synthesised from myo-inositol ortho formate (55).42 A key step in the route is a resolution-protection procedure involving camphor acetal (57). A closely related and newly discovered, natural phospatidylinositol (58) has also been synthesised from m y o - i n ~ s i t o l .3~~ Deoxy-D-myo-inositol 1-phosphate, 1-phosphonate and ether lipid analogues,

OCOR2

. .-

OH (55)

OR

0 II

(56)R = H or P(OH)2

OBn (57)

e.g. (59-61), have been prepared and evaluated as inhibitors of phosphatidylinositol-3-kinase signalling and cancer cell growth.44 A variety of triphosphate

analogues have been reported. Phosphatidylinositol 3,4,5-triphosphate analogues (62) containing saturated acyl side-chains have been prepared and their binding to PIP3 5-phosphatase i n ~ e s t i g a t e d Permuted .~~ isomers (63) of ~ - a phosphatidyl-D-myo-inositoltriphosphate (PtdInsP3) have been synthesised in order to investigate the principles governing ligand selection for PtdInsP3 specific binding proteins.46 A number of reports of syntheses of highly complex phosphatidylinositols which act as anchors in various systems have appeared. These include a highly convergent synthesis of rat brain Thy-1 glycosylphosphatidylinositol anchor,47 and the corresponding anchors of yeast4*and the sleeping sickness parasite Trypanosoma b r ~ c e iIn . ~the ~ last case

91

3: Quinquevalent Phosphorus Acids

0 II

_../

"'OH 070H)a

1 OH (59) X = H , Y = O (80) X = F , Y = O (61) X = H , Y=CH;!

0 (62) n = 1, 3, 7, 17

OH

the phospholipid residue was attached to the oligosaccharide via reaction with the phosphoramidite (64) followed by oxidation. The unsymmetrical optically active phosphatidyl glycerol (65) has been prepared in six steps from protected ~-mannitol.~O These, and similar optically active phospholipids, have general use in studying enzymes involved in signal transduction and membrane biochemistry. The synthesis of the phosphatidic acid mimic (66), carrying a terminal thiol function, has been r e p ~ r t e d . The ~' purpose of the thiol group is to allow more effective anchoring of such compounds to metal surfaces.

Synthetic approaches to a wide range of phospholipids and related structures have been reported. The two possible diastereomers, e.g. (67), of a novel aminoglycoglycerolipid isolated from Mycoplasrna fermentans have been prepared from (S)-and (R)-glycidols, respectively, in order to determine the absolute configuration of the natural material.52 Dimeric phospho-

92

OrganophosphorusChemistry

H

OCO(CH2)14CH3 OCO(CH2)14CH3 (67)

lipid structures synthesised include a variety of ether-linked bolaform lipids (68) from epi~hlorohydrin~~ and the dimeric phosphatidyl ethanolamine (69).54 The dimer (69), unlike the monomer structure, readily forms uniformly flat, self-assembled, lamellar supramolecular arrays and liposomes that are stable up to 80°C. Although problems due to degradation of the aldehydic side-chain were encountered using established methods, a modified approach has allowed the synthesis of 2-lysophosphatidylcholine esters (70) of y-hydroxy-a,P-unsaturated aldehydic acids.55 Sphingosine- 1-phophate (71), one of an emerging class of lipid second messengers, has been synthesised from sphingosine in two steps by an enzymic method? The corresponding cyclic 1,3-phosphate (72), which may be a precursor in the biosynthesis of (71), has now been prepared.57 Thiophospholipid disulfide dimers (73) have been synthesised by the use of N,N'-disuccinimidyl to couple diacylglycerophosphatidylethanolamine with bis-o-hydroxypolyethyleno~ydisulfide.~~ Compounds (73) can be used to anchor biomembranes to gold surfaces.

(70)n = 2

H OI L O * 0-

H3N H

93

3: Quinquevalent Phosphorus Acids

2.2 Reactions of Phosphoric Acids and their Derivatives. - Recent developments in the understanding of nucleophilic, general acid and metal-ion catalysis of phosphate diester hydrolysis have been reviewed.59A wide range of investigations of phosphate ester hydrolysis and ester exchange continue to appear. A detailed study of the solvolysis reactions of a series of aryl phosphates in t-butanol and in t-amyl alcohol has been reported.m The large rate increases, compared to rates in aqueous solution, observed in some cases are due solely to entropic factors and the results support a mechanism, previously proposed for reactions in aqueous solution, involving a metaphosphate intermediate. The hydrolysis of tri-n-butyl phosphate in a mixture of hydrocarbon and aqueous sodium hydroxide is known to be autocatalytic with an induction period.61A new investigation of this reaction has shown that the autocatalytic effect is due to the formation of a third phase in which a more rapid hydrolysis reaction occurs due to the high concentration of ester and hydroxide ion. Metal complexes as activators for phosphate ester hydrolysis is an area of current interest. It is now reported that the zirconium complex (79, the structure of which was determined by X-ray crystallography, substantially accelerates hydrolysis of certain diesters, e.g. (74).62A number of peptide-zirconium complexes that catalyse phosphate hydrolysis have been discovered by screening a combinatorial undecapeptide 1ibra1-y.~~ The thermodynamics, pH dependency, solvent effects, and the effect of divalent metal ions on the hydrolysis of p-nitrophenylphosphorothioate (76) have been examined and the results compared with a similar study of the hydrolysis of the corresponding phosphate ester (77).64 In a continuing investigation of how metal-ion catalysis achieves the hydrolysis of phosphate diesters containing poor leaving groups, the hydrolysis of the phosphonate metal complex (78) has

0

0

P h OI - L O Y

0(74)

o 2 4 3 -o - l - x I -

OH

0-

(76)X = S (77)x = o

Organophosphorus Chemistry

94

been studied as a model of the corresponding phosphate complex65 and the relative reactivity of a series of phosphate diesters coordinated to form a dinuclear Co(111) complex, e.g. (79), has been investigated.66 The intramolecular transesterification reaction of 2-hydroxypropyl 4-nitrophenyl phosphate (80) is reported to be accelerated by 105-106 fold on the addition of divalent metal ions such as Zn2+ and Cu2+in the absence of base.67The mechanism of ester exchange reactions of phosphate monoester dianions in aqueous solution has been studied by theoretical methods.68 Although the results do not exclude the generally accepted dissociative mechanism involving a metaphosphate intermediate, they do suggest that there are other mechanisms that should be considered. The mechanism of photo-induced electron transfer in tri-lnaphthyl phosphates (8 1) and (82) sensitised by 9,lO-dicyanoanthracene to give 1,l '-binaphthyls and the phosphate monoester has been i n ~ e s t i g a t e d . ~ ~

.O\P=O

MeCN

(x

13

(81) X = H (82) X=OMe

Aminolysis of P-C1 bonds remains an important route to amides of P(V) acids and many examples of this reaction using well established methods have been reported. The kinetics and mechanism of the reaction of diary1 chlorophosphates (83) with amines in acetonitrile have been in~estigated.~'The results are consistent with a concerted process and a late, product-like

95

3: Quinquevalent Phosphorus Acids 0 II PhO-P-CI I OAr

(83)

transition state. N, O-Bis(trimethylsily1)-a-aminoacids (84) form peptide oligomers when treated with o-phenylene phosphor~chloridate.~~ The mechanism has been investigated by 31P NMR and is suggested to involve the cyclic pentacoordinate phosphoric-carboxylic mixed anhydride (85) as the activated amino acid intermediate. Me3SiNHCHRC0$3iMe3 +

PNHCHRC0$3iMe3

(84)

I peptide oligomers

-

(85)

Phosphate diester continues to be used as a leaving group in a variety of nucleophilic substitution reactions, including glycosylation. Further examples of such reactions of enol phosphates catalysed by Pd(0)72and by Ni(II)73have been reported. A variety of 2-substituted N-heterocycles have been synthesised from p-lactam enol phosphates (86) (Scheme 7)72 and both cyclic and acyclic dienyl phosphates (87) undergo efficient Ni(I1)-catalysed coupling with Grignard reagents to provide 2-alkyl- and 2-aryl-substituted dienes in mod-

Reagents i, PhZnCI, Pd(PPh3)4,THF; ii, Et3AI, Pd(PPh3)4; iii, CO, P ~ ( O A C )Ph3P, ~, MeOH; iv, Bu3SnCH=CH2, Pd(PPh3)4,LiCI, THF Scheme 7

96

Organophosphorus Chemistry

erate to good yields.73 Reactions of thio-(88) and seleno-(89) phosphates provide new routes to vinyl-thiiranes (90) and conjugated dienes (examples are given in Scheme 8).74 The need to synthesise increasingly complex glycojugates 0

(88)x = s (89)X = S e Reagents: i , KCN, 18-Crown-6, DME, Et20; ii, NaBH4,MeOH ( X = S)

Scheme 8

demands efficient methods of O-glycosylation. A stereoselective method to give a-or P-O-linked glycosides using the cyclic phosphate (91) or diphenylphosphinate (92) as leaving groups has been reported.75 Activation of the anomeric centre of suitably protected L-fucopyranose with propane- 1,3-diyl phosphate to give (93) has been used in the synthesis of the disaccharide (94).76

G? p.

(91) @ =

o'

U0

AcO TMSOTf, CHzCh, -78 "C +

AcO OAc (93)

AcO

Me+OA~ OAc

AcO OAc (94)

S-(2-Deoxyglycosyl)phosphorodithioates (95) have been used as glycoside donors in a highly stereoselective synthesis of 2-deoxy-a-glycosides and adisa~charides.~~ The stereochemistry of nucleophilic displacement of phosphate from P-(phosphatoxy)alkyl radicals, e.g. (98), has been investigated through reactions of the diastereomers (96) and (97) with tributyltin hydride and a radical initiator in the presence of octanol as the n ~ c l e o p h i l e The .~~

97

3: Quinquevalent Phosphorus Acids

(95)

t;

Collidine MeCN, 20 "C

results suggest that reaction with the nucleophile takes place by backside or frontside attack depending on steric constraints. Acyl(bistrifluoroacetyl) phosphates (99), prepared in situ from acyl trifluoroacetates, phosphoric acid and trifluoroacetic anhydride, act as powerful acylating agents.79 For example, anisole is rapidly acylated at room temperature exclusively at the 4-position without the need for an additional Lewis acid catalyst. The system has potential as a clean alternative to the Friedel-Crafts reaction. 0 CF3CO0, I I P-OCOR CF3COO'

The Aldol reactions of the 0-(trichlorosily1)enolates (100) with aldehydes, catalysed by the chiral (S,5')-phosphoramide ( 101) have been investigated (Scheme 9)." Good to excellent diastereo- (up to 3513) and enantio- (up to 92% e.e.) selectivity was observed. A systematic investigation of the influence of solvent, concentration, addition rate and catalyst on the rate and stereoselectivity of such Aldol addition reactions has also been carried out.8'

(100)

n=

0, 2 , CH2C12, -78

(101)

Minor

Major

"C;ii, NaHC03, H20 Scheme 9

A number of rearrangement reactions of P(V) acid derivatives have been reported. The P-0 to P-C rearrangement of chiral aryl phosphoramidates (102) has been investigated as a method of synthesis of P-(o-hydroxyary1)diazaphospholidine P-oxides ( 103) (Scheme 1O).82 In all cases studied, with the

98

Organophosphorus Chemistry OH

0

I, I1 __c

Reagents: i, LDA, THF, -78°C; ii. H20

scheme 10

exception of one naphthyl-substituted example, the reaction was regio- and stereospecific. A different rearrangement, to give the bicyclic diamide (lOS), occurs on treatment of 1 -oxo-2,8-diphenyl-2,5,8-triaza1h5-phosphabicyclo[3.3.0]octane (104) with five equivalents of b ~ t y l l i t h i u m .Further ~~ treatment of (105) with butyllithium or treatment of (104)with 20 equivalents of butyllithium gives (106) by a second, similar rearrangement. New oligomeric compounds (108) have been synthesised by acid-catalysed ring-opening of cyclic phosphorimidates (107) and shown to be intermediates in the acidcatalysed imide-amide rearrangement of (107) to give ( 109).84 0

The reaction of dialkyl phosphates with p-quinone methide (1 10) in the presence of a Bronsted acid has been investigated and shown to provide trialkyl phosphates with equilibrium conversions up to 8 3 % It~ has ~ ~ been reported that aryl phosphate, phosphonate and phosphinate esters and arylphosphine oxides are all effective sensitisers for the photoisomerisation of (2)cyclooctene to its highly-strained (E)-isomer.86The mechanism of bisalkylation by isophosphoramide mustard, the active metabolite of the anti-cancer agent ifosfamide, has been investigated via an NMR study of the reaction of the deuterated derivative (1 1 1) with t h i o ~ u l f a t eThe . ~ ~ distribution of products was consistent with bisalkylation via sequential aziridinyl intermediates, e.g. (1 12). Aldehydes and ketones are reported to be transformed into their a,p-unsatu-

99

3: Quinquevalent Phosphorus Acids

-@ MesOH

(R0)2P-O0 II

M+ +

or RCO&I

R

rated derivatives in moderate to excellent yield on treatment with allyldiethyl phosphate and sodium carbonate in the presence of 4 mol% Pd(I1) as a catalyst (Scheme 1 1).** A number of epimeric six-membered cyclic aryl thiophosphates (113) and (114) have been oxidised to the corresponding phosphates by R

-CHO

R

-CHO \

0

Reagents: i,

Na2C03, Pd(OAc)2 Scheme 11 OAr

OAr

(113) S

0

aqueous hydrogen peroxide and hydrogen chloride.89 The reaction is highly stereoselective with retention of configuration at the phosphorus centre and the results do not support the participation of pentacoordinate species as intermediates. Polyhydroxy benzene and quinone structures have a variety of biological activity and inositol is a potential source of such compounds. This has now been exploited in the synthesis of 1,2,3,4-tetrahydroxybenzene(116) from glucose, via the myo-inositol 1-phosphate (I 15), by a combination of enzymic and chemical methods.90 A chemosensor molecule (1 17) with selectivity for inositol triphosphate (IP3) has been r e p ~ r t e d . ~The ' use of (1 17)

100

Organophosphorus Chemistry

allows detection of IP3 at the nM level. An enzymic synthesis of 4-deoxy-~manno-2-octulosonic acid has ben reported in which the key step is the formation of the C5-C6 bond from a fructose- 1,6-bisphosphate aldolasecatalysed coupling of dihydroxyacetone phosphate (1 18).92 The reaction of diethyl phosphorocyanidate ( 1 19) with carboxylic acids provides a new route to the homologated a-hydroxy acids (120) in moderate to excellent yield.93

n R=

(117)

0

0

R02C (118) CH20H OH

0

II

2(EtO)*PCN + RC02H (119)

Et3N

THF

CN

0

HJO+

I

R-C-CN

I 0 1 0 1 . w w 2

RCHC02H

I

OH (120)

2.3 Selected Biological Aspects. - One limitation on the phosphorylation of phosphatidylinositols with PI 3-kinase has been demonstrated in that the fatty acid residue at glycerol Sn-2 must be no longer than octanoic acid to act as a substrate.94 A hybrid quantum mechanicdmolecular mechanical study of phosphoryl transfer in protein kinases has been reported.95 The conserved aspartate residue which is present in protein kinase and protein tyrosine phosphatase enzymes is thought to act as either a general acid or general base in reversible phosphorylation reactions that involve these enzymes.96Theoretical studies of this concept now suggest that in systems where the phosphate and aspartate groups are in close proximity it is the phosphate rather than the

3: Quinquevalent Phosphorus Acids

101

aspartate group which acts as the general acid or base. Two dimensional NMR spectroscopy has been used to study the bound structure of sulfotyrosine peptide IRK 1154, a known inhibitor of protein tyrosine p h o ~ p h a t a s eThe .~~ phosphotyrosine-containing peptide (121) is a high affinity ligand for the ~ 5 6 ' SH2 " ~ domain in intramolecular signal transduction proteins. A series of simplified analogues, e.g. (122), of (121) with comparable potencies have now been prepared.98 A novel catalytic triad (123) which has a dual function in the enzymic cleavage of the P-0 bond has been identified.99A new strategy for the synthesis of phosphorylated and glycosylated peptides using enzyme labile protecting groups has been reported. loo Two novel, fluorescent derivatives, ( 124) and (12 9 , of geranylgeranyl diphosphate have been prepared for use in elucidating the mechanism of RabGGTase and REP- 1.lol

R

0

COzH

I

rNHM, 7

1

'

0

(124) n = 1

Fosmidomycin ( 127) has been shown to inhibit 1-deoxy-D-xylulose 5phosphate (DXP) reductoisomerase in an alternative, non-mevalonate pathway for terpenoid biosynthesis.lo2 DXP reductoisomerase is a potential target for new antibacterial drugs. In related work ''C-labelled I -deoxy-Dxylulose 5-phosphate ( 126) together with the enzyme inhibitor fosmidomycin ( 1 27), have been used to investigate and confirm the presence of the deoxyxylulose pathway in chromo- and chloro-plasts of various higher plants.Io3A study using I 3C- and 14C-labelledpyruvic acid in the presence of 2-(dimethyl-

102

Organophosphorus Chemistry

amino)ethyl diphosphate, an inhi bi tor of isopentenyl diphosphate isomerase, has shown that the terminal metabolite for monoterpene biosynthesis via the deoxyxylulose-5-phosphatepathway is isopentenyl diphosphate. The isotopically enriched farnesyl diphosphate stereoisomer (128) has been prepared and used to study the stereochemistry, and hence the mechanism, of the protein farnesyltransferase-catalysed reaction with a peptide-derived cysteine residue. lo5 Following degradation, NMR spectroscopy was used to compare the enzyme reaction product with one which had been preparcd chemically. A new chemoenzymic approach to glyco-lipopolymers provides a practical synthesis of galactose-PEG-distearoylphosphatidic acid (129), which retains full lectin binding. lo6 Purified 3-deoxy-~-arabino-heptulosonate 7-phosphate (DAH 7-P) synthase, a key enzyme in the biosynthesis of phenylalanine, has been obtained by cloning and over expression in E. coli and shown to catalyse the Aldol-type condensation of PEP with various 5-carbon analogues of erythrose 4-phosphate to give, e.g. (1 30).lo7 The mechanism of the 3,4-dihydroxy-2butanone 4-phosphate synthase reaction in the biosynthesis of riboflavin has been investigated using (5R)-(131) and (5594 132)-[S2H11-ribulose 5-phosphate synthesised from (6R)- and (6S)-[6-2Hl]-glucose, respectively. lo8 The results add further support to the mechanism proposed earlier by Volk and Bacher. lo9

CH2-0-P(

0

OH

DAH7-P Synthase

OH

‘

cop-

HO OH

( 130)

CH20H I ? :OH H

OH

(131) X=2H, Y = ’ H (132) X = ’H, Y =2H

0 II 00-

3: Quinquevalent Phosphorus Acids

3

103

Phosphonic and Phosphinic Acids

The preparation and reactions of phosphonates containing a formyl group' lo and the synthesis, structure, properties and potential uses of molecular phosphonate cages"' have been the subjects of reviews.

3.1 Synthesis of Phosphonic and Phosphinic Acids and their Derivatives. - An improved method of synthesis of phosphonic acids, e.g. (134), from the reaction of white phosphorus with Barton PTOC esters, e.g. (133), has been reported. The new method allows even relatively sensitive acids and unsaturated acids to be used. A wide variety of phosphonates have been synthesised by the tetramethylguanidine-catalysed addition of dialkyl phosphites to aldehydes, ketones, imines, and a,P-unsaturated carbonyls and nitriles. Methyl- and difluoromethyl-phosphonateanalogues of phosphates are widely used in studies of biological activity. The reaction of primary triflates with dibenzyl lithiomethylphosphofiate (1 35) and dibenzyl lithiodifluoromethyl-phosphonate ( 136) provide routes to the substituted examples of the corresponding phosphonates. l4 The benzyl protecting groups may be removed by hydrogenolysis which offers a convenient alternative to the commonly used trimethylhalosilane deprotection.

'

0

QsOH DCC

0 II

(PhCH20)2PCXpLi (135) X = H (136) X = F

3. I . I Alkyl, Cycloalkyl, Aralkyl and Related Acids. Alkali metal alkoxides are effective catalysts in the synthesis of mixed esters of methyl phosphonic acid from dimethyl methylphosphonate by exchange of alkoxy groups with carboxylic esters (Scheme 12).I s Piperidine-4-yl-phosphinic (137) and phosphonic (138), and methyl(piperidin-4-y1)phosphinic (139) acid analogues of the GABA4 agonist piperidin-4-ylcarboxylic acid (isonipecotic acid) ( 140) have 0 II

f:

(MeO)*PMe + MeCOR

MOB^'

0

0

II II (RO)(MeO)PMe + MeCOMe scheme 12

H N D 1 - Z OH (137) Z = H (138) Z = OH (139) Z = M e

Organophosphorus Chemistry

104

’

been synthesised from N-ethoxycarbonyl-4-piperidine.I6 Two phosphonate analogues (142) and (144) of mannose 6-phosphate (M6P) have been prepared from suitably protected mannose.’I7 Compound (142) is formed via Wadsworth-Emmons phosphoryl-olefination of the aldehyde ( 141) while compound (144) is prepared by Arbusov phosphorylation of the bromide (143). Compound (142) is reported to bind to M6P receptors as effectively as M6P itself.

CHO 0 [(Et0)$]2CH

OBn BnO

BnO bOMe

A new total synthesis of (+)-phosphonothrixin (145) a novel, natural herbicide, has been reported! l 8 The route involves the E-allylphosphonate intermediate (146) and overcomes some of the difficulties of earlier routes. Stereoselective SnC14-promoted [2+l]cycloaddition reactions of 1-seleno-2silylethene ( 147) with 2-phosphonoacrylates provide highly functionalised cylcopropanephosphonate esters (148) in excellent yield.’ I9 This approach was used to synthesise the novel a-aminophosphonic acid (149), an analogue of homoserine. Polysubstituted a-chlorocyclopropylphosphonates, e.g, (150), have been synthesised with d.e.s of up to 100% by electroreduction of diisopropyl trichloromethylphosphonate in the presence of Michael acceptors

105

3: Quinquevalent Phosphorus Acids 0

0 II

Reagents: i, Mg anode, & c o w ,

II ('PIO)~F! \

,C02Me

.

DMF, Bu4N+BF4-

Scheme 13

(Scheme 13).120 The bivalent anchor (15 1) has been synthesised with a view to attaching redox assemblies to metal oxide semiconductors and shown to bind to doped indium oxide and titanium dioxide surfaces.121 Phosphonoboronates (152) have been prepared in good yields by the Arbusov reaction of 1iodoalkylboronates (Scheme 14).122Compounds (1 52) can be converted by selective deprotection or complete hydrolysis into phosphonic acid (153) or the phosphonic boronic acid (154), respectively.

( 152) (153) Reagents: i, (Me0)sP. 90 "C, 1 hr; ii, 2 x MeSSiBr; iii, MeOH; iv, 6N HCI, 1 hr Scheme14

3.1.2 Alkenyl, Alkynyl, Aryl, Heteroaryl and Related Acids. New, convenient methods of synthesis for vinylphosphonates are still needed. A report describing the preparation of 1-dialkylamino- and 1- and 2-alkoxy-vinylphosphonates by Ni(I1) and Pd(0) catalysed reactions of vinyl halides with trialkyl or dialkyl phosphites has appeared (Scheme 15).123A closely related method using Pd(0)-mediated alkyl halide coupling has been used to synthesise chiral 2-(alk-1-enyl)-1,3,2-diazaphospholidine2-oxides (155). 24 Compounds ( 155) undergo Diels-Alder reactions with a variety of dienes, generally in excellent yield and with some degree of diastereoselectivity. An alternative approach to

106

Organophosphorus Chemistry 0 II

RXp(oEt)2 R

d

Y \ R=HorMe Y = OR, NEtp X = Br or CI

li

/

Y

0 II Reagents: i, (Et0)3P, Ni(1I); ii, (EtO)pH, Pd(O), Et3N Scheme 15

M

M

Bn

?"

a,P-unsaturated phosphonates involves the addition of alkyl or aryl copper reagents to 1-alkynylphosphonates. 125 This reaction provides 2,2-disubstituted vinylphosphonates (1 56) in excellent yields and with high levels of regio- and stereo-selectivity. A variety of l-substituted analogues of (156) can also be prepared by trapping the intermediate carbanion, formed in the initial addition reaction, with various electrophiles. A series of vinyl- and arylphosphonates (1 57) and phosphonic bis(diethy1amides) (158) have been synthesised by Cu-promoted substitution of the cqrresponding bromides (Scheme 16) and their optical and second harmonic generation (SHG) properties investigated. 26

'

0 II

/ R'Br

R' P(OR2)2 (157)

(1 58)

R' = Ph, PhCH=CH, PhCH=CH-CH=CH, 0

II Reagents: i, (R20)2PH.CuI. base; ii, (Et2N)3P, CuI Scheme 16

The c h i d diarylphophinamide ( 160), derived from proline, has been prepared from the corresponding dimethyl ester ( 159).127 Compound ( 160) acts as an efficient chiral catalyst in the asymmetric reduction of ketones by

107

3: Quinquevalent Phosphorus Acids

borane, giving e.e.s of up to 94%. 6,6‘-Bis(diethoxyphosphoryl-1,l’-binaphthalene-2,2’-diol (1 61) and the corresponding acid (162) have been synthesised in both racemic and enantiopure forms by palladium-assisted phosphonation (Scheme 17). 12* In the case of enantiopure (1 61), the MgBr

“3

0

(Me0)2P-N

(1 59)

(161) R = Et (162) R = H

0

I1 Reagents: i, (RO)2PH, 5% PdC12(PPh&. 5% HSiEb, Et3N; ii, EtMgBr; iii, HCI(,,) Scheme17

phosphonation of the enantiopure bromide takes place with no epimerisation. The optically active diarylphosphinic acid (163) has been prepared in seven steps from phenylalanine. 129 Complexes of (1 63) with Zn(I1) bind M

aromatic guests carrying anionic (phosphate and carboxylate) groups, showing 1O3 fold discrimination in one case. P-Enaminophosphonate chemistry has been used to prepare a number of heteroaryl- and related phosphonates. These reports include one offering a new, simple route to 3phosphonyl-4-aminoquinolines( 164) (Scheme 1 8)I3O and one describing the synthesis of 5-phosphonylated- (166) and phosphorylated- ( 1 67) pyrimidin2,4-diones from functionalised amides ( 165), themselves derived from Benaminophosphonates. *

108

Organophosphorus Chemistry

0”“’-

R3NH

0

+ R12PCH&H0 0 II R’ = Ph, OEt

I1

QNfPR12

R2

R2

H

clll

~

0

&$”” R2

(164)

Reagents: i, BuLi; ii, R3NCO; iii, Ph3P, c2cl6, Et3N

scheme 18

(166) R 4 = A r (167) R4=NR2

(165) X = O o r S

3.1.3 Halogenoalkyl and Related Acids. Due primarily to their potential biological activity, or their use in the synthesis of such compounds, the large majority of examples in this area are fluoroalkyl compounds (fluorinated amino acid analogues are discussed in Section 3.1.6). The two main methods of synthesis continue to be electrophilic fluorination of phosphonate carbanions and reactions of carbanions of a-fluorinated methylphosphonates. The novel (halogenomethanetriy1)trisphosphonic acids (169) and ( 170) have been prepared from (methanetriy1)trisphosphonate (168) by electrophilic chlorination and fluorination, respectively (Scheme 19).132Compounds (169) and (170) are

(170) Reagents: i, NaOCI, NaHC03, 0 “C; ii, TMSBr, Bu3N, CH&12; iii, FC103, NaHMDS, THF scheme19

‘supercharged’, i.e. have an exceptionally high net negative charge at physiological pH, when compared to pyrophosphoric acid. An X-ray structure of the fluorinated analogue (170) indicates that in many respects it is a good isostere of pyrophosphoric acid. Examples of the alternative approach to halogenoalkylphosphonates include a convenient synthesis of functionalised 1-fluoroalkylphosphonates by the reaction of zinc (171) and copper (172) organophosphonates with electrophiles (Scheme 20).1 3 3 A new route to 1,1difluoroallylphosphonates (1 74), in moderate to good yield, involves the cerium-catalysed Michael-addition of lithium 1,l -difluoromethylphosphonate to vinylsulfoxides (173) followed by thermal elimination of sulfoxide (Scheme 21).134 No reaction was observed in the absence of cerium salts. The 4(difluoromethylphosphony1)phenyl triflate ( 175) has been prepared from 4-

109

3: Quinquevalent Phosphorus Acids 0 II

(Et0)2PCFHZnBr

I

0 II

(Et0)zPCFHR’

( E t 0 ) 2 kFHCU (172)

ii R’ = RCH=CH, R C Z , (Et0)2P, Ar, CO2Et Reagents: i, R’X; ii, CuBr, THFIDMF, 0°C Scheme 20

R’

R’

R’

0 II

I

R2,

A

i

Reagents: i, 3 x CeCl3, THF, -78°C; ii, A, PhMe scheme21 0

0

II

Reagents: i, (EtO)2PCF2ZnBr,CuBr, sonication, 18 h; ii, ArSnBu3 or ArB(OH)2 scheme22

iodophenyl triflate by reaction with zinc difluoromethylphosphonate. 135 Compound (175) has been used in Stille and Suzuki coupling reactions to provide a large number of 4-substituted aryl(difluoromethy1)phosphonates (176) (Scheme 22). 3. I . 4 HydroxyaZkyl and EpoxyalkyZ Acids. Hydrophosphonylation of ketones and aldehydes continues to be used as a convenient and efficient route to both racemic and optically active a-hydroxyalkylphosphonatesand -phosphinates. (or-Hydroxyalky1)phosphinic acid, and hence the corresponding phosphonic acid, amphiphiles ( 177) have been conveniently synthesised by sonication of heterogeneous mixtures of aqueous hypophosphorous acid and long-chain aldehydes in the presence of hydrochloric acid as a catalyst. 136 Minor amounts of the bis-addition product (178) are also formed. A variety of approaches hydroxyhave been investigated for the synthesis of non-racemic dimethyl a-( farnesy1)phosphonate (179). 137 Problems were encountered in all the methods used. For example, although diastereomeric esters of (179) could be prepared and separated, extensive isomerisation took place on hydrolysis back to the acid. Ultimatedly both enantiomers of (179) were prepared with low enantiomeric excesses. Other reported attempts to synthesise optically active ahydroxyphosphonates have avoided this problem by confining themselves to the preparation of esters. The structural effects of a wide range of chiral diol

110

OrganophosphorusChemistry OH 0 I I,H

HCI.

H3PO2 + Me(CH2),&H0

* Me(CH2)&H-kOH H@, Dioxan, Sonication (177)6 W %

0

-

+

OH 0 I II [Me(CH&CHI2POH (178) 3-7%

0

i

II (Me0)2PH

+

RCHO

OH

Reagents: i, E t g , 20 mol% Ti(O'Pr)4,20 mol% Chiral diol

Scheme 23

ligands on the titanium tetraisopropoxide-catalysed phosphonylation of aldehydes (Scheme 23) have been investigated.13*Enantiomeric excesses of up to 70% were obtained. In a separate report a number of polysubstituted BINOL derivatives have been synthesised and their lanthanide salts investigated as catalysts for asymmetric phosphonylation of aldehydes (1 82).13' Bulky 3,3'substituents in the BINOL derivative, for example (180), reduce enantioselectivity. The best results, giving moderate e.e. values, were obtained with the 6,6-diphenylsubstituted derivatives ( 181). At best moderate diastereoselectivity has been obtained in the formation of the phosphonate analogue (183) of 3-

(180) R' = H, R2 = SiMe:, (181) R' = Ph, R2 = H

0 II

(Et0)2PH + R

OH

e

C

.

0

Chiral La Cat.* THF, -40 "C

0

R ~ ~ H - - b ( ( O E t ) ~

phenylisoserine through the reaction of the aminoaldehyde with diethyl phosphonate under various conditions. 140 Acylphosphonates and acylphosphonic acids are readily available from acylation of phosphites. a-Hydroxy-

3: Quinquevalent Phosphorus Acids

111

alkanephosphonic acids (184) and a,o-dihydroxyalkane-a,o-bisphosphonic acids (1 85) have now been conveniently prepared by borohydride reduction of the corresponding a-acyl and a,o-diacyl phosphonic acids. 141 The structure of the sodium salts of (1 84) and (185) have been investigated by NMR spectroscopy. The use of asymmetric reduction in this synthetic approach offers a possible solution to the synthesis of enantiopure a-hydroxyalkylphosphonic acids (see reference 137). Racemic 4-amino- I-, -2-, and -3-hydroxybutylphosphinicacids (186) and the corresponding methylphosphonic acids (187) have been prepared as potential GABAAand GABABreceptor binders. 142 None of the compounds synthesised showed activity. The first stereoselective synthesis of phosphocarnitine (188), the phosphonate analogue of carnitine (189), has been achieved from (R)-(-)epichorohydrin. 143 With a view to obtaining analogues of 2-deoxy-a-~-ribose1-phosphate, phosphonate derivatives ( 190) of 2-deoxyribose and 2-deoxy-2fluoroarabinose have been synthesised and their conformation investigated by NMR spectroscopy.14 None of the analogues prepared showed inhibitory activity towards E. coli thymidine phosphorylase. OH 0

I

II

R-CH-P(OH)2 (184) R = Ph, PhCH2

OOH OH0 II I \ II (H0)2PCH(CH2)$HP(OH)2 (185) I/ = 4, 5, 6

OH

0 I I OH

H2N(CH2)s'H(CH2)R
3.1.5 Oxoalkyl Acids. Acylphosphonates (192) have substantial potential as

reagents and intermediates. However, their synthesis by oxidation of the readily available a-hydroxyalkylphosphonates (19 1) has only been achieved for a small number of special cases. It is now reported that the use of chromium dioxide in refluxing acetonitrile allows the synthesis of a wide range of acylphosphonates from corresponding hydroxyphosphonate. 145 Dipeptidyl analogues ( 193), containing phosphonate, phosphinate and phosphine oxide groups, have been synthesised as potential mimics of peptide a-ketoesters and a - k e t 0 a ~ i d s .Some l ~ ~ of these compounds act as potent inhibitors of human calpain I, which may play a crucial role in several pathological processes. The functionalised phosphonate (195) has been prepared in five steps from but-1yne-4-01, with the reaction of dimethyl methylphosphonate Grignard reagent

112

Organophosphorus Chemistry

and the activated ester (194) as the key step.147Compound (195) undergoes Wadsworth-Emmons reactions without any observable 1,4-elimination.

0 (193) AA = Leu, R3 =

AA = Val, R3 = CH2Ph; R’ = R2 = Ar, Me R’ = Ph, R2 = OEt R’ = R2 = OR

0 N(OMe)2 + B ~ M S C0 IIH ~ P ( O M ~THF )~

TBSO

CI

0

W b ( ( O M e ) , TBSO

-78°C

CI

0

3.1.6 Aminoalkyl and Related Acids. The condensation of aldehyde, amine and

dialkyl phosphite to give a-aminoalkylphosphonates (the Kabachnik-Fields reaction) is well known and widely used. It is now reported that this reaction is catalysed by lithium perchlorate-diethylether to give excellent yields of phosphonate amino acid analogues (196).148 Diastereomeric excesses of up to 80% were obtained from reactions using chiral amines or aldehydes. N-(Phosphinoylmethy1)amino derivatives are non-hydrolysable mimics of the hydrolysis-sensitive N-phosphinoylamino derivatives. A number of such derivatives, e.g. (197), of amino acids have now been synthesised and converted into N(phosphinoylmethy1)amino derivatives of acids ( 198), amides, amino acids (199), etc.’49Optically active aminophosphinic acids (201) have been prepared with e.e.s of 80-98% by catalytic asymmetric hydrogenation of the corresponding a,P-unsaturated aminophosphinic acid (200),using Rh(1) catalysts, e.g. (202). 150 Lipase-catalysed desymmetrisation by either ester hydrolysis or formation has been used to generate the enantiopure chiral centre in a

f: R’CHO

+

R22NH + (Me0)2PH

-

R ~ ~ N

LDPE, RT

R’

P(OMe)2

(197) R’,R2 = OMe, OH, Ph

113

3: Quinquevalent Phosphorus Acids

"" (202)

R'

NHCOPh

0 I I,OR2

R'CH2--

HR3 NHCOPh

'

synthesis of phosphonate analogues of tyrosine phosphate. 5 1 The 173-propanediols (203) or the corresponding diacetates (204) are converted into the enantiomeric monoacetates which provide the tyrosine phosphonate analogues through a further four chemical steps (Scheme 24). The synthesis of phosphonates containing aziridine rings1s2-153 and ones containing azirine rings'53 have been reported. 1-Phosphono-2-aza- 173~dienes (206) have been prepared by chlorination/dehydrochlorinationof W(phosphonomethy1)imines (205) and converted into 1-vinyl-2-phosphonoaziridines(207) by reaction with diazomethane (Scheme 25). 152 An alternative route to aziridine 2-phosphonates, e.g. (209), and hence 2-phosphonoazirines, e.g. (2 lo), is available through the reaction of enantiopure (3-sulfinimne (208) with chloromethylphosphonate carbanion (Scheme 26). Llpase . PS,

(Et0)2!CX2%

(EtO)$CX2% 0 c

Vlnyl acetate, THF

OH

OH

OH

OAc

(203) X = H , F

0

0

( E t 0I I ) 2 p c x 2 y 9 5

(Et0)2pcx2% II

Lipase PS,

.w

Phosphate M e r

OAc (204) X = H, F

OAc OH

OAc Scheme24

Reagents: i, NCS, CC4, ii, NaH, THF; iii, 5 x CH2N2,Et20

Scheme 25

Organophosphorus Chemistry

114

i’

H

(208)

Ph

Q..,,

pToi/\N=(

i

~T~I~I’+”H

t i +

(Et0)2P+

Ph

t i

(Eto)2pPph CI

CI

I ii,

p T ~ l y l / ~NH \

iii

Q

I Ii,

lii

+ o It

Ph N H 0 P(OEt)2 II

0 Ph (210)

(210)

0

II Reagents: i, CICH2P(OEt)2, LiHMDS; ii, NaH; iii, CFS02H; iv, DMSO, (COC1)2; v, Et3N scheme26

1,2-Dihydropyridine phosphonate derivatives (2 11) are the unexpected products of attempts to react dialkyl phosphites with ethyl propiolate in the presence of ~ y r i d i n e . ’The ~ ~ activation of pyridine rings by reaction or coordination at nitrogen is well known, and presumably accounts for the reported results. Tetraalkyl(pyrrolidine-2,2-diyl)bisphosphonates(2 12) and the corresponding nitrones (213) have been synthesised, and the use of (213) as a spin trap has been investigated by ESR.’55 Single enantiomers of both cis-(:! 14) and tram(215) 2-(isocyanomethyl)-5,5dimethyl-2-0~0-4-phenyl1,3,2-dioxaphosphorinanes have been synthesised and their structures investigated by X-ray ~rystallography.’~~ Compounds (214) and (215) are the first reported examples of chiral isocyano-methylphosphonates. Cyanophosphonate anions are potential intermediates for the synthesis of a variety of organophosphorus compounds and convenient routes to both the dianion and monoester monoanion have now been r e ~ 0 r t e d . I ~ ~ Diethyl cyanophosphonate (2 16) undergoes dealkylation on treatment with

3: Quinquevalent Phosphorus Acids

115

iodomethylsilane to provide the corresponding diacid, which can be readily converted to a range of salts (Scheme 27). The monoester anions were prepared by treatment of (216) with sodium, phosphonium, sulfonium and ammonium iodides or bromides.

Reagents: i, MesSiI; ii, ROH; iii, Base; iv, I-

Scheme27

Phosphonic and phosphinic acid-containing ligands, e.g. (2 17), have been synthesised and used in luminescence sensors. Following rational molecular design, a variety of macrocyclic organophosphonate compounds, e.g. (2 18), have been synthesised and shown to act as inhibitors of cement setting.’59

8 Me @) =

(218)

uw 8 @) = P
3.2.7 Sulfur- and Selenium-containing Compounds. Few methods exist for the synthesis of P-fluoro phosphorus dithioacids (220) in spite of their potential as reagents, ligands and stereochemical probes. It has now been reported that a wide range of such compounds can be efficiently prepared from the phosphonodithioites (2 19) by sulfurisation and fluorination (Scheme 28). 160

Reagents: i, S8, PhH; ii, TBAF, THF

Scheme 28

3.1.8 Phosphorus-Nitrogen Bonded Compounds. In continuing studies of phoshorylated imines, enamines, and azadienes the synthesis of N-phosphorylated azadienes (22 1), from a,P-unsaturated oximes, and the derived primary (a-allylamines (222) has been reported (Scheme 29).16’ A new series of hydroxamic acid- based metallopro teinase inhibitors (223), containing the phosphinamide motif derived from D-amino acids, have been

Organophosphorus Chemistry

116

+ CIPR42

-

Reagents: i, EbN; ii, NaBH4, EtOH; iii, HCI

Scheme 29

(223) R3 = R4 = alkyl or phenyl

synthesised. 16* Compounds with the (R)-configuration at phosphorus were potent MMP inhibitors, whereas those with the (3-configuration were generally inactive. 3.1.9 Phosphorus-Containing Ring Systems. The previously reported ringclosing metathesis reaction of allyl- and vinyl-phosphonic acid derivatives has now been extended to provide a new route to various five-, six-, and sevenmembered phosphorus heterocycles, e.g. (224-226). 163 A similar approach,

involving ruthenium-catalysed metathesis, has been used to prepare a variety of cyclic phosphinates (228) in excellent yield from diallylphosphinates (227).164 trans-2,5-Diphenylphospholanicacid (229) has been synthesised, resolved and converted into optically active 1,2,5-triphenylphospholane (230).’65Compound (230) was used as a chiral ligand in the rhodium-catalysed hydrogenation of protected dehydrophenylalanine to give protected phenylalanine in quantitative yield and with 82% e.e.

(227)n = 1, m = 1 n=l, m=2 n=2,m=2

1

Ph

1

Ph

117

3: Quinquevalent Phosphorus Acids

1,5,2-Diazaphosphorines (232) have been prepared by the reaction of penaminophosphonates (23 1) with isocyanates followed by treament with base (Scheme 30). 166 Cyclotrimethylene-triphosphonic acid (234) and its sodium salt have been synthesised by acid hydrolysis of the triphosphinine (233) and their structures investigated by NMR spectroscopy. 167 The synthesis of phospho-sugar analogues, e.g, (236), of D-mannosamine, by reduction of the mannofuranoside phosphonate and subsequent cyclisation and re-oxidation (Scheme 3 l), has been reported. 0

II WOW2

R'

NH2

,,

-

R'

(231)

Reagents: i, R'NCO; ii, LDA

?\ PE'

'-. INA0

H

N R ~

H (232)

Scheme 30

0

II C O B " Map-

I

Me0

(235) Reagents: i, NaBH2(0CH2CH20Me)2;ii, HCI; iii, H202

Scheme 31

3.2 Reactions of Phosphonic and Phosphinic Acids and their Derivatives. Reactions of vinylphosphinate and phosphonate compounds provide routes to a variety of functionalised derivatives. Vinylphosphonates (237) and vinylR' RbP(OR),

d'

HC02-+NH4 - RL d'

PdlCs

R2

P(OR)2

sulfones have been reduced to the corresponding saturated compounds in excellent yields by the ammonium formate/Pd-carbon system. 169 This provides an alternative to current methods which require medium pressures of hydrogen or expensive catalysts. 2-Dialkylthio- (238) and alkoxy-substituted (239) vinylphosphonates have been converted into a variety of 1-substituted derivatives, and further derived structures, viu reaction of electrophiles with the 1carbanions and by Friedel- Craft-type reactions (Scheme 32).170 The products

118

Organophosphorus Chemistry

Reagents: i,

a,

RS

COR‘

THF; ii. E; iii, R’COCI, AIC13, CH&I2

Li

Scheme 32

(240) from the latter reaction have been used to prepare a variety of other phosphonate structures. The reaction of (4-oxo-4H-chromen-3-yl)phosphonates (241) with amines has been investigated and shown, in the case of priamry amines, to give novel cyclic phosphonic acid analogues (242) of chromone. 17’ 3-Phosphonyl-2-aza- 1,3-butadienes (244) have been prepared by Wadsworth-Emmons reaction of the bisphosphonylalkylimine (243). 172 The 2azatriene analogues of (244) undergo intramolecular Diels-Alder reaction and aromatisation on heating to give substituted 2-phosphorylated pyridines (245) (Scheme 33). Radical cyclisation involving a,P-unsaturated phosphonates (246) has been used as the key step in the synthesis of phosphonic analogues (247) of kainoids, structures which have pronounced neuroexcitatory properties. 73 Harger’s group has continued their investigations of reactions involving or appearing to involve three-coordinate quinquevalent phosphorus acid inter-

’

Reagents

I,

R’CHO. ii, Base: iii. R2CHO; iv, A scheme 33

3: Quinquevalent Phosphorus Acids

119

0

X

PhS

(247)

(246) X = OMe, H

mediates. The conversion of phosphonamidic chloride (248) to (251) by reaction with diethylamine is reported to be much slower than the similar reaction of the corresponding thiophosphoryl compound (249).174 Evidence supports tricoordinate pentavalent phosphorus intermediates (250) in both reactions. The stereoselectivity of the analogous substitution reactions of the phosphonamidic chloride (252) with secondary amines to give (254) depends on the steric bulk and concentration of the amine used.175It is suggested that two elimination pathways may be involved, both incorporating the phosphene intermediate (253) but differing in whether or not (253) becomes fully liberated

E12NH

Et2NH ___)

(248) X = 0 (249) X = S Me

(251)X = O Me

-

,NR2 ..., Me NCHMePh 0 (254)

R'2CH-P

CI

(253)

11

before reaction. Further evidence for the involvement of the thiophosphene intermediate (256) in these reactions is provided by the fact that almost identical isomer ratios are obtained from the reaction of each of the two diastereoisomers of the acid chloride (255) with diethylamine (Scheme 34).176 A further detailed investigation of the base-induced rearrangement of N phosphinoyl- O-sulfonylhydroxylamine (257) has been reported. I 77 Compound (257) reacts with t-butylamine to give the rearrangement product (259). Although the previously postulated metaphosphonimidate intermediate (260) may be involved, at low concentrations of amine another intermediate,

120

Organophosphorus Chemistry

identified as (258), has been observed by 31PNMR. The stereochemistry of the reaction of the enantiopure phenylphosphamidothioic acid 26 1 with alcohols to give (263) has been investigated.178In most cases the reactions are largely non-stereoselective which indicates the involvement of a thiometaphosphonate intermediate (262).

A stereospecific synthesis of P-chiral sulfenyl chlorides, e.g. (264), from Pchiral sulfenylamides has been reported. 79 The sulfenyl chlorides react stereospecifically with secondary amines indicating that the sulfur atoms do not become equivalent during the replacement. The effect of the nature of the base used to catalyse the reaction of methanesulfinyl chloride (265) and methylphenylphosphinyl chloride (266), respectively, with chiral alcohols has been investigated.lso The diastereoisomeric ratios obtained in each case show large variations and are dependent on the nature of the base. The authors suggest that hypervalent intermediates are involved in the reactions. Cyclic a,P-unsaturated N-diphenylphosphinyl imines (267) are reduced stereoselectively to the protected allylic amines (268) by 9-borabicyclo[3.3.1]nonane (9-BBN) and by di-iso-butylaluminium hydride (DIBAH). 8 1 Previously the use of lithium tri-sec-butylborohydride in these reactions had led to concurrent reduction of the C-C double bond. The use of 1-alkoxy-2-hydroxy3-amino-3-phenylpropane chiral ligands in the asymmetric addition of diethyl-

3: Quinquevalent Phosphorus Acids

121

(264)

-

0

II Me,S,CI

0, *:,

Base

+ 'ROH

S

/ \

+

Me OR'

(265)

'i60 / \

Me OR"

-

0

Base

II

Me-P, + 'ROH Me' cI (266)

ph, 0 0, p h P + ,Pi /\ Me OR" Me OR'

zinc to N-diphenylphosphinoyl imines (269) has been investigated. 18* The highest e.e. values were obtained using bulky alkoxy substituents and a dual catalytic system incorporating bulky chlorosilanes (Scheme 35). The phosphin0 I1

1-111

*r~N'PPh2 (269)

Et 0 II ArAN,PPh2 H e.e. 1 6 1 9%

NMe2

Reagents: i, Ph' b O ' C P h 3 I

OH

; ii, 3 x Et2Zn,0°C;iii, R3SiX,-20 "C Scheme 35

amide N-protecting group is reported to encourage excellent diastereoselectivity during the reduction of proximinal ketone f ~ n c t i 0 n s . l For ~~ example, borane reduction of (270) gives exclusively the diastereoismomer (271). Reactions of acyltributylphosphonium chlorides (272), and diethyl (273) and di-iso-propyl (274) acylphosphonates with Grignard reagents have been investigated and evaluated as new routes to ketones.'84 Although the reactions of (273 and 274), unlike those of (272), require a further hydrolysis step, they produce less side reactions over a variety of substrates and are therefore the preferred method. A new, efficient route to a-chloro-fatty acids is provided by chlorination of long-chain acylphosphonates (275) followed by oxidative hydrolysis (Scheme 36). 185

Organophosphorus Chemistry

122

O R M P0h Ph2P-N II H (270) R = CHMe2, CH2Ph

= THF

0 I1 R)-(ph

Ph2P-N OH H (271) R = CHM+, CH2Ph

(273) R = Et (274) R = ‘Pr

I

(275)

0 C H 3 ( C H 2 ) n y c , I0I H

-

ii

qAOH

CHdCH2)n

iii. k

CI CI Reagents: i, S02C12, RT, 7 h; ii, 4 x H202,4 x NaHC03; iii, H202; iv, HCI

Scheme 36

A new approach to the synthesis of thiopeptides via ring-opening reactions of the cyclic thiophosphondiamides (276) has been suggested.’86 Model reactions using the analogue (277) gave excellent yields of the ring-opened products, e.g. (278). The kinetics of intramolecular nucleophilic substitution reactions of the phosphonate anions (279) and (280) to give five- and sixmembered rings, respectively, have been reported. 187 Surprisingly the rate of five-membered ring formation is only four to six times faster than that of six-

Me ‘PrNH2

‘

N

Me,

H20

Me (277)

0

I I Ph XCH~CH~(CH~)&H~P( 0(279) n = 0; X = Bt, CI (280) n = 1; X = Bt, CI

s”P,

S Me II ,NCH2CNHMe

0- ‘PriH3

3: Quinquevalent Phosphorus Acids

123

membered ring formation. The first examples of intramolecular cyclopropanation of a-diazophosphonates (28 1) catalysed by rhodium diacetate have been reported.lg8 Mixtures of (282) and (283) were obtained with moderate levels of diastereoselectivity. Diazaphospholidine oxides (284) are reported to undergo stereospecific ring-expansion reactions to give, e.g.

pseudorotation 8xLDA

c

ellrnlnailon

___)

-78 "C

Pd (284)

6" (286)

(286). A mechanism involving a trigonal-bipyramidal intermediate (285) is postulated. Enantioselective oxidation of alkylthiomethylphosphonates (287) with organic hydroperoxides in the presence of titanium diethyl tartrate complexes gave the corresponding sulfoxide (289) with moderate to good e.e.s. Alternatively monomethyl esters (288) were oxidised with achiral and chiral oxidants, In the latter case high d.e. values were obtained. The reaction of (289) with Grignard reagents provides a new route to enantiomerically pure arylalkyl and dialkyl sulfoxides.19' 1907191

(287) R 2 = Et (288) R2 = Menthyl

Phosphonic and phosphinic acid derivatives have been widely used as catalysts and selective receptors. Examples of the former include chiral ohydroxyarylphosphinic acid derivatives, e.g. (290), which have been investigated as catalysts for the asymmetric addition of diethylzinc to benzaldehyde.19* 1-Phenylpropanol is obtained with e.e.s of up to 98%. Phosphinic Etgn. THF. 20 "C

PhCHO 5 rnoFo.e.g (290)

*

OH Ph-CTH Et

124

Organophosphorus Chemistry

and phosphoric mono- and diacids catalyse the reaction of diamines with diphenyl carbonate, providing convenient routes to mono-(29 1) and di-(292) carbamates. 93 Zirconium sulfophenylphosphonate (293) is reported to be an efficient catalyst for the THP protection of alcohols and phenols. 194 Simple xylylene bisphosphonates have previously been shown to act as selective artificial receptors for 1,2- and 1,3-aminoalcohols. In an extension of this work structure-selectivity has been investigated for the interaction of the bisphosphonate (294) with a number of aminopyranoses and an open-chain amino sugar alcohol. 195 P-Add

H2N- Ar- NH2 (PhO)&

H2N-Ar-NH2

=0

P-Acid 2 x (PhO)&=O

* PhOCONHArNH2 + PhOH (291 )

* PhOCONHArNHC02Ph + 2PhOH (292)

Zr(03PMe)1.2(03P +so3w*.13 (293)

3.3 Selected Biological Aspects. - Bisphosphonate derivatives continue to be of interest not only in the treatment of bone disorders but also as analogues of pyrophosphate, other diphosphates, and phosphocarboxylic acids. The bisphosphonate anhydrides (296) have been synthesised, from the tetrasodium salt (295) of the osteoporosis drug clodronate, and evaluated as bioreversible prodrugs with increased oral availability. 196 With a view to producing potential cardiovascular drugs, a series of novel analogues, e.g. (297-299), of 1,3bisphospho-D-glyceric acid have been synthesised and their binding to phosphoglycerate kinase e ~ a 1 u a t e d . IThe ~ ~ most effective ligands bind up to 100 x more strongly than 3-phospho-~-glycericacid. Potential inhibitors (301) and (302) of mammalian dihydroorotase have been designed, synthesised from the amino acid (300) and evaluated against the enzyme.198Compounds (301) and (302) showed marginally greater activity than the previously evaluated oxygen analogue. A number of peptide-containing phosphonate analogues of tyrosine phosphate have been evaluated as inhibitors of the association of phosphatidylinositol 3-kinase with platelet-derived growth factor-p receptor. 199 A wide variety of non-phosphate-containing ligands, including methylenephosphonate, e.g. (303), and difluoromethylenephosphonate, e.g. (3041, analogues are reported to be potent inhibitors of Grb2 SH2 domain binding.*OOThe inhibition by L-leucinephosphonic acid of the aminopeptidase from Aerornonas

125

3: Quinquevulent Phosphorus Acids

proteolytica has been investigated with a view to gaining an understanding of the mode of function of dinuclear metallohydrolases.20' Using diphenyl 1-(S)prolylpyrrolidine-2(R,S)-phosphonate (305) as a lead compound, a variety of di(substituted phenyl) 1-(S)-prolylpyrrolidine-2(R,S)-phosphonates have been synthesised with a view to producing more potent inhibitors of dipeptidyl peptidase IV, an enzyme involved in cell proliferation. Compound (306) was a much more potent inhibitor than (305).202With new antibacterials as the ultimate target, computer graphics molecular modelling studies of the active site of lumazine synthase have been carried As a result of these studies three phosphonic acids, (307)-(309), have been identified as potential inhibitors of the enzyme and synthesised. Compound (309) was found to be the most potent inhibitor of lumazine synthase so far reported.

(305) A r = P h (306) Ar = ( e N H A c

(307)n = 4 (308)n = 5 (309)n = 6

F F

Two phenylalanine derivatives (3 10) and (311) have been synthesised as haptens with a view to raising monoclonal antibodies with esterase activity.204

126

Organophosphorus Chemistry

Whereas 17 out of 41 antibodies raised against the negatively charged (310) show such activity, no activity was observed in any of the antibodies generated against (311). An ab initio study also indicated that the negative electrostatic potential around phopshonyl oxygen was important in inducing esterase activity. Haptens containing phosphorane, e.g. (3 12), and a-hydroxyphosphonate, e.g. (313), structures have been synthesised for the selction of monoclonal antibodies with phosphatase-like activity, with the ultimate aim of detoxifying organophosphorus chemical weapons.205 Compounds (3 12) were unsuitable due to the bulky substituents required for chemical stability. A variety of organophosphorus warfare agents, e.g. sarin, soman, and VX, ultimately degrade to methylphosphonic acid and so a convenient, portable detection method for this compound would be very useful. Such a method, based on a cloned antibody with a high level of specifity for methylphosphonic acid and with a detection limit of 200 ppb, has now been developed.*06 0

0

0

R = NH-protein (310) X = O , Y = O (311) X=NH, Y=OMe

4

Structure

The rotational barriers of various neutral and ionic methyl phosphates, phosphorothioates, and phosphonates have been investigated using theoretical methods.207The main purpose of the work was to examine models for DNA linkages but the results have wider applications. The rotational barriers of the N-formyl-N-phosphonomethylglycines(3 15) and (3 16), prepared by the reaction of N-phosphonomethylglycinate (3 14) with triethyl orthoformate, have

EtOC0,NvP(OEt)2 EO t CON ,P ,\ (OH)2

H

II

CHO 0 I II

. (EtO)$H

(31 5)

+

CHO 0 I

(314)

H02C\,NvP(OEt)2

(316)

I1

3: Quinquevalent Phosphorus Acids

127

been investigated by 'H and 31PN M R spectroscopy and by theoretical methods.208 Individual diastereoisomers (3 17) and (3 18) of chiral 2pyridinylphosphonate have been prepared and their conformation, and that of some derivatives investigated by NMR and X-ray methods.209The stability and structure in solution of various metal ion complexes of acetyl phosphate (3 19) and acetonylphosphonate (320) have been studied.210 The relative binding affinities of bis(thiouronium) receptor (321) for anions of aryl phosphate monoesters, arylphosphonic acids and phosphoric acid have been determined in D M S 0 . 2 1 With the exception of phosphoric acid mono anion (the strongest binder) the affinities correlate well with the basicity of the anions. A novel, phosphate-containing cyclic depsipeptide, chymotrypsin inhibitor has been isolated from the cyanobacterium Microcystis aeruginosa and its structure established by chemical degradation and 2D N M R spectroscopy.212

'

fNH

HN]

2Br-

References 1 2 3 4 5

6 7 8

T. Wada, A. Mochizuki, Y. Sato, and M. Sekine, Tetrahedron Lett., 1998, 39, 7 123. J. Zhou and R. Chen, J. Chem. Soc., Perkin Trans. I , 1998,29 17. K. A. Van Houton, C. M. Boggs, and R. S. Pilato, Tetrahedron, 1998,54, 10973. A. Koohang, R. M. Coates, D. Owen, and C. D. Poulter, J. Org. Chem., 1999, 64, 6. M. Sprecher, R. Breslow, R. Philosof-Oppenheimer,and E. Chavet, Tetrahedron, 1999,55,5465. C. Larri, D. Bressolles, C. Turrin, B. Donnadieu, A-M. Caminade, and J-P. Majoral, J. Am. Chem. Soc., 1998,120, 13070. A. de la Cruz, K. J. Koeller, N. P. Rath, C. D. Spilling, and I. C. F. Vasconcelos, Tetrahedron, 1998,54, 1051 3. S. E. Denmark, X. Su, Y. Nishigaichi, D. M. Coe, K-T. Wong, S. B. D. Winter, and J. Y. Choi, J. Org. Chem., 1999,64, 1958.

128 9 10 11

12

13 14

15 16 17 18

19 20 21 22 23 24 25 26 27 28 29 30 31

32 33 34 35 36 37 38

Organophosphorus Chemistry M. L. Mussons, C. Raposo, M. Fe de la Torre, J-R. Morin, and M. C. Caballero, Tetrahedron, 1999,55,4077. K.M. J. Brands, K. Wiedbrank, J. M. Williams, U-H. Dolling, and P. J. Reider, Tetrahedron Lett., 1998,39,9583. C. P. Chow and C. E. Berkmann, Tetrahedron Lett., 1998,39,7471. C . Mathe, C . Perigaud, G. Gosselin, and J-L. Imbach, J. Org. Chem., 1998, 63, 8547. A. B. Smith, 111, G. K. Friestad, J. J-W. Duan, J. Barbosa, K. G . Hull, M. Iwashima, Y. Qiu, P. G. Spoors, E. Bertounesque, and B. A. Salvatore, J. Org. Chem., 1998,63, 7596. X. Fu, F. J. Schmitz, M. Kelly-Borges, T. L. McCready, and C. F. B. Holmes, J. Org. Chem., 1998,63,7957. U. E. Udodong, W. W. Turner, B. A. Astleford, F. Brown, Jr., M. T. Clayton, S. E. Dunlop, S. A. Frank, T. L. Grutsch, L. M. LaGrandeur, D. E. Verral, and J. A. Werner, Tetrahedron Lett., 1998,39,6115. P. J . Garegg, J. Hansson, A-C. Helleand, and S. Oscarson, Tetrahedron Lett., 1999,40,3049. P. Busca and 0. R. Martin, Tetrahedron Lett., 1998,39,8101. 0.J. Plante and P. H. Seeberger, J. Org. Chem., 1998,63,9150. F-T. Ferse, K. Floeder, L. Hennig, M. Findeisen, P. Welzel, D. Miiller, and J. van Heijenoort, Tetrahedron, 1999,55, 3749. N . El-Abadla, M. Lampilas, L. Hennig, M. Findeisen, P. Welzel, D. Muller, A. Markus, and J. van Heijenoort, Tetrahedron, 1999,55, 699. S. Riedel, A. Donnerstag, L. Hennig, and P. Welzel, Tetruhedron, 1999,55, 1921. M. Upreti and R. A. Vishwakarma, Tetrahedron Lett., 1999,40,2619. A. P. Higson, Y. E. Tsvetkov, M. A. T. Ferguson, and A. V. Nikolaev, J. Chem. SOC.,Perkin Trans. I , 1998,2587. I. A. Ivanova, A. J. Ross, M. A. J. Ferguson, and A. V. Nikolaev, J. Chem. Soc., Perkin Trans. I , 1999, 1743. B. S. J. Blagg and C. D. Poulter, J. Org. Chem., 1999,64, 1508. B. R. Dent, R. H. Furneaux, G. J. Gainsford, and G. P. Lynch, Tetrahedron, 1999,55,6977. M. Beaton and D. Gani, Tetrahedron Lett., 1998,39, 8549. A. V. Rukavishnikov, M. P. Smith, G. B. Birrell, J. F. W. Keana, and 0. H. Griffith, Tetrahedron Lett., 1998,39, 6637. D. Stone, D. J. Miller, M. W. Beaton, T. J. Rutherford, and D. Gani, Tetrahedron Lett., 1998,39,4875. M . Vieira de Almeida, D. Dubreuil, J. Cleophax, C. Verre-Sabrie, M. Pipelier, G. Prestat, G . Vass, and S. D. Gero, Tetrahedron, 1999,55, 7251. D. Dubreuil, J . Cleophax, M. Vieira de Almeida, C. Verre-Sabrie, M. Pipelier, G. Vass, and S. D. Gero, Tetrahedron, 1999, 55, 7573. F. Tian, M. E. Migaud, and J. W. Frost, J. Am. Chem. Soc., 1999,121,5795. A. K. Tyagi and R. A. Vishwakarma, Tetruhedron Lett., 1998,39,6069. L. Schmitt, B. Spiess, and G. Schlewer, Tetrahedron Lett., 1998,39,4817. C. H . Jaworck, P. Calias, S. Iacobucci, and M. d’Alarcao, Tetrahedron Lett., 1999,40,667. S . Adelt, 0. Plettenburg. R. Stricker, G. Reiser, H-J. Altenbach, and G. Vogel, J. Med Chem., 1999,42, 1262. S . Shuto, K. Tatani, Y. Ueno, and A. Matsuda, J. Org. Chem., 1998,63, 8815. K. Tani, S. Shuto, Y. Ueno, and A. Matsuda, Tetruhedron Lett., 1998,39, 5065.

3: Quinquevalent Phosphorus Acids 39 40 41 42

43 44

45 46 47 48 49 50 51 52 53 54 55 56

57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72

73

129

C. Lin, R. J. Davis, S. R. Nahorski, S. Ballereau, B. Spiess, and B. V. L. Potter, J. Med. Chem., 1999,42, 1991. M. T. Rudolf, W-h. Li, N. Wolfson, A. E. Traynor-Kaplan, and C. Schultz, J. Med. Chem., 1998,41,3635. J. Chen, L. Feng, and G. D. Prestwich, J. Org. Chem., 1998,63,6511. G . F. Painter, S. J. A. Grove, I. H. Gilbert, A. B. Holmes, P. R. Raithby, M. L. Hill, P. T. Hawkins, and L. R. Stephens, J. Chem. SOC.,Perkin Trans. I , 1999, 923. A. M. Riley and B. V. L. Potter, Tetrahedron Lett., 1998,39,6769. L. Qiao, F. Nan, M. Kunkel, A. Gallegos, G. Powis, A. P. Kozikowski, J. Med. Chem., 1998,41,3303. R. Shirai, K. Morita, A. Nishikawa, N. Nakatsu, Y. Fukui, N. Morisaki, and Y . Hashimot, Tetrahedron Lett., 1998,39,9485. D-S. Wang, A-L. Hsu, X. Song, C-M. Chiou, and C-S. Chen, J. Org. Chem., 1998,63,5430. D. Tailler, V. Ferrieres, K. Pekari, and R. R. Schmidt, Tetrahedron Lett., 1999, 40,679. T. G. Mayer and R. R. Schmidt, Eur. J. Org. Chem., 1999, 1 1 53. D. K. Baeschlin, A. R. Chaperon, V. Charbonneau, L. G. Green, S. V. Ley, U. Lucking, and E. Walther, Angew. Chem., Int. Ed. Engl., 1998,37, 3423. K. Murakami, E. J. Molitor, and H-W. Liu, J. Org. Chem., 1999,64, 648. J. Ohlsson and G. Magnusson, Tetrahedron Lett., 1999,40,2011. Y. Nishida, Y. Takamori, H. Ohrui, 1. Ishizuka, K. Matsuda, and K. Kobayashi, Tetrahedron Lett., 1999,40,2371 . S . Svenson and D. H. Thompson, J. Org. Chem., 1998,63,7180. G . Wang and R. I. Hollingsworth, J. Org. Chem., 1999,64,4140. Y. Deng and R. G. Salomon, J. Org. Chem., 1998,63,7789. E. Morigaki, Y. Muira, K. Takahata, M. Tada, S. Nkajima, and N. Baba, J. Chem. Res. ( S ) , 1998,774. L. Qiao and A. P. Kozikowski, Tetrahedron Lett., 1998,39, 8959. N. Boden, R. J. Bushby, Q. Liu, S. D. Evans, A. T. A. Jenkins, P. F. Knowles, and R. E. Miles, Tetrahedron, 1998,54, 11537. A. Blasko and T. C. Bruice, Acc. Chem. Rex, 1999,32,475. R. H. Hoff and A. C. Hangge, J. Org. Chem., 1998,63,6680. D. J. Burgess and G. Stedman, J. Chem. Soc., Perkin Trans. 2, 1998,2593. E. Stulz and C. Leumann, Chem. Commun. (Cambridge), 1999,239. A. Berkassel and D. A. Herault, Angew. Chem., Int. Ed. Engl., 1999,38, 102. 1. E. Catrina and A. C. Henagge, J. Am. Chem. SOC.,1999,121,2156. J . S. Seo, R. C. Hynes, D. Williams, and J. Chin, J. Am. Chem. Soc., 1998, 120, 9943. N . H. Williams, W. Cheung, and J. Chin, J. Am. Chem. SOC.,1998, 120, 8079; N . H. Williams, A-M. Lebuis, and J. Chin, J. Am. Chem. Soc., 1999, 121, 3341. S-i. Kondo, K. Yoshida, and Y. Yano, J. Chem. Res. ( S ) , 1999, 106. J. Florihn, J . Aqvist, and A. Warshel, J. Am. Chem. SOC.,1998, 120, 11524. M . Nakamurd, R . Dohno, and T. Majima, J. Org. Chem., 1998,63,6258. A. K. Guha, H. W. Lee, and I. Lee, J. Chern. Soc., Perkin Trans. 2, 1999, 765. H. Fu, 2-L. Li, Y-F. Zhao, and G-Z. Tu, J. Am. Chem. SOC.,1999,121,291. K. C. Nicolaou, G-Q. Shi, K. Namoto, and F. Bernal, Chem. Commun. (Cambridge), 1998, 1757. A . S. E. Karlstrom, K. Itami, and J. E. Biickvall, J. Org. Chem., 1999,64, 1745.

130 74 75 76 77 78 79 80 81 82 83 84

85 86 87 88 89 90 91 92 93 94 95 96 97 98

99 I00 101

102 103 104 105

Organophosphorus Chemistry

I. Maciagiewicz, P. Dybowski, and A. Skowronska, Tetrahedron Lett., 1999, 40, 3791. V. Hariprasad, G. Singh, and I. Tranoy, Chem. Commun. (Cambridge), 1998, 2129. H. Vankayalapati and G. Singh, Tetrahedron Lett., 1999,40, 3925. H. Bielawska and M. Michalska, Tetrahedron Lett., 1998,39, 9761. D. Crich and S. Gdstaldi, Tetrahedron Lett., 1998,39, 9377. T. P. Smyth and B. W. Corby, J. Org. Chem., 1998,63,8946. S . E. Denmark, R. A. Stavenger, and K-T. Wong, Tetrahedron, 1998,54, 10389. S . E. Denmark, R . A. Stavenger, K-T. Wong, and X. Su, J. Am. Chem. SOC., 1999, t21,4982. 0. Legrand, J. M. Brunel, and G. Buono, Eur. J. Org. Chem, 1999, 1099. S . A. Bourne, Z. He, T. A. Modro, and P. H. Van Rooyen, Chem. Commun. (Cambridge), 1999,853. E. J. Cabrita, S. X. Candeias, A. M. Ramos, C. A. M. Alonso, and A. G. Santos, Tetrahedron Lett., 1999,40, 1 37. Q . Zhou and K. D. Turnbull, J. Org. Chem., 1999,64,2847. M. Shi and Y. Inoue, J. Chem. SOC.,ferkin Trans. 2, 1998,2421. J. B. Stringer, M. E. Colvin, 0. M. Colvin, and S. M. Ludeman, J. Org. Chem., 1998,63,7218. Y, Shvo and A. H. I. Arisha, J. Org. Chem., 1998,63,5640. B. Gordillo, M. Salas, and J. Herniindez, J. Chem. SOC.,Perkin Trans. 2, 1999, 1281. C . A. Hansen, A. B. Dean, K. M. Draths, and J. W. Frost, J. Am. Chem. SOC., 1999,121,3799. K. Niikura, A. Metzger, and E. V. Anslyn, J. Am. Chem. SOC., 1998,120,8533. C. Guerard, C. Demynck, and J. Bolte, Tetrahedron Lett., 1999,40,4181 . M. Mizuma and T. Shioiri, Tetrahedron Lett., 1998,39,9209. R . Shirai, K. Morita, A. Nishikawa, N. Nakatsu, Y. Fukui, N. Morisaki, and Y. Hashimoto, Tetrahedron Lett., 1999,40, 1693. J. C. Hart, D. W. Sheppard, I. H. Hillier, and N. A. Burton, Chem. Commun. (Cambridge), 1999,79. J . C . Hart, I. H. Hillier, N. A. Burton, and D. W. Sheppard, J. Am. Chem. Soc., 1998,120, 13535. N . R. Glover and A. S. Tracey, J. Am. Chem. SOC.,1999,121,3579. M. Llinas-Brunet, P. L. Beaulieu, D. R. Cameron, J. M. Ferland, J. Gduthier, E. Ghiro, J. Gillerd, V. Gorys, M. Poirier, J. Rancourt, and D. Wernic, J. Med Chem., 1999,42,722. R. J . Kubiak, R. J. Hondal, X. Yue, M-D. Tsai, and K. S. Bruzik, J. Am. Chem. SOC.,1999, 121,488. J . Sander and H. Waldmann, Angew. Chem., Int. Ed. Engl., 1999,38, 1250. D. J . Owen, K. Alexandrov, E. Rostkova, A. J. Scheidig, R. S. Goody, and H. Waldmann, Angew. Chem., int. Ed. Engl., 1999,38,509. T. Kuzuyama, T. Shimuzu, S. Takahashi, and H. Seto, Tetrahedron Lett., 1998, 39, 7913. M. Fellermeier, K . Kis, S. Sagner, U. Maier, A. Bacher, and M. H. Zenk, Tetruhedron Lett., 1999,40,2743. D. McCaskill and R. Croteau, Tetrahedron Lett., 1999,40, 653. R. L. Edelstein, V. A. Weller, M. D. Distefano, and J. S. Tung, J. Org. Chem., 1998,63,5298.

3: Quinquevalent Phosphorus Acids

131

106 S. Zalipsky, N. Mullah, A. Dibble, and T. Flaherty, Chem. Commun. (Cambridge), 1999,653. 107 G. Y. Sheflyan, D. L. Howe, T. L. Wilson, and R. W. Woodard, J. Am. Chem. SOC.,1998, 120, 1 1027. 108 E. Gotze, K. Kis, W. Eisenreich, N. Yamauchi, K. Kakinuma, and A. Bacher, J. Org. Chem., 1998,63,6456. 109 R. Volk and A. Bacher, J. Biol. Chem., 1991,266,20610. 110 B. Iorga, F. Eymery, V. Mouries, and P. Sauvignac, Tetrahedron, 1998, 54, 14637. 111' M. G. Walawakar, H. W. Roesky, and R. Murugavel, Acc. Chem. Rex, 1999,32, 117. 112 D. H. R. Barton and R. A. V. Embse, Tetrahedron, 1998,54,12475. 113 D. Simoni, F. P. Invidiata, M. Manferdini, I. Lampronti, R. Rondanin, M. Roberti, and G. P. Pollini, Tetrahedron Lett., 1998,39, 7615. 114 D. B. Berkowitz, D. Bhuniya, and G. Peris, Tetrahedron Lett., 1999,40, 1869. 115 R. M. Kissling and M. R. Gagne, J. Org. Chem., 1999,64,1585. 116 J. Kehler, B. Ebert, 0. Dahl, and P. Krogsgaard-Larsen, J. Chem. SOC., Perkin Trans. I , 1998, 3241. 117 C. Vidil, A. Morere, M. Garcia, V. Barragan, B. Hamdaoui, H. Rochefort, and J L. Montero, Eur. J. Org. Chem., 1999,447. 118 S . C . Fields, Tetrahedron Lett., 1998,39, 6621. 119 S . Yamazaki, T. Takada, T. Imanaishi, Y. Moriguchi, and S. Yamake, J. Org. Chem., 1998,63,59 19. 120 P. Jubault, S. Goumain, C. Feasson, and N. Collignon, Tetrahedron, 1998, 54, 14767. 121 B. M. Nakhle, S. A. Trammell, K. M. Sigel, T. J, Meyer, and B. W. Erickson, Tetrahedron, 1999,55,2835. 122 1. Pergament and M. Srebnik, Tetrahedron Lett., 1999,40,3895. 123 M. A. Kazankova, I. G. Trostyanskaya, S. V. Lutsenko, and I. P. Beletskaya, Tetrahedron Lett., 1999,40, 569. 124 P. B. Wyatt, C. Villalonga-Barber, and M. Motevalli, Tetrahedron Lett., 1999, 40, 149. 125 J. M. Gil and D. Y. Oh, J. Org. Chem., 1999,64,2950. 126 T. Ogawa, N. Usuki, and N. Ono, J. Chem. SOC., Perkin Trans. I , 1998,2953. 127 M. P. Gamble, A. R. C. Smith, and M. Wills, J. Org. Chem., 1998,63,6068. Perkin Trans. I , 1998,2083. 128 P. A. Jaffres, N. Bar, and D. Villemin, J. Chem. SOC., 129 A. W. Schwabacher, A. D. Stefanescu, and A. U. Rehman, J. Org. Chem., 1999, 64, 1784. 130 F. Palacios, A. M. Ochoa de Retana, and J. Oyarzabal, Tetrahedron, 1999, 55, 5947. 131 F. Palacios, J. M. de 10s Santos, J. Garcia, and J. Oyarzabal, Tetrahedron, 1999, 55, 3105. 132 X. Liu, H. Adams, and M. G. Blackburn, Chem. Commun. (Cambridge), 1998, 2619. 133 X. Zhang, W. Qiu, and D. J. Burton, Tetrahedron Lett., 1999,40, 2681. 134 K. Blades and J. M. Percy, Tetrahedron Lett., 1998,39,9085. 135 G. S . Cockerill, H. J. Easterfield, and J. M. Percy, Tetrahedron Lett., 1999, 40, 2601. 136 D. Albouy, A. Brun, A. Munoz, and G. Etemad-Moghadam, J. Org. Chem., 1998,63,7223.

132

Organophosphorus Chemistry

137 D. M. Cermak, Y. Du, and D. F. Wiemer, J. Org. Chem., 1999,64,388. 138 M. D. Goaning, B. J. Rowe, and C. D. Spilling, Tetrahedron Lett., 1998, 39, 5485. 139 C. Qian, T. Huang, C, Zhu, and J. Sun, J. Chem. Soc., Perkin Trans. I , 1998, 2097. 140 A. E. Wroblewski and D. G. Piotrowska, Tetrahedron, 1998,54,8123. 141 R. Chen and E. Breuer, J. Org. Chem., 1998,63,5107. 142 J. Kehler, B. Ebert, 0. Dahl, and P. Krogsgaard-Larsen, Tetrahedron, 1999, 55, 771. 143 E. Tadensiak, B. Krawiecka, and J. Michalski, Tetrahedron Lett., 1999, 40, 1791. 144 M-J. Rubira, M-L. Jimeno, J. Balzarini, M-J. Camarasa, and M-J. Perez-Perez, Tetrahedron, 1998,54,8223. 145 Y. Liao, H. Shabany, and C. D. Spilling, Tetrahedron Lett., 1998,39, 8389. 146 M. Tao, R. Bihovsky, G. J. Wells, and J. P. Mallamo, J. Med. Chem., 1998, 41, 3912. 147 S. P. Keen and S. M. Weinreb, J. Org. Chem., 1998,63,6739. 148 A. Heydari, A. Kariman, and J. Ipaktchi, Tetrahedron Lett., 1998,39, 6729. 149 J. Spengler and K. Burger, J. Chem. Soc., Perkin Trans. I , 1998,2091. 150 T. Dwars, U. Schmidt, C. Fischer, I. Grassert, R. Kempe, R. Frohlich, K. Drauz, and G. Oehme, Angew. Chem., Int. Ed. Engl., 1998,37,2851. 151 T. Yokomatsu, T. Minowa, T. Murano, and S. Shibuya, Tetrahedron, 1999, 55, 9341. 152 C. Stevens, M. Gallant, and N. de Kimpe, Tetrahedron Lett., 1999,40, 3457. 153 F. A. Davis and W. McCoull, Tetrahedron Lett., 1999,40,249. 154 D. Albaouy, M. Lasperas, G. Elemad-Moghadam, and M. Koening, Tetrahedron Lett., 1999,40,23 1 1. 155 G. Olive, F. le Moigne, A. Mercier, A. Rochenbaur, and P. Tordo, J. Org. Chem., 1998,63,9095. 156 J-W. Weener, J. P. G . Verseijen, A. Meetsma, W. ten Hoeve, and A. M. van Leusen, Eur. J. Org. Chem., 1998, 1511. 157 P. J. Lennon, S. G. Vulfson, and E. Civade, J. Org. Chem., 1999,64,2958. 158 D. Parker, P. K. Sananayake, and J. A. G. Williams, J. Chem. Soc., Perkin Trans. 2 , 1998,2129. 159 P. V. Coveney, R. J. Davey, J. L. W. Griffin, and A. Whiting, Chem. Commun. (Cambridge), 1998, 1467. 160 I. Tworowska and W. Dabkowski, Chem. Commun. (Cambridge), 1998,261 1. 161 F. Palacios, D. Aparicio, J. Garcia, and E. Rodriguez, Eur. J. Org. Chem., 1998, 1413. 162 S . Pikul, K. L. M. Dunham, N. G. Almstead, B. De, M. G. Natchus, M. V. Anastasio, S. J. McPhail, C. E. Snyder, Y. 0. Taiwo, L. Chen, C. M. Dunaway, F. Gu, and G. E. Mieling, J. Med. Chem., 1999,42,87. 163 P. R. Hanson and D. S. Stoianova, Tetrahedron Lett., 1999,40, 3297. 164 H. Bujard, V. Gouvereur, and C. Mioskowski, J. Org. Chem., 1999,64,2119. 165 F. Guillen and J-C. Fiaud, Tetruhedron Lett., 1999,40,2939. 166 F. Palacios, A. M. Ochoa de Retana, and J. Oyarzabal, Tetrahedron, 1999, 55, 309 1. 167 E. Fluck, G. Heckmann, and S. Plank, Angew. Chem. Int. E d , 1999,38,829. 168 T. Hanaya, Y.Fujii, and H. Yamamoto, J. Chem. Res. ( S ) , 1998,790. 169 B. C. Rann, S. K. Guchhait, and K. Ghosh, J. Org. Chem., 1998,63,5250.

3: Quinquevalent Phosphorus Acids

170 171 172 173 174 175 176 177 178 179 180 181 182 183

184 185 186 187 188 189 190 191 192 193 194 195 I96 197 198 199 200

133

R. Kouno, T. Okauchi, M. Nakamurd, J. Ichikawa, and T. Minami, J. Org. Chem., 1998,63,6239. B. Elzbieta and P. Slawomir, Tetrahedron, 1999,55,48 15. F. Palacios, M. J. Gil, E. Martinez de Martinez, and M. Rodriguez, Tetrahedron Lett., 1999,40,2411. Y. Yuasa, N. Fujimaki, T. Yokomatsu, J. Ando, and S. Shikuya, J. Chem. SOC., Perkin Trans. I , 1998, 3577. C. D. Cox and M. J. P. Harger, J. Chem. Res. ( S ) , 1998,578. M. J. P. Harger and D. K. Jones, Chem. Commun. (Cambridge), 1999,339. M. J. P. Harger, Chem. Commun. (Cambridge), 1998,2339. M. J. P. Harger and R. Sreedharan-Menon, J. Chem. SOC., Perkin Trans. 2, 1999, 159. M. J. P. Harger and C. Pater, Chem. Commun. (Cambridge), 1999,931. L. tuczak, A. Lopusinski, and J. Michalski, Tetrahedron, 1998,54,9731 . I. Fernandez, N. Khiar, A. Roca, A. Benabra, A. Alcudia, J. L. Espartero, and F. Alcudia, Tetrahedron Lett., 1999,40,2029. R. 0 . Hutchins, S. J. Rao, J. Adams, and M. K. Hutchins, J. Org. Chem., 1998, 63, 8077. C. Jimeno, A. Vidal-Ferran, A. Moyano, M. A. Pericas, and A. Riera, Tetrahedron Lett., 1999,40,777. M. J. Plamer, J. R. Studley, T. C. Walsgrove, and M. Wills, Tetrahedron, 1998, 54,8827. H. Maeda, K. Takahashi, and H. Ohmori, Tetrahedron, 1998,54,12233. C. Stevens, L. De Buyck, and N. de Kimpe, Tetrahedron Lett., 1998,39,8739. S . Albert, D. Crestia, F. Dujols, and M. Mulliez, Tetrahedron Lett., 1998, 39, 8841. A. Chaudhry, M. J. P. Harger, P. Shuff, and A. Thompson, J. Chem. SOC., Perkin Trans. I , 1999, 1347. P. R. Hanson, K. T. Sprott, and A. D. Wrobleski, Tetrahedron Lett., 1999, 40, 1455. 0. Legrand, J. M. Brunei, and G. Buono, Angew. Chem. Int. Ed., 1999,38, 1479. C. Cardellicchio, G. Fracchiolla, F. Naso, and P. Tortorella, Tetrahedron, 1999, 55, 525. M. A. M. Capozzi, C. Cardellicchio, G . Fracchiolla, F. Naso, and P. Tortorella, J. Am. Chem. SOC., 1999,121,4708. 0.Legrand, J-M. Brunei, and G. Buono, Tetrahedron Lett., 1998,39,9419. M. Aresta, A. Dibenedetto, and E. Quaranta, Tetrahedron, 1998,54, 14145. M. Curini, F. Epifano, M. C. Marcotullio, and 0. Rosati, Tetrahedron Lett., 1998,39,8159. T. Schrader, J. Am. Chem. Soc., 1998,120, 11816. M. Ahlmark, J. Vepsiiliiinen, H. Taipale, R. Niemi, and T. Jiirvinen, J. Med Chem., 1999,42, 1473. D. L. Jakeman, A. J. Ivory, M. P. Williamson, and G. M. Blackburn, J. Med. Chem., 1998,41,4439. M. K. Manthey, D. T. C. Huang, W. A. Bubb, and R. I. Christopherson, J. Med. Chem., 1998,41,4550. S . R. Eaton, W. L. Cody, A. M. Doherty, D. R. Holland, R. L. Panek, G. H. Lu, T. K. Dahring, and D. R. Rose, J. Med. Chem., 1998,41,4329. 2-J. Yao, C-R. King, T. Cao, J. Kelley, G. W. A. Milne, J. H. Voigt, and T. R. Burke, Jr., J. Med. Chem., 1999,42,25.

134

Organophosphorus Chemistry

20 1 202

B. Bennett and R. C. Holz, J. Am. Chem. Soc., 1998,120, 12139. A. Belyaev, X. Zhang, K. Augustyns, A. M. Lambeir, I. De Meester, I. Vadernikova, S. Scharpk, and A. Haemers, J. Med. Chem., 1999,42, 1041. M. Cushman, J. T. Mihalic, K. Kis, and A. Bacher, J. Org. Chem., 1999, 64, 3838. K. Kakinuma, K.Shimazaki, N. Takahashi, K. Takahashi, S. Niihata, Y.Aoki, K. Hamada, H. Matsushita, and Y. Nishi, Tetrahedron, 1999,55,2559. P-Y. Renard, P. Vayron, F. Taran, and C. Mioskowski, Tetrahedron Lett., 1999, 40,281. J. A. Ashley, C-H. Lin, P. Wirsching, and K. D. Janda, Angew. Chem. Int. Ed, 1999,38, 1793. J. Floriin, M. Strajbl, and A. Warshel, J. Am. Chem. SOC., 1998, 120, 7959. Z. Ziora, T. Cierpicki, J. Grembecka, and P. Kafarski, J. Chem. Res. ( S ) , 1999, 68. A. C . Dros, R. W. J. Zylstra, P. Th. Van Duijnen, A. L. Spek, H. Kooijman, and R. M. Kellogg, Tetrahedron, 1998,54, 7787. H. Sigel, C . P. Da Costa, B. Song, P. Carloni, and F. Gregiio, J. Am. Chem. Soc., 1999,121,6248. W-S. Yeo and J-I. Hong, Tetrahedron Lett., 1998,39, 8 137. T. Okano, T. Sano, and K. Kaya, Tetrahedron Lett., 1999,40,2379.

203 204 205 206 207 208 209 210 21 1 212

4 Nucleotides and Nucleic Acids BY JOSEPH S. VYLE AND NICOLA M. HOWARTH

1

introduction

The number of publications in this field has again risen sharply. Novel oligonucleotide analogues have continued to attract considerable attention. The majority of new reports on modified internucleotide linkages centre on oligonucleotide phosphorothioates and phosphoramidates and peptide nucleic acid analogues. An increase in interest in oligonucleotides incorporating conformationally-locked sugars that have been shown to hybridise to complementary oligonucleotide targets with unprecedented affinity has also been apparent in the literature. Exciting new methodology has been developed for preparing oligoribonucleotides using alternatives to the protecting groups previously employed. The rapid increase in novel modified nucleoside triphosphates described previously has continued as techniques involved in nucleic acid library construction and selection become more available. Such libraries have been utilised in several roles: generating novel nucleic acid reactivity; probing protein - nucleic acid and nucleic acid - nucleic acid interactions; and determining metal ion binding sites. Several new reports of the incorporation of site-specific metal ion binding sites into DNA have been made utilising either novel post-synthetic methodology or a solid-phase Heck-type reaction.

2

Mononucleotides

2.1

Nucleoside Acyclic Phosphates. - 2.1.I Mononucleoside Phosphate Deriva-

tives. A series of lactate analogues of d4TMP (la-d) have been prepared as diastereoisomeric mixtures by reacting phenyl dichlorophosphate with the appropriate lactate and subsequently treating the intermediate phosphorochloridate with d4T. I These derivatives were found to be virtually inactive as antiviral agents. Bis(N,N-dimethylcarbamoyloxymethyl) 2’,3’-dideoxyuridine 5’-monophosphate (2a) has been synthesized as a potential membrane-permeable prodrug of 2’,3’-dideoxyuridine 5’-monophosphate (ddUMP).2 The analogue (2a) was shown to be readily converted to ddUMP by phosphodiesterase I but completely resistant to degradation by plasma enzymes in contrast with the corresponding pivaloyl derivative (2b). Two peptide adducts of leucinol Organophosphorus Chemistry, Volume 3 1 N-3 The Royal Society of Chemistry, 2001 135

Organophosphorus Chemistry

136

R-CH

I

c=o I

R/Ho (2)a R = (Me)#C(O)OCH2b R = (Me)3CC(0)OCH2-

(1) a R=R’=Me b R = Me, R’= Et c R = H , R’=Me d R=H, R = E t

5 5

Me

-,

(3)

(4)

Hd

OH

w

Hd

OH

adenylate, (3) and (4), have been assembled by condensing the carboxyl group of the required N-blocked peptides with the alkylamino group of leucinol 5’adenosine pho~phodiester.~ These peptidinol adenylates, which mimic aminoacyl adenylates, were designed to penetrate microorganisms via peptide permeases. Mono-S-acyl-2-thioethyl (SATE) aryl phosphotriester derivatives of AZT (5a,b) have been prepared and found to deliver intracellularly the corresponding 5’-monon~cleotide.~ The bis(SATE) phosphotriester derivatives of 2’-deoxy-4’-thio-~-cytidine and -adenosine (6a,b) have been synthesised using a new route to 2-deoxy-4-thio-~-ribofuranose.~ No significant antiviral activity was observed when examined against a variety of DNA and RNA viruses. The

4: Nucleotides and Nucleic Acids

137

synthesis and in vitro anti-hepatitis B virus (HBV) activity of mononucleoside phosphotriester derivatives of acyclovir incorporating SATE groups (7a,b) have been reported. These derivatives were shown to be potent and selective inhibitors of HBV replication in HepG2.2.15 cells.6 A simple and efficient protocol for the preparation of nucleoside 5’-Hphosphonothioates (8) and nucleoside 5’-H-phosphonates has been d e ~ e l o p e d . ~ The corresponding nucleoside 5’-phosphorodithioate and 5’-phosphorothioate monoesters were prepared following deprotection and sulfurisation under mild conditions. DBU-Mediated nucleophilic displacement of diphenylphosphonate from the 2-thioquinolinyl-protected nucleoside derivative (9) by a nucleoside 3’-thiol has been used to prepare a thioformacetal-linked dinucleoside.*

(7)a R = Me

BH fi

b R=Me3C

0 I1

Ph-P-0

I

1

sII

0-P-0 I

1 .o. ?

Shibuya and co-workers have described the stereoselective P-N-glycosylation of 2,3-dideoxyribofuranose derivatives ( 1Oa) controlled by a methanephosphonothioate functional group at the 3-position to yield the protected 2’,3’dideoxythymidine phosphonothioate diester ( 11a).9 This stereoselectivity was attributed to the stabilisation of a cationic intermediate by the phosphonothioate function. N-Glycosylation of the corresponding phosphate triesters (lob) did not exhibit the same level of stereoselectivity and both a-(1 1b) and P- (12) anomers of the nucleoside phosphonate were isolated. Difluorophosphonate analogues of thionucleosides (1 3), (14) have been prepared as

Organophosphorus Chemistry

138

Bzov Bzov: YTMS

+

Lewis acid

Lpl'x /\

EtO OEt (10) a X = S ; R ' = H , OEt; R2=OEt, H b X = O ; R' = H, OEt; R2=OEt, H

(11) a X = S b X=O

inseparable mixtures of cis- and trans-isomers. l o ( 13) was isolated following triethylsilane / trifluoroacetic acid-mediated reduction of the corresponding dihydrothiophene (15). 0

0 EtO- P 11I -CF2-

1I1

F

OEt

x-L-cF2Y$H

(13)

.-""Q-

Me (15) , X=OEt,O-Na+

F

ub%

(14) B =

''<xi

X=OEt

I

-tvL

The photoaffinity cross-linking reagent 6-thioguanosine has been introduced enzymatically at the 5'-termini of tRNA molecules via the monophosphate.' Inosine monophosphate dehydrogenase (IMPDH) is a target for anticancer, antiviral, immunosuppressive, and antimicrobial chemotherapy. Imidazo[4,5e][l,4]diazepine nucleotide (16) has been shown to be a potent inhibitor of both human type I1 and Escherichia coli IMPDH.12 Davisson and co-workers have described the chemoenzymatic preparation of p-hydroxyguanosine 5'-mOnOphosphate ( 19) from 2-fluoroadenosine 5'-monophosphate ( 17) via 2-fluoroinosine 5'-monophosphate (18) and characterised both (18) and (19) as inhibitors of Escherichia coli guanosine monophosphate synthetase.I3 (1 8) was found to bind weakly to the enzyme (IC50 > 2 mM). In contrast, (1 9) displayed timedependent inhibition and was competitive with respect to the natural substrate (Ki = 92 nM). 5'-Monophosphates of several novel dideoxynucleosides bearing tricyclic nucleobases (20)-(23) have been synthesised by Zhang et all4 Both linear and angular ring-extended analogues of dideoxyadenosine 5'-mOnOphosphate were found to have moderate to good inhibition of HIV integrase. Filippov et al. have described the synthesis of the active fragment of Agrocin 84 (24c).I5A side product observed by 31PNMR following treatment of (24c) with 9: I (v/v) water:acetic acid was attributed to the product of N + O phos-

'

4: Nucleotides and Nucleic Acids

I39

adenyllc acM

deaminase

phoryl migration (25). Cytidine 5'-monophosphate (CMP)-(hcetamid0-9thiomethylmercuric-3,5,9-tr~deoxy-~-~-g~cero-~-g~Z~c~~-nonulopyranos~d acid) (26) was enzymatically incorporated into an oligosaccharide and a nonnatural glycoprotein for use as an aid in the structure determination of these compounds by X-ray crystallography. l6 CPG-bound CMP-N-acetylneuramink acid (27) has been used to immobilise glycoproteins bearing galactoside residues at the non-reducing terminus using sialyltransferase-mediated glycosidic bond formation. l

Organophosphorus Chemistry

140 y

2

y

2

(24) a R‘ = TBDMS, R*= CE, R~ = AC b R’=TBDMS, R 2 = R 3 = H

c R’=R2=R3=H MeHgS

::

NHR

(27) a R=Ac, X=OMe, Y=OCH$H$N b R=H, X=Y=O-

9-[2-(Phosphonomethoxy)ethyl]adenine (PMEA) (28) is the subject of numerous antiviral studies and its preparation has therefore been the subject of considerable interest. Dang et al. have developed a new regio-defined synthesis of PMEA which is suitable for gram-scale synthesis.18 The key steps in this synthesis involve regioselective introduction of the phosphonomethoxyethyl moiety onto a pyrimidine nucleus followed by cyclisation to construct the purine ring. PMEA is afforded in an overall yield of 35%. Holy et al. have prepared a series of dialkyl esters of purine and pyrimidine N-[2-(phosphonomethoxy)ethyl] derivatives substituted at positions 2, 6 or 8 of the purine base or positions 2, 4, or 5 of the pyrimidine base by alkylation of the appropriate heterocyclic base with 2-chloroethoxymethylphosphonate diester in the presence of sodium hydride, caesium carbonate or DBU in DMF.19 Additional derivatives were obtained by carrying out transformations of the bases in suitably modified intermediates bearing reactive functions at the base moiety. The diesters were converted to the corresponding monoesters by treatment with sodium azide while the free acids were obtained from the diesters by successive treatment with bromotrimethylsilane and hydrolysis. 2. I .2 Polynucleoside Monophosphates. Shaw and co-workers have detailed new methodology for the preparation of diuridine 3’,5’-boranophosphates using H-phosphonate chemistry.*O The same group has also described the synthesis of RP and Sp isomers of dithymidine boranophosphates (29a-c) via stereo-

4: Nucleotides and Nucleic Acids

141

specific boronation (with retention of configuration) of the corresponding Hphosphonate diesters.21 Jin and Just have prepared (29a) by resolution of protected dithymidine boranophosphates (29d) using silica chromatography.22 These workers have also detailed the stereoselective synthesis of (Sp)-dinucleoside boranophosphates (29a), (33), with a d.e. of >98% by DBU-mediated reaction of phosphoramidites incorporating the chiral auxiliary (S)-3-hydroxy4-(24ndolyl)butyronitrile (30a,b) with 3’-protected thymidine, boronation of the phosphite triester products (31a,b) and deprotection of the resultant boranophosphates (32a, b) (Scheme l).23

\

/

(2s) a R’ = R~ = H; X,Y = 0,B H ~ b R’ = H, R2 = TBDMS; X,Y = 0,BH3c R’ = DMTr, R2 = TBDMS, TBDPS; X,Y = O(CH2)&N, BH3 d R’ = R2 = H; X,Y = O(CH&CN, BH3

R’owT Hov

v

OR2

OR2

(31) a R’=TBDMS, R2=TBDPS b R’=R2=DMTr

(30) a R’=TBDMS b R’ = DMTr

I

R’ov 4

or 70% HOAc(aq) followed by NH3(aq)

:;p;;HvT

b \

OR’ (33)a R’ = TBDMS b R’ = DMTr

scheme 1

Me&BH3

Y OR2

(32) a R’=TBDMS, R2=TBDPS b R’ = R2 = DMTr

142

Organophosphorus Chemistry

Wang and Just have also described the novel reaction of (30b) with DBU, initially in the absence of a reacting 5’-hydroxyl followed by addition of 3 ’ 4 TBDPS-thymidine to yield a phosphonate (34).24 Treatment of nucleosideindolyloxazaphosphorine derivative (35) under the same conditions did not lead to dinucleoside methyl phosphonate formation. The quantitative and stereospecific preparation of novel dinucleoside 4-pyridylphosphonates (36) has been reported.25 Treatment of dithymidine H-phosphonates with trityl chloride or trityl bromide and DBU in pyridine was used to effect the reaction and the intermediacy of dihydropyridines (37) was proposed.

T B D M S O v T

0

I

Me-P=O I

(34)

(35)

OR (36) R=DMTr, H

DMTrov 0

Pavey et al. have incorporated 2’-homouridine into a dinucleoside monophosphate (38) via the phosphoramidite derivative (39).26The hydrolytic lability of (38) under basic conditions was found to be intermediate between that of the unmodified dinucleoside monophosphate and the homologue containing a 2’hydroxyethyl moiety previously prepared by this group. Qiao and Kishi have described the preparation of a dinucleoside monophosphate incorporating a covalently cross-linked Watson-Crick base pair model (40) and also the phosphoramidite derivative (41).27 2.2 Nucleoside Cyclic Phosphates. - 2’,3’-Unsaturated nucleosides have been prepared in 26% yield from the corresponding 5’-0-silyl-protected adenosine

4: Nucleotides and Nucleic Acids

143

I

“=“-“?OJ”

n

R% OR2 (38)a R’ = DMTr, R 2 = Ac, X =O(CH2)&N b R ’ = R 2 = H , X=O-

0

TBDMSO

0

DMTrO

I

OTBDMS

(40)

2’,3’-cyclicphosphate triester by reductive elimination with sodium naphthalenide.28 Pavey et al, have described the preparation of a novel 2’,3’-cyclic phosphonate diester (42a) and the deprotected product (42b) derived from 2’h ~ m o u r i d i n eCytosine .~~ 2’,3’-dideoxy-3‘,5’-homocyclic monophosphate (43a), its 5-fluoro congener (43a) and adenosine 2’,3’-dideoxy-3’,5’-homocyclic monophosphate (44) have all been synthesised from (SS)-(5-tert-butyldimethylsil-

(42) a R=DMTr, X=OCH&H&N b R = H, X = 0-Et3NH’

(43) a R = H b R=F

oxymethyl)furan-2(5H)-one.30 Although designed as potential inhibitors of HIV reverse transcriptase, none of these compounds were found to possess such activity. Novel diastereomeric thymidine cyclic 3’,5’-threo-phosphoramidates (45) and (46) have been prepared by treatment of the 5’-azido derivative of

Organophosphorus Chemistry

144

threo-thymidine with triphenyl phosphite as well as by treatment of the corresponding amino derivative with phenyl phosph~dichloridate.~’ The reactions were presumed to proceed via formation of the cyclic tetraoxaphosphorane intermediate (47). A series of racemic dioxolane nucleotide analogues have been synthesised (48) which contain a phosphonate group attached PhO,

,OPh

directly to C-2 of the ring and a methylene spacer between the ring and the nucleotide base.32 The anti-HCMV activities of these compounds were evaluated. All except for the cis-guanine derivative were found to be inactive. The anti-HCMV activity of this analogue resides with the (2S, 4R) diastereoisomer. As part of an ongoing programme to develop efficient pronucleotide delivery systems, Meier et al. have synthesised novel cyclo-Sal-ddAMP (49a-d) and

(49) a X = H b X=5-OMe c X=3-Me d X =3,5-Me2

cyclo-Sal-d4AMP (50a-d) derivatives of the antiviral purine dideoxynucleoside analogues 2’,3’-dideoxyadenosine (ddA) and 2’,3’- dideox~-2’,3’-didehydroadenosine (d4A) and examined their lipophilic, hydrolytic and biological properties.33 These compounds were prepared from the appropriate substituted salicyl alcohol utilising phosphorus(II1) methodology. Stereoselectivity at phosphorus was observed in the preparation of (49) and (50). Meier et al. have also synthesised and evaluated novel cyclo-Sal triester derivatives of ara(5 1a-c) and ribo- (52a-c) 2’-fluorinated-2’,3’-dideo~yadenosines.~~ The potential of the generally applicable intramolecular condensation of 3’N-aminoacylpeptidyl-5‘-nucleotideswith the water soluble carbodiimide 1ethyl-3-(3-dimethylaminopropyl)carbodiimidehydrochloride for the production of a range of cyclic peptide nucleotide hybrids (cPNH) (53a-i) has been explored.35 This procedure offers a large number of synthetic possibilities through variation of the base and ribose groups, the phosphate substituent (monolpoly) at the 5’-position and the amino acid or peptide at the 3’-position. Shuto et al. have characterised a cyclic dimer (54) by mass spectroscopy from the reaction of the 8-bromo-N‘-[5-(phenylthiophosphoryl)carbocycl~cribosyl]inosine 5’-phosphate derivative (55) with silver(I) nitrate and triethyl-

4: Nucleotides and Nucleic Acids

(50) a b c d

145

(51) a X = Y = H b X=OMe, Y = H c X = H , Y=Me

X=H X=5-OMe X=3-Me X =3.5-Me2

F (52) a X = Y = A b X=OMe, Y = H c X=H, Y=Me

a b c d

B

R’

A A

OH OH OH OH OH OH OH OH H

A A

e

A

f g h i

A A G T

R2

H H H CH2Ph H, CH2Ph (CH2)4NH2 CH2Ph H H

m 1-3,5 5 3, 5 1,2 1

3 1 1 1

n 2 1 0

2 0-4 2 methylene bisphosphonate 2 2.4

amine in 3 : 1 N-methyl-2-pyrrolidinone: HMPA followed by reductive removal of the bromo group.36 (55) was prepared as shown in Scheme 2. A six-step procedure has been described by Sih and co-workers for the preparation of a novel analogues of cyclic ADP-ribose-2’-phosphate (59) starting with NADP+.37

3

Nucleoside Polyphosphates

Suto et al. have synthesised nucleoside triphosphates (60) linked through their y-phosphates to diamines and these have been coupled to Sepharose for use in protein purification affinity chromatography. 38 Nucleophilic ring opening of

Organophosphorus Chemistry

146

xY N-

0x0

,

,

t

1

(56)

0x0 (58)

Reagents: i, ROTf, K&03, 18-crown-6, DME, 50°C; ii, TBAF, THF, RT; iii, (PhS),P(O)O-, tetrazole, TPSCI, pyridine, RT; iv, iAmONO, AqO, AcOH, pyridine, RT; v, H3P02, Et3N, pyridine, RT. scheme2

HO

$

OP032-

(59) X = Br, -NH(CH2)6NH2

147

4: Nucleotides and Nucleic A c i h

the nucleoside-5’-trimetaphosphate(derived from treating the corresponding triphosphate with dicyclocarbodiimide) with an a,o-diamino hydrocarbon to generate the y-phosphonamide. The 2’-deoxyguanosine-5’-(y-amidohexamethylene-6-amine)-triphosphate Sepharose has been utilised in the affinity chromatographic purification of ribonucloside triphosphate reductase.

Shaw and co-workers have developed a convenient one-pot method to Pure ~ nucleosynthesise ribonucleoside 5’-(a-P-borano)triphosphates(61c ) . ~ side derivatives were isolated in 30-45% overall yield using ion-exchange chromatography following protecting group removal from (61a,b). The two diastereomers of (61c) were isolated in high purity following further purification by reversed-phase HPLC. Workers in the same group have also applied this methodology to the synthesis of a series of 5-substituted analogues of 2’deoxycytidine 5‘-(a-P-borano)triphosphates (63a-d) following deprotection of the precursors (62a-d).40 T7 DNA polymerase-mediated incorporation of the purified putative R P diastereoisomers of (63b-d) was as efficient as 2’deoxycytidine 5’-triphosphate incorporation. The boronated 5-methyl (63c) and 5-ethyl cytidine (63d) nucleotides exhibited increased resistance to exonuclease 111 digestion as compared with the unsubstituted (a-P-borano)HN’

0 I1

0 II

-0-P-0-P-0-P-0 I

0

0 II

II

0 II

-0-P-0-P-0-P-0 I 00RO OR

(61) a R = B z , B = U b R = Ac, B = A, CBz,G c R=H, B=A,C,G.U

R2

0 II

R’O (01) a

b c d (62) a b c C

R’= Ac,

R2 = Bz, R3 = I R’ = Ac, R2 = Bz, R3 = Br R’ = Ac, R2 = Bz, R3 = $-Me R’ = Ac, R2 = Bz, R3 = $ -CH2Me R’ = R ~ H, = R~ = I R’ = R2 = H, R3 = Br R’ = R2 = H, R3 = $-Me R‘ = R2 = H, R3 = $
Organophosphorus Chemistry

148

cytidine and are therefore proposed as potential substrates for direct PCR sequencing. 2’-1odo- and 2’-bromo-ATP (64) and GTP (65) analogues have been prepared from ara-adenosine and ara-guanosine respectively.4’ It was postulated that these nucleotide analogues could be utilised in the preparation of heavy atom derivatives of ATP- and GTP-binding proteins with potential utility in protein crystal structure determination by MIR/MAD phasing. ~-(p-n-Butylphenyl)-2’-deoxyguanosine-5’-(a,~-imido)triphosphate (66) has been prepared and assayed as a non-incorporable inhibitor of B-family DNA p o l y m e r a ~ e s .The ~ ~ analogue (66) was synthesised from the corresponding nucleoside by selective phosphorylation of the 5’-hydroxy group with trichloro[(dichlorophosphoryl)imino]phosphorane followed by hydrolysis of the intermediate to give the imidodiphosphate derivative (67). The triphosphate was isolated in 29% yield after purification following coupling of (67) with orthophosphate using the imidazolide method. (66) was a more potent inhibitor of human DNA polymerase a and T4 DNA polymerase than f l - ( p n-butylphenyl)-2’-deoxyguanosine-5’-triphosphate and was not a substrate for either enzyme.

HO Y (64)a B = A , X = O , Y = I , B r b B = A , X=NH, Y = I , Br (65)B = G , X=NH, Y = I , B r 0

HO (66)x = oP032(67)X = 0-

Workers in the laboratory of Roberts have prepared and evaluated a range of phosphonate (68) and phosphonoacetate (69) derivatives of carbocyclic n u c l e ~ s i d e s . High ~ ~ - ~stability in human blood serum was demonstrated by (69). Inhibition of reteroviral reverse transcriptases and terminal deoxynucleotidy1 transferases by (69) was also demonstrated. Enzymatically stable analogues of AZT-triphosphate (70) designed for coupling to antigenic carrier proteins have been prepared.45 (70) and the natural triphosphate congener were both coupled to keyhole limpet hemocyanin. 4-(Carboxymethy1)-2-(thymidin-9-y1)-6-(hydroxymethyl)morpholine-6-triphos-

4: Nucleotides and Nucleic Acids 0 I

OH

0 l

OH

I49 0

0 l

II

OH I

OH

(68)a B = A , X=CF2, R = O H b B = G , X=CF2, R = O H c B = A , X=CF2, R = M e

0 II

H02Cxx-p-o-~n0

AH

0 - B

(69)X = CH2, CFH2, CF2

d B = A , X=CF2, R = M e e B = G , X=CF*, R = P h f B = A . X=O, R = P h

R

r

X (70)a R’ = Bn, R2 = H, X = N3 b R 1 = R 2 = H , X=NH2 c R’ = Bn. R’ = (CH2)5NHCOCF3, X = N3 d R1 = H, R2 = (CH&NHz, X = N3

phate (71) has been prepared.46 (71) was incorporated into D N A fragments in a base-specific fashion by Taq polymerase and acted as a novel chain terminator in DNA sequencing. An allylic adenosine triphosphate analogue (72) has been prepared as a mixture of cis and trans isomers.47 (72) was tested as a substrate for DNA polymerases and found to be incorporated opposite thymidine by all but one enzyme with concomitant termination of the elongation reaction. (72) was successfully utilised in a sequencing reaction as a substitute for 2’,3’-dideoxyadenosine- 5’-triphospha te.

‘The Base Addition Sequencing Scheme’ (BASS) is a method for sequencing DNA that does not involve gel electrophoresis. BASS employs modified nucleotides that are: (i) incorporated by DNA replicating enzymes; (ii) spectroscopically distinct so that the parent base (A, T, G and C) can be differentiated and (iii) labile at the 3’-position so that the 3’-hydroxyl terminus of the polynucleotide can be regenerated. A major challenge in the development of BASS is that the 3’-blocking group must be removed in an aqueous medium using reagentslconditions that do not denature or modify double stranded-

150

Organophosphorus Chemistry

DNA. To address this issue Welch and Burgess have synthesised fluorescent, photolabile 3’-O-protected nucleoside triphosphates (73).48 No evidence for incorporation into DNA was observed in preliminary tests on (73) as substrates for polymerases.

NO2 (73) B = A, T

The synthesis of 5’-0-( 1-thio)-p-methylguanosine triphosphate (74) and its incorporation into two reverse splicing forms of the Tetrahymena group I intron has been reported.49 Nucleotide analogue interference mapping (NAIM) using (74) was applied to the identification of three sites all of which are known to utilise their exocyclic amino groups to participate in tertiary hydrogen bonds within the ribozyme structure. Unlike the interference pattern with the phosphorothioate of inosine (an analogue that also deletes the N2 amine of G), substitution using (74) did not cause interference at positions attributable to secondary structural stability effects. p - E t hyl-2’-deoxyguanosine triphosphate (75) has been prepared and the level of incorporation into DNA catalysed by mammalian DNA polymerases ct and 6 determined.50 0

H

HO OH (74) X = S , R = $-Me (75)X = O , R=$-CH2Me

A novel fluorescent ribonucleotide analogue 5-thioacetamidofluoresceinuridine 5’-triphosphate (76a) has been prepared and utilised to probe the environment of nascent RNA in E. coli transcription elongation c~mplexes.~’ The related photoaffinity probe-containing derivative (76b) was also prepared. Sakthivel and Barbas have reported the preparation of a series of highly functionalized dUTP analogues (77) derived from 5-(3-aminopropenyl)-2’deoxyuridine triphosphate with exciting potential to extend the catalytic range of r i b ~ z y m e s .The ~ ~ ability of these analogues to act as substrates for thermostable DNA polymerases and reverse transcriptase was tested. Godovikova et al. have prepared base-substituted analogues of 2’-deoxyuridine-S-

4: Nucleotides and Nucleic Acids

151

triphosphate containing arylazido functions ( 7 8 a - ~ ) .(78a) ~ ~ was capable of efficiently elongating DNA primers with both Klenow fragment DNA polymerase I and Thermus aquaticus DNA polymerase.

4-0gp30 HO OH

H

0

b R = O 0 N Q N3

4-0Qp30 HO

Ostermann et ul. have also prepared novel N2-labelled fluorescent GTP analogues (79).54 These compounds were found to interact with the small GTPases H-Ras and cdc42 with an accompanying increase in fluorescence yield and displayed kinetic constants that are similar to those of unmodified nucleotides. These derivatives were designed for applications in mechanistic

152

Organophosphorus Chemistry

4-0gp30 0

0

I

I

II

II

0

II

HO OH (79) a X = O , n = 1 , 3 b X=NH, n = l

studies of GTPase (which do not tolerate modifications in the sugar part of the nucleoside). 8-Hydroxyguanosine triphosphate (80) and 2-hydroxyadenosine triphosphate (8 1) have been prepared by nucleoside-diphosphate kinase-mediated phosphorylation of the corresponding d i p h ~ s p h a t e sThis . ~ ~ simple method has potential utility in the preparation of y-phosphate labelled nucleoside triphosphates. Guengerich and co-workers have prepared (80) directly from the

153

4: Nucleotides and Nucleic Acids

nucleoside via the diphosphate and examined the kinetics of incorporation into DNA by polymerases, HIV- 1 reverse transcriptase and bacteriophage T7 e x o n u c l e a ~ eThe . ~ ~ triphosphate (80) was found to be a poor substrate for the polymerases, with insertion efficiencies greater than 104-fold lower than for dGTP incorporation. 2’-Deoxyoxanosine 5’-triphosphate (82) was prepared by nitrous acid treatment of 2’-deoxyguanosine 5’-triphosphate and its incorporation into DNA by DNA polymerases was investigated.57 Frequencies of mutagenic incorporation of (82) opposite template T were dependent on the nearest neighbour base pairs, and 1.6-3.9-fold higher than those for dGTP. For some time there has been an interest in nucleoside analogues which possess ambivalent base-pairing properties. To this end, Williams et al. have synthesised a tricyclic pyrrolopyrimidine nucleoside together with its 5’-triphosphate (83).58 The thirteenstep synthesis starts from 2-methylsulfanyl-4-hydroxy-6-aminopyrimidine. Leoni and co-workers have prepared 2-chloro-2’-deoxyadenosine5’-triphosphate (84) and demonstrated that, in the presence of cytochrome c, it induces an apoptotic program in cell-free extracts.59 Matray and Kool have synthesised and examined pyrene nucleoside triphosphate (dPTP) (85) incorporation opposite abasic sites.60 The fluorescent

pyrene ‘base’ is nearly as large as an entire Watson-Crick base pair and dPTP was found to be efficiently and specifically inserted by DNA polymerases opposite abasic sites. This property has been utilised to sequence abasic lesions in DNA. These findings confirm that steric complementarity is an important factor in the fidelity of DNA replication. Unrau and Bartel have prepared an adenylated ribose derivative (86) and utilised this derivative to tether the activated ribose unit to the 3’-termini of a HO OH

M

~04-o-g-o-~_,

A

-b

0 0 I1 It 0-P-0-P-0I I HO OH 00-

(86)

Organophosphorus Chemistry

154

pool of RNAs using T4 RNA ligase. Selection from the pool of RNAs was made upon the basis of RNA-catalysed pyrimidine nucleotide synthesisW6’ Enzymatically stable analogues of guanosine diphosphate in which the pyrophosphate moiety was mimicked by the ethylenebisphosphonate (87), the imidodiphosphate groups (88) acetophosphonate (89), and the phosphonoacetate (90) have been prepared from the corresponding benzyl-protected compounds and evaluated in binding studies with transducin.62Of these analogues, 0

0

R’6

OR’

(87) a R’2 = CHPh, R2 = En, R32 = CHNEn2 b R1=R2=R3=H

0

R’O

OR’

(89) a R12=CHPh. R 2 = B n b R1=R2=H

l i

R’O

OR’

(90) a R12=CHPh, R2=Bn. R32=CHNBn2 b R’=R2=R3=H

only the imidodiphosphate (88b) bound transducin. Derivatives of (88) in which the nucleobase (91), (94) or sugar (92) moieties were further modified were also prepared although no transducin binding was observed. The synthesis of a protected GDP analogue functionalised at the nitrogen atom bridging the two phosphorus atoms (93) was also reported although debenzylation resulted in hydrolysis of the imidodiphosphate moiety. Drueckhammer and co-workers have described the synthesis of analogues of coenzyme A (95) derived from a thioester intermediate (96a).63 (96a) was prepared enzymatically following phosphorylation of the intermediate (96b). A phosphinate inhibitor (97) of the rneso-diaminopimelic acid-adding enzyme has been prepared.64 (97) is the first compound in this class (IC50 = 1.1 mM). Novel tripodal analogues of adenosine nucleotides (98) have been described by Liu et al. These analogues were found to selectively inhibit human Fhit Ap3A h y d r ~ l a s e . ~ ~

4

Oligo- and Polynucleotides

4.1 DNA Synthesis. - Devivar et nl. have developed a new type of solidphase support (99) for DNA synthesis.66 Composed of a polymer colloid

155

4: Nucleotides and Nucleic Acids

(91) a R’,R2 = CHPh, R3 = R4 = Bn, R5 = (CH2)20(CH2)20(CH2)2N3.R62 = CHNBn2

b R’ = R2 = R3 = R5 = R6 = H, R4 = (CH2)@(CH&O(CH&N, (92) a R’ = En, R2 = Ac, R3 = R4 = R5 = En, R62 = CHNBn2 b R’ = R2 = H, Ac, R3 = R4 = R5 = R6 = H (93)R’,R2 = CHPh, R3 = (CH2)20CH2Me, R4 = R5 = Bn, R62 = CHNBn2

R ’ 6 OR’

(94)a R12=CHPh, R2=Bn, R32=CHNBn2 b R‘=R2=R3=H

0

II

0-P-0-P-0

0 II

HO’

x,

R HO OH (95)X = NH, Y = OP032-, R = (CH2)3CONH(CH2)$3H,(CH2)7C02-, (CH2)&H, (CH&CONH(CH2)&02(96)a X = S , Y = R = (CH2)2CONH(CH2)2Me b X = S, Y = H, R = (CH2)2CONH(CH2)2Me

HN

0-P-0-P-0

1

)-Me

O

0-

1

>

77 Y

NH

Hgh

1 0-

--cop(97)

OH

156

Organophosphorus Chemistry

HO OH

(98)a X = H , Y = j - O

PA HO OH

b X = H, Y =;-O-br-O

vA HO OH

c X=CI, Y = O H

f-

-N I R

(99) R = Ac, i
5

R' = -NH-(CH2)2~CH2)2-O-(CH~)~-NH-CO-(CH2)~-CO-(DMTr-B) B = dAEZ,dCEZ,dCAC,dG"", T

(100)

coupled to a modified polyethylene filter disc, any carboxylic acid functions on the polymer colloid not used for attachment to the surface were derivatised with a Jeffamine diamine and loaded with the appropriate deoxynucleoside succinate. The performance of this support system was found to be comparable to CPG and polystyrene and superior to TentaGel and ArgoGel. A novel solid support ( 100) for oligonucleotide synthesis has been developed by A ~ h a y e v . ~ ~ This universal solid support was demonstrated to be applicable for the

4: Nucleotides and Nucleic Acids

157

preparation of all types of oligonucleotides (DNA and RNA) and oligomers containing rare base-labile nucleoside residues. Pon and co-workers have performed multiple oligodeoxyribonucleotide syntheses on a reusable solidphase CPG support (Scheme 3)?*

Koster and Worl have prepared novel liquid phase carriers (LPCs) ( 109, (106) for use in large-scale synthesis of oligonucleotides in solution using phosphoramidite ~ h e m i s t r y . The ~ ~ core LPC was composed of either pentaerythritol (105) or 1,3,5-benzenetricarboxylicacid (106) and deoxythymidine residues were appended to the core through alkylamide linkages. LPC (105) was employed in the preparation of several short oligonucleot i d e ~ Gel . ~ ~permeation chromatography was used for fast purification of intermediates. Total cycle yields of 81-95% were obtained with the average cycle yield 87%. A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach has been developed which does not require nucleoside base protection and which utilises imidazolium triflate as the activator in the condensation step.” For solution-phase synthesis, in which equimolar amounts of the N-free nucleoside phosphoramidite and N-unblocked nucleoside were employed, condensation was found to occur in a highly 0-selective manner. However, under solid phase conditions, which required an excess of the phosphoramidite, some N-phosphitylation was observed for deoxyadenosine and deoxycyti-

158

Organophosphorus Chemistry

Me

o0

x

L

H

o = ( HN 2 M e (105) R = DMTr, H

N

O

dine. The undesired product was subsequently converted into the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Beier and Pfleiderer have investigated a series of pyridinium salts for use as catalysts in the condensation step in the synthesis of oligodeoxyribonucleotides via the phosphoramidite approach.72 Pyridinium chloride, bromide and 4methylbenzenesulfonate were the most effective activators studied with all showing almost identical abilities. These pyridinium salts represent cheap and easy-to-handle substitutes for the commonly used 1H-tetrazole. The acidic pK, of the pyridinium cation provides an optimal range for phosphoramidite activation. It was postulated that protonation of the phosphoramidite is followed by nucleophilic attack by pyridine to give the P-pyridino intermediate (107) as the precursor for phosphite triester formation. The same workers have also developed a novel strategy for oligodeoxyribonucleotide synthesis employing phthaloyl protecting groups for the exocyclic amino functions of the nucleoba~es.~’ The advantages of this approach included: (i) the monomeric building blocks (1 OS), (109), (1 10) were prepared in a facile and cheap manner from the appropriate unprotected nucleoside; (ii) the monomers were employed under standard automated oligodeoxyribonucleotide synthesis; and (iii) removal of the phthaloyl protecting groups was accomplished while the oligonucelotide is still attached to the solid support using 1M DBU in acetonitrile. The crude oligodeoxyribonucleotides synthesised using this method showed a high degree of purity and did not require, in general, any further purification.

4: Nucleotides and Nucleic Acids

159

(106)R = DMTr, H

0

f0 x-

NC (107)

x = cr, Br-, -03s-+Me

0

Ro

Organophosphorus Chemistry

160

5’-O-(9-Fluorenylmethoxycarbonyl)-protected trinucleotide phosphoramidites (1 1 la,b) have been applied to the preparation of oligodeoxyribonucleotide libraries.74 Mixtures of (1 1 la) and a standard 5’-0-(4,4’-dimethoxytrityl)protected phosphoramidite were coupled to generate varying levels of mutation. Alternatively, substoichiometric quantities of (1 11b) were coupled to the

v1

FmocO

Me0 (111) a B 1 = B 2 = B 3 = T b B1=G, B2=C, B3=T

free 5’-hydroxyl of a support-bound oligodeoxyribonucleotide followed by three couplings of standard DMT-protected phosphoramidites. The Fmoc groups were removed by treatment with piperidine. Oligodeoxyribonucleotides have been synthesised using solution photogenerated acids.75An acid precursor, such as triarylsulfonium hexafluoroantimonate (1 12) was converted in situ into the corresponding acid through a solution

I

SPh

photolytic process. Following deprotection by the photogenerated acid (PGA), standard chemistry was employed to construct the growing oligodeoxyribonucleotide chain and thus facilitated synthesis of oligodeoxyribonucleotides through conventional chemistry. Ravikumar and co-workers have reported the clean and efficient removal of DMT groups during oligodeoxyribonucleotide synthesis using a solution of dichloroacetic acid in toluene rather than the more hazardous dichloromethane typically employed in this role.76

4: Nucleotides and Nucleic Acids

161

4.2 RNA Synthesis. - Caruthers and co-workers have developed a de novo strategy for RNA synthesis in which monomers containing 5’-0-silyl ether and 2’-O-bis(2-acetoxyethoxy)methyl (ACE) orthoester protecting groups (1 13) Me

I I 0 I

Me-Si-Me Me

I

Me-Si-0-Si-0

I

Me

bR

MeO,

,O

P I NPrI2

0 yo-0

I

O 0

were ~ t i l i s e d Using . ~ ~ these monomers, nucleoside coupling yields were found to be comparable to those of DNA synthesis with yields of >99% being obtained in
4.3 The Synthesis of Modified Oligodeox yribonucleotides and Modified Oligoribonucleotides. - 4.3.I Oligonucleotides Containing ModiJied Phosphodiester Linkages. Luther et al. have reported an iterative, stepwise procedure for chemical replication (Scheme 4) which fkcilitated an exponential increase in the concentration of oligodeoxyribonucleotide analogues.s0 The surface of a solid support was employed. SPREAD (surface-promoted replication and exponential amplification of DNA analogues) involved the synthesis of oligonucleotide copies (1 16) from precursor fragments (1 18) by chemical ligation on immobilised templates ( 1 17), liberated and then immobilised to become new templates. The role of the support was to separate complementary templates which would form stable duplexes in solution. L-RNAs have been prepared as part of an investigation into the use of L-oligoribonucleotides in the control of gene expression.8’ The protected L-ribophosphoramidates ( 121) were incorporated into L-RNA oligomers using standard protocols. The affinity of methylphosphonate-linked oligodeoxyribo-

162

Organophosphorus Chemistry

L

163

4: Nucleotides and Nucleic Acids ODMTr

&J

TBDMSO

0,

DMTroD I

0 I

P/'*CN

I .

NPr'2

Pri2N' p\ Me

(121)B = ABz, CBz,Gih, U

(I22) 8 = ABZ, CiB", T

nucleotides for complementary DNA has been enhanced using the a-anomers prepared via the methyl phosphonamidites ( 122).82 To overcome poor cellular uptake and instability of oligonucleotides and their phosphorothioate analogues, Tosquellas et af. have developed prooligothymidylates containing alternating S-pivaloyl-thioethyl (tBuSATE) phosphotriester/phosphorothioate (123) and tBuSATE-thionophosphotriester/ phosphodiester linkages (124).83 These prooligonucleotides were assembled using automated solid-phase synthesis on a photolabile solid support. Standard phosphoramidite chemistry was employed but the non-nucleophilic base, DBU, was used for elimination of the cyanoethyl groups. Gap prooligodeoxyribonucleotides containing either neutral methylphosphonate termini ( 125) or 0

( 124)

(123)

o=(

But (126)rU' = Y-0-Methyluridine

Organophosphorus Chemistry

164

charged termini with nuclease resistant 2’-O-methyluridines ( 126) were also synthesised. Recently, much interest has been generated in developing cost-effective large-scale syntheses of oligodeoxyribonucleotide phosphorothioates to support current clinical trials and meet future market demands. Turney et al. have investigated the effect of the reactor on the amount of desulfurisation obtained in the final deprotection protocol.84 Desulfurisation of oligodeoxyribonucleotide phosphorothioates was observed in aqueous ammonia in the presence of stainless steel shavings at 55°C. However, this finding was not reproduced when deprotection was performed in either an electropolished stainless steel or glass container. One problem commonly encountered in the automated solid-phase synthesis of oligodeoxyribonucleotide phosphorothioates has been the formation of deletion sequences. Eleuteri et al. -have addressed this issue and shown that a substantial reduction (>85%) in (n- 1)mer content was achieved by using fully-protected trimeric phosphoramidite synthons ( 127).85

ov Hov 0

0 I

(127) B = T, CBz,GiBu,AB‘

SiMe(Ph)p

ow I

OH (128) a X = S , Y = O b X=O, Y = S

Reese and Song have reported the full experimental details for the synthesis of oligonucleotides and oligonucleotide phosphorothioates in solution using an H-phosphonate-based approach.86Bis(2-chlorophenyl)phosphorochloridate was employed as the coupling agent and either 2-(4-~hlorophenylsu1fanyl)isoindole-1,3(2H)-dione or 4-[(2-cyanoethyl)sulfanyl]morpholine-3,5-d~one as sulfur transfer reagents. 2-(Diphenylmethylsily1)ethyl (DPSE)-protected 3’phosphoramidites have been shown to be useful synthons in the preparation of DNA and oligodeoxyribonucleotide phosphorothioates. Krotz et al. have reported an improved deprotection procedure for DPSE-protected ( O,O,O)and (O,O,S)-trialkyl phosphorothioate oligomers (1 28a and b respectively)

165

4: Nucleotides and Nucleic Acids

using tetrabutylammonium fluoride in THF.87 This gave the corresponding phosphorothioates with no formation of phosphodiester linkages being detected . The utility of phenylacetyl disulfide (PADS) as a potential sulfur transfer agent in the solid-phase synthesis of oligodeoxyribonucleotide phosphorothioates has been investigated.88 A 0.2 M solution of PADS in 1:l (v/v) acetonitrile :3-picoline was reported to rapidly and efficiently sulfurise internucleotide phosphite linkages with equivalent efficiency to Beaucage reagent but with greater reproducibility. 3-Methyl-1,2,4-dithiazolin-5-0ne(MEDITH; 129), has also been applied in the synthesis of oligonucleotides phosphorothioates via solid-phase phosphoramidite chemistry.89The sulfurisation efficiency of a solution of 0.03 M MEDITH in acetonitrile was investigated; >99.5% sulfurisation was observed with this reagent using a reaction time of 1 minute and was maintained after three weeks. The stereochemistry of DBU/LiCl-assisted nucleophilic substitution at phosphorus in nucleoside-3’-O-(S-methylmethanephosphonothiolate) and 3’-0(Se-methyl methanephosphonoselenolate) derivatives has been re-evaluated by Stec and c o - w o r k e r ~Single-crystal .~~ X-ray analysis was used to demonstrate that this reaction proceeded by inversion of configuration. 2’,3’-Dideoxyribonucleoside-3’-N-(2-oxo-4,4-( spiropentamethylene-1,3,2-oxathiaphospholanes)) (130)91 and -3’-0-(2-thio-4,4-(spiropentamethylene-l,3,2-oxathiaphospholanes)) have been prepared9* and their solid-phase couplings reported. Stec and co-workers have also described the first stereocontrolled solid-phase synthesis of di-, tri- and tetra[adenosine (2’,5’) phosph~rothioate].~~

DMT*

DMTrO

-T

0 I

s=p-o-

Il?0 (129)

I H

(130)

(131) B = ABz, CBz,GiW, T

A major limitation in the solid-phase synthesis of phosphorodithioate DNA using the phosphoramidite approach has been the synthesis of the thiophosphoramidite monomers. Seeberger et al. have developed an alternative synthesis of phosphorodithioate oligonucleotides using an H-phosphonothioate r n e t h ~ d o l o g y .5’-0-DMT-protected ~~ nucleoside H-phosphonothioate monomers (1 31) were prepared from commercially available methyl-protected nucleoside phosphoramidites in two steps in almost quantitative yield. DPCP was found to be an efficient activator in the solid-phase synthesis of phosphorodithioate DNA utilising these monomers, and resulted in coupling yields consistently higher than 97.5%. 2,4-Dichlorobenzylthiosuccinimidewas employed in the sulfurisation step, performed after each coupling, to afford the corresponding phosphorodithioate triester which was stable during the course of the synthesis.

166

Organophosphorus Chemistry

An improved synthesis of oligodeoxyribonucleotide N3’+ 5’ phosphoramidates and their chimerae via amine exchange of hindered 5’-0-(cis-2,6-dimethylpiperidinyl 2-cyanoethy1)phosphoramiditemonomers (132) and (133) has been reported.95 Initial studies were also performed using 5’-0-phosphoramidite monomers (134a-c). An improved oxidation reagent consisting of hydrogen peroxide, water, pyridine and THF was also introduced. Oligomers were prepared on scales up to 10 mmol using 3.6 equivalents of monomer (133). A final coupling with a standard 2’-TBDMS-protected uridine phosphoramidite

ODMTr

I

(132)

B

NHTr = ABZ, CBz,GIBu Opt, T

NHTr

(133)

MMTrHN OTBDMS (135) B = ABz, T

enabled modified sequences synthesised on a 1 mmol scale to be purified by RPHPLC. This lipophilic handle was removed following treatment with 1:1 1M sodium fluoride:concentrated aqueous ammonia. A novel solid-phase ‘reversesynthesis’ strategy of N3’+ 5’ phosphoramidate oligonucleotides has also been reported by Baraniak et al.96 Support-bound nucleoside 5’-0-( 0-P-cyanoethylin the H-phosphonates) were coupled with 3’-amino-2’,3’-dideoxynucleosides presence of iodine. Average coupling yields were in the range of 92-96% for A, C and T nucleosides and 87% for G nucleosides were reported. Gryaznov and Winter have described the application of amine exchange chemistry to the preparation of oligoribonucleotide N3’ +5’. phosphoramidates via 5‘-phosphoramidite monomers ( 135).97 Oligoribophosphoramidates were found to be resistant to enzymatic hydrolysis and formed stable duplexes with complementary natural phosphodiester DNA and RNA strands, as well as with oligodeoxyribonucleotide N3’+ 5‘ phosphoramidates. Crude H-phosphonate oligonucleotides bearing N-unmodified bases have been prepared with 6-hydroxyhexyl phosphonates at both 5’ and 3’ termini to stabilise the internucleotide linkage during n-propylamine-mediated release from the solid support.98 An effective method for the solid-phase synthesis of oligodeoxyribonucleoside boranophosphates has been reported involving Hphosphonate chain elongation followed by b ~ r o n a t i o n .The ~ ~ boronation procedure required intermediate conversion of an H-phosphonate diester into a phosphite triester by silylation and subsequent oxidation by a borane-amine complex. The efficiency of the boronation procedure was approximately equivalent to iodine oxidation in the formation of oligodeoxyribonucleotides.

167

4: Nucleotides and Nucleic Acids

He et al. have prepared a series of 15-mer oligodeoxyribonucleotide analogues in which one or more phosphodiester linkages have been replaced by a neutral formacetal moiety.loo The formacetal linked dimer phosphoramidites (136a-c) were all prepared using a modification of van Boom’s procedure in which a nucleoside phosphinate, 3’-O-CH2-OP(O)R2, was employed in the condensation reaction instead of a nucleoside phosphate. Dimer phosphoramidite (136d) was synthesised by condensation of the 3’4-methylthiomethyl derivative of a protected 2’-deoxyguanosine with the 5’-hydroxyl group of another protected 2’-deoxyguanosine in the presence of N-iodosuccinimide and trifluoromethanesulfonic acid. These formacetal-linked dimer units were incorporated into oligodeoxyribonucleotides using standard solid-phase chemistry and the phosphoramidite method. A pentathymidylate fully substituted with 3’-thioformacetal internucleotide linkages ( 137) has been prepared and incorporated into a 15-mer oligodeoxyribonucleotide.l o l This oligomer was prepared in solution via an iterative procedure starting with the condensation of a nucleoside sulfhydryl (138) with a phosphinate (139) to yield the dimer sulfhydryl (140) following deprotection. Chain extension to give (141) and a

vpr

DMTrO

vP

DMTrO

O\

T

‘OV2 0 , I DBUIDMFEonnamlde ii MsOHEt3SiH

DMTrS (139)

SH (140)

T

Organophosphorus Chemistry

168 PivO

'r;l +

-

i DBU/DMFAmarnide ii NaOMeMeOH 111 DMTCllPy

(137)

final condensation reaction performed wit,, a 3'-O-lauroyl-protected phosphinate derivatives (142) yielded the pentamer (137). Barawkar and Bruice have reported the synthesis of mixed backbone oligodeoxynucleotides (18-mers) consisting of positively charged guanidinium linkages along with negatively charged phosphodiesters via the dimer phosphoramidite ( 143).Io2Bruice and

co-workers have also reported full experimental details for the solid-phase synthesis of an octameric thymidyl DNG oligomer and evaluated a pentameric t hymidyl methy Ithiourea. * O4 Peptide nucleic acids (PNA) and analogues have continued to enjoy considerable attention this year. Nielsen and co-workers have synthesised the protected 6-thioguanine PNA monomer (144) and incorporated it into a 10mer PNA oligomer.'05 The introduction of a single 6-thioguanine residue in the PNA oligomer resulted in a decrease in stability of the antiparallel PNA:DNA heteroduplex. A simple and efficient one-pot method for the synthesis of known and novel PNA monomers, e.g., (149), has been developed using the Ugi Four Component Condensation reaction (Scheme 5).'06 Lutz et af. have prepared a monocharged PNA primer (150) that was recognised as a Io37

169

4: Nucleotides and Nucleic Acids

SI

OH

-Q

T

substrate by several DNA p o l y m e r a ~ e s . This ' ~ ~ primer was synthesised using the novel phosphoramidite building block (151). Novel chirdl PNA monomers ( 152a-d) have been synthesised by reductive amination of N*-Boc-protected

H

(151)

(152) a R = (42H2CHMeZ b R = I-CH2Ph c R = wH(OCH2Ph)Me d R = I-CH2CsH4-pOH

chiral aldehydes, derived from Leu, Phe, Tyr(Bz1) and Thr( Bzl) respectively, with methyl glycinate.lo8 A novel PNA (153) has been prepared which shows all-or-none-type hybridisation with complementary DNA targets. lo9 Gangamani et al. have synthesised homothymine oligomers of 4-aminopropyl PNAs ( 154), a class of

170

Organophosphorus Chemistry

'

conformationally constrained chiral PNA analogues. l o The D-trans- ( 155) and L-trans- ( 156) 4-aminoproline thymine monomers were also incorporated into standard PNA oligomers. Serinol-derived acyclic nucleoside analogues have been incorporated into oligonucleotides via the corresponding phosphoramidites (157). Triplex-forming oligonucleotides bearing these residues showed

(154) B = T

RCONH H

reduced hybridisation capabilites. von Matt and co-workers have described the introduction of 2'-deoxyribo polyamide nucleic acid monomers into fully substituted and chimeric oligonucleotide analogues using appropriate monomer synthons (158)-( 160). l 2 Binding affinities to complementary nucleic acids were similar to those observed for unmodified oligonucleotides. 4.3.2 Oligonucleotides Containing Modijied Sugars. Conformationally restricted oligonucleotide analogues containing bicyclic monomers have at-

MMTrHNv b. 0

F

'F

171

4: Nucleotides and Nucleic Acids

tracted considerable attention due to their potential for formation of entropically favourable duplexes. Continuing their research in this area, Wengel and co-workers have reported the synthesis of the first analogues of LNA (Locked Nucleic Acids, (161a)): 2’-Thio-LNA (161b) and phosphorothioate-LNA (161c). l 3 9-mer LNAs incorporating one, three or five LNA-2’-thiouridylate monomers, prepared via the phosphoramidite (162)’ were found to hybridise to complementary DNA and RNA targets with thermal affinities comparable to those of the parent LNAs. Workers in the same group have also prepared novel and 2’-methylamino-2’-N,4’-C-methylene bicyclic 2’-amino-2’-N,4-C-methylene ribonucleoside analogues with significantly increased thermal stability toward complementary DNA (ATm= +3.0 “C) and RNA (ATm= +6.0 to +8.0 OC).lL4 These conformationally restricted oligonucleotides were prepared via the corresponding phosphoramidite monomers ( 163a,b). Kvaerns and Wengel have prepared LNAs containing an ‘abasi’ LNA unit via the corresponding phosphoramidite (164). l5 This monomer was incorporated into oligonucleotides using automated solid-phase synthesis under normal conditions except that coupling time was extended. The conformational changes mediated via the nucleobase were demonstrated to be pivotal to the properties of LNA.

? DMTroxl x‘o

O=P-Y-

I

0-! (161) a X = Y = O , B = T b X=S, Y=O, B = U c X=O, Y=S, B = T

s‘0 I

pr12N0p\O/\/CN (162)

DMTrov/ DMTrox? N O R ‘

0‘0

Obika et al. have incorporated bicyclic pyrimidine nucleoside analogues with a fixed N-type conformation into oligonucleotides via the corresponding phosphoramidites (1 65). I I 6 This group has also prepared and evaluated 2-5‘linked oligonucleotide analogues containing 3’-0,4-C-methyleneribonucleosides (166).’I 7 These modified oligonucleotides bound to complementary RNA more strongly than 2’,5‘-RNA and demonstrated significant selectivity for RNA over single-stranded (ss) DNA. Wang et al. have examined oligodeoxyribonucleotides analogues containing 2’,4’-C-bridged 2’-deoxyribonucleosides synthesised via the corresponding phosphoramidite ( 167) using standard automated solid-phase synthesis proto-

172

Organophosphorus Chemistry

cols except that more concentrated solutions and extended coupling times were employed. l8 Hybridisation studies on the modified oligonucleotides showed that incorporation of the bridged bicyclonucleosides significantly enhanced hybridisation to complementary RNA targets.

y-$ 0

DMTrov DMTrO

oMTroli7 O

P

(166) B = T, CBz

0 I

o=p-o-

I H (168) B = 5MeCBz, T

Zou and Matteucci have reported the synthesis and properties of an oligonucleotide analogue bearing 1',3'-di-O-methylene-a-~-fructose prepared from the hydrogen phosphonate monomers (1 68). l9 Hybridisation studies on this modified oligonucleotide indicated that it did not bind to complementary RNA. Enhanced T, values were observed with both complementary RNA and DNA. Phenazine (Pzn)-tethered ara-uridine and xylo-uridine oligodeoxyribonucleotide conjugates have been prepared and the thermal stabilities and fluorescence properties of their duplexes and triplexes have been investigated using automated solid-phase synthesis and the modified phosphoramidite (169a) or succinated derivatives (1 69b,c), ( 1 7 0 a - ~ ) . ' ~ ~ 2'-0-( 1-pyrenylmethyl)uridine has been incorporated into the central position of 9-mer oligonucleotides at the central position via the corresponding phosphoramidite (171). The binding affinities of the 9-mers to the complementary DNA (increased) and RNA (decreased) were measured and sequencedependent fluorescence enhancement was observed with DNA. l 2 * 2'- 0-Aminooxyethyl modified 5-methyluridine and adenosine nucleotides have been incorporated into oligonucleotides via the corresponding phosphoramidites ( 172). The 2'-O-modifications were found to significantly enhance hybridisation against RNA (1.2 "C per substitution) and exhibited specificity for RNA against DNA. Enhanced nuclease resistance of these oligonucleotides compared with unmodified DNA was o b s e r ~ e d . I ~ ~ - ~ ~ ~

173

4: Nucleotides and Nucleic Acids

(169) a R’

= (-P(NPt2)0CH2CH2CN, R2= Me, n = 1 R2= Me, n = 1

b R’ =$&OH, 0

R2 = Pac, n = 3,5

c,d R’ =$&OH, 0

(170) a R = M e , n = l b,c R = Pac, n = 4, 6

0

DM DMTro (?

N c * O N0 ‘ 0 \ N P B

NC*O/

O - O - N BO

p, NPr‘2

0 (171)

(172) B = ABZ, T

Electroactive oligodeoxyribonucleotides have been prepared utilising a phosphoramidite that bears a 9,lO-anthraquinone (AQ) group tethered to the 2-0 of uridine via a hexylamino linker (173).’” Nearly reversible two-electron waves characteristic of an adsorbed anthraquinonehydroquinone redox couple was observed for all of the AQ-ODN conjugates. Fully protected modified oligoribonucleot ides containing 2’- 0-cyanomethylribonucleotide residues were prepared from the corresponding phosphoramidites ( 174) using automated solid-phase synthesis.125 The 2’-O-cyanomethyloligoribonucleotides were post-synthetically converted into 2’-O-carbamoylmethyloligoribonucleotides (175) during standard deprotection conditions with aqueous ammonia. The 2’-0-carbamoylmethyloligori bonucleotides-RNA heteroduplexes were found to be substantially more stable than the corresponding RNA homoduplexes and 2’-0-carbamoylmethyloligoribonucleotides showed a high level of discrimination between complementary RNA and DNA targets. Greiner and Pfleiderer have reported the synthesis of 2’-amino-2‘-deoxyribo-

174

Organophosphorus Chemistry

(173)

s-

DMTrovp ' O J . jI >

0 0-CN

NH2

I

0-I

Pt2N (174) Bp = Up", CBz,A'',

(175) B = U, C, A, G

G

nucleoside-3'-0-phosphoramidites(176a-f). 126 The aglycone and 2'-amino functions were protected using the 2-(4-nitrophenyl)ethoxycarbonyl (npeoc) group. 2'-N-(npeoc)-3'-O-succinylnucleoside- derivatised solid supports could not be used in the solid-phase synthesis of 2'-aminooligodeoxyribonucleotides due to the tendency of the succinyl group to migrate during npehpeoc

0 I

NHnpeoc

prl*N P \ / v C N (176) a R =MMTr. B p = C " F b R = DMTr, Bp= C " p

c d e f

R R R R

= MMTr, BP = U =DMTr, B p = U = DMTr, Bp = G ; K =DMTr. BP=Anp

deprotection with DBU. Consequently, deoxynucleoside or acetyl-protected 2'aminouridine derivatives were attached to the support. The synthesis of oligonucleotides containing 2'-0-(trifluoromethy1)adenosine has been described using the phosphoramidite derivative (1 77).'27 These oligonucleotides were found to form less stable duplexes with complementary DNA but more stable duplexes with complementary RNA. 2'-O-Methylribonucleoside bicyclic oxaphospholidine phosphoramidites (178) and ( 179) have

175

4: Nucleotides and Nucleic Acids

DMTrowp DMTr 6 ,

O ,

OMe

OMe

been synthesised from (R)- and (5‘)-2-pyrrolidine methanol respectively and used in the stereoselective solid-phase synthesis of ( Rp)- and (Sp)-2’-0methyloligoribonucleoside phosphorothioates.128 Interestingly, higher stereoselectivity was obtained in the preparation of (Sp)-2’-0-methyloligoribonucleoside phosphorothioates (96-98%) than (Rp)-2’- 0-methyloligoribonucleoside phosphorothioates (63-76%). A series of novel 2’-0-methylribonucleoside3’0-[2-(4-nitrophenyl)ethyl]dialkyl-phosphoramidites ( 180) has been prepared

R30vp 0

OMe

I

R’Y p \ O R

R2 (180)

B = A*”, AnW,

Cnm, R = MMTr, DMTr R‘ = Me, Et, Pr‘ R2 = Et, Pr’ R3 = npe

G”,,

U

and their stabilities and reactivities have been compared in the automated solid-phase synthesis of 2’-0-methyloligoribonucleosides with the standard 2’0-methylribonucleoside 3 ‘ 4 4P-cyanoethyl)diisopropylphosphoamidites. 29 It was found that although the [2-(4-nitrophenyl)ethyl]diisopropylphosphoramidites were more stable to decomposition than the conventional P-cyanoethyl diisopropylphosphoramidites, they were less reactive. However, if the diisopropyl group was replaced by a diethylamino, isopropyl(methy1)amino or an ethyl(isopropy1) group, then reactivity was retained. Piccirilli and co-workers have described a strategy for the incorporation of 2’-C-P-methylcytidine into oligonucleotides via solid-phase synthesis using phosphoramidite derivatives (1 8 1).13* Oligonucleotides containing 2’-C-Pmethylcytidine were shown to undergo base-catalysed degradation analogous to natural RNA. Dunkel and Reither have prepared 2’-C-a-difluoromethylarauridine 3’-0-phosphoramidite (1 82) from uridine.131 This monomer was employed as a replacement for uridine at position U4 in the synthesis of a hammerhead ribozyme. It was found that substitution of this modification for uridine at U4 resulted in cleavage activities close to 2’-amino-2’-deoxyuridine or similar to 2’- C-allyl-2’-deoxyuridine,known 2’-modified uridines employed

Organophosphorus Chemistry

176 NHBz

6I

OR

Pr‘2N, P , O ~ C N (181) R = THP, TBDMS

in the endonucleolytic stabilisation of hammerhead ribozymes. MatulicAdamic et al. have further refined the ‘5-ribo’ nuclease stabilised hammerhead motif by systematic incorporation of 1-(P-D-xylofurdnosyl)adenine (xA) and 1(g-D-xyl0furanosyl)guanine(xG) via the corresponding 3‘-O-phosphoramidites (183).l3* Modified ribozymes substituted with xA at conserved positions A1 5.1 and A6 demonstrated catalytic activity close to the parent stabilised ribozyme. Analogous guanine substitutions at positions G5, G8 and G12 substantially lowered catalytic rates. In contrast to the mechanism of DNA strand cleavage via 4’-radicals, the corresponding RNA cleavage mechanism has not been investigated to any significant extent. Giese and co-workers have introduced the 4’-acetyl derivative of adenosine into an oligonucleotide using H-phosphonate chemistry via the monomer (184).133Irradiation of the oligomer at 320 nm led to formation of the #-radical and subsequent strand cleavage under aerobic or anaerobic conditions proceded at reduced rates compared with those observed for the 2’deoxy analogue. Workers in the same group have also incorporated 4’pivaloyl-substituted guanosine into oligodeoxynucletides. 134 A highly efficient synthesis of oligonucleotides containing the 2’-deoxyribonolactone lesion ( 185) has been deve10ped.l~~ This lesion is a common ‘abasic’ site found in DNA and is reported to be mutagenic, resistant to repair nucleases and responsible for DNA strand scission. The key to the synthesis was irradiation of an oligonucleotide containing a 7-nitroindole nucleoside unit ( 186). This resulted in formation of (1 85) and 7-nitrosoindole with no trace of other side-products. P-D-Allofuranosyl cytosine phosphoramidites with pendant metal ionbinding sites (187) have been utilised in the preparation of oligoribonucleotide analogues containing 1-aza-18-crown-6 and triethyleneglycol. 36

177

4: Nucleotides and Nucleic Acids

Rlo$:q

R1oPo

OR2 (186) R1 = d(CGCAC), R2 = d(CACGC)

OR2 (185) R1 = d(CGCAC), R2 = d(CACGC)

[1’,2’,3’,4’,5’]-13C5-labelled ribonucleoside phosphoramidites (99 atom YO ( 188) have been synthesised from commercially available 3C6-~-

’3C)

glucose.’37These have then been used in the solid phase synthesis of specifically 13C-labelledstem (27A and 43G), bulge (24C) and loop (31U)regions of 29-mer HIV-1-TAR RNA hairpin. The chemical synthesis of appropriately NHR’

I

protected partially-deuterated 2’(RIS), 3’,5’(RIS)2H3-2’-deoxyribonucleoside phosphoramidites (189a,b) [- 43 atom YO2H at C5’(R); 57 atom YO2H at C5’(S); 15 atom YO2H at CZ’(R); 85 atom YO2H at CZ’(S) and >99 atom YO 2H at C3’] has also been reported. 38 These deuterium labelled building blocks have been incorporated into the Dickerson-Drew dodecamer by solid phase synthesis.

-

-

-

DMTrov 0

I

OTBDMS

0 I

R2

pr12N’p\o%CN

NC*O’p\NPr‘p (188) B = A’‘,

DMTroQ

CBz,GIB”,U

(189) a B = A ~cAc, ~ G ,‘,;: b B = ABz, CAc,G;:‘,

T; R’ = D, R2 = H T; R 1 = H, R2 = D

Organophosphorus Chemistry

178

4.3.3 Oligonucleotides Containing ModiJied Bases. Potential triple-helix-stabilising 2'-deoxycytidine analogues have been prepared and incorporated into oligonucleotides via the corresponding phosphoramidites ( 190). 39 Khattab and Pedersen have reported the highest stabilisation observed to-date for an oligodeoxyribonucleotide three-way junction. 14* This was achieved by incorporating an a-cytidine conjugated to a pyrenylmethyl intercalating moiety at the junction region of an a-oligodeoxyribonucleotide.The oligonucleotide was prepared via the phosphoramidite ( 191). 2'-Deoxy-5-methyl-N4-(4-phenoxypheny1)cytidine has also been introduced at the branch point of a three-way junction using standard phosphoramidite ( 192) chemistry.141 Eritja and coworkers have described the preparation and properties of oligodeoxyribonucleotides containing mercaptoethyl groups at position N-4 of cytosine using a t-butyldisulfide-protected phosphoramidite ( 193).142 Reaction of the resulting thiol-Oligodeoxyribonucleotides with a maleimido-peptide carrying the c-myc tag-sequence yielded a conjugate specifically recognised by an anti c-myc monoclonal antibody. Oligonucleotides incorporating a p-cyano substituted 5-benzoyl-2'-deoxyuridine residue were prepared via the phosphoramidite ( 194).143Photoirradiation of these oligonucleotides at 312 nm followed by treatment with hot piperidine led to selective cleavage at the 5'-G of a GG motif downstream of the

8,

HN

0 I

no'0

HN

HN

-S-SBu'

179

4: Nucleotides and Nucleic Acids

site of modification. Photochemical site-specific cross-linking methods employing photoactive derivatives of nucleotides find a broad range of applications in the elucidation of nucleic acid structure and in the analysis of protein-nucleic acid complexes. Topin et al. have synthesised a novel photo-cross-linking nucleoside analogue, 5-[4-3-(trifluoromethyl)-3H-diazirin-3-yl)phenyl]-2'-deoxyuridine, and incorporated it into the recognition site of EcoRII and MvaI restriction-modification enzymes via the phosphoramidite (195). Becker et al. have reported a novel phosphoramidite (1 96) for site-specific incorporation of 4-thiouridine into oligoribonucleotides.145 4-Thio-2'-deoxyuridine residues in oligodeoxyribonucleotides have been quantitatively regenerated from S-alkylated 4-thio-2'-deoxyuridine moieties using sodium hydrosulfide.146 This method facilitated the 'reuse' of the thiocarbonyl moieties in alkylation reactions within oligodeoxyribonucleotides containing thionucleoside derivatives.

DMTrov DMTm ""'"74 $IOTBDMS

""'"v

Hunziker has synthesised the protected 5-(2-amino-2-deoxy-fb~-glucopyranosyloxymethyl)-2'-deoxyuridine phosphoramidite ( 197) from uridine in twelve steps.147 This novel nucleotide analogue was subsequently incorporated into oligodeoxyribonucleotides using automated solid-phase synthesis. The aminoglycoside-modified oligonucleotides showed decreased binding affinities for complementary RNA and DNA targets. 5-Formyl-2'-O-methyluridinehas been incorporated into oligonucleotide sequences containing the NF-KB binding sequence or its complement via the phosphoramidite (I 98). 148 Following cleavage, deprotection and purification,

Organophosphorus Chemistry

180

the resulting oligonucleotides were treated with sodium periodate to afford the desired 5-formyl-2‘-O-methyluridine derivatives. CS-substituted nucleoside phosphoramidites with pendant 2-nitr0-4,Sdimethoxybenzyl-protected carboxylic acid (199a) or amine (199b) functions

0 OMe I

P

OMe OMe

have been incorporated into oligodeoxyribonucleotides.149 The reactive functional groups were selectively unmasked upon irradiation at 365 nm to afford protected, modified oligodeoxyribonucleotides which were subsequently derivatised and deprotected to afford conjugates (200) in high yield. Khan and Grinstaff have used the Sonogashira Pd(0) cross-coupling reaction to attach alkynyl-derivatised amines, biotin and a transition metal complex to an oligonucleotide (201) during automated solid-phase synthesis immediately following incorporation of 5-iodo-2’-deoxyuridine via the corresponding phosphoramidite, to give (202).150 Ruthenium-labelled oligonucleotides have been prepared by automated solid-phase synthesis using a ruthenium-nucleoside phosphoramidite (203). 15’ Fox and co-workers have prepared triplex-forming oligonucleotides in which third strand 5 4 1-propargylamino)-2’-deoxyuridine residues were introduced via the phosphoramidite (204). 52 Enhanced triplex formation of such oligonucleotides compared with those in which thymidine was utilised was demonstrated by footprinting and melting studies. Two series of modified oligonucleotides based on the self-complementary dodecamer d(CGCTAATTAGCG) incorporating CS-propargyl derivatives of 2‘-deoxyuridine were synthesised using the phosphoramidites (205) and (206).153 Zanta et al. have synthesised a capped 3.3 kbp CMVLuciferase-NLS gene containing a single nuclear localisation signal peptide incorporated at a modified 2’-deoxyuridine residue (207).154 Transfection of cells with the tagged gene remained effective down to nanogram quantities of DNA. Asseline and co-workers have described the application of a dinucleoside H-phosphonate

4: Nucleotides and Nucleic Acids

181

..yX

RioG OR2

(200) a R' = 'd(TACGTACTGA), R2 = yd(GCAGCTCGT), n = 2, X

=$

b R1 = ''d(TACGTACTGA), R2 = 'd(GCAGCTCGT), t~ = 3,

0

ODNi*

HNW

N

H

R

ODN2'

AGCA CT T GCA GTT GA TACATCCTA CT GGTCTTATT(CAC)2- CT -AATAACCTCAGT T cu

(DMTr0)-

(202)a R = S-COCF3 b R = $+(O)OCMe3

(208) in which the nucleobases were linked via a semi-rigid bridge to the generation of 5'-5'-linked oligonucleotides designed for alternate strand triplex formation. 55 Oligonucleotides containing tandem base lesions

Organophosphorus Chemistry

182

v

DMTrO

0

DMTrov (204) R

(206) R=$--Me,

S-Ph,

-8

0

(205) R

N-(2-deoxy-~-~-erythvo-pentofuranosyl)-formylamine/8-oxo-7,8-dihydro-2’-deoxyguanosine (209a,b) have been prepared via the corresponding phosphoramidites. 156 Carell and co-workers have prepared oligonucleotides with a formacetallinked thymidine or the cis-syn photodimer analogue via the corresponding phosphoramidites (2 10) and (2 11) respectively. 157 Photolyase-mediated repair of these single-stranded oligonucleotides or in complex with the complementary DNA was found to be considerably more efficient than when in complex with the complementary RNA. Mizukoshi et al. have prepared oligonucleotides containing the (6-4) photoproduct of thymine-cytosine using the corresponding phosphoramidite (2 1 2 b ) J 8 The key step involved irradiation of thymidyl(3’-5‘)deoxycytidine to give the (6-4) photoproduct (2 12a). Phosphoramidite (212b) was incorporated into oligonucleotides (2 13) using solid-phase synthesis in the absence of the capping step that avoided acylation of the 5amino function. Template-directed photoligation of oligonucleotides has been reported by irradiation at 366 nm of a ternary complex with adjacent thymidine and 4-thiothymidine termini (Scheme 6). 159 Circular DNA templates have also been constructed in this manner.

4: Nucleotides and Nucleic Acids

183 R

0

I

o=p-o-

0

ODMTr

0

I H-P=O

(208)

0-

A tricyclic pyrimidine nucleoside analogue has been incorporated into oligonucleotides via the H-phosphonate derivative (217). 160 T, analysis showed enhanced recognition of both complementary adenine and guanine within a DNA duplex. Moreau and co-workers have reported the synthesis of phosphoramidite derivatives of benzo[gj]- (218) and benzom-quinazolines (219). 16' Triplexforming oligonucleotides incorporating benzoquinazolines as substitutes for thymine were prepared using (218) and (219). Benzo[g]quinazoline revealed strong fluorescence emission properties which were used to monitor selectively the formation of triple-helical structures. Two 32-mer oligonucleotides containing the triazolo[2,3-a]purine ring system have been prepared from their phosphoramidites (220a,b) using automated solid-phase synthesis.16* Khullar et al. have developed a post-synthetic method for generating the major acrolein adduct of 2'-deoxyguanosine in DNA (221).'63 The phosphoramidite derivative (222) was incorporated into oligodeoxyribonucleotides using automated solid-phase synthesis under standard conditions. Subsequently, the purified oligomer was treated with an excess of aqueous sodium periodate. This approach facilitated the site-specific introduction of (221) into ssDNA. Cadet and co-workers have prepared a series of oligonucleotides incorpor-

Organophosphorus Chemistry

184

R

hOMe

(212) a R ' = H , R ~ = $

0 NPri2 b R' = DMTr, R2 =$-PCO-CN

4: Nucleotides and Nucleic Acids

185

0

0

HN

+

Y- OR^

R~O-x

(213) R’ = ’CTTAAGCAA, R* = H,PO,%, R3 = 5’CGTAATC, R4 = ”TGCTTA, , R5 = 5’GATTACG, ’XY = AA, AG, AC, AT, GA, CA, TA

Scheme 6 F

v

DMTrO

DMTro

0 I

H-P=O

I 0-

(217 )

ating 5’,6-cyclopyrimidine, (223),lM and 5’,8-cyclopurine, (224) and (225),1659166 residues. The incorporation of (223) required the use of a nonstandard 5’-levulinyl protecting group in the 3’-phosphoramidite derivative (226) due to the poor reactivity of the 5‘-hydroxy group towards standard detritylation conditions. Seela and co-workers have published several papers describing the introduction of 7-deazapurine analogues into oligonucleotides. The phosphoramidite derivatives of 7-halogenated 8-aza-7-deazaguanines (227 a,b),1677-deaza-2’deoxyinosine (228)168 and pyrazolo[3,4-d]-pyrimidines(229)169 have been synthesised and incorporated into oligonucleotides. In addition, Seela and Leonard have incorporated the H-phosphonate or phosphoramidite derivatives of N7-(2’-deoxy-P-~-erythro-pentofuranosyl)-adenine (230), -hypoxanthine (23 1) and -guanine (232) into oligodeoxyribonucleotides under solid-

Organophosphorus Chemistry

186

0

phase conditions. I7O Seela and Wei have reported the solid-phase synthesis of oligonucleotides containing 7-deaza-2'-deoxyisoguanosineusing appropriately protected monomers (233) and (234).1 7 ' The synthesis of phosphoramidite derivatives of 7-propynyl-, 7-iOdO- and 7-cyano-7-deaza-2-amino-2'-deoxyadenosines has been reported (235). 172 Spectroscopic melting experiments of oligodeoxyribonucleotides incorporating these analogues with complementary RNA showed increases of +3-4 "C per modification for single substitutions and smaller increases per incorporation for multiple substitutions relative to unmodified control sequences. Anti-sense sequences targeting the 34-UTR of murine C-raf mRNA incorporating three and four substitutions of the 7propyne analogue exhibited a 2-3-fold increase in potency over unmodifed controls. Weinhold and co-workers have described a novel post-synthetic protocol for the modification of the exocyclic amino function of adenosine residues within a double-stranded target sequence (236) of S-adenosyl-1-methionine-dependent methyltransferase from Thermus aquaticus to yield N6-alkylated sequences (237; Scheme 7). 173 Diastereoisomeric @-substituted deoxyadenosine-benzo[c]phenanthrene diol epoxide adducts have been incorporated into oligodeoxyribonucleotides via the corresponding phosphoramidites (238a,b).174 The preparation of oligodeoxyribonucleotides containing substituted adenine residues (240) has been reported. 175 Deprotection of phenoxyacetyl-protected oligodeoxyribonucleotides incorporating 6-chloropurine using 0.1 M sodium hydroxide followed by solution-phase reaction of the resultant oligomers (239) with amine nucleophiles yielded (240). This methodology was applied to the preparation of a double-stranded oligodeoxyribonucleotide cross-linked by a

4: Nucleotides and Nucleic Acids

187

4-carbon tether between N6 positions of deoxyadenosines in the two strands (240b). Saito and Kuroda have reported the preparation of base-modified nucleoside phosphoramidites (24 1) for triple helix-mediated recognition of A-T base pairs. 76 A post-synthetic modification protocol has also been applied to the preparation of DNA templates containing oestrogen quinone-derived adducts.i 7 7

188

Organophosphorus Chemistry

I A' R' =H, R 2 = PH(O)O-Et$JH+ OR2

(230) a b R' = H, R2 = P(OCE)NPri2 C

R'

=: Me,

R2= PH(0)O- EtSNH'

d R' = Me, R2 = P(OCE)NH2

OR2

(232)a R' = H, R2 = PH(0)O- Et3NH+ b R' = H, R2 = P(OCE)NRi2 c R' = Me, R2 = P(OCE)NW* NHBu'

DMTrnvdloA NPh2

OR (233)R = F'H(0)O- EtSNH', P(OCE)NPr'2

die

OSTrnV

OR (234) R = PH(0)O- Et3NH+, P(OCE)NR'2

0

I

prI2&O/\/CN (235) a R' =j-Me. b R' =$-CN,

c R' =$-I,

R 2 = Bz R2 = Piv R ~ BZ =

Xu has reported an efficient one-step procedure for attaching a variety of biologically useful functional groups specifically onto thioguanine residues in DNA. 17* A carboxyrnethyl, hydroxymethyl and aminoethyl group and the fluorescent tag 1,5-AEDANS (243) have all been introduced by treating a thioguanine-containing oligodeoxyribonucleotide (242) with the appropriate

189

4: Nucleotides and Nucleic Acids

Taql Methyl transferase

+ cotactor R’O

R’O

R~O-T- OR^

R30-T-OR4

(238)

(237)

Me

HO

HO

OH

OH

R’ = “GCCGCTCG R2 = “TGCCG R3 = ”CGAh%GCGGC R4=”CGGCA R5 = !--Me,

jmNQA HO

OH

scheme7 NHR

I

iodo alkyl derivative. Quantitative and reversible disulfide cross-links within duplex DNA containing appropriately positioned thionucleoside bases (4-thio2’-deoxyuridineand 6-thio-2’-deoxyinosine) has been effected using iodine. 146 Rieger et al. have described the deprotection of oligodeoxyribonucleotides incorporating dimethylaminomethylene-protected 8-amino-2’-deoxyguanosine

190

Organophosphorus Chemistry CI

HNHR3

I

I

(239) a R' = CGGAC, R2 = AGAAG, R3 =HO

(240)

TPh

b R' = GC, R2 = TCCTGCACGACG, R3 = GGAN"cHh'

?9

TGCAG

residues using concentrated ammonia at 55 "C for 20 h or more in the presence of 2-mercaptoethanol. 179 The phosphoramidites of the naturally occurring P-dimethyladenosine modified nucleotides A@-methylguanosine(244) and p, (245) have been prepared and incorporated into short oligoribonucleotides. lSo The 2-(p-nitrophenyl) protecting groups were removed from RNAs containing @-methylguanosine by treatment with TBAF in THF. Beaussire and Pochet have developed a suitable synthetic route to the phosphoramidite derivative of isohypoxanthine (isoI) (246) in which the C2-exocyclic oxygen is protected

191

4: Nucleotides and Nucleic Acids

with a diphenylcarbamoyl group. This was required for an investigation into the hybridisation properties of 5-methyl-isocytosine (5MeisoC) and isoI. Heptadecamers containing either is01 or 5MeisoC at the central position were subsequently assembled using automated solid-phase synthesis and standard phosphoramidite chemistry. Interest in nucleoside analogues selectively enriched with stable isotopes has been growing due to their utility in heteronuclear NMR studies for deter-

NMe2

I

o I

OTBDMS

0

mining nucleic acid structures and dynamics. Ahmadian and Bergstrom have developed a convenient and efficient procedure for synthesising 3C methyllabelled thymidine. 18* The corresponding 3’-phosphoramidite derivative was subsequently prepared and incorporated into an oligodeoxyribonucleotide. LaFrancois et al. have reported the incorporation of I3C(8)-enriched adenine into an oligodeoxyribonucleotide.183

5

OligonucleotideConjugates

A diaziridinylquinone-triple helix-forming oligonucleotide (TFO) conjugate (247) has been prepared by reacting the triethylammonium salt of the 5’hexylamine modified TFO with a diaziridinylquinone derivative bearing a 2,3,5,6-tetrafluorophenyl activated ester linker. This conjugate acts as a triplex-directed interstrand D N A cross-linker with up to 38% interstrand cross-linking occurring at pH 6.2. Skibo and Xing have detailed the alkylation reactions of mononucleotides and D N A by aziridinyl quinones (248a-d).Is5 Bulk D N A was up to 35% alkylated by protonated aziridinyl quinones. Under acidic conditions, these hard electrophiles were found to alkylate the phos-

192

Organophosphorus Chemistry 0

N+50-P-O--”TF0It

I 0-

H& - $ ? ) NE

0

“OR’ R2

(247)

0 (248) a R2 =$-Me N ,

b R2 = I

Me C

d

phate backbone preferentially. The benzimidazole-based aziridinyl quinone (248d) was observed to undergo aziridine ring opening followed by hydrolytic removal of the aminoethyl group from the quinone ring to yield the aminoalkyl phosphate triester. Artificial ribonucleases involving a dinuclear zinc(11) complex as the catalytic centre have been prepared using the phosphoramidite monomer containing a N, N, N’,N’-tetrakis(2-pyridylmethyl)-3,5-bis(aminomethyl)benzene (TPBA; 249).186 This monomer was coupled to the 5’-termini of DNA oligomers and the cleavage of target RNA oligomers monitored. Sequenceselective cleavage in the presence of a twofold molar excess of zinc(I1) was observed. Negligible cleavage occurred in the presence of only zinc(I1) ions or with equimolar initial concentrations of the TPBA-DNA oligomer and the metal ion. The phosphoramidite derivative of a bifunctional ruthenium(I1) complex (250a) has been prepared from 2,2’-bipyridine4,4‘-dicarboxylicacid in four steps.187 This phosphoramidite was incorporated into self-complementary sequences with a coupling efficiency of >95% when performed ‘off-column’ in a glove box, to yield ruthenium(I1)-bridged DNA hairpins (250b-d). An alternative strategy has been developed by McLaughlin and co-workers. A non-nucleoside linker based upon the 2,2’-bipyridine ligand and ethylene glycol was inserted into the backbone of oligothymidylates via the phosphoramidite (251 ). 188 Ruthenium(I1)-containing DNA complexes (252a-d) were prepared upon reaction with cis-dichlorobis(2,2‘-bipyridyl)Ru(I1). Both duplexes and triplexes were formed with (252a-d). Such linkers might therefore have utility in incorporating metals into higher order DNA structures and in antisense technologies. Mercaptoacetyldiglycyl-modifiedaptamer RNA sequences (253a; X = H or SBu‘) have been prepared following post-synthetic modification of a 5’aminoalkylated aptamer sequence. The technicium-99m-labelled aptamer (253b) was prepared following reduction of sodium pertechnetate in the presence of (253a; X = H or SBut).189

4: Nucleotides and Nucleic Acids

(250) bipy-

193

0-0 / \

1\

a R’ =DMTr, # = P(OCH&H&N)NP& b R’ = 5bT4, R2 =“dA4 c R’ = 5’dG3, R2 = ‘dC3 b R‘ = R2 = 5b(GCAATTGC)

(252) a R’ = R2 = dT5 b R1=R2=dTa

c R’ = Sb(CGCACCCAT), R2 = ’d(CTCTCC) d R’ = R2 = 5’d(TG),

Paramagnetic oligodeoxyribonucleotides (254) have been prepared and utilised as contrast agents for magnetic resonance imaging. 190 Meunier and coworkers have observed the chemical transformation of a thiourea linkage to a guanidinium function during the deprotection in ammonia of a fluorescent conjugate based on a manganese cationic porphyrin carboxylate derivative linked to a 5’-amino-3’-fluorescein-labelled oligodeoxyribonucleotide. Solid-phase synthesis of several pept ide-oligonucleotide 5’-conjuga tes (255) has been accomplished on CPG using a fragment coupling approach.I9* The

1 94

Organophosphorus Chemistry

ys HNio,

0

(253) a R =

NH HN

X = H , I-SBu'

A L . 0

n

' y 'i N 1

-No"

b R=

s'

0

Gd(111)

O-~ODN

H

peptide-!

%N

'r( 0

(255) peptide = Gly, Leu.Gly.lle.Gly,Glu(Arg)3(Pro)2.Glu.Gly; n = 2, 5, 11 ;

ODN = dTI2, "d(CCAGGATCTACTGGCT), 5'rUa, 'r(C*GA*A^AC*U*C*C*);N* = Y-Omethylriboside

conjugates contained either glycine, a hydrophobic tetrapeptide or a basic peptide from the HIV-1 Tat protein linked to either dT12, a mixed base Tat d 16-mer, rU9 or a 9-mer mixed ribo/2'- 0-methyloligoribonucleotide.Improved yields were obtained when the internucleotide p-cyanoethyl protecting groups were removed from the CPG-bound oligonucleotide prior to peptide fragment coupling and by use of a long alkyl spacer in the linkage between oligonucleotide and peptide. Several novel procedures for the preparation of oligodeoxyribonucleotides conjugated to peptides at the 3' position have been reported. A modified Tentage1 support (256) has been applied to the solid-phase synthesis of a 17mer oligodeoxyribonucleotide conjugated at the 3'-terminus with the tripeptide Gly-Gly-His (258).193 McMinn and Greenberg have reported the convergent solution-phase synthesis of a nucleopeptide (259) containing a modified DNAbinding helix of the helix-turn-helix protein, h repressor. 194 The nucleopeptide was obtained in a 72% yield using only five equivalents of the protected peptide relative to the protected oligodeoxyribonucleotide. The same group has also described the application of a photolabile support (260) to the preparation of protected oligodeoxyribonucleotides containing 3'-alkyl carboxylic acids (261). The protected oligodeoxyribonucleotides were efficiently conjugated (>SO%) with amines in solution to yield products (262) of high purity under mild reaction conditions. 195 Greenberg and co-workers have also reported an efficient method for preparing 5',3'-bisconjugates of oligodeoxy-

4: Nucleotides and Nucleic Acids

0 ODN synthesis

(2%)

OTBDMS

(257)

0-

OTBDMS

?

p“

NH

I AcNH-As”. Phe.Leu.Ala.Gly.Val.Ala.Ser.GluAO (259)

ribonucleotides (265) via 3’,5’-bisamines (263). 196 An alternative solid-phase synthesis of 3’,5’-bismodified analogues of DNA peptidyl appendages at both ~~ glycolic acid, termini (267) has been developed by Schwope et ~ 2 Z . lSerine, hydroxylauric acid, and dimethylhydroxypropionic acid were tested as 3’linker residues (266). The latter, together with a direct amide link at the 5’terminus of 5’-amino-5’-deoxythymidine, gave the highest yields of amino acid-DNA hybrids. The nuclease stability of these hybrids was significantly enhanced compared to unmodified oligomers. Covalent coupling of nuclear localisation signal (NLS) peptides incorporating a photoreactive moiety (268) to plasmid DNA following photoactivation has been reported. lg8 Torrence and co-workers have prepared 2-5A-PNA adducts (269) using solid-phase techniques. When evaluated for their ability to cause the degradation of two different RNA substrates by the 2-5A-dependent RNase L,

Organophosphorus Chemistry

196

0 R'0-S

~

~

P-o * I

~

~

-

OR2 (261) a R ' = R ~ = H b R'

= DMTr. F?

i R%&, qrsOP. Ps$JEt

1

=FCN

ii Depraledbn

0

HO--"OD"-0-P-0

I 0-

H

these new 2-5A-PNA conjugates were found to be potent RNase L activators.Ig9 Sakakura and co-workers have prepared a series of allyl-protected phosphoramidites (270) that have been applied to the synthesis of oligodoeoxynucleotides bearing 3'-terminal phosphate functions including base-labile functionality.2oo Full experimental details for synthesis of a set of novel achiral linker reagents (271a-c) and modified CPG supports (272a-c) have been reported.20' These were designed to enable free amino groups, fluorescein or biotin to be incorporated into oligodeoxyribonucleotides.Apart from having to use t-butyl hydroperoxide in the oxidation step, these linker reagents and solid supports are fully compatible with standard automated DNA synthesis protocols employing phosphoramidite chemistry. Rothschild and co-workers have described the preparation of phosphoramidites (273a,b) that facilitate the preparation of oligodeoxyribonucleotides containing photocleavable 5'-terminal amino functions.202Conjugates of these oligodeoxyribonucleotides with biotin, digoxigenin, tetrarnethylrhodamine or a solid support were prepared. Guzaev and Manoharan have developed a novel method for synthesising oligodeoxyribonucleotides conjugated to a variety of primary amines and m e r ~ a p t a n s This . ~ ~ ~involves use of the Nchloroacetamidohexyl phosphoramidite reagent (274) that is coupled to the 5'terminus of the oligodeoxyribonucleotide in the last step of the solid phase

4: Nucleotides and Nucleic Acids

197 0

0

II

I

O-P-O-5'ODN'-O-P-0

II

H

H2Nw6

O-/CN

(283)

H

0 II

0 II

I

I

O-P-O-5'ODN'-O-P-0

R2)'(N,w6

0

O/\/CN

H

MsNKR'

/- v C N O (264)

0 H

IhV

I1

I

It ~ C O & iPyBOP, . Pr'flEt iii NHAaq)

0 II

O-P-O-5'ODN'-O-P-0

R2yNw6 0

&

0I

H

XNKR1 0

(285) ODN = "d((TACGTACTGATGCAGCTCGT), ODN' = protected ODN

0

R1=ybNo2 , R2=

Me0

o m i @ 0

0

II R1-N-5'd(TGCGCA)-O-P-O-R2 H I

0MeMe

s'sBu'

(266) R' = H, R 2 = &iAco2-, NHZ

NvCa2H

ykp,co2-,

0 yAJ&ncQ-

?$'0

0

X

0-

0

(267) a X = Y = Gly, Trp, Asp, Lys, Phe b X = Trp, Y = Library, Ala/Pro/Asp/Met/PheTryrA7p

synthesis protocol. Subsequent treatment of the support-bound modified oligodeoxyribonucleotides with the appropriate primary amine or mercaptan, followed by ammonia, yielded the respective oligodeoxyribonucleotide conjugates in good yield. A photolabile linker phosphoramidite (275) has been applied to the prepara-

Organophosphorus Chemistry

198

s\

,Cys.Gly.Ala.Gly.Pro.Lys.(X).Lys.Arg.Lys.Val

R

HO-P-

I HO

N H

(269) n = 4 , 8, 12

Cl

OYJ NT H

n

O

199

4: Nucleotides and Nucleic A c i h

(271) a R = Fmoc b R = C(S)NHfluore~cein(Pv)~ c R =biotin

h - R H (272) a R = Fmoc b R = C(S)NHfluorescein(Pv)2 c R=biotin

NPe2

I

Yo’p‘o-cN (273) a R = Fmoc

tion of a new multifunctional dinucleotide analogue (276a) for application in in vitro selection experiments with linker-coupled reactants.204The molecule incorporated a 5’-pCC ligation site for recognition by T4 RNA ligase, three flexible hexaethylene glycol spacers, a photocleavable o-nitrobenzyl unit and a 3’-terminalcarboxy-function. Three model compounds (276b-d) were prepared from (276a). Seelig and Jaschke have described the enzymatic synthesis of RNA conjugates by T7 RNA polymerase using modified initiator nucleotides during transcription.*05 The solid-phase synthesis of a trinucleotide functionalised at both 3’- and 5’termini with sugar residues (277a) has been reported. Deprotection of (277a) yielded (277b).*06 Novel methodology has been reported for the synthesis of oligodeoxyribonucleotides containing 5’- and 3’-phosphorothioate monoester termini (279) following periodate-mediated removal of uridine from the corresponding phosphorothioate diester (278).*07 Application of this methodology to the preparation of 3’-phosphorothioate terminated oligoribonucleotides did not yield the expected product; a putative terminal 2’,3’-cyclic phosphate was proposed. This reaction was eliminated by incorporating a 2’-deoxynucleotide residue at the penultimate 3’-position. Several novel oligodeoxyribonucleotide conjugates (281) were prepared by reaction of terminal phosphorothioate monoesters with 2-pyridyl and 2-nitropyridyl disulfide derivatives (280) (Scheme A 2,3’-cyclic phosphate-terminated oligouridylate (286b) has been prepared under neutral conditions by iodine-mediated cyclisation of a phosphorothiolate attached to a support (285b) Scheme 9).209A novel support (287) has been prepared and utilised in the synthesis of oligodeoxyribo- and oligoribonucleotides bearing a 3’-terminal puromycin moiety.210 8).2077208

200

Organophosphorus Chemistry

b"" 0 II

HO-P-

I

OH

(275)

'OW 0 OH

I

O=P-OH 1

OH

OH

1

0"'

O="

HO

(276) a R = $-OH CI

HO

6H

A phenanthrodihydrodioxin (PDHD)-based phosphoramidite (288) has been incorporated at the 5'-terminus of a 9-mer oligodeoxyribonucleotide.The conjugate hybridised to a complementary 30-nucleotide-long target and efficiently cleaved it in a sequence specific manner following irradiation at 350 nm.211Komiyama and co-workers have incorporated an azobenzene moiety into an oligodeoxyribonucleotide via the phosphoramidite (289). Cis and trans isomers (produced upon photoirradiation) could be resolved by HPLC.*'* McLaughlin and co-workers have prepared perylene- (290) and naphthalene-

4: Nucleotides and Nucleic A c i h

RR ’ 01

20 1

O--”d(N)3-O-P-O O OR’S 0 II

HO OH

H

0 I

0

I O=PI

O=P-0-ODN I

0-ODN

0-

0-

(279)

(278)

RS-S

0 II

AS-s-P-0

&-

I

ax (280)

v 0 I

O=P-0-ODN

I

0Scheme 8

(2811

derived (291) phosphoramidites and incorporated these derivatives into oligodeoxyribonucleotides. Duplexes and triplexes formed with these oligomers were found to be ~ t a b i l i s e d . ~ ~ ~ A phenazine-derived phosphoramidite (292) has been prepared and incorporated at the 5’-terminus of oligodeoxyribonucleotides.’20 Hybridisation of oligodeoxyribonucleotide conjugates containing one or two androstane units inserted into each strand by short phosphoryl linkers via the corresponding phosphoramidite (293) was shown to generate hydrophobic pockets in aqueous Cysteine-derivatised oligodeoxyribonucleotides (294) have been

202

Organophosphorus Chemistry

o=p-o(286) a R 2 = H b R2 = (Up),

0

MeyMe

.N H+

FmocN

NPI'~ I ,P, wCN

0

OMe (287)

0 I

4: Nucleotides and Nucleic Acids

203

prepared and shown to react specifically and efficiently with maleimidederivatised synthetic peptides corresponding to regions within the glycoprotein of HIV that have been shown to have membranotropic activities.215Bannwarth and Iaiza have synthesised o-DNAs (295) containing two different linkers for use in triplex investigations with homopyrimidine ssDNA and RNA The linear 3'-phosphorylated precusors (295a) were assembled using automated solid-phase synthesis. Cyclisation was effected in solution using EDC. A sulfhydryl-terminated antisense oligodeoxyribonucleotide has been efficiently and rapidly conjugated to an HPMA-based polymer. The polymeroligodeoxyribonucleotide conjugate (296) was efficiently taken up by cultured

" " " O w B

I

H

0 OH OH

H

is, \SH

0 0

0 0 (294) f

'TCTCTC"-X

Y-'TCCTTCT3'

L 3'AGAGAG-

AGG AAG A"

3

Organophosphorus Chemistry

204

R

OH

OH

OH

(296) R = Fluoresceinyl

(297)

0-

cells.*17 Umeno et al. have reported the synthesis of a ssDNA-poly(Nisopropylacrylamide) conjugate (297) for use in 'thermally-induced affinity precipitation separation' of oligodeoxyribonucleotides.2'8 Hybridisation of the conjugate with its complementary oligodeoxyribonucleotide target is performed at a temperature below the phase transition point where the conjugate is soluble in water. The conjugate is subsequently precipitated from the aqueous solution with its complementary oligodeoxyribonucleotide target on raising the temperature above the phase transition point. The conjugate is able to distinguish its target sequence from mismatch DNAs. Workers in the same group have also covalently bound poly(N-isopropylacrylamide) bearing a terminal psoralen group to plasmid pBR 322 DNA via a photochemical r e a ~ t i o nl 9. ~Temperature-responsive precipitation due to the aggregation of poly(N-isopropylacrylamide)chains when heated above 3 1 "Cwas used for the one-pot separation of restriction endonuclease EcoRI. A novel approach to the radioactive labelling of peptides and PNA oligomers based on the conjugation of a deoxynucleoside 3'-phosphate with the terminal amine of the substrate, followed by phosphorylation of the 5'hydroxyl group of the nucleotide using T4 polynucleotide kinase and [y-32P]ATPhas been described.220

6

Nucleic Acid Structures

Several crystal structures of complexes between E. coli aminoacylated tRNAs and aminoacyl tRNA-binding proteins including threonyl-tRNA synthetase,221methionyl-tRNA(f)( Met) transformylase,222and a ternary complex of Cys-tRNA(Cys) and EF-Tu-GDPNP have been reported.223Two groups have published crystal structures of the highly conserved complex between a 58-

4: Nucleotides and Nucleic Acids

205

nucleotide domain of large subunit rRNA and the RNA-binding domain of Other crystal structures of RNA binding proteins ribosomal protein Ll 1 in complex with their target sequences that have been described include the second dsRNA-binding domain of RNA-binding protein A complexed with dsRNA,226the ternary complex between the spliceosomal U2BW2A’ protein complex and hairpin-loop IV of U2 small nuclear RNA227 and also the complex formed between two RNA-binding domains of a Sex-lethal protein and a 12-nucleotide,single-stranded RNA.228 The structures of several RNA aptamers bound to their targets have been published. These include the solution structure of the aminoglycoside antibiotic tobramycin complexed with a stem-loop RNA a ~ t a m e r ,the * ~co-crystal ~ structures of two aptamer sequences bound to MS2 coat protein230and the cocrystal structure of reverse transcriptase in complex with a 33-nucleotide long RNA p s e ~ d o k n o t . ~ ~ ’ Doudna and co-workers have identified the first specific monovalent metal ion binding site within a catalytic RNA using x-ray crystallography; a potassium ion was shown to be coordinated immediately below AA platforms of the Tetrahymena ribozyme P4-P6 domain.232 The crystal structures of the 247-nucleotide ribozyme derived from the Tetrahymena thermophila group I intron catalytic core,233a lead-dependent r i b ~ z y m e and , ~ ~the ~ 72-nucleotide hepatitis delta virus (HDV) r i b ~ z y m e ~ ~ ~ have all been detailed. A’-form RNA has been chara5terized from the single crystal structure of a tridecaribon~cleotide.~~~ A 1.6 A crystal structure of a viral RNA pseudoknot has been described.237The crystal structure of a selfcomplementary RNA duplex with non-adjacent G.U and U.G wobble pairs has been determined to 2.5 resolution.238The crystal structure at 3.0 resolution of an 82-nucleotide RNA-DNA complex formed by the 10-23 DNA enzyme in which two strands of DNA and two strands of RNA gave rise to five double-helical domains has been described.239 The structural and dynamic features of an RNA bulge motif defined by two adjacent adenine nucleotides opposite a uridine nucleotide within a 21 nucleotide hairpin have been investigated using heteronuclear NMR spectroscopy.240 The metal ion requirement of hammerhead model ribozymes has been investigated using electron paramagnetic resonance spectroscopy in the presence of Mn2’ ions.241 Structures of several modified oligodeoxyribonucleotides have been determined. The crystal structure of a fully modified 2’-0-(2-methoxyethyl)-RNA dodecamer duplex (CGCGAAUUCGCG) was determined at 1.7 A resoluEgli and co-workers have described the crystal structures of three Aform DNA duplexes containing 2’- 0-modified ribot hymidine building The solution structure of a DNA decamer duplex containing a pyrimidine(6-4)pyrimidone photoproduct [(6-4) adduct] has been determined using NMR.244Detection of thymine [2+2] photodimer repair in DNA using the selective reaction of KMn04 with thymines has been reported.245The crystal structure of a stalled, covalently-tethered complex of HIV- 1 reverse transcriptase in complex with both the double-stranded DNA template-primer .2249225

.

A

A

206

Organophosphorus Chemistry

A

and the deoxynucleoside triphosphate substrate has been solved at 3.2 resolution.246The crystal structures of a double-stranded DNA containing cisplatin i n t e r ~ t r a n dor~ ~i n~ t r a ~ t r a n dcross-links ~~~ have been described. The crystal structures of several complexes of EcoRV endonuclease and its cognate binding site incorporating base analogues have been solved.249Four crystal structures of single-stranded DNAs containing either oxygen or sulfur at a 3’bridging position bound in conjunction with various metal ions at the 3’-5’ exonucleolytic active site of the Klenow fragment (KF) of DNA polymerase I from Escherichia coli have been solved at up to 2.03 A resolution.250Workers in the same group have also provided the first functional evidence that metallophosphotransferases can mediate catalysis via metal ion coordination to both the leaving group and a nonbridging oxygen of the scissile phosphate utilising a phosphodithioate substrate in which both the 3’-oxygen and the proSp oxygen are simultaneously substituted with The co-crystal structures of restriction endonucleases complexed with DNA in the presence of Ca2+ ions (EcoRV)~’~ or Mn2+ and Ca2+ ions (BamH1)253have been solved. The crystal structure of the complex between a biologically active Ni(I1)bound diphtheria toxin gene repressor(C 102D) mutant and a 33-base-pair DNA segment containing the toxin operator has been Kielkopf et al. have determined the crystal structure of a specific polyamide dimer-DNA complex.255 Several proteins involved in transcription and its regulation have been crystallised in complex with their target DNA. A transcription bubble formed from the four base pairs closest to the catalytic active site of T7 RNA polymerase has been observed in the structure of the enzyme in complex with a 17-base-pair promoter.256 King et al. have described the structure of HAP1 bound to its cognate upstream activation sequence from the CYC7 gene and also of the same sequence bound to a mutant.257-258 The first crystal structure for a member of the AraC prokaryotic transcriptional activator family, MarA, in complex with its cognate DNA-binding site has been described.259 The structure of the 45-amino acid transcriptional repressor CopG bound to its target operator DNA in which compression of both major and minor grooves gives rise to a DNA bend of 60” has been solved.260 The crystal structures of DNA complexes with several homeodomain transcription factors have been described.26* -263 The 2.7 A-resolution crystal structure of a quaternary complex of the DNAbinding domains of NFAT, Fos and Jun with a DNA fragment containing the distal antigen-receptor response element from the interleukin-2 gene promoter, has been determined.264The low-temperature co-crystal structure of a P22 Arc repressor mutant, FVlO, and a 22 base-pair operator sequence has been solved.265STAT proteins are a family of eukaryotic transcription factors that mediate the response to a large number of cytokines and growth factors. The first crystal structure of a STAT protein bound to its DNA recognition site at 2.25 resolution has been reported.266 The 2.1 crystal structure of Zct (a DNA-binding domain of RNA adenosine deaminase) complexed to DNA has been solved.267Sac7d belongs

A

A

4: Nucleotides and Nucleic Acids

207

to a class of small chromosomal proteins from hyperthermophilic archaea which bind to DNA without any particular sequence preference and thereby increase its melting temperature by up to 40 “C and is extremely stable to heat, acid and chemical agents. The crystal structure of Sac7d in complex with two DNA sequences has been solved.268 A novel DNA-binding motif of a Smad3 MHl domain bound to an optimal DNA sequence has been identified from the crystal structure determined at 2.8 A resolution.269 Three structures have been determined for complexes between HhaI methyltransferase (M.Hha1) and oligodeoxyribonucleotides containing a G-A, G-U or G-AP (AP = abasic or apuriniclapyrimidinic) mismatch at the target base pair. The mismatched adenine, uracil and abasic site were all flipped out of the DNA helix and located in the enzyme’s active-site pocket.270It was therefore proposed that rotation of the DNA backbone is the key to base flipping. A new zinc-bound fold and endonuclease active site have been identified in the 1.8 resolution crystal structure of the I-PpoI homing endonuclease bound to homing-site DNA.271The structures of both uncleaved substrate and cleaved product complexes were determined. Van Duyne and co-workers have published the X-ray crystal structures of three DNA Holliday junctions bound by Cre R e ~ o m b i n a s e .The ~~~ crystal ?~~~ structure of human 3-methyladenine DNA glycosylase complexed to a mechanism-based pyrrolidine inhibitor has been determined.274 Multilamellar domains with a regular spacing of 70 and 68 have been characterised in supramolecular assemblies formed by guanidinium-cholesterol reagents and DNA designed for gene transfection using cryotransmission electron microscopy studies and small-angle X-ray scattering experiments.275 Two different structures of PcrA DNA helicase complexed with the same single strand tailed DNA duplex have provided snapshots of different steps on the catalytic pathway of this enzyme.276Large and distinct conformational changes were observed upon binding DNA and a nonhydrolysable analogue of the nucleotide (ATP) cofactor (mimicking a ‘substrate’ complex) or DNA and sulfate ion (mimicking a ‘product’ complex) from which an ‘inchworm’ mechanism was proposed. The crystal structure of the two-subunit Oxytricha nova telomere end binding protein cFmplexed with single strand telomeric DNA has been determined at 2.8 A resolution.277The structure reveals four oligodeoxyribonucleotide/oligosaccharide-bindingfolds, three of which form a deep cleft that binds the ssDNA, and a fourth that forms an unusual protein-protein interaction between the alpha and beta subunits. This structure provides a molecular description of how the two subunits of OnTEBP recognize and bind ssDNA to form a sequence-specific, telomeric nucleoprotein complex that caps the very 3’ ends of chromosomes. A conformational variant of B-DNA has been characterised from crystal structures of bovine papillomavirus E2 dodecanucleotide targets.278Several groups have published NMR scalar couplings across Watson-Crick base pair hydrogen bonds in DNA.279 Opine dehydrogenases catalyse the NAD(P)H-dependent reversible reaction

A

A

A

208

Organophosphorus Chemistry

to form opines that contain two asymmetric centers exhibiting either (L,L) or (D,L) stereochemistry. The first structure of a (D,L) superfamily member, N-( 1D-carboxylethyl)-L-norvahe dehydrogenase (CENDH) from Arthrobacter sp., strain lC, has been determined at 1.8 resolution and theolocation of the bound nucleotide coenzyme has been identified.280The 2.9 A structure of a ternary complex of the human type I1 isoform of inosine monophosphate dehydrogenase with the substrate analogue 6-chloropurine riboside 5’-mOnOphosphate and the NAD analogue selenazole-4-carboxamideadenine dinucleotide has been solved.281 Four crystal structures of the catalytic domains of adenylyl cyclase (AC) in complex with two different ATP analogues (p-~-2’,3’dideoxyadenosine 5’-triphosphate or adenosine 5’-(a-thio)-triphosphate) and various divalent metal ions have been determined.282 There have been several reports of the application of techniques- that facilitate single molecule observation to understanding oligodeoxyribonucleotides. Wang et al. have described the use of an optically controlled gauge to measure transcriptional velocities and forces for single molecules of Escherichia coli RNA polymerase.283DNA shortening and bending upon binding of yeast centromeric DNA binding factor 3 to its target sequence was demonstrated by atomic force microscopy.284 The progressive denaturation of a single DNA molecule as it was unwound was shown to generate distinct, stable denaturation bubbles, beginning in A-T-rich regions.285 The same group has also proposed a structure derived from positive supercoiling in which the phosphate backbones are tightly interwound and bases are exposed in common with Pauling’s early RecA has been shown to bind strongly to stretched DNA grafted between an optical fibre, acting as a force transducer, and a latex bead manipulated with a micropipette mounted on piezoelectric transducers.287 Quake and co-workers have described the fabrication and use of a singlemolecule DNA sizing device for sizing and sorting DNA restriction digests and ladders spanning 2-200 kbp.288Restriction enzyme cleavage of DNA and the unfolding of a DNA hairpin have both been studied using single-molecule fluorescence spectroscopy.289~290 Knots have been introduced into a single DNA molecule using optical tweezers.291

A

References 1

2 3 4 5

6

C. McGuigan, D. Cahard, C. Ballatore, A. Siddiqui, E. de Clercq, and J. Balzdrini, Bioorg. Med. Chem. Lett., 1998, 8, 2949. S. R. Khan, and D. Farquhar, Tetrahedron Lett., 1999,40, 607. A. Kreimeyer, and P. Marliere, Nucleosides Nucleotides, 1998, 17,2339. N. Schlienger,T. Beltran, V. Perigaud, I. Lefebvre, A. Pompon, A.-M. Aubertin, G . Gosselin, and J.-L. Imbach, Bioorg. Med. Chem. Lett., 1998,8, 3003. F. De Valette, J.-L. Barascut, and J.-L. Imbach, NucIeosides Nucleotides, 1998, 17, 2289. C. Perigaud, G . Gosselin, J . L. Girdrdet, B. E. Korba, and J. L. Imbach, Antiviral Res., 1999,40, 167.

4: Nucleotides and Nucleic Acids 7 8 9

209

J. Jankowska, A. Sobkowska, J. Cieslak, M. Sobkowski, A. Kraszewski, J. Stawinski, and D. Shugar, J. Org. Chem., 1998,63, 8150. J. C. Zhang, and M. D. Matteucci, Tetrahedron Lett., 1999,40, 1467. T. Yokomatsu, T. Sada, T. Shimizu, and S. Shibuya, Tetrahedron Letts., 1998, 39, 6299.

10 11

J. Boivin, L. Ramos, and S. 2.Zard, Tetrahedron Lett., 1998,39,6877. E. L. Christian, D. S. McPheeters, and M. E. Harris, Biochemistry, 1998, 37,

12 13 14

W.Wang and L. Hedstrom, Biochemistry, 1998,37, 11949.

17618.

M. L. Deras, S. V. Chittur, and V. J. Davisson, Biochemistry, 1999,38,303. J..Zhang, N. Neamati, Y. Pommier, and V. Nair, Bioorg. Med. Chem. Lett., 1998,8, 1887.

15 16 17 18 19 20 21 22 23 24 25 26 27 28

D. Filippov, C. M. Timmers, A. R. Roerdink, G. A. van der Marel, and J. H. van Boom, Tetrahedron Lett., 1998,39,489 1. R. Martin, K.L. Witte, and C. H. Wong, Bioorg. Med. Chem., 1998,6, 1283. Y. Kajihara, T. Ebata, and H. Kodama, Angew. Chem., Int. Ed Eng., 1998, 37, 3 166. Q. Dang, Y. Liu, and M. D. Erion, Nucleosides Nucleotides, 1998, 17, 1445. A. Holy, J. Giinter, H. Dvorakova, M. Masojidkova, G. Andrei, R. Snoeck, J. Balzdrini, and E. D. Clercq, J. Med. Chem., 1999,42,2064. K. Z . He, D. S. Sergueev, 2.A. Sergueeva, and B. R. Shaw, Tetrahedron Lett., 1999,40,460 1. Z. A. Sergueeva, D. S. Sergueev, and B. R. Shaw, Tetrahedron Lett., 1999, 40, 204 1. Y. Jin and G . Just, Tetrahedron Lett., 1998, 39, 6429, Y.Jin and G. Just, Tetrahedron Lett., 1998,39,6433. J. C. Wang, G. Just, A. P. Guzaev, and M. Manoharan, J. Org. Chem., 1999,64, 2595. A. Kers and J. Stawinski, Tetrahedron Lett., 1999,40,4263.

J. B. J. Pavey, A. J. Lawrence, A. J. Potter, R. Cosstick, and I. A. Oneil, Tetrahedron Lett., 1998,39, 6967. X. X. Qiao and Y . Kishi, Angew. Chem., Int. Ed Eng., 1999,38,928. M. J. Robins, E. Lewandowska, and S. F. Wnuk, J. Org. Chem., 1998, 63, 7375.

29 30 31 32

33

J. B. J. Pavey, R. Cosstick, and I. A. Oneill, Tetrahedron Lett., 1998,39, 8923. M. G. B. Drew, S. Gorsuch, J. H. M. Gould, and J. Mann, Chem. SOC., Perkin Trans. 1 , 1999,969. D. Katalenic and M. Zinic, Nucleosides Nucleotides, 1998,17, 1231. P. Nguyen-Ba, N. Lee, H. Mitchell, L. Chan, and M. Quimpire, Bioorg. Med. Chem. Lett., 1998, 8, 3555. C. Meier, T. Knispel, E. De Clercq, and J. Balzarini, J. Med Chem., 1999, 42,

35

1604. C. Meier, T. Kinspel, V. E. Marquez, M. A. Siddiqui, E. D. Clercq, and J. Balzarini, J. Med. Chem., 1999, 42, 1615. M. Morr, A. Wabmann, and V. Wray, Tetrahedron, 1999,55, 2985.

36

S . Shuto, M. Shirato, Y. Sumita, Y. Ueno, and A. Matsuda, Tetrahedron Lett.,

37 38

1998,39, 734 1. F. J. Zhang, Q. M. Gu, and C. J. Sih, Bioorg. Med Chem., 1999,7,653. R. K. Suto, M. A. Whalen, B. R. Bender, and R. G. Finke, Nucleosides Nucleotides, 1998, 17, 1453.

34

210 39 40 41 42 43 44 45

46 47 48 49 50

51 52

53 54 55 56 57

58 59 60 61 62 63 64 65

Organophosphorus Chemistry B. K. Krzyzanowska, K. Z. He, A. Hasan, and B. R. Shaw, Tetrahedron, 1998, 54,5119. K. Z. He, K. W. Porter, A. Hasan, J. D. Briley, and B. R. Shaw, Nucleic Acids Res., 1999,27, 1788. M. Gruen, C. Becker, A. Beste, C. Siethoff, A. J. Scheidig, and R. S. Goody, Nucleosides Nucleotides, 1999, 18, 137. J. M. Stattel, I. Yanachkov, and G. E. Wright, Nucleosides Nucleotides, 1998, 17, 1505. A. V. Shipitsin, L. S. Victorova, E. A. Shirkova, N. B. Dyatkina, L. E. Goryunova, R. S. Beabealashvilli, C. J. Hamilton, S. M. Roberts, and A. Krayevsky, J. Chem. Soc., Perkin Transl, 1999, 1039. C. J. Hamilton and S. M. Roberts, J. Chem. SOC.,Perkin Trans. I , 1999, 1051. T. Brossette, A. Valleix, L. Goujon, C. Creminon, J. Grassi, C. Mioskowski, and L. Lebeau, Tetrahedron Lett., 1999,40,3391. F. Marciacq, S. Sauvaigo, J. P. Issartel, J. F. Mouret, and D. Molko, Tetrahedron Lett., 1999,40,4673. C. I. Martinez, L. H. Thoresen, R. A. Gibbs, and K. Burgess, Nucleic Acids Rex, 1999,27,1271. M. B. Welch and K. Burgess, Nucleosides Nucleotides, 1999, 18, 197. L. Ortoleva-Donnelly, M. Kronman, and S. A. Strobel, Biochemistry, 1998, 37, 12933. T. Matsuda, I. Terashima, Y. Matsumoto, H. Yabushita, S. Matsui, and S. Shibutani, Biochemistry, 1999,38,929. M. M. Hanna, E. Yuriev, J. Zhang, and D. L. Riggs, Nucleic Acids Res., 1999, 27, 1369. K. Sakthivel and C. F. Barbas, Angew. Chem., Int. Ed. Eng., 1998,37,2872. T. S . Godovikova, D. M. Kolpashchikov, T. N. Orlova, V. A. Richter, T. M. Ivanova, S. L. Grochovsky, T. V. Nasedkina, L. S. Victorova, and A. I. Poletaev, Bioconjugate Chem., 1999, 10, 529. N. Ostermann, M. R. Ahmadian, A. Wittinghofer, and R. S. Goody, Nucleoside Nucleotides, 1999, 18,245. H. Kamiya and H. Kasai, Nucleosides Nucleotides, 1999, 18, 307. H. J. Einolf, N. Schnetz-Boutaud, and F. P. Guengerich, Biochemistry, 1998, 37, 13300. T. Suzuki, M. Yoshida, M. Yamada, H. Ide, M. Kobayashi, K. Kanaori, K. Tajima, and K. Makino, Biochemistry, 1998,37, 1 1592. D. M. Williams, D. Loakes, and D. M. Brown, J. Chern. Soc., Perkin Trans. I, 1998,3565. L. M. Leoni, Q. Chao, H. B. Cottam, D. Genini, M. Rosenbach, C. J. Carrera, I. Budihardjo, X. D. Wang, and D. A. Carson, Proc. Natf. Acad. Sci. USA, 1998, 95, 9567. T. J. Matray and E. T. Kool, Nature, 1999,399,704. P. J. Unrau and D. P. Bartel, Nature, 1998,395,260. S. Vincent, S. Grenier, A. Valleix, C. Salesse, L. Lebeau, and C. Mioskowski, J. Org. Chem., 1998,63, 7244. R. T. Bibart, K. W. Vogel, and D. G. Drueckhammer,J. Org. Chem., 1999,64,2903. B. Q . Zeng, K. K. Wong, D. L. Pompliano, S. Reddy, and M. E. Tanner, J. Org. Chem., 1998,63, 10081 . X. H. Liu, C. Brenner, A. Guranowski, E. Starzynska, and G. M. Blackburn, Angew. Chem., Int. Ed Eng., 1999,38, 1244.

4: Nucleotides and Nucleic Acids

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92

93 94 95

21 I

R. V. Devivar, S. L. Koontz, W. J. Peltier, J. E. Pearson, T. A. Guillory, and J. D. Fabricant, Bioorg. Med. Chem. Lett., 1999, 1239. A. V. Azhayev, Tetrahedron, 1999, 55, 787. R. T. Pon, S. Y. Yu, Z. Q. Guo, and Y. S. Sanghvi, Nucleic Acids Res., 1999, 27, 1531. R. Worl and H. Koster, Tetrahedron, 1999,55, 2941. R. Worl and H. Koster, Tetrahedron, 1999,55,2957. Y. Hayakawa and M. Kataoka, J. Am. Chem. SOC.,1998,120, 12395. M. Beier and W. Meiderer, Helv. Chim. Acta, 1999,82,879. M. Beier and W. Meiderer, Helv. Chim. Acta, 1999,82,633. P. Gaytan, J. Yanez, F. Sanchez, H. Mackie, and X. Soberon, Chem. Biol., 1998, 5, 519. X. Gao, P. Yu, E. LeProust, L. Sonigo, J. P. Pellois, and H. Zhang, J. Am. Chem. Soc., 1998, 120, 12698. A. H. Krotz, D. L. Cole, and V. T. Ravikumar, Bioorg. Med. Chem., 1999, 7, 435. S. A. Scaringe, F. E. Wincott, and M. H. Caruthers, J. Am. Chem. Soc., 1998, 120, 11820. Q. L. Song and R. A. Jones, Tetrahedron Lett., 1999,40,4653. C. B. Reese and Q. L. Song, Nucleic Acids Res., 1999, 27, 2672. A. Luther, R. Brandsch, and G. von Kiedrowski, Nature, 1998,396, 245. A. Garbesi, M. L. Capobianco, F. P. Colonna, M. Maffini, D. Niccolai, and L. Tondelli, Nucleosides Nucleotides, 1998, 17, 1275. F. Debart, A. Meyer, J. J. Vasseur, and B. Rayner, Nucleic Acids Res., 1998, 26, 455 1 . G. Tosquellas, J. C. Bologna, F. Morvan, B. Rayner, and J.-L. Imbach, Bioorg. Med. Chem. Lett., 1998, 8, 2913. B. J. Turney, Z. S. Cheruvallath, M. Andrade, D. L. Cole, and V . T. Ravikumar, Nucleosides Nucleotides, 1999, 18, 89. A. Eleuteri, D. C. Capaldi, D. L. Cole, and V. T. Ravikumar, Nucfeosides Nucleotides, 1999, 18,475. C. B. Reese and Q. Song, J. Chem. Soc., Perkin Trans. I , 1999, 1477. A. H. Krotz, Z. S. Cheruvallath, D. L. Cole, and V. T. Ravikumar, Nucleosides Nucleotides, 1998, 17, 2335. Z. S. Cheruvallath, P. D. Wheeler, D. L. Cole, and V. T. Ravikumar, Nucleosides Nucleotides, 1999, 18,485. Z. D. Zhang, A. Nichols, J. X. Tang, Y. X. Han, and J. Y. Tang, Tetrahedron Lett., 1999,40,2095. L. A. Wozniak, M. Wieczorek, J. Pyzowski, W. Majzner, and W. J. Stec, J. Org. Chem., 1998,63,5395. J. Baraniak, D. Korczynski, R. Kaczmarek, and W. J. Stec, Nucleosides Nucleotides, 1999, 18,2147. W . J. Stec, B. Kanvowski, M. Boczkowska, P. Guga, M. Koziolkiewicz, M. Sochacki, M. W. Wieczorek, and J. Blaszczyk, J. Am. Chem. Soc., 1998, 120, 71 56. X. B. Yang, A. Sierzchala, K. Misiura, W. Niewiarowski, M. Sochacki, W. J. Stec, and M. W. Wieczorek, J. Org. Chem., 1998,63, 7097. P. H. Seeberger, M. H. Caruthers, D. Bankaitis-Davis, and G. Beaton, Tetruhe&on, 1999,55, 5759. K. L. Fearon, B. L. Hirschbein, J. S. Nelson, M. F. Foy, M. Q. Nguyen,

212

96 97 98 99 100

101 102 103 I04 105

106 107 108

109 110 111 112 113 114 115 116

117

118

119 120 121 122 123 124

Organophosphorus Chemistry

A. Okruszek, S. N. McCurdy, J. E. Frediani, L. A. DeDionisio, A. M. Raible, E. N. Cagle, and V. Boyd, Nucleic Acids Rex, 1998,26, 38 13. J . Baraniak, D . Korczynski, R. Kaczmarek, and E. Wasilewska, Nucleosides Nucleotides, 1998, 17, 1347. S. M. Gryaznov, and H. Winter, Nucleic Acids Res., 1998, 26,4160. T. Wada, F. Honda, Y. Sato, and M. Sekine, Tetrahedron Lett., 1999,40,915. D. S. Sergueev and B. R. Shaw, J. Am. Chem. SOC.,1998,120,9417. G.-X. He, J. P. Williams, M. J. M. J, Postich, S. Swaminathan, R. G. Shea, T. Terhorst, V. S. Law, C. T. Mao, C. Sueoka, S. Coutre, and N. Bischofberger, J. Med. Chem., 1998,41,4224. J . Zhang, J. T. Shaw, and M. D. Matteucci, Bioorg. Med. Chem. Lett., 1999,9,319. B. A. Linkletter, I. E. Szabo, and T. C. Bruice, J. Am. Chem. Soc., 1999, 121, 3888. D. P. Arya and T. C. Bruice, J. Am. Chem. SOC.,1998,120,6619. D. P. Arya and T. C. Bruice, J. Am. Chem. SOC.,1998,120, 12419. H. F. Hansen, L. Christensen, 0. Dahl, and P. E. Nielsen, Nucleosides Nucleotides, 1999, 18, 5 . W. Maison, 1. Schlemminger, 0. Westerhoff, and J. Martens, Bioorg. Med. Chem. Lett., 1999,9, 58 1. M. J. Lutz, D. W. Will, G. Breipohl, S. A. Benner, and E. Uhlmann, Nucleosides Nucleotides, 1999, 18, 393. B. Falkiewicz, K. Kowalska, A. S. Kolodziejczyk, K. Wisniewski, and L. Lankiewicz, Nucleosides Nucleotides, 1999, 18, 353. M. Kuwahara, M. Arimitsu, and M. Sisido, J. Am. Chem. SOC.,1999, 121,256. B. P. Gangamani, V. A. Kumar, and K. N. Ganesh, Tetrahedron, 1999,55, 177. R. Benhida, M. Devys, J. L. Fourrey, F. Lecubin, and J . S. Sun, Tetrahedron Lett., 1998,39, 6167. P. von Matt, A. De Mesmaeker, U. Pieles, W. Zurcher, and K. H. Altmann, Tetrahedron Lett., 1999,40, 2899. R. Kumar, S. K. Singh, A. A. Koshkin, V. K. Rajwanshi, M. Meldgaard, and J. Wengel, Bioorg. Med. Chem. Lett., 1998, 8, 2219. S. K. Singh, R. Kumar, and J. Wengel, J. Org. Chem., 1998,63, 10035. L. K v a r n s and J . Wengel, Chem. Commun., 1999,657. S. Obika, D. Nanbu, Y. Hari, J. Andoh, K. Morio, T. Doi, and T. Imanishi, Tetrahedron Lett., 1998,39, 5401. S. Obika, K.-I. Morio, Y . Hari, and T. Imanishi, Bioorg. Med. Chem. Left., 1999, 9, 515. G. Wang, E. Gunic, J.-L. Girdrdet, and V. Stoisavljevic, Bioorg. Med. Chem. Lett., 1999, 9, 1147. R. Zou and M. D. Matteucci, Bioorg. Med. Chem. Lett., 1998,8, 3049. E. Zamaratski and J. Chattopadhyaya, Tetrahedron, 1998,54, 8 183. K. Yamana, R. Iwase, S. Furutani, H. Tsuchida, H. Zako, T. Yamaoka, and A. Murakami, Nucleic Acids Res., 1999, 27, 2387. A. M. Kawasaki, M. D. Casper, T. P. Prakash, S. Manalili, H. Sasmor, M. Manoharan, and P. D. Cook, Nucleosides Nucleotides, 1999, 18, 1419. A. M. Kawasaki, M. D. Casper, T. P. Prakash, S. Manalili, H. Sasmor, M. Manoharan, and P. D. Cook, Tetrahedron Lett., 1999,40,661. N. A. Whittemore, A. N. Mullenix, G . B. Inamati, M. Manoharan, P. D. Cook, A . A . Tuinman, D. C. Baker, and J. Q. Chambers, Bioconjugate Chem., 1999, 10, 261.

4: Nucleotides and Nucleic Acids

213

125 M. Grstli, B. Beijer, and B. Sproat, Tetrahedron, 1999,55,4299. 126 B. Greiner and W. Pfleiderer, Helv. Chim. Acta, 1998,81, 1528. 127 N. Nishizono, Y. Sumita, Y. Ueno, and A. Matsuda, Nucleic Acids Res., 1998, 26, 5067. 128 M. J. Guo, D. Yu, R. P. Iyer, and S. Agrawal, Bioorg. Med. Chern. Lett., 1998,8, 2539. 129 H. Cramer and W. Pf-leiderer, Helv. Chim. Acta, 1999,82,614. 130 X. Q. Tang, X. M. Liao, and J. A. Piccirilli, J. Org. Chem., 1999,64, 747. 131 M. Dunkel, and V. Reither, Bioorg. Med. Chem. Lett., 1999,9, 787. 132 J. Matulic-Adamic, A. T. Daniher, C. Gonzalez, and L. Beigelman, Bioorg. Med. Chem. Lett., 1999,9, 157. 133 H. Strittmatter, A. Dussy, U. Schwitter, and B. Giese, Angerv. Chern., int. Ed. Eng., 1999,38, 135. 134 B. Giese, S. Wessely, M. Spormann, U. Lindemann, E. Meggers, and M. E. Michel-Beyerle, Angew. Chem., in?. Ed. Eng., 1999, 38, 996. 135 M. Kotera, A.-G. Bourdat, E. Defrancq, and J. Lhomme, J. Am. Chem. SOC., 1998,120, 11810. 136 X. L. Wu and S. Pitsch, Nucleic Acids Res., 1998,26,4315. 137 J. Milecki, E. Zamaratski, T. V. Maltseva, A. Foldesi, R. W. Adamiak, and J. Chattopadhyaya, Tetrahedron, 1999,55, 6603. 138 A. Foldesi, T. V. Maltseva, Z. Dinya, and J. Chattopadhyaya, Tetrahedron, 1998, 54, 14487. 139 N. Guzzo-Pernell, G. W. Tregear, J. Haralambidis, and J. M. Lawlor, Nucleosides Nucleotides, 1998, 17, 1 191. 140 A. F. Khattab and E. B. Pedersen, Nucleosides Nucleotides, 1998, 17,2351. 141 0. M. Ali, T. Franch, K. Gerdes, and E. B. Pedersen, Nucleic Acids Res., 1998, 26, 4919. 142 D. Gottschling, H. Seliger, G . Tarrason, J. Piulats, and R. Eritja, Bioconjugate Chem., 1998,9,831. 143 K. Nakatani, K. Fujisawa, C . Dohno, T. Nakamura, and I . Saito, Tetrahedron Lett., 1998,39, 5995. 144 A. N. Topin, 0. M . Gritsenko, M . G. Brevnov, E. S. Gromova, and G. A. Korschunova, Nucleosides Nucleotides, 1998, 17, 1 163. 145 H. F. Becker, H. Grosjean, and J.-L. Fourrey, Nuc1eosicle.s Nucleotides, 1998, 17, 2403. 146 R. S. Coleman and R. M. Pires, Bioorg. Med. Chem. Lett., 1999, 9,931. 147 J. Hunziker, Bioorg. Med. Chem. Lett., 1999, 9, 201. 148 A. Kittaka, T. Kuze, T. Asakura, K. Ito, T. Miyasaka, and J.-I. Inoue, Bioorg. Med. Chem. Lett., 1998,8, 3207. 149 J. D. Kahl and M. M. Greenberg, J. Am. Chem. Soc., 1999, 121, 597. 150 S. I . Khan and M . W. Grinstaff, J. Am. Chem. SOC.,1999, 121,4704. 151 S. I . Khan, A. E. Beilstein, G. D. Smith, M. Sykora, and M . W. Grinstaff, Inorg. Chem., 1999,38,24 1 1. 152 J. Bijapur, M. D. Keppler, S. Bergqvist, T. Brown, and K. R. Fox, Nucleic Acids Res., 1999,27, 1802. 153 M. Ahmadian, P. M. Zhang, and D. E. Bergstrom, Nucleic Acids Rex, 1998, 26, 3 127. 154 M. A. Zanta, P. Belguise-Valladier, and J. P. Behr, Proc. Natl. Acad. Sci. USA, 1999, 96, 9 1. 155 U. Asseline, V. Roig, and N . T. Thuong, Tetruhedron Lett., 1998, 39, 8991.

214

Organophosphorus Chemistry

156

A. G. Bourdat, D. Gasparutto, and J. Cadet, Nucleic Acids Res., 1999, 27, 1015. J. Butenandt, L. T. Burgdorf, and T. Carell, Angew. Chem., Int. Ed. Eng., 1999, 38, 708. T. Mizukoshi, K. Hitomi, T, Todo, and S. Iwai, J. Am. Chem. SOC.,1998, 120, 10634. J. Q. Liu and J . S. Taylor, Nucleic Acids Res., 1998,26, 3300. J. Y. Wang, K. Y. Lin, and M. D. Matteucci, Tetrahedron Lett., 1998,39, 8385. F. Godde, J. J. Toulme, and S. Moreau, Biochemistry, 1998, 37, 13765. M. G . Tutonda, R. W. Buckheit Jr., V. K. Agrawal, and A. D. Broom, J. Med. Chem., 1998,41,4958. S. Khullar, C. V. Varaprasad, and F. Johnson, J. Med Chem., 1999,42,947. A. Romieu, D. Gasparutto, and J. Cadet, J. Chem. SOC.,Perkin Trans. I , 1999, 1257. A. Romieu, D. Gasparutto, D. Molko, and J. Cadet, J. Org. Chem., 1998, 63, 5245. A. Romieu, D. Gasparutto, and J. Cadet, Chem. Res. Toxicol., 1999,12,412. F. Seela and G . Becher, Chem. Commun., 1998,2017. F. Seela and C. Mittelbach, Nucleosides Nucleotides, 1999, 18,425. F. Seela and M. Zulauf, J. Chem. SOC.,Perkin Trans. I , 1999,479. F. Seela and P. Leonard, Helv.Chim. Acta, 1998, 81, 2244. F. Seela and C. Wei, Helv. Chim. Actu, 1999, 82, 726. G . Balow, V. Mohan, E. A. Lesnik, J. F. Johnston, B. P. Monia, and 0. L. Acevedo, Nucleic Acids Res., 1998, 26, 3350. M. Pignot, C . Siethoff, M. Linscheid, and E. Weinhold, Angew. Chem., Int. Ed. Eng., 1998,37, 2888. I . Ponten, J. M. Sayer, A. S. Pilcher, H. Yagi, S. Kumar, D. M. Jerina, and A. Dipple, Biochemistry, 1999,38, 1 144. H. Y. Kim, L. Nechev, L. A. Zhou, P. Tamura, C. M. Harris, and T. M. Harris, Tetrahedron Lett., 1998,39, 6803. A. Saito, and R. Kuroda, Tetrahedron Lett., 1999,40,4837. I . Terashima, N . Suzuki, L. Dasaradhi, C. K. Tan, K. M. Downey, and S. Shibutani, Biochemistry, 1998,37, 13807. Y.-Z.Xu, Bioorg. Med. Chem. Lett., 1998,8, 1839. R. A. Rieger, C. R. Iden, E. Gonikberg, and F. Johnston, Nucleosides Nucleotides, 1999, 18, 73. J . P. Rife, C. S. Cheng, P. B. Moore, and S. A. Strobel, Nucleosides Nucleotides, 1998,17,2281. J.-J. Beaussire and S. Pochet, Tetruhedron, 1998, 54, 13547. M. Ahmadian and D. E. Bergstrom, Nucleosides Nucleotides, 1998, 17, 1183. C. J . LaFrancois, J. Fujimoto, and L. C. Sowers, Nucleosides Nucleotides, 1999, 18, 23. M. W. Reed, A. Wald, and R. B. Meyer, J. Am. Chem. Soc., 1998, 120,9729. E. B. Skibo and C. G. Xing, Biochemistry, 1998,37, 15199. S. Matsuda, A. Ishikubo, A. Kuzuya, M. Yashiro, and M. Komiyama, Angew. Chem., Int. Ed. Eng., 1998,37, 3284. F. D. Lewis, S. A. Helvoigt, and R. L. Letsinger, Chem. Commun, 1999, 327. K. Wiederholt and L. W. McLaughlin, Nucleic Acids Rex, 1999, 27, 2487. C. S. Hilger, M. C. Willis, M. Wolters, and W. A. Pieken, Tetruhedron Lett., 1998,39,9403.

157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183

184 185 186

I87 188 189

4: Nucleotides and Nucleic Acids

215

190 J. V. Hines, G. M. Ammar, J. Buss, and P. Schmalbrock, Bioconjugate Chem., 1999, 10, 155. 191 I. Dubey, G. Pratviel, and B. Meunier, Bioconjugate Chem., 1998,9, 627. 192 S. Peyrottes, B. Mestre, F. Burlina, and M. J. Gait, Tetrahedron, 1998,54, 12513. 193 L. DeNapoli, A. Messere, D. Montesarchio, G. Piccialli, E. Benedetti, E. Bucci, and F. Rossi, Bioorg. Med. Chem., 1999,7,395. 194 D. L. McMinn and M. M. Greenberg, Biuorg. Med. Chem. Lett., 1999,9, 547. 195 J. D. Kahl and M. M. Greenberg, J. Org. Chem., 1999,64,507. 196 J. D. Kahl, D. L. McMinn, and M. M. Greenberg, J. Org. Chem., 1998,63,4870. 197 I. Schwope, C. F. Bleczinski, and C. Richert, J. Org. Chem., 1999,64,4749. 198 C. Ciolina, G. Byk, F. Blanche, V. Thuillier, D. Scherman, and P. Wils, Bioconjugate Chem., 1999,10,49. 199 J. C. Verheijen, G . A. van der Marel, J. H. van Boom, S. F. Bayly, M. R. Player, and P. F. Torrence, Bioorg. Med. Chem., 1999,7,449. 200 A. Sakakura, Y. Hayakawa, H. Harada, M. Hirose, and R. Noyori, Tetrahedron Lett., 1999,40,4359. 20 1 C . Behrens and 0. Dahl, Nucleosides Nucleotides, 1999, 18,291. 202 J. Olejnik, E. Krzymanska-Olejnik, and K. J. Rothschild, Nucleic Acids Res., 1998,26,3572. 203 A. Guzaev and M. Manoharan, Bioorg. Med. Chem. Lett., 1998,8,3671. 204 F. Hausch and A. Jaschke, Tetrahedron Lett., 1998,39, 6 157. 205 B. Seelig and A. Jaschke, Bioconjugute Chem., 1999,10, 371. 206 M. Adinolfi, G . Barone, L. DeNapoli, L. Guariniello, A. Iadonisi, and G. Piccialli, Tetrahedron Lett., 1999,40,2607. 207 S. Alefelder, B. K. Patel, and F. Eckstein, Nucleic Acids Res., 1998,26,4983. 208 M. Chassignol and N. T. Thuong, Tetrahedron Lett., 1998,39, 8271. 209 J. S. Vyle, N. H, Williams, and J. A. Grasby, Tetrahedron Lett., 1998, 39, 7975. 210 S. Ikeda, I. Saito, and H. Sugiyama, Tetrahedron Lett., 1998,39, 5975. 21 1 K . G. Bendinskas, A. Harsch, R. M. Wilson, and W. R. Midden, Bioconjugate Chem., 1998,9,555. 212 K. Yamana, A. Yoshikawa, R. Noda, and H. Nakano, Nucleosides Nucleotides, 1998, 17,233. 213 S. Bevers, T. P. O’Dea, and L. W. McLaughlin, J. Am. Chem. SOC.,1998, 120, 1 1004. 214 R. L. Letsinger and S. Chaturvedi, Bioconjugate Chem., 1998,9, 826. 21 5 S. Soukchareun, J. Haralambidis, and G . Tregear, Bioconjugate Chem., 1998, 9, 466. 216 W. Bannwarth and P. laiza, Helv. Chim. Acta, 1998,81, 1739. 217 L. X. Wang, J. Kristensen, and D. E. Ruffner, Bioconjugute Chem., 1998,9, 749. 21 8 D. Umeno, T. Mori, and M. Maeda, Chem. Commun., 1998, 1433. 219 D. Umeno, M. Kawasaki, and M. Maeda, Bioconjugate Chem., 1998,9,719. 220 1. A. Kozlov, P. E. Nielsen, and L. E. Orgel, Bioconjugate Chem., 1998,9,415. 22 I R. Sankaranarayanan, A. C. Dock-Bregeon, P. Romby, J. Caillet, M. Springer, B. Rees, C. Ehresmann, B. Ehresmann, and D. Moras, Cell, 1999,97, 371. 222 E. Schmitt, M. Panvert, S. Blanquet, and Y. Mechulam, EMBO J., 1998, 17, 68 19. 223 F. Nissen. S. Thirup, M. Kjeldgaard, and J . Nyborg, Struct. Folding Design, 1999,7, 143. 224 G . L. Conn, D. E. Draper, E. E. Lattman, and A. G. Gittis, Science, 1999, 284, 1171.

216

Organophosphorus Chemistry

225

B. T. Wimberly, R. Guymon, J. P. McCutcheon, S. W. White, and V. Ramakrishnan, Cell, 1999,97,491. J. M. Ryter and S. C. Schultz, EMBO J . , 1998, 17, 7505. S. R. Price, P. R. Evens, and K. Nagai, Nature, 1998,394,645. N. Handa, 0. Nureki, K. Kurimoto, I . Kim, H. Sakamoto, Y. Shimura, Y . Muto, and S. Yokoyama, Nature, 1999,398,579. L. C. Jiang and D. J. Patel, Nature Struct. Biol., 1998,5,769. S. Rowsell, N. J. Stonehouse, M. A. Convery, C. J. Adams, A. D. Ellington, I . Hirao, D. S. Peabody, P. G. Stockley, and S. E. V. Phillips, Nature Struct. Biol., 1998, 5,970. J. Jaeger, T. Restle, and T. A. Steitz, EMBO J . , 1998, 17,4535. S. Basu, R . P. Rambo, J. Strauss-Soukup, J. H. Cate, A. R. Ferre-D’Amare, S. A. Strobel, and J. A. Doudna, Nature Struct. Biof., 1998,5,986. B. L. Golden, A. R. Gooding, E. R. Podell, and T. R. Cech, Science, 1998, 282, 259. J. E. Wedekind, and D. B. McKay, Nuture Struct. Biol., 1999,6, 261. A. R. Ferre-D’Amare, K. H. Zhou, and J. A. Doudna, Nature, 1998,395, 567. Y . Tanaka, S. Fujii, H. Hiroaki, T. Sakata, T. Tanaka, S. Uesugi, K. Tomita, and Y . Kyogoku, Nucleic Acids Rex, I999,27,949. L. Su, L. Q. Chen, M. Egli, J. M. Berger, and A. Rich, Nature Struct. Biof., 1999, 6 , 285. K. Shi, M. Wahl, and M. Sundaralingam, Nucleic Acids Res., 1999, 27, 2196. J. Nowakowski, P. J. Shim, G. S. Prasad, C. D. Stout, and G . F. Joyce, Nature Struct. Biol., 1999, 6, 15 1 . J. S. Smith and E. P. Nikonowicz, Biochemistry, 1998,37, 13486. T. E. Horton, D. R. Clardy, and V. J. De Rose, Biochemistry, 1998,37, 18094. M. Teplova, G. Minasov, V. Tereshko, G . B. Inamati, P. D. Cook, M. Manoharan, and M. Egli, Nature Struct. Biol., 1999,6, 535. V. Tereshko, S. Portmann, E. C. Tay, P. Martin, F. Natt, K. H. Altmann, and M. Egli, Biochemistry, 1998, 37, 10626. J. H. Lee, G. S. Hwang, and B. S. Choi, Proc. Natf. Acad. Sci. USA, 1999, 96, 6632. D. Ramaiah, T. Koch, H. Orum, and G . B. Schuster, Nucleic Acids Rex, 1998, 26, 3940. H. F. Huang, R. Chopra, G. L. Verdine, and S . C. Harrison, Science, 1998, 282, 1669. F. Coste, J. M. Malinge, L. Serre, W . Shepard, M. Roth, M. Leng, and C . Zelwer, Nucleic Acids Rex, 1999,27, 1837. U. M. Ohndorf. M. A. Rould, Q . He, C. 0. Pabo, and S. J. Lippard, Nature, 1999,399, 708. A. M. Martin, M. D. Sam, N. 0. Reich, and J. J. Perona, Nature Struct. Biol., 1999,6, 269. C. A. Brautigam, S. Sun, J . A. Piccirilli, and T. A. Steitz, Biochemistry, 1999, 38, 696. A. Yoshida, S. G. Sun, and J. A. Piccirilli, Nature Struct. Biol., 1999,6, 3 18. N. C. Horton, K. J. Newberry, and J. J. Perona, Proc. Nail. Acud. Sci. USA, 1998,95, 13489. H . Viadiu and A. K. Aggarwal, Nature Struct. Biol., 1998,5, 910. A . White, X. C. Ding, J. C. van der Spek, J. R. Murphy, and D. Ringe, Nature, 1998,394, 502.

226 227 228 229 230

23 1 232 233 234 235 236 237 238 239 240 24 1 242 243 244 245 246 247 248 249 250 25 1 252 253 254

4: Nucleotides and Nucleic Acids 255 256 257 258 259 260 26 1 262 263 264 265 266 267 268 269 270 27 1 272 273 274 275

276 277 278 279 280 28 1 282

217

C. L. Kielkopf, S. White, J. W. Szewczyk, J. M. Turner, E. E. Baird, P. B. Dervan, and D. C. Rees, Science, 1998,282, 1 1 1. G. M. T. Cheetham, D. Jeruzalmi, and T. A. Steitz, Nature, 1999,399,80. D. A. King, L. Zhang, L. Guarente, and R. Marmorstein, Nature Struct. Biol., 1999, 6 , 22. D. A. King, L. Zhang, L. Guarente, and R. Marmorstein, Nature Struct. Biol., 1999,6,64. S . Rhee, R. G. Martin, J. L. Rosner, and D. R. Davies, Proc. Natl. Acad. Sci. USA, 1998,95, 10413. F. X. Gomis-Ruth, M. Sola, P. Acebo, A. Parraga, A. Guasch, R. Eritja, A. Gonzalez, M. Espinosa, G. del Solar, and M. Coll, EMBO J., 1998, 17, 7404. E. Fraenkel and C. 0. Pabo, Nature Struct. Biol., 1998,5692. S . Tan and T. J. Richmond, Nature, 1998,391,660. D. E. Piper, A. H. Batchelor, C. P. Chang, M. L. Cleary, and C. Wolberger, Cell, 1999, 96, 587. L. Chen, J. N. M. Glover, P. G. Hogan, A. Rao, and S. C. Harrison, Nature, 1998, 392,42. J. F. Schildbach, A. W. Karzai, B. E. Raumann, and R. T. Sauer, Proc. Natl. Acad. Sci. USA, 1999,96,81 1. S. Becker, B. Groner, and C. W. Muller, Nature, 1998,394, 145. T. Schwartz, M. A. Rould, K. Lowenhaupt, A. Herbert, and A. Rich, Science, 1999,284, 1841. H. Robinson, Y. G. Gao, B. S. McCrary, S. P. Edmondson, J. W. Shriver, and A. H. J. Wang, Nature, 1998,392,202. Y. G. Shi, Y. F. Wang, L. Jayaraman, H. J. Yang, J. Massague, and N . P. Pavletich, Cell, 1998, 94, 585. M. OGara, J. R. Horton, R. J. Roberts, and X. D. Cheng, Nature Struct. Biol., 1998,5,872. K. E. Flick, M. S. Jurica, R. J. Monnat, and B. L. Stoddard, Nature, 1998,394,96. D. N. Gopaul, F. Guo, and G. D. Van Duyne, EMBO J., 1998,17,4175. F. Guo, D. N. Gopaul, and G. D. van Duyne, Proc. Natl. Acad. Sci. USA, 1999, 96, 7143. A. Y. Lau, 0. D. Scharer, L. Samson, G. L. Verdine, and E. Ellenberger, Cell, 1998,95,249. B. Pitard, N. Oudrhiri, J. P. Vigneron, M. Hauchecorne, 0. Aguerre, R. Toury, M. Airiau, R. Ramasawmy, D. Scherman, J. Crouzet, J. M. Lehn, and P. Lehn, Proc. Natl. Acad. Sci. USA, 1999,96, 2621. S. S. Velankar, P. Soultanas, M. S. Dillingham, H. S. Subramanya, and D. B. Wigley, Cell, 1999, 97, 75. M. P. Horvath, V. L. Schweiker, J. M. Bevilacqua, J. A. Ruggles, and S. C. Schultz, Cell, 1998,95, 963. H. Rozenberg, D. Rabinovich, F. Frolow, R. S. Hegde, and 2. Shakked, Proc. Natl. Acad. Sci. USA, 1998,95, 15194. K. Pervushin, A. Ono, C. Fernandez, T. Szyperski, M. Kainosho, and K. Wuthrich, Proc. Natl. Acad. Sci. USA, 1998,95, 14147. K. L. Britton, Y. Asano, and D. W. Rice, Nature Struct. Biol., 1998, 5, 593. T. D. Colby, K. Vanderveen, M. D. Strickler, G. D. Markham, and B. M. Goldstein, Proc. Natl. Acad. Sci. USA, 1999,96, 3531. J. J. G. Tesmer, R. K. Sunahara, R. A. Johnson, G. Gosselin, A. G. Gilman, and S. R. Sprang, Science, 1999, 285, 756.

218

Organophosphorus Chemistry

283

M. D. Wang, M. J. Schnitzer, H. Yin, R. Landick, J. Gelles, and S. M. Block, Science, 1998,282, 902. L. I. Pietrasanta, D. Thrower, W. Hsieh, S. Rao, 0. Stemmann, J. Lechner, J. Carbon, and H. Hansma, Proc. Natl. Acad. Sci. USA, 1999,96,3757. T. R. Strick, V. Croquette, and D. Bensimon, Proc. Natl. Acad. Sci. USA, 1998, 95, 10579. J. F. Allemand, D. Bensimon, R. Lavery, and V. Croquette, Proc. Natl. Acad. Sci. USA, 1998,95, 14152. J. F. Leger, J. Robert, L. Bourdieu, D. Chatenay, and J. F. Marko, Proc. Natl. Acad. Sci. USA, 1998,95, 12295. H. P. Chou, C. Spence, A. Scherer, and S. Quake, Proc. Natl. Acad. Sci. USA, 1999,96, 1 1. T. J. Ha, A. Y. Ting, J. Liang, W. B. Caldwell, A. A. Deniz, D. S. Chemla, P. G. Schultz, and S. Weiss, Proc. Natl. Acad. Sci. USA, 1999,96, 893. A. A. Deniz, M. Dahan, J. R. Grunwell, T. J. Ha, A. E. Faulhaber, D. S. Chemla, S. Weiss, and P. G . Schultz, Proc. Natl. Acad. Sci. USA, 1999,96, 3670. Y. Arai, R. Yasuda, K. Akashi, Y. Harada, H. Miyata, K. Kinosita, and H. Itoh, Nature, 1999,399,446.

284 285 286 287 288 289 290 29 1

5 Ylides and Related Species BY NEIL BRICKLEBANK

1

Introduction

In this chapter we have adopted a revised approach, similar to that introduced last year, but with a greater focus on the organophosphorus reagents themselves and with less of an emphasis on their use in synthesis of specific compounds. The level of interest in Wittig chemistry remains high, primarily as a result of the diversity of application of the reagents. There has been a moderate increase in the number of theoretical and computational studies together with further mechanistic investigations into the thio-Wittig reaction. Other notable highlights include reports on the structures of the simplest phosphorane, methylene(trimethyl)phosphorane, and the first stabilised diaminophosphonium diylide. Linking of different organic reactions into ‘tandem’ processes is a topical area and the first tandem Wittig-Hydroformylation reactions have been described. All of these discoveries are discussed in greater detail in the relevant sections below. 2

Phosphonium Ylides

2.1 Theoretical, Structural and Mechanistic Studies of Phosphorus Ylides and the Wittig Reaction. - Previous mechanistic studies of the Wittig reaction have established that the principal intermediate is an oxaphosphetane which, after pseudorotation, decomposes to give phosphine oxide and alkene products. The characteristics of specific reactions are dependent on variables such as the structure of the ylide and carbonyl substrates, solvent, base etc. Current mechanistic interest is focused towards stereochemical variation of the oxaphosphetane intermediates, i.e. their cisltrans selectivity, and hence that of the alkene products. A computational study by Yamataka and Nagase, using a higher level of calculation than previous work (HF/3-21 G* and B3LYP/631G* levels), compares the reactivities and selectivities of a range of nonstabilised and semi-stabilised ylides with benzaldehyde and acetaldehyde. The reactions between alkylidenetriphenylphosphoranes (non-stabilised ylides) or benzylidenetriphenylphosphoranes (semi-stabilised ylides) and benzaldehyde both displayed two transition states, one with an almost planar structure, Organophosphorus Chemistry, Volume 3 1 q:) The Royal Society of Chemistry, 2001

219

220

Organophosphorus Chemistry

which gave a trans-oxaphosphetane intermediate, the other with a puckered structure, which gave a cis-oxaphosphetane. In contrast to previous semiempirical calculations, these results indicated that the planar transition state is more stable for semi-stabilised ylides whereas the puckered transition state is more stable for the non-stabilised ylide. These calculated selectivities agree with experimental observations. The carbonyl-carbon kinetic isotope effects (KIE) were also calculated for the two reactions;' KIEs are a useful tool for investigating the nature of transition states at the rate-determining steps of chemical reactions. The calculated value for the semi-stabilised ylide (1.05 1 at OOC) was in qualitative agreement with the experimental value. However, the calculated KIE for the non-stabilised ylide (1.039 at OOC) did not agree with the experimentally determined value of unity, suggesting that the calculated cis-oxaphosphetane process may not actually represent what occurs experimentally. The differences in the calculated and observed KIE for the nonstabilised ylide implies that, although the product selectivity is determined by the planar and puckered transition states, the puckered transition state is not the rate-determining transition state for reactions involving non-stabilised ylides. The authors go on to conclude that a full description of the Wittig reaction of non-stabilised ylides by theoretical calculations remains a challenge for the future.' Intermediates, transition states and complexes in a hypothetical aza-Wittig reaction (Scheme 1) have been optimised using a6 initio calculations at the H3P=NH

+

H&O

-

H3P=0

+

H2CNH

Scheme 1

MP2/6-3 1G** level.2 The electronic structure of phosphonium ylide-betaines of the pyrimidine series (1)-(3) have been determined using SCF MO LCAO

Me

(3)

calculations at the CND012 spd level3 The study indicates that the ylide centre is better stabilised by the thiocarbonyl compared with a carbonyl group. The poor reactivity of these compounds in the Wittig reaction is explained in terms of coupling between the carbanion and the pyrimidine 7c system. A quantum mechanical study of the thermolysis of P-oxoethylidenephosphorane, at the AM1 MO level using restricted Hartree-Fock calculations, has been rep~rted.~ In a very detailed study, the pseudorotation, conformations and decomposition kinetics of two unstabilised, unconstrained, Wittig intermediates, ( 3RS,4SR)- and (3RS,4RS)-4-cyclohex y l-2-ethyl-3,4-dimethyl-2,2-diphenyl1,2h5-oxaphosphetane, (4) and ( 5 ) respectively, have been measured by dynamic 3'P NMR spectro~copy.~ For both diastereomers, the two rotamers

5: Ylides und Related Species

22 1

which have the ethyl group in an equatorial position dominate in pseudorotation. Oxaphosphetanes (4) and ( 5 ) stereoselectively decompose to (2)-and 2-cyclohexylbut-2-ene, respectively. At - 30 "C, pseudorotation is faster than decomposition by a factor of ca. 10' and, at -20 "C, the half-life of (5) in alkene formation is ca. 8 times longer than that of (4).

(a-

Although it is now relatively clear that oxaphosphetanes are the primary intermediates in Wittig olefinations, and that betaine intermediates are not involved in Wittig reactions of non-stabilised ylides under salt free conditions, thermodynamic factors make the thio-Wittig reaction somewhat different. In particular, the weaker nature of a phosphorus-sulfur bond compared to a phosphorus-oxygen bond should make thiophosphetane formation less favourable than oxaphosphetane formation. In support of this, Erker and coworkers provide further structural and spectroscopic evidence for the formation of gauche-betaine intermediates in the thio-Wittig reaction.6 These workers describe the structure of betaine (6), isolated from the reaction of phosphorane (7) with Michler's thioketone (8) in deuterated pyridine (Scheme 2). Within (6), the central S-C-C-P atom core is non-planar with a dihedral

Me2N

s(6)

(eP=CH*

+ S=C(CsH,+NMe&

C5ND5 300 k

( e P = S

+ H2C=C(C6H4NMe&

(7)

angle of 52.9(3)", and the separation between the sulfur and phosphorus atoms is large [3.312(2)A]. In a series of comparative reactions, the ylides methylene(triphenyl)phosphorane, methylene(diphenylmethy1)phosphorane and methylene(phenyldimethy1)phosphorane were treated with bisb-methoxyphenyl)ket one or bis(p-methoxyp henyl)t hioket one; the character istic 1 Jpci,,,(aryl) coupling constant was used to elucidate the structural nature of the intermediates. The reactions with the ketone all showed evidence of oxaphosphetane intermediates whereas those involving the thioketone gave signals characteristic of phosphonium species, indicative of betaine formation. Several purely structural investigations of phosphonium ylides have been reported. Mitzel and co-workers have reported the single crystal X-ray crystal-

Organophosphorus Chemistry

222

lographic determination of the simplest isolable phosphonium ylide, methylene(trimethyl)phosphorane, Me3P=CH2. The solid-state structure is compared with that determined in the gas phase, by electron diffraction, and theoretically by ab initio calculations. The theoretical and gas phase structures compare quite favourably, with the P=CH2 moiety having a pyramidal geometry in which the plane of the CH2 group is at an angle of 27.4(58) to the P=C bond (this compares well with a similar angle of 26 in Ph3P=CH2, which serves as a reference structure for phosphonium ylides). However, in the crystal, the geometry of Me3P=CH2 is strikingly different showing marked deviation from that e ~ p e c t e d .The ~ ylide (2,4-cyclopentadien- 1-ylidenehydrazono)triphenylphosphorane (9) can be represented by several canonical forms. The crystal structure of (9) has been determined in order to establish which canonical form predominates. The results show a clear bond alternation in the cyclopentadiene ring, which continues into the azo substructure, indicating that the resonance form containing the non-aromatic neutral cyclopentadienylidene moiety best describes the actual hybrid form.* The preference for an s-transoid ( E ) geometry for the P-N-N-C fragment of (9) was also confirmed. 3-Carboethoxy-3-triphenylphosphoranylidene-2-oxopropane triphenylphosphonium bromide ( 10) contains triphenylphosphonium ylide and triphenylphosphonium salt moieties, both of which have the expected distorted tetrahedral geometries, linked by a carboethoxy-2-oxopropane group.9 The latter adopts an anticonformation, presumably to relieve electrostatic repulsions. Spirobicyclic phosphorane (11) has previously been used in Wittig reactions and in the O

O

0 \,-OR

formation of metal complexes. l o The structure consists of two independent molecules each displaying a distorted trigonal bipyramidal geometry; the distortion follows closely the Berry pseudorotation coordinate. The reaction of stabilised ylides and unsymetrically substituted phthalic anhydrides proceeds at temperatures below 5 "C to yield acyclic adducts. However, if the reactions are allowed to proceed above 5 "C then enol lactones are formed. In an attempt to gain an insight into the mechanism of these reactions the structures of the acyclic intermediates methyl(tripheny1phosphorany1idene)acetate ( 12), methyl( 3-methoxy-2-methoxycarbony1benzoy1)triphenylphosphoranylideneacetate (1 3 ) and methyl(2-methoxycarbonyl-6nitrobenzoy1)triphenylphosphoranylideneacetate ( 14) have been determined. Phosphorus-31 NMR has been used to study the kinetics of the reaction between phthalic anhydride and stabilised ylides. I 2 In a very comprehensive study, Cheng et al. have determined the equilibrium

5: Ylides and Related Species

223

acidities (pK,s) of a number phosphonium salts (15), together with those of their Group 15 and 16 congeners, in dimethyl sulfoxide solution. The results have been used to create a scale of thermodynamic stability for the species.13 The acid-base properties of ylides bearing a hydroxyl functionality, such as (16), have been determined. The results indicate that ylides with the hydroxyl

(15) R = Ph, BU X = H, CF3, C02Me, CN, NO2, OMe

group in the onium fragment of the molecule are less basic than those with the hydroxyl group on the carbanionic fragment.I4 The solution structures of P,ydioxoalkyl(tripheny1)phosphonium salts have been determined for the first time, by NMR spectroscopy, in deuterated chloroform solution. Compounds (17a,b) were found to exist predominantly as a mixture of cis- and trans-enol forms. In contrast, compound (1 8) was found to exist as a mixture of the ketoand one-en01 form. Similarly, bisphosphonium salt (19) has one of the phosphorus centres in the keto form and the other in the enol form. Treatment of salt (19) with base generates ylide (20), which is resistant to further deprotonation and which exists only in the enol form.15

(17) a R = O M e b R=OEt

OH (19)

2.2 Synthesis and Characterisation of Phosphonium Ylides. - Lithium phosphonium diylides were first discovered by George Wittig in 1949. As part of their studies into the reactivity of these species, Taillefer et al. have prepared the first stabilised diaminophosphonium diazaylide; sodium diphenylbis(cyanamido)phosphonium diylide (21) was synthesised by a new variation of the

224 Ph2PCI

Organophosphorus Chemistry

2Na, THF

Ph2PNa

-NaCI

12hP5 O

2NaN3

2BrCN, MeCN -2NaBr

C

NCN

* 2N3CN

(21)

scheme 3

Staudinger reaction (Scheme 3).16 Diylide (21) reacts with metal ions; the crystal structure of its copper complex was reported. The synthesis and crystal structure of an a-(1ithiomethylene)phosphorane (22) has been reported. Compound (22) reacts with water or electrophiles to produce ylides (Scheme 4).

'

SiMe3

SiMe3

SiMe3

Several new chiral stabilised ylides (23), based on the binaphthyl molecule, have been prepared, together with their palladium, rhodium and ruthenium complexes. Environmental concerns continue to stimulate research into synthetic organic chemistry using water as solvent. With the aim of performing Wittig reactions in aqueous media, Russell and Warren have reported the synthesis of a range of new phosphonium salts, (24) and (25), which are soluble and stable in basic aqueous solution.19 The Wittig reactions of these salts with benzaldehyde derivatives in aqueous sodium hydroxide are also discussed. The preparation and synthetic applications of phosphonium ylides bearing

(23) R' = p M e C 6 H 4 ; R2 = C02Et. C0&Me3, CN

(24) R = 4-C02H, 4-OH, 3-OH

(25) R = 4-OH, 3-OH

225

5: Ylides and Related Species

perfluorinated substituents is the subject of several recent publications. Treatment of (a-furoy1)methy It riphenylp hosp honium bromide or (a-thienacy1)methyltriphenylphosphonium with methyl 2-perfluoroalkylnoates, in the presence of potassium carbonate, yields 4-(ac-furoyl)-2-triphenylphosphoranylidene-3-perfluoroalkyl-3-butenoates or 4-(a-thienacyl)-2-triphenylphosphoranylidene-3-perfluoroalkyl-3-butenoates(26) respectively.2092' Hydrolysis of phosphoranes (26) with hot aqueous methanol produces a-furoyl or a-thienacyl pyranones and butenoates. The first a-fluorovinylphosphonium salts, (27a,b) (Scheme 5), have been prepared from fluorovinyldiphenylphosphine.22 C02Me

ph3p=c R

0

(26) E = 0 ,S ; R = CF3, C2F5, R C ~ F ~

i cat CuCI, 140 "C 1,1,2,2-tetrachloroethane

The ylides generated from compounds (27a,b) are useful reagents for introducing a monofluoroethylene moiety into carbonyl compounds although the reactivity of phosphonium salt (27a) was generally lower than that of (27b); for example, sequential treatment of (27b) with ethoxide ion, in ethanol at room temperature, followed by benzaldehyde, yields 1-benzylidene-1-fluoro-2-ethoxyethaneas a 4357 mixture of the E and 2 isomers in 75% yield, whereas salt (27a) provides only a 52% yield of product, with E:Z of 53:47. Aitken and co-workers continue to study the synthesis of new ylides and their decomposition induced by flash vacuum pyrolysis. Compounds prepared include seven new stabilised ylides, (28)-30) (Scheme 6), which are designed to undergo thermal tandem c y c l i ~ a t i o nUpon . ~ ~ flash vacuum pyrolysis at 850 "C the ylides undergo tandem cyclisation and/or abstraction-rearrangementextrusion processes leading to tri- and tetra-cyclic aromatic heterocycles. In a second paper, Aitken reports the synthesis of six new examples of the little known a-sulfinyl phosphorus ylides (31) (Scheme 7).24 Upon flash vacuum pyrolysis at 500°C ylides (31) are found to undergo predominantly extrusion of triphenylphosphine to give thioesters, although it was observed that the ccarylsulfinyl ylides also lose triphenylphosphine oxide to give additional side products. Mikolajczyk et al. have also prepared a family of a-sulfinyl phosphorus ylides (32), although their methodology was based on the reaction of

226

Organophosphorus Chemistry

2BuLi

6Ph3 Hal-

I\

PhCH=CHCOCI

I\

CHz=CHCH&H&OCI

(28)

YMe = = X=Y=S x=o, Y = S x = s , Y=O

PPh3

Ph

(30)x = o , s

(29)

Scheme 6

0 RSH

II

2Ph3P=CHPh

RNS\CI

PhMe. 0°C. NZ, Bu'Li

2S0&12

Ph3pYPh

R = Et, 'Pr, CH2Ph, Ph, 4-MeC6H4,4-CIC6H4

(311

scheme 7

ylides with sulfinic acid esters. These workers utilised the ylides (32) in the stereoselective synthesis of racemic and optically active E-vinyl and E-dienyl sulfoxides.25 Two unusual phosphoranes have been obtained from the reaction of sulfurcontaining heterocycles with organophosphorus reagents. Compound (33), the first azacyclopentadienylphosphorane, was obtained by treating dicyano-

""Y" (32) R = Me, Et, Pr", Me2CH, Me&, Ph

(34) R = H, Me

methylenedithiazole with excess triphenylphosphine.26 Ylides such as (34) were among the products isolated from the reactions between 2-thioxo-4-thiazolidinones and formylmethylenetriphenylphosphorane.27Similarly, the apparently very complex reactions between substituted benzothiazoles and ylides yields a variety of products including benzothiazole-substituted ylides.** In a series of papers, Schmidpeter and co-workers have explored the frequently complex reactions between phosphonium ylides and phosphorus trihalides and related The reaction of allylidenetriphenylphosphorane with phosphorus trichloride has been shown to follow a complicated substitutioddisproportionation pathway yielding diphospholes (35a,b) to-

5: Ylides and Related Species

227

(35)a R = PC12 b R=H

gether with 1,4,7,1O-tetraphosphaphenalene (36).29 Condensation of phosphorus trichloride or phosphorus tribromide with bis(trimethylsily1)ylideyields ylidediylphosphine tetramers (37a) and (37b) (Scheme S), the cations of which have a tetraphosp habicyclo[2.2,2]octane (tetraphospha-barrelane) skeleton. Upon treatment with Lewis acids, (37a) undergoes skeletal rearrangements as illustrated in Scheme Se30The structure of bis(chloropheny1)phosphinylmethy'PPh3

Ph3P=C(SiMe3)2

+

- 3

x\PAP/x

PX3

Ph3P Ph3P

PP '

h3

(37) a X = C I b X=Br

M = Al, Ga

Scheme8

lide (38a) has been determined crystallographically; the structure is analogous to related bis(phosphiny1)ylides (38b) and (38c). Reduction of (38a) results in the formation of diphosphine (39) and 1,2,4,5-tetrapheny1-3,6-bis(triphenylphosphoni0)- 1,2,4,5-tetraphosphinane(40).31 PhP-PPh PhP+ PhsPrCR2

(38)a R = PPhCl b R = PPh2 c R = PC12

)=PPh

Ph/? ?\Ph CI CI (39)

PhP-PPh Ph3P=(

)==PPh3 PhP-PPh

2.3 Ylides Coordinated to Metals. - Niobium complexes (41) and (42) are the products of the reactions bet ween (2-thiazolylcarbony1)met hylenetriphenylphosphorane and [ (NbCl3(dme)}, I and [NbC13(dme)(RC= CR')], respect i ~ e l y Treatment .~~ of alkyne complex (42) (R'= Ph, R2 = Me) with methyl-

Organophosphorus Chemistry

228

(42) R' = R2 = Ph, Me, Et R' = Ph, R2 = Me, Et, Pr, SiMe3

(43)

lithium produces, through deprotonation of a phenyl ring, ortho-metallated complex (43). Furthermore, complex (42) (R'= Ph, R2 = Me) undergoes loss of the alkyne ligand when treated with silver or gold triflate species, yielding heterometallic complexes. In a very comprehensive study, Doherty and co-workers have investigated the nucleophilic, regioselective, addition of tris(dialky1amino)phosphines to the binuclear iron allenyl complex (44) (Scheme 9).33On the basis of NMR

Scheme 9

and crystallographic evidence, these authors conclude that the zwitterionic dimetallacyclopentane complexes (45) do not display any significant ylidic character but vinylidene-bridged complex (46) and dimetallacyclobutane complex (47), which co-crystallise in a 2: 1 ratio, are delocalised with contributions from the ylidic resonance forms. The dimetallacyclopentane complexes (45) undergo thermally induced decarbonylation producing vinylenecarbene

5: Ylides and Related Species

229

complexes or a-phosphonium alkoxide-functionalised alkenyl complexes, neither of which show any phosphorus ylide character. A series of bimetallic complexes, such as (48), containing gold and the ferrocene system, has been prepared from the reaction of ferrocenyl ylides with a variety of gold species.34 Treatment of carbodiphosphorane (49) with nickel tetracarbonyl in toluene gives the yellow-orange coloured tricarbonyl complex (50) (Scheme 10). If the

@ 1.PPh3

(C0)3Ni-C\,,

(48)

THF

/ , F 3

(CO)2Ni-C

PPh3 (50)

\’.

PPh3

(51)

scheme 10

same reaction is repeated in tetrahydrofuran then the red dicarbonyl complex (51) is obtained. Complex (50) converts smoothly into (51) when dissolved in tetrahydrofuran; both complexes have been characterised crystallographially.^^ Several model complexes (with hydrogen atoms replacing the phenyl groups of the phosphorane) were subjected to quantum chemical calculations at the DFT level of theory (B3LYP). Analysis of the nickel-phosphorane bonding in (50) and (51) indicated that metal to ligand donation was more significant than ligand to metal back-donation. The coordination chemistry of ylides towards platinum and palladium continues to attract a great deal of attention; Navarro and co-workers are highlighted as making many significant new reports in this field. The chemistry of bis(y1ide) (52) is the subject of two paper^.^^.^^ Ylide (52) is obtained from phosphonium salt (53) when the latter is treated with palladium acetate, the ylide thus generated coordinating to the palladium, yielding complex (54) (Scheme 1 1 ) . Treatment of (54)with a molar equivalent of thallium perchlorate yields dinuclear complex (55), which forms (56) when treated with a further two equivalents of thallium p e r ~ h l o r a t eThe . ~ ~ reactivity of complexes (55) and (56) towards a variety of different species, including pyridine, tertiary phosphines, ylides and thallium acetylacetonate has been explored.36 When coordinated to palladium, as in complex (55), ylide (52) undergoes either thermally-induced or ligand-induced orthometallation, generating the C,Cchelating ligand illustrated in complexes (57) and (58).37The orthometallation proceeds through an electrophilic substitution pathway with the proton generated by the metallation being captured by an ylide group via an

230

Organophosphorus Chemistry

2c1- Pd(0Ac)z

1

o=cvA P d : " ' CI

1

0 (53)

r

r

M

2+

c 2+

2TIC104

MeCN. r.t.

I

L

+PPh3

(57)

(58)L = Py, 3,5Lutidine, PPh3, PPhMe2 scheme11

intramolecular acid-base rea~tion.~' The reactivity of complexes (57) and (58) towards various deprotonating agents is discussed in a third p ~ b l i c a t i o nFor .~~ example, treatment of (57) with mercury acetate yields the interesting trinuclear complex (59) in which the ylide acts as a C,C,C-tridentate chelating ligand. The coordination chemistry of several iminophosphoranes (60), (61) and (62), towards a variety of platinum and palladium subtrates has been ~ t u d i e d .Ylide ~ ~ , ~(60) ~ displays a high selectivity for coordination through the terminal nitrogen.39 Compound (6 I), which has a poor coordination ability, only bonds through the iminic-nitr~gen.~~ In contrast, (62) displays a variety of coordination modes, including monodentate bonding through the pyridylnitrogen, N,N-chelation and N, 0-chelation; this was proven in complex (63) which was characterised by X-ray cry~tallography.~~ Several platinum(I1) complexes of ketenylidenetriphenylphosphorane have been prepared (Scheme 12). All contain the phosphorane bonded in an q ' mode though the ylidic-carbon atom. The bis(y1ide) complex (64) is stable in solution only at low temperature^.^'

5: Ylides and Related Species

23 1

L

/

/

Ph3P

Ph3P

scheme12

(64)

2.4 Reactions of Phosphonium Ylides. - 2.4.1 Reactions with Carbonyl Compounds. Bolli and Ley have developed polymer-bound Wittig reagents for use in automated combinatorial synthesis.42The ylides generated from phosphonium salts (65) were reacted with aldehydes as a step in the overall conversion of alcohols to P-hydroxyamines. Polymer-bound 4-benzylsulfonyl-1 -triphenylphosphoranylidene-2-butanone(66) has been used in Wittig reactions with aldehydes in the preparation of piperidin-4-one derivative^.^^

Lactones and amides do not usually undergo Wittig olefination under normal conditions because their carbonyl groups are not sufficiently reactive towards phosphoranes. However, Sabitha et al. have found that microwave irradiation can promote these difficult reactions; for example, upon irradiation at 90°C for ninety seconds, diphenyl pyrazolone is converted into a 90:lO mixture of 2- and E-pyrazolylidenacetate in 86% yield.44 Electroreduction of phosphonium salts in acetonitrile, in the presence of substituted benzaldehydes and a supporting electrolyte, led to the formation of olefins via Wittig reactions.45 Kinetic studies of two Wittig reactions performed under phase-transfer

232

Organophosphorus Chemistry

conditions have been reported; in the first, the conversion of aldehydes into allylic dioxolanes by 1,3-dioxolan-2-yl-methyltriphenylphosphoniurn bromide was i n ~ e s t i g a t e dthe ; ~ ~second studied the reaction between substituted benzaldehydes and benzyltriphenylphosphonium bromide.47 Wang and Verkade have reported the synthesis and Wittig reactions of (67), a novel semi-stabilised Compound (67) readily reacts with aldehydes forming alkenes in high yield and with high E-stereoselectivity. The utility of phosphonium salt substituents in the synthesis of functionalised porphyrins is the subject of a short review.50 Wittig reaction of the aldehyde-functionalised porphyrin chlorin led to the unexpected formation of an unusual chlorin-spirochlorin dimer.51 Treatment of aldehyde (68) with iodo-substituted ylide (69) results in moderate yields of the cis epoxides (70) in addition to the expected 2-iodo I

Ph3P=C,

Me&OSiMe2CMe3

/

774

7

Me

OSiMe2CMe3

(69) Me

Me .'""'

OCH&H40Me-p R'R3 = 0, R2 = R4 = H R' = R3 = H, R2R4= 0

~ l e f i n . Wittig ~* reactions have been utilised in the stereoselective synthesis of a number of species including enantiopure a-alkyl, a-formyl and a-hydroxyl ketones and esters,53a-bromo-a$-unsaturated esters (Scheme 13).54 Phospho0 k O E t

Br I

\

*V0

Br

Scheme 13

nium salts (71) have been prepared an