ADVANCESINCANCERRESEARCH VOLUME 58
This Page Intentionally Left Blank
ADVANCES IN CANCERRESEARCH Edited by
GEORGE ...
26 downloads
1440 Views
12MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ADVANCESINCANCERRESEARCH VOLUME 58
This Page Intentionally Left Blank
ADVANCES IN CANCERRESEARCH Edited by
GEORGE F. VANDE WOUDE Frederick Cancer Research and Development Center Frederick, Maryland
GEORGE KLEIN Department of Tumor Biology Karolinska lnstitutet Stockholm, Sweden
Volume 58
ACADEMIC PRESS, INC. Harcourt Brace Jovanovich, Publishers
San Diego New York Boston London Sydney Tokyo Toronto
This book is printed on acid-free paper. @
Copyright 0 1992 by ACADEMIC PRESS, INC. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher.
Academic Press, Inc. San Diego, California 92101 Unikd Kingdom Edition published by ACADEMIC PRESS LIMITED 2428 Oval Road, London NW17DX
Library of Congress Catalog Card Number: 52-13360
ISBN 0-1 2-006658-0 (alk. paper)
PRINTED IN THE UNITED STATES OF AMERICA
92939495
9 8 7 6 5 4 3 2 1
CONTENTS
CONTRIBUTORS TO VOLUME 58 .....................................................................................
ix
Epstein-Barr Virus in B Lymphocytes: Viral Gene Expression and Function in Latency ROBERTP . ROGERS. JACK L . STROMINGER.
AND SAMUEL
H . SPECK
I . Natural History of the Virus and Associated Diseases ............................... I1 . Expression and Function of EBV Genes during Latency I11. Structure of Viral Transcripts and Promoters for the EBV Latent Genes ............................................................................ N . Perspective o n Viral Gene Expression in the LCL Model ........................ References .....................................................................................................
1 4 10 17 21
The Physiology of Transforming Growth Factor-a RIKDERYNCK I. I1. 111.
N. V.
VI. VII . VIII .
Introduction .................................................................................................. TGF-a Is a Member of a Growth Factor Family ...... The Structure of T G F a and Its Precursor ................................................. Interactions of T G F a with the EGF/TGFa Receptor ............................. The Transmembrane TGF-a Precursor ...................................................... A Role for T G F a in the Physiology of Normal Cells ................................ T G F a in Normal Development ....................... ................................... A Role for TGF-a in Tumor Development? ............................. References .....................................................................................................
V
27 28 30 34 36 38 41 43 48
vi
CONTENTS
The Role of Raf-1 Phosphorylation in Signal Transduction GISELAHEIDECKER, WALTER KOLCH,DEBORAH K. MORRISON, AND
I. 11. 111.
IV. V.
ULFR. RAPP
The rajoncogene Family ............................................................................. Raf-1 Activation following Growth Factor Stimulation ............................. Sites of Raf-1 Phosphorylation ......................................... .......... Consequences of Raf-1 Activation ..... ........ Conclusion ._.. ................................................ References .....................................................................................................
53 54 59 66 70 70
G Protein-Controlled Signal Transduction Pathways and the Regulation of Cell Proliferation KLAUS SEUWEN AND JACQUES POUksSEGUR
Introduction ....... Signal Transductio Tyrosine Kinase Activity ............................................................................... 111. Signal Transduction through G Protein-Coupled Receptors . IV. Conclusion ................ ........ References .....................................................................................................
I.
75
11.
76
90
Regulation of Muscle Cell Growth and Differentiation by the MyoD Family of Helix-Loop-Helix Proteins LI LI AND ERICN. OLSON I. 11.
111.
N. V.
Introduction . ...................................... Evidence for Myogenic Regulatory Genes ................................................. The MyoD Family of Muscle-Specific Regulatory Factors ......................... Antagonism between Proliferation and Differentiation within the Myogenic Summary ........................................................................................................ References .............
95 96 97
114
vii
CONTENTS
Molecular Genetic Characterization of CNS Tumor Oncogenesis C . DAVID JAMES I. 11.
111. IV. V.
AND
v. PETER COLLINS
Introduction ................................................................................................... Explanation of Model ................................................................................... Comparison of Molecular Genetic and Histopathologic Analysis ........... Status of Identifying and Characterizing Specific Gene Alterations in CNS Tumor Development ............................................................ Implications of Molecular Gen nalysis on CNS Tumor Diagnosis and Treatment .............................................................................. References .......................................................
121 122 129 132 I37 139
Tumor Eradication by Adoptive Transfer of Cytotoxic T Lymphocytes CORNELIS J. M . MELIEF I. 11. 111. IV. V. VI .
VII.
T Cell Immunity ............................................................................................ Processing of Antigens for Recognition by T Cells ................................... Immunogenicity of Tumors Adoptive lmmunotherapy of Virus-Induced Tumors with T Cells .......... Escapes of Tumor Cells from Immune T Cells ........................................... Relationship of LAK Cells, TIL Cells, NK Cells, and T Cells, All with Antitumor Activity and Clinical Results of Adoptive Therapy with LAK and TIL Cells ........................................................................... Cloned T Cells with Autologous Tumor Specificity in Malignant .................................. ............. ................. . ............... ...............
.
VIII.
..
. I . .
143 144 145
154 160
163 166 167 168
Toward a Genetic Analysis of Tumor Rejection Antigens THIERRY BOON I. 11. 111.
IV. V.
Introduction ................................................................................................... tum- Antigens: Genes, Mutations, and Antigenic Peptides ........ A Tumor Rejection Antigen of Tumor P815 .............................................. d on Human Tumors by Autologous CTLs
....................................................... .. ,I..
References .....................................................................................................
INDEX ........................................................................................................................................
177 183 197 201 205 207
21 1
This Page Intentionally Left Blank
CONTRIBUTORS
Numbers in parentheses indicate the pages on which the authors' contributions begin.
THIERRY BOON,Ludwig Institute for Cancer Research, Brussels Branch, B-1200 Brussels, Belgium, and Cellular Genetics Unit, Universiti Catholique de Louvain, B-1200 Brussels, Belgium ( 177) V. PETER COLLINS, Ludwig Institutefor Cancer Research, Clinical Group, S-10401 Stockholm, Sweden, and Division of Neuropathology, Department of Pathology I, Salgrenska Hospital, 941345 Gothenburg, Sweden (121) RIK DERYNCK, Departments of Growth and Development, Anatomy, and Program of Cell Biology, University of California, San Francisco, San Francisco, California 94143 (27) GISELA HEIDECKER, Viral Pathology Section, Laboratory of Viral Carcinogenesis, NCI-Frederick Cancer Research and Development Facility, Frederick, Malyland 21 702 (53) C. DAWD JAMES, Department of Pediatrics, Division of Hematology/Oncology, Emory University School of Medicine, Atlanta, Georgia 30322 (121) WALTER KOLCH,Viral Pathology Section, Laborat09 of Viral Carcinogenesis,NCIFrederick Cancer Research and Development Center, Frederick, Malyland 21 702 (53) CORNELIS J. M. MELIEF, Division of Immunology, The Netherlands Cancer Institute, 1006 CX Amsterdam, The Netherlands' (143) DEBORAH K. MORRISON, ABL-Basic Research Propam, NCI-Frederick Cancer Research and Development Center, Frederkk, Maryland 21 702 (53) ERICN. OLSON, Department of Biochemistry and Mobcular Biology, The University of Texas M . D. Anderson Cancer Center, Houston, Texas 77030 (95)
'Present address: Department of Immunohematology, University Hospital, 2300 RC Leiden, The Netherlands. ix
X
CONTRIBUTORS TO \'OI.UME
58
Lr LI, Department of Biochemist? and Molecular Biology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030 (95) JACQUES P O U U S S ~ G U R , Centre de Biochemie-CNRS, Uniuersith de NiwSophia Antipolis, 06034 Nice, France (75) ULFR. RAW, Viral Pathology Section, Laboratory of Viral Carcinogenesis, N U , Frederick Cancer Research and Development Facility, Frederick, Maryland 21 702 (53) ROBERT P. ROGERS, Department of Diagnostic Sciences, The University of North Carolina, School of Dentistry, Chapel Hill, North Carolina 27514 ( I ) KLAUSSEUWEN, Centre de Biochemie-CNRS, Universitb de Nice-Sophia Antipolis, 06034 Nice, France (75) SAMUEL H. SPECK, Division of Tumor Virology, Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts 021 1 5 (1) JACK L. STROMINGER, Division of Tumor Virology, Dana Farber Cancer Institute, Haruard Medical School, Boston, Massachusetts 021 15 ( I )
EPSTEIN-BARR VIRUS IN B LYMPHOCYTES: VIRAL GENE EXPRESSION AND FUNCTION IN LATENCY Robert P. Rogers,* Jack L. Strominger,t and Samuel H. Speckt *Department of Diagnostic Sciences, University of North Carolina School of Dentistry, Chapel Hill, North Carolina 27514 +Division of Tumor Virology, Dana Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts 021 15
I.
Natural History of the Virus and Associated Diseases
11. Expression and Function of EBV Genes during Latency
A. Nuclear Antigens B. Membrane Proteins C. EBERS I l l . Structure of Viral Transcripts and Promoters for the EBV Latent Genes A. Transcription of the EBNA Genes B. Transcription of Viral Membrane Proteins IV. Perspective on Viral Gene Expression in the LCL Model References
1. Natural History of the Virus and Associated Diseases Epstein-Barr virus (EBV) is a herpesvirus that infects all human populations (Epstein and Achong, 1979b). Typically, greater than 95% of the adult population carries the virus, which is normally acquired asymptomatically in early childhood. When primary infection is delayed until adolescence or adulthood, approximately half the cases result in the clinical illness called infectious mononucleosis (IM) (Epstein and Achong, 197913; Henle et al., 1968). Once acquired, the virus persists in the host throughout life. It is carried in “latent” form in peripheral blood B lymphocytes (Yao et al., 1985) and is shed in the form of virus particles from a site, perhaps epithelial (Rickinson, 1984; Sixbey et al., 1984; Wolf et al., 1984; Morgan et al., 1979), in the oropharynx (Epstein and Achong, 1979b; Miller et al., 1973). Infected saliva is thought to be the normal mode of viral transmission, although virions have also been found in genital secretions (Sixbey et al., 1986). The ubiquity of EBV in human populations contrasts with the
1 ADVANCES IN CANCER RESEARCH, VOL. 58
Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
2
ROBERT P. ROGERS E T AL.
geographically restricted occurrence of EBV-associated human cancers, namely nasopharyngeal carcinoma (NPC), which is endemic to regions of southern China (for reviews see Klein, 1979; de The, 1982), and Burkitt’s lymphoma (BL), a childhood malignancy found in the malaria belt of Africa and elsewhere (for reviews see Lenoir and Bornkamm, 1987; Epstein and Achong, 1979a; Rowe and Gregory, 1989).EBV-negative BL cases greatly outnumber EBV-positive cases in nonendemic regions, but both types have characteristic chromosomal translocations involving the myc gene on chromosome 8 and (usually) an immunoglobulin locus on chromosome 2, 14, or 22 (Taub et al., 1982; Lenoir and Bornkamm, 1987). Although EBV transforms human B lymphocytes in vitro, its final contribution to the malignant phenotype of BL and other human cancers is not precisely understood. Knowledge about EBV in epithelial lesions is increasing (for review see Sixbey, 1989). In the past, EBV was thought to be present only in undifferentiated or partially differentiated cases of NPC, but low copy numbers of the genome have now been demonstrated in differentiated cases as well (Raab-Traub et al., 1987). The common poorly differentiated phenotype of NPC may be partly due to expression of a specific viral gene (encoding the viral latent membrane protein, LMP), which morphologically transforms and inhibits cellular differentiation in transfected epithelial cell lines (Dawson et al., 1990; Fahraeus et al., 1990a), though other events must be involved in those cases in which LMP is not expressed (Fahraeus et al., 1988). Passage of NPC tumors in nude mice (Raab-Traub et al., 1983; Busson et al., 1988; Billaud et al., 1989) has facilitated study of viral and cellular functions in this malignancy, which, until a recent report (Yao et al., 1990) has lacked a virus-positive cell culture system. A variant of rare thymic carcinomas with histologic similarity to NPC has been shown to possess a high number of EBV genomes and viral nuclear antigen(s) (Leyvraz et al., 1985).EBV is found in another epithelial lesion, oral hairy leukoplakia, which is associated with acquired immune deficiency syndrome (AIDS) (Greenspan et al., 1985). This apparently indolent lesion is a predictor of subsequent AIDS development, and sometimes contains rearranged viral DNA that may trigger viral reproduction (Patton et al., 1990). A rare human genetic defect gives rise to the EBV-induced X-linked lymphoproliferative (XLP) syndrome (Harada et al., 1982; Sullivan et al., 1983; Okano et al., 1988). Prior to EBV infection, affected males have subtle irregularities in their immune responses, but are generally capable of an effective response to all pathogens except EBV. Infection of susceptible males by EBV usually results in fatality involving fulminant hepatitis or hemophagocytic syndrome of the bone marrow. Failure to
EBV I N B LYMPHOCYTES
3
control both B- and T-lymphoproliferative responses, as well as natural killer cell responses, is characteristic of the disease course. Survivors of acute EBV infection are prone to hypogammaglobulinemia and B lymphocyte malignancy. The XLP genetic locus has been mapped to the region of Xq25 (Skare et al., 1987; Sylla et al., 1989). T h e first cytogenetically observed XLP-associated defect in this region was recently reported as a partial deletion of Xq25 (Wyandt et al., 1989). EBV-infected B lymphocytes are apparently controlled in vivo by cytotoxic T lymphocytes in an HLA-restricted manner (Misko et al., 1980; Rickinson et al., 1980). Immunosuppression caused by organ transplant-associated therapy or acquired immune deficiency syndrome can lead to polyclonal proliferation of EBV-carrying B lymphocytes, presumably by loss of cytotoxic T lymphocyte control. Regression of such polyclonal proliferation may occur after removal of immunosuppressive therapy. True BLs, with the characteristic chromosomal translocations, have also been documented in AIDS patients (for reviews see Lenoir and Bornkamm, 1987; Ernberg, 1989). EBV transforms the B lymphocytes of humans and other primates to continuous proliferation in culture, a process called immortalization (Henle and Henle, 1967; Pope et al., 1968; Gerber et al., 1969). T h e resultant latently infected lymphoblastoid cell lines (LCLs) support a predominantly latent viral life cycle in which only a few of the 100 or so viral genes are expressed. Viral genes expressed during latency are candidate immortalizing genes, and thus have attracted much study. Generally, less than 1% of cells of a given LCL will enter the lytic cycle in which most or all viral genes are expressed, resulting in virion production and host cell death. A number of natural and artificial stimuli can increase the percentage of infected cells entering the lytic cycle, but background triggering of untreated LCLs is not understood. Data have emerged to support the existence of two types of EBV, designated A and B (or 1 and 2) (Rowe et al., 1989; Arrand et al., 1989; Dambaugh et al., 1984; Adldinger et al., 1985; Rickinson et al., 1987). Type B viral isolates transformed B lymphocytes less efficiently than did type A viral isolates, and type B virus-transformed cells displayed a lower growth rate (Rickinson et al., 1987). Recently, virus types A and B were demonstrated at nearly equal frequencies in throat washings from healthy individuals of a United States population (Sixbey et al., 1989). Interestingly, some individuals in this study had both virus types, raising the question of whether infection with one viral strain confers immunity against subsequent challenges from other viral strains. EBV binds B lymphocytes through interaction of viral membrane glycoprotein gp350/220 with CR2, the cell surface receptor for the C3d
4
ROBERT P. ROGERS ET AL.
complement fragment (for reviews see Cooper et al., 1988; Nemerow et al., 199Ob). Among a wealth of supportive data, purified CR2 protein has been shown to bind to purified EBV (Nemerow et al., 1986),and the binding of EBV to B lymphocytes was blocked with CR2-specific antibody (Fingeroth et al., 1984). Soluble CR2 inhibits infection of B lymphocytes, a finding which may be of use in clinical treatment of acute and chronic EBV infections (Nemerow et al., 1990a). Positive immunofluorescent staining with some anti-CRP monoclonal antibodies on epithelial cells of the oropharynx has been reported (Young et al., 1986). These investigators have now found a 200-kDa protein immunoprecipitable by an anti-CR2 monoclonal antibody (mAb) (HB5) from fresh ectocervical epithelial cells (Young et al., 1989). The 145-kDa B lymphocyte CR2 molecule has yet to be identified in normal epithelium. Transcription of the CR2 gene in NPC passaged in nude mice was negative by Northern blotting and faintly positive by S1 nuclease protection in one study (Billaud et al., 1989). CR2 is also present on a small fraction of human thymocytes and on one T cell tumor line (Molt-$) (Fingeroth et al., 1988), but the question of whether normal thymocytes can be infected with EBV has not been adequately explored. II. Expression and Function of EBV Genes during Latency A. NUCLEAR ANTIGENS
The EBV genome is over 170 kilobases (kb) in length, has been completely sequenced (Baer et al., 1984), and has been extensively mapped for RNAs, promoters, open reading frames, and other structural elements (Baer et al., 1984; Farrell, 1989). Viral gene products of the latent cycle in LCLs include a set of nuclear proteins, at least three membrane proteins, and two RNA polymerase I11 transcripts (designated EBERS). The six EBV-encoded nuclear proteins are called Epstein-Barr nuclear antigens (EBNAs) and are numbered EBNA1, 2, 3A, 3B, 3C, and 4, though the nomenclature varies in the literature (see Knutson and Sugden, 1989). The latent viral membrane proteins are called LMP, T P l , and TP2. The membrane protein encoded by BHRFl functions as an early lytic antigen, but may have a function in latency as well (Austin et al., 1988). Of all the viral gene products of the latent cycle, function has been demonstrated most clearly for EBNAl . Plasmid constructs expressing EBNAl and containing the cis-acting “ o r i P DNA sequence replicate stably in transfected cells (Yateset al., 1985),suggesting that EBNAl may
EBV I N B LYMPHOCYTES
5
function normally to initiate DNA replication at oriP on episomal EBV genomes. The function of oriP as an initiator and terminator of DNA replication has been recently demonstrated (Gahn and Schildkraut, 1989). In addition, EBNAl has been shown to activate an enhancer (Reisman and Sugden, 1986) in region I of omP, which contains 20 tandemly repeated EBNAl-binding sites (Rawlins et al., 1985). T h e EBNA 1-dependent enhancer appears to be significant in the regulation of Cp, one of the two known promoters utilized in the expression of the EBNA family of proteins (Sugden and Warren, 1989). EBNAl also appears to bind in the BamHI Q region of the genome (Rawlins et al., 1985), where the significance of binding is unknown. T h e EBNA2 coding region is deleted in two BLassociated viral strains, P3HR-1 (Jeang and Hayward, 1983) and Daudi (Jones et al., 1984), which differ from wild-type strains in their inability to immortalize B lymphocytes (Miller et al., 1974). Superinfection of the EBVpositive Raji BL line with the immortalization-incompetent P3HR- 1 virus yields recombinant immortalizing virus with restored EBNA2 coding regions (Skare et al., 1985). These data, although suggestive, do not prove the immortalizing function of EBNA2, because the deleted region is known to be multifunctional. It contains a portion of the EBNA4 coding region (Speck et al., 1986; Sample et al., 1986) and splice signals for many of the EBNA messages (for review see Speck and Strominger, 1989). Lingering questions have been resolved by a recent study that demonstrated the immortalizing function of EBNA2 by genetic analysis (Hammerschmidt and Sugden, 1989). The nonimmortalizing P3HR- 1 virus was found capable of immortalizing B lymphocytes in the presence of a helper virus expressing EBNA2, but not in the presence of a helper virus expressing a truncated EBNA2 protein. Restoration of the EBNA2 coding sequence by homologous recombination achieved the same result, whereas a full-length EBNA4 protein was ruled out as a requirement for immortalization. Others using the same basic approach (Cohen at al., 1989) have confirmed the transforming function of EBNA2, and, by deletion mutants, have begun to examine the EBNAQcoding regions necessary for transformation. The uses of genetic analysis newly applied to the study of Epstein-Barr virus have been discussed (Knutson and Sugden, 1989). Consistent with its role as a transforming gene, EBNA2 lowers the serum requirement for cell growth when transfected into Rat-1 fibroblasts (Dambaugh et al., 1986). Another study (Rickinson et al., 1987) linking EBNA2 with cell growth phenotype took advantage of the existence of two serotypes of this protein, namely, EBNA2A (85 kDa in B95-8 virus) and EBNAPB (75 kDa in the BLassociated strain AG876)
6
ROBERT P. ROGERS E T AL.
(Dambaugh et al., 1984). It was found that lymphoblastoid cell lines were more readily established by infection with type A isolates, and that the growth rate of LCLs carrying type B isolates was lower. Conclusions from this kind of study are limited by unknown patterns of viral strain variation at other genetic loci. EBNA2 influences host cell gene expression by induction of cellular antigens CD21 and CD23 in the EBV-negative cell lines Louckes (a BL) (Wang et al., 1987) and BJAB (a B lymphoma) (Wang et al., 1990b). Cotransfection experiments in BJAB showed a cooperative effect of EBNA2 and viral protein LMP in boosting CD23 at the protein and mRNA levels (Wang et al., 1990b). In an EBV-negative BL (BL41) infected with P3HR-1 virus, expression of EBNA2 led to increased levels of CD21 and CD23 mRNA levels (Cordier et al., 1990). Cell surface CD21, but not CD23, expression was increased, whereas soluble CD23 secreted into the medium was increased. CD23 is a B lymphocyte activation antigen (Hurley and Thorley-Lawson, 1988) that is expressed at high levels on EBV-immortalized B lymphocytes (Kintner and Sugden 1981; Thorley-Lawson et al., 1985). The soluble form of CD23 reportedly functions as an autocrine B lymphocyte growth factor (Swendeman and Thorley-Lawson, 1987; for review see Gordon, 1989). A study suggested a connection between EBNA2 and expression of the latent membrane protein of EBV (Murray et al., 198813).It was found that infection of EBV-negative BL cells with P3HR-1 virus (which lacks coding regions for EBNAQand part of EBNA4) resulted in failure to express LMP, whereas LMP was expressed in BL cells infected with B95-8 virus (which expresses EBNA2). Further work (Abbot et al., 1990) with P3HR-l-infected BL lines (BL30 and BL41) has shown that stable transfectants expressing EBNA2 show induced expression of LMP from the endogenous virus. Expression of full-length EBNA4 (EBNA-LP) by transfection into PSHR-l-infected BL cells was found not to induce LMP expression. The ability of EBNA2 to transactivate the LMP promoter in the absence of any other viral genes was demonstrated by cotransfection studies using EBV-negative B cell lines and CAT constructs (i.e., the chloramphenicol acetyltransferase reporter gene) (Wang et al., 1990a). Interestingly, EBNA2B was more effective than EBNA2A in this regard, whereas EBNA2A has been shown to have a more potent up-regulatory effect on CD21 and CD23 (Wang et al., 1990b) and a stronger growth phenotype (Rickinson et al., 1987; Cohen et al., 1989) than EBNA2B. These findings suggest an EBNA2 function outside its role as a transactivator of LMP (Wang et al., 1990a). Internally deleted EBNA2 mutant genes that fail to transactivate LMP also fail to transform B lymphocytes
EBV IN B LYMPHOCYTES
7
when incorporated into recombinant P3HR-1 virus (Cohen et al., 1989; Wang et al., 1990a). These data are consistent with the hypothesis that transactivation of the LMP gene is necessary for the transforming phenotype of EBNAP. One study obtained results inconsistent with the above results (Cordier et al., 1990) in finding LMP expression absent in BL4 1 transfectants stably expressing EBNA2 and containing P3HR-1 virus. Also, the unexplained LMP expression in P3HR-1 cells (African BL cells bearing the same name as the resident viral strain) may reflect an unknown viral or cellular change. In addition to transactivation of LMP, EBNA2 appears to transactivate the promoters of the viral terminal proteins in cotransfection studies using CAT constructs (Zimber-Strobl et al., 1991). Nuclear run-on experiments will be needed to demonstrate conclusively transcriptional up-regulation of the LMP and T P genes by EBNAP. EBNAP is not known to bind DNA generally, and its trans-activating properties are likely to be mediated by effects on cellular proteins. Recently, an EBNA2- responsive enhancer has been described upstream of Cp, a promoter for the EBNA genes (Sung et al., 1991; Woisetschlaeger et al., 1991).The significance of this enhancer during the initial stages of viral infection of primary B lymphocytes is discussed later. EBNASA, EBNA3B, and EBNA3C compose a family of proteins with adjacent coding regions (in BamHI E) and low-level sequence homology to each other (Hennessy et al., 1985, 1986; Joab et al., 1987). Each is encoded in closely spaced small and large exons. Expression of EBNA3C in BALB/c 3T3 cells produced no change in cell morphology, contact inhibition, or serum dependence (Petti et al., 1988),while expression in the Louckes B lymphoma line induced CD21 expression (Wang et al., 1990b). EBNA4 is a repetitive polypeptide encoded by varying numbers of repeated exons (called W1 and W2, which are transcribed from the multiple BamHI W fragments of the viral major internal repeat) and two C-terminal exons (called Y1 and Y2, which are transcribed from the BamHI Y genomic fragment to the right of the major internal repeat) (Sample et al., 1986; Speck et al., 1986; Finke et al., 1987). EBNA4 has a DNA-binding property in vztro that is reportedly lost in the P3HR-1 variant protein, which lacks the C-terminal45 amino acids (Sauter et al., 1988). Expression of an EBNA4 protein with two repeats and an intact C-terminal portion is insufficient to restore the immortalizing function of the P3HR-1 viral strain, but may contribute to the rate of B lymphocyte growth (Hammerschmidt and Sugden, 1989).
8
ROBERT P. ROGERS ET AL.
B. MEMBRANEPROTEINS Based on an analysis of its predicted hydropathicity, the latent membrane protein LMP was predicted to have six membrane-spanning regions, its N and C termini being cytoplasmic (Fennewald et al., 1984). This type of structure has been noted in membrane proteins with ion transport and signal-transducing functions, though no such function has been demonstrated for LMP (discussed in Sugden, 1989; Knutson and Sugden, 1989). LMP is phosphorylated (Baichwal and Sugden, 1987) and has a shorter form expressed from a late lytic cycle promoter located in an intron sequence of the transcript of the full-length “latent form” of LMP (Hudson et al., 1985a).Expression of LMP in Rat-1 cells, a partially transformed fibroblast line, causes tumorigenicity in nude mice (Wang et al., 1985). Studies describing phenotypic changes in transfected EBVnegative BL cells expressing LMP have shown increased cell surface expression of transferrin receptor and CD23 (D. Wang et al., 1988; F. Wang et al., 1990b).An increase in cell clumping (homotypicadhesion) was related to an LMP-mediated rise in cell surface expression of LFA- 1 and ICAM-1 adhesion molecules (D. Wang et al., 1988; F. Wang et al., 1990b). The LFA-3 cell surface adhesion protein involved in heterotypic immune cell recognition was also up-regulated by LMP (D. Wang et al., 1988; F. Wang et al., 1990b). Intracellular calcium levels were reportedly higher in LMP-transfected cells (Wang et al., 1988).The naturally occurring short form of LMP (lacking the amino terminus and first four transmembrane domains) was only expressed at low levels in transfected cells, obscuring interpretation of associated changes (or lack of changes) in cell phenotype (Wang et al., 1988). (Cooperativity of LMP with EBNA2 in the up-regulation of CD23 was mentioned previously.) cDNA sequences and RNA blots indicate that the joined termini of the episomal EBV genome serve as a template for two highly spliced messages potentially encoding two membrane proteins (called the terminal proteins), the shorter of which (TP2; also called LMP2B) is composed of the C-terminal portion of the longer one (TP1; also called LMP2A) (Laux et al., 1988; Sample et al., 1989). Both proteins have now been detected in several laboratories (Longnecker and Kieff, 1990;Rowe et al., 1990; Frech et al., 1990; Hudson et al., 1985b).TP1 and TP2 have been found in LCLs by immunoblot using specific serum generated with and affinity purified against a T P l fusion protein (Longnecker and Kieff, 1990). Immunofluorescence using this serum was positive in almost all cells of EBVinfected cell lines tested, and some of the staining indicated colocalization of TPl with LMP on the cell periphery (Longnecker and Kieff, 1990). The functions of TPl and TP2 are not yet known.
EBV IN B LYMPHOCYTES
9
The BHRFl protein (EA-R, or restricted early antigen) is readily demonstrated in lytically infected cells, but has not been shown in tightly latent cell lines (Pearson et al., 1987), where expression may be too low to detect with current reagents. However, transcriptional studies, discussed in Section III,B, suggest a role for BHRFl during latency. BHRFl was suggested to encode a membrane protein based on predicted hydropathicity (Pfitzner et al., 1987), which includes a stretch of 21 hydrophobic amino acids near the carboxy terminus. One immunofluorescence study suggested intraluminal or membrane-bound protein localization in the trans-reticular Golgi network (Hardwick et al., 1988). Deletion of the hydrophobic carboxy terminus altered the immunofluorescent pattern to suggest relocalization to the extramembranous cytoplasm (Hardwick et al., 1988). Homologies of the predicted BHRFl protein to polyoma middle T antigen (Pearson et al., 1987) and the oncogene bcl-2 (Cleary et al., 1986; Tsujimoto, 1989; Nunez et al., 1989; Haldar et al., 1989), associated with chromosomal breakpoints in human follicular cell lymphomas, suggest that the BHRFl gene is a potential B lymphocyte-transforming gene. A recent study provides new evidence to support a role for the BHRFl protein in latently infected cells (Kocache and Pearson, 1990). Following release from serum starvation, protein expression, measured on immunoblots of the PSHR-1 BL line, was increased in G, of two successive cycles of cell division. Coincident with peaks in protein expression, antigen-positive cells increased to 100% by immunofluorescence using a previously characterized monoclonal antibody. Controls showed no concurrent induction of two other early viral proteins. Thus, BHRFl protein expression was found to be compatible with cell survival and associated with cells not undergoing the replicative cycle. Similar results were found in other cell lines, including B95-8, but not in cell lines that could not be activated to virus production (Namalwa, EBVconverted Ramos, and IB4). Perhaps BHRFl antigen levels are below the level of detection by current reagents in these latter cell lines. C. EBERS Two small polymerase 111 transcripts (EBERS) compose the most abundant viral RNA species of the latent cycle (for reviews see Kieff et al., 1985; Knutson and Sugden, 1989). Complexed to cellular La antigens, these nonpolyadenylated RNAs have no known function in EBV biology, but are homologous to and complement the function of the adenovirus VAI RNA that is necessary for efficient translation of adenovirus messages at late times after infection (Bhat and Thimmappaya,
10
ROBERT P. ROGERS E T AL.
1985). Recently, recombinant virus from which the EBER genes were deleted was found to be indistinguishable from wildtype virus in the abilities to establish latent infection, transform B lymphocytes, and lytically produce new virus (Swaminathan et al., 1991). 111. Structure of Viral Transcripts and Promoters for the EBV Latent Genes
A. TRANSCRIPTION OF THE EBNA GENES Initially, a component of the Epstein-Barr nuclear antigen complex was mapped to the BumHI K viral genomic fragment when its transfection into mouse LTK - fibroblasts induced a nuclear antigen detected by immunofluorescence with EBV-positive sera (Summers et al., 1982). At the time, it was thought that the promoter for this viral antigen, called EBNAl, was located on the 5-kb BamHI K fragment, because EBNAl was expressed without the specific placement of a eukaryotic promoter on the vector used for transfection. Subsequently, however, it was shown by cDNA analysis that the promoter for EBNAl was located more than 70 kb upstream of the coding region (Speck and Strominger, 1985) (Fig. 1). T h e cDNA clone JYK2 (Speck and Strominger, 1985) provided the first example of the long-range and complex splicing characteristic of transcripts that code for members of the EBNA family. JYK2 is composed of seven exons from the BamHI W, Y, U, E, and K fragments, the last of these bearing the EBNAl coding region, BKRF1. [The open reading frame (ORF) nomenclature is based on the BamHI viral genomic fragments; BKRFl designates “BamHI K right frame one,” meaning the first (leftmost) ORF starting in BamHI K and transcribed in a rightward direction (Baer et al., 1984).] Three other ORFs, including the 3’ portion of the EBNA4 ORF, are located on J Y K P upstream of the EBNA 1 ORF, making the corresponding message potentially polycistronic (capable of being translated into multiple proteins). T h e incomplete 5’ end of the clone prevented identification of the promoter. Two promoters for the EBNA-coding transcripts have since been discovered (Speck et al., 1986; Sample et al., 1986; Bodescot et al., 1986, 1987), one (Wp) in the BamHI W fragment and one (Cp) farther upstream (leftward on the standard genomic map) in the U1 (unique) portion of the BamHI C fragment (Fig. 1). Usage of these promoters has been found by S1 nuclease analysis to be mutually exclusive in different B lymphocyte lines (Woisetschlaeger et al., 1989), although the factors that govern promoter usage are not yet fully understood. Some regulatory elements of these two promoters have been defined. An EBNA 1-
11
EBV I N B LYMPHOCYTES
EBNA mRNAs
TP
c1 c2
C
wow1 w2
w1 w2
*
w1w2
WP
W
FIG. 1 . Diagrammed is the organization of transcriptional units utilized by the latent virus in immortalized B lymphocytes. The BamHI genomic fragments A, Nhet, h, C, and W are shown eniarged above the schematic drawing of the circularized genome. Promoters (bent arrows) are indicated for genes encoding latent membrane protein (LMP), terminal proteins (TP) 1 and 2, and the nuclear antigens (EBNAs); TR, terminal repeat; onP, latent origin of replication; Wp and Cp, promoters; C1, C2, WO, W1, and W2 are exons.
dependent enhancer in oriP has been shown to up-regulate transcription from Cp (Sugden and Warren, 1989; Woisetschlaeger et al., 1989). A glucocorticoid response element located some 850 bp upstream of Cp is also capable of up-regulating Cp-driven gene expression (Kupfer and Summers, 1990). An enhancer within about 500 bp upstream of Wp has activity in lymphoid DG75 cells but not in epithelial HeLa cells (Ricksten et al., 1988). Whether all of the EBNAs can be expressed from one or the other of these promoters in a given cell line is not yet known, and the utilization of additional promoter(s) for EBNA expression remains a possibility. Some latent viral gene expression in BL biopsies is now known to differ from that in most cultured BL lines (M. Rowe et al., 1987; D. T. Rowe et al., 1986). Thus, biopsy material is the most relevant source of viral RNA for study, both by S1 nuclease protection experiments and cDNA cloning, regarding differential promoter usage in BLs. Several observations suggest the utilization of at least one additional promoter: (1) neither Cp nor Wp appears to be utilized in the Raji cell line
12
ROBERT P. ROGERS E T A L .
(Woisetschlaeger et at., 1989) and (2) in type I BL cell lines, e.g., Rael (see below), only EBNAl is expressed. Rael utilizes neither Cp nor Wp, but on induction with azacytidine (Masucci et al., 1989a), Wp and Cp are sequentially activated (M. Woisetschlaeger et al., unpublished observations). Moreover, the mRNA encoding the EBNAl message in the type I BLs Rael and Akata is distinctly smaller than that found in EBV-transformed lymphoblastoid cell lines (A. B. Rickinson, unpublished observations; B. Schaeffer et al., unpublished observations), suggesting either the utilization of a different promoter or a novel splicing mechanism. T h e absence of cross-hybridization of this EBNAl transcript to a probe containing W1 and W2 exons indicates a distinctly different message structure than the EBNA transcript present in LCLs (B. Schaeffer et al., unpublished observations). T h e JYK2 cDNA clone remains the only characterized cDNA representative of highly spliced EBNA transcripts from the JY LCL. Because S1 nuclease data have shown Cp to be active in JY, it is possible but not proved that the EBNAl message in JY cells is transcribed from this promoter. The location of Cp was tentatively identified by the 5’ boundary of the C1 exon found on EBNA-encoding cDNAs from the B95-8 marmoset cell line (Bodescot et al., 1986; Bodescot and Perricaudet, 1986), and then confirmed by S1 nuclease mapping and primer extension (Bodescot et al., 1987). Transcripts for EBNAl, EBNASA, and EBNA3C have been linked to this promoter by cDNA evidence (Bodescot et al., 1986; Bodescot and Perricaudet, 1986) from B95-8 cells. Structures of the EBV latent transcripts have been recently reviewed (Speck and Strominger, 1989) Fig. 2A). Additional characterization of the EBNAS family of transcripts has come from cDNA work on an LCL that demonstrated an alternative C2 exon splice donor site (Sawada et al., 1989). T h e structure of the EBNASB transcript has been recently clarified by the demonstration of the splice joining BERF2a and BERF2b (Kerdiles et al., 1990). In the IB4 LCL, EBNA cDNAs have been identified with 5‘ boundaries mapping about 25 bp downstream of a consensus eukaryotic promoter in the BamHI W fragment (the “W promoter,” Wp) (Speck et al., 1986; Sample et al., 1986). Transcripts for EBNA2 and EBNA4 have been linked to this promoter by cDNA evidence. T h e EBNA4 ORF relies on a particular splice junction to generate its AUG translation initiation codon (the only translation initiation codon in the entire EBNA4 gene) (Sample et al., 1986; Speck et al., 1986), which has been observed in cDNAs in conjunction with the 5‘ terminal WO exon, which is characteristic of Wp usage (see Fig. 2). T h e C2 exon, characteristic of Cp usage, is also capable of generating the EBNA4 start codon by utilization of
13
EBV IN B LYMPHOCYTES
A Genomic DNA
14,360
WO EXON Genomic DNA GGTCCTGCAGCTA~CTGGTCGCA~CAGAGGCCCAGGAGTCCACAC14,407 IB4-WY1 TCAGAGGCCCAGGAGTCCACAC GGAGTCCACAC IB4-W2.16 Genomic DNA AAATGTAAGAGGGGGTCI-~CTACCTCTCCCTAGCCCTCCGCCCCCTC 14,454 AAATIB4-WY1 AAAT IB4-W2.16 Genomic DNA CAAGGACTCGGGCCCAGlTCTAAC‘TmCCCCCI-rCCCTCCCTCGTCT 14,502 Genomic DNA TGCCCTGCGCCCGGGGCCACCTTCATCATCACCGTCGCTGACTCCGCCA 14,548
W1 EXON Genomic DNA IB4-WY1 IB4W2.16
TCCAA~CCTA~GGGAGACCGAAGTGAAGGCCCTGGACC ... -GGGAGACCGAAGTGAAGGCCCTGGACC...
CCTAGGGGAGACCGAAGTGAAGGCCCTGGACC.. .
FIG. 2. (A) Aligned sequences of two cDNAs (IB4-WY1 and IB4-W2.16) corresponding to alternatively spliced RNAs are shown in comparison to genomic sequence from BamHI W. One splice acceptor site (open box) yields a translation initiation codon (AT + G) for the EBNA4 gene, while the other (closed box) does not. The CAAT and TATA promoter elements of Wp are boxed. (B) Alternative splicing to the W 1‘ exon (generating the translation initiation codon for EBNA4) or the W1 exon (failing to generate the EBNA4 translation initiation codon). Cp and Wp are used in a mutually exclusive fashion in different cell lines, and are sequentially activated as described in the text.
known splice donors and acceptors. Although this event has yet to be documented by cDNA evidence, its occurrence in total cellular poly(A) RNAs has been demonstrated by S1 nuclease data (Rogers et al., 1990). EBNA4 has also been called “leader protein” (LP), because its ORF occurs upstream of the ORF for EBNA2 on some characterized cDNAs (Sample et al., 1986). Although many cDNAs whose 3’ exons encode EBNAs 1, 3A, or 3C have EBNA4 coding sequences at their 5‘ ends, these cDNAs either lack the necessary splice-generated ATG start codon +
14
ROBERT P. ROGERS ET AL.
for EBNA4 or have incomplete 5' ends, which preclude positive statements about the translatability of EBNA4 from the corresponding messages. An important mechanism for ensuring translation of all the genes in this transcriptional unit appears to be alternative splicing, yielding either an EBNA4 AUG-containing message (from which the downstream ORFs are most likely not e5ciently translated) or a message lacking this initiation codon (which presumably facilitates the e5cient translation of EBNAs 1, 2, 3A, 3B, and 3C encoded downstream) (Rogers et al., 1990) (Fig. 2B). Analysis of Cp and Wp usage in a large panel of LCL and BL cell lines indicated that the majority of cell lines appeared to use Cp. Furthermore, when an exogenous reporter construct containing both promoters was transfected into either Cp- or Wp-utilizing cell lines, the exogenous Cp was preferentially used in all cases (Woisetschlaeger et al., 1900).This demonstrated that the transcription factors necessary to drive Cp are present in Wp-utilizing cell lines, and suggests that the lack of endogenous Cp activity in these cell lines may be the result of mutation(s) of Cp. Indeed, an analysis of the viral genomes present in two Wp-utilizing cell lines showed that they contain relatively large deletions spanning Cp. A role for Wp during the initial stage of viral infection of B lymphocytes was revealed in time course studies in which Wp, but not Cp, was utilized during the first 48-72 hr postinfection, followed by a dramatic rise in Cp activity (Woisetschlaeger et al., 1990). Thus, the role of Wp may be to initiate viral transcription upon infection of quiescent B lymphocytes, followed by a switch to Cp activity. The mechanism and consequences of EBNA gene expression driven from Cp as opposed to Wp are not fully clear, although splicing patterns may vary with promoter usage, thus altering the pattern of EBNA expression. The discovery of an EBNA2-responsive enhancer upstream of Cp (Sung et al., 1991; Woisetschlaeger et al., 1991)has led to speculation on a role for EBNA2 in a switch from Wp to Cp usage after the first few days of infection of primary B lymphocytes. It appears that both an enhancer and suppressor of transcription map to a region from -429 to -245 bp upstream of Cp (Woisetschlaegeret al., 1991). Transcription in the IB4 LCL has been reexamined by nuclear run-on (Sample and Kieff, 1990), demonstrating an absence of transcription upstream of Wp, which is consistent with our findings of the exclusive use of Wp (Woisetschlaeger et al., 1989) and the deletion of Cp (Woisetschlaeger et al., 1990) in this cell line. Low-level transcription to the right of the EBNAl polyadenylation signal (Sample and Kieff, 1990) in the IB4 cell line is intriguing because no latent gene product is known to arise from this region of the genome.
EBV I N B LYMPHOCYTES
15
A curious aspect of EBV transcription is the great abundance of partially spliced heteronuclear transcripts. One study (van Santen et d., 1981) demonstrated large (up to 22 kb), nuclear, polyadenylated rightward transcripts hybridizing to the BamHI W, Y , and H viral genomic fragments in the IB4 cell line. These transcripts are thought to be precursors of mRNAs that express the EBNAs and possibly the BHRFl protein. Interestingly, a recent study has employed high-resolution in sztu hybridization to demonstrate the presence of highly focused tracklike aggregates of RNAs hybridizing to the BamHI W fragment in the nucleus of the latently infected Namalwa BL line (Lawrenceet al., 1989). Whether this tracklike formation will prove to be a general phenomenon or one restricted to (or readily observable in) cases of long primary transcripts is unknown. Another study (Weigel and Miller, 1983)demonstrated large 12-O-tetradecanoyl phorbol- 13-acetate (TPA)-inducible RNA species hybridizing with the BamHI W fragment in P3HR-1 cells, although the direction of transcription was not investigated. A study of the P3HR-1 subclone, clone 13, has shown that rightward transcription of BamHI W is TPA inducible and unaffected by phosphonoacetic acid (PAA; an inhibitor of the viral DNA polymerase and late lytic viral gene expression) (Rogers and Speck, 1990). Leftward transcription of this region was also observed in B95-8 cells and was found to be TPA inducible and PAA inhibitable, consistent with late lytic gene function. The origin, structure, and function of the leftward transcripts (up to 15 kb in length), which are found in both nucleus and cytoplasm, are unknown. B. TRANSCRIPTION OF VIRALMEMBRANE PROTEINS In contrast to the EBNA genes, the gene encoding the viral latent membrane protein (LMP or LMP1) is transcribed in the leftward direction and has a relatively simple splicing pattern (van Santen et al., 1981; Fennewald et al., 1984; Hudson et al., 1985a) (see Fig. 1). Three closely spaced exons from the BamHI Nhet fragment compose the mature 2.8kb mRNA, which is the most abundant viral mRNA in latently infected cells. Initial studies (Ghosh and Kieff, 1990) with the LMP promoter of latency linked to the CAT gene showed higher reporter enzyme activity in B cells bearing the B95-8 virus as opposed to the P3HR-1 virus. EBNA2 expression from the B95-8 virus appears to mediate this phenomenon (see previous discussion of EBNA2). An EBNAP responsive element was mapped within the -512 to +40 region relative to the mRNA cap site (Wang et al., 1990a). Other workers have shown that EBNA2 overcomes the effect of a &-acting negative regulatory sequence distal to 54 bp upstream of the mRNA cap site, while having no effect on
16
ROBERT P. ROGERS E T AL.
a &-acting positive regulatory sequence proximal to -54 bp in transfected BL cells (Fahraeus et al., 1990b).The region of -634 to -54 acted as an EBNA2-inducible enhancer. Group I BL cell lines, which lack EBNA2 and LMP, also lack the LMP mRNA (Rowe et al., 1987) (see discussion below), implying control of LMP at the level of mRNA transcription. Transcripts for the terminal protein genes were noted as two rightwardly transcribed mRNAs near 2 kb in size in B95-8 cells hybridizing to portions of the unique short (US) region of the viral genome (Hudson et al., 1985b) (see Fig. 1). A cDNA clone encoding TPl revealed nine exons encompassing a protein-coding region that spanned the joined terminal repeats of the circularized genome (Laux et al., 1988). The TP1 promoter was mapped by S1 nuclease studies and inspection of the genomic sequence, which revealed promoter elements and an absence of splice acceptor sites near the projected cap site (Laux et al., 1988). A cDNA for TP2 was shown to have a different 5' exon than the TPl gene, whereas the remaining exons were identical to those of the TPl gene (Sample et al., 1989).Because the first exon of the TP1, but not the TP2, gene has a coding sequence, the corresponding proteins were expected to differ in the presence or absence of hydrophilic amino-terminal domain (Sample et al., 1989). The location of the TP2 promoter was postulated by relating the sizes of the cDNA and the mRNA and by genomic inspection, which showed promoter-like elements and an absence of splice acceptor sites near the projected cap site (Sample et al., 1989). The proximity (within 200 bp) of the promoter elements of the TP2 and LMP genes has led to speculation that they may share regulatory elements (Sample et al., 1989). Recent data support the idea that one of the TP promoters is upregulated by EBNA2 (G. W. Bornkamm, personal communication),similar to the LMP gene. It is of interest to note that the primary transcript of TP1, but not TP2, is complementary to the entire LMP transcript. As discussed above, a role for the BHRFl membrane protein in latency is unproved. However, blots of poly(A)+ RNA from the tightly latent IB4 cell line yield signals with BHRFl probes (Austin et al., 1988). In addition, some cDNAs containing BHRFl show exon structures characteristic of transcripts encoding the EBNAs; i.e., cDNAs from the IB4 LCL (having little viral productive activity) and the B95-8 LCL (having high producer activity) have W1 and W2 exons (see below) (Austin et al., 1988; Bodescot and Perricaudet, 1986; Pearson et al., 1987). One of the B95-8 cDNAs has the C1 exon at its 5' end. BHRFl is also found on messages that are up-regulated in the lytic cycle and transcribed from the bidirectional promoter in BamHI H (Hardwick et al., 1988; Pearson et al., 1987; Austin et al., 1988; Pfitzner et al., 1987), consistent with gene function in the lytic cycle.
EBV I N B LYMPHOCYTES
17
RNA polymerase I1 and 111 elements for the promoter of the small nonpolyadenylated viral RNAs (EBERs)have been described (Howe and Shu, 1989),but discussion of these genes, whose functions are unknown, is beyond the scope of this review.
IV. Perspective on Viral Gene Expression in the LCL Model Although much progress has been made toward understanding EBV gene expression in LCLs, far less is known of the situation in healthy seropositive individuals, in which EBV-carrying cells in the peripheral blood are estimated at a frequency of to lo-’ among mononuclear leukocytes (Rocchi et al., 1977). This estimate is based on the outgrowth of LCLs from wells seeded with limiting dilutions of donor leukocytes cocultivated with EBV-negative umbilical cord blood leukocytes. This indirect measure is the best available because virus-specific immunofluorescence (nuclear or otherwise) performed on peripheral blood cells is not distinguishable from background, given the low frequency of true positives (Klein et al., 1976). Outgrowth of LCLs as described above occurs largely by a two-step mechanism in which virus shed from an infected cell infects and immortalizes adjacent B lymphocytes in vitro (Lewin et al., 1987; Rickinson et al., 1977). The two-step mechanism has been demonstrated by a reduction in the frequency of LCL outgrowth in the presence of virus-neutralizing antibody, and by demonstrating that cocultivation of EBV-negative donor leukocytes with leukocytes from seropositive donors often yields EBNA-positive LCLs composed of cells from the EBV-negative donor, as determined by sex chromosome typing. Demonstration of a one-step mechanism of LCL generation by direct outgrowth (cellular proliferation in vitro) of in vivo-infected B lymphocytes has been difficult. One study that purports to document one-step outgrowth in the presence of virus-neutralizing antibody and phosphonoformate (an inhibitor of viral replication) also provides evidence of cell-to-cell spread of virus under these conditions, making it difficult to positively assign a one-step mechanism to the initiation of outgrowth of the few resultant LCLs (Lewin et al., 1987). The fact that some peripheral blood cells (presumably B lymphocytes) shed virus upon explantation from the healthy seropositive individual raises the question of whether the stimulus for lytic replication arises in vivo or in vitro. After cell separation and washing procedures, explanted leukocytes are typically cultured in artificial medium supplemented with fetal bovine serum in isolation from lymphatic accessory cells, conditions that may well trigger the lytic cycle. Alternatively, triggering of the lytic
18
ROBERT P. ROGERS E T AL.
cycle in a fraction of infected cells in uiuo may be a natural occurrence in healthy seropositives, perhaps concurrently with gene expression typical of the latent cycle in the same cell. It has not been possible to clone EBNA-positive colonies in soft agar from peripheral leukocytes of healthy seropositive individuals (Hinuma and Katsuki, 1978), in which the percentage of EBV-immortalized cells may be too low to detect by this method. Incidental induction of the lytic cycle in uztro by cloning procedures (or induction in vzvo prior to explantation) may impede clonal expansion in soft agar. Alternatively, EBVimmortalized B lymphocytes may simply not exist in the healthy seropositive individual, a possibility raised by the discussion of Klein (Klein, 1989; Masucci et al., 1989b; Gratama et al., 1988),Rickinson (Yao et al., 1989b) and co-workers; this is further discussed below. In contrast to the situation in the healthy seropositive individual, 0.52% of peripheral blood B lymphocytes of acute IM patients are EBNApositive blasts that are demonstrable by immunofluorescence (which does not distinguish the component proteins of EBNA) (Klein et al., 1976). EBNA-positive clones have been readily cultured in soft agar from peripheral blood leukocytes of these patients even in the presence of neutralizing antibody (Hinuma and Katsuki, 1978).Moreover, EBNApositive leukocytes undergoing mitosis have ostensibly been identified soon after isolation from the peripheral blood of these patients (Robinson et al., 1980). The evidence seems to indicate the presence of EBVimmortalized B lymphocytes in the peripheral blood of IM patients, a circumstance that is less certain in the healthy seropositive individual. It has been hypothesized that the EBNA-positive blasts of IM have viral gene expression similar to that of latently infected lymphoblastoid cell lines (Klein, 1989). Now that antisera for specific latent viral gene products (e.g., EBNA components and membrane proteins) are becoming available, it may be possible to reexamine the B blasts of IM. The relative difficulty of undertaking this task in the case of the healthy seropositive individual with extremely low numbers of circulating EBVpositive cells leaves us only with models, one of which (Klein, 1989) is based on immune considerations and the pattern of viral gene expression found in EBV-positive BLs. EBV-positive BL cells lack blast cell morphology and express EBNAl to the exclusion of other viral proteins of EBV latency (Rowe et al., 1987). Upon explantation and passage of EBV-positive BL cells, a wider array of viral latency proteins (including EBNAP and LMP) is usually expressed, and a lymphoblastoid cell morphology often emerges together with homotypic cell clumping and cell surface antigen expression characteristic of LCLs (Rowe et d.,1987; Gregory et d., 1990). Less com-
EBV IN B LYMPHOCYTES
19
monly, a BL cell line will retain its exclusive expression of EBNAl and characteristic cellular antigens during prolonged passage, a phenotype designated “group I” (M. Rowe et al., 1987; D. T. Rowe et al., 1986). Interestingly, such a BL line can be induced to up-regulate expression of LMP and EBNAs 2,3A, 3B, and 3C by treatment with the demethylating agent 5-azacytidine (Masucci et al., 1989a). The capacity for an alternative viral latent state with exclusive expression of EBNAl may be advantageous in uzuo, because EBNA2 and LMP are known to be strong antigenic stimulators of the cytotoxic T lymphocyte response (Murray et al., 1988a; Moss et al., 1988; Thorley-Lawson and Israelsohn, 1987). EBNAl is the only viral gene product needed to maintain the episomal viral genome (by binding to and activating the latency origin of replication), and is thus the minimal essential requirement for maintenance of the viral genomes as an episome in proliferating cells. EBNAl has no known cellular transforming function except perhaps an adjunctive one in which it activates the enhancer at oriP, which can help drive expression of EBNA2, a known transforming gene (Sugden and Warren, 1989).The deregulated myc gene characteristic of BL, and perhaps other unknown changes in cellular gene expression, may make the immortalizing function of EBV unnecessary at some point during tumor evolution, though the EBV growth-transforming properties may be necessary during early tumorigenesis (discussed in Rowe and Gregory, 1989). Some workers have suggested that an oncogenic function will eventually be found for EBNAl (Rowe and Gregory, 1989), giving the virus an active role in the maintenance of BL. BL cells are known to evade the EBV-specific cytotoxic T lymphocyte response that is capable of killing autologous LCLs (Rooney et al., 1985). Thus, EBV-specific cytotoxic T lymphocytes from a BL patient will kill LCLs grown spontaneously from the patient’s peripheral blood, but will not kill tumor cells in viuo or in early passage in uitro. Several mechanisms have been suggested to explain this escape from immune surveillance. The first, mentioned above, is the narrowing of viral antigen expression, particularly the down-regulation of EBNA2 and LMP, antigens capable of eliciting a cytotoxic T lymphocyte response. When a fuller array of viral latent antigens is expressed upon BL cell explantation and passage, susceptibility to cytotoxic T lymphocyte killing can increase (Gregory et al., 1988). In one case in which full viral latent antigen expression appeared without increased susceptibility to cytotoxic T lymphocytes, the intercellular adhesion molecule LFA-3 was found to be down-regulated (Gregory et al., 1988; Rowe et al., 1986).The down-regulation correlated with a reduction of immune cell/target cell adhesion capability. Preliminary studies by the same authors have shown undetectable levels of
20
ROBERT P. ROGERS E T AL.
LFA-3 and ICAM-1, and reduced levels of LFA-1, on BL biopsies, suggesting the possibility of a general mechanism of immune surveillance evasion. Another examination of BL biopsies found LFA-1 levels to be undetectable on the majority of specimens (Clayberger et al., 1987).Low expression of LFA-1 (Patarroyo et al., 1988; Billaud et al., 1990) and LFA-3 (Billaud et al., 1990) has been reported in early passages of some EBV-negative as well as EBV-positive BL cell lines, suggesting a mechanism independent of viral gene expression or tumor cell phenotype selection by an anti-EBV immune response. The relative importance of intercellular adhesion molecule downregulation and narrowed latent viral antigen expression in tumor survival deserves further study. In EBV-positive BL, the absence of LMP expression eliminates not only a source of viral antigen for presentation by HLA class I molecules, but also eliminates the possibility of LMPmediated induction of LFA- 1, LFA-3, and ICAM-1, further reducing the possibility of immune recognition (Wang et al., 1988). An earlier study showed that BL cells down-regulate class I HLA molecules, which might otherwise be expected to mediate antiviral cellular immune responses (Masucci et al., 1987). Down-regulation was demonstrated for a single allele at one locus (HLA-A1l),whereas overall HLA expression remained high on the same cells (compared to autologous LCLs). The fact that at least some EBV-negative BL lines have a down-regulated HLA-A11 phenotype suggests that this phenotype is not related to viral infection (Masucci et al., 1987). The importance of this mechanism for BL cell survival in the host has yet to be determined (for review see Wallace and Murray, 1989). The apparent triggering of the cellular immune response by antigenic stimulus provided by EBNAP and LMP leads one to ask how circulating EBV-infected cells survive in the primed, immunocompetent host. A possible survival strategy suggested by the BL model is restricted latent viral gene expression (Klein, 1989; Yao et al., 1989b). The postulated exclusive expression of EBNA 1 in circulating nonmalignant B lymphocytes implies a lack of need for EBV-induced B lymphocyte proliferation for the survival of the virus over the host organism’s life span. Thus, B lymphocytes exclusively expressing EBNAl could serve as a permanent reservoir of virus over the lifetime of the host, responding to host-directed mitotic stimuli, perhaps in germinal centers of lymph nodes. One could hypothesize that, with appropriate stimulation, occasional infected B lymphocytes might trigger the resident virus to progress to an LcLlike or even lytic pattern of viral gene expression, in which cases cytotoxic T lymphocyte recognition would lead to cell elimination. The efficacy of this process would rely on the current competen-
EBV IN B LYMPHOCYTES
21
cy of the host immune system. The immortalizing capacity of EBV may only be of use in viral biology during initial infection of the host, occurring as IM or an asymptomatic event, when expansion of the numbers (and perhaps kinds) of virus-infected cells is critical. The life-long cellular reservoir of virus in the host organism is uncertain, as is the fundamental question of whether horizontal cell-to-cell spread of the virus occurs on an ongoing basis in the immunocompetent host. Continual or intermittent reinfection of the B cell compartment from an epithelial viral reservoir in healthy carriers is unlikely because month-long acyclovir therapy can eliminate oropharyngeal virus shedding (presumably an epithelial activity) without impacting the numbers of infected circulating B cells (Yao et al., 1989a,b). Resumption of oropharyngeal virus shedding on cessation of acyclovir therapy could results from reinfection of epithelial cells from the B cell compartment, o r reactivation of replicative viral activity from latently infected epithelial cells. Other work has shown the complete disappearance of virus or its replacement with a donor virus strain in bone marrow transplant recipients (Gratama et al., 1988). Eradication from both peripheral blood and the oropharynx was demonstrated. Although the combined anticellular therapies used on these patients can affect both hematopoietic and epithelial cells, the investigators assert that the hematopoietic cells were most drastically affected and constitute the permanent reservoir of virus. Additional data on oropharyngeal shedding, including strain typing, would be most interesting in patients receiving virus-positive marrow transplants. This would presumably address the possibility of virus transfer from hematopoietic to epithelial cells, albeit in an atypical immune environment. To conclude, the discovery that EBV in BL tumors expresses only EBNAl clearly limits the applicability of the LCL model to other situations. RNA from BL biopsy material, which received attention over a decade ago (Dambaugh et al., 1979), and from group I BL cell lines must clearly be a focus of study. Information from such studies, particularly the structure of EBNA 1-expressing transcripts, could aid polymerase chain reaction studies of viral gene expression in peripheral blood B lymphocytes from healthy seropositive individuals, as suggested by Klein (1989).
REFERENCES Abbot, S. D., Rowe, M., Cadwallader, K., Ricksten, A., Gordon, J., Wang, F., Rymo, L., and Rickinson, A. B. (199O).J. Vzrol. 64, 2126-2134. Adldinger, H. K., Delius, H., Freese, U. K., Clarke, J., and Bornkamm, G. W. (1985). Vzrology 141, 121-134.
22
ROBERT P. ROGERS E T AL.
Arrand, J. R., Young, L. S., and Tugwood, J. D. (1989).J. Virol. 63, 983-986. Austin, P. J., Flemington, E., Yandava, C. N., Strominger, J. L., and Speck, S. H. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 3678-3682. Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S., and Barrel], B. G. (1984). Nature (London) 310,207-21 1. Baichwal, V. R., and Sugden, B. (1987).J. Virol. 61, 866-875. Bhat, R. A., and Thimmappaya, B. (1985). J. Virol. 56, 750-756. Billaud, M., Busson, P., Huang, D., Mueller-Lantzsch, N., Rousselet, G., Pavlish, 0.. Wakasugi, H., Seigneurin, J. M., Tursz, T., and Lenoir, G. M. (1989).J. Virol. 63,41214128. Billaud, M., Roussett, F., Calender, A., Cordier, M., Aubry, J.-P., Laisse, V., and Lenoir, G. M. (1990). Blood 75, 1827-1833. Bodescot, M., and Perricaudet, M. (1986). Nucleic Acids Res. 14, 7103-7114. Bodescot, M., Brison, O., and Perricaudet, M. (1986). Nucleic Acids Res. 14, 261 1-2620. Bodescot, M., Perricaudet, M., and Farrell, P. J. (1987).J. Virol. 61, 3424-3430. Busson, P., Ganem, G., Flores, P., Mugneret, F., Clausse, B., Caillou, B., Braham, K., Wakasugi, H., Lipinski, M., and Tursz, T. (1988). Znt. J. Cancer 42, 599-606. Clayberger, C., Wright, A., Medeiros, L. J., Koller, T. D., Link, M. P., Smith, S. D., Warnke, R. A., and Krensky, A. M. (1987). Lamet ii, 533-536. Cleary, M. L., Smith, S. D., and Sklar, J. (1986). Cell 47, 19-28. Cohen, J. I., Wang, F., Mannick, J., and Kieff, E. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 9558-9562. Cooper, N. R., Moore, M. D., and Nemerow, G. R. (1988). Annu. Rev. Zmmunol. 6,85-113. Cordier, M., Calender, A., Billaud, M., Zimber, U., Rousselet, G., Pavlish, O., Banchereau, J., Tursz, T., Bornkamm, G., and Lenoir, G. M. (199O).J. Virol. 64, 1002-1013. Dambaugh, T., Nkrumah, F. K., Biggar, R. J., and Kieff, E. (1979). Cell 16, 313-322. Dambaugh, T., Hennessy, K., Chamnankit, L., and Kieff, E. (1984). Proc. Natl. Acad. Sci. U.S.A. 81, 7632-7636. Dambaugh, T., Wang, F., Hennessy, K., Woodland, E., Rickinson, A. B., and Kieff, E. (1986).J. Virol. 59, 453-462. Dawson, C. W., Rickinson, A. B., and Young, L. S. (1990). Nature (London) 344, 777-780. de The, G. (1982). In “The Herpes Viruses” (B. Roizman, ed.), pp. 25-103. Plenum, New York. Epstein, M. A., and Achong, B. G. (1979a). In “The Epstein-Barr Virus’’ (M. A. Epstein and B. G. Achong, eds.), pp. 321-337. Springer-Verlag, Berlin. Epstein, M. A., and Achong, B. G. (1979b). In “The Epstein-Barr Virus’’ (M. A. Epstein and B. G. Achong, eds.), pp. 1-22. Springer-Verlag, Berlin. Ernberg, I. (1989). Adv. Viral Oncol. 8, 203-214. Fahraeus, R., Fu, H. L., Ernberg, I., Finke, J., Rowe, M., Klein, G., Falk, K., Nilsson, E., Yadav, M., Busson, P., et al. (1988). Znt. J. Cancer 42, 329-338. Fahraeus, R., Rymo, L., Rhim, J. S., and Klein, G. (1990a). Nature(London) 345,447-449. Fahraeus, R., Jansson, A., Ricksten, A., Sjblom, A., and Rymo, L. (1990b). Proc. Natl. Acad. Sci. U.S.A. 87, 7390-7394. Farrell, P. J. (1989). Adv. Viral Oncol. 8, 103-132. Fennewald; S., van Santen, V., and Kieff, E. (1984).J. Virol. 51, 411-419. Fingeroth, J. D., Weis, J. J., Tedder, T. F., Strominger, J. L., Biro, P. A., and Fearon, D. T. (1984). Proc. Natl. Acad. Sci. U.S.A. 81, 4510-4514. Fingeroth, J. D., Clabby, M. L., and Strominger, J. L. (1988).J. Virol. 62, 1442-1447.
EBV IN B LYMPHOCYTES
23
Finke, J., Rowe, M., Kallin, B., Ernberg, I., Rosen, A., Dillner, J., and Klein, G. (1987).J. Virol. 61, 3870-3878. Frech, B., Zimber-Strobl, U., Suentzenich, K.-O., Pavlish, O., Lenoir, G. M., Bornkamm, G. W., and Mueller-Lantzsch, N. (1990).J . Virol. 64, 2759-2767. Gahn, T. A., and Schildkraut, C. L. (1989). Cell 58, 527-535. Gerber, P., Whang-Peng, J., and Monroe, J. (1969). Proc. Natl. A d . Sci. U.S.A. 63, 740747. Ghosh, D., and Kieff, E. (1990). 1. Vzrol. 64, 1855-1858. Gordon, J. (1989). Adv. Viral Oncol. 8, 173-185. Gratama, J. W., Oosterveer, M. A. P., Zwaan, F. E., LePoutre, J., Klein, G., and Ernberg, I. (1988). Proc. Natl. Acud. Sci. U.S.A. 85, 8693-8696. Greenspan, J. S., Greenspan, D., Lennette, E. T., Abrams, D. I., Conant, M. A., Petersen, V., and Freese, U. K. (1985). N . Eng1.J. Med. 313, 1564-1571. Gregory, C. D., Murray, R. J., Edwards, C. F., and Rickinson, A. B. (1988).J. Exp. Med. 167, 1811-1824. Gregory, C . D., Rowe, M., and Rickinson, A. B. (1990).J. Gen. Vzrol. 71, 1481-1495. Haldar, S., Beatty, C., Tsujimoto, Y.,and Croce, C. M. (1989). Nature (London) 342, 195198. Hammerschmidt, W., and Sugden, B. (1989). Nature (London) 340, 393-397. Harada, S., Sakamoto, K., Seeley, J. K., Lindsten, T., Bechtold, T., Yetz, J., Rogers, G., Pearson, G., and Purtilo, D. T. (1982).J . Inanaunol. 129,2532-2535. Hardwick, J. M., Lieberman, P. M., and Hayward, S. D. (1988).J. Virol. 62, 2274-2284. Henle, G., and Henle, W. (1967). Cancer Res. 27, 2422-2446. Henle, G., Henle, W., and Diehl, V. (1968). Proc. Natl. Acud. Scz. U.S.A. 59, 94-101. Hennessy, K., Fennewald, S., and KieE, E. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 59445948. Hennessy, K., Wang, F., Bushman, E. W., and Kieff, E. (1986).Proc. Natl. Acad. Scz. U.S.A. 83,5693-5697. Hinuma, Y., and Katsuki, T. (1978). Int. J . Cancer 21, 426-431. Howe, J. G., and Shu, M. D. (1989). Cell 57, 825-834. Hudson, J. G., Farrell, P. J., and Barrell, B. G. (1985a).J. Virol. 53, 528-535. Hudson, G. S., Bankier, A. T., Satchwell, S. C., and Barrell, B. G. (1985b).Vzrology 147,8198. Hurley, E. A., and Thorley-Lawson, D. A. (1988).J. Exp. Med. 168, 2059-2075. Jeang, D.-T., and Hayward, S. D. (1983).J. Virol. 48, 135-148. Joab, I., Rowe, D. T., Bodescot, M., Nicolas,J. C., Farrell, P. J., and Perricaudet, M. (1987). J . Virol. 61, 3340-3344. Jones, M. D., Foster, L., Sheedy, T., and Griffin, B. E. (1984). E M B O J . 3, 813-821. Kerdiles, B., Walls, D., Triki, H., Perricaudet, M., and Joab, I. (199O).J. Virol. 64, 18121816. Kieff, E., Hennessy, K., Dambaugh, T., Matsuo, T., Fennewald, S., Heller, M., Petti, L., and Hummel, M. (1985). In “Epstein-Barr Virus and Associated Diseases” (P. Levine, G. Pearson, and D. Ablashi, eds.), pp. 22 1-247. Nijhoff, Boston, Massachusetts. Kintner, C., and Sugden, B. (1981). Nature (London) 294,458-460. Klein, G. (1979).In “The Epstein-Barr Virus” (M. A. Epstein and B. G. Achong, eds.), pp. 339-350. Springer-Verlag, Berlin. Klein, G. (1989). Cell 58, 5-8. Klein, G., Svedmyr, E., Jondal, M., and Persson, P. (1976). Znt. J. Cancer 17, 21-26. Knutson, J. C., and Sugden, B. (1989). Adv. Viral Oncol. 8, 151-172.
24
ROBERT P. ROGERS E T AL.
Kocache, M. M., and Pearson, G. R. (1990). Intervirology 31, 1-13. Kupfer, S. R., and Summers, W. C. (199O).J. Virol. 64, 1984-1990. Laux, G., Perricaudet, M., and Farrell, P. J. (1988). EMBO J. 7, 769-774. Lawrence, J. B., Singer, R. H., and Marselle, L.M. (1989). Cell 57,493-502. Lenoir, G. M., and Bornkamm, G. W. (1987). Adu. Viral Oncol. 7 , 173-206. Lewin, N., Aman, P., Masucci, M. G., Klein, E., Klein, G., Oberg, B., Strander, H., Henle, W., and Henle, G. (1987). Int. J. Cancer 39,472-476. Leyvraz, S., Henle, W., Chahinian, A. P., Perlmann, C., Klein, G., Gordon, R. E., Rosenblum, M., and Holland, J. F. (1985). N . Eng1.J. Med. 314, 1296-1299. Longnecker, R., and Kieff, E. (1990).J. Virol. 64, 2319-2326. Masucci, M. G., Torsteindottir, S., Colombani, J., Brautbar, C., Klein, E., and Klein, G. (1987). Proc. Natl. Acad. Sci. U.S.A. 84,4567-4571. Masucci, M. G., Contreras-Salazar, B., Ragnar, E., Falk, K., Minarovits,J., Ernberg, I., and Klein, G. (1989a).J. Virol. 63, 3135-3141. Masucci, M. G., Contreras-Salazar, B., Ragnar, E., Falk, K., Minarovits, J., Ernberg, I., and Klein, G. (1989b).J. Viral. 63, 3135-3141. Miller, G., Niederman, J. C., and Andrews, J.-J. (1973). N . Engl. J. Med. 288, 229-232. Miller, G., Robinson, L., Heston, L., and Lipman, M. (1974).Proc. Nutl. Acad. Sci. U.S.A. 71, 4006-4010. Misko, J. S., Moss, D. J., and Pope, J. H. (1980). Proc. Nutl. Acad. Sci. U.S.A. 77,4247-4250. Morgan, D. G., Niedennan, J. C., Miller, G., Smith, H. W., and Dowaliby, J. M. (1979). Lancet ii, 1154-1157. Moss, D. J., Misko, I. S., Burrows, S. R., Burman, K., McCarthy, R., and Sculley, T. B. (1988). Nature (Lodon) 331, 719-721. Murray, R. J., Wang, D., Young, L. S., Wang, F., Rowe, M., Kieff, E., and Rickinson, A. B. (1988a).J. Virol. 62, 3747-3755. Murray, R. J., Young, L. S., Calender, A., Gregory, C. D., Rowe, M., and Lenoir, G. M. (1988b). J. Virol. 64, 894-90 1. Nemerow, G. R., Siaw, M. F. E., and Cooper, N. R. (1986).J. Virol. 58, 709-712. Nemerow, G. R., Mullen, J. J., 111, Dickson, P. W., and Cooper, N. R. (1990a).J. Viral. 64, 1348-1352. Nemerow, G. R., Moore, M. D., and Cooper, N. R. (1990b). A d a Cancer Res. 54,273-300. Nunez, G., Seto, M., Seremetis, S., Ferrero, D., Grignani, F., Korsmeyer, S. J., and DallaFavera, R. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 4589-4593. Okano, M., Thiele, G. M., Davis, J. R., Grierson, H. L., and Purtilo, D. T. (1988). Clin. Microbial. Reu. 1, 300-312. Patarroyo, M., Prieto, J., Ernberg, I., and Gahmberg, C. G. (1988). Znt.J. Cancer 41,901907. Patton, D. F., Shirley, P., Raab-Traub, N., Resnick, L., and Sixbey, J. W. (199O).J. Vzrol. 64, 397-400. Pearson, G. R., Luka, J., Petti, L., Sample, J., Birkenbach, M., Braun, D., and Kieff, E. (1987). Virology 160, 151-161. Petti, L., Sample, J., Wang, F., and Kieff, E. (1988).J. Virol. 62, 1330-1338. Pfitzner, A. J., Tsai, E. C., Strominger, J. L., and Speck, S. H. (1987).J. Virol. 61, 29022909. Pope, J. H., Horne, M. K., and Scott, W. (1968). Int. J. Cancer 3, 857-866. Raab-Traub, N., Hood, R., Yang, C.-S., Henry, B., and Pagano, J. S. (1983).J . Viral. 48, 580-590. Raab-Traub, N., Flynn, K., Pearson, G., Huang, G., Levine, P., Lanier, A., and Pagano, J. (1987). Int. J. Cancer 39, 25-29.
EBV IN B LYMPHOCYTES
25
Rawlins, D. R., Milman, G., Hayward, S. D, and Hayward, G. S. (1985). Cell 42,659-668. Reisman, D., and Sugden, B. (1986). M o l . Cell. Biol. 6, 3838-3846. Rickinson, A. B. (1984). Nature (London) 310, 99-100. Rickinson, A. B., Finerty, S., and Epstein, M. A. (1977). Int. J. Cancer 19, 775-782. Rickinson, A. B., Wallace, L. E., and Epstein, M. A. (1980). Nature (London) 283,865-867. Rickinson, A. B., Young, L. S., and Rowe, M. (1987).J. Virol. 61, 1310-1317. Ricksten, A,, Olsson, A., Anderson, T., and Rymo, L. (1988). N u c k Aczds Res. 16,83918410. Robinson, J., Smith, D., and Niederman, J. (1980). Nature (London) 287, 334-335. Rocchi, G., Felici, A., Ragona, G., and Heinz, A. (1977). N . Engl. J. Med. 296, 132-134. Rogers, R. P., and Speck, S. H. (1990).J. Virol. 64, 2426-2429. Rogers, R. P., Woisetschlaeger, M., and Speck, S. H. (1990). EMBO J. 9, 2273-2277. Rooney, C. M., Rowe, M., Wallace, L. E., and Rickinson, A. B. (1985). Nature (London) 317, 629-63 1. Rowe, D. T., Rowe, M., Evan, G. I., Wallace, L. E., Farrell, P. J., and Rickinson, A. B. (1986). EMBO J. 5, 2599-2607. Rowe, D. T., Hall, L., Joab, I., and Laux, G. (1990).J. Virol. 64,2866-2875. Rowe, M., and Gregory, C. (1989). Adv. Viral Oncol. 8, 237-259. Rowe, M., Rowe, D. T., Gregory, D., Young, L. S., Farrell, P. J., Rupani, H., and Rickinson, A. B. (1987). EMBOJ. 6, 2743-2751. Rowe, M.,Young, L. S., Cadwallader, K., Petti, L., Kieff, E., and Rickinson, A. B. (1989).J. Vkol. 63, 1031-1039. Sample, J., and Kieff, E. (199O).J. Virol. 64, 1667-1674. Sample, J., Hummel, M., Braun, D., Birkenbach, M., and Kieff, E. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 5096-5100. Sample, J., Liebowitz, D., and Kieff, E. (1989).J. Virol. 63, 933-937. Sauter, M., Boos, H., Hirsch, F., and Mueller-Lantzsch, N. (1988). Virology 166,586-590. Sawada, K., Yamamoto, M., Tabata, T., Smith, M., Tanaka, A., and Nonoyama, M. (1989). Virology 168, 22-30. Sixbey, J. W. (1989). Adv. Viral Oncol. 8, 187-202. Sixbey, J. W., Nedrud, J. G., Raab-Traub, N., Hanes, R. A., and Pagano, J. S. (1984). N . Engl. J. Med. 310, 1225-1230. Sixbey, J. W., Lemon, S. M., and Pagano, J. S. (1986). Lancet ii, 1122- 1124. Sixbey, J. W., Shirley, P., Chesney, P. J., Buntin, D. M., and Resnick, L. (1989). Lancet ii, 761-765. Skare, J., Farley,J., Strominger, J. L., Fresen, K. O., Cho, M. S., and zur Hausen, H. (1985). J. Virol. 55, 286-297. Skare, J. C., Milunsky, A., Byron, K. S., and Sullivan, J. L. (1987). Proc. Natl. Acad. Scz. U.S.A. 84, 2015-2018. Speck, S. H., and Strominger, J. L. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 8305-8309. Speck, S. H., and Strominger, J. L. (1989). Adv. Viral Oncol. 8, 133-150. Speck, S. H., Pfitzner, A. J., and Strominger, J. L. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 9298-9302. Sugden, B. (1989). Cell 57, 5-7. Sugden, B., and Warren, N. (1989).J . Virol. 63, 2644-2649. Sullivan, J. L., Byron, K. S., Brewster, F. E., Baker, S. M., and Ochs, H. D. (1983).J. Clin. Invest. 71, 1765-1778. Summers, W. P., Grogan, E. A., Shedd, D., Robert, M., Liu, C.-R., and Miller, G. (1982). Proc. Natl. Acad. Sci. U.S.A. 79, 5688-5692. Sung, N. S., Kenny, S., Gutsch, D., and Pagano, J. S. (1991).J. Virol. 65, 2164-2169.
26
ROBERT P. ROGERS E T AL.
Swaminathen, S., Tomkinson, B., and Kieff, E. (1991). Proc. Nail. Acad. Sci. U.S.A. 88, 1546-1550. Swendeman, S., and Thorley-Lawson, D. A. (1987). EMBO J. 6, 1637-1642. Sylla, B. S., Wang, Q., Hayoz, D., Lathrop, G. M., and Lenoir, G. M. (1989). Clin. Genet. 36, 459-462. Taub, R., Kirsch, I., Morton, C., Lenoir, G. M., Swan, D., Tronick, S., Aaronson, S., and Leder, P. (1982). Proc. Natl. Acad. Sci. U.S.A. 79, 7837-7841. Thorley-Lawson, D. A,, and Israelsohn, E. S. (1987).Proc. Natl. Acad. Sci. U.S.A. 84,53845388. Thorley-Lawson, D. A., Nadler, L. M., Bahn, A. K., and Schooley, R. T. (1985).J. Zmmunol. 134, 3007-3012. Tsujimoto, Y. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 1958-1962. Urier, G., Buisson, M., Chambard, P., and Sergeant, A. (1989). EMBOJ. 8, 1447-1453. van Santen, V., Cheung, A,, and Kieff, E. (1981). Proc. Natl. Acad. Sci. U.S.A. 78, 19301934. Wallace, L. E., and Murray, R. J. (1989). Adv. Virul Oncol. 8, 219-236. Wang, D., Liebowitz, D., and Kieff, E. (1985). Cell 43, 831-840. Wang, D., Liebowitz, D., Wang, F., Gregory, C. D., Rickinson, A. B., Larson, R., Springer, T., and Kieff, E. (1988).J. Virol. 62, 4173-4184. Wang, F., Gregory, C. D., Rowe, M., Rickinson, A. B., Wang, D., Birkenbach, M., Kikutani, H., Kishimoto, T., and Kieff, E. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 3452-3456. Wang, F., Tsang, S.-F., Kurilla, M. G., Cohen, J. I., and Kieff, E. (1990a).J. Virol. 64,340734 16. Wang, F., Gregory, C., Sample, C., Rowe, M., Liebowitz, D., Murray, R., Rickinson, A., and Kieff, E. (1990b).J. Virol. 64, 2309-2318. Weigel, R., and Miller, G. (1983). Virology 125, 287-298. Woisetschlaeger, M., Strominger, J. L., and Speck, S. H. (1989).Proc. Natl. Acad. Sci. U.S.A. 86,6498-6504. Woisetschlaeger, M., Yandava, C. N., Furmanski, L. A., Strominger, J. L., and Speck, S. H. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 1725-1729. Woisetschlaeger, M., Jin, X. W., Yandava, C. N., Furmanski, L. A., Strominger, J. L., and Speck, S. H. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 3942-3946. Wolf, H., Haus, M., and Wilmes, E. (1984).J. Virol. 51, 795-798. Wyandt, H. E., Grierson, H. L., Sanger, W. G., Skare, J. C., Milunsky, A., and Purtilo, D. T. (1989). Am. J. Med. Genet. 33,426-430. Yao, K., Zhang, H.-Y., Zhu, H.-C., Wang, F.-X., Li, G.-Y., Wen, D.-S., Li, Y.-P., Tsai, C.-H. A., and Glaser, R. (1990). Znt. J. Cancer 45, 83-89. Yao, Q. Y., Rickinson, A. B., and Epstein, M. A. (1985). Znt. J . Cancer 35, 35-42. Yao, Q. Y., Ogan, P., Rowe, M., Wood, M., and Rickinson, A. B. (1989a). Znt. J. Cancer 43, 6 1-66. Yao, Q. Y., Ogan, P., Rowe, M., Wood, M., and Rickinson, A. B. (1989b).Int. J. Cancer 43, 67-7 1 . Yates, J. L., Warren, N., and Sugden, B. (1985). Nature (London) 313, 812-815. Young, L. S., Sixbey, J. W., Clark, D., and Rickinson, A. B. (1986). Lancet i, 240-242. Young, L. S., Dawson, C. W., Brown, K. W., and Rickinson, A. B. (1989). Znt. J. Cancer 43, 786-794. Zimber-Strobl, U., Sventzenich, K.-O., Laux, G., Eick, D., Cordier, M., Calender, A., Billaud, M., Lenoir, G. M., and Bornkamm, G. W. (1991).J. Virol. 65, 415-423.
THE PHYSIOLOGY OF TRANSFORMING GROWTH FACTOR-(.11 Rik Derynck Program of Cell Biology, Departments of Growth and Development and of Anatomy, University of California, San Francisco, San Francisco, California 94143
I.
Introduction
11. TGF-a Is a Member of a Growth Factor Family 111. The Structure of TGF-a and Its Precursor
I v. V. VI. VII. VIII.
Interactions of TGF-a with the EGF/TGF-a Receptor The Transmembrane TGF-a Precursor A Role for TGF-a in the Physiology of Normal Cells TGF-a in Normal Development A Role for TGF-a in Tumor Development? References
1. Introduction Animal cells are normally exposed to a variety of extracellular factors that influence and determine their proliferative behavior. Many of these factors are polypeptides that have been secreted by the target cells themselves or by other cell populations. The polypeptide factors that either stimulate or inhibit cell proliferation are collectively called growth factors. The effects of growth factors on cells depend on a variety of factors, such as the nature of the growth factor, the cell type, and the physiological condition of the responding cell and its environment. In addition, the presence and the nature of other factors, including matrix proteins and other growth factors, profoundly influence the growth modulatory activities, frequently resulting in synergistic or antagonistic effects. Thus, individual factors may stimulate some cell types and inhibit others, depending on the conditions (Sporn and Roberts, 1988). In addition, growth factors often have a variety of activities, only some of which seem to be directly related to their effect on proliferation. Thus a great deal of apparent complexity accompanies the action of growth factors on cells. The effect of these growth factors on responsive cells is of major importance in all processes in which the modification or maintenance of a proliferative state of the cells is affected. It is thus expected that growth factors have profound effects in wound healing, in tissue formation, and in development as well as in formation and maintenance of tumors. We 27 ADVANCES IN CANCER RESEARCH, VOL. 58
Copyright 8 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
28
RIK DERYNCK
currently know of the existence of a largc variety of growth factors for mammalian cells, most of which can be classified in families of structurally related polypeptides. One of these factors is transforming growth factor-a (TGF-a), which is the subject of this review. We discuss here our current knowledge of the role of TGF-a in the proliferation of normal cells and its potential importance in tumor development. II. TGF-a Is a Member of a Growth Factor Family
TGF-a is a member of a small family of structurally related growth factors, of which epidermal growth factor (EGF) was the first member to be isolated and biochemically characterized (Savage et al., 1972, 1973). Besides EGF and TGF-a (Marquardt et al., 1984; Derynck et al., 1984; Lee et al., 1985), this family also contains the recently isolated amphiregulin (Shoyab et al., 1988) and heparin-binding EGF-like growth factor (HB-EGF) (Higashiyama et al., 1991). Another recently cloned growth factor derived from schwannoma cells is presumably the murine homologue of human amphiregulin (Kimura et al., 1990). In addition, there are three virally encoded polypeptide factors that also belong to this same family. These are vaccinia virus growth factor (VGF) (Venkatesan et al., 1982; Stroobant et al., 1985), myxomavirus growth factor (MGF) (Upton et al., 1987), and Shope fibroma growth factor (SFGF) (Chang et at., 1987), all encoded by members of the poxvirus family. T h e basis of the structural relationship is the “EGF unit,” a sequence of about 45-50 amino acids containing six characteristically spaced cysteines (CX, CX,-,CX,,- ,,CXCX,C), which are linked in a defined configuration in three disulfide bridges. T h e fully processed forms of EGF, TGF-a, and VGF correspond to this EGF unit and share a sequence identity of about 35%, including the six cysteines. The structural conservation and disulfide bond configuration in the core sequences of the different family members are the basis for the ability of these factors to interact with the same receptor, usually referred to as the EGF receptor (MassaguC, 1983; Stroobant et al., 1985; Lin et al., 1988; Shoyab et al., 1988; Higashiyama et al., 1991). This does, however, not preclude the possibility that these factors also may interact with other related receptors. TGF-a, EGF, amphiregulin, HB-EGF, and VGF are all made as larger precursors with a hydrophobic transmembrane domain, suggesting their existence as transmembrane, cell surface proteins (Fig. 1). T h e EGF domain in each of these growth factor precursors is localized in the extracellular segment of the precursor. In contrast to TGF-a (Derynck et al., 1984; Lee et al., 1985), amphiregulin (Plowman et al., 1990), HB-EGF (Higashiyama et al., 1991), and VGF (Venkatesan et al., 1982) precursors, the EGF
29
PHYSIOLOGY OF TGF-CX NH2
I
MGF
SFGF
& + COOH
COOH
COOH
EGF
TGF-cc
VGF
AR
HB-EGF
FIG. 1. Schematic representation of the precursors of the members of the EGF family. The precursors of EGF, TGF-a, amphiregulin (AR), HB-EGF, and VGF are represented as transmembrane proteins, whereas the precursors for MGF and SFGF are secreted. The black box in each precursor represents the fully processed form containing the EGF unit. The striped segments in the EGF precursor correspond to EGF-like sequences. All precursors have an NHz-terminal signal peptide (dotted). The branched structures represent Nlinked carbohydrate moieties.
precursor is considerably larger and contains a number of additional EGF-like repeats (Gray et al., 1983; Scott et al., 1983). Its large size, some distinct structural features with homology to segments of the low-density lipoprotein receptor (Russell et al., 1984; Sudhof et al., 1985), and the observation that the EGF precursor is often not processed into mature EGF (Rall et al., 1985) have led to the suggestion that the EGF precursor may be a receptor for an unknown ligand (Pfeffer and Ullrich, 1985). There is as yet no experimental confirmation of this hypothesis. A large variety of other polypeptides share one or more EGF-related sequences. One of these proteins is a small peptide “Cripto,”which has a cysteine configuration that is reminiscent of but different from the EGF theme and which may function as a growth factor (Ciccodicola et al., 1989). None of the other polypeptides with EGF-related sequences that
30
RIK DERYNCK
have been described are known to be mitogenic. This large family can be subdivided into several functional groups. One group consists of proteases and protease cofactors, whereas another group contains various polypeptides that play a role in cell-cell or cell-matrix interactions and may be important in development. The possible roles of the EGF-like domains of these proteins have been discussed elsewhere (Carpenter and Wahl, 1990; Davis, 1990). 111. The Structure of TGF-a and Its Precursor
cDNA cloning has revealed that the 50-amino acid TGF-a peptide is synthesized as an internal segment of a 160-amino acid precursor (Derynck et al., 1984; Lee et al., 1985). The sequence coding for this precursor is contained within a mRNA of 4.5-4.8 kb long. The precursor polypeptide sequence starts with an N-terminal signal sequence of 22 amino acids long, which is removed from the rest of the precursor between the residues Ala and Leu (Brachmann et d.,1989). Following the signal peptide cleavage site and preceding the N-terminus of the 50amino acid TGF-a is a sequence of 17 amino acids, referred to as the pro-TGF-a sequence. This short sequence is N-glycosylated at the Asn (position 24) and also carries O-linked carbohydrates (Bringman et al., 1987; Teixid6 et aZ., 1987; Teixido and Massague, 1988).The proteolytic cleavage at the N-terminus of the 50-amino acid TGF-a is between an Ala and Val-Val and is localized in a hydrophobic sequence context. The same cleavage recognition site (Ala-Val-Val)also marks the boundary of the C-terminus of the 50-amino acid TGF-a in the precursor (Derynck et al., 1984; Lee et al., 1985). These specific cleavage sites indicate the involvement of a highly specific protease with elastase-like properties in the excision process of the short TGF-a peptide from the extracellular domain of the TGF-a precursor (Ignotz et al., 1986; Luetteke et al., 1988; Teixido et al., 1900; Massaguk, 1990; F’andiella and Massague, 1991). The C-terminus of the 50 amino acids is followed nine residues downstream by a long, hydrophobic sequence. This hydrophobic sequence is immediately preceded by a dibasic peptide sequence (Lys-Lys),which is the target for another type of proteolytic cleavage (Derynck et al., 1984; Lee et al., 1985; Bringman et al., 1987).The protease responsible for this cleavage is more generally used because many polypeptide precursors undergo proteolytic processing at dibasic residues. The hydrophobic sequence spans the cell membrane and thus defines the extracellular domain and the C-terminal cytoplasmic domain in the precursor (Bringman et al., 1987; Gentry et al., 1987; Teixid6 et al., 1987) (Fig. 2). The cytoplasmic domain downstream of the transmembrane sequence is
PHYSIOLOGY OF TGF-CL
31
Fig. 2. Schematic representation of the TGF-a precursor. An NHP-terminal 22-amino acid sequence is cleaved from the precursor and precedes the short proregion, which contains an N-linked carbohydrate group. The 50-amino acid TGF-a peptide, shown as the bold line segment, has three disulfide-linked cysteine (C) bridges and is flanked by cleavage sites for the Ala-Val-Val-specificprotease (bold arrows). Another cleavage site (light arrow) is at the dibasic peptide immediately preceding the transmembrane sequence (black box). The cysteine residues are marked with C.
39 amino acids long and is rich in cysteines. This same precursor segment has palmitate covalently attached to it. This linkage of the fatty acid occurs at the cysteine residues, but it is not known how many cysteines and which ones have undergone this modification. The function of the palmitoylation of the precursor is unknown, but this modification could be indicative of a close association of this cytoplasmic domain with the membrane or with cytoskeletal elements (Bringman et al., 1987). Characterization of the TGF-a released in conditioned medium of cells overexpressing this growth factor (Bringman et al., 1987; Gentry et al., 1987) and the presence of several proteolytic cleavage sites in the transmembrane precursor (Bringman et al., 1987; Brachmann et al., 1989; Wong et al., 1989) thus indicate that, following removal of the
32
RIK DERYNCK
signal peptide, there are at least two different proteases involved in the release of soluble TGF-a from the transmembrane precursor. As a result of these cleavages, several soluble TGF-a species can be generated (Bringman et al., 1987) (Fig. 3). One possible form is the short, 50-amino acid species, but two larger forms that have retained the propeptide and thus are N-glycosylated can also be generated. Analyses of the TGF-a naturally secreted by various tumor cells suggest that these glycosylated TGF-a forms are far more common than the 50-amino acid form (De Larco and Todaro, 1978; Todaro et al., 1980; Marquardt and Todaro, 1982; Ignotz et al., 1986). It is attractive to postulate that the cleavage of the precursor by the Ala-Val-Val-specific protease is differentially controlled, thus regulating the relative ratios of soluble, diffusible TGF-a and uncleaved, immobilized TGF-a precursor and the relative levels of soluble glycosylated TGF-a and 50 amino acid TGF-a species. A conversion of the cell surface precursor into diffusible TGF-a would then affect a much larger number of target cells and could thus be much more effective, but could also result in different physiological effects. Such posttranslational regulation of the levels of soluble TGF-a and the nature of the soluble TGF-a species would be meaningful in the context of the transition from normal cells toward malignant tumor cells and in wound healing. It is possible that activation of the protein kinase C pathway enhances this posttranslational cleavage, because treatment of the cells with the tumor promoter 12-O-tetradecanoyl phorbol- 13-acetate (TPA), a protein kinase activator, enhances the proteolytic cleavage of the precursor (Pandiella and Massague, 1991). Cell surface immunofluorescence and biochemical characterization have indicated that TGF-a-synthesizingcells usually, if not always, have cell surface TGF-a pecursor molecules that are not cleaved to release soluble TGF-a. In addition, many TGF-a-synthesizing cells do not secrete soluble TGF-a into the medium (Derynck et al., 1987; Brachmann et al., 1989). Two forms of transmembrane TGF-a can exist, according to the model, with different proteolytic cleavages (Fig. 3). One form has undergone cleavage at the Ala-Val-Val at the N-terminal boundary of the 50amino acid TGF-a sequence, whereas the other form has retained the prosequence and is thus N-glycosylated (Brachmann et al., 1989; Massaguk, 1990). An analysis of TGF-a-overproducing cell lines suggests the likelihood that cells contain a mixture of both forms (Bringman et al., 1987; Gentry et al., 1987; Pandiella and Massague, 1991), although the relative ratios of these forms may depend on the cell line and on the physiological conditions. In any case, it appears that the presence of the transmembrane TGF-a at the cell surface is a normal consequence of TGF-a synthesis (Brachmann et al., 1989; Pandiella and Massague, 1991)
't FIG. 3. Schematic representation of the different forms of TGF-a, derived from the precursor in Fig. 2. Three forms, two of which are Nglycosylated (branched structures), are released into the medium. The two other forms, one with and one without N-glycosylation, are transmembrane forms and remain cell associated. The arrows show the proteolytic cleavage sites, whereas the cysteine residues are marked with C.
34
RIK DERYNCK
and is far more common than the actual release of soluble TGF-a into the medium. IV. Interactions of TGF-a with the EGF/TGF-a Receptor
Competition studies have revealed that EGF and TGF-a compete for binding to the same receptor, usually referred to as the EGF receptor (Todaro et al., 1980; MassaguC, 1983). Whereas it is possible that there might be a different unique receptor for TGF-a, it is currently widely accepted that all TGF-a effects are mediated through the common EGF/TGF-a receptor. The existence of multiple forms of soluble and transmembrane TGF-a species raises the possibility that there might be differences between how the individual TGF-a species interact with the receptor. However, the biological effects of TGF-a and especially comparisons between TGF-a and EGF have been evaluated until now using only the secreted 50-amino acid form of TGF-a. In order to address the question whether TGF-a and EGF are functionally equivalent, highly purified, recombinant 50-amino acid TGF-a and 53-amino acid EGF were compared in several biological assays. In some assays, TGF-a and EGF induce very similar activities. This is apparent in the stimulation of DNA synthesis in several cell lines (Schreiber et al., 1986), in the induction of anchorage independence of some rodent fibroblasts (Anzano et al., 1983), and in the acceleration of eyelid opening in newborn mice (Smith et al., 1985). On the other hand, both ligands exert quantitatively different responses in a variety of other systems, although some qualitatively different aspects cannot be excluded. These differences usually result in a higher potency for TGF-a than for EGF. One of these assays measures the effect of TGF-a and EGF on ruffling of the cell membrane. At high doses, the TGF-a-induced response is higher than that of EGF, and pretreatment of cells with TGF-P extends the duration of the TGF-a-induced response, but antagonizes the EGF-induced cell ruffling (Myrdal et al., 1986). TGF-a is also more potent than EGF in several proliferation-dependent assay systems. One example of these differences between EGF and TGF-a is provided by human keratinocytes. TGF-a is more active than EGF in inducing colony formation in monolayers, an event that results from a combination of cell migration and proliferation (Barrandon and Green, 1987; Pittelkow et al., 1989). TGF-a is also stronger than EGF in inducing a mitogenic response in hepatocytes (Brenner et al., 1989). Finally, TGF-a and EGF exert quantitatively different results on several pancreatic carcinoma cell lines. Using these cells, TGF-a is at least 10-fold more potent than EGF in
PHYSIOLOGY OF TGF-CX
35
inducing anchorage-independent colony formation in soft agar (Smith et al., 1987). TGF-a and EGF both have the ability to induce neovascularization in uiuo, but again TGF-a is much more potent than EGF (Schreiber et al., 1986). A similar result is also seen with an organ culture assay in uitro, in which Ca2 release from bones in culture is measured. TGF-a is considerably more potent than EGF in this assay, which is thought to correlate with bone resorption and hypercalcemia in uiuo (Stern et al., 1985; Ibbotson et al., 1986). Yet another example is provided by an arterial blood flow assay. Both factors are vasoactive and increase blood flow in this system, but TGF-a is again more active than EGF. In addition, treatment with EGF induces a refractory period, during which administration of another dose of EGF is without apparent biological effect. I n contrast, TGF-a does not induce such a refractory period and can overcome the EGF-induced refractory period (Gan et al., 1987). In conclusion, TGF-a, which interacts with the same receptor as EGF, is very frequently a superagonist of EGF. As yet very few comparative data on the nature of the interaction of EGF and TGF-a with the EGF/TGF-a receptor are available. At least two studies have shown that the dissociation constants of both ligands with the receptor are very similar (Lax et al., 1988; Ebner and Derynck, 1991). This, however, does not necessarily guarantee that the ligands interact in a similar fashion with the receptor, because it does not give any information about the ligand-receptor interactions during and following internalization and about the trafficking and fate of the ligands and receptors. T h e major quantitative difference in biological activity could be related to the fact that TGF-a dissociates from the receptor at a considerably higher pH than does EGF. This difference is presumably due to differences in PI of both growth factors, which is much higher for TGF-a than for EGF. This difference in pH dependence of dissociation of the receptor-ligand complex makes it likely that TGF-a, but not EGF, dissociates from the receptor immediately following internalization of the receptor-ligand complexes in the gradually acidifying endosomes. In contrast, EGF remains associated with the receptor until its delivery into lysosomes, which have a pH of around 4.8. Such a difference in pHdependent dissociation could be of determining importance to the fate of the receptors and the ligands following internalization and could profoundly affect the degree of down-regulation of the receptors and, thus, the availability at the cell surface of the receptors to new ligands. As a consequence, a large fraction of the total number of EGFITGF-a receptors could remain continuously available, when the cells are in the presence of TGF-a, whereas addition of EGF results in a virtually +
36
RIK DERYNCK
complete down-regulation of the receptor within a short time. This down-regulation of the receptor will then give rise to a period during which the cells are unresponsive to any additional ligand. An evaluation of potential differences in the intracellular trafficking of the receptors and ligands is currently underway (Ebner and Derynck, 1991). V. The Transmembrane TGF-a Precursor
As mentioned before, many TGF-a-synthesizing cells do not release soluble TGF-a peptides into the medium and all TGF-a-expressing cells examined exhibit transmembrane TGF-a precursors at their cell surface. The TGF-a precursors should thus be considered as normal physiological forms of TGF-a. Two independent studies have demonstrated that these TGF-ol forms interact with the EGF/TGF-a receptors on neighboring cells, without actual release of the growth factor (Brachmann et al., 1989; Wong et al., 1989).Thus cell-to-cell contact is sufficient to induce a mitogenic response in a neighboring cell. The relative activities of the two different transmembrane forms, i.e., the unglycosylated and the glycosylated forms, are not known. We also do not know the relative affinity or potency of the interaction of the receptor with this type of ligand, in comparison with the soluble TGF-a. The solubilized transmembrane TGF-a form is about 100-fold less active than the 50amino acid form (Brachmann et al., 1989),but this is presumably a result of the solubilization per se. The major difference between this interaction between the two cell surface molecules and the interaction of the receptor with the soluble TGF-a is that the former interaction remains very localized. Thus only cells in direct contact with the TGF-a-producing cells are stimulated. Obviously an autocrine interaction of this TGF-a form with the receptors can also take place in the same cell. In contrast, the soluble TGF-a is diffusible and can reach a much larger number of target cells. In addition, it is possible that there are qualitative differences between these two types of interactions. Interaction between the receptor and the cell surface TGF-a precludes an internalization of the ligand-receptor complex, in contrast with the interaction of the receptor with soluble TGF-a and EGF. It is conceivable, but not yet demonstrated, that the former interaction results in a more prolonged effect. In addition, this interaction between cell surface ligand and receptor may result in an enhanced adhesion between cells. Published results have demonstrated a low level of adhesion between cell surface TGF-a and EGF/TGF-a receptor-producing cells (Anklesaria et al., 1990), but the low efficiency of this adhesive interaction indicates that
PHYSIOLOGY OF TGF-OL
37
the TGF-a precursor should not be considered as an adhesion protein similar to cadherins and cell adhesion molecules (CAMS). The observation that a cell surface growth factor can productively interact with its receptor has important implications not only for the action of TGF-a, but also for a variety of other growth factors. Indeed, TGF-a is but one member of the family of EGF-like growth factors. Many of the growth factors in this family are thought to be synthesized as transmembrane precursors. This has been shown not only for TGF-a but also for the large EGF precursor that often remains uncleaved as a large cell surface protein (Rall et al., 1985). It is thus likely that the EGF, VGF, amphiregulin, and HB-EGF precursors are all able to interact productively with their receptors on neighboring cells, without actual release of the soluble growth factor. Some evidence supports this notion in the case of the large EGF precursor (Mroczkowski et al., 1989). In addition, there are at least three other growth factors that are made as transmembrane cell surface polypeptides: colony-stimulating factor-1 (CSF-1) (Rettenmier et al., 1987; Rettenmier and Roussel, 1988), tumor necrosis factor (TNF) (Kriegler et al., 1988),and the c-kit-encoded ligand (Anderson et al., 1990). The proteolytic cleavage of these transmembrane forms into soluble growth factors may be subject to regulation. Also in these cases it is likely that the cell surface-linked forms of the precursors can interact with the cell surface receptors on the same or on neighboring cells, thus resulting in a highly localized mitogenic stimulation of the target cells. The interaction of the transmembrane form of TGF-a and the receptor is thus an interaction between two cell surface proteins, during which there is signal transduction going through the receptor into the receptor-bearing cell. However, it is also possible that there is signal transduction through the TGF-a precursor into the TGF-a-producing cell. Thus the EGF/TGF-a receptor could represent a ligand for the TGF-a precursor as a receptor. Whereas such function is as yet still unproved, a possible physiological role associated with the cytoplasmic domain of the TGF-a precursor is substantiated by its extreme sequence conservation among animal species (Derynck et al., 1984; Lee et al., 1985), which is indicative of a conserved biological function. In addition, the spacing of the cysteine residues in the intracellular TGF-a precursor domain is reminiscent of the cysteine patterns that mediate the interactions between the cytoplasmic domains of the CD4 and CD8 cell surface receptors and the cytoplasmic lck protooncogene product, which functions as a tyrosine protein kinase (Shaw et al., 1989, 1990; Turner et al., 1990). It is possible that the somewhat similar sequence in the cytoplasmic domain
38
RIK DERYNCK
of the TGF-a precursor is indicative of and responsible for an interaction with an as yet to be identified cytoplasmic protein. If there is indeed signal transduction through the TGF-a precursor, then the interaction between both cell surface proteins, the precursor, and the EGF/TGF-a receptor would result in a two-directional signal transduction and cellcell communication and in an activation of cellular functions in both cells. If so, this interaction of the transmembrane TGF-a with the receptor would be qualitatively considerably different from the effect of soluble TGF-a on cells. A characterization of a receptor-like function of the TGF-a precursor would then also lead to a definition of a role for the soluble form of the EGFITGF-a receptor, which appears to be secreted by various cells, such as in the brain (Nieto-Sampedro, 1988) and the liver (Petch et al., 1990). This soluble domain could then function as a ligand that would modify biochemical pathways in cells that have the transmembrane TGF-a form.
VI. A Role for TGF-a in the Physiology of Normal Cells TGF-a was originally discovered in the medium of tumor cells (De Larco and Todaro, 1978; Todaro et al., 1980) and a possible function of TGF-a was considered only in the context of tumor cells. However, research during the last few years has now made it evident that TGF-a plays a role in the physiology of normal cells and tissues. Epithelial cells are the major source of TGF-a synthesis under normal conditions. TGF-a synthesis has been demonstrated by Northern hybridization, in situ hybridization, or immunochemical methods in a variety of normal epithelial cells (Valverius et al., 1989), and gastric and intestinal mucosa cells (Beauchamp et al., 1989). It is thus likely that most, if not all, types of normal epithelial cells synthesize TGF-a. These same cells also have EGF/TGF-a receptors (Carpenter and Wahl, 1990), thus making them responsive to the action of TGF-a in an autocrine fashion. Even though there is as yet no direct proof in uivo, it is likely that a normal role of the endogenous TGF-a synthesis in these epithelia is to drive their proliferation. There is certainly plenty of experimental evidence that epithelial cells in culture are responsive to TGF-a or EGF and that TGF-a or EGF addition results in their increased mitogenic activity (Carpenter and Wahl, 1990). Perhaps the best demonstration of this activity has been obtained using keratinocytes. Normal keratinocytes are dependent on exogenous EGF or TGF-a for their proliferation in culture. Following starvation, the proliferation of these cells is stimulated by TGF-a and EGF at subpicomolar levels. The effect of TGF-a and EGF on substrate-
PHYSIOLOGY OF TGF-OL
39
dependent colony formation of human keratinocytes has been studied in some detail. Starting from a single keratinocyte, a circular colony can only be formed efficiently when either TGF-a or EGF is present in the medium. The colonies of cells are considerably larger when grown in the presence of TGF-a than when using EGF. This colony formation is the result of cell proliferation and migration, but it is not known what the effects of TGF-a are on keratinocyte migration only (Barrandon and Green, 1987). T h e effects of EGF, TGF-a, and VGF on reepithelialization in pig skin due to keratinocyte proliferation in vivo have also been examined. TGF-a has the ability to induce reepithelialization, supporting the notion that it can induce keratinocyte proliferation in vivo (Schultz et al., 1987). It is as yet unknown if natural wound healing of the skin is accompanied by an enhanced TGF-a synthesis by the keratinocytes at the site of the wound. In vivo studies have also evaluated the expression levels of TGF-a in psoriasis. Psoriasis results in a local inflammation and topical proliferation and incomplete differentiation of skin keratinocytes. Analyses by immunohistochemistry, RNA hybridization, and immunological measurements of the TGF-a protein indicate that the levels of TGF-a expression by keratinocytes in the psoriatic lesions are enhanced in comparison with normal skin at unaffected sites o r in normal volunteers (Elder et al., 1989). These results, together with the responsiveness of keratinocytes to low levels of TGF-a, suggest that enhanced TGF-a expression could effectively contribute to the overproliferation of the skin in psoriasis. It is not known whether there is a direct link between the inflammation and the TGF-a synthesis, but recent data have shown that interferon-? can induce TGF-a synthesis (Kumar and Mendelsohn, 1990). Besides a presumed major role of TGF-a in proliferation of epithelia, TGF-a may also play a role in several other tissues. TGF-a expression has been detected in several structures in the brain and appears to be relatively highly expressed in the olfactory locus and in the pituitary (Kobrin et al., 1988; Wilcox and Derynck, 1988a). It is as yet unclear how the distribution of TGF-a expression in the brain compares with the localization of the EGF/TGF-a receptor expression. Because the detection of this growth factor has been mainly based on in situ hybridization of the TGF-a mRNA, it is hard to predict where exactly TGF-a exerts its activity. By analogy with many other peptides, there may indeed by axonal transport of growth factors and receptors in the neurons. No localization studies of both ligand and receptor at the protein level have been reported. We currently do not know the function of TGF-a in the context of the neurons and brain. There is, however, evidence that EGF, and thus presumably also TGF-a, have a potent neurotrophic activity
40
RIK DERYNCK
(Morrison et al., 1987). The role of the endogenous production of TGF-a and many other growth factors in the brain still needs to be established. TGF-a synthesis has also been reported in activated macrophages (Madtes et al., 1988; Rappolee et al., 1988a).Macrophages have the ability to synthesize a large variety of growth factors (Rappolee and Werb, 1991). The abundant presence of macrophages at sites of inflammation and wound healing and the effects of growth factors on cell proliferation strongly suggest that the role of the macrophage-released TGF-a is to participate in the wound-healing process and to stimulate the proliferation of epithelial cells. In addition, TGF-a is also able to induce proliferation of other cell types that have the EGF/TGF-a receptors, such as fibroblasts or endothelial cells. The abundance of the various growth factors released by macrophages is presumably essential for normal wound repair. Relatively little is as yet known about the regulation of TGF-a synthesis in epithelial cells or other cell types. Estrogen-responsivemammary epithelial cells have been shown to increase their level of TGF-a mRNA and protein synthesis following treatment with estrogen. This same treatment also results in an increased proliferation of such cells, suggesting that this could be due in part to an autocrine action of the higher levels of TGF-a (Liu et al., 1987). However, these cells presumably make several other growth factors, some of which may also be induced following estrogen treatment. Another factor that appears to modulate the synthesis of TGF-a by cells is the phorbol ester TPA. Treatment of cells with TPA, an activator of protein kinase C, induces a strong but transient increase of the level of TGF-a synthesis in keratinocytes and other cells (Pittelkowet al., 1989; Mueller et al., 1989; Bjorge et al., 1989). This increase has been shown to be due only to the activation of the protein kinase C pathway and is not due to any other effect of TPA. This leads to the possibility that exposure of cells to physiological levels of hormones or growth factors that activate the kinase C pathway may lead to an increase of TGF-a synthesis in the target cell. As mentioned above, treatment with TPA also results in an increased cleavage of the cell surface TGF-a form, thus releasing higher levels of soluble TGF-a (Pandiella and Massagut, 1991). Finally, TGF-a synthesis in keratinocytes and other cells is also enhanced following treatment with TGF-a or EGF, although not to the same extent as TPA-induced synthesis (Coffey et al., 1987; Bjorge et al., 1989; Mueller et al., 1989). Thus, there is an autostimulation of TGF-a production in these cells. A molecular analysis of this phenomenon could provide us with insight not only in the regulation of TGF-a synthesis, but also in the activation of expression of other genes that are the
PHYSIOLOGY OF TGF-OL
41
target of TGF-a action. It is as yet unclear what the biological meaning of this autoinduction of the TGF-a is. It could represent a simple mechanism to quickly amplify the effect of local TGF-a synthesis. Thus a low concentration of TGF-a released, e.g., by invading macrophages could result in a drastic increase of TGF-a synthesis by keratinocytes or other epithelial cells at a site of wound healing. Another possible consequence of this autoinduction is that such amplification of the TGF-a synthesis and the resulting response give rise to a more or less synchronized induction of cell proliferation. Finally, an autostimulatory mechanism may represent a relatively simple mechanism to maintain the TGF-a synthesis. Following an initial TGF-a induction, this autostimulatory mechanism may then be independent of the much more complex actions of regulators that were responsible for the initial induction of the TGF-a synthesis. Because this autostimulation of TGF-a synthesis has been reported for a few cell types only, it is unclear to what extent this also takes place in other types of normal cells o r tumor cells.
VII. TGF-a in Normal Development Growth factors play major roles in morphogenesis and organogenesis during development. The pattern of TGF-a expression during the development of the mouse has been studied mostly using various RNA detection techniques. Polymerase chain reaction (PCR)-based analysis has detected the presence of TGF-a mRNA in the unfertilized egg (Rappolee et al., 1988b). The TGF-a mRNA is then rapidly destroyed following fertilization and during the initial development of the mammalian embryo, but reappears again in the preimplantation embryo as early as the four-cell stage. The presence of TGF-a protein in virtually all cells of the blastocyst has also been observed by immunostaining (Rappolee et al., 1988b). T h e highest levels of expression occur around days 9-1 1 post coitum. TGF-a is then synthesized in the decidua (Han et al., 1987) and in several structures of the developing fetus (Wilcox and Derynck, 1988b). The levels of TGF-a transcripts in the decidua are highest at day 8 of gestation and decline as the decidua is resorbed. There is no detectable TGF-a mRNA in the nonpregnant uterus or in the pregnant uterus before decidualization (Han et al., 1987). In situ hybridization has revealed that TGF-a transcripts are also present in the developing fetus and that their levels are highest in several structures of ectodermal origin, such as in the branchial arches, the oral and nasopharyngeal epithelia, the otic vesicle, and the developing mesonephric tubules of the kidneys. The levels of TGF-a expression are maximal around days 9 and 10 and decrease at later stages in the fetal development (Wilcox and
42
RIK DERYNCK
Derynck, 1988b). There is, however, no doubt that a more detailed and sensitive analysis would reveal TGF-a synthesis at additional sites and at other stages of the fetal development. Little is known about the development expression of the EGF/TGF-a receptor. Northern hybridization suggests that the receptor mRNA level in the fetus is increased between days 11 and 14. In addition, EGFbinding activity is present in various fetal tissues and in blastocyst outgrowths. Unfortunately, no parallel studies localizing the synthesis of both the ligand and the receptor are available. Results from in uivo experiments or organ cultures using EGF (Carpenter and Wahl, 1990) and from cell culture experiments using TGF-a suggest that the major role of TGF-a in development is to drive the proliferation of various cell populations, especially epithelial cells. The coexpression of the TGF-a and the EGF/TGF-a receptor genes by many epithelial cells likely results in the exertion of the activities of TGF-a in an autocrine manner. Thus TGF-a synthesis could be of major importance in the development of the epithelia and of structures of ectoderma1 origin. A variety of studies, especially by Pratt and colleagues, have examined the effects of exogenous EGF on craniofacial development, particularly of the palate. These results suggest that the function of TGF-a, synthesized by the oral epithelia, is to promote the proliferation of the medial epithelium until the fusion of the palate shelves takes place (Lee and Han, 1990). Several other studies have evaluated the effects of EGF on the development and maturation of intestinal and gastric mucosa and suggest a role for the endogenous TGF-a synthesis in the proliferation and functional maturation of these epithelia (Lee and Han, 1990). A function of TGF-a in the development of epithelia is furthermore also suggested by the histological analysis of epithelia from transgenic mice overexpressing TGF-a (Jhappan et al., 1990; Matsui et al., 1990; Sandgren et al., 1990). Several organs of these mice, developed in three independent studies, had epithelial hyperplasia. This was most striking in the liver, coagulation gland, and intestines. Both colon and duodenum displayed a considerable mucosal hyperplasia. These effects of overexpression of TGF-a on different epithelia in transgenic mice appeared to be most influential during postnatal development, because overexpression of TGF-a had no major influence on the fetal development. Another possible target of the function of TGF-a during development is the mammary gland. Not only are mammary epithelial cells in culture stimulated in their proliferation, but application of TGF-a in a slow-release form to mammary glands of 5-week-old mice results in local alveolar and ductal growth (Vonderhaar, 1987). In accordance, TGF-aoverexpressing transgenic mice exhibit an increased penetration of an
PHYSIOLOGY OF TGF-O1
43
abnormally dense network of mammary epithelial ducts into the mammary fat pad. Thus the TGF-a synthesized in mammary epithelial cells could play an important role in the morphogenesis of the mammary gland. No effects of the overexpression of TGF-a on the mammary epithelial duct system were apparent during the first 4 weeks after birth, suggesting that some additional event or a hormonal stimulus related to puberty is required (Jhappan et al., 1990; Matsui et al., 1990; Sandgren et al., 1990). A further exploration of the role of endogenous TGF-ol synthesis in fetal and postnatal development will eventually require the generation of mice that are defective in TGF-a synthesis. As yet, no mice have been developed in which TGF-a synthesis was abolished following targeted gene disruption.
VIII. A Role for TGF-a in Tumor Development? A possible link between the production of TGF-a and the transformed character was apparent from the initial discovery of this growth factor. TGF-a was indeed first detected in the medium of murine sarcoma virus-transformed cells and several other retrovirus-transformed fibroblasts. Its name originated from the observation that preparations of this growth factor, even though impure, had the ability to induce phenotypic transformation of normal rat kidney cells, an immortalized fibroblast cell line, in culture. This transforming activity, which was apparent from the acquisition of anchorage independence in soft agar and from a different appearance and loss of contact inhibition in monolayer culture, was phenotypic and reversible, because removal of the TGF-a preparations resulted in a reversal to the normal phenotype (De Larco and Todaro, 1978; Todaro et al., 1980). We now know that the full transforming effect of these preparations was due to a synergism between TGF-a and TGF-P, and that neither of these factors alone has this ability to its full extent (Anzano et al., 1983). The transforming activity and the initial finding that TGF-a was only made in transformed fibroblasts and not in their normal counterparts have resulted in the concept that TGF-a could significantly contribute to malignant transformation and tumor development. Examination of a variety of cell lines subsequently showed that TGF-a was not only synthesized by fibroblasts transformed by retroviruses, but also by SV40- and polyoma-transformed cells (Kaplan and Ozanne, 1982; Kaplan et al., 1981). In addition, transformation with the ras oncogene or polyoma middle T coding sequences was sufficient to induce TGF-ol expression in the host cell (Kaplan and Ozanne, 1980; Salomon et al., 1987; Ciardiello et al., 1988). More recent studies have shown that the
44
RIK DERYNCK
induction of endogenous TGF-a expression by immortalized fibroblasts can also be achieved by introduction of and concomitant transformation by a variety of other oncogenes (Ciardielloet al., 1990). However, not all oncogenes had the ability to induce TGF-a synthesis, even though all transfected cells were transformed, indicating that TGF-a expression is not the result of transformation per se, but of a biochemical pathway triggered by selected oncogenes. Although there has not been a systematic study, the current data suggest that expression of oncogenes with gene products localized in the nucleus and presumably directly involved in transcription, does not induce TGF-a expression. In contrast, expression of ras and oncogenes that induce tyrosine phosphorylation or are tyrosine kinases themselves results in TGF-a expression. Examination of human tumor cell lines and biopsies revealed that TGF-a expression is fairly common among tumor types (Derynck et al., 1987; Bates et al., 1988; Nistkr et al., 1988).Hematopoietic tumors apparently do not synthesize TGF-a, but a variety of solid tumors do. Among the latter, carcinomas are most likely to synthesize TGF-a. More than half of the mammary carcinomas and all squamous and renal carcinomas examined synthesize TGF-a. Also, most hepatomas, melanomas, and glioblastomas exhibit an endogenous TGF-a synthesis. The incidence of TGF-a synthesis among tumors of mesenchymal origin is less common, but is by no means rare. Thus, TGF-a synthesis is prevalent among epithelial and other ectodermally derived tumors (Derynck et al., 1987). It is apparent that expression of TGF-a is frequently accompanied by enhanced synthesis of the EGF/TGF-a receptor, at least as assessed by Northern hybridization of the mRNA. This is most striking in the case of squamous and renal carcinomas, which consistently synthesize high levels of TGF-a and EGFITGF-a receptor (Derynck et al., 1987). It is likely that high receptor levels result in an enhanced sensitivity of the cell to the autocrine stimulation of TGF-a, thus considerably amplifying the effects of the growth factor (Di Fiore et al., 1987; Di Marco et al., 1989). It is not known whether the transition from a TGF-asynthesizing epithelial cell to a fully transformed carcinoma results in an increase of TGF-a synthesis, although anecdotal data on unmatched samples suggest that this may be the case. The endogenous synthesis of TGF-a in tumor cells could be of importance in tumor development and maintenance. Unfortunately, results of direct experiments, e.g., aimed at an abolition of TGF-a synthesis in normally TGF-a-synthesizingtumor cells, have as yet not been reported. Thus our knowledge about the role of TGF-a in tumorigenesis is primarily based on a variety of observations from indirect experiments.
PHYSIOLOGY OF TGF-a
45
Because TGF-a is mitogenic for many cells, we assume that the TGF-a produced by tumor cells enhances proliferation of these same cells in an autocrine way, provided these cells have EGFITGF-a receptors. Indeed, most, if not all, TGF-a-producing tumor cells have EGF/TGF-a receptors, and, as mentioned above, an enhanced receptor expression level is frequently encountered. Ligand and receptor could interact in an autocrine fashion in several ways. The most common interaction takes place at the cell surface, but could in principle also occur in cytoplasmic vesicles, such as the exosomes, making these interactions oblivious to the neutralizing effects of antibodies or proteases. Internal ligand-receptor interactions are thus possible and have been unambiguously documented in the case of the platelet-derived growth factor B chain (Keating and Williams, 1988). T h e extracellular TGF-a could exert its activities either as a soluble secreted and diffusible ligand, which thus can interact with many cells in proximity to the producer cells, or as the uncleaved transmembrane form of TGF-a, which can interact only with the neighboring cells in contact with the producer cells. Various experiments strongly suggest that endogenous TGF-a synthesis provides the means for an increased proliferation rate to the tumor cells. A good example of this effect is provided by a study comparing the susceptibility to exogenous TGF-a of untransformed mammary epithelial cells and their polyoma middle T-transformed and rm-transformed counterparts (Salomon et al., 1987). The normal cells and the polyoma middle T-transformed cells are strongly stimulated in their proliferation, whereas the rm-transformed cells are not. T h e polyomatransformed cells have a low level of endogenous TGF-a synthesis and their proliferation rate is enhanced by exogenous TGF-a to a level very similar to that of the rm-transformed cells. The latter cells have a high level of endogenous TGF-a synthesis and are not very dependent on exogenous growth factors. The autocrine stimulation by a high level of TGF-a synthesis may be responsible in part for the very high proliferation rate of the rm-transformed cells, which cannot be further stimulated. Other experiments, comparing the rate of tumor formation in nude mice by papilloma cells that were or were not transfected by a TGF-a expression vector, clearly established an increased tumor size and proliferation rate as a consequence of the TGF-a production (Finzi et al., 1988). Considerable attention has been given to the question whether endogenous TGF-a synthesis by cells is able and sufficient to convert untransformed cells into transformed and tumorigenic cells. The basis for this hypothesis was the original observation that TGF-a preparations
46
RIK DERYNCK
were able to induce phenotypic transformation. In addition, the original autocrine hypothesis (Sporn and Todaro, 1980) proposed that endogenous expression of TGF-a and concomitant autocrine interaction and stimulation of the producer cell lines by these factors resulted in independence of exogenous growth factors, a basis for malignant transformation. Thus cells were transfected with a TGF-a expression plasmid, and selected TGF-a-producing cell lines were examined for their acquisition of characteristics of malignant transformation. Results from various studies established that a high level of TGF-a synthesis can indeed result in transformation and tumorigenicity, but that this clearly depends on the choice of the cell line and on the assays used as criteria for the transformed phenotype. Some immortalized cell lines such as the Rat-1 (Rosenthalet al., 1986)and NRK (Watanabeet al., 1987) fibroblasts and the epithelial NOG-8 cell line (Shankar et al., 1989) clearly lost contact inhibition and anchorage independence when transfected with a TGF-a expression vector and thus were transformed. Also, expression of TGF-a in Rat-1 cells (Rosenthal et la., 1986) and of EGF in Fisher rat 3T3 cells (Stern et al., 1987) resulted in tumorigenicity in animals. However, TGF-a expression in early-passage NIH 3T3 cells resulted only in a higher cell density in the monolayer, but not in anchorage independence or tumorigenicity (Finzi et al., 1987), whereas TGF-a expression in cultured primary epidermal cells did not result in tumor formation either (Finzi et al., 1988). In addition, TGF-a overexpression in skin papillomas did not result in neoplastic progression, but only in increased size of the resulting benign tumors (Finzi et al., 1988). All these results suggest that TGF-a expression can induce transformation and tumorigenicity only when the cells have already evolved closely to the transformed character. A parameter that is very important for the effect of TGF-a expression on the acquisition and establishment of transformation and tumorigenicity is the number of EGF/TGF-a receptors. Indeed, overexpression of the receptors can result in ligand-dependent transformation and there is a minimal quantitative requirement of cell surface receptors in order to obtain the TGF-a-induced malignant phenotype (Di Fiore et al., 1987; Di Marco et al., 1989). It is therefore likely that a high level of TGF-a synthesis, combined with a high receptor expression level, as seen in squamous carcinomas or renal carcinomas, can be of considerable importance to the behavior, the phenotype, and the malignant character of some tumor cell types. Transgenic mice that overexpress TGF-a developed a variety of neoplastic lesions (Sandgren et al., 1990; Jhappan et al., 1990; Matsui et al., 1990). Depending on the mouse strain and the promoter that directs the
PHYSIOLOGY OF TGF-(Y
47
transcription of the TGF-a coding sequence, these mice displayed development of coagulation gland carcinomas, mammary adenocarcinomas, and hepatocellular carcinomas. Thus, expression of the TGF-a gene can be oncongenic in vivo. There is not necessarily a discrepancy between these findings and the result from in vitro transfection experiments, which suggested that the cells had to be already close to transformation in order to see a transforming effect of TGF-a expression. T h e tumors that develop in transgenic mice appear only after an extended period of postnatal development and are often found together with hyperplastic areas in the same tissues or organs. This suggests that the overexpression of TGF-a and the high autocrine responsiveness of the cells and tissues result in an extensive proliferation, before tumor development is initiated. Thus the high proliferation rate may considerably increase the probability of tumor development. The induction of TGF-a expression can thus be seen as a tumor-promoting effect or as a contributing step in the progression of the cell toward a fully transformed phenotype. It is not known to what extent these tumor cells in the transgenic mice are dependent on TGF-a for their neoplastic character and behavior. A recent study has established that a high level of TGF-a expression also influences motility and the capability of the cell to digest the extracellular matrix (Gavrilovic et al., 1990). Expression of a transfected TGF-a cDNA in the NBTII rat carcinoma cell line resulted in the conversion from an epithelial to a vimentin-positive fibroblastic phenotype. These cells also acquired a highly motile behavior and secreted significant levels of a 95-kDa gelatinolytic metalloproteinase, presumably corresponding to a type IV collagenase, which was virtually absent in the parent, untransfected cells. These changes, resulting from the expression of TGF-a, could contribute to a more invasive phenotype in vivo. No experiments have as yet been done to evaluate the role of TGF-a in the invasiveness in vivo and the metastasis of these TGF-aproducing tumor cells. T h e ability of TGF-a to induce neovascularization (Schreiber et al., 1986) could also provide an additional advantage to tumor formation. Solid tumors are indeed very dependent on vascularization, as soon as they reach a critical diameter, which does not allow sufficient access to oxygen and nutrients by diffusion. In order to grow beyond this critical size it is imperative that neovascularization takes place (Klagsbrun and Folkman, 1990). the endogenous synthesis of TGF-a can contribute to this process of angiogenesis, because it has been shown that this growth factor is a potent inducer of angiogenesis in vivo (Schreiber et al., 1986). We can assume that TGF-a may not be the only angiogenic factor released by these cells, because a variety of other growth factors can also
48
RIK DERYNCK
induce neovascularization. It is thus likely that the effect of TGF-a occurs in concert with other factors. Finally, TGF-a secreted by the tumor cells in vivo could also influence calcium metabolism and could contribute to a hypercalcemic state. Malignancy-associated hypercalcemia occurs relatively frequently in patients with renal carcinoma, squamous carcinoma, melanoma, or breast carcinoma (Mundy et al., 1985). Tumors of these types are very consistent producers of TGF-a. I n vitro studies have shown that TGF-a is able to induce Ca2+ release from bone cultures (Stern et al., 1985; Ibbotson et al., 1986),thus suggesting that the TGF-a synthesis and release by these tumors could contribute to the induction of malignancy-induced hypercalcemia. It is, however, important to recognize that TGF-a-induced Ca2+ release may only be one mechanism, because parathyroid hormone-related polypeptide synthesized by tumors could also play a role in this type of hypercalcemia (Mundy et al., 1985). The latter factor could maybe synergize with TGF-a, whereby TGF-a would exert its effects mostly at the local level, e.g., at the site of tumor development or at the site of growth of a metastatic nodule, and the parathyroid hormone-like peptide would represent a more systematic activator of Ca2+ release. As is evident from this review, we know as yet little about the biology and the physiological role of TGF-a. Our current knowledge clearly indicates that TGF-a expression is not restricted to tumors, but is very common in normal cells, especially epithelial cells. Thus TGF-a should be considered as a perfectly normal physiological ligand of the EGFITGF-a receptor, one that plays a role in cellular proliferation not only in the adult, but presumably even more importantly in organ and tissue development. Its role in normal tissues certainly does not exclude a role in the establishment and maintenance of the malignant character of tumor cells. In this context, TGF-a could play a role in and contribute to phenotypic transformation, and could certainly stimulate the proliferation of the tumor cells and of the tumor in vivo. In addition, TGF-a expression may influence the invasive behavior of the tumor cells and contribute to the induction of neovascularization of the tumors and to malignancy-induced hypercalcemia. REFERENCES Anderson, D. M., Lyman, S. D., Baird, A,, Wignall, J. M., Eisenmann, J., Rauch, C., March, C. J., Boswell, H. S., Gimpel, S. D., Cosman, D., and Williams, D. E. (1990). Cell 63, 235-243. Anklesaria, P., Teixid6, J., Laiho, M., Pierce, J. H., Greenberger, J. S., and Massague, J. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 3289-3293.
PHYSIOLOGY OF TGF-CL
49
Anzano, M. A., Roberts, A. B. Smith, J. M., Sporn, M. B., and De Larco, J. E. (1983). Proc. Natl. Acad. Sci. U.S.A. 80, 6264-6268. Barrandon, Y., and Green, H. (1987). Cell 50, 1131-1137. Bates, S. E., Davidson, N. E., Valverius, E., Freter, C. E., Dickson, R. B., Tam, J. P., Kudlow, J. E., Lippman, M. E., and Salomon, D. S. (1988). Mol. Endocrinol. 2, 543-555. Beauchamp, R. D., Barnard, J. A., McCutchen, C. M., Cherner, J. A,, and Coffey, R.J. (1989). J. Clin. Invest. 84, 1017-1023. Bjorge, J. D., Paterson, A. J., and Kudlow, J. E. (1989). J. Biol. Chern. 264, 4021-4027. Brachmann, R., Lindquist, P. B., Nagashima, M., Kohr, W., Lipari, T., Napier, M., and Derynck, R. (1989). Cell 56, 691-700. Brenner, D. A,, Koch, K. E., and Leffert, H. L. (1989). DNA 8, 279-285. Bringman, T. S., Lindquist, P. B., and Derynck, R. (1987). Cell 48, 429-440. Carpenter, G., and Wahl, M. I. (1990). I n “Peptide Growth Factors and Their Receptors” (M. B. Spron and A. B. Roberts, eds.), pp. 69-171. Springer-Verlag, New York. Chang, W., Upton, C., Hsu, S.-L., Purchio, A. F., and MacFadden, G. (1987). Mol. Cell. Biol. 7 , 535-540. Ciardiello, F., Kim, N., Hynes, N., Jaggi, R., Redmond, S., Liscia, D. S., Sanfilippo, B., Merlo, G., Callahan, R., Kidwell, W. R., and Salomon, D. S. (1988). Mol. Endocrinol. 2, 1202- 1215. Ciardiello, F., Valverius, E. M., Colucci-DAmato, G. L., Kim, N., Bassin, R. H., and Salomon, D. S. (1990). J. Cell Biochem 42, 45-57. Ciccodicola, A,, Dono, R., Obici, S., Simeone, A,, Zollo, M., and Persico, G. (1989). EMBO J. 8, 1987-1991. Coffey, R. J., Derynck, R., Wilcox, J. N., Bringman, T. S., Goustin, A. S., Moses, H. L., and Pittelkow, M. R. (1987). Nature (London) 328, 817-820. Davis, C. G. (1990). New B i o l o p t 2, 410-419. De Larco, J. E., and Todaro, G. J. (1978). Proc. Natl. Acad. Sci. U.S.A. 75,4001-4005. Derynck, R.,Roberts, A. B., Winkler, M. E., Chen, E. Y., and Goeddel, D. V. (1984). Cell 38, 287-297. Derynck, R.,Goeddel, D. V., Ullrich, A,, Gutterman, J. U.,Williams, R. D., Bringman, T. S., and Berger, W. H. (1987). Cancer Res. 47, 707-712. Di Fiore, P. P., Pierce, J. H., Fleming, T. P., Hazan, R.,Ullrich, A., King, C. R., Schlessinger, J., and Aaronson, S. A. (1987). Cell 51, 1063-1070. Di Marco, E., Pierce, J. H., Fleming, T. P., Kraus, M. H., Molloy, C. J., Aaronson, S. A., and Di Fiore, P. P. (1989). Oncogene 4, 831-838. Ebner, R., and Derynck, R. (1991). Cell Regul. 2, 599-612. Elder, J. T., Fisher, G. J., Lindquist, P. B., Bennett, G. L., Pittelkow, M. R., Coffey, R. J., Ellingsworth, L., Derynck, R., and Voorhees, J. J. (1989). Science 243, 811-814. Finzi, E., Fleming, T., Segatto, O., Pennington, C. Y., Bringman, T. S., Derynck, R., and Aaronson, S. (1987). Proc. Natl. Acad. Sca. U.S.A. 84, 3733-3737. Finzi, E., Kilkenny, A,, Strickland, J. E., Balaschak, M., Bringman, T., Derynck, R., Aaronson, S., and Yuspa, S. H. (1988).Mol. Carcinog. 1, 7-12. Can, B. S., Hollenberg, M. D., MacCannell, K. L., Lederis, K., Winkler, M. E., and Derynck, R. (1987). J. Phurmacol. Exp. Ther. 242, 331-337. Gavrilovic, J., Moens, G., Thiery, J. P., and Jouanneau, J. (1990). Cell Regul. 1, 1003-1014. Gentry, L. E., Twardzik, D. R., Lim, G. J., Ranchalis, J., and Lee, D. C. 91987). Mol. Cell. Biol. 7, 1585-1591. Gray, A., Dull, T. J., and Ullrich, A. (1983). Nature (London) 303, 722-725. Han, V. K. M., Hunter, E. S., Pratt, R. M., Zendegui, J. G., and Lee, D. C. (1987). Mol. Cell. Biol. 7 , 2335-2343.
50
RIK DERYNCK
Higashiyama, S., Abraham, J. A,, Miller, J., Fiddes, J. C., and Klagsbrun, M. (199 1). Science 251, 936-939. Ibbotson, K. J., Harrod, J., Gowen, M., D’Souza, S., Winkler, M. E., Derynck, R., and Mundy, G. R. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 2228-2232. Ignotz, R. A., Kelly, B., Davis, R. J., and MassaguC,J. (1986).Proc. Natl. Acad. Sci. U.S.A. 83, 6307-63 1 1. Jhappan, C., Stahle, C., Harkins, R. N., Faustos, N., Smith, G. H., and Merlino, G. T. (1990). Cell 61, 1137-1146. Kaplan, P. L., and Ozanne, B. (1982). Virology 123, 372-380. Kaplan, P. L., Topp, W. C., and Ozanne, B. (1981). Virology 108,484-490. Keating, M. T., and Williams, L. T. (1988). Science 239, 914-916. Kimura, H., Fischer, W., and Schubert, D. (1990). Nature (London) 348, 257-261. Klagsbrun, M., and Folkman, J. (1990). I n “Peptide Growth Factors and Their Receptors” (M. B. Sporn and A. B. Roberts, eds.), pp. 549-586. Springer-Verlag, New York. Kobrin, M. S., Samsoondar, J., and Kudlow, J. E. (1988).J. Bwl. C h . 261, 14414-14419. Kriegler, M., Perez, C., DeFay, K., Albert, I., and Lu, S. D. (1988). Cell 53, 45-53. Kumar, R., and Mendelsohn, J. (199O).J.Biol. Chem. 265, 4578-4582. Lax, I., Johnson, A., Howk, R., Sap, J., Bellot, F., Winkler, M., Ullrich, A,, Vennstrom, B., Schlessinger, J., and Givol, D. (1988). Mol. Cell. B i d . 8, 1970-1978. Lee, D. C., and Han, V. K. M. (1990).I n “Peptide Growth Factors and Their Receptors. 11” (M. B. Sporn and A. B. Roberts, eds.), pp. 61 1-643. Springer-Verlag, New York. Lee, D. C., Rose, T. M., Webb, N. R., and Todaro, G. J. (1985). Nature (London) 313,489491. Lin, Y.-Z., Caporaso, G., Chang, P.-Y., Ke, X.-H., and Tam, J. P. (1988). B i o c h t s t y 27, 5640-5645. Liu, S. C., Sanfilippo, B., Perroteau, I., Derynck, R., Salomon, D. S., and Kidwell, W. R. (1987). Mol. Endorrinol. 1, 683-692. Luetteke, N. C., Michalopoulos, G. K., Teixid6, J., Gilmore, R., MassaguC, J., and Lee, D. C. (1988). B i o c h a t s t y 27, 6487-6494. Madtes, D. K., Raines, E. W., Sakariassen, K. S., Assoian, R. K., Sporn, M. B., Bell, G. I., and Ross, R. (1988). Cell 53, 285-293. Marquardt, H., and Todaro, G. J. (1982).J. Biol. Chem. 257, 5220-5225. Marquardt, H., Hunkapiller, M. W., Hood, L. E., and Todaro, G. J. (1984). Science 223, 1079- 1082. MassaguC, J. (1983).J. Biol. Chem. 258, 13614-13620. MassaguC, J. (1990).J . Biol. Chem. 265, 21393-21396. Matsui, Y., Halter, S. A., Holt, J. T., Hogan, B. L. M., and Coffey, R. J. (1990). Cell 61, 1147-1 155. Morrison, R. S., Kornblum, H. I., Leslie, F. M., and Bradshaw, R. A. (1987). Science 238, 72-75. Mroczkowski, B., Reich, M., Chen, K., Bell, G. I., and Cohen, S. N. (1989).Mol. Cell. biol. 9, 2771-2778. Mueller, S. G., Kobrin, M. S., Paterson, A. J., and Kudlow, J. E. (1989).Mol. Endocrinol. 3, 976-983. Mundy, G. R., Ibbotson, K. J., and DSouza, S. M. (1985). J. Clin. Invest. 76, 391-394. Myrdal, S. E., Twardzik, D. R., and Aversperg, N. (1986).J. Cell Biol. 102, 1230-1234. Nieto-Sampedro, M. (1988). Science 240, 1784-1787. NistCr, M., Libermann, T. A., Betsholtz, C., Petterson, M., Claesson-Welsh, L., Heldin, C.-H., Schlessinger, J., and Westermark, B. (1988). Cancer Res. 48, 3910-3918. Pandiella, A., and MassaguC, J. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 1726-1730.
PHYSIOLOGY OF TGF-(Y
51
Petch, L. A., Harris, J., Raymond, V. W., Blasband, A., Lee, D. C., and Earp, H. S. (1990). Mol. Cell. Biol. 10, 2973-2982. Pfeffer, S., and Ullrich, A. (1985). Nature (London) 313, 184. Pittelkow, M. r., Lindquist, P. B., Abraham, R., Graves-Deal, R., Derynck, R., and Coffey, R. J. (1989).J. Biol. Chem. 264, 5164-5171. Plowman, G. D., Green, J. M., MacDonald, V. L., Neubauer, M. G., Disthche, C. M., Todaro, G. J., and Shoyab, M. (1990). Mol. Cell. Biol. 10, 1969-1981. Rall, L. B., Scott, J., Bell, G. I., Crawford, R. J., Penschow, J. D., Niall, H. D., and Coghlan, J. P. (1985). Nature (London) 313, 228-231. Rappolee, D. A., and Werb, Z. (1991). Curr. T q . Microbiol. Immunol. (in press). Rappolee, D. A,, Mark, D., Banda, M. J., and Werb, 2. (1988a). Science 241, 708712. Rappolee, D. A., Brenner, C. A., Schultz, R., Mark, D., and Werb, Z. (1988b). Science 241, 1823- 1825. Rettenmier, C. W., and Roussel, M. F. (1988). Mol. Cell. Biol. 8, 5026-5034. Rettenmier, C. W., Roussel, M. F., Ashmun, R. A., Ralph, P., Price, K., and Scherr, C. J. (1987). Mol. Cell Biol. 67, 2378-2387. Rosenthal, A., Lindquist, P. B., Bringman, T. S., Goeddel, D. V., and Derynck, R. (1986). Cell 46, 301-309. Russell, D. W., Schneider, W. J., Yamamoto, T., Brown, M. S., and Goldstein, J. L. (1984). Cell 37, 577-585. Salomon, D. S., Perroteau, I., Kidwell, W. R., Tam, J., and Derynck, R. (1987). J . Cell. Physiol. 130, 397-409. Sandgren, E. P., Luetteke, N. C., Palmiter, R. D., Brinster, R. L., and Lee, D. C. (1990). Cell 61, 1121-1135. Savage, C. R., Hash, J. H., and Cohen, S. N. (1973).J. Biol. Chem. 248, 7669-7672. Savage, T. R., Inagami, T., and Cohen, S. N. (1972).J. Biol. Chem. 247, 7612-7627. Schreiber, A. B., Winkler, M. E., and Derynck, R. (1986). Science 232, 1250-1253. Schultz, G. S., White, M., Mitchell, R., Brown, G., Lynch, J., Twardzik, D. R., and Todaro, G. J. (1987). Science 235, 350-352. Scott, J., Urdea, M., Quiroga, M., Sanchez-Pescador, R., Fong, N., Selby, M., Rutter, W. J., and Bell, G. I. (1983). Science 221, 236-240. Shankar, V., Ciardiello, F., Kim, N., Derynck, R., Liscia, D. S., Merlo, G., Langton, B. C., Sheer, D., Callahan, R., Bassin, R. H., Lippman, M. E., Hynes, N., and Salomon, D. S. (1989). Mol. Carcinog. 2, 1-1 1. Shaw, A. S., Amrein, K. E., Hammond, C., Stern, D. F., Sefton, B. M., and Rose, J. K. (1989). Cell 59, 627-636. Shaw, A. S., Chalupny, J., Whitney, A., Hammond, C., Amrein, K. E., Kavathas, P., Sefton, B. M., and Rose, J. K. (1990). Mol. Cell. Biol. 10, 1853-1862. Shoyab, M., McDonald, V. L., Bradley, J. G., and Todaro, G. J. (1988). Science 243, 10741076. Smith, J. J., Derynck, R., and Korc, M. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 7567-7570. Smith, J. M., Sporn, M. B., Roberts, A. B., Derynck, R., Winkler, M. E., and Gregory, H. (1985). Nature (London) 315, 515-516. Sporn, M. B., and Roberts, A. B. (1988). Nature (London) 332, 217-219. Sporn, M. B., and Todaro, G. J. (1980). N. Engl. J . Med. 303,878-880. Stern, D. F., Hare, D. L., Caecchini, M. A., and Weinberg, R. A. (1987). Science 235, 321324. Stern, P. H., Krieger, N. S., Nissenson, R. A,, Williams, R. D., Winkler, M. E., Derynck, R., and Strewler, G. J. (1985).J. Clin. Invest. 76, 2016-2019.
52
RIK DERYNCK
Stroobant, P., Rice, A. P., Gullick, W. J., Cheng, D. J., Kerr, I. M., and Waterfield, M. D. (1985). Cell 42, 383-393. Sudhof, T. C., Russell, D. W., Goldstein, J. L., and Brown, M. S. (1985). Science 228,893895. Teixid6, J., and Massaguk, J. (1988).J. B i d . Chem. 263, 3924-3929. Teixid6, J., Gilmore, R.,Lee, D. C., and Massaguk, J. (1987).Nature (London) 326,883-885. Teixidb, J., Wong, S. T., Lee, D. C., and Massagu6, J. (199O).J. Biol. Chem. 265,6410-6415. Todaro, G. J., Fryling, C., and De Larco, J. E. (1980).Proc. Natl. Acad. Scz. U.S.A. 77,52585262. Turner, J. M., Brodsky, M. H., Irving, B. A., Levin, S. D., Perlmutter, R. M., and Littman, D. R. (1990). Cell 60, 755-765. Upton, C., Macen, J. L., and MacFadden, G. (1987).J. Vzrol. 61, 1271-1275. Valverius, E. M., Bates, S. E., Stampfer, M. R., Clark, R., McCormick, F., Salomon, D. S., Lippman, M. E., and Dickson, R. B. (1989).Mol. Endocrinol. 3, 203-214. Venkatesan, S., Gershowitz, A., and Moss, B. (1982).J. Virol. 44, 637-646. Vonderhaar, B. K. (1987).J. Cell. Physiol. 132, 581-584, Watanabe, S., Lazar, E., and Sporn, M. B. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 12581262. Wilcox, J. N., and Derynck, R. (1988a).J. Neurosci. 8, 1901-1904. Wilcox, J. N., and Derynck, R. (1988b).Mol. Cell. biol. 8, 3415-3422. Wong, S. T., Winchell, L. F., McCune, B. K., Earp, H. S., Teixido, J., Massague, J., Herman, B., and Lee, D. C. (1989). Cell 56,495-506.
THE ROLE OF Raf-1 PHOSPHORYMTION IN SIGNAL TRANSDUCTION Gisela Heidecker,* Walter Kolch,*1 Deborah K. Morrison,t and Ulf R. Rapp* 'Viral Pathology Section, Laboratory of Viral Carcinogenesis, NCI-Frederick Cancer Research and Development Center, Frederick, Maryland 21702,
tABL- Basic Research Program, NCI-Frederick Cancer Research and Development Center, Frederick, Maryland 21702
I. The raf Oncogene Family Raf- 1 Activation following Growth Factor Stimulation A. Modes of Raf-1 Activation B. Raf-1 Activation in Cells Expressing Oncogenically Activated PTKs 111. Sites of Raf- 1 Phosphorylation A. Sites of Serine/Threonine Phosphorylation B. Sites of Tyrosine Phosphorylation I v. Consequences of Raf-1 Activation A. Raf- 1 in Activated Receptor Complexes B. Relative Position of Raf in the Signaling Cascade C. Substrates of Activated Raf-1 V. Conclusion References 11.
1. The raf Oncogene Family Raf proteins are serine/threonine-specific protein kinases that function in signal transduction, transmitting mitogenic signals from the ligand-activated growth factor receptors at the cell surface to the transcriptional machinery in the nucleus. The general properties of raffamily genes and their role in carcinogenesis have recently been reviewed (Rapp, 1991; Kolch et al., 1990a; Storm et al., 1990a). Briefly, so far three active genes, c-raf-1, A-raf-1, and B-raf have been described in human, mouse, rat, and chicken cells. In mouse and chicken cells (in the latter, the gene is called mil), truncated versions of c-raf-1 and B-raf have been found as oncogenes of acutely transforming viruses (Rapp et al., 1983a,b; Jansen et al., 1983, 1984; Sutrave et al., 1984; Evchene et al., 1990), and all three genes can be oncogenically activated in vitro (Huleihe1 et al., 1986; Heidecker et al., 1990; Sithanandam et al., 1990). They have been mapped to three different chromosomes and are located at
Current address: W e c k e AG, Biological Research and Biotechnology, Mooswaldalleel-9, 7800 Freiburg, Germany.
53 ADVANCES IN CANCER RESEARCH, VOL. 58
Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
54
GISELA HEIDECKER ET AL.
sites that are frequently altered in human tumors (Sithanandam et al., 1989; Storm et al., 1990a,b). c-ruf-1 is ubiquitously expressed although at variable levels. A-ruf transcripts are most prominent in urogenital tissues and B-raf expression is most abundant in testis and cerebrum (Storm et al., 1990b). T h e raf genes, like most oncogenes, are highly conserved, and homologues have been identified in Xenopur (Le Guellec et al., 1988) and Drosophila (Mark and Rapp, 1984; Mark et al., 1987), in which one of the two gene family members was first identified as the developmental l(1) polehole gene (Ambrosio et al., 1989) acting in concert with the torso gene, which ,encodes a transmembrane phosphotyrosine kinase. A raf-related gene has recently been isolated from CaenorhabditG elegans (Georgi et al., 1990), which combines a Raf-like kinase domain with an amino-terminal region with similarity to the transmembrane and receptor part of transmembrane receptor kinases found in higher organisms. Based on phylogenetic studies, the raf genes, together with mos, encode the only serine/threonine kinases that belong to the src superfamily, which otherwise encodes protein tyrosine kinases (PTKs) (Hanks et al., 1988). 11. Raf-1 Activation following Growth Factor Stimulation
In this article we will concentrate on the evidence for entry of cytosolic Raf- 1 kinase into activated receptor complexes as well as complexdependent or -independent phosphorylation of Raf- 1 on tyrosine and serine residues, which leads to enzyme activation. So far, very little work in this area has addressed the roles of A- o r B-raJ T h e involvement of Raf-1 has been analyzed in more than a dozen receptor systems, all involved in the transduction of mitogenic signals. The findings have lead to the following conclusions: All mitogens but one stimulated Raf-1 kinase activity. Raf- 1 activation was accompanied b y increased Raf- 1 phosphorylation, leading to a characteristic shift in apparent molecular weight (App et al., 1991; Blackshear et al., 1990; Carroll et al., 1990; K. Dell and L. T. Williams, unpublished observations; Kovacina et al., 1990; Morrison et al., 1988, 1989; Siege1 et al., 1990; Thompson et al., 1991; B. C. Turner et al., 1991). Depending on the receptor system, the entire pool of cellular Raf- 1 is activated within 1-20 min and returns to ground levels within 30-120 min in the absence of stimulation. The only mitogen that so far has failed to activate Raf-1 kinase is interleukin-4 (IL-4). Stimulation with I L 4 also resulted in only intermediate growth induction, indicating that I L 4 is not a complete mitogen (B. C. Turner et al., 1991).
1,2: ras regulated?
3: PKC regulated? FIG. 1. Growth factor receptor activation of Raf-1. These receptor systems include receptors with intrinsic or with associated PTK. Ligand-dependent Raf- 1 kinase activation can be triggered by both receptor categories. Several independent pathways exist for Raf coupling: tyrosine phosphorylation, PKC-dependent serine phosphorylation, and PKCindependent serine phosphorylation. Receptors with intrinsic PTK couple predominantly via the latter pathway; receptors with associated P T K couple predominantly via tyrosine phosphorylation, the exception being TCR and Thy-I in 2B4 cells, which exclusively couple via PKC-dependent serine phosphorylation. Ras function is presumably required for stoichiometric Raf-1 activation since blocking YUS. by use of an inducible dominant negative YUS mutant construct inhibits Raf-1 shift induction by serum (U. R. Rapp and G. M. Cooper, unpublished). Ras control of Raf-1 activation may occur at the level of receptor complex formation, Raf- 1 phosphorylation, or may involve regulation of Raf- 1activating second messengers.
56
GISELA HEIDECKER ET AL.
A. MODESOF Raf-1 ACTIVATION The type of Raf-1 phosphorylation that was detected early after receptor engagement varied, depending on the receptor system as well as the cell type in which the activation was analyzed. Basically, four different modes of Raf-1 activation have been observed so far (Table I and Fig. 1): 1. Activation concomitant with protein kinase C-independent phosphorylation on serine residues. 2. Activation following phosphorylation mostly on serines and to a limited extent (less than 1% of the Raf-1 molecules) on tyrosines. 3. Activation accompanied by phosphorylation on tyrosines and serines to about equal levels. 4. Activation with protein kinase C-dependent serine phosphorylation. 1. Protein Kinase C-Independent Sen'nelThreonine Phosphorylation The first mode of activation is most commonly observed following activation of growth factor receptors with intrinsic tyrosine kinase activity. Members of the four structural classes of transmembrane PTK receptors have been analyzed. Ligand binding of insulin receptor (Kovacina et al., 1990; Blackshear et al., 1990) in epithelial cells, and of epidermal growth factor (EGF) receptor (App et al., 1991)and fibroblast growth factor (FGF) receptor (K. Dell and L. T. Williams, unpublished observations) in fibroblasts, was shown to result in an increase of Raf-1 kinase activity, and the same was observed in myeloid cells activated through the colony-stimulating factor (CSF) receptor (Baccarini et al., 1990). In the cases of the EGF and insulin receptors, pretreatment with phorbol ester for 16 hr did not inhibit Raf activation, demonstrating that protein kinase C (PKC) is not responsible for the serine phosphorylation. Indeed, a Raf kinase kinase has been isolated from insulinstimulated cells (Lee et al., 1991). Raf activation following insulin stimulation was also shown to be insensitive to phenyl arsenite oxide, an inhibitor of tyrosine phosphatase that had been used to uncover cryptic tyrosine phosphorylation in other cases (Blackshear et al., 1990), and the increased activity following the stimulation was not diminished by tyrosine-specific phosphatases but could be reduced to basal levels by serine-specific phosphatases (Kovacina et al., 1990). These results taken together suggest that even a minute level of initial tyrosine phosphorylation plays no role in Raf activation in the case of insulin-dependent activation in epithelial cells.
TABLE I MODES OF Raf-ACTIVATION
Cell type
Signal
~
Fibroblast
BAC1.2F5 PC12 a
Kinase activation
Reference
~~
Insulin Insulin
Ser (Tyr)" Ser Ser Ser Ser, Tyr Not determined Ser Ser
IL2 IL-4 Anti-CD4 AntLCD3
Ser, Tyr N o t determined Ser (Tyr)" Ser
IL-3 GMC-SF 1L3 GM-CSF CSF NGF
Ser, Tyr Ser, Tyr Ser (Tyr)" Ser (Tyr)a Ser Ser
PDGF EGF FGF TPA v-src V f i
HeLa-1R cells H5 hepatoma T cells CTLL-2 CTLL-2 CD4 + 2B4 Myeloid cells FDC-PI DA-3
Raf- 1 phosphor y lation on
Morrison et al. (1988, 1989) Morrison et al. (1988); App et al. (1991) Morrison et al. (1988) Morrison et al. (1988) Morrison et al. (1988) Morrison et al. (1988) Kovacina et al. (1990) Blackshear et al. (1990)
+ + +
Only a small fraction of Raf-1 (2%or less) was phosphorylated on tyrosine residues. K. Wood, S. Halegoua, and T. Roberts (personal communication).
B. C. Turner et al. (1991) B. C. Turner et al. (1991) Thompson et al. (1991) Siege1 et al. (1990) Caroll et al. (1990) Caroll et al. ( 1990) Kanakura et al. (1991) Kanakura et al. (1991) Baccarini et al. (1990) In Morrison (1991)b
58
GISELA HEIDECKER E T AL.
2. SerinelThreonine and Low-Level Tyrosine Phosphorylation The only transmembrane PTK growth factor receptor that has been shown to phosphorylate Raf- 1 on tyrosines is platelet-derived growth factor (PDGF) receptor (Morrison et al., 1989). Direct tyrosine phosphorylation was demonstrated when Raf- 1 and PDGF receptor were coproduced in the baculovirus expression system. However, in mouse BALB 3T3 cells, the stoichiometry of the reaction was very low; less than 1% of the Raf molecules were recognized by antiphosphotyrosine antibodies. Indeed, it is possible that not PDGF receptor but an associated tyrosine kinase is responsible for Raf tyrosine phosphorylation, based on the demonstration that several intracellular src family PTKs bind and are activated by PDGF receptor (Kypta et al., 1990). Phosphorylation of Raf- 1 by a transmembrane receptor complex with associated tyrosine kinase has been demonstrated in a human T cell line following CD4 cross-linking. The CD4 transmembrane receptor is bound to the src family tyrosine kinase Lck (Turner et al., 1990; Shaw et al., 1990), which probably directly phosphorylated a small fraction (<1%) of Raf-1 on tyrosines. The tyrosine modification is followed by phosphorylation on serines catalyzed either by an autophosphorylating activity of Raf-1, or by a Raf-1 kinase kinase (Thompson et al., 1991). In agreement with the abortive mitogenic signaling observed when only CD4 is stimulated, Raf-1 phosphorylation was limited to only 1-5% of all molecules with an early maximum after 30 sec and return to ground state after 5 min.
3 . SerineIThreonine and Tyrosine Phosphorylation to about Equal Levels Another example of this type of activation was seen in human myeloid M07 cells following stimulation with I L 3 or granulocyte/ macrophage CSF (GM-CSF) (Kanakura et al., 1991).Again phosphotyrosine accounted for only a small fraction (<2%) of the phosphorylation of Raf- 1. The time course of Raf- 1 activation for these two receptors was slower than that observed for CD4 stimulation, with maximal activity being reached after 1 min and persisting for at least 15 min. Interestingly, the induction of Raf-1 shift was even slower, taking in both cases 15 min to attain maximum. In contrast to these last results, a large fraction of the Raf-1 population (30-50%) was phosphorylated on tyrosine in murine myeloid lines FDC-P1, 32D, and DA-3 after I L 3 and GM-CSF treatment and in murine T cell line CTlO following I L 2 stimulation, which again corre-
Raf- 1 PHOSPHORYLATION
59
lated with increased Raf-1 activity ( B . C. Turner et al., 1991). The I L 2 and I L 3 transmembrane receptors are multisubunit complexes and to date the associated cellular tyrosine kinases have not been identified, although there is some evidence in the case of the IL-2p receptor for ligand-dependent association and activation of the Lck PTK (Horak et al., 1991). In all cases in which an increase in tyrosine phosphorylation was observed, higher levels of phosphoserines were also reported. It is possible that this is caused by Raf-1 autophosphorylation, which has been observed with partially purified enzyme (H. App, W. Kolch, and U. R. Rapp, unpublished observations). Overall, the time course of activation and phosphate incorporation was comparable to that seen for the activation of Raf- 1 following transmembrane growth factor PTK stimulation. 4. Protein Kinme C-Dependent Phosphorylation
The fourth mode of Raf-1 activation was observed following T cell receptor complex stimulation by CD3 or Thy-1 cross-linking (Siege1 et al., 1990). In this case, Raf-1 phosphorylation occurred only on serines and was not observed if PKC had been down-regulated with 12-0tetradecanoyl phorbol- 13-acetate (TPA). Raf- 1 phosphopeptide maps were identical following TPA or T cell receptor stimulation. It is interesting to note in this context that GTPase-activating protein (GAP) activation and, consequently, Ras induction following T cell receptor stimulation have also been shown to be PKC mediated (Downward et al., 1990).
B. Raf-1 ACTIVATION IN CELLS EXPRESSING ONCOGENICALLY ACTIVATED PTKs Ectopically expressed PTKs can functionally replace activated growth factor receptors (for review see Kolch et al., 1990). In cells expressing oncogenically activated PTKs, Raf- 1 is hyperphosphorylated and activated (Morrison et al., 1988). This was especially well demonstrated in FDC-P1 cells, which could be conditionally abrogated for their I L 3 requirement by a temperature-sensitive activated mutant of abl (Cleveland et al., 1989). Under permissive conditions, Raf- 1 become tyrosine phosphorylated and activated (Carroll et al., 1990). 111. Sites of Raf-1 Phosphorylation The Raf-1 molecule has a molecular weight of 74,000 and can be divided into two functional domains, the amino-terminal regulatory half and the carboxy-terminal kinase domain. Based on homology analysis, three conserved regions (CRl, CR2, and CR3) can be identified in the
60
GISELA HEIDECKER ET AL.
Raf family proteins. The first two are located in the regulatory domain and are apparent when the different Raf family members are compared to each other. CR1 is located between residues 62 and 195 and can be divided into two segments, one that is unrelated to any sequence in the National Biological Research Foundation (NBRF) Protein Sequence Data Library, yet is well conserved within the Raf family, and a second segment that contains a cysteine array often referred to as a cysteine finger. CR2 is located between residues 255 and 268, and is very rich in serines and threonines. CR3 constitutes the kinase domain from positions 330 to 608 in Raf-1 (Mark and Rapp, 1984). These conserved regions are interspersed by variable regions (Vl, V2, V3, and V4) that diverge between the different isoforms but are highly conserved within each isoform, suggesting that these variable regions are important for the functional diversification of Raf kinases. The conservation of the Nand C-termini within each isoform is consistent with the idea that the two ends of the molecule interact in the native form and are essential for activity regulation of the enzyme. However, the C-terminal region is not essential for unregulated activity because determination of the minimal transforming sequence showed that the last 20 residues in v-Raf are not necessary for transformation or kinase activity (Heidecker et al., 1990). The borders of the minimal transforming sequence coincide with the borders of CR3 (Heidecker et al., 1990). Evidence for the regulatory role of the amino-terminal half comes from various mutant raf-1 genes. The different v-raf and v-mil genes have all experienced extensive truncation of 5’ coding sequences, and the same was observed for raf-1 genes activated during transfection procedures (Ishikawa et al., 1986; Fukui et al., 1985; Shimizu et al., 1985; Stanton and Cooper, 1987) in which the gene was fragmented due to its large size, 17 exons being distributed over more than 50 kb (Bonner et al., 1986; Beck et al., 1990). Long terminal repeat (LTR) insertion into intron 5 has also resulted in raf gene activation, giving rise to a 48-kDa protein with high transforming activity (Molders et al.,1985).In addition to deletion of the regulatory domain, its perturbation by fusing additional sequences to its amino terminus or by linker insertion mutagenesis has also led to unregulated kinase activity (Heidecker et al., 1990; Ishikawa et al., 1988). Although not closely related in evolutionary terms, the overall structure of the Raf-1 kinase is similar to that of the protein kinase C family members. These also consist of the carboxy-terminalkinase domain and a regulatory amino-terminal half containing the calcium-binding motif and in most isozyme forms two cysteine finger motifs, which have been shown genetically to be involved in binding the phospholipid activator.
165CQTCGYKFHEHCi77
\
NQQFGYQRRASDDKLTDS~\
/
334GQRQSSYYWEIEASEVMLSTBIGSGSFGTVYKGKW367
FIG.2. Possible phosphorylation sites in Raf-1. The overall structure of the Raf-1 molecule is shown with the locations of conserved regions (CR) 1, 2, and 3 indicated. Sequences containing possible phosphorylation sites discussed in the text are shown with the tyrosine (Y) and serine (S) residues in boldface type. Other residues often found in kinase substrate motifs are underlined, such as arginines (R) found in serine phosphorylation sites and acidic residues in the environment of tyrosine sites. Other abbreviations: A, alanine; C, cysteine; D, aspartate; E, glutamate; F, phenylalanine; G, glycine; H, histidine; I, isoleucine; K, lysine; L, leucine; M, methionine; N, asparagine, P, proline; Q, glutamine; T, threonine; V, valine; W, trytophan.
62
GISELA HEIDECKER ET AL.
Phosphopeptide maps of full length Raf-1 protein from resting cells revealed four major sites of phosphorylation, while Raf-1 proteins isolated from cells following TPA or serum stimulation have more complex phosphorylation patterns (Morrison et al., 1988; Siege1 et al., 1990). Comparison of phosphopeptide maps showed that the phosphopeptides observed for Raf-1 expressed in the baculovirus/Sf9 cell system gave the identical patterns as those obtained with Raf-1 from resting cells, suggesting that autophosphorylation accounts for these modifications (Morrison et al., 1991). A truncated Raf-1 version containing the complete kinase domain gives rise to one phosphopeptide. This peptide is also present in full length Raf-1 and in the gene product of the LTR activated raf-1 gene p48LTR-rafwhich contains a second peptide not found in Raf- 1. p48LTR-Tuf generates a total of three tryptic phosphopeptides (Patschinsky and Bister, 1988) containing only phosphoserines. This finding suggests that one phosphorylation site is located in the kinase domain whereas three are present in the regulatory half. The phosphopeptide stemming from the kinase domain as well as one of the amino-terminal peptides comigrate with two of the three c-Mil peptides, whereas the third pair has the same charge but differs in its chromatographic mobility (Patschinsky and Bister, 1988).
A. SITESOF SERINE/THREONINE PHOSPHORYLATION We have determined two of the serine phosphorylation sites-both are located in the aminoterminal half and have been likely candidates for phosphorylation based on biological features. The first one is the serine at position 43 (Fig. 2). The surrounding sequence IVQQFGYQRRASDDGKLTD constitutes a suitable substrate for several serine/ threonine-specific protein kinases (PSK), including PKC, which require basic residues in the environment and have the consensus sequence RXET (Kemp and Pearson, 1990). In addition to this sequence representing a possible substrate of PKC, the location of the site also is reminiscent of the pseudosubstrate sequence found on many PKC isozymes. In the case of the PKC proteins, the serine residue is replaced by alanine; nevertheless a peptide containing the sequence RFARKGALRQKNVHEVKN is able to compete with serine-containing substrate peptides efficiently and to prevent autophosphorylation of PKC (House and Kemp, 1987). It is thought that the pseudosubstrate occupies the active site of PKC, but is released when the protein undergoes conformational change after phospholipid stimulation, enabling substrate phosphorylation. Similar control features have been found in several other kinases, including some (cGMP-dependentPK and CAMP-dependent PK 11) that,
Raf- 1 PHOSPHORYLATION
63
like Raf-1, contain a true substrate sequence (for review see Hardie, 1988). The synthetic peptide containing the Raf-1 sequence is a good substrate for Raf- 1 kinase activity, suggesting that the sequence could function in the regulation of Raf-1 activity. We have generated two mf-1 mutants, one with serine replaced by alanine and the other with Glu-Ile instead of the two arginines. Phosphopeptide maps of the latter mutant produced in the baculovirus/Sf9 system showed only three instead of the normal four spots, suggesting that one of the phosphorylation sites had been removed. However, when we tested whether the predicted reduction in the affinity of the active site for the mutated substrate sequences would result in constitutively activated Raf-1 kinase the answer was ambiguous. When introduced into NIH 3T3 cells as part of a retroviral expression vector the mutant raf genes did not cause overt transformation; however, cells containing this construct took on a transformed phenotype after only a few passages. In vitro kinase assays comparing Raf- 1 kinase activity of resting and stimulated cells expressing only the endogeneous wild-type or wild-type and mutant protein have been inconclusive. Further evidence that this sequence is not the sole determinant for Raf-1 activation is the fact that deletion of the first 50 amino acids results only in a weak oncogenic activation (Stanton et al., 1989). We are currently analyzing whether these mutant proteins show any differences in the way they respond to several mitogenic stimuli. The second phosphorylation site in the amino-terminal half is located in CR2 (253QRQRSTSTPNVHMVSTT), which is very rich in serine and threonines (Fig. 2). Perturbation of this region by deletion or linker insertion has been shown to cause oncogenic activation (Ishikawa et al., 1988; Rapp et al., 1988; Heidecker et al., 1990) suggesting that it plays a role in a negative regulation of Raf- 1 activity. Interestingly, the linker insertion mutant, in addition to perturbing the predicted secondary structure of the protein, introduced a duplication of the RX!j motif. Sequencing of phosphopeptides revealed Ser259 as the second site of phosphorylation in the regulatory domain. Based on these two sites the consensus sequence for Raf- 1 autophosphorylation is RXXS. Neither of the other two sites in resting Raf-1 nor the additional sites from the activated protein have been determined. Instead the evidence for these phosphorylation sites on Raf is more indirect. Examination of the Raf-1 sequence for possible target sites for Raf-1 itself, as well as for various serinelthreonine sites, leaves one with either too many or too few possibilities depending on the stringency of pattern matching one applies. As there are too many serine and threonine residues in both domains which fit consensus requirements for a variety of PSKs to address each
64
GISELA HEIDECKER ET AL.
one individually, we will concentrate here on two more sites which have come into focus based on a variety of findings for homologous sites in other related kinases. The sequence LLTRIGIGSFGIVFR is in the kinase domain containing the GxGxxG motif, which is an integral part of the ATP binding site (Fig. 2). Various other nucleotide-binding proteins have been shown to be regulated by mutations in this region, e.g., cdc2 kinase in fission yeast has a tyrosine instead of the phenylalanine residues in front of the third glycine. Phosphorylation of this tyrosine has been shown to regulate cdc2 kinase activity and thus entry into mitosis (Gould and Nurse, 1989). The threonine and serine residues within the motif could play a similar role in the regulation of Raf-1. Possibly phosphorylation of this site would interfere with ATP binding and thus would have a negative effect on Raf- 1 kinase activity. We are currently investigating this possibility using mutants generated by site-directed mutagenesis. The second region with the sequence 489ATVKSRWSGEQQ501 is located between the highly conserved DFG motif implicated in ATP binding, and the APE motif of the catalytic site. This region contains autophosphorylation sites in many PTKs and either of the highlighted serine residues could be homologous to Tyr416 in pp60c-src. Phosphorylation of this residue is necessary for src kinase activation (PiwnicaWorms et al., 1987), and similar reports have been published for the homologous residue of the insulin receptor (Ellis et al., 1986). Although the sequence surrounding this residue is not very well conserved throughout the kinase family, many serinelthreonine kinases have in this region either threonine or serine residues that could function as substrates (Hanks et al., 1988). In the case the of yeast CAMP-dependent kinase, Thr42 1 is phosphorylated (Lewis et al., 1988). A mutation of this residue to Ala results in decreased interactions with the regulatory subunit. It had, however, no effect on the catalytic activity. We have three lines of evidence that phosphorylation of serines in this region plays a role in the regulation of Raf- 1 kinase activity. When bacterially expressed Raf- 1 or A-Raf peptides representing the C-terminal26 lysines of the proteins were used as PKC substrates an vitro, Raf-1 peptide was an efficient substrate but the A-Raf peptide was not (W. Kolch and U. R. Rapp, unpublished observations). Phosphorylation of the Raf- 1 peptide could be blocked with a monoclonal anti-Raf antibody that recognizes sequences around residue 500 (Kolch et al., 1990b).One of the differences between Raf-1 and A-Raf in this region is that the latter has an alanine residue instead of the serine at position 499, making it likely that this is the site that is occluded by the monoclonal antibody and that it serves as a substrate for PKC phosphorylation in vitro. The phos-
Raf- 1 PHOSPHORYLATION
65
phopeptide maps of Raf- 1 treated with partially purified PKC coincided with those obtained with Raf-1 isolated from cells following TPA stimulation, suggesting that the same sites are modified in nitro and in vivo, and that Ser499 plays a role the regulation of Raf-1 activity by PKC. Experiments using synthetic peptides with the above sequence confirm that PKC will phosphorylate this sequence Zn nitro. The peptide can also be used as substrate in Raf-1 kinase assays, suggesting that this site could also be regulated by autophosphorylation. Preliminary results from site-directed mutagenesis studies showed that exchanging Ser499 for Ala as well as replacing the basic residues with uncharged amino acids reduces the activity of Raf- 1. The first mutation interfered with the appearance of a transiently transformed phenotype observed in cells that had been cotransfected with expression vectors carrying the PKC-a and the wild-type ruf- 1 genes. When the time course of Raf- 1 kinase was compared among cells expressing only wildtype Raf-1 and those expressing a mixture of the endogenous wild-type and the mutant S499A protein, we observed that in the latter case the onset of the shift was delayed but eventually went to completion. This finding suggests that phosphorylation at the 499 position is not responsible for the shift observed after Raf-1 activation. It is at this point not clear whether the shift is induced by several different phosphorylation events, or whether one specific site needs to be hit. In the case of phospholipase C it was shown that the two forms observed after PDGF stimulation differed in only one phosphopeptide (Meisenhelder et ul., 1989). Incorporation of the double mutant Lys493-Arg495 + Trp into an expression vector with a normally transforming truncated ruf- 1 gene abolished the oncogenic activity without affecting the steady-state levels of the protein. Experiments to test whether only Ser499 or both serine residues, possibly in a hierarchical manner, are phosphorylated are currently under way. As mentioned above, in the Raf-1 sequence there are many more serine and threonine residues that could serve as substrates for various PSKs, including Raf-1, based on consensus substrate sequences. In addition to these, several others might be autophosphorylated, as has been found for rat PKC 11, wherein autophosphorylation occurred mostly on threonines that were not part of a consensus substrate sequence, but were accessible to the active site. B. SITESOF TYROSINE PHOSPHORYLATION
Experiments to identify the tyrosine phosphorylation sites of Raf- 1 have only just begun. Raf-1 contains a total of 14 tyrosines, of which 3
66
GISELA HEIDECKER ET AL.
are located in the regulatory domain. As only few natural tyrosine kinase substrate sequences have been determined so far, not much as far as predictive value for the identification of likely substrates can be gleaned, beyond the fact that most have an acidic environment (Kemp and Pearson, 1990). Only two of the tyrosine residues, a Tyr-Tyr dipeptide, in Raf-1 fit this description, and they are located at the N-terminus of CR3. Preliminary data suggest that the tyrosine phosphorylation site(s) are located in the regulatory domain, because a truncated Raf-1 protein lacking residues 26-303 does not become tyrosine phosphorylated in V i m when coexpressed with Lck or PDGF receptor in the baculovirus/ Sf9 cell system, whereas full-length Raf-1 does (Morrison et al., 1991). Functional data addressing the role of individual tyrosine residues in Raf- 1 activation suggested that Tyr38, which just precedes the potential serine/threonine kinase substrate sequence in the N-terminal region mentioned above, is a possible target site. A synthetic peptide containing this sequence served as a substrate for PDGF receptor and competed with the in Vitro tyrosine phosphorylation of Raf- 1, whereas a peptide in which phenylalanine replaces the tyrosine did not (D. K. Morrison et al., unpublished observations). However, a mutant protein with a Y38W exchange contained the same phosphopeptides as the wild-type protein following coexpression with PDGF receptor in the baculovirus expression system, suggesting that one of the other two tyrosines in the regulatory domain are those recognized by PDGF receptor. IV. Consequences of Raf-1 Activation A. Raf-1 IN ACTIVATED RECEPTORCOMPLEXES
Growth factor receptors form multichain complexes; those without intrinsic P T K activity are made up of several subunits in resting cells, whereas assembly in the case of transmembrane growth factor PTKs occurs upon receptor engagement. In several cases it has been shown that ligand binding causes the receptor to dimerize, resulting in activation of the autophosphorylation activity of the PTK (Ullrich and Schlessinger, 1990). The phosphorylated cytoplasmic domain then can interact with secondary enzymes of the growth factor-signaling cascade. Identification of the different components of the signaling complex has mostly been done by probing immune precipitates obtained with antisera against the receptor for the presence of likely associated proteins. This approach does not rule out, however, that the complex is indirect, i.e., that a third partner forms a link between the two proteins, which are visible with the immunological reagents. Many of the proteins-phos-
Raf- 1
PHOSPHORYLATION
67
pholipase C-y (PLC-y), GAP, and src-encoded family members)-that have been identified as part of the transmembrane PTK signaling complexes contain src homology 2 (SH2) sequences, which have been implicated in the interaction (Anderson et al., 1990; Ellis et al., 1990). The actual participants vary depending on the growth factor receptor, e.g., PLC-y, PI-3’ kinase, and GAP are part of the activated PDGF receptor complex (Kaplan et al., 1990; Kazlaukas et al., 1990; Morrison et al., 1990), but the closely related CSF-1 receptor did not bind PLC-y and GAP association was very weak, possibly occurring over a GAP-associated protein of 62 kDa (Reedijk et al., 1990);EGF receptor does complex with PLC-y and GAP but not PI-3’ kinase (Margolis et al., 1989; Meisenhelder et al., 1989; Ellis et al., 1990). Similarly, Raf-1 was found associated with the EGF (App et al., 1991) and PDGF receptors (Morrison et al., 1989, 1990) but not with the CSF-1 receptor (Baccarini et al., 1990). Information about the different components of receptors without intrinsic PTK activity is in general more difficult to obtain due to their complexity, even in the resting state. One exception is the CD4 complex. Here it was shown that upon stimulation by antibody cross-linking, Lck PTK, which is linked to CD4 over a shared cysteine-coordinated divalent cation (Turner et al., 1990; Shaw et al., 1990), will become activated and autophosphorylated. In this state Lck is able to bind and activate Raf- 1, as shown by Thompson et al. (1991). The physiological significance of complex formation is at this point unclear. Simple one-on-one substrate-enzyme relationships seem unlikely, as those should be very short-lived, especially after the reaction has occurred. Analysis of complexes shows that the phosphorylated protein is often retained, as evident from the fact that it can be coimmunoprecipitated. Furthermore, Raf- 1 is not phosphorylated by the EGF receptor but still forms part of the receptor complex. Only a small fraction of Raf-1 is found associated with any growth factor receptor, and in most cases it is only about 1%. Similar proportions have been observed for other receptor/secondary messenger combinations with the exception of GAP and PDGF receptors, wherein 10%of the total cellular GAP was found in anti-PDGF receptor immunoprecipitates (Kazlaukas et al., 1990). If binding between two secondary components was assayed, e.g., the presence of Raf-1 in anti-GAP precipitates following PDGF stimulation, the proportion of total protein present in the complex was often an order of magnitude lower than when direct association was analyzed (Kaplan et al., 1990; Morrison et al., 1990). It is unclear at this point whether this is a reflection of a large number of different combinations making up the receptor complexes or whether it is simply due to a
68
GISELA HEIDECKER ET AL.
large fraction of the bound protein being washed away during the experimental procedure. Alternatively, it could be evidence of the transient nature of the complexes, which could be held together only long enough to transmit the phosphorylation signal through a series of intermediates, the combination of components depending on their stoichiometry in any given cell type. Yet another possibility is that at least some of the secondary complex formation occurs only after cell lysis, perhaps due to the inherent affinity of the SH2 domains of many of the secondary messengers for the receptor molecules.
B. RELATIVE POSITION OF Raf I N THE SIGNALING CASCADE The reports summarized in the preceding sections show that a number of proteins associate with growth factor receptors, and that several of these can be found associated with different receptors. Is there some interdependence among these secondary messengers or is each of them responsible for an independent signal being transmitted? This question has been addressed in several ways to elucidate the role and position of Raf-1, especially in regard to its interactions with ~21"GAP. Early experiments showed that Raf-1 could overcome a block in signal transduction introduced by microinjected anti-Ras antibody (Smith et ul., 1986).The activation status of Raf-1 in cells expressing the dominant negative S17N ras mutant is intermediate (Feig and Cooper, 1988), i.e., the Raf-1 migrates with a mobility that lies between those of the fully activated and resting enzymes (Troppmair et ul., 1992). The fact that activated Raf was able to transform cells that had reverted to a flat phenotype in spite of carrying two activated ras alleles also indicates that Raf functions downstream or independently of Ras (Noda et al., 1983; Rapp et ul., 1988a). In the reverse experiment, activated ras was not able to overcome the block caused by reversion of raf transformation (Kolch et ul., 1991b). Recently we have extended these studies and demonstrated that cells that have no or little functioning Raf due to the expression of rufantisense constructs or a dominant negative ruf mutant could not be efficiently transformed by activated ras, or any growth factor or PTK-related oncogene (Kolch et al., 1991a). Not surprisingly, the ruf revertant cells as well as the cells stably expressing antisense or dominant-negative rufconstructs had severe signaling impairments. The revertant cell lines were deficient in their induction of immediate early genes in growth factor response, including fos, junB, and EGR-1. The defect introduced by high expression of antisense or dominant-negative
Raf- 1 PHOSPHORYLATION
69
mutants proved to be lethal in cells expressing low amounts of wildtype Raf-1. If the recipient cells expressed v-raf stably, transfected cell lines could be obtained. However, DNA synthesis in response to mitogenic stimuli such as TPA treatment or serum induction was greatly reduced. In addition to showing that Raf-1 acts downstream of Ras, these last experiments also prove that Raf function is essential in signal transduction. Another set of experiments was performed to analyze whether the signal that is transmitted via Raf is sufficient to induce proliferation following growth factor stimulation. NIH 3T3 cells transformed by a v-raf oncogene expressing 3611 MSV could not be growth arrested by serum deprivation, indicating that in these cells activated Raf is all that is required (Kolch et al., 1991a). In contrast, activated Raf alone was not able to abrogate the I L 3 requirement of FDC-PI and 32D cells. Nevertheless, Raf- 1 is involved in I L 3 signal transduction, as v-raf significantly accelerated the abrogation of growth factor requirement by v-myc in either cell type (Rapp et al., 1990). In fact, the combination of v-raf and v-myc is as effective in growth factor abrogation as the ectopically expressed PTK. This suggests that the signal initiated by the activated growth factor receptor is transmitted by two pathways, one that involves Ras and Raf, and the other that goes through Myc.
C. SUBSTRATES OF ACTIVATED Raf-1 The data described so far show that Raf-1 activation is a necessary component in the signal transduction of one of the pathways leading from the activated growth factor to mitogenic response. What happens to Raf- 1 upon activation and how does it transmit its signal further down the line? Immunofluorescence and cell fractionation studies have shown that Raf-1 redistributes in the cell, changing from an even distribution in the cytoplasm in resting cells to the acculmulation in the perinuclear space, and possibly the nucleus itself, upon TPA and PDGF treatment (Olah et al., 1990; Rapp et al., 1988b). The effects of activated Raf are quite pleiotropic, ranging from changes in overall cell morphology (Rapp et al., 1988a),to changes in lipid metabolism (Kiss et al., 1988)and stability of differentiation status (Principato et al., 1990), to induction of early gene expression (Wasylyk et al., 1989;Jamal and Ziff, 1990; Kolch et al., 1991b). This latter finding, especially in conjunction with the earlier observed Raf/Myc synergism, has led us to investigate whether any of the known transcription factors are substrates of Raf- 1. Preliminary results from experiments using partially purified components suggest that
70
GISELA HEIDECKER E T AL.
the Jun but not the Fos component of AP-1 is phosphorylated by Raf-1 (T. Rauscher, T. Curran, G. Heidecker, and U. R. Rapp, unpublished observations). V. Conclusion Raf-1 has a central role in the signal transduction pathways of many, if not all, growth factors. Its serine/threonine protein kinase activity is increased following stimulation of most growth factor receptors. The activation is accompanied by phosphorylation on serine and, in some cases, on tyrosine and threonine residues. When activated, Raf-1 is transiently associated with a signaling complex formed around the activated growth factor receptor, which contains several other secondary messengers, the most commonly found so far being GAP, PLC-y, and PI-3’ kinase. The composition of the complex varies depending on the growth factor receptor; for example, PLC-y is not phosphorylated by CSF-1, and EGF receptor does not activate PI-3’ kinase (Cantley et al., 1991). These findings are reminiscent of the combinatorial nature of transcriptional complexes regulating gene expression. It will be illuminating to see what sites on Raf-1 are modified, and what substrates Raf-1 recognizes and phosphorylates in consequence. We already know that several immediate early genes are regulated by signals transmitted through Raf- 1;eventually the signaling cascade should converge in the activation of the cdc2 complex possibly by inducing one of the cell cycle-specific cyclins.
REFERENCES Ambrosio, L., Mahowald, A. P., and Perrimon, N. (1989). Nature (London) 342, 288. Anderson, D., Koch, C. A., Grey, L., Ellis, C., Moran, M. F., and Pawson, T. (1990). Science 250, 979-982. App, H., Hazan, R., Zilberstein, A., Ullrich, A., Schlessinger, J., and Rapp, U. R. (1991). Mol. Cell. Biol. 11, 913-919. Baccarini, M., Sabatini, D. M., App, H., Rapp, U. R., and Stanley, E. R. (1990). E M B O J 9, 3649-3657. Beck, T. W., Huleihel, M., Gunnell, M. A., Bonner, T. I., and Rapp, U. R. (1987). Nucleic Acids Res. 15, 595. Beck, T. W., Brennscheidt, U., Sithanandam, G., Cleveland, J. L., and Rapp, U. R. (1990). Mol. Cell. Biol. 10, 3325-3333. Blackshear, P. J., Haupt, D. M.,App, H.,andRapp, U.R. (199O).J. Biol. Chern. 265,1213112134. Bonner, T. I., Oppermann, H., Seeburg, P., Kerby, S. B., Gunnell, M. A., Young, A. C., and Rapp, U. R. (1986). Nutleic Aczdc Res. 14, 1009-1015. Cantley, L. C., Auger, K.R., Carpenter, C., Duckworth, B., Graziani, A,, Kapeller, R., and Soltoff, S. (1991). Cell 64,281-302.
Raf- 1
PHOSPHORYLATION
71
Carroll, M. P., Clark-Lewis, I., Rapp, U. R., and May, W. S. (1990). J. Biol. Chem. 265, 19812-1981 7. Cleveland, J. L., Dean, M., Rosenberg, N., Wang, J., and Rapp, U. R. (1989).Mol. Cell. Biol. 9, 5685-95. Downward, J., Graves, J. D., Warne, P. H., Rayter, S., and Cantrell, D. A. (1990). Nature (London) 346, 719-723. Ellis, L., Clauser, E., Morgan, D. O., Edery, M., Roth, R. A., and Rutter, W. J. (1986). Cell 45,721-732. Ellis, C., Moran, M., McCormick, F., and Pawson, T. (1990). Nature (London) 343, 377381. Evchene, A., Bechade, C., Marx, M., Laugier, D., Dezelee, P., and Calothy. (199O).J.Virol. 64,231-238. Feig, L. A., and Cooper, G. M. (1988). Mol. Cell. B i d . 8, 3235-3243. Fukui, M., Yamamoto, T., Kawai, S., Maruo, K., and Toyoshima, K. (1985).Proc. Nutl. Acad. Sci. U.S.A. 81, 5954-5958. Georgi, L. L., Albert, P. S., and Riddle, D. L. (1990). Cell 61, 635-645. Could, K. L., and Nurse, P. (1989). Nature (London) 342, 39-45. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988). Science 241, 42-52. Hardie, G. (1988). Nature (London) 335, 592-593. Heidecker, G., Huleihel, M., Cleveland, J. L., Kolch, W., Beck, T. W., Lloyd, P., Pawson, T., and Rapp, U. R. (1990). Mol. Cell. Biol. 10, 2503-2512. Horak, I. D., Cress, R. E., Lucas, P. J., Horak, E. M., Waldmann, T. A,, and Bolen, J. B. (1991). Proc. Nutl. Acad. Sci. U.S.A. 88, 1996-2000. House, C., and Kemp, B. E. (1987). Science 238, 1276-1279. Huleihel, M., Goldsborough, M., Cleveland, J. L., Gunnell, M., Bonner, T., and Rapp, U. R. (1986). Mol. Cell. B i d . 6, 2655-2664. Ikawa, S., Fukui, M., Ueyama, Y., Tamaoki, N., Yamamoto, T., and Toyoshima, K. (1988). Mol. Cell. B i d . 8, 2651. Ishikawa, F., Takaku, F., Hayashi, K., Nagao, M., and Sugimura, T. (1986).Proc. Natl. Acad. Sn'. U.S.A. 83, 3209-3212. Ishikawa, F., Sakai, R., Ochiai, F., Takaku, T., Yamamoto, T., and Nagao, M. (1988). Oncogene 3,635-658. Jamal, S., and Ziff, E. (1990). Nature (London) 344, 463-466. Jansen, H. W., Patschinsky, T., and Bister, K. (1983).J. Virol. 8, 61-73. Jansen, H. W., Lurz, R., Bister, K., Bonner, T. I., Mark, G., and Rapp, U. R. (1984).Nature (London) 307, 281-284. Kanakura, Y., Druker, B., Wood, K. W., and Mamon, H. J., Okuda, K., Roberts, T. M., and Griffin, J. D. (1991).Blood 77, 243-248. Kaplan, D. R., Morrison, D. K., Wong, G., McCormick, F., and Williams, L. T. (1990).Cell 61, 125-133. Kazlaukas, A,, Ellis, C., Pawson, T., and Cooper, J. A. (1990). Science 247, 1578-1581. Kemp, B. E., and Pearson, R. B. (1990). TIBS 15, 342-346. Kiss, Z., Rapp, U. R., and Anderson, W. B. (1988). Febs Let. 240, 221-226. Kolch, W., Weissinger, W., Mischak, H., Troppmair, J., Showalter, S. D., Lloyd, P., Heidecker, G., and Rapp, U. R. (1990a). Oncogene 5,713-720. Kolch, W., Cleveland, J. L., and Rapp, U. R. (1990b). CRC Rev. Cancer 2, 270-290. Kolch, W., Heidecker, G., Lloyd, P., and Rapp, U. R. (1991a). Nature (London) 349, 426428. Kolch, W., Heidecker, G., Troppmair, J., Lloyd, P., Yanagihara, K., Bassin, R. H., and Rapp, U. R. (1991b). Submitted for publication.
72
GISELA HEIDECKER ET AL.
Kovacina, K. S., Yonezawa, K., Brautigan, D. L., Tonks, N. K., Rapp, U. R., and Roth, R. A. (199O).j. Biol. C h . 265, 12115-12118. Kypta, R. M., Goldberg, Y., Ulug, E. T., and Courtneidge, S. A. (1990). Cell 62,481-892. Le Guellec, R., Le Guellec, K., Paris, J., and Philippe, M. (1988). Nuclek Acids Res. 16, 10357. Lee, R. M., Rapp, U. R., and Blackshear, P. J. (1991).J. Bid. Chem. 266, 10351-10357. Lewis, L. R., Kuret, J., Johnson, K. E., Powers, S., Cameron, S., Michaeli, T., Wigler, M., and Lollar, M. J. (1988). Science 240,68-69. Margolis, B., Rhee, S. G., Felder, S., Mervic, M., Lyall, R., Levitzki, A., Ullrich, A,, Zilberstein, A,, and Schlessinger, J. (1989). Cell 57, 1101-1 109. Mark, G. E., and Rapp, U. R. (1984). Science 224, 285-289. Mark, G. E., MacIntyre, R.J., Digan, M. E., Ambrosio, L., and Perrimon, N. (1987). Mol. Cell. Biol. 7, 3124-3133. Meisenhelder, J., Suh, P.-G., Rhee, S. G., and Hunter, T. (1989). Cell 57, 1109-1122. Molders, H., Defesche, J., Muller, D., Bonner, T. I., Rapp, U. R., and Muler, R. (1985). EMBO J. 4, 693-699. Morrison, D. K. (1990). Cancer Cells 2, 377-382. Morrison, D. K., Kaplan, D. R., Rapp, U. R., and Roberts, T. M. (1988).Proc. Natl. Acad. Sci. U.S.A. 85, 8855-8859. Morrison, D. K., Kaplan, D. R., Escobedo,J. A., Rapp, U. R., Roberts, T. M., and Williams, L. T. (1989). Cell 58, 648-657. Morrison, D. K., Kaplan, D., Rhee, S. G., and Williams, L. T. (1990). Mol. Cell. Biol. 10, 2359-2366. Morrison, D. K., Rapp, U. R., and Heidecker, G. (1991). Manuscript in preparation. Noda, M., Selinger, Z., Scolnick, E. M., and Bassin, R. H. (1983).Proc. Natl. Acad. Sn’. U.S.A. 80,5602-5607. Olah, Z., Komoly, S., Nagashima, N., Joo, F., Rapp, U. R., and Anderson, W. B. (1990).Exp. Brain Res. 84,403-4 10. Patschinsky, T., and Bister, K. (1988). Oncogene 3, 357-364. Piwnica-Worms, H., Saunders, K. B., Roberts, T. M., Smith, A. E., and Cheng, S. H. (1987). Cell 49, 75-82. Principato, M., Cleveland, J. L., Rapp, U. R., Holmes, K., Pierce, J., Morse, H., 111, and Klinken, P. (1990). Mol. Cell. Biol. 10, 3562-3568. Rapp, U. R. (1991). Oncogene 6, 495-500. Rapp, U. R., and Cooper, G. M. (1991). In preparation. Rapp, U. R., Reynolds, F. H., Jr., and Stephenson, J. R. (1983a). J. Virol. 45, 914-924. Rapp, U. R., Goldsborough, M. D., Mark, G. E., Bonner, T. I., Groffen, J., Reynolds, F. H., Jr., and Stephenson, J. (1983b). Proc. Natl. Acad. Sci. U.S.A. 80, 4218-4222. Rapp, U. R., Cleveland, J. L., Bonner, T. I., and Storm, S. M. (1988a). In “The Oncogene Handbook (T. Curran, E. P. Reddy, and A. Skalka, eds.), pp. 213-253. Elsevier, Amsterdam. Rapp, U. R., Heidecker, G., Huleihel, M., Cleveland, J. L., Choi, W. C., Pawson, T., Ihle, J. N., and Anderson, W. B. (1988b). Cold Spring Harbor Symp. Quunt. Biol. 53, 173-181. Rapp, U. R., Troppmair, J., Carroll, M., and May, W. S. (1990). C u m Top. Mkrobiol. Immunol. 166, 129-139. Reedijk, M., Liu, X., and Pawson, T. (1990). Mol. Cell. Bzol. 10, 5601-5608. Shaw, A. S., Chalupny, J., Whitney, J. A., Hammond, C., Amrein, K. E., Kavathas, P., Sefton, B. M., and Rose, J. K. (1990). Mol. Cell. Bzol. 10, 1853-1862. Shimizu, K., Nakatsu, Y., Sekiguchi, M., Hokamura, K., Tanaka, K., Terada, M., and Sugimura, T. (1985). PYOC. Natl. Acad. Scz. U.S.A. 82, 5641-5646.
Raf- 1 PHOSPHORYLATION
73
Siegel,J. N., Klausner, R. D., Rapp, U. R., and Samelson, L. E. (199O).J. B i d . Chem. 265, 18472-18480. Sithanandam, G., Dean, M., Brennscheidt, U., Beck, T., Gazdar, A., Minna, J. D., Brauch, H., Zbar, B., and Rapp, U. R. (1989). Oncogene 4,451-455. Sithanandam, G., Kolch, W., Duh, F.-M., and Rapp, U. R. (1990). Oncogene 5 , 1775-1780. Smith, M. R., DeGudicibus, S. J., and Stacey, D. W. (1986). Nature (London) 320, 540-543. Smith, M. R., Heidecker, G., Rapp, U. R., and Kung, H. (1990). Mol. Cell. Bzol. 10, 38283833. Stanton, V. P., Jr., and Cooper, G. M. (1987). Mol. Cell. Bzol. 7 , 1171-1179. Stanton, V. P., Jr., Nichols, D. W., Laudano, A. P.,and Cooper, G. M. (1989).Mol. Cell. Biol. 9, 639-647. Storm, S. M., Brennscheidt, U., Sithanandam, G., & Rapp, U. R. (1990a). CRC Rev. Cancer 2, 1-8. Storm, S. M., Cleveland, J. L., and Rapp, U. R. (1990b). Oncogene 5 , 345-351. Sutrave, P., Bonner, T. I., Rapp, U. R., Jansen, H. W., and Bister, K. (1984).Nature (London) 309, 85-88. Thompson, P. A,, Ledbetter, J. A., Rapp, U. R., and Bolen, J. B. (1991). Cell GrowthDzf., in press. Turner, B. C., Rapp, U. R., App, H., Greene, M. I., Dobashi, K., and Reed, J. C. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 1227-1231. Turner, J. M., Brodsky, M. H., Irving, B. A., Levin, S. D., Perlmutter, R. M., and Littma, D. R. (1990). Cell 60, 755-765. Ullrich, A., and Schlessinger,J. (1990). Cell 61, 203-212. Wasylyk, C., Wasylyk, B., Heidecker, G., Huleihel, H., and Rapp, U. R. (1989). Mol. Cell. Biol. 5 , 2247-2250.
This Page Intentionally Left Blank
G PROTEIN-CONTROLLED SIGNAL TRANSDUCTION PATHWAYS AND THE REGULATION OF CELL PROLIFERATION Klaus Seuwen and Jacques Pouyssegur Centre de Biochimie-CNRS, Universe6 de Nice-Sophia Antipolis, F‘arc Valrose, 06034 Nice, France
I. Introduction 11. Signal Transduction by Receptors with Ligand-Dependent Tyrosine Kinase Activity 111. Signal Transduction through G Protein-Coupled Receptors A. Overview B. CAMPas a Stimulator or Inhibitor of Cell Proliferation, Depending on Cell Type C. Oncogenic Mutations in G, D. Stimulation of Cell Proliferation by Activators of Phosphoinositide Breakdown and by Inhibitors of Adenylyl Cyclase E. Gi Oncogenes and Possible Mechanisms of Action F. An Important Role for Phosphatidylcholine Breakdown? IV. Conclusion References
1. introduction
Cell proliferation is controlled by a large variety of different stimulatory and inhibitory molecules. During the last several years, cellular receptors for many of these agents have been identified by molecular cloning, and we are now beginning to understand signal-transducing processes that link receptor stimulation to cellular responses. Most of the receptors relevant in the context of cell proliferation can be attributed to either of two classes: first, receptors showing ligand-dependent tyrosine kinase activity (Williams, 1989; Ullrich and Schlessinger, 1990),and second, G protein-coupled receptors interacting with different intracellular signaling systems (phospholipid breakdown, adenylyl cyclase, ion channels) (Dohlman et al., 1987; Casey and Gilman, 1988). As proposed by Bourne et al. (1990), we use the term “G protein” to designate the family of heterotrimeric GTP-binding proteins interacting directly with receptors, as opposed, for example, to the smaller monomeric ras-encoded or ras-like-encoded proteins, which belong to the same superfamily of regulatory GTPases. In this review we will focus mostly on the biochemical activities controlled by G protein-coupled receptors. However, we will 75 ADVANCES IN CANCER RESEARCH, VOL. 58
Copyright 0 1992 by Academic Press. Inc. All rights of reproduction in any form reserved.
76
KLAUS SEUWEN AND JACQUES P O U Y S S ~ G U R
also give a brief overview on signal transduction mechanisms activated by receptor tyrosine kinases in order to highlight processes that are controlled by both types of pathways. We will not discuss the action of other hormone receptors important in cell proliferation control, notably the family of intracellular receptors for steroid and thyroid hormones, which work as ligand-dependent transcription factors (Evans, 1988),and a group of lymphocyte cytokine receptors (for which the mechanism of action is not yet well understood (Goodwin et al., 1990; Hibi et al., 1990). When quiescent cells are challenged with growth factors, complex biochemical changes occur within minutes (Rozengurt, 1986). Much research effort has been invested trying to define these alterations, to understand how they are initiated, and to study their possible implication as “early signals” in the process of mitogenic stimulation. Although most of the elements involved in the regulation of cell proliferation are probably still unknown, some obviously important enzyme activities and messenger molecules, well conserved in evolution, have now been identified and named. The scheme shown in Fig. 1 illustrates some of our current knowledge concerning intracellular mechanisms of signal transduction, active shortly after receptor stimulation, in a typical fibroblast or smooth muscle cell. In the following discussions, we will work progressively through this scheme, trying to dissociate relatively well-established notions from more hypothetical ones and trying to discuss the importance of the outlined pathways for mitogenic signaling. Important events occurring later during the process of Go to S phase progression, such as inactivation of the retinoblastoma (Rb) and p53 suppressor gene products (Weinberg, 1990) and activation of cdc2 kinase (Nurse, 1990), are not included in Fig. 1, and we will restrict our discussion to the relation between “early mitogenic events” and the cells’ decision to reenter the cell cycle. II. Signal Transduction by Receptors with LigandDependent Tyrosine Kinase Activity
This field has been reviewed (Williams, 1989; Ullrich and Schlessinger, 1990),but we will nevertheless give a short description, as signaling through receptor tyrosine kinases and through G protein-coupled receptors seems to be tightly interconnected. In fact, growth factors acting through the two pathways usually interact synergistically (Rozengurt, 1986),and enzyme activities are known that are controlled or modulated by both types of receptors, notably phosphoinositide-specific
G PROTEIN SIGNAL TRANSDUCTION
77
Immediate early gene transcription FIG. 1. Regulatory proteins and messenger molecules controlled by receptor tyrosine kinases and G protein-coupled receptors. The pathways shown are discussed in the text. Abbreviations: AC, adenylyl cyclase; A kinase, CAMP-dependent protein kinase; CaM kinase, calcium/calmodulin-dependent protein kinase; C kinase, calcium- and phospholipid-dependent protein kinase; CREB, cyclic AMP responsive element binding protein; DG, diacylglycerol; GAP, GTPase-activating protein; IP3, inositol trisphosphate; LT, leukotriene; MAP kinase, rnitogen-activated protein kinase; PC-PLC, phosphatidylcholine phospholipase C; PG, prostaglandin; PI-SK, phospoinositide-3-kinase; PI-PLC, phospoinositide phospholipase C; PLA2, phosphlipase AP; REF, ras exchange factor; SRF, serum response factor; S6 kinase, kinase-phosphorylating ribosomal protein S6. Direct interactions are shown as solid lines; if direct interaction is not demonstrated, interrupted arcs are presented. Less well-established pathways are marked with question marks. The primary structures of all enzymes and regulatory proteins shown are known, with the exception of the ras exchange factor and PC-PLC. Notably, in the case of PI-PLC and PKC, gene families with several members have been discovered and it is not yet known in detail how the different proteins are regulated.
phospholipase C (PI-PLC) (Cockcroft, 1987; Paris et al., 1988; Rhee et al., 1989) and adenylyl cyclase (AC) (Magnaldo et al., 1989; Ball et al., 1990). A large body of data also shows that the different pathways converge at the level of immediate early gene induction (Schonthal, 1990),which can be considered as an obligatory event in the process of Go to S phase progression. Receptor tyrosine kinases are thought to function by changing the
78
KLAUS SEUWEN AND JACQUES P O U Y S S ~ G U R
activity of intracellular target molecules by phosphorylation on tyrosine. The peptide growth factors platelet-derived growth factor, colony-stimulating factor- 1, epidermal growth factor, fibroblast growth factor, and insulin-like growth factor-I (PDGF, CSF-1, EGF, FGF, and IGF-I) and other factors work through receptors of this kind. For a long time, the intracellular substrates phosphorylated directly by these tyrosine kinases have remained elusive, but recently a number of proteins with potential regulatory function have been found to coprecipitate specifically with ligand-activated receptors in immunocomplexes. The following proteins have thus been identified: type I phosphoinositide-3-kinase (PI-3K) (Kaplan et al., 1987), the GTPase-activating protein (GAP) of the c-rus protooncogene (Molloy et al., 1989), the serine/threonine kinase c-Raf (Morrisson et al., 1989), members of the c-src-encoded family of nonreceptor tyrosine kinases (Kypta et al., 1990), and a phosphoinositidespecific phospholipase C-y (PLC-y) (Kazlauskas and Cooper, 1989). As already indicated above, the latter enzyme activity, also not necessarily the same isosyme, is also directly regulated by G proteins (Cockcroft, 1987). For PLC-y it has recently been shown that phosphorylation on tyrosine indeed increases its activity (Nishibe et al., 1990). For the other target proteins this remains to be demonstrated, but it seems reasonable to assume that this is the case. With the exception of c-Raf, all these presumed tyrosine kinase substrates contain specific protein sequences (SH2 domains) that seem to direct the association with receptors at phosphotyrosine residues resulting from receptor autophosphorylation (Moran et al., 1990). However, it is important to note that different receptor tyrosine kinases exhibit overlapping, but not identical, substrate specificities. The CSF-1 receptor, for instance, is closely related to the PDGF receptor, but does not interact with PLC-?I,although activation of PI-3K (Varticovski et al., 1989) and c-Raf (Baccarini et al., 1990) are documented. The stimulation of PI-3K by receptor tyrosine kinases is intriguing. Several studies on mutated receptors suggest a strong link between the stimulation of this enzyme activity and the mitogenic response (Kazlauskas and Cooper, 1990; Shurtleff et al., 1990); however, as yet no function for phosphoinositides phosphorylated on the 3 position of the inositol ring is known, and these lipids are not substrates for known phospholipases of the C type (Whitman et al., 1988; Serunian et al., 1989). Besides c-Raf, receptor tyrosine kinases activate other intracellular serine-threonine kinases, notably mitogen-activated protein (MAP) kinase (Rossomando et al., 1989),S6 kinase (Susa et al., 1989),and casein kinase I1 (Sommercorn et al., 1987);in these cases, however, activation is probably by indirect mechanisms. Some of these kinases (Raf, MAP
G PROTEIN SIGNAL TRANSDUCTION
79
kinase) seem to receive signals both from the receptor tyrosine kinases and from protein kinase C (Morrison et al., 1989; Anderson et al., 1990) and have been dubbed “switch kinases,” based on their presumed importance as central integrators of mitogenic signals (PouyssCgur et al., 1990). In fact, truncated versions of c-Raf and the viral homologue v-Raf, constitutively active kinases, efficiently transform cells (Schultz et al., 1988). Whether persistent activation of MAP kinase will have similar effects remains to be shown. There are indications that these kinases function in hierarchical order, forming “kinase cascades.” Active MAP kinase, for instance, may be responsible for triggering S6 kinase and casein kinase I1 and may also participate in the growth factor-mediated stimulation of ion transporters such as the Na+ / K + /C1- cotransporter or the Na+ / H exchanger. The latter system has been extensively studied in recent years and our laboratory has obtained strong evidence for regulation through serine/threonine phosphorylation (Sardet et al., 1990). T h e rus genes have been documented to play a central role in cell proliferation control. Microinjection of anti-Ras antibodies has been shown to block the mitogenic effect of serum, PDGF, and the src oncogene (Riabowol et al., 1988), and point-mutated versions of rus are potent oncogenes (Barbacid, 1987). In recent studies, the proportion of c-rus-encoded protein in its GTP-bound, active conformation has been found to increase following stimulation of cells with PDGF o r EGF (Satoh et al., 1990a,b). This would suggest the hypothesis that phosphorylation of GAP on tyrosine inhibits its activity (Malloy et al., 1989; Ellis et al., 1990), but the additional activation of an “exchange factor” (Wolfman and Macara, 1990; Downward et al., 1990), directly stimulating GDP-GTP exchange, can not be excluded (Gibbs et al., 1990). This activation might actually be brought about by the c-src-encoded kinase (Satoh et al., 1990b). The downstream targets of rus action remain unknown. Previous suggestions that ras-encoded proteins were the signaltransducing GTPases linking receptor stimulation to PI breakdown (Wakelam et al., 1987) could not be substantiated (Seuwen et al., 1988a; Hall, 1990). Finally, the different incoming signals are received by the cells’ transcriptional machinery, controlling gene expression. Within minutes following receptor stimulation and without need for protein synthesis, “immediate early genes” are transcribed in response to serum and growth factors; well-studied examples are the protooncogenes c-fos, c-jun, and c-my (Schonthal, 1990). All three code for nuclear proteins that are involved in transcriptional regulation. The expression of these genes is controlled by transcription factors that are present as stable proteins in quiescent cells, notably the serum response factor (SRF) (Norman et al., +
80
KLAUS SEUWEN AND JACQUES POUYSS~GUR
1988) and the CAMP responsive element binding protein (CREB) (Gonzalez and Montminy, 1989). Members of thejun and fos gene family form the heterodimeric activator protein 1 (APl) transcription factors (Kouzarides and Ziff, 1989), which, in the process of Go to S phase progression seem to regulate a second wave of gene expression (Nathans et al., 1988; Schonthal, 1990). AP1 and SRF mediate effects of protein kinase C activators, but seem to receive other signals as well (Kaibuchi et al., 1989; Jamal and Ziff, 1990). CREB is regulated by protein kinase A but also carries consensus sites for phosphorylation by PKC and casein kinase I1 (Gonzales et al., 1989). Unfortunately, the complexity of transcription factor activation and interaction does not yet permit the establishment of a precise link between the events taking place near the cell membrane, following receptor activation, and specific gene transcription. 111. Signal Transduction through G Protein-Coupled Receptors
A. OVERVIEW Many hormones, neurotransmitters, and vasoactive agents work through G protein-coupled receptors. Genes coding for a large number of these receptors have recently been isolated by molecular cloning, including genes for adrenergic, muscarinic, and serotoninergic receptors (Lefkowitz and Caron, 1988; Hartig, 1989; Ashkenazi et al., 1989a). Interestingly, for a given ligand, many different receptor subtypes with distinct functions often exist. A ligand-occupied receptor is thought to induce the exchange of GDP for GTP in specific G proteins, thus pushing them into an active state (Fig. 2) (Casey and Gilman, 1988; Bourne et al., 1990). An inactive G protein is a heterotrimer made up of 01, p, and y chains; upon activation it dissociates into a separate 01 subunit carrying the GTP, and a Py complex. The 01 subunit will now interact with an effector enzyme, stimulating or inhibiting it. The signal is turned off by the intrinsic GTPase activity of the 01 chain, leading to subunit reassociation. Whether the subunits play an active role in effector regulation is a matter of debate. It has been reported that they can stimulate phospholipase A, (PLA,) activity (Kim et al., 1989), participate in the inhibition of adenylyl cyclase (Katada et al., 1987; Linder et al., 1990; Hildebrandt and Kohnken, 1990), and also inhibit atrial K + channels (Okabe et al., 1990). In yeast, Py subunits mediate pheromone action (Whiteway et al., 1989). Compared to the relatively large number of a subunits that have been identi-
G PROTEIN SIGNAL TRANSDUCTION
81
RECEPTOR
GDP
EFFECTOR FIG. 2. Receptor-effector coupling by G proteins. See text for explanations.
fied (>15) (Strathmann et al., 1989), until recently only a few P and y subunits were known (Lochrie and Simon, 1988) and it was assumed that different G proteins used a common pool of Py complexes, suggesting for these a role as relatively unspecific modulators. The fact that new members of the y gene family that have now been identified (Gautam et al., 1990) seem to associate preferentially with distinct 01 subunits and are expressed in a tissue-specific manner suggests that the OL subunits are not alone in their ability to determine the specificity of receptor-effector coupling. Several effector enzymes controlled by G proteins have been described, including adenylyl cyclase (Gilman, 1984), phospholipases (PIP E , PLA,) (Cockcroft, 1987; Burch, 1989; Gupta et al., 1990), and ionic channels (Yatani et al., 1988). In the visual system, the light receptor rhodopsin controls the activity of a cGMP phosphodiesterase via the G protein transducin (Stryer, 1986). This system and the control of AC activity are probably the best characterized examples of G protein-mediated signal transfer. Mammalian adenylyl cyclase receives stimulatory and inhibitory signals (Gilman, 1984). Stimulation is mediated through a G protein named G,; well-known receptors exerting this function are the P-adrenergic
82
KLAUS SEUWEN AND JACQUES P O U Y S S ~ G U R
receptors (Lefkowitz and Caron, 1988). The a subunit of G, is a target for cholera toxin-induced ADP ribosylation, which permanently activates the G protein (Gill, 1977).Cholera toxin is therefore often used to stimulate AC in a receptor-independent manner. The molecular identity of G, is known (Robishaw et al., 1986; Kozasa et al., 1988): one gene coding for a G, a subunit gives rise to four protein products through alternative splicing. In olfactory tissue, a related gene, termed aOlf, exists (Jones and Reed, 1989). By complementation in a,-deficient S49 lymphoma cells, the stimulatory function of these protein products on AC could be demonstrated (Jones et al., 1990). It should be added that at least one form of eukaryotic AC is also stimulated by calmodulin (Krupinski et al., 1989). This may represent a rationale to explain the increases in cAMP production observed after stimulation of cells with growth factors or hormones activating PI breakdown (Felder et al., 1989). The inhibitory G protein of AC has been named G,. Examples of receptors inhibiting AC are the a,-adrenergic (Kobilka et al., 1987) and M,-muscarinic (Ashkenazi et al., 1987) receptors. Pertussis toxin ADP ribosylates Gi, uncoupling it from receptors (Ui, 1984). This toxin also, therefore, tends to increase cAMP levels in intact cells by relieving AC of an inhibitory restraint. Several G protein ci subunits carrying a consensus site for PTX-induced ADP ribosylation have been cloned (Jones and Reed, 1987; Itoh et al., 1988), however, in contrast to G,, it remains unclear which of these actually mediate inhibition of AC, as appropriate recipient cells allowing complementation studies are missing and reconstitution in vitro is a difficult task. The ai2protein, however, may be a good candidate (Simonds et al., 1989; McKenzie and Milligan, 1990; Wong et al., 1991). The issue is further complicated by the fact that G protein Pr subunits may take part in the negative regulation of AC (Linder et al., 1990). The involvement of G proteins or, more generally, GTP-binding proteins in the activation of phosphoinositide breakdown was postulated following observations that GTP and its analogs could stimulate this pathway in membrane preparations (Cockcroft and Gomperts, 1985; Cockcroft, 1987). In intact cells, aluminum fluoride, a universal G protein activator (Chabre, 1990), was shown to stimulate PI-PLC activity (Blackmore et al., 1985; Paris and Pouysskgur, 1987; Paris et al., 1987). Furthermore, hormone-induced PI breakdown was found to be inhibited to varying degrees by pertussis toxin in many experimental systems (Nakamura and Ui, 1985; Paris and Pouyssegur, 1986). Obviously, PIPLC can be activated both by pertussis toxin-sensitive (members of the G, family) and-insensitive G proteins, that may coexist in the same cell and
G PROTEIN SIGNAL TRANSDUCTION
83
couple preferentially to different receptors. In hamster fibroblasts, for instance, PI turnover can be activated in a pertussis toxin sensitive, partially toxin-sensitive, or toxin-insensitive manner, depending on the receptors stimulated (Seuwen et al., 1990a). Recently, pertussis toxin-insensitive G protein a subunits mediating activation of the f3 isoform of PLC have been identified (Taylor et al., 1991; Smrcka et al., 1991). In parallel to PI-PLC, other phospholipases are often found to be activated by the same hormone, for instance, phosphatidylcholine PLC (PC-PLC) and phospholipases D and A, (Nakamura and Ui, 1985; Exton, 1990). How these events relate is for the moment an open question and will receive further discussion later on. B. cAMP AS A STIMULATOR OR INHIBITOR OF CELL PROLIFERATION, DEPENDING ON CELLTYPE cAMP was the first “second messenger” described. Early experiments studying the effect of CAMP-elevating hormones or the analog 8-BrcAMP in established cell lines and tumor cells in uitro indicated that increases in intracellular cAMP inhibited cell proliferation (Pastan et al., 1975). This observation has been extended to many cell lines and primary cultures, often from mesodermal tissue (fibroblasts, smooth muscle cells, mesangial cells). However, Rozengurt and co-workers have shown that 8-Br-cAMP,prostaglandin E, (PGE,), and even cholera toxin stimulated in synergy with insulin the proliferation of Swiss 3T3 fibroblasts (Rozengurt et al., 1981, 1983a),and that the growth factor-induced stimulation of PGE, synthesis and its subsequent autocrine action might explain in part the proliferative response to PDGF (Rozengurt et al., 1983b). Today, a number of cell types are known wherein CAMP-elevating agents clearly stimulate DNA synthesis, notably cells originating from endocrine tissues, such as adrenal cortex, thyroid, and pituitary, as well as many epithelial cells (Dumont et al., 1989). The effects of cAMP are assumed to be mediated exclusively through stimulation of protein kinase A. Thus, microinjection of the catalytic subunit of kinase A leads to the induction of CAMP-responsive genes in the absence of CAMP-elevating agents (Riabowol et al., 1988). It could be further demonstrated that PKA directly controls the activity of the transcription factor CREB, which is supposed to be largely responsible for the regulation of CAMP-dependent gene expression (Gonzales and Montminy, 1989). Interestingly, cAMP seems to regulate the expression of the immediate early genes c-jun and c-myc differentially in cells, where it acts either as a stimulator or inhibitor of proliferation (Heldin et al., 1989; Reuse et al., 1990; Mechta et al., 1989). The positive or negative
84
KLAUS SEUWEN AND JACQUES POUYSS~GUR
effect of cAMP on cell proliferation may well depend on gene regulatory events in the nucleus, where the specific equipment of cells with transcription factors, which may cooperate positively or negatively, could be determinant. Alternatively, or in addition, the phosphorylation of key regulatory proteins involved in signal transduction (receptors, phospholipases, other kinases) by kinase A might be important to reinforce or attenuate some pathways of the signaling network. Protein kinase A phosphorylates a broad range of substrates in viuo and seems to influence signaling through other pathways considerably. For instance, increasing cellular cAMP levels has been reported to inhibit PI breakdown, and phosphorylation of PLC-?Iby kinase A could be the origin of this effect (Kim et al., 1989).
MUTATIONSIN G, C. ONCOGENIC Many oncogenes are thought to function as constitutively active elements in a signal transduction pathway stimulating cell proliferation. Interestingly, mutated forms of the a subunit of G, have been identified in a subset of human pituitary tumors characterized by high basal activities of adenylyl cyclase (Landis et al., 1989). In the pituitary, growth hormone regulatory hormone (GHRH) normally acts as a growth factor by stimulating AC activity (Vallar et al., 1987).The mutations found have been shown to inhibit the intrinsic GTPase activity of the G, a subunit, which normally turns the active, GTP-bound form back into an inactive state (see Fig. 2). As a result, cAMP levels in the affected tissues are increased and very probably stimulate the proliferation of the tumor cells; also, other growth-deregulating lesions certainly participate in the establishment of the malignant phenotype. After transfection into Swiss 3T3 fibroblasts, these G, oncogenes stimulate the mitogenic responsiveness of these cells (Zachary et al., 1990). Analogous mutations have later been found in the a subunit of Gi, (Lyons et al., 1990) (see later).
D. STIMULATION OF CELLPROLIFERATION BY ACTIVATORS OF PHOSPHOINOSITIDE BREAKDOWN AND BY INHIBITORS OF ADENYLYL CYCLASE Since the discovery of the pluripotency of the phosphoinositide-derived second messengers, PI turnover has certainly been the most advertised signaling system to be involved in cell proliferation control. The activation of PKC by diacylglycerol (DG) and the release of Ca2+ from endoplasmic reticulum by inositol triphosphate (IP,) seemed to readily
G PROTEIN SIGNAL TRANSDUCTION
85
account for most of the “early mitogenic events” observed previously, such as the rise of intracellular free calcium, stimulation of N a + / H + exchange, protein phosphorylation, and induction of immediate early genes (Berridge and Irvine, 1984; Nishizuka, 1984; Pouyssegur, 1985). Most of the growth factors described as well as some oncogenes were shown to activate PI turnover at least in some cell systems to varying degrees (Berridge and Irvine, 1984), and a new class of growth-promoting agents emerged, consisting of molecules previously known as neurotransmitters and vasoactive agents, which proved to be particularly potent stimuli for this signaling pathway (Zachary et al., 1987a). Pertussis toxin selectively inhibited the proliferative response to growth factors such as thrombin (Chambard et al., 1987) or bombesin (Letterio et al., 1986), and this seemed to correlate at least in part with the inhibition of PI turnover brought about by the toxin. Today we know that the importance of PI turnover in mitogenic signaling has probably been overestimated. As we will discuss, PI turnover seems rather to play a relatively modest role as a mediator of growth factor action, eliciting significant positive effects only if parallel pathways are coactivated. In fact, the ability of a single growth factor to strongly stimulate cell proliferation may well be due to coexpression of different receptor subtypes in the same cells, triggering two or more separate signaling pathways that may then act synergistically. Thrombin, for instance, is a mitogen interacting with at least t w o G protein-controlled effector systems, PI turnover and adenylyl cyclase, in fibroblasts and smooth muscle cells (Raben et al., 1987; Seuwen et al., 1990b; Berk et al., 1990). By examining the mitogenic effect of serotonin in hamster fibroblasts, we were able to show that stimulation of cell proliferation could be dissociated from PI-PLC activation. In these cells, serotonin stimulates replication in synergy with FGF in a pertussis toxin-sensitive manner and this correlates with the activation of a receptor negatively coupled to AC (Seuwen et al., 1988b). Similar results were later reported for lysophosphatidic acid stimulating the proliferation of Rat- 1 cells (van Corven et al., 1989). In Swiss 3T3 cells, in which vasopressin and bradykinin have been shown to stimulate PI turnover and exert mitogenic effects, these agents also activate receptors inhibiting AC (Murayama and Ui, 1985), and we have postulated that these receptors participate in the stimulation of cell proliferation (Seuwen et al., 1988b). In agreement with the hypothesis that generic Gi-coupled receptors stimulate proliferation in synergy with receptor tyrosine kinases, expression of aPadrenergic receptors in hamster fibroblasts yields cells that respond mitogenically to epinephrine (Seuwen et al., 1990a).
86
KLAUS SEUWEN AND JACQUES POUYSSI~GUR
In a number of cases, receptors coupled to PI-PLC have now been expressed in different cell systems in an attempt to define the importance of PI turnover in mitogenic signaling. These experiments have been interpreted differently: in the first study of this kind by Ashkenazi et al. (1989b), different muscarinic receptors were expressed in CHO cells and a good correlation was found between the stimulation of DNA synthesis by the muscarinic agonist carbachol and the stimulation of PI turnover. CHO cells, however, are transformed cells with relaxed growth factor dependence, which is illustrated by the fact that the maximal stimulation of [3H]thymidine incorporation observed in these experiments was a fivefold increase over basal, compared to a 50- to 100fold increase in a growth factor-dependent cell line such as CCL39 (Perez-Rodriguezet al., 1981). After obtaining recombinant DNA clones of 5-HT,, and 5-HT2 receptors, Julius and co-workers expressed them in NIH 3T3 fibroblasts and observed 5-HT-induced focus formation in serum-supplemented medium and a high incidence compared to control of tumor formation, when focus-forming cells where injected into nude mice (Julius et al., 1989, 1990). However, focus-forming cells did not grow in soft agar in response to 5-HT and the transformed phenotype of tumor cells recovered after in vivo passage was accomplished independent of the presence of the hormone, indicating that additional genetic lesions had occurred. Our own experiments using CCL39 cells transfected with muscarinic M1 (Seuwen et al., 1990b),5-HT,, (Seuwen and Pouyssegur, 1990), and 5-HT, receptors (Van Obberghen-Schilling et al., 1991) showed that even very strong and persistent activation of PI-PLC only minimally stimulated cell proliferation, although induction of “immediate early genes” and other early events had taken place. Significant growth-promoting effects could only be observed if tyrosine kinase-activating growth factors were added in parallel. Functional studies of a recently cloned human (Vu et al., 1991) and hamster (Van Obberghen et al., 1990; Rasmussen et al., 1991) calcium mobilizing thrombin receptor reinforces this notion. This receptor is activated by thrombin through proteolytic cleavage in the N-terminal, extracellular half of the molecule, which liberates a new N-terminus containing a peptide sequence capable of stimulating the receptor. In the absence of thrombin, the receptor can be activated using the synthetic peptide, which results in strong activation of PI turnover and inhibition of adenylyl cyclase (in this case, possibly through the same receptor isoform). However, the peptide alone is not mitogenic in the absence of tyrosine kinase activating growth factors and therefore, the existence of
G PROTEIN SIGNAL TRANSDUCTION
87
additional thrombin-mediated signals and probably another thrombin receptor must be postulated (Vouret-Craviari et al., 1991). In agreement with a minor role of PI-PLC in growth factor signal transduction are the results of Margolis et al. (1990a,b), who show that overexpression of PLC-y in NIH 3T3 cells considerably increased PI turnover in response to PDGF, but did not augment the proliferative response to the growth factor. Furthermore, PDGF receptor mutants exist that activate PI-PLC normally but fail to induce proliferation (Williams, 1989). Of course, these results do not rule out that certain cell types different from fibroblasts or smooth muscle cells might be programmed to respond mitogenically to PI-PLC agonists, as it has been shown, for instance, for embryonal human astrocytes during a short period of development (Ashkenazi et al., 1989b).
E. Gi ONCOGENES AND POSSIBLE MECHANISMS OF ACTION Shortly after the discovery of oncogenic mutations in G,, analogous base changes were detected in genes coding for OL subunits of G, proteins in adrenal cortex tumors (Lyons et al., 1990). Expression of these constitutively activated cxi2 forms in Rat- 1 fibroblasts induced a deregulation of cell growth (Pace et al., 1991). These findings add weight to our previously mentioned hypothesis of the importance of the “Gi pathway” in mitogenic signaling, although it is unclear for the moment which role Gi proteins actually play. A logical explanation of the available data would certainly be that any lowering of cAMP levels should be permissive for proliferation in cells in which cAMP acts as an inhibitor. As it was impossible until recently to lower cAMP levels artificially or to specifically inhibit PKA in intact cells, it was difficult to test this hypothesis. Now, overexpression of cAMP phosphodiesterase activity (Van Lockeren Campagne et al., 1990) could be a key to address this question. For several reasons, however, we favor the hypothesis that Gi proteins, independently of AC, activate signaling pathways that remain to be identified. A strong argument in this direction derives from the observation that bombesin stimulates DNA synthesis in a pertussis toxin (PTX)-sensitive manner in Swiss 3T3 cells (Zachary et al., 1987b), although in this cell line cAMP acts as a positive modulator of proliferation (Rozengurt et al., 1981). In experimental systems different from fibroblast systems, the biological effects of hormones acting through Gi proteins have been dissociated from cyclase inhibition (Haslam et al., 1978; Ullrich and
88
KLAUS SEUWEN AND JACQUES
POUYSSBGUR
Wollheim, 1984). It is known that Gi proteins control cardiac potassium channels (Yatani et al., 1988) and they also seem involved in the regulation of PLA, (Burch, 1989).This enzyme controls the synthesis of arachidonic acid, which is considered rate limiting for the production of prostaglandins and leukotrienes, important mediators in inflammation (Samuelsson et al., 1987; Smith, 1989). The possible role of these substances in cell proliferation control is not completely understood (Millar and Rozengurt, 1990; Han et al., 1990; Handler et al., 1990). Leukotrienes have recently been shown to be involved in ion channel gating (Kurachi et al., 1989; Schweitzer et al., 1990)and comparable effects on a regulatory element controlling cell proliferation could of course be possible. It is noteworthy that PLA, activation has also been observed to occur in response to EGF and PDGF (Handler et al., 1990), thus resembling the regulation of PI-PLC by two classes of growth factors. Another effector system directly or indirectly controlled by Gi proteins and presumably important in cell proliferation control may be calcium channels. Nishimoto and Kojima (1989) claim a determinant role for PTX-sensitive activation of voltage-insensitive channels in the regulation of BALB/c 3T3 cell proliferation. Interestingly, the G protein mediating this effect is, in this system, activated by the IGF-I1 receptor, a molecule structurally different both from the classical G protein-coupled receptors and receptor tyrosine kinases (Okamoto et al., 1990).
ROLEFOR PHOSPHATIDYLCHOLINE F. AN IMPORTANT BREAKDOWN? For many experimental systems it is now well documented that a considerable amount of diacylglycerol can originate from the breakdown of phosphatidylcholine by a specific phospholipase C (PC-PLC)or phospholipase D (PC-PLD).In particular, these activities seem to explain the previously observed discrepancies between DG formation and PI turnover detected in many growth factor- or oncogene-stimulated cells (Lacal, 1990). Signaling through PC hydrolysis has been reviewed in an excellent article (Exton, 1990). How PC breakdown is initiated is not yet completely understood, but several reports demonstrate stimulation by guanine nucleotides (Irving and Exton, 1987; Van der Meulen and Haslam, 1990). In contrast to PI breakdown, PC hydrolysis is generally sustained and Exton (1990) proposes that its main role may be to maintain DG production over a long period of time and therefore to activate cellular processes that necessitate continuous activity of PKC. Articles by Moscat and co-workers claim an essential role for PC hydrolysis in the mitogenic action of both PDGF (Larrodera et al., 1990) and the ~ ( 1 son-
G PROTEIN SIGNAL TRANSDUCTION
89
cogene (Lopez-Barahona et al., 1990). In particular, these authors show that exogenous PC-PLC added to Swiss 3T3 cells is a potent growth stimulator. Neither choline nor phosphocholine, the by-products released from the cleavage of PC by PC-PLD or PC-PLC, respectively, seems to have a role as second messenger, thus it is difficult to imagine how PC breakdown could produce signals different from those produced by PI breakdown or by chronic administration of phosphatidic acid or PKC-activating phorbol esters. However, Diaz-Laviada et al. (1990) have proposed that the absence of PKC down-regulation observed in cells stimulated with exogenous PC-PLC could be determinant. IV. Conclusion
We have described biochemical pathways that seem to be involved in the regulation of cell proliferation by growth factors. Perhaps in contrast to other articles addressing this issue, we have questioned the presumed central role of PI turnover and instead emphasized processes controlled by Gi-coupled receptors, which are only beginning to be acknowledged as regulators of cell proliferation. However, it seems necessary to point out the important role of growth factors activating receptor tyrosine kinases. Many studies now converge to indicate that these agents are “master growth factors,” whereas hormones acting through G proteincoupled receptors are merely able to potentiate their action. This seems to be reflected by the fact that almost all known virus-endoced oncogenes, which have evolved as efficient stimulators of the host cells’ replicative machinery, code for growth factors activating receptor tyrosine kinases (sis), modified receptor tyrosine kinases (fms, erb-B), or regulatory proteins normally controlled in some way by receptor tyrosine kinases (STC, raJ ras, jun, fos). No viral oncogenes have been found to encode G protein-coupled receptors, G protein subunits, or phospholipases. Consequently, we have to postulate that potent growth factors such as a-thrombin do not exert their action exclusively through known G protein-mediated pathways but activate other signals as well, which may include at some level a tyrosine kinase activity. Furthermore, we predict that cells that are stimulated to divide by the activation of a G proteincoupled receptor alone carry alterations activating regulatory elements normally employed by receptor tyrosine kinases. Nevertheless, in vivo a given mitogen never acts on its own and the remarkable synergy between growth actors of the tyrosine kinase class and activators of Gi proteins certainly has physiological importance. The
90
KLAUS SEUWEN AND JACQUES P O U Y S S ~ G U R
discovery in human tumors of G proteins carrying oncogenic mutations underscores this contention.
ACKNOWLEDGMENTS We thank Dr. F. Mckenzie for critical comments and M. Valetti for the preparation of the manuscript. Our work is supported by grants from the Centre National de la Recherche Scientifique (UPR 7300), the Institut National de la Sant6 et de la Recherche Medicale, the Fondation pour la Recherche Medicale, and the Association pour la Recherche contre le Cancer.
REFERENCES Anderson, N. G., Maller, J. L., Tonks, N. K., and Sturgill, T. W. (1990).Nature (London) 343, 651-653. Ashkenazi, A,, Winslow, J. W., Peralta, E. G., Peterson, G. L., Schimerlik, M. I., Capon, D. J., and Ramachandran, J. (1987). Science 238, 672-675. Ashkenazi, A., Peralta, E. G., Winslow, J. W., Ramachandran, J., and Capon, D. J. (1989a). Cell 56, 487-493. Ashkenazi, A., Ramachandran, J., and Capon, D. J. (1989b).Nature (London) 340,146-150. Baccarini, M., Sabatini, D. M., App, H., Rapp, U. R., and Stanley, E. R. (1990).EMBOJ. 9, 3649-3657. Ball, R. L., Tanner, K. D., and Carpenter, G. (1990).J . Biol. Chem. 265, 12836-12845. Barbacid, M. (1987). Annu. Rev. Biochem. 56, 779-827. Berk, B. C., Taubrnan, M. B., Cragoe, E. J., Jr., Fenton, J. W., 11, and Griendling, K. K. (199O).J. B i d . Chem. 265, 17334-17340. Berridge, M. J., and Irvine, R. F. (1984). Nature (London) 312, 315-321. Blackmore, P. F., Bocckino, S. B., Waynick, L. E., and Exton, J. H. (1985).J. B i d . Chem. 260, 14477- 14483. Bourne, H. R., Sanders, D. A., and McCormick, F. (1990). Nature (London) 348, 125-132. Burch, R. M. (1989). Mol. Neurobwl. 3, 155-171. Casey, J. P., and Gilman, A. G. (1988). J . B i d . Chem. 263, 2577-2580. Chabre, M. (1990). Trends Biochem. Sci. 15, 6-10. Chambard, J. C., Paris, S., L'Allemain, and Pouyss6gur,J. (1987). Nature (London) 326,800803. Cockcroft, S. (1987). Tradc Biochem. Sci. 12, 75-78. Cockcroft, S., and Gomperts, B. D. (1985). Nature (London) 314, 534-536. Diaz-Laviada, I., Larrodera, P., Diaz-Meco, M. T., Cornet, M. E., Guddal, P. H., Johansen, T., and Moscat, J. (1990). E M B O J . 9, 3907-3912. Dohlman, H. G., Caron, M. G., and Lefkowitz, R.J. (1987). Biochemistry 26, 2657-2664. Downward, J., Riehl, R., Wu, L., and Weinberg, R. A. 91990). Proc. Natl. Acad. Sci. U.S.A. 87,5998-6002. Dumont, J. E., Jauniaux,,J. C., and Roger, P. P. (1989). Trends Biochem. Sn'. 14, 67-71. Ellis, C., Moran, M., McCormick, F., and Pawson, T. (1990). Nature (London) 343,377-381. Evans, R. M. (1988). Science 240,889-895. Exton, J. H. (199O).J. B i d . Chem. 265, 1-4. Felder, C. C., Kantermann, R. Y.,Ma, A. L., and Axelrod, J. (1989).J. Biol. Chem. 264, 20356-20362.
G PROTEIN SIGNAL TRANSDUCTION
91
Gautam, N., Northup, J., Tamir, H., and Simon, M. I. (1990). Proc. Natl. Acad. Sci. U.S.A. 87,7973-7977. Gibbs, J. B., Marshall, M. S., Scoinick, E. M., and Dixon, R. A. F., and Vogel, U. S. (199O).j. Biol. Chem. 265, 20437-20442. Gill, D. M. (1977). Adv. Cyclic Nucleotide Res. 8, 85-1 18. Gilman, A. G. (1984). Cell 36, 577-579. Gonzalez, G. A., and Montminy, M. R. (1989). Cell 59, 675-680. Gonzalez, G. A., Yamamoto, K. K., Fischer, W. H., Karr, D., Menzel, P., Biggs, W., I l l , Vale, W. W., and Montminy, M. R. (1989). Nature (London) 337, 749-752. Goodwin, R. G., Friend, D., Ziegler, S. F., Jerzy, R., Falk, B. A., Gimpel, S., Cosman, D., Dower, S. K., March, C. J., Namen, A. E., and Park, L. S. (1990) Cell 60, 941-951. Gupta, S. K., Diez, E., Heasley, L. E., Osawa, S., and Johnson, G. L. (1990). Science 249, 662-666. Hall, A. (1990). Science 249, 635-640. Han, J. W., Sadowski, H., Young, D. A., and Macara, I. G. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 3373-3377. Handler, J. A,, Danilowicz, R. M., and Eling, T. E. (1990).J. Biol. Chem. 265, 3669-3673. Hartig, P. R. (1989). Trendc Pharmucol. Sci. 10, 64-69. Haslam, R. J., Davidson, M. M. L., and Desjardins, J. V. (1978). Biochem. J. 176, 83-95. Heldin, N.-E., Paulssou, Y., Forsberg, K., Heldin, C.-H., and Westermark, B. (1989).J. Cell Physiol. 138, 17-23. Hibi, M., Murakami, M., Saito, M., Hirano, T., Taga, T., and Kishimoto, T. (1990). Cell 63, 1149-1157. Hildebrandt, J. D., and Kohnken, R. E. (199O).J. B i d . Chem. 265,9825-9830. Irving, H. R., and Exton, J. H. (1987).J. Eiol. Chem. 262, 3440-3443. Itoh, H., Toyama, R., Kozasa, T., Tsukamoto, T., Matsuoka, M., and Kaziro, Y. (1988).J. Eiol. Chem. 263, 6656-6664. Jamal, S., and Ziff, E. (1990). Nature (London) 344,463-466. Jones, D. T., and Reed, R. R. (1987).J. E d . Chem. 262, 14241-14249. Jones, D. T., and Reed, R. R. (1989). Science 244, 730-736. Jones, D. T., Masters, S. B., Bourne, H. R., and Reed, R. R. (199O).J.Biol. Chem. 265,26712676. Julius, D., Livelli, T. J., Jessell, T. M., and Axel, R. (1989). Science 244, 1057-1062. Julius, D., Huang, K. N., Livelli, T. J., Axel, R., and Jessel, T. M. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 928-932. Kaibuchi, K., Fukumoto, Y., Oku, N., Hori, T., Yamamoto, T., Toyoshima, K., and Takai, Y. (1989). J. Eiol. C h a . 264,20855-20858. Kaplan, D. R., Whitman, M., Schaffhausen, B., Pallas, D. C., White, M., Cantley, L., and Roberts, T. M. (1987). Cell 50, 1021-1029. Katada, T., Kusakabe, K., Oinuma, M., and Ui, M. (1987).J. Eiol. Chem. 262, 11897-1 1900. Kazlauskas, A., and Cooper, J. A. (1989). Cell 58, 1121-1 133. Kazlauskas, A,, and Cooper, J. A. (1990).EMEOJ. 9, 3279-3286. Kim, U. H., Kim, J. W., and Rhee, S. G. (1989).J. Biol. C h a . 264,20167-20170. Kobilka, B. K., Matsui, H., Kobilka, T. S., Yang-Feng, T. L., Francke, U., Caron, M. G., Lefkowitz, R. J., and Regan, J. W. (1987). Science 238,650-656. Kouzarides, T., and Ziff, E. (1989). Cancer Cells 1, 71-76. Kozasa, T., Itoh, H., Tsukamoto, T., and Kaziro, Y. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 2081-2085. Krupinski, J., Coussen, F., Bakalyar, H. A., Tang, W. J., Feinstein, P. G., Orth, K., Slaughter, C., Reed, R. R., and Gilman, A. G. 91989). Science 244, 1558-1564.
92
KLAUS SEUWEN AND JACQUES POUYSS~GUR
Kurachi, Y., Ito, H., Sugimoto, T., Shirnizu, T., Miki, I., and Ui, M. (1989).Nature ( L d o n ) 337, 555-557. Kypta, R. M., Goldberg, Y., Ulug, E. T., and Courtneidge, S. A. (1990). Cell 62,481-492. Lacal, J. C. (1990). Mol. Cell. Biol. 10, 333-340. Landis, C. A., Masters, S. B., Spada, A,, Pace, A. M., Bourne, H. R., and Vallar, L. (1989). Nature (London) 340, 692-696. Larrodera, P., Cornet, M. E., Diaz-Meco, M. T., Lopez-Barahona, M., Diaz-Laviada, I., Guddal, P. H., Johansen, T., and Moscat, J. (1990). Cell 61, 1113-1120. Lefkowitz, R. J., and Caron, M. G. (1988).J. Bzol. Chem. 263,4993-4996. Letterio, J. J., Coughlin, S. R., and Williams, L. T. (1986). Science 234, 1 1 17-1 119. Linder, M. E., Ewald, D. A., Miller, R. J., and Gilman, A. G. (1990).J. Biol. Chem. 265, 8243-825 1 . Lochrie, M. A., and Simon, M. I. (1988). Biochemistry 27,4957-4965. Lopez-Barahona, M., Kaplan, P. L., Cornet, M. E., Diaz-Meco, M. T., Larrodera, P., DiazLaviadad, I., Municio, A. M., and Moscat, J. (1990).J. Biol. Chem. 265, 9022-9026. Lyons, J., Landis, C. A., Harsh, G., Vallar, L., Grunewald, K., Feichtinger, H., Duh, Q. Y., Clark, 0. H., Kawasaki, E., Bourne, H. R., and McCormick, F. (1990).Science 249,655659. Magnaldo, I., Pouyssegur, J., and Paris, S. (1989). Cell. Signall. 1, 507-517. Margolis, B., Zilberstein, A., Franks, C., Felder, S., Krerner, S., Ullrich, A., Rhee, S. G., Skorecki, K., and Schlessinger, J. (1990a). Science 248, 607-610. McKenzie, F. R., and Milligan, G. (1990). Biochem. J. 267, 391-398. Mechta, F., Piette, J., Hirai, S. I., and Yaniv, M. (1989). New Biologzst 1, 297-304. Millar, J. B. A., and Rozengurt, E. (199O).J.Biol. Chem. 265, 19973-19979. Molloy, C. J., Bottaro, D. P., Fleming, T. P., Marshall, M. S., Gibbs, J. B., and Aaronson, S. A. (1989). Nature (London) 342, 71 1-714. Moran, M. F., Koch, C. A., Anderson, D., Ellis, C., England, L., Martin, G. S., and Pawson, T. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 8622-8626. Morrisson, D. K., Kaplan, D. R., Escobedo,J. A., Rapp, U. R., Roberts, T. M., and Williams, L. T. (1989). Cell 58, 649-657. Murayama, T., and Ui, M. (1985).J. Biol. Chem. 260, 7226-7233. Nakamura, T., and Ui, M. (1985).J. Biol. C h . 260, 3584-3593. Nathans, D., Lau, L. F., Christy, B., Hartzell, S., Nakabeppu, Y., and Ryder, K. (1988). Cold Spring Harbor Symp. @ant. Biol. 53, 893-900. Nishibe, S., Wahl, M. I., Hernandez-Sotomayor, S. M. T., Tonks, N. K., Rhee, S. G., and Carpenter, G. (1990). Science 250, 1253-1256. Nishimoto, I., and Kojima, I. (1989). New P h a m c o l . Scz. 4, 94-97. Nishizuka, Y. (1984) Nature (London) 308, 693-698. Norman, C., Runswick, M., Pollock, R., and Treisman, R. (1988). Cell 55, 989-1003. Nurse, P. (1990). Nature (London) 344, 503-508. Okabe, K., Yatani, A., Evans, T., Ho, Y. K., Codina, J., Birnbaumer, L., and Brown, A. M. ( 1990).J. Bzol. Chem. 265, 12854- 12858. Okarnoto, T., Katada, T., Murayama, Y., Ui, M., Ogata, E., and Nishimoto, I. (1990). Cell 62, 709-717. Pace, A. M., Wong, Y. H., and Bourne, H. R. (1991).Proc. Natl. Acad. Sci. U.S.A. 88,70317035. Paris, S., and PouyssCgur, J. (1986). E M B O J . 5, 55-60. Paris, S., and Pouyssegur, J. (1987).J.Biol. Chem. 262, 1970-1976. Paris, S., Chambard, J. C., and Pouyssegur, J. (1987).J. Biol. Chem. 262, 1977-1983. Paris, S., Chambard, J. C., and Pouyssegur, J. (1988).J. Biol. Chem. 263, 12893-12900. Pastan, I. H., Johnson, G. S., and Anderson, W. B. (1975).Annu. Rev. Biochem. 44,491-523.
G PROTEIN SIGNAL TRANSDUCTION
93
Perez-Rodriguez, R., Franchi, A., and PouyssCgur, J. (1981). Cell E d . Int. Rep. 5, 347357. Pouyssegur, J. (1985). Trends Biochem. Scz. 10, 453-455. PouyssCgur, J., Kahan, C., and Seuwen, K. (1990). In “Growth Factors: From Genes to Clinical Applications” (V. R. Sara et al., eds.), New York: Raven, pp. 85-100. Raben, D. M., Yasuda, K., and Cunningham, D. D. (1987). Biochemistry 26, 27592765. Reuse, S., Maenhaut, C., and Dumont, J. E. (1990). Exp. Cell Re$. 189, 33-40. Rasmussen, U. B., Vouret-Craviari, V., Jallat, S., Schlesinger, Y., Pag& G., Pavirani, A., Lecocq, J. P., PouyssCgur, J., and Van Obberghen-Schilling, E. (1991). FEES Lett., in press. Rhee, S. G., Suh, P. G., Ryu, S. H., and Lee, S. Y. (1989). Science 244, 546-550. Riabowol, K. T., Fink, J. S., Gilman, M. Z., Walsh, D. A,, Goodman, R. H., and Fermasico,J. R. (1988). Nature (London) 336, 83-86. Robishaw, J. D., Smigel, M. D., and Gilman, A. G. (1986). J . Biol. Chem. 261, 9587-9590. Rossomando, A. J., Payne, D. M., Weber, M. J., and Sturgill, T. W. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 6940-6943. Rozengurt, E. (1986). Science 234, 161-166. Rozengurt, E., Legg, A., Strang, G., and Courtenay-Luck, N. (1981). Proc. Natl. Acad. Sci. U.S.A. 78, 4392-4396. Rozengurt, E., Collins, M. K. L., and Keehan, M. (1983a).J. Cell. Physzol. 116, 379-384. Rozengurt, E., Stroobant, P., Waterfield, M. D., Deuel, T. F., and Keehan, M. (1983b). Cell 34,265-272. Samuelsson, B., DahlCn, S. E., Lindgren, J. A., Rouzer, C. A,, and Serhan, C. N. (1987). Science 237, 1171-1176. Sardet, C., CouniUon, L., Franchi, A., and PouyssCgur, J. (1990). Science 247, 723-726. Satoh, T., Endo, M., Nakafuku, M., Nakamura, S., and Kaziro, Y. (1990a). Proc. Natl. Acad. Sci. U S A . 87, 5993-5997. Satoh, T., Endo, M., Nakafuku, M., Akiyama, T., Yamamoto, Y., and Kaziro, Y. (1990b). Proc. Natl. Acad. Sci. U.S.A. 87, 7926-7929. Schonthal, A. (1990). Cell. Signall. 2, 215-225. Schultz, A., Copeland, T., Oroszlan, S., and Rapp, U. R. (1988). Oncogene 2, 187-193. Schweitzer, P. Madamba, S., and Siggins, G. R. (1990). Nature (London) 346, 464-467. Serunian, L. A., Haber, M. T., Fukui, T., Kim, J. W., Rhee, S. G., Lowenstein, J. M., and Cantley, L. C. (1989).J. Bwl. Chem. 264, 17809-17815. Seuwen, K., and Pouyssegur, P. (1990). B i o c h a . P h m a c o l . 39, 985-990. Seuwen, K., Lagarde, A., and PouyssCgur, J. (1988a). EMBOJ. 7, 161-168. Seuwen, K., Magnaldo, I., and PouyssCgur, J. (1988b). Nature (London) 335, 254-256. Seuwen, K., Magnaldo, I., Kobilka, B. K., Caron, M. G., Regan, J. W., Lefkowitz, R. J., and PouyssCgur, J, ( 1990a). Cell Regul. 1, 445-45 1. Seuwen, K., Kahan, C., Hartmann, T., and PouyssCgur, J. (1990b). J. Biol. Chem. 265, 22292-22299. Shurtleff, S. A., Downing, J. R., Rock, C. 0..Hawkins, S. A., Roussel, M. F., and Sherr, C. J. (1990). EMBOJ. 9,2415-2421. Simonds, W. F., Goldsmith, P. K., Codina, J., Unson, C. G., and Spiegel, A. M. (1989).Proc. Natl. Acad. Sci. U.S.A. 86, 7809-7813. Smith, W. L. (1989). Biochem.J. 259, 315-324. Smrcka, A. V., Hepler, J. R., Brown, K. O., and Sternweis, P. C. (1991). Science 251, 804807. Sommercorn, J., Mulligan,J. A., Lozernan, F., and Krebs, E. G. (1987).Proc. Natl. Acad. Sci. U.S.A. 84. 8834-8838.
94
KLAUS SEUWEN AND JACQUES P O U Y S S ~ C U R
Strathmann, M., Wilkie, T. M., and Simon, M. I. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 7407-7409. Stryer, L. (1986). Annu. Rev. Neurosci. 9, 87-119. Susa, M., Olivier, A, R., Fabbro, D., and Thomas, G. (1989). Cell 57,817-824. Taylor, S. J., Smith, J. A., and Exton, J. H. (199O).J. Biol. Chem. 265, 17150-17156. Taylor, S. J., Chae, H. Z., Rhee, S. G., and Exton, J. H. (1991). Nature (London) 950, 516518. Ui, M. (1984). Trends Pharmacol. Sci. 5, 277-279. Ullrich, A., and Schlessinger, J. (1990). Cell 61, 203-212. Ullrich, S., and Wollheim, C. B. (1984).J. B i d . Chem. 259, 41 11-41 15. Vallar, L., Spada, A., and Giannattasio, G. (1987). Nature (London) 330, 566-568. van Corven, E. J., Groenink, A., Jalink, K., Eichholtz, T., and Moolenaar, W. H. (1989). Cell 59,45-54. Van der Meulen, J., and Haslam, R. J. (1990). Biochem. J. 271, 693-700. Van Lockeren Campagne, M. M., Wu, E., Fleischmann, R. D., Gottesman, M. M., Chason, K. W., and Kessin, R. H. (1990).J. E d . Chem.265, 5840-5846. Van Obberghen-Schilling, E., Chambard, J. C., Lory, P., Nargeot, and Pouysskgur, J. (1990). FEBS Lett. 262, 330-334. Van Obberghen-Schilling, E., Vouret-Craviari, V., Haslam, R. J., Chambard, J. C., and Pouyss]aegur, J. (1991). Mol. Endocrinol. 5, 881-889. Varticovski, L., Druker, B., Morrison, D., Cantley, L., and Robertd, T. (1989). Nature (London) 342, 699-702. Vouret-Craviari, V., Van Obberghen-Schilling, E., Rasmussen, U. B., Lecocq, J. P., and Pouysstgur, J. (1990). Submitted for publication. Vu, T. K. H., Hung, D., Wheaton, V. I., and Coughlin, S. R. (1991). Cell 64, 1057-1068. Wakelam, M. J. O., Davies, S. A., Houslay, M. D., McKay, I., Marshall, C. J., and Hall, A. (1987). Nature (London) 323, 173-176. Weinberg, R. A. (1990). Trends Biochem. Sci. 15, 199-202. Whiteway, M., Hougan, L., Dignard, D., Thomas, D. Y., Bell, L., Saari, G. C., Grant, F. J., OHara, P., and MacKay, V. L. (1989). Cell 56,467-477. Whitman, M., Downes, C. P., Keller, M., Keller, T., and Cantley, L. (1988). Nature (London) 332, 644-646. Williams, L. T. (1989). Science 243, 1564-1570. Wolfman, A., and Macara, I. (1990). Science 248, 67-69. Wong, Y. H., Federman, A,, Pace, A. M., Zachary, I., Evans, T., Pouysstgur, J., and Bourne, H. R. (1991). Submitted. Yatani, A., Mattera, R., Codina, J., Graf, R., Okabe, K., Padrell, E., Iyengar, R., Brown, A. M., and Birnbaumer, L. (1988). Nature (London) 336, 680-682. Zachary, I., Woll, P., and Rozengurt, E. (1987a). Dev. B i d . 124, 295-308. Zachary, I., Millar, J., Nanberg, E., Higgins, T., and Rozengurt, E. (1987b).Biochem. Bzqphys. Res. Commun. 146,456-463. Zachary, I., Masters, S. B., and Bourne, H. R. (1990). Biochem. Eiophys. Res. Commun. 168, 1184-1 193.
REGULATION OF MUSCLE CELL GROWTH AND DIFFERENTIATION BY THE MYODFAMILY OF HELIX-LOOPHELIX PROTEINS Li Li and Eric N. Olson Department of Biochemistry and Molecular Biology, The University of Texas M.D. Anderson Cancer Center, Houston, Texas 77030
I. Introduction 11. Evidence for Myogenic Regulatory Genes 111. The MyoD Family of Muscle-Specific Regulatory Factors A. Activation of Myogenesis by Single Transfected cDNAs B. The MyoD Family Belongs to a Larger Group of Related Regulatory Factors C. The Basic Region Contributes to Cell Type-Specific Transcription D. Members of the MyoD Family Show Distinct, but Overlapping, Patterns of Expression IV. Antagonism between Proliferation and Differentiation within the Myogenic Lineage A. Growth Factor Signals Inhibit Myogenesis B. Potential Mechanisms for Inactivation of Myogenic HLH Proteins C. Myogenic HLH Proteins Inhibit Cell Proliferation D. Rhabdomyosarcoma V. Summary References
I. Introduction It has long been known that there is a reciprocal relationship between cell proliferation and differentiation. This relationship is apparent during normal development, when many cell types do not begin to differentiate until they have exited the cell cycle, often in response to environmental cues. In some cell types, the loss of proliferative potential is irreversible, resulting in commitment to terminal dif€erentiation, whereas in others the decision to differentiate or divide remains plastic. This mutually exclusive relationship between growth and differentiation is also observed in a variety of malignancies, in which unrestricted cell proliferation is associated with the loss of the differentiated phenotype. Though dramatic insights have been made into the molecular mechanisms that control cell division, the mechanistic basis for the antagonism between cell proliferation and differentiation remains poorly under95
96
LI LI AND ERIC N. OLSON
stood. Skeletal muscle offers an attractive system for exploring this problem because cell growth and differentiation are mutually exclusive events within the myogenic lineage and because the muscle differentiation program can be controlled by a defined set of peptide growth factors that coordinately suppress the transcription of a battery of genetically unlinked muscle-specific genes (for reviews see Schneider and Olson, 1988; Florini et al., 1991). Analysis of the molecular mechanisms that control myoblast proliferation and differentiation has also been facilitated by several established muscle cell lines that retain the ability to proliferate or differentiate virtually indefinitely. Finally, the recent identification of a family of skeletal muscle-specific transcription factors that can suppress cell proliferation and induce myogenesis has contributed to a mechanistic understanding of the molecular events that underlie the establishment of the skeletal muscle phenotype and has provided a framework for thinking about mechanisms that may regulate diverse cellular phenotypes during development (for other recent reviews see Olson, 1990; Weintraub et al., 1991; Tapscott and Weintraub, 1991). This review will focus on the mechanisms that control proliferation and differentiation in the myogenic lineage and on the role of the recently identified skeletal muscle regulatory gene family in mediating these events. T h e prototype of this family of myogenic regulatory factors is MyoD, which has the potential to activate the skeletal muscle phenotype in a variety of cell types and represents a focal point for positive and negative control of myogenesis.
II. Evidence for Myogenic Regulatory Genes Establishment of a skeletal muscle phenotype requires commitment of multipotential stem cells to the myogenic lineage and the subsequent differentiation of skeletal myoblasts to terminally differentiated myotubes. Myoblast differentiation in vitro occurs in response to depletion of exogenous growth factors and is accompanied by the transcriptional induction of a battery of genetically unlinked muscle-specific genes that encode proteins required for the specialized functions of the mature myofiber. During myogenesis, proliferating myoblasts withdraw irreversibly from the cell cycle and fuse to form multinucleate myotubes that assemble a complex contractile apparatus. Generation of the complete myogenic phenotype has been shown to involve coordinated regulation at the levels of transcription, mRNA processing, translation, and protein assembly. Early studies suggested the existence of a “master gene” that could set in motion a cascade of events that culminated with the formation of the
MUSCLE CELL REGULATION
97
mature muscle fiber. Initial evidence for the existence of a myogenic regulatory gene was provided by studies that showed that differentiation of myoblasts could be prevented by exposure to the thymidine analog 5bromo-2’-deoxyuridine (BrdU) and by infection with various oncogenic retroviruses (O’Neill and Stockdale, 1974; Holtzer et al., 1975). The observation that normal myogenesis would ensue following removal of BrdU (Wright, 1982) o r termination of the oncogenic signal (Holtzer et al., 1975; see also Gossett et al., 1988) suggested that myoblasts retained a memory of their position within the myogenic lineage and that these inhibitors somehow silenced regulatory factors that directed muscle-specific gene expression. The possibility of myogenic regulatory factors that could act in trans to regulate muscle-specific genes was supported by heterokaryon experiments that showed that fusion of myoblasts with various nonmuscle cell types could lead to activation of muscle-specific genes in nonmuscle nuclei, presumably as a consequence of regulatory factors emanating from the muscle nuclei (Blau et al., 1983; Wright, 1984). Further support for the concept of genes that could specify the muscle phenotype was provided by studies with the immortalized fibroblast cell line C3H 10T112 ( 1OT 1/ 2 ) ,which can be converted to myoblasts by exposure to the demethylating agent 5-azacytidine (Constantinides et al., 1977, 1978; Taylor and Jones, 1979, 1982). Myogenic clones arise from 5-azacytidine-treated 10T1/2 cells at a frequency of up to 50%, compared to less than 10-8 in the absence of 5-azacytidine. This high frequency suggested that demethylation of one or a few genes upon exposure to 5-azacytidine was responsible for generation of the myogenic phenotype (Konieczny and Emerson, 1984). Because demethylation of CpG residues is a heritable event, myogenic clones that arise from 5-azacytidine-treated 1OT 1/ 2 cells retain myogenic potential indefinitely. Direct evidence that demethylation of a single gene could mediate myogenic conversion of 10T1/2 cells was obtained by genomic transfection experiments in which demethylated DNA from myoblasts, but not from fibroblasts, was shown to convert 10T1/2 cells to myoblasts with a frequency consistent with a single locus (Lassar et al., 1986; Konieczny et al., 1986). Ill. The MyoD Family of Muscle-Specific Regulatory Factors
A. ACTIVATION OF MYOGENESIS BY SINGLE TRANSFECTED cDNAs The first gene to be cloned that fulfilled the criteria of a master gene for myogenesis was the gene encoding MyoD; this gene was identified by
98
LI LI AND ERIC N . OLSON
subtraction hybridization of cDNA, representing transcripts present in myoblasts but absent in 10T1/2 fibroblasts (Davis et al., 1987). When the MyoD cDNA is placed under transcriptional control of a constitutively active promoter and introduced into 10T1/2 cells, it has the potential to activate myogenesis upon removal of exogenous growth factors. Subsequent to the identification of MyoD, three related mammalian factors, myogenin (Wright et al., 1989; Edmondson and Olson, 1989), myf5 (Braun et al., 1989a), and MRF4/herculin/myfG (Rhodes and Konieczny, 1989; Miner and Wold, 1990; Braun et al., 1990a), were independently isolated. Related factors have also been identified in other vertebrate and invertebrate species (Lin et al., 1989; Scales et al., 1990; de la Brousse and Emerson, 1990; Michelson et al., 1990; Krause et al., 1990; Harvey, 1990; Clark et al., 1990; Hopwood et al., 1989; Fujisawa-Sehara et al., 1990; Paterson et al., 1991; Venuti et al., 1991). Like MyoD, each of these factors can convert 1OT1/2 cells to myoblasts. Virtually all of the morphologic and biochemical aspects of myogenesis are induced in 1OT 112 cells by each the four members of the MyoD family. In addition to activating the “downstream” genes associated with myogenesis, each member of the MyoD family can autoregulate its own and cross-activate one anothers’ expression to varying degrees in transfected 10T1/2 cells (Thayer et al., 1989; Braun et al., 198913). These cross-regulatory interactions have made it difficult to assign specific functions to the individual myogenic factors and have raised the question of whether they are functionally redundant or whether one factor mediates the actions of the others. Autoregulation of the MyoD family has been suggested as a mechanism that may provide stability to the myogenic phenotype and may allow these factors to amplify their expression above a critical threshold required for activation of myogenesis. In addition to the MyoD family, a genetic locus myd has been identified by genomic transfection experiments and has been shown to mediate myogenic conversion of 10T1/2 cells (Pinney et al., 1988). T h e myd gene does not cross-hybridize with members of the MyoD family, but it activates their expression in transfected 10T1/2 cells, suggesting that it might function “upstream” of the MyoD family in a dependent myogenic regulatory cascade. However, until myd is cloned and characterized it will remain unknown whether it represents a transcription factor that normally acts to determine the myogenic lineage or, alternatively, whether it functions through a mechanism unrelated to normal myogenesis. Considering the propensity of 10T1/2 cells to form muscle, it is formally possible, for example, that the myd product could function as a gene-specific methylase or even a tumor suppressor that can rescue myogenesis in 10T1/2 cells, but not in other cell types.
MUSCLE CELL REGULATION
99
There is also evidence that the avian retroviral oncogene v-ski can regulate myogenesis. Stavnezer and co-workers showed that infection of quail embryo cells with v-ski can generate muscle that would otherwise not be formed by these cells in culture (Colmenares and Stavnezer, 1989). Expression of ski in skeletal muscle of transgenic mice also leads to hypertrophy of fast twitch fibers (Sutrave et al., 1990). The ski-encoded protein shows no amino acid homology to the MyoD family, but quail embryo cells that have been converted to the myogenic lineage by v-ski express myogenin and MyoD, indicating that at least one member of the MyoD family can be regulated directly or indirectly by a v-ski-dependent pathway (Colmenares et al., 1991). The v- and c-ski-encoded proteins are localized to the nucleus and can bind DNA, but their target sequence(s) have not yet been fully defined (E. Stavnezer, personal communication). The exact mechanism whereby v-ski product induces myogenesis also remains unclear. Conceivably, it might mimic the action of a cellular transcription factor that normally acts early in the niyogenic lineage to induce the expression of myogenin and MyoD. Potential mechanisms of action of the ski product are complicated by the fact that c-ski product is expressed ubiquitously and does not appear to possess myogenic activity, and by the inability of v-ski product to convert cells other than quail embryo cells, which are highly heterogeneous, to muscle. T h e spectrum of cell types that can be converted to muscle has been examined in detail with MyoD (Weintraub et al., 1989). 10T1/2 cells and primary fibroblasts are among the most permissive cell types for myogenic conversion and appear to activate virtually the entire myogenic program in response to MyoD (Davis et al., 1987; Choi et al., 1990). Other cell types from all three germ layers, including fibroblasts, melanomas, neuroblastomas, adipocytes, and osteosarcomas, also can be converted to muscle by MyoD to varying degrees (Weintraub et al., 1989; Chen and Jones, 1990). In some of these cell types (e.g., adipocytes), MyoD extinguishes the endogenous differentiation program, whereas in others (e.g., osteosarcomas) both programs can be coexpressed. These results suggest that MyoD can directly activate muscle-specific genes or initiate a cascade of events that leads to activation of muscle gene expression in collaboration with factors that are widely expressed or that can be induced by MyoD. Whether repression of nonmyogenic differentiation programs by MyoD reflects competition between MyoD and endogenous regulatory factors for limiting cellular factors required for activation of differentiation is an interesting and unresolved question. Certain cell types, such as HeLa, CV-1 (kidney), and HepGP cells, also appear to be refractory to myogenic conversion by MyoD (Weintraub et al., 1989; Schafer et al., 1990). Forced expression of MyoD in frog em-
100
LI LI AND ERIC N . OLSON
bryo cells also does not alter cell fate (Hopwood and Gurdon, 1990). The failure of MyoD to activate myogenesis in these cells suggests that the factors that cooperate with MyoD are not ubiquitous or that there are negative factors that suppress its actions. Indeed, in these and other cell types, heterokaryon experiments have provided evidence for both positive and negative factors that influence the actions of the MyoD family. B. THEMyoD FAMILY BELONGSTO A LARGER GROUPOF RELATED REGULATORY FACTORS Each of the MyoD family members shares about 80% homology within a segment of approximately 70 amino acids that contains a region rich in basic amino acids followed by a motif postulated to adopt a helixloop-helix (HLH) conformation in which two amphipathic a-helices are separated by an intervening loop of variable length (Murre et al., 1989a,b). This region of homology is often referred to as the m y similarity (or bHLH) region because it shares homology with a domain in the myc family of oncogenes that has been shown to be required for transformation of primary fibroblasts in collaboration with ras (Stone et al., 1987). T h e myc similarity region has also been identified in a number of Drosophila gene products that play important roles in specification of cell fate in early embryogenesis, including the acheate-scute (AS-C) (Villares and Cabrera, 1987), daughterless (Caudy et al., 1988; Cronmiller et al., 1988), twist (Thisse et al., 1988), and extramacrocheate gene products (Ellis et al., 1990; Carrel1 and Modolell, 1990). Several widely expressed mammalian transcription factors such as the EZA gene products (E 12 and E47) (Murre et al., 1989b), USF (Gregor et al., 1990), TFE3 (Beckmann et al., 1990) and AP4 (Hu et al., 1990) also contain myc similarity regions. T h e myc similarity region of MyoD has been shown to be necessary and sufficient for binding to the muscle creatine kinase (MCK) enhancer and for activation of myogenesis in stably transfected 10T1/2 cells (TapScott et al., 1988). However, because this region also is presumably sufficient to activate the autoregulatory loop, it is not entirely clear whether it acts alone to induce muscle-specific genes or whether it simply retains enough residual activity to activate one or more of the endogenous MyoD family members, which then amplify their own expression to a level sufficient to induce myogenesis. The fact that the bHLH region is insufficientto activate muscle genes in transiently transfected cells (Davis et al., 1990; T. Chakraborty and E. N. Olson, unpublished observations), under conditions that do not lead to significant activation of the auto-
MUSCLE CELL REGULATION
101
regulatory loops, suggests that autoregulation contributes to its activity in stable transfectants. Mutagenesis studies support the notion that the HLH motif mediates dimerization of HLH proteins, and thereby brings together the basic regions to form a joint DNA-binding domain. There are at least three classes of H LH proteins, defined by their dimerization preferences (Murre et al., 1989b). Class A HLH proteins include several widely expressed gene products such as E12, E47, and daughterless, which preferentially dimerize with class B proteins, which are cell type-specific and include such proteins as MyoD, myogenin, and the acheate-scute gene products. Class C HLH proteins include the products of the myc family, which do not dimerize with class A or B. The recently identified HLH proteins, Max and Myn, may belong to yet another class of HLH proteins, because they dimerize efficiently with myc-encoded proteins but not with class A or class B proteins (Blackwood and Eisenman, 1991; Prendergast et al., 1991). The ability of diverse HLH proteins to heterodimerize dramatically expands the regulatory potential of this family of transcription factors and offers opportunities for combinatorial interactions that may mediate positive and negative regulation of transcription. All HLH proteins that have been shown to bind DNA share the ability to bind as hetero- or homodimers to a conserved DNA sequence, CANNTG, referred to as an “E-box” (see Murre et al., 1989a,b). There are also HLH proteins that fail to bind the E-box consensus and can inhibit DNA binding of the other HLH proteins through formation of nonfunctional heterodimers (Benezra et al., 1990; Garrell and Modolell, 1990; Ellis et al., 1990). Whether these HLH proteins can bind sequences other than the E-box consensus remains to be determined. HLH proteins that bind the E-box consensus show show distinct half-site preferences that depend on the variable nucleotides within and surrounding the invariant dyad symmetry of the CANNTG consensus (Blackwelland Weintraub, 1990). These binding-site preferences may affect binding affinities of HLH heterodimers, as well as the efficiency of transcriptional activation by a specific site. E-boxes have been identified within the control regions of a wide range of cell type-specific genes, including the immunoglobulin (Church et al., 1985; Ephrussi at al., 1985; Sen and Baltimore, 1986; Lenardo et al., 1987) and insulin gene enhancers (Moss et al., 1988; Nelson et al., 1990; Walker et al., 1990), and the enhancers of a number of muscle-specific genes, including those of MCK (Sternberg et al., 1988; Jaynes et al., 1988; Horlick and Benfield, 1989; Lassar et al., 1989a; Buskin and Hauschka, 1988; Brennan and Olson, 1990), MLC1/3 (Wentworth et al., 1991; Rosenthal et al., 1990), a-cardiac actin (Sartorelli et al., 1990; French et al., 1991), troponin I (Lin et al., 1991),
102
LI LI A N D ERIC
N.
OLSON
and the acetylcholine receptor a-subunit (Piette et al., 1990). Many muscle-specific genes contain multiple E-boxes within their control regions. Maximal transcription seems to depend on cooperative interactions among these sites, as well as sites for binding of other muscle-specific and ubiquitous transcription factors. Members of the MyoD family appear to bind DNA weakly by themselves but acquire high affinity for DNA in the presence of El2 and E47, with which they form heterooligomeric complexes in vitro and in vivo (Murre et al., 1989b; Davis et al., 1990; Brennan and Olson, 1990; Chakraborty et al., 1991a; Murre et al., 1991). The failure of myogenin alone to bind DNA efficiently has been shown to be attributable to inefficient homodimerization, which presumably reflects an inability of the HLH motif to self-associate (Chakraborty et al., 1991a). The heterooligomers formed between members of the MyoD family and E12/E47 are probably dimers, although higher order complexes have not been ruled oUt. T h e full range of dimerization partners for the MyoD family in vzvo also has not yet been determined. C. THEBASICREGIONCONTRIBUTES TO CELL TYPE-SPECIFIC TRANSCRIPTION If multiple HLH proteins bind the same CANNTG consensus, how do specific HLH proteins selectively activate only their appropriate target genes, rather than all genes that contain E-boxes? One obvious possibility is that the variable nucleotides surrounding the CANNTG consensus may influence protein binding and thereby mediate specificity. In this regard, some HLH proteins are highly specific for particular E-box sequences. USF, for example, binds the uE3 site in the immunoglobulin heavy chain enhancer (TGCCACATGACC), but will not recognize a KE-2 site (GGCCACCTGCCT) in the immunoglobulin light chain or MCK enhancers (Gregor et al., 1990). Conversely, members of the MyoD family and E2A gene products recognize specific variations of the KE-2 site, but will not bind the the uE3 site (Murre et al., 1989a; Beckmann et al., 1990). Thus in some cases, HLH proteins may preferentially recognize the E-boxes associated with their target genes and may not bind effectively to other types of E-boxes. Differences in DNA binding, however, appear to account for only some of the exquisite transcriptional specificity of HLH proteins. Members of the MyoD family and the E2A gene products, for example, bind the same DNA sequence with similar affinities, yet MyoD can activate myogenesis whereas El2 cannot. Similarly, USF and the m y product bind the same sequence (Gregor et al., 1990; Blackwell and Weintraub, 1990), but obviously regulate different
MUSCLE CELL REGULATION
103
sets of target genes. Thus, if the binding site itself plays a role in determining transcriptional specificity, the effect may be more subtle than an all-or-none effect on DNA binding. Studies with MyoD (Davis et al., 1990) and myogenin (Brennan et at., 1991a) suggest that the basic region plays an important role in mediating cell type-specific transcription. Replacement of the basic domain of MyoD or myogenin with that of Drosophila AS-C T 4 or E12, for example, results in chimeric proteins that retain the ability to bind the MCK enhancer with high affinity, but cannot activate muscle-specific transcription o r initiate myogenesis. This demonstrates that the basic regions of MyoD and myogenin are able to recognize the E-boxes associated with muscle-specific genes and activate transcription, whereas the basic regions of other HLH proteins cannot activate muscle-specific transcription, even though they can bind the same site. Detailed mutagenesis of the basic regions of MyoD and myogenin has shown that two clusters of arginines and lysines mediate DNA binding and the intervening amino acids help to direct muscle-specific transcription. By substitution mutations between MyoD or myogenin and E12, two adjacent amino acids (alanine-threonine) in the center of the MyoD and myogenin basic regions have been shown to impart muscle specificity to the basic region (Davis et al., 1990; Brennan et al., 1991a; H. Weintraub, personal communication). If the basic region of a MyoD-El2 or myogenin-El2 chimera, in which the basic region of MyoD or myogenin has been replaced with that of El2, is back-mutated by introduction of alaninethreonine, full myogenic activity is restored. Alanine-threonine are specific to, and conserved in, this position in all myogenic HLH proteins identified to date, in species ranging from Drosophila to humans, but are absent in the more than 30 other HLH proteins that have been described. The specificity of these amino acids suggests that they constitute part of an ancient protein motif that participates in activation of the myogenic phenotype. Weintraub and co-workers were the first to identify basic domain mutants of MyoD that could bind the MCK enhancer, but were unable to trans-activate the enhancer or induce myogenesis (Davis et al., 1990). Similar mutants have been created with myogenin (Brennan et al., 1991a; Chakraborty et al., 1991a). These mutants are important because they show that activation of muscle-specific transcription is dependent on DNA binding, but that DNA binding alone is insufficient to activate muscle-specific genes. Mutants of MyoD and myogenin that can bind DNA, but cannot activate transcription, are analogous to “positive-control” mutants identified for other transcription factors, such as phage lambda repressor (Hochschild et al., 1983; Hawley and McClure, 1983),
104
LI LI AND ERIC N. OLSON
the glucocorticoid receptor (Schena et al., 1989), yeast HAP-1 (Kim and Guarante, 1990), and the homeodomain transcription factor Oct- 1 (Stern et al., 1989). The behavior of positive-control mutants of myogenin and MyoD creates somewhat of a paradox because both of these factors (H. Weintraub, personal communication; Schwartz et al., 1991), as well as myf5 (Braun et al., 1990b), have been shown to contain transcription activation domains outside of the bHLH region that can constitutively activate transcription when fused to a heterologous DNA-binding domain such as that of the yeast transcription factor GAL4. The ability of myogenin and MyoD to bind DNA without activating transcription when specific mutations are introduced into their basic regions suggests that their activation domains are normally cryptic and that the basic region somehow communicates with the activation domains to direct transcription upon binding to the appropriate E-box. When these activation domains are removed from their normal protein contexts and are fused to a heterologous DNA-binding domain, they apparently become constitutively activated. Because EZA gene products also contain transcription activation domains (Henthorn et al., 1990),these domains must also be silent when dimerized with positive-control mutants of myogenin and MyoD in viva How can the amino acid sequence within the basic domain communicate with the activation domain and specify whether a specific gene will be activated? We envision several possibilities that are not mutually exclusive. The basic region could serve as an interface for interaction with a coactivator, which would not necessarily need to bind DNA directly, but could be required for muscle-specific transcription. Because myogenin and MyoD can activate muscle-specific gene expression in the absence of other tissue-specific factors (Weintraub et al., 1989; Edmondson and Olson, 1989), such an accessory protein would be expected to be expressed in, or at least restricted to, cell types that are susceptible to myogenic conversion. If this type of accessory protein showed some cell type specificity (if it were expressed only in mesoderm, for example), it could account for the inability of MyoD or myogenin to activate efficiently muscle-specific genes in nonmesodermally derived cell types (Weintraub et al., 1989; Schafer et al., 1990).There is precedent for such coactivators. In the case of Oct- 1, for example, positive-control mutations in the DNA-binding domain can abolish transcription activation with no apparent effect on DNA binding (Stern et al., 1989). These mutations map to specific amino acids that are required for interaction with the viral coactivator protein VP16, which cooperates with Oct-1 to induce transcription in virally infected cells.
MUSCLE CELL REGULATION
105
An alternate explanation for the transcriptional specificity of the basic region is that the specific amino acids within the basic domain may, upon interaction with specific E-boxes, allow MyoD and myogenin to undergo a conformational change that unmasks their transcription-activating potential. According to this model, the precise nucleotide sequence of the E-box would be important for activation of transcription, because MyoD and myogenin can bind E-boxes associated with many types of genes, but they only activate transcription from E-boxes associated with musclespecific genes. An additional mechanism that may contribute to target gene specificity of HLH proteins is selectivity in their interactions with other transcription factors that bind sites surrounding the E-box. Studies with several muscle-specific enhancers have revealed the importance of cooperative interactions between myogenic HLH proteins, which often bind paired E-boxes, and other transcription factors that bind nearby (Lassar et al., 1989a; Piette et al., 1990; Weintraub et al., 1991; Sartorelli et al., 1990; Lin et al., 1991; French et al., 1991; Wentworth et al., 1991). Maximal activation of the MCK enhancer, for example, requires cooperative binding of MyoD to a high- and low-affinity E-box, in addition to binding of several ubiquitous factors and the muscle-specific enhancer factor MEF-2 (Lassar et al., 1989a; Weintraub et al., 1991; Gossett et al., 1989). Similarly, transcriptional activation of the human a-cardiac actin promoter has been shown to be dependent on simultaneous binding of a serum response factor, Spl, and MyoD (Sartorelli et al., 1990). If cooperative interactions were mediated by unique domains outside the bHLH region, they could confer target gene specificity to individual HLH proteins that have the ability to bind the same E-box. MyoD, for example, might be able to activate transcription in collaboration with transcription factors A and B, which bind adjacent to the E-box in a muscle-specific enhancer, whereas El2 or acheate-scute might be able to bind the same site, but might only form a productive transcription complex when transcription factors C and D were bound nearby. Experiments with myogenin and MRF4 support the notion that target gene specificity may be determined by protein domains surrounding the bHLH region. Myogenin and MRF4 bind the MCK enhancer with similar affinities, yet only myogenin efficiently trans-activates the enhancer in transient transfection assays (Yutzey et al., 1990; Chakraborty et al., 1991b). Chimeras between myogenin and MRF4 show that the amino and carboxyl termini of myogenin cooperate to direct transcription from the MCK enhancer, and that if these regions of myogenin and MRF4 are swapped, the specificities of these factors for trans-activation of the MCK enhancer are interchanged (Chakraborty et al., 1991~). In contrast,
106
LI LI AND ERIC
N.
OLSON
myogenin and MRF4 show equivalent abilities to trans-activate a target gene linked to multimerized MCK E-box, which would be expected to be less dependent on heterologous protein-protein interactions for activation. D. MEMBERSOF THE MyoD FAMILY SHOWDISTINCT, BUT OVERLAPPING, PATTERNS OF EXPRESSION Although members of the MyoD family are expressed only in skeletal muscle and can activate one anothers’ expression in certain cell types, they show distinct patterns of expression during embryogenesis and in established muscle cell lines, indicating that they are subject to overlapping but distinct forms of regulation (Edmondson and Olson, 1989; Montarras et al., 1989). During mouse embryogenesis, myf5 appears in the somite myotome at 8 days of development and is followed by the appearance of myogenin at 8.5 days and MyoD at 10.5 days (Ott et al., 1991; Wright et al., 1989; Sassoon et al., 1989).The expression of these factors is subsequently repressed as myogenic precursors migrate into the developing limb, at which time these transcripts reappear with other muscle-specific gene products as muscle differentiation is initiated. MRF4 is also expressed briefly in the somite myotome (D. Sassoon, personal communication) and then disappears until after birth, when it increases to high levels (Rhodes and Konieczny, 1989). It is currently unclear whether migrating myogenic precursors, which do not express members pf the MyoD family but are known to be determined to become muscle, were derived from cells in the somite that expressed and then repressed these genes or whether they originated from cells that never expressed members of the MyoD family. The distinct patterns of expression of the MyoD family members during embryogenesis suggest they may play unique roles in determination and differentiation of the myogenic lineage. However, aside from differences in trans-activation of muscle-target genes (Yutzey et al., 1990; Chakraborty et al., 1991b),there has been little evidence to support this notion. An indication that MyoD and myogenin may carry out distinct functions has been provided by studies with the BC3H 1 muscle cell line, which is defective for fusion and commitment to terminal differentiation and does not express MyoD (Spizz et al., 1987; Taubman et al., 1989). Expression of exogenous MyoD in BC3H1 cells can rescue their ability to fuse, suggesting that MyoD may be important for fusion and that myogenin cannot duplicate this function (Brennan et al., 1990; Miller, 1990). The ability of MyoD to induce fusion in BC3H 1 cells is consistent with its temporal pattern of expression in muscle of the developing limb, where it appears coordinately with the appearance of myotubes (Sassoon
MUSCLE CELL REGULATION
107
et al., 1989). Antisense oligonucleotides to myogenin can inhibit muscle-
specific gene expression in BC3Hl cells, indicating that myogenin is required for differentiation and that myf5, which is also expressed by these cells, is unable to activate the myogenic program alone (Brunetti and Goldfine, 1990; Florini and Ewton, 1990). Within different muscle cell lines, only subsets of the MyoD family members are expressed. Myogenin is induced during differentiation of every skeletal muscle cell line that has been examined, but MyoD, myf5, and MRF4 are expressed only in certain muscle cell lines. It is unclear why members of the MyoD family are able to autoregulate and crossactivate each others’ expression only in certain cell types, whereas in other cell types only subsets of their genes can be expressed. Selective repression of certain members of the family by a specific inhibitor or the lack of a gene-specific activator could account for differential expression of these genes. Indeed, the existence of a transacting repressor of MyoD has been suggested, based on the phenotype of a nondifferentiating mouse muscle cell line, NFB (Peterson et al., 1990). NFB cells d o not express MyoD and can extinguish the expression of MyoD in rat muscle cells when heterokaryons are formed between the two cell types. However, upon transfection with an exogenous MyoD expression vector, the MyoD gene can be activated in NFB cells, indicating that the gene is potentially functional. Thayer and Weintraub ( 1990) have also obtained evidence for negative regulation of the MyoD locus by genes on human chromosomes 4 and 8. If human chromosome 11, which carries MyoD, is introduced into 10T1/2 cells, it can activate the endogenous mouse MyoD gene. MyoD expression continues after the subsequent loss of chromosome 11, indicating that the mouse MyoD gene can maintain its own expression, presumably via the autoregulatory loop. However, if chromosome 11 is transferred with chromosomes 4 or 8, it cannot activate the mouse MyoD allele. Whether the putative trans-repressor(s) of MyoD transcription act analogously to other identified tissue-specific extinguisher loci remains to be determined (Killary and Fournier, 1984). Could DNA methylation account for the lack of MyoD expression in certain muscle cell types and the lack of MyoD autoregulation in others? There is an intriguing correlation between the degree of demethylation of MyoD and its expression in cultured cells. Jones and co-workers have shown that MyoD is a CpG island that is methylated in nonmyogenic cell lines, including 10T1/2 Uones et al., 1990). Following conversion of 1OT 1/2 cells to myoblasts by 5-azacytidine, MyoD becomes demethylated. However, in contrast to cultured cells, in which there may be a correlation between demethylation and MyoD expression, the correlation does not hold in primary fibroblasts or mouse tissues, in which the gene is devoid of methylation.
108
LI LI AND ERIC N . OLSON
IV. Antagonism between Proliferation and Differentiation within the Myogenic Lineage
A. GROWTHFACTORSIGNALS INHIBIT MYOGENESIS Differentiation of skeletal myoblasts is dependent on withdrawal from the cell cycle and entry into the G,/G, phase (Nadal-Ginard, 1978). In tissue culture, this is generally brought about by depletion of serum, but the exact signals that initiate myogenesis in vim remain unknown. Though cessation of cell division is essential for activation of the muscle differentiation program, it is not sufficient. Transforming growth factor+ (TGF-P) and in some cases fibroblast growth factor (FGF) can arrest myoblasts in the differentiation pathway without stimulating cell proliferation (Olson et al., 1986; Massague et al., 1986; Florini et al., 1986; Clegg et al., 1987; Spizz et al., 1986; Lathrop et al., 1985a,b). This suggests that the G,/Go phase of the cell cycle may be composed of multiple subcompartments, not all of which are compatible with musclespecific gene activation. Inhibition of myogenesis by activated N- and H-ras also does not involve continued cell proliferation (Gossett et al., 1989; Olson et al., 1987). Recent studies suggest that there is convergence of growth factor signaling pathways and pathways controlled by members of the MyoD family, with the decision of a myoblast to differentiate or divide being determined by a balance between these antagonistic programs. Growth factors appear to act at multiple levels to inhibit myogenesis. Not only do growth factor signals inhibit transcription of the genes coding for myogenin and MyoD, they can also suppress the activity of the myogenin proteins (Davis et al., 1987; Edmondson and Olson, 1989; Vaidya et al:, 1989; Brennan et al., 1991b). High concentrations of mitogens or high levels of expression of activated oncogenes such as ras orfus can overcome, for example, the actions of the muscle-specific HLH proteins and prevent myogenesis. Negative regulation of MyoD function by growth signals is apparent during myogenesis, when MyoD protein is expressed constitutively in proliferating myoblasts prior to initiation of differentiation, and becomes “activated” upon withdrawal of exogenous growth factors (Davis et al., 1987; Tapscott et al., 1988). Growth factor signals may also suppress the activity of myogenin and MyoD during embryogenesis, when these regulatory factors become induced several days before other “downstream” muscle-specific genes (Sassoon et al., 1989; Hopwood et al., 1989; Scales et al., 1990). Conversely, high levels of expression of MyoD can inhibit cell growth even in cells that are highly transformed by activated oncogenes or in cells that are exposed to high concentrations of mitogens (Lassar et al., 198913; Crescenzi et al., 1990;
MUSCLE CELL REGULATION
109
Sorrentino et al., 1990). These results suggest that the decision to differentiate or proliferate is determined by the balance between positive and negative signals elicited by growth factors and myogenic factors, respectively. B. POTENTIAL MECHANISMS FOR INACTIVATION OF MYOCENICHLH PROTEINS The exact mechanisms through which growth factor signals may suppress the activity of myogenic factors remain unclear. Several possible mechanisms can be envisioned, including (1) growth factor-dependent induction of inhibitory HLH proteins, (2) induction of immediate early gene products that inhibit transcription of muscle-specific genes, (3) alterations in the phosphorylation state of myogenic HLH proteins, and (4) negative control of cellular factors required by myogenic HLH proteins to activate muscle-specific target genes. Evidence for each of these mechanisms is considered below. 1. The Inhibitory HLH Protein, Id One mechanism that has been postulated to mediate the negative effects of mitogens on the muscle differentiation program involves the HLH protein Id, which lacks a basic domain and has the ability to form heterodimers with other HLH proteins (such as E12/E47 and MyoD) that cannot bind DNA (Benezra et al., 1990). The behavior of Id is similar to that of basic domain mutants of MyoD, myogenin, and E2A gene products that cannot bind DNA and act as trans-dominant inhibitors of the wild-type proteins (Davis et aE., 1990; Voronova and Baltimore, 1990; Brennan et d.,1991a; Chakraborty et d.,1991a). Interestingly, Id is expressed at relatively high levels in proliferating myoblasts, as well as a variety of other cell types, and is down-regulated when cells differentiate (Benezra et al., 1990). It has therefore been proposed that down-regulation of Id releases E l 2 and MyoD so that they can associate with one another and activate muscle-specific genes. Consistent with this hypothesis is the observation that forced expression of Id can prevent trans-activation of the MCK enhancer by MyoD in transiently transfected fibroblasts. A role for Id in suppression of DNAbinding activity of other HLH proteins is also supported by the observation that MyoD and myogenin are unable to bind the MCK enhancer in proliferating myoblasts that express Id at high levels (Buskin and Hauschka, 1989; Mueller and Wold, 1989; Brennan et al., 1991b). Conversely, the withdrawal of mitogens from myoblasts results in the rapid down-regulation of Id and the acquisition of DNA-binding activity by
110
LI LI A N D ERIC N. OLSON
myogenin and MyoD. T h e ability of Id to inactivate El2 in myoblasts also implies that MyoD autoregulation and activation of myoblast-specific genes by MyoD may involve binding of MyoD homodimers or novel heterodimers between MyoD and other HLH proteins to the control regions of these genes. Because MyoD retains the ability to activate the expression of the lineage markers MyoA and MyoH and positively autoregulates its own transcription in proliferating myoblasts (Davis et al., 1987; Thayer et al., 1989), it has been suggested that MyoD:MyoD homodimers may regulate certain genes in myoblasts. Though Id may mediate the inhibitory effects of mitogens on myogenesis, it does not appear to participate in suppression of the differentiated phenotype by nonmitogenic peptide growth factors. Exposure of myoblasts to TGF-P, for example, in the absence of other mitogens leads to withdrawal from the cell cycle and arrest of cell growth in a Go state (Olson et al., 1987; Florini et al., 1986; Massague et al., 1987). Quiescent myoblasts exposed to TGF-f3 are unable to activaLe the muscle differentiation program. Analysis of the expression of Id in TGF-P-blocked myoblasts shows that Id is down-regulated to basal levels equivalent to those in terminally differentiated myotubes, and myogenin and MyoD acquire the ability to bind DNA (Brennan et al., 1991b). These results suggest that nonmitogenic peptide growth factors, such as TGF-P, can inhibit the transcription-activating properties of myogenic HLH proteins through a mechanism independent of DNA binding. Id is also down-regulated in c-myc-transfected myoblasts upon withdrawal of serum, demonstrating that it is not involved in c-myc-mediated repression of myogenic differentiation (Miner and Wold, 1991). 2. Growth Factor-Inducibb Immediate Early Gene Products as Negative Regulators of Myogenesk T h e possibility that growth factor-inducible immediate early gene products might function as negative regulators of myogenesis was initially suggested by the observation that protein synthesis is required for growth factor-dependent repression of muscle-specific gene expression (Spizz et al., 1987). A variety of growth-related signaling pathways initiated at the cell membrane lead to the induction of c-fos, junB, c-jun, and c-myc (Lewin, 1991). Thus, it is conceivable that these immediate earlyresponse genes could act as the final mediators for diverse signals that are known to inhibit myogenesis. Using the MCK enhancer as a target for transcriptional activation by myogenin and MyoD, it has been shown that constitutively expressed c-Fos, FosB, c-Jun, or JunB expression vectors can repress trans-activation (Lassar et al., 1989b; Li et al., 1991a). In contrast, JunD, which is expressed constitutively in muscle cells and is
.. MUSCLE CkLL REGULATION
111
not induced by growth factors (Li et al., 1990),fails to inhibit myogenin’s transcription-activating function (Li et al., 1991a). Repression by Fos and Jun is targeted at the high-affinityE-box in the MCK enhancer, but does not appear to involve direct binding of Fos or Jun to that site. Whether Fos and Jun compete with myogenin and MyoD for interaction with a common factor required for transcriptional activation is currently under investigation. c-myc has also been implicated in the repression of myogenesis by growth factors. During myogenesis, down-regulation of the expression of c-Myc precedes the induction of muscle-specific genes (Endo and Nadal-Ginard, 1986; Schneider et al., 1987; Sejersen et al., 1985). Infection of primary myoblasts with the avian retrovirus MC29, which carries v-myc, or transfection of established muscle cell lines with c-myc expression vectors can partially inhibit or abolish muscle-specific gene expression (Denis et al., 1987; Falcone et al., 1985; Schneider and Olson, 1988). In some cases, repression of differentiation by Myc has been linked to continued cell proliferation, but in others it appears to be independent of cell proliferation. Miner and Wold (1991) have also shown that overexpression of Myc can inhibit differentiation of cells that constitutively express myogenin or MyoD, or both, indicating that the decision to differentiate may be determined by the relative ratios of these opposing HLH proteins. Because Myc does not appear to interact directly with members of the MyoD family or with E2A gene products (Murre et al., 1989b), it appears that its effects on MyoD and myogenin function are indirect, perhaps being mediated competition for binding to a common DNA sequence or through competition for interaction with a common component of the transcriptional machinery. The recent demonstration that the HLH proteins Max and Myn form heterodimers with Myc that readily bind the CANNTG consensus provides evidence to suggest that Myc may directly induce and repress specific genes (Blackwood and Eisenmann, 1991; Prendergast et al., 1991; see also Blackwell and Weintraub, 1990).
3. Regulation of Myogenic HLH Protein Function by Phosphorylation? Another mechanism through which intracellular growth factor signals may modulate the activities of myogenic HLH proteins is through changes in protein phosphorylation. MyoD and myogenin have each been shown to be phosphorylated in cultured cells (Tapscott et al., 1988; Brennan and Olson, 1990). The precise sites for phosphorylation have not yet been determined; however, in vitro studies reveal that myogenin is an excellent substrate for phosphorylation by protein kinases A and C,
112
LI LI AND ERIC N. OLSON
casein kinase 2, cdc2 kinase, and calmodulin-dependent kinase 2 (L. Li, R. Heller-Harrison, M. Czech, and E. Olson, unpublished observations). Evidence for the potential involvementof protein kinase C in the regulation of myogenic HLH protein activity has been obtained from studies that have shown that cotransfection of a constitutively active protein kinase C (PKC) mutant with myogenin or MyoD can completely abolish the ability of these factors to activate muscle-specific target genes (Li et al., 1991b). Intriguingly, the site for phosphorylation by PKC in these proteins has been mapped to the threonine residue in the basic region that is critical for activation of myogenesis (Brennan et al., 1991a). The ability of a constitutively active PKC mutant to suppress the activity of the myogenic HLH proteins is consistent with observations that exposure of muscle cells to 12-O-tetradecanoylphorbol- 13-acetate (TPA) can completely inhibit myogenesis (Lin et al., 1987). PKC has also been implicated in rwdependent signaling pathways (Imler et al., 1988) and could therefore mediate the inhibitory effects of ras on myogenesis (Olson et al., 1987; Payne et al., 1987; Olson and Capetanaki, 1989; Konieczny et al., 1989; Lassar et al., 1989b). Elevation of intracellular cAMP has also been shown to inhibit muscle-specificgene expression in BC3H1 cells (Hu and Olson, 1988). Consistent with this finding is the observation that the CAMP-dependent protein kinase catalytic subunit, when cotransfected into 10T1/2 fibroblasts, leads to repression of the MCK enhancer (L. Li and E. Olson, unpublished observations). Such repression is directed at the KE-2 site, suggesting that myogenin might be a target for a CAMP-mediated signaltransducing pathway (Li et al., 1991~). Studies with myogenin have also revealed several sites for phosphorylation in the carboxyl terminus within the transcription activation domain (Li et al., 1991~).There is precedent for phosphorylation of transcription activation domains in other transcription factors that can influence their ability to activate their target genes (Tanaka and Herr, 1990; Yamamoto et al., 1988; Boyle et al., 1991). Thus, it is conceivable that modulation of the phosphorylation of this domain could affect myogenin function. Perhaps growth factors such as TGF-f3,which can inhibit the transcription-activating properties of myogenin and MyoD independent of DNA binding, act through modulation of phosphorylation of the transcription activation domain. TGF-P has been shown, for example, to induce phosphorylation of the cAMP response element protein CREB within the nucleus (Kramer et ad., 1991). TGF-f3has also been observed to inhibit phosphorylation of the retinoblastoma (Rb) in the nucleus (Laiho et al., 1990).
MUSCLE CELL REGULATION
113
4. Repression of Myogenic HLH Protein Function through Regulation of Other Cellular Factors Required for Muscle-Specific Gene Activation?
Other than the E2A gene products, El2 and E47, little is known of the cellular factors that collaborate with myogenic HLH proteins to activate myogenesis. However, these proteins could also serve as targets for negative regulation of myogenesis by growth factor signals. Growth factors could, for example, suppress the expression or activity of E2A gene products, which would lead indirectly to suppression of myogenesis. Alternatively, or in addition, there may be coregulators, as discussed above, that are required by myogenic HLH proteins to activate musclespecific genes. These proteins might also serve as intranuclear targets for growth factor signals. It has also been shown that activation of muscle-specific enhancers by myogenin and MyoD requires cooperative interactions with other enhancer binding proteins that bind sites adjacent to the E-boxes (Sartorelli et al., 1990; Gossett et al., 1984; Lin et al., 1991; Weintraub et al., 1989).Thus, inhibition of muscle transcription could be achieved through repression of one of more enhancer binding proteins that normally cooperate with myogenic HLH proteins to activate myogenesis. An important area of investigation in the future will be to identify and characterize the proteins that interact directly and indirectly with myogenic HLH proteins to regulate their functions.
C. MYOCENIC HLH PROTEINS INHIBITCELL PROLIFERATION In addition to activating myogenesis, Davis et al. (1987) originally observed that stable transfection of 10T1/2 cells with a MyoD expression vector led to a reduction in the number of colonies relative to transfections with a selectable marker alone, suggesting that MyoD could inhibit cell proliferation. This observation has been confirmed in a variety of normal as well as transformed cells (Crescenzi et al., 1990; Sorrentino et al., 1990). MyoD-induced growth inhibition occurs within the Go phase of the cell cycle. Analysis of a variety of MyoD mutants for their abilities to suppress cell proliferation revealed the suppressor function maps to the bHLH motif. MyoD mutants in which the basic region has been replaced with that of E l 2 retain the ability to inhibit cell growth, but cannot activate myogenesis, indicating that growth arrest is not a consequence of myogenic differentiation. Similarly, MyoD can inhibit growth
114
LI LI AND ERIC N . OLSON
of several cell types that are refractory to myogenic conversion (Sorrentino et al., 1990; Crescenzi et al., 1990).
D. RHABDOMYOSARCOMA The antagonism between growth signals and the function of myogenic HLH proteins is apparent in rhabdomyosarcoma, a malignant tumor of skeletal muscle found predominantly in young children. Cells derived from these tumors are highly transformed and are anchorage independent in culture. T h e phenotype of rhabdomyosarcoma cells is heterogeneous and gives rise to cells that appear to be blocked at various points in the differentiation pathway downstream of MyoD expression (Scrable et al., 1990; Dias et al., 1991; Hiti et al., 1989). T h e precise etiology of the disease remains unknown, but is likely to arise from the loss of a tumor suppressor gene that maps to chromosome 11 or to an activated ras allele, or both (Scrable et al., 1990; Hall et al., 1983). Although MyoD also maps to human chromosome l l (Tapscott et al., 1988), its expression in all rhabdomysarcomas rules out the possibility that its deletion is a cause for the tumor. Overexpression of MyoD in rhabdomyosarcoma cells is sufficient to increase the ability of the tumor cells to differentiate into myotubes in culture, but is ineffective in reversing tumorigenicity (Hiti et al., 1989). It is interesting to consider whether oncogenes and tumor suppressor genes affect the functions of myogenic HLH proteins by regulation of opposing intracellular pathways that intersect with the pathway(s) regulated by myogenic HLH proteins. V. Summary The skeletal muscle cell system provides a powerful model for exploring the mechanistic basis for the antagonism between cell growth and differentiation. T h e recent identification of the MyoD family of musclespecific transcription factors now offers opportunities to dissect at the molecular level of the mechanisms through which defined cell typespecific transcription factors can activate an entire differentiation program as well as to unravel the mechanisms through which growth factor and oncogenic signals can disrupt cellular differentiation. Because the mechanisms for growth factor signaling and induction of cell proliferation are conserved in diverse cell types, it is tempting to speculate that the molecular mechanisms responsible for the antagonism between cell proliferation and differentiation in muscle cells are also operative in other cell types. Resolution of this question, however, must await identification of the regulatory factors that specify cell fate in other lineages.
MUSCLE CELL REGULATION
115
ACKNOWLEDGMENTS Work in the author’s laboratory is supported by grants from the American Cancer Society and the National Institutes of Health. E N 0 is an Established Investigator of the American Heart Association. LL is supported by a Rosalie B. Hite predoctoral fellowship. The secretarial assistance of Ellen Madson is appreciated.
REFERENCES Beckmann, H., Su, L.-K., and Kadesch, T. (1990). Genes Deu. 4, 167-179. Benezra, R., Davis, R. L., Lockshon, D., Turner, D. L., and Weintraub, H. (1990). Cell 61, 49-59. Blackwell, T. K., and Weintraub, H. (1990). Science 250, 1104-1 110. Blackwood, E. M., and Eisenman, R. N. (1991). Science 251, 121 1-1217. Blau, H. M., Chiu, C. P., and Webster, C. (1983). Cell 32, 1171-1180. Boyle, W. J., Smeal, T., Defize, L. H. K., Angel, P., Woodgett, J. R., Karin, M., and Hunter, T. (1991). Cell 64, 573-584. Braun, T., Buschhausen-Denker, G., Bober, E., Tannich, E., and Arnold, H. H. (1989a). E M B O J . 8, 701-709. Braun, T., Bober, E., Buschhausen-Denker, G., Kotz, S., Grzeschik, K., and Arnold, H. H. (1989b). E M B O J . 8, 3617-3625. Braun, T., Bober, E., Winter, B., Rosenthal, N., and Arnold, H. H. (1990a). E M B O J . 9, 821-831. Braun, T., Winter, B., Bober, E., and Arnold, H. H. (1990b). Nuture (London) 346, 663665. Brennan, T. J., and Olson, E. N. (1990). Genes Dev. 4, 582-595. Brennan, T. J., Edmondson, D. E., and Olson, E. N. (1990). J. Cell Biol. 110, 929-937. Brennan, T., Chakraborty, T., and Olson, E. (1991a). Proc. Natl. Acad. Sci. U.S.A. 88,56755679. Brennan, T. J., Edmondson, D. G., Li, L., and Olson, E. N. (1991b). Proc. Natl. Acad. Sci. U.S.A. 88, 3822-3826. Brunetti, A., and Goldfine, I. D. (1990).J . Biol. Chem. 265, 5960-5963. Buskin, J. N., and Hauschka, S. D. (1989). Mol. Cell. Biol. 9, 2627-2640. Caudy, M., Vassin, H., Brand, M., Tuma, R.,Yeh Jan, L., and Jan, Y. N. (1988). Cell 55, 1061- 1067. Chakraborty, T., and Olson, E. (1991). Mol. Cell. Biol. 11, in press. Chakraborty, T., Brennan, T. J., Li, L., Edmondson, D., and Olson, E. N. (1991a).Mol. Cell. Bzol. 11, 3633-3641. Chakraborty, T., Brennan, T., and Olson, E. (1991b).J. Biol. Chem. 266, 2878-2882. Chen, J., and Jones, P. (1990). Cell Growth Dzffer. 1, 383-392. Choi, J., Costa, M. L., Mermelstein, C. S., Chagas, C., Holtzer, S., and Holtzer, H. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 7988-7992. Church, G. M., Ephrussi, A., Gilbert W., and Tanegawa, S. (1985). Nuture (London) 313, 798-801. Clark, T. G., Morris, J., Akamatsu, M., McGraw, R. A., and Ivarie, R. (1990).Nuclezc Acids Res. 18,3147-3153. Clegg, C. H., Linkhart, T. A., Olwin, B. B., and Hauschka, S. D. (1987).J. Cell Biol. 105, 949-956. Colmenares, C., and Stavnezer, E. (1989). Cell 59, 293-303.
116
LI LI AND ERIC N . OLSON
Colmenares, C., Teumer, J. K., and Stavnezer, E. (1991). Mol. Cell. Biol. 11, 1167-1170. Constantinides, P. G., Jones, P. A., and Gevers, W. (1977). Nature (London) 267, 364-366. Constantinides, P. G., Taylor, S. M., and Jones, P. A. (1978). Dev. Biol. 66, 57-71. Crescenzi, M., Fleming, T. P., Lassar, A. B., Weintraub, H., and Aaronson, S. A. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 8442-8446. Cronmiller, C., Schedl, P., and Cline, R. W. (1988). Genes Dev. 2, 1666-1676. Davis, R. L., Weintraub, H., and Lassar, A. B. (1987). Cell 51, 987-1000. Davis, R. L., Cheng, P.-F., Lassar, A. B., and Weintraub, H. (1990). Cell 60, 733-746. d e la Browse, F. C., and Emerson, C. B. (1990). Genes Deu. 4,567-581. Denis, N., Blanc, S., Leibovitch, M. P., Nicolaiew, N., Dautry, F., Raymondjean, M., Kruh, J., and Kitzis, A. (1987). Exp. CellRes. 172, 212-217. Dias, P., Parham, D. M., Shapiro, D. N., Weber, B. L., and Houghton, P. J. (1991). Am. J. Pathol. 137, 1283-1291. Edmondson, D. G., and Olson, E. N. (1989). Genes Dev. 3, 628-640. Ellis, H. M., Spann, D. R.,and Posakony, J. W. (1990). Cell 61, 27-38. Endo, T., and Nadal-Ginard, B. (1986). Mol. Cell. Biol. 6, 1412-1421. Ephrussi, A., Church, G. M., Tonegawa, S., and Gilbert, W. (1985). Science 227, 134-140. Falcone, G., Tato, F., and Alema, S. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 426-430. Florini, J. R., and Ewton, D. Z. (199O).J.Biol. Chem. 265, 13435-13437. Florini, J. R., Roberts, A. B., Ewton, D. Z., Falen, S. L., Flanders, K. D., and Sporn, M. B. (1986).J. Biol. Chem. 261, 16509-16513. Florini, J. R., Ewton, D. Z., and Magri, K. A. (1991).Annu. Rev. Physiol. 53, 201-216. French, B. A,, Chow, K.-L., Olson, E. N., and Schwartz, R. J. (1991). Mol. Cell. Biol. 11, 2439-2450. Fujisawa-Sehara, S., Nabeshima, Y., Hosoda, Y.,Obinata, T., and Nabeshima, Y. (199O).J. Biol. Chem. 265, 15219-15223. Garrell, J., and Modolell, J. (1990). Cell 61, 39-48. Gossett, L. A., Zhang, W., and Olson, E. N. (1988).J.Cell Biol. 106, 2127-2137. Gossett, L., Kelvin, D., Sternberg, E., and Olson, E. N. (1989).Mol. Cell. Biol.9,5022-5033. Gregor, P. D., Sawadogo, M., and Roeder, R. G. (1990). Genes Deu. 4, 1730-1740. Hall, A,, Marshall, C. J., Spurr, N. K., and Weiss, R. A. (1983). Nature (London) 303, 396400. Harvey, R. P. (1990). Development 108,669-680. Hawley, D. K., and McClure, W. R. (1983). Cell 32, 319-325. Heino,J., and Massague, J. (199O).J.Biol. Chem. 265, 10181-10184. Henthorn, P., Kiledjian, M., and Kadesch, T. (1990). Science 247,467-470. Hiti, A. L., Bogenmann, E., Gonzales, F., and Jones, P. A. (1989).Mol. Cell. Biol. 9, 47224730. Hochschild, A,, Irwin, N., and Ptashne, M. (1983). Cell 32, 319-325. Holtzer, H., Biehl, J., Yeoh, G., Meganathan, R.,and Kaji, A. (1975). Proc. Natl. Acad. Sci. U.S.A. 72, 4051-4055. Hopwood, N. D., and Gurdon, J. B. (1990). Nature (London) 347, 197-200. Hopwood, N. D., Pluck, A., and Gurdon, J. B. (1989). EMBOJ. 8,3409-3417. Hopwood, N. D., Pluck, A., and Gurdon, J. B. (1991). Development (in press). Horlick, R. A., and Benfield, P. A. (1989). Mol. Cell. Biol. 9, 2396-2413. Hu, J.-S., and Olson, E. N. (1988).J. BEol. Chem. 263, 19670-19677. Hu, J.-S., and Olson, E. N. (199O).J.Baol. Chem. 265, 7914-7919. Hu, Y.-F., Luscher, B., Admon, A., Mermod, N., and Tjian, R. (1990). GenesDev. 4, 17411752.
MUSCLE CELL REGULATION
117
Imler, J., Schatz, C., Wasylyk, C., Chatton, B., and Wasylyk, B. (1988).Nature (London) 332, 275-278. Jaynes, J. B., Johnson, J. E., Buskin, J. N., Gartside, C. L., and Hauschka, S. D. (1988).Mol. Cell. Biol. 8, 62-70. Jones, P. A., Wolkowicz, M., Rideout, W. M., 111, Gonzales, F. A., Marziasz, C. M., Coetzee, G . A., and Tapscott, S. J. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 6117-6121. Killary, A. M., and Fournier, R. E. K. (1984). Cell 38, 523-534. Kim, K., and Guarante, L. (1990). Nature (London) 342, 200-203. Konieczny, S. F., and Emerson, C. P. (1984). Cell 38, 791-800. Konieczny, S. F., Baldwin, A. S., and Emerson, C. P., Jr. (1986). In “Molecular and Cellular Biology, New Series” (C. P. Emerson, D. Fischman, B. Nadal-Ginard, and M. A. Q. Siddiqui, eds.) Vol. 29, pp. 21-34. Alan R. Liss, New York. Konieczny, S. F., Drobes, B. L., Menke, S. L., and Taparowsky, E. J. (1989). Oncogme 4, 473-48 1. Kramer, I. M., Koornneef, I., de Latt, S. W., and van den Eijnden-vanRaaij, A. J. M. (1991). E M B O J . 10, 1083-1089. Krause, M., Fire, M., Harrison, S. Preiss, J., and Weintraub, H. (1990). Cell 63, 907-919. Laiho, M., DeCaprio, A., Ludlow,J. W., Livingston, D. M., and Massague, J. (1990). Cell 62, 175- 185. LaRocca, S. A., Grossi, M., Falcone, G., Alema, S., and Tato, F. (1989). Cell 58, 123-131. Lassar, A. B., Patterson, B. M., and Weintraub, H. (1986). Cell 47, 649-656. Lassar, A. B., Buskin, J. N., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D., and Weintraub, H. (1989a). Cell 58, 823-831. Lassar, A. B., Thayer, M. J., Overell, R. W., and Weintraub, H. (1989b). Cell 58,659-667. Lathrop, B., Olson, E., and Glaser, L. (1985a).J. Cell Bzol. 100, 1540-1547. Lathrop, B., Thomas, K., and Glaser, L. (1985b).J. Cell Bzol. 101, 2194-2198. Lenardo, M., Pierce, J. W., and Baltimore, D. (1987). Science 236, 1573-1577. Lewin, B. (1990). Cell 61, 1161-1164. Lewin, B. (1991). Cell 64,303-312. Li, L., Hu, J.-S., and Olson, E. N. (199O).J. Biol. Chem. 265, 1556-1562. Li, L., Chambard, J. C., Karin, M., and Olson, E. N. (1991). Submitted for publication. Li, L., James, G., and Olson, E. N. (1991b). In preparation. Li, L., Heller-Harrison, R., Czech, M., and Olson, E. N. (1991~).In preparation. Lin, A,, Eishelman, J. R., Forry-Schaudies, S., Duran, S., Lessard, J. L., and Holtzer, H. (1987).J. Cell Bzol. 105, 1365-1376. Lin, A.-Y., Deschesne, C. A., Eldridge, J., and Patterson, B. M. (1989). Genes Dev. 3, 986. Lin, H., Yutzey, K., and Konieczny, S. F. (1991). Mol. Cell. Biol. 11, 267-280. Mar, J. H., and Ordahl, C. P. (1990). Mol. Cell. B i d 10, 4271-4283. .Massape, J., Cheifetz, S., Endo, T., and Nadal-Ginard, B. (1986). Proc. Natl. Acad. Scz. U.S.A. 83, 8206-8210. Michelson, A. M., Abmayr, S. M., Bate, M., Martinez-Airias, A., and Maniatis, T. (1990). Gems Dev. 4,2086-2097. Miller, J. B. (199O).J. Cell Biol. 111, 1149-1159. Miner, J. H., and Wold, B. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 1089-1093. Miner, J. H., and Wold, B. J. (1991). Mol. Cell. Biol. 5, 2842-2851. Montarras, D . , Pinset, C., Chelly,.]., Kahn, A., and Gros, F. (1989).E M B O j . 8,2203-2207. Moss, L. G., Moss, J. B., and Rutter, W. J. (1988). Mol. Cell. Bwl. 8, 2620-2627. Mueller, P. R., and Wold, B. (1989). Science 246, 780-786. Murre, C., McCaw, P. S., and Baltimore, D. (1989a). Cell 56, 777-783.
118
LI LI A N D ERIC N . OLSON
Murre, C., McCaw, P. S., Vaessin, H., Caudy, M., Jan, L. Y.,Jan, Y . N., Cabrera, C. V., Buskin, J. N., Hauschka, S. D., Lassar, A. B., Weintraub, H., and Baltimore, D. (1989b). Cell 58, 537-544. Murre, C., Voronova, A., and Baltimore, D. (1991). Mol. Cell. Biol. 58, 537-544. Nadal-Ginard, B. (1978). Cell 15, 855-864. Nelson, C., Shen, L.-P., Meister, A., Fodor, E., and Rutter, W. J. (1990).Genes Dev. 4, 14541461. Olson, E. N. (1990). Genes Dev. 4, 1454-1461. Olson, E. N., and Capetanaki, Y . G. (1989). Oncogene 4, 907-913. Olson, E. N., Sternberg, E., Hu, J. S., Spizz, G., and Wilcox, C. (1986).J. Cell Biol. 103, 1799-1805. Olson, E. N., Spizz, G., and Tainsky, M. A. (1987). Mol. Cell. B i d . 7 , 2104-2111. ONeill, M. C., and Stockdale, F. E. (1974).Dev. Biol. 37, 117-132. Ott, M.-O., Bober, E., Lyons, G., Arnold, H., and Buckingham, M. (1991).Develqfment 111, 1097-1 107. Paterson, B. M., Walidorf, U., Eldridge, J., Dubendorfer, A., Frasch, M., and Gehring, W.J. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 3782-3786. Payne, P. A., Olson, E. N., Hsiau, P., Roberts, R., Perryman, M. B., and Schneider, M. D. (1987). Proc. Natl. Acad. Scz. U.S.A. 84, 8956-8960. Peterson, C., Gordon, H., Hall, Z., Peterson, B., and Blau, H. (1990). Cell 62, 493-502. Pieper, F. R., Slobbe, R. L., Ramaekers, F. C. S., Cuypers, H. T., and Bloemendal, H. (1987). E M B O J . 6,3611-3618. Piette, J., Bessereau, J.-L., Huchet, M., and Changeux, J.-P. (1990). Nature (London) 345, 353-355. Pinney, D. F., Pearson-White, S. H., Konieczny, S. F., Latham, K. E., and Emerson, C. P., Jr. (1988). Cell 53, 781-793. Prendergast, G. C., Lawe, D., and Ziff, E. B. (1991). Cell65, 395-408. Rhodes, S. J., and Konieczny, S. F. (1989). Genes Dev. 3, 2050-2061. Rosenthal, N., Berglund, E. B., Wentworth, B. M., Donoghue, M., Winter, B., Bober, E., Braun, T., and Arnold, H. (1990). Nucleic Acids Res. 18, 6239-6246. Sartorelli,,V., Webster, K. A., and Kedes, L. (1990). Genes Dev. 4, 1811-1822. Sassoon, D., Lyons, G., Wright, W. E., Lin, V., Lassar, A., Weintraub, H., and Buckingham, M. (1989). Nature (London). 341,303-307. Scales, J. B., Olson, E. N., and Perry, M. (1990).Mol. Cell. Biol. 10, 1516-1524. Schafer, B. W., Blakely, B. T., Darlington, G. J., and Blau, H. M. (1990).Nature (Londun) 344, 454-458. Schena, M., Freedman, L. P., and Yamamoto, K. R. (1989). Genes Dev. 3, 1590-1601. Schneider, M. D., and Olson, E. N. (1988).Mol. Neurobiol. 2, 1-39. Schneider, M. D., Perryman, M. B., Payne, P. A., Spizz, G., Roberts, R., and Olson, E. N. (1987). Mol. Cell. Biol. 7 , 1973-1977. Schwartz, J., Chakraborty, T., and Olson, E. N. (1991).Submitted for publication. Suable, H. J., Johnson, D. K., Rinchik, E. M., and Cavanee, W. K. (1990).Proc. Natl. Acad. Sci. U.S.A. 87, 2182-2186. Sejersen, T., Suemegi, J., and Ringertz, N. R. (1985).J . Cell. Physzol. 125, 465-470. Sen, R., and Baltimore, D. (1986). Cell 46, 705-716. Sorrentino, V., Pepperkok, R., Davis, R. L., Ansorge, W., and Philipson, L. (1990).Nature (London) 345, 813-815. Spizz, G., Roman, D., Strauss, A., and Olson, E. N. (198Q.J. Biol. Chem. 261,9483-9488. Spizz, G., Hu, J. S., and Olson, E. N. (1987). Dev. Biol. 143,500-507. Stern, S., Tanaka, M., and Herr, W. (1989).Nature (London) 341, 624-630.
MUSCLE CELL REGULATION
119
Sternberg, E. A., Spizz, G., Perry, W. M., Vizard, D., Weil, T., and Olson, E. N. (1988).Mol. Cell. Biol. 8, 2896-2909. Sternberg, E., Spizz, G., Perry, M. E., and Olson, E. N. (1989).Mol. Cell. Biol. 9, 594-601. Stone, J., De Lange, T., Ransay, G., Jakobovits, E., Bishop, M. J., Varrnus, H., and Lee, W. (1987). Mol. Cell. Biol. 7, 1697-1709. Sun, X-H., and Baltimore, D. (1991). Cell 264,459-470. Sutrave, P., Kelly, A. M., and Hughes, S. H. (1990). Genes Dev. 4, 1462-1472. Tanaka, M., and Herr, W. (1990). Cell 60,375-386. Tapscott, S.J., and Weintraub, H. (1991).J. Clzn. Invest. 87, 1133-1138. Tapscott, S. J., Davis, R. L., Thayer, M. J., Cheng, P.-F., Weintraub, H., and Lassar, A. B. ( 1988). Science 242, 405-4 1 1 . Tapscott, S. J., Davis, R. L., Lassar, A. B., and Weintrau, H. (1989). Science 245, 532-536. Taubman, M. B., Smith, C. W. J., Izumo, S., Grant, J. W., Endo, T., Andreadis, A,, and Nadal-Ginard, B. (1989).J. Cell Biol. 108, 1799-1806. Taylor, S. M., and Jones, P. A. (1979). Cell 17, 771-779. Taylor, S. M., and Jones, P. A. (1982).J.Cell. Physiol. 111, 187-194. Thayer. M. J., and Weintraub, H. (1990). Cell 63,23-32. Thayer, M. J., Tapscott, S. J., Davis, R. L., Wright, W. E., Lassar, A. B., and Weintraub, H. (1989). Cell 58, 241-248. Thisse, B., Stoezel, C., Gorostiza-Thisse, C., and Perrin-Schmitt, F. (1988). EMBO J. 7, 2 175-2183. Vaidya, T. B., Rhodes, S. J., Taparowsky, E. J., and Konieczny, S. F. (1989).Mol. Cell. Bzol. 9, 3576-3579. Venuti, J., Goldberg, L., Chakraborty, T., Olson, E. N., and Klein, W. (1991). Proc. Natl. Acud. Scz. U.S.A. 88, 6219-6223. Villares, R., and Cabrera, C. V. (1987). Cell 50, 415-424. Voronova, A,, and Baltimore, D. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 4722-4726. Walker, M. D., Park, C. W., Rosen, A., and Aronheim, A. (1990). Nucleic Acidc Res. 18, 1159-1 166. Weintraub, H., Tapscott, S. J., Davis, R. L., Thayer, M. J., Adam, M. A., Lassar, A. B., and Miller, A. D. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 5434-5438. Weintraub, H., Davis, R., Tapscott, S., Thayer, M., Krause, M., Benezra, R., Blackwell, T. K., Turner, D., Rupp, R., Hollenberg, S., Zhuang, Y., and Lassar, A. (1991). Science 251, 761-766. Wentworth, B., Donoghue, M., Engert, M., Berglund, E. B., and Rosenthal, N. (1991). Proc. Natl. Acad. Sci. V.S.A. 88, 1242-1256. Wright, W. E. (1982). Somatic Cell Genet. 8, 547-555. Wright, W. E. (1984). Exp. Cell Res. 151, 55-69. Wright, W. E., Sassoon, D. A,, and Lin, V. K. (1989). Cell 56, 607-617. Yamarnoto, K. K., Gonzalez, G. A., Biggs, W. H., 111, and Montminy, M. R. (1988).Nature (London) 334, 494-498. Yutzey, K. E., Rhodes, S. J., and Konieczny, S. F. (1990). Mol. Cell. Biol. 10, 3934-3944.
This Page Intentionally Left Blank
MOLECULAR GENETIC CHARACTERIZATION OF CNS TUMOR ONCOGENESIS C. David James* and V. Peter Collinst 'Department of Pediatrics, Division of Hematology/Oncology,Emory University School of Medicine, Atlanta, Georgia, 30322 +Ludwig Institute for Cancer Research, Clinical Group, S-10401 Stockholm, Sweden, and Division of Neuropathology, Department of Pathology I, Salgrenska Hospital, S-41345 Gothenburg, Sweden
I. Introduction Explanation of Model A. Histopathology as a Standard for Comparison B. Molecular Genetic Analysis 111. Comparison of Molecular Genetic and Histopathologic Analysis IV. Status of Identifying and Characterizing Specific Gene Alterations in CNS Tumor Development V. Implications of Molecular Genetic Analysis on CNS Tumor Diagnosis and Treatment References 11.
I. tntroduction
Recent investigations involving the molecular genetic analysis of several types of human solid tumors have revealed the occurrence and accumulation of clonal genetic alterations during tumor malignant progression (Vogelstein et al., 1988;James et al., 1988; Sat0 et al., 1990; Morita et al., 1991). The results of these studies are consistent with the theoretical model proposed by Nowell (1976), which accounts for the genetic drift of tumor cells from their normal cell progenitors. In this model, the in vim evolution of tumor cell populations is described as occurring through the stepwise accumulation of growth-advantageous genetic changes in affected cells. At the time of its proposal, the tumor cell evolution model offered an explanation of the results of cytogenetic studies of leukemias, which suggested a karyotypic evolution of such tumor cells in association with clinical progression of the disease. The concept of karyotype evolution in association with the malignant progression of human neoplasia is now generally accepted for both leukemias and solid tumors, and cytogenetic data supporting the accuracy of this model have been reviewed by several investigators (Yosida, 1983;
121 ADVANCES IN CANCER RESEARCH. VOL. 58
Copyright 0 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
122
C. DAVID JAMES AND
V.
PETER COLLINS
Wolman, 1983; Sandberg and Turc-Carel, 1987; Nowell and Croce, 1988; Heim et al., 1988). I n this review, we present our accumulated data from the molecular genetic analyses of human central nervous system (CNS) tumors and compare these data with the tumor evolution model of Nowell by using the histopathologically assessed malignancy of such tumors as an indicator of their stage of malignant progression. Second, we will consider the level of resolution that has been obtained toward understanding the molecular genetic nature of CNS neoplasia. Finally, consideration will be given to the significance of molecular genetic research toward the clinical diagnosis and treatment of such tumors. II. Explanation of Model A. HISTOPATHOLOGY AS A STANDARD FOR COMPARISON
For all solid tumors, the histopathological indicators of biological aggressiveness have been empirically determined through the comparison of tumor morphology with corresponding patient clinical outcome. In the case of a CNS tumor, classification is based upon the type of normal glial, neuronal, o r precursor cell the tumor cells most closely resemble, and upon the tumor’s malignancy grade, which is established through the evaluation of several morphologic criteria (Zulch, 1979). As the students of pathology developed systems of tumor classification, both differential and dynamic aspects of tumor morphology became apparent (concepts formalized in Foulds, 1960). For CNS tumors of glial origin, Scherer (1940) was among the first to build a convincing case for the malignant evolution of the most common type of glioma, astrocytoma, through the determination of regional variation of histopathologic malignancy between sections of complete cerebral hemispheres obtained from patients who had died with CNS tumors. A similar interpretation of CNS tumor evolution was derived some years later by Rubenstein as a result of his thorough examination of the brains of 129 patients whose surgical tumor diagnosis was glioblastoma, the most malignant form of glioma. His analysis revealed that in 28 instances there was association of glioblastoma with diffuse, lower malignancygrade astrocytoma [study conducted between 1946 and 1955 (see Russell and Rubenstein, 1989)l. T h e temporal component of tumor morphological evolution has been similarly addressed through the histological comparison of primary (first surgery) and recurrent (second surgery of tumor regrowth) tumors.
CNS TUMOR MOLECULAR GENETICS
123
With respect to the malignant evolution of astrocytoma, two studies revealed that 39 of 79 (Laws et al., 1984) and 92 of 137 (Muller et al., 1977) recurrent tumors displayed increased histological malignancy. A similar study that involved the histopathologic comparison of surgical specimens with specimens obtained from corresponding patients at necropsy suggested malignant progression in 29 of 55 cases (Russell and Rubenstein, 1989). In addition to providing evidence indicating the malignant evolution of CNS tumors, the results of these studies underscore the clinical acceptance of histopathologic diagnosis as a correlate of tumor biological behavior. As a consequence of its acceptance, we have found it most appropriate to compare data from molecular genetic analysis of CNS tumors against this standard of classification. Unfortunately, there have evolved several systems of CNS tumor classification, all of which have an origin traceable to the scheme proposed by Bailey and Cushing (1926), and this diversity occasionally makes it difficult to compare the results from different studies. For our studies, all tumors are classified according to criteria established by the World Health Organization (Zulch, 1979) as well as those delineated by Burger et al. (1985) for distinguishing anaplastic astrocytomas from glioblastomas. For presenting data in this review, the tumors that occur most commonly in adults have been grouped by their numerical malignancy grade; in these categories the grade I1 tumors have been described only by their cellular differentiation, grade 111 tumors have been described by their cellular differentiation and the word anaplastic, and grade IV tumors have been described as glioblastomas (Table I). Two types of tumors that occur most commonly in the pediatric population, the relatively benign pilocytic astrocytoma and the highly malignant medulloblastoma, will be considered separately. B. MOLECULAR GENETICANALYSIS 1. Detection of Dominant Alterations Tumorigenesis, as a dynamic process of increasingly deregulated cell growth, can be considered from many perspectives. For this review it will be considered in the context of the cell biological consequences of dominant and recessive genetic or epigenetic alterations. Dominant alterations elicit a proliferative response in effected cells as a result of increased andlor modified function of the associated gene product; alterations resulting in the elimination of any and all associated protein functions are not included in this category. Dominant alterations include gene mutation (Box, 1988) and increases of gene transcription (Cole,
TABLE I GENETIC ALTERATIONS IN MALIGNANCY GRADE 11-IV GLIOMAS Tumor ‘Y Pea
Chromosomes losing heterozygosityb
Chromosomes retaining heterozygosity
Gene amplificationc
Grade IV tumors GB 1 GB2 GB3 GB4 GB5 GB6 GB7 GB8 GB9 GBlO GBI 1 GB12 GB13 GB14 GB15 GB16
1, 7, 11, 13, 15, 17, 18, 19, 20, X, Y 3, 4, 5, 9, 11, 15, 16, 18, 20, 21, X, Y 1, 3, 5, 8, 11, 12, 14, 16, 21, 22, X, Y 1, 2, 13, 15, 17, 18, 20, 22 1, 2, 7, 11, 13, 14, 15, 16, 17, 20, 22, X, Y 1, 2, 3, 4, 7, 8, 13, 15, 17, 18, 19, 21, X, Y 2, 3, 5, 8, 19, 22, X 1, 2, 9, 11, 14, 15, 20, 21, X, Y 1, 4, 8, 11, 13, 16, 17, 19 1, 2, 3, 11, 12, 13, 17, 18, 19, 20, 21, X, Y 1, 4, 5, 6, 9, 11, 12, 15, 16, 17, 18, 20, 22, X, Y 2, 3, 4, 7, 8, 11, 13, 14, 15, 17, 18, 19, 22, X, Y 1,2,8,9,11,14,17,19,20,22,X,Y~ 5, 7, 8, 9, 11, 13, 15, 16, 20, 21, 22, X I, 3, 7, 8, 13, 14, 16, 18, 19, 22, X, Y 2, 3, 4, 7, 9, 11, 12, 13, 15, 20, 22, x, Y
AA 1 AA2 AA3
1, 4, 5 , 9 , 10, 11, 13, 17, 19, 21, X, Y
9p*, 10, 22, 10, 13, 17, 22 4, 7, 10, 18 10 9p*, 10 9p*, 10, 20, 22 7, 9p*, 10, 11, 13, 15, 17p 10, 13, 17, 22 10 9p, 10, 22 9p*, 10 10, 13 10 10, 17p 10, 17p
None None EGFR EGFR EGFR EGFR EGFR None None EGFR EGFR EGFR EGFR EGFR None None
None 9, 17p None
None None None
10
Grade I11 tumors 1, 3, 4, 5, 7, 8, 10, 11, 13, 14, 15, 16, 19, 20, 21, 22, X 7, 9, 10, 11, 13, 14, 17, 19, 22, X, Y
AA4 AA5 AA6 A 01 A02 AOA 1 AE 1 AE2
1, 2, 3, 5, 7, 10, 13, 16, 18, 19, 20, 21, 22, X, Y 3, 4, 7, 9, 13, 14, 15, 19, 21, 22, X, Y 1, 2, 3, 10, 11, 12, 13, 14, 15, 17, 22, X 3, 8, 10, 12, 13, 15, 16, 17, 22, X 1, 2, 5, 8, 9, 10, 14, 17, 18, 19, 21, 22, X, Y 1, 2, 4, 7, 8, 9, 10, 11, 12, 15, 17, 19, 21, 22, X, Y 3, 5, 6, 9, 10, 11, 12, 15, 17, 19, 21, X 1, 2, 7, 9, 10, 12, 15, 16, 20, 21, X, Y
A1 A2 A3 A4 A5 01 02 03 04 OA 1 OA2 OA3 El
1, 5, 7, 9, 10, 11, 12, 13, 18, 19, 20, 21, 22, X, Y 1, 2, 5, 9, 10, 11, 13, 14, 15, 18, 19, 22, X, Y 1, 7, 9, 10, 12, 15, 16, 17, 20, 22 4, 5, 9, 10, 13, 14, 17, 18, 20, 21, 22 2, 3, 9, 10, 11, 13, 15, 17, 22, X, Y 1, 4, 5 , 7, 9, 10, 11, 13, 15, 17, 20, X, Y 2, 3, 8, 10, 11, 13, 14, 16, 17, 20, X, Y 1, 2, 3, 5, 8, 9, 10, 11, 13, 16, 17, 18, 20, 22, X, Y 1, 2, 8, 9, 10, 11, 12, 13, 15, 16, 17, 19, 21, 22, X 1, 2, 3, 4, 5, 7, 9, 10, 11, 13, 14, 15, 17, 20, 22, X 2, 7, 10, 12, 13, 15, 22 2, 7, 9, 10, 11, 13, 17, 18, 19, 20, 21, 22, X 3, 8, 9, 10, 11, 15, 16, 17, 20
gp, 17p None 9P 1, 4, 9p, 21 13 None 14, 22 6, 13, 17, 22
None None EGFR None None None None None
17P 3, 17p 13 None None None 22 None None None 11 None 13, 21, 22, X
None None None None None None None None None None None None None
Grade I1 tumors
a Tumor types: GB, glioblastoma; AA, anaplastic astrocytoma; AO, anaplastic oligodendroglioma; AOA, anaplastic oligoastrocytoma; AE, anaplastic epedymoma; A, astrocytoma; 0, oligodendroglioma; OA, oligoastrocytorna; E, ependymoma. For chromosomes in cases for which arm-specific loss has been determined, such loss has been indicated by a “p.” Cases in which chromosome 9 interferon probe hybridization indicated locus nullizygosity have been indicated by an asterisk. EGFR, Epidermal growth factor receptor.
126
C. DAVID JAMES A N D V. PETER COLLINS
1985), including cell cycle-specific increases/activations (F’ardee, 1989). These alterations involve the class of genes most frequently referred to as oncogenes, and the number of examples in the literature detailing the involvement of such genes with human neoplasia are legion (Bishop, 1991). Although several oncogenes have been implicated in the development of CNS tumors, the number for which there is any compelling evidence of neoplastic involvement is quite small. A majority of the data describing specific oncogene associations with CNS neoplasia, and for that matter all types of human neoplasia, have resulted from the application of either of two methods of analysis. One of these concerns the determination of oncogene gene dosage in the DNA extracted from tumor tissue. Increasing gene dosage (gene amplification,Alitalo and Schwab, 1986)is a cellular mechanism for increasing the amount of a corresponding gene product by increasing the number of transcribable genes (Wong et al., 1987). For certain types of CNS neoplasia, gene amplification may have been presupposed as a frequent event because cytogenetic studies had, in many instances, revealed the presence of double-minute chromosomes in CNS tumor cells (for review see Bigner et al., 1990a). Such chromosomes have been demonstrated to house amplified genes and their presence has been a consistent indicator of gene amplification in tumor cells. Subsequent to the observation of double minutes in glioma cells, it was determined that the epidermal growth factor receptor (EGFR) gene was frequently amplified in glioblastomas (Libermann et al., 1985))and it has further been demonstrated that there is a positive correlation between the presence of double minutes and EGFR gene amplification in these tumors (Bigner et al., 1987). The product of this gene transmits extracellular signals that promote cell proliferation via an intracellular tyrosine kinase activity, and the transfer and expression of genetic constructs containing wild-type EGFR have been shown to promote liganddependent cell transformation (Di Fiore et al., 1987; Velu et al., 1987). Although amplification and overexpression of this gene has been demonstrated in other types of tumors, its involvement with human neoplasia is most clear with the gliomas: EGFR has been determined to be amplified in nearly half of all glioblastomas analyzed (Libermann et al., 1985; Wong et al., 1987; Ekstrand et al., 1991). Other genes determined to be amplified in biopsies, cell lines, or xenografts of human CNS tumors include N-myc (Garson et al., 1985; Wong et al., 1987; Rouah et al., 1989;James et al., 1990),c-myc (Trent et al., 1986; Raffel et al., 1990; Bigner et al., 1990b), and gli (Kinzler et al.,
CNS TUMOR MOLECULAR GENETICS
127
1987; Wong et al., 1987), and each of these encode nuclear DNA-binding proteins that may act as transcription factors for early growth response genes (Lewin, 1991). It is important to note that the frequency of their involvement with CNS neoplasia in general is not as clear as in the case of EGFR, because their amplification has only been determined in a small proportion of the total cases examined. There is some evidence to suggest, however, that amplification of either of the myc genes may be of significant frequency in a type of CNS tumor that occurs most commonly in children, medulloblastoma (Rouah et al., 1989; Raffel et al., 1990; Bigner et al., 1990b; James et al., 1990). A second approach that has frequently been used to determine oncogene involvement in the tumorigenesis of a specific tissue concerns the measurement of oncogene transcript levels in tumor RNA and comparison of such levels with those determined in corresponding normal tissue. To date there have only been two studies that have involved oncogene expression analysis in a substantial number of CNS tumors and whose results would therefore lend themselves to some generalization. It is interesting that each of these focused upon a growth factorgrowth factor receptor system: epidermal growth factor and/or transforming growth factor-a (TGF-a) with their corresponding receptor, EGFR (Ekstrand et al., 199l), and platelet-derived growth factor-a-chain and +-chain (PDGF-a, PDGF-P), which form homo- and heterodimers that interact with a and P PDGF receptors (Maxwell et al., 1990). The conclusions drawn from each study were similar: the detection of transcripts (expression) for corresponding growth factors and receptors in glial tumors suggests tumor cell utilization of PDGF and EGF growth stimulatory systems, by autocrine and/or paracrine mechanisms, to promote tumor cell proliferation. The results of a study in which components of these growth systems were investigated in an in vitro (cell culture) setting suggested an analagous situation (Nister et al., 1988). In the case of EGFR, it is apparent that glioma cells can activate this growth stimulatory system by other mechanisms, and these mechanisms will be discussed in greater detail in Section IV. The expression of the myc and gli genes, which have been implicated as being involved in at least some cases of CNS tumorigenesis through gene amplification, has yet to be thoroughly investigated.
2 . Detection of Recessive Genetic Alterations In comparison with molecular evidence supporting a dominant component of cancer, molecular evidence of a recessive component is relatively
128
C. DAVID JAMES AND V. PETER COLLINS
recent. Recessive genetic and epigenetic alterations are those that inactivate genes or gene products that provide negative regulation of cell proliferation. The assay used to demonstrate this property involves the introduction of a normal (wild-type) tumor suppressor gene (TSG) into tumor cells with missing and/or inactivated corresponding TSGs and demonstrating that the transcriptional activity of the exogenous gene diminishes the growth potential of the host cell. To date, evidence supporting a tumor suppression function exists for only two genes: retinoblastoma (Rb) (Huang et al., 1988) and TP53 (Baker et al., 1990a; Chen et al., 1990). However, as a result of molecular genetic analysis, at least three other genes, the chromosome 9p-localized gene for interferons (Diaz et al., 1988; Miyakoshi et al., 1990; James et al., 1991), the 18q-localized DCC (deleted in colon cancer) gene (Fearon et al., 1990), and the 11p-localizedWilms’ tumor gene (Haber et al., 1990),have been implicated as having tumor suppression function, and the existence of several additional tumor suppressor genes has been inferred from the cumulative results of cytogenetic and restriction fragment length polymorphism (RFLP) analysis (described below). In an abbreviated form of explanation, RFLP analysis is a molecular genetic technique that allows one to distinguish maternally and paternally inherited alleles as a consequence of restriction fragment length polymorphisms. Such analysis has been used extensively in the determination of the genetic (recombination) distances between syntenic loci for the purpose of developing detailed human chromosomal gene maps (Donis-Keller et al., 1987). With respect to the analysis of solid tumors, it has been used for the determination of the chromosomal locations at which genetic information is lost, as indicated by the disappearance of one of the two allelic variants in a patient’s tumor DNA [loss of constitutional heterozygosity (LOH)]. The determination of a chromosomal or subchromosomal location of such loss as a frequent event in tumors of a specific histology is thought to indicate the location of a gene whose functional loss is involved in the oncogenesis of that class of tumors. This type of analysis was the first to provide molecular support (Cavenee et al., 1983) of the tumor suppressor gene concept resulting from tumor cell fusion experiments performed several years earlier (Harris et al., 1969), and its utilization has been of fundamental importance to the identification of the confirmed and candidate suppressor genes (Marshall, 1991). The results from the application of this technique to CNS neoplasia and a consideration of their bearing on TSG involvement in such tumors will be taken up in the next two sections.
CNS TUMOR MOLECULAR GENETICS
129
Ill. Comparison of Molecular Genetic and Histopathologic Analysis In undertaking a molecular genetic analysis of CNS tumors, we sought to examine both dominant and recessive components of human CNS neoplasia by applying RFLP analysis toward the determination of the chromosomal locations of the relevant tumor suppressor genes, and by applying gene dosage (amplification) analysis toward the identification of relevant, dominantly acting oncogenes. In applying RFLP analysis, we determined to utilize at least one probe, and in most cases multiple probes, to examine loci on each autosome and sex chromosome for loss of genetic information. The results of such analyses are summarized in Table I, revealing several associations between detectable alterations and tumor histopathologic malignacy. The first and most striking association concerns the loss of genetic information from chromosome 10 and its exclusive association with the most malignant variant of glioma, glioblastoma (grade IV malignancy). Of the 40 gliomas that have been thoroughly characterized for LOH, 16 of 16 glioblastomas revealed loss of genetic information from chromosome 10 (Fig. 1A) whereas none of 24 grade I11 or grade I1 tumors (Fig. 1B and C, respectively) displayed such loss. The frequent loss of genetic information from chromosome 10 in high malignancy gliomas has subsequently been demonstrated by several additional groups, and in combination these reports provide good evidence of this alteration being closely associated with advanced glial tumor malignancy (Fujimoto et al., 1989; Watanabe et al., 1990; Venter and Thomas, 1991). Further analysis has revealed that loss of the 9p-localized interferon genes were restricted to grade I11 and IV tumors (James et al., 1991) and that loss of genetic information from chromosomes 13, 17, and 22 occurred at similar frequencies in each malignancy grade of tumor (James et al., 1988, 1989) (Figs. 1A-1D). Of these changes, only the frequent loss of genetic information from the short arm of chromosome 17 in all malignacy stages of adult glioma has thus far been investigated and confirmed by additional groups (el-Azouzi et al., 1989; Fults et al., 1989). With regard to the oncogene amplification analysis of this series of tumors, our results were consistent with the previously established association between EGFR gene amplification and advanced glial tumor malignancy. We determined EGFR amplification in 10 of the 16 glioblastomas, 1 of 1 1 grade I11 tumors, and 0 of 13 grade I1 tumors (Table I). None of these tumors demonstrated amplification of the c-myc or N-myc genes.
130 A K
IIIC
x IC
13
C. DAVID JAMES A N D V. PETER COLLINS
a
D
a
I
C
I
1(H in Gliw
I
12
11' II' %.
8' 7'
*
1'
I' 3.
2 t'
V
almlm It
Fa
thrum
111 I Ill
a
FIG. 1 . Analysis of loss of genetic information in malignancy grade II-IV gliomas. Loss of heterozygosity (LOH) was analyzed for each of the 40 tumors listed in Table I by examining patient normal tumor DNA RFLP patterns at one or more loci from each chromosome. (A-C) Both the number of cases (solid bars) and the percentage of informative cases (striped bars; number of cases displaying loss of heterozygosity divided by the number of cases that were informative for one or more RFLP markers at the corresponding chromosomal region) have been indicated. (D) A histogram summary of the number of cases displaying loss within each malignancy grade facilitates determination of common (e.g., chromosome 17) and malignacy grade-specific (e.g., chromosome 10) losses of genetic information.
In total, our molecular genetic analysis reveals the grade IV tumors as having nearly twice the average number of detectable genetic alterations as the grade I11 tumors, which have nearly twice the average number of alterations as the grade I1 tumors (Table I). These data stand in reasonable accord with the model proposed by Nowell (1976) in suggesting that increased tumor malignancy is associated with increased numbers of
TABLE I1 GENETIC ALTERATIONS I N MEDULLOBLASTOMAS A N D PILOCYTIC ASTROCYTOMAS Tumor 'YPe
Chromosomes retaining heterozygosity
Chromosomes losing heterozygosity"
Gene amplification
n
Medulloblastomas
M1 M2 M3 M4 M5 M6 M7 M8 M9 M10 M11
2, 5, 6, 12, 13, 14, 16, 17, 20, 21, 22, X, Y 7, 8, 10, 11, 12, 13, 14, 15, 17, 19, 21, X, Y 1, 6, 9, 10, 11, 12, 13, 16, 17, 20, 21, 22 2,4, 6, 7, 8, 10, 11, 12, 13, 15, 16, 17, 22, X, Y 1, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 1, 2, 3, 6, 7, 8, 9, 11, 13, 15, 17, 19, 20, 22, X, Y 1, 2, 4, 7, 9, 10, 11, 12, 13, 14, 19, 20, 22 2, 9, 13, 15, 18, 19, 21, 22 2, 5, 7, 8, 10, 11, 12, 13, 14, 15, 16, 20, 21, 22, X, Y 1,4,5,8,9,10,12,13,14,22,X,Y 1, 2, 3, 7, 8, 9, 10, 11, 13, 14, 15, 18, 19, 20, 21, 22
10, 11 22 None None 22 10 17 11, 16, 17p 17P 11, 17p 17P
None None None None None N-myc None None None None None
1, 2, 3,6, 7, 8, 10, 11, 12, 13, 17, 19,20, 22 2, 3, 6, 9, 10, 12, 13, 14, 17, 20, 21, 22 2, 5, 6, 7, 9, 10, 11, 12, 13, 14, 16, 17, 20, 22
5
ci
c:
Pilocytic astrocytomas PA 1 PA2 PA3
5
None None None
Chromosomes in cases for which arm-specific loss was determined have been indicated by a letter "p."
None None None
132
C. DAVID JAMES A N D V. PETER COLLINS
genetic alterations. In addition to an apparent cumulative effect of such alterations upon tumor malignancy, these data suggest a preferential order of occurrence of mutations during the malignant evolution of CNS neoplasia. Therefore, these results form a framework for staging CNS neoplasia with respect to both specific and cumulative genetic alterations (Table I, Fig. 1D). We have also analyzed two common types of CNS tumors that generally occur in pediatric patients, pilocytic astrocytoma and medulloblastoma (James et al., 1990). There is little clinical or histopathological evidence with which to link these tumors with the grade II-IV types that usually occur in adults. The pilocytic astrocytoma is a relatively benign tumor and generally does not demonstrate the propensity for malignant progression. observed in the adult tumors (Gjerris and Klinken, 1978), and although the medulloblastoma is of highest malignancy (grade IV), it has no known or suspected lower malignancy grade precursor. Our data (Table 11) from the analysis of these tumors displays a reasonable degree of correlation with their clinical behavior: the pilocytic astrocytomas represent the only group of CNS tumor for which we have been unable to detect any genetic alterations, whereas alterations were detected in 9 of the 11 medulloblastomas.Among the medulloblastomas, loss of genetic information from the short arm of chromosome 17 was the most common alteration observed (5 of 11 cases). These data correspond well with those of an earlier report that describes the frequent loss of genetic information from chromosome 17 in this type of tumor (Raffel et al., 1990), and with a subsequent report that further defined the region of deletion on the short arm to p12-p13.1 (Cogen et al., 1990).
IV. Status of Identifying and Characterizing Specific Gene Alterations in CNS Tumor Development
The investigations described in the previous section represent preliminary attempts toward the identification of genes whose alteration is causally associated with the development of CNS neoplasia, toward the characterization of such alterations, and toward understanding the functional and biological consequences of such alterations. LOH analysis is a technique that has been utilized to help accomplish the first of these goals and is useful only for the identification of genes whose products provide negative regulation of cell proliferation (Friend et al., 1986; Baker et al., 1989). The molecular genetic studies conducted thus far have suggested a
CNS TUMOR MOLECULAR GENETICS
133
minimum of six tumor suppressor genes at six corresponding genomic locations whose loss is associated with the development of CNS tumors. For four of the locations, the status of the current research effort is still very much at the stage of identification. Of these, chromosome 10 is perhaps the most significant due to the frequency of its loss and its strict association with highest histopathologic malignancy. Unfortunately, our own group and others have thus far failed to apply successfully LOH analysis toward the deletion mapping sublocalization of a region on chromosome 10 that houses one or more tumor suppressor genes. The cumulative data concerning this matter suggest that loss of an entire chromosome 10 is the mechanism by which genetic information is generally eliminated from this chromosome, data in good accord with the frequent cytogenetic determination of monosomy 10 in the cells derived from such tumors. However, the cytogenetic literature also indicates a few instances of partial loss from chromosome 10 and such cases have revealed loss from the distal portion of the chromosome’s long arm (Rey et al., 1987). As an explanation for the apparently high frequency of chromosome 10 nondisjunction (resulting in one daughter cell with monosomy 10) in the development of glioblastoma, it is tempting to speculate that this mechanism may represent a convenient way to eliminate tumor suppressor genes that reside on opposing arms of the chromosome. Less often involved, but at seemingly nonrandom frequencies (Fig. 1) in CNS tumor LOH, are loci on chromosomes 11 (Fults et al., 1990; James et al., 1990), 13 Uames et al., 1988, 1990), and 22 Uames et al., 1988, 1990); these deletions have also been observed in each malignacy grade of glioma. For chromosome 11, the molecular genetic analysis of other types of human tumors suggests at least three distinct tumor suppressor gene loci on this chromosome (Scrable et al., 1987; Haber et al., 1990; Bystrom et al., 1990). Use of probes from opposing arms has indicated that a locus or loci on the p arm may be the target of chromosome 11 deletions reported in astrocytomas (Fults et al., 1990). Although it has yet to be investigated, alteration of the Rb gene is a candidate for association with CNS tumor oncogenesis due to the loss of genetic information from chromosome 13. Such losses have been observed in other cancers in association with a mutant form of the remaining Rb allele (Hansen et al., 1985; Friend et al., 1986; Yokota et al., 1987; Harbour et al., 1988). The locus o r loci on chromosome 22 may involve the as yet to be identified and putative tumor suppressor gene implicated in meningioma (Seizinger et al., 1987; Dumanski et al., 1987, 1990) o r the gene whose alteration predisposes individuals to neurofibromatosis type 2 (Seizinger et al., 1986; Rouleau et al., 1987, 1990). However, there is no
134
C. DAVID JAMES AND V. PETER COLLINS
deletion mapping data available at this time to suggest a subregion of chromosome 22 as housing a TSG whose loss is involved in CNS tumorigenesis. For two other chromosomes, the application of LOH deletion mapping has met with greater success. The analysis of chromosome 9 has revealed the frequent loss of one (hemizygous deletion) or both (homozygous deletion) interferon (IFN-@and/or IFN-a) alleles on the short arm of the chromosome Uames et al., 1991). Significantly, loss of one allele is most frequently seen in the grade 111 tumors whereas loss of both alleles has been determined only in the grade I V tumors. Such data suggest discreet IFN gene deletion events involved in the CNS tumor attainment of intermediate and high-grade malignancy. Although the region of 9p nullizygosity has not been well characterized at this time, there is great intuitive appeal to the idea that such tumor cells would eliminate the genes whose products have been shown to inhibit their own growth in in uitro systems (Cook et al., 1983). Recently it has been demonstrated that the transfer into and expression of an IFN-P gene in the cells of cultured gliomas results in marked growth retardation of the recipient cells (Mizuno et al., 1990). Frequent loss of genetic information from chromosome 17p was determined at a relatively early stage during our LOH analysis of adult CNS tumors (James et al., 1988), and such loss was observed at similar frequencies in each malignancy grade of glioma (Fig. 1D).Subsequent to this determination it was shown that the 17p-localized TP53 gene was mutated in human glioma biopsies and/or xenografts (Nigro at al., 1989), and in combination with studies of colorectal cancer, which have shown that TP53 mutations are often revealed in association with chromosome 17p deletions (Baker et al., 1990b),the normal form of the gene represents a possible target of the 17p deletions observed in the CNS tumors, including the medulloblastomas (Jameset al., 1990; Cogen et al., 1990). Additional evidence that weighs in favor of the involvement of TP53 mutations in CNS neoplasia stems from the determination of the suppression of glioma cell growth by introduction and expression of an exogenous, wild-type TP53 gene (Mercer et al., 1990). With respect to the status of the research effort toward determining the dominant components of CNS neoplasia, it is clear that a majority of such efforts are being directed at the EGFR gene. For a number of reasons, including its having been one of the first cellular genes determined to be related to a transforming retroviral gene, v-erb-B (Downward et al., 1984), the EGFR gene and its product have been intensively studied. It might therefore seem of little value to further investigate its
CNS TUMOR MOLECULAR GENETICS
135
amplification in malignant gliomas because the purpose of the amplification seems clear enough. However, recent investigations have revealed new aspects of this process that warrant further consideration. Our initial examination of the Southern filters containing adjacent and corresponding normal and tumor DNA pairs with a cDNA probe for the EGFR gene (pE7; see Fig. 2) frequently revealed tumor-specific restriction fragments of the gene in several patients with EGFR gene amplification (Sugawa et al., 1990; Ekstrand et al., 1991). Alteration of the EGFR gene in glioblastoma was reported in 1985 (Libermann et al., 1985), and subsequent to this report EGFR rearrangements in several cases of glioblastoma with amplified EGFR genes were sublocalized to that part of the gene encoding the extracellular domain of the receptor (Malden et al., 1988; Yamazaki et al., 1988). Progress in characterizing the effects of such alterations may have been hampered due to the lack of an in uitro system to provide material for analysis, a consequence of the apparent and intriguing selection against cells with EGFR amplification during the culturing of primary tumors displaying EGFR amplification (Bigner et al., 1990~).We determined to sublocalize the regions of this large gene to which the aberrant fragments determined in our own
PI%
P629
PC47
1,1,,111,11~111,11,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,~,,~~~~~~~~~~,,,,,~~~~~~~~~~~,,,,~~~~~~~~~~,~~,,,,,~~~~~~~~~~~,
PE7
FIG.2. cDNA map of the epidermal growth factor receptor gene displaying structural (top) and functional (bottom) encoding domains of the gene and of the regions susceptible to alteration in tumors in which gene amplification has occurred. N, N-terminus; C, Cterminus; EC, extracellular; T M , transmembrane; IC, intracellular/cytoplasmic; SP, signal peptide; LB, ligand binding; T K , tyrosine kinase; CaIn, calcium regulation and internalization; Inhib, inhibitory. Scale for determination of the length (in bases) of the cDNA lies at the bottom of the figure. The alteration that commonly occurs at the 5‘ end of the gene has been denoted by the coding bases that are deleted as a consequence of such alterations, 275-1075 (Sugawa et al., 1990). The alterationThat has been detected at the 3‘ end of the gene has been indicated by the line running under the CaIn and Inhib domains. pE7 is the partial cDNA probe used during the initial examination of tumors listed in Table I; PC15 and PC29 are 50-length oligonucleotide probes that fail to hybridize to EGFR genes and transcripts with 5’ alteration. PC47 is a 50-length oligonucleotide probe that fails to hybridize to EGFR genes and transcripts with 3’ alteration.
136
C. DAVID JAMES AND V. PETER COLLINS
series of tumors could be attributed, and to characterize the corresponding, aberrant cDNA for sequence alterations. Our strategy involved the use of short oligonucleotide probes from various parts of the gene that code for parts of the receptor with specific structural and/or functional properties, and determination of which of these probes would identify the same aberrant fragments revealed by pE7 during our initial examination of the EGFR locus (Fig. 2). Using this approach w e have determined what can be considered as two classes of alterations that occur frequently in tumors with EGFR gene amplification. The first and most thoroughly characterized of these is the class of alterations that result in the elimination of sequences coding for a portion of the receptor’s extracellular domain. The elimination of sequences was determined by the lack of hybridization of oligonucleotidesfrom the 5’ part of the gene (Fig. 2) to DNA and mRNA from tumors with this type of alteration. Further oligonucleotideswere designed on either side of the deleted region to amplify cDNA from these tumors for the sequencing of the altered region of the corresponding mRNA. It was determined that each tumor with this type of alteration had the same altered cDNA sequence at the site of the rearrangement, which revealed that base 274 of the normal sequence had been joined to base 1076 (Sugawa et al., 1990). This alteration has also been demonstrated by two additional groups (Humphrey et al., 1990; Yamazaki et al., 1990), and one of these has presented data suggesting that the altered receptor may be constitutively activated (Yamzaki et al., 1988, 1990). Such a finding is consistent with the results of a study in which an EGFR construct with a truncated extracellular encoding domain was determined to transform primary rodent cells in the absence of ligand (Haley et al., 1989). Of the 10 glioblastomas listed in Table I that displayed EGFR gene amplification, 4 revealed this type of alteration. Examination of a larger series of glioblastomas reveals this alteration to occur in about half of the glioblastomas with EGFR amplification and therefore in about 25% of all such tumors (Ekstrand et al., 1991). More recently we have characterized a second, frequent alteration of the EGFR gene in glioblastomas; this alteration results in the elimination of sequences encoding a portion of the receptor’s cytoplasmic domain, which is involved in receptor internalization (Fig. 2). This type of alteration has been detected in 12% of the glioblastomas we have examined; the details of the sequences of the corresponding altered cDNAs will appear elsewhere. EGFR genes lacking sequences that code for this portion of the receptor display increased ligand-induced cell transformation capacity relative to the wild-type EGFR (Wells et al., 1990). In three tumors, both extracellular and cytoplasmic alterations have been deter-
CNS TUMOR MOLECULAR GENETICS
137
mined, suggesting the genetic evolution of the EGFR gene toward an increasingly oncogenic form, and possibly toward the sequence of its highly transforming retroviral homologue, v-erb-B. As the types of EGFR gene alterations that occur in glioblastomas are thoroughly characterized, it is expected that several research groups will pursue investigations directed toward understanding the functional and biological consequences of these changes. V. Implications of Molecular Genetic Analysis on CNS Tumor Diagnosis and Treatment This research has been consistently directed toward one molecular and one clinical question: 1. What are the molecular events involved in glial cell growth control deregulation? 2. Can molecular analysis be utilized in the clinical management of CNS tumors?
The status of the research effort directed toward the first question was considered in some detail in the previous section; here the clinical implications of these data will be considered. There are two clinical concerns upon which these studies bear, one of which involves diagnosis and the second of which involves therapy. Of the two, the implications of these data appear to hold more immediate relevancy on the diagnostic aspect. As reviewed above, these data suggest both specific and cumulative genetic alteration associations with CNS tumor histopathologic malignancy. T h e histopathologically assessed malignacy has served as the primary standard with which to predict the clinical behavior of patients with CNS cancer and upon which to base postoperative therapeutic decisions. We have recently initiated a study to assess the prognostic value of the molecular data we have gathered. However, it is wholly unlikely that the level of molecular resolution (identification/characterization)we have achieved toward determining the fundamental nature of the events causally involved in CNS tumor oncogenesis is sufficiently advanced that such analysis would replace conventional histopathology ; the question at issue is whether such analysis might augment conventional diagnosis. Due to the strong association of certain genetic alterations with advanced glial tumor malignancy (i.e., LOH from chromosome 10, EGFR amplification, and IFN nullizygosity), its seems plausible that molecular genetic analysis could extend the diagnostic reliability of conventional histologic analysis. It seems unlikely that such analysis will prove clinically
138
C. DAVID JAMES AND V. PETER COLLINS
useful in the immediate future, however, because the methods employed in the studies revealing these alterations would currently not be considered time or cost effective. Although it is entirely presumptuous to consider a therapeutic relevance of this work at this time, it is nonetheless tempting to speculate about some possibilities whose origins lie in the preliminary work. One of these concerns the characterization of EGFR gene alterations. Previously we had determined a specific type of EGFR gene rearrangement occurring in as many as 25% of the highly malignant glioblastomas. It is now clear that this alteration, which eliminates sequences from the 5’ end of the gene (Yamzaki et al., 1990; Sugawawa et al., 1990), results in the formation of an aberrant, tumor cell-specific EGF receptor epitope that can be recognized by antibodies (Humphrey et al., 1990). Such receptors represent potential targets for monoclonal ‘antibodies, and these antibodies might be useful for tumor imaging or the precise delivery of cytotoxic agents. T h e determination of a region of nullizygosity on the short arm of chromosome 9 stands as the most significant result derived from the RFLP deletion mapping. This type of genetic alteration has been previously associated with proximity to or residence within a gene whose product is necessary for the maintenance of normal growth control (Friend et al., 1986; Habei‘ et al., 1990; Fearon et al., 1990). Solely from a molecular genetic perspective it is far from clear as to whether the interferon genes are the targets of such deletions; however, they represent attractive candidates for consideration due to a combination of studies involving in vitro experimentation (Cook et al., 1983; Mizuno etal., 1990) and in vzvo clinical trial (Talpaz et al., 1989; Galvani and Cawley, 1990) that suggest a tumor-suppressive effect of the corresponding gene products. Furthermore, the IFN proteins presumably act through a receptormediated mechanism that implies that appropriate IFN delivery to tumor cells may provide some degree of disease amelioration (by tumor cell growth inhibition), an approach to tumor therapy that would not involve the problems associated with in vivo tumor cell-specific gene transfer. It will be necessary, however, to perform a good deal of additional work before any conclusive identification of the tumor suppressor gene target(s) of the chromosome 9p deletions can be achieved. These results suggest that the multistage interpretation of tumor development, which at first glance promotes a rather pessimistic outlook for the treatment of human neoplasia, may provide a basis for some optimism. T h e characterization of genetic changes that confer tumor cells with increasing growth advantage exposes the mechanisms of cellular proliferation; understanding such processes is fundamental to al-
CNS TUMOR MOLECULAR GENETICS
139
tering them and providing, therefore, some promise for the management of CNS cancer.
REFERENCES Alitalo, K., and Schwab, M. (1986). Adv. Cancer Res. 47, 235-281. Bailey, P., and Cushing, H. (1926). “A Classification of Tumors of the Glioma Group.” Lippincott, Philadelphia, Pennsylvania. Baker, S. J., Fearon, E. R., Nigro, J. M., Hamilton, S. R., Preisinger, A. C., Jessup, J. M., vanTuinen, P., Ledbetter, D. H., Barker, D. F., Nakamura, Y., White, R., and Vogelstein, B. (1989). Science 244, 217-221. Baker, S. J., Markowitz, S., Fearon, E. R., Willson, J. K., and Vogelstein, B. (1990a). Science 249, 912-915. Baker, S. J., Preisinger, A. C., Jessup, J. M., Paraskeva, C., Markowitz, S., Willson, J. K., Hamilton, S., and Vogelstein, B. (1990b). Cancer Res. 50, 7717-7722. Bigner, S. H., Wong, A. J., Mark, J.. Muhlbaier, L. H., Kinzler, K. W., Vogelstein, B., and Bigner, D. I).(1987). Cancer Genet. Cytogenet. 29, 165-170. Bigner, S. H., Mark, J., and Bigner, D. D. (1990a). Cancer Genet. Cytogenet. 47, 141-154. Bigner, S. H., Friedman, H. S., Vogelstein, B., Oakes, W. J., and Bigner, D. D. (1990b). Cancer Res. 50, 2347-2350. Bigner, S. H., Humphrey, P. A,, Wong, A. J., Vogelstein, B., Mark, J., Friedman, H. S., and Bigner, D. D. (1990~).Cancer Re.$. 50, 8017-8022. Bishop, J. M. (1991). Cell 64, 235-248. Bos, J. L. (1988). Mutat. Res. 195, 255-271. Burger, P. C., Vogel, F. S., Green, S. B., and Strike, T. A. (1985). Cancer (Philadelphia) 56, 1 106-1 1 1 1 . Bystrom, C., Larsson, C., Blomberg, C., Sandelin, K., Falkmer, U., Skogseid, B., Oberg, K., Werner, S., and Nordenskjold, M. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 1968-1972. Cavenee, W. K., Dryja, T. P., Phillips, R. A., Benedict, W. F., Godbout, R., Gallie, B. L., Murphree, A. L., Strong, L. C., and White, R. L. (1983). Nature (London) 305,779-784. Chen, P.-L., Chen, Y., Bookstein, R., and Lee, W. H. (1990). Science 250, 1576-1580. Cogen, P. H., Daneshvar, L., Metzger, A. K., and Edwards, M. S. (1990). Genomics 8,279285. Cole, M. D. (1985). Nature (London) 318, 510-511. Cook, A. W., Carter, W. A., Nidzgorski, F., and Akhtar, L. (1983). Science 219, 881-883. Diaz, M. O., Aiemin, S., Le-Beau, M. M., Pitha, P., Smith, S. D., Chilcote. R. R., and Rowley, J. D. (1988). Proc. Natl. Acad. Scz. U.S.A. 85, 5259-5263. Di Fiore, P. P., Pierce, J. H., Fleming, T. P., Hazan, R., Ullrich, A,, King, C. R., Schlessinger, J., and Aaronson, S. A. (1987). Cell 51, 1063-1070. Donis-Keller, H., Green, P., Helms, C., Cartinhour, S., Weiffenbach, B., Stephens, K., Keith, T. P., Bowden, D. W., Smith, D. R., Lander, E. S., et al. (1987). Cell 51, 319-337. Downward, J., Yarden, Y., Mayes, E., Scrace, G., Totty, N., Stockwell, P., Ullrich, A,, Schlessinger, J., and Waterfield, M. D. (1984). Nature (London) 307, 521-527. Dumanski, J. P., Carlbom, E., Collins, V. P., and Nordenskjold, M. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 9275-9279. Dumanski, J. P., Rouleau, G. A., Nordenskjold, M., and Collins, V. P. (1990). CancerRes. 50, 5863-5867. Ekstrand, A. J., James, C. D., Cavenee, W. K., Seliger, B., Pettersson, R. F., and Collins, V. P. (1991).Cancer Res. 51, 2164-2172.
140
C. DAVID JAMES A N D V. PETER COLLINS
el-Azouzi, M., Chung, R. Y., Farmer, G. E., Martuza, R. L., Black, P. M., Rouleau, G. A., Hettlich, C., Hedley-Whyte, E. T., Zervas, N. T., Panagopoulos, K., Nakamura, Y., Gusella, J. F., and Seizinger, B. R. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 7186-7190. Fearon, E. R., Cho, K. R.,Nigro, J. M., Kern, S. E., Simons, J. W., Ruppert, J. M., Hamilton, S. R., Preisinger, A. C., Thomas, G., Kinzler, K. W., and Vogelstein, B. (1990). Science 247, 49-56. Foulds, L. (1960). “Neoplastic Development,” Vol. 1. Academic Press, New York. Friend, S. H., Bernards, R., Rogelj, S., Weinberg, R. A., Rapaport, J. M., Albert, D. M., and Dryja, T. P. (1986). Nature (London) 323,643-646. Fujimoto, M., Fults, D. W., Thomas, G. A., Nakamura, Y., Heilbrun, M. P., White, R., Story, J. L., Naylor, S. L., Kagan-Hallet, K. S., and Sheridan, P. J. (1989). Genomics4,210-214. Fults, D., Tippets, R. H., Thomas, G. A., Nakamura, Y., and White, R. (1989). Cancer Res. 49, 6572-6577. Fults, D., Pedone, C. A., Thomas, G. A., and White, R. (1990). Cancer Res. 50,5784-5789. Galvani, D. W., and Cawley, J. C. (1990). Blood Rev. 4, 175-180. Carson, J. A,, McIntyre, P. G., and Kemshead, J. T. (1985). Lancet ii, 718-719. Gjerris, F., and Klinken, L. (1978).J. Neurosurg. 49, 6572-6577. Haber, D. A., Buckler, A. J., Glaser, T., Call, K. M., Pelletier, J., Sohm, R. L., Douglas, E. C., and Housman, D. E. (1990). Cell 61, 1257-1269. Haley, J. D., Hsuan, J. J., and Waterfield, M. D. (1989). Oncogene 4, 273-283. Hansen, M. F., Koufos, A., Gallie, B. L., Phillips, R. A., Fodstad, O., Brgger, A., GeddeDahl, T., and Cavenee, W. K. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 6216-6220. Harbour, J. W., Lai, S. L., Whang-Peng, J., Gazdar, A. F., Minna, J. D., and Kaye, F. J. (1988). Science 241, 353-357. Harris, H., Miller, 0.J., Klein, G., Worst, P., and Tachibana, T. (1969).Nature (London) 223, 363-368. Heim, S., Mandahl, N., and Mitelman, F. (1988). Cancer Res. 48, 591 1-5916. Huang, H. J., Yee, J. K., Shew, J. Y., Chen, P. L., Bookstein, R., Friedmann, T., Lee, E. Y., and Lee, W. H. (1988). Science 242, 1563-1566. Humphrey, P. A., Wang, A. J., Vogelstein, B., Zalutsky, M. R.,Fuller, G. N., Archer, G. E., Friedman, H. S., Kwatra, M. M., Bigner, S. H., and Bigner, D. D. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 4207-42 11. James, C. D., Carlbom, E., Dumanski, J. P., Hansen, M., Nordenskjold, M., Collins, V. P., and Cavenee, W. K. (1988). Cancer Res. 48,5546-5551. James, C. D., Carlbom, E., Nordenskjold, M., Collins, V. P., and Cavenee, W. K. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 2858-2862. James, C. D., He, J., Carlbom, E., Mikkelsen, T., Ridderheim, P.-A., Cavenee, W. K., and Collins, V. P. (1990). Genes Chromosutn. Cancer 2, 94-102. James, C. D., He, J., Carlbom, E., Nordenskjold, M., Cavenee, W. K., and Collins, V. P. (1991). Cancer Res. 51, 1684-1688. Kinzler, K. W., Bigner, S. H., Bigner, D. D., Trent, J. M., Law, M. L., O’Brien, S. J., Wong, A. J., and Vogelstein, B. (1987). Science 236, 70-73. Laws, E. R., Taylor, W. F., Clifton, M. B., and Okazaki, H. (1984).J. Neurosurg. 61, 665673. Lewin, B. (1991). Cell 64,303-312. Libermann, T. A., Nusbaum, H. R., Razon, N., Kris, R., Lax, I., Soreq, H., Whittle, N., Waterfield, M. D., Ullrich, A., and Schlessinger, J. (1985). Nature (London) 313, 144147. Malden, L. T., Novak, U., Daye, A. H., and Burgess, A. W. (1988). Cancer Res. 48, 271 12714.
CNS TUMOR MOLECULAR GENETICS
141
Marshall, C. J. (1991). Cell 64, 313-326. Maxwell, M., Naber, S. P., Wolfe, H. J., Galanopoulos, T., Hedley-Whyte, E. T., Black, P. M., and Antoniades, H. N. (199O).J. Clin. Invest. 86, 131-140. Mercer, W. E., Shields, M. T., Amin, M., Sauve, G. J., Appella, E., Romano, J. W., and Ullrich, S. J. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 6166-6170. Miyakoshi, J., Dobler, K. D., Allalunis-Turner, J., McKean, J. D. S., Petruk, K., Allen, P. B. R., Aronyk, K. N., Weir, B., Huyser-Wierenga, D., Fulton, D., Urtasan, R. C., and Day, R. S. (1990). Cancer Res. 50, 278-283. Mizuno, M., Yoshida, J., Sugita, K., lnoue, I., Seo, H., Hayahi, Y., Koshizaka, T., and Yagi, K. (1990). Cancer Res. 50, 7826-7829. Morita, R., Ishikawa, J., Tsutsumi, M., Hikiji, K., Tsukada, Y., Kamidona, S., Maeda, S., and Nakamura. Y. (1991). Cancer Res. 51, 820-823. Muller, W., Afra, D., and Schroder, R. (1977). Acta Neurochir. 37, 75-91. Nigro, J. M., Baker, S. J., Preisinger, A. C., Jessup, J. M., Hostetter, R., Cleary, K., Bigner, S. H., Davidson, N., Baylin, S., Devilee, P., Glover, T., Collins, F. S., Weston, A,, Modali, R., Harris, C. C., and Vogelstein, B. (1989). Nature (London) 342, 705-708. Nister, M., Libermann, T. A., Betsholtz, C., Pettersson, M., Claesson-Welsh, L., Heldin, C. H., Schlessinger, J., and Westermark, B. (1988). Cancer Res. 48, 3910-3918. Nowell, P. C. (1976). Science 194, 23-28. Nowell, P. C., and Croce, C. M. (1988). FASEB ]. 2, 3040-3060. Pardee, A. B. (1989). Science 246, 603-608. Raffel, C., Gilles, F. E., and Weinberg, K. I. (1990). Cancer Res. 50, 587-591. Rey, J. A,, Bello, M. J., de Campos, J. M., Kusak, M. E., and Moreno, S. (1987). Cancer Genet. Cytogenet. 29, 323-326. Rouah, E., Wilson, D. R., Armstrong, D. L., and Darlington, G. J. (1989). Cancer Res. 49, 1797-1801. Rouleau, G. A., Wertelecki, W., Haines, J. L., Hobbs, W. J., Trofatter, J. A., Seizinger, B. R., Martuza, R. L., Superneau, D. W., Conneally, P. M., and Gusella, J. F. (1987). Nature (London) 329, 246-248. Rouleau, G. A,, Seizinger, B. R.,Wertelecki, W., Haines, J. L., Superneau, D. W., Martuza, R. L., and Gusella, J. F. (1990). Am. J. Hum. Genet. 46, 323-328. Russell, D. S., and Rubinstein, L. J. (1989). In “Pathology of Tumors of the Nervous System’’ (D. S. Russell and L. J. Rubenstein, eds.), pp. 126, 225. Arnold, London. Sandberg, A. A., and Turc-Carel, C. (1987). Cancer (Philadelphia) 59, 387-395. Sato, T., Tanigami, A., Yamakawa, K., Akiyama, F., Kasumi. F., Sakamoto, G., and Nakamura, Y. (1990). Cancer Res. 50, 7184-7189. Scherer, H. J. (1940). A m . ] . Cancer 40, 159-198. Scrable, H. J., Witte, D. P., Lampkin, B. C., and Cavenee, W. K. (1987). Nature (London) 329, 645-647. Seizinger, B. R., Martuza, R. L., and Gusella, J. F. (1986). Nature (London) 322, 644-647. Seizinger, B. R., de la Monte, S., Atkins, L., Gusella, J. F., and Martuza, R. L. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 5419-5423. Sugawa, N., Ekstrand, A. J., James, C. D., and Collins, V. P. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 8602-8606. Talpaz, M., Kurzrock, R., Kantarjian, H., and Gutterman, J. (1989). Cancer Sum. 8, 793798. Trent, J., Meltzer, P., Rosenblum, M., Harsh, G., Kinzler, K., Mashal, R., Feinberg, A,, and Vogelstein, B. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 470-473. Velu, T. J., Beguinot, L., Vass, W. C., Willingham, M. C., Merlino, G. T., Pastan, I., and Lowy, D. R. (1987). Science 238, 1408-1410.
142
C. DAVID JAMES A N D V. PETER COLLINS
Venter, D. J., and Thomas, D. G. T. (1991). Br.1. Cancer 63, 753-757. Vogelstein, B., Fearon, E. R., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert, M., Nakamura, Y., White, R., Smits, A. M., and Bos, J. L. (1988). N . EngZ.1. Med. 319,525532. Watanabe, K., Nagai, M.,Wakai, S., Arai, T., and Kawashima, K. (1990). Acta Neuropathol. 80,251-254. Wells, A., Welsh, J. B., Lazar, C. S., Wiley, H. S., Gill, G. N., and Rosenfeld, M. G. (1990). Science 247, 962-964. Wolman, S. R. (1983). Cancer Metmtisis Rev. 2, 257-293. Wong, A. J., Bigner, S. H., Bigner, D. D., Kinzler, K. W., Hamilton, S. R., and Vogelstein, B. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 6899-6903. Yamazaki, H., Fukui, Y., Ueyama, Y., Tamaoki, N., Kawamoto, T., Taniguchi, S., and Shibuya, M. (1988). Mol. Cell. Biol. 8, 1816-1820. Yamazaki, H., Ohba, Y., Tamaoki, N., and Masbumi, S. (1990).Jpn.J. Cancer Res. 81,773779. Yokota, J., Wada, M., Shimosato, Y., Terada, M., and Sugimura, T. (1987).Proc. Natl. Acad. Sci. U.S.A. 84, 9252-9256. Yosida, T. H. (1983). Cancer Genet. Cytogenel. 8, 153-179. Zulch, K. G. (1979). “International Histological Classification of Tumors,” No. 2 1 . World Health Organ., Geneva.
TUMOR ERADICATION BY ADOPTIVE TRANSFER OF CYTOTOXIC T LYMPHOCYTES Cornelis J. M. Melief1 Division of Immunology, The Netherlands Cancer Institute, 1066 CX Amsterdam, The Netherlands
I. T Cell Immunity 11. Processing of Antigens for Recognition by T Cells
111. Immunogenicity of Tumors A. Virus-Induced Tumors B. Chemically and UV Light-Induced Tumors C. Mutagenized Tumors D. Spontaneous Tumors IV. Adoptive Immunotherapy of Virus-Induced Tumors with T Cells A. Adoptive Immunotherapy with Bulk Populations of 'rCells B. Adoptive Therapy of Virus-Induced Tumors with T Cell Clones C. Adoptive Immunotherapy of Carcinogen- or UV-Induced Murine Tumors with Cloned T Cells and Tumor-Infiltrating Lymphocytes V. Escapes of Tumor Cells from Immune T Cells A. Immunoselection of Tumor Antigen-Negative Variants B. Down-Regulation of MHC Class I Expression C. Immunosuppression by Chemical Carcinogen and UV Light D. Blockade of Effective Antitumor Immunity and Adoptive T Cell Therapy by Suppressor T Cells E. Other T-Evasive Activity Exerted by Tumor Cells VI. Relationship of LAK Cells, T I L Cells, NK Cells, and T Cells, All with Antitumor Activity and Clinical Results of Adoptive Therapy with LAK and T I L Cells V11. Cloned T Cells with Autologous Tumor Specificity in Malignant Melanoma: Nature of the Melanoma Antigens VIII. Epilogue References
I. T Cell Immunity The dazzling discoveries of the last 15 years on specific antigen recognition by T cells have demonstrated in detail how supremely designed this recognition system is to defend the body against intracellular pathogens such as viruses. T h e same features also make T cells markedly effective against virus-induced tumors and other immunogenic tumors. The first breakthrough in this area was the realization that T cells recognize an antigen only in the context of major histocompatability 'Present address: Department of Immunohematology, University Hospital, 2300 RC Leiden, T h e Netherlands. 143 ADVANCES IN CANCER RESEARCH, VOL. 58
Copyright Q 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.
144
CORNELIS J. M. MELIEF
complex (MHC) molecules at the cell surface (Zinkernagel and Doherty, 1974, 1979; Bevan, 1975). The second landmark discovery concerns the fact that T cells do not recognize large protein antigens but instead recognize small peptides presented in the context of MHC molecules. Such peptides are derived from proteins within cells, by so-called processing, involving proteolytic fragmentation of the proteins into peptides that have the ability to associate with MHC molecules (Babbit et al., 1985; Townsend et al., 1985). The third milestone in this field is the elucidation of the three-dimensional crystal structure of a class I MHC molecule, HLA-A2 (Bjorkman et al., 1987a,b). The polymorphic two outer domains of the class I MHC were shown to be shaped into a platform of eight antiparallel p strands topped by two OL helices. Between the OL helices a large groove is considered to provide the binding area for processed foreign antigens (Bjorkman et al., 1987a). The crystal structure of the class I1 MHC is probably very similar to that of the class I MHC (Brown et al., 1988). Many polymorphic amino acids critical for T cell recognition are located in the groove, allowing diversity of interaction with processed antigenic peptides and/or with T cell receptors (Bjorkman et al., 1987b). II. Processing of Antigens for Recognition by T Cells The concept that T cells recognize antigen fragments presented in the groove of MHC molecules is supported by a large body of evidence indicating that both CD4+ T helper (Th)and CD8+ cytotoxic T lymphocytes (CTL) recognize short sequences of approximately 10 amino acids and that these sequences specifically bind to the MHC molecules in the context of which they are recognized (Babbit et al., 1985; Maryanski et al., 1986; Townsend et al., 1986, 1989; Buus et al., 1987; Ljunggren et al., 1990; Schumacher et al., 1990, 1991; Van Bleek and Nathenson, 1990; Falk et al., 1991). Two major pathways of antigen processing and presentation for T cell recognition have been delineated. Each of these pathways preferentially occurs in MHC class I- or MHC class II-restricted responses (Townsend et al., 1985; Germain, 1986, 1988; Lorenz and Allen, 1988; Moore et al., 1988; Morrison et al., 1988; Yewdell et al., 1988; reviewed in Brodsky and Guagliardi, 1991). The major pathway for MHC class II-associated antigen processing is believed to involve endocytosis of protein antigens from outside the cells. Antigens ingested in the fluid phase or by receptor-mediated endocytosis are then processed in the low-pH environment of endosomes. Subsequently, selective access of peptides to class I1 molecules takes place, possibly in a novel vesicular compartment (Neefjes et
CYTOTOXIC T LYMPHOCYTES
145
al., 1990). Class I molecules are either largely excluded from these sites or arrive there already occupied with peptide loaded in the groove in the rough endoplasmic reticulum (Germain, 1988). It was recently suggested that the so-called invariant (Ii) chain associated with intracellular class I1 but not class I MHC molecules prevents access of peptides to the antigen-binding groove of class I1 molecules until the Ii chain is detached from class I1 in a late endosomal compartment (Roche and Cresswell, 1990; Teyton et al., 1990).The Ii chain, apart from preventing access of peptide to the groove of class I1 molecules, is also likely to be involved in the routing of class I1 molecules to the endosomal/lysosomal pathway (Bakke and Dobberstein, 1990). In this scenario, class I molecules are unable to efficiently acquire peptides produced from extrinsic proteins (Germain, 1988; Moore et al., 1988; Morrison et al., 1988). On the other hand, proteins reaching the cytoplasm in sufficient concentration, either as a result of virus infection (Townsend et al., 1985, 1986; Morrison et al., 1988; Yewdell et al., 1988), by osmotic lysis of pinosomes (Moore et al., 1988), or as normal cellular components, are efficiently fragmented into peptides that are then presumed to become accessible to class I molecules, perhaps in the rough endoplasmic reticulum or cisGolgi (Germain, 1988; Neefjes et al., 1990). Recently, candidate peptide transport molecules were described and referred to as peptide pumps that are likely to be invdlved in active transmembrane transport of peptides from the cytoplasm to the endoplasmic reticulum (Deverson et al., 1990; Trowsdale et al., 1990; Spies et al., 1990; Monaco et al., 1990). An intriguing finding in these studies is the localization of the genes encoding these transporter proteins in the MHC class I1 region in rat, mouse, and man. Due to the existence of these two different antigen-processing pathways, endogenously synthesized protein antigens produced in viral infections are preferentially, but not exclusively, recognized by CD8 CTL in the context of MHC class I molecules, whereas proteins taken up from the environment are largely recognized by CD4+ T, cells in the context of M H C class I1 molecules (Morrison et al., 1988). Under certain circumstances, exogenously administered peptides can also induce MHC class I-restricted CTL cell responses (Carbone and Bevan, 1989; Deres et al., 1989; Aichele et al., 1990; Schulz et al., 1991; Kast et al., 1991). +
I l l . lmmunogenicity of Tumors For a tumor to be immunogenic, it needs to present processed antigen as peptide bound to MHC class I or class I1 molecules. In the T cell repertoire of the tumor-bearing host, T cells expressing T cell receptors capable of responding to such peptide/MHC complexes need to be
146
CORNELIS J. M. MELIEF
present. Thus peptides normally processed from normal cellular components in tumors and bound to MHC molecules are not immunogenic because tolerance for such structures has arisen during T cell ontogeny. The immunogenicity of virus-induced, carcinogen- or UV-induced, mutagenized, and “spontaneous” tumors is discussed in the following sections. TUMORS A. VIRUS-INDUCED
T cell immunity against virus-induced tumors follows the rules of antiviral immunity in general (Melief and Kast, 1990; Melief et al., 1989). Thus, in principle, any tumor virus protein could serve as a target for T cells, provided that it is processed into at least one peptide that binds to an MHC molecule, is subsequently transported to the cell surface, and is recognized by a T cell in the repertoire of the tumor-bearing host. Only a few virus-induced tumors have been investigated to identify the molecular nature of the tumor-associated antigens responsible for the generation of tumor-specific T cells. In the cases investigated so far, the Timmunogenic antigens were encoded by viral structural genes. Thus the T cell response of C57BL/6 (H-2b) mice against the Friend leukemia virus-induced FBL3 tumor was shown to be directed against internal viral gag or viral envelope enu components. FBL3-reactive CD8+ T, cells recognize a viral gag-encoded epitope in the context of the H-2Db class I molecule, whereas FBL3-specific CD4+ T, cells recognized a viral enu-encoded epitope in the context of the I-Ab class I1 molecule (Klarnet et al., 1989). I n this study, two CD4+ clones and one CD8+ clone showed the same enu and gag specificity, respectively, as FBL3specific bulk populations of CD4 and CD8 T lymphocytes. To which extent these CD4 or CD8 cells each recognize a single immunodominant peptide is not known at present. In an adoptive therapy model, both the CD4 and CD8 bulk populations and clones directed against FBL-3 are able to eradicate disseminated disease (see Section IV,B, 1). In our own work on human adenovirus early region 1 (Ad E1)-transformed murine cells, CD8 CTL clones of C57BL/6 (H-2b)origin effective in tumor eradication (see Section VI) were found to be directed against a peptide sequence of the viral nuclear oncogene product ElA, presented in the context of the H-2Db class I molecule (Kast et al., 1989) (see also Section IV,B,2). I n the case of Epstein-Barr virus (EBV), the first reported epitope recognized by CD8+ CTL clones is a peptide sequence from the Epstein-Barr nuclear antigen 3 (EBNA3) protein, presented in the context of HLA-B8 (Burrows et al., 1990). To which extent this epitope is a +
+
+
+
+
+
+
CYTOTOXIC T LYMPHOCYTES
147
target for cytotoxic T lymphocytes (CTLs) against EBV-associated lymphomas, such as Burkitt’s lymphoma, remains to be investigated, but clearly, the escape of some tumor cells from attack by EBV-specific CTLs is possible. In view of this evidence and given our current knowledge of the recognition of viral epitopes in the context of MHC class I molecules in other virus systems (e.g., influenza virus, Townsend et al., 1986, 1989; Bastin et al., 1987; Lamb et al., 1987; Wraith, 1987; Sweetser et al., 1989; vesicular stomatitis virus, Van Bleek and Nathenson, 1990; Sendai virus, Kast et al., 1991; Schumacher et al., 1991), the safe prediction can be made that virus-induced tumor antigens will usually be presented as small peptides of approximately 8- 11 amino acids, processed from longer viral proteins (Falk et al., 1991). Often such proteins are not expressed at the cell surface as intact proteins, but, e.g., in the nucleus or cytoplasm of infected cells, such as the E1A protein of adenovirus, a viral nuclear oncogene product (for review see Melief et al., 1989). The identification of virally encoded peptides as targets for biologically effective CTLs directed against virus-induced tumors explains the classic observation that tumors induced by the same virus express common tumor-specific transplantation antigens (TSTAs) that are targets for T cell-mediated antitumor activity in immunocompetent animals (Klein, 1968; Mora, 1982; Campbell et al., 1983; Sawada et al., 1986; Bellgrau et al., 1988). It cannot be excluded that some CTLs against virus-induced tumors may be specific for antigens encoded by virus-induced cellular genes, but so far no examples of this theoretical possibility have been documented. It is interesting to note that the early workers studying virus-induced tumors had already predicted that the viral genome most likely encodes the TSTA of, e.g., polyomavirus (Klein, 1968). Yet the early observation that the polyomavirus-induced transplantation antigen has identical or cross-reactive specificity in polyoma tumors, even induced in different species (Hellstrom and Sjogren, 1966), is difficult to understand in view of what we know today of T cell immunity and MHC restriction unless it is assumed that the viral antigens were processed by host antigen-presenting cells. Alternatively, the cross-reactivity included not only virus, but also MHC restriction specificities, o r this type of outcome is a peculiarity of the sensitive colony inhibition assay used (Hellstrom and Sjogren, 1966). Indeed, previous transplantation tests involving xenograft immunization followed by isograft challenge had failed to show this type of cross-reactivity (Klein, 1968). The latter result is in line with the outcome of recent adoptive transfer studies of tumor immunity with cloned virus-specific CTLs, in which protection was rigorously
148
CORNELIS J.
M.
MELIEF
MHC restricted, showing the same specificity as in vitro CTL activity (Kast et al., 1989; Melief et al., 1989; Melief and Kast, 1990) (see also Section IV,B,2). Therefore, the rule that virus-induced tumors express common antigens appears to hold in general only for MHC-compatible tumors inasmuch as the major T cell defense system is involved. Specific immunization by histoincompatible tumors to subsequent challenge by isotypic (histocompatible) tumors is most likely the result of T cell immunity induction against viral antigens processed by host antigen-presenting cells, to induction of non-T immune effector mechanisms (e.g., antibody), or to both. B. CHEMICALLY AND UV LIGHT-INDUCED TUMORS The immunogenicity of many chemically induced tumors has been one of the cornerstones of tumor immunology, ever since the pioneering studies of Foley (1953) and Prehn and Main (1957) first conclusively demonstrated this. The antigens eliciting tumor-specific immunity in classical tumor immunization/tumor challenge types of experiments are individually specific for each tumor, even if included by the same chemical in the same animal (Prehn and Main, 1957; Klein et al., 1960; Globerson and Feldman, 1964; Old and Boyse, 1964; Klein, 1968; Prehn, 1968; Shu and Rosenberg, 1985; Naito et al., 1988; Old, 1989; Srivastava and Old, 1988; Barth et al., 1990). In general, specific tumor immunity can be transferred only with T cells and not with antibody, as in the case of virus-induced tumors. For decades, the molecular nature of the tumor-specific antigens on chemically induced tumors has eluded identification and characterization. Recently, however, several interesting molecules harboring the capacity to elicit the characteristic individual tumor-specific transplantation immunity were isolated from transplantable lines of chemically induced tumors (for reviews see Srivastava and Old, 1988; Old, 1989). In several chemically induced tumors, the tumor-specific immunogenicity was contained in molecules closely related to members of heat-shock protein (hsp) families, the hsp 90 family (Ullrich et al., 1986; Moore et al., 1987) or the hsp 108 family (Srivastava et al., 1986, 1987). However, it is not clear whether the tumor antigens are distinct (mutated?) epitopes on these widely distributed proteins or are in fact other immunogenic peptides associated with the hsp-like proteins, which in the latter case serve as immunogenic peptide carriers (Old, 1989). At any rate, the involvement of heat-shock proteins creates an interesting link with infectious disease and autoimmune status, where hsp members are under intensive
CYTOTOXIC T LYMPHOCYTES
149
scrutiny as target molecules for immunological attack by T cells (Young and Elliott, 1989; Cohen, 1991; Kaufmann, 1990; Lydyard and Van Eden, 1990). Several important observations, mainly made by Prehn and associates, have delineated associations between dose of chemical carcinogen on one hand, and latency before subsequent tumor development and immunogenicity of the resultant tumors on the other hand. A low dose of carcinogen is associated with long latency and low to negligible immunogenicity. High-dose carcinogen administration, on the other hand, is associated with short latency and high immunogenicity. The long-latency tumors tend to be monoclonal and the short-latency tumors, following a high dose of carcinogen, tend to be polyclonal. Remarkably, the tumors arising after the shortest latency were usually of an intermediate level of immunogenicity (Prehn, 1975; Prehn and Bartlett, 1987; Prehn and Prehn, 1987). T h e immune mechanisms responsible for these results probably include immunoselection, immunosuppression by the chemical carcinogen, as well as stimulation of tumor growth by a specific immune reaction of low to intermediate strength (for review see Prehn and Prehn, 1987). Like chemically induced tumors, UV light-induced tumors also express individually distinct tumor antigens capable of immunizing the host against subsequent tumor challenge (Kripke, 1981; Ward et al., 1989). The TSTA of one UV-induced tumor was reported to be a mutated MHC class I molecule (Philipps et al., 1985). Later studies, however, showed that the putative tumor-specific MHC molecules were regular allogeneic MHC molecules (Lee et al., 1988; Perdrizet et al., 1990). The nature of the TSTA on UV-induced tumors therefore presently remains elusive. If the TSTAs in chemically and UV-induced tumors are immunogenic peptides arising by mutations in random genes encoding cellular proteins, comparable to the tum - antigens discussed in Section III,C, then the observed correlation between dose of carcinogen and immunogenicity, modulated by the immune response, is what one would expect.
C. MUTACENIZEDTUMORS The only category of non-virus-induced tumors, the TSTAs of which have been molecularly defined down to the antigenic peptides binding to MHC class I molecules and recognized by tumor-specific CTLs, is a group of so-called tumor-negative (tum-) variants of murine tumors (for reviews see Boon, 1983; Boon et al., 1989a,b, 1992). These variants are
150
CORNELIS J. M. MELIEF
derived from various weakly immunogenic murine tumor lines, easily transplantable in syngeneic immunocompetent animals. Following highdose mutagen treatment in vitro, sublines can be obtained at high frequency that are no longer capable of causing tumor growth in vivo, hence their designation tum - . Their failure to grow in vivo is due to a vigorous CTL response against individually distinct antigens on each independently derived tum - variant. Characteristically,and in line with TSTAs on virus, carcinogen-, and UV-induced tumors, the individually distinct TSTAs evoke CTL responses but not antibody responses, and in this regard resemble minor histocompatibility alloantigens. The most intensively investigated series of tum- variants is derived from the P815 mastocytoma line of DBAE (H-2d)origin. A single tum- variant of P815 can express multiple tum- antigens detected by CTLs, as shown by in vitro immunoselectionexperiments. Among more than 15 P8 15tum- variants tested, no cross-reactionbetween their tum - antigens was detected. By an elegant procedure, several genes encoding P8 15 tum- antigens were cloned and sequenced (De Plaen et al., 1988; Boon et al., 1989a,b;Szikora et al., 1990).All genes encoding tum- antigens cloned to date showed no homology to other known genes and all were distinct from each other. In the cases studied the immunogenic peptides containing the tum - antigens were 11- 13 amino acids in length and were recognized in the context of the H-2Ld, H-2Kd, or H-2Dd MHC class I molecules (Boon et al., 1989b).Just as in the case of viral antigen recognition by T cells, the proteins containing the immunogenic peptides did not have to be cell surface proteins. In fact, in most cases they are not (Boon et al., 1989b; Boon, 1992, and personal communication).The mechanisms by which a single amino acid substitution creates a strongly immunogenic peptide are several. In the case of the peptide encoded by the P91A tum- gene, the point mutation endowed the peptide with the capacity to strongly bind to the H-2Ld class I molecule, a capacity the peptide from the normal gene lacked. In another case both the native and the mutant peptide bind similarly to the same MHC class I molecule and, surprisingly, are both capable of sensitizing targets for recognition by mutant specific CTLs. However, the native peptide is tolerated by the CTL repertoire of the host, whereas the mutant peptide is not, possibly due to differences in glycosylation (Szikora et al., 1990). These results imply that the mutations probably occur randomly throughout the genome and that tum- antigens can arise in any gene product capable of generating peptides that are scrutinized by CTLs, which may be close to all cellular proteins (Boon et al., 1989b). The results also point out how powerful the T cell recognition system is in detecting small changes deviating from the integrity of the cell, although
CYTOTOXIC T LYMPHOCYTES
151
obvious limiting factors are the available MHC class I molecules and the available T cell repertoire in a particular host. Apparently the B cell system is not capable of detecting these changes, probably because B cells are not tuned to detect a low density of T-immunogenic peptide bound to MHC molecules (Boon et al., 198913). Finally, how do these startling findings relate to the TSTA on chemically and UV-induced tumors? N o general conclusions are possible at this time. But it would be surprising if at least a proportion of chemical carcinogen or UV-induced tumors did not have TSTAs of a nature similar to those on tum- variants, namely, subtly mutated genes (by random mutation) encoding proteins that in turn yield immunogenic peptides evoking CTL responses throughout the genome. Indeed, chemical carcinogens and UV light are generally mutagenic and, in a dose-dependent fashion, are likely to generate immunogenic peptides by random mutation in cellular genes that are likely to be distinct from the mutations causing malignant transformation (Boon et al., 1989b). This would explain the remarkable similarity of TSTAs on these tumors to those of the tum- variants, with respect to the following traits: (1) their individually distinct nature, (2) their detection by T cells but not by antibody, and (3) their genetic stability. How these findings relate to the identification of hsp-like proteins carrying TSTA activity in several chemically induced tumors (see Section III,B) remains to be determined.
D. SPONTANEOUS TUMORS A shattering blow to the concept that tumors are generally immunogenic was delivered by the observation that “spontaneous” murine tumors, not known to be induced by chemical carcinogens, viruses, or other oncogenic treatments, were completely devoid of immunogenicity (Hewitt et al., 1976). This was assayed by the usual method of transplanting low numbers of tumor cells or by immunization with irradiated tumor cells, followed by inoculation of live tumor cells. Of approximately 20,000 maintenance transplants, involving 27 different tumors (leukemias, sarcomas, carcinomas), none failed and none regressed. Of almost 10,000 carefully observed tumors arising from small or minimal inocula of tumor cells, none spontaneously regressed. Prior immunization with lethally irradiated tumor cells, involving 7 randomly selected tumors, did not cause increased tumor resistance (immunization) (Hewitt et al., 1976). The supreme importance of these studies lies in the fact that they appear to be directly relevant to the majority of human tumors, which either have no obvious viral or chemical etiology or are
152
CORNELIS J. M. MELIEF
linked to low-dose carcinogen exposure (e.g., lung cancer) or UV light exposure (skin cancer) (Bishop, 1991). Nonvirally induced human tumors can therefore be expected to be either nonimmunogenic o r poorly immunogenic, like the low-dose chemically or UV light-induced murine tumors (Section II1,B). This surely creates a bleak prospect for successful immunotherapy of most human cancers, and yet several recent observations in both animal models and in man cause one to rethink such pessimism. First, the joined data of many groups have established beyond doubt that in certain nonvirus-induced human tumors, first and foremost malignant melanoma, MHC class I-restricted CD8 CTLs specific for autologous tumor cells can be cultured from the blood of melanoma patients or tumor-infiltrating lymphocytes (see Section VII). Second, it is increasingly evident that the obvious state of immunologic tolerance that exists vis-a-vis an apparently nonimmunogenic tumor can be broken by immunological manipulations. One of these is immunization with an immunogenic tumvariant discussed in Section II1,C. The response against the strongly immunogenic tum- antigens apparently has an adjuvant effect on the elicitation of an immune response against much weaker antigens also present on the original tumor (Van Pel et al., 1983). Similar results have been obtained by immunization with an allogeneic virus-induced tumor followed by challenge with a weakly immunogenic syngeneic tumor induced by the same virus (Azuma et al., 1987). In this case an adjuvant effect is generated by the vigorous immune response against the alloantigens. Both examples are reminiscent of the adjuvant effects obtainable with immunostimulants such as the bacillus of Calmette and GuCrin (BCG) (Zbar and Rapp, 1974; Bast et al., 1976) o r Corynebacteriumparvum (Shu et al., 1989). The mode of action of all of these interventions is probably strong lymphokine secretion by activated T helper cells, by which dormant T helper or CTL responses against weakly immunogenic tumor antigens are aroused. Once expanded in sufficient numbers, the latter T cells can now be activated without the adjuvant stimulus, probably because they can now raise sufficient lymphokine secretion among themselves. One of the key lymphokines mediating the adjuvant effect is unquestionably interleukin-2 (IL2). The use of I L 2 to activate both natural killer (NK) cells and T cells to exert antitumor effects will be dealt with in a general way in Section VI. Suffice it here to mention that certain weakly immunogenic tumors that are not rejected can be effectively treated with I L 2 alone without adoptive transfer of T cells. In one example investigated in detail, the active host cells induced by this treatment were CD8+ CTLs (Mule et al., 1987). It should be noted, however, that in this same study, +
CYTOTOXIC T LYMPHOCYTES
153
no CD8+ T cell immunity was induced by high-dose I L 2 treatment against nonimmunogenic murine tumors. The I L 2 treatment did have a therapeutic effect against these tumors, but it was less pronounced and mediated by IL-2-activated NK cells (Mule et al., 1987). This brings home the point that even in the presence of high in uiuo doses of IL-2, certain tumors remain nonimmunogenic and at best meet the usually less than formidable barrier of activated N K cells. A most elegant demonstration of the capacity of IL-2 to turn a poorly immunogenic tumor into a strongly immunogenic one was made possible by the introduction of the IL-2 gene into the poorly immunogenic murine colon cancer line CT26 (Fearon et al., 1990). Small numbers (1 x 103-1 x lo4) of CT26 tumor cells injected into syngeneic (BALB/c) mice cause a lethal tumor and do not induce detectable tumor-specific CTLs (Fearon et al., 1988, 1990). On the other hand, much larger numbers (1 x 106-1 x lo7) of IL2-transfected CT26 cells, producing IL-2, caused tumors in only a low proportion of animals. Animals immunized with the engineered cells were protected against subsequent challenge with the parental tumor cell line. Moreover, after subcutaneous injection of the IL-2-producing CT26 cells, significant CTL activity against the parental tumor was detected in the spleen after secondary in vitro stimulation. Subcutaneous injection of parental tumor cells did not induce tumor-specific CTLs under the same assay conditions (Fearon et al., 1988, 1990). The protective effect was found to be mediated by CD8+ cells that did not require the help of CD4+ cells in vivo, suggesting that immunization with the IL-2-producing tumor effectively bypasses CD4 T, function in the generation of an antitumor CTL response (Fearon et al., 1990). Similar results were obtained with IL2-transfected, IL-2-producing B 16 melanoma cells (Fearon et al., 1990). Successful abrogation of poor tumor immunogenicity has also been achieved by other investigators following immunization with tumor cells in which the IL-2 or interferon gamma gene was introduced (Gansbacher et al., 1990a; Ley et al., 1990; Gansbacher et al., 1990b). The elegance of this approach lies in the fact that local sustained IL-2 production by the same cell-presenting antigen in the context of MHC class I bypasses apparently defective CD4+ T, activity and stimulates a CD8+ CTL response in the absence of side effects. Opponents of a potential clinical application of this approach might argue that it is reckless to introduce a growth factor gene into a tumor cell that often got out of control in the first place due to growth factor (receptor) derangements. It should be remembered, however, that nonlymphoid tumor cells rarely, if ever, express I L 2 receptors, let alone are stimulated in their growth by I L 2 . So far the animal studies show the strategic value of this “enemy from within” approach, +
154
CORNELIS J. M. MELIEF
comparable to the ancient city of Troy being destroyed through the daring soldiers in the famous horse. A big, looming question in view of these results remains regarding which proportion of poorly or nonimmunogenic tumors presents potentially immunogenic peptides against which a CD8+ CTL response can be generated if only the inertia of T helper cells or CTLs is overcome or bypassed. It seems virtually certain that not all poorly or nonimmunogenic tumors possess cryptic immunogenic determinants capable of eliciting CD8 responses. One argument in favor of this is the failure of many animal and human tumors to significantly respond to high-dose IL-2 and/or IL-2/LAK treatment (Mule et al., 1987; see also Section VI), and not all of these failures are likely to be due to “suppressor cells.” +
IV. Adoptive lrnrnunotherapy of Virus-Induced Tumors with T Cells A. ADOPTIVE IMMUNOTHERAPY WITH BULK POPULATIONS OF T CELLS The evidence that virus-induced tumors generally elicit T cell responses (see Section 111) and that virus-induced tumors abound in T cell-deficient animals and people (Chesterman et al., 1969; Melief and Schwartz, 1975; Klein and Purtilo, 1981; Greenspan et al., 1988; Penn, 1988; Barr et al., 1989; Knowles et al., 1989; Laraque, 1989; Zur Hausen, 1989; Palefsky et al., 1990) prompted the notion that virus-induced tumors would be amenable to treatment by T cell-mediated adoptive therapy. CTLs were considered as particularly promising candidates for such therapy because they exhibited potent antitumor activity in uitro and were able to infiltrate tumors in uiuo (Brunner et al., 1981). Indeed, the antitumor activity of bulk populations of T cells directed against virusinduced tumors (Engers et al., 1984; Greenberg, 1986) or other antigenbearing tumors (Shu et al., 1987; North et al., 1989; ZangermeisterWittke et al., 1989; Bridges and Longo, 1990) is usually contained within the CD8 subset of T cells, with or without prior culture of these cells in IL-2 (Shu et al., 1989; North et al., 1989). However, in a number of cases purified populations of MHC class II-restricted tumor-specific T, cells of CD4+ phenotype were found to suffice for tumor rejection (Fernandez-Cruz et al., 1980; Greenberg et al., 1981, 1985; for reviews see Greenberg et al., 1988; Klarnet et al., 1989). Sometimes optimal antitumor activity requires the coordinated action of both CD4+ and CD8+ cells (Rosenstein et al., 1984; Johnson et al., 1986; Ellenhorn et al., 1990). In the study of Ellenhorn et al. (1990), rejection of a UV-induced +
155
CYTOTOXIC T LYMPHOCYTES
murine skin tumor line was induced by low-dose anti-CD3 monoclonal antibody treatment of tumor-bearing mice. This schedule causes T cell activation and both CD4+ and CD8+ T cells were required for antiCD3-induced tumor rejection. The CD4 cells provided helper function and were only required in the early rejection phase. CD8+ T cells were required throughout the entire rejection period (Ellenhorn et al., 1990). This CD4 /CD8+ T cell interplay is reminiscent of T cell immunity against some virulent virus diseases in which CD4 and CD8 cells cooperate (see, e.g., Kast et al., 1986). In the study of Kast et al., cloned virus-specific CD4+ cells could be replaced by IL-2 for optimal in vivo activity of a CD8+ Sendai-specific CTL clone. Likewise, in a report by Bear et al. (1988), CD4+ T, cells required for generation of syngeneic CD8 CTLs against P8 15 mastocytoma cells could be replaced by exogenous IL-2. It seems safe to conclude that although CD4+ T cells in many instances are required for the generation of CD8 tumor-specific CTLs, adoptive transfer is often successful with CD8+ T cells alone, once CD8 immunity exists. By this time the CD8 immune population can often muster sufficient cytokine production, including I L 2 , to feed autocrine activation and expansion of CD8+ immune cells in the presence of antigen. In the induction phase of tumor-specific T cell immunity, the delivery of help by CD4 cells is in many cases more crucial (see also Section III,D concerning the uncovering of cryptic determinants detected by CD8+ cells following various forms of adjuvant immunotherapy, including IL2). This state of affairs is closely paralelled by the therapeutic experience with cloned T cells directed against virusinduced tumors. Cloned CD8 CTLs with therapeutic activity against such tumors usually do not produce I L 2 and are therefore crucially dependent on exogenous 1 L 2 (or T, cells) for therapeutic action. In some instances, helper-independent CD8 clones producing their own I L 2 have been isolated. Finally, CD4+ T cell clones with therapeutic activity have also been described (see Section IV,B,l). Below we shall discuss adoptive therapy with T cell clones in two well-documented systems: T cell therapy against Friend virus-induced FBL3 mouse leukemia cells and against human adenovirus-transformed mouse cells. +
+
+
+
+
+
+
+
+
+
+
THERAPY OF VIRUS-INDUCED TUMORS B. ADOPTIVE WITH T CELLCLONES 1. Adoptive Therapy of FBL-3 Friend Virw-Induced Leukemia with T Cell Clones Adoptive therapy of FBL3 Friend virus-induced leukemia of C57BL/6 (B6, H-2b) origin with either bulk or cloned T cells is one of
156
CORNELIS J. M. MELIEF
the best studied adoptive T cell therapy models available and has been reviewed elsewhere (Greenberg et al., 1988). Therefore, only the main points will be reiterated here and some recent studies will be reviewed in more detail. Both CD4+ and CD8+ tumor-specific T cells can be generated by immunization of B6 mice with syngeneic FBLS cells and each is independently capable of completely eradicating disseminated tumor when adoptively transferred either as bulk population or as clone (Greenberg et al., 1988). Successful adoptive therapy requires combined treatment with cyclophosphamide. At the dose used, the drug probably has two effects: (1) elimination of T cells with suppressive activity on the adoptively transferred immune T cells and (2) a modest antitumor activity that prolongs life but does not cure mice (Greenberg et al., 1988). An alternative to cyclophosphamide is whole body irradiation preceding tumor inoculation and CTL therapy (Matis et al., 1986). The therapeutic effect of CD4+ cells is remarkable, because these cells are MHC class I1 restricted and FBLS tumor cells are class I1 negative even after incubation with interferon-y (IFN-y) (Greenberg et al., 1985). Class 11-positive macrophages were found to be required to present processed tumor antigens to CD4 cells (Kern et al., 1986). Bulk cultures of T cells maintained for up to 62 days in nitro and intermittently stimulated with irradiated tumor cells proliferated in uitro in response to FBLS and were specifically cytotoxic. Such cells were effective in tumor therapy and adoptively transferred CD4+ and CD8+ cells persisted for at least 120 days after successful therapy with maintenance of immunologic specificity, indicating specific immunologic memory (Cheever et al., 1986). The best scheme for in uivo expansion of adoptively transferred bulk cultures of FBLS murine cells proved to be intermittent administration of specific antigen plus I L 2 (Chen et al., 1990). Helper-independent CD8+ cytotoxic T cell clones derived from bulk cultures (Matis et al., 1985) likewise proliferated in viuo in response to antigen, eradicated disseminated leukemia, and provided specific immunologic memory (Klarnet et al., 1987). These clones produce sufficient I L 2 to exert a marked therapeutic effect without a requirement for exogenous IL2. However, addition of high-dose exogenous I L 2 further enhances the therapeutic efficacy of these cells (Klarnet et al., 1987), probably by causing more rapid expansion of cloned T cells. As already discussed in Section III,A, FBLreactive CD8+ and CD4+ T cells recognize distinct Friend virusencoded antigens (Klarnet et ah, 1989). The mechanism by which CD4+ T cells eradicate FBLS tumor tissue Zn v i m may involve the induction of tumoricidal activity in macrophages, induced by IFN-y, secreted by the CD4+ FBL3-specific T cells (Green+
157
CYTOTOXIC T LYMPHOCYTES
berg et al., 1988). CD8 cells are also capable of induction of tumoricidal macrophages via IFN-7 secretion. However, FBL-3 murine CD8 T cell populations secreted IFN-7 only if stimulated simultaneously with both FBL-3 tumor cells and IL2. Therefore the CD8+ T cells may not only cause tumor eradication by MHC-restricted tumor cell lysis, but also, like CD4 FBL-3-reactive T cells, by induction of tumoricidal macrophages activated by lymphokines such as IFN-7 (Greenberg et al., 1988). +
+
+
2. Adoptiue Therapy of Human Adenouirw-Induced Murine Tumors with CD8+ Cloned CTLs Human adenovirus (Ad)-induced oncogenesis in rodents is an attractive cancer research model for a number of reasons (Melief et al., 1989). These include (1) the availability of oncogenic (Ad 12) and nononcogenic (Ad2, Ad5) serotypes of adenoviruses; (2) the involvement of two defined genes, ElA and ElB, of the Ad genome in oncogenesis; (3) the functional similarity of the Ad ElA oncogene to the c-myc cellular protooncogene; (4)the homology of conserved regions 1 and 2 of Ad ElA crucial for transformation with the E7 gene of human papillomavirus type 16, implicated in the causation of cervical carcinoma in women; and (5) the interaction of E1A-encoded proteins with the retinoblastoma (Rb) gene product, providing evidence for a physical link between an oncogene (ElA) and an antioncogene (Rb). Whereas cells transformed by the early region (El) of Ad12 are oncogenic in both immunocompetent and immunodeficient rodents (rats, mice), cells transformed by Ad5 E l are only oncogenic in T cell-deficient animals. Although the E l B region of Ad 12 contributes more strongly to the oncogenic state in nude mice than does the ElB region of Ad5 (Schrier et al., 1983), the ElA region of Ad12, as opposed to the ElA region of Ad5, probably also contributes strongly to the oncogenic potential in immunocompetent animals by suppressing MHC class I expression (Bernards et al., 1983; Schrier et al., 1983). This might facilitate evasion of tumor eradication by tumor-directed CD8+ MHC class Irestricted CTLs. In contrast, Ad5 EZ-transformed cells would be incapable of causing tumors in immunocompetent animals due to effective surveillance by CD8+ CTLs. To explore this hypothesis, we generated CD8 CTL clones directed against Ad5 E l -transformed cells and investigated their efficacy in adoptive immunotherapy of T cell-deficient mice bearing Ad5 El-induced tumors. All of 10 independently derived CD8+ CTL clones proved to be ElA specific and to recognize the E1A-encoded peptide CDSGPSNTPPEIHPVV in the context of the H-2Db MHC class I molecule (Kast et al., 1989; for reviews see Melief et al., 1989; Melief and Kast, 1990). This peptide occurs in the major ElA-encoded proteins +
158
CORNELIS J. M. MELIEF
of Ad5, but not in the ElA-encoded proteins of Ad12. The smallest peptide recognized by the CTL clones was the central octamer, PSNTPPEI. However, a much higher concentration of this octamer is needed to sensitize H-2b targets for CTL recognition than is needed of the 16-mer, because the S and G amino acids flanking the octamer at the amino terminal side heavily contribute to binding of the peptide to the H-2Db molecule (Kast and Melief, 1991). Two clones were tested for therapeutic activity against large established tumors grown from subcutaneous (s.c.) inocula of tumor cells in T cell-deficient nu/nu mice. Injection of 1.5 X lo7 CTLs of each clone, intravenously (i.v.) into tumor-bearing mice, caused complete regression of large s . ~ tumor . masses up to 10 cm3 within 12 days, provided 105 units of IL-2 were given simultaneously as a single depot injection in incomplete Freund’s adjuvant at a S.C.site distant from the tumor. The I L 2 is needed because these CD8+ clones are entirely I L 2 dependent both in vitro and in viuo (Kast et al., 1989). Protection was Ad5 specific and MHC restricted, and 3 months after successful therapy the same CTL clone could be aroused in vivo with I L 2 alone to present outgrowth of a second tumor inoculum, proving the existence of a memory state (Kast et al., 1989). N o escapes from therapy were noted, perhaps because the therapy is directed against a peptide encoded by one of the two oncogenes (ElA and ElB) that are essential for the tumorigenic behavior of the EI-transfected cells used in this study. Thus all tumor cells need to express ElA to maintain the transformed state, and downregulation of ElA would be associated with loss of the transformed state. However, other ways to escape from the CTL therapy would include mutation of the target peptide, a mutation affecting its processing or down-regulation of H-2Db expression (see Section VI). Perhaps there is no time for such events, because tumor eradication is complete and permanent within 12 days after initiation of therapy. Following this first example of successful adoptive T cell therapy directed against a nuclear oncogene (ElA) product, it seems attractive to explore whether (nuclear) oncogene-directed therapy has a wider applicability, including human cancer therapy. C. ADOPTIVEIMMUNOTHERAPY OF CARCINOCENOR UV-INDUCED MURINETUMORS WITH CLONED T CELLSAND TUMOR-INFILTRATING LYMPHOCYTES
One of the first reports on adoptive therapy with cloned CTLs showed limited tumoricidal activity, probably because the CTLs failed to migrate to distant tumor sites (Binz et al., 1983). For similar reasons, in
159
CYTOTOXIC T LYMPHOCYTES
other early studies with cloned CTLs against virus-induced tumors (Dailey et al., 1982; Engers et al., 1984), limited therapeutic effects were noted. The results discussed in Section lV,B concerning more recent immunotherapy attempts with cloned CTLs against virus-induced tumors have established beyond doubt that such therapy can be markedly effective. Also, the results of adoptive therapy with bulk populations of T cells directed against carcinogen-induced tumors, discussed in Section IV,A, would suggest that from such bulk cultures clones of T cells with high therapeutic efficacy should be obtainable. So far only a few studies have been published on adoptive therapy of this category of tumors using cloned T cells. In one study of a methylcholanthene (MCA)-induced glioma implanted intracranially in syngeneic mice, adoptive therapy with a cloned tumor-specific CD8 CTL line injected i.v. led to reductions in tumor size. Therapy required administration of IL2-containing factor preparation. One of the conditions limiting the therapeutic effect may have been increased intracranial pressure due to tumor growth (Yamasaki et al., 1984). In another study a cloned CD8+ tumor-specific CTL line was used for adoptive immunotherapy of a syngeneic murine MCA-induced fibrosarcoma. Combined weekly doses of cyclophosphamide, butanol-extracted tumor antigen containing TSTA, and cloned tumor-specific CTLs retarded tumor growth, prolonged survival, and reduced lung metastasis (Naito et al., 1988). A source of potential tumor-specific CTLs that has recently received considerable interest both in animal and human studies is contained within so-called tumor-infiltrating lymphocytes (TILs). In the case of immunogenic carcinogen (MCA)-induced murine tumors, TILs were found to be enriched for therapeutically active cells (Rosenberg et al., 1986) and to recognize unique tumor-associated antigens (Barth et al., 1990). Adoptive transfer of TILs, combined with IL-2 and cyclophosphamide, resulted in a high cure rate in mice bearing large metastatic lesions (Rosenberg et al., 1986). TILs, although enriched for tumor-specific T cells, at least in the case of immunogenic tumors, should be considered as bulk populations of tumor-specific CTLs, e.g., comparable to in vztro-restimulated spleen cells from animals immunized with an immunogenic tumor. Indeed, as expected of CD8+ CTLs, murine TILs were found to be dependent on appropriate MHC class 1 expression on the tumor for therapeutic activity (Weber and Rosenberg, 1990). This was demonstrated with B 16 melanoma lacking H-2Kb class I expression and an H-2Kb-positive subline of B16, transfected with the H-2Kb gene. Cloned CTLs from tumor-specific TILs are expected to show the same high therapeutic +
160
CORNELIS J. M. MELIEF
effectiveness as the cloned CTLs directed against virus-induced tumors (discussed in Sections IV,B,1 and IV,B,2). For a survey of tumor-specific TILs in human systems, see Sections VI and VII. V. Escapes of Tumor Cells from Immune T Cells
There are probably numerous ways by which tumor cells can escape eradication by T cells, only some of which have been identified. This survey is limited to the following known escape routes, many of which have been reviewed elsewhere and will therefore only be dealt with briefly.
A. IMMUNOSELECTION OF TUMOR ANTIGENNEGATIVE VARIANTS Selection of tumor antigen-negative variants under the pressure of tumor-specific T cells has been documented in a variety of immunogenic tumor systems (for review see Urban and Schreiber, 1988; see also Boon et al., 1989a,b; Melief et al., 1989). Usually, the antigen-negative phenotype is stable. However, in our laboratory we have observed a murine leukemia virus-induced tumor that, depending on passage in immunocompetent or T cell-deficient syngeneic mice, assumes a virus antigennegative or -positive phenotype, respectively (Vasmel et al., 1989). Tumor cells cloned at the single-cell level display the same property (A. Sijts, C. J. M. Leupers, and C. J. M. Melief, unpublished observations).
B. DOWN-REGULATION OF MHC CLASSI EXPRESSION The effects of MHC class I expression on tumorigenicity are complex, dependent, among other aspects, on the immunogenicity of the tumor in question (for review see Hammerling et al., 1987; see also Tanaka et al., 1988; Melief et al., 1989; Ljunggren and Karre, 1990). In the case of tumors that are strongly immunogenic, i.e., elicit CD8 CTL responses, down-regulation of the MHC class I allele functioning as the CTL restriction element almost invariably causes increased tumorigenesis. However, in the case of tumors against which T cell immunity is less important, MHC class I down-regulation can lead to increased NK resistance, associated with increased in vivo tumor resistance (Karre et al., 1986; Ljunggren and Karre, 1990). Through a hitherto unidentified mechanism, N K cells are apparently capable of recognizing and eliminating moderate numbers of tumor cells (or other cells) that fail to express self MHC class I molecules (Ljunggren and Karre, 1990). +
CYTOTOXIC T LYMPHOCYTES
161
In human tumors, allele-specific loss of expression of HLA class I antigens is frequently observed (Masucci et al., 1989; Natali et al,, 1989; Smith et al., 1989; Stam et al., 1989). The significance of such MHC down-regulation for T cell immunity or NK immunity in the tumorbearing host remains to be demonstrated. An interesting correlation was observed between high N-myc or c-myc protooncogene expression and low MHC class I expression (Bernards et al., 1987; Versteeg et al., 1989a) in association with increased NK susceptibility (Versteeg et al., 1989b). Sometimes, all HLA class I expression is lost in tumors, e.g., by selective loss of P,-microglobulin mRNA (Momburg and Koch, 1989).
C. IMMUNOSUPPRESSION BY CHEMICAL CARCINOGEN AND UV LIGHT Many chemical carcinogens, including MCA, are immunosuppressive at high doses (Prehn, 1963; Prehn and Karcher, 1983). T h e same holds for UV light (Kripke, 1981, 1984). It has been argued that at moderate doses of MCA, the immunosuppression is insufficient to explain the correlation between dose, latency, and immunogenicity seen with MCAinduced tumors (Prehn and Prehn, 1987). Therefore, the role of immunosuppression by low-dose carcinogen or UV light, associated with the pathogeneis of some human tumors, seems questionable, as a cause of tumor escapes from T cell surveillance. This is especially so in view of the poor immunogenicity of such low-dose carcinogen/UV light-induced tumors (see Sections III,B and 111,D). OF EFFECTIVE ANTITUMOR IMMUNITY D. BLOCKADE A N D ADOPTIVE T CELLTHERAPY BY SUPPRESSOR T CELLS
In many adoptive immunotherapy models in mice and rats, including chemically and virally induced tumors, the therapeutic action of CD8 CTLs in immunocompetent animals is offset by “suppressor” cells that are usually CD4+ (Fefer et al., 1976; Greenberg and Cheever, 1984; Cheever et al., 1986; Klarnet et al., 1987; Awwad and North, 1990; for review see North et al., 1989). The action of suppressor cells can be selectively eliminated by whole-body irradiation or by administration of cyclophosphamide or anti-CD4 monoclonal antibody (Fefer et al., 1976; Dennis et al., 1984; Greenberg and Cheever, 1984; Kwong et al., 1984; North, 1984, 1985; Cheever et al., 1986; Klarnet et a/., 1987; Naito et al., 1988; Awwad and North, 1990; for reviews see Rosenberg and Terry, 1977; North, 1985; North et aE., 1989). The CD4+ suppressor cells +
162
CORNELIS J.
M.
MELIEF
appear to be tumor induced and need several days to be generated in response to tumor growth (Awwad and North, 1990). As pointed out elsewhere in this review, the CD4+ subset in many models also harbors cells that are beneficial in adoptive T cell therapy, either by themselves or as helpers for CD8+ tumor-specific CTLs. Whether the CD4+ suppressor population is distinct from such CD4+ effector cells remains to be established (Awwad and North, 1990). Adoptive T cell therapy of adenovirus El-induced tumors in T cell-deficient nude mice is one of the few examples in which adoptively transferred cloned CD8 tumorspecific CTLs plus I L 2 completely eradicate very large tumor masses without the requirement to treat the tumor-bearing host with cyclophosphamide, irradiation, or anti-CD4 antibody (Kast et al., 1989). This finding is compatible with the fact that regulatory T cells can interfere with the effectiveness of adoptive T cell therapy, although other explanations are possible, such as failure of Ad El-transformed cells to down-regulate T cell activity (see Section V,E). Even adoptive T cell therapy in immunocompetent mice does not always show a requirement for elimination of suppressor cells. For example, in the study of Johnson et al. ( 1986), Friend leukemia virus-induced leukemic mice experienced permanent regression of their disease when given immune T cells or immune CD4+ T cells without any other adjunctive treatment. In studies with TIL plus I L 2 in murine models, treatment with cyclophosphamide or X rays is required for effective antitumor activity (Rosenberg et al., 1986; Cameron et al., 1990). The data in the latter study argue against the elimination of suppressive T cells as an important mechanism in radiation- or cyclophosphamide-induced potentiation of TIL antitumor activity. Local tumor irradiation had the same effect. Moreover, cyclophosphamide also augmented TIL activity against tumors in rigorously T cell-depleted mice. Rather, the data were compatible with the notion that either systemic/local radiation or cyclophosphamide exerted direct antitumor activity (Cameron et al., 1990) or inhibited the production by the tumor of suppressive factors such as transforming growth factor+ (TGF-P) (Cameron et al., 1990; see Section V,E). +
E. OTHER T-EVASIVE ACTIVITY EXERTED BY TUMOR CELLS It is a well-recognized fact that it is much more difficult to eradicate a large immunogenic tumor by adoptive T cell therapy than to immunize a non-tumor-bearing host against the same immunogenic tumor with irradiated or low numbers of tumor cells (for reviews see North, 1984,
CYTOTOXIC T LYMPHOCYTES
163
1985; North et al., 1989). While this may partly be due to suppressive regulatory T cells generated in the course of tumor growth (see previous section), this does not explain entirely the paradoxical survival of a large tumor mass in an immunocompetent host mounting a vigorous T cell response against it. A forceful demonstration of this point is the recent observation that tumors bearing an immunogenic MHC class I antigen through gene transfection were not rejected, whereas simultaneously grafted normal tissues from transgenic mice bearing the same MHC class I antigen were rejected in mice bearing a nontransfected tumor burden (Perdrizet et al., 1990). In non-tumor-bearing animals the same transfected tumor grafts were rejected. In these experiments, low antigenicity, antigen overload, or inadequate proliferative capacity of murine T cells were unlikely causes of the failure of antitransfected class I antigen immunity to be effective. Systemically generated suppressive T cells also cannot explain the results, because such cells should have equally suppressed the rejection of nonmalignant grafts (Perdrizet et al., 1990). Perhaps tumors can exert local effects that prevent T cells from displaying full efficacy, allowing escapes from immunosurveillance. A possible candidate mediating such an effect is TGF-P. Cells malignantly transformed by a variety of mechanisms secrete the cytokines TGF-a and TGF-P (Moses et al., 1981; Kaplan et al., 1982; Anzano et al., 1985; Sporn et al., 1986; Derynck et al., 1987; Dickson et al., 1987). TGF-P is known to inhibit IL2-dependent proliferation of T lymphocytes and the induction of alloreactive CTLs in mixed lymphocyte cultures (Kehrl et al., 1986; Ristow, 1986; Ranges et al., 1987; Seipl et a,l., 1988; Wahl et al., 1989). Conceivably, TGF-P secreted by tumor cells might similarly suppress T lymphocyte proliferation and CTL generation, at least locally. In support of this idea is the observation that a highly immunogenic tumor transfected with murine TGF-P cDNA escaped immunosurveillance (Torre-Amione et al., 1990). Perhaps in pregnancy similar mechanisms are used to suppress untoward T cell reactivity between mother and fetus. Indeed, it was recently found that murine pregnancy decidua produces an immunosuppressive molecule related to TGF-P, (Clark et al., 1990). VI. Relationship of LAK Cells, TIL Cells, NK Cells, and T Cells, All with Antitumor Activity and Clinical Results of Adoptive Therapy with LAK and TIL Cells
Recombinant IL-2 is a very powerful cytokine with the capacity to activate and expand NK cells and T cells in vitro and in vivo; this capacity has been used extensively to generate so-called lymphokine-activated
164
CORNELIS J. M. MELIEF
killer (LAK)cells from lymphoid organs and blood of both tumor bearing and non-tumor-bearing hosts and these cells have broad cytolytic activity against tumor cells in mice and humans (for review see Rosenberg, 1988; see also Rosenberg, 1989; Ballas and Rasmussen, 1990; Chen et al., 1989; Fox and Rosenberg, 1989; Borden and Sondel, 1990). I L 2 administration in vivo similarly generates LAK activity against tumor cells and other targets (Rosenberg, 1988,1989; Goldstein et al., 1989; Peace and Cheever, 1989; Weil-Hillman et al., 1989, 1990). It is now firmly established that the major cell population among LAK cells with broad lytic activity against tumor cells consists of activated NK cells, with a less important contribution by nonspecifically activated T cells (Phillips and Lanier, 1986; Hersey and Bolhuis, 1987; Kalland et al., 1987; Ballas and Rasmussen, 1990; Faure et al., 1990; Weil-Hillman et al., 1989, 1990). I L 2 also causes proliferation of NK cells in vivo (Biron et al., 1990).Expansion of T cells by I L 2 in vivo has been discussed in previous sections. Tumor-infiltrating lymphocytes are also expanded by I L 2 in vitro and the lytic activity against tumor cells exerted by such expanded T I L cultures likewise, depending on tumor type, includes the combined activation of NK cells and T cells. In the case of immunogenic tumors, such as carcinogen-induced murine tumors and human melanoma, TILs cultured with I L 2 are highly enriched for T cells, often CD8 +,with specific antitumor activity (Itoh et al., 1986, 1988; Rosenberg et al., 1986; Heo et al., 1987; Muul et al., 1987; Spiess et al., 1987; Belldegrun et al., 1988, 1989; Topalian et al., 1989; Cameron et al., 1990; Barth et al., 1990). From a conceptual point of view it is important to note that all the major biologic activity against tumors in vitro and in vivo displayed by LAK cells and T I L cells can be traced back to (subsets of) activated N K cells or T cells, especially CD8+ CTLs. In LAK cells, N K activity predominates. In TIL cells, T cells usually predominate. TILs from metastatic melanoma before and after culture with IL2 even contain very few, if any, NK cells (Itoh et al., 1986, 1988; Muul et al, 1987). However, TILs from renal cell carcinomas o r sarcomas were found to contain a substantial proportion of NK cells, increasing in number with I L 2 (Itoh et al., 1988). It is the CD8+ CTLs with MHC-restricted CTL activity against tumor cells among TIL cells that stand out as the major candidate for therapeutic activity in adoptive transfer of T cells, combined with systemic IL-2 treatment in both animal studies and patients with melanoma. In some patients, CD4 cells grown from TILs may contribute to antitumor effects (Muul et al., 1987; Itoh et al., 1988; Rosenberg et al., 1988; Darrow et al., 1989; Topalian et al., 1988, 1989; Barth et al., 1990; Weber and Rosenberg, 1990). To definitively prove the therapeutic capacity of CD8+ CTLs and CD4+ cells cultured from melanoma +
165
CYTOTOXIC T LYMPHOCYTES
TILs, therapy with cloned T cells or purified populations will have to be conducted. The extra contribution of tumor-specific T cells among TILs explains their superiority over LAK cells in adoptive transfer experiments. Obviously, therefore, TILs are expected to be superior over LAK cells only in the case of immunogenic tumors, such as a proportion of malignant melanomas and possibly renal carcinomas in humans. Indeed, IL-2-activated NK cells may have limited therapeutic activity against many tumor types in comparison with CD8 CTLs or even CD4 T cells (Mu16 et al., 1987; Kast et al., 1989; Peace and Cheever, 1989; Parmiani, 1990). T h e moderate antitumor activity exerted by NK cells against many tumors, notably those with a low-level expression of MHC class I (for review see Ljunggren and Karre, 1990), is in line with the concept of NK cell resistance as a first line of defense system against, e.g., viruses (Bukowsky and Welsh, 1985; Rager-Zisman et al., 1987; Biron et al., 1989; Janeway, 1989; Natuk et al., 1989; Kast et al., 1991). T h e price that has to be paid for prompt action and broad specificity is less efficacy and precision. Specific T cells need more time to be generated in sufficient numbers, but once expanded are highly specific and effective. In fact, in the treatment of immunogenic tumors with high-dose I L 2 , activation of NK cells may be harmful rather than beneficial, because such activation can contribute to toxicity without noticeably contributing to the therapeutic efficacy, entirely mediated by ‘r cells (Peace and Cheever, 1989). Finally, the fact that TILs are enriched for tumor-specific T cells in the case of immunogenic tumors makes them a prime and convenient source of tumor-specific T cells in patients with immunogenic cancer. In some patients with melanoma, tumor-specific CTLs have also been cultured from the blood (Degiovanni et al., 1988; Fossati et al., 1988; Anichini et al., 1989; Darrow et al., 1989; Wolfel et al., 1989; Notter and Schirrmacher, 1990). In these cases, CTL lines or clones were obtained by mixed culture of peripheral blood lymphocytes with autologous tumor cells, followed by culture and cloning in the presence of IL2. Clinical evaluation of cancer treatment with high-dose IL-2 with or without LAK cells has shown that in approximately 20% of patients with renal cell carcinoma or metastatic melanoma, measurable tumor regressions occur that are usually partial and of short duration. Occasionally, prolonged complete remissions have been achieved (Rosenberg, 1988, 1989; Borden and Sondel, 1990; Lotze, 1990). Combination of high-dose I L 2 with autologous TIL cells reported to slightly improve the results of treatment of metastatic melanoma, objective tumor regressions being noted in 9 of 15 patients not previously +
+
166
CORNELIS J. M. MELIEF
treated with I L 2 and in 2 of 5 patients in whom previous I L 2 therapy had failed (Rosenberg et al., 1988). The partial (10) and complete (1) remissions lasted from 2 to more than 13 months. On one hand, the somewhat better results may have been due to enrichment of tumorspecific T cells (CD4+ or CD8+) in TIL versus LAK cells plus I L 2 , or I L 2 alone. On the other hand a single dose of cyclophosphamide was added to the treatment regimen, a procedure known to markedly potentiate the therapeutic efficacy of adoptive T cell therapy in many murine models (see Section V,D). In another study of IL-2 plus TIL therapy, 29% of patients with renal cell cancer and 23% of those with melanoma achieved objective tumor responses lasting 3-14 months (Kradin et al., 1989). In this regimen no cyclophosphamide was used. In other types of cancer, following treatment with IL-2 alone or I L 2 plus LAK cells (Rosenberg, 1988, 1989; Borden and Sondel, 1990) or with IL-2 plus T I L cells (Topalian et al., 1988),very few clinical responses were noted. One complete and four partial remissions occurred in 30 patients with colorectal carcinoma treated with IL-2/LAK. Of 5 patients with non-Hodgkin’s lymphoma (NHL) treated with IL-PILAK, 1 experienced a complete remission and 2 experienced a partial remission. None of 12 patients with colorectal cancer and none of 6 with NHL treated with I L 2 alone achieved a complete remission. VII. Cloned T Cells with Autologous Tumor Specificity in Malignant Melanoma: Nature of the Melanoma Antigens
Numerous independent groups have now succeeded in cloning T cells with autologous tumor specificity from the blood or from TILs of melanoma patients (Degiovanni et al., 1988; Fossati et al., 1988; Anichini et al., 1989; Darrow et al., 1989; Wolfel et al., 1989; Van den Eynde et al., 1989; Gervois et al., 1990a,b; Notter and Schirrmacher, 1990). Most of these clones are CD8+ MHC class I-restricted CTLs, but some clones were CD4+ and proliferated specifically. CD8+ clones from a single patient may recognize multiple tumor antigens (Degiovanni et al., 1988; Van den Eynde et al., 1989; Wolfel et al., 1989). The precise molecular nature of the peptides recognized remains unknown. In one study the HLA-A2 class I molecule was the restricting element used by autologous CTL clones derived against three different antigens of a single patient. Four HLA-A2 allogeneic melanoma lines were not recognized by these CTL clones (Wolfel et al., 1989). Thus the expression of these tumor antigens does not seem common in human melanoma. Some melanoma antigens recognized by autologous CTLs appear to be more stably ex+
CYTOTOXIC T LYMPHOCYTES
167
pressed than others (Van den Eynde et al., 1989), and antigen loss variants may offset the success of adoptive T cell therapy (Van den Eynde et al., 1989; Topalian et al., 1990).
VIII. Epilogue Complete and permanent eradication of tumors by MHC class Irestricted CD8+ tumor-specific CTLs can be achieved in a variety of experimental murine models. In human metastatic melanoma, CD8 tumor-specific CTLs are probably the therapeutically most active components among LAK or T I L cells, with a possibly important contribution by CD4+ cells in some patients, although no clinical experience with cloned T cells exists as yet to evaluate this point. Cancer cells can avoid the induction of and destruction by tumorspecific CTLs in a number of ways, some of which can be manipulated to increase the efficacy of sensitization or adoptive therapy. An important challenge in animal models is to disrupt regulatory T cell circuits that are detrimental to effective adoptive CTL therapy and to develop means to deal effectively with CTL-suppressive activity exerted by the tumor cells, such as TGF-P production. Two possibilities to counteract the activity of TGF-P are delivery of tumor necrosis factor (Ranges et al., 1987) o r administration of TGF-P neutralizing antibodies. In the realm of adoptive T cell therapy of human cancer, similar formidable problems need to be surmounted, but in addition the important issue of immunogenicity needs to be addressed. What proportion of human tumors expresses cryptic immunogenic peptides in the context of MHC molecules, which, given sufficient help in the form of, e.g., local I L 2 , can elicit CD8 CTLs or CD4 T, cells that can be grown out and used for adoptive therapy? Is it possible to therapeutically utilize cytotoxic T cells that apparently break the rule of MHC restriction and appear to be directed against tumor-associated mucins (Bornd et al., 1989)? In a murine model, unrestricted recognition of an antigen, the nonpeptide heme moiety of hemoglobin, was also reported (Sherman and Lara, 1989). Perhaps in the future, rather than wait and see what sort of CTLs one can culture from tumor-bearing hosts, it will become possible to specifically direct CTLs against target peptides of choice, such as those encoded by mutated oncogenes (Bishop, 1991; Jung and Schluesener, 1991; Halevy et al., 1990; Van Denderen et al., 1990) or against peptides resulting from secondary changes in transformed cells. Oncogene product-directed therapy can be very effective (Bernards et al., 1987; Kast et al., 1989). Moreover, protective CTL induction by peptide vaccination is +
+
+
168
CORNELIS J. M. MELIEF
now feasible as demonstrated in viral systems (Schulz et al., 1991; Kast et al., 1991). Important progress in immunotherapy of cancer is visible with treatment modalities other than adoptive T cell administration. Some of these may be more convenient and less costly, but T cell therapy allows targeting on minute changes in any cellular peptide that is presentable in the context of MHC molecules. Finally, the fact that CD8+ CTLs stand out as remarkably effective in tumor eradication should not surprise us, in view of their remarkable potency and specificity in allograft rejection (Rosenberg et al., 1988) and antiviral immunity (Byrne and Oldstone, 1984; Lukacher et ad., 1984; Zinkernagel et a)., 1985; Kast et a/., 1986; Lehmann-Grube et al., 1988). REFERENCES
Aichele, P., Hengartner, H., Zinkernagel, R. M., and Schulz, M. (199O).J.Exp. Med. 171, 1815-1820. Anichini, A., Mazzocchi, A., Fossati, G., and Parmiani, G. (1989).J. Immunol. 143, 36923701. Anzano, M. A., Roberts, A. B., De Larco, J. E., Wakefield, L. M., Assoian, R. K., Roche, N. S., Smith, J. M., Lazarus, J. E., and Sporn, M. B. (1985). Mol. Cell. Biol. 5, 242-247. Awwad, M., and North, R. J. (1990). Cancer R e 5 . 50,2228-2233. Azuma, H., Phillips, J. D., and Green, W. R. (1987).J. Immunol. 139, 2464-2473. Babbit, B., Allen, P., Matsuda, G., Haber, E., and Unanue, E. (1985).Nature (London) 317, 359-361. Bakke, O., and Dobberstein, B. (1990). Cell 63, 707-716. Ballas, Z. K., and Rasmussen, W. (199O).J.Immunol. 144, 386-395. Barr, B. B. B., McLaren, J., Smith, I. W., Benton, E. C., Bunney, M. H., Blessing, K., and Hunter, J. A. (1989). Lancet i, 124-129. Barth, R. J., Bock, S. N., Mule, J. J., and Rosenberg, S. A. (199O).J.Immunol. 144, 15311537. Bast, R. C., Jr., Bast, B. S., and Rapp, H. J. (1976).Ann. N.Y. Acad. Sci. 277, 60-93. Bastin, J., Rothbard, J., Davey, J., Jones, I., and Townsend, A. (1987).J. Exp. Med. 165, 1508- 1523. Bear, H. D., Susskind, B. M., Close, K. A., and Barrett, S. K. (1988). CancmRe5.48, 14221427. Belldegrun, A., M u d , L. M., and Rosenberg, S. A. (1988). Cancer Res. 48, 206-214. Belldegrun, A., Kasid, A., Uppenkamp, M.,Topalian, S. L., and Rosenberg, S. A. (1989).J. Immunol. 142,4520-4526, Bellgrau, D., Walker, T. A., and Cook, J. L. (1988).J. Vzrol. 62, 1513-1519. Bernards, R., Schrier, P. I., Rouweling, A., Bos, J. L., Van der Eb, A. J., Zijlstra, M., and Melief, C. J. M. (1983). Nature (Lundon) 305, 776-779. Bernards, R., Destree, A., McKenzie, S., Gordon, E., Weinberg, R. A., and Panicali, D. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 6854-6858. Bevan, M. J. (1975). Nature (London) 256,419-421.
CYTOTOXIC T LYMPHOCYTES
169
Binz, H., Fenner, M., Engel, R., and Wigzell, H. (1983). Int. J. Cancer 32, 491-500. Biron, C. A., Byron, K. S., and Sullivan, J. L. (1989). N . Eng1.J. Med. 320, 1731-1735. Biron, C. A., Young, H. A., and Kasaian, M. T. (199O).J. Exp. Med. 171, 173-188. Bishop, J. M. (1991). Cell 64,235-248. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strorninger, J. L., and Wiley, D. C. (1987a). Nature {London) 329, 506-512. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Strominger, J. L., and Wiley, D. C. (1987b). Nature (London) 329, 512-518. Boon, T. ( 1983). Adu. Cancer Res. 39, 121- 151. Boon, T. (1992). Adv. Cancer Res. 58, 177-210. Boon, T., Van Pel, A., de Plaen, E., Chomez, P., Lurquin, C., Szikora, J. P., Sibille, C., MariamC, B., van den Eynde, B., Lethe, B., and Brichart, V. (1989a). Cold SpringHarbor Symp. @ant. Biol. 54, 587-596. Boon, T., van Pel, A,, and de Plaen, E. (1989b). Cancer Cells 1, 25-28. Borden, E. C., and Sondel, P. M. (1990). Cancer (Phzladelphzu) 65, Suppl. 800-814. Bornd, D. L., Lau, M. S., Metzgar, R. S., and Finn, 0.J. (1989).Proc. Nutl. Acad. Scz. U.S.A. 86,7159-7163. Bridges, S. H., and Longo, D. L. (199O).J. Immunol. 144, 2010-2017. Brodsky, F., and Guagliardi, L. E. (1991). Annu. Rev. Immunol. 9, 707-744. Brown, J. H., Jardetzky, T., Saper, M. A,, Samraoui, B., Bjorkman, P. J., and Wiley, D. C. (1988). Nature (London) 332, 845-849. Brunner, K. T., MacDonald, H. R., and Cerottini, J.-C. (1981).J. Exp. Med. 154, 362-373. Bukowsky, J. F., and Welsh, R. M. (1985).J . Immunol. 135,3537-3541. Burrows, S. R., Sculley, T. B., Misko, I. S., Schmidt, C., and Moss, D. J. (199O).J. Exp. Med. 171, 345-349. Buus, S., Sette, A,, Colon, S. M.,Miles, C., and Grey, H. M. (1987).Science 235, 1353-1358. Byrne, J. A,, and Oldstone, M. B. A. (1984).J. Viral. 51, 682-686. Cameron, R. B., Spiess, P. J., and Rosenberg, S. A. (1990). J. Exp. Med. 171, 249-263. Campbell, A. E., Foley, F. L., and Tevethia, S. S. (1983).J. Immunol. 130, 490-494. Carbone, F., and Bevan, M. J. (1989).J. Exp. Med. 169,603-612. Cheever, M. A,, Britzmann-Thompson, D. Klarnet, J. P., and Greenberg, P. D. (1986).J. Exp. Med. 163, 1100-1112. Chen, B. P., Hauk, J. A,, Kraus, E. E., and Sondel, P. M. (1989). Cell. Immunol. 118, 458468. Chen, W., Reese, V. A., and Cheever, M. A. (1990).J . Immunol. 144,3659-3666. Chesterman, F. C., Gaugas, J. M., Hirsch, M. S., Rees, R.J. W., Harvey,J. J., and Gilchrist, C. (1969). Nature (London) 221, 1033-1036. Clark, D. A, , Flanders, K. C., Bauwatt, D., Millar-Book, W., Manuel, J., Stedronska-Clark, J., and Howley, B. (199O).J. Immunol. 144, 3008-3014. Cohen, 1. R. (1991). Annu. Rev. Immunol. 9, 567-589. Dailey, M. O., Pillemer, E., and Weissman, I. L. (1982). Proc. Nutl. Acad. Scz. U.S.A. 79, 5384-5387. Darrow, T. L., Slingluff, C. L., and Seyler, H. F. (1989).J. Immunol. 142, 3329-3335. Degiovanni, G., Lakaye, T., Herin, M., Hainaut, P., and Boon, T. (1988). Eur. J. Immunol. 18,671-676. Dennis, J. W., Laferte, S., Elliott, B. E., and Kerbel, R. S. (1984).1nt.J. Cancer 34,709-716. De Plaen, E., Lurquin, C., Van Pel, A., Mariame, B., Szikora, J. P., Wolfel, T., Sibille, C., Chomez, P., and Boon, T. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 2274-2278. Deres, K., Schild, H., Wiesmuller, K.-H., Jung, G., and Rammensee, H.-G. (1989). Nature (London) 342, 561-564.
170
CORNELIS J. M. MELIEF
Derynck, R., Goeddel, D. V., Ullrich, A,, Gutterman, J. U., Williams, R. D., Bringman, T. S., and Berger, W. H. ( 1 987). Cancer Res. 47, 707-7 12. Deverson, E. V., Cow, I. R., Coadel, W. J., Monaco, J. J., Butcher, G. W., and Howard, J. C. (1990). Nature (London) 348, 738-740. Dickson, R. B., Kasid, A,, Huff, K. K., Bates, S. E., Knabbe, C., Bronzert, D., Gelmann, E. P., and Lippman, M. E. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 837-841. Ellenhorn, J. D. I., Schreiber, H., and Bluestone, J. A. (199O).J.Immunol. 144,2840-2846. Engers, H. D., Lahaye, T., Sorenson, G. D., Glasebrook, A. L., Horvath, C., and Brunner, K. T. (1984).J. Immunol. 133, 1664-1670. Falk, K., Rotzschke, O., Stevanovic, S.,Jung, G., and Rammensee, H.-G. (1991). Nature (London) 351,290-296. Faure, F., Triebel, F., and Hercend, T. (1990). Immunol. Today 11, 108-109. Fearon, E. R., Itaya, T., Hunt, B., Vogelstein, B., and Frost, P. (1988). Cancer&. 38,29752980. Fearon, E. R., Pardoll, D. M., Itaya, T., Golumbek, P., Levitsky, H. I., Simons, J. W., Karasuyama, H., Vogelstein, B., and Frost, P. (1990). Cell 60, 397-403. Fefer, A., Einstein, A. B., Cheever, M. A., and Berenson, J. R. (1976). Ann N.Y. Acad. Sci. 276, 573-580. Fernandez-Cruz, B. A., Woda, G., and Feldman, J. D. (1980).J.Exp. Med. 152, 823-841. Foley, E. J. (1953). Cancer Res. 13, 835-837. Fossati, G., Anichini, A., Sguarcina, P., Mazzocchi, A., and Parmiani, G. (1988). Int. j. Cancer 42, 239-245. Fox, B. A,, and Rosenberg, S. A. (1989). Cancer Immunol. Immunother. 29, 155-166. Gansbacher, B., Zier, K., Daniels, B., Cronin, K., Bannerji, R.,and Gilboa, E. (199Oa).J . Exp. Med. 172, 1217-1224. Gansbacher, B., Bannerji, R., Daniels, B., Zier, K., Cronin, K., and Gilboa, E. (1990b). Cancer Res. 50, 7820-7825. Germain, R. N. (1986). Nature (London) 322, 687-689. Germain, R. N. (1988). Cell 54, 441-444. Gervois, N., Heuze, F., Diez, E., and Jotereau, F. (1990a). Hum. Immunol. 28, 112-118. Gervois, N., Heuze, F., Diez, E., and Jotereau, F. (1990b).Eur. J. Immunol. 20, 825-831. Globerson, A., and Feldman, M. (1964).J.Natl. Cancer Inst. 32, 1229-1243. Goldstein, D., Sosman, J. A., Hauk, J. A., Weil-Hillman, G., Moore, K. H., Borchert, A., Bechhofer, R., Storer, B., Kohler, P. C., Levitt, D., and Sondel, P. M. (1989). Cancer Res. 49,6832-6839. Greenberg, P. D. (1986).J. Immunol. 136, 1917-1922. Greenberg, P. D., and Cheever, M. A. (1984).j. Immunol. 133, 3401-3404. Greenberg, P. D., Cheever, M. A., and Fefer, A. (198l).J. Exp. Med. 154,952-963. Greenberg, P. D., Kern, D. E., and Cheever, M. A. (1985).J. Exp. Med. 161, 1122-1 134. Greenberg, P. D., Klarnet, J. P., Kern, D. E., and Cheever, M. A. (1988). Prog. Exp. Tumor Res. 32, 104-127. Greenspan, D., De Villiers, E.-M., Greenspan, J. S., Desouza, Y. G., and Zur Hausen, H. (1988).J. Oral Pathol. 17, 482-488. Halevy, O., Michalovitz, D., and Oren, M. (1990). Science 250, 113-116. Hammerling, G. J., Klar, D., Piilm, W., Momburg, F., and Moldenhauer, G. (1987).Biochim. Biophys.Acta 907, 245-259. Hellstrom, I., and Sjogren, H. 0. (1966).Int. J . Cancer 1, 481-489. Heo, D. S., Whiteside, T. L., Johnson, J. T., Chen, K., Barnes, E. L., and Herberman, R. B. ( 1 987). Cancer Res. 47, 6353-6362. Hersey, P., and Bolhuis, R. L. H. (1987). Immunol. Today 8,233-239. Hewitt, H. B., Blake, E. R., and Walder, A. S. (1976). Br. J. Cancer 33, 241-259.
CYTOTOXIC T LYMPHOCYTES
171
ltoh, K., Tilden, A. B., and Balch, C. M. (1986). Cancer Res. 46, 3011-3017. Itoh, K., Platsoucas, C. D., and Balch, C. M. (1988).J. Exp. Med. 168, 1419-1441. Janeway, C. A. (1989). Nature (London) 341, 108. Johnson, C. S., Thurlow, S. M., and Furmanski, P. (1986). Cancer Res. 46, 183-189. Jung, S., and Schluesener, H. J. (199l).J. Exp. Med. 173, 273-276. Kalland, T., Belfrage, H., Bhiladvala, P., and Hedlund, G. (1987).J. Immunol. 138, 36403645. Kaplan, P. L., Anderson, M., and Ozanne, B. (1982). Proc. Natl. Acad. Sci. U.S.A. 79,485489. Karre, K., Ljunggren, H. G., Piontek, G. E., and Kiessling, R. (1986). Nature (London) 319, 675-678. Kast, W. M., and Melief, C. J. M. (1991). Int. J. Cancer (suppl.)6 , 90-94. Kast, W. M., Bronkhorst, A. M., de Waal, L. P., and Melief, C. J. M. (1986).J. Exp. Med. 164, 723-738. Kast, W. M., Offringa, R., Peters, P. J., Voordouw, A. C., Meloen, R. H., Van der Eb, A. J., and Melief, C. J. M. (1989). Cell 59, 603-614. Kast, W. M., Bluestone, J. A,, Heemskerk, M. H. M., Spaargaren, J., Voordouw, A. C., Ellenhorn, J. D. I., and Melief, C. J. M. (1990). J. Immunol. 145, 2254-2259. Kast, W. M., Roux, L., Curran, J., Blom, H. J. J., Voordouw, A. C., Meloen, R. H., Kolakofsky, D., and Melief, C. J. M. (1991). Proc. Natl. Acad. Scz. U.S.A. 88,2283-2287. Kaufmann, S. H. E. (1990). Immunol. Today 11, 129-136. Kehrl, J. H., Wakefield, L. M., Roberts, A. B., Jakowlew, S. B., Alvarez-Mon, M., Derynck, R., Sporn, M. B., and Fauci, A. S. (1986). J. Exp. Med. 163, 1037-1050. Kern, D. E., Klarnet, J. P., Jensen, M. C. V., and Greenberg, P. D. (1986).J. Immunol. 136, 4303-43 10. Klarnet, J. P., Matis, L. A., Kern, D. E., Mizuno, M. T., Peace, D. J., Thompson, J. A., Greenberg, P. D., and Cheever, M. A. (1987).J. Immunol. 138,4012-4017. Klarnet, j.P., Kern, D. E., Okuno, K., Holt, C., Lilly, F., and Greenberg, P. D. (1989).J. Exp. Med. 169, 457-467. Klein, G. (1968). Cancer Res. 28, 625-635. Klein, G., and Purtilo, D. (1981). Cancer Res. 41, 4302-4304. Klein, G., Sjogren, H. O., Klein, E., and Hellstrom, K. E. (1960). Cancel- Res. 20, 15611572. Knowles, D. M., Inhgirami, G., Ubriaco, A., and Dalla-Favera, R. (1989). Blood 73, 792799. Kradin, R. L., Lazarus, D. S., Dubinett, S. M., Gifford, J., Grove, B., Kurnick, J. T., Preffer. F. l., Pinto, C. E., Davidson, E., Callahan, R. j.,andstrauss, H. W. (1989). Lanceti,577580. Kripke, M. L. (1981). Adu. Cancer Res. 34, 69-106. Kripke, M. L. (1984). Immunol. Rev. 80, 87-102. Kwong, L., Kilburn, D. G., and Teh, H. S. (1984). Cancer Immunol. Immunother. 17,205212. Lamb, J. R., McMichael, A. J., and Rothbard, J. R. (1987). Hum. Immunol. 19, 79-89. Laraque, D. (1989). N . Eng1.J. Med. 320, 1220-1221. Lee, D. R., Rubocki, R.J., Lie, W. R., and Hansen, T. H. (1988).,]. Exp. Med. 168, 17191739. Lehmann-Grube, F., Moskophidis, D., and Lohler, J. (1988). Ann. N.Y. Acad. Sci. 532,238256. Ley, V., Roth, C., Langlade-Demoyen, P., Larssen, E. L., and Kourilsky, P. (1990). Res. Immunol. 141,855-863. Ljunggren, H. G., and Karre, K. (1990). ImmunoL Today 11, 237-244.
172
CORNELIS J. M. MELIEF
Ljunggren, H. G., Stam, N. J., Ohlen, C., Neefjes, J. J., Hoogland, P., Heemels, M. T., Bastin, J., Schumacher, T., Townsend, A., Karre, K., and Ploegh, H. L. (1990). Nature (London) 346, 476-480. Lorenz, R. G., and Allen, P. M. (1988). Immunol. Rev. 106, 115-127. Lotze, M. T. (1990). In “Therapy of Advanced Melanoma” (P. Riimke, ed.), Pigment Cell Series, Vol. 10, pp. 163-182. Karger, Basel. Lukacher, A. E., Braciale, V. L., and Braciale, T. J. (1984).J . Exp. Med. 160, 814-826. Lydyard, P. M., and Van Eden, W. (1990). Immunol. Today 11,228-229. Maryanski, J. L., Pala, P., Corradin, J., Fordan, B. B., and Cerottini, J.-C. (1986). Nature (London) 324, 578-579. Masucci, M. G., Stam, N. J., Torsteinsdottir, S., Neefjes, J. J., Klein, G., and Ploegh, H. L. (1989). Cell. Immunol. 120, 396-400. Matis, L. A., Ruscetti, S. K., Longo, D. L., Jacobson, S., Brown, E. J., Zinn, S., and Kruisbeek, A. M. (1985).J.Immunol. 135, 703-713. Matis, L. A., Shu, S., Groves, E. S., Zinn, S., Chou, T., Kruisbeek, A. M., Rosenstein, M., and Rosenberg, S. A. (1986).J. Immunol. 136, 3496-3501. Melief, C. J. M., and Kast, W. M. (1990). Cancer Cells 2, 116-120. Melief, C. J. M., and Schwartz, R. S. (1975). In “Cancer, a Comprehensive Treatise” (F. Becker, ed.), Vol. 1 , pp. 121-159. Plenum, New York. Melief, C. J. M., Vasrnel, W. L. E., Offringa, R., Sijts, E. J. A. M., Matthews, E. A., Peters, P. J., Meloen, R. H., Van der Eb, A. J., and Kast, W. M. (1989). Cold Spring Harbor Symp. Quunt. Biol. 54, 597-603. Momburg, F., and Koch, S. (1989).J. Exp. Med. 169, 309-314. Monaco, J. J., Cho, S., and Attaya, M. (1990). Science 450, 1723-1726. Moore, M. W., Carbone, F. R., and Bevan, M. J. (1988). Cell 54, 777-785. Moore, S. K., Kozak, C., Robinson, E. A., Ullrich, S. J., and Appella, E. (1987).Gene 56,2940. Mora, P. T. (1982). Springer Semin. Immunopathol. 5, 7-32. Morrison, L. A., Braciale, V. L., and Braciale, T. J. (1988).J. Immunol. 141, 363-368. Moses, H. L., Branum, E. L., Proper, J. A., and Robinson, R. A. (1981). Cancer Res. 41, 2842-2848. Mule, J. J., Yang, J. C., Afreniere, R. L., Shu, S., and Rosenberg, S. A. (1987).J.Immunol. 139, 285-294. Muul, L. M., Spiess, P. J., Director, E. P., and Rosenberg, S. A. (1987).J.Immunol. 138,989995. Naito, K., Pellis, N. R., and Kahan, B. D. (1988). Cell. Immunol. 111, 216-234. Natali, P. G., Nicotra, M. R., Bigotti, A., Venturo, I., Marcenaro, L., Giacomini, P., and Russo, C. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 6719-6723. Natuk, R. J., Bukowski, J. F., Brubaker, J. O., and Welsh, R. M. (1989).J.Virol. 63,4969497 1 . Neefjes, J. J., Stollorz, V., Peters, P. J., Geuze, H. J., and Ploegh, H. L. (1990). Cell 61, 171183. North, R. J. (1984). Adv. Immunol. 35, 89-155. North, R. J. (1985). Adv. Cancer Res. 45, 1-43. North, R. J., Awwad, M., and Dunn, P. L. (1989).Prog. Immunol. 7, 1097-1 103. Notter, M., and Schirrmacher, V. (1990). Int. J . Cancer 45, 834-841. Old, L. J. (1989). Prog. Immunol. 7, 1053-1062. Old, L. J., and Boyse, E. A. (1964). Annu. Reu. Med. 15, 167-186. Palefsky, J. M., Gonzales,J., Greenblatt, R. M., Ahn, D. K., and Hollander, H. (199O).J.Am. Med. Assoc. 263, 291 1-2916.
CYTOTOXIC T LYMPHOCYTES
173
Parmiani, G. (1990). Immunol. Today 11, 103-145. Peace, D. J., and Cheever, M. A. (1989).J. Exp. Med. 169, 161-173. Penn, I. (1988). Cancer Detect. Prev. 12, 39-57. Perdrizet, G. A., Ross, S. R., Stauss, H. J., Singh, S., Koeppen, H., and Schreiber, H. (1990). J. Exp. Med. 171, 1205-1219. Phillips, C., McMillan, M., Flood, P. M., Murphy, D. B., Forma, J., Lancki, D., Womack, J. E., Goodenow, R. S., and Schreiber, H. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 51405144. PhiHips, J. H., and Lanier, L. L. (1986). J. Exp. Med. 164, 814-825. Prehn, R. T. (1963).J. Natl. Cancer Inst. 31, 791-805. Prehn, R. T. (1968). Cancer Res. 28, 1326-1330. Prehn, R. T. (1975).J. Natl. Cancer Inst. 55, 189-190. Prehn, R. T., and Bartlett, G. L. (1987). Int. J . Cancer 31, 227-229. Prehn, R. T., and Karcher, C. A. (1983). Int. J . Cancer 31, 227-229. Prehn, R. T., and Main, J. M. (1957).J. Natl. Cancer Inst. 18, 769-778. Prehn, R. T., and Prehn, L. M. (1987). Cancer Res. 47, 927-932. Rager-Zisman, G. B., Quan, P.-C., Rosner, M., Moller, J. R., and Bloom, B R. (1987).J. Immunol. 138, 884-888. Ranges, G. E., Figari, 1. S., Espevik, T., and Palladino, M. A. (1987).J. Exp. Med. 166,911998. Ristow, H. J. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 5531-5533. Roche, P. A., and Cresswell, P. (1990). Nature (London) 345, 615-617. Rosenberg, A. S., and Singer, A. (1988). Proc. Natl. Acud. Sci. U.S.A. 85, 7739-7742. Rosenberg, S. A. (1988). Immunol. Today 9, 58-62. Rosenberg, S. A. (1989). Cancer Treat. Rev. 116, Suppl. A., 1 15-121. Rosenberg, S. A,, and Terry, W. D. (1977). Adv. Cancer Res. 25, 323-388. Rosenberg, S. A,, Spiess, P., and Lafreniere, R. ( 1986). Science 233, 13 18- 132 1 . Rosenberg, S. A., Packard, B. S., Aebersold, P. M. et al. (1988).N . Engl. J. Med. 319, 16761680. Rosenstein, M., Eberlein, T., and Rosenberg, S. A. (1984). J. Immunol. 132, 21 17-2122. Sawada, Y., Urbanelli, D., Raskova,J., Shenk, T. E., and Raska, K. (1986).J. Exp. Med. 163, 563-572. Schrier, P. I., Bernards, R., Vaessen, R. T. M. J., Houweling, A., and Van der Eb, A. J. (1983). Nature (London) 305, 771-775. Schulz, M., Zinkernagel, R. M., and Hengartner, H. (1991).Proc. Natl. Acad. Scz. U. S . A . 88, 991-993. Schumacher, T. N. M., Heemels, M. T., Neefjes, J. J., Kast, W. M., Melief, C. J. M., and Ploegh, H . L. (1990). Cell 62, 563-567. Schumacher, T. N. M., de Bruin, M. L. H., Vernie, L. N., Kast, W. M., Melief, C. J. M., Neefjes, J. J., and Ploegh, H. L. (1991). Nature (London) 350, 703-706. Sherman, L. A., and Lara, A. M. (1989). J. Immunol. 143, 3444-3447. Siepl, C., Bodmer, S., Frei, K., MacDonald, H. R., DeMartin, R.,Hofer, E., and Fontana, A. (1988). Eur. J . Immunol. 18, 593-602. Siepl, C., Bodmer, S., Frei, K., MacDonald, H. R., DeMartin, R., Hofer, E., and Fontana, A. (1988). Eur. J. Immunol. 18, 593-602. Shu, S., and Rosenberg, S. A. (1985). Cancer Res. 45, 1657-1662. Shu, S., Chou, T., and Rosenberg, S. A. (1987).]. Immunol. 139, 295-304. Shu, S., Chou, T., and Sakai, K. (1989).J. Immunol. 143, 740-748. Smith, M. E., Marsh, S. G. E., Bodmer, J. G., Gelsthorpe, K., and Bodmer, W. F. (1989). Proc. NatZ. Acad. Sci. U.S.A. 86, 5557-5561.
174
CORNELIS J . M. MELIEF
Spiess, P. J., Yang, J. C., and Rosenberg, S. A. (1987).J. Natl. Cancer Inst. 79, 1067-1075. Spiess, T., Bresnahan, M., Bahram, S., Arnold, D., Blanck, G., Mellins, E., Pious, D., and d e Mars, R. (1990). Nature (London) 348, 744-747. Sporn, M. B., Roberts, A. B., Wakefield, L. M., and Assoian, R. K. (1986).Science 233,532534. Srivastava, P. K., and Old, L. J. (1988). Immunol. Today 9, 78-83. Srivastava, P. K., DeLeo, A. B., and Old, L. J. (1986).Proc. Natl. Acad. Sci. U.S.A. 83,3407341 1. Srivastava, P. K., Chen, Y.-T., and Old, L. J. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 3807381 1. Stam, N. J., Kast, W. M., Voordouw, A. C., Pastoors, L. B., Van der Hoeven, R. A., Melief, C. J. M., and Ploegh, H. L. (1989).J. Immunol. 142, 41 13-41 17. Sweetser, M. T., Braciale, V. L., and Braciale, T. (1989). J. Exp. Med. 170, 1357-1368. Szikora, J. P., van Pel, A., Brichard, V., Andre, M., Van Baren, N., Henry, P., De Plaen, E., and Boon, T. (1990). EMBOJ. 9, 1041-1050. Tanaka, K., Toshioka, T., Bieberich, C., and Jay, G. (1988).Annu. Reu. Immunol. 6,359-380. Teyton, L., OSullivan, D., Dickson, P. W., Lotteau, V., Sette, A., Fink, P., and Peterson, P. (1990). Nature (London) 348, 39-44. Topalian, S. L., Solomon, D., Avis, F. P., Chang, A. E., Freerksen, D. L., Kinekan, W. M., Lotze, M. T., Robertson, C. N., Seipp, C. A., Simon, P., Simpson, C. G., and Rosenberg, S. A. (1988).J . Clin. Oncol. 6, 839-853. Topalian, S. L., Solomon, D., and Rosenberg, S. A. (1989).J . Immunol. 142, 3714-3725. Topalian, S. L., Kasid, A., and Rosenberg, S. A. (1990).J. Immunol. 144, 4487-4495. Torre-Amione, G., Beauchamp, R. D., Koeppen, H., Park, B. H., Schreiber, H., Moses, H. L., and Rowley, D. A. (1990). Proc.Natl. Acad. Sci. U.S.A. 87, 1486-1490. Townsend, A. R. M., Gotch, F. M., and Davey, J. (1985). Cell 42, 457-467. Townsend, A. R. M., Rothbard, J., Gotch, F. M., Bahadur, G., Wraith, D., and McMichael, A. J. (1986). Cell 44,959-968. Townsend, A. R. M., Ohlen, C., Bastin, J., Ljunggren, H.-G., Foster, L., and Karre, K. (1989). Nature (London) 340, 443-448. Trowsdale, A., Hanson, l., Moskridge, I., Beck, S., Townsend, A., and Kelly, A. (1990). Nature (London) 348, 741-743. Ullrich, S. J., Robinson, E. A., Law, L. W., Willingham, M., and Appella, E. (1986). Pmc. Natl. Acad. Sn'. U.S.A. 83, 3121-3125. Urban, J. L., and Schreiber, H. (1988). Prog. Exp. Tumor Res. 32, 17-68. Van Bleek, G., and Nathenson, S. G. (1990). Nature (London) 348, 252-254. Van Denderen, J., van der Plas, D., Meeuwesen, T., Zegers, N., Boersma, W., Gorveld, G., and van Ewijk, W. (1990). Blood 76, 136-141. Van den Eynde, B., Hainaut, P. Herin, M., Knuth, A., Lemoine, C., Weynants, P. N., Van der Bruggen, P., Fauchet, R., and Boon, T. (1989). Int. J. Cancer 44, 634-640. Van Pel, A., Vessiere, F., and Boon, T. (1983).J. Exp. Med. 157, 1992-2001. Vasmel, W. L. E., Sits, E. J. A. M., Leupers, C. J. M., Matthews, E. A,, and Melief, C. J. M. (1989).J . Exp. Med. 169, 1233- 1254. Versteeg, R., Kriise-Wolters, K., Plomp, A. C., van Leeuwen, A., Stam, N. J., Ploegh, H. L., Ruiter, D. I., and Schrier, P. I. (1989a). .., I. Exg. ' Med. 170, 621-635. Versteeg, R., Feltenburg, L. C., Plomp, A. C., and Schrier, P. 1. (1989b).J. Immunol. 143, 4331-4337. Wahl, S. M., McCartney-Francis, N., and Mergenhagen, S. E. (1989). Immunol. Today 10, 258-261.
CYTOTOXIC T LYMPHOCYTES
175
Ward, P. L., Koeppen, H., Hurteau, T., and Schreiber, H. (1989).J. Exp. Med. 170, 217232. Weber, J. S., and Rosenberg, S. A. (1990).J. N a B Cancer Inst. 82, 755-761. Weil-Hillman, G., Fisch, P., Prieve, A. F., Sosman, J. A., Hauk, J. A,, and Sondel, P. M. (1989). Cancer Res. 49, 3680-3688. Weil-Hillman, G., Voss, S. D., Fisch, P., Schell, K., Hauk, J. A., Sosman, J. A,, Sugamara, K., and Sondel, P. M. (1990). Cancer Res. 50,2683-2691. Wolfel, T., Klehmann, E., Muller, C., Schutt, K. H., Meyer zum Buschenfelde, K. H., and Knuth, A. (1989).J. Exf. Med. 170, 797-810. Wraith, D. C. (1987). Immunol. Today 8, 239-246. Yamasaki, T., Handa, H., Yamashita, J., Watanabe, Y., Namiba, Y., and Hamaoka, M. (1984). Cancer Res. 44, 1776-1783. Yewdell, J. W., Benning, J. R., and Hosaka, Y. (1988). Science 239, 637-643. Young, R. A., and Elliott, T. J. (1989). Cell 59, 5-8. Zangermeister-Wittke, U., Kyewski, B., and Schirrmacher, V. (1989).J. Immunol. 143,379385. Zbar, B., and Rapp, H. J. (1974). Cancer Res. 34, Suppl., 1532-1540. Zinkernagel, R. M., and Doherty, P. C. (1974). Nature (London) 248, 701-702. Zinkernagel, R. M., and Doherty, P. C. (1979). Ads. Immunol. 27, 51-177. Zinkernagel, R. M., Leist, T., Hengartner, H., and Althage, A. (1985).J. Exp. Med. 162, 723-728. Zur Hausen, H. (1989). Cancer Rex 49, 4677-4681.
This Page Intentionally Left Blank
TOWARD A GENETIC ANALYSIS OF TUMOR REJECTION ANTIGENS Thierry Boon Ludwig Institute for Cancer Research, Brussels Branch, and Cellular Genetics Unit, Universitb Catholique de Louvain, 6-1200 Brussels, Belgium
I. Introduction A. Mouse Tumors Express Tumor Rejection Antigens B. Antigen Recognition by T Lymphocytes C. Biochemical Approaches to the Identification of Tumor Rejection Antigens 11. tum - Antigens: Genes, Mutations, and Antigenic Peptides A. tum- Variants B. tum- Antigens Recognized by CTLs C. Cloning of Genes Encoding tum- Antigens D. Genes and tum- Mutations E. Peptides and Role of Mutations F. Immune Surveillance and Tumor Rejection Antigens. 111. A Tumor Rejection Antigen of Tumor P815 A. Tumor Rejection Antigens Defined on PSI5 B. Absence of Mutation on Gene P I A C. Discussion IV. Antigens Recognized on Human Tumors by Autologous CTLs A. Human CTLs Directed against Autologous Melanomas B. Antigen-Loss Variants of Human Tumors V. Perspectives References
1. Introduction
This article is not intended as a general review of the antigens that are involved in tumor rejection. Many aspects of these antigens are very well summarized in the review by C. J. M. Melief in this volume. We present here an integrated account of a genetic approach to the identification of tumor rejection antigens, which has been pursued mainly in our laboratory. These results are presented in the context of the present understanding of antigen recognition by T lymphocytes.
177
178
THIERRY BOON
A. MOUSETUMORS EXPRESS TUMOR REJECTION ANTIGENS One of the major early achievements of tumor immunology was the demonstration that rodent tumors induced with chemical carcinogens elicit immune responses that lead to the rejection of secondary tumor grafts in syngeneic animals (Gross, 1943; Prehn and Main, 1957; Klein et al., 1960). T h e relevant antigens proved different for every tumor (Basombrio, 1970). They were named tumor-specific transplantation antigens (TSTAs) and similar antigens were observed on tumors induced by ultraviolet irradiation (Kripke, 1974). On the other hand, tumors such as spontaneous tumors appeared completely incapable of inducing immune rejection responses (Hewitt et al., 1976; Middle and Embleton, 1981). This raised the possibility that TSTAs might constitute a laboratory artifact restricted to tumors induced with very high doses of carcinogen. However, immunogenic tumor variants, which were derived from spontaneous tumors by mutagen treatment, proved capable of eliciting a specific immune protection against the original tumors. This demonstrated that spontaneous tumors also express antigens that are potential targets for immune responses even though they are not immunogenic (Van Pel et al., 1983). Similar results have been obtained recently by transfecting nonimmunogenic tumor cells with a gene coding for a viral antigen or with the gene encoding interleukin-2 (Fearon et al., 1988, 1990). We conclude that most if not all rodent tumors express antigens that can mediate immune elimination by the syngeneic hosts. These antigens show specificity for individual tumors, because immunization against one tumor usually does not protect against other syngeneic tumors. The response also shows obvious specificity for the tumor cells versus the normal cells for the host, because tumor rejection usually does not produce symptoms of autoimmune disease. However, it is not entirely clear to what extent these two elements of specificity must be absolute, as will be seen later. We therefore prefer the name “tumor rejection antigens” rather than “tumor-specific transplantation antigens.” Besides the tumors described above, the virus-induced mouse tumors also express specific antigens, but these antigens correspond to viral proteins. They have been observed with tumors induced by viruses such as papovaviruses, adenoviruses, and retroviruses (Khera et al., 1963; Sjogren et al., 1961; Klein and Klein, 1964). They are specific for the tumors induced by each particular virus and they can be recognized by cytolytic T lymphocytes (CTLs) (Leclerc et al., 1973; Weiss et al., 1980; Kast et al., 1989).
TUMOR REJECTION ANT I G E N S
179
It is now generally accepted that T lymphocytes are the key specific element of the specific immune responses directed against tumor rejection antigens (Rouse et al., 1972; Kripke and Fisher, 1976; Kripke, 1981). For several tumor systems, it is possible to obtain from syngeneic animals highly specific cytolytic T lymphocytes that can be used to define these antigens rigorously. In view of this, we will start with a brief summary of present concepts regarding antigen recognition by T lymphocytes. B. ANTIGEN RECOGNITION BY T LYMPHOCYTES Considerable progress has been achieved recently in our understanding of antigen recognition by T lymphocytes. Fifteen years ago, T lymphocytes were still believed to bind to antigenic determinants of cell surface molecules by an interaction resembling that of antibodies with their antigen. Then came the crucial discovery of major histocompatability complex (MHC) restriction, leading to the interpretation that the T cell receptor recognizes a complex between a “nominal” antigen and a surface protein encoded by the major histocompatibility complex (Zinkernagel and Doherty, 1974). And now it appears that the T cell receptor binds to a small antigenic peptide located in a groove of the MHC molecule. A most important consequence of this concept is that the antigens recognized by T cells are not limited to determinants of membrane proteins. The major histocompatibility complex and the structures of its major protein products are now known with a remarkable degree of precision both for mouse (H-2 complex) and for humans (HLA complex) (Bjorkman et al., 1987; Bjorkman and Parham, 1990). The MHC codes for two types of membrane-anchored molecules that are polymorphic, i.e., show a high degree of genetic variation (haplotypes). The class I molecules comprise one polymorphic chain, which contains three extracellular domains, associated with the invariant µglobulin chain. In most mouse inbred strains, there are two class I genes (K and D)in the MHC locus, but for some mouse strains, there is an additional gene ( L ) mapping near the D gene. In humans there are three polymorphic class I loci (A, B, and C). The second type of MHC product is the class I1 molecules, which are made of two associated polymorphic chains that ’One should, however, not completely exclude a role for autologous antibody responses in the elimination of tumors, as demonstrated by the results obtained by R. Levy and co-workers. They immunized mice with the idiotypic IgM of a syngeneic lymphoma and observed protection against a lethal tumor challenge (Campbell et al., 1987).
180
THIERRY BOON
each comprise two extracellular domains. They are encoded by Z-A and Z-E in the mouse and DP, DQ, and DR in humans (Fig. 1). Antigens of exogenous proteins are usually presented to T cells by macrophages and other antigen-presenting cells in association with class I1 MHC molecules (Fig. 1). There is now compelling evidence that presentation of these antigens involves endocytosis of the foreign protein, followed by endosomal degradation into short peptides (Allen et al., 1984; Shimonkevitz et al., 1983a,b).These peptides then bind to class I1 molecules and the complexes are transported to the cell surface (Babbitt et al., 1985; Buus et al., 1986, 1987).These MHC-peptide complexes are recognized by the receptor of T lymphocytes expressing the CD4 molecule, which probably binds a constant region of the class I1 molecule (Sprent and Webb, 1987) (Fig. 1). In contrast, endogenous antigens, i.e., antigens that are synthesized within the target cells, are usually recognized in association with class I MHC molecules (Fig. 1). Important examples of such endogenous antigens are viral antigens presented by infected cells, minor histocompatibility antigens, and tumor rejection antigens. For all these antigens, which are often recognized by cytolytic T cells, it was difficult to discard the long-standing notion that they must belong to surface molecules located on the plasma membrane of the target cell. However, studies on viral antigens recognized by CTLs demonstrated that these antigens could be derived from proteins that are devoid of a signal region (Townsend et al., 1985, 1986a). Moreover, synthetic peptides of 10 to 15 amino acids corresponding to short sequences of the viral proteins were found to render target cells sensitive to lysis by the appropriate CTL, presumably by binding directly to surface class I molecules (WabukeBunoti et al., 1984; Townsend et al., 1986b). These observations, have been extended to several other antigens and each antigenic peptide has been found to bind specifically to one of the two or three available types of class I molecules (Maryanski et aL, 1986; Koszinowski et al., 1987). Crystallographic studies of class I molecules have revealed that the two external domains, which carry most of the polymorphic amino acid residues, form a groove that appears well suited to house a short antigenic peptide (Bjorkman et al., 1987). Recent results suggest that the stability of the MHC molecules at the surface of the cell requires that they are complexed with an antigenic peptide (Townsend et al., 1989; Ljunggren et al., 1990).The T lymphocytes that recognize peptides on class I molecules express the CD8 surface molecule, which is thought to bind a constant region of the class I molecule (Parnes, 1989).MHC restriction is a consequence of the fact that given peptides bind preferentially to the products of some MHC haplotypes. It is probably also due to the joint
181
TUMOR REJECTION ANTIGENS
I
I1
antigen-presenting cell
I
8
messenger RNA
D
=
L M
virus
Chromosome17 ss
I human
FIG. 1 . T cell recognition and antigen presentation by class 1 and 11 MHC molecules.
182
THIERRY BOON
recognition of the antigenic peptide and the adjacent parts of the groove of the MHC molecule by the T cell receptor. Endogenous proteins, irrespective of their localization in the cell, can give rise to antigenic peptides presented on the surface of the cell by a class I molecule.
TO THE C. BIOCHEMICAL APPROACHES IDENTIFICATION OF TUMOR REJECTIONANTIGENS
Several viral antigens that induce tumor rejection have been identified with a great degree of precision, quite understandably so, because purified viral proteins and genomes are readily obtained. For Friend leukemia virus, gag- and env-encoded components are recognized by class I- and II-restricted lymphocytes (Klarnet et al., 1989).The product of adenovirus nuclear oncogene E I A is recognized by CTLs (Kast et al., 1989)and so is the nuclear antigen protein EBNAS of the Epstein-Barr virus (Burrows et al., 1990). In the two latter instances, antigenic peptides associated with class I molecules have been identified. The situation is, of course, much more difficult for the tumor rejection antigens, which are encoded by the cellular genome. Insofar as tumor rejection antigens are recognized by T cells and are therefore short antigenic peptides present on a small number of surface MHC molecules (Demotz et al., 1990), it is not surprising that no antibodies have been obtained against these antigens. Because of this, the relevant molecules cannot be isolated by immunoprecipitation. These endogenous molecules and their encoding genes have therefore remained largely unidentified. This applies not only to tumor rejection antigens but also to other transplantation antigens, such as minor histocompatibility antigens and male-specific antigen H-Y (Simpson, 1982). A very interesting biochemical approach to the isolation of T cellrecognized antigens has been initiated recently by Rammensee and coworkers. They have shown that protein extracts of target cells can be digested by endoproteases to yield peptides that sensitize cells to lysis by a CTL directed against minor histocompatibility antigen H-Yb (Wallny and Rammensee, 1990). Remarkably, they also found that by simple acid extraction of cells they could isolate “naturally occurring” minor histocompatibility peptides (Rotzschke et al., 1990). It appears likely that the extracted peptides are detached from the MHC molecule and that the concentration of free peptides occurring in normal cells is very low (Falk, 1990). A first contribution of this approach is that the natural peptides contained in the MHC molecule are relatively short: a major viral peptide was found to contain nine amino-acids. It is difficult to foresee at the
TUMOR REJECTION ANTIGENS
183
present stage whether this method will be applicable to the identification of new antigens encoded by the cellular genome. Biochemical fractionations of tumor cell extracts in order to obtain purified tumor rejection antigens have been attempted by several groups. The fractions were tested for their ability to immunize mice so as to make them resistant to tumor challenge. Thus, an immunogenic protein was isolated from MethA, a methylcholanthrene-induced sarcoma (Ullrich et al., 1986; Moore el al., 1987). This protein proved to be a heatshock protein. By a similar approach, two proteins have been isolated from two methylcholanthrene-induced sarcomas. Each induces an immunity that is specific for its sarcoma of origin. T h e genes coding for these proteins have been isolated, but the basis for the diversity of these antigens has not yet been elucidated (Srivastava et al., 1986, 1987, 1988). We will focus the present review on the possibility of using a direct genetic approach to identify tumor rejection antigens encoded by the cellular genome. We have studied extensively mouse tumor cell variants expressing the so-called tum- antigens, which arise as a result of in vitro mutagenic treatment of tumor cell lines. We describe below the analysis of the genes coding for these antigens and its implications for T cellmediated immune surveillance. We also describe a similar analysis of a gene coding for a tumor rejection antigen.
II. turn - Antigens: Genes, Mutations, and Antigenic Peptides
A. tum- VARIANTS When clonal mouse tumor cell lines are exposed in vitro to the mutagen N-methyl-”-nitrosoguanidine (MNNG), the surviving cell population contains variants that are unable to form progressive tumors in syngeneic animals (Boon, 1983). Because of this failure to produce progressive tumors, these variants have been named ‘‘turn-” in contrast to the original tumorigenic “tum cell line. The tum- variants have been obtained from many different mouse tumor cell lines, including a teratocarcinoma (Boon and Kellermann, 1977), Lewis lung carcinoma (Van Pel et al., 1979), mastocytoma P815 (Uyttenhove et al., 1980), radiation-induced or spontaneous leukemias (Van Pel and Boon, 1982; Van Pel et al., 1983), an adenoacanthoma (Frost et al., 1983), and other tumors (Bonmassar et al., 1970; Altevogt et al., 1985). Similar variants have also been derived from a guinea pig fibrosarcoma (Zbar et al., 1984). More recently, tum- variants were obtained by UV radiation (Hostetler et al., 1986). +
”
184
THIERRY BOON
T h e tum- variants are obtained at very high frequencies, ranging from 1 to 20% of the cells that survive mutagenesis. By repeating the mutagen treatment on the same tumor cell population, it is possible to increase the frequency even further. For instance, the frequency obtained with P815 was equal to 1,20, and 95% after one, three, and eight exposures to MNNG, respectively (Marchand et al., 1983). T h e tumphenotype is rarely absolute: most tum - variants produce progressive tumors in a small fraction of the injected animals, but these tumors usually appear much later than those produced by tum+ cells (Uyttenhove et al., 1980). T h e tum- variants are stable: they remain nontumorigenic during several months of continuous culture. Several lines of evidence indicate that the failure of tum- variants to form tumors is the consequence of an immune rejection response. T h e tum- variants form progressive tumors in mice that have been immunosuppressed by sublethal irradiation (Van Pel et al., 1979). When P815 tum- cells are injected intraperitoneally, they multiply exponentially for 12-15 days and are then eliminated in a few days in the middle of a large influx of lymphocytes and macrophages (Uyttenhove et al., 1980). In rejecting tum- variants, mice acquire an immune memory that enables them to resist to a challenge with the same variant even when they receive immunosuppressive irradiation concurrently (Boon and Kellermann, 1977; Van Pel et al., 1979; Uyttenhove et al., 1980). This immune memory can be transferred adoptively with T lymphocytes (Boon and Van Pel, 1978). B. tum- ANTIGENS RECOGNIZED BY CTLs Mice that have rejected a tum- variant usually present a higher degree of resistance against a challenge with the same variant than against any other tum- variant derived from the same tumor cell line (Boon and Van Pel, 1978). This was the first evidence that most tum- variants express new transplantation antigens that appear to be specific for each variant. We have analyzed in vitro the response directed against tum- .variants derived from mastocytoma P815, a tumor induced with methylcholanthrene in a DBAI2 mouse. A large number of tum- variants have been derived by mutagen treatment of clonal tum+ cell line P1 (Uyttenhove et al., 1980) (Fig. 2). When spleen cells of DBA/2 mice that have rejected a tum- variant are stimulated in vitro with the same variant, very active populations of CTLs are produced. These CTLs always exert some lysis on P1 cells, but for most tum- variants, this lysis is markedly lower than the lysis observed on the immunizing tum- variant
TUMOR REJECTION A N T I G E N S
185
(Boon et al., 1980). These results have been confirmed and extended by the clonal analysis of the CTLs (Maryanski et al., 1982). Limiting dilution experiments demonstrated unambiguously that some CTLs recognize antigens shared by the P815 turn+ cell and by all the tum- variants. These antigens are not present on other syngeneic tumors like L1210 or on normal DBA/2 lymphocytes. They represent, therefore, putative tumor rejection antigens. Other CTL clones recognize antigens that appear to be strictly specific for the immunizing tum- variant. These antigens were therefore named tum- antigens. The analysis of more than 15 independent tum- variants showed that none of their tumantigens was present on more than one variant, nor was any cross-reaction observed among these antigens. The repertoire of the tum- antigens is therefore almost certain to exceed 50 and may be larger by several orders of magnitudes (Boon et al., 1980; Boon, 1983). In this respect, the tum- antigens resemble the antigens observed on the methylcholanthrene-induced tumors. The availability of stable CTL clones provided a very important tool for the analysis of turn- antigens, namely the immune selection of antigen-loss variants (Maryanski and Boon, 1982; Maryanski et al., 1983). By incubation of some tum - variants with the appropriate anti-tum - CTL clones, stable secondary variants were selected that were resistant to the CTLs. In many instances, these cells were still sensitive to other CTL clones that were specific for the same tum- variant. These CTL clones were then used in turn to select resistant variants and the results indicated that tum- variants often express two or more tum- antigens that can be lost independently from each other. These experiments did not rule out that instead of having lost the “nominal” antigen, the resistant variants had lost the restricting H-2d molecule (Van Snick et al., 1982). However, because we almost always observed the loss of a single tumantigen without any loss of the four tumor rejection antigens of P815 (see below), we interpreted our results by the loss of the nominal antigen. As seen below, this interpretation has been confirmed by the recent genetic analysis. In addition, antigen-loss variants provided the proof that the turn antigens defined by CTLs were responsible for the immune rejection of the tum- variants. When antigen-loss variants selected in vitro were injected in DBA/2 mice, we observed that they had regained the ability to form progressive tumors (Maryanski et al., 1982). The converse was also observed: most of the rare tumors obtained after injection of tum variants were found to have become resistant to the CTL clones directed against at least one of the tum- antigens of the injected variants (Maryanski et al., 1983). These observations demonstrate beyond reasonable
186
h
il
I'
1 ;
n m
n
1
t
THIERRY BOON
2 h
r
k
1
TUMOR REJECTION ANTIGENS
187
doubt that antigens recognized by CTLs can be relevant in vivo and they justify the attempts to isolate the genes that code for these antigens. However, we d o not wish to imply that CTL responses are always essential for rejection. Actually, some observations suggest the opposite. First, tum - variants always elicit potent rejection responses but, in most tumor systems we observed little or not CTL response. T h e occurrence of a CTL response appears to depend entirely on the nature of the initial tumor. Moreover, even for the tum- variants derived from P815 we failed to detect a new antigen recognized by CTLs on about one-third of the variants (Boon, 1983). Perhaps these variants express new antigens that interact with nonlytic T lymphocytes. The stability of the tum- variants appeared to fit best with a genetic mutation or a genetic rearrangement. Their very high frequency implied that this genetic change must operate either on a hypervariable gene family or on a very large number of different, probably unrelated genes. Because w e could not obtain antibodies recognizing turn - antigens, we set out to clone the genes encoding these antigens. C. CLONING OF GENES ENCODING tum- ANTIGENS The expression of tum- antigens is dominant in somatic hybrids obtained by fusing the tum+ P1 cell with P815 tum- variants (Maryanski et al., 1983). This led us to try gene transfection as a first step in the cloning of genes coding for tum- antigens. The transfectability of genes coding for cell surface antigens recognized by antibodies was demonstrated by Kavathas and Herzenberg (1983). But we faced the obligation to detect our transfectants with CTLs, and this implied that the recipient cell must be a good target for CTLs and must express the same H-2 haplotype as P8 15. T h e fibroblast lines commonly used for DNA transfection by the calcium phosphate precipitation method (Graham and Van der Eb, 1973) are not very sensitive to CTL lysis. T h e tum+ P1 cell was ideal in this respect, but like most cells growing in suspension, it proved to be a very poor DNA recipient. We therefore selected from P1 a highly transfectable variant by repeated cycles of transfection with a thymidine kinase gene followed by bromodeoxyuridine selection to eliminate the transfected gene (Van Pel et al., 1985). We obtained a line that had a transfection efficiency of
FIG. 2. Tumor rejection antigens and turn - antigens present on the original P8 I5 cell line PI, o n tum- variants P35, P198, and P91, and on a P91 cell that escaped tumor rejection.
188
THIERRY BOON
approximately (i.e., 1 out of 104 cells takes up DNA) compared to less than lo-“ for the original cell. This line, which was named P1 .HTR (“Highly TRansfectable”), endocytoses calcium-precipitated DNA at least 10-fold better than P1 (Goethals et al., 1987). It was reasonable to expect that tum- antigens would be expressed by only one allele of the relevant genes. Considering the size of the mammalian genome (6 x lo6 kb) and the observation that recipients of calcium phosphate-precipitated DNA integrate on the average approximately 1000 kb (Perucho et al., 1980), it appeared that a minimum of 6000 transfectants would have to be screened. Testing all these transfectants individually for CTL lysis appeared impractical. We therefore explored the possibility of detecting transfectants by their ability to stimulate the proliferation of CTL clones directed against the relevant antigens. This was first applied to tum- antigen P91A. Anti-P91A CTL clones were identified that showed a considerable increase in proliferation when the proper target cell was present. Then, we found that mixtures made of cells that expressed the tum- antigen and of cells that did not (P1.HTR) at a 1:30 ratio provided a clearly detectable stimulation of these CTLs. On this basis we set out to cotransfect Pl.HTR with a selective plasmid conferring resistance to geneticin and with DNA of tumvariant P9 1. Geneticin-resistant transfectants were pooled in microcultures by groups of 30. After expansion, the microcultures were duplicated and they were tested for their ability to stimulate an anti-P91A CTL clone. Positive microcultures were found and transfectants expressing antigen P91A were recovered from the duplicate cultures. Seven independent transfectants were obtained from a total of 90,000 drugresistant transfectants (Wolfel et al., 1987). Their sensitivity to lysis by anti-P91A CTLs was similar to that of the original variants. Because we failed to recover the transfected gene of antigen P9 1A on the basis of its linkage with the cotransfected selective gene, we set out to repeat the transfection with DNA of cosmid libraries. A cosmid library was prepared with DNA of cells expressing antigen P91A (Fig. 3). This library, which was prepared with cosmid vector c2RB had to be amplified enormously (los times) to provide enough DNA for transfection. As shown in Table I, we obtained transfectants at a frequency that was of the same order as the theoretical frequency (De Plaen et al., 1988). This theoretical frequency is 1/ 150,000, because this number multiplied by the size of the average cosmid insert (40 kb) is equal to the size of the diploid genome. For the retrieval of the transfected ‘‘turn-” sequences, we benefited from an observation of Lau and Kan (1983), who demonstrated that a gene transfected in a cosmid can often be retrieved by directly packaging
189
TUMOR REJECTION ANTIGENS
do
COSmld library
I
turn' variant
40-kb Insert. 5 cosmlda = 00% complete library
7.10
Gploid genome : 6 . 1 8 kb]
1 copy of the tum' ellole
+
piasmld with selective marker nM
\
\
/
/
genomlc transfeclant, with an average of 1000 kb Integrated -6000 neOr transtectants to: screen to sample the genomlc DNA
l-l +-
cosmld transfectants, average Of 25 cosmlds Integratsd : 3x10' transfectants to screen to sample the library
near
E. coll
lambda phage components
Cloned tum- gene I neo
gene : selective marker turn- allele cos site : requlred for packaging
ot
DNA In phage lambda
FIG.3. Outline of the cloning of genes coding for turn- antigens.
190
THIERRY BOON
TABLE I FREQUENCIES OF TRANSFECTION AND COSMID RESCUEOBTAINED WITH VARIOUS ANTIGENS Cosmid recovery by direct DNA packaging of the DNA of transfectantsc
Antigen
Transfection with genomic DNA=
Transfection with cosmid library*
tumP91A P91B P35B P35A PI98
7/90,000 1/26,000 3135,000 0135,000 2/9000
21700,000 01 1,200,000 51700,000 01700,000 3/400,000
1 I3
Tumor rejection P1.A 3130.000
112,100,000
212
-
119 1 18
* Number of transfectants expressing the antigenlnumber of drug-resistant transfectants.
Number of independent cosmids transferring the antigenlnumber of independent cosmids in library. Number of cosmid transfectants from which a cosmid transferring the expression of the antigen was recovered/total number of tested cosrnid transfectants.
the DNA of the transfectant into lambda phage components (Fig. 3). In agreement with their observation, we found that this very simple procedure enabled us to isolate from some cosmid transfectants a cosmid transferring the expression of the tum- antigen (De Plaen et al., 1988). Once we had isolated a cosmid transferring the expression of antigen P91A, we proceeded to dissect the cosmid with restriction enzymes and to analyze the ability of restriction fragments to transfer the expression of the antigen. Surprisingly,we found that small fragments, of the order of 1000 bases, were capable of transferring antigen expression, even when they were not cloned in expression vectors. Later, it turned out that these fragments correspond to only a small part of the relevant genes and did not include the promoter. The transfection approach was extended to five additional antigens (Table I). For four of them, approximately 1 antigen-expressing transfectant per 10,000 geneticin-resistant transfectants were obtained with genomic DNA. But for one of them, no cell expressing the antigen was obtained among 35,000 drug-resistant transfectants. Cosmid transfectants were obtained for three of the five genes. The procedure that led to the isolation of a cosmid expressing tum- antigen P91A was applied with success to tum- antigens P35B and P198, which are expressed by ther P815 tum- variants (Szikora et al., 1990; Sibille et al., 1990).
TUMOR REJECTION ANTIGENS
191
The ability of small promoterless gene fragments to transfect the expression of tum- antigens was observed for the three tum- genes. This observation is not yet completely understood, but it proved extremely useful for the analysis of the tum- genes, because it led us quickly to the crucial regions of these genes. The availability of cosmids carrying the ‘‘turn-” genes enabled us to identify the restricting MHC elements. Fibroblasts of H-2k origin were transfected with either the Kd, Dd, or Ld gene. Stable clones that expressed one of these three MHC molecules were transfected with the cosmids harboring the tum- genes. For all three genes, only one of the three types of recipients was lysed by the appropriate CTL. The restricting elements of tum- antigens P91A, P35B, and P198 are Ld, Dd, and Kd, respectively.
D. GENESAND tum- MUTATIONS From the cosmid that transferred the expression of antigen P91A, a fragment of 800 bases was isolated that was sufficient for antigen expression. Northern blots probed with this fragment of gene P 9 I A revealed a single messenger RNA species of 2.2 kb. T h e band was of equal intensity for the mRNA of tum- variant P91 and for that of PI, which does not express the antigen (Lurquin et al., 1989). T h e expression of antigen P91A is therefore not due to the activation of a silent gene. The structure of gene P91A is shown in Fig. 4. It comprises 12 exons spread over 14 kb and it does not show any similarity with immunoglobulin, T cell receptor, or MHC genes (Lurquin et al., 1989). The complete sequence has been obtained. It is unrelated to any sequence presently recorded in the main data banks. Additional evidence for the relevance of this gene was provided by the study of three “escaping” tumors obtained with variant P9 1. These variants, which had lost the expression of gene P9IA, all showed deletions in the tum- allele of the gene (Lurquin et al., 1989). A sequence comparison of the normal and tum- alleles of gene P91A indicated that they differ by a point mutation in the exon, which is present in the transfecting 800-bp fragment (Fig. 4). This “turn-” mutation consists of a G to A transition that changes an arginine into a histidine in the product of the main open reading frame of the gene (De Plaen et al., 1988). This mutation appears to be the only difference distinguishing the normal from the antigenic allele. The study of the tum- alleles of genes P35B and P I 9 8 also revealed that they differ from their normal counterpart by a point mutation in an
192
THIERRY BOON
I
I
1
. I
2
11 .I 111 I
1
4 6
( 7
P35B
I
8 S l O t l
I A M :turn'
4
I
1
I
1 1 1 1 1 11
2 a4 5 8
7a
Thr : lum' 4
Pl98
P1A
1 I
h
2
1
1
%
IL.ulLeulHl~ 1ArQlTvr IS.rIL.u1GIu~Glu
Ah :PtA- B*
t
111.
IL.u~PIo~TvI~L.u~GIv~TID ILmuiVml IPhdA1mlv.l
ivml lThrlThr
ISerlPhel
15 nM
FIG. 4. Structure of genes P91A, P35B, P1Y8, and PZA. Dark boxes represent exons. The exon containing the tum- mutation is marked by an asterisk. Sections of the proteins located around the mutated amino acid are indicated. Synthetic peptides corresponding to the mutant and normal sequences of the genes are represented by boxes. For genes PYZA, P?5B, and PZY8, the peptides were tested for their ability to render P1.HTR cells susceptible to lysis by anti-turn- CTLs. The concentration indicated to the right of each peptide provided 50% of the lysis obtained at saturating concentration of peptide. For PZA, the peptide was tested for its ability to render PO.HTR cells susceptible to lysis by anti-P1A CTLs.
exon (Fig. 4). These genes are also expressed equally in P1 and in the relevant turn- variant. The general structures and the sequences of the three tum- genes isolated so far are completely unrelated. Like P91A, P35B and P198 show no homology to any gene presently recorded in data banks.
T U M O R REJECTION ANTIGENS
193
E. PEPTIDES AND ROLEOF MUTATIONS The main open reading frame of gene P91A encodes a protein of 60 kDa, which does not have a typical N-terminal signal sequence and is therefore unlikely to be borne by a membrane protein (Lurquin et al., 1989). This is hardly surprising, considering the demonstration that CTLs recognize influenza antigens corresponding to viral proteins that remain inside the cell (Townsend et al., 1986b). We examined whether we could identify a small peptide that would render P1 cells sensitive to lysis by anti-PgIA CTLs. In our search for this peptide we were guided by the location of the tum- mutation. A short peptide corresponding to the sequence surrounding this mutation made P1 cells sensitive to anti-P91A CTLs when it was incubated with these cells at a concentration around 10 nM (Fig. 4). In confirmation of our transfection experiments, studies with fibroblasts that expressed either Kd, Dd, or L" demonstrated that this P91A peptide is associated with Ld. Studies with P91A peptides enabled us to understand the role of the tum- mutation. A przori, this mutation could influence either the production of the antigenic peptide o r its ability to associate with the Ld molecule (i.e., the aggretope of the peptide) or also the epitope presented to T cells by the peptide-MHC complex. Having defined the antigenic P9 1A peptide, we prepared the homologous peptide corresponding to the normal allele of the gene. This normal peptide did not induce lysis by anti-P91A CTLs, nor did it compete with the mutant peptide. Moreover, we found that the mutant peptide competed effectively to prevent a cytomegalovirus-derived peptide from inducing lysis by CTLs directed against an Ld-associated cytomegalovirus antigen. The normal peptide did not compete, indicating that it did not bind to Ld (Lurquin et al., 1989). We conclude that the P91A tum- mutation generates the aggretope of the antigen, but we cannot exclude that it also influences the epitope. Antigenic peptides corresponding to the sequence surrounding the tum- mutation were also obtained for genes P35R and P198 (Fig. 4). They associate with Dd and Kd, respectively. For antigen P198, the effect of the mutation appears to be different from that of P91A: here a new epitope is introduced on a peptide that is already capable of binding to the Kd-presenting molecule. Presumably, the complex between this normal peptide and Kd corresponds either to a hole in the T cell repertoire or to T cell clones that have been deleted by natural tolerance. For antigen P35B, we were surprised to find that a peptide with the normal sequence provoked lysis, with a half-maximal value around 80 nM. However, no lysis was produced by a shorter peptide corresponding to the
194
THIERRY BOON
most active peptide derived from the mutant sequence. This suggests either that peptides active at concentrations above 80 nM do not have a physiological role or that not all possible peptides, in this instance the longer one, are produced.
F. IMMUNE SURVEILLANCE AND TUMOR REJECTION ANTIGENS The identification of tum- genes and mutations provides a solution to the paradox of tum- variants. They are stable because they are point mutants. They are extremely frequent and diverse because the tummutations arise in a large number of different genes. These mutations generate new antigenic peptides, either by enabling them to bind to an MHC class I molecule or by generating new epitopes on peptides that are already capable of binding, but are not recognized by the T cell repertoire, possibly because of natural tolerance. Point mutations generating new peptides are also involved in the generation of minor histocompatibility (mH) antigen MTF (Fischer Lindahl et al., 1991). MTF shows maternal inheritance, and was therefore rightfully assumed to be a mitochondrial product. Because of the small size of the mitochondrial genome (16 kb), the complete sequence of the DNA of different strains could be compared and a point mutation was shown to be responsible for the antigenic specificity (Loveland et al., 1990). A synthetic peptide was obtained that rendered cells susceptible to lysis by the appropriate anti-MTF CTL. Remarkably, the presenting molecule is a class I product encoded by a gene that maps outside the major histocompatibility complex. Our results suggest that mutations occurring throughout the mammalian genome, can produce new antigenic peptides recognized by some members of the adult T cell repertoire. There is thus an elaborate presentation mechanism that confers to T lymphocytes the potential to monitor the integrity of the mammalian genome. This provides a basis for the long-standing concept of immune surveillance (Burnet, 1970).In our opinion, however, it would be mistaken to believe that cells are eliminated whenever they acquire a mutation. It is likely that cells expressing a new antigen must accumulate into a large number before they can elicit a T cell response (Old and Boyse, 1964). Perhaps these cells must also express several new antigens, so that different T cells can reinforce each other, for instance by interleukin secretion. It is not obvious at all that the immune surveillance mechanism described above plays a significant role in the elimination of incipient tumors or in their retardation. And there is as yet no proof that a tumor
195
TUMOR REJECTION ANTIGENS
rejection antigen results from a point mutation. However, because this is definitely a possibility, it is worth considering how tumor rejection antigens could be produced by mutations. It is possible that some tumor rejection antigens are directly related to the oncogenic transformation, being derived from activated oncogenes or from transformation-induced proteins that are not expressed in normal cells (Fig. 5a). But there is also the possibility that, because carcinogens are mutagens, they induce on the target cells several mutations in addition to those that induce the oncogenic transformation (Fig. 5b). These mutations, which may
u
U
t
transformation
t
carcinogen -+ transformation
a
b
-
class I
MHC molecule
antigenlc
peptide
C
FIG. 5. Possible origin of tumor rejection antigens (TRA) resulting from somatic mutations.
C L anti-B anti-C
40
20 0
80 60 40
f f c7 P1 .iscA-B-
2ol 0
TARGETS anti-D
N
v)
0 0
P1 .iscC-
0
/
-,
i'
8 0 -
a
6 0 -
v,
4 0 -
$!
' I
jj 20
-
0 -
P1 .iscD-
1 0 P1 .istA-
20
O
f 7
A
C D
P1 .istA-B-
EFFECTOR / TARGET RATIO
TUMOR REJECTION ANTIGENS
197
occur on any gene, would be concomitant to the tumoral transformation but functionally unrelated. They would generate tumor rejection antigens that would be specific for every tumor. This would therefore explain readily the high diversity of tumor rejection antigens observed on methylcholanthrene-induced tumors. Finally, it is also possible that upon aging all our normal cells acquire mutations that generate new antigenic peptides. As long as these cells remain normal their clonal progeny may be sufficiently small to render negligible the probability that they encounter T lymphocytes directed against their antigen. However, whenever such a cell would become malignant and would generate a large homogeneous population, its antigen could elicit an immune rejection response (Fig. 5c). Here also the antigen would be individually specific for each tumor. These three possibilities for the origin of tumor rejection antigens are of course not mutually exclusive. Ill. A Tumor Rejection Antigen of Tumor .P815 A. TUMOR REJECTION ANTIGENS DEFINED ON P815 Clonal cell line P1, which was derived from tumor P815, expresses several antigens recognized by CTLs of the syngeneic DBAI2 mice. From mice immunized either with living cells of P815 tum- variants or with irradiated P1 cells, stable CTL clones were obtained that lyse P815 and do not lyse other syngeneic tumors or normal DBA/2 cells. A panel of these CTL clones was used to select in vztro resistant P1 cells. Antigenloss variants were obtained that were resistant to some of the CTLs and not to others (Fig. 6), so that three distinct antigens could be defined. We also observed that P 1 cells that are injected intraperitoneally sometimes undergo a nearly complete rejection followed by a long stationary state during which a low number of tumor cells survive in the peritoneal cavity. Eventually, the tumor cells always resume their growth and kill the animal (Fig. 7). This “tumor dormant state” has been observed in at least one other tumor system (Weinhold et al., 1979). When these escaping P815 cells were analyzed for their sensitivity to the panel of antiP815 CTLs, we found that one of the three antigens defined by in nitro selection could be “split”: one of the antigen-loss variants obtained in vivo (Pl.istA-) had lost only one of two antigens that were invariably lost
FIG. 6. Tumor rejection antigens identified with CTL clones on P815 cell line P1. Antigen-loss variants marked isc were selected in vitro with CTL clones. Those marked ist were recovered from tumors that escaped immune rejection in ziivo.
198
THIERRY BOON
5
10 15
20
25
30
35
40
45
50
55
60
65
70
75
80
DAYS AFTER INJECTION FIG.7. Tumor dormant state in mice that were injected i.p. with PI cells. Samples of the peritoneal fluid were collected at various times and the number of P1 cells was estimated in an agar colony assay. T h e cell population that eventually multiplied and killed the animal contained antigen-loss variants (ist) resistant to anti-P8 15 CTLs.
together in the antigen-loss variants selected in uitro. This brought the number of distinct P815 tumor rejection antigens to four: P815A, B, C, and D, A and B being usually lost together. The observation that P8 15A and B are lost by tumor cells that escape tumor rejection in vim provided a rigorous demonstration that these antigens play a significant role in the antitumoral response occurring in vivo. B. ABSENCE OF MUTATION ON GENEP l A
For the transfection of antigen PlA, we used as recipient cell a P1A-B- antigen-loss variant selected from line P1.HTR with an antiP1A CTL clone. Transfectants expressing antigen PlA were obtained with genomic DNA. All of them expressed P1B also. This confirmed the
TUMOR REJECTION ANTIGENS
199
close linkage between these two antigens and suggested that they were encoded by the same gene. Transfectants were then obtained with a cosmid library made with the DNA of a genomic transfectant, and from these we retrieved a cosmid that was able to transfer the expression of antigens PlA and P l B (Van den Eynde et al., 1991). Transfection studies carried out with fibroblasts expressing either Kd, Dd, or Ld demonstrated that antigens PlA and P l B were both presented to the CTLs by the Ld molecule. The structure and the complete sequence of gene PlA were obtained (Fig. 4). They proved completely different from those of the three tumgenes. No significant homology was found in gene data banks except with sequences that code for an acidic domain present in two nucleolar proteins. When we compared the sequence of gene P I A cloned from tumor cells to the sequence of the equivalent gene cloned from normal cells of the same mouse strain, we did not find any difference (Van den Eynde et al., 1991). To confirm this, we transfected the gene isolated from normal tissue and found that it transferred the expression of antigens PlA and P1B as readily as the gene cloned from P815 cells. The antigenicity is therefore not the result of a mutation affecting the gene expressed by the tumor. Because the antigenicity of gene PIA is not due to a point mutation, there was no easy guide in the search for the antigenic peptide. However, the analysis of the gene carried by the PlA-B+ antigen-loss variant indicated that it differed by a point mutation in exon 1. Synthetic peptides corresponding to the normal version of the sequences surrounding this mutation were prepared, and one of them proved capable of causing lysis by anti-P1A CTLs (Fig. 4). Surprisingly, this peptide also sensitized cells to the anti-P1B CTL. It remains to be seen whether these two CTLs recognize two different epitopes on the same peptide or whether the anti-A CTLs are more sensitive than the anti-B to a decrease in the affinity of the peptide for the Ld molecule. Such a decrease in affinity may be caused by the P1.A-B+ mutation. The expression of gene PIA has been analyzed by Northern blots. The level of transcription is high in P815 but it is undetectable in the normal tissues that were tested such as liver and spleen. Because P815 was originally described as a mastocytoma, we also tested a number of mast cell lines for the expression of the gene. Mast cell line M U 9 (Nabel et al., 1981) and short term cultures of mast cells.isolated form mouse bone marrow were negative on Northern blots. In contrast, a strong signal was obtained with L138.8A, a mast cell line derived from BALB/c bone marrow by culture in conditioned medium containing
200
THIERRY BOON
interleukin-3. We took advantage of the fact that BALB/c and DBA/2 mice share the H-2d haplotype to test the sensitivity of L138.8A to lysis by anti-P8 15 CTL clones. A high level of lysis was observed with anti-A and anti-B CTL. C. DISCUSSION
We conclude that tumor rejection antigens P815A and B result from the expression by tumor P815 of a gene that is either silent or expressed at a very low level in most if not all normal cells of adult mice. This suggests a correlation between the expression of gene P I A and the expression of the antigen, in contradiction with a hypothesis that we put forward (Boon and Van Pel, 1989). To the extent that tumor rejection antigens are generated by point mutations such as the tum- antigens, one expects these antigens to be strictly specific for individual tumors, as observed in methylcholanthrene-induced sarcomas (Basombrio, 1970). On the other hand, the finding that gene P I A carried by tumor P815 is identical to the gene carried by normal cells suggests that some tumor rejection antigens may be shared by independent tumors of the same histology. In agreement with this, we find that antigens P815A and B are shared by P815 and by mast cell line L138.8A, which is tumorigenic in DBA/2 mice. It is difficult at the present time to compare our results with those obtained for antigens of sarcoma MethA because these antigens were isolated on the basis of their ability to stimulate immune responses in vivo and not as targets of CTLs (Srivastava et al., 1986; Ullrich et al., 1986). More genes need to be analyzed before conclusions can be drawn. Mice that reject P815 cells do not present any obvious health impairment. How can antigens that are encoded by normal genes elicit an immune rejection response against the tumor without severe autoimmune consequences? A first explanation may be provided by the longstanding notion of “oncofetal”antigens, implying that tumors reexpress fetal antigens that disappeared from all normal cells before the establishment of natural tolerance. Hence the absence of tolerance and the absence of autoimmune consequences of the response, because no normal cell of the adult animal would express these antigens. An alternative possibility is that gene P l A is expressed by mast cell precursors located in the bone marrow at a brief stage of their differentiation. These cells would not by themselves induce an immune response either because of tolerance or because of their small number and dispersion. The antitumoral response might eliminate some of these precursor cells, but after the rejection of the tumor, the active effector T cells would become
TUMOR REJECTION ANTIGENS
20 1
resting memory cells and mast cell differentiation could resume without damage. It is worth pointing out that there is as yet no evidence that antigens P8 15A and B can elicit a T cell response on their own. P8 15 expresses at least two other antigens recognized by CTLs. One cannot exclude that a response against these antigens creates conditions that strongly facilitate the response against antigens A and B. This would be in line with the observation that tum - variants derived from nonimmunogenic tumors elicit a response directed against an antigen present on these tumors (Van Pel et al., 1983). We hope that the identification of genes coding for tumor rejection antigens will soon be extended to several other mouse tumors. It will be important to find out whether these antigens always result from the expression of a normal gene that is silent in most cells or whether mutations also contribute. It is also essential to realize that, in the absence of a mutation specific for the allele expressed by the tumor, the only evidence that an antigen defined as a CTL target plays a role in the rejection of the tumor is the correlation between resistance to this CTL and tumor escape in vivo (Uyttenhove et al., 1983). It is only because such evidence is clearly provided by antigen-loss variants for P815A and B that we can exclude that they are merely the targets of an artifactual autoimmune response favored by the conditions of mixed lymphocyte-tumor cell cultures. IV. Antigens Recognized on Human Tumors by Autologous CTLs Here, we will refer only to studies of antimelanoma autologous CTL responses, even though valuable studies of responses against other types of human tumors have been reported (Anichini et al., 1987; Hainaut et al., 1990). A. HUMAN CTLs DIRECTED AGAINST AUTOLOGOUS MELANOMAS Several studies of melanoma patients have shown that by cultivating peripheral blood lymphocytes in the presence of autologous melanoma cells, it is possible to obtain cytolytic T cells that show specificity for the tumor. Stable CTL clones have been obtained that lyse the autologous melanoma cells and do not lyse autologous EBV-transformed lymphoblastoid cells, autologous fibroblasts, o r targets of natural killer cells such as K562 (Fig. 8) (Mukherji and MacAlister, 1983; Knuth et al., 1984,
202
THIERRY BOON
7 0
W
6 0
v)
U rr! -I W
5 0 4 0
o autologous fibroblasts 0 allogeneic melanoma
U
b
l-
autologous melanoma autologous EBV lymphoblastoid cells
*
Ln
K562
30 20 10
0
1
1
0.1
1
1
10
1
0.3
1
3
-
1
1
1
1
1
0.1
0.3
1 10
3
EFFECTOR / TARGET RATIO FIG. 8. Specificity of two autologous CTL clones directed against human melanoma MZ2.
1989; Anichini et al., 1986; Herin et al., 1987; Degiovanni et al.. 1988). CTL clones of similar specificity have been derived from tumor-infiltrating lymphocytes (TILs) collected from melanoma tumors (Itoh et al., 1986; Muul et al., 1987). To exclude that these CTLs recognize. antigens that are culture artifacts, it is important to test their ability to recognize fresh tumor cells. This is difficult to demonstrate by lysis, because fresh tumor samples usually contain too much necrotic material and foreign tissue to give
T U M O R REJECTION ANTIGENS
203
interpretable results in chromium release tests. However, TILs derived from a melanoma were recently shown to lyse freshly thawed tumor cells (Topalian et al., 1989). In an alternative approach, evidence was recently obtained that melanoma cells freshly collected from a metastasis were capable of stimulating the proliferation of a CTL clone showing specificity for the primary tumor (Degiovanni et al., 1990).
B. ANTICEN-LOSS VARIANTS OF HUMAN TUMORS T h e availability of specific CTL clones opened the possibility of submitting tumor cells to immunoselection in vitro so as to obtain resistant variants. Knuth et al. (1989) isolated melanoma cells resistant to two different autologous antitumor CTL clones, by incubating tumor cells with CTLs for 6 h r at an effector to target ration of approximately 15. Stable, resistant tumor cell variants were obtained at a frequency of 1-5 x 10-6, but this frequency may have been increased by the 10-Gy irradiation received by the cells immediately before selection. Variants resistant to each CTL clone were still lysed by other CTL clones directed against the same tumor, so that at least three different antigens were defined on this melanoma. The three antigens are presented by HLAA2. Immunoselection also produced variants that had lost the expression of HLA-AP, confirming that this is another way to escape immune recognition (Wolfel et al., 1989). Interestingly, when autologous lymphocytes were stimulated in vitro with these HLA-A2 loss variants, new CTL clones were obtained that lysed these cells. They appear to be directed against an antigen, which is presented by an HLA-B molecule and which is produced by a gene that codes for one of the antigens recognized by HLA-A2. This was concluded because the resistance to the CTL directed against the latter results in resistance against the former. In another study, resistant melanoma variants were obtained by immunoselection with oligoclonal TIL-derived CTL populations (Topalian et al., 1990). T h e variants were sensitive to another TILderived CTL population from the same patient, suggesting that this tumor expressed at least two antigens recognized by autologous CTLs. We have carried out an extensive immunoselection study on another melanoma (Van den Eynde et al., 1989). This tumor presents two “unstable” antigens for which antigen-loss variants are found at very high frequency in the tumor cell population. In addition, a group of stable antigens was defined with a set of autologous CTLs. Antigen-loss variants for three different stable antigens were obtained by immunoselection with different CTL clones at frequencies that were difficult to estimate accurately but were lower than 10-6 (Fig. 9). One additional stable
i
I r
m
0
n
0
O
m
?
?
2
7r
!lE I
n
2;
nr
f
2-
I
0
I
n
0
n
m-
m
? m
0
0
m
?
?
> air
m
X SPECIFIC 51Cr RELEASE
TUMOR REJECTION ANTIGENS
205
antigen was recognized by another CTL, bringing the number of stable antigens to four. T h e main purpose of this analysis was to estimate the number of different stable antigens recognized on the tumor by autologous CTLs. To this end, 13 additional CTL clones directed against the stable antigens were analyzed for their activity on the immunoselected variants. All were found to be directed against one of the three antigens that could be eliminated by immunoselection, indicating that the number of stable antigens recognized on this tumor by autologous CTL is unlikely to exceed four. This does not prove that these antigens are specific for the tumor cells. However, we feel that their limited number is consistent with this notion, whereas a very large number would have suggested that these antigens are targets for an artifactual autoimmune response generated by the peculiar conditions of mixed lymphocytetumor cell culture. We have observed that several melanoma cell lines can undergo gene transfection at good frequencies. Antigen-loss variants may therefore prove useful as DNA recipients for a transfection approach to the cloning of the genes coding for human tumor antigens recognized by autologous CTLs. V. Perspectives Why make such an effort to identify tumor rejection antigens and the genes that encode them? One obvious answer is that once these antigens or their encoding genes are isolated, they can be used for active immunization to elicit antitumoral responses in cancer patients. I believe however, that the complete identification of putative tumor rejection antigens is essential at an earlier stage, namely to ascertain the concept of tumor rejection antigens and define its limits and possible usefulness. Clearly, if point mutations prove to be the major cause of new antigens on human tumor cells, then we can expect absolute specificity for the tumor versus the normal tissues of the patients, and the danger of generating an autoimmune response by hyperimmunizing against a tumor rejection antigen will probably be very low. On the other hand, we will face the need of characterizing one or several new tumor antigens for every patient. If, on the contrary, it turns out that most tumor rejection antigens are products of normal genes that are silent or almost silent in most normal cells, then we must consider carefully the danger that active immunization will generate autoimmune responses that may damage some normal cells. On the other hand, these normal gene products may provide the same tumor antigen on many different tumors, a possibility that could greatly simplify strategies of active immunotherapy.
206
THIERRY BOON
We do not wish to review here the various strategies for active antitumoral immunization. Suffice it to say that “tumor xenogenization,” i.e., addition of viral antigens to tumor cells, has been tested experimentally and is presently being tested on human patients (Kobayashi et al., 1975; Schirrmacher et al., 1989). T h e turn - mutants have been demonstrated experimentally to protect against the parental tumor (Boon and Van Pel, 1978; Uyttenhove et al., 1980; Van Pel et al., 1983), and similar results have been obtained with cells transfected with genes coding for a foreign antigen (Fearon et al., 1988). It is also quite likely that active immunization can profit greatly from interleukins that would be secreted directly by the immunizing cells or by cells injected together with these cells (Fearon et al., 1990). The identification of tumor rejection antigens will undoubtedly provide new possibilities, such as immunizing with cells that overexpress the antigen, and immunizing with purified peptide (Carbone and Bevan, 1989) or with antigen-presenting cells, such as dendritic cells, that have been pulsed with the peptide. When one considers moving from active immunization in animals to similar procedures in cancer patients, there is an important point that must not be overlooked. For experimental antitumoral immunization in animals, one usually immunizes a normal animal and the effect is evaluated by the resistance to a tumor cell challenge. For human patients, we will have to stimulate immune defenses of organisms that have often carried a large tumor burden. Establishment of immune tolerance may therefore have occurred and it may prevent immunization. As soon as we observed that teratocarcinoma-derived tum - variants could protect normal mice against a challenge with the nonimmunogenic initial tumor cells, we became concerned with this issue (Boon and Van Pel, 1978). But we were reassured, perhaps too quickly, by the observation that even those mice that had carried a large subcutaneous tumor, removed by surgery, could later be protected by the tum- variants (Boon et al., 1979). However, Bursuker and North (1984) found that the excision of large MethA tumors left the mice incapable of mounting an anti-MethA response for several weeks. Even if this proves to be an exception, it is still possible that effective immunization cannot proceed in the presence of residual tumor cells. And several lines of evidence suggest that large tumor burdens can tolerize or at least depress the capability to respond against the tumor. Caignard and Martin studied rat tumors wherein regressor variants had been isolated. They showed that these variants failed to be rejected in animals that had been previously injected with progressor cells and carried a tumor (Caignard et al., 1985). North demonstrated that tumor P815, lymphoma L51784, and other tumors generate suppressor T cells when the tumor reaches a certain size (North,
TUMOR REJECTION ANTIGENS
207
1985). T h e suppressor T cells, which appear to be of the CD4 type, can paralyze the anti-P815 response of mice that receive them by adoptive transfer. Some studies on allografts may also be very relevant to tumor immunology. Rosenberg finds that allografts differing from the recipient mouse by only one mHC antigen are not rejected (Rosenberg et al., 1987). However, if an H-Y difference is added by grafting male skin into females, the graft is readily rejected. T h e mice that have rejected these grafts are now very well protected against a challenge with the graft that differs only in the mHC. This appears to be in good agreement with the protection conferred by tum - variants against the original tumor. However, animals that have accepted and carry an mHC disparate graft cannot be protected by the mHC plus H-Y disparate graft against a new challenge with the singly disparate graft (Rees et al., 1990). This situation may be highly relevant to tumor immunology and suggests that we may have to break tolerance or some form of unresponsiveness in patients who carry a significant residual tumor burden at the time of immunization. REFERENCES
Allen, P. M., Strydom, D., and Unanue, E. R. (1984). Proc. Natl. Acad. Scz. U.S.A. 81,24892493. Altevogt, P., Von Hoegen, P., Leidig, S., and Schirrmacher, V. (1985).CancerRes. 45,42704277. Anichini, A., Fossati, G., and Parmiani, G. (1986).J. Exp. Med. 163, 683-689. Anichini, A,, Fossati, G., and F’armiani, G. (1987). Immunol. Toduy 8, 385-389. Babbitt, B., Allen, P., Matsueda, G., Haber, E., and Unanue, E. R. (1985).Nature (London) 317, 359-361. Basombrio, M. (1970). Cancer Res. 30, 2458-2462. Bjorkman, P. J., and Parham, P. (1990). Annu. Rev. Bzochem. 59, 253-288. Bjorkman, P. J., Saper, M. A., Samraoui, B., Bennett, W. S., Stroniinger, J. L., and Wiley, D. C. ( 1987). Nature (London) 329, 5 12-5 18. Bonmassar, E., Bonmassar, A., Vadlamudi, S., and Goldin, A. (1970). Proc. Natl. Acad. Scz. U.S.A. 66, 1089-1095. Boon, T. (1983). Adv. Cancer Res. 39, 121-151. Boon, T., and Kellermann, 0. (1977). Proc. Nutl. Acad. Sci. U.S.A. 74, 272-275. Boon, T., and Van Pel, A. (1978). Proc. Nutl. Acud. Sci. U.S.A. 75, 1519-1523. Boon, T., and Van Pel, A. (1989). Immunogenetics 29, 75-79. Boon, T., Van Pel, A., and Warnier, G. (1979). Protides Biol. Flutdc 27, 173-177. Boon, T., Van Snick, J., Van Pel, A., Uyttenhove, C., and Marchand, M. (198O).J.Exp. Med. 152, 1184-1 193. Burnet, F. M. (1970). Nature (London) 226, 123-126. Burrows, S. R., Sculley, T. B., Misko, I. S., Schmidt, C., and Moss, D. J. (199O).J.Exp. M e d . 171, 345-349. Bursuker, I., and North, R. J. (1984).J. Exp. Med. 159, 1312-1321. Buus, S., Sette, A,, Colon, S., Jenis, D., and Grey, H. M. (1986). Cell 47, 1071-1077.
208
THIERRY BOON
Buus, S., Sette, A., Colon, S., Miles, C., and Grey, H. M. (1987). Science 235, 1353-1358. Caignard, A., Martin, M. S., Michel, M. F., and Martin, F. (1985). Int. J. Cancer 36, 273279. Campbell, M. J., Carroll, W., Shinichiro, K., Thielemans, K., Rothbard, J. B., Levy, 5,and Levy, R. (1987).J. Immunol. 139,2825-2833. Carbone, F. R., and Bevan, M. J. (1989).J. Exp. Med. 169,603-612. Degiovanni, G., Lahaye, T., Herin, M., Hainaut, P., and Boon, T. (1988).Eur.J. Immunol. 18,671-676. Degiovanni, G . , Hainaut, P., Lahaye, T., Weynants, P., and Boon, T. (1990).Eur.J. Immunol. 20, 1865-1868. Demotz, S., Grey, H. M., and Sette, A. (1990). Science 249, 1028-1030. De Plaen, E., Lurquin, C.. Van Pel, A., Mariame, B., Szikora, J. P., Wolfel, T., Sibille, C., Chomez, P., and Boon, T. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 2274-2278. Falk, K., Rotzschke, O., and Rammensee, H . 4 . (1990). Nature (London) 348, 248-251. Fearon, E., Itaya, T., Hunt, B., Vogelstein, B., and Frost, P. (1988). Cancer Res. 48, 29752980. Fearon, E. R., Pardoll, D. M., Itaya, T., Golumbek, P., Levitsky, H. I., Simons, J. W., Karasuyama, H., Voelstein, B., and Frost, P. (1990). Cell 60, 397-403. Fischer Lindahl, K., Hermel, E., Loveland, B. E., and Wang, C.-R. (1991). Annu. Rev. Immunol. 9, 351-372. Frost, P., Kerbel, R., Bauer, E., Tartamella-Biondo, R., and Cefalu, W. (1983). Cancer Res. 43, 125-132. Goethals, A., Courtoy, P., Lurquin, C., Van Pel, A., De Plaen, E., Boon, T., and Baudhuin, P. (1987). Arch. Intern. Physiol. Biochzm. 95, B202. Graham, F., and Van der Eb, A. (1973). Virology 54, 456-467. Gross, L. (1943). Cancer Res. 3, 326-333. Hainaut, P., Weynants, P., Coulie, P. G., and Boon, T. (1990). Immunol. Allergy Clin. North Am. '10,639-661. Herin, M.,Lemoine, C., Weynants, P., Vessiere, F., Van Pel, A., Knuth, A., Devos, R.,and Boon, T. (1987). Int. J . Cancer 39, 390-396. Hewitt, H., Blake, E., and Walder, A. (1976). Br. J. Cancer 33, 241-259. Hostetler, L. W., Ananthaswamy, H. N., and Kripke, M. L. (1986).J. Immunol. 137, 27212725. Itoh, K., Tilden, A. B., and Balch, C. M. (1986). Cancer Res. 46, 3011-3017. Kast, W. M., Offringa, R.,Peters, P. J., Voordouw, A. C., Meloen, R. H., van der Eb, A. J., and Melief, C. J. M. (1989). Cell 59, 603-614. Kavathas, P., and Herzenberg, L. A. (1983). Proc. Nutl. Acad. Scz. U.S.A. 80, 524-528. Khera, K. S., Ashkenasi, A., Rapp, F., and Melnick, J. L. (1963).J. Immunol. 91, 604-613. Klarnet, J. P., Kern, D. E., Okuno, K., Holt, C., Lilly, F., and Greenber, P. D. (1989).J. Exp, Med. 169,457-467. Klein, E., and Klein, G. (1964).J. Natl. Cancer Inst. 32, 547-568. Klein, G., Sjogren, H., Klein, E., and Hellstrom, K. E. (1960). CancerRes. 20, 1561-1572. Knuth, A., Danowski, B., Oettgen, H. F., and Old, L. (1984).Proc. Natl. Acad. Sci. U.S.A. 81, 35 11-35 15. Knuth, A., Wolfel, T., Klehmann, E., Boon, T., and Meyer zum Biischenfelde, K.-H. (1989). Proc. Natl. Acad. U.S.A. 86, 2804-2808. Kobayashi, H., Gotohda, E., Hosokawa, M., and Kodama, T. (1975).J. Nutl. Cancerlnst. 54, 997-999. Koszinowski, U. H., Reddehase, M. J., Keil, G. M., and Schickedanz, J. (1987).J. Virol. 61, 2054-2058.
TUMOR REJECTION ANTIGENS
209
Kripke, M. L. (1974). J. Natl. Cancer Inst. 53, 1333-1336. Kripke, M. L. (1981). Adv. CancerRes. 34, 69-106. Kripke, M. L., and Fisher, M. S. (1976).J. Natl. Cancerlnst. 57, 211-215. t a u , Y.-F., and Kan, Y. W. (1983). Proc. Natl. Acad. Sci. U.S.A. 80, 5225-5229. Leclerc, J. C., Gomard, E., Plata, F., and Levy, J. P. (1973). Int. J. Cancer 11, 426-432. Ljunggren, H.-G., Stam, N. J., Ohlen, C., NeefJes, J. J., Hoglund, P., Heemels, M.-T., Bastin, J., Schumacher, T. N. M., Townsend, A., Karre, K., and Ploegh, H. L. (1990). Nature (London) 346, 476-480. Loveland, B., Wang, C. R., Yonekawa, H., Hermel, E., and Fischer Lindahl, K. (1990). Cell 60,971-980. Lurquin, C., Van Pel, A., MariamC, B., De Plaen, E., Szikora,J.-P., Janssens, C., Reddehase, M. J., Lejeune, J., and Boon, T. (1989). Cell 58, 293-303. Marchand, M., Caspar, P., and Boon, T. (1983). Eur.1. Cancer Clin. Oncol. 19, 1529-1537. Maryanski, J. L., and Boon, T. (1982). Eur. J. Immunol. 12, 406-412. Maryanski, J. L., Van Snick, J., Cerottini, J.-C., and Boon, T. (1982). Eur. J . Immunol. 12, 40 1-406. Maryanski,J. L., Szpirer, J., Szpirer, C., and Boon, T. (1983).Somatic Cell Genet. 9,345-357. Maryanski, J. L., Pala, P., Corradin, G., Jordan, B. R., and Cerottini, J.-C. (1986). Nature (London) 324, 578-579. Middle, J.. and Embleton, M. (1981).J. Natl. Cancer Inst. 67, 637-643. Moore, S. K., Kozak, C., Robinson, E. A., Ullrich, S. J., and Appella, E. (1987). Gene 56,2940. Mukherji, B., and MacAlister, T..]. (1983). 1. Exp. Med. 158, 240-245. Muul, L M., Spiess, P. J., Director,-E. P., and Rosenberg, S. A. (1987).J. Immunol. 138,989995. Nabel, G., Fresno, M., Chessman, A,, and Cantor, H. (1981). Cell 23, 19-28. North, R. J. (1985). Adv. Cancer Res. 45, 1-40. Old, L. J., and Boyse, E. A. (1964). Annu. Rm. Med. 15, 167-186. Parnes, J. R. (1989). Adv. Immunol. 44,265-31 1 . Perucho, M., Hanahan, D., and Wigler, M. (1980). Cell 22, 309-317. Prehn, R. T., and Main, J. M. (1957).J. Natl. Cancer Inst. 18, 769-778. Rees, M. A., Rosenberg, A. S., Munitz, T. I., and Singer, A. (1990). Proc. Natl. Acad. Sci. U S A . 87, 2765-2769. Rosenberg, A. S., Mizuochi, T., Sharrow, S. O., and Singer, A. (1987).J. Exp. Med. 165, 1296-13 15. Rotzschke, O., Falk, K., Wallny, H.-J., Faath, S., and Rammensee, H.-G. (1990). Science 249, 283-287. Rouse, B. T., Rollinghoff, M., and Warner, N. L. (1972). Nature (London), New Biol. 238, 116-117. Schirrmacher, V., Hoegen, P. V., Schlag, P., Liebrich, W., Lehner, B., Schumacher, K., Ahlert, T., and Bastrt, G. (1989).In “Cancer Metastasis. Molecular and Cellular Biology, Host Immune Response and Perspectives for Treatment” (V. Schirrmacher and R. Schwartz-Albiez, eds.), pp. 157- 169. Springer-Verlag, Berlin. Shimonkevitz, R., Colon, S., Kappler, J., Marrack, P., and Grey, H. M. (1983a).J.Immunol. 133, 2067-2074. Shimonkevitz, R., Kappler, J., Marrack, P., and Grey, H. (1983b).J. Exp. Med. 158, 303316. Sibille, C., Chomez, P., Wildmann, C., Van Pel, A., De Plaen, E., Maryanski, J. L., de Bergeyck, V., and Boon, T. (199O).J. Exp. Med. 172, 35-45. Simpson, E. (1982). Immunol. Today 3, 97-106.
210
THIERRY BOON
Sjogren, H. O., Hellstrom, I., and Klein, G. (1961). Exp. Cell Res. 23, 204-208. Sprent, J., and Webb, S. R. (1987). Adv. Immunol. 41, 39-133. Srivastava, P. K., Deleo, A. B., and Old, L. J. (1986). Proc. Natl. Acad. Scz. U.S.A. 83,34073411. Srivastava, P. K., Chen, Y.-T., and Old, L. J. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 3807381 1 . Srivastava, P. K., Kozak, C. A., and Old, L. J. (1988). Immunogenetzcs 28, 205-207. Szikora, J. P., Van Pel, A., Brichard, V., Andre, M., Van Baren, N., Henry, P., De Plaen, E., and Boon, T. (1990).E M B O J . 9, 1041-1050. Topalian, S. L., Muul, L. M., Solomon, D., and Rosenberg, S. A. (1987).J. Immunol. Methoh 102, 127-141. Topalian, S. L., Solomon, D., and Rosenberg, S. A. (1989).J. Immunol. 142, 3714-3725. Topalian, S. L., Kasid, A., and Rosenberg, S. A. (1990).J. Immunol. 144, 4487-4495. Townsend, A., Gotch, F., and Davey, J. (1985). Cell 42,457-467. Townsend, A,, Bastin, J., and Brownlee, G. (1986a). Nature (London) 324, 575-577. Townsend, A,, Rothbard, J., Gotch, F., Bahadur, G., Wraith, D., and McMichael, A. (1986b). Cell 44, 959-968. Townsend, A,, Ohlen, C., Bastin, J., Ljunggren, H. G., Foster, L., and Karre, K. (1989). Nature (London) 340, 443-448. Ullrich, S. J., Robinson, E. A., Law, L. W., Willingham, M., and Appella, E. (1986). Proc. Natl. Acad. U.S.A. 83, 3121-3125. Uyttenhove, C., Van Snick, J., and Boon, T. (1980).J. Exp. Med. 152, 1175-1183. Uyttenhove, C., Maryanski, J., and Boon, T. (1983).J. Exp. Med. 157, 1040-1052. Van den Eynde, B., Hainaut, P., Herin, M., Knuth, A., Lemoine, C., Weynants, P., van der Bruggen, P., Fauchet, R., and Boon, T. (1989). Int. J. Cancer 44, 634-640. Van den Eynde, B., Lethe, B., Van Pel, A,, De Plaen, E., and Boon, T. (1991).J. Exp. Med. 173, 1373-1384. Van Pel, A., and Boon, T. (1982). Proc. Natl. Acad. Scj. U.S.A. 79, 4718-4722. Van Pel, A., De Plaen, E., and Boon, T. (1985). Somatic Cells Mol. Genet. 11, 467-475. Van Pel, A., Georlette, M., and Boon, T. (1979). Proc. Natl. Acad. Sci. U.S.A. 76,5282-5285. Van Pel, A., Vessiere, F., and Boon, T. (1983).J. Exp. Med. 157, 1992-2001. Van Snick, J., Maryanski, J. L., Van Pel, A., Parmiani, G., and Boon, T. (1982). Eur. J. Immunol. 12, 905-908. Wabuke-Bunoti, M., Taku, A., Fan, D., Kent, S., and Webster, R. G. (1984).J. Immunol. 133, 2194-2201. Wallny, H.-J., and Rammensee, H.-G. (1990). Nature (London) 343, 275-277. Weinhold, K., Miller, D., and Wheelock, E. (1979). 1. Exp. Med. 149, 745-757. Weiss, A,, Brunner, K., Macdonald, R.,and Cerottini, J. C. (1980).J. Exp. Med. 152, 12101225. Wolfel, T., Van Pel, A., De Plaen, E., Lurquin, L., Maryanski, J. L., and Boon, T. (1987). Immunogenetics 26, 178- 187. Wolfel, T., Klehmann, E., Miiller, C., Schutt, K.-H., Meyer zum Biischenfelde, K.-H., andKnuth, A. (1989).J. Exp. Med. 170, 797-810. Zbar, B., Sukumar, S., Tanio, Y., Terata, N., and Hovis, J. (1984). Cancer Res. 44, 50795085. Zinkernagel, R. M., and Doherty, P. C. (1974). Nature (London) 248, 701-702.
INDEX
A Acquired immune deficiency syndrome (AIDS), Epstein-Barr virus genes and, 2-3 Activator protein 1 (AF'l), G protein signal transduction and, 80 Acyclovir, Epstein-Barr virus genes and, 21 Adenovirusinduced tumors, cytotoxic T lymphocytes and, 157-158 Adenylyl cyclase, G protein signal transduction and, 77,80-82,84-87 Adoptive transfer of cytotoxic T lymphocytes, tumor eradication by, see Cytotoxic T lymphocytes ADP ribosylation, G protein signal transduction and, 82 AIDS, Epstein-Barr virus genes and, 2-3 Alleles central nervous system tumor oncogenesis and, 128,133-134 cytotoxic T lymphocytes and, 160-161 Epstein-Barr virus genes and, 20 muscle cell regulation and, 107 Raf-1 phosphorylation and, 68 tumor rejection antigens and, 191, 193, 201 Amino acids cytotoxic T lymphocytes and, 144, 147, 150, 158 Epstein-Barr virus genes and, 7 muscle cell regulation and, 99-100, 103-104 Raf-1 phosphorylation and, 63, 65
transforming growth factora and, 30-32,34,36 tumor rejection antigens and, 180, 182 Amphiregulin, transforming growth factora and, 28, 37 Anaplastic astrocytoma, oncogenesis of, 124-125 Angiogenesis, transforming growth factora and, 47 Antagonism, muscle cell regulation and, 108-114 Antibodies central nervous system tumor oncogenesis and, 138 cytotoxic T lymphocytes and, 148, 150-151, 162, 167 Epstein-Barr virus genes and, 17-18 G protein signal transduction and, 79 monoclonal, see Monoclonal antibodies transforming growth factor-a and, 45 tumor rejection antigens and, 187 Antigen-presenting cells, tumor rejection antigens and, 180,206 Antigens cytotoxic T lymphocytes and, 143-145, 167 escapes of tumor cells from immune T cells, 160-161, 163 immunogenicity of tumors, 145-150, 152 melanoma antigens, 166-167 virus-induced tumors, 154, 156, 159 Epstein-Barr virus genes and, 4-7, 9-16, 18-2 1
21 1
212
INDEX
Antigens (continued) tumor rejection, see Tumor rejection antigens Astrocytoma, oncogenesis of, 122-125, 131-133 ATP, Raf-1 phosphorylation and, 64 Autologous CTLs, tumor rejection antigens and, 201-205 Autologous tumor specificity, cytotoxic T lymphocytes and, 166-167 5-Azacytidine, muscle cell regulation and, 97
BumHI, Epstein-Barr virus genes and, 5, 7, 10, 12,15-16 B cells, cytotoxic T lymphocytes and, 151 BC3H 1, muscle cell regulation and, 10&107,112 bHLH region, muscle cell regulation and, 100,104-105,113 BHRFl protein, Epstein-Barr virus genes and, 4 , 9 , 15-16 B lymphocytes, Epstein-Barr virus in, see Epstein-Barr virus genes Bombesin, G protein signal transduction and, 8 5 8 7 Burkitt’s lymphoma, Epstein-Barr virus genes and, 2
C Calcium G protein signal transduction and, 84-86 Raf-1 phosphorylation and, 60 transforming growth factor4 and, 35, 48 tumor rejection antigens and, 188 Calrnodulin-dependent kinase 11, muscle cell regulation and, 112 CAMP,see Cyclic AMP Carcinogens cytotoxic T lymphocytes and, 151-152, 159, 161, 164 tumor rejection antigens and, 178, 195 Casein kinase I1 G protein signal transduction and, 78-80
muscle cell regulation and, 112 CAT, Epstein-Barr virus genes and, 6 7 , 15
CD3 cytotoxic T lymphocytes and, 155 Raf-1 phosphorylation and, 59 CD4 cytotoxic T lymphocytes and, 167 clinical results of adoptive therapy, 164-166 escapes of tumor cells from immune T cells, 161-162 immunogenicity of tumors, 146, 153 virus-induced tumors, 154-1 57 Raf-1 phosphorylation and, 58,67 tumor rejection antigens and, 180,207 CD8 cytotoxic T lymphocytes and, 166-168 clinical results of adoptive therapy, 164-166 escapes of tumor cells from immune T cells, 160-1 62 immunogenicity of tumors, 146, 152-154 virus-induced tumors, 154-159 tumor rejection antigens and, 180,207 CD21, Epstein-Barr virus genes and, 6-7 CD23, Epstein-Barr virus genes and, 6, 8 cdc 2 kinase, muscle cell regulation and, 112 cDNA central nervous system tumor oncogenesis and, 135-1 36 cytotoxic T lymphocytes and, 163 Epstein-Barr virus genes and, 8, 10-12, 16 muscle cell regulation and, 97-100 transforming growth factora and, 30, 47 Cell adhesion molecules, transforming growth factora and, 37 Central nervous system tumor oncogenesis, 121-122 gene alterations, 132-137 histopathology, 122-123, 129-132 molecular genetic analysis, 123-128 comparisons to histopathology, 129-132 implications for treatment, 137-139 Cervical carcinoma, cytotoxic T lymphocytes and, 157 c-fos, G protein signal transduction and, 79 Chemical carcinogens, tumor rejection antigens and, 178
INDEX
Chemically induced tumors, cytotoxic T lymphocytes and, 148-149, 152, 161 Cholera toxin, G protein signal transduction and, 82-83 Chromatography, Raf-1 phosphorylation and, 62 Chromosomes central nervous system tumor oncogenesis and, 124-126, 128-129, 131-1 34,137-138 Epstein-Barr virus genes and, 2-3,9, 17 muscle cell regulation and, 107, 114 Raf-1 phosphorylation and, 53 c-jun, G protein signal transduction and, 79,83 Clones central nervous system tumor oncogenesis and, 121 cytotoxic T lymphocytes and clinical results of adoptive therapy, 165 escapes of tumor cells from immune T cells, 162 immunogenicity of tumors, 146147 melanoma antigens, 166167 virus-induced tumors, 155-160 Epstein-Barr virus genes and, 10-12, 15, 18 G protein signal transduction and, 75, 82,86 muscle cell regulation and, 97 transforming growth factora and, 28, 30 tumor rejection antigens and autologous CTLs, 201-203,205 P815, 197-199 tum- antigens, 183-191, 197 c-myc cytotoxic T lymphocytes and, 157, 161 G protein signal transduction and, 79, 83 muscle cell regulation and, 110-1 11 Colony stimulating factor-1 G protein signal transduction and, 78 transforming growth factora and, 37 Colony-stimulating factor receptor, Raf-1 phosphorylation and, 56, 67, 70 Cosmids, tumor rejection antigens and, 188,190-191, 199 Cp, Epstein-Barr virus genes and, 11-12, 14 CR1, Raf-1 phosphorylation and, 59-60
213
CR2 Epstein-Barr virus genes and, 3-4 Raf-1 phosphorylation and, 59-60 c-rm, G protein signal transduction and, 78-79 CREB, see Cyclic AMP responsive element binding protein Cross-linking, Raf-1 phosphorylation and, 58,67 CT26 cells, cytotoxic T lymphocytes and, 153 Cyclic AMP, G protein signal transduction and, 82-84,87 Cyclic A M P responsive element binding protein (CREB) G protein signal transduction and, 80, 83 muscle cell regulation and, 112 Cyclophosphamide, cytotoxic T lymphocytes and, 156, 159, 161-162, 166 Cysteine Raf-1 phosphorylation and, 60 transforming growth factora and, 28, 31,37 Cytolytic T lymphocytes, tumor rejection antigens and, 178-180, 182 P815, 197-201 recognition, 201-205 turn- antigens, 186188,193 Cytomegalovirus. tumor rejection antigens and, 193 Cytoplasm central nervous system tumor oncogenesis and, 136 cytotoxic T lymphocytes and, 145, 147 Epstein-Barr virus genes and, 8, 15 Raf-1 phosphorylation and, 66, 69 transforming growth factor- and, 30-31,37-38,45 Cytotoxic T lymphocytes Epstein-Barr virus genes and, 3, 19-20 tumor eradication by adoptive transfer of, 167-168 antigen recognition, 144-145 chemically induced tumors, 148-149 clinical results, 163-166 escapes from immune T cells, 160-1 63 immunogenicity of tumors, 145-146 melanoma antigens, 166-167 mutagenized tumors, 149-151
214
INDEX
Cytotoxic T lymphocytes (continued) spontaneous tumors, 151-154 T cell immunity, 143-144 UV-light induced tumors, 148-149 virus-induced tumors, 146148, 154-160
D DBA/2 mice, tumor rejection antigens and, 184-185, 197,200 Demethylation, muscle cell regulation and, 97,107 Diacylglycerol (DG), G protein signal transduction and, 84,88 Differentia tion muscle cell regulation and, 95-97, 114 tumor rejection antigens and, 200-201 DNA central nervous system tumor oncogenesis and, 127-128, 135-136 Epstein-Barr virus genes and, 2, 4 5 , 7 G protein signal transduction and, 83, 86,87 muscle cell regulation and, 97, 99, 101-104,107,109-112 Raf-1 phosphorylation and, 69 transforming growth factora and, 34 tumor rejection antigens and, 187-188, 190, 198-199,205 DNA polymerase, Epstein-Barr virus genes and, 15 Drosqphila, muscle cell regulation and, 100, 103
E EBERS, 4,9-10,17 EBNAs, see Epstein-Barr nuclear antigens Embryogenesis, muscle cell regulation and, 106, 108 Endocytosis cytotoxic T lymphocytes and, 144 tumor rejection antigens and, 180, 187 Endosomes cytotoxic T lymphocytes and, 144-145 transforming growth factora and, 35
enV
cytotoxic T lymphocytes and, 146 tumor rejection antigens and, 182 Enzymes Epstein-Barr virus genes and, 15 G protein signal transduction and, 76, 78, 80, 88 Raf-1 phosphorylation and, 54,59-60, 65,67 tumor rejection antigens and, 190 Epidermal growth factor G protein signal transduction and, 78-79 physiology of,28-30, 37-40, 42 tumor development, 44-46, 48 Epidermal growth factor receptor central nervous system tumor oncogenesis and, 124-127, 129, 134-138 physiology of, 34-36, 40 Raf-1 phosphorylation and, 67, 70 Epithelium Epstein-Barr virus genes and, 1-2, 4, 11, 21 G protein signal transduction and, 83 Raf-1 phosphorylation and, 56 transforming growth factora and, 38, 40-42 tumor development, 44-47 Epitopes cytotoxic T lymphocytes and, 146148 tumor rejection antigens and, 193, 199 Epstein-Barr nuclear antigens (EBNAs), 4-7,10-21 cytotoxic T lymphocytes and, 146147 tumor rejection antigens and, 182 Epstein-Barr virus, cytotoxic T lymphocytes and, 146147 Epstein-Barr virus genes, B lymphocytes and expression EBERS, 9-10 membrane proteins, 8-9 nuclear antigens, 4-7 history of virus, 1-4 LCL model, 17-21 transcription EBNA genes, 10-15 viral membrane proteins, 15-17 Estrogen, transforming growth factora and, 40
215
INDEX
F FBL-3, cytotoxic T lymphocytes and, 146, 155-157 Fibroblast growth factor G protein signal transduction and, 78, 85 muscle cell regulation and, 108 Fibroblast growth factor receptor, Raf-1 phosphorylation and, 56 Fibroblasts G protein signal transduction and, 76, 83-87 muscle cell regulation and, 97-100, 107, 109,112 Raf-1 phosphorylation and, 56 transforming growth factora and, 43-44, 4647 tumor rejection antigens and, 191, 193, 20 1 fos, G protein signal transduction and, 80 Friend leukemia virus cytotoxic T lymphocytes and, 146, 155-157,162 tumor rejection antigens and, 182
G gag cytotoxic T lymphocytes and, 146 tumor rejection antigens and, 182 GDP, G protein signal transduction and, 80 Gene amplification, central nervous system tumor oncogenesis and, 126, 129, 131, 136 Gene dosage, central nervous system tumor oncogenesis and, 126,129 Gene expression Epstein-Barr virus genes and, 6, 11, 17-21 G protein signal transduction and, 80, 83 muscle cell regulation and, 104, 106107, 111 Raf-1 phosphorylation and, 70 tumor rejection antigens and, 192, 199 Genes, muscle cell regulation and, 96, 98, 100-105, 108-111, 113 Genetic analysis, Epstein-Barr virus genes and, 5
Genetic characterization of CNS tumor oncogenesis, see Central nervous system tumor oncogenesis Glioblastoma, oncogenesis of, 122-124, 126, 129, 135-138 Glioma cytotoxic T lymphocytes and, 159 oncogenesis of, 122,124, 126127, 128, 133-1 35 Glycosylation, transforming growth factora and, 32,36 G phase, G protein signal transduction and, 77,80 G protein signal transduction, 75-76, 89-90 liganddependent tyrosine kinase activity, 76-80 receptors, 80-83 CAMP,83-84 oncogenes, 87-88 oncogenic mutations, 84 phosphatidylcholine breakdown, 8889 stimulation of cell proliferation, 84-87 Granulocyte/macrophage colonystimulating factor (GM-CSF), Raf-1 phosphorylation and, 58 Growth factor receptors, Raf-1 phosphorylation and, 66-68, 70 Growth factors cytotoxic T lymphocytes and, 153 G protein signal transduction'and, 76, 8489 muscle cell regulation and, 96, 98, 108-114 physiology of, 28-30, 40-41 Raf-1 phosphorylation and, 54-59, 69-70 GTP, G protein signal transduction and, 75, 79-80 GTPase-activatingprotein (GAP) G protein signal transduction and, 78-79 Raf-1 phosphorylation and, 67-68,70 GTPases, G protein signal transduction and, 75, 79-80
H Haplotypes, tumor rejection antigens and, 179-180, 187,200
216
INDEX
Heat-shock proteins cytotoxic T lymphocytes and, 148, 151 tumor rejection antigens and, 183 Helix-hoophelix (HLH) proteins, muscle cell regulation and, 100-103, 105, 108-114 Heparin-binding EGF-like growth factor (HBEGF), physiology of, 28,37 Heterokalyon, muscle cell regulation and, 100,107 Heterozygosity, central nervous system tumor oncogenesis and, 124-125, 128, 131 Heterozygosity,loss of, central nervous system tumor oncogenesis and, 128, 132-134, 137 Histopathology, central nervous system tumor oncogenesis and, 122-123, 129-133, 137 HLA cytotoxic T lymphocytes and, 161 Epstein-Barr virus genes and, 20 tumor rejection antigens and, 179 HLA-A2 cytotoxic T lymphocytes and, 144, 166 tumor rejection antigens and, 203 HLH proteins, muscle cell regulation and, 100-103, 105, 108-114 Homology cytotoxic T lymphocytes and, 150, 157 Epstein-Barr virus genes and, 5 , 7, 9 muscle cell regulation and, 99-100 Raf-1 phosphorylation and, 59,64,67 transforming growth factor- and, 29 tumor rejection antigens and, 192-193 Hormones G protein signal transduction and, 76, 80, 82, 86, 89 transforming growth factor-a and, 43 Hybridization central nervous system tumor oncogenesis and, 136 Epstein-Barr virus genes and, 15-16 muscle cell regulation and, 98 transforming growth factora and, 3&39,41-43 tumor rejection antigens and, 187 Hydrophobicity Epstein-Barr virus genes and, 9 transforming growth factor- and, 30
Hypercalcemia, transforming growth factora and, 35,48
I ICAM-1, Epstein-Barr virus genes and, 8,20 Id, muscle cell regulation and, 109-110 Immortalization Epstein-Barr virus genes and, 3, 5-7, 17, 19,21 muscle cell regulation and, 97 transforming growth factora and, 44, 46 Immune surveillance, tumor rejection antigens and, 194-195, 197 Immune T cells, escapes of tumor cells from, 160-163 Immunization, tumor rejection antigens and, 178,183,185,205-207 Immunofluorescence Epstein-Barr virus genes and, 8-10, 18 Raf-1 phospholylation and, 69 transforming growth factor- and, 32 Immunogenicity of tumors, cytotoxic T lymphocytes and, 145-154, 160, 165 Immunoglobulin Epstein-Barr virus genes and, 2 muscle cell regulation and, 101-102 tumor rejection antigens and, 191 Immunoselection, tumor rejection antigens and, 203,205 Immunosuppression cytotoxic T lymphocytes and, 149, 161, 163 Epstein-Barr virus genes and, 3 tumor rejection antigens and, 184 Infectious mononucleosis, Epstein-Barr virus genes and, 1, 18,20 Inflammation, transforming growth factora and, 39-40 Inhibitors central nervous system tumor oncogenesis and, 134, 138 cytotoxic T lymphocytes and, 162 G protein signal transduction and, 75, 79-82,84-87 muscle cell regulation and, 97, 101, 1 0 6 114 Raf-1 phosphorylation and, 56 transforming growth factor-a and, 27, 43,46
INDEX
in situ hybridization Epstein-Barr virus genes and, 15 transforming growth factora and, 38-39,41 Insulin recptor, Raf-1 phosphorylation and, 56,64 Interferon, central nervous system tumor oncogenesis and, 129, 134, 137-138 In terferon-7 cytotoxic T lymphocytes and, 153-157 transforming growth factora and, 39 Interleukin, tumor rejection antigens and, 194,206 Interleukin-2 cytotoxic T lymphocytes and, 167 clinical results of adoptive therapy, 163-166 escapes of tumor cells from immune T cells, 162-163 immunogenicity of tumors, 152-153 virus-induced tumors, 154-159 Raf-1 phosphorylation and, 58-59 tumor rejection antigens and, 178 Interleukin-3 Raf-1 phosphorylation and, 58-59, 69 tumor rejection antigens and, 199-200 Interleukin4, Raf-1 phosphorylation and, 54
J jun, G protein signal transduction and, 80
K Karyotypes, central nervous system tumor oncogenesis and, 121 Keratinocytes, transforming growth factora and. 38-41
t Latent membrane protein (LMP), EpsteinBarr virus genes and, 2,4-8, 15-16, 19-20 LCLs, see Lymphoblastoid cell lines Leader protein, Epstein-Barr virus genes and, 13
217
Leukemia central nervous system tumor oncogenesis and, 121 Friend virus-induced, cytotoxic T lymphocytes and, 155-157, 162 tumor rejection antigens and, 183 Leukocytes, Epstein-Barr virus genes and, 17-18 LFA-1, Epstein-Barr virus genes and, 20 LFA-3, Epstein-Barr virus genes and, 8, 19-20 Ligands central nervous system tumor oncogenesis and, 126,136 G protein signal transduction and, 75-80 Raf-1 phosphorylation and, 53, 56 transforming growth factor-a and, 35-38,45-46 Lipids, Raf-1 phosphorylation and, 69 Long terminal repeats, Raf-1 phosphorylation and, 60, 62 Loss of heterozygosity, central nervous system tumor oncogenesis and, 128, 132-134, 137 Lymphoblastoid cell lines (LCLs), EpsteinBarr virus genes and, 3-4, 6, 12, 14, 1621 Lymphoblastoid cells, tumor rejection antigens and, 201 Lymphocytes, see also Cytotoxic T Iymphocytes; Epstein-Barr virus genes, B lymphocytes and; T lymphocytes tumor rejection antigens and, 182, 184-185, 201, 205 Lymphokine-activated killer cells, cytotoxic T lymphocytes and, 163-167 Lymphokines, cytotoxic T lymphocytes and, 152, 157, 163 Lymphomas Epstein-Barr virus genes and, 9 tumor rejection antigens and, 206 Lymphoproliferation, Epstein-Barr virus genes and, 2-3 Lysosomes, transforming growth factorand, 35
Macrophages cytotoxic T lymphocytes and, 156-157
218
INDEX
Macrophages (continued) transforming growth factor- and, 40-41 tumor rejection antigens and, 180,184 Major histocompatibility complex (MHC) cytotoxic T lymphocytes and, 143-145, 166,168 immune T cells, 160-161, 163 immunogenicity of tumors, 145-149, 151-1 52 results of adoptive therapy, 164-165 virusinduced tumors, 154, 156-157, 159 tumor rejection antigens and, 179-180, 182,191, 193-194 Malignancy central nervous system tumor oncogenesis and, 122-124, 132-134,137 cytotoxic T lymphocytes and, 166-167 muscle cell regulation and, 95 tumor rejection antigens and, 197 Mammary glands, transforming growth factor- and, 42-43 Mast cells, tumor rejection antigens and, 199-20 1 Master growth factors, G protein signal transduction and, 89 Medulloblastomas, oncogenesis of, 127, 131-132, 134 MEF2, muscle cell regulation and, 105 Melanoma cytotoxic T lymphocytes and, 152-153, 159, 164-167 tumor rejection antigens and, 201-203, 205 Membrane proteins, Epstein-Barr virus genes and, 8-9 MethA, tumor rejection antigens and, 183, 200,206 Me thylcholan threne cytotoxic T lymphocytes and, 159, 161 tumor rejection antigens and, 183-185, 197,200 N-Methyl-N’-nitrosoganidine (MMNG), tumor rejection antigens and, 183-184 Minor histocompatibility antigens, tumor rejection antigens and, 194, 207 Mitogen-activated protein kinase, G protein signal transduction and, 78-79
Mitogens G protein signal transduction and, 76, 78-79,84-88 muscle cell regulation and, 108-110 Raf-1 phosphorylation and, 53-54,58, 63,69 transforming growth factor- and, 38, 45 Mitosis Epstein-Barr virus genes and, 18 Raf-1 phosphorylation and, 64 Molecular genetic characterization of CNS tumor oncogenesis, see Central nervous system tumor oncogenesis Monoclonal antibodies central nervous system tumor oncogenesis and, 138 cytotoxic T lymphocytes and, 155, 161 Epstein-Barr virus genes and, 4 , Q Raf-1 phosphorylation and, 64 Mononucleosis, infectious, Epstein-Barr virus genes and, 1, 18, 20 Morphology central nervous system tumor oncogenesis and, 122 Epstein-Barr virus genes and, 2, 7, 18 muscle cell regulation and, 98 Raf-1 phosphorylation and, 69 mRNA central nervous system tumor oncogenesis and, 136 Epstein-Barr virus genes and, 6, 12, 15-16 muscle cell regulation and, 96 transforming growth factora and, 30, 39-42,44 tumor rejection antigens and, 191 MTF, tumor rejection antigens and, 194 Muscle cell regulation, 95-96, 114 growth factor signals, 108-109 HLH proteins inactivation of, 109-1 13 inhibition of cell proliferation, 113-114 MyoD family activation by cDNAs, 97-100 expression, 106-107 related factors, 100-102 transcription, 102-106 myogenic regulatory genes, 9 6 9 7 rhabdomyosarcoma, 114
219
INDEX
Muscle creatine kinase (MCK), muscle cell regulation and, 100-101, 103, 105-106, 109, 111 Mutagenesis muscle cell regulation and, 101 Raf-1 phosphorylation and, 60, 64-65 tumor rejection antigens and, 183-184, 195 Mutagenized tumors, cytotoxic T lymphocytes and, 149-151 Mutation central nervous system tumor oncogenesis and, 123, 132-134 cytotoxic T lymphocytes and, 149-151, 158, 167 Epstein-Barr virus genes and, 5, 14 G protein signal transduction and, 78-79,84,87,90 muscle cell regulation and, 103-104, 109, 113 Raf-1 phosphorylation and, 59-60, 63-66,68 tumor rejection antigens and, 205 P815,198-201 turn- antigens, 191, 193-195, 197 mYC
central nervous system tumor oncogenesis and, 127 Epstein-Barr virus genes and, 2, 19 muscle cell regulation and, 100-101 myd, muscle cell regulation and, 98 Myoblasts, muscle cell regulation and, 96-98,107-108,110 MyoD family of muscle-specific regulatory factors, see Muscle cell regulation Myogenesis, muscle cell regulation and, 96-100, 102-103, 108-114 Myogenin, muscle cell regulation and, 99, 101-1 13 Myxomavirus growth factor (MGF), physiology of, 28
Nasopharyngeal carcinoma (NPC), Epstein-Barr virus genes and, 2 , 4 Natural killer cells cytotoxic T lymphocytes and, 152-153, 160,163-165 tumor rejection antigens and, 201
Neoplasia central nervous system tumor oncogenesis and, 121-122, 126-129, 132, 134 transforming growth factor-a and, 4 6 4 7 Neovascularization, transforming growth factor-a and, 47-48 Neurotransmitters, G protein signal transduction and, 80, 85 NFB cells, muscle cell regulation and, 107 Nominal antigens, tumor rejection antigens and, 185 Non-Hodgkin's lymphoma, cytotoxic T lymphocytes and, 166 Nucleotides muscle cell regulation and, 102, 105 Raf-1 phosphorylation and, 64
0 Oligonucleotides central nervous system tumor oncogenesis and, 136 muscle cell regulation and, 106 Oncogenes cytotoxic T lymphocytes and, 167 Epstein-Barr virus genes and, 19 G protein signal transduction and, 84-85,87-90 muscle cell regulation and, 97, 99-100, 108 Fbf-1 phosphorylation and, 53-55, 59, 63,68-69 transforming growth factor-a and, 43-44 tumor rejection antigens and, 195 Oncogenesis central nervous system tumors and, see Central nervous system tumor oncogenesis Open reading frames Epstein-Barr virus genes and, 10, 13 tumor rejection antigens and, 191, 193 m y , Epstein-Barr virus genes and, 5 , 11, 19
P P1 cells, tumor rejection antigens and, 197 P l A genes, tumor rejection antigens and, 198-200
220
INDEX
P815, tumor rejection antigens and, 196-201,206 tum- antigens, 184-185, 187 Parathyroid hormone, transforming growth factor-a and, 48 Peptides cytotoxic T lymphocytes and, 144-145, 166-168 immunogenicity of tumors, 145-151, 154 virus-induced tumors, 157-158 G protein signal transduction and, 86 muscle cell regulation and, 96, 110 Raf-1 phosphorylation and, 62-64,66 transforming growth factor-a and, 29-30,32,36,39 tumor rejection antigens and, 179-180, 182,206 P815, 199 tum- antigens, 193-194 Pertussis toxin, G protein signal transduction and, 82,85,87-88 Phenotype cytotoxic T lymphocytes and, 154, 160 Epstein-Barr virus genes and, 2, 7-8, 19-20 G protein signal transduction and, 84, 86 muscle cell regulation and, 95-97, 103, 110,114 Raf-1 phosphorylation and, 63,68 transforming growth factor-a and, 43, 46-48 Phosphatidylcholine, G protein signal transduction and 88-89 Phosphatidylcholine-phospholipaseC ( P C PLC), G protein signal transduction and, 83,88-89 Phosphatidylcholine-phospholipaseD (PCPLD), G protein signal transduction and, 88-89 Phosphoinositide, G protein signal transduction and, 78-79,82-86,8849 Phosphoinositide-Skinase, G protein signal transduction and, 78 Phosphoinositide-specific phospholipase C (PI-PLC), G protein signal transduction and, 76-77,81-83,85-88 Phospholipase A,, G protein signal transduction and, 80-81,83,88 Phospholipase C, Raf-1 phosphorylation and, 65-67, 70
Phospholipase C-Z, G protein signal transduction and, 78,84,87 Phospholipase D, G protein signal transduction and, 83 Phospholipids, Raf-1 phosphorylation and, 60 Phosphonoacetic acid, Epstein-Barr virus genes and, 15 Phosphopeptides, Raf-1 phosphorylation and, 62-63,65-66 Phosphorylation Epstein-Barr virus genes and, 8 G protein signal transduction and, 78, 80,84-85 muscle cell regulation and, 111-1 12 of Raf-1, see Raf-1 phosphorylation transforming growth factor-a and, 44 P3HR-1 virus, Epstein-Barr virus genes and, 5, 7, 9, 15 Pl.HTR, tumor rejection antigens and, 188,198 Pilocytic astrocytomas, oncogenesis of, 131-132, 134 Plasmids, Epstein-Barr virus genes and, 4 Platelet-derived growth factor G protein signal transduction and, 78, 83,87-88 Raf-1 phosphorylation and, 65, 69 transforming growth factor-a and, 45 Plateletderived growth factor receptor central nervous system tumor oncogenesis and, 127 Raf-1 phosphorylation and, 5 8 , 6 6 6 7 Polymerase chain reaction Epstein-Barr virus genes and, 21 transforming growth factor-a and, 41 Polymorphism cytotoxic T lymphocytes and, 144 tumor rejection antigens and, 179-180 Polyomavirus, cytotoxic T lymphocytes and, 147 Polypeptides, transforming growth factorand, 27-30,37,48 Pregnancy, cytotoxic T lymphocytes and, 163 Proliferation central nervous system tumor oncogenesis and, 123,126128, 132, 138 cytotoxic T lymphocytes and, 163 Epstein-Barr virus genes and, 3, 19
22 1
INDEX
G protein signal transduction and, 83-89 muscle cell regulation and, 95-96, 108111, 113-114 Raf-1 phosphorylation and, 69 transforming growth factora and, 2728,34,38-40,42 tumor development, 45 tumor rejection antigens and, 188 Proteases, transforming growth factora and, 30, 32, 45 Protein central nervous system tumor oncogenesis and, 127,138 cytotoxic T lymphocytes and, 144-147, 150-151,157 Epstein-Barr virus genes and, 2, 4-10, 15-16, 18-20 G protein signal transduction and, see G protein signal transduction muscle cell regulation and, 96, 98-99, 101-106, 108-114 Raf-1 phosphorylation and, see Raf-1 phosphorylation transforming growth factora and, 2729, 37, 39-41 tumor rejection antigens and, 179-180, 183, 193, 195, 199 Protein kinase, Raf-1 phosphorylation and, 53,70 Protein kinase A G protein signal transduction and, 80, 83-84,87 muscle cell regulation and, 111 Protein kinase C G protein signal transduction and, 7980,88-89 muscle cell regulation and, 111-1 12 Raf-1 phosphorylation and, 56, 60, 62, 64 transforming growth factor-a and, 32, 40 Protein tyrosine kinases (PTKs), Raf-1 phosphorylation and, 54, 56, 58-59, 66-67 Proteolytic cleavage, transforming growth factora and, 30-32 Protooncogenes, cytotoxic T lymphocytes and, 157, 161 PSK, Raf-1 phosphorylation and, 62-63 Psoriasis, transforming growth factora and, 39 PTKs, see Protein tyrosine kinases
R Raf-1 phosphorylation, 70 activation, 54 modes, 56-59 PTKs, 59 consequences activated receptor complexes, 66-68 signaling cascade, 68-69 substrates, 69-70 rufoncogene family, 53-55 sites, 59-62 serine/threonine, 62-65 tyrosine, 65-66 ras
G protein signal transduction and, 76, 79 muscle cell regulation and, 100, 112, 114 Raf-1 phosphorylation and, 68 transforming growth factor-a and, 43-45 Recombination, Epstein-Barr virus genes and, 5, 10 Replication, Epstein-Barr virus genes and, 4 5 , 9, 17 Restriction fragment length polymorphism, central nervous system tumor oncogenesis and, 128-129,138 Retinoblastoma central nervous system tumor oncogenesis and, 128,133 cytotoxic T lymphocytes and, 157 G protein signal transduction and, 76 muscle cell regulation and, 112 Rhabdomyosarcoma, muscle cell regulation and, 114 RNA Epstein-Barr virus genes and, 4, 9-1 1, 13, 15-17,Zl transforming growth factor-a and, 39, 41 tumor rejection antigens and, 191 RNA polymerase, Epstein-Barr virus genes and, 4, 17
5 Sarcomas, tumor rejection antigens and, 183, 200 Secondary messengers G protein signal transduction and, 83-84 Raf-1 phosphorylation and, 67-68
222
INDEX
Sequences central nervous system tumor oncogenesis and, 136138 cytotoxic T lymphocytes and, 146, 150 Epstein-Barr virus genes and, 4, 7-8, 13, 15-16 G protein signal transduction and, 86 muscle cell regulation and, 99, 101-102, 104, 111 Raf-1 phosphorylation and, 60,62-67 transforming growth factora and, 28-29,37,43,47 tumor rejection antigens and, 188, 191-194,197 Serine phosphorylation, G protein signal transduction and, 79 Serine residues, Raf-1 phosphorylation and, 54, 56, 60, 64-65, 70 Serine/ threonine kinase G protein signal transduction and, 78 Raf-1 phosphorylation and, 66 Serine/threonine phosphorylation, Raf-1 and, 53-54,56,58-59,62-65 Serum response factor, G protein signal transduction and, 79-80 Shope fibroma growth factor (SFGF), physiology of, 28 Signal transduction G protein-controlled, see G protein signal transduction Raf-1 phosphorylation and, see Raf-1 phosphorylation S6 kinase, G protein signal transduction and, 78-79 S phase, G protein signal transduction and, 77,80 Spontaneous tumors, cytotoxic T lymphocytes and, 151-154 Suppressor cells cytotoxic T lymphocytes and, 154, 161-162 tumor rejection antigens and, 207
T T cell clones, cytotoxic T lymphocytes and, 155-158 T cell receptor cytotoxic T lymphocytes and, 144-145
Raf-1 phosphorylation and, 59 tumor rejection antigens and, 179, 182, 191 T cells, see also Cytotoxic T lymphocytes Epstein-Barr virus genes and, 4 Raf-1 phosphorylation and, 58-59 tumor rejection antigens and, 177, 179-180 autologous CTLs, 201 P815,200-201 tum- antigens, 193-194 Threonine phosphorylation, see also Serine/threonine phosphorylation G protein signal transduction and, 79 Threonine residues muscle cell regulation and, 112 Raf-1 phosphorylation and, 64-65,70 Thrombin, G protein signal transduction and, 85-87,89 Tissue specificity, muscle cell regulation and, 104,107 T lymphocytes cytotoxic, see Cytotoxic T lymphocytes tumor rejection antigens and, 177, 179-182 tum- antigens, 184, 187, 194, 197 TP1, Epstein-Barr virus genes and, 4, 8, 16 TP2, Epstein-Barr virus genes and, 4,8, 16 TPA Epstein-Barr virus genes and, 15 Raf-1 phosphorylation and, 59, 62, 65 transforming growth factora and, 32,40 Transcription central nervous system tumor oncogenesis and, 123,127-1 28 Epstein-Barr virus genes and, 4, 7,9-17, 21 G protein signal transduction and, 76, 79-80,84 muscle cell regulation and, 96, 98, 100106, 110-114 Raf-1 phosphorylation and, 53-54,69-70 transforming growth factor- and, 41, 44 Transforming growth factora, 27-28 central nervous system tumor oncogenesis and, 127 growth factor family, 28-30 physiology of normal cells, 38-41 receptor, 34-36 role in normal development, 41-43
223
INDEX
structure, 30-34 transmembrane precursor, 3 6 3 8 tumor development, 43-48 Transforming growth factor43 cytotoxic T lymphocytesand, 162-163,167 muscle cell regulation and, 108, 110, 112 Translation, muscle cell regulation and, 96 Transmembrane transforming growth factor-a precursor, 3 6 3 8 Transplantation antigens, tumor rejection antigens and, 182, 184 Tum- antigens, 183,200 cloning of genes, 187-191 immune surveillance, 194-195, 197 mutations, 191-194 recognition by CTLs, 184-187 tum- variants, 183-184 Tum- genes, tumor rejection antigens and, 191-192 Tum- mutations, tumor rejection antigens and, 191-193,206 Tumor dormant state, tumor rejection antigens and, 197 Tumor-infiltrating lymphocytes (TILs) adoptive transfer and, 152, 159-160, 162,164-167 tumor rejection antigens and, 202-203 Tumor necrosis factor cytotoxic T lymphocytes and, 167 transforming growth factora and, 37 Tumor rejection antigens, 177,205-207 autologous CTLs, 201-205 biochemical identification, 182-183 expression, 178-179 P815, 196201 recognition by T lymphocytes, 179-182 turn- antigens gene cloning, 187-191 immune surveillance, 194-195, 197 mutations, 191-194 recognition by CTLs, 184187 variants, 183-184 Tumors central nervous system, oncogenesis of, see Central nervous system tumor oncogenesis Epstein-Barr virus genes and, 2, 8, 19-20 eradication by adoptive transfer of cytotoxic T lymphocytes, see Cytotoxic T lymphocytes
G protein signal transduction and, 84, 8687,90 muscle cell regulation and, 98, 114 Raf-1 phosphorylation and, 54 transforming growth factor-a and, 27-28,32,38,41,43-48 Tumor-specific immunity, cytotoxic T lymphocytes and, 148 Tumor-specific transplantation antigens (TSTAs) cytotoxic T lymphocytes and, 147, 149-151, 159 tumor rejection antigens and, 178 Tumor suppressor gene, central nervous system tumor oncogenesis and, 128-129, 133, 138 Tumor xenogenization, tumor rejection antigens and, 206 Tum- variants cytotoxic T lymphocytes and, 149-152 tumor rejection antigens and, 183-185, 187, 190, 192, 194, 206 P815, 197,201 Tyrosine kinase central nervous system tumor oncogenesis and, 126 G protein signal transduction and, 75-80,85-86,88-89 Raf-1 and, 58-59,66 Tyrosine phosphorylation, Raf-1 and, 58-59,6666 Tyrosine residues, Raf-1 phosphorylation and, 54,56, 60,66, 70
U Ultraviolet light, tumor rejection antigens and, 178, 183 Ultraviolet light-induced tumors, cytotoxic T lymphocytes and, 149-152, 154-155, 161
v Vaccinia virus growth factor (VGF) , physiology of, 28, 39 Vascularization, transforming growth factor-a and, 47
224 Vasoactive agents, G protein signal transduction and, 80, 85 Viral membrane proteins, Epstein-Barr virus genes and, 15-17 Virus-induced tumors, cytotoxic T lymphocytes and, 143 adoptive immunotherapy, 154-160 immunogenicity of tumors, 146148
INDEX
W Wound repair, transforming growth factora and, 4 0 4 1 Wp, Epstein-Barr virus genes and, 14
X X-linked lymphoproliferative syndrome, Epstein-Barr virus genes and, 2-3