Advances in Cancer Research Volume 61

ADVANCES IN CANCER RESEARCH VOLUME 61 This Page Intentionally Left Blank ADVANCES IN CANCERRESEARCH Edited by GEOR...

Author: G. Vande Woude

38 downloads 731 Views 13MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

ADVANCES IN CANCER RESEARCH VOLUME 61

This Page Intentionally Left Blank

ADVANCES IN CANCERRESEARCH Edited by

GEORGE F. VANDE WOUDE ABL-Basic Research Program NCI-Frederick Cancer Research and Development Center Frederick, Maryland

GEORGE KLEIN Department of Tumor Biology Karolinska lnstitutet Stockholm, Sweden

Volume 61

ACADEMIC PRESS, INC. Harcourt Brace EL Company

San Diego New York Boston London Sydney Tokyo Toronto

This book is printed on acid-free paper. @

Copyright 0 1993 by ACADEMIC PRESS,INC. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher.

Academic Press, Inc. 1250 Sixth Avenue, San Diego, California 92101-4311 United Kingdom Edition published by

Academic Press Limited 24-28 Oval Road. London NWI 7DX

International Standard Serial Number: 0065-230X International Standard Book Number: 0- 12-006661-0

PRINTED IN THE UNITED STATES OF AMERICA 9 3 9 4 9 5 9 6 9 1 9 8

QW

9 8 1 6 5 4 3 2 1

CONTENTS

CONTRIBUTORS TO VOLUME 61 . . . . . . . . . . . .

.......

....

ix

Cancer Prevention Research Trials PETER G R E E N W A L D ,

WINFRED F. M A L O N E , HARRIET R. S T E R N

MARY

E.

CERNY,

AND

...........................

I . Introduction . . . . . . . . . . . . . . . . . . .

11. Basic Research Stiidies: Surveying earch ..................... 111. ’The Research Strategy: Froin Basic Research to Huinan Applications ............................... ....... IV. Progress i i i CIinirdl Trials . . . . ................................. .............. ........ V. C:onclusions . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . ..................................

I 2

7 I:!

‘Lo 21

Molecular Genetic Changes in Human Breast Cancer MARCJ.VAN I. Introduction

DE Vl.JVER

...................

....................

I l l . Genetic Changes in Hum;in Breast (hnc ........................ I V. Genetic Predisposition t o Breast Ca~icer. . . . . . . . . . . . . . .

V. (:onclutling Remarks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .... ............. References . . . . . . . . . . .

V

30

50

vi

CONTENTS

Molecular Approaches to Cancer Therapy

MARKA. ISRAEL 1. I l i t rod uct ion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. Cancer as a Molecular Disorder ...........................

I l l . Molecular Diagnosis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IV. Molecular Therapies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Regulation and Mechanism of Mammalian Gene Amplification GEORGER. STARK Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Regulation of Amplitication ........ Primary Mechanisnis o f An1 Hypotheses Integrating Regulation of Amplifcation with the Chroniatidic Teloniere Fusion Model . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . V. Evolution of Amplifecl DNA ................................... References ..................

1. 11. 111. IV.

87 89

10.1 108

Ill

Unraveling the Function of the Retinoblastoma Gene

ELDADZACKSENHAUS, ROD B R E M N E R , Z H E J I A N G , R. MONTGOMERY G I L L , MICHELLEMUNCASTER, MARYSOPTA, ROBERTA. PHILLIPS, A N D BRENDAL. (;AI.LIE I . Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11. Genetics of Retinoblastoma . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............. I l l . The K B 1 Gene ;IIKI Protein Protluri

I V. Binding o f Viral Oncoproteins t o pl IOft”’ ............................ V. Mechanisnis of R B I Gene Regulation ......................... VI. Interaction i)f pl lO/(/J/ with Cellular P VII. Functions of‘ pl IOU/’/ . . . . . . . . . . . VIII. Tissue Specific Susceptibility to K B IX.

115 I 1 (i

I I8 I ‘LO

vii

CONTENTS

Tumor Promotion by Inhibitors of Protein Phosphatases 1 and 2A: The Okadaic Acid Class of Compounds HIROTAFUJIKIA N D MASAMISUCANUMA Introduction . . . . . . . . . . Okadaic Acid Class <:ompounds . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ......................... Okadaic Acid and Its Derivatives Calyculins ......................................................... Microcystins and Nodularin ....................... Tautomycin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . v11. Hypotheses in Relation to Human Cancer . . . . . . . . . . . . . . . . . . . . . . . . . . . . s ................................................. VIII. .................................................. IX.

I. 11. Ill. I V. V. VI.

............

.. . . . . .

i43 146 150 168

172 181 183 1 86 187 187

Oncogenic Basis of Radiation Resistance

USHAKASID, KATHLEENPIROLLO, ANATOLY DRITSCHILO, AND ESTHERCHANC 1. Introduction 11. Radiation Res

................ type . . . . . . . . . . .

Ill. I v. V. Transforniation and Radiation Resistance . . . . . . . . . . . . . . . . . . . . . . . . . . . . ............... VI. VII. Cellular Factors . .............................. rapeutic Iniplications VIII. Modulation o f Ra of Oncogene Stra ................... IX. Conclusion . . . . . . . . . . . . . . . . . . . . References .........................................................

195 196 200 210 215 216 220 225 226 227

INDEX . . . ...... .. .... . . . . .......... ........ ... .. .......... . . ......... . .. 235

This Page Intentionally Left Blank

CONTRIBUTORS

Numbers in parentheses indicate the pages on which the authors’ contributions begin.

ROD BREMNER, Department of Molecular and Medical Genetics, and Department of Ophthalmology, University of Toronto, and Division of Immunology & Cancer Research, and Department of Ophthalmology, The Hospital for Sick Children Research Institute, Toronto, Ontario, Canada MSC I SB ( I 15) MARYE. CERNY, Prospect Associates, Rockville, Maryland 20892 (1) ESTHERCHANG, Department of Pathology, and Department of Surgery, Uniformed Services University of the Health Sciences, Bethesda, Maryland 2081 4 ( I 95) ANATOLY DRITSCHILO, Department of Radiation Medicine, Lombardi Cancer Center, Georgetown University, Washington, D.C. 20007 (195) HIROTAFUJIKI, Cancer Prevention Division, National Cancer Center Research Institute, Chuo-ku, Tokyo 104, Japan (143) BRENDAL. GALLIE, Department of Molecular and Medical Genetics, and Department of Ophthalmologv, University of Toronto, and Division of Immunology W Cancer Research, and Department of Ophthulmology, The Hospital for Sick Children Research Institute, Toronto, Ontario, Canada MSG I SB (115)

R. MONTGOMERYGILL,Department of Molecular and Medical Genetics, and Department of Ophthalmology, University of Toronto, and Division of Immunology W Cancer Research, and Department of Ophthalmology, The Hospital for Sick Children Research Institute, Toronto, Ontario, Canada MSG I S B (115) PETER GREENWALD, Division of Cancer Prevention and Control, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 (1) MARKA. ISRAEL, Brain Tumor Research Center, University of California, San Francisco, California 94143 (57) ix

X

CONTRIRUTORS

ZHEJIANG, Department of Molecular and Medical Genetics, and Department of Ophthalmology, University of Toronto, and Division of Immunology €9 Cancer Research, and Department of Ophthalmology, The Hospital for Sick Children Research Institute, Toronto, Ontario, Canada M S G 1SB ( 1 15) USHAKASID, Depavtment of Radiation Medicine, Lombardi Cancer Center, Georgetown University, Washington, D.C. 20007 (195) WINFREDF. MALONE,Division of Cancer Prevention and Control, Nutional Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892 (1) MICHELLE MUNCASTER,Department of Molecular and Mtdical Genetics, arid Department of Ophthalmology, University of Toronto, and Division of I m munology &' Cancer Research, and Department of Ophthalmology, The Hospital .for Sick Children Research Institute, Toronto, Ontario, Canada M S G 1SB (115) ROBERTA. PHILLIPS, Department of Molecular and Medical Genetics, and Department of Ophthalmology, University of Toronto, and Division of 1711munology €9 Cancer Research, and Department of Ophthalmology, The Hospital for Sick Children Research Institute, Toronto, Ontario, Canada M S G 1SB (115) KATHLEENPIROLLO,Department of Radiation Medicine, Lombardi Cancer Center, Georgetown University, Washington, D.C. 20007 (195) MARYSOPTA, Department of Molecular and Medical Genetics, and Department of Ophthalmology, University of Toronto, and Division of Immunology C3 Cancer Research, and Department of Ophthalmology, The Hospital f o r Sick Children Research Institute, Toronto, Ontario, Canada M S G I S B (115) GEORGE R. STARK,Department of Molecular Biology, Research Institute, The Cleveland Clinic Foundation, Cleveland, Ohio 44195 (87) HARRIET R. STERN,Prospect Associates, Rockville, Maryland 20892 (1) MASAMISUGANUMA, Cancer Prevention Division, National Cancm Center Rrsearch Institute, Chuo-ku, Tokyo 104,Japan (143) MARCJ. VAN DE V!~VER, Department of Pathology, State University of Leiden, 2300 RC Leiden, The Netherlands (25) ELDADZACKSENHAUS, Department of Molecular and Medical Genetics, and Department of Ophthalmology, University of Toronto, and Division of Immunology €9 Cancer Research, and Department of Ophthalmology, The Hospital for Sick Children Research Institute, Toronto, Ontario, Canada M S G 1SB ( I 15)

CANCER PREVENTION RESEARCH TRIALS Peter Greenwald,* Winfred F. Malone,* .Mary E. Cerny,t and Harriet R. Sternt 'Division of Cancer Prevention and Control, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892; and *Prospect Associates, Rockville, Maryland 20852

1. Introduction 11. Basic Research Studies: Surveying Basic Research

A. Cell Biology and Genetics B. Carcinogenesis C. Epidemiology 111. The Research Strategy: From Basic Research to Human Applications A. In Vitro Testing B. In Vivo Testing C. Synergism IV. Progress in Clinical Trials A. Medical Setting B. Public Health Setting V. Conclusion References

1. Introduction The focus of current cancer prevention research trials at the National Cancer Institute (NCI) largely has its origins in the epidemiologic and carcinogenesis research that provided strong evidence in the 1970s and 1980s that dietary factors play a major role in cancer risk. In addition, as the field of cancer prevention developed, carcinogenesis studies led to innovative research on tumor inhibition through chemoprevention. T h e evidence for anticarcinogenic activity is compelling for a variety of dietary factors, such as fiber, vitamins, and minerals; for nonnutritive phytochemicals from vegetables and fruits; and for certain pharmaceuticals (Lippman et al., 1987; Boone et al., 1990; Kelloff et al., 1990; Willett, 1990; Henderson et al., 1991; Ziegler, 1991). T h e potential for reducing cancer incidence and mortality by preventive intervention is a unique and promising clinical research area. It involves the use of noncytotoxic dietary and pharmacologic agents to enhance intrinsic physiologic mechanisms to protect against the development and progression of carcinogenesis. The cancers associated most

1 ADVANCES IN CANCER RESEARCH, VOL. 61

Copyright 0 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.

2

PETER GREENWALD ET AL.

frequently with diet-related factors can be estimated to account for a substantial proportion of all new cancers and cancer deaths in 1991 in the United States (National Cancer Institute and NCI Division of Cancer Prevention and Control, 1991). These diet-related malignancies are cancers of the endocrine and digestive systems, including the oral cavity, esophagus, stomach, colonhectum, breast, lung, and prostate (Henderson et al., 1991; Sporn, 1991). Any preventive intervention that produces even small changes in the prevalence of these cancers would provide important public health benefits. T h e National Cancer Institute established the Diet and Cancer and the clinical Chemoprevention Programs in the early 1980s. Studies are conducted in both of these research areas that identify and evaluate protective agents that could beneficially influence the progression of carcinogenesis either before o r well after the disease process has begun (Kelloff et al., 1990). This research has become the main focus of cancer prevention trials. The emphasis of this paper is a discussion of pertinent experimental and epidemiologic evidence for leads to cancer-inhibiting agents and the application of these studies to human prevention research trials.

II. Basic Research Studies: Surveying Basic Research Scientists in the field of cancer prevention research strive to prevent and control the malignant transformation of cells by using both empirical evidence and a mechanistic approach, as directed from a body of chemical and biological evidence (Bertram et a/., 1987; Kelloff etal., 1990). Much of their work is based on the multistage model of carcinogenesis, which assumes that cancer progresses through a series of phases-initiation, promotion, transformation, and progression (Bertram et al., 1987; Boone et ad., 1990; Kelloff et al., 1990). Chemoprevention research focuses heavily on antipromoters, but there is agreement that inhibiting the process of carcinogenesis at one o r more critical points, whether early or late, has great potential for preventing human cancer (Greenwald et al., 1990; Bertram et al., 1987; Boone et al., 1990; Kelloff el al., 1990; Weinstein, 1991). For example, agents that block or suppress the effects of mutation, block mutation, or block mutation and promotion are all potential candidates for chemoprevention; similarly, antioxidants such as ascorbic acid (vitamin C) and a-tocopherol (vitamin E), which block the in vim formation of nitrosamines and mutagens from endogenous carcinogens, are of particular interest for their chemopreventive potential. Also under consideration are compounds with demonstrated

CANCER PREVENTION RESEARCH TRIALS

3

anticarcinogenic activity for which no mechanism of action has been identified. For both the Diet and Cancer and the Chemoprevention Programs, the research strategy begins with surveys of basic science investigations for leads that may reduce disease risk. Determining which foods, nutrients, o r chemicals possess promising carcinogenesis inhibition activity involves a broad spectrum of research. T h e search for chemopreventive agents focuses on their biologic effects, primarily in the areas of cell biology and genetics, carcinogenesis, and epidemiology. AND GENETICS A. CELLBIOLOGY

Genetic and cellular molecular studies provide great insight into understanding the complex etiology of various cancers and in identifying new opportunities for intervention. Advances in our knowledge of the key mechanisms that may delay or prevent carcinogenesis have developed to a great extent from biochemical and molecular research that suggests the existence of the multistage model for carcinogenesis. Also, our understanding of the carcinogenic process is derived in part from studies of molecular entities that appear to control and regulate cell growth and proliferation, namely proto-oncogenes, oncogenes, and tumor suppressor genes. Both growth-promoting proto-oncogenes and growth-inhibiting tumor suppressor genes are present in all normal human and animal cells and help maintain normal cell growth (Taylor, 1989; Weinberg, 1991). However, genetic mutations or lesions can activate oncogenes, which are derived from proto-oncogenes, or inactivate tumor suppressor genes, causing the loss of control over cellular replication and differentiation that is displayed by tumor cells. A well-known example of molecular genetic and cell biology research that is applicable to cancer prevention is the work of Vogelstein and his colleagues, who studied the cell genetic changes associated with the pathogenesis of colon cancer (Vogelstein et al., 1988, 1989; Weinberg, 199 1). Through their analyses of several polymorphic DNA markers from biopsied colon tissue, the Vogelstein group demonstrated the progression in pathology associated with an accumulation of definable genetic changes that parallel the neoplastic progression from normal, healthy epithelium to frank carcinoma. The probability of such changes is affected by an increased number of cell genetic mutations-mostly acquired-that accumulate in the genome of the evolving cancer cell (Weinberg, 1991; Moolgavkar and Luebeck, 1992). Further, because the progression of the pathology of colon cancer generally occurs in adults in their 40s, 50s, and 60s, the potential for prevention in midlife may

4

PETER GREENWALD ET AL.

provide a significant long-term opportunity to reduce the incidence and mortality of this cancer. A further application suggested from the work of Vogelstein’s group is a noninvasive genetic screening test for colorectal cancer. This potential for early detection is based on a small study of nine individuals whose malignant o r benign colorectal tumors contained specific K-ras mutations (Sidransky et al., 1992). DNA purified from stool samples of eight of the nine subjects-including two patients with early precancerous adenomas-had the same K-ras mutations as those found in the tumors. Analyzing stool samples for the presence of mutated ras or other genes may provide a reliable test for detecting early changes in gene expression that later may be expressed as colorectal cancer if untreated. If a mutation was universally present in late adenomas o r early colorectal tumors, the technique of stool DNA analysis might revolutionize screening for colorectal cancer. This test could be studied as a biomarker intermediate endpoint not only for risk identification but also for modulation in chemoprevention trials. Molecular studies also have been useful in defining the specific proliferative characteristics associated with several cancers, including large bowel, stomach, and esophagus (Lipkin, 1988). Analysis of rectal and colonic tissue indicates that individuals who are at high risk of developing colorectal cancer have significantly higher cell turnover rates and distinctly different distribution patterns of DNA-synthesizing cells compared with low-risk individuals (Lipkin et al., 1985; Deschner et al., 1988; Biasco et al., 1990).These results were obtained by measuring the rate and site at which tritium-labeled thymidine is taken up by epithelial cells lining colonic crypts. At present, the [3H]thymidine labeling index is being used in more extensive human studies to establish its reliability as a possible biomarker to monitor the progress and/or success of intervention regimens in cancer prevention trials (Alberts et al., 1990; Lippman et al., 1990; Schatzkin et al., 1990; Wargovich et al., 1991). A newer assay for detecting proliferating cells utilizes the anti-nuclear antibody Ki-67. Cells in the resting phase do not react with Ki-67. A strong correlation has been reported between thymidine labeling index and Ki-67 in breast carcinoma (Kame1 et al., 1989). Evidence from several studies suggests that immunohistochemical staining of benign and invasive breast carcinoma for the Ki-67 epitope may provide cell cycle information useful to the clinician in assessing breast cancer treatment and prognosis (McGurrin et al., 1987). Results of these and other molecular studies provide the conceptual framework as well as the practical foundation for new directions in

CANCER PREVENTION RESEARCH TRIALS

5

chemoprevention. For example, epidemiologists may be able to use results from molecular studies to determine the relative contribution of genetic versus environmental influences of cancer, and clinicians may find such information useful in identifying high-risk individuals, evaluating the efficacy of specific dietary or therapeutic regimens, o r monitoring the potential of a certain therapy in a primary intervention trial (Weinstein, 1988; Taylor, 1989; Muir, 1990; Weinberg, 1991). B. CARCINOCENESIS Evidence that specific nutrients or chemicals may influence the process of carcinogenesis is rooted in the work of Lasnitzki, who reported in the 1950s that premalignant epithelial lesions in mouse prostate cells exposed to the carcinogen methylcholanthrene could be suppressed by the retinoid retinyl acetate (Lasnitzki, 1955). Subsequent research has identified hundreds of potential anticarcinogenic agents belonging to more than 20 different classes of chemicals (Sporn, 1976; Wattenberg, 1985; Bertram et al., 1987; Boone et al., 1990). Of particular importance has been the follow-up of Lasnitzki’s research; the rewards of this early work are evident in results of small clinical trials conducted in the 1980s demonstrating that retinoids might inhibit the progression of several preneoplastic and neoplastic conditions (Gouveia et al., 1982; Hong et al., 1986, 1990; Lippman et al., 1989). Another area of carcinogenesis research investigates the effects of dietary fat and fiber on tumor development. Experimental evidence suggests that saturated fat enhances, while fiber inhibits, the development of colon tumors in laboratory animals (Nigro et al., 1979; Reddy, 1987; National Academy of Sciences et al., 1989; Sinkeldam et al., 1990). A high-fiber diet may, to a certain degree, overcome the cancer-promoting effects of a high-fat diet (National Academy of Sciences et al., 1989; Cohen et al., 1991). T h e findings that fat is harmful and fiber is protective also may apply to breast cancer, as suggested by Cohen et al. (1 99 l), who examined the effects of diet on n-methyl-n-nitrosourea (MNU)induced mammary tumors in rats. Results of this study show that 90% of animals fed a high-fadlow-fiber diet had mammary tumors, compared with 63 to 66% of those given a high-fat/high-fiber diet or a low-fatllowfiber diet. Fewer than 50% of rats on a low-fadhigh-fiber diet developed mammary tumors over the same 15-week experimental period. Determining the differential effects of various types and amounts of fiber and fat on tumor development requires further study. Nonetheless, these results in the MNU-induced mammary carcinogenesis model support

6

PETER GREENWALD E T AL.

the findings from epidemiologic and breast cancer mortality data from Finland that suggest that increased fiber consumption may be contributing to the relatively low breast cancer rates there (Adlercreutz, 1990). C. EPIDEMIOLOGY In many cases, the initial leads for identifying potential anticancer agents are found in epidemiologic evidence. Population studies suggest that diets low in vegetables, fruits, and grains and high in fat, particularly animal fat, are associated with increased incidence of and mortality from colon cancer (Willett, 1990; U.S. Food and Drug Administration, 1991). Similarly, high intakes of vegetables and fruits appear to reduce the risk of certain other cancers, such as cancers of the oral cavity, esophagus, stomach, and lung (Block, 1991; Henderson et al., 1991; Steinmetz and Potter, 199la; Ziegler, 1991). Although the association between other food groups and specific cancers may be less clear, there appears to be considerable evidence to support the hypothesis that a large portion of cancer at several sites is preventable through increased consumption of vegetables and fruits and, for certain high-risk populations, the anticancer activity of specific constituents such as the antioxidants in vegetables and fruits may reduce their individual risk. The benefit of surveying epidemiologic evidence for cancer prevention information is indicated by a 19-year prospective epidemiologic study that examined the relationship between risk of colorectal cancer and dietary consumption of calcium and vitamin D (Garland et al., 1985). This survey of about 2000 men found that persons in the highest quartile for calcium intake had the lowest rate of colorectal cancer (Fig. 1). T h e same was true for vitamin D intake (Fig. l), suggesting that both calcium and vitamin D may protect against colorectal cancer. These conclusions are supported by results of additional epidemiologic and experimental studies (Slattery et al., 1988; Stemmermann et al., 1990; Newmark el al., 1991; Wargovich et al., 1991) and by several small clinical trials designed to test the efficacy of calcium supplementation in reducing colonic cell proliferation in populations at high risk for developing colorectal cancer (Lipkin and Newmark, 1985; Lipkin et al., 1989; Rozen et al., 1989; Wargovich et al., 1991). A more recent example of the importance of epidemiologic research in cancer prevention comes from studies that suggest a protective role for aspirin and other nonsteroidal anti-inflammatory drugs (NSAIDs) in colorectal cancer. The largest report to date, a prospective study of 662,424 adults conducted by the American Cancer Society, found that mortality from colon cancer was reduced by approximately 40% in both

7

CANCER PREVENTION RESEARCH TRIALS

Cdorectal Cancer RisW1000 Men

Quartile of Intake

Calcium

1 39

2 25

3 25

High 4 12

Vitamin D

31

39

14

16

LOW

~5.05

ps.01

FIG.1 . The risk of colorectal cancer, by quartile of dietary calcium and vitamin D intake, from a 19-year prospective study of 2107 men. (Adapted from Garland el al., 1985.)

men and women who used aspirin at least 16 times a month for a minimum of 1 year, when compared with nonusers (Thun et al., 1991). T h e protective effect of aspirin against colon cancer mortality was maintained after adjusting for dietary factors, obesity, physical activity, and family history. However, this study did not examine the relationship between aspirin use and colon cancer incidence or rectal cancer incidence or mortality, and the reported benefits were for aspirin only; use of acetaminophen was not associated with colon cancer risk. Two additional case-control studies found similar reductions in colon and rectal cancer incidence rates among regular aspirin users (Kune et al., 1988; Rosenberg et al., 1991); in one of these studies, use of NSAIDs other than aspirin was associated with lowered risk of colon but not rectal cancer (Kune et al., 1988). On the basis of epidemiologic and experimental evidence as well as several small case reports (Labayle et al., 1991), NCI’s Chemoprevention Program has implemented controlled clinical trials to examine the effects of two NSAIDs, piroxicam and sulindac, on polyp recurrence in patients with previous colon adenomas.

111. The Research Strategy: From Basic Research to Human Applications Identifying the most effective cancer-preventive agents from a pool of hundreds of promising compounds requires a strategic approach that includes defined criteria and decision points based on efficacy and safety data. NCI’s chemopreventive agent development program includes preclinical in vitro and in vivo screening and, when warranted, human clinical trials (Malone et al., 1989). Toxicologic and safety evaluations in animals measure the acute, subchronic, and chronic effects of the proposed chemopreventive agent; this step includes carcinogenesis studies as well as multigeneration reproductive and teratogenicity studies. Compounds that exhibit high efficacy and low toxicity in these preclinical tests are considered for preliminary evaluation in human phase I and I1

8

PETER GREENWALD ET AL.

clinical trials in usually limited numbers of high-risk but otherwise healthy subjects. A. In VITRO TESTING The preclinical evaluation of potential chemopreventive agents begins with a series of in vitro screening tests (Table I). These in vitro systems provide a method for rapidly selecting and prioritizing promising agents for subsequent in vim testing. In vitro assays evaluate the potential cancer-preventive activity of new agents using cell transformation systems; this battery of assays can be used to predict whether the agents being tested possess anti-initiator and/or antipromoter activity. The strengths of an in vitro testing are (a) efficiency in terms of cost and time in the evaluation of a given agent; (6) sensitivity and ease of quantification; (c) controlled test conditions; and (d) most importantly, potential use of human cells. Both cell and tissue systems cultured with specific carcinogens are employed, and including systems derived from human material provides a species-specific screen not possible with animal models. Results from the initial screening of several antimutagens and antiproliferatives are presented in Table 11. In 1992, using in vitro cell transformation systems, researchers supported by NCI’s Chemoprevention Program will screen approximately 170 agents that have been selected from a group of about 1000 potential cancer inhibitors. B. INVIVOTESTING Agents demonstrating clear efficacy in the in vitro screens are evaluated further using a battery of in vivo efficacy and safety tests (Table 111). In uivo screening provides the initial evidence of positive chemopreventive activity in carcinogen-induced animal tumor models; establishes an initial dose-response for compound efficacy and toxicity; and provides evidence of agent acceptability and tolerance in animals (Malone et al., 1989; Boone et al., 1990). Several criteria have been established to determine the battery of in vivo models to be used in chemoprevention agent development. For example, because target organ systems must be relevant to human cancers, in vivo animal models for lung, mammary, colon, bladder, and skin have been chosen. Organ transplantation models generally are not considered relevant to cancer prevention research and, as such, have been omitted from this stage of research. Models using multistaged carcinogenesis [e.g., mouse skin exposed to 7,12-dimethylbenz13-acetate [alanthracene] (DMBA) and 12-O-tetradecanoylphorbol(TPA)] are included, as are chemical models with or without activation.

9

CANCER PREVENTION RESEARCH TRIALS

TABLE I IN VITROSCREENS" Cell substrate Human lung tumor cells (A427) Mouse epidermal cells

Carcinogenb

Promoter

Endpoint: Inhibition of

None

None

Anchorage-independent growth

None

TPA

Anchorage-independent growth

BbIP

None

Transformed foci or colonies

DMBA

TPA

Hyperplastic alveolar nodules

(JW Rat tracheal epithelial cells WE) Mouse mammary organ culture (MMOC)

T h e Chemoprevention Branch, Division of Cancer Prevention and Control, NCI. TPA, 12-0Abbreviations: B(a]P. benzolajpyrene; DMBA. 7,12-dimethylbenz[o]anthracene; tetradecanoylphorbol- I 3-acetate. a

This year, NCI will test about 107 potential chemopreventive agents using in vivo systems. In vivo screening for efficacy and toxicity is required by the U.S. Food and Drug Administration (FDA) before an agent can be considered safe for use in chronic human studies. These tests, which are included in

TABLE I1 IN VITRO SCREENSa

Antimutagens NAC Oltipraz Antiproliferatives DFMO Ibuprofen Piroxicam Antimutagens and antiproliferatives DHEA - 8354 4-HPR

RTEb

A427

MMOC

JB6

+ +

NE

+ +

NE NE

NE NE NE

NE

+ +

+ +

+ +

NE

NE

+ +

+ +

+ +

NE NE

+

" T h e Chemoprevention Branch, Division of Cancer Prevention and Control, NCI.

Abbreviations and symbols used: +, chemopreventive activity observed: significant at P < 0.05; NE, no significant chemopreventive effect observed; DFMO, 2-difluoromethylornithine; DEA, deNAC, N-acetyl-I-cysteine; hydroepiandrosterone; 4-HPR, all-lrawu.-N-(4-hydroxy)phenylretinamide; A427, human lung tumor A427 cell assay; MMOC, mouse mammary gland organ culture assay; RTE, rat tracheal epithelial cell focus assay.

10

PETER CREENWALD E T AL.

TABLE Ill IN VIVO CHEMOPREVENTION SCREENING SYSTEMS (ANIMAL MODELS)~

Species

Carcinogen*

’

Target organ

Endpoint: Inhibition o f

Mouse

DMBAITPA

Skin

Papillomas/carcinomas

Hamster

MNU DEN

Lung Lung

Squamous cell carcinomas Adenocarcinomas

Mouse

OH-BBN

Bladder

Transitional cell carcinomas

Rat

MNU or DMBA

Mammary gland

Adenocarcinomas

Rat

AOM

Colon

Adenocarcinomas

T h e Chemoprevention Branch, Division of Cancer Prevention and Control, NCI. Abbreviations used: DMBA, 7,12-dimethylbenz[a]anthracene;TPA, 12-0-tetradecanoylphorbol-13-acetate; MNU, n-methyl-n-nitrosourea; DEN, n-nitrosodiethylamine; OH-BNN, n-butyl-n-(4hydroxybuty1)nitrosamine; AOM. azoxymethane (Malone, 199 1). a

NCI’s chemoprevention agent development program, assess the acute oral toxicity, 30-day subchronic oral toxicity, 13-week toxicity, 1-year chronic toxicity, chronic 2-year oncogenicity evaluations, reproductive toxicity, multigenerational developmental evaluations, neurobehavioral evaluations, and pharmacokinetic studies. Currently, 14 compounds are undergoing in uiuo toxicity and efficacy testing. An example of NCI’s approach to preclinical testing is provided by the pharmaceutical oltipraz, an antioxidant that is structurally similar to the dithiolthiones found in cabbages, cauliflower, and Brussels sprouts. Epidemiologic and experimental evidence indicates that consumption of these foods is associated with reduced cancer risk in humans and laboratory animals (Bertram et al., 1987). Investigations demonstrate that the relatively nontoxic oltipraz, which has been used to treat schistosomiasis in humans, may act as an anti-initiator by inducing glutathione S-transferase activity, which, in turn, can detoxify electrophilic carcinogenic compounds (Kelloff el al., 1990; Steinmetz and Potter, 1991b). The compound was found effective in two in uitro cellular screensA427, the human lung cell assay, and RTE, the rat tracheal epithelial assay predictive of anti-initiator activity. It also appeared protective in a mouse mammary organ culture, which can be indicative of either antipromoter or anti-initiator activity. Oltipraz was ineffective in a mouse skin assay that tests for antipromoter activity. Anticarcinogenic activity was demonstrated in three in uivo screens-MNU-induced tracheal tumors, DMBA-induced mammary tumors in rats, and n-butyl-n-(4-hydroxybuty1)nitrosamine (OH-BNN)-induced bladder tumors in miceand in two in uivo efficacy models-one for rat colon tumors and another for hamster lung tumors. Oltipraz is also being tested in a mouse

CANCER PREVENTION RESEARCH TRIALS

11

prostate tumor model. One-year feeding studies in dogs and rats indicate low toxicity of the agent in these species. The overall favorable results for oltipraz from preclinical studies, combined with its apparent low toxicity in animals, have led to the implementation of early phase clinical studies. In a recently completed phase I evaluation of 18 patients receiving 125 mg and 250 mg of oltipraz for 6 months, the maximum tolerated dose was 125 mg daily. Toxicities were usually mild but precluded further dose escalation. Further development of dose and schedule that focuses on maximizing glutathione S-transferase levels is being considered (Benson et al., 1992).

C. SYNERGISM T h e possible enhanced biological effects of two or more promising chemopreventive compounds are studied increasingly in efficacy models. The goal of these studies is to find combinations of agents that demonstrate increased organ specificity, increased inhibitory activity, and reduced toxicity, compared with single agents (Moon and Mehta, 1989; I p and Ganther, 1991). Ideally, combination studies test agents that function through different inhibitory mechanisms, such as those agents that interfere with the formation of carcinogens prior to “endogenous’’ exposure; prevent carcinogens from reaching o r reacting with critical sites in target cells (“blocking agents”); or impair, delay, or reverse the genetic and phenotypic expression of malignancy after carcinogen exposure has occurred (“suppressing agents”) (Boone et al., 1990; I p and Ganther, 1991). An enhanced anticarcinogenic effect from the use of both the retinoid all-trans-N-4(hydroxyphenyl)retinamide (4-HPR) and the antiestrogen tamoxifen has been reported. In animals, 4-HPR is highly effective in inhibiting both DMBA- and MNU-induced mammary tumors; it is also substantially less toxic than other retinoids in long-term feeding studies (Moon and Mehta, 1989; Ratko et al., 1989). Tamoxifen has been available to women since the 1970s for the treatment of advanced-stage breast cancer and as an adjuvant therapy for early-stage breast cancer (Nayfield et al., 1991). To assess whether the chemopreventive efficacy of nontoxic tamoxifen therapy could be improved, Ratko et al. (1989) administered both 4-HPR (in the diet) and tamoxifen (via subcutaneous injections) to rats immediately after surgical excision of the first primary MNU-induced mammary tumor. This treatment regimen was continued for 180 days and resulted in enhanced survival and a significant reduction in the number of second primary mammary tumors (Fig. 2). T h e results of this

12

PETER GREENWALD ET AL.

Days on Treatment FIG. 2. Effect of combined treatment with 4-HPR (3 mmol/kg diet) plus tarnoxifen (10 or 20 &rat, three times/week, sc) on the percentage of second primary MNU-induced mammary tumors following excision o f the first primary cancer in female SpragueDawley rats. (Adapted from Ratko et al., 1989.)

study suggest that the coadministration of 4-HPR and tamoxifen could markedly improve the outcome for certain high-risk breast cancer patients-a hypothesis that needs confirmation from controlled clinical trials results. IV. Progress in Clinical Trials Strategic factors drive the decision to enter a clinical trial-the state of the science, agent prioritization, and available resources. The rationale for this approach, as noted earlier, is based on the strength of the evidence from the body of laboratory and epidemiologic research indicating that various agents have the potential to stop o r reverse cancer progression in animals and may have the potential to reduce risks in hhmans. Experimental cancer-inhibiting compounds are prioritized for clinical evaluation according to how they block exposure to mutagenic carcinogens, prevent hyperproliferation, or induce the regression of neoplasia. Because the clinical research of chemopreventive agents frequently is conducted in populations who are at high risk but otherwise healthy, evaluations of the agent’s pharmacokinetics, particularly indica-

CANCER PREVENTION RESEARCH TRIALS

13

tions of human tolerance and toxicity, are as critical as the evaluation of the agent’s efficacy. T h e chemopreventive potential of a number of individual agents o r agent combinations is currently undergoing clinical evaluation in thousands of subjects. More than 30 clinical studies supported by NCI are in progress for agents that have met all the required preclinical criteria for human evaluation. Selected chemoprevention trials are shown in Table IV. Endpoints in these studies include overall incidence of cancer, sitespecific cancer incidence, the rate of regression andlor progression of preneoplastic changes, and changes in cellular or biochemical parameters along the causal pathway of carcinogenesis. Key biochemical o r biological indicators-the intermediate endpoints of carcinogenesisare being evaluated in many of the clinical prevention trials supported by the NCI as indicated in Table IV. These highly sensitive biological indicators provide a unique opportunity to monitor the early stages of the carcinogenesis process when intervention may be most successful. Although a great deal of work remains, once these markers are validated as reliable indicators of preneoplastic changes through multiple studies, the number of chemopreventive agents that could be evaluated in human intervention studies can be expected to increase dramatically. A. MEDICALSETTING Clinical chemoprevention trials are conducted most frequently in the medical setting where patients can be efficiently accrued and monitored. An example of a medical setting trial is the work of Lipkin and Newmark at Memorial Sloan-Kettering on calcium supplementation in a small group of patients at high risk for colorectal cancer. It was suggested that a lack of dietary calcium in the presence of a high-fatlhighphosphatellow-fiber diet causes an increase of free ionized fatty and bile acids that may damage the colonic mucosa (Newmark et al., 1984). To test this hypothesis, Lipkin and Newmark (1985) administered 1.25 g of calcium supplementation as calcium carbonate to 10 patients at high risk for familial colonic cancer. T h e findings shown in Fig. 3 indicate that oral calcium supplementation induced a quiescent equilibrium in epithelial-cell proliferation in the colonic crypt compartment of this highrisk group as indicated by the uptake of tritiated thymidine. These results are now being assessed at Dartmouth in a more extensive trial with 850 post-polypectomy patients to confirm whether calcium carbonate supplements will reduce the rate of new polyp formation in this larger cohort.

TABLE IV SELECTED CHEMOPREVENTION BRANCH CLINICAL TRIALSO Target site ~~~

Study population

Study agent(s)

~

All

Male physicians

p-Carotene, 50 mg/qod Aspirin, 325 mg qod

Bladder

Resected superficial tumors

4-HPR*

Breast

Proliferative breast disease

Breast Cervix

High risk Women, cervical dysplasia

Tamoxifen, 20 mg/day 4-HPR (Fenretinide), 200 mg/day

Cervix

Women, cervical dysplasia

Cervix

Women, mildlmoderate dysplasia P-trans-Retinoicacid, 0.382%

Colon

Previous ademona of the colon

Colon

Previous adenoma of the colon

Colon Colon

Previous colon polyp Previous colon adenoma

Calcium, 1200 mg

Colon

Dukes’ A and B1 colon cancer

Colon

Previous colon adenomas

w-3 fatty acids, 10 g/day Sulindac

Colon Colon

Familial adenomatous polyposis Previous colon cancer

Sulindac, 150 mg twice a day 8-Carotene, 30 mg/day Ascorbic acid, 1 g/day a-Tocopherol, 400 mg/day

Colon Colon

High risk Previous colon cancer

DFMO

Colon

High risk

Calcium carbonate, 3 or 5 glday

Head and neck

Previous head and neck cancer leu koplakia

13-cis-Retinoic acid

Lung

Heavy smokers

p-Carotene, 30 mg/day Retinol, 25,000 lU/day

Lung

High-risk women

Lung

Cigarette smokers

p-Carotene, 50 mg qod Vitamin E, 600 mg qod p-Carotene, 30 mg/day Retinol, 25,000 IUlday

Lung

Chronic smokers

13-cis-Retinoicacid, 1.0 mg/kg daily

Lung

Men exposed to asbestos

Retinol, 25,000 1U qod

Lung

High-risk women

@-Carotene,50 mg/day

Oral cavity

Previous premalignant oral lesions

8-Carotene 13-cis-Retinoic acid

&Carotene, 30 mg/day Folic acid, 5 mg/day Wheat bran, 13, 5, or 2 glday Calcium carbonate, 0.25 or 1.50 glday Piroxicam, 20, 10, 7.5, or 5 mglday Calcium carbonate, 3 g/day

8-Carotene, 30 mg/day

(continued)

,

15

CANCER PREVENTION RESEARCH TRIALS

TABLE IV (Continued) Target site

Study population

Study agent(s)

Previous BCC of skin

Retinol, 25,000 IU/day 13-cis-Retinoicacid, 0.15 mglday p-Carotene, 50 mg/day

Skin

Albinos in Tanzania

&Carotene, 100 mg/day

Skin

Actinic keratosis patients

Retinol, 25,000 IU/day

Skin

Previous BCC of skin

Skin

National Cancer Institute, Division of Cancer Prevention and Control. DFMO, 2-difluoromethylAbbreviations used: 4-HPR. all-lram-N-4(hydroxyphenyl)retindmide; ornithine; BCC, basal cell carcinoma.

The suppression of multistep carcinogenesis of the upper aerodigestive tract with chemopreventive agents has been a major focus for Waun Ki Hong and his group at the M.D. Anderson Cancer Center. For example, oral leukoplakia proceeds to invasive oral carcinoma in about 10% of untreated patients. In a randomized clinical study conducted by this group, treating oral leukoplakia with the synthetic retinoid 13-cisretinoic acid for 3 months demonstrated significant regression of this

2

3

Before Calcium

24

16

8

After Calcium

0 1 base

2

3

4

5 surface

Colon Crypt Compartment

FIG.3. Rate of colonic epithelial cell proliferation, as measured by a [3H]thyrnidine labeling index, for 10 individuals at high risk for familial colon cancer, before and after supplementation with 1250 mg calcium (as calcium carbonate)/day for 2 to 3 months. (Adapted from Lipkin and Newmark, 1985. Reprinted, with permission, from New. Engl.J. Med. 313, 1381-1384 (1985).)

16

PETER GREENWALD ET AL.

premalignant lesion (Hong et al., 1986). More recently, Hong and co-workers randomized head and neck cancer patients who were free of disease following local therapy for postsurgical treatment with either 13cis-retinoic acid o r placebo. Head and neck cancer patients characteristically are subject to second primary tumors following initial therapy. In this placebo-controlled study, Hong’s group examined the frequency with which new second cancers of the head and neck occurred and found that, out of 49 treated patients, only 2 developed new primary cancers. Of the 51 patients receiving the placebo, 12 subjects developed 16 tumors. For patients treated with 13-cis-retinoicacid there was a clear and substantial reduction in new primary cancers of the head and neck (Hong et al., 1990). T h e group has continued working on methods for reducing the agent’s toxicity and improving its effectiveness in chemopreventive and chemotherapeutic regimens. Breast cancer rates in women are a major medical problem. About 180,000 women in the United States in 1992 are expected to be newly diagnosed with invasive breast cancer, and about 46,000 women are expected to die of breast cancer in 1992 (Boring et al., 1992). In a study supported by NCI, Veronesi and his colleagues at the Institute Nazionale Tumori in Milan, Italy, are conducting a 5-year intervention and a 2-year follow-up with 4-HPR for the prevention of contralateral breast cancer in women previously treated for localized disease. T h e synthetic retinoid 4-HPR has been shown to be an effective inhibitor of chemically induced mammary tumorigenesis in animal models (Kelloff et al., 1990). With previous studies demonstrating 4-HPRs breast tissue specificity, negligible accumulation in the liver, antiproliferative effects, and low toxicity, the randomized clinical trial now underway in Milan may determine that 4-HPR is an extremely effective compound for reducing the incidence of contralateral breast cancer in disease-free subjects already treated surgically for the disease in the other breast. Tamoxifen, a synthetic antiestrogen, has been a treatment-of-choice since the 1970s for advanced breast cancer and has also been used as adjuvant treatment in all stages of the disease (Nayfield et al., 1991; Love, 1990). T h e primary postsurgical benefits of tamoxifen appear to be twofold: suppression of the postoperative relapse of early-stage breast cancer and prevention of the development of second primary breast cancer. T h e positive role of tamoxifen, as assessed from treatment trial data, suggests that it may be useful selectively for the primary prevention of breast cancer. T h e potential for adverse effects from tamoxifen use are similar in type and frequency to those of estrogenreplacement therapy, including a twofold increase in risk of endometrial

CANCER PREVENTION RESEARCH TRIALS

17

cancer (Nayfield et al., 1991). Nonetheless, tamoxifen may be an effective prevention option for women at increased risk of breast cancer that can offer added benefits such as the stabilizing of bone mineral loss and a possibly cardioprotective estrogen-like effect in postmenopausal women (McDonald and Stewart, 1991; Nayfield et al., 1991). T h e National Surgical Adjuvant Breast and Bowel Project (NSABP), directed by Dr. Bernard Fisher, conducted a randomized, double-blind, placebo-controlled postoperative adjuvant therapy trial with tamoxifen and showed that women treated with tamoxifen experience about half as many contralateral breast tumors as those receiving the placebo (Fisher and Redmond, 1991). Additionally, an overview of 28 clinical trials comparing adjuvant therapy with tamoxifen to observation or placebo following surgery for early-stage disease demonstrated a reduction by 16% of mortality odds in the tamoxifen-treated groups. Other trials have reported about a 35% decrease in contralateral breast tumors from tamoxifen treatment. These findings are the primary motivation for the NCI and the NSABP to launch the Breast Cancer Prevention Trial, which will evaluate the preventive effects of tamoxifen in 16,000 women over age 35 who are at increased risk for breast cancer. While several agents (low-fat diets or 4-HPR) merit evaluation in breast cancer prevention, tamoxifen is particularly worthy of appraisal because it is tolerated well, and adjuvant use suggests additional health benefits (Fisher and Redmond, 1991). The National Heart, Lung, and Blood Institute will provide support for the analysis of its effect on heart disease, and the National Institute of Arthritis and Musculoskeletal and Skin Diseases will provide support for studies of osteoporosis and bone fractures in the trial participants. B. PUBLICHEALTHSETTING

A study by Dr. Jerome De Cosse and his group at Cornell Medical Center has implications for the general public (De Cosse et al., 1989). In a placebo-controlled trial, 62 patients with familial polyposis were treated with vitamins C and E alone or with these vitamins plus a wheat fiber supplement in excess of 1 1 g per day above their normal daily intake of approximately 11.5 g fiber/day. One-third of the group received a placebo in the form of a simulated high-fiber cereal that was actually a low-fiber supplement. This group served as the control. The vitamin supplements alone may have had a weak independent (nonsignificant) effect, but the results in the group treated with the vitamins and fiber supplements provide evidence of a significantly lower rate of polyp

18

PETER CREENWALD ET AL.

formation. This was the first clinical trial evidence that fiber consumption from a food similar to All Bran reduced polyp rates. The change in polyp ratio by treatment group is shown in Fig. 4. Dr. David Alberts and others at the University of Arizona in Tucson confirmed that dietary wheat bran fiber may have a beneficial effect on rectal epithelial cell proliferation in patients with a history of resected colon or rectal cancer. Patients were fed a wheat bran supplement for 2 months, and a baseline measurement of tritiated thymidine uptake was used as a measure of cell proliferation. Three of eight patients experienced a reduction in the labeling index uptake. A higher proportion, six of eight patients, experienced a reduction if their initial baseline was high (Alberts et al., 1990). On the basis of these and other recent reports, the NCI is conducting a multi-institution randomized trial to assess the association between dietary fat and fiber and colon cancer. This dietary prevention trial is designed to test whether a low-fadhigh-fiber and vegetable- and fruitenriched dietary plan will prevent the recurrence of large bowel adenomatous polyps in otherwise healthy women and men who previously have had a polypectomy. This clinical trial is based on the fact that large bowel adenomas are highly prevalent, occurring in 30% of middle-age and older adults; the polyp recurrence rate is high in those individuals who have undergone surgical polyp removal, and there is a strong association between colon polyps and the development of colon cancer. This dietary intervention trial will enroll 1000 men and women in the diet intervention group and 1000 in the control group. T h e recurrence of

1

2

3

4

Year

FIG.4. The effect of a low-fiber ( I 1.5 g/day) diet; a low-fiber (1 1.5 g/day) diet supplemented with vitamins C (4 g/day) and E (400 mg/day); and a high-fiber (22.5 g/day) diet supplemented with vitamins C (4 g/day) and E (400 mg/day) on colonic polyp ratio (i.e., the number of polyps during treatment divided by the number of polyps at baseline) in individuals with familial adenomatous polyposis. (Adapted from DeCosse et al., 1989.)

CANCER PREVENTION RESEARCH TRIALS

19

polyps as the endpoint will be assessed in both groups at Years 1 and 4 to determine the effect of this dietary intervention. David Rose and his group at the American Health Foundation studied fiber in relation to blood hormone levels, an issue of possible relevance to breast cancer risk (Rose et al., 1991; Rose, 1992). Sixty-two postmenopausal women were randomized into three groups and fed wheat bran, oat bran, o r corn bran. The Rose group then measured serum estradiol and estrone levels before and after this feeding experiment. A significant reduction in serum estrogen levels was found in subjects fed the wheat bran, but no similar estrogen reduction was found from the other two brans. As a country, we are probably hyperestrogenic due to our dietary patterns. Reducing circulating estrogen levels may be helpful in reducing the risk of hormone-dependent cancers in individuals and can be achieved within levels consistent with established normal reproduction and other activities. A number of clinical studies supported by the Chemoprevention Program involve antioxidants such as p-carotene and vitamins A, C, and E. In 1983, the Fred Hutchinson Cancer Research Center began two pilot studies to examine the association between P-carotene and vitamin A and lung cancer. T h e target populations for these studies were asbestosexposed workers and heavy smokers. Based on the feasibility demonstrated in the above study, the Carotene and Retinol Efficacy Trial (CARET) is recruiting 13,000 heavy smokers and 4000 asbestos-exposed workers (Malone, 1991). One-half will be randomized to P-carotene and vitamin A (as retinyl palmitate), and the other half will receive placebos. Thus far the regimen has been closely monitored and has been well tolerated for 4 years (Lippman et al., 1991). In collaboration with the National Public Health Institute of Finland, the NCI is supporting a long-term lung cancer prevention study among 29,000 smokers. Reduction of the rate of lung cancer incidence with daily oral supplements of P-carotene and vitamin E is the primary goal of this study. Participants were randomly assigned to one of the four study arms: P-carotene, vitamin E, both agents, o r placebo. Begun in March 1984 at five health centers in southern Finland, the study will take several more years to complete, and results should indicate whether there is a benefit from either vitamin E or p-carotene, whether there is a synergistic effect, o r whether there is no effect. In the most complex factorial design, a study is under way that aims to lower the frequency of esophageal cancer in an area of China where one of five people die of this cancer. This study seeks to determine whether daily ingestion of multiple vitamin and mineral supplement combinations will reduce rates of esophageal cancer. Four separate combinations

20

PETER GREENWALD ET AL.

Intervention Groups

Placebo*

A

B

AB*

C

AC*

BC*

ABC

D

AD*

BD*

ABD

CD*

ACD

BCD

ABCD*

FIG. 5. The Linixian esophageal cancer prevention trial is a fractional factorial design based on a 2 4 factorial. The asterisks indicate the eight intervention groups included in a half-replicate of the 2 4 factorial design. Thirty-thousand participants, 40 to 69 years old, received either a daily placebo or one of the seven vitamin/mineral combinations. Treatment agents are (A) vitamin A, zinc; (B) riboflavin, niacin; (C) vitamin C, molybdenum; (D) selenium, vitamin E, and P-carotene. (Adapted from Greenwald, 1989).

of supplements are being studied. The principle underlying this study of combined groups is that is it better to find something beneficial in the prevention effort than to miss any opportunity. This study design is shown in Fig. 5 . After the data are analyzed, researchers should be able to determine whether, for example, the combination of vitamin A plus zinc is beneficial; however, they will not be able to determine the individual effects of each agent.

V. Conclusion The NCI chemopreventive agent development program develops compounds for diverse potential interventions. These require a multidisciplinary approach from preclinical to human evaluation. T h e search for new agents and agent combinations with organ site specificity and low toxicity is a high priority at the NCI. Although a major aspect of the agent selection process is identifying new agents for testing, agents that have reliable data from previous pharmaceutical evaluations are especially advantageous. The surge of interest in biological markers as surrogate endpoints in chemoprevention trials can be expected, as markers are validated, to provide endpoints that allow the decrease in time required to complete a cancer endpoint trial and report results. Through the mechanism of interactive research and development projects, NCI intends to increase its support of collaborative preclinical and clinical investigator-initiated research that addresses the role of various

CANCER PREVENTION RESEARCH TRIALS

21

biological and biochemical markers in chemopreventive research to provide reliable endpoints for both prevention and treatment. Where is this area of research to lead? In the medical setting, we feel that it is going to lead to a change in the practice of oncology and the practice of medicine. In other words, the focus of today on diagnosis and therapy will continue, but the scope will be expanded into new prevention areas. Markers in the pathway of causality will be targeted for treatment to inhibit carcinogenesis much earlier in the process. This expansion of prevention research is expected to include research on markers of precancerous lesions, which may be available in the future to indicate high risk, much as high blood pressure indicates high risk of heart or kidney disease or stroke. A number of major phase 111 clinical chemoprevention trials now under way will be completed during the 1990s. Results from these trials will provide direction for the next generation of chemoprevention research studies. Prevention is expected to become a major part of both clinical oncology and public health practice.

REFERENCES Adlercreutz, H. (1990). S c a d . J. Clin. Lab. Invest. 50, 3-23. Alberts, D. S., Einspahr, J., Rees-McGee, S., Ramanujam, P., Buller, M. K., Clark, L., Ritenbaugh, C., Atwood, J.. Pethigal, P., Earnest, D., Villar, H., Phelps, J., Lipkin, M., Wargovich, M., and Meyskens, F. L., Jr. (1990). J. Natl. Cancer Inst. 82, 1280-1285. Benson, A. B., 111, Mobarhan, S., Ratain, M., Sheehan, T., Berezin, F., Giovanazzi-Bannon, S., Ford, C., and Rademaker, A. (1992). Proc. Am. Sot. Clin. Oncol. 11, 145. Bertram, J. S., Kolonel, L. N., and Meyskens, F. L., Jr. (1987). Cancer Res. 47,3012-3031. Biasco, G., Paganelli, G. M., Miglioli, M., Brillanti, S., DiFebo, G., Gizzi, G., Ponz-de-Leon, M., Campieri, M., and Barbara, L. (1990). Cancer Res. 50, 1156-1 159. Block, G. (1991). Am.J. Clin. Nufr. 53, 270s-282s. Boone, C. W., Kelloff, G. J., and Malone, W. F. (1990). Cancer Res. 50, 2-9. Boring, C. C., Squires, T. S., and Tong, T. (1992). CA-A Can.]. Clin. 4!2(1), 19-38. Cohen, L. A., Kendall, M. E., Zang, E., ef al. (1991).]. Natl. Cancer Inst. 83,496-500. De Cosse, J. J., Miller, H.H.,and Lesser, M. L. (1989).]. Natl. Cancer Inst. 81, 1290-1297. Deschner, E. E., Godbold, J., and Lynch, H. T. (1988). Cancer 61,2286-2290. Fisher, B., and Redmond, C. (1991).]. Natl. Cancerlnst. 83, 1278-1280. Garland, C., Shekelle, T. B., Barrett-Connor, E., Crique, M. H., Rossof, A. M., Paul, 0. (1985). Lancet 1, 307-309. Gouveia, J., Hercend, T., Lemaigre, G., ef al. (1982). Lancet 2, 710-712. Greenwald, P. (1989). In “Principles and Practice of Oncology” (V. T. Devita, S. Hellman, and S. A. Rosenberg, eds.), 3rd ed., p. 176. Lippincott, Philadelphia. Greenwald, P., Nixon, D. W., Malone, W. F., Kelloff, G. J., Stern, H. R., and Witkin, K. M. (1990). Cancer 65, 1483-1489. Henderson, B. E., Ross, R. K., and Pike, M. C. (1991). S c h e 254, 1131-1138. Hong, W.K., Endicott, J., Itri, L. M., Doos, W., Batsakis, J. G., Bell, R., et al. (1986). N . Engl. J. Med. 315, 1501-1505.

22

PETER GREENWALD E T AL.

Hong, W. K., Lippman, S. M., Itri, L. M., Karp, D. D., Lee, J. S., Byers, R. M., el al. (1990). N . Engl. J. Med. 323, 795-801. Ip, C., and Ganther, H. E. (1991).Carcinogmsis 12,365-367. Kamel, 0. W., Franklin, W. A., Rungus, J. C., and Meyer, J. S. (1989).Am.J. Pathol. 134, 107-1 13. Kelloff, G. J., Malone, W. F., Boone, C. W., Sigman, C. C., and Fay, J. R. (1990).Sem.Oncol. 17,438-455. Kune, G . A., Kune, S., and Watson, L. F. (1988).Cancer Res. 48,4399-4404. Labayle, D., Fischer, D., Vielh, P., et al. (1991).Gastroenterology 101,635-639. Lasnitzki, I. (1955).Br. J. Cancer 9,434-441. Lipkin, M. (1988).Canter Res. 48, 235-245. Lipkin, M., Friedman, E., Winawer, S. J.. and Newmark, H. L. (1989).Cancer Res. 49,248254. Lipkin, M., and Newmark, H. L. (1985).N . Engl. J. Med. 313, 1381-1384. Lipkin, M., Uehara, K.,Winawer, S., Sanchez, A., Bauer, C., Phillips, R., Lynch, H. T., Blattner, W. A., and Fraumeni, J. F., Jr. (1985).Cancer Lett. 26, 139-144. Lippman, S. M., Garewal, H. S., and Meyskens, F. L., Jr. (1989).Prev. Med. 18,740-748. Lippman, S. M., Hittelman, W. N., Lotan, R., Pastorino, U.. and Hong, W. K. (1991).Cancer Cells 3, 59-65. Lippman, S. M., Lee, J. S., Lotan, R., Hittelman, W., Wargovich, M. J., and Hong, W. K. (1990).J. Natl. Cancer Inst. 82, 555-560. Lippman, S. M., Kessler, J. F., and Meyskens, F. L., Jr. (1987).Cancer Treat. Rep. 71, 391405. Love, R. R. (1990).J. Natl. Cancer Inst. 82, 18-2 I. Malone, W. F. (1991).Am.J. Clin. Nutr. 53, 305s-313s. Malone, W.F., Kelloff, G . J.. Boone, C. W., and Nixon, D. W. (1989).Preu. Med. 18,553556. McDonald, C. G., and Stewart, H. J. (1991).Br. Med. J . 303, 435-437. McGurrin, J. F., Doria, M. I., Jr., Dawson, P. J., Karrison, T., Stein, H. 0.. and Franklin, W. A. (1987).Cancer 59, 1744- 1750. Moolgavkar, S. H., and Luebeck, E. C. (1992).J.Natl. Cancer Inst. 84, 610-618. Moon, R. C., and Mehta, R. G. (1989).Preu. Med. 18, 576-591. Muir, C. S.(1990).Cancer Res. 50,644 1-6448. National Academy of Sciences, National Research Council, Commission on Life Sciences, and Food and Nutrition Board (1989).“Diet and Health: Implications for Reducing Chronic Disease Risk.” National Academy Press, Washington, D.C. National Cancer Institute and NCI Division of Cancer Prevention and Control (1991). “Cancer Statistics Review: 1973- 1988.” U.S. Department of Health and Human Services, Public Health Service, National Institutes of Health, Bethesda, Maryland. Nayfield, S. G., Karp, J. E., Ford, L. G . , Dorr, A., and Kramer, B. S. (1991).J.Natl. Cancer Imt. 83, 1450-1459. Newmark, H. L., Lipkin, M., and Maheshwari, N. (1991).Am.J. Clin. Nutr. 54,209s-214s. Newmark, H. L., Wargovich, M. J., and Bruce, W. R. (1984). J. Natl. Cancer Inst. 72, 13231325. Nigro, N. D., Bull, A. W., Klopfer, B. A., el al. (1979). J. Natl. Cancer Inst. 62, 1097-1 102. Ratko, T. A., Detrisac, C. J.. Dinger, N. M., Thomas, C. F., Kelloff, G. J., and Moon, R. C. (1989).Cancer Res. 49,4472-4476. Reddy, B. S. (1987).Prev.Med. 16,559-565. Rose, D. P. (1992).Nutrition 8,47-51. Rose, D. P., Goldman, M., Connolly, J. M., et al. (1991).Am. J . Clin. Nutr. 54, 520-525.

CANCER PREVENTION RESEARCH TRIALS

23

Rosenberg, L., Palmer, J. R., Zauber, A. G . ,Warshauer, M. E., Stolley, P. D., and Shapiro, S. (1991).J. Natl. Cancer Imt. 83, 355-358. Rozen, P., Fireman, Z., Fine, N., Wax, Y.,and Ron, E. (1989). Gut 30, 650-655. Schatzkin, A., Freedman, L. S., Schiffman, M. H . , e t a l . (199O).J. Natl. CancerImf. 82,17461752. Sidransky, D., Tokino, T., Hamilton, S. R., Kinzler, K. W., Levin, B., Frost, P., and Vogelstein, B. (1992). Science 256, 102-105. Sinkeldam, E. J., Kuper, C. F., Bosland, M. C., Hollanders, V. M. H., and Vedder, D. M. ( 1990). Cancer Res. 50, 1092- 1096. Slattery, M.L., Sorenson, A. W., and Ford, M. H. (1988). A m . ] . Epidemiol. 128, 504-514. Sporn, M. B. (1976). Cancer Res. 36, 2699. Sporn, M. B. (1991). Cancer Res. 51, 6215-6218. Steinmetz, K. A., and Potter, J. D. (1991a). Cancer Causes Control 2, 325-357. Steinmetz, K. A., and Potter, J. D. (1991b). Cancer Causes Control 2, 427-442. Stemmermann, G. N., Nomura, A., and Chyou, P. H. (1990). Dis. Colon Rectum 33, 190194. Taylor, J. A. (1989). A m . J . Epidemiol. 130, 6-13. Thun, M. J., Namboodiri, M. M., and Heath, C. W., Jr. (1991). N . Engl. J . Med. 325, 15931596. U.S. Food and Drug Administration (1991). Fed. Regkter 56, 60566-60578. Vogelstein, B., Fearon, E. R., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert, M., Nakamura, Y., White, R., Smits, A. M. M., and Bos, J. L. (1988). N . Engl. J. Med. 319, 525-532. Vogelstein, B., Fearon, E. R., Kern, S. E., Hamilton, S. R., Preisinger, A. C., Nakamura, Y., and White, R. (1989). Science 244, 207-211. Wargovich, M. J., Lynch, P. M., and Levin, B. (1991). Am. J . Clin. Nutr. 54, 202s-205s. Wattenberg, L. W. (1985). Cancer Res. 45, 1-8. Weinberg, R. A. (1991). Science 254, 1138-1 146. Weinstein, I. B. (1988). Cancer Rex. 48, 4135-4143. Weinstein, I. B. (1991). Cancer R u . 51, 5080s-5085s. Willett, W. C. (1990). Med. Oncol. Tumor Pharmacother. 7 , 93-97. Ziegler, R. G. (1991). A m . J . Clin. Nutr. 53, 251s-259s.

This Page Intentionally Left Blank

MOLECULAR GENETIC CHANGES IN HUMAN BREAST CANCER Marc J. van de Vijver Department of Pathology, State University Leiden, Postbus 9603, 2300 RC Leiden. The Netherlands

1. Introduction 11. Clinicopathological Aspects of Breast Cancer A. Normal Breast Histology B. Histologic Types of Breast Cancer C. Diagnosis and Treatment 111. Genetic Changes in Human Breast Cancer A. Amplification of Oncogenes B. Point Mutations C. Cytogenetic Studies D. Inactivation of Tumor Suppressor Genes IV. Genetic Predisposition to Breast Cancer V. Concluding Remarks References

1. Introduction T h e view that genetic alterations form the basic steps that change a normal cell into a malignant cell is now widely accepted and an increasing number of genetic alterations are being identified in breast cancer. Most gene alterations found to date have been identified in invasive carcinomas and little is known about genetic changes in carcinoma in situ, the only well-characterized early stage of breast cancer development. Therefore at present it is not possible to present a multistep model for breast cancer development. Much work is already in progress to link knowledge of genetic alterations with clinical outcome. An important reason for this is that assessment of prognosis affects treatment of breast cancer patients: patients with poor prognosis often receive some form of adjuvant treatment in addition to treatment of the primary tumor by surgery and/or radiotherapy. It is important to select those patients who will benefit from this adjuvant treatment. In this area of reasearch, close collaboration between clinicians and molecular biologists is very important. Apart from assessing prognoses, there are also other emerging clinical problems that may benefit from basic research, for example, detection of breast cancer at an earlier stage using screening mammography. With increasing frequency, breast tissue with 25 ADVANCES IN CANCER RESEARCH, VOL. 61

Copyright 0 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.

26

MARC J. VAN DE VIJVER

histologic changes that may precede invasive cancer, such as carcinoma in situ, is being removed. However, it is not precisely known which of these lesions will progress to invasive breast cancer and should consequently be treated, nor is it known what constitutes optimal treatment for these lesions. Inherited factors are known to play an important role in breast cancer development in a subgroup of patients; to define the gene alterations responsible for the inheritable predisposition to breast cancer development will be of great importance in clinical management. A genetic alteration results in qualitative or quantitative changes in the protein, encoded by the altered gene; research is being directed at understanding the function of these proteins and how they affect the behavior of cells. T h e most important goal of these studies is to use the emerging knowledge in the clinical management of breast cancer patients. The purpose of this review is to highlight the genetic studies concerned with human breast cancer and place these against the background of breast cancer histology and clinical aspects of breast cancer. Attention is also given to the method by which the genetic changes and the resulting alterations in the encoded protein products can be detected in clinical samples. 11. Clinicopathological Aspects of Breast Cancer

In order to establish a multistep model of genetic alterations in relation to initiation and progression of breast cancer, it is necessary to define the various steps histologically. This, however, is difficult to do: various types of invasive and intraductal (noninvasive) carcinomas are recognized based on histologic criteria, but at present there is no multistep model based on these various tumor types. Other than the noninvasive carcinomas, no precursor lesions to breast carcinomas have been identified with certainty. The histology of the normal breast, of breast carcinomas, and of some other breast lesions are discussed in this section. Since the association with clinical outcome of the various genetic alterations may have important implications for clinical management, some aspects of diagnosis and treatment are addressed also. A. NORMAL BREASTHISTOLOGY The breast (Fig. 1A) is a gland consisting of branching ductal structures ending in lobules, which are embedded in fibrous and fatty tissue. T h e glandular breast tissue, embedded in fatty tissue, rests on the large

MOLECULAR GENETICS I N BREAST CANCER

A

B

27

C

FIG. 1 . Development of ductal carcinoma in situ and invasive carcinoma. (A) Normal breast, in which one of the 15 segments is depicted. (B) Ductal carcinoma in situ (DCIS) within this segment; all cancer cells are confined to the epithelial compartment of the breast. (C) Invasive carcinoma adjacent to DCIS. Cancer cells infiltrate fibrous and fatty tissue outside the epithelial compartment.

pectoral muscle, from which it is separated by a fascia, and is covered by skin. Two major portions of the glandular tissue can be recognized: the large duct system and the terminal duct lobular unit (TDLU). Lobules and all ducts are lined by two layers of epithelial cells: luminal epithelium and the basally located myoepithelium. The lobular and ductal structures are embedded in a myxoid, specialized stroma. T h e larger ducts all come together in a segmental duct; these segmental ducts all have a separate ending in the nipple. T h e breast contains approximately 15 segments, which do not have sharply defined anatomical borders.

TYPES OF BREAST CANCER B. HISTOLOGICAL Of all breast tumors, carcinomas, i.e., malignant tumors of the epithelium, are the most frequent. Other cancers, for instance, sarcomas and lymphomas of the breast, d o occur, but will not be discussed here; these rare tumors have also not been considered in the genetic studies of breast cancer. T h e site of origin of most carcinomas is the TDLU (Azzopardi, 1979). It seems likely that many, if not all, invasive breast carcinomas (Fig. 1C) are preceded by a carcinoma in situ (Fig. lB), which originates in the TDLU. Two major forms of carcinoma in situ are recognized: lobular carcinoma in situ (LCIS) and ductal carcinoma in situ (DCIS). Carcinoma in situ represents a malignant epithelial cell proliferation confined to the epithelial compartment of preexisting ducts and lobules, without evidence of invasive growth. As to be expected given the lack of invasive growth, lymph node metastases accompanying CIS are very rare, and the disease carries an excellent prognosis. Ductal carcinoma in situ is considered to be a precursor to invasive carcinoma, but it is

28

MARC J. VAN DE VIJVER

not known what proportion of DCIS will progress to invasive carcinoma and how long this progression takes; DCIS is subclassified according to morphological growth pattern into comedo, solid, cribriform and (micro)papillary types (Page and Anderson, 1987). Lobular carcinoma in situ represents a malignant proliferation of lobular epithelial cells, confined to the epithelial compartment of lobules, but sometimes also involving ducts; LCIS is considered a low grade malignancy which gives rise to invasive carcinoma at low frequency. The type of invasive carcinoma found in association with LCIS is often, but not always, invasive lobular carcinoma. T h e various histologic types of invasive breast carcinoma and their approximate frequency in a Western population are given in Table I. As can be seen, invasive ductal carcinoma n.0.s. ( not otherwise specified) accounts for the majority of breast cancers, followed by invasive lobular carcinoma. The other, relatively rare, types can be considered tumors of epithelial cells with specific differentiation, for instance, colloid carcinoma, in which the tumor cells are mucin-secreting cells. Are there other breast lesions that could be direct precursors to invasive carcinoma o r are there precursors to carcinoma in situ? Fibrocystic changes are an example of histologically defined lesions that are frequently found and that are sometimes associated with increased risk of developing carcinoma. Not associated with increased risk are histologic lesions classified as fibrosis, adenosis, cysts, apocrine metaplasia, mild epithelial hyperplasia, fibroadenoma, duct ectasia, and mastitis. Moderate epithelial hyperplasia is associated with some increase in the risk of developing breast cancer, but the epithelial cells in epithelial hyperplasia d o not appear to be precursors to breast carcinoma. This condition, TABLE I MAJORTYPES OF INFILI.RATING CARCINOMA AND THEIR APPROXIMATE FREQUENCY" Histologic type Ductal Predominantly intraductal with minimal invasion Lobular Medullary Tubular Co11oi d Papillarylcribriform Data from Page and Anderson, 1987.

Frequency (%) 47-75 3-13 2-14 2-15 1-7 2-9 0.5-9

MOLECULAR GENETICS IN BREAST CANCER

29

then, merely reflects a marker of increased risk and is not a direct precursor. Page and Dupont have described atypical epithelial hyperplasia, which is defined as epithelial hyperplasia with some features of DCIS (Dupont and Page, 1985).Atypical hyperplasia is associated with a 5-fold increased risk of developing breast cancer in the general population, but with an 1 l-fold increased risk in women with a family history of breast cancer. It remains to be established whether atypical ductal hyperplasia is a direct precursor to breast carcinoma, or only a marker of increased risk. C. DIAGNOSIS AND TREATMENT Invasive breast carcinoma is usually detected when a lump is felt by the patient or her physician; the tumor is usually larger than 1 cm and in many instances (over 50% of patients in most series) the tumor will be larger than 2 cm. To detect breast cancer at an earlier stage, in many countries screening programs are being started, in which mammography is performed at a regular interval, for instance, every 2 years, in women over a certain age, for example, 50 years. The primary treatment of low-stage breast cancer is surgery. Following surgery, adjuvant hormonal treatment or adjuvant chemotherapy may be considered. Large prospective studies have shown that such adjuvant treatment results in improved prognosis for patients with operable breast cancer (Early Breast Cancer Trialists’ Collaborative Group), 1992a, b). Although the presence of tumor metastases in axillary lymph nodes is generally used as a selection criterium for adjuvant therapy, a proportion of lymph node-positive tumors will not develop distant metastases and may therefore be overtreated. Likewise, some patients without lymph node metastases but who later developed distant metastases could possibly have benefited from adjuvant treatment. Therefore, additional prognostic factors are of great clinical value. The ideal prognostic factor should identify all patients who will develop distant metastases, and should be absent in all other patients. A large number of risk factors in node-negative breast cancer patients has been reviewed by McGuire and colleagues (McGuire et al., 1990), and it is clear that no single risk factor comes close to this ideal. Even if risk factors identify subgroups of patients that are at an increased risk of developing metastases, the increase in risk may be too small to form the basis for clinical decisions. The classical treatment for breast cancer is removal of all breast tissue; in most (but not all) centers the axillary lymph nodes are also removed. In recent years, experience with breast conserving treatment

30

MARC J. VAN DE VIJVER

has accumulated rapidly. Randomized clinical trials have shown that outcome of breast conserving treatment is as good as that of mastectomy. Breast conserving treatment implies tumor excision, usually followed by radiotherapy. T h e width of excision and amount of radiotherapy that form optimal treatment are the subject of ongoing clinical studies. Ductal carcinoma in situ is sometimes detected as a palpable lump, but because DCIS grows within the confinement of preexisting ducts, the formation of a lump is not frequent and DCIS is usually detected only at screening mammography. Mammographically, DCIS is characterized by typical patterns of microcalcifications. When breast cancer is detected by screening mammography, DCIS constitutes 20% of all cancers, whereas it constitutes only 3% in non-screen-detected cancers. The spread of DCIS along the ductal system of the breast is segmental and often extensive at the time of diagnosis (Holland et d.,1990). Therefore the treatment of choice is mastectomy, as this will remove all tumor and usually leads to complete cure. Clinical trials are being conducted to investigate whether breast conserving treatment is also feasible in DCIS (van Dongen et al., 1989).

Ill. Genetic Changes in Human Breast Cancer T h e types of genetic alteration that have been found in human tumors include oncogene amplification, inactivation of tumor suppressor genes, point mutations, and translocations. Genetic alterations in breast cancer have been studied by analyzing DNA extracted from primary breast carcinomas and from approximately 10 established breast cancer cell lines. Extraction of DNA from primary carcinomas was mainly from frozen tumor material. It is possible to extract DNA from paraffin embedded material, but this DNA is of low molecular weight, making Southern blot analysis unreliable. Most institutes receiving tumor material have only recently started to collect and store frozen tumor tissues; therefore the follow-up time for the patients in most studies is relatively short. Using hybridization of Southern blots with tumor DNA samples with a variety of oncogene probes, amplification of a number of genes has been found relatively frequently in breast cancer (Table 11). Deletion of regions of DNA, hinting at the loss of a tumor suppressor gene, is also relatively common (Table 111). The loss of DNA is usually detected as loss of heterozygosity of a polymorphic allele. To perform this analysis, DNA extracted from the tumor and from normal tissue from the same patient has to be compared. T h e normal DNA for these studies is usually obtained from peripheral blood lymphocytes.

MOLECULAR GENETICS I N BREAST CANCER

31

TABLE 11 GENEAMPLIFICAI.ION I N BREASTCANCERn

% Amplification (range)

Gene c-myc neu (c-m6B-2, HER-2) int-2/bcI-l/PRAD-l/EMS EGF receptor (c-er6B-1) IGF-1 receptor flg bek

15 (6-32) 20 (9-33) 15 (5-23) 3 (0-14) 2 13 12

a T h e genes that are found to be amplified and the approximate percentage of primary breast carcinomas harboring gene amplification are given. When several studies were done, the range of the percentage in which amplification was found is given.

A. AMPLIFICATION OF ONCOGENES Gene amplification results in an increase in the number of copies of a gene, which in turn leads to increased mRNA synthesis and increased protein production. Amplification of a gene is the result of overreplication, together with a selective advantage for cells that contain an increased copy number of the selectable gene. This selective growth advantage is provided by increased levels of the protein encoded by the amplified gene. The gene that confers a selective advantage is amplified together with a variable region of surrounding DNA, which generally ranges from 100 to 1000 kb and may contain other, “coamplified”genes. Coamplified genes that are not expressed at the mRNA level can be

TABLE 111 Loss OF HETEROZYCOSITY IN BREAST CANCER^ % loss of heterozygosity

Chromosome arms with allele loss

~~

>50 30-50 20-30

17P Iq, 3p, 6q, 7q, 8q, 9q, 15q, 16q, l7q. 18q lp, lq, 2p, 2q, loq, Ilp, Ilq, 13q914q, 18p, 21q, 22q

a T h e chomosomal arm and percentage of cases for which loss of heterozygosity was found are given. T h e percentage of tumors with loss of heterozygosity was derived from the pooled data in section I l l D.

32

MARC J . VAN D E VIJVER

ruled out as being the important gene in the amplified region of DNA. However, coamplified genes may be overexpressed at the mRNA and protein level if they were expressed before the occurrence of amplification of the chromosomal region in which they are located (van der Bliek and Borst, 1989). To assign biologic importance to a gene in a region of amplified DNA it is essential, but not sufficient, to find overexpression of this gene. In addition, biologic activity of the gene has to be studied in, for instance, transfection assays. An overview of the genes or chromosomal regions that have been found to be amplified in breast cancer is given in Table I1 and will be discussed in the subsequent subsections.

a. Amplification of the neu (c-erbB-2, HER-2) Gene The neu oncogene, also known as c-erbB-2 or HER-2, was first identified as a transforming oncogene in DNA from chemically induced neuroblastomas in the rat (Schechter et al., 1984). T h e predicted neu protein is homologous to, but distinct from, the epidermal growth factor (EGF) receptor (Schechter et al., 1985; Bargmann et al., 1986). Several proteins with properties expected of a neu ligand have been isolated (Lupu et al., 1990; Dobashi et al., 1991; Peles et al., 1992). T h e gene encoding one of these ligands, a 44-kDa protein, has been shown to encode a large precursor protein with homology to epidermal growth factor (Wen et al., 1992). T h e neu gene is amplified in adenocarcinomas of a variety of organs, including the breast, where the gene is amplified in approximately 20% of cases. Research on neu gene amplification has attracted much attention following the initial finding of an association with poor prognosis in breast cancer by Slamon and co-workers (Slamon et al., 1987). At present, many reports have appeared on the correlation between neu gene amplification and prognosis in breast cancer; the outcome of these studies has been variable (Cline et al., 1987; Slamon et al., 1987, 1989; Ali et al., 1988; Adnane et al., 1989; Garcia et al., 1989; Tsuda et al., 1989; Zeillinger et al., 1989; Guerin et al., 1989; Zhou et al., 1989; Borg et al., 1990). I n addition, overexpression of neu protein using immunohistochemistry on archival, paraffin-embedded, formalin-fixed tissues of patients with long follow-up has been correlated with clinicopathological parameters, especially prognosis (van de Vijver et al., 1988b; Thor et al., 1989; Gullick et al., 1991; Lovekin et al., 1991). neu gene amplification was found to be always accompanied by an increase in expression at the neu mRNA level (van de Vijver el al., 1987; Kraus el al., 1987) as well as the neu protein level (h4ori et al., 1987; van d e Vijver et al., 1988a; Slamon et al., 1989). There is a close correlation between neu gene amplification and immunohistochemical neu membrane staining, validating the study of association between immu-

MOLECULAR GENETICS IN BREAST CANCER

33

nohistochemical neu protein overexpression and clinicopathological parameters in breast cancer. neu gene amplification and neu protein overexpression correlate with high tumor grade and with negative estrogen and progesterone receptor status. Especially in lymph node-positive patients, neu gene amplification and protein overexpression are associated with poor short-term prognosis (Slamon et al., 1989; Lovekin et al., 1991). In node-negative patients this association is less strong (Slamon et al., 1989) and overexpression of neu is not associated with the presence of lymph node metastases. An explanation of these findings could be that neu overexpression leads to a high growth rate of tumor cells, but not to increased metastatic potential. A main goal of adjuvant treatment is to eradicate microscopic metastases at the time of diagnosis. If neu positivity is not associated with increased rate of metastasis it does not seem to be a good prognostic factor to guide adjuvant treatment. neupositive tumors may have a distinct response to chemotherapy; this remains to be investigated further. Whereas 20% of invasive carcinomas overexpress neu, no less than 50% of all DCIS show neu membrane staining. neu overexpression is found in almost all cases of DCIS consisting of large cells, but very rarely in DCIS of small cell type (van de Vijver et al., 1988b; Ramachandra et al., 1990). Large-cell DCIS usually shows a solid growth pattern, often with comedo necrosis. An example of a DCIS overexpressing neu protein is shown in Fig. 2. Sometimes a large-cell DCIS reaches the surface epithelium of the nipple; this is known as Paget’s disease. These tumor cells in the surface epithelium of the nipple, like the underlying DCIS, always show neu membrane staining (Lammie et al., 1989). In large-cell DCIS, the tumor cells show frequent mitoses and have marked nuclear atypia. T h e lesions are usually large (several centimeters); since most patients are treated shortly after detection of their DCIS by excision, the normal biologic behavior is not known with certainty. Ductal carcinoma in situ consisting of small cells usually has a cribriform or micropapillary growth pattern. In these lesions, neu membrane staining is very rare. It may be better to classify DCIS according to cell type rather than growth pattern, as the large-cell DCIS most likely exhibits clinical behavior markedly different from that of the small cell type; the presence or absence of neu membrane staining will be an important aid in making this subclassification. T h e supposition that neu gene amplification alone does not lead to invasive growth of tumor cells is best illustrated by the frequent presence of neu positivity in DCIS, a tumor that by definition lacks invasive growth.

34

MARC J. VAN DE VIJVER

FIG.2. neu membrane staining in a large-cell comedo-type ductal carcinoma in situ. The section was immunohistochemically stained using monoclonal antibody 3B5,directed against neu protein (van de Vijver et al., 1988b). Staining was done using an avidin-biotin complex method on formalin-fixed, parafin-embedded material.

Monoclonal antibodies reactive with domains of the neu protein exposed on the surface of intact cells have been raised (Hudziak et al., 1989; McKenzie et al., 1989; Masuko et al., 1989; Fendly et al., 1990; van Leeuwen et al., 1990; Saga et al., 1991). One of these can inhibit the growth of SKBR-3 cells, a breast cancer cell line with neu protein overexpression as a result of neu gene amplification (Hudziak et al., 1989). Breast cancer cell lines with a normal neu gene copy number are not growth inhibited by this antibody. This may provide novel therapeutic approaches for tumors overexpressing the neu protein.

2. Amplification o f a Repon of DNA on Chromosome I I q 1 3 A region DNA on chromosome 1 lq13 is amplified in about 15-20% of human breast cancers; amplification has also been found in other tumor types, including squamous cell carcinomas (Zhou et al., 1988). This was first discovered using a probe for the int-2 gene (Lidereau et al., 1988), a gene that is frequently activated in mouse breast tumors as a

MOLECULAR GENETICS IN BREAST CANCER

35

result of proviral insertion of the mouse mammary tumor virus (MMTV). Since the znt-2 gene is not expressed in human tumors with int -2 gene amplification, no biologic effect can be expected in these tumors. It is conjectured that (an)other gene(s) in the amplified chromosomal region that contains the int-2 gene confers a selective growth advantage when amplified. Other genes in this region include hst (Theillet et al., 1989), a fibroblast growth factor that is also not expressed at the mRNA level in breast carcinomas with amplification of 1lq13; the bcl-1 region (Theillet et al., 1990), which is involved in chromosomal translocation events in some lymphomas; and the gene for glutathione S-transferase (Saint-Ruf et al., 1991), mRNA expression of which is not known in tumors with l l q 1 3 amplification. Two other genes, which are always coamplified with znt-2, d o show mRNA expression in breast carcinomas and overexpression in tumors with 1lq13 amplification; PRAD-1 and EMS (Lammie et al., 1991; Schuuring et al., 1992). PRAD-1 encodes a G1 cyclin (recently named cyclin D1) and was first identified as a gene activated by translocation in a parathyroid adenoma (Motokura et al., 1991). EMS-1 is a hitherto unknown gene, which was picked u p using a differential cDNA cloning approach (Schuuring et al., 1992). T h e further characterization of the role of PRAD-1, EMS- 1, and possible other genes in this chromosomal region in human breast cancer is under way. Amplification of the llq13 region has mainly been studied using probes for znt-2, bcl- 1, and hst- 1 and is found in approximately 15% of all breast carcinomas, the percentage of tumors with amplification ranging from 5 to 23% (Lidereau et al., 1988; Tsutsumi et al., 1988; Zhou et al., 1988; Adnane et al., 1989; Ali et al., 1989; Machotka et al., 1989; Theillet et al., 1989, 1990; Tsuda et al., 1989; Fantl et al., 1990; Meyers et al., 1990; Borg et al., 1991; Saint-Ruf et al., 1991). Amplification of the 1 lq13 region has been found to be associated with a number of clinicopathological features: poor prognosis (Lidereau et al., 1988; Tsuda et al., 1989; Borg et al., 1991); the presence of lymph node metastases (Adnane et al., 1989; Zhou et al., 1988); estrogen receptor and progesteron receptor positivity (Adnane et al., 1989; Fantl et al., 1990; Borg et al., 1991), and age <50 years (Machotka et al., 1989; Tsuda et al., 1989). Interestingly, amplification of the 1lq13 region seems to identify breast carcinomas that are frequently estrogen receptor- and progesteron receptor-positive and have a relatively poor prognosis, this despite the fact that estrogen and progesteron receptor positivity are associated with relatively good prognosis. The characteristics of tumors with 1lq13 region amplification are quite different from those with neu gene amplification (Borg et al., 1991) and, indeed, 1lq13 region amplification and neu gene amplification are only rarely seen in the same

36

MARC J. VAN DE VIJVER

tumor. This indicates that 1lq13 region amplification may be part of a distinct genetic pathway leading to invasive breast carcinoma. The study of 1lq13 region amplification has thus far only been done by Southern blot hybridization of DNA isolated from tumors. Now that two genes are found to be overexpressed at the mRNA level, it may be possible to study overexpression of protein encoded by either the PRAD-1 or the EMS gene. It is hoped that one or both of these proteins can be detected in formalin-fixed, paraffin-embedded tissue and that overexpression is closely correlated to the presence of l l q 1 3 region amplification, as this will open archival tumor material for analysis.

3. Amplification of the c-myc Gene Overexpression of c-my by several mechanisms is found in a variety of different tumors. c-myc protein is a nuclear protein that could be involved in the regulation of transcription of other genes important for cell growth regulation (Blackwood and Eisenman, 1991). In breast carcinomas and breast carcinoma cell lines, c-my amplification has been observed in 6-32% of cases (Kozbor and Croce, 1984; Escot et al., 1986; Cline et al., 1987; Bonilla et al., 1988; Guerin et al., 1988; Garcia et al., 1989; Seshadri et al., 1989) and was accompanied by high levels of c-myc mRNA (Guerin et al., 1988; Mariani-Constantini et al., 1988). T h e gene is less frequently rearranged in other ways (Escot et al., 1986; Varley et al., 1987; Morse et al., 1988; Bonilla et al., 1988). Amplification of c-myc andlor overexpression of c-my mRNA has been associated with inflammatory carcinoma (Garcia et al., 1989), age >50 years (Escot et al., 1986), lymph node involvement (Guerin et al., 1988), and poor prognosis (Guerin el al., 1988; Berns et al., 1992a). The number of patients studied for association of c-myc amplification with prognosis is rather small, especially when compared to those studied for neu gene amplification. In one series of patients, the association of c-myc amplification with poor prognosis was much stronger than that of neu gene amplification (Berns et al., 1992a). Clearly, further studies are needed here. Analysis of c-my amplification has been done using DNA isolated from frozen tumor specimens. For a limited number of tumors mRNA has been analyzed (Mariani-Constantini et al., 1988). Immunohistochemistry of c-my protein has not been reported in breast carcinomas. For analysis of c-my mRNA and protein, tumor material has to be frozen rapidly after excision, since c-my mRNA and c-my protein have a short half-life (Persson et al., 1986; Ong et al., 1990). With routine processing of tumor material for histopathological examination, c-my protein will degrade before the tissue is fixed. As a result, unfortunately, most archi-

MOLECULAR GENETICS IN BREAST CANCER

37

val formalin-fixed, paraffin-embedded tumor material is not amenable to immunohistochemical analysis of c - m y protein overexpression.

4 . Amplification of the EGF Receptor Gene

T h e EGF receptor is a 170-kDa transmembrane glycoprotein, which is found on many cell types, including breast cancer cells. In addition to EGF a number of growth factors bind to and activate the EGF receptor; these factors include transforming growth factor a (TGF-a), epidermal growth factor, and amphiregulin (Derynck, 1992). T h e EGF receptor has a cysteine-rich cell-external domain that binds the ligand, a transmembrane domain, and a cell-internal domain that contains a tyrosinespecific protein kinase; the kinase is activated upon binding of EGF to the receptor. Activation usually results in a growth-stimulatory effect, which is quite weak in the breast cancer cell lines tested. Amplification of the EGF receptor gene accompanied by elevated levels of mRNA and protein has occasionally been reported in breast cancer cell lines (King et al., 1985; Filmus et al., 1985), and in approximately 3%of the primary carcinomas studied (Slamon et al., 1987; Ro et al., 1988). In the absence of EGF receptor gene amplification, variations in the number of EGF receptors found on primary breast carcinomas are probably important in tumor growth. This importance is mainly highlighted by clinical studies. Epidermal growth factor binding of breast carcinoma cells has been correlated to several clinicopathological parameters. High EGF receptor content is associated with tumors negative for the estrogen receptor (Sainsbury et al., 1985). In the group of patients negative for estrogen receptor, high EGF receptor content is associated with poor prognosis (Sainsbury et al., 1987), but this association is not found by all investigators (Foekens et al., 1989). What determines the number of EGF receptors on tumor cells in these cases remains to be explored. The number of EGF receptors is usually determined using a binding assay; there are also some reports on immunohistochemical detection of EGF receptor expression in formalin-fixed, paraffin-embedded tumor sections (Gullick et al., 1991). It is not known whether there is a good correlation between the number of EGF receptors assessed by EGF binding and immunohistochemically detected EGF receptor expression. How EGF receptor gene amplification relates to immunohistochemically detected EGF receptor expression has not been reported.

5 . Amplification of the IGF-1 Receptor Gene The insulin-like growth factor 1 receptor gene encodes the receptor for IGF-1, also known as somatomedin C. The IGF-1 receptor is

38

MARC J. VAN DE VIJVER

composed of two extracellular 135-kDa a-subunits that bind ligand, complexed to two intracellular 90-kDa P-subunits that are inserted into the cell membrane and contain tyrosine kinase activity. Insulin-like growth factor 1 receptors can be demonstrated on most breast carcinomas and IGF-1 has a growth-stimulatory effect on IGF-1 receptorpositive breast cancer cells in vitro (Macaulay, 1992). Amplification of the IGF-1 receptor gene has been found in 2% of breast carcinomas (Berns et al., 1992b) and is associated with markedly increased numbers of IGF- 1 receptors as measured by Scatchard analysis of binding of radioactively labeled IGF- 1. Variation in IGF- 1 receptor content in tumors with normal IGF-1 receptor gene copy number may also be important: relatively high IGF-1 receptor content has been found associated with estrogen receptor (but not progesterone receptor) positivity and higher age at diagnosis. As frozen tumor material is required for IGF-1 binding assays, it would be useful to be able to detect IGF- 1 receptors using immunohistochemistry on formalin-fixed, paraffin-embedded tumor material; this may be explored in the future. 6 . Amplification of bek and flg Receptors for Members

ofthe FGF Family Bacterial-expressed kinase (bek) and fms-like gene (flg) encode distinct cell membrane-located receptors that bind acidic and basic FGF with high affinity. One recent report describes amplification of the flg and bek genes, each in a distinct group of breast carcinomas (Adnane et al., 1991). As this is the only report, the analysis of amplification of these genes in relation to clinicopathological parameters is not very extensive. The flg and bek genes are each undoubtedly also part of a larger chromosomal region that is amplified; whether they are the genes conferring the selective growth advantage in these tumors remains to be established. It has not yet been reported whetherflg and bek mRNA are expressed in the tumors with flg and bek gene amplification. T h e flg gene is located on chromosome 8 and is amplified in 12.7% of breast carcinomas. Chromosome 8 has been found to contain a homogeneously staining region (HSR; see Section II,C) in 18% of cases (Gerbault-Seureau et al., 1987a), and it is tempting to speculate that this HSR corresponds to the chromosomal region containing theflg gene. Amplification offlg is associated with the presence of amplification of the 1lq13 region. bek gene amplification is found in 11.5% of breast carcinomas and is more frequently encountered in tumors that also harbor c - m y gene amplification.

MOLECULAR GENETICS IN BREAST CANCER

39

B. POINTMUTATIONS T h e only point mutations thus far detected in human cancer are those in the rm family of genes, in the p53 gene and in the prohibitin gene (for the latter two, see Section 11,D). Mutations in the rm genes are rare in human breast cancer. This is in contrast to adenocarcinomas of, for instance, colon and lung, where point mutations in c-Ki-rm are frequent (Rodenhuis et al., 1987; Vogelstein et al., 1988). In breast cancer, the first mutation in a ras gene, in particular the c-Ha-rm gene, was found in a cell line using transfection of NIH/3T3 cell lines (Kraus et al., 1984). Two more breast cancer cell lines have been shown to contain ras gene mutations, affecting the c-Ki-rm gene in both cases. Using the polymerase chain reaction, followed by selective oligonucleotide hybridization (Bos, 1989), only 2 tumors out of a total of 91 primary breast carcinomas were shown to contain a point mutation in the c-Ki-rm gene (Rochlitz et al., 1989; van d e Vijver et al., 1989). From this it appears that rm gene mutations affect only a minor proportion of all tumors. In rat neuroblastomas, the neu gene is activated by a point mutation, resulting in an amino acid substitution in the transmembrane part of the protein. Similar point mutations were screened for in human breast cancer, but no point mutations were found (Lemoine et al., 1990). C. CYTOCENETIC STUDIES

By studying chromosomal (cytogenetic) alterations in breast carcinomas, important starting points can be obtained for further, more detailed analysis involving the cloning of genes. T h e alterations in chromosomes that can be found are numerical and structural changes (Sandberg et al., 1988). For most solid tumors, including breast carcinomas, it is difficult to obtain direct chromosome preparations of sufficient quality for a detailed chromosome analysis; it is also difficult to maintain breast carcinoma cells in tissue culture. As a result, a full analysis of all chromosomes has been obtained only for a limited number of breast cancers. Chromosomal analyses have also been done on cancer cells from metastatic pleural effusions, from which the yield of breast cancer cells for tissue culture is relatively high. The chromosomal alterations found in breast carcinomas are often complex, involving numerous structural changes. T h e chromosome most frequently involved in numerical and structural alterations is chromosome 1, which often shows gain of the q arm (Gerbault-Seureau et al., 198713) or is involved in the formation of marker chromosomes. Other chromosomes relatively

40

MARC J. VAN DE VIJVER

frequently involved in numerical and structural alterations are chromosomes 6, 7, 11 (Trent, 1985) and 3 and 19 (Gebhart et al., 1986).Loss of (parts of) chromosomes 6, 8, 16, 17, 22, and X has also been found (Gebhart et al., 1986; Gerbault-Seureau et al., 1987b; Dutrillaux et al., 1990). However, the breakpoints in the reported cases were random and specific translocations, as found in many hematopoietic tumors and some solid tumors (Sandberg et al., 1988), have thus far not been described. Interstitial deletions have been found for several regions, but these data have not been coupled with those on loss of heterozygosity. Ideally, one would like to get full karyotypes of many primary breast carcinomas and start by looking for common chromosomal abnormalities. Until now this has been difficult for the reasons described; ongoing efforts in improving tissue culture techniques and the refinements in preparing metaphase chromosome preparations and banding techniques will probably produce more specific karyotypic alterations in breast cancer in the coming years. The presence of double minutes (DMs) and HSRs, the cytogenetic equivalents of gene amplification, has been reported in approximately 40% of primary carcinomas and metastatic cells of pleural effusions (Gebhart et al., 1986; Gerbault-Seureau et al., 1987a; Dutrillaux et al., 1990). For most of these tumors it has not been investigated whether known oncogenes were amplified in the tumors containing DMs; in view of the frequency of amplification of oncogenes, reviewed in the previous section, many of these tumors are likely to contain amplification of one or more of these genes. For a number of tumors this has indeed been shown (Saint-Ruf et al., 1990).

D. INACTIVATION OF TUMOR SUPPRESSOR GENES Another important genetic alteration in breast cancer is the inactivation of tumor suppressor genes. These genes normally exert functions counteracting the transformed phenotype. There are various mechanisms by which these genes can be inactivated, which include deletion of the whole gene, point mutation, and small deletions o r rearrangements in the gene. T h e inactivation can affect one or both alleles. T h e point mutations can, for instance, affect the processing of mRNA, by interfering with RNA splicing; also, as described for the p53 gene (see further), a point mutation can result in an altered protein that can interfere with the normal function of the wild-type allele and thus confer a “dominant negative” effect. If the actual recessive oncogene is unknown, one can obtain evidence

MOLECULAR GENETICS IN BREAST CANCER

41

for the existence of such a gene by searching for loss of heterozygosity at linked polymorphic DNA markers. For this, DNA from breast carcinomas is compared to DNA from normal cells from the same patient using restriction enzyme fragment length polymorphisms (RFLPs). Loss of heterozygosity has been detected for loci on all chromosomes, often involving loss of several loci in the same tumor. In part, the loss of heterozygosity may be a result of random changes in tumor DNA, associated with genetic instability. For some of the chromosomal regions, loss of heterozygosity is very frequent, hinting at the presence of a tumor suppressor gene (Table 111). The regions of DNA that are found deleted are usually quite large, sometimes encompassing a whole chromosome arm o r even a whole chromosome. Which of the many deleted genes is the actual tumor suppressor gene has to be determined by other means. It may be that loss of expression of one of the two gene copies already results in a contribution to the transformed phenotype. In those cases it will be difficult to pinpoint the gene whose deletion is implicated in tumorigenesis. More likely, two alleles of the tumor suppressor gene will have to be deleted. When loss of heterozygosity is found, one allele is retained and must be inactivated by a mechanism other than deletion of a large region of DNA. In those cases, the presence of a gene rearrangement, interstitial deletion, or point mutation will give away the tumor suppressor gene. Thus far, a tumor suppressor gene has been identified for only four regions of frequent allele loss: p53 on chromosome 17p; Rb on 13; DCC on 18; and prohibitin on 17q. In view of the high frequency of other allele losses, it is likely that many tumor suppressor genes remain to be discovered in breast cancer. 1 . Allele Loss on Chromosome 17p: The P53 Gene T h e highest frequency of allele loss in primary breast carcinomas has been found for a region on the short arm of chromosome 17: this region is deleted in well over 50% of informative cases (Sato et al., 1990; Larsson et al., 1991; Thompson et al., 1990; Chen et al., 1991; Devilee et al., 1991b; Varley et al., 1991). T h e region deleted includes the p53 gene. T h e p53 gene encodes a 53-kDa nuclear phosphoprotein that binds to DNA as a homodimer (Kern et al., 1991); p53 inhibits transformation of primary rodent cells by ElA and ras, indicating that p53 is a tumor suppressor gene (Finlay et al., 1989). In many tumors, including breast cancer, cases are found in which the p53 gene contains a single base substitution, resulting in a p53 protein with altered growth-regulatory properties (Hollstein et al., 1991). In the various tumor types studied, these point mutations are usually found in exons 5 , 6 , 7 , and 8 and result in amino acid substitutions of residues that are highly conserved during

42

MARC J. VAN DE VIJVER

evolution. Less frequently, the p53 gene has undergone structural alterations, resulting in complete loss of protein expression o r expression of a truncated protein (Varley et al., 1991). Four different changes in p53 gene configuration may be present in a breast carcinoma: (a) one wild-type allele, one deleted or inactivated allele; (6) both alleles deleted or inactivated; (c) one wild-type allele, one mutated allele; (d) one allele deleted or inactivated, one mutated allele. It has been shown that in the presence of a wild-type allele, the mutant p53 can act in a dominant-negative fashion and is thought to inactivate the product of the wild-type allele by complex formation. It is possible that each of the four described genetic variations in p53 gene status has a distinct biologic effect on tumor behavior. In addition, there is evidence from in vitro experiments that the various different p53 point mutations have different effects on cell growth (Havely et al., 1990). From this it is clear that in breast carcinomas, one of a plethora of different p53 gene alterations may be present, and that the various different alterations may each differ in their effect on cell growth. Mutant forms of p53 protein have an increased half-life. Whereas wild-type p53 protein is not detectable using immunohistochemistry, primary breast carcinomas and breast carcinoma cell lines frequently show strong nuclear staining in immunohistochemistry with various antibodies directed against p53 (Bartek et al., 1991; Prosser et al., 1990). An example of such staining is shown in Fig. 3. The tumors showing this p53 nuclear staining have been found to contain point mutations in a number of cases (Bartek et al., 1991). Whether the association of immunohistochemically detectable p53 staining with the presence of a pointmutated p53 gene is absolute remains to be established. T h e percentage of breast carcinomas positive for p53 nuclear staining is 50-60%. From the limited data available, the percentage of breast carcinomas with a point-mutated p53 gene appears to be lower: approximately 30% (Prosser et al., 1990; Varley et al., 1991; P. Devilee and C. Cornelisse, personal communication). In view of these figures, increased levels of p53 protein may also be the result of mechanisms other than p53 gene point mutations. Indeed, there is evidence that a region on chromosome 17p, distal from p53, contains a tumor suppressor gene, the deletion of which results in increased levels of p53 mRNA (Coles et al., 1990). Immunohistochemically detected overexpression of p53 and point mutations has been found in 2 of 15 ductal carcinomas in situ (Davidoff et al., 1991), indicating that the mutation may be an early step in breast cancer development. Not much information is yet available concerning association of p53 point mutation, p53 overexpression, or loss of heterozygosity for 17p

MOLECULAR GENETICS IN BREAST CANCER

43

FIG. 3. p53 nuclear staining in an invasive ductal carcinoma. The section was immunohistochemically stained using monoclonal antibody I80 1 , directed against p53 protein (Bartek el al., 1991). Staining was done using an avidin-biotin complex method on frozen sectioned material.

and clinicopathological parameters. Immunohistochemical staining for p53 overexpression can be done on formalin-fixed, paraffin-embedded tumor material, so that archival material can be analyzed. It should not be long before these data will start to emerge. The analysis of point mutations and loss of heterozygosity will be much more time consuming. One of the findings so far is that loss of heterozygosity for 17p is associated with a high proliferative fraction and with aneuploidy (Chen et al., 1991). 2 . Allek Loss on Chromosome 13q: The Rb Gene Allele loss for chromosome 13 is found in approximately 25% of breast carcinomas (Lundberg at al., 1987; Larsson et al., 1991; Sat0 et al., 1990; Devilee et al., 1991b). Located in this chromosomal region is the Rb gene, which was first isolated as a gene that is inactivated in retinoblastomas. T h e Rb gene is inactivated in retinoblastomas by a “twohit” mechanism: one allele is inactivated in the germline; in the tumors the second allele is also inactivated (Lee et al., 1987). The Rb gene

44

MARC J. VAN DE VIJVER

encodes a 105-kDa nuclear phosphoprotein with DNA binding properties that presumably regulates the growth of cells (Cooper and Whyte, 1989). In two of nine cell lines, the Rb gene contained structural alterations and no protein was detected by immunoprecipitation (Lee et al., 1988). In primary breast carcinomas, structural alterations are found in approximately 5% of cases (Varley et al., 1989; T'Ang et al., 1988). In retinoblastomas, the Rb gene is often inactivated as a result of point mutations. It remains to be established whether this is also the case in breast cancer. Compared to the study of other genetic changes, those involving Rb inactivation in breast cancer have thus far been limited and no data on association with, for instance, tumor histology or clinical outcome have emerged yet. This may in part be due to the great efforts required to find inactivation of Rb in breast cancer. Large interstitial deletions or loss of the whole gene is easy to detect, but small interstitial deletions o r point mutations require nucleotide sequencing of the whole gene or other laborious techniques (Yandell et al., 1989). Many of the inactivating mutations, accompanied by loss of the wild-type allele, will result in loss of Rb protein expression. Immunohistochemistry for Rb protein expression (Varley et al., 1989) with an antibody directed against a synthetic peptide has resulted in strong nuclear and weak cytoplasmic staining of normal epithelial and tumor cells. In breast carcinomas without Rb gene alterations this staining was uniform in all tumor cells; in tumors with loss of heterozygosity or structural alterations for the Rb gene, the proportion of staining cells varied from 5 to 95%. To explain these results, Varley and co-workers hypothesized the inactivation of the Rb gene in a subpopulation of tumor cells. In a series of 90 breast carcinomas, low to absent levels of Rb protein expression were found in 15% of cases; low expression was not associated with loss of heterozygosity at the Rb locus (Borg et al., 1992). To clarify these issues, more investigation of the role of Rb gene activation in breast cancer is required.

3. Allele Loss on Chromosome I7q: The Prohibitin Gene Loss of heterozygosity on 17q has been found in about 40% of breast carcinomas (Sato el al., 1990; Devilee et al., 1991b). Nakamura and colleagues found mutations in the prohibitin gene in 4 of 23 breast carcinomas that showed loss of heterozygosity for chromosome 17q (Sato et al. , 1992); two point mutations resulting in amino acid substitutions; one point mutation possibly interfering with mRNA splicing; and a 2-base deletion resulting in a truncated protein. The prohibitin gene was first

MOLECULAR GENETICS IN BREAST CANCER

45

identified from the rat as a gene with the ability to negatively regulate proliferation. Whether the prohibitin gene is the tumor suppressor gene implicated in all breast carcinomas with 17q deletions remains to be established. Other genes on this chromosome arm include nm23 (Steeg et al., 1988; Leone et al., 1991), a gene that has properties of an antimetastasis gene (Steeg et al., 1991), and Wnt-3, a gene activated by MMTV proviral insertion in mouse mammary tumors (Roelink et al., 1990). Interestingly, an as yet uncharacterized gene for familial breast cancer is also present on chromosome 17q; this will be discussed in Section IV. 4 . Allele Loss on Chromosome 18q: The DCC Gene

Allele loss for chromosome 18q is found in approximately 40% of breast carcinomas (Sato et al., 1990; Devilee et al., 1991a, b). In the majority of cases a gene termed DCC (deleted in colorectal cancer) is included in this region. The DCC gene was first identified as a gene which is located in a region that is frequently deleted in colorectal cancer and whose expression is absent or reduced in many colorectal carcinomas (Fearon et al., 1990).This gene encodes a protein with properties of a cell adhesion protein. Whether DCC is the gene whose deletion is important in breast carcinomas with 18q allelic loss remains to be established .

5. Allele Loss on Chromosomes 1, 7 , and 11 For a number of loci, frequent allele loss has been found but not examined in detail; some associations with clinical parameters have been investigated. a. Chromosome l q This chromosomal arm was investigated in 48 patients, in view of its frequent involvement in karyotypic aberrations. Loss was found in approximately 25% of cases and there was no significant association with clinical parameters (Chen et al., 1989). b. Chromosome 7q In one series of patients, loss of heterozygosity for this chromosome was found using a probe for the c-met oncogene in 40% of cases and this was associated with poor prognosis (Bieche et al., 1992). In two other large series of patients, studied for loss of heterozygosity using the same c-met gene probe, the proportion of patients with allele loss was much lower (Larsson et al., 1991; Devilee et al., 1991b). The reason for this difference remains to be elucidated.

46

MARC J. VAN DE VIJVER

c. Chromosome 1 I p This region is involved in approximately 20% of the cases studied. The deletions, which often include the c-Ha-ras gene, always involve the region between the P-globin and the parathyroid hormone (Ali et al., 1987). Allele loss at 1 l p has been found to be associated with large tumor size, estrogen receptor negativity, poor differentiation grade, and distant metastasis (Mackay et al., 1988; Ali et al., 1987).

IV. Genetic Predisposition to Breast Cancer There are differences in the risk of developing breast cancer, the most important risk factor being the occurrence of the disease in first-degree family members, especially if the disease developed premenopausally and/or affected both breasts. This indicates that genetic factors may play an important role in the development of breast cancer. In addition, families have been described in which the development of breast cancer appears to be inherited as an autosomal dominant trait. Based on epidemiologic analyses the percentage of breast cancer patients in which the disease is in part due to genetic susceptibility is estimated to be 5 % (Lynch et al., 1984; Newman et al., 1988). As breast cancer is a frequent disease in the population, it is problematic to attribute the occurrence of multiple breast cancers in one family to genetic disease susceptibility with certainty. Despite these difficulties King and co-workers have been able to find linkage to a polymorphic DNA marker on chromosome 17q21 in approximately 40% of 23 breast cancer-prone families (Hall et al., 1990). The patients in which a chromosome 17q susceptibility gene is implicated as the culprit are characterized by a relatively young age at the time of breast cancer development. The major task now is to identify the actual breast cancer susceptility gene in this chromosomal region and characterize how it is mutated in the affected breast cancer-prone families. The region in which this gene is located is quite large and contains some characterized genes, including Wnt-3, nm23, neu, and hox2, but many more that have not been characterized or even identified. As discussed in Section III,D, the same region on chromosome 17q is frequently deleted in sporadic breast carcinomas, implicating that the gene which plays a role in hereditary breast cancer may be the same as a tumor suppressor gene in sporadic breast cancer. This situation is reminiscent of that in colon cancer, where the gene which is mutated in familial polyposis coli is also frequently inactivated in sporadic colon carcinomas (Nishiso et al., 1991; Kinder et al., 1991). Hereditary breast cancer in many cases occurs as a site-specific cancer syndrome. In addition, families have been described in which breast and ovarian cancers develop at high frequency. In three of five families with

MOLECULAR GENETICS IN BREAST CANCER

47

familial breast and ovarian cancer, linkage has been reported to the same region on chromosome 17q, indicating that this syndrome may be the result of the same gene defect as hereditary site-specific breast cancer (Narod et al., 1991). Again, we are reminded of the situation in colon disease where the same gene defect can result in related, but distinct, syndromes such as polyposis coli, Gardner syndrome, and a syndrome characterized by the presence of a limited number of colon polyps (Leppert et al., 1990). In a number of families with familial breast cancer no linkage to the locus on chromosome 17 has been found. In those cases, possibly representing 50% or more of all genetic breast cancer, it remains to be discovered to which chromosomal region, and eventually to which gene, breast cancer development should be ascribed. In addition to these genetic syndromes, where breast cancer development is the dominant feature, there are two genetic syndromes where increased breast cancer risk is also found: Li-Fraumeni cancer syndrome and ataxia telangiectasia. Li-Fraumeni syndrome is a rare autosomal dominantly inherited syndrome, in which affected family members develop breast carcinomas, soft tissue sarcomas, brain tumors, osteosarcomas, leukemia, and adrenocortical carcinoma. Affected family members have been found to carry a mutated p53 gene in their germline (MaIkin et al., 1990). Of interest in this respect is the absence of demonstrable p53 gene mutations in 10 affected family members from five families with familial site-specific breast cancer (Prosser et al., 1991). Ataxia telangiectasia is an autosomal recessive syndrome characterized by progressive cerebellar ataxia and oculocutaneous telangiectasias. Affected patients also have a markedly increased risk of developing cancer, especially lymphomas and lymphocytic leukemias. Heterozygote family members are also at increased risk of developing several types of cancer, especially female breast cancer (Swift et al., 1991). The gene for ataxia telangiectasia has been mapped to chromosome 11q22-23 (Gatti et al., 1988), but has not been cloned. Identification of the gene and its mutations in ataxia telangiectasia will be of importance in estimating the contribution of mutations affecting this gene in the risk of developing breast cancer. V. Concluding Remarks

T h e gene alterations found thus far in breast carcinomas are mainly amplification of a number regions of DNA and loss of heterozygosity for a number of regions of DNA. The oncogenes, located in the amplified regions of DNA, have been identified for a number of loci, as have some

48

MARC J. VAN DE VIJVER

of the tumor suppressor genes in the regions for which loss of heterozygosity is found. Based on histologic features and clinical behavior, breast carcinomas are a heterogeneous group of tumors. T h e evolving picture is that also on the basis of the genetic alterations present, breast carcinomas are heterogeneous and can be divided in distinct subgroups, for instance tumors with neu gene amplification and those with amplification of the chromosome 1 lq13 region. The best known model of genetic changes in multistep development of cancer in humans stems from the work on colon cancer (Fearon and Vogelstein, 1990). There, normal colon mucosa changes into an adenoma, which progresses in size and dysplastic features and finally gives rise to an infiltrating adenocarcinoma. With the increase in size and dyplastic features and finally the development of adenocarcinoma, the number of genetic alterations increases. Each specific alteration tends to occur at a characteristic stage of colon carcinoma development: for example, point mutation of the c-Ki-rm gene is an early step, frequently occurring in small adenomas. Point mutation of the p53 gene, on the other hand, shows a significant increase in frequency in invasive carcinomas relative to the frequency in adenomas. An important aim is to unravel a similar model for breast cancer: a precursor lesion which progresses to invasive breast carcinoma in a number of biologically and genetically defined steps. To study this is more difficult for breast cancer than it is for colon cancer: in the colon one can clinically detect the different stages of cancer development using a fiberoptic endoscope; in breast cancer one is usually confronted with an invasive carcinoma, a late stage in cancer development. Another difference with colon cancer is that in breast cancer, a number of distinct histologic types are recognized, whereas most colon cancers are of similar histologic type. In addition, the precursor lesions for invasive carcinoma of the breast are not all very well defined. Despite these difficulties, it should be feasible to establish the genetic alterations and at what stage of breast cancer development and progression they occur, combining histological examination of breast alterations with the study of genetic alterations. One early alteration in breast cancer development is neu gene amplification, and the presence of this genetic alteration appears to mark a subgroup of intraductal and invasive carcinomas. T h e presence of amplification of genes on chromosome 1 1p 13 is the hallmark of another group of breast carcinomas, and there is indication that for other genetic alterations the distribution in different types of breast carcinomas is also not random. Important for clinical management of breast cancer patients are studies on association of genetic alterations with clinicopathological parameters, especially prognosis. In the interpretation of the results it should

MOLECULAR GENETICS IN BREAST CANCER

49

be kept in mind that in many studies the patient groups are small and often very heterogeneous, including small operable tumors as well as large inoperable tumors. Breast cancer metastases often appear relatively late and survival with metastasized breast cancer can be prolonged. Therefore, to be able to measure the effect of a factor on prognosis, prolonged follow-up of the patients under study is necessary. Five to 10 years is considered an adequate follow-up period, but for many of the studies on prognosis reviewed here, the follow-up period has been shorter. Nevertheless, many interesting results that clearly show the effect of a genetic alteration on clinical behavior have emerged, many genetic alterations being associated with poor prognosis. As already mentioned, most of these encouraging results have come from relatively small, heterogeneous groups of patients with a short follow-up time and it is important to corroborate the results studying homogeneous groups of patients with sufficiently long follow-up. To subclassify breast carcinomas on the basis of their genetic alterations is an attractive prospect. Relatively few studies have been done incorporating these genetic alterations in the clinical trials of breast cancer treatment. As indicated in this review, many of the gene alterations or their effects on the encoded proteins can be assessed in clinical samples that have been formalin-fixed and embedded in paraffin. It is hoped that in the future genetic alterations in breast carcinomas will be evaluated in patients treated in a randomized trial. This will result in more precise knowledge on how genetic alterations can be used in guiding treatment. For the estimated 5 % of all breast cancer patients in which an inherited predisposition is present, genetic counseling may be available in the near future. The cloning of the breast cancer predisposing gene on the long arm of chromosome 17 and characterization of the alterations in this gene that lead to breast cancer predisposition are imminent. Also, with present knowledge genetic counseling is possible, albeit with limitations. It is debatable whether this knowledge should already be in use. Future prospects also include the identification of more gene alterations in breast cancer. It is likely that more gene amplifications will be found in human breast cancer when more molecularly cloned genes become available. Many more as yet uncharacterized tumor suppressor genes must play an important role in breast cancer in view of the frequent loss of heterozygosity in tumors. Only gene alterations in breast cancer have been discussed in this review. Of course, the protein products of many genes that are not known to be mutated in breast carcinomas have an important role in tumor behavior. Examples include the estrogen and progesterone receptors, cathepsin D (Spyratos et al., 1989), and the transforming growth

50

MARC J. VAN DE VIJVER

factors (Knabbe et al., 1987; Dickson et al., 1987). Molecular studies of the regulation of these genes and their protein products are of great importance. It is possible that more gene alterations will be identified by detailed study of the genes involved in growth regulation. An example is the finding of splice variants of the estrogen receptor gene, resulting in estrogen receptor protein with markedly altered properties (Fuqua el al., 1992). It is possible that the occurrence of these splice variants is a result of somatic mutations in the estrogen receptor gene in breast carcinomas. Finally, knowledge of the gene alterations in breast cancer makes it possible to devise new types of treatment, directed against the altered gene products. An example of this is provided by therapy with monoclonal antibodies directed against the m u protein, which could be used in patients with carcinomas overexpressing neu protein. Other possibilities include immunotherapy directed against the point-mutated p53 protein. Laboratory studies of these possibilities are in progress, and clinical studies have begun, with more forthcoming. In conclusion, the future will bring knowledge from molecular biologic studies to clinical management of breast cancer patients: in making a profile of genetic alterations of breast carcinomas to help in guiding therapy for intraductal and invasive carcinomas; in genetic counseling for those at risk for developing breast cancer; and in devising new forms of therapy.

REFERENCES Adnane, J., Gaudray, P., Dionne, C. A., Crumley, G., Jaye, M., Schlessinger,J., Jeanteur, P., Birnbaum, D., and Theillet, C. (1991). Oncogene 6,659-663. Adnane, J., Gaudray, P., Simon, M. P., Simony Lafontaine, J., Jeanteur, P., and Theillet, C. (1989). Oncogene 4, 1389-1395. Ali, I. U., Campbell, G., Lidereau, R., and Callahan, R. (1988). Oncogene Res. 3, 139-146. Ah, I. U., Lidereau, R., Theillet, C., and Callahan, R. (1987). Science 238, 185-188. Ali, I. U., Merlo, G., Callahan, R., and Lidereau, R. (1989). Oncogene 4, 89-92. Azzopardi, J. G. (1979). “Problems in Breast Pathology.” Saunders, London. Bargmann, C. I., Hung, M. C., and Weinberg, R. A. (1986). Nature (London) 319,226-234. Bartek, J., Iggo, R., Cannon, J.. and Lane, D. P. (1991). Oncogene 5 , 893-899. Berns, E. M. J. J., Klijn, J. G. M., van Putten, W. L. J., van Staveren, I. L., Portengen, H., and Foekens, J. A. (1992a). Cancer Res. 52, 1107-1 113. Berns, E. M. J. J., Klijn, J. G. M., van Staveren, I. L., Portengen, H., and Foekens, J. A. (1992b). Cancer Res. 52, 1036-1039. Bieche, I., Champeme, M. H., Matifas, F., Hacene, K., Callahan, R., and Lidereau, R. (1992). Lancet 1, 139-143. Blackwood, E. M., and Eisenman, R. N. (1991). Science 251, 1211-1217. Bonilla, M., Ramirez, M., Lopez-Cueto, J.. and Gariglio, P. (1988).J. Nutl. Cancer Inst. 80, 665-67 1.

MOLECULAR GENETICS IN BREAST CANCER

51

Borg, A., Sigurdsson, H., Clark, G. M., Ferno, M., Fuqua, S. A. W., Olsson, H., Killander, D., and McGuire, W. L. (1991). Br.1. Cancer 63, 136-142. Borg, A., Tandon, A. K., Sigurdsson, H., Clark, G. M., Ferno, M., Fuqua, S. A., Killander, D., and McGuire, W. L. (1990). Cancer Res. 50, 4332-4337. Borg, A., Zhang, Q.-X., A h , P., Olsson, H., and Sellberg, G. (1992). Cancer Res. 52,29912994.

Bos, J. L. (1989). Cancer Res. 49, 4682-4689. Chen, L.-C., Dollbaum, C., and Smith, H. S. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 72047207.

Chen, L. C., Neubauer, A., Kurisu, W., Waldnian, F. M., Ljung, B. M., Goodson, W., Goldman, E. S., Moore, D., Balazs, M., Liu, E., Mayall, B. H., and Smith, H. S. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 3847-3851. Cline, M. J., Battifora, H., and Yokota, J. (1987).J. Clin. Oncol. 5, 999-1006. Coles, C., Thompson, A. M., Elder, P. A., Cohen, B. B., Mackenzie, I. M., Cranston, G., Chetty, U., Mackay, J., Macdonald, M., Nakamura, Y., Hoyheim, B., and Steel, C. M. (1990). Lancet 2, 761-763. Cooper, J. A., and Whyte, P. (1989). Cell (Cambridge, Mass.) 58, 1009-1011. Davidoff, A. M., Kerns, B. J., Iglehart, J. D., and Marks, J. R. (1991). CancerRes. 51,25052610.

Derynck, R. (1992). Adv. Cancer Res. 58, 27-52. Devilee, P., van Vliet, M., Kuipers Dijkshoorn, N., Pearson, P. L., and Cornelisse, C. J. (1991a). Oncogene 6, 311-315. Devilee, P., van Vliet, M., van Sloun, P., Kuipersj-Dijkshoorn, N., Hermans, J., Pearson, P. L., and Cornelisse, C. J. (199 1b). Oncogene 6, 1705- 17 1 1. Dickson, R. B., Kasid, A., Huff, K. K., Bates, S. E., Knabbe, C., Bronzert, D., Gelmann, E. P., and Lippman, M. E. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 837-841. Dobashi, K., Davis, J. G., Mikami, Y., Freeman, J. K., Hamuro, J., and Greene, M. I. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 8582-8586. Dupont, W. D., and Page, D. L. (1985). N . Eng1.J. Med. 312, 146-151. Dutrillaux, B., Gerbault-Seureau, M., and Zafrani, B. (1990). Cancer Genet. Cytogenet. 49, 203-217.

Early Breast Cancer Trialistd Collaborative Group (1992a). Lancet 1, 1-15. Early Breast Cancer Trialists’ Collaborative Group (1992b). Lancet 1, 71-85. Escot, C., Theillet, C., Lidereau, R., Spyratos, F., Champeme, M.-H., Gest, J., and Callahan, R. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 4834-4838. Fantl, V., Richards, M. A., Smith, R., Lammie, G. A., Johnstone, G., Allen, D., Gregory, W., Peters, G., Dickson, C., and Barnes, D. M. (1990). Eur. J. Cancer 26, 423-429. Fearon, E. R., Cho, K. R.,Nigro, J. M., Kern, S. E., Simons, J. W., Ruppert, J. M., Hamilton, S. R., Preisinger, A. C., Thomas, G., Kinzler, K. W., and Vogelstein, B. (1990). Science 247,49-56.

Fearon, E. R., and Vogelstein, B. (1990). Cell (Cambndge, Mass.) 61, 759-767. Fendly, B. M., Winget, M., Hudziak, R. M., Lipari, M. T., Napier, M. A., and Ullrich, A. ( 1990). Cancer Res. 50, 1550- 1558. Filmus, J., Pollack, M. N., Cailleau, R., and Buick, R. N. (1985). Biochem. Biophys. Res. Commun. 128, 898-905. Finlay, C. A., Hinds, P. W., and Levine, A. J. (1989). Cell (Cambridge, Mass.) 57, 1083-1093. Foekens, J. A., Portengen, H., van Putten, W. L. J., Trapman, A. M. A. C., Reubi, J.-C., Alexieva-Figush, J.. and Klijn, J. G. M. (1989). Cancer Res. 49, 7002-7009. Fuqua, S. A., Fitzgerald, S. D., Allred, D. C., Elledge, R. M., Nawaz, Z., McDonnell, D. P., OMalley, B. W., Greene, G. L., and McGuire, W. L. (1992). Cancer Res. 52, 483-486.

52

MARC J . VAN DE VIJVER

Garcia, I., Dietrich, P.-Y., Aapro, M., Vauthier, G., Vadas, L., and Engel, E. (1989). Cancer Res. 49,6675-6679. Gatti, R. A., Berkel, I., Boder, E., Braedt, G., Charmley, P., Concannon, P., Ersoy, F., Foroud, T., Jaspers, N. G. J., Lange, K., Lathrop, G. M., Leppert, M., Nakamura, Y., OConnell, P., Paterson, M., Salser, W., Sanal, O., Silver, J., Sparkes, R. S., Susi, E., Weeks, D. E., Wei, S., White, R., and Yoder, F. (1988). Nature (London) 336, 577-580. Gebhart, E., Bruderlein, S., Augustus, M.,Siebert, E., Feldner, J., and Schmidt, W. (1986). Breast Cancer Res. Treat. 8, 125- 138. Gerbault-Seureau, M., Vielh, P., and Dutrillaux, B. (1987a). Ann. Genet. 30, 146-151. Gerbault-Seureau, M., Vielh, P., Zafrani, B., Salmon, R., and Dutrillaux, B. (1987b). Ann. Genet. 30, 138-145. Guerin, M., Barrois, M., Terrier, M. J., Spielmann, M., and Riou, G . (1988).Oncogene Res. 3, 21-31. Guerin, M., Gabillot, M., Mathieu, M. C., Travagli, J. P., Spielmann, M., Andrieu, N., and Riou, G. (1989). Int. J. Cancer. 43, 201-208. Gullick, W. J., Hughes, C. M., Mellon, K., Neal, D. E., and Lemoine, N. R. (1991).J. Pathol. 164, 285-289. Gullick, W.J., Love, S. B., Wright, C., Barnes, D. M., Gusterson, B., Harris, A. L., and Altman, D. G. (1991). Br. J . Cancer 63, 434-438. Hall, J. M., Lee, M. K., Newman, B., Morrow, J. E., Anderson, L. A., Huey, B., and King, M.-C. (1990). Science 250, 1684-1689. Havely, 0..Michalovitz, D., and Oren, 0. (1990). Science 250, 113-1 16. Holland, R., Hendriks, J. H. C. L., Verbeek, A. L. M., Mravunac, M., and Schuurmans Stekhoven, J. H. (1990). Lancet 1, 519-522. Hollstein, M., Sidransky, D., Vogelstein, B., and Harris, C. C. (1991). Sciei~re253, 4953. Hudziak, R. M., Lewis, G. D., Winget, M., Fendly, B. M., Shepard, H. M., and Ullrich, A. (1989). Mol. Cell. Biol. 9, 1165-1 172. Kern, S. E., Kinzler, K. W., Bruskin, A., Jarosz, D., Friedman, P., Prives, C., and Vogelstein, B. (1991). Science 252, 1708-1711. King, C. R., Kraus, M. H., Williams, L. T., Merlino, G. T., Pastan, I. H., and Aaronson, S. A. (1985). Nucleic Acids Res. 13, 8477-8486. Kinzler, K. W., Nilbert, M. C., Su, L.-K., Vogelstein, B., Bryan,T. M., Levy, D. B., Smith, K. J., Preisinger, A. C., Hedge, P., McKechnie, D., Finniear, R., Markhani, A., Groffen, J., Boguski, M. S., Altschul, S. F., Horii, A., Ando, H., Miyoshi, Y., Miki. Y., Nishisho, I., and Nakamura, Y. (1991). Science 253, 661-665. Knabbe, C., Lippman, M. E., Wakefield. L. M., Flanders, K. C., Kasid, A., Derynck, R., and Dickson, R. B. (1987). Cell (Cambndge, Mars.) 48, 417-428. Kozbor, D., and Croce, C. M. (1984). Cancer Res. 44,438-441. Kraus, M. H., Popescu, N. C., Amsbaugh, S. C., and King, C. R. (1987). EMBO J. 6,605610. Kraus, M. H., Yuasa, Y., and Aaronson, S. A. (1984). Proc. Natl. Acad. Sci. U.S.A. 81,53845388. Lammie, G. A., Barnes, D. M., Millis, R. R., and Gullick, W. J. (1989). Histopathology 15, 505-5 14. Lammie, G . A., Fantl, V., Smith, R., Schuuring, E., Brookes, S., Michalides, R., Dickson, C., Arnold, A., and Peters, G. (1991). Oncogene 6,439-444. Larsson, C., Bystrom, C., Skoog, L., Rotstein, S., and Nordenskjold. M. (1991). Genes Chromosomes Cancer 2, 19I - 197.

MOLECULAR GENETICS IN BREAST CANCER

53

Lee, E. Y.-H. P., To, H., Shew, J.-Y., Bookstein, R., Scully, P., and Lee, W.-H. (1988).Science 241, 218-221. Lee, W. H., Bookstein, R.,Hong, F., Young, L. J., Shew, J. Y., and Lee, E. Y. (1987). Science 235, 1394- 1399. Lemoine, N. R., Staddon, S., Dickson, C., Barnes, D. M., and Gullick, W. J. (1990). Oncogene 5, 237-239. Leone, A., McBride, 0. W., Weston, A., Wang, M. G., Anglard, P., Cropp, C. S., Goepel, J. R., Lidereau, R., Callahan, R., Linehan, W. M., Harris, C. C., Liotta, L. A,, and Steeg, P. S. (1991). Cancer Res. 51, 2490-2493. Leppert, M., Burt, R., Hughes, J. P., Samowitz, W., Nakamura, Y., Woodward, S., Gardner, E., Lalouel, J.-M., and White, R. (1990). N . Engl. J. Med. 322, 904-908. Lidereau, R., Callahan, R.,Dickson, C., Peters, G., Escot, C., and Ali, I. U.(1988). Oncogene &s. 2,285-29 I . Lovekin, C., Ellis, I. O., Locker, A., Robertson, J. F. R.,Bell, J.. Nicholson, R.,Gullick, W. J., Elston, C. W., and Blamley, R. W. (1991). Br. J . Cancer 63, 439-443. Lundberg, C., Skoog, L., Cavenee, W. K., and Nordenskjold, M. (1987). Proc. Natl. Acad. Sn'. U.S.A. 84, 2372-2376. Lupu, R., Colomer, R., Zugmaier, G., Sarup,J., Shepard, M., Slamon, D., and Lippman, M. E. (1990). Science 249, 1552-1555. Lynch, H. T., Albano, W. A., Heieck, J. J., Mulcahy, G. M., Lynch, J. F., Layton, M. A., and Danes, B. S. (1984). Cancer G a t . Cytogenet. 13, 43-92. Macaulay, V. M. (1992). Br. J . Cancer 65, 3 1 1-320. Machotka, S. V., Garrett, C. T., Schwartz, A. M., and Callahan, R. (1989). Clin. Chim. Acta 184, 207-218. Mackay, J., Elder, P. A., Porteous, D. J., Steel, C. M., Hawkins, R. A., Going, J. J., and Chetty, U. (1988). I3r.J. Cancer 58, 710-714. Malkin, D., Li, F. P., Strong, L. C., Fraumeni, J. F., Nelson, C. E.,Kim, D. H., Kassel, J.. Gryka, M. A., Bischoff, F. Z., Tainsky, M. A., and Friend, S. H. (1990). Science 250, 1233-1238. Mariani-constant hi, R., Escot, C., Theillet, C., Gentile, A,, Merlo, G., Lidereau, R., and Callahan, R. (1988). Cancer Res. 48, 199-205. Masuko, T., Sugahara, K., Kozono, M., Otsuki, S., Akiyama, T., Yamamoto, T., Toyoshima, K., and Hashimoto, Y. (1989).Jpn.J. Cancer Res. 80, 10-14. McGuire, W. L., Tandon, A. K., Allred, D. C., Chamness, G . C., and Clark, G. M. (199O).J. Natl. Cancer Imt. 82, 1006- 1015. McKenzie, S. J., Marks, P. J., Lam, T., Morgan, J., Panicali, D. L., Trimpe, K. L., and Carney, W. P. (1989). Oncogene 4, 543-548. Meyers, S. L., OBrien, M. T., Smith, T., and Dudley, J. P. (1990). Cancer Res. 50, 591 I5918. Mori, S., Akiyama, T., Morishita, Y., Shimizu, S., Sakai, K., Sudoh, K., Toyoshima, K., and Yamamoto, T. (1987). Vzrchows Arch. B 54, 8-15. Morse, B., Rothberg, P. G., South, V.J., Spandorfer,J. M., and Astrin, S. M. (1988). Nature (London) 333, 87-90. Motokura, T., Bloom, T., Goo Kim, H., Juppner, H., Ruderman, J. V., Kronenberg, H. M., and Arnold, A. (1991). Nature (London) 350, 512-515. Nayrod, S. A., Lynch, H. T., Conway, T., Feunteun, J., Watson, P., Lynch, J., and Lenoir, G. M. (1991). Lancet 2, 82-83. Newman, B., Austin, M. A,, Lee, M., and King, M.-C. (1988). Proc. Natl. Acud. Sci. U.S.A. 85, 3044-3048.

54

MARC J. VAN DE VIJVER

Nishiso, I., Nakamura, Y., Miyoshi, Y., Miki, Y., Ando, H., Horii, A,, Koyama, K., Utsonomiya, J., Baba, S., Hedge, P., Markham, A., Krush, A. J., Petersen, G., Hamilton, S., Nilbert, M. C., Levy, D. B., Bryan, T. M., Preisinger, A. C., Smith, K. J., Su, L.-K., Kinzler, K. W., and Vogelstein, B. (1991). Science 253, 665-669. Ong, G., Gullick, W., and Sikora, K. (1990).Er. J . Cancer 61, 538-542. Page, D. L., and Anderson, T. J. (1987). “Diagnostic Histopathology of the Breast.” Churchill Livingstone, Edinburgh. Peles, E., Bacus, S. S., Koski, R. A., Lu, H. S., Wen, D., Ogden, S. G., Ben Levy, R., and Yarden, Y. (1992). Cell (Cambridge, Muss.) 69, 205-216. Persson, H.. Gray, H. E., Godeau, F., Braunhut, S., and Bellve, A. R. (1986).Mol. Cell. Eiol. 6, 942-949. Prosser, J., Elder, P. A., Condie, A., MacFadyen, I., Steel, C. M., and Evans, H. J. (1991).Er. J. Cancer. 63, 181-184. Prosser, J., Thompson, A. M., Cranston, G., and Evans, H. J. (1990). Oncogene 5, 15731579. Ramachandra, S., Machin, L., Ashley, S., Monaghan, P., and Gusterson, B. A. (1990).J. Pathol. 161, 7-14. Ro, J., North, S. M., Gallick, G. E., Hortobagyi, G. N., Gutterman, J. U., and Blick, M. ( 1988). Cancer Res. 48, 161- 164. Rochlitz, C. F., Scott, G. K., Dodson. J. M., Liu, E., Dollbaum, C., Smith, H. S., and Benz, C. C. (1989). Cancer Res. 49, 357-360. Rodenhuis, S., van d e Wetering, M. L., Mooi, W. J., Evers, S. G., van Zandwijk, N., and Bos, J. L. (1987).N . Engl. J. Med. 317,929-935. Roelink, H., Wagenaar, E., Lopes da Silva, S., and Nusse. R. (1990).Proc. Natl. Acad. Sci. V.S.A. 87, 4519-4523. Saga, T., Endo, K., Akiyama, T., Sakahara, H., Koizumi, M., Watanabe, Y., Nakai, T., Hosono, M., Yamamoto, T., Toyoshima, K., and Konishi, J. (1991).Cancer Rps. 51,990994. Sainsbury, J. R., Farndon, J. R., Needham, G. K., Malcolm, A. J., and Harris, A. L. (1987). Lancet 1, 1398-1402. Sainsbury, J. R. C., Farndon, J. R., Sherbet, V. G., and Harris, A. L. (1985).Lancet 1, 364366. Saint-Ruf, C., Gerbault-Seureau, M., Viegas-Peguignot, E., Zafrani, B., Cassingena, R., and Dutrillaux, B. (1990). Genes Chromosomes Cancer 2, 18-26. Saint-Ruf, C., Malfoy, B., Scholl, S., Zafrani, B., and Dutrillaux, B. (1991).Oncogene6,403406. Sandberg, A. A., Turc-Carel, C., and Gemmill, R. M. (1988). Cancer Res. 48, 1049-1059. Sato, T., Saito, H., Swensen,J., Olifant, A., Wood, C., Danner, D., Sakamoto, T., Takita, K., Kasumi, F., Miki, Y., Skolnick, M., and Nakamura, Y. (1992).Cancer Res. 52, 1643-1646. Sato, T., Tanigami, A., Yamakawa, K., Akiyama, F., Kasumi, F., Sakamoto, G., and Nakamura, Y. (1990). Cancer Res. 50, 7184-7189. Schechter, A. L., Hung, M. C., Vaidyanathan, L., Weinberg, R. A., Yang-Feng, T. L., Francke, U., Ullrich, A. L., and Coussens, L. (1985). Science 229, 976-978. Schechter, A. L., Stern, D. F., Vaidyanathan, L., Decker, S. J., Drebin, J. A,, Greene, M. I., and Weinberg, R. A. (1984).Nature (London) 312, 513-516. Schuuring, E., Verhoeven, E., Mooi, W. J., and Michalides, R. J. A. M. (1992).Oncogene 7, 355-36 1. Seshadri, R., Matthews, C., Dobrovic, A., and Horsfall, D. J. (1989).Int. J. Cancer. 43,270272.

MOLECULAR GENETICS IN BREAST CANCER

55

Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire, W. L. (1987). Science 235, 177- 182. Slamon, D. J., Godolphin, W., Jones, L. A., Holt, J. A., Wong, S. G., Keith, D. E., Levin, W. J., Stuart, S. G., Udove, J., Ullrich, A., and Press, M. F. (1989). Science 244, 707-712. Spyratos, F., Maudelonde, T., Brouillet, J. P., Brunet, M., Defrenne, A., Andrieu, C., Hacene, K., Desplaces, A., Rouesse, J., and Rochefort, H. (1989). Lancet 2, 1 115-1 118. Steeg, P. S., Bevilaqua, G., Kopper, L., Thorgeirsson, U.P., Talmadge, J. E., Liotta, L. A., and Sobel, M. E. (1988). J. Natl. Cancer Inst. 80, 200-204. Steeg, P. S., Cohn, K. H., and Leone, A. (1991). Cancer Cells. 3, 257-262. Swift, M., Morrell, D., Massey, R. B., and Chase, C. L. (1991). N . Engl. J. Med. 325, 18311836. TAng, A., Varley, J. M., Chakraborty, S., Murphree, A. L., and Fung, Y.-K.T. (1988). Science 242, 263-266. Theillet, C., Adnane, J., Szeptowski, P., Simon, M. P., Jeanteur, P., Birnbaum, D., and Gaudray, P. (1990). Oncogene 5, 147-149. Theillet, C., Le Roy, X.,De Lapeyriere, O., Grosgeorges, J., Adnane, J., Raynaud, S. D., Simony-Lafontaine, J., Goldfarb, M., Escot, C., Birnbaum, D., and Gaudray, P. (1989). Oncogene 4, 915-922. Thompson, A. M., Steel, C. M., Chetty, U., Hawkins, R. A., Miller, W. R., Carter, D. C., Forrest, A. P. M., and Evans, H. ,I. (1990). Br. ,I. Cancer 61, 74-78. Thor, A. D., Schwartz, L. H., Koerncr, F. C., Edgerton, S. M., Skates, S. J., Yin, S., McKenzie, S. J., Panicali, D. L., Marks, P. J., Fingert, H. J., and Wood, W. C. (1989). Cancer Res. 49, 7147-7152. Trent, J. (1985). Breatt Cancer Res. Trea:. 5, 221-229. Tsuda, H., Hirohashi, S., Shimosato, Y., Hirota, T., Tsugane, S., Yamamoto, H., Miyajima, N., Toyoshima, K., Yamamoto, T., Yokota, J., Yoshida, T., Sakamoto, H., Terada, M., and Sugimura, T. (1989). Cancer Res. 49, 3104-3108. Tsutsumi, M., Sakamoto, H., Yoshida, T., Kakizoe, T., Koiso, K., Sugimura, T., and Terada, M. (1988). Jpn. J. Cancer Res. 79, 428-432. van de Vijver, M. J., Mooi, W. J.. Wisman, P., Peterse, J. L., and Nusse, R. (1988,). Oncogene 2, 175-178. van de Vijver, M. J., Peterse, J. L., Mooi, W. J., Wisman, P., Lomans, J., Dalesio, 0.. and Nusse, R. (1988b). N . Eng1.J. Med. 319, 1239-1245. van de Vijver, M. J., Peterse, J. L., Mooi, W. J., Verbruggen, M., van de Bersselaar, R., Devilee, P., Cornelisse, C., Bos, J. L., Yarnold, J., and Nusse, R. (1989). Oncogene activations in human breast cancer. I n “Cancer Cells” (M. Furth and M. Greaves, eds.), 7, 385-391. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. van de Vijver, M., van de Bersselaar, R., Devilee, P., Cornelisse, C., Peterse, J., and Nusse, R. (1987). Mol. Cell. Biol. 7, 2019-2023. van der Bliek, A. M., and Borst, P. (1989). Adu. Cancer Res. 52, 165-203. van Dongen, J. A., Fentiman, I. S., Harris, J. R., Holland, R., Peterse, J. L., and Stewart, H. J. (1989). Lancet 2, 25-27. van Leeuwen, F., van de Vijver, M. J.. Lomans, J., van Deemter, L., Jenster, G., Akiyama, T., Yamamoto, T., and Nusse, R. (1990). Oncogene 5, 497-503. Varley, J. M., Armour, J., Swallow,J. E., Jeffreys, A. J., Ponder, B. A. J., TAng, A., Fung, Y.K. T., Brammar, W. J., and Walker, R. A. (1989). Oncogme 4, 725-729. Varley, J. M., Brammar, W. J.. Lane, D. P., Swallow, J. E., Dolan, C., and Walker, R. A. ( 1991). Oncogene 6 , 4 13-42 1. Varley, J. M., Wainwright, A. M., and Brammar, W. J. (1987). Oncogene 1,431-438.

56

MARC J. VAN D E VIJVER

Vogelstein, B., Fearon, E. R., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert, M., Nakamura, Y., White, R., Smits, A. M. M., and Bos, J. L. (1988). N. Engl. J . Med. 319, 525-532.

Wen, D., Peles, E., Cupples, R., Suggs, S. V., Bacus, S. S., Luo, Y.,Trail, G., Hu, S., Silbiger, S. M., Ben Levy, R., Koski, R. A., Lu, H. S., and Yarden, Y. (1992). Cell (Cambridge, MOSS.)69, 559-572. Yandell, D. W., Campbell, T. A., Dayton, S. H., Petersen, R., Walton, D., Little, J. B., McConkie-Rosell, A., Buckley, E. G., and Dryja, T. P. (1989). N. Engl.J. Med. 321, 16891695.

Zeillinger, R., Kury, F., Czerwenka, K., Kubista, E., Sliutz, G . , Knogler, W., Huber, J., Zielinski, C., Reiner, G . , Jakesz, R., Staffen, A., Reiner, A., Wrba, F., a n d Spona, J. (1989). Oncogene 4, 109-1 14. Zhou, D. J., Ahuja, H., and Cline, M. J. (1989). Oncogene 4, 105-108. Zhou, D. J.. Casey, G., and Cline, M. J. (1988). Oncogene 2, 279-282.

MOLECULAR APPROACHES TO CANCER THERAPY Mark A. Israel University of California at Sen Francisco, Sen Francisco, California 94143

I. Introduction 11. Cancer as a Molecular Disorder 111. Molecular Diagnosis

IV. Molecular Therapies A. Novel Antineoplastic Agents B. Modern Immunotherapy C. Therapeutic Repair of Oncogenic Genetic Lesions References

1. Introduction Dramatic advances in cell biology and molecular genetics emerging from the utilization of recombinant DNA technology have provided truly novel opportunities for the treatment of cancer. Several distinct areas of advancement can be identified, though each of these shares a dependence upon this novel technology. For example, as a result of ongoing research a molecular pathology of cancer has evolved providing a broad conceptual framework within which new approaches to therapy have been conceived. A key goal of ongoing research is to convert insights at the molecular level into new pharmaceuticals that can be utilized clinically. Also, such studies of tumor pathology offer the chance to examine how potential therapeutic opportunities might be optimally exploited. We now recognize that cancer arises as a series of molecular alterations that converge to give the cell malignant properties. Although many important details remain to be elucidated, for the first time in the history of cancer research it is possible to identify specific molecular changes that account for specific cellular behaviors. It was obvious some time ago that if a cancer cell was to pass along to its progeny the malignant phenotype there must be some genetic component to malignant transformations. It is only in the last several decades, however, that specific genes contributing to malignancy have been identified. In a very short period of time a long list of genes implicated in carcinogenesis and malignancy has emerged. These genes, in turn, have themselves become the focus for new therapeutic approaches, and the molecular pathways 57 ADVANCES IN CANCER RESEARCH, VOL.61

Copyright 0 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.

58

MARK A . ISRAEL

in which the products of these genes act have been recognized as potential targets for therapeutic modification. We now know that oncogenes, the genes closely associated with the development of cancer, encode products whose activities are easily reconciled with the malignant phenotype of cancer cells. Widely recognized structural alterations and disturbances in the regulation of genes encoding growth factors and their receptors are clearly important in that they relate closely to inappropriate cellular proliferation, the central pathologic feature of malignant tumors. Similarly, the finding that other genes encoded molecules important in the cell’s signal transduction machinery or transcription factors important for the expression of cellular genes gave credence to the idea that an understanding of cancer at the molecular level would provide important new therapeutic opportunities. As reviewed below, such therapeutic opportunities reflect a variety of ideas regarding how the altered function of cells containing such pathologic lesions might best be modulated. These ideas include interruption of aberrant cellular activities, stimulation of opposing cellular activities that might balance pathologic alterations, and improved utilization of existing nonspecific cytotoxic agents. Each of these new approaches to therapy shares a common foundation; each one is rooted in an understanding of both the molecular alterations that characterize specific cancers and the cellular pathways that can be exploited to balance the biologic effects of the pathologic alterations in individual tumors.

II. Cancer as a Molecular Disorder Inappropriate proliferation is the key cellular activity that we recognize as central to the pathology of cancer. Invasion of normal tissue, metastatic potential, and the ability to escape immune surveillance are other important biologic characteristics of many different cancers, which contribute to their pathology. Similarly, it is likely that biochemical alterations such as genetic instability, the production of angiogenic and proteolytic factors, and drug resistance characterize most tumors and contribute substantively to their pathology. None however is likely to be an important contributor to the life-threatening problems presented by cancer unless there is tumor cell proliferation. The last decade has provided expansive detail of the molecular pathways involved in cell growth. I n addition to recognizing a panoply of extracellular growth-stimulatory ligands and their cell surface receptors, we now know much of the cellular events that result from the stimula-

MOLECULAR APPROACHES T O CANCER THERAPY

59

tion of a cell by growth-regulatory molecules. Cancer is often associated with changes in these pathways. An explicit example of such a change would be the tumor-specific amplification of a growth factor receptor gene. Each individual step in the cascade of events that mediates and amplifies the message that these factors bring to the cell is a potential target for cancer therapy. Regrettably, however, it is possible to identify molecular alterations specific to the growth-regulatory machinery in only a minority of tumors. In tumors where no such alterations are detectable, it is possible that the proliferation results from a “normal response” of the tumor cell to inappropriate growth stimuli. In addition to inappropriate cell growth, anaplasia, the lack of differentiated cellular features, is typical of virtually all tumors. Cells that are not fully mature have varying degrees of growth potential. T h e finding that virtually no tumor types arise in fully differentiated cells is consistent with the possibility that in some tumors inappropriate growth is simply the result of these precursor cells doing what they are programmed to do, namely, to divide. Interestingly, it appears that growth regulation of many cell types and tissues is characterized by a number of different growth-stimulatory molecules, and perhaps a number of different growth-inhibitory molecules as well. In this regard, it is noteworthy that in most cancer cells the cell cycle machinery seems to be intact and operate quite normally, although regulation of the cell cycle is aberrant. T h e therapeutic implications of these findings are significant. If the altered regulation of tumor cell growth is a reflection of the immature state of these cells rather than the result of a specific alteration in the tumor cell’s growth-regulatory pathways, modulation of the cell’s state of differentiation may be a more efficacious approach to therapy than attempting to modify what is essentially a normal physiologic activity of the tumor cell. It may be possible to alter the stage in differentiation to which a tumor cell corresponds and, thereby, render it responsive to both therapy and growth-inhibitory signals present in its milieu. Also, therapy directed at altering a specific growth-regulatory pathway in cells that have no known disorder of a particular growthstimulatory pathway does not preclude the possibility that a tumor may continue to respond to some other growth-stimulatory signal. Modifying one growth-regulatory pathway may not be sufficient to achieve a therapeutic effect. Rather, it would be necessary to interrupt some molecular pathway shared by multiple growth-regulatory mechanisms, such as the cell cycle. Such strategies would eventually require tumorspecific targeting to decrease the nonspecific toxicities that would be expected.

60

MARK A . ISRAEL

111. Molecular Diagnosis

An understanding of the molecular basis for many of the malignant characteristics of neoplastic cells holds out the promise that therapies can be developed which can “fix” or negate the effects of the genetic alterations that result in the malignant behavior of cancer cells. Enthusiasm for this possibility rests largely in the belief that such therapies will be directed at tumor-specific alterations and, thereby, be both more effective and less toxic than currently available therapeutic agents. At the present time, the most likely targets for such therapy are the genetic mutations that have been recognized to occur in association with the activation of specific proto-oncogenes o r the inactivation of tumor suppressor genes. Key to the effective development and utilization of such therapies will be our ability to define homogeneous disorders among human tumors. Tumors should not be categorized simply in a manner that reflects the molecular alterations which have affected them. Optimally, they should be classified to reflect the growth-limiting change that is going to be the target of the particular modality of therapy being examined o r utilized. Our current view of the pathogenesis of most human malignancies is that they arise as the result of a series of stochastically occurring mutations that confer increasing degrees of malignancy upon the cells they affect. It seems likely that the precise order in which these changes occur is not critical. Also, a broad spectrum of different oncogenes can contribute to malignancy arising in many different cell types. The most common finding is that for any particular tumor examined only a fraction of individual tumor specimens have evidence of activation of a particular oncogene. Important exceptions to this rule are the cytogenetically detectable chromosomal rearrangements that characterize many hematopoietic malignancies and some solid tumors. Our categorization of myeloid and lymphoid tumors has already been modified to reflect the expansive cytogmetic data characterizing them. We now know that tumors possessing a common chromosomal rearrangement are distinctive biologic and pathologic entities. Remarkably, many of the hematopoietic tumors that had previously been distinguished from one another based on pathologic and clinical criteria are now known to be almost invariably associated with a specific cytogenetic alteration. Where it has been possible to examine closely the genes that are affected by such tumor-specific chromosomal rearrangements, it has consistently emerged that these rearrangements involve genes likely to be critical for the pathogenesis of these tumors. This finding suggests that there may be some genetic

MOLECULAR APPROACHES TO CANCER THERAPY

61

alterations that can be considered characteristic of a particular tumor type. If such genes are critical for the pathology of these tumors, which their variation from tumor type to tumor type would suggest, they may be significant targets for the development of tumor-specific molecular therapies.

IV. Molecular Therapies The ability to characterize tumors at the molecular level and to use modern biological and chemical technologies to identify and develop novel molecules of therapeutic potential has opened several different possible avenues for the development of new therapeutic modalities, which are discussed below. Less obvious but equally important, however, has been the identification of new targets for cancer therapy. Elucidation of the specific molecules involved in signal transduction that mediates malignant cellular behavior such as uncontrolled growth, tissue invasion, drug resistance, and other relevant malignant phenotypes has provided additional previously unrecognized targets against which therapy might now be directed.

A. NOVELANTINEOPLASTIC AGENTS Most available antineoplastic agents interact with DNA in a manner that inhibits the replication of the tumor cell genome. Recognition of the key role that growth factors and their receptors play in the regulation of tumor cell proliferation has directed attention to the plasma membrane, where growth factor receptors are located, and to intracellular signaling pathways as sites in which targets for the development of novel chemotherapeutic agents might be located. Suramin is a drug that nonspecifically binds a number of different growth factors. By blocking the interaction of these mitogens with their receptor, suramin can inhibit growth (LaRocca et al., 1990). Although toxic, this agent may have a place in the treatment of selected tumors. The use of antibodies directed against growth factor receptors (see below) is another approach to interrupting the mitogenic pathways of tumors that is being pursued (Yaish et al., 1988; Garth and Kozikowski, 1991). Several growth factor receptors that are present on the surface of commonly occurring tumors, including those for epidermal-derived growth factor, platelet-derived growth factor, and insulin-derived growth factor, are tyrosine kinases. This finding has led to the search for compounds that might inhibit tyrosine kinases and thereby be the basis for the development of new pharmaceuticals. Initially, nonspecific

62

MARK A. ISRAEL

compounds reactive against many different protein kinases were identified and examined. Genistein and other naturally occurring compounds such as aquercetin and herbimycin were among the first such molecules to be examined. Though such molecules can inhibit the proliferation of human tumor cells (Akiyama el al., 1987), they are highly toxic to normal cells, presumably because of their lack of specificity. Subsequently, inhibitors that were specific for tyrosine kinases were identified. The naturally occurring compound erbstatin was among the early molecules to be examined and found to inhibit the growth of human tumor cells in culture (Imoto et al., 1987; Takekura et al., 1991). Erbstatin is a competitive inhibitor of the epidermal growth receptor tyrosine kinase and it has been possible to synthesize organically a number of structurally related inhibitors, tyrphostins, whose activity is similar to that of erbstatin (Levitzki, 1990). Tyrphostins have a number of unique structural advantages, however, that may give them increased specificity and decreased toxicity. Published studies indicate that erbstatin (Toi et al., 1990) and some tyrophostins (Yoneda et al., 1991) can inhibit tumor growth in vivo without apparent severe toxicities. Following the activation of growth factor receptor tyrosine kinase activity, the mitogenic signal is transduced over pathways that contain several potential targets for antiproliferative drugs. GTPases, such as the ras gene family, and the GTPase-activating proteins play central regulatory roles in the proliferation of malignant cells (Bourne et al., 1990). Since ras proteins are frequently mutated in human tumors and their activity altered (McCormick, 1991), it is possible that the development of GTP antagonists that would alter specific rar functions might be identifiable. Similarly, protein serine/threonine kinases seem to play a central role in the cellular response to many different growth regulators (Morrison, 1990), although in some cells they mediate proliferation whereas in others they are activated during differentiation and in association with growth arrest. One such kinase likely to be of particular importance for growth is protein kinase C. Numerous inhibitors of protein kinase C are known. T h e best studied of these is staurosporine (Tamaoki et al., 1986). Analogs of this compound have antitumor activity in vivo and are candidates for clinical trials (Meyer et al., 1989). A less well-recognized inhibitor of protein kinase C that is already used clinically is tamoxifin (Powis, 1991). T h e precise contribution of protein kinase C inhibition to its antitumor activity is unknown. Other molecules now recognized to play important roles in growth factor-induced mitogenesis, such as phopholipase C (Pandiella et al., 1990) and phosphatidylinositol 3'-kinase (Coughlin et al., 1989), also provide opportunities for the development of new antineoplastic

MOLECULAR APPROACHES TO CANCER THERAPY

63

therapies (Reeve, 1991). These targets emerged as the result of our greatly enhanced understanding of mitogenesis at the molecular level. Until now, antineoplastic drug discovery was largely based upon the empiric evaluation of natural products. A key focus for the future will be to identify efficacious targets and drugs that will modify tumor cell biology without unacceptable activity against normal cells. B. MODERNIMMUNOTHERAPY Modern immunotherapy for cancer, or biologic therapy as it has come to be called, has had a Renaissance as the result of molecular biological technologies that have permitted identification of the mediators of immunologic responsiveness and the manufacture of large quantities of cytokines for medicinal use. Both active and passive approaches to immunotherapy have benefited from these advances. Active immunotherapy, treatment that seeks to immunize hosts against their own tumor, remains an area of great interest in which little therapeutic success has yet emerged. Although cancer vaccines remain a vision to be realized, the advent of gene therapy has permitted the development of rather novel approaches to the utilization of a patient’s own tumor as an immunogen. Active Immunotherapy

It is clear that cancer patients have lymphocytes capable of mounting both a humoral and a cellular immunologic response to their own tumor. Typically this response is muted and often barely detectable for reasons that remain cryptic (Waters, 1981). Nonetheless, the presence of such cells indicates that it may be possible to induce o r enhance a more active immunological response directed against an individual cancer patient’s tumor. T h e vaccination of individuals against tumors as both a preventative and a therapeutic modality has long been a goal of tumor immunologists. The earliest attempts at utilizing host defenses as an effective treatment modality for the management of cancer patients involved the use of active immunization with such substances as bacterial extracts. T h e most widely studied of these extracts were from the bacillus Calmette-Guerin (BCG) strain. T h e goal of these attempts was to nonspecifically stimulate the immune system and thereby enhance an individual’s immune response against the tumor. This approach to immunotherapy has been a failure. Approaches to the active immunization of animals and cancer patients with both tumor tissue (Steele et al., 1984) and specific antigens (Bystryn et al., 1988) have also been pursued.

64

MARK A. ISRAEL

Early tumor vaccines consisted of inactivated autologous o r allogeneic tumor cell preparations. The immunologic responses that have been inducible to date by such approaches, however, lack both the specificity and the intensity necessary to impact significantly on the clinical course of most cancer patients. More active immunogens have therefore been sought by searching for tumor-specific antigens that might serve as vaccines inducing both humoral and cellular immunological activities that are ant ineoplast ic. A few human tumors, such as hepatoma, cervical carcinoma, and Tcell leukemia, are known to arise in association with viral infection. T h e expressed viral antigens in these tumors can distinguish tumor cells from an individual’s normal cells. Until very recently it was not clear whether other tumor-specific antigens existed. Antigens with the greatest potential for playing an important role in immunotherapy, both as immunogens and as targets for therapy, are now recognized to be oncofetal antigens or differentiation antigens (Hirai and Alpert, 1975). T h e expression of these antigens is largely limited to tumors and fetal tissues, thus making them potential targets for the development of immunotherapies. More recently the identification of structurally altered proteins, including growth factor receptors (Hamblin et al., 1980), which are of special interest since they are typically expressed on the surface of tumor cells, has renewed hope of identifying frequently occurring alterations of this sort. Such antigens are a truly tumor-specific target. Other tumor-specific targets might be the idiotypic antigenic structure of immunoglobulin (Ig) heavy- and light-chain variable regions. Such regions are usually involved in antigen recognition and most B cells express Ig on their surface. The clonal expansion of most malignant B cells leads to the entire tumor population bearing a unique surface Ig molecule (Levy et al., 1977). In animal studies anti-idiotypic IgG has been quite effective in leading to protection against lymphomogenesis (George and Stevenson, 1989)and can mediate tumor regression (George et al., 1988). Responses to anti-idiotypic antibody therapy have also been seen in cancer patients with B-cell malignancies (Meeker et al., 1985), although these have not led to curative therapy. More recently, tumor-specific antigenic determinants that may be shared by a group of patients have been identified. This raises the possibility that if effective anti-idiotype antibody-mediated therapy can be developed unique reagents would not have to be formulated for each patient undergoing therapy (Chatterjee et al., 1990; Parker et al., 1991). Some strategies to pursue anti-idiotype treatment against solid tumors have been based upon the network theory (Stevenson, 1991) of antibody production (O’Connell et al., 1989). This theory proposes that

MOLECULAR APPROACHES T O CANCER THERAPY

65

idiotypic antibodies induce the production of anti-anti-idiotype antibodies whose structure mimics the structure of the antigen being recognized by the anti-idiotype. This antibody can then serve as an immunogen to induce further antitumor response. Experimental findings from early clinical trials have demonstrated that such anti-anti-idiotype antibodies can be produced (Wettendorf et al., 1989). More recently, clinical trials in which such an approach has been pursued raise the hope that the development of antibodies mimicking the “internal image” of the anti-idiotypic antibody can lead to significant clinical responses (Mittelman et al., 1992). Attempts to immunize patients with B-cell tumors against the unique immunoglobulin on the surface of their tumor cells have not been successful, presumably because of the low concentration of antigen that has been administered and the possible tolerance of patients to such antigens (Dyke et al., 1992). If cytokines could be administered following such an immunization o r genes encoding cytokines incorporated into tumor cell vaccines, the anticipated immunologic response might be further augmented (see below). Cells engineered in such a way would present not only a tumor-specific antigen to the host immune system, but also a cytokine that could either enhance the cellular interaction o r contribute to the amplification of immunologic events and thereby increase the vaccine’s antitumor effect. T h e possibility of experimental manipulation of tumor cell genomes presents the opportunity to pursue novel approaches to active immunization of cancer patients utilizing autologous tumor cells as a sort of tumor vaccine. In such a model, tumor cells would be modified ex vivo or in vivo to enhance the expression of a particular tumor antigen. Ex vivo such a treatment might involve the incubation of tumor cells with a therapeutic agent that has altered its pattern of gene expression or even the transfer of new genetic material to the tumor cells, which would then be administered back to the patient (see below). Such an approach might best be utilized during clinical remission, when a patient’s immune system would be expected to be optimally functional and the tumor burden minimal. In vivo approaches would involve the administration of a gene encoding a new antigen, perhaps in a retrovirus or passively transferred directly to the tumor in a vehicle such as a liposome. T h e future of tumor vaccines remains uncertain. Successful immunization in veterinary practice strongly suggests that effective strategies will be possible for human tumors in which viruses seem to play a critical pathogenic role. For other human tumors, the feasibility of identifying antigens against which lifelong immunity will not be problematic looms as a critical issue. Similarly the demonstrated capacity of tumors to avoid

66

M A R K A. ISRAEL

immunologic recognition (Glennie et al., 1987), perhaps a manifestation of their inherent genetic instability, remains an unaddressed problem. Interestingly, B-cell tumors that have escaped immunologic recognition by passively administered antibody seem to be less aggressive than the tumors from which they are derived (Stevenson et al., 1990), suggesting a role for immunologic therapy in the amelioration of tumor aggressiveness, if not in establishing a cure. In contrast to the rather limited experimental work that has proceeded in the area of active immunization, the passive administration of various mediators of the immune response has been an extraordinarily active area of innovation and clinical investigation. Cytokines and other biologic response modifiers, monoclonal antibodies, and cells bearing antitumor activity are all important focuses of ongoing work to develop more active cancer therapies based upon emerging information regarding the molecular mediators of the immune response. Whereas soluble mediators of the immune response have been recognized for decades, it was the advent of recombinant DNA technology that allowed precise identification of these molecules, their characterization, and their development as therapeutic agents for the treatment of cancer patients. Most experience to date has been accumulated utilizing molecules that stimulate immune effector cells rather nonspecifically. T h e interferon (IFN) family of molecules has been most extensively studied in this regard and although these molecules have numerous different biologic activities that could contribute to their antitumor activity, their ability to enhance the activity of virtually all types of effector cells known to have antitumor activity is likely to be the most important. Interferons have been shown to enhance the ability of T cells, natural killer (NK) cells, and monocytes to kill tumor cells. In particular, IFN-a has been extensively studied in clinical trials (Galvani and Cawley, 1990). Even as a single agent, IFN-a has activity against a large number of different human tumors including both hematopoietic malignancies and those arising in solid tissues. More than 85% of patients with hairy cell leukemia respond to treatment with IFN-a (Quesada et al., 1984; Robinson et al., 1986) and a role for the use of IFN-a may also emerge in the management of patients with nodular lymphoma (Foon et al., 1984), chronic myelogenous leukemia (Wand1 et al., 1992), renal cell cancer (Bergmann et al., 1991), and melanoma (Robinson et al., 1986). At the current time clinical trials on these and other tumors are being pursued in an effort to optimize the dosing of IFN-a and to determine how such a biological agent might be best used as one component of multimodality a. Cytokines

MOLECULAR APPROACHES TO CANCER THERAPY

67

treatment regimes. In these trials IFN-a is being combined with chemotherapy or radiotherapy in the search for either additive or synergistic effects (Galvani and Cawley, 1990). Interferons, in addition to enhancing the host immune response to tumors, can affect gene expression of many cell types directly. Interferon-? can modulate the expression of the class I major histocompatibility (MHC) antigens, which may enhance the responsiveness of tumors to immunotherapy (see below). It is also possible that other cellular changes, such as IFN-induced differentiation, contribute to the therapeutic effects of these cytokines. Lymphokines mediate their antitumor effect through the activation of effectors cells, which then have a direct effect on tumor growth. Among lymphokines, those that are involved in the proliferation of cytotoxic immunocytes have been of greatest therapeutic interest to oncologists, and interleukin 2 (IL2) has been the most extensively studied of such molecules in clinical trials. First recognized as the key component of T-cell growth factor (Smith el al., 1980; Smith, 1988), I L 2 has no known direct antitumor effect in any laboratory model, and its antitumor activity is thought to result from its ability to amplify cytotoxic T lymphocytes and other T cells, which subsequently release cytokines capable of either directly o r indirectly contributing further to the antitumor response themselves (Grimm and Owen-Schaub, 1991). These activities have been studied extensively in mouse tumor models (Talmadge et al., 1988) and have led directly to an extensive series of human trials examining the efficacy of I L 2 in cancer therapy (Rosenberg, 1991b). Tumor responses to I L 2 therapy have been noted in several different centers. To date I L 2 alone has been documented to have activity against melanoma and renal cancer (Rosenberg, 1991b) and has been extensively studied as an adjuvant to the administration of autologous lymphokine-activated killer (LAK) cells (see below). Ongoing studies to examine the therapeutic efficacy of I L 2 administered by continuous infusion suggest that such an approach may be both therapeutically efficacious and without the side effects that can sometimes complicate bolus administration of IL2. All these trials have been conducted, however, utilizing patients who have measurable tumor burdens, despite animal studies which indicate that IL-2 activity is greatest against micrometastatic disease. Studies to combine I L 2 with the use of other modalities of therapy and with therapeutic approaches that enhance the efficacy of immunologically mediated antitumor effects are proceeding. At present we still know little of how to measure optimally the effective dose of I L 2 or even what the entire spectrum of its antitumor effects is (Kolitz and Mertelsmann, 1991).

68

MARK A. ISRAEL

Other cytokines seem to act exclusively on tumor cells and have a cytotoxic effect themselves. T h e best studied of such molecules is tumor necrosis factor (TNF). Tumor necrosis factor-a and a closely related molecule, TNF-P or lymphotoxin, are physiologically produced by lymphocytes in response to stimulation by some mitogens and antigens. Recombinant TNF-a (rTNF-a) is cytostatic when examined in a wide range of human tumor cell lines (Sugarman et al., 1985) and xenografts in vivo (Creasey et al., 1986), but with the exception of endothelial cells (Frater-Schroder et al., 1987) most normal cell types are resistant to these effects. Tumor necrosis factor can also stimulate monocyte-mediated tumor cell killing (Urban et al., 1986) and seems to play an important role in the cytotoxic effect of several different types of effector cells (Patek et al., 1987). Recombinant TNF-a has been examined in phase I (Schiller et al., 1991) and I1 (Hersh et al., 1991) clinical trials but has not yet shown significant antitumor activity. Its activity has been systematically examined in pancreatic adenocarcinoma (Brown et al., 1991) and renal cell cancer (Skillings et al., 1992) but again without evidence of therapeutic efficacy. Interestingly, the doses of TNF required to cure experimental tumors in mice is in the range of several hundred micrograms per kilogram, although the maximum tolerated dose in humans is less than 10 Fg/kg/day (Schiller et al., 1991). It seems likely that if TNF and related cytokines are to be used in therapy, more effective means of delivering these cytokines to the tumor site (see below) or novel therapeutic formulations of the “active site” in. these molecules are going to have to be identified. In addition to single-agent trials that are currently focused on determining the spectrum of activity of rTNF-a against human tumors, trials are under way to examine its potential as an adjuvant to chemotherapy and radiation therapy. Recombinant tumor necrosis factor a is also being examined in studies where it is combined with IFN-y (Smith et al., 1991; Fiedler et al., 1991) and IL-2 with chemotherapy (Lienard et al., 1992).

Other cytokines with direct cytotoxic o r cytostatic effect on tumor cells have not yet been extensively examined in clinical trials, although increasing numbers of recombinant cytokines, including members of both the tumor growth factor P family of molecules and the fibroblast growth factor family of molecules should be examined in the near future (Rechia et al., 1991). Their potential for antineoplastic therapy remains largely speculative. It is hoped that research to elucidate the specific signals that mediate the immune response to tumors will provide the rationale for mounting clinical studies focused on further enhancing host response to malignant tumors. Recombinant cytokines also have

MOLECULAR APPROACHES T O CANCER THERAPY

69

great potential for contributing to the supportive care of cancer patients and facilitating the dose intensification of known antineoplastic agents which have dose-limiting side effects that can be mitigated by the use of biologicals. Erythropoietin, which stimulates red blood cell production (Vannucchi et al., 1992), and various colony-stimulating factors (CSF), which enhance recovery of the neutrophil compartment following bone marrow suppression induced by chemotherapeutic agents, are already in clinical trials. GM-CSF is now being widely studied as an adjuvant to bone marrow transplant and intensive chemotherapy to speed up bone marrow recovery. b. Monoclonal Antibodies Monoclonal antibodies (mAbs) are now well established as efficacious reagents for the development of novel and highly specific tumor imaging techniques based upon external scintillatography for the detection of radiolabeled antibodies specific for tumor-associated antigens (Schlom, 1989; Goldenberg, 1989). More recently it has been possible to pursue realistically the potential contribution of monoclonal antibodies to the development of novel approaches to cancer therapy (Daar, 1987; Schlom, 1991). T h e targets for most such monoclonals are the same as those that were named as potential targets for therapy mediated by tumor vaccines. To date, oncofetal antigens have been the most extensively studied targets of therapeutic approaches utilizing monoclonal antibodies (Vaickus and Foon, 1991). T h e limited expression of such antigens on the normal tissues of adults is a key determinant of the therapeutic index of these antibodies. Of course, antigens whose expression is either specific for or enhanced on tumor tissues, such as the products of oncogenes, are also important candidate targets. Monoclonals directed against growth-stimulatory receptors can block cell surface interactions required for tumor cell growth. Some monoclonal antibodies can themselves induce cytotoxic activities. Studies to exploit a role for monoclonals in both antibody-dependent cellular cytotoxicity (Vadhan et al., 1988) and complement-dependent cytotoxicity (Nadler et al., 1980) have been explored, but the efficacy of such approaches against both liquid and solid and tumors has been disappointing to date. Similarly, attempts to target tumor specific antigens associated with the dysregulated growth of tumors, such as growth factor receptors, have not yet led to significant tumor regressions (Ennis et al., 1991). Current attention is largely focused on the use of monoclonals to transport cytotoxic moieties to which they have been conjugated (Schlom, 1991). Monoclonal antibodies have been conjugated to cytotoxic drugs, toxins, and radioactive isotopes, and this seems at present a

70

MARK A. ISRAEL

promising approach to delivering therapy to several different types of tumors. Such an approach has the advantage of utilizing proven agents and enhancing their therapeutic index by targeting them specifically to tumor cells. The two most extensively studied toxin conjugates have been those in which mAbs have been coupled to either ricin toxin or Pseudomonas toxin. Ricin is a potent inhibitor of ribosomal activity (Lambert et al., 1988). Typically the A chain of the ricin molecule is coupled to a monoclonal and it is thought that a single molecule of ricin toxin maybe sufficient to kill a tumor cell (Vallera and Myers, 1988).Clinical trials in which ricin-mAb conjugates have been administered for the treatment of breast cancer (Weiner et al., 1989), melanoma (Spitler et al., 1987), and other tumors of both children and adults have demonstrated localization of the toxin to the tumor site and tumor responses, although these responses have typically been transient and partial. Fewer trials utilizing Pseudomonas toxin conjugated to mAb have been pursued to date. In both ricin A-chain and Pseudomonas toxin conjugates, treatment side effects arising from toxicities associated with the immunotoxin have been identified. Peripheral neuropathies have emerged as a dose-limiting toxicity of ricin A-chain conjugates (Gould et al., 1989), although the toxicity of Pseudomonas conjugates has been of only moderate intensity to date (Morgan et al., 1990; Pai et al., 1991). Both types of conjugates evoke the development of antibodies against the conjugated toxins (Grossbard and Nadler, 1992) and more recent trials have attempted to utilize ricin molecules that have been treated to minimize their immunogenicity. The most compromising aspect of treatment strategies that involve immunotoxins is the requirement that these agents be taken u p into the cell for their cytotoxicity to be realized. Some of the antigens against which tumor-reactive m Abs have been developed are not internalized. Attempts to minimize the impact of such limitations include the development of conjugation chemistry to create bonds that are susceptible to cleavage after being bound on the cell surface, thereby releasing toxin for transport into nearby cells (Wawrzynczak and Thorpe, 1987). Radionuclide mAb conjugates may be of particular importance in addressing this shortcoming because the cytotoxic effect of many isotopes can be propagated at a distance greater than one cell diameter after the monoclonal has found its target. Internalization is, of course, not a requirement for cytotoxicity. Iodine- 131 is the most commonly used radioisotope for conjugation to mAbs. Its popularity reflects in part the familiarity of workers in the field, its widespread availability, and the minimal side effects that result from its metabolism. T h e emission profile of yttrium-90 and related

MOLECULAR APPROACHES TO CANCER THERAPY

71

nuclides suggests that they may be particularly attractive sources of radioactivity for such conjugates (Larson, 1991). Significant therapeutic responses including prolonged, complete remissions (Press et al., 1991; Abdel-Nabi et al., 1992) have been observed in patients treated with radionuclide mAb conjugates. The dose-limiting toxicity of such therapies has been bone marrow suppression, presumably resulting from radioconjugated antibody that becomes sequestered in the marrow compartment. Other problems are associated with the logistics of safely administering the required large doses of radiation to patients who must oftentimes be restricted to specially designed patient rooms until a large portion of the administered dose has been excreted. Major areas of current research that may enhance the efficacy of this treatment modality include the examination of multiple nuclides that have varying half-lives and emission profiles, better conjugation methodologies, and additional antibodies. T h e major problems that compromise mAb-based therapy, however, are shared in common by each of the strategies mentioned above. These include the development of human antimurine antibody (HAMA), tumor cell heterogeneity, modulation of antigen expression in association with antibody treatment, and an incomplete understanding of the pharmacology of exogenously administered antibodies. The obstacle that makes the development of effective therapies most problematic is the development of antibodies by cancer patients that diminish the effect of the administered antibody. Most patients can receive only two o r three doses of a particular monoclonal antibody. The ability to produce monoclonal antibodies utilizing recombinant DNA technologies is likely to dramatically enhance the clinical utility of these reagents, since there will be much more control over the precise structure of the immunoglobulin molecule. Characteristics of monoclonal antibodies such as their immunogenicity, antigen-binding affinity and specificity, effector cell interactions, and pharmacokinetic properties rest largely in the Fc portion of the molecule, a region distinct from the antigen-binding site. Recently it has become possible to clone the genomic DNA fragments encoding the heavy- and light-chain variable regions of murine monoclonal antibodies into mammalian expression vectors containing genomic DNA segments encoding the constant regions of human immunoglobulin heavy and light chain (Sun et al., 1987). Functional “human” monoclonals with the same specificity as the original murine hybridoma produced antibody can be produced by transferring the recombinants to mouse myeloma cells. This finding demonstrates the feasibility of constructing chimeric antibodies with therapeutically relevant activities.

72

MARK A. ISRAEL

Of particular importance is the possibility that such chimeric antibodies will alleviate the key problem of HAMA development that invariably occurs in association with the therapeutic use of immunoglobulin molecules (Morrison and Schlom, 1992). Human antimurine antibody results in the formation of antibody-antibody complexes that are cleared by the kidney before the antibody can be effectively bound at antigenic sites on the tumor. “Humanizing” murine monoclonals that are used for cancer therapy should diminish considerably their immunogenicity. Technologies such as the approach referred to above should facilitate the conversion of murine monoclonals, which have been painstakingly characterized, into much less antigenic molecules by exchanging DNA which encodes the murine Fc region of the immunoglobulin for a corresponding human DNA sequence. Other strategies that should also enhance our ability to make human monoclonal antibodies have recently been identified (Wong et al., 1989; Roome and Reading, 1984). Of particular importance in this regard has been the use of combinatorial immunoglobulin gene libraries to generate an enormous potential repertoire of immunoglobulins (Huse et al., 1989). This approach to the generation of new monoclonals involves the construction of libraries of polymerase chain-amplified DNA corresponding to the heavy- and light-chain immunoglobulin RNA isolated from a mouse immunized with the antigen of interest. These libraries are constructed in phage vectors that have been engineered to facilitate the expression and secretion of the cloned immunoglobulin fragments. T h e inserts from these libraries are then combined and the hybrid molecules recloned to construct an expression library with random combinations of heavy and light chains. This expression library can then be screened for an antibody-producing clone of the desired specificity. Among these it can be expected that antibodies which may not have been present in the repertoire of antibodies expressed in the immunized animal will be expressed. Molecular technologies have also made possible the development of totally novel monoclonal antibody-like molecules, single-chain antigen proteins (McCartney et al., 1991). Single-chain antigen proteins are engineered proteins containing the variable regions from both an immunoglobulin heavy chain and an immunoglobulin light chain. These molecules have antigen recognition capacities similar to those of the antibodies from which they are derived. Their small size, however, may contribute to biologic properties particularly advantageous for certain therapeutic applications. Single-chain antigen proteins should be better distributed throughout tumor masses than full-sized antibodies; they should be more rapidly cleared by the kidney, thereby diminishing the

MOLECULAR APPROACHES T O CANCER THERAPY

73

toxicity of various cytotoxic conjugates; and they should be less immunogenic. c. Adaptive Cellular Therapy T h e transfer of immunologically active cells with antitumor activity is a much more recent approach to passive immunotherapy, which has become possible as a direct result of the availability of recombinant IL2. Although it has been known for decades that cellular transfer of lymphocytes from mice immunized with tumor extracts could lead to tumor regression in inbred tumor-bearing mice, the study of cellular transfer in humans was delayed until it became possible to expand autologous lymphocytes in culture (Grimm et al., 1982; Rayner et al., 1985). T h e advent of adoptive immunotherapy in which such cells are expanded in vitro by incubation with the mitogen I L 2 and subsequently administered to patients has opened important, novel treatment opportunities. Rosenberg and colleagues working at the National Institutes of Health have characterized LAK cells (Grimm et al., 1982) and tumorinfiltrating lymphocytes (TIL) and pioneered their use in cancer therapy (Rosenberg et al., 1986) during the 1980s. Lymphokine-activated killer cells for therapy are generated by incubation of peripheral blood lymphocytes with recombinant IL2. Interleukin 2, LAK cells, and a combination of these two have been used to treat patients with a wide variety of cancers. The results of these trials have been summarized and indicate that objective responses can be seen with each of these treatment approaches, although it has not yet been possible to demonstrate that these therapies result in a survival advantage (Rosenberg, 199la). During the course of these trials, it became feasible to grow sufficient quantities of IL2-responsive lymphocytes isolated from tumor tissue, T I L cells, and to return these autologous, in vitro-expanded cells to cancer patients. Tumor-infiltrating lymphocytes are cells that have been isolated from surgically removed tumor tissue and expanded with IL-2 in culture (Rosenberg et al., 1986). Such TILs have a greatly enhanced ability to kill tumor cells when examined in in vivo experimental models (Alexander and Rosenberg, 1991). This effect may be mediated by IFN-y o r TNF (Barth et al., 1991). Tumor-infiltrating lymphocyte T I L cells are generally administered to patients along with I L 2 , to enhance their continued growth, and cyclophosphamide. Cyclophosphamide was empirically determined to enhance the effectiveness of TILs in laboratory models, presumably through its cytotoxic effects on suppressor cells (Rosenberg, 1991b). This effect seems to be mimicked by local irradiation of tumor tissue (Cameron et al., 1990). Clearly when these cells are given to patients as an infusion they traffic to patients’ tumors (Fisher et

74

MARK A. ISRAEL

al., 1989) and can be associated with objective tumor responses in both melanoma (Rosenberg et al., 1988) and renal cell cancer patients (Kradin et al., 1989). Most patients treated to date with LAK or T I L cell-containing regimes have not responded and the reasons for this remain poorly understood. Whether this approach will become effective therapy and enhance the survival of cancer patients remains to be demonstrated. Several different strategies are currently being pursued to enhance the efficacy of treatment with T I L cells. The administration of cytokines such as IFN with TIL cells is being pursued in an effort to enhance the expression of tumor histocompatibility antigens (Rubin et al., 1989; Weber et al., 1987), which may be important for the T I L cell-mediated antitumor effect. Also, the genome of TIL cells is being altered by genetic engineering techniques (see below) in an effort to enhance their tumor killing activities, while capitalizing on their ability to effectively seek out tumor cells. C. THERAPEUTIC REPAIROF ONCOCENIC GENETICALTERATIONS

The elucidation of cancer as a genetic disorder evokes images of repairing the underlying genetic lesion and thereby treating the cancer. T h e essence of cancer as a somatic genetic disorder, namely that it arises as the result of multiple different genetic alterations resulting in unregulated cell growth, provides a particularly challenging situation for gene therapists: which gene should be corrected and how can this gene be repaired in every single tumor cell? Remarkably, tumor cells that have been transfected with functional alleles of tumor suppressor genes in vitro acquire a more normal phenotype of decreased growth in soft agar and decreased tumorigenicity, two important surrogates for the evaluation of human malignancy. Similar results have been obtained in related experiments utilizing novel drugs, especially antisense oligonucleotides, which have the important but potentially limiting characteristic that they are highly specific and likely to affect the expression of only a single gene. These findings raise the possibility that it may not be necessary to correct all of the genetic alterations contributing to a specific malignancy and suggest that if one could alter the tumor cell genome, it might be possible to modify successfully various biological properties of human tumors. Drugs that target specific molecules and gene therapy are divergent approaches to the treatment of cancer but are founded in a common conceptual framework. Also, they share both strategic and technical fea-

MOLECULAR APPROACHES T O CANCER THERAPY

75

tures. Conceptually, both represent approaches to modulate the expression of one o r a very few genes. Depending on the precise therapy being pursued, these treatment modalities share the potential problem of having to alter the biology of every single tumor cell. For this reason, many practitioners of both approaches have focused on the development of treatment strategies that mediate cell killing through soluble factor production as the result of therapy, induction of a “bystander” effect, or modulation of the patient’s antitumor immune response. 1. Antisense Oligonucleotides In contrast to the daunting problems associated with the permanent transfer of new genes to either normal o r malignant cells, the limitations of systemically administered molecules to address very specifically the molecular lesions, which lead to malignant tumor growth, seem quite manageable. Molecules such as ribozymes and highly specific nucleases and proteases may someday contribute to an armamentarium of drugs that carry in their primary structure the basis for highly specific therapeutic activities. At the present time, the best known and most extensively characterized agents belonging to this group of “smart” drugs have been antisense oligonucleotides. These molecules are nucleic acids whose nucleotide sequence is complementary to a DNA or RNA sequence corresponding to a gene whose expression is thought to be deleterious to the cell. The enthusiasm for pursuing this approach to cancer treatment arises from both its potential for specificity and a considerable number of laboratory studies indicating that antisense oligodeoxynucleotides added exogenously to cultures of tumor cells can inhibit their growth. In some such experiments it has been possible to show that growth inhibition is occurring in association with diminished expression of the gene of interest. Key to converting such an observation into efficacious therapy, however, is knowledge of the mechanism by which such inhibition occurs and an understanding of the specific problems that might limit its application. Initially it was thought that the inhibition of gene expression associated with antisense oligodeoxynucleotide treatment was the result of the administered DNA binding to the target mRNA and blocking its translation (Maher and Dolnick, 1987), a sort of hybridization arrest. Such a mechanism may be of importance when the administered oligonucleotide hybridizes to a region near the initiation codon (Cornelissen et al., 1986); however, it is likely that once the ribosome has attached to the mRNA, it is capable of melting such duplexes and normal translation can occur (Blake et al., 1985). Hybridization of antisense molecules to some RNA sequences downstream of the initiation region may inhibit

76

MARK A. ISRAEL

the splicing of nuclear RNA species into mature mRNA molecules (Maher and Dolnick, 1987; Becker et al., 1989; Goodchild et al., 1988) or they may contribute to the inhibition of gene expression by yet unrecognized mechanisms. In experiments examining the effect of antisense oligodeoxynucleotides on the translation of targeted mRNA in cell-free transcription/translation systems (Cornelissen et al., 1986) and in injected oocytes from X e n o ~ wlaevis (Cazenave el al., 1989; O’Keefe et al., 1989) or murine oocytes (Kawasaki, 1985), ribonuclease H has been implicated in contributing to the inhibition of oncogene expression. RNAse H mediates intracellular RNA degradation (Cook, 1991) by cleaving RNA that is duplexed to DNA, but the precise extent of its role and the degree to which it contributes to the diminished expression of targeted genes in mammalian cells is to date unknown. Other antisense strategies for developing novel therapies include designing oligonucleotides to form triple helices with genomic DNA (Helene, 1991) and linking antisense oligonucleotides to antineoplastic agents to target them to DNA (Helene and Thuong, 1989). Regardless of the precise molecular pathway over which the inhibition of gene expression is mediated, it is essential that the oligodeoxynucleotide hybridize efficiently to the target sequences under conditions that would be encountered in viva That is, both the stability and the association constant of the RNA : DNA heteroduplex at 37°C should be high. These guidelines have led to certain suggestions regarding the design of antisense molecules (Zon, 1988) and the selection of specific target sequences (Wickstrom et al., 1988). Also, it is important that the antisense nucleotides be chemically stable under conditions that they will encounter during treatment. In this regard the sensitivity of oligodeoxynucleotides to serum proteases has been a formidable problem to overcome. Most experiments have been carried out in tissue culture where nucleases, predominantly 3’-phosphodiesterases, rapidly degrade oligodeoxynucleotides (Tidd and Warenius, 1989). To minimize this problem various modifications of oligodeoxynucleotide structure have been examined. These have included attempts to block the 3’ end from exonucleolytic attack with various chemical moieties such as methylphosphodiester linkages (Miller and Ts’o, 1987) or 3’-deoxythymidine (Zamecnik et al., 1986) o r by linking oligonucleotides to such molecules as aminoacridine (Verspieren et al., 1987) or poly-L-lysine (Leonetti el al., 1988). In other efforts to build oligonucleotide analogs that would be resistant to nucleolytic cleavage, modifications in the phosphodiester linkage have been examined. The most extensively examined of these are methylphosphonate and phosphorothioate oligonucleotide analogs

MOLECULAR APPROACHES TO CANCER THERAPY

77

(Cazenave et al., 1989; Crooke, 1991; Neckers et al., 1992). Methylphosphonate oligonucleotide analogs are clearly less susceptible to nuclease degradation but hybridize poorly to complementary nucleic acids. This is disappointing because they do not activate ribonuclease H cleavage of mRNA and therefore are best used with the intention of blocking gene expression through hybridization arrest (Giles and Tidd, 1992). Phosphorothioate oligonucleotide analogs have similarly enhanced resistance to nuclease degradation and like the methylphosphonate analogs have reduced affinity for forming heteroduplexes when compared to phosphodiester oligodeoxynucleotides. In contrast to the methylphosphonate oligonucleotide analogs, however, these phosphorothioate analogs d o induce RNAse H-mediated mRNA degradation. 2. Gene Therapy Gene therapy involves the introduction of new genetic information into cells (Benvenisty and Reshef, 1986). To date the focus of such efforts in cancer medicine has been on somatic cells, both normal and tumor cells. As noted above, it has been possible in in nitro experiments using human tumor cell lines to demonstrate that such cell lines exhibit diminished malignant behavior when a normal gene corresponding to one that has been inactivated in tumor cells is replaced. However, the possibility of replacing a normal gene for one that has been deleted or to counteract the effects of a gene that has been mutated is currently compromised by important problems whose resolution cannot yet be envisioned. How to place the gene in every cell of a tumor, how to place it into the tumor cell in a manner that it can be permanently retained and appropriately regulated, and how to diminish the possible deleterious effects of such a gene interrupting the normal function of the other cells into which it would also no doubt be transferred are among such central issues. To date, the most widely used and most extensively studied vehicle for delivery of exogenous genes to mammalian cells in vivo has been defective retroviruses (Cepko et al., 1984). Recombinant viral genomes contain the gene to be transferred in place of virus coat genes. Such recombinant viral genomes are transferred into the recipient cells by infection following packaging of the genomes into virus coat proteins that enable them to infect human cells. Cell lines capable of converting recombinant virus genomes into infectious virus have been engineered to contain only the viral coat genes in their genome. Such cell lines produce coat proteins that envelop the defective recombinant viral genome without producing virus that can be propagated in any other cell type (Mann et al., 1983). Continuous replication of the recombinant viral genome in this

78

MARK A. ISRAEL

packaging line permits the production of culture supernatants that contain sufficient viral titers to be used for the infection of target cells. Currently available vectors result in typical infection efficiencies of approximately 50% in tissue culture, where conditions are optimal, and therefore would not seem to be sufficient for approaches to gene therapy that require the infection of every individual tumor cell. Other delivery strategies involving the administration of foreign genes encapsulated in liposomes o r some other vehicle that would facilitate uptake into the cell while protecting the administered DNA from nucleases are similarly inefficient (Hug and Sleight, 1991). Preliminary evidence suggests that “bystander effects” associated with such therapies can result in the killing of tumor cells beyond what could be expected if only retrovirally infected tumor cells were killed (Russell et al., 1991; Gansbacher et al., 1990a). This finding raises the possibility that significant therapeutic effects may be achievable even when only a minority of the tumor cells can be genetically altered. Most current conceptual approaches to the use of gene therapy for the treatment of cancer focus on strategies that do not require gene transfer into every cancer cell. Genes that are candidates for such an approach to therapy may include those encoding toxins, antibodies, o r secreted cytokines that might enhance the immunologic response to the tumor (Sikora, 1991). Other approaches utilizing gene transfer to tumor cells are directed at changing the tumor cell in a manner that renders it more susceptible to antineoplastic therapy. Gene products that might contribute to the enhanced killing of tumor cells include those that render infected cells uniquely susceptible to drugs that are otherwise not effective antineoplastic agents (Mullen et al., 1992). T h e possibility of using tissue- or cell type-specific promoters to drive the expression of such foreign genes provides specificity to such an approach (Huber et al., 1991). Also, it may eventually be possible to devise strategies that would result in cell surface modifications that could activate either drugs or the host immune system in a manner that leads to enhanced cytotoxicity for all cells in the neighborhood of the genetically modified tumor cells. In animals it has been possible to exploit this approach successfully in the treatment of experimentally induced brain tumors (Culver et al., 1992). Cells containing the herpes simplex virus thymidine kinase gene (HS-tk) are killed by ganciclovir, although normal mammalian cells are not. Inoculation of mouse fibroblasts producing a retrovirus containing HS-tk into the site in rat brains at which 9L glioma tumor cells had been previously injected resulted in animals that were histologically free of tumor approximately 1 month following tumor inoculation. This approach converts the potential liability of retroviruses, namely their abili-

MOLECULAR APPROACHES T O CANCER THERAPY

79

ty to infect only replicating cells, into an asset in that the only cells in brain that are rapidly dividing are tumor cells. These findings call attention to the question of what the nature of the bystander effect might be, since preliminary experiments conducted as part of this study suggested that significant tumor cell kill could be achieved even if only 10% of tumor cells were infected with the recombinant retrovirus. It may also be possible to exploit other approaches to gene therapy in which tumor tissue is specifically sensitized to the actions of a cytotoxic drug. For example, cells that were modified to express the bacterial enzyme cytosine deaminase might convert 5-fluorocytosine, which is normally nontoxic, to 5-fluorouracil, which is cytotoxic (Culver et al., 1992). Gene therapy approaches to modulation of the immunogenicity of tumors are of great interest because they are based on the production of cytokines, which can have a therapeutic effect at considerable distances from the cells into which a new gene has been inserted. Cytokine production by tumor cells opens the possibility of enhanced host killing by cytotoxic lymphocytes and antibodies as a result of amplification of the normal host response. Cytokine expression might also enhance expression of tumor cell histocompatability loci and thereby contribute an additional therapeutic dimension to this approach, which is fundamentally focused on converting tumors that elicit only modest host responses to tumors that are highly immunogenic. A particularly innovative approach to gene therapy involves modifying the genome of cells ex vim and then administering these cells back to the patient with the expectation that they would modify either tumor virulence o r the host response to the tumor. Because of their tumorhoming potential, TIL cells offer a unique vehicle by which to effect such therapy. Stably modifying the genome of TILs to express exogenously introduced genes may enhance their antitumor activity (Kasid et al., 1990, Culver et al., 1991). Tumor-infiltrating lymphocytes have now been used for the treatment of several different human cancers and are being explored as vehicles for gene therapy. In an early study, T I L cells into which the antibiotic resistance gene neomycin phosphotransferase was transferred were reinfused into patients and the kinetics of T I L disappearance from the circulation was examined (Rosenberg et al., 1990). Of particular note in this study was the finding that TIL cells were most easily detected during the first 3 weeks following reinfusion, a time during which the patients were receiving high doses of IL2.More recently, T I L cells modified to carry an exogenously introduced TNF gene, which secreted this cytokine at a level 100 times greater than nontransduced cells, have been prepared for administration to patients in an attempt to increase the local tumor concentration of this highly

80

MARK A. ISRAEL

effective antitumor agent (Rosenberg, 199la). Such an experiment heralds future approaches in which we can anticipate that TIL cells will be further modified to enhance their antitumor activities by the production of other cytokines (Tepper et al., 1989; Gansbacher et al., 1990b) such as interferon-y, which can be expected to upregulate MHC expression. T h e enhanced expression of genes such as the I L 2 receptor to facilitate the maintenance and expansion of the TILs once they are reinfused in vivo has also been proposed. Gene therapy offers the possibility for novel approaches to the development of tumor vaccines. Human papilloma virus is associated with several different human tumors. Laboratory experiments have indicated that the transforming potential of these viruses rests within the viral genes known as E6 and E7. Mouse fibroblasts transfected with a recombinant gene expressing the E7-encoded protein can immunize mice against the development of tumors following their inoculation with E7transformed syngenic cells (Chen et a!., 1991). These findings suggest that tumor-associated viral antigens might be utilized as tumor vaccines for protection against the development of certain tumors and perhaps even as an adjuvant to other therapies. Although it is unclear how immunogenic oncofetal and other so-called tumor-associated antigens will be, viral proteins and gene products encoded uniquely by tumor cells as a result of the genetic rearrangements offer realistic targets for vaccine development. Another distinctive therapeutic approach utilizing gene therapy is directed at modifying host tolerance for therapy. The most straightforward of such approaches involves the transfer of drug resistance genes to tissues in which dose-limiting toxicity is first seen. For example, transfer of the gene that encodes resistance to multiple drugs, the mdr gene, to bone marrow hematopoietic precursor cells may make it possible to administer higher doses of therapy than are currently possible (Mickisch et al., 1992). Additionally there are many other antineoplastic agents for which resistance can be conferred by the activation of even a single gene. Such genes are candidates for providing normal tissue protection for the toxicities of these agents. Considerable evidence suggests that dose intensification holds promise for improving the outcome of selected patients with both hematopoietic and solid tissue tumors. Gene therapy may provide an important new approach to achieving such increased doses of conventional antineoplastic agents. REFERENCES

Abdel-Nabi, H., Wright, G. L., and Gulfo, J. V. (1992). Semin. Urol. 10,45-54. Akiyarna, T.,Ishida, J., and Nakagawa, S. (1987).J Bwl Chem. 269, 5592-5595.

MOLECULAR APPROACHES TO CANCER THERAPY

81

Alexander, R. B., and Rosenberg, S. A. (1991).J. fmmunother. 10,389-397. Barth, R. J., Mule, J. J., Spiess, and P. J. (1991).J Exp Med. 173, 647-658. Becker, D., Meier, C. B., and Herlyn, M. (1989). E M B O J . 8,3685-3691. Benvenisty, N., and Reshef, L. (1986). Proc. Null. Acad. Sci. U.S.A. 83, 275-76. Bergmann, L., Mitrou, P. S., Weidmann, E., Enzinger, H. M., and Franks, C. R. (1991). Proc. Annu. Meet. Am. Assoc. Cancer Res. 32, 1457. Blake, K. R., Murakami, A., and Miller, P. S. (1985). Biochemistry 24, 6132-6138. Bourne, H. R., Saunders, D. A., and McCormick, F. (1990). Nature (London) 348,125-132. Brown, T. D., Goodman, P., Fleming, T., Macdonald, J. S., Hersh, E. M., and Braun, T. J. (1991).J fmmunother. 10, 376-378. Bystryn, J., Oratz, R., Harris, M. N., Roses, D. F., Golomb, F. M., and Speyer, J. L. (1988). Cancer 61, 1065-1070. Cameron, R. B., Spiess, P. J., and Rosenberg, S. A. (199O).J Exp Med. 171, 249-263. Cazenave, C., Stein, C. Z., Loreau, N., Thoung, N. T., Neckers, L. M., Subasinghe, C., HClhe, C., Cohen, J. S., and ToulmC, J. (1989). Nucleic Acids Res. 17, 4255-4273. Cepko, C. L., Roberts, B. E., and Mulligan, R. C. (1984). Cell (Cambridge, Mass.) 37, 105362. Chatterjee, M., Barcos, M., Han, T., Liu, X. L., Berstien, Z., and Foon, K. A. (1990). Blood 76, 1825-1829. Chen, L., Thomas, E. K., Hu,S. L., Hellstrom, I., and Hellstrom, K. E. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 110-14. Cook, P. D. (1991). Anticancer Drug Des. 6, 585-607. Cornelissen, A. W. C., Verspieren, M. P., Toulmk, J., Swinkles, B. W., and Borst, P. (1986). Nucleic Acids Res. 14, 5605-56 14. Coughlin, S. R., Escobedo, J. A., and Williams, L. T. (1989). Science 243, 1191-1 194. Creasey, A. A., Reynolds, M. T., and Laird, W. (1986). Cancer Res. 46, 5687-5690. Crooke, R. M. (1991). Anticancer Drug DeA. 6, 609-646. Culver, K., Cornetta, K., and Morgan, R. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 31553159. Culver, K. W., Ram, Z., Wallbridge, S., Ishii, H., Oldfield, E. H., and Blaese, R. M. (1992). Science 256, 1550-1552. Dyke, R. J.. McBride, H., George, A. J. T., Harnblin, T. J., and Stevenson, F. K. (1991). Cell Immunol. 132, 70-83. Ennis, B. W., Lippman, M. E., and Dickson, R. B. (1991).Cancer Invest. 9, 553-562. Fiedler, W., Zeller, W., Peiman, C. J., Weh, H. J., and Hossfeld, D. K. (1991). Klzn. Wochenschr. 69, 26 1-268. Fisher, B., Packard, B. S., Read, E. J., Carrasquillo, J. A,, Carter, C. S., Topalian, S. L., Yang, J. C., Yolles, P., Larson. S. M., and Rosenberg, S. A. (1989).J. Clin. Oncol. 7,250262. Foon, K. A., Sherwin, S. A.. and Abrams, P. G. (1984). N . Eng1.J. Med. 311, 1148-1152. Frater-Schroder, M., Risau, W., Hallman, R., Gautschi, P., and Bohlen, P. (1987).Proc. Natl. Acad. Sci. U.S.A. 84, 5277-5281. Galvani, D . W., and Cawley, J. C. (1990). Blood Rev. 4, 175-180. Gansbacher, B., Zier, K., Daniels, B., Cronin, K., Bannerji, R., and Gilboa, E. ( 1 990a). J . Exp. Med. 172, 1217-1724. Gansbacher, B., Zier, K., Daniels, B., and (1990b).J. Exp. Med. 172, 1217-1224. Garth, P., and Kozikowski, A. (1991). Clin. Biochem. 24, 385-397. George, A. J. T., Folkard, S. G., Hamblin, T. J., and Stevenson, F. K. (1988).J. Immunol. 141, 2168-2174. George, A. J. T., and Stevenson, F. K. (1989). Int. Rev. Immunol. 4, 271-310.

82

MARK A. ISRAEL

Giles, R. V., and Tidd, D. M. (1992).Anticancer Drug Des. 7, 37-48. Glennie, M. J., McBride, H. M., Stirpe, F., Thorpe, P. E., Worth, A. T., and Stevenson, G. T. (1987).J. Exp. Med. 166, 43-62. Goldenberg, D. M. (1989).Semin. Nucl. Med. 19, 332-339. Coodchild, J., Agrawal, S., Civeira, M. P., Sarin, P. S., Sun, D.. and Zamecnik, P. C. (1988). Proc. Natl. Acad. Sci. U.S.A. 85,5507-551 1. Could, B. J., Borowitz, M. J., and Groves, E. S. (1989).J. Natl. Cancer Inst. 81, 775-781. Grimm, E. A.,Mazumder, A., Zhang, H. Z., and Rosenberg, S. A. (1982).J.ExP. Med. 155, 1823-1 841. Grimm, E. A,, and Owen-Schaub, L. (1991).J.Cell. Biochem. 45, 335-339. Grossbard, M. L.. and Nadler, L. M. (1992).In “Important Advances in Oncology” (V. T. DeVita, S. Hellrnan, and S. A. Rosenberg, eds.), pp. 1111-1135. Lippincott, Philadelphia. Hamblin, T. J.. Abdul-Ahad, A. K., Gordon, J., Stevenson, F. K., and Stevenson, G. T. (1980).8 7 . J. Cancer 42, 495-502. Hersh, E. M., Metch, B. S., Muggia, F. M., Brown, T. D., Whitehead, R. P., Budd, G. T., Rinehart, J. J., Crawford, E. D., Bonnet, J. D., and Behrens, B. C. (1991).jImmunother. 10,426-43 I . Helene, C. (1991).Anticancer Drug Des. 6, 569-584. Helene, C., and Thuong, N. T., (1989).Genome 31, 413-421. Hirai, H., and Alpert, E., (1975).Ann. N . Y.Acad. Sci. 259, 1-452. Huber, B. E.,Richards, C. A., and Krenitsky, T. A. (1991).Proc. Natl. Acad. Sci. U.S.A. 88, 8039-8043. Hug, P., and Sleight, R. G. (1991).Biochim. Biophys. Acfa 1097, 1-17. Huse, W. D.,Sastry, L., and Iverson, S. A. (1989).Science 246, 1275-1281. Imoto, M., Umezawa, K., Komuro, K., Sawa, T., Takeuchi, T., and Umezawa, H. (1987). JPn. J. Cancer Res. 78, 329-332. Kasid, A,, Morecki, S., and Aebersold, P. (1990).Proc. Natl. Acad. Sci. U.S.A. 87,473-477. Kawasaki, E. S. (1985).Nucleic Acids Res. 13,4991-5004. Kolitz, J. E.,and Mertelsmann, R. (1991).Cancer Invest. 9, 529-542. Kradin, R. L., Lazarus, D. S., Dubinett, S. M., Gifford, J.. Grove, B., Kurnick, T.J., Preffer, F. I., Pinto, C. E., Davidson, E., Callahan, R. J., andStrauss, H. W. (1989).Lancet 1,577579. Lambert, J. M., Blattler, W. A., Mclntyre, C. D., Goldmacher, V. S., and Scott, C. F. J. (1988).Cancer Treat. Res. 37, 175-209. LaRocca, R. V., Stein, C. A., and Myers, C. E. (1990).Cancer Cellr 2, 106-1 15. Larson, S. M. (1991).J.Natl. Cancerlnst. 83, 1602-1604. Leonetti, J. P., Rayner, B., Lemaitre, M., Gagnor, C., Milhaud, P. G., Inbach, J., and Lebleu, B. (1988).Gnze 72, 323-332. Levitzki, A. (1990).Biochem. Phannocol. 40,913-918. Levy, R., Warnke, R., Dorfman, R. F., and Hainovich, J. (1977).J.Exp. Med. 145, 10141028. Lienard, D., Ewalenko, P., Delmotte, J. J., Renard, N., and Lejeune, F. J. (1992).J. Clin. 0 ~ 0 110, . 52-60. Maher, L. J. I., and Dolnick, B. J. (1987).Arch. Biockm. Biophys. 253, 214-220. Mann, R.,Mulligan, R. C., and Baltimore, R. C. (1983).Cell (Cambridge, Mass.) 33, 153159. McCartney,J. E., Lederman, L., Drier, E. A., Cabral-Denison, N. A.. Wu, G. M., Batorsky, R. S., Huston, J. S., and Oppermann, H. (1991).J.Protein C k m . 10, 669-683.

MOLECULAR APPROACHES T O CANCER THERAPY

83

McCormick, F. ( 1991). Environ. Health Persfect. 93, 17- 18. Meeker, T. C., Lowder, J., and Maloney, D. G. (1985). Blood 65, 1349-1363. Meyer, T., Regenass, U.,and Fabbro, D. (1989). Int.J. Cancer 43, 851-856. Mickisch, G. H., Aksentijevich, I., Schoenlein, P. V., Goldstein, L. J., Galski, H., Stahle, C., Sachs, D. L., Pastan, I., and Gottesman, M. M. (1992). Blood 79, 1087-1093. Miller, P. S., and Ts’o, P. 0. P. (1987). Anticancer Drug Des. 2, 117-128. Mittelman, A., Chen, Z. J.. Yang, H., Wong, G. Y., and Ferrone, S. (1992). Proc. Natl. Acad. Sci. U.S.A. 89, 466-470. Morgan, A. C., Sivam, G., Beaumier, P., Mclntyre, R., Bjorn, M., and Abrams, P. G. (1990). Mol. Immunol. 27, 273-282. Morrison, D. K. (1990). Cancer Cellr 2, 377-382. Morrison, S. L., and Schlom, J. (1992). I n “Important Advances in Oncology” (V. T. De Vita, S. Hellman, and S. A. Rosenberg, eds.). Lippincott, Philadelphia, in press. Mullen, C. A., Kilstrup, M., and Blaese, R. M. (1992). Proc. Null. Acad. Sci. U.S.A. 89, 3337. Nadler, L. M., Stashenko, P., and Hardy, R. (1980). Cancer Res. 40, 3147-3154. Neckers, L., Whitesell, L., Rosolen, A., and Geselowitz, D. A. (1992). Crit. Ra? Oncog. 3, 175-23 1. OConnell, M. J., Chen, Z. J., Yang, H., Yamada, M., Massaro, M., Mittelman, A., and Ferrone, S. (1989). Semin. Surg. Oncol. 5, 441-447. OKeefe, S. J., Wolfes, H., Kiessling, A. A., and Cooper, G. M. (1989).Proc. Natl. Acad. Sci. U.S.A. 86, 7038-7042. h i , L. H . , Bookman, M. A., and Ozols, R. F. (1991).J. Clin. Oncol. 9, 2095-2103. Pandiella, A., Magni, M., Lovisolo, D., Peres, A., and Meldolesi, J. (1990). In “Growth Factors: From Gene to Clinical Application” (V.R. Sara, K. Hall, and H. Low, eds.), pp. 117-127. Raven Press, New York. Parker, B. A., Halpern, S. E., Miller, R. A., Hupf, H. F., and Royston, 1. (1991). Antibody Immunoconjugates Radiopharmaceuticals 4, 203. Patek, P. Q., Lin, Y., and Collins, J. L. (1987).J. Immunol. 13, 1641-1646. Powis, G. (1991). TIPS 12, 188-194. Press, 0. W., Eary, J. F., and Badger, C. C. (1991). Adv. Enp. Med. Biol. 303, 91-96. Quesada, J. R., Reuben, J.. Manning, J. T., Hersh, E. M., and Gutterman, J. U.(1984). N. Engl. J. Med. 310, 15-18. Rayner, A. A., Grimm, E. A., Lotze, M. T., Chu, E. W., and Rosenberg, S. A. (1985). Cancer 55, 1327-1333. Rechia, F., Marchionni, F., and Rabitti, G. (1991).Proc. Annu. Meet. Am. SOC.Clin. Oncol. 10, 88. Reeve, J. G. (1991). TumourBiol. 12, 1-8. Robinson, W. A., Mughal, T. I., Thomas, M. R., Johnson, M., and Spiegel, R. J. (1986). Immunobiology 172, 275-282. Roome, A. J., and Reading, C. L. (1984). Enf. Biol. 43,35-55. Rosenberg, S. A. (1991a). Proc. Annu. Meet. Am. Assoc. Cancer Res. 32, 441. Rosenberg, S. A. (1991b). In “Molecular Foundations of Oncology” (S. Broder, ed.), pp. 153-93. Williams & Wilkins, Baltimore. Rosenberg, S. A., Aebersold, P., and Cornetta, K. (1990). N. Engl. J . Med. 323, 570-578. Rosenberg, S. A., Packard, B. S., Aebersold, P. M., Solomon, D., Topalian, S. L., Toy, S. T., Simon, P., Lotze, M. T., Yang, J. C., Seipp, C. S., Simpson, C., Carter, C., Bock, S., Schwartzentruber, D., Wei, J. P., and White, D. E. (1988). N . Engl. J. Med. 319, 16761680.

84

MARK A. ISRAEL

Rosenberg, S. A., Spiess, P., a n d Lafreniere, R. (1986). Science 223, 1318-1321. Rubin, J. T., Elwood, L. T., Rosenberg, S. A., and Lotze, M. T. (1989). CancerRes. 49,70867092. Russell, S. J., Eccles, S. A., Flemming, C., Johnson, C. A., a n d Collins, M. K. L. (1991). Int. J. Cancer 47,244-25 I . Schiller, J. H., Storer, B. E., Witt, P. L., Alberti, D., Tombes, M. B., Arzoomanian, R., Proctor, R. A,, McCarthy, D., Brown, R. R.. and Voss, S. D. (1991). CancerRes. 51, 16511658. Schlom, J. (1989).JAMA 261, 744-746. Schlom, J. (1991). In “Molecular Foundations of Oncology” (S. Broder, ed.), pp. 95-134. Williams & Wilkins, Baltimore. Sikora, K. (1991). Eur.J. Cancer 27, 1069-1070. Skillings, J., Wierzbicki, R., Eisenhauer, E., Venner, P., Letendre, F., Stewart, D., a n d Weinerman, B. (1992).J. Immunother. 11, 67-70. Smith, J. W., Urba, W. J., Clark, J. W., Longo, D. L., Farrell, M., Creekmore, S. P., Conlon, K. C., Jaffe, H., and Steis, R. G. (1991).J Immunother. 10, 355-362. Smith, K. A. (1988). Science 240, 1169-1 176. Smith, K. A., Lachman, L. B., Oppenheim, J. J., and Favata, M. F. (1980).J. Exp. Med. 151, 1551-1556. Spitler, L. E., delRio, M., and Khentigan, A. (1987). Cancer Res. 47, 1717-1723. Steele, G. J., Ravikumar, T., Ross, D., King, V., Wilson, R. E., and Dodson, T. (1984). Surgery 96, 352-359. Stevenson, F. K. (1991). FASEE J. 5, 2250-2257. Stevenson, F. K., George, A. J. T., and Glennie, M. J. (1990). Chem. Immunol. 48, 126-166. Sugarman. B. J., Aggarwal, B. B., Hass, P. E., Figari, I. S., Palladino, M. A. J., a n d Shepard, H. M. (1985). Science 230, 943-945. Sun, L. K., Curtis, P., Rakowicz, S. E., Ghrayeb, J., Chang, N., Morrison, S. I., and Koprowski, H. (1987). Proc. Natl. Acud. Sci. U.S.A. 84, 214-218. Takekura, N., Yasui, W., Kyo, E., Yoshida, K., Kameda, T., Katadai, Y., Abe, K., Umezawa, K., and Tahara, E. (1991). Int. J. Cancer 47, 938-942. Talmadge, J. E., Phillips, H., Schindler, J., Tribble, H., and Pennington, R. (1987). Cancer Res. 47, 5725-5732. Tamaoki, T., Nomoto, H., Takahashi, I., Kato, Y.,Morimoto, M., and Tomita, F. (1986). E i o c h . Eiophys. Res. Commun. 135, 397-402. Tepper, R. I., Pattengale, P. K., and Leder, P. (1989). Cell (Cambridge, Mass.) 57, 503-512. Thompson, J. A., Peace, D. J., and Klarnet, J. P. (1986).J. Inmunol. 137, 3675-3680. Tidd, D. M., and Warenius, H. M. (1989). Er. J. Cancer 60, 343-350. Toi, M., Mukaida, H., Wada, T., Hirabayashi, N., Toge, T., Hori, T., and Umezawa, K. (1990). Eur. J . Cancer 26, 722-724. Urban, J. L., Shepard, H. M., Rothstein, J. L., Sugarman, B. J., a n d Schreiber, H. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 5233-5237. Vadhan, R. S., Cordon-Cardo, C., Carswell, E., Mintzer, D., Dantis, L., Duteau, C., Templeton, M. A., Oettgen, H. F., Old, L. J., and Houghton, A. N. (1988).J. Clin. Oncol. 6, 1636-1648. Vaickus, L., and Foon, K. A. (1991). Cancer Invest. 9, 595-599. Vallera, D. A., and Myers, D. E. (1988). Cancer Treat. Res. 37, 141-159. Vannucchi, A. M., Bosi, A., Grossi, A., Guidi, S., Saccardi, R.,Lombardini, L., and RossiFerrini, P. (1992). Leukemiu 6, 2 15-2 19. Verspieren, P., Cornelissen, A. W. C., Thoung, N. T., Hklene, C., and Toulm6, J. J. (1987). Gene 61, 307-315.

MOLECULAR APPROACHES TO CANCER THERAPY

85

Wandl, U.B., Opakal, B. K., Nagel-Heimke, M., Moritz, T., and Niederle, N. (1992). Semin. 0 ~ 0 199, . 88-94. Waters, H. (1981). “The Handbook of Cancer Immunology.” Garland STPM Press, New York. Wawrzynczak, E. J., and Thorpe, P. E. (1987). In “Antibody Conjugates in Radioimaging and Therapy of Cancer,” pp. 28-55. Oxford Univ. Press, New York. Weber, J. S., Jay, G., and Rosenberg, S. A. (1987).J. Ex$. Med. 166, 1716-1733. Weiner, L. M., ODwyer, J., and Kitson, J. (1989). Cancer Res. 49, 4062-4067. Wettendorf, M., Iliopoulos, D., and Tempero, M. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 3787-3791. Wickstrom, E. L., Bacon, T. A., Gonzalez, A., Freeman, D. L., Lyman, G . H., and Wickstrom, E. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 1028-1032. Wong, J. H., Irie, R. F., and Morton, D. L. (1989). Semin. Surg. Oncol. 5, 448-452. Yaish. P., Gazit, A., Gilon, C., and Levitzki, A. (1988). Science 242, 933-935. Yoneda, T., Lyall, R. M., Alsina, M. M., Persons, P. E., Spada, A. P., Levitzki, A., Zilberstein, A,, and Mundy G. R. (1991). Cancer Res. 51, 4430-4435. Zamecnik, P. C., Goodchild, J., Taguchi, Y., and Sarin, P. S. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 4143-4146. Zon, G . (1988). Phonnacol. Res. 5, 539-549.

This Page Intentionally Left Blank

REGULATION AND MECHANISMS OF MAMMALIAN GENE AMPLIFICATION George R. Stark Research Institute, Cleveland Clinic Foundation, Cleveland, Ohio 44195

I. Introduction 11. Regulation of Amplification A. Permissivity B. Probability C. Summary and Overview 111. Primary Mechanisms of Amplification A. Background B. Unequal Sister Chromatid Exchange C. Telomeric Fusions and Bridge-Breakage-Fusion Cycles D. Centromere Recombination E. T h e Chromosome Breakage-Acentric Element Model F. Overview 1V. Hypotheses Integrating Regulation of Amplification with the Chromatidic Telomere Fusion Model V. Evolution of Amplified DNA References

I. Introduction

It is widely appreciated that amplified oncogenes are common in virtually all types of tumors and that it is more likely to find amplifications in more advanced tumors (Schwab, 1990; Schwab and Amler, 1990). Overexpression of specific genes through amplification and by other means must contribute to the formation and spread of tumors in a variety of ways. Amplification of certain oncogenes is found in some tumor types with high frequency, e.g., N-myc amplification in neuroblastomas; see Schwab and Amler (1990) for more examples. More often, amplification of a particular oncogene is found in a minority of a particular tumor type, but any of several different oncogenes may be amplified in independent examples of this tumor. It seems likely that overexpression of alternative oncogenes can satisfy similar requirements in tumor development. It is also widely appreciated that gene amplification is but one of the genetic abnormalities (deletion, translocation, inversion, nondisjunction, broken chromosomes, dicentric chromosomes, acentric chromosomes, etc.) found commonly in tumors but not

ADVANCES IN CANCER RESEARCH, VOL. 61

Copyright 0 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.

88

GEORGE R. STARK

in normal cells. In this article I explore possible explanations for the association of these genetic abnormalities that lie in the basis of regulation of amplification and in the nature of the primary events. Regulation of amplification has t w o different aspects, permissivity and probability. Permissivity: Observations made in several laboratories show that drug-resistant colonies are not formed from normal senescent cells in selections based on amplification but are when other mechanisms (such as loss o r alteration of function by mutation) can lead to resistance. In contrast, with rare exception, cell lines readily give colonies whose resistance is based on amplification, following selection with any of several different drugs (Stark and Wahl, 1984). Typical frequencies are of the order of l o p 5 to Two alternative explanations are (a) the basic events of amplification do not occur in nonpermissive cells or (b) they do occur but nonpermissive cells carrying amplified DNA fail to give colonies. T h e latter explanation provides a potential connection between amplification and other genetic abnormalities if normal cells have a general means of recognizing genetic damage and responding to it by arresting or dying. Recent work has suggested that tumor suppressor proteins such as p53 are required to maintain the nonpermissive state in normal cells, opening the possibility of a detailed analysis of permissivity in the future. Probability: Permissive cells can respond transiently to agents or treatments that damage DNA or arrest DNA synthesis by increasing their rate of gene amplification as much as 10- to 100-fold. Furthermore, stable variant cell lines with u p to 25-fold higher rates of amplification can be obtained by carrying out selections with two cytotoxic drugs together (Giulotto et al., 1987) o r after treating the cells with the demethylating agent 5-aza-2’-deoxycytidine (Perry el al., 1992a). These results strongly suggest that expression of proteins somehow involved in the amplification process can be induced transiently or stably and provide the basis of efforts to identify these proteins, as discussed below. The primary mechanisms of amplification have only begun to become clear during the last several years, making it timely to review the situation now. We know now that huge regions of DNA, as large as entire chromosome arms, are often amplified as one contiguous unit. Furthermore, in most cases the primary events of amplification do not seem to involve overreplication of DNA, as believed earlier, but rather are based on recombination followed by unequal distribution of the recombined DNA into the two daughter cells. This means that the same mechanisms inevitably lead both to amplification and to genetic loss, ie., the very same processes can account both for the increase in copy number of

MAMMALIAN GENE AMPLIFICATION

89

oncogenes and for the loss of heterozygosity that is so important in helping to delete normal copies of suppressor genes from tumor cells. As will be seen below, some of the primary mechanisms lead to the formation of broken chromosome ends, which might serve as signals to activate general cellular responses to damage, such as induction of repair enzymes, growth arrest, or cell death by apoptosis. Thus we begin to perceive connections between aspects of the primary mechanisms and the regulation of gene amplification.

II. Regulation of Amplification A. PERMISSIVITY Normal human (Lucke-Huhle et al., 1987; Lucke-Huhle, 1991; Wright et al., 1990; Tlsty, 1990) o r rodent (Tlsty, 1990) cell strains failed to give resistant colonies containing amplified DNA when selected with cytotoxic drugs that readily select such colonies from immortal cell lines. T h e drugs used were methotrexate, which selects for dihydrofolate reductase (DHFR) gene amplification; hydroxyurea, which selects for ribonucleotide reductase amplification; and N-(phosphonacety1)-L-aspartate (PALA),which selects for amplification of CAD, a gene encoding the first three enzymes of UMP biosynthesis. Several different cell types were assayed, including lung and skin fibroblasts, mammary and liver epithelial cells, and keratinocyres. The frequency of colony formation was less than l o p 9 from the pooled data, at least four orders of magnitude lower than the typical frequency of about l o p 5observed for many different cell lines. What can be the genetic basis for such a striking difference in amplification frequency between normal and abnormal cells? Tlsty et al. (1992) constructed cell-cell hybrids between permissive human HT1080 or HeLa lines and nonpermissive human fibroblasts. The hybrids did not give PALA-resistant colonies, indicating that the nonpermissive state is dominant. Because of the difficulty of working with senescent normal cells, it was essential to find more tractable model systems for detailed analysis. Lucke-Huhle and Herrlich (1991) found that F9 mouse embryonal carcinoma cells readily gave methotrexate-resistant colonies containing amplified DHFR genes but that, after these cells had been stimulated to differentiate to endodermal cells with retinoic acid, it was no longer possible to select resistant colonies. The carefully chosen concentration of retinoic acid used prolonged the cell cycle time from 10 to 22 hr but did not inhibit cell growth completely. In human diploid and mouse embryonal fibroblast cell strains, the

GEORGE R. STARK

90

presence of wild-type p53 correlates well with a state not permissive for amplification of the CAD gene (Yin et al., 1992; Livingstone et al., 1992). Both groups also found that the presence of wild-type p53 correlated with the ability of fibroblasts to arrest in G1 when starved for pyrimidines through the action of PALA. It will be important to discover whether p53-mediated G1 arrest, p53 regulation of apoptosis, or some other process regulated by p53 is responsible for maintaining the nonpermissive state. We have found that rat REF52 cells, unlike most cell lines, do not give colonies containing amplified CAD or DHFR genes upon selection with PALA o r methotrexate (pooled frequencies less than Perry et al., 1992b). Therefore, REF52 cells were used to introduce viral oncogenes known to complex with cellular tumor suppressor proteins such as p53 o r pRb. T h e results, summarized in Table I, indicate that p53 is required to maintain the nonpermissive state of REF52 cells. These results are related to the data of Shay et al. (1991), who found that human fibroblasts were immortalized if they expressed wild-type SV40 large T antigen but not if they expressed mutant T antigens that fail to bind either pRb or p53. Somewhat surprisingly, Lucke-Huhle et al. (1987) mention that two human fibroblast cell lines transformed with SV40 did not amplify DHFR genes even after prolonged exposure to methotrexate. It would be interesting to challenge these cells with another amplificationselective drug such as PALA. As shown in Table 11, a mutant form of ras does not convert REF52 cells to the permissive state alone but will cooperate with the E1A gene of adenovirus 5 to do so. In this case, there should be no alteration of the p53 status of the REF52 cells, showing that the nonpermissive state can be disrupted at alternate points. In a similar vein, Livingstone et al. (1992) report that two cell lines that have wild-type p53 are nevertheless

TABLE I NONPERMISSIVE REF52 CELLSRETAIN p53

Viral protein in REF52 cells None SV40 T antigen Ad5 ElA Note. Data from Perry ct d.(1992b).

Free cellular proteins Perrnissivity -

+ -

P53

+ +

PRb

91

MAMMALIAN GENE AMPLIFICATION

TABLE I1 LACKOF A CORRELATION BETWEEN PERMISSIVITY AND

Proteins in REF52 cells

T24 ras T24 ra.r + E l A T antigen T24 ras + T antigen

TRANSFORMATION^

Permissivity

Transformation

-

-

+ + +

-

+ +

Note. Data from Perry rt ~ l ( ISY'Lb). . Tumorigenicity o r growth in soft agar.

permissive for amplification. E1A and ras also cooperate to transform REF52 cells, a finding well known from previous work and confirmed by Perry et al. (1992b). However, permissivity and transformation are not always correlated, since SV40 T antigen alone does not transform REF52 cells (Table 11) but does convert them to the permissive state. A similar lack of correlation was noted by Tlsty et al. (1992). The combination of ras plus SV40 T antigen does transform REF52 cells, as expected, but does not alter the permissivity achieved with T antigen alone (Table 11; Perry et al., 1992b).

B. PROBABILITY 1 . Transient Stimulation of Amplification Mammalian cells respond to DNA damage or arrest of DNA synthesis in several ways, including transient inhibition of cell growth and induction of gene amplification (Stark and Wahl, 1984; Schimke, 1988; Lucke-Huhle, 1991). These stresses induce expression of many genes, and more than 20 different cDNA clones corresponding to the induced mRNAs have been isolated (Fornace et al., 1988). Five such clones are coordinately induced by growth arrest signals or DNA damage (Fornace et al., 1989). The expression of all five of these mRNAs is substantially elevated in mice carrying a small homozygous deletion of chromosome 7, implying that a negative regulator is encoded in the delegated region (Fornace et al., 1989). The involvement of any of these damage-induced proteins in induced gene amplification is plausible but uncertain; however, it is relevant to note that transient stimulation of amplification is dominant, indicating that trans-acting elements are involved (LuckeHuhle and Herrlich, 1991).

92

GEORGE R. STARK

2. Stable Stimulation of Amplfication If gene amplification can be increased transiently by increased expression of certain proteins, cells with stably increased expression of such proteins should have a stably increased rate of amplification. Such “amplificator” lines can indeed be obtained from several different cells by simultaneous exposure to two drugs that select for amplification of two unlinked genes (Giulotto et al., 1987; Rice et al., 1987; McMillan et al., 1990). Rates of amplification in amplificator cells are increased up to 25-fold (Giulotto et al., 1987). Cell fusion experiments involving monkey cells and amplificator Syrian hamster cells led to enhanced amplification of the monkey CAD gene, showing that the amplificator phenotype is dominant (Rolfe et al., 1988). This result indicates that the amplificator phenotype is likely to be due to altered expression of proteins that regulate amplification or that participate in it directly. A further indication of some connection between induction of amplification and induction of response to DNA damage is provided by Giulotto et al. (1991), who show that four independent amplificator lines are hypersensitive to high doses of UV light or mitomycin C. It is possible to stimulate the formation of amplificator cells by treating Syrian hamster cells with 5-aza-2‘-deoxycytidine, which extensively demethylates the DNA. T h e rate of CAD gene amplification in such cells is increased by up to 25-fold and the amplificator phenotype is stable for at least 30 days (Perry et al., 1992a). A likely explanation is that the expression of amplificator genes has been stably increased by demethylation of the DNA, but a reasonable alternative is that the stably demethylated DNA is more prone to amplification. Circumstantial evidence indicates strongly that high-level expression of certain proteins can stimulate gene amplification. Can the corresponding cDNAs be identified? In at least one case the answer seems to be yes. Denis et al. (1991) have placed human c-myc cDNA, regulated by a metallothionein promoter, into a rat embryo fibroblast cell line. Induction of c-myc expression with zinc ions during selection with methotrexate increased the number of colonies with amplified DHFR genes by at least 10-fold. T h e most likely explanation is that the 10-fold higher level of c-myc protein induced by zinc ions leads to an increased rate of gene amplification. However, since amplification rates were not measured, it remains possible that c-myc selectively enhances the survival of preexisting methotrexate-resistant cells, for example, by altering their plating efficiency or sensitivity to the drug. Lucke-Huhle (1991) reports that DHFR amplification increases in response to high-level expression of

MAMMALIAN GENE AMPLIFICATION

93

c-myc in Chinese hamster cells, a result similar to that of Denis et al. (1991) in rat cells. As Denis et al. point out, the frequent overexpression of c-myc in tumors might enhance genetic instability as well as confer a growth advantage. c-myc is likely to be a transcription factor regulating the expression of genes whose products contribute to the transition from quiescence to proliferation and help to prevent growth arrest and differentiation in transformed cells. c-myc is also likely to be involved in regulating cellular programs of gene expression in response to DNA damage (Sullivan and Willis, 1989) and perhaps in response to other stresses (Crawford et al., 1988), and has been implicated in the activation of SV40 origins of replication in response to DNA damage. These origins function very poorly in Chinese hamster cells even in the presence of T antigen, but DNA damage leads to transient removal of the block to viral DNA replication (Lavi, 1981; Aladjem and Lavi, 1992; LiickeHuhle, 1991). Mai et al. (1990) and Liicke-Huhle (1991) report that overexpression of c-myc leads to an increase in factors that bind to the SV40 origin in vitro and induce SV40 replication in Chinese hamster cells in vivo, without the need for DNA damage. T h e complexity of effects of c-myc is emphasized by the recent results of Evan et al. (1992), who show that deregulated expression of c-myc potently induces apoptosis when combined with a block to proliferation. Because of the importance of identifying genes whose products stimulate amplification, we have attempted to clone the corresponding cDNAs by using an expression strategy, taking advantage of the fact that the amplificator phenotype is dominant and transferable (Rolfe et al., 1988). A major intrinsic difficulty is that there is no direct selection for amplificator genes. One can only select for the stimulated amplification of a specific target, such as CAD, which may happen in one of to amplificator cells. Thus, the overall frequency will be the product of the transfection efficiency for direct gene transfer (for example and - l o p 4 , or -lop9. We made a cosmid library from the DNA of Syrian hamster amplificator cells. Transfection of monkey cells, followed by a period of growth and then selection with a high concentration of PALA, yielded resistant colonies, whereas untransfected cells did not give colonies under the same conditions. A single cosmid clone recovered from these colonies greatly stimulated CAD gene amplification in retransfection experiments. Colonies resistant to 250 mM PALA formed more than 200 times more often than in transfections with negative cosmids, which give results similar to untransfected controls (Y. Deguchi and G.R.S., unpublished). T h e nature and function of this putative amplificator gene are under investigation.

94

GEORGE R. STARK

C. SUMMARY AND OVERVIEW By what means is the rate of amplification in permissive cells increased in response to DNA damage? T h e nature of cloned amplificator genes should give important information on this point. Furthermore, it is certain that a better understanding of how gene amplification is regulated will give more general insight into damage recognition mechanisms in mammalian cells. A reasonable model is that specific structures in damaged DNA such as broken chromosomes o r cross-linked bases activate transcriptional regulators, which in turn, perhaps through a transcriptional cascade, lead to the expression of genes that deal with the emergency by delaying cell division until the damage can be repaired, participating in the repair process directly, and perhaps killing the cell if the damage cannot be repaired quickly enough. As described in the next section, it is now clear that an important primary event in amplification begins with recombination at or near telomeres to generate dicentric sister chromatids. A series of bridgebreakage-fusion cycles (see Section II1,C) generates broken chromosomes anew in each cell cycle until the broken ends are somehow healed. If the broken ends induce gene amplification transiently in each cell cycle, the process will be autocatalytic in that the unstable products of prior amplification events will repeatedly stimulate new events. With respect to permissivity, a key question is: Why do normal cells have normal karyotypes? Perhaps the abnormalities so easily observed in cell lines (deletion, amplification, inversion, translocation, non-disjunction, etc.) simply happen much less often in normal cells. Alternatively, perhaps the frequencies of such events are similar in most cells, but normal cells that suffer such damage are either prevented from growing o r actively killed. This idea is similar to the hypothesis of Rosenberger et al. (1991) that “normal cells possess proof-reading mechanisms which monitor the accuracy of chromosome segregation and replication and which can induce the synthesis of growth inhibitors when they detect major errors in chromosome metabolism.” Such a unifying idea to account for failure to observe the many forms of altered DNA in normal cells is very attractive. p53 is a transcriptional regulator (Farmer et al., 1992) that is important in mediating apoptosis in some cells (YonishRouach et al., 1991; Shaw et al., 1992). p53 also mediates growth arrest in response to DNA damage (Kuerbitz et al., 1992; Kastan et al., 1992). As noted above, p53 also seems to be involved in maintaining the nonpermissive state in normal cells. Kastan et al. (1991) and Lane (1992) discuss the evidence that p53 is the “guardian of the genome,” orchestrating the

MAMMALIAN GENE AMPLIFICATION

95

response of cells to DNA damage and causing elimination of cells in which damage persists. If the process of amplification generates damaged DNA as we now suspect, the linkage between such a function of p53 and its role in permissivity becomes clear. It should be possible in the near future to evaluate both the role of the p53 protein in permissivity and the mechanism by which growth of colonies containing amplified DNA is prevented.

Ill. Primary Mechanisms of Amplification A. BACKGROUND An early proposal for the mechanism of gene amplification postulated that repeated initiation of DNA replication at a single origin within a single cell cycle led to an “onionskin” structure and that this structure was resolved through recombination into intra- or extrachromosomal amplified DNA. This mechanism now seems unlikely to account for the initial events of amplification. See recent reviews for the detailed arguments and for consideration of other mechanisms that are not presented here (Stark et al., 1989, 1990; Windle and Wahl, 1992). A general conclusion is that different mechanisms may be responsible for amplification of different genes in the same cell or of the same gene in cells of different species (Stark et al., 1989, 1990). For more recent examples, see Kopnin et al., 1992. Furthermore, more than one mechanism may operate alternatively at a single locus in a single cell. Recent work in which fluorescence in situ hybridization has been used to look at structures formed during gene amplifications has shed much light on the early events of this process, dramatically changing our ideas about the mechanisms involved. It now seems clear that the first steps involve recombination. Trask and Hamlin (1989) published the original study of amplification using the fluorescence in situ technique. Very early events were not studied, since these workers examined methotrexate-resistant populations of Chinese hamster cells derived by serial selection with increasing concentrations of drug for about 8 weeks. Nevertheless, very important new information was obtained. T h e amplified DHFR genes were chromosomal and very far apart, tens of megabases from one another. Furthermore, they were located on novel chromosome arms that appeared to be extensions of the same arm that carries the single DHFR gene in unselected cells. These authors favored recombination-based mechanisms such as sister chromatid exchange to account for their results. Our own in situ work has been focused on the CAD gene. In the original

96

GEORGE R. STARK

study using radioactive probes to examine Syrian hamster cells selected through several steps of increasing PALA concentration, the amplified CAD genes were always found in chromosomal arrays, usually as an expansion of the short arm of chromosome B9, which carries the normal single copy of CAD (Wahl el al., 1982). More recently, we used the fluorescence in situ method to look at structures formed early in the first step of CAD gene amplification (Smith et al., 1990).

B. UNEQUAL SISTERCHROMATID EXCHANGE Metaphase spreads were examined when colonies representing new CAD amplification events had grown to about lo5 cells (Smith et ad., 1990). T h e amplified genes were contained in multiple copies of very large regions of DNA, each tens of megabases long (Figs. 1A and 1B). In most cases the extra DNA was linked to the end of the short arm of chromosome B9, which retained CAD at its normal site. Individual cells within single clones had quite different numbers of CAD genes (range 2-15). From these results we proposed that, in the initial event, all o r most of the short arm was transferred from one B9 chromosome to another (Fig. 2A). In subsequent cell cycles this initial duplication was proposed to expand rapidly by means of unequal but homologous sister chromatid exchanges (Fig. 2B). However, more recent work in which earlier events were examined has made it clear that a different mechanism-in which fusion of regions near the telomeres of sister chromatids is the first step-accounts for many of the structures observed (Smith et al., 1992). Nevertheless, it still remains possible that sister chromatid exchanges account for at least some of the events observed. As can be seen from Fig. 2, this mechanism makes two strong predictions. First, the selected gene (CAD in this case) will be spaced very regularly along a marker derived from the normal chromosome. The distance separating individual copies of the selected gene will be determined by the initial duplicative event (a whole chromosome arm in the case of Fig. 2). These predictions are consistent with the structures shown in Fig. 1 . The second strong prediction is that the units of amplification will be organized FIG. 1. Examples of B9pf chromosomes carrying amplified Syrian hamster CAD genes. (A, B) Single cells from two different primary PALA-resistant colonies of about lo5 cells each. (C) More condensed arrays, present in cells maintained in the initial concentration of PALA for about 50-60 more population doublings. (D) A highly condensed array, present in cell line B5-4, selected in steps of increasing PALA concentration and containing about 100 copies of the CAD gene. The entire B9p+ arm hybridizes with a CAD probe. [Reproduced with permission from Smith el al. ( I 990) and from Wahl et al. (1982).]

FIG.1

FIG.3

B

3

FIG.5

X

K

C

K

C

MAMMALIAN GENE AMPLIFICATION

97

FIG.2. A model for amplification involving unequal sister chromatid exchanges between peritelomeric and centromeric DNA. (A) Initial formation of chromatids with duplicated and deleted arms. (B) Expansion of the initial duplication in a subsequent cell cycle, after DNA replication, by homologous but unequal exchanges. C, selected genes; 9, telomeres; 0,centromeres. [Reproduced with permission from Smith el al. (1990).]

as direct repeats. This can be tested by using two probes, one for the selected gene and one for a marker sequence located far enough away to give a discrete spot on a metaphase chromosome. Two-color analysis can then reveal the relative orientations of the two markers. Such experiments have been done in another case (Toledo et al., 1992b) but not yet for the amplification of CAD in Syrian hamster cells. FIG.3. (A) Examples of dicentric Syrian hamster chromosomes with amplified CAD genes, 5-7 cell divisions after the initial event. T h e columns (left to right) show in situ hybridizations; G-banding (arrows point to B9q); and, for example, 2 only, C-banding (arrows point to centromeres). (B) A dicentric chromosome containing amplified CAD genes. present in a PALA-resistant Syrian hamster cell at the 105-cell stage. Note the regular pattern of G-negative regions interspersed with the CAD genes. FIG.5. (A) T h e uppermost chromosome has been derived from human chromosome 2 by centromeric fusion in PALA-resistant HTIOSO cells. A normal chromosome 2 can be seen below. T h e marker chromosome has two p arms with CAD (C) near the telomeres and the V k (K) near the centromere. (B) T h e proposed primary event, involving recombination through the centromeres of sister chromatids. T h e two centromeres are not identical. O n e has two “right” portions and the other, two “left” portions. It is important that the recombined centromere on the chromosome bearing CAD retains function.

98

GEORGE R. STARK

Windle and Wahl(l992) conclude that the sister chromatid exchange mechanism is unlikely per se, based on a calculation in which they assume that the initial duplication occurs with a probability typical for exchange within whole chromosomes. However, if this event takes place between atypical regions, such as those near telomeres and centromeres (Fig. 2), it is not easy to predict the rate. Axelrod et al. (1992) have developed a mathematical model that can account for the data of Smith et al. (1990) in terms of sister chromatid exchanges. As far as I know, there is no direct evidence for the sister chromatid exchange mechanism at present, but it seems a reasonable possibility that will surely be tested in future work.

FUSIONS A N D BRIDGE-BREAKAGEC. TELOMERIC FUSIONCYCLES The structures seen at the 105-cell stage of CAD gene amplification were very unstable, as judged by the different numbers of amplified genes present in individual cells of single clones (Fig. 1) and by the evolution of the ladder-like structures observed initially into more highly condensed arrays when the resistant colonies were grown in the original concentration of PALA (Fig. 1C and Smith et al., 1990). Therefore, it was clear that it was very important to observe new amplification events very early, if possible a few cell generations after they had occurred. Shaking mitotic resistant cells off the plastic surface of cultures treated with PALA did enable us to see very early amplified structures, against a low background of sensitive cells that d o not enter mitosis in the presence of PALA. The enrichment was about 10,000-fold (Smith et al., 1992). About one-third of the newly formed marker chromosomes carrying amplified CAD genes were dicentric and about half of these carried two B9 long arms (Fig. 3). These observations can be accounted for by recombination between the p telomeric regions of two B9 sister chromatids, which is likely to be an important primary event of amplification in this system. T h e dicentric chromosomes that result from chromatidic telomere fusions can then enter bridge-breakage-fusion cycles, which provide the means to increase the number of CAD genes per cell in successive generations by asymmetric distribution at each cell division (Fig. 4). This mechanism predicts that the amplified domains will be inverted with respect to one another, which has yet to be tested. In Chinese hamster cells the CAD gene, which maps to the long arm of chromosome 7 near the centromere, is amplified in ladder-like arrays.

MAMMALIAN GENE AMPLIFICATION

99

FIG.4. Two bridge-breakage-fusion cycles following the initial formation of a dicentric B9 chromosome. Note that in the mitotic cell at the top of (B), the dicentric chromatid will appear to be a pair of monocentric sister chromatids, whereas, after segregation without breakage [(B), bottom], a dicentric sister chromatid like the one in Fig. 3, part 2, will become apparent. C, CAD genes; *, the centromeres.

Very early events have not yet been studied but there is evidence that dicentric chromosomes are involved (E. Giulotto, unpublished observations). In the AMP deaminase amplification system studied by Toledo et al. (1992a,b), results obtained by two-color in situ hybridization with AMP deaminase and a coamplified probe provide strong experimental support for bridge-breakage-fusion cycles and are consistent with chromatidic telomere-telomere recombination. Both inverted repeating structures and dicentric chromosomes were observed (Toledo et al., 1992a; M. Debatisse, unpublished observation). Amplification of DHFR in Chinese hamster cells is being studied in two laboratories, with evidence for both chromosomal and extrachromosomal amplification (Trask and Hamlin, 1989; Windle et al., 1991). Both groups have observed dicentric chromosomes with amplified DHFR genes between the

100

GEORGE R. STARK

two centromeres and have mentioned the possible involvement of bridge-breakage-fusion cycles in the evolution of amplified domains. However, neither group has considered telomere fusion to be a possible mechanism for the primary step. I think that chromatidic telomere fusion will turn out to be a frequent mechanism of amplification. Clearly there is a need to examine the structures formed in several different systems as early as possible, ideally by using two widely spaced probes that lie on the same chromosome arm so that the relative orientations of the repeating units can be assigned. D. CENTROMERE RECOMBINATION

We have studied early events of CAD gene amplification in human cells, where amplification of the CAD gene (located at 2p21-22) can be compared with coamplification of an immunoglobulin v k locus that lies near the centromere on the p arm of the same chromosome (Zimmer et al., 1990). Experiments with these two probes have given strong evidence concerning the size and nature of the amplified region (R. Groves, K. A. Smith, M. B. Stark, and G. R. S., unpublished). Using the cell line HT1080, many PALA-resistant clones observed at the 106-cell stage had new marker chromosomes that probably arose by recombination between the centromeres of the two sister chromatids, giving two new chromosomes with either two p arms o r two q arms inverted about the respective centromeres (Fig. 5). This event is very different from the telomere fusions responsible for CAD gene amplification in Syrian hamster cells. However, some PALA-resistant HT1080 clones do have ladderlike structures similar to those shown in Fig. 1. I t will be important to study earlier events in these and other human cells, to follow the stability of the different structures with time, and to study the arrangement of amplified sequences in the ladder-like arrays with CAD and v k probes, detected using two colors. Nevertheless, it seems likely that at least two different primary events take place with roughly comparable probabilities in the amplification of human CAD genes. One of these, recombination through the centromeres of the sister chromatids, represents a novel mechanism of gene amplification. E. THECHROMOSOME BREAKAGE-ACENTRIC MODEL ELEMENT Wahl and colleagues consider this model to represent an important primary mechanism of gene amplification. Their arguments and evi-

MAMMALIAN GENE AMPLIFICATION

101

dence have been reviewed extensively (Wahl, 1989; Windle et al., 1991; Windle and Wahl, 1992). In the most recent review (Windle and Wahl, 1992), three different mechanisms for generating acentric elements are considered; all involve recombinations that take place within partially replicated DNA. Another model, considered only briefly by Windle and Wahl (1992), leads to the formation of a circular element that may o r may not include a centromere by recombination within a chromosome not engaged in DNA replication, and I briefly consider a related model below. A key aspect of the model of Windle and Wahl (1992) is that doublestrand breaks occur in stalled replication bubbles, followed by recombinations to generate new structures. The model predicts that acentric elements will be formed very early in amplification events. T h e only study of early events in which such elements have been observed is that of Windle et al. (1991) in which DHFR gene amplification in Chinese hamster cells was analyzed by in situ hybridization about eight to nine cell doublings after the initial events. Nine clones were examined. Three showed chromosomal amplification only, two extrachromosomal amplification only, and four a mixture of the two. This range of structures might be accounted for by the mechanism proposed if recombination of the acentric elements with centric chromosomes is very rapid, as proposed by these authors. However, the data seem equally consistent with other mechanisms; for example, an initial event such as telomere fusion that does not produce an acentric element directly, followed by secondary events, such as bridge-breakage-fusion cycles, that might. It will be very important to extend the analyses of very early events to see whether the observations of Windle et al. (1991) can also be seen in other amplification systems. Dicentric chromosomes have been observed in the DHFR-Chinese hamster cell system by both Trask and Hamlin (1989) and Windle et al. (1991). In the telomere fusion model, chromosome breakage is known to be a consequence of forming a dicentric chromosome in the initial event (McClintock, 1984), whereas in the chromosome breakage-acentric model, dicentrics are a secondary consequence of chromosome breakage. Why should chromosomes break at replication bubbles or anywhere else? Recently, Yin et al. (1992) proposed that failure of cells lacking wildtype p53 to arrest in PALA can lead to amplification through attempts to replicate DNA from deoxynucleosides triphosphate pools severely depleted in pyrimidines, leading eventually to broken chromosomes. This explanation can account for any stimulation of basal gene amplification by PALA but not for spontaneous CAD gene amplification, which is well known to occur in the absence of PALA (Kempe et al., 1976).

102

GEORGE R. STARK

An additional requirement of the Windle and Wahl model seems at odds with reasonable expectations. T h e common observation that the chromosomally amplified domains are very often found in extensions of the same chromosome arms that carry the single-copy genes in wild-type cells (Trask and Hamlin, 1989; Smith et al., 1990; Toledo et al., 1992a,b) requires that the acentric elements reintegrate back into an unaltered normal locus with high probability, which seems intuitively unlikely. Furthermore, this requirement is difficult to reconcile with the observation of Smith et al. (1990) and Toledo et al. (1992a,b) that an unaltered normal chromosome is usually found in the same cell with the altered homolog that carries the amplified structure. F. OVERVIEW All the mechanisms considered above depend on unequal distribution of genes between daughter cells following recombinational events. It necessarily follows that the very same mechanisms that account for amplification also lead to loss of heterozygosity-see Kimmel and Axelrod (1990) for a mathematical model of this situation. Loss of heterozygosity might also proceed via mechanisms that do not lead to concurrent amplification, for example, by deletion of a chromosomal region as an acentric element followed by loss of this element by exclusion from the nuclei of both daughter cells. Nevertheless, it seems likely that gene amplification and gene loss will often go hand-in-hand in vivo as well as in vitro. Therefore, progress in achieving a fundamental understanding of the mechanisms and regulation of gene amplification will also be important to fully understand how genes are lost. I believe that two primary mechanisms of amplification are strongly supported by the current data. Although observed only for CAD amplification in human cells so far, the inverted structure of the marker chromosome revealed with CAD and V, probes is very clear (Fig. 5 ) and centromere-centromere (C-C) recombination is a straightforward mechanism that can account for it. A mechanism involving recombination between the telomeric regions of sister chromatids (T-T events) is strongly supported by data on CAD amplification in Syrian hamster cells (Smith el al., 1992) and AMP deaminase amplification in Chinese hamster cells (Toledo et al., 1992a,b) and is at least consistent with the observation of dicentric chromosomes in other systems. Clearly more information is desirable here, but the case seems very strong even now. Both the C-C and the T-T mechanisms are proposed to begin with regionspecific recombinations between the highly specialized and conserved sequences found in centromeres (Grady et al., 1992) or near telomeres.

MAMMALIAN GENE AMPLIFICATION

103

Can recombinations also take place between centromeres and telomeres (C-T events) to yield unequal sister chromatid exchanges? The evidence is not strong at present but the possibility must be considered to be at least reasonable, especially since long sequences closely related to the TTAGGG repeats of mammalian telomeres are found not only in the large subtelomeric regions of virtually all chromosomes but also near many centromeres (Meyne et al., 1990). Two types of C-T amplification events can be envisioned, depending on whether the initial recombination is within or between sister chromatids (Figs. 2 and 6 and Smith et al., 1990). Note that the T-T (Fig. 4) and interchromatid C-T events (Fig. 2) generate unstable chromosomal intermediates; in contrast, the marker chromosome generated by the C-C event in human CAD amplification is stable on prolonged culture in a constant concentration of PALA (R. Groves, K. A. Smith, M. B. Stark, and G. R. S., unpublished). What are the most important experiments to d o next? It is crucial to investigate many more cases of primary amplification by studying very early events involving different genes in cells of different species. Our current conclusions rest on relatively few data. In future work it will be essential to use t w o widely spaced probes labeled differently so that the relative orientations of the amplified domains are clear, as done already by Toledo et al. (1992b). The status of the chromosome breakageacentric element model is currently uncertain because data from only one system are available (Windle et al., 1991), because these data can be interpreted in more than one way, and because somewhat different data have been obtained elsewhere from the same system (Trask and Hamlin, 1989; Hamlin, 1992). I n mouse cells, the formation of extrachro-

-+

+

FIG. 6. Generation of an acentric circle of DNA by an intrachromatid telomere-cencentromere. [Reproducedwith tromere recombination.C, selected gene; a,telomere; 0, permission from Smith el al. (1990).]

104

GEORGE R. STARK

mosomal acentric elements has been observed by many workers, but there is no information yet on very early events in such cells to help us decide whether chromosomal or extrachromosomal amplified DNA is formed in the primary events. Another important aspect is the nature of the sequences that are joined together in the primary recombinations that trigger amplification. Are subtelomeric, or TTAGGG sequences, or both present in the T-T regions of newly formed dicentric chromosomes? If so, are the sequences involved in the novel joints similar or different in independent events? Similar questions can be asked of C-C events. A different fundamental issue concerns whether amplification events that have been stimulated transiently or stably proceed by the same mechanisms that occur in unstimulated cells. T h e best way to answer this question is to view the amplified DNA of stimulated cells as soon as possible after the primary events. IV. Hypotheses Integrating Regulation of Amplification with the Chromatidic Telomere Fusion Model

In recent years, we have learned a great deal about the structure and function of telomeres (Blackburn, 1991). Vertebrate chromosomes are terminated by repeating units of the sequence 5' TTAGGG 3'. This terminal sequence is maintained by telomerase, an RNA enzyme. Telomeres bind specific proteins, different from the nucleosomes that occupy the bulk of chromosomal DNA (McKay and Cooke, 1992). Telomeres protect chromosome ends from recombination and probably help to organize chromatin by binding to specific nuclear structures. In somatic cells, telomeres are 10-100 kb long, depending on the species (longer in rodents, shorter in primates). Addition of TTAGGG repeat units by telomerase solves the problem that DNA polymerase cannot replicate linear chromosomes all the way to their ends. For this reason, in the absence of telomerase the telomeres become shorter in each cell cycle. In human somatic cells, telomeres have been observed to become shorter with increasing age of the subject (Hastie et al., 1990) or with increasing time in culture in vitro (Harley et al., 1990). Recent observations of Allsopp et al. (1992) strongly support the idea that telomere length is causally related to the aging of human somatic cells. Recently, Counter et al. (1992) measured both the telomere lengths and the telomerase activities of human cells in culture and found striking correlations. In normal or SV40-transformed senescent cells, telomeres became shorter by 60- 150 bp per generation. T h e normal

MAMMALIAN GENE AMPLIFICATION

105

cells arrested when the mean telomere length reached about 4.5 kb. When the average telomere length of the transformed cells reached about 1.5 kb, the cell populations entered crisis and eventually died. Telomerase was not detectable in any of these cells. Rarely, crisis populations yielded an immortal cell line that had telomerase activity and in which the telomere length became stable at about 1.5 kb. From the limited data available so far, one can postulate that stabilization of telomere length by telomerase is obligatory for immortalization and that normal senescent cells lack sufficient telomerase activity to prevent telomere shortening. Strikingly, Counter et al. (1992) also found a greatly increased incidence (up to 50-fold) of dicentric chromosomes in cells with short telomeres, including the immortal cells. It seems inevitable that when the average telomere is short some chromatid ends will lack telomeres entirely (Levy et al., 1992), causing them to become highly recombinogenic, with dramatic consequences for gene amplification as shown in Fig. 4. If a telomere-free end initiates an amplification sequence, the newly recombined region may lack TTAGGG sequences entirely but may retain the large subtelomeric region of repeated DNA, typically hundreds of kilobases long (Riethman et al., 1989), in an interstitial position within the dicentric chromosome. These regions would then become amplified along with the selected gene in successive bridge-breakage-fusion cycles (Fig. 4). Such interstitial heterochromatic regions would band poorly with Wright’s stain, possibly accounting for the regularly repeated G-negative regions often seen in newly amplified Syrian hamster DNA (Smith et al., 1990; see the dicentric chromosome of Fig. 3B for an example). T h e possibility that telomere-free ends of chromatids may initiate amplification sequences has important consequences for mechanisms and regulation of gene amplification. I now propose a specific model that integrates ideas about permissivity and immortality. These two properties are considered to be independent variables, and some examples of known combinations are presented in Table 111. The two main hypotheses are (a) that immortality requires active telomerase and (b) that permissivity requires loss of an apoptosis-G1 arrest program that is normally activated in response to broken chromosomes. As discussed above, p53 has been heavily implicated as a regulator of both permissivity and G1 arrest. p53 is responsive to damaged DNA and is required for cells to retain the ability to arrest in G1 after exposure to ionizing radiation (Kuerbitz et al., 1992; Kastan et al., 1992). T h e model that now follows is admittedly speculative, but hopefully will serve as a basis for future experiments. 1. In cells lacking telomerase, the probability of generating a

106

GEORGE R. STARK

EXAMPLES OF CELLSI N

WHICH

TABLE I l l PERMISSIVITY A N D IMMORTALITY ARECORRELATED

Permissive for amplification

+

-

Immortality (+) I . REF52 cells (Perry et al., 1992b) 2. REF52 cells containing T antigen 2. SV40 human embryonic kidney cells (Counter et al., 1992) or (Perry el al., 1992b) 3. REF52 cells containing EIA and human fibroblasts (Lucke-Huhle et al., 1987) ras (Perry el al., 1992b) 3. Normal stem cells? 1.

Most cell lines

No example known

Immortality (-) Normal senescent cells (Wright et al., 1990; Tlsty, 1990)

telomere-free chromatid end must increase with the number of cell generations, since this probability is an inverse function of the mean telomere length. There will be a distribution of lengths about the mean (Levy el al., 1992). 2. T h e telomere fusion mechanism of amplification is triggered by a telomere-free end, which is highly recombinogenic. In a cell without telomerase, a telomere-free end will eventually appear in one of two sister chromatids after a round of DNA replication has finished. After cell division and the next round of replication, homologous ends of both sister chromatids will lack telomeres, making it very likely that they will recombine to form a homologous dicentric chromosome, as shown in Fig. 2. 3. Bridge-breakage-fusion cycles readily generate broken chromosome ends from dicentric chromosomes. In a nonpermissive cell, these damaged DNA structures activate GI arrest and apoptosis, and the cell is eliminated. In a permissive cell, the broken ends do not initiate these processes, and the damaged DNA is tolerated, leading to many different chromosomal aberrations in successive cell generations. 4. T h e apoptosis-arrest program is regulated at least in part by tumor suppressor proteins such as p53 and perhaps pRb. In rat REF52 cells, loss of both p53 and pRb (for example, by binding to SV40 T antigen) is sufficient to inactivate the induction of the program in response to broken chromosomes. An alternative is to bind pRb only (as to the adenovirus E1A protein) in REF52 cells that contain an activated ras gene.

MAMMALIAN GENE AMPLIFICATION

107

In human o r mouse fibroblasts, loss of p53 alone is apparently enough to inactivate the apoptosis-arrest program (Yin et al., 1992; Livingstone et al., 1992). 5. A normal, senescent cell population arrests o r dies when the mean telomere length is reduced to the point that the probability of generating a dicentric chromosome is high at each cell division. This prediction seems testable. 6. An abnormal senescent cell strain in which the apoptosis-arrest program has been inactivated reaches crisis when the mean telomere length is much shorter than that in normal senescent cells. These cells do not die by apoptosis (testable) but rather because, as the number of telomere-free ends per cell increases, the level of DNA damage becomes too great. Of course, in the limit, cells cannot survive without telomeres. Examples may be human embryonic kidney cell strains into which SV40 T antigen has been introduced, as studied by Counter et al. (1992). 7. An immortal cell line that has telomerase but lacks the apoptosisarrest program can tolerate DNA damage. The telomeres will be short (see, for example, the SV40-transformed HEK line studied by Counter et al., 1992), so the probability of telomere-free ends is high (Levy et al., 1992) and thus so is the probability of telomere fusion and gene amplification. T h e high level of DNA damage that these cells tolerate will increase the probability that some will suffer lethal damage but, if the proportion of damaged cells is sufficiently small, the population as a whole can grow, albeit with a reduced plating efficiency. This aspect of the model leads to strong, testable predictions: the rate of amplification mediated by telomere fusion will be inversely proportional to the mean telomere length in cell lines. Telomerase should be an antiamplificator gene, and increasing its expression should decrease the rate of amplification if this increase leads to an increase in the mean telomere length. 8. An untransformed cell line such as REF52 would have both telomerase activity and an intact damage recognition system. It would not be permissive for amplification until this system was inactivated, for example, by SV40 T antigen. 9. Populations of permissive, immortal cells may contain individual cells with different mean telomere lengths, due to different activities of telomerase or different regulation of telomere length by other means. If amplification probability is inversely proportional to telomere length, cells with stably shorter telomeres would be amplificator cells and may be selected from the population, as observed by Giulotto et al. (1987). Amplificator genes may down-regulate telomerase activity (at any level), thus leading to shorter telomeres. Many of these predictions can be tested.

108

GEORGE R. STARK

V. Evolution of Amplified DNA Newly amplified chromosomal DNA is often highly unstable. This conclusion rests on several types of observations made in several different systems. (a) Amplified DNA contained in dicentric chromosomes will certainly be unstable due to its participation in bridge-breakage-fusion cycles (Smith et al., 1992; Toledo et al., 1992b). (b) T h e observations that individual cells within single new clones of lo5- lo6 drug-resistant cells have quite different numbers of amplified genes must reflect rapid change within the clonal population originally generated from one cell (Smith et al., 1990; Toledo et al., 1992a. ( c ) T h e ladders of widely spaced genes seen early in amplification processes are gradually replaced by more highly condensed structures when the cells are maintained in the original concentration of selective drug (Fig. 1C; Trask and Hamlin, 1989; Smith et al., 1990; Toledo et al., 1992a). ( d ) In striking contrast to the stability of highly amplified, highly condensed arrays of CAD genes observed when the Syrian hamster cells containing them are grown without selection, the low-copy chromosomal arrays formed initially are quite unstable, being lost completely within 1 or 2 months of growth without selection (Saito et al., 1989). Windle and Wahl (1992) have argued that the spacing between CAD genes in the highly condensed arrays observed by Wahl et al. (1982) is essentially the same as the spacing of the ladder-like arrays observed by Smith et al. (1990) and therefore that little or no evolution has taken place. Unfortunately, the calculation of Windle and Wahl (1992) is incorrect, as can be seen by inspection of the two examples shown in Fig. 1: A cell from line 30-2a, examined when the initial colony had grown to lo5 cells (Smith et al., 1990) has five copies of CAD in a B9p+ arm that is twice the length of the q arm, or 2.5 CAD genes per q arm equivalent (Fig. 1B). A cell from B5-4, a multistep mutant resistant to a high PALA concentration (Wahl et al., 1982), has 100 copies of CAD in a B9p+ arm that is 3 times the length of the q arm, o r 33 CAD genes per q arm equivalent, more than 10 times the number of CAD genes per unit length found in 30-2a cells (Fig. 1D). It is not yet clear whether generation of episomal DNA is a primary o r a secondary amplification event. Episomal amplified DNA appears very early in the process in more than one situation and the evolution of submicroscopic episomal structures to larger double minute chromosomes (Carroll et al., 1988; Pauletti et al., 1990) is an interesting phenomenon, well worth investigating further. We do not know whether secondary events are replication-driven, recombination-driven, or both. This too is an important area, worthy of careful study. The evolved

MAMMALIAN GENE AMPLIFICATION

109

amplified DNA present in cells that have been cultured under selective conditions for a long time can be arranged either as inverted repeats (Passananti et al., 1987; Hamlin, 1992) or as direct repeats (Hamlin, 1992). Hamlin (1992) has pointed out that the regulations of origins of DNA replication within a rearranged region that includes amplified DHFR genes is different from that in unrearranged DNA. In situ hybridization can be used either to follow the fate of newly amplified DNA as resistant cells are grown in a constant concentration of selective drug, so that there is no additional selective pressure above that imposed initially, o r to study the more highly amplified structures selected when the drug concentration is increased. Toledo et al. (1992b) have made the exciting discovery that the coamplified AMPD gene and a marker gene about 5 Mb away alternate in ladder-like inverted chromosomal repeats when condensed chromosomes are viewed in metaphase cells, but cluster into two separate domains in interphase nuclei. This finding implies that the different sequences go to different specific points on the nuclear envelope. Furthermore, such clusters of similar sequence can be lost all at once by extrusion from the nucleus, providing a mechanism by which several independent regions of amplified DNA within a single chromosome can be recombined into a more highly condensed array all at once (Fig. 7). It is important to compare the locations of amplified subdomains in condensed metaphase chromosomes and in interphase nuclei in several other situations to assess the generality of what has been observed so far in only one system. The secondary events that occur in cells cultured in vitro will almost certainly occur also in tumors, where the time between the initial amplification event in a single cell and analysis is inevitably very long. Recent work on the structure of the amplified N-myc DNA present in human neuroblastomas (Amler et al., 1992; Amler and Schwab, 1992) has led to the conclusion that the increase in N-myc copy number involves a multistep process, proceeding from large precursors to smaller multicopy amplicons. T h e N-myc genes are often present as head-to-tail tandem arrays in the tumor cells and one copy of the gene is present at its normal site, a finding not consistent with a mechanism involving excision and reintegration. It is a happy coincidence that the human N-myc ( 2 ~ 2 4 ) and CAD (2~21-22)genes are very close to one another, providing the opportunity to compare the amplified structures found in PALAselected human cells in culture with the structures found in neuroblastomas. For example, it is not obvious how the inverted chromosome shown in Fig. 5 could give rise to an array of directly repeated

110

GEORGE R. STARK

FIG.7. A model for the evolution of amplified DNA. (A) The amplified AMPD gene and a coamplified sequence 5 Mb distant are seen as inverted repeats in metaphase chromosomes. (B) In interphase cells, these two sequences are collected at different points on the nuclear envelope. Extrusion of one such region, accompanied by multiple recombination, leads to condensation of one set of amplified sequences and loss of the other set. [Adapted from Toledo et al. (1992b). Reproduced with permission.]

units, suggesting that the highly amplified array found in neuroblastomas may be derived from a different precursor.

ACKNOWLEDGMENTS This article was made possible by the contributions of the students, fellows, technical staff, and visitors who have allowed my laboratory to study gene amplification for many years. I also thank colleagues from other laboratories for a long series of stimulating conversations and harsh critiques. I am grateful to Clare Middlemiss, who typed her way through the minefield of my handwriting without exploding, as usual.

MAMMALIAN GENE AMPLIFICATION

111

REFERENCES Aladjem, M. I., and Lavi, S. (1992). Mutat. Res. 276, 339-344. Allsopp, R. C., Vaziri, H., Patterson, C., Goldstein, S., Younglai, E. V., Futcher, A. B., Greider, C. W., and Harley, C. B. ( 1992).Proc. Natl. Acad. Sci. U.S.A. 89, 10 1 14- 10 1 18. Amler, L. C., and Schwab, M. (1992). Oncogene 7, 807-809. Amler, L. C., Shibasaki, Y., Savelyeva, L., and Schwab, M. (1992).Mutat. Res. 276,291-297. Axelrod, D. E., Baggerly, K. A., and Kimmel, M. (1992). Genetics, submitted. Blackburn, E. H. (1991). Nature (London) 350, 569-573. Carroll, S. M., DeRose, M. L., Gaudray, P., Moore, C. M., Needham-Vandevanter, D. R., Von Hoff. D. D., and Wahl, G. M. (1988). Mol. Cell. B i d . 8, 1525-1533. Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B., and Bacchetti, S. (1992). E M B O J . 11, 1921-1929. Crawford, D., Zbinden, I., Amstad, P., and Cerutti, P. (1988). Oncogene 3, 27-32. Denis, N., Kitzis, A., Kruh, J.. Dautry, F., and Corcos, D. (1991). Oncogene 6, 1453-1457. Evan, G. I., Wyllie, A. H., Gilbert, C. S., Littlewood, T. D., Land, H., Brooks, M., Waters, C. M., Penn, L. Z., and Hancock, D. C. (1992). Cell (Cambridge, Muss.) 69, 119-128. Farmer, G., Bargonetti, J., Zhu, H., Friedman, P., Prywes, R., and Prives, C. (1992).Nature (London) 358, 83-86. Fornace, A. J., Jr., Alamo, I., Jr., and Hollander, M. C. (1988). Proc. Null. Acad. Sci. U.S.A. 85,8800-8804. Fornace, A. J., Jr., Nebert, D. W., Hollander, M. C., Luethy, J. D., Papathanasiou, M., Fargnoli, J., and Holbrook, N. J. (1989). Mol. Cell. Biol. 9, 4196-4203. Giulotto, E., Bertoni, L., Attolini, C., Rainaldi, G., and Anglana, M. (1991).Proc. Natl. Acud. Sci. U.S.A. 88, 3484-3488. Giulotto, E., Knights, C., and Stark, G. R. (1987). Cell ( C a m b d g e , Mass.) 48, 837-845. Grady, D. L., Ratliff, R. L., Robinson, D. L.,McCanlies, E. C., Meyne, J., and Moyzis. R. K. (1992). Proc. Natl. Acad. Scz. U.S.A. 89, 1695-1699. Hamlin, J. L. (1992). Mutat. Res. 276, 179-187. Harley, C. B., Futcher, A. B., and Greider, C. W. (1990). Nature (London) 345, 458-460. Hastie, N. D., Dempster, M., Dunlop, M. G., Thompson, A. M., Green, D. K., a n d Allshire, R. C. (1990). Nature (London) 346, 866-868. Kastan, M. B., Onyekwere, O., Sidransky, D., Vogelstein, B., and Craig, R. W. (1991). Cancer Res. 51, 6304-631 1. Kastan, M. B., Zhan, Q., El-Deiry, W. S., Carrier, F., Jacks, T., Walsh, W. V., Plunkett, B. S., Vogelstein, B., and Fornace, A. J., Jr. (1992). Cell (Cambridge, Mass.), 71, 587-597. Kempe, T. D., Swyryd, E. A., Bruist, M., and Stark, G. R. (1976). Cell (Cambridge, Mass.) 9, 541-550. Kimmel, M.,and Axelrod, D. E. (1990). Genetics 125, 633-644. Kopnin, B. P., Sokova, 0. I., a n d Demidova, N. S. (1992). Mutat. Res. 276, 163-177. Kuerbitz, S. J., Plunkett, B. S., Walsh, W. V., and Kastan, M. B. (1992).Proc. Natl. Acud. Sci. U.S.A. 89, 7491-7495. Lane, D. P. (1992). Nature (London) 358, 15-16. Lavi, S. (1981). Proc. Null. Acad. Sci. U.S.A. 78,6144-6148. Levy, M. Z., Allsopp, R. C., Futcher, A. B., Greider, C. W., and Harley, C. B. (1992).J.Mol. Biol. 225, 95 1-960. Livingstone, L. R., White, A., Sprouse, J., Livanos, E., Jacks, T., and Tlsty, T. D. (1992).Cell (Cambndge, Mms.) 70, 923-935. Liicke, Huhle, C. (1991). Mol. Toxicol. 2, 237-253. Liicke-Huhle, C., and Herrlich, P. (1991). 1nt.J. Cancer 47,461-465.

112

GEORGE R. STARK

Lucke-Huhle, C., Hinrichs, S., and Speit, G. (1987). Carcinogenesis 8, 1801-1806. Mai, S., Lucke-Huhle, C., Karina, B., Rahmsdorf, H. J., Stein, B., Ponta, H., and Herrlich, P. (1990). In “UCLA Symposium on Molecular and Cellular Biology, lonizing Radiation Damage to DNA: Molecular Aspects” (S. Wallace and R. Painter, eds.), pp. 319-331. Wiley/Liss, Philadelphia. McClintock, B. (1984). Science 226, 792-801. McKay, S. J., and Cooke, H. (1992). Nucleic Acids Res. 20, 1387-1391. McMillan, T. J.. Kalebic, T., Stark, G. R.,and Hart, 1. R. (1990). Eur.J. Cancer 26,565-567. Meyne, J., Baker, R. J., Hobart, H. H., Hsu, T. C., Ryder, 0. A., Ward, 0. G . , Wiley, J. E.. Wurster-Hill, D. H., Yates, T. L., and Moyzis, R. K. (1990). Chromosoma 99, 3-10. Passananti, C., Davies. B., Ford, M.. and Fried, M. (1987). E M B O J . 6, 1697-1703. Pauletti, G . , Lai, E., and Attardi, G. (1990). Proc. Null. Acad. Sci. U.S.A. 87, 2955-2959. Perry, M. E., Rolfe, M., McIntyre, P., Commane. M.. and Stark, G . R. (1992a). Mutat. ReA. 276, 189-197. Perry, M. E., Commane, M., and Stark, G. R.(1992b).Proc. Natl. Acad. Sci. U.S.A. 89,811281 16. Rice, G . C., Ling, V.,and Schimke, R. T. (1987).Proc. Natl. Acad. Sci. U.S.A. 84,9261-9264. Riethman, H. C., Moyzis, R. K., Meyne, J., Burke, D. T.,and Olson. M. V. (1989).Proc. Natl. Acud. Sci. U.S.A. 86, 6240-6244. Rolfe, M., Knights, C., and Stark, G . R. (1988). In “Cancer Cells 6/Eukaryotic DNA Replication” (T. Kelly and B. Stillman, eds), pp. 325-328. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Rosenberger, R. F., Gounaris, E., and Kolettas, E. (1991).J . Theor. B i d . 148, 383-392. Saito, I., Groves, R., Giulotto, E.,Rolfe, M., and Stark, G. R.(1989).Mol. Cell. B i d . 9,24452452. Schimke, R. T. (1988).J . B i d . Chem. 263, 5989-5992. Schwab. M. (1990). CHC Crit. Rev. Oncogen. 2, 35-51. Schwab, M., and Arnler, L. (1990). Genes Chromosomes Cancer 1, 81-93. Shaw, P., Bovey, R., Tardy, S., Sahli, R., Sordat, B., and Costa, J. (1992).Proc. Nad. Acad. Sci. U.S.A. 89, 4495-4499. Shay, J. W., Pereira-Smith, 0. M., and Wright, W. E. (1991). Exp. Cell Res. 196, 33-39. Smith, K. A., Gorman, P. A., Stark, M. B., Groves, R. P., and Stark, G . R. (1990). Cell (Cambridge, Mass.) 63, 1219-1227. Smith, K. A., Stark, M. B., Gorman, P. A., and Stark, G. R. (1992). Proc. Natl. Acad. Sci. U.S.A. 89, 5427-543 1. Stark, G . R., Debatisse, M., Giulotto, E., and Wahl. G. M. (1989). Cell (Cambridge, Mass.) 57, 901-908. Stark, G . R., Debatisse, M., Wahl, G. M., and Glover, D. M.(1990). In “Gene Rearrangement” (B. D. Harnes and D. M. Glover, eds.), pp. 99-149. 1RL Press. UK. Stark, G. R., and Wahl, G. M. (1984). Annu. Rev. Biochem. 53, 447-491. Sullivan, N. F., and Willis, A. E. (1989). Oncogene 4, 1497-1502. Tlsty, T. D. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 3132-3136. T h y , T. D., White, A., and Sanchez, J. (1992). Science 25, 1425-1427. Toledo, F., Smith, K. A., Buttin, G., and Debatisse, M. (1992a). Mufat. Res. 276, 261-273. Toledo, F., Le Roscouet, D., Buttin, G., and Debatisse, M. (1992b). EMBO J. 11, 26652673. Trask, B. J., and Hamlin, J. L. (1989). Gene Deu. 3, 1913-1925. Wahl, G. M. (1989). Cancer Res. 49, 1333-1340. Wahl. G. M., Vitto, L., Padgett, R. A., and Stark, G . R. (1982). Mol. Cell. B i d . 2, 308-319.

MAMMALIAN GENE AMPLIFICATION

113

Windle, B., Draper, B. W., Yin, Y., O’Gorman. S., and Wahl, G. M. (1991). CeneDeu. 5,160174. Windle, B. E., and Wahl, G. M. (1992). Mutut. Res. 276, 199-224. Wright, J. A., Smith, H. S., Watt, F. M., Hancock, M. C., Hudson, D. K., and Stark, G. R. (1990). Proc. Nutl. Acad. Scz. U.S.A. 87, 1791-1795. Yin, Y., Tainsky, M. A., Bischoff, F. Z., Strong, L., and Wahl, G. M. (1992). Cell (Cambridge, Mass.), 70, 937-948. Yonish-Rouach, E., Resnitzky, D., Lotem, J., Sachs, L., Kimchi. A., and Oren, M. (1991). Nature (London) 352, 345-347. Zimmer, F-J., Hameister, H., Schek, H., and Zachau, H. G. (1990).E M B O J . 9, 1535-1542.

This Page Intentionally Left Blank

UNRAVELING THE FUNCTION OF THE RETINOBLASTOMA GENE Eldad Zacksenhaus,* Rod Bremner,* Zhe Jiang,* R. Montgomery Gill,*.* Michelle Muncaster,*.* Mary Sopta,* Robert A. Phillips,*,* and Brenda L. Gallie*.t.*B§ ‘Division of Immunology and Cancer Research, and +Departmentof Ophthalmology, the Hospital for Sick Children Research Institute. Toronto, Ontario, Canada M5G 1X8, and *Departments of Molecular and Medical Genetics and SOphthalmology, University of Toronto, Toronto, Ontario, Canada M5G 1x8

I. Introduction 11. Genetics of Retinoblastoma 111. The RBI Gene and Protein Product 1V. Binding of Viral Oncoproteins to p l lom’ V. Mechanisms of RBI Gene Regulation A. Tissue Distribution of RBI mRNA Transcripts B. Regulation of RB1 Expression C. Localization of p l IORB’ in the Nucleus D. Modulation of p l loRB’ Phosphorylation Vl. lnteraction of pllORB’ with Cellular Proteins A. p l IORB’-Associated Cellular Proteins B. Interaction of p l lORB’ with Cellular Transcription Factors C. lnteraction of p l 1Om’ with c-myc D. Positive and Negative Regulation of RCBP/Spl by p l loRB’ E. ATF2 Binding and Transcription Activation by p l loRB’ VII. Functions of p l lom’ A. pllORB’ Inhibition of Cell Cycle Progression B. pllOR”’ in Inhibition of Cell Proliferation by TGF-P, C. Effect of pllORB’ on DNA Replication D. Suppression of Tumorigenicity by RB1 VIII. Tissue-Specific Susceptibility to RBI Dysfunction IX. Addendum References

I. Introduction

Retinoblastoma (RB) is a malignant eye tumor affecting 0.005% of young children worldwide. The disease is correlated with inactivation of both alleles of a gene, RBI, which is located on chromosome 13 band q 14.2. RBI has evolved as a paradigm for suppressor oncogenes, the loss of which renders cells incapable of negatively regulating proliferation

115 ADVANCES IN CANCER RESEARCH, VOL. 61

Copyright 0 1993 by Academic Press. Inc. All rights of reproduction in any form reserved.

116

ELDAD ZACKSENHAUS

et al.

and ultimately leads to neoplastic transformation. RBI dysfunction predisposes primarily to retinoblastoma, but also to osteosarcoma and soft tissue sarcoma, and is associated with progression of many other tumors. T h e RBI gene is widely expressed, encoding a nuclear phosphoprotein, p 1loRB’, whose state of phosphorylation and activity oscillate during the cell cycle. p l loRB’ is a member of a family of proteins that includes p107 and probably p130 and p300, originally defined as adenovirus E1A-associated proteins. Recent studies suggest that p l loRB’ is a promiscuous transcription factor that regulates cell proliferation by modulating the activity of other transcriptional activators such as E2F/ DRTFl, Spl and ATFP. This article reviews the progress made in understanding the molecular biology of the retinoblastoma gene since its isolation 6 years ago. Many key questions about the biology of RBI remained unanswered. The highly tissue-specific induction of cancer by RBI mutation is unexplained, but the answer will lie in the detailed understanding of the role of p l loRB’. Additional transcriptional activators to which p l loRR’ binds await discovery. Which tissue and developmentally specific transcription factors interact with pllORB’? What is the context in which p l loRB’ exerts its regulatory effect on transcription? Which target genes are under p l loRB’ regulation? II. Genetics of Retinoblastoma

Retinoblastoma is a childhood ocular tumor that can be either heritable or nonheritable. Nonheritable cases are always unilateral and unifocal. Only 6% of retinoblastoma cases are familial; the majority of heritable cases arise as new germline mutations and develop multifocal and bilateral tumors. In 1971, Knudson proposed that two independent mutations (M, and M,) are rate-limiting events in the development of retinoblastoma. In nonheritable cases, the two mutations are somatic, and the likelihood of both occurring in the same retinal cell is so small that only a single focus of malignant tumor forms. In familial cases, M is transmitted through the germline and M, is somatic; the frequency of cells with M, is high enough that individuals with an RBI germline mutation get an average of three to four separate tumors. In 70% of all retinoblastomas, the second mutation, M,, results from loss of heterozygosity (LOH); the remainder (30%) result from small deletions and mutations different from the M I mutation (Dunn et al., 1989). Since 1/20,000 live births will develop retinoblastoma, half of these infants have germline RBI mutations, and each infant with a germline RBI mutation has a 95% chance of developing retinoblastoma, the rela-

FUNCTION OF THE RETINOBLASTOMA GENE

117

tive risk (RR) for retinoblastoma imposed by a germline RBI mutation approaches 40,000. T h e RR for these children to develop osteosarcoma, usually in the second decade, is approximately 500 with no detectable increase in RR for hematopoeitic malignancies. Radiotherapy, frequently used in treatment of retinoblastoma tumors, increases the RR for sarcomas within the radiation field to 3000 for patients with germline RBI mutations (Draper et al., 1986; Roarty et al., 1988). T h e cellular origin of retinoblastoma is believed to be a precursor of the neuroepithelial cells of the developing retina. The term retinoblastoma was coined because of the resemblance of tumor cells to undifferentiated retinoblasts: small, round cells have large basophilic nuclei and scanty cytoplasm. Similar but benign retinal tumors, termed retinoma, may arise from retinal cells at a later stage of differentiation than the precursors of retinoblastoma, or may be precursor tumors with mutations of both RBI alleles, which have not acquired sufficient subsequent mutations for full malignancy (Gallie et al., 1982). Untreated retinoblastoma is usually fatal. The tumor cells can spread into the brain through the optic nerve or disseminate through the blood stream to grow in the bone marrow. Enucleation (surgical removal of the eye) performed prior to metastases results in high rate of cure; however, patients with germline mutations are still predisposed to osteosarcomas, soft tissue sarcomas, and other tumors, later in life. T h e first clue to identifying the gene for retinoblastoma came from the observation of the frequent occurrence of retinoblastoma in patients with a deletion of one chromosome 13. Detailed karyotypic analysis mapped the retinoblastoma susceptibility gene to 13q14 (Yunis and Ramsay, 1978). After the molecular cloning of RBI, the gene was finely mapped to 13q14.2 between the markers ESD/HTR2 and D13S25/ D13S31 (Bowcock et al., 1991), and to chromosome 14 in mouse (Stone et al., 1989) and 15 in rat (Szpirer et al., 1991). In addition to mutations in the RBI gene, retinoblastoma tumor cells exhibit several other chromosomal changes. T h e marker iso(6p) provides two extra copies of the short arm of chromosome 6 in 60% of tumors and is specific to retinoblastoma (Squire et al., 1984). Less specific is the appearance of an extra copy of chromosome 1 or lq (Squire et al., 1985). A few tumors have genomic amplification of N-myc, but the role of N-myc expression in retinoblastoma remains unresolved (Squire et al., 1986). These chromosomal changes indicate that although inactivation of both RBI alleles is the limiting factor in the initiation of retinoblastoma (Knudson, 1971), other mutations may be required to contribute proliferative advantage in the conversion of a normal retinoblast to a malignant tumor.

118

ELDAD ZACKSENHAUS

et al.

111. The RB7 Gene and Protein Product

Th e rationale behind the successful isolation of RBI was based on the association of interstitial deletions in chromosome 13q14 with retinoblastoma. A DNA probe, H3-8, isolated from a chromosome 13-specific library and mapped to 13q14 (Lalande et al., 1984), detected deletions in 3 of 37 independent retinoblastomas (Dryja et al., 1986). Characterization of the genomic region surrounding H3-8 led to the identification of a conserved DNA segment that was subsequently used to isolate the candidate RBI cDNA clone (Friend et al., 1986). The authenticity of this clone was confirmed by identifying internal mutations in retinoblastoma tumors (Dunn et al., 1988). Analysis o f RBI in normal and tumor cells of retinoblastoma patients confirmed Knudson’s hypothesis (Knudson, 1971). Thus, all bilaterally affected patients have one defective RBI allele in their somatic cells. T h e RBI gene is normal in somatic tissues of most patients with unifocal retinoblastoma tumors, but 15% of these patients have one mutant allele (Dunn et al., 1989). All RB tumor cells exhibit abnormalities in both alleles of RBI and the tumors of bilateral patients that show LOH are homozygous for the germline mutation (Dunn et al., 1989). Inactivation of RBI in tumors of non-RB patients has been documented in small cell lung carcinoma (SCLC) (Harbour el al., 1988), bladder carcinoma (Horowitz et al., 1989). breast carcinoma (T’Ang et al., 1988; Lee et al., 1988), prostate carcinoma (Bookstein et al., 1990), and primary leukemia (Furukawa et al., 1991), indicating that RBI inactivation contributes to the malignant phenotype of other tumors, in addition to retinoblastoma and osteosarcoma. Most of the internal mutational events in RBI lead to premature termination of translation, predicted to result in truncated, unstable proteins (Dunn et al., 1989). Almost all mutations affect either of two conserved regions in pllORB’, termed A and B (Fig. l), required for binding viral oncoproteins (Whyte el al., 1988; Hu et al., 1990; DeCaprio et al., 1988; Dyson et al., 1989) (see Section IV). Mutations have been identified in the promoter region that affect the putative recognition sequences for the Sp 1 and ATF transcription factors; these mutations were detected in families with heritable retinoblastoma, suggesting that these sequences are required for RBI promoter activity (Sakai et al., 1991). RBI homologous DNA sequences have been detected in many vertebrates such as mice, cattle, cats, sharks, and chickens (Lee et al., 1987a). Th e degree of conservation of RBI between human and mouse is remarkably high: the promoter regions, coding region, and 3‘ untrans-

FUNCTION OF THE RETINOBLASTOMA GENE

119

FIG. 1. Structure of the RBI gene, mRNA, and p l loRB’.(A) The RBI gene is approximately 180 kb in length and contains 27 exons. The promoter is highly GC rich, constitutes a CpC island, and lacks a typical TATA box. The minimal promoter contains conserved and functionally important Spl and ATF sites and a putative E2F binding site. (B) The RBI mRNA is 4.7 kb with a 2.7-kb coding sequence and a 2-kb 3’ untranslated region containing AUUUA elements, known to determine RNA stability. (C) The p l lorn’ protein contains several cdc2 family of kinases recognition motifs; the serine and threonine residues that have been demonstrated to be targets for the cdc2 family of kinases are boxed. Two consecutive domains in pllORB’, A and B (amino acids 393-572 and 646772). are critical for binding to oncoproteins SV40 large T,adenovirus ElA, and papillomavirus E7. The A and B domains as well as the C-terminal are necessary for interaction with E2E Exon 25 contains a nuclear localization signal.

lated RNA are 80, 88.7, and 77.3% homologous, respectively (Bernards et al., 1989; E. Zacksenhaus, unpublished data). Analysis of the primary sequence of the human RBI cDNA and the predicted amino acid sequence has revealed little homology to other known genes (Lee et al., 1987a). T h e RBI gene contains 27 exons and spans 180 kb (McGee et al., 1989) (Fig. 1). T h e message (4.7 kb) contains a relatively short 5’ untranslated sequence followed by a coding region of 2.7 kb, which encodes 928 amino acids in human and 921 in mouse (Lee et d.,1987a; Bernards et al., 1989). T h e promoter region of RBI is highly rich in GC residues and

120

ELDAD ZACKSENHAUS

et al.

constitutes a CpG island (Ford et al., 1990) (Fig. 1). There are no typical TATA o r CAAT boxes and multiple transcription initiation sites have been observed downstream of a conserved Spl site (M. Gill, unpublished data; E. Zacksenhaus, unpublished data). T h e homology between the human and the mouse promoters extends into a region that includes several potential transcription factor binding sites such as Spl, ATF, and E2IDRTFl. As mentioned above, the detection of mutations in the Spl and ATF sites in familial retinoblastoma (Sakai et al., 1991) supports the conclusion that these sequences are important regulators of RBI transcription. The protein product of RBI (pllORE’) has a calculated molecular mass of 105 kDa. T h e relatively hypophosphorylated form migrates through a denaturing polyacrylamide gel as a 110-kDa band, and as a series of bands from 112-120 kDa when hyperphosphorylated (Lee et al., 1987b). p l loRE’ exhibits an intrinsic DNA-binding activity (Lee et al., 1987b), which is localized between amino acids 612 and 928 (Wang et al., 1989). There are mild hydrophobic and hydrophylic regions in the N- and C-terminals of the protein, respectively. Exons 1 and 23 are rich in proline residues, characteristic of some nuclear oncogenes. Two pairs of putative zinc fingers [H or C]-X,-,-[H o r C] have been noted in exons 17,18 and 20,21 in the human gene; the histidine residue on the exon 18 motif is not conserved in the mouse gene (Bernards et al., 1989).

IV. Binding of Viral Oncoproteins to p l loRS7 A major contribution to our understanding of the role of p l loRE’ in tumorigenicity was the discovery that the transforming proteins of several DNA tumor viruses interact with p l loRBJ.These include adenovirus ElA (Whyte et al., 1988), SV40 and polyoma large T antigen (DeCaprio et al., 1988), and papillomavirus E7 (Dyson et al., 1989). pl10 interacts with these proteins through two noncontiguous regions, termed A and B, between amino acids 393-572 and 646-772 (Fig. 1) (Hu et al., 1990). These regions of p l loRE’ are commonly affected in tumors by mutations and deletions, leading to presumably nonfunctional or truncated, unstable, proteins. Binding of the viral oncoproteins to p l loRB’requires amino acids 105-1 14 of SV40 large T (Ewen et al., 1989), 37-60 and 121-139 of ElA (Egan et al., 1988; Whyte et al., 1989), and 18-37 of E7 (Dyson et al., 1989). These domains share considerable homology, including a motif of LXCXE. This motif is also found in two p l 1ORB’-binding proteins (Defeo-Jones et al., 1991). RBI is a member of a family of related proteins including p107, and

FUNCTION OF THE RETINOBLASTOMA GENE

121

perhaps p130 and p300, all of which bind adenovirus E1A (Whyte et al., 1989). Antibodies specific to human p l loRB’immunoprecipitate, in addition to p l loRB’, several other polypeptides including p107 and p300 (Hu et al., 1991). T h e p107 gene has recently been isolated and found to share sequence homology with pllORE’; it maps to 20q11.2, a region linked to myelodysplastic syndrome (Ewen et al., 1991). Subsequent studies examined the effect on cell growth of large T and E1A mutants that cannot bind p l loRE’. Amino acids 105-1 14 of large T are unnecessary for immortalization of primary cultures of mouse and rat cells (Chen and Paucha, 1990) and the tumorigenicity in nude mice of the resulting transformants is as high as that of cells transformed with wild-type large T (Thompson et al., 1990). The effect of 105-1 14 deletion is critical only for inducing focus formation and growth in soft agar. Thus, binding of large T to p l loRB’is not essential for immortalization of cells in vitro or tumorigenicity in nude mice; however, it is needed for anchorage-independent growth, which may be of importance in transforming cells in vivo and for tumorigenicity in immunocompetent hosts. Similar experiments with E1A mutant alleles have shown that deletions which affect binding to p l loRB’ also affect transformation. However, E1A mutants that bind pllORB’ but fail to bind another E1Aassociated protein, p300, also are incapable of transforming cells, indicating that the association with p l loRB’ is necessary but not sufficient for cellular transformation (Howe et al., 1990). T h e induction of DNA synthesis in quiescent epithelial BRK cells necessitates the binding of ElA to either p l loRB’ or to p300 (Howe et al., 1990). Several ElA mutants that fail to bind p l loRB’ can still induce a cdc2-like kinase activity, which in turn phosphorylates p l loRB’ (Wang et al., 1991). Although such E1A mutants can stimulate cells to enter S phase and replicate their DNA, the cells are unable to proliferate. These observations are compatible with the idea that phosphorylation of pl10 is necessary for the progression of cells into S phase but that direct binding of E 1A to p l loRB’ is required for continuous proliferation. T h e different effects on cell growth of large T and E l A mutant alleles, which do not bind p l loRB’,probably reflect their different interactions with cellular proteins.

V. Mechanisms of RB7 Gene Regulation A. TISSUE DISTRIBUTION OF RBI mRNA TRANSCRIPTS RBI is widely expressed in adult tissues (Bernards et al., 1989). T h e mouse RBZ transcript of 4.6 kb is detectable at 9.5 days of gestation and

122

ELDAD ZACKSENHAUS

et al.

reaches a peak at Days 12.5-14.5 (Bernards et al., 1989). Maximum expression at Day 12.5 is observed in liver, brain, and spinal column. In contrast, relatively low expression is found in adult liver, with the highest level of RBI RNA observed in the lung, thymus, and spleen. T h e major transcript of 4.6 kb is present in all tested tissues. Testis contains a short RNA of 2.8 kb that hybridizes with the RBI RNA observed in the lung, thymus, and spleen. The major transcript of 4.6kb is present in all tested tissues. Testis contains a short RNA of 2.8kb that hybridizes with the RBI probe (Bernards et al., 1989).T h e formation of this transcript at Day 23 coincides with the appearance of spermatids in the testes. It is unknown whether this poly(A)-selected RNA is a degradation product, a product of differential splicing of the RBI gene, or a related crossreacting transcript.

B.

REGULATION OF

RB1 EXPRESSION

Mitogenic stimulation of resting T lymphocytes leads to a two- to fourfold increase in the abundance of RBI RNA with a concomitant increase in the amount of RBI protein and the appearance of hyperphosphorylated p l loREJ(Furukawa et al., 1990).Nuclear run-on assays and measurements of RNA stability in the presence of actinomycin- D indicate that the observed elevation in RBI gene expression is due to an increase in stability of the message rather than in the rate of transcription (Furukawa et al., 1990).Regulation of RBI by RNA stability is consistent with the presence of many AUUUA elements in the 3‘ untranslated portion of RBI mRNA; such elements are known to control RNA stability (Shaw and Kamen, 1986). Induction of RBI gene expression following a differentiation signal has been reported in mouse erythroleukemia cells (Richon et al., 1992), S2 myoblasts (Coppola et al., 1990),and embryonal carcinoma P19 cells (M. McBurney and R. Slack, personal communication). Studies in our laboratory, using the RBI promoter region linked to a reporter CAT gene, show that RBI promoter activity is stimulated in retinoic acidinduced P19 cells, indicating that RBI gene expression is under transcriptional regulation during cellular differentiation (Hamel et al., 1992; E. Zacksenhaus, unpublished data). Analysis of expression of mutant RBI transcripts in normal and tumor cells suggested that the gene is subject to transcriptional autorepression (Dunn et al., 1989),and constituted the first evidence that p l loRE’ might be a transcription factor. Indeed, in transient transfection experiments, p l loREJwas found to suppress the RBI promoter (Hamel et al., 1992; R. M. Gill, unpublished data). Other oncogenes including c-myc

FUNCTION OF THE RETINOBLASTOMA GENE

123

(Penn et al., 1990), neu (Zhao and Hung, 1992), re1 (Hannink and Temin, 1990), c-fos (Konig et al., 1989), and p53 (Grinsberg et al., 1991) also exhibit negative autorepression. Autoregulation of these genes suggests that the levels of these proteins must be maintained within critical limits. This mechanism may ensure normal levels of the corresponding proteins in the event that one allele becomes inactivated. C. LOCALIZATION OF p l loRBJIN

THE

NUCLEUS

Immunostaining revealed that p l loRBJis localized exclusively to the nucleus (Lee et al., 1987b). T h e translocation of large proteins through the nuclear membrane depends on the presence of short basic motifs termed nuclear localization signals (NLSs). To date, an NLS for p 1l o m z has not been reported. We have recently corrected the nucleotide sequence of exon 25 of the mouse RBI gene; the amino acid sequence at positions 2566-2569 (KRN KKLR) is conserved in human and resembles a newly defined class of bipartite NLS (Dingwall and Laskey, 1991; Robbins et al., 1991). Mutations introduced into this putative NLS have confirmed that this sequence is essential for targeting p l loRBJto the nucleus (E. Zacksenhaus, unpublished data). T h e strength of p l loRBJassociation with the nucleus depends on the state of phosphorylation. Hypophosphorylated p l loRBJis firmly attached in the nucleus both in vivo and in vitro and resists low salt extraction (Mittnacht and Weinberg, 1991; Templeton, 1992). In contrast, the hyperphosphorylated form readily leaks out of the nucleus under these conditions. T h e phosphorylation-dependent attachment of p 110 R B J to the nucleus probably reflects differential affinities to the nuclear target(s).

,,

D. MODULATIONOF p l lWBJ PHOSPHORYLATION In cycling cells, the phosphorylation pattern of p l loRBJ oscillates throughout the cell cycle: the hypophosphorylated form is present from late M to late G , and the hyperphosphorylated form from late G , to late M (Buchkovich et al., 1989; Chen et al., 1989; DeCaprio et al., 1989). In fact, there is a gradual increase in the level of phosphorylation of pl10 starting during mid G,, and increasing during S phase to peak in G,/M (DeCaprio et al., 1992). Large T (Ludlow et al., 1989) and the cellular transcription factor E2F (Chellappan et al., 1991) both interact with only hypophosphorylated p l 10RBJ,indicating that this form is the active molecule. Thus, activity of p l loRBzvaries during the cell cycle as the state of phosphorylation changes.

124

ELDAD ZACKSENHAUS

et al.

Several observations suggest that the phosphorylation of p l loRB' " ~ o~r a related kinase late in G, is effected by the cell cycle ~ 3 4 kinase ( ~ 3 3 "(Tsai ~ ~ et ) al., 1991; Devoto et al., 1992). First, 10 phosphotryptic peptides in p l loRR' have been identified by two-dimensional gels; similar peptides have been found following in vitro labeling of insect-produced pllORA' with p34rdc2 (Lin et al., 1991). Second, pllORB' was ' ~ et al., 1992) and p58qcfZd shown to physically associate with ~ 3 4 ' ~(Hu (Williamset al., 1992).Third, several consensus sites for phosphorylation by ~ 3 4 " kinase ~ " ~ have been identified in p l loRE', some of which have been confirmed (Lees et al., 1991) (Fig. 1). plloRB' mutant alleles that do not bind viral oncoproteins are also not phosphorylated in vivo (Hu et al., 1990; Huang et al., 1990). One possible explanation for this observation is that phosphorylation occurs when p l lWB' is complexed to other cellular factors. Several mutations outside the A and B domains d o not affect binding to viral oncoproteins but d o inhibit phosphorylation (Hamel et al., 1990), perhaps by altering the conformation of pllORB', rendering it inaccessible to the kinase. For example, pllWB' with single amino acid changes in exon 23 still becomes phosphorylated, but fails to show the usual shift in apparent molecular weight (see Section I), suggesting that these mutations alter conformation of the protein. Several studies have indicated that induction of cell differentiation is accompanied by dephosphorylation of the p l loRB' protein (Chen et al., 1989; Akiyama and Toyoshima, 1990; Mihara et al., 1989; Richon et al., 1992). Coincident with the HMBA-induced differentiation of murine erythroleukemia cells is prolongation of G, and an increase in the total and the hypophosphorylated fraction of p l loRB' (Richon et al., 1992). However, it is still not clear whether the accumulation of dephosphorylated pl10RR' is a result or a cause of differentiation. VI. Interaction of p l loRB7with Cellular Proteins

A. p l ~ORBI-ASSOCIATED CELLULAR PROTEINS The discovery that p 1loRB' interacts with viral oncoproteins stimulated the search for cellular factors that bind p l loRB'. Understanding the function of the cellular proteins that interact with p l loRB' will undoubtedly provide important clues about the function of the RBI gene. Several novel proteins have been identified by virtue of their binding to p l loRB'. At least eight different proteins specifically bound to a fusion protein of the C-terminal portion of p l loRBJ,including the large T

FUNCTION OF THE RETINOBLASTOMA GENE

125

binding domains, linked to a bacterial protein, glutathione S-transferase (GST) (Kaelin et al., 1991). Using a purified, truncated retinoblastoma protein, Lee’s group identified a single binding protein of 46,000 Dal under a different set of conditions and with a different cell type (HeLa cells) (Huang et al., 1991). Two novel genes encoding pl10 REz-bindingproteins were isolated by screening an expression library with a RBI protein probe (Defeo-Jones et al., 1991). Several of the p l 10RE’-binding proteins are known transcription factors. Below, we describe the association of p l lWB’ with E2FIDRTF1, myc, ATF2 and Spl/RCBP. These data indicate that retinoblastoma protein exerts its effect on cell growth by binding to, and modulating the activity of, transcriptional activators. B. INTERACTION OF pl10R”’ WITH CELLULAR TRANSCRIPTION FACTORS Expression of the adenovirus E2 gene requires a cellular transcription factor, E2F, which binds to TTTCGCGC sequences in the E2 promoter (Kovesdi et al., 1986). Mutations introduced into the E2F binding site decrease transcription 1O-fold, demonstrating that E2F is a positive regulator. Normally E2F is found in heteromeric complexes with other cellular proteins, and in uninfected cells does not promote transcription of the E2 promoter. Upon infection, the adenovirus E1A oncoprotein dissociates the normal complexes to release E2F, which then activates transcription of both the E2 promoter and other cellular genes (Bagchi et al., 1990). An example of a cellular target for activation by E2F is the proto-oncogene c-myc (Hiebert et al., 1989). The c-my promoter contains an E2F binding site and is susceptible to E 1A-dependent transactivation; mutagenesis of the E2F element abolishes the transactivation. During differentiation, p l loRB’ has been found to interact with the differentiation-regulated transcription factor, DRTF 1 (La Thangue et al., 1990). DRTFl and E2F bind the same motif and have similar molecular masses, 50 kDa (Partridge and La Thangue, 1991) and 54 kDa (Bagchi et al., 1990), respectively. T h e exact relationship between DRTFl and E2F is unclear. When an oligonucleotide probe containing an E2F element is mixed with cellular extracts and analyzed on nondenaturing polyacrylamide gels, three shifted bands are observed, each indicative of a distinct DNA-protein complex (Shirodkar et al., 1992; Devoto el al., 1992). T h e fastest migrating band contains DNA-E2F; the slowest contains DNA~ ~ p107. , The intermediate migrating complex E2F, cyclin A, ~ 3 3 “and contains p l 1WE’ and E2F (Chellappan et al., 1991). Importantly, only

126

ELDAD ZACKSENHAUS et

al.

hypophosphorylated p l l P f is found in the E2F-pl lWBf complex. T h e E2F-pl lWBf complex includes an additional, yet unidentified, factor and requires the C-terminal of p l lWBf (Hiebert et al., 1992; Qin et al., 1992). This is in contrast to oncoprotein binding, which depends only on the A and B domains (Fig. 1). T h e levels of the E2F complexes vary during cell proliferation: the DNA-E2F-p1 loRBfcomplex is most abundant during G, and S, whereas the DNA-E2F-pl07-cyclin A - ~ 3 3 "complex ~~ appears at the onset of S phase. Both complexes disappear at G, with a concomitant increase in the level of free E2F (Shirodkar et al., 1992). These data suggest that the p l 10RBf-E2F and p107-E2F complexes may have distinct functions during the cell cycle. A direct prediction from the aforementioned studies was that pl10 RB I would repress the activity of promoters regulated by E2F. This hypothesis has been tested by cotransfecting plasmids expressing p 110 and promoters linked to reporter genes (Hamel et al., 1992; Hiebert et al., 1992; Zamanian and La Thangue, 1992). Hamel et al. (1992) observed repression of the c-my promoter, the adenovirus early promoter, and the RBI promoter; Hiebert et al. (1992) made similar observations with the adenovirus E2 promoters. Mutations introduced into the E2F binding sites of these promoters reduced transcriptional activity and abolished repression, except for the RBI promoter, where the role of the E2F binding site is unclear. T h e autorepression of the RBI promoter by p l lWBf may be effected through other regulatory elements such as Spl o r ATF (see below). When binding sites for DRTFl are added to a heterologous promoter, they function as activating sequences in F9 EC stem cells and Saos-2 cells (Zamanian and La Thangue, 1992). Coexpression of pl lWBf represses the transcriptional activity of DRTFl ; adenovirus ElA prevents this transcriptional repression by p l loRBf. These results are consistent with a model in which plloRBf represses transcription by sequestering a transcription factor (Fig. 2a). Recently, cDNA clones encoding a p l 10RBf-binding protein with properties of E2F have been isolated (Helin et al., 1992; Kaelin et al., 1992). These clones encode a protein of a calculated molecular mass of 60 kDa, which binds p l l P f both in vitro and in vivo. The interaction between the putative E2F and p l lWBf is dissociated by viral oncoproteins. T h e putative E2F binds specifically to the E2F recognition sequence. When cotransfected with adenovirus E2 promoter, the cloned gene induces a 10-fold activation that depends on an intact E2F binding site.

FUNCTION OF THE RETINOBLASTOMA GENE

127

FIG.2. Models for pllORBJ as a transcription factor. Assembly of the transcription initiation complex requires TFIID, a multisubunit complex composed of the TATA binding protein (TBP) and TBP-associated factors (TAF) (Puge and Tjian, 1992; Greenblatt, 1991). Gene-specific transcription activators (TF) stimulate the assembly of the transcription complex on a nearby promoter. RBI may exert a positive or negative effect on the transcription apparatus. Suppression of gene expression by p l lorn1 may be accomplished by sequestering either T F (a), or TAF (b), or other mediators of transcription activation. Activation of gene expression may occur by binding of p l lorn1 to T F (c) or by sequestering repressors of T F (d) or TBP.

C. INTERACTION OF p l loRB’WITH c-myc Using a GST-myc fusion protein Rustgi et al. (1991) have shown that the N-terminals of both c-myc and N-myc bind p l 10RB1.Mapping studies in our laboratory have shown that there are multiple, independent contacts between c-my and p 1 loRBI. One of these is made via the B domain in p l loRBI, and another through a C-terminal region. This is the first

128

ELDAD ZACKSENHAUS

et al.

example of an interaction involving pllORR’ in which an intact A/B domain is not essential. The identification of multiple, independent binding domains is also novel (R. Bremner, unpublished data). One can speculate that p l lWB’ uses these domains to negatively regulate several growth pathways, whereas c-myc has evolved complementary domains to regulate positively the same pathways. We note that, in contrast to serum stimulation which leads to activation of m y , induction of DNA synthesis in quiescent cells by adenovirus is not associated with c-myc activation (Liu et al., 1985). Thus, ElA and c-my may act at a similar stage in G,, and both may d o so, in part, by removing p l loRB’ from transcription activators.

D. POSITIVE AND NEGATIVE REGULATION OF RCBP/Spl BY pllORfl’ The promoter of the c-fos proto-oncogene, and consequently AP-1 activity, has been reported to be a target for p l l W B f suppression in transient transfection experiments in mouse 3T3 cells (Robbins et al., 1990). T h e cis-acting retinoblastoma control element (RCE) includes the sequence CCCGCGCGCCACCCCTCTGGCGCCACCGTG (core element underlined), and mapped between positions -102 and -71 in the c-fos promoter. A similar element may mediate pllORB’ activation of the promoters of TGF-P,, c-my, and c-fos in mink lung epithelial cells and human lung adenocarcinoma cells, and suppression of these promoters in 3T3 mouse fibroblasts and mouse embryo fibroblasts (Kim et al., 1991).T h e RCE element is a variant of the Spl recognit ion sequence

(Faisst and Meyer, 1992). Kim et al. have demonstrated that Spl can bind the RCE element and that p l lWB’ can activate the Spl-dependent promoter of insulin-like growth factor 11. Cotransfection of p l 1WB’ with a GAL4-Spl fusion protein activates promoters containing a GAL4 binding site. p l lWB’ may activate S p l either by direct binding to Spl or by removing a repressor of Spl (Figs. 2a and 2b). We note, however, that no direct binding between p l lWB’ and Spl has been established (Kim et al., 1991).

FUNCTION OF THE RETINOBLASTOMA GENE

129

E. ATF2 BINDING AND TRANSCRIPTION ACTIVATION BY pl1ORBJ A recent report indicates that p l loRB’ activates the TGF-P, promoter in CCL64 mink lung epithelial cells through an ATFS element (Kim et al., 1992). A promoter containing a GAL4 binding site is activated when cotransfected with GAL4-ATF2 fusion protein and p l loRBI. Importantly, a GST-RBI fusion protein binds, either directly or indirectly, to ATF2, but not ATF1 o r ATFS, in nuclear extracts of HeLa cells. These observations point to a way that RBI may control the cell cycle: activation of the TGF-P family of genes that have a negative effect on cell proliferation (see Section VII,B and Fig. 2c).

VII. Functions of pl loRB7 A. p l loRB1INHIBITION OF CELLCYCLE PROGRESSION Several checkpoints have been defined in dividing cells where decisions are made on whether to proceed to the next step in the cell cycle. One such restriction point occurs late in G I and is analogous to START in yeast. T h e restriction point is defined as the moment in GI after which cells are committed to enter S phase and mitosis. Prior to that point in G I , the removal of growth factors o r nutrients leads to withdrawal of cells from the cell cycle into quiescence, or Go (Pardee, 1990) (Fig. 3). Regulation of the G , / S traverse by pllORB’ is suggested from the inhibitory effects on cell proliferation of TGF-PI (see Section VII,B) and of microinjected RB protein. A bacterially produced, purified, truncated form of p 11ORB’ containing the C-terminal portion of the protein (p56 induced cell cycle arrest when microinjected into cells anytime from early to late G , (Goodrich et al., 1991). After this restriction point, micro~ ~no’ effect on the progression of cells into S injection of ~ 5 6 had phase. This restriction point coincides with the period when p l loRBI is hypophosphorylated, from late M to late G I . The involvement of pl1oRB’ in regulation of the G,/G, transition has been suggested from the correlation between the ability of viral oncoproteins to bind p l loRB’ and to induce quiescent cells to proliferate. T h e mechanisms that control this transition in normal cells are illdefined. It is possible that the G,/G, transition is accompanied by the relocation of phosphate groups on p l loRBI,resulting in partial inactivation, but with no detectable change in overall level of phosphorylation, o r that only p l loRB’ in complexes is a target for phosphorylation.

130

ELDAD ZACKSENHAUS

et al.

FIG.3. pl10RB’ and the cell cycle. During cell growth, p l loRB’ is regulated by a cycle of phosphorylation and dephosphorylation that is controlled by a cdc2-like kinase (p33cdQ). Near the GI/S transition pl10R”’ binds to the oncoproteins such as SV40 large T and EIA (om)and transcription factors such as E2F (TF), and is considered to be the active form of p l IORB’. Thus, p l IORB’ modulates the activity of TF, which in turn affect cell proliferation and/or DNA replication genes, most of which have yet to be identified. There is evidence that pllORB’ and the related protein p107 bind to the TF, E2F, at different stages of the cell cycle. TGF-PI may inhibit cell proliferation by down-regulating p33cdQ. resulting in the excess of the hypophosphorylated p l IORB’ evident in quiescent and differentiating cells. pllORB’ appears to be active within a “window” in the cell cycle, between late M and the end of GI (stippled arrow), by which time a decision to escape from the division cycle into Go, or to proceed with DNA replication, must be made. Inactivation of p l IORB’ by phosphorylation may define this GI/S restriction point. pllORB‘ may contribute to maintainance of Go by entrapping transcription factors essential for exit from Go in complexes that include a yet undefined factor(s) (X). In response to mitogens, X may dissociate from the complex, permitting the transcription of genes required for the Go to GI transition. RB, pl10RB’; TF, transcription factor; onc, oncoproteins; solid circles, phosphate groups.

Alternatively, as depicted in Fig. 3, p l loRBf may bind transcription factors essential for exit from Go, in complexes that include a yet undefined factor(s) (X). In response to mitogens, X dissociates from the complex, permitting the transcription of genes required for the Go to G, transition.

B. p l loRB’ IN INHIBITIONOF CELLPROLIFERATION BY TGF-P, As discussed above, p l 1WB’ appears to induce the transcription of TGF-P genes. There is evidence that TGF-P, may in turn activate p110 by modulating its state of phosphorylation. TGF-P, inhibits the proliferation of MvlLu mink lung epithelial cells and MK mouse

FUNCTION OF THE RETINOBLASTOMA GENE

131

keratinocytes late in G I (Moses et al., 1990). One of the hallmarks of inhibition of these cells by TGF-PI is the down-regulation of c-myc transcription (Coffey et al., 1988). Several observations implicate pllO as the transducer of TGF-PI repression of c-myc. First, the oncoproteins E7, ElA, and large T can alleviate the inhibition of c-myc by TGF-P, (Pietenpol et al., 1990). Mutants of E1A and T antigen that cannot block repression of c-myc by TGF-P Seccannot bind p 11WE’ ond, TGF-PI prevents the phosphorylation of p l loRB’ late in G, (Laiho et al., 1990), presumably by inhibiting the kinase that phosphorylates p l loRB1.Thus, the inhibitory effect of TGF-P, on cells late in G, coincides with the time when p l 10RB’ is hyperphosphorylated. Third, antisense oligonucleotides directed against either TGF-P, o r RBI augment the number of detected hematopoeitic progenitors (Hatzfeld et al., 1991); furthermore, the effect of both antisense oligonucleotides is not additive, suggesting that TGF-PI and p l lWB’ operate through the same pathway. These studies are compatible with a model in which TGF-P, affects cell growth through inhibition of the kinase that phosphorylates p l loRB1(see Fig. 3). T h e hypophosphorylated, active pllO then down-regulates the expression of c-myc, and other genes, and thereby arrests cell growth. Other studies, however, indicate that TGF-PI can repress the transcription of c-myc independent of functional p l loRB’. Thus, TGF-PI induces down-regulation of c-myc expression in DU 145 human prostate carcinoma cells that contain a mutated, nonfunctional RBI (Zentella et al., 1991). Transient repression experiments with c-myc promoter constructs linked to a reporter gene have identified a common TGF-PI control element (TCE) with the sequence GCGTGGGGGA upstream of c-myc P1 promoter, which is responsible for down-regulation by TGF-P and p l loRB’ in human foreskin keratinocytes (Pietenpol et al., 1991). In retinoic acid-induced, differentiated mouse P19 embryonal carcinoma cells, however, p l loRB’appears to regulate c-myc through the E2F binding element in the P2 promoter (Hamel et al., 1992), illustrating that multiple pathways for p 1lWB’-dependent repression of c-myc expression may exist in different cell types. C. EFFECTOF p l loRBJON DNA REPLICATION The mechanism by which pllWB’ controls the G,/S transition is unclear and may involve direct binding to DNA replication factors, o r negative regulation of their transcription. The expression of many proteins and auxilliary factors required for DNA replication is transiently elevated just prior to S phase (Pardee, 1990; Challberg and Kelly, 1989),

TABLE I

RBI RECONSTITUTION SUMMARY Reference

Cell line

In vitro growth

pl1W'characteristics

Tumorigenicity

~~

Huang et al., 1988

WERI-Rb27 retinoblastoma Saos-2 osteosarcoma

Mass population slower growth Colonies slower growth Plating efficiency reduced

MW110-116 Phosphorylated

Subcutaneous No tumors Not tested

Sumegi et al., 1990 XU et al., 1991

WERI-Rb27

Not tested

MWl10- 116 Phosphorylated MW 110-1 16

WERI-Rb27

Not tested

MW 110-1 16

Bookstein et al., 1990

DU 145 prostate carcinoma

Growth rate unchanged

MW 110-116 Phosphorylated

Takahashi et al., 1991

HTB9 bladder carcinoma

Slower growth in 3% cbs Reducedplating efficiency

MW 110-116

Madreperia et al., 1991

WERI-Rb27

Not tested

Not tested

w

N c13

Subcutaneous No tumors Intraocular tumors of reduced size p l 1WI-positive Subcutaneous small tumors p l lwl-negative Subcutaneous tumors of reduced sue pllP'-positive Reduced number of intraocular tumors 5% of cells in tumors p l 1WBI-positive

Muncaster et al., 1992

WERI-Rbl retinoblastoma

Growth rate unchanged Platingefficiency reduced

Y-79 retinoblastoma

Growth rate unchanged Plating efficiency not tested

MDA-468-S4 breast carcinoma

Growth rate unchanged Plating efficiency unchanged

Templeton et al., 1991

Saos-2

Variable reduction in growth rate Induction of a senescent phenotype

Qin et al., 1992

Saos-2

Suppressed colony formation Increased cell size (indicative of cell cycle arrest)

MW 110-116 Binds to EIA MW 110-1 I6 Binds to E1A

Intraocular tumors p l lW’-positive

MW 110-116 Phsophorylated Binds to ElA Cell cycle regulation of phosphorylation Not tested

Not tested

MW 110 Not phosphorylated Binds to large T antigen

Not tested

lntraocular tumors p l IWB’-positive

Not tested

134

ELDAD ZACKSENHAUS

et al.

a time that coincides with the phosphorylation and presumed inactivation of plloRBz. plloRB’ may inhibit transcription of these genes by sequestering transcription factors required for their expression. Several genes involved in DNA replication, such as dihydrofolate reductase (DHFR) (Mudryj et al., 1990),thymidylate synthetase (Joliff et al., 1991), and DNA polymerase-a (Pearson et al., 1991)contain putative E2F binding sites in their promoters and are candidates for repression by pl loRB’. The E2F binding motif in the DHFR promoter is functional (Mudryj et al., 1990), but there are no data about the importance of the putative elements in the other genes. pl1oRB’ may also affect DNA replication by direct physical association with replication factors. This type of involvement of plloRB1 in DNA replication was initially suggested by the interaction with SV40 large T, which plays a central role in both cellular transformation and initiation of viral DNA replication (Challberg and Kelly, 1989). Another suppressor oncogene, p53, does bind large T and can suppress SV40 DNA replication (Braithwaiteet al., 1987).Plasmids containing the SV40 origin of replication can replicate well in retinoblastoma lines but less well in RBI +-reconstituted cells (Uzvolgyi et al., 1991). Moreover, overexpression of large T in the RBI+-reconstituted cells leads to an increase in plasmid replication, indicating that the variation in the RBI and RBI cells is due to the antagonistic effect of pl1oRB’ on large T. In herpes virus-infected cells, pl1oRB’ and p53 are relocated to the same nuclear sites as other known DNA replication proteins, including singlestranded binding protein SSB (RF-A), PCNA, and HSV-1 major DNA binding protein 1CP8 (Wilcock and Lane, 1991). Finally, the finding that p l lVB’ binds transcription factors is also compatible with a possible role as a regulator of DNA replication, as it is known that transcription factors can affect initiation of DNA replication (Bennett-Cook and Hassell, 1991). +

OF TUMORICENICITY BY RBI D. SUPPRESSION

One of the criteria for a tumor suppressor gene is the ability to suppress one or more aspects of the neoplastic phenotype. For example, the introduction of p53 into p53-deficient tumor lines arrests cell growth late in G , (Michalovitz et al., 1990; Diller et al., 1990). However, similar experiments with RBI- lines have yielded variable results depending on the cell lines. As summarized in Table I, introduction of wild-type pl10 into most RBI- cells had little effect on growth characteristics in vitro. An exception is the osteogenic sarcoma line Saos-2, which ceases to proliferate in response to transfected RBI (Qin et al., 1992). Several

FUNCTION OF THE RETINOBLASTOMA GENE

135

investigators have successfully transferred a functional RBI gene into retinoblastoma lines (Huang at al., 1988; Sumegi et al., 1990; Xu et al., 1991), a prostate carcinoma line (Bookstein et al., 1990), and a breast carcinoma line (Muncaster et al., 1992) and obtained stably reconstituted lines. The RBI-reconstituted cell lines retained different capacities to form tumors in subcutaneous or intraocular locations (Table I). These variable results are compatible with the idea that the extent of the effect of p l l o R B I on the neoplastic phenotype is relatively weak, compared to p53, and may vary from one tumor line to another depending on the presence or absence of additional mutated oncogenes. The prevention of initiation of cancer by p l lWBJ would appear to occur at a very specific stage of development in very specific tissues.

VIII. Tissue-Specific Susceptibility to RB7 Dysfunction The tissue-specific phenotype associated with RBI loss presents two puzzles. First, inactivation of RBI is implicated in the etiology of leukemia and breast and prostate carcinomas, yet retinoblastoma patients with germline RBI mutations are not predisposed to these malignancies. It is possible that RBI dysfunction may not reduce the onset time of tumors requiring six or seven tumorigenic events sufficiently to be easily determined in the life span of retinoblastoma patients. Second, as RBI is widely expressed in all adult tissues examined, one would expect it to be implicated in many types of neoplasia. The alternatives presented below can be generalized to apply to other widely expressed genes that are implicated in specific types of cancers, including ras, fos, my, and p53. The tissue specificity of susceptibility to RBI inactivation may simply reflect alternate biochemical functions of p l loRBJ in different tissues. As noted in this review, it has already been documented that plloRB’ can exert both positive and negative effects on gene expression depending on the target gene and tissue. These variable effects may be mediated by the array of transcription factors and repressors available for interaction with p l lWBz in different tissues (Faisst and Meyer, 1992). Retinoblasts, and to a lesser extent osteoblasts, may be more susceptible to loss of RBI than other cells. Perhaps most tissues contain additional “back-up” mechanisms that avoid growth deregulation in the absence of functional RBI. Redundancy in regulatory circuits is not uncommon. For example, in yeast, the transition through START is controlled by three G, cyclins, (CLN1,-2, and -3) (Nasmyth, 1990). In response to pheromones, the level of expression of all CLN genes drops and cells stop proliferating and differentiate into gametes capable of

136

ELDAD ZACKSENHAUS

et al.

conjugation. T h e concerted down-regulation of all CLN genes is essential and the persistent expression of any of them abrogates cell differentiation. The effect of pheromones on one CLN gene (CLN2) was found to be mediated through FAR1, which acts as a repressor of CLN2 gene transcription (Chang and Herskowitz, 1990). Mutations in FAR1 result in unregulated CLN2 and loss of cellular response to pheromones. Thus, this system sets an example for redundancy in the transcriptional regulation of molecules affecting cell proliferation, which may not be as well developed in retinoblasts as in other cells. Conversely, complete loss of RBI may be deleterious to normal cells, with the exception of retinoblasts. Two examples of such biological phenomena can be discussed. First, induction of c-myc expression in some cells can have multiple effects, depending on the presence or absence of additional factors. In the presence of growth factors, cells are induced to proliferate. However, in the absence of such factors, overexpression of cmyc results in programmed cell death (apoptosis) (Evan et al., 1992). Similarly, overexpression of wild-type p53 in several cell lines was shown to result in apoptosis (Yonish-Rouach et al., 1991). Second, introduction of activated ras alone into REF52 fibroblasts leads to growth arrest. However, in collaboration with c-myc, E 1A, or dominant-negative alleles of p53, ras can transform REF52 cells, giving rise to highly malignant derivatives (Hirakawa and Ruley, 1988; Hicks et al., 1991). By analogy, homozygous inactivation of RBI may promote cell death in otherwise normal cells, but not in retinoblasts, which instead fail to differentiate terminally. However, in cells already containing activated oncogenes or deleted tumor suppressor genes, RBI dysfunction may contribute to the further development of neoplastic transformation. Indeed, mutations in RBI have been identified in a variety of tumors, consistent with a role in tumor progression rather than initiation in those tissues.

IX. Addendum Following the submission of this review, three publications described the effects of RBI disruption in the mouse (Lee et al. (1992);Jacks et al. (1992); and Clarks et al., 1992). Heterozygous animals are not predisposed to retinoblastoma, either because of a smaller target (i.e., the number of retinoblasts in mice compared to human) o r because of species-specific susceptibility to RBI dysfunction. Instead, some animals developed pituitary tumors. Homozygous mutants die in utero before day 16 with abnormalities in the hematopoietic and central nervous systems, manifested as defective erythropoiesis and neuronal cell death. Thus, p l 1WB’ is not required for cellular proliferation and pattern

FUNCTION OF THE RETINOBLASTOMA GENE

137

formation, but appears essential for cells undergoing terminal differentiation. Since the animals die before day 16, the effect of RBI on terminal differentiation of other tissues could not be assessed. This problem may be approached by tissue-specific disruption of R B I . The cell death induced in homozygous mutant cells supports the model, described in the previous section, in which (with the exception of retinoblasts) RBI dysfunction in otherwise normal cells is irrelevant o r may lead to apoptosis, rather than cellular transformation, in response to differentiation signals.

REFERENCES Akiyama, T., and Toyoshima, K. (1990).Oncogene 5, 179-183. Bagchi, S., Raychaudhuri, P., and Nevins, J. R. (1990).Cell 62,(Cambridge, Mass.) 659-669. Bagchi, S.,Weinmann, R., and Raychaudhuri, P. (1991).Cell (Cambridge, Mass.) 65, 10631072. Bennett-Cook, E., and Hassell, J. A. (1991).E M B O J . 10,959-969. Bernards, R., Schackleford, G. M., Gerber, M. R., Horowitz, J. M., Friend, S. H., Schartl, M., Bogenmann, E., Rapaport, J. M., McGee, T., Dryja, T. P., and Weinberg, R. A. (1989).Proc. Natl. A d . Sci. U.S.A. 86, 6474-6478. Bookstein, R., Shew, J.-Y., Chen, P.-L., Scully, P., and Lee, W.-H. (1990).Science 247, 712715. Bowcock, A. M., Farrer, L. A., Hebert, J. M., Bale, A. E., and Cavalli-Sforza, L. (1991). Genomics 11, 517-529. Braithwaite, A. W., Sturzbecher, H. W., Addison, C., Palmer, C., Rudge, K., and Jenkins, J. R. (1987).Nature (London) 329,458-460. Buchkovich, K., Duffy, L. A,, and Harlow, E. (1989).Cell (Cambridge, Mass.) 58,671-717. Chang, F., and Herskowitz, I. (1990).Cell (Cambridge, Mass.) 63,999-101 I. Chellappan, S. P., Hiebert, S., Mudryl, M., Horowitz, J. M., and Nevins, J. R. (1991).Cell (Cambridge, Mass.) 65, 1053-1061. Chen, P. L., Scully, P., Shew, J. Y., Wang, J. Y., and Lee, W. H. (1989).CelZ(Cambridge,Mass.) 58, 1193-1 198. Chen, S . , and Paucha, E. (199O).J.Virol. 64,3350-3357. Clarke, A. R., Maandag, E. R., Van Roon, M., Van der Lugt, N. M. T., Van der Valk, M., Hooper, M. L., Berns, A., and Te Riele, H. (1992).Nature (London) 359, 328-330. Coffey, R. J.. Sipes, N. J., Bascome, C. C., Graves-Deal, R., Pennington, C. Y., Weissman, B. E., and Moses, H. L. (1988).Cancer Res. 48, 1596-1602. Coppola, J. A., Lewis, B. A,, and Cole, M. D. (1990).Oncogene 5, 1731-1733. DeCaprio, J. A., Furukawa, Y.,Ajchenbaum, F., Griffin, J. D., and Livingston, D. M. (1992). Proc. Natl. Acad. Sci. U.S.A. 89, 1795-1798. DeCaprio, J. A., Ludlow, J. W., Figge, J., Shew, J. Y.,Huang, C. M., Lee, W. H., Marsilio, E., Paucha, E. and Livingston, D. M. (1988).Cell (Cambridge, Mass.) 54, 275-83. DeCaprio, J. A., Ludlow, J. W., Lynch, D., Furukawa, Y., Griffin, J., Piwnica, W. H., Huang, C. M., and Livingston, D. M. (1989).Cell (Cambridge, Moss.)58, 1085-1095. Defeo-Jones, D., Huang, P. S., Jones, R. E., Haskell, K. M., Vuocolo, G. A., Hanobik, M. G . , Huber, H. E.,and Oliff, A. (1991).Nature (London) 352, 251-254. Devoto, S. H., Mudryj, M., Pines, J., Hunter, T., and Nevins, J. R. (1992).Cell (Cambridge, Mass.) 68, 167-176.

138

ELDAD ZACKSENHAUS et

al.

Diller, L., Kassel, J., Nelson, A. E., Magdalena, A. G., Litwak, G., Gebhardt, M., Bressac, B., Ozturk, M., Baker, S. J.. Vogelstein, B., and Friend, S. H. (1990). Mol. Cell. B i d . 10, 5772-578 1. Dingwall, C., and Laskey, R. A. (1991). Trends Biol. Sn'. 16,478-481. Draper, G. J., Sanders, B. M., and Kingston, J. E. (1986). Br.J Cancer 5 3 , 661-671. Dryja, T. P., Rapaport, J. M., Joyce, J. M., and Petersen, R. A. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 7391-7394. Dunn, J. M., Phillips, R. A., Becker, A. J., and Gallie, B. L. (1988). Science 241, 1797-1800. Dunn, J. M., Phillips, R. A,, Zhu, X., Becker, A. J., and Gallie, B. L. (1989).Mol. Cell. B i d . 9, 4594-4602. Dyson, N., Howley, P. M., Miinger, K., and Harlow, E. (1989). Science 242,934-937. Egan, C., Jelsma, T. N., Howe, J. A., Bayley, S. T., Ferguson, B., and Branton, P. E. (1988). Mol. Cell Biol. 8, 3955-3959. Evan, G. l., Wyllie, A. H., Gilbert, C. S., Littlewood, T. D., Land, H. M. B., Waters, C. M., Penn, L.Z., and Hancock, D. C. (1992). Cell (Cambndge, Mass.)69, 119-128. Ewen, M., Xing, Y., Lawrence, J. B., and Livingston, D. (1991). Cell (Cambridge, Mars.) 66, 1 155- 1164. Ewen, M. E., Ludlow, J. W., Marsilio, E., DeCaprio, J. A., Millikan, R. C., Cheng, S. H., Paucha, E., and Livingston, D. M. (1989). Cell (Cambridge, Mars.) 5 8 , 257-267. Faisst, S., and Meyer, S. (1992). Nucleic A& Res. 20, 3-26. Ford, G. M., Canton, M., Gallie, B. L., Phillips, R. A,, and Becker, A. J. (1990). Genomics 6, 284-292. Friend, S. H., Bernards, R., Rogelj, S., Weinberg, R. A., Rapaport, J. M., Albert, D. M. and Dryja, T. P. (1986). Nature (London) 323,643-646. Furukawa, Y., DeCaprio, J. A., Belvin, M., and Griffin, J. D. (1991).Oncogene 6, 1343-1346. Furukawa, Y., DeCaprio, J. A., Freedman, A., Kanakura, Y., Nakamura, M., Ernst, T. J., Livingston, D. M., and Griffin, J. D. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 27702774. Gallie, B. L., Ellsworth, R. M., Abramson, D. H., and Phillips, R. A. (1982). B7.J. Cancer45, 513-52 1. Goodrich, D. W., Wang, N. P., Qian, Y.-W., Lee, E. Y.-H.P., and Lee, W.-H. (1991). Cell (Cambridge, Mass.) 67, 293-302. Greenblatt, J. (1991). Cell 66, 1067-1070. Grinsberg, D., Mechta, F., Yaniv, M., and Oren, M. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 9979-9983. Hamel, P. A., Cohen, B. L., Sorce, L. M., Gallie, B. L., and Phillips, R. A. (1990). Mol. Cell. Biol. 10, 6586-6595. Hamel, P. A., Gill, R. M., Phillips, R. A., and Gallie, B. L. (1992). Mol. Cell. Bzol. 12, 34313438. Hannink, M., and Temin, H. M. (1990). Oncogene 5 , 1843-1850. Harbour, J. W., Lai, S. L.. Whang, P. J., Gazdar, A. F., Minna, J. D., and Kaye, F. J. (1988). Science 441, 353-357. Hatzfeld, J., Li, M.-L., Brown, E. L.,Hemchand, S., Levesque, J.-P., OToole, T., Gurney, C., Clark, S. C., and Hatzfeld, A. (1991).J. Exp. Med. 174, 925-929. Helin, K., Lees, J. A., Vidal, M., Dyson, N., Harlow, E., and Fattaey, A. (1992). Cell (Cambridge, Mass.) 70, 337-350. Hicks, G. G . , Egan, S. E., Greenberg, A. H., and Mowat, M. (1991). Mol. Cell. Baol. 11, 1344-1352. Hiebert, S. W.,Chellapan, S. P., Horowitz, J. M., and Nevins, J. R. (1992). Genes Deu. 6, 177- 185.

FUNCTION OF THE RETINOBLASTOMA GENE

139

Hiebert, S. W., Lipp, M., and Nevins, J. R. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 35943598. Hirakawa, T., and Ruley, H. E. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 1519-1523. Horowitz, J. M., Yandell, D. W., Park, S.-H., Canning, S., Whyte, P., Buchkovich, K., Harlow, E., Weinberg, R. A., and Dryja, T. P. (1989). Sciente 243, 936-940. Howe, J. A., Myrnryk, J. S., Egan, C., Branton, P., and Bayley, S. T. (1990).Proc. Natl. Acad. Sci. U.S.A. 87, 1-6. Hu, Q.. Lees, J. A., Buchkovich, K. J., and Harlow, E. (1992). Mol. Cell. B i d . 12,971-980. Hu, Q. J., Bautista, C., Edwards, G. M., Defeo, J. D., Jones, R. E., and Harlow, E. (1991). Mol. Cell Biol. 11, 5792-5799. Hu, Q. J., Dyson, N., and Harlow, E. (1990). Embo J. 9, 1147-1 155. Huang, H. J., Yee, J. K.,Shew, J. Y., Chen, P. L., Bookstein, R., Friedmann, T., Lee, E. Y., and Lee, W. H. (1988). Science 242, 1563-1566. Huang, S., Lee, W.-H., and Lee, E. Y.-H. P. (1991). Nature (London) 350, 160-162. Huang, S., Wang, N. P., Tseng, B. Y., Lee, W. H., and Lee, E. H. (1990). Embo J. 9, 18151822. Jacks, T., Fazeli, A., Schmitt, E. M., Bronson, R. T., Goodell, M. A., and Weinberg, R. A. (1992). Nature (London) 359, 295-300. Joliff, K., Li, Y., and Johnson, L. F. (1991). Nucleic Aclds Res. 19, 2267-2274. Kaelin, W. G. J., Krek, W., Sellers, W. R., DeCaprio, J. A., Ajchenbaurn, F., Fuchs, C. S., Chittenden, T., Li, Y., Farnham, P. J., Blanar, M. A., Livingston, D. M., and Flemington, E. K. (1992). Cell (Cambridge, M a s . ) 70, 351-364. Kaelin, W. G. J., Pallas, D. C., DeCaprio, J. A., Kaye, F. J., and Livingston, D. M . (1991). Cell (Cambridge, Mass.) 64, 521-532. Kim, S. J., Lee, H. D., Robbins, P. D., Busarn, K., Sporn, M. B., and Roberts, A. B. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 3052-3056. Kim, S. J., Wagner, S., Liu, F., OReilly, M. A., Robbins, P. D., and Green, M. R. (1992). Nature (London) 358, 331-334. Knudson, A. G. (1971). Proc. Natl. Acad. Sci. U.S.A. 68, 820-823. Konig, H., Ponta, H., Rahmsdorf, U., Buscher, M., Schonthal, A., Rahrnsdorf, H. J., and Herrlich, P. (1989). EMBO J. 8, 2559-2566. Kovesdi, I., Reichel, R., and Nevins, J. R. (1986). Cell ( C a m b d p , Mass.) 45, 219-228. La Thangue, N. B., Thimmappaya, B., and Rigby, P. W. (1990)Nucl. Aclds Res. 18,29292938. Laiho, M., DeCaprio, J. A., Ludlow, J. W., Livingston, D. M., and Massaguk, J. (1990). Cell (Cambridge, Mass.) 64, 175-185. Lalande, M., Dryja, T. P., Schreck, R. R., Shipley,J., Flint, A., and Latt, S. A. (1984). Cancer Genet. Cytogenet. 13, 283-295. Lee, E. Y., To, H., Shew, J. Y., Bookstein, R.,Scully, P.,and Lee, W. H. (1988). Science 241, 218-221. Lee, E. Y.-H. P., Chang, C.-Y., Hu, N., Wang, Y . 4 . J., Lai, C.-C., Herrup, K., Lee, W.-H., and Bradley, A. (1992). Nature (London) 359, 288-294. Lee, W. H., Bookstein, R., Hong, F., Young, L. J., Shew, J. Y., and Lee, E. Y. (1987a). Science 235, 1394- 1399. Lee, W. H., Shew,J. Y., Hong, F. D., Sery, T. W., Donoso, L. A., Young, L. J., Bookstein, R., and Lee, E. Y. (1987b). Nature (London) 329, 642-645. Lees, J. A., Buchkovich, K. J., Marshak, D. R., Anderson, C. W., and Harlow, E. (1991). EMBO J . 10,4279-4290. Lin, B. T., Gruenwald, S., Morla, A. O., Lee, W. H., and Wang, J. Y. (1991). EMBO J. 10, 857-864.

140

ELDAD ZACKSENHAUS

et al.

Liu, H. T., Baserga, R., and Mercer, W. E. (1985). Mol. Cell. B i d . 5, 2936-2942. Ludlow, J. W., DeCaprio, J. A., Huang, C.-M., Lee, W.-H., Paucha, E., and Livingston, D. M. (1989). Cell (Cambridge, Mars.)56, 57-65. Madreperla, S. A., Whittum-Hudson, J. A., Prendergast, R. A., Chen, P.-L., and Lee, W.H. (1991). Cancer Res. 51, 6381-6384. McGee, T. L., Yandell, D. W., and Dryja, T. P. (1989). Gene 80, 119-128. Michalovitz, D., Halevy, O., and Oren, M. (1990). Cell (Cambridge, Mars.)62, 671-680. Mihara, K., Cao, X. R., Yen, A., Chandler, S., Driscoll, B., Murphree, A. L., Tang, A., and Fung, Y.K. (1989). Science 246, 1300-1303. Mittnacht, S., and Weinberg, R. A. (1991). Cell (Cambridge, Mass.)65, 381-393. Moses, H. L., Yang, E. Y., and Pietenpol, J. A. (1990). Cell (Cambridge, Mass.)63,245-247. Mudryj, M., Hiebert, S. W., and Nevins, J. R. (1990). EMBOJ. 9, 2179-2184. Muncaster, M., Cohen, B., Phillips, R. A., and Gallie, B. L. (1992). Cancer Res. 52,654-661. Nasmyth, K. A. (1990). Cell (Cambridge, Mass.) 63, 11 17-1 120. Pardee, A. B. (1990). Science 246,603-608. Partridge, J. F., and La Thangue, N. B. (1991). EMBOJ. 10, 3819-3827. Pearson. B. E., Nasheuer, H.-P., and Wang, T. S.-F. (1991). Mol. Cell. Eiol. 11,2081-2095. Penn, L. J., Brooks, M. W., Laufer, E. M., and Land, H. (1990). EMEOJ. 9, 1113-1121. Pietenpol, J. A., Miinger, K., Howley, P. M., Stein, R. W., and Moses, H. L. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 10227-10231. Pietenpol, J. A., Stein, R. W., Moran, E., Yaciuk, P., Schlegel, R., Lyons, R. M., Pittelkow, M. R., Munger, K., Howley, P. M., and Moses, H. L. (1990). Cell (Cambridge, Mass.)61,777785. Puge, B. F., and Tjian, R. (1992).J. B i d . C h . 267, 679-682. Qin, X., Chittenden, T., Livingston, D. M., and Kaelin, W. G . (1992).Genes Dev. 6,953-964. Richon, V. M., Rifkind, R. A., and Marks, P. A. (1992). CellGrowth Dzfferen, 3, 413-420. Roarty, J. D., McLean, 1. W., and Zimmerman, L. E. (1988). Ophthalmology 95, 1583-1587. Robbins, J., Dilworth, S. M., Laskey, R. A., and Dingwall, C. (1991). Cell (Cambndge, Marc.) 64,615-623. Robbins, P. D., Horowitz, J. M., and Mulligan, R. C. (1990). Nature (London) 346,668-67 1. Rustgi, A. K., Dyson, N., and Bernards, R. (1991). Nature (London) 352, 541-544. Sakai, T., Ohtani, N., McGee, T. L., Robbins, P. D., and Dryja, T. P. (1991). Nature (London) 353, 83-86. Sham G . , and Kamen, R. (1986). Cell (Cambridge, Mass.)46,659-667. Shirodkar, S., Ewen, M., DeCaprio, J. A., Morgan, J.. Livingston, D. M., and Chittenden, T. (1992). Cell (Cambridge, Mass.) 68, 157-166. Squire, J., Gallie, B. L., and Phillips, R. A. (1985). Hum Genet. 70, 291-301. Squire, J., Goddard. A. D., Canton, M.. Becker. A., Phillips, R. A,, and Gallie, B. L. (1986). Nature (London) 322, 555-557. Squire, J.. Phillips, R. A., Boyce, S., Godbout, R., Rogers, B., and Gallie, B. L. (1984). Hum. Genet. 66, 46-53. Stone, J. C., Crosby, J. L., Kozak, C. A., Schievella, A. R.,Bernards, R., and Nadeau, J. H. (1989). Genomics 5, 70-75. Sumegi, J., Uzolgyi, E., and Klein, G . (1990). Cell Growth Dzflerent. 1, 247-250. Szpirer, C., Szpirer, J., Riviere, M., Ingvarsson, S., Vennstrom, B., Islam, M.Q., and Levan, G. ( 199I). Oncogene 6, 1319- 1324. T'Ang, A., Varley, J. M., Chakroborty, S., Murphree, A. L., and Fung, Y. K. T. (1988). Science 242, 263-266. Takahashi, R., Hashimoto, T., Xu, H.-J., Hu, S.-X., Matsui, T., Miki, T., Bigo-Marshall, H., Aaronson, S. A., and Benedict, W. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 5257-5261.

FUNCTION OF THE RETINOBLASTOMA GENE

14 1

Templeton, D. J. (1992). Mol. Cell. Biol. 12, 435-443. Templeton, D. J., Parks, S. H., Lanier, L., and Weinberg, R. A. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 3033-3037. Thompson, D. L., Kalderon, D., Smith, A. E., and Tevethia, M. J. (1990). Virology 178, 1534.

Tsai, L.-H., Harlow, E.,and Meyerson, M.(1991). Nature (London) 353, 174-177. Uzvolgyi, E., Classon, M., Henriksson, M., Huang, H. J., Szekely, L., Lee, W. H.. Klein, G., and Surnegi, J. (1991). Cell. Growth. Dzfferen. 2, 297-303. Wang, H. G., Draetta, G., and Moran, E. (1991). Mol. Cell. Biol. 11,4253-4265. Wang, N. P., Chen, P. L., Huang, S., Donoso, L. A., Lee, W. H., and Lee, E. Y. (1990). Cell Growth Differen. 1, 233-239. Whyte, P., Buchkovich, K. J., Horowitz, J. M., Friend, S. H., Raybuck, M.,Weinberg, R. A., and Harlow, E. (1988). Nature (London) 334, 124-129. Whyte, P., Williamson, N. M., and Harlow, E. (1989). Cell (Cambridge, Mas.) 56, 67-75. Wikock, D., and Lane, D. P. (1991). Nature (London) 349, 429-431. Williams, R. T., Carbonaro-Hall, D. A., and Hall, F. L. (1992). Oncogene 7, 423-432. Xu, H. J., Sumegi, J., Hu, S. X., Banerjee, A., Uzvolgyi, E., Klein, G., and Benedict, W. F. (1991). Cancer Res. 51, 4481-4485. Yonish-Rouach, E., Resnitzky, D., Lotem, J., Sachs, L., Kimichi, A., and Oren, M. (1991). Nature (London) 352, 345-347. Yunis, J. J., and Ramsay, N. (1978). Am.]. Dis. Child 132, 161-163. Zarnanian, M., and La Thangue, N. B. (1992). E M B O J . 11, 2603-2610. Zentella, A., Weis, F. M. B., Ralph, D. A., Laiho, M., and Massaguk, J. (1991). Mol. Cell. Biol. 11,4952-4958.

Zhao, Y. X., and Hung, M. C. (1992). Mol. Cell. B i d . 12, 2739-2748.

This Page Intentionally Left Blank

TUMOR PROMOTION BY INHIBITORS OF z PROTEIN PHOSPHATASES 1 AND 2A: THE OKADAIC ACID CLASS OF COMPOUNDS Hirota Fujiki and Masami Suganuma Cancer Prevention Division, National Cancer Center Research Institute, Tsukiji 5-1-1, Chuo-ku, Tokyo 104, Japan

1. Introduction 11. Okadaic Acid Class Compounds A. Okadaic Acid Receptors B. Inhibition of PP-1 a n d PP-2A 111. Okadaic Acid and Its Derivatives A. Structure and Biochemical Activity B. Tumor Promotion o n Mouse Skin C. Tumor Promotion in Rat Glandular Stomach D. Simultaneous Treatment of Okadaic Acid with Teleocidin or TPA E. In Vilro Cell Transformation F. Structure-Activity Relationships G. Apparent “Activation” of Protein Kinases H. Distribution of [SHjOkadaic Acid 1. Biochemical and Biological Effects J. Gene Expression and Transcriptional Regulation IV. Calyculins A. Structure and Biochemical Activity B. Tumor Promotion on Mouse Skin V. Microcystins and Nodularin A. Structure and Biochemical Activity B. Target Tissue C. Tumor Promotion in the Liver D. Molecular Modeling VI. Tautomycin A. Structure and Biochemical Activity B. Absence of Tumor Promotion on Mouse Skin C. Effects o n Digestive Tract VII. Hypotheses in Relation to Human Cancer VIII. Future Perspectives IX. Conclusion References

1. Introduction Tumor promotion by the okadaic acid class of compounds is unique in many respects, such as a strong potency and new mechanisms of 143 ADVANCES IN CANCER RESEARCH, VOL. 61

Copyright 0 1993 by Academic Press, Inc. All rights of reproduction in any form reserved.

144

HIROTA FUJIKI A N D MASAMI SUGANUMA

action. These compounds bind to the okadaic acid receptors protein phosphatases 1 and 2A (PP-1 and PP-2A), inhibit their activities, and result in an increase of phosphorylation of proteins in the cells. Through the signal transduct ion pathway, the expression of various genes related to cell proliferation is stimulated. Two-stage carcinogenesis experiments with the okadaic acid class of compounds established a general mechanism of tumor promotion applicable to various organs. This article reviews our recent studies on the okadaic acid class of tumor promoters and discusses the significance of inhibition of PP- 1 and PP-2A, the okadaic acid pathway, in the study of tumor promotion. We have been studying okadaic acid since 1985. It was initially provided independently by two Japanese chemists, Hirata and Yamada. They thought that okadaic acid might be a potentially useful compound in the study of tumor promotion, based on a pioneering finding by Shibata and associates (1982) that okadaic acid causes muscle contraction even in the absence of external Ca2+ ions. We first subjected okadaic acid to our short-term screening system for 12-O-tetradecanoylphorbol- 13-acetate (TPA)-type tumor promoters, which consists of three successive tests: tests of irritation of mouse ear, induction of ornithine decarboxylase (ODC) in mouse skin and induction of H L 6 0 cell adhesion (Fujiki et al., 1981). Okadaic acid responded differently from TPA in the three tests. Okadaic acid induced redness in the center of the mouse ear and its periphery remained white, whereas TPA induced redness on the entire ear. Okadaic acid induced ODC in mouse skin following a time course similar to that of TPA, but the potency of ODC induction by okadaic acid was one-tenth that of TPA. Okadaic acid did not induce H L 6 0 cell adhesion, whereas TPA tested positive. In addition, okadaic acid did not activate protein kinase C (PKC), whereas TPA is well known to be a potent activator of PKC (Nishizuka, 1984). Nevertheless, the possibility that okadaic acid might be a tumor promoter in mouse skin could not be excluded, because of the known existence of non-TPA-type tumor promoters, such as palytoxin, thapsigargin, and staurosporine (Fujiki et al., 1987, 1989a,b). In 1988, okadaic acid and dinophysistoxin- 1 (35-methylokadaic acid) were reported to be potent non-TPA-type tumor promoters on mouse skin initiated with 7,12-dimethylbenz[a]anthracene(DMBA) (Suganuma et al., 1988; Fujiki et al., 1988). Since their tumor-promoting activities were as potent as those of TPA types, such as TPA itself, teleocidin, and aplysiatoxin (Fujiki and Sugimura, 1987), and the most potent of the non-TPA types, the studies were extended to screening for compounds that bind to the okadaic acid receptors, elucidation of the mechanisms of action of okadaic acid through inhibition of PP-1 and PP-2A, tumor

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

145

promotion on mouse skin and in other organs, and gene expression and transcriptional regulation by okadaic acid compared with TPA, to name a few. So far, we have found 30 compounds of the okadaic acid class that bind to the okadaic acid receptors PP-I and PP-2A and inhibit their activities. Thirty okadaic acid class compounds include four structurally different types, namely, okadaic acid, calyculin, microcystin, and tautomycin (Fig. 1). Okadaic acid induced tumor promotion on mouse skin initiated with DMBA as well as in rat glandular stomach initiated (MNNG) (Fujiki et al., 1992; with N-methyl-N'-nitro-N-nitrosoguanidine

RI

Okadaic acid Dinophysistoxin-1 Acanthifolicin

Calyculin A

H H

Rz H

H

C9-ClO

-

Ra H

CH, C

1's

C'

Microcystin-LR

Tautomycin

FIG. 1. Four structurally different types of okadaic acid class compounds: okadaic acid, calyculin A, microcystin-LR, and tautomycin. Dinophysistoxin-1 and acanthifolicin are also depicted for reference.

146

HIROTA FUJIKI A N D MASAMI SUGANUMA

Suganuma et al., 1992b). Calyculin A was as potent as okadaic acid as a tumor promoter on mouse skin (Suganuma et al., 1990). Microcystin-LR induced tumor promotion in rat liver initiated with diethylnitrosamine (DEN) (Nishiwaki-Matsushima et al., 199213). Tautomycin is thought to be a tumor promoter in rat glandular stomach. We now think the okadaic acid pathway, mediated through inhibition of PP-1 and PP-2A, is a general mechanism of tumor promotion in various organs (Fujiki et al., 1992) and is a biochemical pathway that is also taken in the process of tumor promotion in human cancer development (Fujiki, 1992).

II. Okadaic Acid Class Compounds A. OKADAIC ACIDRECEPTORS Okadaic acid was thought to bind to specific receptors, because the potency of its tumor-promoting activity was comparable to that of TPA, which bound to the phorbol ester receptors in mouse skin (Blumberg, 1988; Weinstein, 1988). 27-[3H]okadaic acid (14 Ci/mmol) was obtained by 3H-labeling of methyl-27-ketookadaate with sodium b ~ r o - [ ~ H ] h y dride. [3H]Okadaic acid bound specifically to a cytosolic fraction and a particulate fraction of mouse skin. T h e dissociation constant, K , value, was 1.0 nM for receptors in the cytosolic fraction and the maximum binding capacity, B,,,, was 6.8 p m o h g protein (Fig. 2). T h e K, value was 21.7 nM for those in the particulate fraction and the B,,, was 2.5 pmol/mg protein (Suganuma et al., 1989). Scatchard analysis indicated that receptors with a high affinity for binding were present in the cytosolic fraction and those with a low affinity were present in the particulate fraction. The specific [3H]okadaic acid binding to the cytosolic and particulate fractions was inhibited dose-dependently by okadaic acid, but not by okadaic acid tetramethyl ether, an inactive compound, and clearly, not by TPA o r teleocidin (Fig. 3) (Fujiki et al., 1989c; Suganuma et al., 1989). Utilizing an assay based on inhibition of specific [3H]okadaic acid binding to the particulate fraction of mouse skin, we have identified other compounds, the calyculins, the microcystins, and tautomycin, which bind to the okadaic acid receptors. They were classified as the okadaic acid class compounds, although their structures were not related (Fig. 1). Thus, the okadaic acid class compounds represent a structurally diverse group with a strong binding affinity for the okadaic acid receptors. In addition to mouse skin, there was specific [3H]okadaicacid binding to the cytosolic and particulate fractions of various mouse tissues, such

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

147

1

t

0

I

I

F

X

En

U

-U 6 C

3

0

n 0

0 lu

4

i

m

0

100

200

300 0..

Cytosolic fraction ( yg )

10

20

H-Okadaic acid ( nM )

FIG.2. Specific [SH]okadaicacid binding to the cytosolic fraction of mouse skin. Various concentrations of the cytosolic fraction were incubated with 20 nM [SH]okadaic acid (A) and the cytosolic fraction (150 Fg) was incubated with various concentrations of [SHIokadaic acid (B). Total bound [SH]okadaic acid (TB, 0), specifically bound [SH jokadaic acid (SB, O), and nonspecifically bound [SHIokadaic acid (NSB, X). (Inset) Scatchard analysis.

as brain, lung, and colon. The total amount of specific binding to the receptors was greater in the cytosolic fraction than in the particulate fraction. The order of the total amount of specific binding to the receptors of the cytosolic fraction (pmol/mg protein) was small intestine > brain > ovaries > colon > stomach. It is interesting to note that target organs for diarrhetic shellfish poisoning, such as small intestine and colon, have a higher total specific binding than other organs (Suganuma et al., 1989). The biochemical nature of okadaic acid receptors has been studied with the cytosolic fraction of mouse brain (Sassa et al., 1989). B. INHIBITIONOF PP-I

AND

PP-ZA

Before the biochemical nature of the okadaic acid receptors had been identified, we had found that [3H]okadaicacid binds to the second peak fraction of protein kinases, which had been eluted with 0.2 M NaCl on DEAE-cellulose column chromatography of the cytosolic fraction of

148

HIROTA FUJIKI A N D MASAMI S U G A N U M A

Concentration ( nM )

FIG.3. Inhibition of specific [SH]okadaic acid binding t o the particulate fraction by various compounds. Unlabeled okadaic acid (0). okadaic acid tetramethyl ether (0), TPA (X), and teleocidin (W).

mouse brain. Moreover, this second peak fraction, which also contained PP-PA, showed the enhanced incorporation of 32P into histone III-S by incubation with [ Y - ~ ~ P I A and T P okadaic acid, whereas it was not found with okadaic acid tetramethyl ether, an inactive compound. When the second peak fraction was further separated into a protein kinase fraction and a PP-2A fraction, to the latter of which the specific [3H]okadaic acid binding was found, we understood this activation of protein kinases by okadaic acid to be the sum of the basal protein kinase activity plus the inhibition of PP-PA by okadaic acid; this we named the apparent "activation" of protein kinases by okadaic acid, because okadaic acid did not directly activate the protein kinases. Thus, our study of the okadaic acid receptors was initiated in relation to protein phosphorylation (Sassa et al., 1989). The first important findings that okadaic acid is a potent inhibitor of PP-1 and PP-PA and inhibits smooth muscle myosin phosphatase activity were obtained by researchers working with muscle contraction. These researchers further investigated the original observations by Shibata and associates (1982) (Takai et al., 1987; Erdodi et al., 1988). Inhibition of the enzyme reaction by okadaic acid has been studied intensively by various research groups (Bialojan and Takai, 1988; Hescheler et al., 1988; Haystead et al., 1989). It had been reported that phorbol ester photoaffinity probes specifi-

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

149

0

m

0

10 Slice number

20

FIG.4. Photoaffinity labeling of PPdA by methyl-7-0-(4-azidobenzoyl)-[27-3Hjokadaate displayed on SDS-PAGE. Total binding (0), specific binding (O),and nonspecific binding (X). The arrows indicate the molecular weights of the three subunits of PP-2A.

cally labeled the lipid environment, rather than protein kinase C (Delclos et al., 1983; Schmidt et al., 1985). How okadaic acid interacts with the protein receptors PP-1 and PP-PA was an important subject of our next studies. An okadaic acid photoaffinity probe, methyl-7-0-(4-azidoben~oyl)-[27-~H]okadaate, was synthesized by Yamada and Ojika (Nishiwaki et al., 1990b) and PP-2A, which consists of three subunits, 65,42, and 37 kDa, was isolated from bovine brain in a pure form. After UV irradiation, SDS-polyacrylamide gel electrophoresis of the reaction mixture revealed that the radioactivity of the 3H adduct specifically corresponds to the catalytic subunit of the 37-kDa protein. This was the first evidence that the photoaffinity probe of okadaic acid binds directly to the catalytic subunit of PP-2A (Fig. 4) (Nishiwaki et al., 1990b). Since the catalytic subunit of PP-2A is structurally homologous to that of PP-1 (Cohen et al., 1988), okadaic acid might also interact with the catalytic subunit of PP-1. T h e okadaic acid binding site of the catalytic subunit is not the substrate binding site, because okadaic acid inhibits PP-1 and PP-2A noncompetitively (Bialojan and Takai, 1988). The other okadaic acid class compounds, the calyculins, the microcystins, and tautomycin, also shared, with [3H]okadaic acid, the specific binding to the receptors. Thus, the okadaic acid binding site of the catalytic subunit is also utilized for binding by all of the okadaic acid class compounds. Using partially purified enzymes isolated from mouse brain, skin, and

150

HIROTA FUJIKI AND MASAMI SUGANUMA

INH~BITION OF PP-1

AND

PP9A

TABLE I BY THE OKADAIC ACIDC u s s COMPOUNDS

Compounds

Inhibition of PP-I

microcyst in-LR Calyculin A Tautomycin Okadaic acid

0.1

Inhibition of PP-2A Ic50

(d)

0.3 0.7

0.10 0.13 0.65

3.4

0.07

Note. The catalytic subunit of PP-I was isolated from rabbit skeletal muscle and that of PP-2A was isolated from human erythrocytes, as described in the text.

liver, we had demonstrated that the okadaic acid class compounds are potent inhibitors of PP-1 and PP-2A, (Sassa et al., 1989; Suganuma et al., 1990; Yoshizawa et al., 1990; Magae et al., 1990). Various research groups independently reported similar results using purified catalytic subunits of PP-1 and PP-PA (Hescheler et al., 1988; Ishihara et al., 1989a; Honkanen et al., 1990, 1991; Mackintosh and Klumpp, 1990; Mackintosh et al., 1990). In this chapter we have presented only the relative potencies of the four compounds of the okadaic acid class for the purified catalytic subunits of PP-1 and PP-2A (Suganuma et al., 1992a). As Table I shows, the IC,,s for the catalytic subunit of PP-1 purified from rabbit skeletal muscle (Brautigan and Shriner, 1988) ranged from 0.1 to 3.4 nM and the order of potencies was microcystin-LR > calyculin A > tautomycin > okadaic acid. T h e IC,,s for that of PP-2A, purified from human erythrocytes (Brautigan and Shriner, 1988), ranged from 0.07 to 0.65 nM and the order was okadaic acid > microcystin-LR > calyculin A > tautomycin (Suganuma et al., 1992a). As various investigators reported, okadaic acid was a unique inhibitor, which is 50-100 times more effective against PP-2A than PP-1. However, the other three compounds were equally effective against PP-1 and PP-'LA. Since these four compounds at doses up to 10 pA4 did not inhibit protein tyrosine phosphatase prepared from recombinant rat brain protein tyrosine phosphatase 1 (Ingebritsen, 1991), the okadaic acid class compounds were found to exhibit selective inhibition of protein serinehhreonine phosphatase activity (Suganuma et al., 1992a).

111. Okadaic Acid and Its Derivatives A. STRUCTURE A N D BIOCHEMICAL ACTIVITY

Okadaic acid is a polyether compound of a C,, fatty acid, isolated from a black sponge, Halichondria okadaz, named in honor of Dr. Yaichiro

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

151

Okada (Tachibana et al., 1981). 35-Methylokadaic acid was first isolated from the hepatopancreas of the mussel M y t i h edulis, as a causative agent of diarrhetic shellfish poisoning in Japan; it was named dinophysistoxin-1 (Fig. l), because it was found to be originally produced by a dinoflagellate, Dinophysisfortii (Murata et al., 1982). Okadaic acid and dinophysistoxin-1 are sometimes isolated at the same time from the black sponge, to which toxin-producing dinoflagellates, such as various species of the Dinophyszli genus and Prorocenlrum lama, have adhered. In addition to these compounds, Yasumoto and associates (1985, 1989) isolated from dinoflagellates various okadaic acid derivatives, such as 7deoxyokadaic acid, 7-0-acylated forms, and ethylokadaatediol esters, and they semisynthesized 7-0-palmitoylokadaic acid and 7-0-docosahexaenoylokadaic acid from okadaic acid. Glycookadaic acid was isolated from H. okadai as a minor component (Uemura and Hirata, 1989). Yamada and associates chemically semisynthesized the following 12 compounds from okadaic acid: okadaic acid methyl ester, okadaic acid tetramethyl ether, okadaic acid methyl ester tetramethyl ether, okadylamine, okadanol, nor-okadanone, nor-okadanol, okadaic acid glycol, okadaic acid spiroketal I, and okadaic acid spiroketal I1 (Nishiwaki et al., 1990a). Acanthifolicin, structurally an episulfide derivative of okadaic acid (Fig. I), was isolated from the marine sponge pandaros acanthifolium. Acanthifolicin methyl ester was also prepared by treatment of acanthifolicin with diazomethane (Schmitz et al., 1981). Okadaic acid and 16 derivatives were evaluated as possible tumor promoters by means of three biochemical tests: inhibition of specific ["Hlokadaic acid binding to a particulate fraction of mouse skin; inhibition of protein phosphatase, which was thought to be mainly PP-2A in the fraction eluted with 0.2 M NaCl on DEAE-cellulose column chromatography of the cytosolic fraction of mouse brain; and induction of ODC in mouse skin. Table I1 summarizes the activities of two of these tests. Acanthifolicin, which gave positive responses in these three tests as strongly as okadaic acid and dinophysistoxin- 1, was predicted to be an additional tumor promoter of the okadaic acid class (Fujiki et al., 1990a,b; Nishiwaki et al., 1990a). B. TUMOR PROMOTION ON MOUSESKIN

Tumor-promoting activities of okadaic acid and dinophysistoxin- 1 were determined by two-stage carcinogenesis experiments on mouse skin initiated with DMBA, following the same procedure as with TPA, teleocidin, and aplysiatoxin (Table 111) (Fujiki et al., 1982). Figure 5 summarizes the tumor-promoting activity of okadaic acid at doses of 0.1,

152

HIROTA FUJIKI AND MASAMI SUGANUMA

TABLE I1 BIOCHEMICAL ACTIVITIESOF OKADAIC ACID AND ITS DERIVATIVES Inhibition of specific [JH]okadaic acid binding Compounds

“c50

Okadaic acid Dinophysistoxin-I Glycookadaic acid Okadaic acid methyl ester Okadaic acid tetramethyl ether Okadaic acid methyl ester tetramethyl ether 7-0-Palmitoylokadaic acid 7-0-Docosahexaenoylokadaic acid Okadylamine Okadanol Nor-okadanone Nor-okadanol Okadaic acid glycol Okadaic acid spirokeral I Okadaic acid spiroketal I1 Acanthifolicin Acanthifolicin methyl ester

(m)1

35 26 > 18,000 > 100,000 > 100,000 > 17,200 4,200 700 > 19,000 > 19,000 > 20,000 > 20,000 14,000 > 44,000 8,600 48 > 100,000

Inhibition of protein phosphatase ( 1 pg compound/ml assay mixture) (% inhibition) I00 I00 51 0 2 0 40 64 17 41 5 14 99 81 99 100 0

TABLE 111 TUMOR-PROMOTING ACTIVITIESOF THE OKADAIC ACIDC u s s A N D TPA-TYPETUMOR PROMOTERS, A N D ACTIVATION OF c-Ha-rr GENE

Tumor promoters Okadaic acid class Okadaic acid Dinophysistoxin-1 Calyculin A TPA types TPA Teleocidin Apl ysiatoxin

Amounts Per application (nmol)

Maximal % of tumorbearing mice

Average No. of tumors per mouse in Week 30

1.2 1.2 I .O

86.7 100.0 93.3

7.2 8.5 4.3

A-T

4.1 5.7 4.0

100.0 100.0 80.0

11.0 4.0 3.4

A+T A+T A+T

Mutation of the second nucleotide in codon 61

A+T A+T

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

0

10

20

153

30

Weeks of tumor promotion

FIG.5. Tumor-promoting activity of okadaic acid. Initiation was carried out by a single application of 100 pg of DMBA in 0. I ml of acetone to the skin of the back of 8-week-old female CD-I mice. After 1 week, a few micrograms of okadaic acid in 0.1 ml of acetone was applied to the skin twice a week throughout the experiment. The groups were treated with DMBA plus okadaic acid (0. I pg per application, A; 1 p g , A; 5 pg, 0; and 10 pg, O), DMBA plus okadaic acid tetramethyl ether (1 pg, a),okadaic acid alone (10 pg, 0).and DMBA alone (X).

1, 5 , and 10 pg (0.12, 1.2, 6.2, and 12 nmol) per application, expressed as the cumulative tumor incidence, as determined in separate experiments (Fujiki et al., 1988; Suganuma et al., 1988, 1990). When compared with the tumor-promoting activity of TPA-type tumor promoters, okadaic acid and teleocidin induced similar potent tumor-promoting activity on mouse skin, based on the molar ratio of their applied doses (Table 111). It was of importance to study histologically the tumors induced by the two different tumor promoters, okadaic acid and teleocidin. Interestingly, the percentage incidences of papillomas and carcinomas were 92.3 and 5.1% in the group treated with DMBA plus okadaic acid and 95.7 and 4.3% in the group treated with DMBA plus teleocidin. Thus, okadaic acid and teleocidin showed about the same potencies for production of papillomas and carcinomas during tumor promotion (Suganuma et al., 1988). Activation of the ras gene is commonly involved in early events of cancer in various organs in humans (Barbacid, 1987; Vogelstein et al., 1989). Balmain and associates previously reported that tumors on mouse skin treated with DMBA plus TPA possess an activated c-Ha-ras gene with a mutation at the second nucleotide of codon 61 (Balmain and Pragnell, 1983; Quintanilla et al., 1986). DNA isolated from tumors in

154

HIROTA FUJIKI AND MASAMI SUCANUMA

the three groups treated with DMBA plus okadaic acid, DMBA plus dinophysistoxin- 1, and DMBA plus calyculin A (discussed in Section IV) revealed the same mutation at the second nucleotide of codon 61 (CAA to CTA) in the c-Ha-ras gene, determined by the polymerase chain reaction procedure and DNA sequencing (Fujiki et al., 1989d). Western blot analysis showed that these tumors contain both the normal p2 1-ras protein and a more rapidly migrating p2 l-ras protein, indicating an amino acid substitution from glutamine to leucine due to the mutation in codon 6 1. Three TPA-type tumor promoters, TPA, teleocidin, and aplysiatoxin, showed the same effects (Table 111) (Fujiki et ul., 1989d). These results suggested that the clonal expansion and development of papillomas from DMBA-initiated cells containing a specific mutation in the c-Ha-ras gene can be induced by two different pathways of tumor promotion, the okadaic acid pathway and the PKC pathway (Fujiki et al., 1989d, 1991). PROMOTION IN RAT GLANDULAR STOMACH C. TUMOR It has been reported that TPA and teleocidin induce tumor promotion only in squamous cells of the skin, esophagus, and forestomach, but not in the glandular stomach (Goerttler et al., 1981; Suganuma et al., 1987). This evidence led us to study whether okadaic acid might induce tumor promotion in cells other than squamous cells, because okadaic acid acts differently on the cells than does TPA. In particular, Yasumoto’s observation that okadaic acid and dinophysistoxin- 1 are causative agents of diarrhetic shellfish poisoning in humans (Yasumoto et al., 1989) prompted us to look at the gastrointestinal tract. Intubation of okadaic acid (more than 10 pg/0.2 ml sesame oil) into the stomach of rats caused diarrhea with an accumulation of a large volume of fluid in the stomach, small intestine, and colon (Suganuma et al., 1988). Ornithine decarboxylase induction is well accepted as one of the significant biochemical effects of tumor promotion (Boutwell, 1977). A single administration of 10 to 30 pg okadaic acid into the stomach of rats induced the maximum ODC induction in the glandular stomach, 4 hr after intubation. Since the rat glandular stomach contained more PP-2A than PP-1, both of which were inhibited by okadaic acid in vitro, the mucosa of the gastrointestinal tract might be a likely target tissue for okadaic acid (Suganuma et al., 1992b). Initiation in the glandular stomach of 6-week-old male SD rats was achieved by giving a solution of MNNG at a concentration of 100 mg/liter of deionized water, pH 7, for the first 8 weeks as drinking water. One week after initiation, a solution of okadaic acid was given orally to rats at a concentration of 0.25 mg/liter (about 10 pglratlday) for 46 weeks,

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

155

from Weeks 9 to 55 of the experiment and 0.5 mg/liter (about 20 pg/rat/day) for 17 weeks, from Weeks 56 to 72. The neoplastic changes in the glandular stomach were estimated by adenomatous hyperplasias plus adenocarcinomas, just as papillomas plus carcinomas occur in mouse skin two-stage carcinogenesis. T h e percentages of neoplastic change-bearing rats in the groups treated with MNNG plus okadaic acid, MNNG alone, or okadaic acid alone were 75,46.4, and 0%, respectively (Suganuma et al., 1992b). Thus, the treatment with okadaic acid enhanced the neoplastic changes in the rat glandular stomach initiated with MNNG (P < 0.05). It is important to note that okadaic acid enhanced tumorigenesis in the MNNG-initiated glandular stomach of rats through the same mechanisms of action as it had in mouse skin, that is, inhibition of PP-PA and PP-I.

D. SIMULTANEOUS TREATMENT OF OKADAIC ACID WITH TELEOCIDIN OR TPA As reported previously, okadaic acid and teleocidin resulted in a potent tumor-promoting activity, mediated through two different pathways, either the okadaic acid or the PKC pathway (Fig. 6). We thought it would be interesting to study the effects of simultaneous applications of two tumor promoters, okadaic acid and teleocidin. Before going on to a two-stage carcinogenesis experiment, in vitro protein kinase activity was

-8

HzN COOH

/ \

Phosphorylation

Signal

Dephosphorylation

t

Okadaic acid class tumor promoters

TPA-type tumor promoters

1 Protein kinase C

H O : l E

’ HOG&.

-Signal

4

Dephosphorylation

FIG.6. Schematic illustration of the okadaic acid pathway and the PKC pathway.

156

HIROTA FUJIKI AND MASAMI SUGANUMA

determined by simultaneous treatment of okadaic acid with teleocidin. T h e assay mixture contained two peak fractions: the first contained PKC eluted with 0.1 M NaCl on DEAE-cellulose column chromatography of the cytosolic fraction of mouse brain and the second contained PP-2A eluted with 0.2 M NaCI. The first fraction was used for activation of PKC by teleocidin and the second fraction was used for inhibition of PP-2A by okadaic acid. When these two fractions were incubated with [y-32P]ATPin the presence of okadaic acid with teleocidin, incorporation of 32P into histone H1 was synergistically increased (Suganuma et al., 1993). Simultaneous applications of okadaic acid with teleocidin to the DMBA-initiated mouse skin, however, did not cause any synergistic o r additive effects on tumor promotion. In one experiment, 1 pg okadaic acid and 2.5 pg teleocidin per application were chosen as the amounts. The percentages of tumor-bearing mice in the groups treated with DMBA plus okadaic acid, DMBA plus teleocidin, and DMBA plus okadaic acid with teleocidin were 73.3, 71.4, and 64.3%, respectively, in Week 20 of tumor promotion (Suganuma et al., 1993). To elucidate the absence of synergistic effects by okadaic acid and teleocidin, we studied their effects in various systems: induction of ODC in mouse skin, hyperphosphorylation of cytokeratins in human keratinocytes, and morphological changes in the cells. Effects of simultaneous treatment supported the results of tumor promotion in mouse skin, indicating no synergistic o r additive effects. These results encouraged us to look for important transcriptional regulation involved in tumor promotion. An absence of synergistic effects by okadaic acid and TPA on induction of the kappa enhancer binding protein (NF-KB),human immunodeficiency virus-long terminal repeat (HIV-LTR), and the AP- 1 complex was observed in gene expression experiments. Okadaic acid treatment for 6 hr induced NF-KBin the nuclear extract of Jurkat cells, whereas TPA induced it after a l-hr treatment. The levels of NF-KBin nuclear extracts were generally found to be similar by electrophoretic mobility shift assay. However, simultaneous treatment of okadaic acid with TPA resulted in little increase in NF-KB levels. Okadaic acid resulted in a marked increase in chloramphenicol acetyltransferase (CAT) activity in Jurkat cells that were transfected with a plasmid containing the HIV-LTR, which contains two tandem KB sites, linked to the CAT 13-acetate was a weak inducer of the gene. 12-O-TetradecanoylphorbolHIV-LTR. Simultaneous treatment of okadaic acid with TPA markedly inhibited the response to okadaic acid, suggesting that TPA may have a negative regulatory effect (Thevenin et al., 1990).

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

157

Treatment with either okadaic acid for 6 hr or TPA for 1 hr markedly induced AP-1 complex in the nuclear extract of Jurkat cells. Simultaneous treatment of okadaic acid with TPA for 6 hr substantially inhibited the induction by okadaic acid (Thkvenin et al., 1991). The components of the AP- 1 complex were studied further. Okadaic acid increased mRNA transcripts of thejun gene family of the proto-oncogene (cjun, jun B, andjun D) and, to a lesser extent, the foJ gene family (c$os and fra-1); TPA was an inefficient inducer of the jun gene family in Jurkat cells. Simultaneous treatment of okadaic acid with TPA markedly inhibited the induction of cjun mRNA by okadaic acid. Although these experiments did not clarify the mechanism by which TPA inhibits the response to okadaic acid, it was found that there is a marked difference between okadaic acid and TPA in induction of both cjun mRNA and the cjun promoter-CAT constructs (Thkvenin et al., 1991).

E. IN

VITRO

CELL TRANSFORMATION

T h e transformation assay with BALB/3T3 cells is useful in predicting tumor-promoting activity of non-TPA-type tumor promoters as well. In uitro cell transformation by some of the okadaic acid class compounds was studied. Cells were treated first with an initiator, 3-methylcholanthrene (MCA), at a concentration of 0.5 pg/ml for 72 hr. Three days later, the medium was replaced, then the cultures were treated with okadaic acid at concentrations of 10 ng/ml(l2.4 nM) and 20 nglml(24.8 nM), with dinophysistoxin-1 at a concentration of 3 ng/ml(3.66 nM) and with dimethyl sulfoxide (DMSO) as a control group, for 2 weeks. Numbers of dishes with transformed foci per numbers of dishes examined were 12/23 and 23/24 for the two concentrations of okadaic acid, 18/24 for dinophysistoxin- 1, and 1/24 for the control group, respectively. T h e results clearly showed that okadaic acid and dinophysistoxin- 1 enhanced MCA-initiated transformed foci in a significant number of dishes, compared with DMSO. Okadaic acid tetramethyl ether, at a concentration of 30 ng/ml(34.7 nM),did not affect the transformation frequency of cells initiated with MCA. Okadaic acid at concentrations of 10 and 20 ng/ml did not produce any significant number of transformed foci with subsequent treatment with TPA, indicating the absence of any initiating activity of okadaic acid (Sakai and Fujiki, 1991). The activity of okadaic acid was compared with that of phorbol- 12,13-didecanoate (PDD) in the BALB/3T3 cell transformation assay. Okadaic acid at a concentration of 10 ng/ml(l2.4 nM) was equipotent to PDD at the same concentration of 10 ng/ml (14.9 nM), resulting in 4.9 and 3.7 focildish, respectively (Katoh et al., 1990).

158

HIROTA FUJIKI AND MASAMI SUGANUMA

Hennings and associates (1990) developed a new in vitro assay system for tumor-promoting activity using cocultures consisting of a small number of the keratinocyte cell line 308 derived from adult mouse skin initiated with DMBA and confluent normal primary keratinocytes. They recently demonstrated that cocultures treated with okadaic acid at concentrations of 1.24 or 2.48 nM induced a significant number of foci of 308 cells, compared with DMSO or with okadaic acid tetramethyl ether as the controls. Okadaic acid at a concentration of 2.48 nM induced as many foci as TPA at a concentration of 162 nM (Hennings et al., 1992). Okadaic acid significantly increased the frequency of transformed foci of mouse C3H/10T1/2 cells that were transfected with a plasmid containing a full-length bovine papilloma virus (BPV-1) DNA. This okadaic acid-dependent cell transformation was inhibited dose-dependently by retinol (Tsang et al., 1991). In contrast to the presence of transforming activity in various assay systems, okadaic acid caused flat reversion of the raf and ret-I1 transformants (Sakai et al., 1989) and inhibited C3H/ 10T1/2 cell transformation induced by either MCA alone or MCA plus TPA (Mordan, 1991; Mordan et al., 1990). What phosphoproteins are inactivated by hyperphosphorylation in these processes remains to be elucidated.

F. STRUCTURE-ACTIVITY RELATIONSHIPS The structure-activity relationships of seventeen okadaic acid derivatives (Section 111, A) were studied by inhibition of specific [3H]okadaic acid binding to the receptors and inhibition of PP-2A (Table 11). Okadaic acid, dinophysistoxin- 1, and acanthifolicin showed similarly potent activities in these tests. T h e presence of one extra carbon on the G-ring of okadaic acid, as in the case of dinophysistoxin-1, or replacement of the olefin in the B-ring with an episulfide, as in the case of acanthifolicin, did not affect the activity. Therefore, these three naturally occurring compounds were the most active forms. Hydrogen bond formation between the carbonyl group at C-1 and the hydroxyl group at C-24, which resulted in formation of a flexible cavity (Fig. 7), was proposed in the okadaic acid molecule (Uemura and Hirata, 1989). Glycookadaic acid, which was weaker than okadaic acid, might have a slightly larger flexible cavity than does okadaic acid. Semisynthetic compounds were less active than okadaic acid, dinophysistoxin- 1, and acanthifolicin (Table 11). Okadaic acid methyl ester and acanthifolicin methyl ester completely lost their activities, due to the loss of the acidic nature of the carboxyl group. Manipulation of the four hydroxyl groups of okadaic acid in making okadaic acid tetramethyl

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

Okadaic acid spiroketal I

159

Okadaic acid spiroketal I1

FIG. 7. Flexible cavity of okadaic acid. Conformation was determined by the interpretation of N M R data. Okadaic acid spiroketals I and I1 are also depicted for reference.

ether resulted in total loss of the activity. Okadaic acid methyl ester tetramethyl ether was also inactive. These results indicated that the carboxyl group as well as the four hydroxyl groups at C-2, C-7, C-24, and C-27 of okadaic acid are important for activity (Nishiwaki et al., 1990a). Levine and associates ( 1988) produced rabbit antibodies directed toward okadaic acid and they developed a radioimmunoassay specific for okadaic acid. The sera from rabbits immunized with an okadaic acidbovine albumin conjugate neutralized the ability of okadaic acid to stirnulate 6-keto-prostaglandin F,, production by rat liver cells. [3H]Okadaic acid binding to the anti-okadaic acid was inhibited by unlabeled okadaic acid. To gain some insight into the structural particularity among the four types of the okadaic acid class compounds, we compared the results of

160

HIROTA FUJIKI A N D MASAMI SUGANUMA

their inhibitory activity toward PP-2A with the results of a radioimmunoassay, that is, inhibition of [SH]okadaicacid binding to rabbit antiokadaic acid (Table IV). Specific [3H]okadaic acid binding to the antiokadaic acid was inhibited only by the okadaic acid type, but not by the three compounds calyculin A, microcystin-LR, and tautomycin. These results showed that rabbit anti-okadaic acid only recognizes the okadaic acid molecule. The anti-okadaic acid also recognized okadaic acid tetramethyl ether as strongly as okadaic acid, although okadaic acid tetramethyl ether is inactive in inhibition of PP-2A. Anti-okadaic acid recognized a site on the okadaic acid molecule that was not related to inhibition of protein phosphatase activity. When an okadaic acid molecule was chemically cleaved into two parts, okadaic acid spiroketal I, containing the A and B rings and okadaic acid spiroketal 11, containing the C to G rings (Fig. 7), the anti-okadaic acid recognized okadaic acid spiroketal I1 as strongly as Okadaic acid and more ef€ectively than okadaic acid spiroketal I (Table IV). These results indicated that the anti-okadaic acid recognizes the terminal F and G rings of okadaic acid, which were projected from the cavity formed by an intramolecular hydrogen bond between C-1 carbony1 and C-24 hydroxyl groups (Uemura and Hirata, 1989) (Fig. 7). These results also suggested that the parts consisting of the A to E rings might be involved in inhibition of PP-1 and PP-2A (Yatsunami et al., TABLE IV BIOCHEMICAL AND IMMUNOLOGICALEFFECTS OF NINEOKADAIC ACIDCLASS COMPOUNDS

Compounds

Inhibition of PP-ZAG ( 1 pg compoundlml assay mixture (% inhibition)

Okadaic acid Dinophysistoxin- I Acanthifolicin Calyculin A Microcystin-LR Tautomycin Okadaic acid tetramethyl ether Okadaic acid spiroketal I Okadaic acid spiroketal I1

100 100 100 100 100 100 2.2 81 99

Inhibition of ["Iokadaic acid binding to antiokadaic acid [Icso ( d l 1 0.5 1.2 0.8 > 1000

> 1000 > 1000 0.6 40.0 0.7

a Phosphorylated histone HI (10,000cpm/pg) was incubated with fraction containing PP-2A partially purified from mouse brain and test compounds for 10 min at 30°C. The inhibitory effects of PP-I with these compounds closely resembled those presented in this table.

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

161

199la). Three murine monoclonal antibodies against okadaic acid were prepared (Usagawa et al., 1989). These antibodies will provide similar results.

G. APPARENT“ACTIVATION” OF PROTEIN KINASES Okadaic acid enhanced incorporation of 32Pinto histone III-S in vitro by incubation with [Y-~~PIATP, protein kinases and protein phosphatases, as reported in Section 11, B. We called this the apparent “activation” of protein kinases (Sassa et al., 1989). Next we studied the consequence of inhibition of PP-1 and PP-PA by okadaic acid in the cells. A hyperphosphorylated protein with a molecular mass of 58 kDa was found in cell lysates of primary human fibroblasts treated with okadaic acid or dinophysistoxin-1 at concentrations of 100 nh4 for 2 hr (Fig. 8). The hyperphosphorylated 58-kDa protein was not induced by teleocidin, one of the TPA-type tumor promoters. Therefore, this hyperphosphorylation was thought to be the result of inhibition of PP-1 and

FIG.8. Hyperphosphorylated vimentin in primary human fibroblasts treated with the okadaic acid class compounds: control ( I ) , okadaic acid (2), dinophysistoxin-1 (3) and calyculin A (4), at a concentration of 100 nM.

162

HIROTA FUJIKI A N D MASAMI SUGANUMA

PP-2A by okadaic acid or dinophysistoxin-1 in primary human fibroblasts (Yatsunami et al., 1991b). The hyperphosphorylated 58-kDa protein in the cell lysates specifically reacted with monoclonal and polyclonal anti-vimentin antibodies. In addition, in vitro phosphorylation of vimentin was enhanced dose-dependently by okadaic acid or dinophysistoxin-1 in the presence of PP-2A and protein kinases; that is, it reproduced the apparent “activation” of protein kinases in primary human fibroblasts by treatment with okadaic acid or dinophysistoxin-1 (Yatsunami et al., 1991b). Vimentin is one of the intermediate filaments, mainly found in various mesenchymal cells (Steinert and Roop, 1988). Various types of intermediate filaments can be hyperphosphorylated in various cells treated with okadaic acid. When human keratinocytes (PHK 16-1 cells), immortalized by human papilloma virus type 16 DNA (HPV 16 DNA), were treated with okadaic acid or dinophysistoxin- 1, six hyperphosphorylated proteins with molecular masses of 60, 58, 56, 52, 42, and 27 kDa were found. Immunoprecipitation and Western blot analysis revealed that the hyperphosphorylated proteins, except 27 kDa, were identified as cytokeratin peptides CK5, CK6, CK7, CK16, and CK19, respectively, and the 27-kDa protein was a heat-shock protein, HSP 27 (Yatsunami et al., 199313). Similar phosphorylation patterns in cytokeratins were not induced in human keratinocytes treated with TPA o r teleocidin. However, the phosphorylation of HSP 27 was induced by TPA or teleocidin. These results indicated that a greater number of target proteins are phosphorylated by the okadaic acid pathway than by the PKC pathway, and some proteins, such as HSP 27, are commonly phosphorylated by both pathways. Hyperphosphorylation of intermediate filaments is associated with morphological changes and is suggested to affect cell cycle regulation directly. In these experiments, the cells were treated with okadaic acid or dinophysistoxin-1 at concentrations of 10 to 100 nM, to obtain marked hyperphosphorylation and morphological changes. These concentrations are reasonable in view of the fact that the intracellular concentrations of PP-1 and PP-2A are often in the range 100 nM to 1 pA4 (Cohen et al., 1990). Therefore, we think the biochemical reaction and morphological changes caused by okadaic acid might be ongoing, to some extent, in the cells, at concentrations even lower than 100 nM. What protein kinases are involved in hyperphosphorylation of intermediate filaments is not well known. There are some reports that ~ 3 4 ‘ ~kinase ‘~ phosphorylates vimentin during mitosis (Chou et al., 1990) and that CAMP-dependent protein kinase, cyclic nucleotide-independent protein kinase, PKC, and Ca2 -calmodulin-dependent pro+

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

163

tein kinase I1 phosphorylate vimentin and cytokeratins (O’Connor et al., 1981; Gilmartin et ad., 1984; Huang et al., 1988; Tokui et al., 1990). We think the sites phosphorylated by these protein kinases are sustained by inhibition of PP-1 and PP-2A in the cells by treatment with okadaic acid. To summarize our understanding of the okadaic acid pathway: okadaic acid binds to PP-1 and PP-2A in the cell membrane; is incorporated into the cells; and inhibits activities in the cytosol and nuclei, resulting in an increase of phosphorylation of proteins, such as hyperphosphorylation of intermediate filaments in the cells. In the nuclei, okadaic acid causes sustained activation of gene expression, as well as hyperphosphorylation of suppressor gene products (Fujiki, 1992; Guy et al., 1992; Yatsunami et al., 1993a). H. DISTRIBUTION OF [3H]OKADAIC ACID On the basis of the evidence that okadaic acid causes diarrhetic shellfish poisoning, the effects of okadaic acid on rat intestinal epithelium were studied (Edebo et al., 1989). In this section, the preliminary results of [SH]okadaicacid distribution given by two different routes, PO and ip, are presented. Oral administration of [3H]okadaic acid (14 pCi/0.2 ml sesame oil) into the stomach of mice was achieved. Most of the radioactivity (>77%) was found in the contents of the gastrointestinal tract 3 hr after intubation. Nineteen hours later, 4% was found in the contents of the gastrointestinal tract and 30% was found in the feces. At 3 and 19 h r after intubation, 1% of the radioactivity was found in the liver. These results suggested that most of the [3H]okadaic acid remained in the gastrointestinal tract and some had interacted with cell membranes (R. Nishiwaki et al., unpublished results). The effects of ip administration of okadaic acid were first reported by Terao and associates (1986). They found that severe injury to the absorptive epithelium of the duodenum and upper part of the small intestine of suckling mice was induced within 15 min of administration of dinophysistoxin- 1. A visible increase in the permeability of the villial vessels of the small intestine, the presence of numerous vesicles in the cytoplasm of the epithelium, and marked destruction of the Golgi apparatus were observed (Terao et al., 1986). [3H]Okadaic acid (28 pCi/0.2 ml saline solution) was injected ip into mice. Most of the radioactivity (33.3%) was found in the contents of the gastrointestinal tract 3 hr after intubation and 5% was found 19 hr later. However, 27.4% of the radioactivity was found in the liver 3 hr after injection and 15.9% was found 19 hr after, suggesting that ip-administered [3H]okadaic acid was

164

HIROTA FUJIKI AND MASAMI SUGANUMA

excreted through hepatobiliary circulation (R. Nishiwaki et al., unpublished results). Intraperitoneal administration of 50 and 100 pg/kg okadaic acid into rats released glutamic pyruvic transaminase (GPT) from the liver into the blood serum, with 38 and 50 IU/liter 24 hr later, respectively, whereas that of the control saline released levels of 18 IU/Iiter. The results indicated that ip administration of okadaic acid has some effects on the liver (Ohta et al., manuscript in preparation). However, the main target tissue of okadaic acid administered by the two routes was the epithelium of the gastrointestinal tract, which contains high amounts of the okadaic acid receptors, as has been previously reported (Suganuma et al., 1989).

I. BIOCHEMICAL AND BIOLOGICAL EFFECTS Although okadaic acid has a simple mechanism of action, the okadaic acid pathway includes the discordant regulation of both protein kinases and protein phosphatases, resulting in induction of various biochemical and biological effects in various cell lines. This is called the pleiotropic effects of a tumor promoter. In this section, biochemical and biological effects related to tumor promotion, as well as unique properties induced by okadaic acid, are summarized briefly. Okadaic acid, at concentrations of 10 to 100 ng/ml (12.4 to 124 nM), stimulated prostaglandin E, production in rat peritoneal macrophages. T h e potency at a concentration of 12.4 nM was as strong as TPA at 16.2 nM, 20 hr after incubation. However, okadaic acid required a lag phase before stimulation. Since cycloheximide inhibited okadaic acid-induced release of radioactivity from [3H]arachidonicacid-labeled macrophages and prostaglandin E, production, protein synthesis was a prerequisite reaction for stimulation of arachidonic acid metabolism (Ohuchi et al., 1989). Okadaic acid induced angiogenesis in the chorioallantoic membrane of the chick embryo. T h e potency was one order of magnitude stronger than that of TPA. There was a difference between the time courses of angiogenesis induction by okadaic acid and TPA (Oikawa et al., 1992). Okadaic acid stimulated mouse macrophages to produce colony-stimulating factors (CSFs), which induced granulocyte macrophage colony-forming unit (CFU-GM) colony formation. However, okadaic acid inhibited the erythroid colony-forming unit (CFU-E) colony formation induced by erythropoietin (Oka et al., 1989). Although we now know that okadaic acid binds to the catalytic subunits of PP-1 and PP-2A, the interaction of okadaic acid with a lipid bilayer membrane was studied to obtain information on its incorporation into the target cells. Okadaic acid was not easily distributed into a

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

165

dipalmitoyl phosphatidylcholine membrane and did not significantly change the membrane structure. Okadaic acid freely permeated through the lipid membrane of multilayer vesicles in a liquid-crystalline state, supporting the evidence that okadaic acid gains access to receptors in the cytosol (Nam et al., 1990). Mammalian cells treated with okadaic acid at concentrations of 0.1 to 1 CLM showed the morphological characteristics accompanying apoptotic death: condensation of chromatin, shedding of cell contents through surface bleb formation, redistribution and compacting of cytoplasmic organelles, formation of cytoplasmic vacuoles, and hyperconvolution of the nuclear membrane. Okadaic acid showed internucleosomal DNA fragmentation in rat promyelocytic IPC-8 1 cells and neuroblastoma cells. However, the extent of DNA fragmentation was much less than that by CAMPat concentrations equipotent for inducing morphological apoptosis and cell death (Bge et al., 1991). In addition, okadaic acidtreated cells did not accumulate in early S-phase, but rather decreased the rate of transition from G, to S, indicating that okadaic acid inhibited DNA replication by regulatory influence rather than by direct DNA damage (Bge et al., 1991). However, okadaic acid inhibited apoptosis induced by either heat treatment or by ionizing radiation exposure to the human B-cell lymphoma cell line, and inhibited dephosphorylation of some proteins involved in apoptosis (Baxter and Lavin, 1992). Okadaic acid increased in vitro phosphorylation of the 100- and 30kDa proteins present in a cytosolic fraction of the mucosa of the rat Adenosine glandular stomach by in vitro incubation with [Y-~~PIATP. diphosphate (ADP) ribosylation by incubation with diphtheria toxin and [3*P]NAD revealed that the 100-kDa protein, which is ADP-ribosylated, is elongation factor-:! (EF-2) (Suganuma et al., 1992b). In addition to protein phosphatase, Ca2 -calmodulin-dependent protein kinase 111, which phosphorylates EF-2 specifically, was present in homogenated Ehrlich ascites tumor cells. Phosphorylation of EF-2, at defined stages of the cell cycle, in the presence and absence of okadaic acid showed that the highest protein kinase activity was found in cells from the early Sphase, whereas protein phosphatase activity was most pronounced during the G, plus M phases (Carlberg et al., 1991). Treatment of cells with okadaic acid increased phosphorylation of various proteins: the EGF receptor, in several cell types (HernandezSotomayor et al., 1991); nuclear proteins, such as a 43-kDa protein in mink lung CC1 64 cells (Kramer et al., 1991) and in human leukemia K562 cells (Zheng et al., 1991); histone H3 and a 33-kDa protein (pp33) in C3H/lOT1/2 mouse fibroblasts (Mahadevan et al., 1991); a progesterone receptor in the chicken oviduct (Denner et d., 1990); and the +

166

HIROTA FUJIKI AND MASAMI SUCANUMA

a-subunit of the inhibitory guanine nucleotide binding protein Gi2 (Bushfield et al., 1991). Some of the unique properties induced by okadaic acid are as follows: stimulation of glucose transport and 2-deoxyglucose uptake (Haystead et al., 1989; Tanti et al., 1991); insulin-mimetic action (Haystead et al., 1990); maturation and maturation promoting factor (MPF) formation in Xenopzls laevis oocytes (Goris et al., 1989); lymphocyte proliferation (Grove and Mastro, 1991); neurotoxicity against rat cerebellar neuron in primary cultures (Fernandez et al., 1991); increase of the amplitude of the synaptic response in the frog (Abdul-Ghani et al., 1991); differentiation of human breast tumor cells to the cells associated with mature phenotypes (Kiguchi et al., 1992); absence of inhibition of junctional communication in hamster embryo cells (Rivedal et al., 1990) and in BALB/3T3 cells and human and mouse keratinocytes (Katoh et al., 1990); and absence of induction of Epstein-Barr virus early antigen in Raji cells (S. Yoshizawa et al., unpublished results). J. GENEEXPRESSION AND TRANSCRIPTIONAL REGULATION

Since 1986, understanding of gene regulation by tumor promoters, such as TPA, has grown enormously (Rahmsdorf and Herrlich, 1990). Herschman and associates studied induction of mRNA of the TPAinduced-sequence (TIS) genes, which are rapidly and transiently induced by TPA, in C3H/lOT1/2 cells and Swiss 3T3 cells (Lim et al., 1987). They first reported that okadaic acid induced TIS 1 and TIS 8 mRNA expressions in the cells. Their maximum mRNA accumulations were found at 3 hr for okadaic acid and at 1 h r for TPA, indicating the presence of qualitative and quantitative differences between gene expressions by okadaic acid and TPA (Herschman et al., 1989). Kim and associates ( 1990) found that induction of collagenase gene expression by okadaic acid, like TPA, requires the AP-1 consensus sequence in the collagenase promoter. Okadaic acid induced transcription of the c-fos gene dramatically, and of the cjun gene to a lesser extent, both in human synoviocytes and in the human 'lung adenocarcinoma cell line A-549 (Kim et al., 1990). On the other hand, in Jurkat cells, it induced transcription of the c-jun gene dramatically and of the c-fos gene to a lesser extent (ThCvenin et al., 1991). Okadaic acid was a potent inducer of NF-KB in Jurkat cells. Treatment of the cells with okadaic acid resulted in the dissociation of NF-KB and a cytoplasmic inhibitor, IKB, within the cytoplasm. The NF-KB translocates to the nucleus, where it

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

167

recognizes an ll-bp DNA sequence that is present in the immunoglobulin K light chain enhancer (Sen and Baltimore, 1986; Atchison and Perry, 1987; Thkvenin et al., 1990). Okadaic acid inhibited myogenesis of mouse myoblast C2C12 cells by both extinguishing the expression of the myogenic determination gene MyoD 1 and inducing the expression of the inhibitor of the differentiation gene Id. MyoDl and Id expression required a prerequisite protein synthesis (Kim et al., 1992). Okadaic acid induced AP-1 binding activity in C2C12 cells. This is suggested to be one of the mechanisms by which okadaic acid regulates the expression of MyoDl negatively and inhibits myogenesis ( h r k et al., 1992). The expression of both early and secondary response genes to okadaic acid was studied in mouse skin. A topical application of okadaic acid induced expression of the c-fos gene, biphasic, 6 hr and 48 to 72 hr after treatment and of the c-jun gene, to a lesser extent, as early response genes. Okadaic acid also induced expression of secondary response genes, such as transin or stromelysin, and plasminogen activator-type urokinase (Holladay et al., 1992). In the study of mouse papilloma cell line 308, okadaic acid induced higher transcripts of c-fos and c-jun genes than an equimolar dose of TPA. It was apparent that their expression induced by okadaic acid continued over a longer period of time. Okadaic acid, like TPA, induced expression of the secondary response genes described above in cell line 308. These studies showed that okadaic acid and TPA affect gene expression in mouse keratinocytes through different pathways (Holladay et al., 1992). These results supported the previous evidence that disruption of the normal balance between members of the AP-1 complex induces malignant cell transformation (Schiitte et al., 1989). Recently, Bowden and associates identified a TPA-inactive mutated TPA response element, ,TGACTCC,, in the human collagenase promoter and named it the okadaic acid response element (ORE). The TPA response element (TRE) had already been identified as ,TGAGTCA,. The ORE is transactivated by both mouse c-jun A and cjun B. Both the consensus sequence of the ORE and possible new transcription factors that bind to the ORE are now under investigation (Levy et al., 1991, 1992). Similar studies have been pursued in various systems. Okadaic acid markedly potentiated the heat-induced expression of a human HSP 70 promoter linked to a CAT gene transfected into N-18 mouse neuroblastoma cells. Analysis using mutant constructs of the HSP 70 promoter revealed that the promoter activity by okadaic acid was not dependent on the heat shock-element, but on a new enhancer element (Huang et al., 1992).

168

HIROTA FUJIKI A N D MASAMI SUGANUMA

IV. Calyculins A. STRUCTURE A N D BIOCHEMICAL ACTIVITY Calyculin A was isolated from a marine sponge, Discodermia calyx, and was a strong inhibitor of starfish development and a strong toxic conipound against L 1210 leukemia cells (Kato et al., 1986). Karaki and associates reported that calyculin A induced contraction of intact and skinned fibers (Ishihara et al., 1989b). Its structure contains an octamethyl-polyhydroxylated C28 fatty acid that is linked to two y-amino acids and esterified by phosphoric acid (Fig. 1). Seven calyculins, B to H, were additionally isolated from the same sponge and their structures were elucidated (Fig. 9) (Kato et al., 1988; Matsunaga et al., 1991). Recently, Matsunaga and Fusetani (1991) determined the absolute stereochemistry of the calyculin molecules. Our first evidence was that calyculin A, provided by Fusetani, bound to the okadaic acid receptors in particulate and cytosolic fractions of mouse skin, although its structure was unrelated to that of okadaic acid (Table V) (Fujiki et al., 1989a, 1991; Suganuma et al., 1989, 1990). As reported in Section 11, B, calyculin A is a potent inhibitor of PP-1 and PP-PA. Distinct from okadaic acid, calyculin A was found equally effective against PP-1 and PP-2A (Ishihara et al., 1989a; Suganuma el al., 1990, 1992a). T h e effective doses for 50% inhibition of specific [3H]okadaic acid binding by calyculins A through H ranged from 2.5 to 9.9 nM, and their IC,, values toward PP-1 and PP-2A in the cytosolic fraction of mouse brain ranged from 0.6 to 7.5 nM and from 2.6 to 14.0 nM, respectively (Table V). Since their potencies were all within a similar range, the seven additional calyculins, B to H, like calyculin A, might be also tumor promoters on mouse skin, indicating that the geometrics of the tetraene portion and the presence or absence of a methyl group on C-32 did not have any effects on activity (Matsunaga et al., 1991). In addition, decahydrocalyculin A isomers, which are hydrogenated derivatives of calyculin A, retained the activity. Calyculin A acetonide, an isopropylidene derivative formed of the hydroxyl groups between C-1 1 and C-13, was chemically synthesized by treatment of calyculin A with 2,2-dimethoxypropane, and its IC,, value indicating I, that these two hydroxyl groups toward PP-2A was > 1 @ were involved in the activity (S. Matsunaga, unpublished results). Calyculin A inhibited specific [%H]okadaicacid binding to particulate and cytosolic fractions of mouse skin, dose-dependently (Fig. 10). T h e binding affinities of calyculin A to the receptors in both fractions were compared with those of okadaic acid. T h e effective doses for 50% inhibition (1C5,) to the receptors in the particulate fraction were 2.5 nM for calyculin A and 45 nM for okadaic acid. However, the IC,,, to the

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

Calyculin Calyculin Calyculin Calyculin

A B C D

Rl CN H CN H

Calyculin Calyculin Calyculin Calyculin

E F G H

CN H CN H

R1

Rz H CN H CN

R2

H CN H CN

169

R3

H H CH3 CH3

R3

H H CH3 CH3

FIG.9. Structures of calyculins A, B, C, D,E, F, G , and H.

receptors in the cytosolic fraction were 2.8 nM for both calyculin A and okadaic acid. That is, calyculin A showed a binding affinity to the particulate fraction about 10 times stronger than okadaic acid, whereas calyculin A showed the same affinity to the cytosolic fraction as okadaic acid (Suganuma et al., 1990). T h e binding of calyculin A and of okadaic acid to the cytosolic fraction were in agreement with the results of

170

HIROTA FUJIKI A N D MASAMI SUCANUMA

TABLE V BIOCHEMICAL ACTIVITIES OF CALYCULINS A TO H

Compounds Calyculin A B C D E F G H

Inhibition of specific ISHIokadaic acid binding [IC5o

Inhibition of PP-1 I1C50 (&)I

Inhibition of PP-2A [ G o (&)I

1.4 1 .0 0.6 4.0 I .4 1.4 6.4 7.5

2.6 3.6 2.8 4.8 5.2 4.8 8.5 14.0

2.5 4.6 3.7 9.9 6.0 6.0 9.0 9.6

inhibition of PP-2A present in the fraction of the cytosolic fraction of mouse brain eluted with 0.2 M NaCl on DEAE-cellulose column chromatography. That is, the dose-dependent inhibitory curve of calyculin A toward PP-2A in the cytosolic fraction was similar to that of okadaic acid (Fig. 10) (Suganuma et al., 1990).These results raised a question about which binding affinity (toeither the particulate or the cytosolic fraction) is correlated with the tumor-promoting activity of calyculin A on mouse skin. B. TUMOR PROMOTION ON MOUSESKIN The tumor-promoting activity of calyculin A was studied at two doses, 0.1 pg (0.1 nmol) and 1 pg (1 nmol) per application, according to the same experimental procedures of the two-stage carcinogenesis experiment. Table VI summarizes the results of the two groups treated with DMBA plus calyculin A compared with those of the group treated with DMBA plus okadaic acid. Calyculin A showed as strong a tumor-promoting activity as okadaic acid at an equimolar dose. Thus, the binding affinities of calyculin A and okadaic acid to the receptors in the cytosolic fraction were well correlated with their tumor-promoting activities, and the inhibition by calyculin A of protein phosphatases in the cytosolic fraction of mouse brain and skin well reflected a tumor-promoting activity. As Table I11 shows, DNA isolated from tumors of the group treated with DMBA plus calyculin A had a mutation at the second nucleotide of codon 61 in the c-Ha-ras gene, similar to that of the tumors of the group

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

I

17 1

Particulate

I

Cytosolic

I

PP-2A

I

Concentration ( n M 1

FIG. 10. Inhibition of specific [3HH]okadaicacid binding to particulate or cytosolic fractions of mouse skin and inhibition of PP-2A by calyculin A (0)and okadaic acid (0).

treated with DMBA plus okadaic acid (Fujiki el al., 1989d). Like okadaic acid, various concentrations of calyculin A increased phosphorylation of vimentin in primary human fibroblasts (Fig. 8) and in mouse embryo fibroblasts BALB/3T3 (Chartier et al., 1991) and BHK cells (Eriksson et al., 1992), and of cytokeratins of various molecular weights in human karatinocytes transfected with HPV 16 DNA (Section 111, G). Therefore, calyculin A and okadaic acid showed the same effects on human

172

HIROTA FUJIKI AND MASAMI S U G A N U M A

TABLE VI TUMOR-PROMOTING AcrIvITY OF CALYCULIN A COMPARED WITH THAT OF OKADAlC ACID Amounts per application (nmol)

% of tumorbearing mice in Week 30

Average No. of tumors per mouse in Week 30

Calyculin A

0.1 1.o

Okadaic acid

1.2

13.3 86.7 80.0

0. I 4.3 7.2

Tumor promoters

Note. The groups treated with DMBA alone, calyculin A alone, or okadaic acid alone did not produce any tumors.

keratinocytes, as well as on mouse skin, with similar potencies. If the binding affinity to the particulate fraction reflects the binding to PP- 1 and that to the cytosolic fraction reflects that to PP-BA, based on the relative potencies of calyculin A and okadaic acid against PP-1 and PP-'LA, the inhibition of PP-PA in the cytosolic fraction rather than that of PP-1 in the particulate fraction seems to be an essential biochemical reaction for tumor promotion (Suganuma et al., 1990; Fujiki et al., 1992).

V. Microcystins and Nodularin A. STRUCTURE A N D BIOCHEMICAL ACTIVITY In 1987, three microcystins, microcystin-LR, -YR and -RR, were provided to us by two Japanese scientists so that we could study the biochemical mechanisms of action (Harada et al., 1988; Watanabe et al., 1988). Microcystins, isolated from colonial and filamentous algae, cyanobacteria, Macrocystis aeruginosa, M. viridis, Anabena jos-aquae, and Oscillatoria agardhii (Carmichael and Mahmood, 1984), attracted our attention for two main reasons: potent hepatotoxicity and unique structure. Toxic blue-green algae containing the microcyst ins pose an increasing environmental hazard in several areas of the world, because death of cattle and liver damage to humans have been caused by drinking water containing the algae. Structurally, the microcystins are cyclic heptapeptides containing two variable L amino acids and an unusual amino acid, E), 6(E)-dienoic 3-amino-9-methoxy- 1O-phenyl-2,6,8-trimethyl-deca-4( acid (Adda) (Botes el al., 1984; Rinehart et al., 1988). T h e microcystins differ primarily in the two variable amino acids and their nomenclature is based on these two L amino acids (Carmichael et al., 1988a). Microcystin-LR contains leucine and arginine in the variable positions (Fig. 1 1).

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

173

Microcystin-YR and -RR contain tyrosine and arginine, instead of the leucine in microcystin-LR. Although the structures of 42 microcystins have been determined to date, all these microcystins commonly contain the Adda molecule, which is necessary for activity. Geometrical isomers at C-7 in the Adda molecule of microcystin-LR and -RR,named 6(Z)-Adda microcystin-LR and -RR, have been isolated as minor components, with maternal microcystin-LR and -RR,from samples containinghficrocystlsspecies (Fig. 1 1) (Harada et al., 1990a,b). Namikoshi and associates (1992) have identified nine new microcystins. R

\

ClU

Mdha

Microcyst in- LR

G(Z)-Adda Microcystin-LR

/

,/-

Am

i

I

1

I . .

lrCY

Nodularin FIG. I 1. Structures of microcystin-LR, 6(Z)-Adda microcystin-LR and nodularin. Microcystin-LR contains two L amino acids, leucine and arginine; two D amino acids, alanine and glutamic acid; erythro-P-methylaspartic acid (Masp); methyldehydroalanine (Mdha); and 3-amino-9-methoxy-1 O-phenyl-2,6,8-trimethyl-deca-4,6-dienoic acid (Adda).

174

HIROTA FUJIKI A N D MASAMI SUGANUMA

Nodularin was isolated from the toxic brackish-water cyanobacterium Nodularia splmigena (Carmichael et al., 198813; Rinehart et al., 1988) and has a cyclic pentapeptide, which contains Adda but lacks one of the L and D amino acids found in the microcystins (Fig. 11). When we first looked at the structure of the microcystins, it was apparent that the cyclic structure of heptapeptides was roughly similar to the flexible cavity of okadaic acid (Fig. 7). Without any further evidence, we subjected microcystin-LR, -YR, and -RR to the test of okadaic acid receptor binding. These three microcystins dose-dependently inhibited specific [3H]okadaicacid binding to the cytosolic fraction of mouse liver. As Table VII shows, the IC,, values of 50% inhibition were between 1.3 and 2.7 nM for the three microcystins and 3.2 nM for okadaic acid. Nodularin also inhibited specific [SH]okadaicacid binding to the cytosolic fraction of mouse liver with an IC,, of 2.3 nM. Three microcystins and nodularin also dose-dependently inhibited specific [SH]okadaicacid binding to the particulate fraction of mouse liver. Thus, the microcystins and nodularin bound to the okadaic acid receptors, although their structures are not related to that of okadaic acid (Yoshizawa et al., 1990). Microcystin-LR, -YR, and -RR and nodularin inhibited dose-dependently PP-2A, which had been partially purified from a cytosolic fraction of mouse liver on DEAE-cellulose column chromatography. As Table VII shows, the IC,, values were between 1.4 and 3.4 nM for the microcystins, and 0.7 nM for nodularin. The well-known hepatotoxic compounds a-amanitin and phalloidin did not show any inhibitory effects on protein phosphatases similar to those of the microcystins and nodularin. TABLE VII BIOCHEMICAL EFFECTS OF THREE MICROCYSTINS A N D NODULARIN COMPARED WITH THOSE OF OKADAIC ACIDAND THE HEPATOTOXIC COMPOUNDS

Compounds

Inhibition of specific [sH]okadaic acid binding [Ic50 ( d ) 1

Inhibition of protein phosphatase activity [IC5O (nM)l

Increase of protein phosphorylation IED50a

microcyst in-LR Microcystin-YR Microcystin-RR Nodularin Okadaic acid a-Amanitin Phalloidin

1.3 2.7 2.0 2.3 3.2 > 10,000 > 10,000

1.6 1.4 3.4 0.7 1.2 > 10,000 > 10,000

2.5 1.3 3.4 1.2 2.5 > 10.000 > 10.000

The concentration causing 50% of maximal activation

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

175

These results indicated that the hepatotoxicity of the microcystins and nodularin is induced by the okadaic pathway. We presented the results with the microcystins and nodularin at the 1988 Gordon Conference on Marine Natural Products (Yoshizawa et al., 1990). Similar results using purified catalytic subunits of PP-1 and PP-2A were presented later (Honkanen et al., 1990, 1991; Mackintosh et al., 1990). It is important to note that microcystin-LR is the most potent inhibitor of PP-1 as well as PP-2A, compared with okadaic acid, calyculin A, and tautomycin (Table I) (Suganuma et al., 1992a). Based on this significant property, microcystin-LR affinity chromatography was developed to purify PP-2A as a holoenzyme. This chromatography was not suitable for PP- 1, however, and okadaic acid affinity chromatography did not give us good purification of protein phosphatases (Nishiwaki et al., 1991). Since the microcystins and nodularin inhibited PP-1 and PP-2A in the cytosolic fraction of mouse liver, these compounds also increased the incorporation of 32P into histone H 1, referred to as the apparent “activation” of protein kinases by okadaic acid, during in vitro incubation with [Y-~~PIATP, protein kinases, and PP-2A (Sassa et al., 1989). T h e ED,, values for the increase of protein phosphorylation were between 1.3 and 3.4 nM for the three microcystins and 1.2 nM for nodularin (Table VII). That is, the microcystins and nodularin showed the same biochemical activities as did okadaic acid, with similar specific activities (Yoshizawa et al., 1990). (22.7 Ci/mmol), Using a newly synthesized [3H]dihydr~micr~cy~tin-LR the specific binding of the cytosolic and particulate fractions of rat liver was studied. The K , value was 0.03 nM for receptors in the cytosolic fraction and 0.4 nM for those in the particulate fraction. Specific [3H]dihydromicrocystin-LR binding to the cytosolic fraction was inhibited by microcystin-LR and -RR. As Fig. 12 shows, the IC,,, values of microcystin-LR and -RR were 0.38 and 0.42 nM, respectively. 6(Z)-Adda microcystin-LR and -RR inhibited binding 100 times more weakly than their maternal microcystins. T h e IC,, values were 32 and 52 nM for both 6(Z)-Adda microcystin-LR and -RR (R. Nishiwaki et al., manuscript in preparation). Next, inhibitory potencies of the two 6(Z)-Adda microcystins toward PP-2A in the cytosolic fraction of mouse brain were compared with those of their maternal compounds. The IC,, values of microcystin-LR and -RR were 0.28 and 0.78 nM, respectively, whereas those of 6(Z)-Adda microcystin-LR and -RR were both 80 nM. Intraperitoneal administration of the maternal microcystins into rats rapidly released GPT from the liver into blood serum. T h e amounts of 50 Fg/kg microcystin-LR and -RR released levels of GPT similar to those of 500 pg/kg 6(Z)-Adda microcystin-LR and -RR, within 24 hr after

176

HIROTA FUJIKI A N D MASAMI SUGANUMA

a

I 1 00

50

i

E

B

0

-

v)

lo-'

10 0

1 02

104

Concentration ( nM 1

FIG. 12. Inhibition of specific [3H]dihydromicrocystin-LR binding to cytosolic fraction of rat liver by microcystin-LR (0) and -RR (A) and G(Z)-Adda microcystin-LR (0)and -RR (A).

administration (Nishiwaki-Matsushima et al., 199l), indicating that the conjugated diene with 4(E),6(E) geometry in the Adda molecule is important for the interaction with PP-1 and PP-2A.

B. TARGET TISSUE Our first evidence showed that the microcystins and nodularin did not induce hyperphosphorylation of vimentin in primary human fibroblasts, whereas other protein phosphatase inhibitors, okadaic acid and calyculin A, did. Moreover, the microcystins and nodularin, which in vitro bind to the okadaic acid receptors in the cell membrane, did not induce ODC in mouse skin. These results suggested that the microcystins and nodularin have difficulty penetrating the cells. In a test, we utilized as a parameter the evidence that okadaic acid at a concentration of 0.1 pbf induced morphological changes of primary human fibroblasts, from a spindle-like to a round form within 2 hr of incubation, whereas microcystin-YR did not, at concentrations up to 9.6 p M . On the basis of our understanding that the morphological changes were induced by the inhibition of PP-1 and PP-2A by okadaic acid in primary human fibroblasts, we microinjected a microcystin-YR solution at a concentration of 670 pbf into about 50 fibroblasts. All of the injected cells caused morphological changes from a spindle-like to a round form, 45 min after injection, whereas noninjected cells did not show any morphological changes. It was noteworthy that morphological changes in-

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

177

duced by injection of microcystin-YR were similar to those induced by incubation with okadaic acid. These results support our idea that the microcystins and nodularin proceed along the okadaic acid pathway in the cells after microinjection, whereas okadaic acid can penetrate readily the cells (Matsushima et al., 1990). Since the microcystins and nodularin are hepatotoxic compounds, we studied whether microcystin-YR could enter rat primary-cultured hepatocytes and also cause morphological changes of the cells. Treatment with microcystin-YR at a concentration of 9.6 pA4 induced morphological changes of primary hepatocytes from the normal round form to fused cells within 2 hr of incubation. Similar changes were also induced by okadaic acid at a concentration of 1.2 pM. These results indicated that microcystin-YR was about eight times less effective than okadaic acid in its action on rat hepatocytes. Microcystin-YR and -LR and nodularin induced hyperphosphorylation of proteins of various molecular weights as the result of inhibition of PP-1 and PP-2A, as did okadaic acid (Yoshizawa et al., 1990). Recently, the main hyperphosphorylated proteins in rat primary-cultured hepatocytes were identified to be cytokeratins 8 and 18, one type of intermediate filament (Ohta et al., 1992). Microcystin-LR, 7-desmethyl-microcystin-RR, and nodularin increased the level of protein phosphorylation in hepatocytes and induced changes in morphology and in the cytoskeleton of hepatocytes (Eriksson et al., 1990a). These results indicated that the microcystins and nodularin can penetrate the liver cells. Livestock deaths due to ingestion of algae are well documented (Francis, 1878; Beasley et al., 1983; Botes et al., 1984; Carmichael, 1988). T h e evidence shows that the microcystins contained in the algae can reach the liver from the digestive tract. Although we have not yet obtained results with po-administered [3H]dihydromicrocystin-LR, the ip administration of [3H]dihydromicrocystin-LR (1 1.4 pCi/0.2 ml saline solution) into mice has been studied. The radioactivity in the liver increased continuously from 5 min to 1 hr after injection, and was 82% 1 hr after. T h e second order of radioactivity, 4% of the radioactivity, at 5 min, was found in the lower small intestine and declined to 0.5% after 1 hr, suggesting that the toxin had adhered to the small intestine before absorption (Ohta et al., manuscript in preparation; Robinson et al., 1989). Eriksson and associates ( 1990b) reported the preferential uptake of the toxin by the multispecific bile acid transport system across the ileum and into the hepatocytes. T h e study of tissue distribution by iv-administered [3H]microcystin-LR into mice revealed long-term hepatic retention of radiolabeling associated with cytosolic components, 85 5 % at Day 1

*

178

HIROTA FUJIKI A N D MASAMI SUGANUMA

and 42 2 11% at Day 6 after injection (Robinson et al., 1991). These results suggest that the target tissue of the microcystins is the liver, in which microcystins are accumulated. PROMOTION IN THE LIVER C. TUMOR The microcystins and nodularin have a unique liver organotrophy. Tumor promotion of microcystin-LR was shown in rat liver with diethylnitrosamine (DEN) and was followed by a partial hepatectomy at the end of third week of the experiment. The doses used for the experiment were below the acute toxicity level. Repeated ip injections of microcystin-LR induced a significant increase of both parameters: increase in numbers and percentage areas of positive foci of glutathione S-transferase placental form (GST-P) in rat liver (Table VIII). In a separate experiment, 0.05% phenobarbital in the diet induced 38.1 & 10.9 foci/cm2 and 1.09 0.5% area of foci. Thus, microcystin-LR is one of the strongest liver tumor promoters found to date (Nishiwaki-Matsushima et al., 1992b). We think that microcystin-LR has a tumor-promoting activity in rat liver, because only a few foci were observed in initiated rats. In the present experiment, no detectable mutation was found in codon 61 of the c-Ha-ras gene in DNA isolated from rat livers of the group treated with DEN plus microcystin-LR. T h e tumor-promoting activity of microcystin-LR may involve human liver cancer through drinking water supplies. Yu (1989) reported that the incidence of primary liver cancer in Qidong County, People’s Republic of China, where people drink pond and ditch water, was about eight times higher than that in populations who drink well water. T h e water of the ponds and ditches of Qidong County is contaminated by

*

TABLE VIII TUMOR-PROMOTING ACTIVITY OF MICROCYSTIN-LR Microcystin-LR Positive foci of GST-P

( P g w

Partial hepatectomy Initiator

Before

After

+ + + +

10 10 10

-

-

10

10 25 50 50

No. of focilliver (No./cm2)

Area of foci

13.4 f 4.2 17.4 2 3.8 32.7 + 11.1 44.4 2 10.3 0.4 f 0.3

2.7 f 3.1 1.9 f 0.5 6.8 f 3.8 29.6 f 12.9 0.1 f 0.2

(%)

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

179

blue-green algae, which produce microcystins (W. W.Carmichael, personal communication). It was reported that the microcystins are not affected by normal chlorination, flocculation, and filtration procedures used by water treatment facilities (Krishnamurthy et al., 1989). Epidemiological study of primary liver cancer in relation to exposure to the microcystins is anticipated. Similar concerns about how serious this threat may be to the human population are becoming global in scope, including countries such as Australia (Falconer et al., 1983), Norway (Skulberg etal., 1984), and the United States (Billing, 1981; Beasley et al., 1989).

D. MOLECULAR MODELING T h e microcystins and nodularin showed specific binding to the okadaic acid receptors, inhibition of PP- 1 and PP-2A and hepatotoxicity, with similar specific activities. Therefore, we think that the microcystins and nodularin have similar specific molecular interaction with PP-1 and PP-2A due to a similar conformation in some parts of their molecules. The recent results with computer models of the three-dimensional structures of microcystin-LR and nodularin showed that their peptide rings formed an angle of 90" to each other, when Adda in both microcystin-LR and nodularin were fitted together (Lanaras et al., 1991). It was difficult to explain from these results, however, the similar potencies of microcystin-LR and nodularin. Computer graphic analyses by Quinn and associates indicated a different conclusion and provided a rationalization for receptor binding properties for the microcystins and nodularin. The lower energy values and the three-dimensional similarity of these compounds suggest that they are more reasonable computer models than those previously reported (Taylor et al., 1992). Figure 13 depicts the optimized structures of microcystin-LR and nodularin showing the planarity of both peptide rings and the relative spatial alignments of the Adda and arginine side chains. Rigid superimposition of the two molecules defined the microcystin-LR and nodularin model (Fig. 13) (Taylor et al., 1992). T h e structures of microcystin-LR and nodularin have arginine and Adda in common. To determine the relative importance of the arginine residue to biochemical activity, microcystin-LA, which contains alanine, rather than arginine, as in microcystin-LR, was tested. T h e IC,, values toward PP-1 in the cytosolic fraction of mouse brain were 0.90 and 0.44 nM for microcystin-LA and -LR, and those toward PP-2A in the cytosolic fraction of mouse brain were 0.38 and 0.32 nM, respectively. They also

180

HIROTA FUJIKI AND MASAMI SUGANUMA

Microcystin-LR

Nodularin

Superimposition FIG. 13. Three-dimensional structures of rnicrocystin-LR and nodularin and their superimposition.

inhibited specific ["Iokadaic acid binding to both PP-1 and PP-PA in the cytosolic fraction of mouse brain with similar IC,, values. These results showed that the arginine residue does not significantly interact with the enzymes and can be substituted by other amino acids without loss of activity (Nishiwaki-Matsushima et al., 1992a). It had already been reported that Adda is essential for activity (Rinehart et al., 1988). As w e previously reported, 6(Z)-Adda microcystins showed 100 times weaker activity than the maternal 6(E)-Adda microcystins (Nishiwaki-Matsushima et al., 1991). Computer models of the three-dimensional structures of microcystinLR and nodularin should be further extended to the three other types of the okadaic acid class compounds. Quinn and associates (1993) are now investigating molecular modeling that allows common regions of okadaic acid, calyculin A, and microcystin-LR to be recognized. Preliminary results meet well with our findings that the F and G rings of the okadaic acid molecule are located outside of the functional group. Computer-assisted molecular modeling will provide us with important information about functional parts of the okadaic acid class compounds.

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

181

VI. Tautomycin A. STRUCTURE AND BIOCHEMICAL ACTIVITY Tautomycin was isolated from Streptomyces spiroverticillutus as an antibiotic (Fig. 1) and is toxic to various cells, including fungi, yeast, and animal cells (Cheng et al., 1987). Tautomycin induced bleb formation on the surface of human chronic leukemia K562 cells and slightly enhanced protein phosphorylation through activation of PKC in vitro, although it did not bind to the phorbol ester receptor in K562 cells (Magae et al., 1988). In 1987, Isono provided us with tautomycin, one part containing a six-membered spiroketal moiety that is similar to some parts of the okadaic acid molecule, and the other part being similar to aplysiatoxin, one of the TPA-type tumor promoters. Following up on his unique observation, we subjected tautomycin to the two tests, activation of PKC in vitro and specific binding to the okadaic acid receptors. We soon obtained conclusive results; that is, tautomycin did not directly activate PKC in vitro, but inhibited specific [3H]okadaic acid binding to the particulate fraction of mouse skin. Thus, tautomycin was further subjected to inhibition of PP-1 and PP-PA in the cytosolic fraction of mouse brain. T h e results revealed that tautomycin is an additional okadaic acid class compound. T h e activity of tautomycin was compared with that of okadaic acid: the IC,, values of specific [3H]okadaic acid binding to a particulate fraction of mouse skin were 180 nM for tautomycin and 59 nh4 for okadaic acid. T h e IC,, values for tautomycin and okadaic acid toward PP-1 in the cytosolic fraction of mouse brain were 2.2 and 45 nM, and toward PP-2A were 1.8 and 0.5 nM, respectively (S. Nishiwaki et al., unpublished results). As described in Table I, tautomycin inhibited activity of the catalytic subunits of PP-1 and PP-2A with IC,, values of 0.7 and 0.65 nM, respectively (Suganuma et al., 1992a). Similar results with tautomycin were reported by various research groups (Mackintosh and Klumpp, 1990; Hori et ul., 1991). One of the reasons tautomycin is weaker than okadaic acid might be its 2,3-dialkylmaleic anhydride structure, which is in equilibrium with an open ring dicarboxylic acid in neutral solution (K. Isono, personal communication). Tautomycin induced hyperphosphorylation of cytokeratins in human keratinocytes, with one-tenth the potency of okadaic acid (unpublished results). Tautomycin also enhanced protein phosphorylation of 15 and 25-kDa in K562 cells. Since the phosphorylation of these two proteins was also enhanced by okadaic acid and dinophysistoxin- 1, but not by okadaic acid tetramethyl ether, we thought it might be the so-called apparent “activation” of protein kinases due to inhibition of PP-1 and

182

HIROTA FUJIKI AND MASAMI SUGANUMA

PP-2A (Magae et al., 1990). Furthermore, tautomycin and okadaic acid were shown to share the same biochemical and biological activities in vitro and in vivo, suggesting that tautomycin might also be a tumor promoter of the okadaic acid class in mouse skin or other organs. B. ABSENCE OF TUMOR PROMOTION ON MOUSESKIN Tumor promotion of tautomycin was tested in a two-stage carcinogenesis experiment on mouse skin following our standard experimental procedure. Initiation was achieved by a single application of 100 pg DMBA. T h e dose of tautomycin to be used per application was carefully considered before tumor promotion was started. We had learned from the study of calyculin A that its potency to inhibit PP-2A in the cytosolic fraction correlates more significantly with tumor-promoting activity than that to inhibit PP-1. Thus, because the relative potency of tautomycin toward PP-2A was about 10 times weaker than that of okadaic acid, 30 pg (36 nmol) of tautomycin per application was the chosen dose, compared with 1 pg (1.2 nmol) of okadaic acid. The group treated with DMBA plus tautomycin did not produce any tumors on mouse skin up to Week 30, the same as in the two control groups, treated with DMBA alone or tautomycin alone. (H. Fujiki, et al., unpublished results). If tautomycin, like okadaic acid, acts on PP-2A in the cells of mouse skin, tautomycin, based on its specific activity, would have shown tumor-promoting activity. We attributed the absence of tumor-promoting activity to the chemical nature of tautomycin; it is probable that the difficulty in penetrating the basal cell layer of mouse skin is due to the polarity of the tautomycin molecule. In contrast to okadaic acid and calyculin A, tautomycin was not an irritant and not able to induce ODC in mouse skin. The absence of irritancy also indicates that tautomycin is unable to reach the basal cell layer through the corneum and does not penetrate the cells of mouse skin. This was further supported by the absence of ODC induction and tumor promotion in mouse skin. C. EFFECTS ON DIGESTIVE TRACT

As microcystin-LR showed tumor promotion in the liver, tautomycin was expected to be a tumor promoter in tissues other than mouse skin. To find these other target tissues, a solution of tautomycin was passed to the stomach through intubation. Surprisingly, 4 hr after intubation, tautomycin induced ODC induction in the glandular stomach to an extent similar that of okadaic acid, but at higher doses (data not shown).

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

183

Recently, Tatematsu and associates demonstrated that a single administration of tautomycin into the stomach of rat induced enhanced incorporation of 5-bromodeoxyuridine (BrdU) in DNA of the cells in the stomach, small intestine, and colon, suggesting induction of cell proliferation (M. Tatematsu et al., manuscript in preparation). A two-stage carcinogenesis experiment on tautomycin is ongoing in the rat glandular stomach, and a tumor-promoting activity is anticipated. Our recent understanding of ODC induction should be briefly discussed. Ornithine decarboxylase induction is partly regulated through TRE in the ODC gene, when PP-1 and PP-2A in the cytosolic fraction are inhibited in the cells. It was previously reported that ODC induction was strongly induced by TPA-type tumor promoters (OBrien et al., 1975), and its induction was strongly inhibited by pretreatment with retinoic acid, and this was well correlated with inhibition of tumor promotion (Verma and Boutwell, 1977). In this regard, ODC induction was thought to be a significant biochemical activity in tumor promotion as a rate-limiting enzyme for polyamine biosynthesis, followed by cell proliferation. However, study of the okadaic acid class compounds provided ODC induction with an additionally significant indication; that is, ODC induction is an important parameter of tumor promotion that signal transduction has occurred at the gene level. To summarize our results, signal transduction from tautomycin takes place in the glandular stomach, but not in mouse skin, whereas, with okadaic acid, signal transduction is found in both the glandular stomach and mouse skin. As discussed previously, okadaic acid induced ODC about 10 times less strongly than TPA, with a similar time course, whereas their tumorpromoting activities were almost the same. Although potency has not been directly correlated to tumor-promoting activity, ODC induction has become a significant biochemical parameter in estimating stimulation of gene expression, indicating the presence of signal transduction for tumor promotion in the responsive gene (Suganuma et al., 1992b). VII. Hypotheses in Relation to Human Cancer By using tumor promoters of the okadaic acid class as chemical probes, we identified a general biochemical mechanism of tumor promotion applicable to various organs. How the okadaic acid pathway is related to human cancer should be considered from at least three aspects (Fig. 14). The first possibility is from exposure to the okadaic acid class compounds. The second is that the okadaic acid pathway might possibly be pursued by endogeneous protein inhibitors. The third is that the effects of the okadaic acid pathway can be mimicked, in part, by t w o

184

HIROTA FUJIKI A N D MASAMI SUGANUMA

87gpPhosphorylation

Function

Inactive

8

8

Transformation

+

Protein

Gene

Mutatio:

I ,

Inactive

+

FIG. 14. Schematic illustration of inactivation of suppressor function by the okadaic acid pathway compared with genetic changes of a suppressor gene.

major monocyte/macrophage-derived lymphokines, interleukin 1 (IL1) and tumor necrosis factor (TNF). 1. Okadaic acid and dinophysistoxin- 1 are tumor promoters in the rat glandular stomach and are also causative agents of diarrhetic shellfish poisoning in humans. These compounds accumulate in the hepatopancreas of mussels and shellfish (Yasumoto, 1990). Consumption of these organisms causes diarrhetic shellfish poisoning, which has been reported in several countries, such as Japan, Chile, Norway, T h e Netherlands, and Spain. In Japan, government regulation sets the maximum allowable levels of toxins in shellfish meat at 0.05 mouse unit/g meat, which corresponds to 0.16 pg okadaic acid/g meat. Thus, it is possible for humans to avoid acute toxicity of okadaic acid and dinophysistoxin- 1. T h e evidence of chronic exposure to okadaic acid and dinophysistoxin- 1 has not been well documented. Chronic exposure to the microcystins or nodularin through drinking water supplies seems to be linked to high incidences of human primary liver cancer. Yu (1989) described that the incidence of human primary liver cancer decreased after the source of water was changed from ditch water to well water in Qidong County, People’s Republic of China; so intake of microcystins might be correlated with development of human liver cancer. Epidemiological investigation of the relationship between the ingested amounts of toxin and incidences of human liver cancer becomes increasingly important. Continuous exposure to the potent liver tumor

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

185

promoters present in drinking water supplies possibly promotes human liver cancer, initiated by aflatoxin, in certain areas. Protectionary measures based on the scientific studies are needed. 2. As for the second possibility, it should be noted that there are endogenous protein inhibitors of PP-1, called inhibitors-l and -2, in the cells (Cohen, 1989). Inhibitor-1, an 18-kDa protein, is activated by CAMP-dependent protein kinase and inhibitor-2, a 22-kDa protein, is an active form without any phosphorylation necessary. Based on molar ratios, the inhibitory activity of inhibitor-2 toward PP-1 was as strong as that of okadaic acid, but inhibitor-2 was not effective on PP-2A (S. Nishiwaki et al., unpublished results). The level of inhibitor-:, is reported to oscillate during the cell cycle, peaking at the S phase and during mitosis in rat fibroblasts (Brautigan et al., 1990). Whether the levels of inhibitors-l and -2 are deregulated in the developmental process of cancer cells remains to be investigated. One particularly striking finding was that a regulatory subunit and the catalytic subunit of PP-2A form stable complexes with the simian virus 40 small T antigen and the small and middle T antigens of polyoma virus (Pallas et al., 1990; Walter et al., 1990). In the stable complexes, the small T antigen acted as an inhibitor of PP-PA, resulting in hyperphosphorylation of p53 and large T antigen, which are both inactive forms (Scheidtmann et al., 1991). The small T antigen also inhibited dephosphorylation of the Rb protein. It is accepted that inactivation of the suppressor function can be caused by hyperphosphorylation of suppressor gene products; both p53 and the Rb protein are phosphorylated by p34'dC2, the cell division cycle protein kinase. This protein kinase is also involved in phosphorylation of vimentin (Chou et al., 1990), the dephosphorylation of which was inhibited by okadaic acid and calyculin A, as reported previously (Yatsunami et al., 1991b). We recently demonstrated that treatment of primary human fibroblasts with okadaic acid induced hyperphosphorylation of p53 and the Rb protein dose-dependently (Yatsunami et al., 1993a). How a protein similar to the small T antigen is constitutively expressed in the cancer cells remains to be clarified. 3. Okadaic acid and I L 1 stimulated the steady-state levels of collagenase transcripts in human synoviocytes through different mechanisms (Postlethwaite et al., 1988; Kim et al., 1990). Okadaic acid and TNF-a induced NF-KBin Jurkat cells (Meichle et al., 1990; Thevenin et al., 1990). In addition to these molecular biological results, I L 1 , TNF-a, and okadaic acid all induced a similar phosphorylation pattern within 15 min in human fibroblasts (Guy et al., 1991, 1992). I L 1 , a 17-kDa protein, binds to I L 1 receptors of an 80-kDa protein present in T lymphocytes,

186

HIROTA FVJIKI AND MASAMI SUGANUMA

fibroblasts, and other connective tissue cells (O’Neillet al., 1990). Tumor necrosis factor a, another 17-kDa protein, binds to two distinct TNF receptors of 56- and 75-kDa proteins in a variety of cell types (Loetscher et al., 1990; Schall et al., 1990; Blank et al., 1992). These two lymphokines are recognized polypeptide mediators of inflammation and cellular immune responses (Old, 1985; Beutler and Cerami, 1988). Therefore, their effects, such as protein phosphorylation, expression of transcription factors (Guy et al., 1992; Viltek and Lee, 1991), and inflammatory response, were in partial mimicry of those of okadaic acid. However, there are distinct differences in the time course of effects between the lymphokines and okadaic acid. That is, I L 1 and TNF directly activate multiple protein kinases through their receptor bindings and their protein phosphorylations were maximum at 15 min after treatment and later declined, whereas hyperphosphorylation of vimentin and cytokeratins by okadaic acid increased gradually and reached a maximum at 2 hr after treatment. It is assumed that the lymphokines function like tumor promoters, although their signaling effects are temporary, compared with those of the okadaic acid class tumor promoters. We recently found that mouse TNF-a stimulated transformation of MCAinitiated BALB/3T3 cells (A. Komori et al., manuscript in preparation).

VIII. Future Perspectives The discovery of the okadaic acid class tumor promoters led us to recognize the significance of protein phosphatase activity and inhibition in cancer research. Although the okadaic acid pathway is biochemically distinct from the PKC pathway, both pathways ultimately involve upregulating the expression of members of the fos and jun gene families, resulting in disruption of the normal balance between members of the AP-1 complex. If a pattern o r series of gene expressions for tumor promotion can be demonstrated, chemical tumor promoters will still be useful tools for the investigation. T h e interaction between Jun and Fos in the initiated cells in relation to protein phosphorylation needs to be clarified. As the stable complex of PP-2A and viral T antigens has indicated, the nature and function of the regulatory subunits of protein phosphatases remain to be further characterized. As depicted in Fig. 14, it should be investigated in initiated cells how the sustained hyperphosphorylation of a tumor suppressor gene product is induced. Although the okadaic acid pathway only deals with PP-1 and PP-2A, the calcium/calmodulin-dependent protein phosphatase-2B, known as calcineurin, was recently found to be inhibited by an immunosuppressantreceptor complex, consisting of cyclosporin A and cyclophilin A (Liu

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

187

et al., 1991; McKeon, 1991). This evidence opens u p a significant role for

PP-PB. How activity of a protein phosphatase is related to those of the other protein phosphatases is not well known. T h e evidence that four structurally different types of compounds of the okadaic acid class bind to a common binding site in the catalytic subunits of PP-1 and PP-2A provides a new research objective for the study of computer modeling. How to inhibit the okadaic acid pathway in the initiated cells and how to recover the deregulated expression of the proto-oncogenes are also important future projects in cancer research. IX. Conclusion Since the discovery that okadaic acid is a tumor promoter as potent as TPA through different mechanisms of action, we have extended studies on okadaic acid derivatives, the calyculins, the microcystins, and tautomycin. T h e evidence that these tumor promoters are all potent inhibitors of PP-1 and PP-2A provided a new area in tumor promotion research and increased interest due to its distinction from the activation of PKC by TPA-type tumor promoters. Present understanding of gene expression of the proto-oncogenes has assisted in interpreting their mechanisms of action at the molecular level and to put these studies in the limelight. Important new pieces of evidence related to tumor promotion have been summarized in this review article. Just after our second publication, in which okadaic acid was shown to have potent tumor-promoting activity, we received numerous requests for okadaic acid, since it was not commercially available at that time. It was very exciting for us to find so many scientists in various research fields who were interested in protein phosphatase activity and its inhibition. Although our research on tumor promoters is a small field in cancer research, we are convinced that it is vitally interrelated with various other research fields, due to the pleiotropic effects of tumor promoters. It is anticipated that this review will provide information to those scientists as well.

ACKNOWLEDGMENTS This work was supported in part by Grants-in-Aid for Cancer Research, Overseas Scientific Research Program (Cancer Program) from the Ministry of Education, Science and Culture, and from the Ministry of Health and Welfare of Japan, and a Comprehensive 10-Year Strategy for Cancer Control from the Ministry of Health and Welfare of Japan, and by grants from the Foundation for Promotion of Cancer Research, the Princess Takamatsu Cancer Research Fund, the Uehara Memorial Life Science Foundation, and the Smoking Research Foundation of Japan. We thank Dr. T. Sugimura for encouragement during the course of this work and Japanese and American scientists cited in the refer-

188

HIROTA FUJIKI AND MASAMI SUGANUMA

ences for collaborations. To the Japanese scientists, including Drs. Y. Hirdta, K. Yamada, T. Yasumoto, D. Uemura, N. Fusetani, K-I. Harada, M. F. Watanabe, and K. Isono, and the many scientists from abroad, including Drs. R. K. Boutwell, I. B. Weinstein, L. Levine, S. H . Yuspa, M. B. Sporn, T. J. Slaga, W. Troll, G. T. Bowden, H. R. Henchman, E. Huberman, M. R. Rosner, S. -J. Kim, W. W. Carmichael, R. E. Moore, Y. Hokama, L. Edebo, E. Hecker, H. zur Hausen, and R. J. Quinn, we express gratitude for fruitful discussions.

REFERENCES Abdul-Ghani, M., Kravitz, E. A,, Meiri, H., and Rahamimoff, R. (1991).Proc. Natl. Acad. Sci. U.S.A. 88, 1803-1807. Atchison, M. L.. and Perry, R. P. (1987). Cell (Cambndge, Mass.) 48, 121-128. Balmain, A., and Pragnell, I. B. (1983). Nature (London) 303, 72-74. Barbacid, M. (1987). Annu. Rev. Biochem. 56, 779-827. Baxter, G. D., and Lavin, M. F. (1992).J . Immunol. 148, 1949-1954. Beasley, V. R., Cook, W. O., Dahlem, A. M., Hooser, S. B., Lovell, R. A., and Valentine, W. M. (1989). Vet. Clin. North. Am. 5, 345-361. Beasley, V. R., Coppock, R. W., Simon, J., Buck, W. B., Ely, R., Corley, R. A., Carlson, D. M., and Gorham, P. R. (1983).J. Am. Vet. Med. Assoc. 182, 413-414. Beutler, B., and Cerami, A. (1988). Annu. Rev. Biochem. 57, 505-518. Bialojan, C.. and Takai, A. (1988). Biochem. J. 256, 283-290. Billing, W. H. (1981). In “The Water Environment; Algal Toxins and Health” (W. W. Carmichael, ed.), pp. 243-255. Plenum Press, New York. Blank, V., Kourilsky. P., and Israel, A. (1992). TfBS 17, 135-140. Blumberg, P. M. (1988). Cancer Res. 48, 1-8. B@e,R., Gjertsen, B. T.. Vintermyr, 0. K., Houge, G., Lanotte, M., and Doskeland, S. 0. (1991). Exp. Cell Re.\. 195, 237-246. Botes, D. P., Tuinman, A. A,, Wessels, P. L., Viljoen, C. C., Kruger, H., Williams, D. H., Santikarn, S., Smith, R. J., and Harnmond, S. J. (1984).J. Chem. Soc. Perkin Tram. 1, 2311-2319. Boutwell, R. K. (1977).In “Origins of Human Cancer” (H. H . Hidt1,J. D. Watson, and J. A. Winsten, eds.), pp. 773-783. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Brautigan, D. L., and Shriner, C. L. (1988).In “Methods in Enzymology” (J. Corbin and R. Johnson, eds.), Vol. 159, pp. 339-346. Academic Press, San Diego. Brautigan, D. L.. Sunwoo,J., Labbe, J.-C., Fernandez, A., and Lamb, N. J. C. (1990).Nature (London) 844, 74-78. Bushfield, M., Lavan, B. E., and Houslay, M. D. (1991). Biochem. J. 274, 317-321. Carlberg, U., Nilsson, A., Skog, S., Palmquist, K., and Nygard, 0. (1991). Biochem. Biophys. Res. Commun. 180, 1372-1376. Carmichael, W. W. (1988). In “Handbook of Natural Toxins” (A. T. Tu, ed.), Vol. 3, pp. 121-147. Dekker, New York. Carmichael, W. W., and Mahrnood, N. A. (1984). In “Seafood Toxins” (E. P. Ragelis, ed.), pp. 377-389. American Chemical Society, Washington. Carmichael, W. W., Beddey, V., Bunner, D. L., Eloff, J. N., Falconer, I., Gorham, P., Harada, K-I., Krishnamurthy, T., Yu, M.-J., Moore, R. E., Rinehart, K. L., Runneger, M., Skulberg, 0. M., and Watanabe, M. (1988a). Toxicon 26, 971-973. Carmichael, W. W., Eschedor, J. T., Patterson, G . M. L., and Moore, R. E. (1988b). Appl. Environ. Microbiol. 54, 2757-2263.

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

189

Chartier, L., Rankin, L. L., Allen, R. E., Kato, Y., Fusetani, N., Karaki, H., Watabe, S., a n d Hartshorne, D. J. (1991). Cell Motil. Cytoskel. 18, 26-40. Cheng, X.-C., Kihara, T., Kusakabe, H., Magae, J., Kobayashi, Y., Fang, R.-P., Ni, Z.-F., Shen, Y.-C., KO, K., Yamaguchi, I., a n d Isono, K. (1987).J. Antibiot. 40, 907-909. Chou, Y-H., Bischoff, J. R., Beach, D., and Goldman, R. D. (1990).Cell (Cambridge, Mass.) 62, 1063-1071. Cohen, P. (1989). Annu. Rev. Biochem. 58, 453-508. Cohen, P., Alemany, S., Hemmings, B. A., Resink, T. J., Stralfors, P., and Lim Tung, H. Y. (1988). I n “Methods in Enzymology” (J. Corbin and R. Johnson, eds.), Vol. 159, pp. 390-408. Academic Press, San Diego. Cohen, P., Holmes, C. F. B., and Tsukitani, Y. (1990). TIBS 15, 98-102. Delclos, K. B., Yeh, E., and Blumberg, P. M. (1983).Proc. Natl. Acad. Sci. U.S.A. 80,30543058. Denner, L., Weigel, N. L., Maxwell, B. L., Schrader, W. T., and OMalley, B. W. (1990). Science 250, 1740- 1743. Edebo, L., Lange, S., Li, X. P., Allenmark, S., and Jennische, E. (1 989). In “Mycotoxins a n d Phycotoxins ’88” (S. Natori. K. Hashimoto, a n d Y. Ueno, eds.), pp. 437-444. Elsevier Science Publishers B. V., Amsterdam. Erdodi, F., Rokolya, A., DiSalvo, J., Barany, M., and Barany, K. (1988). Biochem. Biophys. Res. Commun. 153, 156-161. Eriksson, J. E., Gronberg, L., Nygard, S., Slotte, J. P., and Moriluoto, J. A. 0. (1990a). Biochim. Biophys. A c h 1025, 60-66. Eriksson, J. E., Toivola, D., Meriluoto, J. A. O., Karaki, H., Han, Y.-G., and Hartshorne, D. (1990b). Biochem. Biophys. Res. Commun. 173, 1347-1353. Eriksson, J. E., Brautigan, D. L., Vallee, R., Olmsted, J., Fujiki, H., and Goldman, R. D. (1992). Proc. Natl. Acad. Sci. U.S.A. 89, 11093-1 1097. Falconer, I. R., Beresford, A. M., and Runnegar, M. T. C. (1983).Med. J . A w t . 1,511-514. Fernandez, M. T., Zitko, V., Gascbn, S., and Novelli, A. (1991). Life Sci. 49, 157-162. Francis, G. (1878). Nature (London) 18, 11-12. Fujiki, H. (1992). Mol. Carcinogen. 5, 91-94. Fujiki, H., Mori, M., Nakayasu, M., Terada, M., Sugimura, T., and Moore, R. E. (1981). Proc. Natl. Acad. Sci. U.S.A. 78, 3872-3876. Fujiki, H., Suganuma, M., Matsukura, N., Sugimura, T., a n d Takayama, S. (1982). Carcinogenesis 3, 895-898. Fujiki, H., Suganuma, M., Suguri, H., Yoshizawa, S., Ojika, M., Wakamatsu, K., Yamada, K., and Sugimura, T. (1987). Proc.Japan Acad. B 63, 51-53. Fujiki, H., Suganuma, M., Suguri, H., Yoshizawa, S., Takagi, K., Uda, N., Wakamatsu, K., Yamada, K., Murata, M., Yasumoto, T., and Sugimura, T. (1988). Jpn. J. Cancer Res. (Gann) 79, 1089- 1093. Fujiki, H., Suganuma, M., and Sugimura, T. (1989a). Environ. Carcinogen. Rev. (J. Enuiron. Sci. Health). C7( I), 1-5 1. Fujiki, H., Suganum;. I., Suguri, H., Yoshizawa, S., Hirota, M., Takagi, K., a n d S u g m u r a , T. (1989b). I n ,in Carcinogenesis: Mechanisms and Human Relevance” (T.J. Slaga, A. J. P. Klein-Szanto, R. K. Boutwell, D. E. Stevenson, H. L. Spitzer, and B. DMotto, eds.), pp. 281-291. Alan R. Liss, New York. Fujiki, H., Suganuma, M., Suguri, H., Yoshizawa, S., Takagi, K., Sassa, T., Uda, N.. Wakamatsu, K., Yamada, K., Yasumoto, T., Kato, Y., Fusetani, N., Hashimoto, K., a n d Sugimura, T. (1989~). In “Mycotoxins and Phycotoxins ’88” (S. Natori, K. Hashimoto, and Y. Ueno, eds.), pp. 453-460. Elsevier Science Publishers B. V., Amsterdam. ’

190

HIROTA FUJIKI AND MASAMI SUCANUMA

Fujiki, H., Suganuma, M., Yoshizawa, S., Kanazawa, H., Sugimura, T., Manam, S., Kahn, S. M., Jiang, W., Hoshina, S., and Weinstein, 1. B. (1989d). Mol. Carcinogen. 2, 184-187. Fujiki, H., Suganuma, M., Nishiwaki, S., Yoshizawa, S., Winyar, B., Sugimura, T., and Schmitz, F. J. (1990a). In “The Biology and Medicine of Signal Transduction” (Y. Nishizuka, M. Endo, and C. Tanaka, eds.), pp. 340-344. Raven Press, New York. Fujiki, H., Suganuma, M., Suguri, H., Yoshizawa, S., Takagi, K., Nakayasu, M., Ojika, M., Yamada, K., Yasumoto, T.. Moore, R. E., and Sugimura, T. (1990b). In “Marine Toxins: Origins, Structure and Molecular Pharmacology” (S. Hall and G. Strichartz, eds.), pp. 232-240. American Chemical Society, Washington. Fujiki, H., Suganuma, M., Yoshizawa, S., Nishiwaki, S., Winyar, B., and Sugimura, T. (1991). Environ. Health Persject. 93, 21 1-214. Fujiki, H., Suganuma, M., Nishiwaki, S., Yoshizawa, S., Yatsunami, J., Matsushima, R.. Furuya, H., Okabe, S., Matsunaga, S., and Sugimura, T. (1992). In “Relevance of Animal Studies to the Evaluation of Human Cancer Risk (R. DAmato, T. J. Slaga, W. Farland, and C. Henry, eds.), pp. 337-350. Wiley-Liss, New York. Fujiki, H., and Sugimura, T. (1987). In “Advances in Cancer Research” (G. Klein et al., eds.), Vol. 49, pp. 223-264. Academic Press, San Diego. Gilmartin, M. E., Mitchell, J.. Vidrich, A., and Freedberg, I. M. (1984). J. Cell B i d . 98, 1144-1 149. Goerttler, K., Loehrke, H., Hesse, B., Milz, A., and Schweizer, J. (1981). Carcinogenesis 2, 1087-1094. Goris, J., Hermann, J., Hendrix, P., Ozon, R., and Merlevede, W. (1 989). FEBS Lett. 245, 9 1-94. Grove, D. S., and Mastro, A. M. (1991). Cancer Res. 51, 82-88. Guy, G. R., Cao, X., Chua, S. P., and Tan, Y. H. (1992).J. B i d . Chem. 267, 1846-1852. Guy, G. R., Chua, S. P., Wong, N. S., Ng, S. B., and Tan, Y. H. (1991).J. B i d . Chem. 266, 14343-14352. Harada, K-I., Matsuura, K., Suzuki, M., Oka, H., Watanabe, M. F., Oishi, S., Dahlem, A. M., Beasley, V. R., and Carmichael, W. W. (1988).J. Chromutogr. 448, 275-283. Harada, K-I., Matsuura, K., Suzuki, M., Watanabe, M. F., Oishi, S., Dahlem, A. M., Beasley, V. R., and Carmichael, W. W. (1990a). Toxicon 28, 55-64. Harada, K-I., Ogawa, K., Matsuura, K., Murata, H., Suzuki, M., Watanabe, M. F., Itezono, Y., and Nakayama, N. (1990b). Chem. Res. Toxicol. 3, 473-481. Haystead, T. A. J.. Sim, A. T. R., Carling, D., Honnor, R. C., Tsukitani, Y., Cohen, P., and Hardie, D. G. (1989). Nature (London) 337, 78-8 I . Haystead, T. A. J., Weiel, J. E., Litchfield, D. W., Tsukitani, Y., Fischer, E. H., and Krebs, E. G. (1990).J. Biol. Chem. 266, 16571-16580. Hennings, H., Lowry, D. T., Robinson, V. A., Morgan, D. L., Fujiki, H., and Yuspa, S. H. (1992). Carcinogenesis 13, 2145-2151. Hennings. H.. Robinson, V. A., Michael, D. M., Pettit, G. R., Jung, R., and Yuspa, S. H. ( 1 990). Cancer Res. 50, 4794-4800. Hernandez-Sotomayor, S. M. T., Mumby, M., and Carpenter, G. (1991).J. Biol. C h m . 266, 2 1281-21286. Henchman, H. R., Lim, R. W., Brankow, D. W., and Fujiki, H. (1989). Carcinogenesir 10, 1495- 1498. Hescheler, J., Mieskes, G., Ruegg, J. C., Takai, A., Trautwein, W. (1988). PflUger Arch. 412, 248-252. Holladay, K., Fujiki, H., and Bowden, G. T. (1992). Mol. Carcinogen. 5, 16-24. Honkanen, R. E., Dukelow, M., Zwiller, H., Moore, R. E., Khatra, B. S., and Boynton, A. L. (1991). Mol. Phumacol. 40, 577-583.

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

191

Honkanen, R. E., Zwiller, J., Moore, R. E., Daily, S. L., Khatra, B. S., Dukelow, M., and Boynton, A. L. (199O).J.B i d . Chem. 265, 19401-19404. Hori, M., Magae, J., Han, Y.-G., Hartshorne, D. J., and Karaki, H. (1991).FEBS Lett. 285, 145- 148. Huang, C.-K., Devanney, J. F., and Kennedy, S. P. (1988).Biochem. Biophys. Res. Commun. 150, 1006-101 1. Huang, L. E.,Chang, N. T., and Liu, A. Y.-C. (1992).Proc. Am. Assoc. Cancer Res. 33, 363. Ingebritsen, T. S. (1991).In “Methods in Enzymology”(T. Hunter and B. Sefton, eds.), Vol. 201, pp. 451-465. Academic Press, San Diego. Ishihara, H., Martin, B. L., Brautigan, D. L., Karaki, H., Ozaki, H., Kato, Y., Fusetani, N., Watabe, S., Hashimoto, K., Uemura, D., and Hartshorne, D. J. (1989a).Biochm. Biophys. Res. Commun. 159, 871-877. Ishihara, H., Ozaki, H., Sato, K., Hori, M., Karaki, H., Kato, Y., Watabe, S., Fusetani, N., Hashimoto, K., Uemura, D., and Hartshorne, D. J. (1989b).J.Phannacol. Exp. Ther. 250, 388-396. Kato, Y., Fusetani, N., Matsunaga, S., Hashimoto, K., Fujita, S., and Furuya, T. J. (1986).J. Am. Chem. SOC.108,2780-2781. Kato, Y., Fusetani, N., Matsunaga, S., Hashimoto, K., Koseki, K. (1988).J.Org. Chem. 53, 3930-3932. Katoh, F., Fitzgerald, D. J., Giroldi, L., Fujiki, H., Sugimura, T., and Yamasaki, H. (1990). Jpn. J. Cancer Res. 81,590-597. Kiguchi, K., Giometti, C., Chubb, C., Fujiki, H., and Huberman, E. (1992).Biochem. Biophys. Res. Commun. 189, 1261-1267. Kim, S.-J., Kim, Y. Y., Tapscott, S. J., Winokur, T. S., Park, K., Fujiki, H., Weintraub, H., and Roberts, A. B. (1992).J.Biol. Chem., 267, 15140-15145. Kim, S.-J., Lafyatis, R., Kim, K. Y., Angel, P., Fujiki, H., Karin, M., Sporn, M. B., and Roberts, A. B. (1990).Cell Regul. 1, 269-278. Kramer, I. M., Koornneef, I., de Vries, C., de Groot, R. P., de Laat, S. W., van den Eijndenvan Raaij, A. J. M., and Kruijer, W. (1991).Biochem. Biophys. Res. Commun. 175, 816822. Krishnamurthy, T., Szafraniec, L., Hunt, D. F., Shabanowitz,J., Yates, J. R., 111, Hauer, C. R., Carmichael, W. W., Skulberg, 0.. Codd, G. A., and Missler, S. (1989).Proc. Natl. Acad. Sci. U.S.A. 86, 770-774. Lanaras, T., Cook, C. M.,Eriksson, J. E., Meriluoto, J. A. O., and Hotokka, M. (1991). TO&O~ 29,901-906. Levine, L., Fujiki, H., Yamada, K., Ojika, M., Gjika, H. B., and Van Vunakis, H. (1988). T O X ~26, C O1123-1 ~ 128. Levy, J. P., Fujiki, H., Angel, P., and Bowden, G. T. (1991).Proc. Am. Assoc. Cancer Res. 32, 297. Levy, J. P., Nelson, M. A., and Bowden, G . T. (1992).Proc. Am. Assoc. Cancer Res. 33, 364. Lim, R. W., Varnum, B. C., and Henchman, H. R. (1987).Oncogene 1, 263-270. Liu, J., Farmer, J. D., Lane, W. S., Friedman, J., Weissman, I., and Schreiber, S. L. (1991). Cell (Cambridge, Mass.)66, 807-815. Loetscher, H., Pan, Y.-C. E., Lahm, H.-W., Gentz, R.,Brockhaus, M., Tabuchi, H., and Lesslauer, W. (1990).Cell (Cambridge, Mass.) 61, 351-359. Mackintosh, C., Beattie, K. A., Klumpp, S., Cohen, P., and Codd, G. A. (1990).FEBS Lett. 264, 187-192. Mackintosh, C., and Klumpp, S. (1990).FEBS Lett. 277, 137-140. Magae, J.. Osada, H., Fujiki, H., Saido, T. C., Suzuki, K., Nagai, K., Yamasaki, M., and Isono, K. (1990).Proc. Jpn. Acad. B 66, 209-212.

192

HIROTA FUJIKI A N D MASAMI SUGANUMA

Magae, J., Watanabe, C., Osada, H., Cheng, X-C., and Isono, K. (1988).J.Antibiot. 41,932937. Mahadevan, L. C., Willis, A. C., and Barratt, M. J. (1991). Cell (Cambridge, Mars.)65,775783. Matsunaga, S., Fujiki, H., Sakata, D., and Fusetani, N. (1991). Tetrahedron 47, 2999-3006. Matsunaga, S., and Fusetani, N. (1991). Tetrahedron Lett. 32, 5605-5606. Matsushima, R., Yoshizawa, S., Watanabe, M. F., Harada, K-I., Furusawa, M., Carmichael, W. W., and Fujiki, H. (1990). Biochem. Biophys. Res. Commun. 171, 867-874. McKeon, F. (1991). Cell (Cambridge, Mass.) 66, 823-826. Meichle, A., Schutze, S., Hensel, G., Brunsing, D., and Kronke, M. (199O).J.Biol. Chem. 265, 8339-8343. Mordan, L. J. (1991). Science 251, 142-143. Mordan, L. J., Dean, N. M., Honkanen, R. E., and Boynton, A. L. (1990). Cancer Commun. 2, 237-241. Murata, M., Shimatani, M., Sugitani, H., Oshinia, Y., and Yasumoto, T. (1982). Bull. Jpn. SOC.Sci. Fish. 48, 549-552. Nam, K.-Y., Hiro, M., Kimura, S., Fujiki, H., and Imanishi, Y. (1990). Carcinogenesis 11, 1171-1 174. Namikoshi, M., Rinehart, K. L., Sakai, R., Stotts, R. R., Dahlem, A. M., Beasley, V. R., Carmichael. W.W.,and Evans, W. R. (1992).J. Org. Chem. 57,866-872. Nishiwaki, S., Fujiki, H., Suganuma, M., Furuya-Suguri, H., Matsushima, R., lida, Y., Ojika, M., Yamada, K., Uemura, D.. Yasumoto, T., Schmitz, E J., and Sugimura, T. (1990a). Carcinogenesis 11, 1837- 184 1. Nishiwaki, S., Fujiki, H., Suganuma, M., Ojika, M., Yamada, K., and Sugimura, T. (1990b). Biochem. Biophys. Res. Commun. 170, 1359-1364. Nishiwaki, S., Fujiki, H., Suganuma, M., Nishiwaki-Matsushima, R., and Sugimura, T. (1991). FEBS Lett. 279, 115-1 18. Nishiwaki-Matsushima, R., Nishiwaki, S., Ohta, T., Yoshizawa, S., Suganuma, M., Harada, K-I., Watanabe, M. F., a n d Fujiki, H. (1991).Jpn.J. Cancer Res. 82, 993-996. Nishiwaki-Matsushima, R., Fujiki, H., Harada, K-I., Taylor, C., and Quinn. R. J. (1992a). BioMed. Chem. Lett., 2, 673-676. Nishiwaki-Matsushima, R., Ohta, T., Nishiwaki, S., Suganuma, M., Kohyama, K., Ishikawa, T., Carmichael, W. W., a n d Fujiki, H. (1992b).J. Cancer Res. Clin. Oncol., 1 18,420-424. Nishizuka, Y. (1984). Nature (London) 308, 693-698. OBrien, T. C . , Simsiman, R. C., and Boutwell, R. K. (1975). Cancer Res. 35, 1662-1670. OConnor, C. M., Card, D. L., and Lazarides, E. (1981). Cell (Cambridge, M a s . ) 23, 135143. Ohtd, T., Nishiwaki, R., Yatsunami, J.. Komori, A., Suganuma M., and Fujiki, H. (1992). Carcinogenesis 13, 2443-2447. Ohuchi, K., Tamura, T., Ohashi, M., Watanabe, M., Hirasawd, N., Tsurufuji, S., and Fujiki, H. (1989). Biochim. Biophys. Acta 1013, 86-91. Oikawa, T., Suganuma, M., Ashino-Fuse, H., and Shimamura, M. (1992).Jpn. J.CancerRes. 83, 6-9. Oka, S . , Nakagomi, K., Tanaka, H., and Yasumoto, T. (1989). Biochem. Biophys. Res. Commun. 165,539-546. Old, L. J. ( 1 985). Science 230, 630-632. ONeill, L. A. J., Bird, T. A., and Saklatvala, J. (1990). Immunol. Today 11, 392-394. Pallas, D. C., Shakrik, L. K., Martin, B. L., Jaspers, S., Miller, T. B., Brautigan, D. L., and Roberts, T. M. (1990). Cell (Cambridge, Mars.) 60, 167-176. Park, K., Chung, M., and Kim, S.-J. (1992).J. Eaol. Chem., 267, 10810-10815.

TUMOR PROMOTION BY INHIBITORS OF PROTEIN PHOSPHATASES

193

Postlethwaite, A. E., Raghow, R., Stricklin, G. P., Poppleton, H., Seyer, J. M., a n d Kang, A. H. (1988).J. Cell B i d . 106, 311-318. Quinn, R. J., Taylor, C., Suganuma, M., and Fujiki, H. (1993). BioMed. Chem. Lett., in press. Quintanilla, M., Brown, K., Ramsden, M., and Balmain, A. (1986). Nature (London) 322, 78-80. Rahmsdorf, H. J., and Herrlich, P. (1990). Phannacol. Ther. 48, 157-188. Rinehart, K. L., Harada, K-I., Namikoshi, M., Chen, C., Harvis, C. A., Munro, M. H. G., Blunt, J. W., Mulligan, P. E., Beasley, V. R., Dahlem, A. M., and Carmichael, W. W. (1988).J . Am. C h a . Soc. 110, 8557-8558. Rivedal, E., Mikalsen, S.-O., and Sanner, T. (1990). Biochem. Biophys. Res. Commun. 167, 1302- 1308. Robinson, N. A., Miura, G. A., Matson, C. F., Dinterman, R. E., and Pace, J. G. (1989). Toxicon 27, 1035-1042. Robinson, N. A., Pace, J. G., Matson, C. F., Miura, G. A., and Lawrence, W. B. (1991).J. P h a m c o l . [email protected]. 256, 176- 182. Sakai, A., and Fujiki, H. (1991).Jpn.J. CancerRes. 82, 518-523. Sakai, R., Ikeda, I., Kitani, H., Fujiki, H., Takaku, F., Rapp, U., Sugimura, T., and Nagao, M. (1989). Proc. Natl. Acad. Scz. U.S.A. 86, 9946-9950. Sassa, T., Richter, W. W., Uda, N., Suganuma, M.. Suguri, H.,Yoshizawa, S., Hirota, M., and Fujiki, H . (1989). Biochem. Biophys. Res. Commun. 159,939-944. Schall, T. J., Lewis, M., Koller, K. J., Lee, A., Rice, G. C., Wong, G. H. W., Gatanaga, T., Granger, G . A., Leutz, R., Raab, H., Kohr, W. J., and Goeddel, D. V. (1990). Cell (Cambridge, Mass.) 61, 361-370. Scheidtmann, K. H., Mumby, M. C., Rundell, K., and Walter, G. (1991). Mol. CellBiol. 11, 1996-2003. Schmidt, R., Heck, K., Sorg, B., and Hecker, E. (1985). Cancer Lett. 26, 97- I 1 1 . Schmitz, F. J., Prasad, R. S., Gopichand, Y., Hossain, M. B., van d e r Helm, D., and Schmidt, P. (1981).J. Am. Chem. SOC. 103, 2467-2469. Schiitte, J., Viallet, J., Nau, M., Segal, S., Fedorko, J., and Minna, J. (1989). Cell (Cambridge, Mars.) 59, 987-997. Sen, R., and Baltimore, D. (1986). Cell (Cambridge, Mars.) 47,921-928. Shibata, S., Ishida, Y., Kitano, H., Ohizumi, Y., Habon, J.. Tsukitani, Y., and Kikuchi, H. (1982).J . P h a m c 0 1 . EX$. Thm. 223, 135- 143. Skulberg, 0. M.,Codd, G . A., and Carmichael, W. W. (1984). Am610 13,244-247. Steinert, P. M., and Roop, D. R. (1988). Annu. Rev. Biocha. 57, 593-625. Suganuma, M., Fujiki, H., Morino, K., Takayama, S., and Sugimura, T. (1987). J . Cancer Res. Clin. Oncol. 113, 123-125. Suganuma, M., Fujiki, H., Suguri, H., Yoshizawa, S., Hirota, M., Nakayasu, M., Ojika, M., Wakamatsu, K., Yarnada, K., and Sugimura, T. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 1768-177 I . Suganuma, M., Suttajit, M., Suguri, H., Ojika, M., Yamada, K., and Fujiki, H. (1989).FEES Lett. 250, 615-618. Suganuma, M., Fujiki, H., Furuya-Suguri, H., Yoshizawa, S., Yasumoto, S., Kato, Y., Fusetani, N., and Sugimura, T. (1990). Cancer Res. 50, 3521-3525. Suganuma, M., Fujiki, H., Okabe, S., Nishiwaki, S., Brautigan, D., Ingebritsen, T. S., and Rosner, M. R. (1992a). Tonzcon, 30, 873-878. Suganuma, M., Tatematsu, M., Yatsunami, J., Yoshizawa, S., Okabe, S., Uemura, D., and Fujiki, H. (1992b). Carcinogenesis, 13, 1841-1845. Suganuma, M., Yatsunami, J., Yoshizawa, S., Okabe, S., and Fujiki, H. (1993). Cancer Res., in press.

194

HIROTA FUJIKI AND MASAMI SUGANUMA

Tachibana, K., Scheuer, P. J.. Tsukitani, Y., Kikuchi, H., Van Engen, D., Clardy, J., Gopichand, Y., and Schmitz, F. J. (198l).J. Am. Chem. SOC. 103, 2469-2471. Takai, A., Bialojan, C., Troschka, M., Riiegg, J. C. (1987). FEBS Lett. 217, 81-84. Tanti, J.-F., Gremeaux, T., Van Obberghen, E., and Le Marchand-Brustel, Y. (1991).J B i d . C h m . 266,2099-2103. Taylor, C., Quinn, R. J., McCulloch, R., Nishiwaki-Matsushima, R., and Fujiki, H. (1992). BioMed. C h . Lett. 2, 299-302. Terao, K., Ito, E., Yanagi, T., and Yasumoto, T. (1986). Toxicon 24, 1141-1151. Thkvenin, C., Kim, S.-J., and Kehrl, J. H. (1991).J Eiol. Chem. 266, 9363-9366. Thkvenin, C., Kim, S.-J., Rieckmann, P., Fujiki, H., Norcross, M. A., Sporn, M. B., Fauci, A. S., and Kehrl, J. H. (1990). New Biologist 2, 793-800. Tokui, T., Yamauchi, T., Yano, T., Nishi, Y., Kusagawa, M., Yatani, R.,and Inagaki, M. (1990). Biochem. Eiophys. Res. Commun. 169, 896-904. Tsang, S. S., Stich, H. F., and Fujiki, H. (1991). Cancer Detect. Prev. 15, 423-427. Uemura, D., and Hirata, Y. (1989). In “Studies in Natural Products Chemistry” (A. U. Rahman, ed.), pp. 377-40 1. Elsevier, Amsterdam. Usagawa, T., Nishimura, M., Itoh, Y., Uda, T., and Yasumoto, T. (1989). Toxicon 27, 13231330. Verma, A. K., and Boutwell. R. K. (1977). Cancer Res. 37, 2196-2201. Viltek, J., and Lee, T. H. (1991).]. B i d . Chem. 266, 7313-7316. Vogelstein, B., Fearon, E. R., Kern, S. K., Hamilton, S. R., Preisinger, A. C., Nakamura, Y., and White, R. (1989).Science 244, 207-2 1 1. Walter, G., Ruediger, R., Slaughter, C., and Mumby, M. (1990). Proc. Natl. Acad. Sci. U.S.A. 87,252 1-2525. Watanabe, M. F., Oishi, S., Harada, K-I., Matsuura, K., Kawai, H., and Suzuki, M. (1988). Toxicon 26, 1017-1025. Weinstein, I. B. (1988). Cancer Res. 48, 4135-4143. Yasumoto, T. (1990). In “Toxic Marine Phytoplankton” (E. Graneli, G. Sundstrom, L. Edler, and D. M. Anderson, eds.), pp. 3-8. Elsevier, New York. Yasumoto, T., Murata, M., Lee, J.-S., and Torigoe, K. (1989). In “Mycotoxins and Phycotoxins ’88” (S. Natori, K. Hashimoto, and Y. Ueno, eds.), pp. 375-382. Elsevier Science Publishers B. V., Amsterdam. Yasurnoto, T., Murata, M., Oshima, Y., Sano, M., Matsumoto, G. K., and Clardy, J. (1985). Tetrahedron 41, 10 I 9- 1025. Yatsunami, J., Fujiki, H., Suganuma, M., Nishiwaki, S., Ojika, M., Yamada, K., and Levine, L. (1991a). Toxicon 29, 1409-1412. Yatsunami, J., Fujiki, H., Suganuma, M.. Yoshizawa, S., Eriksson, J. E., Olson, M. 0.J., and Goldman, R. D. (199I b). B i o c h a . Eiophys. Res. Commun. 177, 1 165- 1 170. Yatsunami, J., Komori. A., Ohta, T., Suganuma, M., and Fujiki, H. (1993a). Cancer Res. 53, 239-24 I. Yatsunami, J., Komori, A., Ohta, T., Suganuma, M., and Fujiki, H. (1993b). Cancer Res., in press. Yoshizawa, S., Matsushima, R., Watanabe, M. F., Harada, K-I., Ichihara, A., Carmichael, W. W., and Fujiki, H. (1990).J. Cancer Res. Clin. Oncol. 116, 609-614. Yu, S.-Z. (1989). In “Primary Liver Cancer” (Z. Y.Tang, M. C. Wu, and S. S. Xia, eds.), pp. 30-37. China Academic, Beijing; Springer-Verlag, Berlin. Zheng, B., Woo, C. F., and Kuo, J. F. (1991).J Biol. Chem. 266, 10031-10034.

ONCOGENIC BASIS OF RADIATION R ESISTANCE Usha Kasid,' Kathleen Pirollo,t Anatoly Dritschilo,* and Esther Changt-* 'Department of Radiation Medicine, Lombardi Cancer Center, Georgetown University, Washington, D.C. 20007; and Departments of *Pathology and *Surgery, Uniformed Services University of the Health Sciences, Bethesda, Maryland 20814

I. Introduction 11. Radiation Response Phenotype A. Relative Radioresistance and Radiosensitivity: Radiation Survival Parameters B. Clonal Nature of the Radiation Response 111. Human and Rodent Cell Model Systems A. Radioresistant Human Squamous Cell Carcinomas B. Skin Fibroblasts from a Cancer-Prone Family C. NIH13T3 Transfectants D. Other Cell Lines IV. Mitogenic Signals and Radiation Response V. Transformation and Radiation Resistance VI. Radiation-Resistant Phenotype: Cause or Effect A. Multifactorial Nature of Radiation Response: Differential Gene Expression B. Molecular Targets of Ionizing Radiation VII. DNA Damage and Repair Cascade: Biochemical and Cellular Factors VIII. Modulation of Radiation Resistance: Therapeutic Implications of Oncogene Strategy IX. Conclusion References

1. Introduction

Evidence continues to accumulate implicating oncogenes in the development of neoplasia. T h e normal counterparts of these genes (protooncogenes) are involved in numerous vital cellular functions. The products of many of these protooncogenes have been shown to interact with one another as components of a signal transduction pathway that involves transmission of molecular/biochemical signals from the membrane to the nucleus directing the cells to divide or to differentiate (Weinstein, 1988a; Nigg, 1990; Bishop, 1991; Cantley et al., 1991). Ionizing radiation induces multiple cellular and biological effects either by direct interaction with DNA or through the formation of free 195 ADVANCES IN CANCER RESEARCH. VOL. 61

Copyright 0 199.3 by Academic Press. Inc. All rights of reproduction in any form reserved.

196

USHA KASID ET AL.

radical species leading to DNA damage (Painter, 1980). These effects include cell cycle-specific growth arrest, repair of DNA damage, radicalscavenging proteins, gene mutations, malignant transformation, and cell killing. The mechanisms underlying sensitivity or resistance of certain mammalian cells to the toxic effects of y-radiation have been a topic of a number of studies (Taylor et al., 1975; Paterson et al., 1976; Weichselbaum et al., 1977; Arlett and Harcourt, 1980; Cox and Masson, 1980; Little et al., 1989; Little and Nove, 1990). T h e individual molecular events and specific genes involved in the resistance to y-radiation will affect both normal cellular protection from radiation damage and the failure of tumors to respond to radiation therapy. In recent years, several lines of investigation have coalesced to demonstrate a link between certain oncogenes and the phenomenon of cellular resistance to ionizing radiation. T h e raf-l l protooncogene has been associated with radiation-resistant human laryngeal squamous carcinoma-derived cells (Kasid el al., 1987a, 1989a),as well as radiation-resistant noncancerous skin fibroblasts from a specific cancer-prone family with Li-Fraumeni syndrome (Chang et al., 1987; Pirollo et al., 1989). Transfections not only of the ruf- 1 oncogene, but also of other protein-serine kinase oncogenes, mos and cot, have been shown to confer the radiationresistant phenotype on the recipient cells (Pirollo et al., 1989; Suzuki et al., 1992). An increase in level of radiation resistance was also demonstrated by transfection of Ha-, Ki-, or N-ras oncogene into murine hematopoietic cells or NIH/3T3 cells (FitzCerald et al., 1985; Sklar, 1988), and a synergistic increase in the level of radiation resistance of primary rat embryo cells was seen by cotransfection of ras and m y oncogenes (Ling and Endlich, 1989; McKenna et al., 1990b). Therefore, there is a growing body of evidence indicating that oncogenes play a major role in cellular resistance to ionizing radiation. Here we will review some of that evidence and attempt to formulate the themes underlying the oncogenic basis of radiation resistance. II. Radiation Response Phenotype

A. RELATIVE RADIORESISTANCE AND RADIOSENSITIVITY: RADIATION SURVIVAL PARAMETERS T h e central hypothesis concerning the outcome of the y-irradiation of eukaryotic cells suggests that loss of clonogenic capacity and cell death I Italicized, three-letter code refers to the gene (e.g., ruf); three-letter code with first letter in uppercase refers to the protein (e.g., Raf).

ONCOGENIC BASIS OF RADIATION RESISTANCE

197

result from damage to the structure and function of genomic DNA (Painter, 1980). T h e clonogenic assay for studying responses of cells to radiation is based on the method described by Puck and Marcus (1956). T h e effect of increasing doses of radiation on the clonogenic capacity is described by a radiation dose-survival curve (Alper, 1979), which generally consists of an initial curved component in the low dose range (the shoulder) and of an exponential component (the terminal slope). The single-hit, multitarget (target model) and the linear quadratic model are most commonly used to analyze cellular radiation survival. A graphic representation of the single-hit, multitarget model and the linear quadratic model of radiation survival are shown in Figs. 1A and 1B. T h e target model is based on the parameters Do and 6,where Do is the inverse of the terminal slope of the survival curve and fi, reflects the extrapolation of this slope to the ordinate (Fertil et al., 1980, 1988; Steele et al., 1983). Another parameter, D, is the measure of the shoulder of the survival curve as the terminal slope line intersects the abscissa (Withers, 1987). T h e linear quadratic model has two major parameters: a, the linear component characterizing the radiation response at low doses; and p, the quadratic component predominating at higher doses. T h e higher the value of a,the more linear is the response of cells to low doses of radiation and the more sensitive are the cells to the cytotoxic effects of X-rays (Hall, 1988). In addition, using a model-free parameter, the mean inactivation dose (b,the area under the survival curve plotted on linear coordinates; Fig. 1 C) has been employed as a measure of the intrinsic radiosensitivity of human cell lines (Fertil et al., 1984). Finally, a distinction between the relative radioresistant and radiosensitive phenotypes can be made by comparison of the values of the survival fraction following exposure to 2 Gy (SF,), the dose most usually delivered per session of radiotherapy (Fertil and Malaise, 1985). Parameters that describe the exponential component are used to define the radiosensitivity of cells, whereas those parameters that describe the shoulder reflect the capacity to repair radiation lesions and to restore clonogenicity. Quantitative evaluations of the cellular capacity to repair radiation-induced sublethal damage, potentially lethal damage, DNA single-strand breaks and DNA double-strand breaks are routinely performed employing the previously described and/or modified procedures (Elkind and Sutton, 1959; Philips and Tolmach, 1966; Belli and Shelton, 1969; Little, 1969; Kemp et al., 1984; Wlodek and Hittleman, 1987; Iliakis and Seaner, 1988; Iliakis et al., 1991). In this review, the definition of relative radioresistance (or radiosensitivity) of different cell types, o r transfectants derived thereof, applies to the slope and/or the shoulder of the radiation survival curve. Changes

A

C

B

0

10.0

i -1.o 1

5.0

I

Radiation dose (Gy) 1.o

1.0 C

0

0.5

-

c

0

E

5

.-

2

.c

2.0

4.0

6.0

8.0

10.0

12.0

Radiation dose (Gy) 2.0

4.0

6.0

8.0

10.0

12.0 t

0.5

0

E

LL

-

*' ,

Radiation dose (Gy)

LL

0.1 -

5 0.05 -

0.005

-

0.001

-

0.01

m

.? 0.1

E

$ 0.05

FIG. 1. AnalysiLof a standard radiation survival curve using the multitarget model (A), the linear quadratic model (B), and the concept of mean inactivation dose (D)(C) (adapted from Fenil and Malaise, 1985).

ONCOCENIC BASIS OF RADIATION RESISTANCE

199

in these regions of the curve may result in greater (or lesser) survival after radiation exposure.

B. CLONAL NATUREOF THE RADIATION RESPONSE Clonal heterogeneity has been reported in both normal and neoplastic cells. This phenomenon includes such diverse features as tumor histology, metastatic phenotype, growth characteristics, antigens, and transplantability (Poste et al., 1981; Brattain et al., 1981; Rubin et al., 1983; Heppner, 1984). Heterogeneity of the radiobiological response(s) among clonally derived cell lines has been the focus of several investigations (Hill et al., 1979; Leith et al., 1982; Weichselbaum et al., 1988; Kasid et al., 1989~).These studies have reported significant variations in the radiation survival parameters of clonally derived cell lines representing such diverse cell types as colon and lung carcinomas, human squamous cell carcinomas, and NIH/3T3 cells. Earlier reports have revealed that the cotransfection of human tumor DNA and pSV2Neo plasmid DNA into NIH/3T3 cells results in G418resistant NIH/3T3 clones that demonstrate a spectrum of radiation responses ranging from a relatively radioresistant phenotype (Do = 2.28 Gy) to a relatively radiosensitive phenotype (Do = 1.36 Gy) compared to the untransfected parental NIH/3T3 strain (Do = 2.02 Gy) (Kasid et al., 1989~).However, heterogeneity in radiation response was also observed when the untransfected single cell-derived NIH/3T3 clones were studied (range, Do = 1.06 Gy to 2.38 Gy) (Kasid et al., 1989~).In a recent report, the y-radiation survival of Syrian hamster (SHOK) cells was shown not to be affected by transfection of the neomycin gene (Suzuki et al., 1992). The above studies are in contrast to an earlier report suggesting that transfection of a neomycin resistance marker and clonal selection could impart radioresistance to both normal and tumor cells (F’ardo et al., 1991). In the latter report, these investigators also did not find significant heterogeneity in the radiation response of clonally derived untransfected primary rat embryo cells or glioblastoma cells. Because clonal cell lines derived from both NIH/3T3 and human tumor cell populations exhibit sufficient heterogeneity in radiation survival responses to make interpretation of oncogene effects exceedingly difficult (Leith et al., 1982; Weichselbaum et al., 1988; Kasid et al., 1989c), it seems reasonable to circumvent the heterogenous component of the radiation response phenotype by using pooled transfectant cell populations for studies of the effects of oncogenes on radiation survival response (Kasid et al., 1989a,b; Pirollo et al., 1989). However, in several reports discussed in this review, oncogene-transfected clonally derived

200

USHA KASID ET AL.

cell lines have been used to investigate changes in radiation sensitivity as a function of oncogene expression. Therefore, for the sake of simplicity, this review will be based solely on the interpretations of the radiation survival data as they have been reported in the literature.

111. Human and Rodent Cell Model Systems The initial approach used to identify the genetic factors associated with relatively radiation-resistant cells both from a human squamous cell carcinoma and from nontumorigenic skin fibroblasts (NSFs) of certain cancer-prone individuals was based on cotransfection of the representative human DNA and pSV2Neo plasmid DNA into NIH/3T3 cells followed by G418 selection and screening of the G418-resistant NIH/3T3 transfectant clones for the presence of human counterparts of the known oncogene sequences (Kasid et al., 1987a; Chang et al., 1987; Pir0110 et al., 1989). Subsequently, cloned cDNA of the candidate human protooncogene (raf-1) was expressed in human squamous carcinoma cells in an attempt to determine the phenotypic changes in the recipient human cells (Kasid et al., 1989a). A similar approach was used in studies using other human cell lines and rodent cell lines in order to determine the radiobiological consequences of the expression of a variety of protooncogenes (Pirollo et al., 1989, Table I). This section will (a)summarize the various cell systems that have been studied to date and (6) identify the candidate oncogenes that appear to have a potential role in the regulation of radiation resistance. A. RADIORESISTANT HUMAN SQUAMOUS CELLCARCINOMAS Relatively radioresistant tumor cell lines (SQ-2OB, SCC-35, JSQ-3) were established in culture from squamous cell carcinomas of head and neck origin following the full course of radiotherapy (Weichselbaurn et al., 1989). DNA-mediated gene transfer was used to investigate the genetic factors associated with these tumor cells. The human raf-1 sequences were found in the NIH/3T3 clones transfected with these DNAs. A majority of the NIH/3T3 transfectants were highly tumorigenic in athymic mice (Kasid et al., 1987a, 1993). Significantly, the NIH/3T3 transfectant clone lacking the kinase region (cl 21) was nontumorigenic, as were the control untransfected NIH/3T3 cells (Kasid et al., 1987a). The identification of the loss of the regulatory domain and retention of the kinase domain in the highly tumorigenic clones supports the hypothesis that deletion of the regulatory region results in the

20 1

ONCOGENIC BASIS OF RADIATION RESISTANCE

TABLE 1

ONCOGENE EFFECTS ON RADIATION RESPONSE Oncogeneu v-abl

Cell type used for oncogene transfection

N 1H/3T3

Changes in responseb NC

Sklar el al. (1986); Pirollo et al. (1989) FitzCerald et al. (1991)

t

Suzuki et al. (1992)

NlH/3T3 and murine hematopoietic cells, 32D c13 c-cot

Syrian hamster OsakaKanazawa (SHOK) cells

FitzGerald et al. ( 1990) Suzuki et al. (1992) Pirollo et al. ( I 989)

32D c13 SHOK cells v-fes V Y P

c-fm

v-fos v-mas c-myc

References

NIH/3T3 SHOK cells

Suzuki et al. (1992)

N I H13T3 32D c13

Sklar et al. (1986) FitzGerald et al. (1991)

NI H/3T3

Sklar (1988) FitzGerald et al. (1991)

N IH/3T3 NlH/3T3 SHOK cells N 1H /3T3 Rat embryo cells (REC)

FitzGerald et al. (1990) Pirollo et al. (1989) Suzuki et al. (1992) Pirollo et al. (1989) Ling and Endlich (1989) McKenna et al. (1990a) Kasid el al. (1989b)

lmmortalized human bronchial epithelial cells (Beas-2B) SHOK cells

Suzuki et al. (1992)

v-myc

32D c13

FitzGerald et al. (1991)

c-raf- 1

Human SCC, (SQ-2OB) NIH/3T3 Beas-PB Beas-2B

Kasid et al. (1989a) Pirollo et al. ( I 989) Kasid el al. (1989b)

c-raf-I and c-myc c-raf-I (AS) c-H-rm

SQ-20B NlH/3T3

Kasid et al. (1989b)

.1

Kasid et al. (1989a)

NC

Sklar (1988) Pirollo at al. (1 989); Samid et al. (1991) Grant et al. (1990)

t Transformed human embryo retinal cells (HER)

NC

(continued)

202

USHA KASID ET AL.

TABLE I (Continued )

Oncogenea EJ-Tu

v-H-T~

Cell type used for oncogene transfection

Changes in responseb

References

N I H13T3

t

REC

f (m)

Human mammary epithelial cells, (HBL 100) Immortalized human keratinocytes (HaCaT)

NC

NC

Mendonca et al. (1991)

NIH/3T3

t t (Id)

Sklar (1988) FitzGerald et al. (1990) Suzuki et al. (1992)

t

Sklar (1988) Harris et al. (1990) Szuki et al. (1992)

Sklar (1988); Pirollo et al. ( 1989) Ling and Endlich (1989); McKenna et al. (1990a) Alapetite el al. (1991)

SHOK cells

NC

NIH/3T3 Rat kidney epithelial cells SHOK cells

J. NC

N I H13T3

t

HER SHOK cells REC

NC

REC

t

McKenna et al. (1990a)

V-Sic

32D c13

NC

FitzGerald et al. (1990)

v-STC

N I H13T3 32D c13 Rat fibroblast cells (LA-24) Multidrug-resistant LA-24 cells

J.

NC

FitzGerald et al. ( 1990) FitzGerald et al. (1990) Shimm el al. (1992)

t

Shimm et al. (1992)

v-K-T~s

N-rm

EJ-rm and c-my EJ-rm and

t t

FitzGerald et al. (1985); Sklar (1988) Grant et al. (1990) Suzuki et al. (1992) Ling and Endlich (1989)

v-my

t (Id)

Oncogenes are alphabetically arranged on the basis of their three-letter code. AS, antisense cDNA. t , evidence suggesting increase in relative radiation resistance (Do or D, value); 1, evidence suggesting decrease in relative radiation resistance (Do value); NC, no change reported compared to the experimental control; f (m). moderate increase in relative radioresistance; t (Id). increase in radioresistance reported at low dose range y-irradiation.

ONCOGENIC BASIS OF RADIATION RESISTANCE

203

catalytic activation of the kinase domain (Kasid et al., 1987a; Pfeifer et al., 1989a; Stanton et al., 1989; Heidecker et al., 1990). Although the identification of human m f - 1 sequences in the NIH/3T3 transfection assay has been reported using a variety of tumor DNA samples (Shimizu et al., 1985; Fukui et al., 1985; Ishikawa et al., 1986; Stanton and Cooper, 1987), the presence of human ruf-1 sequences in all of these human a h containing NIH/3T3 transfectant clones derived from transfection of these radioresistant tumor cell-derived DNAs is remarkable. Because the clonally derived NIH/3T3 cell lines (untransfected) present a heterogenous population in terms of their radiation sensitivities (Do values), a direct correlation between activated raf-1 and radiation response was not feasible in the above-described NIH/3T3 transfectants (Kasid et al., 1989~). Given the complex nature of cellular radiation sensitivity, one way to demonstrate a correlation between raf- 1 activation and resistance to ionizing radiation in tumor cells is to perform radiation survival analysis on a pooled cell population in which rafi 1 expression has been inhibited by transfection of antisense human rafil cDNA. Indeed, this antisense RNA approach has been successfully used to demonstrate that the down-regulation of endogenous rafi 1 expression leads to decreased tumorigenicity and enhanced radiation sensitivity of human squamous carcinoma-derived cells, SQ-20B (Kasid et al., 1989a) (Fig. 2). These data provide evidence for the role of raf-1 function in radiation resistance. Furthermore, these studies demonstrate that the antisense vector-based strategy to inhibit the biological outcome of a specific gene function is also applicable to the radiation response phenotype. T h e modulatory effect on radioresistance due to antisense c-raf- 1 expression was evident only during the early passages in culture, as has been observed by other investigators using antisense RNA constructs (Bolen et al., 1987). Nevertheless, modifications of the antisense RNA strategy using inducible vectors or inhibition of Raf- 1 function by antisense deoxyoligonucleotides (Kasid et al., 1991a) are promising approaches for further investigations into the oncogenic basis of radiation resistance. B. SKINFIBROBLASTS FROM

A

CANCER-PRONE FAMILY

T h e cancer family syndrome originally described by Li and Fraumeni (1969)is characterized by a constellation of tumor types including breast carcinoma, soft tissue sarcoma, brain tumors, osteosarcoma, and leukemias. These diverse neoplasms, which occur in a dominantly inherited

204

USHA KASID ET AL.

0.005

0.001

I -

0 100

300

500

700

900

Radiation Dose (cGy)

FIG. 2 . Clonogenic radiation survival curves for c-raf-1 (S) and c-raf-1 (AS) cDNAtransfected SQ-2OB cell populations (adapted from Kasid el al., 1989a). The experimental points are plotted &SEM. The Do values were 310 and 191 cCy for c-raf-I (S) cDNA and for c-raf-1 (AS) cDNA-transfected SQ-POB cell populations, respectively.

pattern, develop at an early age with multiple primaries appearing in the same individual. In some instances they appear to be related to carcinogenic exposures, including ionizing radiation. Recently, inherited germline mutations in the tumor suppressor gene p53 were simultaneously identified by two different groups in a total of six different LiFraumeni families (Malkin et d.,1990; Srivastava et al., 1990). These mutations, which are located in a highly conserved region of the gene, are believed to represent the primary inherited defect predisposing these individuals to develop cancer. One particular Li-Fraumeni family has been studied more exten-

ONCOGENIC BASIS OF RADIATION RESISTANCE

205

sively than others. This specific family, originally described by Blattner et al. (1979), involves 18 affected descendants of a single individual through six generations. Neoplasms in 3 members of the family may have been induced by occupational exposure or therapeutic radiation. One member developed polycythemia Vera after working for 5 years in a factory producing heavy water, a second family member with lung adenocarcinoma worked in a foundry, and an osteosarcoma was diagnosed in a third individual within the field of radiotherapy for an earlier neurilemmoma. In addition to the inherited germline mutation in codon 245 of p53 identified in this family (Srivastava et al., 1990), examination of nontumorigenic skin fibroblast (NSF) cell lines from individuals in the cancer-prone lineage revealed a three- to eightfold elevation in the level of c-myc expression relative to that found in unrelated control fibroblast cells (Chang et al., 1987). Moreover, by means of the NIH/3T3 transfection assay, the presence of an activated raf-1 oncogene has also been detected in the NSFs from at least one family member (Changet al., 1987). It is also noteworthy that the NSF cell lines from most members of this family have been found to display the unusual property of resistance to the killing effects of ionizing radiation (Bech-Hansen et al., 1981) (Fig. 3). Five of the family members examined demonstrated an increased level of radiation resistance relative to the normal controls. In one instance multiple cell lines representing biopsies taken from the same individual but at different times were included in the study. T h e differences in the D,,values were statistically significant (P< 0.001) with the fibroblast line from individual IV-19 having one of the highest levels. Furthermore, no correlation was found between the presence of the inherited p53 mutation and the radiation-resistance phenotype observed in individuals in this family. These results support the notion that the radiation resistance may be one of the inherited defects in this specific cancer-prone family, although this clearly is not the case for all LiFraumeni families (Little et d., 1987). Moreover, heterogeneity does exist among these kindred inasmuch as not all of the families previously identified as having Li-Fraumeni syndrome were found to contain a germline mutation in the tumor suppressor gene p53 (Santibanez-Koref et al., 1991). An association between the radiation-resistant phenotype present in these family members and the activated r a . 1 gene was demonstrated when a tertiary NIH/3T3 transformant derived from DNA of the NSF cell line with one of the highest levels of radiation resistance was assessed for its resistance to killing by y-radiation. This human raf- 1-containing mouse cell line demonstrated an increased level of radiation resistance

206

USHA KASID E T A L .

I

I

I

I

I

IIL

PV

Br

I

I

P

BT BT

BT

Br

ss

# :Single primary cancer

9I: BT

0s

in deceased female : Double primary cancer in proband

FIG.3. Partial pedigree of a specific cancer-prone family with Li-Fraumeni syndrome (modified from Bech-Hansen et al., 1981). Shown here is a branch of a much larger pedigree that traces cancers over five generations in three separate lineages from a woman who died of breast cancer in 1865 (Blattner el al., 1979). Individuals whose normal skin fibroblast cell lines were found to demonstrate an increased level of radioresistance are designated “R.”N, normal level of radiation response; OS, osteogenic sarcoma; S S , soft tissue sarcoma; BT, brain tumor; Br, breast cancer; PV,polycythemia Vera; Le, leukemia; Co, colon cancer; NL, neurilemrnoma.

relative to that of the untransfected NIH/3T3 cells, a level which approximated that observed in the radiation resistant parental NSF cell line (Pirollo et al., 1989)(Fig. 4).This report of the relationship between activated rafand radiation resistance is among the first to link this phenotype to the function of a specific oncogene. Two additional features of the NSF cell lines from members of this cancer-prone family that may be related to its radiation-resistant phenotype have been examined. The first is the level of activity of the topoisomerases in these cells. The activities of both topoisomerase I and I1 in the NSFs of the family were examined (Cunningham et al., 1991). The activity of topoisomerase I1 was found to be elevated in the radiation-resistant cell lines of this family but not in that of the non-radiationresistant cell line derived from a normal spouse (V-7).Topoisomerase I activities were comparable in all of the lines tested. The second feature is the presence of an altered DNA de novo synthesis in the NSFs of family members. The radioresistant NSF cell lines from the proband (VI-2)and his great uncle (IV-19),which both sustain and repair radiogenic DNA damage at rates comparable to those of non-

ONCOGENIC BASIS OF RADIATION RESISTANCE

207

600-.

cA

ul

550 --

3

% 450-

T V 1 OT

400-

350-

t

rn

0-NSF 2800 A-3T3lraf 0 3T3lmos Q A-3T3IEJ-ras 0-3T3lLTR- ras

-

U

500-

0'

A

T 111

0 T

0- NIH3T3 A 3T3lmyc V-3T3Ifes 3T3labl

-

-

FIG.4. Scattergram of the D I Ovalues of various NlH/JTS-transformed cell lines demonstrating an increased level of radiation resistance for cell lines transformed by the raf, mos. or ras oncogene, relative to the parental NIH/3T3 cell line (modified from Pirollo et al., 1989). Each point represents the mean of two to five experiments 2 standard error. T h e error bars for NIH/3T3,3T3/abl, 3T3/mos, and 3T3IEJ-ras are absent due to the fact that the standard errors for these four cell lines (k3.6, 26, 2 7 , and 2 5 , respectively) are too small to be visualized within the parameters of the graph. NSF 2800 is the radioresistant normal skin fibroblast cell line derived from individual IV-19 in the family pedigree (Fig. 3) and is the cell line from which NIH13T3 transformant 3T3lrafwas derived (Chang et al., 1987).

radiation-resistant fibroblast cell lines, possess what has been described as an error-prone semiconservative DNA synthesis mechanism (Paterson et al., 1985). After treatment with y-rays (60Co), these cells displayed a longer lag time prior to initiation of synthesis and sustained a higher level of synthesis for a protracted period of time when compared to nonradiation-resistant fibroblast cells. It is of interest to note that the abnormality in DNA synthesis evident in these radiation-resistant fibroblast cell lines is the exact opposite of that seen in radiation-sensitive AT cells where DNA synthesis is appreciably reduced relative to normal cells (Houldsworth and Lavin, 1980). Therefore, this Li-Fraumeni family is a naturally occurring system that implicates the mf oncogene in the genesis of radioresistance. Since the radiation-resistant NSF cell lines are not tumorigenic, this model also provides evidence that radiation resistance and transformation are not necessarily coincidental phenomena (see also Section V). Furthermore, it suggests that events in the nucleus, such as those involved in DNA conformation, synthesis, and repair, may be important factors in cellular radiation resistance.

208

U S H A KASID E T A L .

C. NIH/3T3 TRANSFECTANTS The earliest report of a possible link between an activated oncogene and a radiation-resistant phenotype in NIH/3T3 cells showed that transfection of the human N-ras oncogene was able to increase the level of relative resistance of the recipient cells at a relatively high radiation dose rate (200 cGy/min) (FitzGerald et al., 1985). Subsequent studies demonstrated that the effect of activated oncogenes on the radiation-resistance level of NIH/3T3 cells is not a generalized phenomenon but is particular to specific oncogenes (Sklar et al., 1986; Sklar, 1988; Pirollo et al., 1989; Suzuki et al., 1992); this will be discussed in greater detail below. The presence of v-H-ras, v-K-ras, EJ-ras, and N-ras oncogenes were found to significantly increase the radioresistance levels of NIH/3T3 cells, whereas NIH/3T3 cells transformed by either vfm or v-a61 did not exhibit changes in radiation sensitivity relative to the untransfected cells (Sklar et al., 1986; Sklar, 1988). A similar effect on the radiation response of NIH/3T3 cells was also demonstrated by overexpression of the normal H-ras protooncogene (Pirollo et al., 1989). Moreover, a significant degree of radiation resistance was conferred on NIH/3T3 cells expressing members of the protein-serinelthreonine kinase family (rufand mos) (Fig. 4). The effects of oncogenes appear to vary depending on the dose rate of y-radiation employed. Although the experiments using a high dose rate of the y-radiation (60Co; = 120 cGy/min) demonstrated no change in the radiation response of NI H/3T3 cells transfected with v-abl, vfm, o r v-fos (Pirollo et al., 1989), other reports using low-dose-rate y-radiation ( 13’Cs; 5 cGy/min) have indicated a significant increase in the radiation resistance of NIH/3T3 cells expressing these oncogenes (FitzGerald et al., 1990, 199 1). T h e precise mechanism(s) and significance underlying these differential effects on radiation response due to the differences in the dose rate of y-radiation employed are unclear at present. D. OTHER CELLLINES

T h e synergistic effect of EJ-ras and c-myclv-myc on the radiation-resistant phenotype has been reported in studies using primary rat embryo cells, REC (Ling and Endlich, 1989; McKenna et al., 1990b). By itself, EJ-ras had only a limited effect on the radiation response of RECs, whereas the myc gene had no effect (McKenna et al., 1990a,b). Together these two oncogenes exhibited a significant increase in radioresistance over the parental cells. These observations suggest the possibility of a putative interaction among the products of the ras and m y oncogenes in signaling mechanisms underlying the radioresistant phenotype.

ONCOCENIC BASIS OF RADIATION RESISTANCE

209

I n a recent report, resistance to y-rays was conferred by the introduction of v-mos, c-cot (both genes encoding cytoplasmic protein serine kinases), o r N-ras gene into Syrian hamster (SHOK) cells (Suzuki et al., 1992). Interestingly, the radiation sensitivity of these cells did not change upon the transfection of the v-fgr, c-myc, v-erb-B, Ha-ras, or K-ras gene. T h e morphological transformation associated with the induction of v-src did not correlate with the radioresponsiveness of rat fibroblast cells (LA-24). However, in the multidrug-resistant clones of these rodent cells, a significant increase in radioresistance has been reported to correlate with the induction of v-src (Shimm et al., 1992). Murine hematopoietic progenitor cells, 32D c13, have also been analyzed for the oncogenic effects on radiation response using low-dose-rate y-radiation. These experiments suggest that with the exception of v-szi, the other oncogenes tested, namely v-erb-B, v-abl, v-src, c$m, and v-myc, are all able to induce radiation resistance in 32D c13 transfectant cells (FitzGerald el al., 1990, 1991). T h e increase in radiation resistance of immortalized human bronchial epithelial cells (Beas-2B) by the expression of raf-1 has also been demonstrated (Kasid et al., 1989b). These reports suggest that the increased expression of raf- 1 is sufficient to increase radioresistance in the nontumorigenic Beas-2B cells, whereas c-myc expression does not change the radiation dose response. In addition, Beas-2B cells transfected with a combination of raf-1 and c-myc genes demonstrated no further increase in the level of radiation resistance (Do value). However, this does not rule out possible synergism between rafand myc in other cell systems. Taken together, the studies to date suggest that Raf-1 plays a dominant role in the radiation-resistant response of both human and rodent cells. Finally, the role of the ras oncogene in the radiation response of human cells is somewhat intriguing. To date, three different human cell model systems have been examined in an effort to elucidate the role of the ras gene product in the radiation response of human cells. T h e N-ras and c-H-ras genes did not seem to alter the radiation sensitivity of transformed human embryo retinal cells (Grant et al., 1990) and EJ-ras transfection and expression had no effect on the radiation response of human mammary epithelial cells (HBL 100) and immortalized human keratinocytes (Alapetite et al., 1991; Mendonca et al., 1991). T h e complex basis of the ras gene-induced effects on radioresistance is also evident from another study in which the radiosensitization of rat kidney epithelial cells containing K-ras has been reported (Harris et al., 1990). Among other possibilities, the differentiation state of the cells and/or a cooperation between another gene and ras may be required to modulate

210

USHA KASID ET AL.

the radiosensitivity of these cell types. Alternatively, a high level of inherent radioresistance may be a limiting factor in certain cell types. Moreover, such reports serve to remind us of the fact that these types of studies can be complicated by both the methodology and the biology of the system.

IV. Mitogenic Signals and Radiation Response The normal counterparts of many of the known oncogenic products have been shown to interact with one another as components of a proposed signal transduction pathway that serves to transmit messages from the cell membrane to the nucleus (Weinstein, 1988a). On the basis of antibody-blocking experiments, Raf- 1 has been placed downstream of Ras in this pathway (Smith et al., 1986; Rapp et al., 1988b; Morrison et al., 1989).As discussed earlier, the r a . 1 oncogene has been implicated in the expression of the radiation-resistant phenotype (Chang et al., 1987; Kasid et al., 1987a, 1989a,b; Pirollo et al., 1989). Additionally, since oncogene products upstream of Ras and Raf in the proposed signaling pathway are able to induce the resistant phenotype and reports from several other laboratories have indicated that activated ras oncogenes, or a combination of ras and myc oncogenes, can influence the radiation resistance level of cells into which they are transferred (Table I), it appears that the expression of radiation resistance may be under the control of a similar type of signal transduction mechanism. Protooncogenes have been shown to code for growth factors and growth factor receptors such as platelet-derived growth factor (PDGF) B-chain, truncated epidermal growth factor (EGF) receptor, fibroblast growth factor (FGF)-related growth factor, colony-stimulating factor (CSF-1) receptor, and nerve growth factor (NGF) receptor (Hunter, 1991).The effect of the oncogenefms, which codes for the mutant CSF-1 receptor protein-tyrosine kinase on radiation response has been examined. This gene has been found to be incapable of modulating the radiation sensitivity of NIH/3T3 cells (Sklar et al., 1986; Sklar, 1988) except at low doses of radiation (FitzGerald et al., 1990). Members of the family of nonreceptor protein-tyrosine kinases seem to be incapable of effecting the level of radiation resistance. The oncogenesfes, abl, and fgr did not alter the radiosensitivity of the recipient NIH/3T3 or Syrian hamster (SHOK) cells (Pirollo et al., 1989; Suzuki et ad., 1992).The exception appears to be the Src protein kinase. The v-src oncogene confers radioresistance on murine hematopoietic cells 32D c13 (at a low-dose-rate y-radiation) (FitzGerald et al., 1990). However, Src protein-tyrosine kinase induction did not increase the radioresistance in

ONCOGENIC BASIS OF RADIATION RESISTANCE

21 1

rat fibroblast cells (LA-24) and appeared to increase the sensitivity of NIH/3T3 cells (FitzGerald et al., 1990). Interestingly, a significant radioresistance was noted in the multidrug-resistant variants of LA-24 cells upon induction of the Src kinase (Shimm et al., 1992). G proteins, which are involved in the reversible exchange of GTP for GDP with concomitant activation of an effector protein, also have a role in the signal transduction pathway. T h e ras p2 1 protein functions as a G protein (Trahey and McCormick, 1987; Vogel et al., 1988) and has been implicated in the activation of phospholipase C (Berridge and Irvine, 1984; Chabre, 1987; Cockroft, 1987; Marshall, 1987; Katain and Parker, 1988). T h e role of the ras gene in radiation resistance has been studied by several investigators, using not only the NIH/3T3 transfection assay (FitzGerald et al., 1985, 1990; Sklar, 1988; Pirollo et al., 1989; Samid et al., 1991), but also the primary rat embryo fibroblast cells (REC) (Ling and Endlich, 1989; McKenna et al., 1990a), Syrian hamster cells (Suzuki et al., 1992), rat kidney epithelial cells (Harris et al., 1990), and human cells (Grant et al., 1990; Alapetite et al., 1991; Mendonca et al., 1991). T h e presence of any member of the ras family, activated through either mutation o r overexpression, was sufficient to significantly increase the level of the radiation resistance in the recipient NIH/3T3 cells. N-rtls expression but not Ha-ras or Ki-ras expression was able to increase the radioresistance in Syrian hamster (SHOK) cells Suzuki et al., 1992), and only a moderate increase in radioresistance of REC was noted following the transfection of EJ-ras (Ling and Endlich, 1989; McKenna et al., 1990a,b). However, the cotransfection of EJ-ras and c-myclv-myc led to a significant increase in the relative radioresistance of REC (Ling and Endlich, 1989; McKenna et al., 1990b). In contrast, rat kidney epithelial cells containing K-ras had increased radiation sensitivity with ras activation. Human cells, however, did not show changes in the radiosensitivity in response to the ras expression. Although a cooperation between oncogenes may be required for the development of in vitro radioresistance in human cells, the evidence is not yet available. T h e cytoplasmic protein-serine/threonine kinases play a central role in signal transduction and are also implicated as one focal point in the pathway to the radiation-resistant phenotype. The prototype for such serine/threonine kinases, protein kinase C (PKC), is a principal effector for signaling mediated by phosphotidylinositol-4,5-biphosphatehydrolysis and is the vehicle by which a number of tumor promoters act (Weinstein, 1988b). Based on Raf-1 inhibition experiments, it is suggested that PKC-dependent mitogenic signals are transduced by PKCmediated activation of Raf-1 kinase in NIH/3T3 cells (Kolch et al., 1991). However, the PDGF effects on Raf-1 are seen in fibroblasts that have

212

USHA KASID ET AL.

been chronically treated with a tumor promoter to down-regulate PKC (Morrison et al., 1988). Therefore, it appears that PKC is not always an effector for the activation of Raf- 1 kinase. However, the possibility exists that PKC may also be affecting the cellular response to y-radiation (Weichselbaum et al., 1991). Most important, cot, mos, and the raf family of oncogenes all encode protein-serine kinases (Aoki et al., 1991; Seth and Vande Woude, 1988; Rapp et al., 1988b) and all have been associated with the acquisition of radiation-resistant phenotype (Kasid et al., 1989a,b; Pirollo et al., 1989; Suzuki et al., 1992). Raf-1 protein kinase appears to be at a central location in the signaling pathway to radiation resistance. An association between the raf- 1 gene and the radiation-resistant phenotype in the NSFs from a specific cancer-prone family with Li-Fraumeni syndrome has been established (Pirollo et al., 1989). Transfection of antisense human raf-1 cDNA into radioresistant human squamous carcinoma cells leads to the down-regulation of endogenous raf 1 expression, delayed tumor growth, and enhanced radiation sensitivity (Kasid et al., 1989a). In addition, the transfection of human raf- 1 cDNA into immortalized human bronchial epithelial cells (Beas-2B) is sufficient to increase the radioresistance of Beas-PB-raf transfectants (Kasid et al., 1989b). These studies suggest a close link between the radiation-resistant phenotype and the function of raf-1 in human cells. Increased phosphorylation and elevated enzymatic activity of Raf- 1 protein kinase have been demonstrated in numerous cell types tested in response to a variety of ligands (Rapp, 1991). In fact, Raf-1 has been found to be complexed with at least two growth factor receptors, EGF-R (App et al., 1991) and PDGF-R (Morrison et al., 1989). Oncogenes shown to have homology to one of the EGF receptors and to PDGF (HER-2 and sis, respectively) have been shown to increase radiation resistance of NIH/3T3 cells (Pirollo et al., 1991). Further evidence for the importance of Raf-1 protein kinase in the signaling pathway leading to the radiation resistance is suggested by the report on the radioprotective effects of granulocyte macrophage-colony-stimulating factor (GM-CSF) (Waddick et al., 1991), which has been shown to increase the activity of Raf-1 protein kinase (Carroll et d., 1991). Therefore, it appears that the functional activation of Raf-1 protein kinase either via direct alteration in the product itself or via modulation of the upstream signals may be sufficient or even necessary for the induction of the molecular/biochemical events leading to radioresistance. The ultimate targets of signal transduction in the nucleus are probably the least understood part of the pathway. However, there are some

ONCOGENIC BASIS OF RADIATION RESISTANCE

213

indications of what may be occurring there. The mitogenic signal(s) received by Raf-1 protein kinase may be forwarded to the nucleus by phosphorylation of transcription factors such as AP-1, which is an association of the products of protooncogenes fos andjun (Chiu et al., 1988; Rauscher et al., 1988; Sassone-Corsi et al., 1988; Bruder et al., 1992). Inactivation of Raf- 1 protein kinase reportedly blocks the transcription of a reporter gene from the promoter containing the AP- 1 DNA binding motif (Bruder and Rapp, 1991; Bruder et al., 1992). These studies indicate that AP-1 requires Raf-1 protein kinase for the transactivation of transcription. T h e effect ofjun on intrinsic radioresistance is not known but fos has no effect on the radiation response of NIH/3T3 cells at low doses (FitzCerald et al., 1990). Experiments using purified components suggest that the Jun but not the Fos component of AP-1 is phosphorylated by Raf-1 (Heidecker et al., 1992). The nuclear oncogene, myc, coding for Myc protein which is downstream of Raf- 1 in the proposed mitogenic signal transduction pathway, is unable by itself to increase the level of radiation resistance in NIH/3T3 cells (Pirollo et al., 1989). Similar results were obtained using primary rat embryo cells (REC) and human bronchial epithelial cells (Beas-2B) (McKenna et al., 1990a; Kasid et al., 1989b). However, when both ras and myc genes were introduced into REC, a synergistic increase in radiation resistance was noted (Ling and Endlich, 1989; McKenna et al., 1990a). In transfection experiments utilizing Beas-2B cells, cotransfection of the raf and myc genes apparently did not induce a synergistic level of radiation resistance. However, this does not necessarily rule out the possibility of cooperation between these two oncogenes. It is conceivable that there may be an upper limitation to the level of detectable in vitro radioresistance (Do value), such that, in this instance, any contribution by Myc may not have been discernible. The support for the combined role of c-myc and c-raf-1 in radioresistance is derived from several lines of investigations. Amplification of c-myc has been associated with an in vitro radiation resistance of a variant of small cell lung carcinoma (oat cell) (Carney et al., 1983; Little et al., 1983), as well as with certain human lung cancer cell lines (Carmichael et al., 1989). Interestingly, a high level of expression of the raf-1 gene, along with a concomitant activation of Raf-1 protein kinase activity, has been found in approximately 60% of all lung cancers (Rapp et al., 1988a). Moreover, an activated raf-1 oncogene was identified via the NIH/3T3 transfection assay, as the transforming gene in a human lung carcinoid (CA1-154) (Stanton and Cooper, 1987). In this same vein, the radiation-resistant NSF cell lines from a specific cancer-prone family with Li-Fraumeni syndrome exhibit both an elevated level of c-myc

214

USHA KASID ET AL.

expression and the presence of an activated raf-1gene, as suggested by the NIH/3T3 transfection procedure. Furthermore, c-my expression is known to be regulated at the level of the cell cycle. Therefore, these data indicate two possibilities: (a)a cooperativity toward radioresistance may exist between the raf and the m y genes and (6) genes such as m y whose expression is also regulated in a cell cycle-dependent manner may modulate in vitro radiosensitivity. The reports available so far suggest the possibility of a signal transduction pathway for radiation resistance analogous to that suggested for cell growth and proliferation or differentiation. Although many of the intermediate steps in this pathway have not yet been identified, there is strong evidence that the cytoplasmic serinelthreonine kinases, particularly Raf-1, play a central role. Several possibilities arise by which multiple signals may interact to influence the radiation-resistant phenotype. In one instance, proteins that already exist in the activated form interact with one another to generate a cell population that is selected for after exposure to radiation. Alternatively, exposure of cells to radiation precipitates events in the nucleus through changes in chromatin. These changes may trigger a cascade of events similar to those described above, leading to cell survival. I n addition, the ability of cells to delay progression through the cell cycle following DNA damage (G, and/or G, arrest) may be an important determinant of cell survival. It is also possible that the key component of the signal directly involved in radioresistance is initiated after exposure to y-rays. For example, radiation is known to induce programmed cell death (apoptosis) (Kerr and Searle, 1980).More recently, the extent of radiation-induced apoptosis has been shown to differ markedly between radiosensitive and radioresistant tumors and correlated with their respective response to local tumor irradiation (Stephens et al., 1991).It seems very likely that the products of certain oncogenes may counteract radiation-induced apoptosis. It is tempting to speculate that this is accomplished by an oncogene-activated effector protein(s), which may direct the normal replication machinery to read through the damage, thereby allowing the cells to proliferate. In support of the role of oncogenes in apoptosis, evidence is beginning to emerge that suggests a role for v-Raf in the suppression of this physiological control mechanism (Troppmair et al.,

1992). Since much is still unknown about the oncogenic interaction(s) in signal transduction, and about the biochemical and physiological bases of radioresistance, the working hypothesis put forth here may likely be modified with the advancement of our knowledge.

ONCOGENIC BASIS OF RADIATION RESISTANCE

215

A majority of the relevant data in the literature is consistent with the above hypothesis. However, some discrepancies do exist. The c-myc oncogene, which was shown not to increase the radiation resistance level of NIH/3T3 cells, rat embryo cells (REC) and human bronchial epithelial cells (Pirollo et al., 1989; Kasid et al., 198913; McKenna et ad., 1990a) did so in one study using RECs (Ling and Endlich, 1989) and also in one study using the hematopoietic progenitor cell line, 32D c13 (albeit at low dose rate only) (FitzGerald et al., 1991). NIH/3T3 cells transformed by abl or fms were found not to be radiation resistant (Sklar et al., 1986; Sklar, 1988; Pirollo et al., 1989). However, in the 32D c13 cells both oncogenes were able to induce radiation resistance, again at low dose rate of y-radiation (FitzGerald et al., 1991). Evidence from clinical studies indicates that different cell types have differing responses to radiation. In fact, studies, primarily with mice, demonstrated that in whole-body irradiation, the cells of the hematopoietic and the gastrointestinal systems are the most sensitive to the killing effects of ionizing radiation (Bond et al., 1965; Bond, 1969; Broerse and MacVittie, 1984). T h e observed effect of oncogenes on radiation resistance may also vary depending on the cell types used in the study (human vs mouse cells; fibroblasts vs epithelial cells or keratinocytes), further complicating the issue. Moreover, some cell types that display a significant level of relative radiation resistance (as measured by the relatively high Do value) may be inappropriate for use in such studies. In support of the latter argument, no change in the Do value of primary human keratinocytes (Do = 2.24 Gy) was observed following immortalization by SV-40/AD-12 virus (Do = 2.43 Gy) or subsequent transformation of the immortalized human keratinocytes by KiMSV infection (Do = 2.51 Gy) (Kasid et d., 1987b). T h e presence of discrepancies, such as those discussed above, underscore the complexity of the factors contributing to radiation resistance and the importance of future studies to achieve a better understanding of the molecular mechanisms involved.

V. Transformation and Radiation Resistance Based upon the above data, it is evident that the signal transduction pathways for mitogenesis and radiation resistance may have some elements in common. Although these signals may intersect with one another at some points, they obviously represent independent pathways that are neither identical nor even concurrent. Support for this is derived from the following reports. It has been well established that ras alone is incapable of transforming primary cells (REC); a cooperative

2 16

USHA KASID ET AL.

oncogene which can immortalize the cells such as myc o r E1A is required for transformation. However, nontumorigenic ras-containing RECs were found to be more radiation resistant than the recipient RECs (Ling and Endlich, 1989). Further evidence of the separation of the two phenotypes is seen in a study of ras-transformed and phenotypically revertant NIH/3T3 cells. In these studies both the tumorigenic and the revertant, nontumorigenic NIH/3T3 cells expressed high levels of ras and exhibited an elevated level of resistance to radiation indicating that, although ras is clearly responsible for the radiation-resistant phenotype of these cells, perhaps another gene is necessary for the transformed phenotype (Contente et al., 1990; Samid et al., 1991). In addition, a distinction between transformation and radioresistance is provided by a report on rat fibroblast cells infected with a temperature-sensitive mutant of v-src (LA-24). In these studies, induction of v-src resulted in the morphological transformation of LA-24 cells but did not change their radiosensitivity, whereas in multidrug-resistant variants, the v-src induction caused a significant increase in radioresistance (Shimm et al., 1992). In the case of the ruf oncogene also, a division between oncogenic transformation and radiation resistance is evident. As mentioned earlier, the radiation-resistant NSF cell lines from a cancer-prone family with Li-Fraumeni syndrome are clearly nontumorigenic. Moreover, immortalized, nontumorigenic human bronchial epithelial cells transfected with the human r.f-1 cDNA are significantly more radioresistant compared to the untransfected cells or the cells transfected with the Zip-neo vector alone (Kasid et al., 1989b; Pfeifer et ul., 1989b). Therefore, it appears that the Raf-1 protein kinase has a dual role, one in mediating the malignant phenotype and a second in the DNA damage and repair cascade. The dissociation between the two pathways is also apparent from the data presented in Table I. Even though capable of a significant degree of transformation, the v-fm, v-fes, v-abl, o r v - f p oncogene does not seem to contribute to the radiation-resistant phenotype. T h e final destination for the signal in the nucleus may be the most critical determinant in differentiating between the two phenotypes. T h e challenge for future studies is to elucidate the mechanism(s) of this new role for certain protooncogene products, i.e., involvement in the cellular capacity to respond to damage and repair induced by y-radiation.

VI. Radiation-Resistant Phenotype: Cause or Effect Cellular radiation sensitivity is a complex function of diverse molecular, biochemical, genetic, and/or environmental factors (Russo et al.,

ONCOGENIC BASIS OF RADIATION RESISTANCE

217

1985; Thacker, 1986; Debenham et al., 1987; Cleaver, 1989). T h e functional involvement of oncogenic factors discussed above may represent only one important level of regulation of radiation response. It is also possible that certain oncogenic factors control the radiation response phenotype by regulating enzymes or substrates (effector proteins) involved directly o r indirectly in the DNA damage and repair system. Indeed, radioresistance/radiosensitivity of human tumor cells has been linked with a differential pattern of gene expression (Kasid et al., 1989d; Ramsamooj et al., 1992). A y-radiation-induced point mutation in c-K-ras has been shown to activate its oncogenic potential (Guerrero et al., 1984). It is not clear at this time whether radiation resistance is a consequence of radiationinduced structural changes in the oncogene(s). Recent reports indicate that ionizing radiation transiently induces certain genes at the transcriptional, translational, or post-translational level (Lambert and Borek, 1988; Boothman et al., 1989, 1991; Singh and Lavin, 1990; Sherman et al., 1990; Hallahan et al., 1991; Brach et al., 1991; Papathanasiou et al., 1991). These observations are highly significant in the context of this review, since some of the genes responsive to y-irradiation code for transcription factors (AP-1, Egr- 1) with a requirement for Raf-1 protein kinase (Bruder et al., 1992; Qureshi et al., 1991).This section reviews the data suggesting (a) that an association may exist between differential expression of the various gene products and radiation response, and (b) that ionizing radiation induces intracellular signaling events involving important growth-related biological molecules. A. MULTIFACTORIAL NATUREOF RADIATION RESPONSE: DIFFERENTIAL GENEEXPRESSION The possibility that multiple genetic factors are involved in the resistance o r sensitivity of human squamous carcinoma-derived cell lines was investigated using two-dimensional polyacrylamide gel electrophoresis (Kasid et al., 1989d; Ramsamooj et al., 1992). Based on the response to radiation therapy and in vitro radiation survival analysis, the tumor cell lines were classified as relatively radioresistant o r radiosensitive (Weichselbaum et al., 1989). A set of at least 14 different proteins was found to be preferentially expressed in each of the three radioresistant tumor cell lines (SQ-20B, SCC-35, JSQ-3; Do range, 2.3 to 2.5 Gy) compared to their expression in the radiosensitive tumor cells, and a set of at least 15 different proteins was specifically expressed in each of the three radiosensitive tumor cell lines (SQ-38, SCC-9, SQ-9G; Do range, 1.3 to 1.7 Gy), compared to their expression in the radioresistant tumor cells

218

USHA KASID ET AL.

TABLE 11 IDENTIFICATIONOF MARKERPROTEINS IN RELATIVELY RADIORESISTANT A N D RADIOSENSIT~IVE HUMAN SQUAMOUS CARCINOMA-DERIVED CELLLINES^

Marker protein Radiation response phenotype

Molecular mass (kDa)

PI

Fold enhancement6

Radioresistant (RR) (Dorange, 2.3 to 2.5 Gy)

92 64 24 47 17

5.5 5.2 6.6 7.4 6.2

NA 17 16 10 10

Radiosensitive (RS) (Dorange, 1.3 to 1.7 Gy)

40 36 34 32 39

7.1 6.4 6.1 6.2 6.2

NA 45 10 9 6

Ramsamooj ct af. (1992). Fold enhancement value of the RR or RS protein represents quantitative difference observed in the signal compared to the value of corresponding protein spot in RS or RR cell type, respectively. NA, not applicable due to the undetectable levels in the other radiation response category. a

(Ramsamooj et al., 1992). A representative computer-assisted quantitative analysis of the 5 most significant marker proteins identified in each response category is shown in Table 11. Some of these proteins may represent candidates belonging to the effector-protein category. The role of these proteins in radiation resistance or sensitivity awaits their structural and functional characterization. Nevertheless, these findings suggest that the complexity of the radiation response phenotype may be due to the functional interaction of multiple proteins.

B. MOLECULARTARGETS OF IONIZING RADIATION A number of X-ray-inducible factors have been reported in recent years (Lambert and Borek, 1988; Boothman et al., 1989, 1991; Singh and Lavin, 1990; Sherman et al., 1990; Hallahan et al., 1991). Some of these genetic elements are immediately early genes (cjun,fos,junB, and egr-I) that are also induced rapidly in response to growth factors. The latter genes code for transcription factors AP-I and Egr-1. The induction of egr-1 and c-jun transcription by X-rays was attenuated upon inhibition of PKC by TPA treatment or by the protein kinase inhibitor H7 (Hallahan et al., 1991), suggesting that ionizing radiation induces a signal transduction pathway involving activation of PKC (Weichselbaum et al., 1991).

ONCOCENIC BASIS OF RADIATION RESISTANCE

219

Additional evidence in support of the y-radiation induction of PKCmediated signaling events is derived from studies based on the radiation-stimulated transcription of a reporter gene coding for chloramphenicol acetyl transferase (CAT) driven by the Moloney murine sarcoma virus long terminal repeat. Preincubation of X-ray-treated cells with TPA to down-regulate PKC abolished this activation process (Lin et al., 1990). Moreover, activation of transcription and the DNA binding activity of another transcription factor, NF-KB,was noted in response to y-irradiation of human myeloid leukemia cells (Brach et al., 1991). Since activation of NF-KB also occurs in response to UV-irradiation, another DNA-damaging agent, a reverse signaling pathway induced by DNAdamaging agents, that transduces signals from the nucleus to the cytoplasm has been proposed (Brach et al., 1991; Weichselbaum et al., 1991). T h e role for transcription factors in the regulation of transcriptional events is well known (Mitchell and Tjian, 1989). Given the functional significance of protein-serine/threonine kinases in radioresistance (discussed in the previous section), it may be of specific interest to note here that the Raf-1 protein kinase is required for the transcriptional transactivation function, via specific DNA binding sites of AP-1 and Egr-1 (Bruder et al., 1992; Qureshi et al., 1991). Cells that are deficient in Raf-1 protein kinase demonstrate impaired signaling in response to growth factors, deficiency in the induction of immediate-early genes (fos, junB and egr-1), and a block of transcription by the transcription factors AP-1, Ets-1, or Egr-1 (Rapp, 1991; Heidecker et al., 1992). Therefore, the obvious question is: What is the effect of the inhibition or activation of the Raf- 1 protein kinase in the y-radiation-induced transcription of genes coding for these transcription factors? The information gained from such studies may provide a significant advance in our understanding of the role of cytoplasmic kinases in the molecular and biochemical effects of y-irradiation, a biological consequence of which may be resistance to such toxic insults. The notion that ionizing radiation induces specific molecular signals also has support from studies of growth factors, cytokines, and cell cycle control genes. Radiation treatment releases growth factors similar to PDGF-a and FGF from vascular endothelial cells (Witte et al., 1989). Basic FGF (bFGF) has been shown to induce the repair of radiationinduced potentially lethal damage (Haimovitz-Friedman et al., 1991). Precoating of culture dishes with bFGF for the postirradiation colonyforming assay caused the cells to exhibit increased repair of radiation damage. These studies have proposed that radiation induces a complete cycle of an autoregulated damage/repair pathway in bovine aortic

220

USHA KASID ET AL.

endothelial cells (BAEC), initiated by radiation-induced damage to cellular DNA and followed by stimulation of bFGF synthesis and its secretion into the medium. The newly synthesized bFGF stimulates the potentially lethal damage/repair (PLDR) pathway, acting via an autocrine loop leading to the recovery of cells from radiation lesions and restoration of clonogenic capacity. Furthermore, these authors have reported that in addition to bFGF, irradiation of BAEC results in an increase in PDGF mRNA. T h e fact that Raf-1 has been observed to be complexed with the PDGF receptor again emphasizes the possibility of an autocrine mechanism of signal transduction leading to increased survival after radiation exposure with Raf-1 playing a central role. The transcriptional regulation of cytokines TNF-a or IL-1 in response to radiation has also been reported (Hallahan et al., 1989; Woloschak et al., 1990). However, the radiobiological consequences of induction of these two cytokines may be different. Whereas, TNF-a is cytotoxic via such mechanisms as free radical formation (Zimmerman et al., 1989), I L 1 is reported to protect mice from lethal doses of wholebody irradiation (Oppenheim et al., 1989). More recently, a delayed synthesis of cyclin B mRNA, which encodes a cell cycle-related protein, and absence of accumulation of the cyclin B protein were observed in HeLa cells exposed to ionizing radiation during the S and G, phases, respectively (Muschel et al., 1991). Evidence that the gene(s) associated with cell cycle checkpoints may contribute to an increase in cell survival following exposure to y-radiation is also derived from other reports (Kastan et al., 1991; Kuerbitz et al., 1992). These studies demonstrate that the levels of wild-type p53 protein in hematopoietic and nonhematopoietic mammalian cells increase and decrease in temporal association with G , arrest following irradiation. More recently, the induction of gadd45 gene following ionizing irradiation has been shown to depend on a wild-type p53 phenotype (Kastan et al., 1992). Therefore, it appears that ionizing radiation affects specific molecules with important growth-related biological functions in a variety of cell types. Further investigations are necessary to provide insight into the radiobiological significance of these radiation-inducible molecular events.

VII. DNA Damage and Repair Cascade: Biochemical and Cellular Factors Ionizing radiation is known to produce a variety of free radical species, the detoxification of which may have potential implications in the phenotypic outcome of the damage caused by irradiation. A number of intracellular radioprotective molecules with a detoxification function

ONCOCENIC BASIS OF RADIATION RESISTANCE

22 1

have been characterized and include superoxide dismutase, catalase, glutathione (GSH) and GSH-related enzymes, protein thiols, and a number of other low-molecular-weight thiol-containing molecules (Meister and Anderson, 1983). Superoxide dismutase converts superoxide to hydrogen peroxide, whereas catalase detoxifies hydrogen peroxide to water. These two enzymes may be important in the detoxification of toxic oxygen-related species that can be produced by radiation. However, it is not clear whether high concentrations of these enzymes can protect cells from radiation damage and whether the modulations of oncogene function(s) can result in the alteration of their biochemical activities. Glutathione, a ubiquitous tripeptide, plays a critical role in several bioreductive reactions, transport, enzyme activity, protection from harmful oxidative species, and detoxification of xenobiotics (Meister and Anderson, 1983); GSH may provide radiation protection by several mechanisms including radical scavenging, restoration of damaged molecules by hydrogen donation, reduction of peroxides, and maintenance of protein thiols in the reduced state (Biaglow et al., 1983a; Clark, 1986; Mitchell and Russo, 1987; Bump and Brown, 1990).A direct correlation between intracellular GSH levels and inherent radiosensitivity has not been established (Louie et al., 1985; Mitchell et al., 1988). The depletion of cellular thiols by several reagents including diamide, N-ethylmaleimide (NEM), and DL-buthionine S,R,-sulfoximine (BSO) may render oxygenated cells more sensitive to radiation (Sinclair, 1973; Vos et al., 1976; Harris, 1979; Mitchell et al., 1983; Biaglow et al., 1983a). In this regard, the effects of BSO are of particular interest since, unlike other agents that must form a covalent bond (i.e., NEM) or oxidize GSH (i.e., diamide), BSO depletes cellular stores of GSH via a fairly specific mechanism, i.e., competitive inhibition of cysteine synthetase, a key enzyme in the biosynthesis of GSH (Griffith and Meister, 1979). Extensive cellular GSH depletion by BSO has been found to be a requirement for aerobic radiosensitization of cells (Mitchell et al., 1983; Biaglow et al., 198313; Leung et al., 1993). The mechanism of diamide-induced radiosensitization may involve oxidation of protein thiols, which are important for DNA repair (Harris, 1979).N-Ethylmaleimide possibly removes thiols from the cells or inhibits enzymes thought to be involved in the repair of lethal damage due to irradiation (Sinclair, 1973). Therefore, the possibility remains that the manipulation of the GSH and related redox systems can be effective in enhancing the cytotoxic effect of radiation and some chemotherapeutic agents in radio- and chemoresistant cells (Clark, 1986). Limited information (reviewed below) is available regarding the re-

222

USHA KASID ET AL.

dox regulation of certain oncogene products via sulfhydryl modifiers (diamide, NEM), and regarding possible alterations in the intracellular levels of GSH or the GSH-related enzyme GSH S-transferase, as a result of oncogene activation o r transfection. An understanding of the role, if any, a specific oncogene(s) plays in the redox-related biochemical control mechanisms apparently elicited by y-radiation is presently lacking. A gap also exists in our knowledge of the effects of free radicals generated by y-irradiation on oncogene function(s). Several transcriptional regulatory proteins require free sulfhydryl residues for DNA binding o r transcriptional activation (Silva and Cidlowski, 1989; Levy et al., 1989). Recent studies have shown that the binding of the Jun homodimer, and the Fos plus Jun heterodimer to the AP-1 DNA binding site is inhibited by NEM. Treatment of these proteins with diamide results in their conversion to slower migrating forms most likely representing disulfide crosslinked dimers. Diamide treatment also causes inhibition of their DNA binding activities. Furthermore, a single cysteine residue in Fos and Jun was found to be important for DNA binding and that reduction was required for association with DNA (Abate et al., 1990). Sulfhydryl groups are also important in the kinase activity of p60v-src (Uehara et al., 1989). Interestingly, the last cysteine of the cysteine-finger region in the N-terminal domain of Raf-1 is critical to its dominant negative regulatory effect (Bruder et al., 1992). However, a potential role for oxidation-reduction in the control of the Raf-1 protein-serine/threonine kinase has not yet been established. It appears that a correlation between the intracellular level of GSH and activation of Raf-1 may exist. A differential modulation of intracellular GSH levels was noted as a direct response to PDGF treatment (5- 10 min) of NIH/3T3 transfectants containing different regions of transfected human raf-1 gene (Kasid et al., 1991b). Moreover, the transformation of rat liver cells with v-H-ras or v-raf is associated with expression of the multidrug resistance gene (mdr-1) and glutathione Stransferase-P, and increased resistance to cytotoxic chemicals (Burt et al., 1988). More recently, sulfhydryl modifiers, BSO and dimethylfumarate (DMF), were found to cause a graded depletion of GSH and modulation of the Raf-l-associated protein-serine/threonine kinase activity in human renal cell carcinoma-derived cells (Leung et al.,1993; U. Kasid et al.,unpublished observations). Clearly, a number of pertinent questions remain unanswered with the thiol-related biochemical regulatory mechanism(s) of Raf-1 protein kinase being one of the main issues. Another factor that may be involved in this response is the activities of DNA strand-break repair-associated enzymes topoisomerase I and 11.

ONCOGENIC BASIS OF RADIATION RESISTANCE

223

These enzymes regulate the conformation of,DNA. Besides the recently described role for these enzymes as targets for anticancer drug therapy, increased levels and activities of topoisomerases have been associated with transformed cells (Heck and Earnshaw, 1986; Crespi et al., 1988; Heck et al., 1988; Schneider et al., 1990). Moreover, it has been suggested that they may be directly involved in oncogenesis (Francis, 1987; Francis et al., 1987; Crespi et al., 1988). Evidence indicating an association between the activity of these enzymes and radiation resistance is fourfold: (a) topoisomerases are known to be activated in vitro by serinelthreonine kinases (Rottman et al., 1987; Durban et al., 1983); (6) deficiency of topoisomerase I1 has been reported to be associated with the radiosensitive phenotype of cells derived from patients with the inherited disorder ataxia telangiectasia (AT) (Mohamed et al., 1987); (c) inhibitors of topoisomerases (I and 11) potentiate ionizing radiation-induced cell killing (Mattern el ad., 1991); and (d) an elevated level of activity of topoisomerase I1 was found not only in the radiation-resistant NSF cell lines from the Li-Fraumeni family, but also in radiation-resistant NIH/3T3-transformed cell lines NIH/3T3 raf and NIH/3T3 EJ-rm (Cunningham et al., 1991). An important aspect of the radiation survival response is its regulation at the level of the cell cycle. The radiation survival experiments using synchronously dividing cell cultures have established that, in general, the cells are most sensitive at or close to mitosis, most resistant in the latter part of the S phase, sensitive in G, phase, and less sensitive in G I . In cells with a long G , phase, they are resistant in early G I , and sensitive toward the end of G I (Terasima and Tolmach, 1961; Sinclair and Morton, 1963; Whitmore et al., 1965; Sinclair, 1968). These variations in radiation sensitivity during the cell cycle have been observed despite differences in intrinsic radiosensitivity (Do value) of squamous carcinoma-derived cell lines (Quiet et al., 1991). It is noteworthy that the Chinese hamster ovary cells enriched in G, phase also reveal most sensitivity to radiation-induced mutagenesis. However, the greatest level of chemical protection from radiation-induced mutagenesis was also observed for G,-enriched populations (Grdina and Sigdestad, 1992). A number of oncogenic proteins either are known to be regulated in a cell cycle-dependent manner or have been implicated in the control of cell cycle (Hunter, 1991). The oncogenes coding for some of these proteins ( m y , r a , mos, and src) have also been implicated in intrinsic radioresistance, and some others (ras plus myc; p53) in the postirradiation changes in cellcycleorDNAsynthesis(TableI; McKenna etal., 1991;Kastan etal., 1991). It is suggested that the GI arrest and/or G , arrest induced by y-radiation allows the cells to recover from the lethal effects of radiation

224

USHA KASID ET AL.

prior to cell division. Thus, alterations in this response may correlate with increased or decreased resistance to radiation. T h e RAD9 control system (or checkpoint) in yeast ensures G, arrest until the damage induced by X-irradiation is repaired, whereas mutations in RAD9 gene allow cells with DNA damage to proceed through cell division (Hartwell and Weinert, 1989). Like RAD9 defects in yeast, caffeine treatment of irradiated mammalian cells permits their entry into mitosis and decreases cell viability (Schlegel and Pardee, 1986). Using the primary rat embryo system, a significant increase in the duration of the G2 block in the radiation-resistant (rm and myc cotransfected) cells was noted compared to the relatively radiation-sensitive cells transfected with myc alone (McKenna et al., 1991). By analogy to the radiobiological characteristics of cells representing the radiosensitive genetic disorder ataxia telangiectasia, the above studies have led to the proposal that alterations in the cell division delay is one mechanism by which radioresistance is conferred on oncogene (ras and my)-transformed cells. A correlation between the expression of wild-type (wt) p53 and G, arrest, as discussed in the previous section, suggests that wt p53 may participate in the control of cell cycle progression following DNA damage (Kastan et al., 1991; Kuerbitz et al., 1992). However, these findings may be more relevant to the aspects of cellular transformation than cellular radiation resistance. As an inherited germline defect, the NSF cell lines from members of families with Li-Fraumeni syndrome have been shown to possess both a point-mutated (mt) and a wt p53 allele (Srivastava et al., 1990; Malkin el al., 1990). Nontumorigenic cell lines from one family have also been shown to express equal amounts of both the mt and the wt forms of the p53 protein (Srivastava et al., 1992). T h e NSFs from this particular Li-Fraumeni family have also been found to display a radiation-resistant phenotype (Bech-Hansen et al., 1981) (Fig. 3). This relatively radioresistant phenotype was seen not only in the cell line from an individual (V-10) homozygous for wt p53 (wt/wt), but also in the cell lines established from two individuals (VI-2 and VI-4) heterozygous with respect to the p53 point mutation (mt/wt). Furthermore, two of the radioresistant NSF cell lines that carry the mt-wt genotype actually displayed a longer lag time between exposure to X-rays and the resumption of DNA synthesis compared to an unrelated, nonradioresistant (control) skin fibroblast cell line (Paterson et al., 1985). Therefore, although the presence of one mutant p53 allele may contribute to the propensity for tumor formation by increasing genetic instability (Kuerbitz et al., 1992), it may not necessarily affect the acquisition of radiation resistance. Given the fact that some other proteins (i.e., cyclins, cdc2 ser-

ONCOCENIC BASIS OF RADIATION RESISTANCE

225

ine/threonine kinase) play a major role in the control of cell cycle (Hunt, 1989; Draetta, 1990; Hunter and Pines, 1991) in a large variety of cell types, it is conceivable that these proteins may also govern, either directly or indirectly, the radiobiological component of the oncogene function. Earlier reports have demonstrated a critical role for the mos gene product in cell cycle control by directly or indirectly stabilizing the cyclin/cdc2 complex (Roy et al., 1990). More recently, it has been suggested that the Raf-1 signaling cascade may converge in the activation of the cdc2 complex (Heidecker et al., 1992). Therefore, an alternative mechanism underlying the differential regulation of the radiation response during the cell cycle may be linked to the modulation of the cell cycle-related proteins via cytoplasmic protein-serinelthreonine protein kinases. Future studies will most likely focus on these topics for a better understanding of the connection between radiation response, the cell cycle, and oncogenes.

VIII. Modulation of Radiation Resistance: Therapeutic Implications of Oncogene Strategy As our understanding of the involvement of specific genetic factors involved in radioresistance increases, so too should our resolve to design potential therapies that can be aimed at the specific genetic o r metabolic process leading to the specific cellular manifestation. One of the most obvious long-term practical uses of the present area of research is the possibility of the radiosensitization of tumor cells by expression of a reduced level of the oncogenic protein playing a potential role in radioresistance. Since the antisense oncogene (raf 1) strategy has proven effective for the down-regulation of radiation resistance in human tumor cells (Kasid et al., 1989a), it seems logical to direct future efforts at improving upon the antisense RNA approach in order to achieve a sustained radiosensitization effect. Antisense oligonucleotides targeted at either viral o r cellular genes have been shown to be highly effective in inhibiting the expression of the targeted gene (Wickstrom, 1991; Murray, 1990; Mol and Van Derkrol, 1990). In some cases the inhibition is highly selective and the specificity reaches to that of a point mutation (Chang et al., 1991). A number of investigators have used antisense oligonucleotides as an innovative treatment strategy to block the specific genes involved in a variety of malignancies as well as in viral, inflammatory, and cardiovascular diseases. T h e development of antisense DNA technology in the last two decades has led to the present provisional approval for the first clinical trial on chronic myelogenous leukemia using an antisense strategy. In pilot

226

USHA KASID ET AL.

studies, using human tumor cells, the radiosensitizing effect of the raf- 1 antisense oligonucleotides has been observed (Kasid et al., 1991a). The potential usefulness of the antisense-based experimental design may be further explored by taking advantage of the cell cycle-related variations in the radiation response and the postirradiation changes in the cell cycle. Recently, a line of transgenic mice that contains the human ruf-1 oncogene was identified as being significantly more radiation resistant than its normal, nontransgenic counterparts (K. F. Pirollo and E. H. Chang, unpublished observations). The development of such animals provides us with an in vivo model system with which to test the various potential therapies, including the antisense therapy designed to increase the therapeutic advantage of radiation-induced cytotoxicity.Thus, it is our hope that the oncogene studies may ultimately lead to the development of a specific gene-directed approach for effective radiotherapy. IX. Conclusion

There is a growing body of evidence suggesting an important role for certain oncogenes (rm,.ah cot, mos,and m y )in the regulation of cellular resistance to ionizing radiation. The observation that some of these genes demonstrate a cooperative effect toward radiation resistance is suggestive of the possibility of a selective interaction among these proteins, analogous to that involved in signal transduction leading to cell growth and proliferation or differentiation. Antisense ruf 1 cDNA transfection has been shown to cause negative regulation of radioresistance in human tumor cells, further implying that the Raf-1 protein kinase may be an important transducer of signals leading to the radiation-resistant phenotype. In addition, perturbations in the cell cycle (C, and/or G , arrest) and cell cycle-related proteins appear to be important factors contributing to cell survival. Therefore, whereas the correlation between an interaction(s) among the specific proteins and radioresistance needs to be more clearly defined, it seems likely that modifications such as serinelthreonine phosphorylation and associated transcriptional activation are critical to the radioresistant phenotype.

ACKNOWLEDGMENTS The authors acknowledge their colleagues and collaborators, especially Drs. G . Mark, A. Pfeifer, P. Ramsamooj, R. Weichselbaum, J. Mitchell, U. Rapp, D. Kaplan, and W. Anderson, for participation in the portions of studies discussed in this review; Dr. Roberta Black for helpful comments; and Elaine Miranda and Jennifer LaMontagne for excellent

ONCOGENIC BASIS OF RADIATION RESISTANCE

227

assistance in typing the manuscript. Work in the authors’ laboratories was supported by NIH Grants CA46641 and CA58984 (U.K.), CA52066 and CA45408 (A.D.),and CA45158 and CA42762 (E.C.). Additional funds were provided by National Foundation for Cancer Research Grant NFCRHUOOl (E.C.) and Uniformed Services University of the Health Sciences Grant USUHSR074DK (K.P.)

REFERENCES Abate, C.. Patel, L., Rauscher, F. J., 11, and Curran, T. (1990). Science 249, 1157-1161. Alapetite, C., Baroche, C., Remvikos, Y.,Goubin, G., and Moustacchi, E. (1991). Int. J. Radial. Biol. 59(2), 385-396. Alper, T. (1979). “Cellular Radiobiology.” Cambridge Univ. Press. App, H., Hazan, R., Zilberstein, A., Ullrich, A., Schlessinger, J., and Rapp, U. R. (1991). Mol. Cell. Biol. 11, 913-919. Aoki, M., Akiyama, T., Miyoshi, J., and Toyoshima, K. (1991). Oncogene 6, 1515-1519. Arlett, C. F., and Harcourt, S. A. (1980). Cancer Res. 40, 926-932. Bech-Hansen, N. T., Blattner, W. A., Sell, B. M., McKeen, E. A., Lampkin, B. C., Fraumeni, J. F., Jr., and Paterson, M. C. (1981). Lancet 1, 1335-1337. Belli, J. A., and Shelton, M. (1969). Science 165, 490-492. Berridge, M. J.. and Irvine, R. F. (1984). Nature (London) 314, 315-321. Biaglow, J. E., Varnes, M. E., Clark, E. P., and Epp, E. R. (1983a). Radiat. Res. 95,437-455. Biaglow, J. E., Clark, E. P., Morse-Gudio, M., Varnes, M. E., and Mitchell, J. B. (1983b). Int. J. Radial. Biol. 44, 489-495. Bishop, J. M. (1991). Cell (Cambridge, Mass.) 64,235-248. Blattner, W. A., McGuire, D. B., Mulvihill,J. J., and Fraumeni, J. F.,Jr. (1979).JAMA,J. Am. Med. Assoc. 24, 259-261. Bolen, J. B., Amini, S., DeSeau, V., Reddy, S., and Shalloway,J. (1987).J . Virot. 61, 10791085. Bond, V. P. (1969).In “Comparative Cellular and Species Radiosensitivity”(V.P. Bond and T. Sugahara, eds.), pp. 1-18. Igaku Shoin Ltd., Tokyo. Bond, V. P., Fliedner, T. M., and Archambeau, J. 0. (1965). In “Mammalian Radiation Lethality: A Disturbance in Cellular Kinetics,” pp. 159-230. Academic Press, New York. Boothman, D. A., Bouvard, I., and Hughes, E. N. (1989). Cancer Res. 49, 2871-2878. Boothman, D. A,, Wang, M., and Lee, S. W. (1991). Cancer Res. 51, 5587-5595. Brach, M. A., Hass, R., Sherman, M. L., Gunji, H., Weichselbaum, R., and Kufe, D. (1991). J. Clin. Invest. 88, 691-695. Brattain, M. G., Fine, W. D., Khalid, F. M., Thompson, J., and Brattain, D. E. (1981). Cancer Res. 41, 1751-1756. Broerse, J. j.,MacVittie, T.J. (eds.) (1984).In “Response of Different Species to Total Body Irradiation.” Martinus Nijhoff, Amsterdam. Bruder, J. T., Heidecker, G., and Rapp, U. R. (1992). Genes Deu., 6, 545-556. Bruder, J. T., and Rapp, U. R. (1991). In “Proceedings, Annual Meeting on Oncogenes,” [abstract] p. 443. Bump, E. A., and Brown, J. M. (1990). Pharm. Ther. 47, 117-136. Burt, R. K., Garfield, S., Johnson, K., and Thorgeirsson, S. (1988). Carcinogenesb 9,23292332. Cantley, L. C., Auger, K. R., Carpenter, C., Duckworth, B., Graniani, A., Kapeller, R., and Soltoff, S. (1991). Cell (Cambndge, Mass.) 64, 281-302.

228

USHA KASID E T AL.

Carmichael, J., Degraff, W. G., Gamson, J.. Russo, D., Gazdar, A. F., Levitt, M. L., Minna, J. D., and Mitchell, J. B. (1989). Eur. J. Clin. Oncol. 25, 527-534. Carney, D. N., Mitchell, J. B., and Kinsella, T. J. (1983). Cancer Res. 43, 2806-281 1. Carroll, M. P., Clark-Lewis, I., Rapp, U. R., and May, W. S. (1991). J. Biol. Chem. 265, 19812- 19817.

Chabre, M. (1987). TIBS 12, 213-215. Chang, E. H., Miller, P., Cushman, C., Devadas, K., Pirollo, K. F., Ts'o, P. 0.P., and Yu, Z. P. (1991). Biochembtry 30, 8283-8286. Chang, E. H., Pirollo, K. F., Zou, Z. Q., Cheung, H-Y., Lawler, E. L., Garner, R., White, E., Bernstein, W. B., Fraumeni, J. W., Jr., and Blatner, W. A. (1987). Science 237, 10361039.

Chiu, R., Boyle, W. J., Meek, J.. Smeal, T., Hunter, T., and Karin, M. (1988). Cell (Cambridge, Mass.) 54, 541-552. Clark, E. P. (1986). Int. J. Radial. Oncol. Biol. Phys. 12, 1 121-1 126. Cleaver, J. E. (1989). Cancer Cells 1, 108-1 10. Cockcroft, S. (1987). TIBS 12, 75-78. Contente, S., Kenyon, K., Rimoldi, D., and Friedman, R. M. (1990). Science 249,796-798. Cox, R., and Masson, W. K. (1980). Int. J. Radial. Biol. 38, 575-576. Crespi, M. D., Mladovan, A. G., and Baldi, A. (1988). Exp. Cell Res. 177, 206-215. Cunningham, J. M., Francis, G. E., Holland, M. J., Pirollo, K. F., and Chang, E. H. (1991). Br. J. Cancer 63, 29-36. Debenham, P. G., Webb, M. B., Jones, N. J., and Cox, R. (1987). J. Cell Sci. 6, 177. Draetta, G. (1990). Trends Biochem. Sci. 15, 378-383. Durban, E., Mills, J. S., Roll, D., and Busch, H. (1983). Biochem. Biophys. Res. Commun. 111, 897-905.

Elkind, M. M., and Sutton, H. G. (1959). Nature (London) 184, 1293-1295. Fertil, B., Dertinger, H., Courdi, A., and Malaise, E. P. (1984). Radial. Res. 99, 75-84. Fertil, B., Deshavanne, P. J., Debieu, D., and Malaise, E. P. (1988). Radial. Res. 116, 74-88. Fertil, B., Deschavanne, P. J., Lachet, B., and Malaise, E. P. (1980). Radial. Res. 82, 297307.

Fertil, B., and Malaise, E. P. (1985). Int. J. Radial. Oncol. B i d . Phys. 11, 1699-1707. FirzGerald, T. J., Henault, S., Sakakeeny, M. A., Santucci, M. A., Pierce, J. H., Anklesaria, P., Kase, K., Lovington, K., and Greenberger, J. S. (1990). Radial. Res. 122, 44-53. FitzGerald, T. J., Rothstein, L. A., Daugherty, C., McKenna, M., Kase, K., and Greenberger, J. S. (1985). Am. ]. Clin. Oncol. 8, 517-522. FitzGerald, T. J., Santucci, M. A., Das, I., Kase, K., Pierce, J. H., and Greenberger, J. S. (1991). Int. J. Radial. Oncol. Biol. Phys. 21, 1203-1210. Francis, G. E. (1987). Med. Hypoth. 22, 223-235. Francis, G. E., Berney, J. J., North, P. S., Kahn, F., Wilson, E. L., Jacobs, P., and Ah, M. (1987). Leukemia 1, 653-659. Fukui, M., Yamamoto, T., Kawai, S., Maruo, T., and Toyoshima, K. (1985). Proc. Natl. Acad. Sci. U.S.A. 81, 5954-5958. Grant, M. L., Bruton, R. K., Byrd, P. J.. Gallimore, P. H., Steele, J. C., Taylor, A. M., and Grant, R. J. (1990). Oncogene 5, 1159-1 164. Grdina, D. J., and Sigdestad, C. P. (1992). Cell Prolif. (Enghnd) 25, 23-29. Griffith, 0. W., and Meister, A. (1979). J. Biol. Chem. 254, 7558-7560. Guerrero, I., Villasante, A., Corces, V., and Pellicer, A. (1984). Science 225, 1159-1 162. Haimovitz-Friedman, A., Vlodavsky, I . , Chaudhuri, A., Witte, L., and Fiks, Z. (1991). Cancer Res. 51, 2552-2558.

ONCOGENIC BASIS OF RADIATION RESISTANCE

229

Hall, E. J. (1988). “Radiobiology for the Radiologist.” Lippincott, Philadelphia. Hallahan, D. E., Spriggs, D. R., Beckett, M. A., Kufe, D. W., and Weichselbaum, R. R. (1989). Proc. Natl. Acad. Sci. U.S.A. 86, 10104-10107. Hallahan, D. E., Sukhatme, V. P., Sherman, M. L., Virudachalam, S., Kufe, D., and Weichselbaum, R. R. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 2156-2160. Harris, J. F., Chambers, A. F., and Tam, A. S. K. (1990). Somat. Cell Mol. Genet. 16, 39-48. Harris, J. W. (1979). Phurmacol. Ther. 7, 375-391. Hartwell, L. H., and Weinert, T. A. (1989). Science 246, 629-634. Heck, M. M. S., and Earnshaw, W. C. (1986).J. Cell Biol. 103, 2569-2581. Heck, M. M. S., Hittleman, W. H., and Earnshaw, W. C. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 1086- 1090. Heidecker, G., Huleihel, M., Cleveland, J. L., Kolch, W., Beck, T. W., Lloyd, P. Pawson, T., and Rapp, U.R. (1990). Mol. Cell B i d . 10, 2503-2512. Heidecker, G., Kolch, W., Morrison, D. K., and Rapp, U. R. (1992).In “Advances in Cancer Research” (G. Vande Woude and G. Klein, eds.), Vol. 58, pp. 53-73. Academic Press, San Diego. Heppner, C. H. (1984). Cancer Res. 44,2259-2265. Hill, H., Hill, J. G., Miller, C. F., Kwong, F., and Purdy, J. (1979). Radiat. Res. 80,259-276. Houldsworth, J., and Lavin, M. F. (1980). Nucleic Acrdc Res. 8, 3709-3720. Hunt, T. (1989). Nature (London) 324, 483-484. Hunter, T. (1991). Cell (Cambridge, Muss.) 64, 249-270. Hunter, T., and Pines, J. (1991). Cell (Cambridge, Muss.) 66, 1071-1074. Iliakis, G., and Seaner, R. (1988). Radiat. Environ. Biophys. 27, 295-305. Iliakis, G. E., Metzger, L., Denko, N., and Stamato, T. D. (1991).Int. J. Radiut. B i d . 59,321342. Ishikawa, F., Takaku, F., Hayashi, K., Nagao, M., and Sugimura, T. (1986).Proc. Nutl. Acad. Sci. U.S.A. 83, 3209-3212. Kasid, U., Pfeifer, A., Weichselbaum, R. R., Dritschilo, A., and Mark, G. E. (1987a). Science 237, 1039-1041. Kasid, U., Dritschilo, A., and Rhim, J. S. (1987b). Radiat. Res. 111, 565-571. Kasid, U., Pfeifer, A., Brennan, T., Beckett, M., Weichselbaum, R. R., Dritschilo, A., and Mark, G. E. (1989a). Science 243, 1354-1356. Kasid, U., Pfeifer, A., Mossman, K., Cahill, R., Tuturea, J., Mark, G., and Dritschilo, A. (1989b). In “Proceedings, Fifth Annual Meeting on Oncogenes,” p. 202. Kasid, U., Weichselbaum, R. R., Brennan, T., Mark, G. E., and Dritschilo, A. (1989~). Cancer Res. 49, 3396-3400. Kasid, U., Weichselbaum, R. R., and Dritschilo, A. (1989d). In “Proceedings, Radiation Research Society Meeting,” p. 181. Kasid, U., Olah, Z., Anderson, W., and Dritschilo, A. (1991a). In “Proceedings, Int. Congr. Radiat. Res.,” p. 215. Kasid, U., Friedman, N., Leung, S., DeGraff, W., Gamson, J., Dritschilo, A., and Mitchell,J. B. (1991b). In “Proceedings, Int. Congr. Radiat. Res.,” p. 151. Kasid, U., Pfeifer, A., Merlino, G., Mark, G. E., and Dritschilo, A. (1993). Radiat. Oncol. Invest.: Clin. Basic Res., in press. Kastan, M. B., Onyekwere, 0.. Sidransky, D., Vogelstein, B., and Craig, R. W. (1991). Cancer Res. 51, 6304-63 1 1. Katain, M. B., Zhan, Q., El-Deiry, W. S., Carrier, F., Jacks, T., Walsh, W. V.,Plunkett, B. S., Volgestein, B., and Fornace, A. J. (1992). Cell (Cambridge, Mass.) 71, 587-597. Katain, M., and Parker, P. J. (1988). Nature (London) 332, 203.

230

USHA KASID E T AL.

Kemp, L. M., Sedgwick, S. G., and Jeggo, P. A. (1984).Mutat. Res. 132, 189-196. Kerr, J. F. R., and Searle, J. (1980).In “Radiation Biology in Cancer Research” (Meyn and Withers, eds.), pp. 367-384. Raven Press, New York. Kolch, W., Heidecker, G., Lloyd, P., and Rapp, U. R. (1991).Nature (London) 349, 426428. Kuerbitz, S. J., Plunkett, B. S., Walsh, W. V., and Kastan, M. 8. (1992).Proc. Natl. Acad. Sci. U.S.A. 89, 7491-7495. Lambert, M., and Borek, C. (1988).J.Natl. Cancer Inst. 80, 1490-1497. Leith, J. T., Dexter, D. L., Dewyngaert, J. K., Zieman, E. M., Chiu, M. Y.,Calabresi, P., and Glicksman, A. S. (1982).Cancer Res. 42, 2556-2561. Leung, S., Mitchell, J. B., Al-Nabulsi, I., Friedman, N., Belldegrun, A., and Kasid, U. (1993).Cancer, 71. Levy, D. E., Kessler, D. S., Pine, R. I., and Darnell, J. E. (1989).Genes Deu. 3, 1362. Li, F. P., and Fraumeni, J. F., Jr. (1969).Ann. Intern. Med. 71, 747-751. Lin, C. S.,Goldwait, D. A., and Samols, D. (1990).Proc. Nad. Acad. S A U.S.A. 87, 36-40. Ling, C. C.,and Endlich, B. (1989).Rodiat. Res. 120,267-279. Little, C. D.,Nau, M. M., Carney, D. N., Gazdar, A. F., and Minna, J. D. (1983).Nature (London) 306, 194-196. Little, J. B. (1969).Nature (London) 224, 804-806. Little, J. B., Nichols, W. W., Troilo, P., Nagasawa, H., and Streng, L. C. (1989).Cancer Res. 49,4705-4714. Little, J. B., and Nove, J, (1990).Radial. Res. 123, 87-92, Little, J. B., Nove, J., Dahlberg, W. K., Troilo, P., Nichols, W. W., and Strong, L. C. (1987). Cancer Res. 47, 4229-4234. Louie, K.G.,Behrens, B. C., Kinsella, T. J., Hamilton, T. C., Grotzinger, K. R., McKoy, W. M., Winker, M. A., and Ozols, R. F. (1985).Cancer Res. 45,2110-2115. Malkin, D.,Li, F. P., Strong, L. C., Fraumeni, Jr., J. F., Nelson, C. E., Kim. D. H., Kassel,J., Gryka, M. A., Bischoff, F. Z., Tainsky, M. A., and Friend, S. H. (1990).S c i a c e 250, 1233-1238. Marshall, C. J. (1987).Cell (Cambridge, Mass.) 49, 723-725. Mattern, M. R., Hofmann, G. A., McCabe, F. L., and Johnson, R. K. (1991).Cancer Res. 51, 58 13-5816. McKenna, W. G.,Weiss, M. C., Bakanauskas, V., Sandler, H., Kelsten, M. L., Biaglow, J., Tuttle, S., Endlich, B., Ling, C. C., and Muschel, R. J. (1990a).1nt.J. Radiat. Oncol. Ezol. Phys. 18, 849-860. McKenna, W. G., Weiss, M. C., Endlich, B., Ling, C. C., Bakanauskas, V. J., Kelsten, M. L., and Muschel, R. J. (1990b).Cancer Res. 50,97-102. McKenna, W. G., Iliakis, G., Weiss, M. C., Bernhard, E. J., and Muschel, R. J. (1991).Radial. Res. 125, 283-287. Meister, A., and Anderson, M. E. (1983).Annu. Rev. E i o c h . 54, 71 1-760. Mendonca, M. S., Boukamp, P., Stanbridge, E. J.. and Redpath, J. L. (1991).Int. J. Radiat. Biol. 59, 1195-1206. Mitchell, J. B., Gamson, J., Russo, A., Friedman, N., DeGraff, W., Carmichael, J., and Glatstein, E. (1988).Natl. Cancer Inst. Monogr. 6, 187-197. Mitchell, J. B., and Russo, A. (1987).Er. J . Cancer (Suppl.) 55, 96-104. Mitchell, J. B., Russo, A., Biaglow, J. E., and McPherson. S. (1983).Radiat. Res. 96, 422428. Mitchell, P. J.. and Tjian, R. (1989).Science 245, 371-378. Mohamed, R., Singh, S. P., Kumar, S., and Lavin, M. F., (1987).E i o c h . Eiophys. Res. Commun. 149,233-238.

ONCOGENIC BASIS OF RADIATION RESISTANCE

23 1

Mol, J. N. M.,and Van Derkrol, A. R. (eds.) (1990). “Antisense Nucleic Acids and Proteins. Fundamentals and Applications.” Wiley-Liss, New York. Morrison, D. K., Kaplan, D. R., Escobedo, J. A., Rapp, U. R., Roberts, T. M.,and Williams, L. T. (1989). Cell (Cambridge, Mars.) 58, 649-657. Morrison, D. K., Kaplan, D. R., Rapp, U. R., and Roberts, T. M. (1988).Proc. Natl. Acad. Sci. U.S.A. 85, 8855-8859. Murray, J. A. H. (ed.) (1990). “Antisense RNA and DNA.” Wiley-Liss, New York. Muschel, R. J., Zhang, H. B., Iliakis, G., and McKenna, W. G. (1991). CancerRes. 51,511351 17. Nigg, E. A. (1990).In “Advances in Cancer Research” (G. Vande Woude and G. Klein, eds.), Vol. 55, pp. 271-310. Academic Press, San Diego. Oppenheim, J. J., Neta, R., Tiberghien, P., Cress, R., Kenny, J. J., and Longo, D. L. (1989). Blood 74, 2257-2263. Painter, R. B. (1980).In “Radiation Biology in Cancer Research,” pp. 59-68. Raven Press, New York. Papathanasiou, M. A., Kerr, N. C. K., Robbins, J. H., McBride, 0. W., Alamo, I., Barrett, S. F., Hickson, I. D., and Fornace, A. J. (1991). Mol. Cell. Biol. 11, 1009-1016. Pardo, F. S., Bristow, R. G., Taghian, A., Ong, A.. and Borek, C. (1991). Proc. Natl. Acad. Sci. U.S.A. 88(23), 10652-10656. F‘aterson, M. C., Gentner, N. E., Middlestadt, M. V., Mirzayans, R., and Weinfeld, M. (1985). In “Epidemology and Quantitation of Environmental Risk in Humans from Radiation and other Agents,” pp. 235-267. Plenum, Castellani. Paterson, M. C., Smith, B. P., Lohman, P. H. M., Anderson, A. K., and Fishman, L. (1976). Nature (London) 260,444-447. Pfeifer, A. M. A., Kasid, U., Tsokos, M. G., Kessler, D. K. Weichselbaum, R. R., Thorgeirsson, S. S., Dritschilo, A., and Mark, G. E. (1989a). Cancer Cells 7, 177-181. Pfeifer, A. M. A., Mark, G. E.,Malan-Shibley, L., Craziano, S., Amstad, P., and Harris, C. C. (1989b). Proc. Natl. Acad. Sci. U.S.A. 86, 10075-10079. Philips, R. A., and Tolmach, L. J. (1966). R a d d . Res. 29, 413-432. Pirollo, K. F., Chen, Y., Villegas, Z., Tong, Y. A., and Chang, E. H. (199 1). In “Proceedings, Seventh Annual Meeting on Oncogenes,” p. 170. Pirollo, K. F., Garner, R., Yuan, S. Y., Li Li, Blattner, W. A., and Chang, E. H. (1989).Int. J. R a d i d . BWl. 55,783-796. Poste, C., Doll, J., and Fidler, I. J. (1981). Proc. Natl. Acad. Sci. U.S.A.78,6226-6230. Puck, T. T., and Marcus, P. I. (1956).J.Exp. Med. 103, 237-284. Quiet, C. A., Weichselbaum, R. R.,and Grdina, D. J. (1991).Int. J. Radial. Oncol. Biol. Phys. 20,733-738. Qureshi, S. A., Rim, M., Bruder, J., Kolch, W., Rapp, U., Sukhatme, V. P., and Foster, D. A. (199 I). J. Biol. C h . 466, 20594-20597. Ramsamooj, P., Kasid, U., and Dritschilo, A., (1992).JNCI, J. Natl. Camer Inst. 84, 622628. Rapp, U. R. (1991). Oncogene 6,495-500. Rapp, U. R., Huleihel, M., Pawson, T., Linnoila, I., Minna, J. D., Heidecker, G., Cleveland, J. L., Beck, T., Forchhammer, J., and Storm, S. M. J. (1988a). Int. Assoc. Study Lung Cancer 4, 162. Rapp, U. R., Cleveland, J. L., Bonner, T. I., and Storm, S. M. (1988b). In “The Oncogene Handbook (T. Curran, E. P. Reddy, and A. Skala, eds.), pp. 213-253. Elsevier Science, The Netherlands. Rauscher, F. J., 111, Cohen, D. R., Curran, T., Box, T. J., Vogt, P. K., Bohmann, D., Tjian, R., and Franza, B. R., Jr. (1988). Science 249, 1010-1016.

232

USHA KASID E T A L .

Rottmann, M., Schroder, H. C., Gramzow, K.. Renneisen, B., Kurelec, B., Dorn, A., Friese, U . , and Muller, W. E. G. (1987). EMBO J. 6, 3939-3944. Roy, L. M., Singh, B., Gautier, J., Arlinghaus, R. B., Nordeen, S. K.. and Maller, J. L. (1990). Cell (Cambridge, M a s . ) 61, 825-83 1. Rubin, J. S., Joyner, A. L., Arnstein, A., and Whitmore, G. F. (1983). Nature (London) 306, 206-2 10. Russo, A., Mitchell, J., Kinsella, T., Morstyn, G., and Glatstein, E. (1985). Semin. h C 0 l . 12, 332-349. Samid, D., Miller, A. C., Rimoldi, D., Gafner, J., and Clark, E. P. (1991). Radial. Rex 126, 244-250. Santibanez-Koref, M. F., Birch, J. M., Hartley, A. L., Jones, P. H., Craft, A. W., Eden, T., Crowther, D., Kelsey, A. M., and Harris, M. (1991). Lancet 338, 1490-1491. Sassone-Corsi, P., Lamph, W. W., Kamps, M., and Verma, 1. M. (1988). Cell (Cambridge, Mus.) 54, 553-560. Schlegel, R., and F’ardee, A. B. (1986). Science 232, 1264-1266. Schneider, E., Hsiang, Y-H., and Liu, L. F. (1990). I n “Advances in Pharmacology” (J. August el al., eds.) Vol. 21, pp. 149-183. Academic Press, San Diego. Seth, A., and Vande Woude, G. F. (1988). In “The Oncogene Handbook (Reddy, Skalka, and Curran, eds.), pp. 195-21 1. Elsevier Science, Amsterdam. Sherman, M. L., Datta, R., Hallahan, D. E., Neichselbaum, R. R., and Kufe, D. W. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 5663-5666. Shimizu, K., Nakatsu, Y., Sekisuchi, M., Hokamura, K., Tanaka, K., Terada, M., and Sugimura, T. (1985). Proc. Natl. Acad. Sci. (U.S.A.)82, 5641-5645. Shimm, D. S., Miller, P. R., Lin, T., Moulinier, P. P., and Hill, A. B. (1992).Radiat. Res. 129, 149-156. Silva, C. M., and Cidlowski, J. A. (198Y).J. B i d . Chem. 264, 6638-6647. Sinclair, W. K. (1968). Radial. Res. 33, 620-643. Sinclair, W. K. ( 1973). Radiat. Rex 55, 4 1-57. Sinclair, W. K., and Morton, R. A. (1963). Nature (London) 199, 1158-1 160. Singh, S. P.,and Lavin, M. F. (1990). Mol. Cell. Biol. 10, 5279-5285. Sklar, M. D. (1988). Science 239,645-647. Sklar, M. D., McQuiston, S., Terry, V. 0.. and Wade, P. T. (1986). Radial. Oncol. B i d . Phys. 12(Suppl. I), 190-191. Smith, M. R., DeGudicibus, S. J., and Stacey, D. W. (1986). Nature (London) 320, 540-543. Srivastava, S. K., Tong, Y. A., Devadas, K., Zou, Z. Q.,Sykes, V. W., Chen, Y., Blattner, W. A., Pirollo, K., and Chang, E. H. (1992). Oncogene 7,987-991. Srivastava, S. K., Zou, Z. Q., Pirollo, K. F., Blattner, W., and Chang, E. H. (1990). Nature (London) 348,747-749. Stanton, V. P., Jr., and Cooper, G. M. (1987). Mol. Cell. Biol. 7, 1171-1 179. Stanton, V. P., Jr., Nichols, D. W., Laudano, A. P., and Cooper, G. M. (1989).Mol. Cell. B i d . 9, 639-647. Steele, G . C., Adams, G. E., and Peckam, M. J. (1983). “The Biological Basis of Radiotherapy,” pp. 1-25. Elsevier, New York. Stephens, C. L., Ang, K. K., Schultheiss, T. E., Milas, L., and Meyn, R. E. (1991). Radial. Res. 127, 308-316. Suzuki, K., Watanabe, M., and Miyoshi, J. (1992). Radial. Res. 129, 157-162. Taylor, A. M. R. Harnden, D. G., Arlett, C. F., Harcourt, S. A., Lehmann, A. R., Stevens, S., and Bridges, B. A. (1975). Nature (London) 258, 427-429. Terasima, T., and Tolmach, L. J. (1961). Nature (London) 190, 1210-121 I.

ONCOGENIC BASIS OF RADIATION RESISTANCE

233

Thacker, T. (1986). Int. J. Radial. Biol. 50, 1-85. Trahey, M., and McCormick, F. (1987). Science 238, 542-547. Troppmair, J., Cleveland, J. L., Askew, D. S., and Rapp, U. R. (1992). Curr. Topics Murobiol. Immunol. 182,453-460. Uehara, Y.,Fukazawa, H.,Murakami, Y.,and Mizuno, S. (1989). Biochem. Biophys. Res. C m m u n . 163,803-809. Vogel, U. S., Dixon, R., Schreiber, M. D., Diehl, R.,E., Marshall, M. S., Scholnick, E. M., Siegal, L. S., and Gibbs, J. B. (1988). Nature (London) 335, 90-93. Vos, 0..Grant, G . A., and Budke, L. (1976). Int. J. Radial. B i d . 29, 513-522. Waddick, K. G., Song, C. W., Souza, L., and Uckun, F. M. (1991). Blood 77, 2364-2371. Wasylyk, B., Wasylyk, C., Flores, P., Begue, A., Leprince, D., and Stejelin, D. (1990). Nature (London) 346, 191-193. Weichselbaum, R. R., Beckett, M. A,, Dahlberg, W., and Dritschilo, A. (1988). Int. J. Radial. Oncol. Biol. Phys. 14, 907-912. Weichselbaum, R. R., Hallahan, D. E., Sukhatme, V., Dritschilo, A., Sherman, M., and Kufe, D. W. (1991).JNCI, J. Nall. Cancer Inst. 83,480-484. Weichselbaum, R. R., Nove, J., and Little, J. B. (1977). Nature (London 266, 726-727. Weichselbaum, R. R., Rotmensch, J., Almed-Swan, S., and Beckett, M. A. (1989). Int. J. Radial. B i d . 56, 553-560. Weinstein, I. B. (1988a). Mutat. Res. 202, 413-420. Weinstein, I. B. (1988b). Cancer Res. 48, 4135-4143. Whitmore, G. F., Gulyas, S., and Botond, J. (1965). In “Cellular Radiation Biology,” pp. 423-44 1. Williams & Wilkins, Baltimore. Wickstrom, E. (ed.) (1991). “Prospects for Antisense Nucleic Acid Therapy of Cancer and AIDS.” Wiley-Liss, New York. Withers, H. R. (1987). I n “Principles and Practice of Radiation Oncology,” pp. 67-98. Witte, L., Fuks, Z.. Haimovitz-Friedman, A., Vlodavsky, I., Goodman, D. S., and Eldor, A. (1989). Cancer Res. 49, 5066-5072. Wlodek, D., and Hittelman, W. N. (1987). Radial. Res. 112, 146-155. Woloschak, G. E., Chang-Liu, C. M., Jones, S. P., and Jones, C. A. (1990). Cancer Res. 50, 339-344.

Zimmerman, R. J., Chan, A,, and Leadon, S. (1989). Cancer Res. 49, 1644-1648.

This Page Intentionally Left Blank

INDEX

A

‘

Ataxia telangiectasia, and breast cancer, 47 ATF2, binding and transcription activation by p l loRBI, 128

Acanthifolicin biochemical and immunological effects, 160 isolation, 151 N-Acetyl-I-cysteine, in vitro testing, 9 Adaptive cellular therapy, 73-74 Adenovirus EIA, binding to pl l W ’ , 120-121 Amplification, gene, see Gene amplification Amplified DNA, evolution, 108-1 10 Angiogenesis, in embryo chorioallantoic membrane, okadaic acid-induced, I64 Antibodies anti-nuclear Ki-67, 4 human antimurine, development, 7172 production, network theory, 64-65 Antigens differentiation, 64 oncofetal, 64 tumor-specific, 64 Anti-idiotypic antibody therapy, 64 Antineoplastic agents, in molecular therapy, 61-63 Antioxidants, and lung cancer, 19 Antisense oligonucleotides, inhibition of gene expression by, 75-77 Antisense RNA, for radiosensitization, 225 AP-1 transcription factor, 213, 218 Aquercetin, 62 Asbestos-exposed workers, 19 Aspirin, protective role in colorectal cancer, 6

B Bacterial extracts, vaccinations from, 63 Beas-2B cells, see Immortalized human bronchial epithelial cells bek gene, amplification in breast cancer, 38-39 Biological markers of intermediate endpoints, 13 as surrogate endpoints, 20 Biologic therapy active immunotherapy, 63-66 passive immunotherapy, 66-74 Blue-green algae, microcyst in-containing, 172-1 77 Breast cancer adjuvant therapy with tamoxifen, 17 and ataxia telangiectasia, 47 Breast Cancer Prevention Trial, 17 chromosomal alterations in, 39-40 clinical management, 48-49 diagnosis, 29-30 double minutes, 40 frequency of carcinoma types, 28 gene amplifications bek and flg genes, 38-39 c-myc gene, 36-37 EGF receptor gene, 37 IGF-1 receptor gene, 37-38 list of, 31 llq13 region, 34-36 neu gene, 32-34 235

236

INDEX

genetic predisposition to, 46-47 hereditary, 46-47 histological types, 27-29 4-HPR trials, 16 inactivation of tumor suppressor genes, 40-4 1 DCC gene, 45 p53 gene, 41-43 prohibitin gene, 44-45 Rb gene, 43-44 lesions, 28-29 and Li-Fraumeni cancer syndrome, 47 lobular carcinoma in situ, 27-28 loss of heterozygosity in, 30-3 1, 4 I model of genetic changes in, 48 normal breast histology, 26-27 point mutations in, 39 sporadic, 46 tamoxifen trials, 16 treatment against altered gene products, 50 Ki-67 epitope information, 4 types of, 29-30 Bridge-breakage-fusion cycles, in CAD gene amplification, 98-99 Bystander effect, 75, 79

C CAD gene, amplification bridge-breakage-fusion cycles, 98-99 centromere recombinations, 99 telomeric fusions, 98-99 unequal sister chromatid exchange, 9697 Calcium dietary, and colorectal cancer, 6 effects on familial colon cancer, clinical trials, 13-15 Calmette-Guerin bacillus, 63 Calyculin A, biochemical and immunological effects, 160 Calyculins biochemical activity, 168-170 structure, 168-1 70 tumor promotion comparison with okadaic acid, 172 on mouse skin, 170-172

Cancer prevention carcinogenesis research, 5-6 cell biology research, 3-5 Chemoprevention Program, 2-3 Diet and Cancer Program, 2-3 drug combination studies, 1 1- 12 epidemiologic research, 6-7 molecular genetic research, 3-5 research strategies in vitro testing, 8 in vivo testing, 8-1 1 Cancer therapy molecular diagnosis, 60-61 molecular disorders, 58-59 repair of oncogenic genetic alterations, 74-75 antisense oligonucleotides, 75-77 gene therapy, 77-80 Carcinogenesis multistage model, 2 research, 5-6 Carcinomas breast, 27-28, see also Breast cancer human squamous cell marker proteins in radioresistant and radiosensitive cells, 2 18 radioresistance. 200-203 p-Carotene, clinical studies, 19 Carotene and Retinol Efficacy Trial, 19 Catalase, radiation protection by, 22 1 C2C12 cells, myogenesis inhibition by okadaic acid, 167 Cell biology, cancer prevention research, 3-5 Cell cycle machinery of cancer cells, 59 progression inhibition by p l lWB', 129 radiation survival response and, 223224 regulation, hyperphosphorylation effects, 162 Cell differentiation, modulation in cancer therapy, 59 Cell transformation in vitro, by okadaic acid class compounds, 157- 158 Cellular radiation survival, see Radiation survival Centromeres, recombinations in CAD gene amplification, 99

237

INDEX

Chemoprevention Program NSAID clinical trials, 7 research strategies, 2-3 Chromatidic telomere fusion model, integration with amplification regulation, 104-107 Chromosomal alterations, in retinoblastoma tumor cells, 117 Chromosomal analyses, of breast cancer cells, 39-40 Chromosomal rearrangements, tumorspecific, 60-6 1 Chromosome breakage-acentric element model, of gene amplification, 100-

102

Chromosome Iq, allele loss on, 45 Chromosome 7q,allele loss on, 45 Chromosome I Ip, allele loss on, 45 Chromosome 1 Iq, 1 lq13 region amplification in breast cancer, 34-36 Chromosome 13q,allele loss on, 43-44 Chromosome 13q 14,retinoblastonia susceptibility gene mapping, 117 Chromosome 17p, allele loss on, 41-43 Chromosome 17q allele loss on, 44-45 breast cancer susceptibility gene, 46 Chromosome 18q,allele loss on, 45 c-jun gene, okadaic acid-induced expression and transcription, 166 Clinical management, of breast cancer,

Clonogenic assay, for cellular response to radiation, 197 Colon cancer dietary fadfiber association, clinical trial, 18-19 pathogenesis, cell genetic changes, 3-5 Colon tumors fat effects, 5-6 fiber effects, 5-6 Colony-stimulating factors inimunotherapy with, 69 macrophage production, stimulation by okadaic acid, 164 Colorectal cancer cell turnover rates, 4 and dietary calcium and vitamin D, epidemiologic study, 6 noninvasive genetic screening, 4 protective role for aspirin and NSAIDs, epidemiologic study, 6-7 cot gene and acquisition of radiation-resistant phenotype, 212 c a t , resistance to y-rays conferred by,

209 Cyclophosphamide, enhancement of T I L effectiveness, 73-74 Cytokines for immunotherapy, 66-69 tumor cell production of, 79

48-49 Clinical trials Breast Cancer Prevention Trial, 17 Carotene and Retinol Efficacy Trial, 19 dietary fatlfiber association with colon cancer, 18- 19 Linixian esophageal cancer prevention trial, 19-20 list of chemoprevention trials, 14-15 medical setting, 13- I7 NSAIDs, 7 public health setting, 17-20 recombinant TNF-a, 68 thymidine labeling index, 4 toxicologic and safety evaluations for, 7 Clonally derived cell lines, heterogeneity in radiation survival responses, 199200

D DCC gene, 45 Dehydroepiandrosterone, in nitro testing, 9 Diet, effects on MNU-induced mammary tumors, 5-6 Diet and Cancer Program, 2-3 Differentiation antigens, 64 2-Difluoromethylornithine, in uitro testing,

9 Digestive tract, tautomycin effects, 182-

183 Dinophysk fortii, dinophysistoxin- 1 isolation, 151 Dinophysistoxin- 1 apparent activation of protein kinases,

162

INDEX

F

biochemical and immunological effects,

I60 isolation, 15 1 structure-activity relationships, 158-

161 tumor promotion on mouse skin, 151-

154 Disco&rmiu calyx, calyculin A isolation,

168 DNA amplified, evolution, 108-1 10 internucleosomal fragmentation, okadaic acid-related, 165 loss on chromosome I lq13 in breast cancer, 34-35 replication, pl10R"' effects, 131-134 synthesis & novo, alteration after y radiation, 206-207 Double minutes, 40 DRTFl transcription factor, interaction with plloRB', 125-126 Drug combinations, research, 11- 12 Ductal carcinoma in situ, 27-28 mammographic characterization, 30

E E2F transcription factor, interaction with plloRB', 125 Egr-1 transcription factor, 218 Epidemiological research, in cancer prevention, 6-7 Epidermal growth factor receptor gene amplification in breast cancer,

37 okadaic acid-stimulated phosphorylation, 165- 166 Epithelium, intestinal, okadaic acid effects, 163-164 Erbstatin, 62 Erythropoietin, immunotherapy with,

69 Esophageal cancer, vitamin/mineral supplement effects trials, 19-20 Estrogen, serum levels, fiber effects, 19 Expression libraries, for generation of new monoclonal antibodies, 72 Ex vivo genome modifications, 79-80

Familial colon cancer, calcium supplementation trials, 13-15 Familial polyposis, vitamins/fiber effects,

17-18 Fat clinical trials, 5-6, 17- 19 saturated, effects on colon tumors, 5-6 Fiber dietary, effects on MNU-induced mammary tumors, 5-6 effects on colon tumors, 5-6 Fibroblasts, nonturmorigenic skin, in LiFraumeni families altered DNA & novo synthesis, 206-

207 radioresistance, 20, 205 topoisomerase activity levels, 206 flg gene, amplification in breast cancer,

38-39 fm gene, effects on radiation response, 210 fos gene, c-fos expression and transcription, okadaic acid-induced, 166-167

G Gamma radiation, see also Ionizing radiation dose rate, and oncogene effects, 208 effects on DNA & n m synthesis in LiFraumeni syndrome, 206-207 G, or G, arrest role in radiation recovery, 223-224 induction of PKC-mediated signaling,

218-219 radioresistance after exposure to, 2 14 resistance conferred by v-mos, c-col, and N-rar genes, 209 role of redox-related biochemical control mechanisms, 222 Gene amplification in breast cancer bek gene, 38-39 c-myc gene, 36-37 flg gene, 38-39

INDEX

IGF-I receptor gene, 37-38 neu gene, 32-34 evolution of amplified DNA, 108-1 10 mechanisms bridge-breakage-fusion cycles, 98-99 centromere recombination, 99 chromosome breakage-acentric element model, 100-102 telomeric fusions, 98-99 unequal sister chromatid exchange, 96-97 regulation integration with chromatidic telomer fusion model, 104- 107 permissivity, 89-91 probability stable stimulation, 92-93 transient stimulation, 91 Gene expression differential, and radiation response, 217-2 18 inhibition, by antisense oligonucleotides, 75-77 RBI gene, regulation, 122- 123 Gene mapping, retinoblastoma susceptibility to 13q14.2, 117 Gene therapy, 77-80 Genetic counseling, for breast cancer, 49 Genistein, 62 Genomes ex uzuo modifications, 79-80 tumor-cell, manipulation, 65 Glutathione intracellular levels, and Raf-1 activation, 22 radiation protection by, 221 Glycookadaic acid, isolation, 151 Granulocyte macrophage-colonystimulating factor, radioprotective effects, 212 GSH, see Glutathione GTP antagonists, 62 GTPases, 62

H Halichundria okadai. okadaic acid isolation, 150-151

Head cancer, 13-cis-retinoicacid trial, 15 Herbimyucin, 62 Heterogeneity, clonal, in radiation response, 199-200 Heterozygosity loss in breast cancer, 30-31, 41 loss in retinoblastoma, 116 Histone H3, okadaic acid-stimulated phosphorylation, 165-166 Host tolerance, for therapy, 80 4-HPR clinical trials, for breast cancer, 16 in uitro testing, 9 tamoxifen-4HPR combination studies, 11-12 Human antimurine antibody, 71-72 Human papilloma virus, E6 and E7 genes, 80 H yperphosphorylation of cytokeratins, tautornycin-induced, 181-182 of intermediate filaments. 162- 163

I Ibuprofen, in vitro testing, 9 IGF-I, see Insulin-like growth factor-] IgG, anti-idiotypic, 64 Immortality, correlation with permissivity, 105- 106 Immortalized human bronchial epithelial cells, rafl expression-related increase i n radiation resistance, 209 Immunotherapy, passive adaptive cellular therapy, 73-74 cytokines, 66-69 monoclonal antibodies, 69-73 Insulin-like growth factor- I receptor gene, amplification in breast cancer, 37-38 Interferon-a, immunotherapy with, 66-67 Interferon-y, imrnunotherapy with, 67 Interleukin- 1, radiation-related transcriptional regulation, 68 Interleukin-2. iminunotherapy with, 67 Intermediate filaments, hyperphosphorylation, 162-163 Intestinal epithelium, okadaic acid effects, 163-164

240

INDEX

In viho testing, for chemopreventive agents, 8 In viva testing of chemopreventive agents, 8-10 for efficacy and toxicity, 9- 10 Iodine-131-mAb conjugates. 70-71 Ionizing radiation, see a h Gamma radiation DNA damage caused by, 220-225 DNA repair cascade, 220-225 induction of growth factors, cytokines, and cell cycle control genes, 219220 molecular targets of, 2 18-220 resistance, correlation with raf- 1 gene activation, 203

K Ki-67 anti-nuclear antibody, 4

L Leukoplakia, oral, 13-ci-retinoic acid trial, 15 Li-Fraumeni syndrome and breast cancer, 47 germline mutations in p53 gene, 204205 radioresistance phenotype, 205 and raf-I gene activation, 47 Linixian esophageal cancer prevention trial, 19-20 Lipid bilayer membrane, okadaic acid interaction, 164- 165 Liver cells, penetration by microcystins and nodularin, 176- 177 Liver toxicity, of microcystin and nodularin, 172-174 Lobular carcinoma in situ, 27-28 Lung cancer, antioxidant trials, 19 Lymphokine-activated killer cells, therapy with, 73 Lymphotoxin, irnmunotherapy with, 68

M Macrophages colony-stimulating factor production, okadaic acid-stimulated, 164 okadaic acid-stimulated prostaglandin E, production, 164 Mammary tumors, MNU-induced, diet effects, 5-6 Mammography, DCIS characterization, 30 Marker proteins, identification in radioresistant and radiosensitive cell lines, 218 mdr gene, 80 Mean inactivation dose, 197 Messenger RNA, RBI gene, 119-120 tissue distribution, 121-122 35-Methylokadaic acid, see Dinophysistoxin- I Methylphosphonate oligonucleotide analog, 76-77 Microcystin-LR, biochemical and immunological effects, 160 Microcystins biochemical activity, 172-176 hepatotoxicity, 174- I79 isolation, 172 molecular modeling, 179- 180 structure, 172- 176 target tissues, 176- 178 tumor promotion, in liver, 178-179 Mitogenic signals, radiation response and, 2 10-2 15 Molecular genetics, cancer prevention research, 3-5 Molecular modeling, microcystins and nodularin, 179-180 Molecular targets, of ionizing radiation, 218-220 Molecular therapies antineoplastic agents, 61-63 immunotherapy active, 63-66 passive, 66-74 tumor-specific, 60-6 1 Monoclonal antibodies combinatorial immunoglobulin gene libraries for, 72 against growth-stirnulatory receptors, 69 immunotherapy with, 69-73

24 1

INDEX

iodine-131 conjugates, 70-71 radionuclide conjugates, 70-7 1 single-chain antigen proteins, 72-73 therapies, problems confronting, 7 1-72 toxin conjugates, 70 mos gene and acquisition of radiation-resistant phenotype, 2 12 v-mos, resistance to y-rays conferred by, 209 myc gene c-myc amplification in breast cancer, 36-37 interaction with p l lORR’, 127 synergistic effect with EJ-ras on radiation-resistant phenotype, 208-209, 2 1 1 combined role with c-rafl gene for radiation resistance, 2 13 with raf gene, synergistic effects, 213 v-myc, synergistic effect with EJ-rcls on radiation-resistant phenotype, 208209, 21 1 Myogenesis, inhibition by okadaic acid (C2C12 cells), 167

N National Surgical Adjuvant Breast and Bowel Project, 17 Neck cancer, 13-cis-retinoic acid trial, 15 Network theory, of antibody production, 64-65 neu gene, amplification in breast cancer, 32-34 NF-KB induction by y-irradiation in human myeloid leukemia cells, 219 induction by okadaic acid in Jurkat cells, 166 N 1H/3T3 cells, radioresistance phenotype, rac gene activation and, 208 nm23 gene, 45 Nodularia spumigeno, nodularin isolation, 174 Nodularin biochemical activity, 172- 176 hepatotoxicity, 174- 179 isolation, 174

molecular modeling, 179-180 structure, 172-176 target tissues, 176-178 tumor promotion, in liver, 178- 179 Noninvasive genetic screening, for colorectal cancer, 4 Nonsteroidal anti-inflammatory drugs, protective role in colorectal cancer, 6 Nonturmorigenic skin fibroblasts, in LiFraumeni families altered DNA de novo synthesis, 206-207 resistance to ionizing radiation, 205 topoisomerase activity levels, 206 NSAIDs, protective role in colorectal cancer, 6 Nuclear localization signals, for pl IORH’, 123 Nuclear proteins, okadaic acid-stimulated phosphorylation, 165-166

0 Okadaic acid biochemical effects, 150-151, 160, 164166 biological effects, 164- 166 compounds synthesized from, 151 derivatives, 150-151 effects on cell morphology, 165 intestinal epithelium, 163- 164 protein phosphorylation, 165- 166 gene expression regulation, 166- 167 3H-labeled, distribution, 163-164 immunological effects, 160 interaction with lipid bilayer membrane, 164-165 simultaneous treatment with teleocidin or TPA, 155-157 structure, 150- 15 1 transcriptional regulation, 166- 167 tumor promotion comparison with calyculin A, 172 on mouse skin, 151-154 in rat glandular stomach, 154-155 unique properties induced by, 166 Okadaic acid class compounds apparent activation of protein kinases, 161- 163

242

INDEX

biochemical activities, 152 biochemical and immunological effects, 160 inhibition of PP-1 and PP-2A, 146-150 in udro cell transformation, 157-158 okadaic acid receptors, 146- 147 structure-activity relationships, 158-161 tumor-promoting activities, 152 Okadaic acid pathway relation to human cancer, 183-186 schematic, 155 summary of, 163 Okadaic acid response element, 167 Okadaic acid spiroketal I biochemical and immunological effects, 160 conformation, 159 Okadaic acid spiroketal I1 biochemical and immunological effects, 160 conformation, 159 Okadaic acid tetrdtmethyi ester, biochemical and immunological effects, 160 Oligonucleotides analogs resistant to nucleolytic cleavage, 76-77 antisense inhibition of gene expression, 75-77 radiosensitizing effects, 226 Oltipraz in uitro testing, 9- 10 preclinical testing, 10-1 1 Oncofetal antigens, 64, 69 Oncogenes activated effects variation with y radiation dose rate, 208 linkage to radiation resistant phenotype, 208 effects on radiation response, 201-202 products, redox regulation, 22 1-222 Oral leukoplakia, 13-cis-retinoicacid trial, 15

P Pandaros acanthifolium, acanthifolicin isolation, 151

Papillomavirus E7, binding to p l loRBI, 120-12 1 Passive immunotherapy adaptive cellular therapy, 73-74 cytokines, 66-69 monoclonal antibodies, 69-73 Permissivity correlation with immortality, 105- 106 in gene amplification, 89-91 p53 gene, 41-43 germline mutations in Li-Fraumeni syndrome, 204-205 wild-type, and cell cycle progression after DNA damage, 224 Phorbol- 12,I 3,didecanoate, comparison with okadaic acid in cell transformation assay, 157- 158 Phosphatidylinositol 3'-kinase, 62 Phospholipase C, 62 Phosphorothioate oligonucleotide analog, 76-77 Phosphorylation okadaic acid effects, 165-166 p l lORBf, modulation, 123-124 tautomycin effects in K562 cells, 181 Piroxicam clinical trial, 7 in vitro testing, 9 Point mutations, in breast cancer, 39 Polyoma large T antigen, binding to pl ]OR"', 120-121 p l loRBI cellular proteins associated with, 124- 125 characterization, 120 effect on DNA replication, 131-134 inhibition of cell cycle progression, 129 of cell proliferation by TGF-P,, 129131 interact ions with cellular transcription factors, 125- 128 with c-myc, 127 localization in nucleus, I23 phosphorylation modulation, 123- 124 regulation of RCBPlSpl, 128 as transcription factor, 116, 127 viral oncoprotein binding, 120- 121 Predisposition, genetic, to breast cancer, 46-47

243

INDEX

Probability, in gene amplification, 91 -93 Progesterone receptor, okadaic acidstimulated phosphorylation, 165- 166 Prohibitin gene, 44-45 Promoters, tissue- and cell type-specific, 78 Protein kinase C activation, ionizing radiation-related, 218-219 inhibitors, 62 role in radiation-resistant phenotype, 211-212 tautomycin effects on activation, 181I82 Protein kinase C pathway, schematic, 155 Protein kinases, apparent activation by okadaic acid class compounds, 161163, 181-182 Protein phosphatase 1, inhibition by okadaic acid class compounds, 146150 Protein phosphatase 2A, inhibition by okadaic acid class compounds, 146150 Pseudomom toxin-mAb conjugates, 70

R RAD9 control system, 224 Radiation resistance after exposure to y-rays, 2 14 antisense RNA approach to, 225-226 combined roles for raf-1 and m y genes, 213 defined, 197 down-regulation with antisense oncogene (raf-I), 225 of human squamous cell carcinomas, 200-203 modulation, 225-226 mutant p53 alleles and, 224 raf-1 gene function, 203 raf gene function, in Li-Fraumeni syndrome, 203-207 Raf-1 protein kinase role, 212 rac gene role, 21 1 SHOK cells, N-rac-related, 2 I 1 synergistic effects of myc and raf genes, 213

topoisomerases I and 11 role, 222223 transformation and, 215-216 v-src gene effects, 209 v-src-related, in murine hematopoietic cells, 2 10-2 1 1 Radiation-resistant phenotype EJ-rac and c-myclv-myc synergistic effects, 208-209 in Li-Fraumeni families, 205 multiple genetic factors involved in, 217-218 multiple signals for, 2 14 transfection of human N-rm oncogene into NIH/3T3 cells, 208 Radiation response clonal nature of, 199-200 fmoncogene effects, 210 of human cells, raf gene role, 209 mitogenic signals and, 2 10-2 15 multifactorial nature of, 21 7-2 I8 oncogene effects, 201-202 variation with cell type, 2 I5 Radiation survival linear quadratic model, 197- 198 multitarget model, 197- 198 Radiation survival curves, relative radioresistance or radiosensitivity, 197-198 Radionuclide-mAb conjugates, 70-7 1 Radioresistance, see Radiation resistance Radiosensitivity defined, 197 intrinsic, measurement by mean activation dose, 197 rat kidney epithelial cells, K-ras-related, 209-2 10 Radiosensitization antisense RNA approach, 225 diamide-induced, 22 1 GSH depletion by BSO and, 22 1 by taf-1 antisense oligonucleotides, 225-226 raf gene and acquisition of radiation-resistant phenotype, 212 EJ-rac, effects on NIH/3T3 radioresistance levels, 208 K-ras, radiosensitization of rat kidney epithelial cells, 209-2 10

244 with myc gene, synergistic effects, 213 N-T~ effects on NIH/3T3 radioresistance levels, 208 effects on SHOK cell radioresistance, 21 I resistance to y-rays conferred by, 209 and oncogenic transformation, 2 16 role in radiation resistance, 216 role in radiation response of human cells, 209 v-H-ru, effects on NIH/3T3 radioresistance levels, 208 v-K-rm, effects on NIH/3T3 radioresistance levels, 208 ruf-I gene activation and GSH intracellular levels, 22 and Li-Fraumeni radioresistance phenotype, 205-206 and radioresistance in Li-Fraumeni syndrome, 203-207 and resistance to ionizing radiation, 203 antisense oligonucleotides, radiosensitizing effects, 225-226 c-ruf-I, combined role with myc gene for radiation resistance, 2 13 expression in Beas-2B cells, radiation resistance conferred by, 209 function, link to radiation-resistant phenotype, 2 12 human sequences in NIHl3T3 transfectants after radiotherapy, 200-203 Raf-1 protein kinase dual role of, 216 role in radiation resistance, 2 12 rcrr gene c-Ha-rcrr activation by okadaic acid class compounds, 152-154 EJ-rcrr, synergistic effect with c-myclv-myc on radiation-resistant phenotype, 208-209, 2 1 1 mutations in breast cancer, 39 in colorectal cancer, 4 role in radiation resistance, 2 I 1, 2 16

INDEX

Rat embryo cells, radioresistance by contransfection of EJ-rcrr and c-myclv-myc, 2 I 1 synergistic effects of myc and rufgenes, 213 Rat kidney epithelial cells, K-rm-induced radiosensitization, 209-2 10 Rb gene, 43-44 RB1 gene characterization, I 18- 120 expression, 116, 122-123 germline mutations, 116-1 17 homologous sequences among vertebrates, 1 I8 inactivation, tissue-specific susceptibility to, 135-136 mRNA transcripts tissue distribution, 121- 122 plIoH*' characterization, I20 viral oncoprotein binding, 120- I2 I reconstituted cell lines, summary, 133 suppression of tuniorigenicity, 133- 135 RCBP, regulation by pl IOP', 128 Restriction enzyme fragment length polymorphisms, breast cancer carcinomas, 4 1 Retinoblastoma familial, 116 gene regulation mechanisms, 12 1 - 124 genetics, 116-1 17 heritable, I16 tumor cells, chromosomal changes in, 117 Retinoblasts. susceptibility to RBI gene inactivation, 135- 136 13-cic-Retinoic acid, clinical trials head and neck cancers, 15 oral leukoplakia, 15 Retinoids, inhibition of neoplastic conditions, 5 Retroviruses, for gene therapy, 77-78 Ricin toxin-mAb conjugates, 70

S Saturated fat, clinical trials. 5-6, 17-19 Single-chain antigen proteins, 72-73

INDEX

.Sister chromatids, unequal exchange in CAD gene amplification, 96-97 Somatomedin C, see Insulin-like growth factor- 1 Spl, regulation by p l loRBI, 128 Squamous cell carcinomas, human marker proteins in radioresistant and radiosensitive cells, 218 radioresistance, 200-203 src gene, v-scr increase in radioresistance induced by, 209 induction of radioresistance in murine hematopoietic cells, 210-21 I Staurosporine, 62 Sulindac, clinical trial, 7 Superoxide dismutase, radiation protection by, 22 I SV40, binding to plloRB’, 120-121

T Tamoxifen, 62 adjuvant therapy for breast cancer, 17 clinical trials for breast cancer, 16 4-HPR-tamoxifen combination studies, 11-12 Tautom ycin biochemical activity, 181-182 biochemical and immunological effects, 160 effects on digestive tract, 182-183 structure, 181-182 tumor promotion on mouse skin, 182 Teleocidin simultaneous treatment with okadaic acid, 155-157 tumor promotion in rat glandular stomach, 154-155 Telomeric fusions, in CAD gene amplification, 98-99 12-0-Tetradecanoylphorbol13-acetate simultaneous treatment with okadaic acid, 155- 157 tumor promotion in rat glandular stomach, 154-155 12-0-Tetradecanoylphorbol13-acetateinduced-sequence genes, okadaic

acid-induced mRNAexpression, 166 12-0-Tetradecanoylphorbol13-acetate response element, 167 Thiols, cellular depletion by BSO, and radiosensitization, 22 1 Three-dimensional structures, microcystin-LR and nodularin, 180 Thymidine labeling index, 4 TIL, see Tumor-infiltrating lymphocytes Tissue-specific susceptibility, to RBI gene inactivation, 135- 136 TNF, see Tumor necrosis factor Topoisomerases I and 11, association with radiation resistance, 222-223 Transcription factors, interactions with plloRB‘, 125-128 Transforming growth factor+, genes, activation by p l IWB’, 128 Transforming growth factor+, , inhibition of cell proliferation, pl1oRB’ role, 129-131 Tumor cells cytokine production, 79 genome manipulation, 65 Tumorigenicity, suppression by RBI, 133135 Tumor-infiltrating lymphocytes, therapy with, 73-74 Tumor necrosis factor-a immunotherapy with, 68 radiation-related transcriptional regulation, 68 Tumor necrosis factor+, immunotherapy with, 68 Tumor promotion by calyculins, on mouse skin, 170- 172 general biochemical mechanism of, 183- 186 by microcystins, in liver, 178-1 79 by nodularin, in liver, 178-179 by okadaic acid biochemical and biological effects, 164-166 on mouse skin, 151-154 by tautomycin on mouse skin, 182 TPA-type, tumor-promoting activities, 152 Tumors classification, 60 common features, 59

246 Tumor-specific chromosomal rearrangements, 60-6 1 Tumor suppressor genes, inactivation in breast cancer DCC gene, 45 p53 gene, 41-43 prohibitin gene, 44-45 Rb gene, 43-44 Tumor vaccines, 63-66 Tyrosine kinase inhibitors, development, 61-62 Tyrphostins, 62

INDEX

Vimentin calyculin A effects on phosphorylation, 171 hyperphosphorylation, 162-163 Vitamin D, dietary, and colorectal cancer, 6 Vitamin E, clinical studies, 19

W Wnt-3 gene, 45

X Vaccines, anti-tumor, 63-66, 80

I S B N O-L2-00666L-O

X-rays, egr-1 and c-jun transcription induction, 218