ADVANCES IN DNA SEQUENCE-SPECIFIC AGENTS
Volume3
9 1998
This Page Intentionally Left Blank
ADVANCES IN DNA SEQUEN...
51 downloads
991 Views
14MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ADVANCES IN DNA SEQUENCE-SPECIFIC AGENTS
Volume3
9 1998
This Page Intentionally Left Blank
ADVANCES IN DNA SEQUENCE-SPECIFIC AGENTS Series Editor:
GRAHAM B. JON ES
Department of Chemistry Clemson University Clemson, South Carolina
Volume Editor: MANLIO PALUMBO Department of Pharmaceutical Sciences University of Padova Padova, Italy VOLUME3
9 1998
( ~ ) JAI PRESSINC. Greenwich, Connecticut
London, England
Copyright 0 1998 by JAI PRESSINC. 55 Old Post Road, No. 2 Greenwich, Connecticut 06836 ],41 PRESSLTD. 38 Tavistock Street Covent Garden London WC2E 7PB England
All rights reserved. No part of this publication may be reproduced, stored on a retrieval system, or transmitted in any form or by any means, electronic, mechanical, photocopying, filming, recording, or otherwise without prior permission in writing from the publisher. ISBN: 0-7623-0203-8 ISSN: 1067-568)( Manufactured in the United States of America
CONTENTS
LIST OF CONTRIBUTORS PREFACE
Graham B. Jones and Manlio Palumbo
vii ix
INTRODUCTION TO DNA SEQUENCE-SPECIFIC AGENTS
Manlio Palumbo
SEQUENCE-SPECIFIC POISONS OF TYPE II DNA TOPOISOMERASES
Giovanni Capranico, Monica Binaschi, Maria E. Borgnetto, Mariagrazia Cornarotti, Emanuela Zagni, Manlio Palumbo, and Franco Zunino
TOPOISOMERASE I-TARGETING DRUGS: NEW DEVELOPMENTS IN CANCER PHARMACOLOGY
Barbara Gatto and Leroy Fong Liu
DNA SEQUENCE RECOGNITION ALTERED BIS-BENZlMIDAZOLE MINOR-GROOVE BINDERS
J. William Lown
39
67
SEQUENCE-SPECIFIC RECOGNITION AND MODIFICATION OF DOUBLE-HELICAL DNA BY MINOR-GROOVE BINDING CONJUGATES STRUCTURALLY RELATED TO NETROPSIN AND DISTAMYCIN
Christian Bailly
97
NEW DEVELOPMENTS IN THE USE OF NITROGEN MUSTARD ALKYLATING AGENTS AS ANTICANCER DRUGS
William A. Denny
157
vi
CONTENTS
DNA BINDING OF NONCLASSICAL PLATINUM ANTITUMOR COMPLEXES
Nicholas Farreil
179
KEDARCIDIN AND MADUROPEPTIN: TWO NOVEL ANTITUMOR CHROMOPROTEINS WITH SELECTIVE PROTEASE ACTIVITY AND DNA CLEAVING PROPERTIES
Nada Zein and Daniel R. Schroeder
201
ANTISENSE- AND ANTIGENE-BASED DRUG DESIGN STRATEGIES IN ONCOLOGY
Karl-Heinz Altmann, Doriano Fabbro, and Thomas Geiger
SEQUENCE-SPECIFIC RECOGNITION OF DOUBLE-STRANDED DNA BY PEPTIDE NUCLEIC ACIDS
Peter E. Nielsen
INDEX
227
267 279
LIST OF CONTRIBUTORS
Karl-Heinz Altmann
Novartis Pharma Inc. Basel, Switzerland
Christian Bailly
Institut de Recherches sur le Cancer de Lille INSERM Lille, France
Monica Binaschi
Division of Experimental Oncology Istituto Nazionale per Io Studio e la Cura dei Tumori Milan, Italy
Maria E. Borgnetto
Division of Experimental Oncology Istituto Nazionale per Io Studio e la Cura dei Tumori Milan, Italy
Giovanni Capranico
Division of Experimental Oncology Istituto Nazionale per Io Studio e la Cura dei Tumori Milan, Italy
Mariagrazia Cornarotti
DAKO SpA Milan, Italy
William A. Denny
School of Medicine University of Auckland Auckland, New Zealand
Doriano Fabbro
Oncology Department Ciba-Geigy Ltd. Basel, Switzerland
Nicholas Farrell
Department of Chemistry Virginia Commonwealth University Richmond, Virginia vii
viii
LIST OF CONTRIBUTORS
Barbara Gatto
Department of Pharmaceutical Sciences University of Padova Padova, Italy
Thomas Geiger
Oncology Department Ciba-Geigy Ltd. Basel, Switzerland
Leroy Fong Liu
Department of Pharmacology UMDNJ-R.W. Johnson Medical School Piscataway, New Jersey
J. William Lown
Department of Chemistry University of Alberta Edmonton, Alberta, Canada
Peter E. Nielsen
Department of Medical Biochemistry and Genetics The Panum Institute Copenhagen, Denmark
Manlio Palumbo
Department of Pharmaceutical Sciences University of Padova Padova, Italy
Daniel R. Schroeder
Pharmaceutical Research Institute Bristol-Myers Squibb Wallingford, Connecticut
Emanuela Zagni
Sandoz Prodotti Farmaceutici SpA Milan, Italy
Nada Zein
Oncology Drug Discovery Pharmaceutical Research Institute Bristol-Myers Squibb Princeton, New Jersey
Franco Zunino
Division of Experimental Oncoiogy Istituto Nazionale per Io Studio e la Cura dei Tumori Milan, Italy
PREFACE DNA sequence specificity plays a critical role in a number of biological processes, and influences a diverse range of molecular recognition phenomena, including protein-DNA, oligomer-DNA, and ligand-DNA interactions. This volume is intended to give the reader an up-to-date view of both the current status of, and developments to be expected in the near future, in research involving DNA interactive antitumor agents. In line with the intent of the series, special emphasis is thus placed on issues connected with sequence specificity and molecular recognition. Whereas volumes 1 and 2 were divided into subsections covering both analytical methods and applications, in this volume the entire focus is devoted to the macromolecule target specificity of DNA interactive developmental therapeutic agents of current interest. A brief introduction to DNA interactive anticancer agents is included for readers who may benefit from an overview surrounding the developments that have contributed to our general understanding of this field. The following nine chapters have been carefully chosen so that they describe topics which are at the forefront of development in DNA-targeted cancer chemotherapy. Issues that have been addressed include the mechanisms of selective DNA topoisomerase I and II poisoning by antitumor agents (Chapters 1 and 2), sequence-specific recognition of DNA by groove-binding drugs and drug-conjugates (Chapters 3 and 4), recent developments in nitrogen mustard alkylating agents and their potential use for antibody-directed enzyme-prodrug therapy (Chapter 5), nonclassical platinum
x
PREFACE
anticancer complexes, including dinuclear and trans-platinum derivatives (Chapter 6), DNA cleaving antitumor chromoproteins containing reactive enediyne moieties, which exhibit interesting free-radical chemistry along with selective targeting (Chapter 7), the potential of new sequence-specific antisense and antigene therapy in oncology (Chapter 8), and finally the conceivable chemotherapeutic use of mimetics of the DNA structure, obtained by substitution of the sugar-phosphate natural chain with a peptide backbone, the so-called peptide nucleic acids (Chapter 9). Important approaches being currently investigated for selective cancer treatment, such as gene therapy and immunochemotherapy, are not discussed in this volume since they fall beyond its scope. Graham B. Jones Series Editor Manlio Palumbo Volume Editor
INTRODUCTION TO DNA SEQUENCE-SPECIFIC AGENTS
Manlio Palumbo
I. Need for Specific Anticancer Drugs . . . . . . . . . . . . . . . . . . . . . . . . II. Nucleic Acid Binding . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . III. The Search for Specificity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Short-Range Specificity . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Long-Range Specificity . . . . . . . . . . . . . . . . . . . . . . . . . . . IV. Newer Strategies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
1 2 4 5 5 6
I. NEED FOR SPECIFIC ANTICANCER DRUGS Cancer is a genetic disease characterized by impaired regulation of cell proliferation and differentiation mechanisms. Normal cells contain specific genes, the protooncogenes, which encode proteins involved in biological processes, e.g. signal transduction and control of gene expression. These growth-promoting genes are counterbalanced by growth (tumor)-suppressing genes: the delicate equilibrium between activation and suppression allows a correct progression of the cell through its vital cycle. Mutations which potentiate proto-oncogene functions, turning them into oncogenes, induce uncontrolled growth in tumor cells. Similarly, DNA damage
Advances in DNA Sequence-Specific Agents Volume 3, pages 1-6 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8
2
MANLIO PALUMBO
at the level of tumor suppressor genes lets cell proliferation proceed unconstrained, thus allowing development of malignancy. The hyperproliferative effects due to proto-oncogenes are generated in a number of ways in cancer cells. Proto-oncogenes may undergo point mutations in their sequence or they can be overexpressed as a result of amplification or translocation mechanisms. In the former case they produce "wrong" signal proteins, which impair the signal-transduction pathway; in the latter case the product of the oncogene differs only in the amount, not in the nature, from the product of the proto-oncogene found in normal cells. These observations clearly indicate how difficult it is to find a selective target for cancer chemotherapy. Many of the drugs used today for treating cancer patients are in fact practically nonselective and exhibit severe toxicity to normal tissues. Another limiting aspect of the current pharmacological therapy of cancer is the onset of resistance phenomena, which in many cases reflects an acquired capacity of developing defense mechanisms against drug treatment (multidrug resistance). Finally, chemotherapy with the presently available drugs can be valid for certain types of tumors but inadequate for common solid tumors. Hence, the requirement for novel effective and specific antineoplastic agents is stringent and pressing, as witnessed by intense efforts by many industrial and academic research teams.
II.
NUCLEIC A C I D B I N D I N G
Since DNA is the depository of genetic information and alterations in its expression are responsible for disease, the search for anticancer drugs directed against DNA, DNA processing enzymes, or their complexes has represented a logical and fruitful approach. Indeed, of the compounds widely employed in clinical practice since the late 1940s or presently in advanced clinical trials, a vast majority interact with DNA or with enzyme-DNA conjugates (Table 1). Even though antimetabolites are listed as "other drugs" in Table 1, they are also related to nucleic acids as they interfere with enzymatic reactions involved in DNA or RNA synthesis. The results of a very large number of investigations show that reversible binding to DNA, which may occur by intercalative or groove-binding mechanisms, is the initial important step of a cascade of chemical and biochemical events causing cell cytotoxicity. Subsequent to these reversible interactions, the DNA-damaging events generally occur. There are a number of ways DNA-directed anticancer drugs injure the nucleic acid. They can be reactive per se and generate damaging species such as free radicals or carbonium ions, which cleave or alkylate DNA, or they can mediate the transfer of a free radical to other species able to degrade the nucleic acid including oxygen or hydroxyl groups. A more elaborate mechanism involves the DNA cutting/rejoining enzymes of the topoisomerase family. In this case drugs interfere with an enzyme-DNA cleavable complex, thereby inducing DNA strand scission. The modes of DNA damage for clinically useful DNA binding anticancer agents are summarized in Table 2.
Introduction
3 Table 1.
ChronologicalDevelopmentof Anticancer Drugs
Drugs Interacting with DNA (or DNA-Enzyme Complex)
Other Drugs
1940s Nitrogen Mustard 1950s Methanesulfonates Busulfan Chlorambucil Cyclophosphamide 1960s Melphalan Actinomycin D
Methotrexate Mercaptopurine
Fluorouracil Vinca Alkaloids Thioguanine Cytosine Arabinoside
1970s Bleomycin Mitomycin Doxorubicin Dacarbazine Nitrosoureas cis-Platin 1980s Epipodophyllotoxins Mitoxantrone Carboplatin Ifosfamide 1990s Camptothecins" Enediynes a
Interferon
Taxola
Note: aDrugsundergoingclinicaltrials.
During the past few years important advances have been made in understanding the basic requirements to promote effective interactions in the drug-DNA complex, and in characterizing its structural features at a molecular level. In addition, biochemical information has become available on ternary interactions involving drug, nucleic acid, and nucleic acid processing enzymes. These include DNA and RNA polymerase, and, most relevant to anticancer activity, DNA topoisomerases. Although the initial events of drug-mediated DNA damage are now relatively well understood, a wealth of knowledge is still missing to connect them to the subsequent
4
MANLIO PALUMBO Table 2. Type of DNA Damage Generated by Clinically Useful
Anticancer Drugs Interacting with DNA
Drug
Type of DNA-Damage
Busulfan Chlorambucil Cyclophosphamide Dacarbazine Ifosfamide Melphalan Methanesulfonates Mitomycin Nitrogen Mustard Nitrosoureas
Alkylation of base nitrogens
Bleomycin Enediynes
Free radical strand-cleavage
Carboplatin
Platinum coordinaiton to purine nitrogens
cis-Platin Actinomycin D
Topoisomerase II-mediated strand-cleavage Interference with DNA processing enzymes
Amsacrine Doxorubicin Epipodofillotoxins Mitoxantrone
Topoisomerase II-mediated strand-cleavage
Camptothecins
Topoisomerase l-mediated strand-cleavage
cytotoxic events, which finally lead to cell death. In addition, as more is learned about the cell cycle and proliferation, other nucleic acid-related targets for chemotherapy are emerging that will require the development of new therapeutic strategies. Among the most promising appears to be telomerase, as it prevents the shortening of telomers and is activated in cancer tissues, but not in somatic tissues.
III. THE SEARCH FOR SPECIFICITY The development of antineoplastic agents possessing a selective and targeted action at the DNA level would represent a major advance in the pharmacological treatment of cancer. Sequence specificity should be considered at two different levels: short-range specificity, which is characteristic for low molecular weight ligands and allows preferential binding to 2-5 consecutive DNA base pairs; and long-range specificity, which may provide effective recognition of one DNA sequence in the
Introduction
5
entire genome. The latter requires matching of the ligand to a minimum of 15-20 base pair regions, i.e. to about 2 helical turns. Both types of specificity are relevant to DNA binding anticancer drugs.
A. Short-Range Specificity It is known that many intercalators and groove binders do not interact with DNA at random, but usually exhibit well-defined preferences for particular base combinations. The location of drug-induced DNA damage is obviously related to the location of the drug along the DNA chain. Different specificities would therefore generate chemical modifications (nitrogen base/strand-cleavage) at different positions, each lesion exhibiting its own biochemical and pharmacological properties. A similar difference in specificity is observed for topoisomerase poisons. Indeed, each family of drugs, characterized by distinctive structural and electronic features, exhibits individual preferences in stimulating/repressing enzyme-mediated DNA cleavage. Again, these differences could explain at least in part the wide range of cytotoxic responses observed for drugs having the same mechanism of action. The field of short-range specificity is therefore, still of general interest, and important advances are likely to be uncovered in the near future. In particular, modulation of sequence specificity of groove binders and development of hybrid molecules, combining different pharmacophoric groups or nonspecific reactive groups with DNA-specific binders, will be surely relevant for producing new, more effective, and less toxic cancer chemotherapeutic agents.
B. Long-Range Specificity Although a full understanding and mastering of short-range specificity will be valuable for directing covalent DNA modification, free radical damage, and topoisomerase-mediated poisoning, the achievement of in vivo recognition of DNA sequences in the 15-20 base pair range might represent a more significant advance to the therapeutic potential of DNA-damaging agents. The present approach to this level of specificity involves antisense and antigene strategies, according to which single- or double-stranded regions of DNA (or RNA) can be recognized by a complementary sequence forming either Watson and Crick or Hoogsteen hydrogen bonding with the target sequence. The knowledge base in this area is growing very quickly, and we may expect pharmacological applications in man in the not too distant future. However, the problems to be solved to fully reach this goal (delivery, stability, specificity, toxicity) are still formidable. Another way to approach the issue of long-range specificity could take advantage of the fact that gene expression is regulated by selective binding of appropriate peptide sequences in regulatory proteins to target DNA. Thus, DNA-specific drugs could involve peptides, rather than oligonucleotides as the recognition elements. This kind of approach is still in its infancy and requires a more thorough knowledge of the interplay between recognition elements from the nucleic acid and from the
6
MANLIO PALUMBO
protein and of the conformational changes occurring when the macromolecules interact. Peptidomimetics will surely represent a valid class of future drugs in this field of cancer selective agents. Not only can oligonucleotides and oligopeptides be used as such, they can also be potentiated by linking to them pharmacophoric groups able to generate permanent damage to DNA, as already indicated by the development of numerous conjugates between alkylators or strand breakers and antisense oligonucleotides.
IV. NEWER STRATEGIES Complimenting the traditional design methods for specific and effective drugs, newer strategies are also being successful in the field of DNA- and protein-specific agents. In particular the development of methodologies to generate peptide, oligonucleotide, or, in general, drug libraries and to screen them against a given target macromolecule (the so-called irrational drug design or epitope targeting) is providing us with new important tools to yield selective candidates for chemotherapeutic applications. Since viable targets have been identified, the design and evaluation of DNA sequence-specific agents continues at a fast pace. The following chapters highlight major advances in this field from a clinical perspective, and will also elude to important questions which remain to be answered in this rapidly developing area.
SEQUENCE-SPECIFIC POISONS OF TYPE II DNA TOPOISOMERASES
Giovanni Capranico, Monica Binaschi, Maria E. Borgnetto, Mariagrazia Cornarotti, Emanuela Zagni, Manlio Palumbo, and Franco Zunino I. II. III.
IV.
V.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Background . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Structure and Function of DNA Topoisomerase II . . . . . . . . . . . . . . . . A. Amino Acid Sequence Homology . . . . . . . . . . . . . . . . . . . . . . B. Enzyme Phosphorylation . . . . . . . . . . . . . . . . . . . . . . . . . . . C. E n z y m e Functions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Drug-Resistant Topoisomerase II Mutants . . . . . . . . . . . . . . . . . . . . A. Prokaryotic Enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Eukaryotic Enzymes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D N A Topoisomerase II Poisons . . . . . . . . . . . . . . . . . . . . . . . . . . A. Structural Determinants of Classical Poisons . . . . . . . . . . . . . . . . B. Non-cleaving Inhibitors . . . . . . . . . . . . . . . . . . . . . . . . . . . C. Development of New Topoisomerase II-Directed Drugs . . . . . . . . . .
Advances in DNA Sequence-Specific Agents Volume 3, pages 7-38 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8
8 8 12 13 15 16 17 17 18 19 19 26 26
8
GIOVANNI CAPRANICO ET AL.
VI. Mechanismsof Drug Cell Killing . . . . . . . . . . . . . . . . . . . . . . . . A. Cellularand Molecular Mechanisms . . . . . . . . . . . . . . . . . . . . B. GeneticMechanisms . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I.
29 29 30 32 33
INTRODUCTION
DNA topoisomerases are nuclear enzymes that regulate DNA topology during transcription, replication, and recombination processes, and are essential for the integrity of the genetic material. Mammalian DNA topoisomerase II is the cellular target of important antitumor drugs, such as intercalating agents, minor-groove binders, and others. These agents interfere with topoisomerases by forming ternary DNA-drug--enzyme complexes in which DNA strands are broken and proteinlinked. Two isoforms (170 and 180 kDa) of type II DNA topoisomerase are present in human and murine cells. The expression of these isozymes, encoded by two distinct genes, are differentially modulated during cell proliferation and development. In recent years, X-ray diffraction studies as well as molecular and genetic analyses have allowed progress in the understanding of the structure and function of DNA topoisomerases. Drug structural determinants have been partially elucidated by studying the DNA sequence specificity of drug-mediated stimulation of topoisomerase II DNA cleavage and by novel structure-activity relationship studies. This will eventually allow design of new compounds targeted to selected genomic regions. Moreover, recent investigations on topoisomerase II inhibitors that do not stimulate DNA cleavage demonstrate that these agents may act against topoisomerases with a novel mechanism, suggesting new screening strategies to identify potential antitumor drugs. The initial molecular event, i.e. formation of the drug-stabilized cleavable complex, is a reversible process, thus how it can ultimately lead to cell death remains a very active area of research. Irreversible double-stranded DNA breaks, generated by interaction of cleavable complexes with ongoing DNA-dependent processes, may trigger a cell death program. This chapter surveys recent advances in the molecular pharmacology of sequence-specific antitumor topoisomerase II poisons.
II.
BACKGROUND
From unicellular organisms to human cells, DNA topology is governed by a large family of highly conserved enzymes known as DNA topoisomerases. 1-8 Regulation of the topology of the DNA molecule is an essential cellular task, thus these enzymes are necessary for the viability of all organisms. Since the discovery of the first topoisomerase, E. coli DNA topoisomerase I (or 0 protein), 2'9 several others have been isolated and characterized from both prokaryotic and eukaryotic cells. 5'1~ Recently, the crystal structure of a central fragment of the yeast type II
Poisons of Type II DNA Topoisomerases
9
DNA topoisomerase was resolved at a resolution of 2.7 ~, providing important insights for the catalytic mechanism. 12 Topoisomerases alter DNA conformations by making reversible DNA breaks in which a tyrosyl residue of the protein is covalently linked to a DNA phosphoryl group. 1-3 These enzymes may be divided into two major groups" type I enzymes introduce a single-stranded DNA cut at a time; type II enzymes on the other hand break both of the two strands of a duplex DNA fragment. Following DNA breakage, the enzyme catalyzes the passage of a single-stranded (type I) or double-stranded (type II) DNA fragment through the break, and finally reseals at the cleavage point. The known DNA topoisomerase I enzymes appear to belong to two distinct subfamilies based on sequence homology and biochemical properties, whereas all known type II enzymes show extensive homology of the amino acid sequences, suggesting that they are evolutionarily and structurally related to each other. 2'13 Type II DNA topoisomerases and eukaryotic topoisomerase I are poisoned by several compounds, some of which are widely used in the therapy of human cancers and infectious diseases (Figures 1 and 2). Antitumor drugs, such as anthracyclines, demethylepipodophyllotoxins, amsacrines, mitoxantrone, actinomycin D, streptonigrin, terpenoids, flavonoids, and camptothecins are poisons of eukaryotic topoisomerases II or I (Table 1), while quinolones, antibacterial agents, are poisons of DNA gyrase and topoisomerase IV, the bacterial type II DNA topoisomerases. These drugs have been shown to stabilize a covalent intermediate of the topoisomerase catalytic cycle, in which DNA strands are broken and the enzyme is covalently linked to the DNA. Drug action thus results in DNA cleavage stimulation that is believed to be the molecular basis of their cytotoxic activity. 14-e2 In recent years, the list of compounds that can interfere with DNA topoisomerase function has indeed become considerably longer. Often the word "inhibitor" is used for any of these compounds, however this may generate some confusion since there is more than one mechanism of drug action. Many agents stabilize the covalent complex, therefore stimulating DNA cleavage; others inhibit the catalytic activity without cleavage enhancement by impeding access of topoisomerases to DNA sequences bound by the drug, and still others interfere with protein conformational transitions by binding to the enzyme and freezing one of the possible protein conformations. Therefore, we define as poisons only the cleaving compounds (Table 1), and as inhibitors only those that inhibit the enzyme catalytic activity but do not stabilize the covalent DNA-enzyme complex. A peculiarity of known topoisomerase poisons is that their action is invariably DNA sequence-specific. DNA topoisomerases commonly produce DNA breakage at selected sites in a given DNA fragment, and a poison acts by stabilizing DNA-enzyme covalent complexes at a subset of these sites. Interestingly, chemically unrelated poisons generally stimulate DNA cleavage at distinct site subsets, resulting in drug-specific DNA cleavage intensity patterns. Detailed structureactivity relationship studies performed in our laboratories and by other groups have established structural determinants of the drug sequence specificity. Moreover,
H-N
d
0
I
H ‘
ww BISANTRENE
NHfi
OH
0
N
MITOXANTRONE
H
DOXORUBICIN
I
O
D
TENIPOSIDE (VM-26) H
‘
N s.Q
/I\
0
H
OH
H N ‘
0
I
d /\/OH NH
AMSACRINE (mAMSA)
ELLIPTICINE
Figure 1. Chemical structures of classical DNA topoisomerase I I poisons.
WCHS 8 0
OH
CLEROCIDIN
0
PLUM BAG IN
INTOPLICIN
ICRF-193
SAINTOPIN
AZATOX I N
STREPTONIGRIN
Figure 2. Chemical structures of other DNA topoisomerase I I poisons and inhibitors.
12
GIOVANNI CAPRANICO ET AL.
Table 1. Poisons of Eukaryotic DNA Topoisomerases a TOPO I
TOPO I & II
TOPO II
Intercalating drugs
Indolocarbozoles (ED- 1 1 0 ) Fagaronine
Actinomycin D Saintopin Intoplicin
Anthracyclines Amsacrines Anthracene derivatives Ellipticines Quinolones Amonafide Flavones Naphthoquinones
Non-intercalating drugs
Camptothecin Bulgarein Hoechst 33258
Indoloquinolinediones Demethylepipodophyllotoxins (AzalQD) Terpenoides Streptonigrin RO- 15-026 Isoflavones Catechins Azatoxin
Note: aMore information on these compounds can be found in 12o,148,149and references therein. Original data on
fagaronine and cathecins have been reported in Refs. 171,226, 227.
these investigations and cross-linking data with photoactivatable poisons have conclusively demonstrated that the drug receptors are located at the protein/DNA interface of the DNA cleavage site. Finally, knowledge of the high heterogeneity of topoisomerase II-mediated DNA cleavage in the chromatin of living cells has suggested that the sequence specific action of the poisons may have profound consequences for drug activity (vide infra). In past years, progress has been made in the elucidation of the mechanism of action of these agents that may be of help in the development of more effective poisons and inhibitors of type II DNA topoisomerase. The structural information on topoisomerase poisons may also be of great interest in the general search for sequence-specific DNA binders able to repress gene transcription at selected genomic loci. In this chapter we will focus on the biological activity and molecular action of the sequence-specific poisons of topoisomerase II, and on the structure and functions of the enzyme relevant to the action of antitumor poisons.
III.
STRUCTURE AND FUNCTION OF DNA TOPOISOMERASE II
Eukaryotic topoisomerase II is composed of two identical subunits, and it has been proposed to act as an ATP-dependent molecular clamp. 12'23-25 The enzyme can utilize an ATP-induced conformational change to capture a second DNA segment
Poisons of Type II DNA Topoisomerases
13
to be transported through the DNA break, and this is thought to be achieved by forming a circular clamp around the double helix. 23 The catalytic cycle might thus be divided into the following steps: (1) the non-covalent binding of the enzyme to the DNA, in which the enzyme is in an open form of the clamp; (2) the enzyme then produces a double-strand break, in which each subunit remains covalently attached to a 5' phosphoryl terminus (base + 1), with each of the two 3' termini (bases-1) recessed by four bases; (3) ATP binding causes an allosteric conformational change that closes the protein clamp after the capture of a second DNA segment; (4) this intact DNA segment is then transported through the broken DNA and allowed to exit from the protein; and (5) ATP hydrolysis restores the open form of the protein clamp. 12'23-25 Experimental evidence and structural data supported the idea that topoisomerase II transports one DNA segment through another by a two-gate mechanism. The DNA segment being transported would exit from the inside of the protein molecule through a gate at the opposite side of the entrance gate. ~2,24,25 Two distinct isozymes of topoisomerase II are present in mammalian cells: topoisomerases Iltx and 1113that have different molecular weights, 170 and 180 kDa, respectively. 26 These isozymes are encoded by two genes mapped to human chromosomes 17 and 3, respectively. 27'28 The a form may be associated with cell proliferation, while the 13form is expressed also in cultured quiescent cells and in nonproliferating normal mouse tissues. 27-31 Although the cellular functions of topoismerase II isoforms may be different, their role in the antitumor activity of the poisons have been debated in recent years. Recently, human topoisomerases Ilct and III3 were purified from yeast cells overexpressing the corresponding plasmid-borne cDNA, and their drug sensitivities were measured with a DNA cleavage assay using 32p-labeled SV40 DNA fragments. 32 Both isozymes were sensitive to VM-26, mAMSA and dh-EPI, that stimulated similar cleavage intensity patterns in agarose and sequencing gels. Sequence specificities of the studied poisons were identical for both isozymes, and corresponded to those established previously for the native murine enzyme. 32 The data suggested that molecular drug interactions in the ternary complex are likely similar between the two isozymes, and that both topoisomerase II~ and 1II3 may be the cellular target of antitumor poisons. 3e
A. Amino Acid Sequence Homology A comparison of the amino acid sequences of several eukaryotic and prokaryotic type II topoisomerases provided evidence for a high degree of homology even between evolutionarily distant proteins. 13'33 The observation that common sequence motifs have been conserved during evolutions at corresponding positions in the various peptides strongly suggests that all type II topoisomerases are evolutionarily and structurally related. Investigations on prokaryotic enzymes may therefore provide information relevant for the eukaryotic enzymes as well. The
14
GIOVANNI CAPRANICO ET AL.
functional conservation of these enzymes is noteworthy: DNA topoisomerases II ofS. pombe, Drosophila, mouse, and the human topoisomerase IIa can complement a top2 mutant in S. cerevisiae. 34-37Moreover, a conditional overexpression of the wild-type Drosophila enzyme can restore the drug sensitivity of hamster cells resistant to drugs due to an endogenous mutated topoisomerase 11.38 The homology analysis of amino acid sequences provided evidence that the enzyme is likely constituted by three major domains: an N-terminal domain with the ATP binding site, a central portion with DNA breakage-rejoining activity, and a C-terminal domain that appears to be important for the regulation of enzyme activity. 13 Susceptibility to protease digestion also defines at least three domains. 39'4~A particularly interesting proteolysis site in the yeast topoisomerase II corresponds approximately to the junction of the Gyr A and Gyr B subunits of DNA gyrase. The proteolysis site is dependent on the presence of a nonhydrolyzable ATP analogue, 39 and may reflect a conformational change, such as the closing of the protein clamp (see above). 24 Wigley and colleagues reported the crystal structure of an N-terminal fragment of Gyr B, a protein subunit of a bacterial topoisomerase II, DNA gyrase. 41 The N-terminal fragment corresponds to the ATPase domain of DNA gyrase, and the authors demonstrated a central hole in the protein, the diameter of which is enough to accommodate a DNA duplex. 41 The amino acid sequence from 103 to 126 of Gyr B participates in the ATP binding site and includes a sequence motif conserved in all type II enzymes. In the human sequence, amino acids 149 to 172 correspond to amino acids 103 to 119 of Gyr B. 13'41 Three amino acid motifs of the central domain, EGDSA, PL(R/K)GK(I/L/M)LN, and IM(T/A)D(Q/A)D, are conserved in all known topoisomerase II sequences. 13 Interestingly, the EGDSA and PLRGK amino acid sequences may correspond to loops found in the structure of the T~i-resolvase, a protein that transfers a DNA strand to an acceptor DNA end. 13 Insertions of short linkers near these motifs reduce the enzyme activity, 42 and mutations within or close to the PLRGK sequence may alter the enzymes sensitivity to drugs 43-45 (vide infra). Taken together, these results strongly suggest that the conserved regions of the topoisomerase II sequence are involved in DNA binding and/or in the DNA breakage-reunion reaction, and are implicated in the drug binding to the enzyme/DNA complex. 13 The topoisomerase II region most sensitive to protease digestion defines the beginning of the C-terminal domain. 39'4~Regulatory functions of enzyme activity have been ascribed to the C-terminal one third of topoisomerase II. 46,47 Interestingly, this enzyme portion is the least homologous among known topoisomerases II. The relatively low degree of homology does not allow identification of large structural motifs in the C-terminus. In the case of the two human isozymes, p 170 and p 180, sequence homology is lower in the C-terminal quarter (46%) than in the first three-quarters (86%), 3~ thus suggesting that the C-terminal part of the protein may mediate different functions of the two isozymes in living cells.
Poisons of Type II DNA Topoisomerases
15
B. EnzymePhosphorylation Nuclear localization signals and phosphorylation sites have been mapped to the C-terminal part of the protein. 46--49 Casein kinase II and protein kinase C were shown to be responsible for the phosphorylation of serine and threonine residues in the last 200 amino acids, therefore determining specific activity, and modulating both the mitotic functions and drug sensitivity of DNA topoisomerase 1I.50-52 Drug stimulation of DNA cleavage may be attenuated by enzyme phosphorylation, possibly due to faster enzyme turnover and ATP hydrolysis. 53-55 Indeed, it has been found that phosphorylation of topoisomerase II was increased 15-fold in a human KB cell line selected for resistance to VP-16. 56 Hyperphosphorylation could thus be a simple way for cultured cancer cells to adapt to growth in the presence of topoisomerase II poisons. Since the C-terminal portion of topoisomerase II is not essential for enzyme activity in vitro, and to a lesser extent also in vivo, 46'47 this seems to contrast with the apparent increase of the enzyme activity following phosphorylation in this portion of the protein. Therefore, it has been proposed that the C-terminal domain may act as a negative regulatory domain of enzyme activity, neutralized by phosphorylation. 57'58 At the same time, phosphorylation has been shown to affect DNA-protein as well as protein-protein interactions. 59'6~ The specificity of topoisomerase II action during the cell cycle suggests that the enzyme activity might be temporally regulated. This regulation could involve posttranslational modification of the protein. In fact, topoisomerase II is known to exist as a phosphoprotein in cells from both lower and higher eukaryotic species. Topoisomerase II from both Drosophila and budding yeast have been shown in vitro to be substrates for casein kinase II. 5~ Wells et al. 61 showed that human topoisomerase IIo~is phosphorylated at multiple sites in vivo and two of these sites are substrates for phosphorylation by casein kinase II in vitro. Topoisomerase IIo~ has been shown to be phosphorylated in vivo in a cell cycle-dependent manner with maximal phosphorylation occurring in the G2/M or specifically M phase. 51'62-64The distribution of the phosphate among multiple sites varies between G1 and M phase in yeast. 51 Chinese hamster ovary (CHO) topoisomerase IIc~ is primarily phosphorylated at a serine residue (with a minor phosphothreonine occurring in mitosis). 64 Determination of the sites of phosphorylation present only in interphase or only in mitosis are interesting in order to determine their effects on the function of the enzyme. In fact a change in the phosphorylation of topoisomerase IIc~ may be involved in the resistance of human leukemia cells to VP-16 and mAMSA. 65'66 Topoisomerase 1113also exists in vivo as a phosphoprotein 67 and in mitotic HeLa cells has a reduced electrophoretic mobility relative to cells at interphase. 68 Burden and Sullivan 69 showed that topoisomerase 1I[3 is posttranslationally modified in vivo in a cell cycle-dependent manner and it has been noted that the 13-isozyme is qualitatively different in mitosis when the nucleolus is disassembled. Phosphorylation of topoisomerase 1113in mitosis might be required for the stabilization of the enzyme during this process.
16
GIOVANNI CAPRANICO ET AL.
C. Enzyme Functions Topoisomerase II has been proposed to be an important factor that governs chromatin structure in living cells. The chromatin of eukaryotic cells is organized into structural loops that are attached to the nuclear matrix and the chromosome scaffold via specialized DNA elements known as SARs. DNA loops are dynamic structural units of chromatin, whose size and properties can vary among distinct genomic regions and during the cell cyle. 7~ Topoisomerase II might regulate chromatin structure by specific interactions with SARs, 70'72'73 which are enriched for sequences related to the in vitro topoisomerase II cleavage consensus 7~ and are preferentially cleaved by the enzyme in vitro. 74-77 Moreover, topoisomerase II preferentially aggregates SAR-containing DNA fragments through cooperative interactions. 74 Type II DNA topoisomerase has a vital role in the decatenation of daughter DNA helices at the end of replication and in the segregation of intertwined chromosomes. 78'79 Studies in a cell-free SV40 replication system suggest a role for DNA topoisomerase II in the elongation stages of DNA replication, 8~ nevertheless topoisomerase II does not seem to be required for the early stages, but it is necessary for the resolution of late replication intermediates. In support of this, S. cerevisiae and S. pombe top2 mutants accumulate multiply-intertwined and catenated dimers derived from newly replicated circular plasmids. 36'78'81 Indeed, the topoisomerase II gene has been shown to be essential in yeast. In the absence of an active enzyme, small chromosomes can apparently resolve intertwinings through simple unravelling of their ends, while larger chromosomes are more inclined to fragment. 82 Also, in Drosophila embryos microinjection of either antibodies against topoisomerase II or the drug VM-26 can inhibit the separation of chromosome daughter sets at anaphase. 83 Catenated dimers and late Cairns-type replication intermediates accumulate during the replication of SV40 DNA in vitro when topoisomerase II is inhibited or depleted from extracts 8~ or inhibited in vivo. 84'86 Interestingly, the requirement for topoisomerase II in chromosome condensation has been demonstrated in vitro by specific immunodepletion. 87'88 Using interphase nuclei of somatic cells and Xenopus egg extracts, chromosome condensation has been shown to be closely correlated with the level of the enzyme. Moreover, studies with ICFR- 193, a noncleavable complex forming inhibitor, showed that this drug mimics the phenotype of yeast top2 mutants by causing cell death during the G2/M phase. 85'89 Downes et al. 9~ showed that in mammalian cells ICRF-193 induced cell-cycle arrest is modulated through a system different from the damage-induced G2 arrest, and sensitive to the decatenation state of DNA. It is uncertain whether a similar system exists in yeast. Temperature-sensitive top2 mutants of S. pombe enter an abortive mitosis with very elongated chromosomes. They conclude that mammalian cells possess a G2 checkpoint system sensitive to the catenation state of DNA or to topoisomerase II activity either directly or through detection of consequent
Poisons of Type II DNA Topoisomerases
17
changes in chromatin. In meiosis, top2 mutants enter arrest prior to meiosis I with no evidence of nuclear elongation. 91 This result suggests that meiotic cells differ from mitotic ones in having a checkpoint mechanism for ensuring that sufficient active topoisomerase II is present for efficient chromosome segregation.
IV. DRUG-RESISTANT TOPOISOMERASE II MUTANTS In recent years, several laboratories have investigated mutated DNA topoisomerases II that are resistant to their poisons. These studies were invaluable, allowing understanding of the structural enzyme domains directly responsible for the topological transformation of DNA molecules, and the amino acid residues that are critical for the formation of the ternary complex: DNA-drug-enzyme. The information of the specific amino acids important for effective drug interactions may certainly be useful for the rational design of more active compounds.
A. Prokaryotic Enzymes The very first studies were carried out on a eubacterial topoisomerase II, DNA gyrase, by mutagenesis of wild-type bacterial strains and then selection for resistance to quinolones, poisons of DNA gyrase. A large number of E. coli gyrase mutants have been identified with this strategy, 92 and they mainly belong to three groups: (1) mutations within the EGDSA motif of GyrB subunit (the D residue changed to N); (2) mutations in the PLKGKILN motif of the same subunit (the first K to E); and (3) mutations at Ser-83 of GyrA subunit--this amino acid residue is close to the catalytic Tyr- 122. Thus, amino acid mutations responsible for quinolone resistance were clustered in few regions of either GyrA or GyrB subunits. On the basis of computer predictions, these motifs correspond to hydrophilic regions of the polypeptide chains, likely situated on the protein surface, that may be important for drug and DNA interactions. Using gyrases reconstituted from both of the two mutated subunits, it has been demonstrated that the double-mutant enzyme was more resistant to oxolinic acid than either the single-mutant protein. 92 Though studies on cultured bacterial strains have provided valuable insights, the mechanism of quinolone resistance has also been investigated using clinical isolates. 93'94Using PCR techniques, eight uropathogenic E. coli strains were analyzed and all of them exhibited high levels of resistance, and had a mutation of Ser-83 to Leu or Trp in the GyrA subunit. 93'94 S. aureus clinical isolates from drug-resistant patients were shown to carry a mutation of Ser-84 to Leu of GryA, this is the equivalent residue of Ser-83 of E. coli GyrA. Interestingly, E. coli DNA gyrase proteins resistant to microcin B 17 have also been reported. 95 Microcin B 17 is a bactericidal peptide whose mode of action resembles that of quinolones. Two independent mutations conferring resistance to microcin B 17 have been isolated, and mapped to the GyrB subunit. The two mutations consisted of the same transition AT to GC at position 2251 of the GyrB
18
GIOVANNI CAPRANICO ET AL.
gene, thus causing the change of Trp-751 to Arg. 95 The mutation lies in the C-terminal half of GyrB that is thought to be responsible for the interaction with GyrA. The fact that mutations conferring resistance to quinolones also lie in the region of subunit A binding (even if in the center of Gyr B) may suggest that drugs and microcin interact with the same region of gyrase.
B. EukaryoticEnzymes The results obtained in bacterial systems may be helpful in understanding the structure and function of mammalian topoisomerases II since these enzymes share several structural domains and show high degrees of amino acid sequence homology (vide infra). In a mammalian system, analogous studies are more difficult to carry out, therefore several laboratories have isolated and characterized drugresistant mutated yeast or human topoisomerases II by using permeability mutants of S. cerevisiae. 96 This system is very useful since the human DNA topoisomerase II can be expressed in a functional form in yeast, and mutational analyses of the enzyme can thus be performed. Indeed, studies in yeast have demonstrated that drug stabilization of the cleavable topoisomerase II-DNA complex is the cellular event that triggers cell killing by anti-topoisomerase II agents, 96 thus demonstrating that topoisomerase II is the cellular target of antitumor drugs including etoposide, amsacrines, and others. Jannetipour et al. 97 have characterized a yeast temperature-sensitive topoisomerase II mutation that confers resistance to amsacrine and etoposide. They have overexpressed the protein to confirm that the enzyme is altered in its interaction with drugs performing cleavage in vitro and, sequencing the gene, three mutations (Arg-884 to Pro, Arg-886 to Ile and Met-887 to Ile) have been discovered. Even if none of these amino acids are absolutely conserved during evolution, this mutant may define a region of topoisomerase II that plays a critical role for drug interaction. Another set of mutations which cause resistance to drugs has been obtained with site-directed mutagenesis of regions within a plasmid-borne yeast top2 gene, and hydroxylamine mutagenesis of the whole plasmid. 98 Three classes of mutants have been identified: 1. Multiple changes in the PLRGK (MLN) sequence (position 474-481 of yeast topoisomerase II). Although the PLRGK motif is highly conserved, replacements within the motif are therefore possible without enzyme inactivation. In contrast, mutagenesis in the EGDSA motif failed to give any resistant mutant since substitutions in this region likely result in inactive enzymes. 98 2. Mutation at A642, which is in a region not present in the T4 topoisomerase II that is sensitive to amsacrine. Therefore, this mutation might cause a change in the protein conformation that prevents interaction with drug. 98 3. Truncation of parts of the carboxy-terminal domain of the enzyme. Recent studies of 3'-end truncated Drosophila topoisomerase II have demonstrated
Poisons of Type II DNA Topoisomerases
19
that deletions up to 240 amino acids had no effect on the catalytic activity of the enzyme and VM-26 cleavage stimulation. Thus, it seems unlikely that this domain is important for the stabilization of cleavable complexes. Since nuclear localization signals are present in the C-terminal part of the protein, it is possible that reduced nuclear concentrations of the enzyme is the cause of drug resistance. Immunofluorescence studies indeed showed that none of the truncation mutants localize to the nucleus as efficiently as the wild-type enzyme. 42 Similar results have been obtained by truncation of S. cerevisiae topoisomerase 1I.48 Topoisomerase II mutations have also been investigated in mammalian cell lines selected for resistance to topoisomerase II poisons. An important observation from these studies is that a large part of the mutations fall in a very conserved protein region (amino acids 449-494) that corresponds to E. coli GyrB mutations conferring resistance to quinolones. 43,99-101 These results further support the idea that the region may be involved in the interaction between topoisomerase II and its poisons. Thus, a variety of drugs (quinolones, amsacrines, and epipodophyllotoxins) are likely to be located in a similar cleft in their interaction with the DNA-protein complex. Another mutation has also been reported in an etoposide resistant human leukemic cell line. 1~ This mutation lies close to the catalytic Tyr-804 residue of the protein (Lys-797 to Asn) and may interfere with drug induced trapping of the cleavable complex. Additionally, for quinolone resistance, mutations which lie in a conserved region of gyrase A protein adjacent to catalytic Tyr-122 have been mapped. Thus, all the mutations in mammalian topoisomerase II co-map with mutations in gyrase.
V.
D N A T O P O I S O M E R A S E II P O I S O N S
A. Structural Determinants of Classical Poisons Topoisomerase poisons often are natural compounds derived either from plants or microorganisms. Agents interacting with topoisomerase II are indeed widespread in nature, suggesting an evolutionary-conserved phenomenon of interference (modulation ?) of topoisomerase activity. The biological significance of this remains to be fully appreciated. In the past, antitumor topoisomerase poisons were classified as intercalating or as non-intercalating agents (see Table 1). It is noteworthy that both DNA intercalating agents and non-intercalative compounds are known to be poisons of eukaryotic DNA topoisomerase II as well as topoisomerase I. At the same time, streptonigrin, a topoisomerase II poison, may interact in the minor groove of the DNA, 1~ and both bulgarein and various Hoechst derivatives, poisons of topoisomerase I, are also DNA minor-groove binders. 1~176 Thus, hypotheses on the mechanism of drug action that are based simply on different modes of drug interaction
20
GIOVANNI CAPRANICO ET AL.
with the DNA seem questionable. With some exceptions (such as the terpenoid clerocidin), drugs have an intercalating moiety or a planar aromatic system that might fit into DNA base pairs in an intercalation-like manner. Interestingly, some agents are "pure intercalators" (ellipticines); some are not intercalators (VM-26, camptothecins), including minor-groove binders (Hoechst 33548, streptonigrin); and some have features of both intercalators and external binders (anthracyclines, actinomycin D, indolocarbazoles). In this latter class of compounds, historically considered intercalating agents, the external binder moiety of the drug molecule is crucial for drug activity. 1~ Present knowledge, indeed, suggests a common mode of action (interference with the cleavage-reunion reaction) for both "intercalating" and "non-intercalating" poisons, and receptor sites for the known topoisomerase II poisons are likely overlapping (vide infra). It is generally believed that the antitumor poisons stabilize the covalent intermediate by forming a ternary complex: DNA--drug-enzyme. Teniposide and other drugs were shown to inhibit the DNA religation step of topoisomerase II reaction both before and after strand passage. 114,115This results in a decrease of the resealing rate of DNA cleavage in in vitro systems. 114'I~5 The data thus suggests that topoisomerase II poisons may act primarily by hindering the religation step of the catalytic reaction. Nevertheless, some topoisomerase II poisons have been suggested to accelerate the forward cleavage reaction instead, since they do not decrease the rate of cleavage resealing. 116'117 Antitumor drugs of different chemical classes typically stimulate topoisomerase II DNA cleavage in a sequence selective manner, resulting in drug-specific cleavage intensity patterns in sequencing gels. 17'118-12~Although sites of DNA cleavage in a given DNA fragment may be uncommon, relative cleavage intensities greatly vary among different compounds. Each drug is thus able to stimulate DNA cleavage preferentially at certain sites, but not at all sites, recognized by the enzyme, thus suggesting that effective drug interactions in the ternary complex depend on the local base sequence. Several investigations have indeed revealed that specific nucleotides flanking the strand cut are required for drug stimulation of the cleavage (Table 2). 103'120-126Analogous observations have been made with camptothecin that prefers a guanine at position + 1, which for topoisomerase I represents the nucleotide noncovalently linked to the protein. ~27'128Based on these findings a stacking model of drug action has been proposed. The model predicts that drugs in the ternary complexes are placed at the interface between the DNA cleavage site and the enzyme active site, possibly with a planar ring system stacking with DNA base pairs. 12~ Consistent with this model, drug localization in the ternary complex has recently been shown using a photoactivatable mAMSA analogue. 129 Upon activation, the compound was covalently linked to DNA bases at the +1 and -1 positions, immediately adjacent to the cleaved phosphodiester bond, when T4 topoisomerase II was present in the reaction mixture. This suggests that the amsacrine receptor site is localized at the protein/DNA interface of the enzyme active site in the topoisomerase II-DNA complex. 129
Poisons of Type II DNA Topoisomerases
21
Table 2. Sequence Specificity of in Vitro DNA Cleavage Stimulated by DNA
Topoisomerase II Poisonsa
Complete Preferred Sequence Position Spec!ficity -1
Drug Doxorubicin, Daunorubicin 3"-epi-daunorubicin V P - 1 6, VM-26 Mitoxantrone
1(/+ 1) +1
-
+2
Piroxantrone Ellipticinium Amonafidea Clerocidin Genistein Amsacrine Bisantrene Saintopin NSC 665517 Streptonigrin
Primary Requirement
-3
-2
-1
+1
+2
References
A
(A)
T
A
(A)
m
121
A(G)
(A)
G
A(G)
(A)
~
C(T)
--
--
C(Y)
C/Th C/Th Tc Ce G T A A G G T
113 122,131)
--
--
~ ~ ~ A/T
~ ~ ~ A/G
C/T C/T T C
~ ~ ~ A
G G
130 125 123,125
~
A m --
A m --
T T T
T A A
134 133 125 122,125 125
m
139 228 .
.
.
.
T
I03
Notes: aln parenthesis, secondarypreferences hWith the exclusionof adenines "With the exclusionof cytosines dThe completepreferred sequenceis required at both strands eWith the exclusionof thymines
This m o d e l has been a useful f r a m e w o r k for novel structure-activity relationship studies a i m e d at identification of the structural (drug) d e t e r m i n a n t s of t o p o i s o m erase p o i s o n i n g and (drug) s e q u e n c e specificity. Interesting data were obtained by s t u d y i n g the s e q u e n c e specificity of m i t o x a n t r o n e and VM-26.13~ T h e two drugs s h o w e d similar cleavage intensity patterns in s e q u e n c i n g gels and the same local base preferences; moreover, in spite of structural similarity and c o m p a r a b l e D N A b i n d i n g affinity, s e q u e n c e selectivities of m i t o x a n t r o n e and d o x o r u b i c i n were c o m p l e t e l y different. 13~ T h e s e results strongly indicate that intercalating and nonintercalating agents have a c o m m o n m o d e of action against the e n z y m e . M o r e o v e r , c o m p e t i t i o n studies a m o n g several t o p o i s o m e r a s e II-interacting agents have provided similar information on the mechanistic effects of the drug. t31 C o m p e t i t i o n a m o n g D N A cleaving poisons, such as V M - 2 6 , amsacrine, genistein, CP- 115,953, and n o n c l e a v i n g inhibitors, such as novobiocin, suggested that the receptor site of V M - 2 6 m a y overlap with those of the poisons, whereas it is distinct from those of the inhibitors. 131 T h r e e main structural d e t e r m i n a n t s of the sequence-specific action of the poisons have been characterized by investigating the s e q u e n c e specificity of drug c l e a v a g e
22
GIOVANNI CAPRANICO ET AL.
stimulation: (1) the spatial conformation of drug molecule, that determines the sequence specificity; (2) particular drug substituents, that can determine preferred bases; and (3) cooperative phenomena, that may markedly influence the specificity of drug effects.
Drug Pharmacophores The observation that mitoxantrone and VM-26, two structurally unrelated drugs, have similar sequence specificity 13~strongly suggests that intercalating and nonintercalating agents likely bind to the same receptor site in the ternary complex. Bisantrene and mAMSA, although chemically unrelated, also stimulate identical cleavage intensity patterns and show the same specific base requirements for cleavage stimulation (adenine at position + 1).125 Since these drugs are structurally unrelated but have the same sequence specificity, these findings allowed us to make an attempt to identify structural determinants of drug action. Comparison of energy-minimized drug structures by computer modeling simulation suggests that bisantrene and mAMSA share a specific pharmacophore that may be an important determinant of the "sequence position specificity". 125 If topoisomerase II poisons have different specific pharmacophores, precise drug receptor sites might thus be only partly overlapping. The case of streptonigrin is particularly interesting in this regard. This compound has a unique sequence specificity since it requires a thymine (or an adenine) at position + 2 (or + 3). 1~ Streptonigrin does not intercalate into DNA, and independent experimental results are consistent with a DNA binding mode similar to that of minor-groove binders. 1~ Therefore, streptonigrin might be placed, in the ternary complex, externally to the DNA, interacting with the T in a groove, and interfering with the DNA religation step of the enzyme reaction. 1~ The streptonigrin receptor site might be only in part overlapping with those of other poisons, and its pharmacophore may then be quite distinct from those of mAMSA and other drugs. 1~
Chemical Substituents Investigations on both anthracycline analogues and clerocidin suggest that specific drug substituents may have instead a role in determining preferred base pairs. Closely related drug congeners generally stimulate identical DNA cleavage intensity patterns, 1~176 and, indeed, in the case of anthracyclines, several modifications of the planar ring and/or the daunosamine did not alter doxorubicinspecific intensity patterns of cleavage. ~1~ However, a daunorubicin derivative with the 3'-NH 2 of daunosamine epimerized, stimulated topoisomerase II DNA cleavage with different cleavage intensity patterns in agarose and sequencing gels (with respect to the parent drug). 113 Several cleavage sites were detected with 3'-epi-daunorubicin, but were not observed with daunorubicin or doxorubicin. A statistical analysis of cleavage sites showed that the major difference between the derivative and parent drugs was that a guanine, instead of a thymine, was preferred at position -2 by the former. These findings, for the first time, demonstrated that
Poisons of Type II DNA Topoisomerases
23
specific (drug) functional groups may be important structural determinants of preferred base pairs. 113It is thus possible that specific analogues of other topoisomerase poisons may also exhibit different sequence selectivity as compared with the corresponding parent drug. Interestingly, an anthracycline analogue with no substituent at the 3' position of the sugar, was able to stimulate DNA cleavage at sites stimulated by parent drugs as well as at those stimulated by 3'-epi-daunorubicin. 113 Thus, the presence of an amino group at the 3' position of the daunosamine restricts the drug activity to either the "parent drug" sites or the "analogue" sites depending on its orientation. These findings were rationalized in terms of interference of the anthracycline amino group with the amino group of guanines in the minor groove, as suggested by theoretical investigations of drug-DNA interactions. 132 This would be predicted to result in the exclusion of guanines at position -2 of the cleavage site by anthracyclines with the natural configuration, ll3 These data also indicate that the sugar moiety of anthracycline, placed in the DNA minor groove, interacts with base pairs up to position-2 and, possibly, with enzyme amino acid residues. More recently, we have also investigated the sequence specificity of the terpenoid clerocidin, a peculiar topoisomerase II poison since it lacks even a small planar drug moiety (see Figure 2), and stimulates salt-resistant DNA cleavage. 133 The results showed that clerocidin-dependent irreversible DNA cleavage was site selective, and required a guanine at position-1. Interestingly, some irreversible sites showed an abnormal electrophoretic mobility in sequencing gels (with respect to cleaved bands generated by mAMSA), suggesting a chemical alteration of the DNA strand. Since in ethanol solution clerocidin underwent chemical modifications of the C12-C15 side chain, losing in parallel the ability to stimulate irreversible DNA breaks, we thus suggested that the drug dicarbonyl function (Figure 2) may react with the guanine at the-1 position in the ternary complex resulting in cleavage irreversibility and altered DNA mobility in sequencing gels. 133
Enzyme Subunit Cooperativity Eukaryotic topoisomerase II subunits appear to act cooperatively during the catalytic reaction while undergoing conformational changes. 23'24 We have shown that cooperativity also occurs during the DNA cleavage step, and that one drug molecule interacting with one enzyme subunit may stimulate a strand cut mediated by the second subunit, due to cooperative effects. 126 This demonstrates that drug action at one subunit may be affected by the action of a second drug molecule acting at the other protein subunit. Consequently, site selectivity of a poison may be influenced, at least partially, by other factors in addition to drug structure itself, as is the case of amonafide. TM This drug has a strikingly high site selectivity since it stimulates about 60% of DNA cleavage at only one site in pBR322 DNA, and at two sites in SV40 DNA. 134 A statistical analysis of 94 sites, including the three prominent sites of pBR322 and SV40 DNAs, showed that amonafide strongly prefers a cytosine at position-1, and to a lesser extent an adenine at position + 1.134
24
GIOVANNI CAPRANICO ET AL.
However, we observed an inverted repeat sequence at the three sites exceptionally stimulated by the drug, with cytosines and adenines at positions-1 and +1, respectively. A base mutation analysis could rule out the involvement of a stem-loop structure of DNA in the drug action or in protein-DNA interactions. The data thus documented that exceptionally high levels of cleavage stimulation occur when amonafide molecules can optimally interact with both of the two enzyme subunits, which may then enhance drug stimulative effects through cooperative action. TM
Drug Receptor Sites in the Ternary Complex The novel information accumulated during recent years suggests a more defined model of a ternary complex, DNA-drug-topoisomerase II (Figure 3). We propose that the drug is placed at the interface protein/DNA of the enzyme active site making contacts with DNA base pairs very close to the cleaved phosphodiester bond (from -2 to +2 positions). To this broadly defined receptor, at least three pharmacophores may bind: (1) one represented by poisons with -1 position specificity; (2) a second represented by poisons with +1 position specificity; and (3) the third represented by poisons with +2 position specificity (Table 2)~ The three pharmacophores may indeed interact with partially different protein and DNA units, thus one may d.istinguish at least three partially overlapping receptor sites in the binary DNAenzyme complex. In Figure 3, this has been indicated by the shape and the position,
A
'! II
1
+2 +3
+4
'
$.
B
+5
$"
t +5
+4
+3
.2
+1 -1,~~'+2
.+3
l[
3'
+2
+1
C -2
-1
-2
-1 ~
+5
+1 +2 + 3
+4
+5
+1
-1
+4
+3
+2
'
+4
+5
1
-1
+1
-2
S'
+5
+4
+3
+2
-2
Figure3. Model of DNA-drug-topoisomerase II ternary complexes with overlapping drug receptor sites. DNA strands are represented by thin lines; drug molecules are shown as black objects.
Poisons of Type II DNA Topoisomerases
25
relative to DNA strands, of the poison [shown as a black object]. Drugs might interact with the DNA in an intercalation-like manner (A and B models) or externally in the minor groove (C model); however, a moiety of the drug molecule would always be close to the 5' and/or 3' termini of the break, interfering with the breakage-rejoining reaction. In this schematic representation, no attempt was made to hypothesize drug interactions with the protein, since the structure of the enzyme active site is not at the present time available. Nevertheless, drugs most likely also interact with topoisomerases, and therefore the precise contacts among the three components-drug, DNA, and enzyme--remain to be fully elucidated. We suggested that in the case of anthracyclines, the sugar, and in particular the 3' amino group, makes contacts with the DNA in the minor groove. The side chain and the OH group at the C-9 position of the saturated ring might then likely interfere with the catalysis of DNA religation, ll3 Morjani et al. 135 reported an investigation of the interaction of intoplicin in the ternary complex by surface-enhanced Raman scattering spectroscopy. Intoplicin is a dual poison, since it can stimulate DNA cleavage by either topoisomerase I and II. 136'137Based on the Raman technique, the authors provided evidence that the drug interacts with topoisomerase II, and possibly that at least part of the drug molecule is buried in an internal part of the protein. Upon DNA binding, the drug is released from the enzyme and forms hydrogen bonds. 135These results indicate the presence of a hydrophobic pocket in the protein that may be easily accessible, and may constitute a high-affinity site for the drug. Such an enzyme pocket resembles the model proposed by Filipski, 138who hypothesized that base binding sites were present in the catalytic site of topoisomerase II, and that a drug molecule could be a competitive poison of DNA bases binding to these enzyme pockets. It is therefore possible that stacking between a drug molecule and DNA bases may occur in a hydrophobic environment constituted by an enzyme pocket. The sequence specificity of DNA cleavage stimulation by saintopin (Figure 2) was investigated in the presence of topoisomerase II and topoisomerase 1.139 The authors found that the drug highly prefers a guanine at position + 1 in the case of both enzymes, suggesting that drug-DNA interactions may be the same in the two cases. It is intriguing that some compounds are able to form ternary complexes with either topoisomerase II and I. Moreover, the observation that drug sequence specificity remains the same with both enzymes in the case of saintopin 139 raises the possibility of at least partial structural resemblance of the drug receptor sites in the two ternary complexes. This may be also supported by the finding that partial homology has been found between certain regions of the amino acid sequences of all DNA topoisomerases I and II. 13A similar cleft among different protein domains may be a common structural basis of the DNA breakage-rejoining catalysis of all DNA topoisomerases. 13
26
GIOVANNI CAPRANICO ET AL.
B. Non-cleaving Inhibitors Several agents are known to inhibit DNA topoisomerases without stabilization of the cleavable complex. 14~ This category of agents includes dioxopiperazines, merbarone, fostriecin, chebulagic acid, 13-1apachone, and others. 140'141'143-145These drugs inhibit the catalytic activity of purified enzymes and prevent DNA cleavage stimulated by teniposide or amsacrine. 14~ The mechanisms by which these drugs affect DNA topoisomerases are not known; however, the action of ICRF-193, a bisdioxopiperazine derivative (Figure 2), against topoisomerase II has recently been elucidated. 146In the absence of ATP, ICRF-193 has little effect on the binding of the enzyme to various forms of DNA, whereas in the presence of ATP, the drug converts the enzyme to a form which is capable of binding linear, but not circular, DNA molecules. 146The results have been interpreted in terms of the protein-clamp model: 23 ICRF- 193 may bind to the closed-clamp form of the enzyme and prevents its conversion to the open-clamp form. A DNA-bound enzyme in the closed-clamp form would be prevented from transporting DNA segments, and a free enzyme trapped in the closed-clamp form would be prevented from binding to DNA. Therefore, the drug action is expected to affect chromosomal condensation and decondensation, and the segregation of intertwined chromosomes during mitosis. Studies with mammalian cell lines show that cell exposures to ICRF-193 inhibit cell cycle progression at G2-M, TM and prevents chromosome segregation during anaphase. 89 Interestingly, ICRF-193 derivatives have been shown to be non-crossresistant with classical topoisomerase II antitumor poisons in a human VM-26resistant leukemia CEM cell line. 147 Thus, it may be of great interest in the development of topoisomerase II poisons with a different mechanism of action, which may be non-cross-resistant with conventional agents used in the therapy of human cancers.
C. Development of New Topoisomerase II-Directed Drugs In the last decade, several laboratories made efforts to discover and develop novel topoisomerase-interacting agents as more selective antitumor drugs. 20'120'148'149 New agents have been discovered both through random screening programs, 15~and from analogue development, based on arbitrary chemical modifications of a lead compound. 151'152 An attempt was made to prospectively design new compounds using molecular modeling, and based on a composite pharmacophore derived from known poisons. 153 The researchers thus synthesized azatoxin, a hybrid molecule of VP-16 and ellipticine. The approach appears successful, since azatoxin (that did not bind to DNA) was shown to be a poison of topoisomerase II and stimulated extensive DNA cleavage. 154 The makaluvamines, a series of pyrroloiminoquinones, were discovered and isolated from a sponge of the genus Zyzzya by following pharmacological activity against the human colon carcinoma line HCT-116.155 These compounds showed
Poisons of Type II DNA Topoisomerases
27
enhanced toxicity toward a cell line sensitive to topoisomerase II poisons, and they were also shown to inhibit enzyme decatenation activity of kinetoplast DNA. ~55 Among the cleavable complex stabilizing agents, a new generation of antitumor intercalators related to mAMSA were constituted" acridine-4-carboxamide, 2-(4pyridyl) quinoline-8-carboxamide, and the 9-anilinoacridine derivatives. 156'15vThe first two tricyclic carboxamides induce DNA-protein cross-links and DNA double-strand breaks in mouse fibrosarcoma cells (line 935.1). 156 9-Anilinoacridines were synthesized and evaluated for their ability to inhibit the growth of Jurkat leukemia cells and to trap human DNA topoisomerase II. Derivatives bearing 1' substituents containing SO 2 moieties proved most potent in stimulating topoisomerase II-mediated DNA cleavage. A good correlation was found between the ability of these compounds to induce DNA breaks in vitro or in whole cells, and their cytotoxicity in human lymphoma Jurkat cells. 157 Another compound related to amsacrine is the anilinoacridine derivative bearing an N-methylpyrrolecarboxamide unit at position 1'. 158 Linear dichroism spectroscopy revealed that this compound intercalates its acridine chromophore between DNA base pairs, with a preference for GC-rich sequences, whereas both the analogue lacking the N-methylpyrrole unit and amsacrine itself intercalate into DNA without any strong sequence preference. This drug stabilizes the topoisomerase II-DNA covalent complex and stimulates DNA cutting at a subset of pre-existing topoisomerase II cleavage sites (which were different from those of anasacrine). 158 The nature of the substituent at position 1' of the anilinoacridine chromophore may therefore determine the site of DNA cleavage stimulation. 158 BE-22179, a cyclic depsipeptide having two 3-hydroxyquinoline moieties, has been shown to be more effective than VM-26 in the inhibition of the DNA-relaxing activity of L 1210 topoisomerase II. 159Nevertheless, it was ineffective in stimulating topoisomerase II DNA cleavage, but able to intercalate into DNA. However, since the compound inhibited topoisomerase II at far lower concentrations than those showing DNA-unwinding activity, this indicated that the anti-topoisomerase II activity of BE-22179 may likely be independent from DNA binding. The authors suggested that BE-22179 may directly interact with the enzyme, thus preventing its binding to DNA. 159 It remains to be established whether the potent cytotoxic activity of BE-22179 is related to topoisomerase II inhibition. Methyl-substituted indolo[2,3-b]quinolines 16~are c~-carboline derivatives, structurally similar to ellipticine. 16 1 Although structurally similar, the difference in cytotoxic activity between these compounds and ellipticines is striking. 16~ The indolo-quinolines showed a cytotoxic activity about 10 times as high as that of ellipticine; moreover these compounds were more active than ellipticines in stimulating in vitro topoisomerase II DNA breaks. These results demonstrated that minor variations of the structure of indolo[2,3-b]quinolines may yield remarkable changes in pharmacological activity. DNA minor-groove binders have been extensively studied for their capacity to bind to specific base sequences. One of the best known of these agents is the
28
GIOVANNI CAPRANICO ET AL.
antiviral antibiotic distamycin, which selectively binds to AT-rich sequences. 162 Distamycin is not able to interfere with the DNA breakage-reunion reaction of topoisomerase II by forming ternary complexes (c.f. anthracyclines, etoposide, and other antitumor drugs); nevertheless the groove binder may affect cleavage levels through modulation of the DNA binding activity of the enzyme. 163Several attempts have been made to rationally design a sequence-specific drug using distamycin or other minor-groove binders. The affinity of distamycin-like ligands for specific sequences can be enhanced by choosing pairs of ligand molecules with complementary DNA recognition properties. 164 A hybrid molecule, such as a distamycin intercalator, may have several potential advantages: the enhancement of the DNA binding strength and selectivity; the potential interference with topoisomerase functions; the improvement of the cellular drug transport; and an increased selectivity against cancer cells. 165 A minor-groove binder that is able to interfere with topoisomerase II activities is berenil, an antitrypanosomal drug. 166Topoisomerase II is unable to interact with DNA sites occupied by berenil or other minor-groove binders. Berenil is a relatively weak poison of type II topoisomerase as compared with other groove ligands. The difference might be related to the lower affinity of berenil for AT-rich DNA sequences with respect to distamycin or netropsin. 162'167 Studies of the molecular interaction of dual topoisomerase I and II poisons may shed light on the mechanism of action of topoisomerase-targeting drugs. Intoplicine (Figure 2) is a synthetic anticancer agent belonging to the series of 7-Hbenzo[e]pyridol[4,3-b]indoles, and is able to poison both enzymes. 137'168 Intoplicine was active in vitro against a variety of human tumor lines, including a subgroup of them that were insensitive to other agents. 169 Direct interaction between the drug and topoisomerase II has been shown, and it can play a critical role in the drug action. 135'17~ Many alkaloids of the benzo[c]phenanthridine family, such as fagaronine and nitidine, are also dual poisons. 171'172Fagaronine is a potent inducer of differentiation in various hematopoietic cell lines, and it has been shown to interact with DNA as well as with double-stranded regions of tRNAs. 173This drug can intercalate into DNA, and lower concentrations are required to inhibit topoisomerase I than topoisomerase 11.172 A particular class of antitumor compounds is the family of protein tyrosine kinase (PTK) poisons that are also DNA topoisomerase II poisons. Drugs which bind to the ATP site of PTK, such as genistein, are common poisons of both types of enzymes. 174Erbstatin and tyrphostine derivatives, which inhibit epidermal growth factor receptor PTK activity by competing with both the peptide substrate and ATE have the capacity to inhibit DNA topoisomerases I and II. 174In contrast to genistein, none of these molecules induced the stabilization of topoisomerase II DNA cleavable complexes.
Poisons of Type II DNA Topoisomerases
VI.
29
M E C H A N I S M S OF D R U G CELL KILLING A. Cellular and Molecular Mechanisms
The stabilization of topoisomerase DNA cleavage by antitumor poisons is a reversible event, and the mechanism by which a transient DNA damage eventually results in cell killing is not completely clear. Thus, although the primary cellular targets of these anticancer drugs have been identified, less is known about how the process leading to selective cell death is activated by the primary lesions. Cell death induced by topoisomerase poisons, and also by other DNA-damaging agents, is likely due to their interference with DNA metabolism. Recent studies support an active cell participation in the process of cell death, since activation of new patterns of gene expression follows exposures to these agents. 175-18~ Indirect evidence suggest that this program is activated when drug-induced lesions are persistent and/or optimal repair is impaired. Inhibition of cell division is a common mechanism of response to DNA damage in prokaryotic and eukaryotic cells. To explain the cytotoxicity of drug-induced cleavage complexes, it has been argued that a cellular process, such as replication or transcription, converts the reversible cleavage complexes into permanent cytotoxic DNA lesions. 16 The role of replication and transcription in the cellular response to topoisomerase poisons has previously been investigated by measuring drug cytotoxicity under conditions where DNA or RNA syntheses were inhibited. 181'182A characteristic G2 arrest is commonly observed when cells are exposed to topoisomerase II poisons, which is likely achieved by downregulation of protein kinase. 183'184 Cell cycle arrest is believed to be an evolutionary conserved cell response to allow repair of DNA lesions before mitosis; 185'186nevertheless, heavily damaged cells might never reach mitosis and die in G2. Cell death might also be caused by incorrect repair of the damage. It has been demonstrated that etoposide and amsacrine induced deletions of a selectable genetic marker, possibly through nonhomologous DNA recombination, in cultured mammalian cells. 187'188The authors suggested that DNA deletions involving essential genes may be lethal to the cell 187'188 and that enzyme subunit exchanges may be the mechanism of large DNA deletions. Moreover, Bodley et al. 189 studied the effects of teniposide treatments on SV40 minichromosomes. Teniposi0e exposures of SV40-infected cells resulted in the rapid conversion of SV40 DNA into a high molecular weight form. The authors showed that this was due to the integration of viral DNA into the cellular genome, and found that integration sites on the viral DNA occurred at major sites of teniposide cleavage stimulation in an in vitro reaction with topoisomerase II. Similarly, Howard and Griffith 19~ showed that several strong sites of topoisomerase II DNA cleavage in HIV DNA were found less than 1000 bp from the integration site in the genome of host cells. These results suggested a direct role of topoisomerase II, and possibly of the ternary cleavable complex, in the integration process, and in chromosomal rearrangement pathways.
30
GIOVANNI CAPRANICO ET AL.
Helicase-driven separation of the double helix occurs during DNA replication and also during other DNA metabolic activities such as repair and recombination. 19) In recent work, a two-hybrid system has been used to demonstrate that the yeast Sgsl protein interacts with the C-terminal domain of yeast topoisomerase II. 192 S gsl protein has sequence homology with a bacterial helicase, and the authors proposed a model for the interaction of topoisomerase II with a helicase to account for the faithful segregation of newly replicated chromosomes. 192 Howard et al. 193 provided biochemical evidence that DNA helicases can convert drug-induced type II topoisomerase cleavage complexes to irreversible DNA lesions by displacing broken ssDNA fragments from the complex. DNA helicases may also play a role in various recombination and/or mutation events induced by DNA topoisomerases. Topoisomerase poisons that stimulate the cleavable complex have been shown to stimulate homologous recombination, sister chromatid exchange, gross genetic rearrangements, and frameshift mutations. 16'17'194For each of these genetic events, the helicase-mediated generation of discrete DNA breaks from a cleavage complex would be a reasonable first step. DNA helicases have recently been found to be sensitive to certain topoisomerase poisons and each helicase appears to have its own unique spectrum of sensitivity. 195'196 If a DNA helicase converts covalent topoisomerase-DNA complexes into cytotoxic lesions in vivo, then topoisomerase poisons that inhibit the helicase should be less cytotoxic than those that do not. The observation that each drug stimulates specific DNA cleavage patterns in in vitro systems raises the question of whether the drug sequence specificity has a role in drug cell killing activity. While drug cytotoxic potency correlates well with the extent of drug-stimulated double-strand breaks when considering closely related derivatives, this relation is lost when compounds of different classes are compared. 15'17'19A high degree of heterogeneity in the localization of topoisomerase II DNA cleavage stimulated by unrelated drugs may be observed in the chromatin of Drosophila Kc cells. 77 Interestingly, the reversibility of topoisomerase II DNA cleavage was slower in a transcriptionally active gene than in a silent genomic locus. Moreover, VM-26 and a doxorubicin analogue stimulated similar levels of doublestrand breaks in the whole cellular genome; nevertheless the anthracycline was 5to 10-fold more cytotoxic than VM-26. When specific loci were examined, the two drugs differed for the extent, location, and reversibility of DNA breakage. These findings suggest that the lethality of drug-stabilized topoisomerase II-DNA complexes might be different, depending on the specific DNA sequence targeted. 77
B. Genetic Mechanisms In recent years, several laboratories have focused on the process of apoptosis, a gene-directed cell death program operationally defined by biochemical and morphological events. 197 Different types of DNA-damaging agents, including T-rays and anticancer compounds, may trigger this genetic program, particularly in hematopoietic cells. 178'198Following drug-stimulated topoisomerase II DNA cleav-
Poisons of Type II DNA Topoisomerases
31
age, the transient DNA breaks are presumably transformed into irreversible lesions that constitute the stimulus for activation of the cell death program. 199 The p5 3 gene product seems to play a crucial role in the drug-activated cell death pathway, z~176 The wild-type p53 protein is required either for the efficient activation of apoptosis or the cell cycle arrest at the G1/S border following exposures to DNA-damaging agents. 176'2~ The p53 product is a transcription factor that, in response to DNA damage, may regulate expression of other genes involved in the G 1 checkpoint. 2~176 The G 1 arrest has been ascribed to the ability of p53 to induce expression of the wafl/cipl gene that encodes a 21 kDa poison of G1 cyclindependent kinases. 2~ The degree of G 1 arrest observed with etoposide and X-rays correlated with the rate of p53 and p21 wafl/cipl protein accumulation, e~ However, whereas cells with wild-type p53 exhibited G 1 and G2 arrests after exposures to ionizing radiation, cells with mutated or deleted p53 retained only G2 arrest. 2~ Moreover, DNA-damaging agents tended to decrease survival to a greater extent in wild-type p53 cell lines as compared with mutant p53 cell lines. 2~ Wild-type p53 protein levels are raised dramatically in response to physical or chemical agents, and this is due to increased protein stability, e~ Studies of p53-deficient transgenic mice (p53 "knockouts") have also demonstrated that p53 is required for the induction of apoptosis by ~,radiation (and by some anticancer drugs, including doxorubicin) in thymocytes that are mainly in the G0/G 1 phase. 176'2~ The role of p5 3 in chemotherapeutic responses has also been evaluated in animal models. Using a transplantable fibrosarcoma, the authors showed that p5 3-deficient tumors treated with 7 radiation or adriamycin continued to enlarge and contained few apoptotic cells, in comparison to tumors with p53+/+ that regressed after drug treatments, e~ GADD genes (growth arrest and DNA damage-inducible genes) may play a role in growth arrest following DNA damage. 2~176 The GADD 45 and wafl/cipl gene expressions are specifically dependent on the wild-type (but not mutated) p53, which may bind to a conserved sequence motif found in an intron of the GADD 45 gene. 2~ Bcl-2 and Bax are homologous proteins that have opposite effects on cell life and death, with Bcl-2 serving to prolong cell survival and Bax acting as an accelerator of apoptosis. 211 Deregulated expression of Bcl-2 may thus protect lymphoma cells from chemotherapeutic agents. 2~2Consistently, Bcl-2 gene rearrangement seems to be correlated with a shorter disease-free survival in lymphoma patients. 212 Kamesaki et al. e~3 showed that overexpression of Bcl-2 protein inhibited etoposideinduced apoptosis and cytotoxicity without affecting the number of single- and double-strand breaks in cultured cells. The Bcl-2 product is likely a member of protein complexes with Bcl-2-related proteins, such as Bax. el4 Miyashita et al. el5 obtained evidence that restoration of p53 in a murine leukemia cell, M1, was associated with increases in Bax mRNA and protein. Furthermore, the increases in Bax gene expression were accompanied by simultaneous decreases in the steadystate levels of Bcl-2 mRNA and protein, el6 The effects of p53 on Bcl-2 gene expression may be mediated at least in part by a cis-acting p53 negative-response
32
GIOVANNI CAPRANICO ET AL.
element located in the 5' untranslated region (5'UTR) of the bcl-2 gene. 217 p53 can downregulate Bcl-2 gene expression in cultured cells and in some tissues in vivo, 215 and Bcl-2 can antagonize apoptosis induced by wild-type p53. 218 Functional analysis of the Bax gene promoter indicates that this apoptosis-inducing gene is a direct target of p53. 219 The results suggest the existence of multiple independent intracellular mechanisms of apoptosis, some of which can be prevented by Bcl-2, while others are unaffected by this gene product. Alternatively, some pathways may involve proteins that differentially regulate Bcl-2 function. Interestingly, the protein tyrosine kinase c-abl has been recently invoked in the pathway of cell death. 22~C-abl codifies for a membrane protein that, when activated (e.g. following a gene translocation), can be associated with leukemogenesis. Sawyers et al. 221 found that overexpression of c-abl leads to growth arrest. Overexpression of a dominant negative mutant leads to growth deregulation. 221 These findings demonstrate that the biological activity of c-abl contrasts with that of the abl-fused oncogene. 221 The c-abl gene may thus resemble a tumor suppressor gene. 222 Cooperativity between c-myc and bcl-2 genes was also studied, and the data indicated that their combined action may be important for transformation, as well as for the development of drug resistance. 223 The expression of Bcl-2 specifically abrogates c-myc-induced apoptosis, without affecting the c-myc mitogenic effect. 223 Moreover, Ryungsa et al. 224 have found that treatment of human leukemic lymphoblasts with teniposide (VM-26), under conditions that stabilize DNA-topoisomerase II complexes, caused the formation of internucleosomal DNA ladders. Under continuous exposure to VM-26, the internucleosomal DNA ladders were associated with the transient induction of c-jun mRNA in a dose-dependent fashion. The induction of c-jun mRNA by VM-26 apparently preceded DNA ladder formation. 224 In recent years, it has been reported that certain topoisomerase II poisons induce apoptotic cell death in human myeloid leukemic cells, characterized by internucleosomal DNA ladders and associated with the induction of transcription factors of c-jun and c-fos genes. 225 In the next few years, more information will certainly be accumulated on the genetic prog~'am of cell death, and how chemical and physical agents may trigger apoptosis in human tumor cells. The knowledge is expected to be fundamental for the complete understanding of the mechanism of the cell killing activity and selectivity of topoisomerase II poisons. Moreover, clinical research will need to establish the role of these factors in the unresponsiveness of certain human cancers to combination chemotherapy.
ACKNOWLEDGMENTS We gratefully acknowledge grant supports from Associazione Italiana per la Ricerca sul Cancro, Milan; Consiglio Nazionale delle Ricerche, Progetto Finalizzato ACRO, Rome; and Ministero della Sanita', Rome, Italy.
Poisons of Type II DNA Topoisomerases
33
REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. I I. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37.
Wang, J. C. Ann. Rev. Biochem. 1985, 54, 665. Wang, J. C. Ann. Rev. Biochem. 1996, 65, 635. Osheroff, N. Pharmacol. Ther. 1989, 41,223. Cozzarelli, N. R.; Wang, J. C. DNA Topology and its Biological Effects; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1990. Wang, J. C. J. Biol. Chem. 1991, 266, 6659. Watt, E M.; Hickson, I. D. Biochem. J. 1994, 303, 681. Andoh, T.; Ikeda, H.; Oguro, M. Molecular Biology of DNA Topoisomerases and its Application to Chemotherapy, CRC Press: Boca Raton, 1993. Osheroff, N.; Zechiedrich, E. L.; Gale, K. C. Bioessays 1991, 13, 269. Wang, J. C.; Becherer, K. Nuclueic Acids Res. 1983, 11, 1773. Bergerat, A.; Gadelle, D.; Forterre, E J. Biol. Chem. 1994, 269, 27663. Slesarev, A. I.; Lake, J. A.; Stetter, K. O.; Gellert, M.; Kozyavkin, S. A. J. Biol. Chem. 1994, 269, 3295. Berger, J. M.; Gamblin, S. J.; Harrison, S. C.; Wang, J. C. Nature 1996, 379, 225. Caron E R.; Wang, J. C.; Andoh, T.; Ikeda, H.; Oguro, M., Eds. Molecular Biology of DNA Topoisomerases and its Application to Chemotherapy; CRC Press: Boca Raton, 1993. Lock, R. B.; Ross, W. E. Anti-Cancer Drug Des. 1987, 2, 151. Pommier, Y.; Kohn, K. W. In Developments in Cancer Chemotherapy; Glazer, R. I. Ed.; CRC: Boca Raton, 1989. D'Arpa, E; Liu, L. E Biochim. Biophys. Acta 1989, 989, 163. Liu, L. E Ann. Rev. Biochem. 1989, 58, 35 I. Zhang, H.; D'Arpa, E; Liu, L. E Cancer Cells 1990, 2, 23, 1990. Zunino, E; Capranico, G. Anti-Cancer Drug Des. 1990, 5, 307. Pommier, Y. Cancer Cherru)ther. PharmacoI. 1993, 32, 103. Binaschi, M.; Zunino, E; Capranico, G. Stem Cells 1995, 13, 369. Corbett, A. H.; Osheroff, N. Chem. Res. ToxicoL 1993, 6, 585. Roca, J.; Wang, J. C. Cell 1992, 71,833. Roca, J.; Wang, J. C. Cell 1994, 77, 609. Orphanides, G.; Maxwell, A. Curr. Biol. 1994, 4, 1006. Drake, E H.; Hofmann, G. A.; Bartus, H. E; Mattern, M. R.; Crooke, S. T.; Mirabelli, C. K. Biochemistry 1989, 28, 8154. Jenkins, J. R.; Ayton, E; Jones, T.; Davies, S. L.; Simmons, D. L.; Harris, A. L.; Sheer, D.; Hickson, I. D. Nucleic Acids Res. 1992, 20, 5587. Tsai-Pflugfelder, M.; Liu, L. E; Liu, A. A.; Tewey, K. M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C. M.; Wang, J. C. Proc. Natl. Acad. Sci. USA 1988, 85, 7177. Chung, T. D.; Drake, E H.; Tan, K. B.; Per, S. R.; Crooke, S. T.; Mirabelli, C. K. Proc. Natl. Acad. Sci. USA 1989, 86, 9431. Austin, C. A.; Sng, J.-H.; Patel, S.; Fisher, L. M. Biochim. Biophys. Acta Gene Struct. Expression 1993, 1172, 283. Capranico, G.; Tinelli, S.; Austin, C. A.; Fisher, M. L.; Zunino, E Biochim. Biophys. Acta 1992, 1132, 43. Cornarotti, M.; Tinelli, S.; Willmore, E.; Zunino E; Fisher, L. M.; Austin, C. A; Capranico, G. MoL Pharmacol. 1996, 50, 1463. Caron, E R.; Wang, J. C. In Advances in Pharmacology; Academic Press: New York, 1994. Wyckoff, E.; Hsieh, T. S. Proc. Natl. Acad. Sci. USA 1988, 85, 6272. Adachi, N.; Miyaike, M.; Ikeda, H.; Kikuchi, A. Nucleic Acids Res. 1992, 20, 5297. Uemura, T.; Ohkura, H.; Adachi, Y.; Morino, K.; Shiozaki, K.; Yanagida, M. Cell 1987, 50, 917. Wasserman, R. A.; Austin, C. A.; Fisher, U M.; Wang, J. C. Cancer Res. 1993, 53, 3591.
34
GIOVANNI CAPRANICO ET AL.
38. Eder, J. P., Jr.; Chan, V.T.-W.; Niemierko, E.; Teicher, B. A.; Schnipper, L. E. J. Biol. Chem. 1993, 268, 13844. 39. Lindsley, J. E.; Wang, J. C. Proc. Natl. Acad. Sci. USA 1991, 88, 10485. 40. Shiozaki, K.; Yanagida, M. Mol. Cell. Biol. 1991, 11, 6093. 41. Wigley, D. B.; Davies, G. J.; Dodson, E. J.; Maxwell, A.; Dodson, G. Nature 1991, 351,624. 42. Lee, M. P.; Hsieh, T. S. J. Mol. Biol. 1994, 235, 436. 43. Chan, V. T. W.; Ng, S.; Eder, J. P.; Schnipper, L. E. J. Biol. Chem. 1993, 268, 2160. 44. Danks, M. K.; Warmoth, M. R.; Friche, E.; Granzen, B.; Bugg, B. Y.; Harker, W. G.; Zwelling, L. A.; Futscher, B. W.; Suttle, D. P.; Beck, W. T. Cancer Res. 1993, 53, 1373. 45. Lee, M. S.; Wang, J. C.; Beran, M. J. Mol. Biol. 1992, 223, 837. 46. Crenshaw, D. G.; Hsieh, T. J. Biol. Chem. 1993, 268, 21328. 47. Crenshaw, D. G.; Hsieh, T. J. Biol. Chem. 1993, 268, 21335. 48. Caron, P. R.; Watt, P.; Wang, J.C. Mol. Cell. Biol. 1994, 14, 3197. 49. Shiozaki, K.; Yanagida, M. J. Cell Biol. 1992, 119, 1023. 50. Ackerman, P.; Glover, C. V.; Osheroff, N. Proc. Natl. Acad. Sci. USA 1985, 82, 3164. 51. Cardenas, M. E.; Dang, Q.; Glover, C. V.; Gasser, S. M. EMBO J. 1992, 11, 1785. 52. Bojanowski, K.; Filhol, O.; Cochet, C.; Chambaz, E. M.; Larsen, A. K. J. Biol. Chem. 1993, 268, 22920. 53. Corbett, A. H.; Femald, A. W.; Osheroff, N. Biochemistry 1993, 32, 2090. 54. Corbett, A. H.; DeVore, R. F.; Osheroff, N. J. Biol. Chem. 1992, 267, 20513. 55. DeVore, R. F.; Corbett, A. H.; Osheroff, N. Cancer Res. 1992, 52, 2156. 56. Takano, H.; Kohno, K.; Ono, M.; Uchida, Y.; Kuwano, M. Cancer Res. 1991, 51,3951. 57. Cardenas, M. E.; Gasser, S. M. J. Cell Sci. 1993, 104, 219. 58. Cardenas, M. E.; Walter, R.; Hanna, D.; Gasser, S. M. J. Cell Sci. 1993, 104, 533. 59. Dang, Q.; Alghisi, G.-C.; Gasser, S. M. J. Mol. Biol. 1994, 243,10. 60. Vassetzky, Y. S.; Dang, Q.; Benedetti, P.; Gasser, S. M. Mol. CelL Biol. 1994, 14, 6962. 61. Wells, N. J.; Addison, C. M.; Fry, A. M.; Ganapathi, R.; Hickson, I. D. J. Biol. Chem. 1994, 269, 29746. 62. Heck, M. M.; Hittelman, W. N.; Eamshaw, W.C.J. Biol. Chem. 1989, 264, 15161. 63. Saijo, M.; Ui, M.; Enomoto, T. Biochemistry 1992, 31,359. 64. Burden, D. A.; Goldsmith, L. J.; Sullivan, D. M. Biochem. J. 1993, 293, 297. 65. Ganapathi, R.; Zwelling, L.; Constantinou, A.; Ford, J.; Grabowski, D. Biochem. Biophys. Res. Commun. 1993, 192, 1274. 66. Ritke, M. K.; Allan, W. P.; Fattman, C.; Gunduz, N. N.; Yalowich, J. C. Mol. Pharmacol. 1994, 46, 58. 67. Taagepera, S.; Rao, P. N.; Drake, E H.; Gorbsky, G. J. Proc. Natl. Acad. Sci. USA 1993, 90, 8407. 68. Kimura, K.; Nozaki, N.; Saijo, M.; Kikuchi, A.; Ui, M.; Enomoto, T. J. Biol. Chem. 1994, 269, 24523. 69. Burden, D. A.; Sullivan, D. M. Biochemistry 1994, 33, 14651. 70. Laemmli, U. K.; K~, E.; Poljak, L.; Adachi, Y. Curr. Opin. Gen. Dev. 1992, 2, 275. 71. Roberge, M.; Gasser, S. M. Mol. Microbiol. 1992, 6, 419. 72. Gasser, S. M.; Laroche, T.; Falquet, J.; Boy de la Tour, E.; Laemmli, U. K. J. Mol. Biol. 1986, 188, 613. 73. Earnshaw, W. C.; Heck, M. M. J. Cell Biol. 1985, 100, 1716. 74. Adachi, Y.; K/is, E.; Laemmli, U. K. EMBO J. 1985, 8, 3997. 75. Pommier, Y.; Cockerill, P. N.; Kohn, K. W.; Garrard, W. T. J. Virol. 1990, 64, 419. 76. K~, E.; Laemmli, U. K. EMBO J. 1992, 11,705. 77. Borgnetto, M. E.; Zunino, E; Tinelli, S.; K/is, E.; Capranico, G. Cancer Res. 1996, 56, 1855. 78. DiNardo, S.; Voelkel, K.; Stemglanz, R. Proc. Natl. Acad. Sci. USA 1984, 81, 2616. 79. Holm, C.; Goto, T.; Wang, J. C.; Botstein, D. Cell 1985, 41,553. 80. Yang, L.; Wold, M. S.; Li, J. J.; Kelly, T. J.; Liu, L. E Proc. Natl. Acad. Sci. USA 1987, 84, 950.
Poisons of Type II DNA Topoisomerases 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108. 109. 110. 111. 112. 113. 114. 115. 116. 117. 118. 119. 120. 121.
35
Holm, C.; Steams, T.; Botstein, D. Mol. Cell. Biol. 1989, 9, 159. Spell, R. M.; Holm, C. Mol. Cell. Biol. 1994, 14, 1465. Buchenau, P.; Saumweber, H.; Arndt-Jovin, D. J. J. Cell Sci. 1993, 104, 1175. Richter, A.; Strausfeld, U. Nucleic Acids Res. 1988, 16, 10119. Ishimi, Y.; Sugasawa, K.; Hanaoka, F.; Eki, T.; Hurwitz, J. J. Biol. Chem. 1992, 267, 462. Snapka, R. M. Mol. Cell. Biol. 1986, 6, 4221. Wood, E. R..; Earnshaw, W. C. J. Cell Biol. 1990, 111, 2839. Adachi, Y.; Luke, M.; Laemmli, U. K. Cell 1991, 64, 137. Clarke, D. J.; Johnson, R. T.; Downes, C. S. J. Cell Sci. 1993, 105, 563. Downes, C. S.; Clarke, D. J.; Mullinger, A. M.; Gimenez-Abian, J. E; Creighton, A. M.; Johnson, R. T. Nature 1994, 372, 467. Rose, D.; Holm, C. Mol. CelL Biol. 1993, 13, 3445. Nakamura, S.; Nakamura, M.; Kojima, T.; Yoshida, H. Agents Chemother. 1989, 33, 254. Cullen, M. E.; Wyke, A. W.; Kuroda, R.; Fisher, L. M. Agents Chemother. 1989, 33, 886. Oram, M.; Fisher, L. M. Antimicrob. Agents Chemother. 1991, 35, 387. Vizan, J. L.; Hemandez-Chico, C.; del Castillo, I.; Moreno, F. EMBO J. 1991, 10, 467. Nitiss, J.; Wang, J. C. Proc. Natl. Acad. Sci. USA 1988, 85, 7501. Jannatipour, M.; Liu, Y.; Nitiss, J. L. J. Biol. Chem. 1993, 268, 18586. Wasserman, R. A.; Wang, J. C. Cancer Res. 1994, 54, 1795. Hinds, M.; Deisseroth, K.; Mayes, J.; Altschuler, E.; Jansen, R.; Ledley, ED.; Zwelling, L.A. Cancer Res. 1991, 51, 4729. Bugg, B. Y.; Danks, M. K.; Beck, W. T.; Suttle, D. P. Proc. Natl. Acad. Sc'i. USA 1991, 88, 7654. Campain, J. A.; Gottesman, M. M.; Pastan, I. Biochemistry 1994, 33, 11327. Patel, S.; Fisher, L. M. J. Cancer 1993, 67, 456. Capranico, G.; Palumbo, M.; Tinelli, S.; Zunino, F. J. Biol. Chem. 1994, 269, 25004. Fujii, N.; Yamashita, Y.; Saitoh, Y.; Nakano, H. J. Biol. Chem. 1993, 268, 13160. Chen, A. Y.; Yu, C.; Gatto, B.; Liu, L. E Proc. Natl. Acad. Sci. USA 1993, 90, 8131. Nelson, E. M.; Tewey, K. M.; Liu, L. E Proc. Natl. Acad. Sci. USA 1984, 81, 1361. Rowe, T. C.; Chen, G. L.; Hsiang, Y. H.; Liu, L. E Cancer Res. 1986, 46, 2021. Zwelling, L. A.; Mitchell, M. J.; Satitpunwaycha, P.; Mayes, J.; Altschuler, E.; Hinds, M.; Baguley, B. C. Cancer Res. 1992, 52, 209. De Isabella, P.; Capranico, G.; Palumbo, M.; Sissi, C.; Krapcho, A. P.; Zunino, F. Mol. Pharmacol. 1993, 43, 715. Capranico, G.; Zunino, F.; Kohn, K. W.; Pommier, Y. Biochemistry 1990, 29, 562. Bodley, A.; Liu, L. E; Israel, M.; Seshadri, R.; Koseki, Y.; Giuliani, E C.; Kirschenbaum, S.; Silber, R.; Potmesil, M. Cancer Res. 1989, 49, 5969. Capranico, G.; Supino, R.; Binaschi, M.; Capolongo, L.; Grandi, M.; Suarato, A.; Zunino, F. Mol. Pharmacol. 1994, 45, 908. Capranico, G.; Butelli, E.; Zunino, E Cancer Res. 1995, 55, 312. Robinson, M. J.; Osheroff, N. Biochemistry 1990, 29, 2511. Robinson, M. J.; Osheroff, N. Biochemistry 1991, 30, 1807. Robinson, M. J.; Martin, B. A.; Gootz, T. D.; McGuirk, P. R.; Moynihan, M.; Sutcliffe, J. A.; Osheroff, N. J. Biol. Chem. 1991, 266, 14585. Sorensen, B. S.; Sinding, J.; Andersen, A. H.; Alsner, J.; Jensen, P. B.; Westergaard, O. J. Mol. Biol. 1992, 228, 778. Tewey, K. M.; Rowe, T. C.; Yang, L.; HaUigan, B. D.; Liu, L. E Science 1984, 226, 466. Chen, G. L.; Yang, L.; Rowe, T. C.; Halligan, B. D.; Tewey, K. M.; Liu, L. F. J. Biol. Chem. 1984, 259, 13560. Capranico, G.; Zunino, E Eur. J. Cancer 1992, 28A, 2055. Capranico, G.; Kohn, K. W.; Pommier, Y. Nucleic Acids Res. 1990, 18, 6611.
36
GIOVANNI CAPRANICO ET AL.
122. Pommier, Y.; Capranico, G.; Orr, A.; Kohn, K. W. (published erratum in Nucleic Acids Res. 1991, 19, 7003) Nucleic Acids Res. 1991,19, 5973. 123. Fosse, P.; Rene, B.; Le Bret, M.; Paoletti, C.; Saucier, J. M. Nucleic Acids Res. 1991, 19, 2861. 124. Freudenreich, C. H.; Kreuzer, K. N. EMBO J. 1993, 12, 2085. 125. Capranico, G.; Palumbo, M.; Tinelli, S.; Mabilia, M.; Pozzan, A.; Zunino, F. J. Mol. Biol. 1994, 235, 1218. 126. Bigioni, M.; Zunino, F.; Capranico, G. Nucleic Acids Res. 1994, 22, 2274. 127. Kjeldsen, E.; Mollerup, S.; Thomsen, B.; Bonven, B. J.; Bolund, L.; Westergaard, O. J. MoL Biol. 1988, 202, 333. 128. Jaxel, C.; Capranico, G.; Kerrigan, D.; Kohn, K. W.; Pommier, Y. J. Biol. Chem. 1991, 266, 20418. 129. Freudenreich, C. H.; Kreuzer, K. N. Proc. Natl. Acad. Sci. USA 1994, 91, 11007. 130. Capranico, G.; De Isabella, P.; Tinelli, S.; Bigioni, M.; Zunino, E Biochemistry 1993, 32, 3038. 131. Corbett, A. H.; Hong, D.; Osheroff, N. J. Biol. Chem. 1993, 268, 14394. 132. Pullman, B. Anti-Cancer Drug Design 1991, 6, 95. 133. Binaschi, M.; Zagotto, G.; Palumbo, M.; Zunino, F.; Farinosi, R.; Capranico, G. Cancer Res. 1997, 57, 1710. 134. De Isabella, P.; Zunino, F.; Capranico, G. Nucleic Acids Res. 1995, 23, 223. 135. Morjani, H.; Riou, J.-E; Nabiev, I.; Lavelle, E; Manfait, M. Cancer Res. 1993, 53, 4784. 136. Riou, J.-F.; Foss6, P.; Nguyen, C. H.; Larsen, A. K.; Bissery, M.-C.; Grondard, L.; Saucier, J.-M., Bisagni, E.; Lavelle, E Cancer Res. 1993, 53, 5987. 137. Poddevin, B.; Riou, J.-E; Lavelle, E; Pommier, Y. Mol. Pharmacol. 1993, 44, 767. 138. Filipski, J. FEBS Lett. 1983, 159, 6. 139. Leteurtre, E; Fujimori, A.; Tanizawa, A.; Chhabra, A.; Mazumder, A.; Kohlhagen, G.; Nakano, H.; Pommier, Y. J. Biol. Chem. 1994, 269, 28702. 140. Drake, E H.; Hofmann, G. A.; Mong, S. M.; Bartus, J. O.; Hertzberg, R. P.; Johnson, R. K.; Mattern, M. R.; Mirabelli, C. K. Cancer Res. 1989, 49, 2578. 141. Ishida, R.; Miki, T.; Narita, T.; Yui, R.; Sato, M.; Utsumi, K. R.; Tanabe, K.; Andoh, T. Cancer Res. 1991, 51, 4909. 142. Jensen, P. B.; Sorensen, B. S.; Demant, E. J.; Sehested, M.; Jensen, P. S.; Vindelov, L.; Hansen, H. H. Cancer Res. 1990, 50, 3311. 143. Bojanowski, K.; Lelievre, S.; Markovits, J.; Couprie, J.; Jacquemin-Sablon, A.; Larsen, A.K. Proc. Natl. Acad. Sci. USA 1992, 89, 3025. 144. Boothman, D. A.; Trask, D. K.; Pardee, A. B. Cancer Res. 1989, 49, 605. 145. Boritzki, T. J.; Wolfard, T. S.; Besserer, J. A.; Jackson, R. C.; Fry, D. W. Biochem. Pharmacol. 1988, 37, 4063. 146. Roca, J.; Ishida, R.; Berger, J. M.; Andoh, T.; Wang, J. C. Proc. Natl. Acad. Sci. USA 1994, 91, 1781. 147. Chen, M.; Beck, W. T. Cancer Res. 1993, 53, 5946. 148. D'Incalci, M.; Capranico, G.; Giaccone, G.; Zunino, E; Garattini, S. In Cancer Chemotherapy and Biological Response Modifiers Annual 14; Pinedo, H. M.; Longo, D. L.; Chabner, B. A. Eds.; Elsevier Science: Amsterdam, 1993, Chapter 6. 149. Capranico, G.; Giaccone, G.; Zunino, E; Garattini, S.; D'Incalci, M. In Cancer Chenu~therapy and Biological Response Modifiers Annual 15; Pinedo, H. M.; Longo, D. L.; Chabner, B. A. Eds.; Elsevier Science B.V: Amsterdam, 1994, Chapter 6. 150. Hecht, S. M.; Berry, D. E.; MacKenzie, L. J.; Busby, R. W.; Nasuti, C. A. J. Nat. Prod. 1992, 55, 401. 151. Larue, L.; Rivalle, C.; Muzard, G.; Paoletti, C.; Bisagni, E.; Paoletti, J. J. Med. Chem. 1988, 31, 1951. 152. Zhou, X. M.; Wang, Z. Q.; Chang, J. Y.; Chen, H. X.; Cheng, Y. C.; Lee, K. H. J. Med. Chem. 1991, 34, 3346. 153. Macdonald, T. L.; Lehnert, E. K.; Loper, J. T.; Chow, K.-C.; Ross, W. E. In DNA Topoisomerases in Cancer; Potmesil, M.; Kohn, K. W. Eds.; Oxford University: New York, 1991, Chapter 16.
Poisons of Type II DNA Topoisomerases
37
154. Leteurtre, E; Madalengoitia, J.; Orr, A.; Guzi, T. J.; Lehnert, E.; Macdonald, T.; Pommier, Y.; Cuzi, T. J. G. Cancer Res. 1992, 52, 6136, ibid., 4478. 155. Barrows, L. R.; Radisky, D. C.; Copp, B. R.; Swaffar, D. S.; Kramer, R. A.; Waters, R. L.; Ireland, C. M. Makaluvamines. Anti-Cancer Drug Design 1993, 8, 333. 156. Woynarowski, J. M.; McCarthy, K.; Reynolds, B.; Beerman, T. A.; Denny, W. A. Anti-Cancer Drug Design 1994, 9, 9. 157. Figgitt, D. P.; Denny, W. A.; Gamage, S. A.; Ralph, R. K. Anti-Cancer Drug Design 1994, 9, 199. 158. Fosse, P.; Rene, B.; Saucier, J. M.; Henichart, J. P.; Waring, M. J.; Colson, P.; Houssier, C.; Bailly, C. Biochemistry 1994, 33, 9865. 159. Yoshinari, T.; Okada, H.; Yamada, A.; Uemura, D.; Oka, H.; Suda, H.; Okura, A. Japanese J. Cancer Res. 1994, 85, 550. 160. Peczynska-Czoch, W.; Pognan, F.; Kaczmarek, L.; Boratynski, J. J. Med. Chem. 1994, 37, 3503. 161. Auclair, C. Arch. Biochem. Biophys. 1987, 259, 1. 162. Zimmer, C.; Wahnert, U. Prog. Biophys. Mol. Biol. 1986, 47, 31. 163. Fesen, M.; Pommier, Y. J. Biol. Chem. 1989, 264, 11354. 164. Wade, W. S.; Mrksich, M.; Dervan, P. B. Biochemistry 1993, 32, 11385. 165. Baitly, C.; Michaux, C.; Colson, P.; Houssier, C.; Sun, J.-S.; Garestier, T.; H61~ne, C.; H6nichart, J.-P.; Rivalle, C.; Bisagni, E. et aI. Biochemistry 1994, 33, 15348. 166. Portugal, J. FEBS Lett. 1994, 344, 136. 167. Woynarowski, J. M.; Sigmund, R. D.; Beerman, T. A. Biochemistry 1989, 28, 3850. 168. Nguyen, C. H.; Lhoste, J.-M.; Lavelle, F.; Bissery, M.-C.; Bisagni, E. J. Med. Chem. 1990, 33, 1519. 169. Eckardt, J. R.; Burris, H. A., 3rd; Kuhn, J. G.; Bissery, M. C.; Klink-Alakl, M.; Clark, G. M.; Von Hoff, D. D. J. Natl. Cancer Inst. 1994, 86, 30. 170. Nabiev, I.; Chourpa, I.; Riou, J. E; Nguyen, C. H.; Lavelle, E; Manfait, M. Biochemistry 1994, 33, 9013. 171. Larsen, A. K.; Grondard, L.; Couprie, J.; Desoize, B.; Comoe, L.; Jardillier, J.-C.; Riou, J.-E Biochem. Pharmacol. 1993, 46, 1403. 172. Janin, Y. L.; Croisy, A.; Riou, J.-F.; Bisagni, E. J. Med. Chem. 1993, 36, 3686. 173. Pezzuto, J. M.; Antosiak, S. K.; Messmer, W. M.; Slaytor, B.; Honig, G. R. Chem. Biol. Interact. 1983, 43, 323. 174. Markovits, J.; Larsen, A. K.; Segal-Bendirdjian, E.; Fosse, P.; Saucier, J. M.; Gazit, A.; Levitzki, A.; Umezawa, K.; Jacquemin-Sablon, A. Biochem. Pharmacol. 1994, 48, 549. 175. Hickman, J. A. Cancer Metastasis Rev. 1992, 11, 121. 176. Clarke, A. R.; Purdie, C. A.; Harrrison, D. J.; Morris, R. G.; Bird, C. C.; Hooper, M. U; Wyllie, A. H. Nature 1993, 362, 849. 177. Sen, S.; D'Incalci, M. FEBS Lett. 1992, 307, 122. 178. Williams, T. G.; Smith, C. A. Cell 1993, 74, 777. 179. Sinkovics, J.; Horvath, J. Leukemia 1994, 8, Suppl 1, $98. 180. Fernandes, R. S.; Cotter, T. G. Biochem. PharmacoL 1994, 48, 675. 181. Holm, C.; Covey, J. M.; Kerrigan, D.; Pommier, Y. Cancer Res. 1989, 49, 6365. 182. D'Arpa, P.; Beardmore, C.; Liu, L. E Cancer Res. 1990, 50, 6919. 183. Lock, R. B.; Ross, W. E. Cancer Res. 1990, 50, 3767. 184. Lock, R. B.; Ross, W. E. Cancer Res. 1993, 53, 3761. 185. Weinert, T. A.; Hartwell, L. H. Science 1988, 241,317. 186. D'Ari, R.; Huisman, O. J. Bacteriol. 1983, 156, 243. 187. Berger, N. A.; Chatterjee, S.; Schmotzer, J. A.; Helms, S. R. Proc. Natl. Acad. Sci. USA 1991, 88, 8740. 188. Shibuya, M. U; Ueno, A. M.; Vannais, D. B.; Craven, P. A.; Waldren, C. A. Cancer Res. 1994, 54, 1092. 189. Bodley, A. L.; Huang, H.-C.; Yu, C.; Liu, L. F. MoL Cell Biol. 1993, 13, 6190.
38 190. 191. 192. 193. 194. 195. 196. 197. 198. 199. 200. 201. 202. 203. 204. 205. 206. 207. 208. 209. 210. 211. 212. 213. 214. 215. 216. 217. 218. 219. 220. 221. 222. 223. 224. 225. 226. 227. 228.
GIOVANNI CAPRANICO ET AL. Howard, M. T.; Griffith, J. D. J. Mol. Biol. 1993, 232, 1060. Matson, S. W.; Kaiser-Rogers, K. A. Ann. Rev. Biochem. 1990, 59, 289. Watt, P. M.; Louis, E. J.; Borts, R. H.; Hickson, I. D. Cell 1995, 81,253. Howard, M. T.; Neece, S. H.; Matson, S. W.; Kreuzer, K. N. Proc. Natl. Acad. Sci. USA 1994, 91, 12031. Ripley, L. S.; Dubins, J. S.; deBoer, J. G.; DeMarini, D. M.; Bogerd, A. M.; Kreuzer, K. N. J. Mol. Biol. 1988, 200, 665. George, J. W.; Ghate, S.; Matson, S. W.; Besterman, J. M. J. Biol. Chem. 1992, 267, 10683. Naegeli, H.; Modrich, P.; Friedberg, E. C. J. Biol. Chem. 1993, 268, 10386. Wyllie, A. H.; Kerr, J. E R.; Currie, A. R. Cell 198t), 68, 251. Walker, P. R.; Smith, C.; Youdale, T.; Leblanc, J.; Whitfield, J. F.; Sikorska, M. Cancer Res. 1991, 51, 1078. Ryan, A. J.; Squires, S.; Strutt, H. L.; Evans, A.; Johnson, R. T. Carcinogenesis 1994, 15, 823. Hartwell, L. Cell 1992, 71,543. Lowe, S. W.; Ruley, H. E.; Jacks, T.; Housman, D. E. Cell 1993, 74, 957. Kastan, M. B.; Zhan, Q.; El-deiry, W. S.; Carrier, E; Jacks, T.; Walsh, W. V.; Plunkett, B. S.; Volgestain, B.; Fomace, A. J. Cell 1992, 71,587. Unger, T.; Nau, M. M.; Segal, S.; Minna, J. D. EMBO J. 1992, 11, 1383. El-deiry, W. S.; Tokino, T.; Velculescu, V. E.; Levy, D. B.; Parsons, R.; Trent, J. M.; Lin, D.; Mercer, W. E.; Kinzler, K. W.; Vogelstein, B. Cell 1993, 75, 817. Fan, S.; El-deiry, W. S.; Bae, I.; Freeman, J.; Jondle, D.; Bhatia, K.; Fomace, A. J.; Magrath, J. I.; Kohn, K. W.; O'Connor, P. M. Cancer Res. 1994, 54, 5824. Kuerbitz, S. J.; Plunkett, B. S.; Walsh, W. V.; Kastan, M. B. Proc. Natl. Acad. Sci. USA 1992, 89, 7491. Fritsche, M.; Haessler, C.; Brandner, G. Oncogene 1993, 8, 307. Lowe, S. W.; Schmitt, E. M.; Smith, S. W.; Osborne, B. A.; Jacks, T. Nature 1993, 362, 847. Lowe, S. W.; Bodis, S.; McClatchey, A.; Remington, L.; Ruley, H. E.; Fisher, D. E.; Housman, D. E.; Jacks, T. Science 1994, 266, 807. Luethy, J. D.; Holbrook, N. J. Cancer Res. 1992, 52, 5. Reed, J. C. J. Cell. Biol. 1994, 124, I. Yunis, J. J.; Mayer, M. G.; Arnesen, M. A.; Aeppli, D. E; Oken, M. M.; Frizzera, G. N. Engl. J. Med. 1989, 320, 1047. Kamesaki, S.; Kamesaki, H.; Jorgensen, T. J.; Tanizawa, A.; Pommier, Y.; Cossman, J. Cancer Res. 1993, 53, 425 I. Oltvai, Z. N.; Milliman, C. L.; Korsmeyer, S. J. Cell 1993, 74, 609. Miyashita, T.; Krajewsld, S.; Krajewska, M.; Wang, H. G.; Lin, H. K.; Liebermann, D. A.; Hoffman, B.; Reed, J. C. Oncogene 1994, 9, 1799. Selvakumaran, M.; Lin, H. K.; Miyashita, T.; Wang, H. G.; Krajewsld, S.; Reed, J. C.; Hoffman, B.; Liebermann, D. Oncogene 1994, 9, 1791. Miyashita, T.; Harigai, M.; Hanada, M.; Reed, J. C. Cancer Res. 1994, 54, 3131. Wang, Y.; Szekely, L.; Okan, I.; Klein, G.; Wiman, K. G. Oncogene 1993, 8, 3427. Miyashita, T.; Reed, J. C. Cell 1995, 80, 293. Chapman, R. S.;Whetton, A. D.; Dive, C. Cancer Res. 1994, 54, 5131. Sawyers, C. L.; McLaughlin, J.; Goga, A.; Havlik, M.; Witte, O. Cell 1994, 77, 121. Levine, A. J. Ann. Rev. Biochem. 1993, 62, 623. Lotem, J.; Sachs, L. Cell Growth Differ. 1993, 4, 41. Ryungsa, K.; Beck, W. T. Cancer Res. 1994, 54, 4958. Rubin, E.; Kharbanda, S.; Gunji, H.; Kufe, D. Mol. Pharmacol. 1991, 39, 697. Wang, L.-K.; Johnson, R. K.; Hecht, S. M. Chem. Res. Toxicol. 1993, 6, 813. Austin, C. A.; Patel, S.; Ono, K.; Nakane, H.; Fisher, L. M. Biochem. J. 1992, 282, 883. Gupta, M.; Abdel-Megeed, M.; Hold, Y.; Kohlhagen, G.; Paull, K.; Pommier, Y. Mol. Pharmacol. 1995, 48, 658.
TOPOISOMERASE I-TARGETING DRUGS" NEW DEVELOPMENTS IN CANCER PHARMACOLOGY
Barbara Gatto and Leroy Fong Liu
I.
II.
III.
IV.
V.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Topoisomerases are Essential Enzymes . . . . . . . . . . . . . . . . . . . B. TopoisomeraseoTargeting Drugs: Two Classes of Compounds . . . . . . . Eukaryotic Topoisomerase I . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Physiological Roles and Cellular Regulation . . . . . . . . . . . . . . . . B. Mechanism of Action . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Camptothecins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Camptothecin is an Antitumor Agent . . . . . . . . . . . . . . . . . . . . . B. Camptothecin is a Topoisomerase I Poison . . . . . . . . . . . . . . . . . C. Camptothecin Binding Site is Defined by Topoisomerase I Mutants . . . . D. Camptothecin-Cleavable Complex Interactions: Design of New Derivatives.. New Topoisomerase I-Targeting Drugs . . . . . . . . . . . . . . . . . . . . . . A. Specific Topoisomerase I Poisons . . . . . . . . . . . . . . . . . . . . . . B. Dual Topoisomerase I and II Poisons . . . . . . . . . . . . . . . . . . . . Concluding Remarks . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Advances in DNA Sequence-Specific Agents Volume 3, pages 39-65 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8 39
40 40 40 41 41 42 43 43 45 46 48 53 54 57 61 61
40
BARBARA GATTO and LEROY FONG LIU I.
INTRODUCTION
A. Topoisomerasesare Essential Enzymes Topoisomerase-targeting drugs are a vast group of compounds exerting various pharmacological activities, characterized by their ability to target the nuclear proteins topoisomerases or their prokaryotic analogues, n-4 Topoisomerases represent a class of nuclear enzymes deputed to solve the topological problems arising during normal cellular processing of nucleic acids. 1 Since the isolation of the first enzyme able to catalyze topological reactions, the protein co in E. coli, 5 proteins with topoisomerase activity have been found in almost every organism studied. Their ubiquity, as well as the significant homologies in their primary sequences, is linked to the "mechanical" problems posed by the complexity of the nucleic acids to any helix-processing activity. Detailed analysis of the reactions catalyzed by topoisomerases and their roles in fundamental processes like replication, transcription, and recombination have been the subject of many reviews 4'6-9 and therefore will not be covered here. All topoisomerases share a common activity toward their nucleic acid substrate, namely the nicking-closing activity, l~ Based on their mechanism of action, topoisomerases can be classified into two classes, type I and type II enzymes, x More recently, based on sequence homologies and on biochemical properties, all known topoisomerases have been divided into three subgroups. ~xThe group whose targeting agents are reviewed in this chapter is represented by eukaryotic topoisomerase I and by vaccinia virus topo I. A recent paper, however, based on differences in the domain organization of the two enzymes, suggests that they belong to separate subfamilies, ~2 a hypothesis that was supported by the partial crystal structure of both enzymes. 13,14
B. Topoisomerase-Targeting Drugs: Two Classes of Compounds Any drug capable of inhibiting the catalytic activity of the enzyme could theoretically result in inhibition of the cell growth. The first drugs with recognized ability to target topoisomerases were however not classical enzyme inhibitors, but rather compounds capable of transforming the enzyme into cellular poisons. 15-17 For example, doxorubicin, a well known antitumor agent, showed the ability to trap an essential intermediate of the reactions catalyzed by topoisomerase II, the "cleavable complex." In this drug-DNA-protein complex the nucleic acid is broken and covalently linked to the enzyme, and the presence of these drug-stabilized breaks in the nucleic acid triggers the events leading to cell death, l Many compounds behaving like doxorubicin have been discovered, with pharmacological actions ranging from antiproliferative to antibacterial, antifungal, and antitrypanosomal. ~'18-21 More recently, a different class of topoisomerase II inhibitors such as the ICRF compounds were identified. 22 We will follow the classification of topoisomerase I inhibitors proposed previously. II Hence, class I drugs are all
Topoisomerase I-Targeting Drugs
41
compounds which are able to stabilize the cleavable complex, known collectively as "topoisomerase poisons," while to class II belong all drugs that inhibit topoisomerases catalytic functions in other ways. While a conspicuous number of compounds, belonging to either class I or II drugs, are known to target the type II eukaryotic enzymes, camptothecin and its derivatives are until recently the only drugs with significant pharmacological activity linked to the poisoning of eukaryotic type I topoisomerase. However, research on eukaryotic topoisomerase I-targeting drugs has recently entered an explosive stage, leading to the isolation of new compounds belonging to diverse chemical classes. Before reviewing them, we will briefly examine the topoisomerase I mechanism of action and its significance as a target for antitumor chemotherapy.
II.
EUKARYOTIC TOPOISOMERASE
I
A. Physiological Roles and Cellular Regulation All type I eukaryotic enzymes are monomeric nuclear proteins capable of relaxing positive and negative DNA supercoils without energy cofactors, ll The first eukaryotic type I topoisomerase was identified by DNA superhelical untwisting activity in mouse cell extracts. 23 Its physiological importance is linked mainly to the swiveling activity necessary to unwind the DNA helix during replication, as well as to the relaxation of DNA supercoils generated by RNA polymerase during transcription. 24'25 Quite surprisingly however, topoisomerase I is not essential for cell viability in yeast, 26'27 although Drosophila topoisomerase I plays an essential role during fly development. 28 All eukaryotic topoisomerases I share significant homologies and catalyze the same type of in vitro reactions. 29 One of these suggests a role for topoisomerase I in illegitimate recombination: the enzyme can ligate oligonucleotides with free 5'-hydroxyls to the bound nicked-DNA strand, provided that sequence complementarities exist between the oligonucleotides and the noncleaved DNA strand. The involvement of eukaryotic topoisomerase I in recombination is further supported by an increase in illegitimate recombination events in yeast strains overexpressing topoisomerase I. Furthermore, the "hot spot" sequences for these integrations correspond to the preferred in vitro topoisomerase I induced cleavage sites. 3~ The activity of the enzyme is regulated in the cell by posttranslational modifications. The best characterized of these modifications is phosphorylation, 31'32 and differently phosphorylated forms of topoisomerase I appear during the cell cycle. 33'34 Certain types of phosphorylation can apparently enhance the relaxation activity of topoisomerase 1 35 and could be responsible for the lack of correlation between mRNA and protein levels during events like cell proliferation and cell differentiation. ADP ribosylation by poly(ADP-ribose)polymerase on the contrary abolishes topoisomerase I relaxing activity in vitro. 36'37 Since the addition of
42
BARBARA GATTO and LEROY FONG LIU
poly-ribose is stimulated by DNA strand breaks, 38 this modification may play a role in the cellular responses to topoisomerase I drugs. A recent paper describes the phosphorylation by mammalian topoisomerase I on proteins belonging to the SR family of splicing factors. 39 Topoisomerase I lacks a canonical ATP binding domain, but can indeed bind ATP and phosphorylate selected serine residues at the arginine-serine rich region of SR proteins; since this kinase activity is blocked by the topoisomerase I poison camptothecin, and phosphorylation regulates the activity of SR proteins, a possible role of topoisomerase I in RNA splicing was suggested. 39
B. Mechanism of Action The catalytic domain of known eukaryotic topoisomerase I is highly conserved, with a sequence homology higher than 50%. 12'4~It is located close to the C-terminal of the protein primary sequence, and contains a consensus sequence of six amino acids surrounding the tyrosine responsible for the DNA transesterification reactions. The mechanism of action of topoisomerase I has been classically subdivided into discrete steps: DNA binding, DNA cleavage, swiveling (or DNA passage), DNA religation, and, finally, enzyme turnover. 4j The best characterized steps, and the most relevant to our discussion on topoisomerase I-targeting drugs, are the DNA binding, cleavage, and religation reactions. 1~ DNA
Binding Specificity
Information on topoisomerase I binding preferences are usually inferred from DNA cleavage patterns, and might be biased by this experimental limitation. The enzyme prefers to bind double-stranded DNA, or single-stranded DNA in regions of secondary structures. 43 The footprint of topoisomerase I bound to a specific recognition site of an intergenic Tetrahymena DNA sequence has revealed a protection region of 16-20 base pairs roughly symmetrical with respect to the cleavage site, 44 with the main noncovalent contacts taking place in the upstream region. Specific contacts have also been suggested in the downstream region. 45 Another consensus sequence for enzyme binding has been deduced from the analysis of other strong in vitro cleavage sites; 43 the common element in the different proposed consensus sequences seems to be a strong preference for a T in position -1.46 Downstream of the cleavage site, the conformation of the DNA, rather than its primary sequence, appears important; if the bent A-tract downstream of the preferred topoisomerase I cleavage site in Tetrahymena DNA is mutated, the frequency of the enzyme-induced cleavage is reduced or abolished. 47 The preference of topoisomerase I for bent to nonbent sequences, as well as for supercoiled to linearized DNA, 48 is consistent with its role as a relaxing enzyme. Topoisomerase I, thus, is sensitive to the presence of writhe in DNA. 29
Topoisomerase I- Targeting Drugs
43
The Cleavable Complex Upon noncovalent binding to its DNA substrate, a tyrosine residue at the enzyme active site reacts with the phosphodiester backbone. The result of this nucleophilic attack is a complex in which the tyrosine is covalently linked to the 3'-phosphate of the broken DNA end. This reaction intermediate, easily isolated by the use of protein denaturants like alkali or SDS, has been called the "cleavable complex. ''l The cleavage-religation reaction is completely reversible, as demonstrated by conditions that favor enzyme dissociation from the nucleic acid substrate, like high salt, heat, DNA addition, or simple dilution. In other words, the cleavable complex is in equilibrium with the "noncleavable" complex. The religation step is driven by the energy accumulated in the phosphotyrosine linkage: the free 5'-OH of the broken DNA strand can attack the enzyme-linked phosphate to restore the phosphodiester bond. During a cleavage-religation cycle the enzyme can perform its physiological role in relaxation and strand passage events. Two hypotheses have been proposed to explain the strand passage mechanism. The simplest explanation calls for a free rotation of the intact DNA strand around the nicked one, while in the second model the intact strand passes through the gate created by the enzyme in the broken DNA. 49 A way to study the cleavable complex in vitro and in vivo, and hence to obtain more information about the enzyme mechanism, is through the use of compounds able to enhance formation of the reaction intermediate. These compounds, whose prototype is camptothecin, can shift the cleavage-religation equilibrium toward the cleaved state by inhibiting the religation step. 5~ The block is completely reversible, unless transformed into an irreversible event by enzyme denaturation with SDS or alkali. In this way it is possible to isolate DNA fragments covalently linked to the 3'-end of the enzyme through a phosphotyrosine link. 5~ Much of what is known about topoisomerase I cleavable complex comes from studies using camptothecin, although the discovery of new drugs able to target the enzyme in a different mode will also be likely to accelerate our understanding of the enzyme mechanism.
III.
CAMPTOTHECINS
The interest in topoisomerase I as a target for antitumor chemotherapy has its basis in the successful clinical development of the alkaloid camptothecin. Only recently new drugs structurally different from camptothecin have been identified. In order to examine in more detail the most recent findings on the basic and applied pharmacology of eukaryotic topoisomerase I-targeted drugs, we will outline the principal features of their activity.
A. Camptothecin is an Antitumor Agent Camptothecin, whose structure is shown in Figure 1, is a natural alkaloid isolated in 196652 whose broad spectrum of antitumor activity in animal models was related
44
BARBARA GATTO and LEROY FONG LIU NH 2
~
"
N
0
0 OH 0
OH 0
9-amino-20-(S)-Ca mptothecin
20-(S)-Camptothecin
O o
OH u
CPT-I1
OH u
Topotecan
Figure 1. Camptothecin derivatives currently in clinical trials. to the inhibition of DNA and RNA synthesis. After these encouraging observations, the drug entered phase I and II clinical studies; however, due to the alkaloids' low solubility, the chosen formulation was its carboxylate sodium salt, obtained by hydrolysis of the lactone form. The early clinical trials proved the drug to be too toxic and ineffective, and further investigations were abandoned. 53 Renewed interest came more than a decade later with the discovery that camptothecin can induce in vitro formation of a cleavable complex in the presence of mammalian topoisomerase 1;50 the requirement of the intact lactone form for activity 5~ explained the failure of the early clinical trials and strongly suggested the involvement of topoisomerase I poisoning in mediating the antitumor effect of campthotecin. This hypothesis was proved correct using different approaches. First, classic structureactivity relationship studies on camptothecin derivatives established a correlation between the ability to trap topoisomerase I in vitro and the observed cytotoxic effect. 5~ In vivo, a genetic approach using yeast as a model showed that those cells whose topoisomerase I gene is deleted are insensitive to camptothecin, but drug sensitivity is restored by transfection with the human topoisomerase I
Topoisomerase I-Targeting Drugs
45
gene. 26'56A third and conclusive piece of evidence pointing out topoisomerase I as being the only intracellular target for camptothecin came from the observation that the drug-resistant phenotype in human cell lines is mediated either by lower protein levels or by structural alterations resulting from point mutations in the topoisomerase I gene. 57-61 It was later established that the enzyme levels, although relatively constant throughout the cell cycle, 62'63 are elevated in several types of leukemia 64 and in some cancers like primary colon adenocarcinoma. 65 When these and other type of solid tumors, implanted as xenografts in nude mice, were treated with 9-aminocamptothecin, a synthetic derivative of camptothecin, tumor growth was arrested, and the treated animals showed prolonged remission. These impressive results opened the way to clinical studies: at the present moment 9-amino-CPT, 20(S)camptothecin, the prodrug CPT-11, and the water soluble topotecan, all shown in Figure 1, are at different stages of clinical trials. 66-73 New studies on tumor biopsies confirm that topoisomerase I levels and its catalytic activity are elevated in colorectal tumors and prostate cancer, but not in other types of cancer like kidney tumors, lung, and breast. 74'75 Topoisomerase I drugs are therefore good candidates for the chemotherapy of selected types of tumors overexpressing the enzyme either as a result of altered transcription/translation, or by increased mRNA stability.
B. Camptothecin is a Topoisomerase I Poison Camptothecin is a topoisomerase "poison," since it interferes with the cleavagereligation equilibrium of the enzyme on its nucleic acid substrate, shifting this equilibrium toward the cleaved state. The final effect is a persistent and lethal DNA damage induced by the enzyme, exclusively in the presence of drug. It is assumed that camptothecin inhibits the enzyme at the religation step, although the issue remains controversial. 76'77 Since the shifted cleavable complex is fully reversible, camptothecin needs the intervention of other processes to show its effect. The main cellular event responsible for the cell killing is ongoing DNA synthesis, as proved by the finding that replication inhibitors like aphidicolin abolish camptothecin toxicity. 78'79It is likely that the collision between the replication fork and the cleavable complex transforms reversible single-strand DNA breaks into irreversible double-strand breaks, sensed by the cell as DNA damage. 79 Yeast cells with mutations in the DNA repair gene RAD52 are in fact extremely sensitive to the antiproliferative effects of camptothecin. 26 The actual cellular processes of the damage induced by camptothecin are however still unknown, and much effort is directed toward this area. 8~ Studies in yeast cells, mutagenized and selected for mutations able to restore the cell viability in the presence of drug, led to the isolation of dominant SCT (suppressor of camptothecin toxicity) mutants. Differently from "classical" mutants, their drug resistance is
46
BARBARA GATTO and LEROY FONG LIU
neither due to altered enzyme catalytic activity nor to a significative decrease in drug uptake. 8~The growth rate of such mutants is unaffected by drug treatment but they are still sensitive to DNA damage induced by UV light or by mutagens. Although a mechanism of increased double-strand DNA-breaks repair could be involved, further characterization of the mutants are needed to clarify the biochemical pathways involved in the lethal effect of camptothecin.
C. Camptothecin Binding Site is Defined by Topoisomerase I Mutants Molecular interactions of camptothecin with its partners are complex: it does not bind isolated DNA 81 or topoisomerase I unless in the context of the ternary complex. 54 The drug presumably contacts various protein domains 82 in the cleft that represents the enzyme catalytic site. The nature and complexity of this binding site can be indirectly deduced by the analysis of topoisomerase I mutants resistant to camptothecin. As shown in Figure 2, many mutations were detected either in cell lines exposed to increasing concentrations of camptothecin, or one of its analogues, or by site directed/random mutagenesis of human topoisomerase I gene, transformed and selected in bacteria or yeast. All these mutations cluster in defined regions in the enzyme primary sequence, and are likely to represent interdomainal points of contacts, delimiting the catalytic site and the camptothecin binding domain. 82 All the reported mutations map in regions, or "homology domains, ''4~ with the highest identity in the primary sequence of topoisomerase I from different organisms, namely Homo sapiens, Drosophila melanogaster, Arabidopsis thaliana, S. cerevisiae, and S. pombei. 4~ It is evident from Figure 2 that some of these sequences are conserved even in the vaccinia virus enzyme, and are likely to define domains critical for enzyme catalysis. Of particular interest is the study of vaccinia virus topoisomerase I, a small enzyme of 314 amino acids with significant homologies to its human and yeast counterparts, but naturally resistant to camptothecin. 83 When the two conserved amino acids (721 and 722) preceding the human (or yeast) catalytic tyrosine are substituted with the corresponding amino acids found in vaccinia virus, the "chimeric" enzymes become camptothecin-resistant. 84 The corresponding exchange of the yeast amino acids into the vaccinia virus enzyme however does not yield a camptothecin-sensitive vaccinia virus topoisomerase I, 83 suggesting that additional domains not present in the simple viral enzyme are needed to form the active camptothecin pocket. Topoisomerase I from CEM/C2 cells, derived by stepwise selection by camptothecin of human leukemia cells CCRF/CEM, bear a mutation at Asn-722 too, that results in a twofold reduction of the enzyme catalytic activity. 85 Other mutants isolated in different cell lines map in this region, immediately surrounding the catalytic site of topoisomerase I. Two mutations at 717 and 729 were isolated from the ovarian cancer line CPT-2000, derived from A2780, 86 and the same mutation at 729 was found in PC-7/CPT, a lung cancer cell line selected for resistance to CPT-11. 87,88 While in the latter case the mutant enzyme has a reduced relaxation
Topoisomerase I-Targeting Drugs
47 T729A D533G D221V N722A !i I
il
G363C I~12(. ,'' i
"
'
i
J 35~nPP. LrRGRG.HPK
: '
t~nr~a~k.]~e I
139n D T V G l l tL
.......
,,
I
I1 U. U
ICOOH
|
! ,,r~rsK.i~.bPa. t#] i 267pstSKr'aYmn--tt|
~
5s3GL.AKVFRTYNAS 216GirIKd_IR~..gvn
[ 52,FDFiGKDsI 162ikFvGKDkv
!
[
Figure 2. Mutations in the human topoisomerase I sequence responsible for camptothecin resistance. The mutation site evidenced as a black bar is responsible for camptothecin sensitivity of vaccinia virus topoisomerase I. The amino acidic residues surrounding the underlined mutation sites are boxed. The upper capitalized sequence shows the consensus found for 6 eukaryotic topoisomerases i (from Ref. 31), with numberings corresponding to the human enzyme. The lower sequence is vaccinia virus topoisomerase I. The amino acid residues conserved both in the eukaryotic consensus and in vaccinia virus sequences are capitalized. "Dots" correspond to nonconserved residues, while "hyphens" indicate gaps due to sequence alignment. * Indicates that the mutation has been isolated in Chinese hamster cells. # Indicates a nonconserved residue in the human topoisomerase I sequence. activity, other mutants have a fully functional enzyme in the absence of drug. The best characterized of these type of mutants is found in CPT-K5 cells, a human lymphoblastic leukemia cell line that bears two point mutations in the topoisomerase I gene, at 533 and 583. Only the mutation changing Asp-533 to Gly is responsible for resistance, 89'9~ which could be the result of the recession of the surrounding domain from the enzyme surface. 89 The hypothesis of a structural alteration of the drug binding site is supported by the finding that CPT-K5 topoisomerase I binds and cleaves a subset of cleavage sites with higher efficiency than the wild-type enzyme. 91 Other mutations map in the regions spanning residues 500-600. The mutation at position 503 isolated from a Chinese hamster cell line maps in a very conserved region, and corresponds to position 505 of the human enzyme. 58 The camptothecin sensitivity of the mutant enzyme could be the result of an altered binding of the drug to the DNA-enzyme complex. Similarly, the
48
BARBARA GATTO and LEROY FONG LIU
replacement of Asp-221 of vaccinia virus topoisomerase I with Val, highly conserved in the corresponding position of much of the topoisomerase I gene (588 in human sequence), results in a camptothecin-sensitive vaccinia virus topoisomerase I. 92 A third domain involved in the formation of the camptothecin pocket is around position 363. 93 The mutation Gly363Cys isolated from a pool of mutagenized clones expressed in a drug permeable yeast strain does not result in alterations of mRNA or protein levels, or in decreased relaxation activity in the absence of drug. Similarly, a mutation Phe to Ser at residue 361 isolated in U-937/CR, a human myeloid leukemia cell line selected for resistance to 9-nitro-20(S)-camptothecin, 94 yields an enzyme whose cellular levels and activity are comparable to the wild type, but is 10-fold less active in the presence of drug. A comparison with the recently published crystal structure of yeast topo I shows that these two mutations in the human enzyme map in a I]-hairpin like loop 14 that is part of a highly conserved protein region contacting DNA. Biochemical and structural studies show how this domain is part of the surface of camptothecin cleft, involved both in the formation of a ternary complex, and in the DNA cleavage-religation reaction. A different set of yeast mutants show the ability to cause extensive DNA cleavage, resulting in cell growth inhibition and death in the absence of drug. 95 Despite the identification of the mutated residues, the molecular basis of action of these "camptothecin-mimicking" enzymes is still unclear, but resembles the nicking activity of mammalian topo I at mismatched sequences. 96 New camptothecin-resistant mutants are continuously been engineered and isolated for mechanistic studies, but clinically relevant ones are likely to become a major problem once the drugs enter the market. The elucidation of the biochemical properties of these mutants in the light of the crystal structure of the enzyme is therefore urgent: the definition of the drug binding domain in the drug-DNA-enzyme ternary complex will lead to the design and synthesis of new topoisomerase 1-targeting compounds.
D. Camptothecin-Cleavable Complex Interactions: Design of New Derivatives The extensive structure activity relationship conducted on camptothecin was aimed at: (a) establishing the structural requirements for activity, and (b) obtaining new potent semisynthetic derivatives with a better pharmacokinetic profile than the parent compound. Both aims have been fulfilled: potent water-soluble derivatives have been developed and are entering or completing clinical trials. In addition, the whole body of research has led to the definition of a "minimal" model for the drug interactions within the cleavable complex, whose main features are shown in Figure 3. Camptothecins' potency lies in what actually represents a pharmacokinetical disadvantage, the intact lactone at ring E: its pH-dependent hydrolysis renders the
Topoisomerase I-Targeting Drugs
49
planar ring system docking in DNA-enzymecleft ....
I
I
NU :
5
~i ~ ( C~ND._4,0 ~-" 12
1
interaction with V enzyme/DNA surface
~ 1 ~
"~
OH
!
inte raction with enzyme/DNAsurface : Nu
, I
stereospecific interaction with enzyme
Figure 3. "Minimal" model for the interaction of camptothecin with topoisomerase I and the nucleic acid in the cleavable complex (see text for details). drug inactive. 97 The lactone-carboxylate equilibrium shown in Figure 4 is shifted at physiological pH toward the open form. In whole blood the active closed form is only 5.3% of the total, 98 and represents a compromise between the preferential binding of the open form to human serum albumin 99 and the interaction of the lactone with lipid bilayer of the erythrocyte membrane. 98 The carbonyl group of the lactone form that reaches its nuclear target undergoes a reversible nucleophilic attack by the enzyme. The lactam analogue of camptothecin, whose carbonyl group is less prone to hydrolysis but also less reactive to nucleophilic additions, is in fact inactive. 55 Ring E interactions within the enzymeDNA complex is supported by its stereospecificity: only the S (hydroxyl group in C-20) shows activity, 55'1~176 but the ethyl moiety at C-20 can be substituted by bulkier groups without significant loss of activity. 1~ The requirement for this a-hydroxyl group has been recently challenged by the finding that 18-noranhydrocamptothecin, a camptothecin derivative with an exo-methylidene group at C-20, shown in Figure 5, retains the enzyme inhibitory activity. 1~ This result, if confirmed by
11
9
7
9
1
5
9 '~
~
7
11
0
12
14
OH O
1
5N
L OH
OH OO- Na+
2
Figure 4. Camptothecin lactone form (1) readily hydrolyzes to the inactive carboxylate form (2) at physiological pH.
50
BARBARA GATTO and LEROY FONG LIU
I
N
O
CH 2 0
Figure 5. 18-noranhydrocamptothecin, a new derivative with major modifications at the stereospecific position 20 of camptothecin.
in vivo data, will open a whole new field on alkylating camptothecin analogues, useful both as new chemotherapeutics and as tools for mechanistic studies. The camptothecins currently under development retain the t~-hydroxylactone moiety at the E ring, but have extensive modifications at other positions of the pentacyclic structure. Each ring of the camptothecin molecule has been functionalized in the attempt of obtaining either water-soluble drugs or simplified molecules with considerable activity. The structural requirements of camptothecin are, however, strict. The ABCD ring system has been simplified to various tetra-, tri-, biand even monocyclic rings, 1~ with total or partial loss of activity; 1~ overall planarity of the "left" part of the molecule is undoubtedly an essential feature. 1~ In the most active pentacyclic structure, substitutions at C-12 and C-14 are absolutely detrimental to activity, suggesting steric limitations imposed by the enzyme or by the DNA-enzyme surface. 1~176 Positions C-9 and C-10, on the contrary, can be functionalized by a wide variety of substituents, 1~ as exemplified by the appreciable activity of 9-amino-camptothecin and topotecan. 65'11oRing A, the "left" part of the molecule, is a possible point of contact between drug and enzyme, since camptothecin derivatives with an alkylating group at position C-9 bind covalently to nucleophilic residues on the enzyme. Ill Position C-7 in ring B defines another possible surface of contact ll2 and is a good site for functionalization as demonstrated by CPT-11,113-114 a water-soluble prodrug whose active form SN-38 has shown good activity in clinical trials, ll5 More recently, a C-7 alkylated derivative of camptothecin showed the ability to react with DNA in the presence of topoisomerase 1.116 The drug can alkylate the purine immediately +1 to the topoisomerase I-induced cleavage site, demonstrating close proximity of this "side" of camptothecin and DNA in the enzyme-DNA interface. Since the reaction results in an irreversible trapping of the cleavable complex, this compound may represent a lead in the design of new potent camptothecin derivatives. In addition, the substitutions at C-7, C-9, and C-10 lower the association with human serum albumins and prolong the drug's half-life. 99 A new line of research couples the accessibility of position 7 with previous results evidencing how an additional methylenedioxy ring fused at positions C-10 and
Topoisomerase I-Targeting Drugs
51
C-11 can significantly enhance camptothecin activity. 117 The high toxicity of 10,11-methylene-dioxycamptothecin (10,11-MDC) precluded its therapeutic use, but is lowered by functionalization at position C-9.117 The new water-soluble compounds GI149893 and GI147211, shown in Figure 6, bear hydrophilic piperazino groups at position C-7 of 10,11-(methylendioxy) and (ethylenedioxy)-(20S)camptothecin, respectively, 118 and are 4-5 times more soluble than topotecan. ~9 Their in vitro and in vivo potency is comparable or superior to that shown by the reference compound topotecan, both in cultured tumor cell lines and in colon tumors implanted as xenografts in nude mice. 119By analogy to camptothecin, both GI compounds exhibit comparable cytotoxicity to sensitive and multi-drug resistant ovarian cell lines, making them good candidates for the treatment ofMDR overexpressing tumors. Clinical evaluation of the drug G1147211 is currently underway. 12~ A similar series of compounds bearing various aromatic quaternary ammonium salts at position C-7 are undergoing testing also, and have so far showed good in vitro a,nd in vivo activities. 121
ON O
10,11-methylendioxycamptothecin
/
O
/CH3
CH 3
O
c2
N---.
o
--+-4
ON O
ON O GI-149893
GI-147211
Figure 6. The new water soluble derivatives GI149893 and GI147211 are formerly derived from 10,11 -methylenedioxy-camptothecin.
52
BARBARA GATTO and LEROY FONG LIU
The search for new camptothecin analogues with improved water solubility led to the development of substituted l l-aza-derivatives, 122 already known to have good activity in vitro in the cleavable complex assay. 5~ Though most of these water-soluble derivatives have good in vitro activity, this does not correlate with the in vivo data, probably due to pharmacokinetical limitations. An exception is represented by the compound shown in Figure 7A, which showed excellent potency in delaying tumor growth in nude mice xenografts. 122The possible formation of a penta- or hexacyclic ring by an intramolecular H-bond between the substituent at C-10 and the A ring nitrogen makes the overall structure of this compound similar to that of 10,11-methylenedioxy-camptothecin, and adds further evidence to the potential clinical development of rigid camptothecin analogues. Amore dramatic approach has been followed by Lackey et al. 1~ who synthesized a series of rigid analogues formally derived from the condensation of the CDE drug rings with an oxodihydroindolylidene moiety (Figure 7B). Various derivatives, tested in the cleavable complex assay, showed activity in the same concentration range as camptothecin. A noteworthy observation is that the structure of 9-amino10,11-methylene-dioxy-camptothecin and these oxodihydroindolyl-derivatives can be superimposed, and show striking similarities in steric terms. 1~ The structure-activity relationship established for this series of drugs in fact confirm the
.OH
H-NNNN~ HN
J
~'~/N-~ '0
OHu
-""O~H ~: B -
F"~
.,,,,\NH2
N ~ C
0
OHO
Figure 7. New rigid camptothecin analogues. (A) 11-aza-camptothecin derivatives. (B) oxodihydroindolylidene-derivatives. (C) 7,9 Hexacyclic-camptothecin derivatives..
Topoisomerase I- Targeting Drugs
53
same steric limitations imposed to camptothecin by the geometry of the cleavable complex. 10,11 MDC analogues show that the addition of a sixth ring to the basic pentacyclic structure of camptothecin increases its antitumor activity. In fact, other heterocycles can be fused at positions C-10 and C-11 without significant loss of activity. ~23 This observation has been the basis for the synthesis of another series of rigid camptothecin derivatives in which a sixth ring of 5, 6, or 7 atoms is fused between positions C-7 and C-9.124 These new hexacyclic compounds (e.g. Figure 7C) showed good in vitro activity that correlated to good in vivo cytotoxicity on P388 cells implanted in nude mice. The more rigid structure obtained, tolerated from a steric point of view, is favored by the entropic effect represented by the docking of an ordered and rigid ring system into its pocket in the ternary cleavable complex. 124 In addition, the presence of a sixth ring offers additional positions for the functionalization of the lead compound with a hydrophilic moiety. The compound DX-8951 f (Figure 7C) showed very good activity against a panel of 32 tumor cell lines. 125 It has activity on MDR overexpressing cell lines and inhibits tumor growth on gastric adenocarcinoma implanted in mice. This drug is therefore likely to become the prototype for new hexacyclic water soluble camptothecin derivatives with broad spectrum antitumor activity. All the semisynthetic derivatives obtained and developed, while successful in obtaining more potent and water-soluble derivatives, have failed in the intent of obtaining topoisomerase I poisons with simpler structures and devoid of the main limitation of camptothecin~the requirement for a very unstable and short-lived lactone ring. This problem, added to the likely onset of clinical resistance to camptothecin-like drugs, forms the basis for research on newer drugs able to target topoisomerase I and show antitumor activity.
IV. NEW TOPOISOMERASE I-TARGETING DRUGS Following the interest generated by camptothecin, a great deal of effort has been recently directed toward the discovery of natural and synthetic compounds able to target eukaryotic topoisomerase I. This research has indeed shown that many structurally diverse compounds inhibit the enzyme either by direct binding, like in the case of acidic phospholipids, 126 tannins, 127-I29 and the tyrosine kinase blocker tyrphostin, 13~ or by binding to the nucleic acid component. 131-133 The ability of such inhibitors to produce an antitumor effect is however marginal or unrelated to topoisomerase I inhibition, and, at the present moment, these compounds can be regarded merely as tools for studying the biochemical properties of the enzyme. From the increasingly large number of reports describing new topoisomerase I-targeting agents distinct from the camptothecin series, some of the compounds emerging are likely to be developed into preclinical and clinical candidates. Their varied chemical structures suggest a distinct mode of interaction either with the enzyme or with the cleavable complex, although the presence of planar rings could
54
BARBARA GATTO and LEROY FONG LIU
account for some of the similarities. In the case of type I drugs (poisons), a mechanism of action different from camptothecin is usually deduced by: (a) a different pattern of DNA cleavage, and (b) cytotoxicity toward camptothecin-resistant topoisomerase I mutants. Despite these properties however, the observed cytotoxic effect on sensitive tumor cell lines could not result solely from topoisomerase I poisoning. Unlike the extensively investigated camptothecin, these drugs are at an initial stage of investigation. More studies on their structure-activity relationships and, whenever possible, in model systems (e.g. yeast cells overexpressing human topoisomerase I) will be needed to establish unequivocably the involvement of topoisomerase I in their antitumor effect. As evidenced in Figures 8A and B, there are no prominent structural correlations among these compounds. A classification based on their activity distinguishes two broad categories: 1. Specific topoisomerase I poisons. 2. Dual topoisomerase I and II poisons.
A. Specific Topoisomerase I Poisons These compounds are denoted "specific" since, like camptothecin, they do not induce appreciable DNA cleavage in the presence of topoisomerase II. Differently from camptothecin, however, these compounds are either intercalators or minor groove binders, although the correlation between DNA sequence recognition and trapping of the cleavable complex is not always clear. Their marked DNA binding properties on the other hand account for a nonspecific inhibition of topoisomerase I and II catalytic functions.
Mono-, Bis- and Ter-benzimidazoles The bis-benzimidazole dyes, Hoechst 33258 and 33342, whose structure is reported in Figure 8A, are well-known synthetic compounds whose nucleic acid binding properties have been thoroughly investigated by spectroscopic, 134'135X-ray crystallography, 136 and footprinting 137'138 methods. The fluorescence quantum yield enhancement upon tight DNA binding is the basis of their wide use as chromosomal stains, and is related to nonintercalative binding into the dbuble-helix minor groove. The binding is highly specific for A+T sequences, and this selectivity accounts for the drug cytotoxicity to the Plasmodium falciparum agent of malaria, 139 whose genome is highly A+T rich. Thanks to their binding properties, the drugs can directly inhibit topoisomerase I and II catalytic activity either by template occupancy or by structural alteration of double-helical DNA. 132 Besides a modulating activity on enzyme-mediated DNA cleavage induced by classical topoisomerase poisons, 14~Hoechst dyes, as well as a series of bis-benzimidazole derivatives induce in vitro reversible DNA cleavage in the presence of mammalian topoisomerase 1.141-143 The cleavage is highly specific and sequencing analysis of the three
Topoisomerase I- Targeting Drugs
55
CH3~ N ~ " ' ~
A
-N H
O HC.
Hoechst 33258 Hoechst 33342
a
R=H R=C2Hs
NH I
HO OH
h
I-I
OH OH
NB-506
R=~ I ' ~ H
---0 0
OH OH
Bulgarein
(continued) Figure 8,4. New topoisomerase I-targeting drugs different from camptothecin. Specific topoisomerase I poisons.
strongest topoisomerase I-induced cleavage sites has evidenced the consensus sequence 5'-TCATITrT-3', with the cleavage occurring between T and C. 144 The highly specific motif in topoisomerase I trapped by Hoechst dyes has suggested the following model for the drug interaction in the cleavable complex. 145The enzymes main contacts are upstream of the cleavage site, while the drug interacts directly with the downstream sequence, consistently with its established preference for Aor T-tracts. 136-138The presence of C+ 1 is not detrimental to DNA binding, since a wider minor groove at GC base pairs can better accommodate the bulky piperazino ring. 136 Polarity in the drug binding to DNA is further suggested by the analysis of the DNA cleavage pattern induced by UV-A light irradiation of iodo-Hoechst 33258 complexed to DNA. 146The phenyl ring bearing the reactive iodine is preferentially positioned at the end of runs of four consecutive T's. 146 The drug could well be accommodated at the cleavage site with the orientation piperazino-bis-benzimidophenyl following the 5'-3' polarity of the consensus sequence mentioned above. This region is not implicated in tight binding with the enzyme, whose main contacts are upstream of the cleavage site. 45 The direct interaction of the phenyl moiety, known to protrude out of the DNA double helix, 136 with specific residues in the
56
BARBARA GATTO and LEROY FONG LIU
enzyme, and/or the alteration of the local DNA curvature upon drug binding, could be responsible for the observed poisoning effect. Steric constraints to the benzimidazole structure 14~are in accord with the hypothesis of a direct drug-DNA--enzyme interaction. Extensive structure-activity relationship studies on bis- and terbenzimidazoles have shown in fact that the drug size is crucial for the template occupancy/enzyme interaction: lengthening of the active terbenzimidazole with a phenyl ring oriented like in Hoechst 33342 abolishes the in vitro topoisomerase I activity. 141 Modulation in drug potency is achieved with subtle modification at the phenyl ring or with substitutions on the p-methyl-piperazynil moiety.141'142 A second DNA binding mode, less specific and responsible for binding to GC base pairs and to denatured calf thymus DNA, 135 could be responsible for the lack of correlation between topoisomerase I-induced DNA cleavage and the nucleic acid binding potency for each series of compounds. 144 It is noteworthy that the minimization of the lead compound to the monomeric benzimidazole abolishes topoisomerase I activity, unless hydrogen acceptor moieties sit at specific positions. These compounds do not bind DNA, as reflected by their DNA cleavage pattern, similar to that of camptothecin. 147 Benzimidazoles then, differently from their bis- and ter-analogues, represent a new family of topoisomerase I poisons unrelated to the minor groove binder. Although a preliminary structure-activity relationship study showed that their in vivo cytotoxicity could be due to multiple mechanisms, the advantages represented by the small structure, coupled with the lack of chemical lability, makes them potential lead compounds for the development of new classes of topoisomerase I-targeting drugs.
Indolocarbazole Derivatives These semisynthetic derivatives, whose structure is shown in Figure 8A, induce in vitro and in vivo formation of cleavable complexes in the presence of topoisom-
erase I. They inhibit DNA relaxation and this activity is related to their DNA binding properties. They are in fact intercalators, although their relative potencies, evaluated by DNA unwinding measurements and ethidium bromide displacements, do not correlate with their potencies in inducing topoisomerase I-mediated DNA cleavage. 148 Their cytotoxicity toward cultured mammalian cells is lower than camptothecin, but they are equally cytotoxic to parental and MDR expressing cells. 149'15~ The recently developed indolocarbazole NB-506, shown in Figure 8A, is a DNA intercalator that exhibits good potency in inducing topoisomerase I-mediated DNA cleavage in vitro 151 with no observable activity on topoisomerase II. It shows a remarkable cytotoxicity both in human tumor cell lines and in xenograft models. Thanks to its good activity both in leukemia cell lines and in solid tumors implanted 1 in mice, coupled to a low cumulative cytotoxicity, 152 .53 this compound represents a promising new candidate for clinical investigation, and has recently entered phase I clinical trials. 154
Topoisomerase I- Targeting Drugs
57
Bulgarein Bulgarein (Figure 8A) is a blue pigment whose ability to induce DNA cleavage in the presence of calf thymus topoisomerase I was identified during screening studies from cultures of actinomycetes and fungi. 155 Its potency in reversibly trapping the cleavable complex is similar to that of camptothecin, although the relative amounts of the DNA fragments produced by the two drugs are different. Contrary to camptothecin, high concentrations of bulgarein inhibits DNA cleavage, similarly to that observed for DNA binders like the Hoechst dye. 144 The DNA binding properties of bulgarein are peculiar in that the drug winds to DNA like the minor groove binder netropsin. Similarly to netropsin, the alteration of DNA structure upon drug binding accounts for the inhibition of topoisomerase I and II relaxation activity, ~55 but it is not clear how it affects its unique ability to induce topoisomerase I-mediated DNA cleavage. The mechanism of DNA winding induced by bulgarein could be unrelated to minor-groove binding and due to a unique interaction with DNA resulting in topoisomerase I poisoning. Bulgarein, were this hypothesis true, would represent a very interesting tool for the study of the enzymes' mechanism of action.
B. Dual Topoisomerase I and II Poisons These compounds are characterized by their ability to induce cleavable complexes with eukaryotic topoisomerase I and II, although to different extents. Actinomycin D, an intercalator with dual poisoning activity, 156and some anthracycline derivatives, like morpholinyldoxorubicin 156 and nogalamycin, 157 are topoisomerase I poisons that, upon appropriate chemical substitutions, can exhibit topoisomerase I or II activity. Since their cytotoxicity precludes clinical developments, they are regarded merely as interesting probes for investigating the nature of cleavable complex. Dual poisons are all, with the possible exception of the indoloquinolinedione azaIQD (Figure 8B), j58 DNA intercalators, but it is unclear how this is related to their topoisomerase I activity. What is lacking at the present moment is an unambiguous correlation between a drug's mode of DNA binding and topoisomerase I or II inhibition. Their ability to target both enzymes at the same time is intriguing for the possible combination of cytotoxic effects, although experiments using "classical" topoisomerase I and II poisons simultaneously show conflicting results. A synergistic effect on chromosome damage and cytotoxicity was observed using camptothecin with either m-AMSA or etoposide, 159'16~but data from other groups indicated an antagonistic rather than additive effect. 79'161'162 This antagonism results probably from the block of cell cycle progression by topoisomerase II drugs, that in turn lowers the population of S-phase cells, which are the preferential target of camptothecin. 79 On the other hand, it has been observed that simultaneous inhibition of topoisomerase I and II by dual inhibitors enhances the cytotoxicity of
58
B
BARBARA GATTO and LEROY FONG LIU
HO
tCH 3 IH(CH2)zN\cH 3
0
r'
OH
CH3
Intoplicine
0
OH OH
Saintopin
CH30~...."~.,.,,"'~/N~ CH3
CH3
Nitidine
Fagaronine OCH3 ,OCH3 CH30~'~~J~
CH30
CH30 ~..,'.~,,,,,"~/,,,-'-~
OCH3
Berberine
Coralyne R~
0
p
X=N M = OMe P, RI, R2=H
AzalQD Figure 8B. New topoisomerase I-targeting drugs different from camptothecin. Dual topoisomerase I and II poisons.
those compounds whose molecular interactions within the cleavable complex appear different from those of the "classical" poisons. 163
intoplicine Intoplicine is a polycyclic compound shown in Figure 8B, with very good antitumor activity, and it is presently the only dual poison in clinical trials. 164 Its cytotoxic properties on a variety of cultured tumor cell lines 165 indicate that the drug, despite being a candidate for mdr, like many topoisomerase II poisons, has
Topoisomerase I-Targeting Drugs
59
activity against cell lines with diminished intracellular content of topoisomerase II or with an altered form oftopoisomerase 1.165Structure-activity relationship studies on the intoplicine series showed that the dual poisoning activity correlates well with cytotoxicity, 163 while no such correlation was found for drugs having "pure" topoisomerase I or II cleavage potency. 163Dual poisoning by intoplicine seems thus to be critical for the antitumor effect, and could be linked to its particular mode of interaction in the ternary cleavable complex. The drug stimulates topoisomerase I and II cleavage at different sites, suggesting that different parts of the molecule interact with either enzyme. 163 This hypothesis is supported by the fact that the topoisomerase I and II poisoning effect can be modulated by appropriate substituents, 163 and such drug substitutions influence the binding mode of the drug to DNA. 166 Two modes of interaction with the nucleic acid have been evidenced by spectroscopic studies. 166A first "deep intercalation mode" is responsible for DNA unwinding, while an "outside" binding mode of the drug in the major groove through its hydroxyl moiety seems to be implicated in the drug interaction with topoisomerase II. The drug has affinity for topoisomerase II alone, but does not interact with topoisomerase I unless in the context of the ternary complex. The deep intercalation mode accounts for only 10% of the total bound intoplicine, but has the effect of altering both locally and at longer range, the nucleic acid structure; this structural alteration could in turn result in topoisomerase I poisoning. 166 The simultaneous presence of intoplicine and specific residues of topoisomerase II in the nucleic acid major groove would instead account for a direct drug-enzyme interaction resulting in the stabilization oftopoisomerase II cleavable complexes. 166 Besides its importance for the study of the general mechanism of action of topoisomerase-targeting drugs, intoplicine is the most developed compound among non-camptothecin-like agents. Although its phase I clinical trials evidenced a severe hepatotoxicity, 164,168 it showed preclinical activity against breast, non-small-cell and small-cell lung and ovarian cancer. 167
Saintopin Saintopin (Figure 8B) is a weak intercalator, as potent as VP-16 or m-AMSA in inducing cleavable complex formation in vitro in the presence of topoisomerase II, and with good potency in topoisomerase I poisoning. 169'17~Its cleavage pattern, different from that observed with other topoisomerase poisons, has been analyzed at the sequencing level, showing a strong preference for a guanine in position + 1 to the cleavage, both in the case of topoisomerase I and topoisomerase 11.171This preference, possibly due to the formation of hydrogen bonds between the drug hydroxyl group and the guanine at + 1, is not shared with other topoisomerase II poisons, but is the same exhibited by camptothecin, and could reflect a similar interaction of the two drugs in the cleavable complex. ~7~As postulated by a "drug stacking model" for topoisomerase II poisoning, 172stacking of the drug planar ring with both the enzyme catalytic tyrosine and the guanine/cytosine base pair at the intercalation site could account for direct interaction with topoisomerase I and II
60
BARBARA GATTO and LEROY FONG LIU
in the cleavable complex, resulting in the inhibition of both enzymes at the religation step. 171
Nitidine Derivatives Nitidine, whose structure is shown in Figure 8B, is a natural alkaloid with antitumor properties 173 able to stabilize topoisomerase I and II cleavable complexes. 174--176The DNA cleavage pattern induced by nitidine and its derivative fagaronine is similar to that of camptothecin, although their potency is slightly lower. 174Nitidine unwinds DNA, but that does not correlate with the topoisomerase I cleavage ability. 175 Intercalation is evidenced by the presence of discrete and specific bands in its topoisomerase II-induced cleavage of plasmid DNA. 176 The sequencing of these sites and the comparison with the actual DNA binding preference exhibited by nitidine is needed to clarify how intercalation affects topoisomerase II-induced DNA cleavage. Nitidine is selectively cytotoxic to yeast cells expressing human topoisomerase I, suggesting that the main target responsible for cell killing is topoisomerase I and not 11.176However, a structure-activity relationship study on nitidine derivatives clearly showed that very simple modifications to the methoxy groups can modulate the dual activity in in vitro assay, and that cytotoxicity against camptothecin sensitive and resistant cell lines correlates with dual poisoning. 177 Berberine Derivatives
Berberine is another natural alkaloid with a wide variety of pharmacological actions. 178 Its structural similarities to nitidine prompted the investigation on the topoisomerase poisoning activity of a series of berberine derivatives. 179,180Berberine exhibits a weak potency in inducing DNA cleavage by topoisomerases, but topoisomerase I or II poisoning can be modulated by hydroxyl or methoxyl moieties at appropriate positions. 179'18~The nature and position of these substituting groups are critical for the modulation of berberines activity. In fact the most potent compound in the series, coralyne, 181 cannot be considered a dual poison, 176 since its ability to stabilize the cleavable complex in the presence of topoisomerase II is only apparent at much higher concentrations than those needed for inducing topoisomerase I-mediated DNA cleavage. Consistent with this observation, a c!osely related coralyne derivative, methylenedioxy-dihydro-demethyl-coralyne, is highly cytotoxic to yeast cells expressing human topoisomerase I. 176 Despite being a strong intercalator, 182 coralyne's pattern of DNA cleavage is the same exhibited by camptothecin, although its cytotoxicity to camptothecin resistant cell lines at high doses seems to indicate that another target, distinct from topoisomerases, could be involved. Their ability in overcoming mdr makes them very interesting lead structures for further development, both as specific or, depending on the substitutions, dual topoisomerase poisons.
Topoisomerase I-Targeting Drugs
61
Indoloquinoflnediones AzalQD (Figure 8B) is the most interesting compound of a series of indoloquinolinedione derivatives tested for their ability to poison topoisomerases. ~58 It stimulates topoisomerase I-mediated DNA cleavage similarly to camptothecin, although with lower potency, and is a weak inducer of topoisomerase II poisoning. Consistently with the in vitro data, studies in yeast cells expressing human topoisomerase I showed that topoisomerase I poisoning is responsible for the drugs cytotoxic effect, although this may be due to low permeability, to a much lesser extent than camptothecin. 158 The drug does not unwind DNA, and does not show experimentally detectable DNA binding properties. Further synthetic development will exploit the potential antitumor properties of these derivatives.
V. CONCLUDING REMARKS The field of cancer pharmacology gained a new protagonist with camptothecin. Effort in understanding the molecular basis of its action, coupled to the interest in exploiting its antitumor properties, brought interaction between different disciplines in the basic sciences with the applied clinical sciences. The resulting effect has been synthetic development of derivatives with better pharmacokinetic profiles, and the evaluation of more efficient administration protocols. More derivatives are likely to be developed in the future: they will bring their contribution to the unveiling of the drugs mechanism of action or, if they find their way to the clinical practice, to the fight against cancer. The picture in the field of new topoisomerase I-targeting drugs distinct from camptothecin is still not well defined. Despite being at an initial and somehow confusing stage in their development, among all the different chemical structures and seemingly different mechanisms of action examined, some patterns are emerging. A better understanding of their role as new antitumor drugs will be achieved by more extensive investigations of their molecular mechanisms of action. In particular, the role of DNA binding in directing topoisomerase I cleavable complex trapping by the new drugs needs further investigation, and should be correlated to their cytotoxic properties. Although few of these compounds will prove to possess all the requisites to enter in vivo experimentation and, eventually, clinical practice, they are indeed interesting probes for studying the enzymes activity. Besides biochemical importance, however, they might possess selective activity against topoisomerase I of different pathogenic organisms, like fungi or parasites. The chapter of topoisomerase I-targeting drugs is therefore likely to expand soon from cancer chemotherapy into other branches of pharmacology.
REFERENCES 1. Liu, L. E Annu. Rev. Biochem. 1989, 58, 351. 2. Gellert, M. Annu. Rev. Biochem. 1981, 50, 879.
62 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44.
BARBARA GATTO and LEROY FONG LIU Reece, R. J.; Maxwell, A. Crit. Rev. Biochem. Mol. Biol. 1991, 26, 335. Wang, J. C. Annu. Rev. Biochem. 1996, 65, 635. Wang, J. C. J. Mol. Biol. 1969, 43, 263. Drolet, M.; Wu, H. Y.; Liu, L. E In Advances in Pharmacology; Liu, L.F., Ed.; Academic: San Diego, 1994, Vol. 29A, p.135. Nitiss, J. L. In Advances in Pharmacology; Liu, UF., Ed.; Academic: San Diego, 1994, Vol. 29A, p.103. Ikeda, H. In Advances in Pharmacology; Liu, L.F., Ed.; Academic: San Diego, 1994, Vol. 29A, p.147. Froelich, A. S.; Osheroff, N. J. Biol. Chem. 1995, 270, 21429. Been, M. D.; Champoux, J. J. Nucleic Acids Res. 1980, 8, 6129. Wang, J. C. InAdvances in Pharmacology; Liu, L.E, Ed.; Academic: San Diego, 1994, Vol. 29A, p.1. Stewart, L.; Ireton, G. C.; Champoux, J. J. J. Biol. Chem. 1996, 271, 7602. Sharma, A.; Hanai, R.; Mondragon, A. Structure 1994, 2, 767. Lue, N.; Sharma, A.; Mondragon, A.; Wang, J. C. Structure 1995, 3, 1315. Nelson, E. M.; Tewey, K. M.; Liu, L. E Proc. Natl. Acad. Sci. USA 1984, 81, 1361. Tewey, K. M.; Chen, G. L.; Nelson, E. M.; Liu, L. F. J. Biol. Chem. 1984, 259, 9182. Pommier, Y.; Zwelling, L. A.; Mattern, M. R.; Erickson, L. C.; Kerrigan, D.; Schwartz, R.; Kohn, K. W. Cancer Res. 1983, 43, 5718. Shen, L. U; Baranowski, J.; Fostel, J.; Montgomery, D. A.; Lartey, P. A. Antimicrob. Agents Chemother. 1992, 36, 2778. Bodley, A. L.; Shapiro, T. A. Proc. Natl. Acad. Sci. USA 1995, 92, 3726. Bodley, A. L.; Wani, M. C.; Wall, M. E.; Shapiro, T. A. Biochem. Pharmacol. 1995, 50, 937. Fostel, J.; Montgomery, D. Antimicrob. Agents Chemother. 1995, 39, 586. Ishimi, Y.; Ishida, R.; Andoh, T. Mol. Cell Biol. 1992, 12, 4007. Champoux, J. J.; Dulbecco, R. Proc. Natl. Acad. Sci. USA 1972, 69, 143. Kim, R. A.; Wang, J. C. J. Mol. Biol. 1989, 208, 257. Liu, L. F.; Wang, J. C. Proc. Natl. Acad. Sci. USA 1987, 84, 7024. Nitiss, J.; Wang, J. C. Proc. Natl. Acad. Sci. USA 1988, 85, 7501. Goto, T.; Wang, J. C. Proc. Natl. Acad. Sci. USA 1985, 82, 7178. Lee, M. P.; Brown, S. D.; Chen, A.; Hsieh, T. S. Proc. Natl. Acad .Sci. USA 1993, 90, 6656. Champoux, J. J. In Advances in Pharmacology; Liu, L.F., Ed.; Academic: San Diego, 1994, Vol. 29A, p.71. Zhu, J.; Schiestl, R. H. Mol. Cell. Biol. 1996, 16, 1805. Mills, J. S.; Busch, H.; Durban, E. Biochem. Biophys. Res. Commun. 1982, 109, 1222. Durban, E.; Goodenough, M.; Mills, J.; Busch, H. EMBO J. 1985, 4, 2921. D'Arpa, P.; Liu, L. F. Exp. Cell Res. 1995, 217, 125. Kaufmann, S. H.; Charron, M.; Burke, P. J.; Karp, J. E. Cancer Res. 1995, 55, 1255. Durban, E.; Mills, J. S.; Roll, D.; Busch, H. Biochem. Biophys. Res. Commun. 1983, ~11,897. Ferro, A. M.; Olivera, B. M. J. Biol. Chem. 1984, 259, 547. Kasid, U. N.; Halligan, B.; Liu, L. E; Dritschilo, A.; Smulson, M. J. Biol. Chem. 1989, 264, 18687. Althaus, E R.; Richter, C. Mol. Biol. Biochem. Biophys. 1987, 37, 1. Rossi, F.; Labourier, E.; Fome, T.; Divita, G.; Derancourt, J.; Riou, J. E; Antoine, E.; Cathala, G.; Brunel, C.; Tazi, J. Nature 1996, 381, 80. Hsieh, T.; Lee, M. P.; Brown, S. D. In Advances in Pharmacology; Liu, L.F., Ed.; Academic: San Diego, 1994, Vol. 29A, p.l 91. Maxwell, A.; Gellert, M. Adv. Protein. Chem. 1986, 38, 69. Been, M. D.; Champoux, J. J. Proc. Natl. Acad. Sci. USA 1981, 78, 2883. Been, M. D.; Burgess, R. R.; Champoux, J. J. Nucleic Acids Res. 1984, 12, 3097. Stevnsner, T.; Mortensen, U. H.; Westergaard, O.; Bonven, B. J. J. Biol. Chem. 1989, 264, 10110.
Topoisomerase I-Targeting Drugs
63
45. Svejstrup, J. Q.; Christiansen, K.; Andersen, A. H.; Lund, K.; Westergaard, O. J. Biol. Chem. 1990, 265, 12529. 46. Halligan, B. D.; Davis, J. L.; Edwards, K. A.; Liu, L. F. J. Biol. Chem. 1982, 257, 3995. 47. Krogh, S.; Mortensen, U. H.; Westergaard, O.; Bonven, B. J. Nucleic Acids Res. 1991, 19, 1235. 48. Camilloni, G.; Caserta, M.; Amadei, A.; Di, M. E. Biochim. Biophys. Acta 1991, 1129, 73. 49. Brown, P. O.; Cozzarelli, N. R. Proc. Natl. Acad. Sci. USA 1981, 78, 843. 50. Hsiang, Y. H.; Hertzberg, R.; Hecht, S.; Liu, L. F. J. Biol. Chem. 1985, 260, 14873. 51. Porter, S. E.; Champoux, J. J. Nucleic Acids Res. 1989, 17, 8521. 52. Wall, M. E. et al. J. Am. Chem. Soc. 1966, 88, 3888. 53. Moertel, C. et al. Cancer Chemother. Rep. 1972, 56, 95. 54. Hertzberg, R. P.; Caranfa, M. J.; Hecht, S. M. Biochemistry 1989, 28, 4629. 55. Jaxel, C.; Kohn, K. W.; Wani, M. C.; Wall, M. E.; Pommier, Y. Cancer Res. 1989, 49, 1465. 56. Bjomsti, M. A.; Benedetti, P.; Viglianti, G. A.; Wang, J. C. Cancer Res. 1989, 49, 6318. 57. Andoh, T.; Ishii, K.; Suzuki, Y.; Ikegami, Y.; Kusunoki, Y.; Takemoto, Y.; Okada, K. Proc. Natl. Acad. Sci. USA 1987, 84, 5565 58. Tanizawa, A.; Pommier, Y. Cancer Res. 1992, 52, 1848. 59. Gupta, R. S.; Gupta, R.; Eng, B.; Lock, R. B.; Ross, W. E.; Hertzberg, R. P.; Caranfa, M. J.;Johnson, R. K. Cancer Res. 1988, 48, 6404. 60. Kjeldsen, E.; Bonven, B. J.; Andoh, T.; Ishii, K.; Okada, K.; Bolund, L.; Westergaard, O. J. Biol. Cheml 1988, 263, 3912. 61. Sugimoto, Y.; Tsukahara, S.; Oh, h. T.; Isoe, T.; Tsuruo, T. Cancer Res. 1990, 50, 6925. 62. Hsiang, Y. H.; Wu, H. Y.; Liu, L. F. Cancer Res. 1988, 48, 3230. 63. Heck, M. M.; Hittelman, W. N.; Earnshaw, W. C. Proc. Natl. Acad. Sci. USA 1988, 85, 1086. 64. Potmesil, M.; Hsiang, Y. H.; Liu, L. F.; Bank, B.; Grossberg, H.; Kirschenbaum, S.; Forlenza, T. J.; Penziner, A.; Kanganis, D.; Forlenzar; TJ et, a.1. Cancer Res. 1988, 48, 3537. 65. Giovanella, B. C.; Stehlin, J. S.; Wall, M. E.; Wani, M. C.; Nicholas, A. W.; Liu, L. F.; Silber, R.; Potmesil, M. Science 1989, 246, 1046. 66. Costin, D.; Potmesil, M. In Advances in Pharmacology; Liu, L.F., Ed.; Academic: San Diego, 1994, Vol. 29B, p.51 67. Eckardt, J. et al. Contemp. Oncol. 1993, 47 68. Pantazis, P. Leuk Res. 1995, 19, 775. 69. Dahut, W.; Harold, N.; Takimoto, C.; Allegra, C.; Chen, A.; Hamilton, J. M.; Arbuck, S.; Sorensen, M.; Grollman, E; Nakashima, H.; Lieberman, R.; Liang, M.; Corse, W.; Grem, J. J. Clin. Oncol. 1996, 14, 1236. 70. Rowinsky, E. K.; Grochow, L. B.; Sartorius, S. E.; Bowling, M. K.; Kaufmann, S. H.; Peereboom, D.; Donehower, R. C. J. Clin. Oncol. 1996, 14, 1224. 71. Bramwell, V. H.; Eisenhauer, E. A.; Blackstein, M.; Boos, G.; Knowling, M.; Jolivet, J.; Bogues, W. Ann. Oncol. 1995, 6, 847. 72. Creemers, G. J.; Wanders, J.; Gamucci, T.; Vallentin, S.; Dirix, L. Y.; Schoffski, P.; Hudson, I.; Verweij, J. Ann. Oncol. 1995, 6, 844. 73. Rothenberg, M. L.; Eckardt, J. R.; Kuhn, J. G.; Bums, H. 3.; Nelson, J.; Hilsenbeck, S. G.; Rodriguez, G. I.; Thurman, A. M.; Smith, L. S.; Eckhardt, S. G.; Weiss, G. R.; Elfring, G. U; Rinaldi, D. A.; Schaaf, L. J.; Von, H. D. J. Clin. Oncol. 1996, 14, 1128. 74. Husain, I.; Mohler, J. L.; Seigler, H. F.; Besterman, J. M. Cancer Res. 1994, 54, 539. 75. McLeod, H. L.; Douglas, F.; Oates, M.; Symonds, R. P.; Prakash, D.; van der Zee, Ag; Kaye, S. B.; Brown, R.; Keith, W. N. Int. J. Cancer 1994, 59, 607. 76. Kjeldsen, E.; Svejstrup, J. Q.; Gromova, I. I.; Alsner, J.; Westergaard, 0. J. Mol. Biol. 1992, 228, 1025. 77. Pommier, Y.; Jenkins, J.; Kohlhagen, G.; Leteurtre, F. Mutat Res. 1995, 337, 135. 78. Hsiang, Y. H.; Lihou, M. G.; Liu, L. E Cancer Res. 1989, 49, 5077. 79. D'Arpa, P.; Beardmore, C.; Liu, L. F. Cancer Res. 1990, 50, 6919.
64
BARBARA GATTO and LEROY FONG LIU
80. Kauh, E. A.; Bjomsti, M. A. Proc. Natl. Acad. Sci. USA 1995, 92, 6299. 81. Fukada, M. Biochem. Pharmacol. 1985, 34, 1225. 82. Caron, P.; Wang, J. In Molecular Biology of DNA Topoisomerases and Its Application to Chemotherapy; Andoh, T.; Ikeda, H.; Oguro, M., Eds.; CRC: Boca Raton, FL 1993, P.I 83. Morham, S. G.; Shuman, S. J. Biol. Chem. 1992, 267, 15984. 84. Knab, A. M.; Fertala, J.; Bjornsti, M. A. J. Biol. Chem. 1993, 268, 22322. 85. Fujimori, A.; Harker, W. G.; Kohlhagen, G.; Hoki, Y.; Pommier, Y. Cancer Res. 1995, 55, 1339. 86. Wang, L.-E et al. Isolation and Characterization of A2780 Ovarian Cancer Cells Resistant to Camptothecin. In Proc. of The 5th Conference on DNA Topoisomerase in Therapy, New York, NY, 1994. 87. Kanzawa, F.; Sugimoto, Y.; Minato, K.; Kasahara, K.; Bungo, M.; Nakagawa, K.; Fujiwara, Y.; Liu, L. E; Saijo, N. Cancer Res. 1990, 50, 5919. 88. Kubota, N.; Kanzawa, F.; Nishio, K.; Takeda, Y.; Ohmori, T.; Fujiwara, Y.; Terashima, Y.; Saijo, N. Biochem. Biophys. Res. Commun. 1992, 188, 571. 89. Tamura, H.; Kohchi, C.; Yamada, R.; Ikeda, T.; Koiwai, O.; Patterson, E.; Keene, J. D.; Okada, K.; Kjeldsen, E.; Nishikawa, K.; et, a.l. Nucleic Acids Res. 1991, 19, 69. 90. Andoh, T.; Okada, K. In Advances in Pharmacology; Liu, L.F., Ed.; Academic: San Diego, 1994, , Vol. 29A, p.93. 91. Gromova, I. I.; Kjeldsen, E.; Svejstrup, J. Q.; Alsner, J.; Christiansen, K.; Westergaard, O. Nucleic Acids Res. 1993, 21,593. 92. Gupta, M.; Zhu, C. X.; Tse, D. Y. J. Biol. Chem .1992, 267, 24177. 93. Benedetti, P.; Fiorani, P.; Capuani, L.; Wang, J. C. Cancer Res. 1993, 53, 4343. 94. Rubin, E.; Pantazis, P.; Bharti, A.; Toppmeyer, D.; Giovanella, B.; Kufe, D. J. Biol. Chem. 1994, 269,2433. 95. Levin, N. A.; Bjomsti, M. A.; Fink, G. R. Genetics 1993, 133, 799. 96. Yeh, Y. C.; Liu, H. E; Ellis, C. A.; Lu, A. L. J. Biol. Chem. 1994, 269, 15498. 97. Wani, M. C.; Ronman, P. E.; Lindley, J. T.; Wall, M. E. J. Med. Chem. 1980, 23, 554. 98. Mi, Z.; Burke, T. G. Biochemistry 1994, 33, 10325. 99. Mi, Z.; Burke, T. G. Biochemistry 1994, 33, 12540. 100. Wall, M. E.; Wani, M. C. Annu. Rev. Pharmacol. Toxicol. 1977, 17, 117. 101. Jew, S. S. et al. Bioorg. Med. Chem. Lett. 1996, 6, 849. 102. Snyder, L. et al. J. Org. Chem. 1994, 59, 7033. 103. Wall, M.; Wani, M. In DNA Topoisomerases in Cancer; Potmesil, M.; Kohn, K., Eds.; Oxford University: New York, 1991, p.93. 104. Kurihara, T. et al. J. Heterocycl. Chem. 1993, 30, 643. 105. Crow, R. T.; Crothers, D. M. J. Med. Chem. 1992, 35, 4160. 106. Sugimori, M. et al. Heterocycles 1994, 38, 81. 107. Lackey, K.; Besterman, J. M.; Fletcher, W.; Leitner, P.; Morton, B.; Sternbach, D. D. J. Med. Chem. 1995, 38, 906. 108. Peel, M. R.; Stembach, D. D. Bioorg. Med. Chem. Lett. 1994, 4, 2753. 109. Zhao, R. L.; Oreski, B.; Lown, J. W. Bioorg. Med. Chem. Lett. 1995, 5, 3063. 110. Kingsbury, W. D.; Boehm, J. C.; Jakas, D. R.; Holden, K. G.; Hecht, S. M.; Gallagher, G.; Caranfa, M. J.; McCabe, E L.; Faucette, L. F.; Johnson, R. K.; et al. J. Med. Chem. 1991, 34, 98. 111. Hertzberg, R. P.; Busby, R. W.; Caranfa, M. J.; Holden, K. G.; Johnson, R. K.; Hecht, S. M.; Kingsbury, W. D. J. Biol. Chem. 1990, 265, 19287. 112. Tanizawa, A.; Kohn, K. W.; Kohlhagen, G.; Leteurtre, E; Pommier, Y. Biochemistry 1995, 34, 7200. 113. Sawada, S.; Nokata, K.; Furuta, T.; Yokokura, T.; Miyasaka, T. Chem. Pharm. BulL (Tokyo) 1991, 39, 2574. 114. Sawada, S.; Matsuoka, S.; Nokata, K.; Nagata, H.; Furuta, T.; Yokokura, T.; Miyasaka, T. Chem. Pharm. Bull. (Tokyo) 1991, 39, 3183.
TopoisomeraseI-TargetingDrugs
65
115. Abigerges, D.; Chabot, G. G.; Armand, J. P.; Herait, P.; Gouyette, A.; Gandia, D. J. Clin. Oncol. 1995, 13, 210. 116. Pommier, Y.; Kohlhagen, G.; Kohn, K. W.; Leteurtre, F.; Wani, M. C.; Wall, M. E. Proc. Natl. Acad. Sci. USA 1995, 92, 8861. 117. Wall, M. E.; Wani, M. C.; Nicholas, A. W.; Manikumar, G.; Tele, C.; Moore, L.; Truesdale, A.; Leitner, P.; Besterman, J. M. J. Med. Chem. 1993, 36, 2689. 118. Luzzio, M. J.; Besterman, J. M.; Emerson, D. L.; Evans, M. G.; Lackey, K.; Leitner, P. L.; Mclntyre, G.; Morton, B.; Myers, P. L.; Peel, M.; et, a. 1. J. Med. Chem. 1995, 38, 395. 119. Emerson, D. L.; Besterman, J. M.; Brown, H. R.; Evans, M. G.; Leitner, P. P.; Luzzio, M. J.; Shaffer, J. E.; Sternbach, D. D.; Uehling, D.; Vuong, A. Cancer Res. 1995, 55, 603. 120. Gerrits, C. J.; Creemers, G. J.; Schellens, J. H.; Wissel, P.; Planting, A. S.; Kunka, R.; Selinger, K.; de, B.; Dennert, M.; Marijnen, Y.; Harteveld, M.; Verweij, J. Br. J. Cancer 1996, 73, 744. 121. Lackey, K.; Sternbach, D. D.; Croom, D. K.; Emerson, D. L. ;Evans, M. G.; Leitner, P. L.; Luzzio, M. J.; Mclntyre, G.; Vuong, A.; Yates, J.; Besterman, J. M. J. Med. Chem. 1996, 39, 713. 122. Uehling, D. E.; Nanthakumar, S. S.; Croom, D.; Emerson, D. L.; Leitner, P. P.; Luzzio, M. J.; Mclntyre, G.; Morton, B.; Profeta, S.; Sisco, J.; et al. J. Med. Chem. 1995, 38, 1106. 123. Peel, M. R. et al. Bioorg. Med. Chem. Lett. 1995, 5, 2129 124. Sugimori, M.; Ejima, A.; Ohsuki, S.; Uoto, K.; Mitsui, I.; Matsumoto, K.; Kawato, Y.; Yasuoka, M.; Sato, K.; Tagawa, H.; et al. J. Med. Chem. 1994, 37, 3033. 125. Mitsui, I.; Kumazawa, E.; Hirota, Y.; Aonuma, M.; Sugimori, M.; Ohsuki, S.; Uoto, K.; Ejima, A.; Terasawa, H.; Sato, K. J1m. J. Cancer Res. 1995, 86, 776. 126. Tamura, H.; Ikegami, Y.; Ono, K.; Sekimizu, K.; Andoh, T. FEBS Lett 1990, 261, 151. 127. Bastow, K. E; Bori, I. D.; Fukushima, Y.; Kashiwada, Y.; Tanaka, T.; Nonaka, G.; Nishioka, I.; Lee, K. H. Planta Med. 1993, 59, 240. 128. Berry, D. E. et al. J. Org. Chem. 1992, 57, 420. 129. Hecht, S. M.; Berry, D. E.; MacKenzie, L. J.; Busby, R. W.; Nasuti, C. A. J. Nat. Prod. 1992, 55, 401. 130. Aflalo, E.; Iftach, S.; Segal, S.; Gazit, A.; Priel, E. Cancer Res. 1994, 54, 5138. 131. Crow, R. T.; Crothers, D. M.J. Med. Chem. 1994,37, 3191. 132. McHugh, M. M.; Woynarowski, J. M.; Sigmund, R. D.; Beerman, T. A. Biochem. Pharmacol. 1989, 38, 2323. 133. Pommier, Y.; Covey, J. M.; Kerrigan, D.; Markovits, J.; Pham, R. Nucleic Acids Res. 1987, 15, 6713. 134. Mikhailov, M. V.; Zasedatelev, A. S.; Krylov, A. S.; Gurskii, G. V. Mol. Biol. (Mosk) 1981, 15, 69O. 135. Stokke, T.; Steen, H. B. J. Histachem. Cytochem. 1985, 33, 333. 136. Pjura, P. E.; Grzeskowiak, K.; Dickerson, R. E. J. Mol. Biol. 1987, 197, 257. 137. Harshman, K. D.; Dorvan, P. B. Nucleic Acids Res. 1985, 13, 4825. 138. Portugal, J.; Waring, M. J. Biochim. Biophys. Acta 1988, 949, 158. 139. Ginsburg, H.; Nissani, E.; Krugliak, M.; Williamson, D. H. Mol. Biochem. Parasitol. 1993, 58, 7. 140. Woynarowski, J. M.; McHugh, M.; Sigmund, R. D.; Beerman, T. A. Mol. Pharmacol. 1989, 35, 177. 141. Sun, Q.; Gatto, B.; Yu, C.; Liu, A.; Liu, L. F.; LaVoie, E. J. J. Med. Chem. 1995, 38, 3638. 142. Kim, J. S.; Gatto, B.; Yu, C.; Liu, A.; Liu, L. F.; LaVoie, E. J. J. Med. Chem. 1996, 39, 992. 143. Sun, Q. et al. Bioorg. Med. Chem. Lett. 1994, 4, 2871. 144. Chen, A. Y.; Yu, C.; Gatto, B.; Liu, L. E Proc. Natl. Acad. Sci. USA 1993, 90, 8131. 145. Chen, A. Y.; Liu, L. E Annu. Rev. Pharmacol. Toxicol. 1994, 34, 191. 146. Murray, V.; Martin, R. F. Nucleic Acids Res. 1994, 22, 506. 147. Kim, J. S.; Sun, Q.; Gatto, B.; Yu, C.; Liu, A.; Liu, U F.; LaVoie, E. J. Bioorg. Med. Chem. 1996, 4, 621.
66
BARBARA GATTO and LEROY FONG LIU
148. Yamashita, Y.; Fujii, N.; Murakata, C.; Ashizawa, T.; Okabe, M.; Nakano, H. Biochemistry 1992, 31, 12069. 149. Yoshinari, T.; Yamada, A.; Uemura, D.; Nomura, K.; Arakawa, H.; Kojiri, K.; Yoshida, E.; Suda, H.; Okura, A. Cancer Res. 1993, 53, 490. 150. Arakawa, H.; Iguchi, T.; Yoshinari, T.; Kojiri, K.; Suda, H.; Okura, A. Jpn. J. Cancer Res. 1993, 84, 574. 151. Yoshinari, T.; Matsumoto, M.; Arakawa, H.; Okada, H.; Noguchi, K.; Suda, H.; Okura, A.; Nishimura, S. Cancer Res. 1995, 55, 1310. 152. Arakawa, H.; Iguchi, T.; Morita, M.; Yoshinari, T.; Kojiri, K.; Suda, H.; Okura, A.; Nishimura, S. Cancer Res. 1995, 55, 1316. 153. Kanzawa, F.; Nishio, K.; Kubota, N.; Saijo, N. Cancer Res. 1995, 55, 2806. 154. Arakawa, H.; Matsumoto, H.; Morita, M.; Sasaki, M.; Taguchi, K.; Okura, A.; Nishimura, S. Jpn. J. Cancer Res. 1996, 87, 518. 155. Fujii, N." Yamashita, Y.; Saitoh, Y." Nakano, H. J. Biol. Chem. 199~, 268, 13160. 156. Wassermann, K.; Markovits, J.; Jaxel, C.; Capranico, G.; Kohn, K. W.; Pommier, Y. Mol. Pharmacol. 1990, 38, 38. 157. Chen, A. Y. et al. Proc. Am. Ass. Cancer Res. 1994, 35, 456. 158. Riou, J. F.; Helissey, P.; Grondard, L.; Giorgi, R. S. Mol. PharmacoL 1991, 40, 699. 159. Taudou, G.; Portemer, C.; Jaxel, C.; Duguet, M. Biochem. Pharmacol. 1993, 45, 331. 160. Cortes, E; Pinero, J. Cancer Chenu~ther. Pharmacol. 1994, 34, 411. 161. Kaufmann, S. H. Cancer Res. 1991, 51, 1129. 162. Masumoto, N.; Nakano, S.; Esaki, T.; Tatsumoto, T.; Fujishima, H.; Baba, E.; Nakamura, M.; Niho, Y. Anticancer Res. 1995, 15, 405. 163. Riou, J. E; Fosse, P.; Nguyen, C. H.; Larsen, A. K.; Bissery, M. C.; Grondard, L.; Saucier, J. M.; Bisagni, E.; Lavelle, E Cancer Res. 1993, 53, 5987. 164. Von, H. D.; Bums, H. 3.; Eckardt, J.; Rothenberg, M.; Fields, S. M.; Chen, S. F.; Kuhn, J. G. Cancer Chemother. Pharmacol. 1994, 34(S), $41. 165. Poddevin, B.; Riou, J. E; Lavelle, E; Pommier, Y. Mol. Pharmacol. 1993, 44, 767. 166. Nabiev, I.; Chourpa, I.; Riou, J. F.; Nguyen, C. H.; Lavelle, F.; Manfait, M. Biochemistry 1994, 33, 9013. 167. Eckardt, J. R.; Bums, H. 3.; Kuhn, J. G.; Bissery, M. C.; Klink, A. M.; Clark, G. M.; Von, H. D. J. Natl. Cancer Inst. 1994, 86, 30. 168. Abigerges, D.; Armand, J. P.; Chabot, G. G.; Bruno, R.; Bissery, M. C.; Bayssas, M.; Klink, A. M.; Clavel, M.; Catimel, G. Anticancer Drugs 1996, 7, 166. 169. Yamashita, Y.; Saitoh, Y.; Ando, K.; Takahashi, K.; Ohno, H.; Nakano, H. J. Antibiot. (Tokyo) 1990, 43, 1344. 170. Yamashita, Y.; Kawada, S.; Fujii, N.; Nakano, HI Biochemistry 1991, 30, 5838. 171. Leteurtre, E; Fujimori, A.; Tanizawa, A.; Chhabra, A.; Mazumder, A.; Kohlhagen, G.; Nakano, H.; Pommier, Y. J. Biol. Chem. 1994, 269, 28702. 172. Pommier, Y.; Capranico, G.; Orr, A.; Kohn, K. W. Nucleic Acids Res. 1991, 19, 5973. 173. Simeon, S.; Rios, J. L.; Villar, A. Pharmazie 1989, 44, 593. 174. Fang, S.-H.; Wang, L.-K; Hecht, S. J. Org. Chem. 1993, 58, 5025. 175. Wang, L. K.; Johnson, R. K.; Hecht, S. M. Chem. Res. Toxicol. 1993, 6, 813. 176. Gatto, B.; Sanders, M. M.; Yu, C.; Wu, H. Y.; Makhey, D.; LaVoie, E. J.; Liu, L. F. Cancer Res. 1996, 56, 2795. 177. Janin, Y. L.; Croisy, A.; Riou, J. F.; Bisagni, E. J. Med. Chem. 1993, 36, 3686. 178. Bhakkuni, D.; Jain, S. The Alkaloid; Brossi, A., Ed.; Academic Press; New York, 1986, Vol. 28, p.95. 179. Makhey, D. et al. Med. Chem. Res. 1994, 5, 1. 180. Makhey, D.; Gatto, B.; Yu, C.; Liu, A.; Liu, L. E; LaVoie, E. J. Bioorg. Med. Chem. 1996, 4, 781. 181. Wang, L. K.; Rogers, B. D.; Hecht, S. M. Chem. Res. Toxicol. 1996, 9, 75. 182. Wilson, W. D.; Gough, A. N.; Doyle, J. J.; Davidson, M. W. J. Med. Chem. 1976, 19, 1261.
DNA SEQUENCE RECOGNITION ALTERED BIS-BENZIMIDAZOLE MINOR-GROOVE BINDERS
J. William Lown
I. II. III.
IV.
V.
VI.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Design and Synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . DNA Binding and Sequence Recognition Properties . . . . . . . . . . . . . . . A. DNA Binding Properties . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Sequence Preferential Binding . . . . . . . . . . . . . . . . . . . . . . . . Structural Analysis of Ligand-DNA Interactions . . . . . . . . . . . . . . . . . A. NMR Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. FTIR Study of Specific Binding Interactions between Hoechst Analogues and Polynucleotides . . . . . . . . . . . . . . . . . . . . . . . C. Discrimination between Groove Binding and Intercalation of Ligands by Electric Linear Dichroism . . . . . . . . . . . . . . . . . . . . Cellular and Pharmacological Effects . . . . . . . . . . . . . . . . . . . . . . . A. In Vitro Cytotoxicity of Bis-benzimidazoles . . . . . . . . . . . . . . . . . B. In Vivo Anticancer Activity of Bis-benzimidazoles . . . . . . . . . . . . . C. Cellular Effects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Conclusions and Prospects . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Advances in DNA Sequence-Specific Agents Volume 3, pages 67-95 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8 67
68 70 73 73 73 77 77 81 82 87 87 88 89 93 93 93
68
J. WILLIAM LOWN I.
INTRODUCTION
Recently it has become evident that DNA sequence selectivity is an important component contributing to the cytotoxic potency of several chemotherapeutic agents derived from natural sources. Examples include: the pyrrolo(1,4)-benzodiazepinone antitumor antibiotics, 1 saframycins, 2 CC-1065, 3 calicheamicin, 4 and bleomycin. 5 Therefore the question arises whether one could tailor the binding preference of DNA binding agents to particular base sequences and thereby produce new drugs that might prove effective clinically and complement efforts in the triple helix antigene area. Recent advances in our understanding of molecular recognition between ligands and nucleic acids, together with the advent of new DNA sequencing and footprinting methodology and molecular modeling, afford an approach to the design of sequence-selective agents. 6-11 In contrast to the situation with control proteins, many low molecular weight antiviral, antibiotic, or anticancer agents and several xenobiotics appear to bind in the minor-groove of the DNA double helix, possibly because it represents an accessible region in the macromolecular receptor. The minor groove thus represents a vulnerable site of attack, in that it is normally unoccupied, and this is presumably the reason for the evolution of antibiotics to attack the DNA of competing organisms. Thus, although minor-groove binders are, at first sight, less attractive as probes in that they target the less information-rich minor groove, they may nevertheless prove to have several complementary advantages compared with majorgroove ligands. Therefore an alternative and complementary approach to the antisense oligonucleotide effort is to develop sequence-specific probes based on naturally occurring DNA groove binding agents. We have reported such an approach based on the naturally occurring oligopeptide antibiotics netropsin and distamycin. 6-~1 Rational structural modification led to the development of lexitropsins, or information-reading agents, some of which are capable of recognizing unique sequences and which exhibit no memory for the preferred sequence of the parent antibiotic. 12 Progress has been made 9 in understanding some of the factors contributing to the molecular recognition processes which include" (1) the ability of certain hydrogen bond accepting heterocyclic moieties towards specific base pair recognition; (2) the influence of ligand cationic charge in sequenceselective binding; and (3) certain van der Waals contacts in 3'-terminal base pair recognition 13as well as the importance of pharmacological factors such as the ready cellular uptake of the prototype lexitropsins and their subcellular distribution in living cancer cells with concentration in the nucleus. 14 The development of G.C recognition elements has also been expanded to assess the validity of the concepts discussed in the preceding sections to alternative molecular assemblies. The synthetic bis-benzimidazole dye agent Hoechst 33258, containing benzimidazole repeating structural motifs, is similar to netropsin and distamycin in terms of the crescent shape and periodicity of hydrogen bond donating groups and also exhibits a distinct selectivity for binding within the minor
Figure 7. Rationale for design of sequence recognition alteration of bis-benzimidazoles. (a) Hoechst 33258 parent structure.
(b) structurally modified bis-benzimidazole.
70
I. WILLIAM LOWN
groove of AT-rich DNA sequences. 15The fluorescence enhancement observed from a high-affinity DNA binding of this dye is of widespread practical use in staining of chromosomes. 16'17Hoechst 33258 (Figure la) offers a protection pattern against DNA cleavage by footprinting agents that is essentially similar to those by netropsin and distamycin, suggesting a binding site size of 5 + 1 A.T base pairs. Structural data on Hoechst 33258-DNA complexes from X-ray crystallography 18-e~ and NMR studies 21-23provide evidence for the minor-groove binding and an ensemble of intermolecular van der Waals contacts and hydrogen-bonding interactions. The structural modifications that were employed in our investigation 24 on the first series of Hoechst 33258 analogues (Figure 1b) include a systematic incorporation of a benzoxazole ring, in either of its two configurations (i.e. orientations with oxygen or nitrogen on the DNA minor-groove directed edges), in place of one of the benzimidazole rings in the parent structure. Related structural alterations included bis-benzoxazole, pyridoimidazole/benzimidazole, and the bis-pyridoimidazole. 25 In this review we will examine these and additional factors that have been uncovered that contribute to the molecular recognition processes between groovebinding ligands and nucleic acid receptors and that may consequently be incorporated into drug design. Additional incentive to pursue this approach of rationally altered DNA sequence recognition of small molecules is provided by the observation of biological responses attributable to sequence specific effects in the cases of both lexitropsins and bis-benzimidazoles (q.v.).
II.
D E S I G N A N D SYNTHESIS
The design principles that were applied in the development of lexitropsins by rational structural modification of the parent natural products netropsin and distamycin resulted in predictable alteration in DNA base and sequence recognition. 6-11 This approach then proved useful in the development of new agents with promising activity against cancer and several viruses including HIV-I. 26 While structural modification of the oligopeptides, netropsin and distamycin, has received a great deal of attention, the same can not be said concerning Hoechst 33258. Although the structures of Hoechst 33258 and netropsin are ostensibly quite dissimilar, examination of the molecular recognition surface components of the two ligands directed inwards to the DNA minor-groove receptor reveals significant similarities. li Therefore it appeared that Hoechst 33258 ought to be amenable to similar systematic structural alteration in order to change its sequence recognition. The rationale for this approach is depicted in Figure 1. Convergent synthetic schemes were devised 27'28 in order to introduce, for example, the inward-directed pyridine nitrogen (anticipated to accept a hydrogen bond from G-2-NH 2) and are illustrated in Figure 2. Additional routes were devised to introduce benzoxazole moieties (two possible orientations) in place of benzimidazole groups. 28 Hoechst 33258, analogues 2-7, and bispiperizinylbibenzimidazole
Figure2. Schematic presentationof the synthesis of two representativestructurally modified (benzoxazole) analogues of Hoechst 33258. Reaction conditions: (a) 4-hydroxybenzaldehyde in ethanol, then Pb(OAc)4 in acetic acid; (b) LiAIH4 in THF, then pyridinium chlorochromate; (c) 1methylpiperazine and K2C03, DMF; (d) H2, Pd-C 5% in EtOAc; (e) PhN02, heat 24 h; (fl4-hydroxybenzaldehyde in ethanol, then Pb(OAc)4 in acetic acid; (g) LiAIH4 in THF, then pyridiniurn chlorochrornate; (h) PhN02, heat 24 h.
72
J. WILLIAM LOWN 19
/.~]
12
2
CfI3
CI I3j
CIt3/
~
~~FG'r o,
OH
N
OH
4
N
CH3/N V , J
~
oH
CH3/
6
Oll
r CH3 / N
.i..~ N
8
[~N~oI3
Figure 3. Structures of novel analogues of Hoechst 33258 used in studies of DNA recognition and binding.
Bis-Benzimidazole Minor-Groove Binders
73
8 (Figure 3) were synthesized as outlined in representative reactions in Figure 2 following a convergent approach. Treatment of ortho-hydroxyanilines with phenolic carboxaldehydes followed by oxidative cyclization with Pb(OAc)4 in benzene or acetic acid afforded the substituted benzoxazole moieties in good yield. 29 Benzimidazoles were constructed by heating ortho-aromatic diamines with the appropriate aromatic carboxaldehyde in a 1:1 molar ratio in nitrobenzene, and the progress of the reaction was monitored by TLC. In this reaction the initially formed Schiff base undergoes oxidative cyclization in air to afford the benzimidazole. 3~ Treatment of 5-chloro-2-nitroaniline with 1-methylpiperazine in the presence of K2CO 3 in DMF afforded the required piperazinyl derivative in 64% yield together with a small amount of 5-dimethylamino-2-nitroaniline. The latter compound may have resulted from substitution of chlorine by the dimethylamino group of DME Precedents for this kind of reaction have been reported recently. 31 Thus treatment of 5-chloro-2-nitrophenol with 1-methylpiperazine in the absence of K2CO 3 afforded only 5-dimethylamino-2-nitrophenol (whereas similar treatment in the presence of K2CO 3 gave no reaction). This result also supports the suggestion that the dimethylamino group of DMF is acting as a nucleophile. The required 2-nitro5(1-methylpiperazino)phenol was subsequently obtained by heating 5-chloro-2-nitrophenol with 1-methylpiperazine in the absence of solvent.
III.
DNA BINDING AND SEQUENCE RECOGNITION PROPERTIES A. DNA Binding Properties
The novel derivatives bind in the minor groove to native DNAs and polynucleotides. As may be seen from Table 1 there is an overall tendency to bind to poly(dA-dT) and mixed sequences but also, in individual cases, significant binding to poly(dG-dC) is observed. 24 This latter phenomenon of GC base site acceptance is also reflected in the sequencing studies.
B. SequencePreferential Binding As Hoechst 33258 provides several strong footprints on the fragment of DNA analyzed (which does not contain strings of five or more A.T base pairs in a row), it is clear that terminal G.C base pairs can be accommodated. At sufficiently high ligand/base pair ratios, Hoechst will even bind at sites with interior G.C pairs. Thus, while Hoechst may prefer continuous strings of A.T base pairs, the requirement is not absolute. 15 With the exception of 8 (Figure 3), a binding site size of 5 + 1 base pairs has been observed for the new ligands, in accord with a previous footprinting study of Hoechst 33258.15 Footprints of 4-8 base pairs are estimated for 8, though exact size determination is not possible using the available data 24 (Figure 4).
74
J. WILLIAM LOWN Table 1. Apparent Affinity Constants Determined by Ethidium Bromide Assay K a (M-I) a Compound b
Poly(dA-dT)
ct DNA
I
6.33 x 107
1.85 x 107
Poly(dG-dC) 1.1 x 106
2
2.64 x 107
1.72 X 107
7.6 x 105
3
9.50 x 106
4.72 x 106
4.5 x 105
4
5.34 x 106
4.72 x 106
3.5 x 105
5
2.38 x 107
1.43 x 107
8.3 x 105
6
1.19 • 107
9.43 • 106
5.0 • 105
7 8
3.96 x 107 1.90 x 107
3.85 x 107 1.22 x 107
1.1 x 106 4.7 x 105
Notes: aKa were measured from C50 values. 33 Buffer was 20 mM NaCI, pH 7.1 at room temperature. Excitation and emission wavelengths were 525 and 600 nm, respectively. bNumbers refer to structures given in Figure 3.
Among the new molecules, 7 is the one most similar to Hoechst both in terms of structure and binding site strength and location. Replacing one benzimidazole CH with N, however, causes marked changes as evidenced by footprinting. The greatest differences are the addition of two new GC-rich binding sites (ACCCTG, 128-133; GATGC, 134-138) and a shift to interior G.C base pairs at two other sites (AAATCT, 89-94; ACAAT, 96-100). The other notable change is the general footprint weakness by 7 at lower r'. Although Hoechst maintains strong footprints at r' 0.16 (and lower), 7 protects fewer sites under these conditions and even shows a general weakening and loss of sites at the AT-rich stretch from bases 84-100. Both 2 and 3 are structurally quite similar to the parent ligand. In the case of these two analogues, however, great changes in binding are apparent. This is due, in part, to the reduced basicity of the benzoxazole moiety compared with benzimidazole. With its benzoxazole oxygen directed away from the floor of the groove, 3 presents a potential hydrogen bond-accepting nitrogen to the DNA, rather than the hydrogen bond donor of Hoechst. This arrangement proves unsatisfactory for binding. The interior oxygen placement of 2, on the other hand, does allow some degree of binding at several sites which Hoechst occupies (Figure 4). Other than a generalized footprint weakness, the most evident features of 2 are a refusal to bind at GTTAT (155-159) and a shift toward internal GC sites. The nearly complete absence of cleavage inhibition by the bis-benzoxazole 4, is not unexpected given the poor footprinting ability of mono-oxazoles 2 and 3. The structural modifications in 3 and 4 possibly allow acceptance of new sequences and/or rejection of Hoechst sites, but their weak binding precludes expression of any altered recognition properties.
1
3
--
1:
5
120
163
1?O
Ip
I
u
v1
6
ia *5'-
.3'-
- -a-
C A C C G T G T A T G AATC ACAATGCGCTCATCGTCATCCTCGGCACCGTCACCCTGGATGCTGTAGGCATAGGCTTGGTTATGCCG-3 GTGGCACATAC T T A G T T G T T A C C C G A G T A G C A G T A G G A G C C G T G G C A G T G G G A C C T A C G h C A T C C G T A T C C G A A C C A A T A C G G C -5' 1-1-
-
9
Figure 4. Histogram of complementary strand MPE footprinting of new bis-benzimidazoles Numbers refer to structures given in Figure 3.
76
J. WILLIAM LOWN
Compounds 5 and 6 afford an intermediate level of cleavage protection relative to strong binding 7 and the weak binders 2-4. Their pyridines marginally increase binding relative to 2 and 3, and their benzoxazoles considerably weaken them compared to 7. Interestingly, 5 accepts one of the new GC-rich sites bound by 7 (CCCTG), but rejects the terminal- G.C site GTTAT which is a Hoechst site (and part of a 7 site). Overall 5 shows an invariable requirement for at least one non-terminal G.C base pair. This has been tentatively interpreted in structural terms as shown in Figure 5. In addition, a terminal A.T pair is present at all but one binding site for 5. This preference for a terminal A.T pair probably results from the electrostatic demands of the N-methylpiperazine. 36 The most structurally distinct of the new molecules, 8, favors binding at locations with high A.T base pair content. This trend was anticipated since the curved contour of alternating hydrophobic and NH hydrogen-bonding components in molecules bearing multiple positive charges appear to be general features of binding to the minor groove of AT-rich DNA. 32'33 The new ligands do not recognize A-DNA or Z-DNA and neither does the parent compound 1, Hoechst 33258. In addition the results demonstrate that the minor groove is the binding site for the new ligands like their parent molecule. The data indicate that the interaction between ligands and poly(dA-dT) is salt-independent.
3'
I /
5'
/
---
]
....... ] - - - -
G-4
1 r-~
~-"~
5'
y,H/
\
.', t
~ +I.
H ~ H H :: / " "N" ': u
~NC J# CH3
'~ ii ' ":"'N--H [
G-5
m~..C"----~m C'8 ~r
;
/H,..,"
Is~'
"x
J
. I
~,'~
.~
C-7
I 3' 5'
Figure 5. Schematic depiction of ligand-DNA interactions deduced from 1H-NMR NOEs.
Bis-Benzimidazole Minor-Groove Binders
77
IV. STRUCTURAL ANALYSIS OF LIGAND-DNA
INTERACTIONS A. NMR Studies
Bis-benzimidazole Bearing One Inward-Directed Pyridine Nitrogen The binding characteristics of Hoechst 33258 (1), a synthetic bis-benzimidazole (Figure 1b), and its structural analogue 2, with one of the benzimidazoles replaced by a pyridoimidazole, to the self-complementary decadeoxyribonucleotide sequences d(CGCAATrGCG) 2 (A) and d(CATGGCCATG) 2 (B), respectively, were examined using high-field 1H NMR techniques (Figure 6). 34 Selective complexation induced chemical shift changes, the presence of exchange signals, and intermolecular NOE contacts between the ligands and the minor groove protons of the oligonucleotides suggest the preferred binding sites as the centrally located AATr segment for complex A1, and the CCAT segment for complex B2. The B-type conformations of the two DNA duplexes are preserved upon complexation, as confirmed by the 2D NOESY-based sequential connectivities involving DNA base and sugar protons. Close intermolecular NOE-based contacts between the ligands and their respective DNA sequences were further refined to model the ligand-DNA complexes starting from the computer generated B-type structures for the oligonucleotides. Force field calculations of ligand-DNA interaction energies indicate a more favorable contribution from the van der Waals energy component in the case of complex A1 consistent with its stronger net binding compared with the complex B2. Overall, the incorporation of a pyridinic nitrogen into the Hoechst 33258 structure alters its selectivity for base pair recognition from A.T to G.C, resulting largely from the formation of a hydrogen bond between the new basic center and the 2-NH 2 group of a guanosine moiety. The rates for the exchange of ligands between the two equivalent binding sites (AATI" for 1, and CCAT for 2) of the self-complementary DNA sequences, are estimated from analyses of coalescence of NMR signals to be 189 s-1 at 301 K for A1, and 79 s-1 at 297 K for B2, which correspond to AG* of 13.8 and 18:6 kcal mo1-1, respectively. 34
Bis-benzimidazole Bearing Two Inward.Directed Pyridine Nitrogens Based on the general principle that incorporation of hydrogen-accepting heterocycles permits the recognition of GC sites, it was envisaged that the replacement of both the benzimidazole rings in the parent molecule with pyridoimidazoles (Figure 5) should show increasing amounts of G.C base pair acceptance due to incorporation of two suitably located pyridinic nitrogen centers. Structural information on the complex formed between this ligand and d(CATGGCCATG)2 has been obtained from selected NMR experiments. 25The presence of the ligand results in selective chemical shift perturbations and removal of the degeneracy in the palindromic decanucleotide sequence. Judging by the doubling of the resonances
3'
OH I
5'
3::
0
.;
:r..
78 "1.. e-
i
2
0
c
0
N n~ X O N cQ; ..Q I Q;
E
O N "O
-Oo
c~
r-
..-..
QQ
v
i
Lr~
Lr~ C'N r~ r~
r" ~J QJ
e"
O
O -r
~
~J
c-o_
E
r-
figure 6. (A) Schematic binding of Hoechst 33258 to 5'-AAl7, and (B) pyridoimidazole-benzoxazole analogue to 5'-TGAG sequences.
Bis-Benzimidazole Minor-Groove Binders
79
due to the loss of the twofold symmetry of the self-complementary DNA duplex, it is concluded that the residence time of the ligand on the DNA is long relative to the NMR time scale. Supporting evidence is provided by a downfield shift of the DNA imino protons that is consistent with a minor-groove binding mode. 35 Precise information about the nature of binding interactions is obtained by observing intermolecular proton-proton NOE contacts, thus providing the basis for elucidating the 5'-GGCCA segment as the ligand binding site. The relative orientation of the ligand is deduced from intermolecular NOEs observed at both the N-methylpiperazine and methoxyphenyl ends of the ligand. On the basis of these results, we infer that in the initial stages of DNA recognition the cationic N-methylpiperazine group in its protonated form anchors at the highly negative electrostatic potential at the AT sites in the minor groove of DNA, 36 followed by alignment of the rest of the molecule onto the floor of the minor groove. The overall binding is facilitated by the natural crescent shape of the ligand and is further stabilized by favorable H-bonding interactions between the heteroatom containing edge of the ligand molecule and potential H-bond donors of the DNA. The results from the present study are in general agreement with those from related structures reported 34'37where the 1:1 complexes of two different topoisomerase II inhibitory analogues of Hoechst 33258 were examined with the same decadeoxynucleotide sequence as employed in the present study. These analogues were designed to alter the parent sequence preference of A.T base pair recognition to GC by incorporating H-bond acceptor moieties in appropriate positions in the structure of Hoechst 33258. The two compounds have a common feature in the form of a pyridinic nitrogen center (pyridoimidazole in the place of one benzimidazole) and, despite the difference in the second substitution (benzoxazole v s benzimidazole), they both exhibit preferential binding on the 5'-CCAT segment. Such partial selectivity for G.C base pairs observed by NMR is in agreement with conclusions drawn from footprinting studies. 24 The analogue used in this study was designed with the incorporation of two pyridinic nitrogens by substituting both the benzimidazole rings by pyridoimidazole (Figure 5) with the expectation of an increased recognition and/or selectivity for G.C base pairs. As anticipated, the binding region on the same DNA fragment has shifted to 5'-GGCCA indicating a marked preference of the ligand for GC-rich segments (Figure 5). In contrast to the steric clash between the benzimidazole rings of the parent Hoechst 33258 molecule and the guanine 2-NH e groups, which renders it" G.C avoiding" and thus "A.T base pair preferring", the ligand described here overcomes these unfavorable interactions and instead exhibits a marked preference for G-C base pairs. This behavior appears to arise from additional stabilization due to H-bonding with the guanine 2-NH 2 groups. Although a ligand induced distortion at the binding site is qualitatively assessable, the overall B-type conformation of the DNA fragment is retained upon complexation. The structural conclusions drawn from the NMR-NOE evidence were corroborated by molecular mechanics and molecular modeling studies (Figure 5).
80
J. WILLIAM LOWN
Hoechst 33258 Analogue Bearing One Inward.Directed Nitrogen and One Benzoxazole Moiety The nonexchangeable and imino proton NMR resonances have been assigned in the 1' 1 complex of an analog of Hoechst 33258 bound to the decadeoxyribonucleotide d(CATGGCCATG) 2 by a combination of NOE difference, COSY, and NOESYPH techniques. In contrast to Hoechst 33258 which recognize 5'-AATr sequences exclusively, this analogue possesses structural features designed to permit the recognition of GC sites. 37 The Hoechst 33258 analogue is located on the 5'-TGAG sequence of the DNA duplex (Figure 6). This conclusion is supported by the complexation-induced shifts of selected protons across the oligonucleotide d(CATGGCCATG) 2 and the appearance of certain exchange signals in the IH NMR of the 1"1 complex. The orientation of the drug placing the N-methylpiperazine residue at the GC position in the binding site in the minor groove, which is wider than the AT minor groove, is confirmed by NOESY and 1D-NOE experiments of both exchangeable and nonexchangeable protons in the 1"1 complex. The cross-correlation peaks in NOESY experiments have revealed that the DNA duplex in the 1"1 complex retains its right-handed B form, which is similar to that of free decamer. Furthermore, H-15 and H-11 give NOEs with A8H2, indicating that the benzoxazole moiety is recognizing the 5'-A8 site by forming anew hydrogen bond between N1 of pyridoimidazole and the 2-NH 2 of guanine. The drug molecule undergoes rotation around the C9-C 10 bond and which is slow on the NMR time scale, even after binding. However the cross-peak between H- 11 and A8H2 is quite weak, suggesting that the concave face of the drug is predominantly facing the floor of the minor groove, but due to rotation around single covalent bond (C9-C 10), the phenolic part is pushed away from the floor of the minor groove. The two hydrogen bonds to the cytosine-O 2 and thymine-O 2 to N9-H proton and new hydrogen bond between N 1 of drug and 2-NH 2 of guanine (G4) hold the drug molecule tightly in the minor groove. It is the new hydrogen bond between N1 and 2-NH 2 (G4) which is responsible for GC reading by the pyridoimidazole residue in the drug. Individual van der Waal contacts between H-15 or H-11 of the drug and the A8H2 proton of the dA8.dT3 base pair result in 5'-CCAT reading of this Hoechst 33258 analogue. On the basis of the increase in lifetimes of the imino protons and the variable temperature study (Tm) of the complex, it appears that the DNA double helix is stabilized by binding of the drug 2. The two-site exchange rate is found to be 60 s-l and AG [] is 65 kJ mo1-1 at 308 K for two equivalent sites upon binding of the drug to DNA duplex. The experimental analysis fully agrees with the proposed slide-swing mechanism for the exchange process. 37 An overwinding/shrinking of the DNA double helix at the binding site has been observed as a result of binding of the drug, which is evident from certain internucleotide NOEs on the 5'-CCAT site.
Bis-Benzimidazole Minor-Groove Binders
81
The results of the force field calculations show that the shape of the ligands necessary to bind isohelically to DNA, can be adopted in the Hoechst analogue and in its parent structure with equal energy expense. The distances between the two benzimidazole N-H groups in the Hoechst drug and between the benzimidazole N-H and the benzoxazole O in the analogue allow a direct match with consecutive base pairs on the floor of the minor groove. The hydrogen bond between basic substituents of an AT sequence and the benzimidazole N-H is quite long. However, the NMR study indicates no such strong interaction between the benzoxazole oxygen and a hydrogen donor in the minor groove of the DNA. The substituents on the floor of the negatively charged minor groove of an AT sequence evidently bind stronger to hydrogen bond donors than to acceptors. In all the benzoxazole derivatives studied so far, the binding to AT sequences is weaker compared with the parent compound. These are the first compounds studied in which the "backbone" hydrogen donors of the ligands (amide- or benzimidazole-NH in lexitropsins and Hoechst compounds, respectively) are replaced by a hydrogen bond acceptor. The Hoechst analogue has, in a sense, conflicting requirements for molecular recognition of DNA sequences. The benzoxazole oxygen requires a GC sequence for the formation of a strong hydrogen bond, but then the aromatic C-H would clash with guanosine-2-NH 2. The pyridine nitrogen on the left part of the molecule allows, however, the binding to a GC sequence. This study indicates that the possibility for strong GC sequence preference should be greatest in this series for a derivative, which consists of two pyridine oxazole moieties. Specific NOEs locate the benzoxazole moiety on the 5'-CCAT and are consistent with the pyridine nitrogen forming a new hydrogen bond to G(4)-2NH 2 at 5'-CCAT. The drug appears to undergo rotation around the C9-C 10 bond, at a rate comparable with the NMR time scale, even after binding. Variable temperature 1H NMR studies established that the DNA is thermally stabilized as a result of the drug binding. The drug binding is a dynamic process involving exchange between the equivalent 5'-CCAT sites at -60 s-1 with AG~ of 65 kJ mo1-1 at 308 K. The experimental evidence is in accord with a slide-swing mechanism for this process.
B. FTIR Study of Specific Binding Interactions between Hoechst Analogues and Polynucleotides FTIR spectroscopy was used to study the interactions between polynucleotides and two series of minor groove binding compounds. The latter were developed and described previously as part of an ongoing program of rational design of modified ligands based on the naturally occurring pyrrole amidine antibiotic, netropsin, and varying the structure of bis-benzimidazole chromosomal stain Hoechst 33258. Characteristic IR absorptions due to the vibrations of thymidine and cytosine keto groups in polynucleotides containing A.T and G.C base pairs respectively are used to monitor their interaction with the added ligands. 38 The in-plane double bond vibration frequencies corresponding to the thymidine C2 keto group of the nucleic
82
J. WILLIAM LOWN
acid bases in the IR spectra ofpolynucleotide poly(dA-dT), are observed to undergo specific changes in the presence of the lexitropsin which are attributed to a direct interaction of these A.T base pair discriminating ligands at the minor groove of the AT-rich DNA polymer. In contrast, these ligands fail to induce any changes in the spectra of polynucleotides containing purely G.C base pairs, i.e. poly dG.poly dC and poly(dG-dC). These results are in agreement with the previous observations on the netropsin-poly(dA-dT) complex where the specific binding of the molecule to the alternating AT sequences in the DNA minor groove is now firmly established. In the second series of compounds based on Hoechst 33258, the structure obtained by replacing the two benzimidazoles in the parent compound by a combination of pyridoimidazole and benzoxazole, exhibits changes in the carbonyl frequency region of poly dG.poly dC which are attributed to the ligand interaction at the minor groove of G.C base pairs. In the case of this ligand, strong interaction with poly dG.poly dC is discernable via changes in the IR absorption frequencies corresponding to the carbonyl groups of the bases; no interaction is observed in this case with A.T base pair containing polymers. Since changes are also not observed for poly(dG-dC), it is evident that the presence of adjacent cytosine residues in the DNA favors the complexation with the ligand, which is in excellent agreement with a recent NMR study on its complexation with double-stranded decadeoxyribonucleotide d(CATGGCCATG). 24 In contrast, Hoechst 33258 itself interacts only with poly dA. poly dT. Weak or no interaction exists between the ligands and any of the polynucleotides at the level of phosphate groups or the deoxyribose units. The interaction of the ligands at the level of phosphate groups and deoxyribose units, which were analyzed by their characteristic IR absorptions, is absent or minimal. In summary, the technique of IR spectroscopy has allowed us to determine, independently of NMR methods, the ligand-DNA interactions at the level of functional groups present in the minor groove of the nucleic acid bases. Characteristic signals corresponding to these moieties should then serve as useful markers to distinguish between the specific modes of binding, and add to the information base on DNA binding agents.
C. Discrimination between Groove Binding and Intercalation of Ligands by Electric Linear Dichroism One of the underlying design principles guiding this work is that one can develop information-reading small molecules capable of reading the minor groove by rational structural alteration. This presupposes recognition of the DNA by such ligands exclusively via the minor groove. However, experience of the prototype ligands, the lexitropsins, alerted us to the possibility of alternative modes of binding operation. When a terminal N-methylpyrrole group in a polypyrrolecarboxamide is replaced by certain thiazole groups, intercalation of the latter moiety is observed as evidenced by high-field NMR analysis.9 In the case of certain small ligands like DAPI, the alternative modes of binding-intercalation and groove binding may
Bis-Benzimidazole Minor-Groove Binders
83
operate simultaneously but at different sites. Electric linear dichroism (ELD) provides a means of discriminating between these modes of DNA binding. In this procedure DNA molecules are oriented by an electric pulse and the dichroism in the DNA absorption bands or of the bound ligand is probed using linearly polarized light. Two situations can arise in which (1) positive dichroism ratios are observed for intercalator-DNA complexes, or (2) negative dichroism ratios are indicative of minor groove binding. 39 Nine structures related to Hoechst 33258, and incorporating some of the structural features that confer the ability to recognize alternative sequences, were examined by ELD for this interaction with a wide range of native DNAs and polynucleotides. Compounds 2 and 6 only differ by the position of the nitrogen and oxygen atoms in the oxazole ring but, surprisingly, they behave totally differently in their binding reaction with DNA. Compound 2 always gives negative DR values (positive reduced dichroism) (Figure 7), attesting that this compound is a pure minor-groove binder. In contrast, 6 always gives positive DR values whatever the DNA sequences to which it binds. The dichroism ratio increases as the AT content of the DNA increases and the high DR values obtained in the presence of poly(dA).poly(dT) and poly(dI-dC).poly(dI-dC) suggest that the drug is more or less parallel to the plane of the DNA base pairs. Therefore this compound is very likely to be a DNA intercalating agent (an AT-specific intercalator). Moreover, the fact that we obtained negative reduced dichroism signals for the 4-coliphage T4 DNA complex indicates that the negative dichroisms observed are not the result of binding into the major groove (which is occluded with this DNA) but effectively corresponds to an intercalative binding. The introduction of an extra nitrogen atom into the two benzimidazole rings (benzimidazole C16 ~ azabenzimidazole N16) together with the replacement of the hydroxyl terminal group of Hoechst 33258 by a methoxy group have profound effects on the DNA binding properties of the drug. With 7, we did not detect any negative dichroism. It seems that this compound is able to bind to the minor groove of DNA whatever the sequence, even with GC-rich polynucleotides. We note also that the DR values become more negative as the percent GC of the DNA increased. This cannot, per se, be considered as evidence for G.C selectivity; however it indicates that this compound accepts G.C base pairs. It is probably the newly introduced nitrogen atom of the chromophore which allows the drug to engage hydrogen bond(s) with the exocyclic amino group of guanines in the minor groove. 24 These results are in accord with reported results from footprinting. 24 Analogue 9 (Table 2) differs from 7 by the presence of a methoxymethyl side chain linked to the nitrogen atom of the benzimidazole ring. On the whole, the results are similar to those obtained with 5. The short side chain has no significant effect on the structure of the drug-DNA complex. The binding of the three compounds, 10, 11, and 12, to the natural DNAs and the AT-rich polynucleotides is not very different from that observed with the parent compound Hoechst 33258. Therefore, as observed for 9, the side chain attached to the pyridoimidazole ring
I
.
.
.
.
.
84
0
PolY(~).PlY(dc)
I
DII
poly(~-dc).poly(dGdc)
DNA Micrococcus lysodrihicus ( 7 2 M C ) DNA cdf thymus (42%GC) DNA Clostridiumperfringem (26QGC) .I J
-I
I
Dm
I
DR
0
0
-I J
-I J
figure 7. Variations of the dichroism ratio for bis-benzirnidazole compounds (structuresgiven in Table 2 ) bound to DNAs of different base composition.
Chemical Structures and Binding Constants f o r Ligands 1 - 9 / C a l f T h y m u s D N A
Table 2.
G ( M -~) 19
4
U
12
3.1 + 0.3 x 107 6/N~,,/ (:a'13 3' 4'
16
H
41~~60H
H
1
s
CH/
OH
1 . 1 + 0 . 2 x 107
2
3.8 + 0.1 x 106 3
Oil CH3 t N ~
4
cM3/
/ CH3
1 . 5 + 0 . 6 x 107
5
~/"
6
~ , ~
s
.
~ N
sCH2OCH3
k.....
-~-~
ok0.,k~ '
1.9~x~0~
7
~~ cn3/N,,,.~
9.0 _+0.2 x 106
CH30
r~--~--~
CJFI31N ~
7.0 + 0.2 x 106
r
N
n
~CH2OCH2CH3
L,.~,"~OCK~
2.31 x 107
$ ,,,
c-3 " N ' ~
"
~N
9
sCH20(CH2)~CH~
~k"~'X"~ 86
2.20 x 107
Bis-Benzimidazole Minor-Groove Binders
87
has no pronounced effect on the minor-groove binding process which occurs predominantly at AT sequences. In contrast, the side chain seems to affect the binding to GC sequences. The three drugs exhibit negative DR values with the GC-rich DNA from Micrococcus Lysodeikticus, while Hoechst 33258 gives intense positive DR with this DNA. The length of the side chain is critical since compounds 11 and 10 that have a relatively short side chain still exhibit positive DR values with the two GC polynucleotides as observed with Hoechst 33258 (although the positive DR values are significantly diminished) (Figure 7). However, compound 12 bearing a long side chain [CH3-(CHz)7-OCH2-] gives negative DR values with poly(dGdC).poly(dG-dC) and poly(dG).poly(dC). Hoechst 33258 is evidently able to intercalate into GC sequences and the presence of a bulky substituent directly linked to the chromophore does not permit this intercalative binding process. In the presence of 4, the intensities of the ELD signals were always very low and the data cannot be analyzed with accuracy. Its affinity for DNA is evidently much weaker than that of the other analogues as shown by the K a values. The substitution of the benzimidazole for benzoxazole rings evidently has a marked effect on the DNA binding affinities. The order of DNA binding affinity is 1 > 7 > 2 > 6 > 4 (Table 2). The order of the effects of the bis-benzimidazoles on the inhibition of VM-26 cross-link formation in intact cell nuclei is 7 > 1 > 4 > 6 > 2 (see Section V.C). 4~ These data suggest that strong DNA binding, per se, is not sufficient to guarantee efficient topoisomerase inhibition. More significant factors are (1) the ability to recognize and bind to GC-containing sequences, e.g. 7 vs 1, and (2) minor-groove binding (7, 1) is essential in contrast to pure intercalation (6) or very weak binding (4). These conclusions are in accord with the observation that examination of the pBR322 cleavage recognition sequence reported for Drosophila topoisomerase II revealed the presence of two binding sites for the more potent topoisomerase inhibitors 7 and 1 (see Section V.C). 4~The results are also in accord with recent evidence that topoisomerases make significant contact with the duplex DNA via the minor groove. Weaker minor-groove binding was observed with the less topoisomerase II inhibitory agents 2 and 6, the latter of which is now revealed as a pure intercalator. The results set the stage for the design of more effective topoisomerase inhibitors.
V. CELLULAR A N D PHARMACOLOGICAL EFFECTS A.
In Vitro
Cytotoxicity of Bis-benzimidazoles
The novel bis-benzimidazoles displayed inhibitory effects against the proliferation of both murine leukemia cells (L1210) and human tumor cell lines including T-lymphoblast cells (Molt/4F) and naseopharengeal cells (KB). 41 The IC50 values were generally in the range of--1.00 ~g/mL or less as may be seen from Table 3. In general those bis-benzimidazoles that were effective against murine cells are also
88
J. WILLIAM LOWN
Table 3. Inhibitory Effects of Compounds on the Proliferation of Murine Leukemia Cells (L1210) and Human T-Lymphoblast Cells (Molt/4F)- Bis-Benzimidazoles Cywtoxicity IDsoa (Ixg/mL) Code No.
Structure
KB
H
w
L1210
Molt/4F
- OCHj
HCI
CH3"N~IJ
OCH,
HCI
14
[""~NN ~
N~HN~N~
on; N , ~
0.432 0.554
1.50
>1.0050.4
38.2
OCH,
HCI
15
GN Z ~ N('ff)ZN~. '~)--' ~ s~/'N~~ --N ' ~_N~,'~ ~ ell;
OCn, HCi
16
~;N,,~
~r
NT 7.02
17.8
NT 5.16
2.68
HO
17
,f~ N cll; N.....J ~
ocH,
HCI
Note:
a50%Inhibitorydose.
inhibitory against the human cell lines. Exceptions are seen in those cases where only weak binding to DNA is observed. 37 B. In Vivo Anticancer
Activity of Bis-benzimidazoles
The cytotoxic activity seen with certain of the bis-benzimidazoles in vitro is sustained in vivo. A lead compound 7 has an IC50 of 0.02 ktg/mL against L 1210 cells and of 0.289 kt/mL against KB cells in vitro. Because of the superior'potency against leukemic cells it was then tested in mice against P388 (i.p. injection) at a single dose of 100 mg/kg. This resulted in a 45.1% increased life span compared with controls. 41
Bis-Benzimidazole Minor-Groove Binders
89
C. Cellular Effects Inhibition of Nucleic and Biosynthesis In Whole Cells Having observed cytotoxic effects in vitro against a range of cancer cells and confirmed the activity in vivo we now wished to explore the cellular effects of the bis-benzimidazoles as a first step in elucidating their mode of action. The more potent examples were found to inhibit both DNA and RNA synthesis in whole cells with IC5o values in the range of 5-8 l.tM.41 This suggested that interaction with the cellular nucleic acid contributed to the cytotoxic potency.
Effects of Analogues of Hoechst 33258 On Topoisomerase I and II-Mediated Activities The importance of the topoisomerase enzymes as chemotherapeutic targets has become evident in recent years. 42--44Agents which inhibit or enhance the activity of these enzymes may play a pivotal role in cell survival. Hoechst 33258 is a DNA minor-groove agent which, with the exception of its use as an antihelmintic, 45 has not been developed as a therapeutic agent. 46-49 Nevertheless, significant effects on topoisomerase mediated activities have been observed. The evidence for the effects of a series of Hoechst 33258 analogues on these key enzymes provided a new avenue for defining which structural modifications of this compound were important in drug design. The Hoechst agents used in this study were extensively characterized in an earlier report. 24Although these analogues all bound to the minor groove of B-DNA, certain sequence selectivity differences were noted. For example, while strong footprinting with agents 5 and 7 was observed over the same sequences as with Hoechst compound 1, some alterations in base specificity within the binding sites were observed. Both 5 and 7 showed increased binding to G.C pairs compared with compound 1. By contrast, the parent compound can only bind GC at the terminus of its binding site. 2 A generally reduced footprinting intensity was observed with agents 2-7 compared With 1, and the order of binding strength for the Hoechst compounds using either calf thymus or poly(dA-dT) DNA was 1 > 7 > 5 > 2 > 6 > 3>4. How do base specificity and binding strength relate to the observed effects of Hoechst compounds on topoisomerase-mediated activities? Analysis of the intact cell and nuclear data indicated that Hoechst compounds 1, 5, and 7 were good inhibitors of VM-26-induced cross-links and all showed similar footprinting intensities. 24 These same agents also showed strong binding affinities for calf thymus and poly(dA-dT) DNA. 24 Similarly, agents 2 and 3, with reduced footprinting and overall binding intensity, were also less effective at inhibiting cross-links. The increased preference for GC binding sites did not reduce the effectiveness of either 5 or 7 compared with 1 in the present study.
90
J. WILLIAM LOWN
While the cell and nuclear data generally reflected the drug binding characteristics defined with isolated DNA fragments, a good correlation between the binding affinities (Ka) and cross-link inhibition was not observed. Thus, as is to be expected, modulating factors other than strict affinity of the drugs for DNA must be considered when evaluating topoisomerase-mediated nuclear or cellular lesions. In intact cells drug uptake mechanisms may well be a factor. For example, the presence of a methoxy group at C6 was shown earlier to enhance cellular uptake of Hoechst 33258. 24 This substitution probably contributed to the enhanced activity of 7 in intact cells. Additionally, interpretation of the effects of Hoechst on cross-link formation in nuclei or intact cells requires consideration of the sites of VM-26, m-AMSA, or camptothecin action. These agents associate with the topoisomerase-DNA complex via binding to enzyme or DNA or both. 5~ Thus, inhibition of nuclear cross-link formation may result from interference with either the enzyme-DNA recognition site, the VM-26 (or m-AMSA or camptothecin) DNA binding site (if any), or the cleavage site of the DNA-enzyme complex. The association of nuclear and cellular DNA with histone and non-histone chromatin proteins may also contribute to an alteration in enzyme reactivity. Recent evidence suggested that minor-groove binders alter the association of DNA with its nucleosome core proteins. 57 Such an alteration may in itself be sufficient for bisbenzimidazole-induced reduction in topoisomerase-mediated cross-links. Alternatively, topoisomerase activity may be localized to specific chromatin domains (e.g. replicating or transcribing regions. 58-6~ Unless Hoechst binding is highly specific for the same chromatin regions as are bound by these enzymes, one would not expect a direct correlation between Ka and inhibition of topoisomerasemediated activities in nuclei. In contrast to the above effects on cross-link formation, all four Hoechst compounds were potent inhibitors of topoisomerase I and II catalytic activity (Table 4). Agent 2, which was less effective in the nuclear system than would be predicted from its K a, strongly inhibited both enzymes. Agent 3, differing from agent 1 in that the nitrogen in the N2 position has been replaced by oxygen, was the least effective. According to the earlier footprinting study, this orientation alters hydrogen bonding by the Hoechst analogue such that N1 of agent 3 becomes a potential hydrogen bond-accepting nitrogen rather than a hydrogen bond donor as in 1. 24 Thus, both footprinting intensity and topoisomerase inhibition are enhanced by a nitrogen in the N2 position. As in the nuclear and cellular studies, agent 7 was a very effective inhibitor of topoisomerase activity. Despite a lower DNA binding affinity than 1 (Ka = 1.5 compared with 3.1), this agent showed increased binding at GC-rich sequences as a result of the substitution of N at the C16 position. 24 However, the relevance of such sites to topoisomerase-mediated activity remains unclear until more evidence derived from additional (GC) n directed agents are examined. Tight binding to the minor groove might be expected to make this region of DNA less accessible to enzyme interactions. Indeed, the good correlation between
Bis-Benzimidazole Minor-Groove Binders
91
Table 4. Effects of Hoechst Analogues on Catalytic Activity of Topoisomerase II and Ia
Drug Required for 25% Reduction in Relaxation of pBR322 Analogue (pM) b Compound
1
2
3
7
Topoisomerase II
10.8
11.2
28
8.2
Topoisomerase I
1.6
2.3
5
1.6
Notes:
~q'opoisomerase reactions were performed as described in Materials and Methods with Hoechst 33258 analogue concentrations ranging from 1.0 to 40 ~tM. Maximum relaxation was that obtained in the absence of Hoechst and equaled 45 (topoisomerase II) and 49% (topoisomerase I) conversion of supercoiled to relaxed form I. Each point represents the average of 4 to 6 independent enzyme assays. bCompound numbers refer to structures in Figure 3.
Hoechst analogue Ka'S and the amount of drug necessary to inhibit topoisomerase activity by 25% was indicative of this relationship. 4~ Are the above effects on topoisomerase-mediated activities related, at least in part, to the ionic charge of the Hoechst molecule? Both stimulation and inhibition of topoisomerases have been observed with differing concentrations of divalent cations (e.g. Ca 2+ and Mg2+)62'63 polycations (e.g. histones, polyamines) 63-65 and the polyanionic heparin molecule. 66 However, the enzyme inhibitory concentrations of Hoechst compounds (1-40 ktM) reported in the study are relatively low compared with those required for modulation by charged moieties (--0.1 mM). Harshman and Dervan represent Hoechst 33258 as monocationic under physiological conditions. 67 Additionally, charge variations among the Hoechst compounds tested were minimal 24 and did not correlate with drug potency. In view of the correlation with K a, changes in topoisomerase catalytic activity were more likely to be the result of Hoechst DNA binding affinity than molecular charge effects. Agent 7 was more effective than either 1, 2, or 3 at inhibiting VM-26 cross-link formation in intact cells. In view of this observation, future studies will examine a series of structural analogues of the lead agent 7 for their ability to modify topoisomerase activities. Such studies with compounds differing only by one or two molecular substitutions should refine the definition of structures capable of selective modulation of topoisomerase activity in intact cell and subcellular preparations.
Correlation between Interference of Bis-benzimidazoles with Topoisomerase II-Mediated Reactions in Whole Cells and Anticancer Potency Anticancer agents usually express their cytotoxicity by multiple cellular lesions and pathways. Thus it is seldom, if ever, possible to point to an individual cellular effect as being exclusively or even predominantly responsible for cytotoxicity. Nevertheless, as a first step in trying to understand the mechanism of action of an
92
J. WILLIAM LOWN Table 5. Correlation between Interference with Topoisomerase II-Mediated Reactions in Whole Cells and Anticancer Cytotoxicity of Bis-benzimidazoles DNA-Protein Cross-links Inhibition (%)a
Compound Hoechst 33258
35 (100)
5
50(100)
6
> 90 (100)
Cywtoxic Activity 16'5o (lab/) 13
1 0.28
N
Cil)Z V ~1
OCH~
HC!
CII~I
v
CH~O
OC]['l$
HCI
Note: aAt 100 ~M MGBD.
anticancer agent, it is often instructive to look for such correlations. In the case of the novel bis-benzimidazoles they all exhibit, to a greater or lesser extent, inhibitory action on topoisomerases both in vitro and in whole cells. 40 Acorrelation is observed between the ability of the drugs to interfere with topoisomerase II-mediated DNA-protein cross-link formation by drugs such as etoposide or camptothecin, and their cytotoxic potency over almost 2 orders of magnitude (Table 5). 41
Relation between DNA Sequence Recognition of Bis.benzimidazolesand Cellular Effects We have seen above (Sections II, III.A and B) that it is possible by rational structure alteration of the bis-benzimidazole molecule to alter, to some extent, the characteristic sequence preference. It has also been possible to increase the cytotoxic potency (compared with Hoechst 33258) by ca. 100-fold. The question then arises whether the cellular and/or pharmacological effects are related to the sequence preference. It is clear that other pharmacological factors concerned with solubility, cellular uptake, and intracellular stability will play significant roles. Assuming, for the moment, that such factors will be comparable for this series of drugs, one may then examine for factors concerned with DNA binding capacity and sequence preference. The contribution of the DNA binding affinity to, for example, t.opoisomerase inhibition has been discussed above (Section V.C). Factors other than drug binding affinity may also influence enzyme activity. For example, an examination of the pBR322 cleavage recognition sequence reported for Drosophila
Bis-Benzimidazole Minor-Groove Binders
93
topoisomerase I168 revealed the presence of two binding sites for the more potent topoisomerase inhibitors 1 and 7. This sequence, with the Hoechst binding sites underlined, is: ACAATG $ CGCTCATC. (The arrow denotes the enzyme cleavage site.) Neither 2 nor 3 showed significant binding at either of these sites. By contrast, no such identity between pBR322 topoisomerase I recognition sequences and Hoechst analogue binding sites was apparent. Thus it is possible that sequence recognition effects may also contribute to overall potency.
VI. CONCLUSIONS AND PROSPECTS It has been possible by rational structural modification to modify the strict (AT), recognition of Hoechst 33258 so that appropriate new bis-benzimidazoles also accept GC-rich sequences. Detailed analysis by high field NMR of drug-oligonucleotide complexes provided structural details that both supported the concept of base site acceptance and assisted subsequent drug design. The new bis-benzimidazoles inhibit DNA and RNA synthesis and proved to be uniquely active in inhibiting topoisomerase I and II activity in whole cells. They are also quite cytotoxic and have IC50 values against KB cells of-0.4 ktg/mL and against L1210 cells of ca. 1 x 10-7 M. The antiproliferative activity in vitro expresses itself as anticancer activity in vivo with an ILS of 145% in mice following i.p. injection of P388 cells. A tentative correlation can be established between the ability of the drugs to inhibit topoisomerase II-mediated processes and their cytotoxicities over a range of - 100. Finally there is evidence that, in addition to DNA binding affinity, sequence selectivity of the bis-benzimidazoles also appears to play a role in the cytotoxic potency. The stage is now set for the further development of therapeutically useful agents based on the bis-benzimidazole structure.
ACKNOWLEDGMENT We thank the National Cancer Institute of Canada for financial support.
REFERENCES 1. Hurley, L. H. In Annual Reports in Medical Chemistry; Vol. 22; Bailey, D., Ed.; Academic Press, New York, 1987, Vol. 259, Chapter 26. 2. Rao, E. K.; Lown, J. W. Chem. Res. Toxicol. 1990, 3, 262. 3. Hurley, L. H.; Needham-van de Vanter, D. R. Acc. Chem. Res. 1986, 19, 230. 4. Lee, M. D.; Dunne, T. S.; Siegel, M. M.; Chang, C. C.; Morton, G. O.; Borders, B. D. J. Am. Chem. Soc. 1987, 109, 2464. 5. Stubbe, J.; Kozarich, J. W. Chem. Rev. 1987, 87, 1107. 6. Lown, J. W. In Molecular Aspects of Anti-Cancer Drug Action; Neidle, S., Waring, M.J., Eds.; MacMillan Press: London, 1983, Vol. 3, p. 283. 7. Lown, J. W. Anticancer Drug Design 1988, 3, 25. 8. Lown, J. W. Org. Prep. and Proceed. Intl. 1989, 21, 1.
94
J. WILLIAM LOWN
9. Lown, J. W. In Molecular Basis of Specificity in Nucleic Acid-Drug Interactions; Pullman, B., Jortner, J., Eds.; Kluwer Academic Publishers: Dordrecht, Netherlands, 1990, p. 103. 10. Lown, J. W. Antiviral Res. 1992, 17, 179. 11. Lown, J. W. Chemtracts - Org. Chem. 1993, 6, 205. 12. Kissinger, I.; Krowicki, K.; Dabrowiak, J. C.; Lown, J. W. Biochemistry 1987, 26, 5590. 13. Lee, M.; Krowicki, K.; Hartley, J. A.; Pon, R. T.; Lown, J. W. J. Am. Chem. Soc. 1988, 110, 3641. 14. Bailly, C.; Catteau, J-P.; Henichart, J-P.; Rezska, K.; Shea, R. G.; Krowicki, K.; Lown, J. W. Biochem. Pharmacol. 1989, 38, 1625. 15. Harshman, K. D.; Dervan, P. B. Nucleic Acids Res. 1985, 13, 4825. 16. Commings, D. E. Chromosoma 1975, 52, 229. 17. Holmquist, G. Chromosoma 1975, 49, 333. 18. Pjura, P. E.; Grzeskowiak, I.; Dickrson, R. E. J. Mol. Biol. 1987, 197, 257. 19. Teng, M-K.; Usman, N.; Frederick, C. A.; Wang, A. H-J. Nucleic Acids Res. 1988, 16, 2671. 20. de C.T Carrondo, M. A. A. DE; Coil, M.; Aymami, J.; Wang, A. H-J.; van der Marel, G. A.; van Boom, J. A.; Rich, A. Biochemistry 1989, 28, 7849. 21. Parkinson, J. A.; Barber, J.; Douglas, K. T.; Rosamund, J.; Sharpies, D., Biochemistry 1990, 29, 10181. 22. Searle, M. S.; Embrey, K. J. Nucleic Acids Res. 1990; 18, 3753. 23. Fede, A.; Labhardt, A.; Bannwarth, W.; Leupin, W. Biochemistry 1991, 30, 11377. 24. Bathini, Y.; Rao, K. E.; Shea, R. G.; Lown, J. W. Chem. Res. Toxicol. 1990, 3, 268. 25. Singh, M. P.; Joseph, T.; Kumar, S.; Bathini, Y.; Lown, J. W. Chem. Res. Toxicol. 1992, 5, 597. 26. Wang, W.; Lown, J. W. J. Med. Chem. 1992, 35, 2890. 27. Bathini, YU.; Lown, J. W. Syn. Commun. 1990, 20, 955. 28. Bathini, Y.; Lown, J.W. Syn. Commun. 1991, 21, 215. 29. Stephens, E F.; Bower, J. D. J. Chem. Soc. 1949, 2971. 30. Dubey, P. D.; Ratnam, C. F. Indian J. Chem. 1979, 18B, 428. 31. Kuznetsov, V. A.; Galabadzhiu; Ginsburg, G. E J. Org. Chem. USSR 1987, 23, 576. 32. Morgan, A. R.; Lee, J. S.; Pulleyblank, D. E.; Murray, N. L.; Evans, D. H. Nucleic Acids Res. 1979, 7, 547. 33. Baguley, B. C. Mol. Cell. Biochem. 1982, 43, 167. 34. Kumar, S.; Joseph, T.; Singh, M. P.; Bathini, Y.; Lown, J. W. J. Biomol. Struct. Dyn. 1992, 9, 853. 35. Feigon, J.; Denny, W. A.; Leupin, W.; Keams, D. R. J. Med. Chem. 1984, 27, 450. 36. Pullman, A.; Pullman, B. Quart. Rev. Biophys. 1981, 14, 289. 37. Kumar, S.; Bathini, Y.; Zimmermann, J.; Pon, R. T.; Lown, J. W. J. Biomol. Struct. Dyn. 1990, 8, 331. 38. Adnet, F.; Liquier, J.; Taillandier, E.; Singh, M. P.; Rao, K. E.; Lown, J. W. J. Biomol. Struct. Dyn. 1992, 10, 565. 39. Bailly, C.; Colson, P.; Houssier, C.; Wangh, H.; Bathini, Y.; Lown, J.W.J. Biomol. Struct. Dyn. 1994, 12, 173. 40. Beerman, T. A.; McHugh, M. M.; Sigmund, R.; Lown, J. W.; Rao, K. E.; Bathini, Y. Biochim. Biophys. Acta 1992, 1131, 53. 41. Lown, J. W., unpublished results. 42. Hsiang, Y-H.; Wu, H-Y.; Liu, L. E Biochem. Pharmacol. 1988, 37, 1801. 43. Lock, R. B.; Ross, W. E. Anti-Cancer Drug Design 1987, 2, 151. 44. Wang, J. C. Biochim. Biophys. Acta 1987, 909, 1. 45. Friedheim, E. A. H. Bull. WHO 1974, 50, 572. 46. Woynarowski, J. M.; McHugh, M.; Sigmund, R. D.; Beerman, T. A. Mol. Pharmacol. 1989, 35, 177. 47. McHugh, M. M.; Woynarowski, J. M.; Sigmund, R. D.; Beerman, T. A. Biochem. Pharmacol. 1989, 38, 2323. 48. Woynarowski, J. M. Sigmund; R. D.; Beerman, T. A. Biochemistry 1989, 28, 3850.
Bis-Benzimidazole Minor-Groove Binders 49. 50. 51. 52. 53. 54. 55. 56. 57. 58. 59. 60. 61. 62. 63. 64. 65. 66. 67. 68. 69.
95
McHugh, M. M.; Sigmund, R. D.; Beerman, T. A. Biochem. Pharmacol. 1990, 39, 7077. Hsiang, Y-H.; Hertzberg, R.; Hecht, S.; Liu, L. E J. Biol. Chem. 1985, 260, 14873. Nieson, E. M.; Tewey, K. M.; Liu, L. E Proc. Natl. Acad. Sci. USA 1984, 81, 1361. Chen G. L.; Yang, L.; Rowe, T.; Halligan, B. D.; Tewey, K. M.; Liu, L. J. Biol. Chem. 1984, 259, 13560. Tewey, K. M.; Chen, G. L.; Nelson, E. M.; Liu, L. J. Biol. Chem. 1984, 259, 9182. Rowe, T.; Kupfer, G.; Ross, W. Biochem. Pharmacol. 1985, 34, 2483. Pommier, Y.; Covey, J.; Kerrigan, D.; Mttes, W.; Markovits, J.; Kohn, K. Biochem. Pharmacol. 1987, 36, 3477. Hertzberg, R.; Caranfo, J. J.; Hecht, S. M. Biochemistry 1989, 28, 4629. Portugal, J.; Waring, M. J. Nucleic Acids Res. 1986, 14, 8735. Ness, P. J.; Koller, T.; Thoma, E J. Mol. Biol. 1988, 200, 127. Champoux, J. J. J. Virol. 1988, 62, 3675. Culotta, V.; Sollner-Webb, B. Cell 1988, 52, 585. Rowe, T. C. Wang; J. C.; Liu, L. E Mol. Cell. Biol. 1986, 6, 985. Osheroff, O. Biochemistry 1987, 26, 6402. Javaherian, K.; Liu, L. Nucleic Acids Res. 1983, 11, 461. Srivenugopal, K. S.; Morris, D. R. Biochemistry 1985, 24, 4766. Pommier, Y.; Kerrigan, D.; Kohn, K. Biochemistry 1989, 28, 995. Ishii, K.; Futaki, S.; Uchiyama, H.; Nagasawa, K.; Andoh, T. Biochem. J. 1987, 241, 111. Harshman, K. D.; Dervan, P. B. Nucleic Acids Res. 1985, 782, 4825. Andersen, A. H.; Christiansen, K.; Zechiedrich, E. L.; Jensen, P. S.; Osheroff, N.; Westergaard, O. Biochemistry 1989, 28, 6237. Gellert, M.; Mizuuchi, K.; O'Dea, M. H.; Nash, H. A. Proc. Natl. Acad. Sci. USA 1976, 73, 3872.
This Page Intentionally Left Blank
SEQUENCE-SPECIFIC RECOGNITION AN D MODIFICATION OF DOUBLE-HELICAL DNA BY MINOR-GROOVE BINDING CONJUGATES STRUCTURALLY RELATED TO N ETROPSI N AN D DISTAMYCI N
Christian Bailly I~ II. III.
IV.
Cancer, Genetics, and Chemotherapy . . . . . . . . . . . . . . . . . . . . . . . Binding to DNA and Antitumor Activity . . . . . . . . . . . . . . . . . . . . Sequence-Specific DNA Recognition . . . . . . . . . . . . . . . . . . . . . . A. Proteins and Peptides . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Minor-Groove Binding Drugs . . . . . . . . . . . . . . . . . . . . . . . Design of Sequence-Specific Minor-Groove Binding Drugs . . . . . . . . . . A. Recognition of Long AT Sequences . . . . . . . . . . . . . . . . . . . .
Advances in DNA Sequence-Specific Agents Volume 3, pages 97-156 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8 97
98 100 102 102 105 107 108
98
CHRISTIAN BAILLY
B. The Lexitropsin Approach: From Monomers to Dimers . . . . . . . . . . V. Netropsin and Distamycin Derivatives Equipped with a Binding/Modifying Element . . . . . . . . . . . . . . . . . . . . . . . . . . . A. Conjugation with Polyamines: The Microgonotropen Approach . . . . . . B. Conjugation with a DNA Alkylating Group . . . . . . . . . . . . . . . . C. Conjugation with a Photosensitive Group . . . . . . . . . . . . . . . . . D. Conjugation with a Metal-Complexing Group . . . . . . . . . . . . . . . E. Conjugation with an Enediyne Structure . . . . . . . . . . . . . . . . . . E Conjugation with a DNA Intercalating Drug . . . . . . . . . . . . . . . . VI. Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
110 118 118
119 123 127 131 132
144 146 146
I. CANCER, GENETICS, AND CHEMOTHERAPY Cancer can be adequately described as a breakdown of one or several cellular growth controlling systems. Malignant tumors arise from a long sequence of intertwined molecular events. The first step in the sequence, as well as several other latter stages, is believed to result from DNA damage which affect either the expression or the biochemical function of particular genes. Cancer is a malady of genes. 1 In most cases, the causes of point mutations, rearrangement in DNA, gene amplification, or chromosomal translocation, and the exact mechanisms by which they occur, remain enigmatic. However, if these molecular events cannot yet be predicted they can often be detected. The continuously growing body of information on the molecular biology of cancer has brought a new vision with which to develop novel approaches to fight against cancer. By understanding the mechanisms responsible for the activation of oncogenes and the ensuing malignant transformation, we have acquired new devices for the prevention and diagnosis of cancer. With the advent of gene therapy we may acquire efficient devices for the treatment of cancer. Local therapies using surgery, radiotherapy, and certain forms of chemotherapy often permit tumor eradication when the malignant cells are confined to the treated area. This is so in about one-third of cancer patients but for the majority some form of systemic therapy is required. Patients with widespread cancer have to face treatment combining high-dose regimens of chemotherapy using cytotoxic drugs and sometimes radiotherapy. While there are numerous successes for Hodgkin's disease, non-Hodgkin's lymphoma, childhood leukemia, and certain forms of testicular cancers, only a small proportion of the advanced cancers such as those of the lung, breast, and colon can be cured. Even the most sophisticated, the most destructive, and the gloomiest treatments cannot get rid of certain forms of common cancers. It is sad to have to admit that despite the enormous efforts in new drug development, drug combination with cytokines, and the improved high-dose regi-
Recognition and Modification of Double-Helical DNA
99
mens, there still remain a significant proportion of cancers that do not respond to any of the available therapies. In most cases, if chemotherapy fails, death results. In recent years new hopes have been founded on the use of oligonucleotides to inhibit specifically the expression of certain genes and/or the production of cellular oncoproteins. The utilization of short DNA fragments to inhibit, or to facilitate in certain circumstances, the expression of oncogenes or tumor-suppressing genes may provide efficient ways to selectively control the development of tumor cells. Oligonucleotides have proved very useful as tools to help decipher the pathways controlling cell growth and differentiation. The use of natural and chemically modified oligonucleotides has largely contributed to our growing understanding of oncogene action and the numerous molecular events leading to malignancy. But so far, antisense and antigene oligonucleotides rather constitute tools for genetic analysis than new anticancer drugs. The antisense (RNA-targeted) and antigene (DNA-targeted) approaches offer rational means to interfere specifically with the function of oncogenes. 2-4 One may conceive and hope that soon oligonucleotides will take their place in the armament against cancer. However, there is still much to learn about the potential use of oligonucleotides before any therapeutic application can be contemplated. 5 Gene therapy is another emerging approach for cancer treatment. 6'7 Promising results have been obtained in a restricted number of trials dealing with advanced cancers. Genes coding for the tumor necrosis factor, interleukin-2, thymidine kinase, and the proteins K-ras and p53 are among those few genes which have been tested so far for gene transfer. In just a few years the use of molecular genetics to specifically manipulate tumor cells so as to provoke their destruction has become a palpable clinical reality. Gene therapy offers promising perspectives for enhancing tumor immunogenicity, vectoring cytokines to tumors, inserting drug activating genes, suppressing oncogene expression, replacing defective tumor suppressor genes, and marking tumor cells. 8 In the last 2 years we have witnessed the first successes of this approach but it is still too early to foresee the real potentiality of gene therapy in the daily practice of medical oncology. Our knowledge of the mechanisms of gene transfer are still too sparse for a true consensus picture to emerge. Alongside the .safety, ethical, and social concerns, there are numerous scientific problems still to solve before we can transfer genes efficiently and stably into tumor cells in vivo. This is not to deny that in the future it is likely that gene therapy will bring decisive clinical benefits to the treatment of chemo-resistant cancers and other genetic diseases. However, whatever the degree of hope, DNA as a pharmaceutical agentmbe it an antisense, an antigene oligonucleotide, or a transfer genemyet remains a cherished goal and not a reality. For more than 50 years and for the foreseeable future it has been and it will remain necessary to administer to patients a "small molecule" and in most cases a combination of drugs to fight the tumor and the disseminated malignant cells. 9 Over the last two decades impressive advances have occurred in the development of new molecules as well as refined applications of existing drugs. Nowadays, cancer
100
CHRISTIAN BAILLY
pharmacologists and clinicians dispense a somewhat confusing array of compounds with widely different mechanisms of action. There are about 60 potential therapies for the treatment of cancer among a total of more than 100 products under development worldwide. Each of the about 45 drugs which have been accepted as useful for the treatment of human tumors is the result of intense screening in vitro and in vivo, and has undergone years of intense clinical testing in many countries. Any new compound, as promising as it may appear after the primary screening, must be tested against a panel of tumor cells of different histological types to investigate selectivity of effect. The preclinical development is mandatory to identify acute and long-term toxic side effects, to determine a maximum tolerated dose, and to help define optimum schedules and therapeutic index. Only then can the phase I clinical evaluation begin, possibly followed by phase II and phase III clinical trials.
II. BINDING TO DNA AND ANTITUMOR ACTIVITY The different series of cytotoxic and noncytotoxic compounds used in chemotherapy are indicated in Table 1. Compounds which interact with nucleic acids represent by far the largest class of antitumor drugs. 1~ According to the mechanisms of interaction with DNA, the drugs are usually (and somewhat artificially) categorized into DNA alkylating, intercalating, groove binding, and cleaving agents. The major DNA-interacting anticancer drugs either approved for clinical use or still under clinical development are listed in Table 2. For all these drugs, DNA constitutes the
Table 1. Principal Series of Antitumor Drugs
Cytotoxic compounds antimetabolites antimitotic alkaloids DNA-alkylatingagents non-covalentDNA-bindingantibiotics topoisomeraseinhibitors tubulin interactingagents Noncytotoxic compounds hormones growth factors cytokines monoclonalantibodies modulatorsof resistance differentiation modifiers chemopreventionagents angiogenesiscompounds chemo- and radio-protectors.
Recognition and Modification of Double-Helical DNA
101
Table 2. Principal Series of Antitumor Drugs Acting on DNA Used in the Clinic or Under Clinical Trials Alkylating agents nitrogen mustards mechlorethamine chlorambucil melphalan cyclophosphamide ifosfamide nitrosoureas carmustine lomustine aziridines thiotepa triethylenemelamine trenimon alkylsulfonates busulfan epoxides dianhydrogalactitol dibromodulcitol platinum analogues cisplatin carboplatin others procarbazine dacarbazine mitomycins
Intercalating agents anthracyclines daunomycin doxorubicin epirubicin idarubicin anthraquinones and derivatives mitoxantrone piroxantrone merbarone oxanthrazole acridines amsacrine nitracrine DACA others actinomycin D amonafide, mitonafide elliptinium DNA cleaving agents bleomycin antibiotics bleomycin A2 phleomycin tallysomycin Minor groove binders mitramycin adozelosin Others cristanol dynemicin misonidazole camptothecin derivatives
major but not unique intracellular target. Within each class of compounds one can find homologous series having similar, if identical, DNA binding capacity but displaying variable antitumor properties. For example, the literature is replete with DNA intercalating agents but only a few exhibit useful therapeutic properties. Moreover, the biological properties vary considerably: some intercalators are potent anticancer drugs (e.g. daunomycin, actinomycin, amsacrine), whereas other rather exhibit antiparasitic (e.g. lucanthone, pyronaridine), antiviral (e.g. tilorone),
102
CHRISTIAN BAILLY
or antimicrobial (e.g. ethidium) activities. II Other potent intercalators are carcinogenic (e.g. certain polycyclic aromatic hydrocarbons). Moreover, some intercalators display a GC selectivity, whereas others prefer AT sequences.12-16 Therefore, if in the 1960--1970s DNA was considered the principal, if not the unique target for antitumor drugs, nowadays DNA is widely considered as being a possible but neither a unique nor a mandatory intracellular target for antitumor action. This dogma was best illustrated recently with the discovery of potent antitumor drugs such as taxol which do not interact at all with DNA. Therefore, on the one hand, it seems possible to disregard DNA in the rational scheme of antitumor drug discovery but, on the other hand, the demonstration that the malignant transformation of a cellmbe it a cell of the blood, lung, liver, or brain---due to an alteration of particular genes, strongly call for the development of DNA-interacting substances. 17'18Moreover, DNA is probably the best structurally characterized target. Its large size and its seemingly repetitive and ordered structure make it an attractive receptor for drug design. A nonspecialist tracking the literature relevant to DNA structure might conclude that all aspects of DNA structures are now elucidated by the advances of X-ray crystallography, NMR, and many other sophisticated spectroscopic and biochemical techniques. It is true that we possess an overwhelming body of information on DNA conformation. Numerous three-dimensional structures of oligonucleotides have been solved to atomic resolution; the notion of flexibility, bendability, and supercoiling become more and more palpable. But despite all these important discoveries, DNA remains an elusive target for selective drug action. 19 The search for sequence-specific DNA binding ligands has attracted considerable interest over the last 15 years but at the present day there neither exists a drug capable of recognizing a unique sequence in DNA nor one can certify that chemotherapeutic selectivity will be improved by virtue of an increase in sequence selectivity.
III.
SEQUENCE-SPECIFIC D N A RECOGNITION
There are two channels of information in DNA: the minor-groove and major groove which present different characteristics in terms of hydrogen bonding and electrostatic potential. The conventional wisdom argues that proteins access the genetic information via the major groove, whereas drugs use the minor-groove to read DNA. Although this idea remains on the whole correct, this simplistic view is gradually changing with the discovery of proteins which interact within the minor groove and small molecules which can reside in the major groove upon binding to DNA. The design of sequence-selective small molecules has largely profited from the elucidation of the mechanism of protein-DNA recognition.
A. Proteins and Peptides DNA binding proteins such as activators, repressors, and certain endonucleases have the capacity to recognize DNA with a high level of sequence specificity. The
Recognition and Modification of Double-Helical DNA
103
molecular recognition process between a given transcription factor and its specific target sequence permits precise regulation of gene expression and other genetic events. The sequence-specific protein-DNA recognition is mediated by structural elements such as the well characterized helix-turn-helix, leucine-zipper, and the Cys-Cys or Cys-His zinc-finger motifs. 2~ The three-dimensional shape of the motif, which is to a large extent determined by the amino acid sequence of the protein, ideally adapts to that of the target nucleotide sequence (and vice versa) but there is no simple recognition code whereby a given base pair on the DNA is recognized by a given type or combination of amino acids on the protein. DNAprotein recognition involves a complex network of interdependent hydrogen bonding, van der Waals contacts, and ionic interactions. The high level of complexity often observed in protein-DNA interactions makes it difficult but, however, possible to envisage the design of protein-like effectors capable of recognizing specified DNA sequences. 22 Moreover, during the past decade it has become obvious that in most cases, in addition to the direct recognition (digital readout), it is necessary to consider an indirect recognition (analogue readout) as a major determinant of sequence selectivity. The local conformation of the DNA molecule can have a profound, if not a dominant, influence on protein-DNA interactions. 23 For these reasons, the structural domains encountered in proteins do not yet offer many possibilities for designing sequence-specific DNA-reading small molecules. Proteins or peptide motifs have been coupled with DNA binding/cleaving functionalities but even if sequence-specific binding has been achieved these molecular tools are more valuable for genetic analysis than for therapeutic purposes. Alongside the regulatory proteins which make sequence-specific contacts with the edge of base pairs exposed in the major groove of DNA, there exist a category of proteins which recognize DNA sequences primarily via interactions within the minor groove. 24 For example, the bacterial integration host factor (IHF) and the non-histone chromosomal protein HMG-I bind to the minor groove of DNA. 25'26 A number of recent studies have revealed that these proteins often possess particular proline-rich amino acid sequences that may be considered as a kind of architectural domain capable of recognizing minor groove features. The list of proteins that interact with specific sequences via the minor groove of DNA is rapidly growing. The list includes several chromosomal proteins (e.g. histone HI) and related proteins involved in DNA condensation (e.g. the bacterial HU protein) as well as certain gene-regulatory proteins such as the RNApolymerase II transcription factor TFIID which, on binding to the TATA box element, results in DNA bending. 27-29 Most of these minor groove binding proteins bind preferentially and sometimes specifically to AT-rich sequences. 24'3~ It is likely that the proteins recognize a localized sequence-dependent DNA structure, i.e. a narrow minor groove or intrinsic bend than rather a primary AT sequence (analogue readout as opposed to digital readout). The best studied model for protein-DNA minor groove recognition is perhaps the SPXX motif (S for Ser; P for Pro, and X for a basic amino acid residue such as
104
CHRISTIAN BAILLY
K for Lys or R for Arg). 34-37 The SPKK peptide is believed to adopt an H-bond stabilized I]G-turn structure that confers to the peptide a crescent shape conformation, complementary to that of the minor groove and would thus permit the adjacent amide group to face the bases so as to hydrogen bond with A.T base pairs. 38'39 Although the precise structures of such SPKK motifs have yet to be experimentally established, it is clear that they actively participate in sequence-selective DNA recognition. Such basic peptide motifs have been shown to participate in the mechanisms of binding to DNA of TFIID and HMG nuclear proteins, but they are also encountered with major-groove binding proteins such as GCN4 and the 434 repressor. They are supposed to contribute actively to the interaction with DNA, perhaps also to the sequence recognition process. The degree of sequence selectivity of minor-groove binding proteins is generally several orders of magnitude lower than that of major-groove binding proteins. However, a moderate sequence selectivity such as that of HMG- 1 protein may be relevant to the in vivo function of the protein, providing that the target sequences are sufficiently abundant. 4~ As such, minor-groove binding proteins and SPKK peptide motifs provide interesting opportunities for designing drugs capable of recognizing AT sequences selectively.41-43 Minor groove recognition of DNA by proteins can also occur by oc-helix motifs. For example, the DNA binding domain of the purine repressor PurR contains both a helix-turn-helix motif and o~helices that make base specific contacts in the major and minor grooves, respectively. 44 A structural analogy between minor-groove binding drugs and SPKK-containing peptides was proposed to explain the selective interaction with AT sequences. 34'35 The antibiotics and drugs netropsin (1), distamycin (2), pentamidine (3), Hoechst 33258 (4), DAPI (5), and berenil (6) all adopt a crescent shape conformation roughly complementary to the spiral of the DNA double helix. They share the common properties of binding to DNA by displacing the spine of hydration within AT-rich sequences of the minor groove. 45-49 The bis-benzimidazole derivative Hoechst 33258 (4) effectively competes with a (SPKK)6 peptide for binding to
H2N'~NH
H2N"
NH
HN
(1) netropsin
H2N'~NH
HN,~.NH2
HN O
HN O
HN
HN H3
~r--N,.
HN
o
t
CH3 (2)
distamycin
H3
0 ~.,,,.~0 T
~
NH2
(3)
pentamidine
Recognition and Modification of Double-Helical DNA
105
/CH3
N"
HN
HO~"-~ . . /
L)
,, NH2
(4)
(5)
Hoechst 33258
~
H2N
DAPI
(6) berenil
DNA 34'35and both ligands preferentially recognizes the same AT-rich sequences. 5~ These experimental results together with the predictive I]-turn structure of the SPKK peptide have reinforced the idea that the SPXX motif represents an "AThook. ''51 However, recent NMR studies argued against such a proposal but showed that related basic peptides containing PRGRP (but not PKGKP) motif bind specifically to AT sites. The authors postulated that the arginine guanidinium groups are major determinants of the AT specificity. Unlike the SPKKSPKK octapeptide, the SPRKSPRK peptide apparently does not fold into a I]-turn structure but adopts an extended conformation suitable to fit into the helicoidal cleft of the DNA, as observed with the well-characterized minor-groove binding drug netropsin. 52
B. Minor-Groove Binding Drugs Many low molecular weight molecules such as 1-6 fit within the minor groove of DNA but only a few exhibit antitumor properties. Such is the case for the antibiotics CC-1065 (7) and mithramycin (8) isolated from fermentation broths of Streptomyces zelensis and S. plicatus, respectively. Mithramycin (Plicamycin| belongs to the aureolic acid group of antibiotics and consist of a heterocyclic chromophore substituted with a hydrophilic side chain, and two carbohydrate moieties. Mithramycin has antitumor activity in disseminated embryonal cell carcinoma of the testis, but its primary uses are in the treatment of (1) hypercalcemia of malignancy unresponsive to other treatments, (2) Paget disease of bone, and (3) to promote maturation of myeloblasts in patients with the blastic phase of chronic myelogeneous leukemia. 53 The antitumor activity of mithramycin and its chemically related analogues, chromomycin and olivomycin, is believed to result from inhibition of DNA and RNA synthesis as a result of its complexation with DNA. It has been postulated that the antitumor activity of mithramycin results from selective blocking of formation of transcription initiation complexes of genes with GC-rich promoter regions, including the c-myc oncogene. Sequence-selective binding of mithramycin to GC-rich sequences blocks the binding of the transcription factor
106
CHRISTIAN BAILLY
OCH3
"~:"
~X, NH
o
/~~,,~O ~
/.,~ /.,&
H OCHa OH
"o
.,,~- O
/~,,.~
.~c" ",f ",f "n" o.o. o
(7)
(s)
cc- 1065
mith ramycin
OH
~'o-
H,c ?m
- ~ 6.u
o
H
Spl to a GC-rich element upstream to the TATA box of the promoter P1 of c-myc. 54'55 Mithramycin also inhibits the formation of an intermolecular triplex in the human c-Ki-ras promoter. 56 The sequence-specific recognition of DNA by mithramycin prevents the binding of important regulatory proteins (e.g. RNA polymerase II), thus inhibiting formation of transcription initiation complexes. Although early studies suggested that mithramycin intercalates into DNA or binds to the major groove, it is now clearly established that the antibiotic binds as a divalent cation coordinated head-to-tail dimer to the minor groove of DNA. 57'58 The antiparallel alignment of two Mg2§ mithramycin molecules generates a right-handed continuous hexasaccharide domain which spans six base pairs in the minor groove of DNA. The aureolic acid antibiotics are unique among minor-groove binders because they bind selectively to GC-rich sequences 59'6~ whereas all other groove binders display an AT selectivity. As for netropsin, the guanine 2-amino group is a key element for sequence-specific recognition of DNA by mithramycin. It would be most interesting to use mithramycin or chromomycin as a model for designing simpler molecules capable of reading GC sequences. However, given the absolute requirement for divalent cations such as Mg 2§ or Zn 2§ for binding to DNA, and the high complexity of the drug-DNA recognition process, at present it has not been possible to elaborate mithramycin-like molecules mimicking the carbohydrate side chains which actively participate in the GC specificity. Although both drugs interact within the minor groove of DNA, CC-1065 (7) is at the antipode of mithramycin in terms of DNA recognition. (+)-CC-1065 reacts with double-stranded DNA through N-3 of reactive adenine forming a covalent adduct that overlaps a 5 base pair region in the minor groove. CC-1065 reacts specifically with 5'-AAAAA* and 5'-PuNTs sequences and has a number of unique characteristics. It is one of the most potent cytotoxic drugs and shows efficacy against a wide variety of tumors in vitro. At the same time, it represents the "ideal" drug to bind to the minor groove of DNA. Among 1000 molecules tested for their ability to fit into the minor groove, CC- 1065 ranked first and thus appeared to be much more suited than netropsin to complement to the minor groove of an
Recognition and Modification of Double-Helical DNA
107
AT-tract. 61 The discovery of unusual delayed lethality in mice precluded CC-1065 from clinical evaluation. However, its optimal adaptation to the minor groove coupled with its unique sequence recognition properties make CC-1065 an attractive model for designing less toxic analogues. A large number of derivatives have been synthesized and some of them such as the DNA-DNA interstrand cross-linker dimeric derivative U-7779, the prodrug U-80244, and adozelesin exhibit improved antitumor efficacy over CC-1065, and do not show delayed lethality. These drugs have now entered Phase I clinical trials. Comprehensive review on the DNA binding properties of CC-1065 (and the duocarmycins) and the development of antitumor analogues have been reported by Hurley 62'63 and Boger.64 The desire to synthesize molecules capable of recognizing specifically defined sequences in DNA has been a powerful stimulus during the last 10 years. Most of the approaches developed to create sequence-specific small molecules are based on the capacity of the antiviral drugs, netropsin (1) and distamycin (2), to bind selectively to AT-rich sequences. 65 Twenty years after the initial work of Wartell et al. 66 the study of the mechanism of binding of netropsin to DNA continues to arouse interest. The three-dimensional structures of netropsin and distamycin complexed to a variety of oligonucleotides containing an (A-T)4_6 tract have been solved to atomic resolution. 67-7~ In addition to crystallography, a multiplicity of spectroscopic techniques (visible, UV, IR, Raman, CD, LD, and NMR) have been used to further characterize netropsin-DNA complexes. Many thermodynamic and chemical studies have also been reported. Molecular modeling investigations have aided to define accurately the contribution of the electronic component of the DNA binding reaction and to design analogues. Taken together, these studies have led to a detailed understanding of the mechanisms whereby netropsin and distamycin engage in contact with the edge of A.T base pairs in the minor groove of B-DNA. Three main factors contribute favorably to the stability between AT sequences and netropsin or distamycin: (1) hydrogen bonding between the amide NH of the drug and thymine 0-2 and adenine N-3 atoms; (2) an overall shape complementarity as a result of close ligand-DNA van der Waals contacts; and (3) electrostatic interaction between the polyanionic DNA and the cationic drugs. It is assumed that the van der Waals interactions are pivotal in the sequence recognition. 72-74The knowledge of the mechanisms of interaction between AT sequences and the antibiotics netropsin and distamycin has greatly aided in the design of sequence-specific DNA binding molecules.
IV.
DESIGN OF SEQUENCE-SPECIFIC MINOR-GROOVE BINDING DRUGS
Several hundred derivatives of netropsin/distamycin have been synthesized since the first crystallographic studies. 67 This review is concerned with the different categories of netropsin and distamycin derivatives synthesized during the last 10 years and the many conjugates which are currently being developed.
108
CHRISTIAN BAILLY A. Recognition of Long AT Sequences
In 1985, oligo(N-methylpyrrolecarboxamide) molecules were synthesized with the aim of targeting large contiguous AT-rich sequences. 75 riffs-, tetra-, penta-, and hexa-N-methylpyrrolecarboxamide derivatives were shown to bind to sequences containing 5, 6, 7, and 8 contiguous A.T base pairs respectively. These studies led Dervan to deduce the following rule: the binding site size for an analogue containing n-1 pyrrole rings or n amide bonds is n + 1 base pair long. 76 This rule is valid for analogues containing up to six N-methylpyrrolecarboxamide residues. Longer molecules exhibit a lower affinity for DNA. A hepta(N-methylpyrrolecarboxamide)
NH
HN
N...jI
H
H3C'
H
-,,,o ~L.I~'CH3
O
flexible bis-netropsins (9) n= 1-10
HNH' CC~N:~NH NH
H3C
NHNH
~ i
~~N~c)HN
H
H
:
i ~
,
121
i
O (10)
o
i
rigid bis-netropsins
HN
~CH 3
109
Recognition and Modification of Double-Helical DNA HN'~NHz HN G/y G/y O H2N, 0 ~, ~ . 0 ~.-" /I~.~N" ..H\N'~,,"NH NH--..-/ ~ H / H Cys% Gly L ~N.~~ H3C~ N.'~ -n- ~ /.~NH H3c_NN/~ O--.'--,NH
l
HN
S/
O ",, JL Gty
I
HN,./~f'--NH
\
Gly ~1~ ":
0
Cys
('~N-CH3 ,,~ HN O
~....N
"CH3
H i /'~N,H.
"~0 "'_'~/N "~0 u
\ S
O
Gly
"~
Gly
2
Gly-Cys-(Gly)3 - - netropsin
netropsin - - (Gly)3-Cys-Gly NH2
(11)
,
derivative does not fit very well with the natural twist of the DNA presumably because the molecule gets out of phase with the base pairs along the minor groove floor of the double helix. Indeed, the pyrrolecarboxamide unit is approximately 20% longer than required to match perfectly the base pair rise in the minor groove. 77 Two alternative strategies to circumvent the lack of dimensional correspondence between the DNA and N-methylpyrrolecarboxamide-containing ligands have been envisaged. The first consists in joining two netropsin or distamycin molecules by a linker of suitable length to permit bidentate binding to DNA. A considerable number of bis-netropsins containing different types of linkers have been elaborated. 78-8~ Bis-netropsins coupled by a polymethylene tether (9) can engage in bidentate binding providing that the connector contains at least three methylene groups. However, owing to the flexibility of the aliphatic connector, monodentate binding of such bis-netropsins is also possible. In contrast, bis-netropsins possessing conformationally rigid linkers (10)can readily bind to sequences containing 8-10 consecutive AT base pairs without parasite binding to shorter sequences. 81'82 For chiral bis-netropsins, the stereochemistry of the linker is critical, and may be used for controlling the directionality in binding to DNA. 83The linker can also play an active role in the DNA recognition process. For example, the bis-netropsin analogue 11, in which the two netropsin residues are connected by a disulfide bond between two Gly-Cys-Gly peptides, binds better to sequences containing a central GC step such as (AT)3(GC)2(AT)3 than to a strict homologous (AT)n sequences. 84'85 The second strategy consists of replacing the carboxamide bond in netropsin and distamycin with shorter keto or amino linkages. Molecular modeling predicts that isohelical molecules such as 12 and 13 (called isolexins) would bind more tightly
110
CHRISTIAN BAILLY
H2N
H2NONH
H,~-H
~
~__N ~H '
HN~NH2
(12)
(13)
H2N'J~H
,~ 7"N N~
NH "~
0
.~0
HN==~ NH2 isolexins
H2N'~H
sCH3
ff
H H3C~NHf (14)
--
L.~N~N_CH3 HsC
vynilexins
"CH3 (15)
in the minor groove than their corresponding carboxamide analogues. 77'86 As for lexitropsins (Section IV.B), the use of imidazole or furan rings would favor recognition of GC sequences. In the same way, the computational studies predict that the replacement of the carboxamide bond of netropsin with an ethylene bond (compound 14) would permit an optimum fit to the minor-groove surface. 87 According to the computational measurements, molecules called vynilexins containing b o t h - C - - C - linkages and imidazole and/or furan heterocycles (e.g. compound 15) would display a considerable preference for GC-rich sequences. 88 Although very promising, so far neither the isolexin nor the vynilexin strategy has been experimentally tested.
B. The Lexitropsin Approach: From Monomers to Dimers Computational studies have suggested that the 2-amino group of guanines are primarily responsible for the lack of binding of netropsin and distamycin to GC sequences. 77 Indeed, the guanine 2-amino group protrudes into the minor groove and thus obstructs the access of these drugs to the floor of the groove. The fact that the 2-amino group constitutes a critical recognition element for binding of small molecules in the minor groove of DNA was recently clearly demonstrated. The expedient of preparing homologous DNA molecules containing inosine and/or 2,6-diaminopurine residues in place of guanine and/or adenine residues, respectively (Figure 1), has been used to investigate the exact role of the purine 2-amino group in determining the preferred binding sites on DNA for different groups of antibiotics including netropsin. 89'9~ Footprinting experiments using PCR-made DNA fragments containing A.T, G.C, DAP.T, or I.C base pairs chosen at will, revealed unambiguously that the binding of netropsin in the minor groove of DNA depends critically upon the presence or the absence of the 2-amino group of guanines. In normal DNA containing the four canonical bases, netropsin binds selectively to sequences lacking the 2-amino group, i.e. to AT sequences, as
Recognition and Modification of Double-Helical DNA N
H
.0~. _/CH3
~, A 'I~I........
"~..-N
N~.(
0
H
r-~N
...H-N ...... ....
/
"
N
111 H
.Q.
N~.~,
CH3
..... 0
H "N'H .......
H r~N
/
H
.... H-N .....
or
,
H.N,,H .... --
Figure 1. Structures of purine-pyrimidine Watson-Crick base pairs involving natural and unnatural nucleotides.
expected. DNA molecules in which all purine residues bear a 2-amino group (DAP-substituted DNA) do not bind netropsin at all, even at drug concentrations as high as 100 l.tM. On the opposite, the use of DNA molecules containing I.C and A.T base pairs (inosine DNA) results in a nonspecific binding of netropsin to DNA since in this case all sequences lack the purine 2-amino group. DNA in which the 2-amino group has been shifted from guanines to adenines (I+DAP doubly substituted DNA) show a complete redistribution of netropsin binding sites; netropsin binds exclusively to IC sequences. 89For all minor-groove binders tested (netropsin, distamycin, berenil, Hoechst 33258, DAPI, and pentamidine) as well as for intercalating and DNA-cleaving drugs, the repositionment of the guanine 2-amino group is sufficient to alter the drug-DNA recognition process. 89-94 Given both the strategic position of the guanine 2-amino group in the minor groove and its hydrogen-bonding capacity (it is the only H-bond donor exposed in the minor groove), it was proposed that the introduction of a H-bond acceptor heteroatom in the pyrrole rings of netropsin might permit the drug to bind to GC sequences. 77 Lown and coworkers have extensively exploited this concept and synthesized an impressive number of molecules christened lexitropsins or information-reading oligopeptides structurally related to netropsin and distamycin. 95'96 By substituting imidazole, thiazole, triazole, pyrazole, or oxazole heterocycles for the N-methylpyrrole rings of netropsin, it is possible to design drugs capable of binding to sequences containing one or two G.C pairs embedded in an AT sequence (Figure 2). Among the numerous lexitropsins synthesized so far, imidazole-lexitropsins such as compounds 16-18 display the most pronounced capacity for binding to GC-containing sequences. 97-1~ Thiazole-lexitropsins either accept or avoid a G.C base pair in their binding sites depending on the position of the sulfur atom. 1~ For example, the lexitropsin 19 with the sulfur atom directed into the minor groove does not bind to GC-containing sites, whereas the lexitropsin Thia-Nt 20 containing two thiazole rings with the sulfur atoms directed
112
CHRISTIAN BAILLY CH3
CH3
O fl
NI
~--/,~C\N,,~--ZN/
netropsin .... I'1'"-- C"
o .N_CH;2~ -~N ' ~H, ._ ' T : H i
NH
i
H
H
!
II
~
?
N-S
a inward '.
_
s ~
9 Z. I ~
,
~N
N~_.. N__
/
i~.
"~c
/
O/'%N
H,C/~'~j
.....
~
,-1
II
\\
O~ Z~
Ir
/a-
"
-
NH
CH3
pyrazole o
.~ ...........
..... ~'"
........,- ~ . _ o . ,
~c,~
nz"'C ~ t ' ~ - ~ ~ " ~ /'/'~_ lai
/I
.,
o ..."
c~(''" N-- N/ ,.~N_...// t
NHi I
'
/
iH
furan ,----.a
"
I%~X"
",, H '"-
""O:"";,'Nc H oxazole
.~; ~ _ i
%'~"~ " u , ,
St'~
II i
i
:' N~ C":"N~ o i \\ / i I
0 '" Y
thiophene
O
N-3
~.T" ~ c ,
.
CH3
'hi . . . .
H ~U"
~..~ / C 2~ 0-2 / C 2 "
thiazole s ~ward
lexitropsin
. /N~r,u_CH2 H 7"2 "C--NH2
"
.c~.. " A ' T
c+o
2P
NH v 2
~~C;
I
1 I
HiN-cz t
/\
N \ G
~
G I/C2.NH 2 ~
/
~ ,; N--~
imidazole
~=o
H.... N/"........ ~N
-..
I
H"..... ~..~o "N ........... N.,.,~
~
triazole "
pyrldlne
Figure 2. (Top)Representation ofthe binding to DNA of netropsin. (Bottom) Proposed representation of a model lexitropsin molecule with guanine residues in DNA. Heavy arrows are hydrogen bonds, from donor to acceptor. Dashed lines mark close van der Waals nonbonded contacts between DNA and drug.
outwards from the minor groove binds best to alternating purine-pyrimidine sequences such as 5'-TATGAC and 5'-TGCATGC. ll3 However, this compound remains capable of interacting with AT sequences. The same types of results were obtained with the furan-containing lexitropsin 21. ]14 To make a long story short, the lexitropsin approach based on 1:1 complex has led to minor groove binders with increased tolerance for G.C base pairs in the binding site, but did not lead to the design of a purely GC-specific molecule. 115 According to computational studies, the observation that most lexitropsins can accommodate both AT- and GC-containing sequences comes in part from the fact that the electrostatic potential in the minor
Recognition and Modification of Double-Helical DNA
HzNLNH
H2N.~NH
HN ..0
N~
..Y
H3C'~N"CH3 L~
HN -O
N'CH3
(16)
113
HN .~
NZ N'CH3
N
.)-=/
.)=/
(17) imidazole-lexitropsins
"CH3
~"' (18)
CH~ H2N
H2N ~N
~CH~
HN
H
~
HN
~CH3
o
,So
,.
(19)
/,o
c H2N
thiazole-lexitropsins
(20)
(21) furan-lexitropsin
(22) pyridine-lexitropsin
groove of AT-rich regions is very negative. 116The electrostatic interactions between AT sites and the positively charged end groups in the lexitropsins presumably provide the initial attraction. The binding of mono- and dicationic minor-groove binders to AT-rich regions has a significant electrostatic component. 71'117'118However, that neutral lexitropsins show the same interaction with AT sequences as the monocationic distamycin tripeptide, argues against the role of electrostatics in sequence selectivity. 119 An alternative approach to design minor-groove binders capable of binding G.C pairs is to connect a netropsin-like molecule with GC-recognizing elements. For example, substitution of the terminal formamido-methylpyrrole group of distamycin for a pyridine group (compound 22) permits the interaction with a G.C base pair. However, as for the imidazole-lexitropsin, the binding to pure AT sequences is not abolished. ~2~ The bithiazole moiety of the antitumor drug bleomycin has offered opportunities for binding to GC sites. Indeed, we showed that a netropsinbithiazole hybrid 23 ligand binds specific sequences in DNA. The netropsin moiety
114
CHRISTIAN BAILLY CHa I _..1~
O
/O
H
c~O
14
NH2
H
~C2~
C-
/ ~,~
o-2 / ~ 2
T ~
o-2
~C2
N-3
A N o.z
/N
/
, H
HN
bithiazole-netropsin (23)
Figure 3. Proposed binding model of the netropsin-bithiazole 23 to the sequence 3'-CGTAT. Heavy arrows are hydrogen bonds, from donor to acceptor. Dashed lines mark close van der Waals nonbonded contacts between DNA and drug.
drives the conjugates to AT sites and allows the appended bithiazole unit to contact a pyrimidine-G-pyrimidine motif. Footprinting studies supported the model shown in Figure 3 for the interaction of the netropsin-bithiazole conjugate to the sequence 5'-TATGC. 121 This model supported previous modeling studies showing that the bithiazole-carboxamide moiety of metallobleomycin interacts with the guanosine residue of the 5'-TGC motif.122 The lexitropsin approach seemed in a somewhat wrecked state until it was reported that distamycin can form 2:1 complexes with short oligonucleotides. 123-127 The minor groove of the l l-mer d(CGCAAATTGCC) and the 12-mer d(CGCAAATTFGGC) can expand slightly to simultaneously accommodate two distamycin molecules associated side-by-side in an antiparallel head-to-head orientation (Figure 4). Subsequently, the 2:1 drugs:DNA motif was evidenced with different distamycin analogues including a carbamoyl tetrapyrrole derivative. 128 This landmark discovery immediately inspired the design of homo- and heterodimeric ligands. Imidazole- and pyridine-containing lexitropsins (compounds 24 and 25) were combined side-by-side so as to permit direct interaction with G-C pairs via hydrogen bonding with the 2-amino group of guanines (Figure 4). 129-132 The sequence selectivity, affinity, and geometry of the drug-DNA 2:1 complex can be optimized by adequately choosing pairs of ligand molecules with complementary recognition properties and by covalently linking the two DNA-reading elements (compounds 26, 27). 133-138 In recent years, important discoveries in this emerging field have been reported. A cross-linked dimeric lexitropsin possessing two distamycin-like residues connected by a heptakis(methylene) linkage exhibits a binding affinity for AT sequences approximately 1000 times higher than that of the monomer. 139'14~Hairpin pyrrole-imidazole polyamides, such as 28 and 29 which
Recognition and Modification of Double-Helical DNA CH=
o
k~
o
,.NH~
"
~
H,C / C - - N
~j~ N-"'~
9
F--~(* /
~,,,
I
..~
. ..............A . T /
I
..........
o I
"c'N--H ...........
L N~
I
/ /
o% ~ A ~ . T
, I ~
L-t
~CH=
~
H~i
~. /---'~ / \N--,~, c.=
"y
3 ' /
.... C . G .......-c.,
~ /
H
'~'N/---'
rlk
_
/""N"'C ~ 2)
"
i:
(24)
c,.
CHa
o
,~:-c,,
C',,N...,.J
1 / o ~'~ '. ...............A'T' ..c, , c - . , /, ~-~ " ............... / / A o
y
~C"
...... C . G ....~ j
._.
"'" ...............
. 2 G o C ............
. 5'~ T ~.A~ ............ % /
"*
H / H,C-.?N/----' +~
0.3
.~. N,.
L,',
\
"-% j~
11
~I~N / 0 ~H
(25)
=
/
0
' c ~'
~
oIL~-~- N.,..,..
Hac
Y
,.--o
/ .o.. --ff T . A ......... - , ~o
.L
3 ' /
/
9
~
N.......
........ / /
/
/
....... -:~.(2... ./'"-.-, v ".....H
,, I A ; ' T - - A 3' / H fN CH~
C
o"
4/
".......,,,, ,--c. a Y
.........."-,.'C-'o
G'C
. ........................ / C ' G/, , . ,
.=c. ,,
,
'- . "-. . . .
"
/~-~ H=IC~,N,~ ,~-
A .T/
oC--N
. ........../ . ............. / / _ % ........ O.. * G .
H"
hO
~'~c.. ,.-4"-C'o
distamycin
.
1
.........."-,
oH3
c,:
/
I1~
........ / / ..............Te A/.. ...... H--N /
[
CH~
/
. ........ A - T /
.~G.C ,,~T.A-~---
o
O
../-'~ 1 /
...............
MaC.N,/~.N."
.........
2,,,
__.,-c.J
H:IC% ? - - N N H
H
.............- A * T .... r / / " ".~lSC.o
/ . 5 , 1 # . lA l o / "w--...........
(•HI§
o
% P~
/
T.A,......,.o
H .........
115
".,
/
N--C~ " ~
.....~ o ~ /
C"=l
.._~"-R,/-%, \~
"N"..,
0
(30)
Figure 4. Homodimeric binding models for the complexes between a target DNA sequence and distamycin and the lexitropsin molecules 24, 25, and 30. Hydrogen bonds (dashed lines) can be formed (1) between the amide NH groups of the minor groove binders and the N-3 of purines and 0-2 of pyrimidines, and (2) between the nitrogen atoms of the imidazole or pyridine heterocycles of the drugs and the 2-amino group of guanine residues. bind to 5'-(A,T)GG(A,T) 2141,142 and 5'-AAAAAGACAAAAA, ]38 respectively, offer promising possibilities for high-affinity specific recognition of a broad sequence repertoire in the minor-groove of DNA. 141']42 An imidazole containing homodimer 30 binds specifically to GCGC sequences (Figure 4). This was the first instance where a minor groove binding lexitropsin was directed uniquely to GC sites. 143 No doubt, with the precise engineering of molecules forming 2:1 peptideDNA motifs, a decisive step has been realized towards the targeting of any
116
CHRISTIAN BAILLY
H3C
"N~
H3C
O
~/
HNf~
H3C'-NAON~'H ~-NN/~-NH O=~~lt~/
CH3
HN.~'
0//''NH
~I.
CH3 (26)
H3C /I"- ~ N , 0
CH3
imidazole-netropsindimers H3C,,N~.~N_ ~ O CH3 H3C ~'~~
H3C ~ O ~ N ~'~N
O N,"
HN ~=~
,,CH3 ~H3
NH (27)
pyridine-netropsin dimers
n- 1-4 designated DNA sequence with small molecules. By combining the end-to-end with the side-by-side dimeric motifs one will hopefully succeed in targeting 15-17 base pairs of unique sequence in a biological system. Moreover, the repertoire of sequences targeted by artificial ligands can be further extended by combining an oligonucleotide with a netropsin-like ~44or a hairpin polyamide derivative ~45 (or a Hoechst 33258 (4) analogue146'147). For example, the affinity of the conjugate 31 for the 18 base pair target site 5'-TGACATTAAAAAAGAAA-3' is 150-fold higher than that of the unlinked subunits. 148 A related ligand consisting of a pyrimidine oligonucleotide 11 bases in length covalently tethered to an imidazole-containing polyamide cooperatively binds as a dimer to 27 noncontiguous base pairs of double-helical DNA via the formation of a 2:1 ligand:DNA complex. 145 In both cases, the recognition process involves simultaneous recognition of the minor and major grooves of the double helix, thus mimicking the function of certain sequencespecific DNA binding proteins. Despite all these elegant structural studies of lexitropsin-DNA complexes, the biological activity of minor-groove binders has not been much improved. So far the lexitropsin approach has not led to clinically useful drugs although certain monomeric and dimeric lexitropsins exhibit interesting antiviral or anticancer
Recognition and Modification of Double-Helical DNA
N--=.
H3C~ Hs~~ NH
0
117
0
/~
(28) NH'I~O N~ AcPyPyPy-7-1mlmPy-~-Dp~~/N'CH3 H3C,, H3C" NH ~N~c:) O~NH'~NH "~ O / H3 ~NH NH H3c'O 3 H3~-==~ - _NH ",--N NH (29) NH,,~O ~N,,CH3 i Nr~ CH3 imPypy.13.pypypy.D p ~N"CH3 H3C" NH H3C~ Ot2"~NH~,~ N~N~c s) NH
o~N~
N-...=.
O
H3c_N/~NH
02" NH
(31)
O
/
NH,~O
~N.CH3
NI~ ImPyPy-y-ImlPyPy-I~--H3C-'"'..~" NH O'~NH NH.~N~O N
o
r i I I I ' I I MeCMeCTI'T.3'
'ICH3
118
CHRISTIANBAILLu
activities in vitro and sometimes in vivo. The new generation of GC-specific lexitropsins may provide more efficient drugs since GC-rich sequences are frequently found in genes associated with proliferation including a number of oncogenes such as c-Ha-ras. 149 The human genome contains regions with more than 80% GC content which account for --1.3% of the genome. 15~By analogy with the GC-selective antitumor drug mithramycin discussed above, GC-specific lexitropsins may exhibit useful biological properties via recognition of key sequences in DNA.
V. NETROPSIN AND DISTAMYCIN DERIVATIVES EQUIPPED WITH A BINDING/MODIFYING ELEMENT A considerable number of antitumor agents, including some of clinical value, induce DNA damage either directly by alkylation (electrophilic modification of bases, e.g. nitrogen mustard, cis-platinum) or cleavage of DNA (oxidative degradation of the sugar backbone or hydrolysis of the phosphodiester bond, e.g. bleomycin, calicheamicin) or indirectly via inhibition of topoisomerase activities (e.g. daunomycin, amsacrine). The DNA lesions induced by these different categories of drugs are presumably responsible for their cellular toxicity. Irreversible damage of the genetic material in cells has been considered as the basis of the antitumor effect but it is more likely responsible, to some extent, for the toxic side effects towards normal cells (genotoxicity). Consequently, there is currently intense interest in the development of sequence-directed DNA damaging agents with a view to improving the therapeutic value of the drugs by virtue of a highly selective gene-specific recognition. The following sections describe some examples of netropsin/distamycin conjugates rationally designed to bind tightly to DNA and/or to produce irreparable damage at precisely defined genomic locations.
A. Conjugationwith Polyamines:The Microgonotropen Approach Minor-groove binding ligands such as distamycin can efficiently compete with the binding of protein in the major groove of DNA. 151-154 Inhibition of protein binding to the AT sequences is believed to contribute to the biological activity of minor-groove binders. 155'156However, under certain circumstances DNA can accommodate both a protein and a lexitropsin in the major and minor grooves, respectively. 157The capacity of a minor-groove binding agent to compete with the binding of a protein may be enhanced in different ways: (1) by increasing the affinity and sequence selectivity of the drug for DNA, (2) by equipping the drug with a major-groove binding element so as to interfere directly with the protein, and/or (3) by using drugs capable of inducing adequate structural changes in DNA. The bending and flexibility of DNA are actively exploited by sequence-specific DNA binding proteins. 21'23 Bruice and coworkers have conceived an elegant approach to increase the affinity of distamycin analogues for DNA while maintain-
Recognition and Modification of Double-Helical DNA CH3 H3C"N'~ HN
fH3 H3C'N~I, 0
HN
~3.a
119
HN
"~N~cH 3
n=3-5
(32) dien-microgonotropen
~CH3
l-IN
~3Ha
0
0
n=3-5
(33) tren-microgonotropen
\ NHz
ing the AT selectivity, and allowing potential recognition within the major groove of DNA. They designed a series of molecules called microgonotropens in which the methyl substituent on the central pyrrole ring of distamycin is replaced with a branched polyamine. 158-164The polyamine substituent on the dien- (32) and trenmicrogonotropens (33) projects outwards from the minor groove and acts as a hook to increase the affinity for DNA via interaction with the phosphodiester backbone or with the major groove of DNA. The tren [-NHCH2CH2N(CH2CH2NH2)] microgonotropen (33, n = 4) is much more effective than distamycin in promoting DNA bending and straightening. 165 The microgonotropen strategy represents a new avenue to the design of minor-groove-reading ligands having a very high affinity for DNA. In addition, the metal-chelating properties 166 of the dien and tren substituents may be exploited for the conception of catalysts for sequence-selective hydrolysis of DNA, i.e. for the design of artificial nucleases. 167'168
B. Conjugation with a DNA Alkylating Group The large majority of alkylating drugs react with DNA via an electrophilic attack of purine residues, in particular with guanines. Classical alkylating agents such as chlorambucil and cis-platinum react within the major groove of DNA at the N-7 position of guanines. 169Nucleophilic attack from N-7 of guanine is also implicated for the DNA alkylation by the pluramycin antibiotics (altromycin B, hedamycin). 17~ A few alkylating drugs of natural origin bind in the minor groove of DNA. Such is the case for (1) mitomycin C 171 and anthramycin 172'173 which both form adducts with the exocyclic amino group of guanine (mitomycin can also react with N-7 of guanine under acidic conditions but the biological significance of the N-7 adduct remains uncertain), and (2) the adenine-specific alkylators duocarmycin A and CC- 1065 discussed above. The accessibility of the major groove and the high intrinsic nucleophilicity of the N-7 heteroatom position contribute to the G-alkylation by nitrogen mustards.
120
CHRISTIAN BAILLY CH~
H2N~ H
"3c'N't.1 HN 0 ~N
~N...CHs
HN ..0
CI HN
"-CH3
HN
0
"CHa
HN
0 N...CH3
HN
~N~"--~O
ar j
H3
.N
(34)
(3s)
(~)
N-chloroacetyl-netropsin
N-bromoacetyl-distamycin
bis(chloroethyl)-netropsin
~H3
CH3
H3c"N'~,L
"l HN
"l
O
HN
N, , , ~ ~ ~N"
CH3
"-'~,/" " CH3
CI
O
N...CH3
~N...CH3 el HN ~==0
Ci CI~
H3c"N",,L
HN ~
H ~--N
..
/--~ HN"~N'cH3
o
0
cH3
(37)
(3a)
bis(chloroethyl)-distamycins
However, the sequence-selective alkylation of N-7 guanine by nitrogen mustards and nitrosoureas can be modified by linking the reactive group to a DNA reading element. The first generation of alkylating lexitropsins consisted of netropsin and distamycin analogues equipped with N-chloroacetyl (34) and N-bromoacetyl (35) substituents or with bis(chloroethyl)amino substituents (e.g. 36--38). 174'175 N-Bromoacetyl--distamycin 35 reacts with a single adenine in the sequence 5'GTTTA-5'-TA*AAC within a 167 base pair restriction fragment. 176'177The second generation of alkylating lexitropsins contained benzoyl- (39,40) or benzyl-mustards (41,42). 178-181 Following the discovery of the aforementioned antiparallel side-by-side motif, bismustard cross-linked lexitropsins such as 43 were synthesized. 182 The efficiency of DNA alkylation by chlorambucil and L-phenylalanine mustard can be considerably enhanced by linkage with DNA carriers such as spermidine, anilino-quinoline, and acridine derivatives. 183-187 Certain acridinelinked mustards exhibit a preference for adenine alkylation compared to guanine
121
Recognition and Modification of Double-Helical DNA
H2N'~H
H3C,,NJCH3 HN ~._O
HN 0
c,
IN "OH3
~
c'-k_N~
HN H
HN
N j.
N
H~
H3 L)
I:H3
OH3
"O
(39)
(40)
(N-benzoyl-mustard)-distamycin FCE 24517
(N-benzoyl-mustard)-Iexitropsin
H3C"N'CH3
H3C"N"CH3
HN .,_O
HN ..O
N~N ' "OH3Cl yL ' ~N ~l
C~-~N-~'~ H N~O Cl/..~/ ~ " ~ O N.~N~o,."~ N-CH3
N 'cH3Y ~N ' N--~O
~ H "--~ N,~N.~N"~V N"CH3
I::H,
~:H,
(41)
(42)
chlorambucil-lexitropsin
(benzyl-mustard)-Iexitropsin
H3C,
H3/'--~~HN .0
"~N"CH3 /N~ O
S O~~
CI
'/ ~/~Cl (44)
40
~
H O
~/.~ (43) bismustard-lexitropsin
CH3
H~C'~~
CH3
J
HN~o
N0
})CH3
122
CHRISTIAN BAILLY
alkylation. A much higher level of sequence-selective alkylation/crosslinking has been achieved by attaching nitrogen mustards or nitrosoureas to oligonucleotides ]88'189and lexitropsin moieties. Distamycin analogues equipped with DNA alkylating functionalities such as compounds 39--42 show a remarkable sequence selectivity with, in some cases, an almost exclusive alkylation of adenines in the minor groove with no detectable guanine N-7 reaction. The lead compound in the series is the bis(2-chloroethyl)aminobenzoyl derivative of distamycin FCE24517 (39), also known as tallimustine, which demonstrates significant anticancer activity in animal models and is currently undergoing clinical trials. 190-196It remains to be demonstrated whether or not the potent antitumor activity of FCE24517 is attributable to its DNA binding selectivity. Perhaps, alkylation at specific A-containing sites (e.g. 5'-TI'I'IGA*) produce adducts which are poorly repaired and evolve into strand breaks lethal for the cell. Sequence-specific inhibition of the binding to DNA of transcription factors has also been postulated. 156']94Fifty years after they were introduced into medical practice in the treatment of neoplastic diseases, 197 nitrogen mustards are still among the most clinically useful anticancer drugs. With the rational design of tumor-active drugs like FCE24517, there is good reason to believe that for a considerable time nitrogen mustards will remain of major clinical importance. Other series of distamycin conjugates equipped with alkylating functionalities have been synthesized. Lown and collaborators ha.ve synthesized a series of lexitropsin-cyclopropylpyrroloindole (CPI) hybrids. 198 The CPI-N-methylpyrrolecarboxamide derivative (44) exhibits an exceptional cytotoxic potency against KB tumor cells in vitro (IC50 = 0.76 fg/L) and forms stable covalent adducts in the minor groove of DNA. ]99 Church et al. 2~176 have synthesized chloroethylnitrosoureas-lexitropsin conjugates such as 45 which alkylates adenine residues in the minor groove. Zhang et al. ]19 have prepared a series of noncationic Nmethylpyrrole dipeptides incorporating sulfonate ester terminal groups (46,47). Here also, efficient alkylation at adenine N-3 in the minor groove was observed. An elegant way to provoke DNA-DNA cross-links was recently reported using a CH3 "1 ~~=jN
c,
o
HN
0 .,...CH3
HN
__)=o
CI-ENU-netropsin
HN ---CH3
.-CH3
~''~N'~ /--~N O. HN 0~N' H N""~.~-"~0 H/N"'"~/"l'CH3 SO~"'~O
(45)
0
HN
H3
H3C"SO~')~ 0 HN
(46)
(47) methylsulfonate-netropsins
H3
Recognition and Modification of Double-Helical DNA
123
...CH3
OH
~'-N"
~Ha
0
(48) [bis-(hydroxymethyl)-pyrrole]-distamycin
H2N
(49) anthramycin-netropsin
distamycin analogue coupled to a 2,3-bis(hydroxymethyl)pyrrole function which in part mimics the functionality present in reductively activated mitomycins or oxidatively activated pyrrolizidine alkaloids. Compound 48 efficiently produces interstrand cross-links by bridging the 2-amino groups of two-paired CpG steps. 2~176 More recently, Walker et al. 2~ have designed netropsin-anthramycin conjugates such as the chimera 49 which is expected to recognize the sequence RGAAAA from the HIV- 1 polyypurine tract.
C. Conjugation with a Photosensitive Group Sequence-selective minor-groove binding as a route to targeting photosensitive compounds to DNA has been considered in recent years. Among photoactive compounds of biological interest, psoralens (furocoumarins) are probably the most important group since some derivatives such as 8-methoxypsoralen are used in phototherapy for the treatment of various human skin diseases, chronic leukemia, and some infections connected with AIDS. The biological effect presumably derives from the action at the nucleic acids level. Psoralens can intercalate into DNA. When exposed to UV light, intercalated molecules react covalently with DNA to form cyclobutane linkage to pyrimidine bases, predominantly at 5'-TpA steps. 2~ Psoralen-derivatized oligonucleotides have been used to induce lightdependent sequence-specific reaction with RNA (antisense) and DNA (antigenes). 2~176 In the same vein, minor-groove binding oligopeptides were coupled with psoralens (50-53) and coumarins (54,55) to direct photoreaction at specific sites. 2~176 Pyrene-lexitropsin conjugates such as 56 were also synthesized. 2~ The cytotoxic activity towards human leukemia cells of this sequence-selective photosensitizer is significantly enhanced upon irradiation. The photo-induced DNA lesions apparently result from the production of singlet oxygen. 2~ Using a similar approach, Herfeld et al. 21~ have synthesized netropsin-isoalloxazine conjugates such as compounds 57 and 58. Upon photoactivation in the presence of molecular
124
CHRISTIANBAILLY HzN'~NH HN 0 ~ N 'CHa
(50) O~
H3C.,.N,CH3
~
HN
0
~m~N~CH3
(51)
HN 0 H3
HN .0
0
N~N"CH3
H2N'~ NH
(52)
HN 0 ~ N ""CH3 C~3 /OvCH3 HNI 0 0--/~'~ _H ,,~0 H,G.N,OH ' ~ . HN,~N.oH3 L~ CH:l o~"~'~0 HN : (53)
'0 ~
.N N-o
o
~
HN~N"cH3
0
.OH, (54)
HNY
HN 0
H3C,N.OH, I~ H:'~:....CH' (55) y N~ 0
0
oxygen, the flavin chromophore oxidizes and generates oxy radicals capable of causing DNA breaks. The linkage of netropsin to a flavin chromophore lead to AT-selective strand cleavage reactions. 211'212 Quinone-netropsin hybrids (e.g. 59,6t)) have been also designed. These conjugates are capable of inducing UV-mediated strand breaks. 213 Cationic porphyrins can also act as DNA photosensitizers. 214'215 Netropsinporphyrin conjugates (e.g. 61) have been synthesized. Molecular modeling predicts that the porphyrin moiety intercalates into DNA. 216'217UV-sensitive p-nitrobenzoyl groups attached to netropsin-acridine hybrids also act as photocleavers (Section V.F). Matsumoto et al. 218 have synthesized a series of oligo(N-methylpyrrolecarboxamide) derivatives linked to halogenated heteroaromatic groups. Efficient photoinduced DNA cleavage was observed with bis-pyrrole derivatives such as the bromofuran-netropsin conjugate 62. DNA cleavage is not mediated via active oxygen species (OH.) but may be due to the reaction of an aryl radical produced by photohomolysis of the carbon-halogen bond. 218A similar mechanism with drug radical production has been proposed for X-ray sensitive nitroaromatic compounds.
Recognition and Modification of Double-Helical DNA
125
HzN,,,~..INH HN 0 HN N~'I
(56)
,
H3a ~
CH3
N~ C H 3
N?
N.. ~ N~)
HN
~
~/
O
HN~'~N_../~
H-y~
/CH3
HN ._O ~N"CH3
(60)
n3~"~~
o
~
ItO
~N.C:)
HN
N ~
~ "~ ' K ~ N ~ .
porphyrin-netropsin
/
O o
o
(c.,)&o
o
H N ' ~ sCH3
(61)
H3
H2N',~NH
(69)
HN..~N.cH3
HNNH=~\
" " Y "~"."~(CH,>,"-(,o quinone-netropsin
HN/--"
H3C~/'N.,~,N. ~ " ' ~ ~ k O OH3 O
HN L
(,,,
O
,
HNTO
CH3 I+~ N.
HN -0
~N....CH3
HN'
~~,
O NH
~'N~'CH3 (r T"- T"- ~ ~ -+N/~ '~N HN.~
o~
HN O H3C-k ~ r
'
"
%/,l
OH3
Metronidazole 63 and misonidazole 64 are typical examples of radiosensitizing agents used in the treatment of anaerobic infections and are under continuing investigation regarding their use in cancer therapy, acting as markers for hypoxic regions in tumors. 219 These sensitizers can react with DNA presumably via an electron-seeking radical (the metronidazole nitro radical anion RNO 2. has been identified in dimethylforfamide) but they exhibit very little binding to DNA. 22~ Targeting of a 2-nitroimidazole moiety to DNA via an acridine intercalator or a minor-groove binder has been investigated as a means of increasing sensitizer concentrations at defined sites on DNA. 222'223The affinity of 2-nitroimidazolenetropsin conjugate 65 for DNA is about 200-fold superior to that of misonidazole 64 but in spite of the improved interaction with DNA and improved cellular uptake
126
CHRISTIAN BAILLY
HzN,~NH
/'~NOz NyN~/~,OH
HN ~
HN 0~0 Br'
CH3
"CH3 9
(63) metronidazole
) H.N~ N ~ c H3
f'~ OH N,~,,,,N.v~OCH3 NO2
(62) bromofuran-netropsin
(64) misonidazole
H,N .
H3c.CHaN.t
HNTO ~ N ' cH3 HN NO2
'~0 (es)
misonidazole-netropsin
HN 0 ~N~CH3 HN CI (6s)
p-chlorobenzylsulfonamido-netropsin
capacity, the radiosenzitization efficiency of the netropsin-nitroarene conjugates remains relatively poor and not better than that of misonidazole. 223 Photoinduced DNA cleavage has been reported with oligo-N-methylpyrrole-carboxamide derivatives substituted with a benzyl-sulfonamido group such as the p-chlorobenzenesulfonamide-netropsin hybrid 66. The efficiency of single-strand cleavage under UV-A irradiation depends on the length of the pyrrolecarboxamide chain. Tetrapyrrole-sulfonamide conjugates are more efficient DNA cleavers than the corresponding analogues containing three or two pyrrole units. Conjugates with only one pyrrole are practically inactive. 224 The same conclusion was drawn for simple oligopeptides such as 67 and 68 which do not possess special side chains sensitive to UV light but which, nevertheless, can induce DNA cleavage under UV-A irradiation. 225 Conversely, for nitrated oligopyrrolecarboxamide derivatives such as 69 and 70, the DNA photocleavage efficiency is higher for the monopyrrole compounds than for the bis- and tris-peptides. 226 Another type of netropsin conjugate capable of inducing DNA cleavage upon X-ray ionization has been designed by Grokhovski and Zubarev. 227 Footprinting
Recognition and Modification of Double-Helical DNA
HO'~,,NH
H2N~~,,N~NH z
HN~~ HN HN H~O
""CH3
HN H"~O
H3 (68)
CH3 H3c'N~,""I ..CH3
HN H~
(67)
CH3 H3c'N~,"~
HN~~ "CH3
127
HN
HN
~~N~I 3
~~N~c )
N 0 NO, (69)
.CH3
02N (70)
studies showed that the netropsin-platinum-netropsin conjugate 71 binds selectively to AT-rich sequences in DNA. X-ray radiation of drug-DNA complexes yield discrete cutting sites near the center of the platinum-bis(netropsin) binding sites. In this case the cleavage would result from the rupture of the deoxyribose residues upon attack by Auger electrons generated by the irradiated platinum atom. Such conjugate compounds capable of triggering sequence-specific DNA degradation might be of interest for X-ray therapy of tumors.
D. Conjugation with a MetaI-Complexing Group Ligand binding sites on DNA can be identified by a variety of techniques based on DNA sequencing methodologies. The most widely used method is the footprinting technique. 228The ligandmbe it a protein or a drugmis equilibrated with a singly end-labeled DNA restriction fragment and the complex is subjected to partial cleavage by an enzymic or chemical nuclease (Figure 5). DNAase I is the most frequently used endonuclease but transition metal complexes such as Fe.EDTA and Cu.phenanthroline can help to define more accurately the exact location and size of the binding sites. 229'23~An alternative strategy for mapping ligand binding sites on DNA consists of equipping the ligand with its own DNA cleaving functionality, e.g. to attach an Fe.EDTA complex to the test drug. This method, termed DNA affinity cleaving (Figure 5), proved very successful in analyzing binding sites for distamycin via the use of EDTA-distamycin conjugates such as compound 72. 23]'233 The technique has been extensively exploited by Dervan's group to study oligo(N-methylpyrrole-carboxamide) derivatives containing up to 12 pyrrole units as well as a variety of monomer and dimer lexitropsins. 234-239 Upon chemical activation with a reducing agent (e.g. dithiothreitol) the iron-EDTA portion generates hydroxyl radicals which react with deoxyriboses so as to provoke DNA strand cleavage. In contrast to Fe.EDTA footprinting, the active oxygen species are
128
CHRISTIAN BAILLY footprinting
nuclease
nuclease
m
m
DNA affinity cleaving
m
activation
m
Figure 5. Illustration of two methods used to locate drug binding sites on DNA. In the footprinting experiments, a DNA restriction fragment radioactively labeled on one strand is subjected to cleavage by a chemical or enzymic nuclease. In presence of a sequence-specific ligand, DNA cleavage is inhibited at the binding sites identified by the footprints on the autoradiogram. In the DNA affinity cleaving experiments, a DNA restriction fragment radioactively labeled on one strand is subjected to cleavage by the ligand itself which is equipped with a DNA cleaving functionality, e.g. a transition metal complex such as the EDTA-Fe(II) system activated by a reducing agent. Binding sites are identified by the cleavage products visible on the autoradiogram. In both cases, the resulting DNA cleavage products are analyzed using a standard DNA sequencing gel. The sequence of the DNA (and binding sites) can be identified by coelectrophoresis of oligonucleotide markers produced by cleavage of the DNA using standard Maxam-Gilbert sequencing methods.
Recognition and Modification of Double-Helical DNA CHa
o
O.;N.
H'C'N~NH O
(71)
HN
O
Q ~.. r ....__~Iv,. ~
NH ..... NH--..,/
.: H
~~'cu/~ ~
~ ~,~.'..~._/,,,
(72)
HN
~,,
H
0
~_ N'cH~ HN
HN~NHa O
~JNN-CH3
0
; N.H
H
L
, , ,~~ /
"~.--N
HN
Ha
CHa
distamycin-EDTA
L .~.~o
~,, ~'... o
....
~N f
cH3
HN
HN G/y
o
0
netropsin-platinum-netropsin
O-",,
'o...~..~ Y"'!'N
%
o
0 /-~...
O
.or7
~N.-CH,
~
Gly
129
~,,
c.,
(73)
Gly-Gly-His-(Gly)3-netropsin produced directly in the vicinity of the ligand binding sites on DNA and so are less susceptible to diffuse. Metal-complexing peptides can serve as a source of oxygen radicals. The growth-modulating tripeptide glycyl-histidyl-lysyl (GHK) and the related tripeptide glycyl-glycyl-L-histidine (GGH) both form complexes with copper, and upon activation can engender oxygen active species. 24~ Linkage of the GHK peptide to intercalating 245-247 and minor groove binding drugs has been considered as a means of inducing sequence-selective cleavage. The peptide moiety not only cleaves DNA but also contributes positively to the DNA binding reaction. 248 Two molecules of the GGH-netropsin conjugate 73 (one copper-free and one coppercomplexed) bind cooperatively to the sequence 5'-TITI'NCAA*AA. The two netropsin moieties occupy the minor groove of the two (A.T)4 tracts, whereas the GGH group is superimposed over the central G.C pair. In the proposed model, the 2-amino group of the central guanine residue hydrogen bonds with the histidine carbonyl group. 249 It is worth mentioning that GGH can also complex Ni(II) to produce activated oxygen species. 25~The oxidizing potential of Ni-chelated GGH has been exploited to study sequence-specific binding of the netropsin-GGH conjugates described above, as well as for proteins such as Hin recombinase 251 and peptide nucleic acids. 252
130
CHRISTIAN
BAILLY
The best characterized natural model for sequence-specific DNA cleavage is bleomycin. The bleomycin antibiotics are among the most useful antitumor drugs. Their therapeutic effects are believed to arise from their ability to cause DNA degradation in the presence of redox-active ions and a source of oxygen. The bleomycin.Fe(II) complex combines with 0 2 to produce a reactive oxygenated metallobleomycin species which is capable of abstracting a hydrogen atom from the deoxyriboses in DNA. Bleomycin generates mainly single-strand breaks at pyrimidine residues 3' to a guanine residue (i.e. at 5'-GpC and 5'-GpT sequences). 253-257 The long-established clinical utility of bleomycin (one of the few anticancer agents which has little bone marrow toxicity) sparked tremendous interest. A considerable number of bleomycin analogues and related structures have been designed including some equipped with DNA reading elements based on netropsin and distamycin. The structure of the antibiotic has been simplified to yield analogues such as PYML, PMAH, 258 and AMPHIS 259-261 which mimic efficiently
~NH [[~"7/>
.,,~iF~!? . ......
. . I " ~ "-~NH 0 d" (74)
CH3 HN ~
Amphis-netropsin
HN&.. o ~
~ O H3C.....j HN
-C o
A ~..N ~ "NHIF __NH'~'"~NJ ~ :',f/' : Fe : "
O
(7')
.,,.,.~1~"J~o O'))''N" V
g'~tr
N/CH3 HN
~ ~I'cH. HN&0
~O v
-HN.~o/ 'OH,
,.o
,,-~
HN"%~
H3C',N_.~ 0 # HsC,- ~
CONH2
(7'6)
CH3
OHN~N'CHa
,r
,,, o
0
.
,CH,
..
.o
.....
CH,""' (~H, H
~,,u.n=
PYML(6)-(AaM)-distamycin
(77)
,,,,NH'r~..N--~' J i-Fe i ~'-'O-IBu ~N'/-----~I~'(
..co o
O
~O a /~. /N~N'cH,
CH= PYML(6)-(APA)-distamycin
Recognition and Modification of Double-Helical DNA
131
the metal-chelating/oxygen activation domain of bleomycin. Attachment of PYML 262'263 and AMPHIS 264-267 to lexitropsin carders led to the synthesis of bleomycin-like conjugates such as compounds 74-77 endowed with interesting sequence-specific DNA recognition properties. For bleomycin, the whole molecule spanning from the pyrimidine region to the bithiazole terminus appears to be responsible for specific recognition of DNA. 268 In contrast, the lexitropsin moiety is only responsible for specific base recognition of man-designed bleomycin conjugates. The fact that the synthetic PYML-distamycin hybrid 76 is more toxic than bleomycin itself towards L 1210 leukemia cells in vitro encourages the design of other related bleomycin-like molecules tailored with DNA reading elements. Bleomycin models have also been used to design sequence-specific DNA cleaving proteins 269 and oligonucleotides. 27~
E. Conjugation with an Enediyne Structure The discoveries in the late 1980s of tumor-active enediyne antibiotics have rapidly elicited extensive research activities in chemistry. A impressive number of synthetic analogues of dynemicin (78), neocarzinostatin (79), calichaemicin, and esperamicin have been described. 271-273 Upon activation, enediynes trigger a Bergman reaction which leads to highly reactive benzenoid diradicals and cause severe DNA damage. 256 Enediyne antibiotics are among the most cytotoxic compounds known to date, and their activity is likely attributable to their effect on DNA (at least in part). The excessive reactivity of the enediyne moiety prompted the development of analogues containing DNA delivery systems. To this end, netropsin was coupled with the neocarzinostatin chromophore (80) 274 and distamycin was attached to a dynemicin model (81). 271 More recently, the design of a simple cyclic enediyne attached to netropsin was reported. 275 The linkage of the two functionalities via acetate (82) and crotonate (83) tethers results in a hybrid series in which the cleavage efficiency is strongly enhanced (up to a 1000-fold compared to the enediyne alone). These encouraging results pave the way for the design of simpler related structures capable of triggering effective DNA cleavage via a radical mechanism. In this context, Bregant et al. 276 synthesized the netropsin analogue g4 equipped with a trimethylenemethane group (TMM) which can undergo cycloaddition to electron-deficient alkenes. Upon photolysis of the diazene moiety, the TMM-netropsin conjugate can transform to a diyl radical and cleave DNA, predominantly at AT-rich regions. 277 Propargylic sulfones are small synthetic molecules that mimic the chemical action of enediynes. They can cleave DNA in a pH-dependent fashion. Here again, linkage of lexitropsin carriers to propargylic sulfones (85-87) may permit direction of the cleavage of specific sequences in DNA. 278 Parenthetically, it is worth mentioning here the netropsin-quinocarcin conjugate 88 which can efficiently cleave DNA at AT-rich sequences via the production of a nondiffusible oxidant. 279
132
OH o
CHRISTIAN BAILLY
(79) neocarzinostatin ~--o OCH3 chromophore oN/I
~ 3
~~ ~ o
HN'_~:'~"~, ~~
y--C-y (78) OH 0 OH dynemicinA
CH3 H3c'N'~L
HO'~d
HN 0
HNTO
dynemicin-distamycin ~N.~CH'
~0
O~.N~~.~
o~S_O
~~) "o ~o~.~
HNy~ Hi
HNy~ HI
Oo
H3C"N"CH3 HN =O ~__N "CHs HN
HN~N O ...CH~ HN
HN O ~N .-CH3
(82)
"l
181)
NCH3
neocarzinostatin-netropsin~~N. c
CH3 Hac'N'~
Hd) CHa-
"~T~..
(80)
O
(83)
_
(84)
TMM-netropsin
F. Conjugationwith a DNA IntercalatingDrug By analogy with the lexitropsins, hybrid molecules combining a minor-groove binding element structurally related to netropsin or distamycin, and an intercalating chromophore are called combilexins. 28~
Combilexins and DNA Recognition In general, intercalating drugs exhibit a high affinity for double-stranded DNA but display little sequence selectivity. Simple intercalating agents such as ethidium and proflavine interact similarly with both AT- and GC-rich regions in DNA and
Recognition and Modification of Double-Helical DNA
133
HaCO 0 HO~
(S5)
~N'~CH3_ HN
~,0
o
H N ~
N H3
HN
~Hs H3CO,.,~O /,OH ....
~
,'~N"CH~
"%0
N ~.~ H N ~ C H 3
CH3 fOH 0 /~ :sJ
H3CO~~...CHa (87)
HN~ ' / ~-o
ICH3 slightly prefer alternating purine-pyrimidine alternating sequences as compared to homopolymeric sequences. 16A large number of intercalating drugs, including some of major clinical value, possess an heterocyclic chromophore substituted with side chains of different nature that participate in DNA recognition. These chains represent a kind of hook for sequence-selective interaction within the minor groove of DNA. For example, the antitumor drug actinomycin (89) bears two sterically demanding cyclic peptides attached to a phenoxazinone chromophore. Upon bind-
2"' "NH
NH CH3
0
CH3
134
CHRISTIAN BAILLY
ing to DNA, the chromophore intercalates between base pairs leaving the two pentapeptide lactones lying in the minor groove of the double helix. 282-284The sharp selectivity of the drug for intercalating at 5'-GpC steps arises from prior recognition of a suitable groove geometry (e.g. an adequate minor groove width) followed by a reading of particular structural elements (e.g. the guanine 2-amino group) in the minor groove of the DNA helix by the antibiotic. 285 The symmetrically disposed peptides participate actively in the GC-specific recognition process through hydrogen bonding interactions between the N-3 atoms and 2-amino groups of the guanines, and the amide groups of the threonine residues. The amino acid residues of the drug play a considerable role in both the DNA binding properties and the biological activities. 286 Similar observations can be made for a variety of tumoractive intercalating drugs. Anthracyclines such as daunomycin and nogalamycin contain carbohydrate residues that serve as DNA recognition elements. 287 The peptide ring of the quinoxaline antibiotics echinomycin and triostin A are prime determinants for sequence-specific recognition by the drug. 288 The enediyne antibiotics dynemicin A (78) 289 and neocarzinostatin (79) 290 bind to DNA by intercalation of their chromophore (naphtoate for neocarzinostatin and anthraquinone for dynemicin), placing their reactive ene-diyne-containing bicyclic core moiety in the
o
0
=o~ o
CH2 H21C" ~C.,_ CH H3C ~C...CH.N ~u I 3 "N ""C~. ,,CH C'H~ CH "CH3
o=c,
?.
H3C.NcH C=O ,..d, C"O--cH'CH'NH _ C..t.,n o Hs ~., O CH,, ~C",0
CH= HaC/ '~C., 0 HsC, Q ~,, CH-c" CH .~CH ~-C' ' ~ "N" a I'l'aC" ~'CH ~ru
c=o
NH
0=~ N~ HN'CH-cH-O..--c'C~H O*C/ ~ CH- O CH , "CH3
II 1 1 "~o~o [
CH3 (89)CH3
actinomycin
~
H3C~
.~ HN
~
o
,_,, . ~ o 0
"3 - ~uN H
CH
.N.,,,.~O r / ~N'CH3 ,~='~"
....
N ~N_.~ 0 ~ " N~... ~
o~....~"l~^
~/~ N''CH3
O"-1F'~N.20
HN~',.0 "-~.._..~ N,CH.
distactin (gO)
0
"f
ell3
[bis-(EDTA-distamycin)]-phenoxazone
Recognition and Modification of Double-Helical DNA
135
minor groove in a suitable position for selective DNA cleavage. The list can go on. Such considerations indicate that in many cases drugs usually referred to as "intercalators" in fact exhibit mixed modes of binding to DNA and therefore should be considered as intercalator-minor-groove-reading hybrid molecules or naturally occurring combilexins. Using actinomycin D as a model compound, Krivtsora et al. 291 designed a series of hybrid molecules called distactins in which the phenoxazone chromophore is substituted at positions 1 and 9 with one, two, or three N-methylpyrrole carboxamide units. Bidentate reaction with DNA involving intercalation of the chromophore and minor-groove binding of the DNA reading element was observed with distactins bearing one or two pyrrole rings but not with the analogues having three units. The model was reconsidered two years latter by Dervan 76 who elaborated a distactin molecule in which two distamycin tripeptides are connected to the phenoxazone by glycine tethers. DNA affinity cleaving studies of the bis-(EDTAdistamycin)-phenoxazone conjugate molecule 90 revealed a major cleavage site flanking the 10 base pair sequence 5'-TATAGGTI'AA, thus suggesting that intercalation of the tricyclic nucleus at the central GG step is accompanied with minor-groove binding of the distamycin moieties at the flanking (A.T)4 sites. Additional single cleavage loci were also observed. Depending on the recognized sequence, only one or both recognition elements engage in contact with DNA. These preliminary studies paved the way for the design of different categories of intercalator-minor-groove binder hybrid molecules endowed with sequencespecific recognition properties. Several reports have clearly established that a groove binder like netropsin and an intercalator (e.g. actinomycin, acridines) can bind to DNA simultaneously and in close proximity. 292-294 The affinity of distamycin for DNA can be considerably enhanced when the drug is attached to an intercalating agent. The chromophore not only provides extra strength of binding but can also notably influence the DNA recognition by the minor-groove element. Different behaviors have been observed depending on the chemical structure of the appended intercalating drug and the length and the flexibility of the linker between the two DNA binding functionalities. Bis-pyrrolecarboxamide moieties were linked to a 9-aminoacridine chromophore by alkyl linkers of variable length, z95 Optimum fit to DNA was obtained with the combilexin 91 with a butyroyl tether. This biscationic hybrid exhibits a strict AT preference as for distamycin. A structurally related acridine-distamycin ligand equipped with a photoactivatable p-nitrobenzoyl group 92 has been synthesized. 296 This conjugate can cut DNA upon activation with UV light (310 nm) with a preference for AT sequences. 297 The selectivity for AT sites was found to be significantly decreased when a truncated netropsin moiety was linked to a glycylanilinoacridine chromophore structurally related to the antileukemic drug amsacrine 93. In this case, the rigid connector between the bispyrrole unit and the acridine nucleus of the combilexin molecule 94 (NetGA) does not permit optimal intercalation of the acridine and apparently slightly restricts the netropsin moiety fitting
136
CHRISTIAN BAILLY
HN..~
netropsin-acridine
HN.~
HN
HN
HN~o CH= 9H3
H ~
HN~o CH3 0
H I~
.
o
02N" V
o~
deeply into the minor groove. Molecular modeling and experimental binding studies were consistent with a model in which the acridine ring is significantly tilted with respect to the helical axis of DNA. 298'299By contrast, the monopyrrolecarboxamide-anilinoacridine ligand MePyGA 95 (i.e. the mono-pyrrole counterpart of NetGA 94) behaves as a classical DNA intercalating drug as judged from electric linear dichroism measurements. 3~176 Moreover, this simpler analogue exhibits a marked preference for intercalating at GC sequences and the sequence selectivity correlates with its topoisomerase II inhibition capacities. The exact mechanism of binding of this pyrrole-anilinoacridine conjugate is not yet fully elucidated but we suspect that the intercalated acridine projects its anilino-glycyl-N-methylpyrrolecarboxamide substituent towards the exterior of the helix so as to place the carboxamide group in close contact with a guanine 2-amino group protruding in the minor groove. Covalent linkage of distamycin to the GC-selective ellipticine derivative 963~ afforded a monocationic hybrid molecule Distel(l+) (97) capable of bidentate binding to DNA. Complementary biochemical and spectroscopic studies showed that, in this case, the reaction with DNA was primarily driven by the charged ellipticine moiety of the hybrid. 3~ The geometry of the Distel(1 +)-DNA complexes can vary according to the target sequence. 3~ As a result, the hybrid exhibits little, if any, sequence preference. 3~ The ellipticine chromophore has markedly reinforced the affinity of the ligand for DNA, but the effect is at the expense of DNA sequence selectivity. Molecular modeling aided the design of a second-generation distamycin-ellipticine hybrid endowed with superior DNA recognition properties. Indeed, computational studies suggested that the addition of a positively charged group on the distamycin terminal group would favor binding to AT sequences. 3~ A recent experimental demonstration to this proposal clearly established that indeed substituting the terminal formamido group of Distel(l+) for an aminopropionamido group charged at neutral pH was the correct way to proceed in order to convert a nonspecific conjugate into a highly specific DNA reader. 3~ Both DNAase I and MPE.Fe(II) footprinting studies indicated that the combilexin
Recognition and Modification of Double-Helical DNA
~NH-~-CHz I I DNA-binding domain
13 7
a m s a c r i n e (93)
Topoisomerase ll-targeted domain
=
, N~~ NH.~~ ~-'#
! o H N.~1.,,.,.~N~ I:1 O
NH2 C;H3
MePyGA(95)
NH2
H
~ DNA-intercalating moiety
t~1
O
skeletalcore
(~H3
NetGA(94)
DNA minor groove binding and topoisomerase-targeted moiety
molecule Distel(2+) (98) binds specifically to AT sites. A molecular model of the Distel(2+)-DNA complex is shown in Figure 6. In contrast to Distel(l+), the interaction of Distel(2+) with DNA seems to be driven as much by the distamycin moiety as by the ellipticine residue. A different situation has been reported with the biscationic netropsin-oxazolopyridocarbazole combilexin Net-OPC (99). Oxazolopyridocarbazoles are intercalating drugs derived from ellipticines and exhibit cytotoxic properties against malignant cells in vitro. 306'307 A detailed characterization of the complexes between o
,CH3
O
CH3
CH3 0
,o
H CH~ I
~"N"
CH3
(97)
HN
ellipticine derivative
Distel (1 +)
~'-r~ ~ HN.~./N ...CH3
H
138
CHRISTIAN BAILLY H
(~")
Distel (2+)
HNH~ OcH:= NHz
Not-oec HN
NH2
,,o~N
HN--~ "CH=
N
H
Net-OPC and DNA showed that the hybrid ligand adopts different configurations according to the sequence to which it binds. The hybrid binds much tighter to AT compared to GC sequences, as expected. At GC sites, the OPC chromophore intercalates into DNA but the netropsin remains unbound. At AT sites, the most energetically favored complex has both the netropsin and the OPC moieties inserted in the minor groove of a 7 base pair long sequence. In contrast, the second favored complex at (A.T) 4 sites involved intercalation of the OPC ring and minor groove recognition by the bispyrrole moiety. 3~ A somewhat similar coexistence of an intercalative and a nonintercalative binding mode was recently reported for the netropsin-porphyrin conjugate 61. 216 Theoretical studies reinforced the view that the connecting group between the two DNA binding elements play a critical role in the DNA recognition process. 217These typical examples illustrate the difficulties encountered in designing combilexin molecules. It is a challenging exercise which demands consideration of the notions of geometrical compatibility, hydrogen bonding capability, and the overall electronic properties of the interacting species.
Combilexins and Topoisomerase Inhibition As noted previously, drugs that intercalate into DNA are among the most useful cancer chemotherapeutic agents. However, the DNA intercalating properties of antitumor drugs such as acridines, anthracyclines, actinomycins, and anthracenediones are very similar to those of intercalators which have no therapeutic value such as ethidium and proflavine. There is mounting evidence suggesting that the antitumor activities of intercalating drugs is not due to interaction with DNA per se but is, at least in part, the result of the inhibition of enzymes that regulate DNA topology: the topoisomerases. 312'313 In most cases, topoisomerase poisons inhibit the reaction of topoisomerases with DNA by stabilizing an abortive reaction intermediate, termed the cleavable complex, whereby the DNA is cleaved but cannot be readily resealed. 314 The ATP-modulated protein-clamp model for topoisomerase II is an alternative model by which topoisomerase II inhibitors which do
Recognition and Modification of Double-Helical DNA
139
Figure 6. View from the major groove of the best energy-minimized model of the Distel (2+)-[d(GCATATGC)2] complex. Complex formation induces a pronounced DNA bending towards the minor groove in the vicinity of the ellipticine binding site.302,303 not stabilize the cleavable complex may act. 315'316The cytotoxicity of drugs such as amsacrine, ellipticine, and daunomycin which trap the covalent enzyme-DNA complex is closely related to breakage of double-stranded DNA; for example as a result of the collision between replication forks and enzyme-DNA-drug ternary
140
CHRISTIAN BAILLY
complexes. Topoisomerase inhibitors can induce various types of lethal lesions in cells such as chromosomal aberrations, sister chromatid exchanges, nonhomologous recombinations, and genomic mutations. 317 Intercalation into DNA and the ensuing poisoning of topoisomerases affect the genetic stability and integrity of chromosome structure, and therefore contribute to the cytotoxic action of the drugs. Topoisomerases appear as one of the most promising targets for the design of more active antitumor agents. 318-32~ These observations prompted us to investigate the effect of combilexin molecules on the catalytic activities of mammalian DNA topoisomerases. We reasoned that the linkage of an intercalating chromophore, which stabilizes the topoisomerase II-DNA cleavable complex with a minor-groove binder related to distamycin which also affects topoisomerase functions, 321-325 may lead to novel categories of topoisomerase effectors and hopefully to the discovery of tumor-active compounds. In contrast to intercalating agents used in combilexin molecules (e.g. acridine, ellipticine), distamycin does not stabilize topoisomerase II-DNA cleavable complexes, but probably acts by impeding the access of topoisomerases to sequences in DNA selectively recognized by the drug. Therefore, a hybrid ligand may behave differently from its constituents. Of the two distamycin-ellipticine hybrids 97 and 98, only the monocationic hybrid Distel(l+) 97 proved to be a topoisomerase inhibitor. Its biscationic analogue Distel(2+) 98 showed practically no effect on both topoisomerase I and topoisomerase II despite its superior DNA binding properties. 326Distel(1 +) exhibits a moderate effect on topoisomerase II but exerts a significant effect on topoisomerase I. The effect is different from that observed with its constituents, namely distamycin and the ellipticine derivative. The poisoning of topoisomerase I by Distel(l+) detected using purified calf thymus enzyme is also observed in cells. Indeed, Distel(l+) is markedly cytotoxic towards P388 murine leukemia cells, whereas distamycin and Distel(2+) are totally inactive. Distel(l+) is even more cytotoxic than the ellipticine derivative. The toxicity is attributable to the effect of the hybrid ligand on topoisomerase I since P388CPT5 cells resistant to camptothecin (a powerful topoisomerase I inhibitor) display a notable cross-resistance to Distel(1 +).326 These results suggest that (t) tight and sequence-selective binding to DNA does not necessarily correlate with topoisomerase inhibition, and (2) of the two effects, binding to DNA and interference with topoisomerase functions, it is the latter which is important for the biological activity. In addition the results indicate that, as expected, combilexins may lead to new series of topoisomerase inhibitors. Amsacrine 93 (m-AMSA; 4'-(9-acridinylamino)-methanesulfon-m-anisidide) is an antitumor agent used in the clinic for the treatment of acute myelogenous leukemia. It is commonly accepted that the anticancer activity of amsacrine is connected with its ability to bind to DNA 327 and to interfere with topoisomerases. 312'328On the basis of structure-activity relationships, Baguley et al. 329 have proposed a model that divides amsacrine into two functional domains: the acridine
Recognition and Modification of Double-Helical DNA
141
chromophore constitutes the DNA binding domain and the anilino group would represent the topoisomerase II binding domain. The methoxy group is not absolutely required for activity, but it can serve as a switch to enhance (meta position) or to block (ortho position) the activity of the drug. In fact, from recent studies it has been suggested that the l'-methanesulfonamide side chain attached to the anilino group is the putative site of interaction with topoisomerase 11.330 These observations prompted us to examine the issue of DNA binding and topoisomerase II poisoning by the mono- and bis-(N-methylpyrrolecarboxamide)-glycylanilinoacridine conjugates NetGA (94) and MePyGA (95). The studies showed that these two intercalating agents have the capacity to stabilize the topoisomerase II-DNA complex and stimulate the cutting of DNA at a subset of preexisting topoisomerase II cleavage sites. 300'331 The effect was attributed to the presence of the pyrrolecarboxamide moiety of the hybrids since the removal of the Nmethylpyrrole units (compound GA) abolishes the topoisomerase II-mediated DNA cleavage, but does not inhibit the intercalation of the drug into DNA. The spectroscopic and biochemical data lead to the conclusion that two functional domains can be identified in the combilexins 94 and 95: the anilino group can be regarded as a skeletal core to which are connected (1) the tricyclic acridine moiety which represents the DNA binding domain, and (2) the N-methylpyrrolecarboxamide moiety which constitutes the topoisomerase II-targeted domain. Therefore, the study supports the original model 329'330 in showing that the presence of a substituent at position 1' of the anilinoacridine chromophore is required to permit the drug to interfere with the catalytic activities of topoisomerase II. The existence of two functional domains in amsacrine and these combilexin molecules also accords with the structure-activity analyses on analogues of anthracyclines, 332 epipodophyllotoxin derivatives, 333 and several other structurally different topoisomerase II poisons. 334'335 Thus it may turn out that such a model points to a general principle valid for the majority of topoisomerase II inhibitors. The pyrrolecarboxamide-anilinoacridine derivatives 94 and 95 exhibit marked cytotoxic properties in vitro which correlate with their effects on topoisomerase 11.336 The cytotoxicity of compound 94 is remarkably dependent on topoisomerase II since the drug is 170 times more cytotoxic towards the Chinese hamster lung cells DC3F compared to DC3F/9-OHE cells which are resistant to the topoisomerase II inhibitor, 9-hydroxy-ellipticine. 337-339 DC3F/9-OHE cells contain about fivefold less topoisomerase IIt~ than the sensitive DC3F cells, and topoisomerase 1113is practically undetectable. 34~It is interesting to note that compound GA which has no effect on topoisomerase II is weakly cytotoxic. Moreover, unlike compound GA, the combilexin molecules 94 and 95 display noticeable antitumor properties in vivo (T/C--140). Although potential correlation does not mean causality, 341 it seems likely that topoisomerase II constitutes a primary target for such hybrid molecules in vivo. A moderate antitumor activity in vivo was observed with the bifunctional molecule ThiaNetGA 100 which combines features of both the lexitropsin and com-
142
CHRISTIAN BAILLY
bilexin approaches. 342 This hybrid ligand, in which are conjugated the thiazolelexitropsin 20 and the intercalating anilino-acridine chromophore GA, binds to DNA via a bimodal process involving minor-groove binding of the lexitropsin moiety and intercalation of the acridine moiety. Studies are in progress to determine whether the antitumor activity is connected with toposiomerase inhibition. Very recently, we have developed a second-generation combilexin which consists of a minor groove-binding netropsin-like moiety attached to an intercalating chromophore structurally related to amsacrine. This netropsin-amsacrine hybrid, called NetAmsa (101), differs from the netropsin-anilinoacridine derivative NetGA (94), bears a positively charged terminal side chain which contributes significantly to the AT-selectivity of such ligands, 3~ and retains the m-methoxy and methanesulphonamide substituents on the anilino ring which constitute key elements for the interference with topoisomerases, the maintenance of redox properties, and the biological properties of amsacrine. The netropsin moiety is connected to the acridine ring via a 4-carboxamide side chain, whereas it was previously attached directly to the anilino group. Linkage of a carboxamide side chain to position 4 of the acridine ring of amsacrine has earlier been shown to convert the drug from a classical intercalator to a threading intercalator. 343'344Structural and kinetic studies have revealed that the conjugate threads through the DNA double helix so as to intercalate its acridine chromophore, leaving the netropsin moiety and the methanesulfonanilino group positioned within the minor and major grooves of the double helix, respectively, as depicted in Figure 7. 345 In addition, the hybrid retains the susceptibility to copper-dependent oxidation, characteristic of the parent amsacrine moiety, as well as its ability to generate oxygen radicals which can mediate DNA damage, mainly at cytidine and guanosine nucleotides. 346It also retains the property of stimulating the formation of cleavable complexes with DNA in the presence of topoisomerase II, but its netropsin-like moiety confers little or no influence on the reaction with topoisomerase I. 346 Thus far, the combilexin strategy concerned netropsin- or lexitropsin-like minor groove binders attached to different intercalating chromophores. In 1995, the strategy was extended to another category of minor-groove binders, namely 1,3diaryltriazenes derived from the antiviral and antiprotozoal drug berenil (6). The acridine-triazene combilexin (1t)2) exhibits a distinct preference for AT base tracts rather than GC-rich sequences and is about 40-fold more cytotoxic than the triazene or acridine subunits towards L1210 mouse leukemia and A2780 human colon cancer cell lines. 347The results on combilexin molecules obtained so far encourage us tobelieve that this approach to DNA-targeted pharmacology has the potential to yield important developments in the search for new classes of topoisomerase inhibitors, and perhaps for new and better anticancer drugs. The epipodophyllotoxins etoposide (VP-16-213) and teniposide (VM-26) are very potent topoisomerase II inhibitors and are largely used in chemotherapy for the treatment of small cell lung cancer, testicular cancer, lymphoma, and leukemia. These compounds stabilize DNA-topoisomerase II complexes but interact only
Recognition and Modification of Double-Helical DNA
143
Figure 7. View from the minor groove of an energy-minimized model of the complex between NetAmsa (101) and d(GCGCAATTGCGC)2. The molecular model illustrates the threading of the hybrid through the double helix so as to occupy both the minor and major grooves. The netropsin moiety of the hybrid lies in the minor groove of the AATT central core, the acridine ring is intercalated between the last A.T base pair and the adjacent C.G base pair and the methansulfonanilino group resides in the major groove. 345
weakly, if at all, with DNA in the absence of the enzyme. Lown and coworkers have attempted to direct epipodophyllotoxins to specific sequences via the conjugation with lexitropsins. A series of 4'-demethylepipodophyllotoxin-lexitropsin conjugates such as compound 103 were synthesized but these compounds were found to be much less cytotoxic than the parent compounds. 348
144
CHRISTIAN BAILLY o
~._j NH.~NH (100) ThiaNet-GA
N
I-~C-~-.NH O
~O (101) Net~m~
~--s Ns~O
-.CHa HN O
.N--t,
..~N,c F
H=C.,N,.C~H ,,,,J
H3C H.c'N"~
(102)
(103) N.,NH O/%O N H3CO ~
~ : ~ ~ C H s OO ~
.o~o H3co
o,,(,o )
. H ~,)'"~O ~N
"OCHa
.y~'-N*
VI. CONCLUSION Netropsin and distamycin have largely contributed to our understanding of the molecular basis of drug-DNA recognition. The understanding of how these two antibiotics recognize and bind to AT sequences in DNA gave perceptions of how to design sequence-specific DNA binding molecules. The knowledge arising from these two antibiotics has inspired the rational design of DNA reading molecules; hopefully, they will contribute to tackling the therapy of chemoresistant tumors. As shown in this review, the chemical structure of netropsin-like DNA reading elements may be varied in many synthetically convenient fashions, to produce different repertoires of sequence-selective DNA binding molecules with a range of functionalities. Sterically demanding groups can be attached to netropsin and distamycin without abolishing their sequence recognition properties. The fact that certain netropsin analogues can readily recognize a specific sequence in DNA (e.g. lexitropsins forming 2:1 complexes) shows DNA targeting with minor-groove binding drugs is no longer a possibility but a practical reality. The fact that certain netropsin conjugates capable of inducing DNA damages at specific sequences exhibit potent antitumor activities (e.g. netropsin-nitrogen mustard conjugates)
Recognition and Modification of Double-Helical DNA
145
show that this DNA-targeted strategy has the potential to yield new and efficient antitumor agents. There is good reason to believe that netropsin and distamycin will continue to inspire the development of new anticancer agents. 349-352 In the many examples presented in this review, netropsin and distamycin are almost always used to deliver cytotoxic drugs to specific sequences in DNA, but they can also be used to deliver DNA to cells. Gene transfer with netropsin-lipid conjugates has been attempted. 353 Moreover, netropsin and distamycin analogues can also be used independently of their capacity to bind to AT-rich DNA sequences. For example, sulfonated and phosphonated ureido dimers of netropsin such as compound 104 containing six sulfonic acid units and the phosphonic acid-containing ligand 105 represent a new class of surface-acting antiviral agents. Their mechanism of action apparently does not require binding to DNA but may involve the disruption of the virus attachment to CD4+-susceptible cells via an effect on CD4-gp 120 interactions. 354 Although there are a few netropsin conjugates under clinical or preclinical evaluation, medicinal chemists still have much to do to design new clinically useful drugs endowed with the aptitude for reading any given DNA sequence, and inducing the required DNA modification to obtain the desired biological response. Computer-based methods will increasingly serve to delineate more precisely the molecular rules that govern drug-DNA recognition. The increasing evidence that DNA binding proteins such as topoisomerases and transcription factors mediate the effects of drugs suggest that in addition to elucidating the structures of drug-DNA complexes, it will be necessary to examine in detail the effects of drugs on protein-DNA complexes. Close collaboration between medicinal chemists and molecular biologists will be necessary if we are to gain an improved understanding PO3H2
PO3H2
(105)
NH H3
NH
S.O3H H O 3 S ~ T
v
H
H3C
HN CH3
Ha
~
"NH
S.O3H
"SO3H
HN
SO3HCc~N~ H3
H
HN
(104)
NH
H
H
H~c'
~~N~c) HN
'cN~ ureido dimers
S03H He
146
CHRISTIAN BAILLY
of the mechanisms whereby antitumor drugs affect the function of particular oncogenes. Over the last 15 years, research on small molecules acting on nucleic acids has not only led to therapeutically useful drugs but has also provided a inexhaustible source of structural and biological information on nucleic acids. The recent discovery of new tumor-active compounds, such as those based on netropsin and distamycin reported here, has restored small molecules to the forefront of cancer therapy. It is still premature to state that netropsin and distamycin derivatives will provide new generations of sequence-specific antitumor drugs. However, the results obtained thus far are suggestive and promising. They augur exciting developments for years to come.
ACKNOWLEDGMENTS I w~sh to thank my colleagues, past and present, who contributed to many of the studies cited in this chapter. Research performed in the author's laboratory are supported by the INSERM, the Association pour la Recherche contre le Cancer (ARC) and the Ligue Nationale Frangaise Contre le Cancer (Comit6 du Nord).
REFERENCES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21.
Bishop, J. M. Science 1987, 235, 305. Stein, C. A.; Cohen, J. S. Cancer Res. 1988, 48, 2659. H61~ne,C. Eur. J. Cancer 1991, 27, 1466. Thuong, N. T.; H61~ne,C. Angew. Chem. Int. Ed. Engl. 1993, 32, 666. Saison-Behmoaras, T.; H61~ne,C. In The Searchfor New Anticancer Drugs; Waring, M. J.; Ponder, B. A. J., Eds.; Kluwer Academic: London, 1992, p. 259. Anderson, W. E Science 1992, 256, 808. Thompson, L. Science 1992, 258, 744. Sikora, K. Gene Therapy 1994, 1, 149. Stevens, M. E G. In The Search for New Anticancer Drugs; Waring, M. J.; Ponder, B. A. J., Eds.; Kluwer Academic: London, 1992, p. 1. Waring, M. J. Annu. Rev. Biochem. 1981, 50, 159. Wakelin, L. E G.; Waring, M. J. In Comprehensive Medicinal Chemistry; Sammes, E G., Ed.; Pergamon: Oxford, 1990, Vol. 2, p. 703. Feigon, J.; Denny, W. A.; Leupin, W.; Kearns, D R. J. Med. Chem. 1984, 27, 450. Bailly, C.; Waxing, M. J. Biochemistry 1993, 32, 5985. Bailly, C.; Waxing, M. J. Antiviral Chem. Chemother. 1993, 4, 113. Bailly,C.; Denny, W.A.; Mellor, L.; Wakelin, L. E G.; Waxing,M. J. Biochemistry 1992, 31, 3514. Bailly, C.; H6nichart, J. E; Colson, E; Houssier, C. J. Mol. Recognit. 1992, 5, 155. Baguley, B. C. Anti-Cancer Drug Des. 1991, 6, 1. Denny, W. A. In The Search for New Anticancer Drugs; Waring, M. J.; Ponder, B. A. J., Eds.; Kluwer Academic: London, 1992, p. 19. Hurley, L. H. J. Med. Chem. 1989, 32, 2027. Steitz, T. A. Structural Studies of Protein-Nucleic Acid Interaction; University Press: Cambridge, 1993. Travers, A. A. DNA-Protein Interactions; Chapman and Hall: London, 1993.
Recognition and Modification of Double-Helical DNA 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53.
54. 55. 56. 57. 58. 59. 60. 61.
147
Pellegrini, M.; Ebright, R. H. J. Am. Chem. Soc. 1996, 118, 5832. Travers, A. A. Annu. Rev. Biochem. 1989, 58, 427. Churchill, M. E. A.; Travers, A. A. Trends Biochem. Sci. 1991, 16, 92. Bonnefoy, E.; Rouvi~re-Yaniv, J. EMBO J. 1991, 10, 687. Wang, S.; Cosstick, R.; Gardner, J. F.; Gumport, R. I. Biochemistry 1995, 34, 13082. Lee, D. K.; Horikoshi, M.; Roeder, R. G. Cell 1991, 67, 1241. Start, D. B.; Hawley, D. K. Cell 1991, 67, 1231. Juo, Z. S.; Chiu, T. K.; Leiberman, P. M.; Baikalov, I.; Berk, A. J.; Dickerson, R. E. J. Mol. Biol. 1996, 261,239. Reardon, B. J.; Winters, R. S.; Gordon, D.; Winter, E. Proc. Natl. Acad. Sci. USA 1993, 11327. King, C.-Y.; Weiss, M. A. Proc. Natl. Acad. Sci. USA 1993, 90, 11990. Wong, J. M.; Bateman, E. Nucleic Acids Res. 1994, 22, 1890. Ades, S. E.; Sauer, R. T. Biochemistry 1995, 34, 14601. Suzuki, M. EMBO J. 1989, 8, 797. Suzuki, M. J. Mol. Biol. 1989, 207, 61. Suzuki, M. In Nucleic Acids. and Molecular Biology; Eckstein, F.; Lilley, D. M. J., Eds.; Springer-Verlag: Berlin, 1991, Vol. 5, p. 126. Lindsey, G. G.; Thompson, P. J. Biol. Chem. 1992, 267, 14622. Suzuki, M.; Yagi, N. Proc. R. Soc. Lond. B 1991, 246, 231. Suzuki, M.; Gerstein, M.; Johnson, T. Protein Engr. 1993, 6, 565.. Strauss, F.; Varshavsky, A. Cell 1984, 37, 889. Bailly, E; Bailly, C.; Waring, M. J.; H6nichart, J. P. Biochem. Biophys. Res. Commun. 1992, 184, 930. Flock, S.; Bailly, E; Bailly, C.; Waring, M. J.; H6nichart, J. P.; Colson, P.; Houssier, C. J. Biomol. Struct. Dyn. 1994, 11,881. Bourdouxhe-Housiaux, C.; Colson, P.; Houssier, C.; Bailly, C. Anti-Cancer Drug Design, 1996, in press. Schumacher, M. A.; Choi, K. Y.; Zalkin, H.; Brennan, R. G. Science 1994, 266, 763-770. Van Dyke, M. W.; Hertzberg, R. P.; Dervan, P. B. Proc. Natl. Acad. Sci. USA 1983, 79, 5470. Harshman, K. D.; Dervan, P. B. Nucleic Acids Res. 1985, 13, 4825. Portugal, J.; Waring, M. J. Eur. J. Biochem. 1987, 167, 281. Bailly, C.; Donkor, I. O.; Gentle, D.; Thomalley, M.; Waring, M. J. Mol. Pharmacol. 1994, 46, 313. Abu-Daya, A.; Brown, P. M.; Fox, K. R. Nucleic Acids Res. 1995, 23, 3385. Churchill, M. E. A.; Suzuki, M. EMBO J. 1989, 8, 4189. Reeves, R.; Nissen, M. S. J. Biol. Chem. 1990, 265, 8573. Geierstanger, B. H.; Volkman, B. F.; Kremer, W.; Wemmer, D. E. Biochemistry 1994, 33, 5347. Verweij, J.; den Hartigh, J.; Pinedo, H. M. Antitunu~r Antibiotics in Cancer Chemotherapy--Principles and Practice; Chabner, B. A.; Collins, J. M., Eds.; J. B. Lippincott: Philadelphia, 1990, p. 382. Ray, R.; Snyder, R. C.; Thomas, S.; Koller, C. A.; Miller, D. M. J. Clin. Invest. 1989, 83, 2003. Snyder, R. C.; Ray, R.; Blume, S.; Miller, D. M. Biochemistry 1991, 30, 4290. Vigneswaran, N.; Mayfield, C. A.; Rodu, B.; James, R.; Kim, H.-G.; Miller, D. M. Biochemistry 1996, 35, 1106. Keniry, M. A.; Banville, D. L.; Simmonds, P. M.; Shafer, R. J. Mol. Biol. 1993, 231,753. Sastry, M.; Patel, D. J. Biochemistry 1993, 32, 6588. Van Dyke, M. W.; Dervan, P. B. Biochemistry 1983, 22, 2373. Liu, C.; Chen, F.-M. Biochemistry 1994, 33, 1419. Grootenhuis, P. D. J.; Kollman, P. A.; Seibel, G. L.; DesJarlais, R. L.; Kuntz, I. D. Anti-Cancer Drug Des. 1990, 5, 237.
148
CHRISTIAN BAILLY
62. Hurley, L. H.; Draves, E H. In Molecular Aspects ofAnticancer Drug-DNA Interactions; Neidle, S.; Waring, M. J., Eds.; Macmillan: London, 1993, Vol. l, pp. 89-133. 63. Hurley, L. H.; Sun, D. J. Mol. Recognit. 1994, 7, 123. 64. Boger, D. L.; Johnson, D. S. Angew. Chem. Int. Ed. Engl. 1996, 35, 1438. 65. Zimmer, C.; W~ihnert, U. Prog. Biophys. Mol. Biol. 1986, 47, 3 I. 66. Wartell, R. M.; Larson, J. E.; Wells, R. D.; Netropsin. J. Biol. Chem. 1974, 249, 6719. 67. Kopka, M. L.; Yoon, C.; Goodsell, D.; Pjura, E; Dickerson, R. E. J. Mol. Biol. 1985, 183, 553. 68. Coil, M.; Frederick, C. A.; Wang, A. H. J.; Rich, A. Proc. Natl. Acad. Sci. USA 1987, 84, 8385. 69. Coll, M.; Aymami, J.; van der Marel, G. A.; van Boom, J. H.; Rich, A.; Wang, A. H.-J. Biochemistry 1989, 28, 3 lO. 70. Tabemero, L.; Verdaguer, N.; Coil, M.; Fita, I.; van der Marel, G. A.; van Boom, J. H.; Rich, A.; Aymami, J. Biochemistry 1993, 32, 8403. 7 I. Goodsell, D. S.; Leung, Ng H.; Kopka, M. L.; Lown, J. W.; Dickerson, R. E. Biochemistry 1995, 34, 16654. 72. Kopka, M. L.; Yoon, C.; Goodsell, D.; Pjura, E; Dickerson, R. E. Proc. Natl. Acad. Sci. USA 1985, 82, 1376. 73. Chen, X.; Ramakrishnan, B.; Sundaralingam, M. Nature Struct. Biol. 1995, 2, 733. 74. Goodsell, D. S.; Kopka, M. L.; Dickerson, R. E. Biochemistry 1995, 34, 4983. 75. Youngquist, R. S.; Dervan, E B. Proc. Natl. Acad. Sci. USA 1985, 82, 2565. 76. Dervan, E B. Science 1986, 232, 464. 77. Goodsell, D.; Dickerson, R. E. J. Med. Chem. 1986, 29, 727. 78. Khodin, A. A.; Krylov, A. S.; Grokhovsky, S. L.; Zhuze, A. L.; Zasedatelev, A. S.; Gursky, G. V.; Gottikh, B. E FEBS Lett. 1980, 118, 311. 79. Lown, J. W.; Krowicki, K.; Balzarini, J.; Newman, R. A.; De Clercq, E. J. Med. Chem. 1989, 32, 2368. 80. Wang, W.; Lown, J. W. J. Med. Chem. 1992, 35, 2890. 81. Kissinger, K. L.; Dabrowiak, J. C.; Lown, J. W. Chem. Res. Toxicol. 1990, 3, 162. 82. Rao, K. E.; Zimmermann, J.; Lown, J. W. J. Org. Chem. 1991, 56, 786. 83. Singh, M. E; Plouvier, B.; Hill, G. C.; Gueck, J.; Pon, R. T.; Lown, J. W. J. Am. Chem. Soc. 1994, 116, 7006. 84. Leinsoo, T. A.; Nikolaev, V. A.; Grokhovskii, S. L.; Surovaya, A. M.; Sidorova, N. Y.; Streltsov, S. A.; Zasedatelev, A. S.; Zhuze, A. L. Mol. Biol. 1989, 23, 1616. 85. Nikolaev, V. A.; Grokhovsky, S. L.; Surovaya, A. N.; Leinsoo, T. A.; Sidorova, N. Y.; Zasedatelev, A. S.; Zhuze, A. L.; Strahan, G. A.; Shafer, R. H.; Gursky, G. V. J. Biomol. Struct. Dyn. 1996, 14, 31. 86. Zakrzewska, K.; Pullman, B. J. Biomol. Struct. Dyn. 1988, 5, 1043. 87. Pullman, B. In Perspectives in Quantum Chemistry; Jortner, J.; Pullman, B., Eds.; Kluwer Academic: Dordrecht, 1989. 88. Zakrzewska, K.; Randrianarivelino, M.; Pullman, B. J. Biomol. Struct. Dyn. 1988, 6, 331. 89. Waring, M. J.; Bailly, C. Gene 1994, 149, 69. 90. Bailly, C.; Waring, M. J. Nucleic Acids Res. 1995, 23, 885. 91. Marchand, C.; Bailly, C.; McLean, M. J.; Moroney, S. E.; Waring, M. J. Nucleic Acids Res. 1992, 20, 5601. 92. Bailly, C.; Marchand, C.; Waring, M. J. J. Am. Chem. Soc. 1993, 115, 3784. 93. Bailly, C.; Payet, D.; Travers, A. A.; Waring, M. J. Proc. Natl. Acad. Sci. USA 1996, 93, 13623. 94. Waring, M. J.; Bailly, C. J. Mol. Recognit., in press. 95. Lown, J. W. Anti-Cancer Drug Des. 1988, 3, 25. 96. Lown, J. W. J. Mol. Recognit. 1994, 7, 79. 97. Lown, J. W.; Krowicki, K.; Balzarini, J.; De Clercq, E. J. Med. Chem. 1986, 29, 1210. 98. Lown, J. W.; Krowicki, K.; Bhat, U. G.; Skorobogaty, A.; Ward, B.; Dabrowiak, J. C. Biochemistry 1986, 25, 7408.
Recognition and Modification of Double-Helical DNA 99. 100. 101. 102.
149
Krowicki, K.; Lown, J. W. J. Org. Chem. 1987, 52, 3493. Kissinger, K. L.; Krowicki, K.; Dabrowiak, J. C.; Lown, J. W. Biochemistry 1987, 26, 5590. Lee, M.; Pon, R. T.; Krowicki, K.; Lown, J. W. J. Biomol. Struct. Dyn. 1988, 5, 939. Lee, M.; Coulter, D. M.; Pon, R. T.; Krowicki, K.; Lown, J. W. J. Biorru)l. Struct. Dyn. 1988, 5, 1059. 103. Lee, M.; Hartley, J. A.; Pon, R. T.; Krowicki, K.; Lown, J. W. Nucleic Acids Res. 1988, 16, 665. 104. Lee, M.; Chang, D. K.; Hartley, J. A.; Pon, R. T.; Krowicki, K.; Lown, J. W. Biochemistry 1988, 27, 445. 105. Lee, M.; Krowicki, K.; Hartley, J. A.; Pon, R. T.; Lown, J. W. J. Am. Chem. Soc. 1988, 110, 3641. 106. Burckhardt, G.; Luck, G.; Zimmer, C.; Sttid, J.; Krowicki, K.; Lown, J. W. Biochim. Biophys. Acta 1989, 1009, I 1. 107. Lee, M.; Rhodes, A. L.; Wyatt, M. D.; Forrow, S.; Hartley, J. A. Biochemistry 1993, 32, 4237. 108. Wyatt, M. D.; Garbiras, B. J.; Lee, M.; Forrow, S. M.; Hartley, J. A. Bioorg. Med. Chem. Lett. 1994, 4, 801. 109. Rao, K. E.; Bathini, Y.; Lown, J. W. J. Org. Chem. 1990, 55, 728. 110. Rao, K. E.; Shea, R. G.; Yadagiri, B.; Lown, J. W. Anti-Cancer Drug Des. 1990, 5, 3. 111. Kumar, S.; Jaseja, M.; Zimmermann, J.; Yadagiri, B.; Pon, R. T.; Sapse, A. M. J. Biorm)l. Struct. Dyn. 1990, 8, 99. 112. Kumar, S.; Bathini, Y.; Joseph, T.; Pon, R. T.; Lown, J. W. J. Biomx)l. Struct. Dyn. 1991, 9, 1. 113. Plou~,ier, B.; Bailly, C.; Houssin, R.; Rao, K. E.; Lown, J. W.; H6nichart, J.-P.; Waring, M. J. Nucleic Acids Res. 1991, 19, 5821. 114. Lee, M.; Krowicki, K.; Shea, R. G.; Lown, J. W.; Pon, R. T. J. Mol. Recognit. 1989, 2, 84. 115. Kopka, M. L.; Larsen, T. A. In Nucleic Acid Targeted Drug Design; Propst, C. L.; Perun, T. J., Eds.; Marcel Dekker: New York, 1992, pp. 303-374. 116. Pullman, A.; Pullman, B. Q. Rev. Biophysics 1981, 14, 289. 117. Marky, L. A.; Breslauer, K. J. Proc. Natl. Acad. Sci. USA 1987, 84, 4359. 118. Singh, S. B.; Wemmer, D. E.; Kollman, P. A. Proc. Natl. Acad. Sci. USA 1994, 91, 7673. 119. Zhang, Y.; Chen, F.-X.; Mehta, P.; Gold, B. Biochemistry 1993, 32, 7954. 120. Wade, W. S.; Dervan, P. B. J. Am. Chem. Soc. 1987, 109, 1574. 121. Bailly, C.; Colson, P.; Houssier, C.; Houssin, R.; Mrani, D.; Gosselin, G.; Imbach, J. L.; Waring, M. J.; Lown, J. W.; H6nichart, J. P. Biochemistry 1992, 31, 8349. 122. Kuwahara, J.; Sugiura, Y. Proc. Natl. Acad. Sci. USA 1988, 85, 2459. 123. Pelton, J. G.; Wemmer, D. E. Proc. Natl. Acad. Sci. USA 1989, 86, 5723. 124. Pelton, J. G.; Wemmer, D. E. J. Am. Chem. Soc. 1990, 112, 1393. 125. Fagan, P.; Wemmer, D. E. J. Am. Chem. Soc. 1992, 114, 1080. 126. Chen, X.; Ramakrishnan, B.; Rao, S. T.; Sundaraligam, M. Struct. Biol. 1994, 1, 169. 127. Rentzeperis, D.; Marky, L. A. Biochemistry 1995, 34, 2937. 128. Animati, E; Arcamone, E M.; Conte, M. R.; Felicetti, P.; Galeone, A.; Lombardi, P.; Mayol, L.; Paloma, L. G.; Rossi, C. J. Med. Chem. 1995, 38, 1140. I29. Wade, W. S.; Mrksich, M.; Dervan, P. B. Biochemistry 1993, 32, 11385. 130. Geierstanger, B. H.; Dwyer, T. J.; Bathini, Y.; Lown, J. W.; Wemmer, D. E. J. Am. Chem. Soc. 1993, 115, 4474. 131. Geierstanger, B. H.; Jacobsen, J. P.; Mrksich, M.; Dervan, P. B.; Wemmer, D. E. Biochemistry 1994, 33, 3055. 132. Mrksich, M.; Wade, W. S.; Dwyer, T. J.; Geierstanger, B. H.; Wemmer, D. E.; Dervan, P. B. Proc. Natl. Acad. Sci. USA 1992, 89, 7586. 133. Mrksich, M.; Dervan, P. B. J. Am. Chem. Soc. 1993, 115, 9892. 134. Mrksich, M.; Dervan, P. B. J. Am. Chem. Soc. 1994, 116, 3663. 135. Dwyer, T. J.; Geierstanger, B. H.; Mrksich, M.; Dervan, P. B.; Wemmer, D. E. J. Am. Chem. Soc. 1993, 115, 9900. 136. Mrksich, M.; Dervan, P. B. J. Am. Chem. Soc. 1994, 116, 7983.
150
CHRISTIAN BAILLY
137. 138. 139. 140. 141. 142. 143. 144.
Cho, J.; Parks, M. E.; Dervan, E B. Proc. Natl. Acad. Sci. USA 1995, 92, 10389. Trauger, J. W.; Baird, E. E.; Mrksich, M.; Dervan, P. B. J. Am. Chem. Soc. 1996, 118, 6160. A1-Said, N. H.; Lown, J. W. Tetrahedron Lett. 1994, 35, 7577. Chen, Y.-H.; Lown, J. W. J. Am. Chem. Soc. 1994, 116, 6995. Parks, M. E.; Baird, E. E.; Dervan, P. B. J. Am. Chem. Soc. 1996, 118, 6147. Parks, M. E.; Baird, E. E. J. Am. Chem. Soc. 1996, 118, 6153. Geierstanger, B. H.; Mrksich, M.; Dervan, P. B.; Wemmer, D. E. Science 1994, 266, 646. Sinyakov, A. N.; Lokhov, S. G.; Kutyavin, I. V.; Gamper, H. B.; Meyer, R. B. Jr. J. Am. Chem. Soc. 1995, II 7, 4995. Szewczyk, J. W.; Baird, E. E.; Dervan, P. B. J. Am. Chem. Soc. 1996, 118, 6778. Robles, J.; Rajur, S. B.; McLaughlin, L. W. J. Am. Chem. Soc. 1996, 118, 5820. Wiederholt, K.; Rajur, S. B.; Giuliano, J. Jr.; O'Donnell, M. J.; McLaughlin, L. W. J. Am. Chem. Soc. 1996, 118, 7055. Szewczyk, J. W.; Baird, E. E.; Dervan, P. B. Angew. Chem. Int. Ed. Engl. 1996, 35, 1487. Mattes, W. A.; Hartley, J. A.; Kohn, K. W.; Matheson, D. W. Carcinogenesis 1988, 9, 2065. Zerial, M.; Salinas, J.; Filipski, J.; Bemardini, G. Eur. J. Biochem` 1986, 160, 479. Broggini, M.; Ponti, M.; Ottolenghi, S.; D'Incalci, M.; Mongelli, N.; Mantovani, R. Nucleic Acids Res. 1989, 17, 1051. Gambari, R.; Barbieri, R.; Nastruzzi, C.; Chiorboli, V.; Feriotto, G.; Natali, G. P.; Giacomini, P.; Arcamone, E Biochem. Pharmacol. 1991, 41,497. Dorn, A.; Affolter, M.; Muller, M.; Gehring, W. J.; Leupin, W. EMBO J. 1992, 11,279. Chai, S.; Alonso, J. C. Nucleic Acids Res. 1996, 24, 282. Gambari, R.; Nastruzzi, C. Biochem. Pharmacol. 1994, 47, 599. Broggini, M.; D'Incalci, M. Anti-Cancer Drug Des. 1994, 9, 373. Oakley, M. G.; Mrksich, M.; Dervan, P. B. Biochemistry 1992, 31, 10969. Browne, K. A.; He, G.-X.; Bruice, T. C. J. Am. Chem. Soc. 1993, 115, 7072. Blask6, A.; Bruice, T. C. Proc. Natl. Acad. Sci. USA 1993, 90, 10018. Blask6, A.; Browne, K. A.; Bruice, T. C. J. Am. Chem. Soc. 1994, 116, 3726. He, G.-X.; Browne, K. A.; Blaskb, A.; Bruice, T. C. J. Am. Chem. Soc. 1994, 116, 3716. He, G.-X." Browne, K. A.; Groppe, J. C." Blask6, A.; Mei, HI-Y.; Bruice, T. C. J. Am. Chem. Soc. 1993, 115, 7061. Blaskb, A.; Browne, K. A.; Bruice, T. C. BioOrg. Med. Chem. 1995, 3, 631. Xue, T.; Browne, K. A.; Bruice, T. C. Bioconjugate Chem. 1995, 6, 82. Hansma, H. G.; Browne, K. A.; Groppe, J. C.; Bezanilla, M.; Bruice, T. C. Biochemistry 1994, 33, 8436. Browne, K. A.; Bruice, T. C. J. Am. Chem. Soc. 1992, 114, 4951. Bruice, T. C.; Mei, H.-H.; He, G.-X.; Lopez, V. Proc. Natl. Acad. Sci. USA 1992, 89, 1700. Sigman, D. S.; Mazumder, A.; Perrin, D. M. Chem. Rev. 1993, 93, 2295. Hartley, J. A. In Molecular Aspects ofAnticancer Drug-DNA Interactions; Neidle, S.; Waring, M. J., Eds.; Macmillan: London, 1993, Vol. 1, p. 1. Hansen, M.; Hurley, L. Acc. Chem. Res. 1996, 29, 249. Tomasz, M. In Molecular Aspects ofAnticancer Drug-DNA Interactions; Neidle, S.; Waring, M. J., Eds.; Macmillan: London, 1994, Vol. 2, p. 312. Boyd, E L.; Cheatham, S. E; Remers, W.; Hill, G. C.; Hurley, L. H. J. Am. Chem. Soc. 1990, 112, 3279. Kopka, M. L." Goodsell, D.; Baikalov, I." Grzeskowiak, K." Cascio, D.; Dickerson, R. E. Biochemistry 1994, 33, 13593. Krowicki, K.; Balzarini, J.; De Clercq, E.; Newman, R. A.; Lown, J. W. J. Med. Chem. 1988, 31, 341.
145. 146. 147. 148. 149. 150. 151. 152. 153. 154. 155. 156. 157. 158. 159. 160. 161. 162. 163. 164. 165. 166. 167. 168. 169. 170. 171. 172. 173. 174.
Recognition and Modification of Double-Helical DNA
151
175. Arcamone, E A.; Animati, E; Barbieri, B.; Configliacchi, E.; D'Alesio, R.; Geroni, C.; Giulani, F. C.; Lazzari, E.; Menozzi, M.; Mongelli, N.; Penco, S.; Verini, M. A. J. Med. Chem. 1989, 32, 774. 176. Baker, B. E; Dervan, P. B. J. Am. Chem. Soc. 1985, 107, 8266. 177. Baker, B. E; Dervan, P. B. J. Am. Chem. Soc. 1989, 111, 2700. 178. Lee, M.; Rhodes, A. L.; Wyatt, M. D.; Forrow, S.; Hartley, J. A. Anti-Cancer Drug Des. 1993, 8, 173. 179. Xie, G.; Gupta, R.; Lown, J. W. Anti-Cancer Drug Des. 1995, 10, 389. 180. Wyatt, M. D.; Lee, M.; Garbirasd, B. J.; Souhami, R. L.; Hartley, J. A. Biochemistry 1995, 34, 13034. 181. Ciucci, A.; Manzini, S.; Lombardi, P.; Arcamone, E Nucleic Acids Res. 1996, 24, 311. 182. Chen, H. Y.; Liu, J. X.; Lown, J. W. BioOrg. Med. Chem. Lett. 1995, 5, 2223. 183. Gourdie, T. A.; Valu, K. K.; Gravatt, G. L.; Boritzki, T. J.; Baguley, B. C.; Wakelin, L. P. G.; Wilson, W. R.; Woodgate, P. D.; Denny, W. A. J. Med. Chem. 1990, 33, 1177. 184. Palmer, B. D.; Lee, H. H.; Johnson, P.; Baguley, B. C.; Wicklam, G.; Wakelin, L. P. G.; McFadyen, W. D.; Denny, W. A. J. Med. Chem. 1990, 33, 3008. 185. Prakash, A. S.; Denny, W. A.; Gourdie, T. A.; Valu, K. K.; Woodgate, P. D.; Wakelin, L. P. G. Biochemistry 1990, 29, 9799. 186. Valu, K. K.; Gourdie, T. A.; Boritzki, T. J.; Gravatt, G. L.; Baguley, B. C.; Wilson, W. R.; Wakelin, L. P. G.; Woodgate, P. D.; Denny, W. A. J. Med. Chem. 1990, 33, 3014. 187. Wickham, G.; Prakash, A. S.; Wakelin, L. P. G.; McFadyen, W. D. Biochim. Biophys. Acta 1991, 1073, 528. 188. Vlassov, V. V.; Gaidamakov, S. A.; Zarytova, V. F.; Knorre, D. G.; Levina, A. S.; Nikonova, A. A.; Podust, L. M.; Fedorova, O. S. Gene 1988, 72, 313. 189. Kutyavin, I. V.; Gamper, H. B.; Gall, A. A.; Meyer, R. B. Jr. J. Am. Chem. Soc. 1993, 115, 9303. 190. Broggini, M.; Erba, E.; Ponti, M.; Ballinari, D.; Geroni, C.; Spreafico, E; D'Incalci, M. Cancer Res. 1991, 51,199. 191. Montecucco, A.; Fontana, M.; Focher, E; Lestingi, M.; Spadari, S.; Ciarrochi, G. Nucleic Acids Res. 1991, 19, 1067. 192. Fontana, M.; Lestingi, M.; Mondello, C.; Braghetti, A.; Montecucco, A.; Ciarrochi, G.Anti-Cancer Drug Des. 1992, 7, 131. 193. Broggini, M.; Coley, H. M.; Mongelli, N.; Pesenti, E.; Wyatt, M. D.; Hartley, J. A.; D'Incalci, M. Nucleic Acids Res. 1995, 23, 81. 194. Broggini, M.; Moncollin, V.; D' Incalci, M.; Mongelli, N.; Mantovani, R. Nucleic Acids Res. 1995, 23, 1657. 195. Pezzoni, G.; Grandi, M.; Biasoli, G.; Capolongo, L.; Ballinari, D.; Giuliani, E C.; Barbieri, B.; Pastori, A.; Pesenti, E.; Mongelli, N. Br. J. Cancer 1991, 64, 1047. 196. Coley, H. M.; Mongelli, N.; D'Incalci, M. Biochem. Pharmacol. 1993, 45, 619. 197. Rhoads, C. J. JAMA 1946, 131,656. 198. Wang, Y.; Gupta, R.; Huang, L.; Luo, W.; Lown, J. W. Anti-Cancer Drug Des. 1996, 11, 15. 199. Fregeau, N. L.; Wang, Y.; Pon, R. T.; Wylie, W. A.; Lown, J. W. J. Am. Chem. Soc. 1995, 117, 8917. 200. Church, K. M.; Wurdeman, R. L.; Zhang, Y.; Gold, B. Biochemistry 1990, 29, 6827. 201. Sigurdsson, S. T.; Rink, S. M.; Hopkins, P. B. J. Am. Chem. Soc. 1993, 115, 12633. 202. Fagan, P. A.; Spielmann, H. P.; Sigurdsson, S. Th.; Rink, S. M.; Hopkins, P. B.; Wemmer, D. E. Nucleic Acids Res. 1996, 24, 1566. 203. Walker, W. L.; Kopka, M. L.; Filipowsky, M. E.; Dickerson, R. E.; Goodsell, D. S. Biopolymers 1995, 35, 543. 204. Nielsen, P. E. J. Mol. Recognit. 1990, 3, 1. 205. Takasugi, M.; Guendouz, A.; Chassignol, M.; Decout, J. L.; Lhomme, J.; Thuong, N. T.; H61~ne, C. Proc. Natl. Acad. Sci. USA 1991, 88, 5602.
152
CHRISTIAN BAILLY
206. Godard, G." Francois, J. C.; Duroux, I.; Asseline, U.; Chassignol, M.; Thuong, N.; H616ne, C." Saison-Behmoaras, T. Nucleic Acids Res. 1994, 22, 4789. 207. Hartley, J. A.; McAdam, S. R.; Das, S.; Roldan, M. C.; Haskell, M. K.; Lee, M. Anti-Cancer Drug Des. 1994, 9, 181. 208. Rao, K. E.; Gosselin, G." Mrani, D.; P6rigaud, C.; lmbach, J. L.; Bailly, C.; H6nichart, J. P." Colson, P.; Houssier, C.; Lown, J. W. Anti-Cancer Drug Des. 1994, 9, 221. 209. Hartley, J. A.; Webber, J.; Wyatt, M. D.; Bordenick, N.; Lee, M. BioOrg. Med. Chem. Lett. 1995, 3, 623. 210. Herfeld, P.; Helissey, P.; Giorgi-Renault, S. Bioconjugate Chem. 1994, 5, 67. 211. Bouziane, M.; Ketterl6, C.; Helissey, P.; Herfeld, P.; Le Bret, M.; Giorgi-Renault, S.; Auclair, C. Biochemistry 1995, 34, 14051. 212. Ketterl6, C.; Gabarro-Arpa, J.; Ouali, M.; Bouziane, M.; Auclair, C.; Helissey, P.; Giorgi-Renault, S.; Le Bret, M. J. Biomol. Struct. Dyn. 1996, 13, 963. 213. Helissey, P.; Bailly, C.; Vishwakarma, J. N.; Auclair, C.; Waring, M. J.; Giorgi-Renault, S. Anti-Cancer Drug Des. 1996, 11,527-551. 214. Meunier, B. Chem. Rev. 1992, 92, 141. 215. Munson, B. R.; Fiel, R. J. Nucleic Acid Res. 1992, 20, 1315. 216. Anneheim-Herbelin, G.; Perr6e-Fauvet, M.; Gaudemer, A.; Helissey, P.; Giorgi-Renault, S. Tetrahedron Lett. 1993, 34, 7263. 217. Perr6e-Fauvet, M.; Gresh, N. J. Biomol. Struct. Dyn. 1994, 11, 1203. 218. Matsumoto, T.; Utsumi, Y.; Sakai, Y.; Toyooka, K.; Shibuya, M. Heterocycles 1992, 34, 1697. 219. Wilson, W. R. In The Search for New Anticancer Drugs; Waring, M. J.; Ponder, B. A. J., Eds.; Kluwer Academic: London, 1992, p. 87. 220. Tocher, J. H.; Edwards, D. I. Biochem. Pharmacol. 1994, 48, 1089. 221. Kappen, L. S.; Lee, T. R.; Yang, C.-C.; Goldberg, I. H. Biochemistry 1989, 28, 4540. 222. Nishiwaki, E.; Lee, H.; Matsumoto, T.; Toyooka, K.; Sakurai, H.; Shibuya, M. Tetrahedron Lett. 1990, 31, 1299. 223. Parrick, J.; Porssa, M.; Davies, L. K.; Dennis, M. E; Patel, K. B.; Stratford, M. R. L.; Wardman, P. BioOrg. Med. Chem. Lett. 1993, 3, 1697. 224. Matsumoto, T.; Sakai, Y.; Toyooka, K.; Shibuya, M. Heterocycles 1992, 33, 135. 225. Nishiwaki, E.; Nakagawa, H.; Takasaki, M.; Matsumoto, T.; Sakurai, H.; Shibuya, M. Heterocycles 1990, 31, 1763. 226. Nishiwaki, E.; Lee, H.; Matsumoto, T.; Toyooka, K.; Sakurai, H.; Shibuya, M. Tetrahedron Lett. 1990, 31, 1299. 227. Grokhovsky, S. L.; Zubarev, V. E. Nucleic Acids Res. 1991, 19, 257. 228. Galas, D. J.; Schmitz, A. Nucleic Acids Res. 1978, 5, 3157. 229. Dabrowiak, J. C.; Stankus, A. A.; Goodisman, J. In Nucleic Acid Targeted Drug Design; Propst, C. L.; Perun, T. J., Eds.; Marcel Dekker: New York, 1992, p. 93. 230. Bailly, C.; Waring, M. J. J. Biomol. Struct. Dyn. 1995, 12, 869. 231. Schultz, P. G.; Dervan, P. B. J. Biomol. Struct. Dyn. 1983, 1, 1133. 232. Taylor, J. S.; Schultz, P. G.; Dervan, P. B. Tetrahedron 1984, 40, 457. 233. Schultz, P. G.; Dervan, P. B. Proc. Natl. Acad. Sci. USA 1983, 80, 6834. 234. Schultz, P. G.; Taylor, J. S.; Dervan P. B. J. Am. Chem. Soc. 1982, 104, 6861. 235. Schultz, P. G.; Dervan, P. B. J. Am. Chem. Soc. 1983, 105, 7748. 236. Youngquist, R. S.; Dervan, P. B. J. Am. Chem. Soc. 1985, 107, 5528. 237. Youngquist, R. S.; Dervan, P. B. J. Am. Chem. Soc. 1987, 109, 7564. 238. Wade, W. S.; Mrksich, M.; Dervan, P. B. J. Am. Chem. Soc. 1992, 114, 8783. 239. Mrksich, M.; Dervan, P. B. J. Am. Chem. Soc. 1993, 115, 2572. 240. Camerman, N.; Camerman, A.; Sarkar, B. Can. J. Chem. 1976, 54, 1309. 241. Pickart, L.; Freedman, J. H.; Loker, W. J.; Peisach, J.; Perkins, C. M.; Stenkamp, R. E.; Weinstein, B. Nature 1980, 288, 715.
Recognition and Modification of Double-Helical DNA 242. 243. 244. 245. 246. 247. 248. 249. 250. 251. 252. 253. 254. 255. 256. 257. 258. 259. 260. 261. 262. 263. 264. 265. 266. 267. 268. 269. 270. 271. 272. 273. 274. 275. 276. 277. 278. 279. 280.
15 3
Freedman, J. H.; Pickart, L.; Weinstein, B.; Mims, W. B.; Peisach, J. Biochemistry 1982, 21, 4540. Chikira, M.; Sato, T.; Antholine, W. E.; Petering, D. H. J. Biol. Chem. 1991, 266, 2859. Sigman, D. S.; Mazumder, A.; Perrin, D. M. Chem. Rev. 1993, 93, 2295. Bailly, C.; Bernier, J. L.; Houssin, R.; Helbecque, N.; H6nichart, J. P. Anti-Cancer Drug Des. 1987, 1,303. Morier-Teissier, E.; Bailly, C.; Bemier, J. L.; Houssin, R.; Helbecque, N.; Catteau, J. P.; Colson, P.; Houssier, C.; H6nichart, J. P. Anti-Cancer Drug Des. 1989, 4, 37. Morier-Teissier, E.; Bernier, J. L.; Lohez, M.; Catteau, J. P.; H6nichart, J. P. Anti-Cancer Drug Des. 1990, 5, 291. Bailly, C.; Sun, J. S.; Colson, P.; Houssier, C.; H61~ne, C.; Waring, M. J.; HEnichart, J. P. Bioconjugate Chem. 1992, 3, 100. Grokhovskii, S. L.; Nikolaev, V. A.; Zubarev, V. E.; Surovaya, A. N.; Zhuze, A. L.; Chemov, B. K.; Sidorova, N. Y.; Zasedatelev, A. S.; Gurskii, G. V. Molecular Biol. 1993, 6, 839. Chen, X. C.; Rokita, S. E.; Burrows, C. J. J. Am. Chem. Soc. 1991, 113, 5884. Mack, D. P.; Dervan, P. B. J. Am. Chem. Soc. 1990, 112, 4604. Footer, M.; Egholm, M.; Kron, S.; Coull, J. M.; Matsudaira, P. Biochemistry 1996, 35, 10673. Hecht, S. M. Acc. Chem. Res. 1986, 19, 383. Stubbe, J.; Kozarich, J. W. Chem. Rev. 1987, 87, 1107. Natrajan, A.; Hecht, S. M. In Molecular Aspects ofAnticancer Drug-DNA Interactions; Neidle, S.; Waring, M. J., Eds.; Macmillan: London, 1994, Vol. 2, p. 197. Pratviel, G.; Bernadou, J.; Meunier, B. Angew. Chem. Int. Ed. Engl. 1995, 34, 746. Stubbe, J.; Kozarich, J. W.; Wu, W.; Vanderwall, D. E. Acc. Chem. Res. 1996, 29, 322. Farinas, E.; Tan, J. D.; Baidya, N.; Mascharak, P. K. J. Am. Chem. Soc. 1993, 115, 2996. H6nichart, J. P.; Houssin, R.; Bemier, J. L.; Catteau, J. P. J. Chem. Soc., Chem. Commun. 1982, 1295. H6nichart, J. P.; Bemier, J. L.; Houssin, R.; Lohez, M.; K6nani, A.; Catteau, J. P. Biochem. Biophys. Res. Commun. 1985, 126, 1036. Kohda, J.; Shinozuka, K.; Sawai, H. Tetrahedron Lett. 1995, 36, 5575. Otsuka, M.; Masuda, T.; Haupt, A.; Ohno, M.; Shiraki, T.; Sugiura, Y.; Maeda, K. J. Am. Chem. Soc. 1990, 112, 838. Owa, T.; Haupt, A.; Otsuka, M.; Kobayashi, S.; Tomioka, N.; Itai, A.; Ohno, M.; Shiraki, T.; Uesugi, M.; Sugiura, Y.; Maeda, K. Tetrahedron 1992, 48, 1193. Huang, L.; Morgan, R.; Lown, J. W. BioOrg. Med. Chem. Lett. 1993, 3, 1751. Huang, L.; Quada, J. C.; Lown, J. W. Tetrahedron Lett. 1994, 35, 5323. Huang, L.; Quada, J. C. Jr.; Lown, J. W. Bioconjugate Chem. 1995, 6, 21. Huang, L.; Quada, J. C. Jr.; Lown, J. W. BioOrg. Med. Chem. 1995, 3, 647. Kane, S. A.; Natrajan, A.; Hecht, S. M. J. Biol. Chem. 1994, 269, 10899. Oakley, M. G.; Turnbull, K. D.; Dervan, P. B. Bioconjugate Chem. 1994, 5, 242. Zarytova, V. F.; Sergeyev, D. S.; Godovikova, T. S. Bioconjugate Chem. 1993, 4, 189. Nicolaou, K. C.; Dai, W.-M. Angew. Chem. Int. Ed. Engl. 1991, 30, 1387. Nicolaou, K. C.; Dai, W.-M.; Tsay, S.-C.; Estevez, V. A.; Wrasidlo, W. Science 1992, 256, 1172. Nicolaou, K. C.; Smith A. L.; Yue, E. W. Proc. Natl. Acad. Sci. USA 1993, 90, 5881. Tokuda, M.; Fujiwara, K.; Gomibuchi, T.; Hirama, M.; Uesugi, M.; Sugiura, Y. Tetrahedron Lett. 1993, 34, 669. Semmelhack, M. F.; Gallagher, J. J. J. Org. Chem. 1993, 59, 4357. Bregant, T. M.; Groppe, J.; Little, R. D. 1994, 116, 3635. Spielmann, H. P.; Fagan, P. A.; Bregant, T. M.; Little, R. D.; Wemmer, D. E. Nucleic Acids Res. 1995, 23, 1576. Xie, G.; Morgan, A. R.; Lown, J. W. BioOrg. Med. Chem. Lett. 1993, 3, 1565. Flanagan, M. E.; Rollins, S. B.; Williams, R. M. Chem. Biol. 1995, 2, 145. Bailly, C.; H6nichart, J. P. Bioconjugate Chem. 1991, 2, 379.
154
CHRISTIAN BAILLY
281. Bailly, C.; H6nichart, J. P. In Molecular Aspects of Anticancer Drug-DNA Interactions; Neidle, S.; Waring, M. J., Eds.; Macmillan: London, 1994, Vol. 2, p. 162. 282. Kamitori, S.; Takusagawa, E J. Mol. Biol. 1992, 225, 445. 283. Kamitori, S.; Takusagawa, E J. Am. Chem. Soc. 1994, 116, 4154. 284. Chen, H.; Liu, X.; Patel, D. J. J. Mol. Biol. 1996, 258, 457. 285. Bailly, C.; Ridge, G.; Graves, D. E.; Waring, M. J. Biochemistry 1994, 33, 8736. 286. Chu, W.; Shinomiya, M.; Kamitori, K. Y.; Kamitori, S.; Carlson, R. G.; Weaver, R. E; Takusagawa, E J. Am. Chem. Soc. 1994, 116, 797 I. 287. Wang, A. H. J. Curr. Opin. Struct. Biol. 1992, 2, 36 I. 288. Waring, M. J. In Molecular Aspects ofAnticancer Drug-DNA Interactions; Neidle, S.; Waring, M. J., Eds.; Macmillan: London, 1993, Vol. l, p. 213. 289. Sugiura, Y.; Shiraki, T.; Konishi, M.; Oki, T. Proc. Natl. Acad. Sci. USA 1993, 87, 383 I. 290. Lee, S. H.; Goldberg, I. H. Biochemistry 1989, 28, 1019. 291. Krivtsora, M. A.; Moroshkina, E. B.; Glibin, E. Mol. Biol. 1984, 18, 950. 292. Wartell, R. M.; Larson, J. E.; Wells, R. D. J. Biol. Chem. 1975, 250, 2698. 293. Patel, D. J.; Kozlowski, S. A.; Rice, J. A.; Broka, C.; Itakura, K. Proc. Natl. Acad. Sci. USA 1981, 78, 7281. 294. Bourdouxhe, C.; Colson, P.; Houssier, C.; H6nichart, J. P.; Waring, M. J.; Denny, W. A.; Bailly, C. Anti-Cancer Drug Des. 1994, 10, 131. 295. Eliadis, A.; Phillips, D. R.; Reiss, J. A.; Skorobogaty, A. J. Chem. Soc., Chem. Commun. 1988, 1049. 296. Shinomiya, M.; Kuroda, R. Tetrahedron Lett. 1992, 33, 2697. 297. Kuroda, R.; Satoh, H.; Shinomiya, M.; Watanabe, T.; Otsuka, O. Nucleic Acids Res. 1995, 23, 1524. 298. Bailly, C.; Pommery, N.; Houssin, R.; H6nichart, J. E J. Pharm. Sci. 1989, 78, 910. 299. Bailly, C.; Helbecque, N.; H6nichart, J. P.; Colson, P.; Houssier, C.; Rao, K. E.; Shea, R. G.; Lown, J. W. J. Mol. Recognit. 1990, 3, 26. 300. Foss6, P.; Ren6, B.; Saucier, J. M.; H6nichart, J. P.; Waring, M. J.; Colson, P.; Houssier, C.; Bailly, C. Biochemistry 1994, 33, 9865. 301. Bailly, C.; OhUigin, C.; Rivalle, C.; Bisagni, E.; H6nichart, J. P.; Waring, M. J. Nucleic Acids Res. 1990, 18, 6283. 302. Bourdouxhe, C.; Colson, P.; Houssier, C.; Sun, J.-S." Montenay-Garestier, T.; H61~ne, C.; Rivalle, C.; Bisagni, E.; Waring, M. J.; H6nichart, J.-P.; Bailly, C. Biochemistry 1992, 31, 12385. 303. Bailly, C." Lecl~re, V." Pommery, N.; Colson, P.; Houssier, C." Rivalle, C.; Bisagni, E.; H6nichart, J. P. Anti-Cancer Drug Des. 1993, 8, 145. 304. Bailly, C.; OhUigin, C.; Houssin, R.; Colson, P.; Houssier, C.; Rivalle, C.; Bisagni, E.; H6nichart, J. P.; Waring, M. J. Mol. Pharmacol. 1992, 41,845. 305. Bailly, C.; Michaux, C.; Colson, P.; Houssier, C.; Sun, J. S.; Garestier, T.; H61~ne, C.; H6nichart, J. P.; Rivalle, C.; Bisagni, E.; Waring, M. J. Biochemistry 1994, 33, 15348. 306. Auclair, C. Arch. Biochem. Biophys. 1987, 258, 1. 307. Auclair, C.; Schwaller, M. A.; Ren6, B.; Banoun, H.; Saucier, J. M.; Larsen, A. K. Anti-Cancer Drug Des. 1988, 3, 133. 308. Mrani, D.; Gosselin, G.; Auclair, C.; Balzarini, J.; De Clercq, E.; Paoletti, C.; Imbach, J. L. Eur. J. Med. Chem. 1991, 26, 481. 309. Subra, F.; Carteau, S.; Pager, J.; Paoletti, J.; Paoletti, C.; Auclair, C.; Mrani, D.; Gosselin, G.; Imbach, J. L. Biochemistry 1991, 30, 1642. 310. Subra, E; Mouscadet, J. E; Lavignon, M.; Roy, C.; Auclair, C. Biochem. Pharmacol. 1993, 45, 93. 311. Goulaouic, H.; Carteau, S.; Subra, E; Mouscadet, J. E; Auclair, C.; Sun, J.-S. Biochemistry 1994, 33, 1412.
Recognition and Modification of Double-Helical DNA
155
312. Ralph, R. K.; Judd, W.; Pommier, Y.; Kohn, K. W. In Molecular Aspects ofAnticancer Drug-DNA Interactions; Neidle, S.; Waring, M. J., Eds.; Macmillan: London, 1994, Vol. 2, p. 1. 313. Wang, J. C. Annu. Rev. Biochem. 1996, 65, 635. 314. Berger, J. M.; Gamblin, S. J.; Harrison, S. C.; Wang, J. C. Nature 1996, 379, 225. 315. Roca, J.; Wang, J. C. Cell 1992, 71,833. 316. Roca, J.; Wang, J. C. Cell 1994, 77, 609. 317. Pommier, Y.; Bertrand, R. In The Causes and Consequences of ChromosomaI Aberrations; Kirsch, I. R., Ed.; CRC: London, 1993, p. 277. 318. Liu, L. F. Annu. Rev. Biochem. 1989, 58, 351. 319. Zunino, E; Capranico, G. Anti-Cancer Drug Des. 1990, 5, 307. 320. Capranico, G.; Zunino, E Curr. Pharm. Des. 1995, 1, 1. 321. Fesen, M.; Pommier, Y. J. Biol. Chem. 1989, 264, 11354. 322. McHugh, M. M.; Woynarowski, J. M.; Sigmund, R. D.; Beerman, T. A. Biochem. Pharmacol. 1989, 38, 2323. 323. Woynarowski, J. M.; McHugh, M.; Sigmund, R. D.; Beerman, T. A. MoI. Pharmacol. 1989, 35, 177. 324. Woynarowski, J. M.; Sigmund, R. D.; Beerman, T. A. Biochemistry 1989, 28, 3850. 325. McHugh, M.; Sigmund, R. D.; Beerman, T. A. Biochem. Pharmacol. 1990, 39, 707. 326. Riou, J. E; Grondard, L.; Naudin, A.; Bailly, C. Biochem. Pharmacol. 1995, 50, 424. 327. Wilson, W. R.; Baguley, B. C.; Wakelin, L. P. G.; Waring, M. J. MoL Pharmacol. 1981, 20, 404. 328. Nelson, E. M.; Tewey, K. M.; Liu, L. E Proc. Natl. Acad. Sci. USA 1984, 81, 1361. 329. Baguley, B. C.; Holdaway, K. M.; Fray, L. M. J. Natl. Cancer Inst. 1990, 82, 398. 330. Zwelling, L. A.; Mitchell, M. J.; Satitpunwaycha, P.; Mayes, J.; Altschuler, E.; Hinds, M.; Baguley, B. Cancer Res. 1992, 52, 209. 331. Bailly, C.; Collyn-d'Hooghe, M.; Lantoine, D.; Fournier, C.; Hecquet, B.; Foss6, P.; Saucier, J. M.; Colson, P.; Houssier, C.; H6nichart, J. P. Biochem. Pharmacol. 1992, 43, 457. 332. Jensen, P. B.; SCrensen, S. B.; Sehested, M.; Demant, E. J. E; Kjeldsen, E.; Friche, E.; Hansen, H. H. Biochem. Pharmacol. 1993, 45, 2025. 333. Chow, K. C.; MacDonald, T. L.; Ross, W. E. Mol. Pharmacol. 1989, 34, 467. 334. Capranico, G.; Palumbo, M.; Tinelli, S.; Mabilia, M.; Pozzan, A.; Zunino, F. J. Mol. Biol. 1994, 235, 1218. 335. Palumbo, M.; Mabilia, M.; Pozzan, A.; Capranico, G.; Tinelli, S.; Zunino, E J. Mol. Recognit. 1994, 7, 227. 336. Ren6, B.; Foss6, P.; Kh61ifa, T.; Jacquemin-Sablon, A.; Bailly, C. Mol. Pharmacol. 1996, 49, 343. 337. Charcosset, J. Y.; Bendirdjian, J. P.; Lantieri, M. E; Jacquemin-Sablon, A. Cancer Res. 1985, 45, 4229. 338. Pommier, Y.; Schwartz, R. E.; Zwelling, L. A.; Kerrigan, D.; Mattern, M. R.; Charcosset, J. Y.; Jacquemin-Sablon,.A.; Kohn, K. W. Cancer Res. 1986, 46, 611. 339. Charcosset, J. Y.; Saucier, J. M.; Jacquemin-Sablon, A. Biochem. Pharmacol. 1988, 37, 2145. 340. Jacquemin-Sablon, A.; Bojanowski, K.; Casabianca-Pign~de, M. R.; Cr6mier, S.; Delaporte, C.; Khelifa, T.; Markovits, J.; Ren6, B.; Saucier, J. M.; Larsen, A. K. Bull. Cancer 1994, 81,381. 341. Gewirtz, D. A. Biochem. Pharmacol. 1991, 42, 2253. 342. Plouvier, B.; Houssin, R.; Hecquet, B.; Colson, P.; Houssier, C.; Waring, M. J.; H6nichart, J. P.; Bailly, C. Bioconjugate Chem. 5, 475. 343. Denny, W. A.; Wakelin, L. P. G. Cancer Res. 1986, 46, 1717. 344. Bailly, C.; Denny, W. A.; Mellor, L.; Wakelin, L. P. G.; Waring, M. J. Biochemistry 1992, 31, 3514. 345. Bourdouxhe-Housiaux, C.; Colson, P.; Houssier, C.; Waring, M. J.; Bailly, C. Biochemistry 1996, 35, 4251. 346. H6nichart, J. P.; Waring, M. J.; Riou, J. E; Denny, W. A.; Bailly, C. Mol. Pharmacol. 1997, 51, 448. 347. McCaunaughie, A. W.; Jenkins, T. C. J. Med. Chem. 1995, 38, 3488.
156
CHRISTIAN BAILLY
348. 349. 350. 351. 352. 353. 354.
Gupta, R.; AI-Said, N. H.; Oreski, B.; Lown, J. W. Anti-Cancer Drug Des. 1996, 11,325. Lown, J. W. Drug Development Res. 1995, 34, 145. Geierstanger, B. H.; Wemmer, D. E. Annu. Rev. Biophyx. Biomol. Struct. 1995, 24, 463. Zunino, E; Animati, E; Capranico, G. Curr. Pharm. Des. 1995, 1, 83. Kahne, D. Chem. Biol. 1995, 2, 7. Remy, J.-S.; Sirlin, C.; Vierling, E; Behr, J.-E Bioconjugate Chem. 1994, 5, 647. Clanton, D. J.; Buckeit, R. W. Jr.; Terpening, S. J.; Kiser, R.; Mongelli, N.; Borgia, N. L.; Schultz, R.; Narayanan, V.; Bader, J. E; Rice, W. G. Antiviral Res. 1995, 27, 335.
NEW DEVELOPMENTS IN THE USE OF NITROGEN MUSTARD ALKYLATING AGENTS AS ANTICANCER DRUGS
William A. Denny
II.
III.
IV.
"Classical" Nitrogen Mustards . . . . . . . . . . . . . . . . . . . . . . . . . 158 A. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 158 B. Sequence Selectivity of D N A Alkylation . . . . . . . . . . . . . . . . . 158 C. Mechanism of D N A Alkylation . . . . . . . . . . . . . . . . . . . . . . 159 D. Limitations of "Classical" Nitrogen Mustards as Anticancer Drugs . . . . 160 DNA-Targeted Mustards . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161 A. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161 B. D N A Intercalating Mustards . . . . . . . . . . . . . . . . . . . . . . . . 162 C. D N A Minor-Groove Binding Mustards . . . . . . . . . . . . . . . . . . 164 Mustards as Effectors in Hypoxia-Activated Prodrugs . . . . . . . . . . . . . 167 A. Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167 B. Advantages of Mustards as Effectors for Hypoxia-Activated Prodrugs . . 167 C. Mustards as Effectors in Hypoxia-Activated Prodrugs . . . . . . . . . . 168 Mustards as Effectors in Prodrugs for Antibody-Directed E n z y m e - P r o d r u g Therapy (ADEPT) . . . . . . . . . . . . . . . . . . . . . . 171 A. Mustard Prodrugs for Carboxypeptidase . . . . . . . . . . . . . . . . . . 172
Advances in DNA Sequence-Specific Agents Volume 3, pages 157-178 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8
157
158
WILLIAM A. DENNY
B. Mustard Prodrugs for 13-Lactamase . . . . . . . . . . . . . . . . . . . . . C. Mustard Prodrugs for Penicillin G Amidase . . . . . . . . . . . . . . . . D. Mustard Prodrugs for 13-Glucuronidase . . . . . . . . . . . . . . . . . . . E. Mustard Prodrugs for NR2 Nitroreductase . . . . . . . . . . . . . . . . . V. Summary and Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
I.
173 173 173 173 174 175
"CLASSICAL" NITROGEN MUSTARDS
A. Introduction Compounds that alkylate DNA have long been of interest for their biological properties. They constitute major classes of both anticancer drugs and carcinogens. While a number of different types of chemical are able to alkylate DNA, historically the most important "simple" alkylating agents functioning as anticancer drugs are the nitrosoureas, platinum complexes, and particularly the nitrogen mustards [N,N-bis(2-chloroethyl)amines]. Nitrogen mustards (mustards) were among the earliest classes of agents used as systemic anticancer drugs. The simplest such compound, mechlorethamine (1), was one of the earliest clinical drugs. Derivatives still used today are the aniline mustards chlorambucil (2) and melphalan (3), and particularly the phosphoramide mustard cyclophosphamide (4), which is a component of many combination chemotherapy regimens. The biologically important initial lesion formed by mustards in cells is interstrand cross-links between different DNA bases, 1 although there is evidence that they also cause termination of transcription. 2 Many excellent reviews exist on the classical mustards, 3'4 and it is not the purpose of the present chapter to cover this in detail. Instead, only points required as background for the later sections are discussed.
B. Sequence Selectivity of DNA Alkylation The major site of DNA alkylation is at the N7 position of guanine, particularly at guanines in contiguous runs of guanines 5 that have the lowest molecular electrostatic potentials. 6 However, the level of selectivity of the initial attack by mustards (to form monoadducts) is quite low, with evidence 7 that most guanines are attacked. Recent studies with compounds 1-3 have also indicated significant levels of alkylation at the N3 position of adenine. 8-1~The sequence selectivity of cross-link formation by mustards is necessarily higher, because of the requirement to have two suitable sites juxtaposed. Early work ~1'12on the interaction of mechlorethamine with DNA isolated the bis-guanine adduct (5), and it was widely assumed that the cross-links formed between adjacent guanines (i.e. at 5'-GC or 5'-CG sites). However, recent work 13 has shown that the preferred cross-links are between nonadjacent guanines (at 5'-GNC sites).
Nitrogen Mustard Alkylating Agents
159
CI
MeN
,___/
R
1 CI Me
o HN~
,,--/
,Ju.., N
H2NJ'eN" -14>
5
CI
N
cO
N
CI 2 : R = (CH2)3COOH 3 : R = CH2CH(NH2)COOH
CI
,---"
N
4
o
bl~N,.1,t
N <~1
NH 2
C. Mechanism of DNA Alkylation The overall process of alkylation is the same for all nitrogen mustards, being a two-step sequence involving formation of a cyclic cationic intermediate, followed by nucleophilic attack on that intermediate by DNA. However, they can be divided into two broad classes depending on the mechanism of the rate-determining step in this process. For the less basic compounds, such as the aromatic mustard chlorambucil, the rate-determining step is considered to be the formation, following first-order kinetics, of the solvated cyclic carbocation (in equilibrium with the aziridinium cation). 3 Nucleophilic attack on this is then rapid so that the cyclic form does not accumulate, and the overall reaction is first-order (SN1) with the rate depending only on the concentration of the mustard. For the more basic compounds (e.g. aliphatic mustards such as 1), the first step (formation of the aziridinium cation) is rapid, and the rate-determining step is a second-order nucleophilic substitution on this by DNA. 3 The aziridinium cation can be detected as an intermediate, and the overall reaction is second-order (SN2) with the rate depending on the concentrations of both the mustard and the DNA. This distinction based on kinetics is idealized, and it is sometimes difficult to classify a compound as one or the other. In particular, there has been much debate about the mechanism of alkylation by aryl mustards, 4'14 and detailed kinetic studies of their reaction with DNA are not available. Recent kinetic studies using a series of aryl nitrogen mustards indicate that both hydrolysis and NBP alkylation reactions might proceed via an SN2 mechanism. 15 However the above classification is useful as a broad predictor of the spectrum of adducts formed. Generally, SNl-type compounds are expected to be less discriminating in their pattern of alkylation (reaction at N, P, and O sites on DNA). In contrast, most SN2 type compounds tend to alkylate only at N sites on the DNA bases. 4 The rates of the various reactions of nitrogen mustards (hydrolysis, alkylation of DNA) correlate closely with the basicity of the nitrogen. This is demonstrated most clearly for the aromatic mustards, where the basicity of the mustard nitrogen can be systematically altered by ring substituents. For example, the rates of hydrolysis (KH) of a series of substituted aromatic nitrogen mustards in aqueous acetone can be described 16 by Eq. 1, where 0 is the Hammett electronic parameter.
160
WILLIAM A. DENNY
log KH = - 1.84 ~ - 4.02
(1)
The negative slope is evidence for an SN1 mechanism, indicating that electronreleasing substituents (negative ~ values) increase the rate of hydrolysis by accelerating formation of the carbocation. While rates of hydrolysis are not necessarily good predictors for how well the compounds alkylate DNA since water is a very high dielectric solvent, the same broad correlations do hold. Thus a very similar Eq. 2 describes the rates of alkylation (K) of 4-(4-nitrobenzyl)pyridine (a nucleophile similar to DNA nucleophilic sites) by substituted aromatic nitrogen mustards, 16 where 6- is an electronic parameter closely related to ~. log K =-1.92 6 - - 1.17
(2)
Because simple mustards exert their cytotoxic effects by alkylating DNA, it is not surprising that the cytotoxicities of the above compounds (1/ICs0 values) also correlate well with substituent ~ values, with the more reactive compounds (bearing electron-donating substituents) being the more cytotoxic (Eq. 3). 17 log (1/ICso) =-2.46 ~ + 0.53
(3)
The cytotoxicity of aromatic mustards is thus predictably varied over a very wide range by controlling the basicity of the mustard nitrogen through ring substitution or other means. This property is of importance in some of the newer uses of nitrogen mustards (see below).
D. Limitations of "Classical" Nitrogen Mustards as Anticancer Drugs The "classical" nitrogen mustards, in particular melphalan (3) and cyclophosphamide (4), are important as components in a variety of multidrug protocols. However, they have a number of drawbacks common to all alkylating agents. Their high chemical reactivity and low (reversible) binding affinity for DNA leads to rapid loss of drug by interaction with other cellular nucleophiles, particularly proteins and low molecular weight thiols. One consequence is that cells can develop resistance to such reactive electrophiles by increasing the levels of low molecular weight thiols (particularly glutathione). 18'19Another is that a significant amount of the drug may reach the DNA with only one arm of the mustard intact, leading to monoalkylation events that are considered to be genotoxic rather than cytotoxic. 2~ For the classical mustards, the frequency of monoadducts to cross-links is high (up to 20:1).2~ This is due partly to the problem referred to above, but also because cross-linking is a two-step process, with the second step very dependent on spatial availability of the second nucleophilic DNA site. If this is not present, hydrolysis of the second arm of a DNA-attached mustard can occur, adding to the proportion of (genotoxic) monoalkylation events. Another important limitation of the classical mustards is that they have no intrinsic biochemical or pharmacological selectivity for cancer cells, and act as
Nitrogen Mustard Alkylating Agents
161
classical antiproliferative drugs, whose therapeutic effects are primarily cytokinetic. They target rapidly dividing cells rather than cancer cells. This, together with their generally systemic distribution, causes killing of rapidly dividing normal cell populations in the bone marrow and gut, resulting in dose-limiting side effects. A great many past efforts to target mustards selectively to cancer cells in some way, by attaching them to carriers such as sugars, proteins, steroids, lipids, and other modifiers, have been essentially unsuccessful. 4 However, in recent years three new approaches to providing more cancer cell specific targeting of mustards have collectively resulted in renewed research interest in this class of compounds.
II.
DNA-TARGETED
MUSTARDS
A. Introduction Many of the limitations noted above for the classical mustards as anticancer drugs could (in principle) be ameliorated by attaching them to a DNA affinic carrier molecule, resulting in specific targeting to the DNA via reversible binding. 21-23 Such direction to the site of action would mean less chance of losing active drug by reaction with other cell components, thus rendering less effective the development of cellular resistance by elevation of thiol levels. Furthermore, if a higher proportion of bifunctional alkylating agent is delivered to the DNA and presented in an appropriate conformation by the DNA affinic carrier, a higher proportion of (cytotoxic) cross-links with respect to (genotoxic) monoalkylation events are theoretically possible. Finally, the use of a DNA affinic carrier offers the ability (in principle) to generate the alkylated lesions in a more directed manner, both sequence specifically (at the favored reversible binding site of the carrier) and regiospecifically (at particular atoms on the DNA bases). In pursuit of this improved control, and to some extent stimulated by the discovery of very potent DNA-targeted alkylating agents of different chemistry such as CC-1065 (6) 24 and doxorubicin cyanomorpholide (7), 25 much work has recently been carried out on the development of DNA-targeted mustards.
o
6
7 ~-..~,
o~i~
~N OH
162
WILLIAM A. DENNY
B. DNA Intercalating Mustards The vast majority of this work has used 9-alkylaminoacridines as the DNA intercalating carrier. Creech et al. 26'27 originally suggested that the attachment of mustard alkylating agents to an acridine carrier might serve to target the reactive center to DNA. They showed that these compounds were more potent than the corresponding untargeted mustards against ascitic tumors in vivo. They suggested this was due to the high affinity of the chromophores for DNA, so that even the monofunctional mustards acted essentially as bifunctional agents. A later analysis of the results 28 supported this view in that changes in the chromophore that increase DNA binding resulted also in enhanced potency. Mustards of tertiary amines in this series (e.g. 8) showed high antitumor activity, but mustards of secondary amines proved to be exceptionally potent frameshift mutagens in bacteria. Compounds such as 9 (ICR 191) are widely used as experimental mutagens 29 to the extent that the possible utility of this class of compounds as anticancer drugs became overshadowed. Similarly, the intrinsic cytotoxicities of aniline mustards can also be drastically increased (up to 100-fold) by targeting via a 9-aminoacridine carrier. 22'28 For a series of aniline mustards of varying reactivity (controlled by varying the electronic nature of the link group), DNA targeting decreased the usual tight dependence of cytotoxicity on mustard reactivity. In the series studied, the untargeted aniline mustards showed a variation in cytotoxicity of about 50-fold between the most (10) and least (11) reactive compounds, while for the corresponding targeted mustards (12 and 13) the variation was less than threefold. 22 Most of the DNA-targeted mustards showed in vivo antitumor activity, being both more dose-potent and more active than chlorambucil. A study where the mustard linking group was kept fixed (i.e. the reactivity of the mustard was unchanged) but the length of the linker chain was altered showed that chain length variation did appear to position the alkylating moiety differently with respect to the DNA, since cross-linking ability was maximal with the C4 analogue in each series. 3~ Within each active series, the most active compound was the C4 homologue, suggesting some relationship between activity and the extent of DNA alkylation. DNA targeting did appear to allow the use of less reactive mustards, since the S-linked acridine mustards showed significant activity whereas the parent S-mustard did not. 3~ A series of anthraquinone-linked alkyl mustards (e.g. 14) were also shown to be more cytotoxic than the corresponding untargeted mustards. 31'32 In addition to increasing cytotoxicity, such targeting can also dramatically modify the sequence specificity of DNA alkylation by the mustard. Untargeted mustards n
~
H.N~NI
~ OMe
CI
Nitrogen Mustard Alkylating Agents
163
,__1CI MeX-~,-- N ,--,,
o
CI o.
CI NH(CH~-- X - @ -
[~~
Nr /
NH(CH~-X-~--N'
CI
CI
17" X = CH2, n = 2 18" X =O, n=5
H.N~N~cI c I ~ O M e 15
14
Et
~--..-\ ~
12"X=O,n=5 13" X- SO2, n = 5 16" X = O, n=2
o o .
H . N ~ N ~
O
M
e
~CI let
19
react largely at the N7 of guanines in runs of guaniues, but quinacrine mustard (15) 5 also alkylates at guanines in 5'-GT sites. DNA targeting also affected alkylation specificity. In the acridine-linked aniline mustard series, a dramatic switch from alkylation at 5'-GT sites to the complementary 5'-AC sites was seen as the separation between the chromophore and the mustard was lengthened (e.g. from 16; n = 2 to 12; n = 5). 7 This was interpreted as a change from alkylation at N7 of guanine to N7 of adenine. 7 However, isolation and identification of the adducts formed by the closely related monofunctional mustards 17 and 18 showed that, while the principal reaction (80%) with the shorter chain analogue 17 was indeed at the N7 of guanine, the longer chain analogue 18 reacted almost entirely (>90%) at the N1 of adenine, together with much smaller amounts of adenine N3 (ca. 5%) and guanine N7 (<5 %) products. 33 The unprecedented preferential alkylation by 18 at the adenine N 1 site, which is normally involved in Watson-Crick hydrogen bonding in double-stranded DNA, shows the extent to which DNA targeting by attachment to carrier molecules can alter the usual pattern of DNA alkylation by mustards. The selectivity in the case of 18 was suggested to result from a preference for the acridine mustard side chain of the compound to project into the major groove following intercalation of the acridine, coupled with structural distortion of the DNA helix to make the N1 positions of adenines adjacent to the intercalation sites more accessible. 33 Other effects of DNA targeting by intercalating carriers have also been observed. Compounds such as 12 alkylate DNA more rapidly than the corresponding untargeted compounds, 22'3~ and possess quite different mutagenic properties. 29'34A different variation in sequence selectivity of DNA alkylation with chain length was noted 35 for a series of acridine-linked aliphatic mustards. Longer chain variants (e.g. 19)
164
WILLIAM A. DENNY
alkylated mainly at 5'-GT sequences, whereas shorter chain analogues did not show such selectivity.
C. DNA Minor-Groove Binding Mustards Introduction Compared to DNA intercalators, which have limited base sequence selectivity (2-3 base pairs) because of their small binding site, size, and poorly defined orientation in these binding sites, DNA minor-groove binding ligands offer larger binding site sizes (up to 5-6 base pairs) and a highly defined binding orientation. Both of these factors suggest that DNA minor-groove binders would be more suitable carriers than intercalating agents, in terms of specific delivery of alkylating functionality. The discovery 24 of the extraordinarily potent anticancer agent CC-1065 (6) has also stimulated interest in DNA minor-groove alkylating agents. This compound, which binds reversibly in the minor groove of DNA with minimal structural distortion and subsequently alkylates specifically at the N3 position of adenine, is important in the present context for two reasons. First, its extraordinary potency (IC50-0.03 nM against L1210 murine leukemia cells), 24 and its high antitumor activity (analogues are now in clinical evaluation as anticancer drugs) 36'37 show that the general concept of targeting alkylating functionality to the DNA minor groove has validity. Second, the potent cytotoxicity of these compounds result from the formation of monoadducts only. This may be due to the extensive reversible binding interactions of the rest of the molecule in the minor groove, effectively preventing DNA strand separation even though no interstrand cross-link is present. Although a review of the extensive literature on the CC- 1065 family of compounds is not within the scope of this chapter, the increased interest in the targeting of mustards by DNA minor-groove binders owes much to this work. Several distinct classes of DNA minor-groove binders are known, and most have now been explored to some extent as carriers for mustards.
Polypyrrole/Polyimidazole Carriers Most work has been done using analogues of the polypyrrole minor-groove binding ligand distamycin as carriers. These compounds have been well-documented as AT-specific minor groove binders by a number of techniques. 38'39 Early work using a variety of alkylating units (e.g. bromoacetyl) showed highly specific alkylation at adenines in runs of adenines, 4~ and potent cytotoxicity. 41 From this work the benzoic acid mustard derivative tallimustine (20; FCE 24517) was selected for further development on the basis of its broad-spectrum solid tumor activity, 42 and is currently in Phase II clinical trial. 43 It has been shown to alkylate at N3 of adenine in the minor groove, 44 almost exclusively at the sequence "ITI'I'GA. 43 While 20 bears a bifunctional (although relatively unreactive) alkylat-
Nitrogen MustardAlkylating Agents
165
CI
NH .~NH2
Ih
o N '
O
Me H'
O
~
/""
r'~\
~.jN.M e
~N - Me
O "N
X
o
~--J CI ~N N 21"R=(CH2)2CI, X=CONH Me H' 22" R = Et, X = CONH 23" R : (CH2)2CI, X = (CH2)3CONH
Me
NMe H
O N
N N i~I
/"
__J
2""
ing moiety capable of producing interstrand cross-links, these lave not been observed in isolated or cellular DNA at therapeutic doses. 44 Related polyimidazole carriers have also been used. The bifuictional carboxamide mustard 21 is a potent cytotoxin (IC50-0.03 laM against human myeloid leukemia K562 cells), 45 and was also shown to monoalkylate at the N3 of adenine in the minor groove. 46 In contrast, the corresponding monofunctional mustard analogue 22 is much less cytotoxic (IC50 > 100 laM against K562 cells), 47 and shows considerably altered sequence selectivity of alkylation. A series of related compounds (e.g. 23), where the mustard is linked to the polypyrrole carrier by polymethylene chains of varying length connecting the minor-groove binding polypyrrole moiety to the mustard, have been reported. 46These compounds alkylatr primarily at the N7 of guanine in the major groove, and while they show high cross-linking efficiency they have decreased cytotoxicity. It has been proposed that the flexibility of the methylene chain allows intercalation of the mustard aromatic ring and subsequent alkylation by the bischloroethyl group in the major groove. 46
Bisbenzimidazole Carriers The bis-benzimidazoles are another well-described series of synthetic minor groove binding ligands. Thus 24 (pibenzimol, Hoechst 33258) has been widely studied for its sequence-specific interaction with DNA, 48-5~and has also undergone Phase I clinical evaluation as an anticancer agent. 51 We have recently reported 52the synthesis and biological evaluation of a series of minor-groove binding difunctional aniline mustards (e.g. 25) based on 24. These compounds, in common with the polyimidazole derivatives such as 23 mentioned above, also have a variable length polymethylene chain linking the mustard moiety and the bis-benzimidazole carrier. All of these compounds are efficient DNA interstrand cross-linkers. Some are
166
WILLIAM A. DENNY
N IT--;{ 'N~-'/'B F~N . ~ N>--'<'.~"NH ' H MeN'v"J 24:R= ~ O H CI r_/ 25 R9= - - - ~ ~
N
\ CI
potent cytotoxins in cell culture (e.g. 25 has an IC50 of 0.01 IxM against P388 murine leukemia cells) and are active in vivo as antileukemic agents. 52
Anilinoquinoline Carriers The bisquaternary ammonium heterocycles are another class of AT-specific DNA minor-groove binding ligands which are active as anticancer drugs in their own right. 53 The parent compound of the series (26) has been shown by NMR 54'55 and X-ray crystallography 56 to bind preferentially in the minor groove of AT-rich oligodeoxynucleotides by the formation of specific hydrogen bonds. Mustards linked to this chromophore (e.g. 27) react with DNA sites in the minor groove, 57 and were active against P388 leukemia in vivo but not particularly dose-potent. 58
PolybenzamideCarriers The terephthalanilides, 59 and related bisquaternary salts, 6~also developed originally as anticancer drugs, have been shown to be minor-groove binding ligands. 61 A series of mustard analogues (e.g. 28) based on a related polybenzamide carrier has recently been reported, and shown to alkylate at adenine N3 s ites . 62'63 These H! N
O
H.N
@
H 26
H.
N ~ N ~ / C I
Me
I Me
N' O ~ N CIM~~N ~~=~-- N ~ 'H
Me
28
H
Et 'N
CI
-k--c,
-O "--~_.N/Me "Me
Nitrogen Mustard Alkylating Agents
167
compounds, some of which are very potent cytotoxins, are notable for their use of two separate monofunctional mustards, both of which appear necessary for maximum cytotoxicity.
III.
MUSTARDS AS EFFECTORS IN HYPOXIA-ACTIVATED PRODRUGS A. Introduction
Another way in which to improve the therapeutic effects of mustards is to mask their cytotoxicity by the formation of prodrug forms which will be selectively activated in tumor cells. As noted above, previous attempts to improve the therapeutic effects of mustards in various ways, including prodrug approaches, have not been very successful. 4 However, there has recently been a renewed interest in prodrugs which can be activated selectively in tumors by various mechanisms. 64 One such mechanism is oxygen-inhibited bioreduction, because of the existence of hypoxic (oxygen-deficient) cells in human solid tumors. 65'66 This phenomenon occurs because of the inefficiency of the neoplastic vasculature. 65'67 In addition, spasmodic shutdown of tumor blood vessels (possibly due to compression by the growing tumor known as "perfusion hypoxia ''67) has also been demonstrated in animal tumors. 68 The hypoxic microenvironment is an attractive target, despite the difficulty of delivering drugs to hypoxic cells 69'7~and their relative resistance to many drugs because of their pH 71 and noncycling status. 72 Nearly all normal tissue is well-perfused, and drugs which could be activated only in hypoxic regions offer the possibility of being truly specific for solid tumors. 73 A number of different classes of compounds have been evaluated as hypoxiaactivated prodrugs, and general design criteria for such drugs have been formulated. 74'75The nontoxic precursor molecule requires the ability to diffuse efficiently to the relatively inaccessible hypoxic cells, undergo selective metabolism of some trigger moiety only in the hypoxic environment, and in so doing generate a cytotoxin (effector) with suitable properties. Selective metabolism is normally achieved by using a trigger which undergoes initial reduction by ubiquitous enzymes, to give a transient species that is (at some early point) re-oxidized by molecular oxygen in oxygenated cells. Mammalian cells contain a wide variety of enzymes which can add electrons to substrates of suitable reduction potential. 74
B. Advantages of Mustards as Effectors for Hypoxia-Activated Prodrugs Nitrogen mustards have been proposed 75'76 as the most suitable effectors for hypoxia-activated prodrugs for several reasons. They are typically small neutral molecules with low levels of reversible binding to cellular macromolecules such as DNA. This ensures their efficient diffusion when activated. 76 The chemistry of
168
WILLIAM A. DENNY
their deactivation (via electron withdrawal from the mustard nitrogen) is well-understood, allowing the possible use of a number of different trigger units. In order to achieve hypoxia-selective killing, it is necessary that the ultimate metabolites (beyond the oxygen-reversible stage) be highly cytotoxic (much more cytotoxic than the reactive oxygen species which will be produced in normally oxygenated cells as the result of oxygen scavenging). Simple mustards are sufficiently potent, and this potency can be greatly increased by DNA targeting (see Section II). Because of the heterogeneous microenvironments in solid tumors, the released cytotoxin needs to have high cytotoxic potency against all major tumor cell subpopulations (cycling and noncycling cells, oxic and hypoxic cells, and cells at low and high pH). Mustards are less sensitive to tumor cell environment than most other types of anticancer drugs. 76 Aliphatic (and reactive aromatic) mustards have half-lives under physiological conditions of ca. 5-60 min. This is sufficiently long to permit them to back-diffuse from the hypoxic cells where they are generated to kill surrounding cells which may be too well oxygenated for activation to occur, but not so long that the activated form is likely to be released back into the general circulation. 76 The very reactive species (radicals, nitrenium, or carbonium ions) released by some prodrugs have very short half-lives, thus restricting their effects to the cells in vhich they are generated, and failing to fully exploit the small proportion of hypoxic cells. The half-lives of aromatic mustards in particular can be controlled by the nature of the substituent groups on them. Several classes of mustard-containing compounds have been reported as hypoxia-activated prodrugs, and these are classified below by the type of triggering moiety used.
C. Mustards as Effectors in Hypoxia-Activated Prodrugs Nitro-Deactivated Aromatic Mustards In this concept, 73'77 bioreduction of a nitro group is employed to activate a prepositioned mustard attached at a resonant position on the aromatic ring (see Scheme 1). As noted above, the stability, alkylating reactivity, and cytotoxicity of aromatic nitrogen mustards is determined almost entirely by the electron density on the nitrogen. Reduction of a nitro group to a hydroxylamine or amine results in a very large difference in electron release, as quantified by the change in Hammett electronic parameters between the respective groups (A~ is 1.32 for reduction to hydroxylamine; 1.44 for reduction to amine). Because the first (one-electron) intermediate in this process, the nitro radical anion, can be back-oxidized by molecular oxygen in oxygenated cells, such compounds can undergo hypoxiaselective bioreductive activation (see Scheme 1). This concept was backed up by the evaluation of a series of monosubstituted aniline mustards, where a very large difference in cytotoxicity was seen between the 4-nitro and 4-amino analogues. 17 This work also showed that the simplest such compound, N,N-bis(2-chloroethyl)-
Nitrogen Mustard Alkylating Agents
NO2
l. II N
169
NO2 NO~ O /(31 ,,,~, ,'CONH2 ,,,~V CONH2 H2N_!_ N/-'" II II o x---x, ,ooc/'W c " N /N\ .,,L.. _N~
c,/,5c, c, o\c,
,1
zNxMe 32 Me
4-nitroaniline (29) does have modest but significant hypoxic selectivity, despite a low nitro group reduction potential of about -510 mV, which must result in very slow metabolic reduction even under hypoxic conditions. 17 Derivatives of 29 with higher nitro group reduction potentials, obtained by further electron-withdrawing substituents on the ring, showed increased hypoxic selectivity, with the 2,4-dinitroaniline mustard (30; SN 23862) having a differential of about 60-fold for hypoxic UV4 cells in culture. 78'79 A related compound, the dinitroaziridine (31; CB 1954), is also selectively toxic to both hypoxic V79 and AA8 cells in culture, 8~but much less so than 30 (ca. 3.5-fold in UV4 cells). A likely reason for this is that 30 is a much less efficient substrate than 31 for DT diaphorase (a major aerobic nitroreductase enzyme), thus avoiding significant reduction by oxygen-independent pathways. 79 Some positional isomers of 30 also showed significant hypoxic selectivity. 81 One potential limitation of this concept is that the trigger and effector are attached to a common aromatic system, but have opposing electronic requirements. To achieve sufficiently rapid enzymic reduction of aromatic nitro groups requires reduction potentials above c a . - 4 5 0 mV. 73 This necessitates a very electron-deficient ring, which lowers the absolute potency of the mustard. Some work has been reported in which the two units have been electronically isolated, with communication being "through-space" by way of reduction-induced internal cyclization. The parameters determining the rate of cyclization have been determined, but only model compounds have been reported so far.82'83 The nitroquinoline 32 provides a conceptually similar approach. 84 In this case, it is postulated that the increased basicity of the quinoline nitrogen on bioreduction initiates a base-
CI %N+
~
NO2
Me
CI
" I[ ~ ~
~enzyme I % ~ , , ~
i~/~cl 33
02
NO2
Me
Scheme 1.
cl
NO2
Me~N~CI " +
L,~
|
CI
1
170
W I L L I A M A. D E N N Y
catalyzed rearrangement, ultimately releasing a phosphoramide mustard and resulting in modest hypoxic selectivity.
Mustard Quaternary Salts Another approach using nitroaromatic triggers are the nitrobenzyl mustard quaternary salts (e.g. 33). 85,86Here, re-oxidation of the initially-formed nitro radical anion is considered to compete 87 with fragmentation of the radical at the benzyl position 88 to physically release the clinically used aliphatic mustard mechlorethamine (1) (Scheme 1). The cationic charge on the quaternary salt serves a number of purposes, ensuring a high degree of deactivation of the mustard, excellent water solubility for the compounds and, because it is a such a powerful electron-withdrawing group, raising the reduction potential of the nitro group to -369 mV 89 (into the correct range for efficient cellular reduction). Another possible advantage is that, by analogy with nitrobenzyl halides, 9~the rates of the fragmentation reaction should be controllable over several orders of magnitude by appropriate structural changes. A possible disadvantage with compounds such as 33 is that the quaternary charge limits the rate of cellular uptake. The rate of release of mechlorethamine from 33 inside EMT6 cells has been shown to increase under hypoxic conditions, but the yield of mechlorethamine was very low; nevertheless, the compound shows very high hypoxic selectivity (several thousand-fold) towards EMT6 cells in culture. 89 It is also much more cytotoxic towards EMT6 cells assembled into spheroids than against the same cells in suspension culture under aerobic conditions, indicating that the mechlorethamine generated in the hypoxic core of the spheroids can diffuse to kill surrounding oxygenated cells. 89
Transition Metal Complexes of Mustards Cobalt complexes of mustards have also been reported as hypoxia-activated prodrugs. 91'92 Co(III) complexes are attractive as triggers in that coordination of the mustard nitrogen deactivates by lowering electron density through involvement of the lone pair in forming the (relatively stable) coordinate bond. Evidence suggests 93 that one-electron reduction occurs (through competition between the complex and oxygen for cellular reducing species) selectively in hypoxic cells. This gives Co(II) species where the coordinate bond is enormously labilized (by a factor of about 1012),94 releasing the mustard (Scheme 2). While monodentate mustards do not appear to form Co(II) complexes of sufficient stability for back-oxidation to compete with fragmentation, the bidentate mustard complex (34) showed sig-
[COIIIL6]
enzyme
_~
~
02
[ColIL6] ~ Scheme 2.
[ColI]2*
+6L
Nitrogen MustardAlkylating Agents
171
Me Me Mex....O--C ~ NH~/~''z
MemO
Me
/I
NHJ
Cl H.N/~/ NHJ ~ C I
/
X....c,
a4
35
COOHF.....,,,,...sCOOH
\c
o-..., f .o c
.
Cl
nificant hypoxia-selective cytotoxicity (30-fold) through oxygen-inhibited release of the cytotoxic free mustard (35). 92
Mustard N-Oxides Another potential chemistry for providing hypoxia-activated prodrugs of mustards is by N-oxidation because this significantly decreases the electron density on the nitrogen, lowering pKa by about 5 units. 95 Molecular oxygen is known to inhibit the metabolic reduction of tertiary amine N-oxides, 96'97 and in line with this the N-oxide derivative of mechlorethamine (1), nitromin (36), has been reported to have modest hypoxia selectivity (ca. fourfold) in cell culture due to bioreductive release of the mustard. 98 An aromatic analogue, chlorambucil N-oxide (37), was reported 99'1~176 to show no hypoxic selectivity in cell culture. However, it has recently been shown 1~ that the reason is that 37 is too unstable, and that the earlier studies of its hypoxic selectivity had inadvertently used the rearrangement product 38.
IV. MUSTARDS AS EFFECTORS IN PRODRUGS FOR ANTIBODY-DIRECTED ENZYME-PRODRUG THERAPY
(ADEPT)
Another contemporary approach to improve the targeting of classical antiproliferative cytotoxic drugs to tumor cell populations has been the use of antibody-linked enzymes to activate nontoxic prodrugs. This approach was devised 1~ to combine the specific targeting achieved by immunotoxins 1~176 with the benefits of freely diffusible small molecule cytotoxins. In this concept, an enzyme/antibody conjugate is constructed, using preferably a nonhuman enzyme and an antibody raised against some tumor-specific antigen. This conjugate is first allowed to locate
COOH
172
WILLIAM A. DENNY
H
COOH
COOH
CPG
CI/
40"~OMs
selectively on its antigen-expressing cells, and is followed by a nontoxic prodrug which is activated (extracellularly) specifically by the enzyme to form a toxic species (effector). Further increases in specificity can be achieved if the prodrug is designed to be excluded from cells until activation. The main advantages of this approach are that the activation can be catalytic, with one enzyme molecule capable of activating many prodrug molecule, and that the activated prodrug can diffuse from the site of release, killing surrounding cells which may not be expressing the target antigen. Mustards have been used extensively as the effectors in ADEPT prodrugs, 1~176 largely for the reasons outlined above with respect to hypoxiaactivated prodrugs in combination with a number of different activating enzymes.
A. Mustard Prodrugs for Carboxypeptidase Most work to date has been reported on the mixed glutamate mustard 39 and analogues in conjunction with the enzyme carboxypeptidase G2.107-109 Hydrolysis of the amide bond of 39 by the enzyme generates the carboxylate mustard 40, which is much more cytotoxic because of electron release to the mustard. As before (see above), this can be quantified by the difference in Hammett G parameters for the two groups (Ao is 0.36). Some responses to clinical trials with 39 have been reported. 11~
R-NH o
S
R-NH S O.IT,N~,actamaso HOOC ~-I'" "I
OOOH o
N
H
COOH v CI
N~
R-NH
CI
CI
N/~,,S
COOH
CI
42
L..,I CI
Scheme 3.
Nitrogen Mustard Alkylating Agents 0
173 OH 0
v
N
-NH 2
amidase
.~3
B. Mustard Prodrugs for II-Lactamase This enzyme has been used to release a variety of cytotoxic agents, including nitrogen mustards, l~ from cephalosporin-containing prodrugs, exploiting the principle that these enzymes very selectively hydrolyze the 13-1actam ring. This increases the electron density on the nitrogen, triggering spontaneous fragmentation of the carbamate-containing side chain to release the aminoaniline mustard 42 (Scheme 3). The prodrug 41 showed ca. 100-fold activation using a 13-1actamase/L6 antibody conjugate, and lesser but significant effects in vivo. 111'112
C. Mustard Prodrugs for Penicillin G Amidase This is a less selective amidase, but has been used with various effectors including melphalan (3). 113 In this case the prodrug (43) does not provide electronic deactivation of the mustard, but instead probably inhibits the known II4 active transport of melphalan, resulting in 20-fold lower cytotoxicity, ll3
D. Mustard Prodrugs for ~-Glucuronidase Use has also been made of enzymes such as 13-glucuronidases, which hydrolyze sugar acetals (although human ~-glucuronidases exist, they are at low levels in plasma). 115 The cytotoxicity of 4-hydroxyaniline mustard (45) can be effectively masked by 13-glucuronidation to form the prodrug 44. At first glance this is surprising, because the difference in Hammett values between OH and OR is small (Ao is only 0.10). The large increase in cytotoxicity (>1000-fold) seen 115 on treatment of human hepatoma cells with 44 and E. coli 13-glucuronidase may be due to the small proportion of O-present; the Hammett differential is then 0.55. An approximate 200-fold increase in sensitivity to 44 by antigen-positive cells was shown using a 13-glucuronidase/RH1 antibody conjugate, ll5
E. Mustard Prodrugs for NR2 Nitroreductase Because a much larger degree of electron release can be obtained by reduction of a nitro group to its hydroxylamine or amine reduction products (A(r is 1.12 and 1.44, respectively; see above) than by amide hydrolysis, nitroreductase enzymes
174
WILLIAM A. DENNY COOH
CI
CI glucuronidase H
H 44 O2N~o
CI O
46
~N..~ H
N 45
CI
CI
N/"-'/ NR2 ~ reductas~ 42 X CI
have therefore also been considered for ADEPT. Most work has been done with the aerobic NR2 nitroreductase from E. coli B 116 activating two main classes of prodrugs. One employs 4-nitrophenylcarbamates as a trigger with a number of different effectors. 117 However, the only mustard prodrug reported (46) showed a low degree of activation by NR2; one possible reason may be poor solubility. 117 The second class are 2,4-dinitrophenylcarboxamides (e.g. 30 and 31). While these compounds are also hypoxia-activated prodrugs, undergoing oxygen-inhibited activation by cellular nitroreductases (see above), under aerobic conditions activation by the aerobic NR2 enzyme predominates.118'119 Thus 31) in particular is a good substrate ( k c a t "- 26 s-l), and is 150-fold more toxic to UV4 cells in the presence of the NR2 enzyme. 119 An analogue where the 4-nitro group was replaced with a similarly electron-withdrawing methylsulfonyl group showed much lower selectivity. 12~
V.
SUMMARY AND CONCLUSIONS
Nitrogen mustards were among the earliest drugs to be used for systemic cancer treatment, beginning in the 1940s and still continuing. Over this time an enormous amount of information has become available on their chemistry and their mechanisms of interaction with DNA, and on the spectrum of their biological activities in living systems. Despite all of this information, there have been relatively few clinically useful mustard-based anticancer drugs developed in the last few decades. The usefulness of mustards as cytotoxins has never been in question; the difficulty has always been to deliver them in a tumor cell selective fashion. This review briefly outlines three relatively new ways in which more selective targeting of mustards is being attempted. The work on DNA targeting has already resulted in the development of tallimustine (20) for clinical trial. It seems likely that the work now proceeding, and outlined above, on hypoxia-selective ADEPT and GDEPT (genedirected enzyme-prodrug therapy) prodrugs using mustards as effectors will also result in new mustards for clinical evaluation. Thus their story has not finished, but has instead begun a new and exciting phase.
Nitrogen Mustard Alkylating Agents
175
REFERENCES 1. Hansson, J.; Lewensohn, R.; Ringborg, U.; Nilsson, B. Cancer Res. 1987, 47, 2631. 2. Peiper, R. O.; Futscher, B. W.; Erickson, L. C. Carcinogenesis 1989, 10, 1307. 3. Niculescu-Duvaz, I.; Baracu, I.; Balaban, A. T. In Chemistry of Antitumour Agents; Wilman, D. E. V., Ed.; Blackie: London, 1989, p. 63. 4. Wilman, D. E. V.; Connors; T. A. In Molecular Aspects of Anticancer Drug Action; Neidle, S.; Waring, M. J., Eds.; Macmillan: London, 1983, p. 233. 5. Kohn, K. W.; Hartley, J. A.; Mattes, W. B. Nucleic Acids Res. 1987, 15, 10531. 6. Pullman, A.; Pullman, B. Quart. Rev. Biophys. 1981, 14, 289. 7. Prakash, A. S.; Denny, W. A.; Gourdie, T. A.; Valu, K. K.; Woodgate, P. D.; Wakelin, L. P. G. Biochemistry 1990, 29, 9799. 8. Osborne, M. R.; Wilman, D. E. V.; Lawley, P. D. Chem. Res. Tox. 1995, 8, 316. 9. Osborne, M. R.; Lawley, P. D. Chem.-Biol. Int. 1993, 89, 49. 10. Wang, P.; Bauer, G. B.; Kellogg, G. E.; Abraham, D. J.; Povirk, L. F. Mutagenesis 1994, 9, 133. 11. Brookes, P.; Lawley, P. D. J. Chem. Soc. 1961, 3923. 12. Lawley, P. D." Brookes, P. J. Mol. Biol. 1967, 25, 143. 13. Millard, J. T.; Raucher, S.; Hopkins, P. B. J. Am. Chem. Soc. 1990, 112, 2459. 14. Bardos, T. J.; Datta-Gupta, N.; Hebbom, P.; Triggle, D. J. J. Med. Chem. 1965, 8, 167. 15. O'Connor, C. J.; Denny, W. A.; Fan, J-Y.; Gravatt, G. L.; Grigor, B. A.; McLennan, D. J. J. Chem. Soc., Perkin Trans. 2 1991, 1933. 16. Panthananickal, A.; Hansch, C.; Leo, A.; Quinn, F. R. J. Med. Chem. 1978, 21, 16. 17. Palmer, B. D.; Wilson, W. R.; Pullen, S. M.; Denny, W. A. J. Med. Chem. 1990, 33, 112. 18. Wang, A. L." Tew, K. D. Cancer Treatment Repts. 1985, 69, 677. 19. Suzukake, K.; Vistica, B. P.; Vistica, D. T. Biochem. Pharmacol. 1983, 32, 165. 20. Brendel, M.; Ruhland, A. Mutation Res. 1984, 133, 51. 21. Denny, W. A.Anti-Cancer Drug Des., 1989, 4, 241. 22. Gourdie, T. A.; Valu, K. K.; Gravatt, G. L.; Boritzki, T. J.; Baguley, B. C.; Wilson, W. R.; Woodgate, P. D.; Denny, W. A. J. Med. Chem. 1990, 33, 1177. 23. Mattes, W. B.; Hartley, J. A.; Kohn, K. W. Nucleic Acids Res. 1986, 14, 2971. 24. Hurley, L. H." Lee, C-S.; McGovren, J. P.; Warpehoski, M. A.; Mitchell, M. A.; Kelly, R. C." Aristoff, P. A. Biochemistry 1988, 27, 3886. 25. Scudder, S. A.; Brown, J. M.; Sikic, I. B. J. Natl. Cancer Inst. 1988, 80, 1294. 26. Creech, H. J.; Preston, R. K.; Peck, R. M.; O'Connell, A. S.; Ames, B. N. J. Med. Chem. 1972, 15, 739. 27. Preston, R. K.; Peck, R. M.; Breuninger, E.; Miller, A. J.; Creech, H. J. J. Med. Chem. 1964, 7, 471. 28. Denny, W. A.; Baguley, B. C.; Cain, B. F.; Waring, M. J. Antitumour acridines. In Molecular Aspects of Anticancer Drug Action; Neidle, S.; Waxing, M. J., Eds.; Macmillan: London, 1983, p. I.
29. Ferguson, L. R.; Denny, W. A. Mutat. Res. 1991, 258, 123. 30. Valu, K. K.; Gourdie, T. A.; Gravatt, G. L.; Boritzki, T. J.; Woodgate, P. D.; Baguley, B. C.; Denny, W. A. J. Med. Chem. 1990, 33, 3014. 31. Koyama, M.; Kelly, T. R.; Wanatabe, K. A. J. Med. Chem. 1988, 31,284. 32. Koyama, M.; Takahashi, K.; Chou, T-C.; Darzynkiewicz, Z.; Kapuscinski, J.; Kelly, T. R.; Wanatabe, K. A. J. Med. Chem. 1989, 32, 1594. 33. O'Connor, C. J.; Denny, W. A.; Gamage, R. S. K.; Fan, J-Y. Chem.-Biol. Int. 1992, 85, 1. 34. Ferguson, L. R.; Turner, P. M.; Gourdie, T. A.; Valu, K. K.; Denny, W. A. Mutat. Res. 1989, 215, 213. 35. Kohn, K. W.; Orr, A.; O'Connor, P. M.; Guziec, L. J.; Guziec, F. S. J. Med. Chem. 1994, 37, 67.
176
WILLIAM A. DENNY
36. Fleming, G. E; Ratain, M. J.; O'Brien, S. M.; Schilsky, R. I.; Hoffman, E C.; Richards, J. M.; Vogelzang, M. J.; Kasunic, D. A.; Earhart, R. H. J. Natl. Cancer Inst. 1994, 86, 368. 37. Li, L. H.; DeKoning, T. E; Kelly, R. C.; Krueger, W. C.; McGovren, J. P.; Padbury, G. E.; Petzold, G. L.; Wallace, T. L.; Ouding, R. J.; Prairie, M. D.; Gebhard, I. Cancer Res. 1992, 52, 4904. 38. Kopka, M. L.; Yoon, C.; Goodsell, D.; Pjura, P.; Dickerson, R. E. Proc. Natl. Acad. Sci. USA 1985, 82, 1376. 39. Pelton, J. G.; Wemmer, D. E. J. Am. Chem. Soc. 1990, 112, 1393. 40. Baker, B. E; Dervan, P. B. J. Am. Chem. Soc. 1985, 107, 8266. 41. Krowicki, K.; Balzarini, J.; De Clercq, E.; Newnan, R. A.; Lown, J. W. J. Med. Chem. 1988, 31, 341. 42. Arcamone, E M.; Animati, E; Barbieri, B.; Configliacchi, E.; D'Alessio, R.; Geroni, C.; Giuliani, E C.; Lazzaxi, E.; Menozzi, M.; Mongelli, N.; Penco, S.; Verini, M. A. J. Med. Chem. 1989, 32, 774. 43. Broggini, M.; Coley, H. M.; Mongelli, N.; Pesenti, E.; Wyatt, M. D.; Hartley, J. A.; D'lncalci, M. Nucleic Acids Res. 1995, 23, 81. 44. Broggini, M.; Erba, E.; Ponti, M.; Ballinaxi, D.; Geroni, C.; Spreafico, F.; D'Incalci, M. Cancer Res. 1991, 51, 199. 45. Lee, M.; Rhodes, A. L.; Wyatt, M. D.; D'Incalci, M.; Forrow, S.; Hartley, J. A. J. Med. Chem. 1993, 36, 863. 46. Lee, M.; Rhodes, A. L.; Wyatt, M. D.; Forrow, S.; Hartley, J. A. Anti-Cancer Drug Des. 1992, 8, 173. 47. Hartley, J. A.; Wyatt, M. D.; Garbiras, B. J.; Richter, C.; Lee, M. Biorg. Med. Chem. Lett. 1994, 4,2412. 48. Pjura, P. E.; Grzeskowiak, K.; Dickerson, R. E. J. MoL Biol. 1987, 197, 257. 49. Teng, M.; Usman, N.; Frederick, C. A.; Wang, A. H-J. Nucleic Acids Res. 1988, 16, 2671. 50. Carrondo, M.; Coll, M.; Ayami, J.; Wang, A. H-J.; van der Marel, G. A.; van Boom, J. H.; Rich, A. Biochemistry 1989, 28, 7849. 51. Patel, S. K.; Kvols, L. K.; Rubin, J.; O'Connell, M. J.; Edmonson, J. H.; Ames, M. M.; Kovach, J. S. Invest. New Drugs 1991, 9, 53. 52. Gravatt, G. L.; Baguley, B. C.; Wilson, W. R.; Denny, W. A. J. Med. Che~ 1994, 37, 4338. 53. Denny, W. A.; Atwell, G. J.; Baguley, B. C.; Cain, B. E J. Med. Chem. 1979, 22, 134. 54. Leupin, W.; Chazin, W. J.; Hyberts, S.; Denny, W. A.; Stewart, G. M.; Wuthrich, K. Biochemistry 1986, 25, 5902. 55. Chen, S. M.; Leupin, W.; Rance, M.; Chazin, W. J. Biochemistry 1992, 31, 4406. 56. Gao, Y-G.; Siriram, M.; Denny, W. A.; Wang, H-J. Biochemistry 1993, 32, 9639. 57. O'Connor, C. J.; Denny, W. A.; Fan, J-Y. Chem-Biol. Int. 1991, 77, 223. 58. Gravatt, G. L.; Baguley, B. C.; Wilson, W. R.; Denny, W. A. J. Med. Chem. 1991, 34, 1552. 59. Oettgen, H. E; Clifford, P.; Burchenal, J. H. Cancer Treatment Repts. 1953, 27, 45. 60. Cain, B. E; Atwell, G. J.; Seelye, R. N. J. Med. Chem. 1969, 12, 199. 61. Braithwaite, A. W.; Baguley, B. C. Biochemistry 1980, 19, 1101. 62. Prakash, A. S.; Valu, K. K.; Wakelin, L. P. G.; Woodgate, P. D.; Denny, W. A. Anti-Cancer Drug Des., 1991, 6, 195. 63. Atwell, G. J.; ~/'aghi, B. M.; Turner, P. R.; Boyd, M.; O'Connor, C. J." Ferguson, L. R.; Baguley, B. C.; Denny, W. A. Bioorg. Med. Chem. 1995, 6, 679. 64. Denny, W. A. Curr. Pharmaceut. Des. 1996, 2, 281. 65. Vaupel, P.; Kallinowski, E; Okunieff, P. Cancer Res. 1989, 49, 6449. 66. Urtasun, R. C.; Chapman, J. D.; Raleigh, J. A.; Franko, A. J.; Koch, C. J. Int. J. Radiat. Oncol. Biol. Phys. 1986, 12, 1263. 67. Coleman, C. N. J. Natl. Cancer Inst. 1988, 80, 310. 68. Chaplin, D. J.; Olive, P. L.; Durand, R. E. Cancer Res. 1987, 47, 597. 69. Jain, R. K. J. Natl. Cancer Inst. 1989, 81,570.
Nitrogen Mustard Alkylating Agents 70. 71. 72. 73. 74. 75. 76. 77. 78. 79. 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100. 101. 102. 103. 104. 105. 106. 107. 108.
177
Durand, R. E. J. Natl. Cancer Inst. 1989, 81,146. Tannock, I. F.; Rotin, D. Cancer Res. 1989, 49, 4373. Tannock, I. E Br. J. Cancer 1968, 22, 258. Denny, W. A.; Wilson, W. R. J. Med. Chem. 1986, 29, 879. Wilson, W. R. In Cancer Biology and Medicine; Waring, M. J.; Ponder, B. A. J., Eds.; Kluwer Academic: Lancaster, 1992, Vol. 3,p. 87. Denny, W. A.; Wilson, W. R.; Hay, M. P. Br. J. Cancer, 1996, 74 (Suppl. XXVII), 32. Denny, W. A.; Wilson, W. R. Cancer. Met. Rev. 1993, 12, 135. Alston, T. A.; Porter, D. J. T.; Bright, H. J. Acc. Chem. Res. 1983, 16, 418. Palmer, B. D.; Wilson, W. R.; Cliffe, S.; Denny, W. A. J. Med. Chem. 1992, 35, 3214. Palmer, B. D.; Wilson, W. R.; Atwell, G. J.; Schultz, D.; Xu, X. Z.; Denny, W. A. J. Med. Chem. 1994, 217, 537. Stratford, I. J.; Williamson, C.; Hoe, S.; Adams, G. E. Radiation Res. 1981, 88, 502. Palmer, B. D.; Wilson, W. R.; Anderson, R. E; Boyd, M.; Denny, W. A. J. Med. Chem. 1996, 39, 2518. Atwell, G. J.; Sykes, B. M.; O'Connor, C. J.; Denny, W. A. J. Med. Chem. 1994, 37, 371. Sykes, B. M.; Atwell, G. J.; Denny, W. A.; McLennan, D. J.; O'Connor, C. J. J. Chem. Soc. Perkin, Trans. 2 1995, 337. Firestone, A.; Mulcahy, R. T.; Borch, R. F. J. Med. Chem. 1991, 34, 2933. Tercel, M.; Wilson, W. R.; Denny, W. A. J. Med. Chem. 1993, 36, 2578. Tercel, M.; Wilson, W. R.; Anderson, R. F.; Denny, W. A. J. Med. Chem. 1996, 39, 1084. Stock, L. M.; Wasielewski, M. R. J. Am. Chem. Soc. 1975, 97, 5620. Moreno, S. N. J.; Schreiber, J.; Mason, R. P. J. Biol. Chem. 1986, 261, 7811. Denny, W. A.; Wilson, W. R.; Tercel, M.; Van Zijl, P.; Pullen, S. M. Int. J. Radiat. Biol. Oncol. Phys. 1994, 29, 317. Norris, R. K.; Barker, S. D.; Neta, P. J. Am. Chem. Soc. 1984, 106, 3140. Ware, D. C.; Wilson, W. R.; Denny, W. A.; Rickard, C. E. E J. Chem. Soc. Chem. Comm. 1991, 1171. Ware, D. C.; Palmer, B. D.; Wilson, W. R.; Denny, W. A. J. Med. Chem. 1993, 36, 1839. Anderson, R. F.; Denny, W. A.; Ware, D. C.; Wilson, W. R. Br. J. Cancer 1996, 74 (Suppl. XXVII), 48. Atwood, J. D. In Inorganic and Organometallic Reaction Mechanisms; Brooks/Cole: Monterey, CA, 1985, p. 87. Perrin, D. D. Dissociation Constants of Organic Bases in Aqueous Solution; Butterworths: London, 1965, (Supplement 1972). Wilson, W. R.; van Zijl, P.; Denny, W. A. Int. J. Radiat. Oncol. Biol. Phys. 1992, 22, 693. Patterson, L. H. CancerMet. Rev. 1993, 12, 119. White, I. N. H.; Suzanger, M.; Mattocks, A. R.; Bailey, E.; Farmer, P. B.; Connors, T. A. Carcinogenesis 1991, 10, 2113. Mann, J.; Shervington, L. A. J. Chem. Soc., Perkin Trans. 1 1991, 2961. Kirkpatrick, D. L.; Schroeder, H. L.; Chandler, K. J. Anti-Cancer Drugs 1994, 5, 467. Tercel, M.; Wilson, W. R.; Denny, W. A. J. Med. Chem. 1995, 38, 1247. Bagshawe, K. D. Anal. Proc. 1990, 27, 5. Pastan, I.; Chaudhary, V.; FitzGerald, D. J. Annu. Rev. Biochem. 1992, 61, 331. Pietersz, G. A.; Krauer, K. J. Drug Targeting 1994, 2, 183. Melton, R. G.; Sherwood, R. F. J. Natl. Cancer Inst. 1996, 88, 153. Hay, M. P.; Denny, W. A. Drugs of the Future 1996, 21, 917. Springer, C. J.; Bagshawe, K. D.; Searle, E; Bisset, G. M. E; Jarman, M. J. Med. Chem. 1990, 33, 677. Dowell, R. I.; Springer, C. J.; Davies, D. H.; Hadley, E. M.; Burke, P. J.; Boyle, E T.; Melton, R. G.; Connors, T. A.; Blakey, D. C.; Mauger, A. B. J. Med. Chem. 1996, 39, 1100.
178
WILLIAM A. DENNY
109. Springer, C. J.; Niculescu-Duvaz, I. Anti-Cancer Drug Des. 1995, I0, 361. 110. Bagshawe, K. D.; Sharma, S. K.; Springer, C. J.; Rogers, G. T. Annals Oncol. 1994, 5, 879. 111. Vrudhula, V. M.; Svensson, H. P.; Kennedy, K. A.; Senter, P. D.; Wallace, P. M. Bioconj. Chem. 1993, 4, 334. 112. Alexander, R. P.; Beeley, N. R. A.; Driscoll, M.; ONeill, E P.; Millican, T. A.; Pratt, A. J.; Willenbrock, E W. Tetrahedron Lett. 1991, 32, 3269. 113. Vivekananda, M. V.; Senter, P. D.; Fischer, K. J.; Wallace, P. M. J. Med. Chem. 1993, 36, 919. 114. Smyth, M. J.; Pietersz, G. A.; McKenzie, I. F. C. Cancer Res. 1987, 47, 62. 115. Wang, S-M.; Chern, J-W.; Yeh, M-Y.; Ng, J. C.; Tung, E.; Roffler, S. R. Cancer Res. 1992, 52, 4484. 116. Michael, N. P.; Brehm, J. K.; Anlezark, G. M.; Minton, N. P. FEMS Microbiol. Lett. 1994, 124, 195. 117. Mauger, A. B.; Burke, P. J.; Somani, H. H.; Friedlos, E; Knox, R. J. J. Med. Chem. 1994, 37, 3452. 118. Knox, R. J.; Friedlos, F.; Sherwood, R. E; Melton, R. G.; Anlezark, G. M. Biochem. Pharmacol. 1992, 44, 2297. 119. Anlezark, G. M.; Melton, R. G.; Sherwood, R. F.; Knox, R. J.; Friedlos, E; Wilson, W. R.; Denny, W. A.; Palmer, B. D. Biochem. Pharmacol. 1995, 50, 609. 120. Atwell, G. J.; Boyd, M.; Palmer, B. D.; Anderson, R. E; Pullen, S. M.; Wilson, W. R.; Denny, W. A. Anti-Cancer Drug Des. 1996, 11,553.
DNA BINDING OF NONCLASSICAL PLATI N U M ANTITU MOR COMPLEXES
Nicholas Farrell
I. II.
III.
IV.
V.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 180 DNA Binding of cis-DDP . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181 A. Intrastrand Cross-links from cis-DDP . . . . . . . . . . . . . . . . . . . 181 B. Interstrand Cross-links from cis-DDP . . . . . . . . . . . . . . . . . . . 182 C. Monofunctional Binding of Platinum-Amine Complexes . . . . . . . . . 182 D. Protein Recognition of c i s - D D P - D N A Adducts . . . . . . . . . . . . . . 182 D N A Binding of Structural Analogues of cis-DDP . . . . . . . . . . . . . . . 183 A. Effects of Leaving Groups . . . . . . . . . . . . . . . . . . . . . . . . . 183 B. Effects of Carrier Ligands . . . . . . . . . . . . . . . . . . . . . . . . . 184 Dinuclear Platinum Complexes . . . . . . . . . . . . . . . . . . . . . . . . . 185 A. Biological Effects of Dinuclear Platinum Complexes . . . . . . . . . . . 186 B. DNA Interactions of Dinuclear Platinum Complexes . . . . . . . . . . . 189 C. Conformational Changes Upon Formation of (Pt,Pt) Interstrand Cross-links . . . . . . . . . . . . . . . . . . . . . . . . . . . 189 D. Conformational Changes of the (Pt,Pt) Intrastrand Cross-link . . . . . . 190 E. Effects of Conformational Changes of Bis(platinum)-DNA Interactions . 190 Novel Antitumor Active trans-Platinum Complexes . . . . . . . . . . . . . . 192 A. DNA Binding of trans-DDP . . . . . . . . . . . . . . . . . . . . . . . . 192
Advances in DNA Sequence-Specific Agents Volume 3, pages 179--199 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8
179
180
NICHOLAS FARRELL
B. Novel trans-Platinum Complexes . . . . . . . . . . . . . . . . . . . . . . C. DNA Strand Breakage is a Consequence of trans-Platinum Damage in Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . D. DNA Binding of trans-Platinum Complexes with Planar Amines . . . . . VI. Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
I.
193 194 194 196 196 197
INTRODUCTION
The coordination complexes cisplatin (cis-[PtCl2(NH3)2), cis-DDP, and carboplatin ([Pt(CBDCA)(NH3)2)]) have by now an established place in cancer chemotherapy regimens. The cellular target of the platinum complexes is accepted to be DNA and the nature of the Pt-DNA interaction is known in considerable detail. 1-5 Inhibition of DNA synthesis, inhibition of transcription, and selective repair have all been measured as consequences of Pt-DNA adduct formation. Upon cisplatin binding to DNA, monofunctional adducts and bifunctional adducts such as d(GG), d(AG), and d(GNG) intrastrand cross-links are formed. DNA-DNA interstrand GG crosslinks and DNA-protein cross-links are produced to a lesser extent. The individual adducts differ in their ability to inhibit specific processes essential for cell growth and division. Design and development of cisplatin analogues stressed the need for the cis-DDP structure, and varied both the nature of the leaving group (chloride) and nonleaving group (amine). These analogues, however, have not shown a greatly altered spectrum of clinical efficacy in comparison to the parent drug. 6-8 With respect to DNA binding, all cis-DDP analogues produce an array of adducts very similar to those of cis-DDP and it is therefore not surprising that they induce similar biological consequences. The relative efficiency of the biological action of analogues in comparison to cisplatin (as indicated by assays measuring cell death or by monitoring DNA replication and transcription) is dependent on the kinetics of adduct formation as well as the specific structure of the Pt-DNA adduct formed. An important question in platinum antitumor research is whether the bifunctional DNA binding of cis-DDP is truly unique in its biological effects. Our research efforts have been driven by the hypothesis that development of platinum compounds structurally dissimilar to cis-DDP may, by virtue of formation of different types of Pt-DNA adducts, lead to compounds with a spectrum of clinical activity complementary to the parent drug. Platinum coordination compounds display a vast potential for systematic variation of DNA binding properties which, coupled with appropriate pharmacokinetic properties, affords the promise for rational drug design and more specific inhibition of critical cellular and biochemical targets. This review will summarize briefly the effects of changing both leaving group and nonleaving group within the cis-DDP structure and will further summarize the DNA
Platinum Antitumor Complexes
181
binding properties of "nonclassical" platinum complexes not containing the cisDDP structure.
!1. D N A B I N D I N G OF cis-DDP The reader is referred to the many excellent reviews for the details of the cis-DDPDNA interaction. 1-5 These lesions result in conformational changes reflected in bending and local unwinding of the DNA. The structural basis for such conformational changes has been elucidated in many cases through study of site-specifically modified oligonucleotides. The cytotoxic effects of cis-DDP should be considered to be due to the combined effects of these lesions, rather than as a result of one specific event, although the structurally distinct adducts differ in their lethality. Underlining the fact that the structurally different adducts produce different cellular responses is the result that the AG adduct is approximately five times more mutagenic than the GG analogue. 9'1~
A. Intrastrand Cross-links from cis-DDP The major DNA adduct produced by cis-DDP is the 1,2-intrastrand cross-link between two adjacent guanines. Both solution (NMR) and solid-state crystal structures of singly platinated dinucleotides 11'12'13and oligonucleotides incorporating the d(GpG) binding site give a detailed picture of the conformational changes accompanying intrastrand cross-link formation. The dihedral angle between the two guanine bases is altered from the native DNA structure, and the sugar pucker of the 5'-nucleotide changes to C3"-endo or N-type. This latter feature is common to all d(GpG) adducts studied. 14The two guanine moieties maintain an anti, anti configuration with respect to the sugars. These structural features result in unstacking of the adjacent bases and kinking of the helix. The resultant unwinding and bending of site-specifically d(GG) platinated oligonucleotides has been measured as 13~ and 32-34 ~ respectively. 3'4'15 Interestingly, a very similar distortion is found for the d(AG) adduct. 15The crystal structure of a site-specifically modified 1,2-intrastrand adduct on d(CCTCTG*G*TCTCC).d(GGAGACCAGAGG), where the G* is the platination site, confirms the bending. 16 In brief, coordination of the cis{Pt(NH3)2 }2+unit bends the duplex toward the major groove without any disruption of Watson-Crick hydrogen bonding. There are large displacements of the metal out of the plane of platinated guanines (1.3 and 0.8 ,~) and the observation of a NH3-phosphate oxygen hydrogen bond. At this resolution the sugar puckers cannot be identified unequivocally but an abrupt change to a duplex form resembling A-DNA, rather than canonical B-DNA, occurs to the 5'-side of the adduct. This "fusion" of A- and B-forms, if maintained in solution, could promulgate the A-form well beyond the lesion site, indicating how proteins may recognize the damaged site. Bending of DNA has further been confirmed by solution 1H NMR spectroscopy studies on a d(CCTG*G*TCC).d(GGACCAGG) octamer. 17
182
NICHOLAS FARRELL
B. Interstrand Cross-links from cis-DDP For cis-DDP, the selective reaction of the various types of Pt-DNA adducts with NaCN may be exploited to isolate interstrand cross-links. 18-2~The 5'-d(GC) crosslink between adjacent guanines has been considered most favored over the alternative d(CG) structure. 21 The distortions caused by the interstrand cross-link is indicated as bending of the DNA by approximately 55 ~ localized at the d(GC/CG) sequence. 22 This adduct has been shown to be a block to RNA polymerase. 17 The bending in a site-specific interstrand cross-link formed between the two indicated guanines of adjacent GC base pairs {5'-d(CATG*C*TATG) 2} have been reported. 23 The platinated guanine residues no longer form hydrogen bonds with their cytosine pairs, which become destacked from the double helix and adopt the syn conformation. The overall result is that the platinum unit lies in the minor rather than major groove and the double helix is locally converted to a left-handed form.
C. Monofunctional Binding of Platinum-Amine Complexes Monofunctional binding to oligonucleotide sequences from one Pt center, as from [PtCl(dien)] § does not require any major changes in sugar pucker since the flexibility of the sugar-phosphate backbone is not restricted. 24 Monofunctional binding, as monitored by NMR 25 and physical and biochemical studies, 26 causes only localized conformational changes without any kinking of the helix. In agreement with this, monofunctional binding does not efficiently inhibit polymerase excision.
D. Protein Recognition of cis-DDP-DNA Adducts The structural changes now known in some detail for cis-DDP manifest their cytotoxic effects by a "downstream" effect upon protein recognition of DNA. This is most easily seen when one considers that the cis-DDP adducts act as blocks to DNA polymerases of various origins. 27-29 More recently the isolation of proteins binding to cis-DDP-damaged DNA has spurred investigation of the role of protein recognition in the mechanism of cis-DDP cytotoxicity, its relevance to cellular resistance to cis-DDP, and repair of cis-DDP-DNA adducts. 3~ The high mobility group (HMG) structural motif is a common feature of the structure specific recognition proteins, which recognize cis-DDP-damaged DNA, but not DNA damaged by trans-DDP or the monofunctional [PtCl(dien)]C1. 32-35The rigid bending induced by cis-DDP, either through the 1,2-intrastrand or interstrand cross-link, is almost certainly the recognition motif for the protein. 36-38The human mismatchrepair protein (hMSH2) also binds specifically to cis-DDP-modified DNA. 39 The high expression of hMSH2 in testis and ovary may suggest the underlying reason for tissue specificity of platinum drug efficacy. How protein recognition affects DNA repair or replication inhibition will reveal further clues as to the detailed molecular mechanism of cytotoxicity of cis-DDP.
183
Platinum Antitumor Complexes
III.
D N A BINDING OF STRUCTURAL ANALOGUES OF cis-DDP A. Effects of Leaving Groups
A large number of novel leaving groups have been employed in attempts to impart a more favorable spectrum of activity and toxicity to the cisplatin structure. Figure 1 shows some cis-[Pt(NH3) 2] analogues with different leaving groups which have entered into preliminary clinical trials. The prototype is the substituted malonate ligand as found in carboplatin. Introduction of carboplatin into the clinic reduced considerably the severe nephrotoxic side effects of the parent cisplatin. The chelated dicarboxylato group is significantly more inert to nucleophilic substitution than chloride. The lack of reactivity of carboplatin is usually attributed to the slow opening of the chelated bidentate dicarboxylate ring. Carboplatin is approximately 50 times less cytotoxic than cisplatin, but equitoxic doses produce similar levels of DNA platination. 4~ Using alkaline elution techniques, the formation of both interstrand and DNA-protein cross-links by carboplatin has been confirmed. 41 Thus, the adducts produced by carboplatin are similar to those of cis-DDP, but the kinetics of formation differ for the two compounds. The rate of reaction of carboplatin with 5'-GMP has been calculated as kobs = 4.1 x 10-6 s-l. 42 This rate is significantly faster than those calculated for ring-opening by water, which vary depending on buffer conditions but are in the range 10-7 to 10-8 S-1. 35'43 Model studies indicate that direct reaction of the carboplatin moiety could occur, followed by a rapid bifunctional closure on DNA through displacement of the monodentate carboxylate group, reflecting the rela-
0
NH3\ / CI /
NH3
m
\
NH3~p~o--c ~/~X2 /
CI
NH3
Cisplatin(CDDP)
\o
c" v -- %
Carboplatin(CBDCA)
NH3~ /O__C~'O NHa/
\O--CH2
254-s
Figure 1. Structuresof cisplatin and analoguescontaining the cis-[Pt(NH3)2] motif.
184
NICHOLAS FARRELL
tively facile displacement of a monodentate carboxylate ligand in comparison to chloride or the chelated dicarboxylate.
B. Effects of Carrier Ligands A number of different chelating diamine ligands have been used within the basic
cis-[PtX2(amine)2 ] structure, as shown in Figure 2. The most widely studied has been that of 1,2-diaminocyclohexane. Very early studies showed that compounds containing this carrier ligand retained cytotoxicity in L1210 cells with acquired resistance to cis-DDP. 44 This observation became a major driving force for the clinical development of compounds in this series. Note that the 1,2-diaminocyclohexane ligand is resolved into geometrical (cis,trans) as well as optical (R,R and S,S for the trans-isomer) isomers. Complexes with geometrically or optically pure ligand do show differences in antitumor activity, depending on the nature of the ligand employed, but significant differences have not been found with respect to DNA binding. 45'46 Currently, oxaliplatin is the principal clinical candidate of this class of compounds-the Pt(IV) derivative tetraplatin has been abandoned due to unpredictable side effects, especially neurotoxicity. Other analogues currently of clinical interest are those of DWA2114R and JM216. The former combines effects of carrier ligand and leaving group with optical isomers possible in the nonleaving 1,4-butanediamine chelate. The compound JM216 is a mixed amine complex developed as an orally active drug.
~NH2
OCOCH3
X,CI j/cJ
H3N~ I /CI Pt
Pt
\Ct ~ ~x/_.N/[ H20COCH3
el CI Ormaplatin(OP)
[~
NH2
JM216
/O--c ~O
Pt
NH/ ~O -C
Oxaliplatin(I-OHP)
l
%
O it---,NH2~Pt/O m C ~
H~'~
~o__C~ '
DWA2114R
Figure 2. Structures of cisplatin analogues of clinical interest containing various nonleaving (carrier) groups other than NH3.
Platinum Antitumor Complexes
185
1,2.Diaminocyciohexane Complexes For 1,2-diaminocyclohexane, the nature of the ligand does not affect greatly the types and frequency of the Pt-DNA adducts formed, with the intrastrand GG and AG sites predominating. 47 Model studies on the [Pt(dach)]-d(GpG) adducts show considerable similarity to that of cis-DDR 48 An interesting study on the effect of the carrier ligand on DNA repair was carried out using site-specifically modified adducts. The adducts differ significantly in their ability to serve as substrates for the UVrABC repair complex with excision being in the order d(GNG) > monofunctional > d(AG) > d(GG). 49 The diamine ligand slowed conversion of monoadduct to diadduct by a factor of 1.8 in comparison to the [Pt(NH3) 2] group.
DWA 2114R The relationship between the total number of platinum atoms binding to DNA and cytotoxicity indicated that DWA2114R was 2-3 times more effective cytotoxin than cis-DDP in HeLa S-3 cells. 5~ In agreement with the presence of the slowly displaced dicarboxylate group, 10 times the dose of DWA2114R is needed to produce the same cytotoxic effect. An in vitro assay showed that DWA 2114R adducts terminated DNA polymerase template activity in a manner similar to that of cis-DDR rendering it likely that the two compounds form a very similar array of adducts. 51 In agreement with this conclusion, CT DNA modified by DWA2114R shows similar conformational changes with a kinetic preference for dG nucleoside binding. 52
An Orally Active Platinum Complex The complex JM216 is currently in clinical trials. 53 A predicted metabolite is the Pt(II) complex, cis-[PtC12(NH3)(cyclohexylamine)]. The major product (54%) of the proposed metabolite with CT DNA is the d(GpG) intrastrand cross-link, with much smaller contributions from interstrand and long-range intrastrand crosslinks. 54 As this complex has two inequivalent amines (NH 3 and C6HllNH2),the adducts were distinguished by the novel finding of orientational isomers with either the 5' or 3' end of the dinucleotide oriented toward the NH 3 group. Replication of site specifically platinated M13 genomes with T7 DNA polymerase showed that the orientational isomers were less efficient than cis-DDP in inhibition of replication. 49
IV. DINUCLEAR PLATINUM COMPLEXES The weight of evidence indicates that all cisplatin analogues eventually produce an array of DNA adducts similar to those formed from cis-DDP. Differences in antitumor activity and toxicity may be dictated by more favorable pharmacokinetics of the analogues, rather than enhanced inhibition of target (DNA) function. Sequence specificity, conformational changes, and interactions with DNA processing
186
NICHOLAS FARRELL
proteins of the analogues appear to be qualitatively similar to the parent drug. Thus, the need arises to study "nonclassical" platinum complexes to examine the effectiveness of adducts structurally different to those of cis-DDP and its congeners. This section summarizes the DNA binding properties so far elucidated for two new classes of platinum drugs---dinuclear complexes containing two Pt-amine units linked by a flexible diamine chain and transplatinum complexes. The results clearly demonstrate that antitumor activity can be obtained with chemical structures distinct from cis-DDP. 55 Likewise, the array of DNA adducts produced by these two distinct series differ significantly from those formed by the cis-[PtX:(amine)2 ] family. Studies on the binding modes of these new clinical candidates allow us to examine how different modes of DNA binding may contribute to a different spectrum of antitumor activity. The following discussions build on recently published reviews. 56-58 A. Biological Effects of Dinuclear Platinum Complexes Dinuclear platinum complexes represent a large class of general formula
[{PtClm(NH3)3_m(H2N-R-NH2)] 2(2-m)+ (m = 0-3 and R is a linear or substituted
Pt
el'
/\
/\
I~
NH2(CH2)~I2N
el
2,2/c,c
o \ /~", Pt
H3N
/\
.,.\ /
-'12+
1~
/\
NH2(CH~)aH2 N
NH;
H3N
/\
/\
Pt
Pt
NH2(CH2)nH2N
NH3
l,l/e~
l,l/t,t
o\/.., Cl
/\
Pl
/\
NH2(CH2)~H2N
1,2/t,c
Pl NH3
CI
/\
Pl
/\
NH2(CH2)nH2N
1,2/c,c
Figure 3. Dinuclear platinum complexes.
Pl NH3
Platinum Antitumor Complexes
187
aliphatic linker). Within this broad scope, bifunctional, trifunctional, and tetrafunctional complexes are all possible (Figure 3). Examples of all types have been synthesized. The high antitumoral activity of dinuclear complexes in both cis-DDPsensitive and -resistant cells 59'6~as well as in human tumor cell lines inherently insensitive to cis-DDP 61 gives this series significant clinical potential. The first complex chosen from this series will enter clinical trials in late 1997 and is based on the 1,1/t,t geometry. The dinuclear platinum complexes demonstrate the first alternative mechanism of action for platinum complexes, with unique modes of DNA binding inaccessible to the mononuclear complexes. 57'58'62'63 The structures of the distinct bis(platinum)-DNA adducts will be described below. The UVrABC repair complex recognizes and excises damage induced by dinuclear platinum complexes. 64'65The efficiency of equivalent numbers of lesions in inhibition of Taq DNA polymerase and inhibition of transcription were measured in human cells using a host-cell r e a c t i v a t i o n assay.66 Inhibition of transcription was essentially equivalent for all dinuclear complexes and similar to that of cis-DDP but much more effective than lesions caused by either trans-DDP or the monofunctional [PtCI(NH3)3]+ (Figure 4). In contrast, inhibition of replication between the 1,1/t,t and 1,1/c,c geometric isomers differed by almost an order of magnitude. The relative repair efficiencies of all dinuclear platinum complexes in normal (NF) and repair-deficient. (XPA) human fibroblasts were less than that of cis-DDP.
II1 cO
r-----I Transcription Replication
7 e-
"~ .9
6 s
l= -9-
~ ~ ,,.
4
i._
.ag.
2
z
1
E
cisDDP
transDDP
triamine (Pt)
bis(Pt) 1,11t, t
bis(Pt) 2,21c,c
L_
bis(Pt) 1,11c,c
Figure 4. A comparison of the number of platinum lesions required to block RNA or DNA synthesis for a series of platinum complexes. The dinuclear complexes are abbreviated as in Figure 3. The extent of platinum-lesion "by-pass" by native RNA polymerase or Taq DNA polymerase was determined for each of the Pt complexes by comparing results from host-cell reactivation and QPCR assays. See Ref. 58 for details.
188
NICHOLAS FARRELL
Cellular studies using alkaline elution techniques in both murine L1210 and human tumor A2780 cells showed that dinuclear platinum complexes form significantly higher numbers of interstrand cross-links in comparison to cis-DDP, and that these persist longer than those of the mononuclear compound. 67'68 An interesting effect of geometric isomerism is also observed with the 1,1/c,c complex, producing significantly more interstrand cross-links than the 1,1/t,t isomer and being the predominant lesion in this case. 69 The interstrand cross-links also persist in cisDDP-resistant cell lines. This point is particularly relevant in view of the observations of gene-specific removal of cis-DDP interstrand cross-links in CHO cells, and the implications that acquired cellular resistance to cis-DDP may be associated with increased DNA repair of the interstrand cross-link. 7~ In summary, the lesions caused by the family of dinuclear compounds are in general as effective as those of cis-DDP, but relative efficiencies vary with the structure of the compound and thus the exact nature of the lesions formed. The lesions, or some thereof, appear also to be responsible for overcoming acquired
(Pt, Pt)lnterstrand Cross-link
(Pt, Pt)Intrastrand Cross-link
2+
2+ CI
H3N
X/ Pt /N
NH3
HaN
X/ Pt /\
NH2(CH2)nH2N
1,1/ t,t
C!
H3N
NH3
H3N
\/ PI /\
CI
CI
\/ Pt /\
NH2(CH2)nH2N
1,1/
NHz
NH3
c,c
Figure 5. Schematic representation of the limiting modes of bifunctional DNA binding of the cis- and trans-isomers of the dinuclear platinum complexes [{PtCI(NH3)2}21~-H2N(CH2)4NH2]2+. In the case of cis-DDP-like coordination spheres (See Figure 3), further reaction of these minimal structures will lead to tri- and tetrafunctional DNA-DNA and DNA-protein cross-links.
Platinum Antitumor Complexes
189
resistance to the parent cis-DDP. What then is the nature of these lesions, their global conformational changes, and how do they compare with those of cis-DDP?
B. DNA Interactions of Dinuclear Platinum Complexes Binding of dinuclear platinum complexes to DNA leads to: (1) DNA (Pt,Pt) interstrand cross-links by binding of one Pt atom to each strand of DNA; (2) (Pt,Pt) intrastrand cross-links by binding of the two Pt atoms to the same strand, as well as (3) DNA-protein cross-links, as shown in Figure 5. In the case of trifunctional and tetrafunctional complexes, further binding sites are possible and indeed a novel ternary complex of a DNA-DNA cross-link with elements of the UVrABC repair system produces unique DNA-protein adducts. 57
C. Conformational Changes Upon Formation of (Pt,Pt) Interstrand Cross-links Interstrand cross-link formation by dinuclear platinum complexes is significantly greater than for cis-DDp.56'72 The cross-linking is also dependent on the geometry around the Pt atom 61 and the length of the diamine chain. 73 cis-DDP, and indeed most alkylating agents, give rise to only 1,2-interstrand cross-links. In contrast, both the length and the flexibility of the diamine chain in dinuclear compounds allows the targeting of much larger DNA sequences for cross-link formation. 74'75 For binding between guanines on opposite strands, in addition to 1,2 cross-links, 1,3 and 1,4 interstrand cross-links are possible. In 1,3 and 1,4 cross-links the guanines are separated by one and two base pairs, respectively, whereas a 1,2 cross-link is formed from guanines on neighboring base pairs. In an interesting study of a 1,2 cross-link produced specifically in the 8-mer 5'-CATGCATG-3' by trans-[ {PtCI(NH3) 2}2kt-NH2(CH2)4NH2] 2+, a novel dumbbell structure is observed. 76 This structure arises from first folding the singlestranded DNA octamer into a mini-hairpin with a three-base pairs stem and a two-base loop. Now, since there are two such mini-hairpins arising from platination on both strands, placing the two hairpins end-over-end produces the dumbbell structure. A possible consequence for cruciform formation in longer oligonucleotides is shown in Figure 6. The formation of such structures may be facilitated by the syn conformation induced in the G sugar upon platination. The syn conformation of a platinated guanine has also been observed in the hairpin structure induced by cis-DDP binding in the palindromic sequence d(ATGGGTACCAT). 77 The induction of the syn conformation in both strands of DNA upon cross-linking by dinuclear platinum complexes may also contribute to the remarkable ease with which these compounds induce the B --> Z transition in poly(dG-dC).poly(dGdC). 65 As few as one 1,1/t,t bis(Pt) lesion per 25 bases is needed for complete conversion to the Z form. The syn conformation is an essential feature of the left-handed helix. 78 The effect of different adduct structures on conformational changes within a similar sequence may be appreciated by the fact that cis-DDP
190
NICHOLAS FARRELL
C'4 GC
1,l/t,t
Figure 6. Formation of a four-way DNA junction through a 1,2-intrastrand (Pt,Pt)cross-link.
stabilizes B-form poly(dG-dC).poly(dG-dC). 79'8~ The m o n o f u n c t i o n a l [PtCl(dien)] § also facilitates the B --> Z DNA transition at low r b but does not, by itself, fully induce the conformational change. 71 A further interesting feature of this B --> Z transition is that it is irreversible upon interstrand cross-linking. 81 The ability to lock the Z-DNA conformation could have important consequences in regulation of transcription, where the relevance of Z-DNA regions has been implicated. 82'83 It is noteworthy that d(CGTA'CG) 2 (A' =2-NHzA) modified by [PtCI(NH3) 3+ maintains the hexanucleotide in a Z-form. 84
D. Conformational Changes of the (Pt, Pt) Intrastrand Cross-link In a dinuclear complex, initial monofunctional binding of one center leads to possible (Pt,Pt) interstrand cross-linking by binding of the second center to the opposite strand or, alternatively, (Pt,Pt) intrastrand cross-linking by binding of the second Pt atom to the same strand, as shown in Figure 5. These preferences may be controlled by the geometry of the bis(platinum) complex as well as by the nature of the ligands coordinated to the platinum. 61 Model studies with the dinucleotide d(GpG) confirmed the formation of (Pt,Pt) 1,2-intrastrand cross-links with the dinuclear [ {trans-PtCl(NH3) 2}2HzN(CHz)6NH212§ 85 The formation of intrastrand cross-links was also observed in double-stranded DNA. 66 Unlike the structure of the cis-DDP adduct, 11'13 the (Pt,Pt) adduct features a syn conformation of the 3' base with the sugar pucker being more N type, although not 100% (c.f. the anti, anti conformation and the 100% N-type pucker of the cis-DDP structure). 86 Importantly, the (Pt,Pt) intrastrand cross-link appears to produce a less rigid adduct than cis-DDP. This is a result not only of the fact that one monofunctional Pt center binds to each of the two guanines, but also the flexibility of the diamine chain. A"stepped" head-to-head structure is proposed. 86
E. Effects of Conformational Changes of Bis(platinum)-DNA Interactions The conformational differences between the (Pt,Pt) intrastrand adduct and the intrastrand d(GpG) cross-link of cis-DDP could have important biological conse-
Platinum Antitumor Complexes
191
quences. The latter is not removed as efficiently as interstrand cross-links in gene-specific repair, 63 and other workers have confirmed that site-defined d(GpG)cis-DDP adducts are refractory to repair in cell extracts. 86 Differential repair of the (Pt,Pt) intrastrand adduct relative to that of cis-DDP could affect, for example, cytotoxicity in cis-DDP-resistant cells, where enhanced DNA repair is implicated in the mechanism of resistance. 87 The global conformational changes of importance to protein recognition of DNA are unwinding and bending. For the formally bifunctional platinum complexes [{ PtCI(NH3)2}zla-(HzN(CHz)4NH2)] 2+ the unwinding caused in supercoiled DNA is similar to that of cis-DDE We would not expect unwinding, therefore, to be the cause of any differential biological effects between dinuclear complexes and cis-DDE The bending of site-specifically modified oligonucleotides is not as
I cis-DDP 1 +
F]
I
~
......
~.':.T : :
/ ......
Figure 7. Proposal for differential pathways for protein recognition of (Pt,Pt)-DNA adducts in comparison to those of cis-DDP. The protein as depicted would recognize a bend as induced by cis-DDP intrastrand or interstrand cross-links. The flexibility and structural differences of the (Pt,Pt) adducts do not give the conformational changes required for protein recognition and are thus bypassed.
192
NICHOLAS FARRELL
significant due in part to the flexibility of the (Pt,Pt) intrastrand adduct, ss This structural difference between dinuclear platinum complexes and cis-DDP is further manifested by the significantly reduced recognition of (Pt,Pt)-DNA adducts by HMG proteins. 61 Bearing in mind that bending by cis-DDP is a significant structural feature contributing to recognition by structure-specific proteins, it is reasonable to conclude that the "downstream" effects of (Pt,Pt)-DNA adducts will be distinct from those discussed above. Figure 7 shows this feature in a schematic mannernwe are now beginning to see that different structures have different biological consequences with respect to interaction with DNA processing enzymes. These features, if correlated with a different spectrum of antitumor activity, point the way toward rational molecular mechanisms to design new drugs complementary to those currently employed in the anticancer field.
V. NOVEL ANTITUMOR ACTIVE TRANS-PLATINUM
COMPLEXES
Very early studies showed that the trans-DDP isomer was devoid of antitumor activity. 89 No major differences in uptake and bioavailability have been found between the cis- and trans-DDP isomers. 9~These observations led to emphasis on the differences in DNA binding to explain the dramatic difference in antitumor activity between the two compounds. Both kinetic and structural effects contribute to the inability of the trans-DDP-DNA adducts to effectively inhibit replication and transcription.
A. DNA Binding of trans.DDP The trans-[PtCl2(NH3) 2] is kinetically more reactive than its cis-isomer. The monofunctional adduct of trans-DDP may react readily with glutathione preventing closure to the toxic bifunctional adduct. 91'92 This chemical repair could be assisted by the persistence of long-lived monofunctional trans-DDP adducts. B ifunctional cis-DDP-DNA adducts may inhibit DNA replication to a greater extent than those formed from trans-DDP 93 or the array of DNA adducts formed by trans-DDP may be repaired more rapidly. 94 These explanations assume that an equal number of bifunctional lesions are formed by the two isomers. The trans-isomer is sterically inhibited from formation of 1,2-intrastrand cross-links but instead 1,3-d(GNG) cross-links are formed. These adducts also result in bending of the DNA, but the deformation is distinct from that caused by the cis-DDP structure and is best interpreted in terms of flexible hinge joints. 15'95 The 1,3-GAG binding site within the CCTCGAGTCTCC sequence also produces localized disruption of base pairing and destacking of the platinated bases, as indicated from NMR and molecular dynamic modeling studies. 96
Platinum Antitumor Complexes
193
The structure of the trans-DDP interstrand cross-link is between the GN7 and CN3 of the same base pair, rather than the two opposite GN7 atoms of a GC-C'G' duplex, as for cis-DDP. 97'98 Thus, the structure of the interstrand cross-links formed by cis- and trans-DDP are not the same. The conformational distortions of the interstrand cross-link have been measured as an unwinding of approximately 12 ~ and a bending of 260. 90
B. Novel trans.Platinum Complexes Use of a more sterically hindering nonleaving group than the simple NH3 may retard the kinetic reactivity of the trans geometry. Results from a number of laboratories now show that use of sterically hindered ligands in the trans geometry produces antitumor activity and preclinical activity distinct from c i s - D D E 99 T h e two most studied structural groups are trans-[PtC12(L)(L')], where L - L ' - p y r i d i n e or thiazole, or L = planar ligand such as pyridine, quinoline, or thiazole and L' NH 3 (Figure 8). The features of cytotoxicity of trans planar amine (TPA) complexes in both murine and human tumor cell lines include cytotoxicity at least equivalent to their corresponding cis-isomers and, indeed, equivalent to cis-DDP itself. Retention of activity in cell lines rendered resistant to cis-DDP and a different pattern of
Cl~ /N ~ /
Pt
t rans- [PtCl2(pyddine)2]
CI~/NH3 N/ ~CI H2 t,t,t.-[PtCI2(OH)2(NHz)(cha)]
CI~ /NI'I3 Pt
c N / \CI trans-[PtCl2(M4z)(quinoline)] Me ~C/OMe // CI~ / N~
H~ / P t ~ c I H
MeO,..--/C ~/N Me trans-[PtCI2(iminoether)2]
Figure 8. Structures of trans-platinum complexes displaying antitumor activity.
194
NICHOLAS FARRELL
cytotoxicity over a range of cell lines in comparison to that of cis-DDP is observed. 5~176176The activity of the trans-platinum geometry has been confirmed by studies on t,t,t-[PtC12(OH)2(NH3)(cyclohexylamine)] l~ and on [transPtC12{ HN=CRR')2}2] (R = Me, R ' = OMe) 1~ (Figure 8). These results are of particular interest because the trans-platinum complexes are completely or partially non-cross-resistant to cis-DDP in all cell lines we have tested. Factors contributing to cisplatin resistance include drug accumulation, selective repair of Pt-DNA adducts, and modulation of the Pt-DNA adduct level by intracellular thiols such as glutathione. The cellular pharmacology of the new TPA complexes is significantly different to that of cis-DDP with respect to all important parameters of cytotoxicity and cellular resistance.
C. DNA Strand Breakage is a Consequence of trans-Platinum Damage in Cells An unparalleled finding in platinum antitumor chemistry has been that the predominant effect of TPA complexes upon cellular DNA is the induction of protein-associated breaks. 1~ Interstrand cross-links are also formed and the relative balance of strand breakage and interstrand cross-linking is dependent on structure. Strand breakage is not observed with either cis- or trans-DDP. In contrast, elution of DNA from trans-[PtCla(py)2]-treated cells indicate the presence of DNA strand breaks beyond those introduced by radiation. Further studies have shown that the DNA strand breaks induced by trans-[PtCl2(py)2] are protein-associated, occur in the absence of irradiation, and are observable at early time points. These effects are similar to those seen with filter elution studies of topoisomerase inhibitors such as etoposide, Adriamycin, m-AMSA, and camptothecin. The phenomenon of proteinassociated DNA strand breaks is general--the order is trans-[PtCl2(NH3)(quin)] < trans-[PtCl2(NH3)(thiazole)] < trans-[PtCl2(py)2]. The corresponding cis-isomers produce a significantly smaller amount of strand breaks.
D. DNA Binding of trans-Platinum Complexes with Planar Amines The relative proportion of strand breakage and interstrand cross-linking is dependent on the exact structure of the trans-plafinum complex. The mechanism of induction of the protein-associated strand breaks indicates, at this point, a pattern similar to that of topoisomerase inhibitors. Other candidate proteins would be helicases and those involved in DNA repair. The production of transient strand breaks by DNA processing enzymes suggests a plausible mode of attack for drugs which, in the case of topoisomerase poisons, may stabilize the drug-protein complex. If a monofunctional adduct on DNA is sufficiently long-lived, then a competition is set up between DNA interstrand cross-linking and formation of ternary DNA-protein cross-links, as illustrated in Figure 9. Both kinetic and structural features of platinum complexes can be systematically modified to dictate one pathway over the other. The observation of protein-associated strand breakage
Platinum Antitumor Complexes
195
I! / _T P A
Figure 9. Competition between formation of an interstrand cross-link and a DNAprotein cross-link upon initial formation of a monofunctional adduct of a trans-platinum complex. TPA stands for trans-planaramine.
from trans-isomers, and to a lesser extent from cis-isomers containing planar amines, is consistent with a steric effect retarding closure to a bifunctional DNADNA intrastrand or interstrand cross-link. In studies using DNA from various sources (CT, plasmid, or defined oligonucleotide sequence) interstrand cross-linking is considerably enhanced by trans[PtC12(py)2] over both its cis-isomers. 56' 101 At 10 ILtM (rb = 0.005) interstrand cross-links represent 0.23 or 23% of the total lesions (c.f. cis-DDP with < 5% interstrand cross-links). Modeling indicates that the GG "cis-DDP-like" interstrand cross-link in d(GC) sequences is favored due to the steric constraints of the planar ligands. Thus, the steric effects favor the GG interstrand cross-link over the GC cross-link favored by trans-platinum, as shown in Figure 10. The presence of planar rings has a considerable effect on DNA binding properties in comparison to the [PtCI2(NH3)2] isomers. Local unwinding of the DNA helix, as measured by topological unwinding of supercoiled plasmids, is significantly more effective for trans-[PtCl2(py) 2] than trans-DDP, with unwinding angles of
196
NICHOLAS FARRELL
H2N "NH'#O 0
1-12N Nil O NH3NH2
Figure 10. Schematic diagrams of coordination spheres of interstrand cross-links formed from trans-[PtCi2(py)2] (a GC/CG cross-link) and trans-[PtCi2(NH3)2] (a crosslink between G and C of the same base pair). 17 ~ and 9 ~ respectively. 99 The sequence specificity for trans-platinum complexes with planar ligands is for alternating (GC) sites. The adducts from trans[PtC12(NH3)(quinoline)] and trans-[PtCl2(py) 2] are not recognized by HMG proteins, which may indicate little or no bending of the DNA. 56 In summary, the structural and kinetic effects of substitution of a planar ligand for NH 3 in the trans-platinum geometry leads to an array of structurally distinct Pt-DNA adducts, which may be responsible for different pathways of protein recognition (such as proteins involved in strand breakage) in comparison to that delineated from cis-DDP.
VI. SUMMARY B ifunctional binding of platinum complexes to DNA is considered essential for manifestation of antitumor activity. Studies on direct analogues of cis-DDP confirm that all cis-[PtX2(amine) 2] complexes will produce a similar array of adducts with similar consequences. This fact may well be a reason for the similarity in clinical profile of those analogues which have entered clinical trials. On the other hand, work on dinuclear platinum and trans-platinum complexes indicate that complexes structurally different to cis-DDP and acting on DNA in a manner distinct to the clinically used agent may display an altered spectrum of antitumor activity. A rich array of new structures has been discovered worthy of further exploration to develop new platinum complexes genuinely complementary to the currently used drugs. 109
ACKNOWLEDGMENTS I thank my many co-workers for the results presented. This work is supported by The American Cancer Society (Grant DHP-2D) and Boehringer Mannheim Italia.
Platinum Antitumor Complexes
197
REFERENCES 1. Sherman, S. E.; Lippard, S. J. Chem. Rev. 1987, 87, 1153. 2. Reedijk, J.; Fichtinger-Schepman, A. M. J.; van Oosterom, A. T.; van de Putte, P. Structure and Bonding 1987, 67, 53. 3. Lepre, C. A.; Lippard, S. J. In Nucleic Acids and Molecular Biology; Eckstein, E; Lilley, D. M. J., Eds.; Springer-Verlag: Berlin, 1990, Chapter 2. 4. Comess, K. M.; Lippard, S. J. In Molecular Aspects of Anticancer Drug-DNA Interactions; Neidles, S.; Waring, M., Eds.; CRC Press: Boca Raton, 1993, Chapter 5. 5. Reed, E.; Kohn, K. W. In Cancer Chemotherapy- Principles and Practice; Chabner, B. A.; Collins, J., Eds.; J.B. Lippincott: Philadelphia, 1990, pp. 465--490. 6. Christian, M. C. Sem. Oncol. 1992, 19, 720. 7. Eisenhauer, E.; Swerton, K.; Sturgeon, J.; Fine, S.; O'Reilly, S.; Canetta, R. In Carboplatin: Current Perspectives and Future Directions; Bunn, P.; Canetta, R.; Ozols, R.; Rozencweig, M., Eds.; W.B. Saunders: Philadelphia, pp. 133-140. 8. Dorr, R. T.; Noel, K. Prin. Prac. Gynecol. OncoL Updates 1993, 1, 1. 9. Bumouf, D.; Daune, M.; Fuchs, R. P. P. Proc. Natl. Acad. Sci. USA 1987, 84, 3758. 10. Naser, L. J.; Pinto, A. L.; Lippard, S. J.; Essigman, J. M. Biochemistry 1998, 27, 4357. 11. 5;herman, S. E.; Gibson, D.; Wang, A. H.-J.; Lippard, S. J. Science 1998, 230, 412. 12. Coil, M.; Sherman, S. E.; Gibson, D.; Wang, A. H.-J." Lippard, S. J. J. Biomol. Struc. Dyn. 1990, 8,315. 13. den Hartog J.H.J.; Altona, C.; Chottard, J. C.; Girault, J. P.; Chottard, G.; Lallemand, J. Y.; Mansuy, D.; de Leeuw, E A. A. M.; Marcelis, A. T. M.; Reedijk, J. Nucleic Acids Res. 1982, 10, 4715-4730. 14. Bloemink, M. J.; Reedijk, J. Metal Ions Biol. Sys. 1996, 32, 641. 15. Bellon, S. E; Coleman, J. H.; Lippard, S. J. Biochemistry 1991, 30, 8026. 16. Takahara, P. M.; Rosenzweig, A. C.; Frederick, C. A.; Lippard, S. J. Nature 1995, 377, 649. 17. Yang, D.; van Boom, S. S. G. E.; Reedijk, J.; van Boom, J. H.; Wang, A. H.-J. Biochemistry 1995, 34, 12912. 18. Schwartz, A.; Sip, M.; Leng, M. J. Am. Chem. Soc. 1990, 112, 3673. 19. Lemaire, M.-A.; Schwartz, A.; Rahmouni, A. R.; Leng M. Proc. Natl. Acad. Sci. USA 1991, 88, 1982. 20. Rahmouni, A.; Leng, M. Biochemistry 1987, 26, 7229. 21. Hopkins, P. B.; Milliard, J. T.; Woo, J.; Weidner, M. E; Kirchner, J. J.; Sigurdsson, S. Th.; Raucher, S. Tetrahedron 1991, 47, 2475. 22. Sip, M.; Schwartz, A.; Vovelle, F.; Ptak, M.; Leng, M. Biochemistry 1992, 31, 2508. 23. Huang, H.; Zhu, L.; Reid, B. R.; Drobny, G. P.; Hopkins, P. B. Science 1995, 270, 1842. 24. van Garderen, C. J.; van Houte, L. P. A.; van den Elst, H.; van Boom, J. H.; Reedijk, J. J. Amer. Chem. Soc. 1989, 111, 4123. 25. van Garderen, C. J.; Altona, C.; Reedijk, J. Inorg. Chem. 1990, 29, 1481. 26. Brabec, V.; Reedijk, J.; Leng, M. Biochemistry 1992, 31, 12397. 27. ViUani, G.; Hubscher, U.; Butour, J.-L. Nucleic Acids Res. 1988, 16, 4407. 28. Pinto, A. I.; Lippard, S. J. Proc. Natl. Acad. Sci. USA 1985, 82, 4616. 29. Gralla, J. D.; Sasse-Dwight, S.; Poljak, L. G. Cancer Res. 1987, 47, 5092. 30. Bissett, D.; McLaughlin, K.; Kelland, L. R.; Brown, R. Br. J. Cancer 1993, 67, 742. 31. Chu, G.; Chang, E. Proc. Natl. Acad. Sci. USA 1990, 87, 3324. 32. Billings, P. C.; Davis, R. J.; Engelsberg, B. N.; Skov, K. A.; Hughes, E. N. Biochem. Biophy. Res. Comm. 1992, 188, 1286. 33. Brown, S. J.; Kellett, P. J.; Lippard, S. J. Science 1993, 261,603. 34. Pil, P. M.; Lippard, S. J. Science 1992, 256, 234. 35. Whitehead, J. P.; Lippard, S. J. Metal Ions Biolog. Syst. 1996, 32, 687. 36. Lilley, D. M. J. Nature 1992, 357, 282.
198
NICHOLAS FARRELL
37. Chu, G. J. Biol. Chem. 1994, 269, 787. 38. Kasparkova, J.; Brabec, V. 7th International Symposium on Platinum and Other Metal Compounds in Cancer Chemotherapy; Amsterdam, 1995, Abstract S098. 39. Mello, J. A.; Acharya, S.; Fishel, R.; Essigmann, J. Chem. Biol. 1996, 3, 579. 40. Knox, R. J.; Friedlos, F.; Lydall, D. A.; Roberts, J. J. Cancer Res. 1986, 46, 1972. 41. Micetich, K. C.; Barnes, D.; Erickson, L. C. Cancer Res. 1985, 45, 4043. 42. Frey, U.; Ranford, J. D.; Sadler, P. J. Inorg. Chem. 1993, 32,1333. 43. Canovese, L.; Cattalini, L.; Chessa, G.; Tobe, M. L. J. Chem. Soc., Dalton Trans. 1988, 2135. 44. Burchenal, J. H.; Kalaher, K.; Dew, K.; Lokys, L.; Gale, G. Biochimie 1978, 60, 961. 45. Kidani, Y.; Inagaki, K. J. Med. Chem. 1978, 21, 1315. 46. Boudny, V.; Vrana, O.; Gaucheron, F.; Kleinwachter, V.; Leng, M.; Brabec, V. Nucleic Acids Res. 1992, 20, 267. 47. Jennerwein, M.; Eastman, A.; Khokhar, A. Chem.-Biol. Inter. 1989, 70, 39. 48. Inagaki, K.; Nakahra, H.; Alink, M.; Kidani, Y. lnorg. Chem. 1990, 29, 4496. 49. Page, J. D.; Husain, I.; Sancar, A.; Chaney, S. G. Biochemistry 1990, 29, 1016. 50. Akaboshi, M.; Kawai, K.; Ujeno, Y.; Takada, S.; Miyahara, T. Jpn. J. Cancer Res. 1994, 85, 106. 51. Iwata, M.; Izuta, S.; Suzuki, M.; Kojima, K.; Furuhashi, Y.; Tomoda, Y.; Yoshida, S. Jpn. J. Cancer Res. 1994, 82, 433. 52. Morikawa, K.; Matsumotot, T.; Matsuoka, Y.; Koizumi, K. Chem. Pharm. Bull. 1992, 40, 21. 53. Kelland, L. R.; Mistry, P.; Abel, G.; Loh, S. Y.; O'Neill, C. E; Murrer, B. A.; Harrap, K. R. Cancer Res. 1992, 52, 3857. 54. Hartwig, J. E; Lippard, S. J. J. Am. Chem. Soc. 1992, 114, 5646. 55. Farrell, N. Cancer Invest. 1993, 11,578. 56. Farrell, N. Metal hms Biolog. Syst. 1996, 32, 603. 57. Farrell, N. Advances in DNA Sequence Spec~[ic Agents. Hurley, L. H.; Chaires, J. B., Eds.; JAI Press: Greenwich, CT, 1996, Vol. 2, p. 187. 58. Farrell, N. Comments Inorg. Chem. 1995, 16, 373. 59. Hoeschele, J. D.; Kraker, A. J.; Qu, Y.; Van Houten, B.; Farrell, N. In Molecular Ba~visof Specificity in Nucleic Acid-Drug Interactions; Pullman, B.; Jortner, J., Eds.; Kluwer Academic Press: Dordrecht, 1990, Vol. 23, p. 301 ff. 60. Farrell, N.; Qu, Y.; Hacker, M. E J. Med. Chem. 1990, 33, 2179. 61. Manzotti, C.; Pezzoni, G.; Giuliani, E; Valsecchi, M.; Farrell, N.; Tognella, S. Proc. A.A.C.R. 1990, 35, 2628. 62. Mellish, K. J.; Qu, Y., Scarsdale, N.; Farrell, N. Nucleic Acids Res. 1997, 25, 1265. 63. Kharatishvili, M.; Mathieson, M.; Farrell, N. Inorg. Chim. Acta 1997, 255, I. 64. Roberts, J. D.; van Houten, B.; Qu, Y.; Farrell, N. E Nucleic Acids Res. 17, 9719. 65. Van Houten, B.; IUenye, S.; Qu, Y.; Farrell, N. Biochemistry 1993, 32, 11794. 66. Johnson, A. L.; Illenye, S.; Farrell, N.; Van Houten, B. Proc. A.A.C.R. 1994, 35, 2634. 67. Lehnert, S.; Farrell, N. Proc. A.A.C.R. 1995, 36, 2376. 68. Farrell, N.; Roberts, J. D.; Qu, Y.; Zou, Y.; Marples, B.; Skov, K. A.; Tognella, S. Proc. A.A.C.R. 1994, 35, 2637. 69. Farrell, N.; Appleton, T. G.; Qu, Y.; Roberts, J. D.; Soares Fontes, A. E; Skov, K. A.; Wu, E; Zou, Y. Biochemistry 1995, 34, 15480. 70. Zhen, W.; Link Jr., C. J.; O'Connor, E M.; Reed, E.; Parker, R.; Howell, S. B.; Bohr, V. A. Mol. Cell Biol. 1992, 12, 3689. 71. Jones, J. C.; Zhen, W.; Reed, E.; Parker, R. J.; Sancar, A.; Bohr, V. A. J. Biol. Chem. 1991, 266, 7101. 72. Farrell, N.; Qu, Y.; Feng, L.; Van Houten, B. Biochemistry 1990, 29, 9522. 73. Johnson, A.; Qu, Y.; Van Houten, B.; Farrell, N. Nucleic Acids Res. 1992, 20, 1697. 74. Zou, Y.; Van Houten, B.; Farrell, N. Biochemistry 1994, 33, 5404. 75. Gruff, E. S.; Orgel, L.E. Nucleic Acids Res. 1991, 19, 6849.
Platinum Antitumor Complexes
199
76. Yang, D.; van Boom, S.; Reedijk, J.; van Boom, J.; Farrell, N.; Wang, A. H.-J. Nature Struc. Biol. 1995, 2, 577. 77. Iwamoto, M.; Mukunda, S. J.; Marzilli, L. G. J. Am. Chem. Soc. 1994, 116, 6238. 78. Rich, A.; Nordheim, A.; Wang, A. H.-J. Ann. Rev. Biochem. 1984, 53, 791. 79. Malfoy, B.; Hartmann, B.; Leng, M. Nucleic Acids Res. 1981, 9, 5659. 80. Ushay, M.; Santella, R. M.; Grunberger, D.; Lippard, S. J. Nucleic Acids Res. 1982, 10, 3573. 81. Kharatishvili, M.; Qu, Y.; Farrell, N. Biochemistry, submitted. 82. Liu, L. E; Wang, J. C. Proc. Natl. Acad. Sci. USA 1987, 84, 7024. 83. Rich, A. In Proceedings of The Robert A. Welch Foundation; Houston, 1993, Vol. 37, pp. 13-34. 84. Parkinson, G. N.; Arvanitis, G. M.; Lessinger, L.; Ginell, S. I.; Jones, R.; Gaffney, B.; Berman, H. Biochemistry 1995, 34, 2960. 85. Bloemink, M. J.; Reedijk, J.; Farrell, N.; Qu, Y.; Stetsenko, A. I. J. Chem. Soc., Chem. Commun. 1992, 1002. 86. Qu, Y.; Bloemink, M. J.; Reedijk, J.; Hambley, T. W.; Farrell, N. J. Am. Chem. Soc. 1992, 118, 9307. 87. Syzmkowski, D. E.; Yarema, K.; Essigmann, J. M.; Lippard, S. J.; Wood, R. D. Proc. Natl. Acad. Sci. USA 1992, 89, 10772. 88. Richon, W. M.; Schulte, N. A.; Eastman, A. Cancer Res. 1987, 47, 2056. 89. Kasparkova, J.; Mellish, K. J.; Qu, Y.; Brabec, V.; Farrell, N. Biochemistry 1996, 35, 16705. 90. Rosenberg, B. In Nucleic Acid - Metal hm Interactions; Spiro, T.G. Ed.; Wiley: New York, 1980, Vol. 1, pp. 1-29. 91. Hoeschele, J. D.; Butler, T. A.; Roberts, J. A. Inorganic Chemistry in Biology and Medicine; ACS Symposium Series; Martell, A. E., Ed.; 1980, Vol. 140, p. 181ff. 92. Eastman, A.; Barry, M. A. Biochemistry 1987, 26, 3303. 93. Bancroft, D. P.; Lepre, C. A.; Lippard, S. J. J. Am. Chem. Soc. 1990, 112, 6860. 94. Roberts, J. J.; Friedlos, F. Cancer Res. 1987, 47, 31. 95. Ciccarelli, R. B.; Solomon, M. J.; Varshavsky, A.; Lippard, S. J. Biochemistry 1985, 24, 7533. 96. Bellon, S. E; Lippard, S. J. Biophys. Chem. 1990, 35, 179. 97. Lepre, C. A.; Chassot, L.; Costello, C. E.; Lippard, S. J. Biochemistry 1990, 29, 811. 98. Brabec, V.; Leng, M. Proc. Natl. Acad. Sci. USA 1993, 90, 5345. 99. Brabec, V.; Sip, M.; Leng, M. Biochemistry 1993, 32, 11676. I00. Van Beusichem, M.; Farrell, N. lnorg. Chem. 1992, 31,634. 101. Farrell, N.; Kelland, L. R.; Roberts, J. D.; Van Beusichem, M. Cancer Res. 1992, 52, 5065. 102. Kelland, L. R.; Bamard, C. F. J.; Mellish, K. J.; Jones, M.; Goddard, P. M.; Valenti, M.; Bryant, A.; Murrer, B. A.; Harrap, K. R. Cancer Res. 1994, 54, 5618. 103. Coluccia, M.; Nassi, A.; Loseto, F.; Boccarelli, A.; Mariggio, M. A.; Giordano, D.; Intini, E P.; Caputo, P.; Natile, G. J. Med. Chem. 1993, 36, 510.
This Page Intentionally Left Blank
KEDARCI DI N AN D M A D U ROPEPTI N" TWO NOVEL ANTITU MOR CH ROMOPROTEI NS WITH SELECTIVE PROTEASE ACTIVITY AND DNA CLEAVING PROPERTIES
Nada Zein and Daniel R. Schroeder
I~ II.
III.
IV.
Introduction
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
202
Kedarcidin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
202
A.
Kedarcidin: The Holoantibiotic
. . . . . . . . . . . . . . . . . . . . . .
202
B.
Kedarcidin: The C h r o m o p h o r e . . . . . . . . . . . . . . . . . . . . . . .
203
C.
Kedarcidin: The Apoprotein
Maduropeptin
. . . . . . . . . . . . . . . . . . . . . . . .
209
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
214
A.
Maduropeptin: The Holoantibiotic . . . . . . . . . . . . . . . . . . . . .
214
B. C.
The C h r o m o p h o r e and Solvent Artifacts . . . . . . . . . . . . . . . . . . Maduropeptin: The Apoprotein . . . . . . . . . . . . . . . . . . . . . . .
215 220
Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
223
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
223
Advances in DNA Sequence-Specific Agents Volume 3, pages 201-225 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8
201
202
NADA ZEIN and DANIEL R. SCHROEDER I.
INTRODUCTION
Enediyne antitumor antibiotics represent a novel chemical class of compounds with an outstanding array of biological and chemical properties. In vitro studies on various cell lines and in vivo testing on murine solid tumors and human xenograft models demonstrate that the enediynes are the most potent antitumor agents ever isolated. As an example, C1027 is 107 times more potent than adriamycin, one of the most clinically effective antitumor drugs used to date. The enediynes contain two acetylenic groups conjugated to a double bond or incipient double bond within a 9- or 10-membered ring. This diyne--ene unit is often referred to as the warhead. Upon proper activation in the presence of DNA, the warhead undergoes rearrangement yielding sp 2 carbon-centered diradicals that cleave DNA. This radical-mediated DNA damaging capability is believed to account for the potent antitumor activity of the enediynes. 1 To date, the 9-membered enediyne antibiotics have been isolated as a complex with an acidic apoprotein; they are referred to as the chromoproteins and include auromomycin, actinoxanthin, neocarzinostatin, kedarcidin, maduropeptin, and C 1027. 2-18 This is in contrast to esperamicin, calicheamicin, and dynemicin, agents that contain 10-membered enediyne rings and, to date, have been isolated without associated apoproteins. 19-22 The chemistry, biology, and the mechanism of action of the 10-membered enediyne-containing antitumor agents have been extensively discussed in several recent review articles. 23 This chapter will focus on the latest studies conducted on kedarcidin and maduropeptin, the two 9-membered enediyne containing chromoproteins recently isolated and characterized at Bristol-Myers Squibb. 9-14 For a thorough review on neocarzinostatin, refer to the work of Goldberg and coworkers who paved the way for many of the mechanistic studies performed on the enediyne chromophores. 24
II.
KEDARCIDIN
Kedarcidin chromoprotein was isolated from the culture supernatant of an actinomycete strain obtained from soils collected in the Maharastra State in India. This compound exhibits potent in vivo antitumor activity against P388 leukemia and B 16 melanoma in murine models at an optimal dose of 3.3 and 2~tg/kg, respectively. The potency of kedarcidin against murine tumors is similar to that of calicheamicin and esperamicin. Kedarcidin also shows potent activity against Gram-positive bacteria but no activity against Gram-negative bacteria. Exposure of H C T l l 6 human colon cancer cell lines to kedarcidin results in an IC50 value of 10-9 MmlCso is the drug concentration that causes 50% cell kill. 9'1~
A. Kedarcidin: The Holoantibiotic Kedarcidin is an acidic complex (pI 3.65) with an apparent molecular mass of 12,400 Da as determined by SDS-PAGE. It consists of an apoprotein and a highly
Kedarcidin and Maduropeptin
203
ASAAVSVSPA
TGLADGATVT
VSASGFATST
SATALQCAIL
ADGRGACNVA
EFHDFSLSGG
EGTTSVVVRR
SFTGYVMPDG
PEVGAVDCDT
APGGCQIVVG
GNTGEYGNAA
I SFG
i 14
Sequence 1. Proposed amino acid sequence of the kedarcidin apoprotein. labile, non-peptidic chromophore. The major apoprotein is a single-chain polypeptide consisting of 114 amino acid residues (Sequence 1).l~ The chromophore is a solvent-extractable molecule having a molecular weight of 1029. ll'12 Depending on fermentation conditions, the kedarcidin complex varies with respect to amino acid composition in the apoprotein. The molecular formulae of the chromophores and the ratio of apoprotein to chI:omophore are as follows: Amino acid sequencing studies have revealed the presence of three variants of the kedarcidin apoprotein. The major variant polypeptide consists of 114 amino acid residues and is the one used in our studies (Sequence 1). Two minor variants were also identified; one lacks the first alanine of the major variant and the second lacks the first two amino acids of the major variant. HPLC-UV and LC-MS showed the presence of three different chromophores of varying ratios and molecular weights. The major chromophore 1 (see Scheme 1) of molecular weight 1029 has been fully characterized and is the subject of our discussion in this part of the chapter. The ratio of apoprotein to chromophore in the complex varied from 1" 1 to 18:1 as shown by a quantitative UV method of analysis. The complex, chromophore and apoprotein used in our studies, came from a lot that had a 16:1 ratio of apoprotein to chromophore. Like neocarzinostatin, kedarcidin chromophore is believed to reside in a hydrophobic cleft in the apoprotein where it is shielded from degradation. This situation keeps the otherwise insoluble chromophore in aqueous solutions and may aid in exporting it out of the producing organism. The three-dimensional structure of the kedarcidin holoantibiotic has not yet been determined; however recent NMR studies on the apokedarcidin revealed that apokedarcidin adopts an overall structure similar to that elucidated for neocarzinostatin, macromomycin, and apoactinoxanthin. 25-3~ This structure consists of a seven-stranded antiparallel [3-barrel domain linked to a subdomain composed of two 13-hairpin ribbons. Interestingly, this motif resembles the variable domain of immunoglobulins. 31
B. Kedarcidin:The Chromophore Chemical Structure and Activation Initial attempts to characterize the intact kedarcidin chromophore 1 were unsuccessful due to its low stability in most organic solvents. Considerable substructural information was obtained by acidic methanolysis experiments from which the
204
NADA ZEIN and DANIEL R. SCHROEDER
structures of the two carbohydrate residues and the bridging azatyrosine residue could be deduced. Reduction of the crude chromophore fraction followed by isolation of the two major products gave invaluable information on the structure of the enediyne core and the attachment of the carbohydrate and bridging amino acid residues as well as important clues regarding its activation. 11'12 Close examination of the structure shows that the functionalities on the aglycone are all strategically situated with respect to each other to participate in the formation of a transient 1,4 diyl by a chemically induced Bergman-type bond reorganization. 32 The cycloaromatization is initiated by attack of a reducing thiol on the less-hindered side of C- 12 followed by bond migration and opening of the epoxide ring, as shown in Scheme 1. Subsequent cyclization of the enediyne gives the 1,4-benzenoid diradical, 3, the species believed to cause DNA damage. The opening of the epoxide reduces the strain energy developed in the transition state leading to cycloaromatization. This mechanism of action contrasts with that of the neocarzinostatin chromophore, in which the epoxide ring opening generates a cumulene intermediate that aromatizes to a C-2/C-6 indacene diradical. 8
Cleavage of Plasmid DNA Agarose gel electrophoresis studies demonstrate that overnight incubation of the kedarcidin chromophore at 37 ~ with supercoiled pM2 DNA (Form I) in the presence of ~3-mercaptoethanol results in the conversion of Form I DNA to mostly Form II (i.e. open circular DNA). A plot of the consumption of Form I and the formation of Forms II and III (i.e. linear DNA), as a function of drug concentration, showed that at 37 ~ single-strand breaks accumulate on average four times more rapidly than double-strand breaks, consistent with the behavior of a single-strand cutter. Treatment of the cleavage products with hydrazine and putrescine had no effect on the results suggesting absence of alkali-labile lesions. A time-dependent study at one concentration of chromophore showed that the chromophore cleaved the DNA within 5 minutes of incubation time. Omitting 13-mercaptoethanol from the reaction mixture greatly decreased the DNA cleavage, consistent with the proposed mechanism for the formation of the diradical active intermediate 3 (Scheme 1). A temperature-dependent study at 4 and 37 ~ showed the rate of accumulation of both forms to be about 5 times more rapid at 37 than at 4 ~ A comparative study between the cleavage of various forms of OX174 indicated that the kedarcidin chromophore does not recognize the single-strand form and that it favors supercoiled DNA over the open circular and the linearized forms. 33
DNA Cleavage Site, Sequence Specifidty, and Cleavage Chemistry 5"-End-Labeled Studies. Cleavage specificity was examined by the reaction of the kedarcidin chromophore with five different 5'-end-labeled pBR322 and pUC 18 restriction fragments in presence of 13-mercaptoethanol. Comparison of the electrophoretic mobility of the drug-induced cleavage products with the Maxam-
205
Kedarcidin and Maduropeptin CH3y C H ~ O ~ O H C H , O ~ OCH,
I
CI~ ..,N.. ~
. IH
0
ArCO
CH, .... 'N'CH'
o~
I II "I r''H
Cl ~,~N ~ , / , , ~ . NH
OH
o"~~
~ pSH 0
sugar.O~"
OH
--
HO._U-7",,.~ CH3
ArCO
I
sugar-O w -
~
~"~" OH |
g
---
ArCO
I II "I r""H O.,"';',,~ O,,'~M.O,,,',,,~,,\O"suga, ~::",:, H \ "~~ H
Cl ~,~N ~ , , , , ~ . . NH
"
o~ o ' ' ' x '~~
"H
DNA
.~r'~"
sugar-O
.,-:,o.
,...,
H4' "OH
3
....
Scheme 1.
Gilbert chemically produced markers 34 shows that the DNA cleavage caused by the chromophore is highly sequence-specific. Also, as observed from the agarose gel studies, the kedarcidin chromophore cleaves DNA in a single-stranded manner. A preferred site is the 3' nucleotide (N = T, C, G, A) adjacent to the TCCT tetramer, as seen in Figure 1. Another favored site is TCGTN, where N is a C or a G. The 5-mer TCATN is less preferred than TCCTN (<_50% of the TCCTN band), with the extent of cleavage dependent on the flanking sequences. Secondary sites are ACGCN and TCTAN (<50% of the TCCTN band). The electrophoretic mobilities of the drug-induced fragments appear to be the same as those of the Maxam-Gilbert markers. Treatment of the cleavage products with base and sodium borohydride does not have any effect on the reaction products, suggesting fragments ending in 3'-phosphate or 3'-phosphoglycolate termini. 33 Competition experiments with netropsin, a known minor groove binder, showed that some of the kedarcidin cleavage sites are modified or eliminated by netropsin, suggesting that kedarcidin chromophore acts in the minor groove of DNA. 35
3"-End-LabeledStudies. Studies with the 3'-end-labeled pBR322 SalI/BamHI fragment also show strong specificity for the TCCTN site as shown
206
NADA ZEIN and DANIEL R. SCHROEDER CoGAGCTCI
2. 3 4
$ 6 7 8 9
5'.end
Figure 1. Autoradiogram of the reaction of kedarcidin chromophore 1 with the 5'-end-labeled fragment pBR322 Sall/BamHI in presence of 14 mM 13-mercaptoethanol. G, AG, C, TC are the Maxam-Gilbert lanes. Lane 1, 1 at 5 ~tM. Lane 2, under anaerobic conditions; lanes 3, 4, 7 with 50 mM NaCI and 10 mM MgCI2 and CaCI2, respectively; lanes 5, 6, in presence of catalase and superoxide dismutase; lane 8 in absence of 13-SH; lane 9, 1 at 50 ~tM. Co is control lane. by a major band matching the chemically produced marker (Figure 2). In addition, two faint and poorly resolved bands both of which migrate slower than the principal band are observed. NaOH treatment moves the slowest band c to where it matches the Maxam-Gilbert marker, but the middle band b and the principal band a remain unaffected. Sodium borohydride treatment of the cleavage products causes band c to move slightly faster, leaving band a unaffected (Figure 2). Based on extensive m
w
Kedarcidin and Maduropeptin
207
G A G C T C 1 2 3 Co
i
3' end
Figure 2. Autoradiogram of the reaction of kedarcidin chromophore 1 with the 3' end-labeled fragment pBR322 Sall/BamHI in presence of 14 mM 13-mercaptoethanol. G, AG, C, TC are the Maxam-Gilbert lanes. Lane 1, 1 at 5 ktM. Lanes 2, 3, products of lane 1 treated with 0.1 M NaOH and 0.28 M NaBH4, respectively. 33
studies performed on bleomycin, neocarzinostatin, and calicheamicin, the observed electrophoretic mobilities of the cleavage products obtained in the 5'- and 3'-endlabeled studies suggest principally 4'-hydrogen atom abstraction along with a small portion of 5'-H abstraction from the targeted DNA deoxyribose sugars. 35-48
Effect of Various Factors on DNA Cleavage. The effect of various factors on the cleavage reaction of the kedarcidin chromophore with DNA was studied using the 5'-end-labeled pBR322 SalUBamHI fragment. To ensure that reactive oxygen species were not participating in the DNA cutting, the reaction was also
208
NADA ZEIN and DANIEL R. SCHROEDER
carried out in presence of excess superoxide dismutase or catalase. These enzymes had no effect on strand scission. Reduced oxygen species are, therefore, not involved in the cleavage reaction. Under anaerobic conditions, cleavage was dramatically inhibited. These results along with the specificity of the cuts argue against a diffusible species such as hydroxyl radicals, and support instead a nondiffusible, carbon-centered radical produced during the aromatization of the enediyne moiety. 46-48 As shown in Scheme 1, reaction with thiol at C-12 and epoxide ring-opening triggers the cyclization of the enediyne to an activated diradical intermediate 3. This intermediate then abstracts hydrogen from the DNA causing strand breakage. However, a definitive interpretation of these results is not presently in hand. Additional experiments are in progress to provide further insight into the chemical nature of the cleavage. The similarity of the kedarcidin chromophore naphthoate moiety with that of siderophores led us to evaluate the chelationcapacity of the chromophore for certain cations and its effect on strand cleavage. 49'5~As seen in Figure 1, addition of 10 mM CaCI 2 or MgCI 2 to the reaction mixtures resulted in at least 90% inhibition of the DNA cleavage. In contrast, addition of 100 mM CaCI 2 to DNA/esperamicin A 1 and calicheamicin T11 reaction mixtures had no effect on their cleaving properties. Notably, esperamicin A 1 and calicheamicin )'lI lack the siderophore-like moiety.
NMR Studies in Presence of Calcium Chloride. To gain further insight into the significance of these observations, we examined the effect of increasing amounts of CaCI 2 on a kedarcidin chromophore solution by high resolution NMR. These studies showed that one proton was significantly affected. The singlet at 7.1 ppm corresponding to C4"-H shifted downfield while all other protons shifted slightly upfield relative to the control. 33These observations suggest the localization
CHs~CHs T
q II
4"
OCH. CIr.. ,,N,,. ~
i
I IH
~ Jl
C H . ~OH H4 HO..j..-7-.~ CHs
---
N
O~'~..OH ~
"o.
_..
/
1t
1'
Kedarcidin and Maduropeptin
209
of the Ca 2§ ion in the region of the naphthoic acid moiety as shown in structure 1'. In the chelated form, kedarcidin presumably cannot associate with the DNA binding site, thus preventing DNA cleavage. These results suggest that the naphthoate moiety is involved in DNA binding.
C. Kedarcidin: The Apoprotein As mentioned earlier, since the discovery of the enediyne-containing chromoproteins, the apoprotein component was relegated to the role of a sheath for the highly labile 9-membered rings. It has also been suggested that the antitumor activity of all enediynes involves DNA cleavage, a process about which there is substantial in vitro chemical and structural information. 23 As previously shown for neocarzinostatin, 8 DNA experiments with both the isolated chromophore and the kedarcidin chromoprotein demonstrate that DNA cleavage is primarily due to the chromophore. However, cytotoxicity assays using the human colon cancer cell line HCT116 showed that the chromoprotein exhibits equivalent cytotoxicity to that of the chromophore (IC50 of 10-9 M); 51 this is intriguing since in the complex studied, the ratio of chromophore to apoprotein is 1:16. These observations implied that the apoprotein must be contributing actively to the cytotoxicity of the holomolecule and prompted us to investigate an additional role for the kedarcidin polypeptide beyond that of an inert chromophore stabilizer.
Inhibition of Cellular Macromolecular Synthesis In a preliminary step, the effects of the chromophore, the complex, and the kedarcidin apoprotein on the DNA, RNA, and protein synthesis inhibition in HCT 116 cells were examined and compared. This was achieved by labeling the cells with tritiated 3H thymidine, 3H uridine, and 3H leucine after a 2 hour treatment with each of the three kedarcidin species. The cellular uptake of the tritiated molecules was measured. As expected for any cytotoxic agent, the kedarcidin chromophore inhibited DNA, RNA, and protein syntheses; the IC5o values were measured to be 3 • 10-9 M, 4 • 10-7 M, and 4 • 10-7 M, respectively, as shown in Figure 3. The kedarcidin apoprotein, free from any detectable chromophore, had no measurable effect on any of the macromolecular synthesis. However, to our surprise the kedarcidin complex (chromophore + apoprotein) inhibited DNA synthesis at the nanomolar levels similarly to the chromophore, yet did not have any effect on RNA nor cellular protein syntheses (Figure 3). Premixing the chromophore with the apoprotein prior to cell treatment yielded identical results to those obtained with the complex, i.e. the DNA synthesis was inhibited after a 2 hour treatment; yet, RNA and protein synthesis was unaffected. 51 These observations strengthened the hypothesis that the apoprotein may play a role in addition to that of a carrier/stabilizer.
210
NADA ZEIN and DANIEL R. SCHROEDER
100 80
o o
-----e---- D N A RNA .... Promin
60 40 20 84 0
1 0 " ~ 0 "1~, 0 "~~ 0 " 9 1 0 " S l 0 .7 1 0 " 6 1 0 " S l 0 "~ Chromophore
Concentration
in
Molarity
120" 100
80 r~
" ; ...... --"-,
60
DNA RNA
Pmmin
40 20
I 0"121 o ' l l l O'i~ 0 .9 1 0 "s 1 0 .7 1 0 "6 I 0 .5 I 0 "4 Chromoprotein
Concentration
in
Molarity
Figure 3. DNA, RNA, and protein synthesis inhibition in HCT 116 cells. The cells (2 x 104 cells/mL) were treated with various concentrations of kedarcidin chromophore or chromoprotein for two hours. The drug treatment was followed by a wash and a two-hour incubation with 3H thymidine (DNA), 3H uridine (for RNA), and 3H leucine (for protein). The data is calculated as percent incorporation relative to that of the control.
Kedarcidin and Maduropeptin
211
Proteolytic Cleavage of Histones Because the ultimate effect of the chromophore in mammalian cells is believed to be on DNA, and because of the acidic nature of the apoprotein, we decided to examine possible interactions of the complex, the chromophore, and the kedarcidin apoprotein with histones. Histones are highly basic by nature and form the DNA scaffold in mammalian cells; significantly, one of the histones, histone HI, holds the nucleosomes together. 52-55 To reach the DNA intact, not only must the chromophore be protected by the protein but the DNA in chromatin needs to be exposed to the chromophore, perhaps with the help of the apoprotein. The implication of this hypothesis was that the apoprotein alone must have an effect on histones. In order to test our hypothesis, carefully purified kedarcidin apoprotein was reacted with total calf thymus histones in vitro. SDS-PAGE electrophoresis analyses demonstrated that the apoprotein cleaved the histones into low molecular weight peptides. Incubation of each individual calf thymus histone (HI, H2A, H2B, H3, and H4) with the apoprotein showed that all histones were cleaved, as shown in Figure 4. The relative susceptibility to cleavage was: HI > H2B, H3, H2A > H4, (Figure 4). Histone H1 is richest in lysines, followed by H2A, H2B, H3, and H4. In a time-course experiment the apoprotein was shown to cleave H 1 within 3 hours of incubation. In contrast to a previous report which showed that macromomycin 1 2 3 4 5 6 7 8 9 101112131415
Figure 4. 17% SDS polyacrylamide gel of the reaction of kedarcidin apoprotein with calfthymus histones. Reaction conditions: 50 mM Tris-HCI pH 7.5, 1 mg/mL individual histones, in a total volume of 10 IzL, 37 ~ overnight. The control reactions were carried out under identical conditions except that the apoprotein was replaced by pure water. Lanes 1, 4, 7, 10, 13 control reactions with H1, H2A, H2B, H3, and H4, respectively; lanes 2, 5, 8, 11, 14 reactions of the apoprotein at 0.1 mg/mL with H1, H2A, H2B, H3, and H4, respectively. Lanes 3, 6, 9, 12, 15 reactions ofthe apoprotein at 1 mg/mL with H1, H2A, H2B, H3, and H4, respectively.
212
NADA ZEIN and DANIEL R. SCHROEDER
acts as an aminopeptidase, 56 our results suggested that the kedarcidin apoprotein possesses proteolytic activity similar to that of an endoprotease since it is able to cleave histones generating small peptides. 57 In addition, whereas macromomycin was unable to degrade acetylated proteins, kedarcidin efficiently cleaved histones H 1 and H2A, both of which have acetylated N-termini. To test the effect of the presence of the chromophore (in the protein) on the proteolytic activity, the kedarcidin chromoprotein was reacted with the histones in a manner similar to that of the apoprotein. The results were identical to those observed with the apoprotein demonstrating that the presence of the chromophore in the complex does not influence histone cleavage. Reacting the naked kedarcidin chromophore with histones for 15 hours however, caused the formation of high molecular weight aggregates, but only at relatively high levels of chromophore. Histone H4, richest in arginines, was the most sensitive to the enediyne. The observed protein agglomeration is compatible with the formation of an enediyneradical intermediate---e.g, intermediate 3, Scheme lmwhich leads to a cascade of reactions resulting in protein intermolecular cross-links. It should be noted that the kedarcidin chromophore damages DNA extensively at a 3 orders of magnitude dilution, suggesting DNA to be the preferred substrate for this natural enediyne. In summary, the above observations indicate that the kedarcidin apo/chromoprotein and the chromophore have different damaging effects on histones. The kedarcidin chromophore causes protein agglomeration at high concentrations, whereas the apo/chromoprotein cleave the histones into low molecular weight peptides. 57
Selectivity of Proteolytic Cleavage To assess the selectivity of the apoprotein towards histones, several less basic proteins were reacted with the kedarcidin apoprotein/chromoprotein. These proteins include 3':5' cyclic AMP-dependent protein kinase, prostatic phosphatase, calf brain tubulin, apo- and holo-transferrin, and HCTll6 cell membrane protein extract. None of these proteins were cleaved suggesting that, in vitro, the apo/chromoprotein is selective in the proteins it cleaves. 57 Histones which are most opposite in net charge to the highly acidic apoprotein are damaged most readily. Unsurprisingly, histone H 1, richest in lysines, is the most susceptible to cleavage.
Specificity of Proteolytic Cleavage To better understand the proteolytic cleavage, we synthesized a 24-amino acid peptide (Sequence 2), the sequence of which represents a very basic region of histone HI. This peptide was designed to serve as a starting point to probe the
IAEKTPVKKKA IIAKKPAGARRK 21ASGP-NH2 Sequence2.
Kedarcidin and Maduropeptin
213
specificity exhibited by the kedarcidin chromoprotein/apoprotein. The peptide was incubated individually with similar concentrations of the kedarcidin chromoprotein as well as the kedarcidin apoprotein. The reaction products were then analyzed by electrospray liquid chromatography/mass spectrometry. The results indicate that the chromoprotein cleaves the peptide at specific sites and that the kedarcidin apoprotein is less specific than the kedarcidin chromoprotein. The kedarcidin chromoprotein cleaves the peptide after two major sites, Lys 9 and Ala 15, while the apoprotein cleaves the peptide after the following amino acids: Lys 9, Arg 18, Arg 19, Lys 20, and Ala 21, as shown in Figure 5. 58 The difference in proteolytic specificity between the apo- and the chromokedarcidin is intriguing. In the absence of NMR data and a crystal structure of the kedarcidin chromoprotein, it is difficult to offer a definitive interpretation of this result. However, it is possible that the chromophore induces a slight conformational change in the protein such that the structure of the active site of the chromoprotein is slightly different from that of the apoprotein. Since the cleavage sites identified for apo- and chromokedarcidin resemble those found for serine proteases, we tested the effect of the most common serine protease inhibitors on the cleavage of histone H1. Addition of leupeptin, antipain, aprotinin, diisopropyl phosphofluoridate (DIFP), 4-(2-aminoethyl)-benzenesulfonyl fluoride, hydrochloride (AEBSF), and trypsin inhibitor all inhibited the cleavage reactions. In contrast, pepstatin, an acid protease inhibitor, had no effect. Currently, we do not know the protease active site, therefore a definitive interpretation of these observations is not yet possible. However, these preliminary results suggest that kedarcidin protein acts as a serine protease.
(A) AEKTPVKKK,I,AAKKPAGARSRSK,LA,I,SGP-NH2
(B) AEKTPVKKK'I'AAKKPA'I'GARRKASGP-NH2
(C) AEKTPVKKSK,I,A AKKPAGARRK,I, ASGP-NH2
(D) AEKTPVKKKAAKKPAGARRK,LASGP-NH2 Figure 5. The arrows indicate the observed cleavage sites caused by: (A) Kedarcidin apoprotein. (B) Kedarcidin chromoprotein. (C) Neocarzinostatin. (D) Maduropeptin.
214
NADA ZEIN and DANIEL R. SCHROEDER
III.
MADUROPEPTIN
Maduropeptin was isolated from the broth filtrate of Actinomadura madurae. The organism was obtained from soils collected in Germany. Maduropeptin is a unique and lethal material in that, besides DNA strand cleaving properties, it apparently has DNA alkylating properties. It possesses potent antibacterial and antitumor properties similar to the other chromoproteins, and characteristic of compounds in the enediyne class. Cytotoxicity assays on several human carcinoma cell lines resulted in determining an IC50 value of 5 • 10-1~ M. Impressive B 16 melanoma activity observed in the mouse subrenal capsule (SCR) assay and other solid tumor models has been the driving force for research in this class. Unlike most other enediyne antitumor antibiotics, DNA strand scission is not bioreductively induced with maduropeptin. 13 Although maduropeptin was discovered several years before kedarcidin, not nearly as much is known about the complex. There were two main reasons for this outcome. One is that kedarcidin was chosen as a project compound by BristolMyers Squibb Co. for development, and thus commanded tremendous resources to address the many issues that arose. The second reason is tied to the inherent properties of maduropeptin that make it different from the five chromoproteins that have been characterized thus far. As will be discussed below, the chromophore is very tightly bound to apoprotein, and it was nearly 10 years after the discovery of maduropeptin before a process was found to effect the removal of the chromophore without its complete degradation. ~4
A. Maduropeptin: The Holoantibiotic Maduropeptin is also an acidic complex (pI 4.75) but unlike the other chromoproteins it does not appear to possess any basic amino acids. The complex can be isolated by conventional techniques including ion exchange and size exclusion chromatographies. The protein has unusual properties and does not stain with most dyes including Coomassie blue, but does stain with amido black. The intact macromolecular antibiotic has recently been estimated by mass spectrometry to be approximately 13,000 Da, while the chromophore portion is believed to have a molecular weight of 746.14'59 The primary structure of the protein is currently being elucidated and, as far as is known, the apoprotein is a single-chain polypeptide of comparable size to the enediyne-associated proteins that have been encountered thus far. A point of interest is that maduropeptin apoprotein does not appear to show any sequence homology to the related enediyne-containing chromoproteins, and seems to represent a new protein class. 59 In keeping with this thought, it is possible that maduropeptin apoprotein does not have an easily accessible binding pocket for the chromophore on its surface. Unlike the variations in ratio of apoprotein to chromophore found in fermentations of Kedarcidin, the ratio in the maduropeptin complex was always 1:1 and was
Kedarcidin and Maduropeptin
215
not dependent upon fermentation conditions. Neither was there chromophore loss during the isolation process, which is consistent with the chromophore not being solvent extractable. These data suggest that the chromophore is more deeply imbedded in this larger protein or possibly covalently linked.
B. The Chromophore and Solvent Artifacts Chemical Structure and Activation Maduropeptin chromophore was not released from apoprotein using the known techniques of solvent partitioning or trituration of lyophilized solids with methanol. A new process was discovered to effect the dissociation that exploited the acidity of the complex. 14 Substantially pure holoantibiotic was bound to DEAE-cellulose. With the chromoprotein tightly bound to the anion exchanger and spread over a large surface area, cold methanol was allowed to percolate slowly through the bed. The methanol apparently denatured the protein and released the chromophore leaving the apoprotein bound. The parent chromophore was not recovered however; instead a mixture of artifacts formed by addition to the double bond of the enediyne at C-5, as depicted in Scheme 2. Although never isolated, the structure of maduropeptin chromophore is proposed to be 5. The opening of the aziridine ring, which constitutes a ring expansion of the bridging atoms, is the driving force for the formation of the artifacts through the relief of ring strain. The methanol adduct 6 was the dominant isolable product formed in the process along with a minor chlorine containing artifact 7 and several other compounds. DNA studies were carried out using mostly chromophore 6 unless otherwise stated. Of great interest to us is that the solvent artifacts 6 and 7 of the chromophore may, in essence, be prodrugs and regenerate the parent chromophore 5 of the holoantibiotic. This would account for the same high-sequence selectivity observed in the drug-DNA studies, because in both cases the same highly reactive enediyne species 5 might be responsible for the cutting (vide infra). The decrease in potency of the methanol adduct 6 as compared to holoantibiotic is attributed to the poor leaving group ability of the methoxy group that initially combined to C-5. Equally exciting is that the compound 9 generated in situ from these transformations is capable of further damage, possibly by alkylation of DNA or a repair enzyme. This cycloaromatized compound has been isolated and determined to display both antibacterial and antitumor properties with a unique biological profile. 6~ Although maduropeptin apoprotein is quite different from the other known apoproteins, the chromophore 5 seems to be biogenetically related to the family of enediyne chromophores that have been characterized thus far, having the same 14 unbranched carbons in the core rings. Kedarcidin and neocarzinostatin chromophores require an activation event, which has been referred to as a trigger mechanism, before cycloaromatization can occur to a highly reactive diradical species. Maduropeptin chromophore is apparently already in an activated state, but is
216
NADA ZEIN and DANIEL R. SCHROEDER ---
HO. e0~ ' ~"-. ~ ~ _ .Cl ~l 0 HO/'~ t~O....,,,'~",O H HO 0 ~~ -' --. H3HCI~0 CH30
H/
NH
~
Cl e''~0
HOck/O ~ ~T'r"~ HsC~2/ CH30"~' HN
~ 0
~ 0
~H
CH3
to Dimdical
RO3PO.._.~'N/;.~,0~V .,Base
HO~~'-.,,, " ~'~---/""OH HQA
HO,~fO AF~kB HsC)/ HN
. ~~ CHsO 9
6 X= OCHs Z X=Cl
CHs
Cycloaromatization
,,It 9N
0 H
OPOsR' 4'Habstraction frombothDNAstrands
'""N__o HO O
. o1(
HO)(~ 0
CHs 0
o
"%_ ~
CH30/'"
I;
.~
CHs
CHs Scheme 2.
sufficiently stabilized by the apoprotein portion to prevent spontaneous cycloaromatization prematurely. This may also be the case for C-1027 chromophore. 61-63
Cleavage of Plasmid DNA Agarose gel electrophoresis analyses show that at 37 ~ maduropeptin is 100-fold more potent in cleaving covalently closed circular DNA, i.e. Form I, than the rearranged chromophore 6 (data not shown). Maduropeptin cleaves 50% of Form I DNA at 10-8 M while compound 6 cleaves 50% of Form I DNA at 10-6 M. In both cases, Form I is converted to both Form II (open circular DNA) and Form III (linear DNA), suggesting a mixture of single- and double-strand breaks, Neither chromophore had any effect on single-strand (I)X174 (+ strand), even at relatively high concentrations of drugs. 64
DNA Cleavage Site, SequenceSpecificity, and Cleavage Chemistry Identification of Double-Strand Cleavage Sites. Cleavage specificity was examined by reacting maduropeptin and 6 with several different 5'- and 3'-end-
Kedarcidin and Maduropeptin
217
labeled pBKS+, pBR322, and pUC18 restriction fragments in the presence of salmon sperm DNA. The cleavage products were determined by comparison with the Maxam-Gilbert standards on sequencing gels. 34 Our results show that both maduropeptin and 6 are site-selective and that they share the same DNA site selectivity. These observations are compatible with Scheme 2 where we propose that for both chromophores the same highly reactive enediyne species 8 is responsible for DNA cutting. The prominent DNA breaks observed on both strands are of similar intensities and occur with a two-nucleotide 3'-stagger. Given the fact that the cleavage experiments are run under single-hit kinetics, our results suggest that the DNA damage at those sites could result from bistranded lesions. Two such sites, independent of flanking sequences, identified after analysis of five different 5'- and four different 3'-end-labeled restriction fragments, are 5' TCTT/3' AGAA, and 5' TCTC/3' AGAG. Another preferred double-stranded cleavage site is 5' "IqTT/3" AAAA (Figure 6). However, in this case, the DNA bases that are cleaved within this tetramer and the extent of cleavage is dependent on the DNA context. The nature (double-stranded versus single-stranded) and magnitude of cleavage of other secondary sites were found to be contingent upon DNA content beyond the immediate neighboring DNA bases. Such is the case of 5' NTI"I~,5' TCAT, 5' TCTC, 5' TTAT, 5' TCCT, 5' TCTA, and their complementary sequences. Whether the cleavage sites are primary or secondary, the data suggest that, in most cases, maduropeptin and 6 exhibit a strong preference towards polypyrimidine/polypurine
G A-AC'--
AG
TC
C
1
2
9
C-T'-- i G Figure 6. Detail of the autoradiograms of the reaction products of maduropeptin and chromophore 6 with the 3'-end-labeled pBKS+ Pstl/Pvull restriction fragment. G, AG, C, TC are the Maxam-Gilbert lanes. Lane 1, maduropeptin at 0.05 mg/mL. Lane 2, 6 at 0.1 mg/mL.
218
NADA ZEIN and DANIEL R. SCHROEDER
regions of the DNA. 64 Similar observations were reported for calicheamicin q(lI , kedarcidin, and C- 1027. 8,33,35,48,62--65 It is likely that these regions are flexible areas of the DNA as opposed to the more rigid "poly C/poly G" tracts which are rarely cleaved by any of the above mentioned compounds.
Characterization of the Double-Strand Cleavage Chemistry. The chromophore-cleavage chemistry of the primary was investigated by examining the electrophoretic mobilities of the cleavage products relative to those of the MaxamGilbert standards. When the DNA was 5'-end-labeled, cleavage of the preferred sites 5' TCTT/3' AGAA and 5' CIqqTG/3' GAAAAC yielded fragments that ran slightly faster than the Maxam-Gilbert standards. The mobility of the fragments was not affected when they were treated with base and sodium borohydride. When the DNA was 3'-end-labeled, these fragments matched the chemical standards. These observations suggest fragments ending with 3'-phosphoglycolate residues and therefore chemistry at the C-4' carbon of the DNA sugar moieties at the cleavage sites. Additional evidence for 4'H-abstraction was obtained by examining the reaction of 6 with two complementary 16-mers containing one single cleavage site, the 5' TCTC/3' AGAG tetramer. The oligomers were individually 5'-end-labeled, annealed with the nonlabeled complementary strand, and reacted with chromophore 6. The reaction products were treated with putrescine and hydrazine. As shown in Figure 7, for both oligomers, putrescine treatment caused an increase in 3'-phosphate-ended fragments, a behavior characteristic of alkali-labile lesions resulting from 4'H-abstraction. 35-45'66In addition, hydrazine treatment resulted in DNA oligomers that migrate slower than the corresponding Maxam-Gilbert stand-
1
2
3
1
2
3
Figure 7. Detail of the autoradiograms of the reaction products of chromophore 6 with (A) the 5'-end-labeled 16-mer 5' GGGCG{TTCTCC}GGGCC annealed with the nonlabeled complementary strand, and (B) the 5'-end-labeled complementary strand 5' GGCCC{GGAGAA}CGCCC annealed with the nonlabeled 16-mer represented in A. Lane 1 is 6 at 1 mg/mL; lanes 2 and 3 represent the reaction products from lane 1 treated with hydrazine and putrescine, respectively.
Kedarcidin and Maduropeptin
219
ard (i.e. than the phosphate-ended fragment). As shown with bleomycin, such oligomers end with 3'-phosphopyridazine residues. These residues were shown to arise from the reaction of hydrazine with a product of 4'-chemistry, i.e. the 4'-hydroxylated abasic site. 42-45 Our results with maduropeptin and 6 suggest that DNA scission is a result of H-abstraction at the C-4' of the deoxyribose sugars; H-abstraction leads to at least two different types of lesions. Of note, alkali-labile lesions were not observed with the kedarcidin chromophore.
Effect of Various Factors on DNA Cleavage. The effect of various factors on DNA cleavage was studied by reacting chromophore 6 with the 5'-end-labeled pBR322 SalI/BamHI fragment. Competition experiments with netropsin, a known minor groove binder, show that preincubation with netropsin alters chromophore 6 cleavage sites. This observation added to the nature of the staggered cleavage suggests that the chromophore acts in the minor groove of DNA. As shown for kedarcidin and calicheamicin, 33'35 DNA cleavage was inhibited under anaerobic conditions. Also, addition of excess superoxide dismutase and catalase to the DNA cleavage experiments had no effect on strand scission. These results, along with the specificity of the cleavage, argue for a mechanism involving a nondiffusible, carbon-centered radical, i.e. 8 as depicted in Scheme 2. It is interesting to note that the 9-membered enediyne chromophores maduropeptin, 64 neocarzinostatin, 8 and C-1027 63 cleave double-strand DNA with a two nucleotide stagger. In contrast, the double-stranded cuts in the case of the 10-membered enediynes, calicheamicin, 35 and esperamicin, 66 occur with a three-nucleotide stagger. The presence of two siderophore-like functionalities in the molecule and precedent with kedarcidin prompted an examination of the effect of certain cations on DNA cleavage. 33'49'5~As observed with kedarcidin, DNA cleavage was inhibited in the presence of 10 mM CaC12 and MgC12 (Figure 1). NMR Studies in the Presence of Calcium Chloride. NMR studies on 6 in the presence of CaC12 provided clues regarding its activation and gave insight as to the chromophore regions important in DNA binding. These studies showed that upon addition of increasing amounts of CaC12 to compound 6, protons in two regions of the molecule were affected as shown in Figure 8. At low concentrations (beginning at l0 mM) of CaC12, two protons H-5' and H-8' (7.25 and 2.71 ppm, respectively) were shifted downfield. This suggests the localization of a Ca 2+ ion in the region of C-9' and C-7', i.e. in the 13-hydroxy amide function in the linker that bridges the core rings, i.e. structure 6'. Such chelation could prevent activation of 6, thus interfering with the formation of 5. As a result, the DNA-damaging intermediate 8 cannot form and DNA cleavage cannot occur. In addition, with increasing concentrations of CaC12 the protons at 6.97 (C-4'"), 6.58 (C-5"'), 2.19 (C-9'"), and 2.10 ppm (C-8"') were broadened (Figure 8). The broadening suggested chelation at the 2'"-phenol and 7'"-carbonyl site in the region of the terminal benzamide (structure 6'). This data suggest the involvement of the terminal sugar-
220
NADA ZEIN and DANIEL R. SCHROEDER Control
CnCI2 Added
I
I
,t3~ I
A
I
I
I
, . , .............. 7.4 7.2 7.0 6.8 6.6 6.4 6.2
P P M
-
,
-
,
.
,
-
,
.....
,
.
,
.
7.4 7.2 7.0 6.8 6.6 6.4 6.2
Figure 8. Expanded NMR spectra of chromophore 6 with increasing amounts of D20 (control) and CaCI2 in D20. benzamide moiety in DNA binding since in the chelated form, the chromophore cannot associate with DNA and thus DNA cleavage does not occur. As with kedarcidin, these siderophore-like chelation sites obviously play a role in the interaction of the chromophore with DNA and add to the unique chemical features of these chromophores. C. Maduropeptin: The
Apoprotein
Proteolytic Cleavageof Histones As was shown for kedarcidin, maduropeptin exhibits selective proteolytic activity. Incubation of each individual calf thymus histone (HI, H2A, H2B, H3, and H4)
221
Kedarcidin and Maduropeptin
_
~~-~~~
.or . ~ r, , 0
.0,7, ~
el " O v . L rJ..,
//
H 3 C ' ~ CH30"~,~"S' HN
_
NH ~I
OCH3~ /
L
J
CH3
with maduropeptin at 50 ~tg/ml indicated that H1 is the most susceptible to proteolysis (Figure 9). Increasing the concentration of maduropeptin results in cleavage of the other histones in the following order: H1 >> H2B, H3, H2A > H4. A concentration dependence study demonstrated that 50% of H 1 was consumed at 10 l.tg/ml in maduropeptin. A time course experiment with histone H 1 revealed the formation of low molecular weight bands within 3 hours of incubation. It is important to note that the H1 cleavage profile with maduropeptin was different from that obtained with kedarcidin. Also, unlike kedarcidin, addition of the protease inhibitors leupeptin, antipain, aprotinin, AEBSF, and DFP, at the concentrations described above, had no effect on the maduropeptin proteolytic activity. The newly discovered proteolytic activity for kedarcidin and maduropeptin prompted us to investigate the proteolytic activity of neocarzinostatin, another member of the chromoprotein family. Studies with all calf thymus histones showed that neocarzinostatin also acts as an endoprotease with a bias towards H1 (Figure 9). Among the protease inhibitors tested on kedarcidin and maduropeptin, only DFP had a slight effect on inhibiting H1 cleavage by neocarzinostatin. Also the H 1 cleavage profile with neocarzinostatin was different from that of kedarcidin and maduropeptin (Figure 9). Although preliminary, our results suggest that the nature of the maduropeptin, kedarcidin, and neocarzinostatin proteolytic activities differs from chromoprotein to chromoprotein. To obtain further information regarding this issue, we determined the maduropeptin and neocarzinostatin cleavage sites on the synthetic 24-amino acid peptide as described earlier for kedarcidin.
Specificity of Proteolytic Cleavage Incubation of peptide 2 with neocarzinostatin and maduropeptin results in proteolytic cleavage of the peptide at specific sites as shown in Figure 5. The
222
NADA ZEIN and DANIEL R. SCHROEDER
3
45
............ ......
6
:
1
2 3 4 5
7
6
:i il;ii iii
- - 29 k D a
--- 14.3 k D a
L
JL_. A
-
J B
Figure 9. A 17% SDS/polyacrylamide gel of the reaction of (A) neocarzinostatin and
(B) maduropeptin with calf thymus histone H1. Reaction conditions: 50 mM Tris HCI (pH 7.5), 1 mg/mL H1, and varying concentrations of neocarzinostatin and maduropeptin in a total volume of 10 ILtL,37 ~ overnight. The control reactions were carried out under identical conditions except that the chromoproteins were replaced by pure water. Lanes 1, control reactions with H1. Lanes 2, 3, 4, 5, 6 reactions of H1 with 10/.tg/mL; 50 ~tg/mL; 100 ~tg/mL; 500 ILtg/mL; 1 mg/mL, respectively of neocarzinostatin (A) and maduropeptin (B). Lane 7, protein size standards from 200 to 14.3 kDa. The band corresponding to neocarzinostatin protein seen in A6 and A7 migrates close to the 14.3-kDa marker and that corresponding to maduropeptin protein in B6 and B7 migrates close to the 29-kDa marker.
neocarzinostatin cleavage sites are after Lys 8, Lys 9, and Lys 20, whereas maduropeptin cleaves the peptide at one major site which is after Lys 20. These results mirrored those obtained in the H1 cleavage experiments in that each chromoprotein yields a unique cleavage pattern.
Kedarcidin and Maduropeptin
223
The cleavage sites identified for apo- and chromokedarcidin, neocarzinostatin, and maduropeptin resemble those found for serine proteases in that their substrates have common P1 sites (nomenclature of Schechter and Berger) for cleavage, 67 specifically lysine and arginine (trypsin-like) or alanine (elastase-like). 68 However, only kedarcidin apo- and chromoprotein were inhibited by serine protease inhibitors. Additional studies into the specifics of the proteolytic cleavage are in progress.
IV. CONCLUSION Kedarcidin, neocarzinostatin, and maduropeptin are members of a growing class of enediyne-containing chromoproteins that exhibit dual functionalities: a DNA cleaving chromophore and a stabilizing, selective, protease-like apoprotein. The potent cytotoxicity of enediyne--chromophores suggest that the preferred DNA scission sites are biologicallycritical DNA sequences. In addition, even though maduropeptin apoprotein shows no homology to the kedarcidin and neocarzinostatin class of proteins, the data suggest that the protein component of the neocarzinostatin, kedarcidin, and maduropeptin may provide a "targeted delivery" of the highly cytotoxic chromophores to the chromatin. This "two-pronged" attack could explain the high potency of these natural products. A more thorough understanding of the substrate specificity of these proteins and their mechanism(s) of proteolytic activity, together with a knowledge of the chemistry of their corresponding enediyne chromophores, will provide a useful basis for the design of new generation antitumor agents.
REFERENCES 1. Doyle, T. W.; Borders, D. B. In Enediyne Antibiotics as Antitumor Agents; Doyle, T. W.; Borders, D. B.; Eds.; Marcel Dekker: New York, 1994, Chapter 1. 2. Chimura, H.; Ishizuka, M.; Hamada, M.; Hori, S.; Kimura, K.; Iwanga, J.; Takeuchi, T.; Umezawa, H. J. Antibiot. 1968, 21, 44. 3. Khoklov, A. S.; Cherches, B. Z.; Reshetov, P. D.; Smirnova, G. M.; Sorokina, I. B.; Prokoptzeva, T. A.; Koloditskaya, T. A.; Smirnov, V. V.; Navashin, S. M.; Fomina, I. P. J. Antibiot. 1969, 22, 541. 4. Khoklov, A. S.; Reshetov, P. D.; Chupova, L. A.; Cherches, B. Z.; Zhigis, L. S.; Stoyachenko, I. A. J. Antibiot. 1976, 29, 1026. 5. Edo, K.; Mizugaki, M.; Koide, Y.; Seto, H.; Furihata, K.; Okate, N.; Ishida, N. Tetrahedron Len. 1985, 26, 331. 6. Hensens, O. D.; Goldberg, I. H. J. Antibiot. 1989, 42, 761. 7. Hensens, O. D.; Giner, J. L.; Goldberg, I. H. J. Am. Chem. Soc. 1989, 111, 3295. 8. Goldberg, I. H. Accts. Chem. Res. 1991, 24, 191. 9. Lam, K. S.; Hesler, G. A.; Gustavson, D. R.; Crosswell, A. R.; Veitch, J. M.; Forenza, S. J. Antibiot. 1991, 44, 472. 10. Hofstead, S. J.; Matson, J. A.; Malacko, A. R.; Marquardt, H. J. Antibiot. 1992, 45, 1250. 11. Leet, J. E.; Schroeder, D. R.; Hofstead, S. J.; Golik, J.; Colson, K. L.; Huang, S.; Klohr, S. E.; Doyle, T. W.; Matson, J. A. J. Am. Chem. Soc. 1992, 114, 7946.
224
NADA ZEIN and DANIEL R. SCHROEDER
12. Leet, J. E.; Schroeder, D. R.; Langley, D. R.; Colson, K. L.; Huang, S.; Klohr, S. E.; Lee, M. S.; Golik, J.; Hofstead, S. J.; Doyle, T. W.; Matson, J. A. J. Am. Chem. Soc. 1993, 115, 8432. 13. Hanada M.; Ohkuma, H.; Yonemoto, T.; Tomita, K.; Ohbayashi, M.; Kamei, H.; Konishi, M.; Kawagushi, H.; Forenza, S. J. Antibiot. 1991, 44, 403. 14. Schroeder, D. R.; Colson, K. L.; Klohr, S. E.; Zein, N.; Langley, D. R.; Lee, M. S.; Matson, J. A.; Doyle, T. W. J. Am. Chem. Soc. 1994, 116, 9351. 15. Hu, J.; Xue, Y. C.; Xie, M. Y.; Zhang, R.; Otani, T.; Minami, Y.; Yamada, Y.; Marunaka, T. J. Antibiot. 1988, 41, 1575. 16. Otani, T.; Minami, Y.; Marunaka, T.; Zhang, R.; Xie, M. Y. J. Antibiot. 1988, 41, 1580. 17. Zhen, Y. S.; Ming, X. Y.; Yu, B.; Otani, T.; Saito, H.; Yamada, Y. J. Antibiot. 1989, 42, 1294. 18. Sugimito, Y.; Otani, T.; Oie, S.; Wierzba, K.; Yamada, Y. J. Antibiot. 1990, 43, 417. 19. Golik, J.; Clardy, J.; Dubay, G.; Groenewold, G.; Kawaguchi, H.; Konishi, M.; Krishnan, B.; Ohkuma, H.; Saitoh, K.; Doyle, T. W. J. Am. Chem. Soc. 1987, 109, 3461. 20. Golik, J.; Clardy, J.; Dubay, G.; Groenewold, G.; Kawaguchi, H.; Konishi, M.; Krishnan, B.; Ohkuma, H.; Saitoh, K.; Doyle, T. W. J. Am. Chem. Soc. 1987, 109, 3462. 21. Lee, M. C.; Dunne, T. S.; Chang, C. C.; Siegel, M. M.; Ellestad, G. A.; Morton, G. O.; McGahren, W. J.; Borders, D. B. J. Am. Chem. Soc. 1992, 114, 985. 22. Konishi, M.; Ohkuma, H.; Matsumoto, K.; Kamei, H.; Miyaki, T.; Tsuno, T.; Oki, T.; Kawaguchi, H.; VanDuyne, G. D.; Clardy, J. J. Antibiot. 1989, 42, 1449. 923. Doyle, T. W.; Borders, D. B., Eds.; Enediyne Antibiotics as Antitunu~r Agents; Marcel Dekker: New York, 1994. 24. Goldberg, I. H.; Kappen, L. S. In Enediyne Antibiotics as Antitunu~rAgents; Doyle, T. W.; Borders, D. B., Eds.; Marcel Dekker: New York, 1994, Chapter 16. 25. Constantine, K. L.; Colson K. L.; W~ttekind, M.; Friedrichs, M. S.; Zein, N.; Tuttle, J.; Langley, D. R.; Leet, J. E.; Schroeder, D. R.; Lam, K. S.; Farmer II, B. T.; Metzler, W. J.; Bruccoleri, R. E.; Mueller, L. Biochemistry 1994, 33, 11438. 26. Gao, X. J. Mol. Biol. 1992, 225, 125. 27. Teplyakov, A.; Obmolova, G.; Wilson, K.; Kuromizu, K. Eur. J. Biochem. 1993, 213, 737. 28. Kim, K.-H.; Kwon, B. M.; Myers, A. G.; Rees, D. C. Science 1993, 262, 1042. 29. Van Roey, P.; Beerman, T. A. Proc. Natl. Acad. Sci. USA 1989, 86, 6587. 30. Pletnev, V. Z.; Kuzin, A. P.; Trakhanov, S. D.; Kostetsky, P. V. Biopolymers 1982, 21,287. 31. Adjaj, E.; Quiniou, E.; Mispelter, J.; Favaudon, V.; Lhoste, J. M. Biochimie 1992, 74, 853. 32. Bergmann, R. G. ACC. Chem. Res. 1973, 6,25. 33. Zein N.; Colson, K. L.; Leet, J. E.; Schroeder, D. S.; Solomon, W.; Doyle, T. W.; Casazza, A. M. Proc. Natl. Acad. Sci. USA 1993, 90, 2822. 34. Maxam, A. M.; Gilbert, W. Meth. Enzymol. 1980, 65, 499. 35. Zein, N.; Sinha, A. M.; McGahren, W. J.; Ellestad, G. A. Science 1988, 240, 1198. 36. Kappen, L. S.; Goldberg, I. H. Biochemistry 1983, 22, 4872. 37. Kappen, L. S.; Ellenberger, T. E.; Goldberg, I. H. Biochemistry 1987, 26, 384. 38. Hensens, O. D.; Dewey, R. S.; Liesch, T. R. S.; Napier, M. A.; Reamer, R. A.; Smith, J. L.; Albers-Schonberg, G.; Goldberg I. H. Biochem. Biophys. Res. Commun. 1983, 113, 538. 39. Myers, A. G. Tetrahedron Lett. 1987, 28, 4493. 40. Goldberg, I. H. Free Radical Biol. Med. 1987, 3, 41. 41. Giloni, L.; Takeshita, M.; Johnson, E; Iden, C.; Grollman, A. P. J. Biol. Chem. 1981, 256, 8608. 42. Stubbe, J.; Kozarich, J. W. Chem. Rev. 1987, 87, 1107. 43. Kozarich, J. W.; Worth Jr., L.; Frank, B. L.; Christner, D. E; Vanderwall, D. E.; Stubbe, J. Science 1989, 245, 1396. 44. Rabow, L. E.; Stubbe, J. A.; Kozarich, J. W. J. Am. Chem. Soc. 1990, 112, 3196. 45. Rabow, L. E.; McGall, G. H.; Stubbe, J. A.; Kozarich, J. W. J. Am. Chem. Soc. 1990, 112, 3203. 46. Zein, N.; McGahren, J. M.; Morton, G. O.; Ashcroft, J.; Ellestad, G. A. J.Am. Chem. Soc. 1989, 111, 6888.
Kedarcidin and Maduropeptin
225
47. De Voss, J. J.; Townsend, C. A.; Ding, W. D.; Morton, G. O.; Ellestad, G. A.; Zein, N.; Tabor, A. B.; Schreiber, S. L. J. Am. Chem. Soc. 1990, 112, 9669. 48. Ellestad, G. A.; Ding, W-D.; Zein, N.; Townsend, C. A. In Enediyne Antibiotics as Antitumor Agents; Doyle, T. W.; Borders, D. B., Eds.; Marcel Dekker: New York, 1994, Chapter 9. 49. Peterson, T.; Neilands J. B.Tetrahedron Lett. 1979, 50, 4805. 50. Telford, J. R.; Leary, J. A.; Tunstad, L. M. G.; Byers, B. R.; Raymond, K. N. J. Am. Chem. Soc. 1994, 116, 4499. 51. Solomon, W.; Zein, N., unpublished results. 52. Sperling, R.; Wahtel, E. J.Advances in Protein Chemistry; Academic Press: New York, 1981, Vol. 34, p. 1. 53. Pederson, D. S.; Thoma, E; Simpson, R. T. Ann. Rev. Cell Biol. 1986, 2, 117. 54. Wolffe, A. P. FASEB J. 1992, 6, 3354. 55. Grunstein, M. Scien. Amer. 1992, 74B. 56. Zaheer, A,; Zaheer, S.; Montgomerry, R. J. Biol. Chem. 1985, 260, 11787. 57. Zein, N.; Casazza, A. M.; Doyle, T. W.; Leet, J. E.; Schroeder, D. R.; Solomon, W.; Nadler, S. G. Proc. Natl Acad. Sci. USA 1993, 90, 8009. 58. Zein, N.; Reiss, P.; Bernatowicz, M.; Bolgar, M. Chem. Biol. 1995, 2, 7. 59. Hail M., unpublished results. 60. Schroeder, D.; Zein, N., unpublished data. 61. Otani, T.; Minami, Y.; Marunaka, T.; Zhang, R.; Xie, M.-Y. J. Antibiot. 1988, 41, 1580. 62. Sugiura, Y.; Matsumoto, T. Biochemistry 1993, 32, 5548. 63. Xu, Y-J.; Zhen, Y-S.; Goldberg, I. H. Biochemistry 1994, 33, 5947. 64. Zein, N.; Solomon, W.; Colson, K. L.; Schroeder, D. Biochemistry 1995, 34, 11591. 65. Walker, S.; Landovitz, R.; Ding, W.-D.; Ellestad, G. A.; Kahne, D. Proc. Natl. Acad. Sci. USA 1992, 89, 4608. 66. Yu, L.; Golik, J.; Harrison, R.; Dedon, P. J. Am. Chem. Soc. 1994, 116, 9733. 67. Schechter, I.; Berger, A. Biochem. Biophys. Res. Commun. 1967, 27, 157. 68. Zwilling, R.; Neurath, H. Meth. Enzymol. 1981, 80, 633.
This Page Intentionally Left Blank
ANTISENSE- AND ANTIGENE-BASED DRUG DESIGN STRATEGIES IN ONCOLOGY
Karl-Heinz Altmann, Doriano Fabbro, and Thomas Geiger i
I. II.
III.
IV.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Inhibition of Protein Expression by Antisense and Antigene Oligonucleotides A. General Principles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . B. Mechanism of Action of Antisense Oligonucleotides . . . . . . . . . . . C. Chemical Modifications of Antisense Oligonucleotides . . . . . . . . . . D. Cellular Uptake of Antisense Oligonucleotides . . . . . . . . . . . . . . Antisense Oligonucleotides as Anticancer Agents . . . . . . . . . . . . . . . A. Potential Targets in Antisense-Based Cancer Therapy . . . . . . . . . . . B. In Vivo Pharmacokinetics and Toxicology of Antisense . . . . . . . . . . Issues and Opportunities . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References and Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Advances in DNA Sequence-Specific Agents Volume 3, pages 227-266 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8
227
228 . . 229 229 231 234 238 239 239 255 257 259
228
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER I.
INTRODUCTION
Cancer represents the second most frequent cause of death in the civilized countries and it is expected to become the leading mortal disease in the immediate future. The treatment of cancer presently is based on a combination of surgery, radiotherapy, and chemotherapy, with surgery and chemotherapy having been used in the treatment of localized, regional, and disseminated disease over the last 20 years with only minor innovative changes. Altogether the surgical removal of solid tumors has met with rather limited success, mainly because of the frequent relapse of tumors due to the presence of distant metastases. Along the same lines, cytotoxic chemotherapy so far has not lived up to the promise it had originally held for the treatment of inoperable and disseminated malignancies, and except for a small proportion of patients these therapies in the palliative setting are often associated with significant morbidity and only marginal improvement of survival. However, certain improvements in chemotherapy have definitively been realized in the recent past years due to the introduction of potent cytotoxic agents (doxorubicin, cis-platinum, taxol), by improved drug delivery protocols, and by the use of consensus protocols for combination therapies. Aggressive chemotherapy in combination with improved diagnostics and myeloprotectives is now also used as a primary therapy, but this strategy is limited to hematological malignancies. More recently, immunotherapy as well as radio- and chemoprotectors and-sensitizers have also been included in standard treatments by chemotherapy. On the other hand, postoperative cancer therapy following surgical removal of solid tumors has obviously reached its limits with respect to efficacy and this type of therapy has a severe negative impact on patients' quality of life. In addition, postoperative chemotherapy is often plagued by the induction of multidrug resistance and has not significantly prolonged overall survival of patients with solid cancers. Although certain successes have been achieved for malignancies of the breast and cervix, much less progress has been made in the combat of most other solid cancers, e.g. of the colorectal cancers, melanoma, cancers of the pancreas, prostate, stomach, and esophagus, and for non-small cell lung cancer. The limitations of successful chemotherapy reside in the unacceptably low tolerability of chemotherapeutic agents at efficacious doses, with the toxicity of these compounds originating in the lack of specificity in their mechanisms of action as transcriptional inhibitors or DNA damaging agents. It is thus clear that therapeutic alternatives that are based on strategies aiming at clearly defined diseaserelevant molecular targets are urgently required, since such strategies are much more likely to lead to the discovery of highly efficacious anticancer agents with much better tolerability. It is before this background that recent advances in the fields of nucleic acid chemistry and biochemistry in combination with our improved (though still highly insufficient) understanding of the factors contributing to carcinogenesis may now offer the possibility to design oligonucleotide-based
Antisense- and Antigene-BasedDrug Design
229
therapeutic agents that could be largely devoid of the unspecific toxic side effects displayed by traditional anticancer agents. The strategies involved are based on the inhibition of protein expression by the specific binding of synthetic oligonucleotides to single-stranded RNA (antisense approach) or double-stranded genomic DNA (antigene approach). The underlying concepts of these approaches have been extensively reviewed in the recent literature. 1-7 Nevertheless, we consider it appropriate to begin this chapter with a brief summary of the general aspects involved in antisense- and antigene-based drug design strategies which should form the basis for a more comprehensive understanding of the subsequent discussion of specific applications of antisense and antigene oligonucleotides as potential anticancer drugs. It should be pointed out that this review will focus on the use of exogenously delivered synthetic oligonucleotides as potential therapeutic agents, while related approaches involving, e.g., the plasmid-derived endogenous expression of antisense RNA (either permanently or under the control of an inducible promoter) or the application of exogenously delivered large antisense RNA molecules, though also important strategies, will only be discussed very briefly. It should also be understood that antisense research in general and its application to problems of cancer therapy in particular are very dynamic and rapidly developing areas of activity. It is therefore impossible to provide the reader with a comprehensive reference list comprising every single piece of published work that may be related to the subject of this article. Whenever possible we have resorted to the citation of previous review articles covering certain specific aspects of antisense research in a more comprehensive manner. However, in some cases we are just providing a limited selection of references and it should be clear that in such instances a much larger number of studies may have been conducted in conjunction with the corresponding subjects.
II.
INHIBITION OF PROTEIN EXPRESSION BY ANTISENSE A N D ANTIGENE OLIGONUCLEOTIDES A. General Principles
The antisense approach to inhibition of gene expression at the RNA level rests on the basic idea that the binding of a relatively small synthetic oligonucleotide ("antisense" oligonucleotide, hereafter referred to as AS-ODN) to a complementary base sequence on a target messenger RNA could lead to suppression of the expression of the corresponding protein (Figure 1A). 1-7 Such an inhibitory effect on RNA translation could conceivably occur through a variety of mechanisms (which will be defined in more detail below) and its functional consequences would be equivalent to the inhibition of protein function, e.g. by small molecule enzyme inhibitors or receptor antagonists. The first to demonstrate the principal feasibility of such a concept were Zamecznik and Stephenson, 9'1~ who in 1978 showed that
230
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
treatment of cultured cells infected with the Rous Sarcoma virus with a 13-mer oligodeoxyribonucleotide complementary to part of the viral RNA sequence inhibited virus replication. It has been subsequently pointed out that the antisense concept is not a man-made invention, but that many bacteria as well as eukaryotic cells make use of antisense RNA as a means to control gene expression at the translational level. 11 Since the antisense strategy is based on the very specific rules that nature has developed for the mutual recognition of nucleic acids (these interactions also being
f
9
j,,p Q,.,,,,~, ~
li i
i
, DNA~ . ~, N
',,, g i
i
SI''B.,,,Q,~
\
l
>
)
Q
DNA I
,
./"
-...~.,~ m-RNA
Protein
.-H~N o9
~
IT N
"
N~C. 1'
. . . . N.~" , , , , ~~_~l N
H'" O
H~NtH.....
~C-1'
I C N"O'" "H'~N~H Figure 1. (A) General principle of antisense inhibition of protein expression: Binding of an antisense oligonucleotide to a complementary region on a target mRNA suppresses translation and thus prevents synthesis of the corresponding target protein. (Figure adapted from Moser, H. In Perspectives in Medicinal Chemistry; Testa, B.; Kyburz, E.; Fuhrer, W.; Giger, R.; Eds.; Verlag Helvetica Chimica Acta: 1993, p. 279.) (B) Recognition of nucleic acids by Watson-Crick hydrogen-bonding: A(denosine) pairs with T(hymidine) and G(uanosine) pairs with C(ytidine).
Antisense- and Antigene-BasedDrug Design
231
among the strongest known in biological chemistry) (Figure 1B), 12 in theory the use of AS-ODNs should allow for the elimination of any given protein from the cell in a very specific manner as long as the mRNA sequence for the target protein is known and the target base sequence on this RNA is unique for the entire RNA population of the cell. On a purely statistical basis, any particular RNA sequence longer than 18 bases can be expected to occur only once throughout the entire human genome, and oligonucleotides containing at least 18 nucleotide units should therefore suffice to achieve specificity. 1 In practical terms, very high specificity might even be achievable with shorter oligonucleotides (as long as they display high enough RNA binding affinity), since large parts of a mRNA molecule are rendered inaccessible for binding of an AS-ODN due to extensive secondary structure formation. 1-8 The potential for exquisite specificity in the inhibition of protein expression (and thus protein function) represents the most attractive feature of antisense-based drug development strategies and constitutes the most important single advantage of the antisense approach over traditional medicinal chemistry approaches directed towards the inhibition of protein function. Tight complexes between nucleic acids may not only be formed by interactions between single-stranded DNA or RNA molecules via Watson-Crick base pairing, but under certain circumstances oligonucleotides can also bind to double-stranded DNA, i.e. Watson-Crick double helices, in a sequence-specific fashion, leading to the formation of triple helices or triplexes (Figure 2A). 4'13-15For the most important pyr-pur-pyr structural motif binding of a third strand requires one strand of the DNA/DNA duplex to incorporate a large majority of purine nucleotides, and recognition occurs via Hoogsten base pairing between T's and (protonated) C's in the third strand to A's and G's, respectively, in the polypurine strand of the double helical component (Figure 2B). The binding of the polypyrimidine third strand occurs parallel to the polypurine strand of the double helix (Figure 2A). The practical applicability of the triplex approach for drug design is currently still limited by the requirement for polypurine tracts within genomic DNA regions, but examples do exist in the literature where triplex-forming oligonucleotides have been used to specifically block transcription in vitro;4"16-23furthermore, attempts have been made to extend the triplex alphabet by the design of non-natural nucleic acid bases that may eventually allow the design of oligonucleotides capable of binding to DNA/DNA double helices of any given base sequence. 24-28
B. Mechanism of Action of Antisense Oligonucleotides There are two different basic mechanisms by which the binding of an AS-ODN to a target mRNA can lead to inhibition of protein expression, namely physical blockage of a variety of processes involved in the sequence of events leading from DNA to protein, or RNAse H-mediated RNA degradation (Figure 3). 1-7 In the former case, binding of the AS-ODN, e.g., in the vicinity of the AUG start codon,
232
KARL-HEINZALTMANN, DORIANO FABBRO, and THOMAS GEIGER
WATSON-CRICK HYDROGENBOND DOUBLE-S~F.D DNA
MAJORGROOVE
t. .::::,::-" 5" 3'
,,C-1' 9 9
H
H-~I~
H
O
H
H
.
"
"0
O""
I ~ NI TT ~ O~H .....- ',,,~N (~-1'
~C-I'
" ~
H~ ~H"'"" ~ N ~ c ' I ' N
~CZ ~,
,.I~G I
N"'"
C-1'
0-
I
...."H~N~H
Figure 2. (A) Schematic representation of triple helix formation. The polypyrimidine third strand is bound in the major groove of double-stranded DNA via Hoogsteen base pairing. The orientation of the third strand is parallel to the poly-purine strand of the DNA/DNA duplex. (B) Recognition of AT and GC base pairs in double-stranded DNA by T and (protonated) C, respectively, via Hoogsteen hydrogen bonds.
blookedtranm~lptlon 5'Me
'ill I 3' ~ 5 ' blocked spiking
onzyrr~tlc 3'
enzymatic attack
I
attack by rlbozyme8 ~ ' ~
.oo
5'
os-
~~ffexprt attackby ribozymes
bindinglit CA~Por Inltlatlonsltea 5'Me ,
~I~NI..~ ~ N I - ~ 5,Me~ ~ ~ ~ r ~
&AAA
block ribosomeassemblyor initiation
dbosomemigrationblocked
2
NH2
I~roteinfunktion blodmd by binding of nuoleioacid
Figure 3. Possible points of interference of antisense and antigene oligonucleotides with protein expression. Note that the binding of antisense oligonucleotides to single-stranded mRNA may lead to suppression of protein synthesis either by physical blockage or by RNAse H-mediated degradation of bound RNA. (From Murray, J. A. H.; Crockett, N. In Antisense DNA and RNA; Murray, J. A. H., Ed.; Wiley-Lyss: 1992, p. 21.) 233
234
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
may prevent binding of initiation factors or the assembly of ribosomal subunits by a steric effect. The latter mechanism, on the other hand, involves degradation of the RNA strand of the DNA/RNA duplex formed upon binding of the AS-ODN to its RNA target sequence by the endogenous RNAse H enzyme(s). It would appear that due to its irreversible and catalytic nature, RNA cleavage should be the most efficient mechanism of AS-ODN-mediated inhibition of protein expression and it has in fact been demonstrated in a variety of cases that potent inhibition of translation by AS-ODNs depends on RNAse H-mediated destruction of the target RNA. 29-36 It should be noted, however, that specific RNA degradation conceivably could also be induced by AS-ODNs equipped with an appropriate (synthetic) chemical cleaver moiety, and successful attempts to design such cleaver moieties have been recently reported in the literature (although no cell culture or in vivo data are yet available for such cleaver-oligonucleotide conjugates). 37'38 The activation of RNAse L (a single-stranded ribonuclease) by 2'-5'-oligoadenylates attached to an antisense oligonucleotide via an appropriate spacer group has been demonstrated to lead to RNA cleavage only in the vicinity of the bound oligonucleotide. 39'4~An antisense oligonucleotide of this type was also shown to be a potent inhibitor of the expression of the double-stranded RNA-dependent protein kinase PKR in HeLa cells, 4~ resulting in the unresponsiveness of these cells to activation of nuclear factor-~cB (NF-nB) by poly(I):Poly(C). Obviously, any inhibitory effect of triplex-forming oligonucleotides on gene transcription must depend on the physical blockage of transcription factor or RNA polymerase binding, or, alternatively, on the presence of an artificial (ds) DNA cleaving agent delivered with the antigene oligonucleotide. Although such modified oligonucleotides have been used in model systems to cleave double-stranded DNA, 14'41'42 experiments involving animals have not been reported for triplexforming oligonucleotides in conjunction with either type of mechanism.
C. Chemical Modifications of Antisense Oligonucleotides For the basic concepts outlined in the previous discussion to be transformed into a viable drug design and drug development strategy, it is clear that an antisense or antigene oligonucleotide has to fulfill a number of requirements; failure to meet any single one most likely will abolish, or at least severely limit, its therapeutic utility. 1. The oligonucleotide has to exhibit a reasonable metabolic stability in a physiological environment. 2. It has to bind to its target RNA (or double-stranded DNA) with high affinity and specificity. 3. It must be taken up by the target cells and tissues at a reasonable rate and to a reasonable extent. 4. It has to show appropriate pharmacokinetic and pharmacodynamic behavior.
Antisense- and Antigene-BasedDrug Design
235
Natural oligonucleotides (i.e. short pieces of single-stranded DNA based on a phosphodiester backbone) are very rapidly degraded under physiological conditions by the action of single-stranded nucleases (primarily 3'-exonucleases) and therefore are not suitable for applications in vivo. ~-7 It is for this reason that extensive efforts have been made over the past few years to design and synthesize chemically modified oligonucleotides or oligonucleotide analogues which would exhibit improved nuclease resistance, but retain the ability to bind to complementary RNA with high affinity and specificity (Figure 4). 43--46 From these studies a number of sugar, base, and backbone modifications have emerged, some of which dramatically increase the stability of oligonucleotides against nucleolytic degradation and/or make them tighter binders to RNA than natural DNA itself. It should be noted that the affinity of oligonucleotides for complementary RNA and especially for double-stranded DNA may be improved by simple conjugation with intercalating groups, an approach that has been extensively followed by H61~ne and coworkers in the design of antigene oligonucleotides. 4'47 On the other hand, several affinity-enhancing modifications of the sugar or base moiety do not lead to improved nuclease resistance, and their favorable binding properties can only be exploited in combination with stabilizing backbone modifications (e.g. a phosphorothioate backbone). 33'48 One of the major shortcomings of almost all the chemical modifications of oligonucleotides reported to date is their inability to activate RNAse H, i.e. the corresponding DNA/RNA duplexes do not serve as RNAse H substrates. 1-7'29'31-33 In fact, so far phosphorothioates are the only class of modified oligonucleotides with very favorable nuclease resistance, sufficiently tight binding to RNA, and the ability to elicit RNAse H cleavage of bound RNA. However, strategies have been devised to overcome this problem of lack of RNAse H activation; these involve the design of chimeric oligonucleotides containing non-RNAse H activating (but possibly RNA binding affinity enhancing) modifications only in the terminal parts of the sequence ("wings"), while the central part ("gap") is based on a (2'-deoxyribose) phosphorothioate backbone. 32'49'5~The part of the bound RNA located across the 2'-deoxy phosphorothioate section of the AS-ODN in the oligonucleotide/RNA duplex is then still susceptible to RNAse H cleavage. The feasibility of this strategy has been impressively demonstrated by Monia et al. in in vitro studies on the inhibition of the H-ras oncogene in T 24 cells. 32'36 It is not only for this reason, however, but also for reasons of synthetic accessibility of phosphorothioates that this class of compounds has been most extensively studied for antisense effects in vitro and, more recently, also in vivo. There are now many examples in the literature where phosphorothioates have proven to act as very potent and specific inhibitors of gene expression, 1-7'29-33'51 but it also has to be noted that this first generation of potential antisense drugs still suffers from a variety of problems associated with it. Due to chirality on phosphorus and the generally stereo-random mode of their synthesis, phosphorothioates are mixtures of 2 n diastereoisomers (where n denotes the number of phosphorothioate
""6
"~0
~0
~,0
o/~
in
co
__./
o,,
o-~'~
,,__.~.~o,,,
w <
o
e-
8
= e-
"r
x
>,
0 o
~
it)
(o
:~ ~:~
E
6
,o ~
m
m
9
o
...J
o ~ ~
e4
~
.
-r
~~_,, ,
--
c~
._
E
6,
>
~
z
~o,,,
CO
%-z-- r- o
'
III
,__~-~o,,, _c Z rr
'~"0
"~'0
"~o
m
w
~ ~
uJ
.~
~ m--7...... ~
o
w (o
r,/'j m' 7 " - ~
w
ON
o.
u o
._o e-
II)
,- ,-
-r
,,.
~:
-r
"r
~
.~
o
.c
-O0
i
< Z rr
>
"r
E::~. 9 m
.~
"a
~ o
e-
:= Q" Q~
oe -
z:
0
.o=
Q)
~ E
~
~8
ul
LU m
o\-~
0
o
N
m
/
2-~
< m.--/~
0
h -~
-', ',0 ~.a,,
~
0
0,,
\J-~--O
d
I
~ "
/
236
C
2-minoadenine
5-propyny luracil
5'-thiazolyluracil
RNA-Affinity:
H73
VH74
VH75
Stability:
L
L3'
NR
Figure 4. Selected types of chemical modifications of oligonucleotides. (A) Modifications of the ribose moiety. (B) Backbone modifications. (C)Base modifications. "RNA-Affinity" refers to the binding affinity of the corresponding modified oligonucleotides for complementary single-stranded RNA. "Stability" refers to nuclease resistance. H = high; VH = very high; M = medium; L = low; V = variable, i. e. there is a strong sequence dependence; NR = not reported.
238
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
groups; e.g. for a fully modified 20-mer phosphorothioate there are 524,288 possible isomers). It should be mentioned, however, that regulatory institutions have accepted this situation and in most cases have raised no objections to the use of these diastereomeric mixtures in clinical trials. Furthermore, phosphorothioates certainly display suboptimal affinity for complementary RNA, with the duplexes between phosphorothioate oligonucleotides and RNA being less stable than the corresponding duplexes incorporating an unmodified DNA strand. 43'52 However, the major drawback in the use of phosphorothioates for therapeutic purposes may consist in a certain potential for toxic side effects due to unspecific protein binding, which is a general and characteristic phenomenon for this class of oligonucleotide analogues. 53-58 Phosphorothioates bind to serum albumin with an apparent affinity that is in the same range as that of clinically used drugs such as aspirin and penicillin. As indicated above, new generations of modified oligonucleotides are now available which have higher affinity for target RNA than phosphorothioates or even natural DNA, and which also do not inevitably depend on the presence of phosphorothioate groups for nuclease resistance. Even if complete elimination of sulfur may presently be difficult to sustain because of the RNAse H-dependent mechanism of action of many active AS-ODNs (see above), it should nevertheless be possible in the immediate future to evaluate nuclease resistant high-affinity oligonucleotides with reduced sulfur content for biological potency in vitro and in vivo.
D. Cellular Uptake of Antisense Oligonucleotides Given the state of research on chemically modified oligonucleotides with improved RNA binding affinity and nuclease resistance, our understanding of the cellular uptake of oligonucleotides and especially our ability to favorably influence the uptake of antisense oligonucleotides into cells, as well as to control their intracellular distribution, may still be considered to rest in its infancy. The solution to this problem (although there may not be a single and general solution) may well represent the ultimate challenge for a successful general implementation of the antisense strategy in a wide variety of therapeutic areas. Indications exist in the literature that certain cell types possess specific cellular receptor proteins for oligonucleotides which mediate oligonucleotide internalization by an endocytotic mechanism. 76'77 On the other hand, there are numerous examples where oligonucleotides (e.g. phosphorothioates) are not at all taken up by cells from the medium efficiently, as judged by the complete lack of observable biological activity (i.e. downregulation of target RNA or protein). Alternatively, oligonucleotides after cellular uptake may be trapped in endosomal vesicles and thus not be available for intracellular binding to their target mRNA. 78 Cellular uptake of antisense oligonucleotides and the associated biological activities can be improved to a dramatic extent by the use of cationic lipids (e.g.
Antisense- and Antigene-BasedDrug Design
239
DOTAP, DOTMA) as uptake mediators. 79'8~Cellular uptake of oligonucleotides is highly cell-type specific and optimization of uptake properties for certain cell lines does not necessarily lead to improved uptake in others. Improvement of oligonucleotide internalization has been reported for cholesterol 81'82 and polylysine 83 conjugates of oligonucleotides, for oligonucleotide-transferrin conjugates 84 (involving binding to the transferrin receptor), and for oligonucleotides encapsulated in liposomes, 85-87 but it is unclear how generalizable these results are, and especially whether they can be extrapolated to in vivo experiments. As indicated above, in vitro cell culture experiments are often conducted in the presence of cationic lipids which (generally) greatly enhance oligonucleotide uptake and thus allow for the potency of various oligonucleotides to be assessed outside of the limitations imposed by insufficient cellular uptake. In this way, active sequences can be identified in a rather straightforward fashion, but the question remains whether the same efficacy can be achieved in vivo by simple i.v. or i.p. administration of the same oligonucleotide, even if nuclease resistance is not an issue. The question of cellular uptake of oligonucleotides is further complicated by the fact that the effects of cationic lipids themselves are highly cell-type specific, thus leading to variable results between different cell lines.
III. ANTISENSE OLIGONUCLEOTIDES AS ANTICANCER AGENTS A. Potential Targets in Antisense-Based Cancer Therapy In the past decade, major progress has been made in understanding the molecular basis of the pathophysiology of cancer. The unrestricted proliferation of cells is now perceived to be the result of the activation of oncogenes or the loss of tumor suppressors, both of which confer a selective growth advantage to cancer cells. Oncogene activation itself in most cases is the consequence of structural alterations in the chromosomal organization of the affected cells, such as amplification of genes, translocations, or point mutations. 88-91The consequences of these alterations are either the deregulated expression of structurally normal oncogene products, or the expression of an abnormal oncogene (point mutations and translocations that alter the affected oncogene). Many of the genes that are mutated or lost in cancer cells, including both the oncogenes and tumor suppressors, encode proteins that are crucial regulators in various signal transduction pathways, like growth factors and their receptors, GTP-binding proteins, transcription factors, adhesion molecules, angiogenic factors, or tumor suppressor genes such as p53 and Rb. Almost every extracellular signal transduced either by receptor-activated tyrosine phosphorylations or by receptor coupling to trimeric GTP-binding proteins is amplified and diversified inside cells by protein kinase cascades. The constituent protein kinases building up these highly conserved networks are important players in propagating, integrating, and delivering incoming mitogenic stimuli to the
240
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
cell-cycle regulators. Mutant alleles of these protein kinase genes or of oncogenic ras as well as the anti-oncogene p53 or Rb affect these protein kinase cascades. This perturbs the entire signaling network, leading to the deregulation of both transient processes such as changes in cell shape or motility, or less reversible processes such as cell differentiation, division, and programmed cell death (apoptosis). Thus, the multistage carcinogenic process, which ultimately leads to a clinically identifiable tumor mass, can be conceptualized as a multistep and progressive disordering of the signal transduction processes inside the cell, with the set of genes responsible for the deregulation of mitogenic signaling most likely being involved in the rate-limiting steps in cellular tumor growth. Based on these concepts it is clear that the selective inhibition of deregulated oncogene products (e.g. a variety of protein kinases involved in signal transduction) or the restoration of function of mutated tumor suppressors should result in antitumor activity. In contrast to classical antitumor chemotherapy, such a molecular approach to the growth inhibition of tumor cells may be expected to yield highly efficacious growth inhibitors with superior tolerability as compared to standard antineoplastic agents. Although the specific inhibition of oncogene product function may in principle also be accomplishable by appropriate small molecules (e.g. highly specific protein kinase inhibitors), it is obvious from the above discussions that antisense technology is ideally suited to neutralize mutated or deregulated oncogenes in neoplastic cells, since it offers the unique opportunity to knock out target genes by a highly specific mechanism. It is therefore reasonable to expect that antisense-based anticancer agents should be devoid of the undesired side effects associated with classical anticancer chemotherapy; however, it has to be kept in mind that other types of toxicities may surface for antisense or antigene oligonucleotides, which may also depend on the exact chemical nature of the (modified) oligonucleotide in question, and which are not predictable at this stage. A great variety of nuclear factors and oncogenes have been targeted by antisense oligonucleotides or antisense vector constructs in cell culture studies, including the transcription factors c-myc, 92-97 c-myb, 98-103 c-fos, 104-106 c-jun, ~~ and NF-KB, 107-109and additional nuclear factors such as p 120 nucleolar antigen ll~ or components of the cell cycle machinery like PCNA lll'll2 and cdc2.113'114 In addition, various growth factors and their receptors 115-124as well as growth-related kinases involved in cellular signal transduction have been chosen as targets for antisense approaches, including protein kinase C, 125-127 protein kinase A subunits, 122'128'129tyrosine kinases, 13~ and c-raf. 51'138-141. Also oncogenes like Ha-ras, 31'32 K-ras, 142'143 and N-ras, 144 as well as tumor suppressors like p53, have been targeted. In many cases, inhibition of protein synthesis and/or downregulation of the targeted mRNA have been observed even at submicromolar oligonucleotide concentration (especially with nuclease-resistant phosphorothioates), and several of these studies have additionally demonstrated pronounced anti-proliferative effects of AS-ODNs in cell culture experiments. These studies have recently been excellently reviewed by Pierga and Magdalenat 145and their arguments will not be
Antisense- and Antigene-Based Drug Design
241
reiterated here in any detail. Rather, the following sections will focus on some examples of relevant studies in animal models, involving either ex vivo treatment of affected cells by A S - O D N s and subsequent reimplantation, or systemic applications of A S - O D N s (Table 1). Potential therapeutic applications of A S - O D N s in oncology have only recently been conceived, but the increasing interest in antisense technology in the treatment of cancer and neoplastic diseases is reflected by a growing list of review articles in the international literature that cover this exploding field. 145-157
Targets Related to Hematological Malignancies The most suitable target genes (respectively the corresponding m R N A s ) for A S - O D N s are those that are exclusively or at least preferentially expressed in malignant cells, but are not (or only at strongly reduced levels) in normal nontransformed cells. M a n y malignant diseases of the hematologic and lymphatic systems
Table 1. Inhibition of Oncology Targets in'Animals by Antisense Oligonucleotides Target Protein
Indication TargetRegion
bcr-abl cdc2 PCNA c-myb c-myb
CML restenosis restenosis AML/CML cancer
cyclin B 1 bcl-2
restenosis B-cell lymphoma cancer cancer
Ha-ras Ha-ras TGF-t~ EGF receptor NF-~B, p65 NF-~cB, p65 ICAM- 1 p 120 PKCtx, murine PKC-ct, human c-raf basic FGF PKA, RIt~
cancer cancer cancer cancer melanoma metastasis cancer cancer cancer cancer Kaposi's sarcoma cancer
OligoModification
Concept Reference Validation Number
breakpoint AUG AUG AUG 5'-UTR, coding AUG AUG
26-mer,P"-S 18-mer, P=O 18-mer, P--O 21-mer, P=S 20-mer, P--S
+ + + +
169 225 225 170 230
18-mer, P--O 20-mer, P--O P=S cap
-
114 177
5'-UTR coding (codon 12) AUG AUG AUG AUG 3'-UTR
15-mer, P--O 13-mer, P--O, absorbed to nanoparticles 39-mer, P=O P--S cap 39-mer, P=O P---S cap 24-mer, P=S 20-mer, P--S 20-mer, P--'S
3'-UTR AUG 3'-UTR 3'-UTR AUG
20-mer, P'-S 20-mer, P--S 20-mer, P=S 20-mer, P-'S 24-mer, P--S
110 30 165 62 229
AUG
18-mer, P=S
168
179 180 + -
227 227 107 228 181
242
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
fulfill these requirements and can therefore be considered as ideal targets for antisense approaches. The bcr-abl fusion protein is typically found in patients with a Philadelphia chromosome-positive leukemic disease. At the molecular level the abl proto-oncogene is translocated from the long arm of chromosome 9 onto the bcr gene on chromosome 22 to form a hybrid bcr-abl fusion gene that is expressed as the fusion protein p210 bcr-abl. This chromosomal translocation is the hallmark of chronic myelogenous leukemia (CML), 158but was also detected later in a cohort of Philadelphia-positive acute lymphocytic leukemia patients (ALL). 159The hybrid p210 bcr-abl protein has deregulated tyrosine kinase activity and is therefore important for the pathogenesis and progression of CML. The characteristic of CML is a clonal disorder of the hematopoietic stem cell system, which evolves in two different phases, a chronic phase and the acute blast crisis. The chronic phase of CML is characterized by an increase in immature and mature hematopoietic stem cells in the peripheral blood and in the bone marrow. The subsequent CML blast crisis involves a marked degree of differentiation arrest of leukemic cells in the peripheral blood and bone marrow, and due to the fact that the blasts are refractory to any of the established therapeutic regimens, ultimately leads to death. Philadelphia chromosome-positive CML blast cells have been targeted both in vitro and in vivo with antisense ODNs against the bcr-abl fusion region. 16~ Inhibition of cell proliferation has also been achieved by treatment of leukemia cells with a bcl-abl-specific ribozyme, which resulted in specific cleavage of bcr-abl mRNA at the targeted site. 166'167The tendency to form blast colonies in vitro was inhibited 80-90% by unmodified AS-ODNs (15-30 ~tM) compared to cells treated with control oligonucleotides. TM This study used a mismatched control oligonucleotide and it was demonstrated that the introduction of mismatches into the antisense sequence inhibited the specific effect of the antisense sequence on blast cell colony formation. Furthermore, it was also shown that if normal bone marrow and blast cells were mixed, exposed to the oligonucleotide, and assayed for residual colony formation, the majority of residual cells consisted largely of differentiated cells suggesting the selective elimination of leukemic blast cells. 161'168 In another study, the CML blast crisis cell line BV173 was injected into SCID mice where a disease process developed that closely resembled that observed in leukemic patients with blast crisis. 169 One to three weeks after injection of 106 BV 173 cells into mice, bcr-abl transcripts were detected in the bone marrow, blood, spleen, liver, and lungs. Systemic treatment of the leukemic mice with a 26-mer bcr-abl AS-ODN for 9 days (from day 7 or day 21 after tumor inoculation) led to a marked decrease in bcr-abl transcripts and reduced the number of leukemic cells. AS-ODNs, but not sense or mismatched controls, prolonged the survival of the BV173-injected mice from 8-13 weeks to 18-23 weeks. This study provided compelling evidence for the in vivo effectiveness of anticancer therapy based on antisense ODNs targeting a tumor-specific gene. In addition, bcr-abl antisense oligodeoxynucleotides in combination with a low dose of mafosfamide drastically reduced clonogenicity and growth of BV173 cells in nude mice, in a 1:1 mixture
Antisense- and Antigene-Based Drug Design
243
with normal bone marrow. 168Such combination treatment was by far more effective in the elimination of tumor cells than a high dose mafosfamide treatment, and spared much higher numbers of normal progenitors. This experiment demonstrated that AS-ODNs could potentially be used as nontoxic and highly effective agents for ex vivo bone marrow purging in autologous bone marrow transplantation to eliminate leukemia cells specifically. The c-myb proto-oncogene encodes proteins that have been shown to be important for hematopoietic cell proliferation. In vivo treatment of human leukemia SCID mouse chimeras that had been inoculated with the human K562 leukemia cell line with c-myb antisense phosphorothioate ODNs by osmotic minipumps at a dose of 5 mg/kg body weight significantly prolonged the survival of the mice. 17~ Once inoculated leukemic blast cells were detected, the survival of untreated mice or mice treated with control ODNs was only 6 + 3 days, whereas the mice that were treated with AS-ODNs to c-myb survived 3 to 8 times longer. In addition, the AS-ODN treated mice had significantly less leukemic cell infiltration in the central nervous system and the ovary, the two sites that show manifestation of disease most frequently. Another important gene fusion event occurs after the translocation t(15;17) in acute promyelocytic leukemia. This translocation involves the gene for the retinoic acid receptor-c~ and a gene designated PML. Burkitt's lymphoma is a B-cell malignancy characterized by the chromosomal translocation t(8:14). This translocation is found in 90% of all cases and juxtaposes c-myc and immunoglobulin heavy-chain genes. These fusion proteins are only found in malignant cells, to which they confer a growth advantage, and although no antisense work has been reported on those targets they should be ideally suited for inhibition with AS-ODNs. Problematic side effects of such a therapy due to the elimination of these proteins in normal cells is unlikely, as is the development of resistance if the presence of the fusion protein is necessary for the persistence of tumor growth. Another potential therapeutic target that has been examined for the treatment of acute myeloid leukemia is p53, the most frequently mutated gene in cancer cells. 171' 172 p53 is known to be a tumor suppressor gene that is mutated in leukemic cells and consequently leads to a transformed phenotype by endowing the leukemic cells with a selective growth advantage. The p53 AS-ODN treatment resulted in a drastic decrease in viable leukemia blast cells. The aberrant expression of protooncogenes in tumor cells can also be caused by another recognizable mechanism of gene activation--gene amplification. A 20--40fold amplification of the c-myc gene has been observed in HL-60 promyelocytic leukemia cells. 173 Exposure of HL-60 cells to a phosphodiester oligonucleotide designed to hybridize to the translational start codon of c-myc, in a dose-dependent manner, inhibited c-myc expression and proliferation of HL-60 cells by inhibition of S-phase entry, 174 whereas various control oligonucleotides with unrelated sequences had no effects. These results demonstrate that the growth advantage that c-myc overexpression confers to HL-60 cells can be eliminated by inhibiting
244
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
overexpression of the oncogene. An 18-mer AS-ODN complementary to codons 2 to 7 of c-myb mRNA inhibited c-myb RNA and protein expression in myelogenous leukemia cell lines and primary leukemia cells obtained from patients. 98 The downregulation of c-myb expression was accompanied by inhibition of proliferation of the leukemic cell lines and by inhibition of clonogenic growth in freshly obtained leukemia cells. However, in contrast to c-myc, inhibition of c-myb expression in HL-60 cells was not accompanied by the induction of terminal differentiation, suggesting that c-myc and c-myb regulate leukemia cell proliferation and differentiation at different levels. The Wilms tumor gene (WT1) has been recently targeted with antisense oligonucleotides in leukemia cells and inhibition of proliferation and induction of programmed cell death was observed. 175'176These data indicate that the Wilms tumor gene plays an important role in leukemogenesis and therefore should represent an attractive target for the treatment of leukemia with antisense oligonucleotides.
Targets Related to Solid Tumors The activation of oncogenes that confer a growth advantage to the tumor cell is also an important mechanism in solid tumors. In vitro treatment of a B-cell lymphoma cell line that had a bcl-2 translocation with AS-ODNs directed to the translational start codon of the bcl-2 mRNA before injection into SCID mice resulted in a reduction in bcl-2 expression and prevented the establishment of lymphoma disease in the mice, whereas sense and nonsense control oligonucleotides were without effect. 177 AS-ODNs have been targeted to the p65 subunit of NF-~B, which is implicated in the induction of adhesion molecule expression. In this very elegant study, AS-ODNs were shown to inhibit the tumorigenicity of a fibrosarcoma cell line in vivo and led to tumor regression in nude mice. 1~ In this particular study, the mechanism of action of the AS-ODNs was explicitly verified (i.e. the antisense concept was validated) by means of control oligonucleotides that were without effect, and by the use of tumor cells transfected with a dexamethasone-inducible antisense construct. The effect of the inducible antisense construct in inhibiting in vivo tumor growth was comparable to the effect of systemically administered oligonucleotides. In another study, NF-r,B Rel A expression could be successfully inhibited by phosphorothioate antisense oligonucleotides resulting in the suppression of urokinase-type plasminogen activator (uPA) but not of its inhibitor PAI- 1. These findings indicate that Rel A may play an important role in tumor spread and metastasis. 178 In follicular lymphomas, the bcl-2 gene is overexpressed due to its juxtaposition to immunoglobulin heavy-chain sequences as a result of a t(14; 18) translocation. Since bcl-2 inhibits programmed cell death, the elimination of its aberrant expression in these lymphomas could potentially lead to tumor regression. The design of a tumor-specific oligonucleotide targeting the region of bcl-2 that is juxtaposed to immunoglobulin sequences should be achievable as in the case of oligonucleotides that target the bcr-abl fusion gene in CML.
Antisense- and Antigene-BasedDrug Design
245
Oligonucleotides against the nucleolar antigen p120 were shown to inhibit the growth and tumorigenesis of human melanoma cells (LOX) injected i.p. into nude mice. 11~ In this study, the oligonucleotides were injected i.p. into tumor-beating mice at days 1, 3, and 5 after inoculation in the presence of cationic lipids. This study represents the first report showing enhancement of antisense effects by cationic lipids in vivo in an animal model. The ras oncogene is one of the most frequently mutated oncogenes in several different types of tumors. In vitro treatment of Ha-ras transformed NIH3T3 cells with AS-ODNs to the 5'-flanking region of the ras mRNA for 3 consecutive days (50 ktM) resulted in more than 90% reduction in Ha-ras levels. 179When these cells were implanted into nude mice, tumor growth of the AS-ODN treated cells was dramatically reduced for up to 14 days, compared to cells treated with nonspecific control ODNs. The treatment of transformed cells with Ha-ras AS-ODNs reversed the transformed phenotype and this reversal of transformation was a long-lasting effect after termination of the AS-ODN treatment. Oligonucleotides directed to the codon 12 point mutation of Ha-ras selectively inhibited the proliferation of cells expressing the mutated Ha-ras. 18~This study used phosphodiester ODNs which are rapidly degraded by nucleases. To increase their nuclease resistance, the ODNs were absorbed onto polyalkylcyanoacrylate nanoparticles, which resulted in a 100-fold increase in potency compared to free ODNs. When cells expressing mutated Ha-ras were implanted into nude mice, they formed ras-dependent tumors and AS-ODNs absorbed to nanoparticles were also capable of inhibiting tumor growth in vivo. In this study 18~it was demonstrated that inhibition ofras oncogene can block tumor development even though ras oncogenic activation is probably an early event in tumor progression. In addition, the stability and cellular activity of phosphodiester oligonucleotides was shown to be dramatically improved by absorption of the oligonucleotide onto polyalkylcyanoacrylate nanoparticles. Cytokine treatment (TNF-o~ and IFN-T) of human metastatic melanoma cells (C8161) increased the formation of lung metastasis in nude mice up to fourfold. 181 Treatment of C8161 cells in vitro with AS-ODNs to the cell adhesion protein ICAM-1 inhibited ICAM-1 expression > 90% and inhibited metastasis formation in vivo, indicating that ICAM- 1 is involved in melanoma cell metastasis formation. Osteopontin is a secreted, calcium-binding phosphoprotein that frequently has been associated with the transformed phenotype. Antisense inhibition of osteopontin expression in murine PAP2 cells, a metastatic ras-transformed NIH3T3 cell line, reduced the tumorigenic and metastatic properties of tumors in vivo, thus demonstrating that osteopontin is involved in tumorigenesis. ~82 The regulatory subunits of protein kinase A, RI, and RII have been implicated in tumor growth. RI is a growth-stimulatory protein, whereas RII is a growth inhibitory and differentiation-inducing protein. 154Rltx is presumably responsible for the neoplastic cell growth of human colon, breast, gastric cancer, and neuroblastoma cells. 154'183Exposure of the cell lines to a 21-mer phosphorothioate oligonucleotide
246
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
to human Rloc exhibited growth inhibition with an IC50 of 6 lxM without signs of toxicity. Oligonucleotide treatment was correlated with a decrease in RIo~ mRNA and protein suppression and a concomitant increase in RIII3 expression. 183 The erbB2 oncogene (also called neu and Her-2) codes for a 185-kDa transmembrane growth factor receptor with an intracellular tyrosine kinase catalytic domain. 184'185The erbB2 gene copy number is amplified in many adenocarcinomas; erbB-2 is also amplified and overexpressed in approximately 25% of human breast carcinoma samples. Amplification and overexpression oferbB2 in malignant breast tumors has been correlated with nodal metastases, early relapse, and shortened survival. 186 erbB2 antisense phosphodiester oligonucleotides were used to inhibit the growth and DNA synthesis of breast cancer cell lines 184with an amplified erbB2 gene, and this growth inhibition was accompanied by a dose-dependent inhibition of erbB2 expression, as measured by immunohistochemistry. Control sense oligonucleotides did not inhibit cellular proliferation at the same concentration, but showed inhibitory effects at much higher concentration. There was no effect of erbB2 oligonucleotides on breast cancer cell lines that had no amplification of erbB2, indicating that the erbB2 overexpression is important for the proliferation of breast cancer cells that have been selected for erbB2 amplification. Malignant melanomas, unlike normal melanocytes, can proliferate in the absence of exogenous basic fibroblast growth factor. Exposure of primary melanomas in the vertical growth phase and metastatic melanomas to unmodified AS-ODNs, targeted against 3 different sites of human bFGF mRNA, inhibited cell proliferation and colony formation in soft agar. 187 In addition, the human malignant melanoma cell line HTZ19 was demonstrated to be dependent on PDGF-AA as an autocrine growth factor. 188 Transfection of tumor cells with antisense constructs has been used to investigate the role of target proteins and oncogenes in tumorigenesis. Expression of antisense RNA to TGF-13 with a metallothionein promoter construct 189 reduced the anchorage-independent growth of murine mesothelioma cells in vitro and their tumorigenesis in vivo, but did not influence anchorage-dependent growth. Maximal reductions in TGF-I3 mRNA of 60 to 80% were achieved in this study. This finding suggests that very strong promoter systems have to be used for vector-based antisense inhibition of target genes in order to achieve the estimated required ratio of 1:20 between target mRNA and antisense RNA for efficient inhibition of gene expression. In another study, an antisense construct to the IGF-1 receptor ~9~was introduced into FO-1 human melanoma cells under the control of the HSP70 promoter. The expression of the antisense construct resulted in a marked reduction in the number of IGF-1 cell surface receptors, and the growth of the transfected cells implanted into nude mice was strongly inhibited or even abrogated. When tumors arose after long delay in nude mice, the tumor cells had often lost the expression plasmid and the IGF-1 receptor levels had returned to wild-type levels. The growth-inhibitory effect of vector-transfected cells in the mice in vivo was remarkable, because the
Antisense- and Antigene-BasedDrug Design
247
growth of FO-1 cells in monolayer culture was not affected by the expression of antisense RNA. Inhibition of tumorigenesis in this study was also observed when FO-1 cells were treated in vitro with synthetic AS-ODNs prior to the injection into nude mice. These results strongly indicate that this effect was due to antisense inhibition of IGF- 1 receptor expression. Urokinase plasminogen activator (uPA) and its surface receptor (PAR) have been shown to correlate strongly with an invasive tumor cell phenotype. A human malignant epidermoid carcinoma cell line (Hep3) was transfected with an antisense construct to PAR in a constitutive promoter construct. 191'192 The antisense clones showed 50-75% reduction in PAR mRNA and protein expression. The clones with the lowest PAR expression showed a significantly lower level of invasion (chorioallantoic membrane) and a drastically reduced tumorigenicity and local invasion in vivo. It was concluded therefore that diminished expression of surface PAR in tumor cells leads to a reduction in the invasiveness and an increase in tumor latency, which makes PAR an attractive target for inhibition by AS-ODNs in different tumor cell lines. Another target for AS-ODNs in solid tumors is. c-raf kinase, a kinase that is located downstream of Ras and upstream of Map kinase in the Map kinase signaling pathway. It has previously been demonstrated that transfection of the radiationresistant human squamous carcinoma cell line SW-20B with a c-raf-1 antisense construct significantly reduced the malignant potential, in comparison to cells containing a construct with a sense orientation. 193The raf antisense clones appeared to have an increased radiation sensitivity, indicating that reduced expression of raf kinase is sufficient to modulate both the tumorigenicity and the radiation phenotype of squamous carcinoma cells. In a recent study Monia et al. have reported the identification of a potent 20-mer phosphorothioate antisense oligonucleotide targeted to the 3'-UTR of human c-raf mRNA. In the presence of cationic lipids this oligonucleotide, CGP 69846ABSIS 5132, inhibits c-rafkinase expression in cancer cells in vitro with an IC50 below 100 nM, and also shows potent antitumor activity against a variety of human tumors subcutaneously transplanted into nude mice in the dose range of 0.006 to 6 mg/kg (Figure 5). 51 Employing analogues of CGP69846A/ISIS5132 incorporating an increasing number of mismatched bases, it was also demonstrated that the antitumor activity of this oligonucleotide is a highly sequence-specific phenomenon (Figure 6). 66b In combination with other data, especially the observed downregulation of c-raf mRNA levels in the tumors of CGP69846A/ISIS5132-treated animals, 51 this latter f i n d i n g s t r o n g l y s u g g e s t s that the p o t e n t a n t i t u m o r a c t i v i t y of CGP69846A/ISIS5132 is mediated by a true antisense mechanism of action involving RNAse H-mediated degradation of bound target mRNA. C G P 6 9 8 4 6 A / I S I S 5 1 3 2 has been modified by incorporation of 2'-0methoxyethyl modified building blocks (cf. Figure 4A), which has resulted in an analogue (CGP69845A) which in comparison to the 2'-deoxyphosphorothioate displays higher biological activity in vitro and is at least an equipotent inhibitor of
248
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
tumor growth in vivo. 66 CGP69845A may be considered as the prototype of a second-generation antisense oligonucleotide which exhibits a significantly reduced phosphorothioate content, and therefore may be less prone to side effects that are caused by the presence of phosphorothioate linkages. With regard to other targets involved in signal transduction, Dean et al. have recently described a 20-mer phosphorothioate oligonucleotide targeted to the 3'-UTR of human PKC-o~ mRNA (CGP64128A/ISIS3521). 127 As in the case of CGP69846A/ISIS5132, CGP64128A/ISIS3521 is a potent inhibitor of PKC-o~ expression in vitro and displays high antitumor activity against various human tumors transplanted into nude mice. 127 It should be noted that CGP64128A/ISIS3521 is a true isozyme-specific inhibitor of PKC-o~ expression and does not inhibit the expression of other PKC isozymes, i.e. PKC-~5,-E, -11, and _~.126 Downregulation of PKC-a expression in A549 tumors by CGP 64128A has also been demonstrated (J. Phillipps, unpublished observation, this laboratory).
0.8
CGP 69846A 0.7
~
--
~ _.~
0.6-
,
Control 0.006 mg/kg 0.06 mg/kg 0.6 mg/kg 6.0 mg/kg
0.50.4O
~'
0.3-
~
0.2-
0.1
--
0.0 8
I
I
I
I
I
I
10
12
14
16
18
20
22
days after tumor transplantation
Figure 5. Antitumor activity of CGP 69846A (A) and a scrambled control ODN (B) against A549 human lung carcinomas transplanted s.c. into nude mice. 51 A549 human lung carcinoma tumor fragments (25 mg) were implanted subcutaneously into nude mice at day_ 0. The tumors were allowed to grow until they reached a mean volume of 100 mm 3. CGP 69846A and a control ODN were injected i.v. once daily from day 9 to day 21 at doses of 6, 0.6, 0.06, and 0.006 mg/kg. Tumor growth was monitored twice weekly and tumor volumes were calculated.
Antisense- and Antigene-BasedDrug Design
249
The antitumor activity of CGP69846A and CGP64128A has also been studied in combination with standard chemotherapeutic agents (cisplatin, mitomycin-C, vinblastine, tamoxifen, 5-fluorouracil, adriamycin, and ifosfamide) against a variety of human tumors transplanted into nude mice (Figure 7). For most of the combinations studied, antitumor effects were essentially additive, but pronounced synergism was observed for the combination of CGP69846A/ISIS5132 as well as CGP64128A/ISIS3521 with mitomycin and cisplatin (Geiger et al., unpublished observations, this laboratory). For PC-3 human prostate carcinomas, treatment with CGP69846A/ISIS5132 in combination with cisplatin resulted in tumor cures. Both CGP69846A and CGP64128A are in development as anticancer agents and are presently in phase I clinical trials. The expression of the metalloproteinase matrilysin in human colon carcinoma cells (SW480, SW420) correlates with the ability to invade an artificial basement membrane in vitro and to metastasize to the liver following injection into the cecum of nude mice in vivo. 194 Reduction of matrilysin expression by AS-ODNs decreased tumorigenicity in vivo and inhibited subsequent metastasis to the liver, indicating
B
0.9-
Control ODN 0.8
-
0.7
-
Control --II-- 0.006 mg/kg 0.06 mg/kg 0.6 mg/kg 6.0 mg/kg
CO
E 0.6o
O
E 0.5O O
E 0.40.3
--
0.2
--
0.1
--
8
i
I
i
I
I
I
10
12
14
16
18
20
days after tumor transplantation Figure 5. (Continued)
22
250
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
that matrilysin is involved in tumorigenicity and metastasis of colon carcinoma cell lines. Inhibition of matrilysin expression by antisense oligonucleotides was also observed in BM314 colon cancer cells, resulting in inhibition of invasiveness in vitro. 195
Multidrug Resistance Emergence of drug-resistant tumors after chemotherapy is a persistent problem in the treatment of cancer. The most common and serious manifestation of this problem is the phenomenon of both acquired and intrinsic pleiotropic drug resistance or multidrug resistance (MDR). MDR is a complex system of biochemical
A
100 @ 5 mismatche,, ~' 4 mismatches
A 2
tO O O
80
60
v
<
Z hE
,A 3 mismatche,,
40
6 2 mismatche,,
20
"E) 1 mismatch 9 CGP 69846A I
I
I
I
I
I'"
I
0
200
400
600
800
1000
1200
Concentration of ODN (nM)
Figure 6. (A) Effects of a series of mismatched ODNs of CGP69846A on c-raf kinase mRNA expression in T24 human bladder carcinoma cells. T24 human bladder carcinoma cells were treated with increasing concentrations of CGP69846A and a series of mismatched ODNs in the presence of cationic lipids for 4 h. c-raf mRNA levels were determined 24 h later by Northern blotting. (B) Effects of CGP69846A and a series of mismatched ODNs on the growth of A549 tumors in vim. A549 human lung carcinomas were implanted subcutaneously into nude mice at day 0. CGP 69846A and the mismatched ODNs were injected i.v. once daily from day 12 to day 34 at a dose of 6 mg/kg. Tumor growth was monitored twice weekly and tumor volumes were calculated.
Antisense- and Antigene-BasedDrug Design
251
and genetic mechanisms and at least three major types of MDR have been described. The first type is mediated by the P-glycoprotein (Pgp), the second involves topoisomerase-II, and a third, more heterogeneous type of MDR, depends on mechanisms that are not mediated by Pgp. The latter include e.g. enhanced synthesis or altered drug affinity of dehydrofolate reductase and thymidylate synthase as well as overexpression of detoxifying enzymes such as glutathione S-transferase, glutathione peroxidase, and cytochrome P-450 mixed function oxidases. It should be emphasized that most of these mechanisms have been identified experimentally and that their clinical relevance is still poorly understood. To complicate matters further, all of these various forms of MDR may occur in different tumor types independently or in combination. 196-198
1.5 O h, H q'
0.75
O
Control CGP 69846A 1 mismatch 2 mismatches 3 mismatches 4 mismatches 5 mismatches
6 mg/kg
0.5 t~
E o
~
tl) N L_
O
E
0.25
0.15
0.1 0.075 I
I
I
I
I
12
19
26
31
35
days after tumor transplantation
Figure 6. (Continued)
252
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
1 -
O
0.75
,x
Placebo CGP69846A ADR C G P 6 9 8 4 6 A and A D R
0.5
O3
E
to
0.25
r
.N m t~ O
E
0.15 0.1 0.075 0.05
0.025
I
J
I
I
I
I
6
13
20
27
34
41
days after tumor transplantation
Figure 7. (A) Effect of CGP 69846A in combination with adriamycin on the growth of s.c. transplanted human melanoma SK-mel 3 in female Balb/c nude mice. Tumor fragments of approximately 25 mg were transplanted into the left flank of each female Balb/c nude mouse. Treatment was started on day 6 after tumor transplantation and end of treatment was on day 40. CGP 69846A was administered once daily (days 6-40) at a dose of 6.0 mg/kg i.v. as a single agent as well as in the combination group. Adriamycin (ADR) (9 mg/kg i.v.) was administered once weekly (days 6, 13, and 20) as a single agent as well as in the combination group. Mean tumor volume is given in cm 3 + S.D. (B) Effect of CGP 69846A in combination with cisplatin on the growth of s.c. transplanted human prostate carcinoma PC-3 in male Balb/c nude mice. Tumor fragments of 25 mg were transplanted into the left flank of each male Balb/c nude mouse. Treatment was started on day 12 after tumor transplantation and end of treatment was on day 32. CGP 69846A was administered once daily (days 12-32) at a dose of 6.0 mg/kg i.v. as a single agent as well as in the combination group. Cisplatin (CPT) 11 mg/kg i.v. was administered once weekly (days 12 and 19) as a single agent as well as in the combination group. Mean tumor volume is given in cm 3 + S.D
Antisense- and Antigene-BasedDrug Design
253
The type of MDR that is presently best understood is the one mediated by pgp,199-201 which depends on the overexpression of a plasma membrane-spanning surface glycoprotein of 170 kDa. This P-glycoprotein is encoded by the mdr- 1 gene and functions as an energy-dependent membrane-bound effiux pump for a broad variety of natural product anti-cancer agents like anthracyclins, vinca alkaloids, epipodophyllotoxins, actinomycin-D, colchicine, and taxol. Pgp-mediated MDR is characterized by decreased drug accumulation, by an increased drug effiux, and, at least for the anthracyclines, also by a decreased intranuclear concentration. Increased levels of Pgp expression after chemotherapy have been reported in neuroblastoma, sarcoma, breast carcinoma, ovarian cancer, nephroblastoma, and several hematological malignancies. 196'2~176 In addition, a correlation between Pgp expression in tumor specimen and treatment outcome has been described in neuroblastoma, childhood sarcoma, breast cancer, ovarian cancer, small cell lung cancer, and leukemia. 2~176 Although Pgp-mediated MDR may not be the only mechanism that is involved in all human cancers, and despite the fact that inhibition of Pgp may also lead to
1.5
-,-
o .']. -~-
1
0.75
P,acebo CGP69846A CPT CGP 69846A and CPT
0.5
~E O N L
o E
0.25 0.15 0.1 0.075 0.05
0.025 0.015 0.01
I
I
I
I
1-
12
19
22
26
33
days after tumor transplantation
Figure 7.
(Continued)
254
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
adverse effects due to interference with the normal physiological processes Pgp is involved in, the clinical feasibility to inhibit Pgp function by modulators has been considered an important aspect of postoperative cancer treatment. A significant problem with most resistance modulators, however, is the substantial toxicity occurring at doses that are required to build up plasma levels capable of reverting Pgp-mediated MDR. 2~176 AS-ODNs directed against the MDR gene (respectively the corresponding mRNA) may again offer a way out of this dilemma, because they can be expected to exert their inhibitory effects much more selectively than classical modulators. However, surprisingly little work has been reported in the literature on attempts to revert MDR by means of AS-ODNs. Oligonucleotides against the MDR1 gene decreased the expression of Pgp in human mesangial cells and decreased the effiux of drugs that are actively transported by Pgp to a similar extent as cyclosporine A and verapamil. 2~ In another study, 2~ the effect of antisense phosphodiester oligonucleotides to Pgp was studied in human colon carcinoma cell lines (LoVo) that were either resistant or sensitive to doxorubicin. The downregulation of Pgp in that study did not correlate with the susceptibility of the cells to killing by lymphocyte-activated killer cells, indicating that downregulation of p 170 Pgp will not reduce the potential effectiveness of chemoimmunotherapy. In this study the effect of the antisensemediated inhibition of Pgp was compared to the effect of verapamil and the antisense oligonucleotide was found to be equally effective as verapamil in the reversal of multidrug resistance. 2~ 15-Mer phosphorothioate-capped oligonucleotides (two modifications at both ends) to the 5'-end of the coding region of the mdr-1 mRNA reduced P-glycoprotein expression and doxorubicin resistance in human ovarian cancer cells. 2~ In this study, a novel liposomal delivery system, the minimal volume entrapment technique, was used to facilitate uptake of oligonucleotides, and free oligonucleotides were found to be substantially less potent compared to the liposomally formulated ones. The MDR phenotype was further reversed in human adenocarcinoma lines by treatment with unmodified 20-mer MDR1 oligonucleotides directed to different regions of the MDR1 mRNA. 21~ The most active oligonucleotide was located upstream of the AUG codon, whereas no effect was observed with oligonucleotides complementary to the nucleotide binding sites and with oligonucleotides located downstream of the AUG codon. Sixty percent of the cells lost their resistance to doxorubicin and did not form colonies in the presence of the drug. In another study, 14-, 15-, and 18-mer PS-ODNs directed to different regions of the mdr- 1 gene sequence were used to inhibit expression of the mdr- 1 gene product (p 170, P-glycoprotein) in the overexpressing cell lines Lo-VoDxR, S 180DxR, and KBChR8. The highest efficiency in reduction of multiple drug resistance was obtained at a concentration of 2 gM. In proliferation assays, a growth reduction of 50% was observed after exposure of doxorubicin-resistant cells to one of the ODNs. Based on these results, a ribozyme directed against the mRNA target regions of that
Antisense- and Antigene-BasedDrug Design
255
same AS-ODN was designed, which was able to reduce the mdr- 1 mRNA from cell line LoVoDxR up to 80% after an incubation time of 6 hours. 21~ Reversal of MDR has also been achieved by the use of hammerhead ribozymes. These are catalytically active RNA molecules, which after binding to a mRNA target are capable of cleaving the bound RNA in the vicinity of a GUC sequence motif. Their irreversible mechanism of action in principle makes them very attractive antisense agents; their practical applicability is, however, rather limited due to their pronounced susceptibility to degradation by single-stranded RNAses. Ribozyme-mediated cleavage of the 4.5-kb mdr-1 transcript in drug-resistant human mesothelioma cells resulted in significantly reduced expression of P-glycoprotein, and restored the sensitivity of the cells to chemotherapeutic drugs. 211 The target site for cleavage on the mdr-1 transcript was a GUC sequence motif located at positions -6 to -4. Ribozyme-mediated mdr-1 mRNA cleavage was also observed for a 14-mer ODN targeted to the GUC motif at position 2440. This ribozyme cleaved 91% of a 292 nucleotide in vitro transcript of the mdr-1 mRNA within 15 hours. 212 A hammerhead ribozyme targeting c-fos was cloned into a plasmid with an inducible promoter system and transfected into a human ovarian carcinoma cell line that exhibited the MDR phenotype and resistance to actinomycin D. 213 The upstream promoter of the mdr-1 gene contains an AP-1 site and the expression is therefore dependent on c-fos. Induction of the expression of the ribozyme resulted in decreased c-fos and MDR-1 expression, and the sensitivity to chemotherapeutic agents was restored. Compared to the mdr- 1 ribozyme, the c-fos ribozyme was more potent in the reversal of the MDR phenotype in this study. Kobayashi et al. used ribozymes targeting different sites in the mdr-1 transcript to reverse multidrug resistance in MOLT-3 cells. 214 The level of drug resistance in MOLT-3 cells and the amount of mdr- 1 transcripts was shown to correlate inversely with the amount of ribozyme. It was clearly shown that the effect was the result of ribozyme action and not a conventional antisense mechanism, as mutated analogues incapable of RNA cleavage were devoid of any activity. In addition, it was demonstrated that two different ribozymes targeting different regions on the mdr- 1 transcript had different activities, indicating that it is difficult to predict the location of the most promising target sites on the mRNA (see also below). B. In Vivo Pharmacokinetics and Toxicology of Antisense
Most of the pharmacokinetic and pharmacodynamic data that exist for oligonucleotides to date have been acquired for the chemical class of phosphorothioates. The subject has been reviewed 3'215'216 and shall not be discussed here in great detail. Phosphorothioate oligonucleotides have been previously shown to be stable entities when injected into animals and they were shown to be rapidly absorbed systemically after i.v. or i.p. injection into mice, rats, or monkeys. B iphasic plasma-elimination kinetics has been observed in these cases, with an
256
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
initial short half-life of 0.5-1 h representing distribution out of the plasma compartment, and a second longer half-life of-- 40 h corresponding to elimination of the oligonucleotide from the body. Systemic bioavailability of phosphorothioates after i.v. and i.p. injection is very good, whereas oral bioavailability appears to be negligible. Systemic bioavailability of phosphorothioates in rabbits was even reported after administration to the cornea. 3 It should also be noted that second-generation antisense oligonucleotides incorporating 2'-O-methyl-modified sugar residues (cf. Figure 4A) have been reported to exhibit significant oral bioavailiblity. 217 However, these results still await confirmation in more extensive studies. Accumulation of oligonucleotide after i.v. or i.p. administration was found to occur mainly in the liver and kidney. 215'218'219 In contrast to a 20-mer phosphorothioate, where only 30% of the total dose of radioactively (35S) labeled oligonucleotide was excreted in the urine 24 h after i.v. administration into mice, about 70% of the total administered dose was found in the urine between 60 and 120 min for a 12-mer methylphosphonate. 215 The latter study has also reconfirmed the unacceptably low stability of unmodified AS-ODNs under in vivo conditions, with basically all of a 25-mer phosphodiester oligonucleotide being degraded only 15 min after injection into monkeys. The same study also raises some question about the general in vivo stability of phosphorothioates. It has previously been demonstrated that these compounds are very stable (tl/2 > 24 h) under a variety of cell culture assay conditions and against serum nucleases. A similar degree of stability also under in vivo conditions had been indicated by previous animal experiments, where the oligonucleotides were found to be excreted in the urine mainly as intact entities. 216'218'219 However, almost the entire amount of phosphorothioate oligonucleotide recovered from mouse or human urine after i.v. administration was found to be degraded in the more recent study. It should be noted, however, that the profound biological effects that have been observed with phosphorothioates also in vivo indicate that the half-life of these compounds under in vivo conditions clearly suffices to make them attractive potential candidates for first generation antisense drugs. Regarding the toxicity of phosphorothioate oligonucleotides, previous studies have shown that in spite of their potential for unspecific protein binding, these compounds appear to be very well tolerated in mice, rats, and rabbits and no acute toxicity was observed up to doses above 100 mg/kg. 3'216'218'219 The LD5o for injection of phosphorothioate oligonucleotides in mice is about 500-600 mg/kg and therefore 1 to 2 orders of magnitude above the therapeutically used and active doses. So far, no evidence for antigenicity and humoral immune response reactions in animals and in humans has been described, although phosphorothioates have been shown to induce B-cell proliferation which leads to some of the side effects after chronic application, i.e. splenomegaly and lymph node hyperplasy. Toxicity studies have been conducted on a variety of different cell lines and significant differences were found with respect to tolerance of oligonucleotides. In general,
Antisense- and Antigene-BasedDrug Design
257
however, viability of cells was only affected at (therapeutically irrelevant) concentrations in the 30-50 mM range, if at all. 3 In contrast, a recent study with a 25-mer anti-HIV phosphorothioate AS-ODN in monkeys has revealed adverse effects on cardiovascular function upon i.v. administration of the compound, which might be due to complement activation and/or release of cytokines. 22~ These findings have prompted the FDA to issue updated recommendations for pharmacology and toxicology studies for oligonucleotide drugs. 221 However, it is important to realize that these effects were dose-related and also depended on the exact administration modality, i.e. bolus injection or slow injection, with the latter leading to unfavorable side effects only at very high doses; it thus appears that at least in this particular case any phosphorothioate related toxicity is irrelevant at therapeutically effective dose-levels. Based on our present state of knowledge this may well turn out to be true for most phosphorothioate oligonucleotides that display very potent antisense effects, and therefore could be of therapeutic value even at very low dose-levels. Clearly, a larger number of in .vivo studies will be necessary in order to fully assess the real therapeutic potential of phosphorothioate AS-ODNs.
IV. ISSUES A N D OPPORTUNITIES Enormous progress has been made in antisense research over the last few years, and it has now become an established fact that antisense oligonucleotides can be highly potent and very specific inhibitors of gene expression in vitro. Moreover, data are now starting to emerge indicating that the concept may also be workable in vivo, and in fact several antisense compounds are presently undergoing phase I or even phase II clinical trials. 222 However, much remains to be done before the potential of this technology can be fully appreciated, especially with respect to the understanding and ultimately altering the uptake, pharmacokinetic, and pharmacodynamic properties of antisense oligonucleotides. It should be kept in mind that phosphorothioates, despite the fact that such molecules now undergo clinical trials, may only represent a first generation of antisense molecules. Differently modified oligonucleotides have been identified in recent years, which are clearly superior to full 2'-deoxy phosphorothioates in terms of RNA binding affinity and also in vitro antisense activity. These compounds are likely to exhibit different uptake, pharmacokinetic, and pharmacodynamic profiles, and it remains to be seen whether improved RNA binding affinity actually translates into better efficacy in vivo. It should also be remembered that so far the in vivo activity of oligonucleotide drugs in most cases has not been explicitly demonstrated to be mediated by an antisense mechanism (e.g. by demonstrating downregulation of the target mRNA and/or protein in stable or regressing tumors), although indirect evidence exists in several cases to strongly support an antisense hypothesis. Notable exceptions from this generalization are c-raf kinase and PKC-a inhibitors CGP69846A/ISIS5132
258
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
and CGP64128A/ISIS3521, which are currently undergoing phase I clinical trials (vide supra). However, in many cases reported activities of antisense oliognucleotides in vivo and in vitro may in fact depend on non-antisense mechanisms, especially for phosphorothioates (although the effect may still be specific for a particular base sequence). If antisense technology is to be accepted as a general strategy to approach the treatment of human disease, it is absolutely crucial to separate such non-antisense effects from true antisense mechanisms. For this reason, appropriate concept validation experiments (i.e. proof of mRNA and/or protein downregulation) should be part of any serious in vivo and also in vitro study on the potential of modified oligonucleotides to inhibit protein expression by an antisense mechanism. Should such direct proof be difficult to obtain in particular cases (especially in vivo), the use of adequate control oligonucleotides (to demonstrate reduced activity or complete absence thereof) may serve as an acceptable substitute strategy. As has been recently pointed out, 223 the use of mismatched oligonucleotides, differing from the active compound at only few base positions, appears to be more appropriate for this purpose than the (frequently practiced) use of scrambled or sense controls. Further improvement of antisense oligonucleotide potency may be expected from the development of improved methodology for target site selection. Despite the availability of computer programs to predict secondary structures in large RNA molecules, active antisense oligonucleotides are still commonly identified by rather awkward gene walk strategies. Preferred target regions for antisense oligonucleotides on mRNAs have been identified over the last few years by purely empirical means (especially sequences in the vicinity of the AUG start codon and in the 3'-untranslated part of the RNA); however, due to the inherently limited number of oligonucleotides that may be screened in the course of a gene walk process, it is by no means clear whether those targets sites that are found to be amenable to antisense inhibition in fact represent the most suitable target site on a particular mRNA. It appears rather likely that other target sequences (even slightly different ones) may exist that would lead to equivalent or even improved antisense activity. Recent developments in the preparation of oligonucleotide arrays on solid supports 224 may offer the opportunity to overcome these limitations (at least to a large extent) and lead to a much more efficient process for target site identification. Combinatorial approaches (i.e. the use of oligonucleotide libraries in solution) involving RNAse H cleavage of bound target mRNA in vitro, and subsequent identification of cleavage sites, may represent an alternative approach. 226 In summary, antisense technology offers an enormous potential for rational drug design and the specificity of Watson--Crick base pairing gives us the opportunity to "knock out" with great specificity the expression of target genes that differ from their normal counterparts by only a single point mutation. Antisense technology is well suited and promises enormous selectivity for the treatment of diseases in which the genes, whose expression is to be inhibited, are not found in normal cells, such as viral diseases and cancer. The technology offers many possibilities both as a
Antisense- a n d Antigene-Based Drug Design
259
research tool for the identification of gene function and as a novel therapeutic approach for the treatment of disease in man. Although a final assessment of the viability of antisense-based treatment strategies for human disease has to be postponed to the future, the data that have accumulated so far for in vitro and, more recently, for in vivo experiments, are very encouraging and indicate that antisense-based therapeutic approaches may become clinical reality in the not too distant future. In this conjunction it should also be noted that production costs for oligonucleotides have come down tremendously over the last few years, and without wanting to get lost in speculations on the future manufacturing costs for large quantities of oligonucleotide drugs, it is relatively clear that oligonucleotide-based therapies can be affordable if sufficient efficacy can be achieved, especially if life-threatening diseases are involved. Whether the bullet is really magical and whether oligonucleotides will and should become novel and innovative therapeutic agents in the future, however, can only be determined by an open and objective evaluation of their potential in clinical trials by the entire scientific community. We feel confident that antisense technology can be very useful for the specific and selective therapy of human diseases in a concept-based approach, and we look forward to further clinical trials and to the evaluation of the potential of antisense technology in man.
REFERENCES AND NOTES 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. l 1. 12. 13. 14. 15. 16. 17. 18. 19. 20.
Uhlmann,E.; Peyman, A. Chem. Rev. 1991, 90, 543. Milligan,J. F.; Matteucci, M. D.; Martin, J. C. J. Med. Chem. 1993, 36, 1923. Crooke, S. T. Annu. Rev. Pharmacol. Toxicol. 1992, 32, 329. H616ne,C.; Toulm6, J.-J. Biochimica et Biphysica Acta 1990, 1049, 99. Cohen, J. S. Adv. Pharmacol. 1994, 25, 319. Crooke, S. T. Med. Res. Rev. 1996, 16, 319. Crooke, S. T.; Bennett, C. E Ann. Rev. Pharmacol. Toxicol. 1996, 36, 107. For a recent example cf.: Wagner,R. W.; Matteucci, M. D.; Grant, D.; Huang, T.; Froehler, B. C. Nature Biotechnol. 1996, 14, 840. Zamecnik,E C.; Stephenson, M. L. Proc. Natl. Acad. Sci USA 1978, 75, 280. Stephenson,M. L.; Zamecnik,E C. Proc. Natl. Acad. Sci USA 1978, 75, 285. Takayama,K. M.; Inouye, M. Crit. Rev. Biochem. 1990, 25, 155. For a comprehensivediscussion of nucleic acid structure see: Saenger, W. Principles of Nucleic Acid Structure; Springer: New York, 1984. Felsenfeld,G.; Davies, D. R.; Rich, A. J. Am. Chem. Soc. 1957, 79, 2023. Moser, H.; Dervan, E B. Science 1987, 238, 645. Dervan, P. B. In Oligodeoxynucleotides - Antisense Inhibitors qf Gene Expression; Cohen, J. S., Ed.; Macmillan Press: London, 1989, p. 197. Grigoriev, M.; Praseuth, D.; Robin, P.; Hemar, A.; Saison-Behmoaras, T.; Dautry-Varsat, A.; Thuong, N. T.; H61~ne,C.; Harel-Bellan,A. J. Biol. Chem. 1992, 267, 3389. Maher,J. L., III; Dervan, P. B.; Wold, B. Biochemistry 1992, 31, 70. Gee, J. E.; Blume, S.; Snyder, R. C.; Ray, R.; Miller, D. M. J. Biol. Chem. 1992, 267, 11163. Maher,J. L., III. Biochemistry 1992, 31, 7587. Postel, E. H.; Flint, S. J.; Kessler,D. J.; Hogan, M. E. Proc. Natl. Acad. Sci. USA 1991, 88, 8227.
260
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
21. Ing, N. H.; Beekman, J. M.; Kessler, D. J.; Murphy, M.; Jayaraman, K.; Zendegui, J. G.; Hogan, M. E.; O'Malley, B. W.; Tsai, M.-J. Nucleic Acids Res. 1993, 21, 2789. 22. Giovanangeli, C.; Perouault, L.; Escud6, C.; Gryaznov, S.; H61~ne, C. J. Mol. Biol. 1996, 261, 386. 23. Mayfield, C.; Squibb, M.; Miller, D. Biochemistry 1994, 33, 3358. 24. Griffin, L. C.; Kiessling, L. L.; Beal, P. A.; Gillespie, P.; Dervan, P. B. J. Am. Chem. Soc. 1992, 114, 7976. 25. Stiltz, H. U.; Dervan, P. B. Biochemistry 1993, 32, 2177. 26. Miller, P. S.; Bhan, P.; Cushman, C. D.; Trapane, T. L. Biochemistry 1992, 31, 6788. 27. Trapane, T. L.; Christopherson, M. S.; Roby, C. D.; Ts'o, P. O. P.; Wang, D. J. Am. Chem. Soc. 1994, 116, 8412. 28. Zimmerman, S. C.; Schmitt, P. J. Am. Chem. Soc. 1995, 117, 10769. 29. Chiang, M-Y.; Chan, H.; Zounes, M. A.; Freier, S. M.; Lima, W. E; Bennett, C. E J. Biol. Chem. 1991, 266, 18162. 30. Dean, N. M.; McKay, R. Proc. Natl. Acad Sci. USA 1994, 91, 11762. 31. Monia, B. P.; Johnston, J. E; Ecker, D. J.; Zounes, M. A.; Lima, W. F.; Freier, S. M. J. Biol. Chem. 1992, 267, 19954. 32. Monia, B. P.; Lesnik, E. A.; Gonzalez, C.; Lima, W. F.; McGee, D.; Guinosso, C. J.; Kawasaki, A. M.; Cook, P. D.; Freier, S. M. J. Biol. Chem. 1993, 268, 14514. 33. Wagner, R. W.; Matteucci, M. D.; Lewis, J. G.; Gutierrez, A. J.; Moulds, C.; Froehler, B. C. Science 1993, 260, 1510. 34. Moulds, C.; Lewis, J. G.; Froehler, B. C.; Grant, D.; Huang, T.; Milligan, J. F.; Matteucci, M. D.; Wagner, R. W. Biochemistry 1995, 34, 5044. 35. McKay, R. A.; Cummins, L. L.; Graham, M. J.; Lesnik, E. A.; Owens, S. R.; Winniman, M.; Dean, N. M. Nucleic Acids Res. 1996, 24, 411. 36. Monia, B. P.; Johnston, J. E; Sasmor, H.; Cummins, L. L. J. Biol. Chem. 1996, 271, 14533. 37. Hall, J.; HiJsken, D.; Pieles, U.; Moser, H. E.; H~iner, R. Chem, Biol. 1994, 1, 185. 38. Magda, D.; Miller, R. A.; Sessler, J. L.; Iverson, B. L. J. Am. Chem. Soc. 1994, 116, 7439. 39. Torrence, P. F.; Maitra, R. K.; Lesiak, K.; Khamnei, S.; Zhou, A.; Silverman, R. H. Proc. Natl. Acad. Sci. USA 1993, 90, 1300. 40. Avudaiappan, M.; Maitra, R. K.; Kumar, A.; Dong, B.; Xiao, W. X.; Li, G.; Williams, B. R. G.; Torrence, P. E; Silverman, R. H. Science 1994, 265, 789. 41. Vlassov, V. V.; Zarytova, V. E In Oligodeoxynucleotides - Antisense lnhibitors of Gene Expression; Cohen, J. S., Ed.; Macmilian Press: London, 1989, p. 173. 42. H61~ne, C.; Toulm6, J.-J. In Oligodeoxynucleotides - Antisense Inhibimrs of Gene Expression; Cohen, J. S., Ed.; Macmillan Press: London, 1989, p. 137. 43. Cook, P. D. Anti-Cancer Drug Design 1991, 6, 585. 44. Carbohydrate Modifications in Antisense Research; Sanghvi, Y. S.; Cook, P. D., Eds." ACS Symposium Series, ACS, Washington, 1994. 45. De Mesmaeker, A.; H~er, R.; Martin, P.; Moser, H. E. Acc. Chem. Res. 1995, 28, 366. 46. De Mesmaeker, A.; Altmann, K.-H.; Waldner, A.; Wendeborn, S. Curr. Opin. Struct. Biol. 1995, 5, 343. 47. Mergny, J. L.; Duval-Valentin, G.; Nguyen, C. H.; Perrouault, L.; Faucon, B.; Roug6e, M.; Montenay-Garestier, T.; Bisagni, E.; H61~ne, C. Science 1992, 256, 1681. 48. Kawasaki, A. M.; Casper, M. D.; Freier, S. M.; Lesnik, E. A.; Zounes, M. C.; Cummins, L. L.; Gonzales, C.; Cook, P. D. J. Med. Chem. 1993, 36, 831. 49. Giles, R. V.; Tidd, D. M. Nucleic Acids Res. 1992, 20, 763. 50. Giles, R. V.; Tidd, D. M. Anti-Cancer Drug Des. 1992, 7, 35. 51. Monia, B. P.; Johnston, J. E; Geiger, T.; Miiller, M.; Fabbro, D. Nature Med. 1996, 2, 668. 52. Hoke, G. D.; Draper, K.; Freier, S. M.; Gonzalez, C.; Driver, V. B.; Zounes, M. C.; Ecker, D. J. Nucleic Acids Res. 1991, 19, 5743.
Antisense- and Antigene-BasedDrug Design
261
53. Stein, C. A.; Cohen, J. S. In Oligodeoxynucleotides - Antisense Inhibimrs of Gene Expression; Cohen, J. S., Ed.; Macmillan Press: London, 1989, p. 97. 54. Stein, C. A.; Cheng, Y.-C. Science 1993, 261, 1004. 55. Ghosh, M. K.; Ghosh, K.; Dalai, O.; Cohen, J. S. Nucleic Acids Res. 1993, 21, 5761. 56. Gao, W.-Y.; Han, E U.; Storm, C.; Egan, W.; Cheng, Y.-C. Mol. Pharmacol. 1992, 41,223. 57. Srinivasan, S. K.; Tewary, H. K.; Iversen, P. L. Antisense Res. Dev. 1995, 5, 131. 58. Teasdale, R. M.; Matson, S. L.; Fisher, E.; Krieg, A. M. Antisense Res. Dev. 1994, 4, 295. 59. Lesnik, E. A.; Guinosso, C. J.; Kawasaki, A. M.; Sasmor, H.; Zounes, M.; Cummins, L. L.; Ecker, D. J.; Cook, P. D.; Freier, S."M. Biochemistry 1993, 32, 7832. 60. Morvan, E; Porumb, H.; Degols, G.; Lefebvre, I.; Pompon, A.; Sproat, B. S.; Rayner, B.; Malvy, C.; Lebleu. B.; Imbach, J.-L. J. Med. Chem. 1993, 36, 280. 61. Sproat, B. S.; Lamond, A. I.; Beijer, B.; Neuner, P.; Ryder, U. Nucleic Acids Res. 1989, 17, 3373. 62. Irribaren, A. M.; Sproat, B. S.; Neuner, P.; Sulston, I.; Ryder, U.; Lamond, A. I. Proc. Natl. Acad. Sci. USA 1990, 87, 7747. 63. Rayner, B.; Malvy, C.; Paoletti, J.; Lebleu, B.; Paoletti, C.; Imbach, J.-L. In Oligodeoxynucleotides - Antisense lnhibitors of Gene Expression; Cohen, J. S., Ed.; Macmillan Press: London, 1989, p. 119. 64. Vichier-Guerre, S.; Pompon, A.; Lefebvre, I.; Imbach, J.-L. Antisense Res. Dev. 1994, 4, 9. 65. Martin, P. Helv. Chim. Acta 1995, 78, 486. 66. (a) Altmann, K.-H.; Dean, N. M.; Fabbro, D.; Freier, S. M.; Geiger, T.; H~ner, R.; Hiisken, D.; Martin, P.; Monia, B. P.; Mtiller, M.; Natt, F.; Nicklin, P.; Phillips, J.; Pieles, U.; Sasmor, H.; Moser, H. E. Chimia 1996, 50, 168. (b) Altmann, K.-H.; Fabbro, D.; Dean, N. M.; Geiger, T.; Monia, B. P.; Mtiller, M.; Nicklin, P. Biochem. Soc. Trans. 1996, 24, 630. 67. Gryaznov, S. M.; Lloyd, D. H.; Chen, J.-K.; Schultz, R. G.; DeDionisio, L. A.; Ratmeyer, L.; Wilson, W. D. Proc. Natl. Acad. Sci. USA 1995, 92, 5798. 68. Gryaznov, S. M.; Chen, J.-K. J. Am. Chem. Soc. 1994, 116, 3143. 69. Kean, J. M.; Cushman, C. D.; Kang, H.; Leonard, T. E.; Miller, P. S. Nucleic Acids Res. 1994, 22, 4497. 70. Miller, P. S. In Oligodeoxynucleotides - Antisense Inhibitors of Gene Expression; Cohen, J. S., Ed.; Macmillan Press: London, 1989, p, 79. 71. De Mesmaeker, A.; Waldner, A.; Lebreton, J.; Hoffmann, P.; Fritsch, V.; Wolf, R. M.; Freier, S. M. Angew. Chemie Int. Ed. 1994, 33, 226. 72. Jones, R. J.; Lin, K.-Y.; Milligan, J. F.; Wadwani, S.; Matteucci, M. D. J. Org. Chem. 1993, 58, 2983. 73. Gryaznov, S.; Schultz, R. G. Tetrahedron Lett. 1994, 35, 2489. 74. Froehler, B. C.; Wadwani, S.; Terhorst, T. J.; Gerrard, S. Tetrahedron Lett. 1992, 33, 5307. 75. Gutierrez, A. J.; Terhorst, T. J.; Matteucci, M. D.; Froehler, B. C. J. Am. Chem. Soc. 1994, 116, 5540. 76. Loke, S. L.; Stein, C. A.; Zhang, X. H.; Moil, J.; Nakanishi, M.; Subasinghe, C.; Cohen, J. S.; Neckers, L. M. Proc. Natl. Acad. Sci. USA 1989, 86, 3474. 77. Yakubov, L. A.; Deeva, E. A.; Zaytova, V. E; lvanova, E. M.; Ryte, A. S.; Yurchenko, L. V.; Vlassov, V. V. Proc. Natl. Acad. Sci. USA 1989, 86, 6454. 78. (a) Fisher, T. L.; Terhorst, T.; Cao, X.; Wagner, R. W. Nucleic Acids Res. 1993, 21, 3857. (b) Bonham, M. A.; Brown, S.; Boyd, A. L.; Brown, P. H.; Bruckenstein, D. A.; Hanvey, J. C.; Thomson, S. A.; Pipe, A.; Hassman, E; Bisi, J. E.; Froehler, B. C.; Matteucci, M. D.; Wagner, R. W.; Noble, S. A.; Babiss, L. E. Nucleic Acids Res. 1995, 23, 1197. 79. Bennett, C. F.; Chiang, M.-Y.; Chan, H.; Shoemaker, J. E. E.; Mirabelli, C. K. Mol. Pharmacol. 1992, 41, 1023. 80. Flanagan, W. M.; Kothavale, A.; Wagner, R. W. Nucleic Acids Res. 1996, 24, 2936. 81. Ryte, A. S.; Karamyshev, V. N.; Nechaeva, M. V.; Guskova, Z. V.; Ivanova, E. M.; Zarytova, V. F.; Vlassov, V. V. FEBS J. 1992, 299, 124.
262
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
82. Krieg, A. M.; Tonkinson, J.; Matson, S.; Zhao, Q.; Saxon, M.; Zhang, L. M.; Bhanja, U.; Yakubov, L.; Stein, C. A. Proc. Natl. Acad. Sci. USA 1993, 90, 1048. 83. Clarenc, J. E; Degois, G.; Leonetti, J. E; Milhaud, E; Lebleu, B. Anti-Cancer Drug Des. 1993, 8, 81. 84. Citro, G.; Perrotti, D.; Cucco, C.; D'Agnano, I.; Sacchi, A.; Zupi, G.; Calabretta, B. Proc. Natl. Acad. Sci. USA 1992, 89, 7031. 85. Thierry, A. R.; Dritschilo, A. Nucleic Acids Res. 1992, 20, 5691. 86. Thierry, A. R.; Rahman, A.; Dritschilo, A. Biochem. Biophys. Res. Commun. 1993, 190, 952. 87. Leonetti, J. E; Machy, E; Degols, G.; Lebleu, B.; Leserman, L. Proc. Natl. Acad. Sci. USA 1990, 87, 2448. 88. Croce, C. M. Cell 1987, 49, 155. 89. Alitalo, K.; Schwab, M. Adv. Cancer Res. 1988, 46, 235. 90. Rabbitts, T. H. Nature 1994, 372, 143. 91. Bishop, J. M. Cell 1991, 64, 235. 92. Degols, G.; Leonetti, J. E; Mechti, N.; Lebleu, B. Nucleic Acids Res. 1991, 19, 945. 93. Watson, E H.; Pon, R. T; Shiu, R. E C. Cancer Res. 1991, 51, 3996. 94. Leonetti, C.; DiiAgnano, I.; Luzupone, E; Valentini, A.; Geiser, T.; Zon, G.; Calabretta, B.; Citro, G. C.; Zupi, G. J. Natl. Cancer Inst. 1996, 88, 391. 95. Kang, Y.; Cortina, R.; Perry, R. R. J. Natl. Cancer Inst. 1996, 88, 224. 96. Li, B. D.; Budnick, R. M.; Russo, C. A.; Anderson, G. R.; Stewart, C. C. J. Surg. Res. 1995, 59, 485. 97. Mizutani, Y.; Bonavida, B.; Fukumoto, M.; Yoshida, O. J. Immunother. Emphasis Tunu~rImmunol. 1995, 17, 78. 98. Calabretta, B.; Sims, R. B.; Valtieri, M.; Caracciolo, D.; Szczylik, C.; Venturelli, D.; Ratajczak, M.; Beran, M.; Gewirtz, A. M. Proc. Natl. Acad. Sci. USA 1991, 88, .2351. 99. Melani, C.; Rivoltini, L.; Parmiani, G.; Calabretta, B.; Colombo, M. P. Cancer Res. 1991, 51, 2897. I00. Del-Bufalo, D." Cucco, C.; Leonetti, C.; Citr0, G." D'Agnano, I.; Benassi, M.; Geiser, T.; Zon, G." Calabretta, B.; Zupi, G. British J. Cancer 1996, 74, 387. 101. Pitch, R. J.; Goodman, G. R.; Minion, D. J.; Madura, J. A.; Fox, P. L.; Graham, L. M. J. Va~vc. Surg. 1996, 23, 783. 102. Burgess, T. L.; Fisher, E. E; Ross, S. L.; Bready, J. V.; Qian, Y. X.; Bayewitch, L. A. Proc. Natl. Acad. Sci. USA 1955, 92, 4051. 103. Villa, A. E.; Guzman, L. A.; Poptic, E. J.; Labhasetwar, V.; D'Souza, S.; Farrel, C. L.; Plow, E. F.; Levy, R. J.; DiCodeto, P. E.; Topoi. E. J. Circ'. Res. 1995, 76, 505. 104. Colotta, E; Polentarutti, N.; Sironi, M.; Mantovani, A. J. Biol. Chem. 1992, 267, 18278. 105. Holt, J. T. Mol. Cell, Biol. 1993, 13, 3821. 106. Machwate, M.; JuUienne, A.; Moukhtar, M.; Lomri, A.; Made, P. J. Mol. Endocrinol. 1995, 9, 187. 107. Higgins, K. A." Perez, J. R." Coleman, T. A." Dorshkind, K.; McComas, W. A.; Sarmiento, U. M." Rosen, C. A.; Narayanan, R. Proc. Natl. Acad. Sci. USA 1993, 90, 9901. 108. Sharma, H. W.; Perez, J. R.; Higgins-Sochaski, K.; Hsiao, R.; Narayanan, R. Anticancer Res. 1996, 16,61. 109. Rovin, B. H.; Dickerson, J. A.; Tan, L. C.; Hebert, C. A. Kidney Int. 1995, 48, 1263. 110. Pedaky, L.; Saijo, Y.; Busch, R. K.; Bennett, C. E; Mirabelli, C. K.; Crooke, S. T.; Busch. H. Anti-Cancer Drug Des. 1993, 8, 3. 111. Speir, E.; Epstein, S. E. Circulation 1992, 86, 538. 112. Sakakura, C.; Hagiwara, A.; Tsujimoto, H.; Ozaki, K.; Sakakibara, T.; Oyama, T.; Ogaki, M.; Takahashi, T. Surg. Today 1995, 25, 184. 113. Furukawa, Y.; Piwnica-Worms, H.; Ernst, T. J.; Kanakura, Y.; Griffin, J. D. Science 1990, 250, 805. 114. Morishita, R.; Gibbons, G. H.; Kaneda, Y.; Ogihara, T.; Dzau, V. J. Gene 1994, 149, 13.
Antisense- and Antigene-BasedDrug Design
263
115. Moroni, M. C.; Willingham, M. C.; Beguinot, L. J. Biol. Chem. 1992, 267, 2714. 116. Becker, D.; Lee, P. L.; Rodeck, U.; Hedyn, M. Oncogene 1992, 7, 2303. 117. Fitzpatrick, D. R.; Bielefeldt-Ohmann, H.; Himbeck, R. P.; Jarnicki, A. G.; Marzo, A. L.; Robinson, R. W. S. Growth Fact. 1994, 11, 29. 118. Itoh, H.; Mukoyama, M.; Pratt, R. E.; Dzau, V. J. Biochem. Biophys. Res. Commun. 1992, 188, 1205. 119. Reiss, K.; Porcu, P.; Sell, C.; Piertrzkowski, Z.; Baserga, R. Oncogene 1992, 7, 2243. 120. Burfeind, P.; Chernicky, C. L.; Rininsland, E; llan, J. Proc. Natl. Acad. Sci. USA 1996, 93, 7263. 121. Resnicoff, M.; Li, W.; Basak, S.; Hedyn, D.; Baserga, R.; Rubin, R. Cancer lmmunol, lmmunother. 1996, 42, 64. 122. Nesterova, M.; Cho-Chung, Y. S. Nature Med. 1995, 1,528. 123. Resnicoff, M.; Abraham, D.; Yutanawiboonchai, W.; Rotman, H. L.; Kajstura, J.; Rubin, R.; Zoltick, P.; Baserga, R. Cancer Res. 1995, 55, 2463. 124. Long, L.; Rubin, R.; Baserga, R.; Brodt, P. Cancer Res. 1995, 55, 1006. 125. Ahmad, S.; Glazer, R. I. Mol. Pharmacol. 1993, 43, 858. 126. Dean, N. M.; McKay, R.; Condon, T. P.; Bennett, C. E J. Biol. Chem. 1994, 269, 16416. 127. Dean, N. M.; McKay, R.; Miraglia, L.; Howard, R.; Meister, L.; Ziel, R.; Geiger, T.; MUller, M.; Fabbro, D. Cancer Res. 1996, 56, 3499. 128. Tortora, G.; Pep, S.; Bianco, C.; Baldassarre, G.; Budillon, A.; Clair, T.; Chochung, Y. S.; Bianco, A. R.; Ciardiello, E Oncogene 1994, 9, 3233. 129. Tortora, G.; Yokozaki, H.; Pepe, S.; Clair, T.; Cho-Chung, Y. S. Proc. Natl. Acad. Sci. USA 1991, 88, 2011. 130. Taieb, J.; Vitte-Mony, I.; Auffredou, M. T.; Dorseuil, O.; Gacon, G.; Bertoglio, J.; Vazquez, A. J. Biol. Chem. 1993, 268, 9169. 131. Yao, Y. R.; Scott, D. W. Proc. Natl. Acad. Sci. USA 1993, 90, 7946. 132. Coulson, J. M.; Poyner, D. R.; Chantry, A.; Irwin, W. J.; Akhtar, S. Mol. Pharmacol. 1996, 50, 314. 133. Yamanishi, Y.; Maeda, H.; Hiyama, K.; lshioka, S.; Yamakido, M. Jpn J. Cancer Res. 1996, 87, 534. 134. Katagiri, K.; Yokoyama, K. K.; Yamamoto, T.; Omura, S.; Irie, S.; Katagiri, T. J. Biol. Chem. 1996, 271, 11557. 135. Wiechen, K.; Dietel, M. Int. J. Cancer 1995, 63, 604, 1995. 136. Rosti, V.; Bergamaschi, G.; Lucotti, C.; Danova, M.; Carlo-Stella, C.; Locatelli, E; Tonon, L.; Mazzini, G.; Cazzola, M. Blood 1995, 86, 3387. 137. Delafontaine, P.; Anwar, A.; Lou, H.; Ku, L. J. Clin. Invest. 1996, 97, 139. 138. Kasid, U.; Pfeifer, A.; Brennan, T.; Beckett, M.; Weichselbaum, R. R.; Dristchilo, A.; Mark, G. E. Science 1989, 243, 1354. 139. Keller, J. R.; Ruscetti, E W.; Heidecker, G.; Linnekin, D. M.; Rapp, U.; Troppmair, J.; Gooya, J.; Muszynski, K. W. Curr. Top. Microbiol. Immunol. 1996, 211, 43. 140. Muszynski, K. W.; Ruscetti, E W.; Heidecker, G.; Rapp, U.; Troppmair, J.; Gooya, J. M.; Keller, J. R. J. Exp. Med. 1995, 181, 2189. 141. Skorski, T.; Nieborowska-Skorska, M.; Szczylik, C.; Kanakaraj, P.; Perrotti, D.; Zon, G.; Gewirtz, A.; Perussia, B.; Calabretta, B. Cancer Res. 1995, 55, 2275. 142. Mukhopadhyay, T.; Tainsky, M.; Cavender, A. C.; Roth, J. A. Cancer Res. 1991, 51, 1744. 143. Aoki, K.; Yoshida, T.; Sugimura, T.; Terada, M. Cancer Res. 1995, 55, 3810. 144. Skorski, T.; Szczylik, C.; Ratajczak, M. Z.; Malaguamera, L.; Gewirtz, A. M.; Calabretta, B. J. Exp. Med. 1992, 175, 743. '145. Pierga, J.-Y.; Magdelenat, H. Cell. Molec. Biol. 1994, 40, 237. 146. Bayever, E.; Iversen, P. Hematol. Oncol. 1994, 12, 9. 147. Magrath, I. T. Ann. Oncol. 1994, 5, $67. 148. Carter, G.; Lemoine, N. R. Br. J. Cancer 1993, 67, 869.
264
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
149. O'Brien, S. G.; Kirkland, M. A.; Goldman, J. M. Eur. J. Cancer 1994, 30A, 1160. 150. De Lord, C.; Clutterbuck, R. D.; Powles, R. L.; Min, T.; Titley, J. C.; Millar, J. L. Exp. Hematol. 1993, 21,826. 151. Gewirtz, A. M. Stem Cells 1993, 11 (suppl.3), 96. 152. Cho-Chung, Y.-S. Curt Opin. Ther Pat. 1993, 3, 1737. 153. Calabretta, B.; Skorski, T.; Szczylik, C.; Zon, G. Cancer Treat. Rev. 1993, 19, 169. 154. Cho-Chung, Y. S.; Clair, T. Pharmacol. Ther. 1993, 60, 265. 155. Sharma, H. W.; Narayanan, R. Bioessays 1995, 17, 1055. 156. Mastrangelo, M. J.; Berd, D.; Nathan, E E.; Lattinme, E. C. Sere. Oncol. 199@ 23, 4. 157. Hanania, E. G.; Kavanagh, J. H.; Hortobagyi, G.; Giles, R. E.; Champlin, R.; Deisseroth, A. B. Am. J. Med. 1995, 99, 537. 158. Nowell, E C.; Hungerford, D. A. Science 1960, 132, 149 I. 159. Rowley, J. D. Science 1982, 216, 749. 160. Szczylik, C.; Skorski, T.; Nicolaides, N. C.; Manzella, L.; Malaguamera, L.; Venturelli, D.; Gewirtz, A.; Calabretta, B. Science 1991, 253, 562. 161. Rowley, E T.; Keng, E C.; Kosciolek, B. A. Leuk. Res. 1996, 20, 473. 162. Mahon, E X.; Belloc, E; Vianes, I.; Barbot, C.; Boiron, J. M.; Cowen, D.; Lacombe, E; Brizard, A.; Bilhou-Nabera, C.; Bernard, E Leuk. Lymphoma 1995, 19, 423. 163. Mahon, E X.; Ripoche, J.; Pigeonnier, V.; Jazwiec, B.; Pigneux, A.; Moreau, J. E; Reiffers, J. Exp. Hematol. 1995, 23, 1606. 164. Vaerman, J. L.; Lammineur, C.; Moureau, E; Lewalle, E; Deldime, E; Blumenfeld, M.; Martiat, E Blood 1995, 86, 389 I. 165. Maekawa, T.; Kimura, S.; Hirakawa, K.; Murakami, A.; Zon, G.; Abe, T. Int. J. Cancer 1995, 62, 63. 166. Lange, W. Klin. Padiatr. 1995, 207, 222. 167. Lange, W.; Daskalakis, M.; Finke, J.; D/Slken, G. FEBS Lett. 1994, 228, 175. 168. Skorski, T.; Nieborowska-Skorska, M.; Ratajczak, M. Z.; Barletta, C.; Malaguamera, L.; Szczylik, C.; Chen, S.-T.; Lange, B.; Gewirtz, A. M.; Calabretta, B. J. Clin. Invest. 1993, 92, 194. 169. Skorski, T.; Nieborowska-Skorska, M.; Nicolaides, N. C.; Szcylik, C.; Iversen, E; Iozzo, R. V.; Zon, G.; Calabretta, B. Proc. Natl. Acad. Sci. USA 1994, 91, 4504. 170. Ratajczak, M. Z.; Kant, J. A.; Luger, S. M.; Hijiya, N.; Zhang, J.; Zon, G.; Gewirtz, A. M. Proc. Natl. Acad. Sci. USA 1992, 89, 11823. 171. Bayever, E.; Haines, K. M.; Iversen, E L.; Ruddon, R. W.; Pirruccello, S. J.; Mountjoy, C. E; Ameson, M. A.; Smith, L. J. Leuk,. Lymphoma 1994, 12, 223. 172. Lanza, E; Bi, S.; Moretti, S.; Castoldi, G.; Goldman, J. M. Br. J. Haematol. 1995, 90, 8. 173. Collins, S.; Groudine, M. Nature 1982, 299, 679. 174. Wickstrom, E. L.; Bacon, T. A.; Gonzalez, A.; Freeman, D. L.; Lyman, G. H.; Wickstrom, E. Proc. Natl. Acad. Sci. USA 1988, 85, 1028. 175. Algar, E. M.; Khromykh, T.; Smith, S.; Blackburn, D. M.; Bryson, G. J.; Smith, E J. Oncogene 1996, 12, 1005. 176. Yamagami, T.; Sugiyama, H.; Inoue, K.; Ogawa, H.; Tatekawa, T.; Hirata, M.; Kudoh, T.; Akiyama, T.; Murakami, A.; Maekawa, T. Blood 1996, 87, 2878. 177. Cotter, E E.; Johnson, E; Hall, E; Pocock, C.; As Mahdi, N. A.; Cowell, J. K.; Morgan, G. Oncogene 1994, 9, 3049. 178. Reuning, U.; Wilhelm, O.; Nishiguchi, T.; Guerrini, L.; Blasi, E; Graeff, H.; Schmitt, M. Nucleic Acids Res. 1995, 23, 3887. 179. Gray, G. D.; Hemandez, O. M.; Hebel, D.; Root, M.; Pow-Sang, J. M.; Wickstrom, E. Cancer Res. 1993, 53, 577. 180. Schwab, G.; Chavany, C.; Duroux, I.; Goubin, G.; Lebeau, J.; H61~ne, C.; Saison-Behmoaras, T. Proc. Natl. Acad. Sci. USA 1994, 91, 10460. 181. Miele, M. E.; Bennett, C. E; Miller, B. E.; Welch, D. R. Exp. Cell Rex. 1994, 214, 231.
Antisense- and Antigene-BasedDrug Design
265
182. Behrend, E. I.; Craig, A. M.; Wilson, S. M.; Denhardt, D. T.; Chambers, A. F. CancerRes. 1994, 54, 832. 183. Yokozaki, H.; Budillon, A.; Tortora, G.; Meissner, S.; Beaucage, S. L.; Miki, K.; Chochung, Y. S. Cancer Res. 1993, 53, 868. 184. Colomer, R.; Lupu, R.; Bacus, S. S.; Gelmann, E. P. Br. J. Cancer 1994, 70, 819. 185. Schechter, A. L.; Hung, M. C.; Vaidyanathan, L.; Weinberg, R. A.; Yang-Feng, T.; Francke, U.; Coussens, T. Science 1985, 229, 976. 186. Slamon, D. J.; Clark, G. M.; Wong, S. G.; Levin, M. J.; Ullrich, A.; McGuire, W. L. Science 1987, 235, 177. 187. Becker, D.; Meier, C. B.; Herlyn, M. Embo J. 1989, 8, 3685. 188. Behl, C.; Bogdahn, U.; Winkler, J.; Apfel, R.; Brysch, W.; Schlingensiepen, K. H. Biochem. Biophys. Res. Commun. 1993, 193, 744. 189. Fitzpatrick, D. R.; Bielefeldt-Ohmann, H.; Himbeck, R. P.; Jamicki, A. G.; Marzo, A. L.; Robinson, R. W. S. Growth Factors 1994, 11, 29. 190. Resnicoff, M.; Coppola, D.; Sell, C.; Rubin, R.; Ferrone S.; Baserga, R. Cancer Res. 1994, 54, 4848. 191. Quattrone, A.; Fibbi, G.; Anichini, E.; Zamperini, A.; Cappacioli, S.; del Rosso, M. Cancer Res. 1995, 55, 90. 192. Kook, Y. H.; Adamski, J.; Zelen, A.; Ossowski, L. Embo J. 1994, 13, 3983. 193. Kasid, U.; Pfeifer, A.; Brennan, T.; Beckett, M.; Weichselbaum, R. R.; Dritschilo, A.; Mark, G. E. Science 1989, 243, 1354. 194. Witty, J. P.; McDonnell, S.; Newell, K. J.; Cannon, P.; Navre, M.; Tressler, R. J.; Matrisian, L. M. Cancer Res. 1994, 54, 4805. 195. Yamamoto, H.; Itoh, E; Hinoda, Y.; Imai, K. Int. J. Cancer 1995, 61,218. 196. van Kalken, C. K.; Pinedo, H. M.; Giaccone, G. Eur. J. Cancer 1991, 27, 1481. 197. Dietel, M. Cancer Res. 1993, 53, 2683. 198. Kaye, S. B. Br. J. Cancer 1993, 67, 641. 199. Gottesman, M. M. Cancer Res. 1993, 53, 747. 200. Pastan, I.; Gottesman, M. M. Ann. Rev. Med. 1991, 41,277. 201. Chan, H. S. L.; Haddad, G.; Thomer, P. S.; deBoer, G.; Yun, P. L.; Ondrusek, M.; Yeger, H.; Ling, V. N. Engl. J. Med. 1991, 325, 1608. 202. Chan, H. S. L.; Thomer, P. S.; Haddad, G.; Ling, V. J. Clin. Oncol. 1990, 8, 689. 203. Holzmayer, T. A.; Hilsenbeck, S.; von Hoff, D. D.; Roninson, I. B. J. Natl. Cancer Inst. 1992, 84, 1486. 204. Pirker, R.; Wallner, J.; Geissler, K.; Linkesch, W.; Haas, O. A.; Bettelheim, P.; Hopfner, M.; Scherrer, R.; Valent, P.; Haveloc, L. J. Natl. Cancer Inst. 1991, 83, 708. 205. Verelle, P.; Meissonier, F.; Fonck, Y.; Feillel, V.; Dionet, C.; Kwiatowski, F.; Plagne, R.; Chassagne, J. J. Natl. Cancer Inst. 1991, 83, 111. 206. Ford, J. M.; Hait, W. N. Pharmacol. Rev. 1990, 42, 155. 207. Bello-Rehss, E.; Ernest, S. Am. J. Physiol. 1994, 267, C1351. 208. Rivoltini, L.; Colombo, M. P.; Supino, R.; Ballinari, D.; Tsuruo, T.; Parmiani, G. Int. J. Cancer 1990, 46, 727. 209. Comas, M. V.; Tonini, G. P. Anticancer Res. 1992, 12, 1431. 210. Bertram, J.; Palfner, K.; Killian, M.; Brysch, W.; Schlingensiepen, K. H.; Hiddemann, W.; Kneba, M. Anticancer Drugs 1995, 6, 124. 211. Kiehntopf, M.; Brach, M. A.; Licht, T.; Petschauer, S.; Karawajew, L.; Kirschning, C.; Herrmann, E Embo J. 1994, 13, 4645. 212. Palfner, K.; Kneba, M.; Hiddemann, W.; Bertram, J. Biol. Chem. 1995, 376, 289. 213. Scanlon, K. J.; Ishida, H.; Kashani-Sabet, M. Proc. Natl. Acad. Sci. USA 1994, 91, 11123. 214. Kobayashi, H.; Dorai, T.; Holland, J. E; Ohnuma, T. Cancer Res. 1994, 54, 1271. 215. Agrawal, S.; Temsamani, J.; Galbraith, W.; Tang, J. Clin. Pharmacokinet. 1995, 28, 7.
266
KARL-HEINZ ALTMANN, DORIANO FABBRO, and THOMAS GEIGER
216. Iversen, P. Anti-Cancer Drug Des. 1991, 6, 531. 217. Agrawal, S.; Zhang, X.; Lu, Z.; Zhao, H.; Tamburin, J. M.; Yan, J.; Cai, H.; Diasio, R. B.; Habus, I.; Jiang, Z.; Iyer, R. E; Yu, D.; Zhang, R. Biochem. Pharmacol. 1995, 50, 571. 218. Agrawal, S.; Temsamani, J.; Tang, J. Y. Proc. Natl. Acad. Sci. USA 1991, 88, 7595. 219. Saijo, Y.; Pedaky, L.; Wang, H.; Busch, H. Oncol. Res. 1994, 6, 243. 220. Galbraith, W. M.; Hobson, W. C.; Giclas, E C.; Schechter, R J.; Agrawal, S. Antisense Res. Dev. 1994, 4, 201. 221. Black, L. E.; Farrelly, J. G.; Cavagnaro, J. A.; Ahn, C.-H.; DeGeorge, J. J.; Taylor, A. S.; DeFelice, A. E; Jordan, A. Antisense Res. Dev. 1994, 4, 299. 222. Szymkowski, D. E. Drug Discovery Today 1996, 1, 415. 223. Stein, C. A.; Krieg, A. M. Antisense Res. Dev. 1994, 4, 67. 224. Southern, E. M.; Case-Green, S. C.; Elder, J. K.; Johnson, M.; Mir, K. U.; Wang, L.; Williams, J. C. Nucleic Acids Res. 1994, 22, 1368. 225. Morishita, R.; Gibbons, G. H.; Ellison, K. E.; Nakajima, M.; Zhang, L.; Kaneda, Y.; Ogihara, T.; Dzau, V. J. Proc. Natl. Acad. Sci. USA 1993, 90, 8474. 226. Ho, S. R; Britton, D. H. O.; Stone, B. A.; Behrens, D. L.; Leffet, L. M.; Hobbs, E W.; Miller, J. A.; Trainor, G. I. Nucleic Acids Res. 1996, 24, 1901. 227. Rubenstein, M.; Mirochnik, Y.; Chou, E; Guinan, R J. Surg. Oncol. 1996, 62, 194. 228. Hijiya, N.; Zhang, J.; Ratajczak, M. Z.; Kant, J. A.; deRiel, K.; Herlyn, M.; Zon, G.; Gewirtz, A. M. Proc. Natl. Acad. Sci. USA 1994, 91, 4499. 229. Ensoli, B.; Markham, P.; Kao, V.; Barillar, G.; Fiorelli, V.; Gendelman, R.; Raffeld, M.; Zon, G.; Gallo, R. C. J. Clin. Invest. 1994, 94, 1736. 230. Kitayima, I.; Shinohara, T.; Bilakovics, J.; Brown, D. A.; Yu, Y.; Nerenberg, M. Science 1992, 158, 1792.
SEQUENCE-SPECIFIC RECOGNITION OF DOU BLE-STRANDED DNA BY PEPTI DE N UCLEIC ACI DS
Peter E. Nielsen
I~ II. III. IV. V. VI. VII.
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Peptide Nucleic Acid . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Recognition of DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Antigene Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Gene Activation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Cellular Effects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Gene Therapeutic Drug Potential . . . . . . . . . . . . . . . . . . . . . . . . Acknowledgement . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
I.
267 268 273 275 275 276 276 276 276
INTRODUCTION
Sequence specific targeting of double-stranded D N A has b e e n a long sought goal of anticancer drug design, because this could open the door to design of genetargeted drugs. 1-3
Advances in DNA Sequence-Specific Agents Volume 3, pages 267-278 Copyright 9 1998 by JAI Press Inc. All rights of reproduction in any form reserved. ISBN: 0-7623-0203-8
267
PETERE. NIELSEN
268
A A
A
\
\
Tlarai,e
...,~
'
"" )
A ~U~
.
Adenine
Gr~176
A A
Figure 1. Chemical structures of AT and GC base pairs and molecular recognition from the minor and major grooves. The arrows point to the hydrogen donor and acceptor sites as well as the hydrophobic methyl group of thymine which are accessible from the grooves. Double-stranded DNA may be recognized sequence specifically either from the minor, or, with greater specificity, from the major groove via hydrogen bonding and hydrophobic interactions (Figure 1). Thus DNA may be regarded as a multifunctional receptor. Although some approaches for developing sequence-specific DNA binding reagents like minor-groove binding lexitropsins, ]'4 the major-groove binding, triplex-forming oligonucleotides, 1'5'6 and not least the very promising side-by-side minor groove binders 7'8 have been met with partial success, a general principle has not yet been developed.
II.
PEPTIDE N U C L E I C A C I D
A few years ago we developed a DNA mimic, peptide nucleic acid (PNA), based on a pseudo-peptide backbone to which the DNA nucleobases are attached (Figure 2). 9-16 PNA was originally designed as a major groove "triple helix binder", but surprisingly subsequent experiments showed that sequence-specific binding to double-stranded DNA took place to homopurine tracts via strand displacement upon formation of an internal PNA2/DNA triplex--a P-loop (Figure 3). 17'18 Because a PNA is a pseudo peptide, chemical syntheses have utilized conventional solid-phase peptide methodology 10-13 " employing the four adequately protected nucleobase monomers (A, C, G, and T) (Figure 4) and the Boc -17'18 or later the Fmoc-strategy. ]9 PNA oligomers of 10-20 units in length are routinely prepared and are conveniently purified by reversed-phase HPLC and characterized by mass spectrometry (e.g. MALDI-TOF).
Peptide Nucleic Acids
269 H
N~
B
O'y
.
il
"NH
II
B
DNA
PNA
Figure 2. Chemical structure of PNA compared to DNA. B is one of the nucleobases: adenine, cytosine, guanine or thymine.
Several backbone-modified PNA derivatives have been synthesized and the general conclusion from these studies shows that any methylene extensions within the backbone result in PNAs with drastically reduced hybridization affinity, although a significant sequence discrimination is retained (Table 1).2~ Amino acids other than glycine (e.g. D-lysine) may, however, be incorporated into the pseudopeptide backbone without compromising the hybridization properties, and the D-form is generally preferred (Table 2). 23,24 PNA oligomers are water soluble but some PNAs, in a yet uncharacterized sequence-dependent manner, precipitate at elevated concentrations (-- 1 mM) and/or at high ionic strength. In these cases one or more terminal lysines, or even better, a few lysine backbone modifications will significantly improve the solubility. 24 PNAs retain the nucleic acid hybridization properties of DNA, and at physiological ionic strength (< 1 M Na § the thermal stability of a PNA-DNA duplex is approximately 1 ~ higher than that of the corresponding DNA-DNA duplex. 14 Furthermore, the sequence discrimination of the PNA hybridization is at least as good as that of oligonucleotides. 14 Contrary to oligonucleotides, PNA oligomers can bind to complementary singlestranded DNA, RNA, or PNA oligomers in both orientations, although the antiparallel complexes are more stable (by analogy to peptides, PNAs are oriented from the amino-terminal to carboxy-terminal (thus the amino-terminal of the PNA is facing the 3'-end of the oligonucleotide in an antiparallel complex). 14NMR studies have shown that the PNA adapts somewhat to the nucleic acid conformation, such that the DNA part of a PNA-DNA duplex is in the B-form, 25 whereas the RNA in
PETER E. NIELSEN
270 5'
31
/~CH3
R--N~~/~O""H.N,H , """ ( ~ ~ ' ~ 0 H,,, J "'~I~N~N""HN R / ~~t N~ H~gsteen A C
Watson-Crick
§
H
O
FI
"
9
U
s ~ ~"
O
'
N" H ~
Hoogsteen G
,
H"" N'~rll N" R C
Watson-Crick
C-G T-A G-C C-G A-T (N) ,, G- C T-A-T T-A-T +C-G-c T-A-T T-A-T +C-G-c T-A-T T- FI-T T-A-T T - A - T ...--~ / C-G" (el T-A G-C C-G A-T
T T C T T C T T T T
7-T
Figure 3. Chemical structures of T-AT and C+-GC Hoogsteen-Watson/Crick nucleobases triplets, and schematic representation of a PNA2/DNA-DNA P-loop. The PNA part of the triplets and the P-loop are shown in bold, while the DNA part is shown in grey. N and C denote the amino and carboxy end of the PNA molecule, respectively. In the preferred binding orientation, the amino end of the PNA faces the 3' end of the Watson--Crick DNA strand (anti-parallel orientation), whereas the amino end of the PNA faces the 5' DNA end in the Hoogsteen strand parallel. Thus the two PNA strands are preferably antiparallel. a PNA-RNA duplex is in the A-form. 26 However, these structures also show characteristics towards the P-form helix, which is adopted by PNA 2 duplexes 27 or PNA2-DNA triples. 28The P-form helix is very wide (26-28 ~) and has a very large pitch (16-18 base pairs (triplets)). 27'28 When homopurine single-stranded DNA (or RNA) sequences are targeted with homopyrimidine PNA, extremely stable PNA~DNA (or RNA) triplexes are formed via combined Watson--Crick/Hoogsteen hydrogen bonding (Figure 3), 29 and these show even greater sequence discrimination, especially when linked PNAs (bis-PNAs) are employed. 3~The most stable PNA 2-DNA triplexes are formed with
Peptide Nucleic Acids
2 71
oZJ•/ >o c ~
oN5
Thymine
Cytosine
t B o c N H , " ~ ~ V CooH
tBocN~V
Adenine
COOH
Guanine
Figure 4. Chemical structures of requisite PNA monomers.
Effectson Thermal Stability (ATm, ~ for Structurally Modified PNA T-Monomers when Incorporated into the Oligomer Sequences H-GTA GAT CAC T-NH2
Table 1.
Entry
Stnwture
Backbone~Linker
ATm DNA
AT., RNA
Reference
ethylglycine
0
0
propylglycine
--8.0
-6.5
20
ethyl-13-aniline
-10
--7.5
20
Base /
l
k,~O O
.IJ'-N / ~ / N ~ . 1 J" H Base
2
H
~L/N~
O /
N~ j . r Base
3
.iJ" N ~ N , v ~ ~ H
~ O
(continued)
272
PETER E. NIELSEN
Table 1. (Continued) Entry
Structure
Backbone~Linker
AT m DNA
AT m RNA
Reference
propionyl linker
-20
-16
20
ethyl linker
-22
- 18
21
retro-inverso
.-6.5
nd
22
Base.
4
~
-0 0
H Base /
5
~
0
j.(.N~Nv~j.r. H Base
In
H "~-
6
o
Table 2. Effects on Thermal Stability (ATm, ~ per monomer) for the PNA Sequence H-GIA G A I CAC I - N H 2 a Incorporating Three Chiral Monomers as Compared to an Unmodified PNA 24
0
Entry
7 8
R
CH 3 CH 3
9
sec-Bu
10 11 12 13 14 15
CH2OH CH2OH CH2CO2H CH2CH2COEH (CH2)4NH 2 (CHE)NH 2
Chirality
AT m DNA
AT m RNA
L D L L D L D L D
-1.8 -0.7 -2.6 -1.0 -0.6 -3.3 -2.3 -l.0 +1.0
nd nd -3.0 -1.0 -1.0 nd nd -1.3 0
Peptide Nucleic Acids
273
the Watson-Crick-bonded PNA strand being antiparallel, and the Hoogsteenbonded PNA strand being parallel to the DNA target. 3~ As mentioned above, the stability of PNA2-DNA triplexes is so high that homopyrimidine PNAs, when targeted to homopurine sequences in doublestranded DNA, binds as a PNA2-DNA triplex via strand displacement (Figure 3) 9'17'18 instead of conventional triple-helix formation as observed with oligonucleotides, z3 Such PNA-dsDNA strand displacement complexes show thermal stability equivalent to that observed for oligonucleotide PNA2-DNA triplexes, 31 but the strand invasion is strongly inhibited by elevated ionic strength (> 50 mM), 32'33 although once formed in low-salt buffer, the complexes are stable to high-salt conditions, e.g. as needed for enzymatic activity. 33-35 These and other properties described below make PNAs very attractive genetargeting reagents.
III.
R E C O G N I T I O N OF D N A
The mechanism by which PNA2/DNA-DNA P-loops are formed is not yet known in detail, but it necessarily involves duplex DNA base pair opening (DNA breathing), most probably as (part of) the rate-limiting step. 36-38 The simplest pathway to reach a P-loop is outlined in Figure 5. Footprinting experiments using a 10-mer PNA (TaCT2CT2) show that formation of the single-strand DNA loop and binding of the Hoogsteen PNA strand occurs concomitantly at a wide range of PNA concentrations. 18Therefore any intermediate appears to be much less stable than the final complex. This is also consistent with the finding that mixed purine/pyrimidine PNAs do not bind stably to doublestranded DNA. However, it was recently found that a 10-mer homopurine P N A - which with the complementary oligonucleotide formed a duplex of thermal stability comparable to that of a PNA2-DNA triplex--did indeed invade a double-stranded
PNA
--
PNA
dsDNA
Figure 5. Simplest pathway for P-loop formation. The DNA is shown in black, while the PNA is grey.
274
PETER E. NIELSEN
DNA target. 39 Also it has been shown by Dnase I footprinting that a cytosine-rich homopyrimidine PNA is capable of triplex binding to double-stranded DNA, although the most stable complex is that of strand displacement. 4~Thus, the binding mechanism of strand invasion is surely more complex than the simple scheme presented in Figure 5. Recent kinetic binding data shows that the pronounced sequence discrimination exhibited by PNA binding, e.g. between PNA-T10 and PNA TsCT4 to an Alo target, is kinetically controlled, 36 although even the single mismatch complexes once formed are thermodynamically stable. This conclusion is also consistent with results obtained by electron microscopy analysis of the DNA binding of biotinylated PNAs using streptavidin for the EM mapping. 41 Binding of cytosine-containing PNAs is more efficient at acidic pH and quite inefficient at pH >8,18 because Hoogsteen hydrogen bonding of the second PNA strand requires protonation of the cytosine (Figure 3), which in free form has a pKa of ~4.5. Several alternative nucleobases such as 8-oxoadenine 42'43or pseudoisocytosine 44 have been employed with triplex-forming oligonucleotides in order to obtain pH-independent binding. Likewise, PNAs containing pseudoisocytosine (Figure 6) instead of cytosine bind DNA without pronounced pH sensitivity, 3~Furthermore, since two PNA strands are required for P-loop formation upon binding to doublestranded DNA, bis-PNAs in which two PNA molecules are covalently linked bind
H
Watson-Crick
G
H
'.
H
%/ t,
t G
Figure 6. Chemical structures of C+.GC and viC.GC base triplets.
275
Peptide Nucleic Acids
more efficiently. This is especially true when the cytosine strand forming the Watson-Crick hydrogen bonding is antiparallel with the DNA target, and the Hoogsteen strand is parallel with the DNA target. 3~ Strand displacement binding of PNA to a target in double-stranded DNA is very sensitive to the presence of cations that stabilize the DNA duplex, and a dramatic decrease in binding rate is seen under physiological ionic strength conditions. 32'45 However, by including several lysines in the PNA, combined with the employment of the linked bis-PNAs 3~ containing pseudoisocytosine in the Hoogsteen strand, 3~ it is possible to invade duplex targets at 140 mM K+.45 Furthermore, it has been demonstrated that negative supercoiling of the DNA (e.g. induced by the transcription process) increases the PNA binding up to 200-fold, 37 and also the transcription itself catalyzes PNA binding, presumably because the PNA catches the transient transcription bubbles. 46 Therefore, in the nucleus, PNA may actually be targeted to actively transcribing genes by the transcription process.
IV. ANTIGENE ACTIVITY Efficient inhibition of transcription by triplex-forming oligonuleotides is only obtained when the target is part of the transcriptional promoter, 47 or the oligonucleotide is covalently bound to the target. 48 (Recent results using phosphoramidates indicate that these may effectively block elongating RNA polymerase). 49 PNA strand displacement complexes, in contrast, efficiently block transcription elongation even when positioned far downstream from the promoter, thereby producing truncated RNA transcripts. 35'5~ This requires, however, that the PNA target is situated on the template DNA strand. It has been found that even an 8-mer PNA (T8) is able to efficiently block phage T 3 polymerase in vitro. 35 Experiments analyzing the effect of having a PNA target within a promoter region have been reported for the IL-2Rcx gene, and efficient inhibition of gene expression was demonstrated. 4~ Conversely, PNA binding proximal to or overlapping a restriction enzyme cleavage site efficiently inhibits DNA cleavage by the enzyme. 32'33Thus PNA binding in a promoter region interferes with RNA polymerase and/or transcription factor binding, thereby prohibiting transcription initiation.
V. GENE ACTIVATION It has been demonstrated that P-loops are efficient transcription initiation sites for E. coli and mammalian RNA polymerases in which the polymerase starts transcription using the single-stranded DNA loop as a template. 52 This is consistent with the affinity of RNA polymerase for single-stranded DNA and with its ability to transcribe single-stranded DNA. Likewise it was recently shown that E. coli polymerase 53 also initiates transcription from DNA mismatch loops of--10 bases. Furthermore, the PNA promoter appears to be at least as strong as the lacUV5 promoter 52 in an in vitro E. coli assay. PNAs can thus mimic the action of a
276
PETER E. NIELSEN
transcription factor using the PNA target as a promoter, and PNAs are therefore potentially gene-specific activating drugs, an entirely new concept in drug development.
VI. CELLULAR EFFECTS Effects of PNAs on intact cells have only been demonstrated upon cellular microinjection. The results showed a PNA antisense activity against a transfected gene. 5~ Like oligonucleotides, 54 PNAs are poorly taken up by cells and studies of possible delivery systems, such as liposomes, have not yet been reported.
VII. GENE THERAPEUTIC DRUG POTENTIAL PNA is clearly a good lead in gene therapeutic drug design, either employing an antisense or an antigene strategy, 35'46'5~ provided specific and sensitive targets can be identified. 56 PNAs can be designed that bind strongly, and sequence specifically to any mRNA sequence, or to any homopurine-rich sequences in double-stranded DNA. While PNA binding to mRNA interferes with translation, PNA-dsDNA strand displacement i~omplexes prohibit protein binding and block RNA polymerase elongation. Furthermore, PNAs are biologically 57 and chemically stable. It is also of interest to note that PNAs targeted to the RNA of telomerase, which carries its own telomere template, are very potent and specific inhibitors of this presumably cancer-related enzyme. 58 Areas of continued research efforts include cellular uptake and general recognition of mixed purine/pyrimidine targets in double-stranded DNA, especially at physiological ionic conditions. However, it should be mentioned that uptake studies on isolated cells in culture are not necessarily a good model for in vivo drug delivery. It has been found that phosphorothioate oligonucleotides show extensive tissue distribution, metabolism, and antitumor effects in animal studies 59-61 despite their poor in vitro cellular uptake. Likewise, the apparently poor cellular uptake of PNAs may not be reflecting the in vivo situation.
ACKNOWLEDGEMENT This work was supported by the Danish National Research Foundation.
REFERENCES 1. 2. 3. 4.
Nielsen,P. E. Bioconjugate Chem. 1992, 2, 1. Dervan,P. B. Nature 1992, 359, 87. Helene, C. Curr. Opin. Biotech. 1993, 4, 29. Lown, J. W. In Molecular Basis of Specificity in Nucleic Acid-Drug Interaction; Pullman, B.; Jortner, J.; Eds., KluwerAcademic: Dordrecht, 1990, Vol. 23, p. 103. 5. Moser, H. E.; Dervan, P. B. Science 1987, 238, 645.
Peptide Nucleic Acids
277
6. Doan Le, T.; Perrouault, L.; Praseuth, D.; Habhoub, N.; Decout, J. L.; Thuong, N. T.; Lhomme, J.; Helene, C. Nucleic Acids Res. 1987, 15, 7749. 7. Parks, M. E.; Baird, E. E.; Dervan, P. B. J. Amer. Chem. Soc. 1996, 118, 6147. 8. Swalley, S. E.; Baird, E.E .; Dervan, P. B. J. Amer. Chem. Soc. 1996, 118, 8198. 9. Nielsen, P. E.; Egholm, M.; Berg, R. H.; Buchardt, O. Science 1991, 254, 1497. 10. Egholm, M.; Buchardt, O.; Nielsen, P. E.; Berg, R. H. J. Amer. Chem. Soc. 1992, 114, 1895. 11. Egholm, M.; Buchardt, O.; Nielsen, P. E.; Berg, R. H. J. Amer. Chem. Soc. 1992, 114, 9677. 12. Dueholm, K. L.; Egholm, M.; Behrens, C.; Christensen, L.; Hansen, H. F.; Vulpius, T.; Petersen, K.; Berg, R. H.; Nielsen, P. E.; Buchardt, O. J. Org. Chem. 1994, 59, 5767. 13. Christensen, L.; Fitzpatrick, R.; Gildea, B.; Petersen, K. H.; Hansen, H. E; Koch; T.; Egholm, M.; Buchardt, O.; Nielsen, P. E.; Coull, J.; Berg, R. H. J. Peptide Sci. 1995, 3, 175. 14. Egholm, M.; Buchardt, O.; Christensen, L.; Behrens, C.; Freier, S. M.; Driver, D. A.; Berg, R. H.; Kim, S. K.; NordJn, B.; Nielsen, P. E. Nature 1993, 365, 556. 15. Hyrup, B.; Nielsen, P. E. Bioorg. Biomed. Chent 1996, 4, 5. 16. Larsen, H. J.; Nielsen, P. E. InAnalysis ofAntisense andRelated Compounds; Cohen, A.S.; Smisek, D.L., Eds., CRC Press: Boca Raton, FL, 1997, in press. 17. Cherny, D. Y.; Belotserkovskii, B. P.; Frank-Kamenetskii, M. D.; Egholm, M.; Buchardt, O.; Berg, R. H.; Nielsen, P. E. Proc. Natl. Acad. Sci. USA 1933, 90, 1667. 18. Nielsen, P. E.; Egholm, M.; Buchardt, O. J. Mol. Recog. 1994, 7, 165. 19. Thomson, S. A.; Josey, J. A.; Cadilla, R.; Gaul, M. D.; Hassman, E C.; Luzzio, M. J.; Pipe, A. J.; Reed, K. L.; Ricca, D. J.; Wiethe, R. W.; Noble, S. A. Tetrahedron 1995, 51, 6179. 20. Hyrup, B.; Eghlom, M.; Nielsen, P. E.; Wituung, P.; NordJn, B.; Buchardt, O. J. Amer. Chem. Soc. 1994, 116, 7964. 21. Hyrup, B.; Egholm, M.; Buchardt, O; Nielsen, P. E. Bioorg. Med. Chem. Lett. 1996, 6, 1083. 22. Krotz, A. H.; Buchardt, O.; Nielsen, P. E. Tetrahedron Lett. 1995, 36, 6941. 23. Dueholm, K.; Petersen, K. H.; Jensen, D. K.; Egholm, M.; Nielsen, P. E.; Buchardt, O. Bioorg. Med. Chem. Lett. 1994, 4, 1077. 24. Haaima, G.; Lohse, A.; Buchardt, O.; Nielsen, P. E. Angewandte Chemie 1996, 35, 1939. 25. Eriksson, M.; Nielsen, P. E. Nature Struc. Biol. 1996, 3, 410. 26. Brown, S. C.; Thomson, S. A.; Veal, J. M.; Davis, D. G. Science 1994, 265, 777. 27. Rasmussen, H.; Kastrup, J. S.; Nielsen, J. N.; Nielsen, J. M.; Nielsen, P. E. Nature Struct. Biol. 1997, 4, 98. 28. Betts, L.; Josey, J. A.; Veal, J. M.; Jordan, S. R. Science 1995, 270, 1838. 29. Kim, S. K.; Nielsen, P. E.; Egholm, M.; Buchardt, O.; Berg, R. H.; NordJn, B. J. Amer. Chem. Soc. 1993, 115, 6477. 30. Egholm, M.; Christensen, L.; Buchardt, O.; Coull, J.; Nielsen, P. E. Nucleic Acids Res. 1995, 23, 217. 31. Nielsen, P. E.; Egholm, M.; Berg, R. H.; Buchardt, O. In Antisense Research and Application; Crook, S.; Lebleu, B., Eds.; CRC Press: Boca Raton, FL, 1993, p. 363. 32. Nielsen, P. E.; Egholm. M.; Berg, R. H.; Buchardt, O. Nucleic Acids Res. 1993, 21, 197. 33. Peffer, N. J.; Hanvey, J. C.; Bisi, J. E.; Thomson, S. A.; Hassman, E C.; Noble, S.A.; Babiss, L.E. Proc. Natl. Acad. Sci. USA 1993, 90, 10648. 34. Nielsen, P. E., unpublished observations. 35. Nielsen, P. E.; Egholm, M.; Buchardt, O. Gene 1994, 149, 139. 36. Demidov, V. V.; Yavnilovich, M. V.; Belotserkovskii, B. P.; Frank-Kamenetskii, M. D.; Nielsen, P. E. Proc. Natl. Acad. Sci. USA 1995, 92, 2537. 37. Bentin, T.; Nielsen, P. E. Biochemistry 1996, 35, 8863. 38. Wittung, P.; Nielsen, P. E.; NordJn, B. J. Amer. Chem. Soc. 1996, 118, 7049. 39. Nielsen, P. E.; Christensen, L. J. Amer. Chem. Soc. 1996, 118, 2287. 40. Praseuth, D.; Grigoriev, M.; Guieysse, A. L.; Pritchard L. L., Harel-Bellan, A.; Nielsen, P. E.; Helene, C. Biochim. Biophys. Acta 1996, 1309, 226.
278
PETER E. NIELSEN
41. Demidov, V. V.; Chemy, D.; Kurakin, A. V.; Yanilovich, M. V.; Malkov, V. A.; Frank-Kamenetskii, M. D.; Sonnichsen, S. H.; Nielsen, P. E. Nucleic Acids Res. 1994, 22, 5218. 42. Miller, P. S.; Bhan, P.; Cushman, C. D.; Trapane, T. L. Biochemistry 1992, 31, 6788. 43. Jetter, M. C.; Hobbs, F. W: Biochemistry 1993, 32, 3249. 44. Ono, A.; Ts'o, P. O. P; Kan, L. J. Org. Chem. 1992, 57, 3225. 45. Griffith, M. C.; Risen, L. M.; Greig, M. J.; Lesnik, E. A.; Sprangle, K. G.; Griffey, R. H.; Kiely, J. S.; Freier, S. M. J. Amer. Chem. Soc. 1995, 117, 831. 46. Larsen, H. J.; Nielsen, P. E. Nucleic Acids Res. 1996, 24, 458. 47. Duval-Valentin, G.; Thuong, N.; Helene, C. Proc. Natl. Acad. Sci. USA 1992, 89, 504. 48. Grigoriev, M.; Praseuth, D.; Guieysse, A. L.; Robin, P.; Thuong, N. T.; Helene, C.; Harel-Bellan, A. Proc. Natl. Acad. Sci. USA 1993, 90, 3501. 49. Escude, C.; Giovannangeli, C.; Sun, J. S.; Chen, J. K.; Gryaznov, S. M.; Garastier, T.; Helene, C. Proc. Natl. Acad. Sci. USA 1996, 93, 4365. 50. Hanvey, J. C.; Peffer, N. C.; Bisi, J. E.; Thomson, S. A.; Cadilla, R.; Josey, J. A.; Ricca, D. J.; Hassman, C. E; Bonham, M. A.; Au, K. G.; Carter, S. G.; Bruckenstein, D. A.; Boyd, A. L.; Noble, S. A.; Babiss, L. E. Science 1992, 258, 1481. 51. Vickers, T. A.; Griffith, M. C.; Ramasamy, K.; Risen, L. M.; Freier, S. M. Nucleic Acids Res. 1995, 23, 3003. 52. Mollegaard, N. E.; Buchardt, O.; Egholm, M.; Nielsen, P. E. Proc. Natl. Acad. Sci. USA 1994, 91, 3892. 53. Aiyer, S. E.; Helmann, J. D.; deHaseth, P. L. J. Biol. Chent 1994, 269, 13179. 54. Bonham, M. A.; Brown, S.; Boyd, A. L.; Brown, P. H.; Bruckenstein, D. A.; Hanvey, J.C.; Thomson, S.A.; Pipe, A.; Hassman, F.; Bisi, J. E.; Froehler, B. C.; Matteucci, M. D.; Wagner, R. W.; Noble, S. A.; Babiss, L. E. Nucleic Acids Res. 1995, 23, 1197. 55. Knudsen, H.; Nielsen, P. E. Nucleic Acids Res. 1996, 24, 494. 56. Knudsen, H.; Nielsen, P. E. Anti Cancer Drugs 1997, in press. 57. Demidov, V.; Potaman, V. N.; Frank-Kamenetskii, M. D.; Buchardt, O.; Egholm, M.,; Nielsen, P. E. Biochem. Pharmacol. 1994, 48, 1309. 58. Norton, J. C.; Piatyczek, M. A.; Wright, W. E.; Shay, J. W.; Corey, D. R. Nature Biotechnol. 1996, 14,615. 59. Cossum, P. A.; Troung, L.; Owens, S. R.; Markham, P. M.; Shea, J. P.; Crooke, S. T. J. Pharmacol. Exp. Therapeut. 1994, 269, 89. 60. Cossum, P. A.; Sasmor, H.; Dellinger, D.; Truong, L.; Cummins, L.; Owens, S. R.; Markham, P. M.; Shea, J. P.; Crooke, S. J. Pharmacol. Exp. Therapeut. 1994, 267, 1181. 61. Monia, B. P.; Johnston, J. F.; Geiger, T.; Muller, M.; Fabbro, D. Nature Med. 1996, 2, 668.
INDEX
ABCD ring system, 50 Adducts, protein recognition and, 180181 ADEPT. s e e Antibody-Directed Enzyme Prodrug Therapy A-DNA, 76, 181 AIDS, 123 Aliphatic mustards, 168. s e e a l s o Mustard prodrugs Alkylating drugs, 119 Amino acid, sequence homology, 13-14 Amsacrine, 18, 93, 140 Anaerobic infections, 125 Antibody Directed Enzyme Prodrug Therapy (ADEPT), 171-175 Anticancer drugs design, 267-268 DNA damage and, 4 need for, 1-2 oligonucleotides and, 239-255 specificity, 4-6 Antigene activity, 275-276 drug design, 228-259 protein expression and, 229-238 Antisense cellular uptake of, 238-239 drug design, 228-259 modifications of, 234 oligonucleotides, 229-238
protein expression and, 229-238 RNA and, 99 strategy, 230 toxicology of, 255-257 Antitumor drugs, 202 amsacrines, 18, 93, 140 etoposide and, 18 Antitumor activity, DNA binding and, 100-102
Aproprotein, maduropeptin and, 220223 AT sequences, 107-110 ATP-dependent molecular clamp, 1213 ATP-modulated protein-clamp, 138139 Azatoxin, developement of, 26 B-DNA, 181 Bax, cell death and, 31 Bcl-2, cell survival and, 31 Bcl-2 gene, 244 Berenil, 28 Bis-benzimidazoles, 69, 77-83, 87-93, 166-167 Bulgarein, 57-58 Camptothecin, 43-53, 61 Cancer, 61, 98-100, 249
279
280
Cancer pharmacology, 61 Carboxypeptidase, 172-173 Cationic porphyrins, 124 CDE drug rings, 52 Cell cycle death, 31 genetic mechanisms and, 29-32 phosphorylation, 15 topoisomerase II and, 16 Chelating ligands, 184 Chemotherapy, 4, 98-100 Chinese hamster cell, 47 Chromophore kedarcin and, 203-209 maduropeptin and, 215-220 cis-DDP-DNA, 180-183 Cleavage chemistry, 43, 204-209, 218220 Combilexins, 132-144 Cytokines, 98 Cytotoxic compounds, 100 Dinuclear platinum complexes, 185192 Distamycin, 28 binding/modifying element, 118144 derivatives, 118-144 DNA recognition and, 144 DNA-targeted mustards, 161-167 DNA adducts, 182-183 alkylation, 119-123, 158-160 anticancer drugs and, 4, 228 antitumor activity and, 100-102 binding, see DNA binding breakage, 25, 194-196 cleavage, 29, 71,204-209, 218-220 cutting/rejoining enzymes, 2 damage to, 4, 228 degradation, 130 DNAase, 127, 274 endonulease, 127
INDEX
fragments, 99 gyrase, 9, 17 helicase, 30 HIV and, 29 hydrogen bonding and, 79 intercalating agents, 101, 132-144 internucleosomal DNA ladders, 32 ligand binding sites, 74, 77-87, 127, 174 mustards and, 161-167 photosensitizers, 123-124 platinum, 194-196 polymerase, 3 recognition, 73-77, 102-107, 132144, 267-276 repair gene, 45 replication, 30 sequence, 1-6 structure, 103 synththesis, 180-187 topology of, 8, 138 trans-DDP, 192-193 DNA binding, 68, 101, 183-185 agents, 68 anticancer agents and, 4, 228 antitumor activity and, 100-102 bis-benzimidazoles, 93 cis-DDp, 181-183 domain, 104 minor-groove, 19, 70, 103-104, 164167 sequence recognition properties, 7377 topoisomerase I and, 42, 61 topoisomerase II and, 92-93 DNA recognition, 73-77, 102-107, 132-144, 267-276 DNA topoisomerases, see Topoisomerase I; Topoisomerase II DNA topology, 8, 138 DNAase I, 127, 138 Drosophila, 14-15, 30-41
Index
Drug design, 258 antigene, 228-259 antisense, 228-259 mechanisms of action, 30-32 pharmacophores, 22 receptor sites, 24-25 Dual poisons, of topoisomerase I-II, 54, 58-61 E. coli, DNA gyrase and, 17
Electric linear dichroism, 82-87 Endonuclease, 127 Enzyme functions, DNAase, 127, 274 endonuclease, 127 eukaryotic, 13-19 gyrase, 9, 17 helicase, 30 phosphorylation, 15 subunit activity, 23-24 topoisomerase, see Topoisomerase I; Topoisomerase II erbB2 oncogene, 246 Etoposide, 18 Eukaryotic enzymes, 13-19 Eukaryotic topoisomerase I. see Topoisomerase I Eukaryotic topoisomerase II. see Topoisomerase II Footprinting, 11, 56, 68, 110, 127-128, 136, 174, 274 FTIR spectroscopy, 77-82 GADD genes, 31 GC recognition elements, 68 Genes, 98-100 activation activity, 275-276 amplification, 243 cell killing and, 30-32 drug potential, 276 GADD genes, 31 K-ras gene, 99
281
MDR gene, 254 MDR1 gene, 254 p53 gene, 99, 243 R A D 5 2 repair gene, 45 ~-Glucuronidase, 173 Helix-turn-helix motif, 103 Hematological malignancies, 241-245 Histones, proteolytic cleavage of, 211212 Hoechst 33258, 77-81, 91,104-105 analogue, 80 FTIR spectroscopy and, 81-82 Micrococuccus Lysodeikticus and, 87 topoisomerase and, 89-92 Holoantibiotic, 202-203, 214-215 Hoogsteen hydrogen bonding, 5 Human colon cancer, 249 Hydrogen bonding, 5, 70, 163,268 Hydrophobic interactions, 268 Hypoxia-activated prodrugs, 167-171 Indolocarbazole, 57 Internucleosomal DNA ladders, 32 Kerdarcidin, 202:223 apoprotein, 209-214 chemical structure of, 203-204 chromophore, 203-209 holoantibiotic, 202-203 macromolecular synthesis and, 209211 NMR studies, 208-209 proteolytic cleavage of, 211-212 Kinase, tumor growth and, 245 Kinetics studies, 159 K-ras gene, 99 ~-Lactamase, 173 Leucine-zipper motif, 103 Lexitropsins, 110-118 bismustard cross linked, 120 design principles, 70-73
282
Ligand-DNA interactions, 74 A-DNA and, 76 analysis of, 77-87 binding sites DNA and, 127 chelating, 184 DNA and, 77-87 nucleic acids and, 68 Z-DNA and, 76 Maduropeptin, 202-223 chromaphore structure, 215-220 DNA cleavage and, 219 holoantibiotic, 214-215 proteolytic cleavage and, 220-223 Makulvamines, topoisomerase II and, 26-28 Maxam-Gilbert sequencing methods, 128 Metal-complexing group, 127-131 Metalloproteinase, 249 Microgonotropen approach, 118-119 Minor-groove binding drugs, 19, 105107, 113-114 DNA sequence recognition and, 6893 drug design and, 107-110 sequence specific, 107-118 topoisomerase II and, 28 Mouse cell, topoisomerase I and, 41 Multidrug resistance, 250-255 Mustard prodrugs, 171-175 acridine-linked, 120-121 quarternary salts, 170 transition metal complexes, 171-172 Mycrocococus Lyssdekticus, Hoeechst 33258 and, 87 Netropsin binding/modifying element, 118144 derivatives, 118-144 DNA recognition and, 144
INDEX
Nitrogen mustard, 122 anticancer drugs and, 158-175 classical, 158-161 NMR studies, 1921 208-209 Non-cytotoxic compounds, 100 NR2 Nitroreductase, mustard prodrugs for, 173 Nucleic acid binding, 2-4 Oligonucleotides, 99, 229-238 Oncogenes, activation of, 244-250 Oncology, 228-259 Penicillin G amidase, mustard prodrugs for, 173 Peptide nucleic acid, 102-103, 129, 267-276 Peptidomimetics, 6 Phosphorylation sites of, 15 topoisomerase I, 41 Photosensitive group, 123-127 Plasmid DNA, 204, 216 Plasmodium falciparum, 56 Platinum complexes, 180-184, 187 P-loop formation, 273 PNA. see Peptide nucleic acids Poisons, classical determinants of, 19-26 DNA topoisomerases and, 8-26 dual, 54, 58-61 sequence specific, 18-26 structural determinants of, 19 Polybenzamide cariers, 166-167 Polypyrrole/polymidazole carders, 164-166
Prodrugs, 167 ADEPT and, 171-174 mustards and, 171-174 Prokaryotic enzymes, 13-18
Index
Proteins, 102-105 expression, inhibition of, 210, 229238 recognition, 182-183 Proteins, 102-105 Proteolytic cleavage kedarcidin, 211-212 of histones, 220-223 specificity of, 212-213, 221-223 Pyridoimidazole ring, 83 Quinone-netropsin hybrids, 124
RAD52, DNA repair gene, 45 Raman technique, 25 Ras oncogene, 245 RNA antisense, 99 binding affinity, 235,257 duplex, 270 platinum lesions, 187 polymerase, 3, 41,275-275 S. aureus, 17 Sequence recognition properties, 7376, 102-105, 218-220, 267276 Solid tumors, 244-250 S. plicatus, 105 SPKK peptide, 104 S. pombe, DNA topoisomerase and, 14 SPXX motif, 105 Streptomyces zelensis, 105 Targeting drugs, for topoisomerases, 53-61 Topoisomerase I camptothecin and, 46-49, 55-58 DNA binding specificity and, 41
283
Hoechst 33258 and, 89-92 mechanisms of action, 42-43 mutants, 46-48 phosphorylation and, 41 physiological roles, 41-42 poisons, 54, 57-58 targeting drugs and, 41-43, 53-61 Topoisomerase II ATP-modulated protein-clamp model, 138-139 azatoxin, 26 bis-benzimidazoles and, 91-92 directed drugs, 26-29 drug resistance, 17-19, 26 enzyme subunit cooperation, 23-24 mutants of, 17-19 poisons, 19-28, 54, 138 structure and function of, 12-17 Topoisomerase IV, 9 Topoisomerase-targeting drugs, 41-43, 53-61 trans-DDP, DNA binding and, 192-193 trans-platinum damage, 194-196 trans-platinum geometry, 196 Tumor growth, kinase and, 245 Tumor supressor gene (p53), 243 van der Waals contacts, 68, 77, 103 Watson-Crick hydrogen bonding, 163, 258 X-ray crystallography, 56, 70, 166 Yeast, 18 Z-DNA, ligands and, 76 Zinc-finger motifs, 103 Zyzzya, 26
.1 A
Advances in DNA Sequence Specific Agents Edited by Graham B. Jones, Department of Chemistry, Clemson University, Clemson, South Carolina Sequence recognition of DNA can be achieved by DNA binding proteins and small molecular weight ligands. The molecular interactions which lead to sequence recognition are of considerable importance in chemistry and biology. This series entitled Advances in DNA Sequence Specific Agents will examine the techniques used to study DNA sequence recognition and the interactions between DNA and protein and small molecular weight molecules which lead to sequence recognition.
P R E S S
Volume 1, 1992, 347 pp. ISBN 1-55938-165-5
$109.50/s
CONTENTS: Introduction to Series: An Editor's Foreword, Albert Padwa. Preface. PART I: METHODS USED TO EVALU-
ATE SEQUENCE SPECIFICITY OF DNA REACTIVE COMPOUNDS. Application of Equilibrium Binding Methods for Determination of DNA Sequence Specificity, Jonathan B. Chaires. Quantitative Aspects of Dnase 1+ Footprinting, Jim Dabrowiak. Use of Circular Dichroism to Probe DNA Structure and Drug Binding to DNA, Christoph Zimmer, Jena and Gerhard Luck. NMR Analysis of Reversible Nucleic Acid-Small Molecule Complexes, W. David Wilson, Ying Li and James M. Veal Use of Enzymatic and Chemical Probes to Determine the Effect of Drug Binding on Local DNA Structure, Keith R. Fox. PART I1: SEQUENCE SPECIFICITY OF DRUGS THAT INTERACT WITH DNA IN THE MINOR GROVE. The DNA Sequence Selectivity of CC-1065, Martha Warpehoski. Mitomycin C: DNA Sequence Specificity of a Natural DNA CrossLinking Agent, Maria Tomasz. Sequence Specificity of the Pyrrolo (1,4) Benzodiazepines, John A. Mountzouris and Laurence Hurley. Calicheamicin/Esperamicin, George Ellestad and Nada Zein. DNA Sequence Control Mechanism of Oxidative Deoxyribose Damage by Neocarzinostatin, Irvine Goldberg. Index.
Volume 2, 1996, 246 pp. ISBN 1-55938-166-3
$109.50/s
CONTENTS: Editor's Foreword. Preface, Laurence H. Hurley and Jonathan B. Chaires. PART I: METHODS USED TO EVALUATE THE MOLECULAR BASIS FOR SEQUENCE SPECIFICITY. Calorimetric Studies of Drug-DNA Interactions, Luis A. Markey, Karen Alessi, and Dionisios Rentzeperis. Molecular Modeling of Drug-DNA Interactions: Fact and Fantasies, John O. Trent and Stephen Neidle. X-Ray Crystallographic and NMR Structural Studies Of Anthracycline Anticancer Drugs: Implication of Drug Design, Andrew H.J. Wang. Transcription Assay for Probing Molecular Aspects of DrugDNA Interactions, Don R. Phi/tips. PART I1: SEQUENCE SPECIFICITY OF DNA INTERACTIVE DRUGS. Molecular Recognition of DNA by Daunorubicin, Jonathan B. Chaires. Covalent Interactions of Ethidium and Actinomycin D with Nucleic Acids, David E. Graves. DNA Binding of Dinuclear Platinum Complexes, Nicholas Farre//. DNA Sequence Selectivity of the Pyrrole-derived, Bifunctional Alkylating Agents, Paul B. Hopkins. Index.
FACULTY/PROFESSIONAL discounts are available in the U.S. and Canada at a rate of 40% off the list price when prepaid by personal check or credit card and ordered directly from the publisher.
JAI PRESS INC.
55 Old Post Road No. 2 - P.O. Box 1678 Greenwich, Connecticut 06836-1678 Tel: (203) 661- 7602 Fax: (203) 661-0792
.1 A
P R E 5; S
J A l P R E S S
Advances in Biophysical Chemistry Edited by C. Allen Bush, Department of Chemistry and Biochemistry, The University of Maryland, Baltimore County The rapid growth of biotechnology and drug design, based on rational principles of biopolymer interactions, has generated many new developments in the field of biophysical chemistry. These volumes present an overview of several of the most recent topics in high-resolution nuclear magnetic resonance spectroscopy and molecular modeling, along with structural chemistry crucial for protein design. Volume 6, 1997, 253 pp. ISBN 0-7623-0060-4
$112.50/s
CONTENTS: Preface, C. Allen Bush. Thermodynamic Solvent Isotope Effects and Molecular Hydrophobicity, Terrence G. Oas and Eric J. Toone. Membrane Interactions of Hemolytic and Antibacterial Peptides, Karl Lohner and Richard M. Epand. Spin-Labeled Metabolite Analogs as Probes of Enzyme Structure, Chakravarthy Narasimhan and Henry M. Miziorko. Current Perspectives on the Mechanism of Catalysis by the Enzyme Enolase, John M. Brewer and Lukasz Lebioda. Protein-DNA Interactions: The Papillomavirus E2 Proteins as a Model System, Rashmi S. Hedge. NMR-Based Structure Determination for Unlabeled RNA and DNA, Philip N. Borer, Lucia Pappalardo, Deborah J. Kerwood, and Istv~n Pelczer. Evolution of Mononuclear to Binuclear CUA: An EPR Study, William E. Antholine. Index.
Also Available: Volumes 1-5 ( 1 9 9 0 - 1 9 9 5 )
JAI PRESS INC.
$112.50/s
55 Old Post Road No. 2 - P.O. Box 1678 Greenwich, Connecticut 06836-1678 Tel: (203) 661- 7602 Fax: (203) 661-0792
each