ADVANCES IN
Immunology EDITED BY FRANK J. DIXON The Scripps Research Institute La Jolla, California ASSOCIATE EDITORS
...
15 downloads
935 Views
29MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
ADVANCES IN
Immunology EDITED BY FRANK J. DIXON The Scripps Research Institute La Jolla, California ASSOCIATE EDITORS
FREDERICK ALT K. FRANK AUSTEN TADA~LI ITS U KI S H I M OTO FRITZMELCIIEHS JONATHAN
W. UHR
VOLUME 56
ACADEMIC PRESS San Diego New York Boston London Sydney Tokyo Toronto
This book is printed on acid-free paper. @
Copyright 0 1994 by ACADEMIC PRESS, INC. All Rights Reserved. No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without permission in writing from the publisher.
Academic Press, Inc.
A Division of Harcourt Brace & Company 525 B Street, Suite 1900, San Diego, California 92101-4495
United Kingdom Edition published by
Academic Press Limited 24-28 Oval Road. London NWI 7DX International Standard Serial Number: 0065-2776 International Standard Book Number: 0- 12-022456-9
PRINTED IN THE UNITED STATES OF AMERICA
9 4 9 5 9 6 9 1 9 8
99
BB
9 8 1 6 5 4 3 2 1
ADVANCES IN IMMUNOLOGY, VOL 56
Properties and Functions of Interleukin-10 TIM R. MOSMANN Department of Immunology, Universify of Alberta, Edmonton, Alberta, Canada T6G 2H7
1. Introduction
The initial discovery (1)that led to the characterization and cDNA cloning(2)ofinterleukin-10 ( ILlO) was the demonstration that supernatants from activated T cells could inhibit the secretion of cytokines by TH1 T cell clones. This activity was named cytokine synthesis inhibitory factor (CSIF); after the corresponding recombinant cDNA clone was obtained, it rapidly became clear that CSIF has a large number of functions mediated on multiple cell types and the name ILlO was assigned. ILlO inhibits several macrophage functions, including some microbicidal properties and presentation of antigen to T H 1 cells. In contrast, ILlO has generally enhancing or stirnulatory functions on B cells and mast cells. Since ILlO is produced by macrophages and other cell types in addition to the T cells from which it was originally identified, it is clear that IL10, in common with several other cytokines, has a much more complex role in the immune system than could be inferred from the original activity. II. Discovery
A. THE THlITH2 DICHOTOMY Many strong immune responses tend to involve either mainly delayed type hypersensitivity (DTH) or mainly antibody secretion, and there is considerable evidence that these two responses are often mutually exclusive (3,4).The discovery oftwo types of T helper clones in panels of both mouse (5) and human (6) T cell clones offers some explanation for the reciprocal expression of the two responses. When activated by antigedantigen-presenting cells (APC), TH 1 cells produce IL2, interferon-? (IFNy), and iymphotoxin (LT) (5,7-9); provide limited help for B cell responses (10);and strongly activate cellmediated responses. IFNy is a major macrophage-activating factor (11-13), TNF and IFNy activate granulocytes (14,15), and TH1 cells can initiate DTH reactions (16). The T H l cytokine pattern is often associated with strong DTH reactions in uivo. These functions of T H 1 cells are particularly appropriate for destroying the infected cells dur1 Copyright 0 1994 b y Academic Press, lnc. All rights of reproductmu in m y form reserved.
2
TIM R. MOSMANN
ing infections by intracellular pathogens. In contrast, the TH2 cytokine pattern includes IL4, IL5, IL6, IL9, IL10, and P600 (IL13) (7,17), and TH2 cells are stimulatory for antibody responses but inhibitory for cell-mediated or DTH responses. TH2 cells stimulate B cells by production of IL4, IL5, IL6, and IL10. In very strong TH2 responses this can lead to an allergic reaction since IL4 induces switching to IgE ( 1 8 ~ 9and ) IL5 is the major growth and differentiation factor for eosinophils (20-22). Also, at least in the mouse, several TH2 cytokines (IL3, IL4, IL9, IL10) are stimulatory for mast cell proliferation and activation (23-26). As suggested by this brief description of TH1 and TH2 functions, the secretion of different patterns of cytokines contributes strongly to the major functional differences between these subtypes. Thus the cross-regulation of antibody and DTH responses may be explained in part by cross-regulation of the differentiation and activation of TH1 and TH2 T cells during an immune response. Some of the cross-inhibitory regulators of THl/TH2 derivation and function are known: IFNy is produced by TH1 cells and inhibits the proliferation of TH2 clones (27,28) whereas IL4 is produced by TH2 cells and inhibits the differentiation of TH1 cells (29,30). B. CSIF, A TH2 CYTOKINE THATINHIBITS TH1 CELLS Several years ago we were searching for a cross-regulatory cytokine that would be produced by TH2 cells and inhibit the functions of TH1 cells. We found that TH2 supernatants contained an activity that inhibited cytokine production in cocultures of TH1 cells, APC, and antigen (1).This effect was specific for TH1 cells since TH2 cells responded normally in the presence or absence of the TH2 supernatant factor, CSIF. After immunochemical and biochemical analysis indicated that CSIF was likely to be a novel cytokine, a cDNA clone encoding CSIF was isolated by expression cloning. Characterization of the recombinant cytokine revealed that additional activities of CSIF were already being analyzed in other laboratories. These activities included stimulation of proliferation of mast cells (26) and thymocytes (31).The name “interleukin-10” was then proposed (2). The mouse cDNA sequence was used to isolate a human homologue from a human T cell cDNA library (32), and the biological activities of the human recombinant ILlO were found to be similar to those of the mouse cytokine. Human ILlO acts on both mouse and human cells, whereas mouse ILlO acts on mouse but not human cells. In the sections that follow, the properties and functions of mouse and human ILlO are discussed together unless otherwise specified.
3
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
111. Physical Properties
Mouse ILlO is a homodimeric cytokine with an apparent molecular weight of about 35 kDa (1). During sodium dodecyl sulfate (SDS) gel electrophoresis mouse ILlO monomers migrate in two major bands corresponding to apparent molecular weights of 17 and 21 kDa. Treatment of mouse ILlO with N-glycanase, or synthesis in the presence of tunicamycin, results in nonglycosylated ILlO that migrates at 17 kDa (2).In contrast, human ILlO has little or no glycosylation and migrates as a single band at about 18 kDa. The functions ofglycosylated and nonglycosylated forms of mouse ILlO do not appear to be significantly different, at least in vitro. Chromatography on a hydrophic interaction column resolves three components, corresponding to glycosylation of both, one, or neither of the chains. All three forms have similar specific bioactivities (M. W. Bond, D. F. Fiorentino, and T. R. Mosmann, unpublished). Both mouse and human ILlO are unusually labile in acid solutions and activity is lost rapidly below a p H of5.5. Monoclonal antibodies raised against mouse ILlO revealed that, as for many other cytokines, a significant fraction of ILlO molecules appears to be nonfunctional and to display different antigenic determinants, since two monoclonal antibodies were isolated that bound ILlO but did not recognize any biologically active molecules (33).The properties of mouse and human ILlO are summarized in Table I. IV. cDNA Cloning
A cDNA library was derived from an activated TH2 clone (DlO) in the pcDSRa cloning vector (34)and pools of the resulting clones were screened for their ability to direct the synthesis of CSIF activity in COS cells. A full-length cDNA clone encoding CSIF activity was TABLE I PROPERTIES OF ILl0 AND RELATED GENESA N D PROTEINS
Mol wt Amino acids (mature)
CHO Acid lability Chromosome Exons
Mouse
Human
Viral
16,20
16 160
16
157 +(-)
+
1 5
-
+
-
1 1
4
TIM R . MOSMANN
obtained, and the sequence of the open-reading frame was unrelated to any of the known cytokines. Thus the molecule that mediated CSIF activity was identified as a new cytokine and named IL10. A cDNA clone for human ILlO was isolated by screening a human T cell cDNA library by cross-hybridization with oligonucleotide probes based on the mouse cDNA sequence (32). A rat ILlO cDNA clone was isolated by concanavalin A (Con A) stimulation of T cells from a parasiteinfected rat, followed by polymerase chain reaction (PCR) using primers based on conserved regions of the mouse and human clones (35). The amplified product was then cloned. The nucleotide sequences of the open-reading frames of human and rat IL10 are 81 and 91% homologous to mouse IL10, respectively. The N-terminal 18 amino acids of the open-reading frame are consistent with the presence of a secretion-leader sequence, and mouse and human cDNA clones are readily expressed as secreted proteins in monkey COS cells. The Ntermini of recombinant mouse and human ILlO are Gln22 and SerlS, respectively. There are two potential N-linked glycosylation sites in mouse ILlO and one in human IL10. There are four cysteines in the mature human ILlO protein and five in mouse IL10, although both proteins are noncovalent homodimers (1,36). The 3'-untranslated region of the mRNA contains AT-rich regions similar to those which confer messenger RNA instability in other cytokine mRNAs. Figure 1 shows the protein sequence homologies between human, rat, and mouse IL10, as well as two ILl0-related genes in herpesviruses (discussed below). V. Gene Structure
The genomic clone for ILlO was also isolated from mouse cells (37). The gene contains five exons and spans approximately 5.1 kb of the genome. The noncoding upstream regions of the ILlO gene contain sequences that are also found in the upstream regulatory regions of several other cytokine genes. The mouse and human ILlO genes are both on chromosome 1 (37). VI. Production
Among mouse T cell clones, ILlO is produced by the TH2 and THO subsets of helper (CD4') T cells but not by TH1 cells or CD8+ T cell clones (1,2,33). A subset of mature CD4+ thymocytes expressing low levels of heat-stable antigen also produces ILlO and several other cytokines (38).In all cases, T cells only produce ILlO after stimulation with antigen or polyclonal activators. Among human T cell clones, many but not all clones produce ILlO (39,40), including TH2-like
5
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
ILlO EBV BcRFl EHV-"ILlO" Rat ILlO Mouse ILlO HLlIMn
M
H
s
s
L
-
-
m
u
~
~
m
.ERFUW.Q.....YLAFBX-----TQ.CN..---Q.................T.. .FRAS.-- ...... .A..W.IMCYDSE.Q I I . PI'L. TS..H. .HE..A............. .FG...--.... L . .A..KT.K.HS..N.....V....E..A...Q......K.. .FG...--.... L. .T.M.1.R..YSRED.N.....VOQ...LE.. T...Q......T..
W ILlO Q--Q--QDFDmm
EBV XRFl EV . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . E A .D ............ EHV-"ILlO" . . . .M ..................................... HSTCQE.IH(......K.... Rat ILlO . . . .I....................... K...V........-..E..E.L.....K.... Mouse ILlO . . . .I......................... V. ......-KIIG. E..E.L.....K....
HUmnILlO
EBV -1
......................
I ...............................
I.A.
EHV-"ILlO' .V ...................... S..S......V...................T.MK . Rat ILlO wIQ ...................... D.....D..V....N.......C....V.L.MK . Mouse ILlO .M......................SD.....CQ. V. ...N.......C.....MI .MKS FIG.1. Sequences of mammalian and viral ILlos.
clones and T cells that produce IFNy but little or no IL4 (41). Thus the production of ILlO may not be as precisely confined to T cell subsets in humans, or alternatively, genuine human T H l clones may be less commonly isolated in tissue culture. ILlO is also produced by rat T cells (35). In addition to T cells, a number of other cell types produce this cytokine. Macrophages appear to be a major source of ILlO (42) and synthesis occurs in response to activation by, e.g., lipopolysaccharide (LPS) which also induces synthesis of other cytokines such as IL1, tumor necrosis factor (TNF), and IL6. Mouse mast cell lines express significant levels of ILlO mRNA (2). Normal mouse B cell populations produce ILlO after stimulation (43) and the major B cell producers of ILlO are found in the L y l B cell subset (44). Human B cells also produce IL10, especially after Epstein-Barr (EB) virus transformation (45,46). ILlO is produced by keratinocytes and keratinocyte cell lines (47,48), particularly after exposure to ultraviolet light (Table 11).
~
6
TIM R. MOSMANN
TABLE I1 PRODUCTION OF ILlO
T cells TH2 TH 1 CD8' Mast cell lines Keratinocytes B cells (Lyl)
Mouse
Human
+ +
+ + +? +
-
+ + +
Vil. Biological Effects of Ill0
A. EFFECTSON MACROPHAGES ILlO inhibits the synthesis of several cytokines that are normally secreted by human and mouse monocytes/macrophages in response to activation by LPS (Table 111). These cytokines include IL1, GMCSF, TNF, IL6, IL8, IL10, and IL12 (42,49) (T. Germann, E. Rude, and T. R. Mosmann, unpublished). The production of ILlO by macrophages can be inhibited by ILlO itself (42), thus the secretion of ILlO by macrophages appears to be self-limited. ILlO is secreted relatively late compared to other cytokines, so macrophages may secrete substantial amounts of various cytokines before ILlO inhibition occurs. IFNy also inhibits macrophage secretion of ILlO (50).Thus ILlO and IFNy in some circumstances can each inhibit the synthesis of the other cytokine contributing to a direct cross-inhibitory network. Because ILlO inhibits macrophage cytokine synthesis there are also secondary effects on macrophage function. For example ILlO inhibits the ability of macrophages to kill larvae of Schistosoma mansoni (51). Killing activity is induced by IFNy, which in turn induces TNFa synthesis. ILlO appears to act by blocking the synthesis of TNFa, since supplementation of the cultures with T N F a restored the ability to kill (52). At least part of the killing activity induced by TNFa may be due to the induction of nitric oxide synthesis, which is also downregulated by ILlO in a number of systems (51,53,54). The inhibition of macrophage cytotoxic activity by ILlO is distinct from the mechanisms triggered by two other suppressive agents, IL4 and TGFP, since both of these agents synergize with ILlO to cause increased inhibition of macrophage killing (55).This is consistent with the demonstration that ILlO inhibits macrophage cytokine synthesis by enhancing mRNA
7
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
TABLE 111 FUNCTIONS OF ILlO ~
Macrophages Cytokine production (IL1, IL6, IL8, IL10, IL12, TNF) NO production APC function (for TH1) NK cells Cytokine production T cells Cytokine synthesis CTL differentiation B cells Proliferation MHC I1 expression Antibody secretion Mast cells Proliferation (costimulus) Protease expression In vioo DTH induction DTH effector function
~~
Mouse
Human
Viral
1
1
.1
-1
1
1 1
1
1
.1 t
1
J
t
T
t
5
t t t
1
1
degradation, whereas TGFP appears to act at the translational level (56). In addition to inhibiting cytokine secretion by activated macrophages, ILlO inhibits expression of MHC class I1 antigens on certain classes of monocytes/macrophages (57). In contrast, ILlO stimulates the expression of FcyRl on human monocytes (58).This latter effect is unusual in that ILlO and IFNy mediate similar effects, instead of the usual antagonistic effects of these two cytokines in other assays. Another indirect effect of ILlO that is probably mediated partly via suppression of cytokine synthesis by activated macrophages is the function that was initially used to characterize ILlO-the inhibition of cytokine synthesis by T H 1 cells. Cell-free stimulation methods, such as anti-CD3 antibodies or Con A, induce TH1 synthesis of IFNy that is not inhibited by ILlO (1). TH1 cells stimulated by nonmacrophage APC, e.g., B cells, are also resistant to the effects of ILlO (59). However, when T H 1 cells are stimulated by antigen presented by whole spleen cell populations or macrophages, ILlO partially blocks the secretion of cytokines by the T cells (1). Pretreatment of the macrophage populations with ILlO reduces their subsequent ability to stimu-
8
TIM R. MOSMANN
late T H 1 IFNy production, whereas pretreatment of the T cells has no effect (59). In the absence of exogenous IL2, the proliferation of T cells is also inhibited by IL10, via an effect on the macrophage APC (60), probably due to inhibition of endogenous IL2 production. Thus the CSIF activity of ILlO is mediated via macrophage APC. We and others have examined ILlO inhibition of TH1 stimulation in more detail and found that at least part of this effect appears to be mediated via inhibition of IL12 synthesis. A costimulator required for T H 1 cytokine production in T cell-macrophage cocultures (611, initially named T cell stimulating factor (TSF),was found to be identical to IL12 (T. Germann, M. K. Gately, D. S. Schoenhauf M. Lohoff, S. Fischer, S-C. Jin, E. Schmitt, and E. Rude, unpublished). IL12 is synthesized by macrophages during the interaction of T H 1 cells with macrophages. ILlO blocks IL12 synthesis in this system, and part but not all of the synthesis of IFNy can be restored by adding exogenous recombinant IL12, even in the presence of ILlO (T. Germann, E. Rude and T. R. Mosmann, unpublished; A. O’Garra, personal cammunication). However, even saturating amounts of IL12 do not fully restore the cytokine response of the TH1 cells indicating that reduction of IL12 synthesis is not the only mechanism whereby ILlO reduces cytokine synthesis by T H 1 cells. Given the number of other surface molecules and cytokines whose synthesis and expression are inhibited by IL10, it is perhaps not surprising that the effect on T cells is not mediated through a single costimulator. Other costimulatory molecules that might be downregulated by ILlO could include cell-surface interaction molecules such as B7 (62) or additional unknown cytokines.
B. EFFECTSON T CELLS In addition to the indirect effects described above on cytokine synthesis b y long-term TH1 clones, ILlO also appears to be responsible for strongly inhibiting the synthesis of IFNy in mixed populations of cells derived directly from animals infected with parasites. Spleen cells from Nippostrongylus- or S. mansoni-infected mice produced large amounts of IL4 and IL5 after stimulation with Con A, but secreted very little IFNy (63,64). The addition of anti-IL10 antibodies to these culture systems resulted in much higher production of IFNy in response to Con A or parasite antigen showing that a cryptic THl-like response was in fact being primed but that ILlO was normally synthesized in the activation cultures at sufficiently high levels to inhibit the expression of this TH1 pattern. Since the APC function of B cells is not inhibited by ILlO (59) this suggests that dendritic- or macrophage-like cells may be the major APC in these spleen cell populations.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
9
ILlO can also indirectly affect the proliferation of T cells by inhibiting the production of IL2 (1,60,65). Under conditions where IL2 production is limiting, this will result in a decrease in the proliferation of the T cells. In one study, ILlO inhibited cytokine synthesis by T cells responding to macrophages or dendritic cells, but proliferation was only inhibited by ILlO if macrophages were used as APC (66). Since ILlO normally causes partial inhibition of cytokine synthesis, it is possible that the dendritic cells were more efficient APC and that even the reduced levels of IL2 induced by dendritic cells in the presence of ILlO were sufficient to support proliferation. In experimental systems in which ILlO does inhibit T cell proliferation, this effect can normally be overcome by the addition of exogenous IL2 and so ILlO does not appear to have directly inhibitory effects on T cell proliferation. Although ILlO strongly inhibits the effector function of mature TH 1 cell clones or TH1-like responses from normal T cell populations, ILlO appears to be much less effective at altering the differentiation of T cells from precursor cells. T helper precursors normally secrete only IL2 when first activated (63,67,68) and then differentiate into mature effector cells secreting TH1, TH2, THO, or other cytokine patterns. IL4 and IFNy have strong effects on this differentiation (29,67; S. Sad and T. R. Mosmann, unpublished), each inducing the production of more cells secreting the same cytokine. ILlO is less effective at influencing differentiation, although variable results have been obtained in different studies. In two studies using T cell receptor (TCR)-transgenicmice, ILlO behaved similarly to IL4 in inducing the production of more TH2-like cells (69),whereas in another study, ILlO or anti-IL10 had little effect on the differentiation of T cells into TH1 or TH2 phenotypes (70). These contrasting results may be related to different endogenous levels ofIL10, IFNy, and other cytokines in the cultures. In addition to inhibiting cytokine synthesis by TH1 clones, ILlO also inhibits IFNy synthesis by cytotoxic T cells, although ILlO has no effect on cytotoxicity oftarget cells by CD8' T cell clones or allospecific normal CD8+ populations (T. A. T. Fong and T. R. Mosmann, unpublished). It is not yet known whether this effect of ILlO is mediated via the APC as is the case for CD4' cells. In other circumstances, ILlO has positive effects on the proliferation of peripheral and particularly thymic T cells. Thymocytes proliferate moderately in response to IL2 and IL4, and proliferation is further increased by the addition of ILlO to the other two cytokines (71). Using limiting dilution cultures it was also shown that ILlO stimulates proliferation and differentiation of CD8+ cells, increasing both the
10
TIM R. MOSMANN
CTLP frequency and the cytolytic activity of the expanded clones (72). This effect was only observed in synergy with IL2 and appears to occur during differentiation.
C. EFFECTS ON NATURAL KILLER(NK) CELLS ILlO inhibits the production of IFNy by NK cells responding to IL2 in the presence of accessory cells (73). Thus ILlO can inhibit the synthesis of IFNy by all of the three major producers of IFNy, TH1, CD8, and NK cells, although this depends on the stimulation conditions; for example, TH1 cells stimulated by B cells as APC are not susceptible to IL10. Although IL4 and ILlO both inhibit synthesis of cytokines by NK cells, this occurs via different mechanisms, as the inhibitory effect of IL4 is mediated directly on purified NK cells, whereas the effect of ILlO requires macrophages/monocytes (73).As in the case of TH1 stimulation, IL12 has been implicated as an important cofactor for stimulation of NK cells (74,75) and ILlO also inhibits the synthesis of IL12 in a mouse NK cell stimulation system (T. Germann, E. Rude, and T. R. Mosmann, unpublished).Reconstitution with recombinant IL12 restored almost all of the ability of the NK cells to synthesize IFNy suggesting that the major mechanism of action of ILlO on NK cells may be indirect, through inhibition of the synthesis of IL12 by macrophages.
D. EFFECTSON MASTCELLS Mouse mast cell lines grown in vitro respond to a number of cytokines such as IL3, IL4, IL9, and stem cell factor. When the ILlO cDNA clone was isolated and recombinant ILlO was available, it was found that ILlO was yet another cytokine that enhanced the proliferation of mast cell lines (26). ILlO synergizes with other cytokines such as IL3 or IL4, suggesting that ILlO acts on the mast cell by an independent mechanism. It is not yet known if this mast cell growth-enhancing activity of ILlO is important for in vivo effects. ILlO also activates transcription of the genes for two mast cell proteases, MMCPl and MMCP2, in bone marrow-derived mast cell lines (76,77).
E. EFFECTSON B CELLS ILlO has a number of effects, mostly stimulatory, on mouse and human B cells. On resting B cells, ILlO induces expression of MHC class I1 antigens (78). In contrast to IL4, which also induces MHC class I1 expression, ILlO does not induce expression of CD23 (the FC-Ereceptor) indicating that ILlO does not act via induction of IL4. ILlO enhances survival of small resting mouse B cells in tissue culture
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
11
(78) and is a potent proliferation factor for human B cells that have been activated by anti-CD4O antibodies (79). Similar effects are seen when the B cells are activated by crosslinking of the antigen receptor and the stimulatory effects of ILlO are additive to those of IL4. In addition to these effects on proliferation, ILlO also induces differentiation of human B cells (79). Activated B cells secrete larger amounts of IgG, IgA, and IgM, and ILlO also induces differentiation of antiCD40-activated B cells to morphologically resemble plasma cells. In addition to these general amplification effects on antibody responses, ILlO also appears to synergize with TGFp in inducing human inimunoglobulin class switching to IgA (80). TGFP may be the actual switch factor whereas ILlO may be required for amplification of the switched cells, as TGFp generally inhibits the synthesis or secretion of all immunoglobulin isotypes, even of IgA by those cells that have already switched to IgA production. TGFP also induces switching to IgA production by mouse B cells, but ILlO does not appear to b e required as a cofactor (81). In contrast to these B cell stimulatory effects, ILlO inhibits antibody secretion by mouse B cells that have been activated by TNP-Ficoll and IL5 (82). VIII. Two Herpesviruses Have Acquired an Ill0 Gene
When the cDNA clone for mouse ILlO was first isolated, a search of the GenBank database indicated that the open-reading frame of mouse ILlO cDNA had high homology to a previously uncharacterized open-reading frame (BCRF1) in the EB virus genome (2,83). This homology occurs in the open-reading frame but not in flanking or leader sequences and the homology is higher at the protein level (84%) than the DNA level (71%) suggesting that the sequence has been conserved for functional reasons. Human ILlO (32) is homologous to these two sequences and in fact BCRFl is more homologous to human than to mouse IL10. Since the mouse ILlO gene contains introns whereas BCRFl does not, it appears that the ILlO gene has been acquired from a mammalian genome by the EB virus (EBV), possibly via a step involving ILlO mRNA and reverse transcriptase provided by a retrovirus. When BCRFl was subcloned into an expression vector (84) it encoded a secreted protein similar in size to human and mouse ILlO. The BCRFl protein displays ILlO activity on both mouse and human cells, particularly in assays involving macrophages and human B cells (57,79,84,85). All of this evidence suggests that the EB virus has captured the mammalian ILlO gene at some time in the recent past and has maintained this gene for the purpose of interfering with
12
TIM R. MOSMANN
the immune response. Another gene with homology to ILlO is present in the genome of an equine herpesvirus (EHV) (86). The two viral ILlO genes may be the result of a single acquisition event that occurred in a common ancestor of EBV and EHV. The rationale for the advantage to EBV and EHV of expressing an IL10-related gene is that ILlO inhibits the synthesis of macrophage and T cell cytokines that would otherwise contribute to an antiviral reaction. These include IFNy, lymphotoxin, and TNF. Thus the production of viral IL10, which occurs in the late phase of lytic infection (87), would be expected to reduce the synthesis of these cytokines in the neighborhood of the infected B cell thus resulting in improved viral replication. In addition to this effect of weakening antiviral immune responses, it is likely that the B cell proliferation-enhancing activity of ILlO (79) is also beneficial to the virus since EBV infects human B cells and ILlO/BCRFl would induce an increased number of activated target cells that would be available for viral infection and replication. EBV may also induce expression of the endogenous ILlO gene, since EBV-transformed B cell lines express human ILlO (45,46). The strategy of acquiring mammalian immune system genes for the apparent purpose of interfering with immune responses now appears to be quite widespread among viruses. In addition to these two herpesvirus examples, poxviruses have acquired genes for the receptors for TNF (88) and IFNy (89). These genes have been modified from the (presumably) original mammalian genes by deletion of the transmembrane region resulting in both cases in small secreted molecules that are still able to bind the relevant cytokine. These molecules could potentially neutralize IFNy or T N F in solution before the cytokines could interact with the true receptors on the cell surface and induce death of the infected cells. IX. Functional Similarities between lLl0 and Other TH2 Cytokines
Although ILlO is produced by a number of cell types, it still appears to play a significant role in the functions of TH2 cells. Many of the TH2 cytokines show coherent functions, i.e., they have similar and overlapping functions on various aspects of the immune response. ILlO fits well with the functions of some of the other TH2 cytokines. Both IL4 and ILlO generally enhance B cell activation, proliferation, and antibody secretion. Several TH2 cytokines, including IL3, IL4, IL9, and IL10, enhance proliferation of mouse mast cell lines. In contrast to these enhancing effects on B and mast cells, both ILlO and IL4 are mainly inhibitory for macrophage function. Although each of
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
13
these cytokines does not always inhibit the macrophage by the same mechanism or in conjunction with the same activation signals, nevertheless both IL4 and ILlO can inhibit cytokine synthesis by certain types of macrophages and can also downregulate intracellular killing of bacteria and parasites. Another described cytokine, P600 or IL13 ( J - M . Heslan, L. J. Guilbert, R. Kastelein, J. F. Elliott and T. R. Mosmann, unpublished; 90-92), also has functions that are overlapping and similar to those of IL4 and IL10. IL13 also enhances IgE production, at least in human B cells, and can inhibit the synthesis of cytokines by activated human monocytes. Thus ILlO fits very well with the general functions of TH2 cytokines and appears to play a major role in overall TH2 ftinctions. It should be noted that these overlapping functions do not necessarily mean that IL4 and ILlO have identical functions or activate the same signaling pathway. In fact there is good evidence in several systems that these two cytokines mediate similar effects via different mechanisms. For example, IL4 and ILlO both inhibit cytokine synthesis by monocytes/macrophages yet IL10, but not IL4, prevents the ability of macrophages to present antigen to T H 1 clones (1). Mast cell responses to IL4 and ILlO are clearly mediated by separate mechanisms since the IL4 and ILlO effects are either additive or synergistic (26). Mouse B cells express MHC class I1 in response to IL4 or ILlO, whereas only IL4 induces CD23 expression (78).Human B cells stimulated with anti-CD40 show increased proliferation in response to either IL4 or IL10, but the effects of these two cytokines are additive, and ILlO induces a limited proliferation that is accompanied by antibody secretion and differentiation to a plasma cell phenotype (79). X. Expression of Ill0 Correlates with TH2 Responses
A. In Vitro STIMULATIONS OF PRIMED CELLS The endogenous expression of ILlO and other cytokines has been measured during a variety of immune responses induced by infectious agents or other manipulations. In many responses a TH2-like cytokine pattern is induced either in viva or in cells derived directly from the animal and stimulated in short-term tissue culture. In general there is a good correlation between the induction of TH2-like responses and the expression of IL10. Examples of this Correlation in vitro include treatment of tissue culture keratinocytes or whole mice with ultraviolet light (47),infection of mice with viable S. mansoni (64)or the retrovirus causing MAIDS (93), and the early response against HIV when the
14
TIM R. MOSMANN
patient’s immune system begins to deteriorate (94). Additional examples involve experimental models of infection in which there are resistant and susceptible strains of mice. During infections by Candida (95) and Trypanusoma cruzi (96)that require a cell-mediated immune response for resistance, ILlO is produced at higher levels by cells from susceptible than from resistant mice. In addition to the enhanced production of ILlO by cells from infected animals, either spontaneously or after stimulation in tissue culture with polyclonal activators, it was also shown for Schistosoma and Trypanosoma infections that the ILlO produced in these cultures was responsible for inhibiting the synthesis of IFNy (64,96) and/or downregulating macrophage function (96). Although clear-cut T H 1 and TH2 responses are often observed during strong immune responses, resistance and susceptibility do not always correlate simply with TH1 and TH2 cytokine patterns. For example, during infection of mice with Eimeria, cells from both resistant and susceptible strains produce similar patterns of cytokines, including both T H l - and TH2-specific cytokines, but ILlO is only expressed by the resistant BALB/c strain (97).
B. In Vivo EXPRESSION OF ILlO More direct evidence for the production of ILlO during certain immune responses has been obtained by a number of groups who have analyzed cytokine mRNA in tissue samples. Once again the production of ILlO correlates well with the expression of other TH2 cytokines, which in turn is correlated with susceptibility to infectious agents or tumors that are more effectively eradicated by a cell-mediated response. ILlO mRNA is found at higher levels in lesions of the lepromatous form of leprosy, which involves high levels of antibody production, than in the tuberculoid form, which involves more DTH-like reactions (98).Similarly, TH2 cytokine mRNAs, including IL10, were elevated in the lesions of patients undergoing the erythema nodosum leprosum reaction, which involves immediate hypersensitivity, whereas lesions of patients undergoing the DTH-like reversal reaction showed reduced ILlO expression (99). Strains of mice susceptible to Leishmania infection show heightened levels of ILlO and other TH2 cytokines (100,101), in contrast to resistant mice which express TH1 cytokines and mount DTH reactions. Ommen’s Syndrome is characterized by high levels of IgE and increased expression of TH2 cytokines, including ILlO (102). In immune responses against basal cell carcinoma, high levels of TH2 cytokines, including IL10, are found in the
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
15
actual basal cell carcinoma lesion (103).In contrast, in a benign growth of epidermis, seborrheic keratosis, a more TH1-like pattern of cytokine mRNA was expressed within the lesion, including IL2, IFNy, and lymphotoxin. Thus ILlO expression in vivo is normally associated with a poor or absent response against infections or tumors whose elimination requires a cell-mediated response. This implicates IL10, at least by correlation, as one of the potential mediators that prevents the development of a strong T H l or cell-mediated immune response. In some cases, such as cancer or infection with a number of intracellular pathogens, excess production of ILlO may therefore be harmful to the generation of an appropriate immune response. As mentioned above for in vitro cytokine data, some cytokine expression patterns in vivo do not fit the simple T H l / T H 2 dichotomy. Although these two cytokine patterns are often found in strong responses, additional cytokine patterns have been identified among mouse and human T cell clones (27,63,104,105), and so it is very likely that further complexity in many immune responses remains to be elucidated. One such example may be a model of experimental autoimmune encephalitis, in which several cytokines, including both IL4 and IFNy, are produced during the acute phase of the disease. However, as the disease begins to resolve, there is a rise in ILlO mRNA that correlates with a rapid decline in the mRNA levels for IL2, IL4, IL6, and IFNy (106). ILlO and other TH2 cytokines are elevated during a chronic GVH reaction (107) whereas it has been suggested that an acute GVH reaction is mediated by inflammatory cytokines and may be inhibited by TH2 cytokines (108). However, the involvement of ILlO and other TH2 cytokines in chronic GVH reactions contrasts with the cytokine patterns observed during tolerance to heart allografts, as ILlO and other TH2 cytokines are associated with tolerance to the graft rather than chronic rejection (109). It is possible that a TH2 response may be more damaging for some types of tissue than others but it is clear that in neither case does a TH2 response lead to acute allogeneic attack. Therefore in autoimmunity and transplant rejection it appears possible that the TH2 response may result in little damage or, at worst, chronic rejection or attack, as opposed to the more acute rejection or damage caused by a T H 1 response. Thus in these circumstances excess production of ILlO may be beneficial. This also raises the possibility of therapeutic use of ILlO in situations requiring inhibition of cellmediated responses.
16
TIM €3. MOSMANN
XI. Effects of in Vivo Manipulation of I l l 0 levels
A. ILlO TREATMENT
In a limited number of experiments, ILlO has been injected during immune responses in vivo to test the predicted antiinflammatory properties of this cytokine. Since ILlO inhibits the synthesis of several cytokines produced by activated macrophages, ILlO has been tested for its ability to inhibit endotoxin-induced toxicity in mice which is thought to be due to the release of macrophage mediators, particularly TNF, after LPS challenge. ILlO pretreatment reduced the amounts of circulating TNF induced by LPS and also inhibited the hypothermia induced by injection of large amounts of LPS (110). Finally, ILlO completely prevented mortality after LPS challenge at a dose normally toxic for 50%ofthe mice. All these effects are consistent with the ability of ILlO to block the secretion of cytokines by activated macrophages. In other experiments, ILlO has been tested for its effect on DTH reactions. During Leishmania infection in resistant mice, a strong DTH reaction is generated, and injection of ILlO causes a small inhibition of an antigen-induced DTH response (R. L. Coffman, personal communication). IL4 also causes some inhibition and the combination of IL4 and ILlO is more effective than either cytokine alone. We have investigated the effect of ILlO on the effector phase of the DTH reaction induced by injecting T H 1 clones plus antigen into naive mouse footpads with or without concomitant injection of IL10. Once again ILlO mediates a moderate inhibition (20-30%)of the DTH reaction (L. Li, J. F. Elliott, and T. R. Mosmann, unpublished). Similar inhibitory effects were observed on DTH initiated by injection of sheep erythrocytes into immunized mice. In a different system studying the induction of DTH rather than the effector phase, injection of supernatants of uv-treated keratinocyte cultures inhibited the generation of a subsequent DTH reaction (47). Since anti-IL10 antibodies prevented the DTH-inhibiting effect of the supernatants it is clear that ILlO is at least partly responsible. Thus the general effects of ILlO injected in vivo are consistent with the in vitro functions of ILlO, i.e., inhibition of macrophage and TH1 cell function.
B. REMOVALOF ILlO In vivo treatment from birth with anti-IL10 antibody resulted in mice that were severely depleted for peritoneal Lyl B cells but were otherwise relatively normal (111). The depletion of Lyl B cells by anti-IL10 could be reversed by the concomitant addition of anti-IFNy
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
17
antibodies, suggesting that the depletion of L y l B cells was secondary to the production of increased levels of IFNy in the absence of IL10. IL10-deficient mice have also been created by disruption of the ILlO gene by homologous recombination (112). The resulting mice do not have major perturbations in the populations of B cells, T cells, macrophages, etc., indicating that ILlO does not have an essential role in hematopoiesis. These IL10-minus mice will be a very important model system in which to examine potential effects of ILlO on the generation of different types of T cell response and the functionality of macrophages during parasite infections. Interestingly, the IL 10minus mice have normal Lyl B cell populations which suggests that ILlO is not essential for the generation of Lyl B cells and that the effects seen with antibody treatment may be due to secondary effects of the antibody in addition to their anti-IL10 effects. In order to reconcile the results of the ILl0-minus mouse with the results obtained by treating normal mice with anti-1110, it can be suggested that the antiILlO treatment induces an immune response since the antibody is a rat IgM which may be immunogenic after repeated injections over an extended period. In the absence of such a strong immune response in the IL10-minus mice, high levels of IFNy may not be produced and thus L y l B cell depletion may not occur. XII. ill0 in Pregnancy
It has been known for some time that during pregnancy the maternal immune response appears less able to mount strong DTH (TH1like) responses but capable of enhanced antibody responses. Thus pregnant women are more susceptible to a number of intracellular pathogens and have reduced symptoms for rheumatoid arthritis, a cell-mediated inflammatory disease (reviewed in 113). On the other hand, an antibody-mediated autoimmune disease, systemic lupus erythematosis, can be exacerbated during pregnancy. We have found that there are high constitutive levels of production of TH2 cytokines in placental tissues (H. Lip, L. J. Guilbert, T. R. Mosmann, and T. G. Wegmann, unpublished). In particular, ILlO is expressed at relatively high levels and the ILlO mRNA has been localized by in situ hybridization to the interface area between maternal and fetal tissues. We have postulated (113) that this local TH2 response, particularly involving IL10, may be important to protect the fetus from the damaging effects of NK and TH1-like responses and that this local TH2 bias can sometimes affect the mother’s entire immune system resulting in reduced ability to combat intracellular pathogens.
18
TIM R. MOSMANN
XIII. The I l l 0 Receptor
The human and mouse ILlO receptors are now being characterized and cDNA clones for one IL10-binding protein of each species have been isolated (K. W. Moore, personal communication). These two clones are about 75% homologous at both protein and DNA levels and the open-reading frames comprise 570 amino acids of which about 220 are in the extracellular domain. The sequences are most homologous to the class I1 cytokine receptor gene family which includes the receptors for IFNaIP and y. There is some indirect evidence that suggests that a second ILlO receptor polypeptide chain might exist. Mouse ILlO binds to COS cells expressing either the human or the mouse recombinant ILlO receptor chains. However, human cells expressing ILlO receptors bind human but not mouse IL10. This differential specificity of binding suggests that the receptor expressed in COS cells may not be the complete receptor expressed on human cells. The identified IL10-binding chain is expressed by a wide variety of cells consistent with the response of many cell types to IL10. XIV. Conclusions
From its initial discovery as acytokine that inhibited cytokine synthesis by a subset of T cells, the importance of ILlO in the immune system has now grown to cover a much wider variety of functions. Several functions of ILlO are centered on inhibition of macrophage activation and function. TH1-like responses are in general inhibited by IL10, which appears to be a consistent part of strong TH2 responses against a variety of pathogens and in several other disease states. The early results regarding ILlO production and ILlO interventions in vivo suggest that ILlO can be deleterious to situations in which a DTH response is required, for example many intracellular pathogen infections. The role of ILlO in reducing immune responses against intracellular agents that might otherwise be protected by cytotoxic responses is supported by the fact that two herpesviruses have paid ILlO a high compliment by appropriating the mammalian ILlO gene and expressing it for the apparent purpose of preventing effective antiviral immune responses. On the other hand, ILlO’s ability to inhibit DTH responses may be useful in certain autoimmune situations and in transplantation where a strong TH1 response may cause acute damage whereas a TH2 response would be more benign and might lead to tolerable immune responses that do not constitute a severe threat to the patients.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
19
REFERENCES 1 . Fiorentino, D. F., Bond, M. W., and Mosmann, T. R. (1989).Two types of mouse T helper cell IV: TH2 clones secrete a factor that inhibits cytokine production by T H 1 clones. J. E i p . Med. 170,2081-2095. 2. Moore, K. W., Vieira, P., Fiorentino, D. F., Trounstine, M. L., Khan, T. A., and Mosmann, T. R. (1990). Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science 248, 1230-1234. 3. Parish, C. R. (1972). T h e relationship between humoral and cell-mediated immunity. Transplant. Rev. 13, 35-66. 4 . Katsura, Y. (1977). Cellmediated and humoral immune responses in mice. 111. Dynamic balance between delayed-type hypersensitivity and antibody response. lmmunology 32,227-235. 5. Mosmann, T. R., Chenvinski, H., Bond, M. W., Giedlin, M. A,, and Coffman, R. L. (1986). Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. lmmunol. 136, 2348-2357. 6. Del Prete, G . F., D e Carli, M., Mastromauro, C., Biagiotti, R., Macchia, D., Falagiani, P. Ricci, M., and Romagnani, S . (1991). Purified protein derivative (PPD) of Mycobacteriuni t u b e r c u h i s and excretory-secretory antigen(s) (TES) of Toxocara cunis expand in vitro human T cells with stable and opposite (type 1 T helper or type 2 T helper) profiles of cytokine production. J. Clin. Inwest. 88, 346-350. 7. Chenvinski, H. M., Schumacher, J. H., Brown, K. D., and Mosmann, T. R. (1987). Two types of mouse helper T cell clone. 111. Further differences in lymphokine synthesis between T h l and T h 2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies. ./. Exp. Med. 166, 1229- 1244. 8. Mosmann, T. R., and Coffman, R. L. (1989).T H 1 and TH2 cells: Different patterns of lymphokine secretion lead to different functional properties. Annu. Reu. Invrnunol. 7, 145-173. 9. Mosmann, T . R., and Coffman, R. L. (1989). Heterogeneity of cytokine secretion patterns and functions of helper T cells. Adu. lrnrnunol. 46, 111-147. 10. Coffman, R. L., Seymour, B. W., Lebman, D. A,, Hiraki, D. D., Christiansen, J. A,, Shrader, B., Cherwinski, H. M., Savelkoul, H. F., Finkelman, F. D., Bond, M. W., and Mosmann, T. R. (1988). T h e role of helper T cell products in mouse B cell differentiation and isotype regulation. lmmunol. Reu. 102, 5-28. 1 1 . Murray, H. W., Spitalny, G. L., and Nathan, C. F. (1985). Activation of mouse peritoneal macrophages in vitro and in vivo by interferon-y. ./. Immunol. 134, 1619-1622. 12. Nathan, C. F., Murray, H. W., Wiebe, M. E., and Rubin, B. Y. (1983).Identification of interferon-y as the lymphokine that activates human macrophage oxidative metabolism and antimicrobial activity. ./. E x p . Med. 158, 670-689. 1 3 . Murray, H. W., Rubin, B. Y., and Rothermel, C. D. (1983).Killing of intracellular Leishmunia donouani by lyniphokine-stimulated human mononuclear phagocytes: Evidence that interferon-? is the activating lymphokine. 1. Clin. Znuest. 72, 1506- 1510. 1 4 . Stevenhagen, A,, and van Furth, R. (1993). Interferon-y activates the oxidative killing of Candida albicons by human granulocytes. CEin. Exp. Zm.munol. 91, 170- 175. 15. van Strijp, J . A,, van der Tol, M. E., Miltenburg, L. A., van Kessel, K. P., and
20
TIM R . MOSMANN
Verhoef, J. (1991). Tumour necrosis factor triggers granulocytes to internalize complement-coated virus particles. Immunology 73, 77-82. 16. Cher, D. J., and Mosmann, T. R. (1987). Two types of murine helper T cell clone. 11. Delayed-type hypersensitivity is mediated by TH1 clones. J. Zmmunol. 138, 3688-3694. 17. Brown, K. D., Zurawski, S. M., Mosmann, T. R., and Zurawski, G. (1989). A family of small inducible proteins secreted by leukocytes are members ofa new superfamily that includes leukocyte and fibroblast-derived inflammatory agents, growth factors, and indicators of various activation processes. J . Zmmunol. 142,679-687. 18. Coffman, R. L., Ohara, J., Bond, M. W., Carty, J., Zlotnik, A., and Paul, W. E. (1986).B cell stimulatory factor 1enhances the IgE response of lipopolysaccharideactivated B cells. J . Zmmunol. 136, 4538-4541. 19. Del Prete, G., Maggi, E., Parronchi, P., Chretien, I., Tiri, A., Macchia, D., Ricci, M., Banchereau, J., de Vries, J. E., and Romagnani, S. (1988). IL-4 is an essential factor for the IgE synthesis induced in vitro by human T cell clones and their supernatants. J. Zmmunol. 140,4193-4198. 20. Sanderson, C. J., O’Garra, A., Warren, D. J., and Klaus, G. G. (1986). Eosinophil differentiation factor also has B-cell growth factor activity: Proposed name interleukin 4. Proc. N a t l . Acad. Sci. U.S.A. 83, 437-440. 21. Enokihara, H., Nagashima, S., Noma, T., Kajitani, H., Hamaguchi, H., Saito, K., Furusawa, S . , Shishido, H., and Honjo, T. (1988). Effect of human recombinant interleukin 5 and G-CSF on eosinophil colony formation. Zmmunol. Lett. 18,73-76. 22. Lopez, A. F., Sanderson, C. J . , Gamble, J. R., Campbell, H. D., Young, I. G., and Vadas, M. A. (1988). Recombinant human interleukin 5 is a selective activator of human eosinophil function. J. E x p . Med. 167, 219-224. 23. Ihle, J. N., Keller, J., Oroszlan, S., Henderson, L. E., Copeland, T. D., Fitch, F., Prystowsky, M. B., Goldwasser, E., Schrader, J. W., Palaszynski, E., Dy, M., and Lebel, B. (1983). Biologic properties of homogeneous interleukin 3. I. Demonstration of WEHI-3 growth factor activity, mast cell growth factor activity, p cell-stimulating factor activity, colony-stimulating factor activity, and histamineproducing cell-stimulating factor activity. J . Zmmunol. 131, 282-287. 24. Mosmann, T. R., Bond, M. W., Coffman, R. L., Ohara, J., and Paul, W. E. (1986). T-cell and mast cell lines respond to B-cell stimulatory factor 1. Proc. N a t l . Acad. Sci. U.S.A. 83, 5654-5658. 25. Moeller, J., Hultner, L., Schmitt, E., Breuer, M., and Dormer, P. (1990).Purification of MEA, a mast cell growth-enhancing activity, to apparent homogeneity and its partial amino acid sequencing. J. Zmmunol. 144, 4231-4234. 26. Thompson Snipes, L., Dhar, V., Bond, M. W., Mosmann, T. R., Moore, K. W., and Rennick, D. M. (1991). Interleukin 10: A novel stimulatory factor for mast cells and their progenitors. J. E x p . Med. 173, 507-510. 27. Gajewski, T. F., and Fitch, F. W. (1988). Anti-proliferative effect of IFN-y in immune regulation. I. IFN-y inhibits the proliferation of Th2 but not T h l murine helper T lymphocyte clones. J. Zmmunol. 140,4245-4252. 28. Fernandez-Botran, R., Sanders, V. M., Mosmann, T. R., and Vitetta, E. S. (1988). Lymphokine-mediated regulation of the proliferative response of clones of T Helper 1 and T Helper 2 cells. J . E x p . Med. 168, 543-558. 29. Le Gros, G., Ben Sasson, S . Z., Seder, R., Finkelman, F. D., and Paul, W. E. (1990). Generation of interleukin-4 (I1-4)-producing cells in vivo and in vitro-11-2 and 11-4 are required for in vitro generation of 11-4-producing cells. J . E x p . Med. 172, 921-929.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
21
30. Swain, S. L., Weinberg, A. D., English, M., and Huston, G . (1990). 11-4 directs the development of Th2-like helper effectors. J. Immunol. 145, 3796-3806. 31. Suda, T., O’Garra, A., MacNeil, I., Fischer, M., Bond, M., and Zlotnik, A. (1990). Identification of‘ a novel thymocyte growth promoting factor derived from B cell lymphomas. Cell. Immunol. 129, 228-240. 32. Vieira, P., de Waal Malefyt, R., Dang, M. N., Johnson, K. E., Kastelein, R., Fiorentino, D. F., deVries, J. E., Roncarolo, M. G., Mosmann, T. R., and Moore, K. W. (1991). Isolation and expression of human cytokine synthesis inhibitory &tor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI. Proc. N a t l . Acad. Sci. U.S.A.88, 1172-1176. 33. Mosmann, T. R., Schumacher, J. H., Fiorentino, D. F., Leverah, J., Moore, K. W., and Bond, M. W. (1990). Isolation of MAbs specific for IL4, IL5, and IL6, and a new TH2-specific cytokine, cytokine synthesis inhibitory factor (CSIF, ILlO), using a solid phase radioimniunoadsorbent assay. J. Immunol. 145, 2938-2945. 34. Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M., and Arai, N. (1988). SR a promoter: An efficient and versatile mammalian cDNA expression system composed ofthe simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell Biol. 8, 466-472. 35. Goodman, R. E., Oblak, J., and Bell, R. G . (1992). Synthesis and characterization of rat interleukin-10 (IL-10) cDNA clones from the RNA of cultured 0x8- 0 x 2 2 thoracic duct T cells. Biochem. Biophys. Res. Commun. 189, 1-7. 36. Moore, K. W., O’Garra, A,, de Waal Malefyt, R., Vieira, P., and Mosmann, T. R. (1993). Interleukin-10. Annu. Reu. Immunol: 11, 165-190. 37. Kim, J. M., Brannan, C. I., Copeland, N. G . ,Jenkins, N. A., Khan, T. A., and Moore, K. W. (1992). Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J. lmmunol. 148,3618-3623. 38. Bendelac, A., Matzinger, P., Seder, R. A,, Paul, W. E., and Schwartz, R. H. (1992). Activation events during thymic selection. J. Exp. Med. 175, 731-742. 39. Yssel, H., d e Waal Malefyt, R., Roncarolo, M. G . , Abrams, J. S., Lahesmaa, R., Spits, H., and d e Vries, J. E. (1992). IL-10 is produced by subsets ofhuman CD4+ T cell clones and peripheral blood T cells. J . Immunol. 149, 2378-2384. 40. Barnes, P. F., Abrams, J. S., Lu, S., Sieling, P. A,, Rea, T. H., and Modlin, R. L. (1993). Patterns of cytokine production by niycobacterium-reactive human T-cell clones. Infect. Immun. 61, 197-203. 41. Del Prete, G . , De Carli, M., Almerigogna, F., Giudizi, M. G., Biagiotti, R., and Romagnani, S. (1993). Human IL-10 is produced by both type 1 helper ( T h l ) and type 2 helper (Th2) T cell clones and inhibits their antigen-specific proliferation and cytokine production. J. Immunol. 150, 353-360. 42. d e Waal Malefyt, R., Abrams, J., Bennett, B., Figdor, C. G . , and de Vries, J. E. (1991). Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: An autoregulatory role of IL-10 produced by mon0cytes.J. Exp. Med. 174,1209-1220. 43. O’Garra, A,, Stapleton, G., Dhar, V., Pearce, M., Schumacher, J., Rugo, H., Barbis, D., Stall, A,, Cupp, J., Moore, K., Vieira, P., Mosmann, T. R., Whitmore, A., Arnold, L., Haughton, G., and Howard, M. (1990). Production of cytokines by mouse B cells: B lymphomas and normal B cells produce interleukin 10. Irit. lmmunol. 2, 82 1-832. 44. O’Garra, A,, Chang, R., Go, N., Hastings, R., Haughton, G., and Howard, M. (1992). Ly-l B (B-1) cells are the main source of B cell-derived interleukin 10. Eur. J. lmmunol. 22.711-717.
22
TIM R. MOSMANN
. 4 5 . Benjamin, D., Knobloch, T. J,, and Dayton, M. A. (1992). Human B-cell interleukin10: B-cell lines derived from patients with acquired immunodeficiency syndrome and Burkitt’s lymphoma constitutively secrete large quantities of interleukin-10. Blood 80, 1289-1298. 46. Burdin, N., Peronne, C., Banchereau, J., and Rousset, F. (1993). Epstein-Barr virus transformation induces B lymphocytes to produce human interleukin 10. J . E x p . M e d . 177,295-304. 47. Rivas, J. M., and Ullrich, S. E. (1992). Systemic suppression ofdelayed-type hypersensitivity by supernatants from UV-irradiated keratinocytes: An essential role for keratinocyte-derived IL-10. J . lmmunol. 149, 3865-3871. 48. Enk, A. H., and Katz, S. I. (1992). Identification and induction of keratinocytederived IL-10. J . lmmunol. 149,92-95. 49. Fiorentino, D. F., Zlotnik, A,, Mosmann, T. R., Howard, M., and O’Garra, A. 0. (1991). ILlO inhibits cytokine production by activated macrophages. I . lmmunol. 147,3815-3822. 50. Chomarat, P., Rissoan, M.-C., Banchereau, J., and Miossec, P. (1993). Interferon y inhibits interleukin 10 production by monocytes. J . E x p . Med. 177, 523-527. 51. Gazzinelli, R. T., Oswald, I. P., James, S. L., and Sher, A. (1992). IL-10 inhibits parasite killing and nitrogen oxide production by IFN-y-activated macrophages. J . Immunol. 148,1792-1796. 52. Oswald, I. P., Wynn, T. A., Sher, A,, and James, S.L. (1992). Interleukin 10 inhibits macrophage microbicidal activity by blocking the endogenous production of tumor necrosis factor a required as a costiniulatory factor for interferon y-induced activation. Proc. N a t l . A c a d . Sci. U.S.A. 89, 8676-8680. 53. Cunha, F. Q., Moncada, S., and Liew, F. Y. (1992). Interleukin-10 (IL-10) inhibits the induction of nitric oxide synthase by interferon-? in murine macrophages. Biochem. B i o p h y s . Res. Commun. 182,1155-1159. 54. Gazzinelli, R. T., Oswald, I. P., Hieny, S., James, S . L., and Sher, A. (1992). The microbicidal activity of interferon-y-treated macrophages against T r y p a n o s o m a c r u z i involves an L-arginine-dependent, nitrogen oxide-mediated mechanism inhibitable by interleukin-10 and transforming growth factor+. E u r . J . lmmunol. 22, 2501-2506. 55. Oswald, I. P., Gazzinelli, R. T., Sher, A., and James, S. L. (1992). IL-10 synergizes with IL-4 and transforming growth factor-/3to inhibit macrophage cytotoxic activity. J . Immunol. 148,3578-3582. 56. Bogdan, C., Paik, J., Vodovotz, Y., and Nathan, C. (1992). Contrasting mechanisms for suppression of macrophage cytokine release by transforming growth factor-p and interleukin-10. J . Biol. Chem. 267, 23,301-23,308. 57. de Waal Malefyt, R., Haanen, J., Spits, H., Roncarolo, M. G., te Velde, A,, Figdor, C . , Johnson, K., Kastelein, R., Yssel, H., and de Vries, J. E. (1991). Interleukin 10 (IL-10)and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class I1 major histocompatibility complex expression. J . E x p . M e d . 174, 915924. 58. Te Velde, A. A., de Waal Malefijt, R., Huijbens, R. J., de Vries, J. E., and Figdor, C. G. (1992). IL-10 stimulates monocyte Fc y R surface expression and cytotoxic activity: Distinct regulation of antibody-dependent cellular cytotoxicity by IFN7, IL-4, and IL-10. J . Immunol. 149, 4048-4052. 59. Fiorentino, D. F., Zlotnik, A., Vieira, P., Mosmann, T. R., Howard, M., Moore, K. W., and O’Garra, A . (1991). IL-10 acts on the antigen-presenting cell to inhibit cytokine production by T h l cells. J . lmmunol. 146, 3444-3451.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
23
60. Ding, L., and Shevach, E. M. (1992).IL-10 inhibits mitogen-induced T cell proliferation by selectively inhibiting macrophage costinmlatory function. J . lmmunol. 148,3133-3139. 61. Germann, T., Partenheimer, A,, and Rude, E. (1990). Requirements for the growth of lymphocyte-TH1 clones. E u r . J . Immunol. 20, 2035-2040. 62. Freeman, G. J., Gray, G. S., Gimmi, C. D., Lombard, D. B., Zhou, L. J., White, M., Fingeroth, J. D., Gribben, J. G.,andNadler, L. M. (1991). Structure, expression, and T cell costimulatory activity of the murine homologue of the human B lymphocyte activation antigen B7.J. E x p . Med. 174, 625-631. 63. Street, N. E., Schumacher, J. H., Fong, T. A . T., Bass, H., Fiorentino, D. F., Leverah, J. A., and Mosmann, T. R. (1990). Heterogeneity of mouse helper T cells: Evidence from bulk cultures and limiting dilution cloning for precursors of T h l and Th2 cells.]. Zmmunol. 144, 1629-1639. 64. Sher, A., Fiorentino, D., Caspar, P., Pearce, E., and Mosmann, T. (1991). Production of IL-10 by CD4' T lymphocytes correlates with down-regulation of T h l cytokine synthesis in helminth infection. J . Immunol. 147, 2713-2716. 65. Taga, K. and Tosato, G. (1992). IL-10 inhibits human T cell proliferation and IL2 production. J . Immunol. 148, 1143-1148. 66. Macatonia, S. E., Doherty, T. M., Knight, S. C., and O'Garra, A. (1993). Differential effect of IL-10 on dendritic cell-induced T cell proliferation and IFN-y production. J . Immunol. 150,3755-3765. 67. Swain, S. L., Weinberg, A. D., and English, M. (1990). CD4+ T cell subsets: Lymphokine secretion of memory cells and of effector cells which develop from precursors in vitro. J . Zmmunol. 144, 1788-1799. 68. Salmon, M., Kitas, G. D., and Bacon, P. A. (1989). Production of lymphokine mRNA by CD45R' and CD45R- helper T cells from human peripheral blood and by human CD4+ T cell clones. J. Imnaunol. 143, 907-912. 69. Hsieh, C. S., Heimberger, A. B., Gold, J. S., O'Garra, A,, and Murphy, K. M. (1992). Differential regulation of T helper phenotype development by interleukins 4 and 10 in an (Y p T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. U.S.A. 89, 6065-6069. 70. Seder, R. A., Paul, W. E., Davis, M . M., and Fazekas de St. Groth, B. (1992). The presence of interleukin 4 during in vitro priming determines the lymphokineproducing potential of CD4+ T cells from T cell receptor transgenic mice. J . E x p . Med. 176,1091-1098. 71. MacNeil, I. A,, Suda, T., Moore, K. W., Mosmann, T. R., and Zlotnik, A. (1990). IL-10, a novel growth cofactor for mature and immature T cells. J . lmmunol. 145, 4167-4 173. 72. Chen, W. F., and Zlotnik, A. (1991). IL-10: A novel cytotoxic T cell differentiation factor. J. Zmmunol. 147, 528-534. 73. Hsu, D. H., Moore, K. W., and Spits, H. (1992). Differential effects of IL-4 and IL-10 on IL-2-induced IFN-y synthesis and lymphokine-activated killer activity. Int. lmmunol. 4,563-569. 74. Kobayashi, M., Fitz, L., Ryan, M., Hewick, R. M., Clark, S. C., Chan, S., Loudon, R., Sherman, F., Perussia, B., and Trinchieri, G. (1989). Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J . E x p . Med. 170, 827-845. 75. Chan, S . H., Perussia, B., Gupta, J. W., Kobayashi, M., Pospisil, M., Young, H. A., Wolf, S. F., Young, D., Clark, S. C., andTrinchieri, G . (1991). Induction ofinterferon y production by natural killer cell stimulatory factor: Characterization of the responder cells and synergy with other inducers. J . E x p . Med. 173, 869-879.
24
TIM R. MOSMANN
76. Ghildyal, N., McNeil, H. P., Stechschulte, S., Austen, K. F., Silberstein, D., Gurish, M. F., Somerville, L. L., and Stevens, R. L. (1992). IL-10 induces transcription of the gene for mouse mast cell protease-1, a serine protease preferentially expressed in mucosal mast cells of Trichinella spiralis-infected mice. J . Immunol. 149, 2 123-2 129. 77. Ghildyal, N., McNeil, H. P., Gurish, M. F., Austen, K. F., and Stevens, R. L. (1992). Transcriptional regulation of the mucosal mast cell-specific protease gene, MMCP2, by interleukin 10 and interleukin 3. J . Biol. Chem. 267, 8473-8477. 78. Go, N. F., Castle, B. E., Barrett, R., Kastelein, R., Dang, W., Mosmann, T. R., Moore, K. W., and Howard, M. (1990). Interleukin 10, a novel B cell stimulatory factor: Unresponsiveness of X chromosome-linked immunodeficiency B cells. J . Exp. Med. 172,1625-1631. 79. Rousset, F., Garcia, E., Defrance, T., Peronne, C., Vezzio, N., Hsu, D. H., Kastelein, R., Moore, K. W., and Banchereau, J. (1992). Interleukin 10 is a potent growth and differentiation factor for activated human B lymphocytes. Proc. Natl. Acad. Sci. U.S.A. 89, 1890-1893. 80. Defrance, T., Vanbervliet, B., Briere, F., Durand, I., Rousset, F., and Banchereau, J. (1992). Interleukin 10 and transforming growth factor p cooperate to induce anti-CD40-activated naive human B cells to secrete immunoglobulin A. J. Exp. Med. 175,671-682. 81. Lebman, D. A., Lee, F. D., and Coffman, R. L. (1990). Mechanism for transforming growth factor b and IL2 enhancement of IgA expression in lipopolysaccharidestimulated B cell cultures. J . Immunol. 144, 952-959. 82. Pecanha, L. M., Snapper, C. M., Lees, A., and Mond, J. J. (1992). Lymphokine control of type 2 antigen response: IL-10 inhibits IL-5- but not IL-2-induced Ig secretion by T cell-independent antigens. 1.Immunol. 148,3427-3432. 83. Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S., and Barrell, B. G. (1984). DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature (London) 310,207-211. 84. Hsu, D. H., de Waal Malefyt, R., Fiorentino, D. F., Dang, M. N., Vieira, P., de Vries, J., Spits, H., Mosmann, T. R., and Moore, K. W. (1990). Expression of interleukin-10 activity by Epstein-Barr virus protein BCRF1. Science 250, 830-832. 85. Niiro, H., Otsuka, T., Abe, M., Satoh, H., Ogo, T., Nakano, T., Furukawa, Y., and Niho, Y. (1992). Epstein-Barr virus BCRFl gene product (viral interleukin 10) inhibits superoxide anion production by human monocytes. Lymphokine Cytokine Res. 11, 209-214. 86. Rode, H.-J., Janssen, W., Rosen-Wolff, A., Bugert, J. J., Thein, P., Becker, Y., and Darai, G. (1993). The genome of equine herpesvirus type 2 harbors an interleukin 10 (ILlO)-like gene. Virus Genes 7, 111-116. 87. Hudson, G. S., Bankier, A. T., Satchwell, S. C., and Barrell, B. G. (1985). The short unique region of the B95-8 Epstein-Barr virus genome. Virology 147, 81-98. 88. Smith, C. A., Davis, T., Anderson, D., Solam, L., Beckmann, M. P., Jerzy, R., Dower, S. K., Cosman, D., and Goodwin, R. G. (1990).A receptor for tumor necrosis factor defines an unusual family of cellular and viral proteins. Science 248, 1019- 1023. 89. Upton, C., Mossman, K., and McFadden, G. (1992). Encoding of a homolog of the IFN-y receptor by myxoma virus. Science 258, 1369-1372. 90. Minty, A., Chalon, P., Derocq, J.-M., Dumont, X., Guillemot, J.-C., Kaghad, M.,
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
25
Labit, C., Leplatois, P., Liauzun, P., Miloux, B., Minty, C., Casellas, P., Loison, G., Lupker, J., Shire, D., Ferrara, P., and Caput, D. (1993). Interleukin-13 is a new human lymphokine regulating inflammatoiy and immune responses. Nature (London) 362,248-250. 91. Punnonen, J., Aversa, G., Cocks, B. G., McKenzie, A. N. J., Menon, S., Zurawski, G . , de Waal Malefyt, H., and de Vries, J. E. (1993). Interleukin 13induces interleukin 4independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. U.S.A. 90, 3730-3734. 92. McKenzie, A. N. J., Cnlpepper, J. A., de Wad Malefyt, R., Briere, F., Punnonen, J., Aversa, G., Sato, A., Dang, W., Cocks, B. G., Menon, S.,de Vries, J. E., Banchereau, J., and Zurawski, G. (1993). Interleukin 13, a T-cell-derived cytokine that regulates human monocyte and B-cell function. Proc. Natl. Acad. Sci. U.S.A. 90, 3735-3739. 93. Gazzinelli, R. T., Makino, M., Chattopadhyay, S. K., Snapper. C. M., Sher, A,, Hugin, A. W., and Morse, H. C. (1992). CD4+ subset regulation in viral infection: Preferential activation of Th2 cells during progression ofretrovirus-induced imniunodeficiency in mice. J. Immunot. 148, 182-188. 94. Clerici, M., and Shearer, G. M. (1993). A TEI1+ TH2switch is a critical step in the etiology of HIV infection. Zrnmunol. Today 14, 107-111. 95. Romani, L., Mencacci, A., Cenci, E., Spaccapelo, R., Mosci, P., Puccetti, P., and Bistoni, F. (1993). CD4' subset expression in murine candidiasis: Th responses correlate directly with genetically determined susceptibility o r vaccine-induced resistance. J. Irnrnunol. 150, 925-931. 96. Silva, J. S., Morrissey, P. J., Grabstein, K. H., Mohler, K. M., Anderson, D., and Reed, S. G. (1992). Interleukin 10 and interferon y regulation of experimental Trypanosoma cruzi infection. J. Exp. Med. 175, 169-174. 97. Wakelin, D., Rose, M. E., Hesketh, P., Else, K. J., and Grencis, R. K. (1993). Immunity to coccidiosis: Genetic influences on lymphocyte and cytokine r e sponses to infection with Eirneria uertniformis in inbred mice. Parusite Imrnunol. 15, 11-19. 98. Yamaniura, M., Uyemura, K., Deans, K. J., Weinberg, K., Rea, T . H., Bloom, B. H., and Modlin, R. L. (1991).Defining protective responses to pathogens: CytoLine profiles i n leprosy lesions. Science 254, 277-279. 99. Yaniamura, M., Wang, X. K.,Ohmen, J . D., Uyemura. K.,Hea, T. H., Bloom, B. H., and Modlin, H. L. (1992). Cytokine patterns of' inimunologicallv mediated tissue damage. J. Irnrnunol. 149, 1470-1475. 100. Heinzel, F. P., Sadick, M. D., Mutha, S.S.,and Locksiey, H. M. (1991). Production of interferon y interleukin 2, interleukin 4, and interleukin 10 b y CD4' Ivmphocytes in vivo during healing and progressivc murine leishmaniasis. Proc. NatP. Acad. Sci. U.S.A. 88, 7011-7015. 101. Locksiey, R. M., Heinzel, F. P., Sadick, M. D., Holaday, B. J., and Gardner, K. D., Jr. (1987). Miirine cutaneous leishmaniasis: Susceptibility correlates with differential expansion of helper T-cell subsets. An71. Znst. Pasteur. Zmmunol. 138, 744-749. 102. Schandene, L., Ferster, A., Mascart Lemone, F., Crusiaux, A,, Gerard, C., Marchant, A,, Lybin, M., Velu, T., Sariban, E., and Coldman, M. (1993).T helper type 2-like cells and therapeutic effects of interferon-y in combined immunodeficiency with hypereosinophilia (Onienn's syndrome). Eur. J, Zmniunol. 23, 56-60. 103. Yamamura, M., Modlin, R. L., Ohmen, J. D., and Moy, R. L. (1993).Local expression of antiinflanimatory cytokines i n cancer. J. Clin. Invest. 91, 1005-1010.
26
TIM R. MOSMANN
104. Firestein, G. S., Roeder, W. D., Laxer, J. A., Townsend, K. S., Weaver, C. T., Hom, J. T., Linton, J., Torbett, B. E., and Glasebrook, A. L. (1989).A new murine CD4+ T cell subset with an unrestricted cytokine profile. J. lmmunol. 143, 518-525. 105. Paliard, X., de Waal Malefijt, R., Yssel, H., Blanchard, D., Chretien, I., Abrams, J., de Vries, J. E., and Spits, H. (1988). Simultaneous production of IL-2, IL-4, and IFN-y by activated human CD4+ and CD8' T cell clones. J. Immunol. 141, 849-855. 106. Kennedy, M. K., Torrance, D. S., Picha, K. S., and Mohler, K. M. (1992). Analysis of cytokine mRNA expression in the central nervous system ofmice with experimental autoimmune encephalomyelitis reveals that IL-10 mRNA expression correlates with recovery. 1. Immunol. 149,2496-2505. 107. D e Wit, D., Van Mechelen, M., Zanin, C., Doutrelepont, J. M., Velu, T., Gerard, C., Abramowicz, D., Scheerlinck, J. P., De Baetselier, P., Urbain, J., Oberdan, L., Goldman, M., and Moser, M. (1993). Preferential activation of Th2 cells in chronic graft-versus-host reaction. 1. Immunol. 150, 361-366. 108. Antin, J. H., and Ferrara, J. L. (1992). Cytokine dysregulation and acute graftversus-host disease. Blood 80,2964-2968. 109. Takeuchi, T., Lowry, R. P., and Konieczny, B. (1992).Heart allografts in murine systems: The differential activation of The-like effector cells in peripheral tolerance. Transplantation 53, 1281-1294. 110. Gerard, C., Bruyns, C., Marchant, A., Abramowicz, D., Vandenabeele, P., Delvaux, A,, Fiers, W., Goldman, M., and Velu, T. (1993). Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. 1.E x p . Med. 177,547-550. 111. Ishida, H., Hastings, R., Kearney, J.. and Howard, M. (1992). Continuous antiinterleukin 10 antibody administration depletes mice of Ly-1 B cells but not conventional B cells. J. E x p . Med. 175, 1213-1220. 112. Kuhn, R., Rajewsky, K., and Muller, W. (1992). IL4 and lLl0 deficient mice. 8th lnt. Cong. Imm. 203 [Abstract] 113. Wegmann, T. G., Lin, H., Guilbert, L. J., and Mosmann, T. R. (1993). Bidirectional cytokine interactions in the maternal-fetal relationship: Is successful pregnancy a TH2 phenomenon? Immunol. Today, 14,353-356. This article was accepted for publication on 9 December 1993.
ADVANCES IN IMMUNOLOGY, VOL 56
Properties and Functions of Interleukin-10 TIM R. MOSMANN Department of Immunology, Universify of Alberta, Edmonton, Alberta, Canada T6G 2H7
1. Introduction
The initial discovery (1)that led to the characterization and cDNA cloning(2)ofinterleukin-10 ( ILlO) was the demonstration that supernatants from activated T cells could inhibit the secretion of cytokines by TH1 T cell clones. This activity was named cytokine synthesis inhibitory factor (CSIF); after the corresponding recombinant cDNA clone was obtained, it rapidly became clear that CSIF has a large number of functions mediated on multiple cell types and the name ILlO was assigned. ILlO inhibits several macrophage functions, including some microbicidal properties and presentation of antigen to T H 1 cells. In contrast, ILlO has generally enhancing or stirnulatory functions on B cells and mast cells. Since ILlO is produced by macrophages and other cell types in addition to the T cells from which it was originally identified, it is clear that IL10, in common with several other cytokines, has a much more complex role in the immune system than could be inferred from the original activity. II. Discovery
A. THE THlITH2 DICHOTOMY Many strong immune responses tend to involve either mainly delayed type hypersensitivity (DTH) or mainly antibody secretion, and there is considerable evidence that these two responses are often mutually exclusive (3,4).The discovery oftwo types of T helper clones in panels of both mouse (5) and human (6) T cell clones offers some explanation for the reciprocal expression of the two responses. When activated by antigedantigen-presenting cells (APC), TH 1 cells produce IL2, interferon-? (IFNy), and iymphotoxin (LT) (5,7-9); provide limited help for B cell responses (10);and strongly activate cellmediated responses. IFNy is a major macrophage-activating factor (11-13), TNF and IFNy activate granulocytes (14,15), and TH1 cells can initiate DTH reactions (16). The T H l cytokine pattern is often associated with strong DTH reactions in uivo. These functions of T H 1 cells are particularly appropriate for destroying the infected cells dur1 Copyright 0 1994 b y Academic Press, lnc. All rights of reproductmu in m y form reserved.
2
TIM R. MOSMANN
ing infections by intracellular pathogens. In contrast, the TH2 cytokine pattern includes IL4, IL5, IL6, IL9, IL10, and P600 (IL13) (7,17), and TH2 cells are stimulatory for antibody responses but inhibitory for cell-mediated or DTH responses. TH2 cells stimulate B cells by production of IL4, IL5, IL6, and IL10. In very strong TH2 responses this can lead to an allergic reaction since IL4 induces switching to IgE ( 1 8 ~ 9and ) IL5 is the major growth and differentiation factor for eosinophils (20-22). Also, at least in the mouse, several TH2 cytokines (IL3, IL4, IL9, IL10) are stimulatory for mast cell proliferation and activation (23-26). As suggested by this brief description of TH1 and TH2 functions, the secretion of different patterns of cytokines contributes strongly to the major functional differences between these subtypes. Thus the cross-regulation of antibody and DTH responses may be explained in part by cross-regulation of the differentiation and activation of TH1 and TH2 T cells during an immune response. Some of the cross-inhibitory regulators of THl/TH2 derivation and function are known: IFNy is produced by TH1 cells and inhibits the proliferation of TH2 clones (27,28) whereas IL4 is produced by TH2 cells and inhibits the differentiation of TH1 cells (29,30). B. CSIF, A TH2 CYTOKINE THATINHIBITS TH1 CELLS Several years ago we were searching for a cross-regulatory cytokine that would be produced by TH2 cells and inhibit the functions of TH1 cells. We found that TH2 supernatants contained an activity that inhibited cytokine production in cocultures of TH1 cells, APC, and antigen (1).This effect was specific for TH1 cells since TH2 cells responded normally in the presence or absence of the TH2 supernatant factor, CSIF. After immunochemical and biochemical analysis indicated that CSIF was likely to be a novel cytokine, a cDNA clone encoding CSIF was isolated by expression cloning. Characterization of the recombinant cytokine revealed that additional activities of CSIF were already being analyzed in other laboratories. These activities included stimulation of proliferation of mast cells (26) and thymocytes (31).The name “interleukin-10” was then proposed (2). The mouse cDNA sequence was used to isolate a human homologue from a human T cell cDNA library (32), and the biological activities of the human recombinant ILlO were found to be similar to those of the mouse cytokine. Human ILlO acts on both mouse and human cells, whereas mouse ILlO acts on mouse but not human cells. In the sections that follow, the properties and functions of mouse and human ILlO are discussed together unless otherwise specified.
3
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
111. Physical Properties
Mouse ILlO is a homodimeric cytokine with an apparent molecular weight of about 35 kDa (1). During sodium dodecyl sulfate (SDS) gel electrophoresis mouse ILlO monomers migrate in two major bands corresponding to apparent molecular weights of 17 and 21 kDa. Treatment of mouse ILlO with N-glycanase, or synthesis in the presence of tunicamycin, results in nonglycosylated ILlO that migrates at 17 kDa (2).In contrast, human ILlO has little or no glycosylation and migrates as a single band at about 18 kDa. The functions ofglycosylated and nonglycosylated forms of mouse ILlO do not appear to be significantly different, at least in vitro. Chromatography on a hydrophic interaction column resolves three components, corresponding to glycosylation of both, one, or neither of the chains. All three forms have similar specific bioactivities (M. W. Bond, D. F. Fiorentino, and T. R. Mosmann, unpublished). Both mouse and human ILlO are unusually labile in acid solutions and activity is lost rapidly below a p H of5.5. Monoclonal antibodies raised against mouse ILlO revealed that, as for many other cytokines, a significant fraction of ILlO molecules appears to be nonfunctional and to display different antigenic determinants, since two monoclonal antibodies were isolated that bound ILlO but did not recognize any biologically active molecules (33).The properties of mouse and human ILlO are summarized in Table I. IV. cDNA Cloning
A cDNA library was derived from an activated TH2 clone (DlO) in the pcDSRa cloning vector (34)and pools of the resulting clones were screened for their ability to direct the synthesis of CSIF activity in COS cells. A full-length cDNA clone encoding CSIF activity was TABLE I PROPERTIES OF ILl0 AND RELATED GENESA N D PROTEINS
Mol wt Amino acids (mature)
CHO Acid lability Chromosome Exons
Mouse
Human
Viral
16,20
16 160
16
157 +(-)
+
1 5
-
+
-
1 1
4
TIM R . MOSMANN
obtained, and the sequence of the open-reading frame was unrelated to any of the known cytokines. Thus the molecule that mediated CSIF activity was identified as a new cytokine and named IL10. A cDNA clone for human ILlO was isolated by screening a human T cell cDNA library by cross-hybridization with oligonucleotide probes based on the mouse cDNA sequence (32). A rat ILlO cDNA clone was isolated by concanavalin A (Con A) stimulation of T cells from a parasiteinfected rat, followed by polymerase chain reaction (PCR) using primers based on conserved regions of the mouse and human clones (35). The amplified product was then cloned. The nucleotide sequences of the open-reading frames of human and rat IL10 are 81 and 91% homologous to mouse IL10, respectively. The N-terminal 18 amino acids of the open-reading frame are consistent with the presence of a secretion-leader sequence, and mouse and human cDNA clones are readily expressed as secreted proteins in monkey COS cells. The Ntermini of recombinant mouse and human ILlO are Gln22 and SerlS, respectively. There are two potential N-linked glycosylation sites in mouse ILlO and one in human IL10. There are four cysteines in the mature human ILlO protein and five in mouse IL10, although both proteins are noncovalent homodimers (1,36). The 3'-untranslated region of the mRNA contains AT-rich regions similar to those which confer messenger RNA instability in other cytokine mRNAs. Figure 1 shows the protein sequence homologies between human, rat, and mouse IL10, as well as two ILl0-related genes in herpesviruses (discussed below). V. Gene Structure
The genomic clone for ILlO was also isolated from mouse cells (37). The gene contains five exons and spans approximately 5.1 kb of the genome. The noncoding upstream regions of the ILlO gene contain sequences that are also found in the upstream regulatory regions of several other cytokine genes. The mouse and human ILlO genes are both on chromosome 1 (37). VI. Production
Among mouse T cell clones, ILlO is produced by the TH2 and THO subsets of helper (CD4') T cells but not by TH1 cells or CD8+ T cell clones (1,2,33). A subset of mature CD4+ thymocytes expressing low levels of heat-stable antigen also produces ILlO and several other cytokines (38).In all cases, T cells only produce ILlO after stimulation with antigen or polyclonal activators. Among human T cell clones, many but not all clones produce ILlO (39,40), including TH2-like
5
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
ILlO EBV BcRFl EHV-"ILlO" Rat ILlO Mouse ILlO HLlIMn
M
H
s
s
L
-
-
m
u
~
~
m
.ERFUW.Q.....YLAFBX-----TQ.CN..---Q.................T.. .FRAS.-- ...... .A..W.IMCYDSE.Q I I . PI'L. TS..H. .HE..A............. .FG...--.... L . .A..KT.K.HS..N.....V....E..A...Q......K.. .FG...--.... L. .T.M.1.R..YSRED.N.....VOQ...LE.. T...Q......T..
W ILlO Q--Q--QDFDmm
EBV XRFl EV . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . E A .D ............ EHV-"ILlO" . . . .M ..................................... HSTCQE.IH(......K.... Rat ILlO . . . .I....................... K...V........-..E..E.L.....K.... Mouse ILlO . . . .I......................... V. ......-KIIG. E..E.L.....K....
HUmnILlO
EBV -1
......................
I ...............................
I.A.
EHV-"ILlO' .V ...................... S..S......V...................T.MK . Rat ILlO wIQ ...................... D.....D..V....N.......C....V.L.MK . Mouse ILlO .M......................SD.....CQ. V. ...N.......C.....MI .MKS FIG.1. Sequences of mammalian and viral ILlos.
clones and T cells that produce IFNy but little or no IL4 (41). Thus the production of ILlO may not be as precisely confined to T cell subsets in humans, or alternatively, genuine human T H l clones may be less commonly isolated in tissue culture. ILlO is also produced by rat T cells (35). In addition to T cells, a number of other cell types produce this cytokine. Macrophages appear to be a major source of ILlO (42) and synthesis occurs in response to activation by, e.g., lipopolysaccharide (LPS) which also induces synthesis of other cytokines such as IL1, tumor necrosis factor (TNF), and IL6. Mouse mast cell lines express significant levels of ILlO mRNA (2). Normal mouse B cell populations produce ILlO after stimulation (43) and the major B cell producers of ILlO are found in the L y l B cell subset (44). Human B cells also produce IL10, especially after Epstein-Barr (EB) virus transformation (45,46). ILlO is produced by keratinocytes and keratinocyte cell lines (47,48), particularly after exposure to ultraviolet light (Table 11).
~
6
TIM R. MOSMANN
TABLE I1 PRODUCTION OF ILlO
T cells TH2 TH 1 CD8' Mast cell lines Keratinocytes B cells (Lyl)
Mouse
Human
+ +
+ + +? +
-
+ + +
Vil. Biological Effects of Ill0
A. EFFECTSON MACROPHAGES ILlO inhibits the synthesis of several cytokines that are normally secreted by human and mouse monocytes/macrophages in response to activation by LPS (Table 111). These cytokines include IL1, GMCSF, TNF, IL6, IL8, IL10, and IL12 (42,49) (T. Germann, E. Rude, and T. R. Mosmann, unpublished). The production of ILlO by macrophages can be inhibited by ILlO itself (42), thus the secretion of ILlO by macrophages appears to be self-limited. ILlO is secreted relatively late compared to other cytokines, so macrophages may secrete substantial amounts of various cytokines before ILlO inhibition occurs. IFNy also inhibits macrophage secretion of ILlO (50).Thus ILlO and IFNy in some circumstances can each inhibit the synthesis of the other cytokine contributing to a direct cross-inhibitory network. Because ILlO inhibits macrophage cytokine synthesis there are also secondary effects on macrophage function. For example ILlO inhibits the ability of macrophages to kill larvae of Schistosoma mansoni (51). Killing activity is induced by IFNy, which in turn induces TNFa synthesis. ILlO appears to act by blocking the synthesis of TNFa, since supplementation of the cultures with T N F a restored the ability to kill (52). At least part of the killing activity induced by TNFa may be due to the induction of nitric oxide synthesis, which is also downregulated by ILlO in a number of systems (51,53,54). The inhibition of macrophage cytotoxic activity by ILlO is distinct from the mechanisms triggered by two other suppressive agents, IL4 and TGFP, since both of these agents synergize with ILlO to cause increased inhibition of macrophage killing (55).This is consistent with the demonstration that ILlO inhibits macrophage cytokine synthesis by enhancing mRNA
7
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
TABLE 111 FUNCTIONS OF ILlO ~
Macrophages Cytokine production (IL1, IL6, IL8, IL10, IL12, TNF) NO production APC function (for TH1) NK cells Cytokine production T cells Cytokine synthesis CTL differentiation B cells Proliferation MHC I1 expression Antibody secretion Mast cells Proliferation (costimulus) Protease expression In vioo DTH induction DTH effector function
~~
Mouse
Human
Viral
1
1
.1
-1
1
1 1
1
1
.1 t
1
J
t
T
t
5
t t t
1
1
degradation, whereas TGFP appears to act at the translational level (56). In addition to inhibiting cytokine secretion by activated macrophages, ILlO inhibits expression of MHC class I1 antigens on certain classes of monocytes/macrophages (57). In contrast, ILlO stimulates the expression of FcyRl on human monocytes (58).This latter effect is unusual in that ILlO and IFNy mediate similar effects, instead of the usual antagonistic effects of these two cytokines in other assays. Another indirect effect of ILlO that is probably mediated partly via suppression of cytokine synthesis by activated macrophages is the function that was initially used to characterize ILlO-the inhibition of cytokine synthesis by T H 1 cells. Cell-free stimulation methods, such as anti-CD3 antibodies or Con A, induce TH1 synthesis of IFNy that is not inhibited by ILlO (1). TH1 cells stimulated by nonmacrophage APC, e.g., B cells, are also resistant to the effects of ILlO (59). However, when T H 1 cells are stimulated by antigen presented by whole spleen cell populations or macrophages, ILlO partially blocks the secretion of cytokines by the T cells (1). Pretreatment of the macrophage populations with ILlO reduces their subsequent ability to stimu-
8
TIM R. MOSMANN
late T H 1 IFNy production, whereas pretreatment of the T cells has no effect (59). In the absence of exogenous IL2, the proliferation of T cells is also inhibited by IL10, via an effect on the macrophage APC (60), probably due to inhibition of endogenous IL2 production. Thus the CSIF activity of ILlO is mediated via macrophage APC. We and others have examined ILlO inhibition of TH1 stimulation in more detail and found that at least part of this effect appears to be mediated via inhibition of IL12 synthesis. A costimulator required for T H 1 cytokine production in T cell-macrophage cocultures (611, initially named T cell stimulating factor (TSF),was found to be identical to IL12 (T. Germann, M. K. Gately, D. S. Schoenhauf M. Lohoff, S. Fischer, S-C. Jin, E. Schmitt, and E. Rude, unpublished). IL12 is synthesized by macrophages during the interaction of T H 1 cells with macrophages. ILlO blocks IL12 synthesis in this system, and part but not all of the synthesis of IFNy can be restored by adding exogenous recombinant IL12, even in the presence of ILlO (T. Germann, E. Rude and T. R. Mosmann, unpublished; A. O’Garra, personal cammunication). However, even saturating amounts of IL12 do not fully restore the cytokine response of the TH1 cells indicating that reduction of IL12 synthesis is not the only mechanism whereby ILlO reduces cytokine synthesis by T H 1 cells. Given the number of other surface molecules and cytokines whose synthesis and expression are inhibited by IL10, it is perhaps not surprising that the effect on T cells is not mediated through a single costimulator. Other costimulatory molecules that might be downregulated by ILlO could include cell-surface interaction molecules such as B7 (62) or additional unknown cytokines.
B. EFFECTSON T CELLS In addition to the indirect effects described above on cytokine synthesis b y long-term TH1 clones, ILlO also appears to be responsible for strongly inhibiting the synthesis of IFNy in mixed populations of cells derived directly from animals infected with parasites. Spleen cells from Nippostrongylus- or S. mansoni-infected mice produced large amounts of IL4 and IL5 after stimulation with Con A, but secreted very little IFNy (63,64). The addition of anti-IL10 antibodies to these culture systems resulted in much higher production of IFNy in response to Con A or parasite antigen showing that a cryptic THl-like response was in fact being primed but that ILlO was normally synthesized in the activation cultures at sufficiently high levels to inhibit the expression of this TH1 pattern. Since the APC function of B cells is not inhibited by ILlO (59) this suggests that dendritic- or macrophage-like cells may be the major APC in these spleen cell populations.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
9
ILlO can also indirectly affect the proliferation of T cells by inhibiting the production of IL2 (1,60,65). Under conditions where IL2 production is limiting, this will result in a decrease in the proliferation of the T cells. In one study, ILlO inhibited cytokine synthesis by T cells responding to macrophages or dendritic cells, but proliferation was only inhibited by ILlO if macrophages were used as APC (66). Since ILlO normally causes partial inhibition of cytokine synthesis, it is possible that the dendritic cells were more efficient APC and that even the reduced levels of IL2 induced by dendritic cells in the presence of ILlO were sufficient to support proliferation. In experimental systems in which ILlO does inhibit T cell proliferation, this effect can normally be overcome by the addition of exogenous IL2 and so ILlO does not appear to have directly inhibitory effects on T cell proliferation. Although ILlO strongly inhibits the effector function of mature TH 1 cell clones or TH1-like responses from normal T cell populations, ILlO appears to be much less effective at altering the differentiation of T cells from precursor cells. T helper precursors normally secrete only IL2 when first activated (63,67,68) and then differentiate into mature effector cells secreting TH1, TH2, THO, or other cytokine patterns. IL4 and IFNy have strong effects on this differentiation (29,67; S. Sad and T. R. Mosmann, unpublished), each inducing the production of more cells secreting the same cytokine. ILlO is less effective at influencing differentiation, although variable results have been obtained in different studies. In two studies using T cell receptor (TCR)-transgenicmice, ILlO behaved similarly to IL4 in inducing the production of more TH2-like cells (69),whereas in another study, ILlO or anti-IL10 had little effect on the differentiation of T cells into TH1 or TH2 phenotypes (70). These contrasting results may be related to different endogenous levels ofIL10, IFNy, and other cytokines in the cultures. In addition to inhibiting cytokine synthesis by TH1 clones, ILlO also inhibits IFNy synthesis by cytotoxic T cells, although ILlO has no effect on cytotoxicity oftarget cells by CD8' T cell clones or allospecific normal CD8+ populations (T. A. T. Fong and T. R. Mosmann, unpublished). It is not yet known whether this effect of ILlO is mediated via the APC as is the case for CD4' cells. In other circumstances, ILlO has positive effects on the proliferation of peripheral and particularly thymic T cells. Thymocytes proliferate moderately in response to IL2 and IL4, and proliferation is further increased by the addition of ILlO to the other two cytokines (71). Using limiting dilution cultures it was also shown that ILlO stimulates proliferation and differentiation of CD8+ cells, increasing both the
10
TIM R. MOSMANN
CTLP frequency and the cytolytic activity of the expanded clones (72). This effect was only observed in synergy with IL2 and appears to occur during differentiation.
C. EFFECTS ON NATURAL KILLER(NK) CELLS ILlO inhibits the production of IFNy by NK cells responding to IL2 in the presence of accessory cells (73). Thus ILlO can inhibit the synthesis of IFNy by all of the three major producers of IFNy, TH1, CD8, and NK cells, although this depends on the stimulation conditions; for example, TH1 cells stimulated by B cells as APC are not susceptible to IL10. Although IL4 and ILlO both inhibit synthesis of cytokines by NK cells, this occurs via different mechanisms, as the inhibitory effect of IL4 is mediated directly on purified NK cells, whereas the effect of ILlO requires macrophages/monocytes (73).As in the case of TH1 stimulation, IL12 has been implicated as an important cofactor for stimulation of NK cells (74,75) and ILlO also inhibits the synthesis of IL12 in a mouse NK cell stimulation system (T. Germann, E. Rude, and T. R. Mosmann, unpublished).Reconstitution with recombinant IL12 restored almost all of the ability of the NK cells to synthesize IFNy suggesting that the major mechanism of action of ILlO on NK cells may be indirect, through inhibition of the synthesis of IL12 by macrophages.
D. EFFECTSON MASTCELLS Mouse mast cell lines grown in vitro respond to a number of cytokines such as IL3, IL4, IL9, and stem cell factor. When the ILlO cDNA clone was isolated and recombinant ILlO was available, it was found that ILlO was yet another cytokine that enhanced the proliferation of mast cell lines (26). ILlO synergizes with other cytokines such as IL3 or IL4, suggesting that ILlO acts on the mast cell by an independent mechanism. It is not yet known if this mast cell growth-enhancing activity of ILlO is important for in vivo effects. ILlO also activates transcription of the genes for two mast cell proteases, MMCPl and MMCP2, in bone marrow-derived mast cell lines (76,77).
E. EFFECTSON B CELLS ILlO has a number of effects, mostly stimulatory, on mouse and human B cells. On resting B cells, ILlO induces expression of MHC class I1 antigens (78). In contrast to IL4, which also induces MHC class I1 expression, ILlO does not induce expression of CD23 (the FC-Ereceptor) indicating that ILlO does not act via induction of IL4. ILlO enhances survival of small resting mouse B cells in tissue culture
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
11
(78) and is a potent proliferation factor for human B cells that have been activated by anti-CD4O antibodies (79). Similar effects are seen when the B cells are activated by crosslinking of the antigen receptor and the stimulatory effects of ILlO are additive to those of IL4. In addition to these effects on proliferation, ILlO also induces differentiation of human B cells (79). Activated B cells secrete larger amounts of IgG, IgA, and IgM, and ILlO also induces differentiation of antiCD40-activated B cells to morphologically resemble plasma cells. In addition to these general amplification effects on antibody responses, ILlO also appears to synergize with TGFp in inducing human inimunoglobulin class switching to IgA (80). TGFP may be the actual switch factor whereas ILlO may be required for amplification of the switched cells, as TGFp generally inhibits the synthesis or secretion of all immunoglobulin isotypes, even of IgA by those cells that have already switched to IgA production. TGFP also induces switching to IgA production by mouse B cells, but ILlO does not appear to b e required as a cofactor (81). In contrast to these B cell stimulatory effects, ILlO inhibits antibody secretion by mouse B cells that have been activated by TNP-Ficoll and IL5 (82). VIII. Two Herpesviruses Have Acquired an Ill0 Gene
When the cDNA clone for mouse ILlO was first isolated, a search of the GenBank database indicated that the open-reading frame of mouse ILlO cDNA had high homology to a previously uncharacterized open-reading frame (BCRF1) in the EB virus genome (2,83). This homology occurs in the open-reading frame but not in flanking or leader sequences and the homology is higher at the protein level (84%) than the DNA level (71%) suggesting that the sequence has been conserved for functional reasons. Human ILlO (32) is homologous to these two sequences and in fact BCRFl is more homologous to human than to mouse IL10. Since the mouse ILlO gene contains introns whereas BCRFl does not, it appears that the ILlO gene has been acquired from a mammalian genome by the EB virus (EBV), possibly via a step involving ILlO mRNA and reverse transcriptase provided by a retrovirus. When BCRFl was subcloned into an expression vector (84) it encoded a secreted protein similar in size to human and mouse ILlO. The BCRFl protein displays ILlO activity on both mouse and human cells, particularly in assays involving macrophages and human B cells (57,79,84,85). All of this evidence suggests that the EB virus has captured the mammalian ILlO gene at some time in the recent past and has maintained this gene for the purpose of interfering with
12
TIM R. MOSMANN
the immune response. Another gene with homology to ILlO is present in the genome of an equine herpesvirus (EHV) (86). The two viral ILlO genes may be the result of a single acquisition event that occurred in a common ancestor of EBV and EHV. The rationale for the advantage to EBV and EHV of expressing an IL10-related gene is that ILlO inhibits the synthesis of macrophage and T cell cytokines that would otherwise contribute to an antiviral reaction. These include IFNy, lymphotoxin, and TNF. Thus the production of viral IL10, which occurs in the late phase of lytic infection (87), would be expected to reduce the synthesis of these cytokines in the neighborhood of the infected B cell thus resulting in improved viral replication. In addition to this effect of weakening antiviral immune responses, it is likely that the B cell proliferation-enhancing activity of ILlO (79) is also beneficial to the virus since EBV infects human B cells and ILlO/BCRFl would induce an increased number of activated target cells that would be available for viral infection and replication. EBV may also induce expression of the endogenous ILlO gene, since EBV-transformed B cell lines express human ILlO (45,46). The strategy of acquiring mammalian immune system genes for the apparent purpose of interfering with immune responses now appears to be quite widespread among viruses. In addition to these two herpesvirus examples, poxviruses have acquired genes for the receptors for TNF (88) and IFNy (89). These genes have been modified from the (presumably) original mammalian genes by deletion of the transmembrane region resulting in both cases in small secreted molecules that are still able to bind the relevant cytokine. These molecules could potentially neutralize IFNy or T N F in solution before the cytokines could interact with the true receptors on the cell surface and induce death of the infected cells. IX. Functional Similarities between lLl0 and Other TH2 Cytokines
Although ILlO is produced by a number of cell types, it still appears to play a significant role in the functions of TH2 cells. Many of the TH2 cytokines show coherent functions, i.e., they have similar and overlapping functions on various aspects of the immune response. ILlO fits well with the functions of some of the other TH2 cytokines. Both IL4 and ILlO generally enhance B cell activation, proliferation, and antibody secretion. Several TH2 cytokines, including IL3, IL4, IL9, and IL10, enhance proliferation of mouse mast cell lines. In contrast to these enhancing effects on B and mast cells, both ILlO and IL4 are mainly inhibitory for macrophage function. Although each of
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
13
these cytokines does not always inhibit the macrophage by the same mechanism or in conjunction with the same activation signals, nevertheless both IL4 and ILlO can inhibit cytokine synthesis by certain types of macrophages and can also downregulate intracellular killing of bacteria and parasites. Another described cytokine, P600 or IL13 ( J - M . Heslan, L. J. Guilbert, R. Kastelein, J. F. Elliott and T. R. Mosmann, unpublished; 90-92), also has functions that are overlapping and similar to those of IL4 and IL10. IL13 also enhances IgE production, at least in human B cells, and can inhibit the synthesis of cytokines by activated human monocytes. Thus ILlO fits very well with the general functions of TH2 cytokines and appears to play a major role in overall TH2 ftinctions. It should be noted that these overlapping functions do not necessarily mean that IL4 and ILlO have identical functions or activate the same signaling pathway. In fact there is good evidence in several systems that these two cytokines mediate similar effects via different mechanisms. For example, IL4 and ILlO both inhibit cytokine synthesis by monocytes/macrophages yet IL10, but not IL4, prevents the ability of macrophages to present antigen to T H 1 clones (1). Mast cell responses to IL4 and ILlO are clearly mediated by separate mechanisms since the IL4 and ILlO effects are either additive or synergistic (26). Mouse B cells express MHC class I1 in response to IL4 or ILlO, whereas only IL4 induces CD23 expression (78).Human B cells stimulated with anti-CD40 show increased proliferation in response to either IL4 or IL10, but the effects of these two cytokines are additive, and ILlO induces a limited proliferation that is accompanied by antibody secretion and differentiation to a plasma cell phenotype (79). X. Expression of Ill0 Correlates with TH2 Responses
A. In Vitro STIMULATIONS OF PRIMED CELLS The endogenous expression of ILlO and other cytokines has been measured during a variety of immune responses induced by infectious agents or other manipulations. In many responses a TH2-like cytokine pattern is induced either in viva or in cells derived directly from the animal and stimulated in short-term tissue culture. In general there is a good correlation between the induction of TH2-like responses and the expression of IL10. Examples of this Correlation in vitro include treatment of tissue culture keratinocytes or whole mice with ultraviolet light (47),infection of mice with viable S. mansoni (64)or the retrovirus causing MAIDS (93), and the early response against HIV when the
14
TIM R. MOSMANN
patient’s immune system begins to deteriorate (94). Additional examples involve experimental models of infection in which there are resistant and susceptible strains of mice. During infections by Candida (95) and Trypanusoma cruzi (96)that require a cell-mediated immune response for resistance, ILlO is produced at higher levels by cells from susceptible than from resistant mice. In addition to the enhanced production of ILlO by cells from infected animals, either spontaneously or after stimulation in tissue culture with polyclonal activators, it was also shown for Schistosoma and Trypanosoma infections that the ILlO produced in these cultures was responsible for inhibiting the synthesis of IFNy (64,96) and/or downregulating macrophage function (96). Although clear-cut T H 1 and TH2 responses are often observed during strong immune responses, resistance and susceptibility do not always correlate simply with TH1 and TH2 cytokine patterns. For example, during infection of mice with Eimeria, cells from both resistant and susceptible strains produce similar patterns of cytokines, including both T H l - and TH2-specific cytokines, but ILlO is only expressed by the resistant BALB/c strain (97).
B. In Vivo EXPRESSION OF ILlO More direct evidence for the production of ILlO during certain immune responses has been obtained by a number of groups who have analyzed cytokine mRNA in tissue samples. Once again the production of ILlO correlates well with the expression of other TH2 cytokines, which in turn is correlated with susceptibility to infectious agents or tumors that are more effectively eradicated by a cell-mediated response. ILlO mRNA is found at higher levels in lesions of the lepromatous form of leprosy, which involves high levels of antibody production, than in the tuberculoid form, which involves more DTH-like reactions (98).Similarly, TH2 cytokine mRNAs, including IL10, were elevated in the lesions of patients undergoing the erythema nodosum leprosum reaction, which involves immediate hypersensitivity, whereas lesions of patients undergoing the DTH-like reversal reaction showed reduced ILlO expression (99). Strains of mice susceptible to Leishmania infection show heightened levels of ILlO and other TH2 cytokines (100,101), in contrast to resistant mice which express TH1 cytokines and mount DTH reactions. Ommen’s Syndrome is characterized by high levels of IgE and increased expression of TH2 cytokines, including ILlO (102). In immune responses against basal cell carcinoma, high levels of TH2 cytokines, including IL10, are found in the
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
15
actual basal cell carcinoma lesion (103).In contrast, in a benign growth of epidermis, seborrheic keratosis, a more TH1-like pattern of cytokine mRNA was expressed within the lesion, including IL2, IFNy, and lymphotoxin. Thus ILlO expression in vivo is normally associated with a poor or absent response against infections or tumors whose elimination requires a cell-mediated response. This implicates IL10, at least by correlation, as one of the potential mediators that prevents the development of a strong T H l or cell-mediated immune response. In some cases, such as cancer or infection with a number of intracellular pathogens, excess production of ILlO may therefore be harmful to the generation of an appropriate immune response. As mentioned above for in vitro cytokine data, some cytokine expression patterns in vivo do not fit the simple T H l / T H 2 dichotomy. Although these two cytokine patterns are often found in strong responses, additional cytokine patterns have been identified among mouse and human T cell clones (27,63,104,105), and so it is very likely that further complexity in many immune responses remains to be elucidated. One such example may be a model of experimental autoimmune encephalitis, in which several cytokines, including both IL4 and IFNy, are produced during the acute phase of the disease. However, as the disease begins to resolve, there is a rise in ILlO mRNA that correlates with a rapid decline in the mRNA levels for IL2, IL4, IL6, and IFNy (106). ILlO and other TH2 cytokines are elevated during a chronic GVH reaction (107) whereas it has been suggested that an acute GVH reaction is mediated by inflammatory cytokines and may be inhibited by TH2 cytokines (108). However, the involvement of ILlO and other TH2 cytokines in chronic GVH reactions contrasts with the cytokine patterns observed during tolerance to heart allografts, as ILlO and other TH2 cytokines are associated with tolerance to the graft rather than chronic rejection (109). It is possible that a TH2 response may be more damaging for some types of tissue than others but it is clear that in neither case does a TH2 response lead to acute allogeneic attack. Therefore in autoimmunity and transplant rejection it appears possible that the TH2 response may result in little damage or, at worst, chronic rejection or attack, as opposed to the more acute rejection or damage caused by a T H 1 response. Thus in these circumstances excess production of ILlO may be beneficial. This also raises the possibility of therapeutic use of ILlO in situations requiring inhibition of cellmediated responses.
16
TIM €3. MOSMANN
XI. Effects of in Vivo Manipulation of I l l 0 levels
A. ILlO TREATMENT
In a limited number of experiments, ILlO has been injected during immune responses in vivo to test the predicted antiinflammatory properties of this cytokine. Since ILlO inhibits the synthesis of several cytokines produced by activated macrophages, ILlO has been tested for its ability to inhibit endotoxin-induced toxicity in mice which is thought to be due to the release of macrophage mediators, particularly TNF, after LPS challenge. ILlO pretreatment reduced the amounts of circulating TNF induced by LPS and also inhibited the hypothermia induced by injection of large amounts of LPS (110). Finally, ILlO completely prevented mortality after LPS challenge at a dose normally toxic for 50%ofthe mice. All these effects are consistent with the ability of ILlO to block the secretion of cytokines by activated macrophages. In other experiments, ILlO has been tested for its effect on DTH reactions. During Leishmania infection in resistant mice, a strong DTH reaction is generated, and injection of ILlO causes a small inhibition of an antigen-induced DTH response (R. L. Coffman, personal communication). IL4 also causes some inhibition and the combination of IL4 and ILlO is more effective than either cytokine alone. We have investigated the effect of ILlO on the effector phase of the DTH reaction induced by injecting T H 1 clones plus antigen into naive mouse footpads with or without concomitant injection of IL10. Once again ILlO mediates a moderate inhibition (20-30%)of the DTH reaction (L. Li, J. F. Elliott, and T. R. Mosmann, unpublished). Similar inhibitory effects were observed on DTH initiated by injection of sheep erythrocytes into immunized mice. In a different system studying the induction of DTH rather than the effector phase, injection of supernatants of uv-treated keratinocyte cultures inhibited the generation of a subsequent DTH reaction (47). Since anti-IL10 antibodies prevented the DTH-inhibiting effect of the supernatants it is clear that ILlO is at least partly responsible. Thus the general effects of ILlO injected in vivo are consistent with the in vitro functions of ILlO, i.e., inhibition of macrophage and TH1 cell function.
B. REMOVALOF ILlO In vivo treatment from birth with anti-IL10 antibody resulted in mice that were severely depleted for peritoneal Lyl B cells but were otherwise relatively normal (111). The depletion of Lyl B cells by anti-IL10 could be reversed by the concomitant addition of anti-IFNy
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
17
antibodies, suggesting that the depletion of L y l B cells was secondary to the production of increased levels of IFNy in the absence of IL10. IL10-deficient mice have also been created by disruption of the ILlO gene by homologous recombination (112). The resulting mice do not have major perturbations in the populations of B cells, T cells, macrophages, etc., indicating that ILlO does not have an essential role in hematopoiesis. These IL10-minus mice will be a very important model system in which to examine potential effects of ILlO on the generation of different types of T cell response and the functionality of macrophages during parasite infections. Interestingly, the IL 10minus mice have normal Lyl B cell populations which suggests that ILlO is not essential for the generation of Lyl B cells and that the effects seen with antibody treatment may be due to secondary effects of the antibody in addition to their anti-IL10 effects. In order to reconcile the results of the ILl0-minus mouse with the results obtained by treating normal mice with anti-1110, it can be suggested that the antiILlO treatment induces an immune response since the antibody is a rat IgM which may be immunogenic after repeated injections over an extended period. In the absence of such a strong immune response in the IL10-minus mice, high levels of IFNy may not be produced and thus L y l B cell depletion may not occur. XII. ill0 in Pregnancy
It has been known for some time that during pregnancy the maternal immune response appears less able to mount strong DTH (TH1like) responses but capable of enhanced antibody responses. Thus pregnant women are more susceptible to a number of intracellular pathogens and have reduced symptoms for rheumatoid arthritis, a cell-mediated inflammatory disease (reviewed in 113). On the other hand, an antibody-mediated autoimmune disease, systemic lupus erythematosis, can be exacerbated during pregnancy. We have found that there are high constitutive levels of production of TH2 cytokines in placental tissues (H. Lip, L. J. Guilbert, T. R. Mosmann, and T. G. Wegmann, unpublished). In particular, ILlO is expressed at relatively high levels and the ILlO mRNA has been localized by in situ hybridization to the interface area between maternal and fetal tissues. We have postulated (113) that this local TH2 response, particularly involving IL10, may be important to protect the fetus from the damaging effects of NK and TH1-like responses and that this local TH2 bias can sometimes affect the mother’s entire immune system resulting in reduced ability to combat intracellular pathogens.
18
TIM R. MOSMANN
XIII. The I l l 0 Receptor
The human and mouse ILlO receptors are now being characterized and cDNA clones for one IL10-binding protein of each species have been isolated (K. W. Moore, personal communication). These two clones are about 75% homologous at both protein and DNA levels and the open-reading frames comprise 570 amino acids of which about 220 are in the extracellular domain. The sequences are most homologous to the class I1 cytokine receptor gene family which includes the receptors for IFNaIP and y. There is some indirect evidence that suggests that a second ILlO receptor polypeptide chain might exist. Mouse ILlO binds to COS cells expressing either the human or the mouse recombinant ILlO receptor chains. However, human cells expressing ILlO receptors bind human but not mouse IL10. This differential specificity of binding suggests that the receptor expressed in COS cells may not be the complete receptor expressed on human cells. The identified IL10-binding chain is expressed by a wide variety of cells consistent with the response of many cell types to IL10. XIV. Conclusions
From its initial discovery as acytokine that inhibited cytokine synthesis by a subset of T cells, the importance of ILlO in the immune system has now grown to cover a much wider variety of functions. Several functions of ILlO are centered on inhibition of macrophage activation and function. TH1-like responses are in general inhibited by IL10, which appears to be a consistent part of strong TH2 responses against a variety of pathogens and in several other disease states. The early results regarding ILlO production and ILlO interventions in vivo suggest that ILlO can be deleterious to situations in which a DTH response is required, for example many intracellular pathogen infections. The role of ILlO in reducing immune responses against intracellular agents that might otherwise be protected by cytotoxic responses is supported by the fact that two herpesviruses have paid ILlO a high compliment by appropriating the mammalian ILlO gene and expressing it for the apparent purpose of preventing effective antiviral immune responses. On the other hand, ILlO’s ability to inhibit DTH responses may be useful in certain autoimmune situations and in transplantation where a strong TH1 response may cause acute damage whereas a TH2 response would be more benign and might lead to tolerable immune responses that do not constitute a severe threat to the patients.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
19
REFERENCES 1 . Fiorentino, D. F., Bond, M. W., and Mosmann, T. R. (1989).Two types of mouse T helper cell IV: TH2 clones secrete a factor that inhibits cytokine production by T H 1 clones. J. E i p . Med. 170,2081-2095. 2. Moore, K. W., Vieira, P., Fiorentino, D. F., Trounstine, M. L., Khan, T. A., and Mosmann, T. R. (1990). Homology of cytokine synthesis inhibitory factor (IL-10) to the Epstein-Barr virus gene BCRFI. Science 248, 1230-1234. 3. Parish, C. R. (1972). T h e relationship between humoral and cell-mediated immunity. Transplant. Rev. 13, 35-66. 4 . Katsura, Y. (1977). Cellmediated and humoral immune responses in mice. 111. Dynamic balance between delayed-type hypersensitivity and antibody response. lmmunology 32,227-235. 5. Mosmann, T. R., Chenvinski, H., Bond, M. W., Giedlin, M. A,, and Coffman, R. L. (1986). Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J. lmmunol. 136, 2348-2357. 6. Del Prete, G . F., D e Carli, M., Mastromauro, C., Biagiotti, R., Macchia, D., Falagiani, P. Ricci, M., and Romagnani, S . (1991). Purified protein derivative (PPD) of Mycobacteriuni t u b e r c u h i s and excretory-secretory antigen(s) (TES) of Toxocara cunis expand in vitro human T cells with stable and opposite (type 1 T helper or type 2 T helper) profiles of cytokine production. J. Clin. Inwest. 88, 346-350. 7. Chenvinski, H. M., Schumacher, J. H., Brown, K. D., and Mosmann, T. R. (1987). Two types of mouse helper T cell clone. 111. Further differences in lymphokine synthesis between T h l and T h 2 clones revealed by RNA hybridization, functionally monospecific bioassays, and monoclonal antibodies. ./. Exp. Med. 166, 1229- 1244. 8. Mosmann, T. R., and Coffman, R. L. (1989).T H 1 and TH2 cells: Different patterns of lymphokine secretion lead to different functional properties. Annu. Reu. Invrnunol. 7, 145-173. 9. Mosmann, T . R., and Coffman, R. L. (1989). Heterogeneity of cytokine secretion patterns and functions of helper T cells. Adu. lrnrnunol. 46, 111-147. 10. Coffman, R. L., Seymour, B. W., Lebman, D. A,, Hiraki, D. D., Christiansen, J. A,, Shrader, B., Cherwinski, H. M., Savelkoul, H. F., Finkelman, F. D., Bond, M. W., and Mosmann, T. R. (1988). T h e role of helper T cell products in mouse B cell differentiation and isotype regulation. lmmunol. Reu. 102, 5-28. 1 1 . Murray, H. W., Spitalny, G. L., and Nathan, C. F. (1985). Activation of mouse peritoneal macrophages in vitro and in vivo by interferon-y. ./. Immunol. 134, 1619-1622. 12. Nathan, C. F., Murray, H. W., Wiebe, M. E., and Rubin, B. Y. (1983).Identification of interferon-y as the lymphokine that activates human macrophage oxidative metabolism and antimicrobial activity. ./. E x p . Med. 158, 670-689. 1 3 . Murray, H. W., Rubin, B. Y., and Rothermel, C. D. (1983).Killing of intracellular Leishmunia donouani by lyniphokine-stimulated human mononuclear phagocytes: Evidence that interferon-? is the activating lymphokine. 1. Clin. Znuest. 72, 1506- 1510. 1 4 . Stevenhagen, A,, and van Furth, R. (1993). Interferon-y activates the oxidative killing of Candida albicons by human granulocytes. CEin. Exp. Zm.munol. 91, 170- 175. 15. van Strijp, J . A,, van der Tol, M. E., Miltenburg, L. A., van Kessel, K. P., and
20
TIM R . MOSMANN
Verhoef, J. (1991). Tumour necrosis factor triggers granulocytes to internalize complement-coated virus particles. Immunology 73, 77-82. 16. Cher, D. J., and Mosmann, T. R. (1987). Two types of murine helper T cell clone. 11. Delayed-type hypersensitivity is mediated by TH1 clones. J. Zmmunol. 138, 3688-3694. 17. Brown, K. D., Zurawski, S. M., Mosmann, T. R., and Zurawski, G. (1989). A family of small inducible proteins secreted by leukocytes are members ofa new superfamily that includes leukocyte and fibroblast-derived inflammatory agents, growth factors, and indicators of various activation processes. J . Zmmunol. 142,679-687. 18. Coffman, R. L., Ohara, J., Bond, M. W., Carty, J., Zlotnik, A., and Paul, W. E. (1986).B cell stimulatory factor 1enhances the IgE response of lipopolysaccharideactivated B cells. J . Zmmunol. 136, 4538-4541. 19. Del Prete, G., Maggi, E., Parronchi, P., Chretien, I., Tiri, A., Macchia, D., Ricci, M., Banchereau, J., de Vries, J. E., and Romagnani, S. (1988). IL-4 is an essential factor for the IgE synthesis induced in vitro by human T cell clones and their supernatants. J. Zmmunol. 140,4193-4198. 20. Sanderson, C. J., O’Garra, A., Warren, D. J., and Klaus, G. G. (1986). Eosinophil differentiation factor also has B-cell growth factor activity: Proposed name interleukin 4. Proc. N a t l . Acad. Sci. U.S.A. 83, 437-440. 21. Enokihara, H., Nagashima, S., Noma, T., Kajitani, H., Hamaguchi, H., Saito, K., Furusawa, S . , Shishido, H., and Honjo, T. (1988). Effect of human recombinant interleukin 5 and G-CSF on eosinophil colony formation. Zmmunol. Lett. 18,73-76. 22. Lopez, A. F., Sanderson, C. J . , Gamble, J. R., Campbell, H. D., Young, I. G., and Vadas, M. A. (1988). Recombinant human interleukin 5 is a selective activator of human eosinophil function. J. E x p . Med. 167, 219-224. 23. Ihle, J. N., Keller, J., Oroszlan, S., Henderson, L. E., Copeland, T. D., Fitch, F., Prystowsky, M. B., Goldwasser, E., Schrader, J. W., Palaszynski, E., Dy, M., and Lebel, B. (1983). Biologic properties of homogeneous interleukin 3. I. Demonstration of WEHI-3 growth factor activity, mast cell growth factor activity, p cell-stimulating factor activity, colony-stimulating factor activity, and histamineproducing cell-stimulating factor activity. J . Zmmunol. 131, 282-287. 24. Mosmann, T. R., Bond, M. W., Coffman, R. L., Ohara, J., and Paul, W. E. (1986). T-cell and mast cell lines respond to B-cell stimulatory factor 1. Proc. N a t l . Acad. Sci. U.S.A. 83, 5654-5658. 25. Moeller, J., Hultner, L., Schmitt, E., Breuer, M., and Dormer, P. (1990).Purification of MEA, a mast cell growth-enhancing activity, to apparent homogeneity and its partial amino acid sequencing. J. Zmmunol. 144, 4231-4234. 26. Thompson Snipes, L., Dhar, V., Bond, M. W., Mosmann, T. R., Moore, K. W., and Rennick, D. M. (1991). Interleukin 10: A novel stimulatory factor for mast cells and their progenitors. J. E x p . Med. 173, 507-510. 27. Gajewski, T. F., and Fitch, F. W. (1988). Anti-proliferative effect of IFN-y in immune regulation. I. IFN-y inhibits the proliferation of Th2 but not T h l murine helper T lymphocyte clones. J. Zmmunol. 140,4245-4252. 28. Fernandez-Botran, R., Sanders, V. M., Mosmann, T. R., and Vitetta, E. S. (1988). Lymphokine-mediated regulation of the proliferative response of clones of T Helper 1 and T Helper 2 cells. J . E x p . Med. 168, 543-558. 29. Le Gros, G., Ben Sasson, S . Z., Seder, R., Finkelman, F. D., and Paul, W. E. (1990). Generation of interleukin-4 (I1-4)-producing cells in vivo and in vitro-11-2 and 11-4 are required for in vitro generation of 11-4-producing cells. J . E x p . Med. 172, 921-929.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
21
30. Swain, S. L., Weinberg, A. D., English, M., and Huston, G . (1990). 11-4 directs the development of Th2-like helper effectors. J. Immunol. 145, 3796-3806. 31. Suda, T., O’Garra, A., MacNeil, I., Fischer, M., Bond, M., and Zlotnik, A. (1990). Identification of‘ a novel thymocyte growth promoting factor derived from B cell lymphomas. Cell. Immunol. 129, 228-240. 32. Vieira, P., de Waal Malefyt, R., Dang, M. N., Johnson, K. E., Kastelein, R., Fiorentino, D. F., deVries, J. E., Roncarolo, M. G., Mosmann, T. R., and Moore, K. W. (1991). Isolation and expression of human cytokine synthesis inhibitory &tor cDNA clones: Homology to Epstein-Barr virus open reading frame BCRFI. Proc. N a t l . Acad. Sci. U.S.A.88, 1172-1176. 33. Mosmann, T. R., Schumacher, J. H., Fiorentino, D. F., Leverah, J., Moore, K. W., and Bond, M. W. (1990). Isolation of MAbs specific for IL4, IL5, and IL6, and a new TH2-specific cytokine, cytokine synthesis inhibitory factor (CSIF, ILlO), using a solid phase radioimniunoadsorbent assay. J. Immunol. 145, 2938-2945. 34. Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M., and Arai, N. (1988). SR a promoter: An efficient and versatile mammalian cDNA expression system composed ofthe simian virus 40 early promoter and the R-U5 segment of human T-cell leukemia virus type 1 long terminal repeat. Mol. Cell Biol. 8, 466-472. 35. Goodman, R. E., Oblak, J., and Bell, R. G . (1992). Synthesis and characterization of rat interleukin-10 (IL-10) cDNA clones from the RNA of cultured 0x8- 0 x 2 2 thoracic duct T cells. Biochem. Biophys. Res. Commun. 189, 1-7. 36. Moore, K. W., O’Garra, A,, de Waal Malefyt, R., Vieira, P., and Mosmann, T. R. (1993). Interleukin-10. Annu. Reu. Immunol: 11, 165-190. 37. Kim, J. M., Brannan, C. I., Copeland, N. G . ,Jenkins, N. A., Khan, T. A., and Moore, K. W. (1992). Structure of the mouse IL-10 gene and chromosomal localization of the mouse and human genes. J. lmmunol. 148,3618-3623. 38. Bendelac, A., Matzinger, P., Seder, R. A,, Paul, W. E., and Schwartz, R. H. (1992). Activation events during thymic selection. J. Exp. Med. 175, 731-742. 39. Yssel, H., d e Waal Malefyt, R., Roncarolo, M. G . , Abrams, J. S., Lahesmaa, R., Spits, H., and d e Vries, J. E. (1992). IL-10 is produced by subsets ofhuman CD4+ T cell clones and peripheral blood T cells. J . Immunol. 149, 2378-2384. 40. Barnes, P. F., Abrams, J. S., Lu, S., Sieling, P. A,, Rea, T. H., and Modlin, R. L. (1993). Patterns of cytokine production by niycobacterium-reactive human T-cell clones. Infect. Immun. 61, 197-203. 41. Del Prete, G . , De Carli, M., Almerigogna, F., Giudizi, M. G., Biagiotti, R., and Romagnani, S. (1993). Human IL-10 is produced by both type 1 helper ( T h l ) and type 2 helper (Th2) T cell clones and inhibits their antigen-specific proliferation and cytokine production. J. Immunol. 150, 353-360. 42. d e Waal Malefyt, R., Abrams, J., Bennett, B., Figdor, C. G . , and de Vries, J. E. (1991). Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: An autoregulatory role of IL-10 produced by mon0cytes.J. Exp. Med. 174,1209-1220. 43. O’Garra, A,, Stapleton, G., Dhar, V., Pearce, M., Schumacher, J., Rugo, H., Barbis, D., Stall, A,, Cupp, J., Moore, K., Vieira, P., Mosmann, T. R., Whitmore, A., Arnold, L., Haughton, G., and Howard, M. (1990). Production of cytokines by mouse B cells: B lymphomas and normal B cells produce interleukin 10. Irit. lmmunol. 2, 82 1-832. 44. O’Garra, A,, Chang, R., Go, N., Hastings, R., Haughton, G., and Howard, M. (1992). Ly-l B (B-1) cells are the main source of B cell-derived interleukin 10. Eur. J. lmmunol. 22.711-717.
22
TIM R. MOSMANN
. 4 5 . Benjamin, D., Knobloch, T. J,, and Dayton, M. A. (1992). Human B-cell interleukin10: B-cell lines derived from patients with acquired immunodeficiency syndrome and Burkitt’s lymphoma constitutively secrete large quantities of interleukin-10. Blood 80, 1289-1298. 46. Burdin, N., Peronne, C., Banchereau, J., and Rousset, F. (1993). Epstein-Barr virus transformation induces B lymphocytes to produce human interleukin 10. J . E x p . M e d . 177,295-304. 47. Rivas, J. M., and Ullrich, S. E. (1992). Systemic suppression ofdelayed-type hypersensitivity by supernatants from UV-irradiated keratinocytes: An essential role for keratinocyte-derived IL-10. J . lmmunol. 149, 3865-3871. 48. Enk, A. H., and Katz, S. I. (1992). Identification and induction of keratinocytederived IL-10. J . lmmunol. 149,92-95. 49. Fiorentino, D. F., Zlotnik, A,, Mosmann, T. R., Howard, M., and O’Garra, A. 0. (1991). ILlO inhibits cytokine production by activated macrophages. I . lmmunol. 147,3815-3822. 50. Chomarat, P., Rissoan, M.-C., Banchereau, J., and Miossec, P. (1993). Interferon y inhibits interleukin 10 production by monocytes. J . E x p . Med. 177, 523-527. 51. Gazzinelli, R. T., Oswald, I. P., James, S. L., and Sher, A. (1992). IL-10 inhibits parasite killing and nitrogen oxide production by IFN-y-activated macrophages. J . Immunol. 148,1792-1796. 52. Oswald, I. P., Wynn, T. A., Sher, A,, and James, S.L. (1992). Interleukin 10 inhibits macrophage microbicidal activity by blocking the endogenous production of tumor necrosis factor a required as a costiniulatory factor for interferon y-induced activation. Proc. N a t l . A c a d . Sci. U.S.A. 89, 8676-8680. 53. Cunha, F. Q., Moncada, S., and Liew, F. Y. (1992). Interleukin-10 (IL-10) inhibits the induction of nitric oxide synthase by interferon-? in murine macrophages. Biochem. B i o p h y s . Res. Commun. 182,1155-1159. 54. Gazzinelli, R. T., Oswald, I. P., Hieny, S., James, S . L., and Sher, A. (1992). The microbicidal activity of interferon-y-treated macrophages against T r y p a n o s o m a c r u z i involves an L-arginine-dependent, nitrogen oxide-mediated mechanism inhibitable by interleukin-10 and transforming growth factor+. E u r . J . lmmunol. 22, 2501-2506. 55. Oswald, I. P., Gazzinelli, R. T., Sher, A., and James, S. L. (1992). IL-10 synergizes with IL-4 and transforming growth factor-/3to inhibit macrophage cytotoxic activity. J . Immunol. 148,3578-3582. 56. Bogdan, C., Paik, J., Vodovotz, Y., and Nathan, C. (1992). Contrasting mechanisms for suppression of macrophage cytokine release by transforming growth factor-p and interleukin-10. J . Biol. Chem. 267, 23,301-23,308. 57. de Waal Malefyt, R., Haanen, J., Spits, H., Roncarolo, M. G., te Velde, A,, Figdor, C . , Johnson, K., Kastelein, R., Yssel, H., and de Vries, J. E. (1991). Interleukin 10 (IL-10)and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class I1 major histocompatibility complex expression. J . E x p . M e d . 174, 915924. 58. Te Velde, A. A., de Waal Malefijt, R., Huijbens, R. J., de Vries, J. E., and Figdor, C. G. (1992). IL-10 stimulates monocyte Fc y R surface expression and cytotoxic activity: Distinct regulation of antibody-dependent cellular cytotoxicity by IFN7, IL-4, and IL-10. J . Immunol. 149, 4048-4052. 59. Fiorentino, D. F., Zlotnik, A., Vieira, P., Mosmann, T. R., Howard, M., Moore, K. W., and O’Garra, A . (1991). IL-10 acts on the antigen-presenting cell to inhibit cytokine production by T h l cells. J . lmmunol. 146, 3444-3451.
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-10
23
60. Ding, L., and Shevach, E. M. (1992).IL-10 inhibits mitogen-induced T cell proliferation by selectively inhibiting macrophage costinmlatory function. J . lmmunol. 148,3133-3139. 61. Germann, T., Partenheimer, A,, and Rude, E. (1990). Requirements for the growth of lymphocyte-TH1 clones. E u r . J . Immunol. 20, 2035-2040. 62. Freeman, G. J., Gray, G. S., Gimmi, C. D., Lombard, D. B., Zhou, L. J., White, M., Fingeroth, J. D., Gribben, J. G.,andNadler, L. M. (1991). Structure, expression, and T cell costimulatory activity of the murine homologue of the human B lymphocyte activation antigen B7.J. E x p . Med. 174, 625-631. 63. Street, N. E., Schumacher, J. H., Fong, T. A . T., Bass, H., Fiorentino, D. F., Leverah, J. A., and Mosmann, T. R. (1990). Heterogeneity of mouse helper T cells: Evidence from bulk cultures and limiting dilution cloning for precursors of T h l and Th2 cells.]. Zmmunol. 144, 1629-1639. 64. Sher, A., Fiorentino, D., Caspar, P., Pearce, E., and Mosmann, T. (1991). Production of IL-10 by CD4' T lymphocytes correlates with down-regulation of T h l cytokine synthesis in helminth infection. J . Immunol. 147, 2713-2716. 65. Taga, K. and Tosato, G. (1992). IL-10 inhibits human T cell proliferation and IL2 production. J . Immunol. 148, 1143-1148. 66. Macatonia, S. E., Doherty, T. M., Knight, S. C., and O'Garra, A. (1993). Differential effect of IL-10 on dendritic cell-induced T cell proliferation and IFN-y production. J . Immunol. 150,3755-3765. 67. Swain, S. L., Weinberg, A. D., and English, M. (1990). CD4+ T cell subsets: Lymphokine secretion of memory cells and of effector cells which develop from precursors in vitro. J . Zmmunol. 144, 1788-1799. 68. Salmon, M., Kitas, G. D., and Bacon, P. A. (1989). Production of lymphokine mRNA by CD45R' and CD45R- helper T cells from human peripheral blood and by human CD4+ T cell clones. J. Imnaunol. 143, 907-912. 69. Hsieh, C. S., Heimberger, A. B., Gold, J. S., O'Garra, A,, and Murphy, K. M. (1992). Differential regulation of T helper phenotype development by interleukins 4 and 10 in an (Y p T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. U.S.A. 89, 6065-6069. 70. Seder, R. A., Paul, W. E., Davis, M . M., and Fazekas de St. Groth, B. (1992). The presence of interleukin 4 during in vitro priming determines the lymphokineproducing potential of CD4+ T cells from T cell receptor transgenic mice. J . E x p . Med. 176,1091-1098. 71. MacNeil, I. A,, Suda, T., Moore, K. W., Mosmann, T. R., and Zlotnik, A. (1990). IL-10, a novel growth cofactor for mature and immature T cells. J . lmmunol. 145, 4167-4 173. 72. Chen, W. F., and Zlotnik, A. (1991). IL-10: A novel cytotoxic T cell differentiation factor. J. Zmmunol. 147, 528-534. 73. Hsu, D. H., Moore, K. W., and Spits, H. (1992). Differential effects of IL-4 and IL-10 on IL-2-induced IFN-y synthesis and lymphokine-activated killer activity. Int. lmmunol. 4,563-569. 74. Kobayashi, M., Fitz, L., Ryan, M., Hewick, R. M., Clark, S. C., Chan, S., Loudon, R., Sherman, F., Perussia, B., and Trinchieri, G. (1989). Identification and purification of natural killer cell stimulatory factor (NKSF), a cytokine with multiple biologic effects on human lymphocytes. J . E x p . Med. 170, 827-845. 75. Chan, S . H., Perussia, B., Gupta, J. W., Kobayashi, M., Pospisil, M., Young, H. A., Wolf, S. F., Young, D., Clark, S. C., andTrinchieri, G . (1991). Induction ofinterferon y production by natural killer cell stimulatory factor: Characterization of the responder cells and synergy with other inducers. J . E x p . Med. 173, 869-879.
24
TIM R. MOSMANN
76. Ghildyal, N., McNeil, H. P., Stechschulte, S., Austen, K. F., Silberstein, D., Gurish, M. F., Somerville, L. L., and Stevens, R. L. (1992). IL-10 induces transcription of the gene for mouse mast cell protease-1, a serine protease preferentially expressed in mucosal mast cells of Trichinella spiralis-infected mice. J . Immunol. 149, 2 123-2 129. 77. Ghildyal, N., McNeil, H. P., Gurish, M. F., Austen, K. F., and Stevens, R. L. (1992). Transcriptional regulation of the mucosal mast cell-specific protease gene, MMCP2, by interleukin 10 and interleukin 3. J . Biol. Chem. 267, 8473-8477. 78. Go, N. F., Castle, B. E., Barrett, R., Kastelein, R., Dang, W., Mosmann, T. R., Moore, K. W., and Howard, M. (1990). Interleukin 10, a novel B cell stimulatory factor: Unresponsiveness of X chromosome-linked immunodeficiency B cells. J . Exp. Med. 172,1625-1631. 79. Rousset, F., Garcia, E., Defrance, T., Peronne, C., Vezzio, N., Hsu, D. H., Kastelein, R., Moore, K. W., and Banchereau, J. (1992). Interleukin 10 is a potent growth and differentiation factor for activated human B lymphocytes. Proc. Natl. Acad. Sci. U.S.A. 89, 1890-1893. 80. Defrance, T., Vanbervliet, B., Briere, F., Durand, I., Rousset, F., and Banchereau, J. (1992). Interleukin 10 and transforming growth factor p cooperate to induce anti-CD40-activated naive human B cells to secrete immunoglobulin A. J. Exp. Med. 175,671-682. 81. Lebman, D. A., Lee, F. D., and Coffman, R. L. (1990). Mechanism for transforming growth factor b and IL2 enhancement of IgA expression in lipopolysaccharidestimulated B cell cultures. J . Immunol. 144, 952-959. 82. Pecanha, L. M., Snapper, C. M., Lees, A., and Mond, J. J. (1992). Lymphokine control of type 2 antigen response: IL-10 inhibits IL-5- but not IL-2-induced Ig secretion by T cell-independent antigens. 1.Immunol. 148,3427-3432. 83. Baer, R., Bankier, A. T., Biggin, M. D., Deininger, P. L., Farrell, P. J., Gibson, T. J., Hatfull, G., Hudson, G. S., Satchwell, S. C., Seguin, C., Tuffnell, P. S., and Barrell, B. G. (1984). DNA sequence and expression of the B95-8 Epstein-Barr virus genome. Nature (London) 310,207-211. 84. Hsu, D. H., de Waal Malefyt, R., Fiorentino, D. F., Dang, M. N., Vieira, P., de Vries, J., Spits, H., Mosmann, T. R., and Moore, K. W. (1990). Expression of interleukin-10 activity by Epstein-Barr virus protein BCRF1. Science 250, 830-832. 85. Niiro, H., Otsuka, T., Abe, M., Satoh, H., Ogo, T., Nakano, T., Furukawa, Y., and Niho, Y. (1992). Epstein-Barr virus BCRFl gene product (viral interleukin 10) inhibits superoxide anion production by human monocytes. Lymphokine Cytokine Res. 11, 209-214. 86. Rode, H.-J., Janssen, W., Rosen-Wolff, A., Bugert, J. J., Thein, P., Becker, Y., and Darai, G. (1993). The genome of equine herpesvirus type 2 harbors an interleukin 10 (ILlO)-like gene. Virus Genes 7, 111-116. 87. Hudson, G. S., Bankier, A. T., Satchwell, S. C., and Barrell, B. G. (1985). The short unique region of the B95-8 Epstein-Barr virus genome. Virology 147, 81-98. 88. Smith, C. A., Davis, T., Anderson, D., Solam, L., Beckmann, M. P., Jerzy, R., Dower, S. K., Cosman, D., and Goodwin, R. G. (1990).A receptor for tumor necrosis factor defines an unusual family of cellular and viral proteins. Science 248, 1019- 1023. 89. Upton, C., Mossman, K., and McFadden, G. (1992). Encoding of a homolog of the IFN-y receptor by myxoma virus. Science 258, 1369-1372. 90. Minty, A., Chalon, P., Derocq, J.-M., Dumont, X., Guillemot, J.-C., Kaghad, M.,
PROPERTIES AND FUNCTIONS OF INTERLEUKIN-I0
25
Labit, C., Leplatois, P., Liauzun, P., Miloux, B., Minty, C., Casellas, P., Loison, G., Lupker, J., Shire, D., Ferrara, P., and Caput, D. (1993). Interleukin-13 is a new human lymphokine regulating inflammatoiy and immune responses. Nature (London) 362,248-250. 91. Punnonen, J., Aversa, G., Cocks, B. G., McKenzie, A. N. J., Menon, S., Zurawski, G . , de Waal Malefyt, H., and de Vries, J. E. (1993). Interleukin 13induces interleukin 4independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. U.S.A. 90, 3730-3734. 92. McKenzie, A. N. J., Cnlpepper, J. A., de Wad Malefyt, R., Briere, F., Punnonen, J., Aversa, G., Sato, A., Dang, W., Cocks, B. G., Menon, S.,de Vries, J. E., Banchereau, J., and Zurawski, G. (1993). Interleukin 13, a T-cell-derived cytokine that regulates human monocyte and B-cell function. Proc. Natl. Acad. Sci. U.S.A. 90, 3735-3739. 93. Gazzinelli, R. T., Makino, M., Chattopadhyay, S. K., Snapper. C. M., Sher, A,, Hugin, A. W., and Morse, H. C. (1992). CD4+ subset regulation in viral infection: Preferential activation of Th2 cells during progression ofretrovirus-induced imniunodeficiency in mice. J. Immunot. 148, 182-188. 94. Clerici, M., and Shearer, G. M. (1993). A TEI1+ TH2switch is a critical step in the etiology of HIV infection. Zrnmunol. Today 14, 107-111. 95. Romani, L., Mencacci, A., Cenci, E., Spaccapelo, R., Mosci, P., Puccetti, P., and Bistoni, F. (1993). CD4' subset expression in murine candidiasis: Th responses correlate directly with genetically determined susceptibility o r vaccine-induced resistance. J. Irnrnunol. 150, 925-931. 96. Silva, J. S., Morrissey, P. J., Grabstein, K. H., Mohler, K. M., Anderson, D., and Reed, S. G. (1992). Interleukin 10 and interferon y regulation of experimental Trypanosoma cruzi infection. J. Exp. Med. 175, 169-174. 97. Wakelin, D., Rose, M. E., Hesketh, P., Else, K. J., and Grencis, R. K. (1993). Immunity to coccidiosis: Genetic influences on lymphocyte and cytokine r e sponses to infection with Eirneria uertniformis in inbred mice. Parusite Imrnunol. 15, 11-19. 98. Yamaniura, M., Uyemura, K., Deans, K. J., Weinberg, K., Rea, T . H., Bloom, B. H., and Modlin, R. L. (1991).Defining protective responses to pathogens: CytoLine profiles i n leprosy lesions. Science 254, 277-279. 99. Yaniamura, M., Wang, X. K.,Ohmen, J . D., Uyemura. K.,Hea, T. H., Bloom, B. H., and Modlin, H. L. (1992). Cytokine patterns of' inimunologicallv mediated tissue damage. J. Irnrnunol. 149, 1470-1475. 100. Heinzel, F. P., Sadick, M. D., Mutha, S.S.,and Locksiey, H. M. (1991). Production of interferon y interleukin 2, interleukin 4, and interleukin 10 b y CD4' Ivmphocytes in vivo during healing and progressivc murine leishmaniasis. Proc. NatP. Acad. Sci. U.S.A. 88, 7011-7015. 101. Locksiey, R. M., Heinzel, F. P., Sadick, M. D., Holaday, B. J., and Gardner, K. D., Jr. (1987). Miirine cutaneous leishmaniasis: Susceptibility correlates with differential expansion of helper T-cell subsets. An71. Znst. Pasteur. Zmmunol. 138, 744-749. 102. Schandene, L., Ferster, A., Mascart Lemone, F., Crusiaux, A,, Gerard, C., Marchant, A,, Lybin, M., Velu, T., Sariban, E., and Coldman, M. (1993).T helper type 2-like cells and therapeutic effects of interferon-y in combined immunodeficiency with hypereosinophilia (Onienn's syndrome). Eur. J, Zmniunol. 23, 56-60. 103. Yamamura, M., Modlin, R. L., Ohmen, J. D., and Moy, R. L. (1993).Local expression of antiinflanimatory cytokines i n cancer. J. Clin. Invest. 91, 1005-1010.
26
TIM R. MOSMANN
104. Firestein, G. S., Roeder, W. D., Laxer, J. A., Townsend, K. S., Weaver, C. T., Hom, J. T., Linton, J., Torbett, B. E., and Glasebrook, A. L. (1989).A new murine CD4+ T cell subset with an unrestricted cytokine profile. J. lmmunol. 143, 518-525. 105. Paliard, X., de Waal Malefijt, R., Yssel, H., Blanchard, D., Chretien, I., Abrams, J., de Vries, J. E., and Spits, H. (1988). Simultaneous production of IL-2, IL-4, and IFN-y by activated human CD4+ and CD8' T cell clones. J. Immunol. 141, 849-855. 106. Kennedy, M. K., Torrance, D. S., Picha, K. S., and Mohler, K. M. (1992). Analysis of cytokine mRNA expression in the central nervous system ofmice with experimental autoimmune encephalomyelitis reveals that IL-10 mRNA expression correlates with recovery. 1. Immunol. 149,2496-2505. 107. D e Wit, D., Van Mechelen, M., Zanin, C., Doutrelepont, J. M., Velu, T., Gerard, C., Abramowicz, D., Scheerlinck, J. P., De Baetselier, P., Urbain, J., Oberdan, L., Goldman, M., and Moser, M. (1993). Preferential activation of Th2 cells in chronic graft-versus-host reaction. 1. Immunol. 150, 361-366. 108. Antin, J. H., and Ferrara, J. L. (1992). Cytokine dysregulation and acute graftversus-host disease. Blood 80,2964-2968. 109. Takeuchi, T., Lowry, R. P., and Konieczny, B. (1992).Heart allografts in murine systems: The differential activation of The-like effector cells in peripheral tolerance. Transplantation 53, 1281-1294. 110. Gerard, C., Bruyns, C., Marchant, A., Abramowicz, D., Vandenabeele, P., Delvaux, A,, Fiers, W., Goldman, M., and Velu, T. (1993). Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. 1.E x p . Med. 177,547-550. 111. Ishida, H., Hastings, R., Kearney, J.. and Howard, M. (1992). Continuous antiinterleukin 10 antibody administration depletes mice of Ly-1 B cells but not conventional B cells. J. E x p . Med. 175, 1213-1220. 112. Kuhn, R., Rajewsky, K., and Muller, W. (1992). IL4 and lLl0 deficient mice. 8th lnt. Cong. Imm. 203 [Abstract] 113. Wegmann, T. G., Lin, H., Guilbert, L. J., and Mosmann, T. R. (1993). Bidirectional cytokine interactions in the maternal-fetal relationship: Is successful pregnancy a TH2 phenomenon? Immunol. Today, 14,353-356. This article was accepted for publication on 9 December 1993.
ADVANCES IN IMMUNOLOGY. VOL. 56
The Mechanism of V(D)J Joining: lessons from Molecular, Immunological, and Comparative Analyses SUSANNA M. LEWIS Division of Biology, California lnstitue of Technology, Pasadena, California 91 125
1. Introduction
Antigen receptor gene assembly is a daunting problem of genetic cngineering. Every fiinctional T or R cell must successfully recombine not one, but two different loci. At each locus, two, three, and sometimes four gene segments must be accurately targeted out of megabases of DNA sequence. The outcome is all the more remarkable given that the V( D)J joining apparatus appears to exhibit an inherent flexibility in target site specificity, in the topography of acceptable substrates, and in the directionality of strand exchange. Site-directed recombination in other biological systems is carried out by recombinases that are extremely discriminatory when it comes to one or more of the above properties, and this discrimination is thought to represent the principal means by which the chemically possible outcomes of a reaction are restricted to the one desired product ( a s , for example, discussed in Mizuuchi, 1992b). It may be that the molecular details ofV(D)J recombination, once revealed, will establish similarities between these other systems and V(D)Jjoining that are not yet apparent. But another possibility is that the demands of carrying out a site-directed recombination reaction in the context of a differentiating tissue are so different from those encountered in “simpler” organisms, that the strategies that ensure accuracy here really have no relevant precedent. Numerous review articles on antigen receptor gene rearrangement have appeared (Lieber, 1991,1992; Alt et al., 1992a,b; Feeney, l992a; Gellert, 1992 a,b; Kallenbach and Kougeon, 1992; Oettinger, 1992; Schatz and Chun, 1992; Schatz et ul. 1992; Sell, 1992; Taccioli et nl. 1992; VanDyk and Meek, 1992; Chen and Alt, 1993; Ferguson and Thompson, 1993).Significant advances in the past few years are responsible for encouraging a closer look at the molecular mechanism of the process. The present goal is somewhat different from previous efforts, however. It seems an appropriate time to attempt an interdisciplinary perspective; to consider what both molecular biologists and immunologists have learned about the V(D)J recombination process, as instructed by cross-species (and cross-locus) comparisons. The question 27 Copylight 0 11194 liv Academic Prew. lnc. All rights of reproduction !TI any form resened.
28
SUSANNA M. LEWIS
that will be considered here is how nature ensures a biologically sensible outcome in antigen receptor gene assembly. In particular, to what degree is a successful outcome attributable to the molecular mechanics of the joining process itself? It. V(D)J Joining Basics ‘4. GENEASSEMBLYFOR IMMUNOGLOBULIN, T CELLRECEPTOR
THESTANDARD EQUATION Immune recognition in vertebrates is based on the antigen receptors manufactured by B and T cells. The antigen-binding polypeptides within these multiunit conglomerates (reviewed in Keth, 1992; Rothenberg, 1992) are encoded at the immunoglobulin (Ig) and T cell receptor (TCR) loci (Fig. 1). In mice and humans seven such loci exist, a pair of which must functionally rearrange in every B or T cell before expression is possible. Through the process called “V(D)J joining,” antigen receptor genes are constructed from multiply reiterated DNA segments in B and T cells. By this means, an enormous number of binding specificities can be generated in lymphoid cells from a relatively minimal amount of germline information (reviewed in Davis and Bjorkman, 1988). Rearranging antigen receptor loci are found in creatures representing every ancient vertebrate radiations (Litman et ul., 1993).All except for possibly the most phylogenetically primitive vertebrates appear to possess Ig superfamily homologues, and to the extent this has been determined, the potential for somatic V( D)J recombination is universally observed (e.g., Greenberg and Flajnick, 1994; Greenberg et al. 1993, reviewed in Litman et al., 1993). Although two other types of genetic manipulation, somatic mutation and gene conversion, figure prominently as a device for generating a diverse immune repertoire in some species (reviewed in d u Pasquier, 1992; Thompson, 1992), the variability that is generated by V(D)J joining is of preeminent importance in others (Davis and Bjorkman, 1988; Jorgensen et ul., 1992). A differentiated B or T cell will have rearranged two loci: one of these contains “V” and “J” segments only, the other contains “V’s”, “D’s”, and “J’s”. The process of V(D)J joining forms what is called the “variable exon” ofTCRand Ig genes. Roughly speaking, on completion, a variable exon will have acquired approximately 95 of its codons from one of many germline V segments, about 2 to 9 codons from each D that was incorporated (if D segments were provided at the locus in question), and the remaining 12-22 codons from one of several J PHODUCTION:
TCR 8
FIG. 1 . The structure of rearranging loci in the mouse. Transcriptional orientation is implied by tlie orientation of the lettering. For ii inore detailed presentation (both mouse and hiinian) see Lai e t d., (1989) and citations in text. T h e total number of ( f h c t i o n a l ) V, D. a i d J segments is represented either by the total number of boxes or, where a groiip has been lxacketetl, by the nunil)er indicated above (Kofler et a/., 1989). Pseudogene V and J segments are not illustrated. N o attempt has been iiiade to draw the niaps to scale: relative distances are presented in Lai rt al. (1989). Slashed lines indicate that orientation of the segments I-elative to the rest of tlie locus is not known. Detailed exonic structures of V and C segments are not shown. T h e 12-bpspacerjoining signals tire indicated b y white triangles; 23-base spacer signals are shaded. At loci where rearrangements occur predominantly Ixtweert restricted sets of V’s and J’s, this restriction is indicated with arrows (for references, see section 111,A).V genes are shown in groupings of like polaritv at the K locus; although this is consistent with available arialyses in niouse (Heinrich et u l . , 1984; Lawler et ul., 1992) and with more extensive studies in human (Pargent et ul., 1991; Lautner-Rieske et ul., 1992), it is not known to be the case in general. An important aspect of locus organization is the relative positioning o f V gene seginents belonging to “faiiiilies” ofrelated sequence. This teatiire is not incorporated into the f i g i r e ; however, discussions may he found, for example, in Brodeur et d.(1988) and Kofler et a / . (1989). Cryptic recombination sites that are used with soiiie regularity at the i g and ~ TCHG loci (see section V I I and citations in text) are indicated by asterisks.
segments (Kahat et d., 1991). The vnriahle exon is then spliced to “eonstaiit” region exoils at the HNA level to template the antigen receptor polypeptide. Immunoglobulins manufactured b y B cells consist of one light chain ( K or A ) encoded by a “two-segment” locus, and a heavy chain (IgH) encoded b y a “three-segment locus.” T cell
30
SUSANNA M . LEWIS
receptors are either alp or y / 6 heteromers; in either case, as for immunoglobulin, one chain is encoded by a two-segment locus ( a or y ) and the other is built on the three-segment plan (p or 6; Fig. 1). V(D)J recombination proceeds by joining one pair of gene segments at a time, in what appears to be a simple cut-and-paste type of operation (Bernard et al. 1978; Sakano et ul. 1979; Seidman et al., 1980). The basic transaction is represented by the equation shown in Fig. 2. Initially, in the germline there is a joining signal at the 3’ border of each V segment, at both the 5’ and 3’ borders of’ every D, and at the 5’ border of all J segments (Max et al., 1979; Sakano et al., 1979; Kurosawa et al., 1981; Sakano et ul., 1981). These conserved motifs provide all the necessary elements for targeting by the rearrangement machinery (Lewis et at., 1985; Akira et al., 1987; Hesse et al., 1987). When two gene segments, V and J for example, undergo recombination, a cut is made in each at the boundary between the coding segment and the joining signal. The four ends thus generated are reconnected to form two products. “Coding joint” designates the union of the V and J coding elements (Bernard et ul., 1978; Max et ul., 1979; Sakano et al., 1979); whereas “signal joint” refers to the reciprocal connection of the corresponding signal ends (Steinmetz et al., 1980; Lewis et al., 1984; Fig. 2). Due to the configuration of the joining signals at most loci, V(D)Jjoining is excisive; codingjoints are retained in the chromosome, and signal joints can be demonstrated on extrachromosomal circular DNA molecules (Fujimoto and Yamagishi, 1987; Okazaki et at., 1987). From the perspective of immune function, the all-important junction is the coding joint. The crossover sites between V, D, and J are located in the exon that encodes the antigen-binding domains of Igs and TCRs and have a critical influence on specificity (reviewed in Kabat et al., 1991; Jorgensen et al., 1992). Hypervariability is generated by the combinatorial possibilities presented by the existence of multiple V’s, D’s, and J’s at a given locus (Weigert et al., 1978) as well as by two other features of the V(D)J recombination process. For one, joining does not occur at a fixed position; the amount of sequence contributed by each germline segment (V, D, and J) can vary by a small (usually less than 10)number of residues (Max et al., 1979; Sakano et al., 1979; Weigert et al., 1980). For another, “extra” residues, not present in either precursor element, appear as junctional inserts (Sakano et ul., 1981; Lafaille et al., 1989; McCormack et al., 1989). In striking contrast to the variability ofa coding joint, the reciprocally formed signal joint has a predictable DNA sequence (Lewis et uZ., 1984,1985).The edges ofthe two signal elements are connected to one
V(D)J JOINING
31
GTCCTCC*CACAGTG-12-ACAAAAACC
GGTTTTTGT-23-CACTGTG*CTCAG
--mi+ (-0 +2 -1)
GTCCTCCGGTCAG
(CODING JOINT)
+ (-0
-0)
GGTTTTTGT-23-CACTGTCACAGTG-12-ACAAAAACC
(SIGNAL JOINT) FIG.2. The standard equation for V(D)J recombination. An example ofV-to-J joining is shown. In this and following figures, joining signals are indicated by triangles, coding segments (or equivalent) are indicated by boxes. The coding joint exhibits variability, while the signal joint product is often an exact connection between the heptamer elements of two signals. Dots in the input sequences locate the coding/signal border. As shown, coding elements may be either truncated or joined without base loss. Insertions of sequences at the junction (underlined italics) are also observed. In cases where there are no junctional inserts, the coding joint may sometimes, but not always, exhibit crossover sites located within a very limited “homology” of one or a few residues.
another at a defined position, end-to-end, and in most cases (though not all) this occurs without base addition or base subtraction. Thus two structurally distinct products are formed in a single event by the V(D)J joining machinery. The coincident formation of an imprecise coding joint and a precise signal joint, as depicted in Fig. 2, is the hallmark ofV(D)J recombination. This essential asymmetry in the V(D)J joining reaction has stimulated much speculation about its mechanism. No other recombination reaction can systematically form similar products,
32
SUSANNA M. LEWIS
although analogies to transposition have been drawn by relating the signal joint to a transposon-mediated junction and the coding joint to host-mediated repair processes. Such analogies are provocative, especially in terms of the evolutionary origins of the mechanism (Sakano et ul., 1979), but have yet to prove particularly helpful in understanding the V(D)J joining reaction. In short, as was recognized early (Bernard et al., 1978), there are as many fundamental differences as there are similarities between V(D)J joining and better understood site-directed rearrangement systems. B. RECOMBINATION TARGETS AND
THE 12/23RULE
Joining signals vary in sequence, but all closely resemble a heptamer-spacer-nonamer consensus (Max et al., 1979; Sakano et al., 1979; Fig. 2). Two kinds of joining signal exist, distinguished only by whether the spacer is 12 or 23 residues in length. A feature of the joining mechanism that is essential to the biological success of a joining event is that it follows the “12/23” rule (Early et al., 1980; Sakano et al. 1980; Fig. 2). Accordingly, segments with unlike joining signals (one with a 12-spacer and one with a 23-spacer signal) can be joined together, while segments with like joining signals are incompatible. This constraint imposes a fundamental order on V(D)J assembly. Evolution has apparently shaped the Ig and TCR loci according to the 12/23 rule, so that joining possibilities are restricted to productive segment combinations. V-to-V (or J-to-J) inversions are prevented because each V segment (and likewise each J) has the same type of signal as every other. The 12/23 rule is discussed in more detail in Section VI1,A; despite its central importance, nothing is yet understood about the underlying molecular basis.
c. NONSTANDARD v(D)J JOINING PRODUCTS V(D)J rearrangement can culminate in the production of alternative or “nonstandard” junction products as illustrated in Fig. 3 (StenzelPoore and Rittenberg, 1987; Elliott et al. 1988; Lewis et al., 1988; Morzycka-Wroblewska et al., 1988; Nickerson et al., 1989; Alexandre et al., 1991; VanDyk and Meek, 1992; Carroll et al., 1993a,b; Fish and Bosma 1994;A. Sollbach and G. Wu, personal communication). Demonstrated nonstandard products can account for all theoretically possible signal end-to-coding end assortments. In a “hybrid joint” (Fig 3B), the signal from one gene segment joins to the coding end of another. In an “open-and-shut joint” (Fig 3C), the signal and coding ends created by site-specific cleavage are simply reconnected to one another
33
V(D)J JOINING
B.
A.
Y
C.
3c
Y
+
acoding joint
signal joint
23-hybrid joint
12-hybrid joint
+
+s12-open and shut joint
23-open and shut joint
Frc. 3. Alternative outcomes of V(D)J recombination. (A) Standard. (B) Hybrid. (C) Open and shut. (See legend to Fig. 2.)
without any gross rearrangement: the input. nonrecombinant configuration is maintained. curious thing about these nonstandard junctions is that despite the deviation they represent. they are nevertheless very similar in fine-structure to standard junctions (see Fig. 2 ) . In fact the only major difference between standard and nonstandard joining events appears to be t h e choice ofends that become connected. A codingend, whether it has been incorporated into a standard, hybrid, or open-and-shut joint, exhibits base loss and addition. Signal ends, a s found in any of the three classes of junction, are usually joined without modification (reviewed in Lewis and Gellert, 1989). Nonstandard junctions warrant mention in a section on V(D)J joining basics because these products exemplify one of the le apparent problems ofjoinirig fidelity. The entire category dard joining product is probably not useful physiologically, but despite
34
SUSANNA M. LEWIS
this, is easily demonstrated on both artificial and endogenous V(D)J recombination substrates. Such products then, must be taken into consideration when asking how V(D)J joining arrives at the desired outcome in uiuo.
D. A NOTE ABOUT TERMINOLOGY The literature on V(D)J recombination has expanded to the point where its terminology threatens the patience of an interested nonspecialist. I have attempted to use terms precisely and consistently throughout this review, and the reader will find a glossary of the corresponding definitions in the Appendix. Alternative terms in use by other authors are also included. 111. The Endogenous Substrate
A.
I G AND
TCR Loci
The physiological substrate for V(D)J joining comes in many shapes and sizes. As was briefly mentioned in the previous section, TCR and Ig loci either contain V and J gene segments or contain V’s, D’s, and J’s. Three basic types of segment configuration (discussed below) have been distinguished, as described by the terms “clustered,” “extended,” and “single-gene” (Litman et al., 1993). In addition, locus architecture varies in several other significant features: V gene segments can occur in the same or in mixed orientations, they may be located 5’ or 3’ of their constant regions, they may be flanked by either 12- or 23-spacer signals at a given locus, and, in general, gene segment copy number can range between one and several hundred (Lai et al., 1989; Reynaud et al., 1989a; Litman et al., 1993). Another conspicuous difference between the various rearranging loci is size. Complete physical maps are available in only a few instances, but within this limited sampling, sizes ranging over two orders of magnitude have been observed. The human IgK and IgH loci each have been estimated to cover 2-3 megabases of DNA (Matsuda et al., 1988; Weichhold et al., 1990), while the human TCRy locus is about 160 kb (Lefranc et al., 1989)and the light-chain locus in chickens is only 30 kb (Reynaud et al., 1989a). Confronted with this variety, one must assume that evolution has run up against few absolute constraints in the construction of a rearranging locus. But it does not follow that questions of orientation and distance are of little consequence to the recombination machinery. Locus organization, especially proximity, is frequently offered as an explanation for the apparent preferential rearrangement of particular V gene seg-
V(D)J JOINING
35
ments in various contexts (Yancopoulos et al., 1984; Perlmutter et al., 1985; Jeong and Teale, 1989; Kleinfield and Weigert, 1989; Nickerson et d., 1989; Malynn e t ul. 1990; Allison and Havran, 1991; Roth e t al., 1991; Thompson et al., 1991; Costa et al., 1992; Shirasawa e t al., 1992; Spiel3 et al., 1992; see discussion in section VI1,E). An explanation for the inverted orientation ofV gene segments at the K locus has been suggested (Tiegs et al., 1993; see discussion in Section VI1,G). It has also been proposed that there is functional significance to the gross organizational differences represented by extended, clustered, and single-gene loci (reviewed in Litman et al., 1993). This third notion is discussed in more detail below, as it provides a basis for a brief, comparative tour of the rearranging loci. Generally speaking, none of these suggestions has been completely verified experimentally, although progress has been made in some areas (section VII). The clustered gene configuration (Litman e t al., 1993) is exemplified, in mice, by the murine IgA locus, where neither V nor J is highly reiterated and the gene segments are arranged into units of the following: V..J.. [Constant Exon] .......V..J..[Constant Exon] ... (Blomberg et al., 1981; Storb e t al., 1989; Fig. 1). V-to-J recombination at the A locus appears to occur mostly within a cluster; a V gene segment from one unit is only rarely found to have joined with a J segment from another (see arrows, Fig. 1; Reilly e t al., 1984; Sanchez et al., 1991). A second example of the clustered organization is the murine TCRy locus, in which one cluster contains four V gene segments and each of three others has a single V (Fig. 1). As with the IgA locus, it appears that Vy-to-Jy joining predominantly occurs within units, not between them (arrows, Fig. 1; Raulet et al., 1985; Lai e t al., 1989; and cited therein). The most extreme example of the clustered type of organization (and that which defined this class of gene segment arrangement) was found in cartilaginous fish, where the V..(D)..J....[Constant Exon] ... unit comprising the individual Ig heavy- and light-chain genes is highly reiterated (Kokubu et al., 1988; reviewed in Litman et al., 1993). In these animals, multiple cluster units appear to be scattered throughout the genome, and, again, intracluster recombination appears to be the rule (Hinds-Frey e t al., 1993). The extended gene segment configuration is one where numerous tandemly arranged V segments have the potential to join to a common pool of multiple J (or D) segments (Litman et al., 1993). The reiterated elements are associated with only one or perhaps two constant regions. An extended arrangement, V. .V..V..V..(etc.)......(D..D.. D.etc.). ...J..J..J. (etc.) ...[Constant Exon] ..., is encountered at the murine IgK, IgH, and TCRP loci (Fig. 1).A further variation, found in both mice and humans,
36
SUSANNA M . LEWIS
is where one extended locus (TCRG) is nested within another (TCRa) (Chien et al., 1987a).V gene segments are shared between these intermixed loci so that, although restricted rearrangement patterns are observed in mature T cells, this appears to be imposed, at least in part, b y cellular selection (Spiel3 et al., 1992). Thus, at extended loci, the recombination unit is the entire locus (as indicated by the absence of arrows in Fig. 1). A single-gene organization is found in chickens, where both Ig heavy- and light-chain loci contain only one V gene segment capable of rearrangement. In this case, recombination cannot provide significant diversity (reviewed in McCorniack et al., 199lb; Weill and Reynaud, 1992). Instead, an array of linked pseudo-V gene segments serve as templates for gene conversion, by which process the repertoire is diversified (Reynaud et al. 1987, 1989b). The functional significance of the gross organizational differences represented b y extended, clustered, and single-gene loci is reviewed in Litman et a l . (1993). I n mammals, the difference may not be of overriding significance. The same locus (TCRy for example) is found to be extended in one species and clustered in another (reviewed in Lai et al., 1989). However, broader phylogenetic comparisons provide a picture with sharper contrasts (Litman et al., 1993). The basic organization of rearranging loci appears to have undergone major changes during evolution, and there is reason to believe that the clustered type of organization is the more archaic (Litman et al., 1993). The changeover from clustered to extended configuration roughly corresponds to an increase in the complexity of'the repertoire. Where the clustered organization might limit a V segment to a particular partner (I3 segment and/or J segment), new conibinatorial possibilities were introduced by the regrouping and diversifying of component segments into an extended arrangement (Litman et al., 1993). It may be that in animals (such as mammals) where both clustered and extended configurations are options, the two plans accommodate different needs. A clustered type of configuration may be desirable to limit variability in the gene products of certain loci and to help generate antigen receptors that have predetermined specificities (Litman ot al., 19931. It'such structure/function relationships indeed underlie locus organization, what exactly defines a recombination unit, and how recombination is limited to within, not between clusters is unknown at present. It may come down to an issue of proximity in some species (e.g., Hinds-Frey et al., 1993) but it is also possible that recombination boundaries are imposed by other means as well. These other means might involve elements such as enhancers, matrix-associated regions
(Blasquez et u l . , 1989; Nu t>t u l . , 1989; Cockerill, 1990; Whitehiirst et al., 1992),or possibly sites that interact specifically with the replication apparatus (Ariizumi e t ul., 1993). It is worth entertainingthe possibility that inuch ofthe gross organization of the various loci, including some of the odder variations such as “nesting,” is the way it is for a reason. Even though mechanistic constraints on locus organization appear to be minimal, it may well be that evolution has sculpted the structure of each locus, in each case, in order to most effectively achieve the desired physiological outcome. The comparative anatomy of rearranging loci, as more is learned in the fiiture, may well reveal important clues to the joining mechanism. This issue is discussed fiirther in Section VII.
B. CHHOM.4TIN
THANSCRIPTION, “ACCESSIBILITY”
C ONF IGURAT ION:
METHYLATION,
Only a subset of all possible sites i n the genome is a substrate for V( D)J recombination i n it rearranging cell. For example, on examination of the antigen receptor genes withiii actively rearranging transformed cell lines, it is apparent that these lines carry out recombination at only one or two ofthe seven possible loci (see Table I and citations). In the case of untransforined, normal cells, rearrangement is confined largely to Ig genes i n a B cell and to TCR genes in a T cell (reviewed in A h et ul., 1992a; Benoist and Mathis, 1992; Malissen et al., 1992). Within ii lineage, the activation of recombination at the necessary loci is temporally regulated (see reviews cited). In every case, recombination is at least initiated at the three-segment locus before V-to-1 recombination lwgins at the two-segment locus (for example. IgH before K in a pre-B cell, Alt c)t d . ,1981, or TCRP before a i n a pre-T cell, Raulet ct uZ., 1985).Within a Iocus, the identit), otthe gene segments targeted by the recombination machinery appears to change as a function of’ difierentiation. This is seen for example at three-segment loci where, for TCKP and IgH. 1: genes are not activated for recombination until aftw 13-to-J joining has taken place. A t TCRG, there is evidence that \:-to-Djoining precedes J segment rearrangement (Chien el ul., 19871): Lauzurica and Krangel. 1993, and cited therein). Targeting of gene segments may be even more finely specified still: at certain loci, individual V gene segments appear to rearrange in a temporally defined order (reviewed in Chen and Alt, 1993, and see Goldman et ul.. 1993). For these and other reasons, it is thought that the default state of t h e chroniatin is refractory to \I( D)J recombination, an idea conveyed in general b y the term “accessibility” (Alt et ul., 1987).Much attention
TABLE I CELLLINESACTIVE IN V(D)J RECOMBINATION ~~~~~~~~
Cell line W
m
Phenotypic designation‘
~
Transformed byb
~
~
~
Inducing conditions (if any)d
Pre-B
Ab-MuLV
Pre-B Pre-B
Ab-MuLV Ab-MuLV
33-1
Pre-B
ABC-1 NFS-5
Pre-B Lyl’ pre-B
2017
Pre-T
Ab-MuLV (Igp k transgenic) Ab-MuLV Cas-2 SM MuLV in oivo infection Ab-MuLV
M 14T
Pre-T
HAFTL-I
Progenitor (B cell) B cell
(IgK): Expression of membrane form of p-chain (IgK): Expression of membrane form of p-chain
+
Moloney MuLV i n vivo infection Harvey MuSV 7,12-dimethylbenz(a)anthracene
Ref.r
1
+ / - d IgH
“Typical” Ab-MuLV lymphoid lines P D (300-18) 300-19
38C13
Actively rearranging locic
2 3 4
5 6
(IgH): Overexpression of transcription factor E47
8
TCRa IgH, TCRp
7
(Introduced substrates): Caffeine
9 10
SPL2- 1-2
Immature B
ts All-MuLV
IgH, TCRy
46-6 50.1.1
Pre-B Pro-T
ts All-MuLV Ab-Mu LV
IgH TCRy
1210cl
Early yIG T cell Pre-B (human)
Ab-MuLV (intrathymic injection) Spontaneous
Pro-GMB Pro-B Pro-B Pre-B B cell Pre-B (human) Pre-B (human) Myeloblast Mature B (Human) ? (Hamster)
Balb sarcoma virus Balb sarcoma virus Cas-NS-7 in oioo infection Harvey sarcoma virus myc, raff viral construct Spontaneous (ALL) Spontaneous (ALL) Spontaneous Spontaneous
BLIN-I
w
ED
BAMCl BASC6 C2 NFS70 HSICS BALB-1427 Reh Nalm-6 M1 OCILY8-C3P C H O (“wild-type” or DNA repair-deficient) + RAG-1, -2 A9 + Rag-1, -2 NIH 3T3 + RAG-I, -2 BWlJ +RAG-1, -2
IgK
IgA
(IgH, TCRy): Temperature shift (IgH): Temperature shift (TCRG): In ozuo intrathymic passage and culture with thymic stroma (IgH, TCRy, TCRG): In t h o intrathymic passage ( IgK): Growth in serum-free medium
11 12 13 14
15 16 16 16 16 16 17 17 16 18 19
Fibroblast (L cell dev’t) Fibroblast
20
Hepatocyte
20
20,21
(continues )
T A B L E I-Continued
Cell l i n e HDR37 ( M 1 2 cell l i n e ) + RAG-1, -2 (heat-
Phenotypic designation'
Transformed by'
B-cell
Actively rearranging loci'
I n d u c i n g conditions (if any)d ( I n t r o d u c e d substrates): H e a t shock
Ref.'
22
inducible)
\'drlOuS
(\vlld-typr, AT,
D N A ligase 1(-), Bloom's) +RAG-1, -2
Fibloblast
S\'40
23
(human)
" Designation in reference (01-cited therein), of most closely related normal cell counterpart Note that these are not always unequivocal. All lines are inurine unless otherwise indicated. Trancforniing agent. In the case of in aioo-derived tumors, presence or absence of integrated virus is not always reported in the original citation. All loci listed undergo spontaneous reconibination in parental cells or unnianipulated subclones. No distinction has been made between various types of reconibination at a given locus. In some cases, for example, DJ but not V-to-DJ, recombination niay be observed. Where no locus is listed, the line has been shown to be active for reconibination with introduced substrates. Reference listed reports either de iiotm induction or enhanced recombination for locus in parenthesec. Induction of recombination by cell-cell fusion IS not listed (see for example, Zhao and Storb. 1992; Taccioli et al., 1993; Wang and Rosenberg, 1993). References given are those that reported ongoing recombination activity shown in the table. In most cases, original references for the derivations of the lines shown are cited therein. 1, reviewed in Rosenberg and Witte (1988). Schlissel and Baltimore (1989); 2, Lewis et al. (1982); 3, Reth et oZ. (1985, 1Y87),Daitch r t al. (1952); 4, Iglesias et al. (1991); 5, Persiani et d.(1987); 6, Hardy et al. (1986); 7, Schlissel et al. (1991); 8, Marolleau et 02. (1988), Prinii et al. (1988); 9, Alessandrini et al. (1987), Menetski and Gellert (1990); 10, Roth et al. (1990); 11, Oka et al. (199% Tsukada et al. (1990, 1992); 12, Shirasawa et ul. (1992); 13, Heuze et nl. (1992); 11, Holland et al. (1991); 15, Martin et al. (1991); 16, Lieber et al. (1987); 17, Gauss and Lieber (1993); 18, Stiernholm and Berinstein (1993); 19, Pergola et al. (1993), Taccioli et al. (1993);20, Kallenbach et al. (1992); 21, Schatz et al. (1989), Oettinger et a/., (1990); 22, et al. (1993); 23, Hsieh et al. (1993). Petrini et al. (1994).
'
''
V[D)JJ O I N I N G
41
has been given to the possible cis- and truns-acting regulatory elenients that might govern this accessbility. Although the control of V( D)J joining through the action of enhancer, promoter, and “silencer” elements is central to the topic, this has been discussed elsewhere (relevant reviews are cited above, and see also Winoto, 1991; Schatz et nl., 1992; Serwe and Sablitzky, 1993; Lauster et al., 1993). The influences of various polypeptides (in particular “surrogate” light chains, Ig-p chains, “D-p” proteins, and TCRp chains) in the temporal activation of gene rearrangement are also under intensive investigation (for reviews and discussions, see Chen, 1993a; Ehlich et aZ., 1993; Groettrup et al., 1993; Melchers et al., 1993; Rolink and Melchers, 1993; Shapiro et aZ., 1993). To confine the discussion, the regulatory aspects ofV(D)J joining will not be considered here; the following is fairly narrowly focused on the substrate itself, comprising a review of what might define “rearrangeable” chromatin. Before proceeding to a discussion of chromatin configuration, for reference, the position of known transcriptional regulatory elements relative to V, D, and J segments in the germline are summarized briefiy. Enhancers have been described for all TCR and Ig loci (in mice), and in all cases these are situated either in the J-to-C intron or 3 ’ to the constant region. For the TCR loci; TCRa and p enhancers are found 3 and 6 kb 3’ to Ca and Cp,, respectively, while the TCRG enhancer is intronic (see Leiden 1993 for review and original citations). For the Ig loci, Igh enhancers are found 15.5 kb 3’ to CA,, and 35 kb 3’ to CA,/CA,, the I ~ locus K possesses both an intronic enhancer and one 8.5 kb 3’ of the constant region, and the IgH locus has an intronic enhancer as well as a second element located over 100 k b away at its furthest 3’ reaches (see Staudt and Lenardo 1991 for original citations). Promoter elements are found S’ of all functional V gene segments and additionally, sequences with promoter activity are found 5‘ to D, and Dp (Reth and Alt, 1984; Siu et al., 1984). The state of the chromatin in the neighborhood of rearranging gene segments has been assessed according to three criteria. These are { 1)transcriptional activity, (2) DNase 1 sensitivity, and (3) methylation. Each feature correlates with V( D)J recombination, although none perfectly predicts which joining signals are available for rearrangement. The question of chromatin structure during VCD)J recombination is verv difficult to approach experimentally for reasons that are both technical and theoretical. As assessed in a huik population of cells, the state of the chromatin at the time of observation may o r may not reflect the condition of the substrate during recombination as it exists in an individual cell. Additionally, it is not clear how many different
42
SUSANNA M . LEWIS
“states” need be defined: the chromatin changes that first accompany the onset of recombination, or “opening” of a locus, may be different from that which allows particular elements within the locus to be later targeted. It is also conceivable that the accessible state is achieved through different mechanisms at different stages of gene assembly, so that the features that allow D-to-J joining may be different from those that permit V-to-DJ, V-to-D, or V-to-J rearrangement (Ferrier et d., 1990; Lauzurica and Krangel, 1993; Serwe and Sablitzky, 1993). Consequently, some basic questions still remain to be clearly formulated, and most of the following observations are as yet, only partially interpretable.
1 . Transcription Many studies have shown that it is possible to detect Ig or TCR gene transcription prior to, or concomitant with, the onset of V(D)J rearrangement. Transcripts of unrearranged V gene segments as well as unrearranged J-C regions have been observed (Van Ness et al., 1981; Yancopoulos and Alt, 1985; Cook and Balaton, 1987; Leclercq et al., 1989; Schlissel and Baltimore, 1989; Lennon and Perry, 1990; Martin et al., 1991; Schlissel et al., 1991; Fondell and Marcu, 1992; Madrenas et al., 1992; Thompson et al., 1992; Tsunetsugu-Yokota et ul., 1992; de Chasseval and de Villartay, 1993; Goldman et al., 1993; Shimizu et at., 1993).Transcription and recombination correlate well in several inducible systems (Schlissel and Baltimore, 1989; Martin et al., 1991; Schlissel et al., 1991). V gene segment transcription at the relevant locus is seen in cells poised for V-to-DJ or V-to-J recombination (Yancopoulos and Alt, 1985; Martin et al., 1991; Schlissel et ul., 1991; Fondell and Marcu, 1992; Tsunetsugu-Yokota et at., 1992). Significantly, cells that are inactive for V-to-DJ, but capable of D-toJ H joining (at the same locus) do not transcribe their unrearranged VH gene segments (Schlissel et al., 1991). A particularly striking correlation was found at TCRy where the transcription of unrearranged Vy gene segments rises and falls in parallel with their ordered recombination during ontogeny (Goldman et al., 1993). The essential meaning of the relationship between transcription and recombination is unclear. The data from various studies indicate, above all, that the definitive experiment has yet to be devised. As an example, whereas an estimated 150-fold increase in D-to-J, rearrangement accompanied transfection of a pre-T cell line by the transcription factor E47, the “I-p” transcript that was also induced by this factor, did not actually pass through any D or J segments (Schlissel et al., 1991). Investigation of the link between transcription and V(D)J recombina-
V(D)J JOINING
43
tion with transgenic constructs has supported somewhat varied conclusions as well. Lineage-specific transcription of gene segments parallel rearrangement in some experiments (e.g., Ferrier et al., 199Ob; Lauster et nl., 1993; Chen et al., 1993) but examples of rearrangement in the absence of detected transcription has been found in other cases (e.g., Bucchini et al., 1987; Goodhardt et nl., 1987; Engler et al., 1991a; Kallenbach et al., 1993; Lauster et nl., 1993). Studies with an extrachromosomal plasmid substrate (described in more detail in Section IV,C) showed a constant recombination frequency in tests in which steadystate transcription levels were experimentally varied over four orders of magnitude (Hsieh et a!., 1992).While it is possible that extrachromosoma1 substrates only imperfectly reconstruct the chromatin configuration of the endogenous joining target, taken together, the evidence to date disfavors an obligate link between transcription and recombination. Thus, while transcription may be the one salient feature determining a rearrangeable target site for certain V gene segments (for example, Yancopoulos and Alt, 1985; Schlissel et al., 1991; Goldman et al., 1993), it is difficult to generalize across the board to every category of V(D)J recombination. As many authors note, it would not be surprising to find that either transcription represents only one of several ways to activate the endogenous substrate in some contexts and/or that it is detected as an indirect by-product of “activation.”
2. DNase 1 Sensitivity Nuclease sensitivity provides another means of measuring changes in chromatin configuration. DNase sensitivity studies of either intronic or 3’ enhancers associated with various loci have demonstrated hypersensitive sites early in lymphoid differentiation; in some cases hypersensitivity appears to develop even prior to T or B lineage commitment (Hagman et nl., 1990; Ford ef nl., 1992; Blasquez, 1994). Changes more specifically localized to various gene segments have also been demonstrated. The chromatin of pre-B-like transformants that possess the ability to spontaneously rearrange certain of their Ig loci has been probed in the region surrounding the active J segments, and a consistent correlation between rearrangement and DNase 1 sensitivity was found (Yancopoulos et al., 1986; Persiani and Selsing, 1989). In both T and B lymphocyte lineages, recombination of signal-like elements (unattached to a functional gene segment) occurs with regularity, and such events are likewise linked to the onset of nuclease hypersensitivity (Daitch et al., 1992; de Chasseval and de Villartay, 1993). With introduced substrates, almost all experiments support a relationship between DNase 1 sensitivity and recombination. For example, when
44
SUSANNA M . LEWIS
a substrate containing unrearranged Vp, DP, and Jp segments was tested in a pre-B-like transformant, DP-to-JP joining was observed, but the closely linked Vp gene segment would not rearrange. The introduced Dp and JP gene segment sequences were DNase 1 sensitive when compared to the cell’s endogenous (nonrearranging) Dp and JP gene segments, but, significantly, the nearby, inert, Vp gene segment in the substrate was DNase resistant (Ferrier et al., 1989). DNase 1 sensitivity studies thus appear to pick up global changes that serve as a prelude to recombination as well as more specific changes that create a permissive substrate for rearrangement. The studies indicate, at the very least, that the rearranging loci have a chromatin configuration in primitive embryonic cells, or cells from an irrelevant lineage, different from that in lymphoid progenitors and, further, that within an active cell, differences exist between loci or gene segments that undergo rearrangement and those that do not. These studies thus in a general way substantiate the notion of accessibility on a’molecular level. The precise nature ofthe chromatin conforniational change accompanying nuclease sensitivity remains to be elucidated.
3. Methylation Methylation of cytosine in DNA is an important parameter governing tissue-specific gene expression (reviewed in Razin and Cedar, 1991; Bird, 1992). Early work showed that patterns of CpG methylation change during 1yniphocyte maturation and introduced the notion that such changes might also be relevant for V(D)Jjoining (Storb and Arp, 1983).Within the lymphoid lineage, there is support from studies hoth of the physiological substrate and with introduced sequences for the idea that methylation has consequences for antigen receptor gene assembly. Studies of nontransformed cells indicated that in the region surrounding the JP2 segment, certain sites were less methylated in immature thymocytes when compared to mature T cells, or splenic B cclls (Burger and Radbruch, 1990). A second analysis of methylation o f the J p region in Ixmatopoetic precursors, early fetal thymus, and bone marrow cells also indicated that a hyponiethylated state at the TCRP locus is lineage-specific and is established close in time to the onset o f rearrangement. Further, experimental demethylation, by treating cells with 5-azacytidine, was found to increase recombination in early T lineage cells (Vila ef at., 1993). Studies with introduced substrates have begun to examine demethylation and V(D)J recombination more directly. For example, U. Storb and colleagues found that methylation of a transgenic recombination
substrate was high]). strain dependent and were able to exploit this finding to establish a connection between methylation and rearran ge men t . A 1ocus , name d st rai n- s peci fie modifier- 1 ( S s m -1), was identified that maps to chroniosoine 4 (Engler et al., l Y Y l b ) . By selective crosses it was possillle to derive mice that varied with regard to methylation of the transgene and in this fashion to measure effects of methylatioil on recornhination in a fully in 2iiz;o context (Engler et al.. 1993). A compelling set of observations was that for some lines, the mice had transgene arrays in which individual copies were inethylated to a different extent. The methylation pattern was similar in all tissues (i.e., stable), and within the transgene arra17, recombination was limited to hyponiethylated sequences (Engler et nl., 1993). Tests of the effects of substrate methylation were carried out with introduced plasmid substrates as well (Hsieh and Lieber, 1992). In a provocative study, it was demonstrated that the negative effect of methylation could be reproduced i n an extrachromosomal assay system. Here, a new twist to the story emerged. The minichromosome became resistant to V(D)J recombination only after it was replicated. The joining signals in nonreplicating plasmids recombined, whether methylated or not. This observation argued against the possibility that methylation might interfere directly with the binding of the recombination machinery to its targets. Instead, a change in accessibility was suggested by the resistance of the methylated ininichromosome to restriction enzyme cleavage which, after replication, became even more marked. (It is of interest that for unrelated recombination systems tested in an extrachromosomal assa)., similar effects ofsubstrate methylation are not observed: see Pryciak et d., 1992; Puchta ef al.. 1992.) Based on these obserwtions, the authors suggested that methylation in itself does not IiaI access b y the 1-ecombination machinery, but is a signal that can switcli the chromatin into an inaccessible state afterreplication (Hsieh and Liebel-, 1992). For the present, a great many questions allout the endogenous substrate remain. Is accessil)ility a yes or no situation, or do different states of accessihilit!. exist? How does accessibility correspond to different categories of recoml)ination ( i . c . , D-to-J joining rather than V-to-DJ rearrangement)? Perhaps methylation is only relevant for gene segments that are located near an enhancer, while another feature, such as transcription, is kej. in regulating the recombination of gene segments that are equipped with their own promoters. Some of t h e w issues nia!, be unraveled b y investigating the informative contrasts that exist between the TCKG locus and the other three-segment loci, given that the enhancer dependence of V-to-D versus D-to-J recombi-
46
SUSANNA M . LEWIS
nation is apparently reversed (Lauzurica and Krangel, 1993). There is no question that chromatin configuration is important in this recombination system, and there is much incentive to learn exactly what accessibility means in molecular terms. IV. Model Systems
A. WHYNOT JUSTANALYZEin V~DO-GENERATED JUNCTIONS? As will be detailed in the next section (section V), the structure of the junctions formed in V(D)J recombination events can reveal much about the mechanism. How such junctions are sampled, however, is of key importance. Cells with rearranged antigen receptor genes are readily obtained from normal lymphoid tissues, and, using polymerase chain reaction (PCR) technology, it is possible to generate extensive collections of junction sequences. In real life, selection winnows out a great majority ofV(D)Jjoining products. A number of different repertoires, the “emergent”, the “preimmune”, the “peripheral”, and so forth, can be described for an intact animal, and in any given experiment, it is not always obvious which of these repertoires has been sampled, nor indeed whether selective elimination of an entire category of V(D)J junction might have occurred. Some evidence favors the view that selection can operate on T and B cells, or on antigen receptor gene products, prior to the completion of the rearrangement program (Decker et al., 1991; Mallick et al., 1993; Anderson et al., 1993; Groettrup et al., 1993). One way this might occur is through the incorporation of one of the antigen receptor chains into an immature receptor structure that transduces a signal upon ligation (Takemori et al., 1990; Misener et al., 1991; Groettrup et al., 1992, 1993). Another might be through the association of a component antigen receptor chain with a protein that affects its intracellular fate (Shirasawa et al., 1993). The general problem of selection is not necessarily avoided by limiting an analysis to junctions that arise in partially assembled genes. Promoters upstream of DH (Reth and Alt, 1984), and D p (Siu et al., 1984; Clark et al., 1984) potentiate transcription of chromosomes that have undergone D-to-J joining only, allowing, in theory, for the production of “Vless” peptides. In the case of the Ig heavy chain locus, evidence suggests that a D-p protein can be manufactured in transformed preB cell lines (Reth and Alt, 1984), that has the potential for surface display (Tsubata et al., 1991). It has not yet been established D-p production occurs in normal pre-B cells (Rolink and Melchers, 1993), nevertheless the possibility exists that even D-to-J rearrangements
V(D)J JOINING
47
have in some fashion already been subjected to physiologic selection (e.g., Gu et al., 1991).Oftentimes, “nonproductive” (out-of-frame)joins are presented as examples of unselected junctions. However, when collected from lymphoid cells or tissues, such nonproductive joins are isolated from “successful” cells; their coexistence with productive joins in a functional T or B cell supports the expectation that even out-of-frame junctions may have been subjected to selection on the basis of their coding capacity (or lack thereof). For these reasons, the essential features of the V(D)Jjoining machinery are easiest to analyze when completely removed from the immune environment. It is beyond question that studies of junctions generated in intact animals have drawn attention to features of the joining mechanism that were less emphasized with artificial model systems. It remains the case, however, that having highlighted the possible role of homology in joining or the existence of “P” nucleotides for example (discussed in detail in section V ) such features are not established by in vivo studies. Experimental exploration can go forward only through the use of introduced substrates in systems where the rearranged sequence is of no biological consequence to the cell in which it resides.
B. REARRANGING CELLS:B, T, AND OTHERS V(D)J recombinaton occurs during a defined period early in T and B lymphocyte differentiation, after which the ability to carry out gene assembly is shut down. The complete picture ofhow the recombination process is integrated into the differentiation program is an area of intense research, supported by studies both on normal cells and on transgenic mice that cannot rearrange/express a particular locus (e.g., Chen et al., 1993a; Faust et al., 1993; Itohara et al., 1993; Muegge et al., l993a; Serwe and Sablitzky, 1993; reviewed in Rolink and Melchers, 1993). The isolation of normal cells in the process of V(D)Jjoining initially presented insurmountable technical challenges, so that for a long time immortalized early B lineage cells provided the only experimental opportunities. Oddly, ongoing recombination is not a feature of most transformed pre-B analogs. Hybridomas, where normal pre-B cells are fused to a more mature myeloma cell, are negative for ongoing recombination. Apparently a factor contributed by the myeloma partner downregulates expression of several genes playing a role in V(D)J recombination (Engler et al., 1991a; Zhao and Storb, 1992). A wellstudied pre-B cell line, 702/3,likewise scored negative for recombination activity despite its characteristic pre-B phenotype (Lieber et al., 1987, although rare, recombination positive variants have been se-
48
SUSANNA M. LEWIS
lected; Schatz and Baltimore, 1988). Epstein-Barr virus (EBV)immortalizes human fetal cells, giving rise to transformants that correspond to early stages of B cell differentiation, but their Ig genes do not rearrange during passage in culture (Katamine et al., 1984; Hui et al., 1989; Kubagawa et al., 1989; Nickerson et al., 1989; and cited therein). The only agent that reliably immortalizes cells capable of ongoing Ig gene assembly has proved to be the Abelson-murine leukemia virus (A-MuLV; reviewed in Rosenberg and Witte, 1988). A-MuLV-transformed lymphoid cell lines may be generated by a variety of protocols, usually either by in vivo infection of newborn mice or by in vitro infection of fetal liver or adult bone marrow cells (reviewed in Rosenberg and Witte, 1988). Different protocols yield cells at different stages of B cell differentiation and even some nonB lineage transformants (e.g., Rosenberg and Witte, 1988; Siden, 1993). The typical A-MuLV lymphoid cell line is germline at its Ig lightchain loci and has at least partially rearranged its IgH locus (Alt et al., 1981). Despite having achieved some heavy-chain gene assembly, AMuLV transforinants may or may not be able to synthesize a p heavychain protein and/or carry out further recombination (Lewis et al., 1982; Alt et al., 1984; Ramakrishnan and Rosenberg 1988; Wang and Rosenberg, 1993). Representative phenotypes and gene structures found among lymphoid examples of A-MuLV-transformed cell lines (some of which are T- rather than B-like) are shown in Table 1. Most A-MuLV transformants, even if incapable of rearranging their antigen receptor loci, can recombine defined, introduced substrates (Blackwell and Alt, 1984; Lewis et al., 1984; Lieber et al.. 1987; Ramakrishnan and Rosenberg, 1988; Wang and Rosenberg, 1993).This ability appears to be stable over time (Lieber et al., 1987; Wang and Rosenberg, 1993). A number of different recombination substrates have been used in such studies, as are described in the following section. Only a handful of non-A-MuLV murine lyniphomas and human leukemic cell lines have been reported to actively undergo V(D)J recombination (Kleinfield et al., 1986; Dasgupta and Lilly, 1988; Berrnstein et ul., 1989; Wormann et d.>1989; Roth et a!.- 1990; Martin et al., 1991; Gauss and Lieber, 1993; and see Table I). This alone might indicate that there is something important about the abl protein when it comes to the physiology of a rearranging lymphocyte. This view is underscored by studies with temperature-sensitive variants of AMuLV (as discussed in Rosenberg, 1991) and by the specific depletion of B and T cell progenitors in abl-deficient mice generated by gene targeting (Schwartzberg et al., 1991; Tybulewicz et al., 1991). LilthoughA-MuLV transformants presented the first opportunity to study V(D)J joining as an ongoing event, other sources of clonable,
V(D)JJOINING
49
rearranging cell lines have since been developed. Bone marrow stroina will support B cell lyniphopoeisis (Whitlock and Witte, 1982; reviewed in Dorshkirid and Witte, 1987; Dorshkind, 1990; Rolink et al., 1991) and such long-term culture systems have made it possible to begin to chart the functional relationship between gene rearrangement and other landmarks i n very early B cell differentiation (e.g., Hayashi et al., 1990; Era et al., 1991; Hardy et al., 1991; Cumano and Paige, 1992; Henderson et al., 1992; Palacios and Samaridis, 1992; Cumano et al., 1993; Faust et al., 1993; and reviewed in Kolink and Melchers, 1991). Despite their suitability for the study of regulatory aspects of the V(U)J joining process, long-term bone marrow cultures are far more coniplicated to maintain than A-MuLV-transformed cell lines, and so have not been used extensively to inquire into the recombination mechanism itself. Early B lymphopoiesis has been reconstructed in cultures supported by various lymphokines in the absence of stromal cells. This promises to provide a powerful approach to a single-cell analysis of the coordinate changes accompanying gene rearrangement in very early B cell differentiation (Kee et ul., 1994). Although there is no A-MuLV equivalent for the reproducible derivation of immortalized, rearranging T cells, there are some in vitro systems for studying T cell differentiation. Extrathymic T cell differentiation can be supported in hone marrow cultures (Hurwitz et al., 1988) and a system for analyzing recombination in thymus-dependent lineages involves short-term organ culture of repopulated fetal thymic lobes (Ikuta and Weissmaii, 1991). TCR gene structure has also been analyzed as a function of differentiation for progenitor cell clones grown on thymic epithelial cells (Palacios and Samaridis, 1993). Suspension cultures of thymocytes have been shown to maintain active TCRP gene rearrangement when treated with 11-7 (Muegge et ul., 1993a). In a different type of approach altogether, it has become possible to generate nonlymphoid cell lines with the ability to carry out V(U)J recombination, virtually at will. Co-introduction of the RAG-1 and RAG-2 genes (described in more detail below) into inactive cells potentiates V(D)J joining as measured on introduced substrates (Schatz and Baltimore 1988; Oettinger ct ul., 1990). To date, in every case reported, nonlyinphoid cells have successfully been rendered recombination proficient by this manipulation. Tested lines include (in addition to NIH 3T3 fibroblastoid cells) a fetal mouse hepatoma, an L cell derivative, Chinese hamster ovary cells, and human fibroblastoid lines (Oettinger et al., 1990; Kallenbach et al., 1992; Hsieh et al., 1993; Pergola et al., 1993; Petrini et a/., 1994; Taccioli et al., 1993). This methodology is only just beginning to be exploited, but has great
50
SUSANNA M. LEWIS
potential for uncovering essential information about the mechanics of the recombination system. Increasingly it appears that V(D)J joining requires significant participation of non-tissue-specific functions, thus the ability to look at the products of joining that are formed in mutant cells, in different cell types, and in various species, is particularly relevant.
C. INTRODUCED SUBSTRATES The first systematic explorations of the V(D)J joining process involved the use of artificial recombination substrates introduced into A-MuLV cell lines (Blackwell and Alt, 1984; Lewis et al., 1984).Recombination substrates have subsequently been introduced into normal cells through transgenic technology (reviewed in Rusconi, 1991), where they exhibit lymphoid-specific V(D)J joining (Bucchini et al., 1987; Goodhardt et al., 1987,1993; Ferrier et al., 1990b; Bruggemann et al., 1991; Kawaichi et al., 1991; Matsuoka et al., 1991; Abeliovich et al., 1992; Engler et al., 1992, 1993; Lauster et al., 1993; Lauzurica and Krangel, 1994; Tuaillon e t aZ., 1993). V(D)J joining substrates currently in use may be divided into two main categories: stably integrated and extrachromosomal. Each is well suited to particular applications. Stable introduction of recombination sequences is achieved either b y retroviral infection or DNA transfection. Retroviral vectors are useful where single-copy, nonpermuted integrants are desired (Lewis et al., 1984). A disadvantage of DNA transfection, as compared to virusmediated integration, is that substrate sequences can become partially duplicated or otherwise scrambled in the course of becoming incorporated into the recipient genome (e.g., as was the case in one early experiment, Blackwell and Alt, 1984). Nevertheless, retroviral substrates most often contain functional LTR enhancer/promoter elements, and because this route is limited to infectable cell types, direct DNA transfection is sometimes necessary (Ferrier et al., 1989, 1990b; Engler et al., 1991a,b). A major application for direct introduction is in the generation of transgenic mice, where DNA is either injected into embryos or transfected into ES cells. A prototype construct is shown in Fig. 4a (Lewis et al., 1984). As configured, a site-specific inversion is required in order to activate a drug-resistance marker. The selectable gene becomes flipped by the reciprocal joining of VKand JK gene segments located on either side, and once inversion occurs, the viral LTR promoter drives expression. Recombinant (drug-resistant) cell lines are isolated in selective media, and the new substrate structures can be characterized by a variety of
51
V(D)J JOINING
A. P-
I
(V-to-J inversion)
P-
n
___, (deletion) py early region I
py early region
FIG.4. Introduced substrates for V(D)J joining. For discussion and references, see text. Examples of substrates used in two basic approaches are shown. (A) Retrovirally integrated substrate for testing recombination in a chromosomal context (Lewis et a/., 1984). (B) Episomal shuttle plasinid for use in extrachromosomal assays (Hesse et d., 1987).
methods that may include PCR and DNA sequence analysis. Constructs similar to that shown in Fig. 4a have been developed in a nuniber of laboratories, and for most applications it has been necessary to include a second drug-resistance gene that is expressed independent of recombination (Akira et al., 1987; Landau et ul., 1987; Desiderio and Wolff, 1988; Malynn et al., 1988; Schatz et al., 1989; Hendrickson et ul., 1990; Matsuoka et ul., 1991). Integrated substrates that allow selection based on deletion rather than inversion of D N A sequences have also been developed (Blackwell and Alt, 1984; Engler and Storb, 1987). Stable integration of recombination substrates not only permits isolation of recombinant junctions, but also the retrieval of any cell in a population in which a rare recombination event has occurred. The importance of the latter capability has been amply demonstrated by
52
SUSANNA M. LEWIS
the identification and isolation of the recombination-activating genes, Rag-1 and -2 (Schatz and Baltimore, 1988; Schatz et al., 1989; Oettinger et al., 1990). The second class of recombination substrate (Fig. 4b) does not be1987; come integrated into the recipient cell’s genome (Hesse et d., Lieber et ul., 1987). These shuttle plasmids are transfected into a rearranging cell line and reisolated 2 days later. The substrates contain an SV40 or polyoma early region and thus are maintained extrachromosomally in the interim (Hesse et ul., 1987; Lieber et d . ,1987; Abe et al., 1991; Ramsden and Wu, 1991; Kallenbach et al., 1992; Hsieh et al., 1993; Petrini et al., 1994). [Plasmid replication increases the sensitivity ofthe assay, but is not essential to observe V(D)J recombination (Hsieh et al., 1991).] The recovered DNA is then introduced into Escherichia coli, where it is maintained by virtue of a procaryotic origin of replication. Molecules that underwent V( D)J joining have activated a procaryotic selectable marker and can be isolated and quantified on that basis. Products of recombination can also be analyzed without passing them through E . coli, by Southern blot andlor PCR amplification of DNA prepared from transfected cells ( J . Menetski and M. Gellert, personal communication). Nonintegrated substrates are heavily used in mechanistic studies. Whereas, in principle, an approach with stably introduced substrates might be adapted to allow for quantification of V(D)J recombination frequencies, in practice, such assessments are most reliably accomplished with the extrachromosomal assay (e.g., Lieber et a l . , 1987; Hesse et ul., 1989). The reasons for this are speed, the large sample size yielded by a single experiment, and the ready-to-sequence form in which recombinants are retrieved. These features make the extrachromosomal assay a good choice for making cross-comparison of recombination activity between different cell lines (Lieber et al., 1988b; Hsieh et al., 1993; Pergola et al., 1993; Petrini et al., 1994; Taccioli et al., 1993). Several different reporter genes have been used in V(D)J joining substrates. For eucaryotic selection, these are the guanine-xanthine phosphoribosyl transferase, neomycin phosphotransferase, thymidine kinase, P-galactosidase, and the interleukin-2 (IL2) receptor genes (Akira et al., 1984; Blackwell and Alt, 1984; Lewis et al., 1984; Engler and Storb, 1987; Desiderio and Wolff, 1988; Hendrickson et al., 1991a; Kawaichi et al., 1991). For procaryotic selection schemes, the chloramphenicol acetyl transferase and the p-galactosidase genes have been used (Hesse et al., 1987; Abe et al., 1991; Kallenbach et al., 1992). Particular substrates have been problematic in the past. For example, a transgenic substrate with an inversionally activated p-
\j(ll)l JOINING
53
galactosidase reporter gene gave misleading results (reviewed in Abeliovich et uZ., 1992; Schatz and Chun, 1992),and chloramphenicol acetyl transferase constructs have also been shown to give a background of false positives (Hesse et d.,1989; Abe et d., 1991; Pandey et nf., 1991). As far a s it is known at present, however, there are no technical restrictions on the use of any of the :ivailable substrates, provided that, instructed b y these prior episodes, appropriate caution in the association of a recombinant structure with a positive signal is employed. The sensitivity or utility of any of the above assay systems may be augmented by the use of PCR amplification to either isolate or quantify recombinant junctions (e.g., Abe et uf., 1991; Hendrickson et uf., 19Yla). Although the present systems are quite versatile, there is still sonie room for improvement. The currently available extrachroniosoma1 substrates are used in terminal cultures; down the road it may be advantageous to be able to easily analyze and isolate recombinants without sacrificing the cell line in which rearrangement took place. A substrate that can be both stably and extrachroinosomally maintained might combine the best of both worlds. V. Fine-Structure of Recombinants: Clues to the Mechanism
A. LOCATION OF
THE
CROSSOVER SrrE
I n V(D)J recombination, the crossover site can often be read directly from the D N A sequence. The sequence of one precursor simply ends, and the other begins. In comparing the fine-structure of V(D)J coding joints and signal joints, one feature that is immediately obvious is their asymmetry. Although reciprocally formed, signal joints and coding joints are only rarely exact reciprocals (Lewis et ul., 1985). Moreover, one junction is stereotyped, the other variable. Signal joints contain signal elements that are joined exactly at their borders; suggestive of the probable site of cleavage. The variability of coding joints is consistently related to this hypothetical cleavage site by truncation and/or base addition. Some reports have suggested that the cleavage site might deviate from the position just at the signal edge, where “residual” nucleotides derived from t h e coding region appear a s inserts within signal joints, or vice versa (Malissen et al., 1986; Deev et al., 1987; Okazaki et ul., 1987). However, such junctions are rare, have never been isolated as a coding jointlsigna1 joint reciprocal pair of products, and could easily be explained on the basis of N addition (see below). The only established exception is the special case where, reproducibly, two “coding” bases appear as inserts within signal joints at the TCRG locus (Carroll et nl., 19931)). Here, the se-
54
SUSANNA M . LEWIS
quence flanking DG1 actually contains two overlapping imperfect joining signals, displaced by two bases, each of which has an equal number of identities to the canonical sequence. Thus an apparent variation in the crossover site most probably reflects an invariant recognition of two alternative joining targets (Carroll et al., 1993b). It is not established whether coding and signal ends are fully separated (on both strands) by a double-strand cut prior to strand exchange (for example, models based on single-strand transfers have been suggested in the past: Lewis et al., 1985; Kallenbach and Rougeon, 1992). Evidence, however, favors the possibility that a double-strand break is introduced at or very near the signal border in V(D)J recombination. Southern blot analysis of DNA prepared from newborn thymus revealed the presence of site-specifically broken molecules near the D and J segments of the TCRG locus (Roth et al., 1992a,b). Detailed analysis of the cleaved species showed that the majority of the broken DNA molecules terminated at the signal border were blunt and were 5’ phosphorylated (Roth et al., 1992b, 1993; Schlissel et al., 1993). Although it is possible that the broken molecules detected in thymus DNA arise from a side reaction, or represent aberrant (and thus nonjoinable) products, there is no evidence to date to contradict the simpler interpretation that these structures correspond to intermediates in V(D)J recombination (Gellert, 1992b).
B. JUNCTIONAL INSERTS Two different types of junctional insertion have been described within V(D)J recombination products, these are N regions (or NGEs, for nongermline element) and P (for palindromic) nucleotides (Sakano el al., 1981; Lafaille et al., 1989).A third type of insertion, arising from “oligonucleotide capture” (Roth et al., 1991),has also been proposed to exist (Lieber, 1992). 1 . N Regions and Terminal Deoxynucleotidyl Transferuse Extra bases are incorporated into some recombinant junctions (Sakano et d.,1981; Kurosawa and Tonegawa, 1982). These N regions are typified by an enriched GIC content (Alt and Baltimore, 1982; Roth et ul., 19891, they are rarely longer than roughly 15 nucleotides (Koth et al., 1989),and they are found much more often within coding joints than within signal joints (Lieber et ul., 1988a). The proposition that N regions are introduced by the enzyme terminal deoxynucleotidyl transferase (TdT; Alt and Baltimore, 1982) has been validated. Disruption of the TdT gene resulted in the near-absence of junctional insertion in transgenic animals (Gilfillan et al., 1993; Komori et ul., 1993). (TdT is discussed further in a separate section: see V1,A.)
V(D)J JOINING
55
Because it has been established that virtually all N insertions are due to the activity of TdT, the presence or absence of N regions within recombinant junctions can be interpreted in light of the known in uitro properties of this enzyme (reviewed in Chang and Bollom, 1986). For example, although N inserts can arise in both coding joints and signal joints, in the latter case relatively higher in uiuo levels of TdT activity are required (Lieber et al., 1988a). This observation is fully consistent with the idea that blunt-ended signal termini are generated as cleavage products (discussed above): such molecules would be expected to be relatively refractory to TdT modification (Chang and Bollom, 1986). A second inference is based on the fact that, within signal joints, N nucleotides appear between signals that have been “precisely” interrupted at their borders. This observation indicates that 3’ hydroxyls existed at each signal terminus prior to N modification, consistent with analyses of signal ends generated in uiuo (Roth et al., 1992a, 1993). Disruption of the TdT gene drastically lowered the occurrence of junctional insertion without eliminating them entirely, thus the question remains whether terminal transferase is responsible for every N region. The residual insertion (distinct from P inserts, see below) seen in the gene disruption studies could conceivably be due to low-level TdT activity in the mutant mice (in neither case was the gene deleted in its entirety; Gilfillan et al., 1993; Komori et al., 1993). It seems more likely, however, that some nontemplated insertion occurs in a very minor fraction of coding joints, independent of TdT action. For example, fibroblastoid cells that rearrange V(D)J joining substrates following co-introduction of RAG-1 and RAG-2 do not presumably express TdT (Landau et al., 1987), but still exhibit occasional junctional insertion (Schatz et al., 1992; Taccioli et al., 1993).Regardless, it is evident that TdT is the most physiologically relevant source of insertion in the V(D)Jjoining system (Gilfillan et al., 1993; Komori et al., 1993). A significant feature of N regions is that their occurrence is developmentally regulated. This is a surprisingly general observation; noted in species as diverse as mouse, man, chicken, and frog (Elliott et nl., 1988; Carlsson and Holmberg, 1990; Feeney, 1990, 1991a; Gu et al., 1990; Meek, 1990; Bangs et al., 1991; Bogue et al., 1991; McCormack et al., 1991a; McVay et al., 1991; Schwager et al., 1991; Bonati et al., 1992; Engler et al., 1992; George and Schroeder, 1992; Holman et al., 1992; Mortari et al., 1992; Raaphorst et al., 1992; Roth et al., 1992; Thompson et al., 1992). In fetal or neonatal animals, N regions are low or absent, apparently as a consequence of the developmental regulation of TdT. In close agreement with early studies of the onset
56
SUSANNA M . LEWIS
of TdT protein biosynthesis in the murine thymus during ontogeny (Rothenberg and Triglia, 1983), expression of TdT RNA does not appear until 3 to 5 days after birth (Bogue et al., 1992). TdT expression precedes the appearance of N regions in TCR junctions by a few days (Bogue et al., 1992; see also Bonati et al., 1992, for a similar analysis in humans). It has been suggested that the significance of the delayed onset of TdT expression is that it creates an early repertoire with special properties, possibly allowing for the generation of more polyspecificreceptors in general (Bogueet al., 1991,1993).A second possibility is that absence of TdT allows for the early dominance of certain particular receptors with necessary specificities (Gu et al., 1990; Feeney, 199lb, 1992a; see Section D, Homology, below).
2 . P Nucleotides A second type of junctional insert niay have a less general impact on the physiology of the immune system, but has nonetheless provided an important clue about the joining mechanism. P nucleotides are found in junctions where a coding end has been joined without truncation and constitute a very short inverted repeat of the untrimmed end; hence “P”, for palindrome (Lafaille et al., 1989). A P insert where, for example, a full-length end terminated with the residues “AC”, would be “GT”. Although apparent P insertions were present in many collections of endogenously generated V(D)J junctions, as initially described their infrequent occurrence raised doubts as to their existance. An alternative possibility was that TdT or some other mechanism that introduces random insertions, perhaps coupled with physiological selection, might have generated the apparent pattern. However, several observations have validated the existence of P insertions. One is that P insertions appear in V(D)J junctions formed in cells where it is virtually certain that they were not contributed by terminal deoxynucleotidyl transferase, the major source of random base addition (Komori c,t al., 1989; Kallenbach et al., 1992; Gilfillan et al., 1993). Second, P nucleotides were shown to arise at statistically significant frequencies, regardless of coding end sequence, by the plasmid assay. Here they were distinguished from random base addition and measured in a system that had been removed from physiological selective forces (Meier and Lewis, 1993). The nonrandom nature of P inserts invited speculation about the joining mechanism, even before the inverse-complementary relationship between the patterned inserts and the adjacent coding end had become completely clear (Traunecker et al., 1986; Wysocki et al., 1986; McCormack et al., 1989). A number of experiments now point
V(D)J JOINING
57
toward the possibility that P insertions are present in V(D)J junctions because a hairpin molecule is generated as a cleaved intermediate in joining (Fig. 5 ; Lieber, 1991; and reviewed in Gellert, 1992b; Ferguson and Thompson, 1993). One of the experiments to bring the focus sharply on the hairpin possibility was the provision of direct physical evidence for sitespecifically cleaved coding ends bearing covalently closed termini in thymus DNA (Roth et al., 1992a). Significantly, the cleavage products corresponding to signal ends lacked hairpin termini. This observation was completely in line with the fine-structural data: P insertions had not been found next to signal termini in V(D)J junctions (Lafaille et al., 1989; Lieber, 1991; Meier and Lewis, 1993). A second experiment directly established the link between hairpin-ended DNA molecules and P insertion with the demonstration that introduced synthetic hairpin termini could become joined in A-MuLV cell lines and upon joining did in fact give rise to junctions with P insertions in a large majority of products (Lewis, 1993). A detailed model for the origin of hairpin coding ends and subsequent processing has been provided (Lieber, 1991). For the present, it should be pointed out that this difference between the physical structure ofcoding termini and signal termini could be the key determinant of asymmetry in V(D)Jjoining, (mentioned in section V,A). While signal ends are in ready-to-join form, it may be that the coding ends cannot be connected without additional processing.
C. TRUNCATION The subtraction of a small, variable number of basepairs from the coding ends before joining is a significant source of junctional diversity. In some circumstances where N insertion, somatic mutation, and “combinatorial diversity” are either absent or limited (e.g., in T cells early in ontogeny; Elliott et al., 1988),the major mechanism for antigen receptor diversification is variable truncation (Davis and Bjorkman, 1988).One can inspect virtually any collection of V(D)Jjunctions from any species, tissue or cell type (engineered fibroblasts included), and in many cases the codingends will have lost some residues. Either base loss is intrinsic to the joining mechanism or, if it is due to associated functions, these other functions must be ubiquitous. An early suggestion, which has become fixed in the literature to some extent, is that an exonuclease trims the coding ends after they have been disconnected from their signals and that this processing step precedes joining (Alt and Baltimore, 1982). However, there is no a priori basis for the presumption that “trimming” occurs before liga-
58
SUSANNA M . LEWIS
CATG
t
P
l1
l1
FIG.5. Proposed hairpin origin ofP nucleotide insertions (Lieber, 1991).Both strands of the DNA molecules are indicated. At the top is shown the suggested structure of coding ends immediately following cleavage. Nicking of the hairpin near, but not at, the tip will generate strand extensions. These extensions might suffer a variety of fates prior to ligation. Fill-in polymerization (left) would generate a “P” nucleotide insertion.
tion or even that it is the result of an exonucleolytic rather than endonucleolytic activity (various possibilities are indicated in Fig. 6). The truncation feature of V(D)J joining is reminiscent of base loss that occurs in end-joining reactions, and it is conceivable that there may be a fundamental relationship (Roth and Wilson, 1986). Base loss in end-joining reactions has been attributed to diverse mechanisms which involve an interaction between the two termini: it is not inconceivable that some of these may be relevant to V(D)J joining as well (Roth et al., 1985; Roth and Wilson, 1986; Pfeiffer and Vielmetter, 1988; Ganesh et al., 1993). At present the possibilities have not been significantly restricted experimentally; the sealing of the coding ends in V(D)J joining might involve any one (or more) of the following: (1) a limited exonucleolytic removal of residues starting from the
59
V(D)J JOINING
A
B
C
D
I I I 7
6 exonuclease
7- 7 ‘
4
endonuclease
ligation
4
* * ligation
!,
ligation
trimming
~
4
5
ligation
ligation
FIG.6. Possible modes of base loss during V(D)J joining. (A) A single-strand-specific exonuclease acts prior to ligation; (B) a tlouhle-strand-specific endonuclease acts prior to ligation; (C) a “Hap-ase” exo- or endo-nucleolytically removes tails before ligation; (D) a “Hap-ase” acts after ligation.
terminus, (2) an endonucleolytic break introduced near the terminus, ( 3 )loss following a postulated alignment step that puts the coding ends in register before joining, or (4)base loss occurring as a consequence of endonucleolytic or exonucleolytic removal of “tails,” and/ or mismatch correction following ligation of two offour strands (Figs. 6A-6D). The extent of base loss on V(D)J joining at various loci, at various stages of ontogeny, and within various species has been assessed in the course of a number of studies of naturally occurring junctions. Though complicated by differences in experimental detail, broad comparisons between studies fairly consistently fail to reveal any suggestive correlations (such as were so useful in understanding N addition). Some studies found that base loss was more evident in postnatal or adult samples than in those isolated from fetal lymphoid tissue (La1989; Bangs et d., 1991; McVay et al., 1991; Schwager et faille et d , nl., 1991; Carlsson et al., 1992; Medina and Teale, 1993). However, others have not (Meek et al., 1989; Feeney, l99la; Ikuta and Weissman, 1991; Engler et al., 1992; Raaphorst et nl., 1992). As an example, DJ junctions derived from the IgH locus were isolated from spleens of mice ofvarious ages (Meek, 1990).Populations of DspZto J 1junctions
60
SUSANNA M . LEWIS
were amplified by PCR and tested for the presence of a naturally occurring Rsa 1 restriction site located at a position seven residues inward from the 5‘ end of the J 1 gene segment. The ratio of uncut to cut junctions was quantified and did not vary between fetal and adult samples (Meek, 1990). In contrast a seemingly significant difference in truncation is associated with the primary sequence of a coding end. In a study with plasmid substrates, an almost 10-fold end-specific difference in trimming was found (Meier and Lewis, 1993).There was no parallel variation in overall recombination frequency or in the acquisition of N regions or P nucleotides, nor was there any obvious relationship between truncation and the opportunity for homologous interactions with the “partner” coding end (Meier and Lewis, 1993; and J. T. Meier and S. M. Lewis, unpublished). In a second study, reduced deletion for certain homopolymer coding ends was also observed (Boubnov et al., 1993). Such evidence suggests that some truncation is not based on end-to-end interactions, providing indirect support, at least for the original suggestion that trimming can precede ligation (Figs. 6A and 6B, Alt and Baltimore, 1982). Thus we might look for several different types of endo- or exonuclease to play a role in V(D)J joining. If a nuclease acts prior to strand joining, we might expect it to have some sequence preference (based on the observations described above). If a single entity only is the predominant cause of base loss in V(D)J junctions, then we should anticipate two additional features: (1)it will only cause a limited base removal and (2) its levels should be fairly constant through development. One might alternatively seek a “flap-ase” such as could trim the dangling ends after ligation as shown in Figs. 6C and 6D. Candidate activities are discussed below (section VI).
D. HOMOLOGY An number of studies indicated that within “real” coding joints, the two coding ends may be preferentially connected at positions of homology (Ichihara et al., 1989; Feeney, 1990, 1991b, 199213; Gu et al., 1990, 1991; Manser, 1990; Meek, 1990; Chang et al., 1992). For example, the origin of repeat, “canonical” junctions in some subpopulations of$ T cells, was suggested to reflect a mechanistic predilection for joining within homologies (reviewed in Raulet, 1989),although it is also the case that apparently homology-driven junctional biases are due to cellular selection in other systems (Pandey et al., 1993). The notion that the presence of short one-, two-, or three-base homologies might be of consequence in V(D)J joining (Alt and Baltimore,
V(D)J JOINING
61
1982) has only recently been explored experimentally (Boubnov et
al., 1993; Gerstein and Lieber, 1993b). Plasmid substrates were tested
in a nonselective context, and it could be demonstrated that the presence of homology influenced the recombination process without absolutely constraining the outcome or affecting the overall efficiency (Boubnov et al., 1993; Gerstein and Lieber, l993b). It was also found that the presence of TdT in the cell reduced the representation of homology junctions among isolated recombinants (Gerstein and Lieber, 1993b). Both of these observations indicated that the presence of an homologous (even one-base) region at the two tips of the joined coding ends was not required, a conclusion born out with the TdT knockout experiments (see discussion in Komori et al., 1993). The significance of homology-guided rearrangement in shaping the in .r;ioct repertoire was demonstrated with transgenic substrates which contained TCRy-derived V and J gene segments. These gene segments were identical to their endogenous counterparts except that they contained mutations that prevented expression at the protein level. By far, the major classes ofjunctions in these experiments were those with short homologous overlaps between the joined ends. These junctions corresponded to the canonical sequence observed among epithelialassociated y6 T cells in uioo, but because the joined products were not functional, it was clear that the biased representation was not due to a positive selection for particular receptor specificities (Asarnow et ul., 1993). The same conclusion was reached on the basis of experiments in which the C6 exon was disrupted by gene targeting (Itohara et al., 1993). Directed recombination, to give canonical junctions, appears to be observed at a much greater frequency in the fetal and neonatal repertoires (Lafaille et al., 1989) where two features of the joining mechanism contribute to the effect. One is the homology-guided nature of V(D)J joining (in combination with the sequences that exist at the termini of the joined elements), and the other is the developmentally regulated expression of TdT (reviewed in Feeney 1992a). Somehow TdT expression reduces the homology bias, although the mechanism of this interference is obscure (Feeney, 1992b; Gerstein and Lieber, 1993b; Gilfillan et al., 1993). Curiously, the homology bias is eliminated even among the “N-less” junctions that have been generated in a TdT-positive context (Feeney, 1992b; Gerstein and Lieber, l993b; Gilfillan et al., 1993). This raises the possibility that TdT can block the homology-based interactions of ends, even in the absence of end modification (Gilfillan et al., 1993).Alternatively, the effect is competitive such that the same subfraction of coding termini is a substrate for
62
SUSANNA M. LEWIS
either alignment or TdT modification (Feeney, 1992b; Gilfillan et al., 1993).Although the TdT effect on the frequency of homology junctions might appear to be a minor detail, the inverse relationship between the appearance of canonical junctions (and a generally restricted repertoire for antigen binding) and TdT in development suggests important physiological consequences. Moreover, this sort of detail is very relevant to the still poorly understood steps in V(D)J recombination that occur between cutting and joining. As with truncation, the homology effects in V(D)J joining have been seen before in the recircularization of linear DNA molecules transfected into CV1 cells (Roth and Wilson, 1986).A number of years ago, it was suggested that the joining of cut ends in mammalian somatic cells was facilitated by limited sequence homologies (Wilson et at., 1982). The notion was addressed experimentally in subsequent studies, which suggested that both homology-dependent and homologyindependent processes are materially involved in end joining (Roth et al., 1985; Roth and Wilson, 1986). Alignment factors that appose broken DNA ends and can stabilize feeble 1-bp interactions have been postulated according to the results of in uitro end-joining studies with Xenopus egg extracts (Pfeiffer and Vielmetter, 1988; Thode et al., 1990; Pfeiffer et al., 1994).A role for such factors in V(D)Jjoining has been proposed (Gu et al., 1990). E. OTHER STRUCTURAL FEATURES (OLIGONUCLEOTIDE CAPTURE) Other patterns have been noted in coding junctions. Because these other patterns are either rare or much less specific than the features covered in the above discussion, most will probably prove difficult to establish experimentally. One possibility is that a palindromic pattern of residues might occur adjacent to truncated, as well as nontruncated, ends (Aguilar and Belmont, 1991; Engler et al., 1992).A second suggestion was prompted by an odd frog junction that contained 16 bases of sequence constituting an inverted repeat of the sequence starting 1 base in from the tip of the adjacent JH segment. This example raised the possibility of limited replication during V(D)J joining (Schwager et al., 1991). The above-mentioned inserts, while long enough to look quite different from P or N insertions, are rare, and it is difficult to guess whether they represent exceptional events or instead expose some feature that is typical of a V(D)J joining reaction. A third suggestion was based on the observation that inserts within certain junctions contain DNA segments related by sequence to the two joined ends, but not in the fashion of a P nucleotide insertion. This suggested that an oligonucleotide capture mechanism as described for
V(D)J JOINING
63
end joining (Roth et al., 1991) might be relevant to V(D)J recombination (Lieber, 1992). Experimental tests of oligonucleotide capture, in the case of end joining, indicated that it was infrequent and could only be observed at high injection ratios of oligonucleotide-to-vector DNA end. Capture required that the termini of the captured doublestranded oligonucleotide bear fully compleinentary “cohesive” ends relative to the target DNA. This led the authors to question the relevance of (short) oligonucleotide capture to the generation of “filler” DNA in nonlymphoid systems (Roth et al., 1991). No comparable test of oligonucleotide capture during V(D)J joining has yet been carried out. Although according to one survey of endogenous V(D)J junctions it was suggested that perhaps 2% contain insertions ofgreater than four residues that might have arisen by oligonucleotide capture (Carroll et al., 1993b), it is telling that among over 550 junctions generated in genetically TdT-negative cells, not a single such four-residue possibility was reported (Komori et al., 1993; Gilfillan et al., 1993).
F. GERMLINE JOINING: V(D)J RECOMBINATION LONGAGO AND FARAWAY The Ig and TCR loci, as they exist in the germlines of all vertebrates, bear the imprint of the V(D)J recombination machinery (Kokubu et al., 1988; Lewis et al., 1988). Extensive germline joining most obviously has occurred in the Ig genes of cartilaginous fish (reviewed in Litman et al., 1992). In these species, some copies of the iterated Ig gene clusters (see section III,A, above) are either partially or fully assembled (Kokubu et al., 1988; Hohman et al., 1992; Litman et al., 1993).Complete VDDJ assemblies as well as VDD ...J or VD..DJ structures are found among IgH clusters, and there is also an example of a germline hybrid joint (Kokubu et al., 1988). Extensive germline joining of light chain gene clusters is also observed (Rast et al., 1994). Joined genes may encode functional proteins; it does not appear, however, that joining in the germline is ongoing (Litman et al., 1993; G. Litman personal communication). The sequence conservation between joined and unjoined gene segments is high enough to provide a reasonably good impression of precursor/product relationships. For example, based on existing homologies between the joined genes in Heterodontus francisci (horned shark) and those in an animal of a different elasmobranch order, Raja erinacea (little skate), the V(D)J joining perserved in the genomes of these species probably took place over 200 million years ago (Harding et al., 1990). Judging from the structures of such recombinants, very little of the essential nature of the recombination machinery has
64
SUSANNA M . LEWIS
changed in the ensuing eons. A comparison of the V and D elements in germline-joined genes to either unjoined elements or to a hypothetical consensus is consistent with base loss and addition. In one germlinejoined gene (designated “F101”) the putative inserts at the VD junction (in which these two elements apparently joined without base loss) were consistent with P nucleotide addition; in others cases, base loss and possible N insertion may be seen (Kokubu et al., 1988). To summarize, the fine-structural features of V(D)J recombination products appear to be constant across phyla and through much of the evolutionary history of vertebrates. Despite the variability of V(D)J joining products, this variability follows a pattern: only a few residues are usually lost, only a few are gained, and homology is sometimes used. Some activities that may be responsible for these features are discussed in the following section. VI. Agents of Joining
A few cracks of light are beginning to penetrate what has been described by more than one author as a “black box.” The search for a single “recombinase” has been deflected by an increased appreciation that V(D)J joining may well be carried out b y a collection of loosely related activities. Factors such as RAG-1 and RAG-2, if indeed they serve a catalytic function, may be essential and reaction-specific. Others such as TdT are not essential, but still apparently reaction-specific, and there is the likely possibility that still other components of the recombination machinery are essential for V(D)Jjoining, while at the same time being more generally involved in DNA repair in the cell. A. V(D)JJOINING FACTORS DEFINED BY MOLECULAR GENETICS
1. RAG-I and RAG-2 With a molecular genetic approach, two essential, lymphoid cellspecific, genes called RAG-1 and RAG-2 (for “recombinationactivating gene”) have been identified (Schatz and Baltimore, 1988; Schatz et al., 1989; Oettinger et ul., 1990). A fibroblastoid cell with an integrated recombination substrate was selected for its ability to rearrange (thereby activating a drug-resistance gene) upon transfection of genomic DNA. With recombination as the assay, two linked genes were isolated, which together could potentiate authentic V( D)J joining when introduced by transfection into other nonlymphoid cells (Schatz et ul., 1989; Oettinger et al., 1992). Consistent with a function as a developmentally regulated recombination factor, RAG-1 and -2 are
V(D)J J O I N I N G
65
coexpressed only within tissues and cell lines undergoing active V(D)J recombination (Schatz et al., 1989; Oettinger et al., 1990; Boehm et al., 1991; Turka et al., 1991; Guy-Grand et al., 1992).Although discordant expression of RAG-1 and RAG-2 is observed in some contexts [and for example may occur in a transitional cell type during differentiation (Campbell and Hashimoto, 1993)], there are no examples to date of a recombination-proficient cell that completely lacks expression of one or the other (Oettinger et al., 1990, 1992). Circumstantial evidence all points toward the likelihood that the onset and shut-down of V(D)J rearrangement during lymphoid cell differentiation is accomplished primarily through regulation of the RAGs. RAG mRNA levels drop upon crosslinking antigen receptors in immature T and B cells (Turka et al., 1991; Maet al., 1992).Although the nature of the crosslinking is not fully understood, in the case of T cells, RAG shut-down appears to coincide with positive selection (Brandle et al., 1991; Borgulya et al., 1992; Campbell and Hashimoto, 1993). Recombination appears to cease at a point where cells have begun to be chosen on the basis of their specific interaction with the thymic environment and thus when further alterations in their receptor genes would be detrimental. It has not yet been proven whether the RAGs are part ofthe recombination machinery itself or regulatory in function, although the oddson favorite is the first of these possibilities. Both RAG genes have been knocked out in mice and, in either case, the mutation had specific effects on V(D)J joining only (Mombaerts et ul., 1992b; Shinkai et al., 1992). No defects in any nonlyniphoid tissue were uncovered, and the expression of early lymphoid lineage-specific genes appeared norinal. In tissue culture cells the RAGs’ expression can be manipulated while recombination activity is measured in parallel, and such experiments have revealed a close correspondence (Menetski and Gellert, 1990; Oettinger et al., 1990; Oltz et ul., 1993). Introduction of RAG-1 and RAG-2 fails to cause a recipient fibroblastoid cell to rearrange its endogenous genes or to acquire other markers of early lymphoid differentiation (Schatz et ul., 1989). All told, these observations indicate that either KAG-1 and RAG-2 very specifically and directly regulate the “V( D)J recombinase” or they themselves participate in the recombination reaction. Despite the f k t that the two genes were isolated almost 4 years ago, no sequence-specific DNA binding or cleavage activity has been established for the product of either one. Nor do RAG-1 and RAG-2 proteins appear to associate with one another (Oettinger et al., 1992).
66
SUSANNA M . LEWIS
Neither RAG-1 nor RAG-2 has any significant homologies to other known proteins (Schatz et at., 1989;Oettinger et al., 1990). However, in RAG-1, three sequence motifs have been noted: a nuclear localization signal, a zinc finger-like “Cys-His” motif, and a region with a resemblance to the active sites oftopoisomerases (Schatz et al., 1989; Wang et al., 1990; Freemont et al., 1991). Mutational analyses have investigated how critical each region might be to RAG-1 function. A double-mutant in the nuclear localization signal was indistinguishable from wild type in potentiating recombination of a plasmid substrate in fibroblastoid cells (Silver et aZ., 1993). The Cys-His motif could be altered by point mutation or even deleted entirely, without abolishing recombination. A tyrosine residue at position 998 (of the 1041-residue protein) that had been suggested to relate to the active site tyrosine of type I and I1 topoisomerases (Wang et aZ., 1990) was changed to phenylalanine with little or no effect (Kallenbach et at., 1993; Silver et al., 1993). Recombination was undetected (two orders of magnitude below wild type) with a deletion of4 amino acids from positions 995 to 998 (Kallenbach et al., 1993) as with a deletion from residues 994 to the end (Silver et ul., 1993). Other deletions that took out, for example, the 32 amino acids from residue 1009 to the carboxy terminus, created proteins that exhibited enhanced recombination relative to wild type. Thus these analyses suggest that essential regions for activity reside near the carboxy portion of the RAG-1 protein and are not coincident with the Cys-His motif (which had suggested a transcription factor regulatory-type role; Silver et at., 1993). Despite the radical effects of surgery at residues 995 to 998, it is not clear whether a conformational change is responsible or a functional group on one of the deleted amino acids performs some active catalytic role (Kallenbach et at., 1993). Unfortunately, the cellular localization and protein levels of the carboxy terminal mutants have yet to be defined, due to a lack of useful antibody reagents for these analyses (Silver et a,?., 1993). Clues to RAG-2 function have been equally hard to come by. An acidic region was about the only notable feature of its amino acid sequence (Oettinger et al., 1990), and it was found that most of this could be deleted without effect (Silver et al., 1993). Other regions with weak similarities to a CAMP protein kinase site, a tRNA ligase, and a methylase were noted and mutated, but none had significant effects in the recombination assay (Silver et al., 1993). Two major in vivo phosphorylation sites have been defined, and mutation of one of these sites Ser356affected the activation of V(D)J recombination by RAG-2, without affecting its nuclear localization or steady-state levels
V(D)J JOINING
67
(Lin and Desiderio, 1993). Analysis of the second major site is still in progress. Additionally, the protein kinase ~ 3 4 ' ~ could ' ~ phosphorylate bacterially expressed RAG-2 in oitro. Substitution mutation of the most prominent site, Thr"'), prolonged the half-life of RAG-2 in uiuo, as well as that of chimeric proteins created by fusion of the relevant portion ofRAG-2 to several other genes. It was suggested thatphosphorylation of RAG-2 at the site targeted by ~ 3 4 marked ' ~ ~ the ~ protein for rapid degradation and that this might be essential in coordinating the activity of RAG-2 with other potentially cell-cycle-regulated components of the joining machinery (see Lin and Desiderio, 1993, for a more complete discussion, and Schlissel et al., 1993). As suggested by the analysis ofthe detected in uioo phosphorylations of the RAG-2 protein (Lin and Desiderio, 1993), some necessary posttranslational modification(s)may be lacking in the heterologous expression systems used to generate RAG proteins in most studies. It may be that a shift to an homologous expression system will reveal previously undetected RAG protein interactions, with one another and/or a DNA substrate. While such evidence has been slow in coming, there is still reason to anticipate a future demonstration of an enzymatic function for one or both RAG products. A function for RAG-2, independent of RAG-1, in gene conversion was suggested by its expression pattern in the chicken bursa during ontogeny (Carlson et ul., 1991). RAG-2 is expressed at far higher levels than RAG-1 at a time in B cell development when precursors are essentially finished with Ig gene recombination and have entered into a stage of active gene conversion (Carlson et al., 1991; Reynaud et al., 1992). However, upon deletion of both homologous copies of RAG-2 from a bursal-derived, transformed, B cell line, it was found that the mutated cell was still capable ofgene conversion (Carlson et at., 1991; Takeda et al., 1992). The experiment has since been repeated for a second cell line, with the additional finding that the frequency of homologous recombination is also not affected by the presence or absence of RAG-2 (E. Masteller and C. B. Thompson, personal communication). It remains a puzzle why RAG-2 should continue to be expressed so long after gene rearrangement ceases in the bursa. As mentioned above, in most other contexts, RAG-1 and RAG-2 are suddenly and coordinately downregulated. V( D)J recombination is well over by late embryogenesis in the chicken, and little RAG-1 expression is observed thereafter. RAG-2 expression, on the other hand, is maintained up to 14 weeks posthatching (Carlson et al., 1991). One gets a sense that there is something interesting still to emerge from these observations.
68
SUSANNA M . LEWIS
2. TdT The enzymatic role of TdT in creating the junctional insertions has been touched on in the previous section on N regions (Section V,B). Some additional studies pertaining directly to TdT itself are mentioned here. In mice, two forms of TdT have been identified, each templated by an alternatively spliced precursor RNA. Each has been shown to introduce N regions into V(D)Jjunctions (Landau et al., 1987; Kallenbach et al., 1992; Doyen et al., 1993). TdT is found only in primary lymphoid organs, more specifically, in cortical (immature) thymocytes and in bone marrow cells (Bogue et al., 1992, and references therein). During thymocyte differentiation, TdT expression tracks RAG-1 expression closely, both genes being turned on in immature cells and off in mature cells (Bogue et al., 1992). For these reasons, TdT is considered part of the V(D)J joining machinery, despite the fact that the gene knock-out experiments unambiguously established the optional nature of its participation (Gilfillan et al., 1993; Komori et al., 1993). There is no evidence that TdT exists for any other reason than to diversify V(D)J junctions. The fact that N regions are found in V(D)J junctions of vertebrates representing major evolutionary branch points (Litnian et al., 1993) speaks for the importance of this activity. It remains speculation whether TdT was imported into the vertebrate genome as part of the recombination machinery at the outset, but the preservation of the association throughout vertebrate evolution suggests that, in any case, this association has been very successful. An interesting question is whether TdT and other components of the joining apparatus are physically complexed. TdT itself appears to be associated with the nuclear matrix (Pandey et al., 1989; Di Primio et al., 1991), and by focusing on TdT, it may be possible in the future learn more about the ultrastructural relationships between the V(D)J joining machinery and the organizing elements in the nucleus. A developmental modulation of N insertion is observed in many different species (references cited in section V,B, above). The TdT story constitutes the clearest illustration that an important, tissuespecific component of the V(D)J joining machinery is nevertheless routinely separated from it during ontogeny. Genetically engineered mice lacking N regions are not overtly compromised, the main effect noted to date is that the junctional repertoire in an adult TdT-less mouse resembles that of a neonatal animal (absent N regions and overrepresented canonical junctions; Komori et al., 1989; Gilfillan et ul., 1993). The complement to the gene knock-out approach would be
V(D)J JOINING
69
a “stuff-in” experiment, where the importance of the absence of TdT early in ontogeny might be assessed by creating constitutively TdTpositive animals. It may be significant that attempts to conduct such experiments have only met with partial success: although a human TdT gene has been introduced into the murine germline, the levels of protein are extremely low. One possibility is that a more robust expression is lethal (H. W. Schroeder, personal communication).
B. BIOCHEMICALLY DEFINED The target sites for V(D)J joining were defined almost 15 years ago; easily cultivated cells with ongoing V( D)J joining activity have been available for a decade; and two essential genes in the recombination process (RAG-1 and RAG-2) have been cloned. Still, at the time of this writing, there has been no successful in vitro reconstitution of V(D)Jjoining. Even more modest goals, such as the isolation of activities that specifically bind, cut, or ligate V( D)J joining signals, have been difficult to reach. The state of the effort is summarized below.
1 . Factors That Bind Joining Signals Of the three activities a V(D)J joining candidate might possess (the ability to specifically bind, cut, or ligate a joining signal), the greatest effort has been made in attempting to identify factors that might recognize joining signal D N A in a sequence-specific fashion. The development of techniques such as the electrophoretic “mobility shift” assay and the ability to directly screen cDNA expression libraries for clones encoding DNA-binding proteins (Singh et al., 1988) both have contributed to the popularity of the binding quest. A number of candidate factors have been described, and progress in their analysis has been reasonably brisk. In most cases, it is fair to say that the DNA-binding activities have not proved to have features that unambiguously identify them with the V(D)Jjoining operation. In general, expectations were that a good candidate would (1)hind D N A containing a joining signal better than D N A lacking the same, (2)bind less avidly to noncanonical variants that have been shown to be defective targets in V(D)J recombination assays, ( 3 )be present in both early B and T cells, but perhaps not elsewhere, and (4)(hopefully) possess cutting and/or joining activity. About 10 different signal-binding proteins have been described. One of the first to be reported was called “nonamer-binding protein” (NBP; Halligan and Desiderio, 1987; Li et al., 1989). This protein was identified on the basis of its ability to stably complex with DNA fragments containing a 23-spacer signal and was present in lymphoid, but not nonlymphoid, nuclear extracts (Halligan and Desiderio, 1987).
70
SUSANNA M . LEWIS
Further purification and characterization demonstrated that NBP, a 53-kDa protein, was very specific for the canonical nonamer sequence, but did not possess any nucleolytic activity. Another protein identified upon binding a 12-spacer signal DNA was found to interact most specifically with the heptamer, again with an encouraging tissue distribution (Aguilera et al., 1987). No enzymatic activity has been reported subsequently. A third protein was isolated as a cDNA by screening a Xgtll murine pre-B cell library with a 12-spacer signal probe (Shirakata et al., 1991). The clone, T-160 was specific for 12-spacer signals and failed to bind a sequence with a base change in the third position of the heptamer. DNA binding by the 86-kDa T-160 protein could only be detected with Southwestern blot analysis; the in uitro-translated material could not be demonstrated to bind DNA according to electrophoretic mobility shifts or DNA footprint analysis. Its tissue distribution was not reported. The role of the T-160 protein in V(D)J joining is now in question principally because the human homologue was isolated by screening a mature B cell cDNA library with a platinated (non-joining-signal) DNA probe and, moreover, found to be ubiquitously expressed (Bruhn et ul., 1992). A fourth zinc finger protein called “Rc” was also isolated from a Agtll library, constructed from thymocyte RNA, which had been screened with a probe containing both 12- and 23-spacer signals. Rc was found to bind an isolated heptamer only, as well as an unrelated sequence motif. No tissue distribution was reported (Wu et al., 1993). A fifth protein was purified from an A-MuLV extract on the basis of its ability to bind a 23-signal DNA probe (Hamaguchi et al., 1989). This 60-kDa species (named recombination signal binding protein or “RBP-Jk”) was purified 17,000-fold and found to protect the heptamer of the joining signal in DNase 1footprinting studies. Like T-160, RBP-Jk could discriminate between a canonical joining signal and a DNA sequence that contained a mutation in the heptamer (Hamaguchi et al., 1989). The gene for the RBPJk protein was cloned after a partial amino acid sequence was obtained, and RBP-Jk was found to contain a 40-residue region with similarity to the integrase family of site-specific recombinases (Matsunami et al., 1989).However, one of the three putative integrase active-site residues was missing from the region of similarity, as was a subsequently identified motif that has been implicated in enzymatic function (Abremski and Hoess, 1992). The tissue distribution of RBP-Jk was a surprise: it was initially thought to be limited to lymphoid cells but later studies indicated that the protein was uniquitous in mice and that a homologue was present in Drosophila (Furokawa et al., 1992; Hamaguchi et al., 1992). No enzymatic function apart from binding was consistently
V(D)J JOINING
71
observed, although RBP-Jk isolated from A-MuLV extracts copurified with ligation activity (Hamaguchi et al., 1992). A sixth protein or proteins was identified by electrophoretically fractionating early T and B cell extracts and probing with joining signal DNA after transfer to nitrocellulose. A 115 kDa species was identified that was only present in low amounts in mature lymphoid and nonlymphoid cell lines. Probes where there were base changes in either the heptamer or the nonamer regions of the signal showed reduced binding. The factor or factors appeared to be able to bind both 12- and 23-spacer signals (Miyake et al., 1990); however, no further studies beyond this limited characterization were reported. A sequence- and tissue-specific DNA/protein complex has been visualized by electron microscopy, but binding could not be demonstrated with the electrophoretic mobility shift assay (Kottman et al., 1992). The most recent and most promising candidate among the proteins identified on the basis of binding was found in murine thymocytes (Muegge et al., 1993b). Two features distinguish this work. One was that the distribution correlated well with recombination activity: it was present in cell lines that had tested positive for V(D)J joining, and could be visualized in thymus extracts following a postirradiation reconstitution with embryonic precursor cells. Another was that a fairly extensive range of oligonucleotide joining signal variants were tested in the mobility shift assay for binding to “recognition protein” (or RP). Functional joining signal variants were bound but nonfunctional variants, with, for example, a heptamer mutation or a change in spacer length, were not (Muegge et al., 199313). According to its size, 30 kDa, the protein appears to be distinct from previously described binding factors. This small size also tends to argue against its identity as one of the RAG gene products. Thus to date, RP is the only factor to pass all three tests suggested above: it has specificity for joining signals (and this is the only candidate so far that has the property of binding both heptamer and nonanier sequences in 12- and 23-spacer targets); it binds nonfunctional joining signals poorly, but at the same time is insensitive to changes that do not affect V(D)J recombination; and it appears to be confined to cells and tissues that exhibit recombination activity (Muegge et al., 1993b).
2 . Cutting Given the expectation that a distinctive feature of the V(D)J joining machinery ought to be its ability to introduce cuts at the signal border, it was no surprise that, early on, several groups undertook to detect a site-specific nuclease activity in lymphoid cell extracts. None of the
72
SUSANNA M. LEWIS
examples, however, could be shown to be stringently site-specific and little has been reported beyond the initial characterizations (Desiderio and Baltimore, 1984; Kataoka et al., 1984; Hope et al., 1986). There are two reasons why cutting activities might bear some renewed attention. One is that the analysis of broken molecules in thymus DNA has refined predictions for the putative cleaving activity. We might now anticipate a site-specific generation of hairpin coding ends and blunt signal ends; the latter with 5’ phosphoryl groups (Roth et d., 1992a,b, 1993; Schlissel et al., 1993). A second is that, potentially, a cutting function may be both the beginning and the end of the story in terms of any tissue-specific component(s) of the V(D)J joining machinery.
3. Ligation Functions Zfjoining is due to the lymphoid-cell-specific V(D)J joining machinery (rather than to a nonspecific ligase), then predicted properties would perhaps include a relevant tissue distribution and a joining signal dependence. Whether a ligation function ought to be expected to create coding joints and signal joints before a potential involvement in V(D)J joining is considered is debatable. Some would argue that any joining signal-dependent ligation function is worth a second look. An interesting activity was associated with a clone that was initially isolated on the basis of its nonamer-binding properties. The clone, called “V(D)J joining protein” or VDJP has a predicted molecular mass of 47 kDa, and a data base search revealed a domain with amino acid sequence similarity to bacterial (but not yeast or vertebrate) ligases (Halligan et d., 1994). The region of similarity did not coincide with the known active site for ligase, but was provocative enough to encourage further analysis. A joining signal-dependent ligation activity was found to be associated with a bacterially expressed fragment of the VDJP clone. Ligation could only be observed for fragments that contained a joining signal, and ligation between two fragments was abolished or greatly reduced on deletion of the heptamer from either molecule. The joining signal-dependent ligation function was observed in a recombination-positive A-MuLV-transformed cell line and in other pre-B cell lines, but was not observed in fibroblasts (Halligan et al., 1994). It is not yet clear, however, in what way this function may be involved in V(D)J joining. Despite the joining signal dependence, the products do not particularly resemble signal junctions. One piece of information relevant to the possible importance of VUJP is that tests of V(D)J joining in a human ligase l-negative cell showed it to be normal. This indicates that DNA ligase 1, which is implicated in the sealing of Okazaki fragments during DNA replication
V(D)J JOINING
73
(reviewed in Lindahl and Barnes, 1992) is probably not responsible for creating V(D)J junctions (Hsieh et al., 1993; Petrini et al., 1994). Two other maminalian ligases are known to exist (Lindahl and Barnes, 1992) which have not been similarly tested, nevertheless the idea that ligation is performed b y a V(D)J joining-specific function is quite tenable. C. GENETICALLY DEFINED 1 . Severe Combined Zmmunodeficiency (SCZD) In the defective immune systems of scid mice precursor T and B cells are largely unable to complete differentiation (for reviews see Bosma and Carroll, 1991; Bosma, 1992). Scid T and B cells that, phenotypically, correspond to lymphocytes at the onset of Ig and TCR gene rearrangement are easily demonstrated, but those in later stages of differentiation are deleted (Carroll and Bosma, 1991; Osmond et al., 1992; Hothenberg et al., 1993). The possibility that the mutation directly affects the V(D)J joining process itself was first indicated by the observation that spontaneous thymomas, A-MuLV transformants, and long-term bone marrow cultures derived from scid mice had unusually extensive deletions at their antigen receptor loci, reaching both 5’ and 3’ of the normal V(D)J recombination sites (Schuler et al., 1986; Hirayoshi et al., 1987; Witte et al., 1987; Kim et al., 1988; Malynn et al., 1988; Okazaki et al., 1988). Although junctions derived from untransformed scid lymphocytes looked less aberrant in some cases, a defective ability to carry out V(D)J joining was still suggested. Measurement of the frequency of “wild-type” rearrangement in scid lymphocytes has been estimated in a number of studies and was found to occur somewhere between to for VK-to-JK joining (Hendrickson et a/., 1990; Reichman-Fried et al., 1993), at l o - ’ to lo-’ for Vyto-Jy or DH-to-Jt,(Schuler et nl., 1990; Bosma, 1992; Carroll et al., 1993a; Pennycook et al., 1993), and at near wild-type levels for D6to-JS assembly (Carroll and Bosma, 1991; Carroll et al., 1993a; and A. Carroll, personal communication). Because the scid defect effectively blocks differentiation at a point soon after the V(D)J joining program is initiated (Carroll and Bosma, l991), some of these numbers may well reflect differences in cell survival as the program progresses. In cases where D-to-J joining was observed, recombination was limited; both the rearrangement of V gene segments to the UJ structure and the rearrangement of the companion locus needed to template the complete antigen receptor were extremely infrequent (Carroll et al., 1989b, 1993a; Carroll and Bosma 1991; Kotloffet al., 1993a; Pennycook et al., 1993).
74
SUSANNA M . LEWIS
It has been shown that the scid defect also manifests itself as a DNA repair deficiency in nonlymphoid cells (Fulop and Phillips, 1990).A growing literature on the subject consistently points toward an abnormality in sealing double-strand breaks, in particular as it takes place via an end-joining pathway. First, scid cells show a marked sensitivity to DNA-damaging agents that create double-strand breaks, but are no more sensitive than wild-type cells to treatments that create other types of lesions (Biedermann et al., 1991; Hendrickson et al., 19Ylb; Taniguchi et al., 1993).Second, an unusually high frequency ofchromatid exchanges is found following y-irradiation of scid cells (Disney et al., 1992). Ionizing radiation has been demonstrated to induce interallelic homologous recombination (Benjamin and Little, 1992), thus an increased frequency of exchanges in scid could be interpreted to indicate that such an homologous recombination (as opposed to endjoining) pathway is still available to repair DNA damage in these mice. Third, scid cells are more sensitive than wild type to the cytotoxic effects of restriction enzymes when introduced by electroporation (Chang et al., 1993). Finally, a break-repair defect is suggested by one study in which an 11- to 75-fold reduction in the ability of scid cells to stably integrate transfected foreign DNA was observed (Harrington et al., 1992). One interpretation of the above is that some function involved in double-strand break repair is also involved in V(D)J joining (Fulop and Phillips, 1990).A potential relationship between end-joining and V(D)J recombination was perhaps most handily demonstrated by the observation of site-specifically broken hairpin DNA in scid thymocyte DNA (Roth et al., 1992a). An aspect of these experiments that has not been emphasized here is that only in thymocyte DNA from scid mice was it possible to detect coding ends with covalently closed termini. This prompted the suggestion that one step in common between double-strand break repair and V( D)J joining might be that both processes require the cell to be competent in the resolution of a hairpin DNA structure and that it was this resolution of hairpin ends that was specifically defective in scid (Roth et al., 1992a). Defective hairpin DNA metabolism might also explain the somewhat longer P nucleotide insertion observed in endogenous scid junctions (Schuler et al., 1991; Kienker et al., 1991b; Fish and Bosma, 1994; Kotloff et al., 1993b). A test of the hairpin-resolving ability in scid vs wild-type cells failed to show any differences (Lewis, 1994). An A-MuLV-transformed cell line that had been characterized extensively and was representative in terms of its phenotype according to the extrachromosomal V( D)J joining assay was used in the analysis (Lieber et al., 1988b). Hairpin-
ended, linearized, plasmid D N A was recircularized equally well in both scid and wild-type cells. Both scid and normal cells created junctions in which P nucleotides (of similar lengths) were observed, verifying that the joining reaction had involved specific metabolism of the hairpin structure in each case (Lewis, 1994). This study, along with earlier experiments in which linear molecules with a variety of different terminal structures were tested (Lieber et al., l988b; Harrington et nl., 1992; Chang et al., 1993; Lewis, 1994), indicated that none of the enzymatic operations involved i n end-joining appeared to be missing from scid mice. (A summary ofthe DNA-joining defect in scid is presented in Table 11.) The summary presented in Table I1 highlights a central discrepancy in the scid phenotype as it relates to DNA metabolism. The extrachromosonial assay does not reflect the relative success rate of DNA joining as measured in the chromosomal context. Defects appear to be either more or less extreme with the plasmid assay. Because the results are so consistently discrepant, the extrachromosomal/chromosomal difference might itself constitute a useful clue. Two types of defect, not directly involved with catalysis, might be imagined to manifest differently in the chromosomal and extrachromosomal assays. One might be a required “anchoring” function, missing in scid (Lewis, 1994), another, a necessary cell-cycle coordination (Lin and Desiderio, 1993; Schlissel et al., 1993) is disrupted in the mutant strain. I n the latter case, although it is not easy to project the effects of‘ unsynchronized end joining in either the chromosomal or the extrachromosomal contexts, there is precedent for a discrepancy. The repair defect in Ataxia telangiectasia (AT) is thought to result from a failure to postpone replication following D N A damage (Meyn, 1993,and cited therein; reviewed in Murray, 1992). In A T fibroblasts, high spontaneous recombination rates are only measured with chromosomal, not extrachromosomal, substrates (Meyn, 1993). The possibility that scid involves a structural element that functions to hold broken DNA ends also might be entertained. If so, the context in which end joining is measured becomes very important, because the events that might occur via randoni collision (in a recircularization assay, for example) may or may not require the same anchoring function necessary to seal a chromosomal break. In short, the DNA-joining phenotype in scid may appear inconsistent and complex only because the present understanding of whether a particular joining event is “facilitated” or not is incomplete. While it is too early to know whether every detail of the scid phenotype can be rationalized on the basis of either an anchoring defect or a fiailure in cell-cycle coordination, the
TABLE I1 THE SCID (DNA-JOINING) PHENOTYPE ~
~~
Effects on V(D)J Joining Endogenous sequencesa
Quantitative effects: Estimates for the
frequency of “normal junctions” range from 10-‘ to I . Qualitative effects: Deletions at IgH, Igrc, TCRP, TCRy loci in transformed or cells in extended culture, less evident
Effects on Nonspecific End Joining Quanitative and qualitative effects:
Defective repair of DNA broken by Xray (and mimetic agents); cytogenetic evidence of increased rearrangement; defective repair of breaks induced by electroporation of restriction enzymes.
in nontransformed cells; normal junctions at TCRG, IgH (DJ) or at TCRy (VJ) have been detected; long P inserts in some collections, not others; increase in hybrid joint frequency (TCRG); apparent accumulation of hairpin coding ends in thymus DNA samples (TCRG); increase in hybrid joint frequency. Introduced sequences, integrated”
Quantitative effects: Fewer recombinants
(as inversions). Qualitative effects: Some large abnormal
deletions; some normal coding, hybrid, signal joints also observed (with some abnormal).
Quantitative effects: =11-70 x lower
stable transfection efficiency. Qualitative effects: None reported
Introduced sequences, episomal'
-3
4
Quantitative effects: -1000 x fewer coding joints (as inversions or deletions); = 1 5 ~fewer hybrid joints (as deletions); =normal numbers of signal joints (as deletions).
Quantitative effects: None observed for intermolecular end-joining; none observed for recircularization of Compatible 3' overhang ends Incompatible 3' overhang ends Blunt ends Blunt to 3' overhang Hairpin ends.
Qualitative effects: =50% signal joints show abnormal base loss.
Qualitative effects: None observed (for ends as listed).
" V(D)J joining references: Schriler et al. (1986): Hendrickson et nl. (1988); Kim et al. (1988). Malynn ~t a / . (1988); Okazaki et a / . (1988); Blackwell et ol. (1989). Carroll and Bosnia (1989); Petrini et a / . (1990); Kienker e f a l . (199la.h). S c h d e r et al. (1991); Roth et al. (199211);Carroll et ul. (1993a.b); Fish and Bosnia (1993); Kotloff et al. (l993a,b);Pennycook r t al. (1993). DN.4 end-joining references: Fulop and Phillips (1990); Biedermann et a / . (1991); Hendrickson et al. (l99lb); Disney e t d.(1992), Chang et al. (1993). Taniguchi et al. (1993). V(D)J joining references: Hendrickson et n l . (1988, 1990, 1991a): Weaver and Hendrickson (1989);Fel-rier et a / . (1990a). DNA endjoining references: Harrington e l al. (1992) ' V(D)J joining references: Lieber et a / . (1988b) and Taccioli et al. (1993).DNA end-joining references: liarrington ct u / . (1992) and Lewiq (1994).
''
78
SUSANNA M . LEWIS
point is that it may be more productive to attempt to reconcile various observations according to a unifying principle, rather than discounting either the extrachromosomal or endogenous results entirely. 2. O t h e r
A new way to study the V(D)J joining mechanism is afforded by the ability to induce V(D)J joining in virtually any cell type through the introduction of RAG-1 and -2 expression vectors (Oettinger et al., 1990). As first suggested by the scid observations (Fulop and Phillips 1990)several groups have undertaken to look for V(D)J joining defects in DNA repair-deficient cell lines (Hsieh et al., 1993; Pergola et al., 1993; Taccioli et al., 1993; Petrini et al., 1994; E. A. Hendrickson, personal communication). Some of the cell lines that showed sensitivity to DNA-damaging agents were indeed inept at V(D)J joining; significantly, all of these had in common the feature that they were sensitive to ionizing radiation and were, in particular, defective in double-strand break repair (Pergola et al., 1993; Taccioli et al., 1993). For two of the Chinese hamster cell mutants tested, both coding and signal joint formation were depressed relative to wild type, and the signal joints showed an abnormally increased frequency of truncation at the signal ends (Pergola et at., 1993; Taccioli et al., 1993). In one study, it was shown that the CHO mutants (xrs-6 and XR-1; belonging to two different complementation groups) exhibited a normal level of X-ray sensitivity as well as normal V(D)J joining proficiency on fusion to scid fibroblasts (Taccioli et al., 1993).This indicated that the xrs, XR-1, and scid mutations are all separate entities and that each is probably involved in both double-strand break repair and V( D)J joining. One role suggested for the x r s and XR-1 gene products is that they might hold free ends together prior to ligation (Jeggo, 1990). Whether this proves to be so, the fact that V(D)J joining and doublestrand break repair converge outside of the scid system would seem to solidify the relationship (Pergola et aE., 1993; Taccioli et at., 1993). An observation that indicated a need for further analysis, however, was that the V(D)J joining defects in x r s and XR-1 lines (evident when RAG-1 and -2 and substrate DNAs were introduced either in a standard CaPO, transfection or by electroporation with excess carrier DNA) were abolished if the test DNAs were electroporated into cells in the absence of salmon sperm carrier (Pergola et al., 1993). Two additional cell lines (belonging to still other complementation groups) were identified as havingV(D)J joining defects that persisted even in the absence of carrier DNA. One of the lines had a phenotype very similar to that
V(D)J JOINING
79
of scid, while the defect in the other line was fairly subtle (Pergola et al., 1993). Altogether, it is not clear whether the CHO mutant studies indicate four critical V(D)J joining factors (beside s c i d ) , or none. While there seems to be a consistent correlation between double-strand break repair and V(D)J joining (as most explicitly indicated by co-reversion in various tests, Pergola et al., 1993; Taccioli et al., 1993), the carrier effect introduces some uneasiness as to what it all might mean. This is a very enticing approach, regardless, and presents the most immediate hopes for identifying and molecularly cloning additional genes involved in the V(D)J joining pathway.
D.
WHAT’S
LEFT?
1 . Hairpin Nick-use? When hairpin linear DNA was introduced into A-MuLV-transformed lymphoid cells, the ends were connected to give junctions containing the equivalent of P nucleotide insertions (Lewis, 1994). The structure of the junctions had many similarities to coding joints and left little doubt that these cells must be capable of nicking a hairpin-terminated DNA molecule at a position near, but usually not at, the tip. An endonuclease that simply recognizes single-stranded character (similar to S 1 nuclease, for example) might be expected to cleave predominantly near the two bases at the tip of a hairpin, which are certain to be unpaired (hairpin structure is reviewed in van de Ven and Hilbers, 1988). The tendency of the putative hairpin-nicking activity to cut well “off-tip” may distinguish it in a fundamental way from nucleases that are able to target single-stranded DNA (Drew, 1984).
2. Truncation Factors (“Flap-use”)? As discussed previously (Section V), very little is known about the nature of the truncation that is observed in coding joints. It may be due, in part to the endonucleolytic or exonucleolytic removal of “flaps” following the alignment of coding ends at one or more bases of homology (Figs. 6A and 6B). A candidate structure-specific activity has been purified and efforts to clone it are underway in one laboratory (Harrington and Lieber, 1994).A number of coding joints that show no evidence of having been aligned at homologies are truncated as well, however, suggesting that additional mechanisms may contribute to base loss. One possibility is that an exonuclease trims residues from an end independent of any contact with the partner terminus (see discussion, Section V,C).
80
SUSANNA M . LEWIS
To account for the fine-structure of coding joints, the net removal accomplished by this hypothetical nuclease must be somehow limited. One nuclease, BCAN (B cell-associated nuclease), has been detected in extracts prepared from mature B cells (Kenter and Tredup, 1991). This is a 52-kDa 3’-5’ exonuclease, which exhibits some sequence preference, and is nonprocessive. It will liberate a limited number of residues as niononucleotides from its substrate. It has also been shown to have a single-strand DNA preference (S. Sen and A. Kenter, personal communication). Based on its enzymatic activity, BCAN has properties that would particularly suit it to the role of trimming 3‘ extensions generated upon nicking a coding-terminal hairpin structure. However, although the activity was found in mature B cells, it was present at low levels, if at all, in pre-B cells and thymocytes (Kenter and Tredup, 1991). This of course does not rule out BCAN as the truncation factor in V(D)J joining, but some other role specific to (more mature) B cell DNA metabolism appears more likely (Kenter and Tredup, 1991). Regardless, BCAN is instructive as an example of a nuclease possessing many of the particular attributes one might seek in a candidate for the hypothetical truncation factor.
3. A Role f o r Replication? Studies with extrachromosomal plasmid substrates have indicated that plasmid replication is not an obligatory prerequisite for V(D)J recombination (Lieber et al., 1987; Hsieh et al., 1991). For example, an Mbol site located two bases away from the recombination site in one plasmid was not de-methylated in recombinants (this was assayed by digestion with Mbol prior to bacterial transformation; Hsieh et al., 1991).There was in fact multiple Mbol sites on the substrate, any of which would have been recognized by the nuclease where bacterial GATC methylation is lost on eucaryotic replication. Cleavage at even one demethylated GATC site would prevent the recombinant from being scored in the assay. Thus survival of recombinants after Mbol treatment meant that no wholesale replication took place in these molecules, and even a localized replication of the recombination target site, on both strands, must not be required for V(D)J joining. However, as was pointed out, the pattern of nuclease resistance among recombinant molecules remained compatible with the possibility that localized replication, on one strand, might be associated with recombination (Hsieh et ul., 1991). This possibility was investigated further in a study where recombination products were analyzed in much the same manner (i.e., by measuring resistance to restriction enzymes that discriminate between bacte-
V(D)JJOINING
81
rial and mammalian methylation patterns) except that a PCR assay was used in place of bacterial transformation to specifically probe an exised, signal joint product ( J . Menetski, K. Mizouchi, and M. Gellert, personal communication). Again, the status of sequences very near the recombination site were specifically assessed. Surprisingly, even with a substrate lacking the polyoma origin of replication, a significant fraction of the analyzed products appeared to be hemimethylated. These studies suggested that one of the two strand connections as first formed in a recombinant junction may be created by a process (nickor gap-repair) that involves limited DNA synthesis ( J . Menetski, K. Mizuuchi, and M. Gellert, personal communication). VII. The Origins of Order in V(D)J Joining
Antigen receptor gene assembly usually fails. For example, coding joints are created without regard to the reading frame ofthe constructed exon, so that a nonfunctional gene is generated in about two of every three joining attempts (Altenburger et al., 1980; Max et al., 1980; Lewis et al., 1985; Reth et al., 1986a).An incorrect reading frame is only one of a number of pitfalls that must be skirted in the course of constructing a pair of functional antigen receptor genes. Nevertheless, the system works, and daily millions of receptor-positive cells differentiate in the murine bone marrow and thymus. What forces ensure this success? At the two extremes, one could envision a primarily stochastic recombination program that converges on a biologically filnctional outcome only because there is extensive cullingofaberrant cells duringdifferentiation; at the other, orderliness, accuracy, and reproducibility in gene assembly might be intrinsic properties of the V(D)J joining process itself. In support of the former, a census of early B and T cell populations reveals that between the pro-T or -B and mature T or B stages, large numbers of cells fail to make the cut (reviewed in Rothenberg, 1990; Osmond, 1993; Rolink and Melchers, 1993). Whereas positive and negative cellular selection is understood to act on lymphocytes after gene assembly is complete and antigen receptors are displayed on the cell surface (as described in the cited reviews), the extent to which cells with recombination errors and nonproductive rearrangements drop out of the program at an earlier receptor-negative stage is not known. Cell death occurs at the late pro-B and pro-T stage in scid mice (Osmond et al., 1992; Rothenberg et al., 1993), the arrest-point phenotypes corresponding to lymphocytes that have launched, but not completed, gene assembly (Osmond et al., 1992; Godfrey et al., 1993). For the B lineage, there is evidence that the cells that have not tra-
82
SUSANNA M . LEWIS
versed the arrest point are ingested by niacrophages, suggesting the existence of a mechanism that can detect and remove aberrant precursors at an interim stage of the rearrangement program (Osmond et al., 1992). On the other hand, it seems unlikely that cellular selection could be the sole force imposing order on the V(D)J joining process, if only, as discussed in the present section, there is so much that can go wrong. Several attributes of the joining mechanism itself may figure in guiding the process at the reaction level, some of these, such as the 12/23 rule, have long been recognized, but as discussed below other, less-obvious, factors may also play a role One topic that is not covered, although it is extremely important in ensuring that the rearrangement program overall is successful, is the regulation of various stages of V(D)J joining. The targeting of specific loci for rearrangement in specific lymphocyte lineages, the ordered activation of recombination of elements within loci, and the relationship between the shut-down of rearrangement and allelic exclusion are topics that have been covered in several reviews and cannot b e included here (Raulet et al., 1991; Benoist and Mathis, 1992; Malissen et al., 1992; Schatz et al., 1992; Chen and Alt, 1993; Rolink and Melchers, 1993). Instead, the focus is on the mechanical constraints of the joining operation, known or suspected, that confine the process to a productive outcome.
A. THE12/23 RULE The 12/23 rule was first formulated after it was noted that there existed two types of joining signal (those with 12-base and those with 23-base spacers; Early et al., 1980; Sakano et al., 1980). It was readily appreciated that a rule dictating that segments attached to 12-signals can only become joined to those attached to 23-signals provides the basic assembly instructions for gene rearrangement. At the murine Ig heavy-chain locus, once it was discovered that both V and J gene segments were adjoined by 23-spacer signals, the existence of D elements flanked by 12-signals at both sides was predicted on the basis of this rule (Fig. 1; Early et al., 1980; Sakano et al., 1980). The overall organization of 12- or 23-spacer joining signals at various loci indicates the importance of the 12/23 rule (reviewed in Hunkapiller and Hood, 1989; Kabat et al., 1991; Litman et al., 1993). For example, at the Ig light-chain loci, V genes segments have 12-spacer signals at the K locus, but 23-spacer signals at A. Despite the fact that the signals were once apparently “switchable” during evolution, homogeneity of signal type is now observed for all V genes within a locus. There are only rare exceptions (all of which involve D segments; Kokubu et al., 1988;
V(D)J JOINING
83
Greenberg and Flatjnick, 1993),where signal arrangement is not identical for every member within the same class of gene segment. The immediate effect of signal homogeneity is that V-to-V or J-to-J recombination, clearly an undesirable event, is strongly inhibited. The extent to which “homologous” signals are prevented from joining has been measured with introduced substrates. In one test with a retrovirally integrated substrate, no recombination between two 23spacer signals could be detected (Akira et ul., 1987). However, by the extrachromosomal assay, 23- to 23-signal recombination was found to occur at about 2% of the levels measured for the 12-by-23 combination (Hesse et al., 1989; Lewis and Hesse, 1991).The fact that “like” signals recombine, if inefficiently, is in keeping with evidence that some 12/23 rule violations occur during lymphocyte differentiation (see below). Almost all ofthe known, or suspected, 12/23rule exceptions reported to date have involved the IgH locus. The I) segments at the heavychain locus are flanked on both sides by 12-spacer signals (Fig. 1),so that according to the 12/23 rule, D,-to-D, joining is not expected to occur. Nonetheless, in collections of junctions derived from normal tissue, from 1 to 13% of the isolates had structures suggestive of D,to-D, joining (Feeney, 1990; Gu et ul., 1990; Bangs et al., 1991; Sanz, 1991; Yainada et ul., 1991). Most of these putative D,,-D, junctions had been incorporated into fully assembled genes, so that actual DHto-D,%joining could well have been overestimated. This is because a certain amount of guesswork is necessarily involved in assigning the origin of residues found within VDJ joints. Often the designated D was represented by such a small remnant of coding sequence that the alternative possibility of N region addition could not be reliably excluded. In other cases, D segments were connected in a different 5’-to-3’ order than is present in the germline (Gu et al., 1990; Sanz 1991), which strongly suggested that D segments were first reordered by a D-to-J “hybrid inversion” (see section H). Hybrid inversion results in rearrangenient of joining signals such that an ensuing D,-toD, joining event would be completely in keeping with the 12/23 rule. More convincing examples where, for example, 15 or more contiguous residues exactly matched each of the putative D element precursors in the joined sequence (and the “correct” order was preserved) have been provided (eg., Yamada et ul., 1991); however, even so there still remained the possibility that observed D,,-to-D, joining events may not have actually violated the 12/23 rule. It has been suggested that heptamer-like elements embedded within the D-segment coding sequences might, on occasion, provide the necessary 23-spacer recogni-
84
SUSANNA M . LEWIS
tion element (Kurosawa et al., 1981). The involvement of such “cryptic” signals in rare DH-to-D, joining events is relatively difficult to exclude on the basis of coding joint data alone. Conclusive evidence of 12/23 rule violation for endogenous gene segments has instead been provided by an analysis of partially rearranged IgH alleles (Meek et al.,1989). Documentation of both inversional and deletional DH-to-DHrearrangement was obtained by PCR analysis of bone marrow DNA samples using appropriate primers. The fact that DH-to-DHjoining could occur without involvement of a 23signal was incontrovertibly demonstrated on isolation of a signal joint comprised of two fused 12-spacer signals (Meek et al., 1989). The frequency of DH-to-DHjoining at the murine IgH locus was estimated at one junction per 33,000 pre-B cells (Meek e t al., 1989).This number, if taken to reflect the actual occurrence of 12/23 rule violations in the immune system (i.e., unaffected by cellular selection), is lower than both the 2% frequency observed in plasmid test systems and the 1-13% frequencies that were inferred in various studies to exist in fully assembled junctions. In the latter case, the higher frequencies of DH-to-Dbl joining events reported in the studies cited above may have been inflated by misassignment or, as suggested by Meek et al. (1989),could indicate that the receptors templated by genes with DH-DH joints provided some selective advantage. Thus, in mice and humans, although the 12/23 rule is observed, it is not absolute; site-specific recombination between like signals is established for both endogenous and introduced substrates. The data of Meek et al. (1989) and others (Alt et ul., 1984) suggest that this type of joining is rare in differentiating T and B cells; but exactly how rare remains an important question. If there is indeed a discrepancy between introduced and endogenous substrates such that the 12/23 rule is “tighter” in the physiological context (i.e., with a frequency of 1 in 33,000 joining events instead of 1 in 50 or so), it might mean that the orderly assembly of gene segments in vivo is enforced by some additional mechanism(s). Curiously, 12/23 rule exceptions appear to arise with regularity at the IgH locus in the chicken (Parvari et al., 1988; Mansikka and Toivanen, 1991; Peynaud et al., 1991). Chicken DH gene segments, as in mammals, are flanked by 12-spacer signals on both sides (Reynaud et al., 1991),but junctions containing two, and sometimes even three, virtually full-length tandem D elements are found in both partially and fully rearranged IgH alleles (Mansikka and Toivanen, 1991; Reynaud et ul., 1991).No signal joints corresponding to these DH-D, recombination events have been reported, but the studies cited above neverthe-
V(D)J JOINING
85
less strongly indicated that recognition and recombination of two 12spacer signals may occur at an unusually high frequency in this animal. Most of the reservations concerning murine and human junction data were either ruled out or nearly so; first because typically 20 or more residues from the supernumerary D’s were identified within the DNA sequences of the chicken junctions, second because germline sequences provided little $upport for the existence of cryptic 23-signals, and third because examples where the germline 5’-to-3’ order of the D segments was clearly reversed were infrequent (only 1 case in over 30 reported; Mansikka and Toivanen, 1991; Reynaud et al., 1991). It is possible that cellular selection might play a role in the observed frequencies, because a significant expansion of a small number of B cell clones appears to occur in the bursa (Reynaud et al., 1991; Pandey et al., 1993). If so, there must be a strong selection for DD junctions even as they exist in incompletely assembled alleles, the basis ofwhich would be quite mysterious. It is tempting instead to suppose that the 12/23 rule may simply be more relaxed in chickens. The observation that 10-25% of all junctions appeared to arise from 12/23 rule violations in the chicken is one of many special features of the antigen receptor genes in this species. Perhaps the apparent 12/23 rnle violation is related to the extremely restricted gene organization in the chicken, where, at both the heavy- and light-chain loci, the choices” are limited to one V and one J element (Reynaud et al., 1985, 1989b). Gene rearrangement is necessary in order to express Ig genes in chickens, but the event achieves little in terms of combinatorial diversification. Instead, the requirement for antigen receptor diversity in B cells is largely met by postrecombination gene conversion events (reviewed in McCormack et al., 1991b). Relaxation of the 12/23rule in this animal could permit an inherently limited combinatorial diversity to be expanded by D-to-D joining events. The benefits may outweigh the hazards; thus, because of the simple structure of the rearranging loci, the cost in terms of compromising the orderliness in the gene assembly process overall may actually be minimal. In any case, the chicken provides a notable contrast to the mammalian situation and may present the best opportunity to explore the molecular basis of the 12/23 rule and its role in maintaining order during gene assembly. A fundamental question would be whether the enzymatic machinery itself is different in chickens than in mammals. If so one might expect to find evidence for this in the form of increased V-V or J-J joining either at other rearranging loci (e.g., TCRP; Tjoelker et al., 1990),or with introduced substrates. Further, comparative studies may indicate whether 12/23 rule violations are observed only in 1‘
86
SUSANNA M . LEWIS
species that can “afford” it because of simple locus structure. If, against expectation, it should turn out that the apparently high D-to-D joining frequency at IgH is in fact due to selective clonal expansion, this in itself might be an interesting tale, as the selection must unarguably be extremely strong and must be able to operate upon incompletely rearranged DDJ junctions. The centrality of the 12123 rule is perhaps so obvious as to be taken for granted. Yet it is not a simple task to experimentally test the role of the 12/23 rule, apart from other (ill-defined) factors, in maintaining order in V(D)J joining. As becomes evident from the ensuing discussion, the view taken here is that the 12/23 rule is the key binary code for the gene assembly system and that much ofthe information needed to impose order is encrypted in the critical details of locus architecture.
B. JOINING SIGNALS Conserved sequence motifs occur adjacent to every gene segment that is mobilized by the V(D)J joining machinery (Max et al., 1979; Sakano et al., 1979).These small, tripartite elements, “joining signals” or “recombination recognition sites” (HSS) total either 28 or 39 base pairs in length and consist of a heptamer, a spacer of 12 or 23 residues, and a nonamer. A joining signal, even when disconnected from its coding element, can be specifically targeted by the recombination machinery (Lewis et al., 1985; Akira et al., 1987; Hesse et al., 1987). In such cases, the fine-structural features of the recombinant junctions are preserved; typical signal joints are formed and the sequences substituted for V, D, or J coding elements are incorporated into junctions that are in all ways analogous to a true coding joint. In the germline, joining signals are not all created equal, and in fact they vary slightly from a consensus sequence in the vast majority of cases (e.g., almost 90% ofthe time according to one compilation; Hesse et al., 1989).The requirement for each of the three components-heptamer, spacer, and nonamer-in a joining signal has been probed with the plasmid assay (Hesse et al., 1989). Some of the findings of this study are summarized in Fig. 7 (Hesse et al., 1989). Not surprisingly perhaps, the consensus joining signal performed best in the assay, and the most evolutionarily conserved positions correlated with functionally important sites (Fig. 7). The three residues adjacent to the crossover site “CAC” were key determinants of joining signal function: changing any one of them resulted in the most significant reductions. The identity of the next adjacent residue as an A or T was also important. The only other single base changes found to have any marked effect were at positions 6 and 7 of the nonamer (Fig. 7). These residues
87
V(D)J JOINING
*** **** ** ***** A 4CACAGTG
* * .* *
* * *
- -
H 1 2 / 2 3 HA CAA A A A CCI
heptamer
-spacer-
nonamer
heptamer
-spacer-
nonamer
B FIG.7. (A) The consensus joining signal sequence. The relative importance ofvarious positions, as functionally defined with the plasinid assay, is indicated by stars (Hesse et al., 1989). (B) The relative conservation of various residues in the signal motif according to a survey of endogenous sequences is indicated by the bar graph (Hesse et al., 1989).
(AA) comprise part ofa five-base A-tract within the conserved nonamer element. All other positions of the joining signal were less crucial even though their conservation within naturally occurring joining signals is high. For example, interruptions of the A-tract by single base changes at any position other than 6 or 7 had relatively little effect, as did changing the residues located at the three nonamer-proximal positions of the heptamer. A signal in which all positions of the nonamer were changed to a noncanonical identity could still recombine at a very low level (Hesse et al., 1989). Spacer length was also explored in this study. When spacer length was increased by the addition of two or more residues, recombination frequency dropped drastically. However, an addition or subtraction of only one residue in the spacer was fairly well tolerated. This result was consistent with either of two possibilities: (1) spacer length is fixed and the variant nonamer now located at the appropriate position is still acceptable or (2) spacer length is variable, and the machinery can still interact with the consensus nonamer at its new position (Hesse et al., 1989). It remains unresolved whether spacer length is a flexible or fixed feature of the signal, although this issue is of interest both from the point of view of understanding the target preference of the V(D)J joining machinery and in assessing the overall stringency of recombination site selection. For example, it is an open question whether “cryptic” signals processing heptamer-like sequences, but that either lack nonamers or have variable spacer lengths, are physiolog-
88
SUSANNA M. LEWIS
ically relevant. Although there are a number of reports in the literature where “lone” heptamers have apparently been targeted b y the V( D)J joining machinery, these sites always had some traces of nonamer-Iike sequence as well: for example, only rarely were both of the A residues in positions 6 and 7 (as defined by a standard spacer length) absent (Hochtl and Zachau, 1983; Kelley et al., 1985; Moore et al., 1985; Kleinfield et al., 1986; Klobeck and Zachau, 1986; Reth et al., 1986b; Siminovitch et al., 1987; Komori et al., 1989; Shimizu et al., 1991; Usuda et al., 1992). The wide, acceptable variation in joining signal sequence may serve an important function in the developing immune system. Several studies have traced pronounced differences in gene segment joining frequencies in vivo to differences in the joining competence of the involved signals (Ramsden and Wu, 1991; Gauss and Lieber, 1992; Suzuki and Shiku, 1992). In mice, the ratio of K-to-A light chains in the antigen receptors of B cells is about 20 to 1 (reviewed in Ramsden and Wu, 1992). Representative joining signals from the murine K and A loci were compared by the plasmid assay and found to differ by two orders of magnitude or more, suggesting that the joining signals may indeed be a critical determinant of the relative K I A ratios in vivo (Ramsden and Wu, 1992). A second series of studies showed that preferential joining of JH2to DQ52 in normal mouse thymocytes might also be due to a measurably more proficient joining signal as tested with the plasmid assay (Suzuki et al., 1992; Suzuki and Shiku, 1992). Although the basis of the different proficiencies is often difficult to pinpoint, this study indicated that the signal for one of the lessfrequently joined J segments, JHIcould be improved by correcting its shorter-than-normal spacer length (Suzuki and Shiku, 1992). A third type of physiological bias was approached in a study by Gauss and Lieber (1992). It has been observed that among the heavy-chain antigen receptor genes in B cells, inversional D-to-J recombination (which is accomplished through the use of the 12-signals located on the 5‘ side of D segments) is generally far less frequent than deletional Dto-J joining (involving the 3’ D signal; Wood and Tonegawa, 1983; Meek et al., 1989; VanDyk and Meek, 1992).Here again, joining signal competence was found to contribute to a nonstochastic outcome; several 5’ signals (derived from “real” D segments) tested in the plasmid assay were “weaker” than the 3‘ signals (Gauss and Lieber, 1992). Targeting b y the recombination machinery may also be influenced by sequences apart from the canonical heptamer/nonamer motifs of the joining signal. Although the sequences of the joining signal spacers appear to be unconserved according to broad cross-comparisons,
V(D)JJ O I N I N G
89
family- and locus-specific spacer homologies have nevertheless been identified (Schroeder et al., 1989; Schroeder and Wang, 1990; Haire et a]. 1991; Koop et al., 1992). For example, there are strong sequence similarities in the “nonconserved” spacer regions of joining signals within particular V, gene families (in both mice and humans), and it was proposed on this basis that the actual spacer sequence may indeed have an influence on the frequency with which gene segment families are targeted (Schroeder et at., 1989). This interesting notion has not been tested in detail, although two experiments involving spacer sequence variation have been published (Akira et al., 1984; Wei and Lieber, 1993).A global conservation of sequence within all spacers has also been described. One conserved residue was linked to measurable differences in recombination proficiency (D. Ramsden 1993, Ph.D thesis). Studies have suggested that a “good” vs. “bad” recombination target also may be determined b y coding end sequences (Gauss and Lieber 1992; Boubnov et al.,1993; Gerstein and Lieber, 1993a). This is a k e y consideration both for understanding how rearrangement biases are established in vioo and for attempting to enumerate the total genomic burden of signal-like cryptic sites. A depression of recombination frequency of over two orders of magnitude was measured with plasmid substrates in which no changes apart from the sequence of the coding end just next to the joining signal had been introduced (Gerstein and Lieber, 1993a). Such coding sequence effects may figure early in the V(D)J joining reaction, possibly at the point of the initial binding/ cleavage of the target site (see Gerstein and Lieber, l993a, for discussion). The “rules” governing coding end effects, and the generality of the observation, were only partially disclosed by the study, but the data were consistent with a preference for G or C, over T, at the heptamer-proximal position of the coding end. An undesirable coding end sequence was most detrimental when located adjacent to the 12signal. These observations were interpreted in light of the 5’ versus 3’ joining signal bias in DH-to-JHrecombination, where it was suggested that coding end sequence is a significant parameter in this particular example of target site discrimination (Gauss and Lieber, 1992; Gerstein and Lieber, 1993a).A second implication was that there may be hitherto unrecognized context effects governing the frequency with which the V(D)J joining machinery aberrantly targets cryptic sites. Unusual sequence features abutting one reproducibly targeted cryptic recombination site have been noted previously and suggested to play a role (Fuscoe et al., 1991). (Cryptic sites are discussed in greater detail in section VIII.)
90
SUSANNA M . LEWIS
To summarize, the joining signal comprises the target site for V(D)J recombination; yet within the framework of “canonical” sequence recognition, there may be a relevant range of efficiencies with which a gene segment can recombine. As described here, known or postulated sequence-related effects fall into three categories: (1)the presence of an imperfect match to the canonical heptamer and/or nonamer in the signal, (2) (possibly) variation of the sequence within the spacer, and (3) disfavored sequences at the heptamer-proximal positions of the coding segment. It is too soon to give a relative weight to each of these effects; however, the significance of variable target proficiency in the developmental timing, biased repertoires, and fidelity of V(D)J joining is a subject that in general warrants further research.
C . STANDARD RECOMBINATIONWITH ATYPICAL OUTCOMES Some V(D)J joining products, although created in a joining reaction according to the “standard” equation of Fig. 2, are deviant. In such cases the target sites are unusual in one of two ways. As touched on above, one oftwo targeted recombination sites may not be an authentic signal, but rather a cryptic signal-like element. Alternatively, both targeted signals are canonical and functional; however, in combination with one another, they give rise to nonproductive junctions. In this section, a survey of atypical V(D)Jjoining outcomes, and their possible physiological impact, is presented. Belonging to the first category are V gene replacement and locus deletion and, to the second, is “pseudonormal” joining. Together with the array of recombination products derived from nonstandard joining events (Fig. 3; discussed separately in section H, below), this compilation provides a closer look at the wide range of options that exist during gene assembly.
1 . V Gene Replacement The operation referred to as “V gene replacement” (Kleinfield et ul., 1986; Reth et at., 1986b)is one where a fully assembled Ig heavychain gene is targeted for recombination through the recognition of a heptamer-like sequence near the 3’ end of the V gene segment coding sequence. In the mouse, complete VDJ joining ought to preclude successive rearrangement because all D segments are deleted by the assembly process and thus are not available to serve as adapter elements between the remaining upstream V segments and downstream J segments (both VH and JH elements have 23-signals). Nevertheless, V-to-VDJ rearrangement can in fact occur, mediated by a sitespecific recognition of a cryptic signal embedded within the rear-
V(D)J JOINING
91
ranged V segment. This was shown by two different approaches; in one case it was directly demonstrated that an unrearranged V gene segment within an artificial recombination substrate could in fact site-specifically rearrange with a VDJ sequence to produce both a signal joint and a coding joint (Covey et al., 1990),in another, “excision circles” (see section G, below) containing the predicted signal joint product of V gene replacement events were recovered from a transformed cell line that could be induced to carry out V-to-VDJ replacement (Usuda et d . , 1992). Together, these studies established that V gene replacement can take place on either artificial or endogenous substrates, and will produce junctions typical of a standard V(D)Jjoining event. In a similar type of reaction, a cryptic joining sequence that had been fortuitously created from a V-to-DJ fusion was found to serve as a 12-signal in recornbination between the VDJ assemblage and a downstream J (Komori et al., 1989). By either path (V-to-VDJ recombination or VDJ-to-J rearrangement) the outcome of “gene replacement” is a new antigen receptor gene. V gene replacement (or the analogous J segment replacement) has been proposed to salvage cells that have nonfunctional VDJ joins on both alleles (Reth et al., 1986b; Kleinfield and Weigert, 1989) or to allow diversification in situations where rearrangement is biased in favor of recombination of 3’-most V gene segments (Kleinfield et nl., 1986). There has also been speculation that V gene replacement at the heavy-chain locus might figure in “receptor editing” (Tiegs et nl., 1993; see section D). The observation that an “internal heptamer” is conserved within V gene segment sequences at IgH, at TCRy, and similarly at human and murine TCRcu, 6, and p, was taken to indicate the importance of this mechanism (Garman et al., 1986; Kleinfield et al., 1986; Reth et al., l986b; Bernard et nl., 1988; Holman et al., 1992). To date, there is no proof that V gene replacement occurs at any significant frequency during normal T and B cell differentiation. All the evidence for V gene replacement conies from the analysis ofcontinuously rearranging virally transformed cell lines (as cited above), or cells maintained in long-term culture (Tjoa and Kranz, 1992). Two separate studies have attempted to find evidence for the signal joint product of TCR V gene replacement within excision circles isolated from thymus or fetal spleen and have failed to do so (Aguilar and Belmont, 1991; Usuda et al., 1992).Although this is negative evidence, it does raise the question of whether V gene replacement occurs in untransfornied tissues. An alternative possibility is that V gene replacement, where observed, is aconsequence oflong-term, sustained, recom-
92
SUSANNA M. LEWIS
bination activity in immortalized lines. The evident conservation of the cryptic heptamer within V genes in general may be unrelated to any function as a joining signal. The heptamer is embedded in a region that is strongly conserved at the amino acid level (Kabat et al., 1991). It might well be that a requirement for an invariant cysteine in framework three of all V gene segments, in combination with preferred codon usage, is instead the underlying reason for the maintenance of the internal heptamer (T. Hunkapiller, personal communication).
2 . Locus Deletion A second type of cryptic signal interaction creates aberrant structures duringV(D)Jjoining. This occurs when a V , D, or J segment is correctly targeted, but then interacts with a cryptic signal that is unassociated with another coding segment. The first example of its kind was uncovered at the IgK locus (Hijchtl and Zachau, 1983),where a signal joint composed of a J segment signal and a signal-like element was isolated. The germline counterpart of the cryptic element showed no evidence of an adjacent V-like coding region. Since that time, numerous examples of V-to-X, X-to-D, and X-to-J rearrangement have been reported (e.g., Hochtl and Zachau, 1983; Kelley et al., 1985; Moore et al., 1985; Klobeck and Zachau, 1986; Siminovitch et al., 1987; Shimizu et al., 1991). Some of the cryptic sites responsible were probably once real joining signals, but their associated coding segments have since drifted to pseudo-gene status. Other sites may be completely fortuitous, there being no evidence that the sequence that has been targeted by the joining machinery is some type of evolutionary remnant. It has been suggested that recognition of certain cryptic sites by the V(D)J joining machinery might be a determinative event in T or B cell differentiation, perhaps governing the order in which loci are activated for recombination. The recognition of an element designated “RS” in the mouse (Durdik et al., 1984) and its homologue “Kde” in the human (Siminovitch et al., 1985) is located about 25 kb 3‘ of the K constant region (see asterisk, Fig. 1)and mediates deletion of a large area of the locus including the constant region exon and associated regulatory (enhancer) elements (Klobeck and Zachau, 1986; Muller et al., 1990). The RS element is rearranged through transactions with intron two types ofpartner signal: cryptic sites located within the JK-CK (Durdik et al., 1984; Shimizu e t al., 1991; Fig. 1)or VKjoining signals (Kelley et al., 1985). RS (or Kde)-mediated recombination is widespread in B cells that have rearranged A loci (Persiani et al., 1987; Nadel et d.,1990), implying that elimination or activation of K locus sequences may b e a necessary precondition for differentiation into a
V(D)J JOININC:
93
cell that can express the A isotype (Hieter et al., 1981; Durdik et al., 1984; Moore et al., 1985; Siminovitch et ul., 1985). Further studies have not supported certain aspects of this scenario; in particular, the ability of some A-MuLV-transformed lines to rearrange A was not affected by whether RS recombination had taken place (Persiani et ul., 1987), efforts to identify a putative positive trans-activator of A rearrangement were unsuccessful (Daitch et al., 1992), and genetargeting experiments have shown that, in rjiso, A gene rearrangement and expression can take place in normal cells without prior RS recombination (Chen and Alt, 1993; Zou et al., 1993). More complex models (see Chen et al., 1993b; Zou et al., 1993) have not been ruled out. Similar theories surround the bifurcation of TCRaP and y6 lineages, in that specific deletion of the TCRG locus might be necessary in order to allow commitment to differentiation into an a l p T cell (de Villartay et al., 1988; Takeshita et al., 1989). This deletion might be accomplished in one of two ways: by either Va-to-Ja rearrangement (the TCRG locus is nested within TCRa) or by rearrangement between cryptic signals in the region (asterisks, Fig. 1).The signals, termed “6 Rec” recombine with a “pseudo-Ja” signal that is present in both mouse and human (Takeshita et al., 1989).In either case, the deleted interval encompasses JG-CG, and evidence for the deletion of 6 sequences in TCRa-expressing cells has been obtained for untransformed T lineage cells in both mouse and human (Takeshita et d., 1989; Ohashi et al., 1990;de Villartay et al., 1991).Other data indicated that rearrangement of TCRG vs a genes is not a mutually exclusive choice (Thompson et al., 1990a) and that, in general, the lineage determination occurs independently of gene rearrangement (Ohashi et al., 1990; Mombaerts et al., 1992a; Philpott et al., 1992). It has been suggested that the GRec-to-Ja cryptic site recombination is incidental to the activation ofthe region for gene rearrangement, giving the impression of a causal relationship, but actually reflecting the accessibility of the region (Shimizu et al., 1993). Thus, as with gene replacement, the locu5-deletion type of rearrangement may be a case of what can happen does happen (eventually). I n the case of RS recombination at the K locus, the possibility remains that this type of recombination accumulates in cells that have been recombining longer, or more actively, than other cells and may have no role in the K versus A choice. In the case of TCRG deletion, the recombination correlates positively with the accumulation of V(D)J joining-mediated deletion between cryptic sites elsewhere in the genome (Macintyre et al., 1992; Breit et ul., 1993).Either may represent examples of joining mistakes that are not prohibited (or perhaps may
94
SUSANNA M . LEWIS
be positively selected at some level), rather than rearrangements that trigger commitment. Thus, the idea that the mistake-prone target recognition feature of the V(D)J joining machinery is key in programming differentiation, though provocative, has not been supported experimentally. Although neither the K nor the 6 locus deletions have proven to be obligatory in any T or B cell lineage, the possibility that locus deletion may be helpful in preventing expression of a previously aberrantly rearranged allele is not ruled out (Daitch et al., 1992). If so, whether this design is integrated into an effective scheme for dumping “bad” recombination trials is unclear (for example, will RS recombination occur less frequently on a functionally assembled chromosome?). Leaving open the possibility of surprises in the future, an interim conclusion is that no developmental decisions hinge on the tendency of the V(D)J joining machinery to target certain noncanonical signals.
3. Pseudo-normal Joining The concept of pseudo-normal joining is not particularly serviceable, as this type of junction is not distinguished according to any mechanistic, structural, or topographic criteria. Pseudo-normal junctions are a grab bag of products that have in common the fact that they represent nonuseful outcomes of V(D)J joining and/or were not deemed normal by the experimenter. In all cases a pair of authentic joining signals have been targeted according to the 12/23 rule and either a standard inversion or a deletion ensued. Pseudo-normal joining at the Ig heavychain locus, for example, refers to rare instances where the signal 5’ to a D segment is targeted for recombination with the J signal, resulting in a D-to-J inversion (Alt and Baltimore, 1982). There is nothing structurally abnormal about such products and, in theory, inverted DJ junctions ought to be able to serve as intermediates in V(D)J joining. At the K locus, what has been termed “pseudo-normal” is clearly unproductive. Here, a rearrangement occurring subsequent to a primary VKto-JK inversion can involve a V K and JK whose relative locations are such that a signal joint is presumably retained in the chromosome and the coding joint is recovered on excised DNA (Harada and Yamagishi, 1991).Similarly, at the TCRP locus, pseudo-normal joints were isolated from untransformed thyniocytes where coding joints were found on excision products resulting from recombination between an upstream JP gene segment and a downstream DP (Okazaki et al., 1987; see Fig. 1).At TCRS, pseudo-normal joining refers to a pattern of rearrangement where D-to-D fusion involves the two “outside” signals, leaving a signal joint in the chromosome (again, excising the coding joint prod-
V(D)J JOINING
95
uct). Experiments indicate that, in fact, at the TCRG locus, this type of recombination is fairly common, but should tend to limit the chance of constructing a functional gene from the affected allele (Carroll et al., 199313). Altogether, the joining patterns described as pseudo-normal have the common feature that they are of no obvious benefit to the differentiating lymphoid cell. The underlying issue of interest is how these events are avoided: for in fact nonuseful (physiologically speaking) signal-signal combinations present themselves at every locus. There may not be any one single solution. Strategies may be locus-specific and may be in place only where particular hazards attend the pseudonormal transaction in question. For example, pseudo-normal joining might be prevented at loci with a clustered organization (such as Igh or TCRy, or in elasmobranch loci in general) by restricting “intercluster” rearrangement. At IgH, pseudo-normal joining (D-to-J inversion) may be prevented by a locus-specific rule that (somehow) prevents recombination with the 5’ signals of D segments (discussed further in section I ) . Pseudo-normal joining may be of little consequence, or simply not preventable, at other loci such as K .
D. SUCCESSIVE REARRANGEMENT (SECONDARY REARRANGEMENT) Studies of ongoing rearrangement in A-MuLV cell lines indicated that it was possible for V-to-J or D-to-J rearrangement to occur more than once on a given chromosome (Lewis et al., 1982; Reth et al. 1986a; Maeda et al., 1987),consistent with the suggestion that an initial joining event of itself provided no barrier to subsequent recombination (Early and Hood, 1981). It has been shown that successive rearrangement, in transformed cell lines, can replace a bad K gene construction (i.e., one that was out-of-frame or had involved a pseudo-VK gene segment) with a good assembly (capable of templating a lightchain protein; Feddersen and Ness 1990). There is also evidence that ongoing recombination can displace a successfully assembled VKJK junction (Harada and Yamagishi, 1991; Huber et al., 1992). Successive recombination, with similar results, has been demonstrated for the TCRa locus as well (Marolleau et al., 1988), where such events provide a logical explanation for the in vivo pattern of Jct! use during development (Thompson et nl., 1990b; Roth et nl., 1991). It has been theorized that successive rearrangement may serve a dual purpose, one to rescue cells that have almost made it to the end of the differentiation program, but failed to assemble a functional gene at the last step (Feddersen and Van Ness, 1985), and a second to allow remodeling of an antigen receptor gene that, though functional, templates a product with a detri-
96
SUSANNA M. LEWIS
mental “self” specificity (receptor editing; Nemazee, 1992; Radic et al., 1993). Implicit in both of these theories is the notion that the immune system finds it more economical to have a lymphocyte “try again” than to delete the cell. Thus, among features that contribute to the successful assembly of antigen receptor genes, the fact that successive recombination has been demonstrated, and is not generally proscribed, is clearly relevant. However, it is not yet known how many chances to recombine a differentiating lymphocyte is given at each stage of the assembly process, and it may be that successive rearrangement is a more significant option at some points than others. Moreover, successive rearrangement is not always a force for the betterment of the pre-B or -T cell, as it will also increase the likelihood of assembling two functional genes within a single cell, and thus the production of mixed antigen receptors.
E. DISTANCE EFFECTS Proximity has been suggested to explain the observed pattern of gene segment combinations in the in duo-generated repertoire. Initially it was found that V, gene use in A-MuLV transformants appeared to favor segments located nearest to the D cluster (Yancopoulos et al., 1984). It was later determined that repertoires of both murine and human fetal B cells were also dominated by 3’-most VH families (Perlmutter et al., 1985; Schroeder et al., 1987; Malynn et al., 1990). Distance or proximity has been invoked to account for other nonstochastic patterns as well; as in the virtually absent interunit recombination observed at loci with a clustered type of organization (see section 111,A; Reilly et al., 1984; Raulet, 1989; Sanchez et al., 1991; Litman et aZ., 1993),in the use ofnearby VHgenes in “replacement” recombination (section C, above; Kleinfield et al., 1986; Reth et al., 1986a,b; Shirasawa et al., 1992), to explain the order in which J a segments recombine at the TCRa Iocus (Thompson et al., 199Ob; Roth et al., 1991), or to account for prevalent junctions as formed on transgenic constructs (Uematsu et al., 1988; Tuaillon et al., 1993). Despite these many examples, there is no case where rearrangement patterns can be explained strictly on the basis of proximity. For example, the preferred V, gene segment in humans is not the most 3’ element (Schroeder et al., 1989), and, in mice, strain-specific differences in V gene use map outside the IgH locus (Atkinson et al., 1991; Osman et al., 1992; and cited therein). Proximity plays little role at some loci: this issue has been fairly well investigated for the murine IgK locus, where there is no connection between proximity and a
V(D)J JOINING
97
restricted recombination pattern (Kaushik et al., 1989; Teale and Morris, 1989; Kalled and Brodeur, 1990; Medina and Teale, 1993). Even though proximity effects are not necessarily dominant, they could well be important. Given that the physiological biases that have been described often involve distances that vary over tens of kilobases or more, this question is likely to be best approached experimentally with transgenic systems. For example, in one relevant experiment (Engler et al., 1992), recombination between segments residing in a tandemly repeated transgenic substrate was measured. No difference was found between the frequency with which elements separated by 22 kb rearranged relative to those at only 7.5 kb distance (Engler et ul., 1993).Two other groups have constructed transgenic mouse strains containing =50- to 100-kb portions of the human IgH and/or IK loci in unrearranged form (Bruggemann et al., 1991; Taylor et al., 1992; Tuaillon et al., 1993). Whereas certain D segments in the inserted loci, recombined more frequently it is not yet known if these reflect a proximity effect or not. Although the effect of proximity, on a physiological scale, has not been fully explored, several groups have looked into the possibility of short-range influences. These experiments were largely aimed at investigating the notion that the recombination machinery “tracks” along the DNA from one joining signal to the next, with a preference for rearranging the first signal encountered (Wood and Tonegawa, 1983; Yancopoulos et al., 1984). This idea in its most simplistic form was fairly easily tested with plasmid substrates in which three 12spacer joining signals were arranged in tandem (with two basepairs between each copy), at a distance 6.5 kb from a single 23-spacer signal. The observed recombinants were split fairly evenly between the three signals. The same result was obtained when a construct with three tandem 23-spacer signals located 6.5 kb distance from a 12-signal was tested (Gauss and Lieber, 1992). Another group approached the problem somewhat differently i n seeking to explain a DQ52-to-J.2 bias among in uiuo-generated rearrangements (Suzuki et al., 1992). It was possible to reconstruct this bias with extrachromosomal substrates containing 2111 four JH’s and the DQ52 segment (Suzuki and Shiku 1992), but the JH2bias persisted even when the order of the gene segments was reversed. In short, proximity played no detectable role in the recombination frequency in either of these studies (Gau 1992; Suzuki and Shiku, 1992). Crude analyses such as those described above are the best that can be hoped for in the absence of an in uitro joining assay, and are of value even though they do not directly address the question of’ how
98
SUSANNA M . LEWIS
the recombination factors encounter their target sites. For the V(D)J joining machinery, this still might entail some type of linear diffusion along the DNA, but the situation has at least been clarified to the extent that none of the data to date specifically indicate such a model.
F. Cis- AND T~U~S-REARRANGEMENT Whether the V(D)J recombination machinery can carry out recombination between two target sites residing on physically unlinked DNA molecules bears very directly on the question of how order is maintained in V(D)J joining. A strict ban on interchromosomal recombination would, in theory, be helpful, because there are more hazards than benefits in allowing such events. For example, gene assembly by either interchromatid or interhomologue recombination involving inverted gene segments (at the IgK or TCRP loci) would generate dicentric and acentric chromosomes as products. Also, there are cases where V gene segments (termed “orphons”) have become separated from the rest of the locus and relocated to a new chromosome (Lotscher et al., 1986; Matsuda et al., 1990; Robinson et al., 1993);use ofthese gene segments in V( D)J recombination might generate undesirable translocations. Restricting rearrangement to linked target sites avoids the above types of event and also limits the number of cryptic signals that could interfere with the recombination process to sites that exist in cis. It was only fairly recently that evidence has been provided that indicates that interchromosomal V(D)J joining might in fact be quite rare. Three categories of interchromosomal V( D)J recombination are theoretically possible, that between chromatids, between homologues and between nonhomologues (Fig. 8). Unequal sister chromatid exchange was first proposed to account for the retention of signal joints in K-rearranged lymphoid cells (Van Ness et aZ., 1982).However, subsequent analyses revealed instances of nonsegregation of coding and signal joints following K locus recombination, contradicting the predictions of that model (Fig. 8, left; Hochtl and Zachau, 1983; Klobeck et al., 1988; Feddersen and Ness, 1989). These results as well as physical mapping studies (Lorentz et al., 1988; Weichhold et al., 1990) have led to the general acceptance of an alternative, inversion, model for IgK gene rearrangement (Lewis et al., 1982).Interchromatid recombination was also suggested to explain the presence ofmultiple CP-hybridizing rearrangements in one TCRP-rearranged T cell hybridoma (Kronenberg et al., 1985). This increment in the copy number of elements in the locus was consistent with unequal sister chromatid exchange (Fig. 8, left) and was cited as evidence in several reviews. However, the data were inconclusive, because other likely possibilities such
99
V(I>)J JOINING
Inter-chromatid
Inter-homolog
Obligate segregation
No segregation
Inter-chromosome (non-homoloes)
No segregation (chimeric junctions)
FIG.8. T h e predicted consequences of inter uersus intrachromosomal V(D)Jjoining.
as (a) karyotypic abnormality and (b) subclonal heterogeneity might equally well have accounted for the extra Cp copy in this one cell line and had not been ruled out. Subsequent studies indicate instead that interchromosomal recombination occurs rarely, if at all (see below). Interlocus V(D)J junctions (i.e., in which the V segment was from a different locus than D and/or J) have been detected (Baer et al., 1985; Denny et nl., 1986; Tycko et al., 1989; Kobayashi et al., 1991; Lipkowitz et al., 1992).In several cases, the involved loci were situated on two different chromosomes (Fig. 8, right), and the events have been roughly quantified. For example, estimates put the frequency of D6to-Jy junctions (linking chromosomes 13and 14) at 1per 50,000 murine thymocytes (Tycko et al., 1991) and VG-to-JP (a 14-to-7 translocation) at 1 in every 200,000 human peripheral blood lymphocytes (Kobayashi et nl., 1991). The most revealing comparisons of cis and trans recombination frequencies involved measurement of interhomologue junctions (Fig. 8, middle) at the TCRP locus (Aster and Sklar, 1992). Providentially, the NZW and SWR strains of mice possessed the ideal TCRp alleles for such an undertaking: NZW lacks a portion of the Jp2-to-Cp2 region present in SWR; SWR is deleted for a number of Vp gene segments found in NZW deleted. Through PCR amplification of junctions in F1 animals, products involving a Vp from the NZW chromosome and Jp from the SWR chromosome were detected (Aster and Sklar, 1992). These interchromosomal junctions were rare: estimated to be present in only about 1 of every lo5thymocytes. This was an important result; both alleles were presumably accessible at the time ofjoining, thus the
100
SUSANNA M. LEWIS
low frequency of interallelic rearrangement indicated that unlinked targets are somehow out-of-range of one another. Although the above experiments established the rarity of trans Vto-J recombination, whether in fact interchromosomal V( D)J joining is at all possible has not been conclusively demonstrated. There is no doubt that gene segments that, in the germline, were originally located on two separate chromosomes have in fact become connected to one another in these experiments, but it has not yet been determined that the two gene segments were first brought together by V(D)Jjoining rather than by a nonspecific translocation event. Even the low-level truns-recombinants measured in the above studies may actually have arisen through cis V(D)J joining. Analysis of gene structure in bulk populations ofcells can set an upper limit to the frequency of interchromosomal joining (Aster and Sklar, 1992),whereas the specific diagnostic tests that distinguish a trans-V(D)J joining mechanism from other possibilities must be conducted at the single-cell level (section VIII, Fig. 14). Somewhat surprisingly, there has been little experimental exploration of a possible intra-versus-intermolecular V(D)J joining constraint using introduced substrates. Only one group has carried out a preliminary investigation of the issue (Hesse et al., 1987). In this study, intermolecular recombination was tested by cotransfecting a plasmid substrate containing a single 12-spacer joining signal along with another bearing a single 23-spacer joining signal. No intermolecular recombinants were detected, putting the relative frequency of such events below 0.7% that of intermolecular rearrangement. As such, the negative result provided limited information. Potentially, a more suitable approach might involve stably integrated substrates-transgenic or otherwise-where the copy number is controlled and chromosomal location might be better defined. The observed rarity of interchromosomal V(D)J recombination could have one of several explanations; there might be a mechanistic prohibition against an intermolecular joining event (although it is difficult to imagine how molecules are distinguished at the level of a chromosome), there might he some organization with regard to how chromosomes are draped in the nucleus at the time of recombination that limits the possible outcomes, or, less mysteriously, there might simply be a much lower random-collision probability for physicaIly unlinked elements. The third of these has been suggested to be a factor in the “vicinity effects” observed for site-specific and homologous mitotic recombination in yeast (Lichten and Haber, 1989; Sauer, 1992). As mentioned, none of these possibilities has been distinguished experi-
V(D)J JOINING
101
mentally in the case of V(D)J joining. For the present, in the absence of any information about the relationship between the recombination machinery and the architectural elements that physically organize the genome, alternative suggestions involving a more specific restriction in the case of V(D)J joining can reasonably be entertained (Aster and Sklar, 1992).
G. ORIENTATION: DOESIT MATTER? At most loci, gene segments are in the same transcriptional orientation (Fig. l).Thus, as configured, coding joint formation is deletional, and is accompanied by the physical disconnection of the intervening DNA from the chromosome (see Fig. 9D). The excised DNA is sometimes detectable in circular or linear form (Fujimoto and Yamagishi, 1987; Okazaki et al., 1987; Roth et al., 1992a,b), but ultimately, this region is lost from a stably rearranged cell (Sakano et al., 1979; Seidman et al., 1980). At several loci, recombining elements are in opposed transcriptional orientation prior to rearrangement (Fig. l), and their signal orientations dictate that coding and signal joints remain linked after recombination (Fig. 9B), defining the boundaries of an inverted region. The significance of the choice between inversion and deletion can be considered on two levels: in terms of what it might mean about the molecular mechanism and with regard to physiological consequences. Mixed orientation of VK gene segments (Fig. 1) has been demonstrated directly by molecular cloning of the human K locus (Lorentz et al., 1988), and inversion of over a megabase of DNA can be visualized upon V-to-JK joining (Weichhold et al., 1990). Although physical mapping in the mouse is not as complete as for humans, inverted VK gene segments also appear to be prevalent in this animal (Shapiro and Weigert, 1987, and cited therein). Inversionally oriented gene segments have subsequently been described at some TCR loci (see Fig. 1 for murine examples; Malissen et al., 1986; Chien et al., 1987b; Iwashima et al., 1988; Korman et al., 1989). No locus to date is comprised entirely of backward gene segments, and even at K fewer than half of the V gene segments appear to be inverted (Shapiro and Weigert, 1987; Zachau, 1990; Fig. 1).The opposite situation, loci where the polarities of all gene segments are arranged for deletive joining, is common (Lai et aZ., 1989). There may be a physiological advantage to inverted gene segments in some contexts, but, if so, it is not obvious. Although an initial inversion event might bring distant V gene segments nearer to J K for secondary recombination (Shapiro and Weigert, 1987; Kalled and Brodeur,
102
SUSANNA M . LEWIS
’ (””) B ’
-
INPUT
+I
STANDARD
c
HYBRID
1
(NORMALIZED FREQUENCIES)
1
A
1
1
INVERSION
HYBRID HYBRID STANDARD
0.17
0.002
FIG.9. Standard and hybrid outcomes for all possible signal configurations. See text (data are calculated from Lewis et al., 1988). Recombination can be inversional or deletional for every configuration. Reciprocal “excision circles” are diagrammed as small insets for each deletional outcomes.
1990; Weichhold et al., 199O),deletional joining accomplishes this as well (at the expense of the intervening DNA). It has been suggested that the inverted V gene configuration at the K locus is useful because it preserves a larger number of V segments for subsequent rearrangement (Weichhold e t d . ,1990; Tiegs et al., 1993).Indeed, there is a restricted V K gene segment use, observed among early fetal B cells, that appears to favor inversionally oriented elements (Medina and Teale, 1993).However, it was also noted that some of these favored rearrangements are to the C-proximal J K gene segment and, as such, create a topography that is unlikely to be useful in successive recombination attempts (Medina and Teale, 1993).Possibly, the inverted organization of segments at certain loci exists for reasons unrelated to V(D)J joining. For example, the fairly regular flip-flop polarities of the pseudo-V gene segments at chicken Ig loci have been suggested to help stabilize segment number in the germline by preventing their elimination through homology-based recombination (Reynaud et at., 1989b). It is conceivable that inverted V genes arose by happenstance
V(D)J JOINING
103
and exist because they do not have any particularly negative consequences for the joining system. In other words, whether a locus is set up for deletion or instead inversion may be an almost neutral difference in V( D)J recombination. One obvious difference between inversion and deletion, however, is the number of junctions required for chromosome (or substrate) integrity: only one joint need form in a deletion, as opposed to two for an inversion (Fig. 9). The straightforward one-joint/two-joint difference will always somewhat favor deletion (Gauss and Lieber, 1992). As measured with recombination-proficient substrates, in which the signal sequences as well as signal-proximal residues of the coding ends are the same, deletion is consistently favored over inversion by a factor of somewhere between 2- and 4-to-1 (Hesse et al., 1987; Lewis et aZ., 1988; Gerstein and Lieber, 1993a). Beyond the fact that two, rather than one, junctions must be completed for successful inversion, no evidence from plasmid studies to date has indicated that the V(D)J joining operation can “detect” orientation (Gauss and Lieber, 1992). This was inconsistent with the possibility of a “topological filter” such as exists in a number of other site-directed recombination systems (reviewed in Gellert and Nash, 1987). In many cases, a recombinase can discriminate between different target site orientations due to geometric constraints imposed by organized nucleoprotein complexes at synapsis; as a result, orientation preference may reflect thermodynamic considerations (extra looping is required when sites are in one orientation but not another). Alternatively kinetics has been suggested to play a role (on encounter via a rapid, restricted “slithering” of a plectonemic supercoil, the correct geometry for productive complex formation is already approximated for sites in one orientation but not another; Parker and Halford, 1991). To a certain extent it is inappropriate to make comparisons between results obtained with an in uiuo assay of V(D)J joining and those obtained with highly purified components in uitro in other systems. But as a first pass at the problem, the fairly inconsequential effects of orientation when measured on circular plasmid molecules hint that, in contrast to other recombination systems, productive interaction between target sites is not highly constrained by protein:DNA assemblies (Craig, 1988; Echols, 1990; Mizuuchi, 199213). Although all the available evidence converges on the conclusion that inversion and deletion are roughly equivalent mechanistically, there is nevertheless a marked scarcity of inversionally joined D segments at the Ig heavy-chain locus (Wood and Tonegawa, 1983; Meek et al., 1989; Schlissel et d., 1991; VanDyk and Meek, 1992). DHgene
104
SUSANNA M. LEWIS
segments have 12-spacer signals on both sides; thus, based on the results discussed above, inversional D-J recombination would be expected to occur about 1/3 to 114 of the time. Instead the in vivo ratios are very low, closer to 1000 to 1 (Meek et al., 1989; K. Meek, personal communication). This D-to-J inversion bias, and why it exists, is taken up more fully below, following a review of alternative junctions.
H. THE SPECIFICITY OF ENDEXCHANGE: ALTERNATIVEJUNCTIONS IN
V( D)J JOINING
In many site-directed joining systems, detrimental recombination events are prevented, in part, by the ability of the recombinase to detect the relative orientation of target recombination sites (as discussed in the previous section). For those site-specific recombination systems that are not restricted in this fashion, there is nevertheless some built-in strand-exchange specificity. The term “directionality” has been used to indicate two different types of discrimination. Cre or Flp recombinases, for example, manifest directionality in that a particular orientation of target sites leads to a fixed, and predictable, result (reviewed in Sadowski, 1986).The choice between inversion, or resolution (into two circles), is dictated by the relative orientations of the recombination sites of the input substrate. This type of directionality, as studied in the Cre and Flp systems, appears to be imposed on the reaction largely by DNA:DNA interactions during the strandexchange step (Hoess et al., 1986; Senecoff and Cox, 1986; Serre et al., 1992),although some evidence for interactions that impose a polarity on synapsis at a precleavage stage exists as well (Qian et al., 1992). The term “directionality” also has a second meaning, related to the reversibility of the recombination reaction, as applied to Int-mediated events. Phage A integration is not immediately followed by excision (Landy, 1989; Nash, 1990). The formation and obligate breakdown of higher order nucleoprotein structure ensures that the reaction does not simply reverse to expel the integrated phage genome. In this case, DNA:protein interactions are key to the observed orderliness of recombination (Landy, 1989; Nash, 1990). The V(D)J joining system provides an interesting contrast to the above examples of specificity in strand exchange. For one thing, the standard V(D)J joining event is not simply reversible because one of the products, the coding joint, no longer contains a recombination target site. Given this inherent directionality, even if the forward and backward reactions were energetically neutral, there should be no necessity for more elaborate devices to protect new junctions from becoming disassembled by iterative recombination. Further, direction-
V(D)J JOINING
105
ality as exhibited by the Cre or Flp recombinases (that is, the inherent mechanistic restriction that dictates inversion with one sort of signal arrangement and deletion with another) is not observed (Fig. 9). Starting with each of the four possible joining signal configurations as diagrammed in Fig. 9, both inversion or deletion can be detected. The junctions produced are “standard” or “hybrid.” The options actually include three patterns of end exchange (Fig. 3 ) . Nonstandard V(D)J joining events are those in which signal-tocoding end fusion occurs in place of signal-to-signal and coding-tocoding end connections and include both the hybrid and open-andshut pattern (Figs. 3B and 3C). These nonstandard products have been detected not only with introduced substrates (Lewis et al., 1988; Lieber et al., 1988b; Morzycka-Wroblewska et al., 1988; Weaver and Hendrickson, 1989; Lewis and Hesse, 1991)but also on rearrangement of the endogenous substrate in vivo (Stenzel-Poore and Rittenberg, 1987; Elliott et al., 1988; Nickerson et ul., 1989; Alexandre et al., 1991; VanDyk and Meek, 1992; Carroll et al., 1993a,b; S. Fish and M. Bosma, personal communication; A. Sollbach and G. Wu, personal communication). In hybrid joints (Fig. 3B) two gene segments exchange signals. In an open-and-shut joint (Fig. 3C) a coding segment is disconnected and then reattached to its original signal without any net rearrangement. In short, as illustrated in Fig. 3, every possible 5‘ endto-3’ end combination can be found among the products of V(D)J joining. The fine-structure ofall types ofV(D)J joining product is remarkably consistent. Coding ends, whether they are incorporated into a standard, hybrid, or open-and-shut joint, exhibit base loss and addition (including the occasional P nucleotide insert). Signal ends, as found in any ofthe three types ofjunction are joined most often without modification (reviewed in Lewis and Gellert. 1989). In addition, it has been demonstrated that hybrid junction formation follows the 12/23 rule and can be a reciprocal recombination event (Lewis and Hesse, 1991). All of these observations support the view that an event in which “improper” end exchange occurs is very closely related to the normal (standard) V(D)J joining event (Lewis et al., 1988). The lack of end-exchange specificity in V(D)J joining is peculiar. Many other site-directed recombination systems have developed fairly elaborate mechanisms to ensure that the correct ends become connected (for a discussion see Mizuuchi, 19924. At first glance, one might suspect, given the multiplicity of possible outcomes in V(D)J joining, that perhaps the nonstandard junctions are simply innocuous. However, as it presented more fully below, this is not likely to be the case.
106
SUSANNA M . LEWIS
In the present discussion two issues are examined: (1) the prevalence of nonstandard junctions and (2) the possibility that there are mechanisms in place to actively suppress their formation. Given a particular joining signal configuration, either of two situations pertains: a hybrid junction will be formed deletively and standard junctions will form inversionally (for example, substrate A, Fig. 9), or the reverse is true such that hybrid junctions are formed by inversion and a standard junction forms by deletion (e.g., substrate C ) .With the extrachromosomal assay, hybrid junctions can be discriminated from standard recombinants fairly easily and have been found to represent almost 30% of all products in some cases (Lewis et al., 1988). Only one quantification of hybrid formation has been carried out with a stably integrated substrate (in configuration A), but interestingly, 2 hybrids and 21 standard junctions were isolated in that experiment (Morzycka-Wroblewska et al., 1988). This 9% hybrid joint frequency agrees reasonably well with the 17%frequency measured for configuration A on screening large numbers ofjunctions with the extrachromosoma1 assay (Fig. 9). Accordingly, the representation of hybrid joints observed with plasmid substrates has not somehow been grossly exaggerated in the extrachromosomal assay; the fraction is significant when measured with integrated, single-copy substrates as well. Hybrid joints would not appear to be a good thing for a differentiating lymphocyte for two reasons. One is that a hybrid joint represents essentially wasted effort; a cell that forms such a junction has made no progress toward assembling an antigen receptor gene relative to the fully unrearranged state. A second, more serious consideration is that hybrid joint formation is likely to derail the joining process altogether. Formation of a single hybrid joint clearly erodes locus organization in the one feature that has been preserved through millions of years of evolution, that being an arrangement that will create “sensible” junctions according to the 12/23 rule. The hybrid joint outcome results in the attachment of the wrong signal to a gene segment. As shown for the hypothetical locus in Fig. 10, following hybrid joint formation (Fig. 10, second line), a J segment with a 12-signal is suddenly intermixed with J segments with 23-signals (and likewise signal scrambling occurs for the V segment partner). Once gene segments have acquired inappropriate, but otherwise functional, joining signals, several types of aberrant events may ensue (shown as outcomes 1-4 in Fig. 10). Although a correct VJ junction can still form (for example Fig. 10, outcome 3),other recombination events, in particular, J-to-J and V-to-V joining (outcomes 1 and 4), are no longer precluded on the basis of the 12/23 rule (Fig. 10).Given the projected results of
107
V(D)JJOINING
u hybrid inversion
A U 1
2
4
J.
CI 3
standard 2nd events
J
2
J
C
J
C
4
FIG.10. The hypothetical consequences of hybrid joint formation. A hypothetical, “deletional1y”oriented locus is shown. Upon hybrid inversion,anew slateofreconibination events becomes possible. Dots indicate recombination sites. All of‘ the outcomes shown represent standard recombination events. Outcomes 1,2,and 4 represent failures in gene assembly. Not all possibilities are shown, but potentially, outcome 4 might be favored d u e to the close proximity of the two involved joining signals.
hybrid joint formation, it is of interest to learn whether they are actively suppressed. To launch such an inquiry it is essential to quantify hybrid joint formation both in the mouse and in defined, artificial systems. A partial answer from plasmid studies is that there appears to be an intrinsic anti-hybrid joint bias, but that the effect is only significant for substrates in the C and D configurations. This feature can be appreciated by comparing substrate A to substrate C (Fig. 9, bottom). For substrate A, the ratio of hybrid recombinants-to-standard recombinants is 0.17. In contrast, for substrate C, the hybrid-to-standard ratio is only 0.002 (Lewis et al., 1988).The same result is obtained when substrates B and D are compared; the ratios thus appear to be related to the
108
SUSANNA M . LEWIS
topography of the substrate. Events leading to hybrid joints instead of standard joints are thus less likely to be reciprocal (i.e., there is less likelihood that all four ends are successfully reconnected), so that substrate configurations that require inversional hyrid outcomes (Figs. 9C or 9D) apparently disfavor the nonstandard product. Put another way, the values in Fig. 9 (all of which were normalized to an internal recombination control to allow comparison between configurations), indicate that while the ratio of inversion-to-deletion is around 0.3 for the standard outcome, for hybrid joint formation, it is only about 0.03. In absolute terms, the extrachromosomal plasmid measurements indicate an intrinsic “joining hierarchy”: standard deletions are most easily accomplished, followed by standard inversion, then hybrid deletion, and finally hybrid inversion (Fig. 9, bottom). It is possible that the immune system has evolved a locus structure that capitalizes on this hierarchy. A valid generalization is that the prevailing gene segment configuration is of type D (see Fig. 1 and citations in section HI). In this configuration, the hybrid product, which must form via inversion, is the least favored of all outcomes, while the coding joint (a “standard deletion”) is most favored. Thus the observed configuration D (rather than the A or B type) should reduce the hybrid/standard ratio to its minimum, according to results with the plasmid assay. The implications of an intrinsic joining hierarchy are discussed further in Section VII, I. The key question, not yet touched on, however, is how frequently hybrid joints are actually formed in the completely physiological context. Is it possible that the only deterrent in the system is locus organization (and the joining hierarchy), or is there evidence of other forces that decrease the likelihood of the hybrid outcome? Only a handful of studies have attempted to detect endogenously formed hybrid joints (VanDyk and Meek, 1992; Carroll et al. 1993a,b; Sollbach and Wu, personal communication). The most relevant here are those directed at an analysis of D-to-J recombination at the IgH locus (VanDyk and Meek, 1992). At the IgH locus, D-to-J recombination (ignoring, for the time being, the signal 5‘ to the D segment) is formally equivalent to the joining signal configuration “D” shown in Fig. 9. Thus, standard DJ coding joints form by deletion, and the corresponding hybrid joints by inversion. These two outcomes were detected by PCR amplification, and the relative frequency was estimated by limiting dilution analyses. Hybrid inversion was found to occur at no fewer than 1 per 1000 standard D-to-J deletions (VanDyk and Meek, 1992; K. Meek, personal communication). By the extrachromosomal assay, D-type substrates yielded 1 hybrid inversion per 550 standard deletion products
V( D)J J 0 I N I K C;
109
(Lewis et d., 1988, and unpublished observations). Thus, according to these preliminary comparisons, there seems to be a reasonably good correspondence between the extrachromosomal substrate results and the situation in an actual mouse. What this indicates is that, with regard to hybrid joint formation, for the joining signal configuration (D) that is present at most loci, configuration alone is significant in driving the V(D)J joining reaction toward a functional product. A second type of nonstandard product, termed an open-and-shut joint, has also been demonstrated (Lewis et a!., 1988).As with hybrid joints, their impact on the joining process will only begin to be understood after their frequency is characterized in defined experimental systems and this is compared to what is observed physiologically. Open-and-shut junctions are difficult to quantify, either as endogenously generated products or with introduced substrates, because their only distinguishing feature is that they contain small base additions and deletions at the coding/signal border: they are not products of any gross rearrangement. When measured with specially designed extrachromosomal substrates and screening procedures, open-andshut junctions were found to occur at 1% of the frequency of standard junctions (Lewis and Hesse, 1991). Given their rarity in the extrachromosomal assay, and given that such junctions, as nonrecombinants, are “invisible” in most analyses of physiological junctions, it is remarkable that a number of cases of endogenous open-and-shut junctions have nonetheless surfaced. The physiological occurrence of opening and shutting has not yet been quantified, but preliminary indications are that opening and shutting may be reasonably frequent during antigen receptor gene rearrangement in oiuo. Most of the open-and-shut junctions characterized to date were revealed upon analysis ofthe unrearranged 5‘joining signals o f D elements that had become recombined at their 3’ borders. One example involved the unrearranged S‘ signal of a TCR D61 segment which had become joined at its 3‘ side to J S l (Elliott et al., 1988). Another 7 junctions have been isolated from thymocytes, all involving unrearranged 5’ signals of D62 in D-to-J61 recombinants (Fish and Bosma, 1994). Some possible examples of opening and shutting at partially rearranged DD junctions at TCRG have also been reported (Carroll et at., 1993b). Additionally two DNA sequences derived from completely unrearranged PCK-amplified V a gene segments niay also represent open-and-shut events (Roth et al., 1988,1989). Several similiarly unrearranged examples from the TCRG locus have also been obtained (Fish and Bosma, 1994). A particularly provocative observation was that the 7 open-and-shut joints in the D62-toJ61 collection of
110
SUSANNA M. LEWIS
Fish and Bosma were discovered on randomly sequencing only 37 Dto-J junctions (Fish and Bosma, 1994). This is obviously much higher than the 1% frequency of opening and shutting measured with plasmid substrates . Several possibilities suggest themselves (more than one of which may pertain): one is that opening and shutting is much more frequent in the physiological situation than is indicated by the plasmid assay results; another is that the joining machinery might be somewhat processive, accounting for a high frequency of open-and-shut junctions adjacent to nearby DJ junctions (a possibility that has not yet been explored with plasmid substrates); and a third is that some feature peculiar to the TCRS locus may lead to elevated levels of this type of event. Whatever the root cause, it is clear that open-and-shut products are prevalent in at least in one context (and may increase in an agedependent fashion) (Fish and Bosma, 1994). It is thus conceivable that opening and shutting may influence the ultimate success of the in uiuo V(D)J joining operation. One possibility is that opening and shutting results from abortive recombination attempts and that the ability to open and shut contributes in a positive way to joining fidelity. Because of the considerable variation in target site sequence that is accommodated by the V(D)J joining machinery, it might in fact be helpful to be able to discontinue interactions involving inappropriate targets at the strand-exchange step. With this capability, errors in target recognition, which cannot be stringently avoided, still fail to result in recombination; by returning all elements to the starting configuration, the potential for aberrant translocation is neutralized. There is some experimental support, albeit still incomplete, for this notion. One relevant observation is that the ratio of opening and shutting-to-recombination was increased in a substrate where two 23spacer signals were inappropriately paired (see Lewis and Hesse, 1991, for further discussion). In another study, opening and shutting at a canonical signal was only detected when it was paired with a mutant signal (Hendrickson et al., 1991a). However, the latter result, obtained with retroviral constructs, is in conflict with observations with the plasmid assay, where open-and-shut events at a canonical joining signal are observed in the absence of any partner signal whatsoever (Lewis and Hesse, 1991). This discrepency highlights some of the basic questions that need to be answered before open-and-shut results are fully interpretable. Although it has been established that at least some opening and shutting is the result of a two-signal transaction (the evidence is discussed in detail in Lewis and Hesse, 1991), whether there may be “hidden” partners, in the form of fortuitous
V(D)J JOINING
111
signal-like sequences that interact with canonical signals to induce apparent “single” open-and-shut events, is unresolved. That is, it is not known whether opening and shutting can take place in the complete absence of a signal-signal interaction (discussed further in section IX, below). In terms of joining fidelity, opening and shutting, whether it comes about as either a one-signal or a two-signal transaction, may play a corrective role. The decisive experiment, however, is to demonstrate that, for certain noncanonical target sites, opening and shutting occurs more frequently than rearrangement. Otherwise, one must suppose that opening and shutting is simply evidence of a failed recombination attempt, without necessarily playing a role in reducing the overall number of recombination errors.
I. AN ENIGMA: THECASEFOR A “3’D SIGNALRULE” One regularity in V(D)J joining has not been well explained by any of the factors discussed to this point. Inversional D-to-J recombination at the Ig heavy-chain locus (which should arise any time the signal at the 5’ side of D is targeted in a D-to-J joining event) is rarely seen in B lymphocytes (Wood and Tonegawa, 1983; Meek et at., 1989; Schlissel et al., 1991; VanDyk and Meek, 1992; Sollbach and Wu, personal communication). This observation raises two very general questions: Why should this be so and how does this discrimination come about? As discussed earlier, there is little evidence for a mechanistic prohibition against inversion per se in V(D)J recombination (Lewiset al., 1982, 1984; Hesse et al., 1987; Gauss and Lieber, 1992), yet an accounting of all of the expected D-to-J joining products at the IgH locus indicates that in this particular context, the outcome has been restricted (VanDyk and Meek, 1992). In a nutshell, four types of recombinant are possible upon D-to-J joining at the IgH locus (Fig. 11, top), because this locus is a combination of both B and D signal configuration (Fig. 9). On the basis of plasmid studies (with idealized joining signals), all four ought to be detected (Fig. 9). If expectations are somewhat refined, based on the intrinsic joining hierarchy discussed in the previous section, then the relative proportions of products ought to be standard deletion > standard inversion > hybrid deletion > hybrid inversion (Fig. 9). However, not only is standard DH-to-JHinversion rare at the heavy-chain locus, but hybrid inversions (the least-prevalent product in the plasmid assay; Lewis et al., 1988) are detected more readily than hybrid deletions (Meek et al., 1989; VanDyk and Meek, 1992). It should be noted that the comparison between various endogenous recombination products was carried out through an analysis of incompletely rearranged alleles (VanDyk and Meek, 1992), thus reducing
112
SUSANNA M. LEWIS
STANDA R D
5:.......3‘ ..__._..
HYBRID
......_. .
. .
;@-+-
..___...
deletion
..__...‘ deletion
inversion
inversion
Observed IgH locus
NO
YES
NO
YES
substrates
YES
YES
YES
YES
Predicted on the basis of Dp trx
NO
YES
YES
NO
deletion only
NO
YES
YES
NO
3’ preferance
NO
YES
NO
YES
FIG.11. Two gene segments at the IgH locus (circled) could hypothetically interact in one of four possible ways. Shown are the standard (left) and hybrid (right) outcomes, each ofwhich can arise from an interaction between the 23-signal of the J segment and the 12-signal located either 5‘ or 3‘ of D. For discussion, see text.
the possibility that the observed pattern might have been created by cellular selection after the assembly and display of a complete IgH molecule. As to why this strange bias should exist, there is no obvious relationship between the observed products and those that might be biologically “useful.” In principle, both a standard D-to-J inversion and a standard D-to-J deletion accomplish much the same thing. In each case a short stretch of coding sequence is appended to J, and the product coding joint has the appropriate 12-signal needed for subsequent V-to-DJ joining (Fig. 11, left). Once V-to-DJ joining has taken place, all gross structural differences between a chromosome that underwent an intermediate inversion and one that recombined deletively have been erased; the only remaining difference is in the orientation of the interstitial D sequences (usually involving fewer than 20 base pairs). It is hard to imagine that a bias against inversion exists to prevent “backward” D’s in a hypervariable region of the gene. The
V(D)J JOINING
113
hybrid joint observations are even harder to understand: as is argued above, the presence of any hybrid junction allows the 12/23 rule to be bypassed in the formation of unproductive joints (Fig. lo), yet hybrid deletions appear to be significantly more disfavored than hybrid inversions in uiuo. Curiously as measured in two independent studies, hybrid inversions appear to be detected more readily even than the standard coding joint inversion (VanDyk and Meek, 1992; Sollbach and Wu, personal communication; Fig. 11). To explain the observed pattern of D-to-J products in the endogenous context, one might naturally first suspect that some structural/ functional feature of the product is being “sensed” in uiuo. Whatever this putative feature may be, it is specific either to the actual D and J sequences found at the heavy-chain locus or to the physiological context itself, because the pattern is not recreated with idealized joining substrates (as cited above, and Gauss and Lieber, 1992). Some possibilities are shown in Fig. 11. First, although inversion is not prohibited on a mechanistic level, some ability to distinguish between inverted and deleted chromosomal sequences might be considered. As shown, in fact, this possibility cannot account for the observed pattern: inversion, not deletion is favored in the case of endogenous hybrid recombination (VanDyk and Meek, 1992) (Fig. 11). A second possibility is that activation of transcriptional promoters found 5‘ to D segments as they are brought into the vicinity of the heavy-chain enhancer (see Fig. 11)somehow forms the basis of the observed selectivity. Either the transcripts themselves or the production of a truncated C-p-containing peptide might be the determining feature (Reth and Alt, 1984). However, the promotor 5‘ to D is brought into an equivalent position by both standard and hybrid deletion, so that, on the face of it, promoter activation cannot explain the scarcity of the latter. A third possibility is that neither the structure nor the function of the recombination product is critical, but instead there is some discrimination between 5‘ and 3‘joining signals at the time of D-toJ recombination (Schlissel et al., 1991; Gauss and Lieber, 1992; VanDyk and Meek, 1992; Sollbach and Wu, personal communication). Without speculating for the moment as to the mechanism of the purported 5‘-3‘ signal discrimination, one can appreciate that this rule, rather than a structure/function selection, not only explains the observed pattern of D-to-J joining (Fig. l l ) , but also may suggest the reason why this pattern exists. The organization of the IgH locus presents unique problems (Fig. 12). D-to-J joining at the heavy-chain locus causes, in effect, a “signal replacement” very like hybrid joint formation. Once a D-to-J joining has occixred (Fig. 12, top), the 23-
114
SUSANNA M. LEWIS
Ict ~
D-to-J recombination
I
&
I ':------I I
V-to-DJ
DJ-to-J I
I I
p J -
I I
!
(UNDESIRABLE)
FIG.12. At the IgH locus, standard, deletiona1, coding joint formation amounts to a signal-replacement event. Theoretically, it should be possible for DJ-to-Jjoining to occur, although this is rarely observed (e.g.,Alt and Baltimore, 1982; Wang and Rosenberg, 1983).
signal to the 5' side of J is replaced by a short, variable stretch of D coding sequence and a 12-spacer signal (Fig. 12, second line). With four IgH J segments close to one another and presumably all accessible throughout the period of heavy-chain gene rearrangement, nonproductive DJ-to-J inversion would seem a particularly favored possibility (Fig. 12, bottom). A blanket prohibition against the use of the 5' signal in any type of D-to-J rearrangement, however, solves this problem. The rarity of D-to-J coding joint inversion, as well as hybrid joint deletion relative to other outcomes (Fig. 11)may only be an incidental consequence of a mechanism that is in place principally to avoid the hazards of J-J joining. Figure 13illustrates, in flowchart form, how three suggested features of the joining process (the 12/23 rule, the joining hierarchy, and the 3' D signal rule) are theoretically sufficient to constrain the outcome of rearrangement in favor of VDJ formation at IgH. Initially, at the first stage of heavy-chain gene assembly (Fig. 13), one presumably need consider only D and J gene segment interactions because V gene recombination has not yet been activated [the regulated, step wise features of V(D)J joining are reviewed by, Blackwell and Alt, 1989;
l&-l---l-Ft-W&3
115
3 RULE
V
V
O
D
J
J
STAGE 1 (D-to-J)
STAGE 2 (V-to-DJ)
(continue...)
FUNCTIONAL GENE
FIG.13. Rules refining the V(D)Jjoining outcome, as illustrated for the IgH locus (see text for discussion).
Schatz et al., 19921. With regard to all possible outcomes, D-to-D and J-to-J joining (whether hybrid or standard) are precluded by the 121 23 rule (Fig. 13). Of the four possible D-to-J joining options (shown in Fig. l l ) , standard inversion and hybrid deletion fall to the 3’ D signal rule. The allowed transaction then is between the 3’ D signal and a J signal (shown by a heavy line, “stage 1,” Fig. 13); of the two possible outcomes for this combination, standard deletion will dominate hybrid D-to-J inversion for the straightforward mechanical reasons implicit in the joining hierarchy (Fig. 9). Thus given the three constraints (the 12/23 rule, the 3‘ D signal rule, and the intrinsicjoining hierarchy) the manifold possibilities reduce to the production of the desired, standard, DJ coding joint. At the “price” of eliminating the DJ inversional outcome (which type of coding joint might equally serve as a recombination intermediate), a number of deleterious events are suppressed. At the next stage of Ig heavy-chain gene assembly, one needs to consider how to prevent the newly created possibility of DJ-to-J recombination (a bad thing) from occurring, as well as how to target V gene
116
SUSANNA M. LEWIS
rearrangement to the preassembled DJ junction (a good thing). It is not known how the latter is ensured, nor even to what extent, exactly, V-to-unrearranged D joining is actively prevented in normal cells (VanDyk and Meek, 1992; Shin et al., 1993),although this type ofrecombination is rare in A-MuLV transformants (Alt et al., 1984; Schlissel et al., 1991). The question marks in Fig. 13 must serve as placeholders for the issue of V-to-D interactions, because indeed little has even been hypothesized to date about how the recombination machinery might single out the 5’ signal of a rearranged DJ junction in V-to-DJ joining. The same 3’ preference rule active in stage 1,however, could block the DJ-to-J outcome. Thus the possibilities are narrowed to interactions of a 3‘ D signal with a 5‘ J (a successive joining event that “leapfrogs” the original DJ junction) or to a stage 2 interaction of a V signal with the 5’ signal of the DJ junction (heavy lines, Fig. 13).(It is not known whether both possibilities coexist in the same cell, despite suggestive evidence from A-MuLV-transformed cell lines; Reth et al., 1986a; Oka et al., 1990.) In either case, according to the joining hierarchy the hybrid type outcome of these interactions is inversional (light arrows), and thus not favored, instead leaving the coding joint (formed by a standard deletion) as the most probable outcome. If the recombination at this step has been D-to-J, then a stage 2 V-to-DJ trial is still possible; if instead V-to-DJ joining has occurred, then there remain no further options (except perhaps a rare V gene replacement), and the assembly process is complete. T h e 3’ D signal preference rule may be particularly valuable at the IgH locus rather than TCRP and 6 where, due to joining signal configuration, many detrimental recombination events are barred by the 12/23 rule. In fact, however, a 3’ D signal rule may explain restricted joining patterns at the other three-segment loci as well. For example, at the TCRP locus (see Fig. l),D-to-D joining (which would require the use of both 3’ and 5’joining signals, and would follow the 12/23 rule) does not normally take place (Bogue et al., 1991; Feeney, 1991a; George and Schroeder, 1992). This is odd because both D’s must be accessible: recombination of either D into the downstream J cluster is observed (Born et at., 1985;Kronenberg et al., 1985).Further, excision products caused by pseudo-normal joining between the downstream 3’ D signal and an upstream J signal are detected, as are signal joints arising on recombination between a V segment and a 5’ D signal, whereas no excision products related to DP-DP joining are observed (Okazaki et al., 1987).At TCRG, D-D joining is rare in fetal lymphocytes (Chien et al., 1987b; Elliott et al., 1988). These restrictions at TCRG and TCRP loci also imply a 3’ D signal rule, such that, as at IgH, the
V(D)J JOINING
117
5‘ D signal is not readily used in recombination with any element other than V (VanDyk and Meek, 1992). In the case of TCRG and TCRP, there are hints that the 3’ D signal preference is a regulated phenomenon, because D-D joining is observed in adult thymocytes at TCRG (Elliott et al., 1988)and because exceptional D-to-D junctions
at TCRp can readily be detected in TCRa-negative transgenic mice (Mallick et ul., 1993). Two points must be emphasized about the putative 3’ D signal rule. One is that ifthe underlying molecular basis for this rule is the regional modulation of chromatin accessibility, this must be a punctuated accessibility, and the boundaries between the inaccessible and accessible domains (5’ us 3‘ of D) must be extremely sharply defined throughout the D cluster. The other is that if we may fairly generalize to all of the three-segment loci (to include TCRP and TCRG), the observation that the 3‘ D signal preference to be conditional (see above) suggests that it is not solely the result of sequence effects at 5’ uersus 3’ recombination sites. How might a 3‘ D Fignal rule be established in uiuo? To begin, the plasmid assay has provided some clues. If, instead of canonical sequences, actual D, segments and their signals are tested in extrachromosomal substrates, differences in joining frequencies between the 5’ and 3’ sides have emerged (Gauss and Lieber, 1992). Only a small number of D segments have been analyzed in this fashion; but, if all D segments likewise possess “poor” 5‘ recombination sites and “good” 3’ recombination sites, this can at least partially explain the in uivo D-to-J recornbination patterns (Gauss and Lieber, 1992; Gerstein and Lieber, 1993a). However, one indication that target site sequence is not the complete story is that deletion/inversion biases measured with plasmid substrate were at most 28: 1 (Gauss and Lieber, 1992). These modest differences fall short of reconstructing the degree of the bias observed among endogenously generated D-to-J junctions, where deletion may be favored by as much as 1000:1 ( M e e k et ul., 1989; K. Meek, personal communication; Sollbach and Wu, personal communication). Possibly, the extrachromosomal assay, while revealing relative differences between inversion and deletion, is unable to reflect the magnitude of the effect. (Imaginably, the extrachromosomal system “saturates” at some level, even though there has been little evidence of a consistent limitation in the past.) Another possibility is that there is an additional undiscovered mechanism at work. The recombination pattern at the heavy-chain locus has alternatively been interpreted to mean that when it comes to a choice between the 5’ and 3‘ joining signals o f a D segment in DJ joining, the 3’joining
118
SUSANNA M . LEWIS
signal somehow prevails because of its physical location (VanDyk and Meek, 1992). One suggestion is that the choice is made on the basis of a signal’s position (or orientation) relative to conserved promoterlike elements that lie 5’ to D (VanDyk and Meek, 1992). In favor of the idea that the 5’ or 3’ choice is positional or regulated, rather than sequence directed, is that this choice does not apply across the board to all recombination events involving D,. Rare V-to-D joining events, where a completely unrearranged D has been targeted (and thus presents both 5’ and 3’joining signals to the recombination machinery), do not show a similar bias of one signal over another (VanDyk and Meek, 1992). Whatever the basis of the discrimination, the fact that two signals, separated by only 10-22 base pairs, can be consistently distinguished at the level of D-to-JHrecombination in vivo is one of the more amazing feats of the recombination process; if targeting is involved, it occurs with surgical precision, if a structural or functional feature of the Dto-J recombination product is selected (either intracellulary or by extracellular forces), the basis of this is completely mysterious. No fully formulated proposal has been ventured, and accessibility arguments clearly must be refined far beyond those previously postulated for lineage-, locus-, or gene family-specific recombination patterns. There is the possibility that the 3’ D signal rule and the specificity of V-toDJ (over V-to-unrearranged D) joining are phenomena with a common mechanistic basis, and/or that perhaps V( D)J recombination silencers (Lauster et al., 1993) in addition to enhancers play a role. The problem drops fairly cleanly into the canyon between in vivo studies and those with simplified plasmid substrates, and a fair guess is that further elucidation will almost certainly require analyses based on “minilocus” transgenic substrates (Bruggemann et al., 1991; Tuaillon et al., 1993; Lauzurica and Krangel, 1994). J. SUMMARY
To summarize, four key features of the joining mechanism have an impact on the biological success of V(D)J joining. One is the 12/23 rule, another (incompletely characterized) is the vicinity constraint, a third is the mechanism’s ability to recognize a range of target sites, and a fourth is the nonobligatory and variable reciprocity of the strand exchanges, leading to the joining hierarchy favoring of standard deletion over all other outcomes. These intrinsic mechanistic contraints, however, represent only one side of the equation. The other is locus structure and how the endogenous substrate has been modeled to take advantage of built-in biases. Some ideas of how substrate structure
V(D)j JOINING
119
and joining mechanics interact to achieve the desired outcome have been reviewed above (Fig. 13); these considerations lead onward to the very intriguing parts of the story that remain undeciphered. One is the clear limitation in the products of D-to-J recombination at the heavy-chain locus; the 3’ D signal rule suggested by this limitation (VanDyk and Meek, 1992) can be generalized to all of the threesegment loci, but the basis is unknown. Other, conceptually simpler patterns also have no explanation as yet, such as the apparent ban on intercluster recombination (Fig. 1) or the directive that ensures that V gene segments will connect only to rearranged D’s. V111. Fidelity and Pathogenesis
Any process that induces gross chromosomal rearrangements has the potential to disorganize the genome in a detrimental fashion. It was early recognized that the V(D)J joining system might play a role in some T and B cell malignancies (for reviews see Tycko and Sklar, 1990; Reis et al., 1991; Korsmeyer, 1992; Lieber, 1993). Although by now this is a well-established observation, the precise nature of the joining error or errors is still not fully understood. One particularly useful insight was that the V(D)Jjoining machinery might be involved to a variable extent in potentiating oncogenic genome rearrangements (Boehm and Rabbitts, 1989; Tycko and Sklar, 1990). In broad terms, two different scenarios may be relevant. The contribution of the V( D)J joining machinery to chromosomal translocation might be limited to the donation of a site-specifically broken end (Bakhshi et al., 1987) or the V(D)Jjoining machinery might orchestrate the entire event (Aplan et al., 1990; Brown et al., 1990). The “error” involved is qualitatively quite different; in the first case, it might amount to the premature release of cleaved ends, in the second, to the faulty recognition of recombination targets. Some basic questions about the V(D)J joining operation need answers before these and other possibilities can be evaluated. Of key importance is the question of whether the V(D)J joining machinery is able to carry out interchromosomal recombination events (section VII1,F). A second question is how many cryptic joining targets exist in the genome and how frequently these are recognized. A third is how readily (if at all) the joining operation can donate free ends to other DNA metabolic pathways. Underlying the latter question is whether the V(D)J joining process is actually distinct from “other” nonspecific repair pathways. The state of the field with regard to these three issues is summarized below.
120
SUSANNA M. LEWIS
Considering first the question of interchromosomal recombination, even in the absence of a mechanistic barrier to intermolecular recombination, recombination between unlinked sequences might be effectively prohibited by a requirement for proximity. In the most general sense one needs to know how far apart two sites can be and still be able to rearrange in a V(D)Jjoining reaction. It has been established with certainty that gene segments known to have been originally located on separate chromosomes can be found in a site-specifically joined conformation (Tycko et al., 1991; Aster and Sklar, 1992). However, the data available at present are not enlightening as to whether the interchromosomal connection was accomplished by the V(D)J joining machinery (Fig. 14, top) or a nonspecific translocation event (Fig. 14, bottom). Where observed, interchromosomal V(D)J recombination events may have taken place subsequent to a nonspecific translocation: the particulars of the signal configuration following nonspecific translocation would determine whether signal and/or coding joints could then form in an intramolecular V(D)J joining event (Fig. 14, bottom). Elevated levels of interchromosomal V(D)J joining have been observed in agricultural workers and in cells derived from patients with Ataxia telangiectasia (Lipkowitz et aZ., 1990, 1992; Kobayashi et al., 1991). This observation is consistent with the possibility that nonspecific translocation is rate limiting and that induction of such events by chemical exposure or genetic predisposition secondarily increased interchromosomal V(D)J joining. The Aster and Sklar study described in section VII (Aster and Sklar, 1992) set an upper limit on the frequency of apparent interchromosomal V(D)J joining that highlighted the rarity of such events. However, to a large extent, an understanding of how V(D)J joining errors come about hinges on the possibility of trans recombination. For example, if V(D)J joining does not occur between unlinked (or otherwise well-separated sites) this could mean that a nonspecific translocation event is absolutely required to bring cryptic sites into the neighborhood of a rearranging locus, and perhaps also to “open” a normally inactive region at the outset. The nonspecific translocation is then to be regarded as the key event setting a course toward the development of the tumor. If instead V(D)J joining actually can occur between chromosomes, the focus is shifted to a determination of why and how an inappropriate target site was recognized. Does the cryptic site lie within a transcribed region? Is it physically located near the active locus within the nucleus? Are there context effects that make this DNA sequence especially recombination prone? Can trans V(D)J joining be induced? The big question mark regarding interchromosomal joining represents a major roadblock and is a nontrivial prob-
121
V(D)J JOINING
* -
Translocation mediated directly by V(D)J joining
mdmg Job”’
@
%
A
Y
S l g n a l JO,”,
.. n
No segregation (chimeric junctions)
-
-
Translocation by non-specific mechansims, followed by intermolecular V(D)J joining:
”
J J
P U
c
P No segregaiion (chimeric junctions)
1
u
0
D
+=:
Coding Joint (chimeric)
FIG.14. Predictions following two different types ofparticipation ofthe V(D)Jjoining machinery in translocation. T h e box shows the consequences of a direct mediation of the translocation event oia V(D)J recombination (an “interlocus” recombination involving authentic joining sites is shown). Below are indicated the products that could be formed bv V(D)J recombination as a secondary event. Depending on the configuration of the interacting signals following translocation, a coding joint, a signal joint, or both might be formed. The detection of “chimeric” junctions, either singly or as reciprocal pairs, does not uniquely distinguish between the two models. The only definitive prediction is that if translocation were to be catalyzed by the joining machinery as a first event, it should b e possible to demonstrate the existence o f a reciprocal pair of products in a single cell, in which the signal joint and the coding joint are located on different chromosomes.
lem to address; conceivably, studies of transgenic animals bearing defined recombination substrates on different chromosomes may provide an answer. The challenge will be to extend the findings of earlier work to a single-cell analysis (Aster and Sklar, 1992). It is only at the single-cell level that the different predictions for cis and trans V(D)J joining can be tested (see legend to Fig. 14). The second question is whether cryptic sites are targeted in the physiological context and, if so, how many such sites exist. Initially, the idea that cryptic site recombination by the V(D)Jjoining machinery
122
SUSANNA M. LEWIS
was significant in oncogenesis was met with some skepticism, because early examples ofputative recognition mistakes presented fairly unconvincing similarities to joining signals, and often the product junctions departed in a significant way from the structures expected of the V(D)J joining machinery (discussed in Tycko and Sklar, 1990). Nevertheless, examples of signal joints involving the characteristic “precise” connection between a consensus joining signal and a signal-like element have been provided (e.g., Hochtl and Zachau, 1983; Boehm et al., 1988), and, reproducible, site-specific rearrangements of cryptic (non V-,D-, or J-associated) targets have been observed (Aplan et al., 1990; Brown et al., 1990; Fuscoe et al., 1991). These latter junctions were found, collectively, to display all the established features of coding joints (limited base loss/addition, N regions, as well as P nucleotide addition, see section V). Of critical importance, in each case it was possible to show that the recombination sites were localized at (but never interior to) signal-like elements in unrearranged DNA. Moreover, the cryptic signals identified in these studies all contained residues (“CAC”) shown to be essential in functional assays (Hesse et al., 1989). These convincing examples of cryptic site recognition come from two lines of investigation: one of the tall gene, implicated in T cell leukemia (variably designed SCL or TCL5 by different groups) the other of naturally occurring mutations in the hprt locus (Aplan et al., 1990; Brown et al., 1990; Bernard et al., 1991; Fuscoe et al., 1991, 1992; Breit et al., 1993). In each case rearrangement between two cryptic sites created a deletion: either removing about 90 kb of sequence 5‘ to the tall gene (connecting it to a second locus, s i l ) or about 20 kb of the hprt transcription unit. Notably, in each instance, not one but several cryptic signals were found (Aplan et al., 1990; Brown et al., 1990; Bernard et al., 1991). Cryptic signals that have been discovered in rearranged form more than once are listed in Table 111 (additional examples that exist as unique cases are not shown; see Fuscoe et al., 1991; Breit et al., 1993). Cryptic signals that were targeted repeatedly in these events (for example, the sites designated “sil-1” and “hprt-1”) match the consensus joining signal sequence at fewer than 9 of 16 positions (see Table 111). Thus the hprt and tall gene rearrangements highlight two important features of cryptic sites: first, that, where conditions favor their discovery, it is possible to detect numerous cryptic sites in a region, and second, that a cryptic site can diverge from the consensus signal quite radically. The hprt and tall gene deletions established the validity of the notion that mistakes in target recognition by the V(D)J recombination
123
V(D)JJOINING
TABLE I11 CRYPTIC SITES( t a l l , sil, hprt, loci) Site Consensus
sil-1 tal-dl
tal-d2 hprt-1 hprt-3A hprt-3B
****
**
CA CACTC----I2/23--ACAA A A A CC m T C S - - - - 1 2 - - - - GCATCACTT ----23---- TCT TTCAAC CACACCC----12---- GTATATTGC ----23---- T A A C C M A A C ACAGAG----lZ---- GCC A A A A CT ----23---- C ACT A A CCC CACTCTA----12---- GCAGATGCT ----23---- TGGCCT C A T CACACAC----12---- ACAAATACA ----23---- TATGTGTTT CACAGAG----12---- A C M T A T T C ----23---- AATA A A AA A
All“
(*I”
A-Tract“
16 7 6
6 4 4 4 6 6 4 3 3
5 2 1 2 3 4 2 2
8 8 12 9 8 5 11 4 11 11
5 4 5
6
0 4 0 3 4
Note. See citations for original designations of sites; sil-1 and tal-d 1.2 sites are froni Aplan et al. (1Y90): Brown et (11. (1990); Bernard et a!. (1Y‘JI) and hprt; 3A, B are from Fuscor et ol. (1991) (hprt-l and hprt-3A. B). For each site the sequence of the “heptamer” and “noiiamer” is shown assuming a spacer of either 12 or 23 bp. All sites were identified on the basis of repeated observation of “coding joints”. The sil-1 site was found joined to elther tal-dl or tal-d2 sites, likewise hprt-1 was found joined to hprt-3a and hprt3b sites. It is not known which signal served as the 12signal and which as the 23-signal i n any of these transactions. Additional sites identified on the basis o f a single codingjoint exist, but are not listed (see text). Asterisks indicate residues determined to be the most important for target site function according to Hesse et ul. (1989). Underlining: residues that match the canonical signal in each criyptic site.
machinery are physiologically relevant. However, beyond an appreciation ofthe possibility that many cryptic sites might exist in the genome, it is difficult to guess the total number based on those data. Another way to approach the problem is to count the number of cryptic sites that fortuitously exist within a defined plasmid substrate. This type of analysis indicated that there was at least one site per 500 base pairs (S. Lewis, unpublished). This is a surprising number. Clearly, without any means of reducing the fraction ofthe genome available for recombination, this should be a crushing load and ought seriously to interfere with the ability of the recombination machinery to locate authentic targets. It remains to be established whether some critical features such as transcription determines which cryptic sites are potential targets for V(D)Jjoining mistakes in a rearranging cell. Analyses of the transcrip-
124
SUSANNA hl. LEWIS
tion patterns of involved regions in hprt and tall deletions provide some information, though limited. One problem is that a certain amount of guesswork is involved in extrapolating backward to the cell in which the aberrant rearrangement originally took place. The tall gene deletions are found in T cell acute lymphoblastic leukemias arid are strongly correlated with TCRG locus deletion, as well as with surface expression of an alp antigen receptor in some tumors (Machtyre et al., 1992; Breit et al., 1993). This suggests that the tall deletion may be temporally associated with the TCRG deletions that accumulate during normal differentiation of the alp sublineage of T cells (Macintyre et al., 1992; Breit et al., 1993). Expression of the tall gene itself is not typical of cells in the T lineage and is not detected in normal mature T cells (Begley et al., 1989a; Bernard et al., 1990). Only very weak expression has been observed in unfractionated (immature) thymocytes (Begley et al., 1989b; Mouthon et al., 1993).The 5’ breakpoint of the tall deletion lies within a second gene, sil, which is expressed in a variety of hematopoetic cells and tissues (Aplan et al., 1991).Thus, during T cell differentiation, the sil cryptic site is likely located within a transcribed region; but whether sites in the tall locus are likewise being transcribed, even in a relevant subset of progenitor cells, is not clear. Similarly the hprt observations provide no decisive argument for or against a role for transcription. The intragenic deletions are detected in circulating T cells: because the hprt is a “housekeeping” function and is transcribed both in lymphocytes and in proliferating cells in general (Steen et al., 1990),it seems likely that it is expressed at the time that cryptic sites are targeted by the V(D)J joining machinery during T cell differentiation (Fuscoe et at., 1991).It is worth noting, however, that the rate of hprt transcription during T cell development is not known and the steady-state levels of expression in mature lymphocytes are quite low. In human T cells, there are at best fewer than about 6-10 RNA molecules per cell (Steen et al., 1990). In sum, while one can make a case for a transcription requirement in the physiological targeting of a cryptic site (Bernard et al., 1990; Fuscoe et al., 1991; Macintyre et al., 1992; Breit et al., 1993 and cited therein), there are some indications that the requirement either is not absolute or may be different than that in normal V(D)J recombination. A determination of the actual frequency of V(D)J joining mistakes in vivo awaits further study. It may be most rewarding to focus on the hprt gene rearrangements in the future. T cells bearing site-specific hprt gene rearrangement have been quantified in both fetal and adult samples and were found at a level of about 2-4 per lo7normal lymphocytes (Fuscoe et al., 1991, 1992). Spontaneous mutations can accumu-
V(D)j I O I N I N C
125
late within this nonessential purine salvage enzyme in normal lymphocyte populations, and, although it is difficult to know whether the effects of mutation are absolutely neutral, there is certainly no evidence ofthe strong positive selections that exist for oncogenic transformation. The near-neutral effects of mutation, coupled with the fact that very low-level events can be detected through in vitro selection for resistance to purine analogs, make the hprt locus the most tractable system described to date for getting at some of the basic questions surrounding the interaction between the V( D)J joining machinery and chromosomally located cryptic sites. The final question involves the possibility that the V(D)J joining machinery can contribute to lymphoma not through cryptic site recognition, but rather by a process here designated as “end-donation” (Fig. 13). It has been suggested that the joining apparatus creates strand breaks at authentic sites which are then connected to DNA that has been broken through some unrelated process (Bakhshi et ul., 1987). AS distinguished from rearrangements brought about by cryptic site recognition, the term “end-donation” is meant to imply that the V(D)J joining machinery might be only partially involved in the formation of certain translocation junctions (reviewed in Boehm and Rabbitts, 1989; Tycko and Sklar, 1990), without making any assumptions as to the extent of the involvement. In follicular lymphomas, there are numerous examples of translocations between the bcl-2 region and the IgH locus, in which site-specifically connected J H gene segments have become recombined with DNA that bears little resemblance to a cryptic signal in the gerinline context (Bakhshi et al., 1987; Limpens et al., 1991;Wyatt et al., 1992). Positive evidence that the V(D)Jjoining machinery is not fully responsible for these and other such recombinants exists as well. As first described by Bakhshi et al. (1987), some examples of reciprocal translocation products have been provided. Comparison of products to precursors indicated that a short (3 to 20 bp) repeat of the non-V(D)J-containing chromosome existed at the crossover site in both recombinants (Bakhshi et al., 1987; Neri et al., 1988; Lu et al., 1991). Such repeats are typically taken to indicate the fill-in of a staggered break (reviewed in Tycko and Sklar, 1990). Similar evidence of staggered breaks exists in cases oftranslocations that show no evidence of involvement of the V(D)J joining machinery (Bakhshi et al., 1987 and cited therein). By contrast, repeats of DNA sequence are not found on isolation of reciprocal coding and signal joints, nor has there been any other evidence to suggest that staggered breaks are normally created during V(D)J joining (see section V,B). Putting all of these observations together, it is likely that the V(D)J joining
126
SUSANNA M. LEWIS
machinery has a definite, but partial, involvement in many translocations (Bakhshi et al., 1987). T h e end-donation class of event may contribute significantly to neoplastic transformation in lymphoid lineages (Boehm and Rabbitts, 1989; Korsmeyer, 1992). In some circumstances both types of V(D)J joining error are together evident. Oncogenic activation of the tall gene is apparently achieved not only by cryptic site recognition (resulting in fusion to an upstream transcription unit), but also as a consequence of translocation into the TCRG locus by an end-donation type of event (Begley et al., 1989a; Finger et al., 1989). Because it remains possible that the V(D)Jjoining machinery simply cannot catalyze interchromosomal recombination on its own, it may be that end-donation (rather than the interchromosomal targeting of joining signals) is the only significant way that V(D)J joining contributes to chromosomal translocations. End-donation errors are frequent enough that about half of all tonsillectomy specimens have some cells (about 1 in 10’) with this class of rearrangement (in particular a nononcogenic bcl-1 I JH joining; Limpens et al., 1991; Aster and Sklar, 1992). It will be of interest to determine exactly how end-donation comes about, because several distinct routes can be envisioned. For example, at a low frequency, the V(D)J joining machinery might release sitespecifically cleaved ends. On this view, there may be a connection between end donation and the open-and-shut reactions described earlier (section VII); end-donation might constitute a failure in the “shut” part of the event. Alternatively, site-specifically cleaved ends may simply be available, without in any way having been “released,” during the normal course of a V(D)J joining event. Whether the V(D)J joining machinery contributes to genomic rearrangement through cryptic site recognition or through end-donation, a number of authors have described features of the primary DNA sequence that might influence the frequency of errors. Two specific sequence motifs have been postulated to be significant in end-donation types of translocation events (Krowczynska et al., 1990; Kasai et al., 1992; Wyatt et al., 1992). Additionally, purine-pyrimidine tracts (ZDNA) and oligopurine-oligopyrimidine stretches have been pointed out (Boehm et al., 1988; Fuscoe et aE., 1991; Lu et ul., 1991; Aplan et al., 1992). In this regard, it has been suggested that non-B form DNA either might influence the sites at which nonspecific breaks occur (Boehm et al., 1989; Lu et al., 1991) or might dictate which of many possible cryptic sites is actually recognized by the V(D)J joining machinery (Fuscoe et ul., 1991). Experimental tests of the significance of any either DNA motif or structure in translocation are yet to be reported.
V(D)JJOINING
127
To summarize, when it comes to errors in V( D)J recombination, the possibility exists that there are somewhat different rules of engagement. As an example, the nonamer element might be an important determinant of recombination frequency for a V, D, or J segment, but relatively unimportant for a cryptic site. Instead cryptic recognition might be facilitated by a nearby Z-DNA stretch. Or where transcription may be critical for real V segment rearrangement, it may be less so for the pretenders. It might also be that an open-and-shut outcome is more likely to take place when inappropriate sites have been targeted (Lewis and Hesse, 1991). The V(D)J joining machinery is strongly implicated as a major force in the development of some T cell acute lymphoblastic leukemias [reviewed in Larsen et al., 1993 (in French)] and is clearly a contributing factor in many other lymphoid tumors (Tycko and Sklar, 1990; Rabbitts, 1991; Reis et al., 1991; Sawyers et al., 1991; Korsmeyer, 1992; Magrath, 1992). This speaks for the importance of understanding how fidelity is maintained during antigen receptor gene assembly on a molecular level, and of learning about the factors that might increase the probability of a mishap. IX. The Joining Mechanism: A Working Hypothesis
Diagrams that connect triangles and boxes provide one way to describe the “mechanism” of V(D)J joining. How V(D)J recombination is actually accomplished is another matter and has proved to be a remarkably intransigent problem. It may be unrealistic to anticipate a “recombinase” that can recognize, cut, modify, and join the recombination target sites. Instead the difficulties encountered in reconstructing the V(D)J joining reaction in vitro could be an indication that such an entity does not exist. While it may appear that the field is still light years away from the level of analysis achieved in other sitedirected recombination systems, the following section summarizes, in a descriptive way, a working model for the joining operation that fulfills the minimal requirement that it flows from start to finish without any fundamental conceptual gaps. If it is true that V(D)Jjoining is largely a collaborative venture (as many have suggested), it may be that relatively few pieces are missing and a detailed understanding of V(D)J joining is in fact not that far off.
A. SYNAPSIS In almost every site-directed recombination system, including, for example, nuclear pre-mRNA splicing (Guthrie, 1991),DNA transposition (Mizuuchi, 1992b), and conservative site-specific recombination
128
SUSANNA M . LEWIS
(Craig, 1988), considerable protein/nucleic acid structure forms prior to cleavage. The nucleoprotein structures are specific, as indicated by their designations as “spliceosomes,” “resolvosonies,” etc., and are key to organizing the reactants. It is believed that, b y refining the interaction at the outset, a product can be created that is useful to the organism. It is not at all certain, however, that V(D)J recombination is a similar type of transaction. Although most models for V(D)J joining proceed from the engagement of the 12- and 23-signals to synapsis of the sites, there is some reason to question this picture. One indication that cutting of one or both sites might be able to occur in the absence of synapsis is the fact that opening and shutting was observable with substrates containing only one of two canonical joining signals (Lewis and Hesse, 1991). A second is that although recombination is negatively affected by shortening the intersignal distance below about 100 residues (Lewis and Hesse, 1991; Sheehan and Lieber, 1993), the effect was not absolute. Signals only 16 base pairs apart can be connected by the V(D)J joining machinery (Lewis and Hesse, 1991).This distance is too short to allow looping of double-stranded DNA, as required for synapsis of the two recombination sites at the outset. More likely, the two sites were brought together for strand exchange after one or both was cleaved. V(D)J joining is not the only recombination system that can connect two closely linked sites. The elimination of sequences during macronuclear development of some ciliated protozoa involves the removal of very short pieces of DNA (Ribas-Aparicio et al., 1987). An intramolecular excision-ligation reaction, where 13 residues were eliminated, was demonstrated in uitro (Robinson et al., 1989). The size of the excised region in this system exclude models that require synapsis of unbroken double-stranded DNA, although the possibility that sites are cut as a first step was not specifically suggested (RibasAparicio et al., 1987). Even though V(D)J recombination between very closely spacedjoining signals is possible, it is clear that the interaction between two joining signals is hindered when the distance between them is shortened (Sheehan and Lieber, 1993). For both inversion- and deletiontype substrates, placing the signals too near one another reduces the frequency of recombination. Apparently the constrained interaction takes place in advance of strand exchange. This is because both hybrid joint and standard joint events are affected when the intersignal distance drops below about 100 base pairs (Sheehan and Lieber, 1993). These data are not necessarily incompatible with the notion that cutting precedes synapsis. It is entirely possible, for example, that the
V(D)J JOINING
129
recombination machinery cuts as a first step and then hold the ends together after cleavage. If this were the case, there really is no clear “either/or” prediction regarding distance effects. An intermediate type of situation might pertain, where recombination is hindered, but not completely eliminated over short distances. It is also possible that the major pathway leading to productive recombination involves an initial synapsis followed by cleavage, but the steps of the reaction can occur in a different order when necessary. Synapsis has been proposed to involve a “parallel” alignment of joining signals (Sheehan and Lieber, 1993). This suggestion followed the observation that reduction ofthe intersignal distance had the most pronounced effects for substrates in which the signals were configured for standard inversion. For deletionally oriented joining signals, decreasing the distance also reduced recombination, but the effects were noticeable at a significantly shorter separation. If the transaction is depicted in two dimensions, a parallel alignment requires that the D N A must bend back on itself twice in order to synapse signals in an inversional configuration, but only once for deletion (Sheehan and Lieber, 1993).For a transaction in which the reactants are not necessarily coplanar, the predicted difference between the two alignments may not be so intuitively obvious; however, the simplest interpretation is that there is a parallel alignment of joining signals during a constrained step of V(D)J recombination.
B. CLEAVAGE Much of the evidence (the fine-structure of recombinant products, the pattern of P nucleotide insertion, and analyses of broken DNA species at the TCRG locus) supports the following inferences: (1)cleavage occurs at the exact edges of the joining signals, ( 2 ) the breaks are likely to be introduced in both strands prior to any joining step, (3)the immediate cleavage products are two blunt-cut signal ends and two covalently closed coding termini (for discussion and citations see sections V,A and V,B). The suggestion that there is a hairpin intermediate in V(D)J joining provided an explanation for P nucleotides and the possible existence of this intermediate has been supported by several studies (section V,B). The hairpin structure may arise in the course of severing coding ends from signal ends via a transesterification reaction mechanism (Lieber, 199l), which provides the added satisfaction of establishing a possible link between V(D)J joining and other site-directed DNA recombination systems (Gellert, 1992b; Mizuuchi, 1992b). Once the DNA is broken, what then? It may be that the necessary
130
SUSANNA M. LEWIS
involvement ofany site-specific, lineage-specific agent ends with cleavage. A speculative possibility is that successful completion of rearrangement occurs in the context of tethered ends and that this is accomplished by interactions between site-specific components of the joining machinery and nonspecific anchoring function(s) active in double-strand break repair. There is no direct evidence to this effect; however, the involvement of a nonspecific anchoring function that is required in end joining provides a plausible basis for the scid phenotype (Section V1,C). Also the notion that it may be necessary to hold onto ends in V( D)J joining provides a minimalist conceptual framework for thinking about how end-donation mistakes might occur.
C . ENDEXCHANGE From the cleavage step onward, it is conceivable that V(D)J joining and end joining are the same (Lewis and Gellert, 1989). This idea departs from very similar proposals (e.g., Roth and Wilson, 1988; Gu et al., 1990) only in that no distinction is made between signal end and coding end connection: both are presumed to be accomplished by non-sequence-specific end-joining processes. The following summarizes the resolution steps of the V(D)J joining reaction on the basis of such a model. After cleavage, the four ends, which are engaged by both specific and nonspecific binding factors, are held in proximity to one another. It has perhaps not been fully appreciated that the hairpin mechanism very economically explains the differences between coding ends and signal ends in all types of V(D)Jjunction on the assumption that postcleavage enzymatic operations are nonspecific. A signal end, as soon as it is created by the cleavage step, is as a substrate for ligation. A coding end, in contrast, would require modification before any joining is undertaken; at minimum, the hairpin terminus must be opened. Whether or not the opening is variable, as has been suggested by a number of workers, processing by end-joining functions will likely have a stochastic element. Trimming, tailing, alignment, and fillingin will all be favored for certain of the created termini and disfavored for others. The overall pattern of end exchange may likewise be due to the difference between signal ends and coding ends after cleavage. Standard junctions may be favored products simply because there is no initial barrier to signal-to-signal ligation. It could be that on average, by the time the coding ends have been processed to a form that can be joined, the signal joint is already created: coding joints then form by default (the only available partner is the other coding end). Thus
V(D)J JOINING
131
the standard products come about without enforcing any set “stepwise” pattern of strand exchange, and the formation of alternative junctions is not proscribed.
D. INTERIMMODIFICATION, AND LIGATION The various possible fates ofcoding ends and signal ends with regard to their modification may also be dictated by their initial postcleavage structures. For a coding end, following the endonucleolytic nicking, some of the open coding termini with 3’ extensions may be modified by TdT (if present). TdT might also modify signal ends, but less frequently due to their proposed blunt-ended structure. Base-pairing interactions may align two coding ends for joining (section V,D); however such alignment does not appear to be a necessary prerequisite, even for coding joint formation, and so might be completely irrelevant in signal end connections. Base removal could take place prior to and/or after ligation (Fig. 6). Observed sequence-specific truncation implies an exonuclease with some sequence discrimination as well as a limited ability to remove residues; there may also be a distinct nuclease that trims bases in the course of removing flaps after one of the two coding strand connections have formed (Sections V,C and V1,D). The signal ends, being blunt at the time of ligation, would not require any such trimming. As discussed (Section VI,B) the ligation step may or may not be accomplished by a V(D)J joining specific activity. It appears unlikely to be carried out by DNA ligase 1 based on the analysis of V(D)J junctions formed in mutant human cells; however, involvement of other ligases has not been investigated. The many similarities between end-joining products observed in completely nonlymphoid contexts and V(D)J coding joints are suggestive of a significant overlap in these processes that could well extend to the ligation step.
E. SUMMARY Thus, the “new” frontier in V(D)J joining, may be to understand nonspecific end joining. According to the sparest of all possible models the only missing piece specific to V(D)Jjoining would be the nuclease that site-specifically cleaves at joining signals (RAG-1 and/or -2 being the most likely candidates). Other nonspecific players to be considered are 1) an anchoring protein for locating cut ends near one another (perhaps missing in scid), 2) a hairpin nick-ase (to allow resolution of coding ends), 3) an alignment function (as required for the “homologydirected” junctions, 4) nuclease(s) to account for truncation, and 5) the ligation function necessary to make the strand connections.
132
SUSANNA M. LEWIS
X. Conclusion
A picture emerges of V(D)J joining as an orderly process that is the sum of disorderly parts. Variability comes into play at a number of levels: variable crossover sites, variable joining signals, variable strand exchange, variable degrees of reciprocity, and so forth. It is argued here that the main tactic employed by other site-directed recombination systems is not in evidence for V(D)J joining. Determinism is not built into the mechanism. But this does not necessarily shift the problem of winnowing out useless recombination products onto cellular selection. The missing information that pilots the reaction to a successful conclusion may be contained, in part, in the structure of the loci. Certainly evolution has had ample time to refine the substrate, and evidence suggests that major reorganizations have taken place (Litman et al., 1993). The logic imposed at the level of the interaction of the joining machinery with its physiological substrate may not be fully revealed by simplified reconstructions. The upcoming challenge for those interested in biological form and function in this system may be twofold: to approach V(D)Jjoining on its own terms without wholesale adoption of preexisting paradigms (such as synapsis before cleavage or a centerpiece higher order protein:DNA structure) and second to design experiments that accommodate the possibility that the nonidealized substrate may be a significant reservoir of information. Appendix Aberrant junctions. Often used to refer to out-of-frame recombinants, such junctions are not aberrant in the sense of representing a V(D)Jjoining mistake. To avoid ambiguity the term is used sparingly here and only to refers to low-frequency target misrecognition. Coding joint. Th e junction made upon fusing V, D, and J gene segments, or the positionally-analogous sequences, in an endogenous or artificial substrate (actual coding capacity is not implied by the term). Cryptic site. A DNA sequence that can be targeted by the V(D)J joining machinery, but which is not located adjacent to a V, D, or J gene segment. D-p protein. A polypeptide templated by a chromosome that has undergone D-to-J joining. As detected in A-MuLV-transformed cell lines, these have no variable region sequences and are thought to have the potential to become incorporated into an “immature” receptor. End-donation. As used here, this refers to a presumptive V(D)J joining mistake involving the site-specific cleavage at an authentic joining signal that is followed by joining to a DNA end that has not been generated by V(D)J joining activity. Gen e replacement. As used here, the secondary rearrangement of a fully rearranged (V-to-D-to-J)IgH allele, involving recombination ofan unrearranged V or J gene segment with a cryptic target site contained within the VDJ joint. In some publications gene replacement is used to refer to other categories of recombination event that lead to the replacement of an expressed allele.
V(D)J J O I N I N C
133
Hybrid joint. A recornbinant jrrnction i n which a coding end-to-signal end connection is made in place of the usnal coding-to-coding and signal-to-signal end connections (section VI1,F). Joining signals. T h e small heptanierlspacer/nc,namer elements abutting V, D, and J coding segments which are site-specifically targeted by the joining machinery. These are also called “RSS” (recombination recognition sites) i n some publications. Kde. See RS, below. N regions, NGEs. Nongerrnline sequences introduced into V(D)J junctions. All but a small percentage of N regions are the result of terminal deoxynucleotidvl transferase activity. Open-and-shut joint. A nonrecombinant junction formed by the reconnection of a coding end to a signal end after site-specific cleavage (section VI1,F). P nucleotides. Palindromic junctional insertions found adjacent to nontruncated coding ends in V(D)J junctions. Pseudo-normal joining. See text (section VI1,C). Reciprocal joint. A signal joint (see below). This term is now disfavored. RS. A cryptic recombination site at the K locus in mice, which, when recombined causes deletion of the constant region. (The corresponding site in humans is called Kde). RSS. See joining signal. Signal joint. T h e junctions formed by the union of two joining signals. Secondary recornbinationlrearrangement. These terms have been used in various publications to mean very different things: either a VK-to-JK joining that supersedes a preexisting junction on the same allele heavy-chain V-to-VDJ “gene replacement” (see above), the de n o w rearrangement of a second allele a cell, with one chromosome already in recombined form, or the subsequent connection of V to a previously formed DJ joint. Because of this ambiguity, these terms are not used here. “Standard” joining. V(D)Jjoining events that lead to the production of coding joints and signal joints, as opposed to “alternative” joints events that lead to hybrid joints or open-and-shut joints. Successive recombination. Here, the term “successive recombination” refers to a single allrtle. It is used to indicatc the replacement of one coding joint by another by a subsequent recombination event that u s e s gene segments 5‘ and 3’ o f t h e initial joint. This term is also used in some publications to indicate, simply, ongoing recombination. 3’D signal preference rule (see section V11,I). The apparent discrimination between joining signals 5’ and 3’ of D segnients i n all types of endogenous D-to-J joining. 12/23 rule. See text, section VI1,A. V gene replacement. See gene replacement, above. V(D)Jjoining. Used here in a generic sense to refer to the Ig/TCR site-specific gene rearrangement process, whether to actual V, D, and/or J segments or artificial sequences are involved. VDJ; DJ; or VJ junction/joining. A junction or joining event specifically involving the designated elements.
ACKNOWLEDGMENTS Th e author is responsible for all errors and omissions, but would like to thank the following for generously responding to requests for preprints and unpihlished inforniation and/or, providing general guidance in discussion: F. Alt, S. Anderson, J. Aster, I). Baltimore, H. Baer, V. Blasquez, P. Bjorkman, B. Blomberg, G. Bosma, M . Bosma, A. Carroll, S. Desiderio, K. Dorshkind, A. Eastman, P. Engler, A. Feeney, S. Fish, M. Flajnick, M. Gellert, R. Gerstein, A. Greenberg, B. I-lalligan, R. Hardy, E. Hendrickson,
134
SUSANNA M. LEWIS
T. Honjo, S. Kallenbach, B. Kee, A. Kenter, M. Krangel, D. Kranz, T. LeBien, M. Leiber, G. Litman, D. Mathis, J. Menetski, W. McCormack, T. McKeithan, K. Meek, K. Muegge, M. Modak, M. Oettinger, C. Paige, J. Penninger, R. Perlmutter, P. Pfeiffer, D. Raulet, C.-A. Reynaud, N. Rosenberg, D. Roth, E. Rothenberg, N. Ruetsch, D. Schatz, M. Schlissel, H. Schroeder, Jr., L. Schultz, E. Selsing, L. Steiner, U . Storb, G. Taccioli, C. Thompson, J. Teale, B. Van Ness, W. Vielmetter, D. Weaver, J.-C. Weill, G. Wu, H. Yamagishi, and H. Zachau. Thanks go to Howard Lipshitz, Pamela Bjorkman, Susan Celnicker, Norman Ruetsch and especially Ellen Rothenberg for comments on the manuscript. I thank Susie Suh for much-appreciated assistance in all phases of manuscript preparation. This effort is dedicated to my spouse, Howard Lipshitz, in acknowledgement of his enlightened, usually unwavering, support. Work in the author’s laboratory is funded by American Cancer Society Grant No. IM-599B.
REFERENCES Abe, M., Hayashida, K., Takayama, K., and Shiku, H. (1991).lnt. Immunol. 3, 1025. Abeliovich, A., Gerber, D., Tanaka, O., Katsuki, M., Graybiel, A. M., and Tonegawa, S. (1992). Science 257, 404. Abremski, K. E., and Hoess, R. H. (1992). Protein Eng. 5, 87. Aguilar, L. K., and Belmont, J . W. (1991).J . lmmunol. 146, 1348. Aguilera, R. J . , Akira, S., Okazaki, K., and Sakano, H. (1987).,Cell (Cambridge, Mass.) 51, 909. Akira, S., Sugiyama, H., Sakaguchi, N., and Kishimoto, T. (1984). EMBO J . 3, 677. Akira, S., Okazaki, K., and Sakano, H. (1987).Science 238, 1134. Alessandrini, A., Pierce, J. H., Baltimore, D., and Desiderio, S. V. (1987).Proc. Natl. Acad. Sci. U.S.A.84, 1799. Alexandre, D., Chuchana, P., Roncarolo, M.-G., Yssel, H., Spits, H., Lefranc, G., and Lefranc, M. (1991). lnt. Immunol. 3, 973. Allison, J . P., and Havran, W. L. (1991). Annu. Reo. Immunol. 9, 679. Alt, F., and Baltimore, D. (1982). Proc. Natl. Acad. Sci. U.S.A.79, 4118. Alt, F. W., Rosenberg, N., Lewis, S., Thomas, E., and Baltimore, D. (1981).Cell (Cambridge, Mass) 27, 381. Alt, F. W., Yancopoulos, G. D., Blackwell, T. K., Wood, C., Thomas, E., Boss, M., Coffman, R., Rosenberg, N., Tonegawa, S., and Baltimore, D. (1984). EMBO J . 3, 1209. Alt, F. W., Blackwell, T. K., and Yancopoulos, G. D. (1987).Science 238, 1079. Alt, F. W., Oltz, E. M., Young, F., Gorman, J.,Taccioli, G., andChen, J. (1992a).lmmunol. Today 13,306. Alt, F. W., Rathbun, G . , Oltz, E., Taccioli, G., and Shinkai, Y. (1992b).Ann. N . Y. Acad. Sci. 651, 277. Altenburger, W., Steinmentz, M., and Zachau, H. (1980). Nature (London)287,603. Anderson, S. J., Levin, S. D., and Perlmutter, R. M. (1993). Nature (London)365, 552. Aplan, P. D., Lombardi, D. P., Ginsberg, A. M., Cossman, J . , Bertness, V. L., and Kirsch, I. R. (1990). Science 250, 1426. Aplan, P. D., Lombardi, D. P., and Kirsch, 1. R. (1991). Mot. Cell. B i d . 11, 5462. Aplan, P. D., Raimondi, S. C., and Kirsch, I. R. (1992).J . E x p . Med 176, 1303. Ariizumi, K., Wang, S., and Tucker, P. W. (1993).Proc. Natl. Acad. Sci. U.S.A.90,3695. Asarnow, D. M., Goodman, T., LeFrancois, L., and Allison, J. P. (1989).Nature (London) 341, 60. Asarnow, D. M., Cado, D., and Raulet, D. H. (1993). Nature (London) 362, 158. Aster, J . C., and Sklar, J. (1992).J.Erp. Med. 175, 1773.
V(D)JJOINING
135
Atkinson, M. J.. Michnick, S. A., Paige, S. J., and Wu, G. E. (1991).J . fmmunol. 146, 2805. Baer, R., Chen, K., Smith, S. D., and Rabbitts, T. H. (1985). Cell (Cambridge, Mass.) 43, 705. Bakhshi, A., Wright, J. J., Graninger, W., Seto, M., Owens, J., Cossman, J., Jensen, J. P., Goldman, P., and Korsmeyer, S. J. (1987). Proc. N a t l . Acad. Sci. U.S.A.84,2396. Bangs, L. A., Sanz, I. E., and Teale, J. M. (1991).J . Immunol. 146, 1996. Begley, C. G., Aplan, P. D., Davey, M. P., Nakahara, K., Tchorz, K., Kurtzberg, J., Hershfield, M. S., Haynes, B. F., Cohen, D. I., Waldmann, T. A,, and Kirsch, I. R. (1989a). Proc. N a t l . Acad. Sci. U.S.A.86,2031. Begley, C. G., Aplan, P. D., Denning, S. M., Haynes, B. F., Waldmann, T. A., and Kirsch, I. R. (198913).Proc. N a t l . Acad. Sci. U.S.A. 86, 10,128. Benjamin, M. B., and Little, J. B. (1992). Mol. Cell. Biol. 12, 2730. Benoist, C., and Mathis, D. (1992). Curr. Opinion fmmunol. 4, 156. Berinstein, N., Levy, S., and Levy, R. (1989). Science 244, 337. Bernard, O., Hozumi, N., and Tonegawa, S. (1978).Cell (Cambridge, Muss.) 15, 1133. Bernard, O., Larsen, C., Hampe, A., Mauchauffe, M., Berger, R., and Mathieu-Mahul, D. (1988). Oncogene 2, 195. Bernard, O., Gugliemi, P., Jonveaux, P., Cherif, D., Gisselbrecht, S., Mauchauffe, M., Berger, R., Larsen, C., and Mathieu-Mahul, D. (1990). Genes Chromosomes Cancer 1, 194. Bernard, O., Lecointe, N., Jonveaux, P., Souyri, M., Mauchauffe, M., Berger, R., Larsen, C. J., and Mathieu-Mahul, D. (1991). Oncogene 6, 1477. Biedermann, K. A., Sun, J., Giaccia, A. J., Tosto, T. M., and Brown, J. M. (1991).Proc. Nutl. Acad. Sci. U.S.A. 88, 1394. Bird, A. (1992). Cell (Cambridge, Mass.) 70,5. Blackwell, T. K., and Alt, F. W. (1984). Cell (Cambridge, Mass.) 37, 105. Blackwell, T. K., and Alt, F. W. (1989). Annu. Rev. Genet. 23, 605. Blackwell, T. K., Malynn, B. A,, Pollock, R. R., Ferrier, P., Covey, L. R., Fulop, G. M., Phillips, R. A., Yancopoulos, G. D., and Alt, F. W. (1989).E M B O J . 8, 735. Blasquez, V. (1994).In preparation. Blasquez, V. C., Xu, M., Moses, S. C., and Garrard, W. T. (1989).J . Biol. Chem. 264, 1183. Blomberg, B., Trauenecker, A,, Eisen, H., and Tonegawa, S. (1981). Proc. N a t l . Acad. Sci. U.S.A. 78, 3765. Boehni, T., and Rabbitts, T. H. (1989). FASEB J. 3, 2344. Boehni, T., Baer, R., Lavenir, I., Forster, A,, Waters, J. J., Nacheva, E., and Rabbitts, T. H. (1988).E M B O J . 7, 385. Boehm, T., Mengle-Gaw, L., Kees, R. R., Spurr, N., Lavenir, I., Forster, A., and Rabbitts, T. H . (1989).E M B O J . 8, 2621. Boehm, T., Gonzalez-Sarmiento, R., Kennedy, M., and Rabbitts, T. H. (1991). Proc. Nutl. Acad. Sci. U.S.A. 88, 3927. Bogue, M., Candeias, S., Benoist, C., and Mathis, D. (1991).E M B O J . 10, 3647. Bogue, M., Gilfillan, S., Benoist, C., and Mathis, D. (1992).Proc. N a t l . Acad. Sci. U.S.A. 89, 11,011, Bogue, M., Mossmann, H., Stauffer, U., Benoist, C., and Mathis, D. (1993). Eur. J . fmmunol. 23, 1185. Bonati, A,, Zanelli, P., Ferrari, S., Plebani, A., Starcich, B., Savi, M., and Neri, T. M. (1992). Blood 79, 1472. Borgulya, P., Kishi, H., Uematsu, Y. and von Boehrner, H. (1992). Cell (Cambridge, Mass.) 69, 529.
136
SUSANNA M. LEWIS
Born, W., Yagiie, J., Palmer, E., Kappler, J., and Marrack, P. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 2925. Bosma, M. J. (1992). Zmmunodefic. Reu. 3,261. Bosma, M. J., and Carroll, A. M. (1991). Annu. Reu. Zmmunol. 9, 323. Boubnov, N. V., Wills, Z. P., and Weaver, D. T. (1993). Mol. Cell. Biol., 13, 6957. Brandle, D., Burki, K., Wallace, V. A., Rohrer, U. H., Mak, T. W., Malissen, B., Hengartner, H., and Pircher, H. (1991). Eur. J. Zmmunol. 21, 2195. Breit, T. M., Mol, E. J., Wolvers-Tettero. I. L. M., Ludwig, W.-D., van Wering, E. R., and van Dongen, J. J. M. (1993).J . Exp. Med. 177, 965. Brodeur, P. H., Osman, G. E., Mackle, J. J., and Lalor, T. M. (1988).J. Exp. Med 168, 2261. Brown, L., Cheng, J.-T.,Chen, Q., Siciliano, M. J., Crist, W., Buchanan, G., and Baer, R. (1990).EMBOJ. 9,3343. Bruggemann, M., Spicer, C., Buluwela, L., Rosewell, I., Barton, S., Surani, M. A., and Rabbitts, T. H. (1991). Eur. J. Zmmunol. 21, 1323. Bruhn, S. L., Pil, P. M., Essigmann, J. M., Housman, D. E., and Lippard, S. J. (1992). Proc. Natl. Acad. Sci. U.S.A. 89,2307. Bucchini, D., Reynaud, C.-A., Ripoche, M.-A., Grimal, H., Jami, J., and Weill, J.-C. (1987).Nature (London)326,409. Burger, C., and Radbruch, A. (1990). Eur. J. Zmmunol. 20,2285. Campbell, J. J., and Hashimoto, Y. (1993).J . Zmmunol. 150, 1307. Carlson, L. M., Oettinger, M. A., Schatz, D. G., Masteller, E. L., Hurley, E. A., McCormack, W. T., Baltimore, D., and Thompson, C. B. (1991).Cell (Cambridge,Mass.) 64, 201. Carlsson, L., and Holmberg, D. (1990). Znt. Immunol. 2, 639. Carlsson, L., Overmo, C., and Holmberg, D. (1992). Eur. J. Zmmunol. 22, 71. Carroll, A. M., and Bosma, M. J. (1989). Curr. Top Microbiol. Zmmunol. 152, 63. Carroll, A. M., and Bosma, M. J. (1991). Genes Deu. 5, 1357. Carroll, A. M., Hardy, R. H., Petrini, J., and Bosma, M. J. (1989a).Cum. T o p . Microbiol. Zmmunol. 152, 118. Carroll, A. M., Hardy, R. R., and Bosma, M. J. (1989b).J . Znmunol. 143, 1087. Carroll, A. M., Slack, J. K., and Chang, W. (1993a). Mol. Cell. Biol. 13, 3632. Carroll, A. M., Slack, J. K., and Mu, X. (1993b).J. Zmmunol. 150, 2222. Chang, C., Biedermann, K. A., Mezzina, M., and Brown, J. M. (1993). Cancer Res. 53, 1244. Chang, L. M. S., and Bollom, F. J. (1986). CRC Crit. Reu. Biochem. 21, 27. Chen, J., and Alt, F. W. (1993). Curr. Opinion Zmmunol. 5, 194. Chen, J., Trounstine, M., Alt, F. W., Young, F., Kurahara, C., Loring, J. F., and Huszar, D. (1993a).Int. Zmmunol. 5,647. Chen, J.. Trounstine, M., Kurahara, C., Young, F., Kuo, C., Xu, Y., Loring, J. F., Alt, F. W., and Huszar, D. (1993b).EMBO J. 12, 821. Chien, Y., Iwashima, M., Kaplan, K. B., Elliott, J. F., and Davis, M. M. (1987a). Nature (London)327,677. Chien, Y., Iwashima, M., Wettstein, D. A,, Kaplan, K. B., Elliott, J. F., Born, W., and Davis, M. M. (1987b). Nature (London) 330, 722. Clark, S. P., Yoshikai, Y.,Taylor, S., Siu, G., Hood, L., and Mak, T. W. (1984) Nature (London)311,387. Cockerill, P. N. (1990). Nucleic Acids Res. 18,2643. Cook, W. D., and Balaton, A. M. (1987). Mol. Cell. Biol. 7, 266. Costa, T. E. F., Suh, H., and Nussenzweig, M. C. (1992). Proc. Natl. Acud. Sci. U.S.A. 89, 2205.
V(D)J JOINING
137
Covey, L. R., Ferrier, P., and Alt, F. W. (1990). Int. Immunol. 2, 579. Craig, N. L. (1988). Annu. Reo. Genet. 22, 77. Curnano, A,, and Paige, C. J. (1992). EMBOJ. 11, 593. Curnano, A., Furlonger, C., and Paige, C. J . (1993). Proc. Natl. Acad. Sci. U.S.A. 90, 6429. Daitch, L. E., Moore, M. W., Persiani, D. M., Durdik, J . M., and Selsing, E. (1992). I . Immunol. 149, 832. Dasgupta, U. B., and Lilly, F. (1988). Proc. Natl. Acud. Sci. U.S.A. 85, 3193. Davis, M. M., and Bjorkrnan, P. J. (1988). Nature (London) 334, 395. de Chasseval, R., and de Villartay, J.-P. (1993). Eur. J. Itnmunol. 23, 1294. Decker, D. J . , Boyle, N. E., and Klinman, N. €3. (1991).J. Immunol. 147, 1406. Deev, S. M., Cornbriato, G . , Klobeck, H., and Zachau, H. G. (1987). Nucleic Acids Res. 15, 1. Denny, C. T., Hollis, G. F., Hecht, F., Morgan, R., Link, M. P., Smith, S. D., and Kirsch, I. R. (1986). Science 234, 197. Desiderio, S., and Baltimore, D. (1984). Nature (London) 308, 860. Desiderio, S., and Wolff, K. (1988).J. Exp. Med. 167, 372. de Villartay, J.-P., Hockett, R. D., Coran, D., Korsrneyer, S . J . , and Cohen, D. I. (1988). Nature (London) 335, 170. de Villartay, J.- P., Mossalayi, D., de Chasseval, H., Dalloul, A., and Debri., P. (1991). l n t . Immunol. 3, 1301. Di Prirnio, R., Trubiani, O., and Bollurn, F. J. (1991). Histochemistry 96, 59. Disney, J. E., Barth, A. L., and Schultz, L. D. (1992). Cytogenet Cell Genet. 59,39. Dorshkind, K. (1990). Annu. Reo. Immunol. 8, 111. Dorshkind, K., and Witte, 0. N. (1987). Curr. Top. Microbiol. Immunol. 135, 23. Doyen, N., d’Anton, M. F., Bentolila, L. A., Nguyen, Q. T., and Rougeon, F. (1993). Nucleic Acids Res. 21, 1187. Drew, H. R . (1984).J . Mol. Biol. 176, 535. du Pasquier, L. (1992). APMIS 100, 383. Durdik, J., Moore, M. W., and Selsing, E. (1984). Nature (London) 307, 749. Early, P., and Hood, L. (1981). Cell (Cambridge, Mass.) 24, 1. Early, P., Huang, H., Calame, K. and Hood, L. (1980).Cell (Cambridge, Mass.) 19,981. Echols, H. (1990).J . Biol. Chem. 265, 14,697. Ehlich, A., Schaal, S., Gu, H., Kitamura, D., Muller, W., and Rajewsky, K. (1993). Cell (Cambridge, Mass.) 72, 695. Elliott, J., Rock, J . , Patten, P., Davis, M., and Chien, Y. (1988). Nuture (London) 331, 627. Engler, P., and Storb, U. (1987). Proc. Nutl. Acad. Sci. U.S.A. 84,4949. Engler, P., Roth, P., Kim, J. Y., and Storb, U. (199la).1.Immunol. 146, 2826. Engler, P., Haasch, D., Pinkert, C. A., Doglio, L., Glymour, M., Brinster, R., and Storb, U. (199lb). Cell (Cambridge, Moss.)65, 939. Engler, P., Klutz, E., arid Storb, U. (1992).J. E x p . Med 176, 1399. Engler, P., Weng, A., and Storb, U . (1993). Mol. Cell. B i d . 13, 571. Era, T., Ogawa, M., Nishikawa, S.-I., Okarnoto, M., Honjo, T., Akagi, K., and Yamarnura, K.-I. (1991). E M B O J . 10, 337. Faust, E. A., Saffran, K. C., Toksoz, D., Williams, D. A., and Witte, 0. N . (1993).J. Exp. Med. 177, 915. Feddersen, R., and Van Ness, B. V. (1989). Nucleic Acids Res. 17, 9797. Feddersen, R . , and Van Ness, 8.G. V. (1990). Mal. Cell. Biol. 10, 569. Feddersen, R. M., and Van Ness, B. G . (1985). Proc. Natl. Acad. Sci. U.S.A.82, 4793. Feeney, A. J . (1990).J . E x p . Med. 172, 1377.
138
SUSANNA M . LEWIS
Feeney, A. J. (1991a).J. E r p . Med. 174,115. Feeney, A. J. (1991b).J. Immunol. 147,4343. Feeney, A. J. (1992a). Int. Reu. Immunol. 8, 113. Feeney, A. J. (199213).J. Immunol. 149,222. Ferguson, S. E., and Thompson, C. B. (1993). Curr. Biol. 3, 51. Ferrier, P., Covey, L. R., Suh, H., Winoto, A., Hood, L., and Alt, F. W. (1989). Int. Immunol. 1,66. Ferrier, P., Covey, L. R., Li, S. C., Suh, H., Malynn, B. A., Blackwell, T. K., Morrow, M. A., and Alt, F. W. (1990a).J. Erp. Med. 171, 1909. Ferrier, P., Krippl, B., Blackwell, T. K., Furley, A. J. W., Suh, H., Winoto, A., Cook, W. D., Hood, L., Constantini, F., and Alt, F. W. (1990b). E M B O J . 9, 117. Finger, L. R., Kagan, J., Christopher, G., Kurtzberg, J., Hershfield, H. S., Nowell, P. C., and Croce, C. M. (1989). Proc. Natl. Acad. Sci. U.S.A.86, 5039. Fish, S., and Bosma, M. (1994). Submitted for publication. Fondell, J. D., and Marcu, K. B. (1992). Mol. Cell. Biol. 12, 1480. Ford, A. M., Bennet, C. A., Healy, L. E., Navarro, E., Spooncer, E., and Greaves, M. F. (1992). Proc. Natl. Acad. Sci. U.S.A.89, 3424. Freemont, P. S., Hanson, I. M., and Trowsdale, J. (1991). Cell (Cambridge, Mass.) 64, 483. Fujimoto, S., and Yamagishi, H. (1987). Nature (London) 327,242. Fulop, G . M., and Phillips, R. A. (1990). Nature (London) 347,479. Furokawa, T., Maruyama, S., Kawaishi, M., and Honjo, T. (1992). Cell (Cambridge, Mass.) 69, 1191. Fuscoe, J. C., Zimrnerman, L. J., Lippert, M. J., Nicklas, J. A., O’Neill, J. P., and Albertini, R. J. (1991). Cancer Res. 51, 6001. Fuscoe, J. C., Zirnmerman, L. J., Harrington, K., Burnette, L., Moore, M. M., Nicklaus, J. A., O’Neill, J. P., and Albertini, R. J. (1992). Mutat. Res. 283, 13. Canesh, A., North, P., and Thacker, J. (1993). Mutat. Res. 299,251. Garman, R. D., Doherty, T. J., and Raulet, D. H. (1986). Cell (Cambridge, Mass.) 45, 733. Gauss, G. H., and Lieber, M. R. (1992). Genes Deo. 6, 1553. Gauss, G. H., and Lieber, M. R. (1993). Mol. Cell. Biol. 13, 3900. Gellert, M. (1992a). Annu. Reu. Genet. 26,425. Gellert, M. (199213). Trends Genet. 8, 408. Gellert, M., and Nash, H. (1987). Nature (London) 325, 401. George, J. F., Jr., and Schroeder, H. W., Jr. (1992). J . Immunol. 148, 1230. Gerstein, R. M., and Lieber, M. R. (1993a). Genes Deo. 7, 1459. Cerstein, R. M., and Lieber, M. R. (1993b). Nature (London)363, 625. Gilfillan, S., Dierich, A., Lemeur, M., Benoist, C., and Mathis, D. (1993). Science 261, 1175. Godfrey, D. I., Kennedy, J., Suda, T., and Zlotnick, A. (1993). J. Immunol. 150, 4244. Goldman, J . P., Spencer, D. M., and Raulet, D. H. (1993).J. E x p . Med 177, 729. Goodhardt, M., Cavelier, P., Akimenko, M. A., Lutfalla, G., Babinet, C., and Rougeon, F. (1987). Proc. Natl. Acad. Sci. U.S.A. 84, 4229. Goodhardt, M., Cavelier, P., Doyen, N., Kallenbach, S., Babinet, C., and Rougeon, F. (1993). Eur. J . Immunol. 23, 1789. Greenberg, A., and Flajnik, R. F. (1994). In preparation. Greenberg, A., Steiner, L., Kasahara, M., and Flajnik, R. F. (1994). Proc. Natl. Acad. Sci. U.S.A., 90, 10603.
V(D)J J O I N I N C
139
Groettrup, M., Ungewiss, K., Azogui, O., Palacios, R., Owen, M. J . , Hayday, A. C., and von Boehmer, H. (1993).Cell (Cambridge, Mass.) 75, 283. Groettrup, M., Baron, A., Griffiths, G., Palacios, R., and von Boehmer, H. (1992).EMBO J . 11, 2735. Gu, H., Forster, I., and Rajewsky, K. (1990). E M B O J . 9, 2133. Gu, H., Kitaniura, D., and Rajewsky, K. (1991). Znmunol. Today 12, 420. Guthrie, C. (1991).Science 253, 157. Guy-Grand, D., Broecke, C. V., Briottet, C., Malassis-Seris, M., Selz, F., and Vassali, P. (1992).Eur. J . Zmmunol. 22, 505. Hagman, J., Rudin, C. M., Haasch, K., Chaplin, C . , and Storb, U. (1990).Genes Deu. 4, 978. Haire, H. N., Ohta, Y., Litman, R. T., Ameiniya, C . T., and Litman, G. W. (1991).Nucleic Acids Res. 19, 3061. Halligan, B. D., and Desiderio, S. V. (1987).Proc. N a t l . Acad. Sci. U.S.A. 84, 7019. Halligaii €3. D., Teng, M., and Guillianis, T. G. (1994). Submitted for publication. Haniaguchi, Y., Matsunami, N., Yamamoto, Y., and Honjo, T. (1989).Nucleic Acids Res. 17, 9015. Hamaguchi, Y., Yamamoto, Y., Iwanari, H., Maruyama, S., Furukawa, T., Matsunami, N., and Honjo, T. (1992).J . Biochem. 112, 314. Harada, K., and Yamagishi, H. (1991).J. E x p . Med. 173, 409. Harding, F. A., Cohen, N., and Litman, G. W. (1990).Nucleic Acids Res. 18, 1015. Hardy, R. R., Dangl, J . L., Hayakawa, K., Jager, G., Herzenberg, L. A., and Herzenberg, L. A. (1986). Proc. Natl. Acad. Sci. U.S.A. 83, 1438. Hardy, R. R., Carmack, C. E., Shinton, S . A,, Kemp, J. D., and Hayakawa, K. (1991). J . E x p . Med. 173, 1213. Harrington, J., and Lieber, M. (1994). EMBOJ. 13, in press. Harrington, J., Hsieh, C.-L., Gerton, J., Bosma, G., and Lieber, M. R. (1992).Mol. Cell. B i d . 12,4758. Hayashi, S . , Kunisada, T., Ogawa, M., Sudo, T., Kodama, H., Suda, T., Nishikawa, S., and Nishikawa, S. (1990).I . E x p . Med. 171, 1683. Heinrich, G., Traunecker, A., and Tonegawa, S. (1984).J. E x p . Med 159, 417. Henderson, A. J., Narayanan, R., Collins, L., and Dorshkind, K. (1992).J . Zmmunol. 149, 1973. Hendrickson, E. A., Schatz, D. G . , and Weaver, D. T. (1988). Genes Deu. 2, 817. Hendrickson, E. A., Schlissel, M. S., and Weaver, D. T. (1990).Mol. Cell. B i d . 10,5397. Hendrickson, E. A., Liu, V. F., and Weaver, D. T. (1991a).Mol. Cell. Biol. 11,3155. Hendrickson, E . A., Qin, S., Bump, E. A,, Schatz, D. G., Oettinger, M., and Weaver, D. T. (1991b). Proc. Natl. Acad. Sci. U.S.A. 88, 4061. Hesse, J . E., Lieber, M . R., Cellert, M., and Mizuuchi, K. (1987). Cell (Cambridge, Mass.) 49, 775. Hesse, J. E., Lieber, M. R., Mizuuchi, K., and Gellert, M. (1989). Genes Dev. 3, 1053. Heuze, F., Pardoll, D., Diez, E., Ezine, S., and Jotereau, F. (1992). Eur. J . Zmmunol. 22, 2077. Hieter, P. A., Korsmeyer, S. J., Waldniann, T. A., and Leder, P. W. (1981). Nature (London)290,368. Hinds-Frey, K. R., Nishikata, H., Litman, R. T., and Litman, G. W. (1993).J . E x p . Med. 178, 815. Hirayoshi, K., Nishikawa, S., Kina, T., Hatanaka, M., Habu, S., Nomura, T., and Katsura, Y. (1987). Eur. J . Zrnmunol. 17, 1051. Hochtl, J . , and Zachau, H. G. (1983).Nature (London)302,260.
140
SUSANNA M . LEWIS
Hoess, R., Wierzbicki, A., and Abremski, K. (1986). Nucleic Acids Res. 14, 2287. Hohman, V. H., Schluter, S. F., and Marchalonis, J. J. (1992). Proc. Natl. Acad. Sci. U.S.A. 89, 276. Holland, G. D., Ito, K., Kaehler, D. A,, Tonegawa, S., and Risser, R. (1991).Proc. Natl. Acad. Sci. U.S.A. 88,3700. Holman, P. 0.. Lacy, M. J., Roth, M. E., and Kranz, D. M. (1992). Zmmunogenetics 35, 33. Hope, T. J., Aguilera, R. J., Minie, M. E., and Sakano, H. (1986). Science 231, 1141. Hsieh, C.-L., and Lieber, M. R. (1992). E M B O J . 11, 315. Hsieh, C.-L., McCloskey, R. P., Radany, E., and Lieber, M. R. (1991). Mol. Cell. B i d . 11, 3927. Hsieh, C.-L., McCloskey, R. P., and Lieber, M. R. (1992).J.Biol. Chem. 267, 5613. Hsieh, C.-L., Arlett, C. F., and Lieber, M. R. (1993).J. Biol. Chem. 268, 20105. Huber, C., Klobeck, H., and Zachau, H. G. (1992). Eur. J. Immunol. 22, 1561. Hui, M. F., Lam, P., and Dosch, H.-M. (1989).J. Immunol. 143, 2470. Hunkapiller, T., and Hood, L. (1989).A d o . Immunol. 44, 1. Hurwitz, J . L., Samaridis, J., and Pelkonen, J. (1988). Cell (Cambridge, Mass.) 52,821. Ichihara, Y., Hayashida, H., Miyazawa, S., and Kurosawa, Y. (1989). Eur. J. Imniunol. 1849. Iglesias, A., Kopf, M., Williams, G. S., Buhler, B., and Kohler, G. (1991). E M B O J . 10, 2147. Ikuta, K., and Weissman, I . L. (1991).J. E x p . Med. 174, 1279. Itohara, S., Mombaerts, P., Lafaille, J.J., Iacomini, J., Nelson, A., Clarke, A. R., Hooper, M. L., Farr, A., and Tonegawa, S. (1993). Cell (Cambridge, Mass.) 72, 337. Iwashima, M., Green, A., Davis, M. M., and Chien, Y. (1988). Proc. N a t l . Acad. Sci. U.S.A. 85, 8161. Jeggo, P. A. (1990). M u t a t . Res. 239, 1 . Jeong, H. D., and Teale, J. M. (1989).J . Immunol. 143, 2752. Jorgensen, J. L., Reay, P. A., Ehrich, E. W., and Davis, M. M. (1992). Annu. Reu. rmmunoi. 10,835. Kabat, E. A,, Wu, T. T., Perry, H. M., Gottesman, K. S., and Foeller, C. (1991).“Sequences of Proteins of Immunological Interest.” U S .Department of Health and Human Services, Bethesda MD. Kalled, S. L., and Brodeur, P. H. (1990).J. E x p . Med 172, 559. Kallenbach, S., and Rougeon, F. (1992).Res. Immunol. 143, 873. Kallenbach, S., Doyen, N., D’Andon, M . F., and Rougeon, F. (1992). Proc. Natl. Acad. Sci. U.S.A. 89,2799. Kallenbach, S., Brinkmann, T., and Rougeon, F. (1993). I n t . Immunol. 5, 231. Kallenbach, S., Babinet, C., Pournin, S., Cavelier, P., Goodhardt, M., and Rougeon, F. (1993).E u r . 1 . Immuttol. 23, 1917. Kasai, M., Maziarz, R. T., Aoki, K., Macintyre, E., and Strominger, J. L. (1992). Mol. Cell. B i d . 12, 4751. Katamine, S., Otsu, M., Tada, K., Tsuchiya, S., Sato, T.. Ishida, N., Honjo, T., and Ono, Y. (1984).Nature (London) 309, 369. Kataoka, T., Kondo, S., Nishi, M., Kodaira, M., and Honjo, T. (1984).Nucleic Acids Res. 12, 5995. Kaushik, A., Schulze, D. H., Bona, C., and Kelsoe, G. (1989).J.E x p . Med 169, 1859. Kawaichi, M., Oka, C., Reeves, R., Kinoshita, M. and Honjo, T. (1991).J. Biol. Chem. 226,8387. Kee, B. L., Cumano, A., Iscove, N . N., and Paige, C. J. (1994). Znt. Immunol. 6, in press.
V(D)J J O I N I N G
141
Kelley, D. E., Wiedemann, L. M., Pittet, A,, Strauss, S., Nelson, K. J., Davis, J., Van Ness, B., and Perry, R. P. (1985). Mol. Cell. B i d . 5, 1660. Kenter, A. L., and Tredup, J . (1991). Mol. Cell. Biol. 11, 4398. Kienker, L. J., Kuziel, W. A., Garni-Wagner, B. A., Kuniar, V., and Tucker, P. W. (1991a). J. Zmmunol. 147, 4351. Kienker, L. J., Kuziel, W. A., and Tucker, P. W. (1991b).J. E x p . Med. 174, 169. Kim, M. G., Schuler, W., Bosnia, M. J.. and hlarcu, K. B. (1988).J. Immunol. 141, 1341. Kleinfield, R. W., and Weigert, M. G. (1989).J. Zmmunol. 142,4475. Kleinfield, R., Hardy, R. R., Tarlinton, D., Dangl, J., Herzenberg, L. A,, and Weigert, M. (1986).Nature (London)322, 843. Klobeck, H., and Zachau, H. G. (1986).Nucleic Acids Res. 12, 4591. Klobeck, H . , Adolph, S., Hanieister, H . , and Zachau, H. G . (1988). Nucleic Acids Res. 16, 6243. Kobayashi, Y., Tycko, B., Soreng, A. L., and Sklar, J. (1991).J.Zmmunol. 147, 3201. Kofler, R.., Duchosal, M. A,, and Dixon, F. J. (1989).Zmmunogenetics 29, 65. Kokubu, F., Litman, R., Shaniblott, M. J., Hinds, K., and Litman, G. W. (1988). E M B O J. 11, 3413. Komori, T., Sugiyama, H., and Kishinioto, S. (1989).J . Zmmunol. 143, 1040. Komori, T., Okada, A,, Stewart, V., and Alt, F. W. (1993).Science 261, 1171. Koop, B. F., Wilson, R. K., Wang, K., Vernooij, B., Zaller, D., Kuo, C. L., Seto, D., Toda, M., and Hood, L. (1992). Genomics 13, 1209. Korman, A. J., Maruyama, J., and Raulet, D. H . (1989).Proc. Natl. Acad. Sci. U.S.A. 86, 267. Korsmeyer, S. J . (1992).Annu. Reo. Immunol. 10, 785. Kotloff, D. B., Bosma, M. J., and Ruetsch, N. R. (1993a). Znt. Zmmunol. 5, 383. Kotloff, D. B., Bosma, M. J . , and Ruetsch, N. R. (1993b).J . E x p . Med. 178, 1981. Kottman, A. H., Brack, C., Eibel, H., and Kohler, G . (1992).Eur. J. Zmmunol. 22, 2113. Kronenberg, M., Governian, J., Haars, R., Malissen, M., Kraig, E., Delovitch, L. P. T., Suciu-Foca, N., and Hood, L. (1985).Nuture (London) 311, 647. Krowczynska, A. M., Rudders, R. A., and Krontris, T. G. (1990). Nucleic Acids Res. 18, 1121. Kubagawa, H., Cooper, M. D., Carroll, A. J., and Burrows, P. D. (1989). Proc. N a t l . Acad. Sci. U.S.A. 86, 2356. Kurosawa, Y., and Tonegawa, S. (1982).J.E x p . Med 155, 201. Kurosawa, Y., von Boehmer, H.. Haas, W., Sakano, H., Traunecker, A,, and Tonegawa, S . (1981).Nuture (London)290, 565. Lafaille, J. J., DeCloux, A , , Bonneville, M., Takagaki, Y., and Tonegawa, S . (1989).Cell (Cambridge, M o s s . ) 59, 859. Lai, E., Wilson, R. K., and Hood, L. E. (1989). Ado. Zmniuno!. 46, 1. Landau, N. H., Schatz, D. G., Rosa, M., and Baltimore, D. (1987). M o l . Cell. Biol. 7, 3237. Landy, A. (1989).Annu. Reo. Biochem. 58, 913. Larsen, C., Bernard, O., and Mathieu-Mahul, D. (1993).Bull. Znst. Pusteur 91, 17. Lauster, R., Reynaud, C.-A,, Mirtensson, I.-L., Peter, A , , Bucchini, D., Jami, J.. and Weill, J.-C. (1993).E M B O J . 12, 4615. Lautner-Rieske, A., Huber, C., Meindl, A , , Pargent, W., Shable, K. F.,Thiebe, R., Zocher, I., and Zachau, H. G. (1992). Eur. J . Zmmunol. 22, 1023. Lauzurica, P., and Krangel, M. S. (1994).J. Exp. Med., in press. Lawler, A. M., Umar, A,, and Gearhart, P. J. (1992).Mol. Zmmunol. 29, 295. Leclercq, L., Butkeraitis, P., and Reth, M. (1989).Nucleic Acids Res. 17, 6809.
142
SUSANNA M. LEWIS
Lefranc, M.-P., Chuchana, P., Dariavich, P., Nguyen, C., Huck, S., Brockly, F., Jordan, B., and Lefranc, G. (1989). Eur. J . Zmmunol. 19, 989. Leiden, J. M. (1993). Annu. Reu. Zmmunol. 11, 539. Lennon, G. G., and Perry, R. P. (1990).J . Zmmunol. 144, 1983. Lewis, S., and Gellert, M. (1989). Cell (Cambridge, Mass.) 58, 585. Lewis, S., Rosenberg, N., Alt, F., and Baltimore, D. (1982). Cell (Cambridge, Mass.) 30, 807. Lewis, S., Gifford, A,, and Baltimore, D. (1984). Nature (London) 308, 425. Lewis, S., Gifford, A., and Baltimore, D. (1985). Science 228, 677. Lewis, S., Hesse, J. E., Mizuuchi, K., and Gellert, M. (1988). Cell (Cambridge, Mass.) 55, 1099. Lewis, S. M. (1994). Proc. Natl. Acad. Sci. U.S.A. 91, 1332. Lewis, S . M., and Hesse, J. E. (1991). EMBO]. 10,3631. Li, M., Morzycka-Wroblewska, E., and Desiderio, S. V. (1989). Genes Deu. 3, 1801. Lichten, M., and Haber, J. E. (1989). Genetics 123, 261. Lieber, M. R. (1991). FASEBJ. 4, 2934. Lieber, M. R. (1992). Cell (Cambridge, Mass.) 70, 873. Lieber, M. R., Hesse, J . E., Mizuuchi, K., and Gellert, M. (1987). Genes Dev. 1, 751. Lieber, M. R., Hesse, J. E., Mizuuchi, K., and Gellert, M. (1988a). Proc. Natl. Acad. Sci. U.S.A.85, 8588. Lieber, M. R., Hesse, J. E., Lewis, S., Bosma, G. C., Rosenberg, N. R., Mizuuchi, K., Bosma, M. J.,and Gellert, M. (1988b). Cell (Cambridge, Mass.) 55, 7. Lieber, M. R. (1993). In “The Causes and Consequences of Chromosomal Aberrations,” (I. R. Kirsch, ed.), p. 239. CRC Press, Ann Arbor. Limpens, J . , de Jong, D., van Kreiken, J. H. J. M., Price, C. G. A., Young, B. D., van Ommen, G., and Kluin, P. M. (1991). Oncogene 6,2271. Lin, W.-C., and Desiderio, S. (1993). Science 260, 953. Lindahl, T., and Barnes, D. E. (1992). Annu. Reu. Biochem. 61,251. Lipkowitz, S., Stern, M., and Kirsch, I. R. (1990).J . E x p . Med. 172,409. Lipkowitz, S . , Carry, V. F., and Kirsch, I. R. (1992). Proc. Natl. Acad. Sci. U.S.A. 89, 5301. Litman, C . W., Rast, J . P., Hulst, M. A., Litman, R. T., Shamblott, M. J., Haire, R. N., Hinds-Frey, K. R., Buell, R. D., Margittai, M., Ohta, Y., Zilch, A. C., Good, R. A., and Amemiya, C. T. (1992). Prog. Zmmunol. 8, 107. Litman, G. W., Rast, J. P., Shamblott, M. J., Haire, R. N., Hulst, M., Roess, W., Litman, R. T., Hinds-Frey, K. R., Zilch, A., and Amemiya, C. T. (1993). Mol. Biol. Euol. 10, 60. Lorenz, W., Schable, K. F., Thiebe, R., Stavnezer, J., and Zachau, H. G. (1988). Mol. Zmmunol. 25,479. Lotscher, E., Grzeschik, K., Bauer, H. G., Pohlenz, H., Straubinger, B., and Zachau, H. G. (1986). Nature (London) 320,456. Lu, M., Zhang, N., Raimondi, S., and Ho, A. D. (1991). Nucleic Acids Res. 20, 263. Ma, A., Fisher, R., Dildrop, R., Oltz, E., Rathbun, G., Achacoso, P., Stall, A., and Alt, F. W. (1992). EMBO J . 11, 2727. Macintyre, E. A., Smit, L., Ritz, J., Kirsch, I. R., and Strominger, J. L. (1992). Blood 80, 1511. Madrenas, J., Pazderka, F., Parfrey, N. A., and Halloran, P. F. (1992).J . Zmmunol. 148, 612. Maeda, T., Sugiyama, H., Tani, Y.,Miyake, S., Oka, Y., Ogawa, H., Komori, T., Soma, T., and Kishimoto, S. (1987).J . Zmmunol. 138, 2305.
V(D)J JOINING
143
Magrath, I. (1992). Cancer Res. 52,5529. Malissen, M., McCoy, C., Blanc, D., Trucy, J., Devaux, C., Schmitt-Verhulst, A., Fitch, F., Hood, L., and Malissen, B. (1986). Nature (London)319, 28. Malissen, M., Trucy, F., Jouvin-Marche, E., Cazenave, P., Scollay, R., and Malissen, B. (1992). Zmmunol. Today 13,315. Mallick, C. A., Dudley, E. C., Viney, J. L., Owen, M. J., and Hayday, A. C. (1993).Cell (Cambridge, Mass. ) 73, 513. Malynn, B. A,, Blackwell, T. K., Fulop, G. M., Rathbun, G. A., Furley, A. J . W., Ferrier, P., Heinke, L. B., Phillips, R. A., Yancopoulos, G. D., and Alt, F. W. (1988). Cell (Cambridge, Mass.) 54, 453. Malynn, B. A., Yancopoulos, G. D., Barth, J. E., Bona, C. A., and Alt, F. W. (1990). J . Erp. Med 171,843. Manser, T. (1990). Mol. Immunol. 27,503. Mansikka, A., and Toivanen, P. (1991).Scand. ]. Immunol. 33, 543. Marolleau, J., Fondell, J. D., Malissen, M., Trucy, J., Barbier, E., Marcu, K. B., Cazenave, P., and Primi, D. (1988). Cell (Cambridge, Mass.) 55, 291. Martin, D., Huang, R., LeBien, T., and Van Ness, B. (1991).J. Erp. Med 173,639. Matsuda, F., Lee, K. H., Nakai, S., Sato, T., Kodaira, M., Zong, S. Q., Ohno, H., Fukuhara, S., and Honjo, T. (1988). EMBO]. 7, 1047. Matsuda, F., Shin, E. K., Hirabayashi, Y., Nagaoka, H., Yochida, M. C., Zong, S . Q., and Honjo, T. (1990). EMBO J. 9,2501. Matsunami, N., Hamaguchi, Y., Yamamoto, Y., Kuze, K., Kanagawa, K., Matsuo, H., Kawaichi, M., and Honjo, T. (1989). Nature (London)342, 934. Matsuoka, M., Nagawa, F., Okazaki, K., Kingsbury, L., Yoshida, K., Muller, U., Larue, D. T., Winer, J. A., and Sakano, H. (1991). Science 254,81. Max, E. E., Seidman, J . G., and Leder, P. (1979). Proc. Natl. Acad. Sci. U.S.A. 76, 3450. Max, E. E., Seidman, J. G., Miller, H., and Leder, P. (1980).Cell (Cambridge, Mass.) 21, 793. McCormack, W. T., Tjoelker, L. W., Carlson, L. M., Petryniak, B., Barth, C., Humphries, E., and Thompson, C. B. (1989). Cell (Cambridge, Mass.) 56, 785. McCormack, W. T., Tjoelker, L. W., Stella, G., Postema, C. E., and Thompson, C. B. (1991a).Proc. Natl. Acad. Sci. U.S.A. 88, 7699. McCormack, W. T., Tjoelker, L. W., andThompson, C. B. (1991b).Annu. Reu. Zmmunol. 9, 219. McVay, L. D., Carding, S . R., Bottomly, K., and Hayday, A. C. (1991).EMBO]. 10,83. Medina, C. A,, and Teale, J. M. (1993).J.Erp. Med. 177, 1317. Meek, K. (1990). Science 250, 820. Meek, K., Hasemann, C. A., and Capra, J. D. (1989).]. Erp. Med. 170,39. Meier, J. T., and Lewis, S. M. (1993).Mol. Cell. Biol. 13, 1078. Melchers, F., Karasuyama, H., Haasner, D., Bauer, S., Kudo, A., Kakaguchi, N., Jameson, J., and Rolink, A. (1993). Immunol. Today 14, 60. Menetski, J. P., and Gellert, M. (1990).Proc. Natl. Acad. Sci. U.S.A. 87, 9324. Meyn, M. S . (1993).Science 260, 1327. Misener, V., Downey, G. P., and Jongstra, J. (1991). Znt. Immunol. 3, 1129. Miyake, S., Sugiyama, H., Tani, Y., Fukuda, T., and Kishimoto, S. (1990).J. Zmmunogenet. 17, 67. Mizuuchi, K. (l992a).]. Biol. Chem. 267, 21,273. Mizuuchi, K. (1992b). Annu. Reu. Biochem. 61, 1011. Mombaerts, P., Clarke, A. R., Rudnick, M. A,, Iacomini, J., Itohara, S., Lafaille, J . J.,
144
SUSANNA M. LEWIS
Wang, L., Ichikawa, Y.,Jaenisch, R., Hooper, M. L., andTonegawa, S. (1992a).Nature (London)360,225. Mombaerts, P., Iacomini, J., Johnson, R. S., Herrup, K., Tonegawa, S., and Papaioannou, V. E. (1992b). Cell (Cambridge, Mass.) 68,869. Moore, M . W., Durdik, J., Persiani, D. M., and Selsing, E. (1985). Proc. Natl. Acad. Sci. U.S.A.82, 6211. Mortari, F., Newton, J. A., Wang, J. Y., and Schroeder, H. W. Jr. (1992).Eur.J.Zmmunol. 22, 241. Morzycka-Wroblewska, E., Lee, F. E. H., and Desiderio, S. V. (1988). Science 242,261. Mouthon, M . A., Bernard, O., Mitjavila, M. T., Romeo, P., Vainchenker, W., and MathieuMahul, D. (1993). Blood 81,647. Muegge, K., Vila, M. P., and Durum, S. K. (1993a). Science 261, 93. Muegge, K., West, M., and Durum, S. K. (1993b).Proc. Natl. Acad. Sci. U.S.A.90,4151. Muller, B., Stappert, H., and Reth, M. (1990). Eur. J. Immunol. 20, 1409. Murray, A. W. (1992).Nature (London) 359,599. Nadel, B., Cazenave, P., and Sanchez, P. (1990). EMBOJ. 9, 435. Nash, H. A. (1990). Trends Biochem. 15,222. Nemazee, D. (1992). Res. Immunol. 143, 272. Neri, A., Barriga, F., Knowles, D. M., Magrath, I. T., and Dalla-Favera, R. (1988). Proc. Natl. Acad. Sci. U.S.A. 85, 2748. Nickerson, K. G., Berman, J., Glickman, E., Chess, L., and Alt, F. W. (1989).J . E x p . Med. 169, 1391. Oettinger, M. A. (1992). Trends Genet. 8,413. Oettinger, M. A., Schatz, D. G., Gorka, C., and Baltimore, D. (1990). Science 248, 1517. Oettinger, M. A., Stanger, B., Schatz, D. G., Glaser, T., Call, K., Housman, D., and Baltimore, D. (1992).Immunogenetics 35, 97. Ohashi, P. S., Wallace, V. A,, Broughton, H., Ohashi, C. T., Ferrick, D. A., Jost, V., Mak, T. W., Hengartner, H., and Pircher, H. (1990). Eur. J . Immunol. 20, 517. Oka, Y., Sugiyania, H., Tsukada, S., and Kishimoto, S. (1990).J . Immunol. 145, 361. Okazaki, K., Davis, D. D., and Sakano, H. (1987). Cell (Cambridge, Mass.) 49, 477. Okazaki, K., Nishikawa, S., and Sakano, H. (1988).J.Immunol. 141, 1348. Oltz, E. M., Alt, F. W., Lin, W.-C., Chen, J., Taccioli, G., Desiderio, S., Rathbun, G. (1993). Mol. Cell. B i d 13, 6223. Osman, G. E., Brodeur, P. H., Rosenberg, N., and Wortis, H. H. (1992).J. Immunol. 148, 1928. Osmond, D. G. (1993). Immunol. Today 14,34. Osmond, D. G., Kim, N., Manoukian, R., Phillips, R. A., Rico-Vargas, S. A., and Jacobsen, K. (1992).Blood 79, 1695. Palacios, R., and Samaridis, J. (1992). Mol. Cell. Biol. 12, 518. Palacios, R., and Samaridis, J. (1993). Blood 81, 1222. Pandey, A., Tjoelker, L. W., and Thompson, C. B. (1993).J . E x p . Med. 177, 329. Pandey, V. N., Dave, V. P., and Patil, M. S. (1989). Mol. Biol. Rep. 13, 179. Pandey, V. N., Dave, V. P., Amrute, S. B., Rosenbach, K., and Modak, M. J. (1991). Biochem. Biophys. Res. Commun. 181, 95. Pargent, W., Meindl, A., Thiebe, R., Mitzel, S., and Zachau, H. G. (1991). Eur. J. Immunol. 21, 1821. Parker, C. N., and Halford, S. E. (1991). Cell (Cambridge,Mass.) 66, 781. Parvari, R., Avivi, A., Lentner, F., Ziv, E., Tel-Or, S., Burstein, Y., and Schechter, I. (1988).EMBO J . 7, 739. Pennycook, J. L., Chang, Y. T., Celler, J., Phillips, R. A., and Wu, G. E. (1993).J. E x p . Med., 178, 1007.
V(D)J JOINING
145
Pergola, F., Zdzienicka, M. Z., and Lieber, M. (1993).Mol. Cell. Biol. 13,3464. Perlmutter, R. M., Kearney, J. F., Chang, S. P., and Hood, L. E. (1985). Science 227, 1597. Persiani, D. M., and Selsing, E. (1989). Nucleic Acids Res. 17, 5339. Persiani, D. M., Durdik, J., and Selsing, E. (1987).J. E x p . Med. 165, 1655. Petrini, J. H., Carroll, A. M., and Bosnia, M. J . (1990).Proc. Natl. Acad. Sci. U.S.A. 87, 3450. Petrini, J . H., Donovan, J. W., Dimare, C., and Weaver, D. T. (1994).J. Immunol. 152, 176. Pfeiffer, P., and Vielmetter, W. (1988).Nucleic Acids Res. 16, 907. Pfeiffer, P., Thode, S., Hancke, J., and Vielmetter, W. (1993). Submitted for publication. Philpott, K. L., Viney, J. L., Kay, G., Rastan, S., Gardiner, E. M., Chae, S., Hayday, A. C., and Owen, M . J. (1992). Science 256, 1448. Prinii, D., Clynes, R. A., Jouvin-Marche, E., Marolleau, J.-P., Barbier, E., Cazenave, P.-A., and Marcu, K. B. (1988).Eur. J. Zmmunol. 18, 1101. Pryciak, P. M., Sil, A,, and Varmus, H. E. (1992).E M B O J . 11, 291. Puchta, H., Kocher, S., and Hohn, B. (1992). Mol. Cell. B i d . 12, 3372. Qian, X.-H., Inman, R. B., and Cox, M. M. (1992).J . Biol. Chem. 267, 7794. Raaphorst, F. M., Timmers, E., Kenter, M. J. H., Van Tol, M . J. D., Vossen, J. M., and Schuurman, R. K. B. (1992).Eur. J . Zmmunol. 22, 247. Rabbitts, T. H. (1991).Cell (Cumbridge, Mass.) 67, 641. Radic, M. Z., Erikson, J., Litwin, S., and Weigert, M . (1993).J . E x p . Med. 177, 1165. Ramakrishnan, L., and Rosenberg, N. (1’388). M o l . Cell. B i d . 8, 5216. Ramsden, D. A., and Wu, G. E. (1991).Proc. Nutl. Acad. Sci. U.S.A. 88, 10,721. Ramsden, D. A,, and Wu, G . E. (1992). Res. Immunol. 143, 811. Rast, J . P., Hulst, M. A., Ota, T., Litman, R. T., Margiltai, M., Shamblolt, M., and Litman, G . W. (1994).Zmmunogenetics, in press. Rathburn, G., Oltz, E. M., and Alt, F. W. (1993).Znt. Zmmunol. 5, 997. Raulet, D. H . (1989).Annu. Bet;. Zmmrcnol. 7, 17.5. Raulet, D. H., Garman, R. D., Saito, H., and Tonegawa, S. (1985).Nature (London)314, 103. Raulet, D. H., Spencer, D. M., Hsiang, Y.-H., Goldman, J. P., Bix, M., Liao, N.-S., Zijlstra, M., Jaenisch, R., and Correa, I. (1991). Zmmunol. Reo. 120, 185. Razin, A., and Cedar, H. (1991).Microbiol. Rez;. 55, 451. Reichman-Fried, M . , Bosma, M. J., and Hardy, R. R. (1993).Znt. Zmmunol. 5, 303. Reilly, R. B., Blomberg, B., Imanishi-Kari, T., Tonegawa, S., and Eisen, H. N . (1984). Proc. N a t l . Acud. Sci. U.S.A. 81(2484), Reis, M . D., Griesser, H., and Mak, T. W. (1991).Biochim. Biophys. Acta 1072, 177. Reth, M . (1992).Annu. Reo. Immunol. 10, 97. Reth, M . G., and Alt, F. W. (1984).Nature (London) 312, 418. Reth, M . G . , Ammirati, T., Jackson, S., and Alt, F. (1985). Nature (London) 317, 353. Reth, M. G . , Jackson, S . , and Alt, F. W. (1986a). E M B O J . 5,2131. Reth, M., Gehrmann, R., Petrac, E., and Wiese, P. (1986b). Nature (London) 322, 840. Reth, M . , Petrac, E., Wiese, P., Lobel, L., and Ah, F. W. (1987). E M B O J . 6, 3299. Reynaud, C.-A,,Anquez, V., Dahan, A,, and Weill, J.-C. (1985).Cell (Cambridge, Mass.) 40, 283. Reynaud, C.-A., Anquez, V., Grimal, H., and Weill, J.-C. (1987).Cell (Cambridge, Mass.) 48, 379. Reynaud, C.-A,, Dahan, A,, Anquez, V., and Weill, J.-C. (1989a). In “The Immunoglobulin Genes” (T. Honjo, F. W. Alt, and T. H. Rabbitts, eds.), p. 151. Academic Press, New York.
146
SUSANNA M. LEWIS
Reynaud, C.-A,, Dahan, A,, Anquez, W., and Weill, J.-C. (1989b). Cell (Cambridge, Mass.) 59, 171. Reynaud, C.-A., Anquez, V., and Weill, J.-C. (1991).Eur. J. Zmmunol. 21,2661. Reynaud, C.-A., Imhof, B. A., Anquez, V., and Weill, J.-C. (1992).EMBOJ. 11, 4349. Ribas-Aparicio, R. M., Sparkowski, J. J., Proulx, A. E., Mitchell, J. D., and Klobutcher, L. A. (1987).Genes Deu. I, 323. Robinson, E. K., Cohen, P. D., and Blackburn, E. H. (1989). Cell (Cambridge, Mass.) 58, 887. Robinson, M. A., Mitchell, M. P., Wei, S., Day, C. E., Zhao, T. M., and Concannon, P. (1993). Proc. Natl. Acad. Sci. U.S.A.90,2433. Rolink, A., and Melchers, F. (1991).Cell (Cambridge, Mass.) 66, 1081. Rolink, A., and Melchers, F. (1993).Curr. Opinion Zmmunol. 5, 207. Rolink, A., Kudo, A., Karasuyama, H., Kikuchi, Y., and Melchers, F. (1991).EMBOJ. 10,327. Rosenberg, N. (1991). Semin. Virol. 2, 365. Rosenberg, N., and Witte, 0. N. (1988).Adu. Virus Res. 35,38. Roth, D. B., and Wilson, J. H. (1986).Mol. Cell. Biol. 6,4295. Roth, D., and Wilson, J. (1988). In “Genetic Recombination” (R. Kucherlapati and G. R. Smith, eds.), p. 621. American Society for Microbiology, Washington, DC. Roth, D. B., Porter, T. N., and Wilson, J. H. (1985).Mol. Cell. Biol. 5, 2599. Roth, D. B., Chang, X.-B., and Wilson, J. (1989). Mol. Cell. Biol. 9,3049. Roth, D. B., Proctor, G. N., Stewart, L. K., and Wilson, J. H. (1991).Nucleic Acids Res. 19, 7201. Roth, D. B., Menetski, J. P., Nakajima, P., Bosma, M. J., and Gellert, M. (1992a).Cell (Cambridge, Mass.) 70, 983. Roth, D. B., Nakajima, P. B., Menetski, J. P., Bosma, M. J., and Gellert, M. (199213). Cell (Cambridge, Mass.) 69, 41. Roth, D. B., Zhu, C., and Gellert, M. (1993). Proc. Natl. Acad. Sci. U.S.A. 90, 10788. Roth, M. E., Lacy, M. J., McNeil, L. K., and Kranz, D. M. (1988).Science 241, 1354. Roth, M. E., Lacy, M. J., McNeil, L. K., and Kranz, D. M. (1989).Science 245, 1032. Roth, M. E., Holman, P. O., and Kranz, D. M. (1991).J. Zmmunol. 147, 1075. Roth, M. E., Tjoa, B. A., Schlueter, C. J., Wilson, E. R., Lunn, B. C., and Kranz, D. M. (1992).Mol. Zmmunol. 29, 1447. Roth, M. S., Weiner, G. J., Allen, E. A., Terry, V. H., Harnden, C. E., Boehnke, M., Kaminski, M. S., and Ginsburg, D. (1990). J . Zmmunol. 145, 768. Rothenberg, E., and Triglia, D. (1983).J. Zmmunol. 130, 1627. Rothenberg, E. V. (1990).Zmmunol. Today 11, 116. Rothenberg, E. V. (1992).Adu. Zmmunol. 51, 85. Rothenberg, E. V., Chen, D., and Diamond, R. A. (1993).J. Zmmunol., 151, 3530. Rusconi, S. (1991).Erperientia 47, 866. Sadowski, P. (1986).J. Bacteriol. 165, 341. Sakano, H., Huppi, K., Heinrich, G., and Tonegawa, S. (1979).Nature (London) 280, 288. Sakano, H., Maki, R., Kurosawa, Y., Roeder, W., and Tonegawa, S. (1980).Nature (London) 286,676. Sakano, H., Kurosawa, Y., Weigert, M., and Tonegawa, S. (1981).Nature (London)290, 562. Sanchez, P., Nadel, B., and Cazenave, P.-A. (1991).Eur. J. Zmmunol. 21, 907. Sanz, I. (1991).J. Zmmunol. 147, 1720. Sauer, B. (1992).J. Mol. Biol. 223, 911.
V(D)J JOINING
147
Sawyers, C. L., Denny, C. T., and Witte, 0. N. (1991).Cell (Cambridge,Mass.) 64,337. Schatz, D. G., and Baltimore, D. (1988).Cell (Cambridge, Mass.) 53, 107. Schatz, D. G., and Chun, J . J . M. (1992). New Biol. 4, 188. Schatz, D. G., Oettinger, M. A., and Baltimore, D. (1989).Cell (Cambridge, Mass.) 59, 1035. Schatz, D. G., Oettinger, M. A,, and Schlissel, M. S. (1992). Annu. Reo. Zmmunol. 10, 359. Schlissel, M., Voronova, A., and Baltimore, D. (1991). Genes Deo. 5, 1367. Schlissel, M. S., and Baltimore, D. (1989). Cell (Cambridge, Mass.) 58, 1001. Schlissel, M. S., Corcoran, L. M., and Baltimore, D. (1991).J . E x p . Med. 173, 711. Schlissel, M . S., Constantinescu, A , , Murrow, T., Baxter, M., and Peng, A. (1993).Genes Dea. 7, 2520. Schroeder, H. W. Jr., and Wang, Y. Y. (1990).Proc. Natl. Acad. Sci. U.S.A.87,6146. Schroeder, H. W. Jr., Hillson, J . L., and Perlmutter, R. M . (1987).Science 238, 791. Schroeder, H. W. Jr., Hillson, J. L., and Perlmutter, R. M. (1989).Int. lmmunol. 2, 41. Schuler, W., Weiler, 1. J., Schuler, A,, Phillips, R. A,, Rosenberg, N., Mak, T. W., Kearney, J . F., Perry, R. P., and Bosma, M. J. (1986). Cell (Cambridge, Mass.) 46, 963. Schuler, W., Schuler, A,. and Bosma, M. J. (1990). Eur. J . lmmunol. 20, 545. Schuler, W., Reutsch, N . R., Amsler, M., and Bosma, M. J. (1991).E u r . J .lmmunol. 21, 589. Schwager, J., Burckert, N., Courtet, M., and Du Pasquier, L. (1991).E M B O J . 10,2461. Schwartzberg, P. L., Stall, A. M., Hardin, J. D., Bowdish, K. S., Humaran, T., Boast, S., Harbison, M. L., Robertson, E. J., and Goff, S. P. (1991).Cell (Cambridge,Mass.) 65, 1165. Seidrnan, J. G., Nau, M. M., Norman, B., Kwan, S., Scharff, M., and Leder, P. (1980). Proc. Natl. Acad. Sci. U.S.A.77, 6022. Sell, S . M. (1992).Comput. Chem. 12, 125. Senecoff, J., and Cox, M. (1986).J . B i d . Chem. 261, 7380. Serre, M., Evans, B. R., Araki, H., Oshinia, Y., and Jayararn, M. (1992).J.M o l . Biol. 225, 621. Serwe, M., and Sablitzky, F. (1993).E M B O J . 12,2321. Shapiro, A. M., Schlissel, M. S., Baltimore, P., and DeFranco, A. L. (1993).Mol . Cell. Biol. 13, 5679. Shapiro, M . A., and Weigert, M . (1987).1. lmmunol. 139, 3834. Sheehan, K. M., and Lieber, M. R. (1993). Mol. Cell. B i d . 13, 1363. Shimizu, T., Iwasato, T., and Yamagishi, H. (1991).J . E x p . Med 173, 1065. Shimizu, T., Takeshita, S., Muto, M . , Kubo, E., Sado, T., and Yamagishi, H. (1993). Znt. Zmmunol. 5, 155. Shin, E. K., Matsuda, F., Fujikura, J., Akamizu, T., Sugawa, H., Mori, T., and Honjo, T. (1993). Eur. J . Zmmunol. 23, 2365. Shinkai, Y., Rathbun, G . ,Lam, K.-P., Oltz, E. M., Stewart, V., Mendelsohn, M., Charron, J., Datta. M., Young, F., Stall, A. M., and Alt, F. W. (1992).Cell (Cambridge, Mass.) 68, 855. Shirakata, M., Huppi, K., Usuda, S., Okazaki, K., Yoshida, K., and Sakano, H. (1991). M o l . Cell. Biol. 11, 4528. Shirasawa, T., Miyazoe, I., Hagiwara, S., Kimoto, H., Shigemoto, K., Taniguchi, M., and Takemori, T. (1992).J . E r p . Med. 176, 1209. Shirasawa, T., Ohnishi, K., Hagiwara, S., Shigemoto, K., Takebe, Y., Rajewsky, K., and Takemori, T. (1993). E M B O J . 12, 1827. Siden, E. J. (1993).J . Immunol. 150,4427.
148
SUSANNA M . LEWIS
Silver, D. P., Spanopoulou, E., Mulligan, R. C., and Baltimore, D. (1993). Proc. Natl. Acud. Sci. U.S.A. 90,6100. Siminovitch, K. A., Bakhshi, A., Goldman, P., and Korsmeyer, S. J. (1985). Nature (London)316,260. Siminovitch, K. A., Moore, M. W., Durdik, J., and Selsing, E. (1987).Nucleic Acids Res. 15, 2699. Singh, H., LeBowitz, J. H., Baldwin, A. S., Jr., and Sharp, P. A. (1988).Cell (Cambridge, Muss.) 52, 415. Siu, G., Kronenberg, M., Strauss, E., Haars, R., Mak, T. W., and Hood, L. (1984).Nuture (London)311,344. SpieR, S., Kuhriiber, A., Shimbeck, R., and Reimann, J. (1992). Eur. J . lmmunol. 22, 1939. Staudt, L. M., and Lenardo, M. J. (1991). Annu. Reo. Immunol. 9, 373. Steen, A., Luthman, H., Hellgren, D., and Lambert, B. (1990). E x p . Cell Res. 186,236. Steinmetz, M., Altenburger, W., and Zachau, H. G. (1980). Nucleic Acids Res. 8, 1709. Stenzel-Poore, M. P., and Rittenberg, M. B. (1987).J . Zmmunol. 138, 3055. Stiernholm, N. B. J., and Berinstein, N. L. (1993). Eur. J . Immunol. 23, 1501. Storb, U., and Arp, B. (1983).Proc. Natl. Acud. Sci. U.S.A. 80, 6642. Storb, U., Haasch, D., Arp, B., Sanchez, P., Cazenave, P.-A., and Miller, J. (1989).M o l . Cell. B i d . 9, 711. Suzuki, H., Abe, M., Nishikawa, S., Nakayama, E., and Shiku, H. (1992). Znt. Immunol. 1, 643. Suzuki, H., and Shiku, H. (1992). Eur. J . lmmunol. 22,2225. Taccioli, G. E., Rathbun, G., Shinkai, Y., Oltz, E. M., Cheng, H.-L., Whitmore, G., Staniato, T., Jeggo, P., and Alt, F. W. (1992). Curr. Top. Microbiol. Immunol. 182, 107. Taccioli, G. E., Rathbun, G., Oltz, E., Stamato, T., Jeggo, P. A., and Alt, F. W. (1993). Science 260, 207. Takeda, S., Masteller, E. L., Thompson, C. B., and Buerstedde, J. (1992).Proc. Natl. Acud. Sci. U.S.A. 89,4023. Takemori, T., Mizuguchi, J . , Miyazoe, I., Nakanishi, M., Shigemoto, K., Kinioto, H., Shirasawa, T., Maruyama, N., and Taniguchi, M. (1990).EMBO J . 9, 2493. Takeshita, S., Toda, M., and Yamagishi, H. (1989). EMBO J . 8, 3261. Taniguchi, S., Hirabayashi, Y., Inoue, T., Kanisawa, M., Sasaki, H., Komatsu, K., and Mori, K. J. (1993). Proc. Nutl. Acud. Sci. U.S.A. 90,4354. Taylor, L. D., Carmack, C. E., Schramm, S. R., Mashayekh, R., Higgins, K. M., Kuo, C., Woodhouse, C., Kay, R. M., and Lonberg, N. (1992). Nucleic Acids Res. 20, 6287. Teale, J. M., and Morris, E. G. (1989).J . lmmunol. 143, 2768. Thode, S., Schafer, A., Pfeiffer, P., and Vielmetter, W. (1990). Cell (Cambridge, Mass.) 60,921. Thompson, C. B. (1992).Trends Genet. 8,416. Thompson, S . D., Pelkonen, J . , and Hurwitz, J. L. (199Oa).Proc. Nutl. Acud. Sci. U.S.A. 87, 5538. Thompson, S. D., Pelkonen, J., and Hurwitz, J . L. (1990b).J . Immunol. 145, 2347. Thompson, S. D., Manzo, A. R., Pelkonen, J., Larche, M., and Hurwitz, J. L. (1991). Eur. J . lmmunol. 21, 1939. Thompson, S. D., LarchC, M., Manzo, A. R., and Hurwitz, J. L. (1992). Zmmunogenetics 36,95. Tiegs, S. L., Russel, D. M., and Nemazee, D. (1993).J. E x p . Med. 177, 1009. Tjoa, B., and Kranz, D. M. (1992).J. lmmunol. 149, 253.
V(D)JJOINING
149
Tjoelker, L. W., Carlson, L. M., Lee, K., Lahti, J., McCormack, W. T., Leiden, J. M., Chen, C.-L. H., Cooper, M. D., and Thompson, C. B. (1990). Proc. Natl. Acad. Sci. U.S.A. 87, 7856. Traunecker, A., Oliveri, F., Allen, N., and Kajalainen, K. (1986). EMBO J. 5, 1589. Tsubata, T., Tsubata, R., and Reth, M. (1991). Eur. J . Zmmunol. 21, 1359. Tsukada, S., Sugiyama, H., Oka, Y., and Kishimoto, S. (1990).J. Zmmunol. 144,4053. Tsukada, S., Oka, Y., and Sugiyama, H. (1992). Mol. Zmmunol. 29, 401. Tsunetsugu-Yokota, Y., Minekawa, T., Shigemoto, K., Shirasawa, T., and Takemori, T. (1992). Mol. Zmmunol. 29, 723. Tuaillon, N., Taylor, L. D., Lonberg, N., Tucker, P. W., and Capra, J. D. (1993). Proc. Natl. Acad. Sci. U.S.A. 90, 3720. Turka, L. A., Schatz, D. G., Oettinger, M. A., Chun, J. J. M., Gorka, C., Lee, K., McCormack, W. T., and Thompson, C. B. (1991).Science 253, 778. Tybulewicz, V. L. J., Crawford, C. E., Jackson, P. K., Bronson, R. T., and Mulligan, R. C. (1991). Cell (Cambridge, Mass.) 65, 1153. Tycko, B., and Sklar, J. (1990). Cancer Cells 2, 1. Tycko, B., Palmer, J. D., and Sklar, J. (1989). Science 245, 1242. Tycko, B., Coyle, H., and Sklar, J. (1991).J . Zmmunol. 147, 705. Uematsu, Y., Ryser, S., DembiC, Z., Borgulya, P., Krimpenfort, P., Berns, A., von Boehmer, H., and Steinmetz, M. (1988). Cell (Cambridge, Mass.) 52, 831. Usuda, S., Takemori, T., Matsuoka, M., Shirasawa, T., Yoshida, K., Mori, A., Ishizaka, K., and Sakano, H. (1992). EMBOJ. 11,611. Van de Ven, F. J., and Hilbers, C. W. (1988). Eur. J. Biochem. 178, 1. Van Ness, B. G., Weigert, M., Coleclough, C., Mather, E., Kelley, D. E., and Perry, R. P. (1981). Cell (Cambridge, Mass.) 27, 593. Van Ness, B. G., Coleclough, C., Perry, R. P., and Weigert, M. (1982). Proc. Natl. Acad. Sci. U.S.A. 79, 262. VanDyk, L., and Meek, K. (1992).Intern. Reo. Zmmunol. 8, 123. Vila, M., Durum, S. K., and Muegge, K. (1994). In preparation. Wang, J. C., Caron, P. R., and Kim, R. A. (1990). Cell (Cambridge, Mass.) 62, 403. Wang, L. C., and Rosenberg, N. (1993). Mol. Cell. Biol. 13, 3890. Weaver, D., and Hendrickson, E. (1989). Curr. Top. Microbiol. Zmmunol. 152, 77. Wei, Z., and Lieber, M. R. (1993).J . Biol. Chem. 268, 3180. Weichhold, G. M., Klobeck, H., Ohnheiser, R., Combriato, G., and Zachau, H. G. (1990). Nature (London)347,90. Weigert, M., Gatmaitan, L., Loh, E., Schilling, S., and Hood, L. (1978).Nature (London) 276, 785. Weigert, M., Perry, R., Kelley, D., Hunkapiller, T., Schilling, J., and Hood, L. (1980). Nature (London)283,497. Weill, J.-C., and Reynaud, C.-A. (1992). Ann. N.Y. Acad. Sci. 651, 295. Whitehurst, C., Henney, H. R., Max, E. E., Schroeder, H. W., Jr., Stuber, F., Siminovich, K. A., and Garrard, W. T. (1992). Nucleic Acids Res. 18, 4929. Whitlock, C. A., and Witte, 0. N. (1982). Proc. Natl. Acad. Sci. U.S.A. 79, 3608. Wilson, J. H., Berget, P. B., and Pipas, J. A. (1982). Mol. Cell. Biol. 2, 1258. Winoto, A. (1991). Curr. Opinion Zmmunol. 3, 199. Witte, P. L., Burrows, P. D., Kincade, P. W., and Cooper, M. D. (1987).J . Zmtnunol. 138,2698. Wood, C., and Tonegawa, S. (1983). Proc. Natl. Acad. Sci. U.S.A.80, 3030. Wormann, B., Anderson, J. M., Liberty, J. A., Gajl-Peczalska, K., Brunning, R. D., Silberman, T. L., Arthur, D. C., and LeBien, T. W. (1989).J . Zmmunol. 142, 110.
150
SUSANNA M. LEWIS
Wu, L.-C., Mak, C.-H., Dear, N., Boehm, T., Foroni, L., and Rabbitts, T. H. (1993). Nucleic Acids Res. 21, 5067. Wyatt, R. T., Rudders, R. A., Zelenetz, A,, Delellis, R. A., and Krontiris, T. G. (1992). J . Erp. Med. 175, 1575. Wysocki, L. J., Manser, T., Gridley, T., and Gefter, M. L. (1986).J.Zrnmunol. 137,3699. Xu, M., Mammer, R. E., Blasquez, V. C., Jones, S. L., and Garrard, W. T. (1989).]. B i d . Chem. 264, 1190. Yamada, M., Wasserman, R., Reichard, B. A,, Shane, S., Caton, A. J., and Rovera, G . (1991).1.Erp. Med. 173, 395. Yancopoulos, G. D., and Alt, F. W. (1985). Cell (Cambridge, Mass.) 40, 271. Yaucopoulos, G. D., Desiderio, S. V., Paskind, M., Kearney, J. F., Baltimore, D., and Alt, F. W. (1984). Nature (London)311, 727. Yancopoulos, G. D., Blackwell, T. K., Suh, H., Hood, L., and Alt, F. W. (1986). Cell (Cambridge,Muss.) 44, 251. Zachau, H. G. (1990). Biol. Chem. Hoppe Seyler 371, 1. Zhao, J., and Storb, U. (1992). Deu. Zmniunol. 2, 285. Zou, Y.-R., Takeda, S., and Rajewsky, K. (1993). E M B O J . 12,811. This article was accepted for publication on 9 December 1993.
ADVANCES IN IMMUNOLOGY, VOL. 56
Generating the Antibody Repertoire in Rabbit KATHERINE 1. KNIGHT A N D MARY A. CRANE Department of Microbiology ond Immunology, Loyob University Chicago, Moywood, Illinois 60 153
1. Introduction
Rabbits preferentially utilize one V, gene in their VDJ gene rearrangements. Because, at birth, these genes are undiversified, rabbits have a limited antibody repertoire and are essentially immunoincompetent. With time, the Ig genes diversify and the rabbits become fully immunocompetent. In this paper, we review the rabbit humoral immune system and propose a model for development of the functional antibody repertoire. Our model for B cell development and generation of the antibody repertoire in rabbits is different from that for other mammals. The model gives rise to several predictions that can be readily tested and we hope that it will stimulate interest in researching this system. In the 1960s one of the major debates in immunology was about the genetic basis for antibody diversity. Immunologists argued either that the germline contained multiple V genes, each encoding a particular antibody specificity, or that the germline contained only a few V genes and that the antibody repertoire developed by somatic diversification. We now know that both ideas are correct: the germline does indeed have multiple V genes, and a large amount of the primary antibody repertoire is generated by combinatorial joining of these V gene segments with D and/or J gene segments. The resulting VJ and VUJ gene rearrangements can then be diversified by somatic diversification to develop the secondary antibody repertoire. Rabbits are unusual among mammals in that they have multiple germline V, genes, but they rearrange only one ofthem, VJ, in most B lymphocytes (Knight and Becker, 1990).That means that combinatorial joining of multiple V,, D, and J H gene segments contributes relatively little to the generation of antibody diversity and that the initial antibody repertoire of rabbits is rather limited. Becker and Knight (1990) showed that much of the antibody diversity in rabbits is generated by somatic gene conversion of rearranged VDJ genes. This observation was quite unexpected because in other mammals diversification of rearranged Ig genes occurs by somatic mutation and little, if any, 179 Copvright 0 18Y4 tn Ac,tdemi< Pie\\, Inc All rights ol reproduction 111 aiw fiirin reserved
180
KATHERINE L. KNIGHT AND MARY A. CRANE
occurs by somatic gene conversion (Gearhart et al., 1981; Clarke et ul., 1985; French et al., 1989; Kocks and Rajewsky, 1989; Maizels, 1989; Wysocki and Gefter, 1989). The task before us here is to determine, in rabbit, when and in what location somatic gene conversion occurs and whether it is active in generating the primary and/or secondary functional antibody repertoires. B cells from avian species also utilize only one V gene in their VDJ and VJ gene rearrangements (Reynaud et al., 1985, 1989). In these species, the primary antibody repertoire is generated in the bursa, during embryogenesis, by somatic gene conversion (Reynaud et ul., 1987; Thompson and Neiman, 1987). Because there are histological similarities between the avian bursa and the rabbit gut-associated lymphoid tissue (GALT), especially the appendix and sacculus rotundus (Archer et d., 1963), we suggest that in rabbit, the GALT is the bursal equivalent and that the primary antibody repertoire develops there by somatic gene conversion and somatic mutation. We begin by reviewing the rabbit B lymphoid system including B cell ontogeny, Ig gene organization and rearrangement, and development of the antibody repertoire. Then, we explore the idea that GALT is the bursal equivalent in rabbit, and, finally, we propose a model for the role of GALT in development of the primary antibody repertoire. ti. B lymphocyte Development
A. B LYMPHOPOIESIS In most mammals lymphopoiesis generally occurs throughout the life of the animal, with approximately 2 x lo' B cells produced daily in mouse bone marrow (Raff et al., 1976; Pearl et al., 1978; Osmond, 1990). In this section, we review the data concerning generation of pre-B and B cells in fetal and neonatal rabbits and discuss the possibility that little, if any, B lymphopoiesis occurs in adult rabbits. In mouse and human, the fetal liver, omentum, and bone marrow serve as primary sites for B cell development (Lawton et al., 1972; Velardi and Cooper, 1984; Solvason et al., 1991; Solvason and Kearney, 1992). In rabbit, several groups investigated the distribution of pre-B cells in these organs. One major difficulty in working with rabbit is the limited number of monoclonal antibodies and of DNA probes specific for molecules of immunologic relevance. (For informational purposes, we developed a list of rabbit-specific DNA probes and monoclonal antibodies for molecules of immunologic interest; Table I.) Because no markers for rabbit pre-B cells are available, pre-B cells
GENERATING T H E ANTIBODY REPERTOIRE I N RABBIT
181
were identified as those that are surface-Ig-negative but have cytoplasmic p-chain. Using those criteria, Hayward et ul. (1978) and McElroy et al. (1981)showed that pre-B cells first appear in liver at 17-21 days of fetal development, and they appear in bone marrow by 25 days. Solvason and Kearney (1992) reported the presence of pre-B cells in fetal omentum, but the time ofappearance was not determined. In liver, the level of pre-B cells peaked a few days after birth, and, b y day 10, the pre-B cells were barely detectable. In bone marrow, Hayward et al. (1978) reported that pre-B cells are at the highest level, approximately 9%, one day after birth and rapidly decrease to approximately 2% two days after birth and to 1% b y day 21. McElroy et (11. (1981)reported that the level of pre-B cells in bone marrow can also reach 9%, but in their experiments this peak occurred at 2-3 weeks of age. Others show that the levels of pre-B cells in newborn bone marrow range from 9.6 to 18.0% and decline as the rabbits age (Gathings et al., 1981, 1982). In all of these studies, the levels of preB cells in bone marrow from adult rabbits were estimated at 1-3%. The presence of 1-3% pre-B cells in adult rabbit bone marrow might be used to argue that B lyinphopoiesis continues to occur in adult rabbits just as it occurs in adult mice (Osmond, 1990). However, we suggest that in adults, these pre-B cells are quiescent, that B lymphopoiesis occurs early in ontogeny, that the B cells are self-renewing, and that, as in chicken (Pink et ul., 1986; Cooper and Burrows, 1989), little, if any, B lymphopoiesis occurs in adults. Several observations support these ideas. First, all rabbit B cells are CD5" (Raman and Knight, 1992), and one of the k e y characteristics of CDS' B cells, in mouse, is that they are generated early in ontogeny and are self-renewing (Hayakawa et al., 1986; Fiirster and Rajewsky, 1987). If rabbit CD5' B cells are functionally analogous to the murine CD5' B cells, and results from allotype suppression experiments in mice and rabbits suggest that they are, then rabbit B cells may also be generated early in ontogeny and be self-renewing. In the allotype suppression experiments, mice heterozygous for the IgH locus were injected with antiIgH antibody directed against one of the allelic products, and Ig bearing the allotype against which the antibody was directed was suppressed. The suppression was short-lived, as Ig molecules of the suppressed allotype appeared in serum within 6 weeks (Lalor et ul., 1989). Lalor et al. (1989) analyzed the B cells in mice that had broken suppression and discovered that the B cells that had broken suppression were all CD5-. The CD5' B cells remained suppressed, indicating that, once eliminated, they were not regenerated.
ANTIBODIES AND
Molecules CD1 CD4 CD5 CD8p C D l l a (LFA-1) CD11b (MAC-1) CDllc CD18 CD19 CD25 (IL2Ra) CD40L CD43 (leukosialin) CD44 CD45 CD58 (LFA-3) ILl IL4 IL8 ILlO MHC class I hlHC class I1 DPaIDPP
DNA
Probes" M26249 S44055 LO3204 Yes No NO
No No Yes Yes Yes
No
TABLE I MOLECULESOF
PROBES TO SELECTED
No No No X02852 Yes Yes Yes KO2819 M22640 M21465-68 M 15557
Antibodies NO
Yes Yes' Yes Yes Yes Yes Yes No Yes No Yes Yes Yes Yes No No Yes No Yesd No Yes
IMMUNOLOGIC INTEREST IN
RABBIT"
Reference Calabi et al., 1989 Kotani et al., 1993a; Hague et al., 1992 Raman and Knight, 1992; Kotani et al., 1993a DeSniet et al., 1983; Sawasdikosol et al., 1993 Kotani et a/., 1993a Smet et al., 1986; Galea-Lauri et al., 1993a Blackford and Wilkinson, unpublished data Galea-Lauri et al., 1993a Winstead and Knight, unpublished Kotani et al., 1993b; Sawasdikosol et al., 1993 Boonthum and Knight, unpublished Jackson et a / . , 1983; Wilkinson et al., 1992a Jackson et a/., 1983; Galea-Lauri et al., 1993b DeSmet et al., 1983; Jackson et al., 1983; Wilkinson et a!., 1993 Wilkinson et al., 1992b Furutani et al., 1985 Boonthum and Knight, unpublished Yoshimura and Yuhki, 1991; Harada et al., 1993 Boonthum and Knight, unpublished Marche et al., 1985; LeGuern et al., 1987 Sittisombut and Knight, 1986; LeGuern et a!., 1985 Lobel and Knight, 1984, Sittisombut and Knight, 1986; LeGuern et al., 1986
DRaIDRP
Yes
Yes
DOP Complement component C3 TNFa TNFP TCRa TCRP
M96942 M32434 M 12846 M60340 M 12885 M 14577 M14576 Yes Yes KO0752 500666 Yes X00353 100666 KO075 1 M12762 X00412 M77666 M77667 Yes
No Yes No No No No
Spieker-Polet et al., 1990; Sittisonibut and Knight, 1986; Laverriere et al., 1989 Chouchane et al., 1993 Kusano et al., 1986 Ito et al., 1986 Shakhov et al., 1990 Marche and Kindt, l986a Marche and Kindt, 1986b; Angiolillo, 1985
No No Yes Yes No Yes Yes Yes Yes Yes No No No
Sawasdikosol et al., 1993 Sawasdikosol et al., 1993 Heidmann and Rougeon, 1982a; Bernstein et al., 1983a Bernstein et al., 1983b; Knight et al., 1985 Knight et al., 1985 Knight et al., 1984 Bernstein et al., 1982; Gallarda et al., 1985 Heidmann et al., 1981; Dreher et al., 1983, Bernstein et ul,, 1983c Duvoisin et al., 1984 Mostov et al., 1984 Fuschiotti et al., 1993 Fuschiotti et al., 1993 Short, Raman, and Knight, unpublished
TCR Cy TCR C6 Ig heavy chain Cy CP CE
F
o$
W
Ca VH Ig K-chain Ig A-chain PIgR (secretory component) RAG-1 RAG-2 MB1
Cross-reactive antibodies produced against molecules from other species are not included.
* Available GenEMBL accession numbers of representative DNA sequences are included.
Anti-CD5 mAbs from Raman and Knight (1992)were made against the product of the cloned CD5 gene; anti-CD5 mAb made by Kotani et ol. (1x334 was made against rabbit thymocytes. The anti-RLA mAb is specific for RLA I of the T cell line, RL-5.
184
KATHERINE L. KNIGHT AND MARY A. CRANE
In similar studies with rabbits, Mage and Dray (1965) showed that rabbits heterozygous for the V,a or C,b allotypes, that were neonatally exposed to anti-V,a or anti-C,b alloantisera, did not express Ig of the allotype against which the antisera were directed. Such allotype suppression lasted for at least 2 years, during which time little or no suppressed allotype was found in serum or on B cells, although it was found in secretory IgA after 2-3 months (Mage and Dray, 1965; Harrison and Mage, 1973; Eskinazi et al., 1979b). Thus, the long-term allotype suppression of CD5+ B cells in rabbit is similar to the longterm allotype suppression in mice, and we suggest that the rabbit CD5' B cells are functionally analogous to murine CD5+ B cells and that, once eliminated, they are not readily regenerated. We should point out that in the allotype suppressed rabbits, low levels of pre-B cells and B cells that expressed the suppressed allotype were identified (Harrison and Mage, 1973; Simons et al., 1979).Although the presence of these cells may be used to argue against the idea that B lymphopoiesis is limited in adult rabbits, it should be noted that these cells appeared in young rabbits, between birth and 10 weeks of age, an age at which B lymphopoiesis may still be ongoing. For this reason, and because the state of allotype suppression may not represent a normal physiological state, we think that these data do not argue against limited B lymphopoiesis in adult rabbits. Additional evidence for limited B Iymphopoiesis in adult rabbits came when we searched for undiversified VDJ gene rearrangements in bone marrow by using an RNase protection assay. The rationale for this experiment was that, if B cells were continuously being produced in the bone marrow, then they would express newly rearranged, and therefore undiversified, VDJ genes. In an RNase protection assay, the RNA of these B cells would protect a probe derived from the V,l gene, which is the V, gene used in VDJ gene rearrangements in 80% of B cells (Knight and Becker, 1990). We found that RNA from bone marrow cells of 1 to 6-week-old rabbits was able to protect the V,1 probe, indicating that these cells contained mRNA derived from undiversified VDJ genes (Fig. 1).In contrast, the RNA from bone marrow of adult rabbits protected only the leader region of the probe and not the V, region of the probe, indicating that all mRNA was diversified (Fig. 1). We suggest that the B lineage cells in adult bone marrow are mostly recirculating cells whose VDJ genes have undergone somatic diversification and, further, that few if any B ceIls are newly generated. Finally, the expression patterns of the recombinase genes RAG-1 and RAG-2 give credence to the idea that limited B lymphopoiesis occurs in adult rabbits. Roux and colleagues cloned rabbit RAG-1 and
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
185
FIG. 1. RNase protection assay for undiversified V H 1 mRNA in bone marrow of 1993): 10pg of RNA young and adult rabbits. (A) Method (see Spieker-Polet et d., was hybridized to 32P-VH1antisense probe and strbser~iientlvdigested with RNase and analyzed on 5% polyacrylamide gels. The VH1probe contains the Fj’-untranslated (UT) region, leader, leader intron, and 280 bp of the V, region. Two fragments of 120 and 280 b p of the probe are protected by RNA from cells utilizing undiversified vH1; only the S’UT and leader regions of 120 b p are protected by RNA from cells utilizing VH1 that is diversified. (B) Autoradiogram of RNase-protected RNA from a positive control B lineage cell line PBL-1 that expresses a VDJ gene that utilizes undiversified VH1 (lane 1, left); bone marrow of 5-week-old rabbit (lane 2); bone marrow of three adult rabbits (lanes 3-5). Data are from M. Kingzette and K. L. Knight, unpublished data.
186
KATHERINE L. KNIGHT AND MARY A. CRANE
RAG-2 genes and performed Northern analysis of RNA from several lymphoid tissues (Fuschiotti et al., 1993). They found that RAG-1 and RAG2 were highly expressed in thymus and in newborn bone marrow, but they could not identify significant levels of either RAG-1 or RAG2 in adult bone marrow (Roux et al., 1993). The lack of expression of these genes in adult bone marrow is consistent with the idea that most VDJ gene rearrangements occur early in ontogeny and that little, if any, B lymphopoiesis occurs in adult rabbits. Taken together, the observations from CD5 expression on B cells, allotype suppression, RNase protection of undiversified VDJ genes, and expression of RAG-1 and RAG-2 genes make a strong case for the idea that B lymphopoiesis occurs early in development but does not occur in the adult rabbit. None of these experiments, however, provides direct proof for the lack of B lymphopoiesis in adults, and this issue needs to be addressed directly. B. ONTOCENY OF THE IMMUNE RESPONSE Newborn rabbits are considered to be relatively immunoincompetent. At birth, all peripheral lymphoid tissues are underdeveloped, including the spleen, which is small and has no germinal centers. The appendix, which does not have a lymphoid compartment at birth, begins to develop rapidly within the first week of life and continues until 4-6 weeks of age, at which time it fills with lymphoid follicles and germinal centers (Thorbecke, 1960). The appendix is the first peripheral organ to develop a mature lymphoid structure, which in adults contains 30-40% B cells (Harrison and Mage, 1973; Hayward et al., 1978); the spleen, Peyers’ patches, and the sacculus rotundus develop more slowly and later in ontogeny (Cooper et al., 1968). The Peyer’s patches and sacculus rotundus can usually be observed by about 2-3 weeks of age. To determine whether newborn rabbits were capable of synthesizing antibodies, investigators examined the formation of Ig and antibodies in neonatal and young rabbits. Thorbecke (1960) found that Ig was not synthesized in appendix until 1 week of age. In spleen and other lymphoid tissues it was not synthesized until 4 weeks of age. Dray and Mage and their colleagues (Vice et al., 1969; Harrison and Mage, 1973) studied allotype suppression and found that the circulating Ig of newborn rabbits was primarily of maternal origin and that Ig of the offspring’s allotype did not appear until 2 weeks of age; the levels of the offspring’s allotype Ig then increased rapidly beginning between 4 and 6 weeks of age. Tlaskalova-Hogenova and Stepankova (1980) studied the development of spontaneously arising antibodies to bacte-
GENERATING TH E ANTIBODY REPERTOIRE I N RABBIT
187
rial antigens in young rabbits, and they found that antibacterial plaqueforming cells (PFCs) occurred first in GALT, notably in the appendix, but not before 4 weeks of age. Such antibacterial PFCs did not appear in spleen or lymph node until after 12 weeks of age. Hemolytic antibodies to sheep red blood cells (SRBC)also appeared late in development, without previous immunization, between 4 and 12 weeks of age, and the cells producing these antibodies first appeared in the spleen. Taken together, these studies suggest that newborn rabbits do not synthesize Ig. On the basis of the limited development of lymphoid tissue at birth and the delayed onset of Ig production, one would predict that newborn rabbits that are immunized with antigen would be unable to mount a specific immune response to that antigen within the first 1-2 weeks of age. In fact, several investigators studied the specific immune responses of newborn and young (2- to 3-week-old) rabbits and showed that, indeed, they did not mount a normal specific immune response to a variety of antigens, including bovine serum albumin, SRBC, typhoid bacilli, and Salmonella purutyphi B (Freund, 1930; Sterzl and Trnka, 1957; Bridges et al., 1959). In an effort to determine whether the lack of ability to respond to antigen was due to the inability of the neonatal cells to respond or whether it was due to the lack of appropriate signals in their environment, Dixon and Weigle (1959) transferred neonatal cells to adult rabbits and found that they readily formed antibodies. This observation suggests that the neonatal cells are differentiation competent but that environmental factors necessary for their differentiation are absent in the neonate. These environmental factors may include growth and nutritional factors, bacterial flora, and other factors found in a fully developed rabbit. Taken together, these studies indicate that newborn rabbits are relatively immunoincompetent. The bulk of the lymphoid tissue in the spleen and gut develops after birth, and the first antibodies begin to appear in the appendix at approximately 1 week of age and in other organs a couple weeks later. Immunocompetency develops within approximately 1 week after the appendix develops. Further, it appears that an environmental factor(s) may be necessary for differentiation of immature B cells. 111. lg Genes and Gene Rearrangements
Central to the development of an antibody repertoire is the rearrangement of v, (D), and J gene segments. In this section we discuss the organization ofthe rabbit H- and L-chain genes. This organiza-
188
KATHERINE L. KNIGHT A N D MARY A. CRANE
tion is largely similar to that of other mammals (Fig. 2), except that rabbit has only 1 C y gene and 13 C a genes, compared with 4 Cy genes and only 1 or 2 C a genes in human, mouse, rat, and cow (Flanagan and Rabbitts, 1982; Shimizu et al., 1982; Knight et al., 1985; Bruggemann et al., 1986; Burnett et al., 1989).
A. VH, D, AND JH GENES As with other mammals, the rabbit genome contains a large pool of V, genes that can contribute to the antibody repertoire. The V, chromosomal region contains an estimated 200 V, genes, separated by an average of 5 kb (Currier et at., 1988). Five functional and one nonfunctional JH gene segments reside 63 kb downstream of the VH
K LIGHT CHAIN LOCUS
...
VK
JK ‘K1
...--* VK
/I.
JK
ct
-1Mb
b LIGHT CHAIN LOCUS Vk2
Vk3 vVi4
JiCk5
JkCi6
+-H+3kb
M
FIG.2. Organization of heavy-chain, K light-chain, and A light-chain genes. The organization of the C, genes shown in parentheses is not yet known: however, within the two clusters ofC, genes (Gal, C,2, C,3, C,7, C,10, and C,11) and (C,8 and C,9), the order is as shown. Heavy-chain gene organization is from Becker et al., (1989) and Burnett et al. (1989); K-chain gene organization is from Emorine and Max (1983) and Hole et al. (1991b); A-chain organization is from Duvoisin et al. (1988); the linkage of V, genes to C, genes is arbitrary as the association of these V, and C, genes has not been established either by overlapping phage/cosmid clones or by their association in cDNA clones.
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
189
genes, with 11 known D gene segments i n between (Becker et ul., 1989; Friedman et ul., 1994). The VH genes are generally more than 80% similar and consequently are members of 1 large V, gene family (Bernstein et ul., 1985; McCormack et al., 1985; Currier et ul., 1988; Knight and Becker, 1990) as compared with niurine and human V, genes, which are grouped into 10 and 6 V,, gene families, respectively 1989; Pascual and Capra, 1993). (Brodeur and Riblet, 1984; Lai et d., The high similarity among rabbit V, genes enhances their ability to function as donors in gene conversion events (McCormack and Thompson, 1990a). On the basis of the nucleotide sequence of 49 germline V, genes, approximately one-half of them appear functional as they encode a normal leader and VH region and have conserved heptamer/nonamer recombination sequences (Bernstein et at., 1985; Gallarda et ul., 1985; McCormack et al., 1985; Currier et ul., 1988; Fitts and Mettzer, 1990; Knight and Becker, 1990; Roux et ul., 1991; Short et al., 1991; Raman et ul., 1994). We note, however, that even though one-half of the V, genes appear functional, the promoter regions of most of these are not characterized because the V, genes are generally cloned on small PstI fragments that do not include the promoter regions. Consequently, we cannot be certain that all potentially functional VH genes have functional promoter regions and are expressible. In most species, the first Ig gene rearrangements to occur are D to JH on both heavy-chain alleles in early B lineage cells (reviewed in Cooper and Burrows, 1989). Second, in pre-B cells, a V,, gene rearranges to the DJ,, gene rearrangement on one allele and a p heavy chain is synthesized. Subsequently, the light-chain genes rearrange and a complete Ig molecule is produced. H-chain genes are also the first Ig genes to rearrange in rabbit B lineage cells, as evidenced by the fact that pre-B cells in newborn rabbit bone marrow have cytoplasmic H chains but lack L chains (Gathings et al., 1982). Although the order of rabbit V,, D, and J H gene rearrangements is not yet known, Southern analysis of DNA from B cells of normal rabbits identified unrearranged JH gene segments. The presence of germline JH gene segments suggests that J,, gene rearrangements may occur on only one allele (Becker et ul., 1990; Allegrucci et ul., 1991). Even though we do not know the actual percentage of B cells that have unrearranged JH gene segments on the unexpressed allele, preliminary data (C. Tunyaplin and K. L. Knight) suggest that this is true in nearly all B cells. This means that, unlike other species, rabbit DJH gene rearrangements do not occur on both H-chain chromosomes. This suggests either that one H-chain chromosome is inactive or that the first
190
KATHERINE L. KNIGHT AND MARY A. CRANE
H-chain gene rearrangements are VH to D on both chromosomes followed by a rearrangement of VD to J H on one allele. Indeed, we have cloned a VD gene rearrangement from a leukemic B cell line (Table 11), and several VD gene rearrangements have been amplified by polymerase chain reaction (PCR) from DNA of normal spleen and bone marrow cells (S. K. Zhai and K. L. Knight, unpublished data). We have also PCR-amplified DJ gene rearrangements from DNA and from cDNA derived from normal spleen and bone marrow cells, indicating that the H-chain gene rearrangements can occur as either V, to D or D to J H . It is not known whether one or both VD and DJ gene rearrangements can serve as intermediates for VDJ gene rearrangements. To elucidate the order of v,, D, and J H gene rearrangements, we need to examine the DNA rearrangements that have occurred in clonal populations of pre-B and B cells. It has been difficult to study Ig gene rearrangements in individual clones of lymphocytes because no rabbit B lineage-transforming virus has been identified and because no successful rabbit B lineage fusion partner has been developed. In an attempt to generate stable B cell lines, Knight et al., (1988a,b) developed transgenic rabbits with the c-myc gene driven by either the H-chain enhancer (E,) or the K-chain enhancer (EJ. Transgenic rabbits with the E,-myc transgene developed B cell leukemia, whereas some of those with the E,-myc transgene developed B lymphoma. Three stable B lineage cell lines were developed from these transgenic rabbits, and, on the basis of morphology and surface Ig expression, they appear to b e either late TABLE I1 HEAVY-CHAIN GENEREARRANGEMENTS ON THE UNEXPRESSED ALLELEI N RABBIT LEUKEMIC B LINEAGE CELLS Name
Cell Type
PBLl
Pre-B B cell B cell
55D1 79E
Rearrangement on unexpressed allele
VD
Germline J (VDJ)" Noneb
" By Southern analysis, J H genes of the unexpressed allele (a3)were unrearranged early in developnient of the cell line but rearranged to a VDJ gene during culture. 'I By Southern analysis, J H and D genes on unexpressed chromosome were on germline-sized fragments.
GENERATING THE ANTIBODY REPERTOIRE I N RABBIT
191
pre-B or early B cells (Knight et al., 1988a,b; P. Setupathi and K. L. Knight, unpublished data). The H-chain gene rearrangements of these three cell lines were examined, and all had functional VDJ gene rearrangements on one H-chain chromosome. However, on the unexpressed chromosome, each of the cell lines differed in their H-chain gene organization (Table 11).One of the cell lines, 79E, appeared to have no D or JH gene rearrangement, one, PBL1, had a VD gene rearrangement, and the other, 55D1, had a VDJ gene rearrangement. The presence of functional VDJ gene rearrangements on both heavychain chromosomes, a'la3 in the cell line, 55D1, defies the rule of allelic exclusion and we think that the VDJ gene rearrangement on the a3 chromosome occurred during in vitro culturing. Southern blot analysis of D N A taken from these cells early in the in uitro culture period revealed that the JHgenes on the a3 chromosome were in germline configuration but, after several months, the JH genes on the a3 chromosome were rearranged. Although data from these cell lines show that rabbit B cells rearrange their VH, D, and J H gene segments differently than mouse and human B cells, they do not establish the order in which these genes are rearranged. It will be important to establish normal long-term B cell lines either by activating them with CD40L and IL4 (Banchereau et al., 1991) or by immortalizing them by viral transformation or by somatic cell fusion with a rabbit fusion partner. B. CH GENES The rabbit CHchromosomal region is unique in that it contains 16 CHgenes that span over 200 kb and include 13 C, genes plus one each ofC,, C,, and C,genes (Fig. 2 ) (Knight et al., 1985;Burnett et al., 1989). The C, and C,genes are separated by 55 kb, whereas the remainder of the CH genes are separated by 10-15 kb. A switch region is found approximately 2 kb upstream of each CHgene. No gene for C, has been identified in the rabbit. Because Wilder et al. (1979) and Eskinazi et nl. (19794 identified immunochemically an Ig-like molecule that was non-IgM, non-IgA, and non-IgG, on the surface ofmost B lymphocytes, we extensively searched the DNA between the C, and C, genes for a 8-like heavy-chain gene. Using the human and mouse C, probes (Tucker et al., 1980; White et al., 1985),we found no specific hybridization in this region of DNA, which suggested to us that the rabbit genome does not have a C, gene. We point out, however, that 8heavy chains are evolutionarily the least conserved of the heavy-chain isotypes, and we cannot exclude the possibility that the rabbit germline
192
KATHERINE L. KNIGHT A N D MARY A. CRANE
has a C , gene but that we did not detect it because it may have low homology with mouse and human probes. Just as no C , gene could be cloned from a genomic DNA library, no C, cDNA has been identified in cDNA libraries constructed from splenic RNA. We screened cDNA libraries for potential Cgencoding clones by probing first with V, to identify H-chain-encoding clones and then with p, a, y, and E probes to identify a cDNA clone that hybridized with a V, probe but that did not hybridize with p., a , y, or E probes. To date no such clone has been identified. Although these data support the notion that rabbit does not have IgD, we cannot rule out the posibility that IgD is present but is expressed at levels too low to be identified by this method, especially because the cDNA libraries were derived from total splenic RNA, including RNA from plasma cells, rather than from RNA of purified B cells. Perhaps the most unusual characteristic of the rabbit H-chain chromosomal region is the presence of 13 C, genes (Fig. 2). Nucleotide sequence analyses of these genes indicate that each encodes a functional protein. To test whether the 13 C, genes are expressed, hybrid mouse x rabbit a-chain genes were constructed by ligating each of the 13 C, genes to a murine VDJ gene (Schneiderman et al., 1989). The constructs were transfected into a murine L-chain-secreting hybridoma, and stable transfectoma cell lines were tested for their ability to secrete chimeric rabbit x mouse IgA molecules. Results from these studies showed that at least 12 of the 13 IgA genes are expressible. Further, Schneiderman and colleagues showed that each of these chimeric IgA molecules bound secretory component and that they activated complement by the alternative pathway (Schneiderman et al., 1989; 1990). By RNase protection assays, Spieker-Polet et a1. (1993)showed that 11ofthe 13C, genes are expressed but that they were differentially expressed in various mucosal tissues, including gut, appendix, mesenteric lymph node, and mammary tissue. Surprisingly, only 1 of the genes, C,4, was expressed in lung and tonsil. C,4 is the 5’-most C, gene and Spieker-Polet et al. (1993) proposed that IgA-producing cells may be derived from B cells that have initially undergone isotype switching to C,4 followed by isotype switching to a more 3’ C, gene. However, no direct data to support this idea are available. Because rabbits belong to one of two families of lagomorphs and because Burnett et al. (1989) showed that members of each family have multiple germline C, genes, the expansion of germline C, genes must have occurred in acommon ancestor oflagomorphs. The immunologic significance of 13 IgA isotypes is not clear. The 13 C, genes are generally more than 80%similar, but they differ extensively from each
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
193
other in the hinge region and we suggest that the functional differences among the IgA isotypes may be due to differences in the hinge regions. Burnett et al. (1989) suggested that the rabbits may have a diverse microbial flora in the gut, with these organisms producing several IgA proteases (Plaut et al., 1975). If so, then, the rabbits may need multiple IgA isotypes to protect themselves from these proteases. The IgA proteases that cleave human IgA target the hinge region and, assuming the same would be true for IgA proteases found in rabbit microbial flora, it would make sense that the IgA heavy chains would differ in the hinge region. C.
K
LIGHT-CHAIN GENES
Among mammals, the rabbit K-chain chromosomal region is unusual in that there are two, instead of one, C, genes, C,1 and C g . By pulsedfield analysis, these genes appear to be separated by 1 Mb (Fig. 2) (Benammar and Cazenave, 1982; Emorine and Max, 1983; Heidmann and Rougeon, 1983; Hole et al., 1991b). Each C,gene is associated with a separate 5' cluster of J, genes (Emorine and Max, 1983) and most likely by a 5' cluster of V, genes (Hole et al., 19Ylb). In normal rabbits, K light chains represent 90-95% of total L chains, and nearly all ofthem are derived from C,1 and are designated as the K1 isotype. Five allelic forms of C,1 are known, and they encode the C, allotypes b4, b4v, b5, b6, and b9. The C g gene encodes the K2 isotype of K light chains, but it is rarely expressed, except in some b9 rabbits, wild rabbits, mutant Basilea rabbits, and allotype-suppressed rabbits (Good et al., 1980; Benammar and Cazenave, 1982; Garcia et al., 1982; Emorine and Max, 1983; Heidmann and Rougeon, 1983; Catty et ul., 1985). Relatively little is known of germline V, genes, although Southern analysis of germline DNA identified multiple V,-hybridizing fragments, indicating that the germline contains multiple V, genes. It is not known how many of the V, genes are expressed. The molecular basis for the limited expression of the C g gene is unclear, but Emorine and Max (1983) showed that, compared with the J-C,l intron (Emorine et al., 1983a,b), the J-C,2 intron contains several deletions and mutations, including mutations within the intron-enhancer region. Hole et al. (1991a) tested whether the lack of expression of C$ was due to the lack of a second C, enhancer, 3' of C, genes, that was first identified with the murine C,gene (Meyer and Neuberger, 1989).They found functional 3' enhancers for both C,1 and C$ genes; hence, decreased expression ofthe C g gene is probably not due to the 3'-enhancer region but rather is due to mutations/deletions in the intron enhancer of C$. Results from studying the Basilea rabbit
194
KATHERINE L. KNIGHT AND MARY A. CRANE
discovered by Kelus and Weiss (1977)demonstrate that if the C,1 gene cannot be expressed, then the C,$ gene is readily expressed (Garcia et al., 1982). The Basilea rabbit has a mutation in the acceptor site for RNA splicing in the C,I gene; it is probably this mutation that accounts for the decreased expression of the C,I gene (Lamoyi and Mage, 1985). The Basilea rabbit has increased expression of A light chains as well as C g light chains to compensate for the loss of C,1 light chains (Jaton and Kelus, 1977).
D. A LIGHT-CHAIN GENES Lambda light chains comprise 5-10% of total Ig light chains (Dray et al., 1963b), and because of their low expression in serum, relatively little is known about the proteins. The germline contains a small number of V, and C, genes, and their organization appears similar to that of other mammals (Fig. 2) (reviewed in Selsing et al., 1989). On the basis of Southern analysis, the germline contains up to eight C, genes, six of which are cloned and designated C,l-C,6 (Duvoisin et al., 1986, 1988), but only two of which, c,5 and c,6, appear to be expressed. The c,5 and c,6 genes are separated by 4.7 kb of DNA, and each is associated with a JA gene segment; the other four cloned, but unexpressed C, genes, are not associated with a J, gene segment. Two allotypic specificities, c7 and c21, are associated with A-chains, and, although these allotypes segregate as alleles in some rabbit colonies, they are inherited as linked genes in other colonies (Gilman-Sachs et al., 1969). Hayzer et al. (1987)showed that the CA5 gene encodes the c21 allotype; the gene encoding the c7 allotype is not yet cloned. The germline may well contain another functional J,/C, gene combination that encodes for the c7 allotype. It is not yet known whether all of the J,/C, genes are associated with the same group of VA genes or whether there is more than one cluster of VA-JA/CA genes. By Southern analysis, the germline contains approximately fiveV, genes (Hayzer et al., 1987). Four of these genes are cloned, and two, v,2 and vA3, appear functional. The v$, V,3, and v,4 genes are closely linked to each other but have not yet been linked by cosmid or phage clones to the c,5 and c,6 genes (Hayzer et al., 1987; Hayzer and Jaton, 1989a,b). IV. Development of the Antibody Repertoire
In most mammals, the primary antibody repertoire consists of a vast array of antibodies of diverse specificities formed by combinatorial joining of multiple VH, D, and JH gene segments; association of H and L chains; junctional diversity; and N region addition. Of these,
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
195
combinatorial joining is certainly a major contributing factor to the diversity ofthe primary repertoire. In rabbit, the extent to which combinatorial joining can contribute to the generation of antibody diversity and therefore to generation of a diverse primary repertoire is severely limited due to the fact that, although the genome has multiple functional vHgenes, B cells use predominantly one v, gene, VHl, in the VDJ gene rearrangements (Knight and Becker, 1990; Knight, 1992). Rabbit, like chicken, uses somatic gene conversion to generate antibody diversity (Becker and Knight, 1990). Here we examine V, gene usage and the role of somatic diversification in generating the antibody repertoire. Because Knight and Becker (1990)discovered the preferential use of one V, gene in VDJ gene rearrangements while attempting to explain the genetic inheritance of V, allotypes and because, historically, the V, allotypes played an important role in early discussions of antibody diversity (reviewed in Mage, 1981; Kindt and Capra, 1984), we briefly review the enigma posed by the V, allotypes and how the solution of this enigma impacted discussions on the generation of antibody diversity. A. THEVH ALLOTYPEENIGMA With the discovery of VH-region allotypes (Oudin, 1956a, b), rabbit became the species of interest for immunologists studying Ig structure and generation of antibody diversity. The V,a allotypic specificities a l , a2, and a3, are present on approximately 80% of serum Ig heavy chains (Dray e t al., 1963b), and they correlate with particular amino acids at several positions distributed within V, FR1 and FR3 (Mage et al., 1984). These allotypes are inherited in an allelic fashion (Dray e t al., 1963a), and it was this allelic inheritance that was difficult to explain. The argument was that if the germline contained hundreds of V, genes to generate antibody diversity and most of them both encoded the V,a allotype and were expressed in B cells, then we would expect that meiotic recombination among the VHgenes would have shuffled the VHaallotypes such that their allelic behavior would be lost after several generations of progeny. So, the problem was, how could these V, allotypes be encoded by multiple VHgenes and yet be inherited as allelic genes?
B.
VH
GENEUSAGE
1 . Preferential Use of VHl While investigating the V, allotype problem, Knight and Becker (1990) analyzed VDJ gene rearrangements in B cells from leukemic
196
KATHERINE L. KNIGHT AND MARY A. CRANE
E,-myc transgenic rabbits and discovered that the 3'-most VHgene, VHl, was used in most of the VDJ genes (Becker et al., 1990). Because the v H1 gene from the a', a2, and a3 heavy-chain chromosomes encoded the a l , a2, and a3 V, allotypes, respectively, the authors hypothesized that VHf was preferentially utilized in VDJ gene rearrangements in normal B cells and that this preferential utilization explained the allelic inheritance of the VHa allotypes. Support for the idea that VHl was preferentially used in VDJ genes came from studying a mutant rabbit, Alicia, that, practically speaking, is a spontaneously derived V,l knock-out rabbit. The Alicia rabbit, identified by Kelus and Weiss (1986), is genotypically a2/a2and has normal levels of Ig, but the level of a2 Ig is markedly decreased. Analysis of germline DNA from the Alicia rabbit revealed a 10-kb deletion that spanned the a2-encoding gene, VHl (Knight and Becker, 1990; Allegrucci et al., 1990). Thus, the loss of VHl resulted in the loss of VHa2allotype Ig, indicating that most VHa2Ig is probably derived from B cells that utilize vH1 in their VDJ gene rearrangements. Because normally 80-90% of Ig molecules in an a2a2 rabbit are VHa2 (Dray et al., 1963b), it seems that vH1 is preferentially used in VDJ genes in most B cells. Still more confirmation that V,,l is preferentially used in VDJ genes was obtained from studies by Raman et ul. (1994) who examined stable VHa allotypesecreting rabbit x mouse hybridomas developed from fusion of murine SP2/0 cells with adult rabbit spleen cells. In these experiments, eight of nine hybridomas utilized VHl in their VDJ gene rearrangements. Because approximately 80% of serum Ig molecules have V,a allotypic specificities, the finding that eight of nine V,a-secreting B cells from normal rabbits use VHl indicates to us that V,l is the predominantly used V,, gene in rabbit B cells.
2 . Other Utilized V HGenes While approximately 8 0 4 0 % of Ig molecules have VHa allotypic specificities and are encoded by VHl, the remaining 10-20% of Ig molecules do not have V,,a allotypic specificities and are designated VHa-negative(Dray et al., 1963b). The V, genes that encode these V,anegative molecules were studied both in allotype-suppressed rabbits, whose serum Ig molecules were predominantly V,a-negative (Short et nl., 1991), and in mutant Alicia rabbits that predominantly express VHa-negative Ig molecules (DiPietro et al., 1990; Chen e t al., 1993). Short e t al. (1991) developed VHa allotype-suppressed rabbits by injecting newborn a2/a2rabbits with anti-a2 allotype antiserum. They PCR-amplified and cloned the VDJ genes and then examined the V, genes used in the VDJ gene rearrangements. The V, molecules fell into two groups, designated V,x and VHy.A germline counterpart of
GENERATING THE ANTIBODY KEI'ERTOIRE I N KARHIT
197
the VHy gene was cloned and expressed in vitro and shown to encode V, molecules of the y33 allotype, an allotype discovered by Kim and Dray ( 1973) that is associated with V,a-negative molecules. The exact location of the germline V,y-encoding gene is not known, but it is at least 48 k b 5' of VH1. A germline gene encoding V,X molecules has not yet been cloned. In studying the genes encoding the VHa-negative molecules of the Alicia rabbit, DiPietro et al. (1990)and Chen et al. (1993) again found only two major types of Via-negative molecules, VHX
and VHy.
Because some of the studies described above were performed in adult rabbits, after the VDJ genes were somatically diversified, the identity of some of the genes was difficult to establish. Therefore we analyzed VDJ gene rearrangements in young rabbits prior to the time that their VDJ genes would be diversified beyond unequivocal recognition (Friedman et al., 1994). The VDJ genes were PCR-amplified, from cDNA, and we found that all but 2 of 52 VDJ gene sequences utilized v H 1 , V,,x, or V,,y. The other 2 did not appear to encode V,a allotypic determinants, and they presumably encode a minor population of VHa-negativemolecules that were designated V,Z. These data, taken together with data from the leukemic ral)bits, B cell hybridomas, Alicia rabbits, and VHa allotype-suppressed rabbits, indicate that essentially all of the v, repertoire is encoded by 4 vHgenes, VH1,V,X, VHy, and VHZ. Even though the data indicate that V,,1 is the gene used to encode most VHa allotype molecules, the mutant Alicia rabbits and the rabbit x mouse heterohybridonias demonstrate to us that VHaallotype Ig can be derived, albeit infrequently, from a gene other than V,1. In the case of the nine V,,a allotype-secreting rabbit x mouse heterohybridomas, one of them used a gene other than VH1, but its identity and germline location are unknown (Raman et al., 1994). As for Alicia rabbits, despite not having the V,1 gene, up to 30% ofthe Ig molecules in adults express the a2 allotypic specificity. Chen et al. (1993) studied the a2-encoding cDNA molecules from adult Alicia rabbits and found that they fall into two groups, VH1-like and V&-like. Since the Alicia rabbits do not have a V,,1 gene, they must be using another, as-yetunidentified V,, gene. We think it is likely that the a2 Ig molecules result from gene conversion of a V,a-negative-encoding VDJ gene by an upstream V, gene that encodes a2 allotypic determinants.
3. Preferentiul Rearrangement or Selection The preferential usage of V, genes, especially VH1, could be due to preferential V,, gene rearrangement or to antigen selection of B cells that express particular V,, genes. To differentiate between these
198
KATHERINE L. KNIGHT A N D MARY A. CRANE
two possibilities, we need to examine VDJ gene rearrangements in pre-B cells that do not yet have surface Ig expression. Ifthe preferential usage of VHl is due to preferential rearrangement, then we would expect to find that approximately 80% of the VDJ genes utilized VHl, but if the preferential usage is due to selection, then we would expect to find many V, genes rearranged. At present there are no phenotypic markers for pre-B cells in rabbit, and the best source of pre-B cells is neonatal bone marrow. Therefore, Friedman et al. (1994) began to investigate V, gene usage in VDJ genes of bone marrow and spleen cells of newborn rabbits. The authors found that 80% of the VDJ genes cloned from these tissues utilized VHl, and they suggested that preferential usage of vH1 is due to preferential rearrangement rather than to selection. To directly test this idea, these experiments need to be repeated with purified pre-B cells. C. SOMATIC DIVERSIFICATION
1 . Somatic Gene Conversion As mentioned previously, the predominant usage of V H l in VDJ gene rearrangements in rabbit severely limits the extent to which combinatorial joining can contribute to the generation of antibody diversity. The chicken rearranges only one V, and one V, gene, and the rearranged VDJ and VJ genes extensively diversify by somatic gene conversion (Reynaud et al., 1985, 1987, 1989; Thompson and Neiman, 1987; McCormack and Thompson, 1990b).Therefore, Becker and Knight tested whether the rabbit VDJ genes diversify by somatic gene conversion by comparing the nucleotide sequences of diversified VDJ genes with the nucleotide sequence of the germline vH1 gene (Becker and Knight, 1990). They found many examples of diversified VDJ genes, and the diversification included codon insertions and deletions as well as clusters of mutations. Such codon insertions and deletions do not occur by somatic point mutation; rather, they are characteristic of gene conversion. If such mutations resulted from gene conversion, the germline must contain donor V, genes upstream of VHl that have nucleotide sequences identical to the diversified regions. In searching the database of nucleotide sequences of rabbit germline V, genes, Becker and Knight (1990) and Raman et al. (1994) identified several examples in which the nucleotide sequence of the diversified region was identical to a region of a donor VHgene 5’ of vH1 (Fig. 3 ) .We conclude that rabbit uses a somatic gene conversion-like mechanism as a means of generating antibody diversity. In chicken, diversification of the rearranged V, and V, genes occurs by somatic gene conversion during fetal development (McCormack
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
199
Leader lntron v,1 10-6 V,,b V,l 10-6 V,&
cgnngcactgagtctgggagaggacgtgagtgagagacacagacagtgtgagtgacag/tacctgaccatgtcgtctgtgttttcag
- c - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -9-~"~---~-~--'C-f---------------------g---~----------------------t----.------------- g-~--'--------'C-t------------t---------- 9 - - -1 FRl GT GTC CAG TGT CAG / / I TCG T T G GAG
-- _ _ _ - - _ _ _ _ _ _ _ -- _ _ _ _ _ _ _ _ _ _ _ _
GAG CA- C - GAG CA- C - -
_--
---
FIG.3. Somatic gene conversion of VHl-utilizingVDJ genes. (A) Diversified region of VDJ gene 15-23 spanning 142 bp from the leader intron through FR1, with germline V& as a potential donor gene. (B) Diversified region of VDJ gene 30-10 spanning 103 bp from the leader intron through FR1 with germline vH3 as a potential donor gene. (C) Diversified region of VDJ gene 10-6 spanning 113 bp from the leader intron through codon 5, with germline vH4 as a potential donor gene. Sequence ofthe utilized VH1gene is shown above the diversified sequence and the sequences of the potential donor genes are shown below the diversified gene. (Data are taken from Raman et ~ l , 1994.) Numbers refer to codon numbers according to Kabat et d. (1987).
and Thompson, 1990b) and the chick is born with a diverse primary antibody repertoire. To examine the timing of gene conversion and development of the primary antibody repertoire in the rabbit, VDJ gene rearrangements were examined from lymphoid tissues taken from various organs of rabbits ranging in age from newborn to 2 months old. The VDJ gene rearrangements were cloned and compared to germline V , 1 . In rabbits that were 1-10 days old, the sequences were generally undiversified (Fig. 4), indicating that the gene conversion process had not yet begun in these animals (Friedman et al., 1994). At 4-5 weeks of age, the sequences are stiIl mostly undiversified, although there are some indications of diversification (Crane and
FRl
VH1-a2 599 579 583 675 681 715
CDRl
FR2
Q S V K E S E G G L F K P T D T L T L T C T V S G F S L S S N A I S U V R Q A P UGTCGGTCMGGAGTCCGAGGGAGGTCTCTTCMGCCMCGGATACCCTGA~CT~CCTGU~GTCTCTGGATTCTCCCTCAGTAGCMTGCMTMGCTGGGTCCGC~G~TC~
........................................................................................................................ ........................................................................................................................ ........................................................................................ c............................... ........................................................................................................................ ........................................................................................................................ ........................................................................................................................ G
N
G
L
E
U
I
CDR2 G A
I
G
S
S
G
S
A
Y
Y
A
S
U
A
K
FR3 S R
S
T
I
T
R
N
T
N
L
N
T
V
T
L
K
VH1-a2 599 579 583 675 681 715
GGCMCGGGCTGWATGWTCGWGCCATTGGTAGTAGTGGTAGCGCATACTACGCGAGCTGGGCGAAAAGCCGATCCACCATUCCAGAMCA~CAC~CCTCM~CGGTGACTCT~
VM1-a2 599 579 583 675
ATGACCAGTCTGACAGCCGCGGACACGGCCACCTATTTCTGTGCGAGA
681 715 599 579 583
675 681 715
.....G........................................................G.
............................................................................................ G......................C.... ........................................................................................................................ ........................................................................................................................ ........................................................................................................................ ........................................................................................................................ M
T
S
L
T
A
A
D
T
A
T
Y
F
C
A
R
N-SEG
................................................ ................................................ ................................................ ................................................ ................................................ ................................................
............................... .................................. .................................... .................................... ............................... ....................................... J"
GGA
GATG GATTCCCC TTGAGGGT
GGG
GGC D2a D1 D1 D5 D1 D2b
D"
....................................... ...................... ...................
....................... .............. ...........................
54 J4 J4 J2 J4 J3
FIG.4. Comparison of the nucleotide sequence of germline V H lto the sequences of six VDJ gene rearrangements isolated from cDNA derived from spleen and bone marrow of newborn to 10-day-old rabbits. The germline D and J gene segments used in each VDJ gene rearrangement are indicated. Dots indicate identity. Framework (FR) and complementarity-determining regions (CDR) are according to Kabat et a / . (1987).The nucleotide sequence analyses were performed in only one orientation, J to V.
N-SEG CGA CTTMG CCCTAC AC
cccccc
GENERATING T H E ANTIBODY REPEHTOIHE IN RABBIT
20 1
Knight, unpublished data). At 7-8 weeks of age, the sequences are very diversified (Fig. 5).Much ofthe diversification is consistent with the types of mutations seen in gene conversion events, i.e., codon insertions, codon deletions, and clusters of nucleotide changes. By 2-3 months of age, the VDJ gene rearrangements resemble those seen in adult rabbits in terms of the amount of diversification and, to date, all VDJ genes that have been examined from rabbits 2 months of age or older are diversified, whether they were cloned from PBL, spleen, or appendix. Taken together, the data show that the newborn and young rabbit have relatively undiversified VDJ gene rearrangements, resulting in a limited repertoire. Beginning at about 1 month of age, the somatic gene conversion-like process begins diversifying the initial limited repertoire such that another repertoire is created that is far more diverse than the original. We suggest that this repertoire functions as the primary antibody repertoire and bestows imniunocompetency on the rabbit. We currently do not know whether the gene conversion-like process is antigen-driven or whether it is initiated developmentally, independent of antigen stimulation. Experiments with germfree rabbits could begin to address this issue, at least in terms of the involvement ofmicrobial antigens. Regardless, we suggest that somatic gene conversion is a major mechanism by which rabbit VDJ genes diversify and form the primary antibody repertoire.
2. Somatic Mutution
The D regions of VDJ genes from adult rabbits are quite remarkable because, in general, they are all distinct from one another and they often do not resemble any of the known germline D gene segments (DiPietro and Knight, 1990). In contrast, the D regions of VDJ genes from newborn rabbits are identical to the known germline D gene segments. We conclude that the D regions in VDJ genes of adult rabbits are highly diversified. The D regions are probably diversified by somatic mutation rather than by gene conversion for the following reasons: First, no segments of germline DNA have been found that could function as potential donor sequences for the diversified D regions. Whereas, in chicken, the donor sequences for the D regions are fused with the upstream nonfunctional donor V,, genes (Reynaud et al., 1989), in rabbit, no such ftised germline VD genes have been found (Bernstein et al., 1985; McCormack et ul., 1985; Currier et ul., 1988; Fitts and Metzger, 1990; Knight and Becker, 1990; Roux et d . , 1991; Raman et ul., 1994). Next, analysis of D regions of VDJ genes from newborn to 9-week-old rabbits showed progressive diversification between 3 and 9 weeks of age (Short et d . , 1991). During this
coal FR2 S V K E S E G G L F K P T D T L T L T C T V S G F S L S S N A I S U V R P CAG///TCGGTGAAGWGTCCGAGG~GGTCTCTT~GC~CGGATACCCTGA~CTCACCTG~~GTCTCTGGATTCTCCCT~GTAGC///MT~TMGCT~GTCCGC~G G.C..........T...G.G.G.T............. GAGcA.C T...G.G.G............... C......T.C.AC..G............... G.. C..GG. C. A..T........AGCT.CTGG...T.......-...... FRl
VH1-a2
754 759 760 761 762 763
VH1-a2
754 759 760 761 762 763
VH1-a2
754 759 760 761 762 763
754 759 760 761 762 763
a
................................................................................... ... ...................................................................................... ......................................................................................... ...................... .... ................................... ......... ........................................................................................................................ ................................................................................................ T.CTAC..G...............
CDR2 FR3 A P G N G L E U I G A I G S S G S A Y Y A S Y A K S R S T I T R N T N L N T GCTCCAGGGMCGGGCTGCMTGGATCGGAGCCATT//////GGTAGTAGTGGTAGCGCATACTACGCGAGCTGGGC~GCCGATCCAC~T~C~~~C~CCT~cACG G A........A..........................................................GA....... C.G A........................................................C..... G G.........TG....TATGCT...............A....T...C.........T...TG......T...TC..T.....G...T.G...A..G... A G. G-........ TG TATACT A..C...............T...TG.T T.T.....T.....G.G.A..C..A.......
........... ............................... .............................................. ........ ........... ........ ........... ....... .... ............... .... ........................................................................................................................ ...................... AC ......TT ..........A.....G...... .................................................................
V T L K M T S L T A A D T A T Y F C A R GTGACTCTCAMATGACCAGTCTGACAGCCGCGGACACGGCUCCTATTTCTGTGCGAGA
........................... CG.................... ........... ............G....................... ........................ .GTTGC ..AC..C...A. .....A. ..................TG....A.......... ...T. ....C......A..... .....C.T .............................. ............................ T..... .......................... ............................................................ ..T..... ............................... ..A..... .................................. ...................................... JH
.............T..... ............................ ...................................... ......................................
D5 D2b D2b D3
D4
D2a
DH
I-SEG GGG
GGAGGGG
GacGG
GGGGGG
..........A.. .............G.... ....A....A.....AT..C....... .......... ..A.
A...C..
................ ..M..C.....A......
I-SEG
GGATMGCGCCTTT CcA GGGGCTTGTG CTCCATT GTG
54 54 54 J4 J4 54
FIG.5. Comparison of the nucleotide sequence of germline VH1to the sequences of six VDJ gene rearrangements isolated from peripheral blood lymphocyte cDNA from 7- to 8-week-old rabbits. For additional details, see legend to Fig. 4.
GG
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
203
time, the mutations accumulated as one could expect point mutations to accumulate, and no evidence for codon insertions or deletions was found. The authors concluded that the D region diversified primarily by somatic mutation rather than by somatic gene conversion. We cannot however rule out the possibility that the D regions are diversified by exonuclease activity followed by N region addition. It is nearly impossible to determine whether, in addition to being diversified b y somatic gene conversion, the V regions of the VDJ genes are diversified by somatic mutation. This is because the single nucleotide changes characteristic of point mutations can also occur by gene conversion if the “conversion track” of the donor gene differs from the rearranged VH gene by only one or a small number of nucleotides. We consider it likely that somatic mutation contributes to diversification of the VH region because we have evidence both that the JH regions of the VDJ genes are diversified, albeit at a low frequency, and that somatic mutations occur in the region immediately 3‘ of VDJ genes, in the 3‘-JH region (M. Kingzette and K. L. Knight, unpublished data). Although the frequency of mutations in the JH region is not known for the rabbit VDJ genes, several investigators showed that somatic mutation does extend 3’ of the D region in mouse (Both et ul., 1990; Lebecque and Gearhart, 1990; Hackett et al., 1990; Weber et ul., 1991). The large amount of somatic diversification in the D region compared with that in the JH and 3‘-JHregions is striking. At present, we do not know whether the mutation mechanism specifically targets the D region for mutation or whether the frequency of mutation in D is similar to that in the V and/or JH region. If the frequencies are similar, then perhaps the B cells with diversified D regions are selected for expansion, whereas the B cells with mutations in the JH region either have no selective advantage or are selected against. V. GALT and the Antibody Repertoire
Early in embryogenesis of chickens, cells migrate to the bursa of Fabricius, and their V, and V, genes undergo diversification by somatic gene conversion (Reynaud et ul., 1987, 1989). Within the bursa are highly developed follicles that play an important role in this diversification process and, therefore, in the development of the primary antibody repertoire. Because the follicular structure of the rabbit GALT, notably the appendix, resembles that of the bursa and because rabbit VDJ genes also diversify by somatic gene conversion, we are investigating whether the rabbit GALT is functionally equivalent to the avian bursa. If so, GALT may be the site in which the primary
204
KATHERINE L. KNIGHT AND MARY A. CRANE
antibody repertoire develops in rabbit. In this section, we review the early literature describing investigations to determine whether rabbit GALT was the mammalian bursal equivalent and we review studies of germfree rabbits that demonstrate the relationship between the development of GALT and the development of the immune response. Finally, we propose a model for the role of GALT in the development of the primary antibody repertoire in rabbit.
BURSALEQUIVALENT Because Glick (1956) showed the importance of the bursa in B lymphocyte differentiation in chicken, Max Cooper, Robert A. Good, and their associates began to search for a bursal equivalent in mammals (Archer et al., 1963; Cooper et al., 1966).They began their search in rabbit, focusing their attention on GALT because its follicular organization resembles that of the bursa. The appendix is very large in the rabbit and contains approximately 2 x lo9 lymphoid cells. In their studies, they surgically removed the appendix alone, or the appendix, sacculus rotundus, and Peyer’s patches from newborn rabbits and found that these rabbits were remarkably immunocompromised (Cooper et al., 1968). They found decreased antibody responses to bovine serum albumin (BSA), O-agglutinins, and H-agglutinins but not to SRBC. In addition, they saw decreased levels of circulating Ig and circulating lymphocytes, as well as a dramatically decreased survival rate for the rabbits who had their GALT removed. Although these experiments supported the notion that GALT could be the mammalian equivalent of the bursa, studies by Thorbecke and colleagues (Durkin et al., 1975) showed that the appendix was a “peripheral” lymphoid organ rather than a primary or central lymphoid organ. However, we suggest that, in rabbit, the appendix, although not a primary lymphoid organ, such as bone marrow or thymus, may be the site of somatic diversification ofV, and V,genes just as the bursa is in chicken. Recent data obtained from analyzing VDJ genes in germinal centers of rabbit appendix support this idea (P. Weinstein and R. Mage, NIH, personal communication). As such, we suggest that, in rabbit, the appendix may serve as the “bursal equivalent.” A. GALT
AS
B. GALT AND GERMFREE RABBITS Scientists at the Lobund Institute at the University of Notre Dame initiated much of the early work with germfree animals, by establishing conditions that make it possible to successfully establish reproducing colonies of these animals (Pleasants, 1959; Reyniers, 1959). Histori-
GENERATING T H E ANTIBODY REPERTOIRE I N RABBIT
205
cally, these germfree rabbits were used to examine the interactions of microbes with their hosts. In particular, immunologists were interested in the development of the immune systems in animals lacking both a normal microbial flora as well as pathogenic organisms. Stepankov5 and Kov5r;i (1978, 1985) in Prague developed germfree rabbits and studied their immune responses. First, this group looked at the histology of the lymphoid organs and found that, although the thymus appeared normal, the mesenteric lyinph node, spleen, appendix, and sacculus rotundus were poorly developed. Until the age of 34 months, no germinal centers were found in the secondary lymphatic tissue, and comparison of the appendix from germfree rabbits with the appendix from normal rabbits showed a marked decrease in development of the follicular lymphatic tissue, including a large decrease in the number of lymphoblasts and small lymphocytes. Therefore, it appears that a normal microbial flora is necessary for the development ofsecondary lymphatic tissue in the rabbit. To determine how the lack of a normal microbial flora affected the immune response, Tlaskalovh-Hogenovh and Stephnkovh (1980) also examined the appearance of “naturally occurring” antibodies as well as antibodies formed in response to immunization with antigen in germfree rabbits and compared it with that of conventional rabbits. Whereas, in the GALT of normal rabbits, antibacterial PFCs begin to appear by 4 weeks of age and increase in number until at least 12 weeks ofage, no antibacterial PFCs are found in the GALT of gernifree rabbits, even as late as 16 weeks of age. Similarly, germfree rabbits immunized with either Escherichici coli or SRBC do not form antibodies to these antigens, whereas normal rabbits readily form a PFC response to E . coli after immunization at either 6 or 16 weeks of age. In this way, germfree rabbits resemble newborn rabbits, which also show a decreased ability to respond to antigen. Although the effect was not as striking as when SRBC were used as the iniinunogen, the germfree rabbits did respond to a lesser degree than did normal rabbits. In summary, germfree rabbits have highly underdeveloped secondary lymphoid tissue, do not develop natural antibacterial and hemolytic antibodies, and either are unresponsive to immunization with antigen or have markedly deficient immune responses. Therefore, it is clear that the microbial flora plays an essential role in development o f t h e humoral immune response and in the development of the lymphoid tissue itself. Perhaps these events are actually interdependent, S O that the microbes stimulate the development of the GALT and then B cells migrate there to differentiate. Conversely, the B cells may recognize bacterial antigens, proliferate, and begin to populate the GALT. In
206
KATHERINE L. KNIGHT AND MARY A. CRANE
either case it is clear that a normal microbial flora is critical for the development of an immunocompetent rabbit.
c. MODELFOR THE ROLE OF GALT IN DEVELOPMENT OF THE ANTIBODYREPERTOIRE
In this section, we present a model for how the rabbit humoral immune system develops (Fig. 6). During fetal development, the neonatal repertoire is formed from the association of L chains with a restricted set of H chains that are encoded by VDJ genes that primarily use V H land one of six D gene segments, with each D gene segment used preferentially in one reading frame (Table 111).Although we do not know the extent of diversity among L chains, even if the L-chain repertoire is rather diverse, the total antibody repertoire would still be limited, because of the restricted H-chain repertoire. The limited neonatal repertoire may explain, in part, why rabbits are essentially immunoincompetent at birth. Coinciding with this immunoincompetence is the fact that, at birth, the peripheral lymphoid tissues, especially GALT, are undeveloped. As the lymphoid compartment of GALT begins to develop 1-2 weeks after birth, we postulate that B cells with undiversified VDJ gene rearrangements migrate, presumably from the bone marrow to GALT where they proliferate and undergo diversification by somatic gene conversion and somatic Neonatal Repertoire
Fetal Liver/Bone MarrowlOmentum
VD / DJ / VDJ rearrangements
+
Reading Frame Selection
Periphery
Migration to appendix & sacculus rotundus after birth
Primary Repertoire
Appendix & Sacculus Rotundus Interaction with Bacterial antigen
Gene Conversion
Follicle Formation
\
1
Antigen
&
Periphery
Secondary Repertoire
FIG.6. Model for development of the antibody repertoire in rabbit.
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
207
TABLE I11 READING FRAME (RF) OF D REGIONSI N 44 FUNCTIONAL VDJ GENES FROM NEWBORNRABBITS D
RF1
RF2
RF3
D1 D2a D2b D3 D4 D5
0 1 1 4" 0 0
8"
0 12"
1 0 0 0 0
90
0 2" 6"
~
' Preferred RF.
mutation. We postulate first that, by the time the rabbit is 6-8 weeks of age, this process generates a repertoire of VDJ gene rearrangements that form the functional or primary repertoire in the rabbit, and second that this repertoire makes the rabbit immunocompetent. Further, because we suggest that B cell development occurs early in ontogeny and that little, if any, B lymphopoiesis occurs in adults, this primary repertoire is maintained for the life of the rabbit. There are several reasons why we think that GALT is involved in generating the primary antibody repertoire in rabbit. One is the ontogenetic relationship between the development of GALT and the development of immunocompetency. Shortly after birth, GALT undergoes extensive follicular development resembling that seen in the bursa, and, subsequently, the rabbit develops immunocompetence. Second, the studies of Cooper and Good and colleagues showed that removing GALT from newborn rabbits profoundly decreased their immune response (Cooper et at., 1968).We suggest that, in the absence of GALT, somatic diversification does not occur and the primary antibody repertoire does not develop. The only repertoire available to the rabbits would then be the limited neonatal repertoire. Finally, the studies of Tlaskalova-Hogenova and Stepankova and colleagues showed that germfree rabbits have an undeveloped GALT and a markedly decreased immune response (Stepankova and Kova& 1978,1985; Tlaskalovh-Hogenova and Stepankova, 1980).Together, these studies strongly suggest to us that GALT plays a critical role in generating the antibody repertoire that allows the rabbit to develop a primary immune response. The germfree studies mentioned above also suggest that microbes are directly or indirectly essential for the development of the primary antibody repertoire. We propose that undiversified sIg binds bacterial
208
KATHERINE L. KNIGHT A N D MARY A. CRANE
antigen in GALT and that this interaction results in proliferation of the B cells and diversification of the Ig genes by both somatic gene conversion and somatic mutation. While it is also possible that the B cells are encountering a self-antigen in the GALT or that some other mechanism is stimulating the B cells, we favor the idea that the B cells are directly interacting with the microbes. In any case, the idea that most B cells encounter antigen early in ontogeny is consistent with the observation that by the time the rabbit is 2-3 months old, essentially all VDJ genes are diversified. After the Ig genes are somatically diversified in GALT, we suggest that the B cells enter the periphery and that, because they are selfrenewing, they maintain the primary repertoire. Once these B cells encounter antigen, they undergo affinity maturation by additional diversification of their Ig genes. This diversification presumably occurs in germinal centers of secondary lymphoid tissues and results in formation of the secondary antibody repertoire. We think this round of diversification occurs predominantly by somatic mutation, although we cannot rule out the possibility that somatic gene conversion is also involved. Our model has three major tenets: (1) that B cells develop early in ontogeny and are self-renewing, (2) that GALT is the site at which the primary antibody repertoire develops, and ( 3 )that normal microbial flora is necessary for development of the primary antibody repertoire. These tenets give rise to several testable predictions:
1. If all B cells develop early in ontogeny and are self-renewing, then few, if any, B cells are produced in adult rabbits. We can test for B lymphopoiesis in adult bone marrow and we can test whether peripheral B cells can repopulate irradiated recipients. 2. If GALT is the site at which the primary antibody repertoire develops, then removal of the GALT before the primary repertoire develops should leave the rabbit with the neonatal repertoire. This can be tested by examining VDJ gene rearrangements in rabbits that have had their GALT removed shortly after birth. If this prediction is accurate then most of the VDJ genes would remain undiversified. Further, if our prediction is accurate and GALT is the site to which B cells migrate and undergo VDJ gene diversification, then we can begin to look for homing receptors on B cells that would target their migration to GALT. 3 . If the normal microbial flora is necessary for development of the primary antibody repertoire, then we predict that germfree rabbits will have an undiversified neonatal repertoire. This can be tested by
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
209
examining VDJ genes in germfree rabbits. If this prediction is accurate, then we can begin to determine the mechanism by which bacteria mediate this process. VI. Summary
We describe a model for B cell development and generation of the antibody repertoire in rabbits. In this model, B cells develop early in ontogeny, migrate to GALT, and undergo the first round of diversification by a somatic gene conversion-like process and by somatic mutation. We designate the repertoire developed by this mechanism as the primary antibody repertoire and it is this repertoire that makes the rabbit inimunocompetent. We invoke GALT as the site for development of the primary repertoire because (1)surgical removal of GALT from neonatal rabbits results in highly immunocompromised animals, (2) in germfree rabbits essentially no lymphoid development occurs in GALT and the rabbits are immunoincompetent, and ( 3 )the follicular development of rabbit GALT is highly similar to that of the chicken bursa, the site in which the primary antibody repertoire develops by somatic gene conversion in chicken. We suggest that once the primary antibody repertoire is formed, it is maintained by self-renewing CD5+ B cells and is expanded to a secondary antibody repertoire after the B cells encounter antigen.
REFERENCES Allegrucci, M., Newman, B. A., Young-Cooper, G . O., Alexander, C. B., Meier, D., Kelus, A. S., and Mage, R. G. (1990).Altered phenotypic expression ofimmunoglobulin heavy-chain variable-region (V,) genes in Alicia rabbits probably reflects a small deletion in the V, genes closest to the joining region. Proc. Nut!. Acad. Sci. f f . S . A . 87, 5444. Allegrucci, M., Young-Cooper, G. O., Alexander, C . B., Newman, B. A,, and Mage, R. G . (1991). Preferential rearrangement in normal rabbits of the 3' VHaallotype gene that is deleted in Alicia mutants: Somatic hypermutatiodconversion may play a major role in generating the heterogeneity of rabbit heavy chain variable region sequences. Eur. J. Immunol. 21, 411. Angiolillo, A. L., Lamovi, E., Bernstein, K. E., and Mage, R. G. (1985).Identification of genes for the constant region of rabbit T-cell receptor p chains. Proc. Natl. Acad. Sci. U.S.A.82, 4498. Archer, 0. K., Sutherland, D. E. R., and Good, R. A. (1963). Appendix of the rabbit: A homologue of the bursa in the chicken? Nature (London)200, 337. Banchereau, J., d e Paoli, P., Valle, A., Garcia, E., and Rousset, F. (1991). Long-term human B cell lines dependent on interleukin-4 and antibody to CD40. Science 251, 70. Becker, R. S., and Knight, K. L. (1990).Somatic diversification of immunoglobulin heavy
210
KATHERINE L. KNIGHT A N D MARY A. CRANE
chain VDJ genes: Evidence for somatic gene conversion in rabbits. Cell (Cambridge, Mass.) 63, 987. Becker, R. S., Zhai, S. K., Currier, S. J., and Knight, K. L. (1989). Ig VH, DH and JH germ-line gene segments linked by overlapping cosmid clones of rabbit DNA. J. Zmmunol. 142, 1351. Becker, R. S., Suter, M., and Knight, K. L. (1990). Restricted utilization of V, and DH genes in leukemic rabbit B cells. Eur. J. Zmmunol. 20, 397. Benammar, A., and Cazenave, P.-A. (1982). A second rabbit K isotype. J. E x p . Med. 156, 585. Bernstein, K. E., Reddy, E. P., Alexander, C. B., and Mage, R. G. (1982). A cDNA sequence encoding a rabbit heavy chain variable region ofthe VHa2 allotype showing homologies with human heavy chain sequences. Nature (London)300, 74. Bernstein, K. E., Alexander, C. B., and Mage, R. G. (1983a). Nucleotide sequence of a rabbit IgG heavy chain from the recombinant F-Z haplotype. Zmmunogenetics 18, 387. Bernstein, K. E., Pavirani, A., Alexander, C., Jacobsen, F., Fitzmaurice, L., and Mage, R. (198313). Use of Trypanosoma equiperdum infected rabbits as a source of splenic mRNA: Construction of cDNA clones and identification of a rabbit p heavy chain clone. Mol. Zmmunol. 20,89. Bernstein, K. E., Skurla, R. M., Jr., and Mage, R. G. (1983~).The sequences of rabbit K light chains of b4 and b5 allotypes differ more in their constant regions than in their 3' untranslated regions. Nucleic Acids Res. 11, 7205. Bernstein, K. E., Alexander, C. B., and Mage, R. G. (1985). Germline VHgenes in an a3 rabbit not typical of any one V,a allotype. J . Zmmunol. 134, 3480. Both, G. W., Taylor, L., Pollard, J. W., and Steele, E. J. (1990). Distribution of mutations around rearranged heavy-chain antibody variable-region genes. Mol. Cell. Biol. 10, 5187. Bridges, R. A., Condie, R. M., Zak, S. J., and Good, R. A. (1959).The morphologic basis of antibody formation development during the neonatal period. J. Lab. Clin. Med. 53, 331. Brodeur, P. H., and Riblet, R. (1984).The immunoglobulin heavy chain variable region (Igh-V) Iocus in the mouse. I. One hundred Igh-V genes comprise seven families of homologous genes. Eur. J. Zmmunol. 14,922. Briiggemann, M., Free, J., Diamond, A., Howard, J., Cobbold, S., and Waldmann, H. (1986). Immunoglobulin heavy chain locus of the rat: Striking homology to mouse antibody genes. Proc. Natl. Acad. Sci. U.S.A.83,6075. Burnett, R. C., Hanly, W. C., Zhai, S. K., and Knight, K. L. (1989). The IgA heavy-chain gene family in rabbit: Cloning and sequence analysis of 13 C a genes. EMBO J. 8, 404 1. Calabi, F., Belt, K. T., Yu, C. Y., Bradbury, A., Mandy, W. J., and Milstein, C. (1989). The rabbit CD1 and the evolutionary conservation ofthe CD1 gene family. Zmmunogenetics 30, 370. Catty, J. P., Hole, N. J., and Catty, D. (1985). Presence of ~2 light chain in normal rabbits and as induced auto anti-allotype antibody in ~1light chain suppressed subjects. Mol. Zmmunol. 22,949. Chen, H. T., Alexander, C. B., Young-Cooper, G. O., and Mage, R. G. (1993). VH gene expression and regulation in the mutant Alicia rabbit: Rescue of VHa2 allotype expression. J. Zmmunol. 150, 2783. Chouchane, L., Brown, T. J., and Kindt, T. J. (1993). Structure and expression of a nonpolymorphic rabbit class I1 gene with homology to HLA-DOB. Zmmunogenetics 38, 64.
GENERATING T H E ANTIBODY R E P E R T O I R E I N RABBIT
21 1
Clarke, S . H., Huppi, K., Ruezinsky, D., Staudt, L., Gerhard, W., and Weigert, M. (1985). Inter- and intraclonal diversity in the antibody response to influenza hemagglutinin. J . E x p . Med. 161, 687. Cooper, M. D., and Burrows, P. D. (1989). B-Cell Differentiation. In “Immunoglobulin Genes” (T. Honjo, F. W. Alt, and T. H. Rabbitts, eds.), p. 1. Academic Press Ltd., London. Cooper, M. D., Perey, D. Y., McKneally, M. F . , Gabrielsen, A. E., Sutherland, D. E. R., and Good, R. A. (1966). A mammalian equivalent of the avian bursa of Fabricius. Lancet 1(452), 1388. Cooper, M. D., Perey, D. Y., Gabrielsen, A. E., Sutherland, D. E. R., McKneally, M. F., and Good, R. A. (1968).Production ofan antibody deficiency syndrome in rabbits by neonatal removal of organized intestinal lymphoid tissues. Int. Arch. Allergy 33, 65. Currier, S. J., Gallarda, J. L., and Knight, K. L. (1988). Partial molecular genetic map of the rabbit V, chromosomal region. J . Imtnunol. 140, 1651. De Smet, W., Vaeck, M., Smet, E., Brys, L., and Hamers, R. (1983). Rabbit leukocyte surface antigens defined by monoclonal antibodies. Eur. J . Inmunot. 13,919. DiPietro, L. A., and Knight, K. L. (1990). Restricted utilization of germ-line VH genes and diversity of D regions i n rabbit splenic Ig mRNA. J . Imnunol. 144, 1969. DiPietro, L. A,, Short, J . A,, Zhai, S . K., Kelus, A. S.,Meier, D., and Knight, K. L. (1990).Limited number of immunoglobulin V, regious expressed in the mutant rabbit “Alicia.” E u r . J . Irnmunol. 20, 1401. Dixon, F. J., and Weigle, W. 0. (1959). The nature o f t h e immunologic inadequacy of neonatal rabbits. J. E x p . Med. 110, 139. Dray, S., Young, G. O., and Gerald, L. (1963a). Inimunochernical identification and genetics of rabbit y-globulin allotypes. J . Immunol. 91, 403. Dray, S., Young, G. O., and Nisonoff. A. (19633b). Distribution of allotypic specificities among rabbit y-globulin molecules genetically defined at two loci. Nature (London) 199, 52. Dreher, K. L., Einorine, L., Kindt, T. J., and Max, E . E. (1983). cDNA clone encoding a complete rabbit immunoglobulin K light chain of b4 allotype. Proc. Nut/.Acad. Sci. U.S.A. 80,4489. Durkin, H. G., Caporale, L., and Thorbecke, G. J . (1975). Migratory patterns of B lymphocytes. I. Fate of cells from central and peripheral lymphoid organs in the rabbit and its selective alteration by anti-immunoglobulin. Cell. Imrnunol. 16, 285. Duvoisiu, R. M., Kocher, H. P.. Garcia, I., Rougeon, F., and Jaton, J.-C.(1984).Nucleotide sequence of a cDNA encoding the constant region of a rabbit imniunoglobulin light chain of the A type. E u r . J . Imwiunol. 14, 379. Duvoisin, R. M., Heidmann, O., and Jaton, J.-C. (1986).Characterization offour constant region genes of rabbit iminunoglobulin-A chains. J . Inzmunol. 136, 4297. Duvoisin, R. M., Hayzer, D. J., Belin, D., and Jaton, J.-C. (1988). A rabbit Ig A L chain C region gene encoding C21 allotypes. J . Immunol. 141, 1596. Emorine, L., and Max, E. E. (1983). Structural analysis o f a rabbit immunoglobulin K2 J-C locus reveals multiple deletions. Nucleic Acids Res. 11, 8877. Ernorine, L., Dreher, K., Kindt, T. J., and Max, E. E. (1983). Rabbit immunoglobulin K genes: Structure of a germline b4 allotype J-C locus and evidence for several b4related sequences in the rabbit genome. Proc. Natl. Acad. Sci. U.S.A. 80, 5709. Eskinazi, D. P., Bessinger, B. A,, McNicholas, J . M., Leary, A. L., and Knight, K. L. (197Ya). Expression of an unidentified immunoglobulin isotype on rabbit Ig-bearing lymphocytes. J . Imnaunol. 122, 469.
212
KATHERINE L. KNIGHT A N D MARY A. C R A N E
Eskinazi, D. P., Knight, K. L., and Dray, S. (1979b). Kinetics of escape from supression of Ig heavy chain allotypes in multiheterozygous rabbits. Eur. ]. Immunol. 9, 276. Fitts, M. G., and Metzger, D. W. (1990). Identification of rabbit genomic Ig-vH pseudogenes that could serve as donor sequences for latent allotype expression. ], Inmunol. 145, 2713. Flanagan, J. G., and Rabbitts, T. H. (1982). Arrangement of human immunoglobulin heavy chain constant region genes implies evolutionary duplication of a segment containing y, E and a genes. Nature (London)300,709. Forster, I., and Rajewsky, K. (1987). Expansion and functional activity of Ly-1' B cells upon transfer of peritoneal cells into allotype-congenic, newborn mice. Eur. ]. Zmmunol. 17, 521. French, D. L., Laskov, R., and Scharff, M. D. (1989). The role ofsomatic hypermutation in the generation of antibody diversity. Science 244, 1152. Freund, J. (1930). Influence of age upon antibody formation.]. Zmmunol. 18,315. Friedman, M. L., Tunyaplin, C., Zhai, S. K., and Knight, K. L. (1994). Neonatal VH, D and JH gene usage in rabbit B-lineage cells. J . Imrnunol. 152, 632. Furutani, Y., Notake, M., Yamayoshi, M., Yamagishi, J., Nomura, H., Ohue, M., Furuta, R., Fukui, T., Yamada, M., and Nakamura, S. (1985). Cloning and characterization of the cDNAs for human and rabbit interleukin-1 precursor. Nucleic Acids Res. 13,5869. Fuschiotti, P., Harindranath, N., Mage, R. G., McCormack, W. T., Dhanarajan, P., and Roux, K. H. (1993). Recombination activating genes-1 and -2 of the rabbit: Cloning and characterization of germline and expressed genes. Mol. Zmmunol. 30, 1021. Calea-Lauri, J., Blackford, J., and Wilkinson, J. M. (1993a). The expression of CD11/ CD18 molecules on rabbit leucocytes: Identification of monoclonal antibodies to CD18 and their effect on cellular adhesion processes. Mot. Intmunot. 30,529. Galea-Lauri, J., Wilkinson, J . M., and Evans, C. H. (1993b). Characterization of nionoclonal antibodies against rabbit CD44: Evidence of a role for CD44 in modulating synoviocyte metabolism. Mol. Zmmunol. 30, 1383. Gallarda, J. L., Gleason, K. S., and Knight, K. L. (1985). Organization of rabbit immunoglobulin genes. I. Structure and multiplicity of germ-line VH genes.]. Zrnmunol. 135, 4222. Garcia, I., Brandt, D. C., Benammar, A., Cazenave, P.-A., and Jaton, J.-C. (1982). BASZLEA rabbits express two types of immunoglobulin light chains: A and K-like. Proc. Natl. Acad. Sci. U.S.A. 79, 4391. Gathings, W. E., Mage, R. G., Cooper, M. D., Lawton, A. R., and Young-Cooper, G. 0. (1981). Immunofluorescence studies on the expression of V" a allotypes by pre-B and B cells of homozygous and heterozygous rabbits. Eur. J. Zmmunol. 11,200. Gathings, W. E., Mage, R. G., Cooper, M. D., and Young-Cooper, G. 0. (1982). A subpopulation of small pre-B cells in rabbit bone marrow express K light chains and exhibits allelic exclusion of b locus allotypes. Eur. J. Zmmunol. 12, 76. Gearhart, P. J., Johnson, N. D., Douglas, R., and Hood, L. (1981). IgG antibodies to phosphorylcholine exhibit more diversity than their IgM counterparts. Nature (Lond o n ) 291,29. Gilman-Sachs, A., Mage, R. G., Young, G. O.,Alexander, C.,andDray, S. (1969). Identification and genetic control of two rabbit immunoglobulin allotypes at a second light chain locus, the c locus. J . Immunol. 103, 1159. Glick, B., Chang, T. S . , and Jaap, R. G. (1956). The bursa of Fabricius and antibody production in the domestic fowl. Poult. Sci. 35, 224. Good, P. W., Notenboom, R., Dubiski, S., and Cinader, B. (1980).Basilea rabbit immunoglobulins: Detection and characterization by specific alloantiserum. J . Immunol. 125, 1293.
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
213
Hackett, J., Jr., Rogerson, B. J., O’Brien, R. L., and Storb, U. (1990). Analysis of somatic mutations in K transgenes. J . E x p . A4ed. 172, 131. Hague, B. F., Sawasdikosol, S., Brown, T. J., Lee, K. Reeker, D. P., and Kindt, T. J. (1992). C D4 and its role in infection ofrabbit cell lines by human immunodeficiency virus type 1. Proc. N a t l . Acud. Sci. U.S.A.89, 7963. Hanly, W. C., and Knight, K. L. (1975). Cellular distribution of rabbit IgA allotypes. J . lmnaunol. 115, 590. Harada, A., Sekido, N., Kuno, K., Akiyania, M., Kasahara, T., Nakanishi, I . , Mukaida, N., and Matsushima, K. (1993). Expression of recombinant rabbit IL-8 in Escherichia coli and establishment of the essential involvenwnt of IL-8 in recruiting neutrophils into lipopolysaccharide-induced inflanimatory site of rabbit skin. lnt. Immunol. 5 , 681. Harrison, hl. R., and Mage, R. G . (197:3). Allotype suppression in the rabbit. I. Th e ontogeny of cells bearing ii7iniunoglol,uliii of paternal allotype and the fate of these cells after treatment with antiallotype nntisera. J . E x p . Med. 138, 764. Hayakawa, K., Hardy, R. R., Stall, A. M., Herzenberg, L. A., and Herzenberg, L. A. (1986). Immiinoglobulin-1~earinyB cells reconstitute and maintain the murine Ly-1 B cell lineage. Eur. J . Inmrrnol. 16, 1313. Haywarcl, A. H., Sirnons, M. A., Lawton, A. H., Mage, H. G . , and Cooper, M . D. (1978). Pre-B and B cells i n rabbits: Ontogeny and allelic exclusion of K light chain genes. J . E x p Med. 148, 1367. Hayzer, D. J., and Jaton, J.-C. (1989a). Cloning and sequencing oftwo functional rabbit germ-line immunoglobu~inVA genes. Gene 80, 185. Hayzer, D. J., and Jaton, J.-C. (198%). Inactivation of rabbit immunoglobulin A chain variable region genes by the insertion of short interspersed elements of the C family. Eur. J . Inimunol. 19, 1643. Hayzer, D. J., Duvoisin, R. M., arid Jaton, J.-C. (1987). cDNA clones encoding rabbit imniunoglobulin A chains. Biocheni. J . 245, 691. Heidmann, O., and Rougeon, F. (1982a). Molecular cloning of rabbit y heavy chain mHNA. Nucleic Acids. Res. 10, 153Fj. Heidmann, 0.. and Rougeon, F. (198%). Multiple sequences related to a constantregion K light chain gene in the rabbit genome. Cell (Cambridge,Mass.) 28, 507. Heidmann, O., and Rougeon, F. (1983). Multiplicity of constant K light chain genes in the rabbit genome: A b4b4 homozygous rabbit contains a K-bus gene. EMBO J . 2, 437. Heidmann, 0.. Auffray, C . , Cazenave, P.-A., and Rougeon, F. (1981). Nucleotide sequence of constant and 3’ untranslated regions of a K immunoglobulin light chain mRNA o f a homozygous b4 rabbit. Proc. Natl. Acad. Sci. U.S.A.78, 5802. Hole, N. J. K., Harindranath, N., Young-Cooper, G. O., Garcia, R., and Mage, R. G . (1991a). Identification of enhancer sequences 3’ of the rabbit Iy KL chain loci. J . lnimutiol. 146, 4377. Hole, N. J . K., Young-Cooper, G . O., and Mage, R. G . (1991b). Mapping ofthe duplicated rabbit ininiunoglobulin K light chain locus. Eur. J . Immunol. 21, 403. Ito, H., Shirai, T., Yamamoto, S., Akira, M., Kawahara, S., Todd, C., and Wallace, R. B . (1986). Molecular cloning of the gene encoding rabbit tumor necrosis factor. DNA 5 , 157. Jackson, S., Chused, T. M., Wilkinson, J. M., Leiserson, W. M., and Kindt, T. J. (1983). Differentiation antigens identify subpopulations of rabbit T and B lymphocytes: Definition by flow cytometry. /. E r p . Med. 157, 34. Jaton, J.-C., and Kelus, A. S. (1977). Peptide mapping ofthe A-like chains ofthe BASILEA rabbits. Eur. J . Immunol. 7, 118.
2 14
KATHERINE L. KNIGHT AND MARY A. CRANE
Kabat, E. A.. Wu, T. T., Reid-Miller, M., Perry, H. M., and Gottesnian, K. S. (1987). Sequences of proteins of immunologic interest. United States Department of Health and Human Services. Public Health Service, National Institutes of Health, Bethesda, MD. K Kelus, A. S., and Weiss, S. (1977). Variant strain of rabbits lacking in~n~unoglobulin polypeptide chain. Nature (London) 265, 156. Kelus, A. S., and Weiss, S. (1986). Mutation affecting the expression of immunoglobulin variable regions in the rabbit. Proc. Natl. Acad. Sci. U.S.A. 83, 4883. Kim, 8.S., and Dray, S. (1972). Identification and genetic control ofallotypic specificities on two variable region subgroups of rabbit immunoglobulin heavy chains. Eur. J . Immunol. 2, 509. Kindt, T. J., and Capra, J. D. (1984).“The Antibody Enigma.” Plenum Press, New York. Knight, K. L. (1992). Restricted V, gene usage and generation of antibody diversity in rabbit. Annu. Reo. Immunol. 10, 593. Knight, K. L., and Becker, R. S. (1990). Molecular basis of the allelic inheritance of rabbit immunoglobulin VH allotypes: Implications for the generation of antibody diversity. Cell (Cambridge, Mass.) 60, 963. Knight, K. L., Martens, C. L., Stoklosa, C. M., and Schneiderman, R. D. (1984). Genes encoding a-heavy chains of rabbit IgA: Characterization of cDNA encoding IgA-g subclass a-chains. Nucleic Acids Res. 12, 1657. Knight, K. L., Burnett, R. C., and McNicholas, J. M. (1985). Organization and polymorphism of rabbit immunoglobulin heavy chain genes. 1.Irnrnunol. 134, 1245. Knight, K. L., Spieker-Polet, H., Kazdin, D. S., and Oi, V. T. (1988). Transgenic rabbits with lymphocytic leukemia induced by the c-myc oncogene fused with the inimunoglobulin heavy chain enhancer. Proc. Natl. Acad. Sci. U.S.A. 85, 3130. Kocks, C., and Rajewsky, K. (1989). Stable expression and somatic hypermutation of antibody V regions in B-cell developmental pathways. Annu. Reu. Imnunol. 7,537. Kotani, M., Yamamura, Y., Tamatani, T., Kitamura, F., and Miyasaka, M. (1993a).Generation and characterization of monoclonal antibodies against rabbit CD4, CD5 and C D l l a antigens. J . Immunol. Methods 157, 241. Kotani, M., Yamamura, Y., Tsudo, M., Tamatani, T., Kitamura, F., and Miyasaka, M. (1993b). Generation of monoclonal antibodies to the rabbit interleukin-2 receptor a chain (CD25)and its distribution in HTLV-1-transformed rabbit T cel1s.Jpn.J. Cancer Res. 84, 770. Kusano, M., Choi, N.-H., Toniita, M., Yamamoto, K., Migita, S., Sekiya, T., and Nishimura, S. (1986). Nucleotide sequence of cDNA and derived amino acid sequence of rabbit complement component C3 a-chain. Immunol. Inoest. 15,365. Lai, E., Wilson, R. K., and Hood, L. E. (1989). Physical maps of the monse and human immunoglobulin-like loci. Ado. Immunol. 46, 1. Lalor, P. A., Stall, A. M., Adams, S., and Herzenberg, I,. A. (1989). Permanent alteration of murine Ly-1 B repertoire due to selective depletion of Ly-1 B cells in neonatal animals. Eur. J . Immunol. 19, 501. Lamoyi, E., and Mage, R. G. (1985). Lack of Klb9 light chains in Basilea rabbits is probably due to a mutation in an acceptor site for mRNA splicing. J . E x p . Med. 162, 1149. Laverriere, A., Kulaga, H., Kindt, T. J., LeGuern, C., and Marche, P. N. (1989).A rabbit class I1 MHC gene with strong similarities to HLA-DRA. Iininunogenetics 30, 137. Lawton, A. R., Self, K. S., Royal, S. A., and Cooper, M. D. (1972). Ontogeny of Blymphocytes in the human fetus. Clin. Immunol. Initnunopathol. 1, 84. Lebecque, S. G.. and Gearhart, P. J. (1‘390).Boundaries of somatic mutation in rearranged
GENERATING THE ANTIBODY REPERTOIRE IN RABBIT
2 15
immunoglobulin genes: 5' boundary is near the promoter, and 3' boundary is -1 kb from V(D)J gene.]. E x p . Med. 172, 1717. LeGuern, A., Wetterskog, D., Marche, P. N., and Kindt, T. J. (1987). A monoclonal antibody directed against a synthetic peptide reacts with a cell surface rabbit class I MHC molecule. Mol. Zmmunol. 24, 455. LeGuern, C., Marche, P. N., and Kindt, T. J . (1985).Molecular evidence for five distinct MHC class I1 a genes in the rabbit. Zmmunogenetics 22, 141. LeGuern, C., Weissman, J . D., Marche, P. N., Jouvin-Marche, E., Laverriere, A., Bagnato, M. R., and Kindt, T. J. (1987).Sequence determination o f a transcribed rabbit class I1 gene with homology to N U - D Q a . Immunogenetics 25, 104. Lobel, S. A., and Knight, K. L. (1984). The role of rabbit l a molecules in immune functions as determined with the use of an anti-la monoclonal antibody. lmmunology 51, 35. Mage, R. (1981). Th e phenotypic expression of rabbit immunoglobulins: A model of complex regulated gene expression and ceIlular differentiation. Contemp. Top. Mol. Immunol. 8, 89. Mage, R., and Dray, S. (1965). Persistent altered phenotypic expression of allelic yGimmunoglobulin allotypes in heterozygous rabbits exposed to isoantibodies in fetal and neonatal life.]. lmmunol. 95, 525. Mage, R. G., Bernstein, K. E., McCartney-Fransis, N., Alexander, C. B., Young-Cooper, G . 0..Padlan, E. A., and Cohen, G. H. (1984). T h e structural and genetic basis for expression of normal and latent V,,a allotypes of the rabbit. Mol. Zmmunol. 21, 1067. Maizels, N . (1989).Might gene conversion b e the mechanism of somatic hypermutation of mammalian immunoglobulin genes? Trends Genet. 5 , 4. Marche, P. N., and Kindt, T. J . (1986a). T w o distinct T-cell receptor a-chain transcripts in a rabbit T-cell line: Implications for allelic exclusion in T cells. Proc. Natl. Acad. Sci. U.S.A. 83,2190. Marche, P. N., and Kindt, T. J. (1986b). A variable region gene subfamily encoding T cell receptor @-chains is selectively conserved among mammals. J. lmmunol. 137, 1729. Marche, P. N., Tykocinski, M. L., Max, E. E., and Kindt, T. J . (1985). Structure of a functional rabbit class I MHC gene: Similarity to human class I genes. Zmmunogenetics 21, 71. McConnack, W. T., and Thompson, C. B. (199Oa).Chicken Ig, variable region gene conversions display pseudogene donor preference and 5' to 3' polarity. Genes Deu. 4, 548. McCormack, W. T., and Thompson, C. B. (1990b).Somatic diversification o f t h e chicken immunoglobulin light-chain gene. Adu. Immunol. 48, 41. McCormack, W. T., Laster, S. M., Marzluff, W. F., and Roux, K. H. (1985). Dynamic gene interactions in the evolution of rabbit V, genes: A four codon duplication and block homologies provide evidence for intergenic exchange. Nucleic Acids Res. 13, 704 1. McElroy, P. J., Willcox, N., and Catty, D. (1981).Early precursors of B lymphocytes. I. Rabbit/mouse species differences in the physical properties and surface phenotype of pre-B cells, and in the maturation sequence of early B cells. Eur. J. Immunol. 11, 76. Meyer, K. B., and Neuberger, M. S. (1989). T h e immunoglobulin K locus contains a second, stronger B-cell-specific enhancer which is located downstream of the constant region. E M 3 0 J. 8, 1959. Mostov, K. E., Friedlander, M., and Blobel, G. (1984). The receptor for transepithelial
216
KATHERINE L. KNIGHT AND MARY A. CRANE
transport of IgA and IgM contains multiple immunoglobulin-like domains. Nature (London) 308,37. Osmond, D. G. (1990). B cell development in the bone marrow. Semin. Zmmunol. 2, 173. Oudin, J. (1956a). Reaction de precipitation specifique entre des serums d’animaux de meme espece. C . R . Acad. Sci. D (Paris) 242,2489. Oudin, J. (1956b).L’Allotypie de certains antigens proteidiques du serum. C . R . Acad. Sci. D (Paris) 242, 2606. Pascual, V., and Capra, J. D. (1993). Human immunoglobulin heavy-chain variable region genes: Organization, polymorphism, and expression. Ado. Zmmunol. 49, 1. Pearl, E. R., Vogler, L. B., Okos, A. J., Crist, W. M., Lawton 111, A. R., and Cooper, M. D. (1978). B lymphocyte precursors in human bone marrow: An analysis of normal individuals and patients with antibody-deficiency states. J . Zmmunol. 120, 1169. Pink, J. R. L., Lassila, O., and Vainio, 0. (1986). B-lymphocytes and their self renewal. In “Avian Immunology: Basis and Practice” (A. Toivanen and P. Toivanen, eds.), p. 65. CRC Press, Boca Raton. Plaut, A. G., Gilbert, J. V., Artenstein, M. S., and Capra, J. D. (1975). Neisseria gonorrhoeae and Neisseria meningitidis: Extracellular enzyme cleaves human immunoglobulin A. Science 190, 1103. Pleasants, J. R. (1959). Rearing germfree cesarean-born rats, mice, and rabbits through weaning. Ann. New York Acad. Sci. 78, 116. Raff, M. C., Megson, M., Owen, J. J., and Cooper, M. D. (1976). Early production of intracellular IgM by B-lymphocyte precursors in mouse. Nature (London) 259, 224. Raman, C., and Knight, K. L. (1992). CD5’ B cells predominate in peripheral tissues of rabbit. J. Zmmunol. 149, 3858. Raman, C., Spieker-Polet, H., Yam, P.-C., and Knight, K. L. (1994). Preferential VH gene usage in rabbit immunoglobulin-secreting heterohybridomas. J. Immunology, in press. Reynaud, C.-A., Anquez, V., Dahan, A,, and Weill, J.-C. (1985). A single rearrangement event generates most ofthe chicken immunoglobulin light chain diversity. Cell (Cambridge, Mass.) 40, 283. Reynaud, C.-A., Anquez, V., Grinial, H., and Weill, J.-C. (1987). A hyperconversion mechanism generates the chicken light chain preimmune repertoire. Cell (Cambridge, Mass.) 48, 379. Reynaud, C.-A., Dahan, A., Anquez, V., and Weill, J.-C. (1989). Somatic hyperconversion diversifies the single VH gene of the chicken with a high incidence in the D region. Cell (Canabridge, Mass.) 59, 171. Reyniers, J. A. (1959). The pure-culture concept and gnotobiotics. Ann. N . Y. Acad. Sci. 78, 3. Roux, K. H., Dhanarajan, P., Gottschalk, V., McCormack, W. T., and Renshaw, R. W. (1991). Latent a1 VH germline genes in an a2a2rabbit:Evidence for gene conversion at both the germline and somatic levels. J. Zmmunol. 146, 2027. Roux, K. H., Ray, G., and McCormack, W. T. (1993). Expression of RAG-1 and RAG-2 mRNA in rabbit lymphoid tissues. J . Cell Biochem. 17B, 234. Sawasdikosol, S., Hague, B. F., Zhao, T. M., Bowers, F. S., Simpson, R. M., Robinson, M., and Kindt, T. J . (1993). Selection of rabbit CD4-CD8-TCRy8 cells by in uitro transformation with HTLV-1. J . E x p . Med. 178, 1337. Schneiderman, R. D., Hanly, W. C., and Knight, K. L. (1989). Expression of 12 rabbit IgA Ccy genes as chimeric rabbit-mouse IgA antibodies. Proc. Natl. Acad. Sci. U.S.A. 86, 7561.
GENERATING T H E ANTIBODY REPERTOIRE IN RABBIT
217
Schneiderman, R. D., Lint, T. F., and Knight, K. L. (1990). Activation of the alternative pathway of complement by twelve different rabbit-mouse chimeric transfectoma IgA isotypes. J. Inimunol. 145, 233. Selsing, E., Durdik, J . , Moore, M . W., and Persiani, D. M. (1989).Immunoglobulin A genes. In “Immunoglobulin Genes” (T. Honjo, F. W. Alt, and T. H. Rabbitts, eds.), p. 111. Academic Press Ltd., London. Shakhov, A. N., Kuprash, D. V., Azizov, M. M., Jongeneel, C. V., and Nedospasov, S . A. (1990). Structural analysis ofthe rabbit TNF locus, containing the genes encoding TNF-P (lymphotoxin) and TNF-a (tumor necrosis factof). Gene 95, 215. Shimizu, A., Takahashi, N., Yaoita, Y., and Honjo, T. (1982).‘0rganization ofthe constantregion gene family of the mouse immunoglobulin heavy chain. Cell (Cambridge, Muss.) 28, 499. Short, J. A., Sethupathi, P., Zhai, S. K., and Knight, K. L. (1991). VDJ genes in VHa2 allotype-suppressed rabbits: Limited gerniline VH gene usage and accumulation of somatic mutations in D regions. J. Zmnaunol. 147, 4014. Sinions, M. A,, Hayward, A. R., Gathings, W. E., Lawton, A. R., Young-Cooper, G . O., Cooper, M. D., and Mage, R. C . (1979). Expression ofb4 and b 5 K light chain allotypes by B and pre-B cells in allotype-suppressed and neutralized b4b5 rabbits. Eur. J. Immunol. 9, 887. Sittisombut, N., and Knight, K. L. (1986). Rabbit major histocompatibility complex. I. Isolation and characterization of three subregions of class I1 genes. J. Immunol. 136, 1871. Solvason, N., and Kearney, J. F. (1992). The human fetal omentum: A site of B cell generation. J. E x p . Med. 175, 397. Solvason. N., Lehuen, A,, and Kearney, J. F. (1991). An embryonic source of Ly l but not conventional B cells. Int. Immunol. 3, 543. Spieker-Polet, H., Sittisombut, N., Yam, P.-C., and Knight, K. L. (1990). Rabbit major histocompatibility complex. IV. Expression of major histocompatibility complex class I1 genes. J. Zmmunogenet. 17, 123. Spieker-Polet, H., Yam, P.-C., and Knight, K. L. (1993). Differential expression of 13 IgA-heavy chain genes in rabbit lymphoid tissues. J. Zmmunol. 150, 5457. Stepankova, R., and KovAiG, F. (1978). Development of lymphatic tissues in germfree and conventionally reared rabbits. Proc. 6th Internot. Congr. Lymphol. 290. Stepankovk, R., and KovaiG, F. (1985). Immunoglobulin-producing cells in lymphatic tissues of g e m f r e e and conventional rabbits as detected by an immunofluorescence method. F o l . Microbiol. 30, 291. Sterzl, J., and Trnka, Z. (1957). Effect ofvery large doses ofbacterial antigen on antibody n ) 918. production in newborn rabbits. Nature ( L { ~ i ~ d o179, Thompson, C . B., and Neinian, P. E . (1987). Somatic diversification of the chicken immunoglobulin light chain gene is limited to the rearranged variable gene segment. Cell (Canhrzdge, Muss.) 48, 369. Thorbecke, G. J . (1960). y Globulin and antibody formation in vitro. 1. y Globulin formation in tissues from immature and normal adult rabbits. J. E x p . Med. 112, 279. Tlaskalova-Hogenova, H., and Stepankova, R. (1980). Development of antibody formation in genn-free and conventionally reared rabbits: The role of intestinal lymphoid tissue in antibody formation to E . coli antigens. Fol. Eiol. 26, 81. Tucker, P. W., Liu, C. P., Mushinski, J. F., and Blattner, F. R. (1980).Mouse immunoglobulin D: Messenger RNA and genomic DNA sequences. Science 209, 1353. Velardi, A., and Cooper, M . D. (1984). An immunofluorescence analysis o f t h e ontogeny
218
KATHERINE L. KNIGHT AND MARY A. CRANE
of myeloid, T, and B lineage cells in mouse hemopoietic tissues. J . Immunol. 133, 672. Vice, J. L., Hunt, W. L., and Dray, S. (1969). Zygote transfer to facilitate altered expression of immunoglobulin light chain phenotypes in homozygous rabbits. Proc. SOC. E x p . Biol. Med. 130, 730. Weber, J. S., Berry, J., Manser, T., and Claflin, J. L. (1991). Position of the rearranged V, and its 5’ flanking sequences determines the location of somatic mutations in the J K locus. J. Immunol. 146, 3652. White, M. B., Shen, A. L., Word, C. J., Tucker, P. W., and Blattner, F. R. (1985). Human immunoglobulin D: Genomic sequence of the 6 heavy chain. Science 228,733. Wilder, R. L., Yuen, C. C., Coyle, S. A., and Mage, R. G. (1979). Demonstration of a rabbit cell surface Ig that bears light chain and V,, but lacks p-, a-,and y-allotypesrabbit IgD? J . Immunol. 122, 464. Wilkinson, J. M., Galea-Lauri, J., and Reid, H. W. (1992a).A cytotoxic rabbit T-cell line infected with a y-herpes virus which expresses CD8 and class I1 antigens. Immunology 77, 106. Wilkinson, J. M., Galea-Lauri, J., Sellars, R. A., and Boniface, C. (1992b). Identification and tissue distribution of rabbit leucocyte antigens recognized by monoclonal antibodies. Immunology 76, 625. Wilkinson, J. M., McDonald, G., Smith, S., Galea-Lauri, J., Lewthwaite, J., Henderson, B., and Revell, P. A. (1993). lmmunohistochemical identification of leucocyte populations in normal tissue and inflamed synovium of the rabbit. J. Pathol. 170, 315. Wysocki, L. J., and Gefter, M. L. (1989). Gene conversion and the generation of antibody diversity. Annu. Reo. Biochem. 58, 509. Yoshimura, T., and Yuhki, N. (1991). Neutrophil attractant/activation protein-1 and monocyte chemoattractant protein-1 in rabbit. J . Immunol. 146,3483.
ADVANCES IN IMMUNOLOCY, VOL. 56
lmmunotherapeutic Strategies Directed at the Trimolecular Complex AMITABH GAUR A N D C. GARRISON FATHMAN Deportment of Medicine, Division of Immunology ond Rheumatology, Stanford University Medical Center, Stanford Colifornio 94305
1. Introduction
T cell activation requires interaction among the components ofthe ternary complex: the T cell receptor, MHC gene products, and the nominal peptide antigen. Strategies aimed at inducing unresponsiveness in T cells have targeted each of the components of the activating complex. Prevention and treatment of autoimmune disorders as well as induction of transplantation tolerance are incentives to continue the effort in evolving strategies for establishing specific immune unresponsiveness. This review recapitulates earlier experience in preventing the formation of the ternary complex and discusses some newer attempts to induce unresponsiveness in experimental animals. The three components of the complex serve as independent targets for development of strategies aimed at disrupting the trimolecular complex (Fig 1). II. Target 1 : The T Cell
The earliest attempts at immunotherapy targeting the T cell used anti-lymphocyte serum and monoclonal antibodies directed at the Thy1 antigen, a marker for all T cells, to eliminate or downregulate T cell activation (Like et al., 1979; Maki et al., 1981, 1992; Ledbetter and Seaman, 1982; Cobbold et ul., 1983). The development of hybridoma technology (Kohler and Milstein, 1975; Galfre et al., 1979) made available reagents which could target a specific cell population. Among the target molecules on T cells are the CD3 complex and the CD8 and CD4 molecules. Antibodies to the nonpolymorphic regions of the T cell receptor and to the variable regions of the @-chainof the T cell receptor (TCR)have been used for immunotherapy. T cell vaccination and TCR peptide are the most recent entries into this field of T celldirected imniunotherapy. 219 Copyright 0 1994 b y Academic Press, Inc All rights of reproduction in any Corm reserved.
220
AMITABH GAUR A N D C. GARRISON FATHMAN
Antibodies to *TCR a / p -TCR Vp
*MHC blocking peptides/analogues
f
Antigen Presenting Cell *Antibodies to MHC (la)
FIG.1. Schematic diagram showing the components of the ternary complex. Boxed legends show ways to disrupt the interactions between the components.
A. ANTI-CD3 ANTIBODY The T cell receptor consists of seven polypeptide chains which form the T cell receptor complex. The cup-chains are involved in direct interaction with the antigen MHC complex. The other chains ( y 8 & t 2 ) ofthe complex have important functions in signal transduction. Engagement of these polypeptide chains on the surface b y monoclonal antibodies can result in antigen-independent activation of the T cell. Antibody to the C D 3 complex, OKT3, was among the first monoclonal antibody to be developed for human T cell-surface antigens (Kung et al., 1979). It was quickly employed therapeutically for reversal of acute renal allograft rejection (Cosimi et al., 1981) and then evaluated in multicenter studies for its use in renal allograft rejection (Thistlethwaite et d.,1984; Ortho Study, 1985). Soon it was used as the only immunosuppressive therapy in patients receiving cadaver kidney transplants (Vigeral et d.,1986). The mode of action of antiC D 3 antibody (OKT3) in vivo was initially thought to be the removal
THE TRIMOLECULAR COMPLEX
22 1
of T cells from circulation evidenced by a sharp decline in T cell numbers following anti-CD3 administration. However, the elimination of T cells did not seem to be the prime factor in the success of OKT3 therapy. The antibody does not eliminate T cells for long and CD3-negative T cells reappear. Antibody binding to the T cell surface causes capping, internalization, and shedding of the CD3 complex resulting in a modulated expression of the T cell receptor complex and diminshed antigen recognition and response functions (Chatenoud et al., 1982). The use of OKT3 antibody in reversing transplantation rejection and its attendant side effects and problems has been discussed in detail elsewhere (Transplantation Proceedings, 1987). Antibody to the mouse CD3 was developed and like OKT3 found to inhibit antigen-specific cytolysis by T cells (Leo et al., 1987; Havran et al., 1987). The ability of the mouse CD3 antibody (145.2~11)to induce unresponsiveness was studied in uiuo. For up to 5 weeks after antibody administration cells from the recipient adult mice were completely unresponsive in CTL assays. The mechanisms of unresponsiveness were investigated (Hirsch et al., 1988).Though there was a substantial depletion of T cells from the periphery, spleen and lymph nodes still contained T cells. Anti-CD3 antibody seemed to be acting through mechanisms other than depletion of T cells possible surface modulation of the CD3 complex or delivery o f a “suppressive” or negative signal to T cells (Hirsch et ul., 1988). In a different study, injections of anti-CD3 antibody were given neonatally and the effects were studied in adult mice (Rueff-Juy et at., 1989). Although there was almost complete depletion of T cells in the peripheral organs, there was no significant decrease in thymocytes. However, there was complete suppression of T cell functions. A decrease in “bright” CD3+ cells was seen which was correlated with loss of function. The reappearance of function was correlated with a critical threshold of bright CD3’ cells. No difference in levels of mRNA transcripts for alp TCR and C D ~ was E observed between control and treated mice suggesting no apparent feedback mechanism acting on surface modulation of CD3.9 (Rueff-Juy et al., 1989). Studies mentioned thus far have demonstrated depletion of peripheral T cells following administration of the antibody without affecting the number of thymocytes. However, other studies have shown antiCD3-induced apoptosis in developing thymocytes 40 hr after the antiCD3 injection. Almost complete depletion of double-positive thymocytes was seen and the single-positive CD4+ subset was affected more than the CD8’ cells (Shi et al., 1991). Apoptosis of immature T cells seen in uiuo was confirmation of similar observations in vitro with
222
AMITABH GAUR A N D C. GARRISON FATHMAN
thymic organ cultures (Smith et al., 1989; McConkey et al., 1989; Tadakuma et al., 1990) or with a leukemic T cell line (Takahashi et al., 1989). Though anti-CD3 antibody has been utilized to induce immunosuppression in uiuo, it is interesting to note that the same antibody can induce activation of T cells in uiuo. Anti-CD3 is a potent stimulator of T cells when added to cultures in uitro of either human (Van Wauwe et al., 1980) or murine T cells (Leo et al., 1987; MarusicGalesic et al., 1988). The antibody caused activation of T cells in uiwo was evidenced by induction of interleukin-2 (IL2)receptor and production of colony stimulating factor (CSF). At the doses studied the net result was immunosuppression; however, lower doses might be useful in inducing activation in immunocompromised hosts (Hirsch et al., 1989). The ability of anti-CD3 to induce activation in uiuo is an important caveat, especially when the antibody for immunosuppressive therapeutic effects is administered, and may account for some of the “side affects” observed at least in the early phase of the treatment regimen. Anti-CD3 induces activation of T cells when given intravenously. Release of various cytokines including tumor necrosis factor (TNF), interferon-y (IFNy), IL2, and IL3 in the circulation has been observed. Side effects caused by its activating potential have been discussed (Alegre et al., 1990; Chatenoud and Bach, 1992). Interestingly, the activation potential of anti-CD3 was associated with the intact antibody. F(ab’)2 fragments of the antibody may be more useful as immunosuppressive agents since they lack mitogenic properties (Hirsch et al., 1991). F(ab’)2fragments ofthe antibody given to thymectomized mice resulted in prolonged (up to 3 months) and marked impairment of CD4+ T cell functions including reduced proliferation and IL2 secretion to mitogenic stimulus. IL2 supplementation in uiuo restored T helper functions as evidenced by rejection of skin allografts. CD8+ T cells were not affected by the F(ab’)2 treatment (Hirsch et ul., 1991).Nonmitogenic F(ab’)2portions were shown to prevent lethal murine graft versus host disease (GVHD) in fully allogeneic bone marrow transplant recipients. Both depletion of cells and modulation of CD3/TCR complex were observed in the CD4+ subset. CD8’ T cells were again affected only to a limited degree (Blazar et al., 1993). These results demonstrated the ability of the F(ab’)2portion to induce specific unresponsiveness in the CD4+ subset of T cells without evoking activation-linked side effects associated with the intact antibody treatment. Since CD4+ helper T cells have been implicated in the initiation of different autoimmune diseases, nonmitogenic F(ab’)2 portions of anti-CD3 antibody have been tried in a few experimental models of
THE TRIMOLECULAR COMPLEX
223
autoimmune diseases. The effectiveness of anti-CD3 and its F(ab')2 fragment, in preventing autoimmune diabetes, was compared in the streptozotocin-induced diabetes model in mice. Both intact anti-CD3 and its F(ab')2 fragments were found to suppress insulitis and significantly reduce the occurrence of hyperglycemia as compared to untreated controls. Mice treated with nonmitogenic F(ab')2 did not show any of the signs of morbidity seen in the anti-CD3-treated mice. The depletion of T cells was less pronounced in the case of F(ab')S-treated mice. The cells from treated mice, however, showed reduced activity on challenge with mitogens in vitro (Herold et al., 1992). Apparently, nonmitogenic antibody treatment functioned by rendering the T cells unresponsive by modulating the surface expression of the CD3/TCR complex. In two other murine models of autoimmune diseases, collagen-induced arthritis and Lactobacillus coronary vasculitis (LCA) disease, induction was prevented when anti-CD3 treatment was given at an early stage (Bluestone et al., 1992). B. ANTI-CD4 ANTIBODY In an effort to reach specific populations of the helper/inducer subset of T cells, a specific marker for those cells was used as the target antigen of immunotherapy. Helper T lymphocytes express CD4, a transmembrane glycoprotein (Parnes, 1989)which acts as both an adhesion molecule and a signal transducer through its cytoplasmic tail (Glaichenhaus et al., 1991; Miceli et al., 1991).The use of monoclonal antibodies targeted to CD4 has resulted in subset depletion or inactivation in mice and rats with a concomitant loss of immune function associated with the CD4' T cells. For example, mice depleted of CD4+ helper T cells were unable to mount B cell-dependent IgG responses to a T cell-dependent antigen sheep red blood cells (SRBC) (Cobbold et al., 1984) or to antigens of the herpes simplex virus (Leist et al., 1987). CD4+-depletcd mice lacked DTH responses (Leist et al., 1987) and also exhibited prolonged time in rejecting skin grafts from mismatched donors (Cobbold and Waldmann, 1986).Studies have been carried out on the effects of anti-CD4 treatment in experimental animals by different groups with results very similar to those described above. Using a rat monoclonal antibody GK1.5, directed against mouse CD4 molecule (Dialynas et al., 1983a,b), to treat mice, we examined the effect of such treatment on immune unresponsiveness. BALB/c mice immunized with sperm whale myoglobin did not produce specific antibodies following CD4' T cell depletion with GK1.5 at the time of immunization. This humoral unresponsiveness was long lasting; mice remained unresponsive for more than 4 months despite a
224
AMITABH GAUR A N D C. GARRISON FATHMAN
secondary challenge with sperm whale myoglobin (Goronzy et al., 1986). Similar results were obtained by others using bovine serum albumin or ovalbumin (Wofsy et al., 1985). Interestingly, anti-CD4 treatment 3 or more days following immunization with antigen failed to diminish the immunoglobulin response (Wofsy et al., 1985) suggesting an early requirement for B cell help from CD4+ cells. Benjamin and Waldmann (1986) have shown that antigen immunization at the time of anti-CD4 antibody YTS191.1 (Cobbold et al., 1984) treatment results in specific tolerance to the antigen as evidenced by lack of antibody response on secondary immunization 42 days after the antibody treatment. Responses to other antigens remained unaffected. These and similar observations (Gutstein et al., 1986) indicated the ability of anti-CD4 to induce antigen-specific unresponsiveness. Humoral unresponsiveness following anti-CD4 treatment was not limited to soluble antigens but was also seen in response to alloantigens (Weyand et al., 1989a). Cytotoxic T cell responses induced by CD4+ cells either to allotype dissimilar cells (Weyand et al., 1989a) or to virus-infected cells were also dramatically reduced ( Weyand et al., 198913). Anti-CD4 antibody therapy has been used in experimental animals in an attempt to induce transplantation tolerance. The rationale for this approach came from studies suggesting that CD4+ T cells played a crucial role in rejection of the tissue transplanted across both the MHC “major” or non-MHC “minor” barrier (Mason and Morris, 1986; Steinmuller, 1985; Rosenberg et al., 1987).Work in our laboratory has demonstrated that treatment with anti-CD4 antibody before transplant allowed survival of islet allografts (Shizuru et al., 1987).In these experiments, mice (B6 H-2b) were given a single regimen of treatment with anti-CD4 antibody GK1.5 at the time of allogeneic islet transplant from A/J (H-2a)mice. The recipient mice had been made diabetic by treatment with streptozotocin. Successful retention of the allograft islet transplant was measured by maintenance of normoglycemia in the recipient mice. Our results showed indefinite survival of the engrafted islets of Langerhans (Shizuru et al., 1987) following treatment with anti-CD4. The treatment apparently caused selective depletion of most CD4+ lymphocytes; however, 5%-10% CD4’ cells remained in the spleen and lymph nodes of the treated mice. Cells in the thymus were not depleted by this treatment (Goronzy et al., 1986). In xenogeneic islet grafts (rat to mouse) CD4 antibody treatment of the recipient along with anti-la immunotoxin treatment of the graft substantially increased survival time of the graft (Kaufman et al., 1988). We have also been able to achieve indefinite survival of islet allografts in a rat
THE TRIMOLECULAH COMPLEX
225
model using the mouse anti-rat CD4 antibody 0x38. Pretransplantation treatment of diabetic ACI rats with OX38 allowed acceptance of Lewis rat islets. In the same study, anti-CD8 antibody treatment did not allow long-term allograft survival. Anti-CD8 antibodies when coadministered with anti-CD4 abrogated transplant tolerance and allowed rejection of the allograft. This result suggested that CD8+ cells were soniehow involved in maintaining tissue-specific unresponsiveness (Seydel et al., 1991).This observation was in contrast to earlier observations of Waldmann and co-investigators, in studies in mice, who did not find a requirement of CD8+ cells for induction of anti-CD4mediated tolerance (Waldmann, 1989). Anti-CD4 antibody has additionally been shown to fiacilitate graft survival in skin and bone marrow transplants in mice (Cobbold et al., 1986). Survival of cardiac allografts improved substantially in mice following anti-CD4 therapy (Mottram et al., 1987; Madsen et al., 1987). The mechanism of anti-CD4-mediated “tolerance” in the case of either soluble antigens or transplantation models is not clear. However, some insights into the potential n-rechanism(s) are beginning to emerge. In some models depletion of CD4’ cells is required as suggested by the inability of the nondepleting chimeric CD4 (Alters et ul., 1989) antibodies to successfully treat niurine EAE (Alters et al., 1990). Also, as discussed earlier, humoral unresponsiveness to soluble antigens and survival of allografts seemed to correlate with the depletive capabilities of the antibody. However, nondepletive regimens have also been shown to induce tolerance to soluble antigens (Qin et al., 1987). Additionally, F(ab’)2 portions of anti-CD4 antibodies, though not capable of depleting CD4+ cells, were able to induce tolerance and immunosuppression (Gutstein and Wofsy, 1986; Carteron et d.,1988). Also high doses of a poorly depleting isotype rat IgG 2a anti-CD4 monoclonal antibody allowed tolerance induction again suggesting that depletion was not always required for induction of tolerance (Qin et al., 1989). Even in depletive regimens, cessation of antibody therapy allows repopulation of CD4+ cells to normal levels in approximately 90 days (Goronzy et al., 1986). We attempted to analyze unresponsiveness of the repopulated cells in B6 mice which had not rejected A/ J islets following anti-CD4 therapy. We observed that the repopulated cells responded as well to spleen cells of the donor in an MLR as to a third party. These data suggested the induction of tissue or antigen-specific tolerance but not general unresponsiveness to the donor. In other systems tissue-specific unresponsiveness has been suggested (Dalln-ran et nl., 1987; Armstrong et d., 1987). In a rat cardiac allograft model, we were again able to see
226
AMITABH GAUR A N D C. GARRISON FATHMAN
unresponsiveness when anti-CD4 (0x38)antibody was used for allograft survival. ACI rats received Lewis rat hearts in the abdomen. Only rats treated with OX38 demonstrated indefinite survival of the allograft. A second transplant of a Lewis heart in a different site was accepted without additional treatment while a third party, BN rat heart, was rejected. BN rat hearts were accepted by naive ACI rats following anti-CD4 therapy. As in the mouse islet transplant model system, we observed apparent donor tissue-specific unresponsiveness in rats following anti-CD4 therapy (Shizuru et al., 1990).Similar results have been reported from other groups of rat cardiac allograft systems (Herbert and Roser, 1988; Roser, 1989).Anti CD4-induced donor-specific unresponsiveness persisted in the absence of the transplanted tissue for at least 90 days (the duration of the study) following removal of the transplanted allograft as evidenced by the nonrejection of a second donor-matched cardiac allograft placed 90 days after the removal of the first tolerated graft following anti-CD4 antibody therapy (Shizuru et aZ., 1990). This long-term unresponsiveness in the transplantation system is almost identical to that observed against soluble antigens given following anti-CD4 treatment (Benjamin et al., 1988). In an attempt to elucidate the mechanism of transplantation tolerance following anti-CD4 therapy, our group (Alters et aZ., 1991) studied islet allograft between MHC-disparate mice. The donor islets came from I-E+ mice A/J (I-Ek).In I-E+ mice, T cell receptor V p l l ' and VP5' T cells are deleted in the thymus. In our system, the presence of the I-E+ islet allograft in CD4-depleted recipient mice did not cause clonal deletion of Vp5 or V p l l T cells. No changes in the kinetics of repopulation ofVP5 or V p l l CD4+ cells were observed in transplanted or sham-transplanted anti-CD4-treated mice. FACS analysis using anti-Vpll antibodies 2 months after grafting and following repopulation of CD4+ cells revealed no decrease in VPll' cells. The percentage of V p l l ' T cells seen in anti-CD4-treated transplanted mice were comparable with those of anti-CD4-treated untransplanted mice. Since clonal deletion was obviously not responsible for unresponsiveness in the graft recipients, we assayed T cell receptor crosslinking using solid-phase immobilized Vpll-specific antibodies. Receptor crosslinking usually stimulates specific T cells to proliferate, whereas lack of proliferation is usually correlated with anergy. In our crosslinking experiments, cells from the anti-CD4-treated and I-E islet-engrafted mice failed to respond to anti-Voll crosslinking. There was no difference in the level of stimulation achieved by control antibodies, antiVp8, or anti-CD3between grafted and control mice. Sorted populations of T cells from treated and grafted mice showed little or no stimulation +
227
THE TRIMOLECULAR COMPLEX
in response to Vpl l-specific immobilized antibody in CD4 or CD8 T cells arguing for anergy induction in both CD8+ and CD4 + populations (Alters et at., 1991). To examine the possibility that suppressor cells in transplanted mice caused the receptor crosslinking unresponsiveness, CD4- and CD8-sorted populations were mixed with normal B6 cells (negatively sorted for CD4 or CD8 cells) in an anti-Vp11 stimulation assay. Neither CD4 nor CD8 cells from tolerant mice affected the response of the normal B6 cells in TCR crosslinking (Alters et al., 1991) ruling out any apparent suppressor populations generated by anti-CD4 treatment. Qin et al. (1989, 1990) reported results similar to ours but using nondepleting anti-CD4 antibodies in generating tolerance or anergy. As reported earlier for soluble antigens, e. g., human y-globulin, tolerance induction in their studies required immunization with the antigen under the umbrella of nondepleting CD4 antibodies. The resulting antigen-specific tolerance lasted for a finite period unless immunizations were repeated which could extend and strengthen the specific tolerance. It was postulated that the reversion to the responsive state was due to the arrival of new thymic emigrants which were not tolerant. This hypothesis was supported by the continued unresponsiveness of mice thymectomized after being tolerized. The establishment of tolerance to minor mismatched skin grafts required anti-CD8 antibodies, in addition to anti-CD4 antibodies. However, in this instance, the tolerance was long lasting presumably because of continuous exposure of thymic emigrants to the foreign antigen expressed on the grafted tissue. In a finding similar to that observed by Alters et al., but using nondepleting regimens of antiCD4 antibody, it was found that the Mls 1" (present on the graft)reactive subset of T cells, Vp6 +,was not deleted from the periphery, but rendered anergic as assessed by their inability to proliferate in uitro to either VP6-specific antibody or Mls1"-expressing stimulator cells (Cobbold et al., 1990). GK1.5 treatment, in animal models of autoimmune diseases, has been shown to be effective in blocking or halting the progression of disease. Treatment with anti-CD4 antibody around the time of immunization with myelin basic protein (MBP) prevented experimental autoimmune encephalomyelitis (EAE) (Brostoff and Mason, 1984). Ongoing EAE was also reversed with anti-CD4 treatment (Waldor et al., 1985; 1987a). Experimental autoimmune myasthenia gravis (Christadoss and Dauphinee, 1986), systemic lupus erythematosus (Wofsy and Seaman, 1985), and collagen-induced arthritis (Ranges et al., 1985) have all been treated with anti-CD4 treatment. Using depletive anti-CD4 antibody treatment, our laboratory has prevented the +
+
228
AMITABH GAUR A N D C. GARRISON FATHMAN
development of spontaneous diabetes mellitus in NOD mice (Shizuru et al., 1988).A striking feature ofthe therapy was the long-term absence of disease even after cessation of antibody administration. N o prevention of IDDM was observed if NOD mice were treated for a short course despite adequate depletion. Though we used depleting antibodies for therapy, Carteron et al. (1989) used F(ab')2 fragment of the anti-CD4 antibody in treating another autoimmune disease, mouse lupus, with success. This nondepletive CD4 antibody was demonstrated to be effective in treating autoimmune diseases but again required long-term treatment.
C. ANTI-^^ TCR ANTIBODY About 90% of peripheral T cells express the alp heterodimer; 10% express the y / 6 T cell receptor. The development of monoclonal antibodies (R73 and H57-597) to a nonpolymorphic determinant in the constant region of the rat (Hunig et al., 1989) or mouse (Kubo et al., 1989) alp T cell receptor generated the opportunity for using these antibodies as immunotherapeutics in animal models. Attempts have been made to use these anti-alp TCR antibodies for prevention and treatment of type I1 collagen-induced arthritis in rats (Goldschmidt and Holmdahl, 1991;Yoshino et al., 1991a).Collagen-induced arthritis, an organ-specific autoimmune disease, shares similarities with human rheumatoid arthritis. Administration of anti-alp TCR antibody, either at the time of immunization, with type 11collagen just prior to development of arthritis, or after development of frank symptoms, resulted in inhibition of disease (Goldschmidt and Holmdahl, 1991). Antibody injections given at the time of immunization or before onset of arthritis resulted in complete prevention of disease for the duration of the treatment. The reversal of the disease symptoms in arthritic animals was notable following antibody administration. These impressive effects, however, did not last and after cessation of the antibody therapy severe arthritis was seen in treated animals. Though the antibody was able to deplete large numbers of T cells, the authors suggest functional blockade of the T cell receptor as the mechanism for antibody action. This hypothesis was based on the presence of fairly significant numbers of antibody-coated T cells in the circulation. Also, thymectomized rats went on to develop severe arthritis after a period of disease inhibition during antibody treatment suggesting functional inhibition rather than depletion being responsible for disease inhibitory effects of the anti-alp antibody. In a different rat model, streptococcal cell wallinduced arthritis, which also has similarities with human rheumatoid
THE TRIMOLECULAH COMPLEX
229
arthritis, anti-alp antibodies have been demonstrated to be effective in prevention of chronic disease (Yoshino et al., 1991b).Anti-alp treatment results in minimal destruction of cartilage and very low-level inflamation in the synovium of the tarsal joints. In these studies, rapid but incomplete depletion of the alp TCR' T cells was observed following anti-alp injection. However, by Day 3 85-90% of cells were eliminated and several injections maintained depletion. Following withdrawal of the treatment the alp' T cells returned gradually to about 70% of the normal level. This same group has reported success in using monoclonal anti-alp TCK antibody in treating and preventing adjuvant arthritis (Yoshino et al., 1990).Complete prevention ofspontaneous diabetes in the NOD female mice, a model for the human IDDM, was observed following weekly injections (during 8-24 weeks of age) of monoclonal a l p TCR-specific antibody (Kubo et al., 1989). Twice weekly treatment with F(ab')2 fragments was also shown to be successful (Sempe et al., 1991). Cyclophosphamide-induced acute diabetes in male NOD rnice was also prevented by treatment with a1 p TCR-specific monoclonal antibody. Interestingly, anti-alp treatment was also able to reduce the incidence ofinsulitis in 8-week-old NOD female mice following a single injection of 500 pg. Even overt diabetes could be reversed by anti-alp antibody treatment. After six daily injections of the antibody to six overtly diabetic mice all became normoglycemic, three only for a short period. Treatment of ongoing diabetes by this antibody suggests that cell-mediated effectors are one of its target. When the total IgG anti-alp was used, large-scale depletion of cells from the circulating pool was observed but the splenic population remained unaffected. That depletion was not the major mechanism was also shown by the efficacy of the nondepleting F(ab')2 fragments. N o general immunosuppressive effects were observed following antibody treatment; no significant changes were found in the ability of the NOD mice to maintain allogeneic skin grafts (Sempe et al., 1991).
D. ANTI-TCRVp ANTIBODY The knowledge that there existed a bias for expression of Va- or p-
chains in recognition of specific peptide antigens in the context of MHC molecules suggested yet another potential for immunotherapy. Analysis of antigen-reactive T cell clones revealed a limited heterogeneity in the use of Vp or V a genes in response to well-defined antigens. T cell responses to different model antigens showed limited heterogeneity in T cell receptor usage when analyzed using specific DNA probes or specific antibodies to the T cell receptor chains. Specific examples include pigeon cytochrome C (Fink et al., 1986; Winoto et
230
AMITABH GAUR A N D C. GARRISON FATHMAN
al., 1986; Sorger et al., 1987; Matis et al., 1987; Hedrick et al., 1988),C1 h repressor (Lai et al., 1988,1990),and SWM (sperm whale myoglobin) (Morel et al., 1987; Danska et al., 1990). Immunotherapy based on
this limited TCR expression allowed treatment in both mouse and rat EAE, animal models of multiple sclerosis. Despite the difference in the antigenic epitopes and MHC restrictions essentially a single Vp gene was utilized by almost all the T cell clones analyzed from mice or rats (Happ and Heber-Katz, 1988; Burns et al., 1989; Acha-Orbea et al., 1988; Urban et al., 1988).This led Heber-Katz and Acha-Orbea (1989) to propose the V-region disease hypothesis which implicated the T cell receptor, not only in antigen recognition, but also as an effector in the initiation of the disease process by other unknown mechanisms. Restricted T cell receptor usage has also been reported in experimental autoimmune uveoretinitis where retinal S antigen reactive pathogenic T cell lines use rat homologues of the mouse Va2 and Vp8 (Merryman et al., 1991; Gregerson et al., 1991). All the studies on TCR usage in disease discussed above defined restricted TCR expression in recognition of different antigens on the basis of predominance of a given p- or a-chain in the T cell clones or lines established or maintained in uitro. Restricted TCR usage was also detected in uiuo. More than 90% of the proliferative response to the MBP epitope 1-11 was found in the VpS+ CD4+ T cells when lymph node cells of immunized PL/J (H-2") mice were sorted into Vp8' and Vp8- populations (Acha-Orbea et al., 1988). That limited heterogeneity in TCR usage demonstrated by T cell clones is a true reflection of the immune response in viuo was shown by our work examining the DBAl2 response to SWM. DBAl2 mice immunized with SWM or with an immunodominant determinant (aa110-121)mounted a strong T cell proliferative response which was limited to the Vp8' CD4+ T cell population (Ruberti et al., 1991). These findings showed that the limited heterogeneity in TCR usage demonstrated by the T cell clones was representative of the immune response in uivo. One attractive feature of a limited TCR use in response to defined antigens was the possibility that specific immunointervention could be applied to control a given immune response. Antibodies specific to the variable region of either a- or p-chains of the heterodimeric T cell receptor can be of potential use. Monoclonal antibodies specific for p-chain variable regions have been used for prevention and treatment of MBPinduced EAE in rodents. The (PL/J x SJL)F1 mouse generated predominantly Vp8 encephalitogenic T cells in response to immunization with either MBP or its N terminal epitope Acl-11. H-2" mice, PL/J or (PL/J x SJL)Fl, generate predominantly Vp8.2+, 1-A"+
THE TRIMOLECULAR COMPLEX
23 1
restricted encephalitogenic T cell clones in response to the N terminal Acl-11 epitope of MBP (Acha-Orbea e t al., 1988; Zamvil et al., 1988). F23.1, a depleting monoclonal antibody specific for all members of the Vp8 gene family (Staerz et al., 1985), was used to treat or prevent EAE in H-2" mice (reviewed by Acha-Orbea et al., 1989; Steinman, 1991). In a remarkable study, monoclonal F23.1 antibody was able to cause complete reversal of the disease process in 13 of 16 animals in which disease was induced by transfer of VP8.2+ encephalitogenic cloned T cells. F23.1 eliminated 98% of the Vp8' T cells from circulation and prevented the induction of disease in 18 of 19 mice following immunization with the Acl-11 encephalitogenic epitope of MBP. Even when guinea pig MBP, containing multiple pathogenic epitopes, was used to induce EAE, administration of anti-VP8 after the development of symptoms resulted in substantial (12 of 19) reversal of the disease (Acha-Orbea et al., 1988). Urban et al. (1988) have also used KJ16, another monoclonal antibody (specific for Vp8.1 and 8.2) (Haskins et al., 1984) in preventing EAE in B1O.PL mice. In the B1O.PL (H-2") mice although 84% of T cell clones responding to the N terminal determinant of MBP were Vp8.2' there were some clones (16 in number) which expressed Vp13. Although treatment in vivo with a Vp8.2specific monoclonal antibody F23.2 (Staerz and Bevan, 1985)resulted in almost complete depletion of Vp8.2 cells, it did not completely eliminate proliferative T cell response to MBP nor did it completely prevent the occurrence of MBP-induced EAE. Although 75% of animals treated with anti Vp8.2 did not develop symptoms, 5 of 20 developed fulminant disease in the treated group. Since 1/6th of the MBP-reactive clones expressed VP13 and not Vp8.2 a depleting antiVp13 monoclonal antibody was also used in these experiments. AntiVp13 treatment alone failed to have any impact on disease progression; however, when given along with Vp8.2 specific antibody, it resulted in a dramatic drop (only 1 of 20) in disease incidence (Zaller et al., 19'30). Also, lymph node cells from double antibody-treated animals did not respond to MBP in a proliferation assay. The same mixture of antibodies was found effective in reversing MBP-induced paralysis in the B1O.PL mice (Zaller et al., 1990). Sakai et al., (1988) attempted the use of Vpl7a-specific monoclonal antibody in suppressing EAE in SJL/J (H-2') mice. These mice respond to aa 89-101 of the MBP utilizing largely Vp17a+ clones. However, about half of the clones do not use Vpl7a+ T cell receptor. Whereas both Vp17a+ and Vp17a- clones were effective in transferring disease in naive animals. In this study, depletion mediated by antiVp17a antibody, KJ23a (Kappler et al., 1987), was effective in sup-
232
AMITABH GAUR A N D C. GARRISON FATHMAN
pressing EAE when caused by transfer of 89-101-specific Vp17a T cell clones but was ineffective when the disease was induced by 89-101specific but Vpl7a-negative T cell clones or MBP or even 89-101 peptide. The presence of another epitope nested within 89-101 epitope which is recognized by VP17a- T cells could account for these results. Padula et al. (1991) reported the use of VP4+ T cells in recognizing a new epitope 92-103 in the SJL mice. Anti-VP4 (KT4), when given along with the MBP-specific cell line (57% cells expressing Vp4 TCR) in an adoptive transfer system, was very effective in preventing the development of disease. Three of four mice remained disease free and the fourth had a mild disease as opposed to all five animals which developed severe EAE in the control antibody group. In Lewis rats, an anti-TCR monoclonal antibody recognizing an idiotope on an MBP 68-88-specific rat T cell clone was also used to cause reduction in MBP-induced EAE incidence and severity in 67% of treated animals (Owahashi and Heber-Katz, 1988).The experiments discussed above demonstrate the efficacy of anti-TCR VP-specific monoclonal antibodies in downregulation of immune response and, in the case of autoimmunity, amelioration of disease. The efficacy of this approach depends on the oligoclonality of the T cells in response to a given antigen. Response of a different clonal population (possibly of a lower affinity) on elimination of the main responding population could nullify the immunosuppressive effect. We have shown that despite the neutralizing of the majority of Vp8' cells by SEB treatment mice still developed EAE following immunization with encephalitogenic Acl-11 epitope of MBP. These data were suggestive of the emergence of an encephalitogenic non-Vp8 population having lower affinity for Acl-11 epitope but capable of causing disease (Gaur et al., 1993a). Also, nested epitopes inducing different T cell clonal populations could pose a problem. In situations where more than one TCR is utilized a cocktail of anti-Vp antibodies could be used but oligoclonality of the response remains an essential requirement for the effectiveness of the anti-Vp approach. This was shown in the case of collageninduced arthritis where restricted Vp usage was indicated in disease induction (Banerjee et al., 1988). Use of different Vp monoclonals did not have the desired immunosuppressive effect, possibly because of lack of TCR restriction in the response (Goldschmidt et al., 1990). The situation is further complicated in human autoimmune diseases where no clear restriction in receptor usage has been observed. Analyses of TCR usage in T cell clones obtained from the synovial fluid of a rheumatoid arthritis patient have resulted in conflicting reports. One study demonstrated oligoclonality in clones expanded in vitro (Sta-
THE: TRIMOI,ECUI,AR COMPLEX
233
menkovic et al., 1988) whereas others failed to find any evidence for restricted TCR usage in such T cell clones (Duby et al., 1989).In MS, T cell clones from the cerebral spinal fluid but not from the peripheral blood show limited receptor usage (Hafler et al., 1988).Oksenberg et al. (1993) reported conservation of the junctional sequences of the Vp5.2 from direct polymerase chain reactions (PCRs) of plaques from MS patients. Five different motifs were seen. Interestingly one motif was identical to the V-D-J sequence of an M B P peptide-specific clone isolated from an MS patient. The importance of this finding was underscored by the fact that encephalitogenic rat T cell clones, recognizing a MBP epitope similar to that of the human clone, had same amino acid sequences in the V-D-J region of the TCR p-chain. In another report, Vp usage in the peripheral blood and synovial fluid of rheumatoid arthritis (RA) patients was compared by PCR amplification employing specific Vp oligomers. In the seven RA patients, the frequency of the Vp14' cells in the peripheral blood was extremely low but was significantly increased in the synovial fluid ofthe affected joints. There was no skewing in Vp14' cells in the peripheral blood and synovial fluid of patients with nonrheumatoid arthritis inflammations. The VD-J sequencing of the Vp14 cells showed that 46 to 72% of the Vp14 population in the synovium of HA patients had a single clonotype. The near complete absence of Vp14' cells in the periphery of these patients led the authors to suggest that a superantigen (sharing reactivity with the putative autoantigen at the site of inflammation) could be involved in both elimination of V/314+ cells from the periphery and their oligoclonal expansion in the synovium (Paliard et ul., 1991).The complex etiopathology of autoimmune diseases may not allow such precise but simplistic immunotherapeutic regimens such as the one discussed in this section (Sinha et al., 1990).
E. T CELLVACCINATION In the preceding sections, we have discussed the use of antibodies directed at various proteins on the T eel1 surface in regulating T cell responses, We now examine T cells as effectors of immune regulation. This approach involves the use ofantigen-specific T cell lines or clones as vaccinating agents to elicit "anti-idiotypic" regulator T cells capable of inhibiting the response of the antigen-specific T cell population. As opposed to passive administration of antibodies, this approach involves active participation of the individual's immune system in inducing a regulatory response to the immunizing cells. Using MBP-specific T cell lines for vaccination, Cohen and co-workers were successful in preventing EAE in experimental animals (Ben-Nun et d.,1981).Since
234
AMITABH GAUR A N D C. GARRISON FATHMAN
then, they have tried various vaccination protocols (reviewed by Cohen, 1986,1989) in controlling experimental autoimmune diseases. After activation by antigen myelin basic protein-specific T cells were irradiated (Ben-Nun et al., 1981) and inoculated into Lewis rats. The irradiated cells were able to prevent MBP-induced disease but unable to protect against disease induced by adoptive transfer of MBP-specific T cell lines. Glutaraldehyde crosslinking or pressure aggregation of cell-surface molecules seemed to overcome this problem (Lider et ul., 1987). However, Offner et al. (1989) reported the requirement of both irradiation and pressure treatment of vaccinating T cells to obtain complete protection against active and passively transferred disease (Offner et al., 1989). Even a heterogeneous T cell population like lymph node cells, with few antigen-specific cells, or a nonattenuated subpathogenic dose of a T cell line, was shown to be effective in protecting from active or passive EAE (Lider et al., 1987; Beraud et al., 1989). A nonencephalitogenic T cell clone specific for epitopes other than 72-89 of guinea pig myelin basic protein isolated during the recovery phase of EAE has been used to prevent and treat both active and passive EAE in rats. This clone [expressing Vp8.6 TCR and specific for amino acid 55-69 of GPBP (guinea pig basic protein)] apparently shares a cross-reactive idiotype with encephalitogenic clones, specific for other epitopes. Thus vaccination with this clone downregulates the response of encephalitogenic T cells (Offner et al., 1991a). Besides EAE, T cell vaccination has been used in the prevention of other induced autoimmune diseases including thyroiditis (Maron et al., 1983)and adjuvant arthritis (Lider et al., 1987). Vaccination with irradiated mouse spleen cells primed and activated to thyroglobulin prevented development of EAT (experimental autoimmune thyroiditis) in mice on challenge with thyroglobulin in adjuvant; again such vaccination did not block passive disease induced by adoptive transfer of antigen-specific T cells. The preventative effect of T cell vaccination was not reduced following depletion of CD8+ cells prior to vaccination. Depletion of either CD4+ or CD8+ cells after vaccination did not affect the protective ability of T cell vaccination but depletion of both subsets at the same time abrogated the protective effect of T cell vaccination. This indicated requirement of both subsets to mediate T cell vaccination-induced downregulation of specific immune response (Flynn and Kong, 1991). Experimental autoimmune thyroiditis induced in mice by immunization with thyroglobulin was shown to be prevented by vaccination with a cytotoxic MHC class Irestricted antigen-specific T cell hybridoma. The vaccination was done 3 weeks before induction of disease with the antigen (Roubaty et al.,
T H E TRIMOLECULAR COMPLEX
235
1990).Monoclonal anti-clonotypic antibody specific for this hybridoma was found to be effective in completely preventing antigen-induced thyroiditis in mice (no reduction in autoantibodies to thyroglobulin was seen in treated mice), suggesting that T cell vaccination may well induce anti-clonotypic antibodies, in addition to anti-idiotypic T cells, to neutralize the pathogenic T cells (Texier et nl., 1992). A CD4+ CD8- T cell line specific for mouse testicular antigens has been shown to suppress the induction of autoimmune orchitis (EAO) in mice when given prior to challenge with the autoantigen. Both cellular and antibody responses were suppressed in an antigen-specific manner in treated mice (Itoh et ul., 1992). Experimental autoimmune neuritis (Taylor and Hughes, 1988)and collagen II-induced arthritis (Kakimoto et nl., 1988) have also been suppressed by vaccinations with antigenspecific T cells. Prevaccination with a subuveitogenic dose of antigenspecific T cells resulted in a marked reduction in pathology of experimental autoimmune uveoretinitis (EAU), on subsequent transfer of a disease-inducing dose of the same uveitogenic T cell line. Actively induced disease was not diminished by such treatment. However, anti-idiotypic or anti-ergotypic responses after treatment were observed and could be implicated in regulating the response of pathogenic T cells (Beraud et ul., 1992). MRL/lpr mice spontaneously develop systemic lupus erythematosus (SLE).Vaccination of young mice with low numbers (0.25 million) ofirradiated CD3’ CD4- CD8- cells isolated from hyperplastic lymph nodes of 6-month-old mice resulted in marked reduction in splenic hyperplasia and lymphadenopathy. Transfer of lymph node cells from vaccinated mice to 2-month-old recipients showed a significant decrease in autoimmune signs as evidenced by decreased proteinuria and increased life span (De Alboran et al., 1992). T cell vaccination seems to induce an anti-idiotypic response mediated by CD4’ T cells which “regulate” antigen-specific T cells. CD8’ anti-idiotypic populations have also been generated capable of lysing the idiotype-bearing T cell in uitro. This could account, in part, for certain regulatory effects seen in uivo (Sun et al., 1988). However, the presence of MBP-specific but avirulent T cells in T cell-vaccinated rats suggests the existence of more than one mechanism. How the CD4 arm of the anti-idiotypic response controls the idiotype-positive T cell is not known. However, the CD4 cells do have a suppressive effect as was shown when cells from vaccinated mice inhibited the proliferative response of the idiotype-positive cells to the specific antigen (Cohen, 1986). T cells used in vaccination are more efficient in generating anti-idiotypic responses if they are activated. Antigen or
236
AMITABH GAUR AND C. GARRISON FATHMAN
mitogen-activated cells seem more efficient in vaccination protocols to prevent disease (Cohen, 1986). This was demonstrated when 5 x lo7 nonactivated cells (with the same specificity) were less effective than fewer (
F. TCR PEPTIDEVACCINATION In a further refinement of the T cell vaccination approach, Vanden-
bark et uZ. (1989) used synthetic peptides corresponding to the pro-
T H E TRIMOLECULAR COMPLEX
237
posed coniplementarity determining region (CDR2) of the Vp8.2 encephalitogenic TCR in Lewis rats. They were able to demonstrate protection from MBP-induced EAE by prevaccinating rats with a synthetic TCR peptide. The protection was specific as peptides corresponding to the CDR2 of the Vp14 chain did not have any effect. TCR peptide-specific cell lines derived from vaccinated rats were not cytotoxic for Vp8.2-expressing MBP-specific T cell lines, ruling out elimination of MBP-specific T cells as the cause for TCR peptide vaccination induced protection from EAE. The predominant role of T cells induced by this vaccination was demonstrated by prevention of disease in animals receiving TCR peptide-specific cells prior to MBP immunization. Antibodies to the T cell receptor peptides were also generated and were reported to prevent EAE in rats. Polyclonal rat or rabbit antibodies specific for the TCR peptide were administered in rats and drastically reduced the severity of the MBP-induced EAE (Hashim et al., 1990). The antibodies specifically stained Vp8.2expressing T cell lines. The staining was weak and not consistent with recognition of the intact T cell receptor. It may be proposed that processed fragments of the TCR bound to cell-surface MHC molecules are the targets of antibody recognition. In a different experiment, nonapeptides from the junctional region (CDR3)of the p-chain ofan encephalitogenic T cell receptor were used i n controlling MBP-induced EAE in rats (Howell et al., 1989). An 11 amino acid peptide corresponding to part of the J region of the a-chain was also tried but peptides longer than 9 amino acids spanning the V-D-J region were not as effective in preventing disease (Howell et al., 1989). TCR peptides (CDR2) have also been shown to treat ongoing EAE in rats. Aqueous solutions of TCR peptides, given either intradermally or subcutaneously after the onset of clinical symptoms, were able to reduce the severity and duration of disease in rats (Offner et al., 1991b).TCR peptides (CRD2) from a variable region of other p-chains like Vp6 which is very similar to VP8.2 were also effective in treating EAE induced in Lewis rats with an encephalitogenic epitope (aa 85-99) of MBP (Offner et al., 1992). A combination of CDR2 TCR peptides from Vp8.2 and Vp4 given in saline subcutaneously at 4-day intervals was shown to effectively block the progression of MBP-induced relapsing EAE in mice (Whitham et al., 1993). We have adapted this TCR peptide vaccination strategy to a mouse model and studied the response in DBA/2 mice to a model antigen. DBAI2 ( H-2d)mice respond to the iminunodominant myoglobin determinant (110-121) by utilizing mostly Vp8.2' T cells (Rubeiti et al., 1991). Immunization with a synthetic peptide corresponding to the
238
AMITABH GAUR AND C. GARRISON FATHMAN
putative CDR2 region of the mouse Vp8.2 TCR resulted in significant reduction in the proliferative response of vaccinated mice to the myoglobin determinant (Gaur et al., 1993b). Peptide vaccination did not affect non-Vp8.2 responses as evidenced by a lack of effect on the response to the A repressor C 1 protein 12-26, a response which does not utilize V/38.2+ T cells (Lai et al., 1988,1990).TCR peptide-specific antibodies failed to show any binding to Vp8.2' T cells and were not effective in blocking antigen-driven Vp8.2 T cell responses. While investigating the mechanisms of unresponsiveness induced by TCR peptide vaccination, we noted a significant reduction in the anti-Vp8.2 antibody-induced proliferation (TCR crosslinking-induced proliferation) of cells from TCR peptide-vaccinated mice. This suggested that TCR peptide vaccination was probably inducing unresponsiveness in the T cell population expressing Vp8.2 T cell receptors. The responses to TCR crosslinking by control antibodies remained unaffected in these vaccinated mice (Gaur et at., 1993b).This unresponsiveness in the Vp8.2 population of T cells was not due to depletion as revealed b y FACS analysis of peripheral blood lymphocytes which showed maintenance of similar numbers of Vp8.2' cells in control and TCR peptide-vaccinated mice. Similar effects of TCR peptide vaccination were seen in H-2" (PL/J X SJL )F, mice, the EAE-susceptible strain. H-2" mice develop a proliferative response specific to the TCR peptide following immunization and also exhibit reduced proliferation 0fVp8.2 T cells in receptor crosslinking assay (Gaur et al., 1993b).Investigating further for the probable mediator of TCR peptide-induced anergy we depleted mice or CD8+cells by antibody treatment prior to vaccination with the TCR peptide. Mice depleted of CD8' cells did not demonstrate Vp8.2-specific unresponsiveness following vacination with the Vp8.Z TCR peptide (Gaur et al., 1993b) These results implicated the CD8 cells in TCR peptide-induced unresponsiveness. One scenario would suggest that the TCR peptides obtained by processingofendogenous TCR chains could associate with MHC class I molecules and be presented on the surface of the T cells. The TCR peptide-MHC I complex serves as target for the TCR peptide-specific CD8+ regulator/ suppressor T cells generated by TCR peptide vaccination. Most of the TCR chains synthesized within the T cell are degraded (Minami et al., 1987; Bonifacino et al., 1989) and, as has been shown by Jiang et al. (1991),these fragments of TCR could be colocalized in the endocytic compartment along with class I MHC complexes. This raises the possibility that such complexes could be present on the surface of the T cell and, even without purposeful immunization, serve as components of a natural regulatory circuit for T cell responses. CD8+ T cells have +
+
THE TRIMOLECULAR COMPLEX
239
been shown to be involved in normal regulation of EAE in mice. Mice lacking CDS' cells had more relapses and developed chronic EAE (Jiang et al., 1992; Koh et al., 1992). The observation that rats immunized with MBP developed a TCR peptide-specific response (Offner et al., 1991b) argues for an endogenous regulatory system wherein the expansion of specific Vp + T cells following antigenic challenge leads to anti-Vp T cell response. If the TCR peptide is associated with the class I MHC molecule, then it should be within the size constraints of the peptides found associated with class I molecules. In the rat, an 11 amino acid peptide contained within the larger 23 amino acid 3961 TCR peptide sequence was found to be the minimal epitope required to obtain the effects of TCR peptide vaccination. The sequence, 44-54, elicits TCR peptide-specific class I-restricted T cells and prevents and treats active and passive EAE in Lewis rats (Vainiene et al., 1992; Hashim et al., 1992). For TCR peptide vaccination to be successful in controlling autoimmunity, as in the case of anti-TCR Vp monoclonal treatment, it requires a single Vp to be predominant in a pathogenic response. This offers advantages over antibody treatment as it evokes an immunoregulatory response after immunization. However, in a cautionary note the same CDR2 peptide from the VpS.2 was shown by Desquenne-Clark et al. (1991) to actually result in exacerbation of EAE in Lewis rats. Using high-performance liquid chromatography (HPLC)-purified peptides, results ranged from suppression to enhancement of disease. Kawano et al. (1991)also report mixed results using TCR peptides in controlling EAU. Retinal S antigen-induced EAU was inhibited in some experiments whereas TCR peptide vaccination-enhanced disease symptoms in interphotoreceptor retinoid-binding protein (IRBP) induced EAU. 111. Target 2: The Peptide Antigen
The minimal-peptide T cell epitope (determinant)of an autoantigen is the most attractive component of the trimolecular complex as it offers the highest specificity of immunoregulation. Through the use of the peptide epitope, T cell clones specific only for the peptide-MHC complex can be targeted for clonal elimination or induction of unresponsiveness. Obviously, only those disease situations where the autoantigen is known and the minimal T cell epitopes have been mapped would be amenable to this strategy. Efforts to identify the autoantigens in various autoimmune disorders are currently underway. In the following sections different approaches aimed at achieving specific unresponsiveness employing the peptide determinant are discussed.
240
AMITABH GAUR A N D C. GARRISON FATHMAN
A. PEPTIDEDETERMINANT AS A TOLEROGEN Intact proteins or their peptide determinants have been shown to induce specific unresponsiveness if given in a nonimmunogenic fashion. Exposure to peptide antigen at the neonatal stage usually leads to antigen-specific unresponsiveness in the adult animal as shown in case of sperm whale myoglobin (Young and Atassi, 1983), self-MHC peptides (Benichou et al., 1990),and hepatitis B core antigen peptides (Milich et al., 1989). The inability to mount antigen-specific response on subsequent antigenic challenge in adult life could be due to elimination of antigen-specific T cell clones (Nossal, 1983; Gammon et al., 1986a), clonal anergy (Gammon et al., 1986b), or generation of specific suppressor or regulator cells (Oki and Sercarz, 1985). This approach, of inducing antigen-specific neonatal tolerance, has been used in an attempt to block development of disease in experimental models of autoimmunity. Collagen-induced arthritis in rodents serves as a model for human arthritis. Synthetic peptides corresponding to sequences in Type I1 collagen were injected neonatally to tolerize DBAll mice. At 6-8 weeks of age tolerized mice were immunized with Type I1 collagen to induce arthritis. Of the different peptides tested aa 122-147 (now known as 245-270) provided protection from disease symptoms. Mice tolerized with Type I1 collagen were protected completely in these experiments (Myers et al., 198913). Subsequently, residues important for tolerance induction have been identified in this peptide b y assessing the ability of substituted peptides to induce protection from arthritis in mice (Myers et al., 1992). Myasthenia gravis (MG), a T cell-dependent autoantibody-induced disease, is characterized by neuromuscular dysfunction. Immunization of rodents with acetylcholine receptor results in experimental autoimmune myasthenia gravis (EAMG), a disease similar to MG. Neonatal tolerance to a dominant and discriminatory T cell epitope of acetylcholine receptor (AcHR) achain from Torpedo cdifornica has been reported to confer protection from AcHR-induced disease in a murine model of myasthenia gravis. The region encompassed b y 146-162 ofthe a-chain ofAcHR is immunodominant in the C57BL6 (B6)(H-zb)mice but is unable to provoke disease on its own. However, newborn mice given synthetic peptide corresponding to 146-162 region of the AcHR were resistant to disease induction by AcHR. A reduction in anti-mouse AcHR antibodies was also observed in neonatally tolerized mice. Neonatal injection of intact a-chain of the AcHR was also found to b e effective in preventing clinical signs of EAMG in treated animals (Shenoy et al., 1993). Intraperitoneal administration of the dominant pathogenic N terminal peptide 1-9 (l-9NAc) of MBP in newborn B1O.PL (H-2”) mice
THE TRIMOLECULAR COMPLEX
24 1
resulted in protection from peptide-induced EAE in adult life. Protection from disease in tolerized mice correlated with reduction in proliferative T cell response to the peptide (Clayton et al., 1989). Though neonatal treatment with the peptide was able to prevent peptide-induced EAE it did not have any protective effect on the disease induced by immunization with complete MBP. This lack of protection from MBP-induced EAE was apparently due to the immunopathogenic activity of subdominant epitopes other than 1-9NAc in MBP capable of causing active disease symptoms (Clayton et al., 1989). Like tolerance in the neonates, tolerance in adult animals can also be induced in a determinant-specific manner, by selecting a nonimmunogenic formulation and route of antigen delivery. We have attempted to induce MBP-specific unresponsiveness in the adult H-2" (PL/J x SJL)F, mice using two encephalitogenic peptide determinants of MBP. The proliferative T cell response to the acetylated N terminal (Acl-11) determinant is dominant over the middle (amino acid 35-47) determinant of MBP in H-2" mice. Interestingly, the same hierarchy was maintained in the tolerance induction ability of the two determinants. Though both Acl-11 and 35-47 were able to induce tolerance to themselves, the latter was less potent in reducing MBP-specific response. A combination of the two peptides, when given prior to immunization with MBP, was able to reduce the MBP-specific proliferative response to the same extent as did tolerance to native MBP. The same hierarchy of tolerance induction was observed in the diseasepreventing ability of the two peptide determinants. While Acl-1 1was more effective in preventing MBP-induced EAE symptoms as compared to 35-47 peptide the combination of the two was most effective in preventing development of clinical signs of EAE (Gaur et al., 1992). Our findings on the hierarchy of dominance of determinants and its direct relationship with the tolerogenic potential were similar to those obtained by Ria et al. (1990) where, using linked synthetic peptide epitopes, they showed the same hierarchy in immunodominance as tolerogenicity. In clinical disease a patient presents with clinical signs of an autoimmune disease and, thus, already has autoreactive T cells. We used the two peptide determinants to treat ongoing EAE. Mice which were immunized with MBP to induce EAE were given the combination of the two peptides on the day of onset of disease symptoms. Of the seven mice in the group treated, six remained free of disease for over 200 days (after which the study was terminated), whereas all mice in the control group developed severe disease symptoms. Lymph node cells from similarly treated mice demonstrated reduced proliferation to MBP. To ascertain whether the un-
242
AMITABH GAUR AND C. GARRISON FATHMAN
responsiveness was because of clonal elimination or anergy, exogenous interleukin-2 ( I L 2) was added to the antgen-activated lymph node cell cultures from treated mice. Restoration of an MBP proliferative response by added IL2 suggested that an anergic state of the antigen-specific T cells was responsible for the effectiveness of peptide-mediated therapy of EAE (Gaur et al., 1992). Experimental autoimmune uveoretinitis is a model for human uveitis (Forrester et a,?.,1992). Intraveous injection ofuveitogenic peptides from the IRBP prior to immunogenic challenge with either the peptides or the whole IRBP was able to prevent the development of clinical signs of experimental autoimmune uveoretinitis in adult rats. The protection offered by prior treatment with an intravenous aqueous solution of the peptides was dose-dependent with the higher dose being more potent in conferring protection to an immunogenic challenge by the peptide itself or the whole IRBP. Again, the more uveitogenic peptide (aa 1177-1191 of bovine IRBP) was most effective in preventing EAU induced by whole IRBP (Sasamoto et al., 1992). Peptide determinants coupled to splenocytes administered intravenously serve as efficient tolerogens. Guinea pig MBP(GPMBP) peptide 68-86-linked splenocytes given 2 days after adoptive transfer of EAE with GPMBP-primed T cells were able to arrest the development of EAE in male Lewis rats (Pope et al., 1992). Peptide-linked splenocytes were able to induce specific tolerance in S J U J (H-2') mice. Region 84-104 of MBP is the major encephalitogenic epitope in the H-2Smice. Splenocytes coupled to peptide 84-104 reduced the specific T cell proliferative response but were not effective in blocking adoptively transferred EAE (Tan et al., 1992). However, disease transferred by T cells primed to peptide 91-104 was prevented effectively by administering 91-104-linked splenocytes (Su and Sriram, 1991). Besides the use of peptide determinants for inducing specific unresponsiveness, whole protein antigens have been used in various formulations and routes to induce antigen-specific tolerance in newborn or adult animals. Administration of autoantigens orally has been shown to induce antigen-specific tolerance. Feeding Lewis rats with MBP resulted in antigen-specific unresponsiveness and protected rats from induced EAE. This suppression of MBP-specific T cells was mediated by CD8' T cells which were isolated and demonstrated to transfer suppression both in vitro and i n vivo in naive recipients (Lider et al., 1989b).This suppression does not require cell contact and is achieved by soluble mediators passing through membranes separating effector and target cells (Miller et al., 1991).The soluble factor has been identified as TGFP. TGFp-neutralizing antibodies abrogated suppression
T H E TRIMOLECULAR COMPLEX
243
in both in vitro and in v i m experiments (Miller et al., 1992). A pilot trial of oral tolerization was conducted in 30 multiple sclerosis patients. Bovine myelin protein or a placebo was given orally in a double-blind study. Results of the published trial suggest some beneficial effects to patients receiving myelin orally (Weiner et al., 1993). Importantly, no exacerbation of disease was observed in myelin-fed patients. A controlled study with matched patient groups will be needed to draw definitive conclusions (Weiner et al., 1993). Oral tolerance protocols have also been used with success in the EAU model in rats where retinal S antigen administered orally to animals was able to prevent S antigen-induced EAU. This suppression was again mediated by CD8+ T cells (Nussenblatt et al., 1990). Collagen-induced arthritis was prevented by feeding Type I1 collagen (Zhang et nl., 1990) and diabetes in NOD mice blocked by feeding insulin (Zhang et al., 1991). Besides the oral route of tolerization, CD8+ immunoregulatory cells have been reported to be generated when soluble or nonimmunogenic antigens are used for tolerance induction. Antigen-specific CD8+ regulatory cells have been isolated from the thymus and spleens of mice injected with soluble autologous thyroglobulin and prevent development of autoimmune thyroiditis. These cells appeared to have been generated in the thymus and migrate to the spleen and periphery (Rose and Taylor, 1991). In a murine model of autoimmune orchitis, intravenous administration of soluble testicular antigen was shown to prevent the development of orchitis as judged b y histopathological examination. Protection was adoptively transferrable and found to be mediated by CD8' T cells (Mukasa et al., 1992). Although CD8+ T cells have been implicated in antigeninduced tolerance CD8 + cells were not essential for peptide-induced tolerance (Gaur et ul., unpublished results). To examine the potential role of CD8+ cells in peptide tolerance induction, we depleted CD8+ cells in adult mice by antibody treatment. Mice either depleted or not depleted of CD8 + cells were tolerized equally by a synthetic peptide determinant of sperm whale myoglobin given intraperitoneally emulsified with incomplete Freund's adjuvant (Gaur et al., unpublished results). Both in collagen II-induced arthritis and in autoimmune thyroiditis models where soluble antigen administration resulted in protection from disease, CD4+ T cells were the mediators of antigen-induced suppression (Myers et al., 1989a; Kong et al., 1989; Parish et ul., 1988). In a different strain of mice, Balb/cByJ, susceptible to autoimmune orchitis, CD4+ spleen cells from the disease-resistant strain Balb/cJ were able to suppress the development of EAO in the recipients (Teuscher et al., 1990).
244
AMITABH GAUR A N D C. GARRISON FATHMAN
Besides using peptides alone to induce specific unresponsiveness a complex of soluble MHC class I1 molecule with the pathogenic peptide has also been used to induce specific tolerance. Encephalitogenic peptide 91-103 of MBP complexed with a soluble I-ASmolecule was administered in SJL/J mice and prevented adoptively transferred disease. Active EAE, induced by immunization with another proteolipoprotein peptide, 139-151, was also reduced by treatment with the I-AS-peptide complex. The prevention of disease was due to clonal anergy as demonstrated by in vitro study of the effect of the peptide-MHC complex on the response of a T cell clone specific for MBP peptide 91-103 (Sharma et al., 1991).
B. ANALOGSAS MHC BLOCKERSOR T CELLANTAGONISTS Responses to autoantigens are presumed to be similar to normal immune responses. Thus it seemed logical to block recognition of the disease causing peptide:MHC I1 complex to block activation of selfreactive T cells. Such MHC-T cell receptor blockade has been achieved using peptides with good MHC binding which are not structurally related to the autoantigen. Alternative strategies use known autoantigens as peptides with substitute amino acids to increase MHC binding or to interfere with T cell recognition. In these studies hen egg lysozyme (HEL) peptide 46-61 which is immunogenic in I-Akexpressing mice was used with cells expressing I-Ak or planar membranes bearing I-Ak. Inhibition of MHC class I1 binding and reduction in activation of a T cell hybridoma correlated well for the different competing peptides. One peptide with a sequence which was identical to that of mouse lysozyme was also a good inhibitor of H E L recognition suggesting that the same MHC molecule can bind and compete for autologous and foreign peptides (Babbitt et al., 1986). Competition for the MHC molecule in vivo has been demonstrated using synthetic peptides corresponding to mouse lysozyme (ML) and the HEL sequence 46-62. The mouse sequence was not immunogenic but was capable of preventing the T cell response to the HEL peptide when mice were coimmunized with 30-fold excess of the ML peptide (Adorini et al., 1988). This blockade was allele specific; I-Ek restricted responses were not affected (Adorini et al., 1989). Peptide blockers in soluble form, modified to increase their half-life in circulation, have also been demonstrated to be effective in blocking allele-specific immune responses (Muller et al., 1990).Since autoreactive T cells may recognize endogenous or/and exogenous antigens it was important to assess the ability of MHC II-blocking peptides to effectively prevent both kinds of antigen presentation. Antigen-presenting cells (APCs;
T H E TRIMOLECULAR COMPLEX
245
B cell hybridomas) with appropriate MHC expression were transfected with a construct encoding HEL to generate endogenous lysozyme peptides. HEL-transfected APCs were able to activate a class II-restricted lysozyme-specific T cell hybridoma. Presentation to the T cell was blocked by the addition of I-Ek-bindingmouse lysozyme peptide 46-62. This peptide inhibited the activation induced by endogenous or exogenous stimulator peptides (Adorini et al., 1991). This study demonstrated lack of strict compartmentalization between exogenous and endogenous pathways of antigen presentation. MHC-blocking peptides were then tested in experimental models to block autoimmune diseases. An ideal M HC-blocking peptide would have a high affinity of binding to the disease-linked MHC but lack T cell-activating potential. MBP Acl-11, an encephalitogenic peptide, was substituted with alanine at all positions to determine the relative importance of each residue in either binding to I-A" MHC or activating an Acl-ll-specific T cell clone. This analysis revealed that the residue at position 3 was crucial for T cell activation and the residue at position 4 was important for binding to the MHC. A peptide analog with alanine substitutions at positions 3 and 4 was found to bind I-A" better than Acl-11 and also failed to stimulate Acl-ll-specific T cells. However, the Acl-11 (3A,4A) analogue failed to protect H-2"mice from A c l - l l induced EAE when used in 10-fold excess in coimmunization protocols. Interestingly, another analog Acl-1l(4A) which is better than Acl-11 in MHC binding and in stimulating T cells and, thus, would be expected to worsen disease symptoms, was found to be effective in inhibiting Acl-1 l-induced EAE. Also, treatment with IFA-emulsified Acl-ll(4A) at the time of disease onset resulted in marked reduction in disease incidence and severity (Wraith et al., 1989; Smilek et al., 1991). How Acl-1 l(4A) which is a strong activator of encephalitogenic T cell clones (but does not cause disease on its own) inhibits A c l - l l induced EAE is not clear. Perhaps antigen-induced tolerance (anergy) or suppression in addition to MHC blockade might be possible mechanisms. Sakai et al. (1989) used nonencephalitogenic I-A"-binding competitor peptides from the N terminus of MBP to block AC1-ll-induced EAE. The 20 amino acid nonacetylated, nonencephalitogenic N terminus peptide of MBP was effective in inhibiting EAE at only threefold excess to Acl-11 in coimmunization protocols. The acetylated 9-20 peptide was also effective in blocking Acl-1 l-induced disease. Since these peptides were able to compete for I-A" binding in T cell stimulation assays it was assumed that the disease-inhibiting ability was due to MHC blockade. MHC competitor peptides which are structurally unrelated to the disease-causing peptides have also been successfully used to prevent
246
AMITABH GAUR A N D C. GARRISON FATHMAN
EAE. Peptide 323-339 of ovalbumin binds I-A"and competes for MHC binding with other I-A"-binding peptides in T cell hybridoma stimulation but is not immunogenic in H-2" (PL/J x SJL)F1mice. Coimmunization regimens including ovalbumin peptide 322-339 (at 20- to 25-fold molar excess over Acl-11) resulted in an inhibition of EAE in mice (Gautam et al., 1992). A structurally unrelated peptide that bound with high-affinity I-AS was studied. This KM core extension peptide at 10-fold excess was effective in preventing EAE in SJL/J mice induced by an encephalitogenic peptide, 139-151,of mouse proteolipoprotein (PLP).The protection from disease was transient and could be effected by injecting the competitior peptide a day before encephalitogenic challenge at a different site suggesting MHC blockade as the cause of disease inhibition (Lamont et al., 1990). Mouse lysozyme peptide 49-62, which is nonimmunogenic due to self-tolerance, at a 1000-fold excess was able to suppress the myosin-induced myocarditis in mice (Smith and Allen, 1991). A peptide analog, substituted at three positions, of an arthritogenic peptide (CII 245-270) from Type I1 collagen, capable of binding to 1-Aq, was found to be effective in preventing the onset of CII 245-270induced arthritis at a 320-480 molar excess in DBAll mice. Noteworthy was the inability of the peptide analog to induce tolerance in contrast to the tolerogenic capacity of the CII 245-270 peptide, arguing for MHC blockade by the analog as the reason for the ameliorating arthritic symptoms (Myers et al., 1993). Studies mentioned above presume MHC blockade or competition as the mechanism of peptide analog competitors. However, there is no clear evidence as to how these peptide analogs might be acting by competing for MHC sites in vioo and not by other mechanisms including peptide-specific tolerance and suppression. How a competitor is able to block in oivo all the avaliable MHC molecules of a given allele is not clear. Even if this were to happen based on binding to 0.1% of MHC sites, which is required for T cell activation (Demotz et al., 1990; Harding and Unanue, 1990), still this strategy would block all immune responses (against self- or foreign antigens) restricted by the targeted MHC molecule leading to a generalized immune unresponsiveness. Besides, high doses of the competitor peptide with suitable modifications to increase the half-life of the peptides would be required to block all available MHC molecules. Observations where peptide analog of the antigenic peptide were found to block the activation of the T cell at concentrations 1000- to 10,000-fold less than unrelated MHC competitor peptides having similar affinities of binding to
THE TRIMOLECULAR COMPLEX
247
the MHC molecule suggest a new and effective approach for controlling autoimmunity. Analogs were made with single amino acid substitutions in the peptide determinants of tetanus toxoid (TT 830-843) and hemagglutinin (HA 307-319). Analogs with varying affinities for HLADR1 were used to inhibit antigen presentation to either TT- or HAspecific T cell clones. Interestingly analogs of the same determinant were most effective in blocking T cell activation by their cognate antigens: HA analogs were good inhibitors for the HA clone and TT analogs for TT-specific clone despite having similar affinities for the DR1 molecule. When APCs were prepulsed with the antigen (HA or TT peptides) only antigen-related analogs (HA or TT) and not unrelated MHC blockers were able to inhibit T cell activation. Unrelated MHC-blocking peptides inhibited T cell activation only when added along with the stimulatory peptide. Mechanisms other than peptide competition for MHC were operative. Based on these results, De Magistris et ul., (1992) proposed that the bimolecular complex, peptide analog-MHC, serves as antagonist for the TCR, i.e., it binds the TCR but does not activate the T cell. Such inactivated state of the T cell is maintained only until the TCR is engaged by the antagonist. Apparently, such antagonist-TCR interaction transduces neither activation or inactivation (anergy) signals to the T cell. Alanine-substituted analogs of an encephalitogenic peptide of MBP were compared with analogs of an arthritogenic peptide from heat shock protein 65kDa (HSP-65) from mycobacteria in their ability to block disease in Lewis rats. Although MBP peptide analog had a higher affinity for the MHC than the arthritogenic peptide analog it was not able to prevent arthritis. Only the arthritogenic peptide analog was able to prevent arthritis on coimmunization with the HSP-65 peptide. Also, preimmunization with this analog prevented arthritis induction by the HSP-65 peptide indicating that mechanisms other than or in addition to competition for MHC are involved (Wauben et al., 1992). In a recent report Ostrov et al. (1993) find that fine changes in the TCR junctional regions correlate with the ability of a peptide analog to serve as an antagonist. Accordingly, antagonism is evident when antigen-interactive residue of the TCR is engaged by the altered residue in the analog.
IV. Target 3: The MHC (la) Molecule
Susceptibility and resistance to various autoimmune diseases is linked to expression of a given type of MHC molecule. Individuals
248
AMITABH GAUR A N D C. GARRISON FATHMAN
expressing HLA DR4 have a sixfold higher propensity to develop rheumatoid arthritis (Wordsworth and Bell, 1992). Similar HLA disease associations have been found for other autoimmune diseases like myasthenia gravis and insulin-dependent diabetes mellitus (IDDM) (Bell et al., 1986; Todd et al., 1987, 1988).Animal models of autoimmune diseases also demonstrate the direct relationship of disease susceptibility with the expressed MHC gene products (Steinman, 1992; Acha-Orbea and McDevitt, 1987). The MHC exerts its influence on the disease susceptibility by presumably different ways including facilitating the escape from the thymus through positive selection of selfreactive clones or by deleting suppressor/regulator cells which may be controlling autoreactive cells in the periphery. Expression of MHC class I1 molecules on tissues which normally do not express it may become the trigger for activating autoreactive T cells. This induction of expression of MHC molecules can be initiated by cytokines such as IFNy which could be produced due to some local inflammatory reaction to a pathogen. Transgenic mice expressing cytokines under the control of insulin promoter develop insulitis (Sarvetnick et al., 1990).Another mechanism which could be involved is molecular mimicry wherein shared residues between a pathogen and the MHC gene products could render cells expressing MHC susceptible to attack by pathogen-reactive T cells (Oldstone, 1987). Sequence homology between Epstein-Barr virus (EBV), implicated in susceptibility to rheumatoid arthritis, and HLA-DRP w4 is one such example (Roudier et al., 1988).Presentation ofthe antigen by the MHC molecule appears central to its ability to influence development of autoreactive T cells. Antibodies which could target the MHC gene products specifically seemed appropriate agents for controlling autoimmune diseases. In one of the earliest attempts at regulating autoimmunity animals treated with anti-Ia antibodies showed suppression of overt clinical signs but not histopathological signs of EAE development (Steinman et al., 1981). Repeated injections of monoclonal anti-Ia antibodies after the first attack reduced the mortality due to EAE. Severity and the frequency of relapsing attacks in treated mice were also diminished (Sriram and Steinman, 1983). Monkeys injected with rat monoclonal anti-Ia antibodies showed mitigated EAE signs. Treated animals soon developed anti-rat immunoglobulin and an anti-idiotypic response (Jonker et al., 1988).EAT was completely prevented by anti-Ia (antiI-A) antibody injection at the time of primary immunization with the thyroglobulin. Secondary immunizations with thyroglobulin needed to induce EAT were well tolerated and no disease was produced suggesting in this instance the inhibitory effect of anti-Ia antibodies
T H E TRIMOLECULAR COMPLEX
249
on secondary antigenic challenges (Vladutiu and Steinman, 1987). In the same disease model anti-I-E antibodies were also effective in preventing EAT (Stull et al., 1990) whereas treatment with anti-I-E antibodies exacerbated collagen-induced arthritis in mice. Only antiI-A antibodies were found to inhibit disease in this model (Wooley et al., 198s). EAU in rats (Wetzig et al., 1988; Rao et al., 1989)and EAMG were also treated with anti-Ja antibodies. Response to soluble AcHR was greatly inhibited by anti-Ia antibodies. It was interesting to note that anti-Ia treatment could also affect the effector arm of the immune response as levels of anti-AcHR antibodies were also reduced by the treatment. This inhibitory effect on EAMG was shown to be mediated by cells from anti-Ia-treated mice when they inhibited anti-AcHR antibody production of cells from AcHR-primed animals in an in vitro mixing experiment suggesting that anti-Ia treatment induces generation of specific suppressor cells (Waldor et aE., 1983,1987b). In spontaneously occurring diabetes in NOD mice long-term treatment with a monoclonal antibody specific to the unique NOD MHC, I-Annd,was shown to prevent development of spontaneous diabetes but not insulitis as compared to mice receiving control antibodies. Transfer of spleen cells from anti-Ia-treated mice to NOD recipients prevented the development of diabetes in the adoptively transferred disease model. Depletion of CD4' cells from treated donor cells abrogated the disease inhibitory effect and strongly argues for generation of suppressor cells following anti-Ia treatment (Boitard et al., 1988).However, spleen cells from anti-Ia-treated NZB mice, which were protected from disease (spontaneous lupus-like disease) because of the treatment, failed to inhibit antibody production from B cells of untreated NZB mice pointing to the absence of generation of suppressor mechanism following anti-Ia treatment (Klinman et al., 1986). Similarly no suppressor activity was found in mice treated for EAT by antiIa antibodies (Stull et al., 1990). Anti-Ia antibodies as discussed in this section could be used for modulating immune responses. These antibodies presumably work primarily by affecting the antigenpresenting ability of the MHC which theoretically could be achieved by the following mechanisms: (i) inhibiting peptide-MHC interaction by inducing conformational changes disallowing peptide binding. AS most of the anti-Ia antibodies used are directed to the nonpolymorphic region close to the cell surface it seems unlikely that they are directly inhibiting peptide interaction by steric hindrance. (ii) by elimination of antigen-presenting cells or modulation of MHC expression on the surface of APCs after binding. However, as compared to MHCcompeting peptides which are specifically aimed at blocking the pre-
250
AMITABH GAUR A N D C. GARRISON FATHMAN
sentation of the peptide antigen anti-Ia antibodies can also regulate the immune response by generating specific suppressor cell populations. Anti Ia treatment is not as specific as some other strategies detailed above and could in principle lead to downregulation of all responses dependent on the MHC molecule targeted by the anti-Ia treatment. However, in situations where the autoantigen or the TCR usage is not known as in the case of NOD model it may seem to be a viable alternative. To circumvent the problem of nonspecificity in antiIa treatment Aharoni et al. (1991) developed monoclonal antibodies specific for unique sites generated by binding of an MBP antigen fragment and the self-MHC, I-AS.These antibodies inhibited the proliferative response to the encephalitogenic epitope of the rat MBP without affecting PPD-specific responses in uitro. The antibodies were able to block development of clinical EAE induced by spinal cord homogenate when given in multiple injections around the time of disease induction in SJL/J mice.
V. Conclusion
Among the potential immunotherapeutic strategies outlined in this review the most favored would be the therapy which is most selective in turning off autoantigen-specific T cells while sparing the rest of the immune response. Immunotherapy with peptide antigen would be the best choice. Use of a peptide antigen to induce tolerance or to develop antagonists made by selectively changing crucial residues in the autoantigenic epitope would affect only antigen-specific autoreactive T cells. Problems such as dose and half-life of the peptide need to b e addressed. Synthetic organic molecules mimicking the peptide, with extended stability in circulation, modeled on the structure of the peptide could be potential replacements. Formulation and routes of tolerization which are acceptable need to be worked out. A possibility remains that peptides used as tolerogens in treatment regimens may induce activation of the autoreactive clones and thus exacerbate disease. The duration of unresponsiveness following is also important. Will new T cells joining the circulating pool recreate autoimmunity or maintain normal tolerance to self? Peptide antagonists having the potential to bind but not activate T cells have the advantage of working at lower doses and would be preferred over native sequences. However, the most obvious and currently unfulfilled requirement in this approach is knowledge of the autoreactive determinant. Diseases where the autoantigenic epitope(s) is (are) identified would be amenable to such manipulation. Attempts are currently under way to identify
THE TRIMOLECULAR COMPLEX
25 1
the autoantigens in several autoimmune diseases. The availability of the crystal structure of the MHC class I and TI molecules makes possible the modeling of hypothetical candidate peptide antigens which will best fit the antigen-binding groove for a given allele. Peptides synthesized based on such predictions could then be used as tolerogens (or antagonists) in situations where the HLA allelic association with an autoimmune disease is known. In situations where the target antigen remains elusive other approaches such as antibodies to the differentiation markers on T cells could be used. If a restriction in the TCR Vp usage is found and correlated with the disease symptoms anti-TCRVp antibodies seem appropriate as therapeutic tools. Antibodies to the CD4 molecule are currently in clinical trials for treating rheumatoid arthritis and multiple sclerosis. Encouraging results have been obtained; however, the depletion of CD4’T cells, which is required for symptom-ameliorating effects, does lead to concerns regarding compromised immune status of the patients.
ACKNOWLEDGMENTS This work was supported by NIH Grants A1 27989 and DK 43711. We thank Brett Charlton and Peter Krause for help with the computer.
REFERENCES Acha-Orbea, H., and McDevitt, H. 0. (1987). The first external domain of the nonobese diabetic mouse class I1 I-A p chain is unique. Proc. N u t / . Acud. Sc i. U.S.A. 84, 2435-2439. Acha-Orbea, H., Mitchell, D. J., Timmermann, L., Wraith, D. C., Tausch, G. S., Waldor, M. K., Zamvil, S. S., McDevitt, H. O., and Steinman, L. (1988).Limited heterogeneity of T cell receptors from lymphocytes mediating autoimmune encephalomyelitis allows specific immune intervention. Cell (Can~hridge,Muss.) 54, 263-273. Acha-Orbea, H., Steinman, L., and McDevitt, H. 0. (1989). T cell receptors in murine . Imntunol. 7, 371-405. autoimmune diseases. A ~ I I I UReu r2dorini, L., Muller, S., Cardinaux, F., Lehmann, P. V., Falcioni, F., and Nagy, Z. A. (1988). In vivo competition between self peptides and foreign antigens in T-cell activation. Nature (London)334, 623-625. Adorini, L., Appela, E , , and Nagy, 7,.A. (1989). In “The Immune Response to Structurally Defined Proteins: The Lvsozyme Model” (S. Smith-Gill and E. Sercarz, eds.), pp. 257-266. Adenine Press, Schenectady, NY. Adorini, L., Moreno, J., Momburg, F., Hammerling, G. J., Guery, J. C., Valli, A . , and Fuchs, S. (1991). Exogenous peptides compete for the presentation of endogenous antigens to major histocompatibility complex class 11-restricted T cells. J . E x p . Med. 174,945-948. Aharoni, R., Teitelbaum, D., Arnon, H., and Puri, J. (1991). Immunomodulation of experimental allergic encephalomyelitis by antibodies to the antigen-Ia complex. Nature (Londoti)351, 147-150. Vandenabeele, P., Flaniand, V., Moser, M.,Leo, O., Abramowicz, D., Urbain, Alegre, M., J., Fiers, W., and Goldman, M. (1990). Hypothermia and hypoglycemia induced by
252
AMITABH GAUR A N D C. GARRISON FATHMAN
anti-CD3 monoclonal antibody in mice: Role oftumor necrosis factor. Eur.1. Immunol. 20, 707-710. Alters, S. E., Steinman, L., and Oi, V. T. (1989). Comparison of rat and rat-mouse chimeric anti-murine CD4 antibodies in vitro: Chimeric antibodies lyse low-density CD4’ cells. J . Immunol. 142, 2018-2023. Alters, S. E., Sakai, K., Steinman, L., and Oi, V. T. (1990). Mechanisms of anti-CD4mediated depletion and immunotherapy: A study using a set of chimeric anti-CD4 antibodies. J. Immunol. 144, 4587-4592. Alters, S. E., Shizuru, J. A,, Ackerman, J., Grossman, D., Seydel, K. B., and Fathman, C. C . (1991). Anti-CD4 mediates clonal anergy during transplantation tolerance induction. J . E x p . Med. 173, 491-494. Armstrong, H. E., Bolton, E. M., McMillan, I., Spencer, S.C., and Bradley, J. A. (1987). Prolonged survival of actively enhanced rat reiial allografts despite accelerated cellular infiltration and rapid induction of both class I and class I1 MHC antigens. J . E x p . Med. 165,891-907. Babbitt, B. P., Matsueda, G., Haber, E., Unanue, E. R., arid Allen, P. M. (1986).Antigenic competition at the level of peptide-la binding. Proc. Natl. Acad. Sci. U.S.A. 83, 4509-4513. Banerjee, S., Haqqi, T. M., Luthra, H . S . , Stuart, J. M . , and David, C. S. (1988). Possible role of V p T cell receptor genes in susceptibility to collagen-induced arthritis in mice. J. E x p . Med. 167, 832-839. Bell, J., Rassenti, L., Smoot, S., Smith, K., Newby, C., Hohlfeld, R., Toyka, K., McDevitt, H., and Steinman, L. (1986). HLA-DQ p-chain polymorphism linked to niyasthenia gravis. Lancet 1, 1058-1060. Ben-Nun, A., Wekerle, H., and Cohen, I. R. (1981). Vaccination against autoimmune encephalomyelitis with T-lymphocyte line cells reactive against myelin basic protein. Nature (London) 292, 60-61. Benichou, G., Takizawa, P. A,, Ho, P. T., Killion, C. C., Olson, C . A., McMillan, M., and Sercarz, E. E. (1990). Immunogenicity and tolerogenicity of self-major histoconipatibility complex peptides. J . E x p . Med. 172, 1341-1346. Benjamin, R. J., and Waldmann, H. (1986). Induction of tolerance by monoclonal antibody therapy. Nature (London) 320,449-451. Benjamin, R. J., Qin, S. X., Wise, M . P., Cobold, S. P., and Waldmann, H. (1988). Mechanisms of monoclonal antibody-facilitated tolerance induction: A possible role for the CD4 (L3T4) and C D l l a (LFA-1) molecules in self-non-self discrimination. Eur. J . Immunol. 18, 1079-1088. Beraud, E., Lider, O., Baharav, E., Reshef, T., and Cohen, 1. R. (1989). Vaccination against experimental autoimmune encephalomyelitis using a subencephalitogenic dose of autoimmune effector cells. 1. Characteristics of vaccination. J . Autoimmun. 2, 75-86. Beraud, E., Kotake, S., Caspi, R. R . , Oddo, S. M., Chan, C. C., Gery, I., and Nussenblatt, R. B. (1992). Control of experimental autoimmune uveoretinitis by low dose T cell vaccination. Cell. Immunol. 140, 112-122. Blazar, B. R., Taylor, P. A,, Snover, D. C., Bluestone, J . A., and Vallera, D. A. (1993). Nonmitogenic anti-CD3F(ab’)2fragments inhibit lethal mnrine graft-versus-host disease induced across the major histocompatibility barrier. J . Immunol. 150, 265-277. Bluestone, J. A., Bruce, D. S., and Newell, K. A. (1992). Activation of T cells in vivo using anti C D 3 and staphylococcal enterotoxins. Int. J . Cancer. 7(Suppl.), 39-41. Boitard, C., Bendelac, A., Richard, M. F., Carnaud, C., and Bach, J. F. (1988). Prevention of diabetes in nonobese diabetic mice by anti-I-A monoclonal antibodies: Transfer of protection by splenic T cells. Proc. Natl. Acad. Sci. U.S.A.85,9719-9723.
THE TRIMOLECULAR COMPLEX
253
Bonifacino, J. S., Suzuki, C. K., Lippiiicott-Scliwartz, J., Weissnian, A. M., and Klausner, R. D. (1989). Pre-Golgi degradation of newly synthesized T-cell antigen receptor chains: Intrinsic sensitivity and the role of subunit assemb1y.J. Cell B i d . 109,73-83. Brostoff, S. W., and Mason, D. W. (1984). Experimental allergic encephalomyelitis: Successful treatment in vivo with a inonoclonal antibody that recognizes T helper cells. J . Imrnunol. 133, 1938-1942. Burns, F. R., Li, X. B., Shen, N., Offner, H., Chou, Y. K., Vandenbark, A. A, and HeberKatz, E. (1989). Both rat and mouse T cell receptors specific for the encephalitogenic determinant of inyelin basic protein use similar V (Y and V p chain genes even though the major histocompatibility complex and encephalitogenic determinants are being recognized are different. J. E x p . Med. 169, 27-39. Carteron, N. L., Wofsy, D., and Seanian, W. E. (1988). Induction of immune tolerance during administration of monoclonal antibody to L3T4 does not depend on depletion of L3T4’ cells. J . Imrnunol. 140, 710-716. Carteron, N. L., Schimenti, C. L., and Wofsy, D. (1989). Treatment of murine lupus with F(ab72fragments ofmonoclonal antibody to L3T4: Suppression ofautoimmunity does not depend on T helper cell depletion. /. Itnnrunol. 142, 1470-1475. Chatenoiicl, L., Baudrihaye, M. F., Kreis, H., Goldstein, G., Schindler, J., and Bach, J. F. (1982). Human in vivo antigenic modulation induced by the anti-T cell OKT3 monoclonal antibody. Eur. J. Imtnunol. 12, 979-982. Christadoss, P., and Dauphinee, M. J. (1986). Immunotherapy for myasthenia gravis: A murine model. J. Itnmunol. 136, 2437-2440. Clayton, J. P., Gammon, C. M., Ando, D. G., Kono, D. H., Hood, L.. and Sercarz, E. E. ( 1989).Peptide-specific prevention of experimental allergic encephalomyelitis: Neonatal tolerance induced to the dominant T cell determinant ofmyelinbasic protein. J. E x p . Med. 169, 1681-1691. Cobbold, S.,and Waldmann, H. (1986). Skin allograft rejection by L31T4+ and Lyt2 + T cell subsets. Trunsplantation 41, 634-639. Cobbold, S. P., Thierfelder, S., and Waldmann, H. (1983). Immunosuppression with nionoclonal antibodies: A model to determine the rules for effective serotherapy. Mol. Biol. Med. 1, 285-304. Cobbold, S. P., Jayasuriya, A,, Nash, A , , Prospero, T. D., and Waldmann, H. (1984). Therapy with monoclonal antibodies h y elimination of T-cell subsets in vivo. Nature (London)312, 548-551. Cobbold, S. P., Martin, C., Qin, S., and Waldmann, H. (1986). Monoclonal antibodies to promote marrow engraftinent and tissue graft tolerance. Nuture (London) 323, 164- 166. Cobbold, S. P., Martin, G., and Waldmann, H. (1990).T h e induction of skin graft tolerance in major histocompatibility complex-mismatched or primed recipients: Primed T cells can be tolerized in the periphery with anti-CD4 and anti-CD8 antibodies. Eur. J. Immunol. 20, 2747-2755. Cohen, I. H., (1986). Regulation of autoimmune disease: Physiological and therapeutic. linniunol. Reo. 94, 5-21. Cohen, I. R., (1989). Physiological basis of T-cell vaccination against autoimmune disease. Cold Spring Harbor Synip. Quuiit. Biol. 54(Pt 2), 879-884. Cosimi, A. B., Colvin, R. B., Burton, R. C., Rubin, R. H., Coldstein, C., Kung, P. C . , Hansen, W. P., Delmonico, F. L., and Russell, P. S. (1981). Use ofmonoclonal antibodies to T-cell subsets for immunologic inonitoring and treatment in recipients of renal allografts. N . E u g l . J. Med. 305,308-314. Dallman, M. J., Wood, K. J , , and Morris, P. J. (1987). Specific cytotoxic T cells are found in the nonrejected kidneys of blood-trmsfiised rats. J. E x p . Med. 165, 566-571.
254
AMITABH GAUR A N D C. GARRISON FATHMAN
Dallman, M. J., Shiho, O., Page, T. H., Wood, K. J., and Morris, P. J. (1991).Peripheral tolerance to alloantigen results from altered regulation of the interleukin 2 pathway. J . E x p . Med. 173, 79-87. Danska, J. S., Livingstone, A. M., Paragas, V., Ishihara, T., and Fathman, C. G. (1990). The presumptive CDR3 regions of both T cell receptor a and p chains determine T cell specificity for inyoglobin peptides. J . E x p . Med. 172, 27-33. De Alboran, I. M., Gutierrez, J. C., Gonzalo, J. A,, Andreu, J. L., Marcos, M. A., Kroemer, G., and Martinez, C. (1992). Ipr T cells vaccinate against lupus in MRL/lpr mice. Eur. J . lmmunol. 22, 1089-1093. De Magistris, M. T., Alexander, J., Coggeshall, M., Altman, A., Gaeta, F. C. A., Grey, H. M., and Sette, A. (1992). Antigen analog-major histocompatibility complexes act as antagonists of the T cell receptor. Cell (Cambridge, Mass.) 68, 625-634. Demotz, S., Grey, H. M., and Sette, A. (1990). The minimal number of class I1 MHCantigen complexes needed for T cell activation. Science 249, 1028-1030. Desquenne-Clark, L., Esch, T. R., Otvos, L., Jr., and Heber-Katz, E. (1991). T-cell receptor peptide immunization leads to enhanced and chronic experimental allergic encephalomyelitis. Proc. Nutl. Acad. Sci. U.S.A. 88, 7219-7223. Dialynas, D. P., Quan, Z. D., Wall, K. A., Pierres, A., Quintans, J., Loken, M. R . , Pierres, M., and Fitch, F. W. (1983a). Characterization of the murine T cell surface molecule, designated L3T4, identified b y monoclonal antibody GK1.5: Similarity of L3T4 to the human Leu-3iT4 molecule. J. Immunol. 13,2445-2451. Dialynas, D. P., Wilde, D. B., Marrack, P., Pierres, A,, Wall, K. A., Havran, W., Otten, G., Loken, M. R., Pierres, M., and Kappler, J. (198313). Characterization of the murine antigenic determinant, designated L3T4a, recognized by monoclonal antibody GK1.5: Expression of L3T4a by functional T cell clones appears to correlate primarily with class I1 MHC antigen-reactivity. Immunol. Reo. 74, 29-56. Duby, A. D., Sinclair, A. K., Osborne-Lawrence, S. L., Zeldes, W., Kan, L., and Fox, D. A. (1989). Clonal heterogeneity of synovial fluid T lymphocytes from patients with rheumatoid arthritis. Proc. Natl. Acud. Sci. U.S.A.86, 6206-6210. Fink, P. J., Matis, L. A., McElligott, D. L., Bookman, M., and Hedrick, S. M. (1986). Correlations betwen T-cell specificity and the structure of the antigen receptor. Nature (London)321,219-226. Flynn, J. C., and Kong, Y. C. (1991). In vivo evidence for CD4+ and CD8+ suppressor T cells in vaccination-induced suppression of murine experimental autoimmune thyroiditis. Clin. lmmunol. Immunopathol. 60, 484-494. Forrester, J. V., Liversidge, J., Dua, H. S., Dick, A,, Harper, F., and McMenamin, P. G. (1992). Experimental autoimmune uveoretinitis: A model system for immunointervention: A review. Curr. Eye Res. ll(Suppl), 33-40. Galfre, G, Milstein, C., and Wright, B. (1979). Rat x rat hybrid myelomas and a monoclonal anti-Fd portion of mouse IgG. Nuture (London) 277, 131-133. Gammon, G. M., Oki, A., Shastri, N., and Sercarz, E. E. (1986a). Induction of tolerance to one determinant an a synthetic peptide does not affect the response to a second linked determinant: Implications for the mechanism of neonatal tolerance induction. J. E x p . Med. 164,667-672. Gammon, G., Dunn, K., Shastri, N., Oki, A., WIlbur, S., and Sercarz, E. E. (1986b). Neonatal T-cell tolerance to minimal immunogenic peptides is caused by clonal inactivation. Nature (London)319, 413-415. Gaur, A., Wiers, B., Liu, A., Rothbard, J., and Fathman, C. G. (1992). Amelioration of autoimmune encephalomyelitis by myelin basic protein synthetic peptide-induced anergy. Science 258, 1491-1494.
THE TRIMOLECULAR COMPLEX
255
Gaur, A., Fathman, C. G., Steinman, L., and Brocke, S. (1993a). SEB induced anergy: Modulation of immune response to T cell determinants of myoglobin and myelin basic protein. J . Immunol. 150, 3062-3069. Gaur, A., Haspel, R., Mayer, J. P., and Fathman, C. G. (1993b). Requirement for CD8' cells in T cell receptor peptide-induced clonal unresponsiveness. Science 259,91-94. Gautam, A. M., Pearson, C. I., Sinha, A. A., Smilek, D. E., Steinman, L., and McDevitt, H. 0.(1992).Inhibition ofexperimental autoimmune encephalomyelitis byanonimmunogenic non-self peptide that binds to I-a". J. Immunol. 148, 3049-3054. Glaichenhaus, N., Shastri, N., Littman, D. R., and Turner, J. M. (1991). Requirement for association of p561ck with CD4 in antigen-specific signal transduction in T cells. Cell (Cambridge, Mass.) 64, 511-520. Coldschmidt, T. J., Janson, L., and Holmdahl, R. (1990). In vivo elimination of T cells expressing specific T-cell receptor V p chains in mice susceptible to collagen-induced arthritis. Immunology 69, 508-514. Goldschmidt, T. J., and Holmdahl, R. (1991). Anti-T cell receptor antibody treatment of rats with established autologous collagen-induced arthritis: Suppression of arthritis without reduction of anti-type I1 collagen autoantibody levels. Eur. J. Immunol. 21, 1327- 1330. Goronzy, J., Weyand, C. M., and Fathman, C. G. (1986). Long-term humoral unresponsiveness in vivo, induced by treatment with monoclonal antibody against L3T4. J . E x p . Med. 164,911-925. Gregerson, D. S., Fling, S. P., Merryman, C. F., Zhang, X. M., Li, X. B., and HeberKatz, E. (1991). Conserved T. cell receptor V gene usage by uveitogenic T cells. Clin. Immunol. Immunopathol. 58, 154-161. Gutstein, N. L., and Wofsy, D. (1986).Administration of F(ab')2 fragments of monoclonal antibody to L3T4 inhibits humoral immunity in mice without depleting L3T4 + cells. J. Immunol. 137,3414-3419. Cutstein, N. L., Seaman, W. E., Scott, J. H., and Wofsy, D. (1986). Induction of immune tolerance by administration of monoclonal antibody to L3T4. J . Immunol. 137, 1127-1 132. Hafler, D. A,, Duby, A. D., Lee, S. J., Benjamin, D., Seidman, J. G., and Weiner, H. L. (1988).Oligoclonal T lymphocytes in the cerebrospinal fluid of patients with multiple sclerosis. J . E x p . Med. 167, 1313-1322. Hafler, D. A,, Cohen, I., Benjamin, D. S., and Weiner, H. L. (1992).T. cell vaccination in multiple sclerosis: A preliminary report. Clin. Immunol. Immunopathol. 62,307-313. Happ, M. P., and Heber-Katz, E. (1988). Differences in the repertoire of the Lewis rat T cell response to self and non-self myelin basic proteins. J. E x p . Med. 167, 502513. Harding, C. V., and Unanue, E. R. (1990). Qriantitation of antigen-presenting cell MHC class IUpeptide complexes necessary for T-cell stimulation. Nature (London) 346, 574-576. Hashim, G. A,, Vandenbark, A. A,, Galang, A. B., Diamanduros, T., Carvalho, E., Srinivasan, J., Jones, R., Vainiene, M., Morrison, W. J., and Offner, H. (1990). Antibodies specific for V p 8 receptor peptide suppress experimental autoimmune encephalomyelitis. J. Immunol. 144, 4621-4627. Hashim, G. A,, Offner, H., Wang, R. Y., Shukla, K., Carvalho, E., Morrison, W. J., and Vandenbark, A. A. (1992). Spontaneous development of protective anti-T cell receptor autoimmunity targeted against a natural EAE-regulatory idiotope located within the 39-59 region of the TCR-V p 8.2 chain. J. Immunol. 149, 2803-2809. Haskins, K., Hannum, C., White, J., Roehm, N., Kubo, R., Kappler, J., and Marrack, P.
256
AMITABH GAUR A N D C. GARRISON FATHMAN
(1984).The antigen-specific, major histocompatibility complex-restricted receptor on T cells. VI. An antibody to a receptor allotype. J. E x p . Med. 160, 452-471. Havran, W. L., Poenie, M., Kimura, J., Tsien, R., Weiss, A., and Allison, J. P. (1987). Expression and function ofthe CD3-antigen receptor on murine CD4 +8'thyomocytes. Nature (London) 330, 170-173. Herber-Katz, E., and Acha-Orbea, H. (1989).The V-region disease hypothesis: Evidence from autoimmuneencephalomyelitis. lmmunol. Today 10, 164-169. Hedrick, S. M., Engel, I., McEIIigott, D. L., Fink, P. J., Hsu, M. L., Hamburg, D., and Matis, L. A. (1988). Selection of amino acid sequences in the p chain of the T cell antigen receptor. Science 239, 1541-1544. Herbert, J., and Roser, B. (1988). Strategies of monoclonal antibody therapy that induce permanent tolerance of organ transplants. Transplantation 46(Suppl 2), 128s-134s. Herold, K. C., Bluestone, J. A., Montag, A. G., Parihar, A,, Wiegner, A., Gress, R. E., and Hirsch, R. (1992). Prevention of autoimmune diabetes with nonactivating antiCD3 monoclonal antibody. Diabetes 41, 385-391. Hirsch, R., Eckhaus, M., Auchincloss, H., Jr., Sachs, D. H., and Bluestone, J. A. (1988). Effects of in vivo administration of anti-T3 monoclonal antibody on T cell function in mice. I. Immunosuppression of transplantation responses. J. Zmmunol. 140, 3766-3772. Hirsch, R., Gress, R. E., Pluznik, D. H., Eckhaus, M., and Bluestone, J. A. (1989). Effects of in vivo administration of anti-CD3 monoclonal antibody on T cell function in mice. 11. In vivo activation of T cells. J . lmmunol. 142, 737-743. Hirsch, R., Archibald, J., and Gress, R. E. (1991). Differential T cell hyporesponsiveness induced by in vivo administration of intact or F(ab')2 fragments of anti-CD3 monoclonal antibody: F(ab')2 fragments induce a selective T helper dysfuncti0n.J. Immunol. 147,2088-2093. Howell, M. D., Winters, S. T., Olee, T., Powell, H. C., Carlo, D. J., and Brostoff, S. W. (1989). Vaccination against experimental allergic encephalomyelitis with T cell receptor peptides. Science 246,668-670. Hunig, T., Wallny, H, J., Hartley, J. K., Lawetzky, A., and Tiefenthaler, G. (1989). A monoclonal antibody to a constant determinant of the rat T cell antigen receptor that induces T cell activation. Differential reactivity with subsets of immature and mature T lymphocytes. J . E r p . Med. 169, 73-86. Itoh, M., Mukasa, A., Tokunaga, Y., Hiramine, C., Hojo, K. (1992).Suppression ofefferent limb of testicular autoimmune response by a regulatory CD4+ T cell line in mice. Clin. Erp. lmmunol. 87, 455-460. Jiang, H., Sercarz, E., Nitecki, D., and Pernis, B. (1991). The problems of presentation of T cell receptor peptides by activated T cells. Ann. N . Y . Acad. Sci. 636, 28-32. Jiang, H., Zhang, S. I., and Pernis, B. (1992). Role ofCD8'T cells in murine experimental allergic encephalomyelitis. Science 256, 1213-1215. Jonker, M., van Lambalgen, R., Mitchell, D. J., Durham, S. K., and Steinman, L. (1988). Successful treatment of EAE in rhesus monkeys with MHC class I1 specific monoclonal antibodies. /. Autoimmun. 1, 399-414. Kahn, C . R., McIntosh, K. R., and Drachman, D. B. (1990).T-cell vaccination in experimental Myasthenia graois: A double-edged sword. J. Autoimmun. 3, 659-669. Kakimoto, K., Katsuki, M., Hirofuji, T., Iwata, H., and Koga, T. (1988). Isolation of T celI line capable of protecting mice against collagen-induced arthritis. J. fmmulaol. 140,78-83. Kappler, J. W., Wade, T., White, J., Kishnir, E., Blackman, M., Bill, J . , Roehm, N., and Marrack, P. (1987). A T cell receptor V p segment that imparts reactivity to a class I1 major histocompatibility complex product. Cell (Cambridge, Mass.) 49, 263-271.
T H E TRIMOLECULAR COMPLEX
257
Kaufman, D. S., Kong, C. S . , Shizuru, J. A., Gregory, A. K., and Fathman, C . G. (1988). Use of anti-L3T4 and anti-la treatments for prolongation of xenogeneic islet transplants. Transpluiitation 46, 210-215. Kawano, Y., Sasamoto, Y., Kotake, S., Thurau, S. R . , Wiggert, B., and Gery, I. (1991). Trials of vaccination against experimental autoimmune uveoretinitis with a T-cell receptor peptide. Curr. Eye Res. 10, 789-795. Klinnian, D. M., Lefkowitz, M. D., Raveche, E. S., and Steinberg, A. D. (1986).Effect of anti-Ia treatment on the production of anti-DNA antibody by NZB mice. Eur. J . Irnmunol. 16, 939-944. Koh, D. R., Fung-Leung, W. P., Ho, A., Gray, D., Acha-Orbea, H.. and Mak, T. W. (1992). Less mortality but more relapses in experimental allergic encephalomyelitis in CD8-’- mice. Science 256, 1210-1213. Kohler, G., and Milstein, C. (1975).Continuous cultures of fused cells secreting antibody of predefined specificity. Nature (Lotadon)256,495-497. Kong, Y. M . , Giraldo, A. A,, Waldmann, H., Cobbold, S. P., and Fuller, B. E. (1989). Resistance to experimental autoimmune thyroiditis: L3T4 + cells as mediators ofboth thyroglobulin-activated and TSH-induced suppression. Clin. Imrnunol. Immunoputho/. 51, 38-54. Kroneiiberg, M., Siu, G., Hood, L. E., and Shastri, N. (1986). The molecular genetics of the T-cell antigen receptor and T-cell antigen recognition. Antiu. Reo. Immunol. 4,529-591. Kubo, R. T., Born, W., Kappler, J. W., Marrack, P., and Pigeon, M. (1989). Characterization o f a monoclonal antibody which detects all murine a /3 T cell receptors. J . I n m u nol. 142,2736-2742. Kung, P., Goldstein, G., Reinherz, E. L., and Schlossman, S . F. (1979). Monoclonal antibodies defining distinctive human T cell surface antigens. Science 206,347-349. Lai, M. Z., Huang, S. Y., Briner, T. J., Gnillet, J. G . , Smith, J. A., and Gefter, M. L. (1988). T cell receptor gene usage in the response to h repressor cI protein: An apparent bias in the usage of a V a gene element. J . E x p . Med. 168, 1081-1097. Lai, M. Z., Jang, Y. J., Chen, L. K., and Gefter, M. L. (1990). Restricted V-(D)-Jjunctional regions in the T cell response to A-repressor: Identification of residues critical for antigen recognition. J . Irntnunol. 144, 4851-4856. Lamont, A. G., Sette, A,, Fujinanii, R . , Colon, S. M., Miles, C., and Grey, H. M. (1990). Inhibition of experimental autoiinmune encephaloinyelitis induction in SJLiJ mice by using a peptide with high affinity for I-AS molecules. J . Immunol. 145, 1687-1693. Ledbetter, J. A,, and Seaman, W. E. (1982).The Lyt-2, Lyt-3 macromolecules: Structural and fbnctional studies. Immunol. Reu. 68, 197-218. Leist, T. P.. Cobbold, S . P., Waldmann, H., Aguet, M., and Zinkernagel, R. M. (1987). Functional analysis of T lymphocyte subsets in antiviral host defense. J . Irnmunol. 138,2278-228 1. Leo, O., Foo. M., Sachs, D. H., Sanielson, L. E., and Bluestone, J. A. (1987). Identification of a monoclonal antibody specific for a niurine T 3 polypeptide. Proc. Natl. Acad. Sci. U . S . A . 84, 1374-1378. Lider, O., Karin, N., Shinitzky, M., and Cohen, I . R. (1987). Therapeutic vaccination against adjuvant arthritis using autoimmune T cells treated with hydrostatic pressure. Proc. Natl. Acad. Sci. U . S . A .84, 4577-4580. Lider, O . , Beraud, E., Reshef, T., Friedman, A,, and Cohen, I. R. (1989a). Vaccination against experimental autoimmune encephalomyelitis using a subencephalitogenic dose of autoimniune effector T cells. 2. Induction of a protective anti-idiotypic response. J . Autoimniun. 2, 87-99, Lider, O., Santos, L. M., Lee, C. S., Higgins, P. J., and Weiner, H. L. (1989b). Suppression
258
AMITABH GAUR A N D C. GARRISON FATHMAN
of experimental autoimmune encephalomyelitis by oral administration of myelin basic protein. 11. Suppression of disease and in vitro immune responses are mediated by antigen-specific CD8+ T lymphocytes. J . fmmunol. 142, 748-752. Like, A. A., Rossini, A. A., Guberski, D. L., Appel, M. C., and Williams, R. M. Spontaneous diabetes mellitus: Reversal and prevention in the BB/W rat with antiserum to rat lymphocytes. Science 206, 1421-1423. Lohse, A. W., Mor, F., Karin, N., and Cohen, I. R. (1989). Control of experimental autoimmune encephalomyelitis by T cells responding to activated T cells. Science 244,820-822. Madsen, J. C., Peugh, W. N., Wood, K. J., and Morris, P. J. (1987). The effect of antiL3T4 monoclonal antibody treatment on first-set rejection of murine cardiac allografts. Transplantation 44, 849-852. Maki, T., Gottschalk, R., Wood, M. L., and Monaco, A. P. (1981). Specific unresponsiveness to skin allografts in anti-lymphocyte serum-treated, marrow-injected mice: Participation of donor marrow-derived suppressor T cells. I . Zmmunol. 127, 1433-1438. Maki, T., Ichikawa, T., Blanco, R., and Porter, J, (1992).Long-term abrogation of autoimmune diabetes in nonobese diabetic mice by immunotherapy with anti-lymphocyte serum. Proc. Natl. Acad. Sci. U.S.A.89, 3434-3438. Maron, R., Zerubavel, R., Friedman, A., and Cohen, I. R. (1983). T lymphocyte line specific for thyroglobulin produces or vaccinates against autoimmune thyroiditis in mice.]. lmmunol. 131,2316-2322. Martin, R., Jaraquemada, D., Flerlage, M., Richert, J., Whitaker, J., Long, E. O., McFarlin, D. E., and McFarland, H. F. (1990). Fine specificity and HLA restriction of myelin basic protein-specific cytotoxic T cell lines from multiple sclerosis patients and healthy individuals. 1.Zmmunol. 145, 540-548. Marusic-Galesic, S., Pardoll, D. M., Saito, T., Leo, O., Fowlkes, B. J., Coligan, J., Germain, R. N., Schwartz, R. H., and Kruisbeek, A. M. (1988). Activation properties of T cell receptor-y 6 hybridomas expressing diversity in both y - and 6-chains. 1.Zmmunol. 140,411-418. Mason, D. W., and Morris, P. J. (1986). Effector mechanisms in allograft rejection. Annu. Rev. Zmmunol. 4, 119-145. Matis, L. A., Sorger, S. B., McElligott, D. L., Fink, P. J., and Hedrick, S. M. (1987). The molecular basis of alloreactivity in antigen-specific, major histocompatibility complexrestricted T cell clones. Cell (Cambridge, Mass.) 51,59-69. McConkey, D. J., Hartzell, P., Amador-Perez, J. F., Orrenius, S., and Jondal, M. (1989). Calcium dependent killing of immature thymocytes by stimulation via the CD3/T cell receptor complex. J. Zmmunol. 143, 1801-1806. Merryman, C. F., Donoso, L. A., Zhang, X. M., Heber-Katz, E., and Gregerson, D. S. (1991). Characterization of a new, potent, immunopathogenic epitope in S-antigen that elicits T cells expressing V /3 8 and V a 2-like genes. 1.Zmmunol. 146, 75-80. Miceli, M. C., von Hoegen, P., and Parnes, J. R. (1991). Adhesion versus coreceptor function of CD4 and CD8: Role of the cytoplasmic tail in coreceptor activity. Proc. Natl. Acad. Sci. U.S.A. 88,2623-2627. Milich, D. R., Jones, J. E., McLachlan, A., Houghten, R., Thornton, G. B., and Hughes, J. L. (1989).Distinction between immunogenicity and tolerogenicity among HBcAg T cell determinants: Influence of peptide-MHC interaction. 1. Zmmunol. 143, 3148-3 156. Miller, A., Lider, O., and Weiner, H. L. (1991). Antigen-driven bystander suppression after oral administration of antigens. J. Ezp. Med. 174, 791-798.
THE TRIMOLECULAR COMPLEX
259
Miller, A., Lider, O., Roberts, A. B., Sporn, M. B., and Weiner, H. L. (1992).Suppressor T cells generated by oral tolerization to myelin basic protein suppress both in vitro and in vivo immune responses by the release of transforming growth factor @ after antigen-specific triggering. Proc. Natl. Acad. Sci. U.S.A.89,421-425. Minami, Y . , Weissman, A. M., Samelson, L. E., and Klausner, R. D. (1987). Building a multichain receptor: Synthesis, degradation, and assembly ofthe T-cell antigen receptor. Proc. Natl. Acad. Sci. U.S.A.84, 2688-2692. Morel, P. A . , Livingstone, A. M., and Fathman, C. G. (1987). Correlation of T cell receptor V @ gene family with MHC restriction. J . E x p . Med. 166, 583-588. Mottram, P. L., Wheelahan, J., McKenzie, I. F., anti Clunie, G. J. (1987). Murine cardiac allograft survival following treatment of recipients with monoclonal anti-L3T4 or Ly2 antibodies. Transplant. Proc. 19, 2898-2901. Mukasa, A., Itoh, M., Tokunaga, Y., Hiramine, C., and Hojo, K. (1992). Inhibition of a novel model of murine experimental autoimmune orchitis by intravenous administration with a soluble testicular antigen: Participation of CD8+ regulatory T cells. Clin. Zmmunol.lmmunopatho1. 62, 210-219. Muller, S., Adorini, L., Juretic, A,, and Nagy, 2. A. (1990). Selective in vivo inhibition of T cell activation by class I1 MHC-binding peptides administered in soluble form. J . Zmmunol. 145,4006-4011. Myers, L. K., Stuart, J. M., and Kang, A. H . (19894 A CD4 cell is capable of transferring suppression of collagen-induced arthritis. J. Zmmunol. 143, 3976-3980. Myers, L. K., Stuart, J. M., Seyer, J. M., and Kang, A. H. (1989b). Identification of an immunosuppressive epitope of type I1 collagen that confers protection against collagen-induced arthritis. J. E x p . Med. 170, 1999-2010. Myers, L. K., Terato, K., Seyer, J. M., Stuart, J. M., and Kang, A. H. (1992). Characterization of a tolerogenic T cell epitope of type I1 collagen and its relevance to collageninduced arthritis. J. Immunol. 149, 1439-1443. Myers, L. K., Rosloniec, E. F., Seyer, J. M., Stuart, J. M., and Kang, A. H. (1993). A synthetic peptide analogue of a determinant of type I1 collagen prevents the onset of collagen-induced arthritis. J. Immunol. 150, 4652-4658. Nossal, G . J. (1983). Cellular mechanisms of immunologic tolerance. Annu. Reu. Immunol. 1, 33-62. Nussenblatt, R. B., Caspi, R. R., Mahdi, R., Chan, C. C., Roberge, F., Lider, O., and Weiner, H. L. (1990). Inhibition of S-antigen induced experimental autoimmune uveoretinitis by oral induction of tolerance with S-antigen. J. Immunol. 144, 1689-1695. Offner, H., Jones, R., Celnik, B., and Vandenbark, A. A. (1989). Lymphocyte vaccination against experimental autoimmune encephalomyelitis: Evaluation of vaccination protocols. J . Neuroimmunol. 21, 13-22. Offner, H., Vainiene, M., Gold, D. P., Morrison, W. J., Wang, R. Y.,Hashim, G. A., and Vandenbark, A. A. (1991a). Protection against experimental encephalomyelitis: Idiotypic autoregulation induced by a nonencephalitogenic T cell clone expressing a cross-reactive T cell receptor V gene. J . Zmmunol. 146, 4165-4172. Offner, H., Hashim, G. A,, and Vandenbark, A. A. (1991b).Tcell receptor peptide therapy triggers autoregulation of experimental encephalomyelitis. Science 251, 430-432. Offner, H., Vainiene, M., Gold, D. P., Celnik, B., Wang, R., Hashim, C. A., and Vandenbark, A. A. (1992).Characterization ofthe immune response to a secondary encephalitogenic epitope of basic protein in Lewis rats. I. T cell receptor peptide regulation of T cell clones expressing cross-reactive V @ genes.J. Zmmunol. 148, 1706-1711. Oki, A., and Sercarz, E. (1985). T cell tolerance studied at the level of antigenic determi-
260
AMITABH GAUR A N D C. GARRISON FATHMAN
nants. I. Latent reactivity to lysozyme peptides that lack suppressogenic epitopes can be revealed in lysozyme-tolerant mice. J. E x p . Med. 161, 897-911. Oksenberg, J. R., Stuart, S., Begovich, A. B., Bell, R. B., Erlich, H. A,, Steinman, L., and Bernard, C. C . (1990).Limited heterogeneity of rearranged T-cell receptor V a transcription brains of multiple sclerosis patients. Nature (London) 345, 344-346. Oksenherg, J. R., Panzara, M. A,, Begovich, A. B., Mitchell, D., Erlich, H. A., Murray, R. S., Shimonkevitz, R., Sherritt, M., Rothbard, J., Bernard, C. C., and Steinman, L. (1993).Selection for T-cell receptor V 0-D p-J /3 gene rearrangements with specificity for a myelin basic protein peptide in brain lesions of multiple sclerosis. Nature (London)362,68-70. Oldstone, M. B. (1987).Molecular mimicry and autoimmune disease. Cell (Cumbridge, M U S S . )50(6), 819-820. Ortho Multicenter Transplant Study Group. (1985).A randomized clinical trial of OKT3 monoclonal antibody for acute rejection of cadaveric renal transplants. N . Engl. J. Med. 313,337-342. Ostrov, D., Krieger, J . , Sidney, J., Sette, A., and Concannon, P. (1993). T cell receptor antagonism mediated by interaction between T cell receptor junctional residues and peptide antigen analogues. J. Zmmunol. 150, 4277-4283. Ota, K., Matsui, M., Milford, E . L., Mackin, G. A., Weiner, H. L., and Hafler, D. A. (1990). T-cell recognition of an immunodoniinant myelin basic protein epitope in multiple sclerosis. Nature (London) 346, 183-187. Owhashi, M., and Heber-Katz, E . (1988).Protection from experimental allergic encephalomyelitis conferred by a monoclonal antibody directed against a shared idiotype on rat T cell receptors specific for myelin basic protein. J. E x p . Med. 168,2153-2164. Padula, S. J., Lingenheld, E. G., Stabach, P. R., Chou, C. H., Kono, D. H., and Clark, R. B . (1991). Identification of encephalitogenic V p-4-bearing T cells in SJL mice: Further evidence for the V region disease hypothesis? J. Zmmunol. 146, 879-883. Paliard, X., West, S. G., Lafrerty, J . A,, Clements, J. R., Kappler, J. W., Marrack, P., and Kotzin, €3. L. (1991).Evidence for the effects o f a superantigen in rheumatoid arthritis. Science 253,325-329. Parish, N . M., Roitt, I. M., and Cooke, A. (1988). Phenotypic characteristics of cells involved in induced suppression to niurine experimental autoimmune thyroiditis. Eur. J. Zmmunol. 18, 1463-1467. Parnes, J. R. (1989). Molecular biology and function of CD4 and CD8. Ado. Zmmunol. 44,265-3 11. Pope, L., Patei-son, P. Y., and Miller, S . D. (1992). Antigen-specific inhibition of the adoptive transfer of experimental autoimmune encephalomyelitis in Lewis rats. J. Neuroimmunol. 37, 177-189. Qin, S., Cobbold, S., Tighe, H., Benjamin, R., and Waldmann, H. (1987).CD4 monoclonal antibody pairs for immunosuppression and tolerance induction. Eur. I . Zmmunol. 17, 1159-1165. Qin, S. X., Cobbold, S.,Benjamin, R., and Waldmann, H. (1989). Induction of classical transplantation tolerance in the adult. J. E x p . Med. 169, 779-794. Qin, S. X., Wise, M., Cobbold, S.P., Leong, L., Kong, Y. C., Parnes, J. R., and Waldmann, H. (1990). Induction of tolerance in peripheral T cells with monoclonal antibodies. Eur. J. Immunol. 20,2737-2745. Ranisdell, F., and Fowlkes, B. J. (1990). Clonal deletion versus clonal anergy: Th e role of the thymus in inducing self tolerance. Science 248, 1342-1348. Ranges, G. E., Sriram, S., and Cooper, S. M. (1985). Prevention of type I1 collageninduced arthritis by in vivo treatment with anti-L3T4. J. E x p . Med. 162, 1105-1110.
THE TRIMOL.ECULAR COMPLEX
26 1
Rao, N. A., Atalla, L., Linker-Israeli, M., Chen, F. Y., and George 4th, F. W., Martin, W. J., and Steinman, L. (1989). Suppression of experimental uveitis in rats by antiI-A antibodies. lnoest. Ophthal. Vis. Sci. 30, 2348-2355. Ria, F., Chan, B. M., Scherer, M. T., Smith, J. A,, and Gefter, M. L. (1990). Immunological activity of covalently linked T-cell epitopes. Nature (London) 343, 381-383. Rose, N. R., and Taylor, E. (1991). Antigen-specific iminunoregulation and autoimmune thyroiditis. Ann. N.1'. Acad. Sci. 636, 306-320. Rosenberg, A. S., Mizriochi, T., Sharrow, S. O., and Singer, A. (1987). Phenotype, specificity, and function of T cell subsets and T cell interactions involved in skin allograft rejection. J . E x p . Med. 165, 296-315. Roser, B. J . (1989). Cellular mechanisms in neonatal and adult tolerance. Immunol. Rec. 107, 179-202. Roubaty. C., Bedin, C., and Charreire, J. (1990).Prevention ofexperimental autoimmune thyroiditis through the anti-idiotypic network. J. Imrnunol. 144, 2167-2172. Roudier, J . , Rhodes, G., Petersen, J., Vaughan, J . H . , and Carson, D . A. (1988). Th e Epstein-Barr virns glycoprotein gpl10, a molecular link between HLADR4, HLA DR1, and rheumatoid arthritis. Scand. J. Irnmnnol. 27, 367-371. Ruberti, G., Gaur, A,, Fathinan, C. G . ,and Livingstone, A. M. (1991).Th e T cell receptor repertoire influences V p element usage in response to myoglobin. J . E x p . Med. 174, 83-92. Rueff-Juy, D.. Drapier, A. M., and Cazenave, P. A. (1989). Effects of neonatal injections of anti-CD3 epsilon monoclonal antibodies on the T cell functions of adult mice. J . lniniunol. 142, 3788-3795. Sakai, K.,Sinha, A. A., Mitchell, D . J., Zamvil, S . S., Rothbard, J. B., McDevitt, H . O., and Steinman, L. (1988). Involvement of distinct murine T-cell receptors in the autoiinniune encephalitogenic response to nested epitopes ofmyelin basic protein. Proc. Natl. Acad. Sci. U.S.A. 85, 8608-8612. Sakai, K., Zamvil, S. S., Mitchell, D. J., Hodgkinson, S., Rothbard, J. B., and Steinman, L. (1989). Prevention of experimental encephaloinyelitis with peptides that block interaction of T cells with major histocompatibility complex proteins. Proc. Natl. Acad. Sci. U.S.A. 86, 9470-9474. Sarvetnick, N., Shizuru, J., Liggitt, D., Martin, L., McIntyre, B., Gregory, A., Parslow, T., and Stewart, T. (1990). Loss of pancreatic islet tolerance induced by @-cellexpression of interferon-y. Nature (London) 346, 844-847. Sasamoto, Y., Kawano, Y. I., Bouligny. R., Wiggert, B., Chader, G. J., and Gery, I. (1992). Immunonwdulation of experimental autoimmune uveoretinitis by intravenous injection of uveitogenic peptides. Incest. Ophthalrnol. Vis.Sci. 33,2641-2649. Schwartz, H.H. (1990). A cell culture model for T lymphocyte clonal anergy. Science 248, 1349-1356. Sempe, P., Bedossa, P., Richard. M. F., Villa, M. C., Bach, J. F., and Boitard, C. (1991). Anti-a/@T cell receptor monoclonal antibody provides an efficient therapy for autoimmune diabetes in nonobese diabetic (NOD) mice. Eur. J . Immunol. 21, 11631169. Seydel, K., Shizuru, J., Crossman, D., Wu, A,, Alters, S., and Fathinan, C. G. (1991). Anti-CD8 abrogates effect of anti-CD4-mediated islet allograft survival in rat model. Diabetes 40, 1430-1434. Sharma, S. D., Nag, B., Su, X., Green, D., Spack, E., Clark, B. R., and Sriram, S. (1991). Antigen-specific therapy of experimental allergic encephalomyelitis by soluble class 11 major histocompatibility complex-peptide complexes. Proc. Natl. Acad. Sci. U.S.A. 88, 11465-1 1469.
262
AMITABH GAUR AND C. GARRISON FATHMAN
Shenoy, M., Oshima, M., Atassi, M. Z., and Christadoss, P. (1993). Suppression of experimental autoimmune myasthenia gravis byepitope-specific neonatal tolerance to synthetic region a 146-162 of acetylcholine receptor. Clin. lmmunol. lmmunopathol. 66, 230-238. Shi, Y. F., Bissonnette, R. P., Parfrey, N., Szalay, M.,Kubo, R. T., and Green, D. R. (1991). In vivo administration of monoclonal antibodies to the CD3 T cell receptor complex induces cell death (apoptosis) in immature thymocytes. J . lmmunol. 146(lo), 3340-3346. Shizuru, J. A,, Gregory, A. K., Chao, C. T., and Fathman, C. G. (1987). Islet allograft survival after a single course of treatment of recipient with antibody to L3T4. Science 237,278-280. Shizuru, J. A., Taylor-Edwards, C., Banks, B. A., Gregory, A. K., and Fathman, C. G. (1988). Immunotherapy of the nonobese diabetic mouse: Treatment with an antibody to T-helper lymphocytes. Science 240, 659-662. Shizuru, J. A., Seydel, K. B., Flavin, T. F., Wu, A. P., Kong, C. C., Hoyt, E. G., Fujimoto, N., Billingham, M. E., Starnes, V. A,, and Fathman, C. G. (1990). Induction of donorspecific unresponsiveness to cardiac allografts in rats by pre transplant anti-CD4 monoclonal antibody therapy. Transplantation 50,366-373. Shizuru, J . A., Alters, S. E., and Fathman, C. G. (1992). Anti-CD4 monoclonal antibodies in therapy: Creation of nonclassical tolerance in the adult. Zmmunol. Reo. 129, 105-130. Sinha, A. A., Lopez, M. T., and McDevitt, H. 0. (1990). Autoimmune diseases: The failure of self tolerance. Science 248, 1380-1388. Smilek, D. E., Wraith, D. C., Hodgkinson, S., Dwivedy, S., Steinman, L., and McDevitt, H. 0.(1991).A single amino acid change in a myelin basic protein peptide confers the capacity to prevent rather than induce experimental autoimmune encephalomyelitis. Proc. Natl. Acad. Sci. U.S.A.88,9633-9637. Smith, C. A., Williams, G. T., Kingston, R., Jenkinson, E. J., and Owen, J. J. Antibodies to CD3/T-cell receptor complex induce death by apoptosis in immature T cells in thymic cultures. Nature (London) 337, 181-184. Smith, S. C., and Allen, P. M. (1991). Myosin-induced acute myocarditis is a T cell mediated disease. J . Zmmunol. 147,2141-2147. Sorger, S. B., Hedrick, S. M.,Fink, P. J., Bookman, M. A,, and Matis, L. A. (1987). Generation of diversity in T cell receptor repertoire specific for pigeon cytochrome c. J. Exp. Med. 165, 279-301. Sriram, S., and Steinman, L. (1983).Anti I-A antibody suppresses active encephalomyelitis: Treatment model for diseases linked to IR genes. /. Exp. Med. 158, 1362-1367. Staerz, U., and Bevan, M. (1985).In “Molecular Biology of the Immune System” ( J . Styreilein, F. Ahmad, S. Black, B. Blomberg, and R. Volellmy, eds.), pp. 61-64. Cambridge Univ. Press, Cambridge. Staerz, U. D., Rammensee, H. G., Benedetto, J. D., and Bevan, M. J. (1985).Characterization of a murine monoclonal antibody specific for anallotypic determinant on T cell antigen receptor. J. lmmunol. 134, 3994-4000. Stamenkovic, I., Stegagno, M., Wright, K. A., Krane, S. M., Amento, E. P., Colvin, R. B., Duquesnoy, R. J., and Kurnick, J. T. (1988).Clonal dominance amongT lymphocyte infiltrates in arthritis. Proc. Natl. Acad. Sci. U.S.A.85, 1179-1183. Steinman, L. (1991). The development ofrational strategies for selective immunotherapy against autoimmune demyelinating disease. Ado. lmmunol. 49, 357-379. Steinman, L. (1992). Multiple sclerosis and its animal models: The role of the MHC and the T cell repertoire. Springer Semin. Immunopathol. 14, 79-93. Steinman, L., Rosenbaum, J. T., Sriram, S., and McDevitt, H. 0. (1981). In vivo effects
THE TRIMOLECULAR COMPLEX
263
of antibodies to immune response gene products: Prevention of experimental allergic encephalitis. Proc. Natl. Acad. Sci. U.S.A. 78, 7111-7114. Steinmuller, D. (1985). Which T cells mediate allograft rejection? Transplantation 40, 229-233. Stull, S. J., Kyriakos, M., Sharp, G. C., Bickel, J. T., and Braley-Mullen, H. (1990). Effects of anti-I-A and anti-I-E monoclonal antibodies on the induction and expression of experimental autoimmune thyroiditis in mice. Autoimmunity 6, 23-36. Su, X. M., and Sriram, S. (1991). Treatment of chronic relapsing experimental allergic encephalomyelitis with the intravenous administration of splenocytes coupled to encephalitogenic peptide 91-103 of myelin basic protein. J. Neuroimmunol. 34, 181-190. Sun, D., Qin, Y .,Chluba, J., Epplen, J. T., Wekerle, H. (1988). Suppression ofexperimentally induced autoimmune encephalomyelitis by cytolytic T-T cell interactions. Nature (London)332,843-845. Tadakuma, T., Kizaki, H., Odaka, C., Kubota, R., Ishimura, Y., Yagita, H., and Okumura, K. (1990). CD4tCD8t thymocytes are susceptible to DNA fragmentation induced by phorbol ester, calcium ionophore, and anti-CD3 antibody. Eur. J. Zmmunol. 20, 779-784. Takahashi, S., Maecker, H. T., and Levy, R. (1989). DNA fragmentation and cell death mediated by T cell antigen receptor/CD3 complex on a leukemia T cell line. Eur. J . Immunol. 19,1911-1919. Tan, L. J., Kennedy, M. K., and Miller, S. D. (1992). Regulation of the effector stages of experimental autoimmune encephalomyelitis via neuroantigen-specific tolerance induction. 11. Fine specificity ofeffector T cell inhibiti0n.J. Immunol. 148,2748-2755. Taylor, W. A., and Hughes, R. A. (1988). Responsiveness to P2 of blood- and cauda equina-derived lymphocytes in experimental allergic neuritis in the Lewis rat: Preliminary characterisation of a P2-specific cauda equina-derived T cell line.]. Neuroimmunol. 19, 279-289. Teuscher, C., Hickey, W. F., and Korngold, R. (1990). Experimental allergic orchitis in mice. V. Resistance to actively induced disease in BALB/cJ substrain mice is mediated by CD4+ T cells. lmmunogenetics 32, 34-40. Texier, B., Bedin, C., Roubaty, C., Brezin, C., and Charreire, J. (1992). Protection from experimental autoimmune thyroiditis conferred by a monoclonal antibody to T cell receptor from a cytotoxic hybridoma specific for thyroglobulin. J. Zmmunol. 148, 439-444. Thistlethwaite, J. R., Jr., Cosimi, A. B., Delmonico, F. L., Rubin, R. H., Talkoff-Rubin, N., Nelson, P. W., Fang, L., andRussell, P. S. (1984). EvolvinguseofOKT3monoclonal antibody for treatment of renal allograft rejection. Transplantation 38,695-701. Todd, J. A., Bell, J. I., and McDevitt, H. 0. (1987). HLA-DQ @ gene contributes to susceptibility and resistance to insulin-dependent diabetes mellitus. Nature (London) 329,599-604. Todd, J . A,, Acha-Orbea, H., Bell, J. I., Chao, N., Fronek, Z . , Jacob, C. O., McDermott, M., Sinha, A. A., Timmerman, L., Steinman, L. (1988). A molecular basis for MHC class 11-associated autoimmunity. Science 240, 1003-1009. Transplantation Proceedings (1987). Therapeutic use of the monoclonal antibody Orthoclone OKT3. Transplantation Proc. 19(2 Suppl. l), 1-58. Tse, D. B., Cantor, C. R., McDowell, J., and Pernis, B. (1986). Recycling class I MHC antigens: Dynamics of internationalization, acidification, and ligand-degradation in murine T lymphoblasts. J. Mol. Cell. lmmunol. 2, 315-329. Urban, J. L., Kumar, V., Kono, D. H., Gomez, C., Horvath, S. J., Clayton, J., Ando, D. G., Sercarz, E. E., and Hood, L. (1988). Restricted use of T cell receptor V genes
264
AMITABH GAUR A N D C. GARRISON FATHMAN
in murine autoimmune encephalomyelitis raises possibilities for antibody therapy. Cell (Cambridge, Mass.) 54, 577-592. Vainiene, M., Gold, D. P., Celnik, B., Hashim, G. A,, Vandenbark, A. A., and Offner, H. (1992). Common sequence on distinct V p genes defines a protective idiotope in experimental encephalomyelitis. J . Neurosci. Res. 31, 413-420. Vandenbark, A. A., Hashim, G., and Offner, H. (1989). Immunization with a synthetic T-cell receptor V-region peptide protects against experimental autoimmune encephalomyelitis. Nature (London)341, 541-544. van Laar, J. M., Miltenburg, A. M., Verdonk, M. J., Daha, M. R., de Vries, R. R., and Breedveld, F. C. (1991). T cell vaccination in rheumatoid arthritis. Br. J . Rheumatol. 30(Suppl. 2), 28-29. Van Wauwe, J. P., De Mey, J. R., and Goossens, J. G. (1980). OKT3: A monoclonal antihuman T lymphocyte antibody with potent mitogenic properties. /. Zmmunol. 124, 2708-2713. Vigeral, P., Chkoff, N., Chatenoud, L., Campos, H., Lacombe, M., Droz, D., Goldstein, G., Bach, J. F., and Kreis, H. (1986). Prophylactic use of OKT3 monoclonal antibody in cadaver kidney recipients: Utilization of OKT3 as the sole immunosuppressive agent. Transplantation 41,730-733. Vladutiu, A. O., and Steinman, L. (1987).Inhibition ofexperimental autoimmune thyroiditis in mice by anti-I-A antibodies. Cell. Zmmunol. 109, 169-180. Waldmann, H. (1989). Manipulation of T-cell responses with monoclonal antibodies. Annu. Rev. lmmunol. 7,407-444. Waldor, M. K., Sriram, S., McDevitt, H. O., and Steinman, L. (1983). In vivo therapy with monoclonal anti-I-A antibody suppresses immune responses to acetylcholine receptor. Proc. N o t / . Acad. Sci. U.S.A. 80, 2713-2717. Waldor, M. K., Sriram, S., Hardy, R., Herzenberg, L. A., Herzenberg, L. A., Lanier, L., Lim, M., and Steinman, L. (1985). Reversal of experimental allergic encephalomyelitis with monoclonal antibody to a T-cell subset marker. Science 227,415-417. Waldor, M. K., Mitchell, D., Kipps, T. J., Herzenberg, L. A., and Steinman, L. (1987a). Importance of immunoglobulin isotype in therapy of experimental autoimmune encephalomyelitis with monoclonal anti-CD4 antibody. J . lmmunol. 139, 3660-3664. Waldor, M. K., O’Hearn, M., Sriram, S., and Steinman, L. (1987b).Treatment of experimental autoimmune myasthenia gravis with monoclonal antibodies to immune response gene products. Ann. N . Y . Acad. Sci. 505,655-668. Wauhen, M. H. M., Boog, C. J. P., van der Zee, Joosten, I., Schlief, A,, and van Eden, W. (1992). Disease inhibition by major histocompatibility complex binding peptide analogues of disease-associated epitopes: More than blocking alone. J . E x p . Med. 176, 667-677. Weiner, H. L., Mackin, G. A., Matsui, M., Orav, E. J., Khoury, S. J., Dawson, D. M., and Hafler, D. A. (1993). Double-blind pilot trial of oral tolerization with myelin antigens in multiple sclerosis. Science 259, 1321-1324. Wetzig, R., Hooks, J. J., Percopo, C. M., Nussenblatt, R., Chan, C. C., and Detrick, B. (1988). Anti-la antibody diminishes ocular inflammation in experimental autoimmune uveitis. Curr. Eye Res. 7, 809-818. Weyand, C. M . , Goronzy, J., Swarztrauber, K., and Fathman, C. G. (1989a). Immunosuppression by anti-CD4 treatinent in vivo: Cellular and humoral responses to alloantigens. Transplantation 47, 1039-1042. Weyand, C. M., Goronzy, J., Swarztrauber, K., and Fathman, C. G. (1989b). Immunosuppression by anti-CD4 treatment in vivo: Persistence of secondary antiviral immune responses. Transplantation 47, 1034-1038. Whitham, R. H., Kotzin, B. L., Buenafe, A. C., Weinberg, A. O., Jones, R. E., Hashim,
THE TRIMOLECULAR COMPLEX
265
G. A., Roy, C. M., Vandenbark, A. A., and Offiier, H . (1993). Treatment of relapsing experimental autoimmune encephalomyelitis with T cell receptor peptides. J. Neurosci. Res. 35, 115-128. Winoto, A., Urban, J . L., Lan, N. C., Coverman, J., Hood, L., and Hamburg, D. (1986). Predominant use of a V a gene segment in mouse T-cell receptors for cytochrome c. Nature (London)324, 679-682. Wofsy, D., and Seaman, W. E. (1985). Successfill treatment of autoimmunity in NZB/ NZW F1 mice with monoclonal antibody to L3T4. J . E x p . Med. 161, 378-391. Wofsy, D., Mayes, D. C., Woodcock, J . , and Seaman, W. E . (1985). Inhibition ofhumoral immunity in vivo by monoclonal antibody to L3T4: Studies with soluble antigens in intact mice. J . Irnrnunol. 135, 1698-1701. Wooley, P. H., Luthra, H . S., Lafuse, W. P., Huse, A,, Stuart, J. M., and David, C. S. (1985). Type I1 collagen-induced arthritis in mice. I l l . Suppression of arthritis by using monoclonal arid polyclonal anti-Ia antisera. J . Irnrnunol. 134, 2366-2374. Wordsworth, P., and Bell, J. I. (1992). The immunogenetics of rheumatoid arthritis. Springer Semin. Zmmutiopatho~.14, 59-78. Wraith, D. C., Smilek, D. E., Mitchell, D. J., Steinman, L., and McDevitt, H. 0.(1989). Antigen recognition in autoimmune encephalomyelitis and the potential for peptidemediated immunotherapy. Cell (Camhridge, Muss.) 59, 247-255. Wucherpfennig, K. W., Ota, K., Endo, N., Seidnian, J. C., Rosenzweig, A,, Weiner, H . L., and Hafler, D. A. (1990).Shared human Tcell receptor VPusage to immunodominant regions of myelin basic protein. Science 248, 1016-1019. Yoshino, S., Schlipkoter, E., Kinne, R., Hunig, T., and Emmrich, F. (1990).Suppression and prevention of adjuvant arthritis in rats by a monoclonal antibody to the a l p T cell receptor. Eur. J. Zmmunol. 20, 2805-2808. Yoshino, S., Cleland, L. G., and Mayrhofer, G. (1991a).Treatment of collagen-induced arthritis in rats with a monoclonal antibody against the nip T cell antigen receptor. Arthritis Rheum. 34, 1039-1047. Yoshino, S., Cleland, L. G., Mayrhofer, G., Brown, R. R., and Schwab, J . H. (1991b). Prevention of chronic erosive streptococcal cell wall-induced arthritis in rats by treatment with a monoclonal antibody against the T cell antigen receptor @. ]. Zmmunol. 146,4187-4189. Young, C. R., and Atassi, M. Z. (1983).T-lymphocyte recognition ofsperm-whale nivoglobin: Specificity ofT-cell recognition following neonatal tolerance with either myoglobin or synthetic peptides of an antigenic site. J . Initnunogenet. 10, 161-16Y. Zaller, D. M., Osman, G., Kanagawa, O., and Hood, L. (1990).Prevention and treatment of niurine experimental aIIergic encephalomyelitis with T cell receptor V @specific antibodies. J . E x p . Med. 171, 1943-1955. Zanivil, S. S., Mitchell. D. J., Lee, N. E., Moore, A. C.. Waldor, M. K., Sakai, K., Rothbard, J . B., McDevitt, H. O., Steinman, L., Acha-Orliea, H. (1988).Predominant expression of a T cell receptor V P gene subfdniily iri autoimmune encephalomyelitis. I . E x p . Med. 167, 1586-1596. Zhang, Z. Y., Lee, C. S., Lider, 0..and Weiner, II. L. (1990). Suppression of adjuvant arthritis in Lewis rats by oral administration of type I1 collagen. J. Immurrol. 145, 2489-2493. Zhang, Z.J., Davidson, L., Eisenbarth, G., and Weiner, H . L. (1991). Suppression of diabetes in nonobese diabetic mice by oral administration of' porcine insulin. Proc. N u t l . Acud. Sci. U.S.A.88, 10,252-10,256.
This article was accepted for publicahon on Y December 1993.
ADVANCES IN IMMUNOLOGY, VOL 56
Therapeutic Regulation of the Complement System in Acute Injury States FRANCIS D. MOORE, JR. Department of Surgery, Harvard Medical School, Brigham and Women's Hospital, Boston, Massachusetts 02 1 15
1. Introduction
Both the clinician and the investigator have found the role of the complement system in human disease to be enigmatic. The complement serum proteins have been isolated and characterized from complex mixtures of labile factors in the most laborious way by gifted protein chemists over a 30-year period ending in the mid-1980s. Since then, investigators using the tools of molecular biology have discovered the unexpectedly diverse repertoire of membrane proteins which interact with the serum components. Viewed as a whole, this is a remarkable body of work. But, it has resulted in scant notice due to confusing terminology and to a diversity of ascribed functions arising from in vitro experiments. Although study of inborn complement deficiency states has provided much insight to complement functions in man, the relevance of this system to medicine has been obscured by an inability to specifically inhibit complement activation or to separate complement from other proinflammatory systems. Interest in this field has been renewed with the demonstration of the effectiveness of a recombinant complement inhibitor protein in diverse animal models. In this review, I summarize these new findings within the context of the known interactions of the complement system. Viewed this way, complement emerges as a fundamental, integrated, and early-acting mechanism to invoke and amplify the inflammatory response to acute insults. Furthermore, the studies indicate that modern supportive medical care may no longer require the beneficial aspects of complement activation, with the result that host outcome may be improved by inhibition of the complement system. II. An Overview of Complement Activation
Detailed reviews of the biochemistry of the complement proteins have been published (1-3). In a schematic sense, complement is comprised of only two functional parts: one which includes the serum 267 Copyright Q 1994 by Academic Press, Inc All nghta of reproduction LIL anv form reserved.
268
FRANCIS D. MOORE, JR
proteins and produces a cascade-like sequential activation of proteins in response to specific stimuli and another which consists of cellsurface proteins and derives information from specific products of the complement activation. The pivotal step of complement activation produces a covalent bond between the C3b fragment o f C 3 and the activator, an event termed “complement fixation.” This then results in assembly of the membrane attack cytolytic protein complex and in generation of complement products which interact with leukocytes and other cells. Of the two ways in which C3b deposition can occur, the “classical” (or first described) pathway is the easiest to understand by analogy to the progressive proteolytic steps which lead from vascular injury to the formation of a blood clot. Activation of the classical pathway occurs after IgG or IgM antibody engages antigen through the binding sites of its Fab domains, as would be typically the case on a surface with many antigens exposed and to which the host had been immunized previously. An example of such a surface would be the surface of a bacteria or virus. “Natural” antibodies of the IgM class allow this pathway to be activated also by certain antigens to which the host has not previously been exposed. In a similar fashion, soluble antigen-antibody complexes can activate the classical pathway. As a result, there is specificity inherent in the activation of this pathway which arises from the exquisite specificity of antibodies. On interacting with antigen, a change in the Fc region of antigen-engaged antibody attracts C1 and thereby creates activated C1, attached to the antigen by the antibody bridge. Activated C1 then both attracts and cleaves C4, exposing a reactive thiolester site in its C4b fragment. While the thiol group will most frequently react futilely with water, complement activation proceeds on after the covalent attachment of C4b via its thiol site to the activating surface adjacent to the Ig-C1 complex. In the circumstance of an activating soluble antigen-antibody complex, the surface to which C4b binds is the antibody itself. C4a, a spasmogenic peptide or “anaphylatoxin,” is simultaneously liberated during C4 cleavage and can be detected clinically. The surface-bound C4b attracts C2, positioning C2 for cleavage by the nearby Ig-C1 complex, leading to production of the bimolecular enzyme C4b,C2a. The other portion of C2, C2b, is liberated into solution and is a by-product with kinin activity (C2a and C2b is an example of confusing terminology). Its measurement has not been used to assess activation clinically. C4,C2a then cleaves C3, the most important of the complement proteins. Like C4 (and C5), C 3 also has an internal thiolester site and, when activated, as C3b, binds covalently to the activating surface
COMPLEMENT INMIHITION
269
adjacent to the C4b, C2a complex. In that location, C3b attracts C5, which is then cleaved by the C4b,C2a and in turn bonded nearby to the surface as C5b. Both C 3 and C5 cleavage liberate anaphylatoxin moieties, C3a and C5a, for which assays are available. Activation of the alternative pathway also results in C3 and C5 cleavage. The mechanism of activation of this system is unique. A small amount of reactive C 3 is produced continuously in serum by spontaneous hydrolysis. Each hydrolyzed C3, i n combination with the other alternative pathway proteins (Factors B, D, and properdin), briefly acquires C3-cleaving activity (4),as C 3 can substitute (much less efficiently) for the C3b subunit of the alternative pathway enzyme which cleaves C3. This phenomenon results in the continuous generation of small quantities of reactive C3b. Most such C3b moieties react with water with no proven biologic effect (such fluid-phase C3b’s could theoretically have a counterinflammatory effect), but a few bind to surrounding surfaces. Once bound to a surface, these C3b’s become the scaffold for assembly of alternative pathway activation enzyme complexes. Whether activation proceeds entirely depends on surfacespecific equilibrium conditions for binding of Factor B or Factor H (5)to the C3b deposited on the surface. Binding of B creates activation by producing the C3-cleaving enzyme, C3b,Bb, in concert with Factor D and properdin. Further C3 cleavage and amplified deposition of C3b ensue. In contrast, binding of H prevents activation due to H’s property as a cofactor in the degradation of C3b by Factor I (also called C3b, C4b inactivator protein). The binding of H to a surface-bound C3b produces a form of C3b which cannot participate in further alternative pathway activation. B and H are present in equimolar quantities in serum and extracellular fluid and have similar association constants for C3b. Whether B or H binds to a C3b is known to be a function of charge or glycosylation in the microenvironment surrounding the surface-bound C3b. Surfaces lacking sialic acid residues (6) or heparan polysaccharides (7) favor binding of B and thus are strong alternative pathway activators. Bacterial surfaces are lacking in sialic acid residues, while mammalian cell walls are rich. Thus, this activation mechanism forms the basis by which the alternative pathway distinguishes invader from host. Once C5b has been produced and bound to an activator surface by either pathway, a cascade of enzymatic steps resulting in membrane insertion of the membrane attack complex C5b-C9, “MAC,” occurs. The MAC opens a physical hole through the target membrane causing potential hypotonic lysis of the target. Although this is clearly demonstrated to cause lysis of erythrocytes in in vitru complement assays
270
FRANCIS D. MOORE, JR.
and in some hemolytic anemias, the degree to which cytolysis contributes to cell death with nucleated cells is unclear. Cytolysis may be important in the host defense against certain encapsulated organisms, as deficiencies of the terminal complement components are associated with an increased incidence of infections with Neisserial bacteria species (8).The noncytolytic, membrane-perturbing effects of MAC insertion may be more clinically relevant. For instance, insertion of a MAC into an endothelial cell causes endothelial activation, possibly leading to irreversible cell injury not by lysis but by attraction of activated neutrophils (9).The MAC expresses a neoantigen on assembly. Thus, detection of the MAC neoantigen either in serum or on tissue is an indication of complement activation. Given the mechanisms and stimuli for complement activation, it is not surprising that the clinical sites of complement activation should coincide with sites of inflammation, e.g., sites of acute trauma and microbial invasion. Known possible activators at such sites would include, for the alternative pathway, microbes, denatured DNA and proteins released from cell death, and injured tissue with impaired protection against autologous complement fixation (see below), and for the classical pathway, primarily microbes with antibody affixed and local antigen-antibody complexes. 111. Clinical Assessment of Complement Activation
As small peptides produced by a triggered activation system, one would expect that the anaphylatoxins would not be detectable in healthy patients, with levels rising only during classical pathway activation. In fact, C4a, C3a, and C5a are not detectable in vivo as their C terminal arginines are cleaved off by a serum carboxypeptidase activity, generating the circulating, less-active catabolites, designated as C4a desArg, C3a desArg, and C5a desArg. The desArg peptides are the targets of detection in clinical immunoassays. In the case of C4a desArg, those clinical conditions which affect clearance are not described, and the normal concentration in plasma is surprisingly high at 400 nglml(l0). Similarly, C3a desArg has a surprisingly high plasma concentration in normal volunteers with mean levels of 100 ng/ml (11). In contrast, C5a is so avidly ligated to leukocyte cell-surface receptors that levels of C5a desArg are not detectable in systems containing leukocytes, even with massive complement activation. Concentrations are generally reported to be less than 10 ng/ml, the lowest concentration detectable in the most widely used commercial immunoassay.
COMPLEMENT INHIBITION
27 1
Information as to whether complement activation has occurred and to what degree cannot be gleaned solely through analysis of serum concentrations of C 3 and other intact complement proteins. C 3 is a relatively abundant serum protein (1-2 mg/ml). It is synthesized both by hepatocytes for plasma levels and by macrophages in the periphery at sites of inflammation. Those factors which determine the rate of synthesis and degradation of C 3 are not characterized well enough to predict C 3 levels in a given medical condition. C 3 is also an acutephase reactant, causing concentrations to rise, despite consumption by complement activation. On the other hand, in a state of poor nutrition, concentrations might fall without any complement activation to consume C3. As a plasma protein, C 3 concentrations also are dependent on degrees of hemodilution in the ill patients in whom C 3 might be measured but in whom hemodilution is rarely considered. Finally, complement activation reactions that consume over 5-10% of available serum C 3 would be truly massive. Assessments of the functional capability of the complement lytic system using the CH50 have been employed as a repetitive measure with which to monitor the activity of a chronic systemic inflammatory disorder, such as systemic lupus erythematosis. However, the CH50 is a highly contrived assay designed to measure differences in red cell hemolysis at limiting dilutions of complement proteins (typically several hundred-fold). Whether undiluted serum can ever acquire a complement lytic functional deficiency is doubtful (12). Thus, the mainstay of assessments of complement activation is the measurement of complement activationderived cleavage products such as C3a desArg. However, assuming that complement activation has occurred simultaneous with measured elevations of C3a desArg could be misleading as the factors which influence the rate of C3a desArg degradation are not characterized. Isolated elevations of C3a desArg concentrations are thought to indicate alternative pathway activation. Elevations of both C3a desArg and C4a desArg indicate that classical pathway activation is occurring but is unable to distinguish whether there is simultaneous alternative pathway activation. In most acute injury settings, complement activation has been alternative pathway mediated. IV. Intrinsic Regulation of Complement Activation
The spontaneous and rapid decay of the bimolecular enzymes of each pathway which cleave C3 and C 5 serves as the primary feature which prevents a complement activation event from amplifying uncontrollably. Furthermore, several highly specific complement regluatory
272
FRANCIS D. MOORE, JR.
proteins exist which each inhibit portions ofthe complement activation cascades. In addition to limiting amplified complement activation, there seem to be three more functions served by these “control” proteins. One is to prevent continuous complement activation in plasma due to imperfect specificity. One is to protect cells against autologous complement attack arising from imperfect specificity. The final function is to allow leukocytes to function in a complement activation site without becoming damaged and for them simultaneously to derive information from the surrounding milieu. C 1 esterase inhibitor (Cl-INH) inactivates the catalytic subunits of C1, C l r , and C l s and is the only known protein to have this function. Both subunits of C 1 are serine proteinases, and, not surprisingly, C1INH is a member of a larger class of related proteins, such as a1 antitrypsin, whose function is to inhibit serine proteinases. C1-INH also can inhibit kallekrein and Hageman factor and has activity of unknown importance against Factor XIIa (13).It is produced by hepatocytes, monocytes, and tissue macrophages, putting its site of synthesis at sites of inflammation (14). The inborn deficiency of this control protein serves as an example of uncontrolled complement activation in man. This gives rise to angioneurotic edema, a disease characterized by sudden systemic complement activations via the classical pathway (15).These attacks are triggered by minor environmental events, such as slight traumas. That classical pathway activation is occurring without antibody, in the absence of this inhibitor, is suggested by the low systemic levels of C2 and C4 which these patients manifest between attacks. The mechanism of the paroxysms of classical pathway activation is unknown as is an explanation for the lack of pulmonary edema. In this sense, C1-INH preserves the specificity of the classical pathway by ensuring that activation occurs only with engagement of antigen by antibody. This implies that C1 can spontaneously activate without antibody or that classical pathway activation does not absolutely depend on the antigen-antibody interaction. Factor I (C3b, C4b inhibitor) produces complement inhibition by enzymatically degrading C3b and C4b, those forms of C3 and C4 which participate in generation of further complement activation, to inactive forms. Factor I requires a cofactor in this degradation reaction: Factor H, membrane cofactor protein, CPbinding protein, or CR1, to bind to the C3b and C4b. Genetic deficiency of Factor I produces clinical susceptibility to bacterial infection, as the natural rate of spontaneous C3b generation (which forms the basis of alternative pathway activation, see above) is much accelerated in the absence of Factor I, leading to secondary critical depletion of C3 (16) and Factor B. Thus, this
COMPLEMENT INHIBITION
273
control protein, in analogy to C1-INH, also ensures that the proper specificity for complement activation is maintained, in this case for the alternative pathway, and that futile fluid-phase turnover is avoided. Additional circulating proteins which downregulate complement are Factor H and C4-binding protein. Both serve to displace ligands from their targets of inhibition, Bb from C3b in the case of H and C2a from C4b in the case of C4-binding protein. C3b and C4b then acquire susceptibility to Factor I and are degraded. Properdin could be considered to be an upregulator of complement activation, as it retards the spontaneous decay of the C3b,Bb bimolecular C 3 convertase of the alternative pathway. A unique feature of complement activation is that the activationdependent cleavage of C4, C3, and C 5 generates their respective “b” fragments with a highly reactive thiolester group. What molecules or surfaces fix these fragments is primarily determined by spatial availability. As discussed above, the covalent bonding (other than to water) generally occurs on the activating surface, as a membrane-bound Ig-C1 complex lays down C4 and C 3 around itself to generate C5 cleavage by the classical pathway and as membrane-bound C3b serves as the scaffold for alternative pathway-dependent C 3 and C5 cleavage. However, activated but unreacted C3b, C4b, and C5b fragments are available in solution very briefly and thus can also bond to a nearby surface which was not the initial activator. This can give rise to assembly of C3-cleaving enzymes and MACs on the membranes of cells which are not directly involved in the complement activation, are not themselves complement activators, and are therefore to be damaged as innocent bystanders. As mentioned above, the spontaneous decay ofthe C3b, Bb and C4b, C2a complexes combined with the preferential interaction of C3b with Factor H (and then Factor I) on nonactivating surfaces should prevent bystander injury to homologous tissue. However, this must be imperfect as a second class of complement control proteins exists to protect host cells from nearby complement activation reactions. These are, therefore, membrane proteins. Decay-accelerating factor (DAF, CD55) (17) is expressed on the surface of essentially all cell types and accelerates the proteolytic activity of Factor I on membrane-bound C4b and C3b. It has homology to the circulating proteins of similar function, C4bp and Factor H, and prevents a membrane-bound C3b from becoming a nidus of assembly of a C3-cleaving enzyme. DAF is attached to the membrane via a phosphatidylinositol anchor and can be released by a specific phospholipase C (18).Incorporation of DAF into sheep red cell membranes prevents lysis by antibody and human complement by preventing
274
FRANCIS D. MOORE, JR.
interaction of C4b with C2 and C3b with B (19). Antibody to native DAF increases susceptibility to classical pathway-mediated complement attack (20). The disease, paroxysmal nocturnal hemoglobinuria, is complement mediated and is associated with absent erythrocyte membrane DAF (as well as other PI-anchored proteins). Membrane cofactor protein (CD46) (21)has cofactor activity for Factor I-mediated degradation of C3b. Why it is required in addition to DAF is puzzling, yet it is expressed by fibroblasts, epithelium, and endothelium (22). Transfection experiments into CHO cells (23) as well as experiments with antibody directed against native MCP (20) suggest that MCP preferentially protects against alternative pathway attack, with DAF filling the same role for the classical pathway. The leukocyte and erythrocyte cell-surface C3b receptor (CR1 or complement receptor type 1 or CD35) (24) overlaps with these two proteins in its ability to capture and degrade C3b and C4b, although it functions similarly to Factor 1, rather than as a cofactor for circulating Factor 1 (25). CR1 has major additional important functions, as discussed below. Cell-surface proteins also exist which interfere with the assembly of a MAC (homologous restriction factor, protectin, CD59, C8-binding protein) (26). CD59 is expressed by endothelium (27), erythrocytes, leukocytes, and epithelium (28).Transfection of CD59 into CHO cells prevents pore formation by the MAC (29), while antibody directed against native CD59 increases lytic susceptibility (20).CD59 has been found to be shed from cardiac myocytes in areas of ischemia, suggesting a mechanism of complement damage in ischemic tissue (30). It is safe to assume that the full roster of proteins which protect the host from its own complement activation events has yet to be described. V. Interactions between Leukocytes and Complement
Leukocytes have specific high-affinity cell-surface receptors for the activator-bound and soluble fragments of C3, C4, and C5 which are produced by complement activation. The complement ligand-leukocyte receptor interactions cause an influx of cells to the site of activation (inflammation) with an increased cellular functionality. Such a mechanism leads to “opsonization” of complement activators with the result that activated leukocytes perform their functions with respect to the opsonized material. Receptors for C3a, C4a, C5a, Clq, Factor H, C3b, and its degradation products, and C4b have been described. Engagement of a specific complement fragment with its corresponding receptor has a specific effect, depending on which fragment and on which
COMPLEMENT INHIBITION
275
type of cell is expressing the receptor. The receptors of acute inflammation, C5aR, CR1, CR3, and CR2, are discussed below. C5aR is a 40-50 M , membrane protein of granulocytes and marcophages and has nanomolar affinity for C5a (31).When exposed to C5a dispersing from a site of complement activation, granulocytes migrate toward the C5a source (chemotaxis) and simultaneously become more activated, exposing, among other functions, more opsonic receptors, such as the C3b-C4b receptor (CR1) and the iC3b receptors (CR3), on their cell surfaces (32, 33). When the C5aR becomes saturated with C5a, the cell loses its capacity to respond to a subsequent C5a exposure (34, 35), due to internalization of engaged receptors without replacement. Thus, granulocytes exposed to a C5a solution (rather than a gradient) lose their responsiveness to a C5a gradient (1l ) , a phenomenon termed “desensitization.” More clinically, neutrophils from a patient with an injury large enough to produce concentrations of C5a which saturate local neutrophil C5aR and which then penetrate the vascular compartment may lose their capacity to migrate to the point of injury (36). Because C5a causes both neutrophil and endothelial activation, such an injury may produce pulmonary leukocyte extravasation and ARDS (see below). Whether C5a and C5a desArg have identical mediator functions has yet to resolved completely. This interaction of C5a with granulocytes is the most apparent effect of complement activation in vivo and has the presumably beneficial effect of concentrating immuno- and phagocytosis-competent cells at the site of injury and complement activation. C5a has other proinflammatory iinmunoregulatory properties with respect to lymphocytes. CR1 is one of the opsonic receptors for granulocytes (37), as well as a potent inhibitor of complement activation (25). Multiple allotypes exist with an approximate size of 200,000 M , (38). The natural ligands for CR1 are C3b (39) and C4b, which have covalently interacted through the thiolester site (40,41),for which it has nanomolar affinity. CR1 is also expressed by human erythrocytes, eosinophils, macrophages, and some lymphocytes. Since the specificity of C R l is for only one form of C3b and C4b, CR1 interacts only with C 3 and C4 which have been produced by complement activation, are present on the activator itself, and have not been subject to degradation by Factor I. While granulocytes express a limited number of CR1 molecules on their cell surfaces, a large intracellular pool is presynthesized and available. This pool rapidly translocates to the cell surface after exposure of cells to activators, such as C5a (32), FMLP (32), endotoxin (lo), T N F (42, 43), GM-CSF (44), and PDGF (45), causing peak numbers of about 75,000 CR1 per cell surface. CR1 in this functional state
276
FRANCIS D. MOORE, JR
adheres C3b-coated activators to the leukocyte surface (46). As each activator surface will have many C3b’s on it arrayed around the initial C3b’s deposited and, therefore, multiple sites of CR1 engagement, CRl molecules become effectively immobolized on the granulocyte cell surface after ligating C3b. Increased diglyceride production, indicative of increased cellular function, results from this CR1 cross-linking (37).If antibody is also present on the activator, enhanced phagocytosis (compared to antibody alone) takes place (47). After exposure to phorbol esters, a change in the function of CR1 (48) occurs, leading to CRl-directed phagocytosis in the absence of antibody. This event is associated with phosphorylation of the very small intracellular domain of CR1 (49). Thus, granulocyte CR1 participates in phagocytosis and, by its activity as a cofactor for the degradation of C3b on its own surface, protects granulocytes from being damaged by the intensity of the complement activation. CR1 is being used clinically. Since cell-surface CR1 number is readily measured using indirect immunofluorescence, granulocyte cell-surface CR1 number has been used to monitor the extent of systemic neutrophil and monocyte activation. Second, CR1 is detectable in serum as an alternately transcribed, soluble molecule in ng/ml concentrations (50)with a possible physiologic function as a naturally occurring complement inhibitor. Based on this, recombinant technology has been used to produce soluble human CR1 as a complementinhibiting drug. This has entered Phase 1human trials and is discussed in detail below. CR3 (CD18, C D l l b ) shares many ofthe properties ofCR1; however, its complement ligand is iC3b, the degraded form of C3b which follows interaction with Factor I and cofactor proteins (Factor H, MCP, DAF, CR1). CR3 is expressed by the same cells that express CR1 and has a constitutive level of cell-surface expression with the capacity to be quickly translocated to the cell surface by the same activators that affect CR1 (10, 33, 44, 45, 51). CR3 is independent of CR1 as it is a member of the P2-integrin family with a two-chain structure which bears little relationship to CRI (52).Cations are required for binding to iC3b (53) and a binding site for ICAM-1 is also present on the molecule (54). CR3 functions to promote the attachment of granulocytes to endothelium at the site inflammation (5) with extravasation of granulocytes and engulfment of iC3b-opsonized compelment activators (56). The lung injury caused by systemic complement activation and pulmonary leukosequestration appears to be CR3-dependent. Such injury can be experimentally prevented by white cell depletion (57), complement depletion (58), complement inhibition (59),
COMPLEMENT INItIRITION
277
anti-CD-18 antibodies (60),anti-CDllb and l l a antibodies (61), and anti-ICAM-1 antibodies (61). Since a similar spectrum of inhibitors prevents the inflammatory response to a Iocal injury, it would appear that complement activation triggers a simple integrated response. Complement responds to local injury or microbial invasion by activation, simultaneously generating C5a and opsonizing the foreign material with C3b. Elaborated C5a both activates local endothelium and causes passing granulocytes to adhere and then extravasate at the site. This reaction requires iC3b on the endothelium (62) (possibly an innocent bystander mechanism, see below) and the C5a-induced expression of CR3 on granulocytes and ICAM-1 on endothelium. Granulocytes migrate through the interstitium to the site of C5a generation and engulf the complement activator, using the C 3 fragments bound to the activator for targeting through CR1 and CR3. Other proinflammatory mediators certainly function in this environment, but evidence derived from the capacity of complement inhibition to interfere with and define these events (presented below) suggests that complement may be an effective point of clinical control. CR2 (CD22) forms the link between the phagocytic response to acute injury and the lymphocyte response to produce antibody and future immunity. This cell-surface protein of B lymphocytes (63) ligates to the activator-bound degradation fragments of C3b, iC3b, and C3dg. Experimental immunogens do not generate an IgG response either after depletion o f C3 or in the presence of soluble CR2 used to compete with native lymphocyte CR2 (64).The structures of CR2 and CR1 are so similar that they are generated from alternative transcripts of the same gene in the mouse (65). VI. Complement Deficiency States
Complement deficiency states are distinctly uncommon and result in unique clinical syndromes (reviewed, 66). As stated above, acquisition of a complement deficiency state through consumption is unlikely to occur. Production of a deficient functional status by the use of specific complement inhibitor is discussed below. Deficiency of C 3 produces a predisposition to bacterial infection which can be lethal (67). Such patients also display a deficient repertoire of antibodies, possibly due to a lack of CR2-mediated lymphocyte events in the absence of C3b-mediated opsonization of new antigen. C 3 deficiency occurs in several different ways: a genetic lack of C 3 production, a secondary loss due to accelerated fluid-phase cleavage from an inborn deficiency of Factor I (16)or Factor H (68),or acquisition of an autoanti-
278
FRANCIS D. MOORE, J R .
body which causes C3 activation (69). Excess bacterial infections are seen in patients with granulocyte deficiencies of CR3 (70) and other adhesion molecules or with deficiencies of properdin (71). Immune complex diseases result from deficiencies of erythrocyte CR1 expression (72) or of classical pathway proteins (64), as (in primates) the classical pathway produces immune complex clearance. VII. Clinical Injury and Acute Complement Activation (Failures of Intrinsic Regulation?)
Apparently excessive complement activation has been demonstrated in a number of clinical circumstances, each of which has elucidated a special aspect of the system.
A. HEMODIALYSIS AND ARDS The observation that simultaneous neutropenia, neutrophil aggregation, pulmonary leukosequestration, and hypoxemia occurred during hemodialysis (74, 75)led to the hypothesis that systemic complement activation causes remote pulmonary dysfunction. The initial description predated the availability of assays for C3a desArg and could not prove that there was clinical complement activation. The hypothesis was based on the similar capacities of plasma presumed to contain C5a (activated by zymosan in the absence of leukocytes) and plasma exposed to cellophane to produce neutrophil aggregation (70). The hypothesis generated from this work, e.g., that hemoperfusion through dialysis membranes caused complement activation, resulting in neutrophi1 activation and a form of ARDS, was used as the general etiology of secondary pulmonary injuries. By this theory, since widely adopted, any source of systemic complement activation is capable of causing ARDS, through a mechanism involving activated leukocytes (77, 78). Dialysis, complement activation, and neutrophil activation were reinvestigated with the benefit of C3a desArg levels and flow cytometry of neutrophils in 1984 (79). During hemodialysis in renal failure patients, increased plasma C3a desArg concentrations, indicative of complement activation, were shown to coincide temporally with the onset of neutropenia and neutrophil activation in the systemic blood, as indicated by increased expression of neutorphil cell-surface CR1. The latter was assessed using an immunofluorescent measurement of the binding of anti-CR1 to intact neutrophils. Furthermore, the degree of complement activation, of neutrophil activation, and of neutropenia each covaried with the number of times that a membrane had been used to dialyze a particular patient, all progressively decreasing with
COMPLEMENT INHIBITION
279
the number of uses. Finally, C3a desArg concentrations in the dialyzer efflux exceeded that in the influx, indicating that the dialyzer itself was causing activation. Increased neutrophil expression of the proadhesive CR3 during hemodialysis has been reported, providing an explanation for neutrophil aggregation (80).Whether systemic complement activation is the primary general mechanism precipitating ARDS awaits the results of clinical studies using complement inhibitors (see below). B. CARDIOPULMONARY BYPASS Given that there is an obvious similarity between dialysis membranes and the pump oxygenators used in open-heart surgery, the frequency of pulmonary dysfunction after open-heart surgery provoked an examination of complement activation in this clinical setting. In the initial study, concentrations of C3a desArg increased at the beginning of perfusion with the bypass curcuit, and pulmonary neutrophil trapping was found (81).C5a desArg was not measureable in patients’ blood, as would be expected in a system which contains neutrophils. This study of 15 patients was too limited to correlate complement activation and pulmonary dysfunction. Another study of cardiopulmonary bypass provided insight into the complexity of attributing injury to complement activation in the clinical setting (82). Fifty patients were randomized to bubble oxygenators and 50 comparable patients were randomized to membrane oxygenators on the assumption that the biocompatibility of the oxygenator was the central issue. But, identical rises in plasma C3a desArg were noted in each group, coincident with the onset of bypass. Therefore, the main clinical determinant of complement activation was not the type of perfusion equipment. In a more detailed analysis of five patients, complement activation was found to coincide with neutrophil activation and both activations were highly temperature-dependent, with no activation occurring at the customary hypothermic body temperatures used during open-heart surgery. Because of the dominant effect of temperature, for the group of 100 patients, the level of C3a desArg elevation postoperatively correlated with the length of rewarmed time with the bypass circuit running during the latter stages of the surgery. T h e patients with postoperative respiratory failure had C3a desArg concentrations immediately after surgery which were twice the mean for the patients without respiratory complication. Thus, a complex interplay of empiric conditions, e. g., rapidity of cooling and warming, was responsible for the degree of complement activation, neutrophil activation, and occasional pulmonary dysfunction during and after cardiopulmonary bypass. Cardiopulmonary bypass may produce enough complement
280
FRANCIS D. MOORE, JR
activation to provoke innocent bystander complement attack on host blood elements (83). Future cardiopulmonary bypass investigation must carefully control for temperature-dependent effects. C. THERMAL INJURY Burn injury was felt to cause complement activation as early as 1963 (84). Subsequently, but before C3a desArg assays were available, serum levels of C 3 and other complement components were reported to be reduced early in burn injury (85, 86) and were interpreted as evidence of complement consumption. Further studies documented decrements in alternative pathway function following burns, having observed either reduced plasma C 3 conversion in the presence of alternative pathway activators in vitro (87) or loss of patient’s serum capacity to lyse rabbit erythrocytes in vitro in a buffer system which confined hemolysis to the alternative pathway (88). The complement activation accompanying thermal injury may further injure the host. One mechanism of injury is unnecessary amplification of the inflammatory response at the burn wound. The presence of this deleterious effect is suggested by the observation that early mortality in mice receiving a burn of reproducible size was reduced from 65 to 10% by the prior crippling of complement function produced by depleting animals of C 3 with cobra venom factor treatments (89). Further study demonstrated that the degree of burn wound edema can be attenuated by prior decomplementation or by inhibition of complement activation (57). Complement activation also harms the host in general by causing defective neutrophil chemotaxis. In a study of eight burned patients (go), systemic complement activation was documented using the C3a desArg assay. Patients’ neutrophils exhibited decreased in vitro chemotaxis to C5a and to the synthetic bacterial cell wall analog, f-met-leu-phe. Equilibrium binding of radiolabeled C5a to patient’s neutrophils changed, with loss of C5aR (but with no loss of f-met-leu-phe receptors). The data were interpreted as showing that burn patient’s neutrophils had been exposed to systemic levels of C5a and had lost their capacity subsequently to migrate up to a gradient of increasing C5a concentration to the source of complement activation. This served as one explanation as to why burned patients have a propensity for non-burn site infections. This was further examined in a study of seven burned patients (11)where the clinical course of complement activation, neutrophil chemotaxis, and neutrophil activation was tracked. Neutrophil activation was pronounced and correlated highly with depressed chemotaxis to C5a in vitro. These alterations coincided with complement activation, leading to the conclusion that thermal injury had caused complement activation with
COMPLEMENT INHIBITION
28 1
generation of C5a and secondary, C5a-mediated systemic neutrophil activation. Small burns from this study demonstrated the same degree of neutrophil activation as large burns, suggesting that the complement reponse becomes unphysiologic with even minor degrees of injury. Finally, peak elevations of C3a desArg did not precisely coincide with peak activation of neutrophils. This was suggested later to be an effect of early endotoxemia (10, 91). The mechanism by which burned tissue activates complement has been investigated, with varying results. Heat-precipitated serum proteins caused complement activation in serum (92),as did other types of homogenized injured tissue. However, in the rat, selective perfusion of a burned area with xanthine oxidase inhibitors or hydroxyl radical scavengers was able to reduce the amount of C5a generated at the burn site (93). Since this could be explained as a treatment effect which prevented progression of the inflammatory response by inhibiting inmigrating neutrophils (rather than by treatment effects directly on complement activation), this experiment was repeated in neutrophildepleted animals with the same results. In similar experiments, burn wound edema was attenuated using inhibitors of histamine, raising the possibility that resident granulocytes, such as mast cells (94), might amplify the inflammatory response. Thus, the isolated perfusion experiments cannot be used as conclusive proof that complement activation is caused by oxygen free radicals directly. A rise in C4a desArg concentrations has also been noted after burns (lo), occurring later and at a time of increased IgG concentrations. This was interpreted to be a response to colonization of the wound by bacteria. Burned patients, in the absence of direct heat or volatile chemical injury to the tracheobronchial tree, frequently exhibit transient hypoxemia. As the burn wound produces complement activation, systemic neutrophil activation and pulmonary leukosequestration could follow in the sequence of events. The complement phenomenon observed after burn injury as been viewed as a paradigm that applies to severe trauma, in general (95). Thus, burn injury seems to produce complement activation which is harmful as it may cause the inflammatory response to amplify the size and depth of the burn and as it may cause an important defect in neutrophil function. The reason for complement activation remains obscure. There is no certainty that inhibition of complement will benefit these patients.
D. SEPSISAND SEPTICSHOCK Septic shock causes alternative pathway complement component alterations which suggest complement activation. Studies before the availability of the C3a desArg assay documented normal levels of
282
FRANCIS D. MOORE, JR.
complement components in bacteremic patients, but reduced levels of alternative pathway proteins (Factor B, C3) and terminal complement components in patients with septic shock (96).Lowered complement levels impaired survival in complement-depleted guinea pigs given intraperitoneal Escherichia coli inoculations with strains previously demonstrated to require alternative pathway activation for opsonization (97). The advent of the C3a desArg assay has allowed verification of these preliminary investigations. In 48 critically ill patients, complement activation with increased concentrations of C3a desArg was found in those patients in septic shock (98).Another study with 27 septic patients was confirmatory and also showed that patients whose C3a desArg concentrations failed to return to normal went on to multiple system organ failure (99). It has been difficult to discern whether complement activation is a beneficial response to a major inflammatory event or whether it promotes septic shock. The antibacterial properties of complement suggest that complement activation would be advantageous during septic states. However, recent evidence favors the other interpretation. In rodents, endotoxin infusion resulted in increased concentrations of C3a desArg (100). The cardiovascular effects of endotoxin in these experiments were mimicked by infusions of C5a, and the cardiovascular effects of endotoxin infusion were improved by anti-C5a antibody. Experiments in monkeys had similar results (101).Septic shock in the absence of endotoxin, using gram-positive bacteria, has been shown to cause systemic complement activation in rabbits (102).As the capacity of complement activation to produce neutrophil activation would indicate that neutrophil activation could play a role in these events, one might expect that agents which blocked CR1 and CR3 might also reduce the impact of sepsis. The apparent benefit of administering anti-CR3 in a mouse endotoxin model (103)and in a dog TNF infusion model (104) confirms this suspicion. One could expect that inhibition of complement with therapeutic intent might be applied to the clinical situations discussed above. VIII. Therapeutic Complement Inhibition Using sCRl
A. ISCHEMIA AND REPERFUSION The injury to muscle caused by arterial occlusion followed by reperfusion has similarities to the inflammatory reactions discussed above, as the degree of injury is both neutrophil- and complement-dependent (105, 106). Myocardial infarction has been extensively studied (107, 108).As distinct from the problems of systemic complement and neutro-
COMPLEMENT INHIBITION
283
phi1 activation discussed above but similar to burned tissue, the amplification of the ischemic injury occurring on reperfusion seems to be an example of a local inflammatory response which is harmful. The discovery that there was a soluble form of CR1 (50) in blood and that it was a regulator of fluid-phase complement activation led to the development of a recombinant form of human soluble CR1 (“sCR1”). The initial description (109) presented several salient features. First, sCRl bound to both C3b and C4b, the anticipated ligands. Second, sCRl was a more potent inhibitor of the alternative and classical pathways than the other two known fluid-phase inhibitors, Factor H and C P b p . Third, sCRl (human) was shown to be active in other species, such as rats, mice, guinea pigs, and rabbits, making sCRl an excellent experimental reagent. Finally, a substantial reduction in the size of a myocardial infarct in a model of rat coronary artery occlusion and reperfusion occurred as a result of a low dose of sCRl (now known to be suboptimal), given just before reperfusion. A decrease in endothelial and myocyte immunohistochemical staining for the presence of C5b-9 neoantigen was associated with this reduction in infarct size. Thus, the availability of sCR1, as a highly specific and physiologic complement inhibitor, has allowed investigation of which clinical circumstances might be complement-dependent and of interest for therapeutic complement inhibition. sCRl was used to attenuate the reperfusion injury to ischemic smooth muscle and mucosa of the gut (1lo), in rats subjected to 1 hr of mesenteric arterial occlusion and 3 hr of reperfusion. sCRl given iv 15 min prior to reperfusion resulted in a gross change of bowel appearance after 3 hr, from purple-black in untreated animals to normal in treated animals. The same effect was found with a larger dose of sCRl given at reperfusion. Quantitative measures, such as intestinal mucosal histologic injury score, intestinal accumulation of neutrophil enzymes, and blood levels of Factor VIII-related antigen, were improved. The hemolytic activity of serum complement was reduced, consistent with effective complement inhibition. sCRl also attenuated the secondary lung injury present in untreated animals (see below). Five-day mortality was reduced from 80 to 45%. This allowed several conclusions to be drawn: (i) this therapeutic effect of sCRl in muscle ischemia and reperfusion applied more generally than just to myocardium, (ii) sCRl had therapeutic effects that were achieved without pretreatment (unlike other experimental agents in ischemia and reperfusion) and could be used in a real clinical circumstance, such as an arterial embolus to the mesenteric circulation, and (iii) the apparent ischemic injury was strikingly reversible. The data showed that the
284
FRANCIS D. MOORE, JR.
major injury was caused by the host’s inflammatory response to ischemic, but recoverable tissue. A lethal injury was survived in the presence of therapeutic complement inhibition. The complement and neutrophil dependency of skeletal muscle ischemia and reperfusion, such as might occur in trauma or vascular occlusion, has been shown as well (105, 106). Improved indices of injury in these models are produced by sCRl (111, 112). With rats subjected to 4 hr of bilateral hindlimb tourniquet ischemia and 4 hr of reperfusion (lll),sCRl given iv 5 min before reperfusion improved the local extravasation of radiolabeled albumin and gain in wet weight as well as inhibited serum complement hemolytic activity. In the same model, C 3 deposition in the injured limbs was decreased (113).As with mesenteric ischemia and reperfusion, sCRl attenuated the remote pulmonary injury (see below). In a mouse model of cremaster muscle ischemia and reperfusion (103), the level of leukocyte venular adherence and muscle viability after 4 hr of ischemia and 3 hr of reperfusion improved with sCR1. Since human sCRl does not seem to interact with mouse C4b, the effects noted in this model were alternative pathway-dependent. These studies highlight a fundamental question: By what mechanism can reversibly injured tissues activate homologous complement? One hypothesis depends on the apparent alternative pathway dependency. Tissue rendered ischemic may lose its capacity to prevent those C3b moieties deposited from normal fluid-phase alternative pathway C3 turnover from becoming sites of alternative pathway activation. These tissues would then become alternative pathway activators, transiently, until the cell-surface mechanisms were regained or certain proteins resynthesized. This loss of autoprotective capability could b e due to shedding of DAF or MCP from the ischemic tissue or even from insufficient local native sCR1, if sCRl has a major local regulatory effect.
B. ARDS Systemic or excessive complement activation may cause the development of ARDS, often the initial component of the multisystem organ failure which can follow severe injury or infection. In 34 patients at risk for developing ARDS, the 19 patients who went on to develop the syndrome manifested increased concentrations of C3a desArg, decreased chemotaxis to C5a in uitro, and evidence of systemic neutrophi1 degranulation (114). This was also noted in 44 additional patients with multisystem organ failure of varying etiologies (115).Infusion of zymosan-activated plasma (a source of C5a) produces ARDS in rabbits
COMPLEMENT INHIBITION
285
(57).Neutrophil CR3 and endothelial ICAM-1 are also key components of such pulmonary injury, as blockade of each (116) attenuates the excess lung permeability due to intravenous complement activation caused by cobra venom factor administration in the rat. When the systemic complement activation and pulmonary injury were caused by IgG immune complexes or by thermal injury (59),sCRl administration also led to improvement. In each case, both permeability measures and lung content of neutrophils were reduced. Analysis of other models in which sCRl has been used and in which a remote pulmonary injury is present suggest further complexity. A pulmonary injury is produced by skeletal muscle ischemia and reperfusion (117) and can be lessened using anti-CD18 antibodies (118).A lung injury was present in rats with skeletal ischemia and reperfusion treated with placebo (111)as demonstrated by extravasation of radiolabeled albumin into the alveolar space and increased lung content of a neutrophil-specific enzyme, niyeloperoxidase. The extravasation was improved by sCRl treatment, but there was no effect on the content of myeloperoxidase. Thus, complement inhibition prevented the lung injury, not the pulmonary sequestration of neutrophils. The mesenteric ischemia and reperfusion experiments gave the same findings (110). In a mode1 of lung injury which would not produce systemic complement activation, infusion of low doses of endotoxin and platelet-activating factor, sCR1, also protected against pulmonary edema without changing the degree of neutrophil leukosequestration (119). sCRl prevented deposition of C 3 and C5b-9 in lung vessels. Thus, complement inhibition by sCRl ameliorates a lung injury which is not associated with systemic complement activation, somewhat surprisingly. An explanation may be found in experiments performed with cultured endothelium (62). Endothelial monolayers exposed to homologous complement activation fixed C3, C5, and C5b-9, suggesting that complement activation (presumably mediated by C5a) caused a change in endothelial phenotype which disabled the normal endothelial protective mechanisms. Neutrophils adhered to these complement-treated monolayers, and this was inhibited by anti-CR3 monoclonal antibodies. The complement components which were required to produce neutrophil adhesion were alternative pathway only, as would be the case with a loss of cytoprotective mechanisms. The endothelial monolayers which had not been exposed to complement activation also fixed C3, C5, and C5b-C9, though to a smaller degree. This indicated that cultured, and presumably abnormal, endothelium acquired the capacity to activate autologous complement. Much as ischemia might produce a local loss of autoprotective capacity against complement, the release of non-
286
FRANCIS D. MOORE, JR.
complement mediators into the systemic circulation by an injury may cause pulmonary endothelium to lose autoprotective proteins and become a complement activator. Finally, neutrophil CR3 may have to engage both of its ligands simultaneously, pulmonary endothelial ICAM-1 and endothelium-fixed iC3b, before neutrophil-mediated injury can ensue. Thus, there can be two ways by which sCRl prevents the remote pulmonary injury associated with a major local injury. In the one case, local injury produces elaborate systemic CSa. This causes systemic neutrophil activation with increased expression of CR3 and causes pulmonary endothelium activation with increased expression of ICAM-1 and fixation of iC3b due to loss of protective mechanisms. In such a sequence, treatment with sCRl would prevent the pulmonary edema and the pulmonary neutrophil sequestration by interfering with elaboration of C5a at the site of injury. In the other case, local injury releases other mediators which also cause neutrophil and pulmonary endothelial activation. sCRl would prevent the fixation of iC3b by the pulmonary endothelium, resulting in attenuation of the pulmonary injury without influencing the degree of neutrophil pulmonary leukosequestration. C. LOCALINJURIES Experimental burn wound edema, as assessed by radioalbumin extravasation and tissue water content, was reduced by treatment with intravenous sCRl (59). The myeloperoxidase content of burned tissue was also reduced. In a similar fashion, a reversed passive arthus reaction was attenuated by sCRl(l22).Though this literature is still scanty, logic would indicate that sCRl possesses potent local antiinflammatory effects. D. TISSUETRANSPLANTATION Rejection of transplanted tissue grafts has long been recognized to have an element of complement dependency (121). Present investigations center on hypersensitized allograft rejection (122) and on hyperacute discordant xenograft rejection. A degree of ischemia-reperfusion injury may also be present in clinical transplantation that could be improved with complement inhibition. The immunobiology of xenografting has been extensively reviewed (123, 124). Discordant xenografts are rejected within minutes, and this has been prolonged by treatments aimed at complement depletion, such as heat inactivation of serum in an in vitro rat kidney to dog blood model (125), cobra venom factor treatments in a guinea pig heart heterotopic into rat model (126,127), and cobra venom factor treatment in a porcine
COMPLEMENT INHIBITION
287
heart heterotopic to baboon model (128).Only in the latter two experiments was successful depletion of complement confirmed (127, 128). Hyperacute xenograft rejection has also been replicated in vitro with human serum attack on porcine endothelium (129, 130) and by perfusion of a rabbit heart with human plasma (131). The fixation of preformed or natural IgM antibodies to the xenograft endothelium appears to be the source of complement activation, as immunoabsorption of IgM and classical pathway components delay rejection (129) and as immunohistochemical staining shows deposition of IgM and C4 (128) and minimal Factor B (130).Fungal compounds which inhibit complement succeed only if C1 activation is blocked (132),also indicative of classical pathway involvement. However, antibody bound to heterologous mammalian membranes can activate the alternative pathway (133), so that the identification of natural antibody and complement as the initiators is more important than an absolute distinction between pathways. The use of sCRl in guinea pig heart heterotopic in rat models (discordant xenografts) has been reported (134, 135). In one paper, mean xenograft survival, as assessed by visible cardiac contractions, was 17 min in untreated controls. A total of 3 mg/kg of sCRl increased survival time to 64 min, 15 mg/kg to 189 min, and 60 mg/kg to 12 hr. sCR1treated hearts had a more normal histologic appearance. In a second paper, prolongation of xenograft survival was again seen, along with inhibition of both complement pathways, proving that a biologically active dose of sCRl had been circulating. Attempts to prolong xenograft survival with repeated dosing of sCRl have produced survivals as long as a week (R. L. Kirkman, personal communication), but are limited by the availability of sCR1. N o effect on natural antibody levels has been noted (136).In the future, enough sCRl should be committed to a primate xenograft model to find out when the protection against xenorejection which is produced by sCRl ends. Attempts at replication of the sCRl effect with other solubilized complement regulatory membrane proteins, such as DAF and MCP, are underway. IX. Therapeutic Complement Inhibition Using Other Agents
A. HEPARIN Heparin is known to have multiple interactions which alter the function of the complement system. There is an inhibitory action on the classical pathway arising from the binding of heparin to the Clq portion of the trimolecular C1 complex (137). This interaction both
288
FRANCIS D. MOORE, JR.
inhibits classical pathway activation by interfering with C 1 activation (138)and potentiates the action of C1-INH on activated C 1 (139). An inhibitory action has also been observed in the alternative pathway, as the presence ofheparin interferes with the assembly ofthe bimolecular C3-converting enzyme, C3bBb (7), by covering the binding site on C3b for Factor B (140). Since the Factor B site on C3b is also the Factor H site, heparin produces inhibition of Factor H activity with a longer half-life of C3-converting enzyme decay (141). This would promote activation. However, the overall balance of these effects is inhibitory (82,142).The inhibition is independent of the antithrombin 111-binding activity of heparin (143), raising the possibility of a heparin fractionation or derivitization to produce a new heparin with anticomplementary activity but no anticoagulant activity. This has been done (144) and shown to produce the desired effect in experimental animals (145). The use of heparin to inhibit complement activation-dependent effects in experimental animals has been infrequent. Survival of animals given endotoxin was improved using antiendotoxin antibody and heparin, but not antiendotoxin alone (146). The coating of the cardiopulmonary bypass machine surfaces and tubing with heparin has been shown to reduce the level of complement activation (147, 148). Any clinical trial of this equipment will have to be carefully controlled for temperature-dependent effects, as discussed above.
B. FUNGAL PRODUCTS Several pharmacological products which inhibit complement have been reported. The fungal product complestatin interferes with the assembly of the C3-converting enzyme (149), but has not been tested in uiuo. The agents K76COOH and FUT175 have been shown to prolong xenograft survival in a guinea pig heart to rat model (150). K76COOH is a400 MW fungal product (151)which appears to interfere with C 5 cleavage. It also has been shown to inhibit neutrophil accumulation at a site of experimental acute inflammation (152) and to prevent early proteinuria in experimental glomerulonephritis (153).FUT175 (“nafamstat”) is a synthetic protease inhibitor with strong anticomplementary activity (154), as well as inhibitory activity for thrombin, kallekrein, plasmin, and thrombin. FUT175 binds to the Bb fragment of Factor B, thereby exerting its inhibition (155).It has demonstrated in viuo activity with inhibition of Forssman shock in guinea pigs, passive arthus reactions in rats, as well as hypersensitivity reactions (154). The study of inflammatory reactions in the skin of rabbits suggests that FUT175 may exert antiinflammatory effects by inhibiting
COMPLEMENT INHIBITION
289
other systems in addition to complement (156). Specificity limited to complement has not been proven for these agents, and no human data have been reported. X. Summary
The study of the intrinsic regulation of complement has uncovered a broad array of proteins with differing specificities and physicochemical properties. This will allow application of these proteins, native or modified, to the problem of controlling inflammation. The availability of sCR1, as the first such agent, has permitted further definition of those adverse clinical situations which are complement-dependent. The use of sCRl as a drug might be anticipated in situations of thermal injury, ARDS, septic shock, and ischemia/reperfusion injury, such as myocardial infarction after thrombolytic therapy. sCRl may also serve as the tool with which to unravel and possibly treat xenograft rejection. It can be anticipated that other such specific inhibitors will become available.
REFERENCES 1 . Rother, K., and G. 0. Till, eds. (1988). “The Complement System.” Springer-
Verlag, Berlin. 2. Morgan, B. P. (1990). “Complement: Clinical Aspects and Relevance to Disease.” Harcourt Brace Jovanovich, San Diego. 3. Ross, G. D., ed. (1986). “Immunobiology ofthe Complement System: An Introduction for Research and Clinical Medicine.” Academic Press, Orlando. 4 . Fearon, D. T., and Austen, K. F. (1975). Initiation of C3 cleavage in the alternative complement pathway. 1. Immunol. 115, 1357-1361. 5. Fearon, D. T. (1978). Regulation by membrane sialic acid of p-lh-dependent decay-dissociation of amplification C3 convertase of the alternative complement pathway. Proc. Natl. Acad. Sci. U.S.A. 75, 1971-1975. 6. Kazatchkine, M. D., Fearon, D. T., and Austen, K. F. (1979). Human alternative complement pathway: Membrane-associated sialic acid regulates the competition between B and P-1H for cell-bound C3b. J . Immunol. 122, 75-81. 7 . Weiler, J. M., Yurt, R. W., Fearon, D. T., and Austen, K. F. (1978). Modulation of the formation of the amplification convertase of complement, C3b,Bb, by native and commercial heparin.]. E x p . Med. 147, 409-421. 8. Ellison, R. T., Kohler, P. F., Curd, J. G., Judson, F. N., and Reller, L. B. (1983). Prevalence of congenital or acquired complement deficiency in patients with sporadic meningococcal disease. N . Engl. J. Med. 308, 913-916. 9. Hamilton, K. K., Hattori, R., Esmon, C. T., and Sirns, P. J. (1990). Complement proteins C5b-9 induce vesiculation of the endothelial plasma membrane and expose catalytic surface for assembly o f t h e prothrombin enzyme complex. J . B i d . Chem. 265,3809-3814. 10. Davis, C. F., Moore, F. D., Jr., Rodrick, M. L., Fearon, D. T., and Mannick,
290
FRANCIS D. MOORE, JR.
J. A. (1987). Neutrophil activation after bum injury: Contributions of the classical complement pathway and of endotoxin. Ann. Surg. 102,477-484.
11. Moore, F. D., Jr., Davis, C., Rodrick, M., Mannick, J. A., and Fearon, D. T. (1986).
Neutrophil activation in thermal injury as assessed by increased expression of complement receptors. N. Engl. /. Med. 314, 948-953. 12. Alexander, J. W., McClellan, M. A., Ogle, C. K., and Ogle, J. D. (1976).Consumptive opsoninopathy: Possible pathogenesis in lethal and opportunistic infections. Ann. Surg. 184,672-687. 13. Davis, A. E., Bissler, J. J., and Aulak, K. S. (1993). Genetic defects in the C1 inhibitor gene. In “Complement Today” (J.M. Cruse and R. E. Lewis, Jr., eds.), Vol. 1, pp. 133-150. Karger, Basel. 14. Armbrust, T., Schwogler, S., Zohrens, G., and Ramadori, G. (1993). C1 esterase inhibitor gene expression in rat Kupffer cells, peritoneal macrophages and blood monocytes. J. E x p . Med. 178,373-380. 15. Alsenz, J., Bork, K., and Loos, M. (1987). Autoantibody-mediated acquired deficiency of C1 inhibitor. N. Engl. J. Med. 316, 1360-1366. 16. Thompson, R. A., and Lachmann, P. J. (1977).A second case ofhuman C3b inhibitor (KAF) deficiency. Clin. E x p . lmmunol. 27, 23-29. 17. Nicholson-Weller, A., Burge, J., Fearon, D. T., Weller, P. F., and Austen, K. F. (1982). Isolation of a human erythrocyte membrane glycoprotein with decayaccelerating activity for C3 convertases of the complement system. J. lmmunol. 129,184-191. 18. Davitz, M. A., Low, M. G., and Nussenzweig V. (1986). Release of decayaccelerating factor (DAF) from the cell membrane by phosphatidylinositol-specific phospholipase C (PIPLC): Selective modification of a complement regulatory protein. J. Erp. Med. 163, 1150-1161. 19. Medof, M. E., Kinoshita, T., and Nussenzwieg, V. (1984). Inhibition ofcomplement activation on the surface of cells after incorporation of decay-accelerating factor (DAF) into their membranes. J. E x p . Med. 160, 1558-1578. 20. Brooimans, R. A., van Wieringen, P. A., van Es, L. A., and Daha, M. R. (1992). Relative roles of decay-accelerating factor, membrane co-factor protein, and CD59 in the protection of human endothelial cells against complement-mediated lysis. Eur. J. lmmunol. 22,3135-3140. 21. Liszeweski, M. K., Post, T. W., and Atkinson, J. P. (1991). Membrane cofactor protein (MCP or CD46): Newest member of the regulators of complement aetivation gene cluster. Annu. Rev. lmmunol. 9,431-455. 22. McNeamey, T., Ballard, L., Seya, T., and Atkinson, J. P. (1989). Membrane cofactor protein of complement is present on human fibroblast, epithelial, and endothelial cells. J. Clin. Invest. 84, 538-545. 23. Kojima, A,, Iwata, K., Seya, T., Matsumoto, M., Ariga, H., Atkinson, J. P., and Nagasawa, S. (1993). Membrane cofactor protein (CD46) protects cells predominantly from alternative complement pathway-mediated C3-fragment deposition and cytolysis. J. Immunol. 151, 1519-1527. 24. Fearon, D. T. (1980). Identification of the membrane glycoprotein that is the C3b receptor of the human erythrocyte, polymorphonuclear leukocyte, B lymphocyte, and monocyte. /. Erp. Med. 152,ZO-30. 25. Fearon, D. T. (1979). Regulation of the amplification C3 convertase of human complement by an inhibitory protein isolated from human erythrocyte membrane. Proc. Natl. Acad. Sci. U.S.A.76, 5867-5871. 26. Zalman, L. S., Wood, L. M., and Muller-Eberhard, H. J. (1986).Isolation ofa human
COMPLEMENT INHIBITION
27.
28. 29.
30.
31. 32. 33.
34. 35. 36. 37. 38.
39.
40.
41.
29 1
erythrocyte membrane protein capable of inhibiting expression of homologous complement transmembrane channels. Proc. Natl. Acad. Sci. U.S.A.83,6975-6979. Hamilton, K. K., Ji, Z., Rollins, S., Stewart, B. H., and Sims, P. J. (1990). Regulatory control of the terminal complement proteins at the surface of human endothelial cells: Neutralization of a C5b-9 inhibitor by antibody to CD59. Blood 76, 2572-2577. Meri, S., Waldmann, H., and Lachmann, P. J. (1991). Distribution of protectin (CD59), a complement membrane attack inhibitor, in normal human tissue. Lab Invest. 65, 532-537. Zhao, J., Rollins, S. A., Maher, S. E., Bothwell, A. L., and Sims, P. J. (1991). Amplified gene expression in CD59-transfected Chinese hamster ovary cells confers protection against membrane attack complex of human complement. J . Biol. Chem. 266, 13,418-13,422. Vakeva, A., Laurila, P., and Meri, S. (1992). Loss of expression of protectin (CD59) is associated with complement membrane attack complex deposition in myocardial infarction. Lab Invest. 67, 608-616. Gerard, N. P., and Gerard, C. (1991). The chemotactic receptor for human C5a anaphylatoxin. Nature (London)349, 614-617. Fearon, D. T., and Collins, L. A. (1983). Increased expression of C3b receptors on polymorphonuclear leukocytes induced by chemotactic factors and by purification procedures. j . Immunol. 130,370-375. Berger, M., O’Shea, J., Cross, A. S., Folks, T. M., Chused, T. M., Brown, E. J., and Frank, M. M. (1984). Human neutrophils increase expression ofC3bi as well as C3b receptors upon activation. J. Clin. Invest. 74, 1566-1571. Donabedian, H., and Gallin, J. (1981). Deactivation of human neutrophil chemotaxis by chemoattractants: Effect on receptors for the chemotactic factor f-met-leuphe. j . lmmunol. 127,839-844. Didsbury, J. R., Uhing, R. J., Tomhave, E., Gerard, C., Gerard, N., and Snyderman, R . (1991). Receptor class desensitization of leukocyte chemoattractant receptors. Proc. Natl. Acad. Sci. U.S.A.88, 11,564-11,568. Solomkin, J. S., Jenkins, M. K., Nelson, R. D., Chenoweth, D., and Simmons, R. L. (1981). Neutrophil dysfunction in sepsis. 11. Evidence for the role ofcomplement activation products in cellular deactivation. Surgery 90, 319-326. Fallman, M., Andersson, R., and Andersson, T. (1993). Signaling properties of CR3 (CDllbICD18) and CR1 (CD35) in relation to phagocytosis of complementopsonized particles. J. Immunol. 151, 330-338. Wong, W. W., Cahill, J. M., Rosen, M. D., Kennedy, C. A., Bonaccio, E. T., Morris, M. J., Wilson, J. G., Klickstein, L. B., and Fearon, D. T. (1989). Structure of the human CRI gene: Molecular basis of the structural and quantitative polymorphisms and identification of a new CR1-like allele. J. E x p . Med. 169, 847-863. Kalli, K. R., Hsu, P., Bartow, T. J., Ahearn, J. M., Matsumoto, A. K., Klickstein, L. B., and Fearon, D. T. (1991). Mapping of the C3b-binding site of CR1 and construction of a (CR1)z-F(ab’)zchimeric complement inhibitor. J . E x p . Med. 174, 1451- 1460. Arnaout, M. A., Melamed, J., Tack, B. F., andcolten, H. R. (1981). Characterization ofthe human complement (C3b) receptor with a fluid phase C3b dimer.J. Immunol. 127, 1348-1354. Fearon, D. T., Kaneko, I., and Thompson, G. G. (1981). Membrane distribution and adsorptive endocytosis by C3b receptors on human polymorphonuclear leukocytes. J. E x p . Med. 153, 615-628.
292
FRANCIS D. MOORE, JR.
42. Reed, D., and Moore, F. D., Jr. (1988).Recombinant human tumor necrosis factor increases granulocyte cell-surface complement receptor number. Arch. Surg. 123, 1333- 1336. 43. Berger, M., Wetzler, E. M., and Wallis, R. S . (1988). Tumor necrosis factor is the major monocyte product that increases complement receptor expression on mature human neutrophils. Blood 71, 151-158. 44. Neuman, E., Huleatt, J. W., and Jack, R. M. (1990). Granulocyte-macrophage colony-stimulating factor increase synthesis and expression of CR1 and CR3 by human peripheral blood neutrophils. J . Zmmunol. 145, 3325-3332. 45. Garcia-Aguilar, J., Brown, G . E., and Lanser, M. E . (1989). Coagulation increases neutrophil CRl and CR3 expression: Primary role for platelet-derived growth factor. J . Lab. Clin. Med. 144, 312-320. 46. Ehlenberger, A. G., and Nussenzweig, V. (1977). The role of membrane receptors for C3b and C3d in phagocytosis. J . E x p . Med. 145,357-371. 47. Scribner, D. J., and Fahrney, D. (1976).Neutrophil receptors for IgG and complement: Their roles in the attachment and ingestion phases of phagocytosis.J. Immunol. 116, 892-897. 48. Wright, S. D., and Silverstein, S. C. (1982). Tumor-promotingphorbol esters stimulate C3b and C3b' receptor-mediated phagocytosis in cultured human monocytes. J . E x p . Med. 156, 1149-1164. 49. Changelian, P. S., and Fearon, D. T. (1986). Tissue-specific phosphorylation of complement receptors CR1 and CR2.J. Erp. Med. 163, 101-115. 50. Yoon, S., and Fearon, D. T. (1985). Characterization of a soluble form of the C3b/ C4b receptor (CR1) in human plasma. J . Immunol. 134,3332-3338. 51. Limb, G. A., Hamblin, A. S., Wolstencroft, R. A., and Dumonde, D. C. (1991). Selective up-regulation of human granulocyte integrins and complement receptor 1 by cytokines. Zmmunology 74,696-702. 52. Arnaout, M. A., Remold-O'Donnell, E., Pierce, M. W., Harris, P., and Tenen, D. G . (1988). Molecular cloning of the a-subunit ofhuman and guinea pig leukocyte adhesion glycoprotein Mol: Chromosomal localization and homology to the asubunits of integrins. Proc. Natl. Acad. Sci. U.S.A. 85, 2776-2780. 53. Michisita, M., Videm, V., and Arnaout, M. A. (1993). A novel divalent cationbinding site in the A domain of the p2 integrin CR3 (CDllbICD18) is essential for ligand binding. Cell (Cambridge, Mass.) 72, 857-867. 54. Diamond, M. S., Staunton, D. E., Marlin, S. D., and Springer, T. A. (1991). Binding of the integrin Mac-1 (CDllb/CD18) to the third immunoglobulin-like domain of ICAM-1 (CD54) and its regulation by glycosylation. Cell (Cambridge, Mass.) 65, 961-971. 55. von Andrian, U. H., Berger, E. M., Ramezani, L., Chambers, J. D., Ochs, H. D., Harlan, J. M., Paulson, J. C., Etzioni, A., and Arfors, K-E. (1993). In uioo behavior of neutrophils from two patients with distinct inherited leukocyte adhesion deficiency syndromes. J . Clin. Invest. 91,2893-2897. 56. Arnaout, M. A. (1990). Leukocyte adhesion molecule deficiency: Its structural basis, pathophysiology and implications for modulating the inflammatory response. Immunol. Reo. 114, 145-180. 57. Hohn, D. C., Meyers, A. J., Gherini, S . T., Beckman, A,, Markison, R. E., and Churg, A. M. (1980). Production of acute pulmonary injury by leukocytes and activated complement. Surgery 88, 48-57. 58. Till, G . O., Johnson, K. J., Kunkel, R. G., and Ward, P. A. (1982). Intravascular activation of complement and acute lung injury: Dependency on neutrophils and toxic oxygen metabolites. J . Clin. Znuest. 69, 1126-1135.
COMPLEMENT INHIBITION
293
59. Mulligan, M. S., Yeh, C. G., Rudolph, A. R., and Ward, P. A. (1992). Protective effects of soluble CR1 in complement- and neutrophil-mediated tissue injury. J. Zmmunol. 148,1479-1485. 60. Mulligan, M. S., Warren, J. S., Smith, C. W., Anderson, D. C., Yeh, C. G., Rudolph, A. R., and Ward, P. A. (1992). Lung injury after deposition of IgA immune complexes: Requirements for CD18 and I-arginine. J. Zmrnunol. 148, 3086-3092. 61. Mulligan, M. S., Wilson, G. P., Todd, R. F., Smith, C. W., Anderson, D. C., Varani, J., Issekutz, T. B., Mayasaka, M., Tamatani, T., Rische, J. R., Vaporciyan, A. A,, and Ward, P. A. (1993).Role of Pl, P2 integrins and ICAM-1 in lung injury after deposition of IgG and IgA immune complexes. J. Zmrnunol. 150,2407-2417. 62. Marks, R. M., Todd, R. F. 111, and Ward, P. A. (1989). Rapid induction ofneutrophilendothelial adhesion by endothelial complement fixation. Nature (London) 339, 314-317. 63. Weis, J. J., Tedder, T. F., and Fearon, D. T. (1984). Identification of a 145,000 Mr membrane protein as the C3d receptor (CR2) ofhuman B lymphocytes. Proc. N a t l . Acad. Sci. U.S.A. 81, 881-885. 64. Hebell, T., Ahearn, J. M., and Fearon, D. T. (1991). Suppression of the immune response by a soluble complement receptor of B lymphocytes. Science 254, 102- 106. 65. Molina, H., Wong, W., Kinoshita, T., Brenner, C., Foley, S., and Holers, V. M. (1992). Distinct receptor and regulatory properties of recoinbinant mouse complement receptor 1 (CR1) and Crry, the two genetic homologues of human CR1. J. Exp. Med. 175, 121-129. 66. Hauptmann, G. (1989). Frequency of complement deficiencies in man, disease associations and chromosome assignment of complement genes and linkage groups. Complement InjZamrn. 6, 74-80. 67. Alper, C. A,, Abramson, N., Johnston, R. B., Jr., Jandl, J . H., and Rosen, F. S. (1970). Increased susceptibility to infection associated with abnormalities of complementmediated functions and of the third component of complement (C3). N . Engl. J. Med. 282,349-354. 68. Thompson, R. A,, and Winterborn, M. H . (1981). Hypoconiplementaemia due to genetic deficiency of P l H globulin. Clin. Exp. Zmmunol. 46, 110-119. 69. Edwards, K. M., Alford, R., Gewurz, H., and Mold, C. (1983). Recurrent hacterial infections associated with C3 nephritic factor and hypocomplementemia. N . Engl. 1. Med. 308, 1138-1141. 70. Arnaout, M. A,, Pitt, J., Cohen, H. J., Melamed, J., Rosen, F. S., and Colten, H . R. (1982). Deficiency ofa granulocyte-membrane glycoprotein (gp150) in a boy with recurrent bacterial infections. N . E n g l . 1. Med. 306, 693-699. 71. Sjoholm, A. G., Kuiper, E. J., Tjilsen, C. C., Jansz, A., Bol, P., Spanjaard, L., and Zanen, H. C. (1988). Dysfunctional properdin in a Dutch family with meningococcal disease. N . Engl. J. Med. 319, 33-36. 72. Wilson, J. G., Wong, W. W., Schur, P. H., and Fearon, D. T. (1982). Mode of inheritance of decreased C3b receptors on erythrocytes of patients with systemic lupus erythematosus. N . Engl. J. Med. 307, 981-986. 73. Jackson, C. G., Ochs, H. D., and Wedgewood, R. J. (1979). Immune response of a patient with deficiency of the fourth component of complement and systemic lupus erythernatosus. N . Engl. 1. Med. 300, 1124-1129. 74. Craddock, P. R., Fehr, J., Dalmasso, A. P., Brigham, K. L., and Jacob, H . S. (1977). Hemodialysis leukopenia: Pulmonary vascular leukostasis resulting from complement activation by dialyzer cellophane membranes. J. Clin. Znoest. 59, 879888.
294
FRANCIS D. MOORE, JR.
75. Craddock, P. R., Hammerschmidt, D., White, J. G., Dalmasso, A. P., and Jacob, H. S. (1977). Complement (C5a)-inducedgranulocyte aggregation in uitro: A possible explanation of complement-mediated leukostasis and leukopenia. J. Clin. Znvest. 60,260-264. 76. Craddock, P. R., Fehr, J., Brigham, K. L., Kronenberg, R. S.,and Jacob, H. S. (1977). Complement and leukocyte-mediated pulmonary dysfunction in hemodialysis. N. Engl. J. Med. 296,769-774. 77. Jacob, H. S., Craddock, P. R., Hammerschmidt, S., and MoIdow, C. F. (1980). Complement-induced granulocyte aggregation: An unsuspected mechanism of disease. N. Engl. J. Med. 302,789-794. 78. Hammerschmidt, D. E., Weaver, L. J., Hudson, L. D., Craddock, P. R., and Jacob, H. S. (1980). Association of complement activation and elevated plasma-C5a with adult respiratory distress syndrome: Pathophysiologic relevance and possible prognostic value. Lancet 1(8175), 947-949. 79. Lee, J., Hakim, R. M., and Fearon, D. T. (1984). Increased expression of the C3b receptor by neutrophils and complement activation during hemodialysis. Clin. Erp. lmmunol. 56,205-214. 80. Arnaout, M. A., Hakim, R. M., Todd, R. F., III., Dana, N., and Colten, H. R. (1985). Increased expression of an adhesion-promoting surface glycoprotein in the granulocytopenia of hemodialysis. N. Engl. J. Med. 312,457-462. 81. Chenoweth, D. E., Cooper, S. W., Hugh, T. E., Stewart, R. W., Blackstone, E. H., and Kirklin, J. W. (1981). Complement activation during cardiopulmonary bypass: Evidence for generation of C3a and C5a anaphylatoxins. N. Engl. J. Med. 304, 497-503. 82. Moore, F. D., Jr., Warner, K. G., Assoussa, S., Valeri, C. R., and Khuri, S. F. (1987). The effects of complement activation during cardiopulmonary bypass: Attenuation by hypothermia, heparin, and hemodilution. Ann. Surg. 208,95- 103. 83. Salama, A., Hugo, F., Heinrich, D., Hoge, R., Muller, R., Keifel, V., MullerEckhardt, C., and Bhakdi, S. (1988). Deposition of terminal C5b-9 complement complexes on erythrocytes and leukocytes during cardiopulmonary bypass. N. Engl. J. Med. 318,408-414. 84. Fjellstrom, K-E., and Arturson, G. (1963). Changes in the human complement system following burn injury. Acta Pathol. Microbiol. Scand. 59, 257-270. 85. Daniels, J. C., Larson, D. L., Abston, S., and Ritzman, S. E. (1974). Serum protein profiles in thermal burns. 11. Protease inhibitors, complement factors, and creactive protein. J. Trauma 14, 153-162. 86. Sharma, V. K., Agarwal, D. S., Satyana, N. D., and Saha, K. (1980). Profile of complement components in patients with severe burns. J. Trauma 20, 976-978. 87. Bjornson, A. B., Bjornson, S., and Altemeier, W. A. (1981). Reduction in alternative complement pathway mediated C 3 conversion following burn injury. Ann. Surg. 194,224-231. 88. Celfand, J. A., Donelan, M., and Burke, J . F. (1983). Preferential activation and depletion of the alternative complement pathway by burn injury. Ann. Surg. 198, 58-62. 89. Gelfand, J. A., Donelan, M., and Burke, J. F. (1982). Alternative complement pathway activation increases mortality in a model of burn injury in mice. J. Clin. Invest. 70, 1170-1176. 90. Solomkin, J . S., Nelson, R. D., Chenoweth, D. E., Solem, L. D., and Simmons, R. L. (1984). Regulation of neutrophil migratory function in burn injury by complement activation products. Ann. Surg. 200, 742-746.
COMPLEMENT INHIBITION
295
91. Moore, F. D., Jr., Moss, N. A., Revhaug, A., Wilmore, D., Mannick, J. A., and Rodrick, M. (1987).A single dose ofendotoxin activates neutrophils without activating complement. Surgery 102,200-205. 92. Heideman, M. (1979). The effect of thermal injury on hemodynamic, respiratory, and hematologic variables in relation to complement activation. J. Trauma 19, 239-243. 93. Oldham, K. T., Guice, K. S., Till, G. O., and Ward, P. A. (1988). Activation of complement by hydroxyl radical in thermal injury. Surgery 104,272-278. 94. Fried], H. P., Till, G. O., Trentz, O., and Ward, P. A. (1989). Roles of histamine, complement, and xanthine oxidase in thermal injury of skin. Am. J. Pathol. 135, 203-217. 95. Solomkin, J. S., Cotta, L. A., Ogle, J. D., Brodt, J. K., Ogle, C. K., Satoh, P. S., Hurst, J. M., and Alexander, J. W. (1984). Complement-induced expression of cryptic receptors on the neutrophil surface: A mechanism for regulation of acute inflammation in trauma. Surgery 96, 336-342. 96. Fearon, D. T., Ruddy, S., Schur, P. H., and McCabe, W. R. (1975). Activation of the properdin pathway of complement in patients with gram-negative bacteremia. N. Engl. J. Med. 292,937-940. 97. Watanabe, C., Stinnett, J. D., and Alexander, J. W. (1982). Evaluation of serum replacement therapy for bacterial infection in complement depleted guinea pigs. J. Clin. Surg. 1, 27-31. 98. Slotman, G. J., Burchard, K. W., Williams, J. J., D’Arezzo, A,, and Yellin, S. A. (1986). Interaction of prostaglandins, activated complement, and granulocytes in clinical sepsis and hypotension. Surgery 99, 744-750. 99. Bengston, A., and Heideman, M. (1988). Anaphylatoxin formation in sepsis. Arch. Surg. 123,645-649. 100. Smedegard, G., Cui, L., and Hugli, T. E. (1989). Endotoxin-induced shock in the rat: A role for C5a. Am. J. Pathol. 135, 489-497. 101. Stevens, J. H., O’Hanley, P., Shapiro, J. M., Mihm, F. G., Satoh, P. S., Collins, J. A., and Raffin, T. A. (1986). Effects of anti-C5a antibodies on the adult respiratory distress syndrome in septic primates. J. Clin. lnoest. 77, 1812-1816. 102. Wakabayashi, G., Gelfand, J. A., Jung, W. K., Connolly, R. J., Burke, J. F., and Diarello, C. A. (1991). Staphylococcus epidermidis induces complement activation, tumor necrosis factor and interleukin-1, a shock-like state and tissue injury in rabbits without endotoxemia. J. Clin. Invest. 87, 1925-1935. 103. Morisaki, T., Goya, T., Toh, H., Nishihara, K., and Toisu, M. (1991). The anti Mac1 monoclonal antibody inhibits neutrophil sequestration in lung and liver in a septic murine model. Clin. Immunol. lmmunopathol. 61, 365-375. 104. Eichacker, P. Q., Farese, A., Hoffman, W. D., Banks, S. M., Mouginis, T., Richmond, S., Kuo, G. C., Macvittie, T. J., and Nathanson, C. (1992). Leukocyte CDllblCD18 antigen-directed monoclonal antibody improves early survival and decreases hypoxemia in dogs challenged with tumor necrosis factor. Am. Rev. Respir. Dis. 145, 1023-1029. 105. Rubin, B. B., Smith, A., Liauw, S., Isenman, D., Romaschin, A. D., and Walker, P. M. (1990). Complement activation and white cell sequestration in postischemic skeletal muscle. Am. J. Physiol. 259, H525-H531. 106. Korthius, R. J., Grishman, M. B., and Granger, D. N. (1988). Leukocyte depletion attenuates vascular injury in postischemic skeletal muscle. Am. J. Physiol. 254, H823-H827. 107. Moroko, P. R., Carpenter, C. B., Chiarello, M., Fishbein, M. C., Radvany, P.,
296
108. 109.
110.
111.
112. 113. 114.
115. 116. 117. 118. 119. 120.
121.
FRANCIS D. MOORE, JR.
Knostman, J. D., and Hale, S. L. (1978). Reduction by cobra venom factor of myocardial necrosis after coronary artery occlusion. Lab. Inuest. 48, 43-47. Schafer, P. J., Mathey, D., Hugo, F., and Bhakdi, S. (1986). Deposition of the terminal C5b-9 complex in infarcted areas of human myocardium. J . Immunol. 137,1945-1949. Wiesman, H. F., Bartow, T., Leppo, M. K., Marsh, H. C., Jr., Carson, G. R., Concino, M. F., Boyle, M. P., Roux, K. H., Weisfeldt, M. L., and Fearon, D. T. (1990). Soluble human complement receptor type 1: In uiuo inhibitor of complement suppressing post-ischemic myocardial inflammation and necrosis. Science 249, 146-151. Hill, J., Lindsay, T. F., Ortiz, F., Yeh, C. G . , Hechtman, H. B., and Moore, F. D., Jr. (1992). Soluble complement receptor type 1 ameliorates the local and remote organ injury after intestinal ischemia-reperfusion in the rat. J. lmmunol. 149, 1723- 1728. Lindsay, T. F., Hill, J., Ortiz, F., Rudolph, A., Valeri, C. R., Hechtman, H. B., and Moore, F. D., Jr. (1992). Blockade of complement activation prevents local and pulmonary albumin leak after lower torso ischemia-reperfusion. Ann. Surg. 216, 677-683. Pemberton, M., Anderson, G., Vetvicka, V., Justus, D. E., and Ross, G . D. (1993). Microvascular effects of complement blockade with soluble recombinant CR1 on ischemia and reperfusion injury of skeletal muscle. J . lmmunol. 150, 5104-5113. Hsu, P., Simpson, R., Lindsay, T. F., Hebell, T., Kobzik, L., Moore, F. D., Jr., Fearon, D. T., and Hechtman, H. B. (1993). The alternative pathway mediates complement activation in reperfusion injury. Clin. Res. 41, 233A. [Abstract] Solomkin, J. S., Cotta, L. A., Satoh, P. S., Hurst, J. M., and Nelson, R. D. (1985). Complement activation and clearance in acute illness and injury: Evidence for C5a as a cell-directed mediator of the adult respiratory distress syndrome in man. Surgery 97,668-678. Heideman, M., and Hugh, T. E. (1984). Anaphylatoxin generation in multisystem organ failure. J. Trauma 24, 1038-1043. Mulligan, M. S., Smith, C. W., Anderson, D. C., Todd, R. F. 111, Miyaska, M., Tamatani, T., Issekutz, T. B., and Ward, P. A. (1993).Role of leukocyte adhesion molecules in complement-induced lung injury. J . lmmunol. 150, 2401-2406. Anner, H., Kaufman, R. P., Jr., Kobzik, L., Valeri, C. R., Shepro, D., and Hechtman, H. B. (1987). Pulmonary hypertension and leukosequestration after lower torso ischemia. Ann. Surg. 206, 642-648. Welbourn, R., Goldman, G., Kobzik, L., Paterson, I. S., Valeri, C. R., Shepro, D., and Hechtman, H. B. (1992). Role of neutrophil adherence receptors (CD18) in lung permeability following lower torso ischemia. Circ. Res. 71(l),82-86. Rabinovici, R., Yeh, C. G., Hillegrass, L. M., Griswold, D. E., DiMartino, M. I., Vernick, J.. Fong, K. L., and Feuerstein, G. (1992).Role of complement in endotoxin/platelet-activating factor-induced lung injury. J . lmmunol. 149, 1744-1750. Yeh, C. G., Marsh, H. C., Jr., Carson, G. R., Berman, L., Concino, M. F., Scesney, S. M., Kuestner, R. E., Skibbens, R., Donahue, K. A., and lp, S. H. (1991). Recombinant soluble human complement receptor type 1 inhibits inflammation in the reversed passive arthus reaction in rats. J. lmmunol. 146, 250-256. Austen, K. F., and Russell, P. S. (1966). Detection of renal allograft rejection in man by demonstration of a reduction in the serum concentration of the second component of complement. Ann. N.Y. Acad. Sci. 129,657-672.
COMPLEMENT INHIBITION
297
122. Pruitt, S. K., and Bollinger, R. R. (1991).The effect of soluble complement receptor type 1 in hyperacute allograft rejection. J . Surg. Res. 50, 350-355. 123. Auchincloss, H., Jr. (1988).Xenogeneic transplantation. Transplant 46, 1-20. 124. Platt, J. L., Vercellotti, G . M., Dalmasso, A. P., Matas, A. J., Bolman, R. M., Najarian, J. S., and Bach, F. H. (1990). Transplantation of discordant xenografts: A review of progress. Zmmunol. Today 11, 450-456. 125. Schilling, A,, Land, W., Pratschke, E., Pielsticker, K., and Brendel, W. (1976). Dominant role of complement in the hyperacute xenograft rejection reaction. Surg. Gynecol. Obstet. 142,29-32. 126. Adachi, H., Rosengard, B. R., Hutchins, G. M., Hall, T. S., Baumgartner, W. A., Borkon, A. M., and Reitz, B. A. (1987).Effects of cyclosporine, aspirin, and cobra venom factor on discordant cardiac xenograft survival in rats. Transplant. Proc. 19, 1145-1148. 127. Miyagawa, S . , Hirose, H., Shirakura, R., Naka, Y., Nakata, S., Kawashima, Y., Seya, T., Matsumoto, M., Uenaka, A., and Kitamura, H. (1988). The mechanism of discordant xenograft rejection. Transplantation 46, 825-830. 128. Leventhal, J . R., Dalmasso, A. P., Cromwell, J. W., Platt, J. L., Manivel, C. J., Bolman, R. M., Jr., and Matas, A. J. (1993).Prolongation ofcardiac xenograft survival by depletion of complement. Transplantation 55,857-865. 129. Dalmasso, A. P., Vercellotti, G. M., Fischel, R. J., Bolman, R. J., Bach, F. H., and Platt, J. L. (1992).Mechanism of complement activation in the hyperacute rejection of porcine organs transplanted into primate recipients. Am. J . Pathol. 140, 1157- 1566. 130. Dalmasso, A. P., Platt, J. L., and Bach, F. H. (1991).Reaction of complement with endothelial cells in a model of xenotransplantation. Clin. E x p . Zmmunol. 86(Suppl. l), 31-35. 131. Homeister, J. W., Satoh, P. S., Kilgore, K. S., and Lucchesi, B. R. (1993).Soluble complement receptor type 1 prevents human complement-mediated damage of the rabbit isolated heart. J . Zmmunol. 150, 1055-1064. 132. Miyagawa, S., Shirakura, R., Matsumiya, G., Kitagawa, S., Fukushima, N., Nakata, S., Nakano, S., Kitamura, H., Matsumoto, M., Seya, T., and Matsuda, H. (1992). Effect of anticomplement reagents, K-76 COOH and FUT175, on discordant xenograft survival. Transplant. Proc. 24,483-484. 133. Moore, F. D., Jr., Fearon, D. T., and Austen, K. F. (1981).IgG on mouse erythrocytes augments activation of the human alternative complement pathway by enhancing deposition of C3b. J . Zmmunol. 126, 1805-1809. 134. Pruitt, S . K., Baldwin, W. M., 111, Marsh, H. C., Jr., Lin, S., Yeh, C. G., and Bollinger, R. R. (1991).The effect of soluble complement receptor type 1 in hyperacute xenograft rejection. Transplantation 52, 868-873. 135. Xia, W., Fearon, D. T., Moore, F. D., Jr., Schoen, F. J., Ortiz, F., and Kirkman, R. L. (1992).Prolongation of guinea pig cardiac xenograft survival in rats by soluble human complement receptor type 1. Transplant Proc. 24,479-480. 136. Pruitt, S. K., Baldwin, W. M., 111, Marsh, H. C., Jr., Lin, S. S., Yeh, C. G., and Bollinger, R. R. (1992).Effect of soluble complement receptor type 1 on natural antibody levels during xenograft rejection. Transplant Proc. 24,477-478. 137. Almeda, S., Rosenberg, R. D., and Bing, D. H. (1983).The binding properties of human complement component C l q : Interaction with mucopolysaccharides. J . Biol. Chem. 258, 785-791. 138. Strunk, R., and Colten, H. R. (1976). Inhibition of the enzymatic activity of the
298
FRANCIS D. MOORE, JR.
first componenet of complement ( C l ) by heparin. Clin.lmmunol. Zmmunopathol. 6,248-255. 139. Caughman, G . B., Boackle, R. J., and Vesely, J. (1982). A postulated mechanism for heparin’s protentiation of C1 inhibitor function. Mol. Immunol. 19, 287-295. 140. Maillet, F., Kazatchkine, M. D., Glotz, D., Fischer, E., and Rowe, M. (1981). Heparin prevents formation ofthe human C3 amplification convertase by inhibiting the binding site for B on C3b. Mol. lmmunol. 20, 1401-1404. 141. Boackle, R. J., Caughman, G . B., Veseley, J., Medgyesi, G., and Fudenberg, H. H. (1983). Potentiation of factor H by heparin: A rate-limiting mechanism for inhibition of the alternative complement pathway. Mol. Immunol. 20,1157-1164. 142. Ekre, H. (1985). Inhibition of human and guinea pig complement by heparin fractions differing in affinity for antithrombin 111 or in average molecular weight. Int.]. Immunopharmacol. 7,271-280. 143. Kazatchkine, M. D., Fearon, D. T., Metcalfe, D. D., Rosenberg, R. D., and Austen, K. F. (1981). Structural determinants of the capacity of heparin to inhibit the formation of the human C3 convertase. I . Clin.Znoest. 67, 223-228. 144. Edens, R. E., Engelken, J. D., and Weiler, J. M. (1991). Heparin inhibits zymosan and CoVF activation of serum. Complement Znflamm. 8,143-144. 145. Weiler, J. M., Edens, R. E., Linhardt, R. J., and Kapelanski, D. P. (1992). Heparin and modified heparin inhibit complement activation in oioo. J. Immunol. 148, 3210-3215. 146. Dunn, D. L., Mach, P. A., Cerra, F. B., and Ferguson, R. M. (1983). The role of heparin in guinea pig gram negative bacterial sepsis. J . Surg. Res. 34, 479-485. 147. Nilsson, L., Storm, K. E., Thelin, S., Bagge, L., Hultman, J., Thorelius, J., and Nilsson, U. (1990). Heparin-coated equipment reduces complement activation during cardiopulmonary bypass in the pig. Artif. Organs 14,46-48. 148. Mollnes, T. E., Videm, V., Gotze, O., Harboe, M., and Oppermann, M. (1991). Formation of C5a during cardiopulmonary bypass: Inhibition by precoating with heparin. Ann. Thorac. Surg. 52,92-97. 149. Kaneko, I., Fearon, D. T., and Austen, K. F. (1980). Inhibition of the alternative pathway of human complement in oitro by a natural microbial product, complestatin.]. Immunol. 124, 1194-1198. 150. Miyagawi, S., Shirakura, R., Matsumiya, G., Fukushima, N., Nakata, S., Matsuda, H., Matsumoto, M., Kitamura, H., and Seya, T. (1993). Prolonging discordant xenograft survival with anticomplement reagents K76COOH and FYT175. Transplantation 55, 709-731. 151. Miyazaki, W., Tamaoka, H., Shinohara, M., Kaise, H., Izawa,T., Nakano, Y., Kinoshita, T., Hong, K., and Inoue, K. (1980). A complement inhibitor produced by Stachybotrys complement& nov. sp., K-76, a new species of fungi imperfecti. Microbiol. lmmunol. 24, 1091-1108. 152. Konno, S., and Tsurufuji, S. (1983). Induction of zymosan ear pouch inflammation in rats and its characterization with reference to the effects of anticomplementary and anti-inflammatory agents. Br. /. Pharmacol. 80, 269-277. 153. Iida, H., Izumino, K., Asaka, M., Tkata, M., Mizumura, Y., and Sasayama, S. (1987). Effect of the anticomplementary agent, K-76 monocarboxylic acid, on experimental immune complex glomerulonephritis in rats. Clin.E r p . fmmunol. 67, 130-134. 154. Hitomi, Y., and Fujii, S. (1982). Inhibition of various immunological reactions in oivo by a new synthetic complement inhibitor. l n t . Arch. Allergy A p p l . Immunol. 69,262-267.
COMPLEMENT INHIBITION
299
155. Ikari, N., Sakai, Y., Hitomi, Y., and Fujii, S . (1983). New synthetic inhibitor to the alternative complement pathway. Immunology 49, 685-691. 156. Issekutz, A. C., Roland, D. M., and Patrick, R. A. (1990). The effect of FUT-175 (nafamstat niesilate) on C3a, C4a and C5a generation in uitro and inflammatory reactions in uioo. Int. /. Imtti,inophar?nuco1. 12, 1-9. This article was accepted for publication on 9 December 1993.
A D V A N C E S IN IhlMUNOI.OCY, VOL 5fi
Chemoimmunoconjugatesfor the Treatment of Cancer GEOFFREY A. PIETERSZ, APRIL ROWLAND, MARK J. SMYTH, AND IAN F. C. MCKENflE Austin Research Institute, Austin Hospital, Studley Road, Heidelberg 3084, Victoria, Australia
1. Introduction: Concept of Targeted Chemotherapy
Targeted chemotherapy involves the specific carrier-mediated delivery of chemotherapeutic agents to tumors or other target tissues. This approach presumes the existence of some molecular, genetic or metabolic characteristic that differs between target and nontarget cells such as a structural membrane protein, a cell-surface receptor, an intracellular enzyme, or an altered sequence in the genome. Until recently, a problem existed in establishing a discrete and accessible difference between neoplastic and normal cells; however, the isolation of some oncogenes and their products and the production of monoclonal and polyclonal antibodies to tumor-associated antigens indicate that it is possible to biochemically distinguish normal and tumor cells (1, 2). In parallel with definition of differences between normal and neoplastic cells is the development ofreagents with a high degree of selectivity for targets on the surface and within neoplastic cells. Over the past 20 years, considerable interest has been focused on targeting systems designed to permit selective delivery of drugs, radioisotopes, and toxins to tumors for both diagnosis and therapy and a great deal of this research has been performed utilizing antibodies as carriers (Table I). As vehicles for carrying cytotoxic agents to tumors, antibodies have the greatest potential; however, a number of other possible carriers have been investigated (Table 11).The advantages of antibodies and other carriers include: (i) the selective delivery of the cytotoxic agent to the tumor cells; (ii) the slow release of the cytotoxic agent from the conjugate enabling prolonged exposure of the tumor cells to the cytotoxic agent; (iii) the preferential uptake of the cytotoxic agent-carrier conjugate by tumor cells; (iv) the use of extremely cytotoxic agents which cannot be used alone because of toxicity; (v) the binding of cytotoxic agents to carriers, which may protect the agent from enzymatic degradation and rapid excretion. Evidently then, the use of carriers to target cytotoxic agents is an attractive and provocative area of research; however, for the drug-targeting concept to succeed, both the cytotoxic agent and the carrier when conjugated must retain their 301 Copyright 0 1YY4 hy AcadriiilL P r a % I n < All rights of reproduction in m y form rebrrvrd
302
GEOFFREY A. PIETERSZ ET AL.
TABLE I AGENTSCONJUGATED TO MONOCLONALANTIBODIES Agent Toxins (3) Anticancer drugs Enzymes (5) Chemotactic factors (6) Cytokines (7) Isotopes (8) Radiosensitizers (9) Photosensitizers (10) Liposomes (11) Nuclear magnetic resonance contrast agents (12) Plasminogenactivators (13) Carborane cages (14) Iron oxide particles (15) Other (16)
Examples Ricin, Pseudomonas exotoxin see Table 111 Cytosine deaminase, carboxypeptidase fMLP
IL-2 Wy 1311
Misonidazole Chlorin-e Gadolinium
Muramyl dipeptide
Note. References are in parentheses.
activity in uiuo. For this and many other reasons outlined below, the development of the hybridoma technique to produce monoclonal antibodies (MAbs) has led to the production of more refined cytotoxic agent-carrier conjugates (33). As indicated in Tables I and 11, there are many carriers and many “bullets” which could be targeted. This review focuses on drug-antibody conjugates; the use of toxins, isotopes, and enzymes are extensively reviewed elsewhere (34)-some reference to them is included for comparative purposes. II. Monoclonal Antibodies as Carriers
A. DEVELOPMENT
The use of antibodies as carriers for cytotoxic agents has been under consideration since the first recorded suggestions for targeting (35). The earliest studies made use of antisera raised by immunizing mice, rabbits, sheep, horses, and goats with tumor cells or their subcellular fractions (36-38). Antibodies reacting with normal tissue antigens were removed by absorption with normal tissue homogenates, thereby rendering the antisera relatively “tumor specific.” These approaches
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
303
TABLE I1 NONANTIBODY CARRIERS FOR CYTOTOXIC DRUGS, TOXINS AND RADIOISOTOPES Macromolecules DNA (17) Bovine serum albumin (18) Polyamino acid carriers (19) Dextrans (20) Lectins Concanavalin A (21) Hormones Insulin (22) Melanotropin (23) Thyrotropin (24) Microparticulate carriers Liposomes (25) Cells (26) Microspheres (27) Genetically engineered cytokines IL2-PE (28) IL6-PE (28) IL4-PE (28) TCFa-PE (28) ICF-PE (28) CD4-PE (29) IL2-DAB4M (30) Miscellaneous Arachidonic acid (31) Epidermal growth factor (32) Note. References are in parentheses
were limited, principally because the reagents still lacked specificity for tumor antigens; however, many preparations were of value in formulating procedures for coupling antibodies to cytotoxic drugs (38-40). The desire for monospecific antibody reagents and some of the earlier difficulties with cell-mediated immunity to detect human tumor antigens provided some of the impetus for developing MAbs (41) and the advent of the hybridoma technology and MAbs represented a real advance in the field of tumor immunology (33). As a result of this technology, the production of many MAbs and the subsequent identification of tumor-associated antigens have considerably extended the possibilities of targeting cytotoxic agents to tumors. MAbs, by virtue of their unique specificity, the ability to select for the desired affinity, and ease of production, have surpassed polyclonal preparations as carriers for targeted delivery of cytotoxic agents to tumors. Indeed,
304
GEOFFREY A. PIETERSZ ET AL
the prospect of using antibodies as vehicles for isotopes, drugs, and toxins only became a reality with the development of MAbs with some degree of specificity for tumors. Reexploration of this approach using MAbs has been strengthened by studies which demonstrated that xenogeneic MAbs could not only be safely administered to patients and localize in tumors (42) but could also have a therapeutic effect of their own in xenograft models (43, 44) and in patients with leukemia and lymphoma (45, 46). Although therapeutic effects against tumors have been obtained using MAbs alone, and these responses have involved complement-mediated effects or modulation of effector macrophages and natural killer cells (48), clinical responses to serotherapy have been variable (49,50),and animal studies indicate there are limitations to this approach (51).The variable antitumor effects of MAbs, however, may well be improved by conjugation to cytotoxic agents, given that the cytotoxic potential and mechanism of action of many drugs and toxins are well understood as many have already been used in the clinic.
B. ANTIBODIES ALONE Why not antibodies alone? They clearly function in vivo after active or passive immunisation, particularly for infectious disease. In practice, the use of passively administered antibodies, in cancer, has rarely been successful. With regard to antibodies only OKT3 (52) and Campath 1 (53) appear to be active in transplantation (both) and in lymphoma-leukemia (Campath-1). The reasons have been discussed elsewhere, but essentially there are three major problems: (a) amount of antibody bound; (b) poor mobilization of effector mechanisms by mouse antibodies; and (c)the development of immune responses to the foreign immunoglobulin-refered to as human antimouse antibodies (HAMA). Recombinant monoclonal antibodies consisting of murine variable sequences and human constant domains are now available and some have been tested in Phase I clinical trials (54).These recombinant antibodies where the variable domains of the mouse antibodies are engineered onto human constant domains, binds complement and have antibody-dependent cellular cytotoxicity (ADCC) activity and therefore may activate effector function in man. Alternatively, antibody constant domains have been modified (e.g., altered hinged region) to improve various functional activities (55) for improved therapy in humans. How these modifications effect the HAMA response is discussed below. More recently, additional approaches to increase the antitumor activity of monoclonal antibodies in uivo have been studied by administering biological response modifiers such as interferons (56), interleukins (57), and colony-stimulating factors (58).
CHEMOIMMUNOCONJUCATES IN CANCER TREATMENT
305
C. SPECIFICITY AND LOCALIZATION
1. Targets To increase the selective targeting of cytotoxic agents to neoplastic cells, it is desirable to have clearly defined targets which ideally are expressed on the cell surface of tumor cells but not on normal cells. Despite the repertoire of murine MAbs reacting with antigens associated with human tumors (59), there is no conclusive evidence for the existence of human tumor-specific antigens detected by murine MAbs-with the possible exception of the idiotype of surface immunoglobulin on B cell lymphomas (60). While the search continues for specific antitumor MAbs produced by murine and more by human hybridomas, the targeting of cytotoxic agents with MAbs of absolute specificity may not be necessary. For example, an antigen which has a higher expression on tumor than normal cells or is absent on vital normal cells (e.g., hemopoietic stem cells) may be a suitable target for the delivery of cytotoxic agents. Many potential antigens have been found to be highly tumor-associated, three of the best known examples being a-fetoprotein (AFP) (61),carcinoembryonic antigen (CEA) (6 2 ), and common acute lymphoblastic leukemia antigen (CALLA) (63). A better definition of the known tumor-associated antigens, such as CEA and AFP, has been possible using MAbs recognizing different epitopes (64-66). CEA is representative of many tumor-associated antigens and is one of the most widely studied tumor markers. It is immunologically a complex macromolecule, expressing both protein and carbohydrate determinants on colon carcinoma cells (67)and has been reported to be cross-reactive with NCA-1 (68), NCA-2 (69), normal biliary glycoprotein (70), and some circulating cells (71). These types of cross-reactivities with normal tissues, displayed by many MAbs-binding tumor-associated antigens, make it necessary to clearly define the properties of the MAbs both biochemically and by immunohistochemical techniques before they are used as carriers for cytotoxic agents. Epitope analysis and immunohistology has allowed a number of CEA-specific and cross-reactive antibodies to be identified, prvviding the opportunity of using different mixtures of antibodies to overcome heterogeneity of CEA epitope expression found within individual tumors and between different patients (72). The isolation and characterization of cDNA clones encoding CEA reveal a highly conserved repeating structure (73).Antibodies to various parts of the CEA molecule have been made as an effort to obtain more specific antibodies (74). MAbs against CEA have proved to be of value for the radioimmunoassay of human circulating CEA (75),for the radioimmunolocalization of tumors (76), and as carriers of cytotoxic drugs such as
306
GEOFFREY A. PIETERSZ ET AL.
vindesine (VDS) (77). Studies using a VDS-anti-CEA MAb conjugate demonstrated that the in vivo efficacy against lung and colorectal carcinoma xenografts in nude mice was dependent on target antigen expression on the tumor xenograft cells. This not only demonstrated the specificity of MAbs as carriers for cytotoxic agents, but also showed that the amount of antibody binding the tumor cells was limited by the number of antigen receptors expressed. With the production and characterization of MAbs, there has been an identification of many other tumor-associated membrane markers of potential value in the diagnosis and therapy of tumors such as melanoma (78), lung carcinoma (79),breast carcinoma (80),leukemia, and lymphoma (81-83). Some of the antigens identified are carbohydrate structures present on glycoproteins and glycolipids (84), while other MAbs have been shown to recognize noncarbohydrate determinants on glycoproteins (85). Indeed, it has been demonstrated that a protooncogene HER-e/neu, an epidermal growth factor (EGF) receptor-like member of the tyrosine-specific protein kinase family, was amplified in 30% of subjects with human breast cancer, and the presence of HER-2 was a significant bad prognostic factor (86). The cell-surface membrane protein encoded by this protooncogene is the type of target that may be a good candidate for targeted chemotherapy, particularly as the target antigen has an integral function in the growth of tumor cell. To date, however, MAbs to protooncogene products do not appear to be suitable vectors for targeting cytotoxic agents such as methotrexate (MTX) to tumor cells (87), possibly due to their poor access to oncoproteins in tumor cells as most are expressed intracellularly and not on the surface (88). However, totally intracellular and intranuclear oncogene proteins have been found to be expressed on the cell surface as small peptides-in association with MHC class I molecules (89). In the future, it may be possible to make antibodies to these peptides to enable cell-surface detection. At present, they are only detected by cytotoxic T cells. The cDNAs coding for several other tumor-associated antigens have been cloned, CALLA (go), the protein core of the human milk fat globule antigen (HMFG) (91) and human prostatic acid phosphatase (PAP) (92).cDNAs have been characterized and have led to the production of second-generation antibodies raised to peptide sequences based on translation of cDNA (93). These antibodies could be more specific than monoclonal antibodies.
2. LocalizationlHeterogeneity While highly expressing tumor antigens are required for the specific targeting of cytotoxic agents with MAbs, other important factors are
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
307
the localization of MAbs to tumor cells in uiuo and their uniform penetration into the tumor. Quantitative analysis of the biodistribution of radiolabeled antibodies in patients is required as this provides an assessment of their tumor : normal tissue localization ratio and adequately defines the potential of that MAb to localize a particular cytotoxic agent to a particular tumor. MAbs that have been shown to localize to tumors in uiuo include anti-CEA antibodies to colorectal cancer (76,94),anti-PAP antibodies to prostatic cancer (95),anti-HMFG antibodies to breast cancer (96), MAb p97 to melanoma (97), and 791T/ 36 to bone and soft tissue sarcomas (98).However, radioimmunolocalization has revealed marked variation in the localization of antitumor antibodies in animal and human tumors (99, loo), some MAbs localizing in tumors at concentrations fivefold greater than that of normal tissues, others failing to selectively localize tumors at all in vivo. It is clearly important to coat many antigen-binding sites on the tumor with the drug-antibody conjugate and therefore deliver the maximum dose of drug to the tumor. Within a given tumor mass not all tumor cells are alike and individual cells may not express every tumor antigen and result in antigenic heterogeneity. Antitumor MAbs have not been demonstrated to bind to all the individual tumor cells in human tumor xenografts or patients, and autoradiography of tissue sections after localization of MAb 791T/36 in human osteogenic sarcoma xenografts revealed peripheral localization and low levels of penetration (98).The nonuniform distribution of anti-CEA antibodies and their F(ab‘), in colon carcinoma xenografts has been noted (94), and in patients l3lI-1abeled 791T/36 did not bind many colon carcinoma cells, but rather bound to tumor-pseudoacini and stroma (101). Thus the limitation ofany one MAb not only is due to the heterogeneity of antigen expression, but is also a reflection of its inability to bind every tumor cell due to poor access. Poor tumor vascularity and the inefficient transport of MAb across the capillary endothelium into the tumor may prevent MAbs from reaching every neoplastic cell in a solid tumor. Whether a mixture of several antitumor MAbs can overcome these difficulties is yet to be determined, although “cocktails” of several MAbs should reduce the more fundamental problem of antigen heterogeneity. In this regard, immunohistological staining and flow cytometry with MAbs have demonstrated the heterogeneity of tumor cell populations (both with regard to antigen density as well as the presence or absence of antigen) and emphasized that mixtures of several anticolon carcinoma antibodies can react with almost all colon carcinomas (102, 103). Of relevance is the study by Ceriani et al. which demonstrated an increased therapeutic effect of a cocktail of 1311labeled monoclonal antibodies against a breast xenograft compared
308
GEOFFREY A. PIETERSZ ET AL
to individual labeled antibodies (104). The use of such radionuclide antibody conjugates may overcome tumor heterogeneity by killing bystander tumor cells lacking antigen and provides a clear advantage for using isotopes in immunoconjugates rather than toxin or drugs. Cocktails of drug-antibody conjugates have also been used to investigate the potential of overcoming problems due to antigenic heterogeneity. A cocktail of up to three antibodies conjugated to Idarubicin was used against a human colon cancer xenograft in nude mice and it was found that combinations of the Ida-MAb conjugates were more effective antitumor agents than each conjugate alone (105).
D. INTERNALIZATION AND MODULATION Once localized at the tumor cell surface an immunoconjugate may exert its cytotoxic effect in several ways. First, the cytotoxic agent need not be released from the MAb to act; in macromolecular form it may exert a cytotoxic action either at the plasma membrane (e.g., phospholipase C) or following internalization. Alternatively, the drug or active drug-containing fragment of the conjugate may have to b e released to be active. This dissociation could occur in the extracellular space, at the cell surface, or intracellularly due to degradation by lysosomal enzymes. The latter mechanism of action requiring internalization of the drug-MAb conjugate and delivery to the lysosomes constitutes the “lysosomotropic” approach to drug targeting (106). The present status of MAbs, as carriers of cytotoxic agents, suggests that these reagents should ideally be internalized by tumor cells (100, 107). The pathways that MAbs use to enter different cell types have not been extensively studied, although the internalization of MAbs by leukemic, melanoma, and breast carcinoma cells has been examined (108-1 11).The fact that some toxin-MAb conjugates have poor cytotoxicity (112-114) may be due to the inability of certain antibodies to be endocytosed, either due to a low binding affinity or because the target antigen is not readily internalized. Indeed, a toxin-F(ab’)2 conjugate has been shown to be more cytotoxic than the corresponding Fab’ conjugate in uitro, suggesting that crosslinking of MAb-antigen complexes and endocytosis was important for this conjugate’s cytotoxic effect (115).The cell type may also influence internalization, as MAbs directed against different epitopes of the same target antigen on different cells induce different internalization responses (116). Also given that the A-chain fragments of toxin molecules such as ricin require translocation from an endosomal compartment to avoid deactivation by lysosomal enzymes, the proximity of the MAb-bound epitope to
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
309
the plasma membrane may have some bearing on the cytotoxic effect of some A-chain toxin-MAb conjugates. The availability of large panels of antitumor MAbs to different epitopes on target antigens is no guarantee of successful targeted chemotherapy, as antigenic modulation and/or immunoselection of antigen-negative tumor cells may prevent effective therapy. Antigenic modulation is defined as the redistribution of surface antigen after binding of antibody (117)and may involve internalization and degradation of the antigen or shedding of the antibody-antigen complex from the cell surface. The factors regulating antigenic modulation are not clear. Some antigens modulate rapidly, slowly, or not at all, others modulate when exposed to multiple antibodies directed against unrelated antigens (118). Loss ofantigen from the cell surface by internalization has posed problems for the use of’MAbs aIone in clinical therapy; however, the toxicity of some agents and the intracellular nature of their mechanism of action suggest that MAb-targeted cytotoxic agents could eradicate tumor cells which modulate by antigen internalization (119). In targeting surface antigens that are modulated by shedding, effective therapy may require that the cytotoxic agent be released from the surface-bound antibody before shedding occurs and that the agent be cytotoxic extracellularly, or intracellularly independent ofthe MAb. Selectivity may be compromised, however, and, therefore, target antigens that are modulated by cell-surface shedding are not good candidates for MAb-targeted chemotherapy. Immunoconjugates prepared using a noninternalizing antibody have also shown antitumor effects in mice. These conjugates used a vinca alkaloid derivative linked to antibody via a hydrazide linkage and antitumor efficacy was attributed to the release of drug at the tumor site (120). Another possible drawback for therapy by immunoconjugates is the presence of circulating tumor-associated antigens resulting from cellsurface shedding or tumor cell destruction. These bind conjugates in the serum before they have an opportunity to eradicate tumor cells. As an example, the presence of serum CEA has made MAbs against CEA difficult to use as diagnostic agents in vivo (121). Similarly, in B cell tumors with circulating monoclonal globulins and where the MAb is commonly directed against the idiotype of the antibody secreted by the tumor cell little may reach the tumor; some reduction in circulating antigen can be obtained by plasmaphoresis but the reduction is shortlived (122). Several novel strategies for targeting have been described and are based on the enzymatic activation of “prodrugs,” i.e., inactive forms of the drug which become active only when the drug is released. In
310
GEOFFREY A. PIETERSZ E T AL.
these studies enzymes such as alkaline phosphatase (123), or cytidine deaminase (124), can be coupled to monoclonal antibody and, after the complex localizes to the surface of tumor cells, a nontoxic prodrug is administered. These prodrugs are activated at the target site and diffuse into the tumor or act on the surface. For such therapy, MAbs to noninternalizing antigens are required.
E. SIZE One of the factors that controls the uptake of MAb by the tumor is the permeability across the capillary wall of tumor blood vessels which may have varying types of endothelium, depending on the site and origin of the tumor. The capillaries in tumors have been shown to be “leaky,” at least to proteins, and it is therefore assumed that they are relatively permeable to MAb; this may not apply to all parts of all tumors, and therefore measures which increase permeability, reduce the size of the cytotoxic agent-MAb conjugate, and define its shape and charge must all be considered. Some emphasis has been placed on reducing conjugate size by using antibody fragments: F(ab’), (MW -110 kDa) and Fab’ (MW -55 kDa) are smaller than intact immunoglobulin IgG (MW -150 kDa) and therefore may permeate into tumors more easily. Radioimmunolocalization studies demonstrate that antibody fragments can give earlier and superior localization to intact MAbs (125);however, this is probably due to faster clearance of fragments from the blood, thereby reducing the background rather than giving absolutely higher levels of antibody in the tumor. In addition, cleaving the Fc portion from the antibody molecule should decrease nonspecific binding to nontumor cells possessing Fc receptors and reduce the immunogenicity of xenogeneic MAbs. Not only are fragments cleared more rapidly than intact IgG (126),but the lower affinity associated with univalent Fab’ binding reduced cytotoxicity of toxin-Fab’ conjugates compared with their corresponding divalent F(ab’), and intact IgG conjugates in uitro (127). The preparation of fully active fragments by current techniques (128) is not always easy, each antibody requiring optimization of fragmentation and activity testing in uitro and in uiuo. Therefore MAbs will vary with respect to the in uivo localization of their Fab’ and F(ab’), fragments depending on the particular behavior of the MAb after fragmentation or coupling to cytotoxic agents. Using a nontoxic derivative of the alkylating agent melphalan N-acetylmelphalan (N-AcMEL), fewer molecules of NAcMeL were coupled to F(ab’)z than intact MAb and the antitumor activity against a murine thymoma was only marginally better (129, 130).The use of F(ab‘), immunoconjugates may be useful and neces-
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
31 1
sary for drug conjugates of methotrexate, aminopterin, and other extremely toxic drugs. Immunoconjugates are sometimes more toxic than unbound drug unless F ( a l ~ ’fragments )~ are used as carriers (131, 132). Advances in the production of genetically engineered antibodies and antibody fragments may reduce some of the problems associated with antibody fragments produced by enzymatic methods (133). Fab and F(ab’), fragments have been expressed in transfected cells and more importantly chimeric fragments produced in this way may decrease the immunogenicity (see below) associated with the administration of murine antibody in humans (134, 135). Single-chain antigen-binding proteins (SCA) have also been engineered. These proteins consist of antibody V, and V, regions linked via a peptide (136). The SCAs retain full antigen-binding capacity with some decrease in binding affinity (137). In a study by Yokota et d.,the penetration of various immunoglobulin forms, IgG, F(ab‘),, Fab’, and sFv were compared in uiuo using autoradiography (138).The main conclusion from this study is that maximum penetration for sFv was at 0.5 hr while IgG reached maximum at 48-96 hr postinjection. The percentage injected dose per gram for IgG, F(ab‘)2, Fab’, and sFv were 27.2, 19.2, 3.7, and 1.7, respectively. Furthermore, this study showed that sFv penetrated more deeply (more distal from blood vessels) into the tumour than intact IgG. The smaller size and as a result the rapid clearance from the blood make sFv’s exceptional for coupling radioisotopes for immunoscintigraphy (139); their use as carriers of drugs still remains to be examined.
F. IMMUNOGENICITY AND TOXICITY OF IMMUNOCONJUGATES An antibody response develops in humans after the administration of mouse or rat MAb to tumors (140, 141), resulting in the presence of circulating human anti-immunoglobulin, HAMA. These human antibodies may, on repeated exposure to the originally administered xenogeneic antibodies, form immune complexes leading to hypersensitivity reactions (142),which preclude further immunotherapy. Surprisingly, however, a large amount (1.5-3 g) of foreign MAb has been injected into human subjects without signs of toxicity (50, 122). Immunogenic responses have been noted in more than half the patients receiving mouse antibodies, but few instances of a severe anaphylactic reaction have been recorded. Other relevant observations include the following: in one patient the therapeutic effect of the MAb was neutralized (143) and patients initially developed antibodies against the Fc determinants on mouse MAbs (142). In a Phase I study where a cocktail of three N-AcMEL-MAbs were administered using hepatic artery infu-
312
GEOFFREY A. PIETERSZ E T AL.
sion to patients with colorectal metastases, all patients produced a human anti-mouse response (144). Xenogeneic antibodies given to patients may have a serious limitation to the duration and effectiveness of targeted chemotherapy. Different measures have been used to overcome this problem including: chemical engineering or murine monoclonal antibodies by adding polyethylene glycol residues (145);the development of immunosuppressive treatment schedules with drugs or anti-T cell antibodies (146); the use of genetic engineering to produce stable and functional antibody from the fusion of mouse variable and human constant regions of immunoglobulin genes (147-149) or CDR grafting onto human framework regions (150);the prior administration of irrelevant MAbs to direct antiglobulin responses away from antibodies used to target the cytotoxic agent; and the use oftotally human MAbs. The production of human MAbs has had some success (151) and improved techniques should bring more encouraging results (152-154). Human MAbs should not elicit the same intensity of immune response as murine antibodies as there will be no protein from a foreign species. However, if patients receive (say) 1-2 g of antibody of a unique idiotype, then antiidiotype responses may develop. Nevertheless such antibodies should have enhanced therapeutic potential as carriers of cytotoxic agents . 111. Conjugation Chemistry
A. INTRODUCTION While MAbs with the appropriate immunologic specificity are necessary for successful targeting of cytotoxic agents to tumors, equally important is the method of conjugation (155,156).Prior to conjugating cytotoxic agents to MAbs, it is essential to know the available reactive groups on both the MAb and the cytotoxic agent. Antineoplastic drugs are of many different types and include antimetabolites, alkylating agents, DNA intercalators, and antimitotic agents, all of which have structures that can interfere with cancer cells, leading to cell death (157) (Table 111). The cytotoxic part of anticancer drugs is not usually amenable to chemical modification due to its binding to the target, and therefore close attention must be focused on the structure-activity of cytotoxic drugs when coupling them to MAbs. Reactive groups found on drug molecules that can be used to link to antibodies include amino groups, keto groups, vicinal hydroxyl groups, phenols, free hydroxyl groups, and side-chain carboxyl groups (Table IV). MAbs and interme-
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
313
TABLE 111 DRUGS USED IN ANTINEOPLASTIC DRUG-ANTIBOVY IMMUNOCONJUCATES
Antimetabolites
Alkylating agents
Antimitotic agents DNA intercalating agents
Miscellaneous agents
Methotrexate (158) 5-Fluorouracil (159) Cytosine arabinoside (159) Aminopterin (160) 5-Fluoro-2’-deoxyuridine (161) Chlorambucil (162) Melphalan (129) Mitoinycin C (163) Cisplatinum (164) Trenimon (165) Phenylenediamine mustard (166) Verrucarin (167) T2-toxin (168) Vinca alkaloids (169) Deacetyl colchicine (170) Podophyllotoxin (171) Daunomycin (172) Adriamycin (173) Bleomycin (174) Idarubicin (175) Macromomycin (176) Morpholinodoxorubicin (177) P-Rhodomycin (178) Carminomycin (179) N, N-Diniethyldaunorubicin (178) Rhodorubicin (178) Cytorhodin-S (180) Elliptiniuni acetate (181) Maytansine (182) Calicheamycin (183)
Note. References are in parentheses
diary carriers also contain many chemically reactive groups such as Eamino groups of lysine residues, a-amino groups, phenolic hydroxyl groups of tyrosine residues, carboxylic acid groups, sulphydryl groups of cysteine residues, cis-diols of carbohydrates, and imidazole groups of histidine residues (Table IV). Both cytotoxic drugs and MAbs could have potentially reactive groups located at, near, or distant from the biologically active site. Consequently it is not possible to control the covalent conjugation of cytotoxic agents to a particular amino acid at a specific location on the molecule. Thus the covalent modification of
314
GEOFFREY A. PIETERSZ ET AL
TABLE IV REACTIVEGROUPS FOUNDON DRUGSAND ANTIBODIES Drugs Amino Keto
Vicinal hydroxy Carboxyl
Antibodies
-NH2
Amino
,c\=o c-c I
Carboxyl
I
Sulphydryl
OH OH ---OH
-SH
Hydroxyl
II
0
Hydroxyl
-OH
Phenolic hydroxyl
Disulphide
OH
-S-S-
Phenolic hydroxyl
MAbs, utilizing the reactive groups, lacks selectivity and only a limited number of drug molecules can be conjugated without protein denaturation and reduced antibody activity. In this context, a strategy for covalent modification using the restricted location of oligosaccharide moieties on MAbs may offer some advantages (184). A novel method of protecting the antigen-binding site of monoclonal antibodies was reported (185) where antibody was first reacted with a large excess of 2, 3-dimethylmaleic anhydride and in a separate step reacted with the active ester of methotrexate. Subsequent removal of the 2,3dimethylamaleiyl groups led to conjugates with superior immunoreactivity than those formed by a one-step reaction with the methotrexate active ester. Such a procedure is attractive but has to be optimized for each antibody. A number of different conjugation procedures have evolved for linking cytotoxic agents to MAbs. The following represent the most commonly used and successful methods.
B. CONJUGATION STRATEGIES Many different methods have been used-designed for the different functional groups to be linked. On antibodies amino, carboxylic, and vicinal diols of sugar residues are available for linkage-on drugs it depends on the particular drug used. In general glutaraldehyde and
CHEMOIMMUNOCONJUCATES IN CANCER TREATMENT
315
l-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (ECDI) are not specific and inactivate both drug and antibody. Choosing the more appropriate linker from the others depends very much on the drug and following published procedures is recommended.
1 . Glutaraldehyde Glutaldehyde crosslinks free amino groups present on drugs and antibodies and can be carried out at neutral pH (6.0-8.0) using a wide range of amine-free buffers. The reaction mechanism involves Schiff base formation between one of the aldehyde groups of glutaraldehyde and the antibody amine groups (&-aminogroups of lysine), and between the other aldehyde group on glutaraldehyde and the amino group of the drug (Fig. 1). If stability of these bonds is required, the Schiff bases may be reduced with sodium borohydride or sodium cyanoborohydride. This procedure was described by Avrameas et al. (186)and later used by Hurwitz et al. (40) and Mohammed et al. (187) to bind anthracyclines to antibodies. As the modified groups on the drug and antibody are both amino, the undesirable feature of this procedure is the possible homopolymerization of drug or antibody molecules (i.e., crosslinking of each moiety to itself) to give large aggregates. Because of this problem and subsequent denaturation of antibody, this procedure is not widely used.
2. Periodate Oxidation This coupling reaction is suitable for the conjugation of free amino groups to a variety of sugar residues present on the drug, antibody, or a spacer and, like the glutaraldehyde reaction, is optimal at neutral pH and ambient temperature (Fig. 2 ) . Sodium periodate is generally
MoAb-NH,
+
0 II H-C -CH,CH,CH,-C
0 II
-H
MoAb-N=CH-CH,CH,CH,-CH=N-Drug
FIG.1. Clutaraldehyde reaction
+
H,N-Drug
3 16
GEOFFREY A. PIETERSZ ET AL.
MoAb-NH2 pH 9-9.5
MoAb
FIG.2. Periodate oxidation of a sugar moiety.
used to cleave sugar cis-diols, which can then react with the primary amine of the other participating molecule by Schiff base formation, at pH 9.5. This procedure has been most frequently used to conjugate drugs containing a-aminohydroxy or glycol groups (40, 188), but as these groups may be necessary for drug activity and the linkage formed cannot be readily cleaved in the lysosomes the procedure is not widely used.
3. Carbodiimides Carbodiimides are commonly used crosslinking agents, particularly with the development of the water-soluble carbodiimide ECDI. The reaction involves the conjugation of free amino and carboxyl groups at neutral pH where an excess of drug can be mixed with antibody and ECDI (189) (Fig. 3);carbodiimides usually activate carboxyl groups on drugs which then react with the available amino groups ofthe antibody. A potential disadvantage may arise from the presence of both carboxyl and amino groups on the antibody or drug; however, polymerization (190) may be reduced by a high ratio of drug to antibody or by the delayed introduction of the antibody. The use of ECDI to couple MTX to antibodies, however, appears to be inferior to the N-hydroxysuccini-
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
A
0 II
I
+
DRUG-C-OH
1
R -N= C =N
-R2
R2 I
O
N
DRUG-C-O-
C
I1
317
II I
NH
I
R‘
1
MoAb
B
DRUG - C-OH
0
Carbodi imi de
0
II
- NH,
)
-
,
DRUG -C-O-N
N-Hydrox ysucci ni mi de
0”
0 DRUG -C-
II
NH-MoAb
FIG.3. (A) Carbodiimide reaction. (B) Active ester method.
mide (NHS) method (191).The NHS method was designed to overcome the risk of unwanted crosslinkage by first activating the carboxylic acid group of the drug and then allowing the active intermediate thus formed to react with the amino groups of the antibody (Fig. 3 B ) . The active ester intermediate formed is stable to water hydrolysis in
318
GEOFFREY A. PIETERSZ E T AL.
aqueous solutions but susceptible to reaction with the amino groups. NHS has also been used to produce active ester intermediates for peptide synthesis (192)and to attach haptens to cell surfaces (193). In addition the active ester of MTX has been shown to react with MAb &-aminogroups at p H 8.4 to form stable conventional arnide linkages and also less-stable hydroxylamine-sensitive ester linkages, presumably b y reaction with carbohydrate hydroxyl groups (194),and it has been found that treatment of MTX conjugates with hydroxylamine results in conjugates with improved selectively.
4 . Cis-Acotinic Anhydride This conjugation procedure produces a conjugate that is stable at neutral pH, but is cleaved at acid pH (4.0-5.0) (Fig. 4) and it is therefore an ideal method for preparing a reagent stable in serum but activated in lysosomes, provided that the cytotoxic activity of the agent coupled is retained in the acid environment of the lysosome. The reaction is carried out in two steps using water-soluble carbodiimide in the first step and the amino-containing drug being substituted into the a-carboxyl group of cis-aconitic anhydride at alkaline pH. The ycarboxyl group of the remaining intermediate is then conjugated to the MAb using ECDI. Reducing the pH to 4.0 causes spontaneous cleavage of the drug-amide bond linked via the N-cis-aconityl group
>y COOH
DRUG-NH,
+
0”
cis-Acotinic anhydride
’”’ DRUG
COOH
>
- NH H
-+O
T
F-NH
NH - MOAb
FIG.4. Cis-acotinic anhydride reaction.
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
319
to the MAb (155, 195). When ECDI is used for the second step, the problem of homopolymerization mentioned above may arise and, therefore, an active ester derivative of the intermediate could be synthesized (NHS) prior to reaction with the MAb (196).
5. Mixed Anhydride This reaction procedure is simple and can be adapted for use in aqueous solutions and does not require the preparation and isolation of active derivatives. The drug, containing a terminal free carboxylic acid group, is activated with isobutylchloroformate to form a mixed anhydride which can then react directly with a primary amino group on the MAb. The procedure was originally used for peptide synthesis and the conjugation of steroid hormones to proteins. MTX has been coupled to MAbs in this way; however, different antitumor effects have been obtained by different of investigators (191, 197, 198) and in general low levels of MTX incorporation and reduced ability to inhibit dihydrofolate reductase (DHFR) have been observed.
6 . Diazo Reaction This procedure is suitable when the drug contains an aromatic amine or diamine which can be converted to the diazonium salt by the addition of nitrous acid. The diazonium salt is then conjugated directly to the tyrosine, histidine, tryptophan, and occasionally lysine residues of the antibody at pH 9.0. Early attempts to couple MTX to immunoglobulins for immunochemotherapy were based on the diazo reaction (36, 199, 200); however, extensive precipitation and numerous sidechain reactions resulting from intraprotein and interprotein have not led to widespread use of this procedure (191, 201, 202).
7. N-Succinimidyl 3-(2-Pyridyldithio)Propionate (SPDP) The design of this crosslinker is such that it is possible to introduce activated sulphydryl groups into both the antibody and cytotoxic agent and then conjugate them by disulfide bridge formation (Fig. 5). The SPDP reacts with primary amino groups on the drug and/or antibody molecules. Following the reaction of this primary amino group, the pyridyldisulfide can be cleaved under mild reducing conditions in either the cytotoxic agent or the antibody. The newly formed free sulfydryl group on one component is then linked spontaneously to the remaining activated sulfydryl group on the other, care being taken to remove the reducing agent before the second step. The disulfide bridge formed between the antibody and cytotoxic agent is readily cleaved in the intracellular environment; however, it may also be
320
GEOFFREY A. PIETERSZ ET AL.
0
II
Ab-NH-C-CH2CH2S-S-
1
HS-TOXIN
0
II
Ab-NH-C-CH,CH,S
-S-
A
TOXIN A
FIG.5. SPDP reaction.
labile in the serum, dissociating before the conjugate reaches the tumor cell (203, 204). SPDP has been most commonly used to bind the primary amino groups of antibodies and by disulfide exchange it reacts with either the -SH group on the A-chain of toxins or the SPDP derivatized whole toxin (205, 206). 8. Imidoesters
Antibodies can be conjugated via the &-aminogroups to an imidoester in aqueous solutions at slightly alkaline pH (Fig. 6) resulting in an amidine product that retains the positive charge, thereby providing greater stability and solubility under alkaline conditions. Thus,
+NH, HS-CH,-
CH,-
CH,-
1 I
ci-
C-OCH,
>-
MoAb-NH,
'NH2Ci
HS-CH2-
CH2-
CH2-
II
c
I
NH
I
MoAb
FIG.6 . Imidoester reaction.
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
32 1
if the imidoester has an -SH group (e.g., 2-iminothiolane, methyl-3mercaptopropionimidate), it can be used as a bifunctional agent to link antibodies or cytotoxic agents (containing -SH groups) to drugs or antibodies (containing amino groups) by disulfide bond formation under oxidative conditions (207).
9. Thioether Linkage The reaction occurs between a sulfydryl group (e.g., Fab’-SH) and the double bond of maleimide moiety resulting in a stable thioether (C-S-C) crosslinkage (Fig. 7). Heterobifunctional crosslinking agents such as m-maleimidobenzoic acid N-hydroxysuccinimide ester (MBS) and succinimidyl 4-(pmaleimidopheny1)butyrate (SMPB) containing sulfydryl-reactive maleimide groups and amino-reactive groups can be used to conjugate cytotoxic agents and antibodies (156, 208). The linkage is stable to the reducing conditions of human serum for several hours; however, because the bond is not readily degradable in the endosomes, the cytotoxicity of some conjugates may be reduced (112), e.g., A-chain toxins. Thioether linkages can also be formed by conjugating whole toxin to an active ester of iodoacetic acid and reacting thiolated antibody, thereby blocking galactose binding on the B-chain of the toxin (209). A similar procedure was also used to couple MTXsubstituted human serum albumin (HSA)to iodoacetyl-substituted antibody (210). 10. Cyanuric Chloride
In this reaction, the chloride moiety in the cyanuric chloride molecule can be readily substituted by alcohols (sugars, carbohydrates) while primary amino groups on drugs and antibodies can substitute into another of the chloride positions on the bound cyanuric chloride derivative. This procedure has been used extensively in the production of nonimmunogenic conjugates of enzymes and polyethylene glycols (211). Because the linkage formed between the drug and antibody would be irreversible, this procedure is unlikely to be useful for the targeted chemotherapy of tumors. 1 1 . Noncovalent Bonds Success has been reported with the alkylating agent, chlorambucil, physically adsorbed onto immunoglobulins without the formation of covalent bonds (37), and methods for noncovalently binding chlorambucil to antitumor antibodies at low pH and temperature have been described (212). The exact chemical nature of the noncovalently bound chlorambucil-antibody complexes has not been resolved but physical
322
GEOFFREY A. PIETERSZ ET AL.
A
0
MBS
Mo Ab-SH
‘
S-NoAb
B
0
0 I-CH,C-0-N
I-CH,C
0”
lodoecetic a c i d active ester
1 I
-NH-Ricin
1
MoAb-S-CH,C
0
II
-NH-Ricin
FIG.7. Thioether linkage (A) using MBS (B) using iodoacetic acid active ester.
linkages may include ionic bonds, hydrogen bonds, and weak interactions between dipoles. Because of its simplicity, this method has appeal. 12. Hydrazone Linkage
Hydrazides react readily with aldehydes and ketones at acidic pH to give hydrazones. For example, using periodate oxidation, the hinge region carbohydrate of immunoglobulins can be modified to produce aldehydes which can react with hydrazide derivatives of drugs. Drugs
CHEMOI M h.I UNOCONJUGATES IN CANCER TREATMENT
323
containing ester or carboxylic acid groups can be readily converted to hydrazides by reaction with hydrazine. MTX and vinca alkaloids have been linked to MAbs in this way (131, 213).
13. Ester Linkage Hydroxyl group-containing anticancer drugs are most easily conjugated to antibodies by first forming an ester with either succinic or glutaric anhydride, and the free carboxyl group of the succinate ester or glutarate ester may be then linked to MAb via an active ester. 5-Fluorodeoxyuridine (161), vinblastine (214), and podophyllotoxin (171)have been linked to MAbs using this method and Hermentin et at. (178) linked a series of anthracyclines to MAbs via maleimidobenzoyl derivatives. The versatility of this method is that the substituents on the phenyl ring may be manipulated to change the stability or rate of hydrolysis of the ester to release the free drug.
14. Photoactivation
A novel release mechanism of conjugated agents is photoactivation. Gottmacher et al. conjugated pokeweed antiviral protein to an antitransferrin receptor antibody via a o-nitrobenzyl derivative and, after internalization into HeLa cells, irradiation with 350 nm uv resulted in target-specific killing due to literation of free pokeweed antiviral protein. Since noninternalized conjugate, when irradiated, releases pokeweed antiviral protein, which cannot be internalized, nonspecific toxicity was not apparent.
C. THEUSEOF INTERMEDIARY CARRIERS Since most drugs are generally less cytotoxic than plant and bacterial toxins, drug-carrier systems have been introduced which greatly increase the number of drug molecules coupled to an antitumor MAb. This involves coupling drug molecules to a carrier molecule, which has multiple reactive sites, and then linking this complex to a MAb. A variety of carriers have been used for drug conjugation including human serum albumin, dextran (polyaldehyde and amino), p o l y - ~ glutamic acid (PGA), poly-L-lysine, and poly-L-aspartic acid. HSA has been widely used because it has a defined and appropriate molecular weight, large numbers of both free carboxyl and amino groups for easy chemical substitution, and good biological stability in aqueous solutions and in several organic solvents. For example, MTX conjugates using HSA carrier has been produced with MAbs at ratios of 30-40 molecules of drug/molecule of antibody (210, 216). Th’is compares favorably with a 10 to 1 ratio obtained when MTX was directly
324
GEOFFREY A. PIETERSZ ET AL.
linked to antibody (217). Dextran as a carrier for chemotherapeutic drugs has several advantages in that there are no limitations on its chemical derivitization (218), and as it is a nondigestable polymer it is suitable for human use. Generally carriers have been conjugated using cytotoxic agents and MAbs by one or more of the methods outlined above. For example, cytosine l-0-D-arabinoside was linked to periodate-oxidized dextran and fluorouridine to amino dextran hydrazide (159,219). These derivatives were in turn linked to MAbs, the latter via glutaraldehyde (219), and both drug-antibody conjugates maintained the majority of the original antibody activity and drug cytotoxicity. Bleomycin, a potent anticancer glycopeptide antibiotic, has been linked with MAbs to polyaldehyde dextran by Schiff base formation and subsequent reduction with sodium borohydride (174). The conjugate contained an average of 57 molecules of bleomycin per molecule of MAb and was more cytotoxic than bleomycin itself to antibody-reactive cells. Despite difficulties in consistently preparing and purifying drugcarrier-antibody conjugates, many have displayed highly specific and cytotoxic properties in vitro. To date, however, few have demonstrated enhanced antitumor activities in uivo against human tumor xenografts in nude mice (59, 220, 221). Indeed in uivo problems such as poor tumor localization, rapid clearance from the circulation, and nonspecific toxicity to the reticuloendothelial system may result, depending on the size, biological nature, and stability of the intermediate carrier used. Also, future clinical studies would have to consider the possibility of chronic toxicity and immunogenicity with cytotoxic agents directly linked to MAbs.
D. STRATEGY OF DESIGN When using MAbs as carriers of cytotoxic agents, it is necessary that following conjugation, the antibody and drug retain both specificity and cytotoxic activity, respectively. Conjugation aims to introduce the maximum number of drug molecules under conditions which ensure optimal retention ofboth drug and antibody activity. Most antineoplastic agents are hydrophobic or hydrophilic structures and when conjugated to MAbs give rise to neutral linkages and reduced antibody solubility causing aggregation and precipitation. Generally, substitution ratios ofgreater than 20 : 1with IgG antibodies produce a considerable loss of antibody activity. However, substitution of as few as 3-4 drug residues/antibodymolecule may sometimes be sufficient to cause antibody denaturation. However, it is hard to make generalizations as
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
325
each antibody is different. For example, a drug incorporation of only 3 : 1was achieved when desacetylvinblastine azide was conjugated to an anti-CEA antibody, whereas antibody activity could be retained with ratios of 10: 1 when antimelanoma antibody 96.5 was coupled (59).The degree of substitution is important because conjugates that contain hydrophobic drugs may be nonspecifically adsorbed onto normal cell surfaces when incorporation ratios are too high (222). In addition attention must be paid to the nature of the bond between the cytotoxic agent and the MAb. It might be that the drug does not display cytotoxicity while still conjugated to the antibody and that cleavage of the linkage to release free drug is necessary for drug action. In these circumstances the bond must be stable in the blood and normal tissues, but sensitive to intracellular breakdown, such that the drug can be released and bind its target. Conditions of the conjugation, such as temperature, pH, time, and protection of sensitive sites must therefore be considered. Other factors, such as conjugate biodegradation, elimination, and possible toxic side products must also be addressed. For example, the A-chain of ricin has been coupled to MAbs via a number of different bridging structures and conjugates which were less susceptible to reduction in the circulation demonstrated greater half-lives and comparable cytotoxicities in vivo (203).Because the fate of most molecules bound by surface receptors is to b e internalized and conveyed to the lysosomes for digestion, lysosomal hydrolysis has been sought as a means of releasing the drug from the antibody or carrier molecule. For this purpose a pH-sensitive cis-acotinyl spacer has been used to couple carriers (223)to daunomycin (DM), a cytotoxic intercalating agent which has the properties of lysosomal resistance (13)and transmembrane diffusability (224) needed for effective action after intralysosomal release. Indeed all drugs that are not inactivated in lysosomes are candidates for lysosomal delivery, provided their properties allow them to transverse the lysosomal membrane to their final intracellular target. In addition to improving therapeutic responses, the stable conjugation of cytotoxic agents to MAbs often results in a significant reduction in toxicity to normal tissues. For example, acute toxicity tests with VDS indicated an LD,, of 6.7 mg/kg, whereas no significant toxicity was observed at doses up to 90 mg/kg when VDS was linked to antibody (225). If specific cytotoxicity to tumor cells can be obtained by conjugating highly potent drugs or toxins to MAbs, then many cytotoxic agents previously considered to be too toxic for clinical use should be reconsidered for conjugation to antibodies.
326
GEOFFREY A. PIETERSZ ET AL
IV. Drug-Monoclonal Antibody Conjugates
A. PRECLINICAL TESTING
1 . In Vitro Activity
The nature of the antibody, the drug and the method of conjugation can limit the number of cytotoxic molecules that can be bound to an antibody molecule, and it is crucial that the activity of each moiety be measured at each stage of the procedure. Quantitation of drug molecules incorporated is usually performed by absorption spectrophotometry, and the wavelength at which the drug chromophore absorbs is chosen to determine concentration from the known extinction coefficient. However, if radiolabeled drug is available it can be used as a tracer to obtain the concentration following conjugation to antibody. Antibody concentration can be determined using a radiolabeled tracer or by dye-binding assays (226). Efforts should be made to quantitate the proportion of drug covalently bound versus that noncovalently bound to antibody, as noncovalent bonds may be broken in uiuo. Conjugate preparations must be assessed for retention of both antibody and cytotoxic activity to accurately determine the value of the conjugation strategy. Assessment of drug activity in the conjugate should be based on the mode of antitumor activity, with regard for the possible synergism between the drug and the antibody. A number of assays are available including the more common inhibition of incorporation of radiolabeled precursors into proteins (227), DNA or RNA (228), dyeexclusion assays (229), clonogenic assays (210), tetrazolium assays (230),or direct testing (231).Comparisons between conjugate, mixtures of drug and antibody, and either agent alone should be included in these experiments together with appropriate controls using nonreactive antibody with drug attached. Currently, a number of serological assays are used to measure antibody activity including rosetting (232), flow cytometry (233),and radioimmunoassay (234).In addition, testing conjugate preparations in uiuo is critical, because in uitro tests occur under conditions of optimal cell binding and in the absence of various physiological and anatomical barriers that are encountered in uivo. 2 . In Viuo Activity It is difficult to predict the in oiuo success of antitumor therapy on the basis of in uitro results, shown by the relative potency of different toxin antibody conjugates in uitro and in uiuo (235). The most simple in uiuo model is to inject tumor cells intraperitoneally into animals and then subject them to various local treatments with immunoconju-
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
327
gates. In addition to the conjugate-treated group of animals, controls such as untreated animals and those treated with drug alone, antibody alone, a mixture of drug and antibody, or an unreactive drug-antibody conjugate should be included. In these experiments the first appearance of tumor, the survival of tumor-bearing mice, or the histopathological appearance of tumor can be taken into account when determining the antitumor efficacy of the conjugate. In most cases, however, this type of tumor in animals is not typical of ascites tumors in humans, because the conjugate and the tumor can interact freely. For this reason, an established (i.e., diameter 0.25-1 cm) subcutaneously growing tumor is a more realistic test of the specificity and localizing ability of a drug-antibody conjugate. Treatment can be given by various routes and at different time intervals after tumor inoculation. In this case, measurement of tumor size, weight, or cell number; survival of tumor-bearing animals; histopathological appearance of the tumor; antigen expression before and after treatment; and conjugate localization in the tumor are desirable parameters to be measured. The use of congenic strains of inbred mice where the tumor is not rejected by the mouse, yet carries an antigen or allelic counterpart not found in the mouse, has advantages in that truly tumor-specific systems can be investigated (236-238). Similar to this is the use of human tumor xenografts growing in athymic nude mice, where the mouse antihuman tumor antibody conjugates react with the human xenograft but not the host mouse (217). More recently, immunoconjugate efficacy has been tested in severe combined immunodeficient (SCID) mice (239). The advantage of using SCID rather than nude mice is the ability to more easily graft human tumor cells in comparison to nude mice (240). Ghetie et al. used SCID mice injected intravenously with daudi cells to assess the potency of deglycosylated ricin A-chain antiCD22 and anti-CD19 immunotoxins in a disseminated tumor model (241). A disseminated tumor model has also been established using a murine thymoma in a congenic strain of mice to study the efficacy of Ida-MAb conjugates (242). Several cell lines have been developed by transfection of target antigen DNA into cell lines that normally do not produce the antigen. These cell lines are particularly useful for testing immunoconjugates that react with tumors that do not grow i n vivo. Mucin-l-expressing 3T3 cells have been developed and used in studies to test anti-breast cancer antibodies and conjugates (243). Human CD19 transfected into the 300B4 murine B cell lymphoma line, c-erbB-2, CEA, and placental alkaline phosphatase transfected into murine cell lines are other example (244-246). Cross-reactions with normal tissues and nonspecific drug toxicity can also be monitored
328
GEOFFREY A. PIETERSZ ET AL.
by LD, experiments, organ function tests, histological examination of organs, blood counts, or the in vitro and in vivo determination of conjugate stability. Most animal tumors are not entirely satisfactory models of human malignancies as they are nonmetastasizing and only recently have good metastatic models become available (247, 248). Despite some doubts, murine tumor models continue to play a major role in optimizing dosage and administration schedules and developing new drugs and their conjugates to their full potential as clinically active antineoplastic agents. B. MAJORTYPES OF CONJUGATE
The following section briefly reviews the major types of drug-antibody conjugates tested thus far in preclinical studies. 1. Alkylating Agent-Antibody Conjugates For therapeutic use, alkylating agents, both aliphatic and aromatic, constitute a group of highly reactive drugs capable of reacting with nucleophilic (-NH,,-SH) groups common in cells. Although these agents can alkylate low- and high-molecular-weight molecules (e.g., proteins and nucleic acids), the greater cytotoxicity of polyfunctional alkylating agents is brought about by crosslinking DNA through the 7position of guanine in neighboring strands. Although several alkylating agents such as chlorambucil (CBL), melphalan (MEL), and cisplatinum (cis-DDP) (Fig. 8) have been used clinically against a variety of cancers (249-251), these agents are not selective in their action and thus have limited chemotherapeutic potential. Consequently, a number of the clinically used alkylating agents have been coupled to antibodies in an attempt to increase their therapeutic index.
a. Chlorambucil CBL (Fig. 8) is the phenylbutyrate derivative of nitrogen mustard and is used clinically in the treatment of chronic lymphocytic leukemia, Hodgkin’s disease, and ovarian carcinoma. CBL is relatively easy to couple to antibodies with a retention of biological activity (39) and CBL was intially bound to immunoglobulins via noncovalent linkages simply by mixing the two (37).Later, methods for noncovalently binding CBL to antitumor globulins at low pH and temperature (212)and alkaline p H (252) were described. In both cases, minimal retention of antibody activity occurred above 10 molecules of CBL/molecule of antitumor antibody, and tumor cell inhibition was variable. For example using the method of Blakeslee et a2. (253),Tunget al. (254)noncova-
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
329
/NH2
CI
2pt\ NH2
?&-PLATINUM
MITOMYCIN C
0
II
0
c’-. Na I I
CI
II0
MELPHALAN
TREN I MON
CI’
PHENYLENEDIAMMINE MUSTARD
CI’
CBLORAMBUC I L
FIG.8. Structure of alkylating agents that have been coupled to antibodies.
330
GEOFFREY A. PIETERSZ ET AL.
lently associated CBL to purified antiidiotypic IgM antibodies. The resulting conjugates were demonstrated to more effectively lyse target cells than either CBL or antiidiotypic antibodies alone. To covalently conjugate CBL to antibody, Ross (255) used water-soluble carbodiimide and low temperatures, thereby leaving the cytotoxic bis-2chloroethylamino group active. The effect of these conjugates was no more pronounced than the noncovalent complexes, although it was demonstrated that antibody affinity was retained when 10-15 molecules of CBL were incorporated. To lessen intra- and intermolecular protein crosslinkage, ECDI was added to CBL before the antibody was added. Another method used dextran as an intermediary between CBL and antibody (256) by conjugating CBL to amino dextran and then linking the resulting conjugate to IgG was glutaraldehyde. A ratio of 14 molecules of CBL:B molecules of dextran/molecule of antibody was obtained, with the conjugates retaining antibody activity and being able to cause target cell inhibition in uiuo. This study, however, was incomplete, in that drug alone was not used as a control and there was no evidence of targeting of the drug in suitable tumor models. Taking into account that the above-mentioned studies reported activity that could have been due to the presence of noncovalently bound aggregates of the drug (253), and that methods using ECDI could lead to polymerization of the antibody, a method using the isocyanate derivative of CBL was devised (257). By coupling the isocyanate derivative of CBL to anti-CEA antibodies, conjugates (molar ratio 25 : 1) were demonstrated to be specifically cytotoxic to CEApositive cells. As yet, no in uivo studies of these conjugates against established solid tumors have been reported. An alternative approach was used by Smyth et al. (162) by first preparing an activated carboxy derivative of CBL by the NHS method and then reacting it in a second step with antibody, thereby reducing protein crosslinkage. In this study, it was shown that the covalently linked CBL-antibody conjugates were only marginally better than a mixture of CBL and monoclonal antibody. CBL is easy to couple to antibodies, but because of its low cytotoxicity ( ICm lo-’ M ) its use in targeted chemotherapy may be limited to small tumors or to those growing in ascites form.
-
b. Melphalan The phenylalanine mustard, MEL (Fig. B), is used clinically in the
treatment of melanoma, breast cancer, ovarian cancer, and multiple myeloma. MEL has been a difficult drug to couple to antibodies because of its bifunctional nature (carboxylic acid and amino groups), and only one attempt using a PGA carrier to couple MEL to antibodies
CHEMOIMM UNOCONJUGATES IN CANCER TREATMENT
33 1
has been documented (258).The method first described by Rowland et at. (259) was prepared by reacting PGA with ECDI and MEL at room temperature. The PGA-MEL complex was then coupled to antilymphocyte globulin via free carboxylic acid groups on the complex and amino groups on the antibody, using ECDI. The MEL-carrier-antibody conjugate inhibited proliferative responses in human mixed lymphocyte cultures and the ability of mixed lymphocyte culture-activated T effector cells to lyse 'lcr-labeled lymphoblast target cells. However, when similar conjugates were tested for their ability to prolong the survival of pancreatic allografts in rats and kidney allografts in rabbits they were inefyective. In one study (129), MEL was coupled to the murine MAb using a novel prodrug approach-MEL was inactivated by synthesizing the N-AcMEL derivative and then coupled to antibody using an active ester derivative. Interestingly, coupling N-AcMEL to MAb yielded conjugates only four-fold less cytotoxic than MEL itself. In vivo these conjugates and conjugates made using F(ab')2 fragments were superior to MEL or N-AcMEL in decreasing the growth of established subcutaneous tumors (130).
c. Phenylenediamine Mustard (Fig. 8) This alkylating agent has been coupled to anti-EL4 lymphoma globulin by two different linkages, both involving intermediary carriers. Rowland et ul. (259) covalently linked amino groups of phenylenediamine mustard to PGA using carbodiimide, then coupled this complex to amino groups of the antibody by ECDI. These conjugates prolonged the survival of EL4 tumor-inoculated mice compared with those groups of mice receiving drug or antibody alone; however, treatments and tumor cells were both injected into the intraperitoneal cavity. Using another carrier, dextran, phenylenediamine mustard was coupled to anti-EL4 lymphoma antibodies by a two-step procedure. Phenylenediamine mustard was initially bound to dextran by cyanogen bromide, and this conjugate's free amino groups were coupled to those of the antibody using glutaraldehyde (256).The conjugate was more effective than drug or antibody alone in viuo; however, more extensive and critical murine tumor models were not explored. d . Trenimon (Fig. 8) Trenimon (triaziquinone) was conjugated to rabbit anti-hamster sarcoma antibodies by reducing the antibody with dithiothreitol to produce free sulphydryl groups that could be substituted into the 6position of the trenimon benzoquinone ring (260). Only one to two molecules of trenimon were incorporated/molecule of antibody, and
332
GEOFFREY A. PIETERSZ ET AL.
potential difficulties existed in reducing sulphydryl groups of the antibody. Using dithiothreitol, the IgG may be weakened or degraded into its component heavy and light chain if interchain rather than intrachain cleavage occurs, thereby causing reduced antibody activity and subsequent nonspecific toxicity to normal tissues. An alternative procedure was described in which new sulphur groups were incorporated into the antibody using DL-N-acetylhomocysteinethiolactone (261, 262), but no in vitro or in uivo data were reported.
Cis-Platinum ( F i g . 8) Platinum complexes such as those formed by condensing with amines or diaminocyclohexanes have been developed, which have less nonspecific toxicity (263), but their efficacy as antineoplastic agents is limited. Hurwitz et al. (251) demonstrated that complexes formed by simply incubating platinum salts (cis-DDP and K2PtC14) and antibodies at room temperature for several hours retained antibody activity and could inhibit DNA synthesis. The demonstration that platinum-antibody conjugates had greater activity than free platinum salts is difficult to explain, given that the reaction of cis-DDP with antibody amino groups would probably remove the DNA-reactive chloro groups of cis-DDP. A more attractive alternative method for coupling cisDDP using DTPA chelate has been reported (164); these conjugates were shown not only to be stable, but also to retain antibody activity and selective cytotoxicity. e.
f.Mitomycin C
The potent alkylating agent, mitomycin C (MMC), was first coupled to antibodies by initially activating an anti-AFP antibody with a 25to 50-fold excess of cyanogen bromide at pH 11.0 and then adding MMC at pH 7.5 (264). Although conjugates formed in this manner retained 25% of MMC cytotoxicity and 50% of anti-AFP antibody activity, only 1molecule of MMC could be incorporated/molecule of antibody and it is unlikely that therapeutic levels of MMC could effectively be delivered to tumor cells using this procedure. MMC was also conjugated to an affinity-purified horse antibody to human AFP with HSA as an intermediate carrier (265). This involved coupling MMC at the aziridine nitrogen atom to HSA through a glutaric acid-derived spacer arm, thereby forming cleavable aziridyl amide bonds between MMC and HSA. MMC-HSA was then conjugated via the single free thiol group of HSA to maleimide-modified antibody. The conjugates (antiAFP-HSA-MMC), molar ratio 1 : 1 : 30, retained completely antibody activity (by competitive radioimmunoassay) and retarded tumor
C H E M O I M M U N O C O N J U G A T E S IN C A N C E R T R E A T M E N T
333
growth of established human ovarian yolk sac tumors more effectively than free MMC or a normal horse immunoglobulin-MMC conjugate (221). Importantly, the anti-AFP conjugate injected intraperitoneally reduced subcutaneous tumor growth and lowered serum AFP levels, thereby demonstrating the localizing ability of this drug-carrier-antibody conjugate Dextran-T40 has also been used as an intermediary for loading more MMC onto antibodies (226). Up to 20 molecules of MMC were attached to a anti-gastric cancer antibody with good retention of MAb activity. The MMC conjugates were capable of inhibiting the growth of gastric tumors implanted in the subrenal capsule of nude mice. Alkylating agents are generally not very cytotoxic and therefore are not the ideal drugs to use in drug-antibody conjugates. In addition alkylating agents are very reactive with proteins including serum proteins and immunoconjugates and this event would decrease the amount of active conjugate in the circulation (267).
2 . Anthracycline-Antibody Conjugates Daunomycin and its hydroxy derivative adriamycin (AD) are members of the anthracycline class of antitumor agents (Fig. 9). Both have a broad spectrum of activity against a variety of solid tumors; however, bone marrow toxicity (268) and cardiotoxicity (with prolonged treatment) (269, 270) hinder treatment and a number of less-cardiotoxic anthracycline analogs have been introduced. Attention has also focused on coupling DM and AD to antibodies for tumor-selective immu-
NH2
R =H
Daunomycin
R = OH Adriamycin
FIG.9. Structure of anthracyclines, daunomycin, and adriamycin.
334
GEOFFREY A. PIETERSZ E T AL.
nochemotherapy. The mechanism of action of anthracyclines has not been firmly established, but it is clear that DNA intercalation and possibly cell membrane interactions are involved. The highly cytotoxic nature, the suitable mechanism of cytotoxicity, and the many chemically amenable groups on anthracyclines suggest that these drugs should be ideal for targeted chemotherapy. Although a number of methods for coupling DM to antibodies have been successful, coupling of antibodies to AD, a less-soluble and stable compound, has been difficult. The basic coupling strategies that have been used to couple these anthracyclines to antibodies have involved using the sugar moiety, the amino group, or the keto group of these drugs and in many cases intermediary carriers have been used.
a. Direct Conjugation i. Sugar Moiety. Periodate oxidation of DM cleaves the bond between the C-3 and the C-4 of the amino sugar (40) to produce carbonyl groups on the DM molecule capable of reacting with free amino groups on the antibody and reduction of the Schiff bases formed stabilized the bond. Up to two to five molecules of DM could be coupled per molecule of antibody, and conjugates demonstrated selective cytotoxicity to target tumor cells compared to a DM-bovine serum albumin (BSA) conjugate, DM or antibody alone, and drug and antibody given separately. However, in three different models tumors were pretreated with conjugates prior to their injection in vivo (271). Hurwitz et al., also covalently bound DM to F(ab’)2 fragments by the same method, but the resultant conjugates were no more effective than the intact antibody conjugated in vitro or in vivo (272). Further studies demonstrated that DM-antibody conjugates prepared in this manner were probably released within the tumor cell by enzymatic or acid hydrolysis (273), allowing the free drug to enter the nucleus. In contrast to the studies of Levy et al. (271), Latif et al. (198) found that direct conjugation of DM to anti-K-562 anibodies by periodate oxidation of the sugar moiety inhibited the antibody activity and reduced drug cytotoxicity. In addition, we found that by oxidizing the sugar moiety of A D and prior to coupling to MAbs, a conjugate devoid of cytotoxic activity was produced (156). ii. Sugar Amino Group. Probably the most straightforward approach to couple DM to antibodies has been the use of glutaraldehyde which can crosslink the sugar amino group of the drug and the free amino groups of the antibody. The use of this method produces conjugates containing 4 molecules of DM/antibody molecule which are more cytotoxic than either free drug or antibody (274). However, Hurwitz et al. (40) found that this procedure leads to extensive interprotein
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
335
crosslinking and aggregation. In this light, the studies of Lee et al. (275),which demonstrated that DM coupled to goat antibodies specific for guinea pig fibrin could completely eradicate 50% of subcutaneous tumors in guinea pigs, were surprising, although it is possible that by removing aggregated DM-antibody complexes and injecting the MC-D sarcomas intratumorally, good antitumor activity was achieved. A second method used carbodiimide to couple the sugar amino group of DM to the carboxylic acid groups of the antibody; however, conjugates produced by this method had completely lost their cytotoxic activity (40), probably because the amide bond between the amino group of DM and the carboxylic acid group ofantibody was not susceptible to intracellular enzymatic cleavage (273). It should be noted that both glutaraldehyde and water-soluble carbodiimide are unsatisfactory coupling reagents for the direct conjugation of AD to MAbs (156). However, in one report AD coupled to anti-CEA monoclonal or to polyclonal antibodies using water-soluble carbodiimide to give 1.2and 4.2-residue antibody molecules respectively, which had good in uivo activity, was reported. (276). The most successful approaches to directly conjugate DM to antibodies or carriers have involved the use of acid-sensitive spacers to link the amino group of DM to its carrier such that, on reaching the lysosomes, the active DM molecule is released. Shen et al., (277) demonstrated that by conjugating DM to a cis-aconityl spacer, then further modifying this derivative with carbodiimide, the amino groups of polyD-lysine could be reacted to produce DM-poly-D-lysine conjugate. Biochemical studies revealed that the conjugate entered the tumor cells and reached the lysosomes, where the acid environment caused the release of DM from poly-D-lysine. Subsequently, the use of cisaconityl spacers has been found to be a very effective conjugation procedure for directly linking DM and antitumor antibodies, with good retention of antibody activity and selective cytotoxicity to target tumor cells (155).This procedure was also used to couple DM to antigens which would subsequently bind to B lymphocytes both in uitro and in vivo (278) and lead to their inactivation. In addition, a T lymphocyte response to concanavalin A was selectively prevented by a DM-antiT cell-specific MAb conjugate containing an acid-sensitive cis-aconityl spacer (278). In addition, AD-antimelanoma MAb conjugates have been synthesized using an acid-sensitive cis-aconityl spacer. Conjugates retained activity similar to that ofunmodified antibody and inhibited 50% of [3H]thymidine uptake in tumor cells at an A D concentration of 200 nM (195). In uivo, these Ad-antimelanoma antibody conjugates effectively suppressed the growth of established human melanomas in athymic nude mice.
336
GEOFFREY A. PIETERSZ ET AL
Other spacers sensitive to lysosomal hydrolases have been used to link DM to protein carriers. Tri- and tetrapeptide spacers (Ala-LeuAla-Leu-DM) have been shown to bind succinylated BSA and yield conjugates active in uiuo (14). The in uivo activity displayed was more convincing than that observed when DM was indirectly linked to a carrier via a leucylarginylglucopyranosyl spacer (279). It should be noted that, in general, succinylation of MAbs may alter their binding properties, but the possibility of lysosome-sensitive spacers provides an interesting approach to selectively targeting anthracyclines to tumor cells with MAbs. Other types of linkages between the sugar amino group of anthracyclines and MAbs were used with three different derivatives of AD (156).Only an iodoacetyl AD-MAb conjugate was specifically cytotoxic to target tumor cells and reduced the growth of subcutaneously implanted murine thymomas (156). iii. C-14Methyl Group. To avoid using the sugar amino moiety in reaction-as it is probably essential for anthracycline activity-a new method for covalently binding DM to proteins using the C-14 methyl group side was devised (280), where attachment was achieved by a nucleophilic substitution reaction of 14-bromo-DM with the protein. It was found that DM linked to poly-L-aspartic acid (ester bonds) was more effective than DM bound to poly-L-lysine, demonstrating that the stability of the amine bond may prevent lysosomal degradation (15).Using the 14-bromo-DM derivative, DM was coupled to murine antitumor antibodies by two different methods (155).The first involved linking the 14-bromo-DM directly by substitution to antibody amino groups and the second procedure linked 14-bromo-DM to SPDPtreated antibody that was reduced with dithiothreitol, producing a thioether-bonded DM-antibody conjugate. With both conjugates molar ratios of drug to antibody were 3-4 : 1, however, thioether-linked conjugates were four to eight times less cytotoxic in uitro. When a more potent anthracycline derivative, was coupled to monoclonal antibody using the 14-bromo derivative, two to five residues were coupled with retention of satisfactory antibody activity and protein recovery (175). In uiuo, these conjugates were capable of eradicating large subcutaneously growing tumors in mice. iv. Hydroxyl Group. The coupling of anthracyclines using the hydroxyl group is only possible when the free amino group is not available and, this strategy was used to couple N,N’-dimethyldaunorubicin, rhodomycin, and rhodorubicin to antibody (178).These three anthracyclines were coupled to an anti-lung cancer antibody using a maleimidobenzoyl derivative where final linkage of the 5’-OH ester to antibody was via a thioether linkage. The versatility of this method involves
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
337
the lability of the ester group so that the rate of release of the anthracy-
cline could be controlled by adding various substituents onto the phenyl group. As yet no in vivo data are available on these conjugates. u. Keto Group. The keto group of anthracyclines is amenable to modification via a hydrazone linkage. The acid lability of hydrazone makes it an attractive site for linkage to MAb and subsequent release in the lysosomes. An adriamycin hydrazone derivative with pyridyldithio group was reacted to a thiolated anti-B cell lymphoma antibody. These adriamycin-antibody conjugates inhibited the growth of Daudi and Ramos tumor xenografts (281,282).In vitro studies demonstrated that the conjugates were stable at physiological pH by releasing adriamycin with T I , = 2.5 hr under acidic conditions (pH 4.5). Conjugate doses at the maximum tolerated dose of adriamycin inhibited the growth of tumors with some mice showing complete regression of tumor. Further studies by this group, using several other linkers to prepare conjugates, showed that the cytotoxic activity of the conjugates are dependent on the internalization of the MAb and the rate of release of drug. A synthetic analog of doxorubicin, morpholinodoxorubicin, was also linked to antibodies via the ketone group (177). Several derivatives adriamycin including oxime, phenylh ydrozone, (sulphonylphenyl) hydrozone, and arylhydrazone were synthesized and a correlation of cytotoxicity to hydrolytic stability was shown (283).
b. Use of Intermediary Curriers i. Dextran. Dextran was oxidized by periodate and the resulting polyaldehyde dextran reacted with DM and subsequently with antibody (284);the product was then reduced, taking care not to damage drug and antibody, and yielded 25 molecules drug/molecule antibody. The efficacy of these conjugates was tested extensively, in both the PC5 plasmacytoma and the YAC lymphoma murine tumor models (284). Only in the YAC lymphoma system, when conjugates were injected intravenously and tumor cells intraperitoneally, were the conjugates demonstrated to be more effective than equivalent doses of free drug. Tsukada et al. (285) further demonstrated the value of coupling polyaldehyde dextran to DM and antitumor antibodies when intravenous administration of DM-anti-AFP conjugates were shown to more efficiently delay tumor development than controls. This conjugate (50 molecules DM/molecule anti-AFP antibody) was tested against human yolk sac tumors in nude mice (286) at doses of 20 and 70 pg/mouse and led to moderate retardation of tumor growth compared to control groups. More impressive results were obtained when, in addition to conjugate treatment, a rat hepatoma was surgically resected (287),
338
GEOFFREY A. PIETERSZ ET AL.
suggesting that the conjugates may be limited to the treatment of small tumors; or for minimal residual disease-findings of relevance to the clinical use of these immunoconjugates. An alternative method of coupling using dextran was to leave the sugar amino group unmodified and to bind AD to a hydrazine derivative of dextran via its keto group, thus enabling dextran hydrazone to be attached to the antibody using glutaraldehyde as a crosslinking agent (288).Similarly DM-dextran-antibody conjugates were synthesized using dextran hydrazone (218). No in uiuo studies evaluating the effectiveness of either of these anthracycline-dextran-antibody conjugates with established animal tumors have been reported, possibly because these conjugates gradually become insoluble at high incorporation ratios, which restricts their in uiuo use. ii. Polyglutamic Acid. Tsukada et al. (289) developed a new method for coupling DM to antibodies using a novel thiol derivative of PGA as the intermediate drug carrier. This method has the assurance of binding the intermediary PGA molecule at only one site to the antibody molecule, thereby avoiding the possible formation of highmolecular-weight aggregates often encountered in previous methods using carriers. Typically 15-20 molecules of DM can be coupled per molecule of antibody using this method and conjugates retain high levels of antibody and drug activity in uitro. In uiuo studies investigating the effects of DM-PGA-anti-AFP conjugates on the growth of human hepatocellular carcinoma cells in nude mice were impressive; however, not dramatically more so than DM and antibody mixtures, DM-PGA, or DM alone (220). The anthracyclines and their analogs have been the most extensively used drugs for immunoconjugation and many methods have been used for their conjugation to antibodies. These drugs are very cytotoxic and numerous immunoconjugates have been most effective in animal models.
3. Folic Acid Antagonists The folate antagonist, MTX (Fig. 10) has good solubility and stability and is widely used in the treatment of human cancer (290). It is relatively easy to make substitutions on its free carboxylic acid group without markedly reducing its antifolate action (291)and has therefore been a satisfactory drug to use for the coupling of antibodies. MTX was first conjugated to antibodies by the diazo reaction; however, such conjugates prepared were less active in uitro than free drug, and extensive precipitation and side reactions occurred (36,191,201,202).
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
339
0
0
II
II
C - NH-CH-C-OH
I
I
R
CH,
R=H
Methotrexate Aminopterin
FIG.10. Structure of antirnetabolites, methotrexate, and arninopterin.
The NHS active ester method of linking M T X to antibodies was found to be more effective than either ECDI or a mixed anhydride of MTX for conjugation (191)and up to 10 molecules of MTX could be incorporated/molecule of antibody, with significant retention of antibody and drug activity. By contrast, only 2-3 molecules of MTX/molecule of antibody could be obtained using the mixed anhydride procedure (197) and there was little inhibition of DHFR. The ECDI procedure enabled partial retention of antibody and drug activities at 8 molecules of MTX/molecule of antibody (181);however, better results were demonstrated in uivo when MTX was conjugated to an IgM MAb to murine teratocarcinoma (292). In this study up to 45 molecules of MTX could be incorporated/molecule of IgM antibody, with retention of antibody activity and a selective cytotoxicity three to four times greater than that of MTX in uitro; no in vivo data were presented. Kanellos et al. (217) demonstrated that 8-13 molecules of MTX and 11 molecules the related drug, aminopterin, could be incorporated/molecule of MAb, using an active ester method (160). The specificity of these conjugates was shown in uitro, and their ability to impair the growth of murine tumors and human tumor xenografts was significant. An important pharmacokinetic study has been performed to assess the tumor localization of MTX-anti-PAP MAb conjugates prepared by the active ester method (293). This investigation revealed that [3H]MTX-anti-PAP conjugates accumulated five times more in human prostatic tumor xenografts than [3H]MTX or [3H]MTX-normal IgG
340
GEOFFREY A. PIETERSZ ET AL.
conjugates. However, liver and spleen contained larger amounts of tumor-specific conjugate than MTX or normal IgG conjugate, probably due to immune complex formation. T o carry a greater number of MTX molecules/antibody molecule, Garnett et al. coupled MTX to 791T/36 MAbs (to human osteogenic sarcoma) using an HSA intermediary (210); HSA was modified with SPDP and then coupled to MTX using ECDI. This MTX-HSA complex was then reduced with dithiothreitol and coupled (MTX-HSASH) to iodoacetylated 791T/36 MAb (N-succinimyl iodoacetate). Conjugates contained 32-96 MTX molecules-antibody molecule and achieved a cytotoxic effect equal to that of free MTX in vitro. Further studies elucidated that the conjugate specifically bound antigen, bound the surface of tumor cells, was internalized by endocytosis, and could be intracellularly degraded to release a small active drugprotein fragement or the drug itself (227). Improvements were made in the synthesis of MTX-HSA-MAb conjugates which have resulted in higher and more reproducible MTX substitution and greater cytotoxicity in vitro (294, 295). Despite the fact that these conjugates containing MTX are one of the most potent drug-antibody conjugates described to date in vitro (ICs0 of 4 ng/ml MTX concentration) their in vivo activity has not been impressive (59). Methotrexate and analogs are easy to conjugate and are very cytotoxic. However, it has been noted in animal models that both methotrexate and aminopterin conjugates are more toxic than free drug (296). However, at nontoxic doses aminopterin-antibody conjugates are very effective in reducing the growth of murine tumors in vivo (296).
4 . Vinca Alkaloids The ability of an anti-CEA antibody to enhance the cytotoxicity of the antimitotic agent, vincristine, in a 51Cr-releaseassay, using human lung tumor cells (297), prompted the conjugation of VDS (Fig. 11) to these antibodies (298). Conjugates were prepared from desacetylvinblastine hydrazide by conversion to the azide and reacting this derivative with antibody at p H 9.0 (299), where 4-6 molecules of VDS could be coupled/molecule of antibody. The conjugates could selectively inhibit the growth of target human tumor cells in vitro (300).In vivo a VDS-MAb conjugate reactive with CEA was then shown to suppress the growth of CEA+ human colorectal carcinoma (MAWl) xenografts (3011, although a free drug plus antibody control was not included in these studies, and it is difficult to assess the value of conjugate therapy, particularly as the antibody alone had significant antitumor effects. It
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
34 1
0 1
2
R = cHO, R
OCH,
3
R
OCCH,
Vincristine Vinblastine
= CH,
= OCH,
= OCCH3
:CHB
=NH2
: :
H
Vindesine
FIG.11. Structure of vinca alkaloids.
has also been demonstrated that VDS could be coupled to 791T/36 MAb to selectively inhibit osteogenic sarcoma cell lines (87).A larger study, using a number ofVDS-MAb conjugates prepared from desacetylvinblastine or by activating VDS hemisuccinate as the NHS ester (225),demonstrated the antitumor efficacy of these conjugates against a variety of human tumor xenografts. In particular, it was shown that lasting suppression of colorectal tumor growth could be achieved by repeated injections of VDS-anti-CEA MAb conjugates. In addition, pharmacokinetic studies using [3H]VDS indicated a long retention time in tumor tissue when VDS was conjugated to anti-CEA MAbs (302). In addition bispecific MAb recognizing both CEA and vinca alkaloids has been prepared (303).This approach does not require chemical
342
GEOFFREY A. PIETERSZ ET AL
modification of the antibody on conjugation, and the univalent nature of the tumor cell binding should reduce antigenic modulation and loss of tumor cell antigenicity. Mice injected with the bispecific MAb followed 2 weeks later with an intraperitoned injection of vinblastine demonstrated specific localization of vinca alkaloids to human colorectal tumor xenografts (304). However, it was difficult to define whether the antitumor effects demonstrated (305)were due to synergism between the vinca alkaloid and the hybrid MAb, although it was clear that unmodified vinblastine, targeted through one of the antigencombining sites of the hybrid MAb, was a potentially more effective antitumor agent than free vinblastine. It is doubtful that a sufficiently high concentration of vinca alkaloid could be achieved within tumor cells by administering drug and hybrid MAb separately, as the toxicity of circulating vinca alkaloids is likely to be limiting. This approach may be useful to target very cytotoxic drugs (e.g., calicheamycin) using bispecific antibodies with high affinity to drug and tumor antigen. Vincaalkaloid-antibody conjugates have been most extensively studied by the research group at Lilly Research Laboratories and used in clinical trials. The most potent conjugates were prepared using a hydrazide linkage, where the drug is released at the target cell by hydrolysis of this linkage. There are many different drugs which have already been conjugated to MAbs-Which is the best to use? Because of the relative safety with drug-antibody conjugates, the more potent drugs where large amounts can be conjugated should be examined. In this light, anthracyclines, potent folic acid analogs (e.g., aminopterin; AMN) and vinca analogs all are favored over alkylating agents.
5 . Highly Cytotoxic Drugs To overcome the limitation of the relatively small dose of immunoconjugate that reaches the tumor, efforts have been directed toward the production of highly cytotoxic drug immunoconjugates. These drugs, when given alone, cannot be used in patients due to their systemic toxicity; however, when linked to antibody they would bind specifically to tumors and may be safe for use in patients. Thus far, several agents such as 5-fluoro-2-deoxyuridine (306),aminopterin (296), calicheamycin (183),and maytansine (182)have been conjugated to MAbs. 5-Fluoro-2-deoxyuridine and aminopterin have both effectively reduced the growth of subcutaneous murine thymomas and human tumor xenografts in mice. N-acetyl calicheamycin y 1 was conjugated to an anti-mucin 1 antibody (hCTMol) and in an in vivo model for ovarian
343
CHEMOIMMUNOCONJUCATES IN CANCER TREATMENT
cancer several tumor regressions were observed (307). The safety of these highly toxic immunoconjugates in humans remains to be demonstrated. C.
CONCLUSIONS FROM USINGDRUC-ANTIBODY CONJUGATES PRECLINICAL STUDIES
IN
From extensive preclinical studies using drug-antibody conjugates both in vitro and in viuo, several conclusions could be drawn. (a) Loss ofdrug actiuity: In most cases linkage of drug to monoclonal antibody results in a loss of drug activity. An exception to this rule is chlorambucil, where an increase in activity is seen. The loss of activity can b e attributed to a number of reasons but is most likely due to the inefficient processing of drug-antibody conjugates by the lysosomal enzymes to release free drug. (b) Drug-MAb conjugates are speciJic: Drugs, when linked to antibodies, are selectively cytotoxic to tumor cells carrying the target antigen. The selectivity ranging from 5-to 10fold depending on the drug and antitumor effects are evident in uivo in mice treated with a tumor nonreactive conjugate. Such in vitro and in vivo target cell specificity or selectivity encourages the use of highly cytotoxic drugs that have harmful toxic effects when used alone. (c) Luck of toxicity in viuo: Drugs linked to antibodies are usually less toxic than free drugs. Further, the maximum tolerated dose for drug-MAb conjugates is several fold higher than that for the corresponding free drug. For example, in our studies with idarubicin a total dose of 45 k g idarubicin-anti-CD19 given in three doses showed impressive antitumor activity in nude mice bearing lymphoma xenografts, while the same dose of free drug killed the mice due to toxic effects (308).The increased maximum-tolerated dose is also evident from a clinical trial with the use of N-acetyl melphalan-MAb conjugates in colon cancer where conjugate was given in excess of the MTD for melphalan (309).(d). Zncreased uptake ofdrug by the tumor: Due to the relatively small size and lack of selective accumulation in tumor, free drug injected into the circulation is rapidly cleared and only a small percentage of free drug is found in tumor. However, drugs once linked to MAb accumulate 2-10 times more in tumor that bind the antibody. As a result of such a selective intratumor accumulation, and being relatively nontoxic, drug-MAb complexes show a higher therapeutic index than free drugs. Even though specific uptake is greater than that of free drug, the net injected dose/g in tumor range from 5 to 20% in animals and less than 0.01% humans. Several methods may be used to increase tumor uptake and they are discussed below (section VI,C).
344
GEOFFREY A. PIETERSZ E T AL.
V. Mode of Action of Drug-Monoclonal Antibody Conjugates
A. INTRODUCTION Drug uptake by tumor cells may occur by: (i) passive diffusion (e.g., CBL) where the drug influx presumably occurs through pores in the cell membrane from a high extracellular to a low intracellular concentration; (ii) facilitated diffusion (e.g., 5-fluorouracil) where drug influx involves specific binding to' a transport site; this process is temperature-dependent and follows saturation kinetics; and (iii) active transport (e.g., MTX) where drug transport is energy-dependent and can occur against a concentration gradient. When these drugs are COUpled to macromolecules such as antibodies, changes in cell permeability to the conjugate as a whole or its components may result. It has been assumed that the binding of antibody to target antigen takes precedence over drug binding on uptake for reasons of affinity, availability and size. However, several cytotoxic agents such as chlorambucil, melphalan, and methotrexate have been demonostrated to retain their affinity for target molecules, while bound to intact antibody (40, 202, 260, 310), and consequently some drugs may not need to be released to react with target molecules. It is likely, however, that to exert maximal activity these drugs and others more specific for their target molecules will require intracellular cleavage from the antibody. Ifthe ultimate target ofthe drug is the tumor cell surface (e.g., phospholipase C) then a MAb which localizes the drug to the cell-surface environment is a suitable carrier. MAbs that bind the tumor cell surface and enter a pathway of intracellular migration can also be carriers of drugs with intracellular target sites. B. FUNCTIONAL STUDIESOF SOMEIMMUNOCONJUCATES A number of reviews have addressed the intracellular movements of proteins and macromolecules (Fig. 12) (311,312)and greater understanding of these phenomena has led to the design of drug-MAb conjugates capable of utilizing intracellular sorting processes. Until recently lysosomal hydrolysis was the major target for drug-antibody conjugate cleavage, but now with greater understanding of phagocytosis and receptor-mediated endocytosis, novel strategies for antibody directed drug delivery can be developed. Following the discovery that CBL and antibodies separately administered were as cytotoxic as CBL-antibody conjugates both in vitro and in uivo, a number of studies were undertaken to define a possible drug-antibody synergism (313,314).The earlier studies (19,273,315) found that tumor-associated antigens exposed to CBL-bound antibod-
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
345
Nucleus
FIG. 12. Probable modes of action of drug-MAb conjugates.
ies could “cap” and endocytose into tumor cells and from these and other studies (316) it was clear that the antibody concentrated the chlorambucil at the cell surface and gave rise to a synergistic effect. It has also been demonstrated that internalization was necessary for the cytotoxicity of DM-carrier conjugates, where it could be found attached to nuclei (273). By contrast some AD conjugates (317) did
346
GEOFFREY A. PIETERSZ E T AL.
not need to be internalized to be active. Thus, at present, it is not completely clear whether anthracycline compounds act at the cell surface. Taking advantage of the knowledge that poly-D-lysine is not degraded in cells, Shen et al. inserted several spacers between this and MTX, to study the susceptibility of different linkages to intracellular cleavage (223, 277, 318, 319). Using the protease-sensitive linkage Gly-Gly-Gly, it was demonstrated that MTX-Gly-Gly-Gly-p~ly-~lysine conjugates were cytotoxic to a MTX transport-resistant cell line. Two other MTX-poly-D-lysine conjugates with Gly-Gly-Phe and GlyPhe-Ala spacers were also effective. Longer oligopeptides (Ala-Leu-Ala-Leu) had been used as spacers between DM and BSA (18) and were found to yield active conjugates, this requirement possibly being peculiar to sugar amino-linked anthracycline conjugates. Shen et aE. (223) also explored the possibility of utilizing the acid environment of lysosomes as initially proposed by the early studies (18,106).Both prelysosomal endosomes and lysosomes are acidic intracellular compartments which could cleave acid-sensitive cis-aconityl linkages between drugs (containing an amino group) and carriers such as antibodies. It is also known that intracellular degradation of proteins involves reduction of the disulfide bond; however, the site and nature of this reduction is not completely understood. MTX linked to polyD-lysine through a disulfide bridge was as cytotoxic as MTX-Gly-GlyGly-poly-D-lysine in a MTX transport-resistant cell line (319). The S-S- linkage was critical as when the conjugate was pretreated with 2-mercaptoethanol, cytotoxicity was abolished; however, NH,Cl, a lysosomotropic agent, had no effect on the MTX disulfide-linked polyD-lysine conjugate. Further, leupeptin, an inhibitor of thiol proteases, did not inhibit conjugate cytotoxicity, suggesting that neither a proteolytic nor an acid environment was necessary for reduction. Shen et al. do not exclude the possibility that reduction occurs in the lysosomes, but the exact site of the intracellular cleavage is unknown. Some of these findings are relevant for the future design of drug-MAb conjugates and suggest that intermediary spacers may be necessary to adequately utilize tumor cell catabolism of macromolecules to a therapeutic advantage. The mode of action of MTX linked directly to antibodies (320)or via an HSA carrier (225)was also investigated using biochemical methods. Using L3H]MTX, it was found that, in uitro, EL4 tumor cells took up more MTX conjugated to anti-EL4 antibody than free MTX or MTX coupled to rabbit IgG (320) and the net uptake of the conjugates was proportional to the number of antigen-binding sites on the cell sur-
CHEMOIMMUNOCONIUGATES I N CANCER TREATMENT
347
face and their facility for internalization. These studies also showed that conjugated MTX was retained in the tumor longer than free MTX, suggesting that tumor-specific antibodies can both achieve and maintain high intracellular concentrations of MTX. As well, 35% of the cell-associated radioactivity was found in the low-molecularweight fraction of the cell homogenate as a result of intracellular breakdown. In addition, Garnet et at. (227) studied the properties of a MTX-HSA-MAb conjugate and found that cysteine proteinases were involved in the cytotoxicity, probably activating the conjugate by cleaving the cysteine proteinase-sensitive linkage between MTX-HSA and the antibody. It would appear that this MTX-HSA-antibody conjugate was degraded in the lysosomes, and the resultant MTX-peptide fragments or free MTX itself was transported from the lysosomes to their cytoplasmic DHFR targets (321). C. MORPHOLOGICAL STUDIES To date, few morphological studies have characterized the internalization of MAbs and immunotoxins (109-111) and none have extensively visualized the cellular processing of drug-MAb conjugates. Gold particles have been made to trace the passage of a ricin A-chain-anti-T65 immunotoxin, as the anti-T65 MAbs adsorbed on the gold tracer retained their binding properties for T65 + tumor cells (110).The internalization of this conjugate occurred b y both receptormediated endocytosis and adsorptive pinocytosis ofnoncoated microinvaginations of the plasma membrane. A markedly slower transport of immunotoxin into lysosomes was also found. In addition the functional modification of intracellular vesicles can explain the increased cytotoxicity of immunotoxins in the presence of potentiators such as monensin and ammonium chloride (110). From such studies, it is clear that more effective immunotoxins could be designed by increasing their rate of translocation from prelysosomal endosomes to the endosomes. In addition, the slow kinetics of some ricin A-chain immunotoxins can be attributed to the slow and only partial internalization of their MAb carriers (111).It is apparent that further morphological and functional studies, which provide a greater understanding of how intracellular traffic is controlled, should lead to improvements in the use of MAbs as carriers for targeted antitumor chemotherapy. VI. Barriers to Antibody-Targeted Chemotherapy
With regard to antibody-targeted chemotherapy there has been little emphasis on determining the effects of physiological and anatomical barriers on the efficacy of drug-antibody conjugates. It is likely that
348
GEOFFREY A. PIETERSZ ET AL.
the antitumor activity of conjugates depends on their route of administration, biodistribution, and tumor perfusion while the ability of tumor cells to escape treatment may involve antigenic heterogeneity, drug resistance, or metastatic spread of tumor cells. Surprisingly, few studies, outlined below, have addressed these problems.
A. BIODISTRIBUTION There are a number of anatomical and physiological barriers between a drug-antibody conjugate in the circulation and its ultimate intracellular or extracellular target. These include the endothelium, the basement membrane, and the reticuloendothelial cell system and little is understood about how these barriers effect immunoconjugate localization of tumors. Obviously for a drug-MAb conjugate to reach tumor cells and be effective, it must avoid interaction with the reticuloendothelial system, particularly as toxicity to this system may have deleterious effects on the immune system. The macrophage has a variety of cell-surface receptors including those for the Fc domain of IgG (322), two complement components, and mannosyl/fucosyl-terminatedglycoproteins (323). Antibody-targeted cytotoxic agents where the antibody is of IgGl and IgG3 subclasses could bind to macrophages directly or when bound to their antigen (IgG2 and IgG4) via their Fc receptors. If repeated administration of xenogeneic antibody-drug conjugates is necessary, the subsequent production of antibodies will cause immune complex formation and clearance by the reticuloendothelial system, thereby reducing antitumor efficacy and interfering with normal reticuloendothelial system function. When the conjugate contains proteins with mannose or fucose residues, such as the A- and B-chains of some toxins, the problem of reticuloendothelial system uptake is compounded and the toxicity to the reticuloendothelial system may be severe.
B. ROUTEOF ADMINISTRATION Several different routes of administration are available when delivering drug-antibody conjugates to tumors including intravenous, intraperitoneal, subcutaneous, intratumor, intraarterial, and intrathecal injections. In the majority of cases, it would sem logical to use the vascular system for conveying the immunoconjugate to the tumor; however, it is becoming increasingly evident that the local administration of therapy is far more efficacious. Radiolabeled antibodies have been administered to tumors by intrapericardial, intrapleural, intraperitoneal, and intraarterial infusion and a greater percentage of the radiola-
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
349
be1 has reached the tumor target when given locally than by other routes (324, 325). The use of hepatic artery infusion has been in practice for many years to more directly deliver chemotherapeutic agents to liver tumors whose blood supply is almost entirely via the hepatic artery. A variation of this approach is the intracarotid artery administration of drugs (326) and antibodies (327) to tumors of the brain. Approximately 20% more antibody was delivered to an intracranial tumor by intracarotid infusion compared with intravenous administration, with no difference in the levels of normal tissue uptake between the two routes observed (327). When conjugates of antibody and cytotoxic agent are injected intraperitoneally, cells of the peritoneal wall and neighboring organs are exposed to the highest concentrations of the cytotoxic agent which diffuses into the vascular and lymphatic systems. However, distant metastases in lymph nodes are more effectively localized by intravenous administration of radiolabeled antibodies (328). By comparison, far more favorble tumor uptake of ‘“‘l-labeled anti-ovarian carcinoma antibody has been observed after intraperitoneal (as opposed to intravenous) administration in ovarian cancer patients, although not all investigators would agree with this. However, in addition to a higher tumor uptake, lower uptake was noted in blood, bone marrow, and liver after intraperitoneal administration (329). When the aim is to specifically target lymph nodes special delivery sites may have to be considered, e.g., subcutaneous delivery may enable a greater and faster localization to axillary nodes than that obtainable with intravenous injection (330). The lymphatic route is currently under consideration for the detection of lymph node metastases of breast, lung, colon, and prostate tumors; however, blocked lymph flow and poor penetration could be problems for the therapy of metastatic deposits in these sites. Intratumor treatment may have practical application in the treatment of skin metastases and recurrences of tumors which are not surgically resectable. The intratumoral injection of neocarzinostatin (NCS)-A7 immunoconjugate into subcutaneous colon tumor xenografts caused eradication of tumor in five of six mice (331). Systemic toxicity was also reduced when compared to intravenous administration of NSCA7 conjugate. In addition, the injection of whole ricin immunotoxins with (332)or without lactose (333-335) directly into human and murine tumors in mouse tumor models has completely eradicated the tumors within several days of treatment. Such treatment also drastically reduced the toxicity of whole immunotoxin treatment that occurs after intravenous administration and clearly demonstrates that local adminis-
350
GEOFFREY A. PIETERSZ ET AL
tration of conjugates avoids many of the previously mentioned barriers to therapy. AND PERFUSION C. TUMORVASCULATURE
The effective delivery of cytotoxic agents by antitumor antibodies requires that the conjugates penetrate uniformly throughout the tumor. However, the distribution of intravenously administered radiolabeled antibodies or drug-antibody conjugates indicates that many areas of tumors remain free of antibody (99,100).Blood flow and vessel permeability vary significantly in different regions of the same tumor (118) and the absence of a continuous basement membrane in some tumor capillaries and the presence of tumor cells lining blood vessels can increase the extravasation of conjugates from the blood (336). The proportion of abnormal vessels is different in every tumor depending on its stage, type, origin, and location. It should be realized however that free access of macromolecules to the extravascular tumor cell interstitium is not obvious, even for serum protein (336). Subcutaneously implanted tumors in animal models may have a markedly different vascular supply to metastatic deposits in human cancer, particularly within the first few days after tumor cell inoculation when the local subcutaneous microvasculature is considerably disrupted. Consequently it is important that in such experiments the treatment regimes begin several days after tumor implantation to ensure endothelial regulated passage of treatments from the blood the the tumor tissue. Little is known about the nourishment of tumors at their earliest stages of growth, however, tumor cells probably obtain their needs by diffusion from the surrounding normal vessels. As tumor development occurs, microregions of tumors evolve gradients of oxygen, glucose, other nutrients, growth factors, and hormones which decrease from the periphery of the tumor to its center (337).Other gradients such as those of lactate concentration and pH increase from the periphery to the center. These gradients have pronounced effects on the cells, including their proliferative nature, their cell-cycle distribution, their antigen expression and differentiation, and consequently their response to immunoconjugate therapy. For example, hypoxia can modulate the pharmacokinetics of some of the conventionally used antineoplastic agents (338),and radioresistant hypoxic cells have been found in nearly all the animal tumors investigated thus far (339), probably as a result of irregular and intermittent blood flow through some areas of solid tumors (340).Central necrotic areas of large tumors lose most of their antigenic properties and, accordingly, there is a higher relative
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
35 1
uptake of radiolabeled anti-CEA antibodies in smaller tumors where the majority of tissue is viable and active (341). Some investigators have been interested in altering the vascular perfusion of tumors with vasoactive agents, which may have great application for improved chemotherapy, radiotherapy, and thermotherapy. The success of this approach requires that the vasoactive agent exert a differential effect on the tumor compared to the normal vasculature. For example, the majority of tumor blood vessels lack sufficient smooth muscle to constrict or dilate in response to vasoactive agents that can regulate the normal vasculature (342). Adrenaline has been employed, to amplify the radiographic contrast between normal and tumor tissue (343),and other agents (344)have been used in an attempt to increase oxygen tension within tumors for more effective radiation therapy. The anesthetic, pentobarbitone sodium, was demonstrated to increase the relative tumor perfusion in mice by a decrease in the blood flow to muscle (345).In one study it was found that P-adrenergic blocking agents, propranolol, oxprenolol, and pindolol were capable of increasing the tumor localization of monoclonal antibodies twofold (346). In the same study, these agents were found to increase the antitumor efficacy of monoclonal antibody conjugates. Many vasoactive agents may also be mediators of inflammation, which can increase the passage of proteins from the blood plasma to the tumor cell interstitiurn. Such effects on the permeability of tumor blood vessels will conceivably allow immunoconjugates greater access to the entire tumor cell population. Vascular leakage from capillaries at sites of inflammation is normally induced by a variety of endogenous inflammatory mediators; however, leakage may also be initiated by direct tissue injury or injury to the vascular endothelium (347).Vascular endothelial injury, such as that observed after administration of endotoxin (348) or tumor necrosis factor (TNF) (349),involves venous congestion, endothelial damage, and platelet aggregation, followed by extravasation of erythrocytes, macrophages, and neutrophils into the tumor. It is believed that the hemorrhagic necrosis inflicted by T N F is a result of vascular obstruction and tumor tissue hypoxia (350). Several studies (351, 352) have demonstrated an increased uptake of radiolabeled MAb into murine tumors using human and murine TNF; the increased uptake was dependent on the time of administration of TNF, with maximum effects when T N F was given simultaneously with radiolabeled Ab. The therapeutic effect of AMN and N-AcMEL conjugates was also increased when they were administered with TNF. Vasoactive agents and other inflammatory mediators (including lymphokines) may therefore prove to be useful in the treatment of solid
352
GEOFFREY A. PIETERSZ ET AL.
tumors with immunoconjugates. In contrast, radiation or hyperthermia only appear to be useful when used in combination with a limited number of antineoplastic drugs (353).
D. TUMOR ANTIGEN-HETEROGENEITY Tumor cell heterogeneity is one of the principal causes of treatment failure and represents a formidable barrier to the development of effective regimes of antibody-targeted cytotoxic agents. Tumor cell populations resistant to drug MAb conjugates may emerge by a variation of antigen expression, drug resistance, or development of metastatic potential. Heterogeneity is particularly well illustrated in colon carcinoma where the unstable phenotypic composition of tumors produces a mosaic of antigen expression (102).The everchanging antigen expression of tumors appears to be influenced by selective environmental pressures (354)and results as a consequence of antigen loss, modulation, or shedding into the circulation (355).Thus immunoconjugates which were initially effective may become ineffective as the surviving and expanding population becomes antigen-negative by responding to the selective pressures of treatment. Depending on the cytotoxic agent targeted, even low antigen expression on tumor cells may permit their survival. Effective targeting of cytotoxic agents to tumors may therefore be improved by using a cocktail of antibodies which could be established by determining the antigenic repertoire of tumor cell populations. Thus, a cocktail of anti-HMFG MAbs has demonstrated superior antitumor effects to any one of these MAbs alone against a heterogeneous population of breast cancer cells (104). By using panels of MAbs directed at different antigens or epitopes, both the chances of binding every tumor cell and the loading of cytotoxic agent per tumor cell should be increased. Other possible solutions to the antigenic heterogeneity of tumors involve the targeting of agents to essential components of the cell involved in maintenance or transformation such as oncogene products. Furthermore, as there is less heterogeneity associated with protein rather than carbohydrate determinants MAbs to the protein components of cell membrane antigens may be more useful therapeutically (356).It should be noted that different cocktails of immunoconjugates are needed to treat tumors in different patients, then their commercial development and clinical use will have to tailor the treatment to the patient-but this may not be possible given that the antigenic profile of every metastasis cannot be determined (356). The development of drug resistance by neoplastic cells is both a common clinical failing of conventional chemotherapy and an area
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
353
of active research interest. At this level there are many gaps in our understanding of drug resistance; however, several mechanisms have been elucidated both experimentally and in the clinic. Defective transport, defective drug metabolism to the active species, altered intracellular targets, increased drug inactivation, altered DNA repair, and gene amplification have all been cited as possibilities leading to drug resistance (358).Given what is known about the mechanism of action of immunoconjugates, all ofthese mechanisms ofresistance, except defective transport, are pertinent for antibody-targeted chemotherapy. Defective transport will not be overcome if the defect exists at the cytoplasmic level and increased drug inactivation may be avoided if the immunoconjugate intracellular pathway bypasses the cell substrates involved in inactivating the drug. Better understanding of both the immunoconjugate’s mode of action and the mechanisms of drug and conjugate resistance, from a biochemical standpoint, should enable many forms of drug resistance to be successfully overcome. Tumor cell populations differ significantly in their metastatic potential and ability to avoid host defense mechanisms (359). Little is understood about the development of metastatic properties. Few, if any, studies have considered the disseminated nature of metastatic disease when evaluating the preclinical efficacy of immunoconjugate therapy. Insights into the genesis of progressive tumor growth and metastatic spread suggest that a heterogeneous response oftumors to immunoconjugate therapy will be observed (357).In this case, it is unlikely that any single treatment regimen will eradicate all the tumor cells in primary and metastatic lesions, but rather a combination of antibodytargeted chemotherapy and other approaches will be required. Several new approaches have attempted to increase cytotoxicity of the immunoconjugates by using potentiators or conventional chemotherapeutic drugs. Weil-Hillman et al. (332) found that localized treatment with a ricin immunotoxin and mafosfamid, a DNA alkylator, was superior to either immunotoxin or mafosfamid alone in human tumor xenografts in athymic nude mice. The reason why enhanced antitumor effects were observed was not clear. Verapamil, a clinically important calcium-channel blocker was found to cause a 40-fold enhancement of cytotoxicity by pseudomonas-exotoxin-EGF conjugates on E G F receptor-positive KB3.1 cells due either to delayed degradation of‘the immunotoxin in the lysosomes or to a general effect of verapamil on membrane permeability (32). Other studies have demonstrated the combined use of immunotoxins and chemotherapy (360,361), including the use of vinblastine, bleomycin, or MTX which enhanced the binding of a ricin A-chain immunotoxin hybrid to tumor cells (362).
354
GEOFFREY A. PIETERSZ ET AL
In each of these investigations, chemotherapeutic drugs at subclinical doses increased the cytotoxicity ofthe immunotoxin. Radioimmunoconjugates constructed by linking ricin to MAb then radiolabeling this conjugate with "Yt were of similar cytotoxicity to the native immunotoxin in vitro (363). Biological response modifiers, cytokines, are currently being investigated as possible adjuvants to surgery and chemotherapy. The development of recombinant DNA technology has resulted in the availability of purified cytokines for assessment of their immunomodulatory and antitumor activities. Thus far the diversity of effects attributed to many of these cytokines has confused the issue of their utility in cancer treatment; however clinical trials of interferon (IFN), TNF, interleukin-2 (ILZ), and combinations of other cytokines are presently in progress. Interesting preclinical data, however, suggest that TNF can demonstrate striking antitumor effects when combined with toposiomerasetargeted drugs (e.g., AD) (364). Furthermore it has been shown in vivo that human IFNy can effectively increase the amount of tumorassociated antigen expressed by a human colon xenograft and augment the localization of a radiolabeled MAb to the tumor site (365).Therefore the combined use of human IFNa and antibody-delivered cytotoxic agents may improve the treatment of tumors with low levels of tumor-associated cell-surface antigens and enable the reconstitution of antigen levels following initial treatments. VII. Clinical Trials
The administration of immunoconjugates to patients has been undertaken in a number of studies, although very few can be classed as formal phase I trials (Table V). The majority of trials have used a relatively small amount of immunoconjugate in patients with advanced disease, thus the lack of response observed in many patients is not entirely surprising. Undoubtedly, it is too early to pass judgment on the clinical efficacy of antibody-targeted chemotherapy; however, it is evident that the move from preclinical studies in experimental model systems to clinical trials poses a number of special problems. First, the majority of monoclonal antibodies evaluated in targeting studies are not necessarily recognizing truly tumor-specific antigens, but rather reacting with normal or modified tissue antigens which are preferentially expressed on malignant cells. Most monoclonal antibody-drug conjugates are evaluated in vitro and in vivo in mice bearing human tumor xenografts and although such a model is useful, it
CHEMOIMMUNOCONJUCATES IN CANCER TREATMENT
355
is important to remember the mouse usually has no normal human tissue against which the antibody reacts, whereas normal tissue reactivity in the patient may contribute significantly to the overall toxicity. The importance of this was emphasized in a Phase I study of an antibreast cancer immunotoxin where, although animal data suggested that the immunotoxin would be well-tolerated in patients, severe toxic effects were observed in most patients including marked fluid overload and debilitating sensorimotor neuropathies (376).Subsequent examination of the antibody activity by the immunoperoxidase technique suggested that the binding of the immunoconjugate to neural cells induced demyelination and subsequent neuropathy. Reactivity was also observed in clinical trials using the KS 1/4 monoclonal antibody which showed no reactivity with mouse tissue and therefore no toxicity but bound to human intestinal mucoas as well as a variety of neoplastic tissues. In one clinical trial using the KS1/4-methotrexate inimunoconjugate, the antibody was detected in normal gut in 7/9 colonic biopsies treated with either antibody alone or immunoconjugate, although it was not possible to correlate the presence of antibody with the observed gastrointestinal side effects (375). In another Phase I study using a KS1/4-vinca conjugate 15/22 patients given either single or multiple doses of immunoconjugate developed dose-limiting symptoms of gastrointestinal toxicity (374). Examination of duodenal biopsies in affected patients revealed ulceration of epithelium, with loss of villous structure and intense inflammatory cell infiltrate and again impressive localization of the antibody. In retrospect, these side effects could have been predicted based on the known in uitro reactivity of the antibody. But how much prediction can be based on such studies? For example, anti-HMFG (MUC1) antibodies, known to react with normal kidney, lung, pancreas, and other tissues has been given without ill effect to many patients (377)and this includes very large doses of 9OYt-radiolabeled antibodies (378). These studies demonstrate that unexpected effects may occur with antibodies as it is difficult to test all possible tissues in vitro. However, Phase I studies are designed with this in mind and by starting with a low dose and with careful dose escalation and patient monitoring, such side effects should really be detected early in the trial and the study curtailed. Antibodies under consideration for clinical use should ideally be examined in patients using radiolabeled antibody and tumor imaging (379-385). The most widely used route of administration is intravenous and has shown that the blood clearance of free antibody is essentially biphasic with an initial blood clearance of 11-15 hr and a second catabolic phase of 18-45 hr. Using a radiolabeled antibody-methotrex-
TABLE V
SUMMARY OF CLINICAL TRIALS Disease
Drug
Route
Disseminated malignant melanoma ( 1 patient)
Chlorambucil
it iv
Disseminated malignant melanoma (1 patient)
Chlorambucil
iv
Metatastic carcinoma (4 colorectal, 4 ovarian) Neuroblastoma (7 patients)
Vindesine
iv
Daunomycin chlorambucil
iv
Colon carcinoma and postoperative liver metastases (41 patients)
Neocarzinostatin
Disseminated refractory malignancies (23 pahents)
Adriamycin
w
u1
ia, iv, or ip
LV
Treatment Schedule Two doses of 0.38 mg it into metastatic nodules. Three i\ injections of 2.5, 3. and 4 mg. 41 mg given over 9 injections on alternate days; 80 mg was then given over 16 injections 5 months later followed by 17.5 mg over 3 injections 7 days later. Single dose of 24-1800 p g (Phase I).
1 mg/kg of daunomycin twice a week or 0.5 mg/kg chlorambucil once a week. Treatments were continued for up to 1 year. 1OOO-6ooo units with either 1 or 2 doses.
Initial doses of below 300 nig were given three times per week. Using cocktails of up to six antibodies. Later up to 1 g of drug was given over 2-3 weeks.
Toxicity
Responbe
Reference
None reported.
Regression of all metastatic nodules regardless of whether locally injected.
37
Mild anaphylaxis following a total of 25 injections of goat IgC. Three later injections of rabbit IgC again induced anaphylactic reactions. No obvious toxicity.
Regression of skin metastases.
367
No benefit.
368
Minor bone marrow depression.
317 patients NED 3 years after diagnosis; 1/7, PR; 217, MR.
369
Fever in 50% of patients, leukocvtosit. in 5 patients.
Of 8 patients with postoperative liver metastases, 3 showed evidence of tumor reduction and 3 claimed pain relief. N o benefit to patients with lung or peritoneal metastases,
370
5/23. MR.
371
Rash, chills, fever
W
--1 01
Hepatic a r t e n infusion
Up to 20 m g i d given over 2 days (Phase I).
Mitomycin C
iv
Metastatic carcinoma (43 patients)
Adriamycin mitomycin C
iv
5. 10, 10, 40 nig, administered on alternated days, followed by dose escalation of 20 mg increments (Phase I). Dose eccalation over 2-3 weeks (three timerlweek) up to 1 g of adnaiiiycin or u p to 5 g mitonivcin C .
Adenocarcinoma of lung, colon, o r rectum (13 patientc)
Vinca alkaloid
Stage IIIB or IV nonsmall cell carcinoma of the lung (5patients)
Methotrexate
Advanced colorectal carcinoma (10 patients)
N-Acetylmelphalnn
Metastatic carcinoma (19 patients)
1.4-400 mg given either ar a single dose or as multiple doses of 63 mgim2 diarrhea every 2-3 days for up to 9 doses (Phase 1). Biweekly. escalating doses to a total of 28 mg methotrexate.
Note. MR, minor response; PR, partial response; NED, no evidence of disease.
Serum \icknes\ developed in 1 patient given second course of treatment. Frhrile reaction5 noted with the higher dose\. Thrombocytopeiiia. diarrhea, gastrointestinal bleeding.
Rash. fever. chill, At 64 mg mitomycin C thrornbocytopemn wa, dose limiting. .Alopecia and red urine WAS noted in patients given adriamycin, 4/13 patienth had severe allergic reactions reqmring epinephpe Nausea. abdominal pain
Fever, chills, anorexid, nausea, vumitiiig, diarrhea. mild anaemia
3/9. “rR
144
N o complete or partial response. O n e patient demonstrated SD
372
5/13,M H with adriamgcin N o
373
re\prinse\ ohserved with mitomycin C, although less tumor-induced pain WA, noted.
Antitumor activity not observed.
374
N o decrease in measurable or evaluable disease. O n e patient may have had a clinical response.
375
358
GEOFFREY A. PIETERSZ ET AL.
ate conjugate in patients with colorectal carcinoma, the labeled antibody moiety was found to survive in the circulation with kinetics similar to that of unconjugated antibody and the blood kinetics of both drug and antibody assayed in one patient were found to be virtually identical (386).Also, the KS 1/4-vinca alkaloid conjugate was found to have pharmacokinetic parameters in patients similar to values found for free antibody (387). It is therefore reasonable to assume similar biodistribution of the immunoconjugate as observed with free antibody in these cases. Although preclinical animal MAb studies have shown that up to 10-30% of the injected dose of radiolabeled MAb can accumulate in tumor tissue (388-392), tumor imaging in patients shows that in humans the proportion of antibody localizing at the tumor site is usually less than 0.01%(385).One factor involved in low tumor accumulation of antibody may be neutralization by circulating antigen derived from the tumor tissue, although high levels of circulating antigen in patients do not always appear to affect tumor imaging with radiolabeled antibody (383, 393, 394). It has been suggested that since the volume of a man is very much larger than that of a mouse the dose of antibody would be diluted to a greater amount in a human compared to a mouse (385).Tumor : blood ratios in either animals or man, however, appear to be similar in most studies (385).Extrapolation from mouse to man would indicate that to reach saturation of tumor antigen in man may require several grams of antibody. Even with the rapid development of large scale production methods, the large quantities of monoclonal antibody required for conjugate therapy could become a major limitation for clinical studies. Another problem in patients is that the MAb administered to patients are usually of mouse origin. As discussed previously, the infusion of murine proteins into humans elicits an immune response and the production of HAMA may be a major limitation for therapy. The stimulation of HAMA may evoke organ and/or tissue damage, although these have been surprisingly few in severity. Of greater impact is the inhibition oftumor-localizing properties of the antibody (395,396) with rapid clearance of antibody from the serum by the HAMA. Although this has been extensively reported (397-399), other studies have shown no significant changes in the serum levels of antibody despite increasing levels of anti-mouse antibodies (143, 375, 400). For example, when patients were treated with the (KS1/4)-methotrexate conjugate, serum levels of antibody increased with each biweekly escalating dose, even though a HAMA response was detected in each aptient (375). By contrast, the same antibody conjugated to deactylvinblastine-3-
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
359
carboxyhydrazide was cleared rapidly from the serum in the presence of high anti-mouse antibody levels (399). Although preexisting antimurine antibodies exist in some patients, the detection ofantiidiotypic antibodies against injected immunoglobulin suggests that, at least in part, the production of HAMA is a primary response. The frequency at which HAMA occurs following therapy appears to vary with the tumor type. Patients with chronic lymphocytic leukemia or lymphoma rarely develop HAMA, whereas patients with solid tumors (e.g., melanoma colorectal or lung cancer) incur a high incidence of HAMA production (401). Human monoclonal antibodies are now being produced (402) or, more commonly, humanized (150,403)or chimeric (404-408) antibodies and such antibodies appear to provoke a reduced immune response (135).Even if these altered antibodies produce no anti-constant region response, the problem of antiidiotype and antidrug antibodies still remains. The production of antihapten or antitoxin antibodies has been demonstrated in patients given immunotoxins (409)and immunoconjugates (400), although it has been reported that the antiglobulin response was directed only against determinants common to the mouse Fc region and suggested that HAMA to other components of the antibody may represent a secondary immune response (142, 410). The production of antibodies to both the antigen-binding region (idiotype) and the drug present within an immunoconjugate may prove a serious limitation and patients requiring long-term, high-dose immunoconjugate therapy are likely to require some form of immunosuppressive treatment. Several strategies have been explored to minimize the host’s response to murine antibody, including the use of immunosuppressive drugs such as cyclosporin (411), cyclophosphamide (412), and 15deoxyspergualin (413) and administration of anti-lymphocyte antibodies (414).Another approach would be the use of cocktails of immunoconjugates using sequential administration of antibodies from different species against different epitopes or antigens on the same tumor, linked to different cytotoxic drugs. Such a approach could circumvent the problems of antigenic heterogeneity within the tumor, antigenic modulation, and drug resistance. Although the literature shows that in experimental models immunoconjugates can be therapeutically effective, the clinical trials conducted to date have been disappointing in terms of antitumor effects (Table V). In many of these studies, however, the aim has been to find a nontoxic dose and, in general, immunoconjugates have been well tolerated b y the patient with the amount of drug that can be given being greater than the maximum-tolerated dose for free drug (144).
360
GEOFFREY A. PIETERSZ ET AL.
Certainly, factors such as low tumor accumulation, poor tumor diffusion, heterogeneity of antibody binding through the tumor mass, and the advanced state of the patients disease do not improve the results obtained so far. Although means of enhancing tumor access with cytokines and the use of antibody cocktails may result in greater therapeutic efficacy, these studies will take many clinical trials to achieve the right mixture and it is unlikely that compIete tumor erradication will result. Evidence suggests that, at least in experimental models, it is possible to erradicate small tumors but that it is more difficult to erradicate larger ones (175).Thus, the potential of immunoconjugates in the clinic may be best used to treat small metastatic deposits. Indeed, their greatest value may be at the time of operation to remove the primary lesion to treat microscopic disease with nontoxic immunoconjugates.
VIII. Conclusion
This review has summarized the current status of cancer treatment using antibody-drug conjugates. The major reason that the work with these immunoconjugates has lagged behind studies using isotopes and toxins is that drug conjugation procedures are substantially more difficult. The conjugation of isotopes to antibodies employ relatively simple procedures, and the conjugation of toxins is only slightly more difficult using disulfide bonding of toxin to antibody. Conjugation difficulties aside, isotopes have a finite half-life, are difficult to handle, and may damage surrounding tissues, although for some isotopes (a and p emitters) this may be useful for destroying antigen-negative cells within the tumor mass. Toxin conjugates are generally more potent than antibody drug conjugates, but due to their large size they are likely to be more immunogenic and, as they are highly toxic, they can also have significant deleterious side effects on tissues other than the target tissue. In contrast, antibody-drug conjugates may spare normal cells. Due to the lack of clinical data at this time, it is difficult to establish which moiety (i.e., isotope, toxin, or drug) will be most effective when attached to antitumor antibodies. It is reasonable therefore that all three moieties be fully and appropriately tested in both preclinical and clinical studies. In all such studies using mouse MAbs, however, the occurrence of HAMA may curtail therapy. In the past few years, chimeric, humanized, and indeed fully human antibodies have been produced, and with these reagents the occurrence of HAMA has been dramatically reduced. Added to this benefit is the likelihood
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
36 1
of that chimeric antibodies will have a greater potency of their own than murine antibodies. Thus, all clinical studies with mouse antibodies in drug conjugation should be repeated using chimeric antibodies. As we have discussed in this review, large tumors have proved difficult to eradicate using antibody-drug conjugates, mainly due to poor tumor access. As Phase I studies have usually been performed in patients with advanced metastatic disease and therefore large tumor burden, it is difficult to assess the potential therapeutic efficacy of immunoconjugates. It is becoming clear that this type of therapy alone is unlikely to eradicate large tumors but will be more suited to treating patients with a small tumor burden. We consider the yefore that immunoconjugates will find their place in the treatment of cancer together with surgery, radiotherapy, and conventional treatment particularly in patients with minimal and microscopic disease. We would also suggest that Phase II/III clinical trials involve patients with early disease and that immunotherapeutic protocols be instituted after surgery for the treatment of microscopic disease in an adjuvant setting.
REFERENCES 1 . Herlyn, D., and Koprowski, H. (1982). IgC2a monoclonal antibodies inhibit human tumour growth through interactions with effectorcells. Proc. Natl. Acad. Sci. U.S.A. 79,4761-4765. 2. Tax, A., and Manson, L. A. (1981). Monoclonal antibodies against antigens displayed on progressively growing mammary tumor. Proc. Natl. Acad. Sci. U.S.A. 72, 1383-1387. 3. Press, 0. W. (1991). lmmunotoxins. Biotherupy 3, 65-76. 4 . Koppel, G. A. (1990). Recent advances with monoclonal antibody drug targeting for the treatment of human cancer. Bioconj. Chem. 1, 13-23. 5. Tazzari, P. L., Baltelli, M. G., Abbondanza, A,, Dinota, A,, Rizzi, S., Gobbi, M., and Stirpe, F. (1989). Targeting of a plasma cell line with a conjugate containing xanthine oxidase and the monoclonal antibody 62Bl. Transplantation 48,119-122. 6. Obrist, R., and Sandberg, A. L. (1982). In vitro effects of antitumor antibodychemotactic factor complexes. Clin. Zmrnunot. fmmunopathol. 25, 91-102. 7 . LeBerthon, B., Khawli, L. A., Alauddin, M., Miller, G. K., Charak, B. S., Mazumder, A., and Epstein, A. L. (1990). Enhanced tumor uptake of macromolecules induced by a novel vasoactive interleukin 2 immunoconjugate. Cancer Res. 5,2694-2698. 8. Britton, K. E. (1991). Overview of radioimmunotherapy: A European perspective. Anti. Imrnunocop. Radiopharni. 4, 133-150. 9. Pierce, D. L., Heindel, N . D., Schray, K. J., Jelter, M. M., Emrich, J. G., and Woo, D. V. Misonidazole conjugates of the colorectal tumor associated monoclonal antibody 17-1A. Bioconj. Chern. 1,314-318. 10. Rakestraw, S. L., Tonipkins, R. C . ,and Yarmush, M. L. Preparationandcharacterization of immunoconjugates for antibody-targeted photolysis. Bioconj. Chem. I, 212-221. 1 1 . Berinstein, N., Matthay, K. K., Papahadjopoulos, D., Levy, R., and Sikic, B. I. (1987). Antibody-directed targeting of liposomes to human cell lines: Role of binding and internalization on growth inhibition. Cancer Res 47, 5954-5959.
362
GEOFFREY A. PIETERSZ ET AL.
12. Anderson-Berg, W. T., Strand, M., Lempert, T. E., Rosenbaum, A. E., and Joseph, P. M. (1986). Nucluear magnetic resonance and gamma camera tumor imaging using gadolinium-labeled monoclonal antibodies. 1.Nucl. Med. 27,829-833. 13. Hayzer, D. J., Lubin, I. M., and Runge, M. S. (1991). Conjugation of plasminogen activators and fibrin-specific antibodies to improve thrombolytic therapeutic agents. Bioconj. Chem. 2,301-308. 14. Paxton, R. J., Beatty, B. G., Varadarajan, A., and Hawlhorne. (1992).Carboranyl peptide-antibody conjugates for neutron-capture therapy: Preparation, characterization, and in vivo evaluation. Bioconj. Chem. 3, 241-247. 15. Hermentin, P., Doenges, R., Franssen, U., Bieva, C., Vander Brugghen, F. J., Stryckmans, P., Friesen, H.,-J., Oplaczy, B., Schneider, S., Ax, W., Enssle, K. H., Kurrle, R., and Seiler, F. R. (1990). Hinge-thiol coupling of monoclonal antibody to silanized iron oxide particles and evaluation of magnetic cell depletion. Bioconj. Chem. 1,411-418. 16. Midoux, P., Martin, A., Collet, B., Monsigny, M., Roche, A-C., and Toujas, L. (1992). Activation of mouse macrophages by muramyl dipeptide coupled with antimacrophage monoclonal antibody. Bioconj. Chem. 3, 194-199. 17. Trouet, A., Deprez-De Campeneere, D., and De Duve, C. (1972). Chemotherapy through lysosomes with a DNA-daunorubicin complex. Noture (London)New Biol. 239, 110-112. 18. Trouet, A., Masquelier, M., Baurain, R., and Deprez de Campeneere, D. (1982). A covalent linkage between daunorubicin and proteins that is stable in serum and reversible by lysosomal hydrolases, as required for a lysosomotropic drug-carrier conjugate: In vitro and in vivo studies. Proc. Natl. Acad. Sci. U.S.A.79,626-629. 19. Zunino, F., Savi, G., Guiliani, F., Gambetta, R., Supino, R., Tinelli, S., and Pezzoni, G. (1981). Comparison of antitumor effects of daunorubicin covalently linked to poly-L-amino acid carriers. Eur. J. Cancer Clin. Oncol. 20, 421-425. 20. Shih, L. B., Goldenberg, D. M., Xuan, H., Lu, H., Sharkey, R. M., and Hall, T. C. (1991). Anthracycline immunoconjugates prepared by a site specific linkage via an amino-dextran intermediate carrier. Cancer Res. 51, 4192-4198. 21. Yamaguchi, T., Kato, R., Beppu, M., Terao, T., Inoue, Y., Ikawa, Y., and Osawa, T. (1979). Preparation of concanavalin A-ricin A-chain conjugate and its biological activity against various cultured cells. J . Natl. Cancer Znst. 62, 1387-1395. 22. Pozansky, M. J., Singh, R., and Singh, B. (1984). Insulin 18: Carrier potential for enzyme and drug therapy. Science 223, 1304-1306. 23. Varga, J . M., Asato, N., Lande, S., and Lerner, A. B. (1977). Melanotropindaunomycin conjugate shows receptor-mediated cytotoxicity in cultured murine melanoma cells. Nature (London) 267,56-58. 24. Kaneto, Y. (1981). Thyrotropin-daunomycin conjugate shows receptor mediated cytotoxicity in cultured thyroid cells. H o r n . Metab. Res. 13, 110-114. 25. Noda, H., Ogasawara, T., Yamakawa, H., Iida, T., Kurono, M., and Yagi, K. (1991). Cholesterol sulfate-containing liposome entraping adriamycin-pharmacokinetics and antineoplastic effect. J . Clin. Biochem. Nutri. 10, 181-188. 26. Zimmerman, U. (1983). Cellular drug-carrier systems and their possible targeting. In “Targeted Drugs: Polymers in Biology and Medicine,” (Eugene P. Goldberg, ed.), Vol. 2, pp. 153-200. Wiley, New York. 27. Sur, B., Ray, R. R., Sur, P., and Roy, D. K. (1983).Effect of liposomal encapsulation of cis-platinum diamminodichloride in the treatment of Ehrlich ascites carcinoma. Oncology 40,372-376. 28. FitzGerald, D. J., and Pastan, I. (1992).Pseudomonas exotoxin: Recombinant conjugates as therapeutic agents. Biochem. Soc. Trans. 20,731-734.
CHEMOIMMUNOCONJUGATES IN CANCER T R E A T M E N T
363
29. Pastan, I., and Berger, E. A. (1988).Selective killing of HIV-infected cells by a recombinant human CD4-Psendornonns exotoxin hybrid protein. Nature (London) 335,369-372. 30. Bastos, M . C . , Pankewycz, O., Rubin-Kelley, V. E., Murphy, J. R., and Strom, T. B. (1990). Concomitant administration of hapten and IL-2-toxin (DAB486-IL2) results in specific deletion of antigen activated T cell clones. J . Zmnau~~ol. 145, 3535-3539. 31. Sasaki, T., Tsukada, Y., Deutsch, H. F., and Hirai, H. (1984). Daunomycinarachidonic acid complex as a potential new anti-tumor agennt. Cancer Chemother. Pharinucol. 13, 75-77. 32. Akiyama, S., Cottesnian, M. M., Hanover, J. A., FitzCerald, D. J. P., Willingham, M. C.. and Pastan, I. (1984). Verapaniil enhances the toxicity of conjugates of epidermal growth factor with pesudomonas exotoxin and antitrasferrin receptor with pseudonionas exotoxin. J . Cell. Physiol. 120, 271-279. 33. Kohler, G., arid Milstein, C. (1975). Continuous cultures of fused cells secreting antibody of predefined specificity. Nature (London) 256, 495-497. 34. Pietersz, C . A., and hlcKenzie, I. F. C. (1992). Antibody conjugates for the treatment of cancer. ~narnuno~. Rec. 129, 57-80. 35. Ehrlich, P., “Collected Studies in Immunity,” Vol. 11. Wiley, New York. 36. Mathe, G., LOC,T. B., Bernard, J. C. (1958). Effet sur la leuceniie 1210 d e la souris d’un conibinaison par diazotation d’Aniethopterine et d e gamma globulines de hamsters porteurs de cette leuceniie par hetirogreffe. C. R. Acud. Sci D Paris 246, 1626- 1628. 37. Chose, T., Norvell, S. T., Guclu, A,, Cameron, D., Bodurtha, A,, and McDonald, A. S. (1972).Initnunochemotherapy ofcancer with chlorambucil-carrying antibody. Br. Med. J . 3, 495-499. 38. Arnon, R. (1979). I n “Tumor-Associated Antigens and Their Specific Immune Response” (F. Spreafico and R. Arnon, eds.), pp. 287-304. Academic Press, London. 39. Chose, T., and Blair, A. H. (1978).Antibody linked cytotoxic agents in the treatment of cancer: Current status and future prospects. J . Nutl. Cancer Inst. 61, 657676. 40. Hurwitz, E., Levy, R., Maron, R., Wilchek, M., Arnon, R., and Sela, M. (1975). The covalent binding of daunomycin and adriamycin to antibodies, with retention of both drug and antibody activities. Cancer Res. 35, 1175-1181. 41. Herberman, R. B., and Oldham, R. K. (1975). Problems associated with study of cell-mediated immunity to human turnours by microcytotoxicity assays. J . Natl. Cancer Inst. 55, 749-753. 4 2 . Schroff, R. W., Woodhouse, C. S., Foon, K. A,, Oldham, R. K., Farrell, M. M., Klein, R. A., and Morgan, A. C. Jr. (1985). Intratumor localization of monoclonal antibody in patients with melanoma treated with antibody to a 250,000 dalton melanoma associated antigen. J . Natl. C o m e r Inst. 74, 299-306. 43. Herlyn, D. M., Steplewski, Z., Herlyn, M. F., and Koprowski, H . (1980). Inhibition of growth of colorectal carcinoma in nude mice by monoclonal antibody. Cnrrcer Res. 40, 717-721. 44. Katano, M., Irie, R. F. (1984). Human monoclonal antibody to tumor-associated ganglioside GD2: Suppressed growth of human melanoma in nude mice. Zmmunol. Lett. 8, 169-174. 45. Dillinan, R. O., Shawler, D. L., Sobol, R. E., Collins, H. A., Beauregard, J. C., Wormsley, S. B., and Royston, I . (1989). Murine monoclonal antibody therapy in two patients with chronic lymphocytic leukaeniia. Blood 59, 1036-1045.
364
GEOFFREY A. PIETERSZ ET AL.
46. Miller, R. A,, and Levy, R. (1981). Response of cutaneous T cell lymphoma to therapy with hybridonia monoclonal antibody. Lancet 2,226-230. 47. Rib, J., Pesando, J . M., Sallan, S. E., Clavell, L. A., Notis-McConarty, J., Rosenthal, P., and Schlossman, S. F. (1981). Serotherapy of acute lymphoblastic leukaemia with monoclonal antibody. Blood 58, 141-152. 48. Adams, D. O., Hall, T., Steplewski, Z., and Koprowski, H. (1984).Tumors undergoing rejection induced by monoclonal antibodies of the IgG2a isotype contain increased numbers of macrophages activated for a distinctive fomi of antibodydependent cytolysis. Proc. Natl. Acad. Sci. U.S.A. 81, 3506-3510. 49. Goodman, G. E., Beaumier, P., Hellstrom, I., Fernyhough, B., and Hellstrom, K. E. (1985).Pilot trial of murine monoclonal antibodies in patients with advanced melanoma. J. Clin. Oncol. 3, 340-352. 50. Sears, H. G., Atkinson, B., Mattis, J., Ernst, C., Herlyn, D., Steplewski, Z., Hayry, P., and Koprowski, H. (1982). Phase-I clinical trial of monoclonal antibody in treatment of‘gastrointestinal tumours. Lancet 1, 762-765. 51. Feinerman, B., Paul, R. D., and Feinerman, G. (1983).Treatment ofmurine leukaemia with chlorambucil bound monoclonal antibodies. Ado. Erp. Med. Biol. 166, 59-66. 52. Debure, A., Chkoff, N., Chatenoud, L., Lacombe, M., Campos, H., Noel, L. H., Goldstein, G., Bach, J. F., and Kreis, H. (1988). One-month prophylactic use of OKT3 in cadaver kidney transplant recipients. Transplantation 45, 546-553. 53. Dyer, M . J. S., Hale, G., Marcus, R., and Waldman, H. (1990).Remission induction in patients with lymphoid malignancies using unconjugated CAMPATH-1 monoclonal antibodies. Leukaemia Lymphoma 2, 179-193. 54. Adair, A. J. (1992). Engineered antibodies for therapy. Immunol. Reo. 130, 5-40. 55. Michaelson, T. E., Aase, A., Norderhaug, L., and Sandlie, I. (1992). Antibody dependent cell-mediated cytotoxicity induced by chimeric mouse-human IgG subclasses and IgG3 antibodies with altered hinge regions. Mol. Immunol. 29, 319-326. 56. Guadagni, F., Schlom, J., Pothen, S., Pestka, S., and Greiner, J. W. (1988).Paranieters involved in the enhancement of monoclonal antibody targeting in vivo with recombinant interferon. Cancer Immunol. Immunother. 26, 222-230. 57. Vuist, W. M. J., Buitenen, F. V., Hekman, A., and Melief, C. J. M . (1990). Two distinct mechanisms of antitumor activity mediated by the combination of interleukin 2 and monoclonal antibodies. Cancer Res. 50,5767-5772. 58. Bock, S. N., Cameron, R. B., Kragel, P., Mute, J. J., and Rosenberg, S. A. (1991). Biological and antitumor effects of recombinant human macrophage colony stimulating factor in mice.. Cancer Res. 51,2649-2654. 59. Baldwin, R. W., and Byers, V. S. (eds). (1985). Monoclonal Antibodies for Tumour Detection and Drug Targeting.” Academic Press, London. 60. Thielemans, K., Maloney, D. G., Meeker, T., Fujimoto, J., Doss, C., Warnke, R. A., Bindl, J., Gralow, J., Miller, R. A., and Levy, R. (1984).Strategies for production of monoclonal anti-idiotype antibodies against human B cell lymphomas. J . Immunol. 133,495-501. 61. Abelev, G. I., Perova, S. D., Khramkova, N . I., Postnikova, Z. A,, Irlin, I. S. (1963). Reduction of embryonal a-globulin by transplantable mouse hepatomas. Transplantation 1, 174-180. 62. Gold, P., and Freedman, S. 0. (1965). Demonstration of tumor-specific antigen in human colonic carcinomata by immunological tolerance and absorption technique. J. E x p . Med. 121,439-462.
CHEMOIMMUNOCONJUCATES IN CANCER THEATMENT
365
63. Greaves, M. F., Brown, G., Rapson, N., and Lister, T. A. (1975). Antisera to acute lyinphoblastic leukaemia cells. Clin. Immunol. Immunopathol. 4, 67-84. 64. Corvalan, J. R. F., Axton, C. A., Brandon, 13. R., Smith, W., and Woodhouse, C. (1984).Classification of anti-CEA monoclonal antibodies. Protides B i d . Fluids 31, 921-924. 65. Hedin, A., Hammarstrom, S., and Larsson, A. (1982). Specificities and binding properties of eight monoclonal antibodies against carcinoembryonic antigen. Mol Iinmunol. 19, 1641-1648. 66. Micheel, B., Fiebach, H., Karsten, V., Goussey, A. I., Jazova, A. K.,and Kopp, J . (1983).Monoclonal antibodies to different epitopes on human a-fetoprotein (AFP). Eur J . Cancer Clin. Oncol. 19, 1239-1246. 67. Rogers, G. T., Rawlins, G. A., Kardana, A,, and Gibbons, A. R. (1983). Binding studies on two different monoclonal antibodies raised against CEA. Eur. J . Cancer Clin. Oncol. 19,629-639. 68. von Kleist, S., Chavanel, G., and Burtin, P. (1972).Identification ofa normal antigen that cross-reacts with the carcinoembryonic antigen. Proc. Natl. Acad. Sci. U.S.A. 69,2492-2494. 69. Burtin, P., Chavanel, G., and Hirsch-Marie, H. (1973).Characterisation of a second normal antigen that cross reacts with CEA. 1. Immunol. 111, 1926-1928. 70. Svenberg, T. (1976). Carcinoembryonic antigen-like substances of human bile: Isolation and partial characterisation. Int. J . Cancer 17, 588-596. 71. Dillman, R. O., Beauregard, J . , Sobol,R. E., Royston, I., Bartholomer, R. M., Hagan, P. S., and Halpern, S. E. (1984). Lack of radioimniunodetection and complications associated with monoclonal anti-carcinoenibryonic antigen antibody crossreactivity with an antigen on circulating cells. Cancer Res. 44, 2213-2218. 72. Harwood, P. J., Britton, D. W., Southall, P. J., Boxer, G. M., Rawlins, G., and Rogers, G. T. (1986). Mapping epitope characteristics on carcinoembryonic antigen. Br. J . Cancer 5 4 , 7 5 8 2 . 73. Zimniernian, W., Ortlieb, B., Friedrich, H., and von Kleist, S. (1987). Isolation and characterization of cDNA clones encoding the human carcinoembryonic antigen reveal a highly conserved repeating structure. Pror. Natl. Acad. Sci. U.S.A. 84, 2960-2964. 74. Hass, G. M., Bolling, T. J . , Kinders, R. J., Hanslee, J. G., Mandecki, W., Dorwin, S. A., and Shively, J. E. (1991). Preparation of synthetic polypeptide domains of carcinoembryonic antigen and their use epitope mapping. Cancer Res. 51, 1876- 1882. 75. Neville, A. M., and Cooper, D. B. (1976).BiocKemical monitoring of cancer. Ann. Clin. Biochem. 13, 283-305 76. Begent, R. H. J. (19SS). Recent advances in tumour imaging: Use of radiolabelled antitumour antibodies. Biocheni. Biophys. Acta 780, 151-166. 77. Casson, A. G., Ford, C. H. J., Marsden, H., Gallant, M. E., and Bartlett, S. E. (1986).“Efficacy of Monoclonal Anti-CEA Antibody-Vindesine Conjugate on Five Human Tumour Cell Lines Grown as Xenografts in Nude Mice: NCL Monographs. 78. Brown, J . P., Nishiyania, K., Hellstrom, I., and Hellstrom, K. E., (1981). Structural characterization of human melanoma-associated antigen p97 with monoclonal antibodies. J . Immunol. 127, 539-546. 79. Cuttitta, F., Rosen, S., Gazdar, A. F., and Minna, J. D. (1981).MonoclonaI antibodies that demonstrate specificity for several types of human lung cancer. Proc. Natl. Acad. Sci. U.S.A. 78,4591-4595. 80. Schlom, J . , Greiner, J., Hand, P. H., Colcher, D., Inghirami, G., Weeks, M., Pestka,
366
81.
82. 83.
84. 85. 86.
87. 88. 89.
90.
91.
92. 93. 94.
95.
GEOFFREY A. PIETERSZ ET AL.
S., Fisher, P. B., Noguchi, P., and Kufe, D. (1984). Monoclonal antibodies to breast cancer associated antigens as potential reagents in the management of breast cancer. Cancer 54,2777-2794. Ball, E. D., and Fanger, M. W. (1982).Monoclonal antibodies reactive with human myeloid leukaemia cells. Clin. E r p . Immunol. 48, 655-665. Levy, R., Dilley, J., Fox, R. I., and Warnke, R. (1979).A human thymus-leukaemia antigen defined by hybridoma monoclonal antibodies. Proc. Natl. Acad. Sci. U.S.A. 76,6552-6556. Nadler, L. M., Stashenko, P., Hardy, R., and Schlossman, S. F. (1980).A monoclonal antibody defining a lymphoma associated antigen in man. J . Immunol. 125, 570-577. Feizi, T. (1985). Demonstration by monoclonal antibodies that carbohydrate structures of glycoproteins and glycolipids are onco-developmental antigens. Nature (London)314,53-57. Harper, J. R., Bumol, T. F., and Reisfeld, R. A. (1984). Characterization of monoclonal antibody 155.8 and partial characterization of its proteoglycan antigen on human melanoma cells. J . Immunol. 132, 2096-2104. Slamon, D. J., Clark, G. M., Wong, S. G., Levin, W. J., Ullrich, A., and McGuire, W. L. (1987).Human breast cancer: Correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science 235, 177-182. Embleton, M. J., Rowland, G. F., Simmonds, R. G., Jacobs, E., Marsden, C. H., and Baldwin, R. W., (1983). Selective cytotoxicity against human tumour cells by a vindesine-monoclonal antibody conjugate. Er. J . Cancer 47, 43-49. Heldin, C. H., and Westermark, B. (1984). Growth factors; Mechanism of action and relation to oncogenes. Cell (Cambridge, Mass.) 37, 9-20. Chen, W., Peace, D. J., Rovira, D. K., You, S. G., and Cheever, M. A. (1992).Tcell immunity to the joining region of p210BCR-ABL protein. Proc. Natl. Acad. Sci. U.S.A. 89, 1468-1472. Shipp, M. A., Richardson, N . E., Sayre, P. H., Brown, N. R., Masteller, E. L., Clayton, L. K., Ritz, and Reinhersz, E. L. (1988).Molecular cloning ofthe common acute lymphoblastic leukemia antigen (CALLA) identifies a type of integral membrane protein. Proc. Natl. Acad. Sci. U.S.A.85, 4819-4823. Gendler, S., Taylor-Papadimitriou, J., Duhig, T., Rohlbard, J., and Burchell, J. (1988).A highly immunogenic region of a human polymorphic epithelial mucin expressed by carcinomas is made up of tandem repeats. 1. Eiol. Chem. 263, 12,820-12,823. Vikko, P., Virkkunen, P., Henttu, P., Roiko, K., Solin, T., and Huhtala, M-L. (1988). Molecular cloning and sequence analysis of cDNA encoding human prostatic acid phosphatase. FEBS Lett 236,275-281. Xing, P. X., Prenzoska, J., Layton, G. T., Devine, P., and McKenzie, I. F. C. (1992). Second generation monoclonal antibodies to intestinal MUC2 peptides reactive with colon cancer. J . Natl. Cancer Inst. 84,699-703. Buchegger, F., Haskell, L. M., Schreyer, M., Scazziga, B. R., Randin, S., Carrel, S., and Mach, J-P. (1983).Radiolabelled fragments ofmonoclonal antibodies against carcinoembryonic antigen for localization of human colon carcinoma grafted into nude mice. J . E r p . Med. 158,413-427. Goldenberg, D. M., Deland, F. H., Bennett, S. J., Primus, F. J., Nelson, M. O . , Flanigan, R. C., McRoberts, J. W., Bruce, A. W., and Mahan, D. E. (1983). In vivo use of radioactive antibodies against prostatic acid phosphatase for diagnosis and detection of prostatic cancer by nuclear imaging. J . Am. Med Assoc. 250, 630-635.
C H E M O I M M U N O C O N J U G A T E S I N CANCER T R E A T M E N T
367
96. Rainshury, R. M., Ott, R. J., Westwood, J. H., Kalirai, T. S, Coombes, R. C., McCready, V. R., Neville, A. M., and Gazet, J. C. (1983). Localisation ofmetastatic breast carconima by a monoclonal antibody chelate labelled with indium-111. Lancet ii, 934-938. 97. Larson, S. M., Carrasquillo, J. A., Krohn, K. A., Brown, J. P., McGuffin, J. P., Ferens, J. M., Graham, M. M., Hill, L. D., Beaumier, P. L., Hellstrom, K. E., and Hellstrom, I. (1983). Localization of 13'L-labelled p97 specific Fab fragments in human melanoma as a basis for radiotherapy. J. Clin. lnuest. 72, 2101-2114. 98. Pimm, M. V., Embleton, M. J., Perkins,A. C., Price, M. R., Robbins, R. A., Robinson, G. R., and Baldwin, R. W. (1982). In vivo localization of anti-osteogenic sarcoma 791T monoclonal antibody in osteogenic sarcoma xenografts. Int. J . Cuncer 30, 75-85. 99. Foon, K. A., Bernhard, M. I., and Oldham, R. K. (1983). Monoclonal antibody therapy: Assessment by animal tumor models. J. Biol Response Mod$. 1,277-304. 1 0 0 . Baldwin, R. W., and Pimm, M. V. (1983). Antitumor monoclonal antibodies for radioimmunodetection of tumors and drug targeting. Cancer Metast. Reu. 2, 89-106. 101. Armitage, N. C., Perkins, A. C., Pimm, M. V., Farrands, P. A., Baldwin, R. W., and Hardcastle, J . D. (1984). The localization of an anti-tumour monoclonal antibody (791T/36) in gastrointestinal tumours. Br. J. Surg. 71, 407-412. 102. Durrant, L. G., Robbins, R. A,, Armitage, N. C., Brown, A., Baldwin, R. W., and Hardcastle, J. D. (1986). Association of antigen expression and DNA ploidy in colorectal tumors. Cancer Res. 46, 3543-3549. 103. Andrew, S. M., Whitehead, R. H., Teh, J-G., Russell, S. M., Johnstone, R. W., McKenzie, I. F. C., and Pietersz, G . A. (1990). Tumor localization by combinations of monoclonal antibodies in a new human colon carcinoma cell line (LIM 1899). Cancer Res 50,5225-5230. 104. Ceriani, R. L., Blank, E. W., and Peterson, J. A. (1987). Experimental immunotherapy of human breast carcinomas implanted in nude mice with a mixture of monoclonal antibodies against human milk fat gIobule components. Cancer Res. 47, 532-540. 105. Smyth, M. J., McA Foster, H., Andrew, S. M., Teh, J-G., Krauer, K., McKenzie, I. F. C., and Pietersz, G. A. (1993). Immunochemotherapy of human colon carcinoma xenografts in nude mice using combinations of idarubicin-monoclonal antibody conjugates. lmmunol. Cell Biol. 71, 167-179. 106. DeDuve, C., De Barsy, T., Poole, B., Trouet, A., Tulkens, P., and Vainhoof, F. (1974). Lysomotropic agents. Biochem. Pharmacol. 23,2495-2531. 107. Uhr, J. W. (1984). Immunotoxins: Harnessing nature's poisons. J. Immunol. 133, i-x.
108. Aboud-Pirack, E., Sergent, T., Otte-Slachmuylder, C., Abarca, J., Trouet, A., and Schneider, Y-J. (1988). Binding and endocytosis of a monoclonal antibody to a high molecular weight human milk fat globule membrane-associated antigen by cultured MCF-7 breast cancer cells. Cancer Res. 48,3188-3196. 109. Casellas, P., Brown, J. P., Gros, O., Gros, P., Hellstrom, I., Jansen, F. K., Poncelet, P., Roncucci, R., Vidal, H., and Hellstrom, K. E. (1982). Human melanoma cells can be killed in vitro by an immunotoxin specific for melanoma-associated antigen p97. Znt. J. Cancer 30,437-443. 110. Carriare, D., Casellas, P., Richer, G.,Gros, P., and Jansen, F. K. (1985). Endocytosis of an antibody ricin A-chain conjugate (immuno-A-toxin) absorbed on colloidal gold. E x p . Cell Res. 156, 327-340. 1 1 1 . Della Torre, G . , Canevari, S., Orlandi, R., and Colnaghi, M. I. (1987). Internaliza-
368
GEOFFREY A. PIETERSZ ET AL.
tion of a monoclonal antibody against human breast cancer by immunoelectron microscopy. Br. J. Cancer 55,357-359. 112. Jansen, F. K., Blythman, H. E., Carriare, D., Casellas, P., Gros, O., Gros, P., Laurent, J. C., Paolucci, F., Pau, B., Poncelet, P., Richer, G . , Vidal, H., and Voisin, G . A. (1982). Immunotoxins: Hybrid molecules containing high specificity and potent cytotoxicity. Zmmunol. Reo. 62, 185-216. 113. Kagen, B. L., Finkelstein, A,, and Colombini, M. (1981). Diptheria toxin fragment forms large pores in phospholipid bilayer membranes. Proc. Natl. Acad. Sci. U.S.A. 78,4950-4954. 114. Thorpe, P. E., Ross, W. C. J., Brown,A. N. F., Myers,C. D.,Cumber,A. J., Foxwell, B. M. J., and Forrester, J. T. (1984). Blockade of the galactose-binding sites of ricin by its linkage to antibody: Specific cytotoxic effects of the conjugates. Eur. J . Biochem. 140,63-71. 115. Vitetta, E. S . , Krolick, K. A,, Miyama-Inaba, M., Cushley, W., and Uhr, J. W. (1983). Immunotoxins: A new approach to cancer therapy and immunoregulation. Science 219,644-650. 116. Machy, P., Barbet, J., and Leserman, L. D. (1982). Differential endocytosis of T and B lymphocyte surface molecules evaluated with antibody-bearing fluorescent liposomes containing methotrexate. Proc. Natl. Acad. Sci. U.S.A. 79, 4148-4152. 117. Poste, G., Kirsch, R., and Koestler, T. (1983). The challenge of liposome targeting in vivo. In “Liposome Technology: Targeted Drug Delivery and Biological Interaction” (G. Gregoriadis, ed.), Vol. 3, pp. 1-28. CRC Press, Boca Raton, FL. 118. Poste, G., and Kirsch, R. (1983). Site-specific (targeted) drug delivery in cancer therapy. Biotechnology 1, 869-878. 119. Manske, J. M., Buchsbaum, D. J., Azemove, S. M., Hanna, D. E., and Vallera, D. A. (1986). Antigenic modulation by anti-CD5 immunotoxins. J. Immunol. 136, 4721-4728. 120. Starling, J. J., Maciak, R. S., Law, K. L., Ann Hinson, N., Briggs, S. L., Laguzza, B. C., and Johnson, D. A. (1991).In vivo antitumor activity ofamonoclonal antibody vinca alkaloid immunoconjugate directed against a solid tumor membrane antigen characterized by heterogeneous expression and noninternalization of antibodyantigen complexes. Cancer Res. 51,2965-2972. 121. Mach, J-P., Carrel, S., Forni, M., Ritschard, J., Donath, A., and Alberto, P. (1980). Tumor localization of radiolabelled antibodies against carcino-embryonic antigen in patients with carcinoma: A critical evaluation. N . Engl. 1. Med. 303, 5-20. 122. Meeker, T. C., Lowder, J.. Maloney, D. G., Miller, R. A., Thielemans, K., Warnke, R., and Levy, R. (1985). A clinical trial of anti-idiotype therapy for B cell malignancy. Blood 65, 1349-1363. 123. Senter, P. A., Saulnier, M. G., Schreiber, G. J., Hirschberg, D. L., Brown, J. P., Hellstrom, I., and Hellstrom, K. E. (1988). Anti-tumor effects of antibody-alkaline phosphatase conjugates in combination with etoposide phosphate. Proc. Natl. Acad. Sci. U.S.A.85,4842-4846. 124. Kerr, D. E., Wallace, P. M., and Senter, P. D. (1991). Targeting 5-fluorouracil to tumors using antibody-cytosine deaminase conjugates in combination with 5fluorocytosine. Abstract P97 in Proceedings of the Sixth International Conference on Monoclonal Antibody Immunoconjugates for cancer. Antibiot. Immunoconj. Radiopharm. 4,229, 1991. 125. Andrew, S. M., Pimm, M. V., Perkins, A. C., and Baldwin, R. W. (1986).Comparative imaging and biodistribution studies with an anti-CEA monoclonal antibody and its F(ab)2 and Fab fragments in mice with colon carcinoma xenografts. Eur. /. Nucl. Med. 12, 168-175.
C H E M O I M M U N O C O N J U C A T E S I N CANCER T R E A T M E N T
369
126. Covell, D. G., Barbet, J., Holton, 0. D., Black, C. D. V., Parker, R. J,, and Weinstein, J. N. (1986). Pharniacokinetics of monoclonal immunoglobulin G1, F(ab‘)2, and Fab‘ in mice. Cancer Res. 46, 3969-3978. 127. Masuho, Y., Kishida, K., Saito, M., Uinemoto, N., and Hara, T. (1982). Importance of the antigen-binding valency and the nature of the crosslinking bond in ricin A-chain conjugates with antibody. Biochern. J. 9, 1583-1591. 128. Parham, P. (1983). On the fragmentation of monoclonal IgGl, IgG2a and IgC2h from Balb/c mice. J . Zmrnunol. 131, 2895-2902. 129. Smyth, M. J., Pietersz, G. A., and McKenzie, I. F. C. (1986).Selective enhancement of antitumour activity ofN-acetyl melphalan on conjugation to monoclonal antibodies. Concer Res. 47, 62-69. 130. Smyth, M. J., Pietersz, G. A,, and McKenzie, I. F. C. (1987).The in uitro and i n uiuo anti-tumour activity of N-AcMEL-F(ab’)2conjugates. Br. J. Cancer 55, 7-1 1. 131. Ghose, T., Huntley Blair, A., Kralovec, J.. Uadia, P. O., and Mammen, M. (1988). Synthesis and testing of antibody antifolate conjugates for drug targeting. In “Targeted Diagnosis and Therapy” (J. D. Rodwell, ed.), pp 81-122. Dekker, New York. 132. Chetie, V., Ghetie, M-A., Uhr, J. W., and Vitteta, E. S. (1988). Large scale preparation of immuntoxins constructed with the Fab’ fragment of IgCl murine monoclonal antibodies and chemically deglycosylated ricin A chain. /. fntrnunol. Methods 112,267-277. 133. Better, M., Chang, C., Robinson, R., and Horwitz, A. (1988). Escherichia coli secretion of an active chimeric antibody fragments. Science 240, 1041-1043. 134. Khazaeli, M. B., Saleh, M. N., Wheeler, R. H., Huster, W. J., Holden, H., Carrano, R., and LoBuglio, A. F. (1988). Phase I trial of multiple large doses of murine monoclonal antibody C017-1A: Pharmacokinetics and immune response. J. Nat!. Cancer Inst. 80,937-942. 135. LoBuglio, A. F., Wheeler, R. H., Trang, J., Haynes, A., Rogers, K., Harvey, E., Sun, L., Ghrayeb, J., and Khazaeli, M. (1989). Mouse/human chimeric monoclonal antibody in man: Kinetics and immune response. Proc. Natl. Acad. Sci. U.S.A.86, 4220-4224. 136. Huston, J. S., Levinson, D., and Mudgett-Hunter, M. (1988).Proteins engineering of antibody binding sites: Recovery of specific activity in an anti-digoxin singlechain Fv analogue produced in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A.85, 5879-5883. 137. Glockshuber, R., Malia, M., Pfitzinger, I., and Pluckthun, A. (1990). A comparison of strategies to stabilize immunoglobulin Fv fragments. Biochemistry. 29, 13621367. 138. Yokota, T., Milenic, D. E., Whitlow, M., and Schlom, J . (1992). Rapidtumorpenetration ofasingle-chain Fv and comparison with other immunoglobulin forms. Cancer Res. 52,3402-3408. 139. Colcher, D., Bird, R., Roselli, M., Hardman, K. D., Johnson, S., Pope, S., Dodd, S. W., Pantoliano, M. W., Milenic, D. E., and Scholam, T. (1990). In vivo tumor targeting of a recombinant single-chain antigen binding protein. J. Natl. Cancer. Znst. 82, 1191-1197. 140. Primus, F. J., Bennett, S . J,, Kim, E. E., De Land, F. H., Zahn, M. C., and Goldenberg, D. M. (1980).Circulating immnne complexes in cancer patients receiving goat radiolocalizing antibodies to carcinoembryonic antigen. Cancer Res. 40, 497-501. 141. Carrasquillo, J . A,, Krohn, K. A., Beaumier, P., McGuffin, R. W., Brown, J. P., Hellstrom, K. E., Hellstrom, I., and Larson, S. M. (1984). Diagnosis of and therapy
370
142.
143. 144.
145.
146. 147.
148. 149.
150.
151. 152. 153. 154.
155. 156.
GEOFFREY A. PIETERSZ ET A L
for solid tumours with radio-labeled antibodies and immune fragments. Cancer Treat. Rep. 68,317-328. Courtenay-Luck, N., Epenetos, A. A., Moore, R., Larche, M., Pectasides, D., Dhokia, B., and Ritter, M. A. (1986). Development of primary and secondary immune responses to mouse monoclonal antibodies used in the diagnosis and therapy of malignant neoplasms. Cancer Res. 46,6489-6493. Levy, R., and Miller, R. A. (1983). Tumor therapy with monoclonal antibodies. Fed. Proc. 42,2650-2656. Tjandra, J. J., Pietersz, C. A., Smyth, M. J., Teh, J. C., Cuthbertson, A. M., Sullivan, J. R., and McKenzie, I. F. C. (1989). Phase I clinical trial of drug-monoclonal antibody conjugates in patients with advanced colorectal carcinoma-A preliminary report. Surgery 106,533-545. Kitamura, K., Takahashi, T., Yamaguchi, T., Noguchi, A., Noguchi, A., Takashina, K., Tsurumi, H., Inagake, M., Toyokuni, T., and Hakomori, S. (1991).Chemical engineering of the monoclonal antibody A7 by polyethelene glycol for targeting cancer therapy. Cancer Res. 51,4310-4315. Lowder, J. N., Miller, R. A., Hoppe, R., and Levy, R. (1987). Suppression of anti-mouse immunoglobulin antibodies in subhuman primates receiving murinemonoclonal antibodies against T cell antigens. J . Zmmunol. 138,401-406. McDonald, K. W., Morrisey, D. V., Stone, B. A., Davis, G. L., McIntosh, P. K., and Moore, G. P. (1986).Genetically engineered murine/human chimeric antibody retains specificity for human tumor-associated antigen. J . Immunol. 137, 1066-1074. Kameyama, K., Itoh, T., Taniguchi, M., Miura, K., and Kurosawa, Y. (1989).Convenient plasmid vectors for construction of chimeric mouse/human antibodies. F E B S Lett. 244, 301-306. Beidler, C. B., Ludwig, J. R., Cardenas, J., Phelps, J., Papworth, C-C., Melcher, E., Sierzega, M., Myers, L. J., Unger, B. W., Fisher, M., David, C. %,and Jacqueline Johnson, M. (1988).Cloning and high level expression of a chimeric antibody with specificity for human carcioembryonic antigen. J . Zmmunol. 141, 4053-4060. Hale, G., Clark, M. R., Marcus, R., Winter, G., Dyer, M. J. S., Phillips, J. M., Reichmann, L., and Waldmann, H. (1988). Remission induction in non-Hodgkin lymphoma with reshaped human monoclonal antibody CAMPATH-1H. Lancet 17, 1394-1399. Sikora, K., Alderson, T., Ellis, J., Phillips, J., and Watson, J. (1983).Human hybridomas from patients with malignant disease. Br. J. Cancer 47, 135-145. Kozbor, D., Tripputi, P., Roder, J. C., and Croce, C. M. (1984). A human hybrid myeloma for production of human monoclonal antibodies. J. Zmmunol. 133, 3001-3005. hie, R. P., and Morton, D. L. (1986). Regression ofcutaneous metastatic melanoma by intralesional injection with human monoclonal antibody to ganglioside CD2. Proc. Natl. Acad. Sci. U.S.A. 83, 8694-8698. McCabe, R. P., Peters, L. C., Haspel, M. V., Pomato, N., Carrasquillo, J. A., and Hanna, M. G.,Jr. (1988). Preclinical studies on the pharmacokinetic properties of human monoclonal antibodies to colorectal cancer and their use for detection of tumors. Cancer Res. 4348-4353. Callego, J., Price, M. R., and Baldwin, R. W. (1984).Preparation offour daunomycin monoclonal antibody 791T/36 conjugates with anti-tumor activity. Znt. J. Cancer 33,737-744. Pietersz, C . A., Smyth, M. J., and McKenzie, I. F. C. (1987).The use ofanthracycline
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
157. 158.
159. 160.
161. 162. 163.
164. 165. 166. 167.
168. 169.
170. 171.
371
antibody complexes for specific anti-tumor therapy. In “Targeted Diagnosis and Therapy” ( J . D. Rodwell, ed.) Vol. 1. Dekker, New York. Cassidy, J . M., and Douros, J. D. (eds.) (1980). Anticancer agents based on natural product models: “Medicinal Chemistry,” Vol 16. Academic Press, New York. Shen, W-C., Ballou, B., Ryser, H. J-P., and Hakala, T. R. (1986).Targeting internalization and cytotoxicity of methotrexate-monoclonal anti-stage specific embryonic antigen-1 antibody conjugates in cultured F.9 teratocarcinoma cells. Cancer Res. 46, 3912. Hurwitz, E., Kashi, R., Arnon, R., Wilchek, M., and Sela, M. (1985). T h e covalent linking of two nucleotide analogues to antibodies. /. Med. Chem. 28, 137-140. Kanellos, J., Pietersz, G. A., Cunningham, Z., and McKenzie, I. F. C. (1987). Antitumor activity of aminopterin-monoclonal antibody conjugates: In uitro and in uiuo comparison with methotrexate monoclonal %ntibody conjugates. Imnrutiol. Cell. B i d . 65, 483-493. Goerlach, A,, Krauer, K. G., McKenzie, I . F. C., and Pietersz, G. A. (1991). In uitro antitumor activity of 2’-deoxy-5-fluorouridine monoclonal antibody conjugates. Bioconj. Chem. 2, 96-101. Smyth, M. J . , Pietersz, G. A., Classon, B. J . , and McKenzie, I . F. C . (1986). The specific targeting of chlorambucil to tuniours. /. Natl. Cancer Inst. 76, 503-510. Li, S., Zhang, X-Y., Zang, S-Y., Chen, X-T., Chen, L-J.,Shu, Y-H, Zhang, J-L., and Fan, D-M. (1990). Preparation of antigastric cancer monoclonal antibody MGb2mitoniycin C conjugate with improved antitumor activity. Bioconj. Chem. 1, 245-250. Koch, B., Baum, W., Beck, E., Eger, G., Rohwer, P., Kalden, J. R . , and Gramatzki, M. (1991). In vitro activity of inimunoconjugates between cis-platinum and monoclonal antibodies. Antibiot. Inimutioconj. Radiopharm. 2, 121-132. Linford, J. H . , Froese, G., Berczi, I., and Israels, G. (1974). An alkylating agentglobulin conjugate with both alkylating and antibody activity./. Natl. Cancer Inst. 52, 1665-1667. Rowland, G. F., O’Neill, G. J . , and Davies, D. A. L. (1975). Suppression oftumor growth in mice by a drug-antibody conjugate using a novel approach to linkage. Nature (London)255, 487-488. Sivam, G., Comezoglu, F. T., Vrudhula, V. M., Riker, K., Manger, R., Gray, M . A., Srinivasan, A., Jarvis, B. B., and Morgan, A. C. (1990). Immunoconjugates of a small molecule protein synthesis inhibitor (trichothecene)-an update. Abstract 102, in Proceeding of the 5th International Conference on Monoclonal Antibody Conjugates for Cancer. Antib. Imtnunoconj. Rudiopharma. 3, 63. Ohtani, K., Murakami, H., Shibuya, O., Kawamura, O., Ohi, K., Chiba, J., Otakawa, M., and Ueno, Y. (1990). Antitumor activity of T-2 toxin-conjugated monoclonal antibody to murine thymoma. J p n . /. E x p . Med. 60, 57-65. Laguzza, B. C., Nichols, C. L., Briggs, S. L., Cullinan, G. J., Johnson, D. A., Starling, J. J., Baker, A. L., Bumol, T. F., and Corvalan, J. R. (1989). New antitumor monoclonal antibody-vinca conjugates LY-203725 and related compounds: Design, preparation, and representative in vivo activity. /. Med. Chem. 32, 548-555. Cotter, T. G., Fecycz, T., and O’Malley, K. (1984). Monoclonal antibody mediated delivery of deacetylcolchicine to human peripheral blood neutrophils. Biochem. Soc. Trans. 12, 452. Pietersz, G. A., Krauer, K. G., Holessis, H., and McKenzie, I. F. C. (1991).Conjugation in vitro and in vivo efficacy of highly cytotoxic anticancer drugs-Aminopterin (AMN), 5-fluoro-2-deoxyuridine (5-FUDr) and podophyllotoxin. Abstract P-85. In
372
172.
173. 174.
175. 176. 177.
178.
179.
180.
181.
182.
183.
184.
GEOFFREY A. PIETERSZ ET A L .
“Proceedings of the 5th International Conference on Monoclonal Antibody Immunoconjugates for Cancer,” Vol. 4, p 226. Sweet, F., Rosik, L. D., Sommers, G. M., and Collins, J. L. (1989). Daunorubicin conjugated to a monoclonal anti-CAl25 antibody selectively kills human ovarian cancer cells. Gynecol. Oncol. 34, 305-311. Galun, E., Shouval, D., Adler, R., Shahaar, M., Wilchek, M., Hurwitz, E., and Sela, M. (1990). The effect of anti-a-fetoprotein adriamycin conjugate on a human hepatoma. Hepatology 11, 578-584. Manabe, Y., Tsubota, T., Haruta, Y., Okazaki, M., Haisa, S., Nakamura, K., and Kimura, I. (1983). Production of a monoclonal antibody-bleomycin conjugate utilising dextran T-40 and the antigen-targeting cytotoxicity of the conjugates. Biochem. Biophys. Res. Commun. 115,1009-1014. Pietersz, G. A., Smyth, M. J., and McKenzie, I. F. C. (1988). Immunochemotherapy of a murine thymoma with the use of idarubicin monoclonal antibody conjugates. Cancer Res. 48, 926-931. Manabe, Y., Tsubuta, T., Haruta, Y., Okazaki, M., Haisa, S., Nakamura, K., and Kimura, I. (1984). Production of a macromomycin (MRC)-monoclonal antibody conjugate and its biological activity. Biochem. Pharmacol. 33, 2143-2145. Mueller, B. M., Reisfeld, R. A., Silveira, M. H., Duncan, J. D., and Wrasidlo, W. A. (1991).Preclinical therapy ofhuman melanoma with morpholino-doxorubicin conjugated to a monoclonal antibody directed against an integrin on melanoma cells. Antibiot. Immunoconj. Radiopharm. 2,99-109. Hermentin, P., Doenges, R., Granski, P., Bosslet, K., Kraemer, H. P., Hoffman, D., Zilg, H., Steinstresser, A., Schwartz, A., Kuhlmann, L., Luben, G . , and Seiler, F. R. (1991). Attachment of rhodosaminylanthracyclinone-typeanthracyclines to the hinge region of monoclonal antibodies. Bioconj. Chem. 2, 100-107. Greenfield, R. S., Trail, P. A., and Dalton, K. (1991). 13-Acylhydrazone anthracycline immunoconjugates: Improved therapy by linking carminomycin a more potent analog of adriamycin to the anticarcinoma MAB BR64. Abstract P.89. In “Proceedings of the 5th International Conference on Monoclonal Antibody Immunoconjugates for Cancer,” Vol. 4, p. 227. Iwahashi, T., Tone, Y., Usui, J., Watanabe, H., Sugawara, I., Mori, S., and Okazaki, H. (1989). Selective killing of carcinoembryonic-antigen (CEA) producing cells in vitro by the immunconjugate cytorhodin-S and CEA-reactive cytorhodin-S antibody CA208. Cancer Zmmunol. Zmmunother. 30,239-246. Alberici, G. F., Pallardy, M., Manil, L., Dessaux, J-J., Fournier, J., Mondesir, J-M., Bohuon, C., and Gros, P. (1988). Conjugates of elliptinium acetate with mouse monoclonal anti-a-fetoprotein antibodies or Fab fragments: In vitro cytotoxic effects upon human hepatoma cell lines. Int. J . Cancer 41, 309-314. Chari, R. J., Gross, J. L., Goldmacher, V. S., Martell, B. A., and Blattler, W. A. (1990). Abstract 104 in Proceedings of the 5th International Conference on Monoclonal Antibody Immunoconjugates for Cancer. Antibiot. Zmmunoconj. Radiopharm 3, 64. Hinman, L. M., Wallace, R. E., Hamann, P. R., Durr, F. E., and Upeslacis, J. (1990). Abstract 84 in Proceedings of the 5th International Conference on Monoclonal Antibody Immunoconjugates for Cancer. Antibiot. Zmmunoconj. Radiopharm. 3, 59. Rodwell, J. D., Alvarez, V. L. Lee, C., Lopes, A. D., Goers, J. W. F., King, H. D., Powsner, H. J., and McKearn, T. J. (1986). Site specific covalent modification of monoclonal antibodies: In vitro and in vivo evaluations. Proc. Natl. Acad. Sci. U.S.A.83,2632-2636.
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
373
185. Endo, N., Umemoto, N., Kato, Y., Takeda, Y., and Hara, T. (1987).A novel covalent modification of antibodies at their amino groups with retention of antigen binding activity. J. Zmmunol. Methods 104, 253-258. 186. Avrameas, S. (1969). Coupling of enzymes to proteins with glutaraldehyde: Use of conjugates for the detection of antigens and antibodies. Zrnmunochemistry 6, 43-52. 187. Mohamed, G., Brown, J. M., Greager, J. A., Sinkule, J., and Das Gupta, T. K. (1986). Analysis of adriamycin linked to an anti-sarcoma monoclonal antibody. Pro. A.A.C.R.27, 317. [Abstract 12561. 188. Hunvitz, E., Kashi, R., Arnon, R., Wilchek, M., and Sela, M. (1985).T h e covalent linking of two nucleotide analogues to antibodies. J. Med. Chem. 28, 137-140. 189. Carraway, K. L., and Koshland, D. E. (1972).Carbodiimide modification ofproteins. Methods Enzymol. 25,616-623. 190. Tirnkovich, R. (1977). Polymerization side reactions during protein modification with carbodiimide. Biochern. Biophys. Res. Conimun. 74, 1463-1468. 191. Kulkarni, P. N., Blair, A. H., and Ghose, T. I. (1981).Covalent binding ofmethotrexate to immunoglobulins and the effect of antibody-linked drug on tumor growth in vivo. Cancer Res. 41, 2700-2706. 192. Anderson, G. W., Zimmerman, J . E., and Callahan, F. M. (1964). The use ofesters of N-hydroxysuccinimide in peptide synthesis. J. Am. Chem. Sac. 86, 18391842. 193. Martin, W. J., Wunderlich, J. R., Fletcher, F., and Inman, J. K. (1971).Enhanced iminunogenicity of chemically coated syngeneic tumor cells. Proc. N a t l . Acad. Sci. U.S.A. 68,469-472. 194. Endo, N., Takeda, Y., Umemoto, N., Kishida, K., Watanabe, K., Saito, M., Kato, Y., and Hara, T . (1988). Nature of linkage and mode of action of methotrexate conjugated with antitumor antibodies: Implications for future preparation of conjugates. Cancer Res. 48, 3330-3335. 195. Yang, H. M., and Reisfeld, R. A. (1988).Doxorubicin conjugated with a monoclonal antibody directed to a melanoma associated proteoglycan suppresses the growth of established tumour xenografts in nude mice. Proc. N a t l . Acad. Sci. U.S.A. 85, 1189-1 193. 196. Dillman, R. O., Johnson, D. E., Shawler, D. L., and Koziol, J. A. (1988). Superiority of an acid-labile claunorubicin-monoclonal antibody immunoconjugate compared to free drug. Cancer Res. 48,6097-6102. 197. Burnstein, S . , and Knapp, R. (1977). Chemotherapy of murine ovarian carcinoma by methotrexate-antibody conjugates. J. Med. Chem. 20, 950-952. 198. Latif, Z. A,, Lozzio, B. B., Wust, C . J., Krauss, S., Aggio, M. C., and Lozzio, C. B. (1980).Evaluation ofdrug-antibody conjugates in the treatment ofhuman myelosarcomas transplanted in nude mice. Cancer (Philadelphia) 45, 1326- 1333. 199. De Carvalho, S., Rand, H. J., and Lewis, A. (1964).Coupling ofcyclic chemotherapeutic compounds to immune y globulins. Nature (London) 202,255-258. 200. Calendi, E., Constanzi, G., Indiveri, F.,Lotti, G., and Zini, C . (1969).Histoimmunologic specificity of an anti-lymphoid tissue sarcoma y-globulin bound to methotrexate. Bull. Chim. Farm. 108, 25-28. 201. Robinson, D. A., Whiteley, J. M., and Harding, N. G. L. (1973). Cell directed antimetabolites: Alternative syntheses of cytotoxic methotrexate-containing macromolecules. Biochem. Soc. Trans. 1, 722-726. 202. Harding, N . G. L., (1971).Amethopterin linked covalently to water soluble macromolecules. Ann. N. Y. Acad. Sci. 186,270-283. 203. Worrell, N. R., Cumber, A. J., Parnell, G. D., Mirza, A., Forrester, J. A., and ROSS,
374
GEOFFREY A. PIETERSZ ET AL.
W. C. J. (1986).Effect of linkage variation on pharmacokinetics of ricin. A chainantibody conjugates in normal rats. Anti Cancer Drug Design. 1, 179-188. 204. Letvin, N. L., Goldmacher, V. S., Ritz, J., Yetz, J. M., Schlossman, S. F., and Lambert, J. M. (1986).In viva administration of lymphocyte-specific monoclonal antibodies in non human primates: In vivo stability of disulfide-linked immunotoxin conjugates. J . Clin. Invest. 77,977-984. 205. Cumber, A. J., Forrester, J . A,, Foxwell, B. M. J., Ross, W. C. J., and Thorpe, P. E. (1985).In “Methods in Enzymology” (K. J. Widder and R. Green, eds.), Vol 112,pp. 207-225. Academic Press, Orlando, FL. 206, Carlsson, J., Drevin, D., and Axen, R. (1978).Protein thiolation and reversible protein-protein conjugation: N-succinimidyl 3-(2-pyridyldithio)propionate, a new heterobifunctional reagent. Biochem 1. 173, 723-737. 207. Miyazaki, H., Beppu, M., Terao, T., and Osawa, T. (1980).Preparation of antibody (1gG)-ricin A-chain conjugate and its biologic activity. Gann 71,766-774. 208. Weil-Hillman, G., Runge, W., Jansen, F. K., and Vallera, D. A. (1985).Cytotoxic effect of anti-Mr 67,000protein immunotoxins on human tumors in a nude mouse model. Cancer Res. 45,1328-1336. 209. Thorpe, P. E., Wallace, P. M., Knowles, P. P., Relf, M. G., Brown, A. N . F., Watson, G. J., Knyba, R. E., Wawrzynczak, E. J., and Blakey, D. C.(1987).New coupling agents for the synthesis of immunotoxins containing a hindered disulfide bond with improved stability in vivo. Cancer Res. 47, 5924-5931. 210. Garnett, M. C., Embleton, M. J., Jacobs, E., and Baldwin, R. W. (1983). Preparation and properties of a drug-carrier-antibody conjugate showing selective antibodydirected cytotoxicity in vitro. Int. J. Cancer, 31, 661-670. 211. Abuchowski, A., Van Es, T., Palczuk, N. C., and Davis, F. F. (1977). Alteration of immunological properties of bovine serum albumin by covalent attachment of polyethylene glycol. 1. Biol. Chem. 252, 3578-3581. 212. Guclu, A,, Ghose, T., Tai, J., and Mammen, M. (1976).Binding of chloranibucil with antitumor globulines and its effect on drug and antibody activities. Eur. 1. Cancer 12,95-100. 213. Apelgren, L.D., Zimmernian, D. L.,Briggs, S. L.,and Bumol, T. F. (1990). Antitumor activity ofthe monoclonal antibody vinca alkaloid immunconjugate LY203725 (KS 1/4-4-desacetylvinblastine-3-carboxyhydrazide)in a nude mouse model of human ovarian cancer. Cancer Res. 50,3540-3544. 214. Bumo1.T. F., Baker, A. L.,Andrews, E. L.,Dettterdt, S. V., Briggs, S. L.,Spearman, M .E., and Apelgren, L. D. (1988).KSl/CDAVLB, a monoclonal antibody-vinca alkaloid conjugate for site-directed therapy of epithelial malignancies. In “Targeted Diagnosis and Therapy” ( J . D. Rodwell, ed.), pp. 55-79.Dekker, New York. 21 5 . Goldmacher, V. S., Senter, P. D., Lambert, J. M., and Blattler, W. A. (1992). Photoactivation of toxin conjugates. Bioconj. Chem. 3, 104-107. 216. Pietersz, G. A., Cunningham, Z., and McKenzie, I. F. C. (1988).Specific in vitro antitumonr activity of methotrexate-monoclonal antibody conjugates prepared using human serum albumin as an intermediary. Immunol. Cell. Biol. 66,43-49. 217. Kanellos, J., Pietersz, G. A., and McKenzie, I. F. C. (1985).Studies ofmethotrexatemonoclonal antibody conjugates for immunotherapy. J. Natl. Cancer. lnst. 75, 319-332. 218. Hurwitz, E., Wilchek, M., and Pitha, J. (1980).Soluble macromolecules as carriers for daunorubicin. 1.A p p l . Biochem. 2,25-35. 219. Shih, L. B., Xuan, H., Sharkey, R. M., and Goldenberg, D. M. (1990).A fluorouridine-anti-CEA immunoconjugate is therapeutically effective in a human colonic cancer xenograft model. Int. J. Cancer 46, 1101-1106.
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
375
220. Tsukada, Y., Ohkawa, K., and Hibi, N. (1985).Suppression ofhuman a-fetoproteinproducing hepatocellular carcinoma growth in nude mice by an anti a-fetoprotein antibody-daunorubicin conjugate with a poly-L-glutamic acid derivative as intermediate drug carrier. Br. J . Cancer 52, 111-116. 221. Ohkawa, K., Tsukada, Y., Hibi, N., Umemoto, N., and Hara, T. (1986). Selective in vitro and in vivo growth inhibition against human yolk sac tumor cell lines by purified antibody against human a-fetoprotein conjugated with mitomycin C via human serum albumin. Cancer Immunol. ltnmunother 23,81-86. 222. Hakala, M. T. (1974). Transport of antineoplastic agents. Handb. E x p . Pharmakol. 34,240-269. 223. Shen, W-C., and Ryser, H.J-P. (1981).Cis-aconityl spacer between daunomycin and macromolecular carriers: A model of pH-sensitive linkage releasing drug from a lysosomotropic conjugate. Biochem. Biophys. Res. Commun. 102, 1049-1054. 224. Peterson, C., and Trouet, A. (1978). Transport and storage of daunorubicin and doxorubicin in cultured fibroblasts. Cancer Res. 38, 4645-4649. 225. Rowland, G. F., Axton, C. A,, Baldwin, R. W., Brown, J. P., Corvalan, J. R. F., Embleton, M. J., Gore, V. A,, Hellstrom, I., Hellstrom, K. E., Jacobs, E., Marsden, C. H., Pimm, M. V., Simmonds, R. G., and Smith, W. (1985). Antihimor properties of vindesine-monoclonal antibody conjugates. Cancer lmmunol. Immunother. 19, 1-7. 226. Bradford, M. M. (1976).A rapid and sensitive method of quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72,248-253. 227. Garnett, M. C . , Embleton, M. J . , Jacobs, E., and Baldwin, R. W. (1985). Studies on the mechanism of action of an antibody targeted drug-carrier conjugate. Anti Cancer Drug Design 1, 3-12. 228. Ichihashi, H., Kondo, T., Sakakibara, S., Akiyama, S., and Watanabe, T. (1984). Application of radioactive precursors for the evaluation of sensitivity of cancer cells to anticancer drugs. Oncology 41, 88-95. 229. Mew, D., Lum, V., Wat, C. K., Towers, G . H. N., Sun, C-H.C., Walter, R. J., Wright, W., Berns, M. W., and Levy, J. G. (1985).Ability of specific monoclonal antibodies and conventional antisera conjugated to hematoporphyrin in label and kill selected cell lines subsequent to light activation. Cancer Res. 45,4380-4386. 230. Ford, C. H., Richardson, V. J., and Tsaltas, G. (1989). Comparison of tetrazolium colorimetric and 3H-uridine assays for in vitro chemosensitivity testing. Cancer Chemother. Pharmacol. 24,295-301. 231. Epstein, J . , Rosenthal, R. W., and Ess, R. J. (1955).Use ofa-(4-nitrobenzyl)pyridine as analytical reagent for ethyleniniines and alkylating agents. Anal. Chem. 27, 1435-1439. 232. Parish, C. R., and McKenzie, 1. F. C. (1978). A sensitive rosetting method for detecting subpopulations of lymphocytes which react with alloantisera. J . lmnuno/. Methods 20, 173-183. 233. Robbins, R. A., Laxton, R. R., Garnett, M., Price, M. R., and Baldwin, R. W. (1986). Measurement of tumour reactive antibody and antibody conjugate by competition quantitated by flow cytofluoronietry. J . lmmunol. Methods 90, 165-172. 234. Tsukada, Y., Kischof, W.K-D, Hibi, N., Hirai, H., Hurwitz, E., and Sela, M . (1982). Effect of a conjugate of daunomycin and antibodies to rat a-fetoprotein on the growth of a-fetoprotein-producing tumor cells. Proc. Natl. Acad. Sci. U.S.A. 79, 621-625. 235. Blakey, D. C., Wawrzynczak, E. J., Stirpe, F., and Thorpe, P. E. (1987).Antitumor activity of a panel of anti-Thyl.2 immunotoxins made with different ribosome-
376
GEOFFREY A. PIETERSZ ET AL.
inactivating proteins. In “Membrane Mediated Cytotoxicity,” pp. 195-209. A. R. Liss, New York. 236. Pietersz, G. A,, Kanellos, J., Smyth, M. J., Zalcberg, J., and McKenzie, I. F. C. (1987). The use of monoclonal antibody conjugates for the diagnosis and treatment of cancer. lmmunol. Cell. Biol. 65, 111-125. 237. Kishida, K., Masuko, Y., Saito, M., Hara, T., and Fuji, H. (1983). Ricin A-chain conjugated with anti-Ll210 antibody: In uitro and in oiuo antitumor activity. Cancer lmmunol. lmmunother. 16,93-97. 238. Krollick, K. A,, Uhr, J . W., Slavin, S., and Vitteta, E. S. (1982). In uiuo therapy of a murine B cell tumor (BCL1) using antibody-ricin A chain immunotoxins. J. E x p . Med. 155, 1797-1809. 239. Shah, S. A., Halloran, P. M., Ferris, C. A,, Levine, B. A., Bourret, L. A., Goldmacher, V. S., and Blattler, W. A. (1993). Anti-B4-blocked ricin immunotoxin shows therapeutic efficacy in four different SCID mouse tumour models. Cancer Res. 53, 1360-1367. 240. Philips, R. A., Jewett, M. A. S., and Gallie, 8 . L. (1989). Growth of human tumors in immunodeficient SCID mice and nude mice. Cancer Top. Microbiol. lmmunol. 152,259-263. 241. Ghetie, M. A., Tucker, K., Richardson, J.. Uhr, J. W., and Vitetta, E. S. (1992). The antitumor activity of an anti-CD22 immunotoxin in SCID mice with disseminated daudi lymphoma in enhanced by either an anti-CD19 antibody or an anti-CD19 immunotoxin. Blood 80,2315-2320. 242. Smyth, M. J., Bogdanovski, M., McKenzie, I. F. C., and Pietersz, G. A. (1991). The antitumor activity of idarubicin monoclonal antibody conjugates in a disseminated thymoma model. Cancer Res. 51,310-317. 243. Krauer, K. (1992). “Drug Immunoconjugates in the Treatment of Cancer.” University of Melbourne. 244. Maier, L. A., Jixu, F., Hester, S., Boyer, C. M., McKenzie, S., Bruskin, A. M., Argon, Y., and Bast, R. C. (1991). Requirements for the internalization of a murine monoclonal antibody directed against the HER-e/neu gene product c-erbB-2. Cancer Res. 51,5361-5369. 245. Robbins, P. F., Kantor, J. A., Salgaller, M., Hand, P. H., Fernsten, P. D., and Schlom, J. (1991). Transduction and expression of the human carcinoembryonic antigen gene in a murine colon carcinoma cell line. Cancer Res. 51, 3657-3662. 246. Hendrix, P. G., Dauwe, S. E., Van De Voorde, A., Nouwen, E. J., Haylaerts, M. F., and De Broe, M. E. (1991). Radiolocalization and imaging stably PLAPtransfected M 0 4 tumors with monoclonal antibodies and fragments. Br. J. Cancer 64,1060-1068. 247. Bresalier, R. S., Hujanan, E. S., Raper, S. E., Rolls, F. J., Itzkowtiz, S. H., Martin, G. R., and Kim, Y. S. (1987).An animal model for colon cancer metastasis: Establishment and characterization of murine cell lines with enhanced liver-metastasizing ability. Cancer Res. 47, 1398-1406. 248. Martin, D. S., Balis, M. E., Fisher, B., Frel, E., Freireich, E. J.. Heppner, G. H., Holland, J. F., Houghton, J. A., Houghton, P. J., Johnson, R. K., Mittleman, A., Rustum, Y., Sawyer, R. C., Schmid, F. A., Stolfi, R. L., and Young, C. W. (1986).Role of murine tumor models in cancer treatment research. Cancer Res. 46,2189-2192. 249. Cline, M. J., and Haskell, C. M. (1975). Classes of chemotherapeutic agents. In “Cancer Chemotherapy,” 2nd Ed., pp. 35-36. Saunders, Philadelphia. 250. Moore, C. E., Bross, E. D., Ausman, R., Nadler, S., Jones, R., Jr., Slack, N., and Rimm, A. A. (1968). Effects of chlorambucil (NSC-3088) in 374 patients with advanced cancer. Cancer Chemother. Rep. 52,661-666.
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
377
251. Hurwitz, E., Kashi, R., and Wilchek, M. (1982). Platinium-complexed antitumor immunoglobulins that specifically inhibit DNA synthesis of mouse tumor cells. J. Natl. Cancer Znst. 69,47-51. 252. O’Neill, G . J., Pearson, B. A., and Davies, D. A. L. (1975). In vitro cytotoxicity of anti-0 (Thy-1) antibodies combined with chlorambucil. Immunology. 28,323-329. 253. Blakeslee, D., Chen, M., and Kennedy, J . C. (1975).Aggregation of chlorambucil in vitro may cause misinterpretation of protein binding data. Br. J. Cancer. 31, 689-692. 254. Tung, E . , Goust, J. M., Chen, W. Y., Kang, S. S., and Wang, A. C. (1983).Cytotoxic effect of anti-idiotype antibody-chlorambucil conjugates against human lymphoblastoid cells. Zmmunology 50, 57-64. 255. Ross, W. C. J. (1975). T h e conjugation of chlorambucil with human y-globulin. Chem. Biol. Znteractions 10, 169-172. 256. Rowland, G . F . (1977). Effective antitumour conjugates of alkylating drug and antibody using dextran as the intermediate carrier. Eur. J. Cancer, 13, 593-596. 257. Bernier, L. G . , Page, M., Gaudreault, R. C., and Joly, L. P. (1984).A chlorambucilanti-CEA conjugate cytotoxic for human colon adenocarcinoma cells in vitro. Br. J . Cancer. 49,245-246. 258. Hirschberg, H . , Rowland, G., Thorsby, E., and Lucas, D . (eds.) (1977).In “Proceedings of the 1 l th Leukocyte Culture Conference,” p. 614. Academic Press, New York. 259. Rowland, G. F . , O’Neill, G. J., and Davies, D. A. L. (1975). Suppression oftunlour growth in mice by a drug-antibody conjugate using a novel approach to linkage. Nature (London)255,487-488. 260. Linford, J. H . , Froese, G., Berczi, I., and Israels, L. G. (1984).An alkylating agentglobulin conjugate with both alkylating and antibody activity. ]. Natl. Cancer Znst. 52, 1665-1667. 261. Warzynski, M. J . S., Cochran, K. W., and Ackerman, W. W. (1980). Conjugation of triaziquinone to immunoglobulin G by a thiolation procedure catalyzed by 2pyridinealdoxime methiodide. J. Zmmuiaol. Methods 35, 157-168. 262. White, F. H . , Jr. (1972).In “Methods in Enzymology” (S. P. Colowick and N. 0. Kaplan, eds.), Vol. 25, p. 541. 263. Davidson, J . P., Faber, P. J., Fischer, R. G., Jr., Mansy, S., Peresie, H. J., Rosenberg, B., and Van Camp, L. (1975).“Platinum-pyrimidine blues” and related complexes: A new class of potent antitumor agents. Cancer Chemother. Rep. 59, 287300. 264. Suzuki, T., Sato, E., Goto, K., Katsurada, Y., Unno, K., and Takahashi, T. (1981). Th e preparation of mitomycin C, adriamycin and daunomycin covalently bound to antibodies as improved cancer chemotherapeutic agents. Chem. Pharm. Bull. 29,844-848. 265. Umemoto, N., Kato, Y., Takeda, Y., Saito, M., Seto, M., and Takahashi, T. (1984). Conjugates of mitomycin C with the immunoglobulin M fragment of a monoclonal anti-MM46 immunoglobulin M antibody with or without serumalbuminas intermediary. J. Appl. Biochem. 6, 297. 266. Manabe, Y., Tsubata, T., Haruta, T., Katoaka, K., Okazaki, M., Haisa, S., Nakamura, K., and Kimura, I. (1985). Production of a monoclonal antibody mitomycin C conjugate, utilizing dextran-T40, and its biological activity. Biochem. Pharmacol. 34,289-291. 267. Pietersz, G. A., Krauer, K., Toohey, B., Smyth, M. J., and McKenzie, I. F . C. (1990). Biodistribution of N-acetylmelphalan-monoclonal antibody conjugates in mice. Antibiot. Zmmunoconj. Radiopharm. 3,27-35.
378
GEOFFREY A. PIETERSZ ET AL
268. Phillips, F. S., Gilladoga, A., Marquardt, H., Sternberg, S. S., and Vidal, P. M. (1975). Some observations on the toxicity of adriamycin (NSC-123127). Cancer Chemother. Rep. 6, 177-181. 269. Halazun, J. F., Wagner, H. R., Gaeta, G. F., and Sinks, L. F. (1974). Daunorubicin cardiac toxicity in children with acute lymphoblastic leukemia. Cancer 33, 545-554. 270. Lenaz, L., and Page, J. A. (1976).Cardiotoxicity of adriamycin and related anthracyclines. Cancer Treat. Reu. 3, 111-120. 271. Levy, R., Hunvitz, E., Maron, R., Amon, R., and Sela, M. (1975). The specific cytotoxic effects of daunomycin conjugated to antitumor antibodies. Cancer Res. 35,1182-1 186. 272. Hunvitz, E., Maron, R., Arnon, R., and Sela, M. (1976). Fab dimers of antitumor immunoglobulins as covalent carriers of daunomycin. Cancer Biochern. Biophys. 1, 197-202. 273. Hunvitz, E., Maron, R., Amon, R., Wilchek, M., and Sela, M. (1978). Daunomycinimmunoglobulin conjugates, uptake and activity in vitro. Eur. J. Cancer 14, 1213-1220. 274. Belles-Isles, M., and Page, M. (1980). In vitro activity of daunomycin-anti-a foetoprotein conjugate on mouse hepatoma cells. Br. J . Cancer 41,841-842. 275. Lee, F. H., Berczi, I., Fujimoto, S . , and Sehon, A. H. (1978). The use of antifibrin antibodies for the destruction of tumor cells. 111. Complete regression of MC-D sarcoma in guinea-pigs by conjugates of daunomycin with antifibrin antibodies. Cancer Immunol. lmmunother. 5,201-206. 276. Richardson, V. J., Ford, C. H. J., Tsaltas, G., and Gallant, M. E. (1989).Doxorubicin anti-carcinoembryonic antigen immunoconjugate activity in uitro. Eur. J . Clin. Oncol. 25,633-640. 277. Shen, W-C., and Ryser, H.J-P. (1981). Conjugation of methotrexate to 5 basic polypeptides: Comparison of inhibitory effect on cells defective in drug transport. Fed. Proc. 40,642. [Abstract 23541. 278. Diener, E., Diner, U. E., Sinha, A., Xie, S., and Vergidis, R. (1986). Specific immunosuppression by immunotoxins containing daunomycin. Science 231, 148-150. 279. Monsigny, M., Kieda, C., Roche, A. C., and Delmotte, F. (1980). Preparation and biological properties of a covalent antitumor drug-arm-carrier (DAC conjugate). FEBS Lett. 119,181-186. 280. Zunino, F., Gambetta, R., Vigevani, A., Penco, S., Geroni, C., and DiMarco, A. (1981). Biologic activity of daunorubicin linked to proteins via the methylketone side chain. Tumori 67,521-524. 281. Braslawsky, G . R., Edson, M. A,, Pearce, W., Kaneko, T., and Greenfield, R. S. (1990). Antitumor activity of adriamycin (hydrazone-linked) immunoconjugates compared with free adriamycin and specificity of tumor cell killing. Cancer Res. 50,6608-6614. 282. Greenfield, R. S., Kaneko, T., Daues, A., Edson, M. A., Fitzgerald, K. A., Olech, L. J., Gratten, J. A., Spitalny, G. L., and Braslawsky, G. R. Cancer Res. 50, 6600-6607. 283. Kaneko, T., Willner, D., Monkovic, I., Knipe, J. O., Braslawsky, G. R., Greenfield, R. S., and Vyas, D. M. (1991). New hydrazone derivatives of adriamycin and their immunoconjugates a correlation between acid stability and cytotoxicity. Bioconj. Chem. 2, 133-141. 284. Hurwitz, E., Maron, R., Bernstein, A,, Wilchek, M., Sela, M., and Arnon, R. (1978).
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
379
The effect in vivo of chemotherapeutic drug-antibody conjugates in two murine experimental tumor systems. Znt. 1.Cancer 21,747-755. 285. Tsukada, Y., Hurwitz, E., Kashi, R., Sela, M., Hibi, N., Hara, A,, and Hirai, H. Chemotherapy by intravenous administration of conjugates of daunomycin with monoclonal and conventional anti-rat a-fetoprotein antibodies. Proc. Natl. Acad. Sci. U.S.A.79, 7896-7899. 286. Ohkawa, K., Hibi, H., and Tsukada, Y. (1986).Evaluation of a conjugate of purified antibodies against human AFP-dextran-daunorubicin to human AFP-producing yolk sac tumor cell lines. Cancer Itnrnurrol. Zmniunother. 22, 81-86. 287. Tsukada, Y., Ohkawa, K., and Hibi, N. (1987). Therapeutic effect oftreatment with polycloiial or monoclonal antibodies to a-fetoprotein that have been conjugated to daunomycin via a dextran bridge: Studies with an a-fetoprotein-producing rat hepatoma tumor model. Cancer Res. 47,4293-4295. 288. Hurwitz, E., Arnon, R., Sahar, E., and Danon, Y. (1983). A conjugate of adrianiycin and monoclonal antibodies to Thy-1 antigen inhibits human neuroblastoma cells i n vitro. Ann. N.Y. Acud. Sci. 417, 125-136. 289. Tsukada, Y., Kato, Y., Umemoto, N., Takeda, Y., Hara, T., and Hirai, H . (1984). An anti-a-fetoprotein antibody-daunorubicin conjugate with a novel poly-tglutamic acid derivative as intermediate drug carrier. J . Natl. Cancer Znst. 75, 72 1-729,. 290. Johns, D. G., and Bertino, J . 11. (1973). Folate antagonists. In “Cancer Medicine” ( J . F. Holland and E. Frei 111, eds.), pp. 739-754. Lea & Febinger, Philadelphia. 291. Whiteley, J . M. (1971). Some aspects of the chemistry of the folate molecule. Ann. N.Y. Acad. Sci. 186,29-42. 292. Shen, W-C., Ballou, B., Ryser, H. J-P., and Hakala, T. R. (1986).Targeting: Internalisation and cytotoxicity of methotrexate-monoclonal anti-stage-specific embryonic antigen-1 antibody conjugates in cultured F-9 teratocarcinoma cells. Cancer Res. 46,3912-3916. 253. Deguchi, T., Chu, T. M., Leong, S . S., Horoszewicz, J . S., and Lee, C. (1986).Effect of methotrexate-monoclonal anti-prostatic acid phosphatase antibody conjugate on human prostate tumor. Cancer Res. 46, 3571-3755. 294. Garnett, M. C., and Baldwin, R. W. (1986). A n improved synthesis ofa methotrexatealbumin-791T/36 monoclonal antibody conjugate cytotoxic to human osteogenic sarcoma cell lines. Cancer Res. 46, 2407-2412. 255. Pietersz, G. A., Cunningham, Z., and McKenzie, I. F. C. (1988).Specific in vitro anti-tumour activity of methotrexate-monoclonal antibody conjugates prepared using human serum albumin as an intermediary. Zniniunol. Cell Biol. 66, 43-49. 296. Kraner, K. G., Bell, R., and Pietersz, G. A. (1993). Aniinopterin-monoclonal antibody conjugates: Antitumor activity and toxicity. Drug Targeting Delivery, 1, 27-33. 257. Johnson, J. R., Newman, C. E., and Ford, C. H. J . (1980). In vitro cytotoxicity ot anti-CEA immunoglobulin with cultured lung tumour cells. Br. J . Cancer 42, 17. 258. Johnson, J. R., Ford, C . H. J., Newman, C . E., Woodhouse, C. S., Rowland, G. F., and Simmonds, R. G. (1981). A vindesine-anti-CEA conjugate cytotoxic for human cancer cells in vitro. Br. J . Cancer. 44, 472-475. 299. Conrad, R. A., Cullinan, G. J., Gerzon, K., and Poore, G. A. (1979). Structure activity relationships of dimeric catharanthus alkaloid. 2. Experimental anti-tumour activities of N-substituted desacetyl vi~iblastirreamide (vindesine) sulphates. J . Med. Chem. 22,391-400. 300. Rowland, G . F., Simmonds, R. G., Corvalan, J. R. F., Baldwin, R . W., Brown,
380
301.
302.
303. 304.
305. 306. 307.
308.
309. 310. 311. 312. 313. 314. 315. 316.
GEOFFREY A. PIETERSZ E T AL
J. P., Embleton, M. J., Ford, C. H. J,, Hellstrom, K. E., Hellstrom, I., Kemshead, J. T., Newman, C. E., and Woodhouse, C. S. (1983).Monoclonal antibodies for targeted therapy with vindesine. Protides Biol. Fluids 30, 375-379. Rowland, G. F., Corvalan, J. R. F., Axton, C. A,, Gore, V. A., Marsden, C. H., Smith, W., and Simmonds, R. G. (1984). Suppression of growth of a human colorectal tumour in nude mice by vindesine-monoclonal antibody conjugates. Protides Biol. Fluids 31, 783-786. Rowland, G. F., Simmonds, R. C., Gore, V. A,, Marsden, C. H., and Smith, W. (1986). Drug localisation and growth inhibition studies of vindesine-monoclonal anti-CEA conjugates in a human tumour xenograft. Cancer Zmmunol. Zmmunother. 21, 183-187. Corvalan, J. R. F., and Smith, W. (1987). Construction and characterisation of a hybrid-hybrid monoclonal antibody recognising both carcinoembryonic antigen (CEA) and vinca alkaloids. Cancer lmmunol. Zmmunother. 24, 127-132. Corvalan, J. R. F., Smith, W., Gore, V. A., and Brandon, D. R. (1987). Specific in vitro and in vivo drug localisation to tumour cells using a hybrid-hybrid monoclonal antibody recognising both carcinoembryonic antigen (CEA) and vinca alkaloids. Cancer Zmmunol. lmmunother. 24, 133-137. Corvalan, J. R. F., Smith, W., Core, V. A., Brandon, D. R., and Ryde, P. J. (1987). Increased therapeutic effect of vinca alkaloids targeted to tumour by a hybridhybrid monoclonal antibody. Cancer Zmmunol. Zmmunother. 24, 138-143. Krauer, K., McKenzie, I. F. C., and Pietersz, G. A. (1992). The anti-tumor effect of 2‘-deoxy-5-fluorouridine conjugates against a murine thynioma and colon carcinoma xenografts. Cancer Res. 52, 132-137. Hinman, L. M., Hamann, P. R., Beyer, P. R., Wallace, R., Upeslacis, J., Adair, J., Baker, T., and Mountain, A. (1993). Lysine-linked conjugates of N-acetyl calicheamycin y l with a fully humanized anti-polymorphic epithelial mucin antibody show potent antitumor effects in ovarian tumor xenografts. Proc. AACR. [Abstract 28601 Rowland, A. J., McKenzie, I. F. C., and Pietersz, G. A. (1993).Preclinical investigation of the antitumour effects of anti-CD-19-idarubicin immunoconjugates. Cancer Zmmunol. lmmunother., in press. Pietersz, G. A., Smyth, M. J., Tjandra, J. J., and McKenzie, I. F. C. (1989).Preclinical and clinical studies with N-acetyl melphalan immunoconjugates and tumour necrosis factor. Antibiot. lmmunoconj. Radiopharm. 2, 47-61. Tai, J., Blair, A. H., and Chose, T. (1976). Immunochemotherapy of mouse lymphoma with drug-antibody conjugate. Proc. Can. Fed. Biol. Sci. 19. [Abstract 5021 Steinman, R. M., Mellman, I. S., Muller, W. A., and Cohn, Z. A. (1983). Endocytosis and the recycling of plasma membrane. J . Cell. Biol. 96, 1-27. Pastan, I., and Willingham, M. C. (1983). Receptor-mediated endocytosis: Coated pits, receptosomes and the golgi. Trends Biochem. Sci. 8,250-254. Rubens, R. D., and Dulbecco, R. (1974). Augmentation of cytotoxic drug action by antibodies directed at cell surface. Nature (London) 248, 81-82. Davies, D. A. L. (1974).The combined effect ofdrugs and tumor specific antibodies in protection against a mouse lymphoma. Cancer Res. 34,3040-3043. Guclu, A., Tai, J., and Chose, T. (1975). Endocytosis of chlorambucil-bound antitumour globulin following “capping” in EL4 lymphoma cells. Zmmunol. Commun. 4,229-242. Smyth, M. J., Pietersz, G. A., and McKenzie, I. F. C. (1986). Potentiation of in vitro cytotoxicity of chlorambucil with monoclonal antibodies. J . Zmmunol. 37, 336 1-3366.
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
38 1
31 7 . Tritton, T. R., and Yee, G. (1983). The anticancer agent adriamycin can be actively cytotoxic without entering cells. Science 217, 248-250. 318. Shen, W-C., and Ryser, H. J-P. (1982). The transport and release of poly (basic amino acids)-bound drugs in mammalian cells. In “Proceedings ofthe International Union of Pure and Applied Chemistry, 28th Macromolecular Symposium, Amherst, Maryland,” p. 368. 319. Shen, W-C., Ryser, H. J-P., and LaManna, L. (1985). Disulfide spacer between methotrexate and poly(D-lysine). J . Biol. Chem. 260, 10,905-10.908. 320. Uadia, P., Blair, A. H., Chose, T., and Ferrone, S . (1985). Uptake of methotrexate linked to polyclonal and monoclonal anti-melanoma antibodies by a human melanoma cell line. J . Natl. Cancer Znst. 74, 29-35. 321. Schneider, J. A., Jonas, A. J., Smith, M. L., and Greene, A. A. (1984). Lysosoinal transport of cystine and other small molecules. Biochem. Soc. Trans. 12,908-910. 322. Silverstein, S. C., Steinman, R . M., and Cohn, Z. A. (1977). Endocytosis. Annu. Reu. Eiochem. 46,669-722. 323. Stahl, P., and Gordon, S. (1982). Expression of mannosyl fucosyl receptor function for endocytosis in cultured primary macrophages and their hybrids. J . Cell B i d . 93,49-54. 324. Hammersmith Oncology GroupiImperial Cancer Research Fund. (1984). Antibody-guided irradiation of malignant lesions: Three cases illustrating a new method of treatment. Lancet 1, 1441-1443. 325. Epenetos, A. A., Courtenay-Luck, N., Pickering, D., Hooker, G., Durbin, H., Lavender, J. P., and McKenzie, C. G. (1985). Antibody guided irradiation of brain glioma by arterial infusion of radioactive nionoclonal antibody against epidermal growth factor receptor and blood group A antigen. Br. Med. J . 290, 1463-1466. 326. West, C. R., Avellanosa, A. M., Barua, N. R., Patel, A,, and Hong, C. I. (1983). Intraarterial 1,3-bis(2-chloroethyI)-1-nitrosourea (BCNU) and systemic chemotherapy for malignant gliomas: A follow up study. Neurosurgery 13, 420-426. 327. Lee, Y., Bullard, D. E., Wikstrand, C. J., Zalutsky, M. R., Muhlbaier, L. H., and Bigner, D. D. (1987). Comparison of monoclonal antibody delivery to intracranial glioma xenografts by intravenous and intracarotid administration. Cancer Res. 47, 194 1- 1946. 328. Colcher, D., Carrasquillo, J. A., Esteban, J., Sugarbaker, P., Reynolds, J. C., Bryant, G., Larson, S. M., and Schlom, J. (1987). Complimentarity of intraperitoneal and intravenous administration of MoAb B72.3. In “Second International Conference on Monoclonal Antibody lmmunoconjugates for Cancer, San Diego.” 329. Haisma, H. J . , Battaile, A,, Moseley, K., Zurawski, V. R., Jr.. and Knapp, R. C. (1987). Favourable tumor uptake of 1-131 labelled monoclonal antibody OC125 after intraperitoneal administration as opposed to intravenous administration in ovarian cancer patients. In “Second InternationaI Conference on Monoclonal Antibody Inirnunoconjugates for Cancer, San Diego.” 330. Weinstein, J. N., Parker, R. J . , Keenan, A. M., Dower, S. K., Morse 111, H. C., Sieber, S . M. (1982). Monoclonal antibodies in the lymphatics: Toward the diagnosis and therapy of tumor metastases. Science 218, 1334-1337. 331. Kitaniura, K., Takahashi, T., Kotani, T., Miyagaki, T., Yamaoka. N., Tsurami, H., Noguchi, A., and Yamaguchi, T. (1992). Local administration of monoclonal antibody-drug conjugate: A new strategy to reduce the local recurrence ofcolorectal cancer. Cancer Res. 52,6323-6328. 332. Weil-Hillman, G., Uckun, F. M., Manske, J . M., and Vallera, D. A. (1987). Combined immunochemotherapy of human solid tumors in nude mice. Cancer Res. 47,579-585.
382
GEOFFREY A. PIETERSZ ET AL.
333. Kanellos, J., Pietersz, G . A., and McKenzie, I. F. C. (1989). Intratumour therapy of solid tumours with the use of ricin-antibody conjugates. lmmunol. Cell Biol. 647,89-99. 334. Pietersz, G . A., Kanellos, J., and McKenzie, I. F. C. (1986). The use ofwhole ricinantibody conjugates for the treatment of tumors in mice. In “Membrane Mediated Cytotoxicity,” (B. Bonavida and R. J. Collier, eds.), pp. 213-223. A. R. Liss, New York. 335. Pietersz, G . A., Kanellos, J., and McKenzie, I. F. C. (1988). Novel synthesis and in uitro characterization of a disulfide linked ricin-monoclonal antibody conjugates devoid of galactose binding activity. Cancer Res. 48, 4469-4476. 336. Peterson, H. I. (ed). (1979). “Tumor Blood Circulation: Angiogenesis, Vascular Morphology and Blood Flow of Experimental and Human Tumors.” CRC Press, Boca Raton, FL. 337. Sutherland, R. M. (1986). Importance of critical metabolites and cellular interactions in the biology of microregions of tumors. Cancer 58, 1668-1680. 338. Teicher, B. A., Lazo, J. S . , and Sartovelli, A. C. (1981).Classification ofantineoplastic agents by their selective toxicities toward oxygenated and hypoic tumor cells. Cancer Res. 41, 73-81. 339. Guichard, M., Courdi, A., and Malaise, E. P. (1980). Experimental data on the radiobiology of solid tumors. J . Eur. Radiother. 1, 171-191. 340. Chaplin, D. J,, Olive, P. L., and Durand, R. E. (1987). Intermittent blood flow in a murine tumor: Radiobiological effects. Cancer Res. 47, 597-601, 1987. 341. Duewell, S., Horst, W., and Westera, G . (1986). Uptake of a monoclonal antibody against CEA (Tumak 431/31) in a human colon tumor (Co-112)xenografted in the nude mouse. Cancer lmmunol. lmmunother. 23, 101-106. 342. Babbs, C. F., and DeWitt, D. P. (1981). Physical principles of local heart therapy for cancer. Med. Instrum. 15,367-373. 343. Kahn, P. C. (1985). Epinephrine effect in selective renal angiography. Radiology 85,301-305. 344. Hafstrom, L., Nobin, A., Perron, B., and Sundqvist, K. (1980).Effects of catecholamines on cardiovascular response and blood flow distribution to normal tissue and liver tumors in rats. Cancer Res. 40,481-485. 345. Zanelli, G . D., Lucas, P. B., and Fowler, J. F. (1975). The effect of anaesthetics on blood perfusion in transplanted tumours. Br. J. Cancer. 32,380-390. 346. Smyth, M. J., Pietersz, G . A., and McKenzie, I. F. C. (1987).The use of vasoactive agents to increase tumor perfusion and the antitumor efficacy of drug-monoclonal antibody conjugates. J . Natl. Cancer lnst. 79, 1367-1368. 347. Grega, G. J. (1986). Contractile elements in endothelial cells as potential targets for drug action. Trends Pharmacol. Sci. 7,452-457. 348. MacPherson, C. G., and North, R. J. (1986). Endotoxin-mediated necrosis and regression of established tumors in the mouse: A correlative study of quantitative changes in blood flow and ultrastructural morphology. Cancer lmmunol. lmrnunother. 21,209-216. 349. Regenass, U., Muller, M., Curschellas, E., and Matter, A. (1987).Anti-tumor effects of tumor necrosis factor in combination with chemotherapeutic agents. lnt. J. Cancer 39,266-273. 350. Sato, N., Goto, T., Haranaka, K., Satomi, N., Nariuchi, H., Mano-Hirano, Y., and Saswaski, Y. (1986). Actions of tumor necrosis factor on cultured vascular endothelial cells: Morphologic modulation, growth inhibition, and cytotoxicity. J . Natl. Cancer l n s t . 76, 1113-1121. 351. Smyth, M. J., Pietersz, G. A., and McKenzie, I. F. C. (1988). The increased anti-
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
352.
353. 354. 355. 356. 357. 358. 359. 360. 361.
362.
363.
364.
365. 366.
367. 368.
383
tumor effect of immunoconjugates and tumor necrosis factor in vivo. Cancer Res. 48,3607-3612. Russell, M. S., McKenzie, I. F. C., Krauer, K. G., and Pietersz, G. A. (1990).Effect of tumor necrosis factor on the antitumor efficacy and toxicity of aminopterinmonoclonal antibody conjugates: Parameters in optimization of therapy. Cancer Res. SO, 6028-6033. Marnior, J. B. (1979). Interactions of hyperthermia and chemotherapy in animals. Cancer Res. 39,2269-2276. Pierce, C. B. (1970). Differential, normal and malignant cells. Fed. Proc. 29, 1248- 1254. Obrist, R. (1983). Monoclonal antibodies as drug carriers in oncology. Trends Pharmacol. Sci. 165,375-379. Edwards, P. A. W. (1985). Heterogeneous expression of cell-surface antigens in normal epithelia and their tumours, revealed by monoclonal antibodies. Br. J . Cancer. 51, 149-160. Poste, G. (1986). Pathogenesis of metastatic disease: Implications for current therapy and for the development of new therapeutic strategies. Cancer Treat. Rep. 70, 183-199. Curt, G., Clendeninn, N. J., and Chabner, B. A. (1984). Drug resistance in cancer. Cancer Treat. Rep. 68,87-99. Poste, G., and Fidler, I. J. (1980). The pathogenesis of cancer metastasis. Nature (London)283, 139-146. Sironi, M., Cangegrati, M. A., Romano, M., Vecchi, A., and Spreafico, F. (1984). Chemotherapy increased antineoplastic effects of antibody-toxin conjugates. Cancer Treat. Rep. 68,643-645. Uckun, F. M., Ramakrishnan, S., and Houston, L. L. (1985). Increased efficiency in selective elimination of leukemia cells by a combination of a stable derivative of cyclophosphamide and a human B-cell-specific immunotoxin containing pokeweed anti-viral protein. Cancer Res. 45, 69-75. Webb, K. S., Liberman, S. N., Ware, J. L., and Walther, P. J. (1986). In vitro synergism between hybrid inimunotoxins and chemotherapeutic drugs: Relevance to immunotherapy of prostate carcinoma. Cancer Immunol. Immunother. 21, 100- 106. Buchsbaum, D. J., Nelson, L. A,, Hanna, D. E., and Vallera, D. A. (1986).Human leukemia cell binding and killing by anti-CDS radioimmunotoxins. In “Proceedings of the American Society for Therapeutic Radiology and Oncology 28th Annual Meeting, Los Angeles.” Alexander, R. B., Nelson, W. G., and Coffey, D. S. (1987). Tumor necrosis factor: Synergistic enhancement of in vitro cytotoxicity from chemotherapeutic drugs targeted at DNA topoisomerase 11. Cancer Res. 47, 2403-2406. Greiner, J . W., Cuadagni, F., Noguchi, P., Pestka, S., Colcher, D., Fisher, P. B., and Schlom, J. (1987). Recombinant interferon enhances monoclonal antibodytargeting of carcinoma lesions in vivo. Science 235, 895-898. Greiner, J . W., Hand, P. H., Noguchi, P., Fisher, P. B., Pestka, S., and Schlom, J. (1984).Enhanced expression of surface tumor-associated antigens on human breast and colon tumor cells after recombinant human leukocyte y-interferon treatment. Cancer Res. 44,3208-3214. Chose, T., Norvell, S. T., Guclo, A., Cameron, D., and McDonald, A. S. (1975). Immunochemotherapy of human malignant melanoma with chlorambucii-carrying antibody. Eur. J . Cancer 11,321-326. Ford, C. H. J., Newman, C. E., Johnson, J. R., Woodhouse, C. S., Reeder, T. A.,
384
GEOFFREY A. PIETERSZ ET AL.
Rowland, G. F., and Simmonds, R. G. (1983). Localisation and toxicity study of a vindesine-anti-CEA conjugate in patients with advanced cancer. Br. J. Cancer 47,35-42. 369. Melino, G., Hobbs, J. R., Radford, M., Cooke, K. B., Evans, A. M., Casterllo, M. A,, and Forrest, D. M. (1984). Drug targeting for 7 neuroblastoma patients using human polyclonal antibodies. Protides Biol. Fluids 32, 413-416. 370. Takahashi, T., Yamaguchi, T., Kitamura, K., Suzuyama, H., Hond, M., Yokots, T., Kotanagi, H., Takahashi, M., and Hashimoto, Y. (1988). Clinical application of monoclonal antibody-drug conjugates for immunotargeting chemotherapy of colorectal carcinoma. Cancer 61, 881-888. 371. Oldham, R. K., Lewis, M., Orr, D. W., Avner, B., Liao, S. K., Ogden, J. R., Avner, B., and Birch, R. (1988). Adriamycin custom-tailored immunoconjugates in the treatment of human malignancies. Mol. Biother. 1, 103-113. 372. Orr, D., Oldham, R., Lewis, M., Ogden, J., Liao, S. K., Leung, K., Dupere, S., Birch, R., and Avner, B. (1989). Phase I trial of mitomycin C immunoconjugates cocktails in human malignancies. Mol. Biother. 1, 229-240. 373. Oldham, R. K., Lewis, M., Orr, D. W., Liao, S. K., Ogden, J. R., Hubbard, W. H., and Birch, R. (1989). Individually specified drug immunoconjugates in cancer treatment. Int. J. Biol. Markers 4, 65-77. 374. Schneck, D., Butler, F., Dugan, W., Littrel, D., Dorrbercker, S., Petersen, B., Bowsher, R., Delong, A., and Zimmermann, J. (1989). Phase I studies with a murine monoclonal antibody vinca conjugate (KS1.4-DAVLB) in patients with adenocarcinomas. Antibody lmmunoconj. Radiopharm. 2, 93-100. 375. Elias, D. J., Hirschowitz, L., Kline, L. E., Kroener, J. F., Dillman, R. O., Walker, L. E., Rabb, J. A., and Timms, R. M. (1990). Phase I clinical comparative study of monoclonal antibody KS1/4 and KSUPmethotrexate immunoconjugate in patients with non-small cell lung carcinoma. Cancer Res. 50, 4154-4159. 376. Could, B. J., Borowitz, M. J., Groves, E. S., Carter, P. W., Anthony, D., Weiner, L. M., and Frankel, A. E. (1989).Phase I study ofan anti-breast cancer immunotoxin by continuous infusion: Report of a targeted toxic effect not predicted by animal studies. J. Natl. Cancer Inst. 81, 775-781. 377. Stewart, J. S. W., Hird, V., Snook, D., Dhokia, B., Sirolapenko, G., Hooker, G., Taylor-Papadimitriou, J., Rowlinson, G., Sullivan, M., Lambert, M. E., Coulter, C., Mason, W. P., Soutter, W. P., and Epenetos, A. A. (1990). Intraperitoneal yttrium90-labeled monoclonal antibody in ovarian cancer. ]. Clin. Oncol. 8, 1941-1951. 378. Stewart, J. S. W., Hird, V., Sullivan, M., Snook, D., and Epenetos, A. A. (1989). Intraperitoneal radioimmunotherapy for ovarian cancer. Br. J. Obs. Gytiaecol. 86, 529-536. 379. Epenetos, A. A., Britton, K. E., Mather, S., Shepherd, J., Granowska, M., TaylorPapadimitriou, J., Nimmon, C. C., Durbin, H., Hawkins, L. R., Malpas, J . S., and Bodmer, W. F. (1982). Targeting of iodine-123-labelled tumour associated monoclonal antibodies to ovarian, breast and gastrointestinal tumours. Lancet 2, 999-1005. 380. Hnatowich, D. J., Griffin, T. W., Kosciuczyk, C., Rusckowski, M., Childs, R. L., Mattis, J. A,, Shealy, D., and Doherty, P. W. (1985). Pharmacokinetics ofan indium111-labelled monoclonal antibody in cancer patients. ]. Nucl. Med. 26, 849-858. 381. Pimm, M. V., Perkins, A. C., Armitage, N. C., and Baldwin, R. W. (1985). The characteristics of blood-bourne radiolabels and the effect of anti-mouse IgC antibodies on localization of radiolabelled monoclonal antibody in cancer patients. J. Nucl. Med. 26, 1011-1023.
CHEMOIMMUNOCONJUGATES IN CANCER TREATMENT
385
382. Rosenblum, M. G., Murray, J. L., Haynie, T. P., Glenn, H. J., Jahns, M. F., Benjamin, R. S., Frincke, J. M., Carlo, D. J . , and Hersh, E. M. (1985). Pharmacokinetics of "'In-labelled anti-p97 monoclonal antibody in patients with metastatic malignant melanoma. Cancer Res. 45,2382-2386. 383. Colcher, D., Esteban, J. M., Carrasquillo, J . A., Sugarbaker, P., Reynolds, J. C., Bryant, G., Larson, S. M., and Schlom, J. (1987). Quantitative analysis of selective radiolabelled monoclonal antibody localization in metastatic lesions of colorectal cancer patients. Cancer Res. 47, 1185-1189. 384. Ward, B. G., Mather, S. J., Hawkins, L. R., Crowther, M. e., Shepherd, J . H., Granowska, M., Britton, K. E., and Slevin, M. L. (1987). Localization ofradioactive conjugated to the monoclonal antibody HMFG2 in human ovarian carcinoma: Assessment of intravenous and intraperitoneal routes of administration. Cancer Res. 47,4719-4723. 385. Pimni, M. V. (1988). Drug monoclonal antibody conjugates for cancer therapy: Potentials and limitations. CRC Crit. Rev. Ther. Drug Carrier Syst. 5, 189-227. 386. Ballantyne, K. C., Perkins, A. C., Pimm, M. V., Garnett, M. C., Clegg, J. A., Armitage, N. C., Baldwin, R. W., and Hardcastle, J. D. (1988). Biodistribution ofa monoclonal antibody methotrexate conjugate (791T/36-MTX) in patients with colorectal cancer. Znt.]. Cancer Suppl. 2, 103-108. 387. Schneck, D., Butler, F., Dugas, W., Littrell, D., Petersen, B., Bowsher, R., DeLong, A., and Dorrbecker, S. (1990). Disposition of a murine monoclonal antibody vinca conjugate (KS lI4-DAVLB) in patients with adenocarcinomas. Clin. Pharmacol. Ther. 47,36-41. 388. Pimm, M. V., Baldwin, R. W. (1984). QuanMtative evaluation of the localization of a monoclonal antibody (79IT/36) in human osteogenic sarcoma xenografts. Eur. I . Cancer Clin.Oncol. 20, 515-524. 389. Pimm, M. V., Perkins, A. C., and Baldwin, R. W. (1985). Difference in tumour and nomial tissue concentrations of iodine and indium-labelled-monoclonal antibody. Eur.]. Nucl. Med. 11,300-304. 390. Khaw, B. A., Cooney, J., Edgington, T., and Straws, H. W. (1986). Differences in experimental tumour localization of dual-labelled monoclonal antibody. J. Nucl. Med. 27, 1293-1299. 391. Rogers, G. T., Pedley, R. B., Boden, J., Hanvood, P. J., and Bagshawe, K. D. (1986). Effect of dose escalation of a monoclonal anti-CEA IgG on tumour localization and tissue distribution in nude mice: Xenografted with human colon carcinoma. Cancer Immunol. lmmunother. 23, 107-112. 392. Rogers, G. T., Boden, J., Harwood, P. J., Pedley, R. B., Rawlins, G. A., and Bagshawe, K. D. (1986). Dose dependent localisation of a monoclonal F(ab')2fragment against CEA in the mouse xenograft model. Eur.].Cancer Clin. Oncol. 22,709-710. 393. Halsall, A. K., Fainveather, D. S., Bradwell, A. R., Blackburn, J. C., Dykes, P. W., Howell, A,, Reeder, A,, and Hine, K. R. (1981). Localisation of malignant germcell tumours by external scanning after injection of radiolabelled anti-a-fetoprotein. Br. Med.]. 283,942-944. 394. Abdel-Nabi, H. H., Schwartz, A. N., Higano, C. S., Wechter, D. G., and Unger, M. W. (1987).Colorectal carcinoma: Detection with indium-111anticarcinoembryonic antigen monoclonal antibody, ZCe-025. Radiology 164, 617-621. 395. Jaffers, G. J., Colvin, R. B., Cosimi, J . V., Giorgi, G., Goldstein, T. C., Fuller, J. T., Kurnick, C., Lilehei, C., and Russell, P. S. (1983). The human immune response to murine OKT3 monoclonal antibody. Transplant. Proc. 15, 646648.
386
GEOFFREY A. PIETERSZ ET AL
396. Foon, K. A,, Schroff, R. W., Bunn, P. A., et al. (1984). Effect of monoclonal antibody therapy in patients with chronic lymphocytic leukaemia. Blood 64, 1085-1093. 397. Dillman, R. O., Shawler, D. L., Dillman, J. B., and Royston, I. (1984). Therapy of chronic lymphocytic leukaemic and cutaneous T-cell lymphoma with TlOl monoclonal antibody. J. Clin. Oncol. 2,881-891. 398. Dillman, R. O., Beauregard, J., Shawler, D. L., Halpern, S. E., Markman, M., Ryan, D. P., Baird, S. M., andclutter, M. (1986).Continuous infusion ofTlOl monoclonal antibody in chronic lymphocytic leukaemia and cutaneous T-cell lymphoma. J. Biol. Response Modif. 5,394-410. 399. Petersen, B. H., DeHerdt, S. V., Scheck, D. W., and Bumol, T. F. (1991). The human immune response to KS 1/4-desacetylvinbastine (Ly256787) and KS/4deacetylvinblasine hydrazide (LY203728) in single and multiple dose clinical studies. Cancer Res. 51, 2286-2290. 400. Frodin, J., Harmenberg, U., Biberfeld, P., Christensson, B., Lefvert, A., Rieger, A., Shetye, J., Wahren, B., and Mellstedt, H. (1988). Clinical effects of monoclonal antibodies (MAbl7-1A) in patients with metastatic colorectal carcinoma. Hybridoma 7,309-321. 401. Dillman, R. 0.(1990). Human antimouse and antiglobulin responses to monoclonal antibodies. Antibiot. lmmunoconj. Radiopharm. 3, 1-15. 402. Carson, D. A., and Freimark, B. D. (1986). Human lymphocyte hybridomas and monoclonal antibodies. Adu. Immunol. 38,275-311. 403. Riechmann, L., Clark, M., Waldmann, H., and Winter, G. (1988). Reshaping human antibodies for therapy. Nature (London)332, 325-327. 404. Brown, B. A., Davis, G. L., Saltzgaber-Muller, J., Simon, P., Ho, M-K., Shaw, P. S., Stone, B. A., Sands, H., and Moore, G. P. (1987). Tumour-specific genetically engineered murinelhuman chimaeric monoclonal antibody. Cancer Res. 47, 3577-3583. 405. Beidler, C. B., Ludwig, J . R., and Cardenas, J. (1988). Cloning and high level expression of a chimeric antibody with specificity for human carcinoembryonic antigen. J. Immunol. 141,4053-4060. 406. Shaw, D. R., Khazaeli, M. B., and LoBuglio, A. F. (1988). Mouseihuman chimeric antibodies to a tumor-associated antigen: Biologic activity of the four human IgG sub-classes. /. Natl. Cancer lnst. 80, 1553-1559. 407. Colcher, D., Milenic, D., Roseli, M., Rawbitschek, A., Yarranton, G., King, D., Adair, J., Whittle, N., Bodmer, M., and Schlom, J. (1989). Characterisation and biodistribution of recombinant/chimeric constructs of monoclonal antibody B72.3. Cancer Res. 49, 1738-1745. 408. Junghans, R. P., Waldmann, T. A., Landolfi, N. F., Avdalovic, N. M., Scheneider, W. P., and Queen, C. (1990). Anti-Tach-H, a humanised antibody to the interleukin 2 receptor with new features for immunotherapy in malignant and immune disorders. Cancer Res. 50, 1495-1502. 409. Mischak, R. P., Foxall, C., Rosendorf, L. L., Knebel, K., Scannon, P. J., and Spitler, L. E. (1990). Human antibody responses to components ofthe monoclonal antimelanoma antibody ricin A chain immunotoxin XomaZyme-MEL. Mol. Biother. 2, 104-109. 410. Schroff, R. W., Foon, K. A., Beatty, S. M., Oldham, R. K., and Morgan, A. C. (1985). Human anti-murine immunoglobulin responses in patients receiving monoclonal antibody therapy. Cancer Res. 45, 879-885. 411. Ledermann, J. A., Begent, H. J., Boden, J. A., Searle, F., and Bagshawe, K. D.
CHEMOIMMUNOCONJUGATES IN CANCER THEATMENT
387
(1987).Suppression of the anti-mouse antibody response to a monoclonal antitumor antibody in rabbits with cyclosporin A. Br. J . Cancer 56, 519. 412. Harkonen, S., Stoudemire, J., Mischak, R., Spitler, L. E., Lopez, H., and Scannon, P. (1987). Toxicity and immunogenicity of monoclonal antimelanoma antibodyricin A chain immunotoxin in rats. Cancer Res. 47, 1377-1382. 413. Pai, L. H., Fitzgerald, D. J., Tepper, M., Schacter, B., Spitalny, C., and Pastan, I. (1990). Inhibition of antibody response to Pseudomonas exotoxin and an immunotoxin containing Pseudomonos exotoxin by 15-deoxyspergualin in mice. Cancer Res. 50, 7750-7753. 414. Jin, F-S., Youle, R. J,, Johnson, V. C., Shiloach, J., Fass, R., Longo, D. L., and Bridges, S. H. (1991).Suppression of the immune response to immunotoxins with anti-CD4 monoclonal antibodies. J. Zmmunol. 146, 1806-1811. This article was accepted for publication on 9 December 1993.
ADVANCES IN IMMUNOLOGY, VOL. 56
The Molecular Basis of Susceptibility to Rheumatoid Arthritis ROBERT WINCHESTER Department of Pediatrics College of Physicians and Surgeons Columbia University New rork, New York 10032
1. Overview
Over the past two decades evidence has emerged associating the immune response resulting in rheumatoid arthritis with the inheritance of a shared motif or “epitope” of amino acids encoded by several different MHC class I1 alleles. Similar third diversity region sequences LQRA, LQKA, and LRRA situated at positions 67, 70, 71, and 74 in the DR @-chainare found in over 90% of rheumatoid arthritis patients in nearly all ethnic groups, while critical substitutions with negatively charged amino acid residues in this shared structure characterize the allelic products that do not confer susceptibility. This polymorphism is located at the margin of the a-helix and both faces into the upper portion of the antigen-binding cleft as well as toward the T cell receptor. Presumably this MHC structure is responsible for a specific immune recognition event that underlies the disease. It illustrates that a part of the MHC molecule independent of the other regions regulates this evolutionarily significant immune reaction. The hypothetical recognition event underlying rheumatoid arthritis likely involves the function of the shared epitope as a binding pocket that regulates a critical interaction of the MHC class I1 molecule either by determining the specific binding of a peptide that is selectively recognized by particular T cell clones or by interacting with certain T cell antigen receptors, thereby influencing the T cell repertoire. The penetrance of the trait is such that disease develops in only some of those who inherit the MHC-encoded structure, suggesting that development of rheumatoid arthritis likely also depends on stochastic events involved in the formation and modulation of the T cell repertoire. The inheritance of a second similar susceptibility-determining structure more than additively increases the penetrance of the trait and appears to induce a more severe form of the illness. There is evidence that at least one additional gene apparently located on the X chromosome is involved in defining the oligo genic inheritance of this disease. Rheumatoid arthritis is a chronic systemic inflammatory autoimmune disease that primarily affects the synovial membranes of multiple joints and results in joint destruction. The inciting event and the 389 Copyriglit 0 I991 by A~adeiiiicPress, I i i ~ A l l rights of reproduction in any form reserved.
390
ROBERT WINCHESTER
exact nature of the immune response underlying rheumatoid arthritis remain unknown, apart from the striking production of polyclonal IgG and IgM antibodies directed to IgG constant regions that are termed “rheumatoid factors” and the infiltration of lymphocytes and monocytes in the synovial membrane that has the appearance of a delayed hypersensitivity-type T cell response. These have the characteristics of a response driven by an antigen, the nature of which remains elusive (Winchester, 1993). II. Objectives
This review deals with the development, current understanding, and some of the implications of the molecular basis of susceptibility to rheumatoid arthritis as it relates to the inheritance of particular polymorphic conformations of the MHC class I1 molecules. How the interpretation of these susceptibility structures as peptide-binding pockets alters the paradigm underlying the study of HLA-disease associations to one based on rational structural hypotheses is discussed. Emphasis is placed on the fact that disease susceptibility genes, rather than being “disease genes,” are MHC class I1 alleles that are positively selected and physiologic. The penetrance of rheumatoid arthritis is accordingly low, but in the heterozygous state the gene encoding the shared epitope confers susceptibility indicating it has a dominant mode of action. However, when two susceptibility alleles are inherited together this greatly increase the penetrance and severity of the ensuing disease and raises questions about how these structures act cooperatively to provide the molecular basis of susceptibility. While the genetic basis in the MHC of a small proportion of individuals with rheumatoid arthritis, especially among Black North Americans, still remains undefined. It appears that the field is poised for the next major advance of identifying the particular peptide and the T cell receptors that are involved in the immune recognition event that underlies rheumatoid arthritis. 111. Molecular Genetics of Rheumatoid Arthritis
A. BACKGROUND-MHC TERMINOLOGY AND CONCEPTS Only relevant aspects of this actively developing field are reviewed. More detailed information is contained in several articles (Trowsdale et al., 1991; Charron, 1989; Bjorkman and Parham, 1990). A greatly simplified map of the MHC is illustrated in Fig. 1. The three main types of MHC class I1 molecules, DR, DQ, and DP, are each encoded in a different subregion by an a-chain gene and one or two p-chain genes and are normally expressed only on cells involved in presenta-
39 1
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
MHC CLASS I1 GENES R9 R10
250
450
T/P
DP HLA-B
850
DR
DQ
MHC CLASS I GENES
I HY-C
HLA-X
I
I
2000
650
2500
I
HLA-G HLA-H
HLA-F
HLA-E
I
I 3000
I
I
3500
I
bP
FIG.1. A simplified map of the class I and I1 regions of the human MHC illustrating loci encoding highly polymorphic molecules. The MHC spans nearly 4 Mbp on the short arm of the sixth chromosome oriented with the class I region to the telomere. The three major MHC class I loci, HLA-A, -B, and -C, each have large series of alleles that encode the polymorphic MHC class I molecule heavy chain. Minor MHC class I loci with limited polymorphism and tissue distribution are also shown. The loci encoding the three major types of MHC class I1 molecules, DR, DQ, and DP, contain the genes for both the a-chain and the p-chains of these molecules. The loci are shown in bold type and are designated DRA, DRB, DQA1, DQBl, DPA1, and DPB1. With the exception of the DR a-chain locus, DRA, all of these loci encode segregant series of polymorphic chains. The organization of the DR subregion differs according to the allele of the DRBl locus as shown in Fig. 2.
tion of exogenously derived peptides to CD4 T cells such as B cells, monocyte lineage cells, and certain dendritic cells. The expression of the autosomal genes encoding the MHC molecules is codominant, for example, with a given B cell expressing at least six different types of MHC class I1 molecules. The allelic diversity of the MHC is remarkably large, with most loci exhibiting the phenomenon of allele polymorphism, in that the frequency of an allele is greater than that expected by the operation of chance mutations, i.e., they have undergone positive selection. With the exception of the DR a-chain locus all of the other a- and @chain loci of the class I1 molecules contain polymorphic alleles.
TABLE I MAJORSITESOF SEQUENCE POLYMORPHISM AMONG SOMEDR @-CHAIN ALLELES ILLUSTRATING THE RELATIONSHIP BETWEEN SEROLOGIC SPECIFICITY, T CELL-DEFINED DETERMINANT, AND ALLELEDESIGNATION Amino Acid Positions in DR p-Chain Diversity Regions Serologic specificity
T cell-defined determinant
DR1 DR1 DR103 DM(15) DM(15) DM(16) DR3(17) DR4 DR4 DR4
Dwl Dw20 DwBON Dw2 Dw12 Dw21,AZH Dw3 Dw4 Dw14 Dw14
First 9 W W W Q Q Q E E E E
Second
11
13
L L L D D D S V V V
F F F Y Y Y S H H H
26 L L L F F F Y F F F
28 E E E H H H D D D D
30
C C C D C C Y Y Y Y
Third 37
57
67
70
71
74
86
DR locus and allele
S S S D N N H Y Y Y
D D D D D D D D D D
L L I F F I L L L L
Q Q D D D Q Q Q Q Q -
R R E R R R K K R E
A A A A A
C V V C C V V G V G
B1*0101 B1*0102 B1*0103 B1*1501 B1* 1502 B1* 1601 B1*0301 B1*0401 B1*0404 B1*0408
A
R A A A -
DR4 DR4 DR4 DR4 DR5( 11) DR5( 11) DRGa(l3) DR6b(14) DR6(14) DR7 DR8 DR9 DRlO DR52a DR52b DR52c DR53 DR51 DR51
Dw15 Dw 10 Dw13 DwKT2 Dw5 DwJVM Dw18 Dw9 Amala,Dwl6 Dw17 Dw8.1 Dw23 -
Dw24 Dw25 Dw26 Dw2 Dw21,AZH
E E E E E E E E E W E K E E E E E W W
V V V V S S S S S G S D V R R R A P P
H H H H S S S S S Y G F F S S S C R R
F F F F F F F F F F F Y L Y F F N F F
D D D D D D D D E E D H E D E E I D D
Y Y Y Y Y Y Y Y Y L Y G R H H Y Y Y Y
Y Y Y S Y Y N F N F Y N Y F Y L Y S S
S D D D D D D A D V S V D V D V D D D
_L
I L L F I I L
Q D Q Q D D D R
R E R R R E E E
A A E E A A A E
G V V V G V V V
I F F L _ L L L L I F
D D R R _ Q Q Q R Q D
R R R R _ K K I R A R
Q L E A _ R R R E A A
G G G G G V G V V G
Q
&
G
B1*0405 B1*0402 B1*0403 B1*0406 B1*11011 B1*1102 B1*1301 B1*1401 B1*1402 B 1*0701 B 1*0801 B 1*09011 B 1* 1001 B3*0101 B3*0201 B3*0301 B4*0101 B5*0101 B5*0201
394
ROBERT WINCHESTER
The recognition of these polymorphisms by a variety of technologies has given rise to a complex nomenclature (Table I). A specijkity such as HLA-DR4 refers to a set of usually several related serologically defined attributes of a person’s HLA molecules that allow a general categorization of inherited HLA differences. At an earlier stage of knowledge 10 DR specificities were defined, designated DR1, DR2, . . . , DR10, which were thought to be the product of a single locus. Certain of these have been subdivided to give the current number of nearly two dozen DR specificities. Alleles are distinct alternative gene forms of one locus that encode molecules bearing the serologically defined specificities (Table I). However, multiple alleles may encode the same serologic specificity. For example, there are now over 14 alleles that encode the DR4 specificity, some of which are shown in Table I. These are designated DRB1*0401 through DRB1*0414 in rough order of their molecular definition. For additional information on nomenclature, see Bodmer et al. (1992). Determinants refer to molecular structures defined by T cell recognition such as occurs in mixed leukocyte culture (MLC) typing. In the case of the serologic specificity DR4, several genetically distinct determinants designated Dw4, Dw14, Dw13, Dw14, and Dw15 were recognized and provided the first clue that multiple alleles encoded the same specificities (Table I). The DR4 molecule expressing the Dw4 determinant is encoded by the DRB1*0401 allele while the DRB1*0402 allele encodes a molecule expressing the DwlO determinant. But, as with serologic specificities, several distinct alleles encode molecules differing by one or more amino acids that in common express the same determinants defined by T cells. For example, the DRB1*0404 allele and the DRB1*0408 allele both encode DR4 molecules that bear the Dw14 determinant. Unfortunately, there is no logic to the historical nomenclature since it reflects the best efforts of the particular moment to come to grips with a very intricate genetic system with different technologies. Table I indicates the major sites of sequence polymorphism among DR p-chain alleles. The serologic specificities correlate well with the sequence of the first and second diversity regions shown in single letter amino acid code at positions 9, 11, 13, 26, 28, 30, and 37. All of the alleles encoding the DR4 specificity share first and second diversity region amino acid sequence with other members of this family. The third diversity region is of greatest interest because in most sets of alleles it is completely dissociated from the first two regions in terms of structure, serology, and function. Seven basic patterns are used for the third diversity regions of the various DRBl alleles. For example,
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS DRBl
DR1,lO
395
'€'
3,
0101 0102
0103 1001
DRBl
4' '
DR05
DR2 1501 1602 1502
0101 0102 0201 Y
DR3,5,6
DRBl
DRBP
0301 1301 11011 1401 1102 1402
DR4,7,9
DRBl
0401 0403 0404 0701 0405 0901 0402
DRB3
0101 0201 0202
"
Y
DRB4
0101
DRBl
DR8 0801 0805 0803
FIG.2. The genomic organization of the DR subregion differs according to the DRBl allele. The major families are illustrated which depict the differences in the haplotypes that are found in each. Haplotypes encoding DR1, 8, and 10 have only a single locus, DRB1, encoding the p-chain of the DR molecule. The other haplotypes have two loci encoding DR p-chains. A second DR p-chain locus encodes chains that bear the DR51 (DR2),DR52 (DR3, 5 and 6), and DRS3 (DR4, 7 and 9) specificities. As seen in Table I, these differ by multiple amino acids. However, they are the products of separate loci associated with different haplotypes, only appearing to be allelic (pseudoallelism).The loci coding for these three specificities are respectively designated DRBS, DRB3, and DRB4. The genomic organization of pseudogenes and the location and presence of the DRB3, DRB4, and DRB5 locus are different in each of the families. Alleles shown in bold type that encode the shared epitope associated with susceptibility to rheumatoid arthritis are scattered in several families with different genomic organization.
396
ROBERT WINCHESTER
the motif IDEA is found in D R l Bon, DR4, DwlO, and a DR6 allele at positions 67, 70, 71, and 74. The sharing of LQRIKA is found in DR1 D w l , DR4, Dw4, Dw14, Dw15, and DR6 amala, the presence of which are all associated with susceptibility to rheumatoid arthritis. The alleles are grouped together into five or six major families that each have distinctive features (Fig. 2). For example, one family of structurally related sequences include the DR3, 5, and 6 alleles. Another includes the DR4, 7, and 9 alleles. The presence of additional DRp-chain loci with only a limited number of alleles is a characteristic. In the case of the DR3, 5, and 6 group of alleles, they are situated on a haplotype that contains a second DR p-chain locus with a series of three principal alleles, DRB3*0101, 0201, and 0301, which encode the DR52 specificity. The haplotypes encoding the DR4, 7, and 9 alleles have a different DR p-chain locus with only one principal allele which encodes the DR53 specificity. The somewhat complex relationship of the amino acid polymorphisms encoded by these alleles and their recognition either by serologic reagents or as determinants identified by T cells has a clear simplifying basis when considered in terms of the determined structure of the class I1 molecule (Fig. 3) (Brown et al., 1993). The three groups of the DR p-chain polymorphic residues are found in different regions of the molecule. Two are located in the p-pleated sheet floor of the antigen-binding cleft, from position 9 through the position 37 site. The third is located in the margin of the antigen-binding cleft formed by the a-helical portion of the DR p-chain that includes the polymorphic residues from 57 to 86. In the case of the DR molecule, the p-chain contains all of the significant polymorphic residues. The basis of the allelic diversity is of special interest since it is in large part based on combinatorial selection and assembly of evolutionarily more stable portions of the a-chain and p-chain genes in what can be described as a patchwork manner. For example, as illustrated in Table I the same amino acid sequence is found in the a-helical third diversity region of several alleles with a corresponding nucleotide sequence. Unlike the somatically generated combinatorial development of the T cell receptors from smaller genetic elements, this generation of new germline alleles occurs infrequently and through either gene microconversion or double-recombination events. This illustrates the patchwork pattern of developing allelic variability from recombination of a smaller number of antecedent genes. Gene conversion or intragenic recombination, methods of lateral gene transfer, appears to be the way in which the current repertoire of alleles was
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
397
FIG.3. An illustration of the MHC class I1 molecule showing the peptide backbone and the Iocation of the polymorphic residues in the DR @-chain.T h e cleft in which the peptide antigen is contained is formed by a floor ofp-pleated sheets and walls composed of a-helices. An axis of pseudosymmetry transects the molecule from lower left to upper right, separating the DR a-chain from the DR @-chain. Th e polymorphic amino acids ofthe MHC molecule form binding pockets that interact with the amino acid side chains of the peptide antigen. Some of the polymorphic residues in the a-helical portion of the molecule also interact with the T cell receptor.
assembled from portions of antecedent genes. Had this patchwork composition of the allelic repertoire been known, especially in the case of the DR4 and DR1 specificities, it would have greatly simplified the delineation of the molecular basis of the susceptibility to rheumatoid arthritis. However, the opposite situation prevailed in which establishing the genetic basis of this disease contributed to an understanding of the nature and significance of the structural basis of the MHC alleles. In contrast to the manner of generating alleles specifying the DR4 and DRl specificities, certain other alleles, such as those encoding the DR 3 specificity, do not have markedly different a-helical portions. This fact may have accounted for the relativeIy more simple establishment of susceptibility to certain diseases associated with, for example, the presence of the DR2 or DR3 specificity.
398
B.
ROBERT WINCHESTER
ESTABLISHING ASSOCIATIONS BETWEEN MHC POLYMORPHISMS AND DISEASE RATIONALE OF
In contrast to the recognition of conformational epitopes by the B cell and the antibody, the T cell largely recognizes peptides at the level of their primary structure, with little contribution of conformation. The polymorphic MHC molecules regulate this aspect of the T cell immune response in two fundamentally different ways. In one involving the regulation of antigen presentation, the amino acids that determine the particular polymorphism influence the preferential binding of certain classes of peptides for presentation to the T cell. Sequencing of selfpeptides eluted from MHC molecules reveals certain residues in the peptide to be specific contact moieties for amino acids comprising the MHC polymorphisms in different MHC allelic products. These regions in the allelic products form regions designated as pockets or depressions. This is the molecular basis of the phenomenon of determinant selection. Certain of these interactions serve to anchor the peptide to the MHC class I molecule at either end of the peptide antigen fragment (Falk et al., 1991). For MHC class I1 molecules the length of the peptide fragment is more variable and is not anchored at its termini, relying more on specific side-chain interactions along the extent of the peptide. The second way polymorphic MHC molecules operate to regulate the immune response is to act early in ontogeny to select from the large combinatorial collection of T cell receptor genes, a particular repertoire of T cells bearing receptor that effectively interact with the individual’s MHC molecules. This is the molecular basis of the phenomenon of M H C restriction. This effectively results in each individual having an immune system that is subtlety, but fundamentally, different from that of another individual. The most likely reason for this highly intricate system is that it offers the species, but not necessarily all individuals comprising the species, a highly diverse and constantly reinvented repertoire of immune recognition structures which become a difficult and changing target for a microorganism to exploit. Heterozygosity is apparently favored over homozygosity since it allows the presentation of more peptides on different MHC molecules. The formation of the T cell repertoire occurs through the thymic processes of positive and negative selection, (Blackman et al., 1990; Sprent et al., 1990). Positive selection results in a peripheral T cell population whose receptor repertoire is self-MHC biased and restricted, i.e., T cells whose receptors respond to antigenic peptides only in the context of self-MHC molecules (Klein, 1986). In humans
SUSCEPTIBILITY TO RHEUMATOID ARTHRlTlS
399
this bias includes a considerable proportion of T cell clones that recognize self-MHC peptides (Liu et al., 1992; Harris et al., 1992). Positive selection has been studied in detail in mice and is primarily determined by the MHC allelic products containing self-peptides (Bhayani and Hedrick, 1991; Blackman et al., 1990; Berg et al., 1990; and see Gregersen, 1992).The array of 18 or more intact MHC molecules on the cell surface present self-peptides to create this repertoire, including fragments of the MHC molecules. The resulting array of T cell receptors are biased for the recognition of self-peptides or peptides that somewhat resemble self, i.e., “near self.” The subsequent second process, negative selection, ensures that the repertoire thus constituted does not contain T cells that will respond directly and strongly to self-peptides in the context of self class I1 molecules, i.e., the population is self-tolerant (Kappler et al., 1987). The negative selection either involves permanent removal or deletion by the thymus ofcertain T cells or the induction ofperipheral unresponsiveness. In mice, endogenous retroviruses integrated in various chromosomes illustrated how self structures can negatively shape the T cell repertoire by deleting T cells that express certain VP genes (Frankel et al., 1991; Dyson et al., 1991; Woodland et al., 1991). Some problems of autoimmunity appear to arise in the processes of discrimination of self from nonself that occur either during repertoire formation or subsequently in the maintenance of tolerance, while others appears more likely to result from determinant selection mechanisms. Because of the fundamental role that MHC polymorphisms play in these processes, ascertaining that a MHC polymorphisms is associated with a particular disease points to investigating the abnormality of these immune recognition structures in the disease. C. INCIDENCE Rheumatoid arthritis is generally stated to affect just under 1% of the population, with an annual incidence rate of about 0.5 per 1000 person-years calculated in individuals of European ancestory (Silman et al., 1992). However, ascertainment of the disease in an individual is based on a set of clinical classification criteria (Arnett et al., 1988) and not on an objective test or finding, rendering the diagnosis obvious in the large majority of patients. Accordingly, problems may arise when individuals that are classified by these criteria are then used to study inheritance and genetic susceptibility due to the inclusion of a small but significant proportion of other forms of arthritis that have different patterns of inheritance, as discussed in detail elsewhere (Winchester, 1993).Moreover, reexamination of the prevalence of rheumatoid arthri-
400
ROBERT WINCHESTER
tis in certain populations, such as in rural Nigeria, has shown a remarkably low frequency of those with disease, <0.03%, and a lower frequency of the DR4 MHC alleles associated with susceptibility (Silman et al., 1993). D. DEVELOPMENT OF EARLY KNOWLEDGE ABOUT RHEUMATOID ARTHRITISGENETICS Finding out the genetic basis of the experiment that nature performed which results in the disease rheumatoid arthritis would have been a simple matter if a group of well-defined rheumatoid arthritis patients and ethnically matched controls were analyzed in light of the present knowledge of the structure and organization of the HLA genes. But the opposite occurred and the goal of understanding rheumatoid arthritis provided an important drive to delineating knowledge of the MHC genes, adding some compelling insights into the function of these molecules. Moreover, patient ethnicity was not thought at first to be important. Differences now attributed to the influence of ethnic composition on the frequency of MHC alleles initially confounded, but ultimately were the clue that illuminated, progress toward delineating the molecular basis of susceptibility to rheumatoid arthritis. The general relationship of the incidence of rheumatoid arthritis to the frequency of genetic determinants of susceptibility has not been comprehensively studied in different populations.
E. RECOGNITION THAT MHC DETERMINANTS WERESHARED AMONG THOSE DEVELOPING RHEUMATOID ARTHRITIS The start of solving the puzzle of the genetics of rheumatoid arthritis took place less than 25 years ago in a setting of knowledge that was extremely rudimentary when viewed from the present (Table 11).The end of the “Dark Ages” of the molecular basis of the genetics of rheumatoid arthritis could best be set by the 1969 publication of Astorga and Williams in which lymphocytes from two-thirds of patients with rheumatoid arthritis were found to be mutually poorly or nonreactive when they were incubated together in MLC reactions (Astorga and Williams, 1969).These authors concluded, with what has proved to be an understatement, “. , . a new and potentially exciting lead may be available towards understanding the pathogenesis of rheumatoid arthritis” (Astorga and Williams, 1969). The phenomenon Astorga and Williams recognized was clear, but whether this was a consequence or cause of rheumatoid arthritis remained unknown and had to await several years of studies on the genetic basis of the MLC. In the early 1970s the MLC reaction was a complex and ill-understood phenomenon without a molecular basis.
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
SOMEMILESTONES IN 1969 1976 1977
1982
1986 1987
1988
1990
401
TABLE I1 DEVELOPMENT OF KNOWLEDGE ABOUT THE GENETICBASISOF SUSCEITfIBILITY TO RHEUMATOID ARTHR~TIS
THE
Astorga and Williams identify sharing of common MLC reactivity among rheumatoid arthritis patients (Astorga and Williams, 1969). Stastny identifies the major MLC type shared as Dw4 and established the genetic nature of the phenomenon (Stastny, 1976). Winchester and Panayi and their colleagues identify susceptibility with the serologic specificity HLA-DR4 and obtain increasing evidence for shared epitopes not identical with DR4 (Winchester, 1977; Panayi and Wooley, 1977; Gibofsky et al., 1978a,b; Lee et nl., 1984). Woodrow et al. report contrasting associations with HLA-DR1 and HLA-DR4 in different ethnic groups (Woodrow et al., 1981). This is a time of marked differences in the results from laboratory to laboratory according to the ethnic nature of the population under study. Nepom et nl. introduce biochemical techniques for delineating susceptibility and structurally identify Dw14 as relevant (Nepom et al., 1986). Gregersen et al. analyze the structure of susceptibility alleles at the nucleotide level and map the molecular basis of susceptibility to rheumatoid arthritis into a small motif of nucleotides found in several alleles that encodes a “shared epitope” (Gregersen et al., 1986, 1987; Merryman et al., 1989). Matsuyama et al. delineate the structural basis of the DRlO serologic specificity (Matsuyama et al., 1988) and identify this as a molecule that encodes the 109d6 shared epitope structure recognized in a large proportion of rheumatoid arthritis patients by the antibody in an earlier study. Recognition that two alleles encoding a shared epitope interact in a greater than additive manner to increase penetrance, twin concordance, and in some instances disease severity (Nepom and Nepom, 1992; Rigby, 1992; Deighton et al., 1992; Salmon, 1992; Wordsworth et nl., 1992; Lanchbury, 1992; Goronzy and Weyland, 1993).
Indeed, to our present astonishment, but understandable in the context of the thinking of the time, Astorga and Williams did not interpret their findings as being due to a genetic event. Seven years would pass before the next major step was taken in sorting out the genetics of rheumatoid arthritis (Stastny, 1976). Several paradigms had to be developed in the intervening years that were essential to progress. The first major association of a rheumatic disease, ankylosing spondylitis, with an M H C specificity, HLA-B27, was made in 1973 (Brewerton et al., 1973)and this finding established the direction of experimental work associating HLA specificities with susceptibility to rheumatic diseases that would result in deciphering the meaning of the Astorga and Williams observation. In parallel, the MLC had to be defined as a genetic phenomenon that was related to the presence
402
ROBERT WINCHESTER
of determinants encoded separately from those responsible for the MHC class I molecules, a topic that exceeds the scope of this review. Based on these intervening achievements, the new era of the molecular genetics of rheumatoid arthritis dawned in 1976 with the notable paper by Stastny who found that the presence of an increased proportion of individuals with the same MLC type, Dw4, largely accounted for the 68% of patients who were mutually nonreactive in MLC reactions in the experiments of Astorga and Williams (Stastny, 1976).Thus, while these individuals did not have any class I alleles in common, they manifested a common pattern of reactivity, a finding that would be repeated in a number of variations throughout the development of knowledge in this area. Nevertheless, despite this remarkable paper there remained an appreciable divergence between the number of patients with established rheumatoid arthritis and the smaller number that could be accounted for typing as Dw4 (Gibofsky et al., 1978). Further investigation would be required to identify more completely the nature of the trait that resulted in rheumatoid arthritis. IV. Molecular Basis of Susceptibility
A. SEROLOGIC IDENTIFICATION OF HUMAN CLASSI1 MOLECULES The next major development in the genetics of rheumatoid arthritis was the identification of susceptibility with the inheritance of specific polymorphic molecules rather than the functionally defined MLC reaction. This observation had to await the discovery of human MHC class I1 molecules and that they were the entities responsible for stimulation in the MLC (Winchester et al., 1975). Interestingly, experiments that described the system of human B cell alloantigens, now termed MHC class I1 molecules, grew directly out ofexperiments designed to understand the basis of altered MLC reactivity in rheumatoid arthritis and systemic lupus erythematosus (SLE)(Winchester et al., 1974;Winchester and Kunkel, 1979). The early history of the recognition of the human MHC class I1 system, including the development of the associations of susceptibility to rheumatoid arthritis with MHC class I1 polymorphisms, was reviewed in a previous volume of Advances in Immunology (Winchester and Kunkel, 1979).
Laboratories now could use human transplantation or pregnancy sera containing alloantibodies directed to epitopes on MHC class I1 molecules as immunochemical reagents for the study of disease associations. This was a singular improvement over MLC typing. However, these sera were relatively complex reagents with the potential to recog-
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
403
nize a variety of specificities. A system of DR serologic specificities was gradually defined using cells from reference individuals who were known to have particular MLC-defined determinants. Thus, the MLC types designated D w l , Dw2, Dw3, Dw4, and Dw5 were associated respectively with serologically defined specificities DR1, DR2, DR3, DR4, and DR5. After the definition of Dw5 and DR5, as is evident in Table I, the relationship between Dw and DR became increasingly intricate and the numbers in the two series have no correspondence. Of relevance to rheumatoid arthritis genetics, the MLC determinants Dw4, DwlO, Dw14, and DW15, as well as certain others, were all found to be encoded by genes that specify the DR4 specificity.
B. SEROLOGIC IDENTIFICATION OF A PARTICULAR MHC CLASSI1 MOLECULEWITH SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS: THEBEGINNINGOF THE IDEAOF A SHARED EPITOPE Using these complex serologic reagents the first reports of the identification of the serologic specificity DR4 in patients with rheumatoid arthritis came independently in 1977 from New York and London (Winchester, 1977; Panayi and Wooley, 1977). This work was confirmed and expanded in the next year, (Gibofsky et al., 1978a,b; Stastny, 1978). The genetic basis of rheumatoid arthritis was also shown to be entirely distinct from that predisposing to systemic lupus erythematosus which was found to be associated with the presence of HLA-DR2 and DR3 (Gibofsky et ul., 1978a,b). The difference in DR associations between systemic lupus erythematosus and rheumatoid arthritis addressed the then prevalent view that autoimmunity was a homogeneous state that differed in its expression in particular organ systems and emphasized rather that there were a number of different immune states preceeding from different immune recognition events that in common resulted in diseases which we characterize as being “autoimmune.” It was evident that in addition to identifying those who typed as Dw4, other individuals typed positively with the serologic reagents. Some of these serologically positive persons with rheumatoid arthritis who were negative for the MLC-defined Dw4 determinant proved to be Dw14 and Dw15 (Gibofsky et al., 1978; Nepom et al., 1989; Thomsen et al., 1979; Ollier et al., 1988). An important salient of this early work initiated the idea of what would be termed a “shared epitope” as a structure found in common among rheumatoid arthritis patients that was not encoded by a recognized DR serologic specificity. When a group of reagent sera that all detected DR4 were used on a panel of rheumatoid arthritis patients
404
ROBERT WINCHESTER
most sera would give a similar significantly increased reactivity with rheumatoid arthritis patients over control individuals reflecting the contribution of DR4, but, in addition, a certain few sera identified much larger proportions of rheumatoid arthritis patients. This additional population included those that typed with other more tractable reagents as, for example, those defining DR1 (Gibofsky et al., 1978a,b; Winchester, 1977; Winchester and Kunkel, 1979). These observations gave rise to the notion that disease susceptibility was not strictly associated with a single allelic product. See Fig. 2 for an example of the different haplotypes and alleles that encode the shared epitope, shown in bold type. The fact that patients could share serologically defined epitopes not readily accounted for by the newly identified DR specificities, and not fitting in with supratypic specificities that defined families of related specificities (Winchester, 1977), ran counter to the prevailing notions of MHC molecules as “tissue types” and the goal of recognizing small differences between otherwise similar alleles as the basis of graft rejection. However, the lesson was clear that, regardless ofthe nominal specificity such as DR4 assigned to these reagent sera, a few of the sera proved to be particularly effective reagents as identifying still larger proportions of rheumatoid arthritis patients. This implied that a larger percentage of individuals with different DR specificities shared certain epitopes that were relevant to disease susceptibility. The resolution of this divergence would also have to await further advances and emerged only after a period of relatively confusing observations that appeared to be, but in fact were not, in conflict.
C. PROBLEMS EMERGE WITH THE DR4 ASSOCIATIONS The HLA serologic specificity DR4 was found to be increased in most studies of patients with rheumatoid arthritis, but the results sometimes varied from laboratory to laboratory (Winchester, 1977, 1981; Stastny, 1976,1978; Gibofsky et al., 1978a,b; Sacha and Kirwan, 1986; Schiff et al., 1982). Most notably, rheumatoid arthritis was not encountered at an elevated frequency among DR4-positive Jewish people (Brautbar et at., 1986),certain other Mediterranean groups, (NunezRoldan et al., 1982;Papasteriades et al., 1985),and some Asian Indians, (Woodrow et al., 1981). Further ccmplicating the problem, in three ethnic groups, Asian Indians, Southern Spaniards, and Jews, what was at the time considered to be DR1 but not DR4 was identified as the predominant DR specificity associated with susceptibility (Sacha and Kirwan, 1986; Schiff et al., 1982; Nunez-Roldan et al., 1982) (Fig. 4). Subsequently, among the populations with predominant DR4-
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
DR4(%+) RA NI. RR British- Anglo-Saxon 74 35 4.5
405
DR1 (%+) RA NI. RR
26 20 1.5
British- Indian
17 14 1.2 60 16 7.0
IsraeIi
37 39 0.9
27 6 5.4
FIG.4. Data illustrating that among ethnically distinct groups of Caucasoids the occurrence of rheumatoid arthritis is associated with the completely distinct serologic specificities of either DR4 or DR1. Adapted from Woodrow et al. (1981) and Schiff et al., 1982.
associated susceptibility, DR1 could be shown to be also associated if the preponderant effect of DR4 was subtracted (Sekiquchi et aZ., 1982; Festenstein and Ollier, 1987). Furthermore, analyses of these data show that a subset ofthe individuals typed as DR1, on subsequent investigation with more recent reagents, now are found to be DRlO (Ollier et al., 1991), as discussed subsequently. However, a decade ago none of this was known and the net result of the, then, large ongoing scientific activity was a somewhat profound dissatisfaction, or at least skepticism, with DR typing as a useful tool of genetic analysis for rheumatoid arthritis susceptibility. There were basically two possibilities to explain the situation as it existed in the early and mid-l980s, the heterogeneity and divergence in results meant either that MHC alleles had a weak and variable role in determining susceptibiIity or that we were missing something fundamental in our understanding the MHC system. In retrospect the explanation of the variability in the intensity of the DR4 associations with rheumatoid arthritis from laboratory to laboratory was due to ethnic differences in the frequency of alleles in the groups that were studied and that serologically defined DR4 was not a fully appropriate marker because it could not distinguish among the different DR4 alleles. The highest relative risks for DR4 and rheumatoid arthritis were found in Mexicans and the Chippewa Nation of American Indians, being 14.6 and 13.4, respectively (Harvey et d., 1983; Gorodesky et al., 1981), while some of their genetic antecedents had much lower relative risks, such as, the Southern Spaniards, 1.8 (Sanchez et al., 1990),Japanese, 2.9 (Otha et al., 1982), and Siberians, 4.0 (Nelson et al., 1992). Furthermore, British and American Caucasoids had associations of rheumatoid arthritis with DR4 of different intensity (Stastny, 1980).
406
ROBERT WINCHESTER THE ESTABLISHMENT OF A CHEMICAL BASIS SUSCEPTIBILITY: RESOLUTIONOF THE PROBLEMS OF SEROLOGIC ASSOCIATIONS
D. BEGINNINGS OF OF
Toward the end of this period of growing dissatisfaction with DR serologic typing as an approach to rheumatoid arthritis, several events occurred that were to form the basis of a new approach to the problem. First, by 1983-1984 a well-defined monoclonal antibody MAb 109d6 (Lee et al., 1984), was found that identified an epitope shared by 93% of a population with rheumatoid arthritis consisting of Hispanic persons and Caucasoids predominantly of Mediterranean ancestry, while the frequency of this shared epitope was 44% in ethnically matched controls (Table 111). The relative risk was 14.4. In contrast, the corresponding figures for DR4 were 58 and 16%, with a relative risk of only 7.1. This observation supported the earlier serologic findings made with polyclonal reagents (Winchester, 1977; Gibofsky et at., 1978a,b; Winchester and Kunkel, 1979), but was based on a monoclonal antibody which recognized a single epitope that was encoded by several alleles. The epitope recognized by monoclonal antibody 109d6 was studied in great detail (see below) and provided a strong basis to the idea that specific structures encoded by several alleles were involved in determining susceptibility to rheumatoid arthritis. These findings supported the earlier notions of structures encoded by multiple alleles that are relevant to rheumatoid arthritis susceptibility. At about the same time, Duquesnoy et al. identified a specificity MC1 identified by certain human serologic and cellular typing reagents that was shared between molecules encoded by virtually all DR4 and DR1 haplotypes, including DwlO and Dw13 varieties, and
TABLE 111
MAB 1 0 9 ~ 6DETECTS AN EPITOPE FOUND ON A LARGE PROPORTION OF RHEUMATOID ARTHRITISPATIENTS OF HISPANIC AND MEDITERRANEAN O R I G I N
Specificity
Rheumatoid arthritis n = 50 (% positive)
DR4 DRlO Mab 109d6 DR53
56 23 93 63
Control n = 36
Relative risk Woolf
Prob
16 8
6.7 3.4 16.9 3.8
0.002 0.06 0.000001 0.003
44 31
Note. DRlO persons account for much of the increased reactivity over DR4.
SUSCEPTIBILITY T O RHEUMATOID ARTHRITIS
407
some DR2, DR9, and DRlO haplotypes. The structural basis of this reactivity is not precisely defined and some evidence placed it on DQ molecules (Duquesnoy et al., 1984; Lepage et al., 1985). However, the reactivity of the MC1 typing reagents is of special interest because they identified 83% of those with rheumatoid arthritis and 43% of matched controls (Carpenter et nl., 1988). Another major step in defining the molecular genetics of rheumatoid arthritis during this period was taken by Nepom et ul., who using the unique patterns of each major type of polymorphic MHC class I1 molecule obtained in 2D gel electrophoresis and identified at the biochemical level what are now termed the DRB1*0404 or DRB1*0408 allelic products of Dw14 in rheumatoid arthritis patients (Nepom et al., 1986). These experiments illustrated the importance of characterizing the genetic elements relevant to disease in biochemical terms, an approach that came to dominate the field with the introduction of molecular biologic techniques, This finding extended the earlier finding of Thomsen et al. (1979) on the presence of Dw14 in these patients. Nonetheless while these fundamental observations were being made, the general consensus seemed to be that HLA associations would not be particularly useful in sorting out the genetic basis of rheumatoid arthritis.
E. ADVANCES IN THE STUDY OF THE Dw DETERMINANTS ENCODED BY DR4 MOLECULES Additional findings in ethnically different populations gave critical impetus to progress in the field. In view ofthe identification of susceptibility to rheumatoid arthritis with the MLC determinant Dw4 (Stastny, 1976; Zoschke and Segall, l986), the reports that different populations had differing frequencies of Dw4 accounting for a variable proportion of those with DR4 proved to be a major clue leading to an understandingofthe molecular basis ofthe phenomenon (Fig. 5).Intensive characterization of the Dw subtypes at the genetic and ethnic level led to a deeper understanding of their complexity (Reinsmoen and Bach, 1982). Of the five principal subtypes of DR4, only Dw4, Dw14, and Dw15 were found to be prevalent in ethnic groups that exhibited a strong association of rheumatoid arthritis with DR4, while the subtypes DwlO and Dw13 were the predominant MLC determinant types comprising DR4 in those populations that had weak or no associations of rheumatoid arthritis with DR4 (Nepom et al., 1986, 1989; Zoschke and Segall, 1986; Ollier et al., 1988; Gao et al., 1990; Brautbar et al., 1986; Wordsworth et al., 1989).
408
ROBERT WINCHESTER
N. Am. Cauc. Israelis Japanese -~ (% of DR4-positive people) Dw4 Subtypes Dw4 DwlO Dw13 Dw14 Dw15 KTZ
46 12 10 26
7 42 21
5
2 5
9 17 5 41 17
FIG.5. Data illustrating that in different ethnic groups the DR4 specificity was accounted for by different T cell-defined Dw determinants. In particular the Dw specificities DwlO and Dw13 were found to predominate among Jewish people where rheumatoid arthritis was not associated with DR4, as illustrated in Fig. 4. Based on data of Reinsmoen and Bach (1982); Zosche and Segall (1986).
F. USE OF ETHNICDIFFERENCES IN THE STRUCTURE OF THE MHC CLASSI1 ALLELES IN A SEGREGATION TYPEOF ANALYSIS TO MAP THE
LOCATION OF SUSCEPTIBILITY TO A SHARED EPITOPE
The best working interpretation of the clue of ethnic differences in the frequency of the Dw subtype was that the evident confusion in using serologic typing to determine disease association reflected ethnic differences in the frequency of distinct alleles that encoded serologically indistinguishable molecules which, however, were not equivalent in conferring susceptibility for rheumatoid arthritis. Accordingly it was evident that the molecular structure of the alleles encoding the DR4 specificity had to be determined to determine whether the trait of developing the disease is controlled by a polymorphic gene in linkage disequilibrium with the HLA marker allele or the disease is due to the direct action of the allelic product itself (Gregersen et al., 1987).
To address this question, DR4 haplotypes were analyzed in detail, initially at the level of molecularly defined epitopes recognizable by monoclonal antibodies (Winchester, 1989;Waters et al., 1984;Toguchi et al., 1984; Legrand et al., 1984; Matsuyama et al., 1988), and in parallel in terms of their gene structure using cDNA libraries prepared from representative DR4 homozygous individuals of each of the Dw subtypes (Matsuyama et al., 1988; Gregersen et al., 1986; Merryman et al., 1989). This was followed by the first study of the structure of D R l alleles in individuals with rheumatoid arthritis by Merryman (Merryman et al., 1987, 1988; Matsuyama et at., 1988), which supplemented the report on the sequence of DR1 in a healthy control (Bell
et al., 1985).
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
409
The results of ethnic differences and their association with disease and DR types can be used in what in effect amounts to a segregation analysis to define the locus and its alleles that are most closely associated with susceptibility (Gregersen et al., 1987), as is summarized schematically in Fig. 6. This type of analysis could, in certain circumstances, yield much of the information that would be obtained from an F1 backcross which would be used in this situation in studies of murine immune disease. As an example, DQB and DQA alleIes can be excluded as critical genetic factors because certain identical alleles are shared by the different DW haplotypes that encode the DR4 specificity; for example, the Dw4 and DwlO varieties of DR4 are disparate for association with rheumatoid arthritis. Similarly, the DRB3 and DRA chain loci can be eliminated because the lack of polymorphism of DR53 and D R A alleles does not parallel the presence or absence of disease. The only locus with sufficient allelic heterogeneity to account for the presence or absence of the pattern of association is the D R B l . However, mapping susceptibility to alleles of this locus meant postulating that not all DR4 alleles could encode susceptibility for rheumatoid arthritis (Gregersen et al., 1987; Nepom et al., 1987). Reciprocally, the identification of susceptibility with structure encoded by several different alleles of the DRBl locus greatly diminished the likelihood that gene products other than the known class I1 MHC products are involved. This rendered rather unlikely the oft-invoked hypothesis of a mysterious non-MHC class 11-linked polymorphic gene as the responsible agent for susceptibility. A second major line of work relevant to the mapping of susceptibility into this sequence of amino acids, and by extension into the nucleo-
DQBl DQAl DRBl
'0402
DR1
'0101/2
=
RA Association
+ -
+
FIG.6. A schematic diagram illustrating the occurrence of rheumatoid arthritis and the results of sequencing the DQ and DR a-chain and /3-chain genes in cDNA libraries made from individuals homozygous to each of the prototype DW subtypes of DR4. By using ethnic differences in the organization of the MHC and presence or absence of the occurrence of rheumatoid arthritis with particular MHC haplotypes, a segregation type of experiment could b e performed which allowed the mapping of susceptibility into a shared region of the DR 0-chain.
410
ROBERT WINCHESTER
tides encoding them, was studies on the genomic organization of the MHC class I1 genes in multiple laboratories, in the case of DR4, most notably that of Strominger and his colleagues (Spies et al., 1985). Figure 2 illustrates that multiple alleles indicated in bold face occurring on structurally distinct haplotypes confer susceptibility to rheumatoid arthritis, further emphasizing that a linked gene near the DR locus was not a likely explanation. The central finding was the absence of an open-reading frame encoding a non-HLA gene in this region. This effectively eliminated the contrary possibility that the structural features of the MHC class I1 products identified with susceptibility were markers for another polymorphic gene in tight linkage disequilibrium. Moreover, the identity in RFLP analyses of DwlO and Dw13 individuals with those having other varieties of DR4 argued against the existence of novel haplotype-specific genes or events in the haplotypes that were not formally sequenced at the genomic level. The appearance of several major studies identifying particular Dw subtypes with rheumatoid arthritis (Nepom et al., 1989; Ollier et al., 1988) supported this conclusion. G. MAPPINGOF SUSCEPTIBILITY INTO A SEQUENCE MOTIF IN THE THIRDDIVERSITY REGIONOF THE DR @CHAINGENE,THE SHARED EPITOPE Using differences in the inferred amino acid sequence of DRBl genes present in the various DR4 subtypes (Table I),a stretch of amino acid residues from position 67 to 74 shared by some DR4 alleles can be identified which is the most likely candidate for susceptibility. Figure 7 illustrates the inferred amino acid sequences of the DRBl @chain alleles that are associated with susceptibility and which encode the shared epitope. The nucleotide motifs shared by these alleles associated with rheumatoid arthritis susceptibility likely arose through gene conversion events. In this analysis, one finding was that the significant sequence variations in the DWlO subtype of DR4 (HLADB1*0402) that is not associated with rheumatoid arthritis susceptibility was found in the third diversity region. This has two implications: the polymorphic amino acid sequences of the first and second diversity regions of DR4 alleles do not confer susceptibility to rheumatoid arthritis and, second, the presence of the amino acid Ile (I) at position 67 and Asp (D) and Glu (E), respectively at positions 70 and 71, such as found in the DwlO or Dw13 allelic product, abrogated the property of the molecule to confer susceptibility (Figs. 8-10). This change from the sequence of the Dw4 prototype third diversity region was the critical finding in suggesting the importance of the third diver-
411
SUSCEPTIBILITY T O RHEUMATOID ARTHRITIS
Allele
Diversity Region Second Third 9 11 13 26 28 30 37 67 70 71 74 First
RA
-
DRB1'0101 (Dwl)
W L F
L E C S
L Q R A
t
DRB1'0401 (Dw4)
E V H
F D Y Y
L Q K A
+
DRB1"0402(Dw10)
F D Y y
I D E A
F D Y Y
L
R E
-
DRB1*0404(Dw14)
H E V H E V H
F D Y Y
L Q R A
+
DRB1'0404(Dw15)
E V
H
F D Y y
L Q R A
t
DRB1'0403(Dw13)
E V
Q
FIG.7. The polymorphic amino acid sequences of alleles including the DRB1*0101, DRB1*040I ( D w ~ )and , DRB1*0402 (DwlO) p-chains, respectively, associated or not associated with susceptibility to rheumatoid arthritis, which suggested that the niolecular basis of susceptibility was due to the presence of particular amino acid residues at positions 67, 70, 71, and 74 of the a-helical portion of the DR p-chain. These encode the shared motif LQRIKA, encoded by otherwise distinct alleles, which presumably specifies an "epitope" or conformation responsible for interaction with the side chain of a peptide antigen and the T cell receptor. Alleles encoding negatively charged amino acid residues at positions 70, 71, or 74, asp (D), or glu (E) were not associated with rheumatoid arthritis, suggesting that an imnrune recognition event necessary for the development of the disease was not mediated by these gene products.
FIG.8. An illustration of the MHC class I1 molecule containing the DRB1*0401 pchain showing the peptide backbone and the location of the polymorphic residues in the DR p-chain. The shared motif LQR/KA is shown encoded by residues at positions 67, 70, 71, and 74 of the a-helical portion of the DR p-chain.
FIG.9. An illustration of the MHC class I1 molecule containing the DRB1*0402 pchain (DwlO) which is not associated with susceptibility to rheumatoid arthritis showing the peptide backbone and the location of the negatively charged polymorphic residues at position 70 and 71 in the DR p-chain. Presumably the charge of these residues does not permit an immune recognition event necessary for the development of the rheumatoid arthritis.
FIG. 10. An illustration of the MHC class I1 molecule containing the DRB1*0403 p-chain (Dw13) which is not associated with susceptibility to rheumatoid arthritis showing the peptide backbone and the location ofthe negatively charged polymorphic residue at position 74 in the DR p-chain. Presumably the charge of this residue does not permit an immune recognition event necessary for the development of the rheumatoid arthritis.
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
413
sity region as the site of special relevance to rheumatoid arthritis. These consensus residues permissive for the development of rheumatoid arthritis are, from position 67 and ending at position 74, Leu-LeuGlu-Gln-Arg or Lys-Arg-Ala-Ala, LLGQRKRA. Or, only considering the underlined polymorphic locations at positions 67, 70, 71, and 74, LQRIKA. The sequence of the Dw13 allele that is not associated with susceptibility resembles the sequences of Dw4 and Dw14 alleles with the important difference that, as with the DwlO allele, there is another highly nonconservative negatively charged amino acid substitution involving a change to glutamic acid (E). However, E is located at position 74, not at 71, as in the DwlO @-chain,suggesting that negative charges in the a-helical portion of the @-chainat position 70, 71, or 71 did not permit that gene product to cause susceptibility to rheumatoid arthritis. This interpretation was initially reported by Gregersen et al. (1987), as the shared epitope hypothesis, and was one of the first instances of an attempt to relate the molecular basis of disease susceptibility to a particular defined conformation or structure in an MHC molecule. The designation of this hypothetical structure as an “epitope” is not strictly accurate in the sense that it was not defined by an antibody but the term communicates what was meant fairly well. The inference of an epitope is an example of reverse genetics in which the idea of a hypothetical structure that determines a disease comes directly from the sequencing of DNA where a shared “motif” that exhibits conformational equivalence is evident (Winchester and Gregersen, 1988). In fact as discussed below this region most probably is a contact site or pocket that influences an interaction of a peptide side chain with the MHC molecule. Inasmuch as DR1 is serologically unrelated to DR4, yet both specificities are associated with rheumatoid arthritis, the structural analysis of the DR1 haplotype affords an important approach to determining whether this interpretation of the molecular basis of susceptibility is a valid notion. The structural divergence between the sequence of DR1 and DR4 in the first two diversity regions is marked, and, with the exception of positions 28 and 32, there is little to suggest that susceptibility is encoded by either of these two regions (Table I). However, the third diversity region of DR1, including that from a rheumatoid arthritis patient with a distinctive DR @-chain(DRlNASC) DRB1*0102, was found to be identical to the third diversity region of the DR4 subtypes associated with rheumatoid arthritis susceptibility. This was unsuspected in view of the serologic typing differences of DR4 and DR1 molecules, (Merryman et al., 1987,1988,1989; Winches-
4 14
ROBERT WINCHESTER
ter and Gregersen, 1988). The sequence studies of DR1 in patients with rheumatoid arthritis identified both alleles of DR1, DRB 1*0101 and DRB1*0102, which differ by a glycine to valine substitution at position 86. Interestingly these studies largely performed in a Mediterranean and Jewish population also identified the DRB1*0102 allele as the preponderant DR1 allele found in this subset of the Caucasian population. In the shared epitope model of susceptibility the fact that arginine and lysine, both positively charged residues, were approximately equally associated with rheumatoid arthritis in the Dw4 and Dw14 or Dw15 alleles was taken to mean that positive charge at position 71, or perhaps more importantly the absence of residues with a negative charge at this position, was the essential factor. Similarly, the hydrophobic residue of leucine at position 67 and alanine at position 74 appears important. In the first presentation of the shared epitope hypothesis it was surmised that a glutamine residue had to occupy position 70. With the identification of DRlO as a susceptibility allele and the associated characterization of the structure of the molecule, as discussed below, arginine at this position was also found to be a part of the definition of the shared epitope. Viewed in this way, susceptibility to rheumatoid arthritis might be thought of as exhibiting a dominant mode of inheritance associated with the inheritance of conformationally equivalent portions of certain DR4 or DR1 pl-chain genes defining the molecular basis of the susceptibility, despite the conventional serologic unrelatedness of their products (Winchester and Gregersen, 1988; Gregersen et al., 1987). The contrast of this pattern of allelic association and implication of a shared epitope with the situation in those who develop chronic Lyme disease is informative. Serologic analysis reveals a significant association of DR4 and DR2 with progression to chronic Lyme disease (Steere et al., 1990). However, molecular analysis shows a frequency of Dw determinants and alleles quite different from that of rheumatoid arthritis with a considerable proportion of Dw13. Moreover, DR2 and not DR1 was the second associated DR specificity (Steere et al., 1990). If this association is taken as the basis of a common MHC structure, the most likely interpretation is that the DRB5*0101 allele of the DR2 haplotypes and the DRBl locus alleles of DR4 share features. This suggests that susceptibility to chronic Lyme disease is primarily determined by the residues in the first two diversity regions occupying the floor of the antigen-binding cleft (Figs. 11 and 12) (Dwyer and Winchester, 1993).The possible mapping of susceptibility to a region of the floor of the antigen-binding cleft is suggested by the
415
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
Diversitv . -. -.. Reoion Third
Allele
First Sec;nd-* --
9 Hi3
26281037
67707174
Disease Lyme R A
DRB1'0101
WLF
LECS
LQRA
-
t
DRB1'1501
QDY
FHDD
FDRA
t
-
DRB5*0101
WPR
FDYS
FDRA
t
-
DRB1'0401
EVH
FDYY
LQKA
t
t
DRB1'0402
EVH
FDYY
I DEA
(4
-
DRB1'0403
EVH
FDYY
LQRE
t
-
DRB1'0404
EVH
FDYY
LQRA
t
t
DRB1'0405
EVH
FDYY
LQRA
(4
t
FIG.11. A comparison ofthe polymorphic residues ofalleles associated with susceptibility to rheumatoid arthritis and those associated with the property of developing chronic Lyme disease after infection with B . hurgdorferi. In the situation of chronic Lyme disease, there is a common set of amino acid residues shared by DRB5*01 aIIelic products and DRBl*04 allelic products which delineates a potential conformational structure that could be responsible for the development of chronic Lyme disease. This structure might act at an early stage in formation of the T cell repertoire by negatively selecting T cell clones necessary for an effective response against B . burgdorferi.
FIG.12. An illustration ofthe MHC class I1 molecule showing the peptide backbone and the location of the polymorphic residues in the DR P-chain. A common set of amino acid residues shared by DRBS*Ol allelic products and DRB1*04 allelic products delineates a potential conformational structure that could be responsible for the development of chronic Lyme disease. It differs in location from that associated with susceptibility to rheumatoid arthritis.
4 16
ROBERT WINCHESTER
polymorphic residues shared by the DR5*01 alleles (DR2) and DR1*04 alleles. This would place the relevant amino acid residues that influence susceptibility to chronic Lyme disease as located at positions 13, 26,28, and 30. Since this sequence motif appears to have a dominant association with susceptibility it is likely that the motif acts to present a self-peptide involved in deleting T cell clones necessary for effective elimination of Borrelia burgdorferi. This putative susceptibility structure is compared to the shared epitope sequence in Fig. 11. H. How DOESTHE SHAREDEPITOPEHYPOTHESIS, AS AN EXPLANATION OF MOLECULAR GENETICS, RELATETO THE QUESTION OF SUSCEPTIBILITY? In the case of North American Caucasians, the incidence of rheumatoid arthritis is about 1% and the prevalence of persons with the shared epitope is about 45%. Roughly then, the frequency of rheumatoid arthritis in those with the shared epitope is 2% and more than an order of magnitude lower in those without the shared epitope. The data of the Nepoms provide measures of similar magnitude. In their healthy population the prevalence of the shared epitope (taken as Dw4, Dw14, or D w l ) was 42%, of whom 2.2% developed rheumatoid arthritis, while only 0.17% of the group of persons lacking the shared epitope had rheumatoid arthritis (Nepom and Nepom, 1992).An analysis presented by Silman in Table IV illustrates the risk conferred in the population
TABLE IV BY SILMAN (1993) AN ANALYSIS PRESENTED ILLUSTRATES THE RISK CONFERRED IN THE POPULATION BY THE INHERITANCEOF AN ALLELE EXPRESSING THE SHARED EPITOPE Rheumatoid arthritis
Shared Epitope
Present Absent Total
Present
Absent
Total
95 5 100
4,405 5,495 9,900
4,500 5,500 10,000
Note. It is assumed thatthe prevalence ofrheumatoid arthritis is 1% and the shared epitope is found in 95% of those with the disease and in 45%of the total population. As a marker the shared epitope has a specificity of 561, sensitivity of%%, and a positive predictive value of 2.1%.
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
417
by the inheritance of an allele expressing the shared epitope (Silman, 1993). It is assumed that the prevalence of rheumatoid arthritis is 1% and the shared epitope is found in 95% of those with the disease and in 45%of the total population. Considering the shared epitope simply as a marker to be used in establishing the diagnosis of rheumatoid arthritis, it has a specificity of 56%, sensitivity of 95%,and a positive predictive value of 2.1%.Accordingly, it would appear that determination of the presence of the shared epitope as a simple diagnostic device does not add great power to the physician's assessment of a patient if the only question is whether the patient has rheumatoid arthritis. However, as discussed below, the dosage effect of the shared epitope, the particular structure of the shared epitope, and the nature of the allele that codes for it appear to be very important predictors of the course that the illness will take. Perhaps the central implication of the shared epitope hypothesis was that a new paradigm was implicit in the formulation that susceptibility was specified by a conformationally equivalent structure that was encoded by a number of alleles. No longer could the formal genetic approach be taken of searching for linkage between inheritance of a haplotype and the phenotypic trait of rheumatoid arthritis, since there was equivalence or near equivalence between a number of allelic products and all were characterized by only moderate degrees of penetrance. This idea of the functional equivalence of haplotypes that encode similar structures was pointed out some years ago (Winchester, 1981). The family pedigree provided by Dr. M. A. Kahn (Winchester, 1981), shown in Fig. 13, illustrates a multiplex family in which the mother and one male child developed rheumatoid arthritis. In each, rheumatoid arthritis was associated with the presence of DR4, but each person inherited a different haplotype that bore the DR4 allele associated with susceptibility. Presumably because of this phenomenon, classic linkage studies have usually been unsuccessful in demonstrating any linkage between HLA and rheumatoid arthritis, (Go et al., 1987; Walker et al., 1987), while they have been successful in ankylosing spondylitis where this disease develops in HLA-B27positive individuals at approximately the same rate as it develops in those who possess the shared epitope. The new paradigm involves the concept and hypothetical mechanism that the inheritance of the susceptibility structure associated with this autoimmune disease does not directly act to cause the disease state but influences the T cell repertoire, such that the probability for a transition to a disease state is increased. The article of Rigby et al. concludes with the view that, ". , . the way ahead for genetic epidemiologists would appear to in-
418
ROBERT WINCHESTER
1-B27-DR4 H L A - A ~ - B w ~ ~ - D RHLA-A1 ~ HLA-A3-B8-DR3 HLA-( )-( )-DR5
HLA-AlI-B27-DR4 HLA-A3-B8-DR3
HLA-A2-BW44-DR4 HLA-A3-B8-DR3
FIG.13. A family provided by M. A. Kahn that illustrates the occurrence of rheumatoid arthritis associated with DR4 in two members of a family. However, susceptibility was not inherited by the same allele or haplotype, since the two individuals with disease did not share the same haplotype. This emphasizes the functional, or conformational, equivalence of the products of the two alleles in specifying disease susceptibility and the problems of performing linkage studies in this situation of low penetrance and conformational equivalence of many allelic products.
clude looking more closely at the HLA region at the epitope region . . .” (Rigby, 1992).
I. MAPPINGSUSCEPTIBILITY INTO THE STRIPOF @-HELIX PRESUMED TO BE FACING THE UPPERMOST PARTOF THE ANTIGEN-BINDING GROOVE
The argument can then be made (Winchester and Gregersen, 1988) that the residues in the homologous positions on the DR4 subtypes Dw4, Dw14, and Dw15 that are associated with susceptibility form one or more conformations critically involved in determining the configuration of the immune system that predisposes one to rheumatoid arthritis either at the level of antigen presentation or in the formation of the T cell repertoire by self-tolerance. By crystallographic analysis (Brown et al., 1993), the polymorphic residue 70 faces upward and inward. This residue forms a hydrogen bond with the side chain of a peptide antigen in the DR1 molecule. Residue 71 also might be in a position to interact with the T cell receptor, thereby influencing the T cell receptor repertoire (Davis and Bjorkman, 1988). Residues 67, 71, and 74 face into the antigen-binding cleft located in the left of the diagram. Residues 67, 71, and 74 are neighbors, being approximately in line. The shared epitope structure appears to be a contact site determining the specificity of the interaction between the side chain of the bound peptide and the MHC. Because of its location on the upper side of the molecule it also may influence the interaction with the T cell receptors, an attribute that may distinguish the residues of
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
419
the a-helix from those of the @-pleated sheet floor of the antigenbinding cleft. The side chains of the polymorphic residues comprising the shared epitope, even ifthey are primarily contact residues influencing the binding of specific peptides, are also seen from the top by the T cell receptor. In the instance of MHC molecules not associated with rheumatoid arthritis susceptibility, the presence of nonpermissive amino acid side chains that have different chemical, spatial, and, perhaps most importantly, negative charge and more hydrophilic properties appears to alter the functional character of the a-helix such that it does not operate as a susceptibility determinant for rheumatoid arthritis. This region of the DR p-chain has also attracted considerable interest in studies on structure-function of murine MHC molecules. This is the region of the bm12 mutation which involves polymorphisms on the I-A p-chain only at positions 67, 70, and 71 that regulate whether a mouse responds to defined antigens such as pigeon cytochrome C (Ronchese et al., 1987a,b). Mutagenesis at this position revealed that this region exhibited an important role in regulating specific immun responsiveness, not at the level of antigen binding to the MHC molecule but at the level of the T cell repertoire (Ronchese et ul., 1987a,b). Functional analysis of recombinant molecules was interpreted to imply the presence of two distinct functional sites. One involving the region of the shared epitope was considered to play an important role in the interaction with T cell receptors, and the other, the region of P-pleated sheet structure lying more deeply in the antigen-binding groove, was postulated to control peptide binding (Ronchese et al., 1987a,b). The structural interpretation of these data had to be slightly modified in light of the crystallographic structure (Brown et ul., 1993), since residues involved in the shared epitope region also appear situated to play a role in peptide binding. Nevertheless the functional implications of a role of the shared epitope structure in interacting with T cell receptors remain an important clue to the significance of this motif in the biology of rheumatoid arthritis.
V. Contemporary State of MHC Associations with Susceptibility
A. MOLECULAR ANALYSISOF DR6: A TESTFOR THE SHARED EPITOPEHYPOTHESIS The shared epitope hypothesis was developed to explain the pattern of association with DR4 and DRl alleles. But did it have any predictive value to suggest the molecular basis of associations with alleles other
420
ROBERT WINCHESTER
than DR1 and DR4? Willkens et al. identified DR6 as a serologic specificity associated with susceptibility to rheumatoid arthritis among American Indians of the Yakima Nation (Willkens et al., 1991). Since there were three major varieties of DR6 distinguishable according to the sequence of the polymorphic residues in the a-helical third diversity region, one with the shared epitope and two with negative-charged residues asp (D) or glu (E) at position 70, 71, or 74, the outcome of the analysis was a critical test of the predictions of the shared epitope hypothesis. The DR6 (HLA-Dwl6) allele, DRBl"1402, was found in 83% of the Yakima with rheumatoid arthritis and 60% of Yakima controls. The high frequency of this DR6 allele among this ethnic group illustrates the effects of selection and founder effects that are evident in many American Indian populations. This allele is identical to the shared epitope sequence (see Table I ) and its occurrence in this population of those with rheumatoid arthritis is a correct prediction of the hypothesis. A study of other North American Indians b y Nelson et al. similarly supported the hypothesis of the relationship of the shared epitope to susceptibility to rheumatoid arthritis. In Alaskan Tlingit Indians HLADR4 was decreased in the rheumatoid arthritis group (n = 32) compared with controls ( n = 62) (6% vs 21%, P = 0.07) (Nelson et al., 1992). However, the predominant DR4 allele observed in the control population was DRB1*0403 (Dw13.1), which does not express the shared epitope structure. The most striking observation in these studies was a marked predominance of the same DR6 allele found in the Yakima, the DRB1*1402 allele encoding Dw16 (DRwl4). This allele was present in 91% of rheumatoid arthritis cases, but as with the Yakima was also highly prevalent in controls (80%, OR = 2.4, P = 0.20). In both cases and controls the DRB3*0101 (DR52) 2nd the DQA*0501 and DQB*0301 alleles encoding a subset of DQw3 were associated with DRB 1*1402 suggesting the presence of a preponderant haplotype in this population. SeveraI reviews summarize the development of this knowledge (Lanchbury, 1992; Nepom et al., 1989; Deighton et al., 1992; Ollier and Thomson, 1992; Wordsworth and Salmon, 1992). B. ADDITIONAL STUDIESON DR4 AND DR1 IN RHEUMATOID ARTHRITIS I N DIFFERENT POPULATIONS In populations as diverse as Southern China, India, Italy, South Africa, and Japan, molecular analysis has revealed the presence of a shared epitope structure encoded by various different alleles associated with susceptibility to rheumatoid arthritis. In an analysis of adult
SUSCEPTIBILITY T O RHEUMATOID ARTHRITIS
42 1
Italian rheumatoid arthritis patients, Angelini et al. confirmed the previously reported increase of DR4 specificity, in comparison with healthy Italian individuals. There was a statistically significant positive association of DRB1*0401 and DRB 1*0404 alleles with rheumatoid arthritis (Angelini et al., 1992). These authors also found a trend of positive association of DRB1*0101 in DR4-negative patients versus DR4-negative healthy controls and, in the group of DR4-negative and/ or DR1-negative patients, a similar increase of DRB1*06. In Southern Chinese the linkage between rheumatoid arthritis susceptibility and the presence of HLA-DR4 and DR p allelic third hypervariable region sequences was studied by Seglias et al. (1992), who found an increased frequency of HLA-DR4 alleles which have the same molecular basis of disease susceptibility as that found in Caucasian rheumatoid arthritis patients. Restriction fragment length polymorphism and DRB allele-specific typing of DRB DNA amplified in the polymerase chain reaction revealed that the frequency of HLA-DR4 was significantly increased, 42.4%, among rheumatoid arthritis patients versus 17.8% in controls. Increased frequencies of the DQA3 allele (77.8% vs 48.9%) and the DQB1*0302 allele (71.0%vs 46.3%), which are in linkage disequilibrium with DR4, were also found. Oligonucleotide typing showed that the shared epitope motif of amino acids was found in 19 of49 patients and 5 of 32 controls. The main DR4 allelic subtypes found were DRB1*0404 and DRB1*0405, both of which carry the shared epitope sequence (Seglias et al., 1992). Tsuchiya et al., in a Japanese-language review (Tsuchiya et al., 1992),discuss the genetic susceptibility of rheumatoid arthritis among Japanese, pointing out that DRB1*0405 (Dw15) which encodes the LQRA shared epitope is the DRBl allele that is most frequently found in association with rheumatoid arthritis in this population. Emphasizing that risk estimates for alleles and hypervariable regions differ considerably among different ethnic groups and subsets of patients, the broader aspects of the association between HLA immunogenetics and the susceptibility of developing rheumatoid arthritis were discussed by Lanchbury (1992).Taneja et al. (199%) studied 168 North Indian patients with rheumatoid arthritis confirming the association with DR4 in familial and sporadic patients. The HLA-DR2 and -DR5 alleles were interpreted as conferring protection, with DR5 being reduced significantly in only the nonfamilial patients. The distinction between protection and the absence of susceptibility is not easy to resolve with certainty in this or in other situations. DR4 in combination with DR1 provided the highest relative risk (71.9) followed by DR4, DR4 (RR = 4.1) (Taneja et nl., 1992b). These results are consistent
422
ROBERT WINCHESTER
with the interpretation that susceptibility to rheumatoid arthritis is enhanced when two haplotypes are inherited that encode the shared epitope, an issue discussed in detail below. In Israeli Jews, sequencing reveals that DRB1*0102 is the predominant HLA-DR1 subtype (de-Vries et al., 1993), confirming the earlier results obtained in persons of Jewish ancestry in New York City by Merryman et al. associating this allele with susceptibility (Merryman et al., 1988, 1989). DRB1*0102 (DR1, Dw20) was found in eight rheumatoid arthritis patients and three controls and the DRB1*0101 (DR1 Dwl) was found in four rheumatoid arthritis patients and two controls. N o other DR1 subtypes were encountered. In all 20 DR1 haplotypes, the DRB1*0101 or 0102 allele was associated with DQA1*0101 and DQB1*0501, being identical to the Caucasian DR1 haplotypes (deVries et al., 1993). Studies on the occurrence of rheumatoid arthritis in genetically relatively isolated populations continues to provide useful insights into the genetic basis of susceptibility, as was the case in the investigation of the DR6 alleles among Western North American Indians described in section IV,A. For example, among the Guambiano Amerindian tribe of Colombia, the frequency of persons having serologically defined DR4 is elevated to 62.5%, which is largely composed of individuals with the DRB1*0404 allele (53.3%) (Yunis et al., 1993).This unusual overrepresentation of what is thought to be a Northern Caucasian allele allows explicit testing of whether it predisposes one to rheumatoid arthritis. Among eight Guambianos with the disease, seven were DR4 and six DRB1*0404. Of these one was homozygous for the DRB1*0404 allele, while three were DRB1*0404 /DRB1*0407, one DRB1*0404 /DRB1*0901, and one DRB1*0404/DRB1*1602. These results support the role of the DRB1*0404 allele as one that is independently capable of inducing susceptibility. VI. DRlO and a Second Shared Epitope
A. MAB 109d6 DEFINES SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS The application of MAb 109d6 to patients with rheumatoid arthritis as mentioned previously was the first description identifying an immunochemically defined shared epitope encoded by multiple and otherwise dissimilar alleles using a reagent that was monospecific (Toguchi et al., 1984).This is, in a formal sense, a true shared epitope. Use of this reagent came at an important moment during the period of divergent
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
423
conclusions regarding DR4 since it provided renewed motivation to pursue the notion of the shared epitope defined above (see section II1,e) (Lee et al., 1984). Subsequent work proved that the actual epitope recognized by MAb 109d6 was a structure slightly different from the inferred DR1-DR4 shared epitope described in section III,H, but this research, nevertheless, led to both the identification of DRlO as an allele related to rheumatoid arthritis susceptibility and an expansion of the concept of the shared epitope. The initial results of staining with MAb 109d6 by Lee et al. (1984), as described in section III,E, identified the epitope on 93% ofapopulation of Hispanic persons and Caucasoids predominantly of Mediterranean ancestry with rheumatoid arthritis and 44% of matched controls (relative risk 14.4, Table 111). Two groups of rheumatoid arthritis patients were evident: DR4-positive, MAb 109d6-positive and DR4negative, MAb 109d6-positive. There were no DR4-positive, MAb l09d6-negative patients observed, and of course there were many individuals negative for both reactions. When serologically typed in 1984 using the available polyclonal reagents, one instance of DRlO was detected in the group of DR4-negative, MAb 109d6-positive individuals and five others were typed as DR1. The typing as DR1 was an error because of a contaminant specificity for DQwl determinants in the polyclonal typing reagent. In subsequent studies with improvements in serologic typing, each of the latter five persons was redefined as DR10, with the major clue being that the MAb 109d6 epitope was encoded by a haplotype expressing D Q w l (Matsuyama et al., 1988).
B. MOLECULESRECOGNIZED BY THE MAB 1 0 9 ~ 6 The next challenge was to understand what molecules were being recognized b y MAb 109d6. Immunochemical studies first using cocapping techniques showed that although all DR4-positive individuals were MAb 109d6-positive, the molecules bearing DR4 were distinct from those encoding the MAb 109d6 epitope (Toguchi et al., 1984). Immunoprecipitation and protein sequencing experiments led progressively to the identification of which MHC class I1 molecules bore the MAb 109d6 epitope. In DR4-positive cells the MAb 109d6 epitope was found not on the &-chain bearing the serologic DR4 specificity encoded by the HLA-DRB1 locus but on the minor DR &-chain that bears the DR53 specificity encoded by the HLA-DRB4 locus. This locus is present on DR4, DR7, and DR9 haplotypes (Matsuyama et al., 1986). This finding explained why MAb 109d6 identified DR4-
424
ROBERT WINCHESTER
positive individuals. The finding was in a sense fortuitous since patients were not being identified by the DRBl chain gene product that expressed the DR4-DR1 shared rheumatoid arthritis epitope LQK/ RA,but by the presence of the minor DR &chain that bears the MAb 109d6 epitope. Another aspect of this finding was that the second DR p-chain encoding DR53 and the MAb 109d6 epitope was also expressed by the DR7 haplotype. While the frequency of DR7 was found at a relatively low frequency in the study population and did not greatly affect the analyses, it is of some interest to find that Rigby et al. have identified a significant increase in DR7 among those persons with rheumatoid arthritis after the contributions of DR4 and DR1 have been isolated from the analysis using the relative predispositional method (Rigby, 1992). 6 DRlO C. RECOGNITIONOF THE MAB 1 0 9 ~ ON But what of the DR4-negative MAb l09d6-positive patients? Here immunoprecipitation and microsequencing studies identified the MAb 109d6 epitope on DRlO p-chains encoded by the DRBl locus (Matsuyama et aZ., 1988). These had a characteristic basic mobility on 2D gel electrophoresis. This ability to unequivocally identify DRlO at a biochemical level led to the first cloning and sequencing of the DRlO allele by Merryman et al. (Merryman et aZ., 1987, 1988; Semana et al., 1988). As a result of the sequencing, it was found to be identical with the sequence of a previously unknown type of DR chain in the lymphoblastoid cell line RAJI. Confirmation that RAJI was DRlO was provided by positive staining of the cell line with MAb 109d6 (Merryman et al., 1987, 1988; Semana et al., 1988). The DRlO allele shares some of its third diversity region including positions 70 and 71 with the DR53 DRB4 chain (Table I ) and the DRlO allele likely arose through a conversion event involving the DR53 gene. Position 74 however resembles that of the alleles encoding the shared epitope (Merryman et al., 1987, 1988; Semana et al., 1988). Thus the significance of the association of the MAb 109d6 epitope with rheumatoid arthritis involves the identification of DR4 and DR7, through the possibly surrogate identification of the DRB4 locus alleles which encode the MAb 109d6 epitope; DR9, through the identification of these DRB4 locus alleles as well as a second epitope encoded by the DRBl*09 allele; and DR10, where the only epitope is specified by the DRB1*10 allele. D. A SHARED EPITOPECONSENSUS The critical part of the epitope recognized by MAb 109d6 is determined by the presence of arginine at two polymorphic residues at
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
425
positions 70 and 71, RR, probably in conjunction with the side chains of the surrounding nonpolymorphic residues including another R at position @72. It is unlikely that the epitope extends to residue 74 because the charge of this amino acid is positive in DRlO and negative in DR53 molecules. Mutagenesis of the DRlO @-chaingene supported this interpretation. Changing the @70R residue to Q resulted in the loss of the 109d6 epitope, while altering p72 R to Y had no effect (P. Merryman et al., u n p u b h h e d observations). This structure differs from the center of the postulated sequence of the shared DR4-DR1 epitope LQRA by the substitution of an arginine (R) for glutamine (Q) at position 70. In the case of DR10, which is clearly associated with rheumatoid arthritis, the analogous sequence would be LRRA. It seems likely that both the DR4-DR1 LQR/KA sequence and the LRRA sequence are involved in determining susceptibility. The consensus sequence between the two sequences is LQ/RR/KA (Fig. 14). The substitution of the arginine for glutamine at position 70 is relatively conservative in that it involves postulating the equivalence of a neutral hydrophilic residue (Q) with the only slightly larger positively charged arginine (R). More extensive studies are required to identify whether each of the parent forms of the shared epitopes, those associated with either MAb 109d6-DR10 or DR4-DR1, specify equivalent risks for rheumatoid arthritis justifying the consensus shared epitope sequence. Figure 2 illustrates the alleles that encode the consensus shared epitope sequence.
E. POPULATION STUDIESOF DRlO DR4, AND DRI Further confirmation of the association of DRlO with rheumatoid arthritis has been forthcoming as the ability to define this chain using typing sera improved. DRlO has been identified with rheumatoid arthritis in Mediterranean people such as Spaniards (Sanchez et al., 1990) and Jews, (Gao et al., 1991a,b). Among 180 Caucasian rheumatoid arthritis patients HLA-DR10 has been found in 3 of 23 patients lacking
67
Amino Acid Position 70
71
74
R
A
R/K
A
Consensus L Q/R R/K
A
iogd6
DR10 L R
DR4/1/6
L Q
FIG.14. A concensus sequence from two shared epitopes. Based on the pattern of association of susceptibility of rheumatoid arthritis with different alleles, a consensus motif that specifies susceptibility is proposed.
426
ROBERT WINCHESTER
DR4 or DR1, but in none of 54 normal controls who lacked these two specificities (Wordsworth et al., 1991). The cumulative percentage of rheumatoid arthritis patients with DR4, DR1, and DRlO that express the putative shared epitope LQ/RR/KA in this study was 89%, comparable to the percentage found in the study using MAb 109d6 (Lee et al., 1984). When rheumatoid arthritis occurs in Jewish people it is associated with the presence of alleles that encode a shared epitope. In addition to DR10, these include DRB1*0405 (DR15), DRB1*0408 (Dw14.2), DRB1*0404 (Dw14.1), and DRB1*0101 and DRB1*0102 that taken together account for 56% of the Jewish patients with rheumatoid arthritis, and, considering the shared epitope as a susceptibility determinant, these yielded an overall relative risk of 8.6, (Gao et al., 1991a,b). This study also supported the previous identification of DRB1*0102 in patients with rheumatoid arthritis of this ethnicity (Merryman et al., 1987, 1988; Matsuyama et al., 1988). The alleles with glycine in codon 86 gave slightly higher relative risks than did alleles encoding valine in this position. Indeed all of the DR10-positive rheumatoid arthritis patients were either Hispanic or Jewish in the abovedescribed study of Lee et al., where they were recognized as DR4negative, MAb 109d6-positive, (Lee et al., 1984). Of special interest a reassessment of HLA typing among Asian Indians revealed that some of the patients that had been serologically typed as HLA-DR1 were HLA-DR10. This specificity was found in 27.3% of patients and 8.9% of controls (Ollier et al., 1991) and frequently among another series of 41 multicase families with rheumatoid arthritis in Northern India (Taneja et al., 1993). In a Greek population with rheumatoid arthritis that did not manifest an association of susceptibility with HLA-DR4, alleles encoding HLA-DR1, -DR10, and -DR14 were all found at significantly higher frequency (Cutbush et al., 1990). In view of the weak but definite association of DR7 with rheumatoid arthritis reported by Rigby (1992),and their reactivity with MAb 109d6 because ofthe presence ofthe DRB4*01 alleles on the same haplotype, if a shared epitope theory were to be formulated to account for this situation it would have to involve the presence of the susceptibility structure on a quantitatively minor DR species. This was considered to be an interpretation of the data on susceptibility to chronic Lyme disease (Dwyer and Winchester, 1993) (see Section 111,H). The presence of a susceptibility epitope expressed at a lower level could account for the lower frequency of those with this allele through a consequent reduction of penetrance resulting from a lowered “dose” of MHC molecule. A second implication would be that the structure of the shared epitope in instances where there is a positively charged
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
427
amino acid at polymorphic positions 70 and 71 would tolerate a negative charge at position 74, which is the case in the DR &-chain bearing the Dr53 specificity, as well as in the DR9 p-chain. A prediction of this model would be that rheumatoid arthritis would also be associated with the presence of DR9. This has not previously been identified to be the case in the extensive Northern European and Northern American studies. However, DR9 has been reported to be associated with rheumatoid arthritis among Chileans (Massardo et al., 1990). This is an area that requires additional investigational attention because it is central to the definition of the exact nature of the molecular basis of disease susceptibility.
F. RHEUMATOID ARTHRITISSUSCEPTIBILITY IN BLACKS Among Black individuals, susceptibility to rheumatoid arthritis has several distinct features. In early studies of North American Blacks the relative risk of rheumatoid arthritis in association with DR4 was high but fewer than 50% of those with the disease had DR4. Thus, in this population the attributable risk for rheumatoid arthritis in association with DR4 was unusually low. In a study b y Fraser (l993),only 68% of North American Blacks in the Boston area had an allele encoding a shared epitope. The most frequent HLA type was DR1, found in over half of the patients. Only one-fifth of the patients had DR4 which apparently reflected the low frequency of DRB1*0401 and DRB1*0404/8 alleles in the control population. Disease was most commonly found associated with DRBl*0405, the DR4 allele prevalent among Asians. The proportion of American Blacks developing rheumatoid arthritis with DRlO was nearly equal to those with DR4. Similar results were obtained in a study of North American Blacks in Alabama (McDaniel, 1993). The prevalence of rheumatoid arthritis among North American Blacks is not reliably ascertained and it remains to be determined whether disease frequency is reduced in proportion to a reduction in the population frequency of alleles generally associated with susceptibility in Caucasians. The lower proportion of persons with rheumatoid arthritis that have the shared epitope suggests the possibility that other alleles not having the shared epitope may, in this population, be associated with susceptibility. McDaniel has observed that the frequency of DR3 is increased, from 10% in controls to 26% among those with rheumatoid arthritis, (McDaniel, 1993). This could have two interpretations. In one the third diversity sequence of DR3 at positions 67, 70, 71, and 74, LQKR, has similarities with the shared epitope at the position 70 and 71 consensus in that there are no negative
428
ROBERT WINCHESTER
charged amino acids at these sites. However, the lack of a hydrophobic residue at 74, it being occupied by a positively charged arginine, is not associated in other groups with susceptibility. An alternative interpretation is that racial admixture between Caucasians and American Blacks results in the introduction of non-MHC susceptibility genes into a Black genetic background characterized by a low frequency of these genes, which would result in an increase in penetrance of the MHC alleles bearing the shared epitope that are at a lower frequency in this population (Fraser, 1993). For example, the higher frequency of DR3 (McDaniel, 1993) might include those with the Caucasian HLA-Al-B8-DR3 haplotype and simply serve as an index of racial admixture. A curious feature of rheumatoid arthritis susceptibility among African Blacks is that the prevalence in rural areas is remarkably low. Silman et al. did not encounter a single instance of unequivocal rheumatoid arthritis among a survey of over 2700 rural Nigerians (Silman et al., 1993). Conversely, among urban Black Africans, while the prevalence of this disease is not precisely determined its occurrence is not rare and it is associated with DR4 or DRlO (Pile et al., 1992a). Among South African Negroes 38% of those with rheumatoid arthritis were positive for DR4 while 15% of controls were positive. Among the Cape Colored population, composed of a stable admixture of Black, Caucasians, and Malaysian genes, the frequency of DR4 was 50% among those with rheumatoid arthritis and 21% among controls. Interestingly, the relative risk of rheumatoid arthritis in the setting of DRlO was still higher with the frequency of this uncommon allele, raised from 2% in controls to 9% among those with disease. A study in Zimbabwe of the Shona emphasizes that the frequency of DRB1*0401 and DRB1*0404/8 is rare and that, as with North American Blacks, threequarters of DR4-positive individuals with disease were DRB1*0405 (Garcia Pacheco et at., 1992). It seems that the issue of susceptibility to rheumatoid arthritis among Blacks holds special promise for analyzing the effects of genetics and possibly that ofthe environment on susceptibility. The reduced population frequency of DRB1*0401 and DRB1*0404/8 account, in part, for what might be a lowered prevalence in all situations, both in urban and rural Africa and in North America. However the unusually low prevalence of disease in rural Africa must have another explanation. Do susceptible individuals die of other causes or does the environment either lack exogenous elements that induce rheumatoid arthritis or contain such a burden of infectious disease that the development of rheumatoid arthritis is inhibited. Furthermore, it must be emphasized
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
429
that incidence studies using contemporary criteria have not been performed in all of these populations. Conversely, alleles with the shared epitope, such as, DRBl"0101, DRB1*0405, and DR10, when they are present, confer a definite risk for development of rheumatoid arthritis that is similar in order of magnitude to that seen in the Caucasoid population. Of greatest interest, there appears to be a significant fraction of the population that develops rheumatoid arthritis in the absence of an allele that encodes the shared epitope motif. These and other questions mentioned previously emphasize the importance of detailed genetic epidemiologic studies in these populations. VII. Other Class I I Associations
In addition to the association with the shared epitope motif encoded by DR alleles, certain observations raise the question of whether DQ or DP locus alleles are separately involved in influencing susceptibility. In some population groups, notably Northern European Caucasians, the DQ7 specificity (DQB1*0301) was associated with either simple susceptibility to rheumatoid arthritis or development of severe disease in the setting of DR4 (Rousseau et al., 1991), while in others it was not (Gao et al., 1991a,b). There is agreement that HLA-DQ7 is increased in patients with Felty's syndrome and/or vasculitis that are generally of Northern European ancestry with a coassociation with DRB1*0404/8 (Dw14)apparent in the vasculitis group (Hillarby et al., 1991; Clarkson et al., 1990). In contrast, in an analysis of adult Italian rheumatoid arthritis patients, Angelini et al. observed an increase in the frequency of DQS (DQAl*0301 and DQB1*0302) accompanied by a significant decrease of DQA1*0201, DQA1*0501, and DQB1*0201. As discussed below it remains to be determined whether these associations with susceptibility or severity are related per se to any specific DQ allele, such as DQB1*0301 or 0302, or are accounted for by linkage equilibrium between the DQ allele and a DR allele, such as in the B44-C4B*QO-DR4-DQ7 haplotype (Clarkson et al., 1990) where the DR4 molecule was shown to be responsible for the effect. Of relevance is the study by Taneja et al., who reported that in Asian Indians a HLA-DR4-DQw8 haplotype occurs in those with rheumatoid arthritis (Taneja et al., 199213). HLA haplotype analysis among Southern and Northern Indians revealed none of the isolated associations between particular HLA-DQ alleles and the development of rheumatoid arthritis that held true for a variety of populations that were independent of the presence of a HLA-DR4 gene on the same haplotype. These results support the minimal interpretation that SUS-
430
ROBERT WINCHESTER
ceptibility to rheumatoid arthritis is likely controlled only by genes in the DR locus independent of any DQ associations (Taneja et aZ., 1992a), but they do not exclude a minor adjunctive role for DQ or D P polymorphisms in influencing the efficiency with which a given allele encoding the shared epitope exerts its effect. The possibility that DPBl polymorphism is relevant to rheumatoid arthritis susceptibility was examined by Perdringer et aZ., who found evidence of an association with allele DPB1*0401 (Perdriger et d . , 1992). The DPBl"0401 allele was found to be significantly more frequent in rheumatoid arthritis patients than in controls (77.46% vs 55.40%; P < 0.002; relative risk, 2.74). Analyzing the HLA-DPB1 allele frequencies in 57 HLA - DR - typed rheumatoid arthritis patients did not show any linkage between the DPB1*0401 and the DR4 specificities. Curiously, the DPB1*0401 homozygous frequency was increased in DR4-negative rheumatoid arthritis patients. The authors interpret these findings to suggest an independent role of the DPBl"0401 allele in susceptibility (Perdriger et al., 1992). However, in another study of adult Italian rheumatoid arthritis patients the distribution of DPB 1 alleles did not differ significantly between rheumatoid arthritis patients and healthy controls (Angelini et d . ,1992), raising the concern that ethnic stratification in a particular subset of sampled individuals might have accounted for the apparent association with a DP allele in the prior study. The question of additional genes in the haplotype encoding a shared epitope requires additional study. Charron informatively discusses several theoretic mechanisms by which MHC genes other than those encoding the shared epitope could contribute to the definition of susceptibility (Charron, 1992). Newly discovered genes of the MHC class I1 region are proposed as potential candidates, such as those coding for proteases and transporter channels used in the peptide-loading process of class I molecules and analogous molecules involved in the charging of class I1 molecules. In addition, the role of the invariant chain, a 31-kDa protein associated with the alp complex, is emphasized in antigen presentation and may provide new insights into the pathogenesis and therapy of autoimmune rheumatoid arthritis. Because it is likely that the association of these other polymorphic genes with alleles of the DR and DQ loci has been influenced by evolutionary forces that result in the entire haplotype region containing genes in linkage disequilibrium, it remains a distinct possibility that susceptibility to rheumatoid arthritis will differ slightly according to genes outside the DR regions. Thus each allele encoding the shared epitope would not be expected to be identical in terms of conferring the same risk of developing rheumatoid arthritis.
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
43 1
VIII. Action of HLA Polymorphisms in Rheumatoid Arthritis Apart from Specifying Susceptibility and Severity
A. REMISSIONDURINGPREGNANCY Another phenomenon relating to the female and rheumatoid arthritis is the occurrence of dramatic remissions in disease activity during pregnancy (Persellin, 1977; Hench, 1938; Hazes, 1991).While the first evidence of a decrease in disease activity usually appears in the first trimester, it reaches a maximum with the most striking remission in disease activity occurring in the third trimester. A presumably related observation is that there is a significant decrease in the incidence of rheumatoid arthritis during pregnancy, that is compensated by a numerically greater incidence of disease in the 3 months postpartum (Silman et al., 1992a).The occurrence of an increased incidence in the postpartum period mirrors the development of the “flare” in disease activity that is well recognized to occur at this time. The observation of a pregnancy-induced remission (Hench, 1938) indirectly led P. A. Hench to the use ofcorticosteroids in the disease, but the antiinflammatory mechanism through which the pregnancy-induced remission occurs is still uncertain. The existence of this phenomenon stands as a, if not the, major clue to approaching a new direction in the therapy of rheumatoid arthritis, but it has attracted the interest of only a small, devoted group of investigators. Hypotheses included formation of antibodies to the foreign paternal HLA antigens, selective immunosuppression to maintain the fetal allograft, and other mechanisms (Thomson and Horne, 1980). Nelson et al. examined the niaternal-fetal disparity in MHC class TI molecules during pregnancy-induced remissions and provided strong evidence suggesting that the maternal response to paternal MHC antigens underlies the remission. In 26 of 34 pregnancies (76%) maternal-fetal disparity in alleles was found at the DRBl, DQA, and DQB loci, while in 12 pregnancies without remission only3 exhibited comparable disparity and 75% were very similar (odds ratio 9.7; P = 0.003). Differences at DQA correlated best with the appearance of remission (Nelson et al., 1 9 9 2 ~ ) . B. TOXICITY In 48 rheumatoid arthritis patients who did not respond to gold and developed gold-induced toxic reactions, including thrombocytopenia, proteinuria, or both, analysis of MHC alleles showed that DR3 was significantly increased (Singal et al., 1992). This report, using molecular biologic techniques, confirms the earlier observations using serologic methods that there was an elevated frequency of DR3 in those
432
ROBERT WINCHESTER
with these untoward reactions to chrysotherapy with a relative risk for gold-induced proteinuria of 32 and thrombocytopenia of 9 (Wooley et al., 1980). As is commonly the case with DR3 associations, the question of whether this association is driven by DR3 or by the C4 complement null alleles has been raised in this situation. Clarkson et al. (Silman et al., 1992b), defined C4 null alleles and HLA-DR alleles in 48 patients with rheumatoid arthritis who developed renal or hematological side effects to gold or penicillamine, as compared to 33 rheumatoid arthritis subjects who had received the drugs for similar time periods without developing side effects. A C4A null allele was found in 56% of those with and 31% of those without side effects ( P = 0.027; relative risk 2.8). A similar but statistically nonsignificant trend was observed with the C4B null allele ( P = 0.64) resulting in a higher risk of drug toxicity in rheumatoid patients bearing either a C4A or a C4B null allele (relative risk 5.7) (Clarkson et al., 1992). This question of whether this association is driven by DR3 or by the C4 complement null alleles awaits resolution. IX. New Paradigms for Testing Associations of HLA Polymorphisms with Disease
The classic approach in determining the association of an HLA polymorphism with a disease involved establishing a purely phenomenologic relationship between the occurrence of an MHC allele or specificity and the occurrence of a disease. The compendium of such data by Tiwari and Terasaki illustrates both this approach and what it could accomplish (Tiwari and Terasaki, 1985). In as much as all alleles or specificities were considered a priori to be equally likely to be associated with a disease, it was necessary to correct for the possible occurrence of fortuitous associations by procedures like the Bonferroni correction which reduced the calculated significance by the number of alleles or specificities that were tested. Now the situation is becoming quite different because of the knowledge of MHC structure. First, assessment of genetic differences is increasingly being done at the level of probing for specific polymorphic regions of the MHC alleles, and not simply at the level of determining whether a given allele is present or absent. Had probes for the shared epitope motif been available, the association would have easily been defined. The preliminary identification of a preliminary association with several alleles that had no common structural feature might be viewed with more skepticism than one where the association identified a set of alleles
SUSCEPTIBILITY TO RHEUMATOLD ARTHRITIS
433
that had important common features. Second, based on the delineation of specific peptide-binding pockets, it is possible to formulate specific prior hypotheses of which alleles might be found based on the structure and peptide-binding properties of allelic products. Similarly, the identification of an association now has to meet the test of molecular plausibility. As illustrated by the delineation of the shared epitope the establishment of disease or immune response associations with certain allele families, such as those encoding DR4, has been more difficult because of the patchwork nature with which these alleles have been constructed. In contrast, other alleles such as those encoding DR3 or DR2 specificities are more tractable in that alleles encoding each specificity differ only slightly from one another. For example the motif IDEA contrasts strikingly with the shared epitope motif or that encoded by DR3 haplotypes, LQKR, in that the charge of these three motifs is respectively, -2, + 1, and +2. X. Formal Genetics of Rheumatoid Arthritis
A. FORMAL GENETICS IN FAMILY AND TWINS STUDIES
To provide a context for understanding the role of the molecular genetics governing MHC alleles and susceptibility other genetic approaches may be undertaken. Family and twin studies on the occurrence of rheumatoid arthritis permit a direct estimate to be made of the contributions of heredity and environment and the characterization of some general features of the genetic predisposition. This includes specification of the number of genes involved in determining the trait of predisposition to rheumatoid arthritis, whether the genes exhibit classical Mendelian dominance or recessiveness, and the penetrance of the trait. In formal genetic studies, familial aggregation is clearly evident. The risk of finding an affected relative, given 1 member affected in a family, is estimated at 2.3 in one analysis (Lawrence, 1967) and averaged 3.9 in another (Deighton et al., 1989). Among 370 previously unaffected first-degree relatives, 14 developed rheumatoid arthritis, equivalent to an incidence of 8/1000 person-years of observation (Silman et al., 199213).This aggregation is first-degree family relatives was approximately a 16-fold increase over the incidence in the general population and emphasizes that the incidence of the disease is likely to parallel the frequency of the genetic polymorphisms that confer susceptibility. The possibility that genetic factors might distinguish the probands
434
ROBERT WINCHESTER
in families with multicase rheumatoid arthritis from those in which sporadic disease was excluded (Deighton and Walker, 1992). Among 32 probands analyzed in multicase families, and 21 1 in families with sporadic rheumatoid arthritis, no significant differences were encountered with respect to demographic and clinical details, autoantibodies, and HLA-DR status. The authors conclude that extrapolation of results from familial to sporadic rheumatoid arthritis appears is warranted (Deighton and Walker, 1992).
B. FEMALE SEX Rheumatoid arthritis is more common in women than in men with the generally accepted ratio of nearly 3 : 1. This suggests the possibility that sex hormones or other factors associated with the inheritance of two X chromosomes could enhance the expression of rheumatoid arthritis in females. Several mechanisms of how differential inactivation of portions of the X chromosome could contribute to this sexrelated predominance have been informatively discussed (Gregersen, 1993; Hurley et al., 1982). Deighton et al. (1992) studied 231 sibships of the same sex (186 female, 45 male), in which the proband had classical or definite rheumatoid arthritis. Concordance rates for classical and definite rheumatoid arthritis were three times greater in sibships of women than of men (9.3%vs 3.0%). Probable rheumatoid arthritis was more common in male sibships. These results suggest that female sex, in addition to HLA haplotypes, is important for the presence and expression of rheumatoid arthritis. However, of interest, the severity of the disease is greater in males (Lewis et al., 1980). This may be an example of the “Carter Phenomenon” where in a multigenic disease with a sex predominance, when the propositus is of the less frequently involved sex there is a much greater likelihood for the first-degree relatives to be involved. This simply means that in order to manifest the disease phenotype in a situation where it is not favored to occur, a greater number of susceptibility genes need to be present. In the instance of rheumatoid arthritis this may imply that in males the MHC contribution to genetics is greater, i.e., as discussed in section X, there are two doses of the MHC susceptibility genes. These could interact to result in more severe disease but in the absence of the X chromosome effect, the disease would be less prevalent. This question requires additional study.
C. USE OF CONCORDANCE DATATO ESTIMATE THE NUMBER OF GENESRESPONSIBLE FOR RHEUMATOID ARTHRITIS
Studies comparing the occurrence of disease in mono and dizygotic twins provide significant insight into the operation of germline genetic
435
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
factors in rheumatoid arthritis. As an extension of studies described above, a concordance rate of 20.5% in seropositive H L A identical sibships of the same sex compared with 30% in monozygotic twins suggests that sex and H L A type account for about two-thirds of the inherited risk of rheumatoid arthritis (Deighton et al., 1992). In one cross-sectional study by MacGregor et al. that used a single method of ascertainment, the rate of concordance with which rheumatoid arthritis is found in the second twin, when it is identified in the first, is 15.4% for monozygotic and 3.6% for dizygotic twins (MacGregor et al., 1993). The concordance was slightly higher, 16.9%, when twin pairs who had rheumatoid factor-positivity were studied. When these data are reported in terms of cases per 1000 years of observation these incidence rates are 12 for monozygotic twins, 2.2 for dizygotic twins, and 0.5 for the general population. These concordance rates for monozygotic twins are lower than the original estimate of Lawrence (1970), but in the range of those obtained by Aho (Markku et aZ., 1986) and Silman et al. (1992c), being, respectively, 12 and 15%. As discussed below, when more comprehensive methods of ascertainment are used, the absolute values for twin concordance will be both higher and a complex function of the H L A type of the person, while the ratios of monozygotic twin concordance are very likely to remain in the same range of about four or slightly more than four times greater than the rate in dizygotic twins. Several conclusions can be drawn from these twin data (Table V) (Shen and Winchester, 1986;Winchester, 1981).One is that the genetic basis of susceptibility to rheumatoid arthritis involves the inheritance of from two to three polymorphic genes. This was first estimated in TABLE V
TWINSTUDIES ~~
Inheritance Aut. dominant Aut. recessive Multigen. Multigen. Multifact. Aut. dominant Aut. recessive Multigen.
RA Multigen.
No. of genes
~~
Monozygotic
50% 25% 12% 4 6% ? 40-607’0 44% T w i n studies in RA: N u m b e r of genes 1 35% 17% 2 35% 9% 3 35% 4% 3-4 35% 24% 4 35% 290 1
2 3
100% 100% 100% 100%
Dizygotic
MZIDZ
2 4 8 16 5-15
2
4
8 8-16 16
436
ROBERT WINCHESTER
rheumatoid arthritis using the following approach (Shen and Winchester, 1986; Winchester, 1981). Since dizygotic twins on average share half of their genetic material compared to identical twins if a single segregating gene caused rheumatoid arthritis the rate in monozygotic twins would be twice that found in dizygotic twins. If two genes were required for rheumatoid arthritis then one of every four dizygotic twinships would be expected to share these two genes and the observed rate in monozygotic twins would be four times that found in dizygotic twins. Taking the ratio of concordance rates for monozygotic and dizygotic twins to be in the range of four to six, the number of polymorphic genes that determine susceptibility to rheumatoid arthritis is between two and three. The random segregation ofthese multiple genes accounts, in part, for the seemingly sporadic occurrence of rheumatoid arthritis in a family, Thus, the inheritance of the tendency to develop rheumatoid arthritis is not a simple Mendelian dominant or recessive pattern but one that appears to be dependent on the simultaneous presence of, at the very least, two and probably three to four genes. This type of analysis does not indicate which are the likely genes, but since the MHC is autosomally encoded it could in principle account for either one or two of these hypothetical separately segregating susceptibility genes. This issue is addressed in the next section.
D. REFINEMENTS IN ESTIMATION OF
THE NUMBER OF INHERITED AND THE CONTRIBUTION GENESSPECIFYING SUSCEPTIBILITY MADEBY THE MHC
A detailed examination of the contribution that inherited factors make to the development of rheumatoid arthritis was made by Deighton et al. (1992). In 186 female-female and 45 male-male sibships in which the proband had classical or definite rheumatoid arthritis, each sibling was classified as having classical, definite, probable, or no rheumatoid arthritis and as sharing two, one, or no HLA haplotypes with the proband. Concordance rates in HLA identical sibships were twice those in hemi- and nonidentical sibships, 15.5, 7.1, and 5.2%, respectively. Concordance rates were three times greater in sibships of women than of men, 9.3%vs 3.0%.These results suggest that female sex and the two inherited HLA haplotypes are important for the presence and expression of the rheumatoid arthritis trait. The observed concordance rate was 20.5%in seropositive HLA identical sibships of the same sex. Using a value of 30% concordance in monozygotic twins suggests that sex and HLA type account for about twothirds of the inherited risk of rheumatoid arthritis (Deighton et al., 1992).This estimate has three possible sources of uncertainty. Environ-
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
437
mental factors may be shared more in twins than in siblings making this an upper-level estimate. Since ascertainment of the identical twins and the sibships differed, the estimate of concordance in the twins is not strictly comparable and is also influenced by the HLA status of the twinship. A concordance rate of 15.4% has been advanced as a more likely rate (MacGregor et aZ., 1993). Last, because this study did not characterize different haplotypes for their equivalency in expressing the shared epitope, the possibility exists that some of the haplotype hemi- or nonidentical sibships actually had functionally equivalent genotypes. Taken together this would imply that the estimate that sex and HLA type account for about two-thirds of the inherited risk of rheumatoid arthritis is a lower limit estimate and the actual value could be rather higher, perhaps accounting for all of the susceptibility. Consistent with these results, in an investigation by Silman et al. (199213) of 370 previously unaffected first-degree relatives from multicase rheumatoid arthritis families, 14 individuals developed rheumatoid arthritis, equivalent to an incidence of 8/1000 person-years of observation. This was substantially greater than the population-based estimate of 0.5/1000 per year. Possession of HLA-DR1 or DR4 explained some of the increased risk, but the data suggested that other shared genetic or environmental influences are also relevant. No important effects of age or sex were observed (Silman et al., 1992b). In another study it was concluded that HLA accounted for nearly half of the genetic predisposition to rheumatoid arthritis, with the possible existence of at least one other non-HLA locus predisposing to rheumatoid arthritis with a weight slightly greater than that of HLA (Rigby et aE., 1991). Other analyses strongly implicated sharing of haplotypes encoding HLA-DR4 as the primary determinant of susceptibility in multicase rheumatoid arthritis families (Silman et al., 1991). Affected sib pairs shared parental HLA haplotypes more often than expected according to Mendelian segregation indicating nonrandom segregation of parental haplotypes. HLA-DR4 was observed in 70% of the probands while among DR4-negative probands, DRlO occurred more frequently (Taneja et aZ., 1993). Taken together these and other data identify the MHC as accounting for either one or two of the formally identified two or three genes involved in specifying rheumatoid arthritis susceptibility. Two major questions remain: What is the identity of the additional gene or genes, if indeed it exists, and how do the genes encoded on the MHC haplotypes interact? From the observation of Nepom et al., discussed in greater detail below, that one in seven Dw4 and Dw14 individuals in the general population are likely to develop rheumatoid
438
ROBERT WINCHESTER
arthritis and from the fact that in monozygotic twins with this genotype the rate of penetrance approaches 80% or more it may b e concluded that approximately one in five persons has the additional polymorphic gene allele that completes the definition of the rheumatoid arthritis susceptibility state. As discussed in section IX,A, female sex enters importantly into this definition. To date there is no definite association documented between susceptibility and any delineated allele of any non-MHC locus on the X or autosomal chromosomes. Alleles of the T cell receptor and the Ig molecules are an obvious place to look for such polymorphisms in view of their role in immune recognition events. A study of T cell receptor Vp-chain gene polymorphism was negative (Wallin et al., 1991), but another study reported the association of a Vp8 and a Cp polymorphism with susceptibility (Funkhouser et al., 1992).No association was found with Gm Ig constant region markers in an extensive analysis ofthis issue (Dizier et al., 1991),while another study identified a slight influence of Gm or other markers on the 11th chromosome, (Sidebottom et al., 1991). The possibility that the non-MHC genetic component in rheumatoid arthritis is the same or related to the nonMHC locus on chromosome 11 implicated in susceptibility to HLADR4-dependent Type I diabetes mellitus was studied. In diabetes mellitus there is an allele that acts in concert with HLA-DR4 to enhance susceptibility (relative risk 5-6). Genotype frequencies at this locus, defined by a dimorphic Fok 1 restriction site, were compared in 139healthy controls and 213 patients with classical/definite rheumatoid arthritis. In contrast with diabetes there was no increase in genotypes lacking the Fok 1site in the rheumatoid arthritis group regardless of DR4 status (Pile et al., 1992b). There is no association of the alantitrypsin PIZ allele with rheumatoid arthritis or with its extraarticular complications (Steers et al., 1992) despite the fact that the disease is more severe in those with this deficiency. The identification of transcripts from the region where the putative second gene is located is a goal of high priority, although, as discussed previously, there is not strong evidence that implicates a non-MHC autosomal gene. XI. One or Two M H C Haplotypes and Their Interactions in Determining Susceptibility and the Character of the Resulting Disease
A. EXCESS OCCURRENCE OF PERSONS HAVING TWOHAPLOTYPES A SHARED EPITOPE ENCODING Up to this point, the shared epitope has been discussed largely as if it appeared to be a single, dominant, although poorly penetrant,
439
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
structure specifying rheumatoid arthritis susceptibility. Indeed this is, in one sense, correct because in the population at large the inheritance of any of the appropriate alleles of HLA-DR1, DR4, DR6, or DR10, or their surrogate the shared epitope motif, appears to act as an independent dominant determinant of susceptibility. Because only a single allele is necessary for rheumatoid arthritis, the term dominant is appropriate. But there is a strong and increasing body of evidence that the mechanisms of inherited susceptibility is not at all that simple. A large number of studies demonstrate that there is a clear statistically significant excess of individuals having two hap1otype.s containing alleles associated with susceptibility. For example, among a group of rheumatoid arthritis patients, DR4 was found at the expected frequency of 77%, of which “homozygosity” for DR4 was found in 54%, a frequency more than twice that expected if the shared epitope functioned as a simple dominant determinant with uniform penetrance (Nepom, 1991).It should be cautioned that the term “compound heterozygosity” is the more appropriate description to use in this situation where in strict genetic terms “homozygosity” for the shared epitope does not imply true homozygosity at the level of allele structure because two of the series of serologic or functionally relatively equivalent alleles defining the shared epitope motif occur, respectively, in the maternal and paternal MHC haplotypes. Additional evidence that the risk of developing rheumatoid arthritis is greater when two alleles encoding the shared epitope are inherited together has been obtained by Nepom and Nepom (1992) (Table VI). Similarly, Weyand et al. genotyped 102 patients with seropositive TABLE VI RISK RATIOSFOR HLA GENESASSOCIATED WITH RHEUMATOIDARTHRITIS Estitnates per 10.000 Population HLA class I1 gene
Rheumatoid arthritis
Normals
Dw4 (DRB1*0401) Dw 14 (DRB 1 *0404) Dwl(DRB1*0101) Dw4 or Dw14 Dw4, Dw14, or D w l Dw4 and Dw14 Other
50 25 25 65 90 15 10
1800 500 2000 2300 4200 100 5800
Approximate risk ratio 1 in 1 in 1 in 1 in 1 in 1 in 1 in
35 20 80 35 46
7
580
Note. Estimate of risk of developing clinical rheumatoid arthritis anrong Caucasoids, based on an approximate disease prevalence of 1%. These numbers represent the upper limit of the predictive value. Reprinted with permission from Nepom and Nepom (1992).
440
ROBERT WINCHESTER
erosive rheumatoid arthritis of at least 3 years duration (Weyand et al., 1992), of whom 96% expressed the shared epitope. Of these, 46% carried a double dose of alleles encoding the shared epitope, with 28 expressing HLA-DRB1*04 variants on both alleles and 19 with a HLADRB*04 allele and HLA-DRBl*OlOl or DRB1*1402. Salmon (1992), also emphasizes that the simple model of dominant susceptibility is unsatisfactory as an explanation for the observed ratios of those with one or two Susceptibility motifs. Rigby (1992) examined the distribution of the number of parental HLA haplotypes shared by 143 sib pairs, 36 sib trios, and 4 sib quads. The affected rheumatoid arthritis sibs shared two, one, and zero parental HLA haplotypes in a ratio of 40 : 45 : 15 which was significantly different from random expectation of the ratio of 1 : 2 : 1 (25 : 50 : 25). Risk estimates for the development of rheumatoid arthritis in sibs of probands sharing two, one, and zero parental HLA haplotypes are 6.2, 3.5, and 2.3%,respectively (Rigby, 1992).Deighton et aE. (1992), found concordance rates in HLA identical sibships, i.e., those sharing two haplotypes, to be 15.5%, twice the percentage found in hemi- and nonidentical sibships, 7.1, and 5.2%, respectively. Conversely, probable rheumatoid arthritis was more common in HLA hemi- and nonidentical sibships. Wordsworth et al. (1992) encountered an excess of DR4 homozygotes, particularly Dw4/Dw14 compound heterozygotes found at an odds ratio of 49, while a single copy of the shared epitope in the form of Dw4/DRX gave the lowest odds ratio of 6. These data are clearly not consistent with a simple dominant mode of inheritance. Rigby has carefully examined the question of the mode of inheritance implied by these data and conclude that a simple additive dominant mode of inheritance with constant penetrance is not consistent with the observed features of the inheritance of rheumatoid arthritis (Rigby, 1992). This author along with others find that in multiplex families, the contribution of HLA is actually closer to a recessive model than that of an additive dominant model (Rigby et al., 1991). B. MODE OF INHERITANCE: ALLELICPRODUCTS INTERACT TO INFLUENCE PENETRANCE Taken together, these results, along with those to be disussed later, suggest that two inherited HLA haplotypes encoding the shared epitope confer a much greater risk for developing rheumatoid arthritis than does the inheritance of one such haplotype containing only one copy of the susceptibility motif. This finding is compatible with the formal genetic data on this disease in which case as many as two of the inferred susceptibility “genes” could be both of an individual’s two MHC haplotypes.
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
44 1
The resulting state has somewhat unusual genetic characteristics. From population studies there is very good evidence to support the conclusion that the inheritance of a single susceptibility allele encoding the shared epitope is sufficient, given partial penetrance, to result in rheumatoid arthritis. This is a mode of genetic behavior that we designate as dominant. However, the far stronger association of susceptibility with two copies of the shared epitope is not a simple recessive mode of inheritance because a single copy of the gene would not be expected to confer the disease phenotype, as indeed it does. Looked at in one way, the presence of a first shared epitope enhances the penetrance, or efficiency, of the second in inducing rheumatoid arthritis and at a mechanistic level it is likely that each susceptibility gene product enhances the effectiveness of the other in determining the disease phenotype. This issue of nomenclature is resolvable by considering dominance or recessiveness in this instance not so much as a property of the gene, or a general consequence of its interaction in the organism with the products of other genes, but rather as the result of the interaction with the consequences of the presence of the first gene. This peculiar pattern is what one would suspect if these genes are acting on the T cell receptor repertoire. Other information, to be discussed below, is also relevant to this interpretation.
c. THE INFLUENCE OF THE NUMBERAND NATUREOF MHC ALLELESON RISK FOR MORE SEVERE DISEASE
In addition to influencing susceptibility, there is increasing evidence that the inheritance of two alleles encoding the shared epitope results in the development of more severe disease. The pioneering biochemical studies of Nepom et al., (1989) first directed attention to this issue. Among children with early onset and clinically severe rheumatoid arthritis, they observed an excess number of compound heterozygotes where DR4 was encoded b y Dw14 (*0404 or *0408) and Dw4 (*0401) alleles. In a subsequent detailed study by the Nepoms, evidence was obtained that the particular allele encoding the shared epitopes may be very important in determining the risk of developing rheumatoid arthritis when two alleles encoding the shared epitope are inherited together (Table VI) (Nepom and Nepom, 1992). Nearly all those with severe disease are seen as being compound heterozygotes for DR4 genes. Individuals with rheumatoid arthritis fall into three main categories: “Other,” in which the individual lacks any of the alleles encoding the shared epitope. Here the risk of developing rheumatoid arthritis is 1 in 580. A second category consists of those with intermediate risk. The inheritance of D R l was associated with a risk of disease of 1 in 80. When Dw14 (*0404 or *0408) or Dw4
442
ROBERT WINCHESTER
(*0401) alleles were present the risk increased to 1 in 35, and the presence of these alleles accounted for 65% of those with rheumatoid arthritis. The third group consisted of those who inherited both Dw14 (*0404 or *0408) and Dw4 (*0401) alleles where the person had a striking increase in the risk of developing rheumatoid arthritis of 1 in 7 (Nepom and Nepom, 1992). In English patients with rheumatoid arthritis there is a similar observation (Lanchbury, 1992),in which the DR4 Dw14 allele is almost exclusively found in combination with Dw4. This observation has been expanded by several groups (Nelson et al., 1991a; Ronningen et al., 1990). The report of Wordsworth et al. (1992), described above, also addresses the influence of the nature of the two inherited MHC alleles on the risk for more severe disease. While the Dw4/Dw14 compound heterozygotes are found at an odds ratio of 49, the risk associated with Dw4, itself, depended on the other allele present. In the instance of Dw4/DR1 the second highest risk of 21 was found, while Dw4/Dw4 had a lower risk of 15, and Dw4/DRX, as mentioned, had the lowest odds ratio of 6. There was a significant risk from Dw4/Dw14 compared with Dw4IDw4 for severe rheumatoid arthritis or Felty’s syndrome of2.9 and 4.2, respectively. In contrast, among the DR4 “homozygotes” with milder disease, there was no significant excess of Dw4/Dw14 individuals. The rare Dw41Dw15 genotype was also significantly overrepresented, again arguing that all alleles encoding the shared epitope are not absolutely equal in their ability to interact with others in specifying disease liability. The authors adopt the view that synergistic mechanisms between the trans-encoded DR4 molecules are involved that likely affect the T cell repertoire (Wordsworth et al., 1992). Also emphasizing that in some populations different predominant patterns of compound heterozygosity are found, among 168 North Indian patients with rheumatoid arthritis, Taneja et d.(199213) reported that the combination of DR4 and DR1 provided the highest relative risk of 71.9, while DR4, DR4 yielded only a risk of 4.1. In a different population the frequency of compound heterozygote children with rheumatoid arthritis having the two DR4 alleles of Dw4/Dw14 were increased to 32%from an expected frequency of about 1% in a control population (Nepom, 1991). Salmon (1992), points out that in some series, patients with early disease show little or no association with any HLA alleles, whereas patients with severe forms of rheumatoid arthritis are frequently homozygous for DR4, showing a disproportionate tendency toward compound heterozygosity (Salmon, 1992). In effect this argues that the shared epitope is only a marker for severity and chronicity of the
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
443
disease process and not a marker of susceptibility. Unfortunately this important issue cannot be properly addressed until the diagnosis of rheumatoid arthritis becomes more than an application of syndromic criteria. Indeed in pragmatic terms what really matters is the identification of individuals at risk for virulently destructive arthritis, so that at the present time the outcome of this difference in viewpoint is moot. Weyand et al. (1992) reported that among patients typed as HLADRB1*04/04, rheumatoid nodules were found in all, and 61% had major organ system involvement or joint surgery. Individuals typed as HLA-DR*04/01 had clinical courses intermediate between those with HLA-DRB1*04/04 and those that only had a single copy of a gene encoding the shared epitope who had the mildest courses. However, in this population the occurrence of Dw4IDw14 heterozygosity was much less prominent than that in the Nepom study (Nepom and Nepom, 1992), and all forms of DR4 encoding the shared epitope were approximately equivalent. Goronzy and Weyand (1993) proposed that the shared epitope functions in determining the clinical patterns of rheumatoid arthritis and the severity of the disease in a codominant mode. Patients with a double dose of the shared sequence tend to have more serious disease manifestations, suggesting a model in which the genetic element is involved in perpetuating the disease. They concluded that a pathogenetic model in which the shared epitope selectively binds and presents an arthritogenic peptide appeared too simplistic (Goronzy and Weyand, 1993). These reports, together, provide clear evidence that two copies of an allele encoding the shared epitope are more likely to be found in a person with severe disease and that all haplotypes are not equivalent in their consequences. However, the details of the investigations differ significantly in the details of how particular alleles behave. Thus in some Caucasian populations DR1 has been associated as a second allele that is found in those with more severe disease, while in other populations the association is with less severe disease. Similarly, the DRB1*0404 or 0408 allele has, in some populations, been found in those with more severe disease, while in others it has not. Perhaps the fact that the 0404 and 0408 alleles and the 0101 and 0102 alleles share identical amino acid residues in the shared epitope region and also have comparable variations at positions 85 and 86 is an explanation. In view of the evolutionary origin of the haplotypes bearing these alleles, which involves the coevolution of other polymorphic genes encoding MHC molecules and accessory molecules such as those involved in peptide processing and charging, one might consider that the
444
ROBERT WINCHESTER
haplotype and indeed allele background in which the shared epitope is encoded have no influence on susceptibility as discussed in section VI. Whether these differences in these reports are attributable to ethnic variations in the study populations, or confounding variables such as are present in the design of the study, remains to be established. D. EVIDENCE FOR DIFFERENCES IN THE PROPERTIES OF SUSCEPTIBILITY ALLELES In addition to the question of whether all haplotypes encoding the shared epitope are equivalent in terms of enhancing susceptibility and severity when two are inherited, an issue that is not yet fully resolved is whether each of the susceptibility alleles encoding the shared epitope is equivalent in terms of its ability to induce susceptibility to rheumatoid arthritis when present as a single allele. An important direction of inquiry was initiated by the observation that in one crosssectional series of patients those with more severe disease were more likely to be DR4, while those with milder disease were more likely to be DR1 (Stastny et al., 1989). In a 6-year-long prospective study of the course of rheumatoid arthritis in HLA-typed individuals, the frequency of DR4 was 59.2% in those who had progressive disease and 34.8% in those with mild disease (van Zeben et al., 1991). DR4positivity was associated with nearly all measures of severity including joint scores, functional assessment, radiologic classification, and use of second line drugs. Similar results were found in Japanese patients (Doita et al., 1990). In another study HLA-DR1 was only found to be increased in those with mild rheumatoid arthritis, while DR4 in association with DQ7 was increased in those developing severe disease. DR4 was increased in both populations (McCusker et al., 1991; Singal et aE., 1992). The importance of DR4 and DR1 in conferring susceptibility to rheumatoid arthritis was also studied by Singal et al. (1992); DR4 was significantly increased in all patients with mild or severe disease. The prevalence of DR1 and of DR1 in DR4-negative patients was increased only in patients with mild rheumatoid arthritis, but not in patients with severe disease. The authors conclude that the genes causing susceptibility to mild rheumatoid arthritis are different from those causing susceptibility to severe rheumatoid arthritis (Singal et al., 1992).The possibility that regulatory polymorphisms of the class I1 genes enhance the expression of a molecule expressing the shared epitope has been advanced as another potential mechanism that might increase susceptibility (Charron, 1992). In view of the dose effect shown by genes encoding the shared epitope, this speculation is plausible as an additional way in which this effect may come about.
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
445
The question has been raised by several studies of whether the DRB 1*0404 allele is independently associated with susceptibility. A study (Nepom and Nepom, 1992) of those with mild seronegative rheumatoid disease still meeting the criteria of rheumatoid arthritis revealed DR1 to be the predominant allele (Nepom and Nepom, 1992). There are differing interpretations about the meaning of the observations and their generalizability to all populations because slightly different results have been found in other study populations with Dw14 reported to be a synergistic risk factor with Dw4, but not an independent risk factor for the development of rheumatoid arthritis (Nelson et al., 1991a), while others have obtained clear evidence that Dw14 alleles are a Dw4-independent risk factor for rheumatoid arthritis, for example, among Norwegians, (Ronningen et al., 1992). The Nepoms observed that pediatric age onset of rheumatoid arthritis occurred in a setting of Dw4 or Dw14, but rarely with the inheritance of DR1 (Nepom and Nepom, 1992). Similarly, in those with adult-onset erosive, seropositive disease, DR1 accounted for a larger, but still minor fraction compared to Dw4 and Dw14 alleles (Nepom and Nepom, 1992).Among patients with a single copy of a gene encoding the shared epitope, rheumatoid nodules were found in 59%, 11% had major organ system involvement, and 25% had joint surgery (Weyand et al., 1992). However intriguing the interaction of DRB 1*0404 with other alleles encoding the shared epitope is, there is evidence that the allele also confers an independent dominant risk for rheumatoid arthritis. In addition to that described above in certain populations such as among the Guambiano Amerindian tribe of Colombia, the frequency of persons with rheumatoid arthritis is greatly enriched for the DRBl"0404 allele without coassociation with the DRB1*0401 allele (Yunis et al., 1993). Taken together all of these studies argue very strongly that genotyping patients identifies clinical subsets with different profiles of disease outcome. Moreover they emphasize that studies of outcome and clinical trials of therapeutic agents must address the issue of the patient genetics as a relevant variable. Conversely, does severe disease develop in a population that lacks these severity markers? From the above data it might be implied that rheumatoid arthritis should be mild and of a lower frequency among ethnic groups where the alleles encoding DR4 primarily consist of HLA-DRB*0402 or HLA-DRB 1 *0403, with negligible levels of 0401 and 0404 alleles. This however, does not appear to be the case. For example, there is as yet no evidence that rheumatoid arthritis is a fimdamentally milder disease among Jewish people, who as a group have this pattern of DR4 allelic frequencies, than among other Cauca-
446
ROBERT WINCHESTER
sians who are characterized by a predominance of HLA-DRB*0401 and HLA-DRB1*0404. The still unknown explanation of this fact may well contribute to some of the divergent observations in the current literature. It would be expected that in a racially admixed population such as in North America that each ethnic component would continue to exhibit their separate patterns of susceptibility, particularly when there is a tendency for some of the ethnic components to marry among themselves. Accordingly, a fundamental question to address at a broad level of population studies is the nature of the genetic substrate for severe rheumatoid arthritis in ethnic groups that have a low frequency of the alleles that, when they occur in combination in Northern European or American populations, are associated with severe disease. Studies in Black individuals may be a particularly informative approach to this question. XII. Partial Penetrance and the Somatic Nonidentity of Monozygotic Twins
That the concordance for rheumatoid arthritis in monozygotic twins-who are identical at the level of the germ line-is only some 15-30%, as discussed in section IX,B, emphasizes that the genetic endowment provided by the susceptibility alleles creates only a liability to develop the disease. What are the possible mechanisms underlying the partial penetrance which accounts for this low degree of concordance in view of the data reviewed in the previous section? A common explanation offered for converting a genetic liability into a disease with immunologic features is often infection with a specific etiologic agent, as in the case of Reiter’s disease, or the action of some other exogenous effect. The fact that identical twins with several varieties of autoimmune disease have a relatively low concordance in the absence of any epidemiologic evidence suggesting exogenous infection or other mechanisms is an important clue to an explanation of penetrance entirely through endogenous mechanisms. The possibility that identical twins are dissimilar when considered in terms of their expression o f T cell receptor repertoires was advanced as an explanation of their lack of concordance (Shen and Winchester, 1986). This hypothesis was based on the many stochastic somatic events that occur in the development of the immune system. These involve creation of T cell receptor chains by combinatorial selection of gene segments, somatic addition of N region nucleotides, and subsequent selection of the clones bearing these receptors to form the repertoires by a complex series of cell interactions. These random processes likely explain how twins who are identical at the germline need not
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
447
be identical in terms of the particular repertoire of T and B cell clones nor in the consequent immune function at the somatic level that results in diseases like rheumatoid arthritis (Shen and Winchester, 1986). Two factors influence the measurements of concordance (Table VII) and by implication the quantitation of penetrance. One is that twins develop rheumatoid arthritis at different times. Silman et al. have shown that the concordance rate increases with time from the day when the first twin develops rheumatoid arthritis when it is essentially zero, to a rate of approximately 40% when 30 years of follow up are available, and the rate of 15% is obtained in similarly followed dizygotic twins. The second factor is that concordance varies according to the MHC class I1 genotype inherited by the twins, specifically on the number of alleles encoding the shared epitope (MacGregor et al., 1993a; Ollier et al., 1993; Ollier and Thomson, 1992; Deighton et al., 1992). Ninety one pairs of twins where at least one had rheumatoid arthritis were studied. Monozygosity was confirmed by DNA fingerprinting. In 33 DR4-negative monozygotic twin pairs the concordance rate was 6%,while in 58 pairs who were DR4-positive, the concordance was elevated nearly fourfold to 21%, relative risk 3.4. When analyzed at the level of genotype the results were of special interest. A clear dose effect was evident when twins were stratified according to whether they had zero, one, or two haplotypes encoding the shared epitope. The concordance being, respectively, 5,13, and 28% (Ollier et al., 1993), with a relative risk of 5.3. Indeed only 1 of the 13concordant twinships in the study lacked an allele encoding the shared epitope. The gene dosage effect for DR4 alone was not significant. While the TABLE VII INHERITANCE OF TWO ALLELESTHAT ENCODE THE SHARED EPITOPEIS ASSOCIATED WITH HEIGHTENED SEVERITY, CONCORDANCE, EARLY ONSET,AND PENETRANCE OF RHEUMATOID ARTHRITIS
1. Association of compound heterozygosity for Dw14 and Dw4 with early onset disease (Nepom et al., 1989). These and other data suggest a recessive mode of inheritance, at least in some circumstances (Rigby et al., 1991). They can be thought of as acting to influence penetrance. 2. Concordance rates increase according to whether the twinship is characterized by the presence of zero, one, or two haplotypes that encode shared susceptibility epitopes (Deighton et al., 1992; Ollier et al., 1993). 3. More severe disease is associated with situations where homozygosity for the shared epitope, especially when both haplotypes encoded any DR4 specificity, but without specific emphasis on Dw14/Dw4 (Weyand, 1992; Lanchbury, 1992; Wordsworth et al., 1992; Nepom, 1991; Nepom and Nepom, 1992).
448
ROBERT WINCHESTER
number of twins in the study was not large enough to stratify them for combinations of each type of allele, there were important trends. Among the 6 twins that are DRB1*0401/0404 (Dw4/Dw14) the concordance rate was 50%. Although numbers of cases in these studies are small, relevant to the discussion about the role of DR1, the greatest rate of concordance, 2 of 3, or 67%, was found in twinships with DRB1*0401/0101 (Dw4/Dwl). The third major genotype in which a high penetrance of the trait for rheumatoid arthritis was found was DRB1*0401/1001 (Dw4/DR10).The stochastic time function after disease onset in the first twin when rheumatoid arthritis appeared in the second twin was also influenced by genotype, with the greatest divergence between DR4-negative monozygotic twin pairs and those inheriting one or two DR4 alleles appearing only after 20 years. Clearly the MHC class I1 alleles that an individual inherits are strongly related to concordance of disease development, with evidence of an interesting time and dosage effect. Thus the genetic composition of a population will strongly influence observed average concordance rates in twinships and by extension likely influence penetrance rates in the population at large. ARE IDENTICAL TWINS? A. How IDENTICAL
The possibility that stochastic processes operate in the formation and functioning of the immune system because of selective mechanisms based on the inheritance of particular MHC molecules has been pointed out as an explanation for monozygotic twin discordance in SLE (Shen and Winchester, 1986). In rheumatoid arthritis chance might also operate at the level of which X chromosomes are inactivated in a female, resulting in the potential for differing degrees of mosaicism for expressed genes if the person is an X chromosome heterozygote, as discussed by Gregersen (1993). Chance enters in other ways. The particular repertoires of an individual might be further biased by exposure to microorganisms or environmental insults. While T cell receptor usage in rheumatoid arthritis is outside the scope of this review, a simple search of T cell receptor repertoires in monozygotic twins who were either concordant or discordant for rheumatoid arthritis revealed significant divergences in both groups that resembled the differences found in normal twin pairs. The possibility that discordance for rheumatoid arthritis in monozygotic twins was associated with differences in the representation of Vp gene families in the T cell repertoire between the twin with rheumatoid arthritis and the healthy twin was investigated by Carson et al., with the conclusion that, within the severe limitations of resolution of current method-
449
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
ology, no differences were found (Kohsaka et al., 1993). The expressed T cell receptor (TCR) Vy repertoires both in rheumatoid arthritis patients and in normal subjects were extremely diverse. Furthermore, monozygotic twins who were concordant for rheumatoid arthritis expressed very different frequencies of TCR Vy genes (Kohsaka et al., 1993). XIII. Mechanisms
A. IMMUNE RECOGNITION EVENTAND FUNCTION OF THE
MHC MOLECULES
Based on the immunopathogenic features of rheumatoid arthritis (reviewed in Winchester, 1993), which strongly implicate CD4 lineage T cells as central to the pathologic immune response and the role of the MHC class I1 molecule in determining susceptibility, a specific immune recognition event between these elements is postulated to underlie the development of rheumatoid arthritis as illustrated in Fig. 15. A hypothetical peptide antigen fragment “X” bound by the MHC molecule and recognized by the T cell receptor is the third element of this trimolecular complex. The aim of this section is to consider several potentiaI mechanisms relevant to the nature of this immune recognition event. Concerning the MHC element involved in determining susceptibility, the susceptibility genes are not typical “disease genes” that are
T-cell Antigin
t CD4 T-cell- Memory
-
1
Fibroblast activation and
ingress and
activation Stimulation
-
PMN response
plasma cells ‘complexes
FIG.15. Interrelationships of immune recognition and effector systems in rheumatoid arthritis. A hypothetical scheme for the molecular mechanism ofrheumatoid arthritis as initiated by an immune recognition event involving the interaction between a peptide contained in an MHC molecule bearing the shared epitope and a T cell receptor on a CD4 lineage T cell.
450
ROBERT WINCHESTER
intrinsically detrimental, but to the contrary appear to have been positively selected in many different ethnic and geographic areas. In the normal population, the frequency of alleles that encode the shared epitope approach or exceed 50% in most populations, emphasizing the evolutionary selective advantage to the human race of having these alleles. Conversely, only 2%or fewer ofthe individuals with the shared epitope develop disease. For this reason the disease trait appears partially and in fact poorly penetrant, especially in the heterozygous state. The alleles encoding the shared epitope are moreover roughly equivalent in terms of their ability to predispose to disease, emphasizing that their behavior is indeed very different from genes that have an intrinsically abnormal product. Indeed disease therapy directed toward impairing the function of the MHC molecules involved in susceptibility, e.g., by peptide blockade, does not seem to be a particularly attractive direction to pursue, especially when severe disease is often found in a compound heterozygote.
B. FACTORS INFLUENCINGT CELLREPERTOIREFORMATION As emphasized in Shen and Winchester (1986), in the absence of epidemiologic insights that incriminate a specific infectious agent it is a reasonable hypothesis to attribute discordance in the presence of disease among those with the appropriate genetic susceptibility to partial penetrance based on the operation of stochastic processes involved in the formation and evolution of immune repertoires. Because the central characteristic of the T cell component of the immune system, the ability to distinguish "self" from nonself, is not encoded in the germline but rather is acquired and continuously maintained by somatic mechanisms (section II,B),the potential exists for these mechanisms to break down resulting in autoimmune disease. Two features of rheumatoid arthritis particularly direct attention to the role played by the T cell repertoire in this process. One is the apparent gene dosage effect in which susceptibility, penetrance, concordance, and severity all increase in parallel with increasing dose of the shared epitope. The second is that the passage of time acts in the same manner to increase each of these phenomena. This suggests that genetics and time are in some sort of equivalence, an observation that could be explained by postulating that stochastic events bias the repertoire in susceptible individuals in such a way as to increase the likelihood of developing rheumatoid arthritis. The development of autoimmunity seems to be an example of chaos theory in which a cumulative series of small random events occurring in time ultimately result in a major qualitative change in the function and self-
SUSCEPTIBILITY T O RHEUMATOID ARTHRITIS
45 1
discrimination of the immune system that we recognize as autoimmune disease. In theory there are several levels of repertoire bias in those with rheumatoid arthritis: one in common with other MHC selection events results from the presence of the shared epitope. This bias is common to all persons with the shared epitope and is the expected physiologic consequence of its presence. For example, Reed et al. have provided evidence that the frequency of CD4 but not CD8 T cells bearing receptors containing VpS- or Vpl2a-chains increases among individuals who are HLA-DR4 (Reed et al., 1993). At the other extreme in terms of levels of repertoire bias would be a qualitative alteration that is disease-specific. Unanswered questions are: does this variety of bias exist; how can it be found, if it does; and how does this result in disease ? Two fundamentally different qualitative abnormalities in the T cell repertoire are possible (Table VIII). In one the positive selection process has resulted in the emergence of a specific clone which recognizes peptide “X” in the context of a MHC molecule bearing the shared epitope. Another reasonable but less likely interpretation is based on overzealous negative selection. If deletion were based on the presence of a shared epitope this deletion could create a “hole in the T cell repertoire” that may result in a T lymphocyte population that is specifically deficient with regard to its ability to effectively eradicate certain pathogens (Klein, 1986).This “hole” would also explain the dominant inheritance of the susceptibility associated with rheumatoid arthritis. The gene dosage effect of two shared epitopes could be explained by a reenforcing effect of the two allelic products. In this way, for example, a persistent subclinical viral infection may induce aberrations in immune regulation that eventually result in autoimmune disease. In the special case of rheumatoid arthritis, a functionally evasive pathogen with synovial tropism may initiate a destructive,
TABLE VIII How DOESMHC STRUCTURE IN RHEUMATOID ARTHRITIS INFLUENCEFUNCTION
1. Action of shared epitope in repertoire formation a. Positive selection to bias repertoire i . Binding of self-MHC peptide in groove i i . Binding of non-MHC peptide in groove h. Negative selection-production of a “hole” in the repertoire c. Possible role of superantigen 2. Factors involved in disruption of tolerance . . . mimicry and repertoire bias
452
ROBERT WINCHESTER
albeit ineffective, inflammatory response. Fassbender has concluded that changes in synovial cells resembling psuedotransformation antedate the appearance of any cells of the immune system (Fassbender and Simmling-Annefeld, 1983), and could be a primary alteration. However, there is no evidence that such a mechanism exists. A third possibility is that there is no qualitatively distinctive diseasespecific clonal event in the T cell repertoire of those with rheumatoid arthritis, but that quantitative events in repertoire formation are involved, common to all those who possess the shared epitope, but perhaps slightly shifted in distribution in those who develop the disease. The stochastic character of susceptibility and gene dosage effect is compatible with this process. The implications of each of these three conjectures are different for the T cell repertoire and should be able to be approached experimentally. Events in the B cell repertoire may also be of importance in the establishment of a set of immune recognition structures that result in the development of rheumatoid arthritis. In this respect a preliminary report concerning the association in normal controls of high levels of IgM rheumatoid factor synthesis on CD3 crosslinking with the presence of the DRB1*0404 allele is of interest (Wang et ul., 1993).Among 38 persons evaluated in this assay, all DRB1*0404 individuals were found to be high producers, and accounted for 6 of the 16 high producers. Of the 16 high producers, 14 expressed the shared epitope, encoded by either DR1 or DR4 alleles. This trait mapped to the B cell compartment in cell mixing studies. It is interesting to speculate that tolerance to self in the B cell repertoire is also determined by selfMHC molecules and that the shared epitope plays a role in this process. In view of the critical role of rheumatoid factor in rheumatoid arthritis (see Winchester, 1993, for a review of this topic), these preliminary findings assume a special significance. The resulting immune response has the characteristics of being antigen driven, at least in terms of the immunobiology of the B cell rheumatoid factor antiglobulin response. C. EFFECT OF EXOGENOUS EVENTS IN INITIATING CHANGES IN THE REPERTOIRE The concept of superantigen has been proposed whereby certain antigens usually derived from microorganisms, such as mycoplasma presented in the context of any class I1 molecules, are capable of stimulating all T cell clones that express a certain Vp gene, (Dellabona et al., 1990; Choi et al., 1989; Kappler et al., 1987); an antigenic stimulus of this nature, whether endogenous or exogenous, could be envisaged as initiating a hyperresponsive state in an individual whose
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
453
T cell repertoire displays the corresponding Vp segment at a disproportionately elevated frequency. More recent data do not support the notion of the action of a disease-specific superantigen. If rheumatoid arthritis is considered to proceed from a qualitative abnormality, i.e., a “break” or loss of tolerance with the emergence of unique pathogenic clones, how could this occur? Table IX summarizes some of the possible mechanisms by which T cell autoimmunity is initiated. One possibility that has been proposed is the presence of a mimetic relationship between the structure ofan exogenous antigen and the shared epitope. Roitt et al. (1992) discuss the possibility that molecular mimicry of autoantigens by microbes can stimulate autoreactive cells by their cross-reactivity. It is emphasized that cross-reaction which gives rise to the priming of autoreactive T cells could give rise to the establishment of a chronic autoimmune state. This notion has the appeal of an agent infecting a previously normal host to account for the spontaneous appearance of rheumatoid arthritis. The evidence for a glycosylation defect in the IgG in patients with rheumatoid arthritis is explored by Roitt et al. (1992) as another potential mechanism. Because the spouses of probands with rheumatoid arthritis also have an increased frequency of this glycosylation defect, this raises the possibility of an effect due to an environment factor, such as a microbial infection, and argues against an inherited basis of the phenomenon. In animals with normal regulatory immune systems, such induced autoimmunity is ultimately corrected and it is only in animals where there are defects in regulation that autoimmunity persists (Roitt et al., 1992). Limited regions of intriguing homology that could be the basis of a mimetic effect have been identified with several molecules encoded by pathogens. For example, the 110-kDa late major capsid protein of Epstein-Barr virus (EBV) and the Escherichia coli dnaJ 40-kDa heat shock protein has the sequence glu-gln-lys-arg-ala-ala which includes the shared epitope (Roudier et al., 1988, 1989; Albani et al., 1992b). Evidence obtained by immunization of rabbits suggests that the susceptibility sequence TABLE IX THEORIES OF T CELLAUTOIMMUNITY
N o tolerance to the peptide antigen Cryptic molecule, e.g., in ectoderm Newly expressed in context of neo-class I1 Loss of prior tolerance Induction of modified self molecule Mimicry of self
454
ROBERT WINCHESTER
in the DRB1*0401 molecule is also a cross-reactive B cell epitope, 11 amino acids in length, that is shared by the dnaJ E . coli heat shock protein (Richardson, 1992). A rabbit antipeptide antiserum raised against the sequence of the third hypervariable region of HLA DRB1*0401 specifically bound to dnaJ. Similarly, an antiserum to the dnaJ protein recognized the intact HLA DRBl"0401 polypeptide (Richardson, 1992). An additional mimicry has been identified between the shared epitope sequence and a hexamer sequence ofproteus hemolysin spanning residues 32-37 (ESRRAL) has been identified that resembles more closely the HLA types associated with rheumatoid arthritis (DR1, Dw4, Dw14, Dw15) and those not linked with the disease (DwlO, Dw13) (Ebringer et al., 1992). The possibility exists that the repertoire of an individual can also be influenced by determinants arising from outside that person's genome. Albani et al. (1992a) propose that through a molecular mimicry mechanism involving peptides from microorganisms, T lymphocytes are skewed by positive selection to recognize epitopes that are similar but not identical to self. They present evidence that peptide sequences similar to the rheumatoid arthritis shared epitope are abundantly expressed by microorganisms that chronically infect most people such as the E . coli dnaJ protein or the g p l l 0 protein of EBV. This view is an alternative to the more prevalent but less likely notion that mimetic structures such as these are involved in initiating a specific loss of tolerance critical to the disease pathogenesis and is consistent with the finding that persons with rheumatoid arthritis do not differ from controls of the same HLA type in their reactivity to these exogenous determinants. The report of the influence of maternal MHC allelic products on susceptibility is consistent with this notion, (ten-Wolde et al., 1993). What about those lacking the shared epitope? In a novel attempt to understand why a small proportion of rheumatoid arthritis patients do not carry the shared epitope, the influence of noninherited maternal HLA specificities on the occurrence of rheumatoid arthritis was studied by ten-Wolde et al. (1993). The authors provide data that it is not necessary to inherit the shared epitope structure, but merely to be exposed to it during gestation when repertoire formation is occurring. An increased frequency, compared with controls, of noninherited maternal HLA-DR4 was found predominantly in the mothers of DR4negative patients. An increased frequency of noninherited maternal HLA-DR6 and a decreased frequency of noninherited maternal HLADR3 was also found in the mothers of DR4-positive patients (tenWolde et d., 1993).The authors hypothesize that HLA-DRCassociated
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
455
genetic susceptibility to rheumatoid athritis is due to an effect of DR4 on T cell receptor repertoire expression that can be mediated through the presence of DR4 in the mother. Confirmation of this provocative report is awaited with interest.
D. WHATDRIVES THE IMMUNE RESPONSEAND WHATIS PEPTIDE X? ANTIGEN The nature of antigen X is nearly unknown at this time, although there is no reason to consider that it is exogenous. The possibilities range from endogenous peptides drived from joint tissue, through IgG molecules, to the third diversity region encoded by the DR &chain alleles that contain the shared epitope, to no specific peptide at all. The absence of a completely parallel disease in other species may be evidence that the antigen driving the process involves a polymorphism that is unique to humans. Taken in concert with notions such as the peptidic self-hypothesis of Kourilsky and Claverie (1986),this would direct additional attention to the possibility that the third diversity region itself could be presented as a peptide antigen perhaps influenced by ineffective elimination of these clones during ontogeny. Peptide elution studies from the MHC molecules may help indicate whether this is a realistic possibility. XIV. Conclusion
From the perspective of the person with rheumatoid arthritis, the illness usually appears to be a sporadic event that often makes its appearance only well into adulthood. Yet, as with many diseases where autoimmune reactions are found, there is a clear genetic basis associated with particular MHC alleles, non-MHC alleles, gender, as well as the participation of still undefined stochastic processes (Fig. 16). Progress over the past quarter century has resulted in a reasonable, although still rather incomplete, understanding of the molecular basis of this susceptibility as it involves MHC molecules. Rheumatoid arthritis is distinctly rare in most populations in the absence of an allele encoding the shared epitope motif. Molecular biologic methods have given considerable insight into the structural determinants of antigen recognition and have led directly to an understanding the structural basis of some associations of MHC polymorphisms with disease susceptibility. Moreover by directing specific attention to the helical portion of the MHC encoding the shared epitope, they have expanded our knowledge of how the MHC functions in that this region appears to
456
ROBERT WINCHESTER
FIG.16. A hypothetical scheme of three or four genes delineating susceptibility to rheumatoid arthritis. The expression of these genes is not sufficient for the disease, which requires a stochastic event that likely occurs within the T cell repertoire. The occurrence of this stochastic event acts as if it were accelerated by the inheritance of a second shared epitope. The enhanced penetrance induced by the presence of two copies of a susceptibility conformation results in greater twin concordance and expressed disease susceptibility in the population at large. This state also appears to be characterized by more severe disease, a finding that may prove to be particularly important in determining who should receive more intense and potentially hazardous therapies.
exhibit selective evolutionary relevance. In addition the existence of intriguing trans interactions between alleles encoding susceptibility determinants add an unusual dimension to how these structures result in disease. The structural basis of this susceptibility offers an opportunity for the hypotheses about binding and recognition of candidate peptides at the level of MHC molecule and T cell repertoire to be tested. However, the nature of the type of autoimmunity that underlies rheumatoid arthritis is still elusive and feasible disease-specific therapies based on critical immune recognition events in the pathogenesis of the illness are not yet easily envisioned. It is clear that the MHC genes are not disease genes in the usual sense, with the unfortunate implication that peptide blockade may not be entirely appropriate as an innovative therapy. While the ability to analyze the T cell receptor repertoire is not yet quite equal to the task of sorting out the effect of susceptibility alleles, this appears to be a more promising target area for new therapeutic directions perhaps by altering the repertoire composition or through approaching clones that are involved in the specific immune recognition event underlying the disease.
REFERENCES Albani, S., Carson, D. A., and Roudier, J. (1992a). Genetic and environmental factors in the immune pathogenesis of rheumatoid arthritis. Rheum. Dis. Clin. North. Am. 18(4), 729-740. Albani, S., Tuckwell, J . E., Esparza, L., Carson, D. A., and Roudier, J. (199213). The susceptibility sequence to rheumatoid arthritis is a cross-reactive B cell epitope shared by the Escherichia coli heat shock protein dnaJ and the histocompatibility leukocyte antigen DRB1*0401 molecule. J . Clin. Znwest. 89, 327-331.
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
457
Angelini, G., Morozzi, G., Delfino, L., Pera, C., Falco, M., Marcolongo, R., Giannelli, S., Ratti, G., Ricci, S., Fanetti, C . , et al. (1992). Analysis of HLA DP, DQ, and DR alleles in adult Italian rheumatoid arthritis patients. Hum. Immunol. 34(2), 135-141. Arnett, F. C., Edworthy, S. M., Bloch, D. A., McShane, D. J., Fries, J. F., Cooper, N. S., Healey, L. A., Kaplan, S. R., Liang, M. H., Luthra, H. S., et al. (1988). The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 31, 315-324. Astorga, G. P., and Williams, R. C., Jr. (1969). Altered reactivity in mixed lymphocyte culture of lymphocytes from patients with rheumatoid arthritis. Arthritis Rheum. 12, 547. Bell, J. I., Estess, P., St. John, T., Saiki, R., Waitling, D., Erlich, H. A,, and McDevitt, H. 0.(1985).DNA sequence and characterization ofhuman class I1 major histocompatibility complex p chains from the DR1 haplotype. Proc. Natl. Acad. Sci. U.S.A. 82, 3405-3409. Berg, L. J., Frank, G. D., and Davis, M. M. (1990). The effects of MHC gene dosage and allelic variation on T cell receptor selection. Cell (Cambridge,Mass.) 60, 1043-1053. Bhayani, H. R., and Hedrick, S. M. (1991). The role of polymorphic amino acids of the MHC molecule in the selection of the T cell repert0ire.J. Immunol. 146, 1093-1098. Bjorkman, P. J., and Parham, P. (1990). Annual review. Biochemistry 59, 253-288. Blackman, M., Kappler, J., and Marrack, P. (1990). The role of the T cell receptor in positive and negative selection of developing T cells. Science 248, 1335-1341. Bodmer, J. G., Marsh, S. G., Albert, E. D., Bodmer, W. F., Dupont, B., Erlich, H. A., Mach, B., Mayr, W. R., Parham, P., Sasazuki, T., Schreuder, J. L., Strominger, J. L., Svejgarrd, A,, and Terasaki, P. I. (1992). Nomenclature for factors of the HLA system, 1991. Tissue Antigens 39, 161-173. Brautbar, C., Naparstek, Y., Yaron, M., Amar, A., Ehrenfeld, M., Eliakim, M., Bentwich, Z., Cohen, T., Korman, S . H., and Albert, E. D. (1986). Immunogenetics ofrheumatoid arthritis in Israel. Tissue. Antigens 28, 8-14. Brewerton, D. A., Hart, F. D., Nicholls, A., Caffrey, M., James, D. C. 0..and Sturrock, R. D. (1973). Ankylosing spondylitis and HL-A 27. Lancet 1,904. Brown, J . H., Jardetzky, T. S., Gorga, J. C., Stern, L. J., Urban, R. G., Strominger, J. L., and Wiley, D. C. (1993). Three-dimensional structure of the human class I1 histocompatibility antigen HLA-DRl. Nature (London)364, 33-39. Carpenter, A. B., Kahl, L. E., Bartkowiak, C. D., Duquesnoy, R. J., and Eisenbeis, C. H. (1988)./. Rheumatol. 15, 395. Charron, D. (1989). Molecular basis ofhuman leukocyte antigen class I1 disease associations. Ado. Immunol. 107, 59. Charron, D. J. (1992). New aspects of HLA: Perspectives for rheumatoid arthritis. Clin. E r p . Rheumatol. 10(3), 293-296. Choi, Y. W., Kotzin, B., Herron, L., Callahan, J., Marrack, P., and Kappler, J. (1989). Interaction of Staphylococcus aureus toxin “superantigens” with human T cells. Proc. Natl. Acad. Sci. U.S.A.86, 8941-8945. Clarkson, R., Bate, A. S., Grennan, D. M., Chattopadhyay, C., Sanders, P., Davis, M., and Kelly, C. (1990). DQw7 and the C4B null allele in rheumatoid arthritis and Felty’s syndrome. Ann. Rheum. Dis. 49,976-979. Clarkson, R. W., Sanders, P. A,, and Grennan, D. M. (1992). Complement C4 null alleles as a marker or gold or D-penicillamine toxicity in the treatment ofrheumatoid arthritis. Br. J . Rheumatol. 31(1), 53-54. Cutbush, S., Ollier, W., Papasteriades, C., Awad, J., Boki, K., Moutsoponlos, H., Biro, A,, and Sachs, J. (1990). Association of DR4 related RFLP bands and RA in Greeks. Autoimmunity 8, 169-171.
458
ROBERT WINCHESTER
Davis, M. M., and Bjorkman, P. J. (1988). T-cell antigen receptor genes and T-cell recognition. Nature (London)334, 395-402. de-Vries, N., Ronningen, K. S., Tilanus, M. G., Bouwens-Rombouts, A., Segal, R., Egeland, T., Thorsby, E., van-de-Putte, L. B., and Brautbar, C. (1993). HLA-DR1 and rheumatoid arthritis in Israeli Jews: Sequencing reveals that DRB1*0102 is the predominant HLA-DR1 subtype. Tissue Antigens 41( l),26-30. Deighton, C. M., and Walker, D. J. (1992). What factors distinguish probands from multicase rheumatoid arthritis same sex sibships from sporadic disease?J. Rheumatol. 19(2), 237-241. Deighton, C. M., Walker, D. J., Griffiths, I. D., and Roberts, D. F. (1989).The contribution of HLA to rheumatoid arthritis. Clin. Genet. 36, 178-182. Deighton, C. M., Wentzel, J., Cavanagh, G., Roberts, D. F., and Walker, D. J. (1992). Contribution of inherited factors to rheumatoid arthritis. Ann. Rheum. Dis. 51(2), 182- 185. Dellabona, P., Peccoud, J., Kappler, J., Marrack, P., Benoist, C., and Mathis, D. (1990). Superantigens interact with MHC class I1 molecules outside of the antigen groove. Cell (Cambridge, Mass.) 62, 1115-1121. Dizier, M. H., Silman, A. J., Ollier, W., Grennan, D. M., and Clerget Darpoux, F. (1991). Interactive effect of HLA and Gm and genetic heterogeneity tested in 79 rheumatoid arthritis families. Dis. Markers 9, 27-34. Doita, M., Hirohata, K., and Maeda, S. (1990). Association of HLA-DR antigens with diseaase severity in Japanese patients with rheumatoid arthritis. Kobe J . Med. Sci. 36, 103-114. Duquesnoy, R. J., Marrari, M., Hackbarth, S., and Zeevi, A. (1984).Hum. Zmmunol. 10, 165. Dwyer, E., and Winchester, R. (1993).Genetic basis ofchronic Lyme disease. In “Irnmunogenetics of Lyme Disease” (P. Coyle, ed.). Mosby Year Book. Dyson, P. J., Knight, A. M., Fairchild, S., Simpson, E., and Tomonari, K. (1991). Genes encoding ligands for deletion of V p 11 T cells cosegregate with mammary tumour virus genomes; see comments. Nature (London) 349, 531-532. Ebringer,A., Cunningham, P., Ahmadi, K., Wrigglesworth, J., Hosseini, R., and Wilson, C. (1992). Sequence similarity between HLA-DRI and DR4 subtypes associated with rheumatoid arthritis and proteudserratia membrane haemolysins. Ann. Rheum. Dis. 51(11), 1245-1246. Falk, K., Rotzschke, O., Stevanovic, S., Jung, G., and Rammensee, H. G. (1991). Allelespecific motifs revealed by sequencing of self-peptides eluted from MHC molecules. Nature (London) 351,290-296. Fassbender, H. G., and Simmling-Annefeld, M. (1983). The potential aggressiveness of synovial tissue in rheumatoid arthritis. J . Pathol. 139, 399-406. Festenstein, H., and Ollier, B. (1987). Cellular typing and functional heterogeneity of MHC-encoded products. Br. Med. Bull. 43, 122-155. Frankel, W. N., Rudy, C., Coffin, J. M., and Huber, B. T. (1991). Linkage of Mls genes to endogenous mammary tumour viruses of inbred mice; see comments. Nature (London) 349,526-528. Fraser, P. (1993). Unpublished. Funkhouser, S. W., Concannon, P., Charmley, P., Vredevoe, D. L., and Hood, L. (1992). Differences in T cell receptor restriction fragment length polymorphisms in patients with rheumatoid arthritis. Arthritis. Rheum. 35, 465-471. Gao, X. J., Olsen, N. J., Pincus, T., and Stastny, P. (1990). HLA-DR alleles with naturally occurring amino acid substitutions and risk for development of rheumatoid arthritis. Arthritis Rheum. 33,939-946.
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
459
Gao, X., Gazit, E., Livneh, A., and Stastny, P. (1991a). Rheumatoid arthritis in Israeli Jews: Shared sequences in the third hypervariable region of DRRl alleles are associated with susceptibility. J . Rheumatol. 18, 801-803. Gao, X. J., Brautbar, C., Gazit, E., Segal, R., Naparstek, Y., Livneh, A,, and Stastny, P. (1991b). A variant of HLA-DR4 determines susceptibility to rheumatoid arthritis i n a subset of Israeli Jews. Arthritis Rheutn. 34, 547-551. Garcia Pacheco, J. M., Herbut, B., Cutbush, S., Hitnian, G. A,, Zhonglin, W., Magzoub, M., Bottazzo, G. F., Kiere, C., West, G., Mvere, D., et al. (1992). Distribution of HLA-DQA1, -DQBl and DRBl alleles in black IDDM patients and controls from Zimbabwe. Tissue Antigens 40, 145-149. Gibofsky, A., Winchester, R., Hansen, J., Patarroyo, M., Dupont, B., Paget, S., Lahita, R., Halper, J., Fotino, M., Yunis, E., and Kunkel, H. G. (197%). Contrasting patterns of newer histocompatibility determinants in patients with rheumatoid arthritis and systemic lupus erytheniatosus. Arthritis. Rheum. 21, S134-S138. Gibofsky, A., Winchester, R. J., Patarroyo, M., Fotino, M., and Kunkel, H. G. (1978b). Disease associations of the la-like human alloantigens: Contrasting patterns in rheumatoid arthritis and systemic lupus erythematosus. J . E x p . Med. 148, 1728-1732. Go, R. C. P., Alarcon, G. S.,Acton, R. T., Koopman, W. J., Vittor, V. J., and Barger, B. 0. (1987). Analyses of HLA linkage in white families with multiple cases of seropositive rheumatoid arthritis. Arthritis Rheum. 30, 1115-23, Gorodesky, C., Lavalle, C., and Castro-Escobar, L. E., et al. (1981). HLA antigens in Mexican patients with rheumatoid arthritis. Arthritis Rheum. 24, 269-276. Goronzy, J. J., and Weyand, C. M. (1993). Interplay of T lymphocytes and HLA-DR molecules in rheumatoid arthritis. Curr. Opinion Rheumatol. 5(2), 169- 177. Gregersen, P. K. (1992).T-cell receptor-major histocompatibility complex genetic interactions in rheumatoid arthritis. Rheum. Dis. Clin. North Am. 18, 793-807. Gregersen, P. K. (1993). Selective inactivation of X chromosomes. Arthritis Rheum. 7(1), 106-113. Gregersen, P. K., Shen, M., Song, Q. L., Merryman, P., Degar, S., Seki, T., Maccari, J., Goldberg, D., Murphy, H., Schwerizer, J., Wang, C. Y., Winchester, R. J., Nepom, G. T., and Silver, J. (1986). Molecular diversity of HLA-DR4 haplotypes. Proc. Natl. Acad. Sci. U.S.A.83, 2642-2646. Gregersen, P. K., Silver, J . , and Winchester, R. J. (1987). The shared epitope hypothesis-An approach to understanding the molecular genetics of rheumatoid arthritis susceptibility. Arthritis Rheum. 30, 1205-1213. Harris, P. E., Liu, Z., and Suciu Foca, N. (1992). MHC class I1 binding of peptides derived from HLA-DR 1. J. Imtnunol. 148, 2169-2174. Harvey, J., Lotze, M., Arnett, F. C., Billingsley, L. M., Harvey, E., Hsu, S. H . , Sutton, J. D., Zizic, T. M., and Stevens, M. B. (1983).Rheumatoid arthritis in a Chippewa band. 11. Field study with clinical serologic and HLA D correlations. J . Rheumatol. 10,28. Hazes, J. M. (1991). Pregnancy and its effect on the risk of developing rheumatoid arthritis. Ann. Rheum. Dis. 50, 71-72. Hench, P. S. (1938).The ameliorating effect ofpregnancy on chronic atrophic (infectious rheumatoid) arthritis, fibrositis, and intermittent hydrarthosis. Mayo Clin. Proc. 13, 161. Hillarby, M. C., Clarkson, R., Grennan, D. M., Bate, A. S., Ollier, W., Sanders, P. A., Chattophadhyay, C., Davis, M., O’Sullivan, M. M., and Williams, B. (1991). Immunogenetic heterogeneity in rheumatoid disease as illustrated by different MHC associations (DQ, Dw and C4) in articular and extra-articular subsets. Br. J . Rheumatol. 30, 5-9. Hurley, C. K., Nunez, G., Winchester, R., Finn, 0.J., Levy, R., and Capra, J. D. (1982).
460
ROBERT WINCHESTER
The human HLA-DR antigens are encoded by multiple /3 chain loci. J . Immunol. 129, 2103. Kappler, J. W., Roehm, N., and Marrack, P. (1987). T cell tolerance by clonal elimination in the thymus. Cell (Cambridge, Mass.) 49, 273-280. Klein, J. (1986). “Natural History of the Major Histocompatibility Complex.” Wiley, New York. Kohsaka, H., Chen, P. P., Taniguchi, A., Ollier, W. E., and Carson, D. A. (1993).Divergent T cell receptor y repertoires in rheumatoid arthritis monozygotic twins. Arthritis Rheurn.36(2),213-221. Kourilsky, P., and Claverie, J. M. (1986). The peptidic self model: A hypothesis on the molecular nature of the immunological self. Ann. Znst. Pasteur 137D, 3-21. Lanchbury, J. S . (1992). The HLA association with rheumatoid arthritis. Clin. E x p . Rheurnatol.l0(3),301-304. Lawrence, J. S . (1967). Genetics of rheumatoid factor and rheumatoid arthritis. Clin. Exp. Immunol. 2, Suppl. 769-Suppl. 783. Lawrence, J. S. (1970). Heberden oration, 1969.rheumatoid arthritis-nature or nurture? Ann. Rheum. Dis. 29,357-379. Lee, S. H., Gregersen, P. K., Shen, H. H., Nunez-Roldan, A., Silver, J., and Winchester, R. J. (1984). Strong association of rheumatoid arthritis with the presence of a polymorphic Ia epitope defined by a monoclonal antibody: Comparison with the allodeterminant DR4. Rheumatol. f n t . 4(Suppl.), 17-23. Legrand, L., Lathrop, G. M., Marcelli, B. A,, Dryll, A., Bardin, T., Debeyre, N., Poirier, J. C., Schmid, M., Ryckewaert, A., and Dausset, J. (1984). HLA DR genotype risks in seropositive rheumatoid arthritis. Am. J . Hum. Genet. 36(3), P, 690-699. Lepage, V., Alcalay, D., and Douay, C. (1985). Tissue Antigens 25, 96. Lewis, R. B., Sanders, L. L., and Lipsmeyer, E. (1980). Characteristics of rheumatoid arthritis in a male population. J . Rheumatol. 7, 559-562. Liu, Z., Sun, Y. K., Xi, Y. P., Harris, P., and Suciu Foca, N. (1992). T cell recognition of self-human histocompatibility leukocyte antigens (HLA)-DR peptides in context of syngeneic HLA-DR molecules. J . Exp. Med. 175, 1663-1668. MacCregor, A. J., Thomson, W., Holligan, S., Carthy, D., Ollier, 0. E. R., and Silman, A. J. (1993). Concordance rates for rheumatoid arthritis in twins: Results of a nationwide study. Br. J . Rheurnatol., in Press. [Abstract] Markku, A. K., Touminen, J., and Kaprio, J. (1986). Occurrence of rheumatoid arthritis in a nationwide series of twins. J . Rheumatol. 13,899-902. Massardo, L., Jacobelli, S., Rodriguez, L., Rivero, S., Gonzalez, A., and Marchetti, R. (1990). Weak association between HLA-DR4 and rheumatoid arthritis in Chilean patients. Ann. Rheum. Dis. 49, 290-292. Matsuyama, T., Schwenzer, J., Silver, J., and Winchester, R. (1986). Structural relationships between the DR& and DR& subunits in DR4, 7 and w9 haplotypes and the DRw53(MT3) specificity. J . Immunol. 137, 934-940. Matsuyama, T., Winchester, R., Lee, S., Shookster, L., and Nunez-Roldan, A. (1988). Identification of the DRwlO DRP, chain allele as encoding a polymorphic class I1 MHC epitope otherwise restricted to DR& molecules ofthe DRw53 type.]. Immunol. 140,537-543. McCusker, C. T., Reid, B., Green, D., Gladman, D. D., Buchanan, W. W., and Singal, D. P. (1991). HLA-D region antigens in patients with rheumatoid arthritis. Arthritis Rheum. 34, 192-197. McDaniel, D. 0. (1993). Unpublished. Merryman, P., Gregersen, P., Matsuyama, T., Lee, S., Nunez-Roldan, A., Silver, J., and Winchester, R. (1987). Nucleotide sequence of MHC class I1 region genes i n a patient
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
461
with DR4 negative rheumatoid arthritis (RA) from a multiplex family: Simulation of a DR4 haplotype by trans complementation of the HV 111 regions. Arthritis Rheum. 30, 4(Suppl.), S31. [Abstract] Merryman, P., Cregersen, P. K., Lee, S., Silver, J., Nunez-Roldan, A,, Crapper, R., and Winchester, R. (1988). Nucleotide sequence ofa DRwlO p chain cDNA clone: Identity of the third diversity region with that of the DRw53 allele of the pz locus and as the probable site encoding a polymorphic MHC class I1 epitope. J . Zmmunol. 140, 2447-2452. Merryman, P. F., Crapper, R. M., Lee, S., Gregersen, P. K., and Winchester, R. J. (1989). Class I1 major histocompatibility complex gene sequences in rheumatoid arthritis: The third diversity regions of both DR pl genes in two DR1, DRwlO-positive individuals specify the same inferred amino acid sequence as the DRpl and DRp2 genes of a DR4 (Dw14) haplotype. Arthritis Rheum. 32(3), 251-258. Nelson, J. L., Mickelson, E., Masewicz, S., Barrington, R., Dugowson, C., Koepsell, T., and Hansen, J. A. (1991). Dw14(DRB1*0404) is a Dw4-dependent risk factor for rheumatoid arthritis. Rethinking the “shared epitope” hypothesis. Tissue Antigens 38, 145-151. Nelson, J . L., Boyer, C . , Templin, D., Lanier, A,, Barrington, R., Nisperos, B., Smith, A., Mickelson, E., and Hansen, J. A. (19924. HLA antigens in Tlingit Indians with rheumatoid arthritis. Tissue Antigens 40(2), 57-63. Nelson, J. L., Hansen, J. A,, and Singal, D. P. (1992b). Rheumatoid arthritis-Joint report. In “HLA 1991’’ (K. Tsuji, ed.). Oxford Univ. Press, New York. Nelson, J . L., Hughes, K. A., Smith, A. G., Nisperos, B. B., Branchaud,A. M., and Hansen, J. A. (1992~ ).Remission of rheumatoid arthritis during pregnancy and maternal-fetal class I1 alloantigen disparity. A m . J. Repmd. Zmmunol. 28(3-4), 226-227. Nepom, B. S. (1991). The imniunogenetics of juvenile rheumatoid arthritis. Rheum. Dis. Clin. North Am 17, 825. Nepom, G. T., and Neponi, B. S. (1992). Prediction of susceptibility to rheumatoid arthritis by human leukocyte antigen genotyping. Rheum. Dis. Clin. North A m . 18(4), 785-792. Nepom, G. T., Seyfried, C. E., Holbeck, S . L., Wilske, K. R., and Nepom, B. S. (1986). Identification of HLA-Dw14 genes in DH4 + rheumatoid arthritis. t u n c e t 218514); P, 1002-100s. Nepom, C . T., Hansen, J. A,, and Neponi, B. S. (1987). T h e niolecular basis for HLA class I1 associations with rheumatoid arthritis. J . Clin. Zmmunol. 7, 1-7. Nepom, C. T., Byers, P., Seyfried, C., Healey, L. A,, Wilske, K. R., Stage, D., and Nepom, B. S. (1989). HLA genes associated with rheumatoid arthritis. Arthritis Rheum. 32(1), 15-21. Nunez-Roldan, A,, Arguer, E., Villechenous, E., and Dela Prada, M. (1982). HLA DR antigens in rheumatoid arthritis. Rec. E s p . Rheuniatol. 9, 9-11. Ollier, W., and Thomson, W. (1992). Population genetics of rheumatoid arthritis. Rheum. Dis. Clin. North A m . 18(4), 741-759. Ollier, W., Carthy, D., Cutbush, S., Okoye, R., Awad, J., Fielder, A,, Silman, A., and Festenstein, H. (1988). HLA-DR4 associated Dw types in rheumatoid arthritis. Tissue Antigens 33,30-37. Ollier, W. E., Stephens, C., Awad, J., Carthy, D., Cupta, A., Perry, D., Jawad, A., and Festenstein, H. (1991). Is rheumatoid arthritis in Indians associated with HLA antigens sharing a DR p 1 epitope? Ann. Rheum. Dis. 50,295-297. Ollier, B., Jawaheer, D., Thomson, W., Macgregor, A,, and Silman, A. (1993). Influence of HLA DR alleles in determining concordance rates for rheumatoid arthritis in monozygotic twin pairs. Br. J . Rheumatol., in press.
462
ROBERT WINCHESTER
Otha, N., Nishimura, I. K., Tanimoto, K., Horiuchi, Y., Abe, C., Shikawa, Y., Abe, T., Katagiri, M., Yoshiki, T., and Sasasuki, T. (1982). Association between HLA and Japanese patients with rheumatoid arthritis. Hum. Zmmunol. 5, 123-132. Panayi, G. S., and Wooley, P. H. (1977). B. Lymphocyte alloantigens in the study of the genetic basis of rheumatoid arthritis. Ann. Rheum. Dis. 36, 365-368. Papasteriades, C. A., Kappou, I. D., Skopouli, F. N., Barla, M. N., Fostiropoulos, G. A., and Moutsopoulos, H. M. (1985). Lack of HLA-antigen association in Greek rheumatoid arthritis patients. Rheumatol. Znt. 5, 201-203. Perdriger, A,, Semana, G., Quillivic, F., Chales, G., Chardevel, F., Legrand, E., Meadeb, J., Fauchet, R., and Pawlotsky, Y. (1992). DPBl polymorphism in rheumatoid arthritis: Evidence of an association with allele DPBl 0401. Tissue Antigens 39(1), 14-18. Persellin, R. H. (1977). The effect of pregnancy on rheumatoid arthritis. Bull. Rheum. Dis.27, 922. Pile, K. D., Tikly, M., Bell, J. I., and Wordsworth, B. P. (1992a). HLA-DR antigens and rheumatoid arthritis in black South Africans: A study of ethnic groups. Tissue Antigens 39(3), 138-140. Pile, K. D., Wordsworth, B. P., and Bell, J. I. (199213). Does the locus on chromosome 11 implicated in susceptibility to HLA-DR4 dependent type I diabetes mellitus also affect susceptibility to rheumatoid arthritis? Ann. Rheum. Dis. 51(11), 1250-1251. Reed, E., Tugulea, S., and Suciu-Foca, N. (1993). The influence of HLA antigens on the T cell receptor repertoire. Hum. Immunol. 37 (Suppl. l),4. [Abstract] Reinsmoen, N. L., and Bach, F. H. (1982). Five HLA-D clusters associated with HLADR4. Hum. Zmmunol. 4(3), P, 249-258. Richardson, B. C. (1992). Tcell receptor usage in rheumaticdiseases. Clin. E x p . Rheumatol. 10(3), 271-283. Rigby, A. S. (1992). HLA haplotype sharing in rheumatoid arthritis sibships: Risk estimates in siblings. Scand. J . Rheumatol. 21(2), 68-73. Rigby, A. S., Silman, A. J., Voelm, L., Gregory, J. C., Ollier, W. E. R., Khan, M. A., Nepom, G. T., and Thomson, G. (1991). Investigating the HLA component in rheumatoid arthritis: An additive (dominant) mode of inheritance is rejected, a recessive mode is preferred. Genet.-Epidemiol. 8, 153-175. Roitt, I. M., Hutchings, P. R., Dawe, K. I., Sumar, N., Bodman, K. B., and Cooke, A. (1992). The forces driving autoimmune disease. J . Autoimmun. Suppl. A . 11-26. Ronchese, F., Brown, M. A., and Germain, R. N. (1987a). Structure-function analysis of the ABbml2 mutation suing site-directed mutagenesis and DNA-mediated gene transfer. J . Zmmunol. 139, 629-638. Ronchese, F., Schwartz, R. H., and Germain, R. N. (1987b). Functionally distinct subsites on a class I1 major histocompatibility complex molecule. Nature (London) 329(6136), 254-256. Ronningen, K. S., Spurkland, A., Egeland, T., Iwe, T., Munthe, E., Vartdal, F., and Thorsby, E. (1990). Rheumatoid arthritis may be primarily associated with HLADR4 molecules sharing a particular sequence at residues 67-74. Tissue Antigens 36, 235-240. Ronningen, K. S., Ploski, R., Hansen, T., and Thorsby, E. (1992). Dw14 is a Dw4independent risk factor for rheumatoid arthritis among Norwegians. Tissue Antigens 39(5), 280. [Letter] Roudier, J., Rhodes, G., Petersen, J., Vaughan, J. H., and Carson, D. A. (1988). The Epstein-Barr virus glycoprotein g p l l 0 , a molecular link between HLA DR4, HLA DRl, and rheumatoid arthritis. Scand. J . Zmmunol. 27, 367-371. Roudier, J., Petersen, J., Rhodes, G. H., Luka, J., and Carson, D. A. (1989).Susceptibility
SUSCEPTIBILITY TO RHEUMATOID ARTHRITIS
463
to rheumatoid arthritis maps to a T-cell epitope shared by the HLA-Dw4 DR p-1 chain and the Epstein-Barr virus glycoprotein gpll0. Proc. Natl. Acad. Sci. U.S.A. 86,5104-5108. Rousseau, J., du Toit, E. D., Meyers, 0. L., and Ress, S. R. (1991).HLA DQ p restriction fragment length polymorphism and rheumatoid arthritis: Association between DQw7 and rheumatoid arthritis in DRCpositive subjects. S. Afr. Med. J . 79, 323325. Sacha, J. A., and Kirwan, J. R. (1986).Multiple HLA associations and disease susceptibility. Dis. Markers 4, 13-17. Salmon, M. (1992). The immunogenetic component of susceptibility to rheumatoid arthritis. Curr. Opinion Rheumatol. 4(3), 342-347. Sanchez, B., Moreno, I., Magarino, R., Garzon, M., Gonzalez, M. F., Garcia, A., and Nunez Roldan, A. (1990). HLA-DRwlO confers the highest susceptibility to rheumatoid arthritis in a Spanish population. Tissue Antigens 36, 174-176. Schiff, B., Mizrachi, Y., Orgad, S., et al. (1982). Association of HLA-Aw31 and HLADR1 with adult rheumatoid arthritis. Ann. Rheum. Dis. 41(4), P, 403-404. Seglias, J., Li, E. K., Cohen, M. G., Wong, R. W., Potter, P. K., and So, A. K. (1992). Linkage between rheumatoid arthritis susceptibility and the presence of HLA-DR4 and DR p allelic third hypervariable region sequences in southern Chinese persons. Arthritis Rheum. 35(2), 163-167. Sekiquchi, S., Nishikai, M., Ito, S., and Takata, H. (1982). Rheumatoid arthritis in Japanese. In “Immunogenetics in Rheumatology, Musculoskeletal Disease and DPenicillamine” (R. L. Dawkins, F. T. Christiansen, and P. J. Kilko, eds.), pp. 107-109. Excerpta Medica, Amsterdam. Semana, G., Bignon, J . D., Quillivic, F., Cheneau, M. L., Herniou, E., Muller, J. Y., Genetet, B., and Fauchet, R. (1988).Definition of DRwlO specificity by restriction fragment length polymorphism. Tissue Antigens 32, 113-120. Shen, H. H., and Winchester, R. J. (1986). Susceptibility genetics of systemic lupus erythematosus. Springer Semin. Immunopathol. 9, 143-159. Sidebottom, D., Grennan, D. M., Green, J. R., Sanders, P. A., Ollier, W., and De Lange, G. (1991).Ig C H and D14S1 variants in rheumatoid arthritis-Linkage and association studies. Br.I . Rheumatol. 30, 167-172. Silman, A. (1993).Personal communication. Silman, A. J., Ollier, B., and Mageed, R. A. (1991). Rheumatoid factor detection in the unaffected first degree relatives in families with multicase rheumatoid arthritis. J. Rheumatol. 18, 512-515. Silman, A., Kay, A,, and Brennan, P. (1992a). Timing of pregnancy in relation to the onset of rheumatoid arthritis. Arthritis Rheum. 35, 152-155. Silman, A. J., Hennessy, E., and Ollier, B. (1992b). Incidence of rheumatoid arthritis in a genetically predisposed population. Br. J. Rheumatol. 31(6), 365-368. Silman, A. J., MacGregor, A. J., Holligan, S., Ollier, W. E. R., Thomas, W., and Carthy, D. (1992~). Concordance rates for rheumatoid arthritis in twins: Results ofa nationwide study. Arthritis Rheum. 35(9), Suppl. S47. Silman,A. J,, Ollier, W., Holligan, S., Birrell, F.,Adebajo, A,, Asuzu, M. C., Thomson, W., and Pepper, L. (1993).Absence of rheumatoid arthritis in a rural Nigerian population. J. Rheumatol. 20(4), 618-622. Singal, D. P., Green, D., Reid, B., Gladman, D. D., and Buchanan, W. W. (1992). HLAD region genes and rheumatoid arthritis (RA): Importance of DR and DQ genes in conferring susceptibility to RA. Ann. Rheum. Dis. 51(l),23-28. Spies, T., Sorrentino, R., Boss, J. M., Okada, K., and Strominger, J. L. (1985).Structural
464
ROBERT WINCHESTER
organization of the DR subregion of the human major histocompatibility complex. Proc. Natl. Acad. Sci. U.S.A.82, 5165-5169. Sprent, J., Gao, E. K., and Webb, S. R. (1990). T cell reactivity to MHC molecules: Immunity versus tolerance. Science 248, 1357-1363. Stastny, P. (1976). Mixed lymphocyte cultures in rheumatoid arthritis. J. Clin. Inoest. 57, 1148. Stastny, P. (1978). Association of the B-cell alloantigen DRw4 with rheumatoid arthritis. N. Engl. J. Med. 298(16), P, 869-871. Stastny, P. (1980). Rheumatoid arthritis. In “Histocompatibility Testing 1980’ (P. I. Terasaki, ed.), pp. 681-686. UCLA Tissue Typing Laboratory, Los Angeles. Stastny, P., Olsen, N., Pincus, T., Khan, T., and Ball, E. J. (1989). DR4 and DR1 define different subsets of patients with rheumatoid arthritis. In “Immunobiology of HLA.” Vol 11. “Immunogenetics and Histocompatibility. Proceedings of the 10th Histocompatibility Workshop, Berlin” (B. Dupont, ed.), pp. 418-419. Springer-Verlag, Berlin. Steere, A. C., Dwyer, E., and Winchester, R. (1990). Association of chronic lyme arthritis with increased frequencies of DR2 and DR3. N. Engl. J. Med. 323(4), P, 219-223. Steers, G., McMahon, M. J., Grennan, D. M., and Hillarby, M. C. (1992). Lack of association of the a-1-antitrypsin PIZ allele with rheumatoid arthritis or with its extra articular complications. Dis.Markers 10(3), 151-157. Taneja, V., Mehra, N. K., Chandershekaran, A. N., Ahuja, R. K., Singh, Y. N., and Malaviya, A. N. (1992a). HLA-DR4-DQW8, but not DR4-DWQ7 haplotypes occur in Indian patients with rheumatoid arthritis. Rheumatol. lnt. 11(6),251-255. Taneja, V., Mehra, N. K., Kailash, S., Anand, D., and Malaviya, A. N. (1992b). Protective and risk DR phenotypes in Asian Indian patients with rheumatoid arthritis. Indian J . Med. Res. 96, 16-23. Taneja, V., Mehra, N. K., Singh, R. R., Anand, C., and Malaviya, A. N. (1993). Immunogenetics of familial rheumatoid arthritis: A study of 41 multicase fami1ies.J. Rheumatol. 20(2), 253-258. ten-Wolde, S., Breedveld, F. C., de-Vries, R. R., D’Amaro, J., Rubenstein, P., Schreuder, G. M., Claas, F. H., and van-Rood, J. J. (1993). Influence of non-inherited maternal HLA antigens on occurrence of rheumatoid arthritis; see comments. Lancet 341,(8839), 200-202. Thomsen, N., Morling, N., Snorrason, E., Svejgaard, A., and Sorensen, S. F. (1979). HLA-Dw4 and rheumatoid arthritis. Tissue Antigens 1 3 , 5 6 4 0 . Thomson, A. W., and Horne, C. H. W. (1980). Biological and clinical significance of pregnancy associated a2 glycoprotein (PAG). lnoest. Cell. Pathol. 3, 295. Tiwari, J. L., and Terasaki, P. I. (1985). HLA and disease associations, Springer-Verlag, New York. Toguchi, T., Burmester, G. R., Nunez-Roldan, A., Cregersen, P., Seremetis, S., Lee, S., Szer, I. S., Hurley, C. K., and Winchester, R. J. (1984). Evidence for the separate molecular expression of four distinct polymorphic la epitopes on cells of DR4 homozygous individuals. Hum. Immunol. 10, 69-81. Trowsdale, J., Ragoussis, J., and Campbell, R. D. (1991). Map to the human MHC. lmmunol. Today 12,443-446. Tsuchiya, K., Nishimura, Y., and Sasazuki, T. (1992). Contribution of genetic factors to RA. Nippon-Rinsho 50(3), 438-443. (In Japanese). van Zeben, D., Hazes, J. M., Zwinderman, A. H., Cats, A., Schreuder, G. M., D’Amaro, J., and Breedveld, F. C. (1991). Association of HLA-DR4 with a more progressive disease course in patients with rheumatoid arthritis: Results of a followup study. Arthritis Rheum. 34,822-830.
SUSCEPTIBILITY T O RHEUMATOID ARTHRITIS
465
Walker, D. J., Burn, I. D., Griffiths, D., Roberts, D. F., and Stephenson, A. M. (1987). Linkage studies of HLA and rheumatoid arthritis. Arthritis Rheum. 30, 31-35. Wallin, J., Hillert, J., Olerup, O., Carlsson, B., and Strom, H. (1991). Association of rheumatoid arthritis with a dominant DRl/Dw4/Dwl4 sequence motif, but not with T cell receptor /3 chain gene alleles or haplotypes. Arthritis Rheum. 34, 1416-1424. Wang, J. H.,Mayambala, C., and Stastny, P. (1993). Association of HLA-DR subtypes with in-vitro IgM rheumatoid factor synthesis. Hum. Zmmunol. 37(Suppl. l ) , 68. [Abstract] Waters, F. J., Winchester, R. J., Nagase, F., Thorbecke, C . J., and Bona, C. A. (1984). Antigen presentation by murine and human cells to a murine T cell hybridoma: Demonstration ofa restriction element associated with an MHC class I1 determinant(s) shared by both species. Proc. N a t l . Acad. Sci. U.S.A.81, 7559-7563. Weyand, C. M.,Xie, C., and Goronzy, J. J. (1992). Homozygosity for the HLA-DRB1 allele selects for extraarticular manifestations in rheumatoid arthritis. J . Clin. Inoest. 89(6), 2033-2039. Willkens, R. F., Nepom, G. T., Marks, C. R., Nettles, J. W., and Nepom, B. S. (1991). Association of HLA-Dwl6 with rheumatoid arthritis in Yakima Indians: Further evidence for the “shared epitope” hypothesis. Arthritis Rheum. 34, 43-47. Winchester, R. (1994) Rheumatoid Arthritis in “Samter’s Immunologic Diseases,” 5th edition. (M. M. Frank, K. F. Austen, H. N. Claman, E. R. Unanue,eds),pp.2277-2430. Little Brown, Boston. Winchester, R., and Gregersen, P. K. (1988). The molecular basis of susceptibility to rheumatoid arthritis: The conformational equivalence hypothesis. Springer Semin. Zmmunopathol. 10, 119-139. Winchester, R., and Kunkel, H. G. (1979). The human Ia system. Ado. Immuraol. 28, 221-292. Winchester, R. J. (1977). B-Lymphocyte allo-antigens, cellular expression, and disease significance with special reference to rheumatoid arthritis. Arthritis Rheum. 20, 159-163. Winchester, R. J . (1981).Genetic aspects of rheumatoid arthritis. Springer Semin. Immunopathol. 4,89-102. Winchester, R. J . (1989). The major histocompatibility complex. In “Textbook ofRheuniatology” (W. N. Kelley, E. D. Harris, S. Ruddy, and C. B. Sledge, eds.), pp. 101-137. Saunders, Philadelphia. Winchester, R. J., Wernet, P., Winfield, J., Siegal, F., Bentwich, Z., and Kunkel, H. C. (1974). Lymphocyte populations in patients with rheumatoid arthritis and systemic lupus erythematosus: Occurrence of cold reactive anti-lymphocyte antibodies that interfere with the determination of surface markers. J. Clin. Inoest. 54, 1082. Winchester, R. J., Fu, S. M., Wernet, P., Kunkel, H . G., Dupont, B.,and Jersild, C. (1975). Recognition by pregnancy serums of non-HL-A alloantigens selectively expressed on B lymphocytes. J . E x p . Med. 141, 924. Woodland, D. L., Happ, M. P., Gollob, K. J., and Palmer, E. (1991). An endogenous retrovirus mediating deletion of a/3 T cells? Nature (London) 349, 529-530. Woodrow, J. C., Nichol, F. E., and Zaviropoulos, G. (1981). DR antigens and rheumatoid arthritis: A study of two populations. 87.Med. J . 283, 1287. Wooley, P. H., Griffin, J., Panayi, G. S.,Batchelor, J . R., Welsh, K., and Gibson, T. J . (1980).HLA-DR antigens and toxic reaction to sodium thiomalate and D-penicillamine in patients with rheumatoid arthritis. N . Engl. J . Med. 303, 300. Wordsworth, B. P.,and Salmon, M. (1992).The HLA class I1 component ofsusceptibility to rheumatoid arthritis. Bnillieres. Clin. Rheumatol. 6(2), 325-336.
466
ROBERT WINCHESTER
Wordsworth, B. P., Lanchbury, J . S., Sakkas, L. I., Welsh, K. I., Panayi, G. S., and Bell, J . I. (1989). HLA-DR4 subtype frequencies in rheumatoid arthritis indicate that DRBl is the major susceptibility locus within the HLA class I1 region. Proc. Natl. Acad. Sci. U.S.A.86, 10,049-10,053. Wordsworth, B. P., Stedeford, J., Rosenberg, W. M., and Bell, J. I. (1991). Limited heterogeneity of the HLA class I1 contribution to susceptibility to rheumatoid arthritis is suggested by positive associations with HLA-DR4, DR1 and DRwlO. f3r.J.Rheumatol. 30, 178-180. Wordsworth, P., Pile, K. D., Buckely, J. D., Lanchbury, J. S., Ollier, B., Lathrop, M., and Bell, J . I. (1992). HLA heterozygosity contributes to susceptibility to rheumatoid arthritis. Am. /. Hum. Genet. 51(3), 585-591. Yunis, J. J., Salazar, M., Deulofeut, R., Iglesias, A., Nates, J., Yunis, E., and Yunis, E. J. (1993). DRB1*0404 allele and rheumatoid arthritis in the Guambiano Amerindian tribe of Colombia. Hum. ImmunoE. 37(Suppl. l), 52JAbstractj Zoschke, D., and Segall, M. (1986). Dw subtypes of DR4 in rheumatoid arthritis: Evidence for a preferential association with Dw4. Hum. Immunol. 15, 118-124. This article was accepted for publication on 9 December 1993.
ADVANCES IN IMMUNOLOGY, VOL 56
Retrovirus-Induced B Cell Neoplasia in the Bursa of Fabricius PAUL E. NElMAN Fred Hutchinson Cancer Research Center and the Departments of Medicine and Pathology, University of Washington 98104
I. Introduction'
The bursa of Fabricius is a developmentally regulated lymphoid organ essential for normal B cell development in avians. The features of bursal structure and physiology relevant to this discussion have been reviewed (Weill and Reynaud, 1987). In summary, it is composed of about lo4repeating structural units called bursal follicles. The follicles contain about lo4surface immunoglobulin (1gM)-positivelymphocytes distributed either within a basement membrane-enclosed medulla containing a gut-derived epithelium (medulla) or in a cortex outside the basement membrane (diagrammed in Fig. 1). This collection of follicles develops within the folds of a diverticulum off the cloaca beginning about Day 10 of embryogenesis. It persists until bursal involution about 3 to 4 months after hatching. Based on ablation studies two essential functions of the bursa are expansion of the B cell mass and diversification of Ig genes ( Jalkanen et al., 1984).In chickens, bursal-dependent preimmune Ig light-chain gene diversification proceeds by a gene conversion mechanism involving sequence donation from variable ( V ) region pseudogenes to a single functional V region (Reynaud et al., 1987) in a rearranged Ig allele which has undergone V-J joining (Thompson and Neiman, 1987).Ig heavy-chain gene preimmune diversification employs the same mechanism (Reynaud et al., 1989). All bursal lymphocytes undergo the same initial V region rearrangements making it possible for conversion-mediated sequence diversification of V regions to be monitored in whole bursal populations by restriction endonuclease digestion (Reynaud et al., 1985; Thompson and Neiman, 1987).This property has contributed to the analysis of neoplasms arising within this organ (Thompson et id., 1987). The induction of neoplasms within bursal follicles has proven to be an informative experimental system over the past 9 decades. Study of this process, in the context of these specific features of B cell development, has provided seminal insights into mechanisms of neoplastic
'
This review is dedicated to the memory of Eric H. Huniphries, who contributed greatly to the development of this field. 467 Copyright 0 1994 by Academic Press, loc. 111 any form reserved.
All rights of reproduction
468
PAUL E . NEIMAN
Gut Associoted
GUT LUMEN FIG. 1. Diagram of the architecture of a bursa1 follicle. Bursa1 lymphocytes are distributed in cortical and medullary zones separated by a basement membrane. The epithelium of the medulla is derived from the gut epithelium. The mouth of the follicle opens into the lumen of the bursa which, in turn, communicates with the cloaca.
disease, for example, into viral origins and the role of oncogenes. This review summarizes the history of and current concepts derived from analysis of neoplastic change in the bursa. II. Origins of Research
“Lymphosarcomatosis” in chickens was first recorded in 1868 (Roloff, 1868), classified within a complex of tumors called “lymphoid leukosis” by the first decade of this century (Burmester and Purchase, 1979),and first successfully transmitted by a filterable agent by Ellerman and Bang in 1908. Although controversy continued concerning their etiology for several more decades, and separation from distinctly different virus-induced malignancies (such as herpesvirus-induced Marek’s disease) was not achieved until the 1960s (Biggs, 1964), research on these lymphomas in chickens was seminal to development of the field of tumor virology.
RETROVIRUS-INDUCED B CELL NEOPLASIA
469
Lymphoid leukosis was (and remains) a significant agricultural problem because of outbreaks in commercial chicken flocks. Therefore, research focused on the viral etiology with the hope of designing practical interventions. Demonstration of interference by avian leukosis viruses (ALV) with the replication of Rous sarcoma virus (Rubin, 1960) provided the initial method of screening chickens for the presence ofthe etiologic retroviruses widely endemic in commercial flocks. These viruses were shown to be maternally transmitted through infected eggs (Cottral et al., 1954; Burmester and Waters, 1955). This knowledge, in turn, led to the development of virus-free flocks by elimination of hens which produce infected eggs (Hughes et al., 1963). Such flocks were essential for most of the subsequent research on avian leukosis and sarcoma viruses. Recognition of the essential role of the bursa for the induction of lymphoid leukosis by ALV was achieved by studies demonstrating that bursectomy rendered chickens resistant to the development of this disease (Peterson et al., 1964, 1966). The earliest histological changes induced by infection of susceptible birds with etiologic virus occurred within bursal follicles followed by development of intrabursal neoplasms and disseminated metastasis, prominently to the liver (Cooper et al., 1960; Neiman et al., 1980a).Early solution hybridization studies showed that proviral DNA sequences specific for the infecting ALV were present in bursal follicles during the latent period between infection and the appearance of tumor as well as in the bursal lymphomas which subsequently developed (Neiman et al., 1975). Thus, in aggregate, this research carried out over many decades indicated that infection of bursal follicle cells by ALV initiated a multistage process culminating in a metastasizing malignant lymphoma. 111. Determinants of Susceptibility and Resistance
Domestic chickens (Gallusgallus)vary dramatically in their susceptibility to development of bursal lymphomas. One relatively straightforward set of genetic determinants involves inheritance of genes encoding cell-surface receptors for the envelope glycoproteins of ALV which are classified into subgroups based on neutralizing antibodies and patterns of interference (for sumary see Weiss et al., 1982). These receptors control the ability of virus to infect cell cultures, embryonated eggs, and hatched chickens (Hanafusa et al., 1964; Crittenden and Okazaki, 1965; Hanafusa, 1965). Most field strains of ALV, and many laboratory-maintained viruses, are of subgroups A or B (or complex mixtures) and are fully infectious for the inbred chickens
470
PAUL E. NEIMAN
used for experimental work. In principle immunity to ALV could be another determinant of susceptibility. Infected chickens can develop antibodies to the exogenous viruses, and complex relationships have been described between expression of subgroup E endogenous (genetically transmitted) retroviruses, the immune response to infection by exogenous ALV, and subsequent development of lymphoma (Smith and Fadly, 1988).Nevertheless the role of viral immunity in the development of bursal lymphomas remains to be fully defined, and effective vaccination with viral antigens against bursal lymphomas has not been achieved (Burmester and Purchase, 1979). Of potentially great interest is a genetically controlled level resistance to the development of lymphomas which is independent of control of infection of the bird by ALV. By reciprocal transplants of bursal lymphocytes between inbred strains of chickens that are either highly sensitive or highly resistant to ALV-induced lymphoma, Purchase et al. (1977) were able to demonstrate that this postinfection genetic resistance was expressed in the target lymphocytes of the bursa. Genes of the chicken major histocompatibility (B) complex have been shown to influence dramatically the development of Marek’s disease virusinduced lymphomas (Briles et al., 1983; Crittenden, 1983)and progression of Rous sarcoma virus-induced tumors in chickens (Crittenden, 1983).However, B complex genes have not been shown to be primarily involved in this form of postinfection resistance to ALV-induced lymphomas. A promising lead to understanding the basis of genetic resistance derives from analysis of proteins controlling transcription from the promoter-enhancer of the ALV long-terminal repeat (LTR). Inhibition of protein synthesis in bursal lymphoma-derived cell lines specifically decreases transcription driven by ALV LTR promoter/enhancers (Linial et al., 1985).Among the proteins that bind enhancer elements in the LTR are DNA-binding factors which are short-lived in B cells but not in cells of other lineages (Ruddell et al., 1989). These proteins are thought to be the source of the lability of LTR-enhanced transcription found in bursal lymphomas and in normal prehatching bursa, marrow, and spleen from chickens susceptible to ALV-induced lymphomagenesis (Ruddell et al., 1988). A cDNA for one of these proteins which binds to CCAAT/enhancer elements in the LTR, al/EBP, has been cloned and found to be a novel member of the leucine zipper family of transcription factors (Bowers and Ruddell, 1992). A distinct second labile LTR-binding protein, a3/EBP, may b e closely related to a leucine zipper factor which binds the vitellogenin gene promoter (Bowers et al., 1993). Of relevance to this discussion is the observation that
RETROVIRUS-INDUCED B CELL NEOPLASIA
471
LTR-enhanced transcription is stable in all tissues from inbred chickens resistant to ALV-induced lymphoinagenesis (Ruddell et d., 1988) suggesting that factors controlling the stability of al/EBP, a3/EBP, and functionally related proteins may somehow underlie genetic resistance to induction of lymphomas. Epigenetic factors can also be important. For example androgenic hormones can decrease susceptibility to ALV-induced bursal lymphomas (Romero et al., 1978). In contrast, some vaccine strains of Marek’s disease virus markedly augment the incidence of ALV-induced bursal lymphomas within genetically susceptible but not resistant strains of chickens (Bacon et al., 1988). Immunization with these augmenting strains of Marek’s disease virus prolongs the period after hatching that chickens are susceptible to induction of bursal lymphomas by ALV (Fadly and Witter, 1993).Furthermore, bursal lymphoma cells, and a small subpopulation of normal bursal lymphocytes, are selectively susceptible to infection by Marek’s disease virus (Fynan et al., 1992). These observations suggest the possibility that selective activity of Marek‘s disease virus within the specific target cells for ALV-induced transformation in the bursa leads to enhanced tumorigenesis. Finally, susceptibility to lymphoma induction by ALV is developmentally regulated. Virus has to be introduced either during embryogenesis or within a few weeks after hatching, or else tumors do not develop despite extensive viral replication in the bird (Burmester et al., 1960; Maas et al., 1982). IV. Pathogenesis of ALV-Induced Bursa1 lymphomas
Development of neoplasms in the bursa follows a multistage course.
The first histologic changes after infection with ALV occur 4 to 8 weeks posthatching and are called transformed follicles (TF) (Cooper et al., 1960; Neiman et al., 1980a; Baba and Humphries, 1985). They consist
of replacement of the lymphoid population of a small number of follicles (l-lOO/bursa) with a monomorphic population of pyroninophilic lymphoblasts that are easily detected by staining sections with methyl green pyronin as shown in Fig. 2. The architecture of T F is not altered, and their constituent lymphoblasts do not grow outside of the follicle. Most of these follicles regress when the bursa regresses several months after hatching. In lymphoma-resistant strains of chickens the number of TF that occur is markedly reduced but not to zero (Baba and Humphries, 1984,1985). Therefore, TF represent ALV-induced preneoplastic lesions with a finite probability of progressing to malignant neoplasms within the lifespan of bursal follicles.
472
PAUL E. NEIMAN
Embryonic bursal follicles contain stem cells capable of reconstituting ablated follicles in transplantation experiments (Toivanen and Toivanen, 1973; EskolaandToivanen, 1974).The persistence oftransplantable stem cells corresponds closely to the period of sensitivity of bursal follicles to lymphoma induction. Moreover, transformed follicle cells have been shown to function very efficiently as bursal stem cells in transplantation experiments, although they reconstitute ablated follicles as preneoplastic TF rather than as normal follicles (Neiman et al., 1985; Thompson et al., 1987).Therefore, it is very likely that bursal stem cells are selective targets for the initiation of lymphogenesis by ALV. Bursal lymphomas arise from transformed follicles, sometimes forming fairly discrete intrabursal nodules (Neiman et al., 1980a) before metastasizing systemically, most prominently to the liver. By analysis of ALV proviral integration sites these tumors have been shown to be oligoclonal outgrowths (Neiman et al., 1980b). Immunoglobulin Vregion diversification by gene conversion continues within both TF and derivative lymphomas (Thompson et al., 1987). In some cases Jg gene diversification continues in immortalized cell lines established from these tumors (Buerstedde et al., 1990; Kim et al., 1990). In addition some of these bursal derived cell lines, particularly one called DT-40, carry out site-specific homologous recombination at rates approaching those of random or illegitimate recombination (Buerstedde and Takeda, 1991). The relationship at the molecular level, if any, between Ig gene conversion and the hyperrecombinogenic phenotype has not yet been established. Nevertheless this property makes bursal lymphoma-derived cell lines such as DT-40 useful for experiments requiring targeted recombination at any locus. V. Role of myc in Bursal Lymphomagenesis
A major advance occurred in the analysis of this tumor system, and in oncogene research in general, with the demonstration of the centrality of the myc protooncogene in the development of bursal lymphomas. The seminal observation was the detection, by Hayward, Astrin and colleagues (Hayward et al., 1981), of ALV proviral integration in DNA from bursal lymphomas upstream of c-myc, the cellular homologue of a viral oncogene. In these tumors transcription of c-myc was driven from a proviral promoter in an LTR sequence. The selection in these clonal neoplasms of ALV-induced events which resulted in the constitutive high-level expression of a gene with oncogenic potential strongly implicated c-myc in the development of bursal lymphomas.
RETROVIRUS-INDUCED B CELL NEOPLASIA
473
Within DNA isolated from fully developed tumors the activating insertion of a viral LTR can occur near either end of the c-myc locus, in either transcriptional orientation (Payne et al., 1982), and involve secondary intrachromosomal rearrangements (Nottenburg et al., 1987) and, rarely, the creation of a new myc-transducing retrovirus (Robinson and Gagnon, 1986). In the majority oftumors, however, LTR insertions occur within the first intron of the c-myc locus and produce transcripts containing the coding second and third exons of c-myc (Nee1 et al., 1982; Shih et al., 1984; Robinson and Gagnon, 1986). Furthermore, LTRs influencing c-myc transcription generally occur within an extensively deleted provirus (Westaway et d.,1984; Robinson and Gagnon, 1986; Boerkoel and Kung, 1992). The deletion and/or retention of specific viral sequences is thought to avoid transcriptional interference and permit the selected LTR to drive c-myc expression (Cullen et al., 1984; Boerkoel and Kung, 1992; Herman and Coffin, 1986). The time required for ALV to hit an integration site near c-myc, together with the time required for rearrangements affecting the efficiency of LTRdriven transcription, could account for the latent period between infection of the host and the outgrowth of transformed cells in the bursa. The enhanced transcription of c-myc in tumors is accompanied by overproduction of 62-kDa Myc phosphoprotein located in the tumor cell nucleus (Hann et al., 1983). Although mutations may be present in tumor cell c-myc gene products (Westaway et al., 1984), insertional activation of wild-type c-myc has also been demonstrated in bursal lymphomas. Therefore, altered regulation of c-myc expression is probably sufficient for the development of neoplasia (Hahn and Hayward,
1988).
Transcriptionally deregulated myc oncogenes can also be introduced in this system by infection of embryonic bursal cell populations ex vivo with retroviruses that transduce a v-myc gene (Enrietto et al., 1983) followed by transplantation of the infected population into recipient birds whose bursal follicle lymphoid populations have been ablated by treatment with cyclophosphamide (Eskola and Toivanen, 1974). Bursa1 stem cells present in the donor cell population clonally repopulate the ablated follicles (Pink et al., 1985). Where the progeny of these repopulating stem cells express the transduced v-myc gene they form classical transformed follicles indistinguishable from the preneoplastic lesions which appear following infection with ALV (Neiman et al., 1985; Thompson et al., 1987). The lymphoblastic cells making up these TF, as mentioned, exhibit the cardinal properties of bursal stem cells including efficient reconstitution of bursal follicles (as TF) in secondary transplantation assays and diversification of Ig
474
PAUL E . NEIMAN
gene V regions b y conversion at a rate comparable to that of normal bursal follicles (Thompson et al., 1987). These myc-induced bursal stem cells, however, do not disappear after hatching like normal bursal stem cells. Furthermore, they lose their ability to reconstitute bursal follicles in serial transplant experiments and give rise to invasive bursal lymphomas at a rate approximating one in every lo7 cell divisions within the preneoplastic population (Neiman et al., 1988).These observations give rise to a model, illustrated in Fig. 3, which suggests that the role of deregulated myc expression is to produce, selectively, a maturation arrest at the stem cell stage of bursal development, to permit or drive the replication of these stem cells, and, directly or indirectly, to establish a state of genetic instability. This state, in turn, leads to further genetic changes underlying progression to fully developed neoplasia. The reason for the selective sensitivity of bursal stem cells to the effects of myc deregulation is not immediately apparent. As shown in Fig. 4, a reverse transcriptase-polymerase chain reaction (RT-PCR) technique demonstrated that overexpression supplied by an exogenous v-myc gene shuts off the expression endogenous c-myc in the arrested stem cells (TF cells). It is conceivable that this downregulation of c-myc reflects a physiological requirement for maturation past the stem cell stage in the bursa, perhaps a transient period of quiescence which is incompatible with continued high-level myc expression. An understanding at the molecular level of how rnyc oncogenes accomplish these changes remains a major challenge. Extensive analysis of rnyc deregulation in other tumors, which followed the initial findings in the avian bursa, implicated myc in many other animal and human neoplasms (for review see Cole, 1986).Moreover, rnyc appears to be generally important in the molecular biology of normal as well as neoplastic cellular proliferation (reviewed in Spencer and Groudine, 1991; Marcu et al., 1992) and in gene-directed (apoptotic) cell death (Askew et al., 1991; Neiman et al., 1991; Evan et al., 1992). Myc protein forms heterodimers through helix-loop-helix and leucine zipper domains with a partner called Max and these heterodimers bind specifically to DNA with a core “E box” CACTGT sequence (Blackwood and Eisenman, 1991). Binding of Myc/Max heterodimers to this sequence in promoter regions can stimulate transcription of experimental target gene constructs (Kretzner et al., 1992).While the relevant physiological target genes, or other regulatory elements, for Myc/Max DNA binding remain to be defined, this progress provides a solid basis for further highly revealing analysis of the molecular mechanisms underlying myc-controlled phenotypes.
RETROVIRUS-INDUCED B CELL NEOPLASIA
475
Embryonic follicles
@
Activation
@
FIG.3. Model of normal and myc-induced neoplastic change in the bursa based on references in text. Normal follicles before hatching are filled with a population of proliferating large lymphohlasts including a small compartment of transplantable stem cells (shown in diagram with dark cytoplasm). Following hatching the stem cell compartment disappears, and the follicles are filled with smaller lymphocytes undergoing activation. When deregulated myc is expressed in the stem cell compartment differentiation is arrested and preneoplastic stem cells proliferate and fill the follicles (transformed follicles, TF). The T F cells persist abnormally after hatching within follicles and, at a rate of about 1/107 cell divisions, give rise to bursa1 lymphomas which can invade and grow outside the follicle.
476
P A U L E. NEIMAN
FIG.4. Suppression of normal c-myc expression in TF cells. The charts at the top show the structure of c-myc RNA and the RNA of the avian myelocytomatosis virus HB1 (Enrietto et al., 1983) used to introduce v-myc and induce TF. The position of sequences corresponding to coding (shaded) or noncoding (open) exons are shown as boxes. The position of primers used for RT-PCR amplification of c-myc-specific exon 1, and of exon 3 sequences common to both c-myc and v-myc, are shown by arrows. The distinct sizes of these PCR products is given, and the asterisk marks the position of 32P-labeled probes used to detect these products by Southern blot hybridization analysis shown in the panels. Lanes marked myc-1 and myc-3 show plasmid controls for exon 1and 3 products. The top panels show RT-PCR products detected with c-mycspecific (myc-1) and common (myc-3)probes from 1pg of total cellular RNA from normal bursa (NB) and three different preparations of T F cells (TF). c-myc mRNA is absent specifically in T F cells containing high levels of v-myc RNA. The left lower panel shows analysis with the c-myc-specific (myc-1) probe of RNA from normal chick fibroblasts (N. Fib) and four different types of cells (Fib, fibroblasts; EN, endothelioma; My, myelocytoma; Ly, extra bursal lymphoma) transformed by the v-myc-transducing virus, HB1. The lower right panel shows the same analysis with RNA from REV-induced bursal cell lines from normal bursa (REVNB) and from T F cells expressing low levels of HBl v-myc RNA (REVTF-32) and high levels of v-myc RNA (REVTF-38 and -26). In all cases high levels of v-myc RNA expression apparently shut off c-myc expression.
RETROVIRUS-INDUCED B CELL NEOPLASIA
477
VI. Role of Other Genes (bic, re/, myb) in Tumorigenesis and B Cell Transformation
Obvious questions arising from the foregoing discussion are the following: what additional genes are involved in causing myc-induced preneoplasia to progress to invasive bursal lymphomas, and what is the mechanism of genetic instability that alters their expression? Additional retroviral integration events provide one such pathway for generating additional oncogenic genetic changes. A second clonally selected ALV integration site at a locus called bic has been detected in a fraction of bursal lymphomas (Clurman and Hayward, 1989). Since bic was found to be rearranged more often in hepatic metastases (50%)than in primary bursal lymphomas (12%), it has been suggested that bic might play a role in metastatic progression. Mice expressing deregulated myc transgenes in B cells also undergo a process of multistage B cell lymphomagenesis beginning with a long period of preneoplastic pre-B cell proliferation in the bone marrow. Infection of these mice with Moloney leukemia virus (MoLV), a murine retrovirus analogous to ALV, significantly accelerates the rate of development of B cell tumors, and clonally selected MoLV integration sites found in these tumors define loci which are candidates for contributing to B cell tumor progression in this system (Haupt et d., 1991; Lohuizen et al., 1991). The several genes identified by this approach in mice (bmi1, pim-1 and 2, pal-1, bla-1, emi-1) have not been identified yet as contributing to chicken bursal lymphomas. Reticuloendotheliosis virus (REV) transduces the dominant oncogene v-rel and induces RE neoplasms in chickens and turkeys. Direct infection of bursal lymphocytes ex vivo by REV induces the rapid outgrowth of highly neoplastic B cell lines as a single-hit event (Barth and Humphries, 1988). Helper viruses (lacking v-rel) from the REV complex by themselves produce typical myc-dependent multistage bursal lymphomas (Boerkoel and Kung, 1992). In contrast the introduction of v-re1 by REV arrests the development of bursal B cells and freezes IgG rearrangement at any stage present at time of infection (Barth and Humphries, 1988). Activation of c-rel, the cellular homologue of v-rel, has not been observed in ALV-induced B cell tumors. ALV-induced rearrangement and high-level expression of c-myb, the cellular homologue of the oncogene of avian myeloblastosis virus (AMV),has been observed in bursal-derived B cell tumors. Disruption of the myb locus was described as mutually exclusive with respect cmyc rearrangements following a specific sequential infection protocol with two viruses (Clurman and Hayward, 1989) and as the product of
478
P A U L E. NEIMAN
early embryonic infection (10-12 day) with a single ALV (Pizer and Humphries, 1989). The histological appearance of the myb-induced tumors is said to differ from that of typical myc-induced neoplasms. Within the bursa the tumor cells appear to spread from follicle to follicle without architectural disruption of the bursa. Furthermore, protocols which will establish transplantable tumors and cell lines with myc- and rel-induced neoplasms apparently are ineffective for the myb-induced tumor cells (Pizer et al., 1992). The target cell in which c-myb has been activated in these tumors may be distinct from those giving rise to c-myc and v-rel-induced transformation. VII. Role of Apoptotic Cell Death
Whatever the identity of genes involved evidence indicates that suppression of apoptotic cell death is among the phenotypes required for progression of bursal neoplasms (Neiman e t al., 1991). Briefly summarized this evidence begins with the observation that bursal lymphocytes are exquisitely sensitive to the induction of apoptosis. Either whole-body y-radiation to about 500 R or dispersion as a single-cell suspension in short-term culture triggers the rapid onset of bursal cell death with morphological changes and internucleosomal DNA degradation characteristic of apoptosis. Death occurs within a few hours of induction in virtually the whole lymphoid population and depends on protein synthesis (i.e., inhibitors of protein synthesis inhibit bursal apoptosis). The sensitivity of bursal lymphocytes and stem cells to complete elimination by sublethal doses of the alkalating agent cyclophosphamide (Eskola and Toivanen, 1974),which forms the basis for bursal transplantation technology, probably depends on the induction of bursal apoptosis by this DNA-damaging agent. The lymphoblasts of myc-induced preneoplastic transformed follicles are hypersensitive to activation of the cell death pathway in that they die at lower doses of radiation, and with shorter delay periods after dispersal in culture, than do normal embryonic bursal cells. In contrast, invasive early bursal lymphomas growing between follicles, as well as lymphoma-derived cell lines, are strikingly resistant to radiation-induced apoptosis (Neiman et al., 1991).The suppression of cell death in these tumors and derivative cell lines may be an active process since inhibition of protein synthesis induces apoptosis in these cells. In summary, during the period of susceptibility to ALV-initiated lymphoma, the lymphoid population of the bursa is exquisitely sensitive to induction of cell death. Protection from apoptotic cell death is apparently mediated by signals from the cell surface which are easily
RETROVIRUS-INDUCED B CELL NEOPLASIA
479
interrupted by simple mechanical disruption of cell-cell contact. The preneoplastic effects of myc overexpression include an increased susceptibility to induction of cell death. One of the genetic requirements of tumor progression appears to be suppression of this propensity for cell death. This is hardly surprising since growth outside the bursal follicle, necessarily away from the signals which restrain the death pathway, defines neoplastic progression in this system. At present the genes and mechanisms underlying cell death and its suppression in the bursa are not defined. In vertebrates the bestdefined participants in regulation of apoptotic cell death are a small but growing family related to bcl-2. This gene was originally identified on human chromosome 18 and cloned from the breakpoint oft(14 : 18) translocations present in most human follicular B cell lymphomas (Cleary et al., 1986; Tsujimoto and Croce, 1986) which cause deregulated increases in bcl-2 transcription due to juxtaposition with the Ig heavy-chain locus on chromosome 14 (Bakhshi et al., 1985). Although the precise role of bcl-2 in these human lymphomas remains to be defined, inhibition of cell death appears to be its principal function. For example, overexpression of bcl-2 protects cultured hematopoietic cells and neurons from apoptotic cell death due to the withdrawal of growth factors (Vaux et al., 1988; Hockenbery et al., 1990; Nunez et al., 1990;Borzillo etal., 1992; Garciaet al., 1992).Similarly, overexpression of bcl-2 in vivo has been shown to protect against several forms of cell death during thymic (Sentman et at., 1991; Strasser et at., 1991) and neural (Allsopp et al., 1993) development. In the bursa bcl-2 is expressed early in embryonic development, but declines later in development and is low or absent by the time of hatching (Eguchi et al., 1992). Significantly, we have not been able to detect bcl-2 RNA in preneoplastic TF or bursal lymphomas with probes which easily detected characteristic 7-kb bcl-2 transcripts in gut, brain, and spleen from normal chickens (Neiman, unpublished). Thus, it seems unlikely that bcl-2 plays a role in suppressing cell death during neoplastic progression in the bursa. Two new bcl-2-related genes, bcl-x (Boise et al., 1993) and bax (Oltval et al., 1993), have been isolated which could be important in understanding regulation of cell death in normal and neoplastic bursal cells. Chicken bcl-x was isolated by screening bursal, spleen and thymic cDNA libraries, and a genomic library, with mammalian bcl-2 probes. This distinct gene shows a strong homology to first coding exon of murine bcl-2. This chicken bcl-x gene was expressed as a 2.7kb mRNA most strongly in thymus, bursa, and brain. Using chicken bcl-x probes human homologues of this gene were then isolated and
480
PAUL E. NEIMAN
characterized. Human bcl-x produces alternatively spliced messages encoding a long form (bcl-xL)with a strong homology to the a transcript of human bcl-2 and a shorter form (bcZ-xJ in which the domain of strong homology to bcl-2 has been deleted. Expression of bcl-xLin an interleukin-3 (IL3)-dependenthematopoietic cell line (mouse FLS. 12 cells) protects these cells from IL-3 withdrawal-induced apoptosis as well as or better than bcl-2. In contrast, expression of bcl-x, has no phenotype by itself but strongly inhibits the protective effects of bcl2 when the two genes are coexpressed in IL3-dependent cells. Adult brain expresses the highest levels of bcl-x,; while thymus and activated peripheral T cells express bcl-x,. The bar gene also shares extensive homology with bcl-2. It encodes a 21-kDa membrane-associated protein and two cytosolic forms. Bax protein forms homodimers and heterodimers with Bcl-2. The mRNAs for bax are widely expressed in many tissue types (including the FLS. 12 cell line). When Bax protein is overexpressed in FLS. 12 cells apoptosis induced by IL3 withdrawal is accelerated and the protective effects of Bcl-2 are diminished. These new findings indicate a family of bcl-2-related genes which can act as both positive and negative modulators of the cell death pathway, perhaps in a quantitative, combinatorial fashion. It is proposed that the response to a given cell death signal may be conditioned by a rheostat preset by the ratio of Bcl-2 to Bax in a given cell (Oltval et al., 1993).The expression of bcl-x, (or similar gene products yet to be identified) might explain the failure of bcl-2 to protect against cell death in specific circumstances (Nunez et al., 1990; Sentman et at., 1991; Strasser et al., 1991; Allsopp et al., 1993; Cuende et al., 1993). Determining whether there is a role for this family of genes in normal and neoplastic bursal development is an immediately relevant task.
VIII. Summary
The chicken bursa provides a revealing experimental model system which has helped unravel some of the mysteries surrounding induction of neoplasia by retroviruses lacking dominant viral oncogenes. Analysis of this system continues to provide opportunities for further insight into mechanisms underlying some of the essential characteristics of neoplastic change including maturation arrest, prolonged cell survival, and genetic instability. The deregulation of c-myc expression induced by nearby proviral integration appears to initiate preneoplastic change in a specific window of development, i.e., the bursal stem cell. The generation of large numbers of these preneoplastic stem cells, and the
RETROVIRUS-INDUCED B CELL NEOPLASIA
481
ability for further amplification by transplantation technology, may provide an opportunity to address questions such as how and why myc oncogenes produce preneoplastic maturation arrest or why stem cells are selective targets for these effects. Among the unexplained consequences of this preneoplastic state appears to be genetic instability which leads, inevitably, to formation of invasive bursal neoplasms. It is at least conceivable that the observed myc-induced enhancement of the remarkable capacity for apoptotic cell death present in bursal cells plays a role in this instability. DNA strand breakage is a very early feature of bursal cell apoptosis. If such breakage could occur in sublethal form it might provide a mechanism for increased frequency of genetic change (deletions, rearrangement, and recombination). Among the changes that seem required for successful tumor cell growth outside of follicles is the suppression of cell death induced by loss of cell-cell contact which is characteristic of normal and preneoplastic bursal cells. Several genes in the bcl-2 family are potentially important in the modulation of cell death events central to the evolution of these neoplasms. Their role, if any, remains to be established. ACKNOWLEDGMENT Work referenced to the author and shown in the figures was supported by grants CA 20068 and CA 57215 from the National Cancer Institute.
REFERENCES Allsopp, T. E., Wyatt, S., Paterson, H. F., and Davies, A. M . (1993).Cell (Cambridge, Mass.) 73, 295. Askew, D. S., Ashmun, R. A., Simmons, B. C., and Cleveland, J. L. (1991). Oncogene 6, 1915. Baba, T. W., and Humphries, E. H. (1984).Virology 135, 181. Baba, T. W., and Humphries, E. H. (1985). Proc. Natl. Acad. Sci. U.S.A. 82,213. Bacon, L. D., Witter, R. L., and Fadly, A. M. (1988).J. Virol. 63,504. Bakhshi, A., Jensen, J. P., Goldman, P., Wright, J. J., McBride, 0. W., Epstein, A. L., and Korsmeyer, S. J. (1985).Cell (Cambridge, Mass.) 41, 899. Barth, C. F., and Humphries, E. H. (1988). Mol. Cell. Biol. 8, 5358. Biggs, P. M. (1964). Worlds Poult. Sci. J . 20, 78. Blackwood, E. M., and Eisenman, R. N. (1991).Science 251, 1211. Boerkoel, C. F., and Kung, H . J. (1992).J . Virol. 66, 4814. Boise, L. H., Gonzalez-Garcia, M., Posterna, C. E., Ding, L., Lindsten, T., Turka, L. A,, Mao, X., Nunez, G., and Thompson, C. B. (1993). Cell (Cambridge, Mass.) 74, 597. Borzillo, G. V., Endo, K., and Tsujimoto, Y. (1992).Oncogene 7, 869. Bowers, W. J., and Ruddell, A. (1992).J . Virol. 66, 6578. Bowers, W. J., Petrosino, J. F., Smith, C. D., and Ruddell, A. (1994).Leukemia, in press. Briles, W. E., Briles, R. W., Taffs, R. E., and Stone, H. A. (1983). Science 219, 977. Buerstedde, J.-M., and Takeda, S. (1991).Cell (Cambridge, Mass.) 67, 179. Buerstedde, J.-M., Reynaud, C.-A., Humphries, E. H., Olsen, W., Ewart, D. L., and Weill, J. C. (1990).E M B O ] . 9, 921.
482
PAUL E. NEIMAN
Burmester, B. R., and Purchase, G. H. (1979). Avian Dis. 23, 1. Burmester, B. R., and Waters, N. F. (1955). Poult. Sci. 34, 1415. Burmester, B. R., Fontes, A. K., and Walter, W. G. (1960).J . Natl. Cancer Inst. 24, 1423. Cleary, M. L., Smith, S. D., and Sklar, J. (1986). Cell (Cambridge, Mass.) 47, 19. Clurman, B. E., and Hayward, W. S. (1989). Mol. Cell. Biol. 9,2657. Cole, M. D. (1986).Annu. Rev. Genet. 20, 361. Cooper, M. D., Payne, L. N., Dent, P. B., Burmester, B. R., and Good, R. A. (1960). J . Natl. Cancer Inst. 41, 373. Cottral, G. E., Burmester, B. R., and Waters, N. F. (1954). Poult. Sci. 33, 1174. Crittenden, L. B. (1983). Avian Pathol. 12, 1. Crittenden, L. B., and Okazaki, W. (1965).J.Natl. Cancer Inst. 35,857. Cuende, E., Ales-Martinez, J . E., Ding, L., Gonzalez-Garcia, M., Martinez, A. C., and Nunez, G. (1993). EMBOJ. 12, 1555. Cullen, B. R., Lomedico, P. T., and Ju, G. (1984). Nature (London) 307, 241. Eguchi, Y., Ewart, D. L., and Tsujimoto, Y. (1992). Nucleic Acids Res. 20,4187. Ellerman, V., and Bang, 0. (1908).Zentralbl. Bakteriol. parisitenk Znfektionskrankh. Hyg. 46, 595. Enrietto, P. J., Payne, L. N., and Hayman, M. J. (1983). Cell (Cambridge, Mass.) 35, 369. Eskola, J., and Toivanen, P. (1974). Cell. Imrnunol. 13, 459. Evan, G. I., Wyllie, A. H., Gilbert, C. S., Littlewood, T. D., Land, H., Brooks, M., Waters, C. M., Penn, L. Z., and Hancock, D. C. (1992).Cell (Cambridge, Mass.) 69, 119. Fadly, A. M., and Witter, R. L. (1993). Avian Pathol. 22, 565. Fynan, E., Block, T. M., DuHadaway, J., Olson, W., and Ewart, D. L. (1992).J. Virol. 66, 5860. Garcia, I., Martinou, I., Tsujimoto, Y., and Martinou, J.-C. (1992). Science 258, 302. Hahn, M., and Hayward, W. S. (1988). Mol. Cell. Biol. 8, 2659. Hanafusa, H. (1965). Virology 25,248. Hanafusa, H., Hanafusa, T., and Rubin, H. (1964).Proc. Natl. Acad. Sci. U.S.A. 51,41. Hann, S. R., Abrams, H. D., Rohrschneider, L. R., and Eisenman, R. N. (1983). Cell (Cambridge, Mass.) 34, 789. Haupt, Y., Alexander, W. S., Barri, G., Klinken, S. P., and Adams, J. M. (1991). Cell (Cambridge, Mass.) 65, 753. Hayward, W. S., Neel, B. G., and Astrin, S. M. (1981). Nature (London) 290,475. Herman, S. A., and Coffin, J. M. (1986).J. Virol. 60,497. Hockenbery, D., Nunez, G . , Milliman, C., Schreiber, R. D., and Korsmeyer, S. J. (1990). Nature (London) 348, 334. Hughes, W. F., Watanabe, D. H., and Rubin, H. (1963). Avian Dis. 7, 154. Jalkanen, S., Jalkanen, M., Granfors, K., and Toivanen, P. (1984).Nature (London)311, 69. Kim, S., Humphries, E. H., Tjoelker, L., Carlson, L., and Thompson, C. B. (1990). Mol. Cell. Biol. 10, 3224. Kretzner, L., Blackwood, E. M., and Eisenman, R. N. (1992).Nature (London)359,426. Linial, M., Gunderson, N., and Groudine, M. (1985). Science 230, 1126. Lohuizen, M., Verbeek, S., Scheijen, B., and Wientjens, E. (1991). Cell (Cambridge, Mass.) 65, 737. Maas, H. J. L., Deboer, G. F., and Groenend, J. E. (1982).Avian Pathol. 11, 309. Marcu, K. B., Bossone, S. A., and Pate, A. J. (1992). Ann. Rev. Biochem. 61, 801. Neel, B. G., Gasic, G. P., Rogler, C. E., Skalka, A. M., Ju. G., Hishinuma, F., Papas, T., Astrin, S. M., and Hayward, W. S. (1982).J. Virol. 44, 158.
RETROVIRUS-INDUCED B CELL NEOPLASIA
483
Neiman, Gehly, E. B., Carlson, L. M., Cotter, R. C., and Thompson, C. B. (1988). Curr. Topics Microbiol. Zmmunol. 141, 67. Neiman, P. E., Purchase, H. C., and Okazaki, W. (1975). Cell (Cambridge, Mass.) 4, 311. Neiman, P. E., Jordan, L., Weiss, R. A. and Payne, L. N. (1980a). In “Cold Spring Harbor Conferences on Cell Proliferation: Viruses in Naturally Occurring Cancer.” (M. Essex, G. Todaro, and H. Zur Hausen, eds.), Vol. 7, pp. 519-528. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Neiman, P., Payne, L. N., and Weiss, R. A. (1980b). J. Virol. 34, 178. Neiman, P., Wolf, C., Enrietto, P. J., and Cooper, G. M. (1985). Proc. Natl. Acad. Sci. U.S.A. 82, 222. Neiman, P. E., Thomas, S . J., and Loring, G. (1991). Proc. Natl. Acad. Sci. U.S.A. 88, 5857. Nottenburg, C., Stubblefield, E., and Varmus, H. E. (1987). J. Virol. 61, 1828. Nunez, G . ,London, L., Hockenbery, D., Alexander, M., McKearn, J. P., and Korsmeyer, S. J. (1990).J . Immunol. 144, 3602. Oltval, Z. N., Milliman, C. L., and Korsmeyer, S . J. (1993). Cell (Canzbridge, Mass.) 74, 1. Payne, G . S., Bishop, J. M., and Varmus, H. E. (1982). Nature (London)295, 209. Peterson, R. D. A., Burmester, B. R., Frederickson, T. M., Purchase, H. G., and Good, R. A. (1964).J. Natl. Cancer Znst. 32, 1343. Peterson, R. D. A., Purchase, H. G., Burmester, B. R., Cooper, M. D., and Good, R. A. (1966).J . Natl. Cancer Znst. 36, 5855. Pink, J. R., Vainio, O., and Rijnbeek, A.-M. (1985). Eur. J . Immunol. 15, 83. Pizer, E., and Humphries, E. H. (1989).J . Virol. 63, 1630. Pizer, E. S., Baba, T. W., and Humphries, E. H. (1992).J. Virol. 66, 512. Purchase, H. G., Gilmour, D. C., Romero, C. H., and Okazaki, W. (1977).Nature (London) 270,61. Reynaud, C.-A., Anquez, V., Dahan, A., and Weill, J.-C. (1985). Cell (Cambridge, Mass.) 40, 283. Reynaud, C.-A,, Anquez, V., Grimal, H. and Weill, J.-C. (1987).Cell (Cambridge, Mass.) 48, 379. Reynaud, C . A,, Dahan, A,, Grimal, H., and Weill, J.-C. (1989). Cell (Cambridge, Mass.) 59, 171. Robinson, H. L., and Gagnon, G. C. (1986).J. Virol. 57, 28. Roloff, F. (1868). Mag. f . Tierheilkde 34, 5190. Romero, C. H., Purchase, H. G., Frank, F., Crittenden, L. B., and Chang, T. S . (1978). Avian Pathol. 7, 87. Rubin, H. (1960). Proc. Natl. Acad. Sci. U.S.A. 46, 1105. Ruddell, A., Linial, M., Schubach, W., and Groudine, M. (1988).J . Virol. 62, 2728. Ruddell, A., Linial, M., and Groudine, M. (1989). Mol. Cell. B i d . 9, 5660. Sentman, C. L., Shutter, J. R., Hockenberry, D., Kanagawa, O., and Korsmeyer, S. J. (1991). Cell (Cambridge, Mass.) 67, 879. Shih, C. K., Linial, M., Goodenow, M. M., and Hayward, W. S . (1984). Proc. Natl. Acad. Sci. U.S.A. 81, 4697. Smith, E. J., and Fadly, A. M. (1988).Poult. Sci. 67, 1674. Spencer, C. A,, and Groudine, M. (1991). Ado. Cancer Res. 56, 1. Strasser, A., Harris, A. W., and Cory, S . (1991). Cell (Cantbridge, Mass.) 67, 889. Thompson, C. B., and Neiman, P. E. (1987). Cell (Cambridge, Mass.) 48,369. Thompson, C. B., Humphries, E. H., Carlson, L. M., Chen, C.-L. H., and Neiman, P. E. (1987). Cell (Cambridge, Mass.) 51, 371.
484
PAUL E. NEIMAN
Toivanen, P., and Toivanen, A. (1973). Eur. J. Immunol. 3, 585. Tsujimoto, Y., and Croce, C. M. (1986). Proc. Natl. Acad. Sci. U.S.A. 83,5214. Vaux, D.L., Cory, S., and Adams, J. M. (1988). Nature (London)335,440. Weill, J.-C., and Reynaud, C.-A. (1987). Science 238, 1094. Weiss, R., Teich, N., Varmus, H., and Coffin, J. (1982). “Molecular Biology of Tumor Viruses: RNA Tumor Viruses, pp. 57-68. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Westaway, D., Payne, G., and Varmus, H. E. (1984). Proc. Natl. Acad. Sci. U.S.A. 81, 843. This article was accepted for publication on 9 December 1993.
FIG.2. Norinal bursal follicle (right) and preneoplastic-transformed follicle (left). Methyl green pyronin stain of bursal sections at 210x niapfication was prepared 4 weeks after hatching.
INDEX
A Abelson-murine leukemia virustransfected cells, rearrangement by V(D)J joining of antigen receptor genes, 48-49 Adriamycin antitumor activity, 333-334 monoclonal antibody conjugation procedure, 334-336,338 Adult respiratory distress syndrome, therapeutic regulation of complement system in clinical studies, 278-279 inhibition using soluble CR1,284-286 Alkylating agent-antibody conjugates, as cancer treatment chlorambucil, 328-330 cis-platinum, 329,332 melphalan, 329-331 mitomycin C, 329,332-333 phenylenediamine mustard, 329,331 properties, 328-329 structure, 328-329 trenimon, 329,331-332 Alleles MHC class 11, rheumatoid arthritis susceptibility associated with ethnic differences, 409-410 penetrance influenced by, 440-441 properties, 444-446 risk for severe disease, 441-444 Allelic exclusion, T cell receptor p-chain, in control of thymocyte by p56lCk,164-166 Aminopterin, in cancer treatment, monoclonal antibody conjugation procedure, 342 Anhydrides cis-aconitic, in conjugation procedure for chemoimmunoconjugates in cancer treatment, 318-319 mixed, in conjugation procedure for chenioimmunoconjugates in cancer treatment, 319
Anthracycline-antibody conjugates, as cancer treatment direct conjugation C-14 methyl group, 336 hydroxyl group, 336-337 keto group, 337 sugar amino group, 334-336 sugar moiety, 334 intermediary carriers dextran, 337-338 polyglutamatic acid, 338 properties, 333-334 structure, 333-334 Antibodies human antimouse, immune response, chemotherapy limited by, 304,
358-360
monoclonal, see Monoclonal antibodies to rabbit molecules, 182-183 trimolecular complex anti-alp T cell receptor antibody,
228-229
anti-CD3 antibody, 220-223 anti-CD4 antibody, 223-228 anti-T cell receptor Vp antibody,
229-233
Antibody repertoire, generation in rabbit B lymphocyte development B lymphopoiesis, 180-186 immune response ontogeny,
186-187,209
development of repertoire contributing factors, 194-195 somatic gene conversion, 198-202 somatic mutation, 201,203 VH allotype, 195 VE5 usage, 195-198 gut-associated lymphoid tissue as bursa1 equivalent, 204 follicular structure, 203 germfree rabbits, 204-206 model, 206-209 immunoglobulin genes CHI 191-193
485
486
INDEX
D, 189-191 188-191
JH,
K
light-chain, 193-194
X light-chain, 194
organization, 187-188 VH,
188-191,195-198
mechanism, 179-180,209 Antigen receptor genes, V(D)Jjoining of, see V(D)Jjoining, of antigen receptor genes Antigens carcinoembryonic, monoclonal antibody use in identification, 305 HLA, polymorphisms, rheumatoid arthritis susceptibility associated with remission during pregnancy, 431 testing, 432-433 toxicity, 431-432
MHC
blocking by analogs in trimolecular complex, 244-247 rheumatoid arthritis susceptibility associated with concepts, 390-397 determinants, 400-402
DR1,420-426 DR6,419-420,426 DR10,424-427,429
function influenced by structure,
45 1
function of molecules, 449-450 genetic studies, 436-438 mapping region, 418-419 polymorphism, 398-399 terminology, 390-397 MHC class Ia molecules, as trimolecular complex target,
247-250 MHC class 11, rheumatoid arthritis susceptibility associated with alleles, 429-430
DR4,404-408,420-426 Dw determinants, 407-408 serologic identification, 402-404 peptide, in trimolecular complex features, 239,250-251 MHC blockers, 244-247 peptide determinant as tolerogen,
240-244
T cell antagonists, 244-247 peptide antigen X, rheumatoid arthritis susceptibility role, 455 tumor-associated heterogeneity as barrier to antibodytargeted chemotherapy, 352-354 monoclonal antibody use in identification, 305-306 Appendix, germinal centers, in rabbit, rearrangements of VDJ genes, 204 ARDS, see Adult respiratory distress syndrome Arthritis, rheumatoid, see Rheumatoid arthritis Avian leukosis virus B cell neoplasia induced by myb gene role, 477-478 myc gene role, 472-473 resistance determinants, 470-471 susceptibility determinants, 469-471
pathogenesis of bursa1 lymphomas induced by, 471-472 mechanism, 469
B
B cell-associated nuclease, as truncation factor in V(D)Jjoining, 80 B cell neoplasia, retrovirus-induced, in
avian bursa of fabricius, see Bursa of fabricius, avian B cells antibody repertoire generation in rabbit GALT, 205-209 immune response ontogeny,
186-187,209
immunoglobulin gene rearrangements, 189- 192 lymphopoiesis, 180-186 somatic mutation, 203 interleukin-10 biological effects, 10-1 1 V(D)Jjoining of antigen receptor genes, rearrangement, 47,49 pre-B cells, 47, 49 B lymphocytes, see B cells Bone marrow, rabbit, rearrangements of VDJ genes, 184
INDEX
Bursa of fahricius, avian retrovirus-induced B cell neoplasia analytical views, 480 apoptotic cell death, role of, 478-481 avian leukosis virus-induced lymphoma, pathogenesis, 471-472 bic role, 477 myb role, 477-478 myc role, 472-478,481 research origins, 468-469 re1 role, 477-478 resistance and susceptibility determinants, 469-471 structure, 467-468
C Cancer, treatment with chemoimmurioconjugates, see Chemoimmunoconjugates as cancer treatment Carbodiimides, in crosslinkage procedure for chemoimniunoconjugates in cancer treatment, 316-318 Carcinoemhryonic antigen, monoclonal antibody recognition, 305 Cardiopulmonary bypass, therapeutic regulation of complement system in, 279-280 Chemoimmunoconjugates as cancer treatment, see also Alkylating agent-antibody conjugates; Anthracycline-antibody conjugates barriers to antibody-targeted chemotherapy biodistrihution, 348 effects of, 347-348 route of administration, 348-350 tumor antigen-heterogeneity, 352-354 tumor perfusion, 350-352 tumor vasculature, 350-352 chemistry conjugation procedure, 312-314,360 conjugation strategies, 314-323 design strategy, 324-325 intermediary carriers, 323-324
487
carbodiimides, 316-3 18 cis-aconitic anhydride, 318-319 cyanuric chloride, 321 diazo reaction, 319 ester linkage, 323 glutaraldehyde, 315 hydrazone linkage, 322-323 i m i doesters,320-32 1 mixed anhydrides, 319 noncovalent bonds, 321-322 periodate oxidation, 315-316 photoactivation, 323 N-succinimidyl 3-(2-pyridyldithio) propionate, 319-320 thioether linkage, 321-322 clinical trials, 354-361 drug-monoclonal antibody conjugates alkylating agent-antibody, 328-333 anthracycline-antibody, 333-338 antineoplastic drugs, 313 cytotoxic drugs, 342-343 folic acid antagonists, 338-340 functional studies, 344-347 mode of action, 344-347 morphological studies, 347 preclinical testing studies, 343 in uitro activity, 326 in uiuo activity, 326-328 vinca alkaloids, 340-342 monoclonal antibodies as carriers conjugate size as determinant of permeability, 310-311 development, 302-304 heterogeneity, 306-308 immunogenicity, 311-312 internalization, 308-310 localization, 306-308 modulation, 308-310 specificity, 305-306 targets, 305-306 toxicity, 311-312 studies, 360-361 Chemotherapy, targeted, concept of, 301-303 Chickens, retrovirus-induced B cell neoplasia in bursa of fabricius research, 468-469 resistance, 470 susceptibility, 469-470
488 transformed follicles in lymphomaresistant strains, 471 Chlorambucil, chemotherapeutic use in cancer treatment, 328-330, 344-345 Chromatin, configuration during V(D)J joining of antigen receptor genes, 37,41-46 Chromosomes, interchromosomal recombination during V(D)J joining of antigen receptor genes, 120-121 cis-Aconitic anhydride, in chemoimmunoconjugation, 315-316 cis-Platinum, in cancer treatment, 329, 332 Clones, cDNA, for interleukin-l0,3-5 Complement system, therapeutic regulation in acute injury states activation clinical assessment, 270-271 clinical injury, 278-281 intrinsic regulation, 271-274 mechanisms, 267-270 ARDS, 278-279 cardiopulmonary bypass, 279-280 C1 esterase inhibitor, 272 clinical injury, 278-281 deficiency states, 277-278 hemodialysis, 278-279 leukocyte interaction, 274-277 sepsis, 281-282 septic shock, 281-282 study approaches, 267 therapeutic inhibition with fungal products, 288-289 heparin, 287-288 soluble CR1 ARDS, 284-286 ischemia, 282-284 local injuries, 286 range of use, 289 reperfusion, 282-284 tissue transplantation, 286-287 thermal injury, 280-281 Complement receptors CR1, in therapeutic complement activation, 274-277 CR3, leukocyte interactions, 276-277 soluble CR1, in therapeutic complement inhibition, 284-286
INDEX
ischemia, 282-284 local injuries, 286 range of use, 289 reperfusion, 282-284 tissue transplantation, 286-287 Cyanuric chloride, linkage procedure for chernoimmunoconjugates in cancer treatment, 321 Cytokines, TH2, functional similarities to interleukin-10, 12-13 Cytokine synthesis inhibitory factor, see also Interleukin-10 discovery, 1-2
D Daunomycin, in cancer treatment antitumor activity, 333-334 functional studies, 345 monoclonal antibodiy conjugation, 334-336,338 Decay-accelerating factor, therapeutic complement activation role, 273-274 Dextran, as intermediate carrier in anthracycline-antibody conjugation, 337-338 Diazo reaction, as procedure for chemoimmunoconjugation, 319 DNA complementary, clones, for interleukin-l0,3-5 and rabbit antibody repertoire B cell rearrangements, 190-192 probes to molecules, 182-183 transfection, as substrate introduction method in V(D)Jjoining, 50-53 DNase I, sensitivity as indicator of gene recombination, 43-44 Drug-monoclonal antibody conjugates, as cancer treatment, see Chemoimniunoconjugates as cancer treatment
E
Endothelial injury, vascular, caused by tumor necrosis factor, 351
489
INDEX
Epitope, shared, rheumatoid arthritis susceptibility associated with concept, 403-404,416-418 DRBl genes, 410-416 ethnic differences, 408-410 haplotype encoding, 438-440 Ester linkage, in chemoimmunoconjugation, 323 Ethnicity, rheumatoid arthritis susceptibility associated with,
408-410
F Factor I, in therapeutic complement activation, 272-273 Family studies, rheumatoid arthritis susceptibility, 433-435 5-Fluoro-2-deoxyuridine, use in cancer treatment, monoclonal antibody conjugation procedure, 344-345 Folic acid antagonists, as cancer treatment, 338-340 Follicles, transformed, avian leukosis virus infection, response to,
47 1-472 Fungal products, in therapeutic complement inhibition, 288-289
G GALT, see Gut-associated lymphoid tissue, rabbit Gender, rheumatoid arthritis susceptibility studies, 434 Genes antigen receptor, V(D)J joining of, see V(D)Jjoining, of antigen receptor genes bcl-2, regulation of apoptopic cell death in bursa of fabricius, 479, 48 1 bcl-x, regulation of apoptopic cell death in bursa of fabricius,
479-480 bic, retrovirus-induced B cell
neoplasia in bursa of fabricius, role in, 477
DRB1, rheumatoid arthritis susceptibility associated with,
410-416 HLA, rheumatoid arthritis susceptibility associated with risk ratios, 439 studies, 436-438 immunoglobulin, see Immunoglobulin genes interleukin-10 herpesvirus acquisition of, 11-12 properties, 3 structure, 4 lck, expression regulation restricted accumulation of transcripts, 151-152 transcription, 152-153 myb, retrovirus-induced B cell neoplasia in bursa of fabricius, role in, 477-478 myc, retrovirus-induced B cell neoplasia in bursa of fabricius deregulation of expression, 480 role in, 472-478,481 RAG-1 in rabbit B lymphopoiesis, 184, 186 as V(D)Jjoining agent, 64-67
RAG-2
in rabbit B lymphopoiesis, 184, 186 as V(D)J joining agent, 66-67 rel, retrovirus-induced B cell neoplasia in bursa of fabricius, role in,
477-478 rheumatoid arthritis susceptibility associated with, alleles, 441-446 somatic conversion, and antibody repertoire generation in rabbit,
198-202
V, replacement as outcome of V(D)J recombination, 90-92 VDJ, see VDJ genes V(D)J joining of, see V(D)J joining, of antigen receptor genes V H ~in, rabbit B lymphopoiesis, 184 Genetics, rheumatoid arthritis susceptibility studies family, 433-435 female sex, 434 number of genes, 434-438 twins, 433-435,446-449
490
INDEX
Glutaraldehyde, in crosslinkage procedure for chemoimmunoconjugates in cancer treatment, 315 Gut-associated lymphoid tissue, rabbit antibody repertoire generation role, 180,209 as bursa1 equivalent, 180,204 follicular structure, 203 germfree rabbits, 204-206 model. 206-209 H
Haplotype, MHC, rheumatoid arthritis susceptibility associated with, 438-446 Helper T cells TH1, and interleukin-10 discovery, 1-2 TH2, and interleukin-I0 discovery, 1-2 functional similarities to cytokines, 12-13 in oitro stimulations of primed cells, 13-14 in oioo expression correlated to TH2 responses, 14-15 Hemodialysis, therapeutic regulation of complement system in, 278-279 Heparin, in therapeutic complement inhibition, 287-288 Herpesvirus, interleukin-10 gene acquisition, 11-12 Human antimouse antibodies, chemotherapy limited due to production of, 304, 358-360 Hydrazone, in linkage procedure for chemoimmunoconjugates in cancer treatment, 322-323 N-Hydroxysuccinimide, in crosslinkage procedure for chemoimmunoconjugates in cancer treatment, 316-318
I Imidoesters, in chemoimmunoconjugation, 320-321 Immune response, ontogeny of, in rabbits, 186-187, 209
Immunoglobulin genes, and antibody repertoire generation in rabbit CH, 191-193 D, 189-191 IgA, 192 IgD, 192 JH, 188-191 K light-chain, 193-194 A light-chain, 194 organization, 187-188 VH allotype, 195 organization, 188-191 preferential rearrangement, 197-198 preferential selection, 197- 198 preferential use, 195-196 Immunoglobulins, V(D)J joining of antigen receptor genes at loci endogenous substrate, 34-37 gene assembly, 28-32 Infection, retroviral, as substrate introduction method in V(D)J joining, 50-51 Inheritance, rheumatoid arthritis susceptibility, 441-446 Injury acute states, therapeutic regulation of complement system in, see Complement system thermal, therapeutic regulation of complement system in, 280-281 vascular endotheIia1, by tumor necrosis factor, 351 Interleukin-4, functional similarities with interleukin 10, 12-13 Interleukin-10 biological effects B cells, 10-11 macrophages, 6-8 mast cells, 10 natural killer cells, 10 T cells, 8-10 characterization, 1 complementary DNA clones, 3-5 discovery cytokine synthesis inhibitory factor, 1-2 THUTH2 dichotomy, 1-2 functions, 7, 18 gene acquisition by herpesvirus, 11-12
49 1
INDEX
gene structure, 4 levels, in uiuo manipulation, 16-17 physical properties, 3 in pregnancy, 17 production, 4-6 removal, 16-17
TH2
functional similarities of cytokines,
12-13 responses correlated with expression,
13-15
treatment, 16 Interleukin- 10 receptor, characteristics, 18 Ischemia, therapeutic complement inhibition using soluble CR1,
282-284
Mast cells, interleukin-10 biological effects, 10 Melphalan, chemotherapeutic use in cancer treatment, 329-331 Membrane attack complex, complement activation role, 269-270 Methotrexate, use in cancer treatment functional studies, 346-347 monoclonal antibody conjugation procedure, 338-340 Methylation, V(D)J joining, of antigen receptor genes, endogenous substrate, 44-46 MHC, see Antigens Mitomycin C, in cancer treatment, 329,
332-333
J
Joining, V(D)J, of antigen receptor genes, see V(D)J joining, of antigen receptor genes
Monoclonal antibodies in chemoimmunoconjugates for cancer treatment agents, 302 alkylating agent-antibody conjugates, 328-333 anthracycline-antibody conjugates,
333-338
K
Killer cells, natural, see Natural killer cells
antigen heterogeneity affected by,
352
barriers to chemotherapy, 347-354 clinical trials, 354-356,358-359 conjugation strategies, 312-314,
318-319,323
L Leukocytes, see also B cells; T cells interaction with complement in acute injury states, 274-277 Lymphoma, avian leukosis virus-induced myc gene role, 472-476 pathogenesis, 471-472 resistance, 470 susceptibility, 471 Lymphopoiesis, B cell, in fetal and neonatal rabbit, 180-186 M MAC, see Membrane attack complex Macrophages, interleukin-10 biological effects, 6-8 Major histocompatibility complex, see Antigens
cytotoxic drugs, 342-343 design strategy, 324-325 development, 302-304 folic acid antagonists, 338-340 functional studies, 344-347 imrnunogenicity, 311-312 intermediary carriers, 323-324 internalization, 308-310 localization, 306-308 mode of action, 344-347 modulation, 308-310 morphological studies, ,347 preclinical studies, 326-328,343 radiolabeling, 354 size effects, 310-311 targets, 305-306 toxicity, 311-312 vinca alkaloids, 340-342 109d6, rheumatoid arthritis susceptibility associated with,
422-425
INDEX
regulation post-translational modification, 156-157 structure as factor, 153-156 T cell receptor interactions, 161-162 N thymocyte development, control of Natural killer cells, interleukin-10 allelic exclusion, 164-166 biological effects, 10 differentiation, 162-163 Neoplasia, B cell, retrovirus-induced, in maturation, 164-166 avian bursa of fabricius, 467-481 modes of action, 167-168 NHS, see N-Hydroxysuccinimide T cell receptor p-chain, Nongermline elements, as V(D)J 163-164 recombination products, 54-56 P nucleotides, as V(D)J recombination Nuclease, B cell-associated, as truncation product, 56-58 Polyglutamatic acid, anthracyclinefactor in V(D)Jjoining, 80 antibody conjugation role in cancer Nucleotides, P, as V(D)J recombination product, 56-58 treatment, 338 Population studies, rheumatoid arthritis susceptibility, 425-427 0 Pregnancy and interleukin-10, 17 Oligonucleotide capture, in V(D)J rheumatoid arthritis remission during, joining of antigen receptor genes, 43 1 Proteins 62-63 Oxidation, periodate, as strategy for interleukin-10-related, properties, 3 ras-GAP, as ~ 5 6 ' target " ~ in T cell chemoimmunoconjugation, 315-316 signaling, 159-160 as V(D)J joining factors P nonamer-binding, 69-70 RBP-Jk, 70-71 recognition protein, 71 Peptide antigens, see Antigens Periodate oxidation, as strategy for signal-binding, 69 chemoimmunoconjugation, 315-316 V(D)Jjoining protein, 72 Phenylenediamine mustard, in cancer Protein-tyrosine kinase, p56lCk,T cell treatment, 329,331 signaling by Phosphatases, serinekhreonine, as ~ 5 6 ' " ~ CD4 association, 160-161 targets in T cell signaling, 160 CD8 association, 160-161 Phosphatidylinositol-4 kinase, as p56lCk cell-surface receptor interactions, target in T cell signaling, 160 157-159 Phospholipase Cyl, as ~ 5 6 ' target " ~ in T cellular targets, 159-160 cell signaling, 159 function, 151 Photoactivation, linkage procedure for future research, 168-170 chemoimmunoconjugates in cancer lck expression regulation treatment, 323 Platinum compounds, in cancer treatment, 329,332 R restricted accumulation of transcripts, 151-152 Race, as rheumatoid arthritis transcription, 152- 153 susceptibility factor, 427-429 Mutation, somatic, and antibody repertoire generation in rabbit, 201, 203
493
INDEX
Recombination, by V(D)Jjoining of antigen receptor genes, .see V(D)J joining, of antigen receptor genes Recombination recognition sites, in V(D)Jjoining of antigen receptor genes, 86 Reperfusion, therapeutic complement inhibition using soluble CR1,
282-284
Replication, and V(D)Jjoining of antigen receptor genes, 80-81 Resistance, to retrovirus-induced B cell neoplasia, 470-471 Retroviruses induction of B cell neoplasia in avian bursa of fabricius, see Bursa of fabricius, avian infection as substrate introduction method i n V(D)Jjoining, 50-51 Rheumatoid arthritis, molecular basis of susceptibility alleles properties as factor in determination,
444-446 risk of severe disease associated with, 441-444 blacks, incidence of disease in,
427-429
characteristics of disease process,
389-390
epitope, shared concept, 403-404,416-418 haplotype encoding, 438-440 identification by monoclonal antibodies, 422-425 mapping, 410-416 ethnic differences, 408-410 genetic studies early knowledge, 400-401 family, 433-435 female sex, 434 number of genes, 433-438 twins, 433-435,446-449 HLA polymorphism, actions of remission during pregnancy, 43 1 testing, 432-433 toxicity, 431-432 immune response, 455-456 incidence, 399-400
inheritance mode, 440-441 mapping in region facing antigen-binding groove, 418-419 into sequence motif, 410-416 MHC associated with class I1 molecules, 429-430 serologic identification, 402-404 concepts, 390-397 determinants, 400-402
DR1,420-422,426 DR4,404-408,422-426 DR6,4 19-420 DR10,424-427,429 Dw determinants, 407-408 function of molecules, 449-450 haplotype interactions, 438-446 polymorphism, 398-399 terminology, 390-397 monoclonal antibody 109d6 associated with, 422-425 peptide antigen X role, 455 population studies, 425-427 serologic association, 406-407 structural determinants, 455-456 T cell repertoire exogenous events, 452-455 formation, 450-452 therapeutic directions, 456
S Sepsis, therapeutic regulation of complement system in, 281-282 Serinelthreonine phosphatases, as ~ 5 6 " ' ~ targets in T cell signaling, 160 Severe combined immunodeficiency, and V(D)Jjoining of antigen receptor genes, 73-78 Shock, septic, therapeutic regulation of complement system in, 281-282 N-Succinimidyl3-(2-pyridyldithio) propionate, in crosslinkage procedure for chemoinimunoconjugates in cancer treatment,
319-320
Susceptibility to retrovirus-induced B cell neoplasia,
469-471
494 to rheumatoid arthritis, see Rheumatoid arthritis
INDEX
Thermal injury, therapeutic regulation of complement system in, 280-281 Thioether, linkage procedure for chemoimmunoconjugates in cancer T treatment, 321-322 Threonine phosphatases, as p56ICktargets Targeted chemotherapy, concept of, in T cell signaling, 160 301-303 Thymocytes, p56lckcontrol of T cell receptor development p-chain, signal mediation, and ~ 5 6 ' " ~ allelic exclusion, 164-166 control, in thymocyte differentiation, 162-163 development, 163-164 maturation, 164-166 peptide vaccination in trimolecular modes of action, 167-168 complex, 236-239 T cell receptor p-chain signaling, p561ckinteractions, 161-162 mediation, 163-164 V(D)J joining of antigen receptor Tissue transplantation, therapeutic genes complement inhibition using soluble endogenous,substrate, 34-37 CR1,286-287 gene assembly, 28-32 Transcription, endogenous substrate T cells activation in V(D)Jjoining of antigen antagonists, in trimolecular complex, receptor genes, 41-43 244-247 Transformed follicles, avian leukosis autoimmunity, theories, 453 virus infection, response to, 471-472 helper, see Helper T cells Transplantation, tissue, therapeutic interleukin-10 biological effects, 8-10 complement inhibition using soluble p56Ick,signaling role, see ProteinCR1,286-287 tyrosine kinase, ~ 5 6 ' " ~ Trenimon, in cancer treatment, 329, rheumatoid arthritis susceptibility 331-332 affected by repertoire Trimolecular complex, immunoexogenous events, 452-455 therapeutic strategies directed at formation, 450-452 components, 219-220 as target molecules in trimolecular MHC Ia molecule as target, 247-250 complex peptide antigens as targets anti-alp T cell receptor antibody, analogs 228-229 as MHC blockers, 244-247 anti-CD3 antibody, 220-223 as T cell antagonists, 244-247 anti-CD4 antibody, 223-228 features, 239,250-251 anti-T cell receptor Vp antibody, peptide determinant as tolerogen, 229-233 240-244 perspective, 219 T cell as target receptor peptide vaccination, anti-alp T cell receptor antibody, 236-239 228-229 vaccination, 233-236 anti-CD3 antibody, 220-223 V(D)J joining of antigen receptor anti-CD4 antibody, 223-228 genes resulting in rearrangement, anti-T cell receptor Vp antibody, 47,49 229-233 Terminal deoxynucleotidyl transferase, perspective, 219 as V(D)J recombination product receptor peptide vaccination, molecular genetics, 68-69 236-239 structure, 54-56 vaccination, 233-236
INDEX
Tumor necrosis factor antitumor effects in preclinical trials, 354 vascular endothelial injury caused by, 351 Tumors, barriers to antibody-targeted chemotherapy perfusion, 350-352 tumor antigen-heterogeneity, 352-354 vasculature, 350-352 Twins studies, rheumatoid arthritis susceptibility discordance in identical twins, 448-449 formal genetics, 433-435 somatic nonidentity, 446-449
V Vascular endothelial injury, tumor necrosis factor as cause, 351 VDJ genes, in rabbit, rearrangements antibody repertoire development, 195-198 appendix, germinal centers, 204 bone marrow, 184 GALT model, 206-209 mechanism, 179 organization, 190-192 somatic conversion, 198-202 somatic mutation, 201,203 V(D)Jjoining, of antigen receptor genes agents biochemically defined, 69-73 cutting, 71-72 genetically defined, 73-79 hairpin-nicking activity, 79 joining signals, binding of, 69-71 ligation, 72-73 molecular genetics, 64-69 properties, 64 RAG-l,64-67 RAG-2,66-67 replication role, 80-81 severe combined immunodeficiency, 73-78 terminal deoxynucleotidyl transferase, 68-69 truncation factors, 79-80
495
end donation, 125-126 endogenous substrate accessibility, 37,41-42 active cell lines, 38-40 chromatin configuration, 37,41-46 DNase I sensitivity, 43-44 immunoglobulin loci, 34-37 methylation, 44-46 T cell receptor loci, 34-37 transcription, 41-43 fidelity, 119-127 gene assembly for immunoglobulins, 28-32 for T cell receptors, 28-32 mechanism analysis of process, 27-28, 132 cleavage, 129- 131 end exchange, 130-131 hypothesis, 127-131 ligation, interim, 131 modification, interim, 131 synapsis, 127-129 model systems cell rearrangement, 47-50 introduced substrates, 50-53 in uiuo-generated functions, 46-47 nonstandard products, 32-34 hybrid joint, 32-33 open-and-shut joint, 32-33 order, origins of distance effects, 96-98 joining signals, 86-90 locus deletion, 92-94 mechanisms, 81-82,118-119 orientation, 101-104 pseudo-normal joining, 94-95 rearrangement cis, 98-99 successive, 95-96 trans, 98-101 recombination outcomes, 90-95 recombination recognition sites, 86 specificity of end exchange, 104-1 11 three-dimensional signals, 111-1 18 12/23 rule, 82-86 V gene replacement, 90-92 pathogenesis, 119-127 recombinant structure crossover site location, 53-54
INDEX
germline joining, 63-64 homology, 60-62 junctional inserts, 54-58 N regions, 54-55 oligonucleotide capture, 62-63 P nucleotides, 56-58 terminal deoxynucleotidyl transferase, 54-56 truncation, 57-60 recombination cryptic site, 121-127
interchromosomal, 120-121 outcomes, 90-95 targets, 32 terminology, 34 12/23 rule, 32 Vinca alkaloids, in cancer treatment, monoclonal antibody conjugation procedure, 340-342 vinblastine, 341-342 vincristine, 340-341 vindesine, 340-341