Advances in
MICROBIAL PHYSIOLOGY
This Page Intentionally Left Blank
Advances in
MICROBIAL PHYSIOLOGY Edited by
A...
59 downloads
1238 Views
15MB Size
Report
This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!
Report copyright / DMCA form
Advances in
MICROBIAL PHYSIOLOGY
This Page Intentionally Left Blank
Advances in
MICROBIAL PHYSIOLOGY Edited by
A. H. ROSE School of Biological Sciences Buth University. U K
and
D. W. TEMPEST Departmmt sf Microhiologj? Uniiwsitj?of Sliefieli, U K
Volume 30
ACADEMIC PRESS Hareourr Bruce Jovanovieh, Publishers London San Diego New York Berkeley Boston Sydney Tokyo Toronto
This book is printed on acid-free paper @
ACADEMIC PRESS LIMITED 24-28 Oval Road London NW 1 7DX US.Edition published by ACADEMIC PRESS INC. San Diego CA 92101
Copyright K> 1989 by ACADEMlC PRESS LlMlTED
All Righis Resivvcd
No part of this book may be reproduced in any form by photostat, microfilm, or any other mcans, without written permission from the publishers British Library Cataloguing in Publicution Data
Advances in microbial physiology. Vol. 30 1. Micro-organisms-Physiology 1. Rose, A. H. 11. Tempest, D. W. 576.11 QR84 lSBN 0-12-027730-1 ISSN 0065-291 1
Typeset and printed in Great Britain by Galliard (Printers) Ltd, Great Yarmouth
Contributors C. A. Bilinski Research Department, Labatt Brewing Company Limited, London N6A 4M3, Ontario, Canada A. Datta Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi - 1 0 067, India K. Ganesan Molecular Biology Laboratory School of Life Sciences, Jawaharlal Nehru University, New Delhi - 1 0 067, India N. A. R. Cow Department of Genetics an I Microbiology, Marischal College, University of Aberdeen, Aberdeen AB9 lAS, UK N. Marmiroli Instituto di Genetica, Universita di Parma, 43100 Parma, Italy J. J: Miller Department of Biology, McMaster University, Hamilton LIB 4K1, Ontario, Canada. K. Natarajan Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi - 110 067, India J. Postgate Houndean Lodge, 1 Houndean Rise, Lewes, East Sussex, BN7 IEG, UK J. Preiss Department of Biochemistry, Michigan State University, East Lansing, MI 48824, USA J. 1. Prosser Department of Genetics and Microbiology, Marischal College, University of Aberdeen, Aberdeen, AB9 1AS, Scotland T. Romeo Department of Microbiology and Immunology, Texas College of Osteopathic Medicine, Camp Bowie a t Montgomery, Fort Worth, TX 76107, USA
This Page Intentionally Left Blank
Contents Contributors
V
Trends and Perspectives in Nitrogen Fixation Research JOHN POSTGATE
I. Background 11. Chemistry 111. Biochemistry IV. Genetics V. Physiology VI. Ecology VII. Envoi References
1
5 7 9 13 17 19 19
Apodxis in Saccharomyces cerevisiae and Other Eukaryotic Microorganisms C. A. BILINSKI, N. MARMIROLI and J. J. MILLER
I. Introduction: occurrence of apomixis in yeast 11. The meaning of apomixis in plants, animals and fungi 111. Apomixis in some eukaryotic micro-organisms IV. Inheritance of apomixis in yeasts
V. VI. VII. VIII.
Environmental modification of the apomictic phenotype Timing of events controlling the manner of nuclear division Nucleomitochondrial interactions in facultative apomixis Ecology of apomixis in yeasts IX. Concluding remarks References
23 26 29 33 36 39 41 42 46 48
Current Trends in Candida albicans Research A. DATTA, K. GANESAN and K. NATARAJAN 1. 11. 111. IV. V.
Introduction Genetics Morphogenesis Pathogenesis Problems in research on Candida albicans
53 54 58 67 79
viii
CONTENTS
82 84 84
VI. Summary VII. Acknowledgements References
Circulating Ionic Current in licro-organisms I
N. A. R. GOW
I. 11. Ill. IV. V. VI. VII. VIII. IX.
In trod ucti on Measurement of ionic currents Studies on bacteria Currents in fungi Currents in protozoa Currents in algae Effects of applied voltage and ion gradients Ionic currents and cellular physiology Conclusions References
89 90 92 93 102 105 113 114 119 120
Autotrophic Nitrification in Bacteria J. I. PROSSER
I. Introduction 11. Ecological and economic importance of nitrification 111. Taxonomy and species diversity
IV. V. Vi. VII. VIII. IX. X. XI.
Biochemistry of nitrifying bacteria Growth of nitrifying bacteria in liquid culture Surface growth The effect of oxygen and light on nitrification The effect of pH value on nitrification lnhibition of nitrification Concluding remarks Acknowledgements References
125 126 128 129 136 146 148 157 169 175 177 177
Physiology, Biochemistry and Genetics of Bacterial Glycogen Synthesis J. PREISS and A. ROMEO
Introduction Occurrence of glycogen in bacteria Enzymes involved in synthesis of glycogen Characterization of the bacterial glycogen biosynthesic enzymes Genetic regulation of glycogen biosynthesis in Escherichiu coli V1. Acknowledgements References
I. 11. 111. IV, V.
183 184 189 193 218 233 233
Trends and Perspectives in Nitrogen Fixation Research JOHN POSTGATE Houndean Lodge, 1 Houndean Rise. Lewes, East Sussex BN7 IEG, U.K.
1. Background. . . . . . . . . A. The nitrogen cycle. . . . . . B. Research trends . . . . . . 11. Chemistry . . . . . . . . . A. Models for nitrogenase function . . B. Exploitable systems . . . . . 111. Biochemistry . . . . . . . . A. The dinitrogen-binding site . . . B. Enzymology of nitrogenases , . . 1V. Genetics . . . . . . . . . A. The Klebsieh and Azorobucrer models B. Evolution and genetic manipulation . V. Physiology . . . . . . . . . A. Definition. . . . . . . . B. Functional responses . . . . . C. Symbioses. . . . . . . . VI. Ecology . . . . . . . . . A. New diazotrophic systems. . . . B. Exotic diazotrophic systems . . . V11. Envoi . . . . . . . . . . References . . . . . . . . .
. .
.
. .
. .
. .
.
. . . . . . . .
.
.
. .
. .
. .
. .
. .
. .
. . . .
. .
.
. .
.
. .
.
. .
. .
. .
. .
. .
. . .
. . .
. . .
. . .
. . .
. . .
. . . . . . .
. . . . . . .
. . . . . . .
. . . . . . .
. . . . . . .
. . . . . . . . . . . . . . . . . . . . .
. . . .
. . . .
. . . .
. . . .
. . . .
. . .
.
. . .
. . . . . . . . . . . .
1 1
3
S S
6 I I I 9 9 12 13 13
13
1s 17 11 18 19 19
I. Background A. THE NITROGEN CYCLE
The biological cycles of carbon, oxygen, nitrogen, sulphur and other elements involved in growth and metabolism are fundamental to the persistence of life on this planet, and the rbles of microbes in these cycles are crucial. Despite the rapidity of much microbial metabolism, the global turnover times of these cycles may be extremely long because they are the resultants of a multitude of ADVANCES IN MICROBIAL PHYSIOLOGY, VOL. 30 ISBN 0-12-027730-1
Copyright @> 1969. by Academlc Press Limited All nghts of reproduction in any form reserved
2
JOHN POSTGATE
local subcycles with turnovers ranging from fast to very slow indeed (see Sprent, 1987). For example, in the global nitrogen cycle, illustrated in Fig. 1, every nitrogen atom in the atmosphere cycles once in about lo6 years, but in a tropical rice paddy, where nitrogen fixation takes place in the water and denitrification in the mud, the turnover time must be a matter of a few years only. Similar principles apply to all the biological cycles, and the influence of mankind has been to perturb them, always in the direction of a net acceleration. Thus, by consuming native sulphur, the product of PermioJurassic sulphate reduction, and by burning coal, i.e. carbon fixed in the carboniferous era, we accelerate in obvious manners the sulphur and carbon cycles. The effects of mankind’s intervention in the nitrogen cycle, though less obvious to laymen, is equally impressive and is of special interest because of its impact on world agriculture.
Denitrification 2x108
Ammonif ication
* -- - - - -- - --- 3
-
NH3 -Plant
lolo--
and microbial protein
- -- - - - --
-
Animal protein
------------ ------- Assimilation- __ - --_- - - - - - - - ___ - - - _ _ _ _
+
3 x 10’0 FIG. 1. The nitrogen cycle. A simple form of the cycle is illustrated. The numbers beneath the various steps are orders of magnitude of turnover in tonnes per year. For more precise data, see Delwiche (1977) and Clark and Rosswall (1981).
In the early stages of this planet’s biological history, the reserves of chemically fixed nitrogen in the “primitive soup” must have been adequate for the emergence of life, and for many millennia of its evolution the input of new nitrogen into the primitive biosphere was probably wholly chemical: comprising molecules such as cyanide, hydroxylamine and Urey/Miller organic nitrogen, generated locally from pristine NH, and HCN by lightning, irradiation and volcanic activity. The biological nitrogen “cycle” would then have been a matter of linear exchange of nitrogen between organic and inorganic combination. As the primitive atmosphere became less reducingby photolysis of H,O leading to escape of H, and transient formation of 0,-more oxidized forms of fixed nitrogen (dinitrogen, hydroxylamine, nitrite and,
TRENDS A N D PERSPECTIVES IN NITROGEN FIXATION RESEARCH
3
later, nitrate) would tend to replace NH,. By the time oxygen had become a permanent component of the atmosphere (there is still no agreement when; about lo9 years ago was widely accepted in the early 1970s, but earlier dates are now favoured (Towe, 1983)), nitrite and nitrate would have become the biosphere's major inorganic nitrogen reserves, and these sources must have tended to limit the biomass of the biosphere. Thus selection pressure favouring of the emergence of biological nitrogen fixation arose. Postgate (1 982) argued that ability to fix nitrogen might therefore be a relatively recent acquisition of living things, but this is a matter of informed speculation (see reviews by Sprent and Raven (1987) and Postgate and Eady ( 1 988)), not scientific fact, because the crucial geochemical basis still is lacking. Whatever may be the historical truth, biological nitrogen fixation now exists, and in consequence nitrogen is no longer a limiting nutrient for most equilibrium or climax ecosystems. In virgin forests, natural savannah and other fertile regions which are in ecological balance, biological fixation provides an adequate input of nitrogen, and factors such as temperature, hydration, salinity or availability of other nutrients (such as phosphorous, sulphur and potassium) determine biomass production. However, perturbation of a balanced ecosystem by stresses such as fire, inundation, vulcanism or drought, renews or recycles all the biological elements so, during recovery, supplies of fixed nitrogen generally become limiting. During the present millennium the most persistent perturbations of the natural environment have been brought about by agriculture and forestry, so today, on a global scale, world productivities of these industries is determined by the input of fixed nitrogen into agricultural soils and managed forests. B. RESEARCH TRENDS
In the late 1980s the world's human population passed 5 x lo9. Every concerned scientist recognizes that, assuming no global catastrophe intervenes, it will reach 10'' during the next century. Whether it takes two, three or four decades to reach this number, and whether it then stabilizes, depends on sociopolitical matters such as the efficacy and acceptability of measures of population control. But the inescapable truth is that there are already sufficient children on this earth, who will reproduce before their antecedents die, to ensure a doubling of the world's population even if all programmes of population control were immediately successful. This explosive growth of the world's population in the twentieth century has been supported by the Haber process for fixing molecular dinitrogen from the atmosphere. The net input of industrial nitrogen fertilizer today is said to support a third of the world's present population; to feed double that
4
JOHN POS’fGATE
population will require at least a doubling of the net input of fixed nitrogen into the world’s agricultural soils. Consideration of ways of achieving this augmented input raises very important questions. When is chemically fixed and when is biologically fixed nitrogen the most appropriate fertilizer? How far, under ever increasing pressure for living space, can and should new land be brought into use? Does the obvious overuse of industrial nitrogen fertilizer in some countries justify regulation, by the U.N. or more parochial agencies, of fertilizer use‘?Are the environmental consequences of such a massively increased nitrogen input (in terms of eutrophication, effects of atmospheric nitrogen oxides, contamination of drinking water) as serious as some environmentalists fear? Will the mounting costs of energy (for transport and packaging as much as for production) price Haber nitrogen out of reach of less wealthy countries? Can agricultural procedures be reformed, perhaps redirected to exploitation of biological fixation, without drastic political and economic strain? These are truly vital questions, but they can only be touched upon in a scientific survey. Whatever view one takes of these demographic, sociopolitical and economic problems, it remains clear that mankind must exploit both industrial and biological nitrogen fixation more effectively and extensively than in the past. Such considerations emphasize the practical importance of the research efforts now being put into the study of nitrogen fixation. They impose perfectly proper constraints on the directions of that research and on the perspectives revealed thereby. However, it is a truism which cannot be emphasized too often that progress in practical directions, in any technology, depends utterly on new understanding of the science which underlies that technology. This is especially true of the present subject because the processes underlying nitrogen fixation are not only far from being understood at a fundamental level but also raise fascinating basic questions in chemistry, biochemistry, physiology, genetics and general biology. Even at an elementary level one can point to simple yet vexing questions. Thus, the Haber process requires high pressures, elevated temperatures, special catalysts and anoxic, anhydrous conditions to split and reduce the very stable N=N molecule; how then d o microbes conduct this chemical miracle in wet, aerated soil at ambient pressures and temperatures? And again, if available nitrogen in the environment has determined the productivity of the biosphere for millions upon millions of years, how can it be that the biological process for obtaining this nutrient from the atmosphere, physically the biosphere’s most accessible resource, has remained restricted to some 50 genera of prokaryotes, the most effective of which perform in symbiosis with plants? These are actually very broad questions, but shadowy answers are beginning to form. Attack upon such questions has determined the directions of most basic research over the last three decades, whether the overt objective
5
TRENDS A N D PERSPECTIVES IN NITROGEN FIXATION RESEARCH
has been the advance of knowledge or the amelioration of the human condition. In this review an attempt has been made to provide an overview of the state of published research bearing on the more fundamental aspects of diazotrophy, as it stood towards the beginning of 1989, and to indicate likely directions of further research. As far as has been practicable, reference has been made to review articles rather than primary publications for amplification of the topics discussed. 11. Chemistry A. MODELS FOR NITROGENASE FUNCTION
The study of the properties of the dinitrogen complexes of the transition metals, examples of which are listed in Fig. 2, has provided purely chemical precedents for a number of the reactions of nitrogenases. Examples of such complexes are known which can be formed directly from gaseous dinitrogen in mild, protic conditions, sometimes by displacement of two hydride groups; which can be protonated in an essentially stepwise sequence to hydrazine, ammonia or a mixture of both. Collectively such reactions provide a synthetic model for the binding of N, by nitrogenase, the obligatory release of H, by the functioning enzyme and the formation of stoichiometric amounts of hydrazine when the enzyme is quenched with acid or alkali during N, reduction (see discussions by Henderson et al. (1983), Leigh and Postgate (1985), Newton (1988) and Postgate (1982)). The precise conditions for chemical stability, and for formation of hydrazine as against NH, as end product of protonation, remain uncertain, being conditioned by the ligand Metal
Formula
Ruthenium Cobalt Molybdenum Iron Rhenium Tantalum
[RU(Nz) (NH3)51 ’ xz CoH(N2)(R3P)3 M0 ( N,) 2 (d PPe)2 [FeH(N,)(dppe),I x ReCI(N,) (RR‘,P), Ta CI ( P) ,-N ,-Ta C l3(
R = C6HsR‘ = CH3-
R ” = C 2 H5dppe = R,P . CH,CH,. PR,
’
P) ,
FIG. 2. Examples of dinitrogen complexes. These are organometallic compounds formed by metals of the “transition” group of the Periodic Table. Their complete formulae are complicated, so for simplicity X replaces anions such as CI- where appropriate, and the code above is used for the organophosphine components of the molecules. For more details see Henderson et al. (1983) and Newton (1987).
6
JOHN POSTGATE
environment of the metal and the nature of both the protonating agent and the solvent environment. Moreover, although chemical kinetics have revealed the early steps of protonation satisfactorily, the later stages of NH, formation are less clear. The discovery of nitrogenases based on vanadium and iron atoms (below) has rekindled interest in the dinitrogen complexes of those metals, and also in the long-established but mechanistically elusive protonations of vanadium(r1) compounds studied by Professor Shilov and his colleagues (see Nikinova et ul., 1980). However, in the biological systems the ligands are not organophosphines or other laboratory chemicals; they are biological molecules: protein (or amino-acid residues therefrom), probably molecules such as homocitrate (Hoover et af.,1988),and very likely iron and sulphur atoms. So the study, of more “biological” ligands such as amino and carboxy acids in regular dinitrogen complex chemistry is gaining momentum, coupled with increased urgency over the elucidation of the structures and atomic locations of those conspicuous but intractable features of prosthetic sites of dinitrogenases: the co-factors FeMoco and FeVaco. B. EXPLOITABLE SYSTEMS
Studies on the mechanism of protonation of the dinitrogen group coordinated to a transition metal will necessarily continue until protonation of complexes of the type of the classical tungsten molecule cis-W(N,),(PMe,Ph), (Chatt et al., 1987) is fully understood. Already the possibility of cyclic, and thus potentially catalytic, processes based on such reactions is under investigation, a recent and exciting version being the cyclic electrochemical reduction of a regenerable tungsten dinitrogen complex which was reviewed by Pickett el ul. (1988), a reaction which has potential application as a lowtechnology substitute for the Haber process. At the time of writing, an important problem is the provision of a regenerable protonating component. Recent successes have naturally led to broader perceptions of man-made dinitrogen-fixing systems (reviewed by Newton, 1987) including the historic process for oxidative attack on N, by O2 plus an electric arc (the Berkland-Eyde process) and potential applications of the photoreduction of N, catalysed by titanium dioxide. The reductive nature of the biological process has, however, exerted a strong influence on the development of the complex chemistry of dinitrogen and it is to be hoped that a systematic approach to the oxidative attack of metal-bound N,, complementary to the excellent studies of its reductive attack, will not be long delayed. Perhaps, however, one should discourage a very long-term prospect which arises therefrom: the artefactual creation of a dinitrogen oxygenase in bacteria or plants, would present grotesque environmental problems (see Clement, 1980).
1RENDS A N D PERSPECTIVES I N NITROGEN FIXATION RESEARCH
7
111. Biochemistry A. THE DINITROGEN-BINDING SITE
Although involvement of molybdenum had been suspected since Bortels (1930) first demonstrated that this element is a prerequisite of diazotrophic growth, chemistry has only recently provided good reasons for believing that the N,-binding site of dinitrogenase is a transition metal. Scientists are prejudiced by largely circumstantial evidence towards the view that one, or conceivably two, molybdenum atoms constitute the binding site in conventional dinitrogenase, with vanadium or iron atoms performing comparable functions in the two “alternative” dinitrogenases (Bishop et al., 1988; Eady et al., 1988) recognized so far. Plausible though this view is, it cannot be taken as proved until the modes of action of FeMoco, FeVaco, and “FeFeco” if such a moiety exists, are established. Replacement experiments in vitro using apo-Mo-dinitrogenase from Klebsiella pneumoniae and extracts containing nifV FeMoco (Hawkes et al., 1984) or Azotohacter chroococcum FeVaco (Eady et al., 1988) now provide unequivocal evidence that FeMoco and FeVaco are, contain, or are part of, the N,-binding sites of Mo- and Vdinitrogenase, respectively. However, this information still leaves iron atoms, sulphur atoms or even ligands adjacent to the co-factor clusters, as possible binding sites. The adjacent ligands have rarely been considered overtly as binding sites, but the exciting evidence summarized by Shah et al. (1988) that nfV- mutants lack homocitrate and that homocitrate corrects the nifVphenotype suggests not only that the nifV product is involved in homocitrate synthesis but also that fully functional FeMoco is ligated to homocitrate or a derivative thereof. Elucidation of the structures and rdles of these co-factors is urgent for biochemical as well as chemical reasons and the approach of Imperial et al. ( I 988), investigating co-factor biosynthesis via the products of genes known to be involved (nifN, E, V, B, Q-see Fig. 3), is one of many examples of the interaction of biochemistry and genetics, an interaction which will continue to have a major influence on the directions of biochemical research. B. ENZYMOLOGY OF NITROGENASES
Specialists in the enzymology of nitrogenases are well aware of the perennial difficulties research workers have with the specific activities and analytical compositions of preparations of nitrogenase proteins: problems of obtaining consistent data as between laboratories, even as between preparations made with different batches of cells, have not been solved and published values for these two quantities differ to a vexing extent. The consensus is that iron and
8
JOHN POSTGATF
sulphur analyses generally underestimate the molar content of these atoms in the molybdoprotein and it is still uncertain whether equal numbers of these two elements are present or whether iron atoms marginally outnumber sulphur. As far as the iron protein is concerned, most authorities are satisfied that it carries one 4 F e 4 S cluster per molecule, but at least one claim has been made that two such clusters are present in the undamaged protein (see Eady, 1986).Published specific activities for the two proteins cover an approximately three-fold range. These problems are partly rooted in the methodology of handling and analysing the extremely sensitive nitrogenase proteins, but they may also indicate that precursor or degraded forms are actually part of the ordinary cell’s complement of nitrogenase. Despite these sources of uncertainty, which are sometimes dismissed too easily, studies of the mode of action of Mo-nitrogenase, using artificial electron donors, progressed dramatically in the late 1970s and early 1980s with the exploitation of rapid reaction kinetics together with absorption (visible, UV and pray) and electron spin resonance spectroscopic techniques. A grand scheme for the functioning of K.pneumoniae nitrogenase was put forward by Thorneley and Lowe ( 1 985) which matched observed data well and is now in the process of refinement to accommodate such details as the N,-specific D, exchange reaction, or interaction with the natural electron donor. Yet certainty about the nature of the latter substance had to await input from molecular genetics: although biochemical evidence has long suggested that flavodoxins or ferredoxins are the primary electron donors to nitrogenases (Walker and Mortenson, 1974; Yates, 1972), doubt remained that the observed phenomena might be artefactual-analogous to the action of a viologen dye-and it required the recognition of the NifF- phenotype, followed by identification of the nifF and nif‘J gene products, to make the first unequivocal identification of a primary electron donor to nitrogenase: the nfF-encoded flavodoxin which donates electrons to the Fe-protein of K. pneumoniae nitrogenase (NievaGomez et al., 1980).Nif F cloned in Escherichia coli was used by Deistung and Thorneley (1986) to obtain supplies of the flavodoxin for research on nitrogenase kinetics: Cloned genes are being exploited for studying the biochemistry of most of the nifgene products. A combination of separately cloned genes in an alien genetic background was the experimental basis of evidence that only two ~ ( f gene products, NIFM and NIFH, are necessary for the biosynthesis of active dinitrogenase reductase (Howard et al., 1986; Paul and Merrick, 1987, 1988). The availability of amino-acid sequences for nif gene products deduced from DNA sequences has enabled the application of site-specific mutagenesis to mechanistic problems, and dinitrogenases with known amino-acid substitutions have already been reported (Dean et al., 1988).Such studies cannot fail to extend understanding of the biochemistry of nitrogenase; the problem now,
TRENDS A N D PERSPECTIVES IN NITROGEN FIXATION RESEARCH
9
of course, is to decide which gene products-which proteins-to study and which amino acids to alter. Molecular biology has not yet eliminated the need for intuition. Detailed DNA sequence data were essential to the demonstration of the existence of the “alternative” nitrogenases. Bishop et al. (1988) gave a brief account of the chequered history of these nitrogenases, whose reality was widely doubted until a strain of Azotohacter uinelandii became available with its regular structural nif genes unequivocally deleted. The tenacity of Dr Bishop was then rewarded: the subject has taken wing with the discovery of the V- and Fe-nitrogenases. The observation that ethane is formed from acetylene by non-Mo-nitrogenases, in addition to ethylene, whereas ethylene is the exclusive product formed by Mo-nitrogenase (Dilworth et al., 1987),has indicated a presumptive test for the new nitrogenases which has already provided evidence for such nitrogenases in organisms other than azotobacters (Chan ef al., 1988; Kentemich et al., 1988).Are nitrogenases based on tungsten, ruthenium or other transition metals waiting to be discovered? Evidence (Hales and Case, 1987) that tungstate-resistant A . uinelandii can, in special conditions, make an active dinitrogenase containing both molybdenum and tungsten in 1 :1 ratio, is suggestive. The biochemistry of these new nitrogenases will be fascinating; its elucidation will obviously accelerate understanding of the modes of action of all nitrogenases. But enthusiasm should not lead to neglect of microbiologically exotic Mo-nitrogenases such as those of halotolerant and psychrophilic diazotrophs, as well as diazotrophic archaebacteria, both mesophilic (Murray and Zinder, 1984) and thermophilic (Belay et al., 1984). A final outstanding biochemical question remains: what is the chemical basis of the oxygen sensitivity of all known nitrogen proteins? It is a question few have chosen to address, if only because it involves the deliberate destruction of precious proteins, but we need to know the answer because only then can we decide whether an oxygen-tolerant nitrogenase could in principle exist (or be constructed by protein engineering).
IV. Genetics A. THE
Klehsiella
AND
Azotohacter
MODELS
A complete sequence of 24,206 base pairs of DNA covering the whole of the K. pneumoniae n$regulon is now available (Arnold et al., 1988).The regulon was for several years believed to consist of only 17 genes, though the possibility of additional small genes was not excluded. Sequence data have now revealed that it includes 20 open reading frames (Fig. 3), representing genes which are transcribed when nif is derepressed. They are clustered into seven contiguous
10
JOHN POSTGATE
(bisD, GI
Q
Mo uptake or processing
B
FeMoco synthesis or processing
A
Positive regulator
L
Negative regulator
F
Flavodoxin synthesis
M
Processing Fe-protein
2
?
W
?
V
Processing FeMoco
S
?
U
?
X
?
N
Processing FeMoco
E
Processing FeMoco
Y
?
T
?
K
Synthesis of p-subunit of MoFe-protein
D
Synthesis of a subunit of MoFe-protein
H
Synthesis of Fe -protein
-
(C) ? J
Synthesis of pyruvate-flavodaxin oxidoreductose
(shiA1
FIG. 3. The nif regulon of Klehsiellupneumoniue. The gene cluster is preceded by the his operon and followed by shiA on the K. pneumoniue chromosomc. The arrows signify directions of transcription of the component operons; the biological functions of the encoded peptides are as known in late 1988. A twenty-first gene ( C )has been proposed but is probably part of J.
operons which are not all transcribed in the same direction and one of which includes a secondary promoter (Fig. 3). The amino-acid sequences and various other physicochemical data can be deduced for all 20 gene products but the physiological functions of only about half of them are known (Fig. 3). In particular, the n(fDK genes code for the structural peptides of dinitrogenase and niJ'H for the polypeptide of dinitrogenase reductase; the n$LA operon specifies proteins which regulate the expression of all other ntf operons. Expression of K . pneumoniue n$has features in common with the regulation
TRENDS A N D PERSPECTIVES IN NITROGEN FIXATION RESEARCH
11
of the assimilation of other nitrogen sources (such as nitrate, urea, amino acids) in coliform bacteria: it is regulated in a distinctive way involving action of the products of the ntr genes, which are unlinked to nif: One of these, ntrA (also known as rpoN), codes for a special a-factor, a54.The two others, ntrBC are un-linked to ntrA/rpoN and specify repressor and activator substances. When ammonium ions or some other assimilable nitrogen sources in the external environment are sensed, by a cascade mechanism which is only partly understood, the nrrBC products act in repressive mode. The review by Merrick (1988a) gave fuller details of this developing subject. The ntr gene products have their effect on ntfexpression at the nifLA operon, regulating synthesis of NlFA which, modulated by NIFL, acts at the promoters of the other seven operons within the nifregulon. Genes regulated by ntr or nifLA products have promoter sequences different from the normal E. coli promoter consensus sequence. Though the outlines of nif regulation by fixed nitrogen in K. pneumoniue are known, and the functional domains of the regulatory proteins are being identified, the precise ways in which regulator proteins recognize and act at the appropriate promoter, as well as the details of how fixed nitrogen is sensed and induces repression, remain elusive; folding of the DNA is among the factors involved (see reviews by Dixon, 1988; Merrick, 1988a,b). The pathway of genetic regulation of nifby 0, is being revealed as different in a number of important respects. The relative 0, tolerance of certain nifL mutants earlier suggested that NIFL was intimately concerned with 0,induced control at the transcriptional level; this belief has been confirmed by studies of nif-lac fusions in appropriate mutant backgrounds. There is also evidence for post-transcriptional regulation through 0,-mediated destabilization of the otherwise uncommonly stable nifmRNA. However, whereas nif regulation by fixed nitrogen has many features in common with the general regulation of nitrogen assimilation in coliform bacteria, no comparable sharing of features has been demonstrated between O2 regulation of nifand the 0, regulation of aerobic versus anaerobic metabolism in coliforms; claims to the contrary have not been substantiated. These matters were discussed in Hill’s ( 1 988) succinct review. Rapid progress is being made in the research area of genetic regulation of nif at the time of writing and it has become very clear how very fortunate we were that K . pneumoniue was the first major subject for the study of nifgenetics, because it is uncomplicated by “alternative” nifsystems and its nifgenes are clustered into the familiar regulon. Thus it is an excellent model system for research, especially now that we have learned that, in most other diazotrophs, the nifgenes are not clustered, nor is regulation by ntr necessarily the rule. As far as gene organization is concerned, for example, in those azotobacters and rhizobia that have been studied, the genes for Mo-nitrogenases are only partly contiguous, being dispersed as three or four clusters, and they include some
12
JOHN POSTGATE
(e.g. JixABC) not recognized in K . pneumoniue. A particularly fascinating problem is presented by A . chroococcum and A. vinelundii, which have genetic systems coding for the new nitrogenases as well as for Mo-nitrogenase: Vnitrogenase in A . chroococcum, both V- and Fe-nitrogenases in A. vinelundii. The structural genes for these nitrogenases are quite distinct, in sequences and locations, but some, though not all, genes involved in processing the nitrogenase proteins may be shared. In A . uinelundii,nifN is specific to the Monitrogenase, but n i f M and njf B are concerned with all three nitrogenases. In the matter of nifregulation, ntr genes are indeed present in A. uinelundii, but the ntrBC products seem only to regulate synthesis of V-nitrogenase (see Kennedy and Toukdarien, 1987; Merrick, 1988b) and a new regulatory gene, nfrX is involved with the other two nitrogenases (Bali et ul., 1988). Among non-symbiotic diazotrophs, increased structural and regulatory complexity seems to parallel increased aerotolerance, reaching a peak in heterocystous cyanobacteria, where nif is dispersed and a seemingly unique process of DNA re-arrangement involving excision of two fragments (data summarized by Haselkorn et ul. (1987)) accompanies derepression of ntfwhy? B. EVOLUTION AND GENETIC MANIPULATION
The divergencies in nif arrangement and regulation among various prokaryotes, and even between Mo- and non-Mo-nifin the same prokaryote, show no logical pattern at present; there is a need to know and understand them and this need will condition the main stream of nifgenetics for some years to come. Although their relevance to agriculture has led many laboratories to concentrate on njfin rhizobia, azospirilla or cyanobacteria, the divergencies of the diazotrophic methanogens from the K. pneumuniue model will be of special fundamental interest because the archaebacteria have many distinctive genetical and biochemical features. Already comparison of the deduced amino-acid sequences of the dinitrogenase reductases (nzfH products) from various methanogens (Sibold and Souillard, 1988) indicates that considerably more evolutionary divergence of nifhas taken place within this subgroup of the archaebacteria than has been observed among eubacteria, yet that one of two such proteins from a thermophile shows greater similarity to a dinitrogenase reductase from the eubacterium Closlridium pusteuriunum than to its own companion or to analogous proteins from other methanogens. The possibility therefore resurfaces that lateral nif gene transfer, already proposed within the eubacteria (Postgate, 1982) and doubted as a result of earlier sequence comparisons (Hennecke et ul., 1985),may not only be a reality but may have occurred between the two prokaryotic kingdoms, with the archaebacteria as the “donor” kingdom in which the process originated.
TRENDS A N D PERSPECTIVES IN NITROGEN FIXATION RESEARCH
13
However, Postgate and Eady (1988) have warned against the too-ready acceptance of protein sequence data as indicators of evolutionary pathways. The creation of an entirely new diazotroph, E. coli, by nifgene transfer from K. pneumoniae was crucial to the early exploration of nifgenetics and the extension of such studies to other bacteria yielded valuable information regarding nif expression in alien prokaryotic backgrounds which was reviewed by Postgate et al. (1987). Attention is now turning to expression of individual nif genes such as nifH or nifD in eukaryotes and limited success has been achieved (e.g. by Zilberstein et al., 1988), but, although rational approaches to the goal can be prescribed (e.g. by Postgate, 1987), expression of a full complement of nifgenes in a eukary0te-i.e. eukaryotic diazotrophy-is still a long way off. The dramatic advances of nifmolecular genetics have prejudiced most scientists in favour of a constructional approach, that of engineering nif genes into, say, a plant chloroplast. However, if a sound strategy was available for generating a diazotrophic organelle in plant tissue from a diazotrophic endosymbiont, exploiting perhaps the uptake and conservation of L-forms claimed by Aloysius and Paton (1984), that avenue might enable some of the physiological problems of nif expression which a diazotrophic plant would face to be solved more easily. V. Physiology A. DEFINITION
The physiology of a microbe is the resultant of the interaction of its genetics and its biochemistry. It is therefore entirely appropriate that modern microbial physiology should incorporate substantial genetical and biochemical components, even if classical physiologists find the jargon and concepts troublesome. At the Corvallis international symposium on nitrogen fixation (Evans et al., 1985) about half of the papers categorized as “genetics” in this research area actually described the exploitation of genetics to answer physiological questions. In the matter of the regulation of nitrogenase synthesis in response to oxygenation or starvation of fixed nitrogen, this truism is obvious, and the discovery of a molybdoprotein as an apparent autoregulator of nif required the use of lac-nif fusions. Molecular genetical approaches are now becoming available in most contexts within the classical physiology of diazotrophy. B. FUNCTIONAL RESPONSES
Many of the physiological stratagems available to diazotrophs for the protection of nitrogenase from oxygen damage are reasonably well
14
JOHN POSTCAIE
understood (see Postgate, 1982; Hill, 1988), though refinement of detail, and alteration of emphasis in some instances, will be needed. Two examples are: (1) the “classical” account of oxygen tolerance in azotobacters in terms of respiratory and conformational protection does not cover all levels of 0, stress (Post et al., 1983; Yates, 1988); (2) the rBle of heterocysts in cyanobacterial oxygen exclusion is clear, yet the unicellular Gloeothece is remarkably tolerant of 0, (Maryan et al., 1986) without benefit of heterocyst formation. Such deviations are very important and far from satisfactorily explained at present. Delay in the use of genetics in this research area has arisen largely because the appropriate classes of mutant (e.g. the oxygensensitive Fos- mutants of azobacters (Ramos and Robson, 1985a,b)) are not easy to isolate. Diazotrophs generally show one or both of two “switch-on/off” reactions to their environment, neither of which involves regulation of enzyme synthesis. The first of these is the response to O,, typified by azotobacter’s reversible cessation of nitrogenase activity under excessive 0, stress (the “conformational protection” syndrome). Although it was discovered in the strictly aerobic and very 0,-tolerant A. chroococcurn, comparable phenomena have been detected in all diazotrophs in which 0,-induced switch-on/off has been sought (see Yates, 1988). It occurs even in the highly exacting obligate anaerobe Desulfouihrio gigas, though with this organism recovery from exposure to oxygen is slow compared with azotobacter (see Postgate et al., 1988). If the process is universally associated with diazotrophy, as seems to be the case, the relevant genes ought to be common to all diazotrophs and perhaps linked to nu‘ in some bacteria. A physiological consequence of the reversible inhibition of nitrogenase activity by oxygen which is not always appreciated is that 0,-induced switch-off is also a fortuitous posttranscriptional regulator of nitrogenase synthesis, because switched-off cells rapidly become starved of assimilable nitrogen and further enzyme synthesis will diminish since it can only take place at the expense of endogenous breakdown of cell material. Such cells thus formally resemble dinitrogenlimited populations and may be physiologically poised for the “hyperinduction” of nitrogenase discussed below. The second switch-on/off reaction is a comparable reversible response to low levels of NH, exemplified in Rhodopseudomonas paiustris (see Alef rt al., 1981), and in A . uinelundii of certain physiological status (Klugkist and Haaker, 1984), which can be interpreted teleologically as a measure of ATP economy: it is logical to consume available fixed nitrogen before using N,, The enzymological bases of both of these responses are beginning to be understood but the preliminary sensing mechanisms remain enigmatic. In addition to familiar on-off regulation both of synthesis and activity, nif’
TRENDS A N D PERSPECTIVES IN NITROGEN FIXATION RESEARCH
15
expression can also display hyperactivity. In this respect it recalls the widely forgotten physiological phenomenon of hyperinduction, long ago demonstrated with primary catabolic enzymes such as 8-galactosidase (Novick and Horiuchi, 1962) as a response to growth limitation by the subtrate of that enzyme, lactose. In that case, actual hypersynthesis of enzyme was demonstrated, though its interpretation in terms of gene multiplication can be questioned (Smith and Dean, 1971). Nitrogenase activity can show comparable hyperinduction under limitation by availability of dinitrogen (Arp and Zumft (1983) summarized earlier reports) and also in circumstances in which the stimulus is less clear (intense illumination of a photosynthetic diazotroph in glutamate-limited conditions (Jouanneau et al., 1985)). Its physiological and genetic basis deserves further study, particularly since it may provide insight into the persistence of nitrogenase as against other enzyme activities in rhizobia, as the transition to the symbiotic dormancy of bacteroids proceeds.
C. SYMBIOSES
The physiologies of the various diazotrophic symbioses are, of course, among the most fascinating subjects of study at the interface of microbiology and plant science. Understanding of rhizobium-legume systems, particularly, has benefitted immensely from genetical input, as witness the sym plasmids and the plethora of nifl nod, hsp,.fix and related genes which molecular genetics is currently revealing (see many contributions in the 1988 Koln symposium on nitrogen fixation (Bothe et al., 1988)).The sequential regulation of such genes as nodulation proceeds is beginning to be revealed, particularly the influence of products determined by the host plant’s genes both in host-symbiont recognition (e.g. plant flavonoids; see Johnston et al. (1988)) and in nodule maturation. The mechanism whereby oxygen supply to the bacteroids is regulated, involving a semi-permeable physical barrier to 0, and a haemoglobin as an O2carrier, is becoming clear (see Evans et al., 1987) and so are both the nature of the carbon contributed by the plant and the forms of nitrogen exported by its symbiont. It is the more remarkable, then, that the physiological status of bacteroids themselves, in terms of nitrogen, carbon or oxygen limitation, remains obscure. Another persistent question concerns the physiological function of uptake hydrogenases in nodule systems (see discussion by Evans et al., 1987). In theory this hydrogenase ought to benefit diazotrophs by enabling them to recover some of the ATP lost in the hydrogen-evolving feature of nitrogenase
16
JOHN POSTGATE
function, an economy which ought to be reflected in modest but real yield increases. Yet the phenomenon has proved difficult to reproduce in the hands of different research workers, partly because, until isogenic Hup' and Hup mutants of a single rhizobial genotype became available recently, earlier tests necessarily made use of natural hydrogenase-positive and hydrogenasenegative rhizobia, among which non-specific interstrain differences might mask differences due to possession or not of hydrogenase. Tests with true isogenic mutants of Bradyrhizobium japonicum appear to substantiate the claim that the Hup' phenotype is advantageous but a paradox remains: with natural strains which show positive effects, the benefit of hydrogenase is often disproportionately large. Where one might expect hydrogen recycling to incur saving in the region of 10% to the energy economy of the symbiosis, improvements of 25% or more have been recorded. A threshold effect is thus indicated, one which bears upon the later history of the symbiosis. In this context the evidence of Aguilar e f al. (1985)is suggestive: making use of Hupmutants of A . chroococcum (Yates and Robson, 1985) they showed in chemostat studies that the most pronounced benefit of uptake hydrogenase for this organism is in the initiation ofdiazotrophy; in the steady state its effect is small, at just about at the theoretical level. A comparable benefit in the legume symbiosis might be difficult to detect because in many experimental or environmental condition it could be over-ridden by the physiological response of the plant host to those conditions. The soyabean, lucerne (alfalfa), clover and pea symbioses have been the main examples of the legume symbiosis used in research but others are now becoming popular. Much interest has been excited by the stem-nodulating system of Sesbania rostrata and its attendant Azorhizobium caulinodans (see Alazard et al., 1988)because it has novel features: nodules closer to the sites of photosynthesis than is usual, and a relatively aerotolerant symbiont. Dilworth (1987) surveyed other prospects and questions in the research area of rhizobium biology which stem from recent advances in knowledge of biological nitrogen fixation, including mineral nutrition and the possible involvement of non-Mo-nitrogenases. Among the actinorhizal and cyanobacterial symbioses, too, there are several examples of paradoxical physiologies whose resolution will advance knowledge. Three examples are: lack of vesicles without concomitant oxygen sensitivity in the nodules of Casuarina; seemingly futile persistence of the photosynthesis pigments in the cyanobacterial symbiont of the coralloid roots of Macrozamiu; and extraordinary tolerance of dehydration in diazotrophic lichens. No doubt research on the lesser-known symbioses and associations will produce many other conflicts with the dogma deriving from Klebsiella, Azotobacter and soyabeans, thus forcing constructive revision of our present global view of the physiology of diazotrophy.
TRENDS A N D PERSPECTIVES IN NITROGEN FIXATION RESEARCH
17
VI. Ecology A. NEW DIAZOTROPHIC SYSTEMS
The collection and classification of the agents of diazotrophy proceeds apace; new microbes and new symbioses, including associations with animals, will continue to be added to the lists. “Ghosts” (Postgate, 1988) will probably continue to be reported annually as well, if only because there seem always to be a few research workers who remain unaware that, to be convincing, a report of a new nitrogen-fixing system must fulfill two elementary criteria. Firstly, the systems or cultures must be unequivocally free of known diazotrophs; secondly, they must demonstrate significant uptake of 5N,. An exciting development during the last two decades was the discovery of the rhizocoenoses: the mutualism between Azotobacter paspali and cultivars of Paspalum notatum and, soon after, the rediscovery of what is now known as Azospirillum with its catholic association with the roots of various Gramineae. Numerous associations between diazotrophic bacteria and the roots on monocotyledenous and dicotyledenous plant roots, without gross morphological alteration of root structure comparable to nodule formation, are now known and, though an element of specificity and mutualism is usually present, the contribution of fixed nitrogen by the diazotroph to the partnership is generally marginal (see review by Dobereiner and De Polli, 1980). In particular, the benefit of Azospirillum to the plant seems to be mainly to increase root density (Okon et al., 1988). Although this information has disappointed those who envisaged the immediate application of an equivalent of the legume symbiosis among cereals, search for natural systems capable of higher nitrogen inputs, or the genetic engineering of such systems, is still a promising area of inquiry. As far as new types of diazotroph are concerned, in two instances, Erwinia and Pseudomonas, establishment of diazotrophy in a new genus was simultaneous with the creation of diazotrophic strains of that genus by genetic manipulation (see Postgate et al., 1987). The majority of new strains had earlier been missed for two general reasons: firstly, the extreme oxygen sensitivity of some microaerobic diazotrophs was not always adequately anticipated; secondly, the rhizosphere, the “home” of many of the newer organisms, has only gradually been recognized as an exceptionally good habitat for diazotrophs, whether or not their activities benefit the plant. Most of the newer diazotrophs are conventional eubacteria; the discovery of diazotrophy among the archaebacteria, so far only among the methanogens, is an important development, particularly since it includes a clear example of thermophilic diazotrophy (see below). Inter- and intra-generic transfer of nifin eubacteria, especially on plasmids,
18
JOHN POSTCATE
is a routine operation in the laboratory and the discovery of naturally plasmid-borne nif(e.g. in rhizobia, Banfalvi et al. (1981); Lignobacter, Derylo et al. (1981);desulfovibrios, Postgate et al. (1986))renders it likely that nifgene transfer occurs in the natural environment. Location on a plasmid is not a prerequisite of such transfer: K. pneumoniae can be an effective donor of functional nif-as it was in R. A. Dixon's original gene transfer experiment (Dixon and Postgate, 1972kdespite its genes being chromosomal, because the regulon has some of the properties of a transposon (Piihler et al., 1979)and is thus mobilizable as a linkage group. Azotobacters, with their dispersed niJ; are unlikely to donate a potentially functional package, but the large nif-sym plasmids of rhizobia could well do so. From the viewpoint of ecology, and microbial systematics, this genetic fluidity implies that new diazotrophic species might arise by lateral gene transfer wherever selection pressure favours them. The present Rhizobium-Agrobacterium taxonomy may have arisen from plasmid exchange. Laboratory constructs indicate that, given appropriate selection pressure, naturally occurring diazotrophic strains of Serratia marcescens could be expected (Krishnapillai and Postgate, 1980). Although laboratory-generated diazotrophic strains exist, the normal habitats of E. coli and Proteus mirabilis are probably too nitrogen rich for natural selection of diazotrophic strains to be likely. B. EXOTIC DIAZOTROPHIC SYSTEMS
The single report of diazotrophy in truly thermophilic eubacteria (Closrridium thermosaccharolyticum and C. thermoautotrophicum; Bogdahn and Kleiner (1986)),growing optimally at 65°C urgently requires confirmation because the only earlier example of heat-tolerant eubacterial diazotrophy referred to a borderline case: the cyanobacterium Mastigocladus which grows best at 48"C, though its nitrogenase shows activity at higher temperatures (Stevens et al., 1985). Conversely, the nature, distribution and quantitative activity of psychrophilic diazotrophs, e.g. in the tundra and the oceans, raises problems on the borderline of ecology and biochemistry: Mo-nitrogenase apparently has temperature/activity relationships which cause it to allocate almost all of its electron supply to evolution of H,, not fixation of N,, at temperatures below 10-15°C (Thorneley and Eady, 1977), a property which would be expected to render it useless over the greater part of this planet's surface. Are natural nitrogenases psychrophilic and research materials atypical? Or do they use an alternative, less cold-sensitive enzyme, such as V-nitrogenase (Miller and Eady, 1989),in the real world? Is this why alternative nitrogenases exist? Since tungstate is an inhibitor of molybdenum uptake, are tungstaterich areas colonized by vanadium- or iron-based diazotrophs? The discovery of the new nitrogenases, with at least one instance in a symbiont, Azorhizobium
TRENDS AND PERSPECTIVES I N NITROGEN FIXATION RESEARCH
19
(Chan et al., 1988), raises new questions concerning the ecology of diazotrophy, not least of which arises from the fact that that the acetylene test may underestimate V-nitrogenase activity by up to 10-fold (Eady, 1988). VII. Envoi
In the 1960s the interaction of chemistry and enzymology led to some of the most dramatic advances in our understanding of the basics of biological nitrogen fixation; with the emergence of nifand later syrn genetics in the 1970s, new and equally impressive developments took place and allowed the even more recent use of molecular approaches. Understanding of the physiology of diazotrophy has gained enormously from all these advances, and the day of a “molecular ecology” of diazotrophy is dawning. In all, the recent history of research on nitrogen fixation as a fundamental scientific problem has been an example par excellence of the value of an interdisciplinary approach. The study of diazotrophy in its more biological aspects-which include ecology, symbioses per se and applied research directed towards agriculture, forestry, etc.-is the major pre-occupation of the over 150 laboratories engaged in nitrogen fixation research throughout the world. At the penultimate meeting of the International Biological Programme, fewer than 10% of some 112 contributing laboratories were in any sense working on the fundamental aspects which have provided the main theme of this article. Given the economic importance of nitrogen fixation for the future of mankind, that is probably a reasonable distribution of research effort. But the ecologist and applied scientist must be constantly alert to the developments taking place at more fundamental levels, because they bear upon their methods and outlooks, which themselves require continuous revision and renewal. There is an information cycle, in which observations arising from research in the field raise questions at a fundamental level and investigation of these, while rarely providing simple answers, compels revision of more practical approaches. Today the science is in a period in which spectacular developments are taking place at fundamental levels and the input from those developments, into both basic science and research into the real world, will be spectacular in their turn. REFERENCES
Aguilar. 0.M., Yates, M. G . and Postgate, J. R. (1985).JournalqfGeneral Microbiology 131,3141. Alazard, D. I., Ndoya, 1. and Dreyfus, B. (1988). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 765-769. Gustav Fischer, Stuttgart and New York. Alef, K., Arp, D. J. and Zumft, W. G. (1981). Archives of Microbiology 130, 138. Aloysius, S. K. D. and Paton, A. M. (1984). Journal of Applied Bacteriology 56, 465.
20
JOHN POSTGATE
Arnold, W., Rump, A,, Klipp, W., Priefer, U. B. and Piihler, A. (1988). I n “Nitrogen Fixation: Hundred Years After”(Pr0ceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds). p. 303. Gustav Fischer, Stuttgart and New York. Arp, D. J. and Zumft, W. G . (1983). Journul qfBacferiolog.y 153, 1332. Bali, A., Hill, S., Santero, E., Toukdarien, A., Walmsley, J. and Kennedy, C. (1988). I n “Nitrogen Fixation: Hundred Years After”(Pr0ceedings of the 7th International Symposium on Nitrogen Fixation)(H.Bothe. F. J. deBruijn and W. E. Newton, eds), p. 316. Gustav Fischer, Stuttgart and New York. Banfalvi. Z., Randhawa. G . S., Kondorosi, E., Kiss, A. and Kondorosi, A. (1981). Molecular and General Genetics 184, 3 18. Belay, N., Sparling, R. and Daniels, L. (1984). Narure, London 312, 286. Bishop, P. E.. Premuker, R., Joeger, R. D., Jacobsen, M. R.. Dalton, J. A,, Chisnall, J. R. and Wolfinger, E. D. (1988). I n “Nitrogen Fixation: Hundred Years After” (Proceedings ofthe 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 71-79. Gustav Fischer, Stuttgart and New York. Bogdahn, M. and Kleiner. D. (1986). Archives qf Microbiology 144, 102. Bortels, H. (1930). Archivfur Mikrobiologie 1, 333. Bothe, H., delruijn, F. J. and Newton, W. E. (eds) (1988). “Nitrogen Fixation: Hundred Years After” (Proceedings o f the 7th International Symposium on Nitrogen Fixation). Gustav Fischer, Stuttgart and New York. Chan, Y.-K., Pau. R., Robson, R. L. and Miller, R. W. (1988). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), p. 88. Gustav Fischer, Stuttgart and New York. Chatt, J., Pearman, A. J. and Richards, R. L. (1987). Journul qfrlie Cheniicul Society (Dalton) 1852. Clark, F. E. and Rosswell. T. (eds) (1981).“Terrestrial Nitrogen Cycles”, Ecological Bulletin No. 33. Swedish Natural Research Council, Stockholm. Clement, H. (1980). “The Nitrogen Fix.” Ace Books, New York. Dean, D. R., Brigle, K. E., May, H. D. and Newton, W. E. (1988). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 107-1 14. Gustav Fischer, Stuttgart and New York. Deistung. J. and Thorneley, R. N. F. (1986). Biochemicul Journul 239, 69. Delwiche, C. C. (1977). Scienrific American 223(3), 137. Derylo, M., Glowacka, M., Skorupska, A. and Lorkiewicz, 2. (I98I). Archives u / Microhio/ogy 130, 322. Dilworth. M.J. (1987). Philusnphicuf Transactions of the Rqvul Society of London, S e r k B 317, 279. Dilworth, M. J.. Eady, R. R., Robson, R. L. and Miller, R. W. (1987). Nurure, London 273, 197. Dixon, R. A. (1988). In “The Nitrogen and Sulphur Cycles” (42nd Symposium of the Society for General Microbiology) (J. A. Cole and S. J. Ferguson, eds), pp. 417438. Cambridge University Press. Cambridge. Dixon, R. A. and Postgate, J. R. (1972). Nature, London 237, 1102. Dobereiner, J. and De-Polk H. (1980). In “Nitrogen Fixation” (Proceedings of the Phytochemical Society of Europe’s Symposium Number 18) (W. D. P. Stewart and J. R. Gallon, eds), pp, 301-333. Academic Press, London. Eddy, R. R. (1986).Molecular biology. In “Nitrogen Fixation”. vol. 4, pp, 149.Clarendon Press, Oxford. Eady, R. R. (1988). EioFuctor.7 I, 111. Eady, R. R.. Robson, R. L., Pau, R. N., Woodley, P., Lowe, D. J., Miller. R. W.,Thorneley, R. N. F., Smith, B. E., Gormal. C., Eldridge, M. and Bergstrom, J. (1988). In “Nitrogen Fixation: Hundred Years After”(Pr0ceedings of the 7th.lnternational Symposium on Nitrogen Fixation) (H. Bothe. F. J. deBruijn and W. E. Newton, eds), pp. 81-86. GUStdV Fischer, Stuttgart and New York. Evans, H. J., Bottomley, P. J. and Newton, W. E. (eds) (1985). “Nitrogen Fixation Research
TRENDS A N D PERSPECTIVES IN NITROGEN FIXATION RESEARCH
21
Progress” (Proceedings of the 6th International Congress on Nitrogen Fixation). Martinus Nijhoff, Dordrecht. Evans, H. J., Zuber, M. and Dalton, D. A. (1987). Philosophical Transactions qfthe Royal Society of London, Series B 317, 209. Hales, B. J. and Case, E. E. (1987). Journal of Biological Chemistry 262, 16205. Haselkorn, R., Golden, J. W., Lammers, P. J. and Mulligan, M. E. (1987). Philosophical Transacrions of the Royal Sociery of London, Series B 317, 173. Hawkes, T. R., McLean, P. A. and Smith, B. E. (1984): Biochemical Journal 217, 317. Henderson, R.A., Leigh, G. F. and Pickett, C. J. (1 983). Advances in Inorganic and Radiochemistry 27, 192. Hennecke, H., Kaluza, K., Thony, B., Fuhrmann, M., Ludwig, W. and Stackebrandt, E. (1985). Archives of Microbiology 142, 342. Hill, S. (1988). FEMS Microbiology Reuiew 54, 111. Hoover, T., Imperial, J., Ludden, P.and Shah, V. (1988). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), p. 127. Gustav Fischer, Stuttgart and New York. Howard, K. S., McLean, P. A., Hanson, F. B., Lemlay, P. D., Koblan, K. S. and Orme-Johnson, W. H. (1986). Journal of Biological Chemistry 262, 772. Imperial, J., Shah, V. K., Hoover, T. R. and Ludden, P. (1988). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), p. 128. Gustav Fischer, Stuttgart and New Ycrk. Johnston, A. W. B., Firmin, J. L. and Rossen, L. (1988). In “The Nitrogen and Sulphur Cycles” (42nd Symposium of the Society for General Microbiology) (J. A. Cole and S. J. Ferguson, eds), pp. 439455. Cambridge University Press, Cambridge. Jouanneau, Y., Wong. B. and Vignais, P. M. (1985). Biochimica el Biophysica Aria 808, 149. Kennedy, C. and Toukdarien, A. (1987). Annual Reviews of Microbiology 41, 227. Kentemich, T., Danneberg, C. and Bothe, H. (1988). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), p. 89. Gustav Fischer, Stuttgart and New York. Klugkist, J. and Haaker, H. (1984). Journal qf Bacteriology 157, 148. Krishnapillai, V. and Postgate, J. R. (1980). Archiues of Microbiology 127, 115. Leigh, G. J. and Postgate, J. R. (1985). In “Gas Enzymology” (H. Degn, R. P. Cox and H. Toftland, eds), pp. 229-246, D. Reidel, Odense. Maryan, P.,Eady, R. R.. Chaplin, A. E. and Gallon, J. R. (1986). FEMS Microbiology Letters 34, 251. Merrick, M. J. (1988a).In “The Nitrogen and Sulphur Cycles”(42nd Symposium of the Society for General Microbiology) (J. A. Cole and S. J. Ferguson, eds), pp. 331-361. Cambridge University Press, Cambridge. Merrick, M. J. (1988b). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 293-302. Gustav Fischer, Stuttgart and New York. Miller. R. W. and Eady, R. R. (1989). Biochemical Journal 256,429. Murray, P. L. and Zinder, S. H. (1984). Nature, London 312, 284. Newton, W. E. (1987). Philosophical Transactions of /he Royal Sociery of London, Series B 317, 259. Newton, W. E. (1988). In “Nitrogen Fixation: Hundred Years After’’ (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 43-50. Gustav Fischer, Stuttgart and New York. Nieva-Gomez, D., Roberts, G. P., Klevickis, S. and Brill, W. S. (1980). Proceedings ef the National Academy of Sciences of the United States of America 77, 2555. Nikinova, L. A,, Rummel, S., Shilov, A. E. and Wahren, M. (1980). Nouveau Journal de Chimie 4, 427430. Novick. A. and Horiuchi, T. (1962). Cold Spring Harbour Syniposia on Quanrirative Biology 26, 239. Okon, Y., Fallick, E., Arig, S., Yahalom, E. and Tal, S. (1988). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H.
22
JOHN POSTGATE
Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 741-746. Gustav Fischer, Stuttgart and New York. Paul, W. and Merrick. M. J. (1987). European Journal of Biochemistry 170, 259. Paul, W. and Merrick, M. J. (1988). 1n“Nitrogen Fixation: Hundred Years After”(Pr0ceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe. F. J. deBruijn and W. E. Newton. eds), p. 316. Gustav Fischer, Stuttgart and New York. Pickett, C. J., Cate, K., Macdonald, C . J., Mohammed, M. Y.,Ryder, K. S. and Talarmin, J. (1988). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation)(H. Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 51-56. Gustav Fischer, Stuttgart and New York. Post. E., Kleiner, D. and Oelze, J. (1983). Archives qf Microhiologj) 134, 68. Postgate, J. R. (1982). “The Fundamentals of Nitrogen Fixation”. Cambridge University Press, Cam bridge. Postgate, J. R. (1987). Journal of Applied Bacterio/og.v 63, 85s. Postgate, J. R. (1988). New Scientist (1598) 49. Postgate, J. R. and Eady, R. R. (1988). 1n“Nitrogen Fixation: Hundred Years After”(Pr0ceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 31-42. Gustav Fischer, Stuttgart and New York. Postgate, J. R.. Dixon, R., Hill, S. and Kent, H. (1987). Philosophical Transactions q f t h e Royal Society of London. Series B 317, 227. Postgate. J. R., Kent, H. M. and Robson. R. L. (1986). FEMS Microbiology Letters 33, 159. Postgate, J. R., Kent, H. M. and Robson, R. L. (1988). 1n“The Nitrogen and Sulphur Cycles”(42nd Symposium of the Society for General Microbiology) (J. A. Cole and S. J. Ferguson, eds), pp. 457471. Cambridge University Press, Cambridge. Piihler, A., Burkhardt. H. J. and Klipp, W. (1979). In “Plasmids of Medical, Environmental and Commercial Importance” (K. N. Timmis and A. Piihler, eds), pp. 435-447. Elsevier-North Holland, Amsterdam. Ramos, J. R. and Robson, R. L. (1985a). Journal qf General Microbio1og.y 131, 1449. Ramos. J. R. and Robson, R. L. (1985b). Journal OJ Bacteriology 162, 746. Shah, V. K., Hoover,T. R., Imperial, J., Paustian,T. D., Roberts, G. P. and Ludden, P. W. (1988). In “Nitrogen Fixation: Hundred Years After’’ (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 115-120. Gustav Fischer, Stuttgart and New York. Sibold. L. and Souillard, N. (1988). In “Nitrogen Fixation: Hundred Years After” (Proceedings of the 7th International Symposium on Nitrogen Fixation) (H. Bothe, F. J. deBruijn and W. E. Newton, eds), pp. 705-710. Gustav Fischer, Stuttgart and New York. Smith, R. W. and Dean, A. C. R. (1971). Journul of Generul Microbiology 72, 37. Sprent. J. I. (1987). “The Ecology of the Nitrogen Cycle”. Cambridge University Press, Cambridge. Sprent, J. I. and Raven, J. A. (1987). Proceedings ofthe Rovul Sociery of Edinburgh, Series B 85, 215. Stevens, S. E.. Mehta, V B. and Lane, L. S. (1985). In “Nitrogen fixation and C 0 2 metabolism”. (P. W. Ludden and J. E. Burris, eds), pp. 236243. Elsevier, New York. Thorneley, R. N. F. and Eddy. R. R. (1977). Biochemical Journal 167, 457. Thorneley. R. N. F. and Lowe, D. J. (1985). In “Molybdenum Enzymes” (T. Spiro, ed.), pp. 221-284. Wiley, London. Towe, K. M. (1983). Precambrian Research 20, 161. Walker, G. A. and Mortenson, L. E. (1974). Journal ofBiologica1 Chemistry 249,6356. Yates, M. G. (1972). FEBS Letters 27, 63. Yates, M. G. (1988). In “The Nitrogen and Sulphur Cycles” (42nd Symposium of the Society for General Microbiology) (J. A. Cole and S. J. Ferguson, eds). pp. 383-416. Cambridge University Press. Yates, M. G. and Robson, R. L. (1985). Journal of General Microbiology 131, 1459. Zilberstein. A., Koncz, C., Kaufman, R.. Geva, N.. Zamir, A. and Schell, J. (1988). In “Nitrogen Fixation: Hundred Years After”(Pr0ceedings of the 7th International Symposium on Nitrogen Fixation)(H. Bothe, F. J. deBruijn and W. E. Newton, eds), p. 648. Gustav Fischer, Stuttgart and New York.
Apomixis in Saccharomyces cerevisiae and Other Eukaryotic Micro-organisms CARL A. BILINSKI," NELSON MARMIROLIb and JOHN J. MILLER' Research Department, Labatt Brewing Company Limited, London N6A 4M3, Ontario. Canada, 'Instituto di Cenetica, Universita di Parma, 43100 Parma, Italy, and 'Department of Biology. McMaster University, Hamilton U S 4K1,Ontario, Canada
a
I. Introduction: occurrence of apomixis in yeast .
.
11. The meaning of apomixis in plants, animals and fungi
.
.
. .
111. Apomixis in some eukaryotic micro-organisms . . . . IV. Inheritance of apomixis in yeasts . . . . . . . V. Environmental modification of the apomictic phenotype . VI. Timing of events controlling the manner of nuclear division VII. Nucleomitochondrial interactions in facultative apomixis . VIII. Ecology of apomixis in yeasts . . . . . . . . IX. Concluding remarks . . . . . . . . . . References . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
. . . .
. . . .
. . . .
. . . .
.
.
.
.
.
. .
.
.
.
.
.
.
23 26 29 33 36 39
.
41
.
42 46 48
.
I. Introduction: Occurrence of Apomixis in Yeast Sporulation in a cell of Saccharomyces cerevisiae is normally preceded by meiotic division of the diploid vegetative nucleus, and each of the resulting four haploid nuclei becomes enclosed within a developing spore. The four spores (ascospores) in the differentiated cell (now termed the ascus) can mate in pairs immediately upon germination to initiate clones of diploid vegetative cells, or mating may be delayed for an indefinite number of haploid vegetative generations. The process of cell fusion involved in mating is under control of the mating-type loci, designated M A T a and MATu. A M A T a cell will mate only with a MATu cell, and vice versa. The number of spores in each ascus is typically four, but this is not invariable. In virtually any sporulated culture, asci containing one, two or three spores are also found. The average number of spores per ascus is known ADVANCES I N MICROBIAL PHYSIOLOGY, VOL. 30 ISBN 0-12-027730-1
Copynght 0 1989, by Academic Press Ltmited All rights of reproduction in any form reserved
24
CARL A. BILINSKI. NELSON MARMlROLl A N D JOHN J. MILLER
to be influenced by a number of factors. These are as follows: (1) Although the sole nutrient required in a sporulation medium for optimum sporulation of most strains is a carbon source, e.g. potassium acetate, some asci develop in water or buffer and these are mainly two-spored. Effects of kind or concentration ofcarbon source, presence of other nutrients, and some other conditions of culture on number of spores per ascus were summarized by Miller (1981).Two-spored ascus production seems nutritionally less exacting than production of spore tetrads. A number of compounds, when added to sporulation medium, lower the frequency of spore tetrads, e.g. urethane, glutamic acid (Miller, 1963),cycloheximide (J. J. Miller, unpublished observations). (2) Conditions in presporulation growth medium are also important, e.g. omission of inositol (Tremaine and Miller, 1954) or presence of ethidium bromide for one generation of growth (Kuenzi et al., 1974) increase twospored ascus production. Bilinski et al. (1986, 1987a,b) found evidence that tetrad formation in polyploid brewing yeasts required presporulation growth under conditions in which respiratory and carbon catabolite-repressible gene functions were completely derepressed. Tetrad percentages can also be affected by temperature (reviewed by Bilinski and Casey, 1989; Miller, 1989). (3) Haber and Halvorson (1972) found that newly formed cells produced fewer spores and sporulated more slowly than larger, older, budded cells. This was confirmed by the observation of Sando et al. (1973) that the number of spores formed in a cell was affected by its stage in the vegetative cell cycle. (4) The importance of genetic background is indicated by many examples, e.g. Adams (1 950), Fowell(1951, 1967),Fowell and Moorse (1960).Grewal and Miller (1972)also found wide variation in average numbers ofspores per ascus among yeast strains. Klapholz and Esposito (1980a) detected modifiers that decrease the number of spores formed per ascus as well as total ~ S C U S production. By mutagenesis with ethyl methanesulphonate, Okamoto and Iino (1981) obtained a recessive mutation that caused production of predominantly two-spored asci. Panek et al. (1985) found no spore tetrads in asci of diploids low in trehalose synthase activity.
Cytological, genetical and biochemical studies (reviewed by Miller, 1981) have shown that the nuclei enclosed in the spores of such two-spored asci are haploid and, in fact, two unenclosed (epiplasmic) nuclei are visible in each ascus. Nuclei in these spore pairs are frequently non-sister since they are derived from separate meiosis 11 divisions and, hence, their enclosure is indicated to be not random. This characteristic of two-spored asci was used by Srivastava et al. (1983)to develop a novel, rapid technique for gene mapping in yeast. In a few instances asci containing two uninucleate spores lacking discarded
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
25
epiplasmic nuclei have been produced experimentally. Schild and Byers (1980) obtained two cell division-cycle mutants in which ascus walls formed around the products of meiosis I, producing two viable diploid spores per ascus. Haploid strains disomic for chromosome 111 formed two-spored asci (Roth and Fogel, 1971; Wagstaff et al., 1982). Chromosome 111 carries the matingtype gene which must normally be heterozygous (MA Ta/MATa) for sporulation to occur (Roman and Sands, 1953). Three strains of Sacch. cereuisiae are known that normally produce two spores per ascus and lack epiplasmic nuclei. These resulted from a search for highly sporogenic strains by J. J. Miller during 1964-1969 for use in a study of changes in chemical composition during sporulation. Of 25 1 strains obtained from culture collections and individuals, 140 were sporogenic (arbitrarily defined as producing at least 1% asci under the conditions employed). In 15 of these the asci were predominantly two-spored. The latter strains were studied cytologically by N. S. Grewal as part of a research project for a graduate degree at McMaster University, and in three, which produced exclusively twospored asci, the nucleus in the ascus divided only once. It was concluded that the spores were diploid because conjugations never occurred when they germinated, their DNA content was equal to that of the vegetative cells and clones derived from single spores were competent to sporulate (Grewal and Miller, 1972). The three strains comprised a highly sporogenic strain, designated 19e1, obtained from Station Agronomique et Oenologique de Bordeaux, France, where it was isolated from a natural fermentation, and strains 4098 and 41 17 from the American Type Culture Collection, which lists them as German white wine and Menes wine yeasts, respectively. The 19el strain was also obtained from the Czechoslovak Collection of Microorganisms, Brno, designated as Sacch. cereuisiae strain 292. Sporulation in which a single nuclear division occurred in the ascus was described by Guilliermond (1903) in Sacch. pastorianus. The asci were twospored and conjugation between germinating spores was not observed. Renaud (1937) isolated from wine fermentations three Saccharomyces strains that produced predominantly two-spored asci. Conjugations were rarely observed among germinating spores and, when asci were placed in a growth medium long enough for the spores to swell and commence budding, and then transferred to a sporulation medium, pairs of new spores developed directly within both of the spores in a given ascus or in the buds developing from them. Unfortunately, Renaud did not attempt to determine the manner of nuclear division in the asci of these yeasts. Apparently, other genera of yeasts may also sporulate without meiotic nuclear division. Manuel (1937) found with certain species of Hansenula and Pichia that, although sporulation of single cells occurred, there was no evidence of conjugation at any stage of spore germination or vegetative
26
CARL A. BILINSKI. NELSON MARMlROLl A N D JOHN J. MILLER
growth. Again, nuclear cytology in the ascus was not studied. Using genetical techniques, Henninger (1973) studied the developmental cycle of Endomycopsis fibuliger, which had been shown by Guilliermond (1909) to lack conjugation, and concluded that the asci (two- to four-spored) formed from haploid vegetative cells. Henninger and Emeis (1974) using similar methods with two strains of Lipomyces showed that neither vegetative cells nor spores were haploid. There was no evidence for either conjugation or meiosis in the developmental cycle. A mutant of Schizosaccharomyces pombe that produced two uninucleate, diploid spores per ascus has been found to lack conjugation (Nakaseko e f al., 1984).Evidently, only the first division of meiosis occurred in the developing asci. The term “apomixis” was applied by Henninger (1973) and by Henninger and Emeis (1974) to the two types of developmental cycle they described in Endomycopsis and Lipomyces species, following the usage of Gaumann ( 1 926), and the term has also been applied to the two-spored Sacch. cereuisiae of Grewal and Miller (Moens et al., 1977; Bilinski and Miller, 1980; and others). Succharomyces strains have obvious advantages as the experimental organism for investigating morphogenesis of eukaryotes, which are well summarized by Breitenbach and Lachkovics (1983). These include ease of culture of both haplophase and diplophase, short generation time, ability to induce and control meiosis and sexual conjugation, ability to isolate and grow all four products in each meiotic tetrad, and the availability of a detailed genetic map. As a result, since the discovery of apomictic strains of Saccharomyces in 1972, a considerable volume of research has appeared which has much advanced the knowledge of this infrequent mode of yeast reproduction. This should be of value in understanding induction of apomixis in organisms less convenient for experimental study. The purposes of this review are to survey the occurrence of apomixis in micro-organisms, outline the basic molecular information on apomixis derived from yeast, and assess its relevance to apomixis-related cellular phenomena. 11. The Meaning of Apomixis in Plants, Animals and Fungi
The term “apomixis” has long been used in reproductive biology. It derives from two Greek words-apo meaning away from and mixis meaning the act of mingling(Websterj-and was first applied by Winkler (1906, 1908) to the loss of sexual reproduction (amphimixis) and its replacement by an asexual multiplication process not involving cell and nuclear fusion. His 1908 review discussed the occurrence of apomixis in the plant kingdom and distinguished three types, namely vegetative propagation (reproduction by sprouts, etc.), apogamy (sporophyte originating from vegetative cells of gametophyte) and
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
27
parthenogenesis (sporophyte originating from diploid or haploid egg without fertilization). Concerning bacteria and blue-green algae, he stated that, although these organisms apparently only multiplied asexually, they should not be called apomictic since there was no evidence that they had ever had sexual reproduction and thus could not be said to have lost it. Stebbins (1950) noted that differences of opinion arose among botanists concerning correct terminology, since apomictic phenomena are complex and advances in plant morphology and genetics since the time of Winkler necessitated much re-interpretation. In the classification of apomictic phenomena in plants developed by Gustafsson (1946) and modified by Stebbix (1 950), apomixis includes all forms of vegetative reproduction (e.g. by bulbs, runners and rhizomes) as well as agamospermy, reproduction by means of embryos and seeds produced without fertilization. There are two types of agamospermy: (1) adventitious embryony, in which embryos develop from the diploid tissue of the nucellus (the central tissue of the ovule) or of the ovule integument and (2)gametophytic apomixis, in which a diploid gametophyte (morphologically resembling the usual haploid gametophyte) arises as a result of some method of circumventing meiosis. This can happen either by developing the diploid gametophyte directly from a cell of the nucellus or of the integument (=apospory), or by the development from a cell of the archesporium in which the usual meiotic nuclear divisions do not occur and there is no chromosome reduction (= diplospory). The 2N gametophyte that results from either apospory or diplospory gives rise to an embryo through multiplication of the egg cell (=parthenogenesis)or of one of the other cells of the gametophyte ( = apogamety). Nogler (1984) has recently reviewed gametophytic apomixis in plants. In zoology, a somewhat different terminology has been used. All types of reproduction involving development of the egg cell into a new individual without fertilization are called parthenogenesis by Suomalainen (1 950) and Suomalainen et al. (1976, 1987). In a systematization based on cytological events, three types of parthenogenesis were distinguished: (1) In haploid parthenogenesis eggs in which chromosome reduction has occurred develop into haploid individuals. In some groups of animals it is very important, e.g. male bees develop in this manner. ( 2 ) Automictic parthenogenesis in which chromosome reduction occurs in the narmal manner and the diploid chromosome number is restored by fusion of two of the haploid nuclei. (3) Apornicticparthenogenesis in which there is no chromosome reduction or nuclear fusion. Only one maturation division occurs in the eggs and this division is equational.
The latter two types of parthenogenesis were grouped under the inclusive term
28
CARL A. BILINSKI. NELSON MARMIROLI A N D JOHN J MILLER
diploidparthenogenesis by Beatty (1957), who defined apomixis in animals in a broader sense, i.e. “development without fusion of reproductive cells of opposite sex.. . the embryo is derived from the female parent only”. Beatty’s usage has not been generally adopted. Thus, in the treatise by White (1973) apomixis in animals was defined, similarly to Suomalainen’s apomictic parthenogenesis, as the production of individuals by a process that does not involve fertilization and in which meiosis is entirely suppressed. In the publications of Strunnikov (1978) and his coworkers ameiotic parthenogenesis is equivalent to Suomalainen’s apomictic parthenogenesis. In mycology the terminology derives mainly from Gaumann (1 928), who listed three forms of fertilization that occur in fungi: (1) Amphimixis, the conjugation of sexual cells that are not closely related. (2) Automixis, the conjugation of closely related sexual cells. (3) Pseudomixis, the conjugation of vegetative cells.
Reproduction that occurred by the vegetative development of sexual cells in the absence of fertilization was termed apomixis. He recognized two kinds of apomixis, parthenogenesis, the apomictic development of haploid cells and apogamy, the apomictic development of diploid cells. Burnett’s (1976) treatise designates as apomictic (or amictic) “fungi which appear to possess all the attributes of normal sexual reproduction but on investigation are found to lack both meiosis and fertilization”, and states that, although it has not often been detected, there is good evidence for its occurrence in all three major groups of fungi. In order to relate research on yeast apomixis to that with other organisms, it is useful to consider the classification that would be given to the types of reproduction found in the two-spored Such. cereuisiue strains of Grewal and Miller (1972), and also in typical meiotic strains, using terminology currently employed with the three foregoing biotic groups. Under the GustafssonStebbins system for plants, both the two-spored and the meiotic strains are apomictic because of their asexual reproduction by budding. The meiotic strains also, of course, reproduce by the normal sexual process, and the twospored strains show gametophytic apomixis involving diplospory (single nuclear division in the ascus) and parthenogenesis (development from the diploid spore without fertilization). Under Suomalainen’s system for animals based on cytology, two-spored yeast strains are examples of apomictic parthenogenesis. Typical meiotic strains can be regarded as examples of automictic parthenogenesis in those frequent instances where conjugation occurs in the asci between germinating spores of the same tetrad, or as examples of sexual reproduction ( = gamogony or zygogenesis) where conjugation occurs between spores from different asci or between haploid cells derived from them. Meiotic strains also exemplify haploid parthenogenesis,
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
29
since their haploid spores can, on germination, yield haploid cells that can multiply without fertilization. Asexual reproduction in the diploid phase ( = agamogony), e.g. cell division of protozoa, is not included under parthenogenesis, but we may note that budding of diploid cells is the commonest form of reproduction in strains of Saccharomyces. Applying Gaumann’s mycological scheme, the two-spored strains are obviously apomictic (and apogamic). The haploid spores of meiotic yeast strains, however, are also capable of apomictic development (parthogenesis sensu Gaumann), since they can develop in the absence of fertilization. Since conjugation in the meiotic yeasts can occur between spores from the same or from different asci and between vegetative cells derived from spores, most strains are also capable of Gaumann’s three types of fertilization (see above). Asexual reproduction, e.g. by conidia, hyphal fragmentation or budding, was not included in fungal apomixis by Gaumann. We refer to the process of sporulati.on in our two-spored Saccharomyces strains as apomixis, since this is in accord with accepted usage in mycology (Gaumann, 1926; Burnett, 1976). It has been used previously in this sense in strains of Saccharomyces (Moens et al., 1977; Bilinski and Miller, 1980; Marmiroli et al., 1981a) and in other yeasts (Henninger, 1973; Henninger and Emeis, 1974). The expression “single division meiosis” (Klapholz and Esposito, 1980a)seems inappropriate, since the word meiosis (Gr. meioun = to make smaller) implies reduction, yet a striking feature of sporulation in these yeasts is the absence of reductional division. “Meiotosis” (Esposito and Esposito, 1979) has the same disadvantage. White (1973) referred to certain instances of parthenogenesis in animals asfacultative since it could be induced artificially. Although diploid spore production in our predominantly twospored yeasts is a genetically-determined trait (Klapholz and Esposito, 1980a), evidence (Bilinski and Miller, 1980, 1984; Marmiroli and Bilinski, 1985) that the correct meiotic phenotype with haploid spore production can be rescued by environmental manipulation would justify designation of their sporulation as ,facultative apomixis. 111. Apomixis in some Eukaryotic Micro-organisms
In one sense of the meaning of apomixis in zoology (see p. 27), haploid apornixis is a normal mode of reproduction in most fungi. That is, haploid cells resulting from meiotic divisions may develop into haploid thalli, which are normally of brief duration as in basidiomycetes or of long duration as in ascomycetes, before fertilization and zygote formation occur. In many fungi, haploid thalli reproduce themselves by producing haploid spores asexually and, in one subdivision of the fungi (Deuteromycotina), no true sexual
30
CARL A. BILINSKI, NELSON MARMIROLI A N D JOHN J. MILLER
reproduction occurs. Here we restrict the meaning of apomixis (after Burnett, 1976)to reproduction of fungi which produce sexual structures but which lack both meiosis and fertilization. We will treat as haploid apomixis formation of haploid spores or cells by such sexual structures, and as diploid apomixis instances in which they form diploid spores or cells. Automixis, the reproductive process in which a new diploid individual arises from fusion of haploid nuclei produced from a single meiotically dividing nucleus (Gaumann, 1926; Mogie, 1986), will not be considered here. Emerson (1950) cited examples of apomixis in species of Allomyces (Chytridiomycetes) in which haploid and diploid thalli alternate in the life cycle. Nuclei in resistant sporangia borne on the diploid normally undergo meiosis in formation of uninucleate zoospores each of which can give rise to a haploid thallus. In certain isolates these zoospores developed without fertilization and with high frequency into diploid thalli, a process that was favoured by good nutrition. This may be an example of diploid apomixis. Deacon (1980)noted that many Oomycete fungi, which normally require two mating types to develop sexual spores, may develop them directly from the female sex organ and thus obtain the survival advantage of these resistant spores when one of the mating types is lost. The Zygomycete Syzygites megalocarpus (Cutter, 1942) shows no nuclear fusion or meiosis at any stage in its life cycle, yet it develops sexual structures characteristic of other Mucorales (multinucleate gametangia and zygospores). In ascomycetes the instances of diploid apomixis in Saccharomyces species already cited have been the object of more cell biological research than apomixis in any other micro-organism, and this will be discussed in detail later. Examples of diploid apomixis in other yeasts are strains of Lipomyces starkeyi and L. kononenkoae, studied by Henninger and Emeis (1 974), which lacked meiosis and in which neither vegetative cells nor spores were haploid, and a mutant of Schiz. pombe lacking conjugation in which two uninucleate, diploid spores developed in each ascus (Nakaseko et al., 1984). Endomycopsis fihuliger, which lacks conjugation and in which asci develop from haploid vegetative cells (Henninger, 1973), evidently undergoes haploid apomixis. Since nuclei of mycelial ascomycetes are typically haploid (although some instances of diploidy in this group of fungi are listed in the review of Caten and Day, 1977), apomixis here, when it occurs, must be usually of the haploid type, Gaumann (1940) cited instances of ascomycetes whose antheridia are functionless or absent, and in which ascospore development is not preceded by nuclear fusion or meiotic division. In an important group of plant parasites, the Erysiphales (powdery mildews), he considered most strains to be apomictic. Nuclear behaviour preceding ascospore formation may vary. In Ascobolus equinus (Bjorling, 1944) the single haploid nucleus in the young ascus undergoes three mitoses to form the nuclei of the eight ascospores, and
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
31
in Podospora arizonensis (Mainwaring and Wilson, 1968) the young ascus is initially binucleate but no fusion occurs, both nuclei divide twice mitotically, and eight ascospores result. Bjorling (1944) drew attention to the fact that, although apomixis is of common occurrence in plants, it is comparatively rare in ascomycete fungi. The vegetative mycelium of most basidiomycetes is dikaryotic and nuclear fusion followed by meiosis precedes formation of basidiospores, which are thus haploid, and on germination they initiate haploid mycelia. In the corn smut fungus (Ustilago maydis; Ustilaginales), haploid mycelia are not pathogenic and fusion between mycelia of compatible mating types to restore the dikaryotic phase must precede development of the smut disease. Holliday (1961) studied strains of this fungus in which about 10% of the basidiospores were “solopathogenic”, i.e. capable of initiating disease development independently, and he attributed this to failure of reduction at meiosis so that the basidiospores were diploid. Similarly, some isolates of two species of basidiomycetous yeasts, Rhodosporidium toruloides (Banno, 1967) and Rhodosp. sphaerocarpum (Newell and Fell, 1970) were shown capable of producing teliospores, which normally precede basidiospore formation, without conjugation, and germination of the diploid uninucleate teliospores did not involve meiosis. This process, termed “self-sporulation” by Newell and Fell (1970), is probably diploid apomixis. Haploid apomixis has often been described in basidiomycetes and the literature on this subject was surveyed by Prillinger (1 982),who cited many examples. Features of life cycles indicative of this phenomenon are: basidia bearing two instead of four haploid uninucleate basidiospores, uninucleate instead of binucleate young basidia, absence of nuclear fusion and meiosis, and uninucleate mycelia lacking clamp connections. Fruiting bodies of Schizophyllum commune, which formed in monokaryotic cultures originating from single basidiospores, bore twospored basidia (Esser et al., 1979),and their morphogenesis was controlled by three pleiotrophic genes acting in sequence, as in dikaryotic fruiting. Diploid apomixis is also found in the true slime moulds (Myxomycetes). In this class of organisms, multinucleate plasmodia containing diploid nuclei grow in size by fusing with other plasmodia and by nuclear divisions; at maturity they develop sporangia in which the protoplasm cleaves into uninucleate spores (see Alexopoulos and Mims, 1979). Meiosis evidently occurs in young spores which become uninucleate and haploid through disintegration of all but one nucleus. The diploid plasmodia1 stage is restored through fusion of myxamoebae or flagellated swarm cells that emerge from germinating spores. In his review of myxomycete genetics, Collins (1981)concluded that a common life-cycle mode in these organisms is apomixis and that in nature this mode may alternate with the sexual modes so that either one can predominate at a particular time or location. Of 44 isolates of Didymium
32
CARL A. BILINSKI. NELSON MARMlROLl A N D JOHN J MILLER
iridis studied by Betterley and Collins (1983), 12 were sexual (i.e. requiring fusion of haploid cells of opposite mating types for plasmodia1 development). Lack of evidence for meiosis and nuclear fusion in the others indicated a 2N-2N apomictic life cycle. Co-existence of sexual and apomictic strains may be widespread among myxomycete species (Collins, 198 1, 1986). Instances of diploid apomixis in protozoa are described in the review of Raikov (1972). For example, sexual reproduction in the diploid ciliate Paramecium pufrinum normally involves conjugation of two cells of compatible mating type followed by meiosis and exchange of haploid nuclei. In certain strains, however, conjugation occurred but meiosis, chromosome reduction and exchange of nuclei were not observed; the haploid phase had evidently been lost. Occasionally, a mutation appeared in such strains that restored the typical sexual mode of reproduction. Apomixis is common in the rotifers (Rotatoria), Of the two classes into which this invertebrate phylum is commonly divided (see Pennak, 1978), virtually all species in the class Digononta appear to lack males and reproduce parthenogenetically. In the Monogononta, which comprise about 90% of the known rotifer species, males occur only one to several weeks each year. At other times, the females, whose body cells are diploid, reproduce apomictically by producing eggs that undergo only one, non-reductional, division in the ovary during maturation and are thus diploid and hatch into females. Another type of female (mictic) eventually appears. It produces haploid eggs which become “resting” or “winter” eggs if fertilized, or which develop into haploid males if not. The resting eggs hatch into females which reproduce apomictically . In different classes of algae, development of single gametes into new haploid individuals without fusion has often been reported (Ettl et al., 1967; Bold and Wynne, 1978). Reproductive behaviour that may be equivalent to Saccharomyces-type diploid apomixis seems less frequent but does occur, as the following examples show. In a unicellular group, the pennate diatoms (class Bacillariophyceae, order Bacillariales), vegetative cells are diploid and, in sexual reproduction, produce non-motile gametes, usually one or two per cell. The cells (now gametangia) conjugate and the gametes fuse to form zygotes which then deveiop into auxospores. In some races of Cocconeis pfucentufuthere is no conjugation. A single nuclear division replaces the two steps of meiosis, and development of diploid auxospores follows (Drebes, 1977). In the red algae (Rhodophyceae), meiosis typically occurs in terminal cells (sporangia) on filaments of the diploid tetrasporophyte plants, and each meiosis results in the formation of a row or tetrad of four spores, each of which can germinate to form a gametophyte plant. In some species, binucleate sporangia occur which produce two spores (Bold and Wynne, 1978). Similarly, in brown algae (Phaeophyceae) meiosis occurs in sporangia borne on diploid
AF'OMlXlS IN EUKARYOTIC MICRO-ORGANISMS
33
plants, and the resulting spores give rise to haploids. In Huplospora globosa (Kuhlenkamp and Muller, 1986), the meiotic process in the developing sporangia is incomplete, and there is no reduction of chromosome numbers. Although the resulting spores develop into gametophyte plants, fertilization does not occur and the eggs develop directly into sporophytes. In some isolates, gametophytes rarely occur and the spores produced by the sporophyte plants develop directly into sporophytes. In Ufuu mutahilis, a green alga (Chlorophyceae), Foyn (1962) observed production of diploid in place of haploid gametes, possibly caused by failure of chromatid separation. These developed without fusion into diploid plants. The foregoing examples demonstrate that apomixis (in the mycological sense) is of widespread occurrence among lower eukaryotes, and such organisms are thus not distinct in this respect from more advanced organisms. A thorough survey of the distribution of parthenogenetic reproduction among animal groups is given by Suomalainen e f uf.(1987). For treatments of its occurrence in plants see Stebbins (1950,1971,1980), Asker (1979,1980) and Nogler (1984). The early literature on aberrant types of reproduction in fungi, algae, mosses, ferns, gymnosperms and angiosperms was surveyed by Winkler (1 942). IV. Inheritance of Apomixis in Yeasts In the typical life cycle of Succh. cereuisiue, sporulation encompasses meiosis and ascospore formation (Baker e f ul., 1976; Esposito and Klapholz, 1981). Diploid cells heterozygous (MA Tu/MATa) for the mating-type locus can be induced by nutrient deprivation (see Miller, 1989) to differentiate into asci (sexual structures) within which occurs meiosis followed by ascospore formation. Thus, a maximum of four uninucleate haploid ascospores can be expected to occur in each ascus, two of which are MATu and the remaining two MA Ta.Diploidization occurs through fusions between haploid spores and/or cells of opposite mating type. Thus, haploid and diploid generations can alternate in the life cycle; this is, however, not invariable since the three apomictic strains (ATCC4117, ATCC4098 and 19el)described by Grewal and Miller (1 972) are capable of sporulation yet remain diploid throughout their life cycles. In a genetical analysis of strain ATCC4117, Klapholz and Esposito (1980a) identified two recessive mutations, designated spol2-1 and spol3-I, either of which alone can cause production of diploid spores that give rise to vegetative progeny capable of sporulation without prior matings. By complementation analysis, strain 19el was found to harbour the spol2-1 mutation only. Strain ATCC4098, like ATCC4117, harboured both
34
CARL A BILINSKI. N t L S O N MARMlROLl A N D JOHN J MILLER
mutations (S. Klapholz, personal communication). Analysis (Klapholz and Esposito, 1980b) of recombination and chromosome segregation during sporulation of spol2-1 and spol3-1 diploid strains indicated retention of a normal meiotic prophase, since recombination frequencies approximated standard meiotic levels. However, maintenance of heterozygosity for centromere-linked markers indicated that meiosis I1 occurred in the developing asci without prior completion of a meiosis I division. Further genetic work has shown SP013 to be epistatic to SP012 and, hence, to act prior to SP012 on a common pathway responsible for segregation of homologous centromeres in meiosis I (Esposito and Klapholz, 1981; Wagstaff ef al., 1982). That meiosis I chromosome segregation is bypassed, despite retention of an apparently normal meiotic prophase, is substantiated by ultrastructural observations. Moens (1974) observed that the single nuclear division which preceded diploid-spore formation in strains ATCC4117 and 19el resembled the nuclear behaviour of typical diploid strains that undergo the two meiotic nuclear divisions to yield four haploid spores in each ascus. As in strains that form four-spored asci, a round, granular body was observed in association with nucleoli of sporulating cells. This structure is known to contain synaptonemal complex-like elements (Moens and Rapport, 1971). He also noted that nuclear division in strains 19el and ATCC4117 commenced with a spindle which could have been either a mitotic or a first meiotic spindle. But suddenly the spindle pole bodies, spindle and nucleus adopted characteristics of meiosis I1 of strains that produce four-spored asci; in addition, on completion of nuclear division and ascospore formation, the parental nucleolus was found discarded in the epiplasm surrounding the two diploid spores, as in meiosis I1 of strains that produce four-spored asci (Moens, 1971). Subsequent studies with diploid spore-forming strains derived from ATCC4117 (Moens e f al., 1977; Marmiroli et a]., 1981a) substantiated that a single meiosis 11-likedivision occurred in the developing asci despite retention of a normal meiotic prophase, as indicated by the presence of synaptonemal complexes. In the myxomycete Stemonitis juuogenita, synaptonemal complexes have also been observed in an apomictic line (Gaither and Collins, I984), indicating that chromosome pairing occurs but meiosis is arrested prior to reduction division. A comparison of meiotic and apomictic nuclear divisions in Sacch. cereuisiae is given in Fig. 1. For a recent treatment of the cytology, mechanics and biochemistry of meiosis, see Moens ( 1987). In a small proportion ofdyads produced by the spol2-1 and spol3-1 diploid strains, homozygosity for centromere-linked markers has been detected, indicating that meiosis I chromosome segregation preceded spore formation (Klapholz and Esposito, 1980b).Nakaseko et al. (1984)isolated diploid sporeforming mutants from Schiz. pombe in which ascospore formation was
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
35
meiotic pmphase
FIG. 1. Diagrammatic representation of ultrastructural events leading to apomictic dyad and meiotic tetrad formation in Saccharomyces cereuisiae. In both developmental routes structures expected of meiotic prophase are evident; these include spindle pole bodies (spb),axial cores (ac),synaptonemal complexes (sc),nucleolar organizer (no)and a nuclear dense body (ndb).In spol2-1 and spol3-1 mutants, meiosis I fails to proceed to completion. The reductional chromosome segregation of meiosis is bypassed (- - -) and instead, a single meiosis 11-like division ensues. In apomixis, the nucleolus, represented by the stippled region and shown to be confined to one lobe of the nucleus, is discarded in the epiplasm as in meiosis I1 of strains forming four-spored asci. Two diploid (2n) spores are produced instead of the usual four haploid (n) spores per ascus. Adapted from Moens (1982).
evidently preceded by meiosis I without meiosis 11, thus also rendering segregants diploid and homozygous for centromere-linked markers. Two cell division-cycle (cdc) mutants of Succh. cereoisiae, designated cdc5 and cdc 14, also produce asci containing two diploid spores that evidently result from a single reduction division at the semipermissive temperature (Schild and Byers, 1980). In plants, meiotic mutants that yield diploid progeny by reductional chromosome segregation have been detected in citrus fruit crosses by Esen et al. (1979), in irradiated Jimson weed (Duturu stramonium) by Satina and Blakeslee (1939, and in maize by Nel(l975). Parthenogenesis in angiosperm plants appears, however, to be usually a quantitative trait under polygenic control (see the review by Nogler, 1984). Mutations responsible for apomictic sporulation in Succh. cereoisiue may have their counterparts in other lower eukaryotes. In slime moulds (Myxomycetes), apomixis, presumably controlled by mutations that block reduction division during meiosis, is a prominent mode of reproduction. Apomictic-heterothallic interconversion occurs, and may cause these two reproductive states to alternate in nature, which could be important in the
36
C A R L A. BILINSKI. NELSON MARMlROLl A N D JOHN J. MILLER
process of speciation (Collins, 1981, 1986). In certain species of Duphniu (Cladocera) loss of sexual reproduction is evidently due to the occurrence of a single meiosis suppressor (Hebert, 1987). Since the mutation is sex-limited in expression, causing loss of meiosis in the female line, male carriers can spread the gene for asexuality. According to Cuellar (1987), “we seem to know less about the origins of parthenogenesis than we did more than half a century ago”. With identification of apomixis in Succh. cereuisiue, a unicellular eukaryote that is amenable to genetic analysis, some insight can be gained regarding at least one possible origin of apomixis in diploid species. Succhuromyces cereuisiue strains 19el and ATCC4117 are diploids that harbour dominant genes for homothallism (Klapholz and Esposito, 1980a; Bilinski, 1983) and genetic analysis has shown that there are two recessive mutations, designated spol2-1 and spol3-1, either of which alone can cause apomictic sporulation (Klapholz and Esposito, 1980a).In homothallic strains of Succh. cereuisiue diploidization occurs through fusions between MATu and MATcr haploid cells that are both descendants of the same haploid ascospore. Consequently, diploid cells are produced that are isogenic for all loci except mating type (Herskowitz and Oshima, 1981). These diploid cells are heterozygous ( M ATuIMATcr) for the mating-type locus, and this condition renders them sporogenic. Occurrence of a mutation in S P 0 1 2 or S P 0 1 3 in a homothallic diploid ancestor would offer a simple explanation for the origin of diploid apomixis in Succh. cereuisiue. Self-diploidization following germination of haploid spores whose chromosomes bear homothallism genes, and either of the mutations known to cause apomictic sporulation, would result in diploid progeny that are heterozygous (MATaIMATcr) for the mating-type locus and, thus, sporogenic but (initially) isogenic for all other loci including the mutation causing apomixis.
V. Environmental Modification of the Apomictic Phenotype A few tetrads have been found to be produced consistently by spol2-1, spol3-1 and spol2-1 spol3-1 diploids under commonly employed sporulation conditions (Klapholz and Esposito, 1980a; Bilinski and Miller, 1980; Bilinski, 1983). This observation suggested that the strains might be facultatively apomictic, a situation quite common in organisms in which apomixis occurs, as pointed out by Winkler (1942). He noted that such organisms can usually also reproduce sexually; for example, in flower heads of many species of Hierucium, both sexual and apomictic flowers may occur side by side. Studies of effects of nutrition on apomictic Succh. cereuisiue have shown that meiosis, and hence production of asci containing four haploid ascospores, can be
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
37
restored (Bilinski and Miller, 1980; Marmiroli and Bilinski, 1985). In strain 19e1, a spol2-1 SP013 diploid (Esposito and Klapholz, 1981),increasing the glucose concentration supplied in the presporulation medium, or the potassium acetate concentration in sporulation medium, induced tetrad formation, and the effects on tetrad yields of simultaneously increasing both of these concentrations were additive (Bilinski and Miller, 1980). The further addition of zinc sulphate to both presporulation and sporulation media gave still higher yields and, under this condition, apomictic dyads and meiotic tetrads were formed in nearly equal percentages. In strain ATCC4117, a spol2-1 spol3-1 diploid (Klapholz and Esposito, 1980a),increases in carbonsource concentrations alone were not found to enhance tetrad formation and their induction frequency increased only on further addition ofzinc ions to the culture media (Bilinski, 1983). Restoration of meiosis in apomictic strains was also accomplished by some treatments other than the foregoing modifications in culture medium composition. The incubation temperature most commonly used for presporulation growth and induction of sporulation of Succh. cereuisiue is 2 7 T , which approximates the optimum with most strains (Miller, 1988). In strain 19e1, it was found possible to induce tetrads by mild temperature shock at 18 or 36°C for the first few hours of sporulation (Bilinski and Miller, 1984), and also by inhibition of protein synthesis with cycloheximide administered during the first few hours of incubation under sporulation-inducing conditions (Bilinski et ul., 1983).In strain ATCC4117, heat shock at 38 or40"C also induced tetrad formation when applied during the same time period of sporulation as with 19el (N. Marmiroli and C. A. Bilinski, 1988, unpublished observations). Success in tetrad induction was also achieved with strain ATCC4117 by manipulation of the carbon source to nitrogen source ratio present during presporulation growth (Marmiroli and Bilinski, 1985). Maximum tetrad yields occurred in sporulation medium when cells were grown in a defined medium containing 6% (w/v) glucose and 0.1 YO(w/v) ammonium sulphate. When the glucose concentration was lowered or when the ammonium sulphate concentration was increased, tetrad yields declined. Glucose added to sporulation medium is known to arrest yeast cells in meiosis I (Miller, 1964), but inclusion of this catabolite repressor in sporulation media at levels that prevent sporulation of meiotic strains has no apparent effect on apomictic sporulation in strains 19e1, ATCC4117 and ATCC4098 (Grewal and Miller, 1972; Bilinski and Miller, 1980; Marmiroli and Bilinski, 1985). The mutations responsible for apomictic sporulation in these strains (see Section IV, p. 33) have evidently released sporulation from glucose catabolite repression and this may be of industrial relevance (see Section IX, p. 42). Alternatively, the mutations may be epistatic to gene functions regulated by glucose in meiosis I and, hence, may act prior to the
38
CARL A. BILINSKI. NELSON MARMlROLl A N D JOHN 1. MILLER
glucose-sensitive step, thereby permitting apomictic sporulation in the presence of glucose. The effect can be dramatic since, under nutritional conditions that restored the two meiotic nuclear divisions in strains 19el and ATCC4117 (Bilinski and Miller, 1980; Marmiroli and Bilinski, 1985), inclusion of glucose, even at a concentration as low as 0.1% (w/v) in the sporulation medium, strongly inhibited meiotic tetrad production with no significant decrease in formation of apomictic dyads in the same sporulation culture. Since glucose repression of mitochondria1 functions is a wellestablished phenomenon in Sacch. cerevisiae (Polakis and Bartley, 1965; Tzagoloff, 1969; Perlman and Mahler, 1974), the apomictic strains thus present themsevles as model systems for investigation of nucleomitochondrial interactions during sporulation (see Section VII, p. 41). The ability to condition environmentally apomictic Sacch. cerevisiae for a complete meiotic programme that culminates in haploid spore production is cause to give some consideration to the possibility of reversing the process, i.e. inducing apomictic sporulation in strains that normally produce haploid spores. In fact, progress in this direction has been made by blocking meiosis I1 with the drugs bleomycin, mitomycin C (Sora et al., 1983)and caffeine (Sora et al., 1984),thereby facilitating recovery of diploid products of the sporulation process. Investigation of the effects of nutrition on ascosporogenesis in apomictic yeast indicated a r81e for zinc in yeast meiosis (Bilinski and Miller, 1980).The precise manner of action of the micronutrilite in restoration of meiosis is unknown. Zinc is known to interact with membranes and participate as a cofactor in macromolecular synthesis (Chvapil, 1973), affect chromatin configuration (Kvist, 1980), promote tubulin polymerization (Crepeau and Fram, 1981), affect ribosome structure (Subcommittee on Zinc, 1979) and accumulate in nucleoli (Fujii, 1954, 1955).Translocation of zinc from vacuolar to nuclear compartments has, in fact, been observed microcytochemically during the first few hours of sporulation under the nutritional conditions that restored meiosis in strain 19el (Bilinski and Miller, 1983).Zinc accumulated in nuclear membranes and nucleoli during this period, and co-incident with this cytological event was an apparent inhibition of protein synthesis that was correlated with the restoration of meiosis (Bilinski el al., 1983). These observations are of interest, since in normal meiosis SPOZZ and SPOZ3 gene products might prevent occurrence of meiosis I1 until meiosis I has been completed (Esposito and Klapholz, 1981; Klapholz and Esposito, 1980b; Wagstaff et af., 1982). Protein breakdown is apparently unaffected on inhibition of protein synthesis in sporulating yeast cultures (Magee and Hopper, 1974). Thus, it is conceivable that the protein synthesis inhibition evident on inclusion of zinc in sporulation medium (Bilinski el a/., 1983) restored meiosis by interrupting the normal sequence of gene expression while
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
39
permitting breakdown of the proteins encoded by genes that would otherwise allow cells to undergo meiosis I1 without prior completion of a meiosis I division. Some of these may, in fact, be mitotic cell-division-cycle (CDC) genes normally not expressed during yeast sporulation as a consequence of SP012 and SP013 regulation (see Section VI, p. 40).
VI. Timing of Events Controlling the Manner of Nuclear Division Since spol2-1 and spol3-1 mutants are rendered capable of meiosis I1 without prior completion of meiosis I (Klapholz and Esposito, 1980a,b), it has been suggested that, in wild-type (SP012 x SP013) diploid cells, which have normal meiosis, occurrence of meiosis I1 is prevented until meiosis I is completed (Klapholz and Esposito, 1980b;Esposito and Klapholz, 1981).The underlying mechanism whereby SP012 and SP013 cells exert such control is as yet unclear, but some insight has been gained by monitoring the sequence of biochemical and nuclear events during sporulation employing the culture conditions that permit manipulation of the apomictic phenotype in strain 19el (Bilinski et al., 1983). These are as follows: (a) cultivation under commonly used culture conditions (1% (w/v) glucose in presporulation medium; 2% (w/v) potassium acetate in sporulation medium), which yield almost exclusively apomictic dyads and are termed non-permissive conditions for meiosis; (b) cultivation with high concentrations of carbon source (6% (w/v) glucose in presporulation medium; 3.5% (w/v) acetate in sporulation medium with addition of 25 pg ml- zinc sulphate to both media. The latter combination yields meiotic tetrads and apomictic dyads in nearly equal frequency, and we have termed it semipermissive for meiosis. Yeast cells normally complete mitosis during the first few hours of incubation under sporulation-inducing conditions and then arrest in the G 1 interval of the cell cycle prior to embarking upon a meiotic programme (Hirschberg and Simchen, 1971).Under non-permissive conditions for meiosis in strain 19e1, the single nuclear division which preceded apomictic dyad formation, however, commenced within the first hour of sporulation (Bilinski et al., 1983). Limitation of protein synthesis, a condition known to signal G1 arrest (Unger and Hartwell, 1976), has been correlated with restoration of meiosis in strain 19e1, and a delay in the onset of nuclear division was observed to co-incide with limitation of protein synthesis during the first few hours of incubation in sporulation medium (Bilinski et al., 1983). During this period, zinc ions were shown to translocate from vacuolar to nuclear compartments and accumulate in the nucleolus and nuclear membrane (Bilinski and Miller, 1983). Meiotic tetrads have been shown to be induced when strains 19el and ATCC4117 are heat shocked during the same early time
40
C A R L A. BILINSKI. NELSON MARMlROLl A N D JOHN J. MILLER
period (Bilinksi and Miller, 1984; N. Marmiroli and C. A. Bilinski, 1988, unpublished observation) and it is known that heat shock causes transient G1 arrest (Johnston and Singer, 1980). Thus, it is conceivable that spol2-1 and spol3-1 mutants are defective in regulation ofcertain cell division-cycle (CDC) genes such as those indicated to control events leading to arrest of yeast cells in GI, for instance CDC25 and CDC35, which also evidently regulate the choice between mitosis and meiosis in response to nutritional stimuli (Shilo et al., 1978).Although the basis for restoration of normal meiosis remains at present unclear, it is evident that events occur early in the sporulation culture which determine whether a given nucleus will undergo meiotic instead of apomictic division. In fact, the gene S P O l 3 has been cloned recently and its expression was found to commence within the first hour of sporulation (Wang et ul., 1987). This co-incides with the time period found to play a key r81e in determining whether apomixis or meiosis ensues. Investigations into the regulation of nuclear division in strain 19el (Bilinski et al., 1983, 1987c)have led to identification of at least three prerequisites for the morphogenetic switch from diploid to haploid spore production during sporulation. These are: (a) limitation of protein synthesis during the early hours of sporulation; (b) a delay in the onset of nuclear division following inoculation of sporulation cultures; (c) occurrence of at least one complete mitotic cell-division cycle. The last prerequisite is of particular interest since a rble for the cell-division cycle in determination of the manner of nuclear division during sporulation has already been suggested above. The number of buds which a yeast cell has produced, and hence its “age”, can be determined by fluorescence staining with calcofluor which reveals the bud scars, and the number of these occurring on the surface of a cell serves as a direct measure of the number of complete mitotic cell-division cycles that it has experienced. These studies (Sando and Saito, 1970; Yanagita et al., 1970)have shown that older cells which have completed several mitotic cell-division cycles produce three- and four-spored asci, whereas freshly formed cells, which lack calcofluor-stainable bud scars and have not yet produced daughter cells, seldom sporulate. Haber and Halvorson (1972) also noted that small cells or buds, in general, have a lower capacity to sporulate than larger mother cells; however, even buds similar in volume to their mother cells sporulated much less frequently. Bilinski et al. (1987~)found that apomictic dyad but not meiotic tetrad formation can occur in newly formed vegetative cells that have not produced a bud and thus have not experienced a mitotic cell-division cycle. The existence of a cell-division age dependency prerequisite for rescue of normal meiosis offers a reasonable explanation for the inability to condition all sporulating cells of a given apomictic mutant for the two meiotic nuclear divisions (Bilinski and Miller, 1980; Marmiroli and Bilinski, 1985). That apomictic dyad formation occurred in newly formed daughter cells is of
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
41
particular interest given the genetic basis for apomixis in Sacch. cerevisiae described in Section IV (p. 33) since the mutations prevent meiosis but permit newly formed cells to sporulate. This observation can account for the fact that sporulation in apomictic Sacch. cerevisiae occurs at very high percentage rates under standard sporulation conditions (Grewal and Miller, 1972; Moens, 1974; Bilinski and Miller, 1980). VII. Nucleomitochondrial Interactions in Facultative Apomixis
Studies (Ephrussi and Hottinguer, 1951;Miller and Halpern, 1956; Puglisi and Zennaro, 1971; Gorts, 1975; Marmiroli et al., 1981b) have shown that respiration and mitochondrial protein synthesis play an important rdle in conditioning yeast cells for sporulation. Not all respiration-related functions are, however, needed for sporulation since several respiratory deficient mutants have been found that retain sporogenic ability (Pratje et al., 1979; Hartig and Breitenbach, 1980). Other mutants have been identified that are able to sporulate under conditions of catabolite repression (Dawes, 1975; Vezinhet et al., 1979; Dawes and Calvert, 1984),and the spof2-f and spof3-f mutations that cause apomictic sporulation can be considered to be in this category since apomictic dyad though not meiotic tetrad formation can occur under conditions of glucose catabolite repression (see Section V, p. 36). Consistent with this observation is the fact that meiotic but not apomictic sporulation is strongly inhibited following inclusion in sporulation medium of erythromycin, a specific inhibitor of mitochondrial protein synthesis (ClarkWalker and Linnane, 1966). Erythromycin has been shown to prevent yeast meiosis by arresting development in prophase of meiosis I at some point between intragenic and intergenic recombination (Marmiroli et al., 1983, 1985). Thus, it is possible that spof2-f and spof3-f mutations render cells capable of sporulation in the presence of erythromycin by acting prior to the erythromycin-sensitive step(s) in the meiotic prophase. This is likely since apomictic dyads are still produced in the presence of mutations (spoff - I , rad52-I) that abolish meiotic recombination (Esposito and Klapholz, 1981; Malone and Esposito, 1981). The fact that restoration of meiosis in apomictic genetic backgrounds is impeded on inhibition of mitochondrial protein synthesis (Marmiroli and Bilinski, 1985)confirms that meiosis is indeed dependent upon mitochondrial translation products (Marmiroli et al., 1981b, 1983,1985; Marmiroli and Lodi, 1984a; Puglisi and Zennaro, 1971). Previous investigations (Petersen et al., 1979; Trew et al., 1979; Wright and Dawes, 1979; Wright et al., 1981; WeirThompson and Dawes, 1984)demonstrated synthesis of sporulation-specific proteins in Sacch. cerevisiae, and these are not synthesized when mitochondrial protein synthesis is prevented (Marmiroli and Lodi, 1984b).In fact,
42
CARL A. RILINSKI. NELSON MARMlROLl A N D JOHN J. MILLER
certain sporulation-specific proteins correspond to known heat-shock proteins (Marmiroli and Lodi, 1984a,b) and this has been confirmed by hybridization of sporulation-specific transcripts with cloned heat-shock genes (Kurtz and Lindquist, 1984, 1986; Kurtz et al., 1986). Some of these sporulation-specific heat-shock proteins are not synthesized when translation of mitochondrial transcripts is blocked by inclusion of erythromycin in sporulation medium (Marmiroli and Lodi, 1984a,b). This observation is important since meiotic-tetrad production is enhanced in strain ATCC4117 and induced in strain 19el when cells of these apomictic strains are heat shocked on transfer from presporulation growth to sporulation-inducing conditions (Bilinski and Miller, 1984; Marmiroli and Bilinski, 1989). In strain ATCC4117, tetrad induction by heat shock has been correlated with induction of certain heat-shock proteins that correspond to sporulation-specific proteins whose synthesis is prevented by inclusion of erythromycin in sporulation medium (N. Marmiroli, unpublished results). The precise rale of these proteins in restoration of meiosis is at present unclear. Given the foregoing effects of erythromycin and heat shock on sporulation in strain ATCC4117, it is conceivable that the mutations responsible for apomixis in Suc.c/z. cerevisiue (see Section IV, p. 33) alter mitochondrial control over the meiotic process. In this regard it is well known that mitochondrial gene expression can be regulated by nuclear genes (for a review see Evans, 1983). Thus, apomictic mutants of Succh. cereuisiae are indicated by these data to have potential for analysis of nucleomitochondrial interactions in determination of the manner ofdevelopment a given cell will follow under sporulationinducing conditions. No such analysis has evidently been undertaken in facultatively apomictic forms of higher eukaryotes, perhaps because none is so amenable to genetic manipulation as Sacch. cerevisiae.
VIII. Ecology of Apomixis in Yeasts No study has been made of the distribution and significance of apomictic strains of Succk. cerevisiae in nature. That they do exist is indicated by their occurrence among strains derived from natural wine fermentations (see p. 25). This characteristic, controlled by a single gene difference affecting only sexual reproduction (see p. 33) offers some useful features as a model system for a study of population dynamics and ecology of wild yeasts. Information on the comparative sensitivity of yeast spores and vegetative cells to stresses has been summarized by Miller (1989). Unlike the bacterial endospore, the yeast ascospore (also an endospore) has heat sensitivity that is only slightly less than that of the vegetative cell, but, in many other respects, its resistance to environmental stress is comparable to that of the bacterial spore. It resists killing by ethanol, diethyl ether, heat, cold, alternate freezing and
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
43
thawing, desiccation, mechanical damage, starvation, radiation and wall digestion by animal and microbial glucanases. A state of dormancy is indicated by low respiratory activity (Pontefract and Miller, 1962)and by the apparent absence of ATP (Barton et al., 1980)and of mRNA turnover (Kurtz and Lindquist, 1984).The well-known difficulty in staining yeast spores with some dyes and in destaining them with acid in common spore-staining procedures indicates low wall permeability (Kelly and Gay, 1969), and this feature may have survival value in the presence of environmental toxins such as the killer factors produced by many naturally occurring yeasts (Starmer et al., 1987; Young, 1987). The hydrophobic surface of the spore wall may aid dissemination by adhering to the exoskeleton of insects or to cuticular plant surfaces, and may even enable movement on water films by surface tension like the hydrophobic spores of the fungus Pithomyces chartarum (Crawley et al., 1962). The products of meiotic nuclear division are thus enclosed in cells that are dormant and more rugged than vegetative cells, and are able to resume vegetative activity when nutritional and other conditions favour renewed growth (Miller, 1989).According to Phaff (1986), the natural habitats of Sacch. cerevisiae strains are not well defined; possible free-living progenitors of industrial strains have been isolated from exudates of pine and oak, oak bark, soil beneath oaks and intestinal tracts of species of Drosophila. Vegetative (mitotic) nuclear division and multiplication of yeast may proceed under environmental conditions well known to be inhibiting to meiosis (Miller, 1989),e.g. low pH value, low water activity, low temperature, anaerobiosis, moderate concentrations of glucose, and presence of ethanol or carbon dioxide, and it seems reasonable to assume that these factors, so commonly encountered in the normal environment of yeast, would restrict spore production in nature. Less is known of the response of apomictic sporulation to environmental stresses, but there is some evidence that it may be less sensitive than meiotic sporulation. Experiments (J. J. Miller, unpublished results) to compare sporulation of the three known apomictic yeast strains with that of two meiotic strains at several temperatures showed that all sporulated well at 27°C; all grew well at 10°C but only the apomictic strains sporulated at 10°C within 10 days. Grewal and Miller (1972), Bilinski and Miller (1980) and Marmiroli and Bilinski (1985) found sporulation of apomictic strains less sensitive to glucose inhibition than that of meiotic strains. Using nutritional conditions that restored meiosis in almost half of the showed that newly developing asci of an apomictic strain, Bilinski et al. (1987~) formed daughter cells could sporulate apomictically but not meioticaily, which suggests that apomixis is the less demanding type of sporulation. Previous production of at least one bud by the cell that becomes the ascus appeared to be a requirement for meiotic, although not for apomictic, sporulation.
44
CARL A BILINSKI. NELSON MARMlROLl AND JOHN J MILLER
The frequency, value and significance of parthenogenesis and apomixis are important problems in population genetics, and have been discussed extensively by many authors (Crow and Kimura, 1971; Williams, 1975; Maynard Smith, 1978; Vespdainen and Jarvinen, 1979; Asker, 1980; Gerritsen, 1980; Lloyd, 1980; Stebbins, 1980; Manning, 1981; Marshall and Brown, 1981; Nogler, 1984; Uyenoyama, 1987). Several advantages can be attributed to non-sexual forms of reproduction. When such a population occurs at a low density, as in colonization of a new habitat, the problem of mating encounters would not arise. Fortuitous genotypes that happen to be particularly well adapted to an environment could be perpetuated without being broken up by recombination. Polyploids or hybrids expressing heterosis of competitive value but prone to meiotic disturbances could be stabilized and propagated rapidly. Since energy and resources need not be used to produce males, an asexual clone can produce more reproductive individuals in a given environment compared with a sexual competitor. These advantages of asexual reproduction are countered by a very important disadvantage, i.e. less genetic diversity can be generated, since, to incorporate two beneficial mutations in the same clone, the second must occur in a descendant of the individual in which the first occurred. Although the number of individuals may be increased, they tend to be copies of one another, so that an asexual population may become an evolutionary “dead end”, and prone to extinction if in competition with related sexual forms. Apomictic forms may, however, be favoured by early colonization of habitats and by low-competition environments, often showing vigorous, “weedy” proliferation and (in animals) tend to occur in cooler or drier conditions than related sexual forms. Detailed, critical discussion of this area of population genetics is given in the references already cited. In the absence of information concerning the frequency and distribution of apomictic yeasts in natural environments, an assessment of their significance must be speculative and based on behaviour in artificial culture. I t is probable that they are not abundant, since examination of sporulation of 140 sporogenic yeast strains obtained randomly from culture collections yielded only three that were apomictic (Grewal and Miller, 1972).Such yeasts possess two types of parthenogenetic development: budding, in which mitotic division of the mother-cell nucleus supplies a diploid nucleus to the growing bud, and apomictic nuclear division in sporulation. Although meiotic levels of recombination occur during the latter (Klapholz and Esposito, 1980b), it can concern only the genetic material initially present in the diploid cell and will represent an evolutionary “dead end”. However, Stebbins (1971) noted that apomictic complexes may contain some populations that are sexual or facultatively apomictic, and can enrich the gene pool of an obligate apomict from time to time. From a study of the slime mould Didymium iridis, Collins
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
45
and Gong (1985) obtained evidence that its apomictic and sexual reproductive modes of development may alternate in nature. Bilinski and Miller (1980, 1984) showed that environmental modification during sporulation and presporulation growth can induce meiotic division in apomictic yeasts. The apomictic yeast strains are diploid (Grewal and Miller, 1972; Esposito ez al., 1974),and thus the frequent correlation between polyploidy and apomixis well known in animalsand plants (Lokki and Saura, 1980; Stebbins, 1980; Nogler, 1984) seems absent here, although polyploidy can occur in yeasts (Leupold, 1956) and especially in brewing yeasts (Stewart, 1981). There is evidence for polyploidy in the major groups of true fungi and in slime moulds, but most of the numerous reports are cytological and speculative (Rogers, 1973; Maniotis, 1980). The best established instances involve fungi with prominent diplophases in their life cycles. Burnett (1975) noted no correlation between apomixis and polyploidy in fungi. From the foregoing comparisons, there seems no obvious selective advantage for apomictic sporulation in Saccharomyces species over vegetative budding in respect to values generally attributed to asexual reproduction, and it is legitimate to wonder why both of these reproductive modes should exist together. A possible ecological role for apomixis in wild yeasts is that, since each apomictically produced spore on germination yields diploid cells, the problem of re-establishing the diploid phase presented by overly thin disperson of haploid spores which have survived a time of stress is overcome. Further, considering the sensitivity of meiotic nuclear division to stresses, it can also be argued that apomixis in yeast may provide a means to invoke the aid of the spore in surviving adversity without the need to undergo stresssensitive meiotic divisions. Stebbins (1950) suggested that the normal course of meiosis in plants can be upset more easily by various environmental disturbances than that of mitosis, and Suomalainen’s (1950) review on animal parthenogenesis gives instances of greater hardiness in parthenogenetic than in bisexual forms. As polyploidy seems not to be a factor in fungal apomixis (see p.45), organisms such as yeast are promising material for experimental investigation of the relevance of mechanics of mitosis and meiosis to the origin and dispersion of apomictic forms. Techniques for probable use in such studies are the rapid Giemsa yeast nuclear staining procedure of Miller (1989) and the possibility of selecting apomictic strains from mixed growing populations by sporulation under conditions (e.g. glucose concentration, temperature) that favour apomictic over meiotic sporulation. Spores that develop in the selective environment could then be recovered in a viable condition by killing the vegetative cells, using diethyl ether (Dawes and Hardie, 1974). The use of selective media for isolation of yeasts from their natural habitats is discussed by Phaff (1986) and by Phaff and Starmer (1987).
46
CARL A. BILINSKI. NELSON MARMlROLl A N D JOHN J. MILLER
IX. Concluding Remarks
Some of the current interest in apomixis stems from its possible application in agriculture as an aid in crop rearing and in development of improved varieties. As discussed by Doll (l973), advantages of apomixis, a phenomenon widespread among agricultural plants, include the following. Formation of seeds is independent of pollination and fertilization and often, therefore, better and more reliable than in the case of related sexual varieties. Heterosis can be maintained through apomixis. Apomixis provides an escape from sterility which may be important with polyploid varieties. Many apomictic agricultural plants show, in comparison with related sexual varieties, a greater degree of vitality and competitiveness which cannot be explained as a heterosis effect; in the important crop genus Poa, which includes many facultative apomicts, the apomictic mode of reproduction is more prominent in cold years and in colder climates. Thus there is much interest (see Nogler, 1984) in introducing apomixis into cultivated sexual plants, especially those unsuitable for large-scale vegetative propagation, such as cereals, and advances will require knowledge of the functioning of the genes for apomixis and thorough understanding of the physiological background of the components of the system. Hanna (1980) suggested a study of transfer of chromosome segments carrying apomictic genes and of methods for turning these genes off and on with chemicals. The existence of yeast strains that sporulate apomictically, and the identification of recessive genes for apomixis in these strains, give an opportunity to obtain information on apomixisrelated cellular phenomena relevant to this important area by exploiting the advantages of working with a unicellular organism. Research on control of sexual and apomictic reproduction of silkworms in the U.S.S.R. led to methods for increasing yields through production of populations with high proportions of either female or male larvae (Strunnikov, 1978). Higher silk yields are obtained from the latter. Apomixis in mammals would have, obviously, great agricultural (and ethical!) significance but, although the parthenogenetic mode of reproduction is fairly common in lower animals and even in some fairly advanced in the evolutionary scale such as amphibians, reptiles and, rarely, birds, it has not been shown conclusively to occur in mammals (see the review by Mittwoch, 1978). This has been accounted for on the basis of a need for both maternal and paternal genomes, not merely for heterozygosity during embryo development (reviewed by Miller, 1987). That is, maternal and paternal genomes acquire critical differences, and a mechanism that was suggested for this is imprinting of chromosomal DNA during gamete production by insertion of chemical groups, e.g. methylation. A medical problem linked to parthenogenetic development is the type of human ovarian tumour referred to as cystic
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
47
teratomas or dermoid cysts, which are benign growths containing tissue elements that arise from all three germ layers. Information concerning the chromosome morphology of cells from these structures obtained by means of electrophoretic enzyme analysis and chromosome-banding techniques indicated that the specimens examined (Linder et al., 1975) had developed without fertilization from single germ cells resulting from the first meiotic division with suppression of meiosis 11. Chromosome polymorphisms situated at or near the centromeres were found to be homozygous in the tumour cells. In a similar study, Parrington et al. (1984)concluded that, although most of the 21 tumours they examined evidently could have arisen from single germ cells resulting from the first meiotic division, others could have originated from failure of meiosis I with successful meiosis 11, thereby resulting in retention of heterozygosity for centromere-linked markers. The latter type of germ-cell development resembles the sequence of cytological events described in Section IV (p. 33) with apomictic yeast. The other type, involving suppression of meiosis 11, has also been demonstrated in Sacch. cereuisiae in two cell-division cycle mutants (Schild and Byers, 1980). Sora and Bianchi (1982) evidently induced apomictic nuclear division in place of meiosis in some cells of a strain of Sacch. cereuisiae by addition of caffeine, and this suggests that study of induction of apomictic nuclear division in this yeast species may supply information relevant to the genesis of teratomas. Fekete (1987) recently proposed that some malignant cells may have a parthenogenetic origin. Some useful features of Sacch. cereuisiae as an experimental organism for research on apomixis are summarized at the end of Section I (p. 26). The fact that the mutations ( 3 ~ 0 1 2 - 1 ,3 ~ 0 1 3 - 1 )have been indicated to release sporulation from glucose catabolite repression (see Section VII, p. 41) may be of relevance in brewery fermentations, since glucose repression is the major factor regulating metabolism of carbohydrates such as maltose (van Wijk et al., 1969),sucrose (Gascon et a/., 1968)and galactose (Spiegelman and Reiner, 1947).Thus, it is conceivable that mutations responsible for apomixis in Sacch. cereuisiae are pleiotropic by also derepressing enzyme synthesis for carbohydrate catabolism under conditions of glucose catabolite repression, thereby improving fermentation performance through enhancement of rates of carbohydrate assimilation and hence of ethanol production. Should this turn out to be so, the fact that gene S P 0 1 3 has been cloned (Wang et al., 1987) will facilitate possible introduction of the characteristic into other yeasts uia gene disruption (Rothstein, 1983).Looking to the future, we may suggest that its possible introduction into higher organisms of economic importance may aid development of techniques to improve control of their reproduction. We see, in conclusion, that the tendency towards apomictic in place of sexual reproduction occurs almost universally throughout the biotic world, and that the lower eukaryotic micro-organisms are no exception in this regard.
48
CARL A BILINSKI. NELSON MARMlROLl A N D JOHN J. MILLER
Inconsistencies occur in the terminology concerning parthenogenetic reproduction of plants, animals and fungi which must be considered when comparisons are made. Apomixis has been shown to occur in three readily available strains of Succh. cereuisiue. As in other organisms, its frequency is environmentally influenced. It may play a r61e in aiding yeast survival by allowing formation of resistant spores without having to undergo meiosis and by permitting sporulation under conditions that would otherwise prevent sporulation in standard meiotic strains. Mitochondria1 functioning plays a less essential r61e in yeast apomixis than in meiosis. Differences in composition and/or microstructure between old and young cells enable the former to effect both meiosis and apomixis, and the latter only apomixis. A single gene can control the apomictic phenotype but more than one locus is involved. Research on the occurrence and distribution of such genes in Succh. cereuisiue and related yeasts in Nature could contribute to microbial ecology and population genetics as well as to an understanding of morphogenetic controls of meiosis. In its historical r61e as an experimental subject for fundamental research, Sacch. cereuisiue provides opportunities for obtaining information in the field of reproduction that may have have wider relevance. Study of yeast apomixis is challenging and offers important scientific as well as applied rewards. REFERENCES
Adams, A. M. (1950). Canadian Journal efRe.vearch F 28, 413. Alexopoulos, C. J. and Mims, C. W. (1979). “Introductory Mycology”, 3rd edn. John Wiley, Chichester. Toronto. Asker, S . (1979). Hereditas 91, 231. Asker, S . (1980). Heredirus 91, 277. Baker, B. S., Carpenter, A. T. C., Esposito, M. S., Esposito, R. E. and Sandler, L. (1976). Annuul Review, of Generics 10, 53. Banno, I. (1967). Journal of Generul and Applied Microbiology 13, 167. Barton, J. K., den Hollander, J. A., Lee, T. M., MacLaughlin, A. and Shulman, R. G. (1980). Proceedings of rhe Narional Academy I$Sciences nfthe United Stares uf Americu 77, 2470. Beatty, R.A. (1957). “Parthenogenesis and Polyploidy in Mammalian Development”. Cambridge University Press, Cambridge. Betterley, D. A. and Collins, 0. R.(1983). Mycologia 75. 1044. Bilinski. C. A. ( 1 983). Ph.D. Thesis: McMaster University, Hamilton. Ontario, Canada. Bilinski. C. A. and Casey, G. P. (1989). Yeast 5 (in press). Bilinski, C. A. and Miller, J. J. (1980). Journal uf Bacteriology 143, 343. Bilinski, C. A. and Miller, J. J. (1983). Canadian Journal qf Generics and Cytology 25, 415. Bilinski, C. A. and Miller, J. J. (1984). Cunadiun Journal uf Micrubiology 30, 793. Bilinski, C. A., Miller, J. J. and Girvitz, S . C. (1983). Journal of Bacreriology 155, 1178. Bilinski, C. A., Russell, I. and Stewart, G . G. (1986). Journal q f t h e Insrirure qf Brewing 92, 594. Bilinski, C. A., Russell, 1. and Stewart, G . G . (1987a). Journal qfthe Insriru/e qf Brewing 93,216. Bilinski, C. A., Hatfield. D. E., Sobczak. J. A., Russell, 1. and Stewart, G. G . (1987b). In “Biological Research on Industrial Yeasts” (G. G. Stewart, 1. Russell, R.D. Klein and R. R.Hiebsch, eds), vol. 2, pp. 37-47. CRC Uniscience Series. C R C Press, Boca Raton, Florida. Bilinski, C. A., Marmiroli, N. and Miller, J. J. (1987~).Yeas/ 3, 1.
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
49
Bjorling, K. (1944). Kungl. FysiograJiska Sallskapets i Lund 14, 147. Bold, H. C. and Wynne, M. J. (1978). “Introduction to the Algae”. Prentice-Hall, Englewood Cliffs, New Jersey.. Breitenbach, M. and Lachkovics, E. (1983). In “Secondary Metabolism in Fungi” (J. W. Bennett and A. Ciegler, eds). pp. 307-374. Marcel Dekker, New York and Basel. Burnett, J. H. (1975). “Mycogenetics”. John Wiley, London. Burnett, J. H. (1976). “Fundamentals of Mycology”, 2nd edn. Edward Arnold, London. Caten, C. E. and Day, A. W. (1977). Annual Review of Phytopathology 15, 295. Chvapil, M. (1973). Life Sciences 13, 1041. Clark-Walker, G . D. and Linnane, A. W. (1966). Biochemical and Biophysical Research Communications 25, 8. Collins, 0. R. (1981). Journal qfrhe Elisha Mitchell Scientific Socicvy 97, 101. Collins, 0. R. (1986). Bulletin ofthe British Mycological Society 20 (Suppl. I), 6. Collins, 0. R. and Gong, T. (1985). Mycologia 77, 300. Crawley, W. E., Campbell, A. G. and Smith, J. D. (1962). Nature 193, 295. Crepeau, R. H. and Frdm, E. K. (1981). Ultramicroscopy 6, 7. Crow, J. F. and Kimura, M. (1971). In “Readings in Population Biology”(P. S. Dawson and C. E. King, eds), pp. 439450. Prentice-Hall, Englewood Cliffs, New Jersey. Cuellar, 0.(1987).In “Meiosis”(P. B. Moens, ed.), pp. 43-104, Academic Press, Orlando, Florida. Cutter, V. M. (1942). Bulletin of the Torrey Botanical Club 69, 592. Dawes, 1. W. (1975). Nature 255, 707. Dawes, 1. W. and Calvert, G. R. (1984). Journal of General Microbiology 130, 605. Dawes, I . W. and Hardie, I. D. (1974). Molecular and General Genetics 131, 281. Deacon, J. W. ( 1 980). “Introduction to Modern Mycology”. Blackwell Scientific, Oxford. Doll, R. (1973). Biologische Rundschau 11, 362. Drebes, G. (1977).In“The Biology of Diatoms”(D. Werner, ed.), pp. 25Ck283. Blackwell, London. Emerson, R. (1950). Annual Review of Microbiology 4, 169. Ephrussi. B. and Hottinguer, H. (1951).Coldspring Harbor Symposium in Quantitarive Biology 16, 75. Esen, A,. Soost, R. K. and Geraci, G. (1979). Journal of Heredity 70, 5. Esposito. M . S. and Esposito, R. E. (1979). Biologie Cellulaire 33, 93. Esposito, M. S., Esposito, R. E. and Moens, P. B. (1974). Molecular and General Genetics 135,91. Esposito, R. E. and Klapholz, S. (1981). In“Molecular Biology of the Yeast Saccharomyces, Life Cycle and Inheritance” (J. N. Strdthern, E. W. Jones and J. R. Broach, eds), pp. 21 1-287. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Esser, K., Saleh, F. and Meinhardt, F. (1979). Currenr Generics I, 85. Ettl, H., Muller, D. G.. Neumann, K., Stosch, H. A. V. and Weber, W. (1967). Handbuch der Pjlanzenphysiologie 18, 597. Evans, 1. H. (1983). In “Yeast Genetics, Fundamental and Applied Aspects” (J. F. T. Spencer, D. M. Spencer and A. R. W. Smith, eds), pp. 269-370. Springer-Verlag, New York. Fekete, B. (1987). Medical Hypotheses 23, 109. Foyn, B. (1962). Nature 193, 300. Fowell, R. R. (1951). Journal ofthe Institute of Brewing 57, 180. Fowell, R. R. (1967). Journal of Applied Bacteriology 30, 450. Fowell, R. R. and Moorse, M. E. (1960). Journal of Applied Bacteriology 23, 53. Fuji, T. (1954). Nature 174, 1108. Fujii. T. (1955). Journal qfrhe Faculty ofScience, University of Tokyo, Secrion IV 7, 313. Gaither, T. and Collins, 0. R. (1984). Mycologia 76, 1123. Gascon, S., Neumann, N. P. and Lampen, J. 0.(1968).Journal of Biological Chemistry 243, 1573. Gaumann, E. A. (1 926). “Vergleichende Morphologie der Pike”. Verlag Fischer, Jena. Gaumann, E. A. (1928). “Comparative Morphology of Fungi”. McGraw Hill, New York. Gaumann, E. A. (1940). Zeir.schrif.fir Botanik 35, 433. Gerritsen, J. (1980). American Naturalist 115, 71 8. Gorts, C. P. M. (1975). Antonie van Leeuwenhoek 41,265. Grewal, N. S. and Miller, J. J. (1972). Canadian Journal of Microbiology 18, 1897. Guilliermond, M. A. (1903). Revue Gindrale de Botanique IS, 49.
50
CARL A. BILINSKI. NELSON MAKMlKOLl A N D JOHN 1. MILLER
Guilliermond, M. A. (1909). Revue Gberale de Eotanique 21, 353. Gustafsson, A. (1946). Lunds Universilets Arskrrkrift 42, 2. Haber, J. E. and Halvorson. H. 0. (1972). Journal of Bacteriology 109, 1027. Hanna, W. H. (1980). “Proceedings of 37th Southern Pasture and Forage Crop Improvement Conference, New Orleans”, pp. 75-80. Agricultural Research Service, United States Department of Agriculture. Hartig, A., and Breitenbach, M. (1980). Current Genetics 1, 97. Hebert, P. D. N. (1987). Hydrohiologia 145, 183. Henninger, W. (1973). “3 Symposium Technische Mikrobiologie, Berlin” (H. Dellweg, ed.), pp. 469474. Verlag Institut fur Garungsgewerbe und Biotechnologie, Berlin. F.R.G. Henninger, W. and Emeis, C. C. (1974). Archives of Microbiology 101, 365. Herskowitz, 1. and Oshima, Y. (1981). I n “Molecular Biology of the Yeast Snccharomyces, Life Cycle and Inheritance” (J. N. Strathern, E. W. Jones and J. R. Broach, eds), pp. 181-209. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Hirschberg, J. and Simchen, G. (1977). Experimental Cell Research 105, 245. Holliday, R. (1961). Genetical Research 2, 231. Johnston, G. C. and Singer, R. A. (1980). In “Current Developments in Yeast Research” (G. G . Stewart and 1. Russell, eds), pp. 555-560, Pergamon Press, Toronto. Kelly, M. S. and Gay. J. L. (1969). Archiv,fur Mikrobiulogie 66, 1. Klapholz, S. and Esposito, R. E. (1980a). Genetics 96, 567. Klapholz, S. and Esposito, R. E. (1980b). Genetics 96, 589. Kuenzi, M. T., Tingle, M. A. and Halvorson, H. 0. (1974). Journal of Bacteriology 117, 80. Kuhlenkamp, R. and Miiller, D. G . (1986). British Phycological Journal 20, 301. Kurtz, S. and Lindquist, S. (1984). Proceedings ofthe National Academy ofsciences of the United States of America 81, 7323.
Kurtz, S. and Lindquist, S. (1986). Cell 45, 771. Kurtz. S.. Rossi, J. H., Petko, L. and Lindquist, S. (1986). Science 231, 1154. Kvist, U. (1980). Actu Physiologica Scandinavica 109, 79. Leupold, U. (1956). Journal qf Genetics 54, 41 1. Linder, D., Kaiser-McCaw, B. and Hecht, F. (1975). New England Journnl q / Medicine 292, 63.
Lloyd, D. G. (1980). Eoolutionary Eiology 13, 69. Lokki. J. and Saura, A. (1980). In “Polyploidy: Biological Relevance” (W. H. Lewis, ed.), pp. 277-312. Basic Life Sciences. Vol. 13. Plenum Press, New York and London. Magee, P. T. and Hopper, A. K. (1974). Journal sf Bacteriology 119, 952. Mainwaring, H. R. and Wilson, 1. M. (1968). Transactions of the Brifish Mycological Society 51, 663.
Malone, R. E. and Esposito, R. E. (1981). Molecular and Cellular Biology 1, 891. Maniotis, J. (1980). In “Polyploidy: Biological Relevance” (W. H. Lewis, ed.), pp. 163-192. Basic Life Sciences, vol. 13. Plenum Press, New York and London. Manning, J. T. (1981). Journal of Theoretical Biology 93, 491. Manuel, J. (1973). Comptes Rendus de I’Academie des Sciences 204. 1955. Marmiroli, N. and Bilinski, C. A. (1985). Yeast 1, 39. Marmiroli, N. and Lodi, T. (1984a). Current Genetics 8, 429. Marmiroli, N. and Lodi, T. (1984b). Molecular and General Genetics 188, 69. Marmiroli, N., Ferrari, C., Tedeschi, F., Puglisi, P. P. and Bruschi, C. (1981a). Biologie Cellulaire 41, 79.
Marmiroli, N., Ferri, M. and Puglisi, P. P. (1983). Journal of Bacteriology 154, 118. Marmiroli, N., Tassi. F., Bianchi, L., Algeri, A. A., Puglisi, P. P. and Esposito, M. S. (1981b). Current Genetics 4, 5 1.
Marmiroli, N., Tedeschi, F., Ferrari, C. and Puglisi, P. P. (1985) Microbiologica 8, 233. Marshall, D. R. and Brown, A. H. D. (1981). Heredity 47, 1. Maynard Smith, J. (1978). “Evolution of Sex”. Cambridge University Press, Cambridge. Miller, J. A. (1987). Bioscience 37, 389. Miller, J. J. (1963). Canadian Journal of Microbiology 9, 259. Miller, J. J. (1964). Experimental Cell Research 33, 46.
APOMlXlS IN EUKARYOTIC MICRO-ORGANISMS
51
Miller, J. J. (1981). In “Current Developments in Yeast Research: Proceedings Fifth International Yeast Symposium” (G. G. Stewart and I. Russell, eds), pp. 239-244. Pergamon Press, Toronto. Miller, J. J. (1989). In “The Yeasts” (A. H. Rose and J. S. Harrison, eds), 2nd edn, vol. 3, pp. 489-550. Academic Press, London. Miller, J. J. and Halpern, C. (1956). Canadian Journal qf Microbiology 2, 519. Mittwoch, U.(1978). Journal qf Medical Genetics 15, 165. Moens, P. B. (1971). Canadian Journal of Microbiology 17, 507. Moens, P. B. (1974). Journal of Cell Science 16, 519. Moens, P. B. (1982). Canadian Journal of Genetics and Cytology 24, 243. Moens. P. B. (1987). “Meiosis”. Academic Press, Orlando, Florida. Moens, P. B., Mowat, M., Esposito, M. S . and Esposito, R. E. (1977). Philosophical Transactions of the Royal Society of London B 277, 351. Moens, P. B. and Rapport, E. (1971). Journal of Cell Biology 50, 344. Mogie, M. (1986). Biological Journal of the Linnean Society 28, 321. Nakaseko, Y., Niwa, 0. and Yanagida, M. (1984). Journal of Bacteriology 157, 334. Nel, P. M. (1975). Genetics 79, 435. Newell, S. Y. and Fell, J. w. (1970). Mycologia 62, 272. Nogler, G. A. (1984). In “Embryology of Angiosperms’’ (B. M. Johri, ed.), pp. 475-518. SpringerVerlag, Berlin and New York. Okamoto, S . and Iino, T. (1981). Genetics 99, 197. Palmer, R. G. (1971). Chromosoma (Berlin) 35, 233. Panek, A. C., Bernardes, E. and Panek, A. D. (1985). Yeast Newsletter 34, 57. Parrington, J. M., West, L. F. and Povey, S . (1984). Journal of Medical Genetics 21, 4. Pennak. R. W. (1978). “Fresh-water Invertebrates of the United States”. John Wiley, New York. Perlman, P. S. and Mahler, H. R. (1974). Archives of Biochemisrry and Biophysics 162, 249. Petersen, J. G. L., Kielland-Brandt, M. C. and Nilsson-Tillgren, T. (1979). Carlsberg Research Communications 44, 149. Phaff, H. J. (1986). Microbial Ecology 12, 31. Phaff, H. J. and Starmer. W. T. (1987). In “The Yeasts” (A. H. Rose and J. S . Harrison, eds), 2nd edn, vol. 1, pp. 123-180. Academic Press, London. Polakis, E. S. and Bartley, W. (1965). Biochemical Journal 97, 284. Pontefract, R. D. and Miller, J. J. (1962). Canadian Journal of Microbiology 8, 573. Pratje. E., Schultz, R., Schnierer, S . and Michaelis, G. (1979). Molecular and General Genetics 176, 41 1.
Prillinger, H. (1982). Zeitschrifi fur Mykologie 48, 275. Puglisi, P. P. and Zennaro, E. (1971). E-vperienlia 27, 963. Raikov, 1. B. (1972). In “Research in Protozoology” (T. C. Chen, ed.), vol. 4, pp. 148-289. Pergamon Press, Oxford. Renaud, J. (1937). Comptes Rendus de la SocietP de Biologie 125, 622. Rogers, J. D. (1973). Eiiolution 27, 153. Roman, H. and Sands, S . M. (1953). Proceedings of the National Academy of Sciences ofthe United States of America 39, 17 1. Roth, R. and Fogel, S . (1971). Molecular and General Genetics 112, 295. Rothstein, R. J. (1983). In “Methods in Enzymology”(R. Wu, L. Grossman and K. Moldave, eds), vol. 101, part C. Academic Press, New York. Sando, N. and Saito, T. (1970). Journal of General and Applied Microbiology 16, 347. Sando, N., Maeda, M., Endo, T.,Oka, R. and Hayashibe, M. (1973). Journalof Generaland Applied Microbiology 19. 359. Satina, S. and Blakeslee, A. F. (1935). Botanical Gazette 96, 521. Schild, D. and Byers, B. (1980). Generics 96, 859. Shilo, V., Simchen, G. and Shilo, B. (1978). Experimental Cell Research 112, 241. Sora, S . and Bianchi, M. (1982). Molecular and Cellular Biology 2, 1299. Sora, S., Crippa, M. and Lucchini, G. (1983). Mutation Research 107, 249. Sora. S., Rossi, C. and Cdrbone, M. L. A. (1984). Mutation Research 141, 161. Spiegelman, S . and Reiner, J. M. (1947). Journal of General Physiology 31, 175. Srivastava, P. K., Harashima, S. and Oshima, Y. (1983). Molecular and General Genetics 191,165.
52
CARL A. RILINSKI, NELSON MARMlROLl A N D IOHN J. MILLER
Starmer, W. T., Ganter, P. F.. Aberdeen, V., Lachance, M.-A. and Phaff, H. J. (1987). Canadian Journal of Microbiology 33, 783. Stebbins, G . L. (1950). “Variation and Evolution in Plants”. Columbia University Press, New York and London. Stebbins, G. L. (1971). “Chromosomal Evolution in Higher Plants”. Edward Arnold, London. Stebbins, G. L. (1980). I n “Polyploidy: Biological Relevance” (W. H. Lewis, ed.), pp.495-520. Basic Life Sciences, vol. 13. Plenum Press, New York and London. Stewart, G. G. (1981). Canadian Journal of Microbiology 27, 973. Strunnikov, V. A. (1978). Soviet Journal of Developmental Biology (English translation) 9, I. Subcommittee on Zinc (1979). Zinc in metalloproteins. I n “Zinc”, chapt. 8, pp. 211-223. Committee on Medical and Biologic Effects of Environmental Pollutants, Division of Medical Sciences, National Research Council. University Park Press, Baltimore. Suomalainen, E. (1950). Advances in Genelics 3, 193. Suomalainen, E., Saura, A. and Lokki, J. (1976). Evolutionary Biology 9, 209. Suomalainen, E., Saura, A. and Lokki, J. (1987). “Cytology and Evolution in Parthenogenesis”, CRC Press, Boca Raton, Florida. Tremaine, J. H. and Miller, J. J. (1954). Botanical Gazette 115, 31 I . Trew, B. J., Friesen, J. 0. and Moens, P. B. (1979). Journal of Bacteriology 138, 60. TzagololT, A. (1969). Journal of Biological Chemistry 244, 5027. Unger, M. W. and Hartwell, L. H. (1976). Proceedings of the National Academy of Sciences of the Uniled States of America 73, 1664. Uyenoyama, M. K. (1987). I n “Meiosis” (P. B. Moens, ed.). pp. 21-41. Academic Press, Orlando. Van Wijk, R., Oewehand, J., van den Bus, T. and Koningsberger, V. V. (1969). Biochimica et Biophysica Acta 186. 178. Vespdainen, K. and Jarvinen, 0. (1979). American Zoologist 19, 739. Vezinhet. F., Kinnaird, J. H. and Dawes, 1. W. (1979). Journal of General Microbiology 1 IS, 391. Wagstaff, J. E., Klapholz, S. and Esposito, R. E. (1982). Proceedings qf the National Academy qf Sciences of the United States of America 79, 2986. Wang, H. T., Frackman, S., Kowalisyn, J., Esposito, R. E. and Elder, R. (1987). Molecular and Cellular Biology 1, 1425. Weir-Thompson, E. M. and Dawes, I. W. (1984). Molecular and Cellular Biology 4, 695. White, M. J. D. (1973).“Animal Cytology and Evolution”, 3rd edn. Cambridge University Press, Cambridge. Williams, G. C. ( I 975). “Sex and Evolution”. Princeton University Press, Princeton, New Jersey. Winkler, H. (1906). Annales du Jardin Botanique de Buitenzorg 2 serie 5, 208. Winkler, H. (1908). Progressus Rei Botanicae 2, 293. Winkler, H. (1942). Planta (Berlin) 33, 1. Wright, J. F. and Dawes, I. W. (1979). FEBS Letters 104, 183. Wright, J. F., Ajam, N. and Dawes, I. W. (1981). Molecular and Cellular Biology 1, 910. Yanagita, T., Yagishawa, M., Oishi, S., Sando, N. and Suto, T. (1970). Journal of General and Applied Microbiology 16, 347. Young, T. W. (1987). In “The Yeasts” (A. H. Rose and J. S. Harrison, eds.), 2nd edn, vol. 2, pp. 131-164. Academic Press, London.
Current Trends in Candida albicans Research ASIS DATTA, K. GANESAN and K. NATARAJAN Molecular Biology Laboratory, School of Life Sciences, Jawaharlal Nehru University, New Delhi I10 067, India
I. Introduction . . . . . . . . 11. Genetics . . . . . . . . . A. Ploidy. . . . . . . . . B. Parasexual analysis . . . . . C. Molecular genetics . . . . . 111. Morphogenesis . . . . . . . , A. Yeast-to-hypha conversion . . . B. Switching of colony morphology . . IV. Pathogenesis . . . . . . . , A. What makes Candida albicans infectious? B. Cure for candidiasis . . . . . V. Problems in research on Candida albicans . VI. Summary . , . . . . . . . VII. Acknowledgements . . . , . . . References . . . . . . . . .
. . . . . ,
. .
. . . ,
. . . .
. .
. . .
.
. .
. . . . ,
.
. . . . .
.
. . . . . . ,
. .
. . . .
. . . . .
.
.
. . . . . .
. . . . . ,
. . . . . . . . .
. .
. .
,
,
.
.
.
.
.
. . . ,
. . . . . . . . . . . . .
.
. . . . . . . . . . . . . .
53 54 54 56 57 58 59 65 67 68 77 79 82 84 84
I. Introduction
Candida albicans has aroused considerable interest because it is a human pathogen and it can also exist in different cellular morphologies. The objectives envisaged in C. albicans research are: (1) to understand the basis of pathogenicity and work out a specific therapy and (2) to study cellular differentiation. These aspects constitute the main subject of this review. Publications on C. albicans have proliferated rapidly in the last few years. There are review articles covering C. albicans morphogenesis (Odds, 1985; Shepherd et al., 1985; Soll, 1986), genetics (Shepherd et al., 1985), antigenic variation (Poulain et al., 1985), pathogenicity (Bodey and Fainstein, 1985; Shepherd et al., 1985; Dei-Cas and Vernes, 1986) and also host-defense mechanism (Waldorf, 1986). There are some exciting developments in C. albicans research. Some of them concern high-frequency switching of colony ADVANCES IN MICROBIAL PHYSIOLOGY, VOL 30 ISBN 0-12-027730-1
Copyright &' 1989. by Academic Press Limited All rights of reproduction in dny form reserved
54
ASlS DATTA,
K.G A M S A N AND K.NATARAJAN
morphology, surface antigens and genetic transformation systems. However, there are obvious difficulties in studying C. afbicans. As it is naturally diploid and a sexual cycle is absent, genetic analysis by conventional techniques cannot be applied. The other problem, which has not been seriously considered so far, is the inherent strain differences. We have highlighted this as one of the problems facing C. albicans research. 11. Genetics
Genetic analysis of C. afbicans has been hampered due to its diploid nature and the lack of a sexual cycle. However, some progress has been made in isolation of mutants, in hybridization and in recombination analysis. These studies were recently reviewed by Shepherd et af. (1985). Our emphasis i s on advances made in the last two years with particular reference to the molecular genetics of this organism. A. PLOIDY
Most clinical isolates of C. afbicans are diploid; few isolates appear to be haploid or tetraploid. The content of DNA and genomic complexity of many isolates indicate that they are diploid. While chemical estimations of DNA content gave a value of 37 fg per cell, kinetic complexity measurements gave half this value per haploid genome (Riggsby et al., 1982). Besides, survival rates of many strains exposed to mutagens were similar to those of Saccharonayces cereuisiae diploids rather than haploids (Olaiya et af.,1980;Suzuki et a/., 1982). Another evidence comes from the biased set of auxotrophs yielded by C. albicans strains. These strains on mild mutagenesis yielded either no auxotrophs or a limited set of auxotrophs at high frequencies (Whelan et al., 1980; Whelan and Magee, 1981; Poulter et al., 1982). The auxotrophs were often found as part of sectored colonies, the prototrophic sector being refractory to further mutagenesis. These results were explained as follows. The strains are diploid and are heterozygous for a limited number of recessive auxotrophic alleles; on mutagenesis, wild-type and mutant alleles segregate by mitotic recombination, giving rise to auxotrophs and stable prototrophs (Fig. 1). Additional evidence for diploidy comes from revertants of these auxotrophs, whose mutation spectra were similar to those of their respective prototrophic parent strains. Furthermore, protoplast fusion (see Section 1I.B) and gene-disruption experiments (see Section 1I.C)confirm the diploid nature of C. albicans. However, not all strains of C. albicans are diploid. Suzuki et al. (1982) found a few haploid and tetraploid strains in their extensive search among clinical isolates. They analysed the isolates for nuclear DNA content, and for
CURRENT TRENDS IN CANDIDA ALBICANS RESEARCH
55
d Homozygous 3
MET
prototrophic segregan t Mitotic recombination in h e teroz yg ous prototrophic p a r e n t
- - : - <
-
met
Horno zy g o us auxo t rop h ic segregant
FIG. 1. Mitotic recombinationcan explain the biased auxotrophic spectra of Candida albicans. The example shown is of strain FC18 (Whelan ef al., 1980), which segregates methionine auxotrophs at high frequency.
sensitivity to ultraviolet irradiation. Ploidy was decided by using Sacch. cereuisiae strains of different ploidy as standards. Fifteen of the isolates were diploid, three were haploid and one was tetraploid. The haploids were atypical since they did not form germ tubes. Olaiya et af.(1980) also reported variant haploid strains which were germ-tube negative. However, to confirm that these strains are true haploids, it has to be shown that their auxotrophic spectra are unbiased, and revertants of auxotrophs obtained from them do not behave as heterozygotes. Ploidy shift, from diploid to tetraploid and from tetraploid to diploid, was reported in a particular strain of C. albicans (Suzuki et al., 1986a). A shiftdown in ploidy was seen in tetraploid cells when nuclear division and cell division proceeded without a significant increase in the content of DNA per cell. This phenomenon is apparently similar to meiosis I1 in Sacch. cereuisiae, but differs in that it produces diploid daughter nuclei. A ploidy shift from diploid to tetraploid was found when the cells underwent rapid nuclear DNA synthesis without much increase in cell number. Increase in ploidy was probably due to chromosome duplication in the absence of nuclear division (Suzuki et al., 1986a). In conclusion, it can be stated that most of the natural isolates of C. albicans are diploid; however, some strains are haploid though atypical. An extensive search among clinical isolates may yield a haploid strain which would resemble a typical C. albicans strain in its physiology, morphogenesis and pathogenesis. From such a strain, it should be possible to isolate any desired mutant defective in morphogenesis or pathogenesis without depending on the chance occurrence of natural heterozygotes.
56
ASlS DATTA. K. GANBSAN AND K. NATARAJAN
B. PARASEXUAL ANALYSIS
No natural sexual cycle has been reported in C. albicans so far. However, Suzuki ef al. (1986b) have shown hybridization, at low frequency, between C. ufbicansstrains and between C. albicuns and C. guilfiermondii;mild ultraviolet irradiation of C. alhicuns was needed to induce hybridization. The DNA content of the hybrids varied from near diploid to triploid levels. The hybrids have apparently resulted from partial transfer of genetic material between the nuclei of heterokaryons rather than from true karyogamy. Extensive work has been done on hybrids that were obtained by fusion of protoplasts. Sarachek ef al. (1 981) and Sarachek and Weber (1984) studied the nature of these hybrids in detail. The products of protoplast fusion are heterokaryons which assort their nuclei into monokaryotic blastospores. Most of these monokaryons have parental-type nuclei, but some have hybrid nuclei with their DNA content between one and two times that of parental strains. Hybrid nuclei arise by transfer of a portion of the genetic material between nuclei of the heterokaryon. The amount of genetic material transferred increases with increasing growth temperatures in the range 2 5 4 I "C.It is not clear whether whole chromosomes are transferred between nuclei. Sarachek and Weber (1986) have shown that the nuclei of heterokaryons often undergo heritable recessive lethal or growth-debilitating genetic damage. These were ascribed to nullisomics, functionally severe aneuploids or deletions of parts of chromosomes, perhaps sustained during internuclear genetic exchanges. Hybrids of C. albicans are unstable. Even tetraploids, apparently obtained through true karyogamy, lose their chromosomes. Cells which are heterozygous for 5-fluorocytosine resistance are only partially resistant to the drug, compared to homozygous resistant cells which are highly resistant. Selection for increased resistance in heterozygous tetraploid hybrids resulted in highly resistant variants which were of lower ploidy. In terms of DNA content, they were aneuploid, triploid or diploid (Whelan et al., 1985). Chromosome loss also can be induced in C. albicans(Hi1ton et a/., 1985). Heat shock leads to a decrease in DNA content of tetraploids and aneuploids to near diploid levels. Such a shock induces mitotic instability in diploid strains as well. However, no change in DNA content is observed; the mechanism for this is not clear. Frequencies of mitotic recombinants, induced in partial hybrids by ultraviolet irradiation, also indicate that most strains of C. albicans are diploid (Sarachek and Weber, 1984). If parent strains are haploid, all partial hybrids prototrophic for a particular requirement must be uniformly heterozygous ( + -) for the wild type (+) and mutant ( - ) alleles. These hybrids should segregate auxotrophic recombinants at similar frequencies. However, if the
CURRENT TRENDS IN CANDIDA ALBICANS RESEARCH
57
parent strains are diploid, partial genetic exchanges in heterokaryons, between a nucleus with auxotrophic alleles ( - -) and one carrying the corresponding wild-type alleles ( + +), would give three kinds of heterozygotes, namely - - +, - + + and - - + +. Ultraviolet irradiation should induce auxotrophic recombinations readily in - - strains, but not at all in ones and at a very low frequency in - strains. Segregation data for partial hybrids clearly show that parent strains are diploid (Sarachek and Weber, 1984). In spite of these limitations, protoplast fusion was successfully used for complementation and recombination analysis. Linkage relationships were deduced mainly from mitotic instability of diploid, aneuploid or tetraploid heterozygotes. Ultraviolet radiation-induced mitotic crossing over was used to map the genes with respect to centromeres. Chromosome loss, spontaneous or induced, has provided information about whole linkage groups. Five linkage groups have been demonstrated so far (Sarachek et al., 1981 ;Poulter et al., 1982; Whelan and Soll, 1982; Kakar et al., 1983; Poulter and Hanrahan, 1983; Poulter and Rikkerink, 1983; Hilton et al., 1985; Shepherd et al., 1985). Electrophoretic karyotype analyses of many C. alhicans strains have been performed. The number of chromosomes reported range from five to 10, depending on the technique employed (Snell and Wilkins, 1986; Lott et af., 1987; Magee and Magee, 1987; Snell et al., 1987). The differences could be due to electrophoretic artefacts; high electric-field strengths and non-uniform electric fields used in typical pulsed-field gradient gel-electrophoretic techniques often lead to DNA disappearance, especially when molecules approach or exceed the sizes of the largest chromosomes of Sacch. cerevisiae (Smith et al., 1987). Such artefacts might also occur with field inversion gelelectrophoresis. Another problem special to C. albicans stems from its ploidy; homologous chromosomes (if they are different in size) might be resolved during electrophoresis and thus can be mistaken for heterologous chromosomes. Southern blotting with cloned gene probes, in conjunction with pulsed field gel-electrophoretic techniques which can resolve DNA molecules with millions of base pairs (Smith et al., 1987), would give a firm answer about chromosome number in C. alhicans.
+ ++
++
C. MOLECULAR GENETICS
Since classical genetics of C. alhicans is tedious and depends on the chance occurrence of heterozygotes to isolate any desired mutant, reverse genetic techniques are all the more imperative. The general approach used so far to clone C. albicans genes is through complementation of Sacch. cerevisiae mutants with plasrnids from C. albicans genomic libraries; URA3 (Gillum ef
58
ASlS DATTA, K GANESAN A N D K. NATARAJAN
al., 1984), HIS3, T R P l (Rosenbluh et al., 1985)and ADEZ (Kurtz et al., 1986) genes were cloned in this manner. Using the ADE2 gene, Kurtz et al. (1986) transformed C. albicans, albeit at low frequency. Their analysis of a limited number of transformants showed that transformation had occurred through homologous recombination at the ADE2 region, of either of the two chromosomal homologues. Through integrative transformation, Kelly et al. (1987) disrupted the URA3 gene of C. albicuns. The ADEZ gene was used as a selectable marker for transformation. The cloned C . albicans URA3 gene was disrupted with the ADEZ gene and the linearized DNA was used for transformation. Both insertional inactivation and a deletion which removes part of the URA3 gene could be engineered into the C. albicans genome. EcoRI restriction sites were different at the (IRA3 regions of the two chromosomal homologues, with which it was shown that either of the homologues could be disrupted. Transformants of one strain (A81-Pu)which were heterozygous for the ura3 mutation were rendered homozygous by ultraviolet irradiation. However, this could not be done with transformants of another strain (SGY 129),which apparently has more than two copies of the URA3 gene. Thus, directed mutagenesis appears possible as long as the gene to be disrupted is not present at more than one locus. Kurtz et ul. (1987) isolated an autonomously replicating sequence (ARS) from C. albiruns, which allows plasmids to be maintained extrachromosomally in this yeast. Such plasmids transform at high frequency and facilitate cloning of nuclear genes through mutant complementation. These plasmids are generally present in high copy number, and thus can be used to study the effect of gene dosage on gene expression. Plasmids with C. albicuns ARS form head-to-tail tandem repeats, which are either present as unstable free plasmids or are integrated stably into the chromosome (Kurtz et ul., 1987). The sequence responsible for ARS phenotype is 350 base pairs in size, and is present as a single copy in each haploid genome. Perhaps this small fragment does not have sufficient sequence information to function like ARSs of Succh. cereuisiue. Additional sequences, or a much larger fragment from the C. alhicans genome, might make these autonomously replicating plasmids more useful. 111. Morphogenesis
Cundidu alhicuns is a polymorphic fungus. It displays four different cellular and a variety of colony morphologies. It grows as blastospores, pseudohyphae or hyphae; it can also form chlamydospores. Blastospores are round or oval cells, 2-5 pm in diameter, with multipolar budding. Pseudohyphae consist of elongated yeast cells attached to each other; junctions between pseudohyphal cells are constricted. True hyphal cells are longer than blastoconidia and have
CURRENT TRENDS IN CANDIDA ALBICANS
RESEARCH
59
perforated septa; cell junctions are not constricted. Chlamydospores are thickwalled asexual spores formed by the rounding up of pre-existing cells (Torosantucci and Cassone, 1983; Odds, 1985). All of these forms can be induced in vitro, under defined growth conditions. A. YEAST-TO-HYPHA CONVERSION
Yeast-to-hypha conversion occurs through an intermediate germ-tube stage. An enormous amount of work has been carried out over the years on this aspect. For recent reviews see Odds (1985), Shepherd et af. (1985) and Sol1 (1 986).
I . Inducers Yeast-to-hypha transition in C. alhicans is controlled by environmental conditions. By varying different parameters such as the carbon source, pH value, ions and temperature, hyphae formation can be induced. It appears that the metabolic state of the cell is an important factor in the ability of C. alhicans to respond to conditions that favour germ-tube formation. It has been demonstrated that actively growing cultures need to be starved before they can produce germ tubes (Shepherd e / al., 1980a). Such starved cells can produce germ tubes regardless of their position in the cell cycle. A number of factors are known to regulate the dimorphic transition of C. alhicans, the most important being growth medium and temperature. Germ tubes are induced when blastospores are incubated at a temperature between 33 and 42'C in a medium containing amino acids such as proline, glutamine and arginine (Odds, 1979), aminosugars such as N-acetylglucosamine and N acetylmannosamine (Simonetti et af., 1974; Sullivan and Shepherd, 1982; Natarajan e / af., 1984) or ethanol (Pollack and Hashimoto, 1985). Furthermore, N-acetylhexose derivatives, such as chitin, mucin, hyaluronic acid and immobilized N-acetylglucosamine (Shepherd and Sullivan, 1983),are all capable of inducing germ tubes. Since these derivatives are not metabolized or transported into cells, it is believed that the inducer binds to a cell-surface receptor and produces an intracellular signal, which primes the cells for germtube formation. Germ-tube formation is induced at 37°C. Above 33°C mycelia are formed while below that temperature pseudomycelia are produced (Cassone et al., 1985). Divalent cations are necessary for germ-tube formation. It has been shown that magnesium ions are required for germination (Walker et af., 1984). The involvement of calcium ions in this process has also been reported (see Section ITI.A.3.a). A pH value in the range 6-8 iscritical for germ-tube formation (Odds, 1979). Under certain conditions, pH value can serve as a sole determinant of cell
60
ASlS DATTA, K. GANESAN AND K. NATARAJAN
morphology. When yeast cells, which have entered the stationary phase of growth due to zinc depletion, are released into fresh medium at 37°C they synchronously form buds at pH 4.5, and form germ tubes at pH 6.7 (Buff0 el al., 1984).The advantage with this method is that the conditions for inducing the alternate phenotypes are very similar, facilitating meaningful analysis of temporal and spatial differences between the phenotypes (Soll, 1986). However, Pollack and Hashimoto (1987) reported that germ tubes are produced at a pH value as low as 3.0, in a medium lacking glucose, suggesting that glucose, at low pH values, suppresses germ-tube formation. However, the mechanism of inhibition is not clear. 2. Morphogenesis-Associated Changes Extensive work has been done on changes associated with yeast-to-hypha conversion in C. alhicans. For comprehensive reviews see Odds (1989, Shepherd er al. (1985) and Soll (1986). Here we concentrate on those aspects which are promising in elucidating the mechanism of morphogenesis. Under pH-regulated dimorphism, the budding and hyphae-forming populations differ in the time of commitment to respective morphologies, in the onset of septation, in the location of septum between the mother and daughter cells and in the shape and dynamics of growth of the daughter cell. Commitment to budding occurs at about the time of evagination, while commitment to hypha formation occurs 20-30 min after evagination (Mitchell and Soll, 1979a). Onset of septum formation is also delayed in hyphae compared with that of buds, and correlates closely with the time of commitment. The septum is positioned a t the junction of the mother cell and bud, but within the hypha about 2pm from the junction (Mitchell and Soll, 1979b). The most obvious difference between budding and hypha-forming cells is the shape of the daughter cell. Staebell and Sol1 (1985)explained this in terms of temporal and spatial differences in cell-wall expansion during bud and hypha formation. During bud growth, a very small, highly active apical zone accounts for about 70% of surface expansion. When the bud reaches about two-thirds of its final surface area, the apical zone shuts down, and subsequent growth is completed by a general expansion. During growth of hypha, at least 90% of expansion is due to a small, highly active, apical growth zone, and less than 10% is due to the general mechanism. The apical growth zone of hyphae never shuts down as long as growth continues in hyphal form. Anderson and Sol1 (1986) reported that actin localization is correlated with the growth zones of buds and hyphae of C. alhicans. In both budding and hypha-forming cells, just before evagination, actin granules are localized at the site of evagination. When the incipient bud or hypha appears, actin granules are seen within them. With continued bud growth, the actin granules are then
CURRENT TRENDS IN CANDlDA ALBICANS RESEARCH
61
redistributed throughout the cytoplasmic cortex. In marked contrast, the majority of actin granules are seen clustered at the hyphal apex. Thus, actin localization seems to determine cell-wall expansion zones. However, it is not clear what in turn determines actin localization. An answer to this problem would perhaps advance our understanding of morphogenesis in C. albicans. During commitment to either the bud or hyphal form, no significant biochemical difference has been observed between budding and hyphaforming cells. Chitin content and chitin synthase activity were shown to be higher in hyphae compared with buds (Braun and Calderone, 1978; Chiew et al., 1980).However, with pH-regulated dimorphism, no difference was seen in the initial rate of chitin synthesis (Soll, 1986). Thus, it is unlikely that chitin synthase is involved in regulation of morphogenesis. Cyclic AMP (CAMP)is involved in signal transduction in many organisms. Cyclic AMP (Niimi et al., 1980; Singh et al., 1980b), CAMP-dependent protein kinases (B. Gupta Roy and A. Datta, unpublished observation) and CAMP-independent protein kinases (Gupta Roy and Datta, 1986)have been detected in C. albicans. With certain induction conditions, germ-tube formation was accompanied by a rise in intracellular concentration of CAMP (Niimi et al., 1980; Chattaway et al., 1981). But, with pH-regulated dimorphism, cAMP contents in budding and hypha-forming populations were not different (Soll, 1986).Thus, it is unlikely that cAMP is involved in signal transduction. Patterns of DNA methylation were studied in yeast and mycelial forms (Russell et al., 1987). The 5methylcytosine content was lower in the mycelial form compared with the yeast form. However, the significance of this observation is not clear. 3. Regulation
Morphogenesis in C. albicans is a phenomenon triggered by environmental conditions. Presumably, transduction of these external signals into the cell results in a differential gene expression, that would in turn result in differentiated phenotypes. Both Ca(rr)and calmodulin are likely to be involved in signal transduction. a. Ca(rItCalmodu1in and Protein Phosphorylation Calmodulin is a ubiquitous protein that plays a central role in many aspects of cellular regulation (Cheung, 1980). Calmodulin is present in C. albicans (Hubbard et al., 1982)and other fungi (Muthukumar et al., 1985,1987). In the dimorphic ascomycete Ceratocystis ulmi, the Ca(rrbalmodu1in interaction is important for commitment to morphological forms (Muthukumar and Nickerson, 1985) and also for mycelium production (Muthukumar and Nickerson, 1984). Chlorpromazine, a known calmodulin antagonist, blocks germ-tube formation by C. albicans (Wood and Nugent, 1985). The
62
ASlS DAT’IA. K. G A N E S A N A N D K. N A T A R A J A N
involvement of Ca(ir)-calmodulin and protein phosphorylation in C. alhirans germ-tube formation is being investigated in our laboratory. Germ-tube formation by this yeast is arrested by trifluoperazine (TFP), a calmodulin inhibitor (Gupta Roy and Datta, 1987). Experiments with the ionophore A23187 have indicated that intracellular Ca(rr) is also required for germ-tube formation. Incorporation of 32Pis higher in germ tube-forming cells; but TFP decreases 32P incorporation (Gupta Roy and Datta, 1987). SDS-PAGE analysis revealed germ tube- and bud-specific protein phosphorylation (V. D. Paranjape, B. Gupta Roy and A. Datta, unpublished observation). Characterization of these morphology-specific phosphoproteins and identification of the putative protein kinases might unravel the signal-transduction pathway involved in morphogenesis. b. Identification of Morphology-Related Gene Products In systems where differentiation is well studied, such as the decision of phage lambda to enter either the lytic or lysogenic mode of growth, and sporulation in Bacillus spp., master control genes regulate differentiation. These genes cause differential expression of other genes, resulting in differentiation. Differential gene expression involves synthesis, disappearance or changes in the contents of certain polypeptides. There are two inherent problems in identifying polypeptides which are differentially expressed in buds or hyphae. The first problem is caused by limitations in the techniques employed. Regulatory polypeptides would be present only in minute amounts and thus might go undetected. The second problem arises from the different culture conditions used to form buds and hyphae. These conditions alone might cause differential expression of certain polypeptides unrelated to morphogenesis. Manning and Mitchell ( 1980b)and Finney et al. (1985) circumvented this problem with strains which were defective in hypha formation. Finney ct al. (1985)identified two polypeptides, one exclusively expressed in buds and the other in hyphae. If they are truly morphology specific, they should be consistently seen under any condition used to grow buds or hyphae. However, Manning and Mitchell (1980b)could not identify any polypeptide specific for either of the morphologies, under their induction conditions. Some proteins are specificallyexpressed on the cell surface of hyphae (Table 1; Anderson and Soll, 1987; Ponton and Jones, 1986; Smail and Jones, 1984; Sundstrom and Kenny, t984). Antibodies against these proteins were used in immunofluorescence experiments. These antibodies did not stain the mother cells, but intensely stained germ tubes and hyphae. Blastospores budding from these hyphae were not stained, confirming the hypha-specific expression of these proteins. If genes coding for these proteins are cloned, their control of expression can be studied. From such studies, it would be possible to know
63
CURRENT TRENDS IN CANDIDA ALBICANS RESEARCH
TABLE 1. Cell surface antigens of Cundidu ulbicans
Molecular weight Location
(M, x
Chemical nature
Serum levels during disease
Hyphaspecific
Glycoprotein (mannoproteins) Glycoprotein
N.D."
Yes
N.D.
Yes
Cell surface 200-235
GIycoprotein
N.D.
Yes
Cell surface N.D.
Carbohydrate
N.D.
Yes
Cytoplasm
48
Protein
Present
N.D.
Secreted
N.D.
Present
N.D.
Secreted
47
Carbohydrate (probably mannans) Carbohydrate
Present
N.D.
N.D. N.D.
Present
N.D. Nob
Cell surface 200 Cytoplasm
19
Secreted 47 Cell surface 13.5
N.D.
Reference Sundstrom and Kenny (1984, 1985) Ponton and Jones (1986) Ponton and Jones ( 1986) Brawner and Cutler ( 1 986a. b) Strockbine el a/. ( 1984a,b) Hopwood et a/. (1986)
Matthews et a/. (1987) Neale el al. (1987) Anderson and Sol1 ( 1987)
N.D., not determined. The 13,500 D a cell-surface antigen is unique to budding, non-germinating opaque cells.
more about, and finally to identify, the master control gene which determines differentiation. 4. Morphological Variants
Another approach in investigating morphogenesis is to study mutants defective in hypha formation. By pin-pointing defects at the biochemical and genetic levels, we might learn more about regulation of morphogenesis. There are several reports of strains that exhibit a variant morphology. They have been isolated from natural populations (Table 2) (Shimokawa and Nakayama, 1984, 1986; Cannon, 1986; Howard et al., 1986), by nitrosoguanidine mutagenesis (Hubbard er af.,1986) or by mild ultraviolet irradiation (Pomes er al., 1985). Use of an induced mutant is suspect, because there is likelihood of simultaneous mutations at unlinked loci. Shimokawa and Nakayama (1986) isolated a variant, obtained by plating normal wild-type cells; this natural variant (a spontaneous mutant) exhibited a rough-colony phenotype but the cellular morphology was yeast-form.
64
A S S DATTA.
K.GANESAN A N D K. NATARAJAN
TABLE 2. Morphological variants of Candida a/bicuns“ Cellular morphology Strain
25°C
37°C
Pathogenicity
2252’ B311V6
Y
H
Y
N.D.d Non-pathogenic
hOG301
H
H
Y Y
(a) Pathogenic (b) Non-pathogenic N.D. N.D.
Y
(a) Non-pathogenic
Y
(b) Pathogenic Pathogenic
Y‘
N.D. MM2002 Y 300-SG (3153A-SG) Y CA2 A12
Y
Reference Manning and Mitchell f1980a) Buckley el a/. (1982); Sobel et a/.(1 984) Shepherd (1 985) Hubbard et a/. (1986) Cannon (1986) Howard e/ a/. (1986) Mattia et a/. (1982); Bistoni et u/. (1986) Shepherd (1985) Torosantucci and Cassone (1983)
Strain hOG301 is an induced mutant, while the other strains are spontaneous mutants. All strains except hOG301 have been typed as authentic C. dbicans. Candidu u/hican.r 2252 produced germ tubes at 37°C in human serum. ‘ Y indicates the yeast form and H the hyphal form. N.D., not determined.
Interestingly, the rough-colony phenotype was conditional; it appeared rough only when grown on Sabouraud glucose agar. This variant was typed as C. afbicans,and displayed cell aggregation and adhesion to glass surfaces. It had about one-fourth of the amount of mannan compared with its parent. Furthermore, its surface hydrophobicity was also high. Cannon (1986) has reported a mutant that is impaired in mycelium production. By several criteria, this mutant was shown to be derived from the parental strain of C. alhicans. N o studies have been undertaken using this mutant to understand morphogenesis. Howard et al. (1986) reported a variant C. alhicans that occurred at a frequency of 0.1 % among natural populations; the reversion frequency was This variant grows as pseudohyphae and does not produce germ tubes. This isolate was verified to be C. albicans. Further investigations are required to pin-point the cause of the defect in germ-tube formation. Hubbard et al. (1986) isolated a “mycelial” mutant after nitrosoguanidine mutagenesis. This had a rough-colony morphology and exhibited a stable, filamentous cellular morphology. A “rough”-colony morphology mutant was reported by Pomes et al. (1985). The wild-type (smooth-colony) strain, upon mild ultraviolet irradiation, gave rise to many “rough” segregants. Rough colonies, on further ultraviolet irradiation, gave sectored rough/smooth segregants. The smooth segregant spontaneously
CURRENT TRENDS IN CANDIDA ALBICANS RESEARCH
65
segregated to produce some rough colonies. Possible involvement of a dominant gene that could control dimorphism (the gene might be involved in repression of mycelium during growth as yeast) has been postulated. B. SWITCHING OF COLONY MORPHOLOGY
Candida afbicans not only can change its cellular morphology in response to growth conditions, but also can heritably switch its cellular phenotype. This was recently discovered in the form of colony morphology switching. The yeast normally forms smooth, white colonies. However, it can switch its colony morphology, heritably and reversibly. At least three different switching systems are known. The first to be reported was in strain 3153A, which switches between at least seven phenotypes, namely smooth, star, ring, irregular wrinkle, hat, stipple and fuzzy (Fig. 2A-G; Slutsky et af., 1985). Spontaneous conversion from the original smooth phenotype to variant phenotypes occurs at a frequency of 1.4 x but is increased 200-fold following a low dose of ultraviolet radiation. After this initial conversion, cells switch spontaneously to other phenotypes at a combined frequency of 2 x lo-* (Slutsky et al., 1985). A C.albicans isolate from a vaginitis patient also exhibited a similar switching system (Soll et al., 1987). A second high-frequency switching system, referred to as white-opaque transition, was first reported in strain WO-1, an isolate from a patient with systemic candidiasis (Slutsky et al., 1987). In this system, cells switch heritably, reversibly and at a high frequency (lo-’) between white hemispherical colonies and opaque colonies which were larger, flatter and grey (Fig. 2 H). A similar switching system was also reported with three isolates from vaginitis patients (Soll et al., 1987). A third switching system was seen in five isolates from vaginitis patients (Soll et al., 1987). Here, the strains switch between a smooth-colony morphology and a heavily myceliated colony morphology. These strains also switch to other colony forms; however, the switching repertoire is not the same for all strains. Colony morphology switching has also been shown in benomyl-induced rough-colony mutants of C. afbicans (Pomes et al., 1987). The parent strain has a white smooth-colony morphology which is stable. However, the rough-colony mutants spontaneously segregate smooth or sectored (rough/smooth) colonies at about 2% frequency. The smooth segregants switch to a rough phenotype at similar frequencies. Other switch morphologies-“wavy” and ‘fuzzy”-which are capable of switching to other forms were also obtained. The cellular basis for the differences in diverse colony morphologies has been worked out only for the white-to-opaque transition (Anderson and Soll, 1987; Slutsky et af., 1987). White and opaque cells differ in their shape, size and budding pattern. Opaque cells are bean shaped, at least twice as large as white
66
ASlS D A T T A . K. G A N E S A N A N D
K. N A T A R A J A N
FIG. 2. Colony morphology of switch phenotypes of Candida afbicansstrain 3153A (A-G) and strain WO-1 (H). Key: A, smooth; B, star; C, ring; D, irregular wrinkle; E, stippled; F, hat; G, fuzzy; H, a white (W) colony with an opaque (Op) sector of strain WO-1. From Slutsky er al. (1985, 1987).
CURRENT TRENDS IN CANBIDA ALBICANS RESEARCH
67
cells, contain twice the mass of white cells and exhibit budding at opposite poles, a condition rarely seen in white cells. No significant difference is seen in ploidy or in nuclear number. When compared with white cells, opaque cells have a longer generation time, fail to form hyphae under standard induction conditions, and are both cold- and heat-sensitive (Slutsky et al., 1987). Opaque cells also show a few other unique features (Anderson and Soll, 1987). Their cell surface has a pimpled or punctate pattern. The dynamics of actin localization indicate that the growth of budding opaque cells is similar to that of budding white cells during the early stages, but similar to that of hyphaforming white cells in the later stages of growth. A hypha-specific antigen is also expressed on the surface of budding opaque cells. An opaque-specific surface antigen is also seen, but distributed in a punctate pattern. Thus, the opaque phenotype seems to result from temporally modulated expression of bud-, hypha- and opaque-specific genes (Anderson and Soll, 1987). Two aspects which are most striking in colony-morphology switching are that it occurs at high frequency and that it results in a large number of phenotypic changes. Thus, switching is probably due to a change in the expression of a master control gene. This gene, presumably, regulates expression of many other genes which would result in diverse phenotypes. A mechanism similar to transposition may affect expression of the regulatory gene and cause switching. A particular mid-repeat sequence is known to be highly mobile in the genome of strain WO- 1, which undergoes white-opaque transition (Soll et al., 1987). However, the genomic changes caused by this sequence were not correlated with the switch phenotypes, indicating that it is not involved in switching. The transposon responsible for switching, if such exists, remains to be discovered. Colony-morphology switching may modulate the capacity of C. alhicans to invade diverse body locations, to evade the host immune system, possibly by changes in cell-surface antigens, or to change antibiotic resistance. Soll et al. (1987) have shown that switching occurs, in some instances, at the site of infection. Many isolates from vaginitis patients were present in multipleswitch phenotypes or were in a high-frequency mode of switching (lo-' to 10- 3). Thus, it is likely that colony-morphology switching plays an important role in pathogenesis. 1V. Pathogenesis
The pathogenic potential of C. alhicans has made it a medically important organism. The yeast causes candidiasis in humans and other mammals. Other species responsible for candidiasis in humans are C. tropicalis, C . pseudotropicalis, C.guilliermondii, C. krusei, C.parapsilosis and C.stellatoidea.
68
ASlS DATTA. K. GANESAN A N D K. NATARAJAN
Candida albicans is the predominant species identified and so this organism is used in most of the studies. Pathologic studies have demonstrated three types of infections, namely superficial, locally invasive and systemic (Luna and Tortoledo, 1985). Superficial infections are the most common and are seen on the mucous membranes of the oral cavity and respiratory tract, and on the skin. Locally invasive candidiasis occurs in immunocompromised patients and is frequently encountered as ulcerations of intestinal, respiratory or genito-urinary tracts. Systemic candidiasis is the most serious variety and involves invasive infection of the parenchyma of visceral organs, such as the heart, kidneys, liver, spleen, lungs and brain. Candida albicans pathogenesis has been described in many reviews (Odds, 1979; Rogers and Balish, 1980; Bodey and Fainstein, 1985; Dei-Cas and Vernes, 1986; Waldorf, 1986). In this review, reports that have appeared in the last two years are covered. At the end of this section, the progress made towards a cure for candidiasis is discussed. A. WHAT MAKES
Candida albicans INFECTIOUS?
Candida albicans is a commensal of the respiratory and gastro-intestinal tracts, the vagina and, less frequently, the skin of healthy persons. The majority of the carriers suffer no ill effects as a result of colonization. However, an important feature of C.albicans pathogenesis is that this harmless commensal becomes infectious, leading to candidiasis, when the host defense breaks down. Hence candidiasis is a disease of the diseased and C. albicans is called an opportunistic pathogen. The host defenses include the skin-mucosal barriers, the immune system and hormone levels.
I . Predisposing Factors and Host Defense Mechanisms a. Skin and Mucosal Barriers The stratified squamous epithelium normally functions as a very effective barrier against microbial invasion (Smith, 1985). Mechanical breakdown of the normal skin defenses is the most important predisposing factor for skin infections. The breakdown might occur as in burn injury or due to increased moisture and maceration of the skin. Mucosal surfaces are the initial site of infection for C. albicans and the major encounter between microbial pathogenic factors and host defenses occurs at this surface. Mucosal surfaces of the mouth, the gut and the vagina may be colonized with C.albicans in up to 80% of normal individuals (Odds, 1979) and the colonization is generally increased in patient populations. The interaction between C.albicans and other commensals is perhaps the most important factor affecting the degree of colonization of mucosal surfaces. The bacterial flora prevents binding and invasion of C. albicans. Given the importance of the normal microbial flora in
CURRENT TRENDS IN CANDIDA ALBICANS RESEARCH
69
suppressing C. albicans colonization, antibiotic therapy thus acts as one of the predisposing factors. b. Immune System The immune system is normally effective in combating C. albicans. Candida albicans infection is dependent on breakdown of the host immune system. The predisposing factors are seen in leukemia patients receiving immunosuppressive therapy (Jones, 1981; Cole et al., 1987; Reizenstein, 1987), in cancer patients (Cho and Choi, 1979), in patients after surgical intervention and in AIDS patients (Klein and Watanakunakorn, 1979; Mildvan et al., 1982; Klein et al., 1984; Centers for Disease Control, 1986; Pedersen et ul., 1987).An analysis of the underlying defects in these patients indicated that C. albicans infection is specifically associated with defective cell-mediated immunity. Delayed-type hypersensitivity (Valdimarsson et al., 1973),an abnormal in vitro proliferative response to C. albicans antigens and an enhanced level of antiCandida antibodies (Takeya et al., 1976) clearly show that defective cellmediated immunity predisposes a host to C. ulbicans infection. c. Inherent Immunity Inflammation is the body’s first reaction to C. albicans invasion. The inflammatory response includes an increased blood supply to the infected area and an increased capillary permeability. These responses help the soluble mediators of immunity to reach the site of infection, while the neutrophil polymorphs, and to a lesser extent the macrophages, migrate out of the capillaries into the surrounding tissues. Once they reach inside the tissue, they migrate towards the site of infection by chemotaxis. The complement factors are believed to function in the chemotactic process. Polymorphonuclear neutrophils contain lysosomal granules, which possess a variety of hydrolytic enzymes. These neutrophils engulf the yeast form of C. albicans. The lysosomal granules fuse with the vacuole containing C. albicans to form a phagolysosome which brings about an efficient killing of the yeast. Candidu albicans hyphae are also frequently encountered in tissues. However, they are too large to be phagocytozed and are probably killed by certain extracellular processes (Waldorf, 1986). In experimental lung infection of mice, the host immune response is dependent on the size of the C. albicans inoculum. A large inoculum elicits neutrophil influx (Nugent and Onofrio, 1983);a smaller inoculum elicits a soluble factor, a protein of M , 29,000, that has a direct candidacidal activity (Nugent and Fick Jr., 1987). Macrophages play a central rble in cell-mediated immunity, because they are involved both in initiation of responses as antigen-presenting cells and in the effector phase as microbicidal cells. Many macrophage functions are
70
ASlS DATTA.
K
GANESAN A N D
K. NATARAJAN
enhanced by a process known as activation, brought about by lymphokines. There are many such lymphokines produced by T-cells (Roitt e? al., 1985). I n a particular experiment, the macrophage colony-stimulating factor, which is a lymphokine, enhanced the ability of macrophages to kill C. alhicans (Karbassi et al., 1987). In this experiment, the colony-stimulating factor is believed to have increased the density of mannose-binding receptors on the macrophage surface, thereby resulting in enhanced binding and ingestion of C. alhicans. The factors that predispose C. ulhicans infections are low neutrophil levels and defective cell-mediated immunity. In a particular instance, T-lymphocytes from chronic mucocutaneous candidiasis patients could not proliferate in oitro, and also could not exert helper activity for B-cell antibody production (Durandy et al., 1987). Thus, the normal anti-Candida defense system would not be active to thwart C. alhicans infection, leading to an efficient invasion and progression of the disease. d. Candidu-Induced Immunity Candida alhicuns also exerts a definite influence on the host immune response resulting in a debilitated candidacidal action. Diamond et al. (1980) showed that hyphae of C. alhicans secrete a peptide that inhibits neutrophil binding to the hyphae. Mannan, a major constituent of the cell wall in C. alhicans, was detected in the serum of some patients with mucocutaneous candidiasis (Fischer er ul., 1978). Mannan inhibited a Candidu antigen-induced in oitro proliferation of normal lymphocytes and also blocked the antigen-presenting ability of macrophages (Fischer et al., 1982). These mannan effects would result in an impaired cellular immune response. In another study, polysaccharide fractions (containing mostly mannose and glucose residues) from C. alhicans stimulated the T-cells to produce a suppressor factor, which in turn inhibited interleukin 1 and interleukin 2 production (Lombardi et ul., 1985). Since interleukins play an important r81e in T-lymphocyte proliferation, action of the suppressor factor would result in a poor immune response. e. Hormone Levels Hormonal changes during pregnancy predispose women to vaginal candidiasis, particularly vaginal thrush (Odds, 1979; Hurley, 1975). The presence of cornified epithelium and absence of leukocytes, which are normally observed during oestrous phase or are due to artificial administration of oestrogen, predispose rats to vaginitis. Oestrogen administration promotes colonization by C. alhicans, but progesterone administration does not (Kinsman and Collard, 1986). Corticosterone-, progesterone- and
CURRENT TRENDS IN CANDIDA ALBICANS RESEARCH
71
oestrogen-binding proteins have been identified in C. albicans (Loose er al., 1981; Powell and Drutz, 1983; Powell et al., 1983; Das and Datta, 1985).These proteins might help C. albicans to sense the hormonal status of the host and respond appropriately. However, so far there is no evidence for this. 2. Virulence Factors a. Morphology Both yeast and hyphal forms of C. alhicans are seen at infected sites. It is believed that, for C.albicans to become invasive, a change in morphology from yeast to hypha is important. However, there is no conclusive evidence to show that virulence is solely dependent on either of the morphological forms. The relevance of morphology to virulence can be understood by studying the capacity of morphology mutants to induce experimental infections (Table 2). A spontaneous mutant, which did not form germ tubes, was reported to be less pathogenic compared with its parent strain (Sobel er al., 1984). A nitrosoguanidine-induced morphology mutant of C. albicans (hOG301) has a stable mycelial morphology (Hubbard et al., 1986). There are conflicting reports about the pathogenicity of this strain; it was found to be nonpathogenic by one group (Hubbard et al., 1986) but pathogenic by another (Shepherd, 1985). The reason for these disparate claims about the pathogenicity of strain hOG301 is not clear. Besides, the pathogenicity of CA2, a non-germ-tube-producing natural variant, is also controversial (Shepherd, 1985; Bistoni et al., 1986). Shepherd (1985) has shown that both budding and hyphal forms of C. albicans are pathogenic. Tissue sections from dead mice revealed that both morphological forms are seen after inoculation with the normal parent strain; but the original morphology (as seen in culture) of mutant strains (hOG301 and CA2) is preserved under in uiuo conditions (Shepherd, 1985).Since the pathogenicity of mutant strains is controversial, it is difficult to draw any conclusion from these publications. However, in the absence of any definite evidence for pathogenicity of the two morphologies, it is generally thought that hyphae are important for tissue invasion. b. Adherence Adherence is the capacity of C. albicans to bind to host cells, which enables the fungus to colonize. Adherence of C. albicans has been shown to play a necessary r6le for virulence of the organism (Macura er al., 1983; Ray et al., 1984; Segal er al., 1984; Ghannoum and Elteen, 1986; Lehrer et al., 1986). Pathogenic strains have adherence values significantly higher than those of non-pathogenic strains (Macura et al., 1983). Besides, in rodents, in uitro
72
ASlS DATTA.
K
GANESAN A N D
K.NATARAJAN
adherence capacity has been observed to correlate with pathogenicity (Ray et al., 1984). Moreover, vaginal epthelial cells from pregnant or diabetic women have a greater capacity to bind C. albicans in uitro. Isolates from patients with vaginitis have a higher adherence capacity than those from asymptomatic carriers (Segal et al., 1984). Adherence-negative mutants have been isolated (Cihlar et al., 1984; Calderone et al., 1985). Cerulenin, an antibiotic which affects fatty-acid synthesis by blocking fatty-acyl synthase, inhibits germ-tube formation (Hoberg et al., 1983) and has been demonstrated to be useful in the study of the surface of C. albicans. A cerulenin-resistant mutant had a modified cell wall which was impermeable to the antibiotic(Hoberg et al., 1986).The mutant also had a lower adherence capacity. It was found to be less virulent than the parent strain in experimental endocarditis in rabbits, and in experimental vaginal infection in mice (Lehrer et al., 1986). However, the parent and the mutant strains caused renal candidiasis to the same extent (Calderone et al., 1985). Mannose (Maisch and Calderone, 1981; Sandin et al., 1982) and Nacetylglucosamine (Segal et al., 1982) have been implicated in adherence. Reorganization of cell-wall glycoproteins is also of probable importance in adherence. Extracellular material, probably rich in aminosugars, is released from the yeast surface. Residues of N-acetylglucosamine which are present under the external cell wall are probably exposed by loss of wall material (Tronchin et a/., 1984). Lipids are also involved in adherence; phospholipids, sterols and sterol esters are the major classes of lipid that blocked adherence on pretreatment of either yeast cells or target cells (Ghannoum et al., 1986). Cell-surface hydrophobicity seems to be important in adherence, A rough colony-morphology variant with greater cell-surface hydrophobicity had greater adherence capacity (Shimokawa and Nakayama, 1986). c. Secretory Proteinases
In the search for virulence factors, secretory acid proteinases have gained importance. Induction by proteins leads to secretion of proteinase by C. albicans in culture. This proteinase is active only at low pH values (3.0-5.5; Ruchel, 198 I). Strain-specific proteinases have also been detected (Ruchel et ul., 1982). Interestingly, a high titre of antibody against a proteinase produced by C. albicans was detected in patients suffering from systemic candidiasis (MacDonald and Odds, 1980). A secretory proteinase-defective mutant was shown to be less virulent in mice (MacDonald and Odds, 1983).Kwon-Chung et ul. (1985) have shown that for C.albicans virulence, secretory proteinase activity is important. In a mouse model system, pathogenicity of a secretory proteinase-defective mutant, its parent and its revertant from tissue sections,
CURRENT TRENDS IN CANDIDA ALBICANS RESEARCH
73
was studied. The parent had a high level of secretory proteinase and was very virulent. The mutant, with no detectable proteinase in uitro, was relatively avirulent. However, a few mice injected with the mutant died after a long incubation period. Isolates obtained from dead mice were found to be revertants, which secreted the proteinase at about half the level of the parent strain. Ghannoum and Elteen (1986) compared 53 isolates of C. albicans and demonstrated that isolates with a greater capacity to secrete proteinase had a higher adherence capacity while the extent of tissue colonization was also high. A strong correlation between proteinase secretion and adherence was observed. Candida albicans invasion into chorioallantoic membrane (Shimuzu et al., 1987)and its virulence for mice (Kondoh ef al., 1987)were used as models to study the relationship between proteinase secretion and pathogenicity. The results indicate that, besides proteinase, other factors are also involved in pathogenesis. Studies on an acid proteinase secreted by C. albicans have shown that the enzyme is necessary but not the sole determinant of pathogenicity. Since the proteinase requires a low pH value (between 3 and 5.5) for activity, it is difficult to explain how this enzyme can be active at the site of C. albicans colonization; the enzyme is actually denatured at neutral pH values (Ruche1et al., 1982). Besides, human saliva inhibited proteinase activity (Germaine and Tellefson, 1981). However, vaginal fluid has a pH value that is close to the optimal pH value required for proteinase activity. It also contains proteinaceous secretions that are potential proteinase inducers. Isolates of the yeast from vaginitis patients secreted more proteinase than isolates from carriers (Cassone et a/., 1987).Thus, at least in vaginitis, acid proteinase seems to play an important rB1e. Its rBle in other forms of candidiasis (though the proteinase appears to be secreted) is doubtful. d. Other Secretory Hydrolytic Enzymes Phospholipases secreted from C. albicans are likely to be involved in pathogenicity (Samaranayake ei al., 1984; Banno et al., 1985;Barrett-Bee et al., 1985).Capacity to adhere to buccal epithelial cells and pathogenicity for mice of four C. albicans isolates correlated with a high phospholipase activity (Barrett-Bee et al., 1985). Non-pathogenic yeasts and avirulent C. albicans strains had lower phospholipase activities (Barrett-Bee et al., 1985). N-Acetylglucosaminidase (chitobiase) is secreted during germ-tube formation by C. albicans (Sullivan et al., 1984). A mutant defective in production of chitobiase was less virulent compared with its parent strain (Jenkinson and Shepherd, 1987).Since this mutant was obtained after rigorous mutagenesis, and because its reversion frequency was high, the above result is not conclusive.
74
ASlS DATTA. K.GANESAN A N D K. NATARAJAN
3. Cell-Surface Antigens
Identification of surface antigens of C . albicans is important for the following reasons: (a)The yeast-to-hypha transition may be brought about by the appearance of new or modified surface antigens. Alternatively, as a consequence of hypha formation, cell-surface determinants can change. (b) Adherence is apparently linked to pathogenicity, and the cell surface of C.albicans is involved in adherence. Cell-surface glycoproteins have been implicated in adherence to the host cell surface (Lehrer et al., 1986; Maisch and Calderone, I98 1;Tronchin et al., 1984), and most of the C. albicans antigens are glycoproteins (Poulain et al., 1985). (c) Candida albicans might change its cell-surface antigens to evade the host immune system. The current trend in work on surface antigens of C. albicans has been on identification of morphology-specific (mainly hyphae-specific) surface antigens and of cell-surface antigens expressed during pathogenesis. Germ tube-specificsurface antigens have been identified using polyclonal antisera by two groups (Table 1; Sunstrom and Kenny, 1984,1985; Sundstrom et al., 1987; Smail and Jones, 1984; Ponton and Jones, 1986). Strains of C. albicans exhibit colony-morphology switching (see Section 1II.B). In the white-opaque switching system, opaque cells are defective in hypha formation. However, they express a cell surface antigen which is specific for hypha-forming white cells. Opaque cells also express a unique antigen of M , 13,500 (Anderson and Soll, 1987). Monoclonal antibodies against blastospores recognized two different cell-surface antigens, namely AgC6 and AgH9 (Brawner and Cutler, 1984, 1986a). Antigens AgC6 and AgH9 were present on old buds and were absent from the surface of new buds, which indicates that there is a temporal difference in expression of these antigens (Brawner and Cutler, 1986a). Expression of these antigens has also been studied during morphogenesis (Brawner and Cutler, 1986b). Antigen AgH9 initially disappeared from the mother cell and preferentially appeared on hyphae during the first four hours of germination, but reappeared on the mother cell by 20 hours. However, antigen AgC6 was constantly expressed on the cell surface of both mother cells and hyphae during germination. Interestingly, expression of these antigens was similar on both hyphae and pseudohyphae (Brawner and Cutler, 1986b). It is important to know whether antigens detected in uitro are also expressed in uiuo, so that the results can be extrapolated to the diseased conditions. Patients with disseminated candidiasis had higher levels of IgG directed against a protein of 48,000Da (Strockbine et al., 1984b). The size of this
CURRENT TRENDS IN CANDIDA ALBICANS RESEARCH
75
protein is similar to actin. Anti-actin antibodies are produced in patients suffering from myasthenia gravis (Williams and Lennon, 1986). Since the 48,000 Da antigen can be used in diagnostics, it was important to know if this was actin. Using an anti-48,000 Da monoclonal antibody, it was shown that actin from C. albicans and the 48,000 Da antigen are immunologically unrelated (Fiss and Buckley, 1987). Thus, the anti-48,000 Da monoclonal antibody can be used in serodiagnostic tests for disseminated candidiasis. A heat-stable 47,000 Da antigen has been detected in sera of most patients with systemic infections (Matthews e f al., 1987).However, the chemical nature of this antigen has not been elucidated. It is also not clear if this antigen is the same as those detected by Strockbine er af. (1984a,b). Recently, Neale er af. (1987) have identified a major antigen of 47,00ODa, as part of circulating immune complexes in patients with C. albicans osteomyelitis. 4. Arninosugar Metabolism
Aminosugars are present in mucous membranes, which are the sites of colonization by C. albicans. Although aminosugars are not in the free form, they are present as part of proteins (glycoproteins). Since C. albicans has to survive on the mucous membrane by utilizing a sugar (possibly aminosugars) as a source of energy, we initiated studies on aminosugar metabolism in C. albicans to gain a better understanding of the biochemical basis of candidiasis. A comparative study of utilization of N-acetylglucosamine (GlcNAc) by pathogenic and non-pathogenic strains was carried out in our laboratory (Singh and Datta, 1979a). Non-pathogenic yeasts cannot utilize GlcNAc, which suggests that the aminosugar metabolic pathway is important in pathogenesis. The aminosugar metabolic pathway in C. albicans was first elucidated in our laboratory. N-Acetylglucosamine is transported by a membrane-associated permease (Singh and Datta, 1979a; Singh e f al., I980a; Mattia et af..1982).The transported sugar is metabolized by the sequential action of GlcNAc kinase (Bhattacharya er al., 1974a,b; Singh and Datta, 1979b; Rai et al., 1980; Shepherd ei al., 1980b),GlcNAc 6-phosphate deacetylase (Gopal et al., 1982; Rai and Datta, 1982) and glucosamine 6-phosphate deaminase (Singh and Datta, 1979b,c; Das and Datta, 1982; Gopal et al., 1982).All of these enzymes are induced on addition of GlcNAc to cultures of C. albicans. A typical feature of this system is the absence of glucose repression (Singh and Datta, 1978; Singh er al., 1980b).Western blot analysis revealed that the deaminase level was stimulated 20-fold when GlcNAc was added to a growing glucosecontaining culture of C. afbicans (K. Natarajan, unpublished result). N-Acetylmannosamine (ManNAc) induces ManNAc 2-epimerase activity in C. albicans (Biswas er al., 1979). Moreover, ManNAc induces all of the
N-Acetvlglucosamine
I N-Acetvlmannosam i n
Clucosanine
WGlucosamine-mClucosanine
6-Phosphate
C l vc cr 1YS is
FIG. 3. Aminosugar metabolism in Cundidu ufbicans: A, N-acetylglucosamine permease, B, N-acetylglucosamine kinase; C, N-acetylglucosamine 6-phosphate deacetylase; D, glucosamine 6-phosphate deaminase; E, N-acetylmannosamine 2-epimerase; F, general sugar permease. Cundida ulbicuns strains seem to vary in their capacity for N-acetylmannosamine transport.
CURRENT TRENDS IN CANDlDA ALBICANS RESEARCH
77
enzymes of GlcNAc metabolism (Biswas et al., 1979; Sullivan and Shepherd, 1982). N-Acetylmannosamine can also be utilized by at least two C. albicans strains as a sole carbon source for growth (Biswas et al., 1979; Torosantucci and Cassone, 1983). But it has also been reported that a different C. albicans strain cannot transport ManNAc from the medium (Sullivan and Shepherd, 1982). This discrepancy is probably due to strain differences. Glucosamine (GlcN) also supports growth of C. albicans(Torosantucci and Cassone, 1983). This sugar is transported probably by a general sugar permease, and a GlcN kinase has also been detected (Corner et al., 1986). NAcetylglucosamine kinase is not induced by GlcN (Natarajan et al., 1984; Corner et al., 1986).The aminosugar metabolic pathway is summarized in Fig. 3. Presently, it is speculative whether the capability to metabolize GlcNAc is important for pathogenesis because the sugar in the free form is not available at the site of colonization. However, N-acetylglucosaminidase (chitobiase), which is also induced by GlcNAc (Sullivan et al., 1984),might release GlcNAc residues from glycoproteins. These residues can be utilized by C.albicans for its growth. The inducible GlcNAc-metabolizing system is a good model to study the regulatory circuits of gene expression. Studies with inhibitors indicate that the genes of the GlcNAc metabolic pathway are regulated at the stage of transcription (Singh and Datta, 1979b; Biswas et al., 1982; Gopal et al., 1982). To understand molecular details of the process and to study the relevance of GlcNAc metabolism in pathogenesis and morphogenesis, we are currently involved in molecular cloning of the genes for GlcNAc metabolic enzymes. B. CURE FOR CANDIDIASIS
Candidiasis is still an intractable malady. However, in this section, we describe progress made towards finding a cure for candidiasis. Rapid and reliable identification of the causative organism is necessary to devise a suitable therapy. Experiments related to diagnostics are being done to identify antigens of C. albicans and metabolites in the sera of patients. A heat-stable antigen (mannan) and a heat-labile antigen (a protein) have been detected in serum (Bennett, 1987). Other reports on circulating antigens have been discussed. The 47,000 and 48,000 Da antigens are consistently detected in the sera of patients with systemic candidiasis (see Section IV.A.3). These are absent from healthy individuals and those who are in the recovery phase of the disease. Monoclonal antibodies against the 48,000 Da antigen are available (Strockbine et al., 1984a)which can be used in diagnosis. Another approach to identifying the pathogen is by species typing. Identification by classical methods involves, among others, cumbersome sugar assimilation and fermentation tests and ability to form germ tubes. In a rapidly advancing area,
78
ASlS DA’ITA.
K GANESAN AND K. NATARAJAN
species typing is being attempted by analysis of mitochondria1 DNA (Olivo et al., 1987), rRNA-encoding DNA (Scherer and Stevens, 1987) and actinencoding DNA (Mason et al., 1987). Refinement of DNA analysis strategies and serodiagnosis holds the key for an efficient and reliable diagnostic tool for C. albicans. The prevalent view concerning the source of the pathogen is that it is from the patient’s gastro-intestinal tract. However, Burnie et al. (1985) reported that an outbreak of systemic candidiasis in a hospital intensive-care unit was caused by a single strain of C. alhicans. Hospital-acquired C. albicans infections have recently become more prevalent. If such infections are due to a single strain, then management of the disease would be easier. General antifungal agents are prescribed for candidiasis. Polyenes, such as nystatin and amphotericin B, has been used for a long time. The efficacy of these antibiotics has been evaluated with divergent results. High doses of amphotericin B lead to impaired renal function. But, Medoff et al. (1972) reported a low-dose therapy that was effective in clearing systemic infections. Amphotericin B at low doses stimulates the host immune system, in addition to its antifungal action. However, the low-dose regimen is not effective against candidemia and some other forms of candidiasis. Although there are reports of polyene-resistant strains of C. alhicuns isolated from patients with defective neutrophil function, amphotericin-B-resistant strains are considered rare (Drutz, 1987). Other therapeutic agents include 5-fluorocytosine (5FC), and azoles (imidazole derivatives such as ketoconazole, miconozole and clotrimazole. 5Fluorocytosine is converted by cytosine deaminase into 5-fluorouracil which is incorporated into DNA and RNA. In addition, 5FC inhibits DNA synthesis. It is specific for C. alhicans, since cytosine deaminase is absent from, or is present at a very low level in, host mammalian cells. Unlike amphotericin B, 5FC is almost completely absorbed from the gastro-intestinal tract and thus enters into circulation. It is excreted unchanged in high concentrations through urine (Bennett, 1977). Strains of C. alhicans resistant to 5FC have been documented. The gene conferring resistance was heterozygous in the clinical isolates (Defever et al., 1982); the heterozygous strains segregated and gave rise to highly resistant strains. Conflicting results have been reported on the potential value of imidazoles in prophylaxis. A rBle for miconazole in management of immunocompromised patients seems very limited (Meunier, 1987). Ketoconazole is highly effective in patients with chronic mucocutaneous candidiasis (Horsburg and Kirkpatrick, 1983) as well as in AIDS patients with oropharyngeal candidiasis(Go1d and Armstrong, 1984). However, the definitive rBle as well as specific indications for ketoconazole in other immunocompromised patients have not yet been clearly established.
CURRENT TRENDS IN CANDIDA ALBICANS RESEARCH
79
There are several other antibiotics that can interfere with RNA or protein synthesis in cell extracts of C. albicans, but do not affect the organism as such, probably because intact C. ulbicans does not take them up. Amphotericin B, at low concentrations, is non-toxic and non-lethal, but perturbs the cell membrane which results in an increased permeability to other drugs. Medoff (1987) reported that a low concentration of amphotericin B increased uptake of 5FC by C. albicans; as a result, the minimum inhibitory concentration required for 5FC was decreased. Controlled studies have yet to be done before prescribing this combination therapy. Another approach for treatment of candidiasis has been to develop a drugcarrier system; liposomes are being used to deliver amphotericin B (LopezBerestein, 1987).The high hydrophobicity of amphotericin B makes it a good candidate for liposomal incorporation. Liposome-encapsulated amphotericin B is superior to amphotericin B alone in treatment of experimental candidiasis in neutropenic mice (Lopez-Berestein et af., 1984). Liposome-mediated drug delivery holds promise as high concentrations can be given without the usual side effects. In conclusion, there is still no consensus on the best prophylactic approach in candidiasis (Meunier, 1987). Elimination of predisposing factors is still a judicious approach in effective management of candidiasis. V. Problems in Research on Candida albicans
The main difficulty in research on C. albicans has been due to the organism itself. Natural isolates are predominantly diploid; also, a sexual cycle is absent. Advancement of knowledge in fungi, especially yeasts like Saccharomyces cereuisiue, has been through elaborate genetic analyses using conventional techniques. Genetic analyses in C. albicans has been attempted through parasexual techniques but with limited success. The second difficulty with C. albicans are the variations between strains. This has created confusion in interpreting results of many studies. In this section, aspects of strain variations are discussed. Strains of C. alhicans display a great deal of heterogeneity in germ-tube formation. All strains do not possess the capability to form germ tubes; even if a strain has the capability, it does not form germ tubes under all conditions that favour this morphological change. To illustrate this point, C. albicans 2252, although it formed germ tubes in serum, did not do so in all other media examined (Manning and Mitchell, 1980a). Strains of C. alhicans have been classified as high responders, low responders and non-responders based on the ease with which they can be induced to form germ tubes. High responders can be induced by GlcNAc alone, whereas low responders can be induced by
80
ASlS D A T T A .
K.G A N E S A N A N D K.N A T A R A J A N
serum or GlcNAc together with serum; non-responders do not form germ tubes (Mattia et al., 1982). Strains of C. alhicans vary in expression of cell-surface antigens (Brawner and Cutler, 1984; Sundstrom and Kenny, 1985; Hopwood et al., 1986). This reflects inherent differences 'among strains. Even clonal populations of a particular strain exhibited heterogeneous reactivity to patient serum (Fig. 4; Poulain et al., 1985). Manning and Mitchell (1980b) showed differences in polypeptides between two C. alhicans strains, a germ tube-producing strain (4918)and another that does not form germ tubes(2252). Over 80 polypeptides were different in cells of strains 2252 and 4918, when compared under identical experimental conditions. This observation implies that the comparison between any two strains is difficult. Candidu alhicans exhibits strain-specific variations with respect to natural heterozygosity. On mild mutagenesis, they yield a limited set of auxotrophs at high frequency and each strain gives rise to a particular type of auxotroph. For example, C. albicans ATCC 10261 is heterozygous for a gene involved in lysine biosynthesis (Hilton et a[., 1985); strain NIH Ca529 gave suf- segregants (defective in reduction of inorganic sulphate) (Whelan and Soll, 1982) and strain 6631 gave rise to canavanine-sensitive segregants at a high frequency (Crandall, 1983). Singh and Datta (1978) reported that glucose does not repress induction of the GIcNAc metabolic pathway in C. alhicans 3100. Also, in another strain (SC5314), there is no glucose repression of GlcNAc kinase and GlcNAc 6phosphate deaminase activities (A. Banerjee and K. Natarajan, unpublished observations). However, Niimi et al. (1987)have reported glucose repression in two other strains of C. albicans. Careful examination of the results (Niimi et al., 1987) revealed that, under identical conditions, the two strains exhibited quantitative differences in glucose repression of the GlcNAc uptake system. This is also true for GlcNAc kinase activity (Niimi et al., 1987).These results can only be explained in terms of strain differences. Ability to form germ tubes is one of the main criteria by which C. albicuns is identified (Meyer et al., 1984). Variability in germ-tube formation among C. albicans strains has lead to problems in species identification. Presently, the focus is on the DNA fragment pattern generated by restriction endonucleases (Magee et al., 1987; Olivo et al., 1987; Scherer and Stevens, 1987). Each Candida species has a characteristic DNA restriction-fragment pattern (Magee et a[., 1987). However, various strains of C. albicans displayed variations in the lengths of restriction fragments (Magee et al., 1987). Physiological characteristics of C. albicans are modulated by growth temperature (Hazen and Hazen, 1987).When cells grown a t 28 and 37°C were compared, virulence, cell-surface hydrophobicity, and germ-tube formation were found to differ. Hazen and Hazen (1987) concluded that cells grown at
Titre J
I
l o 2 0
50
( 0 0 2 0 0 4 0 0 & m 1 6 0 0 3 2 0 0 6 4 m
+
CMRT 91
FIG. 4. Clonal populations of Candida albicans strain VW show variation in the level of cell-surface antigents, as determined by their reactivity to patient sera A and B. Titres of sera A and B against the original uncloned strain were 100 and 400, respectively. The most representative groups of the clonal populations reacted at titres similar to those of the original strain. GMRT 91 and 716 indicate the geometrical mean range titres for respective sera. From Poulain ef at. (1980).
82
ASlS D A T T A . K G A N E S A N A N D K N A T A R A J A N
37°C are affected more by environmental perturbations and germinate less. Cells grown at 28°C are more virulent than those grown at 37°C. These observations indicate that apparent subtle differences can lead to serious problems. Differences in growth temperature, media composition, stage of cell growth, etc., have to be seriously considered by researchers. We have shown, through a few examples, the magnitude of strain differences and how inherent differencescan lead to inconclusive results. Thus, findings in one strain cannot be generalized to the species C. alhicans as a whole. It is difficult to ascribe reasons for the enormous variation among C. ulhicuns strains. Lack of a sexual cycle appears to be the reason for strain variations. With no opportunity for mixing of genetic traits, strains seem to accumulate variations and evolve independently. Even clonal populations of a particular strain exhibited heterogenous reactivity to patient serum (Fig. 4;Poulain et a/., 1980, 1985). Such variations might be due to mechanisms similar to colonymorphology switching, but more subtle. Colony-morphology switching is associated with a large number of differences at the cellular and molecular level (see Section II1.B). Thus, switching alone can cause strain variations. Presently, different strains of C. alhicans are being used to study morphogenesis. A couple of selected, standard C. albicans strains are recommended to carry out research related to genetics and morphogenesis. However, pathogenesis experiments cannot be undertaken with a few strains. Since C. ulhicuns strains vary in their cell-surface antigens and in their relative virulence, a specific immunization therapy for candidiasis would be acceptable only after considerable experimentation with regard to its ability to protect the host against most, if not all, strains. V1. Summary
Canclidu alhicuns is an opportunistic pathogen of human beings and other mammals. Two other features, besides its pathogenicity, have made it a popular organism of study. It exists in different cellular forms and can change from one form to another, depending on growth conditions. Thus, it is being used as a model system to study cellular differentiation. It can also heritably and reversibly switch its cellular and colony morphologies. The yeast is diploid and lacks a sexual cycle. Thus, it has not been possible to apply the powerful methods of genetic analysis to understand morphogenesis or pathogenesis. Few clinical isolates are haploid, but they do not form hyphae and are not yet well characterized. Recombinant DNA techniques are increasingly being applied to C. albicans to solve many of the unanswered questions of morphogenesis and pathogenesis. Genetic transformation and gene-disruption techniques were recently developed for the yeast. Thus it is
CURRENT TRENDS IN CANDlDA ALBICANS RESEARCH
83
possible to study the rdle of any cloned gene through directed mutagenesis. However, the difficulty is to clone the putative genes involved in morphogenesis or pathogenesis. Cundidu ulbicuns exists in four different cellular forms, namely blastospores, pseudohyphae, hyphae and chlamydospores. Blastospore-to-hypha conversion is well studied. A variety of conditions can induce this transition. It is not clear how cells sense such varied conditions and respond appropriately. In other systems where differentiation is well understood, regulatory genes which control differentiation have been uncovered. These genes cause differential expression of other genes, and ultimately differentiated phenotypes. Thus, it is likely that differential gene expression is involved in the bud-to-hypha transition in C. ulhicuns. Certain proteins are expressed exclusively on the cell surface of hyphae. It should be possible to clone genes coding for these proteins. A study of the expression of these genes might allow us to identify the regulatory gene which determines differentiation. Another approach to understanding morphogenesis is to study how the difference in the shape of buds and hyphae is generated. This difference appears to be due to the differential activity of apical and general growth zones, which determine growth of the cell wall. Activity of these growth zones is apparently determined by actin localization. It remains a possibility that conditions which induce hyphae formation may directly affect actin localization or cell-wall growth zones and cause differences in cell shape. Cundidu ulbicuns can also heritably switch its cellular phenotype. This has come to light from a study of colony-morphology switching. Some strains can switch their colony morphology, both heritably and reversibly. At least three switching systems are known. The white-to-opaque transition is well studied at the cellular level. White and opaque cells differ in a large number of features. Since switching occurs at a high frequency, the differences in phenotypes are probably due to a change in expression of a key regulatory gene. A mechanism analogous to transposition may affect expression of the regulatory gene and cause switching. Opaque cells are not capable of forming hyphae under standard induction conditions. However, they express hypha-specific proteins on their cell surface during the later stages of bud growth. Thus, identification of the regulatory gene, and genes controlled by it, would not only explain switching, but may also explain differentiation of buds into hyphae in normal cells. Cundidu ulhicuns is present as a commensal in healthy hosts, but becomes pathogenic in individuals with immune dysfunction or hormonal imbalance. It causes superficial, locally invasive and systemic infections. Among the factors which make it virulent are its ability to adhere to host cells, and to secrete proteinases and other hydrolytic enzymes. Its cell-surface proteins and its capacity to utilize aminosugars are also likely to be important in
84
ASlS DATTA. K GANESAN AND K. NATARAJAN
pathogenesis. Its ability to change its cell morphology heritably, or in response to growth conditions, is also likely to play an important r6le in pathogenesis. The most active component of the host defence against C. afbicans is phagocytosis. Macrophage colony-stimulating factor-1 and a 29,000 Da protein are also known to be active in host defense. Cundidu ulbicans evades the host immune response by suppressing phagocytic functions. Its cell-wall components, particularly mannan, are mainly responsible for this suppression. Furthermore, a peptide secreted by the yeast is also involved.
VII. Acknowledgements We are indebted to all of the former and current researchers in this laboratory. Our special thanks go to Bipasha Gupta Roy, Anasua Banerjee and Vijay Paranjape for their helpful discussions. We are thankful to Samar Chatterjee for his critical comments on the manuscript, and Sarjeet Singh and Gajanan Hegde for their efficient typing. REFERENCES
Anderson, J. M. and Soll, D. R. (1986). Journal qf General Microbiology 132, 2035. Anderson. J. M. and Soll, D. R. (1987). Journal of Bacteriology 169, 5579. Banno, Y., Yamada, T. and Nozawd, Y. (1985). Sabouraudia 23.47. Barrett-Bee, K., Hayes, Y., Wilson, R. G.and Ryley, J. F. (1985).Journal ofGeneru1 Microbiology 131, 1217. Bennett, J. E. (1977). Annals qf Internal Medicine 86, 319. Bennett, J. E. (1987). Reoiew of Infecrious Diseases 9, 398. Bhattacharya, A., Banerjee, S. and Datta, A. (1974a). Biochimica et Biophysica Aria 374, 384. Bhattacharya, A., Puri, M. and Datta, A. (1974b). Biochemical Journal 141, 593. Bistoni. F., Vecchiarelli. A., Ceuci, E., Puccetti, P., Marconi, P. and Cassone, A. (1986).Infivtion and Immunity 51, 668. Biswas, M., Singh, B. and Ddtta, A. (1979). Biochimica el Biophysica Acta 585. 535. Biswas, M., Singh, B., Rai, Y. P. and Datta, A. (1982).fndian Journal oJE.uperimenta1 Biology 20, 829. Bodey, G. P. and Fainstein, V. (1985). “Candidiasis”. Raven Press, New York. Braun, P. C. and Calderone, R. A. (1978). Journal qf Bacteriology 133, 1472. Brawner, D. L. and Cutler, J. E. (1984). Infection and Immunity 43, 966. Brawner, D. L. and Cutler. J. E. (1986a). Infection and Immunity 51, 327. Brawner. D. L. and Cutler, J. E. (1986b). Infection and Immunity 51, 337. Buckley, H. R., Price, M. R. and Daneo-Moore. L. (1982). Infection and Immunity 37, 1209. Buffo, J., Herman, M. A. and SOH, D. R. (1984). Mycopathologia 85, 21. Burnie, J. P., Odds, F. C., Lee, W., Webster, C. and Williams, J. D. (1985).British Medical Journal 290, 746. Calderone, R.A., Cihlar, R. L., Lee, D. D.-S., Hoberg, K. and Scheld, W. M. (1985). Journal of Infectious Dbeases 152, I1 0.
Cannon, R. D. (1986). Journal of General Microbiology 132, 2405. Cassone, A., Bernardis, F. D., Mondello, F., Ceddia, T. and Agatensi, L. (1987). Journal of Infectious Diseases 156, 777. Cassone, A., Sullivan, P. A. and Shepherd, M. G. (1985). Microbiolugica 8, 85.
CURRENT TRENDS IN C A N D I D A ALEICANS RESEARCH
85
Centers for Disease Control (1986) Update. Acquired immunodeficiency syndrome, United States. Morbidity and Mortality Weekly Reports 35, 17. Chattaway, F. W., Wheeler, P. R. and OReilly, J. (1981). Journalof GeneralMicrobiology 123,233. Cheung, W. Y . (1980). Science 207, 19. Chiew, Y.Y.,Shepherd, M. G. and Sullivan, P. A. (1980). Archives of Microbiology 125, 97. Cho. Y.S. and Choi, H. Y . (1979). American Journal of Clinical Pathology 72, 617. Cihlar, R., Hoberg, K. and Calderone, R. A. (1984). In “Microbiology” (L. Levine and D. Schlessinger, eds), pp. 148. American Society for Microbiology, Washington D.C. Cole, S., Zawin, M.. Lundberg, B., Hoffman, J., Bailey, L. and Ernstoff, M. A. (1987). American Journal of Medicine 82, 662. Corner, B. E., Poulter. R. T. M., Shepherd, M. G. and Sullivan, P. A. (1986). Journal of General Microbiology 132, 15. Crandall, M. (1983). Current Genetics 7, 167. DdS, M. and Datta, A. (1982). Biochemistry International5, 735. Das, M. and Datta, A. (1985). Biochemistry International 11, 171. Defever, K. S., Whelan, W. L., Rogers, A. L., Beneke, E. S., Veslenak, J. M. and Soll, D. R. (1982). Antimicrobial Agents and Chemorherapy 22, 8 10. Dei-Cas, E. and Vernes, A. (1986). In “Critical Reviews in Microbiology”(W. M. OLeary, ed.), vol. 13, pp. 173. CRC Press, Boca Raton, Florida. Diamond, R. D., Oppenheim, F., Nakagdwa, Y.,Krzesicki, R. and Haudenschild, C. C. (1980). Journal of Immunology 125, 2797. Drutz, D. J. (1987). Reuiew oflnfectious Diseases 9, 417. Durandy. A., Fischer, A., Le Deist, F., Drouhet, E. and Griscelli, C. (1987). Journal of Clinical Immunology 7, 400. Finney, R., Langtimm, C. J. and Soll, D. R. (1985). Mycoparhologia 91, 3. Fischer, A., Ballett, J. J. and Griscelli, C. (1978). Journal of Clinical Investigation 62, 1005. Fischer. A., Pichat. L..Audinot. M. and Griscelli, C. (1982). ClinicalandE.rperimentulImmunol~~g~~ 47, 653.
Fiss. E. and Buckley, H. R. (1987). Infection and Immunity 55, 2324. Germaine, G . R. and Tellefson, L. M. (1981). Injection and fmmunity 31, 323. Ghannoum. M. and Elteen, K. A. (1986). Journal of Medical and Velerinary Mycology 24, 407. GhdnnOUm, M. A., Burns, G. R., Elteen, K. A. and Radwan, S. S. (1986). Infection and Immunity 54, 189. Gillum, A. M., Tsay, E. Y. H. and Kirsch, D. R. (1984). Molecular and General Generics 198, 179. Gold, J. W. M. and Armstrong, D. (1984). Annals ofihe New York Academy of Sciences 437,383. Gopal, P., Sullivan, P. A. and Shepherd, M. G. (1982). Journal of General Microbiology 128,2319. Gupta Roy, B. and Datta, A. (1986) Biochemical Journal 234, 543. Gupta Roy, B. and Datta, A. (1987). FEMS Microbiology Letters 41, 327. Hazen, K. C. and Hazen, B. W. (1987). Microbiology and Immunology 31,497 Hilton, C., Markie, D., Corner, B., Rikkerink, E. and Poulter, R. (1985). Molecular and General Genetics 200, 162. Hoberg, K. A., Cihlar, R. L. and Calderone, R. A. ( I 983). An/imicrobial Agents and Chemotherapy 24, 401.
Hoberg, K. A., Cihlar, R. L. and Calderone, R. A. (1986). Infection and lmmuniry 51, 102. Hopwood. V., Poulain, D., Fortier, B., Evans, G. and Vernes, A. (1986). Infecrion and Immunity 54, 222.
Horsburgh Jr. C. R. and Kirkpatrick, C. H. (1983). American Journal of Medicine 74, 23. Howard, D. H., Zeuthen. M. L. and Dabrowa, N. (1986). Journal of General Microbiology 132, 2359.
Hubbard. M., Bradley, M., Sullivan, P., Shepherd, M. and Forrester, I. (1982). FEBS Lerters 137, 85.
Hubbard, M. J., Markie. D. and Poulter, R. T. M. (1986). Journal ofBarleriology 165, 61. Hurley, R. (1975). The Practitioner 215, 753. Jenkinson, H. F. and Shepherd, M. G. (1987). Journal of General Microbiolog-v 133, 2097. Jones, J. M. (1981). Annuls of Internal Medicine 94, 475. Kakar, S. N., Partridge, R. M. and Magee, P. T. (1983). Genetics 104, 241.
86
ASlS DATTA.
K.G A N E S A N A N D K. NA’IAKAJAN
Karbassi. A., Becker, J. M., Foster, J. S. and Moore, R. N. (1987). Journalof Immunology 139,417. Kelly, R., Miller, S. M., Kurtz, M. B. and Kirsch, D. R. (1987). Molecular and Cellular Biology 7 , 199. Kinsman, 0. S. and Collard, A. E. (1986). Injection and Immunity 53, 498. Klein, J. J. and Watanakunakorn, C. (1979). American Journal of Medicine 67, 51. Klein, R. S.. Harris, C. A.. Small, C. B., Moll, B., Lesser, M. and Friedland, G. H. (1984). New Englund Journal of Medicine 311, 354. Kondoh. Y., Shimuzu, K. and Tanaka, K. (1987). Microbiology and Immunology 31, 1061. Kurtz, M. B., Cortelyou, M. W. and Kirsch, D. R. (1986). Molecular and Cellular Biology 6 , 142. Kurtz, M. B., Cortelyou, M. W., Miller, S. M., Lai, M. and Kirsch, D. R. (1987). Molecular and Cellular Biology 7 . 209. Kwon-Chung, K. J., Lehman, D., Good, C. and Magee, P. T. (1985). Infection and Imnruni/y 49, 571. Lehrer, N.. Segal, E., Cihlar, R. L. and Calderone, R. A. (1986).Journal of Medicaland Veterinury M-vcohgy 24, 127. Lombardi, G., Vismara, D., Piccolella, E., Colizzi, V. and Asherson, G. L. (1985). Clinical and Esperimental 1niniunolog.v 60,303. Loose, D. S., Schurman. D. J. and Feldman, D. (1981). Nature 293, 477. Lott, T. J.. Boiron, P. and Reiss, E. (1987). Molecular and General Genetics 209, 170. Lopez-Berestein, G . (1987). Antimicrobial Agents and Chemotherapy 31, 675. Lopez-Berestein, G.,Hopfer, R. L., Mehta, K.. Hersch, E. M. and Juliano, R. L. (1984).Journalof In/iJctious Diseases 150, 278. Luna, M. A. and Tortoledo, M. E. (1985). In “Candidiasis” (G. P. Bodey and V. Fainstein. eds.), pp. 13-27, Raven Press, New York. MacDonald, F. and Odds, F. C. (1980).Journal (?/Medical Microbiology 13, 423. MacDonald, F. and Odds, F. C. ( I 983). Journal of Generul Microbi01og.v 129, 43 I . Macura, A., Powlik, B. and Wita, B. (1983).Zenrralbla/r,fir Bakreriologie und Ahteilung Originale (A) 254, 561. Maisch, P. A. and Calderone. R. A. (1981). Ic/ection and Immunity 32, 92. Magee, B. B. and Magee, P. T. (1987). Journal of General Microbiology 133, 425. Magee, B. B., DSouza, T. M. and Magee, P. T. (1987). Journal of Bacteriology 169, 1639. Manning, M. and Mitchell, T. G. (1980a). Journul q / Bacteriology 142, 714. Manning, M. and Mitchell, T. G. (1980b). Journal flfBUCtf‘rio/Ogy 144, 258. Mason, M. M., Lasker, 8. A. and Riggsby, W. S. (19871. Journul ofClinicul Microbio/ogjS25,563. Matthews, R. C.. Burnie. J. P.and Tabaqchali, S. (1987).Journd ofClinica1 Microbiologji 25,230. Mattia, E., Carruba, G., Angiolella. L. and Cassone, A. (1982).Journal of Bacteriolog)~152, 555. Medoff, G. (1987). Reiliew of Infectious Diseases 9, 403. Medoff, G.,Dismukes, W. E., Meade, R. H. and Moses, J. M. (1972). Archives of Internal Medicine 130, 24 I. Meunier, F. (1987). Review of Infivtious Diseases 9, 408. Meyer, S. A., Ahearn. D. G. and Yarrow, D. (1984)1n“The Yeasts, A Taxonomic Study”(N. J. W. Kreger-Van Rij, ed.), 3rd edn, pp. 585-844. Elsevier, Amsterdam. Mildvan. D., Mathur, V., Enlow, R. W., Romain, P. L., Winchester, R. J., Colp, C., Singhman, H., Adelsberg, B. R. and Spigland, 1. (1982). Annals qf Inrernal Medicine 96, 700. Mitchell. L. and SOH,D. R. (1979a). Experimental Cell Research 120, 167. Mitchell, L. and Soll, D. R. (1979b). Experimental Mycology 3, 298. Muthukumar, G. and Nickerson, K. W. (1984). Journal of Bacteriolcigy 159, 390. Muthukumar, G. and Nickerson, K. W. (1985). FEMS Microbiology Le/ter.s 25, 199. Muthukumar, G., Kulkarni, R. K. and Nickerson, K. W. (1985).Journalc~fBucteriolugy162,47. Muthukumar, G., Nickerson, A. W. and Nickerson, K. W. (1987).FEMS Microbiology Letters 41, 253. Natarajan, K., Rai, Y. P. and Datta, A. (1984). Biochemistry In/ernational9, 735. Neale, T. J., Muir, J. C. and Drake, B. (1987). Australia andNen*Zeuland JournalofMedicine 17, 201. Niimi, M., Kamiyama, A., Tokunaga, M. and Nakayama, H. (1987). Canadian Journal of Microbiology 33, 345.
C U R R E N T T R E N D S IN CANDlDA ALBlCANS RESEARCH
87
Niimi, M., Niimi, K., Tokunaga, J. and Nakayama, H. (1980). Journalof Bacteriology 142, 1010. Nugent, K. M. and Fick Jr, R. B. (1987). Infection and Immunitj~55, 541. Nugent, K. M. and Onofrio, J. M. (1983). American Review c~f Respiratory Diseuses 128, 909. Odds, F. C. (1979). In ”Candida and Candidosis”. University Park Press, Baltimore. Odds, F. C. (1985).In “Critical Reviews in Microbiology” (W. M. OLeary, ed.), vol. 12, pp. 4S93. CRC Press, Boca Raton, Florida. Olaiya, A. F., Steed, J. R. and Sogin, S. J. (1980). Journal qfBacteriology 141, 1284. Olivo, P. D., McManus, E. J., Riggsby, W. S. and Jones, J. M. (1987). Journalof Infectious Diseases 156, 214. Pedersen, C., Gerstoft, J.. Lindhardt, B. 0. and Sindrup, J. (1987).Journal of Infectious Diseases 156, 529. Pollack, J. H. and Hashimoto, T. (1985). Journal of General Microbiology 131, 3303. Pollack, J. H. and Hashimoto, T. (1987). Journal of General Microbiology 133, 415. Pomes. R., Gil, C. and Nombela, C. (1985). Journal of General Microbiology 131, 2107. Pomes. R.. Gil, C., Cabetas, M. D. and Nombela, C. (1987).FEMS Microbiology Letrers 48, 255. Ponton, J. and Jones, J. M. (1986). Infection and Immunity 54, 864. Poulain, D., Vernes, A. and Fruit, J. (1980). Sabouraudia 18, 61. Poulain. D., Hopwood, V. and Vernes, A. (1985). In “Critical Reviews in Microbiology” (W. M. O’Leary. ed.), vol. 12, pp. 223-270. CRC Press, Boca Raton, Florida. Poulter, R. and Hanrahan, V. (1983). Journal sf Bacteriology 156, 498. Poulter, R., Hanrahan, V., JelTery, K., Markie, D., Shepherd, M. G. and Sullivan, P. A. (1982). Journal of Bacteriology 152, 969. Poulter, R. T. and Rikkerink, E. H. (1983).Journal of Bacreriology 156, 1066. Powell, B. L. and Drutz, D. J. (1983). Journal of In/l.crious Diseases 147, 359. Powell, B. L., Frey, C. L. and Drutz, D. J. (1983). 23rd Interscience Conference on Antimicrobial Agents and Chemotherapy, Abstract No. 751. Rai, Y. P. and Datta, A. (1982). Indian Journul of Biochemistry and Biophysics 19, 285. Rai, Y. P., Singh, B., Elango, N. and Datta, A. (1980). Biochimica el Biophysica Acra 614, 350. Ray, T. L., Digre, K. B. and Payne, C. D. (1984).Journal of Inoesligaiive Dermatology 83, 37. Reizenstein, P. (1987). Lancet i. 275. Riggsby, W. S., Torres-Bauza. L. J., Wills, J. W. and Townes, T. M. (1982). Molecular and Cellular Bio1og.v 2, 853. Rogers, T. J. and Balish, E. (1980). Microbiological Reuiews 44, 660. Roitt, 1. M.. Brostoff, J. and Male, D. K. (1985).“Immunology”, p. 11.9, Gower Medical, London. Rosenbluh. A., Mevarech, M., Koltin, Y. and Gorman, J. A. (1985). Molecular and General Genetics 200, 500. Ruchel. R. (1981). Biochimica et Biophjisica Aria 659, 99. Ruchel, R., Tegeler, R. and Trost. M. (1982). Sahouraudia 20, 233. Russell, P. J., Welsch, J. A., Rachlin, E. M. and McCloskey, J. A. (1987).Journul of Barreriology 169, 4393. Samaranayake, L. P., Raeside, J. M. and MacFarlane, T. W. (1984). Sabouraudia 22, 201. Sandin, R. L., Rogers, A. L., Patterson, R. J. and Beneke, E.S. (1982).InfecrionandImmunit.v 35.79. Sarachek, A. and Weber, D. A. (1984). Current Genetic.s 8, 181. Sarachek, A. and Weber, D. A. (1986). Current Genetics 10, 685. Sarachek, A,, Rhoads, D. D. and Schwarzhofl, R. H. (1981). Archives qf Microbiology 129, 1. Scherer, S. and Stevens, D. A. (1987). Journal of Clinical Microbiology 25, 675. Segal, E., Lehrer, N. and Ofek. I. (1982). Experimental Cell Biology 50, 13. Segal. E.. Soroka, A. and Schechter, A. (1984). Sabouraudia 22, 191. Shepherd, M. G. (1985). It~fectionand Immuniry 50, 541. Shepherd, M. G. and Sullivan, P. A. (1983). FEMS Microbiology Letters 17, 167. Shepherd, M. G., Chiew, Y. Y.. Ram, S. P. and Sullivan, P. A. (1980a). Canadian Journal of Microbiology 26, 2 1. Shepherd. M. G., Ghazali, H. M. and Sullivan, P. A. (1980b). E.xperimentu1 Mycology 4, 147. Shepherd, M. G., Poulter, R. T. M. and Sullivan, P. A. (1985).Annual Review of Microbiology 39, 579. Shimokawa, 0. and Nakayama, H. (1984). Sabouraudia 22, 315.
88
ASlS DATTA, K . GANESAN A N D K. NATARAJAN
Shimokawa, 0. and Nakayama, H. (1986). Journal of Medical and Veterinary Mycology 24, 165. Shimuzu, K., Kondoh. Y. and Tanaka, K. (1987). Microbiology and Immunology 31, 1045. Simonetti, N., Strippoli, V. and Cassone, A. (1974). Nature 250, 344. Singh, B. R. and Datta, A. (1978). Biochemical and Biophysical Research Communications 84.58. Singh, B. and Datta, A. (1979a). Biochimica el Biophysica Acfa 557. 248. Singh. B. and Datta. A. (l979b). Biochemical Journal 178, 427. Singh, B. and Datta, A. (1979~).Biochimica et Biophysica Acra 583, 28. Singh, B. R., Biswas, M. and Datta, A. (1980a). Journal qf Bacteriology 144, 1. Singh. B., Gupta Roy, B., Hasan, G. and Datta, A. (1980b). Biochimica el Biophysica Acla 632,345. Slutsky. B., Buffo, J. and Soll, D. R. (1985). Science 230, 666. Slutsky. B., Staebell, M., Anderson. J., Risen, L.. Pfaller, M. and Soil, D. R. (1987). Journul of Bucreriology 169, 189. Smail, E. H. and Jones, J. M. (1984). Infection and Immuniry 45, 74. Smith. C. B. (1985). In “Candidiasis”(G. P. Bodey and V. Fainstein, eds.), pp. 53-70. Raven Press, New York. Klco, S., Fan, J.-B., Yanagida, M. and Cantor,C. R. (1987). Smith, C. L.. Matsumoto, T., Niwa, 0.. Nucleic Acids Research IS. 448 I . Snell, R. G. and Wilkins, R.J. (1986). Nucleic Acids Research 14, 4401. Snell, R. G., Hermans, I. F., Wilkins, R. J. and Corner. B. E. (1987). Nucleic Acids Research IS, 3625.
Sobel. J. D., Muller, G. and Buckley, H. R. (1984). Infection and Immunity 44, 576. Soll, D. R. ( I 986). BioE.s.say,s5, 5. Soll, D. R., Langtimm, C. J., McDowell, J., Hicks, J. and Galask, R. (1987). Journal uf Clinical Micr<~bio/ogy 25, 161 I. Staebell, M. and Soll. D. R. (1985). Journal qf General Microbiology 131, 1467. Strockbine, N. A., Largen, M. T. and Buckley, H. R. (1984a). Infection and Immunity 43, 1012. Strockbine, N. A.. Largen, M. T.. Zweibel, S. M. and Buckley, H. R. (l984b). Infection and Immunity 43, 715. Sullivan, P. A. and Shepherd, M. G. (1982). Journal o j Bacteriology 151, 1118. Sullivan, P. A., Mchugh. N. J., Romana, L. K. and Shepherd, M. G . (1984). Journal of General Microbiology 130, 2213. Sundstrom, P. M. and Kenny, G. E. (1984). Infection and Immunity 43, 850. Sundstrom, P. M. and Kenny, G. E. (1985). Infixtion and Immuniry 49, 609. Sundstrom, P. M.. Nichols, E. J. and Kenny, G. E. (1987). Infection and Immunity 55, 616. Suzuki, T., Nishibayashi, S., Kuroiwa, T.. Kanbe, T. and Tanaka, K. (1982). Journiil of Bacteriology 152, 893. Suzuki, T., Kanbe. T.. Kuroiwa. T. and Tanaka, K. (1986a). Journal ~fGeneru1MicTfJbifJ/~J~J 132, 443.
Suzuki. T., Rogers, A. L. and Magee, P. T. (1986b) Yeu.st 2, 53. Takeya, K., Nomoto, K., Matsumoto. T., Miyake, T. and Himeno. K. (1976). Clinicul and E.xperinienra1 Imntunolog~~ 25, 497. Torosantucci, A. and Cassone, A. (1983). Sabouraudiu 21, 49. Tronchin, G., Poulain, D. and Vernes, A. (1984). Archives uf Microbiology 139, 221. Valdimarsson, H. J., Higgs, J. M., Wells, R. S., Yamamura. M., Hobbs, J. R. and Holt, J. L. (1973). Cellular Immunology 6, 348. Waldorf, A. R. (1986). In “Critical Reviews in Microbiology” (W. M. O’Leary, ed.), vol. 13, pp. 133-172. C R C Press, Boca Raton, Florida. Walker, G. M.. Sullivan, P. A. and Shepherd, M. G. (1984). JiJUrnd ofGenera1 Microbiology 130, 1941.
Whelan, W. L. and Magee, P. T. (1981). Journul of Bucreriology 145, 896. Whelan, W. L. and Soll, D. R. (1982). Molecular and General Generics 187, 477. Whelan, W. L., Markie, D. M., Simpkin, K. G. and Poulter. R. M. (1985). Journal of Eacreriology 161, 1131.
Whelan. W. L., Partridge, R. M. and Magee, P. T. (1980). Molecular und Generul Generics 180, 107. Williams, C. L. and Lennon, V. A. (1986). Journal qf Experimental Medicine 164, 1043. Wood, N. C. and Nugent, K. M. (1985). Anfinticrobid Agenfs and Chemotherapy 27,692.
Circulating Ionic Currents in Micro-organisms N . A . R . GOW Department of Genetics and Microbiology. Marischal College. University of Aberdeen. Aberdeen AB9 I A S . U.K.
1. Introduction . . . . . . . . . . . I1 . Measurement of ionic currents . . . . . . . 111. Studies on bacteria . . . . . . . . . . IV . Currents in fungi . . . . . . . . . . A. Blasrocladiella species . . . . . . . . . B. Achlya species-urrents and growth . . . . C . Achlya species-urrents and differentiation . . D. Allomyces species . . . . . . . . . E. Neurospora crassa and other filamentous fungi . V. Currents in protozoa . . . . . . . . . A . Amoebae-Amoeba and Chaos species . . . B. Ciliates-Paramecium species . . . . . . C . Slime moulds-Physurum and Dictyostelium species V1. Currents in algae . . . . . . . . . . A . Fucoid eggs-Fucus and Peluetia species . . . B. Chara and Nirellu species . . . . . . . C. Acetabularia species . . . . . . . . D. Tip-growing algae-Griflthsia and Vaucheria species E. Micrasrerias and Closterium species . . . . F. Noctiluca species . . . . . . . . . VII . Effects of applied voltage and ion gradients . . . . VIII . Ionic currents and cellular physiology . . . . . IX . Conclusions . . . . . . . . . . . References . . . . . . . . . . . .
.
.
.
.
.
. . .
. . .
. . .
. . .
. . .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. .
. . .
. . .
. . .
. . .
. . .
.
.
.
.
.
. . . . . . .
. .
. .
. .
. .
.
.
.
.
.
.
.
.
.
.
. .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
. .
.
.
.
.
.
.
.
.
89 90 92 93 93 96 99 100 101 102 102 103 104 105 105
107 110 111 112 112 113 114 119 120
.
I Introduction A fundamental aspect of the physiology of growth lies in the ability of a cell or group of cells to undergo spatial differentiation . Biological cells often have a sidedness or polarity so that the cell is structurally and physiologically differentiated along its length and around its perimeter. Growth itself is also commonly asymmetrical and is directed to one or a limited number of sites of the cell. This directed growth is essential to proper development and
.
ADVANCES I N MICROBIAL PHYSIOLOGY VOL . 30 ISBN 0-12-027730-1
.
Copyright (; 1989 by Academic Press Limited All rights of reproduction in any form reserved
90
N A. R. COW
differentiation. The ways in which cells make one end of themselves different from the other are at present rather mysterious, although a number of physiological phenomena have been found which accompany spatial differentiation of cells and have been put forward as candidates for determinants of cell polarity and positional information. In eukaryotic microorganisms, and eukaryotic cells in general, one such candidate is the circulating currents of inorganic ions or so-called “ionic currents” which many cells drive through themselves. These currents enter in one region, flow through the cytoplasm along the length of the cell and then exit at a separate location on the cell surface. The current-loop is closed in the extracellular space (periplasm, cell wall and external medium) so that the ionic current circulates through a spatially defined loop or circuit. These ionic currents reflect natural asymmetries in the arrangement of ion-transport systems in the plasma membrane. What is intriguing is that the profile of many of these ionic currents often reflects the morphological polarity of cells or the spatial differentiation of the cell or tissue (Jaffe, 1981, 1985; Nuccitelli, 1983, 1984). Ionic currents have been described in plant, animal and microbial systems, in individual cells of unicellular and multicellular organisms, in tissues and organs, and in both embryonic and mature cells. They are found during the normal course of growth and development and are associated with initiation and maintenance of growth and with regrowth and damage repair (Jaffe, 1985). Ionic currents are therefore very common in nature. Indeed, to my knowledge, there has only been one notable failure to find a current in a developmental system. What is much less clear is the rBle that these circulating ionic currents play in the physiology of the cell. Some of the clearest insights into the answer to this have come from studies on eukaryotic microbial systems, and it is these systems on which this review is primarily focused. 11. Measurement of Ionic Currents
Since ionic currents are carried by charged particles, their flow creates an electrical current and a voltage gradient around the cell. They are often studied by measuring the extracellular component of the current using an ultrasensitive vibrating micro-electrode called a vibrating probe. This instrument consists of a glass micropipette or platinum/iridium wire on the end ofwhich iselectroplated a platinum ball. The electrode iscaused to vibrate at a frequency of between 200 and 800 Hz over a distance of between 10 and 50 pm and a voltage is measured between the extremities of the vibration. The resistivity of the growth medium can be easily determined from the reciprocal of its electrical conductivity, and the inward or outward flow of current can then be calculated using a modified form of Ohm’s law (Jaffe and Nuccitelli,
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
91
1974). Electrophysiologists, like electricians, define the direction of current with respect to the net movement of positive electrical charge and, therefore, an inward electrical current at onz position of a cell represents a net influx of cations or a net efflux of anions. It must be emphasized, however, that the vibrating probe only measures net electrical current; it cannot discriminate between the currents and countercurrents of individual ionic species. The voltage gradients that are detected around living cells are then processed by a lock-in amplifier which detects signals only at the frequency at which the electrode is being vibrated. Consequently, the vibrating probe is able to select a very small signal from a noisy background and this improved signal-to-noise ratio gives the instrument about three orders of magnitude more sensitivity than static voltage-sensitive micro-electrodes. This greatly increased sensitivity allows detection of the electrical currents of single-celled microbes where the extracellular electric currents and electrical fields can be as small as OSpAcm-’ and 1 nVpm-’, respectively-too small to be measured with conventional electrodes. The vibrating probe is held in position with a micromanipulator and can be moved around the cell to build up a map or profile of the flow of electrical current. These extracellular measurements are therefore completely noninvasive and require only that the cell be oriented in such a way as to allow the probe to be brought into position adjacent to the cell, and that the cell be immersed in a suitable liquid medium, preferably of a high resistivity. The specimen is normally examined using an inverted microscope which may be coupled to a video camera. The vibrating probe was originally developed by Lionel Jaffe and Richard Nuccitelli (1974) and was based on glass electrodes which vibrated in one plane and a simple one-dimensional current vector. Additional information and descriptions of elaborations and modifications of this design are given by Dorn and Weisenseel (1982), Nawata (1984) and Scheffey (1988). Subsequent technical modifications and refinements have produced instruments with more robust wire electrodes which can be made to vibrate in two dimensions so that the currents in two axial planes are made simultaneously. The resultant vector is calculated by a computer, and the direction and magnitude of the current vector are displayed on a television screen while the image is stored on videotape (Freeman et al., 1985; Nuccitelli, 1986; Scheffey, 1988). This two-dimensional probe system greatly facilitates examination of specimens with a complex architecture. In most cases, it is desirable to know something of the ionic composition of the current. This is usually done by performing a series of experiments where bathing media are exchanged for ones in which individual ions are first omitted and then restored. If removal of an ion from the external medium causes a decrease in the measured current density it may be inferred that the ion was carrying a proportion of the original current. Ion-substitution
92
N.A. R. COW
experiments only provide an indirect indication of the chemical nature of the electrical current and are least satisfactory when proton currents are considered. Modulation of the external proton concentration can only be achieved by changing the pH value of the medium, and this may have biological as well as electrophysiological consequences. It is possible to study ion currents by measuring the external ionic gradients that result from the flow of an ionic current using extracellular ion-selective micro-electrodes. For example, in the water mould Achlya bisexualis, a proton current enters the hyphal tip. The external medium in the region where protons enter the hypha is made alkaline; where protons are expelled the medium is acidic (Gow et al., 1984).The external pH gradient would therefore seem to be a manifestation of the protonic electrical current. Recently, W. Kuhlreiber and L. F. Jaffe (unpublished observation) developed a vibrating calcium electrode which can detect extracellular calcium-ion gradients generated by calcium-ion currents. Finally, the directional flow of electrical current can also be determined from membrane-potential measurements using intracellular micro-electrodes. The ionic composition can be inferred from the sensitivity of the membrane potential to changes in the external concentration of individual ions. See, for example, the studies of Van Brunt et al. (1982) and Kropf (1986) which are described later in this chapter. 111. Studies on Bacteria
Prokaryotes may not have transcellular ion currents. The only recorded failures to detect currents have been in a study of cyanobacterial filaments of Oscillatoria princeps, Anabaenaflos-aquae and Anabaena cylindricu (Jaffe and Walsby, 1985).No current was found around developing heterocysts of A.,fiosaquae or around gliding filaments of 0. princeps and A. cylindricu. Hader (1978) reported large voltages of around 20 mV along filaments of the gliding cyanobacterium Phorrnidium uncinatum which were detected by measuring the voltage across a narrow constriction as the filament passed through. This large voltage would be expected to support a current in the order of lOpAcrn-’ along the filament. Jaffe and Walsby (1985) failed to find such a current in gliding cyanobacteria. The voltages measured by Hader (1978) may have been diffusion potentials generated by formation of a transient gradient of pH value or some other charged secretion in the slime rather than flow of electrical current through and around the cyanobacterial filaments. Bacteria other than cyanobacteria are too small to be examined with vibrating probes since cells of diameters much less than lOpm are unlikely to be able to generate currents of a detectable density. Harold and Van Brunt (1977) showed that Srreptococcusfaecalis was capable of growth without a membrane potential
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
93
when exposed to the potassium/proton ionophore valinomycin. The growth medium had to be of a pH value which matched the normal cytoplasmic pH value, and of a composition that allowed the cell to maintain high concentrations of internal potassium ions and to obtain nutrients in the absence of ion-driven transport. However, the cells clearly did not require a membrane potential for growth or division. Since currents require a driving voltage across the cell membrane, we must conclude that these bacteria d o not need a current for the processes of growth and division. IV. Currents in Fungi A.
Blastocladiella
SPECIES
This fungus is a water mould of the phylum Chytridiomycota and consists of a spheroid thallus which is anchored to the substrate of its aquatic environment by a series of slender branching rhizoids (Fig. 1). The thallus differentiates into a sporangium which releases swimming zoospores through a discharge papilla at its apex. The zoospores are chemotactic and eventually settle and germinate
BlastccladMa
Pelvetia
Ach&a/tU?urospara
Acetabularia
Allomyces
Cbura/Nite//o
A Vaucberia
Amoeba
Noctifuca
FIG. 1. Circulating ionic currents from representative eukaryotic micro-organisms as described in the text. The arrows indicate the movement of positive electrical current. The direction of growth or movement of the hyphae of species of Achlya, Neurospora and Allomyccs of cells of Amoeba, Pelvetia, Acetabularia, Vaucheria and Micrasterias and plasmodium of fhysarum are, in each organism, towards the upper end of the figure.
94
N A R GOW
on a suitable substrate thereby perpetuating the life cycle. Stump et al. (1980) showed that positive electrical current entered the rhizoid region and exited from the thallus and sporangium. When sporulation was initiated by replacing the growth medium with non-nutrient buffer, the current pattern reversed so that current now entered the sporangium. This reversed pattern was maintained until the last 45 min prior to zoospore discharge when outward current was again found at the sporangium. As zoospores were released, the current declined to zero by the time zoospores had all been discharged. Ion-substitution experiments showed the current accompanying vegetative growth of the thallus was insensitive to removal of all of the major inorganic ions other than calcium ions and protons. Removal of calcium ions induced rapid vacuolation and aberrant growth as well as fluctuations in the direction and magnitude of the current. By a process of elimination, protons were left as the most likely current-carrying ion. The hypothesis that a proton current might influence the site of rhizoid formation and subsequent rhizoid growth had also been suggested in previous experiments where glass fibres coated with the proton ionophores tetrachlorosalicylanilide and compound 1799 were found to cause orientation of the rhizoids towards the source of ionophore (Harold and Harold, 1980). Gradients of the calcium ionophores A23187 and ionomycin, and various other types of inhibitors, did not affect the direction of rhizoid growth. But rhizoids were also oriented strongly by gradients of phosphate and amino acids, but not glucose, potassium ions or calcium ions (Harold and Harold, 1980). Proton currents therefore entered the rhizoid during growth. Proton leakage, induced using ionophores, caused orientation of the rhizoids towards the site of maximum proton entry. In ensuing work, Van Brunt et al. (1982) investigated the genesis of the circulating current using intracellular micro-electrodes inserted into the thallus. In contrast to the findings of Slayman and his collaborators (Slayman, 1965a,b; Slayman et al., 1973) who found the membrane potential of the ascomycete Neurosporci crassa was due mainly to an electrogenic proton pump, the membrane potential in Blastocladiella emersonii was shown to be set by outward diffusion of potassium ions (Van Brunt er al., 1982). This was suggested from experiments in which the membrane potential was measured in media containing different concentrations of potassium ions. When the external potassium ion concentration was high, few of the high internal potassium ions diffused out of the cell, and the membrane potential was correspondingly low. When the potassium-ion gradient across the membrane was increased by lowering the external potassium-ion concentration, the membrane potential increased correspondingly. Potassium-ion efflux from the thallus(Fig. 2) was calculated to be large enough to account for the size of the outward currents measured with the vibrating probe. On the basis of these observations, it was suggested that potassium ions were accumulated by an
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
95
H+aa
Elostocladiella emersanii
Achka bisexwk
H CO;
ATP K+ Ca2+
Pebtia hstyiata
Chara cwralha
FIG. 2. Proposed mechanisms for generation of four circulating currents in four aquatic eukaryotic micro-organisms as described in the text. Mechanisms are shown for sporangia of Blastocladiella emersonii, hyphae of Achlya bisexualis, zygotes of Pelvetia fastigiata and internodal cells of Chara corralina.
electroneutral pump in the thallus which exchanged potassium ions for protons, while the inward current at the rhizoids maintained the overall charge balance was due to localized proton leakage (Fig. 2). The rhizoid of B. emersonii is therefore a site at which protons leak into the cell. Presumably, proton carriers, such as proton symporters, are localized at this site. Kropf and Harold (1982) showed that the rhizoids of this organism were also sites at which nutrients were taken up. These results again re-inforce the observation that the rhizoids of B. emersonii are chemotropic for
96
N A. R. COW
phosphate and amino acids (Harold and Harold, 1980). The nutrients were presumed to be then translocated into the thallus to support growth. Certain nutrients, such as phosphate and amino acids, were taken up preferentially at this site. Since phosphate and amino acids are normally transported by proton symport (Eddy, 1982), the proton current may relate in part to localized proton-coupled transport of nutrients. In summary, there is a good correlation between proton entry, localized nutrient entry and rhizoid orientation in this organism. This point will be returned to in following sections of this review, since this provides an important insight of the significance of the circulating current. B. Achlya SPECIES-CURRENTS
AND GROWTH
The most studied of all ionic currents are those associated with growth and differentiation of the hyphae of organisms of the genus Achlya of the phylum Oomycota. Oomycetes resemble filamentous fungi, but their hyphae do not contain chitin, and the sequences of bases in their 18s ribosomal RNA are dissimilar from those of fungi. Indeed, phylogenies constructed from rRNA sequences suggest their nearest relatives may not be fungi but the Crysophytae or golden algae (Gunderson et al., 1987). Although they may not be phylogenetic cousins of true fungi, growth of their hyphae is remarkably similar. Extension of the hyphae and branches of the mycelium is restricted to the tapering zone at the extreme apex (Gooday, 1983).In this zone, membranebound microvesicles, loaded with biosynthetic enzymes, fuse and provide the enzymes, raw materials and new membrane for tip expansion. Localization of exocytosis of these microvesicles results in highly polarized growth. It is not known what translocates these microvesicles to the apex or what causes them to fuse selectively at this region. Hyphae of oomycetes and true fungi have microtubules running longitudinally throughout the cytoplasm, and have microfilaments in the peripheral cytoplasm, especially under the apical dome (for reviews see McKerracher and Heath, 1987;Gow, 1989a).These are almost certainly involved in cytoplasmic transport of microvesicles and local cell growth. However, the mechanisms are not yet clear. Assembly and functioning of the cytoskeleton are influenced strongly by calcium ions and by pH value and so it is possible that organization of microfilaments and microtubules in the cell may be regulated by the voltages, currents and ionic gradients which cells establish in their cytoplasm (see p. 117). The discovery of electrical currents accompanying hyphal growth of Achlya species was therefore of some interest in these respects. Armbruster and Weisenseel (1 983) and Kropf et al. (1983)reported inward electrical currents of around 0.2 pA cm-’ in the medium around the tips of extending hyphae of Achlya deharyana and Achlya bisexualis, respectively (Fig. 1). This corre-
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
97
sponds to a current density of around l . O ~ A c m when - ~ extrapolated to the hyphal surface (Kropf et al., 1984). Outward currents were found behind the apex. The report of Armbruster and Weisenseel (1983) remains unique for hyphal micro-organisms in as much as the current was spikey, not steady. The current at the tips of branching hyphae sometimes turned transiently outward as new inward currents associated with new branches became established (Kropf et al., 1983). Despite this, the original apex with the reversed current continued to extend at an uninterrupted rate. Remarkably, the inward current associated with the branch was detectable up to 20 min before any visible sign of evagination, and the peak of the new current predicted accurately where the branch would form. Currents that predict new sites of growth have been reported several times (Weisenseel et al., 1975; Nuccitelli et al., 1977; Nuccitelli, 1978; Gow and Gooday, 1987) and these provide strong indications, but not proof, that ionic currents might be a causal factor in the determination of cellular polarity. The circulating ionic current of A. bisexualis is perhaps the best characterized of all that have so far been investigated. Inward and outward currents are both carried by protons. Protons enter the apex by co-transport with amino acids especially, but not exclusively, with methionine (Gow et al., 1984; Kropf et al., 1984; Harold et al., 1985a,b; Kropf, 1986; Schreurs and Harold, 1988; Fig. 2). The outward current is probably due to the activity of electrogenic proton-pumping ATPases situated subapically. This current circulation therefore represents a spatially extended chemi-osmotic system with leaks at the tip and pumps at the rear. Evidence for this came from several directions. Firstly, the vibrating probe was used to show that hyphae had normal rates of extension and normal currents in media lacking the common inorganic ions or glucose. There is little or no evidence that calcium ions are of any importance since hyphae extended normally for at least 30 min in media in which the calcium-ion concentration was below lO-’w (Kropf et al., 1984; Schreurs and Harold, 1988). Raising the external pH value by two units, or depriving the medium of methionine (or to a lesser extent other amino acids), were the only treatments which diminished the current and the rate of hyphal extension. Other types of micro-electrodes provided corroborative evidence for this model. Glass pH-sensitive micro-electrodes detected an alkaline zone around the apex where protons entered the hypha. Where the proton current was outward, the external medium was made acidic (Gow et al., 1984; Kropf et al., 1984;Schreurs and Harold, 1988).As with the inward current, apical alkalinity was lost when amino acids were removed while it returned again when the amino acids were restored. Similarly, the alkalinity was abolished when the current was turned off by increasing the external pH value (Gow et al., 1984). These findings suggest that the external pH profile is a manifestation of the
98
N A R GOW
circulating ionic current. However, Schreurs and Harold (1988)and Thiel et al. (1988) showed that A . hisexualis excretes ammonium ions during growth, and so it is possible that apical alkalinity may represent localized ammonium-ion excretion, not proton uptake. The final series of observations used to formulate the amino acid-proton symport model for the inward current were made by Kropf (1986) using voltage-sensitive intracellular micro-electrodes. It was demonstrated that hyphae of A . hisexualis generated a membrane potential of -150 to - 170mV, interior negative, and that this membrane potential was governed by an electrogenic ion pump rather than diffusion potential as in B. emersonii. This is comparable to the situation in hyphae of Neurospora crassa where the membrane potential is also established by electrogenic proton pumping (Slayman, 1965a,b; Slayman et al., 1973).This finding supports the view that the outward current and driving force for the circulating current are attributable to the activity of a plasma-membrane proton ATPase (Fig. 2). Removal of external amino acids, such as methionine, caused the membrane potential to become hyperpolarized suggesting that methionine did indeed enter by proton symport. When the membrane potential was measured at locations at the tip and behind it, a voltage gradient was found with the tip relatively depolarized. This depolarization is almost certainly due to local entry of protons at the apex. The cytoplasmic electrical gradient was of the order of 0.4 V cm- I , large enough in theory to cause electrophoretic migration of charged proteins and organelles in the cytoplasm (Kropf, 1986; Gow, 1989a).The internal electrical field was abolished when the circulating current was turned off by removing exogenous amino acids. In all of these experiments using the vibrating probe, pH-sensitive micro-electrodes or intracellular voltage-sensitive electrodes, hyphal extension and entry of a proton current into the hyphal tip were correlated. Further evidence that local proton entry and local growth are linked is evident from experiments in which proton leakage into hyphae was induced artificially using proton ionophores. This caused stimulation of branching in A. hisexualis (Harold and Harold, 1986). However, although calcium ions seem to play little r81e in the transcellular current, calcium ionophores enhance branching in both N. crassa and A . hisexuulis (Reissig and Kinney, 1983; Harold and Harold, 1986). Proton-ionophore gradients established adjacent to an extending hypha of A . bisexualis, using a narrow-tipped capillary, caused hyphae to bend towards the micropipette and in some cases actually to grow into it (W. J. A. Schreurs, R. Harold and F. M. Harold, unpublished observations). It should be borne in mind that compounds which inhibit apical extension of hyphae are likely to promote hyphal branching by rediverting biosynthetic potential to new apices (Trinci, 1979).This argument may provide an alternative rationale for the stimulatory effects of ionophores
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
99
on hyphal branching, but it would not explain why hyphae should exhibit chemotropism towards an ionophore. Amino acids also induce positive chemotropisms in this fungus (Musgrave et al., 1977), especially methionine (Manavathu and Thomas, 1985). So, as in B. emersonii, local nutrient uptake, proton influx and cell extension are tightly correlated. Further evidence that there is an electrical dimension to control of hyphal growth is suggested from experiments in which hyphae are exposed to artificial electrical fields (McGillivray and Gow, 1986). These experiments are discussed later in this review. There are, however, an increasing number of problems in attributing an important rble for the electrical current in hyphal-tip extension in A. hisexualis. For example, observations of continued hyphal extension during the complete reversal in direction of current flow (Kropf et al., 1983) make it difficult to believe that the electrical current is a driving force for tip extension. However, Gow et al. (1984) showed that alkalinity persisted even around the tips of branching hyphae. It is possible that the transitory reversed current was due to efflux of some other cation, such as potassium, and that protons continued to enter the apex even when the electrical current had reversed. Also, Schreurs and Harold (1988) showed that hyphae of A. hisexualis had a normal diameter and extension rate, but almost no electrical current, in a medium lacking amino acids but supplemented with thioglycolate and urea. Evidence from studies of other fungi, discussed later in this review, also mitigate against an important rble for the electrical current. The hypothesis that an inwardly directed proton current (as opposed to an inward electrical current) may be important in control of hyphal extension remains to be established firmly and cannot be discounted.
c. Achfva
SPECIES-CURRENTS
AND DIFFERENTIATION
Various aspects of the sexual and asexual development of Achfya species have been investigated using the vibrating probe. Asexual development is induced in non-nutrient media, and involves differentiation of vegetative hyphae into sporangia which are separated from the mycelium by a cross-wall. Zoospores are liberated after six or seven hours through a papilla at the end of the sporangium. Positive current enters the hypha and developing sporangium throughout this process, although a brief period of intense outward current has been shown to be associated with the “homogeneous phase” around the time of spore cleavage (Armbruster and Weisenseel, 1983; Thiel et al., 1988). Thiel et af.(1988) showed that the late burst of outward current was probably an artefact arising from a transitory increase in the conductivity of the medium which is registered as an outward current by the vibrating probe. This was due to release of salts from the central vacuole as it was broken down at
100
N.A. R. GOW
the time when zoospore plasma membranes were being delimited (Money and Brownlee, 1987). It appeared as though the steady inward current also had little rBle in this developmental cycle. Addition of nitrate frequently abolished the current yet had no effect on organization or timing of sporangium formation (Thiel et al., 1988). Sexual differentiation in the related heterothallic species Achlya ambisexua h is under control of two sex pheremones, namely antheridiol, secreted by female strains, and oogoniol which is secreted by males. Antheridiol is the more potent of the hormones and it induces a series of responses in the male including induction of specialized antheridial branches which can arise from any position along the stem of vegetative hypha. These branches are unlike vegetative branches; they herniate frequently and are chemotropic for female hyphae. The effects of addition of chemically synthesized antheridiol on growth, development and electrical currents of A . amhisexualis have been studied using a vibrating probe (Gow and Gooday, 1987). After antheridiol was added, vegetative hyphae stopped extending. This was accompanied by a marked decline in the inward current at the hyphal apex. After hyphae had stopped growing, new inward currents developed behind the apex. The position of the peak of these currents predicted accurately where antheridia formed. The new currents preceded any visible sign of branch formation by as much as 15 min, again inviting speculation that they may be serving in some direct way in establishment of a new site of growth. D.
Allomyces
SPECIES
Like B. emersonii, Allomyces macrogynus is a chyridiomycetous fungus. It is therefore a water mould but one which is a relatively distant relative of the oomycetes such as Achlya species. As with B. emersonii it has a systeni of rhizoids serving as a holdfast. However, unlike B. emersonii but like A . hisexualis, it forms tip-growing hyphae (Fig. 1). It was therefore of interest to establish whether the electrical current pattern would follow the former, in having inward current at the rhizoids, or the latter with inward currents at the hyphal tip. In the event, A . macrogynus was shown to have inward current at the rhizoid and a constant outward current at the hyphal tip (Youatt et al., 1988). This is the only fungus found to date with a steady outward current associated with tip growth of the hypha. When hyphae of A . macrogynus are grown with a limited supply of oxygen, they become narrow and grow towards sources of highest oxygen tension. If oxygen is then restored to these hyphae, they exhibit “backwards development” in which the hypha widens first at the apex then backwards towards the hyphal base (Cleary e f al., 1986). This is a process of active growth since it can be stopped using antibiotics such as nikkomycin and polyoxin which inhibit de nouo chitin biosynthesis. However,
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
101
the current remained outward even during backward growth (Youatt et al., 1988).This organism therefore provides another exception to the rule that tip growth is associated with an inwardly directed electrical current. Also, the polarity ofgrowth of this fungus could be reversed without consequence to the electrical current. Comparison of the currents and nutrition of A . bisexualis, B. emersonii and A. macrogynus provides an insight into the possible function of the ionic current in water moulds. In A . macrogynus, the rhizoids are chemotropic but the hypha is not or is so only very weakly (J. Youatt, N. A. R. Gow and G. W. Gooday, unpublished results). This suggests that, in A. macrogynus like B. emersonii, the rhizoids are the main nutrient-transport organs. In water moulds, sites of inward current are the rhizoids of the chytridiomycetes and the hyphal apex of the oomycetes. These are also sites at which nutrients are taken up by proton-coupled transport (Kropf and Harold, 1982; Kropf et al., 1984), By this token, the electrical currents of water moulds may relate to the necessity to localize nutrient transport, not growth. E.
Neurospora crassa AND
OTHER FILAMENTOUS FUNGI
The following filamentous fungi have also been examined with a vibrating probe: N. crassa (Gow, 1984; McGillivray and Gow, 1987; Takeuchi et al., 1988), Aspergillus nidulans (ascomycetes), Mucor mucedo, Basidiobolus ranarum (zygomycetes), Coprinus cinereus, Schizophyllum commune (basidiomycetes) (Gow, 1984, 1989b) and Trichoderma harzianum (a deuteromycete) (Horwiz et ul., 1984).The general trend in these fungi is for positive current to enter the growing tip. A proton-based transhyphal ionic current has been proposed to flow through hyphae of the marine fungus Dendryphiella salina as a result of the spatial segregation of ATPases (Galpin and Jennings, 1975; Galpin et al., 1978; Jennings, 1986). The current pattern here was inferred from cytochemical staining of the plasma-membrane ATPase in hyphae. It was suggested that this current also involves transport systems for potassium and sodium ions. The first indication that transcellular ion currents may be driven by fungal hyphae was suggested from the experiments of Slayman and Slayman (1 962) who demonstrated a gradient of membrane potential of around 0.5 V cm- ' in hyphae of N. crussa. Like A. hisexudis (Kropf, 1986),the tip was depolarized compared to the membrane potential in the mature hypha at the rear. As mentioned previously, the membrane potential was shown to be generated by the electrogenic pumping of protons from hyphae (Slayman, 1965a,b; Slayman et al., 1973). In N . crassa, ion-substitution experiments also suggested that protons were again the principal ion responsible for the transcellular current measured with
102
N. A. R COW
a vibrating probe. (McGillivray and Gow, 1987; Takeuchi et al., 1988). In this fungus, protons may enter in symport with phosphate and perhaps also with potassium ions (Takeuchi et al., 1988). Glucose was required for current generation and for hyphal extension, but glucose symport was not thought to account for current entry since this process is inducible in N . crassa (Slayman and Slayman, 1974; Scarborough, 1970) and would have been repressed by the concentrations of glucose used in the growth medium that was used in the vibrating-probe experiments (McGillivray and Cow, 1987). Hyphae of N . crassa stained with bromocresol green, a pH-sensitive permeable dye, are differentially coloured at the tip and subapical region, indicating that the pH value of the apex is of the order of a pH unit more acidic (Turian, 1983; McGillivray and Cow, 1987). Calcium ions were required for hyphal extension but not for current generation in this organism (McGillivray and Cow, 1987; Takeuchi el a/., 1988; Schmid and Harold, 1988). Prolonged calcium-ion depletion decreased the hyphal extension rate to a greater extent than the rate of biomass production, so that the germ tubes that developed from conidiospores became progressively shorter and wider (Schmid and Harold, 1988). Calcium ions may therefore be involved in wall shaping and tip extension but not in carrying the circulating ionic current. In a few cases, hyphae of N . crassa were mapped with the vibrating probe and were found to have outward currents (McGillivray and Cow, 1987) and so the relationship between generation of an electrical current and extension of hyphae was not obligatory. Little correlation was found between the length of the actively growing portion of hyphae (the peripheral growth zone) of N . crassa, A . nidulans and B. ranarum and the length of the inward and inward-plus-outward portions of the electrical current profile (Cow, 1989b). Neither was there any meaningful correlation between hyphal extension rate and the magnitude of the inward current (Takeuchi rt al., 1988). These results do not support the view that the electrical current in filamentous fungi is a driving force for tip growth. The relationship between generation of a circulating ionic current and determination of cell polarity is discussed later in this review. V. Currents in Protozoa A.
AMOEBAE-Amoeba
AND
Chaos SPECIES
Ionic currents have been measured that are associated with movements of Amoeba proteus and Chaos chaos (Nuccitelli rt al., 1977). Three main types of
electrical activity were detected using a vibrating probe. The first was a steady current of 0.1-0.2pA cm-2 which entered the uroid or rear of the amoebae and left from the pseudopods at the front (Fig. 1). This current was carried mainly but not exclusively by calcium ions. Secondly there were spontaneous
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
103
current pulses of up to 4pA cm-2 and of approximately six seconds duration which were calcium-dependent and which could enter or leave the tail or pseudopods. Finally, induced current pulses of around 0.4 pA cm-* of similar or longer duration than the spontaneous pulses occurred when the probe was brought very close to the cell and were normally directed into the pseudopod. Several observations suggested that this electrical behaviour was related to the shape-forming processes and movement of amoebae. Reversal of the direction of cytoplasmic streaming leading to production of a new tail was preceded by a change in the steady current pattern so that the region with the largest new inward current became the site of the new tail. Spontaneous current pulses were more frequent in multipodial amoebae, and the site at which the pulse entered was often followed by formation of a hyaline cap and then a pseudopod initial. Expansion of pseudopods was most commonly associated with pulses entering the pods. Retraction of pseudopods was invariably preceded and accompanied by outward pulses from the sides of the pseudopods. It is possible that these pulses are due to periodic emptying of the contractile vacuole so that local changes in conductivity are produced (see the preceding discussion above for A . bisexualis, p. 99). Emptying of contractile vacuoles has been shown to cause membrane depolarization (Josefsson, 1966) which are of a similar shape to the current pulses described by Nuccitelli e t a / . (1977). Finally, the pulses induced artificially using a vibrating probe often led to local formation of hyaline caps and pseudopods. However, a few pods were formed under the probe without any measured pulse. While none of these observations provides a mechanistic explanation of control of amoebic movement, they suggest that membrane-controlled electrical events are correlated with amoebic movements and may feature in control of this process. B.
ClLIATES-pUrUmeCiUm
SPECIES
There are obvious difficulties in performing electrophysiological examinations on motile organisms such as the cilates, and they have not yet to my knowledge been studied with a vibrating probe. There would, however, seem to be much to be gained from such a study. The swimming behaviour of Paramecium species has been much studied from the electrophysiological point of view using cells that are impaled on micro-electrodes (Eckert, 1982; Evans et al., 1987). Here the direction and speed of swimming of the cell have been shown to be controlled by the cytoplasmic concentration of calcium ions, which in turn is set by the relative effects of two membrane-transport proteins, namely calcium channels and calcium pumps. The calcium channels are voltage sensitive and allow calcium ions to diffuse into the cell at a slower or faster rate according to the membrane potential. The calcium pump
104
N. A. R. GOW
constantly tries to empty the cell of calcium ions. The calcium channel opens and closes in response to stretching of the membrane which results from collision of the Paramecium species into solid objects. When the channel is open, calcium ions flood into the cell, the internal calcium ion concentration rises and the cilia reverse the direction of beating causing the cell to back away. The channel is only open for a finite period so that the internal calcium concentration is ultimately pumped back down to its previous value and the normal forward swimming is restored (for a review see Eckert, 1972; Harold, 1986). It is not known whether these calcium-ion movements occur uniformly over the cell surface or whether they form localized calcium-ion currents analogous to those described in amoebae. The patterns of ciliature in protozoans are spatially precise and are inherited, yet information for their assembly and inheritance lies not in the nucleus but in organization of the cortex. Morphogenetic fields describing these patterns of ciliature can be described mathematically (Goodwin, 1980; Frankel, 1984)and it would be of interest to ascertain whether their physical basis reflects the distribution of electrogenic ion carriers. C. SLIME
MOULDS-Physarum
AND
Dicryostelium
SPECIES
The taxonomic position of the slime moulds is uncertain but they show some structural and genetic similarities to certain protozoans (Gunderson et al., 1987).Physarum polycephalum exists as a large migratory multinucleated cell called a plasmodium for much of its life cycle. Upon starvation, the plasmodium culminates and forms a fruiting body. The plasmodium undergoes amoeba-like movement which is characterized by oscillating cytoplasmic streaming in which the endoplasm is squeezed back and forwards by contraction of the two ends of the plasmodia1 strands. Achenbach and Weisenseel (1981) showed that the advancing end of the plasmodium generates outward electrical current, and that inward current flowed into the tail (Fig. 1.). There was also an additional smaller zone of outward current at the base of the tail. This pattern is therefore similar to that observed in amoebae where current entered the pseudopods and exited from the tail (Nuccitelli et al., 1977).The additional zone of outward current at the tail base of the plasmodium may reflect the oscillatory behaviour of cytoplasmic streaming in P. polycephalum in contrast to the unidirectional cytoplasmic flow in amoebae. Recently, a circulating calcium-ion current has been shown to be generated during migration of pseudoplasmodia of the cellular slime mould Dicryostelium discoideum (W. Kuhlreiber and L. F. Jaffe, personal communication). Calcium-ion gradients have also been demonstrated in pseudomycelial slugs of D. discoideum with the highest calcium-ion concentration at the
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
105
anterior prestalk region (Maeda and Maeda, 1973). In another cellular slime mould, Polysphondylium violaceurn, calcium ionophore A23 187 induced formation of aggregation centres of the ameobae (Cone and Bonner, 1980). Thus, there is some evidence implicating calcium-ion currents in migration and differentiation of slime moulds. The flow of current associated with amoebic migration of wall-less cells, such as C. chaos, A . proteus and the slime moulds contrasts to the pattern of current flow in tip-growing plants and most fungi where positive electrical current normally enters the site of cell expansion.
VI. Currents in Algae A. FUCOID
EGGS-Fucus
and Pehetia
SPECIES
The developing fucoid egg is a classical system for studies of the localization of cell growth. The unfertilized egg and newly fertilized zygote are radially symmetrical and totally apolar, since the first bulging outgrowth of the cell which eventually develops into the rhizoid can be formed at any position around its circumference. This highly localized outgrowth occurs after about 15 hours, and is the result of the establishment and fixation of an axis of polarity. It is this polarization of a structurally homogeneous cell zygote which has been the focus of attention of cell biologists for almost a century. The axis of growth can be oriented by at least 13 different physical and chemical gradients (Kropf, 1988),although normally it is established in response to light so that the rhizoid forms on the dark side of the egg. The developmental process can be separated into three phases. Firstly there is a period of some 10 hours during which the site of eventual outgrowth can be re-oriented by changing the direction at which light and other gradients impinge on the egg. During this time, called axis formation, the axis is labile. After about 10 hours, the axis can no longer be re-oriented and is said to be fixed. Some time after axis fixation, a region of the outer cortex clears itself of pigment and the process of tip growth is initiated at this site. Vesicles containing wall precursors fuse at the growing end, and turgor pressure generated by uptake of potassium and chloride ions (Robinson and Jaffe, 1973)causes expansion and bulging of the rhizoidal germination site. Cell division follows bulging, dividing the cell into two. The rhizoidal end goes on to form the holdfast and the other cell develops into the thallus. Lionel Jaffe along with his many collaborators provided the conceptional framework and technological means for investigating circulating ionic currents. Much of their own work has centred on a detailed investigation of the development of eggs of the brown alga Pelvetia fastigiara.Jaffe (1966) was able to demonstrate that the developing egg drove a current through itself
106
N. A. R. GOW
before the vibrating probe had been developed. Eggs cells were placed in series in a capillary tube with a diameter only slightly wider than that of the eggs. Unidirectional light was used to induce germination of the eggs in one direction. When conventional micro-electrodes were placed at the ends of the capillary, a potential difference was detected indicating a net flow of positive current through the cells in the rhizoid-to-thallus direction. Later, steady and pulsatile currents of individual eggs were measured with a Vibrating probe (Nuccitelli and Jaffe, 1974). Initially, the profile of the steady current was erratic, but eventually it stabilized and entered at one side of the egg which later became the site where cortical clearing and rhizoidal formation occurred (Fig. 1) (Nuccitelli, 1978).This current could be measured during the very earliest phase of axis formation. Ion-substitution experiments and experiments measuring net fluxes of radioactive tracer ions showed that the inward current was due to calcium-ion influx and chloride-ion efflux, and that outward current was probably potassium-ion efflux (Fig. 2; Robinson and Jaffe, 1975; Nuccitelli, 1978).The pulsatile current was stimulated by calcium ions but was due to chloride-ion efflux followed by loss of potassium ions in proportion to the resulting depolarization of the membrane potential (Nuccitelli and Jaffe, 1976).Although calcium ions were estimated to account for only 10% of the total inward current, this ionic flux is likely to be ofgreater significance to the establishment of developmental polarity. The calcium-ion concentration and mobility are very low inside the cell compared to chloride ions, and so a small flux will result in a large calcium-ion gradient. The predicted calcium-ion gradient, high in the growing rhizoid, has been measured using low-temperature 45Ca autoradiography (Gilkey and Jaffe, 1976); however, see the photographs in Nuccitelli (1984).Controls labelled with 3"CI did not show a chloride gradient. Calcium-ion gradients in fucoid eggs have also been demonstrated using the fluorescent dye chlortetracycline (CTC) which indicates regions of membrane associated calcium ions (Kropf and Quatrano, 1987). In Fucus serratus, a gradient of free calcium ions was demonstrated using intracellular calcium micro-electrodes (Brownlee and Wood, 1986). Kropf and Quatrano ( 1 987) showed that only a minority of egg cells (20%) had an observable CTC gradient before axis formation and the onset of tip growth and germination, and that there was no correlation between orientation of the visible gradients of these 20% of cells and the eventual site of outgrowth. This indicates that gradients of membrane-bound calcium ions were not involved in establishment of the developmental axis. Deprivation of external calcium ions or blockage of calcium-ion uptake with transport antagonists inhibited tip growth but not axis formation, so that these experiments suggest that calcium-ion currents may be important for tip growth but not for establishment of egg-cell polarity. A more positive indication of a causal r6le for the calcium-ion current in
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
107
control of polarity in fucoid eggs was indicated in experiments where a calcium-ion gradient was imposed on the ungerminated egg. Robinson and Cone (1980) coated glass fibres with the calcium ionophore A23187, and showed that nearly 80% of the cells that were within a cell diameter of the fibre formed rhizoids towards the fibre. External voltage gradients (Peng and Jaffe, 1976) and pH gradients (Bentrup et al., 1967) also polarize the site of rhizoid formation (Table 1) and it has been argued that these gradients might have these effects by affecting local calcium-ion entry at one side of the egg (Jaffe et al., 1975; Robinson, 1985). However, it must be borne in mind that many other environmental stimuli can polarize outgrowth (Jaffe, 1969; Kropf, 1988) and that it may not be possible to invoke indirect effects on calcium-ion entry in each case. Recent experiments using micro-injected calcium buffers (BAPTA buffers) also seem to indicate that disturbance of the intracellular calcium-ion gradient interferes with development (Speksnijder et a!., 1989). If BAPTA buffers with an appropriate dissociation constant are injected into the ungerminated fucoid egg at just the right concentration, the egg cell does not die but fails to germinate. A reasonable interpretation of this result is that the buffer dissipates cytoplasmic calcium-ion gradients, and that such a gradient is required for polarization of the egg. B.
Chara
AND
Nitella
SPECIES
The giant freshwater green algae Chara corallina and NitellaJlexilus grow as long tubular cells which are anchored to the substrate at one end (Fig. 1). The tubular cell is physiologically differentiated along its length into a number of internodes. These internodes can be distinguished visually as alternating calcified and non-calcified regions of the cell wall in C . corallina and alternating bands of lighter and darker green pigmentation in N..flexilus.The internodal cells of C. corallina are also physiologically differentiated so that transport of bicarbonate ions into the cell, to provide carbon dioxide for photosynthesis, occurs in regions which are separate from but adjacent to those where hydroxide ions are expelled (or protons are taken up) after carbon dioxide fixation (Lucas and Nuccitelli, 1980). This spatial segregation of transport systems results in net outward (positive) current and external acidity where bicarbonate and chloride ions and carbon dioxide are taken up and protons are expelled, and inward current and external alkalinity where hydroxide ions are expelled (Fig. 2) (Walker and Smith, 1977; Lucas, 1979; Lucas et al., 1983). Calcium carbonate precipitates in the zone of external alkalinity thus accounting for the periodic calcified deposits. In N . ,flexilus, inward current flowed into the light green region of the trunk of the cell and outward current flowed o u t of the darker green zones in which there were
TABLE 1. Studies of the effects of applied electrical fields and ionophore gradients on eukaryotic microbial cells Organism
Gradient
Response
Electrical C a 2 + / H +ionophores Electrical Electrical
Growth and branching towards anode Stimulates branching Rhizoids and hyphae grow towards anode Germ tube and bud formation towards cathode
Blasrocladiella emersonii
H ionophore
Mucor mucedo Neurospora crassa
Electrical Electrical
Neurospora crassa Phyromyces blakesleeanus Rhizopus stolonlfer
Ca2 ionophore Electrical Electrical
Rhizoids form and grow towards ionophore Growth and branching towards cathode Germination, growth and branching towards anode: perpendicular growth at higher field strengths Stimulates branching Germination and growth towards cathode Growth towards cathode
Schizophyllum commune Sordaria marrospora
Electrical Electrical
Protoplasts regenerate towards anode Growth and branching towards anode
Fungi Arhlya bisexualis Achlya hise.rualis Allomyres macrog-vnus Candida albicans
+
+
Reference
McGillivray and Cow (1986) Harold and Harold (1986) Youatt et a/. (1988) T. Crombie, N. A. R Cow and G. W. Gooday (unpublished observations) Harold and Harold (1982) McGillivray and Cow (1986) McGillivray and Gow (1986)
Reissig and Kinney (1983) Van Laere (1988) I. Clark and A. Goldsworthy (unpublished observations) De Vries and Wessels (1982) B. Robertson, N. A. R. Gow and N. Read (unpublished observations)
Trichoderma harzianum
Electrical
Growth towards anode, cathode 01 perpendicular according to field strength
McGillivray and Cow, (1986)
Protozor Amoeba proteus Polysphondylium violaceurn
Electrical Ca2 ionophore
Migration towards cathode Induction of slime-mould amoeba aggregation
Hahnert (1932) Cone and Bonner (1980)
Algae Fucus inpatus Fucus serratus Fucus species
Electrical Electrical H + ionophore
Rhizoids form and grow towards anode Rhizoids form and grow towards cathode Rhizoids form and grow towards ionophore Rhizoids form and grow towards high concentrations of K + / H + Growth of lobes towards cathode Delocalization of growth Rhizoids form and grow towards anode, cathode or both poles with different batches of eggs and varying field strength Rhizoids form and grow towards ionophore
Lund (1923) Bentrup (1968) Whitaker and Berg (1944)
+
Fucus species
K + / H + gradients
Micrasterias denticulata Micrarterias thomasiana Pelvetia fastigiata
Electrical CaZ+ Electrical
Peltietia ,fastigiata
CaZ+ ionophore
,
Bentrup et af. (1967) Brower and Mclntosh (1980a,b) McNally e f al. (1983) Peng and Jaffe (1976)
Robinson and Cone (1980)
110
N A R.GOW
more chloroplasts (Dorn and Weisenseel, 1984). It would seem likely that the outward current associated with chloroplast-rich zones reflects enhanced uptake of bicarbonate ions and carbon dioxide in this region. When cells of either C. corallina or N..flexiIus are placed in the dark or under a green light filter, the outward and inward currents fall off dramatically (Lucas and Nuccitelli, 1980; Dorn and Weisenseel, 1984).These currents are not growthrelated but instead reflect spatial separations of ion-transport proteins to satisfy the need for efficient supply of substrate for photosynthesis. However, there is some indication of a correlation between external acidification and localized cell expansion in immature growing cells of Chara and Nitella species (Lucas and Smith, 1973; Taiz et al., 1981).Dorn and Weisenseel (1984)suggest that the extracellular electrical fields may function in an unstirred environment in concentrating bicarbonate ions externally at sites adjacent to those of maximal photosynthesis. In C. corallina it has been suggested that the zones of external acidity encourage bicarbonate to be converted to carbon dioxide thereby enhancing carbon dioxide uptake and respiration (Walker, 1980). C.
Acetabularia
SPECIES
Acetabularia mediterranea is a large single-celled green, marine alga which consists of an elaborate cap subtended by a slender stalk which in turn is rooted to a solid substrate. This alga and other Acetabularia species have been studied extensively from a developmental point of view since decapitated cells are capable of regenerating the stalk and cap even in the absence of a nucleus. The positional information for organization of growth and regeneration therefore seems to reside in some property of the cortex (Sandakhchiev et al., 1972). Mature, immature and regenerating cells of A . mediterranea generate very large currents of up to 500 pA c m V 2into the rhizoid when cells are illuminated with white light (Bowles and Allen, 1986).Smaller currents of 0 - 6 0 ~ A c m - ~ enter along the stalk. This inward current diminishes towards the growing tip which is often electrically quiescent (Bowles and Allen, 1986; Goodwin et al., 1987; Fig. 1). Both inward and outward currents are diminished greatly after cells are placed in the dark (Bowles and Allen, 1986;Goodwin et al., 1987).The current that remains is diminished by a further 5-15% by addition of cobalt ions which block calcium-ion uptake (Goodwin et al., 1987) indicating that some of the current flowing out of the stalk and into the rhizoid is carried by calcium ions. The attenuated current measured in the dark may be important for development none the less, since the process of regeneration is not retarded in the dark. The greater part of the current may be due to chloride-ion influx and/or sodium-ion efflux since the membrane of this organism is known to
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
111
have electrogenic pumps for these ions (Saddler, 1970). Fluxes of these various ions would seem to be at equilibrium at the growing apex where little or no electrical activity can be detected using a vibrating probe. Regeneration of decapitated cells has been shown to be preceded by hyperpolarization of the cell membrane at the regenerating end (Goodwin and Pateromickelakis, 1979). However, Dazy et al. (1986) showed that stalk-cell fragments that had also been isolated from the rhizoid lost their electrical polarity without losing the capacity to grow. Electrical currents in this organism may be related to several processes including photosynthesis, tip growth and morphogenesis of the cap. The significance of the current to each of these is difficult to ascertain since they normally happen simultaneously. However, the possibility that ionic currents may have an organizational role in development of this organism is made the more intriguing by the knowledge that the cortical membrane is the site of information for regeneration and growth of a complex structure like the cell cap.
D . TIP-GROWING
ALGAE-Grifithsia
AND
Vaucheria SPECIES
Many algae have tip-growing cells which are functionally analogous to the hyphae of fungi. In the marine red alga Grzfithsia pacijica, for example, the rhizoids and repair-shoot cells both extend by apical incorporation of new wall material. Waaland and Lucas (1984) used a vibrating probe to investigate the correlation between apical growth and ionic currents in this organism. Normally, these cell types both drive current into the growing ends. However, examples of both cells were found in which the extension rate was normal but no current was measurable. As with fungal hyphae, there was no correlation between extension rate and the magnitude of the current. Moreover, they found that resumption of growth of the rhizoids following prolonged dark incubation could occur in the absence of any current at the tip. The current did not seem to have any indispensible r81e in the establishment or maintenance of tip growth in this organism. In Vaucheria terrestris, another tip-growing alga, a much tighter correlation was found between extension rate and current flow (Kataoka and Weisenseel, 1988). Here again the current was inward at the tip but, in this case, fast growing cells had larger currents than slower growing ones. Irradiation with blue light caused a transient stimulation of extension rate. In V. terrestris this was preceded by a large and transient increase in the inward current. This blue light-stimulated current was thought to reflect increased proton entry at the apex. Red-light irradiation caused only small increases or decreases in the current and did not affect cell growth.
112
N. A. R. GOW
E. Micrasterias AND Closterium SPECIES
The unicellular green algal desmids, such as Micrasterias and Closterium species, exist as two symmetrical cells which grow by splitting in two and reproducing a daughter cell by expansion of the septum. In Micrasterias species the septum forms furrows or clefts during expansion to regenerate the highly sculpted lobate appearance of the mature cell (Fig. 1). The simpler crescental shape of Closterium species involves apical expansion of the septum of the bisected parent cell. Electrical currents associated with development of these desmids have been mapped with a vibrating probe (Troxell et al., 1986; Troxell, 1989). In both algae, expansion of the septum of the half-cell was accompanied by influx of electrical current. This current disappeared upon maturation of the wall. In Micrasterias rotata and Micrasterias thomasiana, high-resolution probes showed inward current at the tips of the lobes and weak outward at the clefts (Fig. 1). Since the lobe tips are the site of maximal wall growth (Kiermayer, 1970a,b; Lacalli, 1975), local growth is again correlated with inward current. In these desmids the currents seem to be carried mainly by calcium ions, with protons, chloride ions and potassium ions accounting for most of the rest (Troxell, 1989). Membrane-bound calcium ions in Micrasterias species have been shown to be highest under the tips of the growing lobes (Meindl, 1982),and disruption of the endogenous calcium-ion gradient with the calcium ionophore A23187 had the effect of delocalizing the normal pattern of wall desposition (McNally et al., 1983). Electrical fields also affected the pattern of growth by stimulating the layingdown of new wall on the cathode side (Brower and McIntosh, 1980a,b). This may again be the result of re-orientation of cytoplasmic calcium-ion gradients due to electrical fields. F.
Noctiluca
SPECIES
The marine dinoflagellate Noctiluca miliaris feeds by catching food particles and then transfering them to a specialized region of the surface called the cytostome where they are phagocytosed (Fig. 1). Immediately prior to phagocytosis, the cytoplasm streams towards the cytostome and aggregates around it. Nawata and Sibaoka (1987) showed that a compound current of calcium, sodium and magnesium ions enters a specialized region called the sulcus in the region of the cytostome prior to initiation of feeding, and they proposed that the calcium-ion component of the current was responsible for inducing the cytoplasmic aggregation. This piece of work therefore parallels the study of Nuccitelli et al. (1977) who showed that calcium-ion currents precede cytoplasmic contractions associated with pseudopodial movements of amoebae.
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
113
VII. Effects of Applied Voltage and Ion Gradients The natural ionic currents already described generate extracellular and intracellular gradients of electrical potential (voltage) and ions such as calcium and protons. If these parameters are of importance to the polarity of cells, artificial voltage gradients or ionic gradients ought to impose a sense of polarity on the cells. As already indicated, applied electrical fields and ionophore gradients have been shown to cause orientation or stimulation of growth of many micro-organisms. Studies on the effects of applied electrical fields and applied ionophore gradients on micro-organisms are summarized in Table 1. It is clear that applied electrical fields exert a dramatic influence on the polarity of cell growth, and they do this without causing disruption of normal biosynthetic and metabolic processes of the cell (for a review see Gow, 1987). However, analysis of the data obtained from these experiments reveals that the effects of the artificial electric field may not mimic those of natural ones. For example, Peng and Jaffe (1976) showed that rhizoids of Pelvetiu species grew towards the anode or cathode or to both electrical poles according to the batch of eggs and the field strength. However, the natural electrical polarity of these cells is the same. Similarly, hyphae of filamentous fungi grow either to the anode or to the cathode (McGillivray and Gow, 1986; Van Laere, 1988; Youatt et al., 1988), yet the endogenous electrical polarity of all fungal hyphae examined to data (with the exception of Allomyces macrogynus) is normally the same. Clearly there is no simple correlation between the profile of the natural electrical field and the response to an applied one. The sizes of the electrical fields needed to polarize growth of cells such as fungal hyphae or fucoid eggs are around or above 1 Vcm-' (10 mV (cell diameter)- l), much larger than those measured around the outside of these cells (approx. 1OpVcm-'). Applied fields will have effects on the outside and the inside of the cell membrane. However, the high electrical resistance of the cell membrane will mean that only a small fraction of an artificial electric field will be experienced by the inside of the cell. In the cytoplasm of hyphae of N . c r a m and A . bisexualis, the voltage gradients through which the natural currents flow are much steeper than those measured externally, and can be as much as 0.5V cm-' (Slayman and Slayman, 1962; Kropf, 1986) which is comparable with the size of applied fields capable of directing movement. The size of the intracellular electrical field in these fungi is large enough to electrophorese proteins with a modest electronegativity towards the apex at a rate compatible with the extension rate of most fungal hyphae (Kropf, 1986; Gow, 1987). Applied electrical fields may also affect the distribution of membrane proteins which carry exposed charged groups (Jaffe, 1977; Poo, 1981; Gow, 1987). In regenerating protoplasts of the basidiomycetous fungus
114
N. A. R. GOW
Schizophyllum commune, it was shown that the wall-synthesizing enzyme chitin synthase was not polarized by artificial electrical fields (De Vries and Wessels, 1982) although, in animal cell systems, there is unequivocal evidence that electric fields do move proteins around in the cell membrane (Poo, 198 1; McCloskey et al., 1984). In a remarkable series of experiments by Patel and Po0 (1984), it was shown that the electrophoretic redistribution of concanavalin A receptors in neurones of Xenopus spp. was essential for a galvanotropic response. Inhibition of this field-induced redistribution, through the simple procedure of adding concanavalin A, abolished the ability of the cells to exhibit galvanotropism, without inhibiting growth, These data suggest that polarization of growth processes in eukaryotic micro-organisms which are applied electrical fields may also operate by moving membrane proteins concerned with extension of the tip to one end of the cell. It is also possible or probable that applied electrical fields establish gradients of ions in the cytoplasm. The membrane potential will be hyperpolarized at the anode-facing side of a cell and depolarized at the cathodic end. This will alter the driving force for ion-driven transport systems and may also cause opening of voltage-sensitive channels. Thus, the artificial field may drive a current of ions into one end of a cell and thereby establish a cytoplasmic gradient for that ion (Robinson, 1985). Therefore, applied fields may induce cell polarity by causing electrophoretic redistribution of proteins or organelles in the cytoplasm or cell membrane o r by forcing an ionic current through a cell, thereby establishing standing gradients of those ions. Cooper and Schliwa (1985, 1986) and Onuma and Hui (1985, 1988) showed that galvanotactic and galvanotropic migrations of certain animal cells was abolished in the presence of cobalt ions or other compounds which block calcium channels. Addition of the calcium ionophore A231 87 restored galvanotaxis, but with a reversed polarity (Cooper and Schliwa, 1985, 1986). These results show that applied fields in some instances may mediate their effect through induced asymmetric transport of calcium ions. Applied electrical fields have also been shown to cause re-arrangements of actin microfilaments in animal cells (Luther et al., 1983; Onuma and Hui, 1988) indicating a possible link between applied fields, calcium-ion currents and cytoskeleton-mediated cell movement. Experiments using applied electrical fields certainly seem to indicate that there is an electrical dimension to control ofcell polarity, but it is not clear what they tell us about the natural electrical activities of cells and control of cell growth and morphogenesis. VIII. Ionic Currents and Cellular Physiology Studies of ionic currents are largely motivated by the possibility that they have some significance in control of cell polarity and development. Electrical
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
115
currents are indicative of an organization of ion-transport proteins in the cell membrane so that electrogenic transport systems are not inserted at random but rather that work is done to ensure some sort of spatial separation of pumps and porters. Since the fight against randomness requires expenditure of work it does not seem likely that electrical currents lack physiological significance.However, examination of the data generated to date does not yet permit an unequivocal statement to be made about the relationship between ionic currents and cell polarity, and it is possible or likely that they have a multiplicity of functions quite apart from any putative morphogenetic r81e. It is informative to summarize the findings of the various studies already described in the light of the hypothesis that ionic currents are causally related to control of cell polarity and extension. In doing so it is useful to consider that ionic currents, like the proton-motive force and other electrochemical gradients, have two separate but linked components-an electrical or voltagerelated component and a chemical or ionic component. There are many observations that support the general contention that currents and polarity are interrelated. Ionic currents are invariably symmetrically oriented around the axis of growth. In tip-growing organisms, the current normally flows the same way-into the tip and out from the nongrowing parts. In experiments where the current can be shut off (for example by depleting the growth medium of Achlya bisexualis of amino acids), growth is inhibited concommitantly. Currents precede sites of new growth and predict accurately their location. Finally, artificial gradients of electrical potential, ions and ionophores are capable of polarizing growth or inducing new growing points. These are general observations that span studies of a wide range of eukaryotic micro-organisms. However, there are important exceptions to the general trends, and these exceptions cast a doubt on the validity of the hypothesis. For example, in the fungi A . bisexualis and Neurospora crassa, growing hyphae were found with currents running transiently in the reverse direction (Kropf et al., 1983; McGillivray and Gow, 1987) and in Allomyces macrogynus the hyphae drove a constant outward current which was unaffected by the growth reversal which occurred after oxygen was restored to oxygen-depleted hyphae (Youatt et al., 1988). In hyphae of A . hisexualis growing in media containing urea and thioglycollate but lacking amino acids (Schreurs and Harold, 1988), in stalks of Acetabularia mediterranea growing in the dark and in rhizoids and repair-shoot cells of Grrfith.siapacifica (Waaland and Lucas, 1984), tip extension could occur in the virtual absence of any electrical current. It is possible that currents of individual ions, such as calcium or protons, continue to enter cells which are electrically quiescent if their entry is balanced by the efflux of some counter ion. An example of this is in A. bisexualis where currents fluctuate, diminish or reverse, but proton entry, as indicated by external alkalinity around the tip,
1 I6
N. A. R GOW
persists as long as the fungus grows (Gow et al., 1984). However, in general, these results seem to indicate that the vectorial flux of electrical charges is a dispensible function in the control of cell polarity, at least in these organisms. The electrical flux may sometimes be useful as an indication of movements of the current carrying ions, but, in many organisms, it does not in itself seem to have any essential rale to play. It is, however, conceivable that electrical forces act in the cytoplasm. The large voltage gradients measured in the cytoplasm of A . bisexualis and N . crassa (Kropf, 1986; Slayman and Slayman, 1962) may normally be a manifestation of the ionic current. However, the tips of these hyphae and many other tip-growing structures are also rich in calcium ions (Reiss and Herth, 1979; Meindl, 1982; Brownlee and Wood, 1986; Kropf and Quatrano, 1987; Schmid and Harold, 1988) and the relative immobility of this ion may mean that the calcium-ion gradient establishes a substantial fixed charge gradient (Donnan potential) which may be maintained even when the electrical flux is small or even reversed. This would sustain the possibility that cytoplasmic electrophoresis causes movement of appropriately charged proteins, microvesicles and organelles to the apex of tip-growing cells thereby localizing exocytosis and growth (Jaffe et al., 1974). Electrophoretic sorting of charged proteins in an electrically active tissue has been demonstrated in insect embryos (Woodruff and Telfer, 1980; Deloof, 1983; Munz and Dittmann, 1987). Here it was observed that fluorescently tagged electropositive proteins moved towards the negative end of the tissue and electronegative proteins moved to the positive end. The direction of spread of fluorescence of an electropositive protein could be reversed if its charge was changed to net electronegativity by carboxymethylation (Woodruff and Telfer, 1980). This type of experiment has not yet been attempted in a microbial cell. The large cytoplasmic voltages in hyphae of A . bisexualis and N . crassa would seem to provide ideal subjects for this kind of investigation. The polarizing effects of applied electrical fields would seem to be most easily explained by proposing that they cause an electrophoretic redistribution of proteins in the cell. These experiments would appear to emphasize the importance of the electrical component of ionic currents. Because of the high electrical resistance of membrane-bound proteins they are more likely to be electrophoresed than cytoplasmic ones, since the internal environment is to a large extent electrically insulated. However, the relationship between applied and natural electrical fields is uncertain and the experiments already described with fungi and fucoid algae show that there is no tight correlation between the natural electrical polarity of a cell and its response to an external electric field. Exogenous electric fields may work not through direct electrophoresis but rather by setting up ion gradients in the cell. This may occur in a number of possible ways, for example by altering the magnitude of the driving force for ion-transport at opposite ends of a cell in a field, by opening or closing voltage-
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
117
gated ion channels or, indeed, by electrophoresing ion-transport proteins in the membrane. It is therefore possible that electric fields polarize cells by inducing chemical, as opposed to electrical, asymmetries within the cell. Turning to the ionic aspects of circulating currents, it is first clear that the composition of the currents of different micro-organisms varies greatly. In some organisms, such as A . bisexualis, most of the current is carried by a single ionic species, in this example protons. In other organisms, several ions are involved (Fig. 2). The most common ionic components of currents are, however, protons and calcium ions. The gradients of these ions which result from their asymmetric transport are likely to have a range of effects on polarity and growth. For example, both protons and calcium ions can regulate enzyme function, either directly or via their effects on protein kinases, calmodulin and phosphorylated cyclic nucleotides (Busa and Nuccitelli, 1984; Carafoli and Penniston, 1985; Harold, 1986). Vesicle fusion and exocytosis require calcium ions, and so high concentrations of calcium ions at the site of cell extension may provide conditions permissive for local growth. However, consider also the following examples. Hyphae of A. bisexualis and cell tips of Vaucheria terrestris do not require exogenous calcium ions for tip growth to generate their currents (Kropf et al., 1984; Kataoka and Weisenseel, 1988). In contrast, N . crassa requires exogenous calcium ions for hyphal extension but not for current generation (McGillivray and Cow, 1987;Takeuchi et al., 1988) while in fucoid eggs calcium ions are required for the current (Nuccitelli, 1978) and for germination and tip growth but may not be required for establishment of the initial axis of cell polarity (Kropf and Quatrano, 1987). If one assumes that local, polarized growth is supported in all of these instances by local exocytosis of membraneous microvesicles, it can be argued that a calcium-ion gradient may be actively involved in regulating tip growth. But it must also be inferred that the gradient is not always dependent on a continuous supply of exogenous calcium ions via an inwardly directed calcium-ion current. The results of Kropf and Quatrano (1987)with fucoid eggs do not lend themselves to the notion that the calcium-ion current is required for establishment of the primary axis of polarity in this system. However, this must be weighed against the findings that a calcium-ion current predicts precisely where localized outgrowth will take place and that ionophore gradients are capable of fixing the axis of growth (see p. 107). Cytoplasmic gradients of protons and calcium ions may influence enzyme activity and exocytosis. They may also have important effects on the function of the cytoskeleton. Tip-growing cells have a cytoskeleton consisting of microfilaments and microtubules which run longitudinally from tip to base. Properties of actin gels and polymerization of G-actin to F-actin are influenced strongly by pH value and by calcium-ion concentration (Harold, 1986). Contraction of microfilaments which are normally a t high concentration in the apex of tip-growing cells (Brawley and Robinson, 1985;
118
N A R COW
Harold, 1986; McKerracher and Heath, 1987) can be stimulated by changes in the free cytoplasmic calcium-ion concentration (Williamson, 1984; McKerracher and Heath, 1986). These contractions may be involved in cytoplasmic streaming and directional growth. Also, it is possible that actin in the peripheral cytoplasm may influence microvesicle-membrane interactions. Thus, calciums ion and protons may be involved in regulation of cytoplasmic movement and exocytosis. An elegant model for a relationship between calcium currents, microfilaments and the establishment of polarity and tip growth in fucoid eggs has been proposed by Brawley and Robinson (1985). They showed that polymerized actin (F-actin) accumulates in the cortical cytoplasm at the presumptive rhizoidal end around the time that the axis of polarity is fixed. The microfilament inhibitor cytochalasin D prevented polarized accumulation of F-actin, and inhibited the calcium-ion current which entered at the same site. On the basis of these results it was proposed that there may be a positive feedback mechanism operating during polar-axis formation and fixation which involved an interaction between the calcium-ion current and cortical microfilaments. Initially, it was envisaged that light, or some other external polarizing influence, caused depolymerization of microfilaments at what was to become the non-rhizoidal/thallus end. Functional polymerized microfilaments in the presumptive rhizoid at the opposite side were proposed to start carrying microvesicles loaded with calcium-channel proteins preferentially to the presumptive rhizoidal pole. Insertion of the calcium channels then allows calcium-ion current to enter the zygote at this point. The resulting local increase in cytoplasmic calcium-ion concentration stimulates more microfilament polymerization. This in turn may lead to more vesicle deposition and more calcium-ion channels being inserted. The resulting positive feedback loop was proposed to stabilize and strengthen the current and thereby orient the microfilament-based channelling of microvesicles to the extending rhizoid tip. This type of model would seem to bridge our perceptions of the structural and electrophysiological basis of cellular polarity and provides a direction for further experiments on the significance of circulating electrical currents. Finally, we must bear in mind the real possibility that there may be no causal relationship between ionic currents and polarity or development. For example, comparison of the currents of the water moulds Allomyces macrogynus, Blustocladiella emersonii and A. hisexualis suggests an alternative explanation of the physiological r6le of the current. Allomyces macrogynus and B. emersonii both have rhizoids which take up nutrients by protoncoupled transport and which drive an inward protonic current (Youatt et al., 1988; Gow, 1988b; Kropf and Harold, 1982; Stump et ul., 1980) (Fig. 2). In A . hisexualis, proton symport is again responsible for nutrient transport and for the electrical current into the hyphal tip (Kropf et ui., 1984). There is an
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
119
excellent correlation between the zones at which proton-coupled nutrient transport occurs and the regions where positive electrical current enters these fungi. The current may therefore indicate local nutrient uptake rather than local cell growth. Similarly, in the freshwater algae Chum spp. and Nitella spp., the ionic current reflects the need to take up carbon dioxide in the form of bicarbonate preferentially at the sites of maximal photosynthesis. These examples illustrate the important point that proteins which carry ionic currents usually are essential for nutrition or maintenance of ionic balance in the cell. Asymmetries in the organization of these proteins need not be related to the mechanisms which account collectively for localization of growth and differentiation. IX. Conclusions
Ion-transport proteins in the plasma membrane of eukaryotic microorganisms are often spatially segregated so that an electrical current is driven through and around the cell. These circulating ionic currents can be carried by a variety of inorganic ions, most commonly protons or calcium ions. Current often, but not always, enters the growing ends of tip-growing cells and new currents predict where new sites of tip growth will take place. Further evidence for a causal relationship between electrical and morphological polarity comes from experiments in which applied electrical fields or artificial gradients of ions or ionophores have been demonstrated actively to polarize cell growth. There are, however, problems in reconciling the relationship between endogenous electrical currents and the effects of exogenous ones. However, most of the evidence suggesting that ionic currents are actively involved in establishing and maintaining polarized growth is essentially correlative, and it is not yet clear whether the current is the cause or consequence of polarity. Ionic currents have both an electrical and a chemical component. Analysis of the data from a number of sources leads one to conclude that the vectorial flux of electrical charge is not important for polarized growth. Cytoplasmic proton and calcium-ion gradients and fixed-charge gradients resulting from asymmetric transport of calcium into a cell may, however, be involved in localizing growth. These might regulate activities of enzymes and secondary messengers, or provide a permissive environment for localized exocytosis or modulate the conformation and assembly of the cytoskeleton. Studies of fungi and of certain photosynthetic algae show that some currents may arise from the necessity to localize electrogenic nutrient transport to support heterotrophic or autotrophic growth, respectively. This leads to the conclusion that the current need not necessarily be related to control of cellular polarity and of development. However, it is also clear that growth and differentiation in eukaryotic micro-organisms have an electrical dimension which, until recently, had received little attention. In seeking to discover the
120
N. A. R. GOW
forces which shape development as a whole, we will have to look further than control of gene expression and consider the integrated workings of the whole cell. To this end, the study of ionic currents would seem to offer new perspectives of ways in which electrical, chemical and physical forces orchestrate growth and form of biological cells. REFERENCES
Achenbach, F. and Weisenseel, M. H. (1981). Cell Biology International Reports 5, 375. Armbruster, B. L. and Weisenseel, M. H. (1983). Proioplasma 115, 65. Bentrup, F. W. (1968). Zeirschrift fur Pjanzenphysiologie 59, 309. Bentrup, F. W., Sandan, T. and Jaffe, L. F. (1967). Protoplusma 64, 254. Bowles, E. A. and Allen. N. S. (1986).In “Ionic Currents in Development” (R. Nuccitelli, ed.), pp. 113-121. Alan R. Liss, New York. Brawley, S. H. and Robinson, K. R. (1985). Journal of Cell Biology 100, I 173. Brower. D. L. and Mclntosh, J. R. (1980a). Journal qf Cell Science 42, 261. Brower, D. L. and Mclntosh, J. R.(1980b). Journal of Cell Science 42, 279. Brownlee, C. and Wood, J. W. (1986). Nature 320, 624. Busa, W. B. and Nuccitelli, R. (1984). American Journal of Physiology 246, R409. Carafoli, E. and Penniston, J. T. (1985). ScienriJic American 253, 50. Cleary, A., Youatt, J. and OBrien, T. P. (1986). Australian Journal of Biological Science 39, 241. Cooper, M. and Schliwa, M. (1985). Journal of Neuroscience Research 13, 223. Cooper, M. and Schliwa. M. (1986). In “Ionic Currents in Development” (R. Nuccitelli, ed.), pp. 311-318. Alan R. Liss, New York. Cone, R. D. and Bonner, J. T. (1980). Experimenral Cell Research 128,479. Dazy. A. C., Borghi, H., Garcia, E. and Puiseux-Dao, S. (1986). In “Ionic Currents in Development” (R. Nuccitelli, ed.), pp. 123-130. Alan R. Liss, New York. De Loof. A. (1983). Comparative Biochemisrry and Physiology 74A, 3. De Vries, S. C, and Wessels, J. G . H. (1982). Experimenral Mycology 6. 95. Dorn, A. and Weisenseel, M. H. (1982). Protoplasma 113, 89. Dorn, A. and Weisenseel, M. H. (1984). Journal of Experimental Botany 35, 373. Eckert, R. (1972). Science 176. 473. Eddy, A. A. (1982). Advances in Microbial Physiology 23, 1. Evans, T. C., Hennessey, T. and Nelson, D. L. (1987). Journal of Membrane Biology 98, 275. Frankel, J. (1984). In “Pattern Formation. A Primer in Developmental Biology” (G. M. Malacinski and S. V. Bryant, eds). pp. 163-196. Macmillan, London. Freeman, J. A., Manis, P. B., Snipes, G. J., Mayes, B. N., Samson, P. C., Wikswo. J. P. and Freeman, D. 0. (1985). Journal of Neuroscience Research 13, 257. Galpin, M. F. J. and Jennings, D. H. (1975). Transac/ionsof rhe Brirish M,yrologiral Sociery 65,477. Galpin, M. F. J., Jennings, D. H., Oates. K. and Hobot, J. (1978). Experimental M.vcology 2, 258. Gilkey, J. C. and Jaffe, L. F. (1976). Biophysical Journal 516, 1 IOa. Gooday, G. W. (1983). In “Fungal Differentiation: A Contemporary Synthesis” (J. E. Smith, ed.), pp. 315-356. Marcel Dekker, New York. Goodwin, B. C. (1980).In “The Eukaryotic Microbial Cell” (G. W. Gooday, D. Lloyd and A. P. J. Trinci, eds), pp. 377404. Cambridge University Press, Cambridge. Goodwin, B. C. and Pateromichelakis, S. (1979). Planiu 145, 427. Goodwin, B. C., Briere, C. and OShea. P. S. (1987). In “Spatial Organisation in Eukaryotic Microbes” (R. K. Poole and A. P. J. Trinci, eds), pp. 1-9. IRL Press, Oxford. Cow, N. A. R. (1984). Journal ofGeneral Microbiology 130, 3313. Cow, N. A. R. (1987). In “Spatial Organisation in Eukaryotic Microbes” (R. K. Poole and A. P. J. Trinci, eds), pp. 2 5 4 1 . IRL Press, Oxford. Cow, N. A. R. (1989a). Curreni Topics in Medical Mycology 3, 109. Gow, N. A. R. (1989b). Biological Bulletin 1765, 31.
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
121
Gow, N. A. R. and Gooday, G. W. (1987). Journal of General Microbiology 133, 3531. Gow, N. A. R., Kropf, D. L. and Harold, F. M. (1984). Journal of General Microbiology 130,2967. Gunderson, J . H., Elwood, H., Ingold, A., Kindle, K. and Sogin, M. ( I 987). Proceedings of the National Academy of Sciences of the United States of America 84, 5823. Hader, H. P. (1978). Archives of Microbiology 119,75. Hahnert, W.F. (1932). Physiological Zoology 5, 491. Harold, F. M. (1986). “The Vital Force”. Freeman, New York. Harold, R. L. and Harold, F. M. (1980). Journal of Bacteriology 144, 1259. Harold, R. L. and Harold, F. M. (1986). Journal of General Microbiology 132, 213. Harold, F. M. and Van Brunt, J. (1977). Science 197, 372. Harold, F. M., Kropf, D. L. and Caldwell, J. H. (1985a). Experimental Mycology 9, 183. Harold, F. M.. Schreurs, W. J., Harold, R. L. and Caldwell, J. H. (1985b).Microbio1ogicalScience.s 2, 363. Horwitz. B. A., Weisenseel, M. H., Dorn, A. and Gressel, J. (1984). Plant Physiology 74, 912. Jaffe, L. F. (1966).Proceedings of the National Academy of Sciences of the Unired Stares of America 56, 1102. Jaffe, L. F. (1969). Developmenral Biology, Supplement 3, 83. Jaffe, L. F. (1977). Nature 265, 600. Jaffe, L. F. (1981). Philosophical Transactions of the Royal Society of London B295, 553. Jaffe, L. F. (1985). Trends in Neurosciences 8, 51 7. Jaffe, L. F. and Nuccitelli, R. (1974). Journal sf Cell Biology 63,614. Jaffe, L. F. and Walsby, A. E. (1985). Biological Bulletin 168, 476. Jaffe, L. F., Robinson, K. R. and Nuccitelli, R. (1974).Annals Sf the New York Academy of Sciences 238,272. Jaffe, L. F., Robinson, K. R. and Nuccitelli, R. (1975). In “Cellular Adhesion and Pattern Formation” (D. McMahon and D. F. Fox, eds), pp. 135-147. W. A. Benjamin, London. Jennings, D. H. (1986). In “Plasticity in Plants” (D. H. Jennings and A. J. Trewavas, eds), pp. 329-346. Symposia of the Society for Experimental Biology, vol. XXXX. Pindar, Cambridge. Josefsson, J. 0. (1966). Acta Physiologia Scandinavica 66, 395. Kataoka, H. and Weisenseel, M. H. (1988). Planta 173,490. Kiermayer. 0.(1970a). Annals of the New York Academy ofScience.7 175, 686. Kiermayer, 0.(1970b). Protoplasma 69, 97. Kropf, D. L. (1986). Journal of Cell Biology 102, 1209. Kropf, D.L. (1989). Biological Bulletin 1765,5. Kropf, D.L. and Harold, F. M. (1982). Journal q/ Bacteriology 151,429. Kropf, D. L. and Quatrano, R. S. (1987). Planta 171, 158. Kropf, D. L.. Lupa, M. D., Caldwell, J. H. and Harold, F. M. (1983). Science 220, 1385. Kropf, D.L., Caldwell, J. H., Gow, N. A. R. and Harold, F. M. (1984).Journal sf Cell Biology 99, 486. Lacalli, T. C. (1975). Journal of Embryology and Experimental Morphology 33, 95. Lucas, W. J. ( 1 979). Plant Physiology 63, 248. Lucas. W.J. and Nuccitelli, R. (1980). Planta 150, 120. Lucas, W.J. and Smith, F. A. (1973). Journal of Experimental Botany 24, 1. Lucas, W. J., Keifer, D. W. and Sanders, D. ( I 983). Journal of Membrane Biology 73, 263. Lund, E.J. (1923). Botanical Gazette 76, 288. Luther, P. W., Peng, H. B. and Lin, J. J . 4 . (1983). Nature 303, 61. Maeda, Y. and Maeda, M. (1973). Experimental Cell Research 82, 125. Manavathu, E. K. and Thomas, D. D. S. (1985). Journal of General Microbiology 131, 71. Meindl, U.( I 982). Protoplasma 110, 143. McGillivray, A. M. and Cow, N. A. R. (1986). Journal of General Microbiology 132, 2515. McGillivray, A. M. and Cow, N. A. R. (1987). Journal of General Microbiology 133, 2875. McKerracher, L. J. and Heath, I. B. (1986). Cell Motility and the Cytoskeleron 6, 136. McKerracher, L. J. and Heath, 1. B. (1987). Experimental Mycology 11, 79. McCloskey, M. A,, Liu, Z.-Y. and Poo, M.-M. (1984). Journal of Cell Biology 99, 778. McNally, J. G., Cowan, J. D. and Swift, H. (1983). Developmental Biology 97, 137. Money, N. P. and Brownlee, C. (1987). Proroplasma 136, 199.
122
N. A. R. COW
Musgrave, A.. Ero, L., Scheffer, R. and Oehlers, E. (1977).Journalof GenerdMicrobiology 101.65. Munz, A. and Dittmann, F. (1987). Roux’s Archives of Developmental Biology 196, 391. Nawata, T. (1984). Plant and Cell Physiology 25, 1089. Nawata, T. and Sibaoka, T. (1987). Protoplasma 137, 125. Nuccitelli, R. (1978). Developmenral Biology 62, 13. Nuccitelli, R. (1983). Modern Cell Biology 2, 451. Nuccitelli, R. (1984). In “Pattern Formation. A Primer in Developmental Biology” (G. M. Malacinski and S. V. Bryant, eds), pp. 22-46. Macmillan, London. Nuccitelli, R. (1986).I n “Ionic Currents in Development” (R. Nuccitelli, ed.), pp. 13-20. Alan R. Liss, New York. Nuccitelli. R. and Jaffe, L. F. (1974).Proceedings ufthe National Academy ofsciences of the Unired Srates qf America 71, 4855. Nuccitelli, R. and Jaffe, L. F. ( I 976). Developmenral Biology 49, 51 8. Nuccitelli, R., Poo, M.-M. and Jaffe, M. H. (1977). Journal of General Physiology 69, 743. Onuma. E. K. and Hui, S.-W. (1985). Cell Calcium 6, 281. Onuma, E. K. and Hui, S.-W. (1988).Journal qf Cell Biology 106, 2067. Patel, N. B. and Poo, M.-M. (1984).Journal uf Neurosciences 4, 2939. Peng, H. B. and Jaffe. L. F. (1976). Developmenral Biology 53, 277. Poo, M.-M. (198I ) . Annual Review qf Biophysics and Bioengineering 10, 245. Reiss. H. D. and Herth, W. (1979). Planta 146, 615. Reissig, J. L. and Kinney, S. G. (1983). Journal qf Bacreriology 146, 615. Robinson, K. R. (1985).Journal of Cell Biology 101, 2023. Robinson, K. R. and Cone, R. (1980). Science 207, 77. Robinson, K. R. and Jaffe, L. F. (1973). Developmenral Biology 35, 349. Robinson, K . R. and Jaffe, L. F. (1975). Science 187, 70. Saddler, H. D. N. (1970).Journal qf General Physiokogy 55, 802. Sandakhchiev, L. S.. Puchkova, L. I., Pikalova, A. V., Kristobulova, N. B. and Kiseleva, E. V. (1972). In “Biology and Radiobiology of Anucleate Systems. 11. Plant Cells” (S. Bonotto, Maisin, eds), pp. 297-323. Academic Press, New York. R. Goutier, R. Kirchman and J.-R. Scarborough, G. A. (1970). Journal qf’ Biuhgical Chemistry 245, 1694. Scheffey, C. (1988). Revieu of Scientific Insrrumenrs 59, 787. Schmid, J. and Harold, F. M. (1988). Journal ofGeneral Microbiology 134, 2623. Schreurs, W. J. A. and Harold, F. M. (1988).Proceedings of the National Academy qfScirncTsofrhe United States qf America 85, 1534. Slayman, C. L. (1965a).Journal of General Physiology 49, 69. Slayman, C. L. (l965b). Journal qf General Pliysiolugy 49, 93. Slayman, C. L. and Slayman, C. W. (1962). Science 136, 876. Slayman. C. L. and Slayman, C. W. (1974). Proceedings qfrhe Nulional Academy qfScienws tJfthe Unired Srares v/’ America 71, 1935. Slayman, C. L., Long, W. S. and Lu, C. Y.-H. (1973).Journal qf Membrane Biology 14, 305. Speksnijder, J. E.. Weisenseel, M. H., Chen, T.-H. and Jaffe, L. F. (1989). Biological Bulletin 1765, 9. Stump. R. F., Robinson, K. R., Harold, R. L. and Harold. F. M. ( 1 980). Proceedings u f h Narional Academy qf Sciences of the United Stares qf America 17, 6673. Taiz. L., Metrdux, J. P.and Richmond, P: A. (1981). Cell Biology Monographs 8, 231. Takeuchi, Y., Schmid, J., Caldwell, J. H. and Harold, F. M. (1988).JournalqfMembrane Biology 101, 33. Thiel, R.. Schreurs, W. J. A. and Harold, F. M. (1988).Journal CfGeneral Microbiology 134. 1089. Trinci, A. P. J. (1979).I n “Fungal Walls and Hyphal Growth” (J. H. Burnett and A. P. J. Trinci, eds), pp. 3 19-358. Cambridge University Press, Cambridge. Troxell, C. L., Scheffey,C. and Pickett-Heaps, J. D. (1986).In “Ionic Currents in Development” (R. Nuccitelli, ed.), pp. 105-1 12. Alan R. Liss, New York. Troxell, C. L. (1989). Biological Bulletin, 1765, 36. Turian, G. (1983). Botunica Helverica 93, 27. Van Brunt, J., Caldwell, J. H. and Harold, F. M. (1982).Journal ofBacieriology 150, 1449. Van Laere, A. (1988). FEMS Microbiology Letters 49, 111.
CIRCULATING IONIC CURRENTS IN MICRO-ORGANISMS
123
Waaland, S. D. and Lucas, W. J. (1984). Protoplasma 123, 184. Walker, N. A. (1980). In “Plant Membrane Transport: Current Conceptual Issues” (R. M. Spanswick, W. J. Lucas and J. Dainty, eds), pp. 287-300. Elsevier, Amsterdam. Walker, N. A. and Smith, F. A. (1977). Journal of Experimental Botany 28, 1190. Weisenseel, M. H., Nuccitelli, R. and Jaffe, L. F. (1975). Journal of Cell Biology 58, 172. Whitaker, D. M. and Berg, W. E. (1944). Biological Bulletin 86, 125. Williamson, R. E. (1984). Plant, Cell and Environment 7 , 431. Woodruff, R. 1. and Telfer, W. H. (1980) Nature 286, 84. Youatt, J.. Cow, N. A. R. and Gooday, G. W. (1988). Protoplasma 146, 118.
This Page Intentionally Left Blank
Autotrophic Nitrification in Bacteria J . I . PROSSER Department of Genetics and Microbiology. Marischal College. University of Aherdeen. Aherdeen AB9 IAS. U.K. 1. Introduction . . . . . . . . . . . . I1 . Ecological and economic importance of nitrification . . Ill . Taxonomy and species diversity . . . . . . . A. Ammonia oxidizers . . . . . . . . . B. Nitrite oxidizers . . . . . . . . . . IV . Biochemistry of nitrifying bacteria . . . . . . . A. Ammonia oxidation . . . . . . . . . B. Nitrite oxidation . . . . . . . . . . C. Carbon metabolism . . . . . . . . . V . Growth of nitrifying bacteria in liquid culture . . . . A. Maximum specific growth rate . . . . . . B. Growth yield . . . . . . . . . . . C. Cell activity . . . . . . . . . . . D. Saturation constants . . . . . . . . . E. Problems of biomass production . . . . . . v1. Surface growth . . . . . . . . . . . . VII . The effect of oxygen and light on nitrification . . . . A. Inhibition of nitrification at high oxygen concentration B. Photo-inhibition . . . . . . . . . . C. Nitrification at low oxygen concentrations . . . D . Reduction of nitrite and nitrate by nitrifying bacteria . VIII . The effect of pH value on nitrification . . . . . . A. Do acidophilic strains of nitrifying bacteria exist? . . B. Protection from effects of pH by surface growth . . C. Micro-environments and urease activity . . . . D. Heterotrophic nitrification . . . . . . . IX. Inhibition of nitrification . . . . . . . . . A. Mechanism of inhibition . . . . . . . . B. Strain variability . . . . . . . . . . C. Inhibition of attached cells . . . . . . . X . Concluding remarks . . . . . . . . . . XI . Acknowledgements . . . . . . . . . . . References . . . . . . . . . . . . .
.
.
.
.
. .
. .
. .
. .
.
.
.
.
.
.
.
.
. . . . .
.
.
.
. .
. .
. .
. .
.
.
.
.
.
.
.
.
. . . .
. . . .
. . . . . . . . .
. . . . . . . . .
. . . . . . . . .
. . . . . . . . .
. . . . . . .
. . .
. . .
. . .
. .
. .
. .
. .
.
.
.
. . . . . . .
. . .
.
. .
.
.
. .
125 126 128 128 129 129 130 133 133 136 137 139 142 143 146 146 148 148 149 150 152 157 160 161 164 166 169 170 171 174 175 177 177
.
I Introduction Nitrification is traditionally viewed as the oxidation of ammonia to nitrate. via nitrite. by two groups of chemolithotrophic bacteria. ammonia oxidizers. ADVANCES IN MICROBIAL PHYSIOLOGY. VOL. 30 ISBN 0-12-027730-1
.
Copyright 0 1989 by Academic Press Limited All nghts of reproduction in m y form reserved
126
J LPROSSER
typified by the genus Nitrosomonus, and nitrite oxidizers, typified by the genus Nitrohacter. Oxidation of ammonia or nitrite provides the only source of energy for these organisms and organic carbon is obtained by fixation of carbon dioxide. Nitrifying bacteria, and the process of nitrification, are aerobic with optimal activity at mesophilic temperatures and neutral to alkaline pH values, with no growth or activity at acid pH values. Growth of these organisms is considered inefficient in comparison to that of heterotrophs and they have low specific growth rates and growth yields due to the small energy gain obtained from oxidation of ammonia or nitrite. Frequently, advances in a particular field lead to the formulation of unifying hypotheses or theories explaining contradictory experimental findings or conflicting views, and in that sense simplify our view of that field. To an extent, recent advances in our knowledge of the physiology of nitrifying bacteria have achieved this by explaining many poorly understood aspects of nitrification. They have also led to the discovery of many new and interesting properties of these organisms which demonstrate a greatly increased metabolic versatility. In a sense these findings produce a more complex situation which challenges our perception of nitrifying bacteria and their riile within the nitrogen cycle. The traditional view stated above, therefore, must be considered at best simplistic. The majority of these advances have arisen at the interface between microbial physiology and ecology. The driving force for much of the work discussed in this article has been the desire to explain aspects of nitrification in natural environments in terms of the biochemistry and physiology of the organisms responsible. While the essential r61e of physiology in microbial ecology is now widely recognized, nitrification provides a situation where ecological observations have stimulated physiological studies, leading to the discovery of new and important properties of nitrifying bacteria. This article will, therefore, consider several aspects of the physiology of nitrifiers of relevance to their growth and activity in natural environments. After describing the basic features of the biochemistry of ammonia and nitrite oxidation, the factors limiting growth and activity of these organisms will be discussed. The influence of oxygen concentration, pH value and inhibitors on their physiology will then be considered, and throughout these discussions additional effects due to surface growth will be considered. 11. Ecological and Economic Importance of Nitrification Nitrification plays a central r6Ie in the nitrogen cycle of terrestrial and aquatic ecosystems, converting the most reduced form of nitrogen, NH,, to the most oxidized form, NO;. Ammonia is produced naturally through mineralization
AUTOTROPHIC NITRIFICATION IN BACTERIA
127
of organic matter and is also supplied to agricultural systems directly, as inorganic ammonium, e.g. ammonium nitrate, or indirectly, as urea and other ammonium-based fertilizers. In marine environments ammonium is present at concentrations less than 0.01 pg NH: - N ml-l, in other aquatic systems and in unfertilized soil at concentrations in the order of 1-1Opg ml-', with concentrations rising to 50 pg ml- in areas of intensive agriculture with high inputs of ammonium fertilizer. In sewage treatment systems, concentrations of ammonia are similar to those in soil but some industrial effluents give rise to concentrations up to 1000pg NH: - N ml- ' (i.e. about 70 mM). Nitrification of fertilizer nitrogen in agricultural systems is considered detrimental. While the anionic NH; is bound to cationic components of the soil, the product of nitrification, NO;, is much more mobile and is readily lost through leaching. Losses may also occur through denitrification of nitrate. Leaching can lead to eutrophication of run-off waters and nitrate pollution of ground-waters. Concern regarding the latter arises from the production of nitrosamines from nitrite, following consumption of nitrate in drinking water, and also the occurrence of methaemoglobinaemia in infants and young animals. Regulations regarding nitrate in drinking waters have consequently been strengthened and there is renewed interest in the application of nitrification inhibitors along with ammonium-based fertilizers. Nitrification is a necessary component of sewage treatment processes where large amounts of ammonia are produced through decomposition of organic material. Nitrification prevents discharge of toxic levels of ammonia into receiving waters, which may cause death of fish populations and may lead to eutrophication. The latter may also be caused by nitrate, and complete removal of nitrogen is achieved by processes involving both nitrification and denitrification. The low specific growth rates of nitrifying bacteria limit the rate at which material can pass through suspended growth systems, e.g. the activated sludge process. Faster through-put is possible using fixed film systems, e.g. rotating biological contactors and trickling filters. In aquatic environments, the major pool of inorganic nitrogen is nitrate, formed through nitrification of ammonia released by mineralization. Concentrations of ammonia available to freely suspended cells within the water column are low, but cells associated with decomposing organic matter, either suspended or in sediments, will receive higher concentrations. Nitrate acts as a substrate for denitrification which, together with nitrification, leads to production of nitric and nitrous oxides. The production of these gases is currently causing great concern with regard to their effects on atmospheric chemistry, in particular on the ozone layer and on acid rain. Recently, attention has also been directed to the r61e of nitrification in corrosion of cement and natural stones. Kaltwasser (1976) and Wasserbauer et al. (1988)
128
I. 1. PROSSER
demonstrated the involvement of nitrifying bacteria in production of nitrous acid, leading to disintegration of asbestos cement. Nitrifying bacteria have also been isolated from sandstone bridges and historical monuments at a number of sites (Bock et al., 1988; Wolters et al., 1988; Meincke et al., 1988) and are frequently the major component of the microbial population isolated from these environments. These organisms grow and survive in pores within the sandstone and oxidize ammonia scavenged from the atmosphere. 111. Taxonomy and Species Diversity
Ammonia and nitrite oxidizers constitute the family Nitrobacteraceae. This family is designated solely on physiological properties, i.e. the use of ammonia or nitrite oxidation as an energy source and fixation of carbon dioxide for organic carbon (Watson, 1974). All members are Gram-negative but exhibit a wide range of morphologies, with regard to cell shape and arrangement of intracytoplasmic membranes. These features form the basis for classification within the family. Nitrifying bacteria, therefore, probably arose from a number of unrelated strains developing independently the ability to use ammonia or nitrite as an energy source. Full descriptions of all genera and strains are given by Watson (1974), Watson et al. (1981) and Bock et al. (1986). A. AMMONIA OXIDIZERS
Ammonia oxidizers are placed in five genera on the basis of cell shape, which is reflected in their names: Nitrosomonas, Nitrosococcus, Nitrosospira, Nitrosolobus and Nitrosovibrio. The most extensively studied ammonia oxidizer is Nitrosomonas europaea, which is the only species recognized within this group. Recent analysis of per cent guanine plus cytosine (%(G+ C)) values (Koops and Harms, 1985) and DNA:DNA hybridization studies (Bock et al., 1986) suggest the existence of seven new species, some of which are correlated with environments from which isolates were obtained. Most physiological studies have been carried out using N. europaea, which is the most frequently isolated strain. This appears to result from its preference for growth conditions associated with typical batch isolation procedures and there is increasing evidence of dominance by other genera in particular environments. Nitrosolobus species are the most common ammonia oxidizers in soil (Macdonald, 1986), Nitrosospira species dominate in acid soils (see Section VII1.A) and Nitrosococcus species are important in marine environments. In addition, significant qualitative and quantitative physiological differences exist between strains and genera. While the knowledge of the properties of N . europaea argue for its continued use in fundamental
AUTOTROPHIC NITRIFICATION IN BACTERIA
129
investigations into the biochemistry of ammonia oxidation, full realization of the metabolic potential and diversity of ammonia oxidizers requires more detailed study of other genera. B. NITRITE OXIDIZERS
There are four genera of nitrite oxidizers, Nitrobacter, Nitrococcus, Nitrospira and Nitrospina, determined, as with ammonia oxidizers, by cell shape and ultrastructure. Only the genus Nitrobacter has been subjected to detailed taxonomic and physiological studies. It contains three species, N. winogradskyi, N. hamburgensis and a third species distinguished on the basis of %(G + C ) values and DNA hybridization studies (Bock et al., 1986).Analysis of cytochromes from the genera Nitrosomonas and Nitrobacter suggests they are distantly related (Wood, 1986)and N . agilis appears most closely related to Rhodopseudomonas viridis. Both organisms possess complex intracytoplasmic membrane systems suggesting a common evolutionary background. One reason for concentration of studies on the genus Nitrobacter is the inability to isolate members of other genera from soil. The genera Nitrococcus, Nitrospira and Nitrospina are generally restricted to marine environments and grow optimally at high salt concentrations. One exception is a Nitrospira strain isolated from soil (Bock et al., 1986). The application of modern taxonomic techniques to nitrifying bacteria is hampered, as in physiological studies, by difficulties in obtaining sufficient biomass for analysis. Despite this, %(G + C ) values, DNA hybridization and RNA sequence analyses are yielding important information. Nitrobacteraceae is now considered to contain at least three groups: Nitrobacter, ammonia oxidizers and Nitrococcus (Woese et al., 1984a,b, 1985). The extension of such studies to a wider range of nitrifier strains will permit a more complete understanding of the interrelationships between nitrifiers and of their evolutionary origin. Molecular biological studies should also increase our knowledge of the extent and significance of species diversity within natural populations of nitrifying bacteria through the application of modern, molecular based, detection techniques.
IV. Biochemistry of Nitrifying Bacteria Wood (1986, 1987, 1988)has recently reviewed the biochemistry of ammonia oxidation while Bock et al. (1986) and Wood (1986, 1988) provide comprehensive reviews of nitrite oxidation. Here I will discuss the basic features of the biochemistry of nitrifying bacteria and readers are referred to these reviews for detailed references. Certain aspects of their biochemistry will also be discussed in later sections where appropriate.
130
J. I . PROSSER
A. AMMONIA OXIDATION
The first stage in ammonia oxidation is its endergonic conversion to hydroxylamine (AGO = + 17 kJ mol-I). This reaction is carried out by a membrane-bound ammonia mono-oxygenase for which the substrate is ammonia (NH,) rather than ammonium ions (NH:) (Suzuki et al., 1974).The reaction requires oxygen, supplied as molecular oxygen, and a source of reducing power. Wood suggests that the mono-oxygenase accepts electrons from the ubiquinone-cytochrome b region of the electron-transport chain. The reaction may therefore be represented by the equation: NH,
+ 0, + 2H+ + 2e- + NH,OH + H,O
Ammonia mono-oxygenase has a broad specificity and appears capable of oxidizing a number of low-molecular-weight organic compounds including propene, benzene, cyclohexane, phenol and methanol. Attempts to isolate ammonium mono-oxygenase in soluble form have failed. The enzyme is irreversibly inhibited by acetylene (Hynes and Knowles, 1978), which it attempts to oxidize but which acts as a “suicide” substrate (Hyman and Wood, 1985). Incubation with radiolabelled acetylene allows identification of the enzyme by SDS-PAGE, which indicates a molecular weight of 28,000 Da. Of particular interest is the similarity between ammonia mono-oxygenase and the membrane-bound (but not the soluble) methane mono-oxygenase found in methane-oxidizing bacteria. Both enzymes are associated with intracytoplasmic membrane systems and both have common inhibitors and substrates, although the methane mono-oxygenase is unable to hydroxylate aromatic compounds. Methanotrophs are capable of oxidizing ammonia, but at a much lower rate than Nitrosomonas species, and methanotrophs will not grow with ammonia as the sole energy source. Similarly, oxidation of methane by Nitrosomonas species is much slower than by methanotrophs and does not affect its growth. Ward (1987) carried out comparative studies of ammonium and methane oxidation by the marine nitrifier Nitrosococcus oceanus. Inhibition of ammonia oxidation by methane was not simple competitive inhibition (Fig. 1) and suggested multiple active sites for ammonia, each behaving independently. The enzyme had similar affinities for both substrates, whereas in N. europaea the affinity for ammonia was much greater than for methane. Importantly, radiolabelled methane and methanol were incorporated into cell material in the presence of ammonia at levels at which nitrification was not inhibited. Cells, therefore, apparently possess two parallel pathways for methane and ammonia oxidation, which share a common initial enzyme and similar capabilities for oxidation of methane and ammonia. Ward (1986) notes the apparent difficulty in isolating methanotrophs from
AUTOTROPHlC NITRIFICATION IN BACTERIA
131
I/[S] (pM NH,)-'
FIG. 1. a, Oxidation of ammonia by Nitrosomonasoceanus and inhibition by methane. inhibition by methane. b, Lineweaver-Burk plot of data in part a. Key: A,control; 0, From Ward (1987) with permission.
such ecosystems, and suggests that Nitrosococcus strains may fulfil a dual r81e in marine environments, oxidizing whichever substrate is available. Apart from this possibility, oxidation by ammonia oxidizers of organic compounds appears to be fortuitous and has no known ecological r8le. Hydroxylamine is oxidized to nitrite, via uncharacterized intermediates, by the soluble enzyme hydroxylamine oxidoreductase, which has a complex
132
J. 1. PROSSER
1
,teversed
,’electron f l o w
,,
J monooxygenase NH20H, H ,)I
periplasm
1
cytoplasmic membrane
cytoplasm
FIG. 2. Proposed scheme for electron transport in the genus Nitrosomonus. From Wood (1986) with permission.
structure and probably resides in the periplasm. This reaction generates energy (AGO’= + 60mV) and receives oxygen from water. A scheme for electron transport in Nitrosomonas species is presented in Fig. 2 and involves a normal electron-transport chain, with electrons fed in from hydroxylamine oxidoreductase at a point close to ubiquinone. Oxidation of hydroxylamine releases four electrons: NH,OH
+ H,O + NO; + 5H+ + 4e-
Two of these electrons are required for the ammonia mono-oxygenase while the remaining two pass down the electron-transport chain generating a proton motive force. Consequently, the respiratory chain is branched with ammonia mono-oxygenase and the terminal oxidase competing for electrons. Two mechanisms have been proposed for the control of electron flow. Hooper and Terry (1973) observed stimulation of added hydroxylamine in the presence of uncouplers but inhibition of ammonia oxidation. This suggests that electron flow to the terminal oxidase may be restrained by the proton motive force. The second control mechanism involves hydroxylamine which inhibits ammonia mono-oxygenase. This provides a feed-back inhibition mechanism, with establishment of a low steady state hydroxylamine concentration following the onset of ammonium oxidation. Wood (1986) considered H+/O ratios, which are 3.9 and 2.7 for hydroxylamine and ammonium ions, respectively.
AUTOTROPHIC NITRIFICATION IN BACTERIA
133
Analysis of stoichiometries implies that the branches to ammonia monooxygenase and the terminal oxidase are equally efficient, which he suggests is not indicated by the action of uncouplers. B. NITRITE OXIDATION
Nitrite oxidation is carried out by the soluble enzyme nitrite oxidoreductase with oxygen supplied by water: NO;
+ H,O 4NO; + 2H+ + 2e-
Nitrite oxidoreductase has been purified by Tanka et al. (1983) and Sundermeyer-Klinger et al. (1984) using different extraction techniques which are discussed by Bock et al. (1986). The enzyme is reversible, carrying out nitrate reduction, the significance of which is discussed in Section V1I.D. Coupling of nitrite oxidation to the generation of a proton motive force is theoretically possible but the detailed mechanism has yet to be elucidated. Wood (1986) discusses the experimental evidence for mechanisms of energy generation by nitrite oxidation and proposes the scheme illustrated in Fig. 3. Bock et al. (1986) propose a more complex electron-transport system for Nitrobacter hamburgensis, with two linked respiratory chains, one for lithoautotrophic growth and the other for heterotrophic growth. C. CARBON METABOLISM
1. Fixation of Carbon Dioxide The major source of organic carbon for nitrifying bacteria is carbon dioxide which is fixed via the Calvin cycle. Some, but not all, nitrifiers contain carboxysomes (see Bock et al., 1986) which are associated with ribulose 1,5bisphosphate carboxylase oxygenase (RuBisCO). In some strains only soluble RuBisCO is found, while others have both soluble and carboxysome-bound RuBisCO. In N . hamburgensis two different genes and gene products have been identified for RuBisCO, one residing on the chromosome and the other on a plasmid. The energy obtained from oxidizing ammonia or nitrite is very low. The NO;/NH: redox potential is + 340 mV and that for the NO;/NO; couple is +430mV. This potential is vastly more positive than the NAD+/NADH couple and, indeed, ammonia and nitrite are at the limits for provision of energy for growth. As a consequence, NAD must be reduced by energy-driven reversed electron flow; Zcyt. c(Fe2') + NAD+ + (N)H,,+", + 2cyt .c(Fe3+)+ NADH + ( N - l)H!;
Much of the limited amount of energy generated by ammonia and nitrite
134
J. I. PROSSER
peri plasm
.. .
cytoplasmic membrane
.... .:-
.
cyt opl as m
..
0
yn H+
0
\
,
.
0
NY HP
?e-
0
4
hversed , electron f l o w
cytochrome c-556
a NAD+
\nitrite oxidoreductase
di
2 H+s,
\
\\\\
’cyt oc hrome
oxidase
to
\ \
4‘
H+
FIG. 3. Proposed scheme for energy conservation in the genus Nitrobaclrr. From Wood (1986) with permission.
oxidation is therefore used to generate reducing power, for which carbon dioxide fixation imposes a high requirement. On thermodynamic grounds, Kelly (1978) estimates that 80% of energy generated by autotrophs is used to fix carbon dioxide. Glover (1 985) determined thermodynamic efficiencies for growth of ammonia oxidizers and nitrite oxidizers in the range 4.421.3%. The consequences of this for growth of both organisms will be discussed in Section V.
AUTOTROPHIC NITRIFICATION IN BACTERIA
135
2. Assimilation of Organic Compounds by Ammonia Oxidizers Ammonia oxidizers are capable of assimilating organic compounds with varying effects on growth. Clark and Schmidt (1967a,b) demonstrated uptake and incorporation of 14 amino acids by N. europaea. While some amino acids had no effect on growth, others either inhibited or stimulated growth by effecting the length of the lag phase and the final nitrite concentration. There was no obvious correlation between such effects and the extent of amino-acid uptake. Rates of incorporation were much less than those of heterotrophs but were greater in the presence of ammonium. Krummel and Harms (1982) investigated growth of a variety of ammonia oxidizers in the presence of formate, acetate, pyruvate, glucose and peptone. Again results were variable. Growth of Nitrosomonas strains was not affected while Nitrosococcus oceanus was inhibited by all five compounds. Formate and acetate inhibited growth of Nitrosococcus mobilis but stimulated one Nitrosospira strain and had little effect on a second Nitrosospira strain. Nitrosouibrio tenuis was stimulated by formate and glucose, but inhibited by acetate and pyruvate. Mixotrophic growth increased yield, measured as biomass formed per unit ammonium converted. Heterotrophic growth of ammonia oxidizers (i.e. use of organic compounds for both carbon and energy) has never been observed despite incubations for 23 months in organic media (Krummel and Harms, 1982). The variability described above, both with regard to species diversity and responses to different compounds, explains the variable effects of heterotrophic contaminants on ammonia oxidizers. Clark and Schmidt (1966) found that stimulation of growth of N. europaea in the presence of a heterotroph could be reproduced by supplying pyruvate, which had little effect on exponentially growing cells but accelerated recovery of old cultures. The heterotroph did not grow and stimulation of ammonia oxidation was believed to result from assimilation of the products ofcell lysis. Jones and Hood (1980), however, report a mutualistic interaction between a Nitrosomonas species, a Pseudomonas species and Nocardia atlantica isolated from an estuarine environment. Ammonium oxidation was increased by 150% and growth of the heterotrophs by a factor of 10, but the precise nature of the interaction is unknown. Other interactions in mixed culture are discussed by Kuenen and Gottschal (1 982). 3. Heterotrophic Growth of Nitrite Oxidizers
The situation for nitrite oxidizers is different. Heterotrophic growth on acetate, casein hydrolysate, glycerol or pyruvate has been demonstrated in Nitrobacter agilis (Smith and Hoare, 1968; Bock, 1976) and Nitrobacter
136
J. 1. PROSSER
winogradskyi (Kalthoff et al., 1979). Mixotrophic growth stimulates both maximum specific growth rate and cell yield. Steinmuller and Bock (1976) obtained stimulation of growth of several Nitrobacter strains supplied with culture filtrates of a number of heterotrophs grown in yeast extract-peptone solution. Nitrite oxidation rate was increased by as much as 200% and biomass yield by a maximum of 48%. Growth also continued after exhaustion of nitrate, with a 30% increase in biomass concentration. The mechanism of stimulation is not known, and may involve removal of inhibitory compounds by the heterotroph, but its presence and extent varied with both the strain of Nitrobacter and the heterotroph. Heterotrophic growth of Nitrobacter species is slower than that of other heterotrophs and slower than growth on nitrite. Bock (1976) reported a minimum generation time of 65 hours for N . agilis growing on pyruvate, which also gave greater yields than acetate and formate. N. winogradskyi had generation times of 70 and 96 hours on pyruvate and acetate, respectively. (Kalthoff et al., 1979). Heterotrophic growth also leads to differences in cellwall antigenic structure and to larger cells of irregular morphology. Heterotrophically grown cells possess lower levels of nitrite oxidoreductase (Steinmuller and Bock, 1977), requiring up to 3-4 weeks induction before regaining the ability to grow autotrophically (Bock, 1976). Kirstein et al. (1986)demonstrated heterotrophic growth of a third strain, N. hamburgensis and noted differences in b-type cytochromes between autotrophically and heterotrophically grown cells. The former possessed cytochrome hSh2- 564 while the latter contained a cytochrome b which absorbed in the 558-560 nm region. Further differences in cytochromes are discussed by Bock rt al. (1986)and led to the proposition that N. hamburgensis possesses two respiratory chains, one for autotrophic and one for heterotrophic growth. Certain cytochromes are components of both chains, although their levels may vary with growth conditions. The presence of others depends on whether growth is autotrophic or heterotrophic.
V. Growth of Nitrifying Bacteria in Liquid Culture Nitrifying bacteria are typically cultivated in defined inorganic mineral salts media containing ammonium or nitrite. Representative media for both ammonia and nitrite oxidizers are listed in Watson et al. (1981). Growth in batch culture is most readily assessed by following rates of substrate (ammonia or nitrite) utilization or product (nitrite or nitrate) formation. Ammonia concentrations in the order of 50-2000 pg NH: - N ml (3-140m~)and 5G200pg NO; - N m l - ' ( 3 - 1 0 m ~ )are typical. Ammonia oxidizers are routinely cultured in weakly buffered media containing phenol
AUTOTROPHIC NITRIFICATION IN BACTERIA
137
red as a pH-value indicator. Qualitative assessment of growth is then achieved through a colour change resulting from reduction in pH value through production of nitrous acid. Acid is neutralized by addition of sodium carbonate or sodium hydroxide, the former providing a source of carbon dioxide which is otherwise supplied by aeration. Cultures are generally incubated aerobically with shaking, but high concentrations of oxygen can be inhibitory (see Section VILA). Estimation of biomass by absorbance techniques is not normally possible due to the low cell concentrations and biomass densities involved. Cell concentrations generally increase from approximately lo5 cells ml-' to 107-108 cells ml-' in batch culture. Turbid cultures of ammonia oxidizers may be obtained in strongly buffered medium containing a high ammonium concentration. Continued replenishment of cultures of nitrite oxidizers with nitrite, following nitrite exhaustion, also results, ultimately, in turbidity. Growth parameters for ammonia and nitrite oxidizers have been measured in both batch and continuous-flow systems involving pure cultures and in mixed-culture systems with enriched cultures, particularly from soil and sewage. Estimates from pure-culture studies will be discussed with regard to factors limiting their size and their relevance both to physiological studies and to values obtained in natural environments. A. MAXIMUM SPECIFIC GROWTH RATE
It has been demonstrated (Belser and Schmidt, 1980;Keen and Prosser, 1987a) that product concentration increases exponentially during batch growth of nitrifying bacteria. The slope of a semi-logarithmic plot of product concentration versus time is equivalent to the specific growth rate and provides similar values to those calculated as specific increases in cell concentration. Use of this technique is only valid during balanced growth when cell size and cell activity are constant. Hofman and Lees (1952) and Koops (1969) have suggested that increases in nitrite concentration will decrease the efficiency with which ammonia oxidation is coupled to biomass formation as batch cultures age due to product inhibition. Glover (1985) showed decreases in energetic efficiency in ageing cultures to be due to reduced potential for carbon dioxide fixation (see following section). The implications for the use of product formation as a measure of specific growth rate are, however, unlikely to be serious as Glover's data indicate that this imbalance occurs within the deceleration phase when specific growth rate is decreasing. values for both ammonia and nitrite oxidizers are low for pureThe pmax and mixed-culture systems under ideal conditions in comparison to those of is 0.087 h- ',equivalent to a heterotrophs. The highest reported value for pmax
138
J. 1. PROSSER
TABLE I. Maximum specific growth rate (pmaX) values of pure cultures of nitrifying bacteria
Batch culture
Continuous culture
Ammonia oxidizers Nilrosomoflus Spp.
Sewage isolate Sewage isolate N. europueu
0.016-0.058 0.012-0.043 0.088 0.02-0.03 N. ruro~pu~u 0.052-0.066 N. i~uro~prrcw ATCC 0.052-0.054 N. cw~~poprrc~u FH 1 0.036 N . iwrop(prrecr N. cwrcpwu 0.017 0.018 N. ntrrriprriu Ni1rosococcic.s ocwnus 0.0I4 N ~ I ~ ( J , w JOl'l'LIIIILV ~ ; ~ Y I ~ . Y 0.032 Nilrosospiru AV2 0.033-0.035 N i l , o s ~ ~ l o h uAV s 3 0.043-0.044
Nitrite oxidizers Nilrohucli~rspp. N. sp. N . N.W. N. L. N. sp. Ni1roi~occic.sntohi/i.s
0.058 0.039 0.025 0.043 0.033
Reference
} Loveless and Painter (1968) 0.063
Skinner & Walker (1961) Drozd ( I 980)
} Belser and Schmidt (1980) 0.064 0.039
Helder and de Vries ( I 983) Keen and Prosser (l987a) Glover (1985) Glover (1985)
} Belser and Schmidt (1980) Could and Lees (1960)
0'033 0.0 I8 0.035
} Gay and Corman (1984) Keen and Prosser ( 1987a) Glover (1985)
doubling time of 8 h, for N . europaea growing in batch culture, although the same strain in continuous culture had a pmarof only 0.063 h - ' (Skinner and Walker, 1961). Values of pmaxusually lie within the range 0.0140.064 h-' (equivalent to doubling times of 50-1 1 h) (Table 1). Maximum specific growth rate is limited by the low energy gain from ammonia and nitrite oxidation. The small amount of energy generated is then required for production of reducing power for fixation of carbon dioxide. How, then, could an ammonia or nitrite oxidizer adapt to increase its maximum specific growth rate. One way would be to increase the amount of cell material devoted to substrate oxidation. This strategy is employed by many, if not all, nitrifiers and is seen in the complex invaginations of the cell membrane believed to be the site of ammonia mono-oxygenase and respiratory enzymes. Another function for such membranes in ammonia oxidizers is the compartmentalization of hydroxylamine, which is toxic. Proliferation of membranes will increase the amount of energy-generating
AUTOTROPHIC NITRIFICATION IN BACTERIA
139
material within the cell and, potentially, the actual rate of biomass production. Presumably, a limit will be reached where this imbalance in cellular structure becomes counter-productive and the amount of other cellular components required becomes inefficiently small. A complex membranous structure may also decrease diffusion of ammonia to the sites of oxidation and diffusion of intermediates and products between reaction centres. Specific growth rate does not depend solely on the actual rate of biomass production but rather on the rate at which cell mass may be doubled, i.e. the specific rate of biomass formation. Specific growth rate can therefore be increased by decreasing cell size for the same energy-generating capacity. To an extent this is seen in nitrifiers, which are never longer or wider than 2 pm and whose cell size is, frequently, in the order of 1 pm. We will also see that cells of the same specific growth rate can have very different cell activities, again due to the differences in cell size. The important factor in increasing ammoniaoxidizing capability is the proportion, rather than the amount, of cell material occupied by intracytoplasmic membranes. The benefits of a high maximum specific growth rate in nature are dubious. Wood (1986) has pointed out the perversity of ammonia oxidizers in their refusal to generate energy from organic compounds, even though they have the potential to metabolize such compounds. Assimilation of organic carbon does not significantly increase maximum specific growth rate or yield. If heterotrophy presented an advantage, presumably ammonia oxidizers would have developed to exploit its potential. A high maximum specific growth rate is considered to provide an ecological competitive advantage where substrate concentrations are high. Although this may be the case in sewage treatment processes, in most natural environments bulk concentrations of ammonia are low and those of nitrite are negligible. The ability of nitrifiers to grow and survive at low substrate concentrations and to interact closely with the producers of ammonia and nitrite may, therefore, be more important selective properties for these organisms than a high specific growth rate. B. GROWTH YIELD
In the absence of substrate or product inhibition, exponential growth of ammonia oxidizers usually ceases when the medium becomes acidic, while that of nitrite oxidizers continues until nitrite is completely utilized. Inhibition of nitrite oxidation by intact cells and cell-free extracts of Nitrohacter strains was demonstrated by Boon and Laudelout (1962) to be due to nitrous acid at low pH values and competitive inhibition by hydroxyl ions at high pH values. Non-competitive product inhibition by nitrate was also found. Equivalent studies have not been carried out for ammonia oxidizers, but free ammonia is inhibitory to both ammonia and nitrite oxidizers and ammonia oxidation is
140
J. I . PROSSER
also subject to inhibition by nitrous acid. Such inhibition generally occurs at relatively high concentrations (greater than 30 m~ (Focht and Verstraete, 1977)).Keen and Prosser (1987a) found no evidence for substrate inhibition of ammonia or nitrite oxidation in continuous culture with substrate concentrations less than 50pg N ml-' (3.5mM). Data from sewage treatment processes indicate that free ammonia and nitrous acid act as differential inhibitors of nitrite and ammonia oxidations, respectively (Anthonisen et al., 1976). Substrate inhibition in sewage treatment processes has been modelled by Castens and Rozich (1986) using classical enzyme kinetics. In soil, Darrah et al. (1986) found inhibition by high concentrations of ammonium chloride, but this appeared to be due to an effect on osmotic pressure or chloride concentration rather than direct inhibition by high ammonium concentrations. There is evidence of strain variability with regard to substrate inhibition of nitrite oxidizers. Nitrospira gracilis cannot grow at nitrite concentrations greater than 1 mM and N . winogradskyi dominates in enrichment media containing high initial nitrite concentrations. The basis for these differences in tolerance to nitrite inhibition is unknown but has obvious implications for isolation procedures (see Section VILA). It is also probable that ammonia oxidizers will show strain variability with regard to substrate inhibition which may be important in optimal operation of sewage treatment processes. Values for yield coefficientson ammonia and nitrite are given in Table 2 and can be seen to be low. Values are similar for both groups of nitrifiers and each cell must convert in the order of 10 times its own weight of ammonia- or nitrite-nitrogen to double in mass. Experimental values for true growth yield (Y,) and maintenance coefficients ( m ) have been determined by Keen and Prosser (1987a) (Table 2). The maintenance coefficient was calculated from steady state.continuous culture data assuming m to be independent of specific growth rate. These values indicate that at an ammonium concentration of 1 jig NHf - N ml- ', the specific growth rate of Nitrosomonas strains will be 21 YO of pmax and 76% of substrate will be consumed for maintenance. Similarly, pmax for Nitrohacter strains will be reduced to 26% of pma,at 1 pg NO; - N ml-', with 81% of nitrite oxidized for maintenance. Maintenance requirements are similar for both organisms and are significant in natural environments where substrate concentrations are low. Belser (1979) calculated that, on the assumption of a value of m = 0.028 (gcell)-' h-I, an ammonification rate in soil of 6.18pgNHf - N h - ' would permit establishment of a population of 2.4 x lo3 to 2.4 x lo5 cells (g soil)This may, therefore, be the major factor limiting population levels in the soil and the significant feature in limiting cell yields in liquid culture, The relationship between substrate oxidation and carbon dioxide fixation has been studied by Glover (1985) who found a decrease in free-energy
'.
AUTOTROPHIC NITRIFICATION IN BACTERIA
141
TABLE 2. Yield and maintenance coefficients for nitrifying bacteria
Ammonia oxidizers Biomass and cell yield on ammonia: Nitrosomonas sp. 0.42-1.40 g biomass molNitrosomonas europaea 0.6-0.8 g biomass mol- ' Nitrosomonas europaeu 1.261.72g biomass mol-' Nirrosomonas ATCC 4.61-6.44 x 10l2cells mol- I Nilr(J.SUm(JnU.7 FH I 1.38-2.44 x 10'2cellsmol-' Nitrosospira sp. 8.0410.6 x 1012cellsmol-' Nitrosolobus sp. 1.85-2.24 x 1012cellsmol-' True growth yield Maintenance coefficient
5.88 g biomass mol- I 0.88 mol g biomass-'
I
Loveless and Painter (1968) Drozd (1980) Keen and Prosser (1987a) Belser and Schmidt (1980)
h-l
Carbon yield on ammonia (ratio of CO, fixed: NO; produced): Ni~r~J.sOM~J~U.S sp. 0.090 Wezernak and Gannon (1967) Nitro.somona.7 sp. 0.033 Helder and de Vries (1983) Nitrosomona.s spp. 0.08 14.094 Belser ( 1 984) Nitrosomonas niarinu 0.044.07 Glover (1985) Nitrosopira spp. 0.0754.096 Belser (1984) Nitrosocysti.~~ici~anu.~ 0.074. I3 Gunderson ( I 966) Ni1ro.socysti.s oceanus 0.064.10 Carlucci and Strickland (1968) Nitroxococcus mohilis 0.014-0.031 Glover (1985)
Nitrite oxidizers Biomass yield on nitrite: NirrohoctcJrsp.
1.11-1.51 g biomass mol-'
Keen and Prosser (1987a)
Carbon yield on nitrite (ratio of CO, fixed: NO; produced): Nitrohucrer sp. 0.0I 3 4 . 0I4 Schon (1 965) Nitrohucti~rsp. 0.0125 Wezernak and Gannon ( 1 967) Nitrohucter sp. 0.02 Helder and de Vries (1984) Nirrohacter spp. 0.024.03 Belser (1984) Nitrococcus mvhilis 0.014-0.031 Glover (1985) True growth yield Maintenance coefficient
9.8 g biomass mol0.78 mol biomass-I
h-l
efficiency of approximately 70% between early and late exponential phases in cultures of Nitrosomonas marina and Nirrosococcus oceanus. This was correlated with a decrease in cellular organic carbon and nitrogen content and chemostat studies demonstrated a decrease in efficiency with specific growth rate which was independent of nitrite concentration. In continuous culture, decreasing specific growth rate (dilution rate) was also associated with a reduction in the activity of RuBisCO (measured as enzyme activity per unit biomass) and in the yield of organic carbon. Similar behaviour was found for the nitrite oxidizer, Nitrococcus mobilis. Ageing batch cultures and cells grown in continuous culture at low specific growth rates therefore had reduced
142
J. I . PROSSER
potential for carbon dioxide fixation and ammonia oxidation was consequently less efficient in terms of biomass production. The carbon yield from nitrification (the ratio of carbon fixed to nitrogen oxidized) varied with substrate concentration and specific growth rate (Table 2) and was greater for ammonia oxidizers than for Nitrococcus species. This is due to the greater energy gain from ammonia oxidation. Belser (1984) obtained similar relative values for the ammonia oxidizers N . europaeu and Nitrosospiru species and a Nitrohacter species (Table 2). The ratio of carbon fixed to substrate oxidized varied little with specific growth rate and with pH value in continuous culture, indicating that cellular metabolism is regulated to maintain an optimal ratio. Short-term changes caused by additions of substrate to cell suspensions altered the ratio, as did addition of metabolic inhibitors, particularly for Nitrohucter strains. C. CELL ACTIVITY
In batch culture, simultaneous estimation of cell concentration and product concentration allows calculation of cell activity. Values have also been TABLE 3. Ccll and biomass activities for nitrifying bactcria
20 II 23 0.9-5.1
23 0.9-4.9 1 .O-7.0 13.7-31.3 Nirrosospirtr hricwi.r Nirrosolohu.~niultiforniis
4 23
Biomass activity (nmol NO; produced g biomass- h - l ) : Nirr(~.soriionrr.siwrupueu 4 Nilrosomot7ir.v 1’u~OpUc’U 30-200 7.5-16 NilrfJ.YfJnioltu,seuropueu
Nitrite oxidizers Ccll activity (fmol NO; produccd ce1l-l h K 1 ) Nitrohuctcv sp. 5.1-13.6 Nilrohuctar spp. 9-42 Nirrohucror sp. 5.1-1 3.6 Ni/roi,ctccus f)i’i~fft7US’ 6.7- 1 1.4
Biomass activity (nmol NO,; produced g biomass-’ h K 1 ) Ni!rohuctar sp. 15.1-25.2
Belscr (1979) Remacle and DeLeval t 1978) Belser and Schmidt ( 1 980) Glover (1985) Keen and Prosscr (19874 Glover (1985)
} Belser
( 1979)
Skinner and Walker (1961) Drozd ( 1980) Keen and Prosser (1987a)
Remaclc and DeLeval (1978) Belser ( 1979) Keen and Prosscr (1987a) Glover ( I 985) Keen and Prosser (l987a)
AUTOTROPHIC NlTRlFlCATlON IN BACTERIA
143
calculated in continuous culture, which also enables measurement of activity per unit biomass. Typical values are presented in Table 3. Both Keen and Prosser (1987a) and Glover (1985) found cell activity to increase with specific growth rate in continuous culture, as might be expected, and Keen and Prosser's data indicate a Michaelis-Menten relationship. Cell activities have also been calculated for ammonia oxidizers in sewage treatment processes and in soil. Enumeration of nitrifiers in samples from natural environments requires use of the most probable technique which is inaccurate and leads to underestimation of cell concentrations. This in turn leads to overestimation of cell activities, but when such errors are taken into account values are comparable to those in Table 3. The use of cell-activity measurements for enumeration in natural environments is discussed by Belser and Mays (1982) and Prosser (1989). Measured values for biomass yields indicate that large amounts of ammonia and nitrite must be converted to synthesize biomass. The converse is that relatively low cell concentrations may be associated with high rates of substrate conversion and respiration with no perceptible growth. Drozd (1980)estimates that ammonia oxidizers consume one-third of their weight of ammonia per hour. The small populations of nitrifiers found in soil and immobilized cells in attached-growth sewage treatment processes are, therefore, capable of significant rates of nitrification. D. SATURATION CONSTANTS
There is much confusion in the literature regarding saturation constants for ammonia and nitrite oxidation. Many measurements of short-term activity have been carried out on cell-free extracts or non-growing cell suspensions, thereby reflecting saturation constants for enzyme activity, K,. Experimental determinations of saturation constants for growth ( K , ) of growing populations in continuous culture are rare. Values for both are given in Table 4. Further measurements have been made of nitrifiers in mixed culture systems from natural environments. Experimentally measured K, and K , values show some degree of variability but are generally similar to, or greater than, concentrations of ammonia or nitrite found in the environment from which the cells were originally isolated. Only in sewage treatment plants and in fertilized soil will average or bulk ammonia concentrations exceed 1Opg N ml-' and nitrite rarely accumulates above 1 p g NO; - N. Substrate affinities are not high in relation to these concentrations and, like maximum specific growth rates, are therefore unlikely to give these organisms a competitive advantage in natural environments. What limits Ks for these nitrifying bacteria? Unfortunately little is known of the transport mechanisms for ammonia and nitrite. Nitrite can enter microbial cells by passive diffusion and similarities between K , values for intact cells and
TABLE 4. Saturation constants for growth and activity of nitrifying bacteria Ammonia oxidizers
Reference
Nitrite oxidizers
Reference
Satmation cowtaut for activity (&,)
Nifrosvnionas sp. l4m~NHi 3 . 6 m ~0, Nitrosonionas rurvpaeo 0.4 mM NH; Nitrosonionas europaeu 0.12-1Om~(NH: +NH,) 0.018-0.058 mM NH, Nitrosonionas sp. 1.1-3.8m~NH: Nifrosomonus europaea 0.5-7.0m~NH:
Loveless and Painter ( 1968)
Nirrohacrer spp.
1.6-3.6m~NO;
Boon and Laudelout (1962)
Nifrohacferspp.
0.256 m~ 0, 0.062 mM 0,
Peeters e f a/. (1 969)
Suzuki (1974) Suzuki el a/. (1974)
Laudelout et af.(1976) Drozd (1976)
Saturation constant for growth (KJ
Niirvsomonus sp. 0.07 mM NH: Nitrosvmonas sp. 0.055 mM NH: Nitrosomonas europaea 0.051 mM NH:
Remacle and D e k v a l (1978)
Nifrvbacttv spp.
0.I78 m~ NO;
Could and Lees (1960)
Helder and de Vries (1983)
Nirrohacfer spp.
0.045 mM NO;
Remacle and DeLeval(l978)
Keen and Prosser ( 1 987a)
Nirrohacfer spp. Nifrvhocferspp.
0.267 m~ NO; 0.039 mM NO; 0.015 mM NO;
Helder and de Vries (1983) Gay and Corman (1984)
AUTOTROPHIC NITRIFICATION IN BACTERIA
145
cell-free extracts and between K , and K , values suggest that uptake mechanisms do not limit nitrite-oxidizing activity. The evidence for ammonia transport in ammonia-oxidizing bacteria is conflicting. Suzuki et af. (1974) found that the K , value for both suspended cells and cell-free extracts of N . europaea did not vary with pH value if measured in terms of ammonia (NH,) rather than total ammonium (NH, + NH:) concentration. This was taken as evidence that ammonia was the substrate for the ammonium mono-oxygenase and that the saturation constant did not reflect a K , value for transport. This is also implied by similarities between K, and K , values. Drozd (1980) suggests that substrate may be transported into the cell as ammonia leaving a H + behind. This will contribute to acidification of the medium, which accompanies ammonia oxidation, and could lead to alkalinization of the cytoplasm with implications for regulation of internal pH value. On the other hand, Ward (1987) found an increase in K , value with pH value for ammonia oxidation by Nitrosococcus oceanus and suggested that low pH values may affect enzyme activity in addition to ammonia availability. Glover (1982) studied uptake by the same organism of radiolabelled methylamine, an analogue of ammonium, which she found to inhibit ammonia oxidation and, to a lesser extent, carbon dioxide assimilation and growth. Glover suggests that methylamine may affect cells (a) as a transport analogue of NHf, (b) as an internal analogue of ammonium, or (c) as an uncoupler of phosphorylation. Further experimentation is therefore necessary to determine whether ammonia or ammonium, or both, are transported and, if so, how. Ammonia, like nitrite, can enter microbial cells by passive diffusion, when its rate of transport will depend on the concentration gradient across the cell membrane and, consequently, on the rate at which the cell can use ammonia and deplete intracellular pools. As the internal concentration decreases below the K , value for the ammonium mono-oxygenase, the rate of ammonia oxidation will decrease, reducing the concentration gradient and rate of entry. The Ks value may therefore reflect the K , value of the ammonium monooxygenase enzyme, rather than any transport process. On the other hand, a high affinity NH: transport process, giving a low K,, would drain energy from the cell, which at low ammonia concentrations it would not be able to replenish. Using values in Table 3, at approximately 1.4pg N H f - N ml-', the specific growth rate for N . europaea is 28% of its maximum and cell activity will only equal that required for maintenance. Such a cell will have little energy to spare for scavenging of ammonium from the environment. However, ammonia oxidizers in marine environments experience only submicromolar concentrations of ammonia but the K , and K , values of marine isolates are much higher (Table 4). It is difficult to understand how they survive, grow and multiply.
146
J. 1. PROSSER
The effects of substrate concentration on natural populations of marine nitrifiers indicate much higher substrate affinities than those of pure cultures. Olson (1981a) found Michaelis-Menten-type kinetics for nitrite oxidation in sea water in the range 0.1-1 p~ NO; and estimated a K , value of 0 . 0 7 ~ ~ . Similar behaviour is reported by Ward ( 1 986), and both workers found constant rates of ammonia oxidation in concentration ranges 0.1-21 p~ and 0.02-2p~.Hashimoto et af. (1983) estimated a K,,, value of 0.1 p~ for natural populations of marine ammonia oxidizers. Ward (1986) argues on the basis of immunofluorescence studies that cultures isolated from marine environments are truly representative of natural populations. She suggests that differences in substrate affinities between pure cultures and natural samples arise through (a) loss of low-substrate-affinity systems by pure-culture isolates or (b) the existence of complex enzyme systems capable of efficient use of substrates over concentration ranges of several orders of magnitude. Certainly, complete explanations of the ability of marine nitrifiers to grow suspended within the water column require further physiological study. E. PROBLEMS OF BIOMASS PRODUCTION
Features of nitrifying bacteria discussed above present the physiologist with a basic problem in experimental work, i.e. that of obtaining sufficient biomass for analysis. This is partly due to the low maximum specific growth rates and low growth yields on ammonia and nitrite but also to substrate and product inhibition and high maintenance requirements. For example, a one-litre continuous culture growing at near-maximum specific growth rate will produce only 0.2mg dry weight biomass per hour.
V1. Surface Growth While nitrifiers present disadvantages for studying growth in suspended culture, the ease with which substrate and product concentrations may be measured presents distinct advantages for studying growth on surfaces, where measurement of biomass or cell concentration is difficult for all organisms. In addition, the opposite charges carried by the respective substrates for ammonia and nitrite oxidation (i.e. NH,f and NO;) provide a means for testing hypotheses regarding the effects of surface charge on attachment and growth. The study of nitrification in soil suspensions and the use of calcium carbonate to buffer defined inorganic liquid media led to the early belief that particulate material and surface growth were necessary for nitrification. Goldberg and Gainey (1955) were the first to demonstrate nitrification in the
AUTOTROPHIC NITRIFICATION IN BACTERIA
147
absence of surfaces, greatly improving the potential for physiological studies. They also determined the effects of clay minerals on nitrification in batch culture (see Section V1II.B) but most early studies on surface-attached populations were restricted to batch or, more usually, continuous-flow reactors packed with either soil or glass beads. These were based on the reperfusion system of Lees and Quastel (1946) with subsequent development of continuous-flow systems with a high degree of sophisticated control of moisture content and other environmental factors and facilities for measurement of soluble and gaseous substrates and products. Such experimental systems are reviewed by Prosser and Bazin (1988) and have provided values for cell activities of natural populations of attached cells, but suffer from difficulties in enumeration. This is normally only possible using the most-probable-number technique, following extraction of cells, and leads to significant under-estimation of viable cell concentrations. The use of glassbead columns inoculated with pure cultures of nitrifying bacteria alleviates some of these problems, as cells may be enumerated microscopically following removal by ultrasonication. This provides more reliable estimates of cell activity. Importantly, glass-bead columns have demonstrated the production of large quantities of extracellular polymeric substances binding cells to surfaces, stabilizing such communities and permitting high rates of ammonia and nitrite oxidation. More recently, the physiology of attached populations of nitrifiers has been studied in batch and continuous-flow systems using glass slides or cover-slips and ion-exchange resin beads as substrata for attachment (Underhill and Prosser, 1987a; Keen and Prosser, 1988; Powell, 1985).Effects of surface growth on the pH response of nitrifiers and on inhibition are described in Sections VIII and IX. In the absence of inhibitors the major findings are as summarized below. In the absence of substrate, both N . europaea and Nitrobacter sp. colonize anion- and cation-exchange resins to a similar but limited extent. In the presence of ammonia or nitrite N . europaea and Nitrobacter sp. extensively colonize cation- and anion-exchange resin beads, respectively, i.e. each species colonizes the resin to which its substrate is adsorbed. This does not represent passive attachment but actual growth on the substratum and cell-surface charge therefore appears to be unimportant in initial attachment and growth. In batch culture the presence of glass slides stimulates growth of Nitrobacter sp. but reduces the maximum specific growth rate for N . europaea. The reasons for this are unclear. Glass possesses a small negative charge and clay minerals with stronger negative surface charges reduce the maximum specific growth rate of N . europaea (Armstrong and Prosser, 1988), possibly by localized competition for adsorption sites between ammonium ions and adsorbed cells. This does not explain stimulation of growth of Nitrobacter. Initial attachment is not correlated with production of extracellular polymeric substances (EPS)
148
J . I. PROSSER
but reversible permanent attachment is mediated by formation of a slime layer which stabilizes the biofilm and allows faster response to changing conditions. The nitri te-oxidizing activity of cells from Nitrohacter sp. attached to anionexchange resins in a continuous-flow air-lift column fermenter is found to be less than that of freely suspended cells under the same substrate concentrations. This may be caused by nutrient limitation due to diffusion through the biofilm or to the effect of abrasion on cell viability. Although statistically significant, the effect of surface attachment on growth parameters is not dramatic but has important effects on the response of nitrifiers to low pH values and to inhibitors, as will be seen in later sections. It is remarkable, however, that organisms growing under energy limitations should direct efforts to production of large quantities of EPS material. Clearly, production of this material must provide significant advantages. The particular continuous-flow systems studied provide very selective conditions, in that cells without the ability to remain attached will be washed out quickly. Attachment therefore provides stability and maintenance of the community and the ability to respond quickly to changing conditions. These will be important factors in natural environments but in the soil a major function of EPS may lie in providing resistance to desiccation stress, thus increasing survival. Cultures recently isolated from soil frequently produce capsular material but this material, and the ability to produce it, appear to be lost with continued laboratory subculturing. Production of EPS is therefore an area requiring study both to determine its function and to determine the mechanisms for regulation and control of its production in organisms for whom fixation of carbon dioxide is so expensive in terms of energy.
VII. The Effect of Oxygen and Light on Nitrification A. INHIBITION OF NITRIFICATION AT HIGH OXYGEN CONCENTRATION
Nitrification is classically described as an aerobic process with molecular oxygen required for oxidation of ammonia and for respiration in both ammonia and nitrite oxidizers. At high concentrations, oxygen is inhibitory. Gunderson (1966) found inhibition of colony growth of Nitrosocystis oceanus on solid medium in the presence of pure oxygen, poor growth in the presence of air and rapid colony formation only at low partial pressures of oxygen. Growth was optimal at a partial pressure 10% that of air. Although growth was inhibited by high oxygen concentrations, the respiration rate was increased. High oxygen partial pressure also inhibits growth of Nitrohacter species and leads to an increase in polyphosphate pools. Growth on solid media requires low oxygen partial pressures, and free-radical formation is suggested as the mechanism of oxygen inhibition.
AUTOTROPHIC NITRIFICATION IN BACTERIA
149
Oxygen inhibition is of practical significance in activated sludge systems supplied with pure oxygen rather than with air. Inhibitory effects in laboratory-scale activated-sludge units are manifest at higher oxygen concentrations (Painter and King, 1976; Charley et al., 1980; Jones and Paskins, 1982).This appears, however, to be due to reduced removal of carbon dioxide leading to reduction in pH value. Jones and Paskins (1982)also found that nitrifiers could become acclimatized to high concentrations of oxygen but not to sudden changes from normal to high levels, which could lead to washout of these organisms. B. PHOTO-INHIBITION
Oxygen is also implicated in the sensitivity of nitrifying bacteria to light. The bactericidal effects of visible blue, and long-wavelength ultraviolet, light were first noted by Muller-Neugluck and Engel (1961).Schon and Engel (1962)and Bock (1965)found strains of Nitrohacter to be much more sensitive than those of Nitrosomonas and suggested that photo-oxidation of cytochrome c was the mechanism for inhibition by light. Hooper and Terry (1974) found reduced sensitivity to photo-inhibition in the absence of oxygen, when ammonia oxidation was completely inhibited, or in the presence of high concentrations of ammonia or hydroxylamine. Sensitivity was greatest when flux through the ammonia hydroxylamine-nitrite pathway was low, e.g. due to low ammonia concentration, endogenous metabolism, decreased temperature or partial inhibition of ammonia oxidation. Shears and Wood (1 985) presented spectroscopic evidence for the existence, in resting cells, of an oxygenated state of the ammonia mono-oxygenase with a broad ultraviolet absorbance band. They suggest that ultraviolet absorption results in an excited state giving rise to an active form of oxygen which destroys the enzyme. Light inhibition is significant in surface waters and Olson (1981b) found 50% inhibition of ammonia and nitrite oxidizers at light intensities approximately three orders of magnitude less than the intensity of full sunlight. This has important implications for nitrification in such environments. Firstly, it reduces competition for ammonium in surface waters between nitrification and assimilation by phytoplankton. Secondly, in aquatic environments the differences in the degree of inhibition of ammonia and nitrite oxidation have been proposed to result in spatial separation of the two processes and accumulation of intermediates leading to a primary nitrite maximum (Olson, 1981b; Ward, 1986).Nitrite maxima of this type have not been observed in lake environments (Hall, 1986), but an alternative explanation for their occurrence in estuarine environments based on differences in affinity for oxygen is presented below. An important consideration in natural environments is the ability to
150
J. I. PROSSER
recover from inhibition during dark periods. Hooper and Terry (1974) reported recovery of N . europaea from 90% photo-activation within a minimum period of 10h and Alleman et ul. (1987) found faster recovery (2.5-3 h) in a mixed culture system. Yoshioka and Saijo (1985) subjected ammonia and nitrite oxidizers to 12 h light/dark cycles and found reduced recovery from photo-inhibition in the absence of ammonia and differences in sensitivity between ammonia and nitrite oxidizers, with the latter more sensitive during short-term experiments. They also found that following illumination for 7 days, recovery from photo-inhibition in the absence of ammonia did not occur until after 120 days. The extent of photo-inhibition and the length of the recovery period depend on the intensity of the illumination, the attenuation properties of the water and circulation of water within the hypolimnion. The combined effects of these factors are discussed by Hall (1986). C. NITRIFICATION AT LOW OXYGEN CONCENTRATIONS
Low concentrations of oxygen reduce rates of nitrification and the dual effects of substrate and oxygen limitation have been modelled using doublesubstrate-limiting kinetics (Sharma and Ahlert, 1977). Saturation constants for oxygen for pure cultures of ammonia and nitrite oxidizers lie in the range 0.25-2.5 mg dissolved oxygen 1 - (Painter, 1986) (Table 4), with similar values reported for mixed-culture-activated sludge systems. The Ksvalues are higher than those for heterotrophs, and nitrifiers are therefore likely to be poor competitors for oxygen at low oxygen concentrations. This is significant in two situations. Firstly, heterotrophic nitrifiers have a lower K , value for oxygen, providing them with a competitive advantage in low-oxygen environments. Secondly, competition for oxygen may be important where nitrifiers are a component of mixed biofilms. In addition, Megraw and Knowles (1987) found that the co-existence of nitrifiers and methanotrophs in soil was only possible at high levels of oxygen and ammonia. At reduced oxygen levels, nitrifiers were outcompeted due to a combination of higher K,,, value for oxygen, lower maximum specificgrowth rate and lower growth yield. Under ammonium limitation, the high assimilation requirement of the methanotrophs again led to their dominance. The effect of oxygen on the marine nitrifier Nifrosococcus oceunus varies with ammonia concentration and is not represented by simple doublesubstrate-limitation kinetics (Ward, 1987), with inhibition of ammonia ~ ) oxidation by oxygen at high ammonia concentrations (greater than 2 0 ~and activation at low concentrations (Fig. 4). Ammonia oxidation in marine environments, where substrate concentrations will be low, may therefore be enhanced by reduced oxygen levels.
AUTOTROPHIC NITRIFICATION IN BACTERIA
12
151
I"
I
0
.02
I
I
I
.04
.06
.00
I/
IS1 (wM NHf)-'
FIG. 4. a, Effect of reduced oxygen concentration on ammonia oxidation by Nitrosococcus oceanus. b, Lineweaver-Burk plot of data in part a. Key: 0 , control reduced oxygen concentration (1.23ml I-'). (oxygen concentration =4.88 ml I-'); 0, From Ward (1987) with permission.
There is some evidence that ammonia oxidizers have greater saturation constants for oxygen than nitrite oxidizers. Helder and de Vries (1983) suggest that ammonium oxidation is inhibited below 30pmol 0, 1 - ' while nitrite oxidation is inhibited below 125pmol0,l- These differencescan give rise to spatial separation of these two groups in attached biofilms limited by supply
',
152
J . 1 PROSSER
of oxygen by diffusion. Tanaka and Dunn (1982) modelled this situation using multiple substrate kinetics and predicted accumulation of Nitrobacter species below Nitrosomonas species in biofilms carrying out nitrification. Limited experimental evidence was presented, based on respirometric measurements in the presence of ammonium or nitrite, for greater nitrite-oxidizing activity and lower ammonia oxidizing with increasing biofilm depth in a mixed-culture fluidized-sand-bed reactor. Helder and de Vries (1983) found a similar effect in an estuarine environment. Strains of Nitrosomonas and Nitrohacler isolated from an estuarine sediment were grown together in continuous culture at a range of oxygen concentrations. At concentrations greater than 95 mmol 0, 1 - ', ammonium and nitrite concentrations were negligible. As oxygen concentration was reduced below this level, firstly nitrite and then ammonia appeared in steady state culture fluids. This implies a higher K , value for oxygen for nitrite oxidizers and explains the occurrence of a nitrite maximum in the surface waters of the estuary from which these organisms were isolated. It may also explain the occurrence of primary nitrite maxima in marine surface waters discussed above. D. REDUCTION OF NITRITE A N D NITRATE BY NITRIFYING BACTERIA
The physiological and metabolic activities of both ammonia and nitrite oxidizers change significantly at low oxygen concentrations, with important environmental consequences. Both ammonia and nitrite oxidizers are capable of reversing what are considered to be their natural processes by reducing nitrite and nitrate. 1. Reduction of Nitrite by Ammonia Oxidizers Production of nitrous oxide has been observed in the genera Nitrosomonas, Nitrosolobus, Nitrosospiru and Nitrosocystis (Goreau et al., 1980) and is presumably a general property of ammonia oxidizers. Ritchie and Nicholas (1972) observed that N. europaea produced labelled 1 5 N 2 0from either lSNlabelled ammonia, nitrite o r hydroxylamine. Subsequently, the presence of a nitrite reductase was demonstrated in ammonia oxidizers (Ritchie and Nicholas, 1974; Dispirit0 et al., 1985; Miller and Nicholas, 1985). The production of nitrous oxide is correlated with nitrification (Hynes and Knowles, 1984), constituting approximately 0.1YOof nitrogen oxidized under aerobic conditions, and its production is inhibited by specific inhibitors of nitrification, e.g. nitrapyrin. In addition, the proportion of nitrous oxide increases with decreasing oxygen concentration. Goreau et al. (1980) found yields of 0.1-O.5% total N as N,O for the four
AUTOTROPHlC NITRIFICATION IN BACTERIA
153
genera of ammonia oxidizers listed above. A reduction in oxygen concentration from 7 to 0.18 mg I-' greatly increased nitrous oxide yield, which reached 2.5% of total N in N. europaea. Yields as high as 10% have been obtained for a marine strain of Nitrosomonas. Cellular rates of production of N,O and NO; also varied with oxygen concentration from 1-5 x lo-'' nmol N,O cell-' day-' and 0.47-3.7 x lo-'' nmol NO; cell-' day-'. Lipschultz et al. (1981) found a correlation between reduced oxygen concentration and production of both nitrous and nitric oxides and suggested nitrification as a significant global source of atmospheric nitrogen oxides. Hynes and Knowles (1984) observed variation in the proportion of N,O to NO; - N production during growth of N. europaea on a range of initial ammonium concentrations, and production increased five-fold under anaerobic conditions. Acetylene, an inhibitor of ammonia oxidation, inhibited N,O production from ammonium but not from hydroxylamine. The correlation of nitrous oxide production with nitrification and production of I5N,O from labelled ammonia and hydroxylamine led to the belief that nitrous oxide was a byproduct of nitrification, produced by reaction of intermediates involved in ammonia oxidation, as well as nitrite reduction by nitrate reductase. Poth and Focht (1985), using isotopic techniques and kinetic analysis of labelled substrates and products, showed nitrite reduction to be the sole source of nitrous oxide. Ammonia oxidizers can, therefore, carry out denitrification, but simultaneous oxidation of ammonia is required as a source of electrons. Nitrous oxide production occurred only under conditions of oxygen stress. The authors suggest that the process functions to (a) conserve oxygen for use by the ammonia mono-oxygenase, (b) reduce production of nitrite (which may accumulate to toxic levels), and (c) decrease competition for oxygen by nitrite oxidizers, by denying them their source of substrate. Wood (1986) suggests that this process may also function to maintain an optimal redox poise. Additional evidence for nitrous oxide production from nitrite has come from work on 15Nz0abundance studies by Yoshida (1988). Poth (1986) has also isolated a strain of N. europaea which, under oxygen stress, denitrifies nitrite to gaseous nitrogen with little production of nitrous oxide. Nitrogen gas constituted approximately 0.85% of added labelled nitrite and this process is similar to that carried out by many aerobic denitrifiers. 2. Nitrate Reduction by Nitrite Oxidizers In the major nitrite oxidizer genus Nitrobacter, but not in the genus Nitrospira (Watson et al., 1986), the key enzyme is a nitrite oxidoreductase which is capable of oxidizing nitrite to nitrate and of reducing nitrate to nitrite in the presence of reduced methylviologen/benzylviologen or NADH as electron donor (Tanaka et al., 1983; Sundermeyer-Klinger et al., 1984). During
154
J. I . PROSSER
heterotrophic growth, the enzyme is at high levels in the presence of nitrate but is repressed when nitrate is absent. It has an apparent K,,, value of 0.9 mM for nitrate. Bock et al. (1986) reported anaerobic growth of N . winogradskyi with glycerol as electron donor and nitrate as electron acceptor. Growth, however, was incomplete, with only 10% glycerol utilized, and was unbalanced in that 80-90% of cell mass consisted of poly-P-hydroxybutyrate (PHB). Growth limitation was thought to be due to nitrite accumulation and inhibition, but the authors suggested prolonged anaerobic growth would be possible if nitrite could be removed. dissolved oxygen tension
pyruvate protein
Iglll
[mgAI
30 20
10
2
1
NO;
10
20
30
LO
d
NO;
NH;
[mM1
ImMl
FIG. 5. Growth of Nitrohacrer species in a gas-tight culture chamber. Liquid medium contained nitrite, nitrate and pyruvate, and a biofilm was formed on silicone tubing cell protein in the biofilm; 0. cell protein in the within the liquid medium. Key: 0, liquid medium; A,pyruvate; 0 ,nitrite; +, nitrate; A,ammonia; --, oxygen. From Freitag e/ ul. (1987) with pcrmission.
AUTOTROPH IC NlTRl FICATION IN BACTERIA
155
This has now been achieved in a biofilm system which allows both production of nitrite, from nitrate, and its removal by nitrite oxidation (Freitag et al., 1987; Bock et al., 1988). The biofilm was formed on the outside of silicone tubing placed within gas-tight bottles containing mineral salts medium plus nitrite and pyruvate. Air pumped through the tubing provided oxygen by diffusion and a Nitrobacter-species biofilm developed initially due to mixotrophic growth on nitrite and pyruvate (Fig. 5). This reduced the oxygen concentration in the liquid medium, giving rise to an oxygen gradient across the biofilm and subsequent development of a heterogeneous population. Cells adjacent to the silicone tubing continued to be supplied with oxygen and oxidized nitrite, and were seen, in electron-micrograph ultrathin sections, to contain many carboxysomes. Cells adjacent to the anaerobic liquid medium were morphologically distinct, containing many large PHB granules, and were similar to cells suspended in the liquid medium. The growth of these cells was correlated with production of nitrate and ammonia and reduction in nitrite. In addition, up to 40% of nitrogen was lost as nitrous oxide. This is strong evidence, therefore, for growth via reduction of nitrate, produced by nitrite oxidation, with further reduction to ammonia. It also, of course, provides an alternative explanation for the accumulation of nitrite oxidizers beneath ammonia oxidizers in trickling filter biofilms discussed above. 3. Ecological Implications
The metabolic diversity of nitrifiers under conditions of low oxygen concentration can have great significance for their r81e within the nitrogen cycle and their interactions with other groups involved in this cycle. We now see that in the presence of organic carbon, Nitrobacter species can carry out nitrification and dissimilatory nitrate reduction, providing ammonia for ammonia oxidizers under the correct conditions, thereby reversing the whole process of nitrification and converting commensalism into a form of mutualism. The production of nitrous oxides is of particular ecological significance in terms of acid rain and their effect on the ozone layer. Unfortunately, it is often difficult to determine the organisms responsible, as denitrification and nitrification may occur in close proximity and denitrifiers require nitrification as a source of nitrate. There is also evidence for nitrous oxide production by other microbial groups (Knowles, 1986) and by nonbiological means. Metabolic inhibitors, in particular acetylene, have been used to distinguish sources of N,O production but the conditions for use are critical and vary between soils (Davidson et al., 1986; Klemedtsson et al., 1988). Despite these difficulties, nitrification is believed to be a significant source of nitrogen oxides in fertilized agricultural soils (Bremner and Blackmer, 1979;
156
J. 1 PROSSER
Blackmer et al., 1980),marine environments (Lipschultz et al., 1981; Ward and Zafiriou, 1988)and freshwater ecosystems (Downes, 1988).In non-agricultural forest soils the evidence indicates nitrifiers to be of less significance (Robertson and Tiedje, 1987). 4. Interactions Between Nitrijiers and Denitrijiers
The interaction between nitrification and denitrification must also be assessed in the light of advances of our knowledge of nitrifier physiology. These processes are traditionally considered to be separated spatially as nitrification is aerobic and denitrification anaerobic. As we have seen, however, ammonia and nitrite oxidizers can be active at low or zero oxygen concentrations and produce gaseous intermediates similar to those of denitrification. In addition, aerobic denitrification is now seen to be feasible (Robertson and Kuenen, 1983).There is strong evidence to show spatial separation of these processes in natural environments such as estuarine sediments (Keith et al., 1987) and the sediments of streams(Cookeand White, 1987).Macfarlane and Herbert (1985) studied the interaction between nitrifiers and denitrifiers in a series of three chemostat vessels interlinked via membranes which allowed diffusion of soluble substrates and products between vessels. The first vessel was maintained anaerobic and was inoculated with a denitrifying Vihrio strain, supplied with glycerol and nitrate. The second and third vessels were aerobic and were inoculated with strains of Nitrohacter and Nitrosomonas, respectively, and were supplied only with mineral salts medium. Under nitrogen limitation, the Vibrio strain produced ammonium which stimulated growth of the Nitrosomonas strain and subsequently that of the Nitrohacter strain, although nitrite production was insufficient for significant growth of the Nitrohacter strain. Under carbon limitation, nitrite was the major product leading to growth of the Nitrobacter strain but washout of the .Nirrosomonas strain. This sort of experiment demonstrates the ability of denitrifiers to generate substrates for nitrification with diffusion of products across an oxygen gradient and also the effect of nutritional conditions on denitrification and on the relative numbers of ammonia and nitrite oxidizers. The coupling of nitrification and denitrification is of value in sewage treatment processes requiring complete removal of nitrogen. This may be achieved in two-stage systems, the first being aerobic and the second anaerobic, but Kokufuta et al. (1988) devised a single-stage system for both processes. This involved co-immobilization of N . eurupaea and Paracoccus denitriJicans using a pol yelectrolyte complex. They obtained simultaneous nitrification and denitrification, due to the existence of aerobic and anaerobic regions within the support system. Ammonia was converted through to gaseous material enabling complete removal of nitrogen. In addition,
157
AUTOTROPHIC NITRIFICATION I N BACTERIA
ammonia oxidation was faster in the presence of the Paracoccus strain because of immediate removal of nitrite, thereby preventing inhibition.
VIII. The Effect of pH Value on Nitrification Both ammonia and nitrite oxidation are considered to be optimal at neutralalkaline pH values. Watson (1974) quotes a pH range for pure cultures of ammonia oxidizers of 5.8-8.5 and a range of 6.5-8.5 for nitrite oxidizers. Most nitrifiers have pH optima for growth in the range 7.5-8 and grow within a pH range of approximately 2 pH units. N. europaea is exceptional with a pH range for growth of 5.8-8.5, reflecting the diversity of strains within this species. Similar properties are reported for mixed cultures such as those found in activated sludge processes. Below the optimum pH value, specific growth rate falls off sharply. Figure 6 shows the effect of pH value on the maximum specific growth rate of Nitrobacter sp. in pure-batch culture(Keen and Prosser, 1987b). A maximum specific growth rate of 0.0048 h- was found at pH 7.5. At pH 6 this fell to 59% of the maximum and no growth occurred at pH 5.5. We have obtained similar data for N . europaea with a maximum specific growth rate at pH 8, a 54% reduction in pmaxat pH 7 and no growth at pH 6.5.
5
FIG. 6. Effect of pH value on maximum specific growth rate of Nitrobacter species.
158
J. 1. PROSSER
The response of specific growth rate of nitrifiers to pH value reflects the pK values for their respective substrates. For NH:/NH, the pK value is 9.25 (Wood, 1988). Evidence has been presented in Section V that ammonia is the substrate for ammonia oxidation and reduction in pH value will decrease the concentration of free ammonia by one order of magnitude for each unit decrease in pH value. For a typical ammonia-oxidizer medium containing 1OOpg NH: ml-' the ammonia concentration will be 5.6,0.56 and 0.056pg ml-' at pH values of 8, 7 and 6, respectively, explaining the sharp cut-off effects discussed above. Reduced ammonia availability will only affect specific growth rate if the cell must expend increasing amounts of energy on maintenance of internal pH value and/or if ammonia is the form in which substrate is transported into the cell. If ammonia is transported by passive diffusion, the rate of uptake will be reduced at low pH values due to a decreased concentration gradient across the cell membrane. If an energydependent ammonium uptake mechanism exists, the increased maintenance energy demand required to maintain internal pH, in addition to that required for uptake, may leave insufficient energy for growth. There is also evidence that reduction in pH value affects enzyme activity and not just ammonia availability (Glover, 1982). Above the optimum pH value for growth, the advantages of increased availability of free ammonia are counterbalanced by the need to maintain an internal pH value below that of the external medium (Wood, 1987). The above discussion implies that the optimum pH value for growth will depend on ammonium Concentration. Quinlan ( 1984)presented a quantitative theoretical model relating optimum pH value and ammonium concentration based on the assumptions that (a) ammonia was the substrate for ammonia
kl
,
11. Ilr(
EH
+
S
Sd
'
k2
EH+S
FIG. 7. Proposed mechanisms for the effect of pH value on the kinetics of ammonia oxidation. Redrawn from Quinlan (1984).
AUTOTROPHIC NITRIFICATION IN BACTERIA
159
oxidation, (b) substrate ionization occurred, and (c) ammonia oxidation was controlled by ampholytic ionization of the rate-limiting enzyme substrate (EHS) complex, but not of the free enzyme (EH) (See Fig. 7). The values k , and k , represent forward and reverse rate constants for the formation of enzyme substrate complex and k , is the rate constant for irreversible product formation. The constant K3 represents reversible and pHdependent ionization of NH, to NH:, and is consequently related to pK, while K, and K, represent ionization of the ES complex. A mathematical model based on this hypothesized mechanism was used to describe the effects of pH value on enzyme velocity and on the saturation constant. Predictions provided a good fit to experimental data of Suzuki et al. ( 1 974) and Laudelout et al. (1976) on the effectsof pH value on whole cells and cell-free extracts and allowed calculations of values for pK,, pK, and pK,. Values of K, derived from these experimental data compared well with independent estimates of K,, providing support for the proposed scheme. Further analysis of the model allowed prediction of the effect of ammoniaconcentration on the optimum pH value for growth (pH,) which is described by the equation:
where N is the total nitrogen concentration and K$ = (K,/K,)K,. Experimental data described above indicated values for K: sufficiently large to predict a linear decrease in pH, with a logarithmic increase in ammonia concentration over the pH range 1-50pgml-'. The pK, value of nitrite is 3.15 and inhibition at high pH values results from competitive inhibition by hydroxyl ions (Boon and Laudelout, 1962). At acid pH values, inhibition occurs through increased formation of nitrous acid (see Section V.B.). In addition, as pH values decrease below 4, significant chemical decomposition of nitrite occurs with formation of nitrogen oxides. Laudelout et al. ( 1 976) incorporated kinetics associated with these proposed mechanisms for pH effects, and those of oxygen concentration, into a mathematical model for nitrification and found good agreement between predicted and experimental results. In particular, the model correctly predicted the effect of aeration on transient increases in nitrite concentration. Despite the neutrophilic/alkalophilic growth of pure cultures of nitrifying bacteria in liquid medium, nitrification in acid soils is well documented (Weber and Gainey, 1962; Vitousek et al., 1982; Wickramasinghe et al., 1985; Klein et al., 1983; Federer, 1983; Adams, 1986).Four explanations have been proposed for this phenomenon: (a) the existence of acidophilic strains, (b) surface growth, (c) the existence of micro-environments of neutral pH value, and (d) heterotrophic nitrification. Each of these will now be discussed in turn.
1 60
J. I. PROSSER
A. DO ACIDOPHILIC STRAINS OF NITRIFYING BACTERIA
EXIST?
1. Ammonia Oxidizers On the basis of energetic considerations discussed above, and on the effects of pH value on ammonia availability, the existence of acidophilic ammonia oxidizers would appear unlikely. However, ammonia oxidizers are frequently isolated from acid soils in which nitrification takes place. Strains of Nitrosospira, Nitrosomonas and Nitrohacter were isolated by Bhuiya and Walker (1977) from acid tea soils (pH 5.0-6.2) and Walker and Wickramasinghe (1979) found a Nitrosospira strain to be the only isolate from acid tea soils in Bangladesh (pH4.0-4.5). Sri Lankan soils of similar pH values also contained strains of Nitrosolobus and Nitrosouibrio. Martikainen and Nurmiaho-Lassila (1985) and Hankinson and Schmidt (1984) also found Nitrosospira to be the dominant genus in coniferous forest soils. Other strains including Nitrosouibrio have been isolated by Vitousek et al. (1982) from an acid forest soil. In our laboratory we have isolated a similar broad range of ammonia-oxidizing organisms from soils of pH value down to 2.5 and from one soil maintained at pH 4.0-4.5 for 2-5 years (Allison, 1989). In addition, nitrification in some acid soils is inhibited by inhibitors of autotrophic nitrification. For example, Wickramasinghe et ul. (1985) found inhibition of nitrification in acid tea soils (pH 4.0-4.3) by nitrapyrin and dicyandiamide (DCD)and Killham (1986) reported inhibition by acetylene of nitrification in arable soils of pH 4.5. All of the strains isolated from acid soils are neutrophilic or alkalophilic with pH ranges and optima for growth typical of ammonia oxidizers from other environments. Acidophilic strains of ammonia oxidizers have, therefore, not been isolated in pure culture and none have been reported in enriched cultures. Many of these studies may be criticized for use of isolation media of neutral pH value, but we have been unable to isolate ammonia oxidizers on media of low pH value even after incubation for several months. It is, however, possible that specific, as yet undiscovered conditions are required for successful isolation. The inability to isolate acidophilic ammonia oxidizers, coupled with plausible explanations for their lack of existence, indicate that they are not responsible for nitrification in acid soils. 2. Nitrite Oxidizers The same would have been said with regard to nitrite oxidizers until isolation by Hankinson and Schmidt (1984) of acidophilic and acid-tolerant strains of Nitrobarter dominant in acid forest soils of pH 4.3-5. Isolation was achieved by carrying out most-probable-number counts in liquid media of pH 7 and 5, enabling simultaneous isolation and enumeration and subsequent assessment
AUTOTROPHIC NITRIFICATION IN BACTERIA
161
of the importance of each isolated strain. In addition, nitrite concentration was maintained below 0.1 PM to prevent nitrite toxicity at low pH values. The acid-tolerant strain grew at pH values down to 5.5 with an optimum of 7.2, while the acidophilic strain grew between pH values of 4.6 and 7, but not at pH 8, with optimal growth at pH 5.5. At low pH values the acidophile exhibited signs of stress, including cell lengthening and branching, but nitrite oxidase activity was demonstrated at pH values down to 3.5. In terms of nitrite oxidation, therefore, acidophilic autotrophic strains may be responsible for the second stage of nitrification in acid soils. B. PROTECTION FROM EFFECTS OF
pH
BY SURFACE GROWTH
The effect of surface attachment on the growth and activity of nitrifiers has been discussed in Section 1V.C. Lees and Quastel (1946)provided evidence for the association of nitrifiers with the surface of particles in soil, but McLaren and Skujins (1963) were the first to consider the significance of surface attachment for pH optima for nitrification. They compared the rate of nitrite oxidation by a pure culture of Nitrobacter sp. in liquid culture with that in either soil or negatively charged ion-exchange resins perfused with nitrite. Relative rates of nitrification by attached populations were found to be less than those in liquid culture over the pH range 5.5-7 and the pH value for half the maximum rate of nitrite oxidation was 0.5 pH units higher in soil. This difference was explained by inhibition caused by localized increases in pH value due to adsorption of H + ions or reduced substrate availability due to repulsion of NO; ions by the negatively charged particles. The situation for ammonia oxidation is more complex as both substrate (NHf) and Hf ions will be attracted to soil particles (see below). Keen and Prosser (1987b) studied the combined effects of three physiological factors, relevant to soil nitrification, on nitrite oxidation by a Nitrobacter species: (a) low substrate concentration, (b) surface growth, and (c) whether cells were actively growing or in stationary phase. In liquid batch culture the optimum pH for growth was 7.5 but cells did not grow below pH 6 in standard liquid culture media containing 50pg NO; - N ml-'. At lower initial nitrite concentrations (5-40pg NO, ml- '), however, growth occurred down to pH 5.5, but not below this value. This can be explained by reduced toxicity through nitrous acid and is relevant to the methodology used by Hankinson and Schmidt (1985) for isolation of the acidophilic Nitrobacter strain. A similar effect was found in nitrite-limited chemostat cultures with growth down to pH 5.5 at a dilution rate of 0.016 h-' (33% of the maximum specific growth rate in batch culture) but not at pH 5. Unlike Mclaren and Skujins (1963), Keen and Prosser found no differences between the pH profiles for growth of suspended cells and colonized glass
162
1.1 PROSSER
coverslips, possibly due to differences in the degree of negative charge on the surface. Specific growth rate was, however, stimulated by the presence of glass coverslips. Growth of a Nitrohacier strain was also studied on positively charged anion-exchange resin beads which, as discussed earlier, provide a better substratum for growth due to attraction of nitrite and, possibly, repulsion of H f ions. Initial attachment to glass was unaffected by pH value but attachment to anion-exchange resin beads increased sharply with increased pH. This is thought to be due to an increase in the negative cell surface charge with pH. The effect of pH on attached cell populations was studied further in a heterogeneous continuous flow system in which cells were present as a biofilm on ion-exchange resin beads suspended and circulated within liquid medium. Under these conditions, nitrite oxidation was possible down to a pH value of 4.5, that is 1.5 units lower than in batch culture. Colonized beads removed from this continuous flow culture at pH 5 were unable to carry out nitrite oxidation in batch culture at pH values less than 6. Attached cells were contained within a glycocalyx, confirming earlier work of Cox et al. (1980) on growth of nitrifying bacteria on glass beads in a continuous-flow packedcolumn reactor. Thus, it is possible for actively growing, surface-attached cells, supplied continuously with a low concentration of nitrite to exhibit high rates of nitrite oxidation at pH 4.5. Experiments with glass slides indicate that localized pH effects, i.e. concentration of Hf by the resin beads, may not be important and that attraction of substrate (NO;) is a more significant factor than tolerance to low pH values. In soil, where the majority of particles are negatively charged, this effect will be reversed and there is in fact some evidence that cells of the Niirohacter strain may be less firmly attached than those of the Niirosumonas strain to such surfaces. In the soil, ammonia will be adsorbed to clay minerals and humic material. This concentration of substrate offers the potential for increased rates of ammonia oxidation, but this effect may be counteracted by localized increases in H + concentration a t the same anionic sites. In fact, comparison of specific growth rates of pure cultures of N . eurupaea inoculated into sterile soil with specific growth rates in liquid medium indicate little stimulating or inhibitory effects caused by surface properties (Powell and Prosser, 1986a). Surface properties are, however, important when considering pH effects, and work on nitrification in the presence of purified clay minerals is of relevance. Goldberg and Gainey (1955) studied the effect of several clays, of differing bufferingcapacity and saturated with K or NHZ, on nitrification by enriched cultures of nitrifiers. They demonstrated that oxidation of ammonia only occurred after release of NH; into the liquid medium. They also found +
163
AUTOTROPHIC NITRIFICATION IN BACTERIA
incomplete oxidation of adsorbed ammonia, a proportion of which appeared to be “fixed” by the clay minerals. Powell (1985) studied the kinetics of nitrite formation by N . europaea in the presence of clay minerals. A single phase of nitrification was observed in the presence of illite while vermiculite and montmorillonite (both expanding clays) gave rise to a second phase of nitrite production at a lower specific rate. This may be explained by the existence of two “pools” of ammonia, one of which is less available, producing lower concentrations of dissolved ammonia. Although the available evidence indicates dissolved rather than fixed ammonia as substrate for ammonia oxidation, adsorption of clay minerals may provide localized buffering of surface-associated ammonia oxidation, reducing limitation due to acid production. Armstrong and Prosser (1988) investigated growth of N . europaeu in batch culture in the presence and absence of ammonia-treated vermiculite(ATV),prepared by passing anhydrous ammonia through vermiculite (Ahlrichs et al., 1972). In complete inorganic medium containing 50 pg NH: - N ml- and inoculated with N . europaea, a yield of 5.6 pg NO; - N ml- was obtained before growth ceased due to acid production (Table 5). The presence of ATV did not significantly change this final nitrite yield and did not buffer the medium, which again became acidified. The ATV did, however, reduce the maximum specific growth rate and abolished the lag phase before ammonia oxidation. In liquid medium in which ATV provided the only source of ammonia, the final nitrite concentration increased significantly to I6 pg NO; - N ml- and medium was not acidified. Limitation here is thought to have been due to exhaustion of freely available ammonia, as some will be unavailable in the internal layers of the clay particles. An alternative possible limiting factor is localized reduction in pH value. These data imply that ammonia derived from adsorption sites on the clay mineral, probably following diffusion into liquid medium, is exchanged for H + ions produced during ammonia oxidation. Further, in terms of ammonia
’
’
TABLE 5 . Growth parameters of Nitr0.WJm~JnU.Seuropuc.a in the presence and absence of ammonia-treated vermiculite (ATV) (Armstrong and Prosser. 1988) Final nitrite Specific growth Duration of concentration Final pH rate (h-’) lag phase (h) (pgNO; - N ml-’) value Complete medium minus ATV Complete medium plus ATV Incomplete medium plus ATV
0.060 0.045 0.038
10
0 0
5.6 6.0 16.0
< 7.0 < 7.0 > 7.0
Complete and incomplete media contained 50 and Opg NH: - N ml-’, respectively. The pH values of the media were assessed by change in colour of the indicator phenol red at pH 7.
164
J. I. PROSSER
oxidation, these H ions were effectively immobilized and the only noticeable effect was a decrease in the maximum specific growth rate to approximately 50% of that in liquid culture. This may merely reflect the low concentration of ammonia in the liquid medium, released by the clay mineral, which is the direct source of substrate. This, therefore, provides a mechanism for ammonia oxidation in acid soils on a localized scale and links with the consideration of microsites, below. Protection may also be provided by EPS material described here and in other studies, but the precise mechanism of this protection is unclear and much more detailed and critical studies are required before this can be considered seriously. Virtually nothing is known of the chemical composition of EPS material nor of the means by which it might give protection. It is therefore easy to provide it with any properties which are considered desirable. Biofilms do, however, increase stability by preventing removal of cells which is particularly important in sewage treatment processes and may permit high rates of activity not necessarily associated with growth. There is now evidence (Allison, 1989) that the pH minima for growth and activity of ammonia oxidizers may be significantly lower in soil than in liquid batch culture. A continuous-flow sand column, inoculated with N . europuea, and supplied continuously with ammonium, was capable of significant nitrification at pH 5.7. The same strain in liquid culture did not grow below pH 7. Ammonia oxidation was not possible at pH 5.5 or lower and surface growth and protection does not provide a complete explanation for autotrophic nitrification in soils of pH 4. It does, however, significantly lower the pH minimum for ammonia-oxidizing activity. +
C. MICRO-ENVIRONMENTS AND UREASE ACTIVITY
The existence of micro-environments of alkaline or neutral pH value has been suggested as a possible explanation for autotrophic nitrification in acid soils. Unfortunately, as when invoking protection by surface growth, it is easy to postulate the existence of micro-environments with any required property but difficult to determine their existence and more importantly their significance. To an extent, a biofilm provides a micro-environment where organisms may be protected or buffered from the effects of low pH value. A major feature of biofilms is their spatial heterogeneity and organization which can lead to development of communities with distinctive properties not found in spatially homogeneous environments. Molina (1985) provided a theoretical basis for the study of soil microaggregates and the effect of microsites on the kinetics of nitrification. Soil was considered to consist of an infinite population of micro-aggregates, each containing a cluster of ammonia oxidizers. Ammonia oxidation within a
AUTOTROPHIC NITRIFICATION IN BACTERIA
165
cluster continued until limited by acid production. Nitrification therefore consisted of numerous asynchronous pulses of ammonia oxidation, the asynchrony arising through variability in the length of lag phases before oxidation commenced. The kinetics of nitrification, as measured by increases in nitrite concentration, represented accumulation of nitrite produced by the whole population of micro-aggregates, and clusters, and was related to the distribution in length of lag phases. Virtually nothing is known of the physiological factors determining the lengths of lag phases for ammonia or nitrite oxidizers. Molina (1985) tested this theory by sieving soil, to obtain micro-aggregates, which were then inoculated individually into ammonia-oxidizer liquid medium, with growth assessed by testing for acid production. His data explained observed “gross” kinetics for nitrification in soil and suggested that the soil contained 56 clusters of ammonia oxidizers per gram. In addition, the specific rates of nitrite production calculated from his data were lower than those observed in liquid culture. A similar approach has been adopted by Darrah et al. (1987) to explain variation in the observed kinetics of nitrate formation by soils of different pH value. Overrein (1967) and Hankinson and Schmidt (1985) suggested that close association between nitrifiers and heterotrophic organisms mineralizing organic nitrogen may allow nitrification in acid soil microsites. Ammonia released by mineralization would raise the local pH value with subsequent reduction in pH value through nitrification. An increase in the numbers of autotrophic nitrifying bacteria in an acid forest soil following addition of nitrogen, phosphorous and potassium fertilizers, even when soil pH remained at 4.5, was observed by de Boer et al. (1989a). Inhibitor studies showed nitrification to be autotrophic and organisms isolated were not acidophilic. In addition, nitrification appeared to be directly coupled to mineralization, as in soil suspensions of both acid and neutral pH values, the onset of nitrate production corresponded with the onset of net ammonia production when nitrification was inhibited by the addition of nitrapyrin. The delay in nitrification was not due to substrate limitation, as sufficient ammonia was present, nor due to an increase in pH value, but appeared to involve the close proximity of mineralizing and nitrifying organisms. Further evidence came from the observed stimulation of nitrification in soil suspensions supplemented with urea. Again, this stimulation did not result from an increase in pH value but was related to the previously undiscovered presence of urease activity in ammonia oxidizers. An ammonia-oxidizing strain isolated from acid soil, when incubated at pH 4.3 in the presence of Nitrobacter (to reduce nitrite toxicity), resulted in complete conversion of 1 mM urea to nitrate. During this process, pH rose to 6.6 as urea hydrolysis occurred and then returned to pH 4.5 as nitrification became dominant.
166
J ILPROSSER
Although ATCC strains of Nitrosomonas and Nitrosospira showed no urease activity under the conditions tested, strains isolated from other acid soils (Allison, 1989) have since been shown to have similar properties. Consequently, de Boer et al. (1989b) suggested that urease activity may provide cells with an alternative source of ammonia which is particularly important at low pH values. Urea may enter the cell by passive diffusion and may accumulate to higher intracellular levels than ammonia at low pH values. Urease activity, producing intracellular or extracellular ammonia, will then provide a source of ammonia, simultaneously and locally increasing the pH value. D. HETEROTROPHIC NITRIFICATION
Nitrification is now defined as the oxidation of reduced N compounds rather than restricting the definition to oxidation of ammonium. This broader definition encompasses heterotrophic nitrification which is reviewed extensively by Verstraete (19759, Focht and Verstraete (1977) and Killham (1986). Heterotrophic nitrifiers include a wide range of fungi, actinomycetes and bacteria, with most experimental work being carried out on aspergilli, streptomycetes, Alcaligenes species and arthrobacters. Fungi are generally considered to be the most efficient and most numerous of these groups in soil. Substrates include ammonium, hydroxylamine, hydroxamic acids, amino or oxime nitrogen, aliphatic and aromatic nitro compounds, and nitrite. The products are nitrite, nitrate and a wide range of nitrogenous organic compounds. In no case has heterotrophic nitrification been shown to be associated with energy production or growth and the process is described as endogenous or secondary metabolism. The products of heterotrophic nitrification provide the only clues to its function in these organisms (Focht and Verstraete, 1977). They include hydroxaminic acids which can act as growth factors and have been implicated in iron uptake. On the other hand, many of the products are toxic and may provide a competitive advantage in natural environments. Killham (1989)also suggests heterotrophic nitrification may enable oligotrophic growth of fungi in coniferous forest soils. Two biochemical pathways have been proposed and may act in combination (Fig. 8). The inorganic pathway (Aleem, 1975) is essentially a combination of those carried out by individual autotrophic organisms, with oxidation of organic N to hydroxylamine, nitroxyl, nitrite and nitrate. The organic pathway (Doxtader, 1965) is believed to begin with oxidation of an amine or amide to a substituted hydroxylamine, with subsequent oxidation to nitroso and nitro compounds and finally to nitrate. At each stage this pathway can link with the inorganic pathway, e.g. by release of free hydroxylamine. A
AUTOTROPHIC NITRIFICATION IN BACTERIA
NR, A NH,OH
t
t
--D
(HNO)
t
167
NO;
R N I 3 . d R N H O H A RNO 4 RNO, FIG. 8. Proposed inorganic and organic pathways for heterotrophic nitrification. third mechanism, involving OH- radicals arising from hydrogen peroxide production and lignin breakdown, has been suggested by Wood (1987). Complete nitrification may require the involvement of autotrophic nitrite oxidizers. Castignetti and Gunner (1980, 1982) studied the production of nitrite from pyruvic oxime and hydroxylamine by an Alcaligenes species, with subsequent nitrite oxidation to nitrate by Nitrobacter sp. In monoculture, however, Nitrobacter sp. did not oxidize pyruvic oxime, the presence of which also inhibited nitrite oxidation. In addition, Nitrobacter sp. was very sensitive to levels of hydroxylamine which were tolerated by Alcaligenes strains. In coculture, despite the presence of pyruvic oxime and high levels of hydroxlamine, the Nitrobacter strain remained viable and oxidized nitrite to nitrate. In addition to providing an explanation for the relatively high populations of the genus Nitrobacter in comparison to those of Nitrosomonas found in the soil, this work raises important questions regarding interactions of nitrifiers with other organisms involved in the nitrogen cycle. This close interaction is similar in some respects to that between ammonifiers and nitrifiers discussed above and requires new experimental approaches for more detailed study. Rho ( 1 986) also reported an interaction between a heterotrophic nitrifier, Arthrohacter sp., and a Corynehacterium species, isolated from an estuarine environment. In medium containing ammonium, acetate and inorganic salts, the Arthrohacter species produced low, and the Corynehacterium species negligible, amounts of nitrite and nitrate. In co-culture, production of nitrite and nitrate was an order of magnitude greater than by Arthrobacter species alone. This stimulation occurred for both resting and actively growing cells. In monoculture, neither organism was capable of growth on media containing 1 mg ml-' of NO; - N or acetaldoxime but both grew in co-culture and nitrification of acetaldoxime occurred. As with many of the interactions discussed here, the physiological basis of this particular interaction is unknown and needs to be determined before its ecological significance can be assessed. Rates of nitrification by heterotrophic organisms, measured as nitrite producer per cell or per unit biomass, are traditionally considered low in comparison to those of autotrophic organisms. For example, Castignetti and Hollocher (1984) quote specific activities of 0.066-0.003 pmol N min-' mg protein- for nitrification of pyruvic oxime and hydroxylamine by
168
J. 1. PROSSER
Alcaligenes species. Although this is the highest rate of heterotrophic nitrification reported, it is still one order of magnitude less than that carried out by Nitrosomonas species. The biomass concentrations of heterotrophic nitrifiers may, however, be several orders of magnitude greater than those of autotrophs and many, particularly the fungi, can grow at low pH values. Such organisms have been isolated from acid soils (Remade, 1977; Johnsrud, 1978). The majority of heterotrophic nitrifiers isolated are not acidophilic, but Stroo et al. (1986) isolated a fungal nitrifier, Ahsidia cyfindrospora, from an acid forest soil in which nitrate was produced at pH 3.2-6.1. N o autotrophic nitrifiers could be isolated but A . cylindrospora produced nitrite and nitrate from p-alanine at pH values of 4 . W . 8 . Hydroxylamine, hydroxamic acids and primary aliphatic nitro compounds did not accumulate during nitrite formation, and addition of sterile soil was required for complete oxidation to nitrate. This final step may therefore have been non-enzymic. Lang and Jagnow (1986) also reported isolation of fungi from a forest soil with capability for heterotrophic nitrification at low pH values. The significance of heterotrophs appears to depend on a number of factors. The process of heterotrophic nitrification has been identified in a heath soil (pH 4.3) (van de Dijk and Troelstra, 1980),a mature coniferous forest soil (pH 5.8) (Schimel et al., 1984) and a larch humus (pH 3.5-4.0)(Adams, 1986). Heterotrophic nitrification in these studies was indicated by a lack ofeffect of inhibitors of autotrophic nitrification, lack of stimulation by addition of ammonium, increased nitrate production after amendment with peptone or identification of the fate of 'N pools following addition of radio-labelled ammonium. The discovery of urease activity in ammonia oxidizers necessitates the reassessment of some of these assumptions and in some acid soils there are strong indications that nitrification is not due to heterotrophs. Killham (1987), using acetylene as an inhibitor of autotrophic nitrification, found nitrification potentials of acid coniferous forests soils to be dominantly of heterotrophic origin while those of agricultural soils of pH 4.5-7.5 were all dominantly autotrophic. Killham (1986) discusses this topic more fully and suggests that factors other than pH value (e.g. the form and mineralization rate of organic nitrogen) may be significant in determining the relative significance of autotrophic and heterotrophic processes. Kreitinger et al. (1985) found stimulation of nitrate production by peptone in an acid forest soil of pH 3.6-4.0. Nitrapyrin did not inhibit nitrification in unamended soil, but caused inhibition in soils amended with ammonium, decreased carbon dioxide fixation and stimulated mineralization. On the basis of these results, the authors suggest that methylotrophs may have been responsible for significant levels of ammonium oxidation. The situation is complicated further by the discovery by Robertson and Kuenen (1983) of an aerobic denitrifier, Thiosphaera pantotropha, which can
AUTOTROPHIC NITRIFICATION I N BACTERIA
169
also carry out heterotrophic nitrification. Castignetti and Hollocher (1984) demonstrated that many common denitrifiers were capable of heterotrophic nitrification, but some were considered poor nitrifiers. Thiosphaera panrotropha produces nitrite from ammonia, hydroxylamine and urea (Robertson and Kuenen, 1984,1988)with both nitrification and denitrification maximal at dissolved oxygen concentrations approximately 30% of that of air. Correct evaluation of the ability of such organisms to nitrify requires full nitrogen balances to be carried out, as nitrite will only accumulate when denitrification (i.e. nitrite reduction) is prevented. Kuenen and Robertson (1987) suggest that all aerobic denitrifiers are heterotrophic nitrifiers, although the level of oxygen at which denitrification ceases varies between species. The discovery of organisms such as T.pantotropha which can carry out several processes within the nitrogen cycle previously considered distinct impacts on the way in which we measure and perceive nitrogen-cycle processes and the organisms involved. It highlights the versatility of heterotrophic and autotrophic nitrifiers and demonstrates their previously unrecognized metabolic potential. Physiological studies can provide information on the conditions required for expression of these different metabolic potentials but assessment of their significance in natural environments provides a much greater challenge.
IX. Inhibition of Nitrification Inhibitors of nitrification serve three practical purposes. Firstly, their application along with ammonia-based agricultural fertilizers can reduce economic losses and pollution due to denitrification or leaching of nitrate formed by nitrification. Secondly, they are used as metabolic blocks in ecological studies, to enable distinction of different processes within the nitrogen cycle. Thirdly, inhibitors are important in sewage treatment processes where they may result in washout of nitrifiers from suspended biomass systems. Inhibitors are listed by Hauck (1980) and Bremner (1986) and many pesticides and plant products are also inhibitory (Goring and Laskowski, 1982;Sahrawat and Keeney, 1985).The majority of inhibitors are specific to ammonia oxidation, although often inhibiting nitrite oxidation at high concentrations. The most widely used commercial inhibitor is nitrapyrin or NServe (2-chloro-6-(trichloromethyl)pyridine) (Goring, 1962). Its major disadvantage is its low solubility in water but it is an effective inhibitor of soil nitrification and is widely used in ecological studies to inhibit specifically autotrophic nitrification. Etridiazol (5-ethoxy-3-trichloromethyl-1,2,4-triadiazole) and dicyandiamide (DCD) have also attracted commercial interest. The former has fungicidal properties while DCD acts as a slow-release
170
J I PROSSER
nitrogenous fertilizer. Inhibition by allylthiourea is occasionally preferred to nitrapyrin because of its greater water solubility (Hall, 1986). Two groups of inhibitors are based on gaseous compounds. Xanthates act by releasing carbon disulphide, the most useful compound being potassium ethyl xanthate (Ashworth et al., 1979). Their initial discovery arose through inhibition of nitrification in experiments for which water was collected through rubber tubing, which releases carbon disulphide (Powlson and Jenkinson, 197 1). Inhibition of ammonia oxidation by acetylene was discussed in Section 1V.A and the effectiveness of non-gaseous substituted acetylenes has been studied (Bremner, 1986). Greatest inhibition of soil nitrification was produced by 2-ethynylpyridine and phenylacetylene, the former being as effective as nitrapyrin and etridiazole. Chlorate is considered an inhibitor of nitrite oxidation, although the true inhibitor is thought to be chlorite, ClO,. Chlorate is an alternative substrate and competitive inhibitor of nitrate reductase in Nitrohacter species (Straat and Nason, 1965) and can act as a terminal electron acceptor for nitrite oxidation of Nitrohacter species in the absence of oxygen (Hynes and Knowles, 1983). Nitrohacter species therefore convert chlorate to chlorite which then inhibits nitrite oxidation. Importantly, Hynes and Knowles demonstrated that N . europaea is 50 times more sensitive to chlorite than a Nitrohacter strain. In co-culture, therefore, inhibition was not specific to Nitrobacter strains, and N . europaea was inhibited by chlorite produced by the nitrite oxidizer. Keeney (1986) has recently reviewed the factors affecting inhibition in soil and Oremland and Capone (1988) discuss the use of inhibitors, particularly nitrapyrin and acetylene, as metabolic blocks. Suggestions have been made for a r81e for naturally occurring nitrification inhibitors in allelopathic inhibition of nitrification in climax ecosystems. Rice and Pancholy (1972, 1973, 1974) proposed that phenolic compounds and tannins, produced by vegetation in such ecosystems, inhibited ammonia oxidation thereby reducing nitrite losses. There is now increasing evidence (see McCarty and Bremner, 1986; Killham, 1989) that inhibition by such compounds is neither widespread nor significant and that nitrification in such ecosystems is limited rather by the rate of ammonification of organic nitrogen. A. MECHANISM OF INHIBITION
Despite widespread use and commercial interest in inhibitors of nitrification, very little is known of their mechanism of action or of their effects on the physiology of ammonia oxidizers. Many inhibitory compounds act as chelating agents and chelation of metal components of the ammonia monooxygenase enzyme has been suggested as a general mechanism for inhibition (Lees, 1952; Hooper and Terry, 1973). The most extensively studied inhibitor is
AUTOTROPHIC NITRIFICATION IN BACTERIA
171
nitrapyrin and Campbell and Aleem (1965) reported that addition of copper relieved inhibition of ammonia oxidation by cell suspensions of N . europaea. Bhandari and Nicholas (1979) reported a similar effect on inhibition by sodium diethyldithiocarbamate. Chelation of the copper components of ammonia mono-oxygenase was therefore accepted as the mode of action for this inhibitor, although inhibition by another chelating agent, allylthiourea, was not affected by addition ofcopper. The chelating action of nitrapyrin must be specific to ammonia mono-oxygenase as other copper-containing enzymes, e.g. hydroxylamine oxidoreductase and nitrite oxidoreductase, are not effected (Oremland and Capone, 1988). In addition, Powell and Prosser (1986a) found increased inhibition by nitrapyrin of growing cultures of N . europaea in the presence of copper. Effects on growing cells and cell suspensions may differ for several reasons (see below) but these data suggest that the mechanisms of inhibition may be more complex than simple chelation. The inhibitors based on carbon disulphide are also chelating agents. Underhill and Prosser (1987b) investigated inhibition of both N . europaea and Nitrobacter sp. by potassium ethyl xanthate in continuous culture at a range of inhibitory concentrations. Chelating compounds would be expected to act as non-competitive inhibitors but steady state data indicated competitive inhibition of the Nitrobacter species while data for N . europaea did not indicate non-competitive inhibition. Nitrapyrin also inhibits methanogenesis (Salvas and Taylor, 1980) and methane oxidation (Topp and Knowles, 1984). Nitrapyrin hydrolyses chemically to chloropicolinic acid, which contains no trichloromethyl group. Salvas and Taylor (1980, 1984) found inhibition of methane oxidation by this compound but not of nitrification or methanogenesis. They suggested the involvement of the trichloromethyl group in inhibition of nitrification and methanogenesis and the potential use of chloropicolinic acid for selective inhibition of methane oxidation. Powell and Prosser (1985) found inhibition by both nitrapyrin and chloropicolinic acid of growing cultures of N . europaea, and trichloromethane (chloroform) at the equivalent concentration had no effect. Inhibition by chloropicolinic acid occurred after a lag of approximately 8 h, while nitrapyrin caused inhibition immediately after addition. Salvas and Taylor (1980, 1984) studied effects on cell suspensions, rather than growing cultures, and differences in response to inhibitors may result from differences in uptake properties or their conversion to more inhibitory compounds. As discussed above, extrapolation of data on cell suspensions to growing populations of cells is dangerous. B. STRAIN VARIABILITY
The extent and type of inhibition varies markedly between different strains and different genera of ammonia-oxidizing bacteria. This was first noted by Belser and Schmidt (1981) who found differences in sensitivity to inhibition by
172
J. I. PROSSER
nitrapyrin between strains of Nitrosospira, Nitrosolobus and five strains of Nitrosomonas. Differences within Nitrosomonas strains were as great as those between Nitrosomonas, Nitrosospira and Nitrosolobus and are therefore not associated with specific genera. Powell and Prosser (1986b) found differences in sensitivity between two strains of N. europaea derived from the same parent strain during continued laboratory subculturing. Nitrapyrin was added to batch cultures either at the beginning of incubation or during exponential growth and the kinetics of nitrite production is illustrated in Fig. 9. Growing cells were more sensitive to inhibition than stationary phase cells. In the example illustrated, maximum specific growth rate was reduced from 0.047 to 0.0133 h - after addition to exponentially growing cultures and to 0.029h-' after addition at the beginning of incubation. Similar behaviour was found for all strains (Table 6) but quantitative effects on both maximum specific growth rate and the length of lag periods varied between strains. In addition, detailed examination of these kinetics, coupled with most-probable-number counts indicated a
2
w
25
50 TIME
7s
100
125
FIG. 9. Production of nitrite by Nitrosomonas europaea in liquid batch culture. Key: 0 ,control; 0 ,addition of O S p g nitrapyrin mi-' before incubation; 0, addition of
O S p g nitrapyrin ml- during exponential growth. From Powell and Prosser (1986a)
with permission.
173
AUTOTROPHIC NITRIFICATION IN BACTERIA
TABLE 6. Growth characteristics of three strains of Nitrosomonas europaea in the presence and absence of OSpg nitrapyrin ml-' (from Powell and Prosser, 1986a).
Tred tment
Parent strain
Strain 2
Strain 3
Length Specific of lag growth phase (h) rate(h-l)
Length Specific oflag growth phase (h) rate(h-')
Length Specific of lag growth phase (h) rate(h-l)
N o nitrapyrin
22
0.0452
9
0.0465
7
0.084
Nitrapyrin added before incubation
33
0.03I3
9
0.0285
7
0.0342
Nitrapyrin added to exponentially growing culture
-
0.0076
-
0.0133
-
0.0195
bacteriostatic effect of nitrapyrin on the parent strain and one derived strain, but a bactericidal effect on the second derived strain. The basis for marked qualitative and quantitative differences in sensitivity between such closely related strains is unclear and is an obvious and important area for study. It has important implications for the commercial use of such inhibitors and for discovery of new inhibitory compounds. It may also help to explain difficulties in distinguishing between bacteriostatic and bactericidal effects of nitrapyrin added to soil (Rodgers and Ashworth, 1982)where strains of different sensitivity may be selected after inhibitor treatment. More detailed studies of inhibition of both N. europaea and a Nitrobacter strain by potassium ethyl xanthate (Underhill and Prosser, 1987b) and inhibition of N . europaea by nitrapyrin (Powell, 1985) in continuous culture produced the surprising result that both inhibitors stimulate ammonia oxidation at low concentrations. Figure 10 shows stimulation of ammonia oxidation by 0.2 pg potassium ethyl xanthate ml- ',a concentration which in batch culture had no effect on stationary phase or exponentially growing cells. A reduction in steady state ammonia concentration was associated with an increase in cell concentration and yield coefficient but cell activity remained constant, i.e. cells appeared to grow more efficiently. Cell activity was reduced at higher, inhibitory concentrations. Powell (1985)observed stimulation of ammonia oxidation by N. europaea at concentrations of nitrapyrin (0.5-1.5 p g ml- ') which were inhibitory in batch culture. This stimulation was associated with increases in cell activity by a factor of two at a concentration of 1.5pg ml-'. These effects occurred at substrate concentrations approaching those of the K, value and are, therefore, particularly significant for inhibition of nitrification in soil, but again the biochemical mechanism of stimulation and inhibition requires further study.
174
J. I . PROSSER
IS
0
100 200
300 400 500 600 700 Time (h)
FIG. 10. Stimulation of ammonia oxidation following addition of potassium ethyl xanthate (0.2pg ml- I ) to a steady state culture of Nitrosomonas ruropaea. The time of addition is indicated by the arrow. From Underhill and Prosser (1978b) with permission. C. INHIBITION OF ATTACHED CELLS
Both Nitrosomonas and Nitrobacter species are more sensitive to inhibition by potassium ethyl xanthate (Underhill and Prosser, 1985)and nitrapyrin (Powell and Prosser, 1986b) than when treated with equivalent concentrations after inoculation into sterile soil. An interesting differential effect was found for inhibition of potassium ethyl xanthate, with a Nitrohacter strain being more sensitive than a Nitrosomonas strain in liquid culture and the reverse behaviour in soil. This can be explained by adsorption of xanthate or its breakdown products to soil particles, which will also adsorb ammonium ions and encourage colonization by the Nitrosomonas strain. The Nitrohacter strain will, therefore, be less affected by the inhibitor if it can exist in the soil solution, where its substrate will be concentrated. Much of the protection afforded by soil is believed to result from immobilization of inhibitors by organic matter but there is also evidence of protection through surface attachment. Powell (1985) demonstrated that cells of N. europuea newly attached to glass slides were as sensitive to inhibition by nitrapyrin as freely suspended cells, while established biofilms were not affected by nitrapyrin concentrations which gave significant inhibition in liquid culture. Cells retained this reduced sensitivity after detachment, suggesting a relatively permanent change in physiology. EPS
AUTOTROPHIC NITRIFICATION IN BACTERIA
175
material, produced within the biofilm, may be involved in such protection, being retained by detached cells as capsular material. Protection was also afforded by colonization of ATV, which again may suggest protective effects by clay minerals within the soil. While these physiological studies are of some relevance to ecology, what is severely lacking is an understanding of the biochemical mechanisms for inhibition by these compounds. Such an understanding will have important practical implications for development of new inhibitors and more efficient use of existing compounds and, importantly, will provide information on the biochemistry of ammonia and nitrite oxidation and its control and regulation with regard to activity and growth.
X. Concluding Remarks In this article I have attempted to highlight the ways in which our traditional view of nitrification must be modified in the light of recent advances in our knowledge of the physiology of autotrophic ammonia- and nitrite-oxidizing bacteria. These advances have arisen through basic physiological and biochemical studies and also through the need to explain phenomena associated with nitrification in natural environments. We can no longer consider N . europaea to be the dominant or even a typical ammonia oxidizer. Other species and strains are important in a range of environments, and physiological differences leading to dominance of these strains requires investigation. In particular, marine strains appear to have significantly different properties and the mechanisms by which they survive at low substrate concentrations is a particularly interesting area for study. Many aspects of basic biochemistry and physiology are poorly understood. Little is known of the mechanisms of transport of substrate into the cell, despite their potential importance in determining saturation constants for growth and activity. Only limited data are available on maintenance energy requirements which, at environmental substrate concentrations, will be significant. More work is also required to confirm the proposed mechanisms for regulation and control of substrate oxidation, energy generation and carbon dioxide fixation. Such studies are of fundamental value in our understanding of the autotrophic mode of existence. Practical applications include a greater understanding of the mechanisms of action of inhibitors, particularly those of ammonia oxidation. Nitrifiers are trapped by the mode of existence which they have chosen. Their substrates provide the bare minimum of energy required for growth. They must then use much of this energy to form reducing equivalents required for carbon dioxide fixation. This requirement would be alleviated by assimilation of organic carbon. Ammonia oxidizers, however, appear to gain
176
J I PROSSER
little benefit from this, although nitrite oxidizers are more versatile and are capable of mixotrophic and heterotrophic growth. Both groups are inhibited by high concentrations of their substrates and have little energy to spare for high-affinity substrate uptake systems which would enable growth at low substrate concentrations. The range of concentrations over which they can exist is therefore limited. Despite these disadvantages, nitrifying bacteria occupy niches in many ecosystems and must, therefore, compete successfully with faster and more efficiently growing organisms for oxygen, ammonia and carbon dioxide. One reason for this may be their previously unrecognized metabolic versatility. Nitrifiers are capable of reversing the nitrification process, carrying out denitrification and producing nitrite, ammonia, nitrous and nitric oxides and gaseous nitrogen. Ammonia oxidizers can metabolize urea and can assimilate carbon from methane while nitrite oxidizers can grow anaerobically in the presence of organic compounds and nitrate. In addition, they grow and have significant activity in environments which data from laboratory studies indicate are totally unsuitable. The most obvious example is their growth in environments of low pH value for which several explanations exist. Some involve interactions with other organisms, particularly heterotrophs releasing ammonia through mineralization of organic matter. Others involve modification of their environment to gain protection. Production of extracellular polymeric substances by attached organisms appears to provide some protection from low pH values, presumably by altering in some way the pH value which the cell experiences. This material will also affect diffusion of oxygen within a biofilm leading, for example, to anaerobic growth of nitrite oxidizers. Growth on clay minerals also appears to provide a local buffering effect during ammonia oxidation. The production of EPS material by these organisms is remarkable and its study is of interest and importance to both physiologists and ecologists. Amid these discoveries of new metabolic functions within nitrifying bacteria, we should not lose sight of the fact that they are primarily aerobic organisms, oxidizing ammonia or nitrite and fixing carbon dioxide at neutral/alkaline pH values. Physiological studies may indicate their metabolic potential but the extent to which this potential is expressed in natural environments is much more difficult to assess. Interactions with heterotrophs have been described which significantly affect nitrification, and the complexities introduced by heterotrophic nitrifiers make study of processes within the nitrogen cycle in natural environments both difficult and challenging. In addition, other factors of environmental importance, in particular temperature and water stress, have been little studied at the physiological level. The techniques of modern molecular biology have barely been applied to
AUTOTROPHIC NITRIFICATION IN BACTERIA
177
nitrifying bacteria. I t is hoped that their application, coupled with sound physiological studies, will build on the recent work described in this article to provide a fuller understanding of the mechanisms regulating growth and activity in this fascinating and unique group of organisms. Similar application of modern techniques of microbial ecology will enable a fuller assessment of their r81e within the nitrogen cycle and the extent to which their metabolic versatility is expressed in nature.
XI. Acknowledgements I would like to acknowledge Dr Booth and Dr Killham for helpful discussions and authors who provided copies of papers in press. REFERENCES
Adams, J. A. (1986). Soil Biology and Biochemistry 18, 45. Ahlrichs, J. L., Fraser, R. and Russell, J. D. (1972). Clay Minerals 9, 263. Aleem, M. 1. H. (1975). Plan/ and Soil 43, 587. Allerman, J. E., Keramida, V. and Pantea-Kiser, L. (1987). Warer Research 21, 499. Allison, S. M. (1989).Autotrophic nitrification at low pH. Ph.D. Thesis, University of Aberdeen, Aberdeen. Anthonisen. A., Loehr, R. C.. Prakasam, T. B. S. and Srinath, E. G . (1976).Journal of /he Wurer Pollution Conrrol Federarion 48, 835. Armstrong, E. F. and Prosser, J. 1. (1988). Soil Biology and Biochemisrry 20, 409. Ashworth, J., Rodgers, G. A. and Briggs, G. G. (1979). Chemistry and Industry (London) 3. 90. Belser, L. W. ( 1979). Annual Reviews in Microbiology 33, 309. Belser, L. W. (1984). Applied and Environmental Microbiology 48, 1100. Belser, L. W. and Mays, E. L. (1982). Applied and Environmental Microbiology 43, 945. Belser, L. W. and Schmidt, E. L. (1980). FEMS Microbiology Le//ers 7, 213. Belser. L. W. and Schmidt, E. L. (1981). Applied uiid Enrironmen/ul Microbiologj- 41, 819. Bhandari. B. and Nicholas, D. J. D. (1979). Archives qf Microbiology 122, 249. Bhuiya, Z. H. and Walker, N. (1977). Journal of Applied Bacleriology 42, 2534. Blackmer, A. M., Bremner, J. M. and Schmidt, E. L. (1980). Applied and Environmen/al Microbiology 40, 1060. Bock, E. (1965). Archiirfir Mikrobiologie 51, 18. Bock, E. (1976). Archives of Microbiology 108, 305. Bock. E., Koops, H.-P. and Harms, H. (1986). I n “Nitrification” (J. 1. Prosser. ed.), pp. 17-38. IRL Press. Oxford. Bock, E., Wilderer, P. A. and Freitag, A. (1988). Water Research 22, 245. Bock, E., Sand, W., Meincke, M., Wolters, B., Ahlers, B., Meyer, C. and Sameluck, F. (1988). In “Biodeterioration 7” (D. R. Houghton, R. N. Smith, H. 0.W. Eggins, eds), pp. 436440. Elsevier, Applied Science, London. De Boer, W., Duits, H. and Laanbroek, H. J. (1989a). Soil Biology and Biochemislry 21, 349. De Boer, W., Duits, H. and Laanbroek, H. J. (1989b). Soil Biology and Biochernislry (in press). Boon, B. and Laudelout, H. (1962). Biochemical Journal 85, 440. Bremner, J. M. and Blackmer, A. M. (1979). Nature 280, 380. Bremner, J. M. (1986). In “Perspectives in Microbial Ecology” (F. Megusar and M. Ganter, eds), pp. 337-342. Slovene Society for Microbiology, Ljubljana, Yugoslavia. Campbell, N. E. and Aleern, M. I. H. (1965). Anionie van Leeuwenhoek 31, 124. Carlucci, A. F. and Strickland, J. D. H. (1968). Journal qf Experimental Marine Biology and Ecology 2, 156.
178
J. I.PROSSER
Castens, D. J. and Rozich, A. F. (1986). Biotechnology and Bioengineering 28, 461. Castignetti, D. and Gunner, H. B. (1980). Canadian Journal of Microbiology 26, 1 1 14. Castignetti, D. and Gunner, H. B. (1982). Canadian Journal of Microbiology 28, 148. Castignetti, D. and Hollocher, T. C. (1984). Applied and Environmental Microbiology 47, 620. Charley, R. C., Hooper, D. G. and McLee. A. G. (1980). Water Research 14, 1387. Clark, C. and Schmidt, E. L. (1966). Journal of Bacteriology 91, 367. Clark, C. and Schmidt, E. L. (1967a).Journal ofBacteriology 93, 1302. Clark, C. and Schmidt, E. L. (1967b). Juurnal of Bacteriology 93, 1309. Cooke. J. G. and White, R. E. (1987). Freshwaier Biolugy 18, 213. Cox, D. J.. Bazin, M. J. and Gull, K. (1980). Soil Biology and Biochemistrjl 12, 241. Davidson. E. A., Swank, W. T. and Perry, T. 0.(1986). Applied and Environmental Microbiology 52, 1280. Darrah, P. R., White, R. E. and Nye, P. H. (1986). Journal of Soil Science 37, 41. Darrah, P. R., White, R. E. and Nye, P. H. (1987). Plant and Soil 99, 387. DiSpirito. A. A., Taafe, L. R., Lipscomb, J. D. and Hooper, A. B. (1985). Biochimicu ei Biophysica Acia 827, 320. Downes, M. T., (1988). Applied and Enuironmenral Microhiology 54, 172. Doxtader, K . G. (1965). Nitrification by heterotrophic microorganisms. Ph.D. Thesis, Cornell University, Ithaca, New York. Drozd. J. W. ( 1 976). Archirvs uf Mic~rohiolugy110, 257. Drozd, J. W. (1980).In”Diversity of Bacterial Respiratory Systems”(C. J. Knowles,ed.), vol. 2, pp. 87-1 1 I. CRC Press, Boca Raton, Florida. Federer, C. A. (1983). Soil Science Society of America Journal 47, 1008. Focht, D. D. and Verstraete, W. (1977). Advances in Microhial Ecology I , 135. Freitag, A., Rudert, M. and Bock, E. (1987). FEMS Microbiology Letters 48, 105. Gay, G. and Corman. A. (1984). Microbial Ecology 10, 99. Glover, H. E. (1982). Archivsy of Microbiology 132. 37. Glover, H. E. (1985). Archives of Microbiology 142, 45. Goldberg, S. S . and Gainey. P. L. (1955). Soil Science 43. Goreau, T. J., Kaplan, W. A,, Wofsy, S . C., McElroy, M. B.. Valois, F. W. and Watson, S . W. (1980). Applied and Encironmenial Biology 40, 4526. Goring, C. A. 1. (1962). Soil Science 93, 21 1. Goring, C. A. I. and Laskowski, D. A. (1982).In “Nitrogen in Agricultural SoiIs”(F. J. Stevenson, ed.), pp. 689-720, American Society of Agronomy, Crop Science Society of America, Soil Science Society of America, Madison, Wisconsin. Could, G . W. and Lees, H. (1960). Canadiun Journal of Microbiology 6, 299. Gunderson, K. ( I 966). Journal of General Microbiology 42, 387. Hall, G . H. (1986). I n “Nitrification” (J. 1. Prosser, ed.), pp. 127-156. 1RL Press, Oxford. Hankinson, T. R. and Schmidt, E. L. (1984). Canadian Journal of Microbiology 30, 1125. Hankinson, T. R. and Schmidt, E. L. (1988). Applied and Environmenrul Microbiology 54, 1536. Hashimoto, L. K., Kaplan, W. A., Wofsy, S. C. and McElroy, M. B. (1983). Deep-sea Research 30, 575. Hauck, R. D. (1980). In “Nitrification Inhibitors-Potentials and Limitations” (J. J. Meisinger, G . W. Randall and M. L. Vitosh, eds), pp. 19-32. American Society For Agronomy. Crop Science Society of America, Soil Science of America, Madison, Wisconsin. Journul (J/’SeuRiwuri+i 17, I . Helder, W. and de Vries, R. T. P. (1983). Nefhc~r1und.v Hofman, T. and Lees, H. (1952). Biochemical Journul52, 140. Hooper, A. 9. and Terry, K. R. (1973). Journal qf Bacferiology 115, 480. Hooper, A. B. and Terry, K. R. (1974). Journal if Bacteriology 119, 899. Hyman, M. R. and Wood, P. M. (1985). Biochemical Journal 227, 719. Hynes, R. K. and Knowles, R. (1978). FEMS Microbiology Letters 4, 319. Hynes, R. K. and Knowles, R. (1983). Applied and Environmental Microhiology 45, 1178. Hynes, R. K. and Knowles, R. (1984). Canadian Journal of Microbiology 30, 1397. Johnsrud, S. C. (1978). Holurctic Ecology 1, 27. Jones, G. L. and Paskins, A. R. (1982).JournalqfChemical Technology andliotechnology 32,213. Jones, R. D. and Hood, M. A. (1980). Microbial Eculogy 6, 271.
AUTOTROPHIC NITRIFICATION IN BACTERIA
179
Kalthoff, H., Fehr. S., Sundermeyer, H., Renwrantz, L. and Bock, E. (1979). Currenr Microbiology 2, 375. Kaltwasser, H. (1976). European Journal of Applied Microbiology 3, 185. Keen, G . A. and Prosser, J. 1. (1987a). Archives qf Microbiology 147,73. Keen, G . A. and Prosser. J. 1. (1987b). Soil B i o l ~ g yBiochemisrry 19,665. Keen, G . A. and Prosser, J. 1. (1988). Microbial Ecology 15,21. Keeney. D. R. (1986). In “Nitrification” (J. 1. Prosser, ed), pp. 99-1 15. IRL Press, Oxford. Keith, S. M., Russ, M. A., MacFarlane. G . T. and Herbert, R. A. (1987). Proceedings ofrhe Royizl Socierj of Edinburgh 92B, 323. Kelly, D. P. (1978). In “Companion to Microbiology” (A. T. Bull and P. M. Meadow, eds.), pp. 363-386. Longman, London. Killham, K. (1986). In “Nitrification” (J. 1. Prosser, ed.), pp. 117-126. IRL Press, Oxford. Killham, K. (1987). Plant and Soil 97, 267. Killham, K. (1989). In “Changes in the Nitrogen Status of Forest Ecosystems”. Aberdeen Centre for Land Use, Aberdeen (in press). Kirstein, K. O., Miller, D. J., Bock, E. and Nicholas, D. J. D. (1986). FEMS Microbiology Letters 36,63. Klein, T. M., Kreitinger, J. P. and Alexander, M. (1983).Soil Science Sociery qf America Journiil 41, 506. Klemedtsson, L., Svensson, B. H. and Rosswall, T. (1988). Biology and Ferrility of Soils 6, 112. Knowles, R. (1986). In “Perspectives in Microbial Ecology” (F. Megusar and M. Canter, eds), pp. 319-324. Slovene Society for Microbiology, Ljubjana, Yugoslavia. Kokufuta. E., Yukishage, M. and Nakamura, 1. (1988). Biotechnology and Bioengineering 31,382. Koops, H.-P. (1969). Archio,fiir Mikrohiologie 65, 115. Koops. H.-P. and Harms, H. (1985). Archives of Microhiology 141, 214. Kreitinger, J. P., Klein, T. N., Novick. N. J. and Alexander, M. (1986). Soil Science Socief.v qf America Journal 49, 1407. Krummel. A. and Harms, H. (1982). Archioes o/ Microbiology 135,50. Kuenen, J. G .and Gottschal, J. C. (1982). In“Microbia1 Interactions and Communities”(A.T. Bull and J. H. Slater, eds), vol. 1, pp. 153-187. Academic Press, London. Kuenen, J. G . and Robertson, L. A. (1987). In “The Nitrogen and Sulphur Cycles” (J. A. Cole and S. Ferguson, eds), pp. 161-218. Cambridge University Press, Cambridge. Lang, E. and Jagnow, G . (1986). FEMS Microbiology Ecology 38, 257. Laudelout, H., Lambert, R. and Pham, M. L. (1976). Annales de Microhiologie (Instirure Pasreur) 127a, 367. Lees, H. (1952). Biochemical Journal 52, 134. Lees, H. and Quastel, J. H. (1946). Biochemical Journal 40, 815. Lipschulz, F., Zafiriou. 0.C., Wofsy, S. C., McElroy, M. B., Valois, F. W. and Watson, S. E. (1981). Narure 294,614. Loveless. J. E. and Painter, H.A. (1968). Journal yf General Microbiology 52, 1. McCarty. G . W. and Bremner, J. A. M. (1986). Soil Science Sociery of America Journal 50, 920. Macdonald, R. M. L. (1986). In “Nitrification” (J. 1. Prosser, ed.), pp. 1-16. IRL Press, Oxford. Macfarlane, G . T. and Herbert, R. A. (1985). FEMS Microbiology Ecology 31, 249. McLaren, A. D. and Skujins. J. J. (1963). Canadian Journal of Microbiology 9, 729. Martikainen, P. J. and Nurmiaho-Lassila, E.-L. (1985). Canadian Journalc?fMicrobiology 31, 190. Megraw, S.and Knowles, R. (1987). Biology and Ferrility of Soils 4, 205. Meincke, M., Ahlers, B.. Krause-Kupsch,T., Krieg, E., Meyer, L., Sameluck, F., Sand, W., Wolters, B. and Bock, E. (1988). In “Proceedings of the 6th International Conference on Deterioration and Conservation of Stone”, pp. 15-23. Nicholas Copernicus University Press, Torum, Poland. Miller, D. J. and Nicholas, D. J. D. (1985). Journal of General Micr0biolog.v 131, 1851. Molina, J. A. (1985). Soil Science Sociery of America Journal 49, 603. Muller-Neugluck, N. and Engel, A. (1961). Archiv,fiir Mikrobiologie 39, 130. Olson, R.J. (1981a). Journal of Marine Research 39, 203. Olson, R. J. (1981b). Journal of Marine Research 39, 227. Oremland, R. S. and Capone, D. G . (1988). Advances in Microbial Ecology 10, 285. Overrein, L. (1967). Plant and Soil 27, 1.
180
J. I. PROSSER
Painter, H. A. (1986). In “Nitrification” (J. I. Prosser, ed.), pp, 185-211. IRL Press, Oxford. Painter. H.A. and King, E. F. (1976). “Report LR 581”. Water Research Centre, Stevenage. Peelers, T. L., van Gool. A. D. and Laudelout, H. (1969). “Bacteriological Proceedings” p. 141. American Society for Microbiology, Washington D. C. Poth, M. (1986). Applied and Environmental Microbiology 52, 957. Poth, M. and Focht, D. D. (1985). Applied and Environmental Microhiology 49, 1134. Powell, S. J. (1985).Inhibition of Nitrosomonaseuropaea by Nitrapyrin: the role ofsurfaces. Ph.D. Thesis, University of Aberdeen, Aberdeen. Powell, S. J. and Prosser, J. 1. (1985). FEMS Microbiology Lerrers 28, 51. Powell, S. J. and Prosser, J. 1. (1986a). Applied and Enitironmental Microbiology 52, 782. Powell, S. J. and Prosser, J. I. (l986b). Current Microbiology 14, 177, Powlson, D. S. and Jenkinson, D. s. (1971). SO;/ Biology utrtl Bioc/rcwi.rtry 3, 267. Prosser, J. L. (1989). Advances in Microbial Ecology 11 (in press). Prosser, J. 1. and Bazin, M. J. (1988). In “Handbook of Laboratory Systems for Microbial Ecosystem Research” (J. W. T. Wimpenny, ed.), vol. 2, pp. 31-49. CRC Press, Boca Raton, Florida. Quintan, A. 9. (1984). Water Research 18, 561. Remade, J. (1977).Ecologicia Planetarium 7, 69. Remade, J. and DeLeval, 1.(1978). In “Microbiology--1978” (D. Schlessinger, ed.), pp. 352-356. American Society for Microbiology, Washington D.C. Rho. J. (1986). Canadian Journal of Microbiology 32, 243. Rice, E. L. and Pancholy, S. K. (1972). American Journal oj’ Botany 39, 1033. Rice, E. L. and Pancholy, S. K. (1973). American Journal qf’Bulany 60, 691. Rice, E. L. and Pancholy, S. K. (1974). American Journal OfButany 61, 1095. Ritchie, G. A. F. and Nicholas, D. J . D. (1972). Bioch~micalJournal 126, 1181. Ritchie. G . A. F. and Nicholas, D. J. D. (1974). Biochcw~icdJournul 138, 471 Robertson. L. A. and Kuenen, J. G. (1983). Journal uf General Microbiology 129, 2847. Robertson, L. A. and Kuenen, J. G. (1984). Archive.7 u/ Micrnbiolug~139, 351. Robertson, L. A. and Kuenen, J. G . (1988). Journal qf Grnerul Mic~rcrhiukogy134, 857. Robertson, G. P. and Tiedje, J. M. (1987). Soil Biology and Biochemistry 19, 187. Rodgers, G. A. and Ashworth, J. (1982). Canadian Journal oj’Microbiology 28, 1093. Salvas. P. L. and Taylor, B. F. (1980). Current Microbiology 4, 305. SdbfdS, P. L. and Tdylor, 9. F. (1984). Currenr Microbiology 10, 53. Sahrawdt, K. L. and Keeney, D. R. (1985). Conrmunicutions in Suil Science utid Plant Analjwi.r 16, 517. Schimel. J. P., Firestone. M. K. and Killham. K. S. ( 1984).Appliecluntl Enilironmerttul Microhiolugj. 48, 802. Schon. G. (1965). Archiv ,fur Mikrobiologie 50, 1 1 1. Schon, G. and Engel, H. (1962). Archiv,fur Mikrobiologie 42, 415. Sharma. B. and Ahlert, R. C. (1977). Water Research 11, 897. Shears. J . H. and Wood, P. M. (1985). Biochemical Journal 226, 499. Skinner, F. A. and Walker. N. (1961).Archivfur Mikrobiulogie 38, 339. Smith, A. J. and Hoare, D. S. (1968). Journal qf Bacteriology 95, 844. Steinmuller, W. and Bock, E. (1976). Archives of Microbiology 108, 299. Steinmuller, W. and Bock, E. (2977). Archives qf Microbiology 115, 51. Straat. 9. A. and Nason, A. (1965). Journal of’ Biological Chemistry 240, 1412. Stroo, H. F., Klein, T. M. and Alexander, M. (1986).Appliedand Enuironmental Microbiology 52, 1107. Sundermeyer-Klinger. H., Meyer, W., Warninghoff, 9. and Bock, E. (1984). Archiws $I Microbiology 140, 153. Susuki, 1. (1974). Annuul Reviews in Microhiology 28, 85. Suzuki, I., Dular, U. and Kwok, S. C. (1974). Journal q/Bucteriolog~120, 556. Tsnaka, H. and Dunn, 1. J. (1982). Biorechnology and Bioengineering 24, 669. Tanaka. Y., Fukumori, Y.and Yamanaka, T. (1983). Archives of Microbiology 135, 265. Topp, E. and Knowles, R. (1984). Applied and Environmental Microbiology 41, 284. Underhill, S. E. and Prosser, J. 1. (1985). Soil Biology and Biocheniisrry 17, 229.
AUTOTROPHIC NITRIFICATION IN BACTERIA
181
Underhill, S. E. and Prosser, J. I. (1987a). Microbial Ecology 14, 129. Underhill, S. E. and Prosser, J. 1. (1987b). Journal oj’Genera/ Microbiology 133, 3237. van der Dijk, S. J. and Troelstra, S. R. (1980). Plant and Soil 57, 1 I . Verstraete, W. (1975). Bulletin oJ the Academy oJ Science, USSR Biology Series 4, 5 15. Vitousek, P. M., Gosz, J. R., Grier, C. C., Melillo, J. M. and Reiners, W. A. (1982). Ecology Monographs 52, 155. Walker, N. and Wickramasinghe, K. N. (1979). Soil Biology and Biochemistry 11, 231. Ward, B. B. (1986). In “Nitrification” (J. 1. Prosser, ed.), pp. 157-184. IRL Press, Oxford. Ward, B. B. (1987). Archives of Microbiology 147, 126. Ward, B. B. and Zafiriou, 0. C. (1988). Deep-Seu Reseurch 35, 1127. Wasserbauer, R., Zadak, 2.and Novotny, J. (1988). International Biodeterioration 24, 153. Watson, S. W. (1974). In “Bergey’s Manual of Determinative Bacteriology” (R. E. Buchanan and N. E. Gibbons, eds.), 8th edn, pp. 450-456. Williams and Wilkins, Baltimore. Watson, S. W., Valois, F. W. and Waterbury, J. B. (1981). In “The Prokaryotes” (M. P. Starr, H. Stolp, H. G .Truper, A. Balows and H. G. Schlegel, eds), vol. 1, pp. 1005-1022. Springer-Verlag. Berlin. Watson, S. W., Bock, E., Valois, F. W., Waterbury, J. B. and Schlosser, R. U.(1986). Archives cf Microbiology 144, I . Weber, D. F. and Gainey, P. L. (1962). Soil Science 94, 138. Wezernak. C. T. and Gannon, J. J. (1967). Applied Microbiology 15, 1211. Wickramasinghe, K. N., Rodgers, G. A. and Jenkinson, D. S. (1985). Soil Biology and Biochemistry 17, 249. Woese, C. R., Stackebrandt, E., Weisburg, W. G., Paster, B. J., Madigan, M. T.. Fowler. V. J., Hahn. C. M., Blaz, P., Gupta, R., Nealson, K. H. and Fox. G. E. (1984a). Systemuric and Applied Microbiology 5, 3 15. Woese. C. R., Weisburg, W. G., Paster, B. J., Hahn, C. M., Tanner. R. S.. Krieg, N. R.. Koops, H.-P.. Harms. H. and Stackebrandt, E. (l984b). Systemuric und Applied Mic,mbiu/ugj~5, 327. Woese. C. R., Weisburg, W. G., Hahn, C. M., Paster, B. J., Zablen. L. B., Lewis, B. J., Macke. T. J.. Ludwig, W. and Stackebrandt, E. (1985). Systematic and Applied Microbiology 6, 25. Wolters, B.. Sand, W., Ahlers, B., Sameluck, F., Meincke, M., Meyer, C., Krause-Kupsch, T. and Bock, E. (1988). In “Proceedings of the 6th International Conference on Deterioration and Conservation of Stone”, pp. 24-3 I. Nicholas Copernicus University Press, Torun. Poland. Wood, P. M. (1986). In “Nitrification” (J. 1. Prosser, ed.), pp.39-62. IRL Press. Oxford. Wood, P.M. (1987). In “The Nitrogen and Sulphur Cycles” (J. A. Cole and S. J. Ferguson, eds), pp. 219-243. Cambridge University Press, London. Wood. P. M.(1988). In“Bacteria1 Energy Transduction”(C. Anthony, ed.). pp. 183-230. Academic Press, London. Yoshioka, T. and Saijo. Y. (1985). Journal qf Generul and Applied Microbiolog.~30, 151. Yoshida, N. (1988). Nulure 335, 528.
This Page Intentionally Left Blank
Physiology, Biochemistry and Genetics of Bacterial Glycogen Synthesis JACK PREISS and TONY ROMEO Department of' Biochanistry, Michigan State University. East Lansing, MI 48824, U.S.A. 1. Introduction . . . . . . . , . , , . . . . . II. Occurrence of glycogen in bacteria . . . . . . . . , . . A. Physiological conditions allowing glycogen synthesis . . . . . B. Possible biological functions of bacterial glycogen . . . . . . 111. Enzymes involved in synthesis of glycogen . . . . . . . . . A. A DPgl ucose pathway . . . . . . . . . . . . . B. Synthesis from the disaccharides, sucrose or maltose . . . . . C. Regulation of the ADPglucose pathway . . . . . . . . IV. Characterization of the bacterial glycogen biosynthetic enzymes . . . A. ADPglucose pyrophosphorylase . . , . . , . . . . B. Chemical modification of the activator sites of E.wherichiu coli and Rhod~ipseudornonu.ssphoeroides A DPglucose pyrophosphorylases , . C. Evidence for location of substrate binding sites in ADPglucose . . . . . . . . . . . . . pyrophosphorylase D. Chemical modification of the inhibitor sites of the Escherichiu coli ADPglucose pyrophosphorylase and the relationship of the inhibitor site with the substrate and activator sites . . . . . . . . . E. Use of mutagenesis techniques in virio and in oirro to determine the functional amino-acid residues in substrate binding and allosteric function . . . . . . . . . . . . . . . . F. Glycogen synthase . . . . . . . . . . . . . G . Branching enzyme. . . . . . . . . . . . . . V. Genetic regulation of glycogen biosynthesis in Escherichiu coli . . . . A. Characterization of the structural genes for glycogen biosynthesis . . B. Factors which regulate glycogen gene expression . . . . . . C. Fine structure of the glycogen biosynthetic genecluster and potential sites . . . . . . . . . . . . . for gene regulation D. Physiological interpretations . . . . . . . . . . . VI. Acknowledgements . . . . . . . . . . . . . . . References . . . . . . . . . . . . . . . . .
183 184 184 185 189 189 189 191 193 193 196
199 203
205 217 218 218 219 22 1 229 23 1 233 233
I. Introduction Many bacteria can accumulate polymers that are believed to function as energy reserves. These compounds can accumulate during growth or at the ADVANCES IN MICROBIAL PHYSIOLOGY. VOL. 30 ISBN 0-12-027730-1
Copyright ( 1989. by Acddemic Press Limited All rights of reproduction in dny form reserved
184
JACK PREISS AND TONY ROMEO
end of the growth phase and are degraded to provide energy or be utilized as a source of carbon that is no longer available from the media or environment. One major intracellular reserve polymer is glycogen, a branched polymer consisting of about 90% of its glucose in a-1,4-glucosidic linkages and the rest in a- 1,6-linkages. Glycogen usually accumulates in the bacterial cell when there is excess of carbon in the media and when growth is limited by a lack of required nutrient for growth. The concentration of glycogen accumulated is dependent on the nutritional content of the media as well as the growth phase of the organism and can at times be very high: above 50% of the cell dry weight. An advantage in having glycogen as a reserve storage compound is that, because of its high molecular weight and physical properties, it has little effect on the internal osmotic pressure in the cell. Previous reviews on bacterial glycogen synthesis (Preiss, 1969, 1972, 1973, 1978, 1984; Krebs and Preiss, 1975; Preiss and Walsh, 1981 ; Preiss et a/., 1983) have discussed various aspects of the enzymology and regulation of glycogen synthesis and degradation including genetic and allosteric regulation of the involved enzymes. Since 1984 more knowledge has been obtained on the structure and effector/catalytic sites of the bacterial ADPglucose pyrqphosphorylases. Also, the structural genes of the glycogen biosynthetic enzymes of Escherichia coli and of Salmonella ryphimurium have been isolated and more information bearing on the genetic regulation of glycogen synthesis in E. coli has accumulated. Thus, current views and concepts of regulation of enzyme activity and expression will also be presented in this review. 11. Occurrence of Glycogen in Bacteria A. PHYSIOLOGICAL CONDITIONS ALLOWING GLYCOGEN SYNTHESIS
Many bacterial species accumulate glycogen in either stationary phase or under limited growth conditions with excess carbon in the media. Holme (1957) showed in E. coli that rate of growth and quantity of glycogen accumulated are inversely related when cells are grown in glucose-containing media and limited in nitrogen. However, there are some bacteria that optimally synthesize glycogen during exponential growth. Rhodopseudomonus capsulata (Eidels and Preiss, 1970) Streptococcus mitis (Gibbons and Kapsimalis, I963), and the archaebacterial strain Su/folohus solfatarrcus (Konig et al., 1982) accumulate glycogen during exponential optimal growth. However, for several bacterial species (E. coli, Agrohactcrium tumcfacicws, Arthrohacter, Enterohacter aerogenes), it has been shown that the rate of glycogen accumulation in stationary phase increases when growth ceases due to depletion of a nutrient required for growth. The limiting nutrients used in these experiments were either nitrogen in the form of ammonia or amino acid (Holme and Palmstierna, 1956; Holme, 1957; Strange et al., 1961; Mulder et al.,
BACTERIAL GLYCOGEN SYNTHESIS
185
1962;Madsen, 1963;Segel et al., 1963;Sigal et al., 1964;Zevenhuizen, 1966), sulphur (Segel et al., 1963;Zevenhuizen, 1966) or phosphate (Zevenhuizen, 1966). Diminished growth due to unfavorable pH values also induced glycogen synthesis in Arthrobacter (Zevenhuizen, 1966). When studied in detail, it is usually found that the largest accumulation of glycogen occurs under nitrogen-limiting conditions. A glycogen-like polymer accumulates at the onset of sporogenesis in some bacteria. This has been observed with Streptomyces viridochromogenes (Brana et al., 1980),with various clostridia strains (Strasdine, 1968,1972;Mackey and Morris, 1971)and with Bacillus cereus (Slock and Stahley, 1974),suggesting a function for glycogen during sporulation (see Section 1I.B). In an Anabaena species,glycogen accumulation was shown to be light dependent and occurred when the cells were undergoing sporulation (Sarma and Kanta, 1979).In the dark or in the presence of an inhibitor of photophosphorylation, DCMU, glycogen did not accumulate, suggesting that glycogen accumulates if there is an excess of energy over that required for growth and other necessary processes. It is impirtant to note that glycogen is not required for growth since mutants of E. coli, including a deletion mutant (Govons et al., 1969;CreuzatSigal et ul, 1972), S. typhimurium (Steiner and Preiss, 1977) and Clostridium pasteurianum (Mackey and Morris, I974), which have defective structural genes for the glycogen biosynthetic enzymes and thus are unable to synthesize glycogen, grow as well as their normal parent strains. Glycogen or other similar a-1,4-glucans have been reported in over 40 different bacterial species and they are listed in Table 1. The polysaccharide is not restricted to any class of bacteria since many Gram-negative and Grampositive species, as well as archaebacterial strains, have been reported to contain glycogen. B. POSSIBLE BIOLOGICAL FUNCTIONS OF BACTERIAL GLYCOGEN
Various strains of E. coli (Strange, 1968).Enterobacter aerogenes (Strange et al., 1961)and Streptococcus mitis (Van Houte and Jansen, 1970)not containing glycogen have been compared with respect to their viability to the same strains containing glycogen in media having no exogenous carbon source. Prolonged survival rates were observed with the strains containing glycogen. It was also showm that under starvation conditions, the glycogen-less E. coli and Ent. aerogenes cells degraded their RNA and protein constituents to NH, (Ribbons and Dawes, 1963;Strange, 1968). In cells containing glycogen this either did not occur or occurred at a lower rate. It was suggested that when glycogen was available its use as an energy source eliminated the need for degradation of RNA and protein for production of energy. Marr et a/. (1963)
186
JACK PREISS AND TONY ROMEO
TABLE I . Bacteria accumulating glycogen Bacteria
Reference
Bacteria
Reference
A ci~rioihrio celluloluii~iis Aeron1onu.s hydrophilu Agro hor ieriuni iumt+ucii>ns Anuhumu Spp.
Patel and Breuil (1981) Shaw and Squires ( 1 980) Madsen (1961, 1963)
Mvcohac'lerium phlei
Antoine and Tepper ( I 969a. b,c); German ei ul. (1961) Antoine and Tepper (1969a); Elbein and Mitchell (1973) Antoine and Tepper ( I 969a); Chargaff and Moore (1944)
Sarma and Kanta (1979) Boylen and Ensign Arrlirohucter ( 1 970) crys tollopuii*ies Arihrohaclcr i>i.sr.osus Zevenhuizen (1966); Mulder el ul. (1962); Ghosh and Preiss (1965); Mulder and Zevenhuizen (1967) Mulder PI (11. ( I 962); Bucillus rcreus ccreus Bucilliis SIock and Stahly (1974) Bucillus nii~guii~riunt ntt~guieriunt Barry ei ui. (1952); Bocil1u.v Cassity and Kolodziej (1984) Goldemberg (1972)
Ciosiridiuni hoiulinuni Clo.siridiuni pusreurictnuni Desulfi,bulhrrs prapinic'us Desuifovihrio gigus Desul/iwibrio Lvdguriv Desulfurocwcus spp. Enlcwhocier aerogenes Escher ichiu coli
Lindner ei ul. 1979) Hart ei ul. (1973) Sirevag (1975); Sirevag and Omerod (1977) Strasdine (1968); Whyte and Strasdine (1972) Darvill ei ul. (1977) Stains ei a/. ( I 983) Stams ei ul. (1983) Stanis er ul. (1983) Konig er a/. (1982) Strange ei ul. (1961); Segel e/ al. (1963) Holme and Palmstierna (1956); Levine C I ul. (1953)
M,rccibucteriurn sniegnial is hfycobai.teriuni tuberculosis
Nocordiu usreroides
Emeruwd ( 198 I ) Dietzler and Strominger (1973) Auling C I i d . (1978) Zevenhuizen (1981) Zevenhuizen (1981) Zevenhuizen ( 1 98 I ) Zevenhuizen (I98 I ) Eidels and Preiss ( 1970) Pfenning and Truper (1974) Stanier er ul. (1959) Levine er
01.
(1953)
Steiner and Preiss (1977) Burleigh and Dawes ( I 967) Kamio ei ul. (1981) Levine P I a/. (1953) McFarland ci ul. ( 1984) Gibbons and Kapsimalas (1963); Van Houte and Jansen (1970): Van Houte and Saxton (1971)
187
BACTERIAL GLYCOGEN SYNTHESIS
TABLE I-conid, Bacteria
Reference
Sireprococcus mutans Sireprococcus pogmes
Slreprococcus sulii~ariiis
Sireprococcus
Van Houte and Saxton (1971) McFarland er a/. (1984) Van Houte and Jansen (1968); Birkhed and Tanzer ( I 979) .sanguis Van Houte and Saxton (1971); Eisenberg cr a/. ( I 974) Brana c t a/. ( I 982)
Bacteria
Reference
Sireptomyces fluorescens Strepiomyces griseus Sirepronijws uiridochromogenes Su1fi)lohu.rspp. Sulfi,lohus .solfuiaricus Synechoc,occus 6301
Brana
ei
ul. (1982)
,
Thermococcus spp. Tlrermoproreus spp.
k a n a PI ul. (1982) Brana ei ul. (1980) Konig el ul. (1982) Konig er NI. (1982) Lehmann and Wober (1976) Konig ei a/. (1982) Konig cr ul. (1982)
This list is not presumed to be complete, either in indication of all bacteria accumulating glycogen or in the references documenting their occurrence.
suggested that resynthesis of proteins in E. coli during stationary phase probably involves the major part of the energy required for survival of the cell. Thus there are a number of studies suggesting that glycogen plays a r6le in the survival of the bacterial cell. Its precise function, however, remains unclear. Moreover, a number of studies appear to be in conflict with the concept of glycogen as an endogenous energy source. Glycogen-rich Sarcina lutea die at a faster rate compared to glycogen-less Sur. lutea cells when starved in phosphate buffer (Burleigh and Dawes, 1967). In media containing 0.5 to 1.0 mM MgCI,, both glycogen-containing and glycogen-deficient Ent. aerogenes cells had similar survival rates (Tempest and Strange, 1966; Strange, 1968). In this situation, however, Mg2' ions may increase the stability of the ribosomes. Since the major requirement of energy during stationary phase in Ent. aerogenes may be resynthesis of proteins, Mg2+ ions stabilization of the ribosomes would lessen the energy requirement for survival. Obviously, further clarification of the rBle of bacterial glycogen is needed. Mutants deficient in glycogen as well as mutants that accumulate greater amounts ofglycogen than the wild-type strains could be useful in determining whether glycogen does prolong survival. In Bacillus cereus (Slock and Stahly, 1974), in various Clostridia species (Strasdine, 1968, 1972; Mackey and Morris, 1971), as well as in Streptomvces iiiridochromogenes (Brana et ul., 1980),a glycogen-like molecule accumulates up to 60% of their dry weight prior to the onset of sporulation. The
188
JACK PREISS A N D TONY ROMEO
polysaccharide is then utilized during formation and maturation of the spores. Thus, it is thought that glycogen is an endogenous source of carbon and energy utilized for spore formation and maturation. There must be some regulatory processes that signal expression of glycogen synthesis prior to sporogenesis and then expression of glycogen degradation during spore formation. I t is of interest to note that glycogen synthesis and subsequent degradation by oral bacteria (e.g. Streptococcus mutans (Huis et a/., 1978) or Strep. mitis (Gibbons and Kapsimalis, 1963)) may be an important process in dental caries development (Van Houte and Saxton, 1971; Tanzer et al., 1976). These streptococci are capable of synthesizing glycogen. They also produce more acid from exogenous sugar and can produce acid in the absence of the exogenous carbohydrate when compared to oral bacteria unable to synthesize glycogen (Huis et ul., 1978). The acid formed from polysaccharide catabolism may be of significance in production of dental caries, for it is formed over a considerable period of time and consequently could be responsible for the lower resting pH values which have been observed in plaque from individuals with active caries (Huis et al., 1978). Although not proven, all the above studies d o suggest that glycogen does have an energy-storage function. Wilkinson (1 959) proposed three criteria for classification of compounds having energy-storage function. First, the compound should accumulate intracellularly under conditions when energy for growth of the organism is in excess. Second, the reserve polymer is utilized when the components of energy or carbon in the media are no longer available for sustenance of growth or other processes required for maintenance of viability. Wilkinson (1959) pointed out that various cell functions require energy or carbon; e.g. maintenance of a functioning semipermeable cytoplasmic membrane, energy for replacement of proteins and nucleic acids during turnover, maintenance of intracellular pH value, or for other processes induced for bacterial survival, such as encystment and sporulation. Last, the storage compound should be utilized by the cell for energy that would enable it to survive in its environment. This energy requirement for survival is designated as “energy of maintenance” (Mallette, 1963; Marr, et a/., 1963; Pirt, 1965, 1982). Perhaps this last criterion is the most important, for as Wilkinson notes, a number of other substances may be produced for other functions such as, “to detoxicate end-products of metabolism which otherwise accumulate too rapidly and prove toxic”. The observations that glycogen in the cell decreases during stationary phase when no exogenous carbon source is present, or its utilization during spore formation, are consistent with its r61e as an energy reserve.
189
BACTERIAL GLYCOGEN SYNTHESIS
111. Enzymes Involved in Synthesis of Glycogen A.
ADPGLUCOSE PATHWAY
In 1964, UDPglucose was considered to be the glucosyl donor for glycogen synthesis in mammalian tissues and eukaryotic micro-organisms (Leloir et al., 1959; Stalman and Hers, 1973; Krebs and Preiss, 1975). However, Sigal et al. (1964) reported that a number of UDPglucose pyrophosphorylase-deficient mutants of E. coli K12 were able to accumulate normal amounts of glycogen during stationary phase of growth in limiting nitrogen media. The evidence with the E. coli UDPglucose pyrophosphorylase-deficient mutants suggested that UDPglucose was not a precursor for E. coli glycogen synthesis. In 1964 it was also shown that extracts of several bacteria contained both an ADPglucose pyrophosphorylase (reaction A; Shen and Preiss, 1964)as well as an ADPglucose-specific glycogen synthase (reaction B; Greenberg and Preiss, 1964). These enzyme-catalysed reactions have been observed in extracts from 46 bacterial species (see Section IV and Preiss and Walsh, 1981; Preiss, 1984).
+
(Reaction A) ATP + or-glucose 1-phosphate= ADPglucose pyrophosphate ADPglucose + a-glucan +a-1,4-glucosyl-glucan ADP (Reaction B)
+
Subsequently, it was shown that branching enzyme activity was also present in many bacterial extracts; e.g. E. coli(Siga1et al., 1965; Boyer and Preiss, 1977; Preiss et al., 1976b; Holmes rt al., 1982) Arthrobacter globiformis (Zevenhuizen, 1964), S. typhimurium (Steiner and Preiss, 1977), Serratia marcescens (Preiss et al., 1976a), Strep. mitis (Walker and Builder, 1971) and various photosynthetic organisms (Preiss et al., 1980; Preiss and Greenberg, 1981; Greenberg et al., 1983). Thus, many bacteria which were reported to accumulate glycogen have the enzymes of the ADPglucose pathway to synthesize a-1 ,4-glucosidic linkages, as well as branching enzyme activity for synthesis of the a- 1,6-glucosidic linkages of glycogen. B. SYNTHESIS FROM THE DISACCHARIDES, SUCROSE OR MALTOSE
a-Glucans similar to glycogen have been shown to be formed from either sucrose or from maltose. Neisseria strains, when grown on sucrose, accumulate large amounts of a glycogen-type polysaccharide (Hehre and Hamilton, 1946, 1948; Hehre et al., 1949; Hestrin, 1960; Okada and Hehre, 1974; MacKenzie et al., 1977). Sucrose conversion to an a-1,4-glucan is catalysed by the enzyme amylosucrase and its reaction (C) is shown below. There is a transfer of the glucosyl portion of sucrose to a primer to form the new a- 1,4-glucosidic linkage. (Reaction C) Sucrose + a-glucan + D-fructose + a-1,4-glucosyl-g~ucan
190
JACK PRFISF A N D r O N Y ROMFO
Amylosucrase, however, appears to be limited to a few bacterial strains and is induced only in the presence of sucrose in the medium. Moreover, reports indicate that neither the species Neissrria nor any other bacteria are able to synthesize sucrose from other carbon sources. Thus, accumulation of glycogen in Nrisseriu species and in other bacteria grown on other carbon sources besides sucrose cannot be catalysed by amylosucrase. Many enteric bacteria and other organisms (Walker, 1966; Lacks, 1968; Palmer e/ ul., 1973; Wober, 1973; McFarland e / a/., 1981), when grown on maltose or maltodextrins, can synthesize a low-molecular-weight a-1A-glucan via transfer of the glucosyl moiety of maltose to a growing a-1,Cglucan chain (reaction D). The enzyme responsible for this reaction is amylomaltase (reaction D). (Rcaction D) Maltose + sc-glucan + D-glucose
+ sc-I,4-glucosyl-glucan
The polymer is of very low molecular weight and can be degraded by another enzyme also induced by the presence of maltose in the medium, maltodextrin phosphorylase (Hestrin, 1960). The synthesis of these two enzymes, however, is repressed by glucose (Chao and Weathersbee, 1974) and thus the activity of either amylomaltase or maltodextrin phosphorylase cannot be responsible for synthesis of glycogen when the organisms are grown on other carbon sources. Glycogen phosphorylase, as well as maltodextrin phosphorylase, are found in many bacteria (Hestrin, 1960; Preiss and Walsh, 1981) and catalyse synthesis or phosphorolysis of 1,Cglucosyl linkages in maltodextrins or in glycogen, as seen in reaction E.
+
(Reaction E) r-1,4(glucosyl), P , e x - g l u c o s e I-P
+ ~-1,4(glucosyl),~,
However, as stated above, maltodextrin phosphorylase is only induced in the presence of maltose or maltodextrins. Escherichia coli mutants deficient in this enzyme accumulate maltodextrins (Schwartz, 1965), thus indicating that the maltodextrin phosphorylase is involved in degradation of the a-glucans rather than in synthesis. The glycogen phosphorylase activity usually found in organisms is generally insufficient in activity to account for the observed glycogen synthetic rate (Chen and Segal, 1968a,b; Khandelwal e / u/,, 1973). I t therefore appears that bacterial glycogen synthesis occurs mainly via the sugar nucleotide pathway. Both E. coli and S. ryphiniuriurn mutants, either glycogen-deficient or containing glycogen in amounts exceeding that observed in the parent wild-type strain, have been isolated (Damotte e / a/., 1968: Cattaneo et al., 1969; Govons et al., 1969, 1973; Preiss et al., 1970, 1971, 1975, 1976b, 1983: Krebs and Preiss, 1975; Steiner and Preiss, 1977; Preiss and Walsh, 1981). They are affected either in their glycogen synthase or in ADPglucose synthetase activity and, thus at least in these organisms, the data
BACTERIAL GLYCOGEN SYNTHESIS
191
strongly indicate that the ADPglucose pathway is the major, if not the exclusive, route to glycogen formation.
c.
REGULATION OF THE
ADPGLUCOSE PATHWAY
1. The Site of’ Regulation of Glycogen Synthesis in Bacteria is at the
ADPglucose Pyrophosphorylase Step For the bacterial enzymes studied, glycolytic intermediates activate ADPglucose synthesis while AMP, ADP, and/or inorganic phosphate are inhibitors of ADPglucose synthesis (for review, see Preiss, 1969, 1978; Preiss and Walsh, 1981).In viewing ATP as one of the substrates, one can consider that glycogen synthesis is regulated by the energy charge or state of the cell (Atkinson 1970; Shen and Atkinson, 1970).The glycolytic intermediates in the cell may be considered as signals of carbon excess in the cell. For most of the bacterial ADPglucose pyrophosphorylases the activator glycolytic intermediate increases the apparent affinity of the enzyme for its substrates, ATP and glucose I-phosphate. In addition, increasing concentrations of the activator may also reverse the inhibition caused by AMP, ADP or inorganic phosphate. The observations which show that allosteric regulation occurs at the ADPglucose synthetic step are in agreement with the concept that regulation of a biosynthetic pathway occurs at its first unique step. Studies of the activator specificities of over 40 ADPglucose pyrophosphorylases have shown that they can be divided into seven groups, based on differences in their specificity of activation by glycolytic intermediates (Preiss, 1984).This is seen in Table 2. It has been postulated that the variation of activator specificity seen in Table 2 is associated to the type of carbon degradation or assimilation pathway that occurs either in the bacterial cell or plant tissue. A number of reviews (Preiss, 1969, 1973, 1978, 1984; Preiss and Walsh, 1981) have discussed at length the correlation of activator specificity of the ADPglucose pyrophosphorylases with the carbon assimilation pathways prevalent in the organism. For example, when the bacterium obtains its energy mainly through glycolysis, the ADPglucose pyrophosphorylase is usually activated by fructose 1,6-bisphosphate (e.g. E. coli). The photosynthetic cyanobacterial and plant ADPglucose pyrophosphorylases are activated by 3-phosphoglycerate, the primary CO, fixation product of oxygenic photosynthesis (Preiss and Levi, 1980; Preiss, 1988).The initial CO, fixation product therefore stimulates the enzyme involved into synthesizing one of the ultimate products of photosynthesis; glycogen in the cyanobacteria and starch in plants. Discussions of the activator specificities of other ADPglucose pyrophosphorylases and their relation to the metabolic pathways present in the microorganism may be read in the above reviews.
192
JACK PKEISS A N D 1 O N Y ROMEO
TABLE 2. Groups of bacterial ADPglucose pyrophosphorylases with different specificity for allosteric activator Activdtor(s) None Pyruvate
3-phosphoglycerate Pyruvate Fructose 6-phosphate Fructose 6-phosphate Fructose 1.6-hisphosphate Pyruvate Fructose 6-phosphate Fructose 1.6-bisphosphate Fructose 1,6-bisphosphate Pyridoxal phosphate NADPH
Bacteria Clostridium pusteurianum, Enterohucter hafniae, Serruria spp. (Ser. Liquifaciens, Ser. marcescens) Rhodospirillum spp. ( Rh. fuluum, Rh. molischianum, Rh. photomi>tricum, Rh. ruhrum, Rh. tenue), Rliodoc:,clu.u purpureus Aphanocapsa 6308. Synechococcus 6301 Agrohuctcvk4m tumcfuciens, Arthrohacter uiscosus, Chlorobium limicolu, Chromalium uinosuni Rhoilop.pseudomonas spp. ( R . ucidophila, R . hlasticu, R. tupuhtu, R. puhtris), Rhodomicrobium uunnielii Aeronionus hydrophila. Micrococcus luleus. Mycohacterium .smegmatis, Rhodopseudomonas viridis RAod(~pst.udomonassp. ( R. gelutinttsu, R. gloh$ormi.s R. sphueroides) Citrohucier jreundii. EiAwrdsielfu iurrln. Enierohocrc~r uercigenes. Enrerohacrer cloaceu, Escherichia uurescens. Ewhericliia coli. Klehsiellu pneunioniae, Sulomon~~llu enteriditis. SulmoneJlu t.vphimurium, Shigellu dysenlcriuc
2. Physiology Studies with Mutants Show that Allosteric Actioution and Inhibition haw Importance in vivo ,for Regulation qf Gl.vcogen Synthesis There is much evidence to indicate that the allosteric activation and inhibition observed in many kinetic studies in uitro are functional under physiological conditions in oioo. These results have geen obtained from studying a class of mutants of E. coli (Cattaneo et al., 1969; Govons eta].,1969,1973; Preiss el al., 1971,1975, 1976b)and S. typphimurium LT-2 (Steiner and Preiss, 1977)affected in their ability to accumulate glycogen which can be correlated to the altered regulatory properties of the mutant ADPglucose pyrophosphorylases. The studies of these various mutants have recently been reviewed (Preiss, 1978; Preiss and Walsh, 1981; Preiss et ul., 1983).Essentially, what is observed is that the mutants containing ADPglucose pyrophosphorylases with higher afinity for the activator, fructose 1,6-bisphosphate and/or lower affinity for the inhibitor AMP, accumulate more glycogen than the parent wild-type strain. Those mutants having an ADPglucose pyrophosphorylase with lower affinity for the activator accumulate less glycogen than the parent wild-type strains. Studies by Dietzler et cil. (1974, 1975)have also suggested that fructose 1,6bisphosphate is the in-uioo activator of the ADPglucose pyrophosphorylase. Two mutants of E. coli were grown under different media conditions where the
BACTERIAL GLYCOGEN SYNTHESIS
193
carbon and/or nitrogen sources were changed. These different conditions yielded a 10-fold range in the rate of glycogen accumulation in stationary phase and were linearly related to the square of the fructose 1,6-bisphosphate concentration found under the different conditions. ATP concentrations were essentially the same under the different growth conditions. Thus, a direct relationship between the rate of glycogen accumulation and fructose 1,6bisphosphate concentration, in addition to the mutant studies described above, strongly indicate that the fructose 1,6-bisphosphate is physiologically functional as an activator of ADPglucose pyrophosphorylase and of glycogen synthesis in E. coli and S. ryphimurium. IV. Characterization of the Bacterial Glycogen Biosynthetic Enzymes A.
ADPGLUCOSE PYROPHOSPHORYLASE
Many of the physical and chemical properties of the bacterial ADPglucose pyrophosphorylases have been summarized in previous reviews (Preiss, 1973, 1978, 1984; Preiss and Walsh, 1981; Preiss ef al., 1983) and the reader is referred to them with respect to information from earlier studies reporting on the subunit structures and kinetic analysis of ADPglucose pyrophosphorylases from many bacteria. A reason to continue to investigate the structure of the E. coli ADPglucose pyrophosphorylase is that in the homotetrameric native enzyme, the 50,000Da subunit has an allosteric activator site and an inhibitor site, in addition to the substrate sites. There also appears to be an independent Mg2+ion binding site in addition to the Mg-ATP substrate site (Gentner and Preiss, 1968). The interaction of the substrate sites with the effector sites to evoke the modulation of catalytic activity is of considerable interest. Moreover, the different activator specificities which are observed for various ADPglucose pyrophosphorylases raise questions with respect to structure-function relationships of the effector sites and their variability among the different ADPglucose pyrophosphorylases. Thus, research in the past few years has been designed to examine the various effector and substrate binding sites. The results obtained from these studies are discussed in the following sections. The structural genes of the glycogen biosynthetic enzymes of E. coli (Okita et al., 1981) and S. ryphimurium (Leung and Preiss, 1987a) have been cloned and the glgC (ADPglucose pyrophosphorylase) gene of E. coli (Baecker et al., 1983) and of S. ryphimurium (Leung and Preiss, 1987b) have been sequenced. Amino-acid sequences, deduced from the nucleotide sequences, also have been obtained for both sequences and are seen in Fig. 1. The nucleotide sequences of the glgC gene of both bacteria contained an open-reading frame of 1293 bp providing coding for 431 amino acids. The molecular weight for the E. coli
-E. -coli S. typhimurium
20
40 V A L I L A C G R C TRLKDLINKR V A L I L A G C R C TRLKDLANKR
60 FRJI DFALSN FRVIDFALSN
MVSLEKNDHL MVsLEKNDRJ
MLARQLPLKS MLARQLPLKS
CINSGIRRF$ CLNSCIRRIG
VITQYQSHTL VITQYQSHTL
VTQNLKIIRR VTQNLKIIRR
140 YKAEYVVILA GDHIYKQDYS Y K A E W V I L A CDHIYKQDYS
RMLIDHVEKC RMLIDHVEKG
ARCTVACMPV ARCTVACMPV
PIEEAS_AFGV PIFATAFGV
200 SMPPDESKSL DFVEKPANP- AMLLDASKSL
220 ASMCIYVFDA DYLYELLEJD ASMGIYVFDA D Y L Y E L L Y D
DRDZSSHDF DIJDZSSHDF
80
MAVDEZDKI I MAVDEDKII
-EFVEKPANPP
GKDLIPKITE CKDAIPKITE
-ACLAYAHPFP EFYAHPFP
-
DRNWPIRTYN DaNwPIRTHJ
ESLPEAKFVQ ESLPRAKFVQ
NIDSAVLLPE NIDSAVLLPE
VWV_GRSCRLR VEEGRSCRLR
VQHIQRCWSE VQHIQRCWSL
-
260 LSCVQSDPDA LSCVQSDP(JA
320 DRSGSHGMTL ERSCSHGMTL
380 ACVIDRACII CCVIDRACLI
AKPAVHFGCK AKPAVHFCGK
1 00 FNEEMNEFVD LLPAQQRMKG FSEEMNEFVD LLPAQQRMKC
160
280 EPYWRDVCTL EPYWRDVCTL
EAYUKANLDL EAYWKANEDL
340
NSLVSGGCII -K S L V E W L I
120
ENUYRCTADA ENNYRGTADA
180
240
300 ASVVPKLDMY ASVTPPLDHY
360
SGSVVVQSVL SCSVVVQSVL
FsRVRINSFC FERVRLNSFC
400 PECMVIGENA EEDARRFYRS PECMVIGENA EEDARRFYRS
EEGIVLVTRE EECIVLVTRE
420
MLRKL-GHKQER MLRKLQGHKQWR
FIG. 1. The deduced amino-acid sequences of Escherichia coli and Salmonella typhimurium ADPglucose pyrophosphorylases. As indicated,the top line pertains to the Escherichia coli enzyme, while the line underneath pertains to the Salmonella typhimurium enzyme. Numbers indicate the amino-acid residue. The one-letter code for amino acids is used and the lines underneath the letter indicate the differences seen between the two enzymes.
BACTERIAL GLYCOGEN SYNTH€SIS
195
coded polypeptide was 48,476 (Baecker et al., 1983)and for the S. typhimurium polypeptide, 48,590 (Leung and Preiss, 1987b). The total amino-acid composition of the deduced amino-acid sequences was in accordance with the amino-acid compositions determined by acid hydrolysis and reported earlier (Haugen et a/., 1976; Lehman and Preiss, 1980). The deduced amino-acid sequences of the S. typhimurium and E. coli gfgC genes are compared in Fig. 1. There is 90% homology in their deduced aminoacid sequence, and most of the changes are conservative. Of 45 differences in their amino-acid sequences, 16 involve only one base change, 25 involve two base changes, and only four of them involve three base changes. Lehmann and Preiss (1980) reported that ADPglucose pyrophosphorylases from E. coli and S. typhimurium differ in their first 27 amino-acid residues in the N-terminus at residues 9 and 10. The two differences are histidine in E. coli to arginine in S. typhimurium at residue 9 and leucine in E. coli to valine in S. typhimurium at residue 10. The change in amino-acid character is conservative because both arginine and histidine are basic amino acids and both leucine and valine are non-polar in nature. The ionic character and hydrophobicity in this portion of the enzyme is therefore retained. Moreover, the change from leucine to valine involves only one base change, from TTA to GTA. It is expected, however, to see great homology between the E. coli and S. typhimurium enzymes because these micro-organisms are related and the activiator specificity of the enzymes are the same. It should be pointed out that deduced amino-acid sequences are identical to the partial sequences determined by classical Edman degradation (Baecker et ul., 1983; Leung and Preiss, 1987b).Knowledge of the primary sequences of the E. coli and S. t.vphimurium enzymes is important in order to determine the nature of the substrate- and effector-binding domains and catalytic sites, and thus determine and understand the allosteric and catalytic mechanisms. Only partial N-terminal sequences are known for other bacterial ADPglucose pyrophosphorylases (Preiss, 1984). The amino-terminal aminoacid sequences of the enzymes of the photosynthetic organisms, Rhodospirillum tenue, Rhodospirillum rubrum and Rhodopseudomonas sphueroides are different from those observed for the enteric organisms, as well as different from each other. The R. sphaeroides enzyme is activated by fructose 1,6bisphosphate in addition to fructose 6-phosphate and pyruvate (Preiss et al., 1980). Although activated by fructose 1,6-bisphosphate, as are the enteric enzymes, the amino-terminal sequence has no resemblance to the enteric enzyme sequences. Somewhat unexpectedly, the amino-terminal sequences of the two enzymes activated only by pyruvate are also quite dissimilar. Indeed, antibody prepared against the Rsp. tenue enzyme had little effect on Rsp. rubrum activity in enzyme neutralization tests (Yung and Preiss, 1981). Only 25% of the
196
JACK PREISS A N D TONY ROMEO
enzyme activity was inhibited, suggesting very little similarity of the two enzymes in structure. Thus, despite the fact that the ADPglucose pyrophosphorylases from the genus Rhodospirillum are activated solely by pyruvate, the immunological studies suggest that their amino-acid sequences may be distinct. Whether the allosteric activator site of the photosynthetic bacterial ADPglucose pyrophosphorylase is near the amino-terminal portion of the enzyme, as observed for the enteric enzymes, is not known. Indeed, recent studies with the spinach leaf ADPglucose pyrophosphorylase have shown that, for one of its subunits, the activator site is close to the carboxyl terminus (Morel1 et al., 1988). Further studies would be required to determine the sequence as well as the position of the activator site in other bacterial ADPglucose pyrophosphorylases. B. CHEMICAL MODIFICATION OF THE ACTIVATOR SITES OF Escherichia coli AND Rhodopseudomonas sphaeroides ADPGLUCOSE PYROPHOSPHORYLASES
1. Escherichia coli
Reductive phosphopyridoxylation of the E. coli ADPglucose pyrophosphorylase has provided information on the nature and amino-acid sequence of both the allosteric activator and substrate-binding sites (Parsons and Preiss, 1978a,b). In the presence of ADPglucose plus Mg2+ions, reaction of the E. coli ADPglucose pyrophosphorylase with pyridoxal phosphate and sodium borohydride (NaBH,) led to formation of an enzyme which no longer required the presence of fructose 1,6-bisphosphate for high activity, especially after incorporation of 0.5 mol of pyridoxal phosphate per mole of subunit (Parsons and Preiss, 1978a).When the reaction was carried out in the presence of other activators, such as fructose l,Qbisphosphate, 1,6-hexanediol bisphosphate or the inhibitor, 5’-AMP, the incorporation of pyridoxal phosphate was inhibited, and the formation of an activator-independent enzyme did not occur. The two phenomena, formation of active enzyme by reductive phosphopyridoxylation and inhibition of formation of active enzyme by the other activators, strongly suggest that reductive phosphopyridoxylation occurred at the activator binding site. Although the inhibitor, AMP, prevented reductive phosphopyridoxylation, it was not believed that AMP bound at the activator site. AMP still inhibited the pyridoxal phosphate-modified enzyme in the same manner as the unmodified enzyme with the same concentration giving 50% inhibition (Parsons and Preiss, 1978a). Thus, activator and inhibitor must bind at different sites. The E. coli ADPglucose pyrophosphorylase containing the incorporated labelled pyridoxal phosphate was degraded with cyanogen bromide (CNBr) and the labelled peptide isolated and sequenced (Parsons and Preiss, 1978b).
BACTERIAL GLYCOGEN SYNTHESIS
197
The covalently modified lysine residue was identified as the 39th amino acid from the amino terminus (Fig. 1). There is a predominance of basic residues in the sequence in close proximity to L Y S ~ The ~ .activator site has six positively charged amino-acid residues: arginine at residues 29, 32 and 40; lysine at residues 34, 39 and 42. Thus the sequence from residues 29 through 42 has sufficient positive charge and epsilon amino groups for binding of phosphates, carboxyl or aldehyde groups (via Schiff base formation) of the various activators. The effective activators for the E. coli ADPglucose pyrophosphorylase have either two phosphate residues (e.g. fructose 1,6-bisphosphate, 1,6-hexanediol bisphosphate, NADPH) or one phosphate plus an aldehyde group (pyridoxal phosphate) or a carboxyl group (2-phosphoglycerate, phosphoenolpyruvate or 4-pyridoxic acid 5-phosphate) (Preiss, 1969, 1972, 1973, 1978, 1984; Preiss and Walsh, 1981). Suggestions that these various activators bind to the same site have been obtained from kinetic studies (Preiss et al., 1966;Gentner et al., 1969)and binding studies(Haugen and Preiss, 1979). Chemical modification of the E. coli ADPglucose pyrophosphorylase has also suggested that arginine residues were also present at the activator site (Carlson and Preiss, 1982). There was a decreased ability of the activator, fructose 1,6-bisphosphate to stimulate activity after modification with phenylglyoxal. The apparent affinity for fructose 1,6-bisphosphate and the V,,, value of the reaction at saturating concentrations of the activator were decreased. 1,6-Hexanediol bisphosphate and fructose 1,6-bisphosphate could partially protect the enzyme from the modification. However, studies to determine which arginine residue(s) in the enzyme were affected were not done. It would be of interest if the residues at 29,32 or 40 (Fig. 1) were modified, or if the affected arginine resided elsewhere (residues 375,378,380,381,386,?) in the enzyme. 2. Rhodopseudomonas sphaeroides It was of interest to determine whether the allosteric effector sites of other ADPglucose pyrophosphorylases were present at the N-terminal portion of the proteins. Thus, chemical modification studies have been done with R. sphaeroides ADPglucose pyrophosphorylase as well as with a non-bacterial enzyme, spinach leaf ADPglucose pyrophosphorylase. Bromopyruvate could activate the R. sphaeroides enzyme 2.2-fold under conditions where the natural activator stimulated the reaction five-fold (Preiss et al., 1983). The concentrations required for half-maximal activation, A , , , , were almost equivalent, 0.1 mM for pyruvate and 0.14 mM for bromopyruvate (Preiss et al., 1983). Incubation with labelled bromopyruvate resulted in incorporation of the label into the enzyme, which had a 2.5- to three-fold higher activity than the unmodified, unactivated enzyme. There was a linear
198
JACK PREISS A N D TONY ROMEO
relationship between extent of bromopyruvate incorporation and of activation (Preiss ez ai., 1983) until 1.3mol of bromopyruvate was incorporated per mole of subunit. Further incorporation resulted in a decrease of activity. Cyanogen bromide degradation of the labelled enzyme modified with bromopyruvate and after NaBH, reduction and carboxylmethylation gave rise to 14 peptides on SDS-urea polyacrylamide-gel electrophoresis. Two of the peptides were labelled with one containing 70% of the radioactivity. Tryptic digestion of the carboxymethylated and [3-'4C]bromopyruvatemodified protein also released two labelled peptides. The amino-acid sequence and position of the labelled peptide in the subunit has still not been determined. However, the available evidence suggests that the amino-acid residue modified is cysteine. First, dithiobis (2-nitrobenzoic acid) (DTNB) incorporation into modified and unmodified R. sphaeroides ADPglucose pyrophosphorylase shows that there is a decrease of about 0.68mol of cysteine per mole of subunit in the bromopyruvate modified enzyme. Second, modification of the R. sphaevoides enzyme with DTNB or 2,2'-dithiodipyridine resulted in about a 1.8- to two-fold increase of activity in the absence of activator. If, however, more than I mol of SH group was modified per mole of subunit, the enzyme activity decreased. Thus, bromopyruvate most probably alkylates a sulphhydryl residue to form Spyruvyl cysteine. 3. Spinach Leuf Enzyme
The spinach leaf ADPglucose pyrophosphorylase can also be activated by ~ ~ thus lower than the pyridoxal phosphate. Its ,40,5 value is about 1 . 5 and physiological activator, 3-phosphoglycerate (3PGA) (Preiss et ul., 1987a,b). Although the pyridoxal phosphate may have a higher apparent affinity it can only stimulate the enzyme activity about six-fold while 3PGA increases V,,, 25-fold. Suggestive evidence that pyridoxal phosphate binds to the same site as 3PGA is that it inhibits the activation caused by 3PGA, and similar to 3PGA can overcome inhibition caused by inorganic phosphate in the absence of activator (Preiss et al., 1987a). Reductive phosphopyridoxylation of the enzyme with NaBH, causes the enzyme to be five- to six-fold more active in the absence of activator. If 3PGA or inorganic phosphate was present during the reductive phosphopyridoxylation no increase of activity in the absence of activator was observed (Preiss et al., 1987a.b; Preiss, 1988).These observations strongly suggest that pyridoxal phosphate was bound at the active site. In addition, the phosphopyridoxylated enzyme is quite insensitive to inhibition by inorganic phosphate (Preiss e t a/., 1987a,b). Thus, as observed with the spinach leaf
199
BACTERIAL GLYCOGEN SYNTHESIS
-E. -coli:
Arg-Leu-Lys-Asp-Leu-Thr-Asn-Lys'-Arg-Arg-Ala-Lys-Pro-Ala-Val
Spinach leaf:
Ser-Gly-Ile-Val-thr-Val-Ile-Lys*-Asp-Ala-Leu-Ile-Pro-Ser
FIG. 2. Comparison of amino-acid sequence of the Escherichiu coli ADPglucose pyrophosphorylase fructose 1,6-bisphosphate activator binding site with the spinach leaf ADPglucose pyrophosphorylase 3-phosphoglycerate activator-binding site.
enzyme in the presence of 3PGA, the pyridoxal phosphate-modified enzyme is in a conformation that is more resistant to phosphate inhibition. The plant enzymes are more complicated in structure than the bacterial enzymes in that they are heterotetramers consisting of two different subnits (Morell et al., 1987a; Preiss, 1988) while the bacterial enzymes are homotetramers (Preiss, 1988).Subsequently, it was shown that [3H]pyridoxal phosphate was incorporated into both the 54,000 and 51,000 Da subunits of the spinach leaf ADPglucose pyrophosphorylase (Morell et al., 1988). The incorporation into both subunits was equivalent. At present, the labelled 51,000 Da subunit has been subjected to tryptic digestion and the labelled peptide isolated and purified using reversed-phase HPLC and then sequenced (Morell et al., 1987b; 1988).The amino acid sequence is observed in Fig. 2 and is compared to the E. coli ADPglucose pyrophosphorylase activator-site sequence. The sequences are different, but this is not surprising, as the major activator for the spinach leaf enzyme is 3PGA, while for the E. colienzyme the activator is fructose 1,6-bisphosphate. There are many more basic residues in the E. coli sequence than in the spinach leaf 51,000Da subunit activator sequence. At present, the 54,000 Da subunit activator sequence has not been determined. Whether the sequences would be similar is at present not known. It should be emphasized, however, that there are many questions unresolved with respect to the subunits associated with the plant ADPglucose pyrophosphorylases. There is much evidence to indicate that in spinach leaf the 51,000 and 54,000Da subunits are different proteins. Their tryptic digest HPLC maps are different, as well as their antigenic properties (Morell ef al., 1987a). They appear to have activator-binding sites but whether both have substrate sites remains to be resolved. Of particular interest is that the allosteric activator site of the 51,000Da subunit is situated near the carboxyl terminus of the polypeptide (Morell et al., 1987b, 1988; Preiss et al., 1987a), in contrast to the amino-terminal location which has been found for the E. coli and S. /yphimuriurn allosteric sites (Baecker et al., 1983; Leung and Preiss, 1987b). C. EVIDENCE FOR
LOCATION OF SUBSTRATE BINDING SITES IN
ADPGLUCOSE
PYROPHOSPHORYLASE
Initial experiments indicated that reductive phosphopyridoxylation of E. coli ADPglucose pyrophosphorylase at high concentrations of pyridoxal
200
JACK PREISS A N D TONY ROMEO
phosphate caused a decrease in enzyme activity (Parsons and Preiss, 1978a). However, this enzyme inactivation could be prevented by the presence of the substrates, ADPglucose plus Mg2+ or ATP and Mg2+.These experiments thus suggested that there was an epsilon amino lysine group required for either substrate binding or for catalytic activity. The ADPglucose-protected site was isolated by cleaving the labelled enzyme, after reductive phosphopyridoxylation in the presence of activator fructose 1,6-bisphosphate or hexanediol 1,6-bisphosphate, with CNBr (Parsons and Preiss, 1978b).The 21amino-acid peptide, isolated and sequenced, was identified as Ala to HornoSer’” (Fig. I). L Y S ’was ~ ~ labelled with C3H]pyridoxal phosphate. To obtain further information on the substrate binding site of the E. coli enzyme, the photo-affinity labelling agent 8-azido-ATP was used (Lee et af., 1986, Lee and Preiss, 1986).The 8-azido-adenosine nucleotide analogues have been successfully used to identify ligand binding sites of many nucleotidebinding proteins (Kerlavage and Taylor, 1980; Cross and Nalin, 1982).Upon irradiation with ultraviolet light the azido (N,) compound forms a nitrene radical which reacts with electron-rich groups. It is even capable of forming a secondary amine with a C-H bond. It was found that the 8-N3-ATP was a substrate for the enzyme. The So,s value (i.e. concentration of substrate given 50% of maximal velocity) for 8-N3-ATP was about I .7 times higher than the So.5value for the natural substrate, ATP. The product of the reaction, 8-N3ADPglucose was characterized and was shown to have a typical spectrum of an 8-azido nucleotide(Lee et al., 1986).The 8-N3-ADPglucose was also shown to be a substrate in the reverse direction having an So,s value of 75 PM which is identical to the value obtained for the natural substrate, ADPglucose. However, the maximal velocities obtained with the 8-N3 substrates were 0.3% for 8-N3-ATP and 0.9% for 8-N3-ADPglucose of those observed for the natural substrates, ATP and ADPglucose. It was also found that the 8-N3-ATP was a competitive inhibitor of ADPglucose synthesis from ATP and 8-N3ADPglucose was a competitive inhibitor of pyrophosphorolysis of ADPglucose. Thus, the kinetic experiments indicated that 8-N3-ATPand 8N,-ADPglucose specifically interact at the substrate site of the ADPglucose pyrophosphorylase. Photo-inactivation of the E. cofi enzyme in the presence of fructose 1,6bisphosphate and Mg2 with either 8-N3-ADPglucose or 8-N3-ATP was effectivelyprevented when either ATP or ADPglucose was present. Adenylic acid and ADP were much less effective, as were UTP and UDPglucose. This also suggested that the 8-N3-adenosine nucleotides were bound specifically at the substrate binding sites. Using radioactive 8-N3-ATP or 8-N3-ADPglucose enabled one to relate extent of inactivation with extent of binding of the inactivator (Lee et al., 1986). About 70% inactivation occurred with 0.35 mol of E(-N,-ATP bound to 1 mol of enzyme subunit. Extrapolation of the curve + .
BACTERIAL GLYCOGEN SYNTHESIS
20 1
showed that 100% inactivation would occur with the binding of 0.5 mol of analogue per mole of subunit. This observation of half-site reactivity of the 8N,-ATP is consistent with the previous published studies of half-site binding of ATP to the E. coli enzyme (Haugen and Preiss, 1979). The sites of incorporation of [14C]-8-N3-ADPglu~o~e into the E. coli ADPglucose pyrophosphorylase were determined by digestion of the modified enzyme with trypsin and isolation of the labelled peptide via HPLC (Lee and Preiss, 1986). Subsequent amino-terminal sequence analysis identified the sites or regions where incorporation of the [ l4C]-8-N3ADPglucose occurred. About 65% of the label was found in the region of 108-128 (Fig. I). Most notable was the amino acid. Tyr'',, which was believed to be the acceptor of the nitrene radical. About 20% of the label was incorporated between C Y S ' to ~ ~LysZo8.L Y S ' is ~ ~in that region and, as indicated before, was the amino acid which was protected from reductive phosphopyridoxylation by the substrate ADPglucose plus Mg2+. Another area of minor incorporation (15%) was Arg381 to Arg385. There are some notable features about these areas. The peptide segment comprising amino acid residues 108-1 29, has some interesting structural features. It is rich in basic amino acids, Lys at residue 108 and Arg at positions 107, 115, 129, and 130, and these may be essential for binding of the anionic phosphate groups of the nucleotide substrate. Basic amino acids, especially arginine residues, have been postulated to be important for the binding to enzymes of substrates containing phosphate groups (Riordan er al., 1977). Also, analysis of this peptide by Chou and Fasman conformation rules (Chou and Fasman, 1974) predicts a strong /?-turn secondary structure at residues 1 10-1 13 (Gly-Glu-Asn-Trp) and at residues 115-1 18 (Arg-Gly-Thr-Ala). Reverse /?-turns are considered to be located on the surface of the protein and do not possess a stable conformation being structures of least resistance in the folding process of the peptide chain. Moreover, analysis by the Chou-Fasman model of the whole protein (Larsen et al., 1986) predicts the presence of a Rossman-fold supersecondary structure, a structure found in many other adenine nucleotide-binding proteins. A structure consisting of three consecutive strands of parallel fi-pleated sheet and two joining a-helices is predicted for the primary sequence from residues 79 to 131 (Fig. 1). The reverse !-turns of residues 110-113 and 115-1 18 are present in this structure as well as Tyr' 14. Region 79-1 31 is the only region in the enzyme in which such a contiguous fold is predicted by the Chou-Fasman analysis. It has been shown for at least five other adenine nucleotide-binding proteins that tyrosine is in proximity to the adenine ring. Tyrosine was found by X-ray crystallography to be associated with an adenine ring in pig muscle adenylate kinase (Pai et al., 1977) and in dogfish M, lactate dehydrogenase (Adams et af., 1973) and by photo-affinity labelling using 8-N3-adenine nucleotides in the regulatory
202
JACK P R E S S A N D TONY ROMEO
subunit of porcine heart CAMP-dependent protein kinase (Kerlavage and Taylor, 1980), bovine mitochondria1 F,-ATPase (Hollemans et ul., 1983) and E. coli recA protein (Knight and McEntee, 1985). The absolute functional requirement for Tyr at these sites has not been shown, however, and it may just be part of a fairly non-specific hydrophobic adenine-binding pocket. The second major binding region of 8-N3-ADPglucose in the enzyme lies within residues 163-208 (Fig. 1 ) and includes LysI9’ which, as indicated earlier, when modified by pyridoxal phosphate caused inactivation of the ADPglucose pyrophosphorylase. The residue was postulated to be involved with binding of the substrates ADPglucose and ATP since these substrates could protect the enzyme from inactivation by reductive phosphopyridoxylation (Parsons and Preiss, 1978a,b). Thus, binding of 8-N3ADPglucose in this region would support this postulation. The cause of the lower incorporation in the region of residues 163-208 than in the region of 108-129 may be a less favourable orientation of the azido group to react with nucleophilic groups. An interesting feature of the region 163-208 is the predominance of negatively charged amino acids: Glu at positions 173, 174, 185, and 191; Asp at positions 184, 187 and 205; and Pro (residues 169, 171, 196, 199, 200, 203 and 206). Although this region is dissimilar to the basic region 108-129 (Fig. l), it shows strong potentiality of reverse turns in predicted secondary structure at Pro2’’, Metzo2 and Aspzos (Chou and Fasman, 1974; Lee and Preiss, 1986).The structure can also be considered as a poly-Pro conformation due to Pro 199, 200, 203 and 206. LysI9’ is situated between a predicted P-sheet (residues 190-194) and a reverse p-turn or polyPro conformation, suggesting that the lysine is at the conformational boundary and well exposed to the solvent. The third region where 8-N,-ADP-[’4C]glucose is covalently incorporated is amino-acid residues 381-386 (Fig. 1). There is a predominance of the basic amino-acid arginine at positions 380,38 I and 386, which may be essential for the electrostatic attraction of the substrate to the enzyme. Arginine is also present at residues 375 and 378. The predicted secondary structure of region 382-386 shows ,!I-sheet conformation (Lee and Preiss, 1986). From the above data, it is postulated that these regions where 8-N,ADPglucose was incorporated are situated in close proximity in the tertiary structure. However, a better understanding of the architecture of the active site would have to await X-ray crystallographic data. The E. coli ADPglucose pyrophosphorylase has been crystallized (Mulichak et ul., 1988). Preliminary diffraction data indicate that the crystals are orthorhombic but their diffraction quality was relatively poor and the crystals were sensitive to X-ray exposure damage. Thus, efforts are being made to improve the diffraction quality of the crystals in order to obtain more detailed information of the enzyme structure.
BACTERIAL GLYCOGEN SYNTHESIS
203
D. CHEMICAL MODIFICATIONOF THE INHIBITORSITES OF THE Escherichia coli ADPGLUCOSE PYROPHOSPHORYLASE AND THE RELATIONSHIP OF THE INHIBITOR SITE WITH THE SUBSTRATE AND ACTIVATOR SITES
To identify the inhibitor binding site the photo-affinity analogue 8-N3-AMP was used as a site-specificprobe of the inhibitor-binding sites. In the absence of light, the enzyme is inhibited by 8-N3-AMP and as shown for the natural inhibitor, 5‘-AMP, the enzyme was more sensitive to inhibition at lower concentrations of the activator, fructose 1,6-bisphosphate (Larsen and Preiss, 1986; Lee et al., 1987b).With 5 0 p fructose ~ 1,6-bisphosphate, 50% inhibition occurred at 3.4 p~ AMP and 43 p~ 8-N3-AMPwhile with 1.5 mM of activator, 7 0 p AMP ~ or 307 PM 8-N3-AMP was required for 50% inhibition. Thus 4.4 to 12.6 times more 8-N3-AMPwas required for 50% inhibition. Nevertheless, the inhibition by 8-N3-AMP is similar to that observed with AMP. In the presence of ultraviolet light (254 nm), 8-N3-AMP specifically and covalently modified the enzyme and photo-incorporation of labelled 8-N3AMP was linearly related to decrease in catalytic activity up to at least 65% inactivation. Curiously, the substrates ADPglucose and ATP provided 100 and 50% protection, respectively, from inactivation and photo-incorporation of 8-N3-AMP. The inhibitor, AMP, only provided 33% protection. The enzyme labelled with 8-N,-C3H]AMP was degraded with CNBr which gave radioactive soluble and insoluble fractions. The insoluble fraction was digested further with mouse submaxillary arginyl-specific protease (MSAP). The radioactive peptides were isolated and purified by HPLC and characterized via amino-acid sequencing or amino-acid analysis, and agreement with the deduced amino-acid sequence (Larsen et al., 1986). A number of the peptides corresponded to the amino-acid sequence of residues 109-1 28, and contributed about 61 70of the recovered radioactivity present in the isolated labelled peptides. Tyrosine’ l 4 was identified as the amino acid modified by 8-N3-AMP.A second major binding region of the labelled 8-N3AMP (22%) corresponded via amino-acid analysis to the region Leu” to Met69. LysJ9,the residue involved in binding of the activator is contained in this region. Of interest and possible importance is that incorporation of the label in this region was inhibited to a greater extent by the presence of AMP than by the substrates, ATP or ADPglucose (Larsen et al., 1986). Given the specific protection by AMP it is possible that this is a major domain for AMP binding. A third binding region for 8-N,-C3H)AMP (17%) was located at residues 223-255 (Fig. 1). This region is highly negative in charge, containing four Asp residues (230, 231, 233 and 239) and four Glu residues (225, 228, 229 and 234). These studies strongly suggest overlap of the inhibitor-binding site with
204
JACK PREISS A N D TONY ROMEO
both the substrate- and activator-binding sites. The protection from photoinactivation by the inhibitor analogue and by the substrates would be consistent with this. Moreover, the major site of binding is Tyr114 for both the photo-affinity substrate analogues, 8-N3-ADPglucose or 8-N3-ATP (Lee et al., 1986)and the photo-affinity inhibitor analogue, 8-N3-AMP(Larsen et al., 1986).Obviously, the adenine ring of the three adenine nucleotides binds at or near the same site in the ADPglucose pyrophosphorylase. Specifically,the C-8 atom of the adenine ring to which the azido moiety is bound must be very close to Tyr' l 4 for all three adenine nucleotides. Thus, all adenine nucleotide ligand protection of both 8-N3-AMPand 8-N3-ADPglucose photo-inactivation can be explained. However, the secondary sites of incorporation of the 8-N3-AMP- and 8-N3ADPglucose-modified enzymes are different indicating that the binding domains, although overlapping, are different. In the 8-N3-ADPglucosemodified enzyme, the second major labelled region contained residues , determined pyridoxal182-202 (Lee rt al., 1986); L Y S ' ~a~ previously phosphate modified ADPglucose-protected site, is located there (Parsons and Preiss, 1978a,b). However, the second major region of the 8-N3-AMPmodified enzyme is residues 12-69 which contain the pyridoxal phosphate binding site at L Y S , (Parsons ~ and Preiss, 1978a,b). Since AMP protected incorporation into this region better than ATP or ADPglucose, some of this region probably participates as part of the important inhibitor-specific binding site. The third binding regions of the S-N,-AMP and 8-N3ADPglucose are also different, residues 223-255 for 8-N3-AMPand 381-386 for 8-N3-ADPglucose. They are quite different with respect to their charge properties. Residues 223-255 are highly negative while residues 380-386 contain three arginine residues and thus is a highly basic region. Thus, the ligand-binding sites probably do not overlap completely. The concept of the various ligand-binding sites from the structural data may help explain previous kinetic and binding data. Adenylic acid decreases the apparent affinity and Hill slope ii of ATP and V,,,,, of the E. coli ADPglucose pyrophosphorylase (Gentner and Preiss, 1968; Preiss, 1978)and is therefore only partially competitive with ATP. Thus, the inhibitor and substrates may share only part of their otherwise separate sites. As indicated earlier (Section IIIC), Tyr' l 4 is in the area of the enzyme predicted to contain two reverse p-turns. Reverse p-turns are not conformationally stable and are regions of least resistance in the folding process of peptide chains (Schulz and Schirmer, 1979).Thus it is quite possible that this flexible region of the enzyme is involved in binding of both substrates and the inhibitor which are held in mutally exclusive binding-site orientations. This may help to explain the kinetic effects and the observation that at low concentrations, and in the absence of activator, ATP stimulates binding of AMP to the enzyme (Haugen and Preiss, 1979).
BACTERIAL GLYCOGEN SYNTHESIS
205
There may also be a functional r81e for the second 8-N3-AMP modification site. The modified residue appears to be near L Y S ~the ~ ,allosteric-activatorbinding site. Thus, the activator binding site might be in three-dimensional juxtaposition with part of the inhibitor- and substrate-binding sites at Tyr’ 14. A number of previously observed enzyme ligand interactions might then be explained. Sensitivity of the enzyme to inhibitor is modulated by the activator concentration (Gentner and Preiss, 1967; Preiss, 1978). Furthermore, the binding of 1,6-hexanediol bisphosphate (an activator analogue of fructose 1,6bisphosphate) and AMP together is never greater than one ligand per subunit (Haugen and Preiss, 1979).Finally, the binding of AMP is inhibited only when ATP and fructose 1,6-bisphosphate are present together. Neither ligand alone inhibits AMP binding (Haugen and Preiss, 1979). It is quite possible that the AMP-binding site is “flexible” and can be repositioned in the presence ofeither ATP or fructose 1,6-bisphosphate. But when both ATP and the activator are bound together the site for AMP is constricted. The region about Tyr114 may be a part of a binding-site region that delicately regulates the interactions of activator, inhibitor and substrates. These interactions may be exerted through the conformational changes induced by binding of the ligands. The above concepts of the three-dimensional relationships of the binding sites of the various ligands at present are just speculation. The binding sites of activator, inhibitor and substrates may be juxtaposed in the enzymes’ tertiary structure. Further work, particularly X-ray crystallography, is needed to determine the three-dimensional topologies and structural relationships of the E. coli ADPglucose pyrophosphorylase ligand-binding sites. E. USE OF MUTAGENESIS TECHNIQUES in UiUO AND in UitrO TO DETERMINE THE FUNCTIONAL AMINO-ACID RESIDUES IN SUBSTRATE BINDING AND ALLOSTERIC FUNCTION
I . Oligonucleotide Directed Mutagenesis of ADPglucose Pyrophosphorylase Try‘ l 4 to Phe’ l4
As indicated above, the covalent modification studies implicated Tyrosine’ l 4 of the E. coli ADPglucose pyrophosphorylase as being involved in substrate binding (Lee and Preiss, 1986). Using site-directed mutagenesis (Zoller and Smith, 1983) an E. coli ADPglucose pyrophosphorylase variant containing a Tyr’ l 4 to Phe substitution was prepared in order to test whether the phenolic hydroxyl group plays a r61e in catalysis. Figure 3 shows the restriction map of the cloned glgC and glgA genes. A 1.9 kbp HincII restriction fragment from the plasmid pOP12 (Okita et al., 1981)which contained the whole glgC gene and about 500 bp upstream of the starting codon was cloned into bacteriophage M 13mpl8 and oligonucleotidedirected mutagenesis was carried out (Kumar et al., 1988). The HincII
206
JACK PREISS AND TONY ROMEO
I
0
I
I
I
I
0.2 0.4
I
1
I
0.6
1
0.8
I
I
1.0
I
I-wLpuc8 1.2 1.4
(Kb)
FIG. 3. Restriction endonuclease map of the Escherichia coli gfgC gene ligated to plasmid pUC8. The nuclease cleavage sites are represented by the virtical arrows.
fragment that was mutagenized was then isolated from M 13mpl8 by digestion with HincIl and then cloned into plasmid pUC8. The recombinant plasmid DNA having the mutagenized HincII fragment was isolated after transformation into E. coli strain JM101 and then transformed into E. coli K12 strain G6MD3, a deletion mutant containing no glg genes (Kumar et af., 1988).The mutant enzyme (Phe1I4enzyme) which was expressed in transformed E. coli G6MD3 was then purified to near homogeneity and compared via kinetic studies to the wild-type E. coli enzyme. These studies are essentially summarized in Table 3. As seen in Table 3, the Phe'l4 mutant enzyme is affected not only in apparent substrate affinity but also in allosteric activation. Thus, using substrate and activator concentrations that provide maximal activity for the wild-type enzyme, very little activity is observed with the Phe' l4 enzyme. For ATP the concentration needed for half-maximal activity, So.s,is 2.8 mM while, for the normal wild-type enzyme, it is 0.26 m ~Thus, . there is an 1 I-fold decrease in the apparent affinity of the Phe1I4 mutant enzyme for ATP. Ofcuriosity is that fructose 1,6-bisphosphate can decrease the ATP So,s value five-fold with the normal enzyme, yet it has little effect on the ATP So,s value for the mutant enzyme. Similarly, the So,5value for MgC1, for the Phe114mutant enzyme is about 13-fold higher than the normal enzyme and, as observed with ATP, fructose 1,6-bisphosphate does not affect the So,s value for MgCI, in the mutant enzyme. In contrast, the activator decreases the MgCI, So,5value of the normal enzyme nine-fold. The S0.5 value for glucose1-phosphate for the mutant enzyme is very similar to that found for the normal, wild-type ADPglucose pyrophosphorylase in the presence of activator, fructose-l,6-bisphosphate.However, in the absence of activator, the So.5 value of glucose-1-phosphate for the Phe'I4 enzyme is about seven-fold higher than that observed for the wild-type enzyme (Table 3). In the pyrophosphorolysis direction, higher values were observed for ADPglucose, pyrophosphate, and MgCI, for the Phe1I4mutant enzyme when compared to the wild-type enzyme (Table 3). Values were obtained only in the
207
BACTERIAL GLYCOGEN SYNTHESIS
TABLE 3. Kinetic constants of Wild-type and Phe1I4 mutant ADPglucose pyrophosphorylase Fructose
Phe114 enzyme
Wild-type enzyme
1,6-
Substrate/effector Synthesis ATP ATP Glucose I-phosphate Glucose I-phosphate MgCb MgCh Fructose I ,6-bisphosphate Hexanediol 1.6-bisphosphate AMP Pyrophosphorolysis A DPglucose Pyrophospha te MgCIz Fructose I ,6-bisphosphate
bisphosphate"
A0,5
s0,5
l0.5
A0.5
0.26 mM 0.3 mM 25 p~ 60 p~
2.8 mM 2.5mM 31 p~ 420 p~ 19 mM 20 mM
-
+
1.4mM
11.5m~
3.5 pM
28 p~ 66 p~
66 p~ 51 p~ 86 pM 3.2m~
0.28 mM 0.37 m~ 7.5mM 2.3mM
IO.5
s0.5
38 p~
"Theconcentration offructose 1,6-bisphosphate in thecase ofthe wild-typeenzyme was 1.5 mM in both synthesis and in pyrophosphorolysis directions. For the PheIi4-mutant enzyme, the concentration of fructose 1,6-bisphosphate was 4 mM in synthesis and 5 mM in the pyrophosphorolysis direction. A,,,, So,5and lo,5are concentrations of activator, substrate and inhibitor giving, respectively. 50% of maximal stimulation, velocity or inhibition.
presence of activator since there was insufficient activity for accurate assay in the absence of activator for the pyrophosphorolysis direction. The Phe1I4 enzyme V,,, value is only 28% of the wild-type enzyme in synthesis of, and only 67% in pyrophosphorolysis of, ADPglucose with fructose 1,6-bisphosphate as the activator at saturating concentrations. The specificity of the enzyme for nucleoside triphosphate or for activator remains unchanged. The kinetic parameters of both the activator and inhibitor were also modified in the Phe114 enzyme. In the synthesis direction, fructose 1,6bisphosphate was only able to activate the mutant enzyme about 1.8-fold and much higher concentrations (3 mM) are needed to obtain maximum activation. Half-maximal activation occurred at about 1.1 mM. In contrast, the normal E. coli K12 enzyme is maximally activated at 1.0 to 1 . 5 m ~fructose-1,6bisphosphate. The ,40,5 value is 4 4 p ~and 15- to 30-fold activation by fructose- 1,6-bisphosphate is observed. 1,6-Hexanediol bisphosphate, a potent activator of the E. coli enzyme is more effectivethan fructose-l,6-bisphosphate
208
JACK PREISS AND TONY ROMEO
in activating the Phe' l 4 mutant enzyme. It activates the synthetic activity about three-fold, and 28 p~ provides half-maximal activation (Table 3). The apparent affinity for 1,6-hexanediol bisphosphate, however, is less than that of the native wild-type enzyme, since its Ao,5value is about eight-fold higher than that observed for the wild-type enzyme (Table 3). Of interest is that the mutant Phe'l4 enzyme is highly dependent on the presence of activator in the pyrophosphorolysis direction. High concentrations of fructose-l,6-bisphosphate(5-7 mM) stimulate the activity 30fold. However, the Ao,5value for fructose-l,6-bisphosphateis about 60-fold higher than the Ao.5 value for the normal ADPglucose pyrophosphorylase. As indicated in Section III.D, the binding sites for the inhibitor AMP and the adenine nucleotide substrates share a binding domain near Tyr' 14. Table 3 shows that the Zo.s value for the mutant and wild-type enzyme is the same, 6 6 ~However, ~ . Hill plots of the inhibition curve show that the shape of the curves are dissimilar (Kumar et af., 1988). The wild-type enzyme has a sigmoidal inhibition curve with a Hill coefficient, 6, of 1.7, while that of the Phe' l 4 mutant enzyme shows negative cooperativity with a Hill coefficient, 6,of 0.5. Thus, the mutant enzyme shows more sensitivity to inhibition at low AMP concentrations, but is more resistant to inhibition at AMP . native enzyme is inhibited greater than concentrations greater than 66 p ~The , the mutant enzyme is inhibited 74% (Kumar er al., 1988). 90% at 3 0 0 p ~while Thus, the single-site mutation at amino-acid residue 114 from tyrosine to phenylalanine not only lowers the apparent binding affinity of the substrates ADPglucose, ATP, pyrophosphate, and the divalent cation, Mg2+,but it also affects the apparent affinity for the activators and alters the pattern of AMP inhibition. Although the catalytic activities in synthesis and pyrophosphorolysis are lowered, more dramatic effects are seen with respect to the decrease of the apparent affinities for substrates and effectors of the enzyme. These observations are consistent with experiments employing 8-N3-ATP, 8-N3-ADPglucose and 8-N3-AMPwhich are discussed in Sections 1II.C and 1II.D. These studies suggested that the adenine nucleotide substrates shared a common site with the inhibitor, AMP, and that incorporation of 8-N3-AMP into the protein was at amino-acid residues close to the activator-binding sites. Thus, it is believed that the activator, substrate, and inhibitor sites were juxtaposed in the three-dimensional structure of the enzyme. The mutation in oivo of Tyr' l 4 to Phe results in the expected decrease in apparent affinity of the adenine nucleotides, and the additional effects seen on the kinetics of the activator and inhibitor are also consistent with the view that inhibitor-, activator- and adenine nucleotide-binding sites are proximal to each other in the enzyme's tertiary structure. Alteration of the substrate adenine nucleotidebinding site by the amino-acid substitution could cause a change in the interaction of the activator-, inhibitor- and substrate-binding sites. The lower
BACTERIAL GLYCOGEN SYNTHESIS
209
apparent affinity for the substrates also results in similar alterations of the binding of the activator and inhibitor. As previously indicated, binding studies (Haugen and Preiss, 1979)have shown that binding of the substrate ATP alone or activator alone has no effect on the binding of the inhibitor. Indeed, there is a slight stimulation of AMP binding by subsaturating concentrations of ATP (Haugen and Preiss, 1979). However, the presence of ATP and fructose-1,6bisphosphate together effectively inhibits the binding of the inhibitor, thus indicating an important interplay of the three separate sites in modulating activity. Oligonucleotide-directed mutagenesis thus can play an important r81e in elucidating the structure-function relationships in various residues and domains that have been identified via previous chemical modification studies. It would be of interest to do mutagenesis in uitro of other amino acids implicated in catalytic activity or in substrate or allosteric ligand binding. It would be of interest to modify to L Y S ' ~ ~ , or the arginine residues in region 380-386. Moreover, other regions implicated in substrate binding, 181-201 and 109-128, as well as the regions involved in inhibitor binding, 12-69 and 223-255, should also be considered for mutagenesis experiments in uirro. 2. Cloning of an Escherichia coli Allosteric Mutant. Elucidation of the Altered Amino Acids Causing Changes in the Allosteric Properties As indicated previously, a class of mutants both in E. coli and in Salmonella typhimurium LT-2 have been isolated from various mutageneses with either N-methyl-N'-nitro-N-nitrosoguanidine or ethylmethane sulphonate, that are affected in glycogen synthesis/accumulation and shown to have ADPglucose pyrophosphorylases affected in their allosteric properties. These findings have been described and discussed in various reviews (Preiss, 1973,1978; Preiss and Walsh, 1981; Preiss et al., 1983).In addition, an E. coli K12 mutant, strain 618, that had altered glycogen accumulation and altered ADPglucose pyrophosphorylase allosteric properties was isolated by Cattaneo's group (Cattaneo et al., 1969; Creuzat-Signal et al., 1972). Table 4 summarizes the various properties of these mutants with respect to glycogen accumulation and with respect to the regulatory properties of the ADPglucose pyrophosphorylases. In essence what is observed is a relation between the affinity of the enzyme for the activator and the ability of the mutant to accumulate glycogen when compared to the parent wild-type strain. If the apparent affinity for the activator, fructose 1,6-bisphosphate, is higher for the mutant enzyme than for the parent strain then glycogen accumulation is higher. If the apparent affinity for the activator is lower, as in E. coli mutant SG14, then glycogen accumulation is less than in the parent strain. The E. coli mutants which have
210
JACK PREISS AND TONY ROMEO
TABLE 4. Comparison of glycogen accumulation and kinetic consiants for allosteric effectors of ADPglucose pyrophosphorylases of Esrherichiu coli and Sulmonrllu lypliimurium LT2 mutants with the parent wild-type strains Glycogen accumulation (mg g - ‘)a
Fructose I ,6-bisphosphatc,
Escherichia coli Mutant CLI 136 Mutant SG5 Mutant 618 Mutant SG14
20
68 5.2 22 15 820
Salmonella typhimurium Mutant JP23 Mutant JP5I
I2 15 20
Organism
74
35 70 8.4
.40.5(PM)b
AMP 10.5
(Nb
75 680 170 860 500
95
108
c
250
84
485
‘The data shown above was obtained by growth of the organisms in minimal media with 0.75% glucose 21s the carbon source and is expressed as mg oranhydroglucose per gram (wet wt) of cells and is the maximal amount seen in stationary phase. * A , , , is the concentration giving 50% of maximal stimulation and is the concentration of AMP required for 50% inhibition in the presence of 1 . 5 m ~fructose 1,6-bisphosphate for the Esclwrichiu coli enzymes or in the presence of I mM fructose 1,6-bisphosphate for the Sulmotirllu /yplrimurium enzymes. Mutant JP23 is not activated by fructose 1,6-bisphosphate.
higher affinity for the activator also have lower affinity for the inhibitor. In the case of the S. typphinzurium mutants, the JP23 ADPglucose pyrophosphorylase is fully active without activator and has a 2.5-fold lower apparent affinity for the inhibitor, AMP. Mutant JP51, on the other hand, has the same apparent affinity for the activator but has a 4.5-fold lower apparent affinity for the inhibitor, AMP. I t would thus be of great interest to determine the various amino-acid substitutions caused by the mutations. This would provide significant insight into the structure-function relationships both of allosteric modulation and catalytic activity. Thus, effort has been made to clone the various allosteric mutants. Presently, one of them, the glgC gene of E. coli mutant 618, has been cloned (Leung et at., 1986) and its nucleotide and deduced amino-acid sequence determined (Lee et at., 1987a). Figure 4 shows the sites of base differences in the 61 8 glgC gene which causes the amino-acid changes as well as the surrounding sequences. The remainder of the deduced amino-acid sequence is identical to those of the wild-type enzyme, E. coli K 12 strain 3000. Unfortunately, E. roli K12 strain 3000 is not isogenic with the E. coli mutant 618. It was originally found that there was a difference of five + A h , Val16h+ amino acids out of 431 residues in the E. coli mutant, Ala, Lys296-+Glu, Gly336+Asp, and ThrIa9+ Ile. However, a repeat of the
Site
4
ADPglucose Synthetase
Mutation Sites and Surrounding DNA Sequences
E. coli K12 3000 (Wild-Type)
Ala CCC
Ser TCT
Val GTG
Val CTC
c':
E. coli K12 618 (Mutant)
Ala CCC
Ser TCT
Val CTG
Val GTG
Pro CCG
A
Glu GAA
Leu CTG
Asp CAT
Met ATG
Tyr TAC
Asp GAT
Leu CTG
Asp GAT
Met ATC
Tyr TAC
Asp
cly CGT
Cys TCT
Val CTG
Ile ATC
Ser TCC
cly CCT
Cys TGT
Val GTG
Ile ATC
SeF TCC
GAT
8
Asn
Ser
Leu
Val
Ser
FIG. 4. Mutation sites and the surrounding DNA sequences of the allosteric mutant-618 structural gene of ADPglucose pyrophosphorylase. The base substitution which directs change on amino acid is boxed, while the redundant change in the genetic code is underlined.
212
JACK PREISS A N D TONY ROMEO
nucleotide sequencing of the E. coli K12 3000 glgC gene showed that the amino acids at revidues 161, 166 and 189 were Ala, Ala and Ile (M. A. Hill and J. Preiss, unpublished results). Thus, there were no changes in amino acids between mutant 618 and the wild-type enzymes at residues 161, 166 and 189. Nevertheless, replacement at residues 296 (Lys -,Glu) and 336 (Gly + Asp) show changes resulting in a charge difference and drastic changes in properties of amino acids. These two amino-acid changes involve a single base substitution at the genetic-code level. Since there are two amino-acid differencesbetween the mutant and the wildtype enzyme of the bacterial ADPglucose synthetase and they are not localized in one area, sequence-wise, it was difficult to single out the aminoacid residue change due to the mutation, which is critically involved in altering the regulatory properties of the enzyme. The different amino acids shown in Fig. 4 seems not to be in the proximity of the known activator site, Lys39 (Parsons and Preiss, 1978a,b) and inhibitor or substrate site, Tyr114 and the surrounding sequences of the major binding locus (Lee et al., 1986; Larsen et al., 1986), as far as the primary structure of the enzyme is concerned. This observation may suggest that a certain amino-acid residue at the mutation site is located near the binding sites of activator and/or inhibitor in the threedimensional folding of the ADPglucose pyrophosphorylase. Recently, the S. typhimurium LT-2 ADPglucose pyrophosphorylase gene has been cloned and sequenced (Leung and Preiss, 1987a,b). The amino-acid residue at 296 is a variant site among the three enzymes, Lys in the E. coli wildtype, Glu in the E. coli mutant, and Gln in s. typhimurium. However, the residue 336 (gly) is an invariant site between E. coli wild-type and S. typhimurium enzyme. The E. coli K 12-618 (mutant)enzyme does not share Gly at 336 but contains Asp instead, suggesting that the Gly- Asp change may be important in altering the allosteric properties. The possibility that the allosteric kinetic changes are induced by multi-amino acid differences observed in the mutant, however, could not be excluded. In order to determine which amino acid was responsible for the alteration of the allosteric properties, various approaches were taken. Single mutations, Lys296-+ Glu and Gly336+Asp, were done using oligonucleotide-directed mutagenesis (Zoller and Smith, 1983)and via DNA recombinance, two hybrid glgC genes were constructed from the E. coli 618 and E. coli K12 glgC genes. ~ and ~ the ~ other normal One contained the double mutation, G ~ anduAsp3j6, amino acids, Lys296and Gly336,and the N-terminus portion coded by the mutant 618 gene (P. Ghosh and J. Preiss, unpublished observations). The restriction map seen for the mutant 618 g/gC gene is very similar to that of the wild-type E. coli glgC gene which is shown in Fig. 3. Thus, the 1.9 kbp HincII fragment of the wild-type and mutant 618 gene were subcloned separately onto the plasmid pUC8 (Vieira and Messing, 1982). As seen in
213
BACTERIAL GLYCOGEN SYNTHESIS
Fig. 3, there is a HindIII site in the wild-type and 618 HincII fragments. HindIII digestion of the pUC8 subclones produced two fragments, 1.4 and 3.2 kbp (Fig. 5). The 1.4kbp fragment of the mutant contains the N-terminal portion of the mutant enzyme while the mutant 3.2 kbp fragment contains the two mutation sites (Lys296+Glu and G1y336+Asp) closer to the C-terminal. To prepare the double mutant, the 1.4kbp HindIII fragment of the wild-typeglgC gene and the 3.2 kbp HindIII fragment of the mutant g/gC gene were ligated by ~, hybrid gene, the T, DNA ligase (Fig. 5). For preparation of the L Y S ~ 'GIy336 1.4kbp HindIII fragment of the mutant pUC8 clone and the 3.2 kbp Hind111 fragment of the wild-type were ligated using T, DNA ligase. The resultant
E. coli HincI1
MUTANT 618
K12
Hindm
Hincn
I
pUC8
1
Hind
m
diqestion
p PPlOl
AAA+
G A A ( L Y ~ ~ ~ + G1 I ~
GGC-
G A C (Gly336+Arp)
I p UC8 Hind
diqestion
pGH9 Lyr2';
Gly336
FIG. 5. Construction of plasmids containing the various nucleotide changes in mutant 618. Ligation of the various fragments obtained after HindIII digestion with T, DNA ligase enables the isolation of pPPlOl that will express ADPglucose pyrophosphorylase having Glu at position 296 and Asp at position 336, and pGH9 expressing enzyme G1y336,and having the N-terminal portion as coded by the mutant g/gC having gene.
214
JACK PREISS AND TONY ROMEO
recombinant plasmids were transformed into the E. coli mutant G6MD3 which is a deletion mutant with respect to the glycogen biosynthetic genes (Schwarz, 1966; Creuzat-Segal et al., 1972).The schematic representation of these constructions is shown in Fig. 5. The double-mutant clone was ~ , 33h hybrid clone was designated as designated as pPPlOl and the L Y S ' ~Gly pGH9. The enzymes expressed by transformation by the plasmids pPPlOl and pGH9 were partially purified and their allosteric properties were studied and C
Ii
II
R-
B. 0
10.-
FIG. 6. A, Activation of mutant-618 ADPglucose pyrophosphorylase (solid circles) and G I u * ~ Asp"' ~, double-mutant ADPglucose pyrophosphorylase (crosses) by fructose 1.6-bisphosphate (fructose 136-P2).B, Activation of LysZ9', Gly336hybrid enzyme by fructose 1,6-bisphosphate. The enclosed inset is a Hill plot of the data.
215
BACTERIAL GLYCOGEN SYNTHESIS
compared with those of the wild-type and mutant-618 enzymes (P. Ghosh and J. Preiss, unpublished results). Figure 6 shows the fructose 1,6-bisphosphate activation curve for the double-mutant (Lys296+Glu, G1y336+Asp) enzyme and LysZ9', G1y336 hybrid enzyme and compares it with the mutant-618 enzyme. Fructose 1,6-bisphosphate activates both enzymes 1.8-fold and 50% of maximal stimulation, A,,,, occurred at 1 0 ~In~contrast, . fructose 1,6bisphosphate activated the hybrid enzyme 35-fold and the A o . 5 value was 5 7 ~ The ~ . curve was sigmoidal, giving a Hill slope value of 1.9. Thus, the values obtained for the double-mutant enzyme were similar to those of the mutant-618 enzyme and the values obtained for the L Y S * ~G1y336 ~ , hybrid enzyme were very similar to those seen with the wild-type enzyme. Other --* Glu kinetic parameters also indicated that the amino-acid changes of and G1y336+ Asp in mutant-618 were responsible for the allosteric changes in this mutant and are summarized in Table 5 . The AMP inhibition curves of the double-mutant enzyme and the 618 mutant were virtually the same (P. Ghosh and J. Preiss, unpublished observations) giving similar Zo,5 values and roughly 10- to I 1-fold higher values than wild-type E. coli enzyme. The Zo,5 value obtained for the pGH9 enzyme was about the same seen for the normal E. coli enzyme. The results TABLE 5. Kinetic constants of ADPglucose pyrophosphorylases of wild-type Escherichia coli, mutant 618 andenzymeexpressed incells transformed with pPPlOl ( L y ~ ~ ' ~ - t G Gly336-+Asp) lu. or with pGH9 Enzyme from: Escherichiu coli
Escherichiu
Mutant 618
(pPPIO1)
Escherichiu coli (pGH9)
68 p~
10pM
10 jfM
57 j t M
ATP, .So,s (in the presence of I .O mM fructose I .6-bisphosphate)
340 PM
58 PM
58 p~
N.D.
MgCI,, .So,5 (in the presence of I .Omy fructose 1.6-bisphosphate
2.6m~
1.4rnM
1.3 mM
N.D.
Glucose I-phosphate, K,,, (in the presence of I .O mM fructose 1.6-bisphosphate)
24 PM
32 PM
33 pM
N.D.
Substrate/effector Fructose 1.6-bisphosphate.
coli
AMP. /o,s (in the presence of I .O mM fructose I ,6-bisphosphate)
N.D.. not determined.
216
JACK PREISS AND TONY
ROMEO
seen for the substrates ATP, glucose 1-phosphate and for Mg2+ for the double-mutant enzyme are essentially the same as observed for mutant-61 8 enzyme. They are also different from that observed for the wild-type E. coli enzyme. Thus, these results strongly indicate that the alteration of the allosteric properties of the ADPglucose pyrophosphorylase seen in mutant618 enzyme is due to the amino-acid changes at residues 296 and 336. The hybrid enzyme containing the N-terminal portion of mutant 61 8 enzyme and the C-terminal portion of the wild-type enzyme had allosteric properties, at least with respect to AMP inhibition and fructose 1,6-bisphosphate activation (Fig. 6 and Table 5), similar to the wild-type enzyme. Because position 296 in the enzyme varies between S. typhimurium enzyme, E. coli wild-type and mutant enzymes, and position 336 is the same in E. coli and S. typhimurium enzymes, it is quite likely the nitrosoguanidine mutagenesis caused the aminoacid change at residue 336. The question remains whether both changes at residues 296 and 336 are required for allosteric alterations. Preliminary results (A. Kumar, Y.M. Lee and J. Preiss, unpublished observations) would suggest that both changes, G ~ andu Asp336, ~ ~are required ~ for the changes in allosteric properties. Construction of single mutations via oligonucleotide-directed mutagenesis, to provide enzymes with a single mutation at L y ~ ~ ~ ~ +and G an l u enzyme with the change G l ~ ~ ~ ~ - +show A s in p ,preliminary results that the G ~ enzyme has the same allosteric properties as the normal Lys296enzyme (A. Kumar and J. Preiss, unpublished observations). The catalytic activity also appears to be the same with respect to substate kinetics. Thus, the Glu change appears not to have any effect on enzyme activity. The Asp336 mutant enzyme, however, has low activity compared to the G1y336enzyme and is heat labile at 65°C unlike the Gly3j6 enzyme (A. Kumar and J. Preiss, unpublished observations). The major effect of the mutation to Asp33his that the catalytic activity is only 2-3% of that seen for the normal G1y336 ADPglucose pyrophosphorylase. Thus, a single-site amino-acid change cannot account for the modified allosteric properties seen in mutant-618 enzyme, but changes in residue 296 to Glu and residue 336 to Asp together enable the enzyme to have higher apparent affinity and less dependence on the activator, fructose 1,6-bisphosphate, and to change the inhibition by 5’-AMP. It seems the change to acidic amino acids at positions 296 and 336 enables the enzyme to be more active under physiological conditions in the E. coli cell causing a more rapid increase in glycogen synthesis. It would be of interest to observe the effect of other amino-acid changes at these positions on the catalytic and allosteric activities. In this respect it would also be of interest to determine the other amino-acid changes in the other ADPglucose pyrophosphorylase mutants listed in Table 4. Would the glycogen “excess” mutant CLll36 (Preiss et al., 1976b)and SG5 (Govonset al.,
u
~
BACTERIAL GLYCOGEN SYNTHESIS
217
1969; Carlson et al., 1976) ADPglucose pyrophosphorylases show amino-acid substitutions in the same region as seen in the 618 enzyme? Would the Salmonella glycogen “excess” mutants JP23 and JP5 1 show different changes, since their modified allosteric properties are different from those observed for the E. coli glycogen “excess” mutants? Finally, since the allosteric properties as well as the substrate affinities of the ADPglucose pyrophosphorylase of the glycogen-deficient mutant SG 14 are modified, where would these amino-acid changes occur? The ability to clone the genes of these mutant ADPglucose pyrophosphorylases will allow one to easily determine the various aminoacid substitutions, causing alterations in the catalytic properties of the ADPglucose pyrophosphorylases, and will help to define the structurefunction relationships in allosteric regulation and catalytic activity. F. GLYCOGEN SYNTHASE
Bacterial glycogen synthases were last reviewed by Preiss and Walsh (1981) and the reader is referred to that review for earlier studies on that enzyme from many bacteria. As indicated in the above review, the enzyme appears to be specific for the sugar nucleotide ADPglucose, or is preferred, as recently shown in the case of some of the archaebacteria (Konig et al., 1982). Generally, other sugar nucleotides have less than 1% of the activity seen with ADPglucose. Other properties of the enzyme, particularly for the E. coli glycogen synthase, have been described in the above review. Some chemical-modification studies have been done with the E. coli glycogen synthase. Holmes and Preiss (1982) have shown that there are two distinct sulphhydryl residues present in the enzyme. One, modified by iodoacetic acid, can be protected by either ADP or ADPglucose. Glycogen gave minimal protection. The other SH group is modified by 5,5’-dithiobis (2nitrobenzoic acid) and is almost completely protected from reaction with that sulphhydryl reagent by glycogen. Poor protection was given by ADPglucose. Each reagent is therefore specific for a given site. Thus, the reactive sulphhydryl groups are probably located at or near the binding sites for each substrate, glycogen and ADPglucose. Antibodies have been prepared against the purified E. coli glycogen synthase (Holmes er al., 1982), and it has been shown that glycogen synthases from other enteric bacteria, Escherichia aurescens and S. ryphimurium, were highly related to that of E. coli in neutralization of enzyme activity and in immuno-double-diffusion experiments (Holmes et al, 1982). Single precipitin bands formed that were continuous with that formed by the purified E. coli enzyme, and no spurs were observed. About one-sixth antigenic reactivity was seen with the Enr. aerogenes and Klebsiella pneumoniae glycogen synthases and very little reactivity was seen with the glycogen synthases of Serratia
218
JACK PREISS A N D TONY ROMEO
marcescens, Aeromonas hydrophita, Rhodohacrer sphaeroides, Rhodobacter gelatinosa and Rhodospirillum molischianum in enzyme-neutralization tests. The structural gene for glycogen synthase, glgA, has been cloned from both E. coli (Okita et al., 1981) and S. typhimurium (Leung and Preiss, 1987a). The nucleotide sequence of the E. coliglgA gene has been elucidated (Kumar et a/., 1986). It consisted of 1431 bp specifying a protein of 477 amino acids with a molecular weight of 52,412. The deduced amino-acid sequence was consistent with the amino-acid analysis obtained with the pure protein and with the amino-acid terminal sequence and amino-acid sequences of various peptides obtained from CNBr degradation of the purified enzyme. G . BRANCHING ENZYME
The last review of branching enzyme was by Preiss and Walsh (1981). Since that time very little information has been reported on the bacterial branching enzymes. Antibodies to the E. coli branching enzyme have been prepared and their reaction with branching-enzyme activities in extracts of other bacteria were tested in neutralization of activity assays (Holmes el al., 1982).There was a close relationship between the various enteric enzymes tested from E. uurescens, S. t~~phimurium, Ent. aerogenes, K. pneumoniae, and Ser. Iyiarcescens. However, only 5 6 6 6 % inhibition of activity was obtained with the enteric enzymes, except for those from E. coli and E. aurescens. The structural gene for the E. coli branching enzyme has been cloned (Okita et al., 1981 ) and the openreading frame of the gene was shown to be about 200 bp downstream from the Asd gene (Baecker et al., 1986; Haziza et al., 1982).The complete nucleotide sequences and deduced amino-acid sequence was determined (Baecker et al., 1986).The gene consisted of 2181 bp specifying a protein of 727 amino acids. The deduced amino-acid sequence was consistent with the amino-acid analysis obtained with the pure protein as well as the molecular weight determined from sodium dodecyl sulphate-gel electrophoresis. The deduced amino-acid molecular weight is 84,231. The deduced amino-acid sequence is also consistent with the amino-terminal sequence and the amino-acid sequence analysis of various peptides obtained from CNBr degradation of the purified enzyme (Baecker et al., 1986).
V. Genetic Regulation of Glycogen Biosynthesis in Escherichis coli Previous reviews have presented a case for the involvement of genetic regulation in the control of glycogen biosynthesis, based in part on the fact that intracellular levels of the glycogen biosynthetic enzymes in E. coli are modulated according to the physiological state of the culture (Preiss and
BACTERIAL GLYCOGEN SYNTHESIS
219
Walsh, 1981; Preiss et al., 1983; Preiss, 1984).A general observation is that the rate of glycogen biosynthesis, and the biosynthetic enzyme levels, are inversely correlated with growth rate. For example, cells grown in enriched media containing I YOglucose show a significant increase in the specific activities of ADPglucose pyrophosphorylase, glycogen synthase (1 1- to 12-fold each), and glycogen branching enzyme (five-fold) upon transition into stationary phase. In minimal media containing 0.6% glucose and limiting NH:, the levels of ADPglucose pyrophosphorylase and glycogen synthase undergo a two- to three-fold increase, and branching enzyme levels do not change in stationary phase (Krebs and Preiss, 1975; Preiss et al., 1983, and references therein). The enzyme levels in stationary phase are similar in enriched and minimal media. The levels of ADPglucose pyrophosphorylase and glycogen synthase increase co-ordinately (Krebs and Preiss, 1975), but under certain growth conditions the level of branching enzyme does not. The mechanisms by which the cell regulates the synthesis of the enzymes involved in glycogen biosynthesis are just beginning to be studied at the molecular level. The following discussion will concentrate on recent developments in this area. A. CHARACTERIZATION OF THE STRUCTURAL GENES FOR GLYCOGEN BIOSYNTHESIS
As previously indicated, a major advancement in the molecular biology of glycogen synthesis was accomplished with the cloning of the structural genes (Okita et al., 1981).Earlier transductional analysis of mutants of E. coli K-12 localized glgC (ADPglucose pyrophosphorylase), glgA (glycogen synthase), and gIgB (branching enzyme) together at 75 min on the genomic map, and established the gene order at this location as glpD-glgA-glgC-glgB-a~d(LatilDamottee and Lares, 1977).Although thecapacity for glycogen biosynthesis is a detectable phenotype, it is not required for viability, and is not directly selectable. Therefore, molecular cloning experiments used the nearby asdgene (aspartate semialdehyde dehydrogenase) as a marker for positive selection (Okita et ul., 1981). Genomic DNA from E. coli K-12 was partially digested with the restriction enzyme PstI and ligated into the PstI site of pBR322. A strain of E. coli which has a chromosomal deletion of asd and the glg genes, G6MD3 (Schwartz, 1966; Creuzat-Sigal et al., 1972),was used as a recipient. Transformants which were positive for asdwere screened for glycogen and the biosynthetic enzymes. A single plasmid, pOP12, which contains a 10.5kbp insert encoding the three biosynthetic genes, was chosen for characterization. The structure of the E. coliglg gene cluster, as contained in pOP12, has been analysed by deletion mapping (Okita et al., 1981) and the continuous nucleotide sequence of this DNA has been determined (Baecker et al., 1983; Baecker et al., 1986; Kumar et al., 1986; Romeo et al., 1988).Figure 7 shows the
220
JACK PREISS A N D TONY ROMEO
*
PVUE
.1
Eco R I
Hindm PStI
*++ 3. ** * *
* *
* osd
4
4*?
*
c
*
* glgB 4
glgX
*
4
**
J,
4
*
* 4
glgC glgA glgY
8
12
9lPD9lPEglPG9lPR T--
- - JT-:cl:~:l 16
-20
24
kb FIG. 7. Structure of the glycogen gene cluster in Escherirhiu coli. This map was constructed from previously published data on the glg genes (Okita et ul., 1981; Yu et u/., 1988),the glpD region (Schweizer and Larsen, 1987)and the comprehensive map of the Eschrrichiu coli genome (Kohara et a/., 1987). The region shown with solid lines is well established; that shown with broken lines is tentatively presented. The glg genes are transcribed from left to right.
established structure of the region of the genome from asd through glgY, as well as a proposed physical structure for the region which extends to the glpD operon. The latter region was deduced by comparison of the restriction maps of the glycogen gene cluster (Okita et al., I98 1; Yu et al., 1988)and those of the glpD operon (Schweizer and Larsen, 1987)with a comprehensive map ofthe E. coli genome (Kohara et al., 1987). Some variability exists between the restriction maps, possibly due to source strain differences or errors in the genomic map (Kohara el ul., 1987).Therefore, the location shown for theglpD operon is tentative. In addition to the three glycogen structural genes which have been mentioned, two open-reading frames, glgX and glgY, are found in the glg gene cluster (Romeo et al., 1988). The proposed amino-acid sequence of glgX is significantly related to a group of enzymes which hydrolyse a-1,4-glucans or catalyse a-1, 4-glucan transferase reactions. The related proteins include all a-amylases for which sequences are known, pullulanase, cyclodextrin glucanotransferase, the glycogen branching enzyme and others. The product of the glgY gene is the E. coli glycogen phosphorylase. This was suggested on the basis of the amino-acid sequence similarity to the enzyme from rabbit muscle (Romeo et al., 1988) and demonstrated by expression and characterization of the gene product (Yu et al., 1988). The latter authors have designated the gene as glgP. Evidence suggests that neither glgX nor glgY are required for the cell to synthesize a-1, 4-glucan. This is based upon the positive iodinestaining properties of colonies of cells which contain only the glgC and glgA genes (Romeo ef al., 1988). This is consistent with the fact that glycogen
BACTERIAL GLYCOGEN SYNTHESIS
22 1
phosphorylase is a degradative enzyme, and suggests the same for glgX. Of course, glgX might also function in glycogen biosynthesis in a non-essential capacity, perhaps affecting glucan structure or the rate or extent of polymer formation. B. FACTORS WHICH REGULATE GLYCOGEN GENE EXPRESSION
The identification of the biochemical factors which regulate any cellular process is a paramount step in the overall elucidation of the control mechanisms for that process. At least some of the factors which affect the genetic regulation of glycogen biosynthesis have been identified by biochemical and/ or genetic criteria.
I . Mutations which affect biosynthetic enzyme levels Two mutant strains which accumulate high levels of glycogen, and have elevated levels of glycogen biosynthetic enzymes have been derived from E. coli strains B, SG3 and AC70R1. The properties of these mutants have been previously described in detail (Okita et al., 1981; Preiss and Walsh, 1981; Preiss ef al., 1983; Preiss, 1984). The mutation in SG3, which affects glgR, is closely linked to the structural genes in PI transduction studies (Preiss et al., 1973).It leads to elevated levels of ADPglucose pyrophosphorylase (eight- to 10-fold) and glycogen synthase (three- to four-fold). However, glycogen branchingenzyme levels are normal in this strain. The mutant AC70R1, which is affected in glgQ, accumulates elevated levels of ADPglucose pyrophosphorylase (1 1fold), glycogen synthase (5.5-fold) and branching enzyme (two-fold). The mutation was not found to be linked to the structural genes in PI transduction, and leads to enhanced accumulation of glycogen biosynthetic enzymes encoded on multicopy plasmids (Okita et al., 1981). It, therefore, appears to affect one or more trans-acting elements. From SG3, AC70R1, the deletion strain G6MD3, and from wild-type E. coli strains K12 3000 and E. coli B, RNA was isolated and analysed using S1 nuclease mapping according to Berk and Sharp (1977) (Romeo and Preiss, 1989). Transcripts encoding glgC apparently initiated at four discrete sites, located between glgC and glgX (see Fig. 8) in all strains except for G6MD3. The 5’-termini of three transcripts were determined at high resolution. Their flanking regions are compared to consensus promoter sequences for E. coli transcripts in Table 6 . From these studies, it is clear that no new promoter sites were utilized due to the mutations in SG3 or AC70R1. The SG3 strain overaccumulated a single transcript approximately three-fold with respect to E. coli B (Table 6). Considered along with the above information on this mutant, this suggests that the phenotype may be the result of a promoter-up mutation
TABLE 6. Quantification of glgC transcripts and comparison of their 5'-flanking regions with consensus sequences for Eschericliiu coli promoters Relative concentrationb Escherichia
gigc A B O
TT C G C T GGAGAGGAT AACCC ACT G A T T ACGGCT GT C T GGC A
TTGATCGCAATTAACGCCACCCTTGAGGTAACAGAGATTGTTTT AGGCGACGGCAATGTCCGTTGGCTAAATCGATATGCT ~
U
AC70R 1
3 15 7
4
100
51
64
5
14
sequences' S
- 35
TTGACA u3' CTTGAA us4 C T G G C A C N, TAAA FlhB + Flu1 0''
SG3
tcplLFcriptn
c
C
cot; B
- 10 T A T AAT CCCCATTTA TTCCA GCCGATAA
"These data were obtained by S1 nuclease mapping (Romeo and Preiss. 1989).The 5'-termini of glgC transcripts are indicated by black dots. The approximate locations for transcripts A, Band C are -60. - 130and -245, respectively. relative to the initiation codon. The best - 10 and - 35 regions of the glgC transcripts relative to the u70 consensus sequence are underlined. hThese data were collected by densitometric analysis of an autoradiogram from an S1 nuclease protection experiment (Romeo and Preiss, 1989). Transcripts were from early stationary phase cultures. Arbitrary integration units were normalized with respect to the highest value (AC'JORI,transcript A1. 'The original references for these sequences and information on the function of bacterial o factors are available in a recent review (Helmann and nitrogen-starvation Chamberlin. 1988).Generally speaking. these factors are used for the expression ofhousekeeping genes (u"). heat-shock genes (d2). genes (us4or NtrA), and chemotaxis and motility genes (FlbB and F k I ) .
223
BACTERIAL GLYCOGEN SYNTHESIS
Transcripts
919 x CR P Bind i ng
+
g IgCI- I lac z gene fusion
C
B
A
--
r
HincII
-
D
r
HinfI
f
Ava JI
Ip
d
KpnI BamHI
-I
I
-
I
100 b p
FIG. 8. Preliminary dissection of cis regulatory sites for glgC. The 5'-termini of glgC transcripts were mapped using S1 nuclease protection analyses. Identification of a CRP-binding restriction fragment was based upon detection of altered electrophoretic migration of DNA in a mobility-shift experiment (Romeo and Preiss, 1988, 1989). The construction of a glgC'-'lacZ gene fusion using the indicated HinclI-BamH1 restriction fragment and results obtained with the hybrid gene are discussed elsewhere in this review.
or an operator constitutive mutation upstream from the 5'-end of this transcript. Resolution of this question awaits nucleotide-sequence analysis of this region of DNA from the SG3 strain, and other studies. The AC70R1 mutant accumulated elevated levels of all of the transcripts which were analysed. The transcript closest to the coding region was found in extremely high levels, approximately 25-fold with respect to the corresponding one from SG3 and E. coli B (Table 6). This suggests the presence of a cis-active region, upstream from the 5'-terminus of this transcript, which interacts with the factor(s) which is altered in AC70R1. Of course, these results do not preclude the involvement of a distant cis-acting site, such as an enhancer element. However, further evidence for a cis-active site in the region proximal to glgC will be presented later. Biochemical isolation of the factor which is affected in AC70Rl will allow critical experiments on its molecular mechanism to be performed. Precise localization of the site(s) required for its function could allow construction of a sequence-specific DNA-affinity system for purification of the factor, as has been accomplished for eukaryotic DNA-binding factors (Kadagonana and Tjian, 1986; Jones et al., 1987). The AC70R1 factor is probably not one of the global regulatory compounds which regulate glg expression, as discussed below. Those systems would be expected to affect lacZ expression, yet the level of P-galactosidase is similar in AC70Rl and E. coli B (T. Romeo and J. Preiss, unpublished observations).
224
JACK PREISS A N D TONY ROMEO
2. Effects of c A M P and c A M P receptor protein Two global regulatory compounds, cAMP and ppGpp, are involved in the control of glg gene expression. The effects of cAMP on the rate of glycogen biosynthesis in vivo were initially observed by Dietzler et al. (1977). They observed that both the cya and crp genes were required for optimal synthesis of glycogen. Exogenous cAMP restored the defect in cya but not crp mutants, indicating that cAMP required CAMP-receptor protein (CRP) for its effects (Dietzler el al., 1977, 1979; Leckie et al., 1983). The fact that cAMP is not an allosteric effector of ADPglucose pyrophosphorylase, and its addition to cultures does not affect levels of metabolites which are known to alter the activity of ADPglucose pyrophosphorylase, indicated to these researchers that cAMP may affect the synthesis of an enzyme which metabolizes an effector of ADPglucose pyrophosphorylase. The first evidence that cAMP may directly affect the expression of the glgC gene was reported byurbanowski et al. (1983). They observed 2.5- to four-fold enhancement of the synthesis in vitro of the first dipeptide and tripeptide of the glgC gene encoded on pOP12. Both cAMP and CRP were required for the effect. More recently, cAMP and CRP were demonstrated to stimulate the synthesis of ADPglucose pyrophosphorylase up to 25-fold and glycogen synthase up to 10-fold in an in-vitro coupled transcription-translation system (Romeo and Preiss, 1989). Little or no effect was observed on branching enzyme synthesis. The formation of the first dipeptide of glgA was also activated by these compounds. A region of DNA immediately upstream from glgC was shown to specifically interact with the CAMP-CRP complex using a gel-mobility shift assay (see Fig. 8). A restriction fragment which included 0.5 kbp of DNA upstream from g/gC as well as the glgC coding region, allowed the CRP-mediated stimulation of glgC expression in the dipeptide assay. Figure 9 demonstrates that a glgC-lacZ gene fusion which contains 0.5 kbp of DNA from the 5’-flanking region of g/gC was expressed in vivo approximately five-fold better in a wild-type strain versus an isogenic cva deletion strain. Addition of 5 mM cAMP restored plasmid-encoded pgalactosidase activity in the A-cya strain almost to the wild-type level, and resulted in as much as 50% increase in the activity from the wild-type strain (T. Romeo, J. Black and J. Preiss, unpublished observations). This indicates that the positive effect of CAMP on glgC expression which was observed in the invitro assays occurs at least qualitatively in oivo. Also, it confirms the above experiments, which indicate that CRP binding occurs within 0.5 kbp of the glgC coding region. The molecular details of the activation at glgC are not yet known. Recent observations on the effects of CRP on gene expression indicate that it may function via a variety of mechanisms. Its binding inhibits transcription of
225
BACTERIAL GLYCOGEN SYNTHESIS
2.0-
-af
Q
wt
+ CAMP
1.0wt
'
0
t 0.5-(3
0.2--
0.J
f
Acya
A
b 1
I
I
I
II
4
0
12 Time ( h )
16
20
I
24
FIG. 9. /3-galactosidase activity from a glgC-'IucZ gene fusion is deficient in a A-cya strain, but is restored by CAMP.The gene fusion contains 0.5 kbp of 5'-flanking DNA and 0.2 kpb of glgC coding sequence, as shown in Fig. 8, cloned into the SmaI-BamHI site of pMLB1034 (Silhavy et al., 1984). An in-frame construction was obtained via selection in uiuo of lac' colonies in MBM7060 as described by Silhavy et al. (1984). The resulting plasmid has been characterized by restriction endonuclease mapping and in uifro and in uiuo expression studies (T. Romeo, J. Black, A. Gardiol and J. Preiss, unpublished observations). /3-Galactosidase activity from permeabilized cells was measured with minor modification of the technique of Miller (1972). Absorbance readings from cells containing the fusion plasmid were corrected for non-specific absorbance or scatter relative to reactions that lacked substrate. These values were corrected for chromosomal lacZ expression by subtracting activity from strains containing pMLB1034, which lacks a promoter and a ribosome-binding site for lacZ. The resulting data is shown as The cAMP was added at 5 m final ~ concentration. All cultures were grown at 37°C with gyratory shaking (200rpm), in Kornberg medium (Romeo et al., 1988). Broken lines indicate growth solid lines indicate corrected /I-galactosidase activities. Solid circles and triangles indicate growth in the presence of CAMP; open symbols indicate no cAMP was added. The wild-type (wt) strain was ED8654; the A-cya strain was ML2 (Guerinot and Chelm, 1984).
226
JACK PHEISS AND TONY ROMEO
some genes (Polayes et al., 1988, and references therein), although transcription is usually activated. Activation of transcription may be accomplished by increasing the binding of RNA polymerase to the promoter to enhance formation of a closed promoter complex, as in the case of lac or gal, or by increasing the rate of promoter clearance, as in the case of m a n (discussed by Buc et al., 1986). Activation generally requires the binding of a single CRP molecule to a promoter region, but the gal system requires the simultaneous binding of two CRP molecules (Shanblatt and Revzin, 1983; Shanblatt and Revzin, 1987). In addition, CRP plays an accessory r61e in gene activation in systems such as ara and ma1 (recently reviewed, Schlief, 1987; Schwartz, 1987). The ArdC protein is capable of functioning as either a repressor or activator, depending upon the presence of the physiological inducer. Recent data suggest that CRP can activate araBAD transcription, whether or not AraC-mediated repression is present (Lichenstein et al., 1987). CRP appears to function in addition to the activator MalT at m a E F G and malK IamB, although it may be only indirectly involved at malPQ, via its effects on the expression of m a n itself (Schwartz, 1987). Activation by CRP probably exhibits common mechanistic features in all of these cases, such as the capacity of CRP to bind to and induce the bending of DNA (Liu-Johnson et al., (1986) and its ability to interact co-operatively with proteins such as RNA polymerase (Ren et af., 1988). Understanding the basis of CRP activation at glgC will provide additional information on this versatile regulatory molecule. 3. Efecrs of ppCpp on the expression of gl-vcogen hiosynrhetic genes
The synthesis in vivo of bacterial glycogen has been shown to be deficient in strains which are altered in the relA gene, which encodes the enzyme required for pppGpp and ppGpp synthesis during stringent response (Deitzler and Leckie, 1977; Bridger and Paranchych, 1978: Taguchi et al., 1980). Although there have been a number of alternative explanations proposed to account for the effect, it now is clear that ppGpp directly enhances the synthesis of ADPglucose pyrophosphorylase (three- to four-fold) and glycogen synthase (two-fold) in the S-30 coupled transcription-translation system (Romeo and Preiss, 1988, 1989). As in the case for CAMP, the effect of ppGpp on the synthesis of branching enzyme was either weak or absent. Activation ofglgC expression by ppGpp in vitro could be observed in the absence of CAMP, in agreement with observations in uiuo on glycogen synthesis (Leckie el al., 1985), although the degree of activation due to ppGpp was higher in the presence of CAMPand CRP. Experiments using the dipeptide assay for gene expression failed to demonstrate effects of ppGpp on glgC expression (Urbanowski et al., 1983).
BACTERIAL G L Y C O G E N S Y N T H E S I S
227
We have more thoroughly examined the effect of ppGpp on glgC expression with the dipeptide assay, using concentrations ranging from 25 to 5 0 0 p ~ and , we have measured ppGpp effects in the presence and absence of CAMP and CRP (Romeo and Preiss, 1989). Again, no significant effect was observed for ppGpp. At this time, the most likely explanation for these conflicting observations is that the completely defined dipeptide system requires an additional factor(s) which is present in the S-30 cell extract. A similar conclusion was drawn when ppGpp failed to affect lucZ expression in a purified transcription system, but activated P-galactosidase synthesis in the S30 transcription-translation assay (Aboud and Pastan, 1975). Although there is persuasive evidence that ppGpp may interact directly with RNA polymerase, in the absence of other factors, to alter the rate of transcription of certain genes (discussed by Cashel and Rudd, 1987), this does not appear to be true for lac or glg. Figure 10 indicates that the expression in uivo of the glgC’-’IucZgene fusion is enhanced in strains which produce elevated levels of ppGpp (data of T. Romeo, J. Black, and J. Preiss). This effect is consistent with the results of coupled transcription-translation assays, and identifies a 0.5 kbp region required for activation of g/gC by ppGpp. In addition, the g1gC’-’lacZencoded /3-galactosidase is accumulated exponentially with respect to the doubling time for these strains. Since the intracellular ppGpp concentration in these strains varies linearly with the doubling time (Sarubbi et al., 1988), this implies that the expression of glgC is exponentially related to intracellular ppGpp levels in these strains. The effect is apparently the inverse of that observed at the rrnA P , , which is inhibited by ppGpp (Sarubbi et al., 1988). In attempts to identify factors which control glycogen biosynthesis, negative results were found for some potential regulators. As stated above, starvation of cells for nitrogen enhances the rate of glycogen synthesis. The NtrA and NtrC proteins are an alternate a-factor and a DNA-binding protein, respectively, which activate transcription from various promoters of genes in the nitrogen-starvation regulon (Hirschman et ul., 1985; Keener ef al., 1987).These proteins were, therefore, considered to be excellent candidates for regulators of the glg genes. Both NfrA and NtrC failed to enhance expression of the glg genes in the coupled transcription assay, although the expression of a glnA’-’IucZ gene fusion was greatly enhanced under the assay conditions (Romeo and Preiss, 1989). These factors also failed to activate the expression of glgC in the dipeptide assay. Experiments have not addressed the possibility that the glg genes are under regulation of phosphorous starvation or are constituted in other nutritional regulons, although the above finding suggests that this may not be required to allow glycogen syntheses to be responsive to such nutritional restrictions.
228
JACK PREISS AND TONY ROMEO
50
I
041
P a
a
40
40 80 I Doubling time ( m i n )
Doubling time (min)
41
-2f 2. 0
3
e
(3
I!
0
0. 0
4
8
12
16
20
Time ( h ) FIG. 10. 8-Galactosidase activity from a gIgC'-'IacZ gene fusion is exponentially related to intracellular ppGpp levels in a series of strains altered in spoT. The pgalactosidase assay methods and calculations were described in the legend to Fig. 8. The set of isogenic mutants, which exhibit increased intracellular ppGpp due to mutation(s) in the gene which encodes a ppGpp 3'-pyrophosphohydrolase, spoT, has been described (Sarubbi et ul., 1988). Doubling times for these strains vary in a direct linear relationship with respect to ppGpp levels, under the experimental conditions of Sarubbi et 01. (1988).which have been followed here. For insets a and b, the solid circles and squares, and open circles indicate data from mid-exponential, early stationary, and late stationary phases, respectively.
BACTERIAL GLYCOGEN SYNTHESIS
229
C. FINE STRUCTURE OF THE GLYCOGEN BIOSYNTHETIC GENE CLUSTER AND
POTENTIAL SITES FOR GENE REGULATION
The cloning and sequencing of the glycogen gene cluster and the identification of some of the factors which affect the expression of the glg genes present an opportunity to greatly enhance our understanding of the regulation of the major carbon and energy storage compound of E. coli and related bacteria. Based upon the fine structure of the gene cluster, rational approaches can be devised for dissecting the cis-acting control sites of this gene cluster.
I
+]II
cAMP.CRP
FIG. I I . Model for transcriptional regulation of the Esrherichiu coli glycogen genes. The data for this model are discussed in the text. Effects of CAMP and CRP, as well as ppGpp, have been localized to a region upstream from glgC, using assays both in uitro and in uiuo. The four transcripts shown in this region were identified by SI mapping analysis of in-uiuo transcripts. The indicated transcripts could also encode gIgA and glgY, and/or these genes may have their own promoters. The glgB gene almost certainly contains its own promoter(s). The expression of glgB, glgC and glgC is probably affected by theglgQ product, based upon specificactivities of the biosynthetic enzymes in AC70R 1. The gIgC transcript which initiates closest to the coding region is found in 25-fold higher concentration in AC70Rl than in other Escherichiu coli B strains (see Table 6).The glgC'-'lucZ gene fusion was also expressed better in AC70R1 than in wild-type Eschericiu coli B (T. Romeo, J. Black and J. Preiss, unpublished observations). A putative p-independent termination site has been located downstream from glgY (or glgP; Y u cr al., 1988).
All of theglg genes are transcribed from left to right as shown in Fig. 1 1.The gene for branching enzyme, glgB, must therefore be transcribed via its own promoter(s), assuming that transcription does not proceed from the apparently unrelated asd gene. A region of 0.2 kbp separates asd and glgB, which could contain the promoter(s) and other cis elements required for control, such as a binding site for the putative AC70R1 trans-acting factor. One base of the amino-acid coding region of glgB overlaps with the glgX open reading frame (Romeo rt al., 1988). The product of glgX may be weakly expressed or may have special requirements for its synthesis, since it was not observed using the S-30 assay or in maxicell analyses (T. Romeo and J. Preiss, unpublished observations). It is conceivable that glgX is expressed from a
230
JACK PREISS A N D TONY ROMEO
polycistronic message which also encodes branching enzyme, although glgX might also utilize promoter(s) internal to glgB. A potential ribosome-binding site precedes the coding region for glgX. The glgB-glgX pair of genes is separated from glgC by 0.5 kbp of noncoding DNA. As indicated previously, CRP binding occurs in this region, and a restriction fragment which contains this region allows in uitro and apparent in uiuo activation of g/gC expression by CAMP. The glgC-'lucZ gene fusion which contains this region appears to be positively regulated in uiuo by ppGpp (Fig. lo), and the product of this gene was found in three- to five-fold higher levels in AC70R1 than in E. coli B (T. Romeo, J. Black and J. Preiss, unpublished observations). Therefore, this region contains the sites required for response to each of the known trans-acting regulators. Transcripts from the region proximal toglgC were mapped using S1 nuclease analysis(Romeo and Preiss, 1989).The putative promoter sites for three of the four transcripts which were identified are shown in Table 6. Their nucleotide sequences show poor similarity to a7'-dependent promoters as well as promoters which require the other known CT factors. The explanation for this poor similarity may be that the system requires at least two activator systems and possibly a third. Positively regulated promoters typically have poor similarity to the consensus (Raibaud and Swartz, 1984).Alternatively, one or more of the transcripts may require a novel o factor for its synthesis. Preliminary evidence in favour of the former possibility has been obtained. Monoclonal antibodies have been developed against bacterial D factors (Lesley rt al., 1987). One such antibody, 3D3, specifically inhibits the expression of genes which depend upon cr7' for initiation of transcription, but ~ ~ B. does not inhibit transcription of genes dependent upon d2or C T (NtrA)(S. Jovanovich, S. A. Lesley and R. R. Burgess, unpublished observations). The synthesis in iritro of ADPglucose pyrophosphorylase was inhibited up to 85% by this monoclonal preparation (T. Romeo and J. Preiss, unpublished observations). There is a formal possibility that the antibody cross-reacts with an alternative D factor responsible for glgC expression. However, Western blot analysis of E. coliproteins with 3D3 did not reveal such a protein (S.A. Lesley, personal communication). The glgA and glgY genes may be dependent upon transcription originating proximal to glgC, i.e. these three genes may constitute an operon, and/or each may contain promoters which are internal to the coding regions of the preceeding genes. The glgA-coding region overlaps with 1 bp ofglgC (Kumar et ul., 1986),and glgY is separated by only 18 bp from the glgA-coding region (Romeo rt al., 1988). One piece of evidence which is consistent with the possibility of a glgC-glgA-glgY operon is that a plasmid which contains the gIgA gene cloned into pBR322, pOP245 (Kumar et ul., 1986)no longer exhibits CAMP-mediated activation in uitro (T. Romeo and J. Preiss, unpublished
BACTERIAL GLYCOGEN SYNTHESIS
23 1
observations). The presence of a putative p-independent terminator following glgY (alternatively called glgP) has been described (Yu et al., 1988), suggesting that glgY may constitute the 3'-end of the operon. D. PHYSIOLOGICAL INTERPRETATIONS
From the foregoing discussion, it is clear that the genetic regulation of glycogen biosynthesis allows this process to respond to the physiological state of the culture through two global regulatory systems which gauge the availability of amino acids, carbon source and energy (see Table 7). These systems alone might account for the effects of nutrient depletion on glycogen synthesis. In addition to its r61e as a signal for amino-acid starvation during stringent response, there is strong evidence that ppGpp may be involved in growth rate or metabolic regulation of a variety of systems (for an excellent discussion of this see Cashel and Rudd (1987)).Therefore, ppGpp may play a major r61e in maintenance of the observed inverse relationship of glycogen synthesis with growth rate. However, the effects in uitro of ppGpp on glg gene expression were several times weaker than those of cAMP and CRP. In addition, ppGpp had stronger effects (higher activation) on the synthesis of ADPglucose pyrophosphorylase and glycogen synthase when added in the presence of cAMP and CRP (Romeo and Preiss, 1989). An intriguing possibility is that these two systems may affect glycogen synthesis in a synergistic manner in uiuo, although this cannot be assumed based upon the data in uitro. Mechanistically, the existence of one or more promoters which are regulated by both compounds could yield this kind of result, as could independently regulated promoters which are interactive with each other. As previously stated, the effects of the above factors in S-30 coupled transcription-translation were approximately 2.5- to four-fold greater at glgC than at glgA, and were negligible for glgB. This is reasonable with respect to the levels of apparent induction which are observed for these enzymes upon entry into stationary phase. The specific activity of branching enzyme is more weakly affected than that of ADPglucose pyrophosphorylase or glycogen synthase. However, as described earlier, branching enzyme does exhibit some apparent induction or derepression under certain conditions, and is overaccumulated in the mutant AC70RI. The three structural genes may therefore exist as part of a glycogen regulon, which may include at least one gene, glgY, which is involved in glycogen catabolism. The location of glgY immediately downstream from glgA suggests that the synthesis of an enzyme involved in glucan degradation, glycogen phosphorylase, may be translationally coupled to that of ADPglucose pyrophosphorylase and glycogen synthase. Clearly, both the allosteric regulation of ADPglucose pyrophosphorylase and the control of biosynthetic enzyme levels via genetic regulatory
TABLE 7. Structural and regulatory genes involved in glycogen metabolism
Gew product
ADP-glucosepyrophosphorylase
Glycogen synthase Glycogen branching enzyme Glycogen phosphorylase Glucan hydrolase/transferase (?) Gene product
F d o n Glucosyl donor formation Glucosyl transferase 2-1.6 branch formation Glycogen utilization (phosphorolysis) Glycogen utilization (?)
Map h t i w (min)
COmmeOtS
Adenylate cyclase CAMP receptor protein
85 14
Mediate global response to carbon/energy status
ppGpp synthase I (p)ppGpp 3’-pyrophosphohydrolase
60
Mediate global response to amino acidknergy status
Trans-acting transcriptional regulator (?)
?
Yields overproduction of GlgC, GlgA, ClgB, and and glgC transcripts
Cis-acting site, promoter or operator (?)
75
Yields overproduction of GlgC and GlgA, and one of the g/gC transcripts
M)
All of the indicated structural genes are located at 75 min on the Escherichia coli genome. bThis gene has been identified by nucleotide sequence analysis, the product has not been characterized (Romeo el u/., 1988). ‘Other genes which may affect ppGpp levels, such as reK, gpp, ndk, relC and rpoB, might also be expected to alter expression of glg genes.
a
BACTERIAL
GLYCOGEN SYNTHESIS
233
mechanisms are important in determining the overall status of glucan metabolism in E. coli. The reaction catalysed by ADPglucose pyrophosphorylase is the critical committed step of glycogen biosynthesis, as reflected in the allosteric properties of this enzyme, and by the significant regulatory effects in uitro exerted by CAMP and ppGpp on its synthesis. VI. Acknowledgements
We wish to thank Michael Cashel for providing the spoT strains of E. coli, before their construction and characterization had been published. Also, S. B. Jovanovich, S. A. Lesley, and R. R. Burgess generously supplied antibodies against E. coli cr factors prior to their publication. Jill Black and Alicia Gardiol contributed to the studies on the g1gC’-’IacZ gene fusion. REFERENCES
Aboud. M. and Pastan. 1. (1975). Journal qf’Biologicul Chemistry 250, 2189. Adams. M. J., Buehner, M., Chandrasekhar, K., Ford, G . C., Hacker, M. L., Liljas, A,, Rossman, M. G..Smiley, 1. E., Allison. W. S., Everse, J.. Kaplan. N. and Taylor, S. S. (1973). Proceedings qf the Naiionul Acudemy of Science sf’ the United States of’ America 10, 1968. Antoine. A. D. and Tepper, B. S. (1969a). Archities qf’Biochemistry and Biophysics 134, 207. Antoine, A. D. and Tepper, B. S. (1969b). Journal of General Microbiology 55, 217. Antoine. A. D. and Tepper, B. S. (1969~).Journul of’ Bacteriology 100, 538. Atkinson, D. E. ( I 970).In “The Enzymes”(P. D. Boyer, ed.), 3rd edn, vol. I , pp. 461-469. Academic Press. New York. Auling. G., Reh, M., Lee, C. M. and Schlegel, H. G. (1978). Inrernarionul Journal qf’Systematic Bfic,/cTi(J/iJgJ28, 82. Baecker, P. A.. Furlong, C. E. and Preiss, J. (1 983). Journul qf’ Biological Chemisrry 258, 5084. Baecker. P. A.. Greenberg, E. and Preiss, J. (1986). Journal qf’ Biological Chemistry 261, 8738. Barry. C., Gavdrd. R.. Milhaud, G . and Aubert, J. P. (1952). Compi. Rend. 235, 1062. Berk, A. and Sharp, P. A. (1977). Cell 12, 721-732. Birkhed, D. and Tanzer, J. M. (1979). Archiires qf Oral Biology 24, 67. Boyer, C. and Preiss, J. (1977). Biochemistry 16, 3693. Boylen, C. W. and Ensign, J. C. (1970). Journal of’ Bacteriology 103, 578. Brana, A. F., Manzanal, M. B.. Hardisson, C. (1980). Journal qf Bacrrriology 144, 1139. k a n a . A. F.,Manzanal. M. B.. Hardisson, C. (1982). Canadian Journal ofMicrohiology 28, 1320. Bridger, W. A. and Pardnchych, W. (1978). Canadian Journal of’Biochemistry 56,403. Buc, H.. Amoyal, M., Buckle, M., Herbert, M., Kolb, A., Kotlarz, D., Menendez, M., Rimsky, S.. Spassky. A. and Veramian, E. (1986). In “RNA Polymerase and the Regulation of Transcription”(W. S. Reznikoff, R. R. Burgess, J. E. Dahlberg, C. A. Gross, M. T. Record and M. Wickens, eds), pp. I 15-1 25. Elsevier, New York. Burleigh, 1. G. and Dawes, E. A. (1967). Biochemical Journul 102, 236. Carlson, C. A., Parsons, T. F. and Preiss, J. (1976). Journal of Biological Chemisiry 251, 7866. Carlson. C. A. and Pieiss, J. (1982). Biochemistry 21, 1929. Cashel. M. and Rudd, K. E. (1987). In “Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology”(F. C. Neidhardt, J. L. Ingraham, D. 8. Low, B. Magasanik, M. Schaecter and H. E. Urnbarger, eds), pp. 1410-1438. American Society for Microbiology, Washington, D.C. Cassity, T. R. and Kolodziej, B. J. (1984). Journal qf Generul Microbiology 130, 535.
234
JACK PREISS AND TONY ROMEO
Cattaneo, J., Damotte. M., Sigal, N., Sanchez-Medina, G . and Puig, J. (1969). Biochemical and Biophysical Research Communications 34, 694. Chao, J. and Weathersbee, C. J. (1974). Journal qf Bacferiolugy 117, 181. ChargafT, E. and Moore, D. H. (1944). Journal of' Biological Chemistry 155, 493. Chen, G . S. and Segel, 1. H. (1968a). Archives qf Biochemistry and Biophysics 127, 164. Chen, G. S. and Segel. 1. H. (1968b). Archioes qf Biochemistry and Biophysics 127, 175. Chou, P. Y. and Fasman, G . D. (1974). Biochemistry 13, 222. Creuzat-Sigal. N., Latil-Damotte, M., Cattaneo, J. and Puig, J. (1972). In "Biochemistry of Glycosidic Linkage". pp. 647-680. Academic Press, New York. Cross, R. L. and Nalin, C. M. (1982). Journal of Biological Chemistry 257, 2784. Damotte, M., Cattaneo, J., Sigal, N. and Puig. J. (1968). Biochemical and Biophysical Reseurch Communicutiun.v 32, 9 16. Darvill, R. G., Hall, M. A., Fish, J. P. and Morris, J. G . (1977). Cunudian Journal qf Microhiology 23, 947. Dietzler, D. N. and Leckie, M. P. (1977). Biucheniicd and Biophjlsical Research Communications 77, 1459. Dietzler. D. N., Leckie, M. P., Lais, C. J. and Magnani, J. L. (1974).Archiues uf Biochemistry mid Biophysics 162, 602. Dietzler, D. N.. Leckic. M. P. Lais, C. J. and Magnani, J. L. (1975).JournulqfBiological Chemistry 250, 2383. Dietzler, D. N.. Leckie, M. P., Magnani, J. L., Sughrue, M. J., Bergstein, P. E. and Sternheim, W. L. ( 1979). Journul of Biological Chemistry, 254, 8308. Dietzler, D. N., Leckie. M. P., Sternheim. W. L., Taxman, T. L., Unger, J. M. and Porter, S . E. ( 1977). Bioc,licvnicd and Biophysical Re.rearch Comniunicntions 77, 168. Dietzler, D. N. and Strominger, J. L. (1973). Journal o / Bacteriology 113, 946. Eidels, L. and Preiss, J. (1970). Archives q/Biochemistry and Biophysics 140, 75. Eisenberg, R. J.. Elchisak, M. and Lai, C. (1974). Biochemical and Biophysical Reseurch Communicutions 57, 959. Elbein. A. D. and Mitchell, M. (1973).Journul of Bacteriology 113, 863. Emeruwa, A. C. (1981). Annules Microhiologie (Inst. Pasteur) 1328, 13. Gentner, N., Greenberg. E. and Preiss. J. (1969). Biochemical und Bioph,vsical Research Coniniunicarion.s 36, 373. Gentner, N. and Preiss, J. (1967). Biochemicul B i c ~ p h y ~ i cResearch d Communicutions 73, 978. Gentner. N. and Preiss. J. (1968). Journul of Biologicul Chemisrry 243, 5882. German, R. J., Jones, A. S. and Nadayah, M. (1961) Nature 189, 1008. Gibbons, R. J. and Kapsimalis, B. (1963). Arc,hiws of Oral Biology 8, 319. Goldemberg, S. H. (1972).fn"Biochemistry of the Glycoside Linkage", Vol. 2 (R. Piras and H. G . Pontis. eds.) pp. 621-622, Academic Press, New York. Ghosh. H. P. and Preiss. J. (1965). Biochimicu et Biophysicu Acra 104, 274. Govons, S.. Gentner. N.. Greenberg. E. and Preiss, J. (1973).Journal o/'Biologicul Cliemistrj. 248, 1731. Govons, S., Vinopal, R., Ingraham. J. and Preiss, J. (1969).Journal qf Bacteriology 97, 970. Greenberg, E. and Preiss, J. (1964). Journal of Biolugical Chemistry 239, 4314. Greenberg, E.. Preiss, J. E.. Van Boldrick. M. and Preiss. J. (1983). Archives qf Biochemistry und Biophysics 220, 594. Guerinot, M. L. and Chelm. B. K. (1984). Journul qf Bacteriology 159, 1068. Hara, F., Akazawa. T. and Kojima. K. (1973). Plant and Cell Physiology 14, 737. Haugen. T., lshaquc, A. and Preiss, J. (1976). Journal qf Biologicul Chemistry 251, 7880. Haugen, T. H. and Preiss, J. (1979). Journcrl of' Biologicul Chetnistry 254, 1/27. Haziza, C., Stragier, P. and Patte. J.-C. ( I 982). European Molecular Biology Organization Journal I, 379. Hehre, E. J. and Hamilton, D. M. (1946). Journal qf Biological Chemistry 166, 777. Hehre, E. J. and Hamilton, D. M. (1948). Journal of Bacteriology 55, 197. Hehre. E. J.. Hamilton. D. M. and Carlson, A. S. (1949).Journal qf Biological Chemistry 177, 267. Helmann, J. D. and Chamberlin, M. J. (1988). Annual Reoiew of Biochemistry 57, 839. Hestrin, S. (1960). fn "The Bacteria", vol. 3, pp. 373-388. Academic Press, New York.
BACTERIAL GLYCOGEN SYNTHESIS
235
Hirschman. J., Wong, P.-K., Sei, K.. Keener, J. and Kustu, S . (1985). Proceedings ofihe National Acuderny of' Science of' the United Slates of' America 82, 7525. Hollemans. M., Runswick, M. J., Fearnley, I. M. and Walker, J. E. (1983). Journal of' Biological Chemisiry 258. 9307. Holme, T. (1957). Actu Chimicu Scandunai!ia I I , 763. Holme, T. and Palrnstierna, H. (1956). Actcr Chimicu Scundinuuiu 10, 578. Holmes. E.. Boyer, C. and Preiss, J. (1982). Journal of Bacieriohgy 151, 1444. Holmes, E. and Preiss, J. (1982). Archii!e.vof Biochemistry und Biophysic.~216, 736. Huis. J. H. J., in't Veld. 0. D. and Dirks. 0. B. (1978). Curies Reseurch 12, 243. Jones, K. A.. Kadonaga, J. T., Rosenfeld. P. J., Kelly, T. J. and Tjian, R. (1987). Cell 48, 79. Kadonaga. J. T. and Tjian. R. (1986).Proweding.v ofthe Natiotiu/ Acudemy ofScien1.e ofthe tinired S/a/es of' America 83, 5889. Kamio, Y.. Terawaki. Y.. Nakajima. T. and Matsuda, K. (1981). Agriculrurul and Biologicul Chemis/ry 45, 209. Keener. J.. Wong, P., Popharn, D., Wallis, J. and Kustu. S. (1987). In "RNA Polymerase and the Regulation ofTranscription" (W. S. Reznikofl, R. R. Burgess, J. E. Dahlberg, C. A. Gross, M. T. Record and M. P. Wickens, eds), pp. 159-175. Elsevier, New York. Kerlavage. A. R. and Taylor. S. S. ( 1 980). Journul O / Biologicul Chemis/ry 255, 8483. Khandelwal, R. L., Spearman, T. N. and Hamilton, I. R. (1973). Archiiws qf Biochemis/ry unrl BilJph~Sil'S'154, 295. Knight. K. and McEntee, K. (1985). Journal of Bii~logicdC/iemi.s/rj.260, 10185. Kohara. Y., Akiyama, K. and Isono, K. (1987). Cell 50, 495. Konig, H.. Skorko, R., Zillig. W. and Reiter, W. D. (1982). Archiiv.~qfMicrohiology 131, 297. Krebs. E. G . and Preiss. J. (1975). In "International Review of Science, Biochemistry of Carbohydrates" (W. J. Whelan, ed.), pp. 337-389. University Park Press, Baltimore. Kumar. A.. Larsen, C. E. and Preiss, J. (1986). Journul 0f'~%OkJgiCU/Chemi,v/ry. 261, 16256. Kumar. A.. Tanaka, T.. Lee. Y. M. and Preiss, J. (1988).Journd ~Jf'Biologicu/ Biochemis/rj. 263, 14634. Lacks. S. ( 1968). Gene/ics 60, 685. Larsen. C. E.. Lee. Y. M. and Preiss. J. (1986). Journd ~ / B i ~ l c ~ gChPmi.v/ry icd 261, 15402. Larsen, C. E. and Preiss. J. ( 1986). Bioc.hemi.s/r~~ 25, 4371. Latil-Damotte. M. and Lares, C . (1977). Moleculur m i l Generul Genetics 150, 325. Leckie. M. P.. Ng. R. H.. Porter. S. E.. Compton. D. R. and Deitzler, D. N. (1983). Journul iJ/ BiO/OgiCY//ChetV;.FIry 258, 38 13. Leckie. M. P.. Ticber, V. L.. Porter. S. E., Roth. W. G. and Dietzler, D. N. (1985). Journd of Bucteriolo,yy 165, I 33. Lee, Y. M.. Kumar, A. and Preiss, J. (1987a). Nucleic Acids Reseurch 15, 10603. Lee. Y. M..Larsen, C. E. and Preiss, J. (1978b). In "Proteins" (J. J. L'Italien, ed.), pp. 581-598, Plenum. New York. 244, 585. Lee, Y. M., Mukherjee, S. and Preiss, J. (1986). Ari,liires ofBiochemi,s/ryund Biophj~,sii,.s Lee. Y. M. and Preiss, .I.(1986). Journd of Biologiccrl Chrrni,vtrj*261. 1058. Lehmann, M. and Preiss, J. (1980). Journd o/Bucteriolog,r 143, 120. Lehmann, M. and Wober. G. (1976). Archiivs of Microhiologj- 111, 93. Leloir. L. F.. Olivarria. J. M., Goldemberg. S. H. and Carminatti, H. (1959). Archiivs O / Biochemi,s/rj.und Bi~p/iy.vic.v81, 508. Lesley. S. A., Thompson. N. E. and Burgess, R. R. (1987). Journu/ of'Biologicul Cheniistr.~~ 262, 5404. Leung, P.. Lee, Y. M., Greenberg. E., Esch, K., Boylan, S. and Preiss. J. (1986). Journal of' Bacterio/ogy 167, 82. Leung. P. S. C. and Preiss, J. (1987a). Journul ofBuc/erio/ogy 169, 4349. Leung. P. S. C. and Preiss. J. (1987b). Journal ~ f ' B u c I e r i ~ l o 169, g y 4355. Levine. S., Stevenson. H. J. R., Tabor. E. C., Bordner. R. H. and Chambers, L. A. (1953).Journal?/ BaciiJrio/ogy66, 664. Lichenstein, H. S., Hamilton, E. P. and Lee, N. (1987).Journul qfBucteriology 169, 811. Lindner. J. G. E., Marcellis. J. H.. DeVos, N. M.and Hoogkamp-Korstanje, G. A. (1979). Journul of Generd Microhiohgy 11 I , 93.
236
JACK PREISS A N D TONY ROMEO
Liu-Johnson, H.-N.. Gartenberg, M. R. and Crothers, D. M. (1986). Cell 47, 995. MacKenzie, C. R.. Johnson, K. G. and McDonald, 1. J. (1977). Canadian Journal of Microbiology 23, 1303. Mackey. B. J. and Morris, J. G. (1971). Journal of General Microbiology 66, I. Mackey, B. J. and Morris, J. G. (1974). FEBS fetters 48, 64. Madsen. N. B. (1961). Biochemica et Biophysica Acra 50, 194. Madsen, N. B. (1963). Canadian Journal of Biochemistry and Physiology, 41, 561. Mallette, M. F. (1963). Annals of rlie Nen. York Academy of Science 102, 521. Marr, A. G., Nilson, E. H. and Clark, D. J. (1963).Annals ofrhe New York Academy ?/Science 102, 536. McFarland, C. R.,Boyle-Rockwell, P. and Rodriguez, J. F. (1981). Microbios 32, 143. McFarland, C. R.. Snyder, T. L. and McKenzie, R. (1984). Microbios 40, 7. Miller, J. H. (1972).“Experiments in Molecular Genetics”. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Morell, M. K., Bloom, M.. Knowles, V. and Preiss, J. (1987a). Plant Physiology 85, 182. Morell. M. K., Bloom, M., Larsen. R.. Okita, T. W. and Preiss, J. (1987b). In “Plant Gene Systems and Their Biology” (J. Key and L. Mclntosh. eds), pp. 227-242. Alan R. Liss, New York. Morell. M.. Bloom, M. and Preiss, J. (1988). Journal of Biological Cliemis/ry 263, 633. Mulder, E. G., Dienema. M. H.. Van Veen. W. L. and Zevenhuizen. L. P. T. M. (1962). Rec. Truv. Chim. des Par.s-Ba.c 81, 797. Mulder. E. G . and Zevenhuizen, L. P. T. M. (1967). Archives qf Microbiology 59, 345. Mulichak, A. M., Jankun, E. S., Rydel, T. J., Tulinsky. A. and Preiss, J. (1988).Journalof’Biological Chemistry 263, 17237. Okada, G. V. and Hehre. E. J. (1974). Journal of Biological Chemistry 249, 126. Okita. T. W., Rodriguez, R. L. and Preiss, J. (1981). Journal of Biological Chemisrry 256, 6944. Pai. E. F., Sachsenheimer. W.. Schirmer, R. H. and Schulz, G. E. (1977). Journal of Molecular Biolog.~114, 37. Palmer, T. N., Wober, G. and Whelm, W. J. (1973). Eurripean Journal qf Biochemistry 39, 601. Parsons, T. F. and Preiss, J. (1978a). Journal n/‘Biologicul Cheniistry 253, 6197. Parsons, T. F. and Preiss, J. (1978b). Journal qf Biological Chemistry 253, 7638. Patel, G. B. and Breuil. C. (1981). Archives qfMicrobiology 129, 265. Pfennig, N. P and Truper, H. G. (1974). In “Bergey’s Manual of Determinative Bacteriology” (R. F. Buchanan and N. E. Gibbons, eds), 8th edn, p. 24. Williams Wilkens, Baltimore. Pirt. S. J. (1965). Proceedings f?f/IieRoyal Socie/y B 163, 224. Pirt, S. J. (1982). Arc1iiue.c of Microbiology 139, 300. Polayes, D. A.. Rice. P. W.. Garner, M. M. and Dahlberg. J. E. (1988).JournalyfBac/eriology170, 31 10. Preiss, J. (1969).In “Current Topics in Cellular Regulation“ (B. L. Horecker and E. R. Stadtman, eds) vol. I, pp. 125-160. Academic Press, New York. Preiss. J. (1972). Intra-Science Cliemistrj Reports 6, 13. Preiss, J. (1973). In “The Enzymes’’ (P. D. Boyer, ed.), 3rd edn, vol. 8. pp. 73-1 19, Academic Press, New York. Preiss. J. (1978). In “Advances in Enzymology and Related Areas of Molecular Biology” (A. Meister, ed.), vol. 46, pp. 317-381. Wiley-Interscience, New York. Preiss, J. (1984). Annuul Reiieii3.c of Microbiology, 38, 419. Preiss, J. (1988).In “The Biochemistry of Plants” (J. Preiss, ed), vol. XIV, pp. 181-254. Academic Press, New York. Preiss. J. and Levi. C. (1980).In “Biochemistry of Plant Carbohydrates”, (J. Preiss. ed.), vol. 3, pp. 371-423. Academic Press, New York. Preiss, J. and Greenberg, E. (1981). Journal of Bacteriology 147, 711. Preiss, J. and Walsh, D. A. (1981). In “Biology of Carbohydrates” (V. Ginsburg, ed.), vol. I , pp. 199-314. John Wiley, New York. Preiss, J., Shen, L., Greenberg, E. and Gentner, N. (1966). Biochemistry 5, 1833. Preiss. J.. Govons, S., Eidels, L., Lammel, C., Greenberg, E., Edelmann, P. and Sabraw, A. (1970). In “Proceedings of the Miami Winter Symposia”, vol. I, pp. 122-139. North Holland, Amsterdam.
BACTERIAL GLYCOGEN SYNTHESIS
237
Preiss, J., Sabraw, A. and Greenberg, E. (1971). Biochemical and Biophysical Research Communications 42, 180. Preiss, J.. Ozbun, J. L., Hawker, J. S., Greenberg, E. and Lammel, C. (1973). Annals of the Ne” York Academy ?/ Sciences 210, 265. Preiss, J., Greenberg, E. and Sabraw, A. (1975). Journal of Biological Chemistry 250, 7631. Preiss, J., Crawford, K., Downey, J., Lammel, C. and Greenberg, E. (1976a). Journal of Bacteriology, 127, 193. Preiss, J., Lammel, C. and Greenberg, E. (1976b). Archives of Biochemistr.p and Biophysics 174, 105.
Preiss, J., Greenberg. E.. Parsons. T. F. and Downey, J. (1980). Archives qf Microhiology 126, 21. Preiss, J., Yung, S.-G. and Baecker, P. A. (1983). Molecular and Cell Biochemistry 57, 61. Preiss, J.. Bloom, M., Morell, M., Knowles, V. L., Plaxton, W. C., Okita, T. W., Larsen, R., Harmon, A. and Putnam-Evans, C. (1987a). In “Tailoring Genes for Crop Improvement” (G. Bruening, J. Harada, T. Kosuge and A. Hollaender, eds), pp. 133-152. Plenum, New York. Preiss, J., Morell, M., Bloom, M., Knowles, V. L. and Lin, T. P. (1987b). I n “Progress in Photosynthesis Research” (Biggins, J., ed.), Vol. 111, pp. 693-700. Martinius Nijhoff, Dordrecht. Raibaud. 0. and Swartz, M. (1984). Annual Review ?/Generics 18, 173. Ren, Y. L.. Garges, S., Adhya. S. and Krakow, J. S. (1988). Proceedings of the Nalional Academy sf Sciences o f t h e United States qf America, 85, 4138. Ribbons, D. W. and Dawes. E. A. (1963). Annals o f t h e New York Academy ofscience 102, 564. Riordan, J. G., McElvay, K. D. and Borders, C. L., Jr (1977). Science 195, 884. Romeo, T. and Preiss, J. (1988). In “ICSU Short Reports, Volume 8. Advances in Gene Technology: Protein Eingineering and Production. Proceedings of the Miami Winter Symposium”, (K. Brew, F. Ahmad, H. Bialy, S. Black, R. E. Fenna, D. Puett, W. A. Scott, J. VonBrunt. R. W. Voellmy, W. J. Whelan and J. F. Woessner, eds), p. 75. Romeo, T. and Preiss, J. (1989). Journal q/Bacteriology 171, 2773. Romeo, T., Kumar, A. and Preiss, J. (1988). Gene 70, 363. Sarma, T. A. and Kanta, S. (1979). Zeitschrift Allegmeine Mikrohiologie 19, 571. Sarubbi, E., Rudd, K. E. and Cashel, M. (1988). Molecular and General Genetics 213, 214. Schlief. R. (1987). In “Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology” (F. C. Neidhardt, J. L. Ingraham. K. B. Low, B. Magasanik, M. Schaecter and H. E. Umbarger, eds), pp. 1473-148 1. American Society for Microbiology, Washington, D.C. Schulz. G. E. and Shirmer, R. H. (1979). Principles of Protein Structure, Springer Verlag. New York. Schwartz, M. (1965). Compte Rendues A d e m i e Paris 260, 2613. Schwartz. M. (1966). Journal ofBacferio/ogy92, 1083. Schwartz. M. (1987). In “€.scherichia coli and Salmonella tj’phimurium: Cellular and Molecular Biology” (F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaecter and H. E. Umbarger, eds). pp. 1482-1 502. American Society for Microbiology, Washington. D.C. Schweizer. H. and Larsen, T. J. (1987). Journal qf’ Bacteriology 169, 507. Segel, 1. H.. Cattaneo, J. and Sigal, N. (1963). I n “Proceedings of the International CNRS Symposium on Mech. regulation cellular activities of microorganisms, Marseille, 1963”. pp. 335-337. Centre National de la Recherche Scientifique, Paris, 1965. Shanblatt, S. H. and Revzin, A. (1983). Proceeding.P ? f / h e Na/ional Academy ?/Science 80, 1594. Shanblatt, S. H. and Revzin, A. (1987). Journal uf’Biological Chemislry 262, 11422. Shaw. D. H. and Squires. M. J. (1980). Archives ?/Microbiology 125, 83. Shen. L. C. and Atkinson, D. E. (1970). Journal q/ Biological Chemistry 245, 3996. Shen, L. and Preiss, J. ( 1964). Biochemical and Biophysical Research Communicarions 17,424429. Sigal, N., Cattaneo, J., Chambost, J. P. and Favard, A. (1956). Biochemical and Biophysical Research Communications 20, 616. Sigal. N., Cattaneo, J. and Segel, 1. H. (1964). Archives qfbiochemistry and Biophysics 108, 440. Silhavy, T. J., Berman, M. L. and Enquist, L. W. (1984). “Experiments with Gene Fusions”. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. Sirevag. R. (1975). Archiues of Microhiulogy 104, 105. Sirevag, R. and Omerod, J. G . (1977). Archives qf Microhiologj~111, 239. Slock, J. A. and Stahly. D. P. (1974). Journal ?/ Bac/eriology 120, 399.
238
JACK PREISS A N D TONY ROMEO
Stalmans, W. and Hers, H . G. (1973). In “The Enzymes” (P. D. Boyer, ed.), 3rd ed, vol. 8, pp. 309-361. Academic Press, New York. Stams, F. J. M.. Veenhuis. M.. Weenk, G. H. and Hansen, T. A. (1983). Archives qfMicrobiology 136, 54. Stanier, R. Y., Doudoroff, M., Kunisawa, R. and Contopoulos. R. (1959). Proceedings efthe Nulional Academy of Sciences qf the lJnited Slates of America 45, 1246. Steiner. K. E. and Preiss, J. (1977). Journal qf Bacreriulugy 129, 246. Strange, R. E. (1968). Naiure 220, 606. Strange, R. E., Dark, F. A. and Ness, A. G. (1961). Journul uf General Microbiology 25, 61. Strasdine, G. A. (1968). Cunadian Journal of Microbiology 14, 1059. Strasdine. G . A. (1972). Canadiun Journal qf Microbiology 18, 21 I . Taguchi, M., h i , K. and Katsuki, H. (1980). Journal of Biocheniistry (Tokyo)88, 3790. Tanzer. J. M., Freedman, M. L., Woodiel, F. N., Eifert, R. L. and Rinehimer, L. A. (1976).Journul of Dental Resrcirch 55, B 1 73. Tempest, D. W. and Strange, R. E. (1966). Journal qf General Microbiologji 44, 273. Urbanowski. J., Leung, P., Weissbach, H. and Preiss, J. (1983).Journal of Biological ChemLFtry 258. 2782. Van Hmte, J. and Jansen, H. M. (1968). Curies Researi,h 2, 47. Van Houte, J . and Jansen, H. M. (1970). Journal qfBacieriology 101, 1083. Van Houte, J. and Saxton, C. A. (1971). Curics Reseurch 5, 30. Vieira, J. and Messing, J. (1982). Gene 19, 259. Walker, G. J. (1966). Biochemical Journal 101, 861. Walker. G. J. and Builder, J. E. (1971). European Journul sf Biochemistry 21, 14. Whyte. J. N. C. and Strasdine, G. A. (1972). Carbohydrate Research 25, 435. Wilkinson, J. F. (1959). Experimenral Cell Research, Supplenient 7, I 1 I. Wober, G. (1973). Physiologic Chemii. 354, 75. Yu,F.,Jen, Y., Takeuchi, E., Inouye. M.. Nakayama, H., Tagaya, M. and Fukui, T. (1988).Journal of Biological Chemisrry 263, 13706. Yung, S. G. and Preiss, J . (1981). Journal of Bacreriology 151, 742. Zevenhuizen. L. P. T. M. (1964). Biochimica er Bi(iphj*sicuActo 81, 608. Zevenhuizen, L. P. T. M. (1966). Journul of Microbiology and Serology 32, 356. Zevenhuizen. L. P. T. M. (1981). Anionic Van Leeuwenhoek 47. 481. Zoller, M. J. and Smith, M. (1983). M e h d s qfEnzymology 100, 468.
Author Index Numbers in bold refer to rhe pages on which references are listed at rhe end of each chapter
A Aberdeen, V., 43,52 Aboud. M., 227,233 Achenbach, F . , 104, 120 Adams, A.M., 24,48 Adams, J.A., 159, 168, 177 Adarns, M.J., 201, 233 Adelsberg, B.R., 69,86 Adhya, S., 226,237 Agatensi, L., 73, 84 Aguilar, O.M., 16, 19 Ahearn, D.G., 80,86 Ahlers, B., 128,177, 179,181 Ahlert, R.C., 150, 180 Ahlrichs, J.L., 163, 177 Ajam, N . , 41,52 Akazawa, T., 186,234 Akiyama, K., 220,235 Alazard, D.I., 16, 19 Aleem, M.I.H., 166, 171, 177 Alef, K., 14, 19 Alexander, M., 159, 168, 179, 180 Alexopoulos, C.J., 31, 48 Algeri, A.A., 41,50 Allen, N.S., 110, 120 Allerman, J.E., 150, 177 Allison, S.M., 160,164, 166, 177 Allison, W.S., 201,233 Aloysius, S.K.D., 13, 19 Amoval. M.. 226.233 Andekon, J:M., bo, 62,63,65,66,67, 74,84,88
Angiolella, L., 64,75, 80, 86 Anthonisen, A., 140, 177 Antoine, A.D., 186,233 Arig, S . , 17, 21 Armbruster, B.L., 96,97,99, 120 Armstrong, D., 78, 85 Armstrong, E.F., 147,163,177 Arnold, W., 9,20 Arp, D.J., 14, 15,19,20 Asherson, G.L., 70,86 Ashworth, J., 170,173, 177, 180 Asker, S., 33,44,48 Atkinson, D.E., 191,233,237 Aubert, J.P., 186,233 Audinot, M., 70,85 Auling, G., 186,233
B Baecker, P.A., 184, 190, 192, 193, 195, 197, 198, 199,209,218,219,221, 233, 237 Bailey, L., 69, 85 Baker, B.S., 33,48 Bali, A., 12,20 Balish, E., 68, 87 Ballett, J.J., 70, 85 Banfalvi, Z . , 18, 20 Banno, I., 31,48 Banno, Y., 73,84 Barrett-Bee, K., 73, 84 Barry, C., 186, 233 Bartley, W., 38, 51
239
240
AUTHOR INDEX
Barton, J.K., 43,48 Bazin, M.J., 147,162,178,180 Beatty, R.A., 28,48 Becker, J.M., 70,86 Belay, N. 9,20 Belser, L.W., 137, 138, 140, 141, 142, 143,171, 177 Beneke, E.S., 72,78,85,87 Bennett, J.E., 77,78,84 Bentrup, F.W., 107,109,120 Berbardes, E., 24,51 Berg, W.E., 109, 123 Bergstein, P.E., 224, 234 Bergstrom, J., 7,20 Berk, A,, 221,233 Berman, M.L., 225,237 Bernardis, F.D., 73,84 Betterley, D.A., 32,48 Bhandari, B., 171, 177 Bhattacharya, A., 75,84 Bhuiya. Z.H., 160, 177 Bianchi, L., 41,50 Bianchi, M., 47,51 Bilinski, C.A., 2324,26,29,36,37,38, 39,40,41,42,43,45,48,50 Birkhed, D., 187,233 Bishop, P.E., 7,9,20 Bistoni, F., 64,71,84 Biswas, M., 75. 77,84.88 Bjorling, K., 30,31,49 Blackmer, A.M., 155, 156, 177 Blakeslee, A.F., 35,51 Blaz, P., 129, 181 Bloom, M., 190, 196, 198,199,236, 237 Bock, E., 128, 129, 133, 135, 136, 149, 153, 154, 155, 177, 178, 179, 180, 181 Bodey, G.P., 53,68,84 Bogdahn, M., 18,20 Boiron, P., 57,86 Bold, H.C., 32, 49 Bonner, J.T., 105, 109,120 Boon, B., 139, 144, 159, 177 Borders, C.L.jr., 201, 237 Bordner, R.H., 186,235 Borghi, H., 111, 120 Bortels, H., 7,20 Bothe, H., 9,15,20,21 Bottomley, P.J., 13, 20 Bowles, E.A., 110,120 Boyer, C., 189,217,218,233,235
Boylan, S., 210,235 Boylen, C.W., 186,233 Boyle-Rockwell, P., 190, 236 Bradley, M., 61.85 Brana, A.F., 185, 187,233 Braun, P.C., 61,84 Brawley, S.H., 117, 118,120 Brawner, D.L., 63,74,80,84 Breitenbach, M., 26,41,49, 50 Bremner, J.A.M., 155,156,169,170, 177, 179 Breuil, C., 186, 236 Bridger, W.A., 226, 233 Briere, C., 110, 120 Briggs, G.G., 170, 177 Brigle, K.E., 8, 20 Brill, W.S., 8, 21 Brostoff, J., 70, 87 Brower, D.L., 109, 112,120 Brown, A.H.D., 44,50 Brownlee, C., 100,106, 116,120, 122 Bruschi, C., 29,34,50 Buc, H., 226,233 Buckle, M., 226, 233 Buckley, H.R., 63,64,71,75,77,84, 85,88
Buehner, M., 201,233 Buffo, J., 60,65, 66,84,88 Builder, J.E., 189,238 Burgess, R.R., 230,235 Burkhardt, H.J., 18,22 Burleigh, I.G., 186, 187,233 Burnett, J.H., 28,29, 30,45,49 Burnie, J.P., 63,75,78,84,86 Burns, G.R., 72,85 Busa, W.B., 117, 120 Byers, B., 25,35, 47,51 C
Calderone, R.A. 61,71,72,74,84, 85, 86 Caldwell, J.H., 92,94,96,97,99, 101, 102, 115,117, 118. 121,122 Calvert, G.R., 41,49 Campbell, A.G., 43,49 Campbell, N.E., 171,177 Cannon, R.D., 63,64,84 Cantor, C.R., 57, 88 Capone, D.G., 170,171, 179 Carafoli, E., 117, 120
24 1
AUTHOR INDEX
Carbone, M.L.A., 38, 51 Carlson, A.S., 189,234 Carlson, C . A . , 197,217,233 Carlucci, A.F., 141, 177 Carminatti, H . , 189, 235 Carpenter, A.T.C., 33,48 Carruba. G . , 64, 75, 80, 86 Case, E.E.. 9 , 2 1 Casey, G.P., 24,48 Cashel, M., 227, 228, 231, 233, 237 Cassity, T.R., 186, 233 Cassone, A., 59.64, 71. 73, 75, 77, 80, 84,86,88 Castens, D.J., 140, 178 Castignetti, D., 167, 178 Cate, K., 6,22 Caten, C.E., 30,49 Cattaneo, J., 185, 186, 189, 190, 192, 209,214,219,234,237 Ceddia, T., 73,84 Centers for Disease Control (1986), 69, 85 Chamberlin, M.J., 222,234 Chambers, L.A., 186,235 Chambost, J.P., 189,237 9, 19, 20 Chan, F.-K., Chandrasekhar, K., 201,233 Chao, J., 190,234 Chaplin, A.E., 14,21 Chargaff, E., 186,234 Charley, R.C., 149, 178 Chatt, J., 6, 20 Chattaway, F.W., 61,85 Chelm, B.K., 225,234 Chen, G.S., 190,234 Chen, T.-H., 107,122 Cheung, W.Y., 61,85 Chiew, Y . Y . , 59,61,85,87 Chisnall, J.R., 7, 9, 20 Cho, Y.S., 69,85 Choi, H.Y., 69,85 Chou, P.Y., 201,202,234 Chvapil, M . , 38,49 Cihlar, R.L., 71, 72, 74, 84, 85, 86 Clark, C., 135, 178 Clark, D.J., 185,188,236 Clark, F.E., 2,20 Clark-Walker, G.D., 41,49 Cleary, A., 100, 120 Clement, H., 6 , 2 0 Cole, S.,69,85
Colizzi, V., 70, 86 Collard, A.E., 70, 86 Collins, O . R . , 31, 32, 34, 36,45,48,49 Colp, C., 69,86 Compton, D.R., 224,235 Cone, R . D . , 105, 107, 109, 120, 122 Contopoulos, R., 186,238 Cooke, J.G., 156, 178 Cooper, M., 114, 120 Corman, A , , 138, 144, 178 Corner, B . E . , 56, 57, 77, 80,85,88 Cortelyou, M.W., 58, 86 Cowan, J.D., 109, 112, 121 Cox, D.J., 162, 178 Crandall, M., 80, 85 Crawford, K . , 189,237 Crawley, W.E., 43,49 Crepeau, R.H., 38,49 Creuzat-Sigal, N . , 185,209,214, 219, 234 Crippa, M., 38, 51 Cross, R.L., 200,234 Crothers, D.M., 226,236 Crow, J . F . , 44,49 Cuellar, O., 36, 49 Cutler, J . E . , 63, 74,80,84 Cutter, V.M., 30,49
D Dobereiner, J . , 17,20 D’Souza, T.M., 80,86 Dabrowa, N . , 63,64,85 Dahlberg, J.E., 226,236 Dalton, D.A., 15,21 Dalton, J. A . ,7, 9, 20 Damotte, M., 190, 192, 209,234 Daneo-Moore, L., 64,84 Daniels, L., 9, 20 Danneberg C., 9 , 2 1 Dark, F.A., 184, 185, 186,238 Darrah, P.R., 140, 165, 178 Darvill, R.G., 186, 234 Das, M . , 71,75, 85 Datta, A., 5359, 61,62,71,75,77, 80, 84, 85,86,87, 88 Davidson. E.A., 155, 178 Dawes, E.A., 185, 186, 187, 233,237 Dawes, I.W., 41,45,49,52 Day, A.W., 30,49 Dazy, A . C . , 111,120
242
AUTHOR INDEX
Deacon, J.W., 30,49 Dean, A.C.R., 15,22 Dean, D.R., 8,20 De Boer, W., 165,166,177 deBruijn, F.J., 15,20 Defever, K.S., 78,85 Dei-Cas, E., 53.68,85 Deistung, J., 8,20 Deitzler. D.N., 224, 235 DeLeval, J., 142, 144, 180 De Loof, A,, 116,120 Delwiche, C.C., 2,20 den Hollander, J.A., 43,48 De-Polli, H., 17,20 Derylo, M., 18.20 DeVos, N.M., 186,235 deVries, R.T.P., 138, 141, 144, 151, 152,178 De Vries, S.C., 108, 114, 120 Diamond, R.D., 70,8S Dienema, M.H., 184,186,236 Dietzler, D.N., 186, 192,224,226,234, 235 Digre, K.B., 71,72,87 Dilworth, M.J., 9. 16,20 Dirks, O.B., 188,235 Dismukes, W.E., 78,86 DiSpirito, A.A., 152, 178 Dittmann, F., 116, 122 Dixon, R.A., 11, 13, 17, 18, 20, 22 Doll, R., 46, 49 Dorn, A., 91, 101, 110, 120, 121 Doudoroff, M., 186,238 Downes, M.T., 156,178 Downey, J., 189,195,237 Doxtader, K.G., 166, 178 Drake, B., 63,75,86 Drebes, G., 32, 49 Dreyfus, B., 16, 19 Drouhet, E., 70, 85 Drozd, J.W., 138, 141, 142, 143, 144, 145, 178 Drutz, D.J., 71,78,85,87 Duits, H., 165, 166, 177 Dular, U., 130, 144, 145, 159, 180 Dunn, I.J., 152, 180 Durandy, A., 70,85
E Eady, R.R., 3, 7, 8 , 9 , 13, 14, 18, 19, 20,21,22
Eckert, R., 103, 104, 120 Eddy, A.A., 96,120 Edelmann, P., 190,236 Eidels, L., 184, 186, 190,234,236 Eifert, R.L., 188,238 Eisenberg, R.J., 187,234 Elango, N., 75,87 Elbein, A.D., 186,234 Elchisak, M., 187,234 Elder, R., 40,47,52 Eldridge, M., 7, 20 Elteen, K.A., 71,72,73,85 Elwood, H., 96, 104, 121 Emerson, R., 30,49 Emesi, C.C., 26,29,30, 50 Endo, T., 24,51 Engel, A., 149, 179 Engel, H., 149, 180 Enlow, R.W., 69,86 Enquist, L.W., 225, 237 Ensign, J.C., 186,233 Ephrussi, B., 41,49 Ernstoff, M.A., 69,85 Ero, L., 99,122 Esch, K., 210,235 Esen, A , , 35.49 Esposito, M.S., 26,29,33,34,41, 45, 48,49,50,51 Esposito, R.E., 24, 25,26,29,33, 34, 36,37,38,39,40,41,44,45,47,48, 49,50,51,52 Esser, K., 31,49 Ettl, H., 32, 49 Evans, G., 63,80,85 Evans, H.J., 13, 15.20,21 Evans, I . H . , 42,49 Evans, T.C., 103,120 Everse, J., 201,233
F Fainstein, V., 53,68,84 Fallick, E., 17, 21 Fan, J.-B., 57,88 Fasman, g.D., 201,202,234 Favard, A., 189,237 Fearnley, I.M., 202,235 Federer, C.A., 159, 178 Fehr, S., 136, 179 Fekete, B., 47,49 Feldman, D., 71,86 Fell, J.W., 31,51
AUTHOR INDEX
Fen, M., 41,50 Ferrari, C., 29,34,41,50 Fick Jr, R . B . , 69,87 Finney, R.G., 62,85 Firestone, M.K., 168,180 Firmin, J.L., 15,21 Fischer, A . , 70,85 Fish, J.P., 186,234 Fiss, E . , 75,85 Focht, D . D . , 140,153,166,178,180 Fogel, S., 25,51 Ford, G.C., 201,233 Forrester, I., 61,85 Fortier, B . , 63,80, 85 Foster, J.S., 70,86 Fowell, R . R . , 24,49 Fowler, V.J., 129,181 Fox, G.E., 129,181 Foyn, B . , 33,49 Frackman, S . , 40,47,52 Fram, E.K., 38,49 Frankel, J . , 104,120 Fraser, R . , 163,177 Freedman, M.L., 188,238 Freeman, D . B . , 91,120 Freeman, J.A., 91,120 Freitag, A . , 154,155,177,178 Frey, C.L., 71,87 Friedland, G.H., 69,86 Friesen, J.O., 41,52 Fruit, J . , 81,82,87 Fuhrmann, M., 12,21 Fujii, T., 38,49 Fukui, T., 220,229,231,238 Fukumori, Y . , 133,153,180 Furlong, C.E., 193,195,199,219, 233
G Gainey, P.L., 146,159,162,178,181 Gaither, T . , 34,49 Galask, R . , 65,67,88 Gallon, J.R., 14,21 Galpin, M.F.J., 101,120 Ganesan, K., 53annon, J . I . , 141,181 Ganter, P.F., 43,52 Garcia, E., 111, 120 Garges, S . , 226,237 Garner, M.M., 226,236 Gartenberg, M.R., 226,236 Gascon, S . , 47,49 Gaumann, E . A . , 26,28,29,30,49
243
Gavard, R., 186,233 Gay, G., 138,144,178 Gay, J.L., 43,50 Gentner, N . , 190,192,193,197,204,
205,234,236
Geraci, G., 35,49 Germaine, G . R . , 73,85 German, R.J., 186,234 Gerritsen, J . , 44,49 Gerstoft, J . , 69,87 Geva, N.,13,22 Ghannoum, M A . , 71,72,73,85 Ghazali, H.M., 75,87 Ghosh, H.P., 186,234 Gibbons, R.J., 184,186,188,234 Gil, C., 63,64, 65,87 Gilkey, J.C., 106,120 Gillum, A.M., 57,85 Girvitz, S.C., 38,39,40,48 Glover, H.E., 134,137,138,140,141.
142,143,145,158,178
Glowacka, M., 18,20 Gold, J.W.M., 78,85 Goldberg, S.S., 146,162,178 Goldemberg, S . H . , 186,189,234, 235 Golden, J.W., 12,21 Gong, T., 45,49 Good, C., 72,86 Gooday, G.W., 96,97,100,101,108,
113,115,118,120,121,123
Goodwin, B.C., 104,110,111,120 Gopal, P . , 75,77,85 Goreau, T.J., 152,178 Goring, C.A.I., 169,178 Gormal, C., 7,20 Gorman, J.A., 58,87 Gorts, C.P.M., 41,49 Gosz, J.R., 159,160,181 Gottschal, J.C., 135,179 Gould, G.W., 138,144,178 Govons, S . , 185,190,192,216,234,
236
Gow, N . A . R . , 89 92,96,97,98,99,
100,101,102,103,108,109,113, 115,116,117,118,120,121,123 Greenberg, E., 189,190,192,195,197, 210,216,218,219,221,233,234, 235,236,237 Gressel, J . , 101,121 Grewal, N.S., 24,25,28,33,37,41,43, 44,49 Grier, C.C., 159,160,181
244
AUTHOR INDEX
Griscelli, C., 70, 85 Guerinot, M.L., 225,234 Guilliermond, M.A., 25,26,49,50 Gull, K., 162,178 Gunderson, J.H., 96, 104,121 Gunderson, K., 141,148, 178 Gunner, H.B., 167,178 Gupta, R. 129, 181 Gupta, Roy B., 61,62,75,85,88 Gustafsson, A., 27,50
H Haaker, H., 14,21 Haber, J.E., 24,40,50 Hacker, M.L., 201,233 Hader, H.P., 92,121 Hahn, C.M., 129,181 Hahnert, W.F., 109, 121 Hales, B.J., 9, 21 Hall, G.H., 149, 150, 170,178 Hall, M.A., 186,234 Halpern, C., 41, 51 Halvorson, H.O., 24,40,50 Hamilton, D.M., 189,234 Hamilton, E.P., 226,235 Hamilton, I.R., 190,235 Hankinson, T.R. 160,161,165,178 Hanna, W.H., 46,50 Hanrahan, V., 54,57,87 Hansen, T.A., 186,238 Hanson, F.B., 8,21 Hara, F., 186, 234 Harashima, S., 24,51 Hardie, I.D., 45,49 Hardisson. C., 185, 187,233 Harmon, A., 198, 199,237 Harms, H., 128, 129, 133,135, 136, 154, 177, 179, 181 Harold, F.M., 92,94,95,96,97,98, 99, 100,101,102, 104,108, 115, 116, 117, 118,121,122 Harold, R.L., 94,96,97,98, 108, 118, 121,122 Harris, C.A., 69,86 Hartig, A., 41,50 Hartwell, L.H., 39, 52 Hasan, G., 61,75,88 Haselkorn, R., 12,21 Hashimoto, L.K., 146, 178 Hashimoto, T., 59,60,87
Hatfield, D.E., 24,48 Hauck, R.D., 169, 178 Haudenschild, C.C., 70,85 Haugen, T.H., 195,197,201,204,234 Hawker, J.S., 221,237 Hawkes, T.R., 7,21 Hayashibe, M., 24,51 Hayes. Y.,73,84 Hazen, B.W., 80,85 Hazen, K.C., 80, 85 Haziza, C., 218, 234 Heath, I.B., 96, 118, 121 Hebert, P.D.N., 36,50 Hecht, F., 47,50 Hehre, E.J. 189, 234,236 Helder, W., 138, 141,144, 151, 152, 178 Helmann, J.D. 222,234 Henderson, R.A., 5,21 Hennecke, H. 12,21 Hennessey, T., 103,120 Henninger, W., 26,29,30,50 Herbert, M., 226, 233 Herbert, R.A., 156, 179 Herman, M.A., 60,84 Her'mans, I.F., 57,88 Hers, H.G., 189,238 Hersch, E.M., 79,86 Herskowitz, I., 36,50 Herth, W., 116,122 Hestrin, S., 189, 190,234 Hicks, J., 65,67,88 Higgs, J.M., 69, 88 Hill, S., 12, 13, 14, 17,20,21,22 Hilton, C., 56, 57, 80,85 Himeno, K., 69,88 Hirschberg, J., 39,50 Hirschman, J., 227,235 Hoare, D.S., 135, 180 Hobbs, J.R., 69,88 Hoberg, K.A., 72,84,85 Hobot, J., 101, 120 Hoffman, J., 69,85 Hofman, T., 137, 178 Hollemans, M. 202,235 Holliday, R., 31, 50 Hollocher, T.C., 167, 178 Holme, T., 184, 186,235 Holmes, E., 189,217,218,235 Holt, J.L., 69, 88 Hood, M.A., 135, 178
245
AUTHOR INDEX
Hoogkamp-Korstanje, 186,235 Hooper, A.B., 132, 149, 150, 152, 170, 178 Hooper, D.G., 149,178 Hoover, T.R., 6,7,21,22 Hopfer, R.L., 79,86 Hopper, A.K.. 38,50 Hopwood, V., 53,63,74, 80,82,85,87 Horiuchi, T., 15,21 Horsburgh Jr, C.R. 78,85 Horwitz, B.A., 101,121 Hottinguer, H., 41,49 Howard, D.H., 63,64,85 Howard, K.S., 8,21 Hubbard, M.J., 61,63,64,71,85 Hui, S.-W., 114,122 Huis, J.H., 188, 235 Hurley, R., 70,85 Hyman, M.R, 130,178 Hynes, R.K., 130,152, 153, 170, 178
I Iino, T., 24, 51 Imperial, J., 6, 7, 21, 22 Ingold, A., 96, 104, 121 Ingraham, J., 185,190, 192,216, 234 Inouye, M., 220,229,231,238 Ishaque, A,, 195,234 Isono, K., 220,235 Izui, K., 226, 238
J Jacobsen, M.R.. 7,9,20 Jaffe, L.F., 90,91,92,97, 105, 106, 107,109,113, 116, 120, 121, 122, 123 Jaffe, M.H., 97, 102, 103, 122 Jagnow, G.,168,179 Jankun, E.S., 202,236 Jansen, H.M., 185, 186, 187,238 Jarvinen, O., 44,52 Jeffery, K., 54,57,87 Jen, Y., 220,229,231,238 Jenkinson, D.S., 159, 160, 170, 180, 181 Jenkinson, H.F., 73,85 Jennings, D.H., 101, 120,121 Joeger, R.D., 7,9,20 Johnson, K.G., 189,236
Johnsrud, S.C., 168, 178 Johnston, A.W.B., 15,21 Johnston, G.C., 40,50 Jones, A.S., 186,234 Jones, G.L., 149, 178 Jones, J.M., 62,63,69,74,78,80,85, 87,88
Jones, K.A., 223,235 Jones, R.D., 135, 178 Josefsson, J.O., 103, 121 Jouanneau, Y., 15,21 Juliano, R.L., 79, 86
K Kadonaga, J.T., 223,235 Kaiser, 47, 50 Kaiser-McCaw, B., 47,50 Kakar, S.N., 57,85 Kalthoff, H., 136, 179 Kaltwasser, H., 127, 179 Kaluza, K., 12,21 Kamio, Y., 186,235 Kamiyama, A., 80,86 Kanbe, T., 54,55,88 Kanta, S., 185, 186,237 Kaplan, N., 201,233 Kaplan, W.A., 146,152, 178 Kapsimalis, B., 184,186, 188,234 Karbassi, A., 70,86 Kataoka, H., 111, 117, 121 Katsuki, H., 226, 238 Kaufman, R., 13.22 Keen, G.A., 137, 138, 140, 141, 142, 143, 144, 147, 157, 161, 179 Keener, J., 227,235 Keeney, D.R., 169, 170, 179,180 Keifer, D.W., 107, 121 Keith, S.M., 156, 179 Kelly, D.P., 134, 179 Kelly, M.S., 43,50 Kelly, R., 58, 86 Kelly, T.J., 223, 235 Kennedy, C., 12,20,21 Kenny, G.E., 62,63,74,80,88 Kent, H.M., 13, 14, 17, 18,22 Kentemich.T., 9,21 Keramida, V., 150, 177 Kerlavage, A.R., 200,202,235 Khandelwal, R.L., 190,235 Kielland-Brandt, M.C., 41,51
246
AUTHOR INDEX
Kiermayer, 0.. 112, 121 Kilham, K., 160, 166, 168, 170, 179 Killham, K.S., 168, 180 Kimura, M., 44,49 Kindle, K., 96, 104, 121 King, E.F., 149,180 Kinnaird, J.H., 41,52 Kinney, S.G., 98, 108, 122 Kinsman, O.S., 70,86 Kirkpatrick, C.H., 78,85 Kirsch, D.R., 57,58,85,86 Kirstein, K.O., 136, 179 Kiseleva, E.V., 110, 122 Kiss, A., 18, 20 Klapholz, S., 24,25,29,33, 34,36,37, 38,39,41,44,49,50, 52 Klco, S., 57,88 Klein, J.J., 69, 86 Klein, T.M., 168,180 Klein, T.N., 159, 168, 179 Kleiner, D., 14, 18,20,22 Klemedtsson, L., 155, 179 Klevickis, S. 8, 21 Klipp, W., 9, 18,20,22 Klugkist, J., 14, 21 Knight, K., 202, 235 Knowles, R., 130,150, 152, 153, 155, 170, 171, 178, 179, 180 Knowles, V.L., 190, 198, 199,236,237 Koblan, K.S., 8.21 Kohara, Y., 220,235 Kojima, K., 186,234 Kokufuta, E., 156, 179 Kolb, A., 226,233 Kolodziej, B.J., 186, 233 Koltin, Y., 58,87 Koncz, C., 13,22 Kondoh, Y., 73,86,88 Kondorosi, A., 18,20 Kondorosi, E., 18,20 Konig, H., 184, 186,187,217,235 Koningsberger, V.V., 47,52 KOOPS,H.-P. 128, 129, 133, 136, 137, 154, 177, 179, 181 Kotlarz, D., 226, 233 Kowalisyn, J., 40,47,52 Krakow, J.S., 226,237 Krause-Kupsch, T., 128, 179, 181 Krebs, E.G., 184, 189, 190,219,235 Kreitinger, J.P., 159, 168, 179 Krieg, E., 128, 179 I
Krieg, N.R., 129, 181 Krishnapillai, V., 14, 21 Kristobulova, N.B., 110, 122 Kropf, D.L., 92,95,96, 97,98,99, 101, 106, 113, 115, 116, 117, 118, 121 Krumrnel, A ., 135, 179 Krzesicki, R., 70, 85 Kuenen, J.G., 135, 156, 168, 169, 179, 180 Kuenzi, M.T., 24,50 Kuhlenkamp, R., 33,50 Kuhlreiber, W., 92, 121 Kulkarni, R.K., 61,86 Kumar, A , , 205,206,208,210,218, 219,220,225, 229,230,232,235,237 Kunisawa, R., 186,238 Kupsch, T., 128, 181 Kuroiwa, T., 54,55,88 Kurtz, M.B., 58, 86 Kurtz, S., 42,43,50 Kustu, S., 227,235 Kvist, U., 38, 50 Kwok, S.C., 130, 144, 145, 159, 180 Kwon-Chung, K.J., 72,86
L Laanbroek, H.J., 165,166, 177 Lacalli, T.C., 112, 121 Lachance, M.-A,, 43,52 Lachkovics, E., 26,49 Lacks, S . , 190,235 Lai, C., 187,234 Lai, M., 58, 86 Lais, C.J., 192, 234 Lambert, R., 144, 159, 179 Lammel, C., 189, 190, 192,216,221. 236,237 Lammers, P.J., 12,21 Lampen, J.O., 47,49 Lane, L.S., 18,22 Lang, E., 168,179 Langtimm, C.J., 62,65,67,85,88 Lares, C., 219,235 Largen, M.T., 63,77,88 Larsen, C.E., 201,203,204,212,218, 219,230,235 Larsen, R., 198,199,236,237 Larsen, T.J., 220,237 Lasker, B.A., 78,86 Laskowski, D.A., 169, 178
247
AUTHOR INDEX
Latil-Damotte, M., 185,209,214,219, 234,235 Laudelout, H., 139,144, 159,177,179, 180 Leckie, M.P., 192,224,226,234,235 Le Deist, F., 70,85 Lee, C.M., 186,233 Lee, D.D.-S., 72,84 Lee, N., 226,235 Lee, T.M., 43,48 Lee, W., 78,84 Lee, Y.M., 200, 201,202,203,204, 205,206,208, 210,212,235 Lees, H., 137, 138, 144,147,161,170, 178,179 Lehman, D., 72,86 Lehmann, M., 187, 195,235 Lehrer, N., 71,72, 74,86,87 Leigh, G.F., 5,21 Leigh, G.J., 5,21 Leloir, L.F., 189,235 Lemlay, P.D., 8,21 Lennon, V.A., 75,88 Lesley, S.A., 230,235 Lesser, M., 69,86 Leung, P.S.C., 193,195, 199,210,212, 218,224,226,235,238 Leupold, U., 45,50 Levine, S., 186,235 Lewis, B.J., 129, 181 Lichenstein, H.S., 226, 235 Liljas, A., 201, 233 Lin, J.J.-C., 114, 121 Linder, D., 47,50 Lindhardt, B.O., 69,87 Lindner, J.G.E., 186,235 Lindquist, S., 42,43,50 Linnane, A.W., 41,49 Lipschulz, F., 153, 156, 179 Lipscomb, J.D., 152, 178 Liu, Z.-Y., 114, 121 Liu-Johnson, H.-N., 226,236 Lloyd, D.G., 44,50 Lodi, T., 41,42,50 Loehr, R.C., 140,177 Lokki, J., 27,33,45,50,52 Lombardi, G., 70, 86 Long, W.S., 94,98,101,122 Loose, D.S., 71,86 Lopez-Berestein, G., 79,86 Lorkiewicz, Z., 18.20
Lott, T.J., 57,86 Loveless, J.E., 138, 141, 144, 179 Lowe, D.J., 7,8,20,22 Lu, C.Y .-H., 94, 98, 101,122 Lucas, W.J., 107, 110, 111, 115,121, 123 Lucchini, G., 38, 51 Ludden, P.W., 6,7,21,22 Ludwig, W., 12, 21, 129, 181 Luna, M.A., 68,86 Lund, E.J., 109,121 Lundberg, B., 69,85 Lupa, M.D., 96,97,99, 115, 121 Luther, P.W., 114,121
M Muller, D.G., 33, 50 McCarty, G.W., 170, 179 McCloskey, J.A., 61,87 McCloskey, M.A., 114,121 Macdonald, C.J., 6,22 MacDonald, F., 72, 86 McDonald, I.J., 189,236 Macdonald, R.M.L., 128,179 McDowell, J . , 65, 67,88 McElroy, M.B., 146, 152, 153, 156, 178,179 McElvay, K.D., 201,237 McEntee, K., 202,235 McFarland, C.R., 186,187, 190,236 MacFarlane, G.T., 156,179 MacFarlane, T.W., 73,87 McGillivray, A.M., 99,101, 102,108, 109, 113, 115, 117, 121 Mchugh, N.J., 73,77,88 McIntosh, J.R., 109, 112, 120 Macke, T.J., 129, 181 MacKenzie, C.R., 189,236 McKenzie, R., 186,187,236 McKerracher, L.J., 96, 118, 121 Mackey, B.J., 185, 187,236 McLaren, A.D., 161, 179 MacLaughlin, A., 43,48 McLean, P.A., 7,8,21 McLee, A.G., 149,178 McManus, E.J., 78, 80,87 McNally, J.G., 109, 112,121 Macura, A., 71,86 Madigan, M.T., 129, 181
248
AUTHOR INDEX
Madsen, N.B., 185,186,236 Maeda, M., 24,51,105, 121 Maeda, Y., 105,121 Magee, B.B., 57,80,86 Magee, P.T., 38,50,54,55,56,57,72, 80,85,86,88 Magnani. J.L., 192,224,234 Mahler, H.R., 38,51 Mainwaring, H.R., 31, 50 Maisch, P.A., 72,74,86 Male, D.K., 70.87 Mallette, M.F., 188, 236 Malone, R.E., 41.50 Manavathu, E.K., 99,121 Maniotis, J., 45, 50 Manis, P.B., 91, 120 Manning, J.T., 44,50 Manning, M., 62,64,79,80,86 Manuel, J., 25,50 Manzanal, M.B., 185, 187,233 Marcellis, J.H., 186, 235 Marconi, P., 64, 71,84 Markie, D.M, 54,56,57,63,64,71, 80,85,87,88 Marmiroli, N., 23-52,29,34,37,38, 40,41,42,43,48,50 Marr, A.G., 185, 188,236 Marshall, D.R., 44,50 Martikainen, P.J., 160, 179 Maryan, P., 14,21 Mason, M.M., 78,86 Mathur, V., 69,86 Matsuda, K., 186,235 Matsumoto, T., 57,69,88 Matthews, R.C., 63,75,86 Mattia, E., 64,75,80, 86 May, H.D., 8 , 2 0 Mayes, B.N., 91, 120 Maynard Smith, J., 44,50 Mays, E.L., 143,177 Meade, R.H., 78,86 Medoff, G., 78,79,86 Megraw, S . , 150, 179 Mehta, K., 79,86 Mehta, V.B., 18,22 Meincke, M., 128, 177, 179, 181 Meindl, U., 112, 116, 121 Meinhardt, F., 31,49 Melillo, J.M., 159, 160, 181 Menendez, M., 226,233
Merrick, M.J., 8, 11, 12,21,22 Messing, J., 212, 238 Metraux, J.P., 110, 122 Meunier , F., 78,79,86 Mevarech, M., 58,87 Meyer, C., 128, 177, 181 Meyer, L., 128, 179 Meyer, S.A., 80,86 Meyer. W., 133, 153, 180 Michaelis, G., 41,51 Mildvan, D., 69,86 Milhaud, G., 186,233 Miller, D.J., 136, 152, 179 Miller, J.H., 225, 236 Miller, J.J., 2324,25,26,28,29,33,36, 37,38,39,40,41,42,43,44,45,46, 48,49,50,51,52 Miller, R.W., 7 , 9 , 18, 19,20,21 Miller, S.M., 58,86 Mims, C.W., 31,48 Mitchell, L., 60,86 Mitchell, M., 186, 234 Mitchell, T.G., 62,64, 79, 80, 86 Mittwoch, U., 46,51 Miyake, T.. 69,88 Moens, P.B., 26,29, 34, 35,41,45,49, 51,52 Mogie, M., 30,51 Mohammed, M.Y., 6 , 2 2 Molina, J.A., 164, 165, 179 Moll, B., 69,86 Mondello F., 73,84 Money, N.P., 100,121 Moore, D.H., 186,234 Moore, R.N., 70,86 Moorse, M.E., 24,49 Morell, M.K., 190, 196, 198, 199, 236, 237 Morris, J.G., 185,186, 187,234,236 Mortenson, L.E., 8 , 2 2 Moses, J.M., 78,86 Mowat, M., 26,29,34,51 Muir, J.C., 63,75,86 Mukherjee, S . , 200,204,212,235 Mulder, E.G., 184,186,236 Mulichak, A.M., 202, 236 Muller, D.G., 32, 49 Muller, G., 64,71,88 Muller-Neugluck, N., 149,179 Mulligan, M.E., 12,21
249
AUTHOR INDEX
Munz, A., 116,122 Murray, P.L., 9,21 Musgrave, A., 99,122 Muthukumar, G., 61,86
N Nadayah, M., 186,234 Nakagawa, Y.,70,85 Nakajima, T., 186,235 Nakamura, I., 156,179 Nakaseko. Y., 26,30, 34,51 Nakayama, H., 61,63, 72,80,86,87, 88,220,229,231,238 Nalin, C.M., 200, 234 Nason, A., 170, 180 Natarajan, K., 5359,77,86 Nawata, T., 91, 112, 122 Ndoya, I., 16, 19 Neale, T.J., 63,75, 86 Nealson, K.H., 129,181 Nel, P.M., 35,51 Nelson, D.L., 103, 120 Ness, A.G., 184, 185, 186,238 Neumann, K., 32,49 Neumann, N.P., 47,49 Newell, S.Y., 31, 51 Newton, W.E., 5,6, 8,13, 15, 20,21 Ng, R.H., 224,235 Nicholas, D.J.D. 136, 152, 171, 177, 179, 180 Nichols, E.J., 74,88 Nickerson, A.W., 61,86 Nickerson, K.W., 61,86 Nieva-gomez, D., 8,21 Niimi, K., 61,87 Niimi, M., 61,80,86,87 Nikinova, L.A., 6, 21 Nilson, E.H., 185, 188,236 Nilsson-Tillgren, T., 41,51 Nishibayashi, S., 54, 88 Niwa, O., 26,30,34,51,57,88 Nogler, G.A., 27,33,35,44,45,46,51 Nombela, C., 63,64,65,87 Nomoto, K., 69,88 Novick, A., 15,21 Novick, N.J., 168,179 Novotny, J., 127, 181 Nozawa, Y., 73,84
Nuccitelli, R., 90,91,97, 102, 103, 106, 107, 110, 116, 117,120,121, 122, 123 Nugent, K.M., 61,69,87,88 Nurmiaho-Lassila, E.-L., 160,179 Nye, P.H., 140, 165, 178
0 Oates, K., 101, 120 O’Brien, T.P., 100, 120 Odds, F.C., 53, 59,60,68,70,72,78, 84,86,87 Oehlers, E., 99,122 Oelze, J., 14, 22 Oewehand, J., 47,52 Ofek, I., 72,87 Oishi, S., 40,52 Oka, R., 24, 51 Okada, G.V., 189,236 Okamoto, S., 24,51 Okita, T.W., 193,198, 199,205, 218, 219,220,221,236,237 Okon, Y., 17,21 Olaiya, A.F., 54, 55, 87 Olivarria, J.M., 189,235 Olivo, P.D., 78,80,87 Olson, R.J., 146, 149, 179 Omerod, J.G., 186,237 Onofrio, J.M., 69,87 Onuma, E.K., 114, 122 Oppenheim, F., 70,85 O’Reilly, J., 61,85 Oremland, R.S., 170, 171, 179 Orme-Johnson, W.H., 8,21 O’Shea, P.S., 110,120 Oshima, Y., 24,36,50,51 Overrein, L., 165, 179 Ozbun, J.L., 221,237
P Pai, E.F., 201,236 Painter, H.A., 138, 141, 144, 149, 150, 179,180 Palmer, T.N., 190,236 Palmstierna, H., 184, 186,235 Pancholy, S.K., 170, 180 Panek, A.C., 24,51 Panek, A.D., 24,51 Pantea-Kiser, L., 150, 177
250
AUTHOR INDEX
Paranchych, W., 226,233 Parrington, J.M., 47,51 Parsons, T.F., 189, 195, 196,200,202, 204,212,217,233,236,237 Partridge, R.M., 54,55, 57,85,88 Paskins, A.R., 149, 178 Pastan, I . , 227, 233 Paster, B.J., 129, 181 Patel, G.B., 186, 236 Patel, N.B., 114, 122 Pateromichelakis, S., 111, 120 Paton, A.M., 13, 19 Patte, J.-C., 218, 234 Patterson, R.J., 72,87 Pau, R., 7 , 9 , 19,20 Paul, W., 8, 22 Paustian, T.D., 7,22 Payne, C.D.. 71,72,87 Pearman, A.J., 6,20 Pedersen, C., 69,87 Peeters, T.L., 144, 180 Peng, H.B., 109, 113,114,121,122 Pennak, R.W., 32,51 Penniston, J.T., 117, 120 Perlman, P.S., 38,51 Perry, T.O., 155, 178 Petersen, J.G.L., 41, 51 Petko, L.. 42,50 Pfaller, M., 65,66,67, 88 Pfennig, N.P., 186,236 Phaff, H.J., 43,45,51,52 Pham, M.L., 144,159, 179 Piccolella, E., 70,86 Pichat, L., 70, 85 Pickett, C.J., 5, 6, 21, 22 Pickett-Heaps, J.D., 112, 122 Pikalova, A.V., 110, 122 Pirt, S.J., 188, 236 Plaxton, W.C., 198, 199,237 Polakis, E.S., 38, 51 Polayes, D.A., 226, 236 Pollack, J.H., 59, 60,87 Pomes, R., 63,64,65,87 Pontefract, R.D., 4 3 , J l Ponton, J . , 74,87, 63.62 Poo,M.-M.,97, 102, 103, 113, 114, 121,122 Popham, D., 227,235 Porter, S.E., 224,226, 234,235 Post, E., 14,22 Postgate, J.R., 13, 5, 12,13, 14, 16, 17, 18,19,20,21,22
Poth, M., 153, 180 Poulain, D., 53,63,72,74,80,81,82, 85,87,88 Poulter, R.T.M., 53,54,56,57,59,60, 63,64,71,77, 80,85,87,88 Povey, S., 47,51 Powell, B.L., 71,87 Powell, S.J., 147, 162, 163, 171, 172, 173,174, 180 Powlik, B., 71,86 Powlson, D.S., 170, 180 Prakasam, T.B.S., 140, 177 Pratje, E., 41,51 Preiss, J., 183 184, 185, 186, 189, 190, 191, 192, 193, 195, 196, 197, 198, 199,200,201,202,203,204,205, 206,208,209,210,212,216,217, 218,219,220,221,222,223,224, 225,226,227,229,230,231,232, 233,234,235,236,237,238 Preiss, J.E., 189, 234 Premuker, R., 7, 9, 20 Price, M.R., 64,84 Priefer, U.B., 9, 20 Prillinger, H., 31, 51 Prosser, J.I., 125 137, 138, 140, 141, 142, 143,144, 147, 157, 161, 162, 163, 171, 172, 173, 174, 177, 179, 180, 181 Prosser, J.L., 143, 180 Puccetti, P., 64,71,84 Puchkova, L.I., 110,122 Puglishi, P.P. 29,34,50 Puglisi, P.P., 41,50, 51 Piihler, A., 9, 18,20.22 Puig, J., 185, 190, 192,209, 214,219, 234 Puiseux-Dao, S., 111, 120 Puri, M., 75,84 Putnam-Evans, C., 198, 199,237
Q Quastel, J.H., 147, 161, 179 Quatrano, R.S., 106, 116, 117,121 Quinlan, A.B., 158, 180
R Rachlin, E.M., 61,87 Radwan, S.S., 72,85 Raeside, J.M., 73,87
25 1
AUTHOR INDEX
Rai, Y.P., 59,75,77,84,86,87 Raibaud, O., 230,237 Raikov, I.B., 32,51 Ram, S.P., 59.87 Ramos, J.R., 14,22 Randhawa, G.S., 18,20 Rapport, E., 34,51 Raven, J.A., 3,22 Ray, T.L., 71,72,87 Reh, M., 186,233 Reiner, J.M., 47,51 Reiners, W.A., 159, 160, 181 Reiss, E., 57,86 Reiss, H.D., 116, 122 Reissig, J.L., 98, 108, 122 Reiter, W.D., 184,186, 187,217,235 Reizenstein, P., 69,87 Remade, J., 142, 144, 168, 180 Ren, Y.L., 226,237 Renaud, J., 25,51 Renwrantz, L., 136, 179 Revzin, A., 226,237 Rho, J., 167, 180 Rhoads, D.D., 56, 57, 87 Ribbons, D.W., 185,237 Rice, E.L., 170, 180 Rice, P.W., 226,236 Richards, R.L., 6,20 Richmond, P.A., 110, 122 Riggsby, W.S., 54,78, 80,86,87 Rikkerink, E.H., 56,57,80,85,87 Rimsky, S., 226,233 Rinehimer, L.A., 188,238 Riordan, J.G., 201,237 Risen, L., 65,66,67,88 Ritchie, G.A.F., 152, 180 Roberts, G.P., 7, 8, 21,22 Robertson, G.P., 156, 180 Robertson, L.A., 156, 168, 169, 179, 180 Robinson, K.R., 94, 105, 106, 107, 109, 114, 116, 117,118, 120, 121, 122 Robson, R.L., 7 , 9 , 14, 16, 18, 19,20, 22 Rodgers, G.A., 159, 160, 170, 173, 177,180,181 Rodriguez, J.F., 190, 236 Rodriguez, R.L., 193,205, 218,219, 220,221,236 Rogers, A.L., 56,72,78,85,87,88 Rogers, J.D., 45,51 Rogers, T.J., 68,87
Roitt, I.M., 70, 87 Romain, P.L., 69,86 Roman, H., 25,51 Romana, L.K., 73,77,88 Romeo, T., 183 219,220,221,222, 223,224,225, 226,227,229,230, 231,232,237 Rosenbluh, A., 58,87 Rosenfeld, P.J., 223, 235 Rossen, L., 15,21 Rossi, C., 38, 51 Rossi, J.H., 42, 50 Rossman, M.G., 201,233 Rosswall, T., 155, 179 Rosswell, T., 2,20 Roth, R . , 25,51 Roth, W.G., 226,235 Rothstein, R.J., 47, 51 Rozich, A.F., 140, 178 Ruchel, R., 72,73,87 Rudd, K.E., 227,228,231,233,237 Rudert, M., 154,155,178 Rummel, S . , 6,21 Rump, A., 9 , 2 0 Runswick, M.J., 202,235 Russ, M.A., 156, 179 Russell, I., 24, 48 Russell, J.D., 163, 177 Russell, P.J., 61,87 Rydel, T.J., 202,236 Ryder, K.S., 6,22 Ryley, J.F., 73, 84
S Sabraw, A., 190, 192,236,237 Sachsenheimer, W., 201,236 Saddler, H.D.N., 111, 122 Sahrawat, K.L., 169, 180 Saijo, Y., 150, 181 Saito, T., 40, 51 Saleh, F., 31,49 Salvas, P.L., 171, 180 Samaranayake, L.P., 73,87 Sameluck, F., 128,177,179,181 Samson, P.C., 91,120 Sanchez-Medina, G., 190, 192, 209, 234 Sand, W., 128,177, 179,181 Sandakhchiev, L.S., 110,122 Sandan, T., 107,109,120 Sanders, D., 107,121
252
AUTHOR INDEX
Sandin, R.L., 72,87 Sandler, L., 33,48 Sando, N., 24,40,51,52 Sands, S.M., 25,51 Santero, E., 12,20 Sarachek, A., 56,57,87 Sarma, T.A., 185, 186,237 Sarubbi, E., 227,228,237 Satina, S., 35,51 Saura, A,, 27, 33,45,50,52 Saxton, C.A., 186, 187, 188,238 Scarborough, G.A., 102,122 Schechter, A,, 71, 72,87 Scheffer, R., 99,122 Scheffey, C., 91, 112, 122 Scheld, W.M., 72,84 Schell, J., 13,22 Scherer, S., 78,80,87 Schild. D., 25,35,47,51 Schimel, J.P., 168, 180 Schirmer, R.H., 201,236 Schlegel, H.G., 186, 233 Schlief, R., 226, 237 Schliwa, M., 114, 120 Schlosser, R.U., 153, 181 Schmid, J., 101, 102, 116, 117,122 Schmidt, E.L., 135,137,138,141, 142, 156, 160, 161, 165, 171, 177, 178 Schnierer, S., 41,51 Schon, G., 141,149,180 Schreurs, W.J.A., 97,98, 99, 100, 115, 121,122 Schultz, R., 41,51 Schulz, G.E., 201,204,236,237 Schurman, D.J., 71,86 Schwartz, M., 190,214,219,226,237 Schwarzhoff, R.H., 56,57,87 Schweizer, H., 220,237 Segal, E., 71, 72, 74,86,87 Segel, I.H., 185, 186, 189, 190,234, 237 Sei, K., 227,235 Shah, V.K., 6,7,21,22 Shanblatt, S.H., 226,237 Sharma, B., 150, 180 Sharp, P.A., 221, 233 Shaw, D.H., 186,237 Shears, J.H., 149, 180 Shen, L., 189, 191, 197,236,237 Shepherd, M.G., 53,54,57,59,60, 61, 64,71, 73,75,77,84,85, 87,88
Shilo, B., 40,51 Shilo, V., 40,51 Shilov, A.E., 6,21 Shimokawa, O., 63,72,87,88 Shimuzu, K., 73, 86,88 Shirmer, R.H., 204,237 Shulman, R.G., 43,48 Sibaoka, T., 112, 122 Sibold, L., 12,22 Sigal, N., 185,186, 189,190, 192,209, 234,237 Silhavy, T.J., 225, 237 Simchen, G., 39,40,50,51 Simonetti, N., 59,88 Simpkin, K.G., 56,88 Sindrup, J., 69,87 Singer, R.A., 40, 50 Singh, B.R., 61,75,77,80,84,87,88 Singhman, H., 69,86 Sirevag, R., 186,237 Skinner, F.A., 138, 142, 180 Skorko, R., 184,186, 187,217,235 Skorupska, A., 18,20 Skujins, J.J., 161, 179 Slayman, C.L., 94,98, 101, 102, 113, 116,122 Slayman, C.W., 101, 102, 113,116, 122 Slock, J.A., 185, 186, 187,237 Slutsky, B., 65,66,67,88 Smail, E.H., 62,74,88 Small, C.B., 69, 86 Smiley, I.E., 201,233 Smith, C.L., 57,88 Smith, A.J., 135, 180 Smith, B.E., 7,20,21 Smith, C.B., 68,88 Smith, F.A., 107,110, 121, 123 Smith, J.D., 43,49 Smith, M., 205,212,238 Smith, R.W., 15,22 Snell, R.G., 57,88 Snipes, G.J., 91, 120 Snyder, T.L., 186, 187,236 Sobczak, J.A., 24,48 Sobel, J.D., 64,71,88 Sogin, M., 96, 104, 121 Sogin, S.J., 54, 55, 87 Soll, D.R., 53,57,59,60,61,62,63, 65,66,67,74,78,80,84,85,86,88 Soost, R.K., 35,49 Sora, S., 38,47,51
253
AUTHOR INDEX
Soroka, A., 71,72,87 Souillard, N., 12,22 Sparling, R., 9,20 Spassky, A., 226,233 Spearman, T.N., 190,235 Speksnijder, J.E., 107,122 Spiegelman, S . , 47,51 Spigland, I., 69,86 Sprent, J.I., 2,3,22 Squires, M.J., 186,237 Srinath, E.G., 140,177 Srivastava, P.K., 24,51 Stackebrandt, E., 12,21,129,181 Staebell, M., 60,65,66,67,88 Stahly, D.P., 185,186, 187,237 Stalmans, W., 189,238 Stams, F.J.M., 186,238 Stanier, R.Y., 186,238 Starmer, W.T., 43,45,51,52 Stebbins, G.L., 27,33,43,44,45,52 Steed, J.R., 54,55,87 Steiner, K.E., 185,186,189,190,192,
238
Steinmuller, W., 136,180 Sternheim, W.L., 224,234 Stevens, D.A., 78,80,87 Stevens, S.E., 18,22 Stevenson, H.J.R., 186,235 Stewart, G.G., 24,45,48,52 Stosch, H.A.V., 32,49 Straat, B.A., 170,180 Stradine, G.A., 186,238 Stragier, P., 218,234 Strange, R.E., 184,185,186,187,238 Strasdine, G.A., 185, 186,187,238 Strickland, J.D.H., 141,177 Strippoli, V., 59,88 Strockbine, N.A., 63,77,88 Strominger, J.L., 186,234 Stroo, H.F., 168,180 Strunnikov, V.A., 28,46,52 Stump, R.F., 94,118,122 Subcommitee on Zinc(1979), 38,52 Sughrue, M.J,, 224,234 Sullivan, P.A., 53,54,57,59,60,61,
73,75,77,84,85, 87.88
Sundermeyer, H., 136,179 Sundermeyer-Klinger, H., 133,153,
180
Sundstrom, P.M. 62,63,74,80,88 Suomalainen, E., 27,33,45,52
Susuki, I. 144,180 Suto, T.,40,52 Suzuki, I., 130, 144,145,159,180 Suzuki, T., 54,55,56,88 Svensson, B.H., 155,179 Swank, W.T., 155, 178 Swartz, M., 230,237 Swift, H., 109,112,121
T Taafe, L.R., 152,178 Tabaqchali, S.,63,75,86 Tabor, E.C.,186,235 Tagaya M., 220,229,231,238 Taguchi, M., 226,238 Taiz, L., 110,122 Takeuchi, E., 220,229,231,238 Takeuchi, Y., 101,102,117,122 Takeya, K.,69,88 Tal, S.,17,21 Talarmin, J., 6,22 Tanaka, H., 152,180 Tanaka, K., 54,55,73,86,88 Tanaka, T., 205,206,208,235 Tanaka, Y., 133,153,180 Tanner, R.S., 129,181 Tanzer, J.M., 187,188,233,238 Tassi, F., 41,50 Taxman, T.L., 224,234 Taylor, B.F., 171,180 Taylor, S.S.,200,201,202,233,235 Tedeschi, F.,29,34,41,50 Tegeler, R., 72,73,87 Telfer, W.H., 116,123 Tellefson, L.M., 73,85 Tempest, D.W., 187,238 Tepper, B.S., 186,233 Terawaki, Y.,186,235 Terry, K.R., 132,149,150,170,178 Thiel, R., 98,99,100,122 Thomas, D.D.S., 99,121 Thompson, N.E., 230,235 Thony, B., 12,21 Thorneley, R.N.F., 7,8,18,20,22 Tieber, V.L., 226,235 Tiedje, J.M., 156,180 Tingle, M.A., 24,50 Tjian, R., 223,235 Tokunaga, M., 80,86 Topp, E., 171,180
254
AUTHOR INDEX
Torosantucci, A., 59,64,77,88 Torres-Bauza, L.J., 54,87 Tortoledo, M.E., 68,86 Toukdarien, A., 12,20,21 Towe, K.M., 3,22 Townes, T.M., 54,87 Tremaine, J.H., 24,52 Trew, B.J., 41,52 Trinci, A.P.J., 98, 122 Troelstra, S.R., 168, 181 Tronchin, G., 72,74,88 Trost, M., 72,73,87 Troxell, C.L., 112, 122 Truper, H.G., 186,236 Tsay, E.Y.H., 57,85 Tulinsky, A., 202, 236 Turian, G., 102, 122 Tzagoloff, A . , 38,52
U Underhill, S.E., 147, 171, 173, 174, 180,181 Unger, J.M., 224,234 Unger, M.W., 39,52 Urbanowski, J., 224,226,238 Uyenoyama, M.K., 44,52
V Valdimarsson, H.J., 69, 88 Valois, F.W., 128,136, 152, 153, 156, 178,179,181 Van Boldrick, M., 189, 234 Van Brunt, J., 92,94,121, 122 van den Bus, T., 47,52 van der Dijk, S.J., 168, 181 van Gool, A.D., 144, 180 Van Houte, J., 185, 186, 187, 188,238 Van Laere, A . , 108, 113,122 Van Veen, W.L., 184, 186, 236 Van Wijk, R.,47,52 Vecchiarelli, A , , 64.71, 84 Veenhuis, M., 186,238 in't Veld, O.D., 188, 235 Veramian, E., 226,233 Vernes, A . , 53,63,68,72,74,80,81, 82,85,87,88 Verstraete, W., 140,166, 178, 181 Veslenak, J.M., 78,85 Vespdainen, K., 44,52
Vezinhet, F., 41, 52 Vieira, J . , 212, 238 Vignais, P.M., 15,21 Vinopal. R., 185, 190, 192,216,234 Vismara, D., 70,86 Vitousek, P.M., 159, 160, 181
W Wagstaff, J.E., 25,34,38,52 Wahren, M., 6 , 2 1 Waldorf, A.R., 53, 68, 69, 88 Walker, G.A., 8, 22 Walker, G.J., 189, 190, 238 Walker, G.M., 59.88 Walker, J.E., 202,235 Walker, N., 138, 142, 160, 177, 180, 181 Walker, N.A., 107, 110, 123 Wallis, J . , 227, 235 Walmsley, J., 12,20 Walsby, A.E., 92, 121 Walsh, D.A., 184, 189, 190, 191, 192, 193,197,209,217,218,221,236 Wang, H.T., 40,47,52 Ward, B.B., 130, 131, 132, 145, 146, 149, 150, 151, 156, 181 Warninghoff, B . , 133, 153,180 Wasserbauer, R., 127, 181 Watanakunakorn, C . , 69,86 Waterbury, J.B., 128, 136, 153,181 Watson, S.E., 153, 156, 179 Watson, S.W., 128, 136, 152, 153, 157, 178, 181 Weathersbee, C.J.. 190, 234 Weber, D.A., 56,57,87 Weber, D.F., 159, 181 Weber, W., 32,49 Webster, C.,78,84 Weenk, G.H., 186,238 Weir-Thompson, E.M., 41,52 Weisburg, W.G., 129. 181 Weisenseel, M.H., 91,96,97,99, 101, 104, 107, 110, 111, 117,120,121, 122,123 Wells, R.S., 69, 88 Welsch, J.A., 61,87 Wessbach, H., 224,226,238 Wessels, J.G.H., 108, 114, 120 West, L.F., 47,51 Wezernak, C.T., 141,181
255
AUTHOR INDEX
Wheeler, P.R., 61,85 Whelan, W.J., 190,236 Whelan, W.L., 54,55,56,57, 78,80, 85,88
Whitaker, D.M., 109, 123 White, M.J.D., 28,29, 52 White, R.E., 140, 156, 165, 178 Whyte, J.N.C., 186,238 Wickramasinghe, K.N., 159, 160, 181 Wikswo, J.P., 91, 120 Wilderer, P.A., 155, 177 Wilkins, R.J., 57, 88 Wilkinson, J.F., 188, 238 Williams, C.L., 75, 88 Williams, G.C., 44, 52 Williams, J.D., 78, 84 Williamson, R.E., 118, 123 Wills, J.W., 54, 87 Wilson, I.M., 31,50 Wilson, R.G., 73,84 Winchester, R.J., 69.86 Winkler, H., 26, 33, 36, 52 Wita, B., 71,86 Wober, G., 187. 190,235,236,238 Woese, C.R., 129,181 Wofsy, S.C., 146, 152, 153, 156,178, 179 Wolfinger, E.D., 7 , 9 , 2 0 Wolters, B., 128, 177, 179, 181 Wong, B., 15,21 Wong, P., 227,235 Wong, P.-K., 227,235 Wood, J.W,., 106, 116, 120 Wood, N.C., 61,88 Wood, P.M., 129, 130, 132, 133, 134, 139, 149, 158, 167, 178, 180, 181 Woodiel, F.N., 188, 238 Woodley, P., 7,20 Woodruff, R.I., 116, 123 Wright, J.F., 41, 52
Wynne, M.J., 32,49
Y Yahalom, E . , 17,21 Yamada, T., 73,84 Yamamura, M., 69,88 Yamanaka, T., 133,153, 180 Yanagida, M., 26,30, 34,51,57,88 Yanagita, T., 40, 52 Yarrow, D . , 80,86 Yates, M.G., 8, 14, 16, 19, 22 Yoshida, N., 153, 181 Yoshioka, T., 150, 181 Youatt, J., 100, 101, 108, 113, 115, 118, 120, 123 Young, T.W., 43,52 Yu, F., 220,229,231, 238 Yukishage, M., 156, 179 Yung, S.G., 184, 190, 192, 193, 195, 197, 198,209,219,221,237, 238
Z Zablen, L.B., 129, 181 Zadak, Z., 127, 181 Zafiriou, O.C., 153, 156, 179, 181 Zamir, A., 13,22 Zawin, M., 69,85 Zennaro, E., 41,51 Zeuthen, M.L., 63,64,85 Zevenhuizen, L.P.T.M., 184, 185, 186, 189,236,238 Zilberstein, A., 13, 22 Zillig, W., 184, 186, 187,217, 235 Zinder, S.H., 9 , 2 1 Zoller, M.J., 205,212,238 Zuber, M., 15,21 Zumft, W.G., 14, 15, 19,20 Zweibel, S.M., 63,77,88
This Page Intentionally Left Blank
Subject Index A Absidia cylindrospora, 168 Acetabularia, ionic currents in, 93, 110111, 115 growth without ionic currents, 111, 115 inward, at rhizoid, 110 Acetate, Nitrosococcus mobilis growth inhibition, 135 Acetylene, ammonia oxidation inhibition, 130, 168, 170 Acetylene test, non-Mo-nitrogenase, 9, 19 N-Acetylglucosamine, in adherence of C. albicans to host cells, 72 metabolic enzymes, 75,77,80 transport and metabolism by C . albicans, 75-76 N-Acetylglucosaminidase (chitobiase) , 73 N-Acetylmannosamine(ManNAc), 75, 77 Achlya bisexualis, 96-99, 113, 116 Achlya, ionic currents in, 93,96100 amino acid-proton symport model, 95, 98, 117 antheridial branches and, 100 applied voltage and ion gradients, 113,116 differentiation and, 99-100 growth and, 93,9699, 115 inward, branching stimulation, 97, 98-99 inward and outward, 96-97
nutrient uptake and, 99, 118 plasma-membrane proton ATPase, 98,99 protons in, 97-99 sexual differentiation, 100 Acid proteinase, secreted by C. albicans, 73 Acid rain, 127, 155 Actin, in buds and hyphae of C . albicans, 60-61 calcium ions and cytoplasmic movement, 117, 118 Activated sludge systems, 149 ADE2 gene, cloning, 58 Adenylic acid, 204 ADPglucose pathway, 189, 191 activators and inhibitors, 191, 192193 fructose 2,6-bisphosphate as activator, 191, 192-193, 196, 199 pyrophosporolysis, mutant vs. wildtype enzyme, 207 reactions, 189 regulation, 191-193 mutants, activation and inhibition importance, 192-193 site at ADPglucose pyrophosphoryiase step, 191-192 ADPglucose pyrophosphorylase, 189, 193-196 activator, 191, 192, 196, 197, 199 affinity, 197, 198 affinity, changed by single-site mutation, 208 inhibitor, substrate binding sites
257
258
SUBJECT INDEX
ADPglucose pyrophosphorylase-cont. overlap, 203-204,205,208 Rhodospirillum spp, 195 specificity, 191, 192, 195-196 activator site, 196 arginine residues, 197 chemical modification, 196-199 cysteine in R. sphaeroides, 198 E.coli, 195, 196197,199 in, 197 Rhodopseudornonas sphaeroides, 197-198 sequences comparison, E. coli and spinach leaf, 198-199 spinach leaf, 196, 198-199 amino-terminal sequences, 194, 195, 197 characterization, 193-217 E.coli allosteric mutant, 192,209217 activator affinity and accumulation relationship, 192, 197,209-210 changes (residues 296,336), effects, 211-216 cloning, 209-214 gene, see glgC gene; Glycogen gene inhibition by AMP, 191, 192 single-site mutation effect, 208 inhibitor, 191,203 affinity in E. coli mutants, 192, 210 sensitivity modulated by activator, 205 inhibitor binding site, 196 AMP, 203,208 chemical modification, 203-205 Lys3' in, 203,204,205 muta enesis, 208 Tyr'" in, 203,204,208 kinetic constants, double mutant expressed in plasmids, 214,215 wild-type vs. mutant 618,214-215 wild-type vs. Phe'I4 mutant, 206, 207 mutagenesis, double allosteric mutants, 211-215 functional amino acids in binding, 205-217 oligonucleotide directed Tyr' l 4 to Phe114,205-209
single allosteric mutations, 216 reductive phosphopyridoxylation, 196, 198, 199 sequence homology and differences, E.co1i and S. typhirnuriurn, 194, 195 sequences, 193-195 spinach leaf, 196 activators, 198, 199 subunits, 199 substrate, 200 affinity lowered by single-site mutation, 206-208 binding, amino acids functional in, 205-217 protection from reductive phosphopyridoxylation, 200,202 substrate binding site, 193, 199-204 8-azido- ADPglucose incorporation, 200-201 arginine residue in, 202 LyslY5in, 202,204 predicted secondary structure, 201. 202,204 tertiary structure, 202 Tyr114in, 201, 204 synthesis increased, by CAMPand CAMP-receptor protein, 224 bylgPpPP9 226 Tyr site, 201,203,204,208 regulation of substratelinhibitorl activator interaction, 205 ADPglucose-specific glycogen synthase, see Glycogen synthase Adventitious embryony, 27 Agamospermy, 27 Agricultural soil, autotrophic nitrification, 168 Agriculture, apomixis, applications of, 46 biological nitrogen fixation and, 4, 12 Alcaligenes, 167 Algae, apomixis in, 32-33 ionic currents in, 93,95, 105-112 applied electrical fields1 ionophores, 113-114 Allomyces, apomixis in, 30
SUBJECT INDEX
ionic currents in, 93, 1010-1101 inward, at rhizoid, 100 nutrient uptake and, 101, 118 outward, at hyphal tip, 100-101, 115 reversal of, growth despite, 101, 115 Allornyces rnacrogynus, 100-101, 118 Amino acid-proton symport model in Achlya, 95,98 Amino acids, chemotropism in Achlya, 99 Aminosugar metabolism, in C. albicans, 75-77 Ammonia, concentrations, in liquid cultures of nitrifying bacteria, 136-137 in marine environments, 127 diazotroph response to, 14 free, inhibition of ammonia oxidation, 140 pools of, 163 transport, 143, 145, 158 Ammonia mono-oxygenase, 130, 145 destruction by ultraviolet light, 149 inhibitors, 130, 168, 170 chelation mechanism, 170-171 methane mono-oxygenase similarity, 130 saturation constant(K,), 145 Ammonia oxidation, 130-133 in acid soils, mechanisms, 163-164 after release of ammonium ion into liquid medium, 162-163 high oxygen concentration effects, 148 inhibitors, 169, 170-171 acetylene, 130, 168, 170 nitrous oxide, 139-140,140,159 see also Nitrapyrin light inhibition, 149-150 low oxygen concentration effects, 150-151 pH effect on, 158 stimulation by low concentrations of nitrification inhibitors, 173 substrate inhibition, 140 surface-associated, 162-163 Ammonia oxidizers, 125-126, 128-129
259
accumulation above nitrite oxidizers in biofilms, 152, 155 ammonia production for, by nitrite oxidizers, 155 ammonia transport, 143, 145 pH effect, 158 assimilation of organic compounds, 135,175 cell activity, 142-143 existence of acidophilic strains?, 160 heterotrophic growth not observed, 135 heterotrophs with, effect on growth, 135, 165 inhibition, mechanisms, 170-171 isolation from acid soils, 160 maximum specific growth rate, 137, 138 in micro-enivronments, clusters per gram of soil, 164, 165 mixotrophic growth, 135 nitrification in acid soils/conditions, 163-164 nitrite reduction, 152-153, 176 optimum pH and ammonium concentration, 158-159 photo-inhibition and recovery from, 149,150 pH range, 157 saturation constants for activity and growth, 143-146 substrate inhibition, 139, 140 thermodynamic efficiency, 134 urease activity, 165-166, 168, 176 yield and maintenance coefficients, 140, 141 see also Nitrification; Nitrifying bacteria; Nitrosomonas Ammonia-treated vermiculite(ATV), 163 Ammonium ion excretion, by Achlya bisexualis, 98 Ammonium sulphate, apomictic phenotype modification, 37 Amoeba proteus, ionic currents in, 93, 102-103 steady and spontaneous, possible functions, 102-103 AMP, ADPglucose pyrophosphorylase inhibition, 191,203
260
SUBJECT INDEX
AMP, ADPglucose-cont. activator and substrate modulating, 205 double-mutant, 215 reductive phosphopyridoxylation prevention, 196 Amphimixis, 26, 28 Amphotericin B, 78,79 Amylomaltase, 190 Amylosucrase, 189, 190 Anabaena, failure to detect ionic currents, 92 glycogen accumulation, 185 Anion-exchange column, Nitrobacter growth, 147, 148, 161, 162 Antheridial, 100 Anti-actin antibodies, 75 Antifungal agents, 78 Apogamy, 28 Apomictic gene trnsfer, 46 Apomictic parthenogenesis, 27, 28 Apomicticrothallic interconversion, 3536 Apomixis, 23-52 in algae, 32-33 applications, 46, 4647 in ascomycetes and basidiomycetes, 30-3 1 culture conditions affecting, 24,3739,39,43 definitions, 26, 26-28, 29 diploid, 30,31-32 ecology, 43-45,45 environmental modification, 3 6 3 9 in eukaryotic micro-organisms, 29-33 facultative, 29,36, 44 nucleomitochondrial interactions, 41-42 frequency, value and significance, 4445,46 in fungi, 30-31 terminology, 28,29 gametophytic, 27 haploid, 29-30, 31 induction of, conditions favouring, 38 influence of cell cycle stage (age), 24, 40.43 meaning and terminology, development of, 26-29,48 meiosis I1 before meiosis I complete, 34,35,39
meiosis control, timing of events, 3941 origins of, 36 in plants, 26-27, 35 in Protozoa, 32 resistance to environmental stress, 4243,45 in rotifers, 32 in silkworms, 46 in slime moulds, 31-32,35-36 in yeasts, 23,25-26,28 ecology, 4245 inheritance, 33-36 in zoology, terminology and definitions, 27 see also individual yeast strains; Sporulation Aquatic environments, ammonia concentrations, 127 ara genes, 226 Archaebacteria, 12, 17 Arfhrobacter, 167 Ascomycetes, apomixis in, 30 Ascospores, formation, 23,24-25,33 yeast, low wall permeability and hydrophobic surface, 43 see also Ascus; Sporulation Ascus, spore number, 23-24 two-spored, 24 diploid, 25,40 factors influencing, 24 haploid with epiplasmic nuclei, 24 influence of cell cycle stage(age), 24,40,43 prerequisites for development, 24, 40 see also Apomixis; Sporulation asd gene, 219,229 Asexual reproduction in yeasts, advantages and disadvantages, 44 ATP, substrate in ADPglucose pathway, 191 ATPase, plasma-membrane proton, in Achlya, 97,98 Automixis, 28,30 Autonomously replicating sequence(ARS), C. albicans, 58 g-Azido-AMP, inhibitor of ADPglucose pyrophosphorylase, 203-204,205
SUBJECT INDEX
8-Azido-ATP, 200 Azospirillum, 17 Azotobacter chroococcum, 12 Hup- mutants, 16 Azotobacter paspali, 17 Azotobacter vinelandii, 9, 12
B Bacteroid, 15 BAPTA buffer, 107 Basidiomycetes, apomixis in, 31 Berkland process, 6 Bicarbonate uptake by Chara, 95, 107, 110 Biofilm, nitrifying bacteria in, 148, 150, 164 effect of pH on, 162 as micro-environment, 164 nitrite oxidizers beneath ammonia oxidizers in, 152, 155 nitrite production and removal, 154, 155 Biomass, nitrifying bacteria, 137, 139 activity, 142-143 specific rate of biomass formation, 139 yield on ammonia and nitrite, 141 Blastocladiella. ionic currents in, 93-96, 118 membrane potential, 94 proton leakage and rhizoid formation/growth, 94,95-96, 118 Blastospores, C. albicans, 58 monoclonal antibodies, 74 Brudyrhizobium japonicum, 16 Branching enzyme, in glycogen synthesis, 189 accumulation in E. coli mutant AC70R1,231 characterization, 218 gene cloning, 218 Bromopyruvate, 197
C Ca(I1)-calmodulin, in morphogenesis of C. albicans, 61-62 Caffeine, apomictic process induced by, 38,47
261
Calcium, channels and pumps in Paramecium, 103-104 currents, in desmids, 112 microfilaments, polarity and tip growth relationship, 118 in Noctiluca, 112 in slime moulds, 104-105 for germination and tip growth but not cell polarity, 117, 118 hyphal extension in Neurospora, 102, 117 influx, in fucoid eggs, 95, 1 6 1 0 7 , 117 removal in Blastocladiella, aberrant growth, 94 r61e in cytoplasmic movement and exocytosis, 117-1 18 Calcium buffers, micro-injected, 107 Calcium carbonate, in Chara and Nitella, 107, 110 Calcium ionophores, 108-109 branching stimulation in Neurospora and Achlya, 98-99 galvanotaxis and, 114 migration in slime moulds, 105 wall deposition in Micrasterias, 112 Calmodulin, morphogenesis control in C. albicans, 61-62 Candida albicans, 53-88 adherence to host cells, 71-72 cell-surface antigens, 74 secretory proteinase and, 73 adherence-negative mutants, 72 auxotrophs, 54,56-57,80 cell-surface antigens, 62,63 in vivo expression in candidiasis, 74-75 monoclonal antibodies against, 7475 variations in, 80,81,82 colony morphology switching, 65-67, 82, 83 frequency and number of changes, 67 master control gene, 62,67, 83 r6le in pathogenesis, 67 rough-colony mutants, 63-64.65, 72 as commensal, 68,83 cure of infections, 77-79
262
SUBJECT INDEX
Candida albicans-cont. diagnosis, monoclonal antibodies in, 74,75,77 DNA restriction fragment pattern, 80 5-fluorocytosine-resistant, 78 genetics, 54-58 autonomously replicating sequence(ARS), 58 chromosome loss induction, 56 chromosome number, 57 cloning of genes, 57-58 differential gene expression, 62, 83 DNA content, 54,56 gene-disruption and transformation techniques, 58, 82 gene map and linkage analysis, 57 mitotic recombination, 54, 55, 56 molecular, 57-58 parasexual analysis, 56-57 ploidy, 54-55, 82 ploidy shift, 55 germ-tube formation, 55,59,6041 conditions favouring, 59-60 heterogeneity, 79 high, low and non-responders, 79 mechanisms and associated changes, 60-61 mutants defective, 62,63,64,71, 80 regulation and inhibition, 61-62, 72 specific surface antigens, 63,74 haploid and tetrapoloid strains, 54 hospital-acquired infections, 78 hybrids, instability of, 56 hydrolytic enzymes secreted by, 73 -induced immunity, 70,84 morphogenesis, 58-67 morphology, pathogenesis and, 7173 mutants defective in hypha formation, 62,63,64,71,80 pathogenesis, 67-79 adherence importance, 71-72 aminosugar metabolism, 75-77 causes of infections, 68-77 cell-surface antigens, 74-75 immune system in, 69-70 predisposing factors and host
defense mechanisms, 68-71,83 secretory proteinases importance, 73 superficial, locally invasive and systemic infections, 68 virulence factors, 71-73 protoplast fusion, 56-57 research problems, 54,56,79-82 absence of sexual cycle, 54, 56,79 review articles, 53 rough-colony mutants, 63-64,65,72 secretory proteinase, 72-73 secretory proteinase-defective mutant, 72 species typing, 77-78 white-opaque transition, 65,66, 83 cell-surface antigens, 67,74 cellular basis, 65,67, 83 yeast-to-hypha conversion, 59-65, 83 actin localization, 60-61 cell-surface antigens, 74 cell-wall expansion, 60, 61, 83 commitment and evagination time, 60 inducers, 59-60, 80 invasiveness development, 71 morphogenesis-associated changes, 60-61 morphological variants, 62, 63-65 morphology-related gene products, 62-63 regulation, 61-63 shape of daughter cells, 60 Candida albicans strain 3153A. 65, 66 Candida albicans strain CA2, 71 Candida albicans strain hOG301, 71 Candida albicans strain W0-1,65,66, 67 Candidacidal factors, 69, 84 Candidiasis, 67, 68 cell-surface antigen expression, 7475 cure, 77-79 Carbon, apomictic phenotype modification, 37 metabolism, by nitrifying bacteria, 126, 128, 133-135, 175 source, spore numberlascus, 24,37 yield from nitrification, 141, 142
SUBJECT INDEX
Carbon dioxide, fixation, by nitrifying bacteria, 133134 reduced in ageing cultures, 137 substrate oxidation and, 140-141 uptake by Chara, 95, 107, 110,119 Catabolite repression of sporulation, 37-38,41,47 industrial applications of mutations releasing, 37, 47 Cation-exchange column, Nitrosomonas colonization, 147 cdc 5 and cdc 14 mutants, 35 Cell cycle, G1, arrest, 39,40 number of, apomictic dyad formation, 24,40,43 Cell-division-cycle(CDC)genes, 39 cdc25 and cdc35 genes, 40 cdc 5 and cdc 14 mutants, 35 spol2-1 and spol3-1 mutants defective in, 39,40 Cell-mediated immunity, defective, C. albicans infections, 69, 70 Cell polarity, ionic currents and, 90, 113 in Achlya, indications of, 96-97 applied electrical fields effects, 107, 113-114 calcium currents, microfilaments and tip growth relationship, 118 evidence fodagainst relationship, 106, 114115 in fucoid eggs, 105-107 calcium influx rdle?, 106-107 membrane protein polarization, 114, 116 Cement, corrosion, nitrification r6le in, 127-128 Cerulenin, 72 Chara corallina, ionic currents in, 93, 107,110, 119 Chelators, nitrification inhibitors, 17Q171 Chitin, in yeast-to-hypha conversion of C. albicans, 61 Chitin synthase 61, 114 Chlamydospores, 59,83 Chlorate, 170 Chloride,
263
efflux, in fucoid eggs, 106 uptake by Chara, 95, 107 Chlorite, nitrification inhibition, 170 Chlorpicolinic acid, 171 Chlorpromazine, C. albicans germ-tube formation block, 61 Chlortetracycline(CTC), 106 Chou-Fasman analysis, 201 Chromosomes, C. albicans, 56,57 Clay minerals, ammonia adsorption, effect on nitrification and pH, 162, 163, 176 batch culture of nitrifying bacteria, effect, 146-147 Closterium, ionic currents in, 93, 112 Concanavalin A receptors, 114 ”Conformational protection” syndrome, 14 Conjugation, absence in apomictic strains of yeasts, 25,26 see also Apomixis Consensus sequences, E. coli promotors, 221,222 Corynebacterium, heterotrophic nitrifier with, 167 crp gene, 224,232 Culture conditions, affecting nuclear division timing, 39 apomictic phenotype modification, 24,37-39,43 Culture medium, yeast-to-hypha conversion in C. albicans, 59 cya gene, 224,232 Cyanobacteria, heterocystous, 12, 14 Cyclic AMP(cAMP), effector synthesis, ADPglucose pyrophosphorylase, 224 regulation of glg gene expression, 224226,231 binding site and model, 229, 230 yeast-to-hypha conversion of C. albicans, 61 Cyclic AMP-receptor protein(CRP), inhibition and activation of transcription, 224,226 regulation of glg gene expression, 224226,231 binding site and model, 229, 230 Cytochrome c, 149
264
SUBJECT INDEX
Cytochrome, b-type, 136 Cytosine deaminase, 78
D Dendryphiella salina, 101 Denitrification, 127, 152-157, 156, 176 by ammonia oxidizers, 152-153 ecological implications, 155-156 by nitrite oxidizers, 153-155 Denitrifiers, aerobic, 168-169 interactions with nitrifiers, 155, 156157 Dental caries, 188 Desmids, ionic currents in, 112 Desulfovibrio gigas, 14 Diazotrophs, nif genes in, 10-12 Diazotrophy, eukaryotic, 13 exotic systems, 18-19 initiation, uptake hydrogenase effect 16 new systems, strains, 17-18 physiology, 13-16, 19 psychrophilic, 18 thermophilic, 17, 18 see also Nitrogen fixation: Nitrogenase Dictyostelium, ionic currents in, 104105 Dicyandiamide(DCD), 169 Didymium iridis, 31-32 Dinitrogen, 5 , 6 complexes of transition metals, 5 fixation, see Nitrogen fixation Dintrogenase reductase, 12 nif gene products required, 8, 10 Diploid apomixis, 30, 31-32 Diploid parthenogensis, 28 Diploid two-spored asci, see Apomixis; Ascus; Sporulation Diplospory, 28 DNA, content of C. albicans, 54,56
E Ecological implications, apomixis, 43-45 denitrification, 155-156 diazotrophic systems, 17-19 nitrification, 126-128
Electrical fields, applied, 108-109, 113114,116 in Achyla, effect on hyphal growth, 99 effects on cell polarity, 107, 113-114 electrophoretic distribution of proteins, 114, 116 fucoid eggs, 107, 113 sizes, cell polarity and, 113 Electron transport, in Nitrobacter hamburgenesis, 133, 134 in Nitrosomonas, 132 Electrophoretic redistribution of proteins, 114, 116 Endomycopsis fibuliger ,26,30 Energy, for carbon metabolism in nitrifying bacteria, 134 from ammonia oxidation, 138 from nitrite oxidation, 133, 134, 138 ‘Energy of maintenance’, 188 Energy-storage compounds, 188 glycogen as, 185, 188 Enterobacter aerogenes, survival and glycogen accumulation, 187 Environmental stress, resistance, apomictic strains, 42-43, 45 Erwinia, diazotrophic strains, 17 Erythromycin, yeast meiosis inhibition, 41,42 Escherichia coli, ADPglucose pyrophosphorylase activator sites, 195, 196-197, 199 glgC gene sequencing, 193-195 glycogen accumulation, 184 glycogen accumulation mutants, 192, 209 activator affinity and accumulation relationship, 192, 209-210 allosteric, 209-217 cloning of glgC, 212-214 inhibitor affinity, 210 mutation sites, 211 properties, 209-2 10 glycogen deficient mutants, 185, 187, 192,210 glycogen excess mutants, 216,217, 221 glycogen gene transcription, 221-223 levels in mutants, 221,222 model for regulation, 229
265
SUBJECT INDEX
nifgene transfer, 13 promotors, consensus sequences, 221,222,230 Escherichia coli K12 strain G6MD3, 206,214,219,221 Escherichia coli mutant 618,210,211, 212-213 kinetic constants, 214-215 mutation sites, allosteric properties, 211-216 Escherichia coli mutant AC70R1, binding site for factor, 229 factor, 223, 229 glgC transcripts, levels, 221, 222, 223 regulation of glgC expression, 223 Escherichia cofi mutant CL1136,210, 216 Escherichia coli mutant SG3,221,222 Escherichia coli mutant SG5,210,216 Estuarine environment, oxygen levels, effect on nitrifiers, 152, 156 Ethane, non-Mo-nitrogenase formation, 9 Ethidium bromide, 24 Etridiazol, 169 Eukaryotic diazotrophy , 13 Eutrophication, 127 Evolution, nifgenes, 12-13, 18 Extracellular polymeric substances(EPS), 147-148, 176 possible function, 148, 164, 175
F F-actin, 117, 118 Facultative apomixis, see Apomixis FeMoeo, 6 , 7 Fe-nitrogenase, 6.8, 9, 12 Fermentations, apomictic strain significance, 42,47 Fertilizers, 4, 127 FeVaco, 6 , 7 Flavodoxins, electron donor to nitrogenases, 8 5-Fluorocytosine(SFC), 78,79 Formate, 135 Fructose 1,6-bisphosphate, ADPglucose pyrophosphorylase activation, 191, 192-193, 196, 199 affinity after chemical modification, 197 double-mutant, 214-215
site-directed mutant vs. wild-type, 206,207,208 Fucoid eggs, ionic currents in, 93,95, 105-107 axis formation and fixation, 105-106 calcium influx, evidence forlagainst rBle in polarity, 106-107 polarity and applied electrical fields, 107,113 Fucus,ionic currents in, 93,95, 105107 Fucus serratus, 106 Fungi, apomixis in, 30 ionic currents in, 93-102 applied electrical fields, 108, 113114 see also individual species
G /3-Galactosidase, 223,224,225,227, 228 Galvanotropism, 114 Gametophyte, diploid, 27 Gametophytic apomixis, 27 Gene-disruption techniques, 58,82 Genes, apornictic phenotype, see spoZ2-2 and spol3-1 mutants Candida albicans, cloning of, 57-58 glycogen biosynthetic enzymes, see Glycogen gene; specific glg genes nif, see nifgene Genetic factors, influencing spore numberlascus, 24 Genetics, C. albicans, 54-58 Genetic transformation, C. albicans, 58,82 Germ-tube formation, see Candida albicans Glass-bead columns, nitrifying bacteria growth, 147 Glass slides, nitrifying bacteria growth on, 147-148, 161 gfg,see Glycogen gene; individual glg genes glgA gene, 218,232 characterization, 219-221 restriction map. 205,206 transcription, 230-231
266
SUBJECT INDEX
glgB gene, 232 characterization, 218,219-221 overlap with glgX gene, 229 transcription, 229,230 glgC gene, 232 characterization, 219-221 cis regulatory sites, 223 cloning and sequencing, 193-195 from E. coli allosteric mutants, 210-212 expression increased by ppGpp, 226227 promotor sites, 222,230 restriction map, 205,206 transcription, 230 initiation sites, 221, 222 transcripts in E.coli mutants, 221, 222 see also ADPglucose pyrophosphorylase glgC’-’lac2 gene fusion, 223,224,225, 227,228 glgP gene, 220,231 glgQ gene, 221,232 glgR gene, 232 glgX gene, 220,221,232 overlap with glgB gene, 229 transcription, 229-230 glgY gene, 220,232 location and product, 231 transcription, 230-231 a-l,4-Glucans, 184, 185, 189 enzymes hydrolyzing, 220 formation from sucrose and maltose, 189 Glucosamine(GlcN), metabolism by C. albicans, 77 Glucose, catabolite repression of sporulation, 37-38,41,47 ionic currents and hyphal extension in Neurospora, 102 repression of GlcNAc metabolism in C. albicans, absence of, 75,80 in sporulation medium, apomictic phenotype modification, 37-38 suppression of yeast-to-hypha conversion in C. albicans, 60 Glycogen, 184 as energy source, 185, 188 “excess” mutants, 216, 217, 221
mutants deficient in, 185,187, 192, 210 occurrence in bacteria, 184-188 physiological conditions, 184-185 possible functions, 185, 187-188 species accumulating, 185, 186-187 r6le in survival prolongation, 185, 187,188 synthesis and degradation, dental caries, 188 see also Glycogen synthesis (below) Glycogen gene, characterization, 219-221 cluster, 219-220 fine structure and regulation sites, 229-23 1 factors regulating expression, 221228 cAMP and cAMP receptor protein, 224-226 failure of NtrA and NtrC to, 227 mutations affecting levels, 221-223 ppGpp, 226228,231 regulation, 218-232 sigma factors in, 230 regulatory, products and map location, 232 structural, products and functions, 232 trans-acting regulator binding sites, 229-230 transcription, 22 1-223 regulation, model, 229 see also individual glg genes Glycogen phosphorylase, 190,220 glgY gene, 220,231, 232 Glycogen synthase, 189, 190 antibodies, 217-218 characterization, 2 17-2 18 chemical modification, 217 gene, see glgA gene stimulation by cAMP and CAMPreceptor protein, 224 substrate binding site, 217 synthesis increased by ppGpp, 226 Glycogen synthesis, bacterial, 183-238 ADPglucose pathway, see ADPglucose pathway conditions allowing, 184-185 enzymes, 189-193, 193-218 genes, 193-195
267
SUBJECT lNDEX
see also Glycogen gene levels in stationary phase, 184, 219,231 regulation, 219-232 see also individual enzymes from sucrose or maltose, 189-191 genetic regulation, 218-232 nutrient depletion effect, 184-185, 23 1 physiological interpretations, 231233 rate, inverse correlation with growth rate, 184, 219,231 see also Glycogen GrifJithsia pacifa, ionic currents in, 93, 111, 115
H Haber process, dinitrogen fixation, 3,4 Haploid apomixis, 29-30, 31 Haplospora globosa, 33 Heat shock, chromosome loss in C . albicans, 56 meiosis restoration in apomictic strains, 37, 3940,42 Heat-shock proteins, sporulationspecific, 42 Heterokaryons, 56 Heterotrophic growth, of ammonia oxidizers, 135 of nitrite oxidizers, 135-136, 154, 166, 175 Heterotrophic nitrification, see Nitrification Heterotrophic organisms, ammonia oxidizers with, 135, 165 nitrification rates, 167-168 1,6-Hexanediol bisphosphate, 207 Homocitrate, nifV product, 7 Homothallism, 36 Hormones, C. albicans infections and, 70-7 1 Host defense mechanisms, C. albicans infections, 68 Hup mutants, 16 Hyaline cap formation in amoebae, 103 Hydrazine, 5 Hydrogenase, uptake, 15-16 Hydrophobicity, in adherence of C. albicans to host cells, 72
Hydroxaminic acids, 166 Hydroxylamine, 130,166 compartmentalization, to increase maximum specific growth rate, 138 oxidation to nitrite, 131, 132 Hydroxylamine oxidoreductase, 131, 132
I Illite, 163 Imidazoles, 78 Immune evasion, by C. albicans, 7071,84 Immune system, C. albicans infections, 69,70 Immunity, inherent and C.albicans infections, 69-70 Immunosuppression, C . albicans infections, 69 Inflammation, C . albicans infections, 69 Ionic currents, circulating, 89-123 in algae, 105-1 12 Acetabularia, 93, 110-111, 115 Chara and Nitella, 11,93, 107 fucoid eggs, 93,95, 105-107 Micrasterias and Closterium, 93, 112 Noctiluca, 93, 112 tip-growing species, 93, 111 in amoebic movement, 103 antheridial branches in Achlya, 100 applied voltage and gradients, 107, 108-109,113-114 in bacteria, 92-93 carbon dioxide uptake in algae, 95, 107, 110,119 cell polarity control, see Cell polarity cellular physiology and, 114-119 directional flow, determination, 91, 92 electrical and chemical components, 115 electrophoretic redistribution of proteins, 114, 116 extracellular component, measurement, 90-91 in fungi, 93-102 Achlya, 93,96-99,99-100
268
SUBJECT INDEX
Ionic c u r r e n t s o n t . Allomyces, 100-101 Blastocladiella, 93-96 Neurospora, 101-102 hyphal growth, Achlya, 96-99, 115 Allornyces, outward current, 100, 101,115 calcium-ion gradients, 117 evidence against rale, 99, 102, 115 Neurospora, 102,115 as indicator of movement of ions, 116 ionic composition, determination, 91 measurement, 9&92 migration and differentiation in slime moulds, 105 nutrient entry correlation, 95-96, 101,118-119 in photosynthesis and tip growth, Acetabularia, 111, 115 Polarity development in fucoid eggs, 106-107,113 in protozoa, 93,102-105 amoebae, 93,102-103 ciliates, 93, 103-104 slime moulds, 93, 104-105 rhizoid growth and orientation, see Rhizoids rdle, 90, 114-119 see also Calcium; Cell polarity Ion-selective micro-electrode, 92 Ion-substitution experiments, 91-92 Blastocladiella, 94 in fucoid eggs, 106 Neurospora, 101-102 Iron, nitrogenases based on, 6 , 8 , 9 , 12
K Ketoconazole, 78 Klebsiella pneumoniae, as nif gene donor, 13,18 nifgene regulon, 9-12 nitrogenase, 7, 8
L lac-nif gene fusions, 11, 13 1acZ gene fusion, glgC gene, 223,224, 225,227,228
Lipids, in adherence of C. albicans to host cells, 72 Lipomyces, apomixis in, 26,30 Liposomes, antifungal agent delivery, 79 Lymphokines, 70
M Macrophage, in C. albicans infections, 69-70 Macrophage colony-stimulating factor, 70.84 Magnesium, binding site in ADPglucose pyrophosphorylase, 193 yeast-to-hypha conversion in C. albicans, 59 ma1 genes, 226 Maltodextrin phosphorylase, 190 Maltose, glycogen synthesis from, 189191 Mannan, in mucocutaneous candidiasis, 70 Mannose, in adherence of C. albicans to host cells, 72 Marine environment, nitrifiers, 146 Mating-type loci (MATalMata), 23,25, 33,36 Maximum specific growth rate(u,,,), nitrifying bacteria, 137-139 adaptations to increase, 138-139 benefits in nature, 139 Meiosis, 29, 33 I, without meiosis 11, yeast mutants, 35 11, characteristics, in diploid-spore formation, 34,35 and failure of meiosis I in ovarian turnours, 47 prevention, until after meiosis I in wild-type SP012; SP013 cells, 38,39 suppression, in ovarian tumours, 47 without meiosis I completion in apomixis, 34,35,39 mitochondria1 protein synthesis rdle, 41,42 non-permissive conditions for, 39
269
SUBJECT INDEX
restoration in apomictic strains, conditions favouring, 37-38 heat shock, 37,39-40,42 prevention, mitochondria1 protein synthesis inhibition, 41 protein synthesis inhibition, 38, 39,
40 semipermissive conditions for, 39 timing of events controlling, 39-41 Membrane potential, Blastocladiella, 94 Neurospora crassa, 98, 101 Methane mono-oxygenase, 130 Methane oxidation, 130, 171 Methanotrophs, 130-1,150 Methionine, entry by proton symport in Achlya ,97,98 Methylamine, 145 Methylotrophs, 168 Micrasterias, ionic currents in, 93, 112 Micro-electrodes, 91, 92 Micro-environment, nitrification in acid conditions, 164-166 Microfilaments in hyphal growth, 117118 in Achlya, 96 calcium currents and polarity relationship, 118 Microtubules in hyphal growth, 96, 117-118 Microvesicles, translocation to hyphal apex in Achlya, 96 Mitochondria1 control of meiosis, spol2 and sp01.3 mutants altering, 42 Mitochondrial protein synthesis, inhibition, 41 Mitosis, in yeast, environmental conditions, 43 Mixotrophic growth, 135,136,155 Molybdenum, dinitrogen binding site, 7 Mo-nitrogenase, 7.8 genes, 11-12 temperature/activity relationship, 18 Monoclonal antibodies, C.albicans blastospores, 74 cell-surface antigens of C. albicans, 74,75,77 diagnosis of C. albicans, 74,75,77 sigma factor, 230
Mucosal barrier, to C . albicans, 68 Myxomycetes, see Slime moulds
N Neisseria, glycogen formation from sucrose, 189 Neurospora crassa, ionic currents in, 93,101-102 applied voltages and ion gradients, 113,116 inward, at tip and growth, 101, 115 membrane potential, 98, 101 Neutrophils, phagocytosis of C. albicans, 69,70 Nictosocystis oceanus, effect of oxygen on growth, 148 nif gene, 8,9-12 evolution and genetic manipulation, 12-13,18 expression in eukaryotes, 13 lac-nifgene fusions, 11, 13 lateral transfer, 12-13, 18 nifLA genes, 10, 11 n i p , n i w , n i p , 8,12 n i p - mutants, 7 post-transcriptional regulation, 11, 14 regulation of, 10-11, 12 by fixed nitrogen, 11,14 by ntr gene products, 11,12 by oxygen, 11,14 regulon, 8, 10 transcription, 9, 10 transfer, plasmid-borne, 17-18 nif plasmids, 18 Nitellaflexilus, ionic currents in, 93, 107,110,119 Nitrapyrin, 165,168,169 bacteriostatic and bactericidal effects, 172 mechanism of action, 171 strain variability in sensitivity to, 171-172 Nitrate, losses, leaching and denitrification, 127,169 reduction by nitrite oxidizers, 153155 nitrite oxidoreductase, 133, 153
270
SUBJECT INDEX
Nitric oxide, 127 Nitrification, 156, 166 in acid soils, explanations, 159-169 acidophilic strains, 160-161 micro-environments and urease activity, 164-166 protection by surface growth, 161164 in aquatic environments, light inhibition, 149-150 autotrophic, 125-181 biochemistry, 129-136 ecological and economic importance, 126-128 reactions, 126 taxonomy and species diversity, 128-129 effect of oxygen on, high concentrations, 148-149 low concentrations, 150-152 heterotrophic, 135, 136, 166, 166-169 biochemical pathways, 166-167 by denitrifiers, 169 locations and significance of, 168 rates of, 167-168 inhibition, 169-175 of attached cells, 173-174 mechanism, 170-171 purposes, 169, 170 strain variability, 171-173 mineralization coupled to, 165 pH effect, 157-169, 176 ammonia availability, 158 on maximum specific growth rate, 157-158 photo-inhibition, 149-150 recovery from, 150 Nitrifying bacteria, acidophilic strains existence?, 160 ammonia oxidation, 131-133 batch culture, 137, 138, 142 clay mineral effects, 146-147 biochemistry, 129-136 biomass yields, 142, 143 carbon metabolism by, 126, 128, 133-135,175 carbon yield, 141, 142 cell activity increases with specific growth rate, 143 growth in liquid culture, 136-146 biomass production problem, 146
cell activity, 142-143 changes to increase maximum specific growth rate, 138-139 comparison with surface growth, 161 growth yield, 139-142 maximum specific growth rate, 137-139 saturation constants, 143-146 heterotrophic, 135, 136, 154, 166, 175 interactions with denitrifiers, 155, 156-157 marine environments, substrate affinities, 146 maximum specific growth rate, 137139 increased with decreased size, 139 pH effect on, 157-158 nitrite and nitrate reduction by, 152157 ecological implications, 155-156 see also Denitrification nitrite oxidation, 133, 134 saturation constants, for growth, 143-146 for oxygen, 150, 151 selective pressures, 139 species diversity, 128-129 surface growth, 146-148 glass-bead columns, 147, 161 protection from pH effects, 161164 sensitivity to inhibitors, 174-175 see also Ammonia oxidizers; Nitrite oxidizers; specific species Nitrite, oxidation, 133 energy generation, 133, 134 inhibition in acidic conditions, 139, 140 inhibitors, 170 reduction by ammonia oxidizers, 152-153, 176 transport, 143, 145 Nitrite oxidizers, 126, 129 accumulation beneath ammonia oxidizers in biofilms, 152, 155 acidophilic strains existence?, 160161 cell activity, 142-143
SUBJECT INDEX
heterotrophic growth, 135-136,154, 166, 167, 175 saturation constant for oxygen, 150 inhibition in acidic conditions, 139, 140 low oxygen concentration effects, 150, 151, 152 maximum specific growth rate, 137, 138 methanotrophs with, 150 mixotrophic growth, 136, 155 nitrate reduction by, 153-155 photo-inhibition and recovery from, 149,150 saturation constant for oxygen, 151, 152 saturation constants for activity and growth, 143-146 substrate inhibition, 140, 176 thermodynamic efficiency, 134 yield and maintenance coefficients, 140, 141 see also Nitrification; Nitrifying bacteria; Nitrobacter Nitrite oxidoreductase, 133, 153 Nitrite reductase, 152 Nitrobacter, 126, 129 acidophilic, 160-161 ammonia production by nitrate reduction, 155 anion-exchange column colonization, 147, 148, 161, 162 effect of pH on maximum specific growth rate, 157 high oxygen level inhibition of growth, 148 inhibitors of nitrification, 172, 173 nitrate reduction, 153-154 nitrite oxidation rate in soil vs. liquid culture, 161 photo-inhibition of, 149 surface growth, 147,148,161, 162 Nitrobacteraceae, 128, 129 Nitrobacter agilis , 135 Nitrobacter hamburgensis, electron transport system, 133, 134 heterotrophic growth, 136 RuBisCO, 133 Nitrobacter winograhkyi , 135- 136, 140 Nitrococcus, 129 Nitrogenase ,
27 1
alternative, 9 “biological” ligands, 6 dintrogen binding site, 7 enzymology, 7-9 function, models, 5-6 hyperinduction, 14, 15 oxygen-induced inhibition, 11, 14 protection from oxygen damage, 1314 Nitrogen cycle, 1-2 biological, evolution, 2-3 global, 2 mankind’s intervention, 2 , 3 turnover time, 2 Nitrogen fixation, 1-22 biochemistry, 7-9 biological, 2, 3 chemistry, 5-6 criteria for systems, 17 dinitrogen binding site, 7 ecological aspects, 17-19 evolution and genetic manipulation, 12-13 exploitable systems in, 6 genetics, 9-13 importance, 3 , 4 , 19 man-made systems, 6 need to increase, 3-4 physiology, 13-16, 19 symbioses, 15-16 processes, need for research on, 4-5, 19 research trends, 3-5, 19 see also Diazotrophy Nitrogen starvation, glycogen synthesis rate, 227 Nitrosococcus mobilis, 135 Nitrosococcus oceanus, 130 effect of low oxygen concentrations on, 150-151 pH effects on enzyme activity, 145 Nitrosolobus, 128 Nitrosomonas, 126 electron transport in, 132 Nitrosomonas europaea, 128 amino acid uptake, 135 carbon yield from nitrification, 141 cation-exchange column colonization, 147 co-immobilization with Paracoccus denitrificans, 156-1 57
272
SUBJECT lNDEX
Nitrosomonas europaea--cont. denitrification of nitrite, 153 effect of pH on maximum specific growth rate, 157-158 inhibition by potassium ethyl xanthate, 173, 174 methane and ammonia oxidation, 130 nitrification in acid soils/conditions, 163-164 recovery from photo-inhibition, 150 sensitivity to nitrapyrin, 171, 172, 173 stimulation by low concentrations of nitrapyrin, 173 surface growth, maximum specific growth rate reduction, 147 Nitrosospira, 128 Nitrospira, 129 Nitrospira gracilis, 140 Nitrous acid, 137, 139 ammonia oxidation inhibition, 140, 159 Nitrous oxide, 127 production, ecological implications, 155 production by ammonia oxidizers, 152-153,155 conditions and possible reasons for, 153 proportion of nitrite to, during ammonia oxidizer growth, 153 yield, by ammonia oxidizers, 152, 153 Noctiluca, ionic currents in, 93, 112 Nodulation, gene regulation, 15 Nodule systems, uptake hydrogenases, function, 15-16 NtrA and NtrC proteins, 227 ntr genes, 11, 12 Nuclei, epiplasmic, 24, 25 Nucleolus, in apomixis, 34, 35 Nucleomitochondrial interactions, during sporulation, 38,4142 Nutrient uptake, ionic currents and, 95-96, 101,118-119
0 Oestrogen, C.albicans infections, 7071
Oligonucleotide directed mutagenesis, ADPglucose pyrophosphorylase, 205-209,216 Ovarian tumours, parthenogenetic development, 46-47 Oxygen, diazotroph response to, 11, 14 effect on nitrification, inhibition at high levels, 148-149 low concentrations, 150-152, 156 effect on nitrite reduction by ammonia oxidizers, 153 regulation of nifregulon, 11 saturation constant, 150, 151 sensitivity, nitrogenase, 9 supply to bacteroids, regulation, 15 tolerance in azotobacters, 13-14
P Paracoccus denitr$cans, 156-157 Paramecium, 103-104 Parthenogenesis, 27-28,28 ameiotic, 28 apomictic, 27, 28,47 automictic, 27, 28 diploid, 28 facultative, 29 haploid, 27,28 origins, 36 Pelvetia, ionic currents in, 93,95, 105107 applied electrical fields, cell polarity and, 107, 109,113 PH, ionic currents and hyphal growth in Achlya, 97-98 K, value in ammonia oxidizers, 145 in Neurospora, 102 nitrification, see Nitrification -sensitive micro-electrodes, 97 yeast-to-hypha conversion in C. albicans, 59,6041 Phormidium uncinatum, 92 3-Phosphoglycerate(3PGA), 198, 199 Phospholipases, C. albicans secretion of, 73 Photo-inhibition of nitrification, 149150 Physarum polycephalum, ionic currents in, 93, 104-105
273
SUBJECT INDEX
Physiology, 13 symbioses, 15-16 Plants, apomixis in, 26-27 applications and advantages, 46 inheritance of, 35 Plasmid, C. albicans gene cloning, 57-58 cloning of E. coli mutant ADPglucose pyrophosphorylase, 213-214 nifgene transfer, 17-18 Plasmid pGH9, 213,214 Plasmid pOP12,219 Plasmid pPP101,213,214 Ploidy, C. albicans, 54-55, 82 Poly-p-hydroxybutyrate(PHB), 154 Polyploidy, fungal apomixis and, 45 Polysphondylium violaceum, ionic currents in, 105 Potassium efflux, in Blastocladiella, 94 in Pelvetia, 95, 106 Potassium ethyl xanthate, 170, 173, 174 PPGPP, 231 regulation of glg gene expression, 226-228,231 binding site and model, 229, 230 Presporulation medium, apomictic phenotype modification, 37,39,43 spore numberlascus, 24 Protein phosphorylation, morphogenesis control in C. albicans, 62 Protein synthesis inhibition, meiosis restoration in apomictic strains, 38,39,40 Proton currents, in Achlya, 97-99, 117 amino acid-proton symport model, 95,98 entry and local growth, 98-99 in Blastocladiella rhizoid formation, 94,95-96 influence on enzyme action and exocytosis, 117-118 in Neurospora, 101-102 Protoplast fusion, C. albicans, 56-57 Protozoa, diploid apomixis in, 32 ionic currents in, 93, 102-103
applied electrical fields and ionophores, 109 Pseudohyphae, C. albicans, 58,64,83 Pseudomixis, 28 Pseudomonas, diazotrophic strains, 17 Pseudomycelia, 59 Pseudopods, in amoebae, ionic currents and, 103 Pyridoxal phosphate, 196, 198, 199-200 Pyruvate, ammonia oxidizer growth in presence of heterotrophs, 135 Pyruvic oxime , 167
R relA gene, 226,232 Rhizobiumme systems, 15 Rhizocoenoses, 17 Rhizoids, ionic currents and, formation, in Pelvetia, 105-106, 113 formation site and growth, 94-95 evidence fodagainst r d e , 115 inward, in Acetabularia, 110 in Allomyces, 100, 101 in Blastocladiella, 94, 95 nutrient transport, 95-96,101 orientation, phosphate and amino acids affecting, 94 Rhodopseudomonas sphaeroides, ADPglucose pyrophosphorylase, 195,197-198 Rhodospirillum rubrum, ADPglucose pyrophosphorylase, 195 Rhodospirillum tenue, ADPglucose pyrophosphorylase, 195 Rhodosporidium, 31 Ribulose 1,s-bisphosphate carboxylase oxygenase(RuBisCO), 133, 141 Rotifers, apomixis in, 32 rpoN gene, 11 RuBisCO, 133,141 S Saccharomyces cerevisiae, advantages as experimental organism, 26,47 apomixis in, 23-24,25,36,48 inheritance of, 33-34 strains, 25, 26,48
274
SUBJECT INDEX
Saccharomyces cerevisiae-cont, see also Apomixis; Ascus; Meiosis; specijic strains (below) complementation of mutants, C . albicans genes, 57-58 life cycle, 33, 36 sporulation in, 23-24,33,36 Saccharomyces cerevisiae ATCC4098 strain, 25, 33 Saccharomyces cerevisiae ATCC4117 strain, 25, 33 apomictic dyad formation, 34-35 carbon source effect on tetrad formation, 37,39 meiotic tetrad production on heatshock, 37,39,42 mutations in, 33-34 see also spol2-1 and spol3-1 mutants Saccharomyces cerevisiae strain 19e1, 25,33 meiotic tetrad production on heatshock, 37, 39,42 nuclear division regulation, 40-41 presporulation medium effect on tetrad formation, 37, 39,43 spol2-1 mutation, 33 Saccharomyces pastorianus, sporulation in, 25 Salmonella typhimurium LT2, ADPglucose pyrophosphorylase gene cloning, 212 glgC gene sequencing, 193-195 glycogen accumulation mutants, 192, 210,217 properties, 210 JP23 and JP51 mutants, 210,217 Saturation constants in nitrifying bacteria, for growth and enzyme activity, 143146 for oxygen, 150, 151, 152 Schizophyllum commune, 31, 114 Schizosaccharomyces pombe, meiosis I without meiosis I1 in, 34-35 two-spored asci, 26 Self-diploidization, 36 “Self-sporulation”, 31 Sewage treatment systems, 143 ammonia concentrations, 127, 140
nitrification in, 127, 140 denitrification coupling, 156 inhibitors, 140, 169 Sigma(u) factors, 230,237 consensus sequences of promotors, 222,230 monoclonal antibodies, 230 uS4, 11,222,230 Signal transduction, in C. albicans, 61 Silkworms, apomictic reproduction in, 46 “Single division meiosis”, 29 Skin, barrier to C. albicans infections, 68 Slime moulds, apomictic and sexual reproductive modes alternation, 45 apomixis in, 31,35-36 ionic currents in, 93, 104-105 migration and differentiation, 105 Spinach leaf ADPglucose pyrophosphorylase, 196, 198199 activator, 198, 199 subunits, 199 spol2-1 and spol3-1 mutants, 33-34, 36 apomictic dyad formation in, 34,35, 40 CDC genes defective in, 35,39,40 culture conditions restoring meiosis, 37-39,43 facultative apomictic, 36-37, 4142 meiosis I1 before meiosis I complete, 34,35,39 nucleomitochondrial interactions, 41-42 in origin of apomixis, 36 possible nature of mutations, 39,40, 42 sporulation in presence of erythromycin, 41 sporulation under catabolite repression, 37-38,41 SPO 12 and SPO 13 products, wildtype, prevention of meiosis I1 until meiosis I complete, 38, 39 spol3. cloning, 40,47 SP013, epistatic to SP012,34
275
SUBJECT INDEX
Sporogenesis, glycogen-like polymer accumulation, 185, 187-188 Sporulation, apomixis less demanding than meiotic, 41, 42,43 Blastocladiella, ionic currents and, 94 catabolite repression, 37,41,47 environmental changes to apomictic phenotype, 37-39,39,43 in fungi, 30, 31 glycogen accumulation, 185, 187-188 influence of vegetative cell cycle stage (age), 24,40,43 nucleomitochondrial interactions, 38, 41-42 in S. cerevisiae, 23, 33 spore number/ascus, factors influencing, 23-24,37-39,43 yeast, 23-24, 33,36 see also Apomixis; Ascus; Meiosis Sporulation-specific heat-shock proteins, 42 spo T gene, 232 Streptococcus faecalis, growth without membrane potential, 92-93 Sucrose, glycogen synthesis from, 189191 Survival, glycogen accumulation and, 185,187,188 Symbioses, physiology, 15-16 Synaptonemal complexes, 34 Syzygites megalocarpus, 30
U UDPglucose pyrophosphorylasedeficient mutants, 189 Ultraviolet irradiation, partial hybrids of C. albicans, 56 Uptake hydrogenase, 15-16 URA3 genes, C. albicans, 58 Urea, nitrification stimulation, 165166,176 Urease, activity in ammonia oxidizers, 165-166, 168, 176 Ustilago maydis, apomixis in, 31
V Vaginal fluid, C . albicans secretory proteinase activity, 73 Vaginitis, C. albicans, adherence capacity and, 72 colony morphology switching, 67 Vanadium, nitrogenase based on, 6, 7, 9, 12, 18 in psychrophilic diazotrophs?, 18 Vaucheria terrestris, ionic currents in, 93, 111, 117 Vermiculite, 163 Vibrating calcium electrode, 92 Vibrating probe, 90-91 modifications and refinements, 91 Voltage, applied, 108-109, 113-114 in Achlya and Neurospora, 113,116 Voltage-sensitive micro-electrodes, 91
T T-cells, suppressor factor induced by C. albicans, 70 Temperature, apomictic phenotype modification, 37,43 yeast-to-hypha conversion in C. albicans, 59,80 Teratoma, genesis, 47 Thermophilic diazotrophy, 17, 18 Thiospkaera pantotropha, 168-169 Transition metals, dinitrogen complexes, 5 , 7 Trifluoperazine(TFP), 62 Tungsten, nitrogenase based on, 9,18
W Water moulds, ionic currents in, 93-94, 100-101 White-opaque transition, see Candida albicans
x Xanthates, 170
Y Yeasts, apomixis in, see Apomixis
276
SUBJECT INDEX
vegetative (mitotic) nuclear division, 24,33,43,44 see also individual species
z Zinc, translocation, restoration of meiosis in apomictic strains, 38, 39 in yeast meiosis, 38 Zinc sulphate, effect on apomictic phenotype, 37 Zoospores, Blastocladiella, ionic currents and, 93-94