B Chromosomes In The Eukaryote Genome (Cytogenetic & Genome Research)

Single topic volume B Chromosomes in the Eukaryote Genome Editor Juan Pedro M. Camacho, Granada 107 ﬁgures, 17 in c...

Author: Juan Pedro M. Camacho

68 downloads 822 Views 8MB Size Report

This content was uploaded by our users and we assume good faith they have the permission to share this book. If you own the copyright to this book and it is wrongfully on our website, we offer a simple DMCA procedure to remove your content from our site. Start by pressing the button below!

Report copyright / DMCA form

DOWNLOAD PDF

Single topic volume

B Chromosomes in the Eukaryote Genome

Editor

Juan Pedro M. Camacho, Granada

107 ﬁgures, 17 in color, and 77 tables, 2004

Basel • Freiburg • Paris • London • New York • Bangalore • Bangkok • Singapore • Tokyo • Sydney

Cover illustration DAPI-stained primary spermatocyte of the grasshopper Eyprepocnemis plorans, showing the standard A chromosomes (11 bivalents plus the X univalent) and a brightly stained small B chromosome (on the left).

S. Karger Medical and Scientiﬁc Publishers Basel • Freiburg • Paris • London New York • Bangalore • Bangkok Singapore • Tokyo • Sydney

Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

Drug Dosage The authors and the publisher have exerted every effort to ensure that drug selection and dosage set forth in this text are in accord with current recommendations and practice at the time of publication. However, in view of ongoing research, changes in government regulations, and the constant ﬂow of information relating to drug therapy and drug reactions, the reader is urged to check the package insert for each drug for any change in indications and dosage and for added warnings and precautions. This is particularly important when the recommended agent is a new and/or infrequently employed drug.

All rights reserved. No part of this publication may be translated into other languages, reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, microcopying, or by any information storage and retrieval system, without permission in writing from the publisher or, in the case of photocopying, direct payment of a speciﬁed fee to the Copyright Clearance Center (see ‘General Information’). © Copyright 2004 by S. Karger AG, P.O. Box, CH–4009 Basel (Switzerland) Printed in Switzerland on acid-free paper by Reinhardt Druck, Basel

Vol. 106, No. 2–4, 2004

Contents

215 B chromosomes in Crustacea Decapoda Coluccia E, Cannas R, Cau A, Deiana AM, Salvadori S

147 Preface Camacho JP

222 Current knowledge on B chromosomes in natural

A Valuable Tool 149 The B chromosome database Jones RN, Díez M 151 The distribution of B chromosomes across species Palestis BG, Trivers R, Burt A, Jones RN

What Are B Chromosomes? 159 Are the dot-like chromosomes in Trinomys iheringi

(Rodentia, Echimyidae) B chromosomes? Fagundes V, Camacho JPM, Yonenaga-Yassuda Y

populations of helminth parasites: a review Špakulová M, Casanova JC 230 B chromosomes in the fish Astyanax scabripinnis

(Characidae, Tetragonopterinae): An overview in natural populations Moreira-Filho O, Galetti Jr. PM, Bertollo LAC 235 Structure and evolution of B chromosomes in

amphibians Green DM 243 Occurrence of B chromosomes in lizards: a review Bertolotto CEV, Pellegrino KCM, Yonenaga-Yassuda Y

165 Human supernumeraries: are they B chromosomes? Fuster C, Rigola MA, Egozcue J

247 B chromosomes in populations of mammals Vujošević M, Blagojević J

173 Is the aneuploid chromosome in an apomictic

257 B chromosomes in Brazilian rodents Silva MJJ, Yonenaga-Yassuda, Y

Boechera holboellii a genuine B chromosome? Sharbel TF, Voigt M-L, Mitchell-Olds T, Kantama L, de Jong H

264 The mammalian model for population studies of

B chromosomes: the wood mouse (Apodemus) Report of New B Chromosomes 184 The occurrence of different Bs in Cestrum intermedium

and C. strigilatum (Solanaceae) evidenced by chromosome banding

Wójcik JM, Wójcik AM, Macholán M, Piálek J, Zima J 271 A complex B chromosome system in the Korean field

mouse, Apodemus peninsulae Kartavtseva IV, Roslik GV

Fregonezi JN, Rocha C, Torezan JMD, Vanzela ALL 189 Distribution and stability of supernumerary

microchromosomes in natural populations of the Amazon molly, Poecilia formosa Lamatsch DK, Nanda I, Schlupp I, Epplen JT, Schmid M, Schartl M 195 B chromosomes in Amazonian cichlid species Feldberg E, Porto JIR, Alves-Brinn MN, Mendonça MNC, Benzaquem DC

Review on B Chromosomes 199 The B chromosomes in Brachycome Leach CR, Houben A, Timmis JN 210 B chromosomes in Sternorrhyncha (Hemiptera, Insecta) Maryañska-Nadachowska A

Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

Structure and Origin of B Chromosomes 279 A RAPD marker associated with B chromosomes in

Partamona helleri (Hymenoptera, Apidae) Tosta VC, Fernandes-Salomão TM, Tavares MG, Pompolo SG, Barros EG, Campos LAO 284 Comparative FISH analysis of distribution of B

chromosome repetitive DNA in A and B chromosomes in two subspecies of Podisma sapporensis (Orthoptera, Acrididae) Bugrov AG, Karamysheva TV, Rubtsov DN, Andreenkova OV, Rubtsov NB

Population Dynamics and Evolution of B Chromosomes

289 Comparative analysis of micro and macro

B chromosomes in the Korean field mouse Apodemus peninsulae (Rodentia, Murinae) performed by chromosome microdissection and FISH

351 Cytogeography and the evolutionary significance of

Rubtsov NB, Karamysheva TV, Andreenkova OV, Bochkaerev MN, Kartavtseva IV, Roslik GV, Borissov YM

B chromosomes in relation to inverted rearrangements in a grasshopper species Colombo P, Confalonieri V 359 Mitotically unstable B chromosome polymorphism in

295 FISH detection of ribosomal cistrons and

the grasshopper Dichroplus elongatus

assortment-distortion for X and B chromosomes in Dichroplus pratensis (Acrididae)

Remis MI, Vilardi JC

Bidau CJ, Rosato M, Martí DA

365 Geographic and seasonal variations of the number of

B chromosomes and external morphology in Psathyropus tenuipes (Arachnida: Opiliones)

302 X and B chromosomes display similar meiotic

characteristics in male grasshoppers

Tsurusaki N, Shimada T

Viera A, Calvente A, Page J, Parra MT, Gómez R, Suja JA, Rufas JS, Santos JL

376 Spatio-temporal dynamics of a neutralized

size for the maize B chromosome

B chromosome in the grasshopper Eyprepocnemis plorans

Phelps-Durr TL, Birchler JA

Perfectti F, Pita M, de la Vega CG, Gosálvez J, Camacho JPM

309 An asymptotic determination of minimum centromere

386 The parasitic effects of rye B chromosomes might be

beneficial in the long term

Effects of B Chromosomes on the A Genome

González-Sánchez M, Chiavarino M, Jiménez G, Manzanero S, Rosato M, Puertas MJ

314 B chromosomes in hybrids of temperate cereals and

grasses Jenkins G, Jones RN

Integration of B Chromosomes into the A Genome

320 Different numbers of rye B chromosomes induce 394 Interaction of B chromosomes with A or

identical compaction changes in distinct A chromosome domains

B chromosomes in segregation in insects Nokkala S, Nokkala C

Delgado M, Caperta A, Ribeiro T, Viegas W, Jones RN, Morais-Cecílio L

398 Imitate to integrate: Reviewing the pathway for

325 The odd-even effect in mitotically unstable

B chromosomes in grasshoppers

B chromosome integration in Trypoxylon (Trypargilum) albitarse (Hymenoptera, Sphecidae)

Camacho JPM, Perfectti F, Teruel M, López-León MD, Cabrero J

Rocha-Sanchez SMS, Pompolo SG 402 B chromosomes: the troubles of integration Granado N, Rebollo E, Sánchez FJ, Arana P

Transmission of B Chromosomes 332 The B chromosome polymorphism of the grasshopper

Eyprepocnemis plorans in North Africa. IV. Transmission of rare B chromosome variants Bakkali M, Camacho JPM

411 Author Index Vol. 106, No. 2–4, 2004 412 Author Index Vol. 106, 2004 after 412 Contents Vol. 106, 2004

338 Rapid suppression of drive for a parasitic

B chromosome Perfectti F, Corral JM, Mesa JA, Cabrero J, Bakkali M, López-León MD, Camacho JPM 344 Transmission analysis of B chromosomes in

Rattus rattus from Northern Africa Stitou S, Zurita F, Díaz de la Guardia R, Jiménez R, Burgos M 347 B chromosomes and Robertsonian fusions of

Dichroplus pratensis (Acrididae): intraspecific support for the centromeric drive theory Bidau CJ, Martí DA

146

Contents

Contents Vol. 106, 2004

82 A comparative karyological study of the blue-breasted quail

No. 1

(Coturnix chinensis, Phasianidae) and California quail (Callipepla californica, Odontophoridae)

Abstracts 1 16th European Colloquium on Animal Cytogenetics and Gene

Mapping National Institute for Agronomic Research (INRA) Jouy-en-Josas, France, July 6–8, 2004 25 Satellite Meeting: 40th anniversary of the discovery of the

t(1;29) in cattle National Institute for Agronomic Research (INRA) Jouy-en-Josas, France, July 9, 2004

Shibusawa M, Nishida-Umehara C, Tsudzuki M, Masabanda J, Grifﬁn DK, Matsuda Y

91 Cloning and characterization of the mouse Arht2 gene which

encodes a putative atypical GTPase Shan Y, Hexige S, Guo Z, Wan B, Chen K, Chen X, Ma L, Huang C, Zhao S, Yu L

98 Molecular characterization of porcine hyaluronidase genes 1,

2, and 3 clustered on SSC13q21 Gatphayak K, Knorr C, Beck J, Brenig B

107 Gene mapping of 5S rDNA sites in eight fish species from the

Paraíba do Sul river basin, Brazil

Original Articles

Kavalco KF, Pazza R, Bertollo LAC, Moreira-Filho O

28 Analysis of the cytogenetic stability of the human embryonal

kidney cell line 293 by cytogenetic and STR profiling approaches Bylund L, Kytölä S, Lui W-O, Larsson C, Weber G

33 Retained heterodisomy for chromosome 12 in atypical

lipomatous tumors: implications for ring chromosome formation Mertens F, Panagopoulos I, Jonson T, Gisselsson D, Isaksson M, Domanski HA, Mandahl N

39 The effect of cold storage on recombination frequencies in

human male testicular cells Sun F, Trpkov K, Rademaker A, Ko E, Barclay L, Mikhaail-Philips M, Martin RH

43 The most common chromosome aberration detected by

high-resolution comparative genomic hybridization in vulvar intraepithelial neoplasia is not seen in vulvar squamous cell carcinoma Bryndorf T, Kirchhoff M, Larsen J, Andreasson B, Bjerregaard B, Westh H, Rose H, Lundsteen C

49 Evolution of unbalanced gain of distal chromosome 2p in

neuroblastoma Stallings RL, Carty P, McArdle L, Mullarkey M, McDermott M, O’Meara A, Ryan E, Catchpoole D, Breatnach F

55 Mosaicism for an ectopic NOR at 8pter and a complex

rearrangement of chromosome 8 in a patient with severe psychomotor retardation Felbor U, Knötgen N, Schams G, Buwe A, Steinlein C, Schmid M

111 Karyotypic evolution in the Galliformes: An examination of the

process of karyotypic evolution by comparison of the molecular cytogenetic findings with the molecular phylogeny Shibusawa M, Nishibori M, Nishida-Umehara C, Tsudzuki M, Masabanda J, Grifﬁn DK, Matsuda Y

Abstracts 120 38th Biennial American Cytogenetics Conference

April 22–25, 2004 Skamania Lodge, Stevenson, Washington Brief Gene Mapping Reports – Internet Publication 142 A Assignment of two isoforms of the AMP-activated protein

kinase ␥ subunits, PRKAG1 and PRKAG2 to porcine chromosomes 5 and 18, respectively by radiation hybrid panel mapping Haberkern G, Regenhard P, Ottzen-Schirakow G, Kalm E, Looft C

142 B Assignment of the ovine uroporphyrinogen decarboxylase

(UROD) gene to chromosome 1p34tp36 by fluorescence in situ hybridization Nezamzadeh R, Habermann J, Fries R, Brenig B

142 C Assignment of the surfactant protein A gene (SFTPA) to

bovine chromosome 28q1.8tq1.9 by radiation hybrid mapping Gjerstorff M, Dueholm B, Bendixen C, Holmskov U, Hansen S

142 D Physical mapping and marker development for the porcine

Gene Mapping, Cloning and Sequencing

glial cells missing homolog 1 (Drosophila) (GCM1) gene Spötter A, Drögemüller C, Kuiper H, Hamann H, Distl O

61 Cloning and characterization of an inversion breakpoint at

6q23.3 suggests a role for Map7 in sacral dysgenesis

142 E Mapping of three porcine 20S proteasome genes using the

IMpRH panel

Sood R, Bader PI, Speer MC, Edwards YH, Eddings EM, Blair RT, Hu P, Faruque MU, Robbins CM, Zhang H, Leuders J, Morrison K, Thompson D, Schwartzberg PL, Meltzer PS, Trent JM

Wu X, Yu M, Liu B, Yerle M, Zhao SH, Wang YF, Fan B, Li K

Animal Cytogenetics and Comparative Mapping

No. 2–4

68 Isolation and characterization of the Xenopus laevis orthologs

of the human papillary renal cell carcinoma-associated genes PRCC and MAD2L2 (MAD2B)

147 Preface Camacho JP

van den Hurk WH, Martens GJM, Geurts van Kessel A, van Groningen JJM

74 Identifying differentially expressed genes in the mammalian

retina and the retinal pigment epithelium by suppression subtractive hybridization Schulz HL, Rahman FA, Fadl El Moula FM, Stojic J, Gehrig A, Weber BHF

A Valuable Tool 149 The B chromosome database Jones RN, Díez M 151 The distribution of B chromosomes across species Palestis BG, Trivers R, Burt A, Jones RN

Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel

Access to full text and tables of contents, including tentative ones for forthcoming issues: www.karger.com/cgr_issues

What Are B Chromosomes?

302 X and B chromosomes display similar meiotic characteristics

in male grasshoppers 159 Are the dot-like chromosomes in Trinomys iheringi (Rodentia,

Echimyidae) B chromosomes? Fagundes V, Camacho JPM, Yonenaga-Yassuda Y

165 Human supernumeraries: are they B chromosomes? Fuster C, Rigola MA, Egozcue J 173 Is the aneuploid chromosome in an apomictic Boechera

holboellii a genuine B chromosome? Sharbel TF, Voigt M-L, Mitchell-Olds T, Kantama L, de Jong H

Report of New B Chromosomes

Viera A, Calvente A, Page J, Parra MT, Gómez R, Suja JA, Rufas JS, Santos JL

309 An asymptotic determination of minimum centromere size for

the maize B chromosome Phelps-Durr TL, Birchler JA

Effects of B Chromosomes on the A Genome 314 B chromosomes in hybrids of temperate cereals and grasses Jenkins G, Jones RN 320 Different numbers of rye B chromosomes induce identical

184 The occurrence of different Bs in Cestrum intermedium and

C. strigilatum (Solanaceae) evidenced by chromosome banding Fregonezi JN, Rocha C, Torezan JMD, Vanzela ALL

189 Distribution and stability of supernumerary

microchromosomes in natural populations of the Amazon molly, Poecilia formosa

compaction changes in distinct. A chromosome domains Delgado M, Caperta A, Ribeiro T, Viegas W, Jones RN, Morais-Cecílio L

325 The odd-even effect in mitotically unstable

B chromosomes in grasshoppers Camacho JPM, Perfectti F, Teruel M, López-León MD, Cabrero J

Transmission of B Chromosomes

Lamatsch DK, Nanda I, Schlupp I, Epplen JT, Schmid M, Schartl M

195 B chromosomes in Amazonian cichlid species Feldberg E, Porto JIR, Alves-Brinn MN, Mendonça MNC, Benzaquem DC

Review on B Chromosomes 199 The B chromosomes in Brachycome Leach CR, Houben A, Timmis JN 210 B chromosomes in Sternorrhyncha (Hemiptera, Insecta) Maryañska-Nadachowska A 215 B chromosomes in Crustacea Decapoda Coluccia E, Cannas R, Cau A, Deiana AM, Salvadori S 222 Current knowledge on B chromosomes in natural populations

of helminth parasites: a review Špakulová M, Casanova JC 230 B chromosomes in the fish Astyanax scabripinnis (Characidae,

332 The B chromosome polymorphism of the grasshopper

Eyprepocnemis plorans in North Africa. IV. Transmission of rare B chromosome variants Bakkali M, Camacho JPM

338 Rapid suppression of drive for a parasitic B chromosome Perfectti F, Corral JM, Mesa JA, Cabrero J, Bakkali M, López-León MD, Camacho JPM 344 Transmission analysis of B chromosomes in Rattus rattus from

Northern Africa Stitou S, Zurita F, Díaz de la Guardia R, Jiménez R, Burgos M

347 B chromosomes and Robertsonian fusions of Dichroplus

pratensis (Acrididae): intraspecific support for the centromeric drive theory Bidau CJ, Martí DA

Population Dynamics and Evolution of B Chromosomes

Tetragonopterinae): An overview in natural populations Moreira-Filho O, Galetti Jr. PM, Bertollo LAC

235 Structure and evolution of B chromosomes in amphibians Green DM 243 Occurrence of B chromosomes in lizards: a review Bertolotto CEV, Pellegrino KCM, Yonenaga-Yassuda Y 247 B chromosomes in populations of mammals Vujošević M, Blagojević J 257 B chromosomes in Brazilian rodents Silva MJJ, Yonenaga-Yassuda, Y 264 The mammalian model for population studies of

B chromosomes: the wood mouse (Apodemus) Wójcik JM, Wójcik AM, Macholán M, Piálek J, Zima J

271 A complex B chromosome system in the Korean field mouse,

Apodemus peninsulae Kartavtseva IV, Roslik GV

Structure and Origin of B Chromosomes 279 A RAPD marker associated with B chromosomes in Partamona

helleri (Hymenoptera, Apidae) Tosta VC, Fernandes-Salomão TM, Tavares MG, Pompolo SG, Barros EG, Campos LAO

284 Comparative FISH analysis of distribution of B chromosome

repetitive DNA in A and B chromosomes in two subspecies of Podisma sapporensis (Orthoptera, Acrididae) Bugrov AG, Karamysheva TV, Rubtsov DN, Andreenkova OV, Rubtsov NB

289 Comparative analysis of micro and macro B chromosomes in

the Korean field mouse Apodemus peninsulae (Rodentia, Murinae) performed by chromosome microdissection and FISH Rubtsov NB, Karamysheva TV, Andreenkova OV, Bochkaerev MN, Kartavtseva IV, Roslik GV, Borissov YM

295 FISH detection of ribosomal cistrons and

351 Cytogeography and the evolutionary significance of

B chromosomes in relation to inverted rearrangements in a grasshopper species Colombo P, Confalonieri V

359 Mitotically unstable B chromosome polymorphism in the

grasshopper Dichroplus elongatus Remis MI, Vilardi JC

365 Geographic and seasonal variations of the number of

B chromosomes and external morphology in Psathyropus tenuipes (Arachnida: Opiliones) Tsurusaki N, Shimada T

376 Spatio-temporal dynamics of a neutralized B chromosome in

the grasshopper Eyprepocnemis plorans Perfectti F, Pita M, de la Vega CG, Gosálvez J, Camacho JPM

386 The parasitic effects of rye B chromosomes might be

beneficial in the long term González-Sánchez M, Chiavarino M, Jiménez G, Manzanero S, Rosato M, Puertas MJ

Integration of B Chromosomes into the A Genome 394 Interaction of B chromosomes with A or B chromosomes in

segregation in insects Nokkala S, Nokkala C

398 Imitate to integrate: Reviewing the pathway for

B chromosome integration in Trypoxylon (Trypargilum) albitarse (Hymenoptera, Sphecidae) Rocha-Sanchez SMS, Pompolo SG

402 B chromosomes: the troubles of integration Granado N, Rebollo E, Sánchez FJ, Arana P 411 Author Index Vol. 106, No. 2–4, 2004 412 Author Index Vol. 106, 2004

assortment-distortion for X and B chromosomes in Dichroplus pratensis (Acrididae) Bidau CJ, Rosato M, Martí DA

IV

Cytogenet Genome Res Vol. 106, 2004

Contents

Cytogenet Genome Res 106:147–148 (2004)

Preface

Subsequently to the ascription of genetic inheritance to chromosomes, the presence of additional passengers in the karyotype of a hemipteran insect was detected (Wilson, 1906); supernumerary chromosomes, also called accessory or B chromosomes in order to distinguish them from the standard A chromosomes, had been discovered. It was Östergren (1945) who first considered B chromosomes as parasitic elements, but the scientific community was reluctant to accept this view until the emergence of the selfish DNA theory (Doolittle and Sapienza, 1980; Orgel and Crick, 1980). In the light of this theory the interpretation of B chromosomes had a remarkable advance, opening new approaches to their study and understanding. B chromosomes have been reported in most eukaryote taxa, with the remarkable exception of birds, where only one species, the zebra finch Taeniopygia guttatta, has been reported to carry a single accessory chromosome restricted to the germ line of both sexes (Pigozzi and Solari, 1998). The last compilation of B chromosomes in eukaryotes was done in the classical book authored by Jones and Rees (1982), which has since been the main reference and inspiration for researchers. In these last 22 years, many new findings have contributed to building an increasing body of knowledge of most aspects of B chromosomes, ranging from origin and molecular nature to population dynamics and long term evolution. The field was demanding an update of these new data. The present single topic issue of Cytogenetic and Genome Research tries to cover this need. It contains 40 contributions by colleagues from 19 countries in most continents, and provides both reviews and new original data on many aspects of B chromosomes. This issue begins with a B chromosome database designed by R.N. Jones and M. Dı´ez which reviews all the literature on B chromosomes up to 1994, and is here first made available to the scientific community. The usefulness of this resource is illustrated by the comparative analysis of Palestis and coworkers on the presence of B chromosomes across species. The second section includes articles trying to delimit what is and what is not a B chromosome. It includes cases of dot-like chromosomes in

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel

rodents, human supernumerary chromosomes, and aneuploid chromosomes associated with apomictic reproduction in a plant. The third section contains articles providing new discoveries of B chromosomes in plants and fish, whereas the fourth includes reviews on the plant Brachycome, Sternorrhyncha hemipterans, decapodan crustaceans, helminth parasites, the fish Astyanax scabripinnis, amphibians, lizards and mammals. The fifth section is devoted to the structure, composition and origin of B chromosomes, focusing on the isolation of a RAPD marker associated with B chromosomes in a bee, FISH analyses of the distribution of repetitive DNAs in A and B chromosomes of a grasshopper and the Korean field mouse, FISH detection of ribosomal cistrons and X–B assortment distortion in the grasshopper Dichroplus pratensis, and the molecular estimation of the smallest functional maize B centromere. The sixth section contains reports on several kinds of effects of B chromosomes on the host genome, such as meiotic behaviour in inter-generic and inter-specific plant hybrids, rye A chromosome organization with respect to rDNA and satellite DNA, and the odd-even effect in mitotically unstable B chromosomes in grasshoppers. The seventh section reports on the transmission of B chromosomes. It includes articles on the transmission rates of rare B chromosome variants in the grasshopper E. plorans, rapid drive suppression of B chromosomes in the same species, the parasitic nature of B chromosomes in the black rat, and the first intraspecific support for a negative association between B chromosomes and Robertsonian fusions as predicted by the theory of centromeric drive (see Palestis et al., 2004). The eighth section contains articles dealing with several aspects of population dynamics and evolution of B chromosomes in grasshoppers, an arachnid species and maize. The last section includes three contributions with total or partial focus on the possibility of an integration of B chromosomes into the A genome of insects. The present volume on B chromosomes is by no means complete, since it was not possible to include all the data found in many other species. Nevertheless, I hope it will provide new

Accessible online at: www.karger.com/cgr

impulses for studies on B chromosomes and contribute to disentangling the biological meaning of these mysterious components of many eukaryotic genomes. I am very thankful to all authors and coauthors for having prepared their excellent manuscripts within a very short period of time and with relentless enthusiasm, and to all expert reviewers for their excellent assistance. Furthermore, I wish to express my gratitude to the staff of the American and European Editorial Offices of Cytogenetic and Genome Research for their support during the preparation of this single topic issue on B chromosomes. Juan Pedro M. Camacho Granada, June 2004

148 6

Cytogenet Genome Res 106:147–148 (2004)

References Doolittle WF, Sapienza C: Selfish genes, the phenotype paradigm and genome evolution. Nature 284:601–603 (1980). Jones RN, Rees H: B chromosomes (Academic Press, New York 1982). Orgel LE, Crick FH: Selfish DNA: the ultimate parasite. Nature 284:604–607 (1980). Östergren G: Parasitic nature of extra fragment chromosomes. Bot Notiser 2:157–163 (1945). Palestis BG, Burt A, Jones RN, Trivers R: B chromosomes are more frequent in mammals with acrocentric karyotypes: support for the theory of centromeric drive. Proc R Soc London B (Suppl):S22–S24 (2004). Pigozzi MI, Solari AJ: Germ cell restriction and regular transmission of an accessory chromosome that mimics a sex body in the zebra finch, Taeniopygia guttata. Chromosome Res 6:105–113 (1998). Wilson EB: Studies on chromosomes. V. The chromosomes of Metapodius. A contribution to the hypothesis of genetic continuity of chromosomes. J Exp Zool 6:147–205 (1906).

A Valuable Tool Cytogenet Genome Res 106:149–150 (2004) DOI: 10.1159/000079280

The B chromosome database R.N. Jonesa and M. Dı´ezb a The

University of Wales Aberystwyth, Institute of Biological Sciences, Aberystwyth, Wales (UK); de Genética, Facultad de Biologı´a, Universidad Complutense, Madrid (Spain)

b Departamento

Abstract. The database is compiled from the world literature on B chromosomes published between 1906 and 1994, and has 3,484 records. A brief description is given of the history and structure of the database, which runs in Microsoft ACCESS.

Background and context The idea to build a B chromosome database (DB) originated in 1988 during the early stages of a research collaboration between RNJ and Maria Puertas of the Complutense University of Madrid, and more than a year was spent over discussions on how to construct the DB to maximize its usefulness. The literature, in the form of original papers and photocopies, had been in the process of collection by RNJ since 1964, and this resource was available. Manuel Dı´ez undertook to deal with the software, and the initial DB used a Spanish version of dBASE III. This was later upgraded to dBASE IV, and then finally transferred to ACCESS 2000 in 2001. The literature collection was maintained, and data gradually entered into the records by RNJ up to 1994 when other duties led to a suspension of the project. The DB therefore covers the period of literature from 1906, when Bs were first discovered, up to 1994. As far as is known all papers which deal with Bs, or make reference to Bs, during this period are included. The early papers were found by systematically “ploughing” through back numbers of journals and following all references until the story was exhausted. There are 3,484 records, and a record is built around a species – so some papers may lead to more than one record if several species are mentioned; and likewise a species may appear in more than one record where several publications are involved. There are fifteen fields, listed below, which includes two keyword fields, a subject field and a memo field for writing more detailed notes (only a few of these).

A downloadable version is available at http://www.bchromosomes.org/bdb/. Copyright © 2004 S. Karger AG, Basel

Any combination of any of the fields can be accessed, so the complete bibliography can be printed out as a full list of all references, or a complete list of species, or species from one family, or papers by one author, and so on. Keywords, which include a short string of words, can be searched. The subject field can also be searched, for all papers which deal with meiosis, for example, or heterochromatic Bs, or fertility, or structure, or populations, or whatever.

Structure of the records The database contains the fields: – AUTHORS – YEAR – TITLE – JOU – VOL – PA – SPECIES – Animal +/– – VARIETY – CHROMOSOME – No. – Bs – No. – PHYLUM – FAMILY – SUBJECT words – MEMO fields (a few entries with detailed notes) – KEYWORDS I a–n – KEYWORDS II o–z

Keywords Received 29 October 2003; manuscript accepted 17 February 2004. Request reprints from Neil Jones, University of Wales Aberystwyth Institute of Biological Sciences, Aberystwyth SY23 3DD, Wales (UK) telephone: +44 1970 622230; fax: +44 1970 622307; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0149$21.00/0

Keywords are divided into two fields, splitting the alphabet, to reduce search time. Each keyword is followed by a short string of words giving some information about the area covered

Accessible online at: www.karger.com/cgr

by the word. A specified list of keywords is used, listed below, and the meaning of keyword words is provided with the list. Additional keywords can be added provided these are included in the list. Keywords I (a–n) Information on acro additionlines androgenetic banding callus cellsize chromocentres “cuckoo” cycles DNAamount endonucleases fertility flowering fold-back germination holocentric hybrids imprinting inbredlines inter iso lampbrush loss majorgen meiosis meta methylation microcloning midget mitostab model molecular norBs nuclearphen

acrocentric chromosomes refers to Bs of rye as addition lines in hexaploid wheat Bs in plants regenerated from anther culture (e.g. Crepis) species with information on C and G-banding Bs in plant callus cultures cases where Bs affect cell size cases where Bs form condensed chromocentres selfish alien addition chromosomes in wheat (not Bs) mitotic and meiotic cycles times DNA values involving Bs endonuclease which destroy lagging Bs Bs effects on fertility in plants and animals flowering time in plants synaptonemal complex studies on fold-back pairing of Bs seed germination in plants Bs with diffuse centromeres Bs in intergeneric and inter-specific hybrids Bs involved in imprinting effects Bs in inbred lines translocations involving Bs Bs as isochromosomes Bs as lampbrush chromosomes loss of knobbed segments, as in maize Bs with major genes behaviour and influence of Bs at meiosis metacentric Bs Bs and methylation microcloning of Bs midget chromosome of rye (not Bs) mitotic stability/instability models of transmission molecular analysis data Bs with NORs influence of Bs on nuclear phenotype

Keywords II (o–z) occur oddeven origin parasitic phenofit polyB polyteny pops recomb regenerants replitrans review size spreading structure submeta subterm synaptonemal telo telomere transinher transposable woody

150 8

data on the occurrence in individuals and populations cases of the odd/even effect information/theories on the origin of Bs cases of parasitic Bs effects on phenotype and fitness polymorphic forms of the Bs within a species species with polytene Bs data on Bs in populations effects on recombination in A chromosomes regenerated plants with Bs data on replication and transcription review papers on Bs data on the size of Bs (and relative to As) Bs and surface spreading of meiocytes information on the structure of Bs submetacentric Bs subterminal Bs synaptonemal complex data telocentric Bs Bs and telomeres data on transmission and inheritance Bs and transposons Bs in woody plants (trees)

Cytogenet Genome Res 106:149–150 (2004)

Subject words In addition to keywords there are a number of chosen subject words which indicate the main areas which are dealt with in a publication. It is useful to find all of the papers which deal with a particular main topic, e.g. recombination, or structure. There is some overlap with keywords. Subject word

Information on

meiosis heterochrom euchrom transinher poly-B mitostab AB-inter structure norBs cycles replitrans recomb hybrids majorgen parasitic phenofit fertility flowering germinat nuclearphen oddeven population origin discussion review

meiosis heterochromatin euchromatin transmission and inheritance polymorphic forms of Bs mitotic stability/instability A-B translocations structure of Bs Bs with NORs mitotic and meiotic cycle times replication and transcription recombination Bs in intergeneric and inter-specific hybrids major genes parasitic Bs phenotype and fitness fertility effects flowering time in plants seed germination in plants effects on the nuclear phenotype the odd/even effect populations origin papers with good discussion sections review papers on Bs

Working with the database The database is built in Microsoft ACCESS, and it is necessary to have this program installed in your computer in order to use it. It works in any version or language. Discussions are in progress, for the future prospects, to set up the DB online and make it interactive. Ideally it can then be brought up to date and kept current.

A Valuable Tool Cytogenet Genome Res 106:151–158 (2004) DOI: 10.1159/000079281

The distribution of B chromosomes across species B.G. Palestis,a R. Trivers,b A. Burt,c and R.N. Jonesd a Department

of Biological Sciences, Wagner College, Staten Island, NY (USA); of Anthropology, Rutgers University, New Brunswick, NJ (USA); c Department of Biology, Imperial College, Silwood Park, Ascot, Berkshire (UK); d Institute of Biological Sciences, University of Wales Aberystwyth, Ceredigion (UK) b Department

Abstract. In this review we look at the broad picture of how B chromosomes are distributed across a wide range of species. We review recent studies of the factors associated with the presence of Bs across species, and provide new analyses with updated data and additional variables. The major obstacle facing comparative studies of B chromosome distribution is variation among species in the intensity of cytogenetic study. Because Bs are, by definition, not present in all individuals of a species, they may often be overlooked in species that are rarely studied. We give examples of corrections for differences in study effort, and show that after a variety of such corrections, strong correlations remain. Several major biological factors are associated with the presence of B chromosomes. Among flowering plants, Bs are more likely to occur in outcrossing than in inbred species, and their presence is also positively correlated with genome size and negatively with chromosome number.

They are no more frequent in polyploids than in diploids, nor in species with multiple ploidies. Among mammals, Bs are more likely to occur in species with karyotypes consisting of mostly acrocentric chromosomes. We find no evidence for an association with chromosome number or genome size in mammals, although the sample for genome size is small. The associations with breeding system and acrocentric chromosomes were both predicted in advance, but those with genome size and chromosome number were discovered empirically and we can offer only tentative explanations for the very strong associations we have uncovered. Our understanding of why B chromosomes are present in some species and absent in others is still in its infancy, and we suggest several potential avenues for future research.

B chromosome research is presently focused on two main areas of investigation, molecular organization and transmission genotypes (for review see Camacho et al., 2000; Puertas, 2002; Jones and Houben, 2003). Interest is centered around the idea of host-parasite interaction between selfish Bs and the host genome, and on the origin and evolution of Bs, especially as

analyzed at the molecular level. The earlier phases of work dealt more with the occurrence of Bs in various species, modes of inheritance, effects and ecological and adaptive significance in populations (Jones and Rees, 1982). This extensive phase of research, covering many species and many decades, provided the base of knowledge about B chromosomes, and the platform on which the more recent transmission genetics and molecular studies are now being built. With rare exceptions, attempts to find an adaptive value for Bs at the level of the individual ran into virtual dead-ends and attention was redirected toward two areas. One was the co-evolution of the host-parasite relationship itself and the other was a description of sequence organization on Bs. We have also reached the point now where most studies involve only a handful of species, and for the rest we are leaving behind many unanswered questions. Despite the vast body of knowledge

Supported by the Biosocial Research Foundation. Received 3 October 2004; manuscript accepted 20 January 2004. Request reprints from: Dr. Brian G. Palestis Department of Biological Sciences, Wagner College Staten Island, NY 10301 (USA) telephone: +1-718-390-3237; fax: +1-718-420-4172 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0151$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

which we now have on Bs within species, we have as yet hardly touched on the question of what factors determine the distribution of B chromosomes across different species. Why do some species and groups of species carry Bs while others do not? Is there some innate property of a genome, or a breeding system, or a taxonomic group, or a karyotype, for instance, which determines whether a species is likely to carry Bs or not? Here we review what is known about the distribution of Bs across species, with special attention to correcting for variation in the intensity with which groups are studied cytogenetically. In addition to reviewing the available studies – which suggest that major genetic and social variables are associated with the distribution of Bs, we also present new analyses using updated data and incorporating additional variables. The questions asked here are appropriate for all classes of selfish genetic elements, which are often maintained despite phenotypic costs by transmission at higher than Mendelian frequencies, but Bs are particularly well suited to answer them. Being so easily visible under the microscope, they have been studied for nearly a century and are known for a large number of species (N F 2000) across a broad range of taxonomic groups (Jones and Rees, 1982; Camacho et al., 2000). The major problem confronting any study of the frequency of B chromosomes across species is that, by definition, they are not present in all individuals of a species. Nor are they always present in all populations – nor all tissues within an individual, e.g., root cells, themselves often used for karyotypic work (Chen et al., 1993) or stems and leaves (Wu, 1992). Due to this variability in B presence among populations, individuals, and tissues, and also due in part to differences among taxa in the ease of chromosomal study, we do not know that a species with no reports of Bs truly lacks them. Bs are especially likely to be overlooked if a karyotype is based on a single individual, which was once true of 17,000 plant species (Darlington and Wylie, 1956). Study intensity (and ease of cytogenetic study) likely also contributes to the apparent distribution of Bs across taxa, as Bs are relatively common in grasses (Gramineae = Poaceae), lilies and allied taxa (Lilianae), and grasshoppers (Orthoptera), all of which have been subject to intensive cytogenetic study (Jones and Rees, 1982; Camacho et al., 2000; Camacho, 2004). In other taxa, such as fungi (Covert, 1998), the identification of Bs depends on the use of recently developed techniques, and thus Bs are known in only a small number of species.

Study intensity There is no simple, single cure for the problem of variation in study intensity. In principle, well studied groups are preferable, if only to improve statistical power. For this reason, Burt and Trivers (1998) chose to analyze B chromosome presence and degree of outcrossing in British flowering plants, a group in which both variables were well studied and there was no reason to expect degree of outcrossing to be associated with amount of cytogenetic work. Since intensity of study also varies within well-studied groups, spurious correlations can occur when the variable of interest co-varies with study effort.

152 10

Cytogenet Genome Res 106:151–158 (2004)

The ideal solution is to statistically correct for variation in study effort. The best measure of study effort would be the total number of karyotypic studies on each species, but such information is often difficult to find and time consuming to compile. To give perhaps the extreme case, in our work on Bs and genome size in 353 species of British flowering plants, it would have been an enormous task to truly quantify the number of karyotypic studies for each species. For example, Darlington and Wylie’s Chromosome Atlas of Flowering Plants was published in 1956 and typically lists only the most “recent” references, yet this compilation has over 2400 references. The available computer literature databases do not search prior to 1965 and most do not search past 1980. Yet databases listing numbers of karyotypic studies would be very valuable to build, especially for well-studied groups. (A complexity is that the effect of study effort on apparent B frequency may be exaggerated if discovery of Bs in a species causes the number of karytotypic studies on that species to increase.) An alternative is to measure some other aspect of study effort in genetics that is believed to be correlated with karyotypic study effort (and, then, test this assumption on a sub-sample of the data). The underlying assumption is that some species are well studied genetically and others not, so degree of study of genome size will correlate positively with intensity of karyotypic study, for example. The former is relatively easy to measure, since online databases of genome size studies exist (Gregory, 2001a, Bennett and Leitch, 2003). A sub-sample of 25 species of British flowering plants shows that number of estimates of genome size does correlate positively with number of cytogenetic studies (P ! 0.01, Spearman’s Rho = 0.56; Trivers et al., 2004). At the very least, comparative studies must exclude species whose chromosomes have never been counted, since obviously Bs could not be found in such species. This simple correction alone can change the rank order of relative B frequency among plant families (Levin et al., manuscript in preparation). In many cases the influence of study effort will be unbiased, at least within taxa. For example, Palestis and colleagues (2004) demonstrate that Bs are more frequent in mammals with karyotypes consisting of mostly acrocentric autosomes (see Chromosome shape). There is no reason to suspect that species with mainly acrocentric chromosomes are studied more frequently than those with mainly bi-armed chromosomes, and, indeed, there is no correlation between study effort and the percentage of autosomes that are acrocentric across mammals (F1, 944 = 0.427, P = 0.513, r2 = 0.0005). Study effort was indexed by the number of studies listed in an online database of mammalian karyotypes (Institute of Cytology and Genetics, 2000). The effect of study effort on apparent B frequency is enormous. Among species with fewer than three studies cited in the online database (n = 647), 2.5 % have reports of B presence, while 30 % of species with greater than 15 references (n = 27) have Bs. But since there is no apparent bias by percentage of acrocentric As, the fact that many species with few karyotypic studies may be misclassified as non-B species would only decrease the chance that a significant correlation between A chromosome shape and B presence would be found. We have added study effort as a variable in a regression analysis and find highly sig-

Table 1. Logistic model coefficients and logistic likelihood ratio tests for the influence of the proportion of A chromosome arms on acrocentrics, study intensity, and number of A chromosomes on B chromosome presence in mammals

Coefficient

Intercept Acrocentric As No. studies Chromosome no.

–3.83 –2.00 0.08 –0.01

SE

0.60 0.49 0.02 0.01

Partial r

–0.31 0.19 0.21 0.00

Logistic likelihood ratio tests χ2

df

probability

16.73 20.48 0.29

1 1 1

<0.0001 <0.0001 0.59

Overall log likelihood = –180.39, r2 = 0.10, χ2 2 = 41.724, P < 0.0001.

Table 2. Logistic model coefficients and logistic likelihood ratio tests for the influence of genome size, breeding system, chromosome number, study intensity, and variation in ploidy on B chromosome presence in British flowering plants

Coefficient

Intercept Genome sizea Breeding systemb Chromosome no. No. studies Variable ploidyc

–1.69 1.35 1.61 –0.08 0.34 0.36

SE

0.84 0.50 0.43 0.03 0.21 0.42

Partial r

–0.10 0.16 0.24 –0.18 0.05 0.00

Logistic likelihood ratio tests χ2

df

probability

7.16 14.20 9.09 2.58 0.74

1 1 1 1 1

0.008 0.0002 0.003 0.11 0.39

Overall log likelihood = –72.98, r2 = 0.31, χ2 5 = 65.57, P < 0.0001. a log(4C/ploidy). b (Selfing + mixed) versus outcrossing. c One reported ploidy level versus more than one.

nificant, independent effects of both study effort and A chromosome shape on the presence of B chromosomes (Table 1). The strength of the correlation between acrocentric As and B presence is unchanged by correcting for study effort. However, there are situations when differences in study effort can introduce bias. Trivers and colleagues (2004) show that study intensity is correlated with the presence of B chromosomes in British flowering plants. The index of study intensity used was the number of studies of genome size on a species, as described above. The chief variable of interest in this study was genome size, with the prediction that Bs would be more frequent in species with large genomes (see Genome size). In this case, study effort led to a bias, because species with large genomes tend to be studied more often than those with small genomes (Trivers et al., 2004). This difference probably results from the greater ease of studying species with large chromosomes (and few chromosomes – genome size and chromosome number are inversely correlated; Vinogradov, 2001; Trivers et al., 2004). Simply finding a correlation between B presence and genome size would be insufficient to demonstrate a relationship, since study effort is positively correlated with both B presence and genome size. It is therefore necessary to control statistically for intensity of study effort using multiple regression. This analysis shows that genome size (as well as breeding system and chromosome number) does make a highly significant contribution to B chromosome presence, independent of study effort (Table 2). Again, correcting for study effort does not affect the strength of the correlation with the variable of interest.

In other cases, biases due to differences in study effort can lead to spurious correlations that disappear when study effort is controlled for, such as an apparent correlation between intraspecific variation in ploidy and B presence (Trivers et al., 2004; Table 2). Increased study effort not only leads to more discoveries of Bs, but also to more discoveries of chromosomal races and ploidy variation.

Correcting for phylogeny Another potential confounding factor in studies of B chromosome presence is non-independence of species due to evolutionary relatedness. For example, imagine a case where 10 species have Bs and 10 do not. Of the 10 species with Bs 9 have trait x, while only two of those without Bs have trait x. This would appear to be evidence of a correlation between trait x and B chromosome presence. However, what if the 10 species with Bs were all in one genus and the 10 without were all in another genus? Now there is really no good evidence of an association between Bs and trait x. While this example is extreme, it does point out the potential problem of pseudoreplication due to phylogenetic relatedness. We have used the method of independent taxonomic contrasts (Felsenstein, 1988; Burt, 1989) to control for possible phylogenetic biases. That Bs may be phylogenetically clustered does not necessarily mean that there is no effect of the variable of interest on B frequency. In the hypothetical example above, it is possible that expanding the study to include many genera would reveal a relationship between Bs and trait x. Perhaps most genera with

Cytogenet Genome Res 106:151–158 (2004)

153 11

high B frequencies also have high frequencies of the trait. In addition, such clustering may suggest factors associated with B presence that had been previously overlooked, if groups with high B frequencies share common characteristics (see Future research). Phylogenetic clustering can also suggest that Bs may survive speciation events, if the Bs are similar in closely related species (Camacho, 2004).

the spread of harmful Bs, has the opposite effect on beneficial Bs, which do best under inbreeding. Selfing species that do have Bs may be interesting species to study, since they may represent cases where Bs are no longer parasitic and are possibly mutualistic (Burt and Trivers, 1998).

Genome size Breeding system In 1969 Moss stated that Bs in plants are most frequent in outbreeding species, but unfortunately published only an abstract with no data (Moss, 1969). A recent comparative study of 226 species of British flowering plants demonstrates that Bs are, indeed, more likely to be present in outbreeding than in inbreeding species (Burt and Trivers, 1998). This result holds after correcting for study effort and other variables, such as genome size (which is correlated with both degree of outbreeding and B presence), chromosome number, and ploidy (Trivers et al., 2004; see Table 2). Experimental studies also support the relationship between Bs and outcrossing. Müntzing (1954) inbred the normally outbreeding rye (Secale cereale), and B frequency declined. Similarly, Bs experimentally introduced into S. vavilovii, which does inbreed, rapidly declined in frequency (Puertas et al., 1987). Empirical evidence based on comparisons of heterozygosity among individuals with and without Bs is mixed, however. Presence of Bs is associated with heterozygosity of RAPD loci in wild roe deer (Capreolus pygargus; Tokarskaia et al., 2000), but Bs in rye are associated with homozygosity at isozyme loci (Benito et al., 1992). An association between Bs and outbreeding is expected on theoretical grounds (Puertas et al., 1987; Bell and Burt, 1990; Shaw and Hewitt, 1990). In inbred or asexual species, natural selection acts among competing lines of descent. Lines without Bs are expected to outcompete those with Bs, if Bs decrease fitness. In outcrossed species Bs can continually infect new lineages and can escape extinction if they drive. Inbreeding also increases the variance in B number among individuals, which increases the power of natural selection to decrease B frequency. Harmful effects of Bs are typically most prevalent at high numbers of Bs per individual, and inbreeding among “infected” individuals would increase the number of offspring with high numbers of Bs. Interestingly, Cruz-Pardilla et al. (1989) demonstrate that rye individuals with Bs have higher rates of outbreeding than those without Bs. Since plants with Bs also had decreased fertility, it is possible that this result reflects mortality of zygotes from selfing, due to high B numbers (Shaw and Hewitt, 1990). If so, this result would support the contention that the harmful effects of parasitic Bs are amplified under inbreeding. It is important to remember that not all Bs are harmful, and some, such as those in Allium schoenoprasum appear to be beneficial (Bougourd and Jones, 1997). The relationship between Bs and breeding system is greatly influenced by the direction of the phenotypic effects of the Bs. Burt and Trivers (1998) show in a population genetic model that outcrossing, which favors

154 12

Cytogenet Genome Res 106:151–158 (2004)

While reviewing the literature on genome size, it was noticed that taxa with relatively large genomes tend to have more species with B chromosomes than do taxa with smaller genomes (e.g. monocots vs. dicots, Orthoptera vs. Diptera). As recently noted by Vujosevic and Blagojevic (2004, this issue), the absence of Bs in birds may be related to their uniformly small genome size. Trivers and colleagues (2004) tested the possible association between genome size and Bs within British flowering plants. A strong positive correlation was found, with Bs completely absent from species with very small genomes. This relationship holds among all British flowering plants, both globally and in a test of taxonomically independent contrasts. The relationship is also statistically significant among dicots and, within the dicots, among the Compositae (Asteraceae), but does not reach statistical significance among the grasses (Gramineae). Oddly the correlation is in the opposite direction for monocots as a whole, but the data set included only one monocot with Bs outside of the Gramineae. The global relationship between genome size and Bs remains highly significant when statistically controlled for potentially confounding variables, such as breeding system, chromosome number, ploidy and study effort. One potential weakness of the Trivers study (Trivers et al., 2004) is that, although British flowering plants are presumably a well-studied group, the presence or absence of B chromosomes was based on data only up to 1982, the B chromosome atlas in Jones and Rees (1982). We have since updated our data set using a database maintained by RNJ though 1994 and by performing computer searches for records of Bs since 1994. We have uncovered only four species that had been misclassified as non-B species. Reclassifying these four species has little effect on the logistic regression analysis (the new analysis is in Table 2), but does cause the effect of genome size on B presence in the grasses to approach significance (P = 0.076). Amazingly, reclassifying just four species greatly improves the independent taxonomic contrasts analysis. Previously 15 contrasts were in the predicted direction and 6 were in the opposite direction (P = 0.04). These four “new” species add three new contrasts and reverse the direction of one; now 19 are in the predicted direction versus 5 in the opposite direction (P = 0.003). This large impact of a small number of misclassified species points to the effect that differences in study effort can have on statistical power. It is also reassuring that as the data set improves, even marginally, correlations become stronger. The most obvious possible explanation for the relationship between genome size and B presence is that species with small genomes may be less able to tolerate the effects of Bs. The shape of the relationship between genome size and Bs in British flowering plants supports this explanation, as Bs are absent from

species with tiny genomes and B frequency levels off once genome size is relatively large (and may actually decline at very large genome sizes) (Trivers et al., 2004). Another possibility is that large genomes, which contain largely non-coding DNA, may provide a source of DNA for the creation of Bs, which also consist largely of non-coding DNA (Puertas, 2002; Jones and Houben, 2003). One possible sampling artifact cannot be ruled out. Plants with small genomes often have many small A chromosomes, while those with large genomes tend to have a small number of large A chromosomes (Vinogradov, 2001; Trivers et al., 2004), which could increase the relative difficulty of detecting Bs in small-genomed species. We have also attempted to test for a relationship between genome size and B chromosome presence in mammals, but genome size data is known for only a small number of mammals with Bs, and nearly all of these are rodents. At least among rodents, species with and without Bs have remarkably similar genome sizes (with Bs: mean 2C genome size B SE = 3.5 B 0.2 pg, n = 12; without Bs: 3.6 B 0.1 pg, n = 51; genome size data from Gregory, 2001a). If a relationship between genome size and B presence does exist in mammals or other amniotes it is unlikely to be a strong effect, because there is little variation in genome size among the amniotes (Gregory, 2001a, b). Within our data, angiosperm 2C-values vary from approximately 0.1 to over 60 pg, while rodent 2C-values vary only from approximately 2 to 8.5 pg.

Chromosome number and ploidy As stated above, there is a negative correlation between genome size and chromosome number in flowering plants (Vinogradov, 2001; Trivers et al., 2004). Since there is a positive correlation between genome size and B presence, it is not surprising to find a negative relationship between chromosome number and B presence. However, this correlation is not simply a side-effect of the relationship with genome size. In a multiple logistic regression of factors affecting B presence in British flowering plants, chromosome number has a highly significant effect, independent of genome size or other variables (Trivers et al., 2004; Table 2). We do not know why this would be true. Camacho (personal communication) suggests that species with many small chromosomes may have evolved more efficient meiotic mechanisms, which could allow removal of Bs to be easier. Because we found such a strong negative relationship between chromosome number and B chromosome presence in plants, we included chromosome number as a variable in our analysis of Bs in mammals. There is no evidence for an effect of chromosome number on B frequency in mammals (Table 1), and average chromosome number is nearly identical among species with Bs (45.7 B 1.7, n = 63) and without Bs (43.3 B 0.4, n = 1112). While this adds to the mystery of the effect of chromosome number in plants, in mammals chromosome shape appears to be the more important variable (see Chromosome shape). The positive correlation between Bs and genome size in flowering plants leads to a natural prediction: Bs should also be

associated with polyploidy. This is not the case. Jones and Rees (1982; see also Jones, 1995) show that the frequency of polyploidy among species with Bs is similar to the frequency among all flowering plants. Trivers and colleagues (2004) demonstrate that polyploidy clearly has no positive effect on B presence, and may actually have a slight negative effect. Additionally, all positive relationships between Bs and genome size improve after correcting for ploidy. Importantly, these results imply that doubling the number of As does not cause B formation. Trivers and colleagues (2004) suggest that doubling chromosome number may actually remove Bs if it results in bivalency among Bs, which could cause the Bs to act as As. Hypothetically, these bivalent Bs could eventually become part of the A chromosome set (see also Araujo et al., 2001 for a similar suggestion involving haplodiploidy in a wasp). Regardless of whether the initial act of doubling chromosome number directly influences B formation or fate, one would still expect a positive correlation between Bs and ploidy level for the same reasons that Bs are associated positively with genome size. For example, if increased genome size per se allows a species to tolerate B presence, the same should be true for increased ploidy. Levin (personal communbication) suggests a possible explanation for the lack of a positive correlation between Bs and polyploidy. Polyploids contain less DNA than the sum of their parental genomes, and presumably have lost non-coding DNA (Levin, 2002; Leitch and Bennett, 2004; Levin and Palestis, unpublished data). Selection against junk DNA may also include selection against Bs, and may also limit the formation of new Bs from A chromosome junk. The lack of a positive association between polyploidy and Bs may also result from differences in breeding system, since polyploids are much more likely than diploids to reproduce via apomixis (Levin, 2002), which would select against Bs (see Breeding system). Another possible, though less likely, explanation is suggested by the fact that average DNA amount per diploid genome is negatively correlated with the prevalence of polyploidy (Grif, 2000). Grif states that this result is due to an upper limit on total DNA content set by the maximum size of the nucleus. If species with small genomes are more likely to become polyploid than are species with large genomes, and species with small genomes rarely harbor Bs, then it is unlikely that polyploid species would contain Bs, at least initially. Additionally, it is possible that polyploid species are close to this upper limit, and thus could not add Bs.

Chromosome shape Most mammals have either mostly acrocentric A chromosomes (with one long arm) or mostly metacentric or submetacentric A chromosomes (with two arms), while relatively few species have intermediate karyotypes (Pardo-Manuel de Villena and Sapienza, 2001a). Pardo-Manuel de Villena and Sapienza (2001a) suggest that this distribution results from a bias during female meiosis that favors either more centromeres (thus favoring acrocentrics) or fewer (thus favoring metacentrics), depending on whether the egg or polar body side of the spindle is more efficient at capturing centromeres (see also Par-

Cytogenet Genome Res 106:151–158 (2004)

155 13

do-Manuel de Villena and Sapienza, 2001b). The direction of this bias switches frequently over evolutionary time, often resulting in closely related species with completely different karyotypes. We predicted that a meiotic environment favoring increased centromere number should also favor Bs, and that Bs should therefore be more frequent in species with mainly acrocentric autosomes (Palestis et al., 2004). We demonstrate that Bs are more common in species with acrocentric karyotypes among all mammals, among rodents, among non-rodents, and in a comparison of independent taxonomic contrasts. Although A chromosome shape explains only a small proportion of the variation in B presence (r2 = 0.048), the numerical difference in the average frequency of acrocentrics in species with and without Bs is quite large (approximately 68 versus 43 % of chromosomes acrocentric, 59 versus 36 % of chromosome arms on acrocentrics; in statistical comparisons we use arms rather than chromosomes, since one metacentric can be formed by the same number of evolutionary events as two acrocentrics (Palestis et al., 2004). This result holds up after adding a correction for study effort (Table 1). This study demonstrates that comparative research on B chromosomes, when used to test theoretical predictions, can have implications beyond identifying factors associated with B presence. In this case B chromosome research provided independent support for the theory of centromeric drive (Henikoff et al., 2001; Pardo-Manuel de Villena and Sapienza, 2001a, b; Henikoff and Malik, 2002a, b). The prediction that Bs will be more frequent among species with acrocentric As depends on B chromosome drive occurring during female meiosis. Unfortunately, for most mammals we do not know whether this assumption is true. It probably is true for Rattus fuscipes (Thomson, 1984) and R. rattus (Yosida, 1978; Stitou et al., 2004, this issue). It is likely that the same relationship between karyotype and B presence will occur in grasshoppers. Hewitt (1976) demonstrates that B drive in Myrmeleotettix maculatus is through females, and is also based on a functional asymmetry of the meiotic spindle poles, favoring nonrandom segregation of B chromosomes to the egg pole (Pardo-Manuel de Villena and Sapienza, 2001b). Bidau and Martı´ (2004, this issue) show an intraspecific correlation between B frequency and acrocentricity in Dichroplus pratensis, but it is unknown whether female meiotic drive occurs in this species. Among plant B chromosomes, female meiotic drive does occur in some species (e.g. Lilium callosum; Kayano, 1957). However, because of the presence of the gametophyte generation in plants, B drive often occurs during mitosis. For example, among grasses the most common method of B drive is nondisjunction at the first pollen grain mitosis (Jones and Rees, 1982; Jones, 1991). Among such species we expect to see no relationship between A chromosome shape and occurrence of Bs. If acrocentric As and B presence are both associated with higher centromere number, it is odd that we see no relationship between Bs and chromosome number in mammals (see Chromosome number and ploidy). We would predict Bs to be more frequent with high chromosome number, the opposite direction of the correlation in plants. Chromosome number in mammals does increase as the proportion that are acrocentric increases (F1, 1167 = 441.74, P ! 0.0001, r2 = 0.27), but there is a

156 14

Cytogenet Genome Res 106:151–158 (2004)

lot of scatter. In fact, the species with the highest chromosome number (Tympanoctomys barrera, 2n = 102) has only one pair of acrocentric chromosomes. In addition to demonstrating an effect of A chromosome shape on B chromosome presence in mammals, we also found a relationship between A chromosome shape and B chromosome shape (Palestis et al., 2004). Excluding species with multiple B morphologies, Bs in species with acrocentric As are typically acrocentric, while Bs in species with metacentric As are typically metacentric. Camacho (2004) reports a similar relationship in grasshoppers. This relationship suggests recent derivation of Bs from As, but B morphology can clearly evolve quickly leading to many different shapes and sizes of Bs within a species (e.g. Eyprepocnemis plorans; Lo´pez-Leo´n et al., 1993).

Future research Throughout this review it has probably been obvious to the reader that nearly all of the examples of comparative studies of B chromosome presence that we cite come from our own work. There is a good reason for this – very few others have attempted similar studies. We hope that this review and the online publication of R.N. Jones’ extensive database on species with Bs, as part of this issue, will stimulate additional research in this area. Several online databases exist for relevant variables (e.g., plant genome size: Bennett and Leitch, 2003; animal genome size: Gregory, 2001a; plant chromosome numbers: Missouri Botanical Garden, 2003; mammalian karyotypes: Institute of Cytology and Genetics, 2000, and supplement to Pardo-Manuel de Villena and Sapienza, 2001a). Here we suggest some potential avenues for future research. Most of the variables that we have considered are genetic (genome size, several aspects of karyotype), with breeding system being the exception. However, many studies have examined the importance of ecological factors, such as temperature, rainfall and altitude, on B presence when comparing populations within one species (reviewed in Jones and Rees, 1982). It is possible that some environmental variables may also influence B presence across species. (Altitude probably does not, since, while it is negatively correlated with B frequency in many species, the correlation is in the opposite direction in others (Beukeboom, 1994)). In most cases authors of studies on ecological variation in B frequency have postulated that clines result from Bs being more common in the optimal habitat of the species, where presumably Bs could be tolerated more easily. However, this explanation cannot be true in all cases, because it would not apply to beneficial Bs and also ignores the effects of history (i.e. site of B origin and subsequent geographic spread) and genetic drift (Beukeboom, 1994). It is also possible that some ecological factors associated with B presence may act directly on the mechanisms of B transmission, rather than or in addition to acting indirectly via the individual’s phenotype (Jones and Rees, 1982). If this is the case, then we would expect to see ecological variables that affect Bs similarly across species. Shaw and Hewitt (1984) demonstrate that transmission of Bs in M. maculatus males is reduced at low temperatures, and B frequency is positively correlated

with temperature in this species. If the relationship between temperature and B transmission holds true for other organisms (most likely other ectotherms), then we would expect Bs to be more prevalent in species that inhabit warmer climates. Another relevant line of research is the search for phyletic “hot-spots” for Bs (Levin et al., manuscript in preparation). Among flowering plants, some lineages have unusually high frequencies of particular chromosomal features, such as polyploidy or translocations (Levin, 2002). Analyzing heterogeneity among taxa in B frequency is not as simple as counting the number of species with Bs, because meaningful comparisons require knowing the number of species whose chromosomes have been counted. B frequency can then be expressed as the proportion of characterized species with Bs. Of course, differences in study effort are particularly problematic here. Nonetheless, B hot-spots and cold-spots clearly emerge. For example, 27.2 % of characterized species in order Commelinales harbor Bs, while there are no reports of B presence in several other orders (Levin et al., manuscript in preparation). Why are some taxa B-rich and others B-poor? Taxonomic patterns can also emerge that suggest correlations between B presence and other variables. For example, very few Bs have been reported in the non-monocot basal angiosperms (Levin et al., manuscript in

preparation). The lack of Bs in these ancient lineages may be related to the small ancestral genome size of angiosperms (Leitch et al., 1998; Levin, 2002; Soltis et al., 2003). In addition, Bs may be present in an unusually high percentage of species, relative to other dicots, in the Loranthaceae, the family with the highest average genome size among the dicots. Comparing B frequency among higher taxa thus provides another method of testing the same correlations we have examined by comparing among species. We have demonstrated that comparative studies of the factors influencing B presence can be fruitful, despite the problem of differences in study effort among species. Future studies can either identify new variables associated with B presence or can expand the analysis of the variables we have studied. It will be exciting to see if the relationships reviewed here can be applied more generally, both in studies of B chromosomes and in studies of other kinds of selfish genetic elements.

Acknowledgements We are grateful to D.A. Levin and J.P.M. Camacho for helpful suggestions and L. Beukeboom for comments on the manuscript. D.A. Levin and M. Vujosevic kindly gave us permission to cite unpublished work.

References Araujo SMSR, Pampolo SG, Perfectti F, Camacho JPM: Integration of a B chromosome into the A genome of a wasp. Proc R Soc Lond B 268:1127– 1131 (2001). Bell G, Burt A: B-chromosomes: germ-line parasites which induce changes in host recombination. Parasitology 100:S19–S26 (1990). Benito C, Romera F, Dı´ez M, Figueiras AM: Genic heterozygosity and fitness in rye populations with B chromosomes. Heredity 69:406–411 (1992). Bennett MD, Leitch IJ: Plant DNA C-values Database (release 2.0, Jan. 2003). http://www.rbgkew.org.uk/ cval/homepage.html Beukeboom LW: Bewildering Bs: an impression of the first B-chromosome conference. Heredity 73:328– 336 (1994). Bidau CJ, Martı´ DA: B chromosomes and Robertsonian fusions of Dichroplus pratensis (Acrididae): intraspecific support for the centromeric drive theory. Cytogenet Genome Res 106:347–350 (2004). Bougourd SM, Jones RN: B chromosomes: a physiological enigma. New Phytol 137:43–54 (1997). Burt A: Comparative methods using phylogenetically independent contrasts. Oxf Surv Evol Biol 6:33–53 (1989). Burt A, Trivers R: Selfish DNA and breeding system in flowering plants. Proc R Soc Lond B 265:141–146 (1998). Camacho JPM: B chromosomes, in Gregory TR (ed): The Evolution of the Genome (Elsevier, Amsterdam 2004). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Chen Q, Jahier J, Cauderson Y: The B chromosome system of Inner Mongolian Agropyron Gaertn. I. Distribution, morphology, and cytological behaviour. Caryologia 46:245–260 (1993). Covert SF: Supernumerary chromosomes in filamentous fungi. Curr Genet 33:311–319 (1998).

Cruz-Pardilla M, Vences FJ, Garcia P, Pérez de la Vega M: The effect of B chromosomes on outcrossing rate in a population of rye Secale cereale L. Heredity 62: 319–326 (1989). Darlington CD, Wylie AP: Chromosome Atlas of Flowering Plants (Macmillan, New York 1956). Felsenstein J: Phylogenies and quantitative characters. Ann Rev Ecol Syst 19:445–471 (1988). Gregory TR: Animal Genome Size Database. http:// www.genomesize.com (2001a). Gregory TR: Coincidence, coevolution, or causation? DNA content, cell size, and the C-value enigma. Biol Rev 76:65–101 (2001b). Grif VG: Some aspects of plant karyology and karyosystematics. Int Rev Cytol 196:131–175 (2000). Henikoff S, Malik HS: Conflict begets complexity: the evolution of centromeres. Curr Opin Genet Devel 12:711–718 (2002a). Henikoff S, Malik HS: Selfish drivers. Nature 417:227 (2002b). Henikoff S, Ahmad K, Malik HS: The centromere paradox: stable inheritance with rapidly evolving DNA. Science 293:1098–1102 (2001). Hewitt GM: Meiotic drive for B-chromosomes in the primary oocytes of Myrmeleotettix maculatus (Thunb.) (Acrididae: Orthoptera). Chromosoma 56:381–391 (1976). Institute of Cytology and Genetics: Diploid Numbers of Mammalia. SB RAS, Novosibirsk. http://www. bionet/nsc.ru/chromosomes (2000). Jones RN: B-chromosome drive. Am Nat 137:430–442 (1991). Jones RN: B chromosomes in plants. New Phytol 131:411–434 (1995). Jones RN, Houben A: B chromosomes in plants: escapees from the A chromosome genome? Trends Plant Sci 8:417–423 (2003). Jones RN, Rees H: B Chromosomes (Academic Press, London 1982).

Kayano H: Cytogenetics studies in Lilium callosum. III. Preferential segregation of a supernumerary chromosome in EMCs. Proc Jpn Acad 33:553–558 (1957). Leitch IJ, Bennett MD: Genome downsizing in polyploid plants. Biol J Linnean Soc (2004). Leitch IJ, Chase MW, Bennett MD: Phylogenetic analysis of DNA C-values provides evidence for a small ancestral genome size in flowering plants. Ann Bot 82:85–94 (1998). Levin DA: The Role of Chromosomal Change in Plant Evolution. (Oxford University Press, Oxford 2002). Lo´pez-Leo´n MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL: Generating high variability of B chromosomes in the grasshopper Eyprepocnemis plorans. Heredity 71:352–362 (1993). Missouri Botanical Garden: Index to Plant Chromosome Numbers (IPCN). http://mobot.mobot.org/ W3T/Search/ipcn.html (2003). Moss JP: B-chromosomes and breeding systems. Chromosomes Today 2:268 (1969). Müntzing A: Cytogenetics of accessory chromosomes (B chromosomes). Caryologia S6:282–301 (1954). Palestis BG, Burt A, Jones RN, Trivers R: B chromosomes are more frequent in mammals with acrocentric karyotypes: support for the theory of centromeric drive. Proc R Soc Lond B 271:S22–S24 (2004). Pardo-Manuel de Villena F, Sapienza C: Female meiosis drives karyotypic evolution in mammals. Genetics 159:1179–1183 (2001a). Pardo-Manuel de Villena F, Sapienza C: Nonrandom segregation during meiosis: the unfairness of females. Mammal Genome 12:331–339 (2001b). Puertas MJ: Nature and evolution of B chromosomes in plants: a non-coding but information-rich part of plant genomes. Cytogenet Genome Res 96:198– 205 (2002).

Cytogenet Genome Res 106:151–158 (2004)

157 15

Puertas MJ, Ramirez A, Baeza F: The transmission of B chromosomes in Secale cereale and Secale vavilovii populations. II. Dynamics of populations. Heredity 58:81–86 (1987). Shaw MW, Hewitt GM: The effect of temperature on meiotic transmission rates of the B chromosome of Myrmeleotettix maculatus (Orthoptera: Acrididae). Heredity 53:259–268 (1984). Shaw MW, Hewitt GM: B chromosomes, selfish DNA and theoretical models: where next? Oxf Surv Evol Biol 7:197–223 (1990). Soltis DE, Soltis PS, Bennett MD, Leitch IJ: Evolution of genome size in the angiosperms. Am J Bot 90:1596–1603 (2003).

158 16

Stitou S, Zurita F, Dı´az de la Guardia R, Jiménez R, Burgos M: Transmission analysis of B chromosomes in Rattus rattus from Northern Africa. Cytogenet Genome Res 106:344–346 (2004). Thomson RL: B chromosomes of Rattus fuscipes II. The transmission of B chromosomes to offspring and population studies: support for the parasitic model. Heredity 52:363–372 (1984). Tokarskaia ON, Efremova DA, Kan NG, Danilkin AA, Sempere A, Petrosian VG, Semenova SK, Ryskov AP: Variability of multilocus DNK markers in populations of the Siberian (Capreolus pygargus Pall.) and European (C. capreolus L.) roe deer. Genetika 36:1520–1530 (2000).

Cytogenet Genome Res 106:151–158 (2004)

Trivers R, Burt A, Palestis BG: B chromosomes and genome size in flowering plants. Genome 47:1–8 (2004). Vinogradov AE: Mirrored genome size distributions in monocot and dicot plants. Acta Biotheor 49:43–51 (2001). Vujosevic M, Blagojevic J: B chromosomes in populations of mammals. Cytogenet Genome Res 106: 247–256 (2004). Wu T: B chromosomes in Sorghum stipoideum. Heredity 68:457–463 (1992). Yosida TH: Some genetic analysis of supernumerary chromosomes in the black rat in laboratory matings. Proc Jpn Acad B 54:440–445 (1978).

What Are B Chromosomes? Cytogenet Genome Res 106:159–164 (2004) DOI: 10.1159/000079282

Are the dot-like chromosomes in Trinomys iheringi (Rodentia, Echimyidae) B chromosomes? V. Fagundes,a J.P.M. Camachob and Y. Yonenaga-Yassudac a Departamento de Ciências Biolo ´ gicas, Centro de Ciências Humanas e Naturais, Universidade Federal do Espı´rito Santo, Espı´rito Santo (Brazil); b Departamento de Genética, Universidad de Granada, Granada (Spain); c Departamento de Biologia, Instituto de Biociências, Universidade de Sa ˜o Paulo, Sa˜o Paulo (Brazil)

Abstract. In this article we review the existing cytogenetic information on the polymorphic dot-like chromosomes in Trinomys iheringi, the only species in the family Echimyidae harboring them, and provide new data on the frequency, banding properties, meiotic behavior and DNA composition of these minute chromosomes. Since no individuals lacking these chromosomes have hitherto been found, one of the main properties of B chromosomes, i.e. dispensability, has not yet been tested, so that some reasonable doubt might exist on whether they are true B chromosomes. The dot-like chromosomes were also present in the twelve new individuals analyzed, showed intraindividual variation in number, most likely due to mitotic insta-

bility during development, failed to show C-bands, showed late-replication, paired among them in meiosis, but not with the large chromosomes, and appeared to be mainly composed of telomeric DNA. These results suggest that these dot-like chromosomes might actually be mitotically unstable micro B chromosomes showing very high frequency in the natural populations thus far analyzed. But, to be confident of this conclusion, individuals lacking the dot-like chromosomes should actively be searched in future research to test their dispensability.

B chromosomes are dispensable chromosomes additional to the standard complement (A chromosomes) which are usually heterochromatic, do not contain major genes (except ribosomal DNA sequences), show non-Mendelian inheritance, do not pair and recombine with A chromosomes and can exhibit high frequencies in natural populations (Jones and Rees, 1982; Camacho et al., 2000).

The spiny rat genus Trinomys (formerly a subgenus of Proechimys, see Lara and Patton, 2000) belongs to the diverse family Echimyidae, and is limited to the eastern states of Brazil, within the Brazilian Atlantic rainforest domain. The genus comprises six species: T. dimidiatus, T. setosus, T. albispinus, T. yonenagae, T. moojeni and T. iheringi (Pessôa and Reis, 1992a, b, 1993, 2002; Rocha, 1995). All T. iheringi specimens analyzed from northern populations in the state of Sa˜o Paulo harbored a variable number (1– 4) of minute dot-like chromosomes in addition to 30 pairs of larger A chromosomes. These small chromosomes were described as B chromosomes by Yonenaga-Yassuda et al. (1985) since the 60 A chromosomes showed almost complete coincidence in G-bands with the 60 A chromosomes in the closely related T. albispinus, a species lacking these dot-like chromosomes (Leal-Mesquita et al., 1992). However, Lara and Patton (2000) evaluated the phylogenetic relationships of Trinomys species using cytochrome b sequence data and suggested that T. iheringi and T. albispinus are not closely related but belong to separate clades.

Supported by Fundaça˜o de Amparo a Pesquisa do Estado de Sa˜o Paulo (FAPESP), Conselho Nacional do Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq) and the Spanish Ministerio de Ciencia y Tecnologı´a (BOS2000-1521) and Plan Andaluz de Investigacio´n (CVI-165). Received 27 October 2003; revision accepted 17 February 2004. Request reprints from Valéria Fagundes Departamento de Ciências Biolo´gicas, CCHN-UFES Av. Marechal Campos, 1468 Maruipe, Vito´ria, ES (Brazil), 29040-090 telephone: +55 (27) 3335 7254; fax: +55 (27) 3335 7254 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0159$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. Number of B chromosomes in somatic cells of Trinomys iheringi from Sa˜o Paulo state (Brazil) Referencea Specimen Sexb Localityc No. of cells with 0–6 dot-like chromosomes

1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2

a b c d e

CIT 1 CIT 4 CIT 12 CIT 21 CIT 24 CIT 30 CIT 42 CIT 51 CIT 271 CIT 273 CIT 276 CIT 334 K A B C D E F G H L M I J TOTAL

M M F M M M M M F F M M M F M M M F F M M M F F M

1 1 1 1 1 1 1 1 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 4 4

0

1

2

3

4

5

6

0 0 0 0 0 0 0 0 0 0 0 0 0 0 7 2 1 0 0 5 3 8 0 5 1

0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 10 10 0 0 26 39 45 0 26 7

0 1 1 19 0 2 0 1 0 0 0 1 4 3 23 0 1 6 0 0 0 0 30 0 56

0 6 10 1 2 19 1 15 1 1 1 2 59 2 1 0 0 1 3 0 0 0 8 0 0

4 8 23 0 4 2 10 0 2 18 0 17 1 15 0 0 0 0 0 0 0 0 0 0 0

19 0 5 0 19 0 4 0 0 1 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0

31 0 1 0 1 0 1 0 17 0 16 0 1 0 0 0 0 0 0 0 0 0 0 0 0

Median Mode

MId

Ae

54 15 41 22 26 23 16 16 20 20 19 20 65 20 31 12 12 7 3 31 42 53 38 31 64 701

6 4 4 2 5 3 4 3 6 4 6 4 3 4 2 1 1 2 3 1 1 1 2 1 2 3.00

0.083 0.133 0.134 0.068 0.069 0.058 0.109 0.021 0.058 0.025 0.044 0.050 0.041 0.100 0.242 0.167 0.167 0.071 0 0.161 0.071 0.151 0.105 0.161 0.070 0.09

–0.083 –0.133 –0.049 –0.023 –0.054 0 0.078 –0.021 –0.058 0 –0.044 –0.050 0 –0.100 –0.210 –0.167 0 0.071 0 –0.161 –0.071 –0.151 0.105 –0.161 –0.070 –0.05

5.50 3.47 3.80 1.95 4.73 3.00 4.31 2.94 5.65 4.00 5.74 3.80 3.00 3.60 1.58 0.83 1.00 2.14 3.00 0.84 0.93 0.85 2.21 0.84 1.86 2.86

6 4 4 2 5 3 4 3 6 4 6 4 3 4 2 1 1 2 3 1 1 1 2 1 2 3.00

1 = Present report, 2 = Yonenaga-Yassuda et al. (1985). M = Male, F = Female. 1 = Iporanga, 2 = Iguape, 3 = Casa Grande, 4 = Ubatuba. MI = Mitotic instability index. A = Accumulation.

In addition, the definitive evidence that these chromosomes are true B chromosomes, i.e. their dispensability, has not yet been obtained since no individuals lacking them have hitherto been found. Here we provide new information on the presence of the dot-like chromosomes in twelve T. iheringi specimens from two new populations, and report new features of their frequency, meiotic behavior, banding response and DNA composition, in order to evaluate whether, with the available information, they could be considered true B chromosomes. Materials and methods Cytogenetic analysis was carried out in 12 specimens (9 males and 3 females) of Trinomys iheringi collected at two southern localities in the state of Sa˜o Paulo (Iporanga and Iguape), Brazil (Table 1). Mitotic metaphases were obtained from bone marrow and spleen after in vivo colchicine treatment and/or fibroblast cultures from embryos, ear or tail biopsy cultures in Dulbecco’s Modified Eagle Medium supplemented with 20 % fetal bovine serum. Meiotic preparations of testis followed Eicher (1966). RBG-, GTGand CBG-banding and Ag-NOR (nucleolar organizer regions) staining were performed using routine techniques. Fluorescence in situ hybridization (FISH) was performed following the protocol of telomeric probes (all human telomeres P5097-DG5-Oncor, digoxigenin labeled). In situ hybridization using a probe containing the 18S rDNA gene of Xenopus laevis was carried out according to Santos et al. (2001).

160 18

Total no. of Mean cells

Cytogenet Genome Res 106:159–164 (2004)

To quantify intraindividual variation in the number of dot-like chromosomes, 14 or more cells were analyzed in each of the 12 new individuals collected (Table 1). Variation was also analyzed in data previously published by Yonenaga-Yassuda et al. (1985). In each individual, we calculated the mean number of dot-like chromosomes per cell, as well as the median and mode of these distributions. In addition, we calculated the mitotic instability index (MI) proposed by Pardo et al. (1995) for quantifying mitotic instability in B chromosomes and, finally, the accumulation index (A), obtained from the difference between mean and median relative to the median, which indicates accumulation if positive or elimination if negative. This last parameter results from assuming that the median number of dot-like chromosomes in the analyzed tissue represents the original number in the zygote. The statistical analyses employed were one-way ANOVA and Student’s t test for dependent samples.

Results All twelve individuals from the southern populations carried dot-like chromosomes showing extensive intraindividual variation in number (Table 1). The A chromosome complement consists of 25 pairs of meta-/submetacentric and four pairs of subtelocentric autosomes (10, 11, 25 and 26) differing in size, the X chromosome being a large submetacentric and the Y a minute metacentric (Fig. 1). The submetacentric chromo-

Fig. 1. Karyotype of a male of Trinomys iheringi with 2n = 64 after conventional staining. Note the presence of four dot-like B chromosomes. Bar = 10 Ìm.

some pair no. 7 carries a secondary constriction interstitially located in the long arm. C-banding pattern revealed conspicuous centromeric bands in most A chromosomes, including the X chromosome, the short arm of the Y chromosome and the interstitial secondary constriction in chromosome no. 7. The dot-like chromosomes showed a negative response to C-banding (Fig. 2a). The analysis of meiotic pairing at diplotene revealed that, in cells with three dot-like chromosomes, they were arranged as one bivalent and one univalent and they did not show association with any A chromosome (Fig. 2b). RBG-banding revealed a late-replicating pattern of the dot-like chromosomes (Fig. 3). Fluorescence in situ hybridization showed the presence of telomeric DNA sequences at both ends of all chromosomes, including the dot-like ones. Considering the minute size of the dot-like chromosomes, it is very likely that they are mainly composed of telomeric DNA sequences (Fig. 4a), although the presence of undetected centromeric DNA repeats cannot be ruled out. FISH with rDNA revealed the presence of rRNA genes only in the secondary constriction of chromosome no. 7 (Fig. 4b). Although all individuals hitherto analyzed carried dot-like chromosomes (see Table 1), the mean number per individual in the southern localities (Iporanga and Iguape) was significantly higher than that in the northern localities (Casa Grande and Ubatuba) (F = 10.47, df = 3, 21, P = 0.0002) (Fig. 5). The analysis of intraindividual variation in the number of dot-like chro-

Fig. 2. (a) Metaphase of a 2n = 62 individual of Trinomys iheringi after CBG-banding. Some chromosomes show pericentromeric heterochromatin as well as the interstitial secondary constriction of pair 7. Dot-like B chromosomes are non-heterochromatic (arrows). (b) Diplotene of a 2n = 63 individual showing the dot-like Bs as univalent and bivalent (arrows).

mosomes (Table 1) showed that the average MI index for the 25 individuals in Table 1 was 0.09, but it did not differ significantly among localities (F = 2.84, df = 3, 21, P = 0.063). Likewise, the A parameter showed an average value of –0.05, but there were no significant differences among localities (F = 0.76, df = 3, 21, P = 0.528). The negative A value suggests about 5 % loss of dot-like chromosomes in the somatic tissues analyzed, such as is also indicated by the significantly lower mean (2.86) than median (3) (see Table 1) (Student’s t = 3.29, df = 24, P = 0.003).

Cytogenet Genome Res 106:159–164 (2004)

161 19

Fig. 3. Karyotype of Trinomys iheringi with 2n = 64 after RBG-banding. The dot-like B chromosomes present a late-replicating pattern.

Discussion B chromosomes are defined as dispensable supernumeraries which do not recombine with any member of the A chromosome set and have irregular and non-Mendelian modes of inheritance. In addition, they are frequently smaller than A chromosomes, may be totally or partially heterochromatic, genetically inert and scarcely affect the viability of the individuals (Jones, 1995; Camacho et al., 2000). The dot-like chromosomes described here for T. iheringi show many of the above mentioned properties, but dispensability remains to be proven since not a single individual lacking them has hitherto been found. In order to evaluate whether they can be considered true B chromosomes, we have analyzed several cytogenetic features such as frequency variation, response to banding techniques, meiotic pairing and DNA composition. Our results have shown that the dot-like chromosomes in T. iheringi resemble, in some respects, the micro B chromosomes found in the Korean field mouse Apodemus peninsulae (Kartavtseva and Roslik, 2004), i.e. they are also minute dotlike chromosomes showing intraindividual variation due to mitotic instability. An association between a small size and mitotic instability is usually found for B chromosomes in other

162 20

Cytogenet Genome Res 106:159–164 (2004)

Fig. 4. Metaphases of Trinomys iheringi. (a) Fluorescence in situ hybridization (FISH) of telomere probes of a 2n = 66 cell showing signals in all telomeres including the dot-like B chromosomes (arrows). (b) FISH of ribosomal probes of a 2n = 62 cell showing signals at the secondary constriction region which was coincident with Ag-NOR position. The dot-like B chromosomes are indicated by arrows.

Fig. 5. Mean frequency of dot-like chromosomes per individual in somatic cells of Trinomys iheringi collected at four localities from Sa˜o Paulo state (Brazil). Locality: 1 = Iporanga, 2 = Iguape, 3 = Casa Grande, 4 = Ubatuba.

organisms including grasshoppers (Hewitt, 1979) and lizards (Bertolotto et al., 2004). But the dot-like chromosomes in T. iheringi show a negative response to C-banding, in contrast to the micro Bs in A. peninsulae which are darkly C-banded. This difference presumably reflects their different composition for repetitive DNA sequences. In T. iheringi, the dot-like chromosomes are mostly composed of telomeric DNA repeats, which explain why they show a negative response to C-banding the same as all telomere regions in A chromosomes (see Fig. 2a). The late-replicating nature of the dot-like chromosomes (see Fig. 3) reinforces the view that they are mostly made of heterochromatin containing repetitive DNA, especially telomeric repeats (see Fig. 4). The meiotic behavior of the dot-like chromosomes suggests that they remain as uni- or bivalents in diplotene-metaphase I cells, and do not pair with any of the A chromosomes. This behavior is also typical for B chromosomes (see Camacho et al., 2000). Intraindividual variation in the number of dot-like chromosomes in T. iheringi can be attributed to processes of mitotic non-disjunction during development. This variation yields distributions where a class predominates so that median and mode coincided in all individuals analyzed (see Table 1). This suggests that assuming that this class resembles the number of dot-like chromosomes originally present in the zygote (or the analyzed tissue) is a parsimonious inference. In mitotically unstable B chromosomes, such as those in the migratory locust Locusta migratoria (see Pardo et al., 1995), this inference seems to be also appropriate. Under this assumption, we can conclude that the dot-like chromosomes in T. iheringi are slightly (5 %) eliminated from the somatic tissues analyzed. It would be conceivable that this elimination would be paralleled

by an accumulation in the germ line, also resembling the case in L. migratoria (Nur, 1969; Kayano, 1971; Viseras et al., 1990), but additional research is necessary comparing the number of dot-like chromosomes in somatic and germ tissues in the same individuals. The MI index showed by the dot-like chromosomes in T. iheringi (about 0.09 on average) is of roughly the same order of magnitude as the values reported for mitotically unstable B chromosomes in L. migratoria (Pardo et al., 1995). In the fish Prochilodus lineatus, the MI values were very high in 1979–80 (about 0.5) but very low only 10 years later ( ! 0.03), which was attributed to the possible neutralization of the unstable B chromosome leading to the loss of its mitotic instability (Cavallaro et al., 2000). The extremely high frequency of dot-like chromosomes in T. iheringi might be a logical consequence for chromosomes showing mitotic instability leading to net accumulation in the germ line. In L. migratoria, for instance, the mitotically unstable Bs show accumulation in both males and females and are present in most analyzed populations from Asia, Africa, Australia and Europe (see Pardo et al., 1994). High frequency of B chromosomes has been reported in other mammalian species. For instance, Baverstock et al. (1976) found a minimum of six B chromosomes in the Australian rat Uromys caudimaculatus. Hayman and Martin (1965) found 2–6 B chromosomes in all analyzed individuals in the marsupial Shoinobates volans. Likewise, Volobujev (1980) found a high frequency (95.6 %) of micro B chromosomes in most individuals of the Korean field mouse Apodemus peninsulae individuals analyzed. In this species, all individuals analyzed in some populations carried micro B chromosomes (see also Kartavtseva and Roslik, 2004). In conclusion, the collection of data presented and discussed here suggest that the dot-like chromosomes in T. iheringi are likely B chromosomes, but future research should be conducted to test their dispensability, by actively searching 0B individuals in the field or else by controlled crosses in the laboratory trying to generate them. In addition, the isolation of possible centromeric DNA repeats in these minute chromosomes is another reasonable research since it might complete the picture of their DNA composition. Finally, the analysis of the inheritance of these chromosomes, in controlled crosses, should provide the crucial information to ascertain why they have been so successful in natural populations.

Acknowledgements We are profoundly grateful to Leonora P. Costa, Yuri L.R. Leite and Albert D. Ditchfield for relevant contributions to the manuscript and to everyone who was involved in field and laboratory work.

Cytogenet Genome Res 106:159–164 (2004)

163 21

References Baverstock PR, Watts CHS, Hogarth JT: Heterochromatin variation in the Australian rodent Uromys caudimaculatus. Chromosoma 57:397–403 (1976). Bertolotto CEV, Pellegrino KCM, Yonenaga-Yassuda Y: Occurrence of B chromosomes in lizards: a review. Cytogenet Genome Res 106:243–246 (2004). Camacho PM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Philos Trans R Soc Lond B Biol Sci 355:163–178 (2000). Cavallaro ZI, Bertollo LAC, Perfectti F, Camacho JPM: Frequency increase and mitotic stabilization of a B chromosome in the fish Prochilodus lineatus. Chromosome Res 8:627–634 (2000). Eicher E: An improve air-drying technique for recovery of all stages of meiosis in the mammalian testis. Mammal Chrom Newsl 20:74 (1966). Hayman DL, Martin PC: Supernumerary chromosomes in the marsupial Shoinobates volans (Kerr.). Aust J Biol Sci 18:1081–1082 (1965). Hewitt GM: Grasshopper and crickets, in John B (ed): Animal Cytogenetics, vol 3: Insecta 1 Orthoptera (Gebrüder Borntraeger, Berlin, Stuttgart 1979). Jones RN: B chromosomes in plants. New Phytol 131:411–434 (1995). Jones RN, Rees H: B chromosomes, 1st ed (Academic Press, London, New York 1982). Kartavtseva IV, Roslik GV: A complex B chromosome system in the Korean field mouse, Apodemus peninsulae. Cytogenet Genome Res 106:271–278 (2004).

164 22

Kayano H: Accumulation of B chromosomes in the germ-line of Locusta migratoria. Heredity 27:119– 123 (1971). Lara MC, Patton JL: Evolutionary diversification of spiny rats (genus Trinomys, Rodentia: Echimyidae) in the Atlantic Forest of Brazil. Zoolog J Linn Soc 130:661–686 (2000). Leal-Mesquita ER, Yonenaga-Yassuda Y, Chu TH, Rocha PLB: Chromosomal characterizarion and comparative cytogenetic analysis of two species of Proechimys (Echimyidae, Rodentia) from the Caatinga domain of the state of Bahia, Brazil. Caryologia 45:197–212 (1992). Nur U: Mitotic instability leading to an accumulation of B-chromosomes in grasshoppers. Chromosoma 27:1–19 (1969). Pardo MC, Lo´pez-Leo´n MD, Cabrero J, Camacho JPM: Transmission analysis of mitotically unstable B chromosomes in Locusta migratoria. Genome 37:1027–1034 (1994). Pardo MC, Lo´pez-Leo´n MD, Viseras E, Cabrero J, Camacho JPM: Mitotic instability of B chromosomes during embryo development in Locusta migratoria. Heredity 74:164–169 (1995). Pessôa LM, Reis SF: Bacular variation in the subgenus Trinomys, genus Proechimys (Rodentia, Echimyidae). Z Säugetierk 57:100–102 (1992a). Pessôa LM, Reis SF: A new species of spiny rat genus Proechimys, subgenus Trinomys (Rodentia, Echimyidae). Z Säugetierk 57:39–46 (1992b).

Cytogenet Genome Res 106:159–164 (2004)

Pessôa LM, Reis SF: Proechimys dimidiatus. Mamm Sp 441:1–3 (1993). Pessôa LM, Reis SF: Proechimys albispinus. Mamm Sp 693:1–3 (2002). Rocha PLB: Proechimys yonenagae, a new species of spiny rat (Rodentia: Echimyidae) from fossil sand dunes in the Brazilian Caatinga. Mammalia 59:537–549 (1995). Santos N, Fagundes V, Yonenaga-Yassuda Y, Souza MJ: Comparative karyology of Brazilian vampire bats Desmodus rotundus and Diphylla ecaudata (Phyllostomidae, Chiroptera): banding patterns, base-specific fluorochromes and FISH of ribosomal genes. Hereditas 134:189–194 (2001). Viseras E, Cano MI, Camacho JPM, Santos JL: Relationship between mitotic instability and accumulation of B chromosomes in Locusta migratoria. Genome 33:23–29 (1990). Volobujev VT: B-chromosome system of the Asiatic forest mouse Apodemus peninsulae (Rodentia, Muridae). I. Structure of karyotype, C- and G-bands and B-chromosomes variation pattern. Genetika 16:1277–1283 (1980). Yonenaga-Yassuda Y, Souza MJ, Kasahara S, L’Abbate M, Chu TH: Supernumerary system in Proechimys iheringi iheringi (Rodentia, Echimyidae) from the state of Sa˜o Paulo, Brazil. Caryologia 38:179–194 (1985).

What Are B Chromosomes Cytogenet Genome Res 106:165–172 (2004) DOI: 10.1159/000079283

Human supernumeraries: are they B chromosomes? C. Fuster, M.A. Rigola and J. Egozcue Departament de Biologia Cel W lular, Fisiologia i Immunologia, Universitat Autònoma de Barcelona, Bellaterra (Spain)

Abstract. In humans, the presence of supernumerary chromosomes is an unusual phenomenon, which is often associated with developmental abnormalities and malformations. In contrast to most animal and plant species, the extensive knowledge of the human genome and the ample set of molecular and cytogenetic tools available have permitted to ascertain not only that most human supernumerary chromosomes (HSCs) derive from the A chromosome set, but also the specific A chromosome from which most of them arose. These extra chromosomes are classified into six types on the basis of morphology and size. There are both heterochromatic and euchromatic HSCs, the latter being more detrimental. Most are mitotically stable, except some producing individual mosaicism. No information is available on the HSC transmission rate since extensive familial studies are not usually performed generally because of death of the relatives or lack of cooperation. The main B chromosome

Introduction The presence of “extra chromosomes” in insects was discovered by Wilson in 1906 (Wilson, 1906). Twenty years later, Randolph (1928) proposed the denomination of “B chromosomes”, to differentiate them from the standard “A chromosomes” in maize. Since them, this denomination has been applied to extra or dispensable chromosomes in a variety of plants, fungi and animals (Jones, 1995). In animals, B chromo-

Financial support was given by SAF2003-03894. Received 11 September 2003; manuscript accepted 19 January 2004. Request reprints from: Prof. Josep Egozcue, Unitat de Biologia Cel W lular Departament de Biologia Cel W lular, Fisiologia i Immunologia Edifici CS, Universitat Autònoma de Barcelona, ES–08193 Bellaterra (Spain) telephone: +34-93-581-1660; fax: +34-93-581-2295 e-mail: [email protected].

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0165$21.00/0

property failing in HSCs seems to be their population spread as polymorphisms, since most HSCs seem to correspond to extra A chromosomes or centric fragments spontaneously arisen in the analysed individual or one of his/her parents. However, we cannot rule out at this moment, that more intensive studies on population distribution and frequency of those HSCs most closely resembling B chromosomes (i.e. those heterochromatic and thus less detrimental) would reveal possible HSCs polymorphisms. Although HSCs cannot be considered B chromosomes, some of them might be a source for future B chromosomes. The best candidates would be heterochromatic HSCs, which might manage to drive in either sex. To ascertain this possibility, research on inheritance and population studies would be very helpful in combination with the powerful cytogenetic and molecular tools available for our species. Copyright © 2004 S. Karger AG, Basel

somes have been found in less than 5 % of mammalian species (Vujocevic and Blagojevic, 2004), and are very rare in birds (Camacho, 2004). In humans, the supernumerary marker chromosomes, extra structurally abnormal chromosomes or stable additional chromosomes, found occasionally in addition to the normal complement of 46 chromosomes, show some characteristics that allow us to consider them as accessory or B chromosomes. The first cases of human supernumerary chromosomes (HSC) were published by Weber et al. (1970) suggesting the existence of a close relationship between the presence of an additional small metacentric chromosome in the karyotype and the existence of anal atresia and eye abnormalities in the patient (cat-eye syndrome). A few years later, several cases of an inverted duplication of chromosome 15 (one of the most frequent HSCs) associated with mental retardation, sterility and various nonspecific neurological disorders were reported (Wisniewski et al., 1979; Wisniewski and Doherty, 1985). By that time it was discovered

Accessible online at: www.karger.com/cgr

Fig. 1. Identification of an SMC present in a oligozoospermic patient using a combination of techniques. (a) G-banding; (b) C-banding; (c) Ag-NOR staining; (d) comparative genomic hybridisation; (e) fluorescence in situ hybridisation using specific 15 centromeric and Prader-Willi/Angelman region probes. While G-, C- and Ag-NOR staining did not provide any information, the use of FISH and CGH allowed us to determine that the SMC originated from the 15q11.1 → q12.3 region. Courtesy of Cristina Hernando.

that bisatellited extra-small metacentric chromosomes produced no obvious phenotypic abnormalities in newborns (Friedrich and Nielsen, 1974). In the 1980s the first cases of HSCs in several series of prenatal diagnosis (Warburton, 1984; Sachs et al., 1987) were published. Thus, it became obvious that the HSC group is characterized by an extreme heterogeneity regarding their size, morphology, origin and clinical consequences, and may be found in phenotypically normal individuals, in patients with constitutional genetic anomalies or even in cancer patients. Can HSCs be considered B chromosomes? According to the International System for Human Cytogenetic Nomenclature (ISCN, 1995), an HSC or marker chromosome (as they are usually known) “is a structural abnormal chromosome in which no part can be identified. Whenever any part of the abnormal chromosome can be recognized, it is a derivative chromosome”. The heterogeneous nature and phenotypical effects of HSCs actually resemble the case of B chromosomes, but other properties need to be also met regarding dispensability, inheritance and population dynamics. Here we review these aspects with the purpose of ascertaining whether HSCs can be considered B chromosomes.

166 24

Cytogenet Genome Res 106:165–172 (2004)

Identification of HSCs by molecular and cytogenetic techniques Until recent years, most HSCs went unclassified because their small size did not allow their identification using banding techniques, as often happens with B chromosomes. However, in humans, the combination of banding methods (G and C banding, Ag-NOR, distamycin A and DAPI staining) with fluorescent in situ hybridization (FISH) (Blennow et al., 1995; Ning et al., 1999; Langer et al., 2001; Nietzel et al., 2001; Henegariu et al., 2001; Yaron et al., 2003) and comparative genomic hybridization (CGH) (Bryndorf et al., 1995; Erdel et al., 1997; Levy et al., 2000) has allowed their complete identification in most cases (Fig. 1), since almost all of them were derived from A chromosomes. In addition, the use of highly polymorphic markers usually allows one to determine their parental origin (Crolla et al., 1998; Schroer et al., 1998; Webb et al., 1998). The use of conventional FISH techniques using different types of probes, such as whole chromosome painting probes (Rauch et al., 1992), or chromosome specific pericentromeric alphoid satellite probes (Callen et al., 1992; Blennow et al., 1995; Spinner et al., 1995) has allowed one to identify a high number

Table 1. Human Supernumerary Chromosome classification Morphology

Size

Frequency (% of HSC)

Chromatin composition

acrocentric (single centromere; may be bisatellited)

small

>50 %

Type II: Large bisatellited and acrocentric dicentric acrocentric (one/two centromeres may be inactivated) Type III: Non- non acrocentric acrocentric

large

Chromosomal origin

Risk of anormal phenotype

Mitotic instability

References

heterochromatin familial/de novo

generally from 15 and 22

low /high cat eye syndrome

Warburton,1991; Crolla et al., 1998; Viersbach et al., 1998

?

euchromatin

most inv dup (15) from maternal origin

most commom is inv dup (15)

high

No (may be lost and produce mosaicism) No (may be lost and produce mosaicism)

heterogeneous

25 %

heterogeneous

small

10 %

heterogeneous

heterogeneous

No (may be lost and produce mosaicism) Yes (typical of rings)

Warburton,1991

Type IV: Ring ring

Type V: Translocation –derived

heterogeneous

heterogeneous

?

euchromatin

high

No

Stamberg and Thomas, 1986; Lin et al., 1986

Type VI: Neocentrics

heterogeneous, all lacking detectable centromere (functional centromere)

heterogeneous

?

euchromatin

i(18p) usually all chromosomes produced de (except chr. 5) novo but may be maternal de novo all autososomes (except chr. 5, 11, 22) originated by most commom a 3:1 meiotic is segregation of der (22)t(11;22) a balanced translocation familial/de most frequent novo 3q,13q and 15q

high

No

Voullaire et al.,1993; Abeliovich et al., 1996; Rivera et al.,1999; Levy et al., 2000; Mackie Ogilvie et al., 2001; Li et al., 2002; Amor and Choo, 2002; Spiegel et al., 2003

Type I: Small acrocentric

Origin

of HSC. However, to use this approach one needs some previous information to choose the appropriate probe. This is obviously difficult in cases where the HSC appeared de novo. MulticolorFISH (M-FISH) (Speicher et al., 1996) and multicolor spectral karyotyping (SKY) (Schröck et al., 1996) allow the simultaneous identification of all chromosomes, and thus the identification of de novo HSCs, ring and non-satellited HSCs (Haddad et al., 1998; Huang et al., 1998; Ning et al., 1999; Yaron et al., 2003). However, if the HSC does not contain euchromatin, it cannot be identified. This happens with many HSCs derived from the short arms of acrocentric chromosomes. In these cases, the AcroM-FISH technique described by Langer and colleagues (Langer et al., 2001), based on the use of probes for all human acrocentric chromosomes (13/21, 14/22, 15 and a probe specific for rDNA), allows their identification. The centromere-specific multicolor-FISH technique (cenM-FISH) (Nietzel et al., 2001) allows the identification of all centromere regions. However, this method does not identify the centromeres of chromosomes 13 and 21, and cannot identify neocentric HSCs which are mitotically stable or HSCs without pericentromeric material, which are mitotically unstable (Kock, 2000). Comparative genomic hybridization (CGH) (Kallionemi et al., 1994) where patient and normal reference genomic DNA are differentially labeled and hybridized to normal metaphase chromosomes allows one to identify not only the chromosome from which the HSC originated, but even the chromosome region from which it derived. Thus, the HSC can be identified with regard to its band(s) of origin. This is important when trying to establish karyotype-phenotype correlations (Levy et al., 2000).

30–100%

Webb,1994

Crolla,1998

General characteristics, frequency and structure of HSCs (Table 1) As with B chromosomes, HSCs are only found in some individuals in the population, in frequencies in newborns ranging from 0.014 to 0.072 % (Warburton, 1991). Most frequently, HSCs are of small size and contain centromeric heterochromatin and centromere specific proteins (CENPs). However, their morphological characteristics can be quite variable, and for this reason they have been classified into six groups (Blennow et al., 1994; Crolla, 1998; Viersbach et al., 1998; Eggermann et al., 2002). Table 1 shows the main characteristics of these six types, and Fig. 2 shows some examples. Type I: Small acrocentric HSCs Most HSCs (1 50 %) are small fragments, with a single centromere (small supernumerary marker chromosomes or smallHSCs) (Warburton, 1991). In general, they only include the paracentromeric region, and can be bisatellited (Crolla et al., 1998; Viersbach et al., 1998). Most often, small-HSCs originate from human chromosomes 15 and 22. Type II: Large acrocentric HSCs: The inv dup (15) syndrome This group contains the bisatellited and dicentric large acrocentric HSCs or large-HSCs. In these euchromatic HSCs, one or two centromeres may be inactivated. The most common large acrocentric marker is the “inv dup (15)” also known as dic(15;15), psu dic (15;15) or iso (15p). It is a bisatellited dicentric which contains two copies of the short arm and two

Cytogenet Genome Res 106:165–172 (2004)

167 25

Fig. 2 . Idiogram of four supernumerary marker chromosomes involved in specific syndromes. (a) Inverted duplication 15 or “in dup (15) syndrome”; (b) inverted duplication 22 or “cat eye syndrome”; (c) isochromosome 12p or “Pallister-Killian syndrome”; (d) isochromosome 18p or “i(18p) syndrome”.

copies of part of the long arm of chromosome 15 (Fig. 2a). In contrast with Type I small-HSCs (15), the large-HSC (15) with breakpoints in the 15q11 → q13 region contains clearly visible euchromatin between the two centromeres (Webb, 1994). Type III: Non-acrocentric HSCs About 25 % of HSCs originate from non-acrocentric chromosomes. This is an extremely heterogeneous group, in which mosaicism is a frequent feature. Non-acrocentric HSCs have been found to originate from any non-acrocentric chromosome, with the exception of chromosome 5. Type IV: Ring HSCs Ring HSCs are usually small, generated de novo, and relatively frequent (10 % of HSCs). Ring HSCs have been described for all human chromosomes except 5, 11 and 22 (Crolla, 1998). Type V: Translocation-derived HSCs This is a heterogeneous group with respect to morphology and size. All translocation-derived HSCs hitherto described contain euchromatin. In some cases, the HSCs originate from the 3:1 meiotic segregation of a translocation multivalent.

168 26

Cytogenet Genome Res 106:165–172 (2004)

Type VI: Neocentric HSCs In 1994, Blennow and colleagues (1994) described a new type of HSC lacking detectable centromeric heterochromatin, which remained stable during cell division, indicating that it contains a functional centromere. These HSCs are known as “analphoid, or alphoid negative, or neocentric marker chromosomes” (neo-HSC). These markers originate from a non-centromeric site, and yet have fully formed kinetochores (Saffery et al., 2000; Choo, 2001), which provide mitotic stability to a fragment that otherwise would be lost (Spiegel et al., 2003). All neoHSCs described contain euchromatin, which allows for their easy identification. So far, about 60 different neo-HSCs have been described, originating from all chromosomes except 6, 7, 16, 18, 19 and 22 (Amor and Choo, 2002). Neocentric markers are morphologically heterogeneous. They may be acrocentrics, submetacentrics, metacentrics or rings (Rivera et al., 1999; Amor and Choo, 2002). Although they may lack a visible primary constriction (centromere), the presence of kinetochores allows for its identification. Analysis of neo-HSCs using FISH (to identify the chromosome) and immunofluorescence (to detect the kinetochore proteins) has shown that most neo-HSCs originate from 3q, 13q and 15q (Amor and Choo, 2002; Li et al., 2002).

In a few cases, the neo-HSC is made of chromosomal fragments not present as such in the normal human karyotype, because they do not hybridize with any chromosomal library (Mackie Ogilvie et al., 2001). These neo-HSCs could correspond to “a complex amplicon of different genomic regions, or a multifold amplification of a very small region, with a neocentromere comprising an active kinetochore but no alphoid DNA” (Mackie Ogilvie et al., 2001). This kind of neo-HSC fulfills the criterion used in fungi to consider extra chromosomes as B chromosomes (Covert, 1998). However, in humans this situation is exceptional, and the neo-HSCs do not fulfill other criteria to be characterized as B chromosomes.

Phenotypic effects of HSCs HSCs have extremely heterogeneous phenotypic consequences; they may be found in normal individuals, in patients with constitutional genetic anomalies or even in cancer patients. However, no beneficial effect has ever been reported for an HSC, and HSC effects seem to depend on their size, origin, presence or absence of euchromatin and/or satellites, degree of mosaicism, tissues affected and, in some cases, from their paternal or maternal origin, if the HSC contains imprinted genes. In general, it is considered that individuals carrying inherited (familial) HSCs have a low risk of showing phenotypical anomalies, whereas in individuals with de novo HSCs this risk may be 13 % or even higher (Warburton, 1991). In the case of familial HSCs, if the carrier parent is phenotypically normal it is assumed that the risk of fetal anomalies is nil (Brondum-Nielsen and Mikkelsen, 1995). However, this assumption is not valid in those cases in which the carrier is a mosaic. If the HSC derives from a 3:1 segregation of a balanced translocation, the risk of phenotypic anomalies is almost 100 % (Stamberg and Thomas, 1986). In de novo HSCs, prediction of the risk is almost impossible, although it may range from 100 %, as in i(18)p, i(12p) or the inv dup (22) to less than 5 % as in small der(Y) chromosomes or in bisatellited monocentric HSCs (Warburton, 1991). In the case of HSCs derived from non-acrocentric chromosomes, the risk has been estimated at 28 %, while in the case of those derived from acrocentric chromosomes (except for chromosomes 15, 22 and Y) the risk is 7 % (Crolla et al., 1998). The risk of producing malformations by small-HSCs (Type I) is very difficult to evaluate, especially if they originate de novo, although the risk is considered to be much lower if they do not contain euchromatin (Crolla et al., 1998). Small-HSCs originating from chromosomes 15 and 22 usually produce malformations except when the breakpoint is at 15q11.1 and the SMC lacks euchromatin (Blennow et al., 1995); those originating from chromosomes 13, 14 and 21 are considered to have a low risk. Recently, Eggermann et al. (2002) have described a high incidence of small-HSCs (15) in oligozoospermic and azoospermic males. The cat eye syndrome may be related to a small-HSC originated from chromosome 22: inv dup (22)(pter → q11.2). Most cases arise de novo, but some are familial, including cases of familial mosaicism (Mears et al., 1994).

In Type II HSCs, the fragment of the long arm of chromosome 15 contains the critical region for the Prader-Willi/Angelman syndromes (Blennow et al., 1995). This region, of a size of 3–4 Mb, contains several genes or pseudogenes which have been recently identified (Christian et al., 1999; Fantes et al., 2002). These large-HSC (15) can give rise to the inv dup (15) syndrome that includes developmental delay, mental retardation, neurological signs and behavioral disturbances (Schroer et al., 1998). Most large-HSC (15) producing the inv dup (15) syndrome are of maternal origin (Webb et al., 1998). Here again, the predominant maternal origin is not related to accumulation. In Type III HSCs, the estimated risk of producing malformations is 28 %, with the exception of isochromosomes 12 and 18 that always result in a severely affected phenotype (Crolla, 1998). As a rule, the risk of producing malformations for any non-acrocentric HSC is directly related to the size of the original chromosome. If the non-acrocentric HSC originates from the X chromosome, the phenotypic effect depends on whether the X inactivation centre is present, in which case the X is inactivated and no phenotypic effects are expected, or it is absent, in which case the X cannot be inactivated and the patient shows severe alterations and mental retardation even if the HSC is small in size (Callen et al., 1995). Y chromosome markers may also be associated to phenotypic defects. Recently McNerlan and colleagues (McNerlan et al., 2003) have suggested that non-acrocentric HSCs could be associated with infertility. The isochromosome 12p gives rise to the Pallister-Killian syndrome (Peltomaki et al., 1987), which includes severe malformations and mental retardation. Often, the syndrome is not diagnosed because the HSC (12) is not found in peripheral blood lymphocytes, and is only detected if a fibroblast culture is studied. This syndrome is an excellent example of tissue-specific mosaicism. The HSC may be familial, and the effects are variable depending on the degree of mosaicism (Struthers et al., 1999). The isochromosome 18p is relatively frequent, and results in a syndrome characterized by low birth weight, microcephaly, hypotonicity, campodactily or adducted thumbs and a typical face. Usually it is produced de novo, but may be maternally inherited (Eggermann et al., 1997). Type IV rings derived from alphoid and pericentromeric heterochromatin (e.g., rings 1, 9, 15 and 18) are associated with a low risk of phenotypic abnormality, while those which include euchromatin (e.g., ring 4) are usually related to mental retardation and congenital malformations. Type V HSCs are usually associated to mental and physical defects. A typical example is the supernumerary der(22)t(11; 22) syndrome, derived from the most frequent human reciprocal translocation. This syndrome includes severe mental retardation, preauricular tag, ear anomalies, cleft or arched palate, micrognatia, heart defects and genital anomalies in the male (Lin et al., 1986). The first neo-HSC (Type VI), originated at 10q25, was found during a routine karyotype in a boy with learning difficulties (Voullaire et al., 1993). The presence of a neo-HSC represents a duplication (partial trisomy) that may result in the

Cytogenet Genome Res 106:165–172 (2004)

169 27

production of mental and physical defects. In fact, taking into account that neo-HSCs contain euchromatin while many other HSCs do not, the risk is much higher for the former (Levy et al., 2000). Exceptions to this rule may occur if the amount of euchromatin is very small and its expression can be switched-off by the pericentromeric euchromatin, (Choo, 2001), or if some genes are silenced by the remodeling of the chromatin which takes place to produce a neocentromere (Levy et al., 2000). Most neo-HSCs are supernumerary inverted duplications of the distal region of an autosome, mainly chromosomes 13 and 15. Their presence results in a partial trisomy or tetrasomy of the duplicated region. The neocentric activity does not represent a selective advantage for fetal survival, because it stabilizes a trisomic or tetrasomic condition, but it does represent a selective advantage in the case of interstitial deletions, in which the acentric fragment would be lost and produce a deficiency (Abeliovich et al., 1996). The neocentric activity could also represent a new mechanism in the development of neoplasias (Abeliovich et al., 1996).

Transmission of HSCs About 50 % of HSCs are of familial origin (Warburton, 1991). These are transmitted following the same pattern as A chromosomes except for inv dup(15) which is mostly of maternal origin. So far, six patients with two small-HSCs (15) have been described; two of them had phenotypic malformations, one was apparently normal (Qumsiyeh et al., 2003) and three were infertile (Manenti, 1992; Gentile et al., 1993). Five of the six patients had inherited the marker chromosome from their mothers. A predominance of maternal transmission is characteristic of B-chromosomes in many animals, because accumulation of Bs frequently takes place in females. In humans, however, cases are too scarce to be conclusive. Since data are not generally obtained from members of the family other than the parents, usually because of death of the relatives or lack of cooperation, no information exists on HSC transmission, so that we cannot know whether this apparent predominant maternal transmission of these HSCs has anything to do with possible drive through the female. Since HSCs are generally unique, they will appear as univalents during meiosis. In the few cases in which the HSC has been detected as two copies, it is assumed that it would produce a bivalent. Most HSCs are mitotically stable, so they cannot show drive related to mitotic instability, as shown by many B chromosomes (for review, see Camacho et al., 2000). Vujocevic and Blagojevic (2004) have suggested that, in birds, the scarcity of B chromosomes might be due to a reduced tolerance to them related to the low DNA repeat content in this group; however, in humans this explanation does not apply, because of the high DNA repeat content of the human genome (International Human Genome Sequencing Consortion, 2001). In mitosis, HSCs may be lost from some tissues, producing different types of mosaicism, but is always limited to the loss of the chromosome. This limitation indicates a low tendency to

170 28

Cytogenet Genome Res 106:165–172 (2004)

non-disjunction, in contrast with what happens with B chromosomes. The only exception are ring-HSCs, because rings are typically unstable.

Can HSCs thus be considered B chromosomes? HSCs apparently share some of the characteristics of B chromosomes; they are a heterogeneous collection of chromosomes added to the standard karyotype. Some of them are heterochromatic and others euchromatic. Many of them are severely harmful, especially those containing euchromatin, presumably due to some genetic activity of putative genes contained in it and the consequent gene dosage decompensation typical of partial trisomics. This is an important difference with B chromosomes, which are usually genetically inert (for review, see Camacho et al., 2000). But HSCs fail to show even more important B chromosome properties. First, HSCs do not seem to show population polymorphisms, indicating that they have not been able to invade populations by virtue of transmission drive, the main weapon of B chromosome attack (Camacho et al., 2003). No information is available on transmission rate of any HSC, but this kind of data is crucial to ascertain the biological meaning of HSCs. Second, most HSCs seem to be derived from specific A chromosomes, suggesting that none of them has suffered molecular changes becoming “elements following their own evolutionary pathway”, as B chromosomes are considered (see Camacho et al., 2000). They are, however, best interpreted as incipient cases of A chromosome polysomy. Since A chromosome polysomy is considered one of the main sources of B chromosomes in animals and plants (Camacho et al., 2000), we could speculate whether some, if any, of the observed types of HSCs might ever evolve into a true B chromosome. It is known that a neo-B (an incipient B) needs drive, or conferring a benefit to host fitness, to invade a population and constitute a polymorphism (Camacho et al., 1997). Given the highly deleterious effects that most HSCs seem to confer to the carrier, only those HSCs being able to drive strongly might invade a population to reach a polymorphism status. This seems to be a very restrictive requisite, and is probably one of the causes for the apparent absence of B chromosome polymorphisms in humans. The HSCs more prone to become B chromosomes would be those genetically inert (e.g. heterochromatic) which are often scarcely or not deleterious, and show some kind of drive. With the available information, it is not possible to anticipate whether any of the known types of HSCs might be a B chromosome in the future, but it would be expected that type I like HSCs should be the best candidates. Homo sapiens is a very studied species at some levels but not at others. The social interest of clinical studies might have biased past studies on HSCs towards individuals with clearly visible phenotypic effects. But B chromosomes in plants and animals rarely cause such severe harm to the carrier (for review see Jones and Rees, 1982), so that it is conceivable that many putative B chromosomes are still to be uncovered in phenotypically unaffected humans. The existence of HSCs demonstrates

that our species carries the raw material (i.e. HSCs) for the evolution of B chromosomes, but the extensive analysis of phenotypically normal individuals carried out so far has not unveiled the existence of these possibly unnoticed passengers (Bs).

Acknowledgements We would like to thank JPM Camacho for his useful discussions and suggestions.

References Abeliovich D, Yehuda O, Ben-Neriah S, Kapelushnik Y, BenYehuda D: Dup (10q) lacking apha-satellite DNA in bone marrow cells of a patient with acute myeloid leukemia. Cancer Genet Cytogenet 89:1–6 (1996). Amor DJ, Choo KHA: Neocentromeres: role in human disease, evolution, and centromere study. Am J Hum Genet 71:695–714 (2002). Blennow E, Bui TH, Kristoffersson U, Vujic M, Annerén G, Holmberg E, Norsdenskjöld M: Swedish survey on extra structurally abnormal chromosomes in 39,105 consecutive prenatal diagnoses: prevalence and characterization by fluorescence in situ hybridization. Prenat Diagn 14:1019–1028 (1994). Blennow E, Brondum-Nielsen K, Telenius H, Carter NP, Kristoffersson U, Holmberg E, Gilberg C, Nordenskjöld M: Fifty probands with extra structurally abnormal chromosomes characterized by fluorescence in situ hybridization. Am J Med Genet 55:85–94 (1995). Brondum-Nielsen K, Mikkelsen M: A 10-years survey, 1980–1990, of prenatally diagnosed small supernumerary marker chromosomes, identified by FISH analysis. Outcome and follow-up of 14 cases diagnosed in a series of 12,699 prenatal samples. Prenat Diagn 15:615–619 (1995). Bryndorf T, Kirchoff M, Rose M, Maahr J, Gerdes T, Karhu R, Kallionemi A, Christensen B, Lundsteen C, Philip J: Comparative genomic hybridization in clinical cytogenetics. Am J Hum Genet 57:1211– 1220 (1995). Callen DF, Eyre H, Yip MY, Freemantle J, Haan EA: Molecular cytogenetic and clinical studies of 42 patients with marker chromosomes. Am J Med Genet 43:709–715 (1992) Callen DF, Eyre HJ, Dolman G, Garrybattersby MB, McCreanor JR, Valeba A, McGill JJ: Molecular cytogenetic characterization of a small ring X chromosome in Turner patient and in a male patient with congenital abnormalities: role of X chromosome inactivation. J Med Genet 32:113–116 (1995). Camacho JPM: B chromosomes, in Gregory TR (ed): The Evolution of the Genome (Elsevier, Amsterdam 2004). Camacho JPM, Shaw MW, Lo´pez–Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997). Camacho JPM., Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Camacho JPM, Cabrero J, Lo´pez-Leo´n MD, Bakkali M, Perfectti F: The B chromosomes of the grasshopper Eyprepocnemis plorans and the intragenomic conflict. Genetica 117:77–84 (2003). Choo KH: Domain organization at the centromere and neocentromere. Dev Cell 1:165–177 (2001). Christian SL, Fantes JA, Mewborn SK, Huang B, Ledbetter DH: Large genomic duplication map to sites of instability in Prader Willi/Angelman syndrome chromosome region (15q11→q13). Hum Mol Genet 8:1025–1037 (1999). Covert SF: Supernumerary chromosomes in filamentous fungi. Curr Genet 33:311–319 (1998).

Crolla JA: FISH and molecular studies of autosomal supernumerary marker chromosomes excluding those derived from chromosome 15. II. Review of the literature. Am J Med Genet 75:367–381 (1998). Crolla JA, Long F, Rivera H, Dennis NR: FISH and molecular study of autosomal supernumerary marker chromosomes excluding those derived from chromosome 15 and 22: I. Results of 26 new cases. Am J Med Genet 75:355–366 (1998). Eggermann K, Mau UA, Bujdoso´ G, Koltai E, Engels H, Schubert R, Eggermann T, Raff R, Schwanitz G: Supernumerary maker chromosomes derived from chromosomes 15: analysis of 32 new cases. Clin Genet 62:89–93 (2002). Eggermann T, Engels H, Apacik C, Moskalonek B, Muller-Navia J, Schwanitz G, Stengel-Rutkowski S: Tetrasomy 18p caused by paternal meiotic nondisjunction. Eur J Hum Genet 5:175–177 (1997). Erdel M, Duba HC, Verdorfer I, Lingenhel A, Geiger R, Gutenberger KH, Ludescher E, Utermann B, Utermann G: Comparative genomic hybridization reveals a partial de novo trisomy 6q23→qter in an infant with congenital malformations: delineation of the phenotype. Hum Genet 99:596–601 (1997). Fantes JA, Mewborn SK, Lese CM, Hedrick J, Brown RJ, Dyomin V, Chaganti RSK, Christian SL, Ledbetter DH: Organisation of the pericentric region of chromosome 15: at least four partial gene copies are amplified in patients with a proximal duplication of 15q. J Med Genet 39:170–177 (2002). Friedrich V, Nielsen J: Bisatellited extra small metacentric chromosomes in newborn. Clin Genet 5:23–31(1974). Gentile M, Susca F, Resta N, Stella A, Cascone A, Guanti G: Infertility in carriers of two bisatellited marker chromosomes. Clin Genet 44:71–75 (1993). Haddad BR, Schröck E, Meck J, Cowan J, Young H, Ferguson-Smith MA, du Manoir S: Identification of de novo chromosomal markers and derivatives by spectral karyotyping. Hum Genet 103:619–625 (1998). Henegariu O, Bray-Ward P, Artan S, Vance GH, Qumsyeh M, Ward DC: Small marker chromosome identification in metaphase and interphase using centromeric multiplex FISH. Lab Invest 81:475– 481 (2001). Huang B, Ning Y, Lamb AN, Sandlin CJ, Jamehdor M, Ried T, Bartley J: Identification of an unusual marker chromosome by spectral karyotyping. Am J Med Genet 80:368–372 (1998). International Human Genome Sequencing Consortium: Initial sequencing and analysis of the human genome. Nature 409:860–921 (2001). ISCN, 1995: An international system for human cytogenetic nomenclature. Mitelman F (ed). (S. Karger, Basel 1995). Jones RN: Tansley Review No.85. B chromosomes in plants. New Phytol 131:411–434 (1995). Jones RN, Rees H: B chromosomes (Academic Press, New York 1982). Kallionemi OP, Kallionemi A, Piper J, Isola J, Waldman FM, Gray JW, Pinkel D: Optimizing comparative genomic hybridization for analysis of DNA sequence copy number changes in solid tumors. Genes Chrom Cancer 10:231–243 (1994).

Kock J: Neocentromeres and alpha satellite: a proposed structural code for functional human centromere DNA. Hum Mol Genet 9:149–154 (2000). Langer S, Fauth C, Rocchi M, Murken J, Speicher MR: AcroM fluorescent in situ hybridization analyses of marker chromosomes. Hum Genet 109:152–158 (2001). Levy B, Papenhausen PR, Tepperberg JH, Dunn TM, Fallet S, Magid MS, Kardon NB, Hirschhorn K, Warburton PE: Prenatal molecular cytogenetic diagnosis of partial tetrasomy 10p due to neocentromere formation in an inversion duplication analphoid marker chromosome. Cytogenet Cell Genet 91:165–170 (2000). Li S, Malafiej P, Levy B, Mahmood R, Field M, Hughes M, Lockhart LH, Wu Z, Huang M, Hirschhorn K, Golpalrao VN, Velagaleti AD, Warbunton PE: Chromosome 13q neocentromeres: molecular cytogenetic characterization of three additional cases and clinical spectrum. Am J Med Genet 110:258– 267 (2002). Lin AE, Bernar J, Chi A: Congenital heart disease in supernumerary der(22),t(11;22) syndrome. Clin Genet 29:269–275 (1986). Mackie Ogilvie C, Harrison RH, Horsley SW, Hodgson SV, Kearney L: A mitotically stable marker chromosome negative for whole chromosome libraries, centromere probes and chromosome specific telomere regions: a novel class of supernumerary marker chromosome? Cytogenet Cell Genet 92: 69–73 (2001). Manenti E: Two extra inv dup (15) chromosome and male infertility: second case. Am J Med Genet 42:402–403 (1992). McNerlan SE, Morrison PJ, McClure N, Nevin NC: A supernumerary chromosome 20, identified by FISH, in a male with azoospermia. Cause or coincidence? Am J Med Genet 117:188–190 (2003). Mears AJ, Duncan AMV, Budarf ML, Emanuel BS, Sellinger E, Siegel-Bartelt J, Greenberg CR, McDermid HE: Molecular characterization of the marker chromosome associated with cat eye syndrome. Am J Hum Genet 55:134–142 (1994). Nietzel A, Rocchi M, Starke H, Heller A, Fiedler W, Wlodarska I, Loncarevic IF, Beensen V, Claussen U, Liehr T: A new multicolor-FISH approach for characterization of marker chromosomes: centromere-specific multicolor-FISH (cenM-FISH). Hum Genet 108:199–204 (2001). Ning Y, Laundon CH, Schröch E, Buchanan P, Ried T: Prenatal diagnosis of a mosaic extra structurally abnormal chromosome by spectral karyotyping. Prenat Diagn 19:480–482 (1999). Peltomaki R, Knuutila S, Rivanen A, Chapelle A: Pallister-Killian syndrome: Cytogenetic and molecular studies. Clin Genet 31:399–405 (1987). Qumsiyeh MB, Rafi SK, Sarri C, Grigoriadou M, Gyftodimou J, Pandelia E, Laskari H, Petersen MB: Double supernumerary isodicentric chromosomes derived from 15 resulting in partial hexasomy. Am J Med Genet 116:356–359 (2003). Randolph L: Types of supernumerary chromosomes in maize. Anat Rec 41:102 (1928). Rauch A, Pfeiffer RA, Trautmann U, Liehr T, Rott HD, Ulmer R: A study of ten small supernumerary (marker) chromosomes identified by fluorescence in situ hybridization (FISH). Clin Genet 42:84–90 (1992).

Cytogenet Genome Res 106:165–172 (2004)

171 29

Rivera H, Vasquez AL, Garcia-Cruz D, Crolla JA: Neocentromere at 13q32 in one of two stable markers derived from a 13q21 break. Am J Med Genet 85:385–388 (1999). Sachs ES, Van Hemel JO, Den Hollander JC, Jahoda MGJ: Marker chromosomes in series of 1000 prenatal diagnoses. Cytogenetic and follow-up studies. Prenat Diagn 7:81–89 (1987). Saffery R, Irvine DV, Griffiths B, Kalitsis P, Wordeman L, Choo KH: Human centromeres and neocentromeres show identical distribution patterns of 1 20 functionally important kinetochore-associated proteins. Hum Mol Genet 9:175–185 (2000). Schröck E, du Manoir S, Veldman T, Schoell B, Wienberg J, Ferguson-Smith MA, Ning Y, Ledbetter DH, Bar-Am I, Soenksen D, Garini Y, Ried T: Multicolor spectral karyotyping of human chromosome. Science 273:494–497 (1996). Schroer RJ, Phelan MC, Michaelis RC, Crawford EC, Skinner SA, Cuccaro M, Simensen RJ, Bishop J, Skinner C, Fender D, Stevenson RE: Autism and maternally derived aberrations of chromosome 15q. Am J Med Genet 76:327–336 (1998). Speicher MR, Gwyn Ballard S, Ward DC: Karyotyping human chromosomes by combinatorial multi-fluor FISH. Nat Genet 12:368–375 (1996). Spiegel M, Hickmann G, Senger G, Kozlowski P, Bartsch O: Two new cases of analphoid marker chromosomes. Am J Med Genet 116:284–289 (2003). Spinner NB, Zackai E, Cheng SD, Knoll J: Supernumerary inv dup (15) in a patient with Angelman syndrome and a delection of 15q11→q13. Am J Med Genet 57:61–65 (1995).

172 30

Stamberg J, Thomas GH: Unusual supernumerary chromosomes: types encountered in a referred population, and high incidence of associated maternal chromosome abnormalities. Hum Genet 72:140– 144 (1986). Struthers JL, Cuthbert CD, Khalifa MM: Parental origin of the isochromosome 12p in Pallister-Killian syndrome: Molecular analysis of one patient and review of the reported cases. Am J Med Genet 84:111–115 (1999). Viersbach R, Engels H, Gamerdinger U, Hansmann M: Delineation of supernumerary marker chromosomes in 38 patients. Am J Med Genet 76:351–358 (1998). Voullaire LE, Slater HR, Petrovic V, Choo KHA: A functional marker centromere with no detectable alpha satellite, satellite III, or CENP-B protein: activation of a latent centromere? Am J Hum Genet 52:1153–1161 (1993). Vujocevic M, Blagojevic J: B chromosomes in populations of mammals. Cytogenet Genome Res 106: 247–256 (2004). Wandstrat AE, Schwartz S: Isolation and molecular analysis of inv dup (15) and construction of physical map of a common breakpoint in order to elucide their mechanism of formation. Chromosome 109:498–505 (2000). Warburton D: De novo structural rearrangements: implications for prenatal diagnosis. Prenat Diagn 4:69–80 (1984).

Cytogenet Genome Res 106:165–172 (2004)

Warburton D: De novo balanced chromosome rearrangements and extra marker chromosomes identified at prenatal diagnosis: clinical significance and distribution of breakpoints. Am J Hum Genet 49: 995–1013 (1991). Webb T: Inv dup(15) supernumerary marker chromosomes. J Med Genet 31:585–594 (1994). Webb T, Hardy CA, King M, Watkiss E, Mitchell C, Cole TA: A clinical, cytogenetic and molecular study of ten probands with supernumerary inv dup (15) marker chromosomes. Clin Genet 53:34–43 (1998). Weber FM, Dooley SR, Sparkes RS: Anal atresia, eye anomalies and additional small abnormal metacentric chromosome (47,XX,mar+): report of a case. J Pediat 76:438–448 (1970). Wilson EB: Studies on chromosomes. V. The chromosomes of Metapodius. A contribution to the hypothesis of the genetic continuity of chromosomes. J Exp Zool 6:147–205 (1906). Wisniewski LP, Hassold T, Heffelfinger J, Higgins TV: Cytogenetic and clinical studies in five cases of inverted duplication (15). Hum Genet 50:259–270 (1979). Wisniewski LP, Doherty RA: Supernumerary microchromosomes identified as inverted duplication of chromosome 15. A report of three cases. Hum Genet 68:161–163 (1985). Yaron Y, Carmon E, Goldstein M, Voskoboinik N, Ochshorn Y, Gelman-Kohan Z, Orr-Urtreger A: The clinical application of spectral karyotype (SKY) in the analysis of prenatally diagnosed extra structurally abnormal chronosomes (ESACs). Prenat Diagn 23: 74–79 (2003).

What Are B Chromosomes? Cytogenet Genome Res 106:173–183 (2004) DOI: 10.1159/000079284

Is the aneuploid chromosome in an apomictic Boechera holboellii a genuine B chromosome? T.F. Sharbel,a M.-L. Voigt,a T. Mitchell-Olds,a L. Kantama,b and H. de Jongc a Max

Planck Institut für Chemische Ökologie, Beutenberg Campus, Jena (Germany); Laboratories of b Biochemistry and c Genetics, Wageningen University, Wageningen (The Netherlands)

Abstract. The Boechera holboellii complex comprises B. holboellii and B. drummondii, both of which can reproduce through sex or apomixis. Sexuality is associated with diploidy, whereas apomictic individuals can either be diploid, aneuploid or triploid. Aneuploid individuals are found in geographically and genetically distinct populations and contain a single extra chromosome. It is unknown whether the supernumerary chromosomes are shared by common descent (single origin) or have originated via introgressive hybridizations associated with the repeated transition from diploidy to triploidy. Diploid plants containing the extra chromosome(s) reproduce apomictically, suggesting that the supernumerary elements are associated with apomixis. In this study we compared flow cytometry data, chromosome morphology, and DNA sequences of sexual diploid and apomictic aneuploids in order to establish whether the extra chromosome fits the classical concept of a B chromosome.

Karyotype analyses revealed that the supernumerary chromosome in the metaphase complement is heterochromatic and often smaller than the A chromosomes, and differs in length between apomictic plants from different populations. DNA sequence analyses furthermore demonstrated elevated levels of non-synonymous substitutions in one of the alleles, likely that on the aneuploid chromosome. Although the extra chromosome in apomictic Boechera does not go through normal reductional meiosis, in which it may get eliminated or accumulated by a B-chromosome-specific process, its variable size and heterochromatic nature does meet the remaining criteria for a genuine B chromosome in other species. Its prevalence and conserved genetic composition nonetheless implies that this chromosome, if truly a B, may be atypical with respect to its influence on its carriers.

Asexual (apomictic or parthenogenetic) reproduction has repeatedly and independently evolved throughout the higher plants (angiosperms) and within certain groups of animals (Suomalainen, 1950; Asker and Jerling, 1992; Simon et al., 2003). Among the angiosperms, such an alternative way of reproduction can involve specific somatic cell divisions (vegetative reproduction) or parthenogenetic development of their seeds (agamospermy or apomixis), while in asexual animals parthenogenesis is the rule rather than the exception (Asker and Jerling, 1992; Beukeboom and Vrijenhoek, 1998). Asexual

reproduction in both higher plants and animals is generally associated with polyploidy (Mogie, 1986; Mogie, 1988; Beukeboom and Vrijenhoek, 1998; van Baarlen et al., 1999), although these traits do not always coexist (Asker and Jerling, 1992). Both allo- and autopolyploid complexes may be involved with asexuality, and a number of explanations have been put forth to explain their association, including allelic dosage and control, escape from sterility, heterosis and shorter meiotic cycles (see Mogie, 1986; Asker and Jerling, 1992; Carman, 1997). Nonetheless, the evolutionary association of these traits remains enigmatic. For example, it is still unclear whether polyploidy is a stable precondition for parthenogenesis, or vice versa (Beukeboom and Vrijenhoek, 1998). While most apomicts are known to be polyploid, a number of apomictic taxa have also been reported to contain one or few extra chromosomes, which in some cases clearly share characteristics of B chromosomes. According to its general concept B chromosomes are supernumerary and not essential for the organism, and are variable in number among and between pop-

This work was supported by the Max-Planck-Gesellschaft. The research of C.D. was funded by a FWF (Austrian Science Foundation Grant P14655-GEN) to Marcus Koch (Heidelberg). Request reprints from: Dr. Timothy F. Sharbel Laboratory of Genetics and Pathology IFREMER, 17390 La Tremblade (France) telephone: +33-(0)546-367620; fax: +33-(0)546-363751 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0173$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

ulations. They are often heterochromatic and rich in repetitive sequences which they generally share with the A chromosomes. B chromosomes are often considered “selfish” elements and may show a typical meiotic drive in which they may get lost somewhere in the germ line and/or have accumulation mechanisms at meiosis or pollen mitosis in order to compensate for the decrease in number. Various hypotheses accounting for the ubiquity of these supernumerary elements have been postulated (Roche et al., 2001; Normark et al., 2003), suggesting that they are by-products of processes leading to polyploidy and/or asexuality, as is suggested in cases of increased tolerance to genetic load in aneuploid/B chromosome carriers (Beukeboom and Vrijenhoek, 1998; Roche et al., 2001) and hybrid disruption in allopolyploid genomes (McVean, 1995). However, extra chromosomes can be prevalent in natural populations, and may in extreme cases behave in a parasitic manner (Camacho et al., 2000). An intriguing possibility is that, in certain cases, aneuploidy may somehow be involved in the expression of apomixis (Roche et al., 2001). One way of examining this latter phenomenon would be to compare B chromosomes from independently evolved apomictic taxa, and to look for conservation in structure or function between them. Since B chromosomes undergo random degenerative processes similar to those which influence sex chromosomes (Green, 1990), any conserved genomic regions on them may have been the result of natural selection. It is thus of interest to understand whether aneuploidy and B chromosomes are a result of, or causally involved in the evolution (i.e. expression) of apomixis from sexual ancestors. The Boechera holboellii complex is composed of B. holboellii and B. drummondii (Love and Love, 1975; Koch et al., 1999, 2000, 2001), both of which are biennial or perennial members of the North American (including Greenland) Brassicaceae which can reproduce through sex or diplosporous apomixis (i.e., meiosis is retained; Böcher, 1951). Among plants, the B. holboellii complex is exceptional in the sense that apomicts occur at both the diploid and triploid level (a rare polyploid condition in plants; see Ramsey and Schemske, 1998), and in addition facultative apomicts (individuals producing seeds through apomixis and sex) may also occur (Böcher, 1951). The basic chromosome number (x) of B. holboellii is 7, and polyploidy (typically triploid) and aneuploidy are common (Böcher, 1951, 1954). Apomictic individuals go through a disturbed meiosis I in which unreduced gametes are produced and, interestingly, a range of variation in chromosomal synapsis can be found in both diploids and triploids (Böcher, 1951). Previous studies have shown that there have been multiple independent origins of polyploidy and aneuploidy within the B. holboellii complex (Sharbel and Mitchell-Olds, 2001) and, at present, no more than one aneuploid chromosome has been documented in any individual. The occurrence of these numerical chromosome variants are consistent with other characteristics of apomictic B. holboellii, including large numbers of geneticallyidentifiable clones, fixed heterozygosity and disjunct apomictic populations (Roy and Rieseberg, 1989; Roy, 1993; Roy and Bierzychudek, 1993). Taken together with the possibility that polyploidy coevolves with the expression of asexual reproduction, these findings suggest that there have been multiple indep-

174 32

Cytogenet Genome Res 106:173–183 (2004)

endent origins of the apomixis phenotype within this group (Roy, 1995; Sharbel and Mitchell-Olds, 2001). Aneuploidy is geographically widespread and is found in different chloroplast haplotypes within the B. holboellii complex (Sharbel et al., 2004). The origin and prevalence of this element could be explained through a chromosomal or cellcycle disruption hypothesis, whereby the repeated transition from stable diploidy to unstable triploidy (Sharbel and Mitchell-Olds, 2001) has led to the frequent origin of aneuploidy. Alternatively, an hypothesis in which the aneuploid chromosome has arisen a single time followed by its spread into different populations, would require that the element was advantageous to its carriers, or that it had some mechanism for increasing its reproductive success. B chromosomes have been described in scenarios similar to the latter hypothesis, and we therefore initiated a study on whether the aneuploid chromosomes in the B. holboellii complex demonstrate characteristics that are typical of Bs.

Materials and methods Sample collection Seeds from single individuals of known genotype were collected from Boechera holboellii and B. drummondii sampled from throughout North America (Table 1). Plants from Montana and adjacent parts of Idaho were identified using keys following Dorn (1984). Other identifications were based on Rollins (1981). In addition, species classifications were compared to known herbarium specimens. Five to ten seeds from each collection site were placed onto moist filter paper in Petri plates, and vernalized at 5 ° C for two to three weeks. Upon germination, three to five seedlings were transferred to pots (11 × 11 × 13 cm) containing sterilized soil and grown in a controlled environmental growth room. Plants were grown in a 12-hour light/ dark cycle under fluorescent lighting (cool white and GrowLux®), with a daily temperature variation from 22 to 28 ° C. Karyotype preparation Cell spread preparations were obtained from root tips, which were collected between 8 and 10 a.m. Root tips from young actively growing plants were pre-treated with 2 mM of the spindle inhibitor 8-hydroxyquinoline for 3 h at 15 ° C, followed by storage in freshly prepared ice-cold Carnoy fixative (3:1 absolute ethanol:acetic acid) at 4 ° C until use. Fixed root tips were rinsed twice (3 min per rinse) in distilled water, followed by a rinse in 10 mM sodium citrate buffer (pH 4.5). Root tips were then digested for 2 h at 37 ° C in an enzyme mix (1 % cellulose RS, 1 % pectolyse Y23 and 1 % cytohelicase in sodium citrate buffer, pH 4.5), carefully rinsed in sterile water, and placed on ice until use. Single root tips were placed onto the middle of an alcoholcleaned microscope slide with a few drops of water, and the tip was chopped with fine needles. A drop of 60 % acetic acid (approximately 50 Ìl) was added to the drop with the cell mixture and then the slide was placed on a 45 ° C hot plate for 2 min. The drying drop was mixed using a needle every 15 s in order to spread the sample on the microscope slide. The slide was then rinsed in ice-cold 3:1 (ethanol:glacial acetic acid) fixative, followed by a rinse in 98 % ethanol and finally air-dried. We screened the chromosome preparations under a phase contrast microscope for spreading quality and presence of sufficient metaphase complements. The slides were then stained with 5 Ìg/ml 4),6-diamidino-2-phenylindole (DAPI) in Vectashield (Vector Laboratories) and studied under a Zeiss Axioplan 2 Photomicroscope, equipped with epifluorescence illumination and appropriate filters, and Planapochromatic optics. Selected metaphase complements were captured with a Photometric 1400 × 1000 pixel camera and the digital images further processed with Genus Image Analysis Workstation software (Applied Imaging Corp.). Images were sharpened with a Hi-Gauss high pass spatial filter to accentuate minor details and heterochromatin banding. We used Adobe Photoshop for brightness and contrast optimization, and ordering chromosomes for the karyotype analysis.

Table 1. Samples of Boechera for which the loci MVI11 and T1B9 were sequenced

Species

ID

Karyotypea

Cp haplotypeb

B. drummondii

521 128 494 522 60 101 173 119 309 144 263 250

2x 2x 3x 2x 2x 2x+B 2x+B 3x 3x 2x+B 2x+B 2x

E C L K K E C K L I K

B. holboellii

a b c

Table 2. Arabidopsis thaliana genome database source of DNA sequence data from which primers were generated for nuclear loci analyses in B. holboellii and B. drummondii

Map numberc 18 19 12 41 26 7 24 4 4 21 5 13

Based upon flow cytometry. TrnL intron (Sharbel and Mitchell-Olds, 2001). See Sharbel et al., 2004.

Map name

Locus

TAIRa accession

Primer 1 (5’ → 3’)

Primer 2

MVI11 T1B9

AT3G19100 AT3G07130

2094053 2098500

TCTGAAGATGATGCAAAAGCA TAGCTTCTTGGCATCCACCT

ATAACGAAGGCCAAGGAGGT TCTAGGATTCCATGGCCAAA

a

Arabidopsis thaliana chromosome location from http://arabidopsis.org/home.html

A certain degree of confusion may arise when comparing flow cytometric and karyotypic data from plant and animal literature, the result of non-standardized chromosome nomenclature. For the purpose of this paper, “C” (DNA content of a haploid G1 cell) will be used to qualify genome size (flow cytometric) and “x” for the basic chromosome number. The aneuploid supernumerary chromosome for both flow cytometric and karyotypic data will be designated as “B”. Nuclear sequence analysis In the course of another experiment we have generated microsatellite data that suggest that the aneuploid chromosome in the B. holboellii complex is partly contiguous with the Arabidopsis thaliana genome (Sharbel and Mitchell-Olds, manuscript in preparation). More specifically, for the microsatellite loci (MDC16 and AthGAPab; see Clauss et al., 2002) we identified frequently 3 alleles in aneuploid B. holboellii (Sharbel and Mitchell-Olds, manuscript in preparation). For the purpose of this study, two loci (MVI11 and T1B9) flanking these microsatellite loci were chosen from the Arabidopsis thaliana genome database (http://arabidopsis.org/home.html). PCR primers were derived from annotated exon regions such that an approximately 500-bp exon-intron-exon product could be generated from each locus (Table 2). The two regions were amplified from two Arabidopsis thaliana accessions (Col and Ler), and twelve diploid (2x = 14), aneuploid (2x + B = 15) and triploid (3x = 21) individuals from both B. holboellii and B. drummondii (Table 1). An 11-Ìl PCR mixture was mixed for each sample containing: 1× buffer, 1 mM MgCl2, 100 ÌM dNTP, 200 pmol each primer, 0.5 units Taq polymerase and 25 ng template DNA. For both loci, 30 PCR cycles of 94 ° C (30 s), 55 ° C (30 s), and 72 ° C (60 s) were performed, followed by a 72 ° C (7 min) step. PCR amplification products were cloned into a PCR2 TOPO vector (Invitrogen), followed by plasmid preparations of individual colony cultures. In order to maximize the probability of sampling all alleles from each individual, 8 clones from the diploid and aneuploid individuals and 12 clones from the triploid individuals were sequenced on both strands using the ABI Prism BigDye Ready Reaction Terminator Cycle Sequencing Kit on an ABI 3700 genetic analyzer. Sequences were assembled, manually checked for errors, and aligned using SeqMan 5.0 and MegAlign 5.03 (DNASTAR Inc.). Coding and noncoding regions were assigned based upon homology searches with the Arabidopsis thaliana genome database (http://arabidopsis.org/home.html). Statistical analyses of inter- and intraspecific DNA sequence were performed using

DnaSP version 3.84 (Rozas and Rozas, 1999) and MEGA version 2.1 (Kumar et al., 2001). Nucleotide diversity () was calculated with the method of Nei (1987). Phylogenetic analyses were performed using the TREECON package (Van de Peer and De Wachter, 1994). Cleaved amplified polymorphic sequence (CAPS) association study Phylogenetic analyses of the sequence data provided information used to develop cleaved amplified polymorphic sequence (CAPS) markers. For this association study, two 96-well micropipette plates were loaded with the MVI11 and T1B9 PCR products from 12 2C and 12 3C B. drummondii, and 22 2C, 24 2C + B, and 24 3C B. holboellii. To the MVI11 and T1B9 PCR products, appropriate dilutions of buffer and the restriction enzymes AlwN1 and MspI were added respectively, followed by incubation at 37 ° C for 4 h. The restriction enzyme products were loaded onto a 1.5 % 1× tris-EDTAborate (TEB) agarose gel, and run at 50 mA for 2 h before being visualized under a UV transilluminator.

Results Karyotype analysis Figure 1 shows the karyotypes of DAPI stained chromosome complements of a sexual diploid (2n = 14) and apomictic aneuploid at the diploid (2n = 15) level. These chromosomes are at prometaphase, show brightly fluorescing heterochromatic regions around the centromeres, measure 3–6 Ìm and have median to subterminal centromere positions. The aneuploid contains an extra chromosome that cannot be matched morphologically with any of the normal chromosomes. The bright DAPI fluorescence indicates highly condensed chromatin, which suggests that the chromosome is highly heterochromatic. Nuclear sequence analysis and CAPS association study We were able to amplify, clone and sequence 474 bp and 498 bp from the loci MVI11 and T1B9 respectively (Table 3).

Cytogenet Genome Res 106:173–183 (2004)

175 33

Fig. 1. Karyograms of DAPI-stained prometaphase complements of Boechera holboellii: (a) sexual diploid plant Ad9G-S22, and (b) 2x+B clone 74.8.8. Chromosomes were tentatively grouped in pairs on the basis of length, centromere position and heterochromatin pattern. The putative B chromosome in the 2x-aneuploid is indicated with an asterisk.

T1B9-17 95

3

T1B9-16 T1B9-20 T1B9-19 T1B9-18

a

Fig. 2. Neighbor-joining tree of alleles sequenced from locus (a) T1B9 and (b) MVI11 for Arabidopsis thaliana out-group and Boechera samples (see Table 1). Grey regions denote sequence groups from which a “hypothetical aneuploid” consensus sequence (allele) was generated. Numbers at terminal ends of both trees designate groups of alleles found in B. holboellii (1), B. drummondii (2) and only aneuploid individuals (3). Bootstrap values greater than 80 % are labeled.

b

100

2

1

MVI11-8 MVI11-5 MVI11-4 MVI11-11 MVI11-13 MVI11-12 MVI11-9 97 MVI11-10 MVI11-7 MVI11-6 MVI11-19 MVI11-3 MVI11-17 MVI11-15 MVI11-1 MVI11-14 99 MVI11-16 MVI11-2 MVI11-18

1

2

3

A. thaliana

All sequences have been submitted to GenBank, and have been given the accession numbers AY376271–AY376289 (MVI11) and AY376290–AY376309 (T1B9). The size and structure of the exon-intron-exon region was similar between A. thaliana and all Boechera samples for each locus (Table 3). Phylogenetic analyses of both loci yielded neighbor joining trees with similar structure (Fig. 2). Using A. thaliana as the out-group, the trees generated for each locus appeared to show three groups of alleles (Fig. 2). Comparisons of allele presence in the different samples which were used for the sequencing experiment (Ta-

176 34

100

T1B9-13 T1B9-14 T1B9-9 T1B9-11 T1B9-10 T1B9-12 T1B9-5 90 T1B9-4 T1B9-8 T1B9-15 T1B9-7 T1B9-3 T1B9-2 T1B9-6 T1B9-1 A. thaliana

Cytogenet Genome Res 106:173–183 (2004)

ble 1) demonstrated a similar trend for both loci: group 1 was composed of alleles found almost exclusively in B. holboellii of all ploidy types, group 2 was composed of alleles found almost exclusively in B. drummondii of all ploidy types, and group 3 was found in aneuploid individuals only (Fig. 2). Considering these patterns, group 3 may represent alleles found on the aneuploid chromosome. This hypothesis was examined by an association study using CAPS markers and a larger sample size (see below). Interestingly, group 3 (putative extra chromosome-specific alleles) clustered with group 2 (B. drummondii alleles) for

Table 3. Polymorphic sites between alleles of locus (a) T1B9 and (b) MVI11 for Arabidopsis thaliana outgroup and Boechera samples (see Table 1)

a

b

thaliana T1B9-1 T1B9-2 T1B9-3 T1B9-4 T1B9-5 T1B9-6 T1B9-7 T1B9-8 T1B9-9 T1B9-10 T1B9-11 T1B9-12 T1B9-13 T1B9-14 T1B9-15 T1B9-16 T1B9-17 T1B9-18 T1B9-19 T1B9-20

CAAT T T CT A . . GA C C . CT . . GC C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . . G . C C . CT . T G . C C . CT T . G . C C . CT T . G . C C . CT T . G . CC . . T T . G . CC . . T T . G . C CT CT

CT - - - - - - - - - - - - - - - - - - - - -

. . . . . . . . . . . . . . . . . . .

T -

T -

T GGC . . T . . . T . . . T . . . T . . . T . . . T . . . T . . . TT . TT . . TT . . TT . . TT . . TT . . TT . . . T . . TT . . TT . AT T . AT T . . TT .

AT . . . C . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

T . . . . . . . . . . . . . . . . . . .

T . . . . . . . . . . . . . . . . . . .

C GA T . . T C . . T C . . T C . . T C . . T C . . T C . . T C . . T C . AT C . . T C . . T C . . T C . . T C . . T C . . T C G . T C G . T C . . T C . . T C G . T C

thaliana MVI11-1 MVI11-2 MVI11-3 MVI11-4 MVI11-5 MVI11-6 MVI11-7 MVI11-8 MVI11-9 MVI11-10 MVI11-11 MVI11-12 MVI11-13 MVI11-14 MVI11-15 MVI11-16 MVI11-17 MVI11-18 MVI11-19

CAAGCAT T . . . A . . CC . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C . . . A . . . C

thaliana MVI11-1 MVI11-2 MVI11-3 MVI11-4 MVI11-5 MVI11-6 MVI11-7 MVI11-8 MVI11-9 MVI11-10 MVI11-11 MVI11-12 MVI11-13 MVI11-14 MVI11-15 MVI11-16 MVI11-17 MVI11-18 MVI11-19

CAT TAGGGATACGACGT . . . C . T . . . . . . A . . . . . . . C . T . C . . . . A . . . . . . . C . T . . . . . TA . . . . . . . C . T . . . . . . A . . . . . . . C . T . . . . . . A . . . . . . . C . T . . . . . . A . . . . . . . C . T . . . . . . A . . . . . . . C . T . . . . . . A . . . . . . . C . TC . . . . . A . . . . . . . C . T . . . . . . A . . . . . . . C . T . . G . . . A . . . . T . . C . T . . . . . . A . . . . . . . C . T . . . . . . A . . . . . . . C . T . . . . . . A . . . . . . . C . T . . . . . . A . . . . . . . C . T . C . . . . A . . . . . . CC . T . . . . . . A . . . . . . . C . T . . . . . . A . . . . . . . C . T . . . . . . A . . . .

CT - - - - - - - - - - - - - - - - - - - - -

T -

T -

GA A GT A G CA A T CA T A A CT A A C CA T CA GA G C . T T T . T AT GG . T G . . . T CC . A . T . A . T . T T . T T T . T AT GG . T G . . . T CC . A . T . A . T . T T . T T T . T AT GG . T G . . . T CC . A . T . A . T . T T . T T T . T AT GG . T G . . . T CC . A . T . A . T . T T . T T T . T AT GG . T G . . . T CC . A . T . A . T . T T . T T T . T A T G G . T G . . GT C C . A . T . A . T . T T . T T T . T AT GG . T G . G . T CC . A . T . A . T . T T . T T T . T AT GG . T G . . . T CC . A . T . A . T . T T . T T T . T A . GG . . G . . . T CC . A . T . G . T . T T . T T T . T A . GG . . GC . . T CC . A . T CG . T . T T . T T T . T A . G G . . G C . . T C C . A . T . G . T GT T . T T T . T A . GG . . G . . . T CC . A . T . A . T . T T . T T T . T A . GG . . G . . . T CC . A . T . G . T . T T . T T T . T A . G G . . G . . . T C C . A . T . G GT . T T . T T T . T AT GG . T G . . . T CC . A . T . A . T . T T A T T T CT A . G G . . G . . . T C C GA T T . G . T . T T . T T T . T A . GG . . G . . . T CC . AT T . G . T . T T . T T T . T A . GGC . G . . . T CC . A . T . A . T . T T . T T T . T A . GG . . G . . . T CC . A . T . G . T . T T . T T T . T T . GG . . G . . . T CC . AT T . G . T . T T

T TAT TGTC T TGTAGC TGC . . . . . T . A . . A . . . . . . T . . . . . T . A . . A . . . . . . T . C . . . T . A . . A . . . . . . T . . . A . TGAC . A . . . . . . T . . . . . TGAC . A . . . . C . T . . . . . TGAC . A . . . . . . T . . . . . TGAC . A . . . . . . T . . . . . TGAC . A . . . . . . T . . . . . TGAC . A . . . . . . T . . . . . TGAC . A . . . . . . T . . . . . TGAC . A . . . . . . T . . . . . TGAC . A . . . . . . T . . . . . TGAC . A . G . . . . T . . . . . T . A . CAC . . . . . T . . . . . T . A . . A . . A . . . T . . . . . T . A . . A . . . . . . T . . . . . T . A . . A . . . . . . T . . . . . T . A . . A . . . . . . T . . . . . T . A . . A . . . . . . T TAAGGATC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

TATTT . TG . . . TG . C . TG . . . TG . . . TG . . . TG . . . TG . . . TG . . . TG . . . TG . . . TG . . . TG . . . TG . . . TG . . . TG . . . TG . C . TG . . . TG . . . TG . .

TGTATAAGCAC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

GT T A G G G CA A C . . GA A T A . . C . . GA A . A . . C C . GA A . A . . C . . GA A . A . C . . GA A . A . . C . A GA A T A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A . . C . . GA A . A C .

TA- T . C . . . C . . . C . . . CA . . CA . . CA . . CA . . CA . . CA . . CA . . CA . . CA . . CA . . C . . . C . . . C . . . C . . . C . . . C . . TGC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Dashes represent deletions, and boxes denote polymorphisms in exon regions

each locus (Fig. 2). Consensus sequences were generated from the putative non-B alleles (sequences from group 1 and 2; Fig. 2) and hypothetical aneuploid alleles (group 3; Fig. 2), and comparisons of restriction enzyme sites between these sequences yielded diagnostic cleavage sites (Fig. 3a). For locus MVI11, an AlwNI site was found at approximately position 150 on the putative aneuploid allele while no corresponding site was found on the non-B allele (Fig. 3a). The predicted cleavage pattern of a hypothetical individual carrying an aneuploid chromosome would thus be: 474-bp fragment (uncleaved non-B allele) + (150 bp + 324 bp [cleaved aneuploid allele]). The restriction digest patterns from 98 individuals

representing both species and all hypothesized ploidy types demonstrated that the diagnostic fragments (324 and 150 bp) were found in all B. drummondii (2C and 3C), and only in 2C+B and 3C B. holboellii (Fig. 3b). Except for two individuals (9 %), no 2C B. holboellii exhibited the diagnostic fragments (Fig. 3b). For locus T1B9, three MspI sites were found, with one of the sites being diagnostic (position 376 bp) for the hypothetical aneuploid allele (Fig. 3a). The predicted cleavage pattern of a hypothetical individual carrying an aneuploid chromosome would thus be: (280 + 140 + 80 bp [cleaved non-B allele]) + (280 + 120 + 100 bp [cleaved aneuploid allele]). The restriction

Cytogenet Genome Res 106:173–183 (2004)

177 35

Fig. 3. (a) Graphical representation of hypothetical non-B (white) and aneuploid (grey) consensus sequences and positions (bp) of diagnostic restriction enzyme cleavage sites for loci MVI11 and T1B9. (b) Cleaved amplified polymorphic sequence (CAPS) association analysis of 2C, 2C+B and 3C B. drummondii and B. holboellii. Loci MVI11 (upper) and T1B9 (lower) were PCR amplified from each sample, and the PCR products were cleaved with the restriction enzymes AlwNI and MspI respectively. Arrows denote fragments diagnostic for the hypothetical aneuploid allele.

digest patterns from 98 individuals representing both species and all hypothesized ploidy types demonstrated variable patterns for the diagnostic fragments. Fragment 100 bp was never found in 2C B. holboellii while fragment 120 bp was found in three (12 %) 2C B. holboellii (Fig. 3b). The three 2C B. holboellii which had the diagnostic 120-bp fragment were not the same individuals as those 2C B. holboellii showing the diagnostic MVI11 fragments (Fig. 3b). The 120-bp fragment was found in all 2C and 3C B. drummondii, all 3C B. holboellii, and in 15 (62 %) 2C+B B. holboellii (Fig. 3b). The 100-bp fragment was found in one 2C B. drummondii, in ten (42 %) 2C+B and in four (17 %) 3C B. holboellii (Fig. 3b). The 100-bp fragment was always present with the 120-bp fragment, although the reverse was not so (Fig. 3b). Nucleotide diversity of locus T1B9 Nucleotide diversity was compared using different methods of grouping alleles. Species were first grouped based upon their ploidy values. For all B. holboellii comparisons, nucleotide diversity was higher in the intron region when compared to either flanking exons (Table 4). Nucleotide diversity for both silent and non-synonymous substitutions was higher in exon 2 relative to exon 1 in all but the triploid B. holboellii (Table 4). For 3C B. holboellii, silent substitution diversity was higher in exon 2, but this was reversed for non-synonymous substitutions (Table 4). Interestingly, silent polymorphism was 0 for all B. holboellii at exon 1, while both the aneuploid diploid and triploid plants demonstrated higher non-synonymous diversity values than the eudiploids (Table 4). Considering the whole

178 36

Cytogenet Genome Res 106:173–183 (2004)

DNA fragment, the aneuploids at diploid and triploid level B. holboellii had three and four times higher diversity respectively than the sexual diploids (Table 4). Our B. drummondii samples were monomorphic in exon 1. When silent substitutions were considered, diversity was two to three times higher in exon 2 compared to the intron region, whereas the diversity values were comparable between these two regions if non-synonymous substitutions were considered (Table 4). A second grouping of alleles was used to estimate nucleotide diversity, considering the allelic distribution among both species and the 3 clusters in both phylogenetic trees (Fig. 2). For all groups of alleles, nucleotide diversity was !0.0001 in exon 1 when considering silent mutations, whereas levels of non-synonymous diversity for exon 1 were comparable to diversity found in the intron region (Table 4). Silent site diversity in exon 2 was highest in drummondii-like alleles, and showed double the diversity for holboellii-like alleles while aneuploid alleles had diversity !0.0001 (Table 4). When non-synonymous substitutions were considered, the aneuploid alleles demonstrated double the diversity compared to both drummondii and holboellii-like alleles (Table 4). Divergence (k) of the consensus sequences of drummondiilike, holboellii-like and aneuploid-specific alleles compared to A. thaliana demonstrated similar patterns (Fig. 4). When considering silent substitutions divergence was highest in the intron region, while non-synonymous substitutions showed the highest divergence in exon 2 in all cases (Fig. 4).

Table 4. Nucleotide diversity (p; Nei, 1987) for B. holboellii and B. drummondii of differing ploidy for T1B9 and MVI11 (gaps not included in the analyses)

T1B9

B. holboellii All (16)b 2C (3) 2C+B (10) 3C (5) B. drummondii All (7) 2C (6) 3C (3) Allelesd drummondii (8) holboellii (9) aneuploid (3)

Exon 1 (122)a

Intron (103)

<0.0001 (0.0128)c <0.0001 (<0.0001) <0.0001 (0.0113) <0.0001 (0.0173)

0.0142 0.0070 0.0130 0.0126

0.0101 (0.0132) <0.0001 (0.0032) 0.0086 (0.0162) 0.0156 (0.0068)

0.0107 (0.0131) 0.0036 (0.0022) 0.0096 (0.0116) 0.0118 (0.0100)

<0.0001 (<0.0001) <0.0001 (<0.0001) <0.0001 (<0.0001)

0.0080 0.0091 0.0070

0.0207 (0.0074) 0.0237 (0.0078) 0.0104 (0.0065)

0.0112 (0.0051) 0.0128 (0.0054) 0.0072 (0.0045)

<0.0001 (0.0093) <0.0001 (0.0069) <0.0001 (0.0072)

0.0071 0.0024 0.0070

0.0077 (0.0066) 0.0035 (0.0051) <0.0001 (0.0130)

0.0063 (0.0074) 0.0024 (0.0057) 0.0036 (0.0112)

Exon 1 (78)

Intron (101)

Exon 2 (293)

0.0084 (0.0027) <0.0001 (0.0039) 0.0273 (<0.0001)

0.0121 0.0120 0.0131

0.0130 (0.0086) <0.0001 (0.0040) 0.0333 (0.0143)

0.0120 (0.0074) 0.0069 (0.0040) 0.0209 (0.0114)

<0.0001 (<0.0001) <0.0001 (<0.0001) <0.0001 (<0.0001)

0.0203 0.0196 0.0196

0.0166 (0.0022) 0.0211 (0.0015) <0.0001 (0.0030)

0.0170 (0.0018) 0.0181 (0.0012) 0.0114 (0.0024)

<0.0001 (0.0071) <0.0001 (<0.0001) 0.0273 (<0.0001)

0.0078 0.0039 0.0098

0.0070 (0.0036) 0.0036 (0.0045) 0.0209 (0.0120)

0.0068 (0.0043) 0.0034 (0.0036) 0.0151 (0.0095)

Exon 2 (272)

All (494)

MVI11

B. holboellii All (13) 2C (1) 2C+B (9) 3C (4) B. drummondii All (8) 2C (6) 3C (3) Alleles drummondii (5) holboellii (10) aneuploid (4) a b c d

All (474)

Number of base pairs. Number of alleles. Nucleotide diversity calculated from: silent sites (non-synonymous sites). Alleles grouped based on phylogenetic clustering (see Fig. 2).

Nucleotide diversity of locus MVI11 Nucleotide diversity was highest for the triploid B. holboellii for all gene regions (Table 4). The diploid individuals containing the extra chromosome showed !0.0001 silent site diversity for exons 1 and 2, with higher levels of non-synonymous diversity for the same exons (Table 4). Triploid individuals showed non-synonymous diversity levels in exon 2 which were comparable to the diversity of the intron region (Table 4). All B. drummondii showed the lowest (! 0.0001) diversity values in exon 1. When silent substitutions were considered, diploid individuals had comparable levels in exon 2 and the intron region, whereas triploid individuals showed higher levels in exon 2 relative to the intron region (Table 4). In all B. drummondii groups, non-synonymous diversity values in exon 2 were comparable to intron nucleotide diversity (Table 4). Diversity for silent mutations was !0.0001 for drummondiilike, holboellii-like and aneuploid-specific alleles, whereas nonsynonymous substitutions for the same region were comparable to diversity in the intron (Table 4). For all groups of alleles, nucleotide diversity was !0.0001 in exon 1 when considering silent mutations, whereas levels of non-synonymous diversity for exon 1 were comparable to diversity found in the intron region (Table 4). Silent and non-synonymous substitution diversities were comparable for drummondii-like and holboelliilike alleles in exon 2, while the aneuploid alleles had !0.0001

silent diversity and the highest non-synonymous diversity of any of the comparisons (Table 4). Divergence (k) of the consensus sequences of drummondiilike, holboellii-like and aneuploid alleles compared to A. thaliana demonstrated similar patterns (Fig. 4). When considering silent substitutions, divergence was highest in the intron region, while non-synonymous substitutions showed the highest divergence in exon 2 in all cases (Fig. 4). DNA sequence statistics In order to examine whether homologous alleles from either species or the aneuploid chromosome were evolving at different rates, a relative rates test was conducted using A. thaliana as a reference taxon. A consensus allele sequence was generated from each group of B. drummondii-like alleles, B. holboellii-like alleles and aneuploid-like alleles of loci MVI11 and T1B9 (Fig. 2) for each comparison. Locus MVI11 showed no significant result for the aneuploid-holboellii comparison (P = 0.083), the aneuploid-drummondii comparison (P = 0.317) or the holboellii-drummondii comparison (P = 0.157; for all sites, with transitions or transversions considered separately). Similarly, the analyses of locus T1B9 demonstrated no significant result for the aneuploid-holboellii comparison (P = 0.414), the aneuploid-drummondii comparison (P = 0.083) or the holboelliidrummondii comparison (P = 0.564; for all sites, and transitions or transversions considered separately).

Cytogenet Genome Res 106:173–183 (2004)

179 37

Fig. 4. Sliding window analysis (window length 50, step size 10) of loci MVI11 and T1B9 for silent (a) and nonsynonymous (b) substitutions. The yaxis represents nucleotide divergence (K), the average proportion of nucleotide differences relative to A. thaliana (Nei, 1987). The gray boxes denote intron regions. Squares, triangles and circles represent B. holboellii-like, B. drummondii-like, and aneuploid alleles respectively, as based upon phylogenetic clustering (see Fig. 2).

Table 5. Results of tests for Tajima’s Da and HKAb tests for allele groupings based upon phylogenetic analysis (Fig. 2)

MVI11 aneuploid drummondii-like holboellii-like T1B9 aneuploid drummondii-like holboellii-like a b c

χ (P value)

1.00 (>0.1) –1.14 (>0.1) –1.90 (<0.05*)

0.016 (0.90) 0.710 (0.40) 0.003 (0.95)

–c –0.06 (>0.1) –1.63 (0.1>P>0.05)

0.056 (0.81) 0.004 (0.95) 0.016 (0.90)

(Tajima, 1989). (Hudson et al., 1987). Insufficient number of alleles for calculation.

A Tajima’s D (Tajima, 1989) test for compatibility with an equilibrium neutral model was performed on the drummondiilike, holboellii-like and aneuploid alleles for each locus (Fig. 2). The holboellii-like alleles group was characterized by an excess of low-frequency polymorphisms that depart from neutral expectation for both loci; no other significant results were obtained (Table 5). An HKA test (Hudson et al., 1987) using A. thaliana for the interspecific comparison revealed no significant departure from neutrality (Table 5).

180 38

2

D (P value)

Cytogenet Genome Res 106:173–183 (2004)

Discussion Hybridization and aneuploid chromosome origin Aneuploidy and polyploidy are prevalent in the Boechera holboellii complex (Böcher, 1951; Sharbel and Mitchell-Olds, 2001). The fact that the aneuploid chromosome intermittently occurs in 3C B. drummondii in addition to its wide and variable distribution among B. holboellii samples (Sharbel et al., 2004) implies that it is dispensable, at least with respect to each

species (i.e. no major fitness effects associated with its presence or absence, although this remains to be tested empirically). The data presented here preclude a test of whether the aneuploid chromosome is dispensable with respect to reproductive mode (e.g. apomixis). The wide geographic distribution of the aneuploid chromosome can thus be interpreted as either the result of multiple origins of the element in distant populations, or a single (and old) origin followed by its introgression into different populations. As aneuploidy represents an imbalanced genomic constitution, it will have low transmission and hence, should be lost by genetic drift (Camacho et al., 2000). The latter scenario (single origin) would therefore entail either significant fitness advantages to aneuploid individuals, or some form of meiotic drive (i.e. segregation distortion) mechanism (Camacho et al., 2000). Hybridization is the common mode of origin for asexual plant and animal complexes (Suomalainen, 1950; Carman, 1997; Normark et al., 2003; Simon et al., 2003), and has been suggested as the mode of origin for apomixis within the B. holboellii complex (Koch et al., 2003). Although analyses of cpDNA (TrnL intron) have demonstrated absence of speciesspecific polymorphisms (Sharbel and Mitchell-Olds, 2001), significant genome size differences (Sharbel and Mitchell-Olds, 2001), microsatellite polymorphisms (Sharbel and MitchellOlds, manuscript in preparation), and allele distributions for loci MVI11 and T1B9 (this paper) all support genetic differentiation between B. holboellii and B. drummondii. Seven of the twelve individuals that were sequenced for locus MVI11 and T1B9 (Table 1) were characterized by both holboellii-like and drummondii-specific alleles (data not shown), and this provides support for hybridization between the two species. Furthermore, analyses of nucleotide polymorphism at locus T1B9 (Table 4) demonstrate higher diversity values for the triploid over the diploid B. holboellii, and this is consistent with interspecific hybridization leading to the generation of triploid individuals (Simon et al., 2003; a similar analysis of MVI11 could not be performed due to the presence of a single 2C allele). Interestingly, this trend is reversed in B. drummondii for both loci whereby triploid individuals exhibit lower polymorphism levels (Table 4), although limited sample size (single triploid individual) would provide an explanation for this. Hybridization between these two species will be the subject of another publication involving 10 microsatellite loci and a much larger sample size (Sharbel and Mitchell-Olds, manuscript in preparation), and hence we presently focus our discussion on genetic variability of the aneuploid chromosome. The CAPS analyses (Figs. 2 and 3) support the identification of putative aneuploid alleles in the sequence analysis of loci MVI11 and T1B9. The distribution of the diagnostic MVI11 restriction fragments in both diploid and triploid B. drummondii demonstrates that the AlwNI restriction site is specific to this species (Fig. 3). The same fragment is only found in the 2x aneuploid and triploid B. holboellii, which have both resulted from genome additions to the ancestral diploid state. The origin of the third MVI11 allele in the 2x aneuploid and the triploid B. holboellii is thus B. drummondii. As the designations of 2C, 2C+B and 3C were based upon genome size as measured by

flow cytometry (Sharbel and Mitchell-Olds, 2001), the identification of two 2C B. holboellii which have the putative aneuploid fragment (Fig. 3) might be explained either by (a) integration of the aneuploid fragment into the regular autosomes, or (b) degeneration of the aneuploid chromosome to a size below flow cytometric resolution between 2C and 2C+B individuals. We have previously provided evidence for aneuploid chromosomes of at least two different size classes (Sharbel and Mitchell-Olds, 2001) and, in addition, the aneuploid chromosomes in this complex are frequently asynaptic during meiosis I (Böcher, 1951). As asynaptic aneuploid chromosomes are prone to degenerative chromosomal processes (Green, 1990), it appears that certain individuals which appear to be 2C based upon genome size measurements may in fact be aneuploid for a relatively small supernumerary element (this hypothesis is presently being tested using FISH methods). Similarly, the distribution of the diagnostic 120-bp CAPS fragment for locus T1B9 supports B. drummondii as the origin of genome addition in 2C+B and 3C B. holboellii (Fig. 3). This fragment is additionally found in three 2C B. holboellii, although this could be explained by a similar aneuploid chromosome degeneration mechanism as for locus MVI11 (Green 1990). The distribution of the diagnostic 100-bp CAPS fragment for locus T1B9 in a single 2C B. drummondii, and in 42 % and 17 % of 2C+B and 3C B. holboellii respectively may be explained by (a) the introgression of multiple B. drummondii alleles into 2C+B and 3C B. holboellii, or (b) the introgression of a single B. drummondii fragment followed by loss of the restriction site via mutation. Of these two possibilities, the introgression of multiple B. drummondii alleles is supported since the fragment is distributed among 2C+B and 3C B. holboellii characterized by different Cp (TrnL) haplotypes and geographic region (data not shown). Loss of the restriction site through mutation in several Cp haplotypes from different geographic regions would imply multiple independent mutations at the same locus. Comparisons of nucleotide diversity between drummondiilike, holboellii-like and aneuploid alleles demonstrate approximately double the number of non-synonymous mutations in the aneuploid group, with most of the diversity concentrated in exon 2 (Table 4). The pattern of genetic divergence along the length of the gene region is nonetheless similar between the three groups (Fig. 4). These data have two implications. First, since the aneuploid chromosome is asynaptic (Böcher, 1951), it is predicted that it should begin to accumulate mutation in a random fashion with regard to chromosomal position (Green, 1990). This hypothesis is supported by a larger number of nonsynonymous mutations in the aneuploid alleles (Table 4). Secondly, since mutations should accumulate in a random fashion along the length of a non-recombining chromosome, divergence with respect to chromosomal position should be expected to deviate from its ancestral (i.e. under selection pressure) state. Low levels of divergence along the three classes of alleles implies that the aneuploid alleles are relatively recently derived, since mutation accumulation has not yet distorted the ancestral pattern of selection (Fig. 4). Alternatively, some form of selection or the genomic context of the loci (Small and Wendel, 2002) might be involved with maintaining this divergence

Cytogenet Genome Res 106:173–183 (2004)

181 39

pattern, although this is unlikely given the large number of nonsynonymous mutations in aneuploid alleles. The aneuploid chromosome thus appears to be relatively young, but nonetheless diverging in the absence of recombination. Nested within the holboellii-like and drummondii-like clusters are alleles that are found in apomictic individuals (Fig. 2). What may explain the lower levels of non-synonymous substitutions relative to aneuploid alleles? Mutations should also be expected to accumulate in a random fashion within asexual genomes (Normark et al., 2003; Simon et al., 2003). One explanation could be that non-B synapsis (between autosomes) during meiosis I (Böcher, 1951) in some apomictic lineages slows down the process of chromosome degeneration. In addition, the production of functional pollen by some apomictic lineages (Böcher, 1951) may also facilitate backcrossing with sexual individuals, and hence some apomictic alleles may be transferred back to a sexual genome whose chromosomes are under selective maintenance. If one also considers that a spectrum of completely synaptic, partially synaptic and completely asynaptic apomictic lineages exist in the B. holboellii complex (Böcher, 1951), the following scenario emerges. A newly generated apomictic lineage should be characterized by structurally similar autosome pairs, as they were derived from an ancestral sexual (hence synaptic) individual. Synapsis and recombination between the chromosomes of a young apomictic lineage should thus tend to homogenize allelic variability (Singh et al., 2000; Burgess, 2002; Maxfield Boumil et al., 2003). As apomictic genomes begin to accumulate large scale chromosomal mutations (Normark et al., 2003; Simon et al., 2003) which gradually inhibit homologous synapsis, loci along the non-B (autosomes) should become fixed in the heterozygous state. At this point mutations should begin to accumulate more rapidly as they are no longer constrained by synapsis, recombination and reductional segregation of the homologues (Normark et al., 2003; Simon et al., 2003). It is thus predicted that the most divergent alleles within the holboellii-like and drummondii-like clusters should be those that have been isolated in an apomictic genome for the longest time. Tajima’s D tests (Tajima, 1989) on drummondii-like, holboellii-like and aneuploid alleles demonstrated an excess of low-frequency polymorphisms that depart from neutral expectation for holboellii-like alleles (both loci; Table 5). This indicates an excess of low-frequency polymorphisms that may be the result of (a) a recent selective sweep, or (b) population level phenomena such as expansion. One possible explanation for this result could be that relatively fewer holboellii-like alleles are involved in the “sex to apomixis” transition than drummondii-like alleles. Most of the samples sequenced for both loci in this study were apomictic (Table 1) and thus most of the described alleles were sampled from apomictic genomes. The significant negative D value could thus be explained if only a single (or few) sexual holboellii-like allele(s) were originally transferred to the apomictic genomes studied here. Sampling of one allele into an apomictic genome followed by accumulating divergence of that allele in subsequent generations of the same apomictic lineage would have the effect of producing low-frequency polymorphisms.

182 40

Cytogenet Genome Res 106:173–183 (2004)

Are the aneuploid chromosomes B chromosomes? We now return to the original question of whether the extra chromosomes of the B. holboellii complex can be classified as genuine B chromosomes. As no general applicable definition exists for B chromosomes (Jones and Rees, 1982; Camacho et al., 2000) we will compare this chromosome of B. holboellii with what has been known from well defined B chromosome systems. From the population- and species-level perspectives, the aneuploid chromosome is morphologically variable between different B. holboellii and B. drummondii accessions, and seems to be not essential for the viability of the plant. However, we never observed apomictic lineages with more than one extra chromosome. We have not tested whether the aneuploid chromosomes are dispensable with respect to sexual and apomictic B. holboellii, although our CAPS marker analyses indicate that the apomixis-specific allele is present in all 2x aneuploids and triploid individuals. As the 2C individuals presented here were not tested for reproductive mode, we cannot conclude whether individuals without the aneuploid chromosome can reproduce apomictically. Regardless of its prevalent distribution among B. holboellii (and 3C B. drummondii), the aneuploid chromosome appears to have originated from B. drummondii, as is evidenced by the phylogenetic analyses (Fig. 2). An alternative explanation would be that a third species provided the source of the aneuploid chromosome, but we have no comparative data such that this hypothesis can be tested. The sequence data and CAPS analysis presented here, in addition to microsatellite analyses (Sharbel and Mitchell-Olds, manuscript in preparation) show that the same DNA fragment characterizes the aneuploid chromosomes of different chloroplast haplotype lineages of B. holboellii from widely dispersed populations. In addition, the flow cytometric data (Sharbel and Mitchell-Olds, 2001), distribution of CAPS markers, and data of Böcher (1951) imply that the aneuploid chromosome can vary in size, and this can be attributed (at least partially) to an absence of synapsis and recombination during meiosis I. Finally, we have observed that the extra chromosome is highly heterochromatic suggesting that it contains high proportions of tandem and/or dispersed repeat DNA sequences. In this sense the extra chromosome follows the definition of a genuine B chromosome. An absence of recombination is suggested by the sequence analyses of loci MVI11 and T1B9, as aneuploid-specific alleles show elevated levels of non-synonymous substitutions, a reflection of relaxed selection pressure on them. Similar divergence patterns with respect to nucleotide position between aneuploid, drummondii-like and holboellii-like alleles may imply that the aneuploid element is relatively young, barring any genomic mechanisms which influence mutational patterns (Small and Wendel, 2002). Contrasting this pattern is the wide geographic distribution of the element (Sharbel et al., 2004), which implies that the element is relatively old. One explanation for these observations could be that the aneuploid chromosome is old (single or few origins), and has attained its present distribution through meiotic drive (Camacho et al., 2000), although this would also require some genetic mechanism (Small and Wendel, 2002) which acted to maintain diversity patterns in both

loci (Fig. 4). Alternatively, the data of Sharbel and MitchellOlds (2001) suggest multiple origins of polyploidy and aneuploidy. If aneuploidy results from chromosomal non-disjunction and loss during triploid meiosis (Böcher, 1951), which in itself is a random process, then similar aneuploid chromosome fragments in divergent (Cp haplotype and population) 2C+B and 3C+B individuals would imply natural selection action on the various chromosomal combinations produced by 3C individuals. As polyploid gene dosage is thought to play a role in apomixis expression (Normark et al., 2003; Simon et al., 2003), selection for a specific chromosome fragment in apomictic B. holboellii would suggest that this chromosome contains linked loci which are somehow involved with apomictic reproduction. Taken together, these results suggest that the aneuploid chromosome in B. holboellii is indeed a B chromosome. Interspecific origin, variable morphology and independent evolu-

tion of this non-recombining fragment are typical B chromosome characteristics (Jones and Rees, 1982; Camacho et al., 2000), although its potential connection with apomictic reproduction means that the element is an atypical B chromosome.

Acknowledgements We thank D. Schnabelrauch and A. Figuth for their help with sequencing, K. Krämer for his work with flow cytometry, and K. Eckstein for secretarial assistance. Additional seeds were collected by J. Konovsky, M. Marler, B. Smith, S. Rhoades, and M. Windham. T.F.S. extends his gratitude to D.M. Green, who introduced him to the joys of B chromosome so many years ago, and to John Ducrou for technical assistance during the preparation of this manuscript. T.F.S. would finally like to warmly thank Andrea and Lara for their support and humour throughout this work.

References Asker S, Jerling L: Apomixis in Plants (CRC Press, Boca Raton 1992). Beukeboom LW, Vrijenhoek RC: Evolutionary genetics and ecology of sperm dependent parthenogenesis. J Evol Biol 11:755–782 (1998). Böcher TW: Cytological and embryological studies in the amphi-apomictic Arabis holboellii complex. Det Kongelige Danske Videnskabernes Selskab 6:1–59 (1951). Böcher TW: Experimental taxonomical studies in the Arabis holboellii complex. Svensk Botanisk Tidskrift 48:31–44 (1954). Burgess SM: Homologous chromosome associations and nuclear order in meiotic and mitotically dividing cells of budding yeast. Adv Genet 46:49–90 (2002). Camacho JPM, Sharbel TF, Beukeboom LW: B chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Carman JG: Asynchronous expression of duplicate genes in angiosperms may cause apomixis, bispory, tetraspory, and polyembryony. Biol J Linn Soc 61:51–94 (1997). Clauss MJ, Cobban H, Mitchell-Olds T: Cross-species microsatellite markers for elucidating population genetic structure in Arabidopsis and Arabis (Brassicaeae). Mol Ecol 11:591–601 (2002). Dorn RD: Vascular Plants of Montana (Mountain West Publishing, Cheyenne 1984). Green DM: Muller’s ratchet and the evolution of supernumerary chromosomes. Genome 33:818–824 (1990). Hudson RR, Kreitman M, Aguade M: A test of neutral molecular evolution based on nucleotide data. Genetics 116:153–159 (1987). Jones RN, Rees H: B chromosomes (Academic Press, New York 1982). Koch M, Bishop J, Mitchell-Olds T: Molecular systematics and evolution of Arabidopsis and Arabis. Plant Biol 1:529–537 (1999). Koch M, Haubold B, Mitchell-Olds T: Molecular systematics of the Brassicaceae: evidence from coding plastidic matK and nuclear Chs sequences. Am J Bot 88:534–544 (2001). Koch MA, Dobes C, Mitchell-Olds T: Multiple hybrid formation in natural populations: concerted evolution of the internal transcribed spacer of nuclear ribosomal DNA (ITS) in North American Arabis divaricarpa (Brassicaceae). Mol Biol Evol 20:338– 350 (2003).

Koch MA, Haubold B, Mitchell-Olds T: Comparative evolutionary analysis of chalcone synthase and alcohol dehydrogenase loci in Arabidopsis, Arabis, and related genera (Brassicaceae). Mol Biol Evol 17:1483–498 (2000). Kumar S, Tamura K, Jakobsen B, Nei M: MEGA2: Molecular Evolutionary Genetics Analysis software. Bioinformatics 17:1244–1245(2001). Love A, Love D: Nomenclatural notes on arctic plants. Botaniska Notiser 128:497–523 (1975). Maxfield Boumil R, Kemp B, Angelichio M, NilssonTillgren T, Dawson DS: Meiotic segregation of a homeologous chromosome pair. Mol Genet Genomics 268:750–760 (2003). McVean GT: Fractious chromosomes: hybrid disruption and the origin of selfish genetic elements. Bioessays 17:579–582 (1995). Mogie M: On the relationship between asexual reproduction and polyploidy. J Theor Biol 122:493–498 (1986). Mogie M: A model for the evolution and control of generative apomixis. Biol J Linn Soc 35:127–153 (1988). Nei M: Molecular Evolutionary Genetics (Columbia University Press, Chichester 1987). Normark BB, Judson OP, Moran NA: Intraclonal genetic variation: ecological and evolutionary aspects. Genomic signatures of ancient asexual lineages. Biol J Linn Soc 79:69–84 (2003). Ramsey J, Schemske DW: Pathways, mechanisms, and rates of polyploid formation in flowering plants. Annu Rev Ecol Syst 29:467–501 (1998). Roche D, Hanna WW, Ozias-Akins P: Is supernumerary chromatin involved in gametophytic apomixis of polyploid plants? Sexual Plant Reproduction 13:343–349 (2001). Rollins RC: Studies of Arabis (Cruciferae) of western North America. Systematic Bot 6:55–64 (1981). Roy BA: Patterns of rust infection as a function of host genetic diversity and host density in natural populations of the apomictic crucifer, Arabis holboellii. Evolution 47:111–124 (1993). Roy BA: The breeding systems of six species of Arabis (Brassicaceae). Amer J Bot 82:869–877 (1995).

Roy BA, Bierzychudek P: The potential for rust infection to cause natural selection in apomictic Arabis holboellii (Brassicaceae). Oecologia 95:533–541 (1993). Roy BA, Rieseberg LH: Evidence for apomixis in Arabis. J Heredity 80:506–508 (1989). Rozas J, Rozas R: DnaSP version 3: an integrated program for molecular population genetics and molecular evolution analysis. Bioinformatics 15:174– 175 (1999). Sharbel TF, Mitchell-Olds T: Recurrent polyploid origins and chloroplast phylogeography in the Arabis holboellii complex (Brassicaceae). Heredity 87:59– 68 (2001). Sharbel TF, Mitchell-Olds T, Dobes C, Kantama L, de Jong H: Biogeographic distribution of polyploidy and B chromosomes in the apomictic Boechera holboellii complex. Cytogenet Genome Res, in press (2004). Simon J-C, Delmotte F, Rispe C, Crease T: Intraclonal genetic variation: ecological and evolutionary aspects. Phylogenetic relationships between parthenogens and their sexual relatives: the possible routes to parthenogenesis in animals. Biol J Linn Soc 79:151–163 (2003). Singh A, Henschel S, Sperling K, Kalscheuer V, Neitzel H: Differences in the meiotic pairing behavior of gonosomal heterochromatin between female and male Microtus agrestis: implications for the mechanism of heterochromatin amplification on the X and Y. Cytogenet Cell Genet 91:253–260 (2000). Small RL, Wendel JF: Differential evolutionary dynamics of duplicated paralogous Adh loci in allotetraploid cotton (Gossypium). Mol Biol Evol 19: 597–607 (2002). Suomalainen E: Parthenogenesis in animals. Adv Genet 3:193–253 (1950). Tajima F: Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123:585–595 (1989). van Baarlen P, Verduijn M, van Dijk PJ: What can we learn from natural apomicts? Trends Plant Sci 4:43–44 (1999). Van de Peer Y, De Wachter R: TREECON for Windows: a software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment. Comput Appl Biosci 10:569–570 (1994).

Cytogenet Genome Res 106:173–183 (2004)

183 41

Report of New B Chromosomes Cytogenet Genome Res 106:184–188 (2004) DOI: 10.1159/000079285

The occurrence of different Bs in Cestrum intermedium and C. strigilatum (Solanaceae) evidenced by chromosome banding J.N. Fregonezi,a C. Rocha,a J.M.D. Torezanb and A.L.L. Vanzelaa a Departamento b Departamento

de Biologia Geral, CCB, Universidade Estadual de Londrina, Londrina, PR; de Biologia Animal e Vegetal, CCB, Universidade Estadual de Londrina, Londrina, Parana´ (Brazil)

Abstract. In this study, we examine the morphology, mitotic stability, meiotic behavior and the composition of heterochromatin of B chromosomes in Cestrum intermedium and C. strigilatum. The results showed that B chromosome number shows intraindividual variation in the root meristem, which seems to lead to a slight rate of B elimination in this somatic

tissue. B chromosomes in both species were similar in size and shape, but differed with regard to the type, size and distribution of heterochromatin. Possible evolutionary pathways for B chromosome origin in Cestrum are discussed.

B chromosomes have been reported in many plants and animals, and they have been very well studied in economically important plant species such as Zea mays (Cheng and Lin, 2003) and Secale cereale (see Puertas, 2002). Generally, B chromosomes differ from the normal A chromosome complement, in size, form and DNA composition, but are easily recognized because they do not pair and recombine with any of the A chromosomes at meiosis. They may or may not be present in certain tissues, individuals, or populations, and probably originate from the normal complement by different mechanisms, as chromosome fragmentation, DNA amplification and introgression by interspecific hybridization (see Camacho et al., 2000; Dhar et al., 2002). It is accepted that inter- and intra-individual numerical variations of B chromosomes occur due to meiotic and mitotic instability, and in most cases these chromosomes have little or no phenotypic effect (Beukeboom, 1994; Puertas, 2002).

Bs are partially or totally composed of one or more repetitive DNA families whose copy number can be higher in Bs than in the A chromosomes (Camacho et al., 2000). Different types of DNA segments have been reported in Bs of plant species, including ribosomal cistrons and Bd49 tandem repeat sequence in Brachycome (Franks et al., 1996; Houben et al., 1997), heterochromatin in Medicago (Hossain and Bauchan, 1999), and PREM-1 retroelements and centromeric and telomeric sequences in Zea mays (Stark et al., 1996; Qi et al., 2002). Cestrum comprises over 250 tropical and subtropical American species (Smith and Downs, 1966). The chromosome number of these species is 2n = 2x = 16, organized mainly in metaand submetacentric chromosomes, with heterochromatin located at distal and intercalary positions and near the centromere. This heterochromatin was shown to be organized into four different groups: (i) cold-sensitive regions (CSRs), associated with AT-rich sites; (ii) GC-rich, adjacent to NOR; (iii) GCrich, not-associated with NOR; and (iv) weak Giemsa C-bands (dots) dispersed along chromosomes (Berg and Greilhuber, 1993a, b). This genus is particularly important because their representatives are widely used in reforestation programs in the Seasonal Semidecidual Forest of North Parana´ state (Southern Brazil). During routine cytogenetic studies of tropical tree species in our laboratory, representatives of five populations of two species of Cestrum (C. intermedium Sendtn. and C. strigilatum R. and P.) were examined, and Bs were found in seedlings obtained from one tree of each species under natural con-

Supported by the Brazilian agencies CAPES, CNPq, Fundaça˜o Arauca´ria and CPG-UEL. Received 10 August 2003; manuscript accepted 9 January 2004. Request reprints from Andre L. Laforga Vanzela Departamento de Biologia Geral, CCB Universidade Estadual de Londrina, CEP 86051-990 Londrina, PR (Brazil); telephone: +55 43 3371-4509 fax: +55 43 3371-4207; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0184$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

ditions. Both species can be found together in the forests border, but C. strigilatum is more abundant above 600 meters of altitude and C. intermedium under that. The aim of this study was to determine and compare the morphology, mitotic stability, meiotic behavior and heterochromatin types of Bs in these two species.

Materials and methods Plant material Seeds of C. intermedium containing Bs were collected from only one tree located at the “Parque Estadual Mata dos Godoy”- PEMG - (Londrina, Parana´, Brazil). Similarly, seeds of C. strigilatum were collected from only one tree located at the “Terra Indı´gena Sa˜o Jerônimo” – TISJ – (Sa˜o Jerônimo da Serra, Parana´, Brazil), about 90 km from Londrina. Both areas are sections of the Seasonal Semidecidual Forest of Southern Brazil. Twenty-eight seedlings of C. intermedium and twenty-five of C. strigilatum were obtained and cultivated in tubes at a nursery and used for cytogenetic analysis. Approximately half of the seedlings showed one B, except for C. intermedium that showed two individuals with two Bs. Eight seedlings from each species were analysed to investigate intraindividual variation in B number in metaphase spreads. Seedlings were cultivated for flower production. Vouchers of each seed donor tree were deposited at the FUEL herbarium. Conventional staining Root tips pretreated with 0.05 % colchicine and young anthers were fixed in Carnoy’s solution (ethanol:acetic acid, 3:1, v:v) for 12–24 h and stored at –20 ° C. Chromosome preparations were stained using Feulgen (mitosis) and 2 % Giemsa (meiosis). Slides were mounted with Entellan (Merck). Cells were analyzed for the presence of Bs, and grouped as: (i) cells without Bs, (ii) with one, and (iii) with two Bs, only when the presence or absence of Bs was clearly evident. Cold-sensitive regions (CSRs) staining Root tips were collected and kept in a Bristol nutrient solution (Bold, 1949) at 0–2 ° C for 24 h, and fixed in Carnoy. Squashes were performed with root tips in a drop of 45 % acetic acid, and slides stained with 2 % Giemsa. Chromosome banding and FISH Chromosome banding was performed on root tips softened in 4 % cellulase plus 40 % pectinase at 37 ° C for 1 h and squashed in a drop of 45 % acetic acid. Slides were treated according to Schwarzacher et al. (1980) and stained with 2 % Giemsa in distilled water, or in 0.5 mg/ml CMA3 and 2 Ìg/ml DAPI. FISH was performed according to Cuadrado and Jouve (1994a) with modifications. The probes utilized were pTa71 and pTa794 (containing 18S-5.8S26S and 5S rDNA, respectively) labeled with biotin-14-dATP by nick translation. Signals were detected with avidin-FITC and chromosomes counterstained with 2.5 Ìg/ml propidium iodide. Slides stained with Giemsa were mounted with Entellan, the slides with fluorochromes were mounted with 50 % glycerol in McIlvaine buffer, and those used for FISH were mounted with antifade. Photographs were taken with Kodak Imagelink HQ 25 ISO for conventional staining, Kodak T-Max 100 ISO for fluorochrome banding and Kodak Proimage 100 ISO for FISH.

Results The two Cestrum species had similar karyotypes of 2n = 2x = 16, which included mainly metacentric and submetacentric type chromosomes, except for the smallest pair which was submetacentric in C. strigilatum (Fig. 1A) and more acrocentric in C. intermedium (Fig. 1B). Conventional analysis showed individuals with and without B chromosomes in both species. There was no variation in the morphology among Bs, which presented similar size and acrocentric shape (Fig. 1A, B).

Table 1. B chromosome frequency in eight samples of Cestrum intermedium Samples

Cells without B

Cells with 1 B

Cells with 2 B

Total cells

PEMG-1 PEMG-6 PEMG-7 PEMG-8 PEMG-15 PEMG-18 PEMG-19 PEMG-24

0 6 (4.3%) 1 (1.8%) 1 (1.7%) 3 (5.6%) 1 (3.6%) 1 (1.1%) 0

36 (100%) 134 (95.0%) 56 (98.2%) 59 (98.3%) 51 (94.4%) 27 (96.4%) 88 (98.9%) 32 (37.2%)

0 1 (0.70%) 0 0 0 0 0 54 (62.8%)

36 141 57 60 54 28 89 86

Total

13

483

55

551

Table 2. B chromosome frequency in eight samples of Cestrum strigilatum Samples

Cells without B

TISJ-1 TISJ-5 TISJ-10 TISJ-12 TISJ-15 TISJ-20 TISJ-25 TISJ-27

1 (2.8%) 0 0 0 1 (3.1%) 1 (3.4%) 0 1 (4.0%)

Total

4

Cells with 1 B 35 (97.2%) 26 (100%) 19 (100%) 24 (100%) 31 (96.9%) 28 (96.5%) 21 (100%) 24 (96.0%) 208

Cells with 2 B 0 0 0 0 0 0 0 0

Total cells 36 26 19 24 32 29 21 25 212

Bs were easily recognized because they were about three times smaller (2.93 Ìm) than the chromosomes of the normal complement (7.25–10.48 Ìm). In addition, Bs of C. strigilatum appeared as typical univalent in about 80 % of pollen mother cells (Fig. 1C). Somatic cells of both species were analysed to detect intraand inter-individual variations in the number of Bs (Table 1). In C. intermedium, only one seedling (PEMG-1) showed no intraindividual variation in B number, but the remaining seven individuals showed between cell variation, with clear predominance of one of the cell classes. If B number in the modal class would coincide with the original number of Bs in the zygote, we could infer that seven of the individuals analysed in C. intermedium had 1B in the zygote stage, and the remaining individual (PEMG-24) had 2B. The asymmetry of B number distributions, with lower frequency of 2B than 0B classes in 1B seedlings, and the absence of 3B cells but high frequency of 1B in PEMG-24, suggests a tendency for B chromosome elimination in this somatic tissue (root meristem). The same was apparent in C. strigilatum, although the tendency to B elimination seemed to be lower in this species since it occurred in only half of the individuals analysed (Table 2). The results obtained from Giemsa C-banding showed that C. strigilatum (Fig. 1D) and C. intermedium (Fig. 1E) had terminal and intercalary heterochromatic blocks in the A complement, and in C. intermedium additional weak centromeric

Cytogenet Genome Res 106:184–188 (2004)

185 43

Fig. 1. (A) Metaphase of C. strigilatum with one B. Arrows indicate the submetacentric pair. (B) Metaphase of C. intermedium with two Bs. Arrows indicate the acrocentric pair. (C) Meiotic metaphase of C. strigilatum, showing an unpaired B. (D) Giemsa C-banding in C. strigilatum. (E) Giemsa C-banding in C. intermedium. Arrows point to the Bs in D and E. (F) Metaphase cold treated in C. strigilatum. Arrow indicates the B. (G) C-CMA3 banding in C. strigilatum. (H) C-DAPI banding in C. strigilatum. (I) C-CMA3 banding in C. intermedium. (J) C-DAPI banding in C. intermedium. Arrows point to CMA30/DAPI0 in A and B chromosomes.

bands appeared in some chromosomes. Centromeric bands in C. strigilatum were not seen. Significant differences in the distribution and size of heterochromatic blocks in Bs of the two species were observed. In Cestrum intermedium, Bs exhibited large heterochromatic blocks at both terminal positions, oc-

186 44

Cytogenet Genome Res 106:184–188 (2004)

cupying about 50 % of the chromosome, and in some preparations, thin intercalary “dots” were also observed (Fig. 1E). B chromosomes of C. strigilatum exhibited up to three small intercalary blocks (dots) on the short and long arms, totaling about 30 % of the chromosome (Fig. 1D).

45S 45S

5S 45S

5S

45S

Fig. 2. Metaphase of C. intermedium with two Bs after FISH with 45S and 5S rDNA probes. Large arrows point to Bs without hybridization signals, and small arrows point to 5S rDNA sites on the A chromosomes.

Results of C-CMA3/DAPI banding showed that most of the heterochromatic blocks in the A complement of C. strigilatum evidenced by Giemsa C-banding were GC- or AT-rich. These AT-rich blocks were sensitive to cold treatment. Interestingly, the Giemsa C-banded heterochromatin detected in the Bs of C. strigilatum was neither AT- nor GC-rich (Fig. 1G, H). The A complement of C. intermedium had pericentromeric AT-rich blocks that were not cold sensitive, fine intercalary CSRs associated with the AT-rich blocks, plus terminal and intercalary GC-rich blocks. The terminal Giemsa C-banded blocks visualized in the Bs of C. intermedium were CMA30/DAPI0, in both samples with one and two Bs (Fig. 1I, J). Intercalary “dots” visualized with C-Giemsa banding were not evident with fluorochromes. CSRs were not detected in the Bs of either species (Fig. 1F). FISH with 45S and 5S rDNA probes showed hybridization signals on A chromosomes but not on B chromosomes in both species (Fig. 2). Two major signals of 45S rDNA probe were found in terminal regions of a metacentric and a submetacentric chromosome pair. The latter also showed a proximal 5S rDNA site in the long arm. A minor 45S rDNA site was detected at terminal positions of the long arm in another M-SM chromosome pair (Fig. 2).

Discussion B chromosomes might be present in up to 15 % of animal and plant species (Beukeboom, 1994). Detailed studies including the molecular composition and transmission rate of Bs have been conducted in a number of plants (Puertas, 2002), but studies on B chromosomes in the Solanaceae family are scarce, as well as in other tropical trees. Acrocentric B chromosomes have recently been described in the Solanaceae Cestrum parqui and in the hybrid C. parqui × C. aurantiacum (Sy´korova´ et al., 2003). These Bs showed overlay of rDNA 5S and 45S at terminal/subterminal positions of the short arm, and rDNA 45S at terminal positions of the long arm, besides dots of BR23 sequences (a 405-bp segment composed of 9–10 bp minisatel-

lite repeats of 5)-A4–5CTGCT-3)). We provide here the first report of the occurrence of B chromosomes in Cestrum intermedium and C. strigilatum. Bs were found in about half of the individuals analyzed in each species and the study also revealed chromosome differences in the heterochromatic pattern between the Bs of C. strigilatum and C. intermedium. It is generally accepted that B chromosome frequency is unstable because Bs do not segregate regularly in meiosis and mitosis, which may lead to B accumulation associated with nondisjunction (Camacho et al., 2000). Samples originating from a donor seed tree of Cestrum intermedium and another of C. strigilatum, showed some intra-individual variation in the number of Bs indicating a slight mitotic instability apparently causing some B elimination from somatic tissues. It would be interesting to analyse whether germ tissues also show this kind of variation and whether it leads to B accumulation or elimination. At this stage of the investigations it is not known whether the Bs present in the seedlings came from the male or female parent nor whether the presence of Bs is advantageous or deleterious to individuals carrying them. Plant genomes are highly dynamic, mainly due to the instability of repetitive DNA associated with amplification, deletion and change in motif position (Guerra, 2000). The dynamics of repetitive DNA has been suggested as an important feature in the appearance and stabilization of B chromosomes in many organisms. The higher content of the heterochromatin of Bs could be associated with the intensity of drive (Camacho et al., 2000). Thus, Cestrum is an excellent tool for such studies due to the presence of Bs and the presence of different types of heterochromatin in the A complement, as previously reported by Berg and Greilhuber (1993a, b). Differences and similarities in the type of heterochromatin between chromosomes of the A complement and the Bs, as well as between Bs of the two species were found. CMA30/DAPI0 heterochromatin, which was not cold sensitive, was only detected in the B of C. intermedium. This is the first report of CMA30/DAPI0 heterochromatin in the genus Cestrum. It suggests a new type of heterochromatin contributing to the formation of Bs. The other differences between the Bs of the two species were clearly evident in regard to the size and location of heterochromatin, which was more abundant in C. intermedium than in C. strigilatum. Apparently, the only similarity between the Bs of C. intermedium and C. strigilatum, besides their same size and shape observed by conventional staining, was the occurrence of Giemsa C-banded “dots,” which were not detected by fluorochromes nor by cold sensitive treatment. Therefore, it is possible that the heterochromatin found as “dots” in the Bs is related to those “dots” revealed by Giemsa C-banding in the A complement of both species. An excellent investigation that demonstrated the importance of different repetitive DNAs in the B chromosomes of plants was conducted in Brachycome dichromosomatica. In this report, Houben et al. (1999) found two different Bs, one small and another large, which showed at least one hybridization site for each of the repeated DNA sequences: Bd49, Bdm29 and an inactive rDNA segment, which suggested a possible monophyletic origin for these Bs. B chromosomes, regardless of size and form, almost certainly originate from the standard A chromosome complement

Cytogenet Genome Res 106:184–188 (2004)

187 45

(Camacho et al., 2000; Puertas, 2002). Cuadrado and Jouve (1994b) studied different rye plants bearing 0, 1 and 2 B chromosomes with some repetitive DNA probes. Based on their findings, these authors suggested that different Bs from different populations present common segments with the A chromosomes, indicating a possible unique origin from A complement. An excellent contribution in favour of the relationship between Bs and A chromosomes was reported by Cheng and Lin (2003). These authors isolated Bs by means of micromanipulation and obtained 19 repetitive sequences after PCR amplification, of which just one did not show homology with the A chromosomes. After having originated from the A complement, B chromosomes can follow their own evolutionary pathway. According to Beukeboom (1994), Bs and As can become less homologous due to accumulation of mutations. Unlike rye, the origin of Bs in these two Cestrum species points to two divergent hypotheses. In the first, the occurrence of Bs with similar size and acrocentric shape in three species of the same genus (including C. parqui), could indicate a common origin for these Bs. Hence, the occurrence of heterochromatin in Bs, differing in type and distribution, could be explained by an independent generation of repetitive DNA in C. intermedium and C. strigilatum, following DNA rearrangements after the formation of Bs. However, it is difficult to explain the maintenance of the same shape in the Bs of three species after great changes in heterochromatin. Perhaps if Bs do follow their own evolutionary pathway this is merely a coincidence. An example of this was reported in four cytodemes of Brachycome dichromosomatica (see Houben et al., 1999) where the Bs are the same size but in one cytodeme a translocation of the rDNA locus and Bd49 position was detected. Other evidence suggests the proposal of a second hypothesis, that is, the independent origin of Bs. The findings that support the latter notion are: (i) the classification

of these species in distinct sections of the genus, according to differences in morphological features, (ii) the striking differences among Bs in the composition and size of the blocks of heterochromatin, e.g, the large terminal CMA30/DAPI0 blocks in C. intermedium and their absence in C. strigilatum and (iii) the occurrence of 45S and 5S rDNA in C. parqui and its absence in C. strigilatum and C. intermedium. Thus, it is possible that these Bs originated independently in these species, and the similarities in acrocentric form and size were only a coincidence. Alternatively, it could indicate the existence of some nucleotypic mechanism that controls and organizes B macrostructure in Cestrum. At the moment, we do not have a definite preference for one hypothesis over the other, and great efforts are being directed toward the further understanding of these Bs. This article provides the second account of Bs in the genus Cestrum and, in addition, it enhances our knowledge of the importance of repetitive DNA in the organization of these chromosomes. However, further studies are warranted to answer questions about transmission rate, detailed molecular organization and evolutionary mechanisms. Bs in Cestrum seem to be excellent material for this type of investigation because representatives of two species occur in natural populations, without natural hybrids, and they differ substantially from A chromosomes in size. The latter physical feature could facilitate the identification of Bs in micromanipulation and crossbreeding procedures.

Acknowledgments The authors thank Edson Mendes Francisco and Karina L. V. Ramalho de Sa´ for help with botanical material.

References Berg C, Greilhuber J: Cold-sensitive chromosome regions and heterochromatin in Cestrum (Solanaceae): C. strigilatum, C. fasciculatum, and C. elegans. Plant Syst Evol 185:133–151 (1993a). Berg C, Greilhuber J: Cold-sensitive regions and heterochromatin in Cestrum aurantiacum (Solanaceae). Plant Syst Evol 185:259–273 (1993b). Beukeboom LW: Bewildering Bs: an impression of the 1st B-chromosome conference. Heredity 73:328– 336 (1994). Bold HC: Bristol’s solution and medium. (1949). Available at: http://www.pai.utexas.edu/research/utex/ media/bristol.html. Camacho JPM, Sharbel TF, Beukeboom LW: B chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Cheng YM, Lin BY: Cloning and characterization of maize B chromosome sequences derived from microdissection. Genetics 164:299–310 (2003). Cuadrado A, Jouve N: Mapping and organization of highly-repeated DNA sequences by means of simultaneous and sequential FISH and C-banding in 6x-Triticale. Chromosome Res 2:331–338 (1994a).

188 46

Cuadrado A, Jouve N: Highly repetitive sequences in B chromosomes of Secale cereale revealed by fluorescence in situ hybridization. Genome 37:709–712 (1994b). Dhar MK, Friebe B, Koul AK, Gill BS: Origin of an apparent B chromosome by mutation, chromosome fragmentation and specific DNA sequence amplification. Chromosoma 111:332–340 (2002). Franks TK, Houben A, Leach CR, Timmis JN: The molecular organisation of a B chromosome tandem repeat sequence from Brachycome dichromosomatica. Chromosoma 105:223–230 (1996). Guerra M: Patterns of heterochromatin distribution in plant chromosomes. Gen Mol Biology 23:1029– 1041 (2000). Hossain MA, Bauchan GR: Identification of B chromosomes using Giemsa banding in Medicago. J Heredity 90:428–429 (1999). Houben A, Leach CR, Verlin D, Rofe R, Timmis JN: A repetitive DNA sequence common to the different B chromosomes of the genus Brachycome. Chromosoma 106:513–519 (1997). Houben A, Thompson N, Ahne R, Leach CR, Verlin D, Timmis JN: A monophyletic origin of the B chromosomes of Brachycome dichromosomatica (Asteraceae). Plant Syst Evol 219:127–135 (1999).

Cytogenet Genome Res 106:184–188 (2004)

Puertas MJ: Nature and evolution of B chromosomes in plants: A non-coding but information-rich part of plant genomes. Cytogenet Genome Res 96:198– 205 (2002). Qi ZX, Zeng H, Li XL, Chen CB, Song WQ, Chen RY: The molecular characterization of maize B chromosome specific AFLPs. Cell Res 12:63–68 (2002). Schwarzacher TP, Ambros P, Schweizer D: Application of Giemsa banding to orchid karyotype analysis. Plant Syst Evol 134:293–297 (1980). Smith LB, Downs RJ: Solana´ceas, in Reitz PR (ed): Flora Ilustrada Catarinense. Part 1, pp 1–321 (Biblioteca Superior de Cultura, Itajaı´ 1966). Stark EA, Connerton I, Bennett ST, Barnes SR, Parker JS, Forster JW: Molecular analysis of the structure of the maize B-chromosome. Chromosome Res 4:15–23 (1996). Sy´korova´ E, Yoong Lim K, Fajkus J, Leitch AR: The signature of the Cestrum genome suggests an evolutionary response to the loss of (TTTAGGG)n telomeres. Chromosoma 112:164–172 (2003).

Report of New B Chromosomes Cytogenet Genome Res 106:189–194 (2004) DOI: 10.1159/000079286

Distribution and stability of supernumerary microchromosomes in natural populations of the Amazon molly, Poecilia formosa D.K. Lamatsch, a I. Nanda,b I. Schlupp,c J.T. Epplen,d M. Schmidb and M. Schartla Institutes of a Physiological Chemistry I and b Human Genetics, Biocenter, University of Würzburg, Würzburg (Germany); c Zoologisches Institut, Universität Zürich, Zürich (Switzerland); d Human Genetics, Ruhr-Universität Bochum, Bochum (Germany)

Abstract. In animals, supernumerary chromosomes and their evolution have mostly been studied in sexual reproducing species. In the present study, for the first time, the natural distribution and stability of supernumerary microchromosomes were investigated in the unisexual fish species Poecilia formosa. Natural habitats throughout the range of P. formosa were screened for the presence of microchromosomes over several years. A high frequency of microchromosomes was found in the

Rı´o Purificacio´n river system. Evidence points to the presence of the same microchromosome lineage over many generations. No supernumerary chromosomes were found elsewhere than in the Rı´o Purificacio´n representing a significant difference in the distribution of microchromosome-bearing individuals between the Rı´o Purificacio´n and all other collection sites.

Supernumerary chromosomes, also called B chromosomes, have been found in all major groups of plants and animals (Jones and Rees, 1982). Their occurrence in fishes has been described earlier. In addition to the 21 fish species listed by Salvador and Moreira-Filho (1992), five other species have been reported to have supernumerary chromosomes (Vicente et al., 1996). They vary greatly in size from microchromosomes (e.g. in Prochilodus scrofa, Pauls and Bertollo, 1983; and Moenkhausia sanctaefilomenae, Foresti et al., 1989), to medium-sized chromosomes (e.g. Rhamdia hilarii, Fenocchio and Bertollo, 1990) or even macrochromosomes (Astyanax scabri-

pinnis, Maistro et al., 1992; Alburnus alburnus, Ziegler et al., 2003). Two primary sources for B chromosomes have been considered (Jones and Rees, 1982; Green, 1990; Camacho et al., 2000): either an intragenomic fragment acquires the characteristics of a B chromosome from duplicated or fragmented pieces within a genome, or interspecific hybridization provides foreign DNA from a closely related species that evolves into a supernumerary chromosome. P. formosa, commonly called Amazon molly, is a small freshwater fish distributed in southern Texas and northeastern Mexico (Schlupp et al., 2002). It was the first unisexual vertebrate to be described (Hubbs and Hubbs, 1932). Its mode of reproduction is gynogenesis (Kallman, 1962) which is defined as sperm-dependent parthenogenesis. Normally, females produce unreduced diploid eggs which are only activated for embryogenesis by sperm of males of closely related species (P. mexicana, P. latipinna, P. latipunctata, Schlupp et al., 2002). Therefore, the offspring is genetically identical to the mother. Supernumerary chromosomes in this species most probably result from a failure in the mechanism, which clears the egg from the sperm nucleus. The interspecific origin could be demonstrated for individuals who expressed a paternal

Supported by the DFG (SFB 567 Mechanismen der interspezifischen Interaktion von Organismen) and Fonds der Chemischen Industrie. Received 28 October 2003; revision accepted 23 January 2004. Request reprints from Dunja Lamatsch, Institute of Physiological Chemistry I Biocenter, Am Hubland, University of Würzburg DE–97074 Würzburg (Germany); telephone: +49 931 888 4152 fax: +49 931 888 4150; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0189$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Fig. 1. Map of the different collection sites in northeastern Mexico and southern Texas as listed in Table 1. Spotted lines are streets (see Balsano et al., 1972). San Marcos (not shown in map) is an introduced population from Caldwell County in central Texas. Source of the introduction was Brownsville (Schlupp et al., 2002).

macromelanophore locus resulting in spotted individuals (Schartl et al., 1995, 1997). Macromelanophores are a pigment cell type specific to the Black molly, an ornamented Poecilia strain selected for its black body pigmentation. Such Black mollies are commonly used as host males in the laboratory. This is a very rare situation since normally supernumerary chromosomes are considered to be genetically inert (Jones and Rees, 1982). In the Amazon molly, not only the above described microchromosomes of Black molly origin exist, but also naturally occurring microchromosomes in wild-type individuals have been seen (Sola et al., 1993). In the genus Poecilia the karyotype usually shows 46 subtelocentric and acrocentric chromosomes (for an overview see Prehn and Rasch, 1969; Haaf and Schmid, 1984; Sola et al., 1992a; Schartl et al., 1995; Rodionova et al., 1996). In P. formosa different chromosomal clones have been described, mostly based on different nucleolus organizer region (NOR) positions (Sola et al., 1997), or heteromorphism of the short arms of chromosome pair 1 (Sola et al., 1992b).

190 48

Cytogenet Genome Res 106:189–194 (2004)

In the present study the natural distribution and the stability of microchromosome bearing P. formosa lineages was studied over several years. We screened natural habitats throughout the range of the Amazon molly for the presence of microchromosomes. Animals bearing microchromosomes were bred for one generation to study whether the microchromosomes are transmitted stably to their offspring. We found a high frequency of microchromosomes in the Rı´o Purificacio´n river system, whereas in other parts of the natural range of P. formosa this phenomenon appears to be rare or absent. Evidence was obtained that points towards the presence of the same microchromosome over many generations.

Materials and methods Fishes All experimental fish were kept in the aquarium of the Biocenter of the University of Würzburg under standard conditions. Wild fish were from the different collection sites in northeastern Mexico and Texas (Table 1, Fig. 1).

Fig. 2. Representative Giemsa-stained metaphases showing the presence of a single accessory (a) tiny and (b) large microchromosome in specimens of unisexual Amazon molly from the Rı´o Purificacio´n population. Arrows indicate the microchromosomes. Note the presence of a large metacentric chromosome (arrowhead) in 2n = 45 specimens with the larger microchromosome in b.

Cytogenetic analyses Cytogenetic analyses were carried out according to Nanda et al. (1995). Chromosomes were Giemsa-stained. At least 10 Giemsa-stained metaphases were counted for each individual. Multilocus DNA fingerprinting DNA was extracted using EDTA buffer and phenol/chloroform according to the method of Blin and Stafford (1976). HinfI was used for restriction digestion, and the restriction fragments were separated on a 0.8 % agarose gel at 1 V/cm. In-gel hybridization was done essentially as described by Nanda et al. (1988). The 32P-labeled oligonucleotides (GATA)4, (GGAT)4, (GA)8, and (CA)8 specific to hypervariable simple repeats were used as hybridization probes.

Results A total of 129 individuals collected between 1993 and 2002 from 14 different sites were analyzed (Fig. 1). In addition to karyotypically normal (2n = 46) diploid specimens (N = 101), metaphases from 28 individuals showed a microchromosome. All metaphases analyzed from these microchromosome-carrying specimens conspicuously had a single microchromosome (Fig. 2). Thus the microchromosome appears to be mitotically stable. Further detailed analysis uncovered that some of these microchromosome-bearing individuals had one unpaired large metacentric chromosome and their diploid number was 45 instead. Due to its small size, it was not possible to detect specific features of the microchromosome using traditional cytogenetic methods. Intriguingly, microchromosomes were only found in females from the Rı´o Purificacio´n. Out of 28 females carrying microchromosomes, 7 individuals showed the normal 2n = 46 chromosome complement with one tiny microchromosome (2n = 46+m) (Fig. 2a). Fourteen individuals, however, were pseudoaneuploid with a diploid chromosome number of 45, and their karyotype displayed one large metacentric chromosome and a larger microchromosome (2n = 45+F+M) (Fig. 2b). Seven individuals showed a triploid karyotype with one tiny

microchromosome of the same type as in the diploid karyotype (3n = 69+m). The frequency of microchromosomes in the Rı´o Purificacio´n (28 with and 47 without, 37.33 %) differs significantly from the frequency at all other collection sites (0 with and 54 without) (¯2 test, df = 1, ¯2 = 23.61, P ! 0.0001; cf. Table 1). Individuals carrying microchromosomes or triploids do not differ phenotypically from diploid individuals. Multilocus DNA fingerprinting of the microchromosomebearing fishes revealed that one analyzed female showing the tiny microchromosome (2n = 46+m) belongs to clone f (Fig. 3), a frequent clone among diploid P. formosa (Lampert et al., 2004). This means that either a fish from clone f has acquired the microchromosome, or alternatively most of the fish of clone f have lost it. Surprisingly, eleven analyzed females possessing the larger microchromosome (45+F+M) belong to six different clones. Clone b) shows one additional band to the overall identical banding pattern of clone b, whereas c) differed from clone c in lacking only one band (Fig. 3). Overall, the basic banding pattern of all clones is quite similar. These clones could not be found in 39 additionally analyzed diploid individuals (data not shown). Two triploid individuals with the tiny microchromosome were analyzed by multilocus DNA fingerprinting. They resemble two different clones (C and E). Whereas clone D is represented by this individual only, clone C is frequent among triploid animals (Lampert et al., 2004). One female of each microchromosome-bearing clone was mated to a Black molly male, and the offspring was analyzed cytogenetically for the presence of the different microchromosomes. It could be shown that the females of the three different clones (2n = 46+m, 2n = 45+F+M, 3n = 69+m) transmitted their microchromosomes to the next generation (N = 5, N = 1, and N = 4, respectively).

Cytogenet Genome Res 106:189–194 (2004)

191 49

Table 1. Number and type of microchromosomes found in P. formosa from natural populations in northeastern Mexico and southern Texas. 2n = 46 refers to animals without microchromosomes. 2n = 46+m and 3n = 69+m refer to diploid and triploid specimens with a single tiny microchromosome, respectively. Animals showing the large metacentric chromosome and a larger microchromosome are referred to as 2n = 45+F+M. Note that microchromosomes were only found in the Rio Purificacio´n populations. Numbers of collection sites as given in Fig. 1.

Mexico

Texas

Locality

Collection site no.

Year

2n = 46

2n = 46+m

2n = 45+F+M 3n = 69+m

N

Rio Purificación, Barretal

28

1993 1996 1998 2002

2 a 29 8 3

2 3 – 2

1 12 1 –

– – 5 1

5 44 14 6

Rio Purificación, Nuevo Padilla

29

1993 1996 1998

1 3 1

– – –

– – –

– – 1

1 3 2 2

Rio Barberena, near Lomas del Real

36

1994

2

–

–

–

Rio Guayalejo, near El Limón

22

1993

1

–

–

–

1

Mante

23

1993

1

–

–

–

1

Ditch north of Mante

21

1993 1998

2 5

– –

– –

– –

2 5

near González (Mex 80)

24

1993

3

–

–

–

3

Rio Guayalejo (Mex 85)

26

1998

1

–

–

–

1

Laguna Champaxan near Altamira

38

1994 2002

3 8

– –

– –

– –

3 8

1

1994

1

–

–

–

1

Northmost Brownsville

2

1994

5

Olmito

3

1995

2

Bay View

4

San Marcos a

1995

2

1994

18

a

–

–

–

5

–

–

–

2

–

–

–

2

–

–

–

18

Heteromorphism chromosome 1.

Discussion In the genus Poecilia the karyotype usually shows 46 subtelocentric or acrocentric chromosomes (Prehn and Rasch, 1969; Haaf and Schmid, 1984; Sola et al., 1992a; Rodionova et al., 1996). In cytogenetic studies on P. formosa only very small sample sizes have been analyzed up to date. Different chromosomal clones have been described in P. formosa, mostly based on different NOR positions (Sola et al., 1997), or heteromorphism of the short arms of chromosome pair 1 (Sola et al., 1992b). Sola et al. (1993) described a single individual out of six investigated fish from the Rı´o Purificacio´n, Nuevo Padilla, Mexico, showing an unpaired metacentric chromosome and a larger microchromosome. In addition, the authors found a triploid individual also showing a single microchromosome. We report here, for the first time, on an extensive screening of different populations of P. formosa focusing on microchromosomes. It is noteworthy that we found the single tiny microchromosome in four different sampling years. No supernumerary chromosomes were found elsewhere than in the Rı´o Purificacio´n. Obviously, there is a significant difference in the distribution of microchromosome-bearing individuals between the Rı´o Purificacio´n and all other collection sites. Thus the Rı´o Purificacio´n may represent a hot-spot for the presence of microchromosomes. Several reasons may explain this pattern: the probability of de novo origin of microchromosomes at other

192 50

a

Cytogenet Genome Res 106:189–194 (2004)

sites may be very low, and/or the conditions for the persistence of such clones may be exceptionally favorable in the Rı´o Purificacio´n. Alternatively, it cannot be excluded that future samplings may reveal the existence of microchromosome-bearing clones at other sites. As analyzed by multilocus DNA fingerprinting, the eleven females possessing the larger microchromosome (45+F+M) belong to six different clones. Taking into account that a similar banding pattern could not be found among 39 diploid individuals analyzed additionally, it is likely that this karyotype evolved only once, and that the observed intraclonal genetic differences are due to mutations that occurred afterwards. The existence of six clearly distinguishable clones points to the fact that many generations must have passed since their common origin because, in general, the mutation rate apparent in different DNA fingerprint patterns is very low in P. formosa. Finding these different clones in subsequent years in the Rı´o Purificacio´n suggests them to be a stable component of the population. In addition, we could show that all offspring tested from the following generation invariantly had the same karyotype as their mothers, including the tiny microchromosome or the metacentric chromosome plus the larger microchromosome. In summary, our study provides some information of the distribution and stability of accessory chromosomes in the genome of the asexual Amazon molly in natural condition. It is

Fig. 3. Multilocus DNA fingerprint of one diploid animal with one tiny microchromosome (2n = 46+m) belonging to the common diploid clone f also found in animals without microchromosomes. Eleven individuals with the unpaired metacentric fusion chromosome and the larger microchromosome (45+F+M) making up six different clones with a very similar basic banding pattern. In-gel hybridization 32P-labeled with oligonucleotide (GGAT)4. Two triploid individuals with one tiny microchromosome (3n = 69+m). Whereas clone E is made up of this single individual only, clone C is frequent among triploids. In-gel hybridization with 32P-labeled oligonucleotide (GT)8.

noteworthy that our repeated sampling over extended years (1993–2002) failed to detect individuals with two or more microchromosomes. This is quite different from the situation reported for those from laboratory broods using the Black molly as sperm donor (Schartl et al., 1995). This might suggest the existence of an upper limit for B number under natural conditions. The larger microchromosome in the fish with 2n = 45 karyotype can be explained by two possibilities. Either it is a host species-derived element like the other – although smaller – microchromosomes, or it could be of intragenomic origin. The appearance of a large metacentric chromosome along with a larger marker chromosome among the individuals with 2n = 45 can be assumed to be the result of a centric fusion involving a breakpoint within or near the centromeric region of two different chromosomes with a recognizable short arm. In this scenario the newly rearranged karyotype will contain a large monocentric metacentric chromosome (F) and consequently will gain a small centric translocation product (White, 1973; Holmquist and Dancis, 1979). In most instances such a small translocation product becomes unstable and is eventually lost due to the lack of a homologous partner during meiotic division in sexually

reproducing animals. Absence of normal meiosis among asexually reproducing vertebrates like the Amazon molly may render to retain this small marker chromosome. In this regard, a fluorescence in situ hybridization experiment with a microdissected microchromosome paint is necessary for precise detection of the breakpoints preceding the centromeric fusion, and to prove that the small microchromosome indeed is an intragenomic segment. In asexual (clonal) organisms mutations are usually the only source of genetic variability. In the case of the Amazon molly, microchromosomes play a role as an additional source of genetic variability, but their function and evolutionary significance remain to be tested.

Acknowledgements We are grateful to the Mexican government for issuing permit no. 210696-213-03 and two fishing licenses (Texas) to collect P. formosa, and to J. Parzefall, M. Döbler, I. Schlupp, K. Körner, U. Hornung and A. Froschauer and local people at Barretal for help in the field. We thank H. Schwind, G. Schneider and P. Weber for breeding of the fish in the laboratory, and P. Fischer and M. Hidding for technical support.

Cytogenet Genome Res 106:189–194 (2004)

193 51

References Balsano JS, Darnell RM, Abramoff P: Electrophoretic evidence of triploidy associated with populations of the gynogenetic teleost Poecilia formosa. Copeia 2:292–297 (1972). Blin N, Stafford DW: A general method for isolation of high molecular weight DNA from eukaryotes. Nucleic Acids Res 3:2303–2308 (1976). Camacho JP, Sharbel TF, Beukeboom LW: B-chromosome evolution. Philos Trans R Soc Lond B Biol Sci 355:163–178 (2000). Fenocchio AS, Bertollo LA: Supernumerary chromosome in a Rhamdia hilarii population (Pisces, Pimelodidae). Genetica 81:193–198 (1990). Foresti F, Almeida-Toledo LF, Toledo FS: Supernumerary chromosome system, C-banding pattern characterization, and multiple nucleolus organizer regions in Moenkhausia sanctaefilomenae (Pisces, Characidae). Genetica 79:107–114 (1989). Green DM: Muller’s ratchet and the evolution of supernumerary chromosomes. Genome 33:818–824 (1990). Haaf T, Schmid M: An early stage of ZW/ZZ sex chromosome differentiation in Poecilia shenops var. melanistica (Poeciliidae, Cyprinodontiformes). Chromosoma 89:37–41 (1984). Holmquist GP, Dancis B: Telomere replication, kinetochore organizers, satellite DNA evolution. Proc Natl Acad Sci USA 76:4566–4570 (1979). Hubbs CL, Hubbs LC: Apparent parthenogenesis in nature, in a form of fish of hybrid origin. Science 76:628–630 (1932). Jones RN, Rees H: B chromosomes (Academic Press, New York 1982). Kallman KD: Gynogenesis in the teleost, M. formosa, with discussion of the detection of parthenogenesis in vertebrates by tissue transplantation. J Genet 58:7–21 (1962).

194 52

Maistro EL, Foresti F, Oliveira C, Almeida-Toledo LF: Occurrence of macro B chromosomes in Astyanax scabripinnis paranae (Pisces, Characiformes, Characidae). Genetica 87:101–106 (1992). Nanda I, Neitzel H, Sperling K, Studer R, Epplen JT: Simple GATCA repeats characterize the X chromosomal heterochromatin of Microtus agrestis, European field vole (Rodentia, Cricetidae). Chromosoma 96:213–219 (1988). Nanda I, Schartl M, Feichtinger W, Schlupp I, Parzefall J, Schmid M: Chromosomal evidence for laboratory synthesis of a triploid hybrid between the gynogenetic teleost Poecilia formosa and its host species. J Fish Biol 47:619–623 (1995). Pauls E, Bertollo LAC: Evidence for a system of supernumerary chromosomes in Prochilodus scrofa Steindacher, 1881 (Pisces, Prochilodontidae). Caryologia 36:307–314 (1983). Prehn LM, Rasch EM: Cytogenetic studies of Poecilia (Pisces). I. Chromosome numbers of naturally occurring poeciliid species and their hybrids from Eastern Mexico. Can J Genet Cytol 11:880–895 (1969). Rodionova MI, Nikitin SV, Borodin PM: Synaptonemal complex analysis of interspecific hybrids of Poecilia (Teleostei, Poeciliidae). Braz J Genet 19:231–235 (1996). Salvador LB, Moreira-Filho O: B chromosomes in Astyanax scabripinnis (Pisces, Characidae). Heredity 69:50–56 (1992). Schartl A, Hornung U, Nanda I, Wacker R, MullerHermelink HK, Schlupp I, Parzefall J, Schmid M, Schartl M: Susceptibility to the development of pigment cell tumors in a clone of the Amazon molly, Poecilia formosa, introduced through a microchromosome. Cancer Res 57:2993–3000 (1997). Schartl M, Nanda I, Schlupp I, Wilde B, Epplen JT, Schmid M, Parzefall J: Incorporation of subgenomic amounts of DNA as compensation for mutational load in a gynogenetic fish. Nature 373:68– 71 (1995).

Cytogenet Genome Res 106:189–194 (2004)

Schlupp I, Parzefall J, Schartl M: Biogeography of the Amazon molly, Poecilia formosa. J Biogeography 29:1–6 (2002). Sola L, Rossi AR, Iaselli V, Rasch EM, Monaco PJ: Cytogenetics of bisexual/unisexual species of Poecilia. II. Analysis of heterochromatin and nucleolar organizer regions in Poecilia mexicana mexicana by C-banding and DAPI, quinacrine, chromomycin A3, and silver staining. Cytogenet Cell Genet 60:229–235 (1992a). Sola L, Iaselli V, Rossi AR, Rasch EM, Monaco PJ: Cytogenetics of bisexual/unisexual species of Poecilia. III. The karyotype of Poecilia formosa, a gynogenetic species of hybrid origin. Cytogenet Cell Genet 60:236–240 (1992b). Sola L, Rossi AR, Bressanello S, Rasch EM, Monaco PJ: Cytogenetics of bisexual/unisexual species of Poecilia. V. Unisexual poeciliids with anomalous karyotypes from northeastern Mexico. Cytogenet Cell Genet 63:189–191 (1993). Sola L, Galetti PM Jr., Monaco PJ, Rasch EM: Cytogenetics of bisexual/unisexual species of Poecilia. VI. Additional nucleolus organizer region chromosomal clones of Poecilia formosa (Amazon molly) from Texas, with a survey of chromosomal clones detected in the Amazon molly. Heredity 78:612– 619 (1997). Vicente VE, Moreira-Filho O, Camacho JPM: Sex-ratio distortion associated with the presence of a B chromosome in Astyanax scabripinnis (Teleostei, Characidae). Cytogenet Cell Genet 74:70–75 (1996). White MJD: Animal cytology and evolution, 3rd ed. (Cambridge University Press, London 1973). Ziegler CG, Lamatsch DK, Steinlein C, Engel W, Schartl M, Schmid M: The giant B chromosome of the cyprinid fish Alburnus alburnus harbours a retrotransposon-derived repetitive DNA sequence. Chromosome Res 11:23–35 (2003).

Report of New B Chromosomes Cytogenet Genome Res 106:195–198 (2004) DOI: 10.1159/000079287

B chromosomes in Amazonian cichlid species E. Feldberg,a J.I.R. Porto,a M.N. Alves-Brinn,b M.N.C. Mendonça,a and D.C. Benzaquema a INPA, Coordenaça ˜o b Curso

de Pesquisas em Biologia Aqua´tica, Laborato´rio de Genética de Peixes, Manaus; de Po´-Graduaça˜o do Depto. de Genética – FMRP/USP, Sa˜o Paulo (Brazil)

Abstract. B chromosomes are reported in three different Amazonian cichlid species. One to three supernumerary microchromosomes were detected in the peacock bass Cichla monoculus (4 out of 28 specimens) and Cichla sp. (4 out of 13 specimens), and pike cichlids Crenicichla reticulata (2 out of 5 specimens), with no similar standard chromosomal morpholo-

gy. C-banding revealed that B chromosomes are totally heterochromatic. We suggest two scenarios for the origin of these B chromosomes either by chromosomal breakdowns due to mutagenic action of methyl mercury present in the aquatic environment or by interspecific origin due to hybridization events.

Many animal and plant species possess B chromosomes, also known as supernumerary or accessory chromosomes, in addition to the standard complement. Since the first published report on B chromosomes in a neotropical freshwater fish species, Prochilodus lineatus (= P. scrofa), in the early 1980s (Pauls and Bertollo, 1983), several other occurrences have been reported in different representative groups of Characiformes (i.e., Anostomidae, Characidae, Characidiidae, Curimatidae, and Prochilodontidae), Siluriformes (Callichthyidae, Loricariidae, Pimelodidae, and Trichomycteridae), Perciformes (Cichlidae), Beloniformes (Belonidae), and Synbranchiformes (Synbranchidae), the number of fish species carrying B chromosomes barely reaching 5 % of all neotropical freshwater fish already karyotyped (Salvador and Moreira Filho, 1992; Claudio Oliveira’s Neotropical fish chromosomal database, unpublished). Among these fishes, the genus Astyanax is by far one of the best studied models, mainly concerning the species A. scabripinnis (Néo et al., 2000, among others). In general, fish extra chromosomes vary from micro- to macro-chromosomes, and can be recognized as punctiform elements in the karyotype or as standard metacentric (M), submetacentric (SM), or subtelocentric (ST) chromosomes. They still

vary in number and, in some cases, seem to be restricted to one gender (Salvador and Moreira-Filho, 1992). The cichlids are Perciformes fish species that present the bimodal diploid number of 48 chromosomes in species from the New World, and 44 in those from the Old World (reviewed in Feldberg et al., 2003). This fish group has also provided some evidence for the presence of B chromosomes, and two distinct cases were reported previously in neotropical cichlids. The first one was described in male germ cells of Gymnogeophagus balzanii (Feldberg and Bertollo, 1984), and the second one as “chromatin corpuscles” in the somatic cells of the species: Geophagus brasiliensis, Cichlasoma paranaensis, and Crenicichla niederleinii (Martins et al., 1995). As part of a long-term study developed with Amazonian fishes we have found scarce B chromosomal cases in cichlid species. Thus, besides reporting these findings, we intend to shed some light about the origin of the B chromosomes along the evolutionary history of this family.

This work was supported by CNPq (Proc. 550703/01-2, PRONEX-661124/1998-3, and scholarships to M.N.Alves-Brinn, M.N.C. Mendonça, D.C Benzaquen), INPA (PPI-3280), and IDAM (Balbina laboratory facility). Received 3 November 2003; manuscript accepted 2 February 2004. Request reprints from: Dr. Eliana Feldberg, INPA Coordenaça˜o de Pesquisas em Biologia Aqua´tica Laborato´rio de Genética de Peixes, Cx. Postal 478 69011-970, Manaus – AM (Brazil); telephone: +55-92-643-3242 fax: +55-92-643-3240; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0195$21.00/0

Copyright © 2004 S. Karger AG, Basel

Materials and methods Peacock bass (Cichla monoculus) and pike cichlid (Crenicichla reticulata) were collected from two sampling sites: (1) Lake Balbina, an anthropogenic lake in the Uatuma˜ River, formed about 20 years ago due to the construction of a hydroelectric power plant dam (59° 20) W, 1° 00) S); (2) in Lake Catala˜o, an ecotone formed by Solimo˜es River “white water” and Negro River “black water” mixture (59° 54) 29) W, 3° 09) 47) S). Cichla sp. was only collected from Lake Balbina. Chromosome preparations from kidney cells were obtained using the airdrying technique described by Bertollo et al. (1978), with modifications. The heterochromatin pattern was analysed according to C-banding (Sumner, 1972).

Accessible online at: www.karger.com/cgr

Fig. 1. Mitotic metaphases of cichlids showing B microchromosomes. (A) and (B): Giemsa staining and C-banding of Cichla monoculus, respectively; (C) and (D): Giemsa staining and C-banding of Cichla sp., respectively; (E) and (F): Giemsa staining and C-banding of Crenicichla reticulata, respectively. Arrows point to B chromosomes. Scale bar represents 5 Ìm.

196 54

Cytogenet Genome Res 106:195–198 (2004)

Results and discussion The three species examined, Cichla monoculus, Cichla sp., and Crenicichla reticulata showed a diploid number equal to 48 chromosomes plus one to three B microchromosomes. In C. monoculus, four specimens out of 28 sampled carried B chromosomes (14.3 %). In Cichla sp., 4 out of 11 individuals analysed carried Bs (36.4 %). In C. reticulata, two out of the five animals sampled carried Bs. Unlike Cichla, where only specimens from Lake Balbina carried B chromosomes, Crenicichla showed B chromosomes in specimens from Lake Balbina and Lake Catala˜o (Fig. 1). C-banding revealed that B chromosomes in the three species are completely heterochromatic (Fig. 1). B chromosomes have already been detected in different neotropical fish groups, with a predominance for the Characidae family (Portela-Castro et al., 2001), and they may be found just in one or more populations of a same species (Moreira Filho et al., 2001). As far as we know, only two fish species bearing B chromosomes have been reported in the Amazon region, i.e., Callichthys callichthys, a Callichthyidae armoured catfish (Porto and Feldberg, 1993), and Metynnis lippincottianus, a Serrasalminae species (Souza et al., 1999). Thus, there seems to be a remarkable bias in the geographic distribution of B chromosomes in Brazil, since most B chromosome records have been reported in southern populations. However this bias seems to be more related to a sampling effect than to other probable cause. In mammals, supporting the theory of centromeric drive, the B chromosomes are more frequent in animals with monoarmed chromosomes (Palestis et al., 2004). However, this is not the case for Cichlidae fishes, even though their karyotypes are mainly formed by acrocentric chromosomes. In fact, considering the available chromosomal data on more than 135 Cichlidae species (Feldberg et al., 2003), only seven B-carrying species (including the three described in the present paper) have been reported. This represents about 5.2 % of the karyotyped cichlids, which is consistent with B frequency in fish in general. B chromosomes can originate intraspecifically from the standard A complement or interspecifically as the result of interspecies mating (Camacho et al., 2000). B chromosomes could be either a by-product of chromosomal rearrangements or a by-product of injured chromosomes. A scenario where B chromosomes are originated by lagging chromosome fragments during the cell division can not be discarded and the mutagenic heavy metal mercury could be the causative agent. It is well known that mercury interferes with the mitotic spindle (Miura and Imura, 1987) and, particularly in Cichla species from Lake Balbina, a certain degree of mercury contamination has been found (Kehrig et al., 1998). Mercury has been released in the Amazon Basin during events of gold mining, deforestation, damning of rivers, and when associated with natural pedogeochemical and atmospherical transformation processes have severely affected the Amazonian biota (Artaxo et al., 2000). Moreover, chromosome damage has been reported in Amazonian people exposed to methyl mercury contamination (Amorim et al., 2000).

Regarding the hypothesis of B chromosome interspecific origin, we have some clues that Cichla species, but not Crenicichla, have experienced hybridization in the wild, as evidenced by mtDNA (Andrade et al., 2001), esterase enzymes (Teixeira and Oliveira, personal communication), and chromosomal data (Alves-Brin, Porto and Feldberg, manuscript in preparation). Thus, Cichla fits well to this model. Chromosomal data has demonstrated a probable hybridization between C. monoculus and C. temensis and the origin of Cichla sp. from this process. Thus, we can speculate that during chromosome introgression from one Cichla species into the other, several rearrangements might have occurred and that fragmentation of the alien chromosomes due to cell instability resulted in B chromosome generation. However, the mechanisms that influenced these small pieces of chromosome to be kept in the cells as extra elements or B chromosomes are still unclear. This premise is supported by case studies in the monocot Coix (Sapre and Deshpande, 1987), fruit fly (Braverman et al., 1992), fish (Schartl et al., 1995) and wasps (Perfectti and Werren, 2001) where the B chromosomes were probably introduced by interspecies mating. The fact that B chromosomes are found in different neotropical fish groups does not necessarily mean they have a common origin or are product of a single event. The likely explanation for the presence of B chromosomes in the Amazonian cichlids might be due to changes in the aquatic environment that led to a heavy metal bioaccumulation, as well as to the failure of the reproductive barrier among some species. These changes could have triggered the origin of B chromosomes in both Crenicichla and Cichla species.

Acknowledgments The authors are grateful to L.A.C. Bertollo and Richard Vogt for his suggestions.

Cytogenet Genome Res 106:195–198 (2004)

197 55

References Amorim MI, Mergler D, Bahia MO, Dubeau H, Miranda D, Lebel J, Burbano RR, Lucotte M: Cytogenetic damage related to low levels of methyl mercury contamination in the Brazilian Amazon. An Acad Bras Cienc 72:487–507 (2000). Andrade F, Schneider H, Farias IP, Feldberg E, Sampaio I: Ana´lise filogenética de duas espécies simpa´tricas de tucunaré (Cichla, Perciformes), com registro de hibridizaça˜o em diferentes pontos da bacia amazônica. Rev Virtual de Iniciaça˜o Acadêmica da UFPA (http://www.ufpa.br/revistaic) 1:1–11 (2001). Artaxo P, Campos RC, Fernandes ET, Martins JV, Xiao Z, Lindqvist O, Ferna´ndez-Jiménez MT, Maenhaut W: Large scale mercury and trace element measurements in the Amazon Basin. Atmospheric Environ 34:4085–4096 (2000). Bertollo LAC, Takahashi CS, Moreira Filho O: Cytotaxonomic considerations on Hoplias lacerdae (Pisces, Erytrinidae). Braz J Genet 1:103–120 (1978). Braverman JB, Goni B, Orr HA: Loss of paternal chromosome causes developmental anomalies among Drosophila hybrids. Heredity 69:416–422 (1992). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Feldberg E, Bertollo LAC: Discordance in chromosome number among somatic and gonadal tissue cells of Gymnogeophagus balzanii (Pisces: Cichlidae). Braz J Genet 4:639–645 (1984).

198 56

Feldberg E, Porto JIR, Bertollo LAC: Chromosomal changes and adaptation of cichlid fishes during evolution, in Val AL, Kapoor BG (eds): Fish Adaptation, pp 285–308 (Science Publishers, Enfield 2003). Kehrig HA, Malm O, Akagi H, Guimara˜es JRD, Torres JPM: Methylmercury in fish and hair samples from the Balbina Reservoir, Brazilian Amazon. Environ Res 77:84–90 (1998). Martins IC, Portella-Castro ALB, Julio Ju´nior HF: Chromosome analysis of 5 species of the Cichlidae family (Pisces-Perciformes) from the Parana´ River. Cytologia 60:223–231 (1995). Miura K, Imura N: Mechanism of methyl mercury toxicity. CRC Crit Rev Toxicol 18:161–187 (1987). Moreira Filho O, Fenocchio AS, Pastori MC, Bertollo LAC: Occurrence of a metacentric macrochromosome B in different species of the genus Astyanax (Pisces, Characidae, Tetragonopterinae). Cytologia 66:59–64 (2001). Néo DM, Bertollo LAC, Moreira Filho O: Morphological differentiation and possible origin of B chromosomes in natural Brazilian population of Astyanax scabripinnis (Pisces, Characidae). Genetica 108: 211–215 (2000). Palestis BG, Burt A, Jones RN, Trivers R: B chromosomes are more frequent in mammals with acrocentric karyotypes: support for the theory of centromeric drive. Proc R Soc Lond B 271:S22–S24 (2004). Pauls E, Bertollo LAC: Evidence for a system of supernumerary chromosomes in Prochilodus scrofa Steindachner, 1881 (Pisces, Prochilodontidae). Caryologia 36:307–314 (1983).

Cytogenet Genome Res 106:195–198 (2004)

Perfectti F, Werren JH: The interspecific origin of B chromosomes: experimental evidence. Evolution 55:1069–1073 (2001). Portela-Castro ALB, Ju´lio-Ju´nior HF, Nishiyama PB: New occurrence of microchromosomes B in Moenkhausia sanctaefilomenae (Pisces, Characidae) from the Parana´ River of Brazil: analysis of the synaptonemal complex. Genetica 110:277–283 (2001). Porto JIR, Feldberg E: Is Callichtys LINNÉ (Ostariophisy, Siluriformes, Callichthyidae) a monotypic genus? Acta Amazonica 23:311–314 (1993). Salvador LB, Moreira-Filho O: B chromosomes in Astyanax scabripinnis (Pisces, Characidae). Heredity 69:50–56 (1992). Sapre AB, Deshpande DS: Origin of B chromosomes in Coix L. through spontaneous interspecific hybridization. J Hered 78:191–196 (1987). Schartl M, Nanda I, Schlupp I, Wilde B, Epplen JT, Schmid M, Parzefall J: Incorporation of subgenomic amounts of DNA as compensation for mutational load in a gynogenetic fish. Nature 373:68– 71 (1995). Souza ACP, Nagamachi CY, Pieczarka JC, Farias LN, Souto PSS, Barros RMS: Descriça˜o cariotı´pica de Metynnis lippincottianus, Cope, 1870 (Pisces, Serrasalmidae), do rio Peixe-Boi, Amazônia Oriental – Para´. Genet Mol Biol 22:59 (1999). Sumner AT: A simple technique for demonstration centromeric heterochromatin. Exp Cell Res 74: 304–306 (1972).

Review on B Chromosomes Cytogenet Genome Res 106:199–209 (2004) DOI: 10.1159/000079288

The B chromosomes in Brachycome C.R. Leach,a A. Houben,b and J.N. Timmisa a School

of Molecular and Biomedical Science (Genetics), The University of Adelaide, SA (Australia); of Plant Genetics and Crop Plant Research (IPK), Gatersleben (Germany)

b Institute

Abstract. This review presents a historical account of studies of B chromosomes in the genus Brachycome Cass. (synonym: Brachyscome) from the earliest cytological investigations carried out in the late 1960s though to the most recent molecular analyses. Molecular analyses provide insights into the origin and evolution of the B chromosomes (Bs) of Brachycome dichromosomatica, a species which has Bs of two different sizes. The larger Bs are somatically stable whereas the smaller, or micro, Bs are somatically unstable. Both B types contain clusters of ribosomal RNA genes that have been shown unequivocally to be inactive in the case of the larger Bs. The large Bs carry a family of tandem repeat sequences (Bd49) that are

located mainly at the centromere. Multiple copies of sequences related to this repeat are present on the A chromosomes (As) of related species, whereas only a few copies exist in the A chromosomes of B. dichromosomatica. The micro Bs share DNA sequences with the As and the larger Bs, and they also have B-specific repeats (Bdm29 and Bdm54). In some cases repeat sequences on the micro Bs have been shown to occur as clusters on the A chromosomes in a proportion of individuals within a population. It is clear that none of these B types originated by simple excision of segments from the A chromosomes.

B chromosomes are dispensable, supernumerary chromosomes which do not obey the laws of Mendelian inheritance, do not recombine with the A chromosomes and follow their own evolutionary pathway (Beukeboom, 1994). Analysis of the molecular structure of B chromosomes reveals that they are subject to gene silencing, heterochromatinization and the accumulation of repetitive DNA. The majority of the molecular studies of B chromosomes have focused on either the rDNA or on isolated B-specific sequences where the primary aim has been to

elucidate the origin of the Bs. Some experiments have sought to determine the mechanisms of B chromosome maintenance in populations and to explain their associated cellular and organismal phenotypes. Despite much speculation as to the origin of B chromosomes little, if any, convincing experimental evidence has emerged and it appears likely that there are many different ways in which Bs are generated and maintained. This review of B chromosomes in the genus Brachycome Cass. (synonym Brachyscome) presents an historical analysis of the studies carried out in this genus from the earliest cytological investigations though to the most recent molecular analysis. It begins by detailing the early cytological and field studies, the effects of B chromosomes and goes on to compare these with the analyses reviewed, in a wide spectrum of species carrying B chromosomes, by Jones and Rees (1982). It concludes with the most recent cytological analyses including fluorescence in situ hybridization, electron microscopic studies, micro-dissection and cloning of chromosomes and modern methods of molecular analysis of the DNA content and organization in B chromosomes.

Supported by grants of the Australian Research Council, Deutsche Forschungsgemeinschaft and the Land Sachsen-Anhalt. Received 17 September 2003; manuscript accepted 10 December 2003. Request reprints from Carolyn R. Leach School of Molecular and Biomedical Science (Genetics) The University of Adelaide, SA 5005 (Australia) telephone: (08) 8303 5599; fax: (08) 8303 4362 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0199$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. Species of Brachycome with B chromosomes Species

Geographic location

Chromosome no. (A + max. number of B chromosomes)

b

Enngonia, NSW

12 + 2B

c

“The Loop” Murchison River, Kalbarri N. P., WA

18 + 2B

c

Bourke, NSW and Louth, NSW

8 + 1B

b

Wyandra, QLD Charleville, QLD

8 + 1B 8 + 1B

B. aff. campylocarpa J.M. Black

B. ciliocarpa W. Fitzg. B. curvicarpa G.L.R. Davis B. aff. curvicarpa (yellow ray florets)

b,c

b

Wirrelpa, Flinders Ranges, SA Wyandra, QLD b Charleville, QLD c Dalby, NSW and Broken Hill, NSW

8 + 2B 16 + 2B 16 + 2B 8 + 1B

c

Polblue Creek, Barrington Tops, NSW

36 + 1B

c

Mt. Chudalup, WA

18 + 2B

a

Bourke, NSW

16 + 4B

B. dentata Gaudich.

b

B. diversifolia (Hook.) Fischer & Meyer B. iberidifolia Benth. Complex B. marginata Benth.

c

Kiandra, NS

36 + 3B

a

Rules Pt., NSW

28 + 2B

B. aff. multicaulis F. Muell. B. nivalis F. Muell. var. alpina (F. Muell.)

c

Ivanhoe, NSW

d

Alpine National Park, Vic

b

Eromagna, QLD

c

Ceduna, SA

e

Cytodeme A1 Pt. Augusta, SA (Leach collection) Cytodeme A2 Hookina, SA (Leach collection) Cytodeme A3 Wilcannia, NSW (provided by Dr CR Carter) Cytodeme A4 Wild Dog Glen, SA (Leach collection)

B. papillosa G.L.R. Davis B. taggellii Tovey & P. Morris B. tetrapterocarpa G.L.R. Davis

B. trachycarpa F. Muell. B. dichromosomatica C.R. Carter

a b c d e

8 + 1B 18 + 2B 4 + 4B 4 + 2B, 9 micro B 4 + 2B 4 + 2B

Smith-White et al., 1970. Watanabe and Short, 1992. Watanabe et al., 1996. Watanabe et al., 1999. Houben et al., 1997b.

The genus Brachycome Cass. (synonym: Brachyscome) The genus Brachycome Cass. (synonym: Brachyscome) is native to the Australasian region, but is predominantly Australian. This genus contains about 80 species which occupy a great variety of geographical areas that include the climatic extremes of the high rainfall zones of coasts and mountains to the semiarid regions of central Australia (Davis, 1948; Smith-White et al., 1970; Carter, 1978b; Salkin et al., 1995). Species within the genus show extensive variation in chromosome number, ranging from 2n = 4, through 6, 8, 10, 12, 14, 16, 18, 22, 24, 26, 27, 28, and 30, to 2n = 36. This extreme variation is compounded by many intraspecific changes in chromosome number and structure (Carter and Smith-White, 1972; Watanabe et al., 1996). Some species within the genus also contain supernumerary chromosomes (Carter and Smith-White, 1972) that are amongst the most extensively studied B chromosomes of higher plants. The distribution of B chromosomes in the genus Brachycome Table 1 lists the species of the genus Brachycome in which B chromosomes have been observed and the geographic locations where they have been collected. A phylogenetic tree (Fig. 1) based on the sequence of the chloroplast gene, matK (Denda et al., 1999), indicates that species with B chromosomes are found in each of the four clades

200 58

8 + 1B 28 + 2B

Cytogenet Genome Res 106:199–209 (2004)

that comprise the genus and the Brachycome and Metabrachycome subgenera. Furthermore, a comparison with Table 1 reveals that these species include those with 2n = 4 (B. dichromosomatica) up to 2n = 36 (Brachycome aff. multicaulis). Only the B chromosomes of B. dichromosomatica have been studied in any detail, though a limited amount of work has also been carried out on the Bs of B. curvicarpa and B. dentata. Brachycome dichromosomatica C.R. Carter B. dichromosomatica, which was formerly known as B. lineariloba race A (Carter, 1978a), is an ephemeral with two pairs of A chromosomes. It is essentially self-incompatible and has no natural means of asexual reproduction. The species includes four cytodemes designated A1, A2, A3 and A4 which differ in distribution and karyotype (Fig. 2a, b). Watanabe et al. (1975) described the chromosomes of plants from the four cytodemes and their hybrids and drew the following conclusions: All cytodemes show internal karyotypic variation. A2, A3 and A4 differ from each other by loss or suppression of nucleolar organizers. A4 has a nucleolar organizer on both chromosome pairs and is likely to be ancestral to the other cytodemes. A1 differs from the rest by chromosomal interchange. There has been some conversion of early to late condensing chromatin/chromosome regions.

Fig. 1. Strict consensus tree based on matK sequences from Brachycome taxa and seven allied genera. * Species with B chromosomes (see Table 1). Modified from Denda et al. (1999).

Cytogenet Genome Res 106:199–209 (2004)

201 59

Fig. 2. (a) The geographical distribution of the cytodemes of B. dichromosomatica (n = 2). Location abbreviations: A.: Adelaide, B.H.: Broken Hill, N.S.W.: New South Wales, P.A.: Port Augusta, S.A.: South Australia, Vic.: Victoria, W.D.G.: Wild Dog Glen (cytodeme A4) (from Watanabe et al., 1975). (b) Metaphase chromosomes of the cytodemes of B. dichromosomatica. Values are in Ìm.

types of B chromosome in cytodeme A2. Twelve percent of 452 plants studied carried 1, 2 or rarely 3 large B chromosomes (referred to for simplicity as Bs hereafter). These B chromosomes, which are about 4 Ìm in length and found in all cytodemes of B. dichromosomatica (Carter, 1978b), are mitotically stable but show meiotic irregularity. Dot-like accessory chromosomes, called micro Bs, were found in 3.8 % of plants within cytodemes A1 and A2 only (Fig. 3). These micro Bs, which are about 1 Ìm in length, show extreme irregularity in both mitotic and meiotic behavior.

Fig. 3. Mitotic metaphase chromosomes of B. dichromosomatica cytodeme A2 (2n = 4 A chromosomes + 2B chromosomes: arrows) and 2 micro B chromosomes (arrowheads).

The forms of B chromosomes of Brachycome dichromosomatica Supernumerary chromosomes were first reported in B. dichromosomatica by Smith-White (1968). Smith-White and Carter (1970) measured the frequencies and behavior of two

202 60

Cytogenet Genome Res 106:199–209 (2004)

Maintenance of B chromosomes in B. dichromosomatica Mature pollen in B. dichromosomatica is trinucleate. There is a high frequency of nondisjunction and directed segregation of the daughter Bs when a single B is present in the microspore, which yields a generative nucleus containing two Bs. This generative nucleus undergoes a second division to yield the male gamete nuclei. Haploid nuclei in the embryo sacs, which undergo three mitoses, show no nondisjunction or preferential segregation of the B chromosomes. However, it appears that 1B and 2B plants are generally less fit than 0B and seasonal selection must balance the drive to permit a stable equilibrium (SmithWhite and Carter, 1981). Effects of B. dichromosomatica B chromosomes Effects on chiasma frequency. Table 2 and Fig. 4 show the number of chiasmata in the A chromosome bivalents of plants carrying 0–3B chromosomes (Leach and Clough, unpublished).

Table 2. Percentage of cells showing 1, 2, 3 or 4 chiasmata per bivalent in plants with and without B chromosomes Number of chiasmata

0B % cells 1B % cells 2B % cells 3B % cells

Chromosome 1

Chromosome 2

Table 3. Two and three class comparisons of B chromosome frequencies in B. dichromosomatica (modified from Carter, 1978c)

Total number of cells

1

2

3

4

1

2

3

10.2 9.3 0 0.02

78.8 72.9 68.6 37.5

8.9 17.8 31.4 47.9

2.5 0 0 12.5

19.4 19.6 8.5 2.1

77.1 77.5 80 68.8

3.3 2.8 11.4 29.2

Fig. 4. Graphical representation of the percentage of chiasmata on chromosome 1 from plants without B chromosomes (a) compared with those with 3 B chromosomes (b).

118 107 35 48

A1 “central” A3 “arid”

0B

1B

2B

Total

221 231

11 7

3 15

225 253

Effects on fitness. In general, the effects of B chromosomes on an individual plant appear to be dependent on the number of B chromosomes present. Low numbers may be neutral and have no measurable effect, but as their numbers increase they may become harmful and act to reduce vigor, viability and fertility (Jones and Rees, 1982). Odd numbers of B chromosomes appear to have a more detrimental effect than even numbers of B chromosomes (Jones and Rees, 1982). B chromosomes occur in all populations of B. dichromosomatica so far studied but the frequency of Bs tends to be higher in populations in marginal environments than in the central localities of the species distribution (Carter, 1978c). Table 3 lists the number of plants with and without B chromosomes in two populations of B. dichromosomatica. Plants from an A1 population in a central location are compared with plants from an A3 population in an arid region. Carter concludes that dry conditions do not affect the relative proportions of plants with and without B chromosomes but, under dry conditions, the frequency of 2B plants increases relative to 1B plants suggesting that under these conditions they have an increased fitness (¯21 = 5, P ! 0.01).

Molecular analysis of B chromosomes

The presence of three B chromosomes significantly (statistical analysis carried out on original numerical data) increases the number of chiasmata per chromosome and the mean chiasma frequency is positively correlated with the number of B chromosomes. This result contrasts with those of Carter (1978c) who, using exactly the same form of analysis, did not observe any effects of B chromosome number on chiasma frequency, albeit in much smaller samples and not including plants with three B chromosomes. Effects on homeologous pairing in interspecific hybrids. There is some evidence that the presence of B chromosomes in a hybrid between B. dichromosomatica and B. erigona suppresses homeologous pairing. An extensive study of meiosis in both 0B and +B hybrids showed no homeologous pairing nor any pairing of the B with any other chromosome and indeed chromosomes at metaphase I in the +B hybrid more closely resembled those normally seen at metaphase II, i.e. there is significant separation of sister chromatids in all chromosomes. It is possible that the B prohibited any homeologous pairing though the degree of pairing seen in the 0B hybrids was low (Leach and Clough, unpublished).

B-specific sequences These investigations started with the isolation, by subtractive hybridization, of DNA from plants of cytodeme A1, of a family of 176 base pair repeats represented in the plasmid clone pBd49 (John et al., 1991). This was later shown to be abundant near the centromere of the B chromosome (Leach et al., 1995). It was estimated that there were 1.8 × 105 copies, contributing 10 % of the 3.36 × 108-bp capacity of the B chromosome. The family of repeats appeared initially to be specific for the B chromosomes (John et al., 1991), but a few copies were later also identified on the A chromosomes and in B. ciliaris. Bd49 was further analyzed considering both its sequence variation and occurrence in the genomes of other Brachycome species with an aim of gaining an insight into its possible origin and, by inference, that of the B chromosome itself. FISH (Fig. 5) showed that high copy-number clusters of Bd49 were constant features of B chromosomes in B. dichromosomatica. Initially the predominantly centromeric location of the Bd49 cluster suggested a possible role for this sequence in the drive processes that cause greater than expected transmission of the B. However a distal cluster in cytodeme A3 and signal size variation between all the Bs of different cytodemes (Fig. 5) argued

Cytogenet Genome Res 106:199–209 (2004)

203 61

Fig. 5. Representative B chromosomes from each of the four cytodemes of B. dichromosomatica after FISH with Bd49 (arrows).

against this and also indicated that the sequence was in a state of flux. Southern analysis of genomic DNA with Bd49 demonstrated that multiple copies of related sequences were also present in the genomes of B. eriogona, B. ciliaris, B. segmentosa and B. multifida (none of which have B chromosomes), whereas other species tested (including 0B plants of B. dichromosomatica and 0B and +B B. curvicarpa and B. dentata) had few or no copies. Bd49-like sequences were isolated by genomic cloning and PCR from four other species (B. curvicarpa with and without B chromosomes, B. ciliaris, B. eriogona, and B. lineariloba 2n = 16). However, determination of phylogenetic relationships within the genus and inference as to the possible origin of the B chromosome were problematic because of extensive intra-genomic heterogeneity of the sequences (Leach et al., 1995). The possibility remains that Bd49 was donated by hybridization with another species, but the extreme heterogeneity of both A and B chromosome DNA in Brachycome (see later) makes a clear decision on the origin of the B impossible. Franks et al. (1996) used Bd49 to probe a lambda genomic library from a 3B B. dichromosomatica plant. A single clone of those analyzed was composed entirely of a tandem array of the repeat unit. In other clones, the Bd49 repeats were linked to, or interspersed with, sequences that were repetitious and distributed elsewhere on the A and B chromosomes. One such repetitious flanking sequence had similarity to retrotransposon-like sequences and a second was similar to chloroplast DNA. Of the four separate junctions analyzed for Bd49-like sequence and flanking DNA, three were associated with the same A/T-rich region in Bd49 and the fourth was close to a 25-bp imperfect dyad (Franks et al., 1996). Ribosomal RNA genes Nucleolar Organizer Regions (NORs), the sites of active ribosomal 18S, 5.8S and 25S RNA genes, have been found on the B chromosomes of many species. Cytological examination of mitotic preparations of B. dichromosomatica readily demonstrated the presence of a secondary constriction on the B chromosomes (Fig. 6a). Later, Donald et al. (1995) used FISH with a biotinylated rDNA probe to confirm the presence of rRNA gene clusters on both the A and B chromosomes of B. dichromosomatica. The regular attachment of the B chromosome to a nucleolus suggested that these ribosomal RNA genes were transcribed and functional in contributing to the ribosomes of the cell. Initially, Southern hybridization of DNA from 0B and +B plants digested with a variety of restriction enzymes indicated

204 62

Cytogenet Genome Res 106:199–209 (2004)

Fig. 6. (a) Mitotic metaphase chromosomes of B. dichromosomatica cytodeme A1 (2n = 4A chromosomes + 3B chromosomes). NOR regions of B chromosomes are indicated with arrows. (b) FISH of metaphase chromosomes of B. dichromosomatica (cytodeme A4) with a probe-specific 45S rDNA (bright). B chromosomes are indicated with arrows. One chromosome no. 2 is partly obscured.

that the rRNA genes on the A and B chromosomes were similar in sequence and methylation status. FISH with an rDNA probe to chromosomes of A4 is shown in Fig. 6b. Subsequently an elegant experiment using PCR amplification of the internal transcribed spacer (ITS2) of rDNA, using primers within the conserved regions encoding the 5.8S and 25S stable rRNA species in cytodeme A1, revealed two consistent differences between the ITS2 sequence amplified from A versus micro-dissected B chromosome DNA. One of these differences was included within an SfcI restriction site that was present only in B chromosome rDNA. Amplification, by PCR, of ITS2 from total genomic DNA of plants with and without B chromosomes showed an additive relationship between the amount of product containing the SfcI site and the number of B

chromosomes present. Replicated quantitative analysis indicated that the proportion of total nuclear rDNA present on a single B chromosome was between 2 and 4 %. Experiments, with stringent positive and negative controls, using reverse transcriptase PCR and SfcI digestion of the equivalent region within the 40–45S precursor rRNA, were unable to detect any transcripts from the B chromosome rDNA. In addition, PCR of reverse transcribed total RNA from plants containing B chromosomes using primers specific for the B chromosome ITS2 was also unable to detect a transcript from the B chromosome (Donald et al., 1997). Because of the high sensitivity of the latter approach it was concluded that the B rDNA was not transcribed in leaf tissue which was the origin of the RNA samples tested. Molecular analysis of the micro B chromosome Southern and in situ hybridization patterns of a total micro B probe, which was generated by micro-isolation and DOPPCR, to genomic DNA or chromosomes from plants with and without micro Bs, demonstrated that the majority of micro B DNA sequences were also present on the A chromosomes. However, an apparently micro B-specific, highly methylated tandem repeat (Bdm29) was cloned from the micro-dissected DNA. After in situ hybridization with Bdm29 the entire micro B chromosome was labeled and groups and chains of condensed micro Bs could be observed at interphase (Fig. 7). A high number of Bdm29-like sequences were also found in the larger B chromosomes of B. dichromosomatica and in other Bs within the genus, suggesting that the Bdm29 sequence is highly conserved and widespread. It was speculated that this sequence is important for the function of all these B chromosomes and that it may have been involved independently several times in the formation of different B chromosomes. Alternatively the sequence evolved early in the evolution of Brachycome and maintained in several lineages, with or without any functional significance (Houben et al., 1997b). Some micro B sequences were also found as polymorphic heterochromatic chromosome segments on the A chromosomes of plants within the A2 populations of B. dichromosomatica. Experiments using selective enrichment and differential hybridization of repetitious DNA (Cot-1 DNA fractions) of plants with and without polymorphic heterochromatic segments led to the isolation of a repetitive sequence (called Bds1) that was located at these rare polymorphic A chromosome sites (also called “supernumerary A segments”; see Houben et al., 2000). A single repeat unit of Bds1 is 92 bp long and is organized in tandem arrays on the micro B at one telomeric end in all instances but there were no Bds1 hybridization sites detectable on the standard B chromosomes of cytodemes A1 or A2. This sequence also is present at up to three different polymorphic sites on the A chromosomes in 48 % of the plants analyzed. Although all the three sites showed extensive polymorphism between plants, the karyotypes of mitotic root cells were invariable within a single plant. Analysis of the Bds1 repeat sequence revealed a stem-loop structure which is a potential protein binding site of the sort that has been shown to be associated with heterochromatin formation in some insects (Bigot et al., 1990) and electron microscopy confirmed the presence of high-

Fig. 7. Characterization of micro B chromosomes by fluorescence in situ hybridization (FISH) with different probes. (a) FISH of the DOP-PCR products of micro-dissected micro B-DNA to a mitotic metaphase spread of B. dichromosomatica, cytodeme A2 (2n = 4 plus micro Bs) showing preferential hybridization to the micro Bs (arrows) and signals of lower intensity on the A chromosomes. Unlabeled satellites of the smaller A chromosome pair, separated during the squash preparation, are marked with arrowheads. (b) FISH with an 18S/25S rDNA probe to mitotic metaphase chromosomes. The nucleolus organizer regions of the smaller A chromosome pair are strongly hybridized (arrows) and weaker signals appear on the micro B chromosomes (arrowheads). (c) Hybridization with an Arabidopsis telomere-specific probe showing two signals on each end of the A and micro B chromosomes. The bar in c represents 10 Ìm for a, b and c. (d) Physically associated micro B chromosomes stained with propidium iodide showing the connection site (indicated with an arrow). (e) Hybridization with a telomere-specific probe. Telomere signals for each micro B chromatid at the connection site are indicated with arrows. The chromosomes of d and e are at a greater magnification.

ly condensed chromatin at the most obvious A chromosome polymorphic site (Houben et al., 2000). There appear to be a number of possible evolutionary interpretations of this polymorphism and the occurrence of the sequence on the micro B chromosome. One possibility is that it is a recent addition to the genome and fixation or deletion may be expected later. However, as at least two cytodemes carry Bds1 sequences, it is likely that the sequence was already

Cytogenet Genome Res 106:199–209 (2004)

205 63

Fig. 8. Diagrammatic summary (according to Houben et al., 1999) of the haploid chromosome sets of four cytodemes of B. dichromosomatica showing A, B and micro B chromosomes. The key explains the chromosomal location of 45S and 5S rDNA and the sequences Bd49, Bds1, Bdm54 and Bdm29. The micro B is enlarged in the inset.

present before they diverged. The observed variation suggests that strong selection pressures acting on the chromosome complement in these wild populations are more likely to account for the polymorphism. One explanation for the polymorphic status of Bds1 A chromosome segments is that its presence in the homozygous state is disadvantageous for plants within the population whereas heterozygotes are able to survive and be maintained. Alternatively, the polymorphic segment could be of benefit when they occur in specific combinations and under specific environmental conditions. To elucidate the evolutionary relationship between the micro Bs and polymorphic A chromosome segments, Houben and colleagues (2001) investigated whether the micro B major component, repeat Bdm29, could form an A chromosome segment polymorphism similar to that described for Bds1. Like Bdm1, a high copy number of this sequence does not occur as a regular feature of the A chromosomes in this species, but it was found in 2 % of individuals in two wild populations that were analyzed. Bdm29 clusters coincided with an interstitial polymorphic heterochromatic segment on the long arm of chromosome 1 of cytodeme A2 (Fig. 8) and the copy number of Bdm29-like sequences at this chromosome position varied between different plants. The origin of the micro B chromosomes was investigated by determining whether they are related to this A chromosome polymorphism by simple excision and/or integration. Results obtained using Bdm29 were extended with another major repeat sequence, Bdm54, and a number of other sequences known to occur on the micro B and A chromosomes. When used in FISH probes and in Southern analysis, these probes demonstrated that the formation of micro B chromosomes is a highly complex multi-step process. The observation that the genomic organization of the micro B chromosome, with regard to these multiple repeat sequences, is unlike anything present on the A chromosomes precludes the origin of micro Bs by simple excision. Conversely, the differences in sequence dispersion and organization preclude direct integration of the micro B into the A complement to form polymorphic heterochromatic segments. Nevertheless, considering that high copy numbers of Bdm29 are conserved on other types of B chromosome within Brachycome and the Bdm29-positive A

206 64

Cytogenet Genome Res 106:199–209 (2004)

segments appear to be in constant flux, it is still feasible that this repeat in particular may represent one of the micro B founder sequences, and one that has an important function in the persistence of the chromosome. One possibility is that B-founder sequences were excised from a polymorphic A chromosome region, and were then stabilized by the addition of telomeric repeats and other Aderived sequences. The rapid accumulation of other sequences on a de novo micro B chromosome would present a barrier to the similarity between the “parent” homologous chromosome regions, and thus interfere with the competence for meiotic pairing between the “parental” and derived segments. The newly formed micro B chromosome may then start its independent evolution. An advantage of this arrangement for an independent B chromosome would be that homologous chromosome segments occur only as rare polymorphisms within a population. A diagram summarizing the size and location of specific sequences on the A, B and micro B chromosomes of the four cytodemes is shown in Fig. 8. Histone H4 acetylation and replication timing of the B chromosomes Differences between A (transcriptionally active) and B (putatively transcriptionally inactive) chromosomes correlates with a different level of histone H4 acetylation and a different timing of DNA replication. These differences in chromatin structure between A and B chromosomes were found after immunolabeling of B. dichromosomatica chromosomes with antibodies specific for different acetylated forms (lysine 5, 8, 12 and 16) of histone H4. In contrast to the A chromosomes, which are labeled brightly in their entirety, the B chromosomes are faintly labeled with antibodies against H4Ac5 and H4Ac8. No such difference between the chromosomes is observed after immunostaining with antibodies to H4Acl2 and H4Acl6. Analysis of DNA replication timing in root-tip meristems demonstrated that B chromosomes are labeled late in S-phase compared with A chromosomes. C-banding revealed that the B chromosome appeared to have a similar amount of heterochromatin as the A chromosomes (Houben et al., 1997a).

Fig. 9. (a) Cohabitation of B. lineariloba (2n = 16) and B. dichromosomatica. A portion of the spatial distribution of B. lineariloba cytodeme C (P, 2n = 16) and B. dichromosomatica var. alba (), 2n = 4) at a site 72 km east of Wilcannia, Australia. Scale bar = 2 m, arrow indicates north. Redrawn from Watanabe et al. (1985). (b) Maximum parsimony phylogenetic analysis of the ITS1 and ITS2 regions of 45S rDNA of the B. lineariloba complex (Leach, Field, Houben and Timmis, unpublished results).

Origin of B chromosomes in B. dichromosomatica Early cytogenetic observations led to a number of suggestions regarding the origin of Bs including that they could arise as a result of inter-specific hybridization (Sapre and Deshpande, 1987). Using some closely related species that grow in close proximity to investigate the possibility that the B chromosome of B. dichromosomatica arose in this way either from B. lineariloba (2n = 12 or 16), B. campylocarpa (2n = 8) or B.

eriogona (2n = 8), Watanabe et al. (1976) analyzed asynchronous chromosome condensation and meiotic behavior in B. lineariloba (B. dichromosomatica) (2n = 4) × B. campylocarpa (2n = 8). They found that the B chromosome has a pattern of late condensation more similar to the chromosomes of B. campylocarpa than those of B. dichromosomatica. We carried out a similar experiment with material of B. erigona and B. dichromosomatica collected within meters of each other. One reason that B. eriogona was considered a good can-

Cytogenet Genome Res 106:199–209 (2004)

207 65

didate as a donor of the B. dichromosomatica standard B was that the smallest of the B. erigona chromosomes is of a similar size to the B and, like the B, it contains a secondary constriction and the Bd49 sequence (John et al., 1991). The cross was made reciprocally, but only B. dichromosomatica as female yielded seed. Three hybrid progeny were successfully raised including one with a B chromosome. An extensive study of meiosis in this +B hybrid showed no pairing of the B with any other chromosome suggesting that, if the B chromosome was indeed a relic of an inter-specific cross, it had subsequently evolved to preclude homologous pairing, even with its ancestral chromosome. B. lineariloba (2n = 10) has an unusual mode of reproduction in which female gametes have 4 chromosomes whereas male gametes have 6 (Carter et al., 1974). Furthermore one of the two chromosomes that are transmitted through the male as univalents is of a similar size to the B. dichromosomatica B chromosome, and like it, has a secondary constriction. No crosses between B. lineariloba (2n = 10) and B. dichromosomatica have been successfully made indicating that although the unusual meiotic behavior of the univalents is reminiscent of Bs, this species is an unlikely donor. However, recent molecular analysis, cytological observations and phylogenetic analysis taken together provide a consistent picture that the standard B chromosome of B. dichromosomatica could be derived from B. lineariloba C (2n = 16). The evidence is: There is extensive overlap of the distribution of these two species (Fig. 9a) and natural hybrids between the species are found in these populations (Smith-White and Carter, 1970). The two races are readily distinguishable in growth habit and inflorescence form, and provisional recognition of hybrids is possible. Two such apparent hybrids were confirmed by karyotype analysis and these plants provided little meiotic material, and meiotic configurations seen were extremely complicated. Two configurations identified were a chain of five, two bivalents and one univalent and a complex multivalent association of seven chromosomes (Kyhos et al., 1977). The occurrence of many cytological variants of B. lineariloba C including one with a small chromosome (almost identical in size to the B) possessing an NOR (Watanabe et al., 1985). B. dichromosomatica certainly occurs with chromosome numbers varying considerably from 2n = 4 (e.g. an aneuploid plant with 11 chromosomes was phenotypically indistinguishable from plants with 2n = 4, so survival of intermediates with a range of unbalanced chromosome sets is feasible). Molecular analysis has revealed that B. lineariloba C has a Bd49 like repeat (John et al., 1991). Detailed, phylogenetic analysis using the ITS1 and ITS2 regions of the B. lineariloba complex of species shows that the complex is divided into two distinct clades. Consistent with an intraspecific origin, the B. dichromosomatica B chromosome ITS sequence groups with its own A chromosome ITS clade. However, it can also be seen that the B chromosome is almost as closely related to B. lineariloba C as it is to B. dichromosomatica (Fig. 9b). Silencing of the rRNA genes on the B chromosome is readily accounted for by nucleolar dominance, a phenomenon that is

208 66

Cytogenet Genome Res 106:199–209 (2004)

regularly associated with NORs from different species. It also has been suggested by Pikaard (2000) that gene silencing may not be restricted to the NOR region but extend to affect neighboring genes. It is possible that NOR suppression initiates more widespread inactivation of the entire B. This scenario does not account for the non-Mendelian inheritance of the B chromosomes nor their other effects.

Concluding remarks Most of the putative B-specific sequences have been found subsequently at least in low copy in the As of the host species or a close relative and it would probably be more accurate to describe these sequences as B-amplified. One exception to this generality comes from a recent detailed study using amplified fragment length polymorphism analyses (AFLP) and fluorescence in situ hybridization (FISH) in the cyprinid fish Alburnus alburnus which has one of the largest supernumerary chromosomes in vertebrates. This B chromosome contains specific sequences with strong homology to retrotransposon from Drosophila Gypsy/Ty3 and medaka (Oryzias latipes). The sequence is highly abundant on the B chromosome but undetectable in the normal A chromosome complement or in the B chromosome of the closely related species, Rutilus rutilus. These results suggest that the supernumerary chromosome of A. alburnus is not derived from the normal chromosome complement but has evolved independently (Ziegler et al., 2003). In contrast, Page et al. (2001) further investigating sequences that had been isolated from the maize B chromosome by Alfenito and Birchler (1993), found sequences homologous to pZmBs at, and only at, the centromere of chromosome 4 in the A genome. Whilst this indicates a diversity of sequences comprising centromeric regions in maize, it also suggests an evolutionary relationship between the chromosome 4 centromere and that of the B chromosome (Page et al., 2001). Finally a study in the black rat, Rattus rattus, revealed an intriguing situation regarding the rRNA genes. In situ hybridization with an rDNA probe demonstrated the presence of ribosomal genes dispersed throughout its B chromosomes. However, despite the clear demonstration of silver staining NORs on the A chromosomes, no silver signal has ever been detected on the B chromosomes. Furthermore, in situ digestions and Southern analyses of DNA digested with the isoschizomers MspI and HpaII indicated that the B chromosomes were highly methylated. The authors suggest that the accessory chromosomes of this species have originated from one of the smaller NOR-carrying chromosome pairs and that in the course of evolution repetitive sequences invaded this supernumerary element. They suggested that its ribosomal DNA content was dispersed throughout the chromosome where it was inactivated by heterochromatinization that precluded access by transcription factors. Subsequent methylation may have reinforced the initial inactivation (Stitou et al., 2000). Our experiments with B. dichromosomatica have revealed a daunting level of complexity that has left us unable to suggest the direction in which sequences have moved.

Thus as more detailed information emerges about B chromosomes, greater complexity is revealed regarding their sequence composition and arrangement and also their origin. It seems clear that it is naive to attempt to develop a “one size fits all” theory about anything to do with B chromosomes. The dan-

ger is that conclusions drawn from scant data may lead to oversimplistic notions about the molecular nature of B chromosomes. More careful and detailed studies often reveal diverse situations that are exceedingly complex.

References Alfenito MR, Birchler JA: Molecular characterization of a maize B chromosome centric sequence. Genetics 135:589–597 (1993). Beukeboom LW: Bewildering Bs: an impression of the 1st B-chromosome conference. Heredity 73:328– 336 (1994). Bigot Y, Hamlin MH, Periquet G: Heterochromatin condensation and evolution of unique satelliteDNA families in two parasitic wasp species: Diadromus pulchellus and Eupelmus vuilletri (Hymenoptera). Mol Biol Evol 7:351–364 (1990). Carter CR: Taxonomy of the Brachycome lineariloba complex (Asteraceae). Telopea 1:387–393 (1978a). Carter CR: The cytology of Brachycome II. The subgenus Metabrachycome: a general survey. Aust J Bot 26:699–706 (1978b). Carter CR: The cytology of Brachycome lineariloba 8. The inheritance, frequency and distribution of B chromosomes in B dichromosomatica (n = 2), formerly included in B. lineariloba. Chromosoma 67:109–121 (1978c). Carter CR, Smith-White S: The cytology of Brachycome lineariloba 3. Accessory Chromosomes. Chromosoma 39:361–379 (1972). Carter CR, Smith-White S, Kyhos DW: The cytology of Brachycome lineariloba 4. The ten-chromosome quasidiploid. Chromosoma 44:439–456 (1974). Davis GL: Revision of the genus Brachycome Cass. 1. The Australian species. Proc Linn Soc NSW 73:142–241 (1948). Denda T, Watanabe K, Kosuge K, Yahara T, Ito M: Molecular phylogeny of Brachycome (Asteraceae). Plant Syst Evol 217:299–311 (1999). Donald TM, Leach CR, Clough A, Timmis JN: Ribosomal RNA genes and the B chromosome of Brachycome dichromosomatica. Heredity 74:556–561 (1995). Donald TM, Houben A, Leach CR, Timmis JN: Ribosomal RNA genes specific to the B chromosomes in Brachycome dichromosomatica are not transcribed in leaf tissue. Genome 40:674–681 (1997). Franks TK, Houben A, Leach CR, Timmis JN: The molecular organisation of a B chromosome tandem repeat sequence from Brachycome dichromosomatica. Chromosoma 105:223–230 (1996). Houben A, Belyaev ND, Leach CR, Timmis JN: Differences of histone H4 acetylation and replication timing between A and B chromosomes of Brachycome dichromosomatica. Chromosome Res 5:233– 237 (1997a).

Houben A, Leach CR, Verlin D, Rofe R, Timmis JN: A repetitive DNA sequence common to the different B chromosomes of the genus Brachycome. Chromosoma 106:513–519 (1997b). Houben A, Thompson N, Ahne R, Leach C, Verlin D, Timmis J: A monophyletic origin of the B chromosomes of Brachycome dichromosomatica (Asteraceae). Plant Syst Evol 219:127–135 (1999). Houben A, Warmer G, Hanson L, Verlin D, Leach CR, Timmis JN: Cloning and characterisation of polymorphic heterochromatic segments of Brachycome dichromosomatica. Chromosoma 109:206–213 (2000). Houben A, Verlin D, Leach CR, Timmis JN: The genomic complexity of micro B chromosomes of Brachycome dichromosomatica. Chromosoma 110:451–459 (2001). John UP, Leach CR, Timmis JN: A sequence specific to B chromosomes in Brachycome dichromosomatica. Genome 34:739–744 (1991). Jones RN, Rees H: B chromosomes, 1st ed. (Academic Press, London, New York 1982). Kyhos DW, Carter CR, Smith-White S: The cytology of Brachycome lineariloba. 7. Meiosis in natural hybrids and race relationships. Chromosoma 65:81– 101 (1977). Leach CR, Donald TM, Franks TK, Spiniello SS, Hanrahan CF, Timmis JN: Organisation and origin of a B chromosome centromeric sequence from Brachycome dichromosomatica. Chromosoma 103: 708–714 (1995). Page TB, Wanous MK, Birchler JA: Characterization of a maize chromosome 4 centromeric sequence: evidence for an evolutionary relationship with the B chromosome centromere. Genetics 159:291–302 (2001). Pikaard CS: Nucleolar dominance: uniparental gene silencing on a multi-megabase scale in genetic hybrids. Plant Mol Biol 43:163–177 (2000). Salkin E, Thomlinson G, Armstrong B, Courtney B, Schaumann M: Australian Brachyscomes (Brown Prior Anderson Pty. Ltd. Vic., Australia 1995). Sapre AB, Deshpande D: Origin of B chromosomes in Coix L. through spontaneous interspecific hybridisation. J Hered 78:191–196 (1987). Smith-White S: Brachycome lineariloba. A species for experimental cytogenetics. Chromosoma 23:359– 364 (1968).

Smith-White S, Carter CR: The cytology of Brachycome lineariloba 2. The chromosome species and their relationships. Chromosoma 30:129–153 (1970). Smith-White S, Carter CR, Stace HM: The cytology of Brachycome I The subgenus Eubrachycome: a general survey. Aust J Bot 18:99–125 (1970). Smith-White S, Carter CR: The maintenance of B chromosomes in Brachycome dichromosomatica, in Atchley WR, Woodruff D (eds): Evolution and Speciation: Essays in Honour of MJD White, pp 335–355 (Cambridge University Press, Cambridge 1981). Stitou S, Diaz de la Guardia R, Jiménez R, Burgos M: Inactive ribosomal cistrons are spread throughout the B chromosomes of Rattus rattus (Rodentia, Muridae). Implications for their origin and evolution. Chromosome Res 8:305–311 (2000). Watanabe K, Short PS: Chromosome number determinations in Brachyscome Cass. (Asteraceae: Astereae) with common species delimitation, relationships and cytogeography. Muelleria 7:457–471 (1992). Watanabe K, Carter CR, Smith-White S: The cytology of Brachycome lineariloba 5. Chromosome relationships and phylogeny of race A cytodemes (n = 2). Chromosoma 52:383–397 (1975). Watanabe K, Carter CR, Smith-White S: The cytology of Brachycome lineariloba 6. Asynchronous chromosome condensation and meiotic behaviour in B. lineariloba (n = 2) × B. campylocarpa A (n = 4). Chromosoma 57:319–331(1976). Watanabe K, Carter CR, Smith-White S: The cytology of Brachycome lineariloba 9. Chromosomal heterogeneity in natural populations of cytodeme C (2n = 16). Can J Genet Cytol 27:410–420 (1985). Watanabe K, Short PS, Denda T, Suzuki Y, Ito M, Yahara T, Kosuge K: Chromosome number determinations in the Australian Astereae (Asteraceae). Muelleria 9:197–228 (1996). Watanabe K, Yahara T, Denda T, Kosuge K: Chromosome evolution in the genus Brachyscome (Asteraceae, Astereae): Statistical test regarding correlation between changes in karyotype and habit using phylogenetic information. J Plant Res 112:145– 161 (1999). Ziegler CG, Lamatsch DK, Steinlein C, Engel W, Schartl M, Schmid M: The giant B chromosome of the cyprinid fish Alburnus alburnus harbours a retrotransposon-derived repetitive DNA sequence. Chromosome Res 11:23–35 (2003).

Cytogenet Genome Res 106:199–209 (2004)

209 67

Review on B Chromosomes Cytogenet Genome Res 106:210–214 (2004) DOI: 10.1159/000079289

B chromosomes in Sternorrhyncha (Hemiptera, Insecta) A. Maryan´ska-Nadachowska Institute of Systematics and Evolution of Animals, Polish Academy of Sciences, Krako´w (Poland)

Abstract. In the hemipteroid insects of the suborder Sternorrhyncha, B chromosomes are relatively common in comparison with other suborders of Hemiptera. However, the occurrence of supernumerary chromosomes is restricted, in most cases, to several genera or closely related species. At least in some species of Psylloidea with the XY sex determination system, a mitotically stable B chromosome integrated into an

Introduction B chromosomes, also known as supernumerary or accessory chromosomes, occur in many plants and animals (White, 1973; Jones and Rees, 1982). B chromosomes are considered as selfish and parasitic genetic elements and do not follow Mendelian laws of inheritance. Many of them show a high transmission rate in meiosis and/or mitosis leading to their accumulation, which favours their increase in frequency and the establishment of B chromosome polymorphisms in natural populations (Camacho et al., 2000). A large number of recent studies have confirmed that B chromosomes are relatively frequent in insects. They have been described predominantly in intensively cytogenetically studied taxonomic groups. However, Bs are not present in all individuals or populations studied and thus they could have been overlooked in chromosome counts of some species. The hemipteroid insects (Hemiptera), which are divided into true bugs (Heteroptera), Coleorhyncha, Fulgoromorpha,

Received 17 September 2003; manuscript accepted 29 January 2004. Request reprints from: Dr. A. Maryan´ska-Nadachowska Institute of Systematics and Evolution of Animals Polish Academy of Sciences, Sławkowska 17, 31-016 Krako´w (Poland) telephone: +48-12-422-7006; fax: +48-12-422-4294 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0210$21.00/0

achiasmatic segregation system with the X, and became fixed as a Y chromosome. In some Aphidoidea with a multiple X system of sex determination, B chromosomes appear to be in fact non-functional X chromosomes. Supernumerary chromosomes thus probably play an important role in the evolution of sex determination systems in Sternorrhyncha. Copyright © 2004 S. Karger AG, Basel

Cicadomorpha, and Sternorrhyncha (Sorensen et al., 1995), belong to groups relatively well-studied karyologically. The suborder Sternorrhyncha comprises four clearly distinguished superfamilies: whiteflies (Aleyrodoidea), jumping plant-lice (Psylloidea), aphids (Aphidoidea), and scale insects (Coccoidea) (Zrzavy, 1990; Klimaszewski and Wojciechowski, 1992). Chromosome numbers of whiteflies have been described for only four species (Blackman and Cahill, 1998). Karyotypes of jumping plant-lice are known for more than 150 species (Maryan´ska-Nadachowska, 2002). Basic chromosome sets of aphids and scale insects, which comprise many agricultural and forest pests, have been described for more than 800 species (Kuznetsova and Shaposhnikov, 1973; Blackman, 1980a, b, 1986, 1990) and almost 400 species (Nur, 1980; Nur et al., 1987; Moharana, 1990), respectively.

B chromosomes in Sternorrhyncha The frequency distribution of supernumerary chromosomes in particular superfamilies is random (Table 1). Only one species that carries B chromosomes has been described in Aleyrodoidea (Thomsen, 1927). In Psylloidea, accessory chromosomes are not as rare and have been found in nine species (Matcharashvili and Kuznetsova, 1997; Kuznetsova et al., 1997; Maryan´ska-Nadachowska, 1999; Nokkala et al., 2000; Maryan´ska-Nadachowska et al.,

Accessible online at: www.karger.com/cgr

Table 1. Species of Sternorrhyncha with B chromosomes

Taxa

Number of chromosomes 2n

Aleyrodoidea Aleurodes proletella Psylloidea Psyllidae Rhinocola aceris

Baeopelma foersteri Cacopsylla crataegi Cacopsylla hippophaes Cacopsylla nebulosa Cacopsylla peregrina Psylla ledi Triozidae Bactericera curvatinervis Trioza apicalis Aphidoidea Euceraphis betulae Euceraphis punctipennis Euceraphis mucida

26 + BB

Thomsen, 1927

12+X0+B 12+X0+BB 12+X0+BBB 14+X0+B 24+X0+B 24+X0+B 24+X0+B 24+X0+B 24+X0+B

Matcharashvili and Kuznetsova, 1997 Maryanska-Nadachowska, 1999 Nokkala et al., 2000 Matcharashvili and Kuznetsova, 1997 Maryanska-Nadachowska et al., 2001 Kuznetsova et al., 1997 Kuznetsova et al., 1997 Kuznetsova et al., 1997

24+XY+B 24+X0+B

Kuznetsova et al., 1997 Kuznetsova et al., 1997

4+X 1X20+B 4+X 1X20+BB 2+X 1X20+B 2+X 1X20+BB 14+X1X20+BBB 14+X1X20+BBBB 4+X1X20+BBB 4+X0+BB 4+X1X20+B

Blackman, 1976

Euceraphis sp. no. 1 Euceraphis sp. no. 2 Euceraphis sp. no. 3 Coccoidea Pseudoccocus affinis (obscurus)

10 + 1–8B

Antonina pertiosa

24 + BB

2001). B chromosomes occur, at low frequency, in natural populations of Psyllidae and Triozidae (most B-carrying individuals harboured only one supernumerary chromosome). The most interesting and unique example of B chromosome occurrence and behaviour in Psylloidea is Rhinocola aceris, where four types of supernumeraries (B1, B2, B3, B4) were described (Maryan´ska-Nadachowska, 1999; Nokkala et al., 2000) (Figs. 1–15). This widely distributed, Palaearctic species shows a basic karyotype consisting of 10 autosomes and the X chromosome in males (Maryan´ska-Nadachowska et al., 1992), and demonstrates a high tolerance to the presence of supernumerary chromosomes. Among eight populations studied from Finland, Russia, Poland and Georgia, seven carried mitotically stable B chromosomes (Nokkala et al., 2000; Table 1). A stable frequency of supernumerary chromosomes is often found for several years, but, in R. aceris, intrapopulation differences in B frequency were observed between samples collected in several years. This probably indicates that B chromosome frequencies in R. aceris depend not only on a high degree of tolerance to additional elements in the chromosome set, but also on other factors. B chromosomes are mitotically stable and segregate quite regularly from the X chromosome. Their behaviour during mitotic prophase and metaphase I suggests that their regular segregation probably results from the incorporation of B chromosomes into achiasmate segregation mechanisms with the X chromosome in the place occupied by the Y chromosome in species with an XY sex determination system. Similar B chromosome behaviour was observed in Cacopsylla peregrina (Kuznetsova et al., 1997) and C. crataegi (Matcharashvili and Kuznetsova, 1997). Additional data from Fin-

References

Blackman, 1976 Blackman, 1988 Blackman, 1988 Blackman, 1988 Blackman, 1988 Nur, 1962b, 1966a, b, 1969; Nur and Brett, 1987, 1988 Nur et al., 1987

land (Turku), Poland (Warsaw) and Bulgaria (Sofia) confirmed that the extra univalent chromosome segregating from the X in C. peregrina was present in all males. The mitotic stability and the segregation pattern of the B from the X in meiosis, traced in all stages, were highly regular. The meiotic X and B chromosomes, which appear as univalents during meiotic prophase, associate at metaphase I on the basis of the achiasmatic segregation mechanisms. Segregating univalents associate and show “touch and go” pairing at early metaphase I, and segregate from each other at anaphase I. All characteristics of supernumerary chromosome in C. peregrina, originally identified as a B chromosome (Kuznetsova et al., 1997), suggest that this extra chromosome has to be referred to as an achiasmatic Y chromosome (Nokkala et al., 2003) (Fig. 16). If this scenario is true then Y chromosomes present in Heteropsyla cubana might also have arisen from B chromosomes (Maryan´ska-Nadachowska et al., 1996). This interpretation is paralleled by the hypothesis that the Y chromosome in Drosophila evolved from a specialized B chromosome instead of a degenerated homologue of the X chromosome (Hackstein et al., 1996; Carvalho, 2002). In Aphidoidea, supernumerary chromosomes have been reported in several species of the genus Euceraphis feeding on various species of birch trees (Betula species). In Euceraphis, with a multiple X chromosome system, the mechanism of appearance and role of B chromosomes seem to be different (Blackman 1976, 1988). Although traditionally viewed and still widely accepted as derived from autosomes, B chromosomes can originate in a number of ways (Camacho et al., 2000). Most of the Euceraphis species have one or more supernumerary chromosomes, similar to the X, but showing greater stability in

Cytogenet Genome Res 106:210–214 (2004)

211 69

Figs. 1–15. Various B chromosome types in Rhinocola aceris (Psylloidea, Hemiptera) in meiotic prophase and metaphase I. Slides were stained with the C-banding method. Figs. 1, 5, 10, 12, 13 and 14 correspond to figures 2b, 4b, 7b, 5b, 5d and 5c in Maryan´ska-Nadachowska (1999), respectively.

size and number than typical B chromosomes. A multiple X system in Aphidoidea probably arises simply from X0 by fissions of the single original X chromosome into two or more parts (Blackman, 1995). However, the multiple X system has probably little or no significance in molecular genetic basis of

212 70

Cytogenet Genome Res 106:210–214 (2004)

sex determination. The behaviour of additional chromosomes with the functional X is apparent. The smaller Bs vary somewhat in size and could have derived from larger ones by, for example, deletion. The larger Bs are similar to the X chromosomes. Almost all species of Euceraphis have at least one of

Fig. 16. The Y chromosome, originated from the B chromosome, in Cacopsyla peregrina with the achiasmatic XY sex determination system. The slide was stained using the Feulgen-Giemsa method.

these extra chromosomes. The relationship of these B chromosomes with the functional X chromosomes is obvious. In Euceraphis, supernumerary chromosomes are stable elements in the chromosomal set and selection that provides stability of B chromosome numbers is probably based on the development of a balanced system of their accumulation and elimination. B chromosomes are in fact non-functional X chromosomes and seem

to derive from X chromosomes rather than from other elements of the chromosomal set. In Euceraphis, the number of B chromosomes varies not only between species, but also between populations within species as in the case of Euceraphis betulae, E. punctipennis and E. mucida (Blackman, 1976, 1988). Two other aphid genera Symydobius and Clethrobius, closely related to Euceraphis, also show the presence of additional chromosomal elements interpreted as a non-functional X. In Coccoidea, a peculiar and unstable system of B chromosomes was found in the mealybug Pseudoccocus affinis (= obscurus) (Nur, 1962a, b, 1966a, b). In this species the rate of transmission and accumulation of supernumeraries is high through male meiosis, and up to eight accessory chromosomes can be present in some specimens. These Bs reduce the fitness of P. affinis individuals and are maintained because of meiotic drive. One of the first demonstrations of the existence of A chromosome genes being able to suppress B chromosome drive was reported in this species (Nur and Brett, 1985, 1987, 1988). B chromosomes have also been described in two other species of coccids: Nautococcus schraderae (Hughes-Schrader, 1942 in Nur, 1962b) and Antonina pertiosa (Nur et al., 1987). In other suborders within Hemiptera, supernumerary chromosomes have been found only sporadically in spite of the fact that a large number of species have been karyotyped. For instance in Cicadomorpha, where karyotypes of more than 580 species are known, B chromosomes were described only in three species belonging to three genera (Kirillova and Kuznetsova, 1990). In Heteroptera, accessory chromosomes are even less frequent (see e.g. Muramoto, 1973; Mola and Papeschi, 1993).

References Blackman RL: Cytogenetics of two species of Euceraphis (Homoptera, Aphididae). Chromosoma 56: 393–408 (1976). Blackman RL: Chromosome numbers in the Aphididae and their taxonomic significance. Syst Ent 5:7–25 (1980a). Blackman RL: Chromosomes and parthenogenesis in aphids, in Blackman RL, Hewitt GM, Ashburner M (eds): Insect Cytogenetics. Symp R Ent Soc London 10:133–148 (1980b). Blackman RL: The chromosomes of Japanese Aphididae (Homoptera) with notes on the cytological work of Orihay Shinji. Cytologia 51:59–83 (1986). Blackman RL: Stability of a multiple X chromosome system and associated B chromosomes in birch aphids (Euceraphis spp., Homoptera: Aphididae). Chromosoma 96:318–324 (1988). Blackman RL: The chromosomes of Lachnidae. Acta Phytopat Entom Hung 25:273–282 (1990). Blackman RL: Sex determination in insects, in: Leather SR, Hardie J (eds): Insect Reproduction, pp 57–94 (CRC Press, Boca Raton 1995). Blackman RL, Cahill M: The karyotype of Bemisia tabaci (Hemiptera: Aleyrodidae). Bull Entom Res 88:213–215 (1998). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000).

Carvalho AB: Origin and evolution of the Drosophila Y chromosome. Curr Opin Genet Dev 12:664–668 (2002). Hackstein JHP, Hochstenbach R, Hauschteck-Jungen E, Beukeboom LW: Is the Y chromosome of Drosophila an evolved supernumerary chromosome? BioEssays 18:317–323 (1996). Hughes-Schrader S: The chromosomes of Nautococcus schraderae Vays., and the meiotic division figures of male Llaveine coccids. J Morph 70:261–299 (1942). Jones RN, Rees H: B Chromosomes (Academic Press, New York 1982). Kirillova VI, Kuznetsova VG: B-chromosomes of Javesella pellucida Fabr. and other Delphacidae (Homoptera, Cicadinea). Citologia 32:282–290 (1990). Klimaszewski SM, Wojciechowski W: Relationships of recent and fossil groups of Sternorrhyncha as indicated by the structure of their forewings. Prace Nauk Uniw S´la˛skiego, Katowice 1318:7–50 (1992). Kuznetsova VG, Shaposhnikov GKH: Chromosome numbers of aphids (Homoptera, Aphidinea) of the world fauna. Entomol Obozr 52:116–135 (1973). Kuznetsova VG, Nokkala S, Maryan´ska-Nadachowska A: Karyotypes, sex-chromosome systems, and male meiosis in Finnish psyllids (Homoptera, Psylloidea). Folia biol (Krako´w) 45:143–152 (1997). Maryan´ska-Nadachowska A: B-chromosome polymorphism in Rhinocola aceris (Psylloidea, Homoptera). Folia biol (Krako´w) 47:115–121 (1999).

Maryan´ska-Nadachowska A: A review of karyotype variation in jumping plant-lice (Psylloidea, Sternorrhyncha, Hemiptera) and checklist of chromosome numbers. Folia biol (Krako´w) 50:135–152 (2002). Maryan´ska-Nadachowska A, Kuznetsova VG, Warchałowska-S´liwa E: Karyotypes of Psyllina (Homoptera). I. New data and check-list. Folia biol (Krako´w) 40:15–25 (1992). Maryan´ska-Nadachowska A, Kuznetsova VG, Yang ChT, Woudstra IH: New data on karyotypes and the number of testicular follicles in the psyllid families Aphalaridae, Psyllidae, Carsidaridae, and Triozidae (Homoptera, Psylloidea). Caryologia 49:279–285 (1996). Maryan´ska-Nadachowska A, Kuznetsova VG, Nokkala S: Standard and C-banded meiotic karyotypes of Psylloidea (Sternorrhyncha, Homoptera, Insecta). Folia biol (Krako´w) 49:53–62 (2001). Matcharashvili ID, Kuznetsova VG: Karyotypes, spermatogenesis, and morphology of the internal reproductive system in males of some species of psyllids (Homoptera, Psylloidea) from Georgia. I. Karyotypes and spermatogonial meiosis. Entomol Obozr 76:16–24 (1997). Moharana S: Cytotaxonomy of coccids (Homoptera: Coccoidea), in Koteja J (ed): Proceedings of the Sixth Internat Symp of Scale Insects Studies, pp 47–54 (Agricultural Univ Press, Cracow 1990)

Cytogenet Genome Res 106:210–214 (2004)

213 71

Mola LM, Papeschi AG: Meiotic studies in Largus rufipennis (Castelnau) (Largidae, Heteroptera): frequency and behaviour of ring bivalents, univalents and B chromosomes. Heredity 71:33–40 (1993). Muramoto N: A study of the B-chromosomes and their occurrence rate of Orthocephalus funestus (Miridae; Heteroptera). La Kromosoms 91:2906–2912 (1973). Nokkala S, Kuznetsova VG, Maryan´ska-Nadachowska A: Achiasmate segregation of a B chromosome from the X chromosome in two species of psyllids (Psylloidea, Homoptera). Genetica 108:181–189 (2000). Nokkala S, Grozeva S, Kuznetsova V, Maryan´ska-Nadachowska A: The origin of the achiasmatic XY sex chromosome system in Cacopsylla peregrina (Frst.) (Psylloidea, Homoptera). Genetica 119: 327–332 (2003). Nur U: Population studies of supernumerary chromosomes in a mealybug. Genetics 47:1679–1690 (1962a). Nur U: A supernumerary chromosome with an accumulation mechanism in the lecanoid genetic system. Chromosoma 13:249–271 (1962b).

214 72

Nur U: Harmful supernumerary chromosomes in a mealy bug population. Genetics 54:1225–1238 (1966a). Nur U: The effect of supernumerary chromosomes on the development of mealy bugs. Genetics 54:1239– 1249 (1966b). Nur U: Harmful B-chromosomes in a mealy bug: additional evidence. Chromosoma 28:280–297 (1969). Nur U: Evolution of unusual chromosome systems in scale insects (Coccoidea: Homoptera), in Blackman RL, Hewitt GM, Ashburner M (eds): Insect Cytogenetics Symp Roy Ent Soc London, vol 10, pp 97–117 (Blackwell, London 1980). Nur U, Brett BLH: Genotypes suppressing meiotic drive of a B chromosome in the mealy bug Pseudococcus obscurus. Genetics 110:73–92 (1985). Nur U, Brett BLH: Control of meiotic drive of B chromosomes in the mealybug, Pseudococcus affinis (obscurus). Genetics 115:499–510 (1987).

Cytogenet Genome Res 106:210–214 (2004)

Nur U, Brett BLH: Genotypes affecting the condensation and transmission of heterochromatic B-chromosomes in the mealybug Pseudococcus affinis. Chromosoma 96:205–212 (1988). Nur U, Brown W, Beardsley JW: Evolution of chromosome number in mealybugs (Pseudococcidae: Homoptera). Genetica 74:53–60 (1987). Sorensen JT, Cambell BC, Gill RJ, Steffen-Cambell JD: Non-monophyly of Auchenorrhyncha (“Homoptera”), based upon 18S rDNA phylogeny: eco-evolutionary and cladistic impications within preHeteropterodea Hemiptera (s.l.) and a proposal for new, monophyletic suborders. Pan-Pacific Ent 71: 37–60 (1995). Thomsen M: Studien über die Parthenogenese bei einigen Cocciden und Aleurodiden. Zschr Zellforsch Mikrosk Anat 5:1–116 (1927). White MJD: Animal Cytology and Evolution, 3rd ed. (Cambridge University Press, Cambridge 1973). Zrzavy J: Evolution of Hemiptera: an attempt at synthetic approach, in Koteja J (ed): Proc Sixth Internat Symp Scale Insects Studies, pp 19–22 (Agricultural Univ Press, Cracow 1990).

Review on B Chromosomes Cytogenet Genome Res 106:215–221 (2004) DOI: 10.1159/000079290

B chromosomes in Crustacea Decapoda E. Coluccia, R. Cannas, A. Cau, A.M. Deiana and S. Salvadori Dipartimento di Biologia Animale ed Ecologia, Università di Cagliari, Cagliari (Italy)

Abstract. Among crustacean Decapoda numerical chromosome variability is frequent, and it has been hypothesized that the presence of supernumerary chromosomes accounts for this variability. Thanks to the improvement of cytogenetic analysis by chromosomal banding techniques, supernumerary B chromosomes (Bs) have been demonstrated in Nephrops norvegicus, Homarus americanus, Palinurus elephas and P. mauritanicus,

belonging to different crustacean families. In all four species Bs were variable in number, mainly heterochromatic and undigested by various endonucleases, and in meiosis they showed non-Mendelian segregation. Compared to the other chromosomes of the complement, the Bs are very small in almost all species, but some of them were very large in N. norvegicus.

Within Crustacea, decapods include commercially important species that have been threatened by intensive fishery activity; for this reason a new approach to management strategies is needed, the choice of which should be based upon knowledge on their biology as well as their genetics. So far little is known about the karyology of decapods, which is a large monophyletic group that first appeared in the Devonian period (Schram, 2001). Most cytogenetic studies date back to the early years of cytogenetic research (reviewed in Lechér et al., 1995), and the information available is scarce mainly because of technical constraints in obtaining good chromosome preparations. Moreover, most techniques use testis tissues that only supply male meiotic metaphase chromosomes. In this taxon, data on karyotype structure are fewer than those available for other arthropods. Decapods show some of the highest chromosome numbers reported for any organism, with diploid numbers ranging from 54 in the swimming crab (Lio-

carcinus vernalis) (Trentini et al., 1989) to 254 in the hermit crab (Eupagurus ochotensis) (Niiyama, 1959), and numerical chromosome polymorphism has been reported for a number of species. The large number and small size of chromosomes make karyological studies and an accurate chromosome count difficult; for the same reasons B chromosome occurrence is difficult to confirm. For the last decade our laboratory has carried out cytogenetic analysis on commercial decapods belonging to the Aristeidae, Scyllaridae, Nephropidae, and Palinuridae families (Deiana et al., 1992a, b; Coluccia et al., 1994; Salvadori et al., 1995; Deiana et al., 1996, 1997; Coluccia et al., 2001; Salvadori et al., 2002; Coluccia et al., 2003). In particular, in species belonging to Scyllaridae, Nephropidae, and Palinuridae families the application of banding methods, especially C-banding, fluorochrome banding, and restriction endonuclease (RE) induced banding, has improved cytogenetic analysis, allowing a sharp differentiation of mitotic chromosomes and meiotic figures, and pointing out the occurrence of Bs in some species. We carried out cytogenetic analyses on mitotic and meiotic metaphases from gonad and somatic tissues of male specimens. We identified chromosomes with some of the features typical of B chromosomes in terms of heterochromatin content, asynapsis, and distorted segregation in four species of Nephropidae and Palinuridae, but not in the Scyllaridae species Scyllarides latus (Deiana et al., 1997) and Scyllarus arctus (our unpublished data).

Received 6 October 2003; manuscript accepted 9 December 2003. Request reprints from: Dr. Elisabetta Coluccia Dipartimento di Biologia Animale ed Ecologia Università di Cagliari, Viale Poetto, 1, IT–09126 Cagliari (Italy) telephone: +39-(0)70-6758003; fax: +39-(0)70-6758005 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0215$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Fig. 1. Metaphases I (a, b), mitosis (c) and metaphases II (d) of Nephrops norvegicus. Bs are indistinguishable from bivalents after Wright’s staining (b). After C-banding and DdeI-digestion (a, c, d) it is possible to identify: large Bs with a wide paracentromeric C-band symmetrically located on the two arms (*); large and medium sized Bs completely heterochromatic ( → ). In metaphases I they are asynaptic, the large Bs (*) make peculiar univalent rings (a). In metaphases II coming from the same meiocyte the distorted segregation of Bs (d).

In this paper we review the cytogenetic characteristics of supernumerary chromosomes in the Nephropidae Nephrops norvegicus (Deiana et al., 1996) and H. americanus (Coluccia et al., 2001), and in the Palinuridae Palinurus elephas (Salvadori et al., 1995; Coluccia et al., 2004a) and P. mauritanicus (Coluccia et al., 2003).

B chromosomes in Nephropidae Among Nephropidae karyological data have been reported for 5 out of 43 species belonging to the family (reviewed in Corni et al., 1989). Numerical variability has been reported in three species: Homarus americanus, H. gammarus and Nephrops

216 74

Cytogenet Genome Res 106:215–221 (2004)

norvegicus (reviewed in Nakamura et al., 1988; Corni et al., 1989) whereas, in Metanephrops japonicus, two authors have reported different chromosome numbers (Niiyama, 1959; Murofushi et al., 1984). C-banding has shown the presence of B chromosomes in N. norvegicus (Deiana et al., 1996) and H. americanus (Coluccia et al., 2001) but not in H. gammarus (Salvadori et al., 2002). The diploid chromosome number in the Norway lobster, N. norvegicus, ranges from 131 to 140. C-banding and the REinduced banding allowed a fine resolution of chromosomes in mitosis and meiosis as well as the detection of supernumerary chromosomes in the chromosome complement (Deiana et al., 1996) (Fig. 1). Bs are mainly heterochromatic, unaffected by digestion with the DdeI-restriction enzyme and are asynaptic

(Fig. 1a, c, d). They are also tightly condensed and their primary constriction is often so difficult to identify that they are undistinguishable from bivalents after conventional staining (Fig. 1b). They present a distorted meiotic segregation, clearly shown by metaphases II from the same meiocyte, which is a logical consequence of their behaviour as univalents (Fig. 1d). The analysis of metaphases I after C- and DdeI- bandings allowed one to count these asynaptic chromosomes; they varied in number up to 8 while the modal number of bivalents was 64. Supernumerary chromosomes include very large chromosomes; the largest B is larger than the A chromosomes, and it is characterized by a wide paracentromeric heterochromatic band symmetrically located on the two arms (asterisk in Fig. 1c). In meiotic metaphase I, this chromosome was asynaptic and often doubled up forming a univalent ring; for this reason it could be regarded as an isochromosome. In some specimens two isochromosomes were detected (asterisks in Fig. 1a). The other large Bs include an acrocentric chromosome and a few metacentric-submetacentric chromosomes, up to 5, that are completely heterochromatic, and randomly distributed in metaphase II (Fig. 1d). Finally in this species there are also smallsize Bs, up to 5, heterochromatic and variable in number. A minimum number of Bs in mitotic and meiotic metaphases, respectively 7 and 3, is always present. Numerical variability has also been reported in the American lobster Homarus americanus, and the presence of B chromosomes has been hypothesized by Roberts (1969) and Hughes (1982). Recently, thanks to the application of C- and RE-banding, we have been able to reveal the presence of 2–4 Bs (Coluccia et al., 2001). Excluding B chromosomes from the count, the modal 2n value was 135–136 (Fig. 2a). The supernumerary chromosomes are smaller than the other members of the complement; in meiotic metaphase I they are recognisable because of their asynapsis and heterochromatic nature revealed by Cbanding (Fig. 2b). Histological analysis of testis sections showed the existence of chromosomes outside the metaphase plate (Coluccia et al., 2001), suggesting that they could be moving from pole to pole as has been reported in grasshopper X and B chromosomes (Rebollo et al., 1998).

B chromosomes in Palinuridae Among the 46 Palinuridae species (Holthuis, 1991), only 5 species have been studied from a karyological point of view (Nakamura, 1988; Salvadori et al., 1995; Coluccia et al., 2003; 2004). Numerical variability was reported in two species (Salvadori et al., 1995; Coluccia et al., 2003), and different chromosome numbers have been reported in Panulirus japonicus (reviewed in Nakamura, 1988). C-banding has shown the presence of B chromosomes in Palinurus elephas (Salvadori et al., 1995) and P. mauritanicus (Coluccia et al., 2004), but not in Panulirus regius (Cannas et al., 2004). The chromosome number of the common spiny lobster P. elephas ranges from 138 to 150. C- and RE-induced banding revealed the presence of small B chromosomes, completely heterochromatic and in variable numbers up to 13 (Fig. 3a). In meiosis I they were observed forming univalents (Fig. 3b),

Fig. 2. Mitosis after Wright’s staining (a) and metaphase I after C-banding (b) of Homarus americanus. Bs are indistinguishable from the A chromosomes after conventional stainings (a). In (b) small asynaptic and heterochromatic Bs are recognizable ( → ).

bivalents, and multivalents (Salvadori et al., 1995). The same as in the American lobster, testis histological sections in P. elephas also showed the existence of chromosomes outside the metaphase plate (Fig. 3c). Mapping of 45S ribosomal DNA by FISH revealed its presence in five pairs of chromosomes and a variable number of signals were recorded on some of the B chromosomes (arrows in Fig. 3d indicate the signals on Bs); moreover, these chromosomes were positive to CMA3 fluorescent staining, indicating a GC-richness (Fig. 3e); after Wright’s staining the bivalents and the Bs could be sharply distinguished (Fig. 3f) (Coluccia et al., 2004). Ribosomal DNA cistrons have been detected on Bs of many species (Lo´pez-Leo´n et al., 1994; Stitou et al., 2000; Jones and Houben, 2003), and they are generally inactive (Lo´pez-Leo´n et al., 1994). The chromosome number of the pink spiny loster P. mauritanicus ranges from 113 to 130 (Fig. 4a). In this species, B chromosomes have been detected by C-banding. They are smaller

Cytogenet Genome Res 106:215–221 (2004)

217 75

Fig. 3. Mitosis (a), metaphase I (b) after C-banding of Palinurus elephas; the arrows show the small, heterochromatic and asynaptic Bs. In the testis histological sections (c) chromosomes outside the metaphase plate are identifiable (arrows). Sequential staining of a metaphase I after 45S rDNA FISH (d), CMA3 (e) and Wright’s staining (f). Arrows in (d), (e), and (f) show small unpaired Bs entirely labeled after FISH and CMA3 .

218 76

Cytogenet Genome Res 106:215–221 (2004)

Fig. 4. Mitosis after Wright’s staining (a) and metaphase I after C-banding (b) of Palinurus mauritanicus. Bs are indistinguishable from the A chromosomes after conventional staining (a). In (b) small asynaptic and heterochromatic Bs are recognizable ( → ). In the testis histological sections (c) chromosomes outside the metaphase plate are identifiable (arrows).

than A chromosomes, vary in number up to eight, are heterochromatic and show asynapsis (Fig. 4b) (Coluccia et al., 2003). In this species testis histological sections also showed the presence of chromosomes outside the metaphase plate (Fig. 4c).

Conclusions B chromosomes appear to be widespread in animals, plants and fungi, and their occurrence seems to be more frequent in cytologically more extensively investigated taxa (Jones and Rees, 1982). Among Crustacea, B chromosomes have been reported in Amphipoda, Anostraca, Decapoda, Isopoda, and Ostracoda (Table 1), and seem to be more frequent in Amphipoda, though this can be due to fact that amphipods are the most widely studied group. In this review, we have focused on the characteristics of B chromosomes in Decapoda. Two main types of Bs have been identified depending on their size: small Bs and large Bs. Small Bs were present in all of the species studied. They are smaller than or equal to the smallest A chromosomes, and this is the most frequent condition for most organisms (Jones and Houben, 2003). In N. norvegicus some of the

B chromosomes are peculiar because of their unusually large size. The largest Bs showed some of the features and behaviour typical of isochromosomes: they are very large and metacentric, with largely symmetrical C-bands in both arms; they often display a folded configuration and in metaphase I they often form univalent rings. Large Bs are present in a few species, among animals they are reported mainly in the Orthoptera (Jones and Rees, 1982), and have been observed more recently in a number of fishes (reviewed in Ziegler et al., 2003).The peculiar features and meiotic behaviour of iso-B chromosomes have been studied in plants (Jones et al., 1989; Santos et al., 1995), in Orthoptera (Hewitt, 1979; Fletcher and Hewitt, 1988; Henriques-Gill et al., 1984; Lo´pez-Leo´n et al., 1993) and in fishes (Mestriner et al., 2000). Iso-B chromosomes are generated by centromere misdivision and nondisjunction and they can derive from the rearrangement of B chromosomes, as reported in the grasshopper Eyprepocnemis plorans (Lo´pez-Leo´n et al., 1993) or from an A chromosome as reported in the fish Astyanax scabripinnis (Mestriner et al., 2000). Since most B chromosomes studies in Decapoda have been carried out on male metaphases, the presence of chromosomes affecting sex determination cannot be excluded. Similarities

Cytogenet Genome Res 106:215–221 (2004)

219 77

Table 1. B chromosomes in Crustacea

Species

Class-Order

2n

B chrs

References

Echinogammarus berilloni Gammarus locusta G. oceanicus G. pulex G. zaddachi Hyperiella dilatata Marinogammarus marinus M. pirloti Phronima atlantica Phronima sedentari Branchipus schaefferi Nephrops norvegicus H. americanus Palinurus elephas Palinurus mauritanicus Asellus coxalis Jaera albifrons albifrons J. marina albifrons J. marina forsmani Erpetocypris cheuvreuxi Eucypris furcata

Amphipoda Amphipoda Amphipoda Amphipoda Amphipoda Amphipoda Amphipoda Amphipoda Amphipoda Amphipoda Anostraca Decapoda Decapoda Decapoda Decapoda Isopoda Isopoda Isopoda Isopoda Ostracoda Ostracoda

– – – 52–54 – 58 50–52 59–63 30 30 n = 10 131–140 135–136 (mode) 138–150 113–130 12 28 21 19 18 16

1–9 Bs Bs Bs Bs 1–2 Bs Bs 0–1 0–1 1–3 8 4 13 8 0–3 Bs 0–1 0–1 4 7

Lop (1989) Salemaa (1986) Salemaa (1986) Orian and Callan (1957) Salemaa (1986) Libertini and Lazzaretto (1993) Orian and Callan (1957) Orian and Callan (1957) Laval and Lechér (1975) Laval and Lechér (1975) Beladjal et al. (2002) Deiana et al. (1996) Coluccia et al. (2001) Salvadori et al. (1995) Coluccia et al. (2003) Rocchi (1967) Lécher (1967) Staiger and Bocquet (1956) Staiger and Bocquet (1956) Tétart (1967) Tétart (1967)

between Bs and sex chromosomes have been found (reviewed in Camacho et al., 2000), and in an anostracan species a malebiased sex ratio has been correlated with the presence of Bs (Beladjal et al., 2002). In the four Decapoda species, B chromosomes were present in all specimens studied, suggesting a high frequency in natural populations presumably accomplished through putative drive mechanisms, in resemblance to those described in many spe-

cies (Beukeboom, 1994; Camacho et al., 2000). The reported data suggest the importance of extending cytogenetic analysis in this very large group of Crustaceans; further investigations, including specimens of different geographic origins as well as females, are needed to understand the distribution of Bs within species. Moreover, molecular analyses will be important to study the origin, the role and the evolution of these supernumerary chromosomes.

References Beladjal L, Vandekerckhove TTM, Muyssen B, Heyrman J, de Caesemaeker J, Mertens J: B-chromosomes and male-biased sex ratio with paternal inheritance in the fairy shrimp Branchipus schaefferi (Crustacea, Anostraca). Heredity 88:356–360 (2002). Beukeboom LW: Bewildering Bs: an impression of the first B-chromosome conference. Heredity 73:328– 336 (1994). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355: 163–178 (2000). Cannas R, Deiana AM, Salvadori S, Coluccia E: Dati preliminari sulla cariologia dell’aragosta reale Panulirus regius De Brito Capello, 1864 (Crustacea, Decapoda). Biol Mar Medit, in press (2004). Coluccia E, Deiana AM, Milia A, Salvadori S, Cau A: Preliminary data on mitotic and meiotic chromosomes of two species of Aristeidae (Crustacea, Decapoda), in Bianchini ML, Ragonese S (eds): Life Cycles and Fisheries of the Deepwater Shrimps Aristeomorpha foliacea and Aristeus antennatus. Proceedings of the International Workshop held in the Istituto di Tecnologia della Pesca e del Pescato. NTR-ITPP Special Publications 3, p 62 (1994). Coluccia E, Cau A, Cannas R, Milia A, Salvadori S, Deiana AM: Mitotic and meiotic chromosomes of the American lobster Homarus americanus (Nephropidae, Decapoda). Hydrobiologia 449:149–152 (2001).

220 78

Coluccia E, Salvadori S, Cannas R, Deiana AM: Studio dei cromosomi mitotici e meiotici di Palinurus mauritanicus (Crustacea, Decapoda). Biol Mar Medit 10:1069–1071 (2003). Coluccia E, Deiana AM, Cannas R, Salvadori S: Study of nucleolar organizer region in Palinurus elephas (Crustacea, Decapoda). Hydrobiologia, in press (2004). Corni MG, Trentini M, Froglia C: Karyological study on Nephrops norvegicus (L., 1758) (Astacidea, Nephropidae) in the Central Adriatic sea. Nova Thalassia 10:127–131 (1989). Deiana AM, Caredda MG, Coluccia E, Cuccu D, Milia A, Salvadori S: I cromosomi mitotici e meiotici di Aristeomorpha foliacea (Crustacea Decapoda). Biologia Marina suppl al Notiziario SIBM 1:381– 382 (1992a). Deiana AM, Coluccia E, Milia A, Salvadori S: Mitosis and meiosis of two Decapoda species. Oebalia Suppl XVII:571–572 (1992b). Deiana AM, Coluccia E, Milia A, Salvadori S: Supernumerary chromosomes in Nephrops norvegicus L. (Crustacea, Decapoda). Heredity 76:92–99 (1996). Deiana AM, Bianchini ML, Coluccia E, Milia A, Cannas R, Serra D, Salvadori S: Dati preliminari sulla cariologia della magnosa (Scyllarides latus, Crustacea, Decapoda). Biol Mar Medit 4:640–642 (1997). Fletcher HL, Hewitt GM: Synaptonemal complex of univalent B chromosomes in the grasshoppers Euthystira brachyptera and Myrmeleotettix maculatus. Heredity 60:383–386 (1988).

Cytogenet Genome Res 106:215–221 (2004)

Henriques-Gil N, Santos JL, Arana P: Evolution of a complex polymorphism in the grasshopper Eyprepocnemis plorans. Chromosoma 89:290–293 (1984). Hewitt GM: Grasshoppers and crickets; in John B (ed): Animal Cytogenetics, Vol 3: Insecta, 1: Orthoptera, pp 1–170 (Gebrüder Borntraeger, Berlin 1979). Holthuis LB: Fao Species Catalogue. Vol. 13 Marine Lobsters of The World. FAO Fisheries Synopsis No 125, 13:91–165 (1991). Hughes JB: Variability of chromosome number in the lobsters, Homarus americanus and Homarus gammarus. Caryologia 35:279–289 (1982). Jones RN, Rees H: B Chromosomes, pp 1–39 (Academic Press, London 1982). Jones GH, Whitehorn JAF, Albini SM: Ultrastructure of meiotic pairing in B chromosomes of Crepis capillaris. I. One-B and two-B pollen mother cells. Genome 32:611–621(1989). Jones N, Houben A: B chromosomes in plants: escapees from the A chromosomes genome? Trends Plant Sci 8:417–423 (2003). Laval P, Lécher P: Caryotypes, chromosomes surnuméraires, parthénogénèse rudimentaire et polyploı¨die chez deux espèces du genre Phronima (Crustacés Amphipodes). Can J Genet Cytol 17:405–412 (1975). Lécher P: Analyse cytophotométrique du polymorphisme chromosomique robertsonien chez l’isopode Jaera (albifrons) syei Bocquet. Arch Zool Exp Gén 108:503–509 (1967).

Lécher P, Defaye D, Noel P: Chromosomes and nuclear DNA of Crustacea. Invert Reprod Develop 27:85– 114 (1995). Libertini A, Lazzaretto I: Karyotype morphology in Hiperiella dilatata Stebbing 1888 (Amphipoda, Hyperiidae) from the Ross sea (Antarctica). Polar Biol 13:101–103 (1993). Lop AF: Karyotypes of the Echinogammarus berillonigroup (Crustacea, Amphipoda) from Spain. Genetica 79:37–43 (1989). Lo´pez-Leo´n MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL: Generating high variability of B chromosomes in the grasshopper Eyprepocnemis plorans. Heredity 71:352–362 (1993). Lo´pez-Leo´n MD, Neves N, Schwarzacher T, HeslopHarrison TS, Hewitt GM, Camacho JPM: Possible origin of a B chromosome deduced from its DNA composition using double FISH technique. Chromosome Res 2:87–92 (1994). Mestriner CA, Galetti PM, Valentini SR, Ruiz IRG, Abel LDS, Moreira-Filho O, Camacho JP: Structural and functional evidence that a B chromosome in the characid fish Astyanax scabripinnis is an isochromosome. Heridity 85:1–9 (2000). Murofushi M, Deguchi Y, Yosida TH: Karyological study of the red swamp crayfish and the Japanese lobsters by air-drying method. Proc Jpn Acad 60:306–309 (1984).

Nakamura HK, Machii A, Wada KT, Awaji M, Townsley SJ: A check list of Decapod chromosomes (Crustacea). Bull Natl Res Inst Aquaculture 13:1–9 (1988). Niiyama H: A comparative study of the chromosomes in Decapods, Isopods and Amphipods, with some remarks on cytotaxonomy and sex-determination in the Crustacea. Mem Fac Fish Hokkaido Univ 7:1–60 (1959). Orian AJE, Callan HG: Chromosomes numbers of Gammarids. J Biol Mar Ass UK 36:129–142 (1957). Rebollo E, Martin S, Manzanero S, Arana P: Chromosomal strategies for adaptation to univalency. Chromosome Res 6:515–531 (1998). Roberts FL: Possible supernumerary chromosomes in the Lobster, Homarus americanus. Crustaceana 16:194–196 (1969). Rocchi A: Sulla presenza di cromosomi soprannumerari in una popolazione di Asellus coxalis. Caryologia 20:107–113 (1967). Salemaa H: Karyology of the northern Baltic peracaridan Crustacea. Sarsia 71:17–25 (1986). Salvadori S, Coluccia E, Milia A, Davini MA, Deiana AM: Studio sulla cariologia di Palinurus elephas Fabr. (Crustacea, Decapoda). Biol Mar Medit 2:581–583 (1995).

Salvadori S, Coluccia E, Milia A, Cannas R, Deiana AM: Studio dei cromosomi mitotici e meiotici di Homarus gammarus (Crustacea, Decapoda). Biol Mar Medit 9:1–3 (2002). Santos JL, Jimenez MM, Diez M: Synaptic patterns of rye B chromosomes. IV. The B isochromosomes. Heredity 74:100–107 (1995). Schram FR: Phylogeny of decapods: moving towards a consensus. Hydrobiologia 449:1–20 (2001). Staiger H, Bocquet C: Cytological demonstration of female heterogamety in Isopods. Experientia 10: 64–66 (1954). Stitou S, Diaz de la Guardia R, Jimenez R, Burgos M: Inactive ribosomal cistrons are spread throughout the B chromosomes of Rattus rattus (Rodentia, Muridae). Implications for their origin and evolution. Chromosome Res 8:305–311 (2000). Trentini M, Corni MG, Froglia C: The chromosomes of Liocarcinus vernalis (Risso, 1816) and Liocarcinus depurator (L., 1758) (Decapoda, Brachyura, Portunidae). Biol Zentralbl 108:163–166 (1989). Tétart J: Étude des garnitures chromosomiques de quelques Ostracodes d’eau douce. Bull Soc Zool France 92:167–176 (1967). Ziegler CG, Lamatsch DK, Steinlein C, Engel W, Schartl M, Schmid M: The giant B chromosome of the cyprinid fish Alburnus alburnus harbours a retrotransposon-derived repetitive DNA sequence. Chromosome Res 11:23–35 (2003).

Cytogenet Genome Res 106:215–221 (2004)

221 79

Review on B Chromosomes Cytogenet Genome Res 106:222–229 (2004) DOI: 10.1159/000079291

Current knowledge on B chromosomes in natural populations of helminth parasites: a review M. Sˇpakulova´,a and J.C. Casanovab a Parasitological b University

Institute of the Slovak Academy of Sciences, Kosˇice (Slovak Republic); of Barcelona, Faculty of Pharmacy, Laboratory of Parasitology, Barcelona (Spain)

Abstract. Helminths, traditionally classified into three phyla Platyhelminthes, Nemathelminthes and Acanthocephala, are a phylogenetically broadly diversified group of invertebrates, characterised by a parasitic life style. Current estimates of the helminth species diversity are at least 23–40,000 platyhelminthes, 10–26,000 nematodes and 1,200 acanthocephalans. Recent information on helminth karyotypes is fragmentary, and basic karyological data are known from approximately 1.1 % of known species. Supernumerary chromosomes have been reported in selected populations of only 11 digenean flukes (Platyhelminthes), 1 thorny-headed worm (Acanthocephala) and 4 roundworms (Nematoda), which represent 3.6, 7.7 and 1.3 % of the total number of species cytogenetically analysed to date within respective helminth groups. B chromosome

presence was not generally associated with heteromorphic sex chromosomes as they occurred both in hermaphroditic flukes and dioecious helminths, and in species having male or female heterogametic sex chromosomes (ZW of schistosomes, XO of acanthocephalans and XY of nematodes). Numbers of B chromosomes varied from 1 to 10. Most often, Bs represented one or two of the smallest elements of the complement but they could be much bigger in some digenean flukes. B chromosomes showed a diverse morphology, including telocentric to metacentric structure. There is no detailed banding or ultrastructural study of Bs in the majority of helminth carriers. Assumptions on the possible relation between the occurrence of Bs in endoparasitic helminths and extreme environments are discussed.

Helminths are a taxonomically and phylogenetically diversified group of invertebrates, characterised by their parasitic life style. However, sometimes this term is also used in the broader sense for free-living forms of Turbellaria, Linguatulida or Hirudinea. Traditionally, helminth parasites were classified into three phyla, namely Platyhelminthes, Nemathelminthes and Acanthocephala. According to the latest phylogenetic stud-

ies, these groups are not closely related, but instead belong to two divergent clades of bilateral metazoans. Thus, platyhelminth worms comprising trematodes, monogeneans and cestodes (and largely free-living turbellarians) are gathered with acanthocephalans and rotifers (Syndermata), molluscs, annelids and some other free-living groups into the new clade Lophotrochozoa. Nematodes and nematomorphs are related to arthropodes that form the majority of another new clade, Ecdysozoa (Zrzavy´, 2001; de Meeu¯s and Renaud, 2002). Apparently, the parasitic way of life evolved independently many times during animal evolution (Dorris et al., 1999; Poulin and Morand, 2000). The number of parasitic species likely exceeds the number of free-living animals (Windsor, 1998). Concerning helminth parasites, the current estimates are at least 23–40,000 platyhelminthes, 10–26,000 nematodes and 1,200 acanthocephalans (Poulin and Morand, 2000; de Meeu¯s and Renaud, 2002). Pre-

The Scientific Grant Agency SR VEGA, grant No. 2/3212/23, provided support for this work. Received 3 October 2003; manuscript accepted 28 January 2004. Request reprints from: Dr. Marta Sˇpakulova´, Parasitological Institute SAS Hlinkova 3, 040 01 Kosˇice (Slovak Republic) telephone: +421-55-6334455; fax: +421-55-6331414 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0222$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

cise estimates of the helminth species diversity are particularly difficult to obtain, and hence the number of species currently described could grossly underestimate the real situation (Poulin, 1996). Recent information on helminth karyotypes is fragmentary although the equine roundworm Parascaris equorum represented the early and very favourable cytogenetic model (2n = 2) (van Beneden, 1883) and the free-living soil nematode Caenorhabditis elegans (2n = 10 + XX/X0) became one of the most popular experimental genetic and biological models. A scarcity of cytogenetic data is mostly due to specific methodological problems associated with helminth parasites (difficulties in isolation of living endoparasites and identification of non-preserved specimens, low frequency of mitotic divisions etc.). This paper presents an overview of the available information on the occurrence of B chromosomes in parasitic helminths belonging to the groups of Trematoda, Monogenea, Cestoda, Acantocephala and Nematoda.

Survey of karyological data on major helminth groups Platyhelminthes – Trematoda The Trematoda are composed of two sister groups. Out of the small archaic Aspidogastrea, which comprises approximately 80 species parasitic to cold-blooded animals (estimate according to Rohde, 2001), only 4 species were analysed karylogically (Rohde, 1973; LoVerde and Frederiksen, 1978; Petkevicˇiu¯te˙, 2001). Two of them had 2n = 10 and 12, while the remainder possessed haploid numbers of 7 and 11. No B chromosomes have been detected so far in this group. Flukes of the Digenea represent probably the largest group of predominantly hermaphroditic platyhelminthes with about 18,000 described species (Cribb et al., 2001). These parasites of vertebrates are also best known from the karyological point of view (Barsˇiene˙, 1993). Up to the present, the diploid number of chromosomes of about 300 digeneans have been reported to range from 12 to 28 (Barsˇiene˙, 1993; Bell et al., 1998). Additionally, Park et al. (2000) published a karyotype of Clonorchis sinensis, an agent of human zoonosis, which demonstrates a diploid number of 56 elements. Detailed morphological characteristics are known in about one-half of the chromosome complements reported. Several digeneans are characterised by triploid populations (reviewed in Stanevicˇiute˙ and Kisiliene˙, 2001). Representatives of the unique dioecious family Schistosomatidae were studied most thoroughly, and have been shown to have relatively long chromosomes, diploid numbers ranging from 14 to 20, and female heterogametic sex determination (i.e. ZZ in male and ZW in female; Short, 1983; Sˇpakulova´ et al., 1997). Several genes and DNA fragments have been localised to chromosomes of the important human blood parasite Schistosoma mansoni using fluorescence in situ hybridization (Hirai and LoVerde, 1995, 1996). Supernumerary B chromosomes have been identified in selected natural populations of 11 fluke species belonging to 6 families (Table 1). This number of host species accounts for 3.6 % of cytogenetically analysed flukes. Adult sexually reproducing forms of these species parasitize amphibians, water

birds and small rodents, and larval stages reproduce asexually within aquatic snails. The larval parthenites were used in all karyological analyses listed, and in case of Notocotylus noyeri, a course of meiosis was additionally analysed within testes and ovaries of adult flukes isolated from the bank vole Clethrionomys glareolus (Barsˇiene˙, 1993). Most frequently, B chromosomes occurred in numbers of 1 or 2, although two species Notocotylus sp. and Diplodiscus subclavatus possessed up to 10 Bs. Morphologically, chromosomes of different sizes and types were found (see Table 1), and more detailed structural analyses of the supernumerary chromosomes have been performed only in the bird schistosome Trichobilharzia regenti (2n = 14 + ZZ/ ZW + 0–2 B). In this species, a conspicuous C– heterochromatin block was found on the long arm of the submetacentric small B chromosome (Sˇpakulova´ et al., 2001), and interestingly a similar block occurred also on this species’ small metacentric sex W chromosome. Platyhelminthes – Monogenea Karyology of monogenean ectoparasites of fish, frogs, turtles and hippopotamus is still in its infancy. Out of 5,000 species (de Meeu¯s and Renaud, 2002), only 15 have been analysed karyologically (reviewed in Rohde, 1994). Haploid numbers range from 4 to 10 and no records on B chromosomes have been published. Platyhelminthes – Cestoda The other major platyhelminth group, tapeworms (Cestoda) includes, according to de Meeu¯s and Renaud (2002), approximately 5,000 nominative species. The last reviews on karyotypes of these vertebrate endoparasites were published relatively long ago (Jones, 1945; Benazzi and Benazzi Lentati, 1976). Chromosome numbers are known for about 100 species, a third of which have been studied also for chromosome morphology. Diploid numbers range from 6 in hymenolepidid Microsomacanthus spp. from ducks (Petkevicˇiu¯te˙ and Regel, 1994) to 28 in the frog parasite Nematotaenia dispar (Vijayaraghavan and Subramanyam, 1980). The most frequent diploid number in tapeworms seems to be 18 or 16 (Sˇpakulova´ and Hanzelova´, 1997). No B chromosomes have been found in tapeworm parasites to date. Acanthocephala Thorny-headed worms (Acanthocephala) are a relatively small group of dioecious endoparasites of vertebrates (Petrochenko, 1956; Amin, 1985; Golvan, 1994). Karyotypes of only 13 acanthocephalans have been described to date (Crompton, 1985; Sˇpakulova´ et al., 2002). The diploid number of chromosomes varies from 5 to 16, and the sex determination mechanism is XX in female and XO or XY in males. Recently, B chromosomes were discovered in a population of the fish parasite Acanthocephalus lucii originating from a polluted water basin (Sˇpakulova´ et al., 2002). A total of 85 % of A. lucii individuals exhibited 1–5 supernumerary metacentric chromosomes which were much smaller than the smallest pair of regular chromosome set (Table 2, Figs. 1, 2). A single B-carrying species, A. lucii, has been found out of 13 karyologically studied acanthocephalans, representing 7.7 %.

Cytogenet Genome Res 106:222–229 (2004)

223 81

Table 1. Karyological data on helminth species of the Trematoda with occurrence of B chromosomes

Taxonomic position of helminth species DIGENEA Strigeidae Apatemon gracilis

2n + B

Morphology of Bs

Host species-Collection locality

References

20 or 20 + 1B

small telocentric

Radix peregra (syn. Lymnaea ovata)Crimea, Ukraine Radix peregraScotland, UK Planorbis planorbisPoland Anisus acronicus-North Chukotka, Russia Valvata piscinalisLithuania

Petkeviciute and Staneviciute (1999)

Staneviciute and Kisiliene (2001)

20 Apatemon minor

20 or 20 + 1–2 B

Apatemon fuligulae

20 or 20 + 1B

Ichthyocotylurus platycephalus

20 or 20 + 1 B or 30 (triploid)

medium-sized submetacentric or small subtelocentric

Schistosomatidae Trichobilharzia regenti

16 (14 + ZZ/ZW) or 16 + 1–2 B

small submetacentric, C-heterochromatin block

Radix peregra-Czech Republic

Spakulova et al. (2001)

22 or 22 + 2 B

small telocentric

Anisus spirorbisLithuania

Barsiene (1993)

20 or 20 + 1 B

big metacentric

Planorbarius corneusLithuania Planorbarius corneusBulgaria Planorbarius corneusLithuania Planorbarius corneusBulgaria Planorbarius corneusBulgaria Planorbarius corneusSlovak Republic Anisus spirorbisLithuania Planorbis planorbisPoland

Petkeviciute and Barsiene (1988) Mutafova et al. (1991) Barsiene (1993)

Hemiuridae Halipegus ovocaudatus Notocotylidae Notocotylus ephemera

small submetacentric small telocentric

20 20 or 20 + 1–2 B 20 or 20 + 1B

big submetacentric big metacentric

20 20 Notocotylus noyeri

Notocotylus sp.

Diplodiscidae Diplodiscus subclavatus

20 or 20 + 1 B

big metacentric

20 or 20 + 2 B

big metacentric

20 or 20 + 1 B

big metacentric

20 or 20 + 1 B or 20 + 1–10 B

1 big metacentric and 3-9 small acrocentrics

20 20 or 20 + 1–10 B

small subtelocentric

20

20 20 Echinostomatidae Echinostoma revolutum

22 22 22 or 22 + 2 B or 23 + 2 B 22 22

224 82

Bell et al. (1998)

Cytogenet Genome Res 106:222–229 (2004)

big metacentric (+ trisomy in pair 10)

Anisus spirorbis, Gyraulus laevis, Clethrionomys glareolus-Lithuania Anisus acronicus-North Chukotka, Russia

Planorbis planorbisCrimea, Russia Anisus spirorbisLithuania Planorbis planorbisPoland

Barsiene et al. (1990) Barsiene (1993)

Barsiene (1993) Mutafova et al. (1995) Mutafova et al. (1995) Petkeviciute et al. (1989a) Barsiene and Grabda-Kazubska (1991) Barsiene (1993)

Barsiene et al. (1990)

Planorbis planorbisBulgaria Planorbis planorbisSlovakia

Petkeviciute et al. (1989b) Petkeviciute et al. (1989b) Barsiene and Grabda-Kazubska (1991) Mutafova et al. (1994) Mutafova et al. (1994)

Lymnaea stagnalisBulgaria Lymnaea stagnalis, L. auricularia-Lithuania Radix peregra (syn. ovata)-Lithuania

Mutafova and Kanev (1986) Barsiene and Kisiliene (1991) Barsiene and Kisiliene (1991)

Lymnaea stagnalisLithuania, Poland Radix auriculariaLithuania

Barsiene (1993) Barsiene (1993)

Fig. 1. Karyotype of Acanthocephalus lucii (Acanthocephala) (see Sˇpakulova´ et al., 2002). Chromosome sets of 5 female individuals. (a) 2n = 6 + XX; (b–e) 2n = 6 + XX + 2–5B. Bar = 10 Ìm.

Table 2. Karyological data on helminth species of the Acanthocephala with occurrence of B chromosomes

Taxonomic position of helminth species

2n + B

PALAEACANTHOCEPHALA Echinorhynchidae Acanthocephalus 8 in female lucii 7/8 (6 + XX/X0) or 7/8 + 1–5 B

Nemathelminthes – Nematoda Roundworms (Nematoda) represent a broad group of predominantly dioecious metazoans that includes both free-living organisms and parasites of animals and plants. The latest estimates involve up to 27,000 nominative species out of which approximately 60 % are parasitic (de Meeus and Renaud, 2002). The most common reproductive strategy of nematodes is amphimixis; however, meiotic and mitotic parthenogenesis and protandric hermaphroditism have evolved in many groups (Triantaphyllou, 1983). At least 300 roundworm species have been studied karyologically for chromosome number, and the last review was pub-

Morphology of Bs

small metacentric

Host species-Collection locality

References

Leuciscus cephalusBulgaria Perca fluviatilis-Slovak Republic

Mutafova et al. (1997) Špakulová et al. (2002)

lished two decades ago by Triantaphyllou (1983). The lowest diploid number 2n = 2 was found in the above mentioned P. equorum, and in the walnut parasite Diplogaster coronata. The maximum 2n = 28 was reported in the wheat gall parasite Anquina tritici; however, higher chromosome numbers were encountered in polyploid forms of some plant parasitic nematodes (Triantaphyllou, 1983). The predominant chromosomal mechanism of sex determination is XX in females, X0 or XY in males. Chromosomes of the majority of nematodes are rodshaped without clear centromere positions, but trichurids possess a localised centromere (Sˇpakulova´ et al., 1994, 2000). In some ascaridoid nematodes, including the human intestinal

Cytogenet Genome Res 106:222–229 (2004)

225 83

roundworm Ascaris lumbricoides, a multiple X/0 (or multiple X/Y) sex determination mechanism has evolved and the existence of holokinetic chromosomes has been shown (Goday and Pimpinelli, 1989; Mutafova, 1995). Moreover, an unusual process of chromatin diminution discovered already in 1887 (Boveri, 1887) was investigated thoroughly in several ascaridoid species. In the initial stages of embryogenesis, chromosomal breakage, new telomere addition and DNA degradation occur in all presomatic cells. Thus, these developmentally regulated genome rearrangements result in differences in the DNA content between germ and somatic cells (Goday and Pimpinelli, 1993; Müller and Tobler, 2000). B chromosomes have been reported merely in 4 amphimictic roundworms that are parasitic in animals and man, representing 1.3 % of nematodes with known chromosome number (Table 3). Goswami (1978) reported up to 2 supernumerary chromosomes in the karyotypes of Trichuris ovis and T. globulosa from goat and sheep from Goa in southern India. These tiny elements, smaller than the X and Y sex chromosomes, were observed both in mitosis and meiotic stages and were present more frequently in cells of T. ovis than in the latter spe-

Fig. 2. Chromosome spreads corresponding to Fig. 1a–e. (a) 1, (b) 2, (c) 3, (d) 4, (e) 5 B chromosomes arrowed.

Table 3. Karyological data on helminth species of the Nematoda with occurrence of B chromosomes

Taxonomic position of helminth species ENOPLIDA Trichuridae Trichuris ovis

Trichuris globulosa SPIRURIDA Onchocercidae Onchocerca volvulus

2n + B

Morphology of Bs

Host species-Collection locality

References

6 (4 + XX/XY) or 6+2B 6 or 6 + 1–2 B

Ovis aries-South India

Goswami (1978)

Ovis aries, Capra hircus-Spain Capra hircus-South India

Valero et al. (1983)

6 (4 + XX/XY) or 6 + 1–2 B

very small element very small element very small element

8 (6 + XX/XY) or 8+1B

very small subtelocentric (?)

Homo sapiens-Southern America, Venezuela

very small element

Homo sapiens-Central America, Guatemala Homo sapiens -West Africa

8 (6 + X X /X Y ) 8 (6 + XX/XY) or 8+1B

8 (6 + XX/XY)

Onchocerca gibsoni

226 84

Cytogenet Genome Res 106:222–229 (2004)

8 (6 + XX/XY) or 8+1B

very small element

Homo sapiens-West Africa, Mali and Sierra Leone Bos taurus-Australia

Goswami (1978)

Basánez et al. (1983), reinterpreted by Procunier and Hirai (1986) Hirai et al. (1985) Miller (1966), reinterpreted by Procunier and Hirai (1986) Post et al. (1989)

Post et al. (1989)

cies. Interestingly, 1 or 2 B chromosomes were present also in the dividing cells of T. ovis originating from Spain (Valero et al., 1983). Other nematodes carrying B chromosomes include 2 spirurid parasites, an agent of human onchocerciasis Onchocerca volvulus and the bovine parasite O. gibsoni (Table 3). Individuals of O. volvulus have been isolated from patients in four geographically distant regions. B chromosomes were found in parasites from South America and West Africa and were absent in worms from Central America and another part of West Africa. Out of five other congeneric species investigated, only the karyotype of O. gibsoni from Australia included 1 B chromosome (Post et al., 1989). In all cases, Bs represent the smallest elements of the complement.

Discussion It has been estimated that supernumerary chromosomes occur in 10–15 % of all eukaryotic organisms (Bell and Burt, 1990). As shown in this paper, karyologically poorly known animal groups like parasitic helminths have rarely been documented as carriers of supernumerary chromosomes. Numbers of species with Bs relative to the approximate numbers of cytogenetically studied species within respective helminth groups ranged from 0 to 7.7 %. The vast majority of data on helminth karyotypes were derived from investigations of conventionally stained slides of either mitotic and/or meiotic cell divisions. Thus, there is an apparent lack of more detailed characteristics of B chromosomes regarding their micro- and ultrastructure or detailed behaviour during mitotic and meiotic divisions. Some authors reported the “heteropycnotic” nature of conventionally stained B chromosomes but, however, only the B chromosome in the dioecious schistosome T. regenti (2n = 14 + ZZ/ZW + 0– 2 B) has been studied in detail. In this species the B is similar to the W sex chromosome in its size and heterochromatin structure, but differed in centromere position (Sˇpakulova´ et al., 2001). To summarize, B chromosomes have been found both in hermaphroditic digenetic flukes, in the above mentioned schistosome T. regenti with a ZZ/ZW sex chromosome pair, as well as in dioecious acanthocephalans and nematodes with an XX/ X0 and XX/XY sex determination mechanism. Therefore, the data are insufficient to discuss any hypothesis regarding the origin of B chromosomes within various helminth groups. In spite of the scarcity of data, a discussion on the possible relation between extreme environmental conditions and the occurrence of Bs has been expressed several times (Petkevicˇiu¯te˙ and Barsˇiene˙, 1988; Barsˇiene˙, 1993; Sˇpakulova´ et al., 2002). For example, carrier populations of two fluke species Notocotylus sp. and A. fuligulae originated from intermediate snail hosts from extremely cold conditions of utmost north of Chukotka (Barsˇiene˙ et al., 1990; Barsˇiene˙, 1993). In this context, a hypothesis that increasing chromosome numbers represented an adaptive process was proposed (Barsˇiene˙, 1993). Unfortunately, there exist no comparative karyological data within these species to test this. Populations of the digenean flukes N. ephemera and E. revolutum possessing B chromosomes came from the highly pol-

luted aquatic environment of the cooling basin of a Lithuanian hydroelectric power station (Petkevicˇiu¯te˙ and Barsˇiene˙, 1988; Barsˇiene˙ and Kisiliene˙, 1991). Four other geographical populations of E. revolutum originating from relatively unpolluted conditions did not have Bs (see Table 1). Barsˇiene˙ (1993) speculated that Bs in these worms could likely appear as a result of the mutagenic effect of pollutants present in the basin, a phenomenon which was also apparent in the high level of aberrant chromosome complements of the host water snails (Petkevicˇiu¯te˙ and Barsˇiene˙, 1988). However, other mechanisms influencing the occurrence of supernumerary chromosomes in fluke populations may also exist since populations of N. ephemera (and other trematodes) from presumably “unpolluted” sites occurred either with or without Bs. Hypothetically, one of these possible influences on B presence in trematodes might be an intense asexual multiplication of larvae occurring regularly during the intramolluscan part of the life cycle (asexual polyembryonic endomitosis). Correspondingly, a correlation of B chromosome occurrence with the asexually reproducing parthenogenetic lineages of the freshwater flatworm Polycelis nigra has been shown by Beukeboom (1994), and a hypothesis on the increased tolerance of parthenogenetic genomes to aneuploidy has been stated. Even though the intramolluscan multiplication of trematode individuals is not through parthenogenetic mechanisms, a similar trend is hypothesized but much more data are required for its confirmation. A possible correlation between B chromosomes and unfavourable environments seems to be additionally supported by the finding of Bs in the fish acanthocephalan A. lucii, originating from a heavily polluted water basin in Slovakia (see Table 3; Sˇpakulova´ et al., 2002). In contrast, a distant population of A. lucii from Bulgaria possessed no supernumerary chromosomes (Mutafova et al., 1997). A parallel study revealed that tissues of B carrier A. lucii specimens contained excess levels of mutagenic elements (cadmium, arsenic and lead) in concentrations 16, 60 and 85 times higher than those in the liver of the host fish (Turcˇekova´ et al., 2002). The ability of thorny-headed worms and some platyhelminthes to accumulate and very probably also tolerate extraordinary amounts of bivalent elements including heavy metals has been shown many times (reviewed in Barusˇ et al., 2001). Environmental factors have been thought to facilitate an increased occurrence of chromosomal rearrangements, which have been assumed to give rise to supernumeraries in some mammals (Baker et al., 1996). Many investigators have argued for a higher prevalence of animal and plant populations possessing B chromosomes in regions providing most favourable living conditions for the host species (Jones and Rees, 1982; Bell and Burt, 1990). For instance, Zima et al. (1999) detected lower numbers of B chromosomes in populations of a yellow-necked mouse Apodemus flavicollis in a polluted industrial and mining area in comparison with the region without environmental mutagenic impact. A proper interpretation of the occurrence of B chromosomes in various helminth species thus requires a much broader karyological study of natural populations derived from ecologically defined localities.

Cytogenet Genome Res 106:222–229 (2004)

227 85

In summary, three major phyla of helminth parasites do not show close phylogenetic relationships. Within these groups, B chromosomes have been described from samples collected world-wide, and in members of fairly unrelated families including roundworms of Trichuridae and Onchocercidae, and flukes

of Strigeidae and Echinostomatidae (DeLey and Blaxter, 2002; Olson et al., 2003). Therefore, this is compatible with the hypothesis that supernumerary elements can very probably occur in all living taxa and in all parts of the world (Beukeboom, 1994).

References Amin OM: Classification, in Crompton DWT, Nickol BB (eds): Biology of the Acathocephala, pp 27–72 (Cambridge University Press, Cambridge 1985). Baker RJ, Hamilton MJ, Bussche van den RA, Wiggins LE, Sugg DW, Smith MH, Lomakin MD, Gaschak SP, Bundova EG, Rudenskaya GA, Chesser RK: Small mammals from the most radioactive sites near the Chernobyl nuclear power plant. J Mammal 77:155–170 (1996). Barsˇiene˙ J: The chromosome set of Apatemon minor and A. sp. (Trematoda) with description of tetraploid enbryos. Angew Parasitol 32:87–92 (1992). Barsˇiene˙ J: The Karyotypes of Trematodes (Academia, Vilnius 1993). Barsˇiene˙ J, Grabda-Kazubska B: Chromosomes sets of Diplodiscus subclavatus (Goeze, 1782) and Notocotylus noyeri Joyeux, 1922 (Trematoda). Acta Parasitol Pol 36: 59–61 (1991). Barsˇiene˙ J, Kisiliene˙ V: Karyological studies of trematodes within the genus Echinostoma. Acta Parasitol Pol 36:23–29 (1991). Barsˇiene˙ J, Petkevicˇiu¯te˙ R, Stanevicˇiu¯te˙ G, Orlovskaja OM: Karyologial investigation of trematodes of the families Notocotylidae, Echinostomatidae and Strigeidae of Northwestern Chukotka. Parazitologiya 24:3–11 (1990). Barusˇ V, Tenora F, Kra´cˇmar S, Prokesˇ: Accumulation of heavy metals in the Ligula intestinalis plerocercoids (Pseudophyllidea) of different age. Helminthologia 38:29–33 (2001). Basa´nˇez MG, Botto C, Yarzabal L: Caracteristicas du un deme de Onchocerca volvulus s.l. del alto Orinoco (Teritorio Federal Amazonas, Venezuela). Estudio citogenético preliminar, in Proicet Amazonas (ed): Las Filariasis Humanas en la Teritorio Federal Amazonas (Venezuela), pp 79–82 (Caracas Pu´blico Cientı´fico 2, 1983). Bell G, Burt A: B-chromosomes: germ-line parasites which induce changes in host recombination. Parasitology 100:S19–S26 (1990). Bell AS, Sommerville C, Gibson DI: Karyological studies on three strigeid digeneans: Ichthyocotylurus erraticus (Rudolphi, 1809), I. variegatus (Creplin, 1825) and Apatemon gracilis (Rudolphi, 1819). Syst Parasitol 41:169–178 (1998). Benazzi M, Benazzi Lentati G: Platyhelminthes, in John B (ed): Animal cytogenetics I, pp 1–182 (Gebrüder Borntraeger, Berlin 1976). Beukeboom LW: Bewildering Bs: an impression of the 1st B-chromosome Conference. Heredity 73:328– 336 (1994). Boveri T: Über Differenzierung der Zellkerne während der Furchung des Eies von Ascaris megalocephala. Anat Anz 2:688–693 (1887). Coomans A: Present status and future of nematode systematics. Nematology 4:573–582 (2002). Cribb TH, Bray RA, Littlewood DTJ, Pichelin SP, Herniou EA: The Digenea, in Littlewood DTJ, Bray RA (eds): Interrelationships of the Platyhelminthes, pp 168–193 (Taylor and Francis, London 2001). Crompton DWT: Reproduction, in Crompton DWT, Nickol BB (eds): Biology of the Acathocephala, pp 213–271 (Cambridge University Press, Cambridge 1985).

228 86

DeLey P, Blaxter M: Systematic position and phylogeny, in Lee DL (ed): The Biology of Nematodes (Taylor and Francis, London 2002). de Meeu¯s T, Renaud F: Parasites within the new phylogeny of eucaryotes. Trends Parasitol 18:247–251 (2002). Dorris M, De Ley P, Blaxter ML: Molecular analysis of nematode diversity and the evolution of parasitism. Parasitol Today 15:188–193 (1999). Goday C, Pimpinelli S: Centromere organization in meiotic chromosomes of Parascaris univalens. Chromosoma 98:160–166 (1989). Goday C, Pimpinelli S: The occurrence, role and evolution of chromatin diminution in nematodes. Parasitol Today 9:319–322 (1993). Golvan YJ: Nomenclature of the Acanthocephala. Res Rev Parasitol 54:135–205 (1994). Goswami U: Some cytogenetical aspects of genus Trichuris (Nematoda). Curr Sci 47:368–371 (1978). Hirai H, LoVerde PT: FISH techniques for constructing physical maps on schistosome chromosomes. Parasitol Today 11:310–314 (1995). Hirai H, LoVerde PT: Identification of the telomeres on Schistosoma mansoni chromosomes by FISH. J Parasitol 82:511–512 (1996). Hirai H, Sakaguchi Y, Tada I: Chromosomes of Onchocerca volvulus and O. gutturosa. Z Parasitenk 71:135–139 (1985). Jones AW: Studies in cestode cytology. J Parasitol 31:212–234 (1945). Jones RN, Rees H: B Chromosomes (Academic Press, London 1982). Lo Verde PT, Frederiksen DW: The chromosomes of Cotylogaster occidentalis and Cotylaspis insignis (Trematoda: Aspidogastrea) with evolutionary considerations. Proc Helm Soc Wash 45:158–161 (1978). Miller MJ: Observations on spermatogenesis in Onchocerca volvulus and Wuchereria bancrofti. Can J Zool 44:1003–1006 (1966). Müller F, Tobler H: Chromatin diminution in the parasitic nematodes Ascaris suum and Parascaris univalens. Int J Parasitol 30:391–399 (2000). Mutafova T: Meiosis and some aspects of cytological mechanisms of chromosome sex determination in nematode species. Int J Parasitol 25:453–462 (1995). Mutafova T, Kanev I: On the Echinostoma revolutum (Frölich, 1802) and Echinostoma echinatum (Zeder, 1803) (Trematoda: Echinostomatidae) karyotypes. Khelmintologiya 22:37–40 (1986). Mutafova T, Nedeva I, Kanev I: Chromosomes of Acanthocephalus lucii. J Helminthol 71:261–262 (1997). Mutafova T, Vasilev I, Kanev I: Comparative karyological studies of representatives of the genera Notocotylus Diesing, 1839 and Catatropis Odhner, 1905 (Trematoda: Notocotylidae). Khelmintologiya 29: 41–48 (1991). Mutafova T, Sˇpakulova´ M, Kanev I: Cytological investigation on Diplodiscus subclavatus (Trematoda, Diplodiscidae) from two geographic regions. Helminthologia 31:139–141 (1994).

Cytogenet Genome Res 106:222–229 (2004)

Mutafova T, Sˇpakulova´ M, Kanev I: A comparative cytogenetical analysis of two Notocotylus ephemera populations (Digenea, Notocotylidae). Helminthologia 32:229–231 (1995). Olson PD, Cribb TH, Tkach VV, Bray RA, Littlewood DTJ: Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). Int J Parasitol 33: 733–755 (2003). Park G-M, Im K, Huh S, Yong T-S: Chromosomes of the liver fluke, Clonorchis sinensis. Korean J Parasitol 38:201–206 (2000). Poulin R, Morand S: The diversity of parasites. Quart Rev Biol 75:277–293 (2000). Petkevicˇiu¯te˙ R: Chromosomes of Aspidogaster conchiola. J Helminthol 75:295–297 (2001). Petkevicˇiu¯te˙ R, Barsˇiene˙ J: The comparative karyological analysis of three species of trematodes of genus Notocotylus. Parazitologiya 22:21–28 (1988). Petkevicˇiu¯te˙ R, Regel KV: Karyometrical analysis of Microsomacanthus spasskii and M. spiralibursata. J Helmintol 68:53–55 (1994). Petkevicˇiu¯te˙ R, Stanevicˇiu¯te˙ G: Karyotypic characterization of Apatemon gracilis. J Helminthol 73:73– 77 (1999). Petkevicˇiu¯te˙ R, Barsˇiene˙ J, Mazˇeika V: Cytogenetic characteristics of Notocotylus noyeri Joyeux, 1922 (Trematoda, Notocotylidae). Acta Parasitol Lithuan 23:93–98 (1989a). Petkevicˇiu¯te˙ R, Stanevicˇiu¯te˙ G, Stenˇko RP: Cytogenetic analysis of two populations of Diplodiscus subclavatus (Goeze, 1782) (Trematoda, Plagiorchiidae). Parazitologiya 23:489–495 (1989b). Petrochenko VI: Acanthocephala of Domestic and Wild Animals, Vol I (Moskva: Izd Akad Nauk SSSR, 1956). Post RJ, McCall PJ, Trees CJ, Delves CJ, Kouyate B: Chromosomes of six species of Onchocerca (Nematoda: Filarioidea). Trop Med Parasit 40:292–294 (1989). Poulin R: How many parasite species are there: are we close to answers? Int J Parasitol 26:1127–1129 (1996). Poulin R, Morand S: The diversity of parasites. Quart Rew Biol 75:277–293 (2000). Procunier WS, Hirai H: The chromosomes of Onchocerca volvulus. Parasitol Today 2:307–309 (1986). Rohde K: Structure and development of Lobatostoma manteri sp. nov. (Trematoda: Aspidogastrea) from the great Barrier Reef, Australia. Parasitology 66:63–83 (1973). Rohde K: Chromosomes of Kuhnia scombri and K. sprostonae (Monogenea, Polyopisthocotylea, Mazocraeidae). Acta Parasitol 39:117–119 (1994). Rohde K: The Aspidogastrea: an archaic group of Platyhelminthes, in Littlewood DTJ, Bray RA (eds): Interrelationships of the Platyhelminthes, pp 159– 167 (Taylor and Francis, London 2001). Short RB: Presidental Address. Sex and the single schistosome. J Parasitol 69:3–22 (1983). Sˇpakulova´ M, Hanzelova´ V: Cytogenetics of cestodes. Helminthologia 34:188 (1997). Sˇpakulova´ M, Hora´k P, Müller V: The karyotype of Trichobilharzia franki Müller et Kimmig, 1994 (Digenea: Schistosomatidae), a new European agent of swimmer’s itch. Parasite 4:63–66 (1997).

Sˇpakulova´ M, Hora´k P, Dvorˇa´k J: The karyotype of Trichobilharzia regenti Hora´k, Kola´rˇova´ et Dvorˇa´k, 1998 (Digenea: Schistosomatidae), a nasal avian schistosome in Central Europe. Parasitol Res 87:479–483 (2001). Sˇpakulova´ M, Kra´l’ova´ I, Cutillas C: Studies on the karyotype and gametogenesis in Trichuris muris. J Helmintol 68:67–72 (1994). Sˇpakulova´ M, Casanova JC, Laplana GN: A karyological study of the spirurid nematode Mastophorus muris (Nematoda: Spirocercidae). Parasite 7:173– 177 (2000). Sˇpakulova´ M, Kra´l’ova´-Hromadova´ I, Dudinˇa´k V, Reddy PV: Karyotype of Acanthocephalus lucii: the first record of supernumerary chromosomes in thormy-headed worms. Parasitol Res 88:778–780 (2002).

Stanevicˇiu¯te˙ G, Kisiliene˙ V: Chromosome studies of Ichthyocotylurus platycephalus (Creplin, 1825) Odening 1969 with description of triploid variant and comparative karyology of the genus Ichthyocotylurus. Parasite 8:137–145 (2001). Triantaphyllou AC: Cytogenetic aspects of nematode evolution, in Stone AR, Platt HM, Khalil LF (eds): Concepts of Nematode Systematics, pp 55–71, Syst Assoc Special Vol 22 (Academic Press, New York 1983). Turcˇekova´ L’, Hanzelova´ V, Sˇpakulova´ M: Concentration of heavy metals in perch and its endoparasites in the polluted water reservoir in Eastern Slovakia. Helminthologia 39:23–28 (2002). Valero A, Pretel A, Romero J: Estudio citogenetico comparativo de Trichuris suis (Schrank, 1788) y Trichuris ovis (Abildgaard, 1795) (Nematoda). Rev Iber Parasitol 43:51–59 (1983).

van Beneden E: Recherches sur la maturation de l’oeuf et la fécondation. Arch Biol 4:265–641 (1883). Vijayaraghavan S, Subramanyam S: The chromosomes of Nematotaenia dispar. Riv Parasitol 41:371–375 (1980) Windsor DA: Most of the species on Earth are parasites. Int J Parasitol 28:1939–1941 (1998). Zima J, Ieradi LA, Allegra F, Sartoretti A, Wlosokova´ E, Cristaldi M: Frequences of B chromosomes in Apodemus flavicollis are not directly related to mutagenetic environmental effects. Folia Zool 48: 115–119 (1999). Zrzavy´ J: The interrelationships of metazoan parasites: a review of phylum- and higher level hypotheses from recent morphological and molecular analyses. Folia Parasitol 48:81–103 (2001).

Cytogenet Genome Res 106:222–229 (2004)

229 87

Review on B Chromosomes Cytogenet Genome Res 106:230–234 (2004) DOI: 10.1159/000079292

B chromosomes in the fish Astyanax scabripinnis (Characidae, Tetragonopterinae): An overview in natural populations O. Moreira-Filho, P.M. Galetti Jr. and L.A.C. Bertollo Universidade Federal de Sa˜o Carlos, Departamento de Genética e Evoluça˜o, Sa˜o Carlos, SP (Brazil)

Abstract. Astyanax scabripinnis, a small neotropical freshwater fish, is a headwater species living in small tributaries of many Brazilian rivers, where they form isolated populations. This species harbors a B chromosome system in several populations. Among the several kinds of Bs reported in this species, the BM variant, a large metacentric of a similar size to the largest A chromosome, is the most widespread in natural populations. It probably corresponds to the ancestral B type in this species and a very similar B chromosome is also found in other Astyanax species. Strong evidence suggests that this B is an isochromosome showing structural and functional homology between its two arms, as shown by satellite DNA localization

A. scabripinnis: a species complex Fish are one of the most numerous and diverse groups of vertebrates, with approximately 25,000 species inhabiting almost all aquatic environments, and showing a large variety of shapes and sizes (Nelson, 1994). A significant part of fish species is found in neotropical water systems (Vari and Malabarba, 1998). The Characidae family is the most complex among the Characiformes order, with approximately 250 South American genera (Britski et al., 1986). This family comprises the majority

Supported by CNPq (Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico) and FAPESP (Fundaça˜o de Amparo à Pesquisa do Estado de Sa˜o Paulo). Received 15 September 2003; revision accepted 22 December 2003. Request reprints from Orlando Moreira-Filho, Universidade Federal de Sa˜o Carlos Departamento de Genética e Evoluça˜o, Caixa Postal 676 13.565-905 Sa˜o Carlos, SP (Brazil); telephone: +55-16-260-8309 fax: +55-16-260-8306; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0230$21.00/0

and the formation of a ring B univalent during meiosis. The BSM and Bm variants, a large submetacentric and a small metacentric, respectively, represent rare variants and may be derived from structural rearrangements of the BM chromosome. In addition, B microchromosomes (Bmicro) were found in some populations. Frequency analyses in mountain populations have shown that B chromosomes are found in populations located at high altitude, but are absent in populations at low altitude, which is consistent with their parasitic nature, given the ecological peculiarities of both kinds of populations. Copyright © 2004 S. Karger AG, Basel

of freshwater fishes in Brazil, with approximately 20 subfamilies and 400 species, varying considerably in size, weight, shape, feeding and behavior. Prominent in this group is the subfamily Tetragonopterinae, with a large number of species, usually small in size, from which the genus Astyanax represents the larger taxonomic unit (Géry, 1977). However, the number of Astyanax species is not yet well known. In a pioneer study, Eigenmann (1921) reported 74 neotropical species and/or subspecies. Meanwhile, Géry (1977) reported more than 62 species and subspecies in Brazilian water systems alone. Astyanax scabripinnis shows a wide geographic distribution, especially in the South and Southeast Brazilian regions. This fish species is restricted to headwaters of small streams, usually exploring the space right below marginal vegetations, which possibly enables this species to avoid competition with other sister groups from the same river (Caramaschi, 1986). Fowler (1948) described six A. scabripinnis subspecies in Brazilian rivers. However, many studies have indicated that A. scabripinnis may correspond to a species complex, as proposed by Moreira-Filho and Bertollo (1991). Indeed, populations at different places in the same or different hydrographic

Accessible online at: www.karger.com/cgr

basins can show specific diploid numbers (2n = 46, 48 and 50) as well as specific C-banding patterns. Similarly, the morphological analysis corroborates the differentiation among populations. In fact, six of the seven populations studied by MoreiraFilho and Bertollo (1991) could be clearly differentiated based on their karyotypical features and/or morphological characters. Subsequent studies reinforced the proposition that A. scabripinnis corresponds to a species complex, including the fact that no hybrids were found among specimens with different diploid chromosome numbers living in sympatry (Souza et al., 1995; Maistro et al., 1998; Mizoguchi and Martins Santos, 1998). The reason for this diversity might rest on the biological characteristics of this fish group. A. scabripinnis, a headwater species, can form small isolated populations with an independent evolutionary pathway and, as a result, distinct chromosomal rearrangements can be fixed among populations. LoweMcConnell (1969) emphasized that the absolute size of certain water systems is an important factor in the evolutionary process of fish, since it allows many species to evolve inside the same system, isolated at the headwaters of the tributaries, where interpopulational barriers can be physical, chemical or even biotic.

B chromosomes in Astyanax scabripinnis The first descriptions of B chromosomes in A. scabripinnis started at the beginning of the 1990s. Salvador and MoreiraFilho (1992), analyzing a local population from Campos do Jorda˜o (city in the highlands of the Serra da Mantiqueira, state of Sa˜o Paulo, Brazil), found a diploid number 2n = 50 plus one large metacentric B (BM), similar in size and morphology to the first chromosome pair in the karyotype. This chromosome was present in approximately 87 % of the specimens analyzed, remaining constant in all cells of its carriers. In a single female specimen, two B chromosomes showed different C-banding patterns, one of them being completely darkly C-banded and the other being only partially C-banded (Salvador and MoreiraFilho, 1992). The same year, a BM chromosome was also identified in another population of A. scabripinnis from the Botucatu (city in the state of Sa˜o Paulo, Brazil) region, which was found only in females, being completely heterochromatic and with a late replication pattern (Maistro et al., 1992). Indeed, the analysis of three other populations, also in the Campos do Jorda˜o region (Vicente et al., 1996), showed that the BM chromosome was more frequent in females, which was also supported by later results (Néo et al., 2000b; Ferro et al., 2003). Although the BM variant shown in Fig. 1a is the most frequently found, other C-banding patterns have occasionally been found (Fig. 1b; see Vicente, 1994). In addition, heterochromatic B microchromosomes (Bmicro; see Fig. 1a) were found at four populations of A. scabripinnis from different regions and hydrographic basins, with 1–4 Bs restricted either to males or to females, depending on the population (Rocon-Stange and Almeida-Toledo, 1993; Mizoguchi and Martins-Santos, 1997). Besides the BM and Bmicro variants, other B chromosomes have been identified in A. scabripinnis (Fig. 1a), i.e., a large het-

Fig. 1. (a) Proposed origins for the distinct B chromosome forms found in Astyanax scabripinnis: BM and Bmicro correspond to isochromosomes derived from the 24th chromosome of the standard karyotype; BSM and Bm are secondary forms originated by chromosomal rearrangements, such as pericentric inversion and deletions, respectively. The gray regions on the chromosomes correspond to heterochromatic segments; the dark signals correspond to the location of the As51 satellite DNA. (b) Some BM chromosome patterns revealed by C-banding.

erochromatic submetacentric (BSM), similar in size to the BM form, and a small heterochromatic metacentric (Bm), being smaller than the previous one (Néo et al., 2000a, b). Both BSM and Bm chromosomes are not frequently found in populations (Table 1). Furthermore, natural triploidy along with BM chromosomes has spontaneously been observed in three A. scabripinnis specimens, two of them characterized by 2n = 3× = 75 + 2B (Fauaz et al., 1994; Maistro et al., 1994b) and one by 2n = 3× = 75 + 1B (Maistro et al., 1994b), respectively.

B chromosomes in the Astyanax genus The BM chromosome is a karyotypic feature found in different A. scabripinnis populations belonging to different hydrographic basins (Table 1) some of them located more than 600 km away. In addition, the occurrence of this same chromosome in populations with 2n = 46, 48 and 50 chromosomes demonstrates that the BM chromosome might predate the karyotypic diversification of the group, i.e. the origin of the A. scabripinnis species complex. A similar BM chromosome has been found in other three species of the same genus, A. eigenmanniorum (Stripecke et al., 1985), A. fasciatus and A. schubarti (Moreira-Filho et al., 2001). In contrast to A. scabripinnis, its occurrence in these species is sporadic and observed only in a few populations. Nevertheless, the sharing of this B variant by four Astyanax species suggests

Cytogenet Genome Res 106:230–234 (2004)

231 89

Table 1. Distribution and frequency of B chromosomes and chromosomal data in Brazilian Astyanax scabripinnis populations Collection sitesa

Ref.b

2nc

FNd

Frequency of B chromosomese BM [%]

Grande river basin

Córrego das Pedras (CJ) Córrego das Pedras (CJ) Córrego das Pedras (CJ) Córrego das Pedras (CJ) Córrego das Pedras (CJ) Ribeirão das Perdizes (CJ) Ribeirão do Casquilho (CJ) Ribeirão Capivari (CJ) Ribeirão do Fojo (CJ) Lago da Carpas (CJ)

Paraíba do Sul river basin

Rio Piracuama (CJ) Ribeirão Grande: altitude 1,920m (CJ) Ribeirão Grande: altitude 1,800m (CJ) Córrego Lavrinha (CJ)

1 4 2 3 5 4 4 6 6 6 15 16, 17 16, 17 7

BSM [%]

Bm [%]

Nf

Rangeg

Bmicro [%]

50 50 50 50 50 50 50 50 50 50

88 88 88 88 88 88 88 88 88 88

87 76 75 ? 52 23 39 58 41 57

– – – – – – – – 7 7

– – – – – – – – 2 –

– – – – – – – – – –

32 92 74 86 29 31 31 41 41 30

0–2 0–2 0–2 0–1 0–2 0–2 0–1 0–2 0–2 0–2

50 50 50 50

86 88 88 88

10 47 19 48

– 3 2 8

– 2 – –

– – – –

10 77 61 40

0–1 0–2 0–1 0–1

Paranaíba river basin

Córrego Jataí

7

50

78

–

–

–

?

?

0–4

Tietê river basin

Córrego Cascatinha (Bt) Córrego Cascatinha (Bt) Rio Araquá (Bt) Rio Lavapés (Bt)

8 9 10 13

50 50 50 50

90 90 88 90

18 66 30 ?

– – – –

– – – –

– – – –

16 65 27 12

0–1 0–1 0–1 0–1

Paranapanema river basin

Rio Água do Rancho Rio Pardo-population 1 (Bt) Rio Pardo-population 2 (Bt) Córrego Água Madalena (Bt)

11, 19 12 12 13

50 50 46 46

84 88 84 78

– ? ? 6

– – – –

– – – –

24 – – –

38 ? ? 17

0–2 0–1 0–1 0–1

Ivaí river basin

Riacho São Domingos Rio Yucatán

14 11, 19

48 50

86 82

– 14

– –

– –

14 –

14 36

0–1 0–1

Leste basin

Rio Jucu

18

50

64

–

–

–

57

55

0–4

a

CJ: Campos do Jordão region; Bt: Botucatu region. Ref.: References: 1. Salvador and Moreira Filho, 1992; 2. Fauaz et al., 1994; 3. Maistro et al., 1994b; 4. Vicente et al., 1996; 5. Mestriner et al., 2000; 6. Ferro et al., 2003; 7. Araujo and Morelli, 2000; 8. Maistro et al., 1994a; 9. Porto-Foresti et al., 1997; 10. Maistro et al., 1992; 11. Mizoguchi and Martins-Santos, 1997; 12. Vieira et al., 1998a; 13. Vieira et al., 1998b; 14. Alves and Martins-Santos, 2002; 15. Souza and Moreira-Filho, 1995; 16. Néo et al., 2000a; 17. Néo et al., 2000b; 18. Rocon-Stange and AlmeidaToledo, 1993; 19. Mizoguchi, 1996. c 2n: diploid number. d FN: fundamental number. e BM: large metacentric B chromosome; BSM: large submetacentric B chromosome; Bm: small metacentric B chromosome; Bmicro: B microchromosome; ?: presence of B chromosomes but frequency not scored. f N: number of individuals analyzed; ?: number of individuals not provided. g Range: number of B chromosomes. b

an early origin for this chromosome, probably preceding the species differentiation (Moreira-Filho et al., 2001), although the molecular analysis of these Bs is needed to test this hypothesis.

The origin of B chromosomes in A. scabripinnis As previously stated, the large metacentric (BM) is the B chromosome variant most commonly found in A. scabripinnis, occurring in different populations and hydrographic basins, and might be the ancestral B in this species (Néo et al., 2000a). Several evidences suggest that BM corresponds to an isochromosome, as initially proposed by Dias (1994), and probably derived from the acrocentric 24th chromosome of the standard karyotype (Vicente et al., 1996). Indeed, Mestriner et al. (2000) demonstrated that the structural and functional features of the BM chromosome strongly support the hypothesis that it is in fact an isochromosome. Using fluorescence in situ hybridiza-

232 90

Cytogenet Genome Res 106:230–234 (2004)

tion it was demonstrated that a repetitive DNA, with about 51 bp and 59 % AT-rich (As51) obtained from digestion of genomic DNA with KpnI, is particularly located in the terminal region of some acrocentric chromosomes, in the NOR region and in the interstitial heterochromatin of chromosome 24. Most significantly, tandem repeats of this DNA lay almost symmetrically on the two arms of the BM chromosome, indicating their structural homology. Analysis of the synaptonemal complexes (SCs) in males carrying one BM chromosome clearly showed the occurrence of 26 SCs perfectly paired, 25 of them corresponding to chromosomes of the standard complement (2n = 50) and the remaining one corresponding to the autopaired BM chromosome, which demonstrates functional homology between both arms. Complementary data on conventional meiosis showed that the univalent BM forms a ring configuration that persists until metaphase I, suggesting the existence of a distal chiasma between the two arms (Mestriner et al., 2000). It is possible that this autopairing of the B univalent, and subsequent unequal exchange, could be associated with the

appearance of the different C-banding patterns observed in the BM chromosome (Néo et al., 2000a). DNA sequences shared by A and B chromosomes of a given species support the intraspecific origin of the Bs, which seems to be the case for A. scabripinnis. Chromosome 24 represents a strong candidate from which the BM chromosome might have originated, considering that this is the only chromosome of the karyotype that presents an interstitial C-band (Vicente et al., 1996), which contains the As51 repetitive DNA which is also interstitially located in both B arms, although these data should not be considered conclusive (Mestriner et al., 2000). The alternative proposition that the BM chromosome might have originated from meiotic non-disjunction of the first metacentric pair of the karyotype, considering the similarities of shape and size of these chromosomes, followed by a complementary heterochromatinization (Salvador and Moreira-Filho, 1992), is not supported by chromosome banding data (Maistro et al., 1999; Ferro et al., 2003). Considering the proposition that the 24th chromosome represents the probable B chromosome ancestor, Néo et al. (2000a) stated that centromeric misdivision of that chromosome, followed by chromatid non-disjunction, could give rise to the BM and Bmicro chromosomes simultaneously (Fig. 1a). In this case, we should expect the simultaneous presence of both B types in the same population. However, as Table 1 shows, neither of the four populations where the Bmicro was found showed the presence of BM. Thus, it is also probable that both B variants are of independent origin. The observation that the Bmicro is found only in a few populations of A. scabripinnis (RoconStange and Almeida-Toledo, 1993; Mizoguchi and MartinsSantos, 1997) might suggest a low transmission rate. In addition, the BSM and Bm chromosomes may represent variants resulting from chromosomal rearrangements in the B chromosomes themselves (Fig. 1a). In fact, the average size of BM and BSM chromosomes is very similar, whereas the average size of the Bm chromosome is more than 50 % smaller (Ferro et al., 2003). These observations suggest the origin of the BSM variant by means of a pericentric inversion of the BM chromosome, and the Bm one from deletions in BM or BSM chromosomes (Fig. 1a). The low frequency of BSM and Bm (Table 1) suggests that either these variants are of recent origin (Ferro et al., 2003), or else they do not show much drive.

B chromosome distribution in A. scabripinnis B chromosomes have already been found in 21 populations of A. scabripinnis, from different places and hydrographic basins (Table 1). The BM chromosome was present in 17 of these populations, whereas the Bmicro was found in only four populations where it was exclusive. On the other hand, the BSM and Bm variants were only found in populations from the Campos do Jorda˜o region (Table 1). Some basins where the populations were sampled have been isolated for millions of years and some places are separated by hundreds of kilometers. In fact, although A. scabripinnis is widely distributed in the main Brazilian rivers, cytogenetic studies have been more focused on the Southeast and part of the South Brazilian regions.

Particularly interesting data have been obtained in the Campos do Jorda˜o region. Environmental characteristics contribute to a low water temperature and major level differences in many streams, resulting in waterfalls that can impair gene flow among populations. It is significant that, along the same stream, B chromosomes are present in populations of high altitude but absent in those located at lower altitude (Néo et al. 2000b). The best explanation for these results is provided by the parasitic model (Néo et al., 2000b), according to which B chromosomes are considered genome parasites maintained in populations by drive mechanisms, even though they might be harmful to carrier individuals (for review, see Camacho et al., 2000). Under this model a higher frequency of Bs is expected in those places where the environmental conditions are more favorable to the species. In the case of A. scabripinnis, a headwater species, these places would be high altitude ones, as they are closer to the headwater streams. Therefore, in such places, ecological conditions allow a higher tolerance to the parasitic Bs, in contrast to the lowest places, which are away from water sources and where higher predation and interspecific competition would be present (Néo et al., 2000b).

Perspectives We have reviewed here the known features of B chromosomes in Astyanax scabripinnis, their presence, origin, frequency and distribution in natural populations. However, many approaches need complementary, further examinations so that the presence and meaning of B chromosomes for the species would be better understood. One of the issues still remaining refers to possible effects of B chromosomes on their carriers. So far no evidence for detectable phenotypic effects has been found. One interesting matter, which can be related to B chromosomes, is the NOR expression in A. scabripinnis. This species holds multiple nucleolar organizing regions, whose expression appears to behave according to altitude. Populations located in regions of low altitudes hold an average number of Ag-NORs higher than of those located in regions of higher altitudes (Ferro et al., 2001). Coincidently, highest populations are also B carriers, mainly the BM type, in contrast to lowest populations. Otherwise, specimens that are Bmicro carriers may present a large number of Ag-NORs (Rocon-Stange and Almeida-Toledo, 1993; Mizoguchi and Martins Santos, 1998), reaching up to a maximum of 15 (Rocon-Stange and Almeida-Toledo, 1993). It is known that NOR expression can be influenced by B chromosomes in grasshoppers (Cabrero et al., 1987; Camacho et al., 2000), but this question remains to be solved in A. scabripinnis. The occurrence of the As51 repetitive DNA in the BM variant, as well as in other chromosomes of the standard karyotype, was an important tool to infer the intraspecific origin of this B chromosome, as well as its isochromosomal nature. Would that repetitive DNA also be present in the variant BSM and Bm chromosomes found in some A. scabripinnis populations? If proven, this would be important evidence for the common origin of the different B variants, in resemblance to other B chromosome systems, e.g. that in the grasshopper

Cytogenet Genome Res 106:230–234 (2004)

233 91

Eyprepocnemis plorans (Cabrero et al., 1999). In addition, it would be interesting to analyze the presence of this type of repetitive DNA in the BM chromosomes found in other Astyanax species. This might provide new evidence for BM origin before the specific differentiation in this genus.

Acknowledgements We thank Dr. J.P.M. Camacho for his special support in the improvement of B chromosome studies in neotropical fish species, as well as for his suggestions and critical reading of the manuscript.

References Alves AL, Martins-Santos I: Cytogenetic studies in two populations of Astyanax scabripinnis with 2n = 48 chromosomes (Teleostei, Characidae). Cytologia 67:117–122 (2002). Araujo ACS, Morelli S: Estudo cariotı´pico da populaça˜o de Astyanax scabripinnis (Pisces, Characidae) da nascente do co´rrego Jataı´, Uberlândia-MG. Genet Mol Biol (Suppl) 23:60 (2000). Britski HA, Sato Y, Rosa ABS: Manual de identificaça˜o de peixes da regia˜o de Três Marias, com chaves de identificaça˜o para os peixes da Bacia do Sa˜o Francisco (Companhia do Desenvolvimento do Vale do Sa˜o Francisco – CODEVASF, Brası´lia 1986). Cabrero J, Alché JD, Camacho JPM: Effects of B chromosomes of the grasshopper Eyprepocnemis plorans on nucleolar organizer regions activity. Activation of a latent NOR on a B chromosome fused to an autosome. Genome 29:116–121 (1987). Cabrero J, Lo´pez-Leo´n MD, Bakkali M, Camacho JPM: Common origin of B chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity 83:435–439 (1999). Camacho JP, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B Biol Sci 355:163–178 (2000). Caramaschi EP: Distribuiça˜o da ictiofauna de riachos das bacias do Tietê e do Paranapanema, junto ao divisor de a´gua (Botucatu, SP). Doctoral Thesis, Universidade Federal de Sa˜o Carlos, Brazil (1986). Dias AL: Estudo do complexo sinaptonêmico de peixes Prochilodus lineatus (Prochilodontidae) e Astyanax scabripinnis (Characidae): ana´lises da sinapse dos cromossomos supranumera´rios. Doctoral Thesis, Universidade Federal de Sa˜o Carlos, Brazil (1994). Eigenmann CH: The American Characidae. Mem Mus Comp Zool 43:227–310 (1921). Fauaz G, Vicente VE, Moreira-Filho O: Natural triploidy and B chromosomes in the Neotropical fish genus Astyanax (Characidae). Braz J Genet 17: 157–163 (1994). Ferro DA, Néo DM, Moreira-Filho O, Bertollo LAC: Nucleolar organizing regions, 18S and 5S rDNA in Astyanax scabripinnis (Pisces, Characidae): populations distribution and functional diversity. Genetica 110:55–62 (2001). Ferro DA, Moreira-Filho O, Bertollo LAC: B chromosome polymorphism in the fish, Astyanax scabripinnis. Genetica 119:147–153 (2003). Fowler HW: Os peixes de a´gua doce do Brasil. Arq Zool 6:1–204 (1948). Géry J: Characoids of the World (TFH Publications, New Jersey 1977).

234 92

Lowe-McConnell RH: Speciation in tropical freshwater fishes. Biol J Linn Soc 1:51–75 (1969). Maistro EL, Foresti F, Oliveira C, Almeida-Toledo LF: Occurrence of macro B chromosome in Astyanax scabripinnis paranae (Pisces, Characiformes, Characidae). Genetica 87:101–106 (1992). Maistro EL, Foresti F, Oliveira C: New occurrence of a macro B chromosome in Astyanax scabripinnis (Pisces, Characiformes, Characidae). Braz J Genet 17:153–156 (1994a). Maistro EL, Dias AL, Foresti F, Oliveira C, MoreiraFilho O: Natural triploidy in Astyanax scabripinnis (Pisces, Characidae) and simultaneous occurrence of macro B-chromosomes. Caryologia 47:233–239 (1994b). Maistro EL, Oliveira C, Foresti F: Comparative cytogenetic and morphological analysis of Astyanax scabripinnis paranae (Pisces, Characidae, Tetragonopterinae). Genet Mol Biol 21:201–206 (1998). Maistro EL, Foresti F, Oliveira C: R- and G-bands patterns in Astyanax scabripinnis paranae (Pisces, Characiformes, Characidae). Genet Mol Biol 22:201–204 (1999). Mestriner CA, Galetti Jr PM, Valentini S, Ruiz IGR, Abel LDS, Moreira-Filho O, Camacho JPM: Structural and functional evidence that a B chromosome in the characid fish Astyanax scabripinnis is an isochromosome. Heredity 85:1–9 (2000). Mizoguchi SMHN: Estudos citogenéticos e morfométricos em populaço˜es de Astyanax scabripinnis (Pisces, Characidae). MSc Dissertation. Universidade Estadual de Maringa´, Brazil (1996). Mizoguchi SMHN, Martins-Santos IC: Macro- and microchromosomes B in females of Astyanax scabripinnis (Pisces, Characidae). Hereditas 127:249– 253 (1997). Mizoguchi SMHN, Martins-Santos IC: Cytogenetics and morphometric differences in populations of Astyanax scabripinnis (Pisces, Characidae) from Maringa´ region, PR, Brazil. Genet Mol Biol 21:55– 61 (1998). Moreira-Filho O, Bertollo LAC: Astyanax scabripinnis (Pisces, Characidae): a species complex. Braz J Genet 14:331–357 (1991). Moreira-Filho O, Fenocchio AS, Pastori MC, Bertollo LAC: Occurrence of a metacentric macrochromosome B in different species of the genus Astyanax (Pisces, Characidae, Tetragonopterinae). Cytologia 66:59–64 (2001). Nelson JS: Fishes of the World (John Wiley and Sons, New York 1994).

Cytogenet Genome Res 106:230–234 (2004)

Néo DM, Bertollo LAC, Moreira-Filho O: Morphological differentiation and possible origin of B chromosomes in natural Brazilian populations of Astyanax scabripinnis (Pisces, Characidae). Genetica 108: 211–215 (2000a). Néo DM, Moreira-Filho O, Camacho JPM: Altitudinal variation for B chromosome frequency in the characid fish Astyanax scabripinnis. Heredity 85:136– 141 (2000b). Porto-Foresti F, Oliveira C, Maistro EL, Foresti F: Estimated frequency of B-chromosomes and population density of Astyanax scabripinnis paranae in a small stream. Braz J Genet 20:377–380 (1997). Rocon-Stange EA, Almeida-Toledo LF: Supernumerary B chromosomes restricted to males in Astyanax scabripinnis (Pisces, Characidae). Braz J Genet 16:601–615 (1993). Salvador LB, Moreira-Filho O: B chromosomes in Astyanax scabripinnis (Pisces, Characidae). Heredity 69:50–56 (1992). Souza IL, Moreira-Filho O: Cytogenetic diversity in the Astyanax scabripinnis species complex (Pisces, Characidae). I. Allopatric distribution in a small stream. Cytologia 60:1–11 (1995). Souza IL, Moreira-Filho O, Bertollo LAC: Cytogenetic diversity in the Astyanax scabripinnis species complex (Pisces, Characidae). II. Different cytotypes living in sympatry. Cytologia 60:273–281 (1995). Stripecke R, Nogueira-Pinto MT, Hackel C, Sazima I: O cario´tipo de Astyanax eigenmanniorum (Osteichthyes, Characidae), in XII Congresso Brasileiro de Zoologia (Campinas, Brazil 1985). Vari RP, Malabarba LR: Neotropical ichthyology: an overview, in Malabarba LR, Reis RE, Vari RP, Lucena AMS, Lucena CA (eds): Phylogeny and Classification of Neotropical Fishes (Edipucrs, Porto Alegre 1998). Vicente VE: Estudo do cromossomo B em três populaço˜es de Astyanax scabripinnis (Pisces, Characidae). MSc Dissertation. Universidade Federal de Sa˜o Carlos, Brazil (1994). Vicente VE, Moreira-Filho O, Camacho JPM: Sex ratio distortion associated to the presence of a B chromosome in Astyanax scabripinnis (Teleostei, Characidae). Cytogenet Cell Genet 74:70–75 (1996). Vieira MMR, Oliveira C, Foresti F: Estudos de conteu´do de DNA em populaço˜es de Astyanax scabripinnis (Pisces, Characidae) da regia˜o de Botucatu, SP. Braz J Genet (Suppl) 21:63 (1998a). Vieira MMR, Oliveira C, Foresti F: Padro˜es de bandeamento G em cromossomos de Astyanax scabripinnis (Pisces, Characidae) da regia˜o de Botucatu, SP. In VII Simpo´sio de Citogenética Evolutiva e Aplicada de Peixes Neotropicais – Londrina, PR. Abstracts, A-18 (1998b).

Review on B Chromosomes Cytogenet Genome Res 106:235–242 (2004) DOI: 10.1159/000079293

Structure and evolution of B chromosomes in amphibians D.M. Green Redpath Museum, McGill University, Montreal, Quebec (Canada)

Abstract. B chromosomes are known from 26 species of salamanders and frogs, equivalent to about 2 % of amphibian species that have been karyotyped. In most cases, the structure of amphibian B chromosomes has not been extensively investigated. The exceptions are the B chromosomes of Hochstetter’s frog, Leiopelma hochstetteri, from New Zealand, and the Coastal Giant salamander, Dicamptodon tenebrosus, from North America. Dicamptodon tenebrosus carries from 0 to 10 non-heterochromatic, telocentric B chromosomes per individual, averaging 0 to 3.4 B chromosomes per individual in populations throughout its extensive range. The B chromosomes of L. hoch-

stetteri occur in frequencies averaging from 0 to 11.4 per individual in different populations, with a known maximum of 15 B chromosomes. Amphibian B chromosomes vary in size, heterochromatin, occurrence and frequency. They are commensurate in size and structure with the rest of the A set of chromosomes of the same species in which they occur. The B chromosomes are at least partly composed of repetitive DNA sequences which exist in numerous copies throughout the autosomes, in conformity to an hypothesis of intraspecific B chromosome origins.

B chromosomes have been described from 26 species of salamanders and frogs, comprising some 2 % of the ca. 1,300 species whose chromosomes have been studied in some fashion (Table 1). There seems to be no particular pattern to their occurrence among the approximately 5,000 known species of amphibians as B chromosomes occur in species from three of the nine extant families of salamanders and five of the 28 living families of frogs. B chromosomes are unknown among caecilians, but little is known in detail about the chromosomes of these tropical, burrowing amphibians in general (Nussbaum, 1991). There have been few additional reports of B chromo-

somes among amphibians since I previously reviewed their occurrence and biology over a decade ago (Green, 1991). Only a further three species of frogs have been discovered to possess B chromosomes since 1991 (Table 1): two species from the family Hylidae (Baldissera et al., 1993; Schmid et al., 2002) and one from the family Leptodactylidae (Rosa et al., 2003). Most B chromosomes are rare and, as with most reports of B chromosomes in other organisms, usually no more than the number occurring in a few specimens of any particular species of amphibian is available to provide information on occurrence. Likewise, for most species of amphibians with B chromosomes, investigations into the structure of these enigmatic genomic elements have not been extensive, being limited usually to conventional chromosome banding methods. However, there is extensive information on occurrence for the B chromosomes of both Hochstetter’s frog, Leiopelma hochstetteri, from the North Island and Great Barrier Island of New Zealand, and the Coastal Giant salamander, Dicamptodon tenebrosus, from the Pacific coast of North America. In both these species, B chromosomes are in high abundance and wide occurrence, and there has been considerable study of the structure of their B chromosomes down to the molecular level.

This has been written in memory of Jim Kezer, ardent pursuer of truth and beauty via the chromosomes of amphibians. Supported by a grant from NSERC Canada. Received 29 October 2003; revision accepted 3 December 2003. Request reprints from David M. Green, Redpath Museum, McGill University 859 Sherbrooke Street West, Montreal, Quebec H3A 2K6 (Canada) telephone: +1 514 398 4086, ext 4088; fax: +1 514 398 3185 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0235$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. B chromosomes among amphibian families and species

Taxon

2n

Max. no. of Bs

Morphologies among Bs

Reference(s)

Caudata (salamanders) Dicamptodontidae Dicamptodon tenebrosus

28

10

1

Sessions, 1984; Green, 1991; Brinkman et al., 2000

28

1

1

Green, 1991

26

2

1

C. chiropterus C. dimidiatus

26 26

7 1

1 1

C. lavae C. sp. Dendrotriton rabbi Lineatriton lineola Oedipina poelzi

26 26 26 26 26

? ? 1 1 2

1 1 1 1 1

O. uniformis Nototriton picadoi Pseudoeurycea rex

26 26 26

8 4 1

1 1 1

26 26 26 26

1 1 1 1

1 1 1 1

Sessions, 1984; Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions, 1984; Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions, 1984; Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions, 1984; Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions and Kezer, 1991 Sessions and Kezer, 1991

15

3

Green, 1988, 1994; Green et al., 1987, 1993; Sharbel et al., 1998

28

2

1

Schmid et al., 1987

28

1

1

Green, 1991

28

1

2

Rosa et al., 2003

22 26 24

5 9 1

1 3 1

Nur and Nevo, 1969 Schmid et al., 2002 Baldissera et al., 1993

26 26 26

1 1 4

1 1 1

Wu and Zhao, 1985 Kuramoto, 1989 Ullerich, 1967; Schmid, 1978; Belcheva and Sofianidou, 1990

Ambystomatidae Ambystoma jeffersonianum Plethodontidae Chiropterotriton arboreus

P. smithi Thorius dubitus T. narisovalis T. pennatulus Anura (frogs and toads) Leiopelmatidae Leiopelma hochstetteri

22+W

Discoglossidae Discoglossus pictus Pelobatidae Scaphiopus hammondi Leptodactylidae Megaelosia massarti Hylidae Acris crepitans Gastrotheca espeletia Hyla sp. Ranidae Amolops liangshanensis Rana everetti Rana temporaria

Occurrence and distribution of B chromosomes among amphibians In all cases among amphibians, B chromosomes are restricted to particular species within genera or even to particular populations within species. In most instances they are recorded from single populations. Small, metacentric B chromosomes, up to five per individual, are found in male cricket frogs, Acris crepitans, from Knoxville, Tennessee (Nur and Nevo, 1969). B chromosomes occur among common frogs, Rana temporaria, from a site near Tübingen, Germany (Ullerich, 1967; Schmid, 1978) and from the Balkan Mountains in Bulgaria (Belcheva and Sofianidou, 1990). These are also metacentric, occur up to four per individual, and are heterochromatic at the distal end of one arm. A small, metacentric B chromosome occurs in females of the Chinese ranid frog, Amolops liangshanensis (Wu and Zhao, 1985). A small telocentric B chromosome, observed only in a single female, occurs in the European frog, Discoglossus

236 94

Cytogenet Genome Res 106:235–242 (2004)

pictus (Schmid et al., 1987), and a similarly small, telocentric chromosome, likewise observed in a single individual, a male, is present in the Philippine frog, Rana everetti (Kuramoto, 1989). In the western North American spadefoot, Spea hammondii, a telocentric B chromosome is as large as any of the A chromosomes, almost completely heterochromatic except for a small region near the centromere, and carries an Ag-staining NOR locus (Green, 1991). B chromosomes have been found in the North American salamander, Ambystoma jeffersonianum (S.K. Sessions, pers. comm.) and in twelve species of plethodontid salamanders from Central America and Mexico (Sessions and Kezer, 1991). These B chromosomes are smaller than the regular A chromosomes of these salamanders but vary in all other ways, including size, shape, frequency, and heterochromatin content. A more-than-usually strange B chromosome occurs among Oedipina poelzi from Costa Rica and Chiropterotriton lavae from Mexico. In both cases, it is a symmetrical iso-chromosome that

Table 2. Frequencies of B chromosomes in Dicamptodon tenebrosus populations

Population

Chilliwack Cumberland Creek Miller Creek Mallardy Creek Mt. Pilchuck Miller River Seattle Cold Creek Prairie Creek Maratta Creek Oneonta Gorge Columbia River Gorge Oak Springs Corvallis Willamette River Loon Lake Humbug Mountains Siskiyou-Trinity

synapses with itself to form an iso-bivalent during meiosis (Sessions and Kezer, 1991). The B chromosome of a species of Thorius from Mexico was found to have lateral transcription loops in lampbrush condition Kezer (Callan, 1986). Rosa et al. (2003) have lately discovered B chromosomes in the hylodine leptodactylid frog, Megaelosia massarti from Brazil. Among only four individuals, two had a single B chromosome in addition to the regular set of 2n = 28 chromosomes. Both individuals were female and in both the B chromosomes were mitotically stable. Yet in one individual, the B was a small, wholly heterochromatic, metacentric element approximately equal in length to the 10th pair of A chromosomes, whereas in the other, the B was submetacentric, heterochromatic only at the telomeres, and the largest chromosome in the set. This level of variability even in so small a sample may be an indication of considerable B chromosome diversity in this species. In the Ecuadorian hylid frog, Gastrotheca espeletia, there is evidence of substantial B chromosome variation and occurrence (Schmid et al., 2002). All of 47 individuals, both male and female, from a single site had from 1 to 9 mitotically stable B chromosomes in addition to 2n = 26 regular chromosomes (Schmid et al., 2002). Three morphologies were present among the Bs: a metacentric about 2/3 the size of the smallest A chromosome pair (pair No. 13), a telocentric about 1/2 the size of pair No. 13, and another telocentric about 1/4 as big as pair No. 13. An individual frog might have any combination of these forms of B chromosome. Nevertheless, females had significantly more of them than males. The B chromosomes were completely heterochromatic, consistently of AT-rich repeated DNA sequences. They were also noted to carry 18S + 28S RNA genes and be depauperate in telomeric sequences. The Coastal Giant salamander, Dicamptodon tenebrosus, from the Pacific coast of western North America, carries from 0 to 10 telocentric B chromosomes per individual (Table 2; Fig. 1A). These are non-heterochromatic even at the centromeres, contain active NORs, and constitute up to 1 % of the

Latitude (North)

49º05' 48º31' 48º27' 48º05' 47º49' 47º50' 47º35' 47º20' 47º05' 46º16' 45º40' 45º32' 45º14' 44º34' 44º00' 43º42' 42º26' 41º00'

No. of specimens B chromosomes

1 2 6 8 4 3 1 4 18 1 3 20 1 22 17 19 13 7

Range

Mean

– 0–1 1–3 1–5 2–4 1–3 1–5 1–6 0–8 – 2–3 0–10 – 0–2 0–6 – 0–2 0–4

1.0 0.5 1.8 2.5 3.4 1.7 2.4 2.1 2.4 2.0 2.7 2.2 3.0 0.6 1.5 0 0.4 1.3

Reference

Green, 1991 Brinkman et al., 2000 Brinkman et al., 2000 Brinkman et al., 2000 Sessions, 1984 Brinkman et al., 2000 Sessions, 1984 Brinkman et al., 2000 Brinkman et al., 2000 Sessions, 1984 Brinkman et al., 2000 Sessions, 1984 Sessions, 1984 Sessions, 1984 Sessions, 1984 Sessions, 1984 Sessions, 1984 Sessions, 1984

Fig. 1. (A) Karyotype of a Coastal Giant salamander, Dicamptodon tenebrosus with eight B chromosomes. (B) Karyotype of a male Hochstetter’s frog, Leiopelma hochstetteri, with five B chromosomes. The species differ in total DNA amount per nucleus (C-value) and both karyotypes are depicted at the same scale (bar = 10 Ìm). The B chromosomes are in varying sizes within individuals but are of comparable relative size to the A chromosomes with which they are associated.

genome. Populations throughout the extent of the range of D. tenebrosus, which extends from southern British Columbia to northern California, average from 0 to 3.4 B chromosomes per individual (Sessions, 1984; Brinkman et al., 2000). Virtually all populations have B chromosomes. Southern populations, as far north as Corvallis, Oregon, have a lower average number of B chromosomes (means !1.5) than northern populations (means 11.7), with the possible exception of the two most northerly sampled sites, located in northern Washington and

Cytogenet Genome Res 106:235–242 (2004)

237 95

southern British Columbia (Fig. 2A). Salamanders from both of these sites averaged less than 1 B chromosome each, but very few salamanders were examined (Brinkman et al., 2000). The B chromosomes of the endemic New Zealand frog, Leiopelma hochstetteri, are the most thoroughly studied of any in an amphibian, and the most diverse. Three different morphologies are present: two forms of telocentric chromosomes and a metacentric chromosome (Green et al., 1993). All the B chromosomes have C-band-positive centromeres, but those from both Mt. Moehau and Tokatea Ridge on the Coromandel Peninsula have additional heterochromatin at the telomeres. The metacentric B chromosome was found in one male from Tapu in the central Coromandel (Green et al., 1993). The B chromosomes range in size from 0.09 to 0.52 % of total genome length and within frogs from the Waitakere Mountains west of Auckland and Tapu, some four different size classes may be discerned among them. The B chromosomes of L. hochstetteri (Fig. 1B) also show extremely high variability in numbers and frequency, up to 11.4 B chromosomes per individual in one population (Table 3; Fig. 2B). Both males and females may carry up to 15 B chromosomes depending upon the population (Green et al., 1987, 1993; Green, 1988, 1994), which is the most known among virtually any wild population of animals (Camacho et al., 2000). B chromosomes occur in low frequency among the population of frogs from the Hunua Mountains west of the Firth of Thames,

Fig. 2. (A) Frequency distribution of B chromosomes among populations of the salamander, Dicamptodon tenebrosus. Larger numbers are for populations sampled in numbers greater than 4 individuals (Table 1). Populations south of the dashed line (i.e. from Corvallis, Oregon, south) have on average fewer B chromosomes per individual than populations to the north. (B) Frequency distribution of B chromosomes among populations of the frog, Leiopelma hochstetteri, not including the univalent W chromosome of North Island females (see text). Only populations in the central regions of the fragmented range have B chromosomes.

Table 3. Frequencies of B chromosomes in Leiopelma hochstetteri populations

Population

No. of specimens

B chromosomes Range

Mean

Waipu Warkworth

4 20

– 0, 11a

0 0.6

Waitakere Mountains Hunua Mountains Mount Ranginui Whareorino Golden Cross Tapu Tokatea Ridge Mount Moehau Great Barrier Island Toatoa Whanarua

12 7 6 1 28 13 14 9 9 12 3

0–13 0–3 – – – 1–12 0–10 8–15 – – –

5.1 1.3 0 0 0 7.1 3.7 11.4 0 0 0

a

Reference(s)

Green et al., 1993 Morescalchi, 1968; Stephenson et al., 1972; Green et al., 1984, 1987; Green, 1988 Green et al., 1993; Sharbel et al., 1998 Green, 1988; Green et al., 1993 Green et al., 1993 Sharbel et al., 1998 Green et al., 1993; Slaven, 1994 Green et al., 1987, 1993; Green, 1988 Stephenson et al., 1972; Green, 1988 Green, 1988; Green et al., 1993; Sharbel et al., 1998 Green et al., 1993; Sharbel et al., 1998 Green, 1988, Green et al., 1993 Green et al., 1993

A single specimen with 11 B chromosomes was described by Morescalchi (1968). None of 19 other frogs from the locality had B chromosomes. The configuration of the B chromosomes in Moresc alchi’s specimen resembles that from the Waitakere Mountains (Gre en et al., 1993).

238 96

Cytogenet Genome Res 106:235–242 (2004)

but are at their highest frequency among individuals from Mt. Moehau, Tokatea Ridge, and Tapu in the northern and central parts of the Coromandel Peninsula, as well as in the Waitakere Mountains. The minimum number of B chromosomes yet found in any frog from Mt. Moehau is eight. Yet no frogs from the southern Coromandel at Golden Cross or in the vicinity of Warkworth just north of Auckland, with one exception, have been discovered to have Bs (Green et al., 1993; Slaven, 1994), despite considerable sampling. Morescalchi (1968) described the chromosomes of a frog, reputedly from the vicinity of Warkworth, that possessed 11 B chromosomes (Green, 1988), a configuration most like that seen among frogs from the nearby Waitakere Mountains than seen in any other of the 20 frogs sampled from Warkworth (Table 3). In spermatocyte meiosis, the B chromosomes of L. hochstetteri do not associate in any way and have no measured effects upon meiosis (Green, 1988). In oocyte meiosis, in the lampbrush condition, the B chromosomes have distinctive morphologies. In frogs from Tapu and Hunua, the lampbrush Bs feature prominent giant granular loops at their telomeres as well as numerous transcription loops along their lengths. The lampbrush chromosomes from Hunua frogs do not associate with each other during meiosis but in frogs from Tapu, the chromosomes form spectacular multi-chromosome “stars” composed of B chromosomes clumping together at their telomeres (Green, 1988). In frogs from the Waitakere Mountains, these associations also occur, but the chromosomes do not have the giant granular loops. Instead they feature distinctive lumpy loops closer to the centromere end of the chromosome. Confounding the variation in B chromosomes in L. hochstetteri, and intimately linked to it, is the strange, univalent W sex chromosome of North Island populations. Technically, this chromosome in its many forms (Green, 1994) could also be considered to be a sort of B chromosome as it is not essential for the organism and does not occur in all populations of the species. Neither the B chromosomes nor the univalent sex chromosome are found in individuals from Great Barrier Island directly north of Mt. Moehau and the Coromandel Peninsula across the Colville Channel. It does, however, carry a gene of some importance. Universally among North Island frogs, females possess the W chromosome and males do not. Based upon the morphology and heterochromatin patterns of the B and W chromosomes, the univalent nature of the W, and the lack of these elements on Great Barrier Island, Green et al. (1993) proposed that the Bs were degenerate Ws, and may have been derived one or more times in the different populations characterized by Bs. This idea is supported by molecular evidence of B chromosome structure (Sharbel et al., 1998). This also implies a relatively recent derivation of both elements (ca. 10,000 years), subsequent to the post-glacial isolation of Great Barrier Island from the North Island (Green, 1988, 1991).

Structure of amphibian B chromosomes There have been assorted investigations into the structure and composition of amphibian B chromosomes. These have identified B chromosomes ranging from those that are almost

devoid of heterochromatin, as in D. tenebrosus (Brinkman et al., 2000), to those that are completely heterochromatic, as in G. espeletia (Schmid et al., 2002). Tandemly repeated DNA sequences are often associated with heterochromatin and may vary between species (Brutlag, 1980; Stephan and Cho, 1994; Vershinin et al., 1996). Amphibian genomes, which are often very large, appear to be particularly susceptible to both the accumulation of noncoding DNA sequences and the tandem duplication of short mobile genetic elements (Batistoni et al., 1995). They carry many times the DNA per nucleus than is present in most other organisms (Sessions and Larson, 1987) and their B chromosomes are, commensurately, very large (Fig. 1). Employing genomic restriction digestion of genomic DNA from individuals with and without Bs, Zeyl and Green (1992) described a highly repeated sequence in L. hochstetteri that featured considerable heteromorphism. Sharbel et al. (1998) and Brinkman et al. (2000), however, used the more direct method of chromosome micromanipulation to physically isolate whole B chromosomes of L. hochstetteri and D. tenebrosus, respectively, in order to analyze their molecular composition. Sharbel et al. (1998) isolated 18 metaphase B chromosomes from each of two specimens of L. hochstetteri: a male with 8 B chromosomes, and a female with 12 B chromosomes plus the univalent W sex chromosome. Binding affinities of the B-DNA probes to genomic DNA on Southern blots indicated that the B chromosomes share sequence similarity with both the autosomes and sex chromosomes. Highly-repeated hybridization patterns in all individuals demonstrated that the Bs are at least partly composed of DNA sequences which exist in numerous copies throughout the autosomes, in conformity to the hypothesis of intraspecific B origins proposed by Green et al. (1993). The W chromosome of L. hochstetteri that is found in all females from the North Island of New Zealand shared the greatest homology with the Bs (Sharbel et al., 1998). Strongly hybridizing W and B specific bands were not found in individuals lacking W and B chromosomes and certain sequences from the B chromosomes were found to share specific DNA homologies with the univalent W chromosome. The positive hybridization of B-specific DNA to a 0.8-kb fragment from a Great Barrier Island female further indicated that B-specific DNA may be related to, or derived from, female-specific DNA (Sharbel et al., 1998). The W chromosome is the only female-specific genomic element in this population (Green et al., 1993) and B chromosome-derived DNA probes shared partial sequence similarity with it. However, the same probes did not hybridize to DNA from any of the mainland individuals carrying the univalent W, suggesting that those Bs were derived from the univalent W relatively soon after its own derivation from the ancestral W. The univalent W is itself highly variable morphologically across North Island populations (Green et al., 1993; Green, 1994). Some DNA probes derived from the B chromosome of L. hochstetteri hybridized to DNA fragments from the congeneric species, L. archeyi. These species are highly divergent, despite being accommodated taxonomically in the same genus, and so any B chromosome homology between genomes is probably ancestral. Certain B chromosome DNA sequences have therefore undergone little change since the divergence of

Cytogenet Genome Res 106:235–242 (2004)

239 97

these two species over 15 million years ago (Sharbel et al., 1998). At the nucleotide level, in different populations of the same species, Bs should lose sequence homology over time through the action of Muller’s ratchet and other evolutionary mechanisms (Green, 1990; Camacho et al., 2000). Southern blot hybridization experiments with B-specific DNA indicated that deletions and other mutations have occurred between different lineages of the Bs in L. hochstetteri despite a presumed common origin. Some B chromosome DNA of L. hochstetteri may form hairpin loops (Sharbel et al., 1998) which have been implicated in a number of processes leading to change in chromosome structure (Bigot et al., 1990), likely predisposing them to a variety of structural rearrangements (Vogel et al., 1990; Eickbush et al., 1992; Chen et al., 1995; Mitas et al., 1995). Brinkman et al. (2000) microdissected and amplified the DNA of approximately 20 B chromosomes from metaphase chromosome spreads from one individual of the salamander, D. tenebrosus. The B chromosomes in D. tenebrosus contain DNA sequences that are present in the A chromosomes of this species, as well as in the genomes of the related species D. copei and D. ensatus. As demonstrated with Southern blot hybridization experiments using two B chromosome clones as probe DNA, B chromosome DNA sequences occur in the genomes of D. tenebrosus individuals whether or not they have B chromosomes. There is variation in the number of genomic DNA bands that hybridize with one particular DNA sequence derived from D. tenebrosus B chromosome DNA, implying that the sequence may be present in different copy numbers and/or occurs at different sites on the chromosomes in different individual salamanders (Brinkman et al., 2000). The sequence gives detectable hybridization signals to a unique 1.4-kb band in individuals of D. tenebrosus that have high numbers of B chromosomes and to a different, also unique, 2-kb band in D. copei. This indicates that subsequent to the evolutionary differentiation of these two species, the sequence was amplified in different chromosome regions in each of them. The hybridization signal to the 1.4-kb band, however, is not detectable in D. tenebrosus individuals with fewer than 5 B chromosomes or in the other species. The plausible explanation is that the sequence may be amplified on the B chromosomes and that greater numbers of B chromosomes result in a higher copy number of the sequence. The B chromosomes may all be fundamentally equivalent or could vary in the location and number of copies of certain sequences. The variation could be more pronounced in individuals with higher numbers of B chromosomes. Brinkman et al. (2000) concluded that the B chromosomes of D. tenebrosus are composed of both low and high abundance sequences. They contain much repetitive DNA, including internal repeats and many sequences that are 98 to 100 % identical in sequence for much of their length. Some 39 % of B chromosome-derived DNA clones from D. tenebrosus hybridized strongly with genomic DNA from the same species, indicating they are represented in high copy number within the genome. The other 61 % of the clones hybridized with gDNA weakly or not at all and thus contained low or single copy sequences. Comprised of only 39 % repetitive DNA, the B chromosomes in D. tenebrosus understandably appear non-heterochromatic

240 98

Cytogenet Genome Res 106:235–242 (2004)

throughout and would thus not likely have high concentrations of tandem repeats. If the B chromosomes originated from an autosomal chromosome region that contained little heterochromatin, perhaps they have not yet evolved high copy numbers of repetitive DNA.

Evidence of origins and evolution It is now well known that B chromosomes may carry expressed genes (Green, 1990; Jones, 1995; Covert, 1998; Camacho et al., 2000). In lampbrush condition, amphibian B chromosomes have the characteristic transcription loops that indicate the presence of actively transcribed genes (Callan, 1986; Green, 1988). What those transcripts are, or whether they are translated in functional proteins, is unknown. Some B chromosomes carry ribosomal DNA genes which, in D. tenebrosus, have been detected through the ability of the B chromosomes to synapse with nucleolar organizer region (NOR)-bearing chromosomes (Sessions, 1984; Green, 1990) or, as in S. hammondii, stain with Ag-NOR banding methods (Green, 1991). Although there is little empirical evidence to explain adequately all B chromosome origins, the sequence homologies between Bs and autosomes in Dicamptodon and Leiopelma is an indication that they arose, in these cases, from amongst the A chromosomes rather than de novo or via hybridization with related species (Sharbel et al., 1998; Brinkman et al., 2000). Among the species of Dicamptodon, B chromosomes have been found only in D. tenebrosus (Sessions, 1984). They could have arisen uniquely in the lineage leading to D. tenebrosus or, less parsimoniously, they could have been present in an ancestral genome and become lost from the related species D. copei, D. ensatus and D. aterrimus. The similarity between B chromosome DNA of D. tenebrosus and gDNA from other Dicamptodon argues for a relatively recent intraspecific origin. The B chromosomes in D. tenebrosus may be in an early stage of diverging from their progenitor chromosome by accumulating repeat DNA. Amphibian genomes have a strong tendency for both the tandem duplication of short retrotransposons and the accumulation of noncoding DNA sequences (Batistoni et al., 1995), thus the genome of D. tenebrosus, including the B chromosomes, may be composed of a large number of genetically dispensable DNA components that are capable of amplification and transposition to different chromosome regions. This would result in high sequence similarity between A and B chromosomes, as seen in this species. In L. hochstetteri, the B chromosomes are almost assuredly derived from the sex chromosome. The unique, univalent W sex chromosome, deprived of recombination, would be prone to cumulative genetic change. Ever more mutated classes of the W could become fixed within populations (Green, 1990; Green et al., 1993), leading to the hypervariability in the W observed between populations (Green, 1994). Homologies in DNA sequences between the B chromosomes and the univalent W chromosome do indicate their derivation from the W (Sharbel et al., 1998), but the hypervariability of both the B and univalent W obscures whether Bs had single or multiple origins (Zeyl

and Green, 1992; Green et al., 1993). B chromosome origins from sex chromosomes have been inferred in many other organisms (see Camacho et al., 2000). A loss-of-function mutation in a W or Y chromosome affecting the sex-determining locus could be a fast track to the genesis of a B chromosome. Underlying the inherent propensity of L. hochstetteri B chromosomes to undergo accelerated change at the nucleotide and structural levels has been the maintenance of B-specific sequences in the Bs from geographically distinct populations (Sharbel et al., 1998). Because the B chromosomes of L. hochstetteri are ultimately autosomal in origin, they primitively contain nucleotide sequences which are duplicated in normal chromosomes that, unlike the Bs, undergo recombination. As with the pseudoautosomal regions of W and Y chromosomes, nonrecombining elements will accumulate mutations via genetic hitchhiking or transposon insertion which can become fixed through the action of Muller’s ratchet (Charlesworth, 1978; Green, 1990; Steinemann et al., 1993; Beukeboom, 1994; Rice, 1994). It has been proposed that B chromosomes might accumulate DNA from various sources (Beukeboom, 1994) and as such exist as amalgamations of transposable DNA (Marshall Graves, 1995). Transposons should accumulate in regions not subject to recombination (Zeyl and Bell, 1996) and thus B chromosomes would provide ideal havens for them (McAllister, 1995). A B-specific nucleotide sequence could thus arise from an accumulation of mutations in a duplicated region, eventually leading to the loss of homology with its parental sequence on an autosome. This is a stochastic, undirected process. It is unlikely that duplicated autosomal DNA residing in independent B chromosome lineages could converge upon any specific B-specific sequence. Therefore their presence in individuals from different populations reflects common ancestry rather than common descent.

so easily manipulated and bred as domesticated plants nor as abundant as insects. The extraordinary diversity of B chromosomes in Leiopelma hochstetteri, as well as the sheer oddness of the sex-chromosome system in North Island populations, has been the impetus for numerous investigations concerning B chromosome evolution and origins (Green et al., 1987, 1993; Green, 1988, 1990, 1991, 1994; Sharbel et al., 1998). Yet contemplating further cytogenetic work on L. hochstetteri populations is problematic as the species is classified as protected wildlife in New Zealand and difficult to obtain. A more common species, Dicamptodon tenebrosus, may be a more amenable subject for the study of B chromosome evolution in amphibians but its genome is very large with great amounts of repetitive DNA. Perhaps Gastrotheca espeletia, which has high B chromosome diversity in one population, will be proven to be a good experimental system once more populations are studied. B chromosomes have been found in about 1300 species of plants and 500 species of animals (Camacho et al., 2000), or 10–15 % of all karyotyped species (Beukeboom, 1994; Jones, 1995), yet they occur in only 2 % of amphibian species. Even so, in a small number of amphibians, they occur in frequencies that are amongst the highest known. Nevertheless, they occur in single species or, even more specifically, in single populations. Thus there is no phylogenetic aspect to their occurrence. Lineages do not seem to carry with them their B chromosomes through speciation events. Could it be that amphibians are resistant to the formation of B chromosomes within their genomes? Does a B chromosome need to be particularly benign a genomic parasite if it is to survive and proliferate in an amphibian? Are B chromosomes impediments to further speciation? More secrets await discovery.

Conclusions from amphibian B chromosomes True to the emerging picture of B chromosomes generally, amphibian B chromosomes are united in their disparity. Some are large while some are small but always relative to the size of the A set of chromosomes (Fig. 1). Some are infested with heterochromatin and repeated DNA sequences, whereas some are entirely euchromatic and low in repetitive DNA. Some occur in low numbers, while some are widespread and in high frequency. In almost all cases, they are mitotically stable. As appears to be the case for most B chromosomes in both animals and plants (Camacho et al., 2000; Jones and Houben, 2003), amphibian B chromosomes are derived from out of the A set of chromosomes of the same species in which they occur, particularly, as in L. hochstetteri, from the sex chromosome. Amphibian Bs also appear to have undergone cumulative evolutionary change subsequent to their origination by whatever means. Amphibian B chromosomes, as objects for study, have the advantage of being large and readily detectable by conventional cytogenetic methods. They also have disadvantages for further research into their structure, transmission and evolution. Amphibian genomes often have inflated amounts of repetitive DNA compared to other organisms and the animals are neither

Cytogenet Genome Res 106:235–242 (2004)

241 99

References Baldissera FA, Deoliveira PSL, Kasahara S: Cytogenetics of 4 Brazilian Hyla species (Amphibia-Anura) and description of a case with a supernumerary chromosome. Rev Bras Genet 16:335–345 (1993). Batistoni R, Pesole G, Marracci S, Nardi I: A tandemly repeated DNA family originated from SINE-related elements in the European plethodontid salamanders (Amphibia, Urodela). J Mol Evol 40:608– 615 (1995). Belcheva RG, Sofianidou TS: Kariological investigation of the brown frogs species (Anura-Ranidae) from Bulgaria and Greece, in Olmo E (ed): Cytogenetics of Amphibians and Reptiles, pp 141–146 (Birkhäuser-Verlag, Basel 1990). Beukeboom LW: Bewildering Bs: an impression of the 1st B chromosome conference. Heredity 73:328– 336 (1994). Bigot Y, Hamelin M-H, Periquet G: Heterochromatin condensation and evolution of unique satelliteDNA families in two parasitic wasp species: Diadromus pulchellus and Eupelmus vuilleti (Hymenoptera). Mol Biol Evol 7:351–364 (1990). Brinkman JN, Sessions SK, Houben A, Green DM: Structure and evolution of supernumerary chromosomes in the Pacific Giant salamander, Dicamptodon tenebrosus. Chromosome Res 8:477– 485 (2000). Brutlag DL: Molecular arrangement and evolution of heterochromatic DNA. Annu Rev Genet 14:121– 144 (1980). Callan HG: Lampbrush Chromosomes (Springer-Verlag, Heidelberg 1986). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Philos Trans R Soc Lond B Biol Sci 355:163–178 (2000). Charlesworth B: Model for evolution of Y chromosomes and dosage compensation. Proc Natl Acad Sci USA 75:5618–5622 (1978). Chen X, Santhana Mariappan SV, Catasti P, Ratliff R, Moyzis RK, Laayoun A, Smith SS, Morton Bradbury E, Gupta G: Hairpins are formed by the single DNA strands of the fragile X triplet repeats: structure and biological implications. Proc Natl Acad Sci USA 92:5199–5203 (1995). Covert SF: Supernumerary chromosomes in filamentous fungi. Curr Genet 33:311–319 (1998). Eickbush DG, Eickbush TH, Werren JH: Molecular characterization of repetitive DNA sequences from a B chromosome. Chromosoma 101:575–583 (1992). Green DM: Cytogenetics of the endemic New Zealand frog, Leiopelma hochstetteri: extraordinary supernumerary chromosome variation and a unique sexchromosome system. Chromosoma 97:55–70 (1988). Green DM: Muller’s Ratchet and the evolution of supernumerary chromosomes. Genome 33:818– 824 (1990). Green DM: Supernumerary chromosomes in amphibians, in Green DM, Sessions SK (eds): Amphibian Cytogenetics and Evolution, pp 333–358 (Academic Press, San Diego 1991).

242 100

Green DM: Genetic and cytogenetic diversity in Hochstetter’s frog, Leiopelma hochstetteri, and its importance for conservation management. New Zealand J Zool 21:417–424 (1994). Green DM, Kezer J, Nussbaum RA: Triploidy in Hochstetter’s frog, Leiopelma hochstetteri, from New Zealand. New Zealand J Zool 11: 457–461 (1984). Green DM, Kezer J, Nussbaum RA: Supernumerary chromosome variation and heterochromatin distribution in the endemic New Zealand frog, Leiopelma hochstetteri. Chromosoma 95:339–344 (1987). Green DM, Zeyl CW, Sharbel TF: The evolution of hypervariable sex and supernumerary chromosomes in the relict New Zealand frog, Leiopelma hochstetteri. J Evol Biol 6:417–441 (1993). Jones RN: Tansley review no. 85. B chromosomes in plants. New Phytol 131:411–434 (1995). Jones N, Houben A: B chromosomes in plants: escapees from the A chromosome genome? Trends Plant Sci 8:417–423 (2003). Kuramoto M: Karyological studies on some Philippine frogs, in Matsui M, Kikida T, Goris RC (eds): Current Herpetology in East Asia, pp 115–121 (Herpetological Society of Japan, Kyoto 1989). Marshall Graves JA: The origin and function of the mammalian Y chromosome and Y-borne genes – and evolving understanding. Bioessays 17:311– 321 (1995). McAllister BF: Isolation and characterization of a retroelement from B chromosome (PSR) in the parasitic wasp Nasonia vitripennis. Insect Mol Biol 4:253–262 (1995). Mitas M, Yu A, Dill J, Kamp TJ, Chambers EJ, Haworth IS: Hairpin properties of single-stranded DNA containing a GC-rich triplet repeat: (CTG)15 . Nucleic Acids Res 23:1050–1059 (1995). Morescalchi A: The karyotype of two specimens of Leiopelma hochstetteri Fitz. (Amphibia Salientia). Caryologia 22:97–102 (1968). Nur U, Nevo E: Supernumerary chromosomes in the cricket frog, Acris crepitans. Caryologia 22:97–102 (1969). Nussbaum RA: Cytotaxonomy of caecilians, in Green DM, Sessions SK (eds): Amphibian Cytogenetics and Evolution, pp 33–66 (Academic Press, San Diego 1991). Rice WR: Degeneration of a nonrecombining chromosome. Science 263:230–232 (1994). Rosa C, Aguiar O, Giaretta AA, Recco-Pimentel SM: Karyotypic variation in the genus Megaelosia (Anura, Hylodinae) with the first description of a Bchromosome in a leptodactylid frog. Copeia 166– 174 (2003). Schmid M: Chromosome banding in Amphibia II. Constitutive heterochromatin and nucleolus organizer regions in Ranidae, Microhylidae and Rhacophoridae. Chromosoma 68:131–148 (1978).

Cytogenet Genome Res 106:235–242 (2004)

Schmid M, Vitelli L, Batistoni R: Chromosome banding in Amphibia XI. Constitutive heterochromatin and nucleolus organizer regions 18S+28S and 5S ribosomal genes in Ascaphidae, Pipidae, Discoglossidae and Pelobatidae. Chromosoma 95:271– 284 (1987). Schmid M, Ziegler CG, Steinlein C, Nanda I, Haaf T: Chromosome banding in amphibia. XXIV. The B chromosomes of Gastrotheca espeletia (Anura, Hylidae). Cytogenet Genome Res 97:205–218 (2002). Sessions SK: Cytogenetics and evolution in salamanders. Ph. D. dissertation, University of California, Berkeley (1984). Sessions SK, Kezer J: Bolitoglossine salamanders, in Green DM, Sessions SK (eds): Amphibian Cytogenetics and Evolution, pp 89–130 (Academic Press, San Diego 1991). Sessions SK, Larson A: Developmental correlates of genome size in plethodontid salamanders and their implications for genome evolution. Evolution 41:1239–1251 (1987). Sharbel TF, Green DM, Houben A: B chromosome origin in the endemic New Zealand frog Leiopelma hochstetteri through sex chromosome devolution. Genome 41:14–22 (1998). Slaven DC: Leiopelma hochstetteri. A study of migratory thresholds and conservation status. M.Sc. Thesis, University of Auckland, Auckland, New Zealand (1994). Steinemann M, Steinemann S, Lottspeich F: How Y chromosomes become genetically inert. Proc Natl Acad Sci USA 90:5737–5741 (1993). Stephan W, Cho S: Possible role of natural selection in the formation of tandem-repetitive noncoding DNA. Genetics 136:333–341 (1994). Stephenson EM, Robinson ES, Stephenson NG: Karyotype variation within the genus Leiopelma (Amphibia: Anura). Can J Genet Cytol 14:691–702 (1972). Ullerich FH: Weitere Untersuchungen über Chromosomenverhältnisse und DNS-Gehalt bei Anuren (Amphibia). Chromosoma 21:345–368 (1967). Vershinin AV, Alkhimova EG, Heslop-Harrison JS: Molecular diversification of tandemly organized DNA sequences and heterochromatic chromosome regions in some Triticeae species. Chromosome Res 4:517–525 (1996). Vogel JM, Nieto MC, Fischer A, Goodenow RS: Overlapping palindromic sequences associated with somatic deletion and meiotic recombination of MHC class I genes. Mol Immunol 27:875–886 (1990). Wu G-F, Zhao E: Preliminary studies on karyotypes of the genus Amolops of the Hengduan Mountains. Acta Herpetol Sinica 4:276–282 (1985). Zeyl CW, Bell G: Symbiotic DNA in eukaryotic genomes. Trends Ecol Evol 11:10–14 (1996). Zeyl CW, Green DM: Heteromorphism for a highly repeated sequence in the New Zealand frog Leiopelma hochstetteri. Evolution 46:1891–1899 (1992).

Review on B Chromosomes Cytogenet Genome Res 106:243–246 (2004) DOI: 10.1159/000079294

Occurrence of B chromosomes in lizards: a review C.E.V. Bertolotto,a,b K.C.M. Pellegrino,c and Y. Yonenaga-Yassudaa a Departamento

de Biologia, Instituto de Biociências, Universidade de Sa˜o Paulo, Sa˜o Paulo, SP (Brazil); de Santo Amaro, Faculdade de Medicina Veterina´ria, Sa˜o Paulo, SP (Brazil); c Programa de Po ´ s-graduaça˜o em Ciências Ambientais e Sau´de, Universidade Cato´lica de Goia´s, Goiânia, GO (Brazil) b Universidade

Abstract. Although B chromosomes have been reported in many species of plants and animals, few studies have revealed the presence of these extra chromosomes in lizards. B chromosomes of lizards show different morphologies and sizes, from microchromosomes to macrochromosomes, or elements of intermediate size between smaller and larger A chromosomes, and number variability at intra- and inter-individual levels. In most cases, they are late-replicating and show either hetero-

Introduction Supernumerary or B chromosomes exist in addition to the normal A complement of an individual. These chromosomes have been found in some populations of many plants and animals, including fishes (Pauls and Bertollo, 1983; Venere et al., 1999), amphibians (Green, 1991; Baldissera et al., 1993), reptiles (Beçak et al., 1972; Pellegrino et al., 1999) and mammals (Hayman et al., 1969; Silva and Yonenaga-Yassuda, 1998). The composition, function and origin of B chromosomes are issues that have been explored in a vast number of studies, mostly in groups of insects and plants. All studies address the peculiarities of these extra chromosomes: (1) non-Mendelian inheritance favors variability in number of Bs at intrapopulation and intraindividual levels (Volobujev, 1981; Cavallaro et al., 2000); (2) they form univalents, bivalents and multivalents

This research was supported by Fundaça˜o de Amparo à Pesquisa do Estado de Sa˜o Paulo (FAPESP) and Conselho Nacional de Pesquisa e desenvolvimento (CNPq). Received 2 October 2003; manuscript accepted 23 January 2004. Request reprints from: Dr. Carolina Elena Viña Bertolotto Departamento de Biologia, Instituto de Biociências Universidade de Sa˜o Paulo 11.461 CEP 05508-900SP C.P, Sa˜o Paulo (Brazil) telephone: +55-11-3091-7574; fax: +55-11-3091-7553 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0243$21.00/0

chromatic or no distinctive patterns after C-banding. The great majority of the publications about supernumerary chromosomes in this group have been based on conventional staining analyses, and there is no study designed to address questions related to their composition and structure or origin and evolution. Copyright © 2004 S. Karger AG, Basel

at meiosis with no pairing between B and A chromosomes, with some exceptions: e.g. pairing between B and Y chromosomes in lemmings (Berend et al., 2001); (3) lack of genes or gene activity; exceptions were reported by Yonenaga-Yassuda and colleagues (Yonenaga-Yassuda et al., 1992) in small rodents and Schmid and colleagues (Schmid et al., 2002) in amphibians; (4) they consist of late replicating DNA. Several methodologies including restriction endonucleases, fluorochromes, in situ hybridization, and chromosome microdissection have been used to elucidate the composition, structure and mechanisms involved in the origin and evolution of B chromosomes in several groups of animals (Lo´pez-Léon et al., 1994; Sharbel et al., 1998; Brinkman et al., 2000; Maistro et al., 2000; Karamysheva et al., 2002; Ziegler et al., 2003). However, none of these approaches have been explored in the study of B chromosomes of reptiles.

Conventionally stained karyotypes and B chromosomes in lizards The few records of B chromosomes in karyotypes of lizard species are based only on conventional staining (Table 1). Many species show standard karyotypes composed of chromosomes known as macro- (M) and microchromosomes (m), because they differ conspicuously in size. B chromosomes have been described as macro- and microchromosomes or interme-

Accessible online at: www.karger.com/cgr

Table 1. Summary of available data on occurrence of B chromosomes in species of lizards

Taxa

Standard 2n

B-carrying

B size

Mitotic instability

Reference

Anolis cristatellus wileyae (Polychrotidae) Tropidurus torquatus (Tropiduridae) Mabuya mabouya mabouya (Scincidae) Anniella pulchra (Anniellidae)

2n=27 (12) (12M+15m) 2n=36 (5) (12M+24m) 2n=30 (2) (16M+14m) 2n=20 (22) (16M+4m) 2n=24 (3) (14M+10m) 2n=32 2n=30–37(155) (M+m) 2n=36 (34M+2m) 2n=40 (36M+4m) 2n=30 (111) (12M+18m) 2n=50 (8)

27/27+1B (1) 27+1B (1) 36/36+1B/36+2B (3) 36/36+2B (1) 30+1B (1)

small

Yes

Gorman et al., 1968

medium

Yes

Beçak et al., 1972

medium

No

Beçak et al., 1972

20+1–4B (14)

small

Yes

Bezy et al., 1977

24/24+1B or 2B (1)

small

Yes

Kupriyanova, 1980

32+1–4B 2n not informed (3)

small

Yes

Jones and Rees, 1982 Blake, 1986

36/36+1B

small

Yes

Olmo et al., 1986

40/40+2B

small

Yes

Olmo et al., 1986

30+1B (1)

small

Yes

Thompson and Sites, 1986

50+1B (1) 50+2B (3) 50+3B (2) 50+1B (1)

medium

No

Yonenaga-Yassuda and Rodrigues, 1999

medium

No

62+1B (1) 62+2B (1) 36+1B (1) 36+1B/36+2B (1) 38+1B (1)

medium

No

Yonenaga-Yassuda and Rodrigues, 1999 Pellegrino et al., 1999

medium

Yes

Bertolotto et al., 2002

small

Yes

Pellegrino et al., (unpublished data)

Lacerta parva (Lacertidae) Mabuya aurata septemtaeniata Anolis grahami Lacerta lepida Takydromus sexlineatus (Lacertidae) Scelopurus graciosus (Phrynosomatidae) Micrablepharus atticolus (Gymnophthalmidae) Micrablepharus maximiliani

2n=50 (2)

Nothobachia ablephara (Gymnophthalmidae) Enyalius bilineatus (Leiosauridae)

2n=62 (5)

Gymnodactylus geckoides amarali (Gekkonidae)

2n=36 (4) (12M+24m) 2n=38 (8) 2n=39 (3) 2n=40 (7)

40+1B/40+2B (1)

The number of specimens analysed and the number of macro- (M) and micro- (m) A chromosomes are indicated in brackets.

diate-sized elements between them. In other species showing karyotypes with chromosomes gradually decreasing in size, B chromosomes have an intermediate size between the larger and the smaller A chromosomes. Hereafter, we represent the karyotypes with macro- and microchromosomes by the formula (M + m), and those without these two distinctive groups of chromosome are named as gradual karyotypes. Beçak and colleagues (1972) studying Tropidurus torquatus from Minas Gerais, Maranha˜o and Sa˜o Paulo (Brazil), found individuals with one or two small submetacentric B macrochromosomes, revealing a diploid number variation at the intraindividual level (Table 1). Bs turned out as a univalent or bivalent at metaphase I and showed heteropycnosis and allocycly during meiosis. No pairing between the Bs and any A chromosome was observed. In Mabuya mabouya mabouya, they also found one specimen from Maranha˜o with 2n = 30 + 1B due to the occurrence of an extra acrocentric chromosome of intermediate size between the M and m (Table 1). Bertolotto et al. (2002) described specimens with 2n = 36 + 1B and 2n = 36 + 1B/36 + 2B in Enyalius bilineatus from Minas Gerais (Brazil). The karyotypes were the result of one or two submetacentric supernumeraries with an intermediate size between the M and m (Table 1). In meiosis of the mosaic specimen a putative univalent was observed.

244 102

Cytogenet Genome Res 106:243–246 (2004)

Reports of B microchromosomes include those initially described by Gorman et al. (1968) in Anolis cristatellus wileyae, with a karyotype of 2n = 28 (12M + 16m) in females and 2n = 27 (12M + 15m) in males due to a multiple chromosome mechanism of sex determination. In specimens from two islands east of Puerto Rico, an extra microchromosome and one univalent were found in a mosaic male 2n = 27/27 + 1B from Vieques island, and one univalent in a different male from Cayo Lobos island (Table 1). Bezy and colleagues (1977) studied Anniella pulchra from populations of northern (2n = 22, 16M + 6m) and southern (2n = 20, 16M + 4m) regions of California (United States) and Baja California (Mexico). One to four B microchromosomes in specimens from northern Baja California and a single B in specimens from Isla Todos Santos were found (Table 1). They form uni-, bi- and trivalents at meiosis and apparently are eliminated in somatic cells, which always showed 2n = 20 (16M + 4m). Accumulation of polysomics rather than the retention of either fusion fragments or microchromosomes is suggested as the more likely mechanism for the origin of these chromosomes in Anniella. Kupriyanova (1980) evaluated the influence caused by the presence of B chromosomes on chiasma frequency in A chromosomes in Lacerta parva from north Armenia. One male

Fig. 1. Metaphases of Micrablepharus atticolus, female 2n = 51 with the presence of one B chromosome (arrows). (a) Conventional staining; (b) CBG-banding; (c) RBG-banding. Bar = 10 Ìm.

showed a variable number of chromosomes due to one or two extra microchromosomes (Table 1), and an increase of chiasma frequency in the A chromosomes was also observed. Olmo et al. (1986) found individuals of the species Takydromus sexlineatus (Thailand) and Lacerta lepida (Spain) bearing supernumerary microchromosomes (Table 1). Mitotic plates with 38, 40 and 42 chromosomes were observed in Takydromus sexlineatus; however at diplotene cells only 20 or 21 bivalents were present. The author considered 2n = 40 as the normal karyotype of this species. An additional univalent was present in some meiocytes of male specimens of Lacerta lepida (Table 1). Thompson and Sites (1986) karyotyped several individuals of Sceloporus graciosus from seven states in the United States (Table 1). A single male showed an extra microchromosome in some meiotic cells, interpreted as a supernumerary. There were no mitotic spreads available for this individual. Blake (1986) studied the chromosomal variations (2n = 30–37) due to different rearrangements and number of macro- and microchromosomes, including accessory micros, in several populations of Anolis grahami from Jamaica. In two specimens, an extra pair of microchromosomes was present in some meiotic metaphase I spreads. In another individual, only one extra and one univalent were detected in mitotic and meiotic cells, respectively. Yonenaga-Yassuda and Rodrigues (1999) reported B chromosomes with intermediate size in the gradual karyotype of Micrablepharus atticolus and M. maximiliani from Goia´s, Mato Grosso and Mato Grosso do Sul (Brazil) (Table 1). Diploid number variation in M. atticolus was attributed to a supernumerary system including one to three different mediumsized metacentric or submetacentric Bs (Table 1; Fig. 1). Diplotene cells of one specimen (2n = 50 + 3B) revealed 25 bivalents plus three univalents, and no homology between Bs and A chromosomes. In M. maximiliani three different karyotypes were detected, one of them with one medium-sized submetacentric B (2n = 50 + 1B; Table 1). Similarly, in Nothobachia ablephara from Bahia (Brazil), deviation from the standard gradual karyotype was attributed to one or two distinct medium-sized subtelocentric Bs (Pellegrino et al., 1999; Table 1).

In specimens of Gymnodactylus geckoides amarali from Goia´s and Mato Grosso (Brazil) six different gradual karyotypes differing for fusion/fission rearrangements and the presence of supernumeraries have been found (Pellegrino et al., unpublished data). One specimen with 2n = 38 + 1B showed a small acrocentric B and a second specimen was a mosaic 2n = 40 + 1B/40 + 2B with two different small B chromosomes (Table 1), one being acrocentric and the other metacentric. In their seminal review, Jones and Rees (1982) reported the occurrence of one to four supernumeraries in Mabuya aurata septemtaeniata (2n = 32 + 1–4B), but no information about size and morphology of these extra chromosomes was provided.

Differentially stained karyotypes and B chromosomes in lizards Reports characterizing B chromosomes in lizards using differential staining techniques are far fewer. Up to date, cytogenetic investigations employing C- and replication R-banding and Ag-NOR staining on species bearing Bs were performed only with the chromosomes of the microteiids Micrablepharus atticolus (Fig. 1), M. maximiliani and Nothobachia ablephara (Yonenaga-Yassuda and Rodrigues, 1999; Pellegrino et al., 1999), and the leiosaurid Enyalius bilineatus (Bertolotto et al., 2002). Different patterns of constitutive heterochromatin were observed in the B chromosomes of M. atticolus, but the B chromosome of the congeneric M. maximiliani was only slightly stained after C-banding. The Bs of both Micrablepharus species exhibited a late-replicating DNA pattern after replication Rbanding. In Nothobachia ablephara, although the Bs did not show any peculiar heterochromatic C-banding pattern, they were also late replicating, which is typical for B heterochromatin. A similar situation was observed in the B chromosome of Enyalius bilineatus, which was not darkly C-banded, but, after R-banding, the B in an individual with 2n = 36 + 1B was almost entirely late replicating, whereas in cells with two Bs of a mosa-

Cytogenet Genome Res 106:243–246 (2004)

245 103

ic specimen, only one B exhibited this pattern. Finally, in the mosaic specimen of Gymnodactylus geckoides amarali, the metacentric B was entirely late replicating, but this pattern was not observed in the acrocentric B (Pellegrino et al., unpublished data).

Conclusions Similar to B chromosomes in other species of animals and plants, in lizards, small Bs tend to be mitotically unstable and show intraindividual variation in B number (all eight cases in Table 1), but medium-sized Bs tend to be mitotically stable (four out of six cases in Table 1). They also appear to vary geographically, occurring only in some populations. Furthermore, these chromosomes have different morphologies and sizes, but

are predominantly small or medium-sized. Most studies employing replication R-banding revealed Bs as being composed of late replicating DNA, and, after C-banding, they may either be darkly C-banded or exhibit no distinctive pattern. To date, there is no record of B chromosomes bearing Ag-NORs in lizards. Considering that lizards are still poorly explored in cytogenetic studies, the karyotyping of additional taxa may increase the number of findings of Bs within the group. Moreover, available reports are all based on routine cytogenetic techniques, except for only a few studies that used differential staining. Further studies specifically designed to address questions related to either composition, structure, or origin and evolution are also needed to better characterize these peculiar chromosomes in species of lizards.

References Baldissera FA, Oliveira PSL, Kasahara S: Cytogenetics of four Brazilian Hyla species (Amphibia-Anura) and description of a case with a supernumerary chromosome. Rev Brasil Genet 16:335–345 (1993). Beçak ML, Beçak W, Denaro L: Chromosome polymorphism, geographical variation and karyotypes in Sauria. Caryologia 25:313–326 (1972). Berend SA, Hale DW, Engstrom MD, Grennbaum IF: Cytogenetics of collared lemmings (Dicrostonyx groenlandicus). II. Meiotic behaviour of B chromosomes suggests a Y-chromosome origin of supernumerary chromosomes. Cytogenet Cell Genet 95: 85–91 (2001). Bertolotto CEV, Pellegrino KCM, Rodrigues MT, Yonenaga-Yassuda Y: Comparative cytogenetics and supernumerary chromosomes in the Brazilian lizard genus Enyalius (Squamata, Polychrotidae). Hereditas 136:51–57 (2002). Bezy RL, Gorman GG, Kim YJ, Wright JW: Chromosomal and genetic divergence in the fossorial lizards of the family Anniellidae. Syst Zoology 26:57– 71 (1977). Blake JA: Complex chromosomal variation in natural populations of the Jamaican lizard Anolis grahami. Genetica 69:3–17 (1986). Brinkman JN, Sessions SK, Houben A, Green DM: Structure and evolution of supernumerary chromosomes in the Pacific giant salamander, Dicamptodon tenebrosus. Chromosome Res 8:477–485 (2000). Cavallaro ZI, Bertollo LA, Perfectti F, Camacho JP: Frequency increase and mitotic stabilization of a B chromosome in the fish Prochilodus lineatus. Chromosome Res 8:627–634 (2000). Gorman GC, Thomas R, Atkins L: Intra- and interspecific chromosome variation in the lizard Anolis cristatellus and its closest relatives. Breviora 293: 1–13 (1968).

246 104

Green DM: Supernumerary chromosomes in amphibians, in Green DM, Sessions SK (eds): Amphibian Cytogenetics and Evolution, pp 333–357 (Academic Press, New York 1991). Hayman DL, Martin PG, Waller PF: Parallel mosaicism of supernumerary chromosomes and sex chromosomes in Echymipera kalabu (Marsupiala). Chromosoma 27:371–380 (1969). Jones RN, Rees H: B Chromosomes (Academic Press, New York 1982). Karamysheva TV, Andreenkova OV, Bochkaerev MN, Borissov YM, Bogdanchikova N, Borodin PM, Rubtsov NB: B chromosomes of Korean field mouse Apodemus peninsulae (Rodentia, Murinae) analysed by microdissection and FISH. Cytogenet Genome Res 96:154–160 (2002). Kupriyanova LA: B-chromosomes in the karyotype of Lacerta parva. Boul Genetica 53:223–226 (1980). Lopez-Leon MD, Neves N, Schwarzacher T, HeslopHarrison TS, Hewitt GM, Camacho JPM: Possible origin of a B chromosome deduced from its DNA composition using double FISH technique. Chromosome Res 2:87–92 (1994). Maistro EL, Oliveira C, Foresti F: Cytogenetic analysis of A- and B-chromosomes of Prochilodus lineatus (Teleostei, Prochilodontidae) using different restriction enzyme banding and staining methods. Genetica 108:119–125 (2000). Olmo E, Odierna G, Cobror O: C-band variability and phylogeny of Lacertidae. Genetica 71:63–74 (1986). Pauls E, Bertollo LAC: Evidence for a system of supernumerary chromosomes in Prochilodus scrofa Steindachner, 1881 (Pisces, Prochilodontidae). Caryologia 36:307–314 (1983). Pellegrino KCM, Rodrigues MT, Yonenaga-Yassuda Y: Chromosomal polymorphisms due to supernumerary chromosomes and pericentric inversions in the eyelidless microteiid lizard Notobachia ablephara (Squamata, Gymnophthalmidae). Chromosome Res 7:247–254 (1999).

Cytogenet Genome Res 106:243–246 (2004)

Schmid M, Ziegler CG, Steinlein C, Nanda I, Haaf T: Chromosome banding in Amphibia. XXIV. The B chromosomes of Gastrotheca espeletia (Anura, Hylidae). Cytogenet Genome Res 97:205–218 (2002). Sharbel TF, Green DM, Houben A: B-chromosome origin in the endemic New Zealand frog Leiopelma hochstetteri through sex chromosome devolution. Genome 41:14–22 (1998). Silva MJJ, Yonenaga-Yassuda Y: Heterogeneity and meiotic behaviour of B and sex chromosomes, banding patterns and localization of (TTAGGG)n sequences by FISH, in the Neotropical water rat Nectomys (Rodentia, Cricetidae). Chromosome Res 6:455–462 (1998). Thompson P, Sites JW: Two aberrant karyotypes in the sacebrush lizard (Sceloporus graciosus): triploidy and a “supernumerary” oddity. Great Basin Naturalist 46:224–227 (1986). Venere PC, Miyazawa CS, Galetti PM: New cases of supernumerary chromosomes in characiform fishes. Genet Mol Biol 22:345–349 (1999). Volobujev VT: B-chromosomes system of the mammals. Caryologia 34:1–23 (1981). Yonenaga-Yassuda Y, Rodrigues MT: Supernumerary chromosome variation, heteromorphic sex chromosomes and banding patterns in microteiid lizards of the genus Micrablepharus (Squamata, Gymnophthalmidae). Chromosome Res 7:21–29 (1999). Yonenaga-Yassuda Y, Assis MFL, Kasahara S: Variability of the nucleolus organizer regions and the presence of the rDNA genes in the supernumerary chromosome of Akodon aff. arviculoides (Cricetidae, Rodentia). Caryologia 45:163–174 (1992). Ziegler CG, Lamatsch DK, Steinlein C, Engel W, Schartl M, Schmid M: The giant B chromosome of the cyprinid fish Alburnus alburnus harbours a retrotransposon-derived repetitive DNA sequence. Chromosome Res 11:23–35 (2003).

Review on B Chromosomes Cytogenet Genome Res 106:247–256 (2004) DOI: 10.1159/000079295

B chromosomes in populations of mammals M. Vujosˇevic´ and J.Blagojevic´ Department of Genetics, Institute for Biological Research, Belgrade (Serbia and Montenegro)

Abstract. B chromosomes (Bs) have been found in 55 out of 4629 living species of mammals. The summarized data show great variability in types of mammalian Bs, including differences in size, shape and molecular composition. This variability extends to the origin, mode of transmission and population dynamics. In general, B chromosomes in mammals do not differ from Bs found in other animal or plant species, but some peculiarities do exist. Most species in which Bs are found are widespread. Some data support the view that Bs may contribute to the successful expansion of some of these species, but it is

possible that Bs are just more easily scored in them due to their frequent occurrence. Most of these species are also characterized by cycling fluctuations of abundance and characteristic social organization that produce conditions favorable for Bs to spread. All areas of research on Bs in mammals suffer from lack of data, emphasizing the necessity for intensified research on the molecular structure and ways of maintenance of Bs in populations.

B chromosomes (Bs) appear as supernumerary to the standard chromosome complement in some members of some populations in some species, but not in others (Jones and Rees, 1982). The term, Bs, covers a wide variety of accessory chromosomes that do not share any feature except a “dispensable nature”. This expression, although not easily translatable in some languages, covers all varieties of Bs. A number of other features, characterizing many of them but not all, gives a more complete picture of Bs. These characteristics give Bs enough discrepancy with respect to standard members of the karyotype to enable them to evolve more or less independently (Camacho et al., 2000).

What is special about B chromosomes? Their dispensable nature, widespread occurrence, diverse origin and other phenomena encompass Bs with enough mystery to make them a very attractive topic for research. Bs are found in fungi, plants and animals. They are observed in all major taxonomic groups of animals except birds, although the extra chromosome found in the zebra finch (Pigozzi and Solari, 1998) might be considered a B chromosome. Genome size in birds (Tiersch and Wachtel, 1991) is small and has a narrow range (2–4 pg). The repeat content in birds is the lowest among vertebrates (15–20 % repeats), which may be the reason why birds cannot tolerate the presence of Bs. Trivers et al. (2004) found that, in flowering plants, the presence of Bs positively covariates with total genome size, so that Bs are largely absent from species with small genomes. According to Wilson and Reeder (1993), there are 4629 species of mammals. At present, Bs have been found in 55 mammalian species (Table 1), but this is certainly not the final number. When the presence of Bs was reviewed in mammals for the first time (Volobujev, 1980) only 14 species were listed. Compared to plants and insects, in which Bs were noticed at the beginning of the 20th century and for which lists of species possessing them are long, chromosome investigations in mammals are of recent origin due to technical difficulty. Since B chromosomes are present in

Supported by the Ministry for Science, Technology and Development of the Republic of Serbia, Grant No. 1693. Received 28 August 2003; manuscript accepted 20 January 2004. Request reprints from Mladen Vujosˇevic´ Department of Genetics, Institute for Biological Research 29 novembra 142, 11060 Belgrade (Serbia and Montenegro) telephone: +381-11-2078332; fax: +381-11-761433 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0247$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. List of mammalian species with B chromosomes Species

2n

No. Bs

c

Bs morphology a

Size

Cent. position

M

References b

1

Peramelemorphia Echymipera kalubu

14

1–5

I

2

Diprotodontia Petauroides (Schoinobates) volans

22

1–8

I

Hayman and Martin (1965), McQuade et al. (1994)

3

Insectivora Crocidura suaveolens

40

1

II

Meylan and Hausser (1974)

4 5

Chiroptera Myotis macrodactylus Nyctalus leisleri

44 44

1 1–3

6

Primates Alouatta seniculus

46

1–3

I

A

Yunis et al. (1976), Vassart et al. (1996)

Carnivora Nyctereutes p. procyonides Nyctereutes p. viverinus Vulpes bengalensis Vulpes vulpes (fulvus)

54 38 34 34

2–4 1–5

II II

SM, A A

1–8

I

M, A

Makinen and Fredga (1980) Ward (1984) Bhatnagar (1973) Moore and Elder (1965), Yang et al. (1999)

Artiodactyla Capreolus pygargus Mazama americana Mazama gouazoubira Moschus sibiricus

70 52 70 58

1–14 5 1–2 1–2

I I I

mi mi mi

Neitzel (1987), Tokarskaia et al. (2000) Neitzel (1987) Neitzel (1987) Sokolov and Prikhodko (1998)

Rodentia Akodon mollis Akodon montensis (arviculoides) Apodemus agrarius Apodemus argenteus Apodemus flavicollis Apodemus mystacinus Apodemus peninsulae ( = giliacus) Apodemus speciosus Apodemus sylvaticus Bandicota indica Cricetulus triton Dasymys rufulus Dicrostonyx groenlandicus Dicrostonyx kilangmiutak Dicrostonyx torquatus Golunda ellioti Holochilus brasiliensis Holochilus vulpinus Mastacomys fuscus Melomys cervinipes Microtus gregalis Microtus longicaudus Mus shortridgei Nectomys rattus Nectomys squamipes Oecomys cf. concolor Oligoryzomys flavescens Oryzomys angouya Oryzomys fornesy Otomys irroratus Perognathus baileyi Proechimys (Trinomys) iheringi Rattus fuscipes Rattus rattus Rattus r. diardii Rattus r. frugivorus Rattus r. kandianus Rattus r. tahnezumi Rattus r. thai Rattus tunneyi Reithrodontomys megalotis Sigmodon hispidus Thamnomys (Grammomys) gazzelae

22 24 48 46 48 48 48 48 48 44 48 36 38–44 47–50 44–45 54 48–51 36 48 48 36 56 46 52 56 60 64 58 64 24–26 46 60 38 42 42 38 40 42 42 42 42 52 56

1 1 1 1 1–9 2 1–24 1–3 1–3 1–3 1–2 1–3 1–3 1–8 1–15 1–4 1–2 1–3 1 1–12

II II I, II I, II II

M M mi, A mi, SM A

I, II, III II II II

mi, SM, M, A M A SM

II II II II II II, III II II I, II

M M, A M SM, M A SM, M A A SM, A

I, II II II I I I I I II I II II II II II II

M, A SM, M, A SM, A SM A M A SM, M mi, M mi M M M M M M

II I

M mi

I, II

A

Lobato et al. (1982) Yonenaga-Yassuda et al. (1992) Kartavtseva (1994) Obara and Sasaki (1997) Soldatovic et al. (1975), Zima and Mácholan (1995) Belcheva et al. (1988) Hayata (1973), Volobujev and Timina (1980) Kral (1971) Vujoševic and Živkovic (1987) Gadi et al. (1982) Wang et al. (1999) Volobouev et al. (2000) van Wynsberghe and Engstrom (1992) Gileva (1973) Gileva (1983) Rao et al. (1979) Freitas et al. (1983) Nachman (1992a) Baverstock et al. (1977) Baverstock et al. (1977) Kovalskaja (1988) Judd and Cross (1980) Gropp et al. (1973) Maia et al. (1984) Yonenaga-Yassuda et al. (1987) Andrades-Miranda et al. (2001) Sbalqueiro et al. (1991) Silva and Yonenaga-Yassuda (this issue) Myers and Carleton (1981) Contrafatto et al. (1992) Patton (1972) Yonenaga-Yassuda et al. (1985) Baverstock et al. (1977) Wahrmann and Gourevitz (1973) Yong and Dhaliwal (1972) de Guevara and de la Guardia (1981) Yosida (1976) Yosida (1976) Gropp et al. (1970) Baverstock et al. (1977) Blanks and Shellhammer (1968) Zimmerman (1970) Civitelli et al. (1989)

7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47

48 49 50 51

248 106

1–12 1–3 1–3 1–3 1–2 1–2 2 1–2 1–9 1–10 1–5 1 1–3 1–4 1–3 1 1 1–6 1 1–7 3–4 2–17

Cytogenet Genome Res 106:247–256 (2004)

Hayman et al. (1969)

Obara et al. (1976) Volleth (1992)

Table 1 (continued) Species

2n

No. Bs

a

52 53 54 55 a b c

Thomomys bottae Thomomys umbrinus Tscherskia triton Uromys caudimaculatus

76 76–78 28 46

1–12 6–12 1–2 1–12

c

Bs morphology Size

Cent. position

I I II II

mi mi A SM, M, A

References b

Patton and Sherwood (1982) Patton and Sherwood (1982) Borisov et al. (1978) Baverstock et al. (1976)

I – smaller than chromosomes from A set, II – same as A, III – larger than A chromosomes. mi – micro, SM – submetacentric, M – metacentric, A – acrocentric chromosomes. When two references are present the second one regards the maximal number of Bs.

some individuals of a species, not in all, they could be overlooked if not enough animals are studied. Likewise, Bs are not always present in all tissues, which could be another reason for not scoring their presence. Up to now Bs have been detected in little more than 1 % of mammalian species (F 1.2 %). If we estimate that about one third of existing species of mammals have been studied karyologically, then the possible frequency of mammalian species with Bs is about 3.6 %. Beukeboom (1994) concluded that Bs are present in 15 % of described living species and this statement is cited often. Likewise, Jones (1995) estimated that about 15 % of flowering plants carry B chromosomes. It is thus likely that B chromosomes are less frequent in mammals than other organisms, perhaps because of a lower tolerance to parasitic Bs. The first mammalian species in which Bs were found were the greater glider, Schoinobates volans (now Petauroides volans) (Hayman and Martin, 1965) and the red fox, Vulpes vulpes (Moore and Elder, 1965). Later on studies disclosed that Bs are mostly outspread among rodents (42 species, F 2.1 %, i.e. double the frequency of mammals in general). In attempting to establish the exact number of mammalian species possessing Bs, we encountered many taxonomic charades. Some species appear in the literature with two or even three different scientific names, so taxonomic names in this article are used according to Wilson and Reeder (1993).

Morphological characteristics of B chromosomes Morphological similarity or dissimilarity in size with A chromosomes was the main criterion in the assignment of mammalian Bs to different categories (Volobujev, 1980; Vujosˇevic´, 1993) (Table 1). The first group includes Bs that are smaller than the smallest A chromosome in the complement. According to the position of the centromere, Bs can be meta-, submeta- or acrocentric, but sometimes they are so small (micro or dot-like) that it is difficult to make a decision. The second group consists of Bs within the size of chromosomes of the standard complement, although Bs of size similar to the smallest A chromosomes prevail. Most Bs in mammals belong to this group. B chromosomes that are larger than A chromosomes pertain to the third group. Such Bs are rare and have been found in only

three species: Uromys caudimaculatus (Baverstock et al., 1976), Holochilus brasiliensis (Nachman, 1992a) and Apodemus peninsulae (Kartavtseva et al., 2000). In the last species, the appearance of large Bs is a rare event and most Bs are dot like or small meta- and submetacentrics. In a number of species, Bs belonging to two of the mentioned groups exist at the same time. In addition, Bs may differ or not from A chromosomes in centromere position, although a significant positive association seems to exist in mammals between A and B chromosome morphology (Palestis et al., 2004). For instance, in the yellow-necked mice, Apodemus flavicollis, and the wood mice, A. sylvaticus, all Bs are acrocentrics as are all chromosomes of the standard complement (Vujosˇevic´ ˇ ivkovic´, 1987), while in A. speciosus Bs are meta and suband Z metacentric (Bekasova et al., 1980), in contrast to the all-acrocentric normal complement. In some cases both situations are present in the same species. An example is the white-tailed rat, Uromys caudimaculatus, where up to 12 Bs per animal are found with very variable morphology, size and response to differential staining (Baverstock et al., 1982).

Frequency of B chromosomes As with Bs in other taxa, different levels of variability exist in mammals. Intraindividual, intrapopulational and interpopulational variability could include the presence or absence of Bs, maximum number of Bs and variability in the frequency of animals with Bs. In Echymipera kalubu, Bs seem to be restricted to testicular tissue and the corneal epithelium (Hayman et al., 1969). Variation in the number of Bs may be found in the same tissue or between different tissues. Thus, tissue mosaicism for the number of Bs has been reported in Rattus rattus (Gropp et al., 1970), Apodemus peninsulae (Bekasova et al., 1980), Vulpes vulpes, (Belyaev et al., 1974a), Thamnomys gazellae (Civitelli et al., 1989) and Apodemus flavicollis (our unpublished data). The most obvious variation in the number of Bs is evident at both intra- and interpopulational levels. Although the presence of one B chromosome is the most common situation, variation in the number of Bs per animal can be broad. Up to 24 Bs in a single animal have been found in Apodemus peninsulae, 17 Bs in Thamnomys gazzelae, and 15 Bs in Dicrostonyx torquatus

Cytogenet Genome Res 106:247–256 (2004)

249 107

(Table 1). The average maximum number of Bs per specimen found in mammalian species, as deduced from Table 1, is 6.2. Variation in B frequency seems to be high in Rattus rattus. In a population from Nepal the number of Bs varied from 0 to 2 (Pathak, 1971), in Malayan populations from 0 to 4 (Yong and Dhaliwal, 1972; Yosida and Sagai, 1975; Yosida, 1977, 1978) and in Thailand from 0 to 6 (Gropp et al., 1970). All Bs were morphologically identical small metacentrics. The same type of Bs has been found in black rats from Oceania (Yosida and Sagai, 1975). Similar variation in B frequency has been found in Perognathus baileyi (Patton, 1972). In Uromys caudimaculatus, Bs are present only in the southern race, varying from 2–5 in the most southern population of this race to 9–12 in the most northern (Baverstock et al., 1982). In some species, Bs are found in populations over a wide geographic range. This especially concerns two species of the genus Apodemus, A. peninsulae and A. flavicollis. In A. flavicollis, B chromosome prevalence (the frequency of B-carrying individuals) ranged among 0.11 to 0.63 in 13 out of 14 populations studied in former Yugoslavia (Vujosˇevic´ et al., 1991; Vujosˇevic´ and Blagojevic´, 2000). Populations with Bs occur through a wide range of species distribution (summarized in Kartavtseva, 2002). Vujosˇevic´ and Blagojevic´ (2000) observed that the frequency of Bs increased with altitude and was positively correlated with extreme climatic conditions. Zima and Machola´n (1995) did not detect correlations with altitude, but found a slightly increasing trend in B chromosome frequency from central to eastern and southeastern Europe. Clinal increase in the number of Bs (from 1 to 14) in West-East direction was found in Siberian roe deer (Hewison and Danilkin, 2001). Giagia et al. (1985) proposed that Bs are more numerous in Apodemus flavicollis in areas with industrial pollution, but the results of Zima et al. (1999) rejected this hypothesis. However, Shellhammer (1969) claimed for a general increase in genetic variability towards the periphery of species distribution as the most reasonable explanation for B frequency variation in Reithrodontomys megalotis. The same was suggested for Perognathus baileyi (Patton, 1972), while Boyeskorov et al. (1994) found the highest B prevalence in A. flavicollis (0.81) in the easternmost part of its area i.e. in a peripheral area with unfavorable conditions. Much higher frequencies of animals with Bs were found in populations of Apodemus peninsulae (95.6 and 97.8 % respectively) by Volobujev (1981) and Zima and Machola´n (1995). In many populations in the Russian Far East all animals possess Bs (Kartavtseva et al., 2000). This species exhibits B chromosome polymorphism with individual variants of five B classes throughout its vast range (from Altai to the Pacific Ocean coast) except for Sakhalin Island (Kartavtseva et al., 2000). The number of Bs varied up to 24 in Siberian populations (Volobujev, 1980) due to increases or decreases in the number of dot-like Bs. Such variation is also characteristic for A. peninsulae in Hokkaido (Hayata, 1973). In the Russian Far East, variation in the number of Bs is limited to 6 and dot-like Bs are not present (Kral, 1971; Kartavseva et al., 1988) indicating that this species has a locality-dependent B chromosome system. Contrary to such high frequencies of Bs in A. peninsulae and A. flavicollis, Zima and Machola´n (1995) found that the fre-

250 108

Cytogenet Genome Res 106:247–256 (2004)

quency of A. sylvaticus individuals with Bs is very low (2.4 %). Kartavtseva (1994) also found that such sporadic occurrence of Bs is characteristic for the striped field mouse, Apodemus agrarius. While A. peninsulae and A. flavicollis are typical forest-dwelling species, A. sylvaticus is limited to the edges of forests and A. agrarius is a typical field mouse.

Structure and composition of B chromosomes The structure of Bs has mostly been characterized by the C-banding technique. Rarely, Bs can be C-negative. Most commonly, Bs appear as small completely darkly C-banded chromosomes but large Bs can also be completely darkly C-banded (Table 2). In a number of species, different C-banded types of Bs exist at the same time. Patton (1972, 1977) observed two types of Bs in Perognathus baileyi, which differed not only in size but also in the distribution of C-bands. While small Bs (type I) were totally heterochromatic, type II Bs could have Cbands located in the centromeric region only. In Nyctereutes procyonoides, Wurster-Hill et al. (1986) found that C-banding patterns of B chromosomes varied between individuals, but none of them was completely darkly C-banded. A similar situation was found in Nectomys squamipes (Silva and YonenagaYassuda, 1998), where three types of Bs were found, each having a different C-band distribution. In the yellow pygmy rice rat, Oryzomys flavescens (= Oligoryzomys flavescens), Bs were completely darkly C-banded but, in comparison to the A chromosomes, the staining was less intense. The heterochromatic nature of B chromosomes is also deduced from 5-BrdU incorporation. In Rattus rattus (Raman and Sharma, 1974) and Vulpes vulpes (Volobujev et al., 1976), Bs have been shown to be late replicating. In Nectomys squamipes (Yonenaga-Yassuda et al., 1988), the pattern of 5-BrdU incorporation clearly demonstrated that Bs were late replicating, except in a proximal band in the long arm showing early replication. Attempts to unmask the structure of Bs by G-banding techniques were much less successful in comparison to the results of C-band applications. Thus, in Holochilus brasiliensis (Yonenaga-Yassuda et al., 1987; Nachman and Myers, 1989), Nyctereutes procyonoides (Wurster-Hill et al., 1986) and Nectomys squamipes (Silva and Yonnenaga-Yassuda, 1998) no G-bands were apparent on B chromosomes. In the yellow-necked mouse, Apodemus flavicollis, G-bands on Bs were homologous to bands ˇ ivkovic´, 1987) while on small A chromosomes (Vujosˇevic´ and Z in Uromys caudimaculatus (Baverstock et al., 1982) and Nectomys squamipes (Yonenaga-Yassuda et al., 1988) the pattern of G-bands on Bs was quite different from that on A chromosomes. The presence of rDNA genes has been detected using silverstained NORs in only two species: Akodon montensis (Castro, 1989; Yonenaga-Yassuda et al., 1992) and Apodemus peninsulae (Boeskorov et al., 1995). However, in the last species this was not confirmed by application of FISH with labeled ribosomal DNA (Trifonov et al., 2002). Moreover, in the first species positive NOR staining was found in only one animal out of four (Yonenaga-Yassuda et al., 1992).

Table 2. C-banding response of B chromosomes

Species

C-negative C-positive Completely Partially dark dark

Akodon mollis Apodemus argenteus Apodemus flavicollis

+ + +

(b)

+

(a)

Apodemus peninsulae Apodemus sylvaticus Bandicota indica Dasymys rufulus Holochilus brasiliensis

+ + (a) +

+

Mastacomys fuscus Mazama americana Mazama gouazoubira Nectomys squamipes Nyctereutes procyonoides

+ + + + (a) +

+ (b) +

Oecomys concolor Oligoryzomys flavescens Perognathus baileyi Proechimys iheringi Rattus rattus Thamnomys gazellae Uromys caudimaculatus

+ + +

+

Although data on the molecular features of B chromosomes are not numerous in mammals, they have been steadily accumulating in recent years and mainly reflect their heterogeneity. Wurster-Hill et al. (1986, 1988) characterized B chromosomes in two subspecies of raccoon dog, Nyctereutes procyonides. They found that the large B chromosome from one subspecies and the small B chromosome from the other subspecies both contained clusters of telomeric sequences along their length that hybridized with the telomeric probe. Interstitial telomeric bands have also been found in a B chromosome in Nectomys squamipes (Silva and Yonenaga-Yassuda, 1998). McQuade et al. (1994) used a combination of micromanipulation and PCR to examine the molecular composition of Bs in the greater glider, Petauroides volans. Bs in this species were found to be composed of a heterogeneous mixture of sequences, some of which were unique, while others shared homology with centromeric regions of A chromosomes. Peppers et al. (1997) used fluorescence in situ hybridization to characterize two types of Bs in the harvest mouse, Reithrodontomys megalotis, by examining the presence or absence of rDNA, LINE elements, telomeric repeats and centromeric heterochromatin. Telomeric repeats were present on both arms of Bs of both types as well as LINE elements, while ribosomal genes were absent. Using in situ hybridization Stitou et al. (2000) demonstrated the presence of non-transcribed ribosomal genes in Bs of the black rat, Rattus rattus. Tanic´ et al. (2000) did not find differences between specimens with and without Bs in yellow-necked mice, Apodemus flavicollis, using comparative restriction enzyme analysis, but the application of AP-PCR based DNA profiling revealed molecular markers specific for B chromosomes. Both qualitative and quantitative changes in the genome of yellow-necked mice harboring Bs were detected.

Similar to As

+

(b)

+ +

+ + + +

+ (b)

+

(b)

References

Lobato et al. (1982) Obara and Sasaki (1997) (a) Vujoševic and Živkovic (1987), (b) Zima and Kral (1984) Hayata (1973) Vujoševic and Živkovic (1987) Gadi et al. (1982) Volobouev et al. (2000) (a) Nachman (1992a), (b) Yonenaga-Yassuda et al. (1987) Baverstock et al. (1977) Neitzel (1987) Neitzel (1987) Yonenaga-Yassuda et al. (1988) (a) Trifonov et al. (2002), (b) Wurster-Hill et al. (1986) Andrades-Miranda et al. (2001) Sbalqueiro et al. (1991) Patton (1972, 1977) Yonenaga-Yassuda et al. (1985) Yosida (1977) Civitelli et al. (1989) Baverstock et al. (1977)

Trifonov et al. (2002) studied B chromosomes in the raccoon dog, Nyctereutes procyonides, and the Asian wood mouse, Apodemus peninsulae, using chromosome segment microdissection and double-color FISH. Bs in the raccoon dog showed molecular heterogeneity and were not homologous with A chromosomes. In contrast, Bs in the Asian wood mouse contained sequences homologous to the heterochromatic regions of sex chromosomes and of some A chromosomes. Moreover, two types of B-specific chromatin existed, named B1 and B2. Most Bs had one of them but some were composed of both. Karamysheva et al. (2002) using whole and partial chromosome probes obtained by microdissection and DOP-PCR found that all B chromosomes in A. peninsulae contained a large amount of repeated DNA sequences which are present in many copies in pericentromeric C-blocks of all autosomes and in non-centromeric blocks of sex chromosomes. In the same species Rubtsov et al. (this issue) found that DNA composition of micro and macro B chromosomes was different.

Meiotic behaviour of B chromosomes Meiotic behaviour of Bs in mammals has been investigated mostly during spermatogenesis. Bs most commonly appear as univalents in the first meiotic division, but bivalents also emerge in some species. In addition to univalents and bivalents, in a number of species Bs appear as multivalents, asymmetrical bivalents (Table 3), or as associations of bivalents with the standard set. In Nectomys squamipes analysis of the synaptonemal complex revealed auto-pairing of univalent Bs (Silva and Yonenaga-Yassuda, 1998). When Bs appear as univalents, in the silver fox, they show folding-back behaviour that ends as intrachro-

Cytogenet Genome Res 106:247–256 (2004)

251 109

Table 3. Behaviour of B chromosomes during meiosis Species

Univalents

Akodon mollis Akodon montensis Apodemus flavicollis Apodemus peninsulae Bandicota indica Crocidura suaveolens Dicrostonyx groenlandicus Echymipera kalubu Holochilus brasiliensis Nectomys squamipes Nyctereutes procyonides Oligoryzomys flavescens Perognathus baileyi Rattus rattus Reithrodontomys megalotis Tamnomys gazellae Trinomys iheringi Tscherskia triton Uromys caudimaculatus Vulpes fulvus Vulpes vulpes

+ + + + + + + + + + + + + + + + + + + + +

Bivalents

+ + +

+

+ + +

+

+

+

+

+

+

+

+

+

+

+ +

+

+ + + +

Transmission of B chromosomes Direct evidence for B chromosome accumulation has been obtained in only a few species. In silver fox males, the number of Bs was higher in germinative than somatic tissue (Radjabli et al., 1978). The same situation occurred in Perognathus baileyi (Patton, 1977) and Apodemus peninsulae (Kolomiets et al., 1988). In lemmings, univalent Bs were eliminated from the polar body and incorporated into secondary oocytes (Gileva and Chebotar, 1979). Evidence for accumulation of Bs has been obtained, by means of controlled crosses, in females of Rattus rattus (Yosida, 1978; Stitou et al., this issue) and Rattus fuscipes (Thomson, 1984). Pardo-Manuel de Villena and Sapienza (2001), from the analysis of 1170 mammalian karyotypes, found strong evidence that karyotypic evolution is driven by nonrandom segregation during female meiosis. They proposed the theory of centromeric drive based on a different ability of the two meiotic poles for capturing centromeres. Support for this theory has recently come from the work by Palestis et al. (2004) in respect to the presence of B chromosomes in mammals. They have shown that Bs among mammals are more common in species with acrocentric chromosomes, suggesting that changes in the direction of centromeric drive favoring acrocentric As also increase the success of Bs (for more details, see also Camacho, 2004). This result appeals for more analysis of B transmission in female mammals.

Cytogenet Genome Res 106:247–256 (2004)

Asymmetrical bivalents

+

mosomal pairing (S´witon´ski et al., 1987), which indicates the presence of repeated DNA sequences. In the collared lemming, Dicrostonyx groenlandicus, it was found that, besides univalents, bivalents and trivalents Bs can make synaptic associations with the Y chromosome (Berend et al., 2001).

252 110

Multivalents

References

Lobato et al. (1982) Kasahara (1978) Vujoševic et al. (1989) Bekasova and Vorontsov (1975) Gadi et al. (1982) Meylan and Hausser (1974) Berend et al. (2001) Hayman et al. (1969) Nachman (1992b) Silva and Yonenaga-Yassuda (1998) Shi et al. (1988) Sbalqueiro et al. (1991) Patton (1977) Raman and Sharma (1974) Blanks and Shellhammer (1968) Civitelli et al. (1989) Fagundes (1993) Kartavtseva et al. (1980) Baverstock et al. (1982) Switonski et al. (1987) Radjabli et al. (1978)

The effects of B chromosomes Although this is the darkest field of B chromosome research in mammals, the available data do not support the idea that Bs are genetically inert. Very little is known except that, as in other taxonomic categories, the presence of Bs is not phenotypically manifested. In general, most reported phenotypic effects of Bs are of a quantitative nature. Except for one character that was studied on a limited number of specimens, Shellhammer (1969) did not establish any correlation between the presence of Bs and variance of external and cranial features. He reported that Bs could influence physiological characteristics, such as behavior. Attempts to connect behavior with the presence of Bs were made in silver foxes by Belayev et al. (1974a, b), Volobujev and Radjabli (1974) and Volobujev et al. (1976). They divided foxes into three groups based on genetically determined types of behavior and analyzed patterns of variation in Bs. The first group was composed of foxes selected for domesticated behavior toward humans, the second group consisted of foxes selected for aggressive behavior and the third one was formed from not selected animals. They found that the frequency of mosaics for Bs was significantly different in the groups of silver foxes selected for particular behavior. The frequencies of mosaics were twice as high in selected groups relative to the group of not selected foxes. Wurster-Hill et al. (1986) observed significant positive correlations between the number of Bs and body weight, but not body length, in males of the Japanese raccoon dog. Moreover, in Apodemus flavicollis Zima and Machola´n (1995) found that animals with Bs were significantly heavier than those without, although this could be questioned, because the sample was pooled from a wide geographic area from animal populations with very different frequencies of Bs. In later studies Zima et al. (2003) confirmed the existence of significant relationship be-

tween mean number of Bs and body weight, but only in males. In the same species Blagojevic´ (1997) reported that variation in the number of Bs affected the degree of morphological integration of cranial traits, indicating that the level of correlation of cranial traits is higher in animals with Bs. Moreover, Blagojevic´ and Vujosˇevic´ (2000) showed that the presence of Bs influences the ratio between two morphometric cranial characters presumed to be discriminative between the sibling species A. flavicollis and A. sylvaticus.

Origin of Bs in mammals The way in which Bs arise in mammals is presumably similar to that in other taxonomic groups. Chromosomes of the same species (both autosomes and sex chromosomes) and of related species are seen as suitable sources for future Bs. Byproducts of chromosomal rearrangements are also accepted as candidates for this purpose. This is always the starting point from which the origin of Bs is discussed. Considering possible mechanisms that could increase the pool of potential Bs in a population will help much in elucidating the appearance and spread of Bs in populations of mammals. Such mechanisms may include virus infections (Bekasova and Vorontsov, 1975) and hormonal disturbances (Vujosˇevic´, 1987). Both situations are easily connected with the social organization of rodent populations as well as that of some other mammalian groups. The social organization of these groups provides an excellent background for the spread of viruses and it also commonly leads to overcrowding, which may be accompanied by hormonal disturbances. Viral infections are known to be a source of numerous chromosomal rearrangements, while hormonal disturbances can produce nondisjunction during meiotic divisions. When data on the origin of Bs in mammalian species are considered, it seems that there are more presumptions and circumstantial evidence than real proofs. Hayman et al. (1969) claimed that Bs in Echymipera kalubu were derived from sex chromosomes, based on the finding that Bs follow the same fate as sex chromosomes, which are eliminated from certain somatic tissues. Berend et al. (2001) suggest that frequent synapsis and recombination between Bs and the Y chromosome in Dicrostonyx groenlandicus point to the Y chromosome as a possible source of Bs. Using three different fluorochromes Obara and Sasaki (1997) found that characteristics of fluorescence banding of B chromosomes in Apodemus argenteus correspond to that of C-heterochromatin in the X chromosome of this species. This promotes the C-block of the X chromosome as a source of Bs in this species. From their G-band patterns, Gadi et al. (1982) suggested that Bs in Bandicota indica and Rattus rattus were of the same origin and arose before divergence of these two species occurred. Moreover, Thomson et al. (1984) observed that the B chromosome in R. fuscipes from Australia is morphologically very similar to that of R. rattus from Japan (Yosida, 1977). However, besides origin from a common source, it is also possible that one chromosome from the karyotype particularly prone to polysomy could be a repeated source of new Bs. Molecular data indicated that Bs in two species of Carnivora, Nyctereutes

procyonides and Vulpes vulpes were not of the same origin (Trifonov et al., 2002). In the genus Apodemus, Bs are found in 6 out of the 21 known species (26 %), but this frequency could actually be higher because chromosomes have not been analysed in all species. In the light of the theory of centromeric drive (Palestis et al., 2004), the high frequency of B chromosomes in this genus is consistent with the predominantly acrocentric shape of A chromosomes. In Apodemus flavicollis and A. sylvaticus, Bs show the same morphology, size, G-, and C-band distribution as small autosomes of the standard set. It was thus assumed that they originated from them by polysomy followed by rapid inactivation similar to X chromosome inactivation in female mamˇ ivkovic´, 1987). Later studies confirmed mals (Vujosˇevic´ and Z the great similarity between DNA of animals with and without B chromosomes in this species (Tanic´ et al., 2000). Although they found some molecular markers specific for B chromosomes there is now doubt that A chromosomes are the source of Bs in this species. Peppers et al. (1997) suggested different origins for the two types of Bs found in the harvest mouse, Reithrodontomys megalotis. They claimed that the large B chromosome arose from centric fusion as a leftover of the centromere, whereas the small B could have originated from an amplified region of an A chromosome or as an intact fragment. Karamysheva et al. (2002) propose two-step appearance of Bs in A. peninsulae. Destabilization of pericentromeric regions produced by invasion of DNA sequences from euchromatic parts of A chromosomes leads to formation of microchromosomes in high frequency, which could be considered as protoBs. Next step is insertion and amplification of new DNA sequences.

Maintenance of B chromosomes The existence of some kind of genetic equilibrium is supposed to be a necessary condition for B chromosome maintenance in natural populations of many species, regardless of whether this equilibrium is the result of B accumulation and selection against B carrying individuals (parasitic model) (Östergreen, 1945), or else it results from the beneficial effects of Bs at low numbers but harmful effects at high numbers (heterotic model) (White, 1973). Alternatively, as a result of the arms race with A chromosomes, parasitic Bs may not be at equilibrium but passing through successive stages, i.e. B invasion, drivesuppression and near-neutral extinction with or without regeneration (Camacho et al., 1997). Conclusive information on which model is operating in each species is actually difficult to obtain, since it requires exhaustively temporal analyses of B frequency and transmission, but performing controlling crosses in the lab is not equally amenable in all organisms. B chromosomes in most species where this information is available, seem to fit the parasitic model, although the existence of heterotic Bs cannot be ruled out (see Camacho et al., 2000). In mammals, however, this kind of information is scarce. In Rattus rattus diardi (Yong and Dhaliwal, 1972), the frequency of animals with Bs was the same in two successive years. Moreover, the

Cytogenet Genome Res 106:247–256 (2004)

253 111

frequency of Apodemus flavicollis individuals with Bs did not change significantly during 8 years regardless of great changes in abundance (Vujosˇevic´, 1992 and unpublished data). On the other hand, it was found that seasonal changes in the frequency of animals with Bs, could be significant under conditions of stress produced by overcrowding (Blagojevic´ and Vujosˇevic´, 1995). When population density is moderate and competition for food and space is stable, then the frequency of animals with Bs is at equilibrium throughout the year (Vujosˇevic´ and Blagojevic´, 1995). In stressful conditions, young animals with Bs were found to be inferior and preferentially eliminated from the population. A kind of imperfect equilibrium (White, 1973), seems to occur in many natural populations that have several generations per year, which is the case with A. flavicollis and many other rodent species. This means that, although the frequency of specimens with Bs varies during the year, it stays stable from year to year. Analyses of nonmetric traits (Blagojevic´ and Vujosˇevic´, 2004) point to population density as a significant factor causing the observed variation in the frequency of specimens with Bs and developmental homeostasis at the same time. Direct or indirect evidences for B drive in mammals are provided for six species only: Vulpes vulpes, Perognathus baileyi, Apodemus peninsulae, Dicrostonyx torquatus, Rattus rattus and Rattus fuscipes (details in Transmission section). The fact that, in half these species, B drive is operating in females gives support to the theory of centromeric drive (Palestis et al., 2004). Thomson (1984) showed that maintenance of Bs in Rat-

tus fuscipes fits well with the parasitic model. Both accumulation via meiotic drive in females and preferential elimination in the prereproductive period were verified. A possible reason for long-term presence of Bs in populations could be their contribution to the genetic variability of species possessing them, as might be arguable under the heterotic model. Increased variability widens the probability that species will survive in changing environmental situations. In Apodemus flavicollis, an increased frequency of animals with Bs is found in more extreme climatic conditions (Vujosˇevic´ and Blagojevic´, 2000). In populations of the Siberian roe deer, Capreolus pygargus, Tokarskaia et al. (2000) found that the presence of Bs is positively correlated with heterozygosity for RAPD loci, which indicates a contribution by Bs to the genetic variation of the species. A model by Burt and Trivers (1998), based on data for flowering plants, suggests that breeding systems play a fundamental role in the biology of B chromosomes. They confirmed that parasitic Bs persist better in outcrossed species, which reinforce the idea that most B chromosomes are selfish. Inbreeding is harmful to parasitic Bs but beneficial to mutualistic ones. Social organization of rodent populations and some other mammalian groups favours inbreeding so that opens possibilities for the presence of beneficial Bs.

Acknowledgement We thank Prof. J.P.M. Camacho for useful comments and suggestions.

References Andrades-Miranda J, Oliveira LFB, Zanchin NIT, Mattevi MS: Chromosomal description of the rodent genera Oecomys and Nectomys from Brazil. Acta ther 46:269–278 (2001). Baverstock PR, Wats CHS, Hogarth JT: Heterochromatin variation in Australian rodent Uromys caudimaculatus. Chromosoma 59:397–403 (1976). Baverstock PR, Wats CHS, Hogarth JT: Chromosome evolution in Australian rodents. I. The Pseudomyinae, the Hydromyinae and Uromys/Melomys group. Chromosoma 61:9–125 (1977). Baverstock PR, Gelder M, Jahnke A: Cytogenetic studies of the Australian rodent Uromys caudimaculatus, a species showing extensive heterochromatin variation. Chromosoma 84:517–533 (1982). Bekasova TS, Vorontsov NN: Populational chromosome polymorphism in Asiatic forest mice Apodemus peninsulae. Genetika XI:89–94 (1975). Bekasova TS, Vorontsov NN, Korobitsyina KV, Korablev VP: B-chromosomes and comparative karyology of the mice of the genus Apodemus. Genetica 52/53:33–43 (1980). Belayev DK, Volobouev VT, Radjabli SI, Trut LN: Polymorphism and mosaicism for additional chromosomes in silver foxes. Genetika X (2):58–67 (1974a). Belayev DK, Volobouev VT, Radjabli SI, Trut LN: Investigation of the nature and role of additional chromosomes in silver fox II. Additional chromosomes and breeding of animals for behaviour. Genetika X (2):83–91 (1974b). Belcheva RG, Topashka-Ancheva MN, Atanassov N: Karyological studies of five species of mammals from Bulgarian fauna. Comptes rendus de l’Académie bulgare des Sciences 42:125–128 (1988).

254 112

Berend SA, Hale DW, Engstrom MD, Greenbaum FI: Cytogenetics of collared lemmings (Dicrostonyx groenlandicus). II. Meiotic behavior of B chromosomes suggests a Y-chromosome origin of supernumerary chromosomes. Cytogenet Cell Genet 95: 85–91 (2001). Beukeboom LW: Bewildering Bs: an impression of the 1st B-chromosome conference. Heredity 73:328– 336 (1994). Bhatnagar VS: Microchromosomes in the somatic cells of Vulpes bengalensis Shaw. Chromosome Info Service 15:32 (1973). Blagojevic´ J: The effects of B chromosomes in the populations of yellow necked mice Apodemus flavicollis (Rodentia, Mammalia). PhD Thesis (University of Belgrade, 1997). Blagojevic´ J, Vujosˇevic´ M: The role of B-chromosomes in population dynamics of yellow necked wood mice Apodemus flavicollis (Rodentia, Mammalia). Genome 38:472–478 (1995). Blagojevic´ J, Vujosˇevic´ M: Do B chromosomes affect morphometric characters in yellow-necked mice Apodemus flavicollis (Rodentia, Mammalia)? Acta ther 45:129–137 (2000). Blagojevic´ J, Vujosˇevic´ M: B chromosomes and developmental homeostasis in the yellow-necked mouse, Apodemus flavicollis (Rodentia, Mammalia) – Effects on nonmetric traits. Heredity (in press) (2004). Blanks GA, Shellhammer SH: Chromosome polymorphism in California populations of harvest mice. J Mamm 49:726–731 (1968).

Cytogenet Genome Res 106:247–256 (2004)

Boeskorov GG, Kartavtseva IV, Zagorodnyuk IV, Belyanin AN, Lyapunova EA: Nucleolus organizer regions and B chromosomes of wood mice (Mammalia, Rodentia, Apodemus). Russ J Genet 31: 156–163 (1995). Borisov YuM, Korablev VP, Kartavtseva IV, Lyapunova EA, Vorontsov NN: Additional chromosomes of the rat-like hamster and its systematical position. Thesis of the Second All-Union Conference of the Theriological Society. Moscow, Nauka, pp 13–14 (1978). Boyeskorov G, Zagorodnyuk I, Belyanin A, Lyapunova EA: B-chromosomes in Apodemus flavicollis from eastern Europe. Polish Ecological Studies 20:523– 526 (1994). Burt A, Trivers R: Selfish DNA and breeding system in flowering plants. Proc R Soc Lond B 265:141–146 (1998). Camacho JPM: B chromosomes, in Gregory TR (ed): The Evolution of the Genome (Elsevier, Amsterdam 2004, in press). Camacho JPM, Shaw MW, Lo´pez–Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997). Camacho JPM, Sharbel TF, Beukeboom LW: B chromosome evolution. Phil Trans R Soc B 355:163– 178 (2000). Castro EC: Ocorência e caracterizaca˜o cromossômica de roedores Akodontinos do Rio Grande do Sul. M. Sci. Thesis, Universidade Federal do Rio Grande do Sul, Brasil (1989).

Civitelli MV, Consentino P, Capanna E: Inter- and intra-individual chromosome variability in Thamnomys (Grammomys) gazellae (Rodentia, Muridae) B-chromosomes and structural heteromorphisms. Genetica 79:93–105 (1989). Contrafatto G, Meester JA, Willan K, Taylor PJ, Roberts MA, Baker CM: Genetic variation in the African rodent subfamily Otomyinae (Muriade). II. Chromosomal changes in some populations of Otomys irroratus. Cytogenet Cell Genet 59:293–299 (1992). de Guevara Ladron RG, Diaz de la Guardia R: Frequency of chromosome polymorphism for pericentric inversions and B-chromosomes in Spanish populations of Rattus rattus frugivorus. Genetica 57:99–103 (1981). Fagundes V: Anaslises chromossomicas e dos complexos sinaptonemicos em roederos brasilieros das familias Cricetidae e Echimyidae, PhD Thesis, Univ Sao Paulo (1993). Freitas TRO, Mattevi MS, Oliveira LFB, Souza MJ, Yonenaga-Yassuda Y, Salzano FM: Chromosome relationship in three representatives of the genus Holochilus (Rodentia, Cricetidae) from Brazil. Genetica 61:13–20 (1983). Gadi IK, Sharma T, Raman R: Supernumerary chromosomes in Bandicota indica nemorivaga and a female individual with XX/X0 mosaicism. Genetica 58:103–108 (1982). Giagia E, Soldatovic´ B, Savic´ I, Zimonjic´ D: Karyotype study of the genus Apodemus (Kaup 1829) populations from the Balkan peninsula. Acta Vet (Beograd) 35:289–298 (1985). Gileva EA: B-chromosomes, unusual inheritance of sex chromosomes and sex ratio in the varying lemming, Dicrostonyx torquatus Pall. (1779). Proc Acad Sci, USSR, 213:952–955 (1973). Gileva EA: Chromosomal diversity and the aberrant genetic system of sex determination in the artic lemming, Dicrostonyx torquatus Pallas, 1779. Genetica 52/53:99–103 (1980). Gileva EA: A constrasted pattern of chromosome evolution in two genera of lemmings, Lemmus and Dicrostonyx (Mammalia, Rodentia). Genetica 60: 173–179 (1983). Gileva EA, Chebotar NA: Fertile X0 males and females in the varying lemming, Dicrostonyx torquatus Pall. (1779). Heredity 42:67–77 (1979). Gropp A, Marshall J, Flatz G, Olbrich M, Manyanondha K, Santadust A: Chromosomenpolymorphismus durch überzählige Autosomen. Beobachtungen an der Hausratte (R. rattus). Z Säugetierk 35:363 (1970). Gropp A, Marshall J, Markvong A: Chromosomal findings in the spiny mice of Thailand (genus Mus) and occurrence of a complex intraspecific variation in M. shortridgei. Z Säugetierk 38:159–168 (1973). Gustavsson I: Mitotic and meiotic behavior of the B chromosomes in the silver fox. Europäisches Kolloquium über Zytogenetik (Chromosomenpathologie), in Veterinärmedizin und Säugetierkunde, pp 34–42, Giessen (1970). Hayata J: Chromosomal polymorphism caused by supernumerary chromosomes in field mouse, Apodemus giliacus. Chromosoma 42:403–414 (1973). Hayman DL, Martin PG: Supernumerary chromosomes in the marsupial Schoinobates volans (Ker). Aust J biol Sci 18:1081–1082 (1965). Hayman DL, Martin PG, Waller PF: Parallel mosaicism of supernumerary chromosomes and sex chromosomes in Echymipera kalabu (Marsupialia). Chromosoma 27:371–380 (1969). Hewison AJM, Danilkin A: Evidence for separate specific status of European (Capreolus capreolus) and Siberian (C. pygargus) roe deer. Mammal Biol 66:13–21 (2001).

Jones RN: Tansley review no. 85: B chromosomes in plants. New Phytol 131:411–434 (1995). Jones RN, Rees H: B Chromosomes (Academic Press, New York 1982). Judd SR, Cross SP: Chromosomal variation in Microtus longicaudus (Merriam). Murrelet 61:2–5 (1980). Karamysheva TV, Andreenkova OV, Bochkaerev MN, Borissov YM, Bogdanchikova N, Borodin PM, Rubtsov NB: B chromosomes of Korean field mouse Apodemus peninsulae (Rodentia, Murinae) analysed by microdissection and FISH. Cytogenet Genome Res 96:154–160 (2002). Kartavtseva IV: Description of B-chromosomes in karyotype of field mouse Apodemus agrarius. Tsitol Genet 28:96–97 (1994). Kartavtseva IV: Karyosystematics of Wood and Field Mice (Rodentia: Muridae) (Russian Academy of Sciences Far Eastern Branch, Vladivostok, Dalnauka 2002). Kartavtseva IV, Borisov YuM, Lyapunova EA, Vorontsov NN, Korablev VP: Accessory chromosomes in the rat-like hamster (Tscherskia triton) and its taxonomic status. Zool J LIX (6): 899–904 (1980). Kartavtseva IV, Pavlenko MV Slepova GV: New data on extra chromosomes of Asiatic wood mice Apodemus peninsulae of Transbaikalia and Far East, Gryzuny (Rodents), in Proc 7th All-Union Conference 1:72–73, Nalchik, Sverdlovsk (1988). Kartavtseva IV, Roslik GV, Pavlenko MV, Amachaeva EYu, Sawaguchi S, Obara Y: The B-chromosome system of the Korean field mouse Apodemus peninsulae in the Russian Far East. Chromosome Sci 4:21–29 (2000). Kasahara E: Variabilidade chromossomica em quatro especies de roedores das familias Cricetidae e Muridae, PhD Thesis, Univ Sao Paulo (1978). Kolomeits OL, Borbiev TE, Safronova LD, Borisov YM, Bogdanov YF: Synaptonemal analysis of Bchromosome behaviour in meiotic prophase I in the East-Asiatic mouse Apodemus peninsulae (Muridae, Rodentia). Cytogenet Cell Genet 48:183– 187 (1988). Kovalskaja YuM: B-chromosomes and XO-males in narrow-skulled vole, Microtus/Stenocranius/gregalis from North Mongolia. In Proc 7th All-Union Conference 1:73–74, Nalchik, Sverdlovsk (1988). Kral B: Chromosome characteristics of certain murine rodents (Muridae) of the Asiatic part of the USSR. Zoologicke listy 20:331–347 (1971). Lobato L, Cantos G, Araujo B, Bianchi NO, Merani S: Cytogenetics of the South American akodont rodents (Cricetidae) X. Akodon mollis: a species with XY females and B chromosomes. Genetica 57: 199–205 (1982). Maia V, Yonenaga-Yassuda Y, Freitas TRO, Kasahara S, Sune-Mattevi M, Oliviera LF: Supernumerary chromosomes, Robertsonian rearrangement and variability of the sex chromosomes in scaly-footed water rat Nectomys squamipes (Cricetidae, Rodentia). Genetica 63:121–128 (1984). Makinen A, Fredga K: Banding analyses of the somatic chromosomes of raccoon dogs, Nyctereutes procyonides, from Finland, in Fourth European Colloquium on the Cytogenetics of Domestic Animals (1980). McQuade LR, Hill RJ, Francis D: B-chromosome systems in the greater glider, Petauroides volans (Marsupialia: Pseudocheiridae). II Investigation of Bchromosome DNA sequences isolated by micromanipulation and PCR. Cytogenet Cell Genet 66:155–61 (1994). Meylan A, Hausser J: Position citotaxonomique de quelques museragines du genere Crocidura au Tessisn (Mammalia: Insectivora). Origine du dessin dentarie “Apodemus” (Rodentia, Mammalia). CR Acad Sci Paris, 264, Serie D:711 (1974). Moore JW, Elder RL: Chromosome of the fox. J Hered 56:142–143 (1965).

Myers P, Carleton MD: The species Oryzomys (Oligoryzomys) in Paraguay and the identity of Azara’s “Rat sixime ou Rat Tarse Noir”. Publ Mus Univ Mich 161:1–141 (1981). Nachman MW: Geographic patterns of chromosomal variation in South American marsh rats, Holochilus brasiliensis and H. vulpinus. Cytogenet Cell Genet 61:10–17 (1992a). Nachman MW: Meiotic studies of Robertsonian polymorphisms in the South American marsh rat, Holochilus brasiliensis. Cytogenet Cell Genet 61:17– 24 (1992b). Nachman MW, Myers P: Exceptional chromosomal mutations in a rodent population are not strongly underdominant. Proc Natl Acad Sci USA 86: 6665–6670 (1989). Neitzel H: Chromosome evolution of Cervidae: Karyotypic and molecular aspects, in Obe G, Basler A (eds): Cytogenetics, pp 90–112 (Springer, Berlin, Heidelberg 1987). Obara Y, Sasaki S: Fluorescent approaches on the origin of B chromosomes of Apodemus argenteus hokkaidi. Chrom Sci 1:1–5 (1997). Obara Y, Tomyiasu T, Saitoh K: Chromosome studies in the Japanese vespertilionid bats. I. Karyotypic variation in Myotis macrodactylus Temmink. Jpn J Genet 51:201–206 (1976). Östergren G: Parasitic nature of extra fragment chromosomes. Bot Not 2:157–163 (1945). Palestis BG, Burt A, Jones RN, Trivers R: B chromosomes are more frequent in mammals with acrocentric karyotypes: support for the theory of centromeric drive. Proc R Soc Lond B (Suppl 3) 271:S22–24 (2004). Pardo-Manuel de Villena F, Sapienza C: Female meiosis drives karyotypic evolution in mammals. Genetics 159:1179–1189 (2001). Pathak S: A new type of intraspecific chromosome polymorphism in Rattus rattus, collected from Nepal. Mammal Chrom Newsletter 11:105 (1971). Patton JL: A complex system of chromosomal variation in the pocket mouse, Perognathus baileyi Merriam. Chromosoma 36:241–255 (1972). Patton JL: B-chromosome system in the pocket mouse, Perognathus baileyi: Meiosis and C-band studies. Chromosoma 60:1–14 (1977). Patton JL, Sherwood SW: Genome evolution in pocket gophers (Genus Thomomys) I. Heterochromatin variation and speciation potential. Chromosoma 85:149–162 (1982). Peppers JA, Wiggins LE, Baker RJ: Nature of B chromosomes in the harvest mouse Reithrodontomys megalotis by flurescence in situ hybridization (FISH). Chrom Res 5:475–479 (1997). Pigozzi MI, Solari AJ: Germ cell restriction and regular transmission of an accessory chromosome that mimics a sex body in the zebra finch, Taeiniopygia guttata. Chrom Res 6:105–113 (1998). Radjabli SI, Isaenko AA, Volobuev VT: Investigation of the nature and role of additional chromosomes in silver fox. Genetika XIIV (3):438–443 (1978). Raman R, Sharma T: DNA replication, G- and Cbands and meiotic behaviour of supernumerary chromosomes of Rattus rattus (Lin). Chromosoma 45:111–119 (1974). Rao KS, Aswathanrayana NV, Prakash KS: Supernumerary (B) chromosomes in Indian bush rat Golunda ellioti (Gray). MCN 20:79 (1979). Rubtsov BN, Karamysheva VT, Andreenkova VO, Bochkaerev NM, Kartavtseva VI, Roslik VG, Borissov MY: Comparative analysis of micro and macro B chromosomes in the Korean field mouse Apodemus peninsulae (Rodentia, Murinae) performed by chromosome microdissection and FISH. Cytogenet Genome Res 106:289–294 (2004).

Cytogenet Genome Res 106:247–256 (2004)

255 113

Sbalqueiro IJ, Mattevi MS, Oliveira LFB, Solano MJV: B chromosome system in populations of Oryzomys flavescens (Rodentia, Cricetidae) from southern Brazil. Acta ther 36:193–199 (1991). Shellhammer HS: Supernumerary chromosomes of the harvest mouse, Reithrodontomys megalotis. Chromosoma 27:102–108 (1969). Shi L, Tang L, Ma K, Ma C: Synaptonemal complex formation among supernumerary B chromosomes: an electron microscopic study on spermatocytes of Chinese raccoon dogs. Chromosoma 97:178–183 (1988). Silva MJJ, Yonenaga-Yassuda Y: Heterogeneity and meiotic behaviour of B and sex chromosomes, banding patterns and localization of (TTAGG)n sequences by fluorescence in situ hybridization in the neotropical water rat Nectomys (Rodentia, Cricetidae). Chromosome Res 6:455–462 (1998). Silva MJJ, Yonenaga-Yassuda Y: B chromosomes in Brazilian rodents. Cytogenet Genome Res 106: 257–263 (2004). Sokolov VE, Prikhodko VI: Taxonomy of the musk deer (Artiodactyla, Mammalia). Izv Akad Nauk Ser Biol Jan-Feb:37–46 (1998). Soldatovic´ B, Savic´ I, Seth P, Reichstein H, Tolksdorf M: Comparative karyological study of the genus Apodemus. Acta Vet (Beograd) 25:1–10 (1975). Stitou S, Diaz de la Guardia R, Jimenez R, Burgos M: Inactive ribosomal cistrons are spread throughout the B chromosomes of Rattus rattus (Rodentia, Muridae). Implications for their origin and evolution. Chrom Res 8:305–311 (2000). Stitou S, Zurita F, Diaz de la Guardia R, Jimenez R, Burgos M: Transmission analysis of B chromosomes in Rattus rattus from Northern Africa. Cytogenet Genome Res 106:344–346 (2004). S´witon´ski M, Gustavsson I, Höjer K, Plöen L: Synaptonemal complex analyses of the B-chromosomes in spermatocytes of the silver fox (Vulpes fulvus Desm.). Cytogenet Cell Genet 45:84–92 (1987). Tanic´ N, Dedovic´ N, Vujosˇevic´ M, Dimitrijevic´ B: DNA profiling of B-chromosomes from the yellownecked mouse Apodemus flavicollis (Rodentia, Mammalia). Genome Res 10:55–61 (2000). Tiersch TR, Wachtel SS: On the evolution of genome size of birds. J Heredity 82:363–368 (1991). Thomson RL: B chromosomes in Rattus fuscipes II. The transmission of B chromosomes to offspring and population studies: support for the “parasitic” model. Heredity 52:367–372 (1984). Thomson RL, Westerman M, Murray ND: B chromosomes in Rattus fuscipes I. Mitotic and meiotic chromosomes and the effects of B on chiasma frequency. Heredity 52:355–372 (1984). Tokarskaia ON, Efremova DA, Kan NG, Danilkin AA, Sempere A, Petrosian VG, Semenova SK, Ryskov AP: Variability of multilocus DNA markers in populations of the Siberian (Capreolus pygargus Pall.) and European (C. capreolus L.) roe deer. Genetika 36:1520–30 (2000). Trifonov VA, Perelman PL, Kawada S-I, Iwasa MA, Oda S-I, Graphodatsky AS: Complex structure Bchromosomes in two mammalian species: Apodemus peninsulae (Rodentia) and Nyctereutes procyonides (Carnivora). Chrom Res 10:109–116 (2002). Trivers R, Burt A, Palestis GB: B chromosomes and genome size in flowering plants. Genome 47:1–8 (2004). Vassart M, Guedant A, Vie JC, Keravec J, Seguela A, Volobouev VT: Chromosomes of Alouatta seniculus (Platyrrhini, Primates) from French Guiana. J Heredity 87:331–334 (1996). Volleth M: Comparative analysis of the banded karyotypes of the European Nyctalus species (Vespertilionidae, Chiroptera), in Hora´cˇek I, Vohralik V Prague (eds): Prague Studies in Mammology, pp 221– 226 (Charles University Press, Prague 1992).

256 114

Volobujev VT, Sicard B, Aniskin VM, Gautun JJ, Granjon L: Robertsonian polymorphism, B chromosomes variation and sex chromosomes heteromorphism in the African water rat Dasymys (Rodentia, Muridae). Chrom Res 8:689–697 (2000). Volobujev VT: The B-chromosome system of mammals. Genetica 52/53:333–337 (1980). Volobujev VT: The B-chromosome system of the mammals. Caryologia 34:1–23 (1981). Volobujev VT, Radjabli SI: Investigation of the nature and the role of additional chromosomes in silver fox. Genetika X(8):77–82 (1974). Volobujev VT, Timina NZ: Unusally high number of B-chromosomes and mosaicism by them in Apodemus peninsulae (Rodentia, Muridae). Tsitol Genet 14:43–45 (1980). Volobujev VT, Radzabli SI, Belajeva ES: Investigation of the nature and the role of additional chromosomes in silver foxes. III. Replication pattern in additional chromosomes. Genetika XII:30–34 (1976). Vujosˇevic´ M: Chromosome polymorphism in two species of the genus Apodemus (Rodentia: Mammalia) PhD Thesis, University of Belgrade, Belgrade (1987). Vujosˇevic´ M: B-chromosome polymorphism in Apodemus flavicollis (Rodentia, Mammalia) during five years. Caryologia 45:347–352 (1992). Vujosˇevic´ M: B-chromosomes in mammals. Genetika 25:247–258 (1993). Vujosˇevic´ M, Blagojevic´ J: Seasonal changes of B-chromosome frequencies within the population of Apodemus flavicollis (Rodentia) on Cer mountain in Yugoslavia. Acta ther 40:131–137 (1995). Vujosˇevic´ M, Blagojevic´ J: Does environment affect polymorphism of B chromosomes in the yellownecked mouse Apodemus flavicollis? Z Säugetierk 65:313–317 (2000). ˇ ivkovic´ S: Numerical chromosome Vujosˇevic´ M, Z polymorphism in Apodemus flavicollis and A. sylvaticus (Mammalia: Rodentia) caused by supernumerary chromosomes. Acta Vet (Beograd) 37:81– 92 (1987). ˇ ivkovic´ S: Meiotic Vujosˇevic´ M, Radosavljevic´ J, Z behavior of B chromosomes in yellow necked mouse Apodemus flavicollis. Arh biol nauka 41:39– 42 (1989). Vujosˇevic´ M, Blagojevic´ J, Radosavljevic´ J, Bejakovic´ D: B chromosome polymorphism in populations of Apodemus flavicollis in Yugoslavia. Genetica 83: 167–170 (1991). Wahrman J, Gourevitz P: The chromosome biology of the 2n = 38 black rat, Rattus rattus, in: Wahrman J, Lewis KR (eds): Chromosomes Today 4:433–434 (John Wiley and Sons, Israel Universities Press, New York and Jerusalem 1973). Wang J, Zhao X, Deng Y, Qi H, Liu Y, Zhang Z, Koh H, Shan X: Karyotypes and B chromosome of greater long-tailed hamster (Cricetulus triton). Acta ther Sinica 19:197–211 (1999). Ward OG: Chromosomes studies in Japanese raccoon dogs: X chromosomes, supernumeraries, and heteromorphism. Mammal Chrom Newsletter 25:34 (1984). White MJD: Animal Cytology and Evolution, 3rd Ed (Cambridge University Press, Cambridge 1973). Wilson DE, Reeder DM: Mammal Species of the World: A Taxonomic and Geographic Reference, 2nd Ed (Smithsonian Institutions, Washington and London 1993). Wurster-Hill DH, Ward OG, Kada BH, Whittmore S: Banded chromosome studies and B chromosomes in wild-caught raccoon dogs, Nyctereutes procyonides viverinus. Cytogenet Cell Genet 42:85–93 (1986).

Cytogenet Genome Res 106:247–256 (2004)

Wurster-Hill DH, Ward OG, Davis BH, Park JP, Moyzis RK, Meyne J: Fragile sites, telomeric DNA sequences, B chromosomes, and DNA content in raccon dogs, Nyctereutes procyonides, with comparative notes on foxes, coyote, wolf, and raccoon. Cytogenet Cell Genet 49:278–281 (1988). van Wynsberghe NR, Engstrom MD: Chromosomal variation in collored lemmings (Dicrostonyx) from the western Hudson Bay region. Musk-Ox 39:203– 209 (1992). Yang F, O’Brien P, Milne B et al: A complete comparative chromosome map for the dog, red fox, and human and its integration with canine genetic maps. Genomics 62:189–202 (1999). Yonenaga Y, Kasahara S, Almeida EJC, Peracchi AL: Chromosomal banding patterns in Akodon arviculoides (2n = 14), Akodon sp. (2n = 24 and 25) and two male hybrids with 19 chromosomes. Cytogenet Cell Genet 15:388–399 (1975). Yonenaga-Yassuda Y, deSouza MJ, Kasahara S, L’Abbate M, Chu HT: Supernumerary system in Proechimys iheringi iheringi (Rodentia, Echimydae), from the state of Sao Paulo, Brazil. Caryologia 38:179–194 (1985). Yonenaga-Yassuda Y, do Prado CR, Mello DA: Supernumerary chromosomes in Holochilus brasiliensis and comparative cytogenetic analysis with Nectomys squamipes (Cricetidae, Rodentia). Rev Brasil Genet X(2):209–220 (1987). Yonenaga-Yassuda Y, Maia V, L’Abbate M: Two tandem fusions and supernumerary chromosomes in Nectomys squamipes (Cricetidae, Rodentia). Caryologia 41:25–39 (1988). Yonenaga-Yassuda Y, Assis MFL, Kasahara S: Variability of the nucleolus organizer regions and the presence of the rDNA genes in the supernumerary chromosome of Akodon aff. arviculoides (Cricetidae, Rodentia). Caryologia 45:163–174 (1992). Yong HS, Dhaliwal SS: Supernumerary (B-) chromosomes in the Malayan house rat, Rattus rattus diardii (Rodentia, Muridae). Chromosoma 36:256– 262 (1972). Yosida TH: Population survey of B-chromosomes in black rat. Ann Rep Nat Inst Genetics 26:33 (1976). Yosida TH: Supernumerary chromosomes in the black rat (Rattus rattus) and their distribution in three geographic variants. Cytogenet Cell Genet 18:149– 159 (1977). Yosida TH: Some genetic analysis of supernumerary chromosomes in the black rat in laboratory matings. Proc Jap Acad 50:440–445 (1978). Yosida TH, Sagai T: Variation of C-bands in the chromosomes of several subspecies of Rattus rattus. Chromosoma 50:283–300 (1975). Yunis EJ, Torres de Caballero OM, Ramirez C, Ramirez ZE: Chromosomal variations in the primate Alouatta seniculus seniculus. Folia Primatol 25: 215–224 (1976). Zima J, Kral B: Karyotypes of European mammals II. Acta Sci Nat Acad Scient Bohemoslovacae Brno, XVIII (8):3–62 (1984). Zima J, Machola´n M: B chromosomes in the wood mice (genus Apodemus). Acta ther (Suppl 3):75–86 (1995). Zima J, Ieardi LA, Allegra F, Sartoretti A, Wlosokova E, Cristaldi M: Frequencies of B chromosomes in Apodemus flavicollis are not directly related to mutagenetic environmental effects. Folia zool 48:115– 119 (1999). Zima J, Pia´lek J, Machola´n M: Possible heterotic effects of B chromosomes on body mass in a population of Apodemus flavicollis. Can J Zool 81:1312– 1317 (2003). Zimmerman EG: Karyology, systematics and chromosomal evolution in the rodent genus Sigmodon. Michigan State Univ Publ Mus Biol Ser 4:385–394 (1970).

Review on B Chromosomes Cytogenet Genome Res 106:257–263 (2004) DOI: 10.1159/000079296

B chromosomes in Brazilian rodents M.J.J. Silva and Y. Yonenaga-Yassuda Departamento de Biologia, Instituto de Biociências, Universidade de Sa˜o Paulo-Rua do Mata˜o, Sa˜o Paulo, SP (Brazil)

Abstract. B chromosomes are now known in eight Brazilian rodent species: Akodon montensis, Holochilus brasiliensis, Nectomys rattus, N. squamipes, Oligoryzomys flavescens, Oryzomys angouya, Proechimys sp. 2 and Trinomys iheringi. Typically these chromosomes are heterogeneous relative to size, morphology, banding patterns, presence/absence of NORs, and presence/absence of interstitial telomeric signals after FISH. In

Occurrence of B chromosomes in Brazilian rodents In 1982, Jones and Rees reported B chromosomes in over a thousand species of plants and more than 260 animal species. From a total of 22 species of vertebrates, 19 were mammals with 12 species of rodents represented. Volobujev (1981) listed 18 species of rodents within the “B-chromosome system of the mammals”, which included three Brazilian species: Akodon sp., Proechimys iheringi and Oryzomys sp. More than twenty years after Volobujev’s review, the number of species with Bs is certainly higher than that previously reported. Concerning Brazilian rodents, up to 1984, Kasahara and Yonenaga-Yassuda had compiled karyotypes of about 60 Brazilian species within the order Rodentia, recognizing six B-car-

most cases, Bs are heterochromatic and late replicating. Active NORs were detected in two species: Akodon montensis and Oryzomys angouya. As a rule, Bs behave as uni or bivalents in meiosis, there is no pairing between Bs and autosomes or sex chromosomes and also their synaptonemal complexes are isopycnotic with those in A chromosomes. Copyright © 2004 S. Karger AG, Basel

rier species. Currently, about 140 species belonging to the families Muridae, Echimyidae, Caviidae, Ctenomyidae, Dasyproctidae, Hydrochaeridae were summarized in a cytogenetic compilation (Silva et al., 2004), including eight species harboring B chromosomes: Akodon montensis (2n = 24 + 0–2B), Holochilus brasiliensis (2n = 56 + 0–2B), Nectomys rattus (2n = 52 + 0–3B), N. squamipes (2n = 56 + 0–3B), Oligoryzomys flavescens (2n = 64 + 0–2B), Oryzomys angouya (2n = 58 + 0 or 2B), Proechimys sp. 2 (2n = 26 + 0–1B) and Trinomys iheringi (2n = 60 + 1–6B) (Table 1). It implies that about 5.7 % of Brazilian rodents probably bear B chromosomes, a figure slightly larger than the 3.3 % estimated for mammals in general (Vujocevic and Blagocevic, 2004).

Considerations on B chromosomes of Brazilian rodents

Supported by Fundaça˜o de Amparo à Pesquisa do Estado de Sa˜o Paulo (FAPESP) and by grants to Dr. Maria José de J. Silva (Proj. # 00/06591-0 and 99/08156-0), to Dr. Yatiyo Yassuda (# 99/11.653-6) and to Dr. Mario de Vivo (BIOTA # 98/ 5075-7), Conselho Nacional de Desenvolvimento Cientifı´co e Technolo´gico (CNPQ). Received 15 October 2003; manuscript accepted 9 February 2004. Request reprints from Maria Jose de J. Silva, Departamento de Biologia Instituto de Biociências, Universidade de Sa˜o Paulo Rua do Mata˜o 277 – 3o. A - Sala 338 - Sa˜o Paulo, SP 05508-900 (Brazil) telephone: 55 11 3091-7574; fax: 55 11 3091-7553 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0257$21.00/0

Characteristically in mammals, B chromosomes neither promote phenotypic alterations nor affect fitness of the individuals (Jones and Rees, 1982). By contrast, in plants for example, increasing numbers of Bs results in loss of vigor, reflected by delay in seed germination and the onset of flowering (Jones and Rees, 1982). In the parasitic wasp genus Nasonia, the paternal sex-ratio (PSR), a B chromosome, causes all-male offspring (Werren, 1991) and, in the fungus Nectria haematococca, Bs confer resistance against toxins (Miao et al., 1991). Similarly, chiasma frequency in A chromosomes can also be affected (Volobujev, 1981).

Accessible online at: www.karger.com/cgr

Table 1. Occurrence of B chromosomes in Brazilian rodents Species

No. of Bs

Locality (states)

Akodon montensis (2n = 24)

0

São Paulo, Rio de Janeiro

0, 1, 1/2 0, 1, 2

Holochilus brasiliensis (2n = 56)

Nectomys rattus (2n = 52)

Nectomys squamipes (2n = 56)

a

0, 1

São Paulo Santa Catarina, Rio Grande do Sul São Paulo

0, 1, 2

Rio Grande do Sul

0, 1, 2

Maranhão

0, 1, 2, 3

Pernambuco

0

Paraíba, Amazonas, Pará, Maranhão, Piauí, Mato Grosso do Sul, Brasília (D.C.)

1

Mato Grosso

0, 1

Tocantins

0, 1

Pernambuco a

0, 1, 2, 0/1

São Paulo

0, 1, 2, 3

Rio de Janeiro

0, 1, 2

Rio Grande do Sul

0, 1, 2

Paraná

0, 1, 2, 3

Rio Grande do Sul, Bahia, Espírito Santo

0, 1, 2

São Paulo

0

São Paulo, Minas Gerais, Rio de Janeiro, Mato Grosso do Sul, Bahia São Paulo

0, 1

258 116

B chromosome characteristics

Medium submetacentric: uniformly G-banded, uni or bivalent Medium submetacentric: BG proximal in the long arm, slightly C-banded Medium submetacentric: late replicating; slightly heterochromatic, univalent in meiosis; SC do not exhibit distinct behavior in relation to the autosomes; NORs in both ends of both arms Submetacentric: slightly C-positive, uni or bivalents in meiosis NORs in both ends of both arms

References Cestari and Imada, 1968 Geise et al., 1998 Kasahara, 1978 Christoff, 1991 Assis et al., 1978 Yonenaga-Yassuda et al., 1992 Fagundes, 1993, 1997 Castro, 1989

Large submetacentrics with different sizes: almost entirely Gpositive; two strong C-positive blocks in the pericentromeric region of both arms; late replicating Absence of NORs Large metacentric, two strong C-positive blocks in the pericentromeric region of both arms; late replicating Absence of NORs

Freitas et al., 1983; Yonenaga-Yassuda et al., 1987

Medium metacentric: totally heterochromatic; Absence of NORs Small acrocentric: heterochromatin distal in the long arm; Absence of NORs

Furtado, 1981 Maia et al., 1984

Large subtelocentric: almost totally heterochromatic, except for the short arm; proximal G-positive band in the long arm; late replicating; FISH: absence of interstitial telomeric sites (ITS); Absence of NORs Medium submetacentric: totally heterochromatic; Absence of NORs Acrocentric (size not mentioned); Absence of NORs Medium submetacentric and one larger-sized submetacentric; heterochromatin in the long arm and pericentromeric regions or C-band in the middle long arm; Absence of NORs Medium submetacentric and one submetacentric smaller than the medium-sized; Absence of NORs Medium submetacentric: very light C-banding in the entire long arm or spreads over the long arm and pericentromeric regions; Absence of NORs Not mentioned Bahia and Rio G. Sul: submetacentric and subtelo/submetacentric; Espírito Santo: subtelo/submetacentric Medium submetacentric different sizes; C-band interstitial in the long arm; G-negative band in the proximal region of the long arm; late replicating; Absence of NORs

Present review

Zanchin, 1988 Yonenaga-Yassuda et al., 1988 Svartman, 1989 Bonvicino et al., 1996 Silva and Yonenaga-Yassuda, 1998

Lima, 2000 Yonenaga, 1972 Freitas, 1980 Furtado, 1981 Maia et al., 1984

Sbalqueiro et al., 1986 Bossle et al., 1988 Zanchin, 1988

Yonenaga-Yassuda et al., 1988

Bonvicino et al., 1996

Medium submetacentric: C banding in the long arm; almost all Silva and Yonenaga-Yassuda, G-positive, except for the proximal G-negative band in the long 1998 arm; late replicating; FISH: a strong block of telomeric band in the proximal region of the long arm; univalent; synaptonemal complexes (SC) do not exhibit distinct behavior in relation to the autosomes; Absence of NORs Medium acrocentric: heterochromatic block distal in the long arm; G-positive band distal in the long arm; early replicating, except for a tiny proximal band; FISH: absence of interstitial telomeric sites (ITS); Absence of NORs

Cytogenet Genome Res 106:257–263 (2004)

Table 1 (continued) Species

No. of Bs

Locality (states)

B chromosome characteristics

References

São Paulo

Minute submetacentrics: heterochromatics; behave as bivalents in the meiosis of individuals with 2n = 66

0, 1, 2, 0/1

Paraná, Rio Grande do Sul

Small acrocentrics: heterochromatics less intensely stained than the pericentromeric blocks of A chromosomes; univalent in meiosis of individuals with 2n = 65 Absence of NORs

Yonenaga et al., 1976 Kasahara, 1978 Kasahara and YonenagaYassuda, 1984 Sbalqueiro et al., 1991

0

Tocantins

Lima, 2000

0 0

São Paulo Espírito Santo, Rio Grande do Sul São Paulo

Almeida, 1980 Zanchin, 1988

Oligoryzomys flavescens 0, 2 (2n = 64) a

Oryzomys angouya (2n = 58)

0, 2 0

Silva, 1994 Present paper Geise, 1995

Minute acrocentric: heterochromatic, univalent

Barros, 1978

Rio de Janeiro a

Pará

Proechimys sp. 2 (2n = 26)

0, 1, 0/1

Trinomys iheringi (2n = 60)

1, 2, 3, 4, 5, São Paulo a 2/3

2, 3, 4, 5, 6 São Paulo

a

Minute metacentrics: heterochromatic, G-positive NORs in both ends of both arms

Minute chromosomes: heteromorphic in size, nonheterochromatics; they do not present late replication

Yonenaga 1972, 1975 Souza, 1981 Kasahara and YonenagaAbsence of NORs Yassuda, 1984 Yonenaga-Yassuda at al., 1985 Minute chromosomes: non-heterochromatics, they do not present Fagundes, 1993 late replication; uni or bivalent in meiosis Absence of NORs

Indicates mosaicism. Other kinds of variation in diploid number were also reported in some species, but we just consider here those related to B chromosomes.

Comparative analysis between B chromosome-bearing specimens and non-carriers in the Brazilian rodent Akodon montensis evidenced neither morphological alteration nor differences in cranial measurements of both B carriers and non-carrier individuals (Christoff, 1991). As summarized in Table 1, 2n = 24 is the standard karyotype for this species and one or two medium-sized submetacentric Bs were reported as uniformly G-banded, slightly C-banded, late replicating and bearing NORs. Compiled data from studies performed by Kasahara (1978), Castro (1989), Christoff (1991), Fagundes (1993) and Geise et al. (1998) revealed a total of 238 specimens with no B chromosomes (69.32 %) – including one specimen with 23/24 that lost the Y in cells with 23 chromosomes and five with 2n = 23 due to monosomy of sex chromosome (2n = 23, X0) – 99 with 1B (28.13 %); 8 with 2B (2.27 %) and one being 1B/2B mosaic (0.28 %). Studies in Holochilus brasiliensis using 5-BrdU in cell cultures in order to evaluate the influence of 0, 1 or 2Bs on sister chromatid exchanges (SCE) rates revealed that neither specimens with 1B nor those with 2B exhibited significant differences in SCE rates relative to animals with 0B, suggesting that the number of SCEs was not affected by the presence of one or two Bs (Silva, unpublished data) (Fig. 1). In the literature, cytogenetic data are available for seven specimens of H. brasiliensis. Two males and one female (2n = 56) lacked B chromosomes, three females carried a single B (two of them resulting from a cross between a 1B female and a 0B male) and one male carried two B chromosomes. Bs were of two different types, both being large submetacentrics but one of them was larger than the largest A chromosome (Yonenaga-

Yassuda et al., 1987). Differential staining after C-banding showed two C-positive blocks proximal in the pericentromeric region in both arms with the remaining chromosome regions showing an intermediate intensity staining (Table 1). B chromosomes in Nectomys rattus and N. squamipes were medium and large sized chromosomes which varied in morphology and differential staining (C, G and R banding patterns) but they have never been shown to carry NORs (Table 1). By contrast, minute or small supernumerary chromosomes have been reported in Oligoryzomys flavescens, Oryzomys angouya, Proechimys sp. 2 and Trinomys iheringi (Table 1). In Oligoryzomys flavescens (2n = 64), one or two Bs have been found (Table 1). In total, 35 individuals had no Bs (57.38 %), 9 showed 1B (14.75 %), 14 carried 2B (22.95 %) and 3 were 0B/1B mosaics (4.92 %). Compilation of the available data in Oryzomys angouya revealed 26 individuals lacking Bs (25 with 2n = 58 and one with 2n = 57 due to a Robertsonian rearrangement involving two autosome acrocentrics) and one with two minute Bs (Fig. 2) (Table 1). These chromosomes were slightly heteromorphic in size, heterochromatic, G-positive although less intensely stained than the darker bands (Fig. 3) and NOR carrier at the ends of both arms (Fig. 4). Proechimys sp. 2 showed 2n = 26 in two specimens, 2n = 26 + 1B in two individuals; and 2n = 26/26 + 1B in four specimens (Table 1). Animals with B chromosomes were no longer collected in nature thus representing a unique record in 25 years. According to Barros (1978), the mosaic 2n = 26/27 was a result of loss of the B chromosome during somatic divisions due to its instability.

Cytogenet Genome Res 106:257–263 (2004)

259 117

Fig. 1. Metaphase showing SCE (sister chromatid exchange) in Holochilus brasilensis (2n = 56 + 1B). B is indicated.

Fig. 2. Conventionally stained karyotype of Oryzomys angouya (2n = 60). Minute metacentrics, indicated as chromosomes 29, are B chromosomes. Heterochromatic pattern of these chromosomes is exhibited in the square (CBG = C-banding pattern): note heteromorphism in size of heterochromatic blocks. Bar = 10 Ìm.

In Trinomys iheringi, 2n = 60 is supposed to be the standard chromosomal complement although animals with this diploid number have never been found: all sampled specimens showed at least one B chromosome (Table 1). Kasahara and YonenagaYassuda (1984) found 2n = 61 to 65 and 2n = 62/63. The variation in the diploid number was suggested to be due to the presence of one to five minute supernumeraries regularly with the same size (however heteromorphism was detected in one specimen). The 2n = 62/63 karyotype represents a mosaic showing

260 118

Cytogenet Genome Res 106:257–263 (2004)

intraindividual variation for B chromosome number presumably due to B mitotic instability (Table 1). Data summarized from Kasahara and Yonenaga-Yassuda (1984), Yonenaga-Yassuda et al. (1985) and Fagundes (1993) reveal five animals with 2n = 61 (22.73 %); five with 2n = 62 (22.73 %); four with 2n = 63 (18.18 %); four had 2n = 64 (18.18 %); two presented 2n = 65 (9.1 %), one with 2n = 66 (4.54 %) and one was a mosaic with 2n = 62/63 (4.54 %), all of them from the state of Sa˜o Paulo. Maintenance of this polymorphism was explained due to the existence of accumulation mechanisms in the gametogenesis process (Yonenaga-Yassuda et al., 1985). But we cannot be confident that these extra chromosomes are Bs until individuals with 60 chromosomes are found which demonstrates the dispensability of the supernumerary chromosomes. More recently, B chromosomes in non-Brazilian rodents have been molecularly explored by fluorescence in situ hybridization, microdissection and sequencing methodologies. Karamysheva et al. (2002), for instance, performing microdissection followed by DOP-PCR and painting metaphases with the generated probes from B chromosomes in the Korean field mouse Apodemus peninsulae, found that all B chromosomes contained a large amount of repeated DNA sequences equivalent to the pericentromeric regions of all autosomes and non-centromeric C-blocks of the sex chromosomes. Molecular approaches were also reported in the Brazilian water rat Nectomys squamipes. In situ hybridization with telomeric probes (TTAGGG)n revealed the presence of a strong interstitial block of these sequences in the submetacentric B (Silva and Yonenaga-Yassuda, 1998). Microdissection of the submetacentric B, followed by DOP-PCR and painting metaphases with the generated probes, showed hybridization with the constitutive heterochromatin of the short arms of the X chromosomes, which is considered a specific category of constitutive heterochromatin (Silva et al., unpublished data), although meiotic data confirmed that Bs behave as uni or bivalents: they were never found paired with autosomes or sex chromosomes. B synaptonemal complex (SC) neither shows peculiar behavior nor exhibits differences of staining when compared to those of A chromosomes. Remarkable heterogeneity in the composition of B chromosomes in samples of N. rattus and N. squamipes was reflected by localization of telomeric sequences, variability of amount and distribution of constitutive heterochromatin, size and morphology (Silva and YonenagaYassuda, 1998) (Table 1). Heterogeneous constitution and nature of different Bs have also been evidenced in the harvest mouse Reithrodontomys megalotis: these chromosomes share euchromatic arms, heterochromatic centromeric regions, absence of hybridization of the ribosomal gene probes, hybridization to LINE probes, telomeric sequences in both ends. However, the differences were concerned with the reduced amount of C-positive material in the smallest B and hybridization of the centromeric heterochromatin (pMeg-1) probe only in the largest B (Peppers et al., 1997). A similar situation seems to be common in other groups of vertebrates. McQuade et al. (1994), for example, microdissected and amplified B chromosome DNA from a marsupial genus Petauroides and observed homologies between supernumeraries and centromeric regions of all autosomes, although

Fig. 3. GTG-banding pattern of Oryzomys angouya (2n = 60). B chromosomes are indicated in the square.

these chromosomes showed exclusive composition and heterogeneous DNA sequences. In Nyctereutes procyonoides, the raccoon dog, telomeric (TTAGGG)n sequences were also found to be distributed in the supernumeraries (Wurster-Hill et al., 1988). Constitutively, B chromosomes are also composed of euchromatin. Empirical data reveal that these chromosomes are not necessarily inert and that chromatin structure or repression by genes on A chromosomes may cause their inactivity instead of the methylation process (Lo´pez-Léon et al., 1995). Ribosomal DNA was detected in several organisms (e.g. Assis et al., 1978; Wurster-Hill et al., 1986; Cabrero et al., 1987; Green, 1990; Lo´pez-Leo´n et al., 1991; Yonenaga-Yassuda et al., 1992; Stitou et al., 2000). Two Brazilian species of rodents, Akodon montensis and Oryzomys angouya, carry Bs with active NORs in some individuals. Nucleolar organizer regions have also been described in Rattus rattus by Stitou et al. (2000), who suggested that the accessory chromosomes have originated from one of the smaller NOR-carrying chromosome pairs, and in the course of evolution, repetitive sequences invaded the supernumerary and NORs were inactivated by heterochromatinization and methylation. Regarding mechanisms of origin and evolution of B chromosomes, the most accepted hypothesis suggests that a new chromosome originates due to non-disjunction or other kind of rearrangement followed by gradual modification of this chromosome because of successive mutations and structural modification until there is a complete loss of homology and capacity to pair with the original A chromosome (Volobujev, 1981; Vujosevic and Zivkovic, 1987; Beukeboom, 1994). Green (1990) suggested that structural differences between B and A chromosomes were the result of mechanisms for diver-

Fig. 4. Total of 15 Ag-NORs (arrows) of Oryzomys angouya (2n = 60), including NORs in both telomeres of one minute supernumerary (arrow head).

gence similar to that observed for Y chromosomes, given that some regions have weak selective pressure and evolve quickly from one generation to another. This hypothesis was supported by studies in maize in which recently originated B chromo-

Cytogenet Genome Res 106:257–263 (2004)

261 119

somes become more heterochromatic in successive generations (Peeters et al., 1985). Camacho et al. (1997) suggested that Bs may evolve towards neutrality by losing both drive and effects on carrier fitness, but the B chromosome polymorphism may persist in natural populations because new parasitic B variants may appear and replace the near-neutral B, which would otherwise be condemned to extinction. Most studies focusing on B chromosomes in Brazilian rodents are related to their structure and composition. Origin and evolution of these chromosomes still remain unclear, however in the light of the present review intriguing questions emerge and should be considered. Regarding the pair of species Nectomys squamipes and N. rattus, the question is: have these chromosomes originated separately in each species or have they had a common ancestry and diverged separately in each species? Similarly, the presumptive B chromosomes in Trinomys iheringi demand additional research. They are non-heterochromatic minute chromosomes showing early replication which appeared in all 22 animals collected in different years and different seasons. The theoretical basic diploid number, 2n = 60, has never been found in nature (Kasahara, 1978; Kasahara and Yonenaga-Yassuda, 1984; Fagundes, 1993). Then, what do the euchromatic and early replicating supernumeraries really mean in the evolutionary history of this species? The possibility also

remains that they are not dispensable, since no individuals lacking them have been hitherto found, so that they could even be incipient A chromosomes. We believe that the question about Nectomys should be investigated by the association of phylogeographical and molecular studies since the ancestral condition of these chromosomes could be checked out in the pair of species; and in Trinomys iheringi, molecular approaches using FISH, microdissection and DNA sequencing will probably help to figure out the nature of those euchromatic dot-like supernumeraries. A more extensive sampling and performing controlled crosses could also help to test the dispensability of the minute chromosomes, by trying to find individuals lacking them. And, finally, the origin of NORs in Akodon montensis and Oryzomys angouya remains an important point to be investigated. It is also important to stress here that many Brazilian regions still need to be surveyed. Therefore the present knowledge of the number of B-carrier rodent species may be an underestimation reflecting our scarce knowledge of the Brazilian biodiversity.

Acknowledgements We thank Carolina E.V. Bertolotto, Katia C.M. Pellegrino, Renata C. Amaro-Ghilardi and Rodrigo M. Santos for suggestions in the manuscript.

References Almeida EJC: Variabilidade citogenética nos gêneros Oryzomys e Thomasomys (Cricetidae, Rodentia). Ph.D. Thesis. Instituto de Biociências, Universidade de Sa˜o Paulo, Sa˜o Paulo (1980). Assis MFL, Kasahara S, Yonenaga-Yassuda Y: Agstaining of nucleolus organizer regions of Akodon sp. (Cricetidae-Rodentia) with supernumerary chromosome. Mammal Chrom Newsletter 19: 125–126 (1978). Barros RSM: Variabilidade cromossômica em Proechimys e Oryzomys (Rodentia) da Amazônia. Ph.D. Thesis. Instituto de Biociências. Universidade de Sa˜o Paulo, Sa˜o Paulo (1978). Beukeboom LW: Bewildering Bs: an impression of the 1st B-chromosome conference. Heredity 73:328– 336 (1994). Bonvicino CR, D’Andrea PS, Cerqueira R, Seua´nez HN: The chromosomes of Nectomys (Rodentia, Cricetidae) with 2n = 52, 2n = 56, and interspecific hybrids (2n = 54). Cytogenet Cell Genet 73:190– 193 (1996). Bossle RC, Alza˜o CR, Beck AD, Sbalqueiro IJ, Lange MBR: Estudos cromossômicos em dois gêneros de roedores da famı´lia Cricetidae coletados na Serra do Mar do Parana´. XV Congress Brasil Zool (resumos), p 521 (1988). Cabrero J, Navas-Castillo J, Camacho JPM: Effects of B chromosomes on the activity of nucleolar organizer regions in the grasshoper Eyprepocnemis plorans: activation of a latent nucleolar organizer region on a B chromosome fused to an autosome. Genome 29:116–121 (1987). Camacho JPM, Cabrero MD, Lo´pez-Leo´n, Shaw MW: Evolution of a near-neutral B chromosome. Chrom Today 12:301–318 (1997).

262 120

Castro EC: Ocorrência e caracterizaça˜o cromossômica de roedores Akodontinos do Rio Grande do Sul. Master Dissertation. Universidade Federal do Rio Grande do Sul, Porto Alegre (1989). Cestari AN, Imada J: Os cromossomos do roedor Akodon arviculoides cursor Winge, 1888 (Cricetidae, Rodentia). Ciênc Cult 20:758–762 (1968). Christoff AU: Cromossomos acesso´rios e caracteres craniométricos de Akodon montensis (Rodentia – Cricetidae). Master Dissertation. Departamento de Genética. Universidade de Federal do Rio Grande do Sul, Porto Alegre (1991). Fagundes V: Ana´lises cromossômicas e dos complexos sinaptonêmicos em roedores brasileiros das famı´lias Cricetidae e Echimyidae. Master Dissertation. Instituto de Biociências. Universidade de Sa˜o Paulo, Sa˜o Paulo (1993). Fagundes V: Contribuiça˜o da citogenética molecular no entendimento da evoluça˜o cromossômica no gênero Akodon (Rodentia, Sigmodontinae). Ph.D. Thesis. Departamento de Biologia. Instituto de Biociências. Universidade de Sa˜o Paulo, Sa˜o Paulo (1997). Freitas TRO: Estudos citogenéticos em roedores do Sul do Brasil. Master Dissertation, Universidade Federal do Rio Grande do Sul, Porto Alegre, Brazil (1980). Freitas TRO, Mattevi MS, Oliveira LFB, Souza MJ, Yonenaga-Yassuda Y, Salzano FM: Chromosome relationship in three representatives of the genus Holochilus (Rodentia, Cricetidae) from Brazil. Genetica 61:13–20 (1983). Freitas TRO, Mattevi MS, Oliveira LFB: Unusual Cband patterns in three rearranged karyotypic forms of Scapteromys (Rodentia, Cricetidae) from Brazil. Cytogenet Cell Genet 38:39–44 (1984).

Cytogenet Genome Res 106:257–263 (2004)

Furtado VV: Diversidade cromossômica em roedores das famı´lias Cricetidae e Caviidae de Pernambuco, Brasil. Ph.D. Thesis. Instituto de Biociências, Universidade de Sa˜o Paulo, Sa˜o Paulo (1981). Geise L: Os roedores Sigmodontinae (Rodentia, Muridae) do Estado do Rio de Janeiro. Sistema´tica, citogenética, distribuiça˜o e variaça˜o geogra´fica. Ph.D. Thesis. Departamento de Genética, UFRJ. Brazil (1995). Geise L, Canavez FC, Seua´nez HN: Comparative karyology in Akodon (Rodentia, Sigmodontinae) from Southwestern Brazil. J Heredity 89:158–163 (1998). Green DM: Muller’s ratchet and the evolution of supernumerary chromosomes. Genome 33:818–824 (1990). Jones RN, Rees H: B Chromosomes, p 266 (Academic Press, New York 1982). Karamysheva TV, Andreenkova OV, Bochkaereva MN, Borissova YM, Bogdanchikova N, Borodin PM, Rubtsov NB: B chromosomes of Korean field mouse Apodemus peninsulae (Rodentia, Murinae) analysed by microdissection and FISH. Cytogenet Genome Res 96:1–4 (2002). Kasahara S: Variabilidade cromossômica em quatro espécies de roedores das famı´lias Cricetidae e Muridae. Ph.D. Thesis. Instituto de Biociências, Universidade de Sa˜o Paulo, Sa˜o Paulo (1978). Kasahara S, Yonenaga-Yassuda Y: A progress report of cytogenetic data on Brazilian rodents. Sa˜o Paulo. Rev Bras Genet VII:509–533 (1984). Lima JFS: Diversidade cariotı´pica em roedores de pequeno porte do estado do Tocantins, Brasil. Ph.D Thesis, Universidade Estadual Paulista: Ju´lio de Mesquita Filho, Rio Claro, Sa˜o Paulo (2000).

Lo´pez-Leo´n MD, Cabrero J, Camacho PM: A nucleolus organizer region in a B chromosome inactived by DNA methylation. Chromosoma 100:134–138 (1991). Lo´pez-Leo´n MD, Cabrero J, Camacho JPM: Changes in DNA methylation during development in the B chromosome NOR of the grasshopper Eyprepocnemis plorans. Heredity 74:296–302 (1995). Maia V, Yonenaga-Yassuda Y, Freitas TRO, Kasahara S, Mattevi MS, Oliveira LF, Galindo MA, Sbalqueiro IJ: Supernumerary chromosomes, Robertsonian rearrangement and variability of the sex chromosomes in Nectomys squamipes (Cricetidae, Rodentia). Genetica 63:121–128 (1984). McQuade LR, Hill RJ, Francis D: B-chromosome system in the greater glider, Petauroides volans (Marsupialia: Pseudocheiridae). II. Investigation of Bchromosome DNA sequences isolated by micromanipulation and PCR. Cytogenet Cell Genet 66:155–161 (1994). Miao VPW, Matthews DE, Vanetten HD: Identification and chromosomal locations of a family of cytochrome P-450 genes pisatin detoxification in the fungus Nectria haematococca. Mol Gen Genet 226:214–223 (1991). Peeters JP, Griffiths AJF, Wilkes G: In vivo karyotypic modifications following spontaneous cell fusion in maize (Zea mays L.). Can J Genet Cytol 27:580– 585 (1985). Peppers JA, Wiggins LE, Baker RJ: Nature of B chromosomes in the harvest mouse Reithrodontomys megalotis by fluorescence in situ hybridization (FISH). Chrom Res 5:475–479 (1997). Sbalqueiro IJ, Kiku M, Lacerda M, Achkar DE, Arnt L: Estudos cromossômicos em roedores da famı´lia Cricetidae coletados no Parana´. Ciênc Cult (suppl) 38:926 (1986). Sbalqueiro IJ, Suñe-Mattevi M, Oliveira LFB, Solano MJV: B chromosome system in populations of Oryzomys flavescens (Rodentia, Cricetidae) from Southern Brazil. Acta Theriol 36:193–199 (1991).

Silva MJJ: Estudos cromossômicos e de complexos sinaptonêmicos em roedores brasileiros da tribo Oryzomyini (Cricetidae, Rodentia). Master Dissertation. Departamento de Biologia. Instituto de Biociências. Universidade de Sa˜o Paulo, Sa˜o Paulo (1994). Silva MJJ, Yonenaga-Yassuda Y: Heterogeneity and meiotic behaviour of B and sex chromosomes, banding patterns and localization of (TTAGGG)n sequences by FISH, in the Neotropical water rat Nectomys (Rodentia, Cricetidae). Chrom Res 6: 455–462 (1998). Silva MJJ, Fagundes V, Yonenaga-Yassuda Y: Revisa˜o citogenética em roedores brasileiros e sua contribuiça˜o para a citotaxonomia, in Freitas TRO (ed): Estudos Sobre a Fauna de Mamı´feros do Brasil (Sociedade Brasileira de Mastozoologia, Porto Alegre, in press 2004). Souza MJ: Caracterizaça˜o cromossômica em oito espécies de roedores brasileiros das famı´lias Cricetidae e Echimiydae. PhD Thesis. Instituto de Biociências. Universidade de Sa˜o Paulo, Brazil (1981). Stitou S, Diaz de la Guardia R, Jiménez R, Burgos M: Inactive ribosomal cistrons are spread throughout the B chromosomes of Rattus rattus (Rodentia, Muridae). Impications for their origin and evolution. Chrom Res 8:305–311 (2000). Svartman M: Levantamento cariotı´pico de roedores da regia˜o do Distrito Federal. Master Dissertation. Instituto de Biociências. Universidade de Sa˜o Paulo, Sa˜o Paulo (1989). Volobujev VT: B-chromosomes system of the mammals. Caryologia 34:1–23 (1981). Vujocevic M, Blagocevic J: B chromosomes in populations of mammals. Cytogenet Genome Res 106: 247–256 (2004). Vujosevic M, Zivkovic S: Numerical chromosome polymorphism in Apodemus flavicollis and A. sylvaticus (Mammalia: Rodentia) caused by supernumerary chromosomes. Acta Veter 37:81–92 (1987). Werren JH: The paternal-sex-ratio chromosome of Nasonia. Am Nat 137:392–402 (1991).

Wurster-Hill DH, Ward OG, Kada H, Whittemore S: Banded chromosome studies and B chromosomes in wild-caught raccoon dogs, Nyctereutes procyonoides viverrinus. Cytogenet Cell Genet 42:85–93 (1986). Wurster-Hill DH, Ward OG, Davis BH, Park JP, Moyzis RK, Meyne J: Fragile sites, telomeric DNA sequences, B chromosomes, and DNA content in raccoon dogs, Nyctereutes procyonoides, with comparative notes on foxes, coyote, wolf, and raccoon. Cytogenet Cell Genet 49:278–281 (1988). Yonenaga Y: Polimorfismos cromossômicos em roedores brasileiros. Ph.D. Thesis. Instituto de Biociências. Universidade de Sa˜o Paulo, Sa˜o Paulo (1972). Yonenaga Y: Karyotypes and chromosome polymorphisms in Brazilian rodents. Caryologia 28:269– 286 (1975). Yonenaga Y, Frota-Pessoa O, Kasahara S, Almeida EJC: Cytogenetic studies on Brazilian rodents. Ciênc Cult 28:202–211 (1976). Yonenaga-Yassuda Y, Souza MJ, Kasahara S, L’Abbate M, Chu HT: Supernumerary system in Proechimys iheringi iheringi (Rodentia, Echimyidae), from the state of Sa˜o Paulo, Brazil. Caryologia 38:179–194 (1985). Yonenaga-Yassuda Y, Prado RC, Mello DA: Supernumerary chromosomes in Holochilus brasiliensis and comparative analysis with Nectomys squamipes (Cricetidae, Rodentia). Rev Brasil Genet X:209–220 (1987). Yonenaga-Yassuda Y, Maia V, L’Abbate M: Two tandem fusions and supernumerary chromosomes in Nectomys squamipes (Cricetidae, Rodentia). Caryologia 41:25–39 (1988). Yonenaga-Yassuda Y, Assis MFL, Kasahara S: Variability of the nucleolus organizer regions and the presence of the rDNA genes in the supernumerary chromosome of Akodon aff. arvicoloides (Cricetidae, Rodentia). Caryologia 45:163–174 (1992). Zanchin NIT: Estudos cromossômicos em orizominos e equimı´deos da Mata Atlântica. Porto Alegre. Master Dissertation. Instituto de Biociências. Universidade Federal do Rio Grande do Sul, Porto Alegre (1988).

Cytogenet Genome Res 106:257–263 (2004)

263 121

Review on B Chromosomes Cytogenet Genome Res 106:264–270 (2004) DOI: 10.1159/000079297

The mammalian model for population studies of B chromosomes: the wood mouse (Apodemus) J.M. Wo´jcik,a A.M. Wo´jcik,a M. Machola´n,b J. Pia´lek,c and J. Zimac a Mammal

Research Institute, Polish Academy of Science, Białowiez˙a (Poland); of Animal Physiology and Genetics; c Institute of Vertebrate Biology, Academy of Sciences of the Czech Republic, Brno (Czech Republic) b Institute

Abstract. The presence of B chromosomes was reported in six species of the genus Apodemus (A. peninsulae, A. agrarius, A. sylvaticus, A. flavicollis, A. mystacinus, A. argenteus). High frequencies of Bs were recorded particularly in A. peninsulae and A. flavicollis. The origin of Bs in Apodemus seems to be rather ancient, and it is possible that the supernumerary elements, and/or a tendency for their appearance, were inherited from the common ancestor of the extant species. We have not found any correlated changes between frequencies of Bs and the level of protein polymorphism and/or heterozygosity assessed in electrophoretic studies. No measurable effect of Bs on

overall genetic variability was thus revealed in studied populations. The pattern of evolutionary dynamics of Bs can be distinctly different between geographical populations, and both the parasitic and the heterotic models can be applied to explain the maintenance of Bs in different populations. Further studies are desirable to improve our understanding of the complicated evolutionary dynamics of Bs in the Apodemus species. An essential condition for success in this respect is much more detailed information on inheritance and the molecular structure of Bs.

The wood mice of the genus Apodemus are common murid rodents of the Palaearctic region inhabiting mainly forest habitats but also steppes, crop fields, rocky and mountain environments. The genus comprises 21 extant species (Musser and Carleton, 1993) often divided into several subgenera. Currently, two main subgenera are commonly recognized, i.e. the nominate Apodemus, with most species of the East Asian distribution, and Sylvaemus, including most species with the west Palaearctic distribution (Musser et al., 1996; Chelomina, 1998; Martin et al., 2000; Serizawa et al., 2000; Filippucci et al., 2002; Michaux et al., 2002).

Karyotypes of the studied Apodemus species are rather uniform with respect to the prevailing diploid number of 48 largely acrocentric chromosomes. B chromosomes, supernumerary to the standard set of the A chromosomes, have been found in somatic and germinal cells of various species of this genus (Fig. 1). The first records of Bs were made in Siberian and Japanese populations of A. peninsulae (Hayata et al., 1970; Kra´l, 1971; Hayata, 1973), and in European populations of A. flavicollis (Wolf et al., 1972; Soldatovic´ et al., 1975). Our knowledge about the occurrence of Bs in wood mice of the genus Apodemus has increased considerably in the last decades when several dozen papers on this topic were published. The presence of Bs has so far been demonstrated in the genome of six Apodemus species, and in populations distributed over the whole Palaearctic range of the genus. The wood mouse of the genus Apodemus has thus become an important mammalian model for studies of evolutionary dynamics and effects of Bs in the host genome. The aim of this paper is to report new data related to certain topical questions of the role of Bs in Apodemus, and to provide a review of current research.

Supported by the Academy of Sciences of the Czech Republic (grant nos. A645402 and KSK6005114). Received 15 October 2003; manuscript accepted 5 January 2004. Request reprints from Dr Jan Zima, Institute of Vertebrate Biology, AS CR Kvetna´ 8, CZ–60365 Brno (Czech Republic) telephone: +420 5 4342 2554; fax: +420 5 4321 1346 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0264$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Chromosome preparations in all the studied individuals were made directly from the bone marrow using the standard method. Some slides were differentially stained using the G- and C-banding techniques.

Results and discussion

Fig. 1. C-banded karyotype of A. flavicollis with two B chromosomes (last row).

Material and methods The original data presented in this study include two samples. The first sample of A. flavicollis was collected in the Białowiez˙a Primeval Forest in north-eastern Poland (23°55) E 52°42) N) in a study area of 5.76 ha from autumn 1986 to spring 1988. The population density index was estimated in each trapping period as a total number of captured mice in the study plot during 5 days of trapping divided by 5.76 ha. The age of the specimens collected was determined on the basis of teeth growth and wear (AdamczewskaAndrzejewska, 1967), and four classes were distinguished: F 2 months, 3–5 months, 6–9 months, and 19 months. A total of 146 individuals were analysed. In this sample, temporal changes in the frequency of individuals with B chromosomes were evaluated in relation to sex and age of animals and population densities during spring and autumn. G-test of independence (Sokal and Rohlf, 1981) was used to compare frequencies of individuals with Bs in samples of young (up to 5 months) and adult mice (over 6 months) and in samples of males and females. Correlation coefficient (Pearson) was calculated between population density index in following seasons and frequencies of B chromosomes (using arcsin transformation). Allozyme variation in a sample of 40 individuals collected in spring 1988 in Białowiez˙a was studied. Horizontal starch gel electrophoresis was performed and 23 presumptive loci were scored (Harris and Hopkinson, 1976, for a list of studied loci see Wo´jcik, 1993). Additionally, variation in transferrin locus was studied in all samples collected in Białowiez˙a during 1986– 1988 (Wo´jcik, 1993). The other sample of A. flavicollis and A. sylvaticus originated from northern Bohemia in the Czech Republic during six trapping periods in 1994– 1996. The animals were live-trapped at two sites: at the village of Filipov in the Deˇcˇı´n district (14°23) E 50°49) N) and in the surroundings of Litvı´nov in the Most district (13°42) E 50°37) N). Juvenile and adult individuals were differentiated according to criteria given by Zima et al. (2003). Samples of kidney and muscles were preserved at – 80 ° C until processing. Horizontal starch gel electrophoresis was performed and 30 presumptive loci were scored (Harris and Hopkinson, 1976). The loci investigated and the basic procedures used were the same as described by Filippucci et al. (1988, 1996). Allozyme data were processed as genotype frequencies with the BIOSYS-1 program of Swofford and Selander (1981). A total of 67 individuals of A. flavicollis and 13 individuals of A. sylvaticus from Filipov, and 29 individuals of A. flavicollis from Litvı´nov were examined. In this sample, the influence of changes in the frequencies of Bs on overall genetic variation estimated by the allozyme data was evaluated.

Origin, molecular composition, and transmission of Bs Parallel appearance and evolution of B chromosomes in different species of the genus Apodemus seem improbable. If the incidence of Bs is a homologous feature of different lineages, i.e. if they were inherited from the common ancestor of the extant Apodemus species, we should suppose that their origin is considerably ancient. Bs occur in representatives of both main phylogenetic lineages of the genus recognized currently as the subgenera Apodemus (A. agrarius, A. peninsulae) and Sylvaemus (A. flavicollis, A. sylvaticus, A. mystacinus). Phylogenetic divergence between these two subgenera was estimated at 2.2– 3.5 MYA (Michaux et al., 2002). Furthermore, the presence of Bs was evidenced also in A. argenteus, a species reported to be not closely related to either of the main subgenera (Musser et al., 1996; Serizawa et al., 2000), and possibly representing a separate monospecific subgenus (Fukushi et al., 2001). This indicates that Bs could actually appear as early as the beginning of the radiation leading to the extant Apodemus species. This supposed ancient origin of Bs in Apodemus is not consistent with the view that Bs have recently been derived from the standard chromosomes in mammals (Palestis et al., 2004). A confirmation of the assumed common origin of Bs within the genus Apodemus should be looked for in shared characters of their molecular composition. Unfortunately, there are currently almost no comparative data in this respect. There is little doubt that Bs in Apodemus are composed largely of repeated DNA sequences. Different satellite DNAs were distinguished in A. sylvaticus, and two major repetitive sequences were isolated (Hirning et al., 1989). In A. peninsulae, repeated sequences from Bs were identified also in the pericentromeric regions of autosomes and in the sex chromosomes (Karamysheva et al., 2002; Trifonov et al., 2002), and active NORs and clusters of rDNA were detected in certain Bs (Rubtsov et al., 2004). Tanic´ et al. (2000) revealed through DNA profiling certain molecular markers specific for Bs in A. flavicollis. A comparative analysis of the molecular structure of Bs in individual Apodemus species is still missing, however, it is strongly indicated that the composition can vary a great extent even within single species or individuals (Rubtsov et al., 2004), and this feature is reflected also in an inconsistent banding pattern of Bs (Abe et al., 1997; Obara and Sasaki, 1997; Trifonov et al., 2002). The heterochromatic nature of Bs was demonstrated also by the absence of their transcriptional activity during pachytene (Ishak et al., 1991). Bs are supposed to show instable behaviour during cell division, and therefore they should be subjected to meiotic drive. Mitotic instability of Bs was demonstrated by the frequent presence of a mosaic of different cell lines in somatic tissues (Kartavtseva, 1999). Bs are usually reported as univalents in the first meiotic division, but they were also observed as bivalents, multivalents, or in some more compli-

Cytogenet Genome Res 106:264–270 (2004)

265 123

Table 1. Frequency distribution of B chromosomes in samples of A. flavicollis and A. sylvaticus examined by the authors

No. of individuals A. flavicollis A. sylvaticus a b c

No. of B chromosomes 0

1

2

3

4

5

6

7

8

356 286

150 5

80 1

47 1

9 1

5 0

2 0

2 0

1 0

F(B)

652 294

45.4 2.7

b

X(B)

c

0.84 0.03

N: total sample size. F(B): percentage of individuals with Bs. X(B): mean number of Bs per individual.

cated configurations (Hayata, 1973; Vujosˇevic´ et al., 1989; Bekasova and Vorontsov, 1995). Studies aimed to analyse the possibility of preferential segregation of Bs during meiosis, however, yielded ambiguous results. Kolomiets et al. (1988) reported indirect evidence for accumulation of Bs in A. peninsulae, however, Vujosˇevic´ et al. (1989) found no evidence for preferential segregation in A. flavicollis, because the same frequencies of Bs were observed in bone marrow and testicular tissue. The similarity in molecular composition between Bs and the sex chromosomes (Karamysheva et al., 2002; Trifonov et al., 2002) as well as observations of associations between Bs and the sex chromosomes in pachytene (Borbiev et al., 1990) may indicate a possible origin of Bs from certain heterochromatin fractions on the sex chromosomes. This possibility can find support in extensive heterochromatin variation in the sex chromosomes that was reported in certain Apodemus species (Nova´ et al., 2002). An alternative view suggests that Bs could originate from autosomes of the standard set through polysomy with ˇ ivkovic´, 1987). subsequent rapid inactivation (Vujosˇevic´ and Z Karamysheva et al. (2002) and Rubtsov et al. (2004) proposed a hypothesis that transposable elements might invade pericentromeric regions of A chromosomes of A. peninsulae. A destabilizing effect of these repeated DNA sequences resulted then in frequent formation of B chromosomes. A relationship was suggested between the B chromosome origin and effects of environmental mutagenic factors such as industrial pollution (Giagia et al., 1985) or viral diseases (Kartavtseva and Roslik, 2004). However, there is currently little evidence of such effects, and certain field data do not support their actual existence (Zima et al., 1999). Frequencies of Bs in individual species and populations The incidence of Bs has been reported in six Apodemus species, i.e. A. peninsulae (Kartavtseva, 2002; Kartavtseva and Roslik, 2004), A. agrarius (Kartavtseva, 1994), A. sylvaticus ˇ ivkovic´, 1987; Zima et al., 1997), A. flavicollis (Vujosˇevic´ and Z (Vujosˇevic´ et al., 1991; Zima and Machola´n, 1995), A. mystacinus (Belcheva et al., 1988), and A. argenteus (Obara and Sasaki, 1997). Frequencies of Bs are distinctly different between species. The highest frequencies were reported in A. peninsulae. In this species, the presence of Bs was revealed in approximately 85 % of individuals examined (n = 1,103), and up to 24 supernumerary elements were observed in a single individual (Kartavtseva and Roslik, 2004, for review). Relatively high frequencies were found also in A. flavicollis. According to our data from

266 124

a

N

Cytogenet Genome Res 106:264–270 (2004)

central, eastern, and southeastern Europe, the presence of Bs was revealed in 45.4 % of individuals analysed (n = 652), and the maximum of eight and the mean of 0.84 Bs per individual were found (Table 1). In A. sylvaticus, much lower frequencies ˇ ivkovic´, 1987; Table 1), of Bs were recorded (Vujosˇevic´ and Z and the presence of Bs in other species should only be considered exceptional. We examined about 200 individuals belonging to species other than those listed above, and we did not find any individual possessing Bs. Variation in the frequency of Bs between geographic populations within a species can be evaluated only in A. peninsulae, A. flavicollis, and A. sylvaticus. However, occasional problems with reliable species determination in A. sylvaticus may bias data related to this species. In A. peninsulae, the highest number of Bs per individual and their highest frequencies in populations were recorded in Siberia and surrounding regions (99.5 % individuals with Bs, n = 388; Kartavtseva and Roslik, 2004). Slightly lower frequencies were reported from other continental parts of the species’ range, e.g., 86.6 % individuals with Bs (n = 543) in the Far East and North Korea, and 82.4 % individuals with Bs (n = 17) in China. An inconsistent situation was reported from two allopatric populations of A. peninsulae occurring on large islands. In Hokkaido island, all the individuals studied (n = 67) possessed at least one B chromosome, whereas no Bs were recorded in a sample of 88 individuals examined on the nearby Sakhalin island (Kartavtseva and Roslik, 2004). A clinal trend towards an increase in the B chromosome frequencies from south-eastern to central Europe was reported in A. flavicollis (Zima and Machola´n, 1995), and it was proposed that this trend may have continued further to eastern and northern Europe (Zima et al., 2003). However, this suggestion is not supported by the data from Białowiez˙a in north-eastern Poland presented in this study (Fig. 2). The addition of these new data reveals a rather complicated pattern of the geographical distribution of B chromosome frequencies in the European range of this species which can hardly be explained by simple latitude or altitude gradients. Evolutionary dynamics and effects of Bs Meiotic drive, random genetic drift, and natural selection at the organismal level have been considered as possible factors of the evolutionary dynamics of Bs. Two alternative models may explain the mechanisms responsible for the maintenance of Bs in populations. The parasitic model suggests deleterious effects of Bs on fitness. Their continuous presence in a population

results from accumulation processes based on meiotic drive (Jones, 1991). The adaptive or heterotic model (White, 1973) assumes that genotypes with Bs have greater adaptive value in certain external conditions, and that selection plays a role in the maintenance of B chromosome polymorphism in populations. The theory of centromeric drive (Palestis et al., 2004) suggests that the Apodemus species with 48 acrocentric chromosomes may represent a group where spreading of Bs is associated with selection favouring more rather than fewer centromeres. B chromosomes were recorded also in a species with the lowered diploid number of 46 chromosomes and two metacentric pairs of autosomes (A. argenteus, Obara and Sasaki, 1997). However, no Bs have been found in certain Japanese populations of A. speciosus possessing a karyotype with 46 chromosomes that can be derived from the karyotypes of related species through a centric fusion of two pairs of autosomes (Tsuchiya, 1974). Another support for this theory can be derived from the very low frequency of centric fusions in natural populations. Only four karyotypes with a heterozygous centric fusion have been reported among hundreds of individuals of ˇ ivkovic´, 1987; Zima et A. flavicollis examined (Vujosˇevic´ and Z al., 1990; Nadzhafova, 1997; our unpublished record in an individual from Ukraine). The centric fusion has never been found in more than one individual from a single population, and no homozygous fusion has been recorded. Polymorphic centric fusions have also not been reported in other species. This shows that karyotype evolution through centric fusions, leading to the decrease in the number of centromeres, is actually not favoured in Apodemus. On the other hand, the distinct differences in frequencies of Bs between individual species indicate that centromeric drive may be an important but not the exclusive mechanism of maintenance and spreading of Bs in populations. The adaptive effects of B chromosomes could result from their influence on the overall genetic variation in populations. We tested the possible contribution of the presence of Bs to genetic variation in the samples collected in Białowiez˙a (Poland) and Litvı´nov and Filipov (northern Bohemia, Czech Republic). The level of genetic variation was rather uniform in the samples of both A. flavicollis and A. sylvaticus (Table 2). We have not recorded any significant difference between the samples of A. flavicollis and A. sylvaticus, even in the period of their syntopic occurrence. There were no significant differences in frequencies of transferrin heterozygotes between samples collected in successive seasons during 1986–1988 in Białowiez˙a. There were also no significant differences in mean heterozygosity of studied loci of allozymes between samples collected in successive seasons in Litvı´nov and Filipov (Table 3). The heterozygosity level was higher in the sample of juveniles compared to adults in Filipov, but the number of polymorphic loci was lower in the former sample which had a lower frequency of Bs. On the other hand, the sample of individuals possessing Bs from Litvı´nov revealed higher levels of heterozygosity than the sample of individuals without Bs (Table 4). However, neither of these differences was significant. The results thus indicate that overall genetic variability expressed by the level of protein polymorphism and/or mean heterozygosity is not correlated with the frequency distribution of B chromosomes.

Fig. 2. Mean frequencies (in percent) of individuals possessing Bs in certain geographical populations of A. flavicollis. Asian Turkey (0.0 %, n = 8; Machola´n and Zima, 1997); European Turkey (24.0 %, n = 41; Zima and Machola´n, 1995); Macedonia, Greece, Bulgaria (40.0 %, n = 55; Zima and Machola´n, 1995); Yugoslavia (40.2 %, n = 421; Vujosˇevic´, 1992; Blagojevic´ and Vujosˇevic´, 1995); Romania, Ukraine (10.5 %, n = 19; Zima and Machola´n, 1995); Slovakia (35.8 %, n = 42; Zima and Machola´n, 1995); Southern Moravia (40.5 %, n = 84; Zima and Machola´n, 1995); Northern Moravia (61.1 %, n = 36; Zima and Machola´n, 1995); Northern Bohemia (80.0 %, n = 138; Zima et al., 2003; this paper); North-eastern Poland (28.1 %, n = 146; this paper); Saratov, Russia (81.0 %, n = 21; Boyeskorov et al., 1994).

Table 2. Genetic variability in the samples of A. flavicollis from Białowie˙z˙a (Poland) and Litvı´nov and Filipov (Czech Republic) and A. sylvaticus from Filipov Species

Site

N

a

A (SD)

P

H (SD)

X(B)

A. flavicollis A. flavicollis A. flavicollis A. sylvaticus

Bialowieza f Litvínov Filipov Filipov

40 29 67 13

1.3 (0.8) 1.4 (0.1) 1.5 (0.2) 1.3 (0.1)

17 23.3 23.3 20.0

0.057 (0.140) 0.062 (0.025) 0.070 (0.026) 0.063 (0.034)

0.43 1.20 2.23 0.19

a b c d e f

b

c

d

e

N: Number of individuals studied. A: Mean number of alleles per locus. P: Percentage of polymorphic loci. H: Heterozygosity. X(B): Mean number of B chromosomes per individual. Sample collected in Spring 1988; 23 loci studied (see Wójcik, 1993).

Table 3. Genetic variability in samples of A. flavicollis from various sites and seasons (see Table 2 for explanations) Year and season

Site

N

A (SD)

P

H (SD)

X(B)

October 1994 October 1995 July 1996 September 1996 October 1995 July 1996

Filipov Filipov Filipov Filipov Litvínov Litvínov

12 19 17 19 9 20

1.4 (0.1) 1.4 (0.1) 1.4 (0.1) 1.4 (0.1) 1.2 (0.1) 1.4 (0.1)

23.3 23.3 25.0 25.0 18.8 21.9

0.072 (0.028) 0.082 (0.035) 0.057 (0.021) 0.073 (0.027) 0.058 (0.025) 0.053 (0.022)

2.42 1.69 2.75 1.93 1.33 1.44

Cytogenet Genome Res 106:264–270 (2004)

267 125

Table 4. Genetic variability in samples of A. flavicollis (see Table 2 for explanations) Sample

Site

N

A(SD)

P

H (SD)

X(B)

juveniles adults

Filipov

35 17

1.5 (0.2) 1.4 (0.1)

25.0 28.1

0.073 (0.027) 0.052 (0.018)

1.68 2.88

2n = 48 2n = 48+B

Litvínov

10 19

1.3 (0.1) 1.3 (0.1)

18.8 21.9

0.039 (0.025) 0.063 (0.026)

0.00 2.35

Table 5. Numbers of Bs in Apodemus flavicollis collected in the Białowiez˙a Primeval Forest from autumn 1986 to spring 1988

Fig. 3. Frequency of individuals with Bs (F(B)) and population density index [n/ha] in Apodemus flavicollis in the Białowiez˙a Primeval Forest (Poland) during four consecutive seasons. Density indexes and F(B) were estimated only for over-winterers in spring seasons.

Fig. 4. Frequency of individuals with Bs (F(B)) in samples of different age classes in Apodemus flavicollis from the Białowiez˙a Primeval Forest (whole sample). G-test value was calculated between samples of young (up to 5 months) and adult mice (over 6 months).

Fig. 5. Frequency of individuals with Bs (F(B)) in samples of young (up to 5 months) and adult (over 6 months) Apodemus flavicollis from the Białowiez˙a Primeval Forest in different seasons.

268 126

Cytogenet Genome Res 106:264–270 (2004)

Karyotype (2n)

Age classes (in months) ~2

3-5

6-9

over 9

Total

48 48+1B 48+2B 48+3B

21 10 1 3

40 13 4 0

25 6 0 0

19 3 1 0

105 32 6 3

Total

35

57

31

23

146

Similarly to samples of A. flavicollis from Filipov and Litvı´nov, we have not recorded significant changes in the frequency of Bs over successive seasons in the sample from Białowiez˙a. In this sample, we found that frequencies of Bs are independent of sex and body mass, and there was no significant correlation (r = 0.553, P = 0.447, d.f. = 2) between the frequency of individuals with Bs and population density in samples from four seasons (Fig. 3). The number of Bs per individual varied from one to three (Table 5). The frequency of individuals with Bs differed significantly between the samples of young and adults (G-test, G = 4.1, P ! 0.05, d.f. = 1). Young animals possessed more Bs than adult ones both in the spring and autumn (Figs. 4, 5). These results contradict our previous data obtained in northern Bohemia (Zima et al., 2003). In a local population, we found a significant prevalence of Bs in the sample of adult males of A. flavicollis. Therefore, a hypothesis was proposed predicting a direct adaptive significance of Bs mediated through differential survival during winter. The individuals with Bs were believed to be better adapted to cold winter owing to an increased growth rate and resulting larger body size. These predictions were not supported in the Białowiez˙a population. The dynamics of Bs in this population can be sufficiently explained by the parasitic model, because animals possessing Bs were eliminated faster from the population than animals without Bs. The fitness of animals carrying Bs should be lowered, and Bs should be maintained in a population by preferential transmission during meiosis. The model proposed for the population from northern Bohemia (Zima et al., 2003) apparently cannot be generalized to other geographical populations of A. flavicollis or other Apodemus species. This conclusion is also supported from the pattern of geographical distribution of B chromosome frequencies in Europe (Fig. 1). The evolutionary dynamics of Bs in different populations of A. flavicollis can

be explained either by the parasitic or heterotic models. Nevertheless, it seems probable that Bs exert particular effects, either deleterious or advantageous, on the organism. The effects of Bs at the organismal level also were proposed by Blagojevic´ and Vujosˇevic´ (2000) and Vujosˇevic´ and Blagojevic´ (2000). The complicated pattern revealed in A. flavicollis and A. peninsulae shows that effects of Bs can vary both spatially and temporally (Camacho et al., 2000), and specific levels of integration into the host genome can be observed. Further studies are desirable to improve our understanding of the possible

parasitic nature and the alternative ways of evolutionary dynamics of Bs in the Apodemus species. An essential condition for success in this respect is much more detailed information on inheritance and the molecular structure of Bs.

Acknowledgements We thank J. Lipiñska and L. Szymura for their technical assistance in this study and J.F. Kamler for correcting English. We are grateful to J.P.M. Camacho and M. Vujosˇevic´ for useful comments on the manuscript.

References Abe S, Han SH, Kojima H, Ishibashi Y, Yoshida MC: Differential staining profiles of B-chromosomes in the East-Asiatic wood mouse Apodemus peninsulae. Chrom Sci l:7–12 (1997). Adamczewska-Andrzejewska K: Age reference model for Apodemus flavicollis (Melchior, 1834). Ekologia Polska A15:787–790 (1967). Bekasova TS, Vorontsov NN: Populational chromosome polymorphism in Asiatic forest mice Apodemus peninsulae. Genetika (Moscow) 11:89–94 (1995). Belcheva RG, Topashka-Ancheva MN, Atanassov N: Karyological studies of five species of mammals from Bulgarian fauna. Compt rend Acad bulg Sci 42:125–128 (1988). Blagojevic´ J, Vujosˇevic´ M: The role of B-chromosomes in population dynamics of yellow necked wood mice Apodemus flavicollis (Rodentia, Mammalia). Genome 38:472–478 (1995). Blagojevic´ J, Vujosˇevic´ M: Do B chromosomes affect morphometric characters in yellow-necked mice Apodemus flavicollis (Rodentia, Mammalia)? Acta Theriol 45:129–137 (2000). Borbiev TE, Kolomiets OL, Borisov YM, Safronova LD, Bogdanov YF: Synaptonemal complexes of Aand B-chromosomes in spermatocytes of the EastAsiatic mouse Apodemus peninsulae. Tsitologiya 32:193–196 (1990). Boyeskorov G, Zagorodnyuk I, Belyanin A, Lyapunova EA: B-chromosomes in Apodemus flavicollis from Eastern Europe. Pol ecol Stud 20:523–526 (1994). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Chelomina GN: Molecular phylogeny of forest and field mice of the genus Apodemus (Muridae, Rodentia) based on the data on restriction analysis of total nuclear DNA. Genetika (Moscow) 34:1286– 1292 (1998). Filippucci MG, Nevo E, Rodino E, Capanna E: Evolutionary genetics and systematics of the garden dormouse, Eliomys Wagner, 1840. 2. Allozyme diversity and differentiation of chromosomal races. Boll Zool 55:47–54 (1988). Filippucci MG, Storch G, Macholan M: Taxonomy of the genus Sylvaemus in western Anatolia – morphological and electrophoretic evidence. Senckenberg Biol 75:1–14 (1996). Filippucci MG, Machola´n M, Michaux JR: Genetic variation and evolution in the genus Apodemus (Muridae: Rodentia). Biol J Linn Soc 75:395–419 (2002). Fukushi D, Kuro-o M, Shichiri M, Obara Y, Tsuchiya K: Molecular cytogenetic analysis of the highly repetitive DNA in the genome of Apodemus argenteus, with comments on the phylogenetic relationships in the genus Apodemus. Cytogenet Cell Genet 92:254–263 (2001).

Giagia E, Soldatovic´ B, Savic´ I, Zimonjic D: Karyotype study of the genus Apodemus (Kaup 1829) populations from the Balkan Peninsula. Acta Vet (Beograd) 35:289–298 (1985). Harris H, Hopkinson DA: Handbook of Enzyme Electrophoresis in Human Genetics (North Holland, Amsterdam and Oxford 1976). Hayata J: Chromosomal polymorphism caused by supernumerary chromosomes in field mouse, Apodemus giliacus. Chromosoma 42:403–414 (1973). Hayata I, Shimba H, Kobayashi T, Makino S: Preliminary accounts on the chromosomal polymorphism in the field mouse, Apodemus giliacus, a new form from Hokkaido. Proc Jpn Acad 46:567–571 (1970). Hirning U, Schulz WA, Just W, Adolph S, Vogel W: A comparative study of the heterochromatin of Apodemus sylvaticus and Apodemus flavicollis. Chromosoma 98:450–455 (1989). Ishak B, Jaafar H, Maetz JL, Rumpler Y: Absence of transcriptional activity in the B-chromosomes of Apodemus peninsulae during pachytene. Chromosoma 100:278–281 (1991). Jones RN: B-chromosome drive. Am Nat 137:430–442 (1991). Karamysheva TV, Andreenkova OV, Bochkaerev MN, Borissov YM, Bogdanchikova N, Borodin PM, Rubtsov NB: B chromosomes of Korean field mouse Apodemus peninsulae (Rodentia, Murinae) analysed by microdissection and FISH. Cytogenet Genome Res 96:154–160 (2002). Kartavtseva IV: Description of B-chromosomes in karyotype of field mouse Apodemus agrarius. Tsitol Genet 28:96–97 (1994). Kartavtseva IV: Seasonal observations on supernumerary chromosomes, mosaicism, and dynamics in two populations of the Eastern-Asian wood mouse Apodemus peninsulae (Rodentia) from Primorskii Krai. Russ J Genet 35:811–817 (1999). Kartavtseva IV: Karyosystematics of Wood and Field Mice (Rodentia: Muridae) (Dalnauka, Vladivostok 2002). Kartavtseva IV, Roslik GV: A complex B chromosome system in the Korean field mouse Apodemus peninsulae. Cytogenet Genome Res 106:271–278 (2004). Kolomiets OL, Borbiev TE, Safronova LD, Borisov YM, Bogdanov YF: Synaptonemal analysis of Bchromosome behaviour in meiotic prophase I in the East-Asiatic mouse Apodemus peninsulae (Muridae, Rodentia). Cytogenet Cell Genet 48:183– 187 (1988). Kra´l B: Chromosome characteristics of certain murine rodents (Muridae) of the Asiatic part of the USSR. Zool listy 20:331–347 (1971). Machola´n M, Zima J: Absence of the B chromosomes in karyotypes of the yellow-necked wood mouse (Apodemus flavicollis) from Asia Minor. Folia Zool 46:191–192 (1997).

Martin Y, Gerlach G, Schötterer C, Meyer A: Molecular phylogeny of the European muroid rodents based on complete cytochrome b sequences. Mol Phyl Evol 16:37–47 (2000). Michaux JR, Chevret P, Filippucci MG, Machola´n M: Phylogeny of the genus Apodemus with a special emphasis on the subgenus Sylvaemus using the nuclear IRBP gene and two mitochondrial markers: cytochrome b and 12S rRNA. Mol Phyl Evol 23:123–136 (2002). Musser MD, Carleton GG: Family Muridae, in Wilson DE, Reeder DM (eds): Mammal Species of the World: A Taxonomic and Geographic Reference, 2nd Ed, pp 501–755 (Smithsonian Institutions, Washington DC 1993). Musser GG, Brothers EM, Carleton MD, Hutterer R: Taxonomy and distributional records of Oriental and European Apodemus, with review of the Apodemus-Sylvaemus problem. Bonn Zool Beitr 46:43–190 (1996). Nadzhafova RS: Unique chromosome rearrangements in karyotypes of yellow-necked mice (Apodemus flavicollis) from various populations. Russ J Genet 33:126–129 (1997). Nova´ P, Reutter BA, Ra´bova´ M, Zima J: Sex-chromosome heterochromatin variation in the wood mouse, Apodemus sylvaticus. Cytogenet Genome Res 96:186–190 (2002). Obara Y, Sasaki S: Fluorescent approaches on the origin of B chromosomes of Apodemus argenteus hokkaidi. Chrom Sci 1:1–5 (1997). Palestis BG, Burt A, Jones RN, Trivers R: B chromosomes are more frequent in mammals with acrocentric karyotypes: support for the theory of centromeric drive. Proc R Soc Lond B 271 Suppl 3:S22–24 (2004). Rubtsov NB, Karamysheva TV, Andreenkova OV, Bochkarev MN, Kartavtseva IV, Roslik GV, Borissov YM: Comparative analysis of micro and macro B chromosomes in the Korean field mouse Apodemus peninsulae (Rodentia, Murinae) performed by chromosome microdissection and FISH. Cytogenet Genome Res 106:289–294 (2004). Serizawa K, Suzuki H, Tsuchiya K: A phylogenetic view on species radiation in Apodemus inferred from variation of nuclear and mitochondrial genes. Biochem Genet 38:27–40 (2000). Sokal RR, Rohlf FJ: Biometry, 2nd Ed (W.H. Freeman, New York 1981). Soldatovic´ B, Savic´ I, Seth P, Reichstein H, Tolksdorf M: Comparative karyological study of the genus Apodemus. Acta Vet (Belgrade) 25:1–10 (1975). Swofford DL, Selander RK: BIOSYS-1: a FORTRAN program for the comprehensive analysis of electrophoretic data in population genetics and systematics. J Hered 72:281–283 (1981). Tanic´ N, Dedovic´ N, Vujosˇevic´ M, Dmitrijevic´ B: DNA profiling of B chromosomes from the yellownecked mouse Apodemus flavicollis (Rodentia, Mammalia). Genome Res 10:55–61 (2000).

Cytogenet Genome Res 106:264–270 (2004)

269 127

Trifonov VA, Perelman PL, Kawada S-I, Iwasa MA, Oda S-I, Graphodatsky AS: Complex structure Bchromosomes in two mammalian species: Apodemus peninsulae (Rodentia) and Nyctereutes procyonides (Carnivora). Chrom Res 10:109–116 (2002). Tsuchiya K: Cytological and biochemical studies of Apodemus speciosus group in Japan. J Mammal Soc Japan 6:67–87 (1974). Vujosˇevic´ M: B-chromosome polymorphism in Apodemus flavicollis (Rodentia, Mammalia) during five years. Caryologia 45:347–352 (1992). Vujosˇevic´ M, Blagojevic´ J: Does environment affect polymorphism of B chromosomes in the yellownecked mouse Apodemus flavicollis? Z Säugetierk 65:313–317 (2000). ˇ ivkovic´ S: Numerical chromosome Vujosˇevic´ M, Z polymorphism in Apodemus flavicollis and A. sylvaticus (Mammalia: Rodentia) caused by supernumerary chromosomes. Acta Vet (Beograd) 37:81– 92 (1987).

270 128

ˇ ivkovic´ S: Meiotic Vujosˇevic´ M, Radosavljevic´ J, Z behavior of B chromosomes in yellow necked mouse Apodemus flavicollis. Arh biol nauka 41:39– 42 (1989). Vujosˇevic´ M, Blagojevic´ J, Radosavljevic´ J, Bejakovic´ D: B chromosome polymorphism in populations of Apodemus flavicollis in Yugoslavia. Genetica 83: 167–170 (1991). White MJD: Animal Cytology and Evolution, 3rd Ed (Cambridge University Press, London 1973). Wo´jcik AM: Genetic variation in a fluctuating population of the yellow-necked mouse Apodemus flavicollis. Acta Theriol 38:273–290 (1993). Wolf U, Voiculescu I, Zenzes MT, Vogel W, Engel W: Chromosome polymorphism in Apodemus flavicollis, possibly due to creation of a new centromere, in Pfeiffer A (ed): Modern Aspects of Cytogenetics: Constitutive Heterochromatin in Man, pp 163– 168 (Springer, Stuttgart 1972).

Cytogenet Genome Res 106:264–270 (2004)

Zima J, Machola´n M: B chromosomes in the wood mice (genus Apodemus). Acta Theriol (Suppl 3): 75–86 (1995). Zima J, Luksˇ D, Machola´n M: Unusual karyotypes in Apodemus cf. flavicollis and Microtus agrestis (Mammalia: Rodentia). Acta Soc Zool Bohemoslov 54:146–149 (1990). Zima J, Machola´n M, Slivkova´ L: Confirmation of the presence of B chromosomes in the wood mouse (Apodemus sylvaticus). Folia Zool 46:217–221 (1997). Zima J, Ieradi LA, Allegra F, Sartoretti A, Wlosokova E, Cristaldi M: Frequencies of B chromosomes in Apodemus flavicollis are not directly related to mutagenetic environmental effects. Folia Zool 48 (Suppl 1):115–119 (1999). Zima J, Pia´lek J, Machola´n M: Possible heterotic effects of B chromosomes on body mass in a population of Apodemus flavicollis. Can J Zool 81:1312– 1317 (2003).

Review on B Chromosomes Cytogenet Genome Res 106:271–278 (2004) DOI: 10.1159/000079298

A complex B chromosome system in the Korean field mouse, Apodemus peninsulae I.V. Kartavtseva and G.V. Roslik Institute of Biology and Soil Science, Russian Academy of Sciences, Vladivostok (Russia)

Abstract. Information on B chromosomes of six subspecies of A. peninsulae Thomas, 1906, from 79 local populations of Russia (Siberia, Altai, Buryatia and the Far East), Mongolia, China, Korea and Japan (Hokkaido) is reviewed. The frequency of animals with B chromosomes is higher in this taxon than in other mammals and ranges from 0.4 up to 1.0, excluding two insular populations (Sakhalin Island and Stenin Island, Primorye) where Bs were not found. The B chromosome polymorphism shows four levels of variation in number (intraindividu-

Introduction The Korean field mouse, Apodemus peninsulae Thomas, 1906 is a polytypic species which has been subdivided into nine (Corbet, 1978; Musser and Carleton, 1993) or six (Pavlenko, 1989) subspecies, dependent on the investigators. This species is widely distributed from East Siberia and North Mongolia, China to the Russian Far East, Korea and Japan (Hokkaido) (Fig. 1). Each subspecies occupies its own geographical region and has a slight differentiation in morphometric character (Vorontsov et al., 1977; Koh and Lee, 1994), the transferrin gene (Pavlenko, 1989), and mitochondrial DNA (Serizawa et

This study was partly supported by the Grants of Far East Branch Russian Academy of Sciences: 03-1-0-06-018, 04-1-¶12-55 and 04-1-¶24-56 Received 14 September 2003; manuscript accepted 23 January 2004. Request reprints from: Dr. Irina V. Kartavtseva Institute of Biology and Soil Science, Russian Academy of Sciences Prospect Sto let Vladivostoku 159, Vladivostok 690022 (Russia) telephone: +7-4232-318198; fax: +7-4232-310193 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0271$21.00/0

al mosaicism, intrapopulational and interpopulational), as well as variability in size, morphology and differential staining. Geographic variation was found among populations for these cytogenetic characteristics and, in some cases, it coincided with subspecies distribution. Comparative chromosome banding of micro and macro Bs illuminates possible pathways for their origin. Copyright © 2004 S. Karger AG, Basel

al., 2002). A. peninsulae belongs to the genus Apodemus, in which six species have been shown to carry B chromosomes (Kartavtseva, 2002; Wo´jcik et al., 2004). However, the Korean field mouse shows the widest spectrum of B chromosome variability and about 100 % of animals with Bs are found in most populations. Many investigators have analysed B chromosome variation in size, morphology and number in local populations of A. peninsulae but, unfortunately, papers were often published in inaccessible journals or used different sets of information. All of these obstacles are among the causes determining that, in spite of numerous investigations on A. peninsulae B chromosomes, no comprehensive review is still available. In this paper we examine chromosomal data in 1,158 animals belonging to six subspecies of A. peninsulae, collected at 79 local populations from Russia (Siberia, Altai, Buryatia and the Far East), Mongolia, China, Korea and Japan (Hokkaido). Data gathered from our own studies, and from the literature, are considered (Table 1, Fig. 1). Table 1 summarizes the B chromosome data, including their number, morphology, type of differential staining and number of mosaics in each examined locality. We also calculated the frequency of animals with macro and micro B chromosomes for geographical regions using our own information and the literature (Table 2).

Accessible online at: www.karger.com/cgr

Fig. 1. Geographic distribution of A. peninsulae Thomas and collection numbers. Arabic numbers beside points are location numbers shown in Table 1. Solid dots show populations with B chromosomes, and squares show populations lacking Bs.

Table 1. Karyotypic characteristics in the Korean field mouse, Apodemus peninsulae Thomas, from different localities Localitya

No. of animalsb Total

No. of B chromosomesb

Mosaics Total

Macro Micro

Type of differential stainingb

References

Kral, 1971; Volobuev, 1979, 1980a; Bekasova et al., 1980; Timina et al., 1980; Roslik et al., 2003 Kral, 1971; Radjabli and Borisov, 1979; Borisov, 1990a; Karamysheva et al., 2002; Trifonov et al., 2002 Our data; Trifonov et al., 2002 Kral, 1971; Borisov, 1990a; Borbiev, 1991 Borisov, 1990c; Radjabli and Borisov, 1979; Kolomiets et al., 1988 Borisov, 1986, 1990c; Borbiev, 1991 Borisov, 1986, 1990b, 1990c; Borbiev, 1991 Volobuev, 1979, 1980a; Timina et al., 1980 Roslik et al., 2003; our data Roslik et al., 2003; our data

A. p. nigritalus Hollister, 1913 Siberia, Russia: 1. Tomsk and Tomsky Region

2. Novosibirsk

3. Altai, Cherga, Shebalinskiy District 4. Teletskoye Lake 5. Novoangarsk, 6. Kan River and 7. Krasnoyarsk 8. Yenisei River (left shore) 9. Yenisei River (right shore) and 10. Sayanogorsk 11. Maina 12. Kizil, Tyva 13. Valley of Ubsunur Lake, Tuva Spermatocytes** Animals from locality 4 Animals from localities 4 and 7 Animals from localities 1 and 11 Subtotal

Baikal Lake region***: 14. Barda and 15. Kochergat 16. Baikalsk and 17. Babushkin Spermatocytes** Animals from locality 16 Subtotal

272 130

32

10

0–13

0–7

0–6

G, C

9

2

2–12

2–7

0–5

C, FISH

6 51 50

6 12 17

4–11 0–7 2–18

0–6 0–7 1–10

2–8 0 0–14

C, FISH C, NOR C

39 39 9 2 5

13 15 9 2 5

1–8 1–12 13–24 13–18 2–8

0–6 0–5 1–4 0–1 1–5

0–5 0–10 12–20 13–17 0–3

2 11 3 242

– 11 – 91

0–3 1–12 6–20 0–24

0–3 – – 0–10

0 – – 0–20

– Ishak et al., 1991 – Kolomiets et al., 1988; Borbiev et al., 1990 – Popova et al., 1980 C, G, NOR, FISH

56 36

0 22

1–7 5–14

1–3 0–5

0 3–14

–

Borisov, 1990d; Zima and Macholan, 1995 Borisov, 1990d; Borbiev, 1991

2 92

– 22

1–3 1–14

– 0–5

– 0–14

– –

Ishak et al., 1991

Cytogenet Genome Res 106:271–278 (2004)

G, NOR C, G, NOR – C –

Table 1 (continued) Localitya

No. of animalsb Total

Buryatia: 18. Ivolginsk, 19. Gusinoozersk and 20. Ulan-Ude

Chita Region: 21. Novokruchininskiy 22. Sretensk and 23. Boti Subtotal

No. of B chromosomesb

Mosaics Total

Macro Micro

Type of differential stainingb

References

9

4

2–4

0–2

1–4

G, NOR

Borisov, 1990d; Borisov and Malygin, 1991; Borbiev, 1991

3 6 18

1 6 11

1–5 3–9 1–9

1–4 0–3 0–4

0–1 2–9 0–9

– – G, NOR

Roslik et al., 2003 Kartavtseva, 2002; Roslik et al., 2003

12 1 1 4 21 1 39

– 1 1 0 4 0 5

1–7 2–4 1–7 2–7 2–13 1 1–13

– 1 – 1–5 1–3 1 1–5

– 2–3 – 0–2 1–11 0 0–11

– – – – – – –

Zima and Macholan, 1995 Kolomiets et al., 1988 Kolomiets et al., 1988 Borisov and Malygin, 1991 Borisov and Malygin, 1991 Borisov and Malygin, 1991

20

11

0–4

0–4

0

–

29

22

0–7

0–7

0–1

FISH

Kartavtseva et al., 2000; Roslik et al., 2003; our data Rubtsov et al., 2004, this volume; our data

19 68

12 45

0–4 0–7

0–4 0–7

0 0–1

– FISH

Kartavtseva et al., 2000; Roslik et al., 2003

112

43

0–5

0–5

0

C, G

9

9

0–4

0–4

0

–

Bekasova and Vorontsov, 1975; Bekasova et al., 1980; Bekasova, 1984; Borisov, 1990ɚ Kartavtseva et al., 2000

14 45 5 8 103

9 33 5 6 47

0–6 0–5 0–5 0–3 1–5

0–6 0–5 0–5 0–3 0–5

0–3 0 0–1 0 0–3

G C, G – – C, G, FISH

13 14 8 6

10 9 1 4

0–5 1–4 1–4 0–4

0–5 1–4 1–4 0–4

0–2 0 0–2 0

– C, G – –

16 67 9 6 13 16 464

11 48 3 6 11 0 255

0–7 0–5 1–4 0–5 0–5 0 0–7

0–5 0–5 1–4 0–5 0–4 0 0–6

0–3 0–1 0 0–1 0–2 0 0–3

Kartavtseva et al., 2000 Kartavtseva et al., 2000 Kartavtseva et al., 2000 Kartavtseva et al., 2000 Kartavtseva et al., 2000 Roslik et al., 2003

10

9

0–6

0–4

0–4

– C, G, NOR – – – C C, G, NOR, FISH –

21

1

1–6

1–6

0

C, G, Q

Koh, 1986; Abe et al., 1997; Sawaguchi et al., 1998

88

0

0

0

0

C, G, Q

Bekasova, 1984; Zima and Macholan, 1995; Kartavtseva et al., 2000; Roslik et al., 2003

7

–

+

+

+

C, G, Q

Sawaguchi et al., 1998

A. p. major Radde, 1862 non Pallas, 1779 Mongolia: NE Mongolia*** N Mongolia*** Spermatocytes** 24. Hangay, East Hantey 25. Bulgansky Aymak and 26. Monastery Amar-Hiid 27. Foothills Great Hingan Subtotal

A. p. praetor Miller, 1914 Far East, Russia: 28. Magadan, Amursky Region: 29. Belogoriye, Jewish Autonomous Region: 30. Birakan and Khabarovsky Region: 31. Krasnoye

32. Evoron Lake, 33. Komsomolsk-na-Amure and 34. Mariinskoye 35. Malyshevo, 36. Pivan and 37. Sovetskaya Gavan Subtotal Primorsky Region***: 38. Krasny Yar, 39. Melnichnoye and 40. SikhoteAlin Reserve 41. Rudnaya Pristan 42. Dalnegorsk, 43. Khrustalny and 44. Olga 45. Chuguevka and 46. Busseyevka 47. Arsenievka River and Nikolaevka 48.Ussuriysky Reserve 49. Novonezhino (3 sample sites) 50. Novolitovsk* and 51.Avangard 52. Vladivostok 53. Turiy Rog (2 sample sites) and 54. Pogranichny (2 sample sites) 55. Granitnaja River and 56. Nezhino 57. Kedrovaya Pad Reserve 58. Ryazanovka, 59. Kraskino and 60. Khasan 61. Gamov peninsula 62. Russky Island 63. Stenin Island Subtotal Laboratory population (from locality 48)

Kartavtseva et al., 2000 Roslik et al., 2003 Kartavtseva et al., 2000 Kartavtseva et al., 2000; Roslik et al., 2003 Bekasova and Vorontsov, 1975; Kartavtseva et al., 2000; Trifonov et al., 2002 Kartavtseva et al., 2000; Roslik et al., 2003 Kartavtseva et al., 2000 Kartavtseva et al., 2000 Kartavtseva et al., 2000

Boeskorov et al., 1995; Roslik et al., 1998

A. p. peninsulae Thomas, 1906

Far East, Korea: 64. Mungyong, 65. Kwangnyung, Kyunggido and 66. Gyeonggi Do

A. p. giliacus Thomas, 1907 Far East, Russia, Sakhalin Island: 67. Okha, 68. Aleksandrovsk, 69. Tymovsk, 70. Sokol, 71. Tomari and 72. Gornozavodsk Tail fibroblast culture (from locality 67)**

+

Cytogenet Genome Res 106:271–278 (2004)

273 131

Table 1 (continued) Localitya

No. of animalsb Total

Far East, Japan, Hokkaido Island: 73. Naganuma Litters from pregnant wild females 74. Hitujigaoka, Sapporo and 75. Hayakita 76. Tomakomai Subtotal Laboratory population (from location 73) Fibroblast cultures (1 female + fetuses)** Male: Bone marrow** Spermatogonia** Lung (culture)** Heart (culture)** Culture

No. of B chromosomesb

Mosaics Total

Macro Micro

Type of differential stainingb

References

Hayata et al., 1970; Hayata, 1973 Hayata, 1973 Abe et al., 1997 Roslik et al., 2003

27 28 5 7 67 31 7 1 1 1 1 1

– – 0 6 7 – – 1 0 1 1 1

3–13 2–9 2–6 4–10 0–13 0–6 2–10 5–6 6 6 5–6 5–6

1–5 1–5 0–4 0–4 0–5 0–3 – – – – – –

1–9 1–6 2 4–9 0–9 0–6 – – – – – –

Q – C, G, Q C C, G, Q – – – – – – –

5

2

0–3

1–3

0

C, G, NOR Wang et al., 2000

7 5

5 2

5–14 0–1

1 0–1

4–13 0

C, G, NOR Wang et al., 2000 C, G, NOR Wang et al., 2000

1158

455

0–24

0–10

0–20

C, G, NOR, FISH

Hayata, 1973 Hayata, 1973 Hayata, 1973 Hayata, 1973 Hayata, 1973

A. p. praetor Miller, 1914

China: 77. Mt. Changbai, Jilin Prov.

A. p. sowerbyi Jones, 1956

78. Mt. Tai, Shandong Prov. 79. Mt. Qinling, Shaanxi Prov. Total

a *: Macro B chromosome. **: Animals that were not counted in the total sum because they had already been registered in their locality. ***: Without numbers; authors did not provide specific sampling sites. b +: Number of chromosomes is unknown. –: No data.

B chromosome morphology B chromosomes, in addition to the standard diploid set of A. peninsulae, were described in a taxon named “A. giliacus” (Hayata et al., 1970) in the Hokkaido population and in a taxon named “A. speciosus” (Kral, 1971) in the Siberia population. The standard (A) diploid set of A. peninsulae contains 48 acrocentric chromosomes gradually decreasing in size. In addition, up to 24 supernumerary (B) chromosomes may be found in some individuals. In this paper, we divide B chromosomes into two groups according to their size. The first group includes Bs of visible morphology under light microscopy (macro Bs), which are larger or equal in size to the smallest A chromosome (Fig. 2A, C, D). The second group includes only dot-like chromosomes which are much smaller than A chromosomes and without clear morphology (micro Bs) (Fig. 2B). The macro B chromosomes are divided into classification types according to their morphology and relative size in comparison with the A chromosomes. We have previously described three types of macro Bs (Kartavtseva et al., 2000), with abbreviations determined by reference to some other sources (Hayata, 1973; Borisov, 1986; Abe et al., 1997): (1) large metacentrics or submetacentrics (Lm-sm); (2) medium-to-small metacentrics or submetacentrics (Mm-sm); (3) large-to-small acrocentrics or subtelocentrics (A-St). The most frequent macro Bs in A. peninsulae are Mm-sm (Fig. 2A), whereas A-St morphological variants of medium or small size are rare. An extremely large St chromosome, which was significantly larger than the largest A

274 132

Cytogenet Genome Res 106:271–278 (2004)

chromosome, was found in one male from locality no. 50 (Fig. 2D) (Kartavtseva et al., 2000). In some cases we could identify the morphology of micro Bs in good quality metaphase plates, but, in most cases, micro Bs looked like very small structures without clear morphology. B chromosome number The number of B chromosomes in continental populations of A. peninsulae varies from 0 to 24 (Table 1), although this extreme value was registered only once, in a population from Siberia (locality no. 11). The number of macro B chromosomes varies from one to ten in some Siberian localities, and from one to three in some localities from China. Geographical and interpopulational variation in the number and morphology of macro Bs is insignificant (Kartavtseva, 2002). In contrast, a high variation in the number of micro Bs is the rule, with a broad variation at inter- and intrapopulation levels: 0–20 in the southern area of Siberia, 0–11, in Siberia and Mongolia (A. p. nigritalus and A. p. major), 4–13 in China (A. p. sowerbyi), 1–9 in Hokkaido (A. p. giliacus) and 0–3 in the Far East (A. p. praetor) (Table 1). B chromosome frequency The frequency of animals carrying B chromosomes (B-prevalence) varies among localities and regions, although most populations analysed show a high B-prevalence, with most individuals carrying B chromosomes of one type or another (Table 2).

Fig. 2. Metaphase plates of A. peninsulae with different B chromosome morphology and size. (A) Cell showing Mm-sm and micro B chromosomes (locality no. 13); (B) C-banded cell showing micro B chromosomes (locality no. 12); (C) Gbanded cell showing Lm-sm and Mm-sm (locality 48); (D) G-banded cell showing large St and Mmsm B chromosomes (locality no. 50). Arrows indicate B chromosomes. Sex chromosomes are marked with X and Y.

Populations lacking B chromosomes (prevalence = 0) were found in two islands, Sakhalin and Stenin. In Sakhalin, which is a large island, none of the 88 individuals hitherto analysed carried B chromosomes. In Stenin, a very small island, we analysed the karyotypes of mice over a two-year period but did not find any B chromosome in a total sample of 16 individuals (Roslik et al., 2003). At the other extreme, for instance, only two animals lacked B chromosomes in Siberia (A. p. nigritalus) (localities nos. 1 and 4) and B prevalence in this region was about 0.99. In addition, all animals from Korea (A. p. peninsulae) carried B chromosomes (prevalence = 1). In two Chinese populations (A. p. sowerbyi), however, B prevalence was very different (1 and 0.4). Almost all B carrying individuals in this species harbour macro B chromosomes. The frequency of animals carrying macro Bs shows only slight differences among regions or subspecies (Table 2). Micro B prevalence broadly differs among regions and subspecies (Table 2). Four subspecies, A. p. nigritalus from Siberia, Buryatiya and Chita Region, A. p. major from Mongolia, A. p. giliacus from Hokkaido and A. p. sowerbyi from China, show a very high frequency of animals with micro Bs (prevalence from 0.59 to 1). On the contrary, two subspecies from the Far East (A. p. peninsulae and A. p. praetor) and one from the Baikal Lake Region (A. p. nigritalus) showed lower values of micro B

prevalence (0–0.39). In three localities from Siberia, nos. 4, 14 and 15, micro Bs were not found even though they are frequent in other localities in this region (see Table 1). In wild populations from the Far East, micro Bs are scarce or absent (they were found in only 46 out of 532 animals analysed). Micro B chromosomes commonly occurred together with bi-armed B chromosomes. However, some animals from Siberia (locality nos. 8 and 13), Chita Region (localities nos. 22 and 23), Buryatia (locality no 19), Mongolia (locality no. 25), Hokkaido (locality no. 73) and the Russian Far East (laboratory population from locality no. 48) carried only micro B chromosomes. Mosaicism for B chromosomes Intraindividual variation for B number in somatic tissues has been reported in the Korean field mouse (Bekasova and Vorontsov, 1975; Radjabli and Borisov, 1979; Volobuev, 1980a). In addition, mosaicism for B morphology in animals with a stable number of B chromosomes has also been reported (Bekasova et al., 1980; Borisov, 1980, 1990c). Mosaicism of one kind or another is a frequent characteristic of B chromosomes in this species (see Table 2). In a previous study, mosaicism was estimated from the presence of two or more cellular clones within a same individual (Belyaev et al., 1974). A cellular clone is a group of cells with a definite diploid number. In cases where the proportion of hypo-

Cytogenet Genome Res 106:271–278 (2004)

275 133

Table 2. B chromosome characteristics in the Korean field mouse, Apodemus peninsulae Thomas from different regions Number of animals

Frequencya of animals with Bs

macro Bs

micro Bs

mosaicism

G-banding

C-banding

242

0.99

0.96

0.59

0.37

G-bands

92 9 9

1.0 1.0 1.0

0.98 0.89 1.0

0.39 1.0 1.0

0.24 0.44 0.78

– G-bands –

C-bands, some negative (like Y chromosome) – – –

39

1.0

0.97

0.85

0.13

–

–

8

1.0

1.0

0

0.63

–

–

60 445 5 13 16

0.78 0.9 1.0 1.0 0

0.78 0.89 1.0 1.0 0

0.07 0.11 0 0.23 0

0.67 0.57 0.4 0.85 0

– Negative Negative – –

– Negative Negative – –

A. p. giliacus Sakhalin Japan: Hokkaido

88 98

0* 1.0

0 0.91

0 0.97

0 0.85**

– Dark or partially banded

– Negative but centromeric C-bands

A. p. peninsulae Korea

21

1.0

1.0

0

0.05

Negative

Negative

7 5

1.0 0.4

1.0 0.4

1.0 0

0.71 0.4

Negative Negative

Negative Negative

Region

A. p. nigritalus Russia: Siberia

Baikal Lake Region Buryatia Chita Region A. p. major Mongolia A. p. praetor Russian Far East:Magadan, Amursky Region Khabarovsky Region Primorsky Region China (locality no. 77) Islands: Russia: Russky Stenin

A. p. sowerbyi China (locality no. 78) (locality no. 79) a b

*: The B chromosomes (macro and micro) arose de novo after polyploidization in the tail culture system. ** Only valid for locality 76. –: Not done.

ploid cells is higher than 10 %, and that of hyperploid cells is 5% or more, as deduced from the modal number of chromosomes, we considered these cells as cellular clones (Belyaev et al., 1974). The main types of B chromosomes in this species are biarmed and thus they are easily distinguishable from acrocentric A chromosomes. To calculate the 2n number, we separately counted A and B chromosomes and did not find any mosaicism affecting A chromosomes. The frequency of animals with mosaicism varied among subspecies. The highest proportion of mosaic individuals was found in A. p. praetor and A. p. giliacus (0.85), A. p. sowerbyi (0.71), A. p. nigritalus (0.78). The lowest values were found in A. p. major (0.13), and A. p. peninsulae (0.05) (Table 2). For the two Primorsky populations (localities nos. 48 and 57), seasonal variation in the frequency of mosaics was observed in association with population size (Kartavtseva, 1999). Data derived from the literature on chromosome numbers in A. peninsulae allow the assumption that there will be a similar correlation in the populations of Siberia (Kartavtseva, 2002). Banding of B chromosomes The G-banding patterns of all macro B chromosomes in mice from Siberia (A. p. nigritalus) and some of the macro Bs found in mice from Hokkaido (A. p. giliacus) are similar to those of some A chromosomes. On the other hand, macro Bs in mice from the Far East (A. p. praetor, A. p. giliacus, A. p. penin-

276 134

Response of macro B chromosomesb to

Cytogenet Genome Res 106:271–278 (2004)

sulae) and China (A. p. sowerbyi) show no G-bands (Tables 1 and 2, Fig. 2 C and D). C-banding response of macro B chromosomes revealed three different patterns: (1) centromeric and interstitial darkly stained bands, found in A. p. nigritalus populations from West Siberia (Radjabli and Borisov, 1979; Borisov, 1990a; Trifonov et al., 2002); (2) only centromeric darkly stained bands, found in A. p. giliacus from Hokkaido (Abe et al., 1997) and Sakhalin (tissues cultures, Sawaguchi et al., 1998); and (3) C-negative or gray stained bands, or poorly stained heterochromatin, found in A. p. praetor Bs from the Russian Far East (Bekasova et al., 1980; Kartavtseva et al., 2000; Kartavtseva, 2002), in A. p. peninsulae Bs from Korea (Abe et al., 1997), China (Wang et al., 2000) and in A. p. sowerbyi Bs from China (Wang et al., 2000) (Table 2). This variation in C-banding response suggests that macro Bs from different subspecies or regions contain a heterogeneous collection of heterochromatic genetic material (Kartavtseva, 2002). Micro B chromosomes in mice from all investigated localities usually show G-negative but C-positive staining (Fig. 2B). The micro Bs from the Hokkaido population were reported to be completely negative for QM staining but fluoresced brightly after CMA3 staining (Sawaguchi et al., 1998), suggesting that they contain GC-rich C-heterochromatin, at least in this population. In one A. p. praetor specimen from the Primorsky Region, nucleolus organizer regions (NORs) were observed on its two

macro B chromosomes (Mm-sm) (Boeskorov et al., 1995), suggesting that Bs might carry rRNA genes. However, in many other animals investigated from this and other populations, NORbanding on both macro and micro Bs was not found (Borbiev, 1991; Wang et al., 2000; Kartavtseva, 2002). It seems that the presence of rRNA genes is also heterogeneous among Bs. Based on B chromosome morphology and G-banding, it was suggested that many B chromosomes in A. p. nigritalus are isochromosomes (Kolomiets et al., 1988; Borbiev, 1991), which was later confirmed by FISH (Karamysheva et al., 2002). This technique has also show that macro and micro Bs contain two types of B-specific heterochromatin (Trifonov et al., 2002) and large amounts of repeated DNA sequences. DNA repeats, obtained from B chromosomes by microdissection, located on pericentromeric regions of B chromosomes, were also present in the pericentromeric C-blocks of all autosomes and in non-centromeric C-blocks of sex chromosomes (Karamysheva et al., 2002). Interesting results were obtained in tissue cultures (Sawaguchi et al., 1998). The modal number of chromosomes in cultured cells from heart, lung and skin tissues was, as a rule, constant, but three out of seven specimens from the Sakhalin Island (locality no. 67, where Bs were never found) showed growing fibroblasts with polyploid cells and with Bs even in the primary cultures. The observed Mm-sm and micro B chromosomes presumably appeared de novo and became visible after polyploidization in the tail culture. Bi-armed Bs contained GCrich heterochromatin in the centromere regions and AT-rich heterochromatin in the arm regions, but micro Bs were completely GC-rich (Sawaguchi et al., 1998). B chromosomes at meiosis Meiosis behavior of B chromosomes is, as a rule, irregular. The micro B chromosomes do not show pairing at metaphase I, remaining as univalent, whereas other B chromosome types show univalents and, rarely, bivalents (Wang et al., 2000) and multivalents (Hayata, 1973; Popova et al., 1980; Kolomiets et al., 1988; Ishak et al., 1991; Borbiev et al., 1990). An increase in the number of B chromosomes was found in zygotene-pachytene spermatocytes relative to that found in bone marrow cells, which may be evidence of B chromosome accumulation in the germ cell line of mice from Siberia (locality no. 7) and North Mongolia (Kolomiets et al., 1988). B chromosomes from Siberian mice showed associations with the X and Y chromosomes at pachytene (Borbiev et al., 1990). Laboratory populations Laboratory populations of Korean field mice from two local populations have been studied (Table 1). The results of breeding experiments and karyotype analysis with four parental pairs of A. peninsulae from Hokkaido (locality no. 73) and their twenty-six offspring showed the occurrence of B variants in the offspring which were not present in the mother (Hayata, 1973). In the continental population no. 48, the experimental tickborn encephalitis (TBE) virus was reproduced in a pregnant female by inoculation with an excessive amount of TBE virus. Ten offspring were obtained from this infected female and her progeny following an inbreeding program (up to F6). Karyo-

types of the mice yielded by this female were analyzed, but the karyotype of the infected female was unknown. In addition to the 48 A chromosomes, 1 to 6 Bs were found, including 0–4 Mm-sm and 0–4 micro Bs. Four of the ten mice only carried micro Bs. The micro Bs are usually rare in mice from this locality and their number did not exceed 3 in the natural population. While B prevalence was only 0.11 in specimens from the Ussuriysky Reserve wild population, it was 1 in laboratory populations (our data). A hypothesis has been suggested that inoculation of artificial TBE may cause some chromosomal alterations which thus increase the frequency of micro Bs in A. peninsulae (Roslik et al., 1998; Kartavtseva, 1999). The absence of Bs in chromosomal sets of A. peninsulae from Sakhalin had been formerly anticipated to be due to TBE absence in mice populations from this island (Bekasova and Vorontsov, 1975; Bekasova, 1984).

The origin of B chromosomes There are several points of view about the origin of B chromosomes in mammals (Volobuev, 1978, 1980b, 1981). In A. peninsulae it is possible to consider several ways of B chromosome origin, perhaps taking place simultaneously. The similarity of G- and C-banding among the A and B chromosomes in this species from the Siberian population support the origin of Bs from the A chromosomes, which is also indicated by the association of Bs with sex chromosomes at pachytene (Kartavtseva, 2002). We found high numbers of micro Bs in a population near a lead factory (locality no. 41), which suggested that lead pollution might favour a B frequency increase in this population, but we did not find micro Bs in a population near a polymetal factory (locality no. 42) (Yakimenko et al., 1994). Therefore, the relationship between B frequency and environmental pollution by heavy metals is not substantiated properly. B frequency is distinctively high in many Siberian populations situated in areas that are apparently not affected by this kind of pollution. Furthermore, there are studies in another Apodemus species (e.g. A. flavicollis) which did not support such correlation (Zima et al., 1999). The geographical heterogeneity of B chromosomes in A. peninsulae is consistent with spatial and temporal patterns of B chromosome variation observed in other B chromosome systems (Camacho et al., 2000). However, many important questions on B structure, molecular composition, effects and inheritance, remain to be answered to understand the reasons for B chromosome occurrence in A. peninsulae. The B chromosome system in this species is thus a good model for analysing the evolution of these enigmatic components of many eukaryote genetic systems.

Acknowledgements We thank Prof. Y. Obara, Hirosaki Univ. Japan for helpful discussion. Our thanks to Profs. at Korea Maritime Univ. Yu. Ph. Kartavtsev and Mr. R. Gaede for editing of the manuscript, and our collaborators, especially Dr. M.V. Pavlenko, for help in the trapping of mice.

Cytogenet Genome Res 106:271–278 (2004)

277 135

References Abe S, Han SH, Kojima H, Ishibashi Y, Yoshida MC: Differential staining profiles of B-chromosomes in the East-Asiatic wood mouse Apodemus peninsulae. Chromosome Sci l:7–12 (1997). Bekasova TS: B-chromosomes of Asiatic wood mice Apodemus peninsulae (Rodentia, Muridae). Voprosy izmenchivosti i zoogeographii mlekopitaushih: 14–29 (Vladivostok 1984). Bekasova TS, Vorontsov NN: Populational chromosome polymorphism in Asiatic Forest mice Apodemus peninsulae. Russ J Genetics 11:89–94 (1975). Bekasova TS, Vorontsov NN, Korobitsyna KV, Korablev VP: B-chromosomes and comparative karyology of the mice of the genus Apodemus. Genetica 52–53:33–43 (1980). Belyaev DK, Volobuev VT, Radjabli SI, Trut LN: Polymorphism and mosaicism for additional chromosomes in silver foxes. Russ J Genetics 10:58–67 (1974). Boeskorov GG, Kartavtseva IV, Zagorodnyuk IV, Belyanin AN, Lyapunova EA: Nucleolus organizer regions and B-chromosomes of wood mice (Mammalia, Rodentia, Apodemus). Russ J Genetics 31:185–192 (1995). Borbiev TE: B-chromosomes of East-Asiatic Mouse (Apodemus peninsulae): Variability and Meiotic Behavior. Ph.D. Thesis (Moscow 1991). Borbiev TE, Kolomiets OL, Borisov YM, Safronova LD, Bogdanov YF: Synaptonemal complexes of Aand B-chromosomes in spermatocytes of the EastAsiatic mouse Apodemus peninsulae. Tsitologiya 32:193–196 (1990). Borisov YuM: Geographical changes of the variants of supernumerary chromosomes system in continental form of Apodemus peninsulae (Rodentia, Muridae). Izvestiya Sib Otd Akad Nauk SSSR Ser Biol Nauki 15:61–69 (1980). Borisov YuM: System of B chromosomes in wood mouse as an integrating and differentiating characteristic of populations. Dokl Akad Nauk SSSR 288: 720–724 (1986). Borisov YuM: Cytogenetic structure of Apodemus peninsulae (Rodentia, Muridae) population on the coast of Teletskoye Lake (Altai). Russ J Genetics 26:1212–1220 (1990a). Borisov YuM: Variability cytogenetic structure of Apodemus peninsulae (Rodentia, Muridae) populations in West Sayans. Russ J Genetics 26:1484– 1491 (1990b). Borisov YuM: Cytogenetic differentiation of Apodemus peninsulae (Rodentia, Muridae) population in East Siberia. Russ J Genetics 26:1828–1839 (1990c). Borisov YuM: The system of B-chromosomes is a marker of Apodemus peninsulae (Rodentia, Muridae) populations in the Pribaikal Region. Russ J Genetics 26:2215–2225 (1990d). Borisov YuM, Malygin VM: Cline variability of the Bchromosome system in Apodemus peninsulae (Rodentia, Muridae) from the Buryatia and Mongolia. Tsitologiya 33:106–111 (1991). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Corbet GB: The Mammals of the Palearctic Regions: A Taxonomic Review (Cornell University Press, London 1978). Hayata I: Chromosomal polymorphism caused by supernumerary chromosomes in the field mouse, Apodemus giliacus. Chromosoma 42:403–414 (1973). Hayata I, Shimba H, Kobayashi T, Makino S: Preliminary accounts on the chromosomal polymorphism in the field mouse, Apodemus giliacus, a new form from Hokkaido. Proc Jpn Acad 46:567–571 (1970).

278 136

Ishak B, Jaafar H, Maetz JL, Rumpler Y: Absence of transcriptional activity of the B-chromosomes of Apodemus peninsulae during pachytene. Chromosoma 100:278–281 (1991). Karamysheva TV, Andreenkova OV, Bochkaerev MN, Borissov YM, Bogdanchikova N, Borodin PM, Rubtsov NB: B chromosomes of Korean field mouse Apodemus peninsulae (Rodentia, Murinae) analysed by microdissection and FISH. Cytogenet Genome Res 96:154–160 (2002). Kartavtseva IV: Seasonal observations on supernumerary chromosomes, mosaicism, and dynamics in two populations of the Eastern-Asian wood mouse Apodemus peninsulae (Rodentia) from Primorskii Krai. Russ J Genetics 8:811–817 (1999). Kartavtseva IV: Karyosystematics of wood and field mice (Rodentia, Muridae). (Dalnauka, Vladivostok 2002). Kartavtseva IV, Roslik GV, Pavlenko MV, Amachaeva EYu, Sawaguchi S, Obara Y: The B-chromosome system of the Korean field mouse Apodemus peninsulae in the Russian Far East. Chromosome Sci 4:21–29 (2000). Koh HS: Systematic studies of Korean rodents: II. A chromosome analysis in Korean field mice, Apodemus peninsulae peninsulae Thomas (Muridae, Rodentia), from Mungyong, with the comparison of morphometric characters of these Korean field mice to sympatric striped field mice, A. agrarius corea Thomas. Korean J Syst Zool 2:1–10 (1986). Koh HS, Lee WJ: Geographic variation of morphometric characters in five subspecies of Korean field mice, Apodemus peninsulae Thomas (Rodentia, Mammalia) in Eastern Asia. Korean J Zool 37:33– 39 (1994). Kolomiets OL, Borbiev TE, Safronova LD, Borisov YM, Bogdanov YF: Synaptonemal complex analysis of B-chromosome behavior in meiotic prophase I in the East-Asiatic mouse Apodemus peninsulae (Muridae, Rodentia). Cytogenet Cell Genet 48: 183–187 (1988). Kral B: Chromosome characteristics of certain murine rodents (Muridae) of the Asiatic part of the USSR. Zool Listy 20:331–347 (1971). Musser GG, Carleton MD: Family Muridae, in Wilson DE, Reeder DM (eds): Mammal Species of the World: A Taxonomic and Geographic Reference, Second edition, pp 501–755 (Smithsonian Institute Press, Washington 1993). Pavlenko MV: The intraspecific differentiation and genogeography of transferrins in the East-Asian mouse Apodemus peninsula, in: The Present-Day Approaches to Studies of Variability, pp 61–63 (Far Eastern Science Center Academy Science of USSR, Vladivistok 1989). Popova NA, Timina NY, Frumkis AE: Behaviour of Bchromosomes of Asiatic forest mouse on the diakinesis – metaphase I stage. Probl Popul Evol Cytogenet Plants Animals 61:124–127 (Tomsk University, Tomsk 1980). Radjabli CI, Borisov YM: Variants of the system of supernumerary chromosomes in continental forms of Apodemus peninsulae (Rodentia, Muridae). Dokl Acad Nauk SSSR 248:979–981 (1979). Roslik GV, Kartavtseva IV, Kosoy M: Dot-like B-chromosomes in Korean field mouse (Apodemus peninsulae, Rodentia) originated from a female artificially infected with tick-borne encephalitis virus. Abstr Intern Symp Modern Achiv in Pop Evol and Ecol Genet: 15 (Vladivostok 1998). Roslik GV, Kartavtseva IV, Iwasa M: Variability and stability of B chromosome number in the Korean field mouse, Apodemus peninsulae (Rodentia, Muridae) from continental and insular populations. Problems Evol 5:136–149 (Dalnauka, Vladivostok 2003).

Cytogenet Genome Res 106:271–278 (2004)

Rubtsov NB, Karamysheva TV, Andreenkova OV, Bochkaerev MN, Kartavtseva IV, Roslik GV, Borissov YM: Comparative analysis of micro and macro B chromosomes in the Korean field mouse Apodemus peninsulae (Rodentia, Murinae) performed by chromosome microdissection and FISH. Cytogenet Genome Res 106:289–294 (2004). Sawaguchi S, Obara Y, Kartavtseva IV, Roslik GV, Shin HE, Han SH: Novel maintenance mode of the B chromosomes in Apodemus peninsulae from 4 areas bordering on the Sea of Japan. Abstr Intern Symp Modern Achiev in Pop Evol and Ecol Genet: 16–17 (Vladivostok 1998). Serisawa K, Suzuki H, Iwasa MA, Tsuchiya K, Pavlenko MV, Kartavtseva IV, Chelomina GN, Dokuchaev NE, Han SH: A spatial aspect on mitochondrial DNA genealogy in Apodemus peninsulae from East Asia. Biochem Genet 40:149–161 (2002). Timina NY, Popova NA, Nagrebetskaya MI, Mikhaylova EA: Polymorphism and mosaicism for B-chromosomes in Asiatic forest mouse Apodemus peninsulae (Rodentia, Muridae). Problems of populational and evolutional cytogenetics of plants and animals:128–138 (Tomsk Univ., Tomsk 1980) Trifonov VA, Perelman PL, Kawada S-I, Iwasa MA, Oda S-I, Graphodatsky AS: Complex structure Bchromosomes in two mammalian species: Apodemus peninsulae (Rodentia) and Nyctereutes procyonides (Carnivora). Chromosome Res 10:109– 116 (2002). Volobuev VT: B-chromosome of the mammals. Usp Sovr Biol 86:387–398 (1978). Volobuev VT: Karyological analysis of three Siberian populations of Asiatic wood mouse, Apodemus peninsulae (Rodentia, Muridae). Doklady AN SSSR 248:1452–1454 (1979). Volobuev VT: B-chromosome system of the Asiatic wood mice Apodemus peninsulae (Rodentia, Muridae). I. Structure of karyotype, G- and C-bands, and the character of variation of B-chromosomes. Russ J Genet 16:1277–1284 (1980a). Volobuev VT: The B-chromosome system of mammals. Genetica 52–53:333–337 (1980b). Volobuev VT: B-chromosome system of the mammals. Caryologia 34:1–23 (1981). Vorontsov NN, Bekasova TS, Kral B, Korobitsyna KV, Ivanitskaya EYu: On specific status of Asian wood mice of genus Apodemus (Rodentia, Muridae) from Siberia and Far East. Zool Zh 56: 437–450 (1977). Wang J, Zhao X, Qi H, Koh HS, Zhang L, Guan Z, Wang CH: Karyotypes and B chromosomes of Apodemus peninsulae (Rodentia, Mammalia). Acta Theriol Sinica 20:289–296 (2000). Wo´jcik JM, Wo´jcik AM, Macholan M, Pia´lek J, Zima J: The mammalian model for population studies of B chromosomes: the wood mice (Apodemus). Cytogenet Genome Res 106:264–270 (2004). Yakimenko LV, Kartavtseva IV, Korobitsyna KV: Cytogenetic abnormalities in house, wood and striped mice in vicinities of chemical and leadplants. Abstr The 2 Symp Ecol Genet in Mamm: 25–26 (Lodz, Poland, 1994). Zima J, Ieradi LA, Allegra F, Sartoretti A, Wlosokova´ E, Cristaldi M: Frequencies of B chromosomes in Apodemus flavicollis are not directly related to mutagenetic environmental effects. Folia Zool 48: 115–119 (1999). Zima J, Macholan M: B-chromosomes in the wood mice (genus Apodemus). Acta Theriol 40:75–86 (1995).

Structure and Origin of B Chromosomes Cytogenet Genome Res 106:279–283 (2004) DOI: 10.1159/000079299

A RAPD marker associated with B chromosomes in Partamona helleri (Hymenoptera, Apidae) V.C. Tosta,a T.M. Fernandes-Saloma˜o,a M.G. Tavares,a S.G. Pompolo,a E.G. Barros,a,b and L.A.O. Camposa a Departamento

de Biologia Geral, and b Instituto de Biotecnologia Aplicada a Agropecua´ria (BIOAGRO), Universidade Federal de Viçosa, Viçosa-MG (Brazil)

Abstract. The hymenopteran Partamona helleri is found in southwestern Brazil in the Mata Atlântica from the north of the state of Santa Catarina until the south of Bahia. This work shows that P. helleri can carry up to four B chromosomes per individual. In order to obtain more information about P. helleri B chromosomes, the RAPD technique was used to detect DNA fragments associated with these chromosomes. The results

showed that the RAPD technique is useful to detect specific sequences associated with B chromosomes. One RAPD marker was identified, cloned and used as probe in a DNA blot analysis. This RAPD marker hybridized with sequences present only in individuals containing B chromosomes.

B chromosomes are found in many species of animals, plants and fungi. These chromosomes are additional dispensable chromosomes which probably arose from the A chromosomes but with a distinct evolutionary pathway and a non-mendelian heredity inheritance (Camacho et al., 2000). They can arise intraspecifically as fragments of normal chromosomes, or interspecifically through hybridization. As a result of their molecular evolution these chromosomes are usually heterochromatic, with large amounts of repetitive DNA sequences and transposable elements, and sometimes express genes affecting directly or indirectly the fitness of the individuals carrying them (Beukeboom, 1994; Camacho et al., 2000).

The hymenopteran species Partamona helleri is found in southwestern Brazil in the Mata Atlântica from the north of the state of Santa Catarina to the south of Bahia (Pedro, 1998). In this species, individuals with 1, 2 and 3 B chromosomes have been found (Costa et al., 1992; Brito et al., 1997). Cytogenetic analysis of another six species of the same genus did not show the presence of B chromosomes (Brito-Ribbon et al., 1999). Brito (1998) characterized P. helleri cytogenetically showing that their B chromosomes are heterochromatic and rich in AT regions. In addition, these B chromosomes had specific restriction sites for endonucleases. Molecular markers have been used successfully for detection of B chromosomes in several organisms such as Nasonia vitripennis (Nur et al., 1988). PCR based markers are principally used to detect B chromosomes in maize (Gourmet and Rayburn, 1996) and mouse (Tanic et al., 2000). In this work, we used the Random Amplified Polymorphism DNA (RAPD) technique to identify markers associated with B chromosomes in P. helleri.

This research was supported by Coordenaça˜o de Aperfeiçoamento de Pessoal de Nı´vel Superior (CAPES), Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq) and Fundaça˜o de Amparo à Pesquisa do Estado de Minas Gerais (FAPEMIG).

Copyright © 2004 S. Karger AG, Basel

Materials and methods

Received 10 September 2003; manuscript accepted 2 February 2004. Request reprints from: Dr. Vander Calmon Tosta Departamento de Biologia Geral, Universidade Federal de Viçosa 36570-000, Viçosa-MG (Brazil); telephone: +55 31 38992510 fax: +55 31 38992549; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0279$21.00/0

Materials Workers larvae of seven colonies of P. helleri kept in the apiary of the Universidade Federal de Viçosa were used. Three colonies (identified by numbers 590, 591, 592) had been collected in Porto Firme (Minas Gerais,

Accessible online at: www.karger.com/cgr

Fig. 1. Metaphase obtained from cerebral ganglion of post-defecant larvae from P. helleri (colony 590) with 2n = 38, showing the presence of four B chromosomes (arrows). Bar = 2.5 Ìm.

Brazil) (20°40)LS, 43°05)LW), and four colonies (588, 603, PK and XAXIM) were from Viçosa (Minas Gerais, Brazil) (20°45)LS, 42°52)LW). Cytogenetic analysis Slides with metaphase chromosomes were prepared from the cerebral ganglion of ten post-defecating larvae from each colony, according to the technique proposed by Imai et al. (1988). Immediately after removal of the ganglion, the remaining larva was frozen (–80 ° C) for DNA extraction. In order to characterize the larvae for the presence/absence of B chromosomes and to determine the number of these chromosomes, ten metaphases were analyzed in each slide with the aid of an Olympus light microscope and photographed. RAPD analysis Genomic DNA extraction was done according to Waldschmidt et al. (1997) and amplified by the polymerase chain reaction (PCR) according to Williams et al. (1990) with some modifications. Each reaction (25 Ìl) contained 2 mM MgCl2, 10 mM Tris-KCl, 4 mM of one primer (Operon Technologies, Alameda, CA), 2 mM dNTPs, and 1U of Taq DNA polymerase. The PCR amplifications consisted of 40 cycles of 94 ° C/15 s to denature the DNA, 35 ° C/30 s to anneal the primers and 72 ° C/60 s for elongation. A final extension step of 72 ° C for 7 min was performed after the 40th cycle. Two hundred and twenty RAPD primers were tested (OPERON series B, C, D, E, F, G, H, L, K, S, U). The RAPD products were separated by electrophoresis in 1.2 % agarose gels, stained with ethidium bromide and visualized and photographed under ultraviolet light. Isolation and cloning The candidate RAPD marker for the B chromosomes was cut and purified directly from the agarose gel using the a Qiagen kit (Qiagen) according to manufacturer’s instructions. The purified DNA was cloned into the plasmid vector pGEM®-T Easy (Promega). This vector was used to transform E. coli DH5· cells. Plasmid DNA from positive colonies was extracted with the aid of the QIA prep SPIN Miniprep (Qiagen). The inserts were released from the plasmid by restriction with EcoRI.

280 138

Cytogenet Genome Res 106:279–283 (2004)

DNA blot analysis For DNA blot analysis, the RAPD products separated by electrophoresis in an agarose gel were transferred to a nylon membrane (Stratagene) according to Southern (1975). Prehybridization and hybridization reactions were performed at 60 ° C in 5× SSC (0.06 M sodium citrate, 0.6 M NaCl), 0.1 % SDS, 5 % dextran sulfate and blocking agent (Amersham Biosciences). For hybridization analysis, clone P1 was labeled with fluor-12-dUTP (Amersham Biosciences) according the manufacturer’s instructions. After hybridization, the membranes were washed with 1× SSC, 0.1 % SDS for 15 min at 60 ° C and in 0.5× SSC, 0.1 % SDS for 15 min at 65 ° C. Bands on the membrane were detected using “CPD-StarTM detection system” (Amersham Biosciences). Membranes were exposed to X-ray film at room temperature for 20 min.

Results and discussion The cytogenetic analyses revealed the presence of B chromosomes in four of the colonies analyzed (588, 590, 591 and 592). The colonies 590 and 591 showed individuals with four B chromosomes (Fig. 1). Costa et al. (1992) and Brito et al. (1997) had found individuals with up to three B chromosomes in P. helleri although these authors collected samples in the same microregion where our samples came from. Colony 588 showed 0B and 1B individuals, which was the reason it was chosen for the initial RAPD analysis. The differences among the individuals in this colony would be mainly due to the presence or absence of B chromosomes, avoiding other genetic differences. The polymorphic primer obtained from testing individuals from colony 588 was also tested in colonies 590 and 591. In these two cases all individuals analyzed

Fig. 2. Electrophoresis of amplified larvae genomic DNA with RAPD primer OPK-14. Samples 1, 3, 5, 7, 9 from larvae with B chromosomes show one RAPD product (arrow) that is not present in samples 2, 4, 6, 8, 10 from larvae without B chromosomes. M corresponds to Ï DNA digested with EcoRI and HindIII.

Fig. 3. Electrophoresis of amplified larvae genomic DNA with RAPD primer OPK-14. Samples 1, 2, 3, 4 from colony 590 (larvae with 1B, 2B, 3B or 4B chromosomes) and samples 5, 6, 7 from colony 591 (larvae with 2B, 3B or 4B chromosomes) show one RAPD product (arrow) that is not present (0) in samples 8–14 from colony 603 (larvae with no B chromosomes).

Cytogenet Genome Res 106:279–283 (2004)

281 139

Fig. 4. Autoradiograph of a nylon membrane showing a hybridization using the clone P1 as probe. The gel depicted in Fig. 2 was transferred to a nylon membrane and used for hybridization. The probe hybridized with DNA from individuals with B chromosomes (1, 3, 5, 7, and 9) but not with DNA from individuals with no B chromosomes (2, 4, 6, 8 and 10). The arrow indicates the band corresponding to the RAPD marker shown in Fig. 2 associated with B chromosomes.

had at least one B chromosome. Colony 603 was used as control in the RAPD analysis as the individuals in this colony presented no B chromosomes. Among the 220 RAPD primers tested, only one (OPK-14) amplified a DNA band, which was exclusive of individuals with B chromosomes (Fig. 2). Amplified DNA samples of individuals with one, two, three or four B chromosomes in colonies 590 and 591, with primer OPK-14 showed the same RAPD product independently of the number of B chromosomes. On the other hand, samples from colony 603 did not show the RAPD product (Fig. 3). The presence of this RAPD product only in DNA samples extracted from larvae with B chromosomes provides clear evidence that it is a RAPD marker associated with the presence of B chromosomes in P. helleri. Two considerations about these findings are important: (1) the RAPD technique is useful to study B chromosomes as shown by Gourmet and Rayburn (1996). These authors identified RAPD markers associated with these chromosomes in maize; (2) it is difficult to find a specific molecular marker for each type of B chromosome. Tanic et al. (2000) using AP-PCR in yellow-necked mouse (Apodemus flavicollis) tried unsuccessfully to associate differences in DNA band intensity with distinct types and numbers of B chromosomes.

282 140

Cytogenet Genome Res 106:279–283 (2004)

The RAPD product we detected was purified, cloned into a plasmid, and transformed into E. coli. Two clones, named P1 and P2, were obtained. To confirm that the clones indeed corresponded to the RAPD marker, clone P1 was labeled and used as probe in a hybridization reaction with the RAPD products obtained by amplification of DNA from individuals with and without B chromosomes with primer OPK14. Fig. 4 shows that the P1 clone corresponds to the RAPD marker. Interestingly, the DNA blot analysis showed that the probe hybridized with the original band detected by the RAPD marker and to additional bands present in larvae with B chromosomes even under stringent conditions (65 ° C). These additional bands were not detected in the original RAPD amplification probably due to the lower sensitivity of ethidium bromide in relation to the autoradiography. This hybridization pattern indicates that the sequence we cloned can be repetitive. Specific B chromosome repetitive sequences not found on A chromosomes have already been found in the wasp Nasonia vitripennis (Eickbush et al., 1992; McAllister and Werren, 1997). As we demonstrate that P1 is indeed located in B chromosomes, the results we obtained open up at least two new perspectives. First, the clones isolated can be used to investigate the origin and evolution of P. helleri B chromosomes. They can be used as probes for in situ hybridization analysis or alterna-

tively they can be sequenced to allow comparisons with other specific B chromosome sequences in GenBank. Second, the RAPD primer obtained can be transformed into a SCAR (sequence characterized amplified regions) marker, a more stable type of marker, and can be used to determine the presence/ absence of B chromosomes in P. helleri natural populations using adult individuals.

Acknowledgments We are grateful to Dr. Elza Fernandes de Arau´jo for allowing the DNA blot analysis in her laboratory, to Dr. Ana Maria Waldschmidt for helping with in RAPD analysis, to Rute Magalha˜es Brito for encouragement and to Dr. Juan Pedro M. Camacho for additional reviews.

References Beukeboom LW: Bewildering Bs: an impression of the first B-chromosome conference. Heredity 73:328– 336 (1994). Brito RM: Caracterizaça˜o citogenética de duas espécies do gênero Partamona Schwarz, 1939 (Hymenoptera, Apidae, Meliponinae). Viçosa: UFV. Dissertaça˜o, Mestrado em Genética e Melhoramento (Universidade Federal de Viçosa 1998). Brito RM, Costa MA, Pompolo SG: Characterization and distribution of supernumerary chromosomes in 23 colonies of Partamona helleri (Hymenoptera, Apidae, Meliponinae). Brazilian J Genet 20:185– 188 (1997). Brito-Ribon RM, Miyazawa CS, Pompolo SG: First karyotype characterization of four species of Partamona (Friese, 1980) (Hymenoptera, Apidae, Meliponinae) in Mato Grosso State, Brazil. Cytobios 100:19–26 (1999).

Costa MA, Pompolo SG, Campos LAO: Supernumerary chromosomes in Partamona cupira (Hymenoptera, Apidae, Meliponinae). Revista Brasileira de Genética 15:801–806 (1992). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Philos Trans R Soc Lond B 355:163–178 (2000). Eickbush DG, Eickbush TH, Werren JH: Molecular characterization of repetitive DNA sequences from a B chromosome. Chromosoma 101:575–590 (1992). Gourmet C, Rayburn L: Identification of RAPD markers associated with the presence of B chromosomes in maize. Heredity 77:240–244 (1996). Imai HT, Taylor RW, Cozier RH: Modes of spontaneous chromosomal mutation and karyotype evolution in ants with reference to Minimum Interaction Hypothesis. Jpn J Genet 63:159–185 (1988). McAllister BF, Werren JH: Hybrid origin of a B chromosome (PSR) in the parasitic wasp Nasonia vitripennis. Chromosoma 106:243–253 (1997). Nur U, Werren JH, Eickbush DG, Burke WD, Eickbush TH: A “selfish” B chromosome that enhances its transmission by eliminating the paternal genome. Science 24:512–514 (1988).

Pedro SRM: Meliponini neotropicais: o gênero Partamona Schwarz, 1939 (Hymenoptera, Apidae) taxonomia e biogeografia. Ribeira˜o Preto Tese. Doutoramento em Ciências, a´rea: Entomologia (Universidade de Sa˜o Paulo, USP 1998). Southern EM: Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 98:503–517 (1975). Tanic N, Dedovic N, Vujosevic M, Dimitrijevic B: DNA profiling of B chromosomes from the yellownecked mouse Apodemus flavicollis (Rodentia, Mammalia). Genome Res 10:55–61 (2000). Waldschmidt AM, Saloma˜o TMF, Barros EG, Campos LAO: Extraction of genomic DNA from Melipona quadrifasciata (Hymenoptera: Apidae, Meliponinae). Brazilian J Genet 20:421–423 (1997). Williams JGK, Hanafey MK, Rafalski JA, Tingey SV: Genetic analysis using random amplified polymorphic DNA markers. Methods Enzymol 218:704– 740 (1990).

Cytogenet Genome Res 106:279–283 (2004)

283 141

Structure and Origin of B Chromosomes Cytogenet Genome Res 106:284–288 (2004) DOI: 10.1159/000079300

Comparative FISH analysis of distribution of B chromosome repetitive DNA in A and B chromosomes in two subspecies of Podisma sapporensis (Orthoptera, Acrididae) A.G. Bugrov,a,c T.V. Karamysheva,b D.N. Rubtsov,c O.V. Andreenkovab and N.B. Rubtsovb,c Institutes of a Systematics and Ecology of Animals and b Cytology and Genetics, Siberian Branch of Russian Academy of Sciences; c Novosibirsk State University, Novosibirsk (Russia)

Abstract. FISH analysis of B chromosome repetitive DNA distribution in A and B chromosomes of two subspecies of Podisma sapporensis (P. s. sapporensis and P. s. krylonensis) was performed. In the B chromosomes, C-positive regions contained homologous DNA repeats present also in some C-positive A chromosome regions. Most C-negative regions contained DNA repeats characteristic of A chromosome euchromatic

regions. The two subspecies analyzed differed in the location of A chromosome regions enriched with repeats homologous to repeats of B chromosomes. The only common region enriched with these B chromosome repeats in both subspecies was the X chromosome pericentromeric region. The origin of B chromosomes in P. sapporensis is discussed.

B chromosomes (Bs) have been reported in many grasshopper species. They are most often represented by small chromosomes mainly consisting of C-heterochromatic regions (Hewitt, 1979; Camacho et al., 2000). In Eyprepocnemis plorans, B chromosomes showed morphological diversity, with presence of Cnegative and C-positive blocks (Henriques-Gil et al., 1984; Henriques-Gil and Arana, 1990; Camacho et al., 1997a, b; Bakkalli et al., 1999; Cabrero et al., 1999). Different hypotheses have been proposed to explain the origin of B chromosomes. The most accepted view claims that Bs are derived from the autosomes through polysomy, from centric fragments gener-

ated in Robertsonian translocations or from amplification of the paracentromeric region of a fragmented autosome (Camacho et al., 2000). Recent cytological and molecular studies have indicated that B chromosomes may also arise by interspecific hybridization (McAllister and Werren, 1997; Camacho et al., 2000; Perfectti and Werren, 2001). Furthermore, there are indications that B chromosomes may harbor a variety of transposable elements (McAllister, 1995; Peppers et al., 1997). Lopez-Leon et al. (1994) on the basis of localization of some molecular markers hypothesized that B chromosomes in E. plorans were most likely derived from the X chromosome, but the analysis of another molecular marker has recently shown that B chromosomes in this species originated from the X chromosome in Western populations (Mediterranean region) but from the smallest autosome in Eastern populations (Northern Caucasus region) (Cabrero et al., 2003). Recently, cytological diversity of B chromosomes has been found in natural populations of the grasshopper Podisma sapporensis sapporensis Shir. from Hokkaido, with seven B chromosome morphotypes being differentiated by size, morphology and C-banding pattern (Warchałowska-S´liwa et al., 2001). The analysis of repetitive DNA distribution in A and B chromo-

Supported by the Russian Foundation for Basic Research (01-04-49534, 02-0448107, 02-04-49398), “Integration” Program by SB RAS No. 48, and by the Presidium of RAN (programs No. 24 and No. 25). Received 6 October 2003; manuscript accepted 12 March 2003. Request reprints from Dr. Nikolay B. Rubtsov, Institute of Cytology and Genetics SB RAS, Lavrentjev av.10, Novosibirsk 6300090 (Russia) telephone: +7-3832-302467; fax: +7-3832-331278; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0284$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

somes performed by FISH with DNA probes generated by microdissection of B chromosomes and the euchromatic region of an A chromosome followed by DOP-PCR (Bugrov et al., 2003) suggested that B chromosome evolution in P. sapporensis sapporensis was mainly associated with DNA insertions into an ancestral A chromosome and further amplification of inserted DNA. The diverse molecular organization of Bs in P. sapporensis makes it a promising model for the elucidation of B chromosome origin and evolution. The present study was devoted to the comparative analysis of DNA repeats distribution in A and B chromosomes of two P. sapporensis subspecies, P. s. sapporensis distributed in Hokkaido and P. s. krylonensis, which is restricted to the southern region of Sakhalin Island.

Materials and methods Twenty females and thirty-two males of P. sapporensis krylonensis were collected on Sakhalin Island (Krylion peninsula) in August 2002. The specimens of P. sapporensis sapporensis captured from populations in Hokkaido Island were described earlier (Bugrov et al., 2003). Chromosomes for routine cytogenetics and FISH analysis were prepared from embryos and adult male testes. Males were injected with 0.1 ml of 0.1 % colchicine for 1.5–2.0 h prior to fixation of testes in ethanol:glacial acetic acid (3:1) for 15 min, and then kept in 70 % ethanol. Air-dried chromosome preparations were made by squashing testis follicles in 45 % acetic acid and then freezing them in dry ice. Females from the same population were placed in a separate cage. After a few days, the females laid egg pods in the moist, coarse sand. Each portion of the eggs was stored in a Petri dish with moist sand and kept at 15–21 ° C. After 15–20 days of incubation, the eggs were placed in an insect saline solution containing 0.05 % colchicine. The tops of the nonmicropylar ends of the eggs were removed. The eggs were then incubated at 30 ° C for 1.5–2 h, after which the embryos were dissected from the eggs and placed into a 0.9 % sodium citrate solution at room temperature. After 20–30 min they were fixed in 3:1 ethanol:acetic acid. For chromosome preparation, embryos were placed on a slide, macerated in a drop of 60 % acetic acid, and air-dried. Meiotic and mitotic chromosomes were stained using standard C-banding techniques. Two DNA probes, B1 and EUR1, were obtained from meiotic chromosomes of P. sapporensis sapporensis by microdissection of the B chromosome and the euchromatic part of the smallest A chromosome, respectively (Bugrov et al., 2003). Briefly, DNA libraries of the whole B chromosome and segments of the A chromosome were prepared by dissection of 8 copies of the B chromosome, and 8 copies of the euchromatic region of the smallest A chromosome. The dissected material was then picked up and transferred into 40 Ìl of buffer solution in a siliconized micropipette tip, treated with proteinase K, and amplified using DOP-PCR with MW6 primer. The DNA was labeled with biotin-16-dUTP or digoxigenin-11-dUTP in 15 PCR cycles (Rubtsov et al., 2000). The DNA probes were used for FISH analysis of meiotic and mitotic chromosomes of P. sapporensis krylonensis. FISH was performed according to standard protocol (Lichter et al., 1988) with salmon sperm DNA as the DNA carrier. Biotin- and digoxigenin-labeled DNA probes were visualized with avidin-FITC and mouse antidigoxigenin antibodies conjugated to Cy3, respectively. The chromosomes were counterstained with DAPI and analysed using an Axioskop 2 microscope (Zeiss) equipped with a CCD-camera, filter sets and ISIS3 image-processing package of Metasystems GmbH.

Results and discussion The karyotypes of P. s. sapporensis from different populations of Hokkaido and chromosome polymorphism in these populations were described earlier in detail (Bugrov et al., 2001). P. s. sapporensis from the vicinities of Sapporo (Teine

Fig. 1. C-banding of metaphase chromosomes of a female embryo of Podisma s. krylonensis. Arrows indicate acrocentrics with large pericentromeric C-blocks partly painted with the B1-probe, arrowheads point to the L1 autosomes, arrows with swallowtail indicate the M5 autosome with a telomeric C-block, the X indicates the X chromosomes, and the B indicates the B chromosome.

Mt. population) showed a standard chromosome complement typical of the genus Podisma, consisting of 22 acrocentric autosomes plus a single acrocentric X chromosome in males (2n = = 23, X0) and two in females (2n Y = 24, XX). The karyotype of P. s. sapporensis from the vicinity of the town Naganuma differed from the standard chromosome set by a fixed pericentric inversion in the M6 chromosome and the presence of additional short C-heterochromatic arms in two pairs of autosomes and the X chromosome. The population of P. s. sapporensis in Mt Daisengen differed in chromosome morphology and C-banding pattern since all chromosomes were biarmed. The short arms in the M6 autosome and the X chromosome were mainly euchromatic. In the remaining chromosomes, the additional short arms were composed of C-heterochromatin. A population from Kunashiri Island and the eastern populations in Hokkaido belonged to the XY chromosome race, resulting from a Robertsonian translocation between the originally acrocentric X chromosome and the M5 autosome (2n = = 20 + neo-X + neoY/2nY = 20 + neo-XX) (Bugrov et al., 2001). In P. s. sapporensis, B chromosomes were revealed in populations belonging to both X0 and XY chromosome races. B chromosomes found in these populations were divided into seven groups according to their morphology and C-banding patterns (Warchałowska-S´liwa et al., 2001). Karyotypic analysis of embryos and males of P. sapporensis krylonensis from Sakhalin Island showed a chromosome complement consisting of 22 acrocentric autosomes and one submetacentric X chromosome in males (2n = = 23, X0), and two submetacentric X chromosomes in females (2nY = 24, XX) (Fig. 1). Pericentromeric C-positive blocks were found in all autosomes. A small pericentromeric C-positive block was revealed in the biarmed X chromosome. Chromosomes of the M5 pair were characterized by a telomeric C-band in the long arm (Fig. 1). In P. s. krylonensis, only one B chromosome morphotype was found. It was a medium sized acrocentric chromosome

Cytogenet Genome Res 106:284–288 (2004)

285 143

Fig. 2. C-banding and two-colour FISH of B1-probe (red) and EUR1probe (green) in different types of B chromosomes in P. s. sapporensis (a, b, c) and P. s. krylonensis (d).

showing a large C-positive region (Fig. 1). It was found in three adult males and in 13 embryos derived from two females. This type of B differed from all morphotypes found in P. s. sapporensis from Hokkaido (Warchałowska-S´liwa et al., 2001) by the presence of a single C-heterochromatic block in contrast to the C-blocks separated by small C-negative regions revealed in the Bs of P. s. sapporensis. However, we cannot exclude the presence of a small C-negative region in the major proximal Cblock that could probably be revealed in lower condensed B chromosomes of P. s. krylonensis. In the B chromosomes of P. s. sapporensis, the B1-probe intensely painted the C-positive regions, whereas the EUR1probe painted the C-negative large terminal region and the small intercalary regions located between the C-blocks. In general, the size of the euchromatic regions increased in direction from centromere to telomere (Fig. 2a). In one of the B morphotypes, an intercalary C-negative region was not painted with either B1- or EUR1-probes (Fig. 2b). Another B morphotype showed no C-positive region but contained a proximal B1- and EUR1-negative region. In this B chromosome two small-sized intercalary B1-positive regions, and a large terminal EUR1positive region were revealed (Fig. 2c). In contrast to the diversity of Bs in P. s. sapporensis, the Bs in P. s. krylonensis belonged to a single morphotype showing a simple pattern of painting with the B1- and EUR1- probes. Like some Bs in P. s. sapporensis, the Bs in P. s. krylonensis were brightly painted with the B1-probe in the C-positive region and with the EUR1probe in the telomeric C-negative region (Fig. 2d). FISH with the B1- and EUR1-probes revealed different painting patterns in the A chromosomes of the two subspecies analyzed (Table 1). Euchromatic regions of A chromosomes in both subspecies were painted with the EUR1-probe. They showed almost no signal after FISH with the B1-probe. All Cpositive regions were not painted with the EUR1-probe. In P. s. sapporensis, the B1-probe painted all additional C-heterochromatic arms and the pericentromeric region of the X chromosome, but gave no signal in the euchromatic long arms and the autosomal pericentromeric C-positive regions (Fig. 3a–d). The B1-positive pericentromeric region of the X was conserved in the chromosome derived from the Robertsonian translocation of the X and M5 autosome giving rise to the neo-XY (Fig. 3d). C-positive regions of long arms and pericentromeric regions of autosomes remained unpainted with the B1-probe.

286 144

Cytogenet Genome Res 106:284–288 (2004)

Fig. 3. FISH with the B1-probe on chromosomes of the different populations of P. s. sapporensis belonging to the X0 chromosome race: Teine (a), Naganuma (b), Daisengen (c); and neo-XY chromosome race (d). Arrows indicate additional heterochromatic arms; arrowhead indicates C-block in the neo-X chromosome. X chromosomes are marked with an X. The B chromosome is marked with B. The B chromosome bivalent is marked with B+B.

Fig. 4. Two-colour FISH with B1-probe (red) and EUR1-probe (green) on metaphase chromosomes of female embryo of Podisma s. krylonensis. Arrows indicate acrocentrics with large pericentromeric C-blocks partly painted with the B1-probe, arrowheads indicate L1 and one of small autosome pairs with small pericentromeric C-block, arrows with swallowtail indicate the M5 autosomes with telomeric C-block; X chromosomes are marked with X.

Table 1. C-banding and painting patternsa of A and B chromosome regions in P. sapporensis and P. tyatiensis X chromosome

Autosomes

C+, B1+, EUR1– C– , B1–, EUR1+

C+, B1+, EUR1–

C+, B1–, EUR1– C– , B1– , EUR1+

C+, B1+, EUR1– C–, B1– , EUR1+ C–, B1–, EUR1–

P. s. sapporensis Pericentromeric Euchromatic (Bugrov et al., region regions 2003)

Additional arms

Pericentromeric regions

Euchromatic regions

Large proximal region, small regions alternating with C-negative regions

Large distal region, small regions alternating with C-positive regions

P. s. krylonensis Pericentromeric Euchromatic (This paper) region regions

Pericentromeric Pericentromeric subregions in four regions and pairs of autosomes subregions, telomeric region of M5

Euchromatic regions

Large proximal region

Large distal region

P. tyatiensis (Bugrov et al., 2003)

Additional arms in two chromosomes, telomeric region in one chromosome, pericentromeric region of submetacentrics, small distal regions in pericentromeric Cblocks

Euchromatic regions

Pericentromeric Euchromatic region, regions telomeric region, small intercalary region

B chromosome

Large proximal regions of pericentromeric C-blocks

Small intercalary region (only the B chromosome in Fig. 2b) Large proximal region (only the B chromosome in Fig. 2c)

a

C+/C– = Positively or negatively C-banded, respectively. B1+/B1– = Presence or absence of FISH signal with the B1 probe. EUR1+/EUR1– = Presence or absence of FISH signal with the EUR1 probe.

In P. s. krylonensis, pericentromeric C-positive blocks of the autosomes could be divided into three groups according to their patterns of painting with the B1-probe (Fig. 4). C-positive blocks of the first group remained unpainted with the B1probe. The second group included C-positive blocks in two pairs of autosomes. One of them was the medium-sized pericentromeric C-block of the L1 autosome. The other was the pericentromeric C-block in one of the smallest autosomes. A dot-like signal for the B1-probe covered only a small pericentromeric part of these C-blocks. The third group included large C-blocks in two pairs of medium-sized autosomes. In contrast to the C-blocks of the second group, the B1-probe intensely painted most of these C-blocks and only small pericentromeric regions remained unpainted. In the submetacentric X chromosome, the B1-probe painted the pericentromeric C-block. The telomeric C-positive block of the M5 autosome was B1- and EUR1-negative (Fig. 4). A summary of C-banding and FISH data in the two P. sapporensis subspecies and P. tyatiensis is shown in Table 1. B chromosomes are frequently composed of repetitive DNAs contained in C-positive and C-negative regions. B chromosomes in the grasshopper Podisma sapporensis, for instance, showed alternating C-positive and C-negative regions (Warchałowska-S´liwa et al., 2001). The comparative analysis of B chromosomes in P. s. sapporensis and P. s. krylonensis, performed here, has revealed a common basic principle of their organization, with the major proximal region being C-positive and the distal terminal region being C-negative. The difference between

B chromosome organization in the two subspecies lies in alternating C-positive and C-negative blocks that were revealed only in P. s. sapporensis. B chromosome organization and DNA repeat distribution in A chromosomes in P. s. sapporensis and P. s. krylonensis focused our interest on B chromosome origin. Repetitive DNA homologous to DNA of B chromosome C-positive regions was revealed in different locations in A chromosomes in all analyzed populations of P. s. sapporensis and P. s. krylonensis. The present analysis of the distribution of B chromosome repeats revealed that the only common region in the A chromosomes of P. s. sapporensis and P. s. krylonensis, being enriched with repeats of B chromosome C-positive regions, is the X chromosome pericentromeric region. Homologous repeats were also revealed in the X chromosome pericentromeric region of a closely related species, P. tyatiensis, where B chromosomes have not been reported (Table 1) (Bugrov et al., 2003). This suggests that these DNA repeats are quite old and predate the origin of these two species and thus the B chromosome. It is conceivable that the B derived from the proximal region of the X chromosome by means of polysomy, deletion of most of its euchromatin and subsequent amplification of the pericentromeric DNA repeats. This hypothesis could be tested by the generation of X chromosome-specific DNA probes followed by chromosomal in situ suppression hybridization, to ascertain the origin of the EUR1 regions in the B chromosomes. Taking into account the possibility of the multiregional origin of the Bs (Cabrero et al., 2003), DNA probes from different Bs should

Cytogenet Genome Res 106:284–288 (2004)

287 145

also be tested by chromosomal in situ suppression hybridization. This approach has shown high efficiency in ascertaining the origin and composition of human marker chromosomes (Anderlid et al., 2001). Studies on the origin of B chromosome euchromatic regions, by means of specific probes and reverse painting, are in progress.

Acknowledgements The authors thank Dr. J.P.M. Camacho and Dr. N. Zhdanova for fruitful discussions and valuable comments.

References Anderlid BM, Sahlen S, Schoumans J, Holmberg E, Ahsgren I, Mortier G, Speleman F, Blennow E: Detailed characterization of 12 supernumerary ring chromosomes using micro-FISH and search for uniparental disomy. Am J Med Genet 99:223– 233 (2001). Bakkali M, Cabrero J, Lopez-Leon MD, Perfectti F, Camacho JP: The B chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North Africa. I. B variants and frequency. Heredity 83:428–341 (1999). Bugrov AG, Warchałowska-S´liwa E, Tatsuta H, Akimoto S: Chromosome polymorphism and C-banding variation of the brachypterous grasshopper Podisma sapporensis Shir. (Orthoptera, Acrididae) in Hokkaido, Nothern Japan. Folia biol (Krako´w) 49:137–152 (2001). Bugrov AG, Karamysheva TV, Pyatkova MS, Rubtsov DN, Andreenkova OV, Warchałowska-S´liwa E, Rubtsov NB: Chromosomes of the Podisma sapporensis Shir. (Orthoptera, Acrididae) analysed by chromosome microdissection and FISH. Folia Biol (Krakow) 51:1–11 (2003). Cabrero J, Lopez-Leon MD, Bakkalli M, Camacho JPM: Common origin of B chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity 83:435–439 (1999). Cabrero J, Bakkali M, Bugrov A, Warchałowska-S´liwa E, Lo´pez-Leo´n MD, Perfectti F, Camacho JPM: Multiregional origin of B chromosomes in the grasshopper Eyprepocnemis plorans. Chromosoma 112:207–211 (2003).

288 146

Camacho JPM, Cabrero J, Lopez-Leon MD, Shaw MW: Evolution of a near-neutral B chromosome, in Henriques-Gil N, Parker JS, Puertas MJ (eds): Chromosomes today 12:301–318 (1997a). Camacho JPM, Shaw MW, Lopez-Leon MD, Padro MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997b). Camacho JP, Sharbel TF, Beukeboom LW: B chromosome evolution. Philos Trans R Soc Lond B Biol Sci 355:163–178 (2000). Henriques-Gil N, Arana P: Origin and substitution of B chromosomes in grasshopper Eyprepocnemis plorans. Evolution 44:747–753 (1990). Henriques-Gil N, Santos JI, Arana P: Evolution of a complex polymorphism in the grasshopper Eyprepocnemis plorans. Chromosoma 89:290–293 (1984). Hewitt GM: Grasshoppers and crickets, in John B (ed): Animal Cytogenetics, 3. Insecta 1. Orthoptera, pp 1–170 (Gebrüder Borntraeger, Berlin, Stuttgart 1979). Lichter P, Cremer T, Tang CJ, Watkins PC, Manuelidis L, Ward DC: Rapid detection of human chromosome 21 aberrations by in situ hybridization. Proc Natl Acad Sci USA 85:9664–9668 (1988). Lopez-Leon MD, Neves N, Schwarzacher T, HeslopHarrison JS, Hewitt GM, Camacho JPM: Possible origin of a B chromosome deduced from its DNA composition using double FISH technique. Chrom Res 2:87–92 (1994).

Cytogenet Genome Res 106:284–288 (2004)

McAllister BF: Isolation and characterization of a retroelement from B chromosome (PSR) in the parasitic wasp Nasonia vitripennis. Insect Mol Biol 4:253–262 (1995). McAllister BF, Werren JH: Hybrid origin of a B chromosome (PSM) in the parasitic wasp Nasonia vitripennis. Chromosoma 106:243–253 (1997). Perfectti, F, Werren, JH: The interspecific origin of B chromosomes: experimental evidence. Evolution 55:1069–1073 (2001). Peppers JA, Wiggins LE, Baker RJ: Nature of B chromosomes in the harvest mouse Reithrodontomys megalotis by fluorescence in situ hybridization (FISH). Chrom Res 5:475–479 (1997). Rubtsov NB, Karamysheva TV, Astakhova NM, Liehr T, Claussen U, Zhdanova NS: Zoo-FISH with region-specific paints for mink chromosome 5q: delineation of inter- and intrachromosomal rearrangements in human, pig, and fox. Cytogenet Cell Genet 90:268–270 (2000). Shaw DD, Wilkinson P, Coates DJ: Increased chromosomal mutation rate after hybridization between two subspecies of grasshoppers. Science 220:1165– 1167 (1983). Warchałowska-S´liwa E, Bugrov AG, Tatsuta H, Akimoto S: B chromosomes, translocation between B and autosomes, and C-heterochromatin polymorphism of the grasshopper Podisma sapporensis Shir. (Orthoptera, Acrididae) in Hokkaido, northern Japan. Folia Biol (Krakow). 49:64–75 (2001).

Structure and Origin of B Chromosomes Cytogenet Genome Res 106:289–294 (2004) DOI: 10.1159/000079301

Comparative analysis of micro and macro B chromosomes in the Korean field mouse Apodemus peninsulae (Rodentia, Murinae) performed by chromosome microdissection and FISH N.B. Rubtsov,a,b T.V. Karamysheva,a O.V. Andreenkova,a M.N. Bochkaerev,a I.V. Kartavtseva,c G.V. Roslik,c and Y.M. Borissova a Institute

of Cytology and Genetics, Siberian Branch of the Russian Academy of Sciences, Novosibirsk; of Cytology and Genetics, Novosibirsk State University, Novosibirsk; c Institute of Biology and Soil Science, Far Eastern Branch of the Russian Academy of Sciences, Vladivostok (Russia) b Department

Abstract. Comparative analysis of micro B and macro B chromosomes of the Korean field mouse Apodemus peninsulae, collected in populations from Siberia and the Russian Far East, was performed with Giemsa, DAPI, Ag-NOR staining and chromosome painting with whole and partial chromosome probes generated by microdissection and DOP-PCR. DNA composition of micro B chromosomes was different from that of macro B chromosomes. All analyzed micro B chromosomes contained clusters of DNA repeats associated with regions characterized by an uncondensed state in mitosis. Giemsa and

DAPI staining did not reveal these regions. Their presence in micro B chromosomes led to their special morphology and underestimation in size. DNA repeat clusters homologous to DNA of micro B chromosome arms were also revealed in telomeric regions of some macro B chromosomes of specimens captured in Siberian regions. Neither active NORs nor clusters of ribosomal DNA were found in the uncondensed regions of micro B chromosomes. Possible evolutionary pathways for the origin of macro and micro B chromosomes are discussed.

Extensive cytological studies of B chromosomes in the Korean field mouse (Apodemus peninsulae Thom.) have been performed for many years. Thousands of animals from populations distributed around a huge area including Western Siberia, North Mongolia, North East China, the Russian Far East, Korea and Japan (Hokkaido) have been karyotyped (for review, see Kartavtseva and Roslik, this issue). According to their mor-

phology detected by Giemsa and DAPI staining, Bs were divided into four groups: (1) large metacentrics or submetacentrics; (2) medium-to-small metacentrics or submetacentrics; (3) medium-to-small acrocentrics or subtelocentrics; and (4) dotlike (micro B) chromosomes (Kartavtseva et al., 2000). Extensive intraindividual, intrapopulational, and interpopulational variability for B chromosome number and morphology have been found. Recently, repeated DNA of Bs in the Korean field mouse has been analyzed by FISH with DNA probes generated by microdissection of A and B chromosomes followed by DOPPCR (Karamysheva et al., 2002). It was shown that all B chromosomes were composed of a large amount of repeated DNA sequences. The repeats were classified in terms of their homology and predominant location. Pericentromeric repeats of the Bs were homologous to repetitive DNA of pericentromeric Cblocks of all autosomes and non-centromeric C-blocks of the sex chromosomes. Two other types of repeats comprised the main body of the arms of the majority of the Bs. One type of B

Supported by the Russian Foundation for Basic Research (grants No. 01-04-49534 and 02-04-48107) and Siberian Branch of the Russian Academy of Sciences (integration project No. 48). Received 3 October 2003; manuscript accepted 16 February 2004. Request reprints from Dr. Nikolay B. Rubtsov Institute of Cytology and Genetics, SB RAS Lavrentyev av.10, Novosibirsk 6300090 (Russia) telephone: +7-3832-302467; fax: +7-3832-331278 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0289$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Fig. 1. Two-color FISH with metaphase chromosomes of A. peninsulae with the DNA probes derived from the arms of macro B chromosomes (green) and pericentromeric C-positive autosome region (red); DAPI counterstaining is blue; micro Bs are marked with m and indicated with arrows (a); macro Bs are marked with M (a, b); sex chromosomes are marked with X and Y; arrows with swallowtail point to macro B chromosome pericentromeric, intercalary, and telomeric regions containing DNA homologous to DNA of autosome pericentromeric regions (b).

Fig. 2. Two-color FISH with metaphase chromosomes of A. peninsulae with the DNA probes derived from the micro B (green) and the small Siberian macro B (red); DAPI counterstaining is blue; metaphase spread with micro B chromosomes (a); metaphase spread with macro B chromosomes containing uncondensed telomeric regions (b); micro Bs are marked with m; macro Bs are marked with M; arrows indicate uncondensed regions in macro Bs; sex chromosomes are marked with X and Y.

chromosome arm repeats also showed homology to repeated interspersed sequences in euchromatic regions of the As (Karamysheva et al., 2002). The second type of DNA repeats was not detected by FISH in the A chromosomes. Distribution of these types of repetitive DNA sequences was also analyzed in the closely related species, A. agrarius. By comparing the distribution of these DNA repeats in the chromosomes of the two species, A. peninsulae and A. agrarius, an assumption of B chromosome origin and evolution in the Korean field mouse was suggested. It implied that DNA sequences which persisted in euchromatic parts of A chromosomes under stringent control of natural selection invaded pericentromeric regions. At the new position, they were involved in amplification resulting in destabilization of pericentromeric regions. This led to a high frequency of micro chromosome formation (Karamysheva et al., 2002). Similar supernumerary familial marker chromosomes containing no euchromatic region and showing no apparent phenotypic effects are well known in human cytogenetics (see Fuster et al., this issue). When the small proto-B chromosomes were established in this way, different types of A chromosomal or extrachromosomal DNA sequences might have invaded them, were amplified, and led to the Bs of a larger size. Very small Bs (dot-like or micro Bs) have been found in many populations of the Korean field mouse.

290 148

Cytogenet Genome Res 106:289–294 (2004)

They were considered to be B chromosomes in the initial stage of their development. Their number varied from 0 to 20 per specimen (Kartavtseva, 1999; Kartavtseva and Roslik, this issue). In this study, we analyze DNA composition of these micro B chromosomes and try to ascertain the reason for interpopulation differences in their frequency.

Materials and methods Overall, 51 specimens of A. peninsulae captured in Siberia (31 specimens) and the Russian Far East (20 specimens) were studied. Chromosomes for routine and FISH analysis were prepared from short-term bone marrow cell cultures. DAPI, Giemsa, and Ag-NOR staining was performed according to standard protocols (Verma and Babu, 1995). B chromosomes were characterized by FISH with DNA probes generated by microdissection of metaphase chromosomes followed by DOP-PCR with the MW6 primer, and subsequent DNA labeling with biotin-16-dUTP or digoxigenin-11-dUTP performed in 15 additional PCR cycles (Rubtsov et al., 2000). DNA probes derived from autosome pericentromeric C-positive regions, arms of macro B chromosomes, small macro B chromosomes, and micro B chromosomes derived from Siberian specimens were described earlier (Karamysheva et al., 2002). Five DNA probes derived from five macro B chromosomes found in three specimens captured in the Russian Far East were generated in this study. One of these Bs was small. But it was nearly twice as large as the micro Bs from Siberian specimens. The DNA probe used for detection of clusters of 18S rDNA (rDNA probe) contained a 3.2-kb frag-

ment of human 18S rDNA in pHr13 (Malygin et al., 1992). It was labeled with biotin-16-dUTP by standard nick translation. FISH was performed according to a standard protocol (Lichter et al., 1988) with salmon sperm DNA as a carrier DNA. Biotin- and digoxigeninlabeled probes were visualized with avidin-FITC and mouse antidigoxigenin antibodies conjugated to Cy3, respectively. Chromosomes were counterstained with DAPI and analyzed using an Axioskop 2 (Zeiss) microscope equipped with a CCD camera, filter set, and ISIS3 image-processing package of Metasystems GmbH.

Results The number of standard (A) chromosomes was 2n = 46 + XY). In addition, 49 out of the 51 individuals analysed carried 1–10 B chromosomes. The total number of Bs analyzed in the 49 individuals was 215. According to their morphology analyzed by Giemsa and DAPI staining, the Bs were divided into two groups: (1) macro Bs (large-to-small metacentrics, submetacentrics, acrocentrics, and subtelocentrics) and (2) micro Bs (dot-like chromosomes). A very small sized B was considered a micro B whenever it showed no detectable chromosome arm in all metaphase spreads analyzed. On this basis, 21 Bs found in nine animals trapped in the Siberian regions were diagnosed as micro Bs. The highest number of micro Bs in an individual was eight. No micro B was found in specimens captured in the Russian Far East. A and B chromosomes in all specimens were analyzed by two-color FISH with pairs of the DNA probes mentioned above. The DNA probe derived from autosome pericentromeric C-positive regions painted the pericentromeric regions of autosomes, an intercalary C-block in the X and a telomeric Cblock in the Y (Fig. 1a, b). Pericentromeric regions of the X and the Y showed no signal. In Siberian Bs this DNA probe painted pericentromeric regions of all micro Bs and some macro Bs (Fig. 1a, b). In a few macro B chromosomes, this probe also painted intercalary or telomeric regions of arms (Fig. 1b). The size of pericentromeric regions painted on B chromosomes was considerably (5–10 fold) smaller than that in the large autosomes. No signal was detected after FISH with DNA probe derived from autosome pericentromeric C-positive regions on B chromosomes of specimens collected in the Russian Far East. Probes derived from Bs of specimens from the Russian Far East gave no signal in C-positive regions of A chromosomes. DNA probes derived from arms of Siberian macro B chromosomes painted normally condensed regions of macro B chromosome arms but gave signal neither in the micro Bs nor in C-positive regions of A chromosomes (Fig. 1a, b). All DNA probes derived from the whole B chromosomes of the specimens captured in the Russian Far East painted the same regions that were painted with the DNA probe derived from the arms of the Siberian B chromosome. Additionally DNA probes derived from the Russian Far East Bs painted pericentromeric regions of the Bs in the Russian Far East specimens and pericentromeric regions of some Bs in Siberian specimens. The DNA probe derived from the small macro B chromosome of the specimen captured in West Siberia painted all regions that showed signal after FISH with the DNA probe derived from autosome pericentromeric C-positive regions and

Fig. 3. DAPI staining of the metaphase spread shown on Fig. 2b; arrows indicate location of uncondensed telomeric regions of macro B chromosomes; arrows indicate macro B chromosomes; sex chromosomes are marked with X and Y.

DNA probe derived from arms of the macro B chromosome (Fig. 2a, b). The DNA probe derived from micro B chromosome painted all chromosome regions showing signal after FISH with DNA probe derived from autosome pericentromeric regions (Fig. 2a, b). This probe also painted all micro Bs (Fig. 2a) and telomeric regions of macro Bs showing uncondensed state in mitosis (Figs. 2b, 3). Data obtained with FISH with DNA probes generated by microdissection and DOP-PCR are summarized in Table 1. Based on results of FISH experiments, the following types of B chromosome organization were revealed. Micro B chromosomes consisted of two types of regions: (a) small pericentromeric region containing repeats homologous to repeats of A chromosome C-positive regions and (b) region(s) showing an uncondensed state in mitosis and containing specific DNA repeats. Macro Bs could be divided into two groups depending on whether their pericentromeric regions showed homology (group 1) or not (group 2) to C-positive autosome pericentromeric regions. Most macro Bs found in specimens collected in Western Siberia and some macro Bs of specimens from East Siberia belonged to group 1. Other macro Bs of specimens from East Siberia and all Bs from the Russian Far East belonged to group 2. The arms of all macro Bs in both groups contained normally condensed regions enriched with homologous repeats. Some macro Bs in Siberian specimens carried uncondensed DNA regions homologous to those in micro Bs (Fig. 2b). These uncondensed regions enriched with specific repeats were present in all micro Bs. FISH analysis did not reveal these repeats in A and macro B chromosomes of specimens captured in the Russian Far East. The registered frequency of micro B chromosomes in specimens from this region is very low (Kartavtseva and Roslik, this issue). Furthermore, a detailed analysis of micro Bs from the Russian Far East showed that they were twice as large as the micro Bs from Siberia and showed

Cytogenet Genome Res 106:289–294 (2004)

291 149

Fig. 5. Two-color FISH with metaphase chromosomes of A. peninsulae with the DNA probes derived from the small Siberian macro B (red) and rDNA probe (green); arrows indicate NORs of the macro Bs; arrowheads indicate NORs of autosomes.

Fig. 4. Ag-NOR banding of Korean field mouse chromosomes; arrows indicate active NORs of the macro Bs; arrowheads indicate autosomes with active NORs.

Table 1. Painting patternsa of the A and B chromosomes produced by FISH with microdissected DNA probes Probe derived from

Autosome pericentromeric region Arms of macro Bs Small macro B from Siberia b Large macro B from the RFE b Small macro B from the RFE Micro B

A chromosomes

Macro Bs

C-blocks Euchromatic regions

Siberian Bs Pericentromeric Arms regions

Uncondensed Pericentromeric Arms regions regions

+++ – ++ – – ++

+– – +– +– +– +–

– – – – – +++

– + + + + –

Micro Bs Russian Far East Bs

– +++ +++ +++ +++ –

– – – + + –

– +++ +++ +++ +++ –

Figures

Pericentromeric Uncondensed regions region

++ – ++ – – ++

– – – – – +++

1a, 1b 1a, 1b 2, 3 c NS c NS 1, 2, 3, 4

a

Regions are painted heavily (+++), with middle intensity (++), a little more intensive than the background (+), as background (–); regions of some chromosomes showed signal whereas regions of other chromosomes showed no signal (+–). b The Russian Far East (RFE). c Results that were not shown on the pictures (NS).

small arms in good quality metaphase spreads. According to their size and morphology they should be considered as small macro B chromosomes, rather than micro Bs. One of these B chromosomes was analyzed by FISH with all available DNA probes. It was painted with DNA probes derived from macro Bs but showed no signal after FISH with DNA probes derived from micro B chromosomes. Conversely, the DNA probe derived from this small B chromosome produced painting patterns in A and B chromosomes identical to those obtained with other DNA probes derived from macro Bs from the Russian Far East (Table 1). These data showed that DNA composition in this small macro B chromosome is similar to that of other macro Bs from the Russian Far East. In an attempt to discover the nature of the uncondensed DNA regions in micro B chromosomes, we analyzed the rDNA

292 150

Cytogenet Genome Res 106:289–294 (2004)

location. rDNA is one of the types of tandemly repeated DNA, which has been frequently revealed in B chromosomes in many species (Green, 1990; Jones, 1995). Active nucleolar organizing regions (NOR) remain usually in an uncondensed state in mammalian mitotic chromosomes. Active NORs and clusters of rDNA in the As and Bs of the Korean field mouse were detected with Ag-NOR banding and FISH with the rDNA probe. The Ag-NOR banding heavily stained the telomeric regions of three or four autosomes (two pairs of middle-sized acrocentrics). Small active NORs in telomeric or intercalary regions of one or both arms of 28 macro Bs in the 24 animals from Siberia and the Russian Far East were additionally revealed (Fig. 4). Ag-positive regions in the Bs were usually similar in size to the smallest Ag-positive regions in the As. Only one B chromosome showed an active NOR comparable in

size with large NORs of autosomes. FISH with the rDNA probe gave signals at the Ag-NOR positive regions of the As and Bs. In the Bs, they were usually smaller than in autosomes (Fig. 5). No micro Bs showed active NORs or clusters of rDNA detectable by the techniques used in this study. Furthermore, all rDNA clusters in the macro B chromosomes were located in regions containing repeats characteristic for normally condensed arms of macro B chromosomes. Consideration of these results led to the conclusion that the uncondensed state of the micro B chromosomes was not associated with the location of active NORs.

Discussion A variety of hypotheses suggesting mechanisms for the evolutionary origin and further development of B chromosomes have been proposed and discussed (for review see Camacho et al., 2000). The most widely accepted view is that they are derived from A chromosomes. For instance, they could derive from the leftover centromere from A chromosome fusions (Patton, 1977), from polysomic chromosomes, from amplified pericentromeric chromosome fragments (Keyl and Hagele, 1971), or they could arise from fragments formed in trisomic pairing (Amos and Dover, 1981). Apart from the many Bs of autosomal origin (Peppers et al., 1997), sex chromosome-derived Bs have also been described (Sharbel et al., 1998; Cabrero et al., 2003). This view is based on the observation that B chromosomes display a certain degree of homology with some regions of A chromosomes (Jamilena et al., 1994, 1995; McQuade et al., 1994; Stark et al., 1996). There are also B chromosomes that are supposed to be composed of transposable elements (McAllister, 1995; Peppers et al., 1997). Data on DNA homology of B chromosome pericentromeric regions to autosome pericentromeric regions in A. peninsulae (Karamysheva et al., 2002) suggested the autosomal origin of some Bs in this species. However further investigation involving B chromosomes from the Russian Far East population revealed the existence of Bs that did not contain DNA homologous to DNA of autosome pericentromeric regions (Table 1). They probably originated from sex chromosomes whose pericentromeric regions showed no homology to autosome pericentromeric regions. Multiregional origin of B chromosomes has recently been shown in the grasshopper Eyprepocnemis plorans (Cabrero et al., 2003). The available data in the Korean field mouse also suggest this possibility. A possible pathway for B chromosome origin could resemble the mechanism suggested by Wandstrat and Schwartz (2000) for the origin of some human supernumerary marker chromosomes (SMC). It would involve illegitimate recombination between homologous acrocentrics followed by nondisjunction and centromere inactivation, with breakpoints localized within the array of DNA repeats in heterochromatic regions or else in euchromatic regions containing several low-copy repeat DNA sequence families. One break and erroneous reparation event leads to the formation of an inverted duplication. In fact, most of the SMCs derived from acrocentrics are inv dup(15). The different frequency of SMCs derived from human acrocentrics presumably indicates the different incidence of chromo-

some rearrangements in their pericentromeric regions. The small size of B chromosome pericentromeric regions in A. peninsulae, which are homologous to autosome pericentromeric regions, leads to the suggestion that at least one breakpoint located within the autosome C-heterochromatic pericentromeric region might have been involved in the formation of these Bs. The suggestion that the formation of the proto-B chromosome could go through a stage of inverted duplication might explain the presence of telomeric repeat clusters in all analyzed Bs in A. peninsulae (Karamysheva et al., 2002). DNA amplification during B chromosome development should lead to difference in size and DNA composition of B chromosome arms. However many large Bs looked like isochromosomes (Karamysheva et al., 2002). This phenomenon could be the consequence of high rate of B chromosome rearrangements with hot spots in their pericentromeric regions forming isochromosomes in the late stages of B chromosome evolution. Presence of NORs in telomeric regions of some B chromosomes could suggest another possible mechanism for B chromosome formation. B chromosomes could derive from autosomes by deletion with one breakpoint in pericentromeric regions and another breakpoint near the telomere. This suggestion can explain the existence of B chromosomes with NORs in telomeric position. At least some of them could derive from autosomes containing NORs by deletion of a large chromosome region. However, insertion of rDNA into B chromosomes could take place on the late stage of their evolution. The latter suggestion could explain NOR locations in Bs derived from the Russian Far East population. The origin of these Bs was discussed above. They were probably derived from sex chromosomes, which contained neither detectable active NORs nor clusters of rDNA. The consideration of possible pathways for B chromosome origin in A. peninsulae has led us to the conclusion that the proto-B chromosome(s) should be small and contain regions originating from A chromosomes. Further proto-B evolution to become Bs as those found in current natural populations would probably be based on the insertion and amplification of new DNA elements. The final B size and morphology would depend on the type of DNA elements inserted and the intensity of their amplification. Insertion and amplification of DNA elements is a common feature of B chromosome evolution in many species (for review see Camacho et al., 2000). But a peculiarity in the development of some B chromosomes was revealed in Siberian populations of A. peninsulae. While most proto-Bs developed into macro Bs, others acquired regions which remain uncondensed in mitosis. In these Bs only a small pericentromeric region could be visualized in metaphase spreads with Giemsa or DAPI staining. According to their small size and special morphology they were named micro Bs. It is conceivable that some micro Bs evolve into macro Bs through the insertion and amplification of certain DNA elements, in which case we should expect that they contain uncondensed DNA regions similar to those in micro Bs. This was the case in some specimens from Siberia. Alternatively, they could arise by insertion or translocation of micro B uncondensed DNA repeats into telomeric regions of macro B chromosomes. Furthermore, the probability that all DNA sequences found in B chromosomes

Cytogenet Genome Res 106:289–294 (2004)

293 151

were already present in the proto-B or even in the ancestor A chromosome cannot be ruled out. In this case, differential amplification of these existing sequences would explain the different B chromosome types found. The origin of DNA repeats in the uncondensed regions of B chromosomes remains unexplained. We know that they are not rDNA, and the question of their possible transcriptional activity remains open. FISH revealed regions enriched with these repeats only in B chromosomes of specimens from Siberia and they were not detected in specimens from the Russian Far East.

Perhaps a multiregional origin of Bs might explain these differences, but testing this suggestion requires further investigation including cloning and sequencing.

Acknowledgements The authors thank Dr. A. Kryukov for all around help in the Russian Far East, Dr. Juan Pedro M. Camacho, Prof. P. Borodin and Dr. N. Zhdanova for fruitful discussions and valuable comments.

References Amos A, Dover D: The distribution of repetitive DNAs between regular and supernumerary chromosomes in species of Glossina (Tsetse): a two-step process in the origin of supernumeraries. Chromosoma 81:673–690 (1981). Cabrero J, Bakkali M, Bugrov A, Warchalowska-Sliwa E, Lopez-Leon MD, Perfectti F, Camacho JP: Multiregional origin of B chromosomes in the grasshopper Eyprepocnemis plorans. Chromosoma 112:207–211 (2003). Camacho JP, Sharbel TF, Beukeboom LW: B chromosome evolution. Phil Trans R Soc Lond B Biol Sci 355:163–178 (2000). Fuster C, Rigola MA, Egozcue J: Human supernumerary chromosomes: are they B chromosomes? Cytogenet Genome Res 106:165–172 (2004). Green DM: Muller’s Ratchet and the evolution of supernumerary chromosomes. Genome 33:818– 824 (1990). Jamilena M, Ruiz Rejon C, Ruiz Rejon M: A molecular analysis of the origin of the Crepis capillaris B chromosome. J Cell Sci 107:703–708 (1994). Jamilena M, Garrido-Ramos M, Ruiz Rejon M, Ruiz Rejon C, Parker JS: Characterisation of repeated sequences from microdissected B chromosomes of Crepis capillaris. Chromosoma 104:113–120 (1995). Jones RN: Tansley review no. 85: B chromosomes in plants. New Phytol 131:411–434 (1995). Karamysheva TV, Andreenkova OV, Bochkaerev MN, Borissov YM, Bogdanchikova N, Borodin PM, Rubtsov NB: B chromosomes of Korean field mouse Apodemus peninsulae (Rodentia, Murinae) analysed by microdissection and FISH. Cytogenet Genome Res 96:154–160 (2002).

294 152

Kartavtseva IV: Seasonal observations on supernumerary chromosomes, mosaicism, and dynamics in two populations of the Eastern-Asian wood mouse Apodemus peninsulae (Rodentia) from Primorskii Krai. Russ J Genet 8:811–817 (1999). Kartavtseva IV, Roslik GV: A complex B chromosome system in the Korean field mouse, Apodemus peninsulae. Cytogenet Genome Res 106:271–278 (2004). Kartavtseva IV, Roslik GV, Pavlenko MV, Amachaeva EYu, Sawaguchi S, Obara Y: The B-chromosome system of the Korean field mouse Apodemus peninsulae in the Russian Far East. Chrom Sci 4:21–29 (2000). Keyl HG, Hagele K: B-chromosomes in Chironomus. Chromosoma 35:403–417 (1971). Lichter P, Cremer T, Tang CJ, Watkins PC, Manuelidis L, Ward DC: Rapid detection of human chromosome 21 aberrations by in situ hybridization. Proc natl Acad Sci, USA 85:9664–9668 (1988). Malygin AA, Graifer DM, Zenkova MA, Mamaev SV, Karpova GG: Affinity modification of 80S ribosomes from human placenta by derivatives of triand hexauridylates as mRNA analogs. Mol Biol (Mosk) 26:369–377 (1992). McAllister BF: Isolation and characterization of a retroelement from B chromosome (PSR) in the parasitic wasp Nasonia vitripennis. Insect Mol Biol 4:253–262 (1995).

Cytogenet Genome Res 106:289–294 (2004)

McQuade LR, Hill RJ, Francis D: B chromosome systems in the greater glider, Petauroides volans (Marsupialia: Pseudocheiridae). II. Investigation of B chromosome DNA sequences isolated by micromanipulation and PCR. Cytogenet Cell Genet 66:155–161 (1994). Patton JL: B chromosome systems in the pocket mouse, Perognathus baileyi: meiosis and C-band studies. Chromosoma 60:1–14 (1977). Peppers JA, Wiggins LE, Baker RJ: Nature of B chromosomes in the harvest mouse Reithrodontomys megalotis by fluorescence in situ hybridization (FISH). Chrom Res 5:475–479 (1997). Rubtsov NB, Karamisheva TV, Astakhova NM, Liehr T, Claussen U, Zhdanova NS: Zoo-FISH with region-specific paints for mink chromosome 5q: delineation of inter- and intrachromosomal rearrangements in human, pig, and fox. Cytogenet Cell Genet 90:268–270 (2000). Sharbel TF, Green DM, Houben A: B chromosome origin in the endemic New Zealand frog Leiopelma hochstetteri through sex chromosome devolution. Genome 41:14–22 (1998). Stark EA, Connerton I, Bennett ST, Barnes SR, Parker JS, Forster JW: Molecular analysis of the structure of the maize B chromosome. Chrom Res 4:15–23 (1996). Verma RS, Babu A: Human Chromosomes. Principles and Techniques (McGraw-Hill, New York 1995). Wandstrat AE, Schwartz S: Isolation and molecular analysis of inv dup(15) and construction of a physical map of a common breakpoint in order to elucidate their mechanism of formation. Chromosoma 109:498–505 (2000).

Structure and Origin of B Chromosomes Cytogenet Genome Res 106:295–301 (2004) DOI: 10.1159/000079302

FISH detection of ribosomal cistrons and assortment-distortion for X and B chromosomes in Dichroplus pratensis (Acrididae) C.J. Bidau, M. Rosato and D.A. Martı´ Laboratorio de Genética Evolutiva, Universidad Nacional de Misiones, Posadas (Argentina)

Abstract. Assortment-distortion with respect to the X and NOR activity of a rare mitotically stable B chromosome (BN), was examined in 16 males of Dichroplus pratensis (Acrididae: Melanoplinae) from Argentine populations. In 1B individuals, the X and B associate preferentially during prophase I reaching a maximum level of association at zygotene. Frequency of X/B association remains relatively high up to diplotene-diakinesis and decreases steeply towards metaphase I. The percent X/B association at each stage is positively influenced by association at the previous stage, and interindividual variability in X/B association decreases as the frequency of association increases. Both chromosomes tended to preferentially orientate toward the same pole at MI (mean ratio of 16 individuals, 1.50:1)

which determined an excess of XB and 00 second spermatocytes over X0 and 0B ones (1.39:1). No significant differences occurred between the MI, AI and MII assortment ratios. Fluorescent in situ hybridisation (FISH) confirmed that the B chromosome carries ribosomal genes and helped to establish that, during spermiogenesis, both the B and the normal NOR-bearing chromosome (S8) are clustered near the centriole adjunct region of spermatids. However, FISH failed to reveal the existence of inactive ribosomal cistrons in the X chromosome, as previously suggested, thus providing no support to a simple origin of the B from the X.

B chromosomes are an almost universal accessory component of eukaryotic genomes (Jones and Rees, 1982; Camacho et al., 2000). They have multiple dissimilar origins, DNA composition and genetic activity are diverse and their behaviour and

effects are complex and sometimes, downright bizarre. It is difficult to generalise on B chromosomes but the consensus is that they are parasitic, selfish DNA entities that co-evolve with the A-genome to maximise their representation in the next generation despite their potential harmful effects (Bell and Burt, 1990; Camacho et al., 2000, 2003). Such effects may derive from their sole presence within the cell (through meiotic misbehaviour) or because of transcription of genes present in the Bs that could somehow interfere with normal cellular activity. Nevertheless, little is known about genetic activity of B chromosomes in most plants and animals, with few notable exceptions (Camacho et al., 2000). The fact that Bs are selfish genetic parasites generates genomic conflict between them and the A genome (Camacho et al., 2000, 2003) and thus, they are under natural selection against their spread throughout the population. Because of the former, B chromosomes have evolved a number of strategies to counteract the effects of negative selection and to persist within natural populations (Jones, 1991). As a result of these opposing forces, Bs may attain the status of near-neutral genomic entities (Camacho et al., 1997a, b, 2000).

The research of D.A.M. was supported by a CONICET doctoral scholarship. C.J.B. is especially indebted to Dr. Lena Geise (Universidade do Estado do Rio de Janeiro) and Dr. Ilana Zalcberg (Instituto Nacional do Cancer, Rio de Janeiro) in whose laboratories this paper was written during a sabbatical leave financed by Fundaça˜o de Amparo a Pequisa do Rio de Janeiro (FAPERJ, Brazil). This work was partially financed through grant PID 0022 CONICET to C.J.B. Received 15 October 2003; accepted 20 January 2004. Request reprints from: Dr. Claudio J. Bidau Laborato´rio de Zoologia de Vertebrados, Departamento de Zoologia Universidade do Estado do Rio de Janeiro Rua Sa˜o Francisco Xavier 524, Maracana˜ Rio de Janeiro, RJ, 20550-900 (Brazil) telephone: +55-21-2587-7980; fax: +55-21-2587-7655 e-mail: [email protected] Present address of C.J.B.: Laborato´rio de Zoologia de Vertebrados Universidade do Estado do Rio de Janeiro (Brazil)

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0295$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. Orientation of X and B chromosomes to the spindle poles at Metaphase I in 16 1B male carriers of Dichroplus pratensis

Individual

Locality

X and B going to Same pole

1 (BN1) 2 (BN1) 3 (BN1) 4 (BN1) 5 (BN1) 6 (BN1) 7 (BN1) 8 (BN1) 9 (BN1) 10 (BN2) 11 (BN2) 12 (BN1) 13 (BN1) 14 (BN1) 15 (BN1)

Sierra de la Ventana 38º06'S 61º48'W Sierra de la Ventana 38º06'S 61º48'W Punta Indio 42º48'S 65º03W Villa Ventana 38º04'S 61º55'W Saldungaray 38º04'S 61º50'W El Atravesado 38º08'S 61º51'W El Atravesado 38º08'S 61º51'W El Atravesado 38º08'S 61º51'W El Atravesado 38º08'S 61º51'W Diadema Argentina 45º45'S 67º48'W Diadema Argentina 45º45'S 67º48'W Puerto Madryn 33º32'S 65º02'W Puerto Madryn 33º32'S 65º02'W Istmo Ameghino 42º27'S 64º28'W Istmo Ameghino 42º27'S 64º28'W Manantiales 33º32'S 63º20'W

Total

Two different types of B chromosomes have been described in the South American grasshopper Dichroplus pratensis (Melanoplinae, Acrididae) (Bidau, 1986, 1987). Nevertheless, and despite the enormous geographical distribution of the species and the large number of natural populations sampled to date (Bidau and Martı´, 2002) these B chromosomes are exceedingly rare within the species. Their frequencies are very low in marginal populations hundreds of kilometers apart, while they are virtually absent in intermediate populations except in hybrid zones (Bidau and Martı´, 2002). In a previous communication (Bidau, 1986) we described a mitotically stable B chromosome that exhibited NOR activity, as shown by silver impregnation, and also showed assortment-distortion with respect to the X chromosome in males. However, since the sample was small, the evaluation of assortment-distortion was provisional. NORs are relatively rare in B chromosomes (Green, 1990; Jones, 1995). Furthermore, silver impregnation does not necessarily reveal true NORs at least in mammals (Dobigny et al., 2002). Thus, after extensive sampling of almost 70 natural populations of D. pratensis, we found 16 males carrying the stable B chromosome, which were subjected to standard and FISH cytogenetic analyses to reanalyze the structure and behaviour of this rare supernumerary chromosome.

296 154

B freq.

Cytogenet Genome Res 106:295–301 (2004)

Opposite poles

Ratio

2

χ

P

0.04

171

111

1.59

12.77

0.000352

0.04

143

98

1.46

8.40

0.003752

0.03

423

311

1.36

17.09

0.000036

0.02

105

61

1.72

11.66

0.000639

0.05

87

59

1.45

5.37

0.020486

0.11

12

1

12.00

9.31

0.002279

0.11

9

6

1.50

0.60

0.438578

0.11

24

16

1.50

1.60

0.205903

0.11

25

12

2.08

4.57

0.032537

0.13

52

28

2.05

7.20

0.007290

0.13

22

20

1.10

0.10

0.751830

0.20

9

11

0.82

0.20

0.654721

0.20

20

8

2.50

6.61

0.010141

0.20

29

23

1.26

0.69

0.406164

0.20

30

15

2.00

5.00

0.025347

0.07

50

33

1.51

3.48

0.062115

1211

810

1.50

79.56

0.000000

Material and methods Sixteen males carrying one of two variants of a mitotically stable B chromosome were collected at the localities shown in Table 1. Non-B-carriers as well as carriers of a different B chromosome which is mitotically unstable (Bidau, 1987; Martı´, 2002) from the same populations were used as controls for FISH analysis. One male carried both B chromosome types (individual 10; see Fig. 1c). Standard testis preparations were performed by squash in propionic hematoxylin or lacto-propionic orcein. Female meiosis was studied as described in Bidau and Martı´ (2002). Cytological preparations for FISH were performed without applying mechanical pressure in order to maintain tridimensional information according to a modification of the technique of Zhong et al. (1996). Briefly, methanol:acetic fixed testis follicles were disrupted onto glass slides containing a drop of 60 % acetic acid. The material was then spread out on a thermal plate at 45 ° C, with circular movements and posterior addition of ice-cold fixative. Slides were left to air dry after several washes with ice-cold fixative, 10 min incubation in 60 % acetic acid and a final wash with 100 % ethanol. The FISH protocol was adapted from Chiavarino et al. (2000) with modifications. Slides were pre-treated with RNAse (1 Ìg/ml, 37 ° C, 1 h), pepsin (0.1 %, pH 2–2.5, 5 min, 37 ° C) and paraformaldehyde 4 % (10 min, room temperature, RT) and ethanol dehydrated. Slides were denatured in 70 % formamide/2× SSC for 1 min at 62 ° C and immediately dehydrated. The biotinylated probe pTa71, containing the 5.8S, 18S and 28S ribosomal DNA cistrons from Triticum aestivum, was used (Gerlach and Bedbrook, 1979). Probe denaturation (2 ng/Ìl) was performed for 10 min at 100 ° C in 50 % formamide/10 % dextran sulfate/2× SSC buffer. Hybridisation was allowed to proceed in a moist chamber at 37 ° C overnight. Slides were washed under agitation in 2× SSC (30 min at RT), twice in 1× SSC (5 min at RT and 30 min

Fig. 1 . Meiosis in 1B carriers of Dichroplus pratensis. (a–c) Male meiotic stages. Propionic hematoxylin squashes. (d) Female metaphase I. Lacto-propionic orcein squash. (a) Mid-pachytene showing association of X and BN1 chromosomes. Arrows indicate nucleoli associated to the BN1 and the S8 bivalent. (b) Early diplotene showing side-by-side alignment of the X and the BN2 chromosome. Arrows point to nucleoli. (c) Diakinesis of an individual carrying one BN2. The cell also has a trivalent formed by an unstable B chromosome (IIIBu). This individual was homozygous for a centric fusion. (d) Metaphase I from a standard (alltelocentric) female showing a BN1 chromosome at one of the spindle poles. Bars = 10 Ìm.

at 37 ° C) and twice in 2× SSC (5 min at RT). Detection was performed by incubation with Avidin-Cy3 at 37 ° C for 1 h, followed by two washes in 4× SSC, 0.2 % Tween 20 for 5 min at 37 ° C under agitation. Preparations were counterstained and mounted with antifade-DAPI (DAKO), and analysed in an Olympus BX 50 microscope, with the appropriate filter set.

Results Orientation and assortment of the BN and X chromosomes during male meiosis Two variants of the NOR-carrying B chromosome (BN) occur in wild populations of D. pratensis. Both are telocentric, mitotically stable and X-like in their meiotic pycnotic behaviour and both show a paracentromeric secondary constriction

which organises a nucleolus during premeiotic interphase and meiosis as suggested by silver impregnation and haematoxylin staining (Fig. 1a, b) (Bidau, 1986; Martı´, 2002). However, one is about two-thirds of the X in length (BN1) and the other, onethird (BN2) (Fig. 1b–d; Fig. 2b). An unstable B chromosome (BU) is also found in some populations of the species also carrying BN (Fig. 1c). The X and BN chromosomes are expected to orientate and segregate independently of one another in meiosis of 1B individuals if during prophase I no association occurs between them, that is, if they behave as complete univalents. We analysed orientation of both univalents at metaphase I (MI) in 16 individuals carrying one or the other variant of the BN chromosome and orientation of both chromosomes deviated signifi-

Cytogenet Genome Res 106:295–301 (2004)

297 155

Fig. 2. FISH with the rDNA pTa71 probe. Meiosis and spermiogenesis of 0B and 1BN males of Dichroplus pratensis. (a) Metaphase I of a 0B centric fusion homozygote. The arrow indicates the S8 bivalent showing two strong hybridisation signals for the pTa71 probe in both homologues. (b) Metaphase I of 1BN2 carrier. Arrows point to the S8 bivalent with two strong hybridisation signals, and to the BN2 chromosome showing a weaker paracentromeric signal. (c) Spermatids at the rounded stage from a 1BN carrier. Arrows indicate two hybridisation signals of the pTa71 probe, clustered at the centriole adjunct region. (d) Spermatids from a 1BN carrier at the beginning of the elongation stage. At right, arrows point to spermatids with both the S8 and BN signals. At left, the arrow indicates a microspermatid with a weak hybridisation signal. (e) Preleptotene nuclei of a 1BN1 carrier. Three hybridisation signals are visible in each nucleus. The arrow points to the signal from the BN chromosome. (f) Zygotene nuclei of a 0B individual showing one strong signal on the S8, resulting from pairing of both homologues. Bar = 10 Ìm.

cantly from the 1:1 expected ratio. That is, X and B tended to orientate preferentially toward the same spindle pole (Table 1). Variation occurred between individuals but it was not statistically significant (contingency ¯2 = 21.72; df = 15; P = 0.11536).

298 156

Cytogenet Genome Res 106:295–301 (2004)

The non-random orientation of X and BN at MI distorts anaphase I (AI) assortment of both univalents. In a pooled sample of 406 first anaphases in which X and B assortment was recorded, both chromosomes had migrated to the same pole in 237 cells, and to opposite poles in 169 cells, in a 1.40:1 ratio

Table 2. Variation in the frequencies of association between the X and B chromosomes during early first meiotic prophase

% X-B Associationa Individual

L

Z

χ

P

Z

EP

χ

P

1 2 3 4 5 6 7 8 9

41.5 38.0 84.0 77.0 64.5 38.6 57.5 60.0 53.9

73.0 81.0 100.0 75.9 100.0 78.7 77.7 85.0 95.8

18.5 18.4 21.0 0.001 4.7 66.6 15.6 1.6 7.1

0.000017 0.000017 0.000005 0.974773 0.030162 0.000000 0.000078 0.205903 0.007708

73.0 82.0 100.0 75.9 100.0 78.7 77.7 85.0 95.8

52.0 72.0 91.0 66.1 78.0 87.4 81.1 63.1 96.2

11.1 1.2 9.5 1.6 1.9 2.0 0.5 1.5 0.4

0.000863 0.273322 0.002055 0.205903 0.168078 0.157299 0.479500 0.220671 0.527089

Total

60.9

80.9

82.7

0.000000

80.9

76.7

a

Table 3. Correlation analysis between X-B association at different meiotic stages and the assortment ratio shown by both univalents

% X-B Associationa 2

2

5.61

0.017858

L, leptotene; Z, zygotene; EP, early pachytene.

Comparisona

r

t

df

Pb

a. L b. Z c. EP d. LP e. DD f. MI

0.69037 0.49332 0.44668 0.69192 0.50710 0.79358

2.3375 1.3892 1.2229 2.3475 1.4412 2.9163

6 6 6 6 6 5

0.02902* 0.10707 0.13309 0.02863* 0.09981 0.01658*

a b

L, leptotene; Z, zygotene; EP, early pachytene; LP, late pachytene; DD, diplotene-diakinesis; MI, metaphase I. *Significant at the 5 % level.

significantly differing from the 1:1 ratio (¯2 = 11.39; df = 1; P = 0.00074). The result is an excess of secondary spermatocytes with either B and X, or none of them. This result is applicable to both BN1 and BN2. Consistently, in 692 metaphase II (MII) cells, 198 were XB, 205 00, 138 X0 and 151 0B producing a 1.39 ratio (¯2 = 19.41; df = 3; P = 0.00023). No significant differences occurred between MI, AI and MII (contingency ¯2 = 0.78; df = 2; P = 0.67706). Behaviour of the BN and X chromosomes during male prophase I To determine the causes of BN (both variants) and X assortment-distortion, their behaviour during prophase I was analysed in 9 males (Table 2; Fig. 3). Both the B and the X appeared as dense-staining bodies at the periphery of the nucleus during preleptotene and first prophase. Both elements could be associated (Fig. 1a–c) or free within the nucleus, but association was not random in all studied males that showed a parallel behaviour indicating a recurrent pattern: the frequencies of X/B association increased significantly from preleptotene to leptotene, and from this latter stage to zygotene where the maximum mean frequency was attained, reaching 100 % in two individuals. From zygotene onwards, the X/B association frequency decreased slowly although maintaining high mean levels during early, middle and late pachytene. This pattern is repeated in all analysed males although slight differences occur (contingency ¯2 = 30.85; df = 15; P = 0.0092). At diplotene/ diakinesis X/B association fell to a level comparable to preleptotene, while a very steep decline occurred between the latter stage and M I. As shown in Table 2, in 7 individuals the differ-

Fig. 3. Frequency of X-BN association (%) from preleptotene to metaphase I. PL, preleptotene; L, leptotene; Z, zygotene; EP, early pachytene; MP, middle pachytene; LP, late pachytene; D-D, diplotene-diakinesis; MI, metaphase I.

ence in X/B association between leptotene and zygotene was highly significant. An opposite result was obtained when zygotene and early pachytene stages were compared (Table 2). A further suggestion of the non-randomness of the X/BN association came from the data on correlation analysis shown in Table 3. Individual ratios of X/BN assortment were positively correlated to prophase I association at all stages, correlations being statistically significant in three cases (Table 3a, d, f). Therefore, prophase I X-BN association might condition their preferential assortment to the same pole in the first meiotic division.

Cytogenet Genome Res 106:295–301 (2004)

299 157

Presence of a NOR in the B chromosome of D. pratensis revealed by FISH In situ hybridisation with the rDNA pTa71 probe revealed the existence of two kinds of signal. A strong signal was present at the paracentromeric region of both homologues of the S8 bivalent which is known, by silver impregnation, to be usually associated to a pair of nucleoli at mitosis and meiosis (Bidau, 1986; Martı´, 2002) (Fig. 2a). A second, weaker, signal was always observed at the paracentric region of both BN chromosomes (Fig. 2b). No other autosome nor the X chromosome or the unstable B chromosomes assayed showed a hybridisation signal at any meiotic stage. The difference in intensity between the S8 and BN signals allowed their localisation and identification in all premeiotic, meiotic and spermiogenesis stages (Fig. 2). For example, spermatids of 1B individuals at different stages of maturation clearly showed one or two signals (of different size) at a 1:1 ratio, as expected from a Mendelian segregation rate for the B chromosome (Fig. 2c, d). It is interesting that when both signals were present, they were always observed near the centriole adjunct region of the spermatid (Fig. 2c, d) while no clustering of the Bs and S8 signals was apparent at any previous stage (i.e. preleptotene nuclei of Fig. 2e). In 0B individuals, the S8 signal was also observed always at the same position in spermatids (Martı´, 2002). Also, microspermatids with a weak signal were observed (Fig. 2d) indicating that they originated through anaphase lagging and micronucleus formation by the B chromosome. We cannot completely discard the possibility that some microspermatids carrying the fluorescent signals contained lagging S8 chromosomes. However, this is doubtful due to the very regular meiotic behavior of S bivalents in this species. Anyway, the proportion of such microspermatids would be negligible.

Discussion B chromosomes usually show non-Mendelian inheritance, so that their rate of meiotic transmission as univalents is higher than 0.5, which constitutes the basis for their parasitic nature (Camacho et al., 2000). A number of different B chromosome drive mechanisms have been described and these are the favoured explanation for B chromosome polymorphisms (Jones and Rees, 1982; Jones 1991; Camacho et al., 2000). Furthermore, some Bs may show meiotic distorted assortment with respect to other chromosomes of the A complement, especially sex chromosomes. Although few cases have been described (Fontana and Vickery, 1973; Lo´pez-Leo´n et al., 1996; Nokkala et al., 2000), they involved achiasmate association and non-independent assortment of the X and B chromosomes to opposite poles. In D. pratensis, however, the association of both elements leads to their preferential migration to the same spindle pole (Bidau, 1986). Furthermore, the behaviour of the BN chromosome is completely different from that of the mitotically unstable B chromosome also found in this species, since the unstable B shows no deviation from independent transmission with respect to the X (Bidau, 1987; Martı´, 2002). The most obvious explanation for X-B assortment-distortion in D. pratensis, is the non-random association of X and B

300 158

Cytogenet Genome Res 106:295–301 (2004)

during prophase I. Due to their usual heterochromatic nature, B and X chromosomes in the grasshopper Metaleptea brevicornis tend to associate achiasmatically during male first prophase, although random association and non significant differences between meiotic substages were observed (Grieco and Bidau, 1999). Moreover, in other grasshopper species, such as Phaulacridium vittatum and Eyprepocnemis plorans, where significant associations between B and X have been observed, both elements either segregated randomly (John and Freeman, 1975) or preferentially to opposite poles independently of previous degree of association (Lo´pez-Leo´n et al., 1996). In D. pratensis however, the association between both univalents clearly followed a recurrent pattern by which, in all individuals, the maximum degree of association was attained during zygoteneearly pachytene. Although the percent of X-B association decreased steadily toward MI, at which moment most associations had lapsed, a positive correlation seemed to occur between percent association at all stages and X-B assortment ratio. It is worth noting that, in the case of the only 2B individual found to date (Bidau, 1986), both B’s associated non-chiasmatically with high frequency during prophase I and segregated regularly at anaphase I, while associations between both Bs and the X were random. The frequent X-B meiotic association in D. pratensis might be interpreted as evidence that the BN chromosome derived from the X chromosome. If residual homology between both elements existed, for example, if both shared repetitive DNA sequences as in the grasshopper Eyprepocnemis plorans (Lo´pezLéon et al., 1996), X-B associations could be partly homologous and thus, not random. A likely candidate for a repetitive sequence on the Bs is ribosomal DNA, which has been found in B chromosomes with certain frequency (Bidau, 1986; Green, 1990; Cabrero et al., 1999; Camacho et al., 2000). In a previous paper (Bidau, 1986) it was described that the BN chromosome of D. pratensis was frequently associated to a nucleolus at its secondary constriction near the centromere in 1B and 2B individuals. The B thus provided an extra NOR in addition to the standard NOR of the species located in the S8 chromosome. The technique used was silver impregnation which, in grasshoppers, reveals nucleoli but not NORs during meiosis. Thus, inactive NOR sequences, which could be widespread within the genome, would have gone completely undetected by this method, whereas inactive rDNA sequences are sometimes widespread within the genome (Lo´pez-Leo´n et al., 1999; Dobigny et al., 2002). Our FISH analysis allowed us to determine that (1) both BN variants carry rDNA sequences which, as shown by silver impregnation (Bidau 1986), represent active NORs, (2) since the strength of the hybridisation signal is much weaker in BN than in S8, BN seems to carry less rDNA repeats than S8, and (3) the X chromosome does not harbour rDNA sequences despite showing a secondary constriction in an equivalent paracentomeric position as BN. The latter observation makes a direct derivation of BN from the X unlikely, despite their overall similarity and behaviour, and points to either a B origin from the only A chromosome harbouring rDNA (S8), by means of polysomy which is a widely accepted mechanism for B chromosome origin (Hewitt, 1979; Camacho et al., 2000), or else from a different A chromosome and later acquisition of the

rDNA through translocation. NOR regions are prone to continuous rearrangement and are likely places for breakage (Camacho et al., 2000). An interesting observation was that, in spermatids, the rDNA sequences of BN and S8 were localised very near one another in a specific nuclear region, although no evidence of co-localisation of both was obtained for meiotic or premeiotic stages. Such a close location might, in principle, facilitate chromosomal rearrangement between an ancestral B and S8. Recently, Cabrero et al. (2003) produced evidence that in the grasshopper Eyprepocnemis plorans although B chromosomes from Spanish and Moroccan populations derive from the X, those from Caucasian populations may have derived from the small S11 chromosome. Thus, further meiotic and molecular analyses are needed to establish the origin of B chromosomes of D. pratensis.

Acknowledgements We wish to thank very especially Dr. Ma. Jesus Puertas and Dr. Juan Luis Santos (Universidad Complutense de Madrid, Spain) for providing useful material and the rDNA probe for FISH analysis. Collection of specimens in difficult Patagonian areas was greatly facilitated by Dr. Kike Crespo (CENPAT, Puerto Madryn) and Ms. Ana Laura Zamit. We are also grateful to Rocı´o Hassan for critical reading of the manuscript. The expert comments of Dr. Juan Pedro Camacho and an anonymous reviewer substantially improved the original manuscript.

References Bell G, Burt A: B-chromosomes: germ-line parasites which induce changes in host recombination. Parasitology 100:S19–S26 (1990). Bidau CJ: A nucleolar-organizing B chromosome showing segregation-distortion in the grasshopper Dichroplus pratensis (Melanoplinae, Acrididae). Can J Genet Cytol 28:138–148 (1986). Bidau CJ: Influence of a rare unstable B-chromosome on chiasma frequency and nonhaploid sperm production in Dichroplus pratensis (Melanoplinae, Acrididae). Genetica 73:201–210 (1987). Bidau CJ, Martı´ DA: Geographic distribution of Robertsonian fusions in Dichroplus pratensis (Melanoplinae, Acrididae): the central-marginal hypothesis reanalysed. Cytogenet Genome Res 96:66–74 (2002). Bidau CJ, Martı´ DA: Clinal variation of body size in Dichroplus pratensis (Orthoptera: Acrididae): inversion of Bergmann’s and Rensch’s Rules. Ann Entomol Soc Amer 97 : in press (2004). Cabrero J, Lo´pez-Leo´n MD, Bakkali M, Camacho JPM: Common origin of B chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity 83:435–439 (1999). Cabrero J, Bakkali M, Bugrov A, Warchalowska-Sliwa E, Lo´pez-Leo´n MD, Perfectti M, Camacho JP: Multiregional origin of B chromosomes in the grasshopper Eyprepocnemis plorans. Chromosoma 112:207–211 (2003). Camacho JPM, Cabrero J, Lo´pez-Leo´n MD, Shaw MW: Evolution of a near-neutral B chromosome, in Henrı´ques-Gil N, Parker JS, Puertas MJ (eds): Chromosomes Today, vol 12, pp 301–318 (Chapman & Hall, London 1997a).

Camacho JPM, Shaw MW, Lo´pez-Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemys plorans. Am Nat 149:1030–1050 (1997b). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Camacho JPM, Cabrero J, Lo´pez-Leo´n MD, Bakkali M, Pefectti F: The B chromosomes of the grasshopper Eyprepocnemis plorans and the intragenomic conflict. Genetica 117:77–84 (2003). Chiavarino AM, Rosato M, Manzanero S, Jiménez G, Gonza´lez-Sa´nchez, M, Puertas MJ: Chromosome nondisjunction and instabilities in tapetal cells are affected by B chromosomes in maize. Genetics 155:889–897 (2000). Dobigny G, Ozouf-Costaz C, Bonillo C, Volobouev V: “Ag-NORs” are not always true NORs: new evidence in mammals. Cytogenet Genome Res 98:75– 77 (2002). Fontana PG, Vickery VR: Segregation distortion in the B chromosome system of Tettigidea lateralis (Say) (Orthoptera: Tetrigidae). Chromosoma 43:75–100 (1973). Gerlach WL, Bedbrook JR: Cloning and characterization of ribosomal RNA genes from wheat and barley. Nucleic Acid Res 7:1869–1885 (1979). Green DM: Muller’s ratchet and the evolution of supernumerary chromosomes. Genome 33:818–824 (1990). Grieco ML, Bidau CJ: Chiasma frequency and distribution in males and females of Metaleptea brevicornis adspersa (Acridinae, Acrididae) with and without B chromosomes. Hereditas 131:101–108 (1999).

Hewitt GM: Grasshoppers and Crickets, in John B (ed): Animal Cytogenetics 3. Insecta 1. (Gebrüder Borntraeger, Berlin 1979). John B, Freeman MGS: The cytogenetic structure of Tasmanian populations of Phaulacridium vittatum. Chromosoma 54:283–293 (1975). Jones RN: B-chromosome drive. Am Nat 137:430–442 (1991). Jones RN: Tansley Review no. 85: B chromosomes in plants. New Phytol 131:411–434 (1995). Jones RN, Rees H: B Chromosomes (Academic Press, New York 1982). Lo´pez-Leo´n C, Cabrero J, Camacho JP: Achiasmate segregation of X and B univalents in males of the grasshopper Eyprepocnemis plorans is independent of previous association. Chromosome Res 4:43–48 (1996). Lo´pez-Leo´n MD, Cabrero J, Camacho JPM: Unusually high amount of inactive ribosomal DNA in the grasshopper Stauroderus scalaris. Chromosome Res 7:83–88 (1999). Martı´ DA: Estudios sobre la Meiosis Masculina y Femenina en Especies Argentinas de Acrı´didos (Melanoplinae). Ph.D. Thesis. Universidad Nacional de Co´rdoba, Argentina (2002). Nokkala S, Kuznetsova V, Maryanska-Nadachowska A: Achiasmate segregation of a B chromosome from the X chromosome in two species of Psyllids (Psylloidea, Homoptera). Genetica 108:181–189 (2000). Zhong X, Fransz PE, Wennekes van Eden J, Zabel P, van Kammen A: High-resolution mapping on pachytene chromosomes extended DNA fibres by fluorescence in situ hybridization. Plant Mol Biol Rep 14:232–242 (1996).

Cytogenet Genome Res 106:295–301 (2004)

301 159

Structure and Origin of B Chromosomes Cytogenet Genome Res 106:302–308 (2004) DOI: 10.1159/000079303

X and B chromosomes display similar meiotic characteristics in male grasshoppers A. Viera,a A. Calvente,a J. Page,a M.T. Parra,a R. Go´mez,a J.A. Suja,a J.S. Rufas,a and J.L. Santosb a Departamento b Departamento

de Biologı´a, Universidad Auto´noma de Madrid; de Genética, Facultad de Biologı´a, Universidad Complutense de Madrid, Madrid (Spain)

Abstract. We have analysed the chromosome organisation and the location and temporal appearance of different proteins in X and B chromosomes in the grasshopper Eyprepocnemis plorans throughout the first meiotic prophase. We have used adult males that carry a B chromosome collected in natural Spanish populations. The scaffold organisation has been analysed by means of silver stained chromatid cores. In addition, we have detected by immunolabelling the presence of phosphoepitopes, the ensemble of cohesin axes, the location of his-

tone Á-H2AX, and recombinase Rad51. Our observations demonstrate that X and B chromosomes share similarities in chromatin organisation and in the expression of the tested proteins, which strongly differ from those of the autosomes. These results could be interpreted either as a support to the hypothesis that the Bs analysed here originated from the X chromosome, and/ or that their chromatin composition and precocious condensation could determine their meiotic behaviour.

Supernumerary, accessory or B chromosomes are additional dispensable chromosomes that are present in some individuals from certain populations in a wide range of animal and plant species, which have probably arisen from the A chromosomes, but follow their own evolutionary pathway (Beukeboom, 1994). Most of them have been considered as genome parasites maintained in natural populations by a variety of accumulation mechanisms (for review, see Jones and Rees, 1982; Jones, 1995; Camacho et al., 2000). B chromosomes are often similar to sex chromosomes in terms of meiotic behaviour, size, morphology and heteropyc-

notic cycle (Hewitt, 1979; Amos and Dover, 1981; Jones and Rees, 1982; Green, 1990). These similarities suggest that the molecular evolution of B chromosomes could be interpreted in the context of sex-chromosome evolution (Camacho et al., 2000). The B chromosome system of the grasshopper Eyprepocnemis plorans has revealed many details of B chromosome evolution (Henriques-Gil et al., 1984; Camacho et al., 1997). It has been hypothesised that the principal accessory chromosomes, e.g. B1, B2, B5 and B24 found in Mediterranean populations of this species, derived from the X chromosome because it is the only A chromosome showing the same order, with respect to the centromere, for a 180-bp satellite DNA and 18S-5.8S-28S ribosomal DNA (Lo´pez-Leo´n et al., 1994; Cabrero et al., 1999; Cabrero et al., 2003). To search for new insights on the relationship between the X and B chromosomes of this species, we have carried out a comparative study of the X, B1 and B24 chromosome organisation in male meiosis. This study refers to the structure of chromosome axes revealed by silver staining and to the immunolocalisation of different proteins: phosphorylated proteins, the cohesin subunit SMC3, histone Á-H2AX, and the recombinase Rad51. SMC3 is a member of the widely conserved structural

This work was supported by grants BMC2002-00043 and BMC2002-01171 from Ministerio de Ciencia y Tecnologı´a (Spain). Alberto Viera holds a fellowship from Fundacio´n General de la U.A.M. and Olympus España S.A. Adela Calvente and Rocı´o Go´mez were awarded by a predoctoral fellowship from U.A.M. Received 3 March 2004; manuscript accepted 4 April 2004. Request reprints from: Dr. J.S. Rufas, Departamento de Biologı´a Facultad de Ciencias, Universidad Auto´noma de Madrid Cantoblanco C/ Darwin, E–28049 Madrid (Spain) telephone: +34-914978241; fax: +34-914978344 e-mail: [email protected] A.V. and A.C. contributed equally to this work.

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0302$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

maintenance of chromosomes (SMC) family proteins (Hirano, 2002). It has been found to localize along the axial elements (AEs) and lateral elements (LEs) of the synaptonemal complex (SC) during prophase I in mammals (Pelttari et al., 2001). ÁH2AX is a form of H2AX histone, phosphorylated on serine 139, which in mammals appears around the sites of doublestrand breaks in processes such as apoptosis and meiotic recombination (Rogakou et al., 1998, 2000; Mahadevaiah et al., 2001). Á-H2AX staining has also been observed in sex bodies and round spermatids of the mouse ( Mahadevaiah et al., 2001; Ferna´ndez-Capetillo et al., 2003; Hamer et al., 2003) suggesting additional functions of H2AX phosphorylation during spermatogenesis. The RecA homologue Rad51 is a key factor in homologous recombination and recombinational repair in eukaryotes. Rad51 seems to display similar properties as RecA in DNA strand exchange (Shinohara et al., 1992). Mammalian spermatocytes exhibited Rad51 foci over the chromatin regions that are undergoing, or are about to undergo, synapsis (Barlow et al., 1997; Moens et al., 1997; Tarsounas et al., 1999).

Materials and methods Adult males of Eyprepocnemis plorans were collected at the Spanish localities of San Juan (Alicante) and Torrox (Ma´laga). The dominant B chromosome types in these populations were B1 and B24, respectively. B carrier specimens, with a single accessory chromosome, were selected analysing squash preparations of seminiferous tubules obtained by testis biopsy. Silver Staining Testes were removed and fixed in 3:1 ethanol-glacial acetic acid and stored at –20 ° C until required. Single follicles were squashed in a drop of 50% acetic acid, coverslips were removed after freezing in liquid nitrogen and slides were then air-dried. Slides were incubated in 2× SSC (1× SSC is 0.15 M NaCl, 0.015 M Na citrate) at 60 ° C for 15 min, rinsed thoroughly in tap water and air-dried. A drop of an AgNO3 solution (0.1 g of AgNO3 in 0.1 ml of distilled water adjusted to pH 3 with formic acid) was placed on each slide, covered with a coverslip and incubated in a moist chamber at 80 ° C. After 3 min the degree of staining was monitored under the light microscope. Finally, slides were rinsed in tap water, air-dried and mounted in Eukitt. Antibodies A monoclonal mouse anti MPM-2 antibody (Upstate) was employed to detect phosphorylated epitopes. A polyclonal rabbit anti-SMC3 antibody (Chemicon International) raised against a synthetic peptide from human SMC3 was used to detect SMC3. To detect Á-H2AX we used a monoclonal mouse antibody (Upstate) raised against amino acids 134–142 of human histone Á-H2AX (Paull et al., 2000). This sequence has 8 identical amino acids in yeast and mouse (Redon et al., 2002). A polyclonal rabbit anti-Rad51 antibody (Ab-1; PC130; Oncogene Research Products), generated against recombinant HsRad51 protein, was used to detect Rad51. All the antibodies used in the present study have previously been tested in E. plorans, in both immunfluorescence and immunoblot assays (Viera et al., 2004). Immunofluorescence microscopy Testes were removed and then processed for immunofluorescence as described by Page et al. (1998). The slides were incubated overnight at 4 ° C with primary antibodies: anti-MPM-2 at a 1:1000 dilution, anti-SMC3 at a 1:30 dilution, anti-Á-H2AX at a 1:500 dilution, and anti-Rad51 at a 1:30 dilution. Following three washes of 5 min in PBS, primary antibodies were revealed with the appropriate secondary antibodies conjugated with either FITC or Texas Red (Jackson), counterstained with DAPI and mounted with Vectashield (Vector Laboratories). For double-immunolabelling experiments of SMC3 with Rad51, slides were first incubated with anti-SMC3 for 1 h at room temperature, rinsed three times for 5 min in PBS and incubated

overnight at 4 ° C with an FITC-conjugated goat Fab) fragment anti-rabbit IgG (Jackson) at a 1:100 dilution in PBS. Afterwards, slides were rinsed six times for 5 min in PBS, incubated with anti-Rad51 for 1 h, rinsed three times for 5 min in PBS, and then incubated with a Texas Red-conjugated goat anti-rabbit IgG (Jackson) at 1:150 dilution. Observations were performed using an Olympus BX61 microscope equipped with a motorised Z axis and epifluorescence optics. The images were captured with a DP70 Olympus digital camera using the Olympus Analysis software and finally analysed and processed using the public domain ImageJ software (National Institutes of Health, USA; http://rsb.info.nih.gov/ ij) and VirtualDub (VirtualDub.org; http://www.virtualdub.com) and Adobe Photoshop 6.0 software.

Results Chromosome organisation in metaphase I condensed chromosomes At the first meiotic metaphase each silver-stained bivalent exhibited two round structures orientated to the opposite cell poles which correspond to closely associated sister kinetochores (Fig. 1A). A linear silver-stained structure which runs throughout almost the whole chromosome length was also observed (Fig. 1A). These threads correspond with the two intimately associated sister chromatid axes, which represents the meiotic scaffold (Rufas et al., 1987). These axes only became individualised at chiasmata sites. On the contrary, the X chromosome sister chromatid axes were individualised at each chromatid, running in parallel to each other. In this case, the axes only associated at both centromere and distal tips of the chromosome (Fig. 1A, B). The same scaffold disposition among sister chromatids was observed when B chromosomes were analysed (Fig. 1A, C). It is noteworthy that autosomal univalents, which appeared occasionally in some metaphase I cells, showed a similar scaffold organisation to that observed in autosomal bivalents (Fig. 1A). A different approach to chromosome organisation in metaphase I was performed using the MPM-2 antibody which labels phosphoepitopes. The antibody recognises a variable amount of phosphoepitopes, most of them being present in proteins which phosphorylated at the onset of mitosis including MAP2, HSP70, CDC25, and DNA topoisomerase II·. Accessory chromosomes B1 and B24 were unambiguously recognised because they presented a conspicuous DAPI-positive signal beyond the paracentromeric region that corresponds to the amount of the 180-bp DNA repeat (Fig. 1D). B1 is similar in size to the autosome M8, and possesses almost identical amounts of repetitive DNA and ribosomal DNA in the long arm. B24 is smaller in size but has additional 180 bp repeated sequences and has lost rDNA (Cabrero et al., 1999). At metaphase I plates, in addition to the deeply stained spindle poles, each autosomal bivalent showed intensely labelled homologous centromeres, facing to opposite poles. Some faint lines at the interchromatid domains were also discerned (data not shown; for details see Suja et al., 1999). By contrast, both X and B chromosomes shared some differential characteristics, namely: (1) both chromosomes presented a single labelled dot at their centromeric region (Fig. 1E), corresponding to the closely associated sister kinetochores; (2) no labelling was detected between sister chromatids in contrast to that showed by the autosomes (Suja et al., 1999).

Cytogenet Genome Res 106:302–308 (2004)

303 161

Fig. 1. Metaphase I chromosomes from B carrier males of Eyprepocnemis plorans. (A) Silver-stained metaphase I plate. Each bivalent displayed two labelled round structures and a single axis that showed its doubleness at chiasma sites. Note the differential axes staining between the autosomal univalents (arrows) and the X and B chromosomes. (B) Enlarged X chromosome with individualised sister chromatid axes. (C) Supernumerary chromosomes also displayed individualised chromatid axes. (D, E) Selected X and B chromosomes, from a single metaphase I plate, immunolabelled using an MPM-2 antibody. Phosphoepitopes (green) were only recognised as single dots at centromere regions. Chromatin was counterstained with DAPI (blue).

Fig. 2. Projections of several focal planes throughout different prophase I squashed spermatocytes from B carrier males of E. plorans immunolabelled against SMC3 (green). Chromatin was counterstained with DAPI (blue). X and B chromosomes are indicated in all cases by red and white arrowheads, respectively. (A, B) Leptotene spermatocytes displayed multiple short discrete SMC3 stretches all over the nucleus, including the X and B chromatin. (C, D) During zygotene, the axial elements of autosomes associated in pairs at the bouquet rearrangement basis. X and B chromosomes were also included in the bouquet conformation and displayed single axis. (E, F) Thick SMC3 filaments were discerned at fully synapsed autosomes. By contrast, X and B chromosomes showed a single unsynapsed axis. Note that the axis which corresponds to the B chromosome was thicker than that observed in the X chromosome. (G, H) Diplotene autosomes presented a fuzzy barbed wire-like SMC3 labelling. However, a straight labelling was present at X as well as in B chromosomes, it being less bright. (I, J) Selected X and B chromosomes from a diakinesis nucleus in which a straight SMC3 labelling was detected in both univalents.

304 162

Cytogenet Genome Res 106:302–308 (2004)

B chromosomes exhibit axial elements The characteristic positive heteropycnosity pattern shown by X and B chromosomes at prophase I spermatocytes allowed their unambiguous identification. Their chromatin appeared as bright and deeply dyed structures within DAPI-stained nuclei. Only those primary spermatocytes in which B chromosomes appeared separated from the sex chromosome (Fig. 2B, D, F and H) were chosen for the analysis of immunodetection of different proteins. Since the behaviour of the accessories B1 and B24 was similar in these type of studies, we will only describe those observations corresponding to B24. An accurately timing determination of the meiotic stages for each spermatocyte was realised by the immunolocalisation of SMC3. The cohesin subunit was found as axial structures at early leptotene, where it was present as short discrete stretches in all members of the complement including the B chromosome (Fig. 2A, B). Meanwhile zygotene progressed, the SMC3 labelling developed into thin regular lines, which firstly associated in pairs to form thick filaments, and progressively became polarised into a bouquet arrangement (Fig. 2C, D). On the contrary, X and B chromosomes only displayed a thin single axis throughout zygotene (Fig. 2C), even though they polarised to the bouquet basis. In pachytene spermatocytes thick SMC3 filaments appeared located over the fully synapsed autosomes, whereas on both X and B chromosomes only a thin SMC3 filament was discerned, which corresponds with a single unsynapsed axis (Fig. 2E, F). It is interesting to point out that at early pachytene the B axis was usually wider than that observed in the X chromosomes and thinner than those of the autosomal bivalents (Fig. 2E). When diplotene spermatocytes were analysed, fuzzy barbed wire-like SMC3 signals were observed over the autosomal axes. On the other hand, X chromosomes displayed straight linear SMC3 signals, of less intensity than those observed in the autosomes (Fig. 2G, H). Likewise, straight linear SMC3 signals were detected in B univalents (Fig. 2G), which showed, however, an intermediate brightness intensity between that shown by autosomal- and X chromosome axes. Both chromosomes maintained this labelling pattern at diakinesis (Fig. 2I, J). Thus, SMC3 labelling onto male B carrier specimens confirms that the X and B univalent chromosomes assemble single SMC3 axes at early leptotene, which are maintained throughout prophase I. Based on the results presented here we assume that the axes revealed by SMC3 allowed us to locate the unsynapsed axial elements (AEs) and the synapsed lateral elements (LEs) of the synaptonemal complex (see also Viera et al., 2004). X and B chromosomes shared the same histone H2AX phosphorylation patterns To analyse the expression of the histone Á-H2AX in the chromatin of B chromosomes throughout prophase I, we have performed an accurate identification of the spermatocyte staging. For this purpose we used the chromatin morphology revealed by DAPI staining, and the synaptic condition revealed by the immunodetection of the cohesin subunit SMC3. ÁH2AX signals became first detectable in all chromosomes, including the Bs at the leptotene-zygotene transition. Massive accumulations appeared located preferentially over the nuclear

portion where chromosome ends clustered before the initiation of autosomal synapsis. The number and intensity of the foci increased until mid zygotene, while broad synapsis occurred in autosomes. Afterwards, Á-H2AX signalling declined at synapsed regions but still encompassed the AEs at those regions of autosomes that had not yet achieved synapsis. When spermatocytes entered at pachytene, only a few discrete Á-H2AX foci rested over the fully synapsed LEs of autosomes, and they progressively disappeared until mid/late pachytene (data not shown; for details see Viera et al., 2004). In addition to the accumulations over autosomes, an extensive Á-H2AX labelling was found covering the unsynapsed AEs of the X and B chromosomes from leptotene-zygotene transition to mid/late pachytene. The last domains of phosphorylated histone H2AX that remained in mid-pachytene spermatocytes were associated with the X and B chromosomes, but appeared as an irregular ribbon inside of these masses (Fig. 3A–F). From late pachytene onwards no Á-H2AX staining was detected (data not shown). Differential loading of RAD51 to autosomes and to the X and B chromosomes A few discrete Rad51 foci appeared at chromosome axes at early zygotene but rose up to several hundred per nucleus, concomitantly to chromosome pairing and synapsis by mid-zygotene. Rad51 foci were broadly distributed in the close proximity to AEs/LEs in both unsynapsed and synapsed autosomal regions. Afterwards, by late zygotene the number of Rad51 foci dropped rapidly; meanwhile autosomal bivalents become fully synapsed, decreasing to five to fifteen foci in early pachytene, and disappeared completely from mid-late pachytene onwards. Rad51 foci were not associated to the chromatin of the single X chromosome at any prophase I stage (data not shown; for details see Viera et al., 2004). To ascertain whether the phosphorylation of H2AX histone in B chromosomes is followed by the recruitment of Rad51 (as it occurred in autosomes) or not (as observed for X chromosome) we performed double immunolocalisations of both SMC3 and Á-H2AX with Rad51. The major expression of Rad51 was observed at mid-zygotene spermatocytes, where multiple foci were located along the unsynapsed and synapsed AEs/LEs of autosomes. Afterwards, in late-zygotene various Rad51 foci remained in the autosomes (Fig. 3H, I), but were absent from the chromatin mass corresponding to the X chromosome (Fig. 3G, H). As regards to the supernumerary chromosomes it must be noted that a few Rad51 foci were sporadically located over the chromatin of the B chromosome but not close to its AE (Fig. 3H–J). Mid/late-zygotene spermatocytes doubly labelled against Rad51 and Á-H2AX demonstrated a correspondence between the number and location of Á-H2AX and Rad51 foci over autosomes (Fig. 3K, L). In striking contrast, the chromatin of both X and B chromosomes exhibited massive Á-H2AX staining which did not correspond to any Rad51 foci (Fig. 3K–N).

Cytogenet Genome Res 106:302–308 (2004)

305 163

Fig. 3. Projections of several focal planes from squashed spermatocytes of E. plorans immunolabelled against Á-H2AX, SMC3 and Rad51. Chromatin was counterstained with DAPI (blue). X and B chromosomes are indicated. (A, B, C) Standard midpachytene nucleus displayed a conspicuous Á-H2AX labelling (green) at the X chromosome. (D, E, F) B carrier pachytene nucleus displayed Á-H2AX labelling (green) at both X and B chromosomes. An irregular ribbon of Á-H2AX signaling was observed in X and B chromosomes (F). (G, H, I, J) Double immunolabelling of SMC3 (green) and Rad51 (red) in a late-zygotene spermatocyte. Rad51 foci were associated with the paired and unpaired axes of autosomes (H). By contrast, Rad51 foci were absent from the single axis of the X chromosome. A few Rad51 foci occasionally appeared nearby the single B chromosome axis (I, J). (K, L, M, N) Late zygotene nucleus doubled labelled against Rad51 (red) and Á-H2AX (green). Á-H2AX and Rad51 foci were observed in the autosomal chromatin (L). On the contrary, both X and B chromosomes exhibited Á-H2AX labelling (N), but no Rad51 foci were observed (M).

Discussion X and B chromosomes of E. plorans males showed a similar meiotic behaviour after silver staining and MPM-2 immunodetection. Thus, they are the only chromosomes of the complement in which separated silver-stained chromatid axes, except at centromere and telomere regions, appear (Fig. 1A–C). Besides, they only showed MPM-2 labelling at the centromere regions (Fig. 1D, E). Therefore, the phosphoepitopes recognised by the MPM-2 antibody were not located at the silverstained chromatid cores (Suja et al., 1999). Moreover, sister chromatid cohesion in X and B chromosomes was maintained

306 164

Cytogenet Genome Res 106:302–308 (2004)

in the absence of MPM-2 phosphoepitopes. These features demonstrated that the condensed meiotic structure of X and B chromosome at metaphase I is different from that of autosomes. The immunolocalisation of the cohesin subunit SMC3 indicated that X and B univalent chromosomes assemble single SMC3 axes throughout prophase I (Fig. 2). Assuming that these cohesin axes are subjacent to the chromosomal AEs (Pelttari et al., 2001; Viera et al., 2004) we can conclude that neither the X nor the B chromosomes self-synapse forming a synaptonemal complex (SC) as a tripartite structure. That is, they remain completely unsynapsed at zygotene-pachytene. These observa-

tions are in agreement with those obtained by SC surface spreading of grasshopper spermatocytes containing accessory chromosomes (unpublished data) but contrast, for instance, with the extensive non-homologous synapsis exhibited by rye B chromosomes at pachytene pollen mother cells (Santos et al., 1993; Jiménez et al., 1994). In mammals, non-homologous synapsis can affect chromosomes (or chromosomal regions) which are not already synapsed in order to satisfy synaptic requirements that are necessary for the correct progression of meiosis (Odorisio et al., 1998; Rodrı´guez and Burgoyne, 2000). It has been claimed that in these situations, unsynapsed whole chromosomes or chromosomal segments form thick axes at pachytene (Speed, 1984; Solari et al., 1989) surrounded by packed chromatin that may hinder the access of transcriptional enzymatic components (Eissenberg et al., 1985) or prevent nonhomologous synapsis (McKee and Handel, 1993). This situation could be related to the high wideness showed by the SMC3 axis of the B chromosome which may represent a thick AE, a feature especially evident when we analysed mid-pachytene spermatocytes (for instance see Fig. 2E). The X and B chromosomes of E. plorans males exhibited the same H2AX phosphorylation pattern from mid zygotene until late pachytene (Fig. 3C, F, L, N). During zygotene, the number of Á-H2AX domains decreased and their intensity declined, being concentrated on the chromatin associated with the last autosomal stretches of AEs to synapse and the X and B chromosomes. These findings strongly support the idea that H2AX phosphorylation in X and B chromosomes throughout meiotic prophase occurs in a manner independent of meiotic doublestrand breaks. This labelling pattern resembles the situation described in mouse sex chromosomes (Mahadevaiah et al., 2001; Ferna´ndez-Capetillo et al., 2003) and could be indicative of the implication of this histone variant in an ancient mechanism related to the meiotic sex chromosome inactivation. However, it is noteworthy that whereas Á-H2AX signal covers the X and Y chromatin in mouse at pachytene, in grasshoppers it is associated with the X and B chromosomes but appears as a conspicuous irregular ribbon inside the chromatin (Fig. 3L, N). Therefore, differences in meiotic chromatin organisation and/ or inactivation between mammals and grasshoppers could explain the different patterns observed if we assume a similar role for phosphorylated H2AX histone in sex and B chromosomes. In grasshopper spermatocytes Rad51 foci were distributed in close proximity to AEs/LEs of autosomal regions immediately after Á-H2AX labelling and, therefore, downstream of double-strand break (DSB) formation (Viera et al., 2004). Intriguingly, whereas the chromatin of both X and B chromosomes exhibits a broad Á-H2AX staining at mid-late zygotene, it is devoid of Rad51 foci. Indeed, Rad51 foci were not clearly associated with the chromatin of these chromosomes at any prophase I stage (Fig. 3H–N). On the contrary, the existence of numerous Rad51 foci at early pachytene on the unsynapsed axes of the X chromosome in mouse and rat spermatocytes has been reported (Ashley et al., 1995; Barlow et al., 1997; Moens et al., 1997; Mahadevaiah et al., 2001) and the Z chromosome in chicken oocytes (Ashley et al., 1995). This distribution is slightly different from that reported in humans, as both the X and Y

are intensely labelled with the exception of the region of the Y axial element that corresponds to its large heterochromatic block (Barlow et al., 1997). All these observations provide evidence that unsynapsed regions of mammalian sex chromosomes are not protected from meiotic DSBs. However, regarding the behaviour of human Y chromosome, it seems that precociously condensed meiotic chromatin regions are prevented from forming Rad51 foci (Barlow et al., 1997). In this sense, it is tempting to suggest that the absence of Rad51 foci on X and B chromosomes is a consequence of their early condensation (and likely inactivation) in the first meiotic prophase, which would take place before the occurrence of DSBs. On these grounds, it is clear that the phosphorylation of H2AX plays additional roles in male meiotic sex chromosomes of mammals (Mahadevaiah et al., 2001; Ferna´ndez-Capetillo et al., 2003) and grasshoppers (Viera et al., 2004), and also in B chromosomes (this paper). In conclusion, X and B chromosomes of the grasshopper E. plorans present in spermatocytes a similar chromatin organisation regarding the structure of chromosome axes revealed by silver staining and to the localisation of different proteins: phosphorylated proteins, SMC3, Á-H2AX and Rad51. These similarities can be interpreted either as additional findings that support the hypothesis that the Bs analysed here are derived from the X chromosome (Cabrero et al., 2003) or just as a reflection of a similar chromatin structure shared by these chromosomes at meiosis. Moreover, our group is currently extending the present characterisation analysis to “heat shock”-generated autosomal univalents, in order to determine whether the univalent condition itself may be implied, or not, in these differences.

Acknowledgements We are also indebted to Dr Juan Pedro Martinez Camacho and the Cytogenetic research team from Universidad de Granada (Spain) for kindly providing us the Torrox B carrier specimens used in this work.

Cytogenet Genome Res 106:302–308 (2004)

307 165

References Amos A, Dover G: The distribution of repetitive DNAs between regular and supernumerary chromosomes in species of Glossina (tsetse): a two-step process in the origin of supernumeraries. Chromosoma 81:673–90 (1981). Ashley T, Plug AW, Xu J, Solari AJ, Reddy G, Golub EI, Ward DC : Dynamic changes in Rad51 distribution on chromatin during meiosis in male and female vertebrates. Chromosoma 104:19–28 (1995). Barlow EL, Benson FE, West SC, Hultén MA: Distribution of the Rad51 recombinase in human and mouse spermatocytes. EMBO J 16:5207–5215 (1997). Beukeboom LW: Bewildering Bs: an impression of the first B-chromosome conference. Heredity 73:328– 336 (1994). Cabrero J, Bakkali M, Bugrov A, Warchalowska-Sliwa E, Lo´pez-Leo´n MD, Perfectti F, Camacho JPM: Multiregional origin of B chromosomes in the grasshopper Eyprepocnemis plorans. Chromosoma 112:207–211 (2003). Cabrero J, Lo´pez-Leo´n MD, Bakkali M, Camacho JPM: Common origin of B chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity 83:435–439 (1999). Camacho JPM, Shaw MW, Lo´pez-Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralised by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Eissenberg JC, Cartwright IL, Thomas GH, Elgin SCR: Selected topics in chromatin structure. Ann Rev Genet 19:485–536 (1985). Ferna´ndez-Capetillo O, Mahadevaiah SK, Celeste A, Romanienko PJ, Camerini-Otero RD, Bonner WM, Manova K, Burgoyne PS, Nussenzweig A: H2AX is required for chromatin remodelling and inactivation of sex chromosomes in male mouse meiosis. Dev Cell 4:497–508 (2003). Green DM: Muller’s rachet and the evolution of B chromosomes. Genome 33:818–824 (1990). Hamer G, Roepers-Gajadien LP, van Duyn-Goedhart A, Gademan IS, Kal HB, van Buul PPW, de Rooij DG: DNA double-strand breaks and Á-H2AX signaling in the testis. Biol Reprod 68:628–634 (2003).

308 166

Henriques-Gil N, Santos JL, Arana P: Evolution of a complex B-chromosome polymorphism in the grasshopper Eyprepocnemis plorans. Chromosoma 89:290–298 (1984). Hewitt GM: Grasshopper and crickets, in John B (ed): Animal Cytogenetics. 3. Insecta 1 Orthoptera pp 1–170 (Gebrüder Borntraeger, Berlin 1979). Hirano T: The ABCs of SMC proteins: two-armed ATPases for chromosome condensation, cohesion, and repair. Genes Dev 16:399–414 (2002). Jiménez MM, Dı´ez M, Santos JL: Synaptic patterns of rye B-chromosomes: The deficient B. Chromosome Res 2:93–98 (1994). Jones RN: B chromosomes in plants. New Phytologist 131:411–434 (1995). Jones RN, Rees H: B-chromosomes (Academic Press, London 1982). Lo´pez-Leo´n MD, Neves N, Schwarzacher T, HeslopHarrison JS, Hewitt GM, Camacho JPM: Possible origin of a B chromosome deduced from its DNA composition using double FISH technique. Chromosome Res 2:87–92 (1994). Mahadevaiah SK, Turner JM, Baudat F, Rogakou EP, de Boer P, Blanco-Rodriguez J, Jasin M, Keeney S, Bonner WM, Burgoyne PS: Recombinational DNA double strand breaks in mice precede synapsis. Nat Genet 21:271–276 (2001). McKee BD, Handel MA: Sex chromosomes, recombination and chromatin conformation. Chromosoma 102:71–80 (1993). Moens PB, Chen DJ, Shen Z, Kolas N, Tarsounas M, Heng HHQ, Spyropoulos B: Rad51 immunocytology in rat and mouse spermatocytes and oocytes. Chromosoma 106:207–215 (1997). Odorisio T, Rodrı´guez, TA, Evans EP, Clarke AR, Burgoyne PS: The meiotic check point monitoring synapsis eliminates spermatocytes via p53-independent apoptosis. Nat Genet 18:257–261 (1998). Page J, Suja JA, Santos JL, Rufas JS: Squash procedure for protein immunolocalisation in meiotic cells. Chromosome Res 6:639–642 (1998). Paull TT, Rogakou EP, Yamazaki V, Kirchgessner CU, Gellert M, Bonner WM: A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage. Curr Biol 10:886–895 (2000). Pelttari J, Hoja MR, Yuan L, Liu JG, Brundell E, Moens P, Santucci-Darmanin S, Jessberger R, Barbero JL, Heyting C, Höög C: A meiotic chromosome core consisting of cohesin complex proteins recruits DNA recombination proteins and promotes synapsis in the absence of an AE in mammalian meiotic cells. Mol Cell Biol 21:5667–5677 (2001).

Cytogenet Genome Res 106:302–308 (2004)

Redon C, Pilch D, Rogakou EP, Sedelnikova O, Newrock K, Bonner WM: Histone HA2 variants H2X and H2Z. Curr Opin Genet Dev 12:162–169 (2002). Rodrı´guez TA, Burgoyne PS: Evidence that sex chromosomes asynapsis, rather than an excess Y gene dosage, is responsible for the meiotic impartment of XYY mice. Cytogenet Cell Genet 89:38–43 (2000). Rogakou EP, Pilch DR, Orr AH, Ivanova VS, Bonner WM: DNA double-stranded breaks induce histone H2AX phosphorylation in serine 139. J Biol Chem 273:5858–5868 (1998). Rogakou EP, Nieves-Neira W, Boon C, Pommier Y, Bonner WM: Initiation of DNA fragmentation during apoptosis induces phosphorylation of H2AX histone at serine 139. J Biol Chem 275:9390–9395 (2000). Rufas JS, Giménez-Abia´n J, Suja JA, Garcı´a de la Vega C: Chromosome organisation in meiosis revealed by light microscope analysis of silver-stained axes. Genome 29:706–712 (1987). Santos JL, Jiménez M, Dı´ez M: Synaptic patterns of B-chromosomes. I. The standard type. Chromosome Res 1:145–152 (1993). Shinohara A, Ogawa H, Ogawa T: Rad51 protein involved in repair and recombination in Saccharomyces cerevisiae is a RecA-like protein. Cell 69:457–470 (1992). Solari AJ, Espinosa MB, Vitullo AD, Merani MS: Meiotic behaviour of gonosomically variant females of Akodon azarae (Rodentia, Cricetidae). Cytogenet Cell Genet 52:57–61 (1989). Speed RM: Meiotic configurations in female trisomy 21 foetuses. Hum Genet 66:176–180 (1984). Suja JA, Antonio C, Debec A, Rufas JS: Phosphorylated proteins are involved in sister chromatid arm cohesion during meiosis I. J Cell Science 112: 2957–2969 (1999). Tarsounas M, Morita T, Pearlman RE, Moens PB: RAD51 and DMC1 form mixed complexes associated with mouse meiotic chromosome cores and synaptonemal complexes. J Cell Biol 147:207–219 (1999). Viera A, Santos JL, Page J, Parra MT, Calvente A, Cifuentes M, Go´mez R, Lira R, Suja JA, Rufas JS: DNA double-strand breaks, recombination and synapsis: the timing of meiosis differs in grasshoppers and flies. EMBO Rep 5:385–391 (2004).

Structure and Origin of B Chromosomes Cytogenet Genome Res 106:309–313 (2004) DOI: 10.1159/000079304

An asymptotic determination of minimum centromere size for the maize B chromosome T.L. Phelps-Durr and J.A. Birchler Division of Biological Sciences, University of Missouri, Columbia, MO (USA)

Abstract. The maize B chromosome is a dispensable chromosome and therefore serves as a model system to study centromere function. The B centromere region is estimated to be approximately 9,000 kb in size and contains a 1.4 kb repeat that is specific to this centromere. When maintained as a univalent, the B chromosome occasionally undergoes centric misdivision. Consecutive misdivision analysis of the maize B chromosome centromere has generated a collection of functional centromeres that are greatly reduced in complexity. These

small centromeres are often correlated with strongly reduced meiotic transmission. Molecular analyses of the misdivision collection have revealed that the smallest functional maize B centromere is a minimum of 110 kb in size. Considering the collection as a whole, meiotic transmission becomes severely compromised when the estimated centromere size is reduced to a few hundred kilobases.

Proper chromosome segregation is a crucial regulatory step during eukaryotic cell division that is dependent on the ability of kinetochore proteins to recognize those sequences that specify the centromeres. The kinetochore proteins are conserved among species; however, the centromeric DNA sequences recognized by the kinetochore proteins vary widely. The least complex centromeres are the point centromeres of Saccharomyces cerevisiae. These centromeres are 125 bp in size and contain three essential DNA elements: CDEI, CDEII and CDEIII (Cottarel et al., 1989). CDEI and CDEIII have been shown to bind proteins that recruit kinetochore proteins and are essential to centromere function (Ng and Carbon, 1987). The centro-

meres of most species are referred to as regional centromeres and consist of several hundred kilobases of repetitive sequence. The centromeric organization of Schizosaccharomyces pombe varies among the three different chromosomes and between the same chromosome of different strains. The centromeres range from 35 to 100 kb in size and all contain a non-repetitive central core flanked by two classes of repetitive sequence (Baum et al., 1994). Studies of Drosophila centromeres have focused on deletion analysis of a minichromosome derived from the X chromosome. These studies revealed that a fully functional centromere is contained within a 420-kb region consisting of complex DNA surrounded by two types of short repetitive sequences interspersed with retrotransposons (Sun et al., 1997). Human centromeres are several megabases in size and are composed of large amounts of tandemly arrayed 171-bp sequence (Schueler et al., 2001). This sequence exhibits chromosome specific variation and a higher order repeat arrangement. Unlike regional centromeres, where the spindle fibers localize to one particular region of the chromosome, holokinetic centromeres have spindle fibers attached throughout the entire length of the chromatids. Such centromeres have been identified in nematodes. The conservation of kinetochore proteins but the extreme variability of underlying centromeric sequence has led to the

This work was supported by a grant from the National Science Foundation Plant Genome Initiative DBI 9975827 and a GAANN Fellowship to T.P. Received 14 September 2003; accepted 22 January 2004. Request reprints from: Dr. James A. Birchler, 117 Tucker Hall University of Missouri, Columbia, MO 65211 (USA) telephone: +1-573-882-4905; fax: +1-573-882-0123 e-mail:[email protected]. Present address of T.L. P.-D.: Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724 (USA)

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0309$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

speculation that centromere function is predominately controlled by an epigenetic mechanism where the underlying sequence forms a special chromatin structure recognized by the centromeric proteins (Karpen and Allshire, 1997). The formation of a specialized chromatin structure at centromeres is supported by the finding that a centromere specific H3 histone variant (CenH3) replaces H3 in the centromeric regions (Henikoff et al., 2001). This CenH3 is thought to co-evolve with the repetitive elements of each individual species and therefore accounts for the wide variation in centromeric sequences (Malik et al., 2002). Until recently, the structure of plant centromeres largely remained unknown. Several studies have now revealed that plant centromeres range in size from 400 to 9,000 kb and are primarily composed of tandemly arrayed sequence interspersed with retrotransposons. In Arabidopsis, the centromeres consist of a 178 bp tandemly arrayed sequence, ranging in size from 400 to 1,400 kb, interspersed with diverged copies of the long terminal repeat of the Athila retrotransposon (Copenhaver et al., 1999). Retrotransposons also seem to be a common and potentially essential centromeric component in several grass species where centromere specific retrotransposons have been identified (Aragon-Alcaide et al., 1996; Jiang et al., 1996). These centromere specific retrotransposons are members of the Ty3/gypsy class and are predicted to have a functional role in the centromere based on the observation that they interact with the centromere specific H3 (Zhong et al., 2002). Maize is an important system in which to study centromere function. The normal ten pairs of chromosomes, the A chromosomes, have centromeres that consist of a 150 bp tandemly arrayed sequence (Cent C) and retrotransposons that are specific and non-specific to the centromere (Nagaki et al., 2003). In addition, some lines of maize have neocentromere formation that results in the preferential segregation of that chromosome during female meiosis. Neocentromeres consist of a 180 bp tandemly arrayed sequence that only has centromere activity in the presence of an abnormal chromosome 10 (Peacock et al., 1981). The neocentromere unit shares homology with centromere sequences specific to chromosome 4 and the B chromosome centromere (Alfenito and Birchler, 1993; Page et al., 2001). B chromosomes are found in some lines of maize (Carlson, 1978). These chromosomes are non-essential, highly heterochromatic and accumulate by a non-disjunction process during the second pollen mitosis. B chromosomes can accumulate to many copies without a reduction in plant vigor (Randolph, 1941). The B chromosome contains no known genes; however, the short euchromatic tip is necessary for non-disjunction during the second pollen mitosis (Roman, 1947). The B chromosome centromere region is on the order of 9,000 kb in size and has been shown to contain a 1.4-kb centromere sequence present as degenerate tandem arrays (Kaszas and Birchler, 1996). This sequence is not present at the centromeres of A chromosomes so it is a formal possibility that this repetitive sequence has a role in the unusual behavior of the B centromere. Alternatively, it may act as a spacer among other centromeric elements in common with the other chromosomes. Analyses of a collection of B centromeres significantly rear-

310 168

Cytogenet Genome Res 106:309–313 (2004)

ranged and reduced in size through the process of centromere misdivision showed that the B specific repeat is present throughout the functional portion of the B centromere (Kaszas and Birchler, 1996). In addition, these studies found a correlation between the transmission frequency and the size of the B centromere (Kaszas and Birchler, 1998). In this study, consecutive misdivision division analysis of the B chromosome centromere was continued. This deletion analysis revealed that the smallest functional B centromere recovered to date is estimated at a minimum of 110 kb in size.

Materials and methods Generation of misdivision derivatives Misdivision derivatives were produced by successively maintaining the previously described misdivision products as univalent chromosomes in an otherwise c1 sh1 wx1 stock (Kaszas and Birchler, 1998). The B-9 chromosome is derived from a reciprocal translocation between the short arm of chromosome 9 and the B chromosome. This translocation links the B centromere to the dominant marker genes C1 and Sh1. In the previous study, the transmission frequencies of the B-9 chromosomes were determined from material thought to be euploid heterozygotes. This presumption was based on the assumptions that maintenance of the translocation through male transmission would select the euploid heterozygous state over a duplicated tertiary trisomic condition and the fact that the tested materials showed 21 chromosomes, which is the expected number of euploid heterozygotes. We now know, however, that these materials were in fact tertiary trisomics, which also have 21 chromosomes. The duplicated 9S region on the normal B-9 chromosome has no detrimental effect on male transmission; therefore over time the stocks were unwittingly converted to tertiary trisomic stocks. Nevertheless, the correlation of molecular structure and meiotic transmission still holds. Meiotic transmission rates were calculated from multiple crosses of a particular derivative in the 9 9 B-9 configuration to the tester line (c1 sh1 wx1). The transmission rate is the ratio of colored kernels to the total number of kernels for each cross. The B-9 chromosome may recombine with the normal chromosomes 9 to transfer the dominant markers C1 Sh1 to the normal chromosome. In this case, a colored plump kernel tested for the rate of transmission will exhibit a 1:1 segregation. This ratio can be recognized as distinct from the typical transmission rates of the chromosomes studied here with the exception of one centromere with increased size and meiotic stability (referred to as derivative 4–16); therefore, these ears were removed from the determination of transmission frequency. However, because the translocation breakpoint is only a few map units proximal to the c1 and sh1 loci and because recombination is apparently reduced in the chromosomal configuration used, these ears were rare. The standard deviation (SD) of the transmission rate was calculated by the formula SD2 = ™(x – a)2/(n – 1), where n is the number of individual ears of a particular derivative, x is the transmission rate, a is the mean of transmission values calculated over n individuals. Molecular analysis and high molecular weight DNA isolation Ten grams of macerated inner leaf tissue surrounding the immature tassel was digested at room temperature with 2 % cellulase (Worthington Biochemicals,) and 0.5 % pectinase (Sigma) in 50 ml of 0.7 M mannitol, 0.01 M CaCl2, pH 5.8. The solution was filtered through a 90 Ìm and 20 Ìm nylon mesh. The protoplasts were pelleted at 90× g for 10–15 min and were resuspended at 37 ° C in an equal volume of 1.6 % low melting point agarose made in 0.7 M mannitol, 0.01 M CaCl2, pH 5.8. With a wide bore pipet, the solution was transferred to BioRAD plug molds and allowed to solidify. The plugs were washed in ESP buffer (0.5 M EDTA pH 8.0, 1 % sodium Nlauroylsarcosine, 1 mg/ml proteinase K) at 50 ° C for 24 h. The plugs were then washed in T10E10 (10 mM Tris-Cl pH 8.0, 10 mM EDTA) at 50 ° C for 15 min with ten changes of T10E10. For restriction enzyme analysis, approximately 1/5 of the plug was equilibrated in the appropriate 1× enzyme buffer. All digests were performed in 150 Ìl of appropriate 1× restriction enzyme buffer with 200 units of enzyme. The digests were placed at 4 ° C on ice overnight and then placed at 37 ° C for 8 h. The DNA was then separated by

Table 1. The population of kernels screened in the identification of new misdivision derivatives Derivative

Transmissiona

Femaleb

Malec

Total Kernelsd

Mosaic Kernels

New Derivatives

iso 3-2 telo 3-3 telo 3-4 telo 3-4 telo 4-4 ring 4-9 telo 6-8 telo 6-9

48% 13% 49% 16% 10% NDe 32% 28%

87 119 26 102 71 17 37 41

43 39 16 23 41 8 10 10

20,800 27,000 7,500 21,200 22,700 5,850 9,825 9,850

2 6 3 7 3 2 2 1

0 0 1 2 1 1 1 1

Twenty-six mosaic kernels were identified out of the approximate total of 125,000 kernels that were screened. Of these twenty-six, seven represented a new centric misdivision. Transmission from Kaszas and Birchler (1998). b Number of times the derivative was used as a female in the test cross. c Number of times the derivative was used as a male in the test cross. d The total number of kernels produced from the crosses (male and female) was estimated by averaging the number of kernels produced on twenty ears for each derivative and multiplying by the number of crosses made. e Due to the inherent instability of ring chromosomes the transmission rate cannot be accurately determined. a

CHEF gel electrophoresis at 6V/cm in 0.5× TBE with a ramped pulse time from 1.8–5.1 s. After separation the DNA was nicked by UV crosslinking at 600,000 ÌJ for 2 min. DNA was transferred and immobilized to nylon membranes by standard protocols. For hybridizations, 500 ng of gel purified B specific repeat DNA was random prime labeled following the instructions provided with the DECAprime II DNA labeling kit (Ambion). The labeled DNA probe (1.6 × 106 cpm) was added for every milliliter of hybridization solution. Hybridizations were performed in 50 % deionized formamide, 5× SSC, 10× Denhardts, 0.5 % SDS, 0.2 mg/ml denatured salmon sperm DNA, 10 % dextran sulfate for 16 h at 42 ° C. The blots were then washed in 0.1× SSC, 0.1 % SDS at 65 ° C four times 15 min each.

Results Misdivision analysis of the B centromere Unpaired (univalent) centromeres have been reported to undergo misdivision during meiosis (Darlington, 1939). Centric misdivision occurs when, at the metaphase plate, the centromere of a univalent chromosome is attached to spindle fibers from both poles. During anaphase, tension is generated on the univalent centromere from both poles and this can result in centromere breakage. Broken centromeres undergo a breakagefusion cycle in the gametophyte but are healed in the sporophyte. Different types of chromosomes are produced depending on how the broken centromere is healed (Kaszas et al., 2002). When two broken sister chromatids are fused, an isochromosome is produced. Alternatively, the broken centromere can fuse to the telomeric end of the same chromosome forming a ring chromosome. Finally, telomeric sequences can be added to the broken centromere forming a telocentric chromosome. If the healed centromere still contains enough functional components, the chromosome will be transmitted to the next generation. The maize B chromosome can undergo centric misdivision (Carlson, 1970, 1973; Carlson and Chou, 1981). In the line of maize previously used for misdivision analyses, the B chromosome carries the dominant alleles of C1 and Sh1 translocated from the short arm of chromosome 9. The color gene C1 condi-

tions anthocyanin pigment in the endosperm when the dominant allele is present. When a breakage-fusion cycle is initiated due to B centromere misdivision, the B chromosome becomes mitotically unstable in the developing endosperm tissue when crossed as a male to the tester stock (Carlson, 1970, 1973; Carlson and Chou, 1981; Kaszas and Birchler, 1998). The instability creates a mosaic pattern in the endosperm where the loss of the B chromosome is apparent by the presence of colorless sectors. In the embryo of these mosaic kernels, the broken centromere is healed. The healed centromeres are stable and transmitted to the next generation if they contain functional centromeres. Selected members of the previously described collection of B chromosome centromeres (Kaszas and Birchler, 1998) were subjected to further misdivision. Some members of the collection have very low transmission rates and centromere size, for example, telo3-3. The centromere of telo3-3 was previously estimated to be on the order of 380 kb (Kaszas and Birchler, 1998). It was of interest whether further derivatives could be recovered from this chromosome accompanied by further reductions in centromere size. From all attempts, twenty-seven mosaic kernels were identified from approximately 125,000 kernels generated from test-crosses (Table 1). Seven new derivative centromeres were identified based on the molecular differences between the new derivative and the progenitor centromeres (Fig. 1). No derivatives were recovered from telo3-3 despite the fact that the largest screening population was devoted to it. The other mosaic kernels identified in this screen showed no change in centromere structure as compared to their respective progenitors. It is likely that these kernels represent mitotic loss of the B-9 chromosome during endosperm development for reasons other than the presence of an unhealed broken centromere. The centromeric rearrangements in the new derivatives vary from simple to quite complex as compared to the progenitors. For example, derivative 7-3 has only a single major fragment change as compared to its progenitor, telocentric 6-9, while derivative 4-16 has many more fragments than its pro-

Cytogenet Genome Res 106:309–313 (2004)

311 169

genitor, telocentric 3-5. Of particular interest to this study are the simplified centromeres of derivative 4-14 and derivative 5-4. These centromeres are greatly reduced in complexity, as compared to their progenitors, but still are transmitted. The size of the B centromeres was estimated by summing the size of each restriction fragment hybridized with the B repeat. The centromeres range in size from 110 to 1,165 kb (Table 2). The two smallest centromeres identified are derivative 4-14 and derivative 5-4 and have centromeres that are estimated at only 190 and 110 kb, respectively. As reported in the previous study (Kaszas and Birchler, 1998), there is a rough correlation between the size of the centromere and the transmission rate. The ability of these centromeres to function was assessed by determining the rate at which the B chromosome is transmitted to the next generation by crossing the new derivatives as males to the tester c1 sh1 wx1. As shown in Table 2 the transmission rate of the derivatives identified in this study range from 2.5 to 49 %. The smallest and least complex derivatives 5-4 and 4-14 are the least transmitted. However, since they are transmitted, they must have retained minimal centromeric function.

Discussion

Fig. 1. HindIII analysis of reduced B chromosome centromeres. High molecular weight DNA was isolated from various misdivision derivatives and comparisons of the centromere structure were made based on the hybridization of B centromere repeats. Molecular weight sizes (in kb) are noted at the top. The pedigree on the left indicates the relatedness of the consecutive misdivision derivatives. The names given to the various derivatives indicate the type of chromosome produced (telo, iso or ring) and the number of misdivisions events that generated the chromosome. The presence (+) or absence (–) of the centric knob found in the normal B chromosome centromere is indicated in parentheses.

Table 2. Size and transmission comparison of newly identified derivatives and the respective progenitor chromosomes

Progenitor

Size (kb)

Telo 3-4 (+) Telo 3-5 (+) Telo 3-5 (+) Telo 4-4 (–) Ring 4-9 (–) Telo 6-8 (–) Telo 6-9 (–)

518 484 484 526 394 374 374

The functional regions of plant centromeres have been difficult to assay due to the lack of sequence information and inability to perform deletion analysis. Whole genome sequencing has aided in the identification of some centromeric sequences but assembly of such highly repetitive regions remains technically difficult. Furthermore, sequence data does not provide information as to whether the sequence is sufficient for centromere function. In this study, the non-essential B chromosome of maize has been used to assay minimal centromere requirements through the process of consecutive centric misdivision. The results of this study suggest that the limits of centromere function as assayed by consecutive misdivision have been reached. The rate of identifying new derivatives has become

Transmissiona

Derivative

Size (kb)

Transmission

16%±4 16%±4 10%±3 NDb 32%±6 28%±15

4–13 4–14 4–16 5–4 5–5 7–2 7–3

750 190 1165 110 398 350 350

36%±2.0 2.5%±7.5 49%±3.7 5%±0.7 25%±1.4 12%±0.2 22%±5.1

The progenitor chromosomes are shown on the left with the estimated size of the centromere and transmission rate of the chromosome followed by the newly identified derivatives size and transmission rate. a Transmission rates as reported by Kaszas and Birchler (1998). b ND=not determined due to the inherent instability of ring chromosomes.

312 170

Cytogenet Genome Res 106:309–313 (2004)

very low compared to the recovery rate of misdivision derivatives of larger size (Kaszas and Birchler, 1998), suggesting that most further misdivision products do not retain enough sequence to specify centromeric function and are lost. The smallest functional maize B centromere identified through consecutive misdivision analysis is estimated to be 110 kb. This figure could be an underestimate if some restriction fragments do not contain a region homologous to the B specific repeat, which acts as a marker for the centromere. Other sequences are known to be interspersed (Alfenito and Birchler, 1993). Nevertheless, because of the interspersion of the B specific repeat throughout the B centromere, as noted above, it is likely that the centromeres in these cases are no more than a few hundred kilobases in size. In maize, multiple retroelements have been identified that are embedded in the centromeric repeats (Nagaki et al., 2003) together with the repetitive element Cent C. The retroelements are specific and non-specific to the centromere. The centromere specific retroelements are predicted to have a functional role in the centromere, because they have been shown to bind the centromere specific version of histone H3, CenH3 (Zhong et al., 2002). It is not known if the B specific repeat binds the centromere specific H3. Since the B repeat is maintained in the reduced functional centromeres, it does appear to be closely associated with the functional region, either as a component for kinetochore association or as a structural feature.

The origins of the B chromosome are unknown. Its presence in the genome may be the result of a wide species hybridization in which all of the chromosomes except for the progenitor B chromosome was lost. Alternatively, the B chromosome could be a relative of chromosome 4, a suggestion that is supported by the homology between the B centromere repeat and a centromere 4 associated sequence (Page et al., 2001). Regardless of the evolutionary origin, the B chromosome could not have been maintained without the presence of centromeric sequences that co-evolved with the maize CenH3. Further characterization of the B chromosome centromere may reveal which sequences have co-evolved with the CenH3 and allowed the B chromosome to be maintained in maize. Previous successive misdivisions have reduced the size of the B repeat cluster. The further attempts, reported here, have failed to reduce the size substantially beyond the previous estimates. This could be because misdivision is less likely with smaller centromeres, or alternatively because further reductions of the centromere can not be recovered. Previous estimates of the smallest B centromeres that could be recovered were slightly below 300 kb (Kaszas and Birchler, 1998). Centromeres estimated to be slightly smaller than this size were recovered in this study from those of larger starting size. These new derivatives, however, are extremely poorly transmitted. Taken together the results suggest that the minimal size for transmission through the life cycle and meiosis is on the order of a few hundred kilobases.

References Alfenito MR, Birchler JA: Molecular characterization of a maize B chromosome centric sequence. Genetics 135:589–597 (1993). Aragon-Alcaide L, Miller T, Schwarzacher T, Reader S, Moore G: A cereal centromeric sequence. Chromosoma 105:261–268 (1996). Baum M, Ngan V, Clarke L: The centromeric K-type repeat and the central core are together sufficient to establish a functional Schizosaccharomyces pombe centromere. Mol Biol Cell 5:747–761 (1994). Carlson WR: Nondisjunction and isochromosome formation in the B chromosome of maize. Chromosoma 30:356–365 (1970). Carlson WR: Instability of the maize B chromosome. Theor Appl Genet 43:147–150 (1973). Carlson WR: The B chromosome of corn. Ann Rev Genet 16:5–23 (1978). Carlson WR, Chou TS: B chromosome nondisjunction in corn: control by factors near the centromere. Genetics 97:379–389 (1981). Copenhaver GP, Nickel K, Kuromori T, Benito MI, Kaul S, et al: Genetic definition and sequence analysis of Arabidopsis centromeres. Science 286: 2468–2474 (1999). Cottarel G, Shero J, Hieter P, Hegemann J: A 125-basepair CEN6 DNA fragment is sufficient for complete meiotic and mitotic centromere functions in Saccharomyces cerevisiae. Mol Cell Biol 9:3342– 3349 (1989).

Darlington CD: Misdivision and the genetics of the centromere. J Genet 37: 341–364 (1939). Henikoff S, Ahmad K, Malik H: The centromere paradox: Stable inheritance with rapidly evolving DNA. Science 293:1098–1102 (2001). Jiang J, Nasuda S, Dong F, Scherrer CW, Woo SS et al: A conserved repetitive element DNA element located in the centromeres of cereal chromosomes. Proc Natl Acad Sci USA 93:14210–14213 (1996). Karpen GH, Allshire RC: The case of epigenetic effects on centromere identity and function. Trends Genet 13:489–496 (1997). Kaszas E, Birchler JA: Misdivision analysis of centromere structure in maize. EMBO J 15:5246–5255 (1996). Kaszas E, Birchler JA: Meiotic transmission rates correlate with physical features of rearraged centromeres in maize. Genetics 150:1683–1692 (1998). Kaszas E, Kato A, Birchler JA: Cytological and molecular analysis of centromere misdivision in maize. Genome 45:759–768 (2002). Malik H, Vermaak D, Henikoff S: Recurrent evolution of DNA-binding motifs in the Drosphila centromeric histone. Proc Natl Acad Sci USA 99:1449– 1454 (2002). Nagaki K, Song J, Stupar RM, Parokonny AS, Yuan Q, Ouyang S, Liu J, Hsiao J, Jones KM, Dawe RK, Buell CR, Jiang J: Molecular and cytological analyses of large tracks of centromeric DNA reveal the structure and evolutionary dynamics of maize centromeres. Genetics 163:759–770 (2003).

Ng R, Carbon J: Mutational and in vitro protein-binding studies on centromere DNA from Saccharomyces cerevisiae. Mol Cell Biol 7:4522–4534 (1987). Page BT, Wanous MK, Birchler JA: Characterization of a maize chromosome 4 centromeric sequence: evidence for an evolutionary relationship with the B chromosome centromere. Genetics 159:291–302 (2001). Peacock WJ, Dennis ES, Rhoades MM, Pryor AJ: Highly repeated DNA sequence limited to knob heterochromatin in maize. Proc Natl Acad Sci USA 78:4490–4494 (1981). Randolph LF: Genetic characteristics of the B-chomosomes in maize. Genetics 26:608–631 (1941). Roman H: Mitotic nondisjunction in the case of interchanges involving the B-type chromosome in maize. Genetics 32:391–409 (1947). Schueler M, Higgins A, Rudd M, Gustashaw K, Willard H: Genomic and genetic definition of a functional human centromere. Science 294:109–114 (2001). Sun X, Wahlstrom J, Karpen G: Molecular structure of a functional Drosophila centromere. Cell 91:1007– 1019 (1997). Zhong CX, Marshall JB, Topp C, Mroczek R, Kato A, Nagaki K, Birchler JA, Jiang J, Dawe RK: Centromeric retroelements and satellites interact with maize kinetochore protein CENH3. Plant Cell 14:2825–2836 (2002).

Cytogenet Genome Res 106:309–313 (2004)

313 171

Effects of B Chromosomes on the A Genome Cytogenet Genome Res 106:314–319 (2004) DOI: 10.1159/000079305

B chromosomes in hybrids of temperate cereals and grasses G. Jenkins and R.N. Jones Institute of Biological Sciences, The University of Wales Aberystwyth, Aberystwyth, Ceredigion, Wales (UK)

Abstract. B chromosomes are considered to be genetically inert, yet often have pronounced and surprising effects upon the A chromosome behaviour at meiosis in inter-generic and inter-specific hybrids. We review here our current knowledge of these effects in a number of different hybrids of the temperate cereals and grasses. Through hybridisation, many effects comparable to the pairing control system of wheat are uncovered,

Introduction When Mochizuki (1964) first reported that the B chromosomes of Aegilops mutica could suppress homoeologous pairing in the F1 hybrid of bread wheat (Triticum aestivum) × Ae. mutica a shiver of excitement passed down the “spine” of the wheat cytogenetics community, and a flurry of activity started to exploit the potential of this finding for practical applications in both the cereals and the grasses. The reasons for this shiver are clear enough to appreciate. The Pooideae family of the Poaceae contains many of the most agronomically important temperate cereals and grasses, such as wheat, barley, oats and ryegrass. Their high status as food for human consumption or as forage for animals has meant that over the years they have been the subjects of intense plant breeding and improvement programmes. These often involve inter-generic or inter-specific crossing of relatives, and the selection of hybrids showing desirable combinations of parental traits. However, the success of this strategy can be thwarted by reduction in the fertility or via-

Request reprints from: Dr. Glyn Jenkins, Institute of Biological Sciences Edward Llwyd Building, The University of Wales Aberystwyth Aberystwyth, Ceredigion SY23 3DA Wales (UK) telephone: +44-(0)-1970-622234; fax: +44-(0)-1970-622350 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0314$21.00/0

together with complex interactions of B chromosomes with hybrid host genotypes. We discuss the genetic and physical basis of the effects and try to make sense of them in terms of what we know about the origin and evolution of B chromosomes in plants. Copyright © 2004 S. Karger AG, Basel

bility of hybrids, the former of which can often be traced by routine cytological examination to aberrations in meiosis and the failure of chromosomes to recombine and segregate in a regular manner. Manipulation of chromosome pairing and recombination in hybrids is an obvious way around this problem, but unfortunately our knowledge of the genetic control of such systems is scant to say the least. Mochizuki’s work acted as a “primer” for a new kind of effort to ameliorate the frustrations of chromosome engineers. The story thus far is a mixed one. On the one hand it has not yet been possible to harness the power of the B chromosomes (Bs) in a way that leads to any desired outcomes for the diploidisation of allopolyploids, or to control their inheritance of Bs in order to achieve stability and neutral effects on other aspects of the phenotype. On the other hand, a new avenue of investigation has been opened up into the manifold mysteries of Bs, and this gives us new insights into ways in which they may exert their influence on the activity of the A chromosome genome. In addition, the term “pairing” is used throughout the review to mean chromosome association at metaphase I, with the exception of several references to presynaptic events and synaptonemal complex formation, which are obvious by their context. A number of crosses between members of the Pooideae has involved Bs. In some of these crosses the effect of Bs is unexpected and has no obvious utility, whereas in other crosses meiotic chromosome pairing is altered to such an extent that Bs

Accessible online at: www.karger.com/cgr

Table 1. Summary of the main effects of Bs in wheat × rye hybrids. In each case the wheat variety “Chinese Spring” has been used as the female parent, and the pollen has been contributed by rye plants with or without Bs. Effect of Bs

Reference

Bs caused a reduction in homoeologous pairing in hybrids with 2 Bs and zero or one dose of pairing control chromosomes 5B of wheat. Rye variety not named. Bs from Transbaikal rye entirely ineffective in compensating for the 5B effect in nulli-5B hybrids with 2 Bs, contrary to the effect on the A chromosomes. Transbaikal rye Bs. No compensation by the Bs for the absence of 3D (nulli-3D, disomic 3AABDR; and nulli-3D, disomic 3B-ABDR) or 5B (nulli-5B, disomic 5D-ABDR) pairing control chromosome of wheat. Rye strain not named. No effect of rye Bs on meiotic synchrony or chiasma frequency in nulli-5B or nulli-5D hybrids. Transbaikal rye Bs. Bs reduced homoeologous pairing slightly, whether 5B present or not. In nulli5D hybrids Bs raised pairing at 20°C; but at 10°C pairing was low anyway (due to the absence of the Ltp gene on 5D) and no effects of the Bs could be detected. Proposed that the rye Bs carry asynaptic gene(s), which decrease effective pairing; as well as independent post-synaptic gene(s) which increase chiasmata at effective pairing sites. Transbaikal rye Bs. Crossability of wheat × rye affected by the number of Bs in rye pollen. Rye plants with 2 Bs had greater crossability than those with 0 B or 4 Bs. Japanese JNK rye. Effect of the rye Bs depends on the function of the wheat chromosome which is absent in nullisomics. Bs suppressed pairing when the suppressing chromosomes 3A, 3D or 5B were missing, and promoted pairing when the promoter chromosomes 3B, 5A or 5D were absent. Japanese JNK rye. Comparison of 0B hybrids with 2n = 28 (ABDR) and hybrids with 2n = 28 + 2B (ABDR + 2B). B chromosomes were found to promote homoeologous pairing. Japanese JNK rye. Several hybrid combinations between rye and wheat ditelosomic for group 3 or 5 chromosomes of mutant ph2b. Bs decrease pairing in absence of wheat suppressors and increase it when wheat promoters are lacking. Japanese JNK rye. No effect of Bs on level of homoeologous pairing, but 3 and 5 Bs increase its variance.

(Feldman, 1971)

or their components may be potentially useful in restoring the fidelity of meiosis. In this review we catalogue and assess the effects of Bs in a variety of near and wide inter-generic and inter-specific crosses. We also detail some investigations of the B of diploid rye introgressed through recurrent backcrossing into hexaploid wheat, since this material provides an excellent opportunity to study the effects of a B in isolation in an alien genetic background, and may have some bearing on the general issue of Bs in inter-generic and inter-specific hybrids. Triticum aestivum is an allohexaploid with three constituent genomes derived from three related diploid species. At first metaphase of meiosis, pairing is restricted to homologous chromosomes within genomes, and there is exclusive bivalent formation. Homoeologous pairing is suppressed by a major suppressor locus (Ph) on chromosome 5B, as well as by several other minor genes including those on chromosomes 3A and 3D (Riley and Chapman, 1958). There are also a number of pairing loci, including those on chromosomes 3B, 5A and 5D, which counteract the suppressor genes and promote homoeologous pairing under certain conditions. Interest in Bs in relation to the pairing control system in hexaploid wheat was first aroused in 1964, as already mentioned, when it was reported that the Bs of Aegilops mutica could suppress homoeologous pairing in the F1 hybrid T. aestivum × Ae. mutica which was nullisomic for the 5B chromosome of wheat (Mochizuki, 1964). In other words, the B chromosomes could substitute for the 5B locus. Since that time there has naturally been much interest in exploring further the interaction between the pairing control genes in wheat and the B chromosomes contributed by related species, as well as investigations of the effects of Bs in hybrids between the related species themselves.

(Roothan and Sybenga, 1976) (Lelly, 1976)

(Neijzing and Viegas, 1979) (Viegas, 1980)

(Zeven and Keijzer, 1980) (Romero and Lacadena, 1980)

(Romero and Lacadena, 1980, 1982a,b)

(Cuadrado et al., 1991)

(Estepa et al., 1993)

Hybrids between wheat and rye Intergeneric hybridisation between wheat and rye has been used successfully for crop improvement, and the genotypic effects upon meiotic pairing of the particular rye cultivars used have been evaluated (Fedak and Gupta, 1991). In all of the wheat × rye hybrids involving B chromosomes made so far, the wheat variety “Chinese Spring” has always been used as the female parent, and the named pollen parent has always been one of two different rye strains – either Transbaikal rye or Japanese JNK strain. The main results of these investigations are summarised in Table 1, together with references. The results seem to be contradictory and confusing, and to present no consistent pattern for the way in which the B chromosomes of rye interact with the pairing control genes of hexaploid wheat. The only general conclusion that we can draw is that the rye Bs do appear to carry genetic elements that interact with the pairing control genes of wheat under some circumstances. The nature of these interactions depends, to some extent at least, on the source of the B chromosomes and the stringency of the experimental procedures. As Romero and Lacadena (1980) have pointed out many of the inconsistencies can be explained if it is assumed that the rye B chromosomes carry genes (and we should use the term “gene” advisedly) for both the suppression and the promotion of pairing, and that the effects which are manifested depend upon which wheat chromosomes are missing in the various nullisomic hybrids used. It is appropriate to refer in this section to Lindström wheat, which although not technically a hybrid, has a hybrid origin and contains introgressed Bs from rye (Lindström, 1965). Because the Bs comprise alien chromatin, they can be discriminated from the wheat chromosome complement by in situ

Cytogenet Genome Res 106:314–319 (2004)

315 173

Table 2. Summary of the main effects of Bs in hybrids between species closely related to hexaploid wheat

Hybrid

Effect of Bs

Reference

Ae. bicornis × Ae. mutica Ae. sharonensis × Ae. mutica T. timopheevii × Ae. mutica Ae. mutica × Ae. speltoides

Report on the occurrence of a B in the F1 hybrid. Origin of the B traced to the Ae. mutica parent. F1 hybrid produced carrying Bs of both species. Hybrids show meiotic spindle abnormalities. Bs of Ae. speltoides induced a striking decrease in homoeologous pairing.

(Mochizuki, 1957)

Ae. speltoides, with and without Bs: × T. dicoccoides × T. dicoccum × T. durum × T. araraticum Ae. mutica, with and without Bs: × Ae. longissima × Ae. comosa × Ae. caudata × Ae. speltoides Hordeum marinum × S. cereale

hybridisation with genomic DNA from rye or with B-specific probes (Hasterok et al., 2002). The ability to specifically label and track Bs in wheat has been put to good use in investigating interphase chromatin organisation, nuclear disposition and association of these chromosomes. Morais-Cecı´lio et al. (1996) showed that the Bs form linear strings, are predominantly cooriented with like ends together, and have a preference for association in pairs, the latter of which is not as pronounced as in their natural rye background (Morais-Cecı´lio et al., 1997). To what extent, if any, this tendency for Bs to associate in pairs is related to their capacity to cause diploidisation of A chromosomes is unknown. Bs have also been shown to reduce transcriptional activity and to alter condensation patterns of rDNA loci (Morais-Cecı´lio et al., 2000). Lindström wheat is also of interest for the manner in which the rye B behaves in the same way in its inheritance in wheat, namely nondisjunction at first pollen and first egg cell mitosis, as it does in rye, giving us an indication of its autonomous and “parasitic” nature. Hybrids between wheat and other Triticeae In the F1 hybrid between T. aestivum nullisomic for 5B and Ae. mutica with Bs, a suppression of homoeologous pairing by the Bs was first reported, although no detailed information was given (Mochizuki, 1964). More extensive investigations on the hybrids T. aestivum × Ae. mutica with Bs, and T. aestivum × Ae. speltoides with Bs showed that pairing control genes segregating on the standard A chromosomes of the two Aegilops species resulted in hybrids with different levels of meiotic chromosome pairing (Dover and Riley, 1972, 1977; Vardi and Dover, 1972). These pairing classes were not influenced by the presence of Bs of Aegilops. But in hybrids lacking the 5B pairing control chromosome, which normally have high frequencies of homoeologous association at first metaphase, there was complete failure of chiasma formation. In other words, the Bs of Aegilops substituted for the 5B chromosome. Further evidence for interaction between the Bs of Aegilops and loci on the A chromosomes of wheat has come from studies on T. aestivum × Ae. mutica and T. aestivum nulli-5D × Ae. mutica at low temperature (12 ° C). A significant drop in chiasma frequency, attributable to the Aegilops Bs was found in both of the hybrids

316 174

Cytogenet Genome Res 106:314–319 (2004)

(Vardi and Dover, 1972)

(Sano and Tanaka, 1980)

Pairing between A chromosome complements greatly reduced by the presence of Bs.

(Ohta and Tanaka, 1981)

2 Bs of rye promote homoeologous pairing.

(Linde-Laursen and Von Bothmer, 1997)

(Vardi and Dover, 1972). On the basis of these results for the wheat × Aegilops hybrids, Dover and Riley (1972, 1977) advanced the theory that the source of the 5B pairing control locus in wheat may have been the incorporation of a critical segment of an Aegilops B, possibly by translocation, into the genome of hexaploid wheat. A comparable effect was also noted in intergeneric hybrids between wheat and Agropyron cristatum and A. mongolicum. Without Bs, the A chromosomes of Agropyron interfere with the Ph system of wheat and permit extensive homoeologous association of wheat chromosomes (Chen et al., 1992). However, in the presence of Bs the Ph effect is restored and chiasmate association reduced (Chen and Jahier, 1993). Hybrids between relatives of wheat Table 2 summarises the effects on meiosis in hybrids of various relatives of wheat. In general, observations of these hybrids reinforces the evidence given above that the Bs of Ae. mutica and Ae. speltoides can reduce chromosome association during meiosis. The opposite is true of the barley × rye hybrid. In hybrids between Hordeum vulgare and rye with Bs, the Bs are actually eliminated, which would in this case thwart attempts to create a rye B introgression line of barley as has been achieved in wheat (Linde-Laursen, 1991). It is worth mentioning in this section that the indiscriminate pairing of the 4 Bs during meiosis in a hybrid between S. cereale with 2 Bs and its weedy relative S. segetale with 2 Bs has been interpreted to signify that the Bs of the two species have a monophyletic origin (Niwa and Sakamoto, 1995). Lolium hybrids Hovin and Hill (1966) were the first to report Bs in 10 out of 11 crosses between Lolium species, namely L. perenne × L. multiflorum, L. perenne × L. rigidum, L. multiflorum × L. loliaceum, L. multiflorum × L. persicum, L. multiflorum × L. remotum, L. multiflorum × L. strictum, L. rigidum × L. persicum, L. rigidum × L. remotum, L. rigidum × L. strictum and L. rigidum × L. temulentum. In most cases it was not known which parent contributed the Bs, because not all of the parent plants used in the crosses were screened cytologically. Meiosis

was reported as being similar in plants with and without Bs, whatever is meant by “similar”. Much of the work in this group of ryegrasses has centred upon hybrids between L. temulentum and L. perenne. These are closely related diploid species with 2n = 2x = 14. They are forage grasses, and much effort has been put into combining their complementary agronomic traits as allopolyploids, where chromosome pairing and fertility are an issue. Interestingly, these two species differ in nuclear DNA amount and chromosome size by about 50 %. Despite this disparity in size, in certain genotypes homoeologous chromosomes form high frequencies of effective bivalents at metaphase I of meiosis in the F1 hybrid. This is achieved largely through the elimination of synaptic irregularities and the confinement of chiasmata to homoeologously paired chromosome segments (Jenkins, 1985a; Jenkins and White, 1990; Jimenez and Jenkins, 1995). Certain wild populations of the L. perenne parent carry Bs, and these may contribute to the hybrids. These Bs are easily detected by light microscopy of conventional squash preparations, or by electron microscopy of synaptonemal complexes (Jenkins, 1985a, b, 1986; Jenkins and White, 1990; Jenkins and Jimenez, 1995; Jimenez and Jenkins, 1995), and by in situ hybridisation with genome-specific DNA sequences (Jenkins et al., 2002). Surprisingly enough, the Bs (Evans and Macefield, 1972, 1973), together with Ph-like genes in Lolium (Taylor and Evans, 1977), were found to promote chiasma formation between homoeologous chromosomes in hybrids (Evans and Davies, 1983, 1985). In the diploid, this has the effect of reducing chiasma frequencies through the prohibition of crossovers in homoeologously paired chromosome segments (Jenkins and Scanlon, 1987). The amphidiploid on the other hand is effectively diploidised by these factors. This is achieved not only by a restriction of synapsis to homologous pairs of chromosomes, but by a correction of multivalents during meiotic prophase before pairing associations are consolidated by chiasmata (Jenkins, 1986; Jenkins and Jimenez, 1995). The effect closely parallels the pairing control system in wheat, and offers the first real hope to plant breeders of genetically diploidising polyploid interspecific hybrids between grass species. In another interspecific hybrid, L. multiflorum × L. perenne, where the two parent species are much more closely related, the effect of B chromosomes was found to be much less dramatic. At the diploid level the Bs contributed by the L. perenne parent reduced both the frequency of chiasmata and the number of bivalents formed. But at the tetraploid level, there was no detectable alteration in the A chromosome pairing behaviour (Evans and Macefield, 1974). It is of interest that both parents of this hybrid are outbreeders and closely related. In the Lolium hybrids referred to above one of the species was an inbreeder, the other an outbreeder, which reminds us that in nature Bs are restricted to the outbreeders in all plant species. Lolium × Festuca and other grass hybrids Bs in the hybrid between L. perenne (2n = 2x = 14) and F. arundinacea (2n = 6x = 42) have been mentioned by Peto (1933), and reported in some detail by Bowman and Thomas (1973). In the F1 hybrid, Bs suppress homoeologous pairing in a similar fashion to those of the Lolium hybrids described above.

The effect is augmented by the segregation of diploidising genes from a particular genotype of the L. perenne parent (Evans and Aung, 1986). By contrast, no effects of the Bs on chiasma frequencies or pairing associations were observed in the hybrids of L. perenne × F. pratensis with Bs, and F. pratensis with Bs × L. multiflorum (Jauhar, 1975, 1976, 1977). In Briza media × B. elatior with Bs the presence of the Bs decreases the mean pollen mother cell chiasma frequency (Murray, 1976), whilst in colchicine-induced tetraploid hybrids of the same species, the Bs reduce homoeologous pairing, and cause some suppression of multivalent formation (Murray, 1978). Evidently the way in which Bs interact with the A chromosome genomes of hybrid plants has no common basis among different hybrids, which makes it all the more difficult to find any rational explanation for their effects.

Epilogue The story that emerges here is one of hopes being raised only to be dashed again, as the complexities of the system and the autonomous and aggressive nature of the Bs themselves comes into play. To a certain extent the optimism should always have been tempered with the knowledge that Bs have irregular modes of inheritance, a property that nobody has thus far succeeded in regularising, as well as seriously adverse effects upon fertility. Without some modification to these negative attributes their agronomic usefulness cannot be exploited, as in Lindström wheat, for example, where Bs may greatly enhance plant vigour and straw weight (Müntzing, 1973). Usefulness aside, these enigmatic effects of Bs on the pairing behaviour of A chromosomes raise new questions of fundamental biological interest: (1) are the effects really due to genes on the Bs, as some authors seem to assume? (2) could they result from epigenetic effects associated with nascent hybrids which carry Bs? or (3) could they have a physical basis due to the presence of extra chromatin modifying the nuclear environment? The latter, in terms of the physical basis, is also applicable to the way in which Bs interact with As in some diploid species by changing the frequency and distribution of chiasmata, an aspect which is dealt with in detail by Jones and Rees (1982) and Jones (1995). Suffice it to say here that in virtually all of the many species of plants and animals which have been studied with respect to the effects of B chromosomes on meiosis the Bs affect either the mean cell chiasma frequency of the As, or the distribution of chiasmata within the A complement; and in some cases there is an interaction between the Bs and As in these respects. As far as the operational basis is concerned, aside from the genotype effect, ultrastructural studies on the synaptonemal complex indicate that Bs do indeed cause some disorganization of order within the nucleus, as in rye (Dı´ez et al., 1993) and Crepis capillaris (Jones et al., 1991). In Hypochoeris maculata meiotic disturbances also include abnormalities of the spindle (Parker et al., 1978), but it is beyond the scope of this review to follow this avenue of recombination in diploids too far. The idea that Bs carry genes which regulate the behaviour of A chromosomes in hybrids in which as far as we know the Bs

Cytogenet Genome Res 106:314–319 (2004)

317 175

have not previously existed, is fanciful in evolutionary terms. In the first place we do not know that “genes”, in the way we understand this term, are actually involved in the B-induced diploidisation. It is accepted that A chromosomes have genes for pairing control, but even here we have yet to define such genes in terms of their molecular sequence organisation. The best we can say about Bs is that they have “genetic elements” which segregate with the whole of the B chromosome. Other than saying this the only way we can rationalise our thoughts is to assume that the Bs have in some way acquired these genetic elements from the parent species in which they naturally occur, either during their birth process or later by some exchange other than meiotic pairing. Even if this is the case then why should they acquire genes to do with meiosis and not with any other characters, since with rare exceptions Bs are devoid of genes anyway? Having painted this dark picture we can still see a chink of light in some new thoughts that are emerging about the origin of Bs in the plant world. In those species where molecular evidence on the sequence organisation of Bs is accumulating, namely maize, rye and the Australian composite Brachycome dichromosomatica, there is sequence evidence to support the notion that Bs arise as fragments of A chromosomes, and then “grow” themselves by the addition of new sequences which transform them into autonomous and independent chromosomes. In other words the initial fragment, centric or otherwise, acts as a platform that recruits additional and essential sequences, including centromeres, to endow them with their functional properties as B chromosomes (Jones and Houben, 2003). It is during this recruitment process that they could acquire genetic information that only later becomes obvious when they land in the new environment of a hybrid nucleus, and as far as we know this could also involve phenotypic effects which are less obvious than the drama of instant diploidisation. The spontaneous amplification of sequences which occurs in the dispensable Bs could involve coding as well as non-coding sequences derived from the A set. This scenario has its attractions, but it still leaves us with another layer of complexity to build into the situation which we now know to be a feature of nascent allopolyploids – namely instant genome re-structuring

in the F1 generation. In these new allopolyploids there is a plethora of genome changes that instantly occur, including structural changes, epigenetic effects, the loss, silencing or activation of previously quiescent sequences, mobile element activation, DNA methylation changes, elimination and re-arrangement of rDNA etc. (reviewed in Liu and Wendel, 2002). When we add B chromosomes into this melting pot, and nobody has yet done this, we can expect the pot to boil over. How this state of flux then leads to the diploidising effect is of course just speculation – but we are still left to wonder if Bs respond to hybridity with the same reactive force as the A chromosomes do? It would be intriguing to find out. Finally there is the physical dimension of dealing with alien genomes plus Bs in the nuclear world of a new hybrid. We can only surmise by what mechanism the presence of Bs could affect A chromosome pairing in such a situation, or indeed how they modify chiasma conditions in normal diploids, and how they might interact with specific A chromosome genotypes as they seem to do. Chromatin is a dynamic structure and the way it is subject to histone modification is particularly fascinating and influential in terms of the regulation of gene expression. How chromatin and genome integrity are modified by bringing together species of differing genome size and then by adding in Bs from one of the parents at the same time remains to be answered. What we do know is that histone acetylation patterns differ between the A and B chromosomes of B. dichromosomatica (Houben et al., 1997), and in all probability this will be the same in other plants including the cereals and grasses. What we do not know is if this difference has any meaning in terms of B effects in hybrids. The only thing we can be sure about is that the nuclear environment will be changed by the Bs, and this cannot be without consequences. Whichever genetic avenue we travel down to understand the role of Bs in modulating homoeologous pairing in hybrids, we end up with another question rather than with an answer. This is not a matter for disappointment though, because geneticists thrive on questions and there is an abundance of “fodder” awaiting those who wish to tackle this particular issue in the future.

References Bowman JG, Thomas H: B-chromosomes and chromosome pairing in Lolium perenne × Festuca arundinacea hybrid. Nat New Biol 245:80–81 (1973). Chen Q, Jahier JYC: The B-chromosome system of inner Mongolian Agropyron Gaertn. 2. Effects of Bs on homologous and homoeologous meiotic chromosome pairing. Caryologia 46:293–299 (1993). Chen Q, Jahier J, Cauderon Y: Enhanced meiotic chromosome pairing in intergeneric hybrids between Triticum aestivum and diploid inner Mongolian Agropyron. Genome 35:98–102 (1992). Cuadrado C, Romero C, Lacadena JR: Meiotic pairing control in wheat-rye hybrids 2. Effect of rye genome and rye B-chromosomes and interaction with the wheat genetic system. Genome 34:6–80 (1991).

318 176

Dı´ez M, Jimenez MM, Santos JL: Synaptic patterns of rye B chromosomes. II. The effect of the standard B chromosomes on the pairing of the A set. Theor Appl Genet 87:17–21 (1993). Dover GA, Riley R: Prevention of pairing of homoeologous chromosomes of wheat by an activity of supernumerary chromosomes of Aegilops. Nature 240:159–161 (1972). Dover GA, Riley R: Inferences from genetical evidence on the course of meiotic chromosome pairing in plants. Philos Trans R Soc Lond B 277:313–328 (1977). Estepa MA, Cuadrado C, Romero C: Odd-even effect of rye B-chromosomes on homoeologous pairing in wheat-rye hybrids. Caryologia 46:17–23 (1993). Evans GM, Aung T: The influence of the genotype of Lolium perenne on homoeologous chromosome association in hexaploid Festuca arundinacea. Heredity 56:97–104 (1986).

Cytogenet Genome Res 106:314–319 (2004)

Evans GM, Davies EW: Fertility and stability in induced polyploids, in Brandham PE, Bennett MD (eds): Kew Chromosome Conference II, pp 139– 146 (Allen and Unwin, 1983). Evans GM, Davies EW: The genetics of meiotic chromosome pairing in Lolium temulentum × Lolium perenne tetraploids. Theor Appl Genet 71:185–192 (1985). Evans GM, Macefield AJ: Suppression of homoeologous pairing by B chromosomes in a Lolium species hybrid. Nat New Biol 236:110–111 (1972). Evans GM, Macefield AJ: The effect of B chromosomes on homoeologous pairing in species hybrids. I. Lolium temulentum × Lolium perenne. Chromosoma 41:63–73 (1973). Evans GM, Macefield AJ: The effect of B chromosomes on homoeologous pairing in species hybrids. II. Lolium multiflorum × Lolium perenne. Chromosoma 45:369–378 (1974).

Fedak G, Gupta PK: Wide hybridization for cereal improvement cytogenetic studies with wheat-rye hybrids and triticale. Cereal Res Commun 19:59– 69 (1991). Feldman M: The regulation of chromosome pairing in inter-varietal, inter-specific and inter-generic hybrids of common wheat. EWAC Newsletter 3:2–4 (1971). Hasterok R, Langdon T, Taylor S, Jenkins G: Combinatorial labelling of DNA probes enables multicolour fluorescence in situ hybridisation in plants. Folia Histochem Cytobiol 40:319–323 (2002). Houben A, Belyaev ND, Leach CR, Timmis JN: Differences of histone H4 acetylation and replication timing between A and B chromosomes of Brachycome dichromosomatica. Chromosome Res 5:233– 237 (1997). Hovin AW, Hill HD: B-chromosomes, their origin and relation to meiosis in interspecific Lolium hybrids. Am J Bot 53:702–708 (1966). Jauhar PP: Chromosome relationships between Lolium and Festuca (Gramineae). Chromosoma 52:103– 121 (1975). Jauhar PP: Chromosome pairing in some triploid and trispecific hybrids in Lolium-Festuca and its phylogenetic implications. Chromosomes Today 5:165– 177 (1976). Jauhar PP: B-chromosomes in relation to forage breeding. International Advances in Breeding Research in Asia and Oceania (SABRAO) 3:34–39 (1977). Jenkins G: Synaptonemal complex formation in hybrids of Lolium temulentum × Lolium perenne (L.). I. High chiasma frequency diploid. Chromosoma 92:81–88 (1985a). Jenkins G: Synaptonemal complex formation in hybrids of Lolium temulentum × Lolium perenne (L.). II. Triploid. Chromosoma 92:387–390 (1985b). Jenkins G: Synaptonemal complex formation in hybrids of Lolium temulentum × Lolium perenne (L.). III. Tetraploid. Chromosoma 93:413–419 (1986). Jenkins G, Jimenez G: Genetic control of synapsis and recombination in Lolium amphidiploids. Chromosoma 104:164–168 (1995). Jenkins G, Scanlon MJ: Chromosome pairing in a Lolium temulentum × Lolium perenne diploid hybrid with a low chiasma frequency. Theor Appl Genet 73:516–522 (1987). Jenkins G, White J: Elimination of synaptonemal complex irregularities in a Lolium hybrid. Heredity 64:45–53 (1990). Jenkins G, Head J, Forster JW: Probing meiosis in hybrids of Lolium (Poaceae) with a discriminatory repetitive genomic sequence. Chromosoma 109: 280–286 (2002).

Jimenez G, Jenkins G: Lateral element lengths and nuclear disposition in Lolium. Heredity 75:273– 280 (1995). Jones GH, Albini SM, Whitehorn JAF: Ultrastructure of meiotic pairing in B chromosomes of Crepis capillaris. II. 4 B pollen mother cells. Chromosoma 100:193–202 (1991). Jones RN: B chromosomes in plants. New Phytol 131:411–434 (1995). Jones RN, Houben A: B chromosomes in plants: escapees from the A chromosome genome? Trends Plant Sci 8:417–423 (2003). Jones RN, Rees H: B chromosomes (Academic Press, New York 1982). Lelly T: The effect of supernumerary chromosomes of rye on homoeologous pairing in hexaploid wheat. Z Pflanzenzuecht 77:281–285 (1976). Linde-Laursen I: Barley × rye hybrids eliminating accessory chromosomes of rye. Hereditas 115:127– 132 (1991). Linde-Laursen I, Von Bothmer R: Effect of rye A and B chromosomes on meiotic association of Hordeum marinum ssp. gussoneanum (4x) chromosomes in intergeneric hybrids. Hereditas 127:193–201 (1997). Lindström J: Transfer to wheat accessory chromosomes from rye. Hereditas 54:149–155 (1965). Liu B, Wendel F: Non-mendelian phenomena in allopolyploid genome evolution. Curr Genom 3:489– 505 (2002). Mochizuki A: B chromosomes in Aegilops mutica Boiss. Wheat Inf Serv 5:9–11 (1957). Mochizuki A: Further studies on the effect of accessory chromosomes on chromosome pairing in Aegilops mutica. Jpn J Genet 39: 356 (1964). Morais-Cecı´lio L, Delgado M, Jones RN, Viegas W: Painting rye B chromosomes in wheat: interphase chromatin organization, nuclear disposition and association in plants with two, three and four Bs. Chromosome Res 4:195–200 (1996). Morais-Cecı´lio L, Delgado M, Jones RN, Viegas W: Interphase arrangement of rye B chromosomes in rye and wheat. Chromosome Res 5:177–181 (1997). Morais-Cecı´lio L, Delgado M, Jones RN, Viegas W: Modification of wheat rDNA loci by the rye B chromosomes: a chromatin organization model. Chromosome Res 8:341–351 (2000). Müntzing A: Effects of accessory chromosomes of rye in the gene environment of hexaploid wheat. Hereditas 74:41–56 (1973). Murray BG: The cytology of the genus Briza L. (Gramineae) III. B chromosomes. Chromosoma 59:73–81 (1976). Murray BG: B chromosomes and multivalent formation in tetraploid hybrids between Briza media and Briza elatior. Heredity 41:227–231 (1978).

Neijzing MG, Viegas WS: The effect of rye B chromosomes on meiotic stability of rye-wheat hybrids in normal, nulli-5B and nulli-5D background. Genetica 51:21–26 (1979). Niwa K, Sakamoto S: Origin of B-chromosomes in cultivated rye. Genome 38:307–312 (1995). Ohta S, Tanaka M: Reconsideration of the genome of Aegilops mutica based on the chromosome pairing in interspecific and intergeneric hybrids. Wheat Inf Serv 52:33–34 (1981). Parker JS, Ainsworth CC, Taylor S: The B chromosome system of Hypochoeris maculata. II. B-effects on meiotic A-chromosome behaviour. Chromosoma 67:123–143 (1978). Peto FH: The cytology of certain intergeneric hybrids between Festuca and Lolium. J Genet 28:113–256 (1933). Riley R, Chapman V: Genetic control of the cytologically diploid behaviour of hexaploid wheat. Nature 182:713–715 (1958). Romero C, Lacadena JR: Interaction between rye B chromosomes and wheat genetic systems controlling homoeologous pairing. Chromosoma 80:33– 48 (1980). Romero C, Lacadena JR: Effect of rye B-chromosomes on pairing in Triticum aestivum × Secale cereale hybrids. Z Pflanzenzuecht 89:39–46 (1982a). Romero C, Lacadena JR: Interaction between rye B chromosomes and wheat genetic systems controlling homoeologous pairing. Chromosoma 80:33– 48 (1982b). Roothan M, Sybenga J: No 5-B compensation by rye B chromosomes. Theor Appl Genet 48:63–66 (1976). Sano J, Tanaka T: Estimation of chromosomal homology between Aegilops speltoides and the tetraploid wheats by using B chromosomes. Jpn J Genet 55: 9–17 (1980). Taylor IB, Evans GM: The genetic control of homoeologous chromosome association in Lolium temulentum × Lolium perenne interspecific hybrids. Chromosoma 62:57–67 (1977). Vardi A, Dover GA: The effect of B chromosomes on meiotic and pre-meiotic spindles and chromosome pairing in Triticum/Aegilops hybrids. Chromosoma 38:367–385 (1972). Viegas WS: The effect of B chromosomes of rye on the chromosome association in F1 hybrids Triticum aestivum × Secale cereale in the absence of chromosomes 5B or 5D. Theor Appl Genet 56:193–198 (1980). Zeven AC, Keijzer CJ: The effect of the number of B chromosomes in rye on its crossability with wheat. Cereal Res Commun 8:491–494 (1980).

Cytogenet Genome Res 106:314–319 (2004)

319 177

Effects of B Chromosomes on the A Genome Cytogenet Genome Res 106:320–324 (2004) DOI: 10.1159/000079306

Different numbers of rye B chromosomes induce identical compaction changes in distinct A chromosome domains M. Delgado,a,b A. Caperta,a,b T. Ribeiro,a W. Viegas,a R.N. Jonesc and L. Morais-Cecı´lioa a Secça ˜o

de Genética, Centro de Botânica Aplicada à Agricultura, Instituto Superior de Agronomia, Tapada da Ajuda; de Humanidade e Tecnologias, Campo Grande, Lisboa (Portugal); c The University of Wales Aberystwyth, Institute of Biological Sciences, Aberystwyth, Wales (UK) b Universidade Luso ´ fona

Abstract. In rye each B chromosome (B) represents 5.5 % of the diploid A genome. Rye Bs have several nuclear to whole plant effects although they seem to bear no genes except for the ones that lead to their maintenance within a population. In this context, and considering that rye Bs are enriched in repetitive non-coding regions that build up heterochromatin (het), we investigated the influence of Bs on the organization of two chromatin fractions, namely the ribosomal DNA (facultative het) and satellite (non-het) domain of rye chromosome 1 by silver staining on root tip metaphase cells. The results show that rye Bs cause condensation both in the NOR and in the chromosome 1 satellite domain. Since the silver staining technique

used is indicative of the transcriptional activity of the NORs, the condensation observed at those loci demonstrates that the rRNA gene arrays are down-regulated in the presence of Bs, regardless of their number per individual. Furthermore, the organizational changes of metaphase NORs find parallel with the interphase organization of ribosomal chromatin, since the frequency of cells with intranucleolar condensed rDNA regions increases drastically and nuclear matrix attachment pattern is altered in the presence of the Bs. Our results show an identical effect of the Bs on the organization of two distinct chromosome domains displaying a presence/absence dichotomy.

A number of endo- or exophenotype characteristics have been correlated with the presence of B chromosomes (Bs) in rye. Rye is notable for the frequent occurrence of these chromosomes, which are found in many populations throughout its geographical range. The property of B non-disjunction at first mitosis in the male and female gametophytes, together with irregularities at meiosis, means that they can be either absent or

present in distinct numbers between different individuals of the same population (for review see Jones and Puertas, 1993; Jones and Houben, 2003). Rye Bs appear to have both heterochromatic and euchromatic domains, and whilst their profile is unique, they have no C-banding properties which distinguish them markedly from the As. The information so far available for DNA sequence composition shows that Bs are mostly composed of repeated DNA common to the As (Wilkes et al., 1995; Houben et al., 1996) with exception of two families of specific repetitive sequences, namely D1100 and E3900 (Sandery et al., 1990; Blunden et al., 1993; Langdon et al., 2000). These sequences exist in high copy number in the terminal part of the B long arm that corresponds to a characteristic prominent C-band. According to this description of the molecular organization of the rye Bs, these supernumerary chromosomes represent additional content of repetitive DNA sequences that usually organize into heterochromatin (het) domains (Houben et al., 1996), although some may escape the cytological analysis (Redi et al., 2001). Considering the referred effects of B chromosomes on nucleo-

Supported by the Fundaça˜o para a Ciência e Tecnologia (project POCTI /1999/AGR/ 34000). M. Delgado was supported by a PhD grant from Fundaça˜o para a Ciência e Tecnologia (PRAXIS XXI/BD/4522/94). Received 23 September 2003; manuscript accepted 3 December 2003. Request reprints from L. Morais-Cecı´lio, Secça˜o de Genética Centro de Botânica Aplicada à Agricultura Instituto Superior de Agronomia, Tapada da Ajuda 1349-017 Lisboa (Portugal); telephone: +351 21 365 32 81 fax: + 351 21 363 50 31; e-mail: [email protected] M.D. and A.C. contributed equally to this work

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0320$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

type features, along with their het nature, we investigated the influence of the presence of the Bs on two distinct chromatin domains located adjacently on rye chromosome 1, namely the ribosomal DNA loci and the satellite region. Previous analysis of different rye accession of B chromosomes showed that rDNA topology is altered in their presence, since the frequency of cells with condensed rDNA within the nucleolus drastically increases (Delgado et al., 1995). In fact, in contrast to wheat (Leitch et al., 1992; Morais-Cecı´lio et al., 2000) and pea (Shaw and Jordan, 1995), condensed rDNA in rye without Bs is restricted to perinucleolar blocks (Leitch et al., 1992; Delgado et al., 1995). Here, we show that this B effect is independent of the B number and is also manifested by condensation of metaphase NOR and chromosome 1 satellite domains and in the periodicity of rDNA attachment to the nuclear matrix.

Materials and methods Analysis of somatic cells was performed in meristems of seedling root tips from JNK rye plants with 0, 1, 2, 3 and 4Bs. Root tips were either fixed in 4 % (w/v) formaldehyde solution in PEM buffer and sectioned as described in Abranches et al. (1998), or colchicine treated in a 0.1 mg/ml solution for 4 h at 22 ° C to induce c-metaphases and then were fixed in 3:1 (v/v) absolute ethanol:glacial acetic acid. Unfixed root tips were also used to obtain nuclear halo preparations according to Allen et al. (1996). Tissue sections and nuclear halo preparations were hybridized with the rDNA probe pTa71 (a 9kb fragment from 45S rDNA gene sequence isolated from wheat, Gerlach and Bedbrook, 1979) and analyzed by confocal laser scanning microscopy. C-metaphase spreads were silver stained and hybridized with pTa71 following the procedure described in Caperta et al. (2002), and analyzed under light and epifluorescence microscopes. Silver staining and in situ hybridization were either performed in distinct preparations or sequentially in the same preparation, producing identical results. Length measurements of c-metaphase NORs and of satellites of chromosome 1 were performed using AxionVision measurement module 3.0.0.0 (Zeiss). For each level of analysis at least three plants from each genotype (0, 2 and 4 Bs) were used.

Results Bs induce condensation of NOR and chromosome 1 satellite domains NOR activity in JNK rye was evaluated on c-metaphases through silver staining. In all c-metaphase cells analyzed from plants without Bs, and from plants with distinct numbers of Bs, homologues of chromosomes 1 show a positive silver staining of the NOR (Ag-NOR), revealing that genes from both NORs are transcribed during the previous interphase (Figs. 1 and 2). However differences in the Ag-NOR length were observed between cells, indicating distinct levels of condensation of the

Table 1. Mean length (Ìm) of satellite and distinct types of Ag-NORs in plants with different numbers of B chromosomes

rDNA chromatin in metaphase chromosomes. In order to evaluate these differences the length of each NOR and its satellite was measured and compared. NORs were considered distended when longer than the satellite (Fig. 1) and condensed when shorter or equal to the satellite (Fig. 2). The results of this analysis are summarized in Table 1. This shows a difference between plants with and without Bs, with both satellite and NOR mean lengths being reduced in the presence of Bs. The frequency of condensed NORs is considerably higher in plants with Bs in relation to plants without Bs, and similar values were obtained for plants with 2 or 4 Bs. These results show that the presence of B chromosomes induces NOR condensation but that this effect is not directly related to the number of Bs present. Similarly the presence of B chromosomes is also related to a reduction in length of chromosome 1 satellite, revealing higher levels of chromatin condensation. Distended NORs analysed using sequential silver staining and FISH with the pTa71 probe show a complex internal organization. FISH labeling revealed a centromere-proximal condensed rDNA region and a distended region with faint labeling (Fig. 1B). In all distended NORs, a portion of the centromereproximal rDNA condensed region does not overlap with silver staining revealing a higher density of argeophilic proteins towards the telomeric end of the NOR (Fig. 1A). Since the presence of argeophilic proteins in the NOR is related to gene transcription, the stronger silver staining of the distal region of the NOR should result from more intense transcriptional activity in that domain. In this respect the homogeneous silver staining observed in condensed NORs (Fig. 2) must result from the high level of rDNA condensation that renders impossible the discrimination of differentially stained regions. The effect of the Bs on interphase rDNA organization is independent of B copy number Hybridization of preserved nuclei with pTa71 and analysis by laser-scanning confocal microscopy gave detailed information on the organization of the NOR at interphase. No hybridization signal was found apart from the nucleolus which is visualized due to reduced DAPI staining. The majority of the nuclei presented two blocks of ribosomal chromatin adjacent to the nucleolar periphery (Fig. 3 inset). Nuclei with only one perinucleolar block were very rare and in these nuclei no other pTa71 signal was detected (Table 2). Perinucleolar blocks were usually large with intense fluorescence, indicating a high level of rDNA condensation. Besides these perinucleolar blocks condensed rDNA was also detected inside the nucleolus (Fig. 3). The number of condensed sites of ribosomal chromatin located intranucleolarly, in contrast with the perinucleolar ones, is not constant and varies from one to more than ten.

No. of Bs

Satellite

NOR

Condensed NOR

%

Distended NOR

%

No. of cells

0 2 4

2.63 (±0.4) 1.55 (±0.2) 1.50 (±0.6)

2.82 (±1.8) 1.18 (±0.4) 1.13 (±0.1)

1.92 (±0.87) 1.06 (±0.26) 1.08 (±0.68)

52 95 88

3.81 (±0.76) 2.15 (±0.36) 2.23 (±0.19)

48 5 12

22 39 21

Cytogenet Genome Res 106:320–324 (2004)

321 179

Fig. 1. C-metaphase cell from 0B genotype after sequential silver staining and in situ hybridization with the rDNA probe pTa71 displaying distended NORs. (A) Simultaneous visualization of the NOR Ag-staining (brown, arrows) and pTa71 signal (red) showing that the centromereproximal rDNA condensed region does not overlap with silver staining. (B) DNA DAPI staining (blue) and pTa71 labeling (red) reveals a faint distended region towards the distal part of the NOR (arrowheads). Bar = 10 Ìm.

Fig. 2. C-metaphase cell with 2 Bs (arrowheads) after sequential silver staining and in situ hybridization with the rDNA probe pTa71 displaying condensed NORs (arrows). NOR Agstaining and pTa71 labeling (red) show colocalization. Bar = 10 Ìm.

Fig. 3. Interphase nucleus of a 4B plant after in situ hybridization with rDNA probe (red) and DAPI DNA staining (blue) showing two large rDNA condensed blocks in the periphery of the nucleolus together with several rDNA condensed regions inside the nucleolus. Inset – interphase nucleus of a 0B plant where the condensed rDNA is restricted to the two perinucleolar blocks. Bar = 5 Ìm.

Table 2. Frequency (%) of nuclei with distinct number of rDNA condensed regions in plants with different numbers of B chromosomes No. of Bs 0 1 2 3 4

No. of condensed rDNA regions per nucleusa 1

2

2.5 0 1.0 0 0

85.0 35.0 34.5 37.5 43.8

3 8.8 22.5 22.5 23.8 30.0

4 2.5 30.0 25.5 20.0 16.3

5

6

>6

1.3 5.0 10.5 8.8 7.5

0 5.0 4.5 7.5 1.3

0 2.5 1.5 2.5 1.3

No. of nuclei 80 40 200 80 80

a More than two condensed rDNA regions correspond to nuclei with condensed rDNA inside the nucleolus.

322 180

Cytogenet Genome Res 106:320–324 (2004)

Fig. 4. Meristematic root tip nucleus after histone extraction hybridized with rDNA probe pTa71 (red), showing rDNA labeling in the residual nucleus as well as uncoiled fibers in the nuclear halo. The hybridization signal is superimposed with DNA DAPI staining. Bar = 10 Ìm.

Table 3. Average length (Ìm) of the uncoiled rDNA fibers from the rye NOR locus in the nuclear halo preparations from plants with different numbers of B chromosomes Genotype

0Bs 2Bs 4Bs b +Bs a

No. of nuclei

12 26 17 43

Medium length of rDNA fibers (SD)

14.8 (±3.7) 10.9 (±4.1) 11.8 (±3.2) 11.2 (±3.9)

Significance of the difference a between genotypes b

2Bs

4Bs

+Bs

P = 0.006

P = 0.034 P = 0.363

P = 0.008

The significance of the difference in length of the extended rDNA fibers between genotypes was assessed using a two-tailed distribution Student’s t test. b Pooled results from 2B and 4B genotypes.

The frequency of nuclei with condensed rDNA in an intranucleolar position shows a drastic increase in the presence of B chromosomes (Table 2, 0B 12.5 %, 1B 65.0 %, 2B 64.5 %, 3B 62.5 % and 4B 56.2 %), corroborating the observations in spread nuclei (Delgado et al., 1995). The frequencies now obtained for nuclei with intranucleolar rDNA condensation both in plants without Bs and in plants with Bs are higher than that previously observed (5 % and 23–33 %, for 0 and +B genotypes respectively). This is probably due to the greater accuracy of confocal microscopy in the detection of spots of smaller size that can be scattered or overlapped in the perinucleolar condensed blocks in nuclei spreads. Nuclei from all genotypes were classified according to the total number of condensed rDNA sites per nucleus independently of their size, and these results are summarized in Table 2. A ¯2 analysis rejected the hypothesis of independence between the number of discrete condensed rDNA spots and the variation of B chromosome number (¯2 = 71.3, P = 0.00). However, when only +B genotypes are considered (¯2 = 7.8, P = 0.25) this analysis clearly indicates that the B chromosome effect upon interphase rDNA organization is not related to their number, but only to the presence or absence of these chromosomes. In addition, in +B genotypes the higher density of condensed rDNA inside the nucleolus is found in the nucleolar subregion closer to the perinucleolar condensed rDNA blocks indicating a tendency to condensation towards the centromere proximal part of the locus. Bs affect the periodicity of rDNA attachment to nuclear matrix The pTa71 hybridization pattern, after histone displacement, shows that the rDNA sequences within the chromosome 1 locus are distributed between the residual nucleus and the nuclear halo (Fig. 4). Two bright blocks are detected in the residual nucleus, close to the nucleolar periphery from which emanate extended threads of rDNA. The maximum length of the uncoiled threads of rDNA of each nuclear halo was measured. The average length was determined for each genotype revealing another difference between plants with and without B chromosomes (Table 3). The average length of the uncoiled rDNA fibers due to histone extraction is significantly higher in the 0B genotype than in the +Bs genotypes. On the other hand, this parameter does not show any significant difference between 2B and 4B plants.

Discussion The relation between positive metaphase NOR silver labeling and transcription of rRNA genes in the preceding interphase has long been established (Goodpasture and Bloom, 1975), and ever since silver staining has been extensively used to evaluate rDNA gene expression and to discriminate between actively transcribed and inactive rRNA gene loci (Jiménez et al., 1988; Zurita et al., 1998; Caperta et al., 2002). Silver labeling analysis of metaphase plates of JNK rye reveals strong silver bands in the NOR region of chromosomes 1, showing that both homologous NORs strongly contribute to nucleolus for-

mation, which is a general feature of diploid rye (Caperta et al. 2002). However, the presence of B chromosomes clearly induces a reduction in the absolute length of the secondary constriction, and thus in the length of the silver label, and also a reduction in the frequency of distended NORs indicating a reduction in rRNA gene expression. The size of Ag-signals in metaphase chromosomes was directly related to the transcriptional level of the NOR (Hubbel, 1985), and used as a parameter to compare NOR activity between homologous and nonhomologous loci (Hubbel, 1985; Zurita et al., 1998, 1999; Mandrioli et al., 1999; Morais-Cecı´lio et al., 2000; Caperta et al., 2002). In addition it is known that the presence in metaphase NORs of argeophilic proteins related to rRNA gene transcription is associated with reduced rDNA condensation (Jiménez et al., 1988; Heliot et al., 1997). The reduction of NOR transcription here observed is in agreement with early reports of B chromosome effects upon nuclear phenotype showing that the presence of Bs is associated with a depletion in RNA content (Kirk and Jones, 1970), that in view of the magnitude of the changes, was later attributed to the ribosomal fraction (Jones and Rees, 1982). The effects of the presence of Bs on metaphase chromosome structure are not limited to the NOR loci, as the length of the chromosome 1 satellite is also reduced in the presence of these chromosomes to a level that is not related to their number. A similar result was obtained by Jones and Rees (1968), where a shortening of metaphase A chromosomes was associated with the presence of Bs, and in this work also no significant differences were found between the effect of 4 or 8 Bs. Interestingly, the reduction in size of NOR silver labeling, and hence a reduction of rDNA gene transcription related with the presence of Bs, was also observed in the hexaploid wheat Lindström, a line with introgressed rye B chromosomes (Morais-Cecı´lio et al., 2000). As in the present work, no evident relation between the severity of the effect and the number of Bs present was found in this wheat line. Following this observation in metaphase chromosomes, the interphase results reveal that also the intranucleolar rDNA condensation induced by the Bs is independent of the number of these chromosomes. In 0B nuclei the rDNA organization pattern is identical to that described for rye cultivars without Bs (Leitch et al., 1992; Delgado et al., 1995; Caperta et al., 2002) where the condensed rDNA is essentially restricted to the outside of the nucleolus in peripheral position. Conversely in +B plants most of the nuclei show intranucleolar condensed rDNA with this organization being independent of number of Bs present. Although intranucleolar condensed regions could be found dispersed throughout the volume of the nucleolus, this situation was mainly restricted to nuclei with higher numbers of intranucleolar rDNA foci. In most nuclei, with few intranucleolar rDNA foci, this condensed rDNA tends to be localized towards the perinucleolar blocks, suggesting that rDNA condensation inside the nucleolus occurs primarily close to the perinucleolar heterochromatic rDNA. Considering that at interphase intranucleolar rDNA condensation is observed prominently towards the centromere side it seems reasonable to assume that a preferential rDNA expression towards the telomere is a characteristic feature of rye NORs, although the extent of global rDNA transcription, and thus rDNA decon-

Cytogenet Genome Res 106:320–324 (2004)

323 181

densation, can vary between distinct genotypes. The effects of Bs on the rDNA organization are also reflected in matrix attachment patterns. The alteration of the periodicity of attachment to the nuclear matrix observed in the rDNA sequences strongly suggests that different or additional attachment sites are recruited in the presence of Bs. Taken together the data obtained from metaphase silver staining and interphase in situ hybridization show a direct correlation between the decrease in nucleolar activity and the increase of intranucleolar condensed rDNA, associated with the presence of B chromosomes. The down regulation of rRNA gene expression by means of rDNA condensation is already related to lower levels of metabolic activity in differentiated cells (Shaw et al., 1993), and with NOR inactivation associated with nucleolar dominance (Neves et al., 1997; Lim et al., 2000).

Although rye Bs are mainly composed of repetitive DNA sequences that build up heterochromatin (Grewal and Moazed, 2003), our results do not show a dosage effect commonly associated with alterations in the total amount of het (Henikoff, 2000). In addition, at this level of analysis it is not patently an odd/even B number effect, frequently associated with the presence of rye Bs (Jones and Puertas, 1993). The effect of Bs upon rDNA and chromosome 1 satellite shows an absence/presence dichotomy, being independent of variation in their number. This suggests that the genome plasticity in terms of chromatin organization is limited in its scope, and that one or a few Bs are sufficient to reach a threshold.

Acknowledgements We are most grateful to Augusta Bara˜o for excellent technical assistance.

References Abranches R, Beven AF, Arago´n-Alcaide L, Shaw PJ: Transcription sites are not correlated with chromosome territories in wheat nuclei. J Cell Biol 143:5– 12 (1998). Allen GC, Hall G Jr, Michalowski S, Newman W, Spiker S, Weissinger AK, Thompson WF: High-level transgene expression in plant cells: effects of a strong scaffold attachment region from tobacco. Plant cell 8:899–913 (1996). Blunden R, Wilkes TJ, Forster JW, Jimenez MM, Sandery MJ, Karp A, Jones RN: Identification of the E3900 family, a second family of rye B chromosome specific repeated sequences. Genome 36: 706–711 (1993). Caperta A, Neves N, Morais-Cecı´lio L, Malho´ R, Viegas W: Genome restructuring in rye affects the expression, organization and disposition of homologous rDNA loci. J Cell Sci 115:2839–2846 (2002). Cuadrado A, Jouve N: Highly repetitive sequences in B chromosomes of Secale cereale revealed by in situ hybridisation. Genome37:709–712 (1994). Delgado M, Morais-Cecı´lio L, Neves N, Jones RN, Viegas W: The influence of B chromosomes on rDNA organization in rye interphase nuclei. Chrom Res 3:487–491 (1995). Gerlach WL, Bedbrook JR: Cloning and characterization of ribosomal RNA genes from wheat and barley. Nucleic Acids Res 7:1869–1885 (1979). Goodpasture C, Bloom SE: Visualization of nucleolar organiser regions in mammalian chromosomes using silver staining. Chromosoma 53:37–50 (1975). Grewal SIS, Moazed D: Heterochromatin and epigenetic control of gene expression. Science 301:798– 802 (2003) Heliot L, Kaplan H, Lucas L, Klein C, Beorchia A, Doco-Fenzy M, Menager M, Thiry M, O’Donohue MF, Ploton D: Electron tomography of metaphase nucleolar organizer regions: evidence for a twistedloop organization. Mol Biol Cell 8:2199–2216 (1997). Henikoff S: Heterochromatin function in complex genomes. Biochim Biophys Acta 1470:1–8 (2000).

324 182

Houben A, Kynast RG, Heim U, Hermann H, Jones RN, Forster JW: Molecular cytogenetic characterization of the terminal heterochromatic segment of the B-chromosomes of rye (Secale cereale). Chromosoma 105:97–103 (1996). Hubbel HR: Silver staining as an indicator of active ribosomal genes. Stain Technol 60:285–294 (1985). Jiménez R, Burgos M, Diaz de la Guardia R: A study of the Ag-staining significance in mitotic NORs. Heredity 60:125–127 (1988). Jones N, Houben A: B chromosomes in plants: escapes from the A chromosomes genome? Trends Plant Sci 8:417–423 (2003). Jones RN, Puertas MJ: The B-chromosomes of rye (Secale cereale L.), in Dhir KK, Sareen TS (eds): Frontiers in Plant Science Research, pp 81–112 (Bhagwati Enterprises, Dehli 1993). Jones RN, Rees H: The influence of B-chromosomes upon the nuclear phenotype in rye. Chromosoma 24:158–176 (1968). Jones RN, Rees H: B Chromosomes (Academic Press, London 1982). Kirk D, Jones RN: Nuclear genetic activity in B chromosomes rye, in terms of the quantitative interrelationships between nuclear protein, nuclear RNA and histone. Chromosoma 31:241–254 (1970). Langdon T, Seago C, Jones RN, Ougham H, Thomas H, Forster JW, Jenkins G: De novo evolution of satellite DNA on the rye B chromosomes. Genetics 154:869–884 (2000). Leitch AR, Mosgoller W, Shi M, Heslop-Harrison JS: Different patterns of r DNA organization at interphase nuclei of wheat and rye. J Cell Sci 101:751– 757 (1992). Lim KY, Kovarik A Matyasek R, Bezdek M, Lichtenstein CP, Leitch AR: Gene conversion of ribosomal DNA in Nicotiana tabacum is associated with undermethylated, decondensed and probably active gene units. Chromosoma 109:161–171 (2000).

Cytogenet Genome Res 106:320–324 (2004)

Mandrioli M, Manicardi GC, Bizzaro D, Bianchi U: NOR heteromorphism within a parthenogenic lineage of the aphid Megoura viciae. Chrom Res 7:157–162 (1999). Morais-Cecı´lio L, Delgado M, Jones RN, Viegas W: Modification of wheat rDNA loci by the rye B chromosomes: a chromatin organization model. Chrom Res 8:341–351 (2000). Neves N, Castilho A, Silva M, Heslop-Harrison JS, Viegas W: Genomic interactions, gene expression, DNA methylation and nuclear architecture. Chrom Today 12:182–200 (1997). Redi CA, Garagna S, Zacharias H, Zuccotti M, Capanna E: The other chromatin. Chromosoma 110:136– 147 (2001). Sandery MJ, Forster JW, Blunden R, Jones RN: Identification of a family of repeated sequences on rye B chromosome. Genome 33:908–913 (1990). Shaw PJ, Jordan EG: The nucleolus. Annu Rev Cell Biol 11:93–121 (1995). Shaw PJ, Rawlins DJ, Highett MI: Nuclear and nucleolar structure in plants, in Heslop-Harrison JS, Flavell RB (eds): John Innes Review – The Chromosome, pp 161–171 (Bios Scientific Publishers, Oxford 1993). Wilkes TM, Francki MG, Langridge P, Karp A, Jones RN, Forster JW: Analysis of rye B-chromosome structure using fluorescence in situ hybridization (FISH). Chrom Res 3:466–472 (1995). Zurita F, Jiménez R, Burgos M, Dı´az la Guardia R: Sequential silver staining and in situ hybridization reveal a direct association between rDNA levels and the expression of homologous nucleolar organizing regions: a hypothesis for NOR structure and function. J Cell Sci 111:1433–1439 (1998). Zurita F, Jiménez R, Dı´az la Guardia R, Burgos M: The relative rDNA content of the NOR determines its level of expression and its probability of becoming active. A sequential silver staining and in-situ hybridization study. Chrom Res 7:563–570 (1999).

Effects of B Chromosomes on the A Genome Cytogenet Genome Res 106:325–331 (2004) DOI: 10.1159/000079307

The odd-even effect in mitotically unstable B chromosomes in grasshoppers J.P.M. Camacho, F. Perfectti, M. Teruel, M.D. Lo´pez-Leo´n and J. Cabrero Departamento de Genética, Universidad de Granada, Granada (Spain)

Abstract. The odd-even effect, by which B chromosomes are more detrimental in odd numbers, has been reported in plants and animals. In grasshoppers, there are only a few reports of this effect and all were referred to as traits related to the formation of aberrant meiotic products (AMPs). Here we review the existing information about B chromosome effects on AMPs, chiasma frequency and the number of active nucleolus organizer regions (NORs) per cell. Polysomy for A chromosomes and B chromosomes are two kinds of chromosome polymorphism frequently found in grasshoppers. In some aspects, e.g. meiotic behaviour and mitotic instability leading to individual mosaicism (in the case of mitotically unstable Bs), polysomic As show similar characteristics to B chromosomes. In fact, polysomy is regarded as one of the main mechanisms for B chromosome origin. Here we review some features of meiotic

behaviour in known cases of polysomy and mitotically unstable Bs in grasshoppers, in looking for possible causes for the oddeven effect. In all these traits, the odd-even effect was apparent, although its appearance was not universal in any case, with variation among species or populations within the same species. The equational division and lagging of the extra chromosomes, when univalents, could favour the appearance of abnormal meiotic products, and the formation of bivalents, when there are two or more extra chromosomes, inhibits this process. Therefore, the odd-even effect might be a consequence of the concomitant operation of both aspects of extra chromosome meiotic behaviour. The possibility that the odd-even effect might result from an increase in cell stress generated by odd numbers is suggested.

One of the most intriguing aspects of B chromosome research is the dependence of their effects on whether they are present in odd or even numbers. Darlington and Upcott (1941) found that maize plants with odd numbers of Bs had more chiasmata than did plants with even B numbers. Jones and Rees (1982) explicitly named it the odd-even effect after find-

ing that the between-cell variance in the number of chiasmata in rye plants with odd number of Bs was significantly higher than that observed in plants with even numbers of B chromosomes. A similar odd-even effect has been detected, in a number of plants and animals, for traits such as protein and RNA amounts, dry nuclear mass, exophenotypic characters and fitness related traits (e.g. fertility) (for review, see Jones and Rees, 1982). In general, an odd number of B chromosomes is more detrimental than even numbers. Mitotically stable B chromosomes show the same number in all cells from the same individual. Mitotically unstable Bs, however, show conspicuous intraindividual variation for the B number due to their mitotic nondisjunction. Therefore, the individuals carrying mitotically unstable Bs are actually mosaic, for which reason, the odd-even effect only makes sense for traits that can be analysed cell by cell (e.g. chiasma frequency or other cytological traits), but not for traits measured in the whole

This study was supported by grants from the Spanish Ministerio de Ciencia y Tecnologı´a (BOS2003-06635) and Plan Andaluz de Investigacio´n, Grupo no. CVI165. Received 10 December 2003; manuscript accepted 28 January 2004. Request reprints from: Dr. J.P.M. Camacho, Departamento de Genética Universidad de Granada, 18071 Granada (Spain) telephone: +34-958-248925; fax: +34-958-244073; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0325$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. Analysis of the odd-even effect for chiasma frequency in Locusta migratoria

Odd B number

Even B number

Sample

Mean

SE

N

Mean

SE

N

Gabias 1983 field Gabias 1983 lab Gabias 1984 field Gabias 1984 lab Padul 1984 field Padul 1984 lab

14.42 14.72 13.61 13.57 14.56 13.88

0.13 0.13 0.21 0.12 0.18 0.13

122 272 57 200 39 64

14.19 14.59 14.31 13.69 14.02 13.34

0.12 0.12 0.24 0.09 0.12 0.09

137 191 45 289 49 88

Data taken from Viseras et al. (1988). N = Number of cells analysed.

organism (e.g. fertility, external morphology, etc.). In this paper, we review the available literature in grasshoppers in looking for the odd-even effect in mitotically unstable B chromosomes. In addition, and since polysomy is considered one of the most widely accepted pathways of B chromosome origin (Camacho et al., 2000), we review several cases of male germline polysomy to analyse whether the odd-even effect is, in some way, also manifested for these putative B chromosome ancestors.

Materials and methods All available literature on unstable B chromosomes and male germ line polysomy in grasshoppers was reviewed in looking for data amenable of analysis for the odd-even effect. Since individuals bearing both types of polymorphisms were mosaic, all traits were analysed at cytological level. These were chiasma frequency and the number of active nucleolus organizer regions NORs in diplotene cells, and the frequency of aberrant meiotic products (AMPs), i.e. macro- and micro-spermatic nuclei and spermatids. B chromosome and polysomy variation was mainly found among testis follicles, with scarce variation within follicles. Therefore macro- and micro-AMPs were scored separately in follicles with different number of extra chromosomes (Bs or A polysomics). A practical way of testing the odd-even effect is to compare the trait between cells with odd and even B numbers. The statistical tests employed were mixed cross-nested ANOVA for chiasma frequency in Locusta migratoria, with “environment” (i.e., caught in the field or bred in the lab) and “odd-even” as independent factors, and “individual male” as a variable nested within “environment”, following the linear model: Xijkl = Ì + Ùi + j + Ù ij + ™ ( )jk + Ù ™ ( )ijk + Âijkl where Ì is the overall mean, Ùi is the deviation due to the odd-even effect, j is the deviation due to the environment factor (lab vs field), Ù ij is the deviation due to the interaction of the odd-even effect with the environment factor, ™ ( )jk is the deviation due to the kth individual nested within the jth environment factor, Ù™ ( )ijk is the deviation due to the interaction of the ith oddeven effect with the kth individual nested within the jth environment factor, and Âijkl is the deviation due to the lth replicate (cell) within each odd-even effect-environment factor combination. In the grasshopper Dichroplus pratensis, Bidau (1987) reported data on chiasma frequency and AMPs in three males carrying a mitotically unstable B chromosome. With the data from Table 4 of this paper, we performed a two-way ANOVA with chiasma frequency as the dependent variable, male as a random factor and odd or even B number as a fixed factor. The data on the number of active NORs per diplotene cell in L. migratoria were compared by the Student’s t test, and the frequency of macro- and micro-AMPs in seven species (see Table 4) were compared between follicles with odd and even number of extra chromosomes by means of the contingency chi-square test.

326 184

Cytogenet Genome Res 106:325–331 (2004)

Results Mitotically unstable B chromosomes The B chromosome in L. migratoria is mitotically unstable, with all variation essentially being inter- but not intrafollicular. A first data set on chiasma frequency in Cabrero et al. (1984) showed that mean chiasma frequency in diplotene cells from testis follicles with odd numbers of Bs (16.01, SD = 1.14) was not significantly different from that in follicles with even B numbers (15.93, SD = 0.96) (t test: t = 0.57, df = 10, P = 0.58). Later, Viseras et al. (1988) analysed chiasma frequency in males collected at two populations in the years 1983 (Gabias) and 1984 (Gabias and Padul). In all samples, field and laboratory-bred males were analysed. In these males, cells were found with up to six B chromosomes; we compared chiasma frequency between cells with odd (1+3+5) and even (2+4+6) numbers of B chromosomes. Cells with no B chromosomes (which were scarce) were not included in the analysis. Table 1 shows the mean chiasma frequency in the six groups of males in cells with odd and even numbers of B chromosomes. Table 2 shows the results of mixed cross-nested ANOVAs performed on the data in Table 1. It was apparent that individual differences affected chiasma frequency in all populations, an expected result. In addition, environment (lab or field) and odd-even affected chiasma frequency in the Padul population, with cells harbouring odd B numbers showing, on average, about 0.5 more chiasmata than cells with an even number of Bs (see Table 1). In Gabias, however, this effect was not apparent, but there was a significant interaction between odd-even and male in the two years analysed (see Table 2), suggesting that the odd-even effect is dependent on male genotype. The analysis of chiasma frequency in Dichroplus pratensis showed close to significant differences among males (F = 17.84, P = 0.053), but an odd-even effect was not apparent (F = 0.03, P = 0.86). Salcedo et al. (1988) analysed the number of active NORs in diplotene cells from L. migratoria male parent and offspring from a laboratory cross performed with a couple from Gabias and another from Padul. The odd-even effect appeared only in the Gabias offspring, with cells bearing an odd number of Bs showing a significantly lower number of active NORs than cells with an even B number (Table 3). The effect, however, was not consistent among populations or generations, although the available sample size in the male parents was actually low (in fact, a single male parent was analysed in each population).

Table 2. Mixed cross-nested ANOVA for chiasma frequency in Locusta migratoria (data from Table 1) (a) Gabias 1983

Type of effect

SS

df

MS

F

P

Environment Male (Environment) Odd-Even Environment x Odd-Even Odd-Even x Male (Environment) Error

Fixed Random Fixed Fixed Random

6.18 796.16 0.66 0.00 70.78 1111.33

1 23 1 1 22 681

6.18 34.62 0.66 0.00 3.22 1.63

0.287 10.264 0.251 0.000 1.972

0.596788 0.000001 0.619581 0.989431 0.005194

(b) Gabias 1984

Type of effect

SS

df

MS

F

P

Environment Male (Environment) Odd-Even Environment x Odd-Even Odd-Even x Male (Environment) Error

Fixed Random Fixed Fixed Random

14.64 652.44 0.98 2.95 71.96 647.89

1 24 1 1 21 543

14.64 27.18 0.98 2.95 3.43 1.19

0.912 6.816 0.381 1.147 2.872

0.348673 0.000053 0.541659 0.292449 0.000024

(c) Padul 1984

Type of effect

SS

df

MS

F

P

Environment Male (Environment) Odd-Even Environment x Odd-Even Odd-Even x Male (Environment) Error

Fixed Random Fixed Fixed Random

18.22 34.66 9.46 0.24 4.34 214.33

1 10 1 1 9 245

18.22 3.47 9.46 0.24 0.48 0.87

7.218 7.231 14.821 0.373 0.551

0.018593 0.003581 0.000405 0.544800 0.835975

Environment classified males into field and laboratory grown males. See Materials and methods of analysis for a detailed explanation.

Table 3. Analysis of the odd-even effect for the number of nucleoli in diplotene cells from Locusta migratoria males Odd B number

Even B number

Student t-test

Variance

F-ratio

Sample

Mean

SE

N

Mean

SE

N

t

df

P

Odd

Even

F

P

Gabias parent Gabias offspring Padul parent Padul offspring

6.20 6.88 7.31 8.64

0.57 0.24 0.38 0.38

15 48 13 25

4.00 8.10 7.00 8.80

0.55 0.23 0.63 0.20

5 51 6 55

2.10 3.62 0.44 0.41

18 97 17 78

0.05053 0.00047 0.66838 0.68611

4.89 2.88 1.90 3.57

1.50 2.77 2.40 2.27

3.26 1.04 1.26 1.57

0.26303 0.89280 0.68038 0.17018

Data from Salcedo et al. (1988). Those tests which remained significant after the sequential Bonferroni test are marked in bold type.

The formation of aberrant (micro- and macro-) meiotic products (spermatic nuclei and spermatids) has been scored in several grasshopper species with mitotically unstable B chromosomes. Micronuclei and microspermatids are presumably derived from chromosomes lost after irregular meiosis, whereas macronuclei and macrospermatids probably result from restitution nuclei in the presence of chromosome laggards during meiotic anaphases, or else nuclear fusion during spermiogenesis (Nur, 1969). Data on AMPs are known in eight species of grasshopper, seven of which are shown in Table 4. The trait was first analysed in Camnula pellucida by Nur (1969). His findings showed that the frequency of both kinds of AMPs was significantly higher in follicles with an odd (1 or 3) number of a mitotically unstable B chromosome (Fig. 1a and Table 4). In Locusta migratoria males carrying a mitotically unstable B chromosome, no macrospermatids and only 0.25 % microspermatids were found in follicles with 1B, even though 61.8 % of the B univalents divided equationally at the first meiotic metaphase. In Sphingonotus coerulans, the frequency of macrospermatids followed a clear odd-even pattern with respect to the number of

unstable B chromosomes, since follicles with an odd (1 and 3) number of B chromosomes showed a frequency significantly higher than that in follicles with an even (2 and 4) B number. The frequency of microspermatids, however, did not show such a difference (Fig. 1b and Table 4). In Cylindrotettix obscurus, B chromosomes also varied among 1 and 4 but, in this case, microspermatids showed a clear odd-even pattern and macrospermatids failed to show it (Fig. 1c and Table 4). In Psophus stridulus, Suja et al. (1989) reported a high frequency of macrospermatids and the absence of microspermatids in males carrying mitotically stable and unstable B chromosomes. This high frequency was especially apparent in individuals carrying the unstable B but, unfortunately, they did not distinguish between follicles with different number of Bs, so we were not able to analyse this case. In Aiolopus strepens, microspermatids were also absent, but the frequency of macrospermatids showed a clear odd-even pattern (Fig. 1d and Table 4). In Dichroplus pratensis, a highly significant odd-even effect was apparent for both macro- and microspermatids in two different males (Table 4). In Dichroplus elongatus, two populations were analysed, Tafi Viejo and Raco, for the frequency of macro- and

Cytogenet Genome Res 106:325–331 (2004)

327 185

Table 4. Frequency of aberrant meiotic products (AMPs) in grasshopper species carrying two kinds of extra chromosomes, i.e. mitotically unstable B chromosomes (B) or extra A chromosomes resulting from polysomy, and comparison between testis follicles with odd and even number of extra chromosomes Type of extra chromosome B B B B B B

B B Polysomy Polysomy Polysomy

Kind of AMP % in odd % in even

Species Camnula pellucida Nur, 1969 Locusta migratoria Cabrero et al., 1984 Sphingonotus coerulans Gosálvez et al., 1985 Cylindrotettix obscurus Confalonieri and Bidau, 1986 Aiolopus strepens Suja et al., 1987 Dichroplus pratensis, male no. 2 Bidau, 1987 Dichroplus pratensis, male no. 3 Bidau, 1987 Dichroplus elongatus from Tafi Viejo Clemente et al., 1994 Dichroplus elongatus from Raco Clemente et al., 1994; Remis and Vilardi, 1986 Atractomorpha similis Peters, 1981 Omocestus bolivari Viseras and Camacho, 1984, 1985 Chorthippus binotatus Talavera et al., 1990

2.24 0.13

% bivalent chi

P

125.38 95.17

< 0.0001 yes < 0.0001 yes

M m M m M m M m M m M m M m M m M m m

5.30 1.35 0 0.25 12.12 0.4 0.93 2.95 3.49 0 7.83 1.78 17.31 2.49 2.25 0.94 2.25 4.5

m

3.34

0.87

10.86

M m

4.71 5.66

4.68 1.71

0.12 43.95

6.35 0.29 0.72 0.35 1.61 0 2.97 0.31 6.01 0.59 0.65 0.17 2.38 1.25

odd>even % equational

47.23 0.69 1.33 84.17 101.24

< 0.0001 yes 0.41 0.25 < 0.0001 yes < 0.0001 yes

267.61 158.39 320.63 73.22 62.34 36.39 0.25 150.94

< 0.0001 < 0.0001 < 0.0001 < 0.0001 < 0.0001 < 0.0001 0.62 < 0.0001

0.001

yes yes yes yes yes yes yes yes

occurs

99

61.8

99.63

97.3

occurs occurs

92.68

no

>90

no lagging Bs

98.8

lagging Bs

94

occurs

yes

0.73 yes < 0.0001

Diplotene Metaphase I

8.45

99.1

100

100

100

100

96.84

48.44

The occurrence of equational division in anaphase I for the extra chromosomes, when univalents, and bivalent formation, when >1, is also indicated. M = macrospermatid; m = microspermatid.

microspermatids in males with an unstable B chromosome (Clemente et al., 1994). In Tafi Viejo, the odd-even effect was apparent for both macro- and microspermatids but, in Raco, it was only apparent for the frequency of microspermatids (Table 4). Male germ-line polysomy Several cases of germ-line polysomy have been reported in grasshoppers. This kind of chromosome polymorphism is characterised by the presence of extra A chromosomes in the male germ-line and their absence from somatic tissues and females. Intraindividual testis variation for these extra (E) chromosomes is similar to that shown by mitotically unstable B chromosomes, i.e. inter- but not intrafollicular variation. It is thus an appropriate material to compare with unstable B chromosomes. The first reported case was in the grasshopper Chorthippus parallelus. It was exhaustively studied but, unfortunately, none of the papers in the literature (Hewitt and John, 1968, 1970; John and Hewitt, 1969; Westerman, 1969, 1970) contains analyzable information with respect to the odd-even effect. A similar case of polysomy has been found in Gomphocerus sibiricus (Gosa´lvez and Lo´pez-Ferna´ndez, 1981), but no effect was also analysed. In the case of Atractomorpha similis, a clear odd-even effect was apparent from results shown in Fig. 6 of the paper by Peters (Peters, 1981), with follicles bearing odd numbers of E

328 186

Cytogenet Genome Res 106:325–331 (2004)

chromosomes showing higher frequency of spermatic micronuclei than follicles bearing even numbers of them. In Omocestus bolivari, the frequency of microspermatids followed an oddeven pattern (Fig. 1e and Table 4). In Chorthippus binotatus, the frequency of micronuclei showed a clear odd-even pattern, but that of macronuclei failed to show it (Fig. 1f and Table 4).

Discussion In all traits analysed, the odd-even effect eventually appeared, although its manifestation varied among populations. For instance, it was apparent for chiasma frequency in L. migratoria males from Padul but not in those from Gabias, although these latter showed a strong odd-even × male interaction suggesting a significant influence of male genotype on the manifestation of the odd-even effect in this population. The consistency of this result among the two years analysed reinforces this conclusion. The same contradictory results were found in D. elongatus for the frequency of macrospermatids, which showed the odd-even effect in Tafi Viejo but not in Raco (see Table 4). The observation of the odd-even effect for a trait in a species does not seem to imply that it necessarily appears for other traits. In L. migratoria from Padul, the odd-even effect was apparent for mean chiasma frequency but not for the number of active NORs. Likewise, in Dichroplus pratensis, the odd-

Fig. 1. Frequency (%) of macro- (solid line) and microspermatids (dotted line) (y-axis) in testis follicles with different number of mitotically unstable B chromosomes (x-axis) in (a) Camnula pellucida, (b) Sphingonotus coerulans, (c) Cylindrotettix obscurus, (d) Aiolopus strepens, and of polysomic A chromosomes in (e) Omocestus bolivari and (f) Chorthippus binotatus.

even effect was clearly manifested for AMPs but not for chiasma frequency. In those cases where the odd-even comparison was significant, the direction of the effect was always consistent with the observation that odd B numbers seem to be more detrimental (Jones and Rees, 1982). For instance, mean chiasma frequency in Padul males of L. migratoria was higher in cells with odd B numbers. Bearing in mind that chiasma frequency seems to be a trait sensitive to the presence of parasitic B chromosomes, as predicted by inducible recombination (see Bell and Burt, 1990; Camacho et al., 2003), the odd-even effect seems to indicate that Bs are more perceptible to cells when they are in odd numbers. Likewise, in the case of the number of active NORs in L. migratoria, the odd-even effect was manifested by a lower number in cells with odd B numbers, which suggests that these cells might find more difficulty in attending rRNA demands, although information on nucleolus size should be necessary to

be confident of this conclusion. Finally, the frequency of AMPs was always higher in the presence of odd B numbers (see Table 4). No clear explanation is available for the odd-even effect, but in looking for possible causes, we should explore both the trait itself and possible B chromosome behaviour that could cause the odd-even differences. The trait for which more data are available is the formation of AMPs, which showed the oddeven effect in most species reviewed here (see Table 4). Possible causes for the origin of spermatic macronuclei (and macrospermatids) were first pointed out by Nur (1969): (1) lagging B univalents during meiotic divisions might inhibit cytokinesis to produce restitution nuclei, (2) Bs might promote nuclear or cell fusion and (3) they might simply derive from polyploid spermatogonia. The restitution mechanism would produce only 2C and 4C macrospermatids, whereas cell fusion would yield a continuum of ploidy levels among macrosperma-

Cytogenet Genome Res 106:325–331 (2004)

329 187

tids depending on the number of fused spermatic nuclei. The last event is facilitated by the syncytial nature of testis follicle cysts (Phillips, 1970). Examples of both kinds of macrospermatid origin seem to exist in the literature. For instance, Gosa´lvez et al. (1985) measured, by microdensitometry, a sample of spermatids in males of S. coerulans carrying unstable B chromosomes and found 1C, 2C and 4C spermatids, as expected from restitution. Consistently, lagging B chromosomes were found in meiotic anaphases. Likewise, Bidau (1986) explained the formation of AMPs in Metalaptea brevicornis as a result of effects of lagging Bs on cytokinesis provoking the formation of restitution nuclei (macrospermatids) and micronuclei. In A. strepens, however, macrospermatids were found with up to ten centriolar adjuncts, which can only be produced by cell fusion (Suja et al., 1987). Two aspects of meiotic behaviour of B chromosomes might potentially be associated to the likelihood of macrospermatid formation, depending on B number, and thus might be responsible for the odd-even effect. First, the equational division of B univalents at metaphase I might induce them to lag at anaphase I and thus provoke restitution and the formation of macrospermatids. Second, the formation of B bivalents in spermatocytes with even B number avoids the existence of B univalents that might lag and induce restitution, thus decreasing the likelihood of macrospermatid formation. In the grasshoppers reviewed here, there seems to be a clear tendency for extra chromosomes, i.e. Bs and polysomic As, to show one or both characteristics favouring the odd-even effect, i.e. equational division of the extra univalents and bivalent formation. As Table 4 shows, one or both effects were found in most species. The odd-even effect, for macrospermatids, was found in C. pellucida, S. coerulans, A. strepens, D. pratensis and D. elongatus. L. migratoria was exceptional since no macrospermatids were found in 1B follicles despite the high frequency of equational division of the B univalents, suggesting that dividing B chromatids do not delay cytokinesis and do not interfere with sperm nuclei individualization within the syncytial testis cysts. Likewise, C. obscurus did not show the oddeven pattern for macrospermatids even though the two meiotic characteristics of their Bs were favourable. D. pratensis and A. strepens might seem to be other exceptions by showing a clear odd-even effect without the equational division of the B but, in A. strepens, the available evidence points to macrospermatid origin by cell fusion (Suja et al., 1987), and in D. pratensis, Bs were found lagging in about 6 % of anaphase II-telophase II cells (Bidau, 1987). As Suja and colleagues pointed out, it is possible that in this species B chromosomes impair the mechanisms that remove the cytoplasmic bridges in the syncytial testis cysts to allow cell and spermatid nucleus fusion. In C. pellucida and D. elongatus, the odd-even effect for macrospermatids coincides with the occurrence of the two meiotic properties that hypothetically might favour it (see Table 4). The appearance of microspermatids, or spermatic micronuclei, has been explained by the loss of lagging extra univalents (or chromatids derived from their equational division) (Nur, 1969). Therefore, their frequency should be associated with the same two aspects of extra chromosomes on meiotic behaviour.

330 188

Cytogenet Genome Res 106:325–331 (2004)

Table 4 shows that, in most cases where the odd-even pattern was found for microspermatids, the two meiotic properties were met. The clearest cases were C. pellucida, C. obscurus, D. elongatus, A. similis and C. binotatus. Again, L. migratoria was exceptional in showing a very low frequency of microspermatids in spite of a high frequency of B equational division. On the contrary, the absence of microspermatids in A. strepens was logical since the Bs were never observed dividing equationally (Suja et al., 1987). In D. pratensis, on the contrary, the odd-even effect was present for microspermatids even though the B was never seen dividing equationally (Bidau, 1987). Out of the 11 cases of the odd-even effect for AMPs reported in Table 4, seven were for microAMPs and four for macroAMPs. This might reflect a possible closer relationship between the odd-even effect for microspermatids and the two mentioned aspects of extra chromosomes meiotic behaviour. Although data are scarce, it seems that polysomic A chromosomes show a high tendency to manifest the odd-even effect for microspermatids, since all three cases tested did (see Table 4). In the three cases, a very high frequency of bivalent formation was found, and in the two species where it was analysed (A. similis and C. binotatus) the extra univalents sometimes divided equationally. If these extra As were candidates to become B chromosomes, then Bs might have a tendency to show the same meiotic behaviour from their inception. In fact, Table 4 shows a high resemblance in meiotic behaviour of extra As and Bs. Another interesting point to discuss is the influence of AMP formation in male fertility. In theory, we should expect that macrospermatids would be more influential than microspermatids, since the first imply the loss of whole genome sets whereas the latter perhaps only of the extra chromosomes. But this last assertion might not be always true, since micronuclei can also include A chromosomes, as was shown by Chiavarino et al. (2000), in tapetal cells from maize plants, by FISH with a collection of DNA probes specific for Bs and some As. It is thus conceivable that a certain proportion of the observed microAMPs in the mentioned grasshopper species actually contain lost A chromosomes, with the subsequent aneuploidy generated in some of the apparently normal spermatic products. Anyway, the frequency of macroAMPs found in the cases reviewed in Table 4 (up to 12.12 %) tended to be higher than that of microAMPs (up to 5.66 %). The odd-even effects revealed here might result from the stressing effects of B chromosomes. It is known that the incidence of recombination is lowest under optimal conditions and increases as the environment becomes more stressful (Hoffman and Parson, 1991). Recently, Kovalchuk et al. (2003) have provided evidence suggesting the existence of a systemic signal increasing the frequency of homologous recombination in tobacco plants infected with either of two different viruses. The putative molecular signals being responsible for this effect are actually unknown, but the production of the same effect in noninfected tissues from infected plants and the transmission of the effect by grafting free-of-virus leaves from infected plants to healthy non-infected plants, clearly point to their existence. The authors suggest that it might constitute an adaptive response to biotic stress, since this increase in recombination

may provide new specificities in pathogen resistance genes. This meets all expectations of the Red Queen Hypothesis (Van Valen, 1973), which predicts that coevolutionary interactions between parasites and hosts may select for an increase in host sex and recombination resulting in genetically different progeny with an expected lower risk of being infected (Bell, 1982). Such an increase in recombination was named “Inducible Recombination” by Bell and Burt (1990) to explain the increase in chiasma frequency associated with the presence of parasitic B chromosomes. They suggested that parasitized individuals should show greater rates of recombination than unparasitized individuals as a result of selection for genes that increase the rate of recombination only when “some stimuli associated with parasite activity are detected.” Strong support for Inducible Recombination came recently from the demonstration that the degree of increase in chiasma frequency depends on the strength of the parasitic B-chromosome attack (Camacho et al., 2002), and Kovalchuk et al. (2003) have shown the existence of a possible “stimuli” for Inducible Recombination. Effects on chiasma frequency might thus be interpreted as a host response to the stress added by parasitic B chromosomes (Bell and Burt, 1990; Camacho et al., 2003), and the odd-even effect for this trait clearly suggests that odd numbers might cause more stress.

At first sight, the existence of a systemic stimulus for B chromosome effects might appear incompatible with the intraindividual odd-even effect observed for mitotically unstable Bs. The stimulus hypothesis would predict that 0B follicles in mosaic males should show B effects even lacking them. This has been tested in two cases. In Sphingonotus coerulans, no significant difference was found for the frequency of macrospermatids between 0B males (1.91 %) and 0B follicles from B-carrying males (2.32 %) (Gosa´lvez et al., 1985) (contingency ¯2 = 0.64, P = 0.42). In Dichroplus elongatus, however, a significant increase in the frequency of abnormal spermatids was apparent even in 0B follicles from B-carrying males. For instance, Clemente et al. (1994) reported that, in the Tafi Viejo population, these 0B follicles showed about double frequency of macro- (0.71 %) and microspermatids (0.086 %) than 0B males (0.3 % and 0.047 %, respectively). In the Raco population, the frequency of macrospermatids in 0B follicles from B-carrying males was more that ten times higher than that observed in 0B males. Loray et al. (1991) and Clemente et al. (1994) claimed that physiological effects of B chromosomes may explain these increases in testis subunits lacking Bs. Such physiological effects might have much to do with the systemic signal uncovered by Kovalchuk et al. (2003), and the odd-even effect might be the result of additional effects modulated by B presence.

References Bell G: The masterpiece of nature: the evolution and genetics of sexuality (University of California Press, Berkeley 1982). Bell G, Burt A: B chromosomes: germ-line parasites which induce changes in host recombination. Parasitology 100:S19–S26 (1990). Bidau C: Effects on cytokinesis and sperm formation of a B-isochromosome in Metaleptea brevicornis adspersa (Acridinae, Acrididae). Caryologia 39:165– 177 (1986). Bidau C: Influence of a rare unstable B chromosome on chiasma frequency and non-haploid sperm formation in Dichroplus pratensis (Melanoplinae, Acrididae). Genetica 73:201–210 (1987). Camacho JPM, Bakkali M, Corral JM, Cabrero J, Lo´pez-Leo´n MD, Aranda I, Martı´n-Alganza A, Perfectti F: Host recombination is dependent on the degree of parasitism. Proc R Soc Lond Ser B 269:2173–2177 (2002). Camacho JPM, Sharbel TF, Beukeboom LW: B Chromosome evolution. Phil Trans R Soc Lond B 355: 163–178 (2000). Chiavarino AM, Rosato M, Manzanero S, Jiménez G, Gonza´lez-Sa´nchez M, Puertas MJ: Chromosome nondisjunction and instabilities in tapetal cells are affected by B chromosomes in maize. Genetics 155 889–897 (2000). Clemente M, Remis MI, Vilardi JC, Alberti A: Supernumerary heterochromatin, chiasma conditions and abnormal sperm formation in Dichroplus elongatus (Orthoptera): intra and interpopulation analysis. Caryologia 47:265–279 (1994). Confalonieri VA, Bidau CJ: The B-chromosomes of 2 species of Cylindrotettix (Leptysminae, Acrididae). Genetica 68:87–95 (1986). Gosa´lvez J, Lo´pez-Ferna´ndez C: Extra heterochromatin in natural-populations of Gomphocerus sibiricus (Orthoptera, Acrididae). Genetica 56:197–204 (1981).

Gosa´lvez J, de la Vega CG, Rufas JS, Lo´pez-Ferna´ndez C: Unstable B-chromosomes producing abnormal spermatid nuclei in Sphingonotus coerulans (Orthoptera). Arch Biol 96:15–22 (1985). Hewitt GM, John B: Parallel polymorphism for supernumerary segments in Chorthippus parallelus (Zetterstedt). I. British populations. Chromosoma 25: 319–342 (1968). Hewitt GM, John B: Parallel polymorphism for supernumerary segments in Chorthippus parallelus (Zetterstedt). 4. Ashurst re-visited. Chromosoma 31: 198–206 (1970). Hoffman AA, Parson PA: Evolutionary Genetics and Environmental Stress (Oxford University Press, Oxford 1991). John B, Hewitt GM: Parallel polymorphism for supernumerary segments in Chorthippus parallelus (Zetterstedt).3. The Ashurst population. Chromosoma 28:73–84 (1969). Jones RN, Rees H: B chromosomes (Academic Press, New York 1982). Kovalchuk I, Kovalchuk O, Kalck V, Boyko V, Filkowski J, Heinlein M, Hohn B: Pathogen-induced systemic plant signal triggers DNA rearrangements. Nature 423:760–762 (2003). Loray MA, Remis MI, Vilardi JC: Parallel polymorphism for supernumerary heterochromatin in Dichroplus elongatus (Orthoptera). Effects on recombination and fertility. Genetica 84:155–163 (1991). Nur U: Mitotic instability leading to an accumulation of B-chromosomes in grasshoppers. Chromosoma 27:1–19 (1969). Peters GB: Germ line polysomy in the grasshopper Atractomorpha similis. Chromosoma 81:593–617 (1981). Phillips DM: Insect sperm: their structure and morphogenesis. J Cell Biol 44:243–277 (1970). Remis MI, Vilardi JC: Meiotic behaviour and dosage effect of B-chromosomes on recombination in Dichroplus elongatus (Orthoptera: Acrididae). Caryologia 39:287–301 (1986).

Salcedo FJ, Viseras E, Camacho JPM: The B chromosomes of Locusta migratoria. III. Effects on the activity of nucleolar organizer regions. Genome 30:387–394 (1988). Suja JA, Gosa´lvez J, Lo´pez-Ferna´ndez C, Rufas JS: A cytogenetic analysis in Psophus stridulus (L) (Orthoptera, Acrididae). B-chromosomes and abnormal spermatid nuclei. Genetica 70:217–224 (1989). Suja JA, de la Vega CG, Rufas JS: Meiotic stability of B chromosomes and production of macrospermatids in Aiolopus strepens (Orthoptera, Acrididae). Genome 29:5–10 (1987). Talavera M, Lo´pez-Leo´n MD, Cabrero J, Camacho JPM: Male germ line polysomy in the grasshopper Chorthippus binotatus: extra chromosomes are not transmitted. Genome 33:384–388 (1990). Van Valen L: A new evolutionary law. Evol Theor 1:1– 30 (1973). Viseras E, Camacho JPM: Polysomy in Omocestus bolivari: endophenotypic effects and suppression of nucleolar organizing region activity in the extra autosomes. Can J Genet Cytol 26:547–556 (1984). Viseras E, Camacho JPM: The B-chromosome system of Omocestus bolivari: changes in B-behaviour in M4-polysomic B-males. Heredity 54:385–390 (1985). Viseras E, Salcedo FJ, Camacho JPM: The B chromosomes of Locusta migratoria II. Effects on chiasma frequency. Genome 30:118–123 (1988). Westerman M: Parallel polymorphism for supernumerary segments in Chorthippus parallelus (Zetterstedt). 2. French populations. Chromosoma 26:7– 21 (1969). Westerman M: Parallel polymorphism for supernumerary segments in Chorthippus parallelus. 5. New polymorphism in Europe. Heredity 25:662–667 (1970).

Cytogenet Genome Res 106:325–331 (2004)

331 189

Transmission of B Chromosomes Cytogenet Genome Res 106:332–337 (2004) DOI: 10.1159/000079308

The B chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North Africa. IV. Transmission of rare B chromosome variants M. Bakkalia and J.P.M. Camachob aInstitute

of Genetics, Queen’s Medical Centre, University of Nottingham, Nottingham (England); de Genética, Universidad de Granada, Granada (Spain)

bDepartamento

Abstract. In addition to the principal B chromosome (B1) in Moroccan populations of the grasshopper Eyprepocnemis plorans, nine B chromosome variants appeared at low frequency. The transmission of five of these rare B chromosome variants through females was analysed in three natural populations. Sixteen controlled crosses provided useful information on the transmission of BM2, BM6 and BM7 in Smir, BM3 and BM6 in SO.DE.A. (Société de Développement Agricole lands near Ksar-el-Kebir city), and BM2 and BM10 in Mechra, all located in Morocco. Since six female parents carried two different B variants, a total of 22 progeny analyses could be studied. Intraindividual variation in B transmission rate (kB) was observed among the successive egg pods in 26.7 % of the females, but this variation did not show a consistent temporal pattern. Only the

BM2 and BM6 variants in Smir showed net drive, although variation was high among crosses, especially for BM2. These two variants are thus good candidates for future regenerations (the replacement of a neutralized B, B1 in this case, by a new driving variant, BM2 or BM6) in Smir, the northern population where the B polymorphism is presumably older. The analysis of all crosses performed in the three populations, including those reported previously for the analysis of B1 transmission, showed that the largest variance in kB among crosses stands at the individual level, and not at population or type of B levels. The implications of these findings for the occurrence of possible regeneration processes in Moroccan populations are discussed.

B chromosomes are dispensable chromosomes present in about 10–15 % of eukaryote species that, in most cases, behave as parasites that infect eukaryote genomes because of some kind of drive and with some damage to the host (Camacho, 2004). The interactions with the host follow an arms race char-

acterized by a variety of mechanisms of attack and defence by both counterparts (Camacho et al., 1997; Frank, 2000). B chromosome attack usually stands on a transmission advantage (drive) and the primary means of host resistance is the suppression of B chromosome drive (Camacho et al., 1997). Even after drive suppression, the high mutability of B chromosomes may facilitate the appearance of a new B variant being able to drive again and thus replace the older neutralized (non-driving) B variant. This process was named “regeneration” by Camacho et al. (1997) and was directly witnessed by Zurita et al. (1998). Most natural populations of the grasshopper Eyprepocnemis plorans harbour a B chromosome polymorphism which has become a paradigm for A-B chromosome coevolution, since it illustrates several stages by which the system can pass through its long term evolution (Camacho et al., 1997). B chromosomes are expected to invade populations because of drive, which is then eliminated by selection for suppressor gene variants in the

This study was partially supported by grants from the Spanish “Ministerio de Ciencia y Tecnologı´a” (no. BOS2000-1521) and “Plan Andaluz de Investigacio´n, Grupo no. CVI-165”. Received 15 September 2003; manuscript accepted 29 October 2003. Request reprints from: Dr. Mohammed Bakkali, Institute of Genetics Queen’s Medical Centre, University of Nottingham NG7 2UH, Nottingham (England) telephone: +44-(0)-115-924-9924 ext. 44581; fax: +44-(0)-115-970-9906 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0332$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

A chromosomes, the Bs becoming neutralized elements. The absence of drive for the principal B chromosome types in E. plorans (Lo´pez-Leo´n et al., 1992) was shown to be presumably due to the existence of A chromosome genes suppressing it (Herrera et al., 1996). The subsequent finding of a B variant (B24) in Torrox (Ma´laga, Spain) being able to drive (Zurita et al., 1998), and even that B1 is still driving in a Moroccan population (Bakkali et al., 2002), strongly supports the coevolutionary interaction between A and B chromosomes, with B drive being the main weapon for B attack and its suppression being the main defense strategy of the host genome. A neutralized B is condemned to extinction under the action of genetic drift and selection against specimens carrying large numbers of B chromosomes (Camacho et al., 1997). But the high mutability of B chromosomes provides them with an additional weapon as, sometimes, it allows them to rescue the driving ability when they appear as new B variants. It is known that this has occurred in the Iberian peninsula since the original B (B1) has been replaced in two specific locations (Henriques-Gil and Arana, 1990). The replacement of B2 by B24 in Torrox is another example. In Morocco, the predominant B is very similar to the original B in the Iberian peninsula (Bakkali et al., 1999; Cabrero et al., 1999). The analysis of the transmission of this B chromosome in three Moroccan populations has shown that it drives significantly in the southern population (Mechra) but shows Mendelian transmission rates in the two northern populations (Smir and SO.DE.A) (Bakkali et al., 2002). This suggests that B1 has already been neutralized in the populations were the polymorphism is presumably older but not in the one where it is younger (Mechra). It is thus conceivable that some of the new B variants that continuously are emerging in E. plorans populations, by mutation of the existing ones, could be good candidates to replace the neutralized B1 because of being able to drive. In this paper we present the analysis of the transmission of five rare B chromosome variants found in the same three Moroccan populations where we previously analyzed B1 transmission, and we discuss possible evolutionary outcomes of the polymorphism in these populations.

Materials and methods The materials and methods for the present study were the same as in Bakkali et al. (2002), where we included the results for the most widespread B chromosome type in Morocco. In brief, we collected adult males and females at three Moroccan populations of the grasshopper Eyprepocnemis plorans located at different latitudes: Smir (the northern site, between Ceuta and Tetouan), SO.DE.A. (near Ksar el Kebir) and Mechra (the sourthern site, near Mechra-Bel-Ksiri (see map locations in Bakkali et al., 1999). Specimens were taken alive to the laboratory where males were analysed in vivo as described in Lo´pez-Leo´n et al. (1993) to determine the B chromosome number. B chromosome frequency was artificially increased in the sample by collectively crossing B-carrying males with females from the same population (H crosses). In parallel, 0B males were collectively crossed to other groups of females to obtain a population with low B frequency as a source of 0B males (L crosses). Culture conditions were similar to those described in Herrera et al. (1996). Controlled crosses were performed between a female yielded by the H crosses and a 0B male from the L crosses. Eggs were incubated at 28 ° C, and eleven-day-old eggs were dissected to cytologically analyse the embryos, along with the male and the female, following the techniques described in Lo´pez-Leo´n et al. (1993).

Egg fertility was calculated as the proportion of eggs containing an embryo in an egg-pod, and B chromosome transmission rate (kB) was calculated as the quotient between the mean number of Bs in the progeny divided by the number of Bs in the female parent. The observed kB values were compared to the expected Mendelian rate (0.5) by means of the Z test proposed by Lo´pez-Leo´n et al. (1992): Z=

(kB – 0.5)

冪

0.25 N

where N is the total number of embryos. Significant departures from Mendelian transmission are indicated by Z values higher than 1.96, for Bs showing accumulation, or lower than –1.96, for those showing elimination. In most crosses (excepting SM22), two or more successive egg pods were analysed. To test for temporal variation in B transmission rate, a contingency chi-square test was performed comparing the frequencies of 0B, 1B or 2B+ embryos among the successive pods laid by each female. When the female carried 1B, the Mendelian segregation law would predict a 1:1 ratio of ova with 0B and 1B. In these cases, and when the crosses for a same B variant gave contradictory results, we performed a heterogeneity chi-square test to get an idea of both average B transmission rate (given by the accumulated chi-square) and variation among females (given by the heterogeneity chisquare). Variation in kB was partitioned by a mixed-model ANOVA performed to all available crosses, in respect to three independent factors: B variant, population and female (nested within population). In six crosses where the female carried two different B chromosome variants, a correlation analysis was performed between the transmission rate for each B variant. The B variants were named following Bakkali and Camacho (2004); adding an M (Morocco) to the number indicating order of finding.

Results In the three populations, the most frequent B chromosome was B1, whose transmission has been reported elsewhere (Bakkali et al., 2002). Here we include the transmission of five other B variants (BM2, BM3, BM6, BM7 and BM10) which appeared in 16 out of the 149 controlled crosses performed (a cytological description of these B variants is provided in Bakkali and Camacho, 2004). Since the female in six crosses carried two different B variants, the 16 crosses performed yielded a total of 22 progeny analyses. In 20 of them (15 crosses), two or more egg-pods were analysed, so that temporal variation for B chromosome transmission through the same female could be assessed. As Table 1 shows, the contingency chi-square test showed significant variation in kB among successive egg pods in five progeny analyses (25 %) from four crosses (26.7 %) (see also Fig. 1). To get a more accurate estimation, we could also consider the crosses described in Bakkali et al. (2002) to analyse B1 transmission, six of which showed intraindividual variation in kB. Note that there was a mistake in Bakkali et al. (2002) (Table 2) regarding the number of pods analysed in three crosses, so that the available crosses, with more than one pod analysed, were 30 instead of 33. Bearing also in mind that females in some of the present crosses also carried B1, and were thus already included in that score, the total number of this kind of crosses is 42. As a whole, ten of these crosses showed intraindividual variation in kB (23.8 %). Since B1 transmission differed among the three populations (accumulation in Mechra but not in the two other populations) (see Bakkali et al., 2002), we analysed the transmission of each B variant in each population separately. Table 1 shows the 22

Cytogenet Genome Res 106:332–337 (2004)

333 191

Fig. 1. Temporal variation for B chromosome transmission through females. (A) Transmission of BM2 in six crosses from Smir. The two crosses (SM4 and SM51) showing significant variation among successive pods are indicated by a wider line. (B) Transmission of BM6 and BM7 (dotted line) through three females from Smir. (C) Transmission of BM3 through six females from SO.DE.A. The wider line shows the only cross (S49) showing significant temporal variation for B transmission. (D) Transmission of BM6 through a female from SO.DE.A, and BM2 and BM10 through a female from Mechra (M12: wider lines).

Table 1. Transmission analysis of five rare B chromosome variants in three Moroccan populations of the grasshopper Eyprepocnemis plorans. Significant results are indicated in bold type letter. Population Cross Total Bs in Smir

SM1 SM4 SM17 SM22

1 1 1 2

SM51 2 SM62 1 SM77 3 SM46 1 SM66 1 SO.DE.A

Mechra

334 192

S40 S44 S49 S56

2 2 2 2

S57

2

S61

2

M12

2

B variant Variant Bs in BM2 BM2 BM2 BM2 BM7 BM2 BM2 BM2 BM6 BM7 BM7

1 1 1 1 1 2 1 1 2 1 1

BM3 BM3 BM3 BM3 BM6 B1 BM3 B1 BM3

2 2 2 1 1 1 1 1 1

BM2 BM10

1 1

Pods Eggs Embryos Fertility Embryos with 0B 1B 2Bs 3Bs kB 3 4 2 1

104 120 102 40

95 112 96 38

0.913 0.933 0.941 0.950

5 6 3

170 126 93

149 119 90

0.876 0.944 0.968

3 2

87 74

79 73

0.908 0.986

5 3 8 2

146 149 255 47

122 124 190 25

0.836 0.832 0.745 0.532

3

90

78

0.867

2

78

55

0.705

2

73

72

0.986

Cytogenet Genome Res 106:332–337 (2004)

Z

Intraindividual variation P Contingency χ2 df

18 71 0 32 76 0 54 37 0 27 11 0 23 15 0 21 111 17 37 69 3 25 61 0 11 28 44 46 33 0 38 35 0

0 0 0 0 0 0 0 0 3 0 0

0.798 0.704 0.407 0.289 0.395 0.487 0.688 0.709 0.727 0.418 0.479

5.618 4.234 –1.782 –2.596 –1.298 –0.328 3.927 3.882 4.205 –1.463 –0.351

5.63 11.86 3.36

2 3 1

0.059905 0.007878 0.066798

24.94 10.2 3.22 1.63 1.05 0.37

8 5 2 4 2 1

0.001567 0.069763 0.199888 0.80339 0.591555 0.543004

28 95 16 98 45 131 4 14 5 13 39 31 32 39 23 27 21 29

0 0 2 0 0 1 0 0 0

0 0 0 0 0 0 0 0 0

0.386 0.430 0.379 0.778 0.722 0.465 0.549 0.540 0.580

–2.525 –1.499 –3.223 2.357 1.886 –0593 0.831 0.566 1.131

4.78 4.39 30.28 0 0.28 2.21 1.89 1.71 1.27

4 2 7 1 1 2 2 1 1

0.310625 0.111359 0.000084 1 0.596701 0.331211 0.38868 0.190985 0.259767

40 32

0 0

0 0

0.429 –1.195 0.536 0.602

5.14 4.41

1 1

0.023381 0.035729

30 37

Fig. 2. Egg fertility in females carrying B1 (the most widespread B in Morocco) or two rare variants: BM2 or BM3. Error bar = standard error.

Table 2. Mixed-model ANOVA for kB as dependent variable and population, female (nested within population) and B variant as independent factors Item

SS

df

MS

F

P

Intercept Population Female (Population) B variant Error

0.937 0.016 1.911 0.025 1.824

1 2 37 4 96

0.937 0.008 0.052 0.006 0.019

49.33 0.42 2.72 0.33

<0.000001 0.658360 0.000050 0.859972

progeny analyses performed. The observed kB ranged between 0.289 and 0.798, with significant accumulation in six progeny analyses, significant elimination in three and Mendelian transmission rate in the remaining 13. The transmission of the BM2 variant was analysed in seven crosses from Smir, in six of which the female carried 1B (Table 1). Four out of these six crosses showed significant accumulation by the Z test, one showed significant B elimination (SM22) and one showed a Mendelian transmission rate. A heterogeneity chi-square test showed very significantly different transmission rates among these six crosses (¯2 = 50.73, df = 5, P ! 0.001). As a whole, these six crosses showed significant accumulation of BM2 (kB = 0.63; ¯2 = 34.98, df = 1, P ! 0.001). In another cross (SM51) the female carried 2BM2. The observed kB (0.487) indicated a Mendelian rate of transmission through this female, but a chi-square test comparing the observed frequencies of embryos with 0B, 1B and 2B, with those expected if the two Bs would behave independently at female meiosis (1:2:1) showed a significant excess of 1B embryos, which suggested that the two Bs in this female tended to segregate to opposite poles, presumably because of bivalent formation. BM2 was also carried by a female from Mechra (M12), which also carried the BM10 variant. This female transmitted both variants at a Mendelian rate (Table 1). The BM3 variant was carried by a total of six females from the SO.DE.A population, three with 1B and three with 2B. The Z test showed significant accumulation in one cross (S56) and significant elimination in two (S40 and S49), with Mendelian

rate in the three remaining (Table 1). The chi-square test failed to show significant heterogeneity among the three crosses where the female carried 1B (¯2 = 3.03, df = 2, P ! 0.22) which, as a whole, showed softly significant accumulation (0.59) (¯2 = 4.50, df = 1, P = 0.034). The three crosses where the female carried two BM3 chromosomes (S40, S44 and S49) yielded a total of 89 0B, 324 1B and 2 2B embryos. These figures differ significantly from the 1:2:1 ratio expected under a Mendelian rate and independent behaviour of the two Bs (¯2 = 167.3, df = 2, P ! 0.001). In contrast to BM2 in the SM51 cross, where 0B and 2B embryos appeared in similar frequency, these three crosses showed almost complete absence of 2B embryos. Remarkably, the crosses where BM3 was present showed lower egg fertility than those carrying B1 (values in Bakkali et al., 2002) or BM2 (see values for BM2 and BM3 in Table 1) (Fig. 2). This suggests that BM3 could be deleterious, especially when more that one is present in a female.

Discussion The present results have provided evidence for the existence of variation for B chromosome transmission among the successive egg pods laid by 26.7 % of the females (or 23.8 %, when also considering the crosses described in Bakkali et al., 2002). The absence of a consistent pattern of temporal variation, as shown in Bakkali et al. (2002), is also confirmed by the present crosses. As Fig. 1 shows, the SM4 and S49 females showed zigzag variation, the SM51 female showed a tendency to kB increase with age, and the M12 female showed a tendency to kB decrease with age, although only two pods were analysed in this last case. Remarkably, the two B variants in the M12 female (BM2 and BM10) showed the same pattern of variation between the two pods analysed (see Fig. 1D), suggesting that the unknown factors influencing B transmission through time do similarly affect the different B chromosomes carried by the female. In our previous paper (Bakkali et al., 2002), we attributed the temporal intraindividual variation for kB to factors related to the reproductive biology of E. plorans, such as the number of matings before laying or the length of the time period between mating and laying. These factors could modify some reproductive conditions in the female, e.g. the amount of proteinaceous nutrients that E. plorans females get from the ejaculate (Pardo et al., 1995), and could thus explain male effects on B chromosome transmission through females (Herrera et al., 1996). Despite this intraindividual variation (which actually was not observed in most females), kB variance seems to mainly stand at the individual level, as was shown by (1) the mixedmodel ANOVA, and (2) the significant correlation among kB for Bs transmitted by the same female, which is especially apparent in the coincident pattern of variation of the two Bs in the M12 female (see Fig. 1D). It is thus clear that the same B may show very different kB in different females, but the same individual transmits two different B variants at very similar rates (see Table 1). This suggests that B chromosome transmission is highly dependent on some individual factors, many of which may be

Cytogenet Genome Res 106:332–337 (2004)

335 193

encoded in the A chromosomes. Evidence has been obtained in a few species, by means of artificial selection for high or low transmission rate of B chromosomes, e.g. in the grasshopper Myrmeleotettix maculatus (Shaw and Hewitt, 1985), in the mealy bug Pseudococcus affinis (Nur and Brett, 1985, 1987, 1988), rye Secale cereale (Romera et al., 1991; Jiménez et al., 1995) and maize Zea mays (Rosato et al., 1996; Chiavarino et al., 1998). In maize, one of the best known cases, an A chromosome gene (mBt) seems to be involved in the preferential fertilisation of B-carrying pollen (Chiavarino et al., 2001; Gonza´lezSa´nchez et al., 2003) and another gene (fBtl) seems to favour meiotic elimination of B univalents in females (Gonza´lez-Sa´nchez et al., 2003). The genetic determinism of cell features being crucial for B chromosome transmission reinforce the importance of individual genotype for these genes, so that variation for these genes might explain a large part of the interindividual variation found in many studies of B chromosome transmission (see, for instance, Müntzing, 1954; Bosemark, 1954; Carlson, 1969; Hewitt, 1973; Parker et al., 1982). In E. plorans, the absence of drive for the most widespread Bs in the Iberian peninsula suggested that drive suppressor genes might be common in the A chromosomes of this species (Lo´pez-Leo´n et al., 1992). Experimental evidence came from interpopulation crosses where the same female showed Mendelian transmission or drive for the same B chromosome, depending on whether the 0B male that mated with her came from the same +B population or from a non-B population, respectively (Herrera et al., 1996). Additional evidence came from the finding of a driving B chromosome replacing a non-driving one in the Torrox population (Zurita et al., 1998) and the existence of B chromosomes showing drive in some Moroccan populations but not in others (Bakkali et al., 2002). In the context of the arms race between A and B chromosomes, where both counterparts are continuously evolving new mechanisms of attack and defence (Frank, 2000), there is a different scenario for the genetic background where a B chromosome has to prosper, depending on whether it is the original B or else it is a derived new variant. The original B faces a genetic background in the A chromosomes which has not been previously exposed to B chromosomes, so that the new B could easily prosper, provided that it is able to drive. But if drive suppressor genes have become common in a population invaded by a B chromosome, and B drive has been neutralised (see B chromosome life cycle in Camacho et al., 1997), the new B variants need not only be able to drive but also be immune to the suppressor genes that acted against the original B. Under this perspective, it is perhaps logical that kB for new B variants is expected to be variable among individuals, depending on the genetic background where the new conditions for driving need to evolve. We named the process by which a neutralised B is replaced by a new B variant (derived from the former) being able to drive (Camacho et al., 1997) “regeneration”. Such regenerations were directly witnessed in Torrox (Ma´laga, Spain), where the parasitic B24 replaced the neutralised B2 during the eighties (Zurita et al., 1998). The original B in the Iberian peninsula was most likely B1, which is the most widespread variant (Henriques-Gil et al., 1984). In the provinces of Granada and Eastern

336 194

Cytogenet Genome Res 106:332–337 (2004)

Ma´laga, the most frequent variant is B2, indicating that at least one regeneration took place in this region when the original B (B1) was substituted by the new B (B2). A similar phenomenon occurred in Fuengirola, where B1 was substituted by B5 (Henriques-Gil and Arana, 1990). Let us name “primary” to the regenerations where the substituted B is the original (B1) and “secondary” to the subsequent regenerations (e.g. B2 replaced by B24). In Spain, both types of regenerations have taken place but, in Morocco, B1 is still the predominant B variant in all nine populations analysed (Bakkali et al., 1999), suggesting that the B chromosome polymorphism is younger than in Spain and regenerations have not yet begun there. Additional evidence is that B1 still drives in the southern population analysed (Mechra) but not in the other two northern ones (Smir and SO.DE.A), suggesting that B chromosomes arose in the Iberian peninsula and later colonised Morocco (Bakkali et al., 2002). Our present results provide an estimate of the likelihood that any of the new B variants analysed may replace B1 and thus undergo a regeneration process. Out of the five B variants analysed, BM6 and BM2 in Smir seem to be the best candidate for future regenerations. BM6 showed kB 1 0.7 in the two crosses analysed. Although the information is still scarce, the fact that it was present in 1/34 individuals from SO.DE.A in 1995 but in 3/41 in 1997 suggests that its frequency might be increasing in this population. It is remarkable that the size and C-banding pattern of BM6 are similar to those of B24, the parasitic B which has replaced the neutralised B2 in the Torrox population (see above). If B chromosomes invaded Morocco from the South of the Iberian peninsula, it is noteworthy that possible regenerations are likely being prepared in the northern population (Smir), which is the closest to the presumed invasion point and, consequently, the population where the B polymorphism is older. This is consistent with the sequence predicted by the life-cycle of E. plorans B chromosomes (Camacho et al., 1997). In the case of BM2, most crosses where the female carried 1B showed significant B accumulation (kB = 0.63 on average, but it varied from 0.289 to 0.798). This wide variation might be a symptom of the coexistence of genetic variants in the A chromosomes permitting B drive with others suppressing it. Given the low frequency of BM2 in Moroccan populations (Bakkali and Camacho, 2004), the presence of suppressor genes from the beginning might be a handicap for a regeneration carried out by this B variant. The single cross where the female carried two Bs showed a Mendelian kB but a significant excess of 1B progeny and deficit of 0B and 2B progeny, suggesting that the two Bs tend to segregate to opposite poles at first metaphase during female meiosis, presumably because the two Bs tend to form a bivalent. If this pattern was frequent, this would be an added difficulty for B invasion and regeneration, as regular segregation is antagonistic with drive based on univalent formation (see Camacho, 2004). The crosses showing BM3 transmission appeared to indicate significant drive, on average. But this could be an artefact since the only cross showing significant drive (0.778 in S56) also carried BM6 which, as commented before, seems to show a tendency to drive and, given that the largest component of variation in kB seems to be at the individual level, it is possible that BM3 would

show drive in this cross as a secondary effect of BM6 tendency to drive, since no other cross showed drive for BM3. In addition, BM3 is possibly harmful for egg fertility, and a significant deficit of 2B embryos was apparent in the females carrying two BM3 chromosomes, suggesting that BM3 might also be deleterious in embryo viability. In these conditions, it is very unlikely that a B variant like this, not showing a clear drive and being harmful for host fitness, could carry out a regeneration process.

Acknowledgments We thank F. Perfectti for his help with statistical analysis. M Bakkali wishes to thank the “Agencia Española de Cooperacio´n Internacional, Instituto de Cooperacio´n con el Mundo A´rabe, Mediterra´neo y Paı´ses en Vı´as de Desarrollo” (Spain) and the “Ministère de l’Enseignement Supérieur, de la Formation des Cadres et de la Recherche Scientifique” (Morocco) for conceding a studentship, and Mr Soulaı¨mane Bakkali for his help in capturing specimens.

References Bakkali M, Camacho JPM: The B chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North Africa: III. Mutation rate of B chromosomes. Heredity (advance online publication 3 March) (2004). Bakkali M, Cabrero J, Lo´pez-Leo´n MD, Perfectti F, Camacho JPM: The B chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North Africa. I. B variants and frequency. Heredity 83:428–434 (1999). Bakkali M, Perfectti F, Camacho JPM: The B chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North Africa. II. Parasitic and neutralized B1 chromosomes. Heredity 88:14–18 (2002). Bosemark NO: On accessory chromosomes in Festuca pratensis. II. Inheritance of the standard type of accessory chromosome. Hereditas 40:425–437 (1954). Cabrero J, Lo´pez-Leo´n MD, Bakkali M, Camacho JPM: Common origin of B chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity 83:435–439 (1999). Camacho JPM: B chromosomes, in Gregory TR (ed): The Evolution of the Genome (Elsevier, Amsterdam 2004). Camacho JPM, Shaw MW, Lo´pez–Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997). Carlson W: Factors affecting preferential fertilization in maize. Genetics 62:543–554 (1969). Chiavarino AM, Rosato M, Rosi P, Poggio L, Naranjo CA: Localization of the genes controlling B chromosome transmission rate in maize (Zea mays ssp. mays, Poaceae). Am J Bot 85:1581–1585 (1998).

Chiavarino AM, Gonzalez-Sanchez M, Poggio L, Puertas MJ, Rosato M, Rosi P: Is maize B chromosome preferential fertilization controlled by a single gene? Heredity 86:743–748 (2001). Frank SA: Polymorphism of attack and defence. Trends Ecol Evol 15:167–171 (2000). Gonzalez-Sanchez M, Gonzalez-Gonzalez E, Molina F, Chiavarino AM, Rosato M, Puertas MJ: One gene determines maize B chromosome accumulation by preferential fertilisation; another gene(s) determines their meiotic loss. Heredity 90:122–129 (2003). Henriques-Gil N, Arana P: Origin and substitution of B chromosomes in the grasshopper Eyprepocnemis plorans. Evolution 44:747–753 (1990). Henriques-Gil N, Santos JL, Arana P: Evolution of a complex polymorphism in the grasshopper Eyprepocnemis plorans. Chromosoma 89:290–293 (1984). Herrera JA, Lo´pez-Leo´n MD, Cabrero J, Shaw MW, Camacho JPM: Evidence for B chromosome drive suppression in the grasshopper Eyprepocnemis plorans. Heredity 76:633–639 (1996). Hewitt GM: Variable transmission rates of a B chromosome in Myrmeleotettix maculatus (Thunb.). Chromosoma 40:83–106 (1973). Jiménez MM, Romera F, Gallego A, Puertas MJ: Genetic control of the rate of transmission of rye B chromosomes. II. 0B × 2B crosses. Heredity 74:518–523 (1995). Lo´pez-Leo´n MD, Cabrero J, Camacho JPM, Cano MI, Santos JL: A widespread B chromosome polymorphism maintained without apparent drive. Evolution 46:529–539 (1992). Lo´pez–Leo´n MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL: Generating high variability of B chromosomes in the grasshopper Eyprepocnemis plorans. Heredity 71:352–362 (1993).

Müntzing A: Cytogenetics of accessory chromosomes (B-chromosomes). Proceedings of the ninth international congress of genetics. Caryologia S6:282– 301 (1954). Nur U, Brett BLH: Genotypes suppressing meiotic drive of a B chromosome in the mealy bug Pseudococcus obscurus. Genetics 110:73–92 (1985). Nur U, Brett BLH: Control of meiotic drive of B chromosomes in the mealy bug Pseudococcus affinis (obscurus). Genetics 115:499–510 (1987). Nur U, Brett BLH: Genotypes affecting the condensation and transmission of heterochromatic B chromosomes in the mealy bug Pseudococcus affinis. Chromosoma 96:205–212 (1988). Pardo MC, Lo´pez-Leo´n MD, Hewitt GM, Camacho JPM: Female fitness is increased by frequent mating in grasshoppers. Heredity 74: 654–660 (1995). Parker JS, Taylor S, Ainsworth CC: The B chromosome system of Hypochoeris maculata. III. Variation in B-chromosome transmission rates. Chromosoma 85:229–310 (1982). Romera F, Jiménez MM, Puertas, MJ: Genetic control of the rate of transmission of rye B chromosomes. I. Effects in 2B × 0B crosses. Heredity 66:61–65 (1991). Rosato M, Chiavarino AM, Puertas MJ, Naranjo CA, Poggio L: Genetic control of B chromosome transmission rate in Zea mays ssp. mays (Poaceae). Am J Bot 83:1107–1112 (1996). Shaw MW, Hewitt GM: The genetic control of meiotic drive acting on the B chromosome of Myrmeleotettix maculatus (Orthoptera: Acrididae). Heredity 54:259–268 (1985). Zurita S, Cabrero J, Lo´pez-Leo´n MD, Camacho JPM: Polymorphism regeneration for a neutralized selfish B chromosome. Evolution 52:274–277 (1998).

Cytogenet Genome Res 106:332–337 (2004)

337 195

Transmission of B Chromosomes Cytogenet Genome Res 106:338–343 (2004) DOI: 10.1159/000079309

Rapid suppression of drive for a parasitic B chromosome F. Perfectti, J.M. Corral, J.A. Mesa, J. Cabrero, M. Bakkali, M.D. Lo´pez-Leo´n and J.P.M. Camacho Departamento de Genética, Universidad de Granada, Granada (Spain)

Abstract. The persistence of parasitic B chromosomes in natural populations depends on both B ability to drive and host response to counteracting it. In the grasshopper Eyprepocnemis plorans, the B24 chromosome is the most widespread B chromosome variant in the Torrox area (Ma´laga, Spain). Its evolutionary success, replacing its ancestral neutralized B variant, B2, was based on meiotic drive in females, as we showed in a sam-

ple caught in 1992. In females collected six years later, mean B24 transmission ratio (kB) was 0.523, implying a very rapid decrease from the 0.696 observed in 1992. This shows that B24 neutralization is running very fast and suggests that it might most likely be based on a single gene of major effect.

Supernumerary or B chromosomes are dispensable chromosomes found in many plant and animal species (Jones and Rees, 1982). Most of them can be considered genome parasites that accumulate in the host germ line thus persisting in natural populations despite harmful effects on several aspects of host fitness (for review see Jones and Rees, 1982 and Camacho et al., 2000). As other types of parasites, B chromosomes engage in an arms race with the host (A chromosomes) manifested by various A and B strategies all leading to get rid of each other (Shaw and Hewitt, 1990). The main B chromosome weapon is its ability to get transmission drive from a variety of mechanisms (see Jones, 1991), and a high frequency of mutation expanding its variability thus promoting its evolutionary chance. The main A chromosome strategy to counteract B chromosome attack is manifested by the control of B drive based on suppressor genes located on the A chromosomes (Shaw et al., 1985; Shaw and Hewitt, 1985; Nur and Brett, 1985, 1987, 1988; Romera et al.,

1991; Cebria´ et al., 1994; Jiménez et al., 1995; Herrera et al., 1996; Puertas et al., 2000; Chiavarino et al., 2001; Gonza´lezSa´nchez et al., 2003). For example, in the grasshopper Myrmeleotettix maculatus, a gene modifying B drive seems to be present as a polymorphism in all populations (Shaw and Hewitt, 1985). In the mealybug, Pseudococcus affinis, Nur and Brett (1987) showed that the high and low transmission lines, that they had previously obtained by artificial selection, differed at two unlinked loci with additive effects on B transmission rate. In maize, a single major gene controls preferential fertilisation of B-carrying male gametes (Chiavarino et al., 2001; Gonza´lez-Sa´nchez et al., 2003), and a dominant gene favours meiotic elimination of B univalents in females (Gonza´lez-Sa´nchez et al., 2003). In some cases, the parasitic B chromosome seems to reach an equilibrium frequency because of a balance between the frequency gain derived from B drive and the frequency loss caused by its deleterious effects on the host (Nur, 1977). In others, B drive is suppressed completely and the B is condemned to stochastic loss (Camacho et al., 1997). In the first case, the A chromosomes will bear the B burden over generations, so that it is intriguing why these Bs are not neutralised. Two explanations are possible, namely, the absence of appropriate A chromosome genetic variation being able to drive suppression of B, or else that suppression is costly. Species where high variation for B transmission ratio among individuals has been reported, e.g. Myrmeleotettix maculatus (Hewitt, 1973), Hypochoeris maculata (Parker et al., 1982), rye (Romera et al., 1991) and maize (Rosato et al., 1996), are probable examples of costly suppression of B drive.

Supported by the Spanish Ministerio de Ciencia y Tecnologı´a (B052003-06635) and Plan Andaluz de Investigacio´n (CVI-165). Received 14 January 2004; manuscript accepted 15 January 2004. Request reprints from F. Perfectti, Departamento de Genética Universidad de Granada, 18071 Granada (Spain) telephone: +34 958 243262; fax: +34 958 244073; e-mail: [email protected] Present address of J.M.C.: Puleva Biotech SA, Camino de Purchil 66 SP–18004 Granada (Spain). Present address of M.B.: Institute of Genetics Queen’s Medical Centre, University of Nottingham Nottingham NG7 2UH (UK)

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0338$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

The grasshopper Eyprepocnemis plorans probably illustrates a case with low cost of B drive suppression, since the A-B arms race, in this species, frequently leads to the neutralization of B drive (Camacho et al., 1997). This species has also illuminated a model for the long-term life cycle of a parasitic B chromosome (Camacho et al., 2003). In this model, the B is neutralized by the host genome through the evolution of host genes that suppress B drive. Because of not forming bivalents, such neutralized B chromosomes are destined to disappear after a long period of stochastic fluctuation, in the course of which the Bs can mutate into a new parasitic variant with high drive that restarts the cycle again (Camacho et al., 1997). The occurrence of B chromosome substitutions has been reported in a population collected at Torrox (Ma´laga, Spain), where a new B type, B24, has just replaced the original one, B2, because of its higher transmission ratio (Zurita et al., 1998). Therefore, it is possible to follow empirically the evolution of this newly parasitic B in this population, in order to test our model predicting that this new B should also be neutralized (Camacho et al., 1997). Here we show that the neutralization of this new parasitic B has taken place rapidly thus suggesting a suppression mechanism most likely based on a single gene of major effect.

Materials and methods During autumn 1998, we caught adult males and nymph females in Torrox (Ma´laga) and started a number of controlled crosses between every female (when adult) and a 0B male (analysed by testis biopsy, see Lo´pez-Leo´n et al., 1992a for details). In sixteen of these crosses, the female carried one or more B chromosomes and yielded enough ten-day-old embryos to analyze B transmission (Table 1). After cross completion, the male was anaesthetized and dissected to fix the testes in 3:1 ethanol-acetic acid (to confirm absence of Bs), and the female was injected with 0.05 % colchicine in insect saline solution for 6 h prior to fixation of ovarioles in 3:1 ethanol-acetic acid (to determine the number of Bs). The eggs were incubated for ten days at 28 ° C and then dissected to fix the embryos following the method described in Camacho et al. (1991). The number of B chromosomes in all fixed materials was analysed by the C-banding technique described in Camacho et al. (1991).

The two key parameters analysed in these crosses were B transmission ratio (kB, the quotient between the mean number of Bs in the offspring and the number of B chromosomes in the parents, i.e. in the mother since all fathers carried no B chromosomes) and egg fertility (the proportion of eggs containing an apparently normal embryo after the ten days of incubation). The statistical methods employed included the Z test (approximation of binomial to normal distribution, to test kB departing from the expected under the Mendelian segregation law, i.e. 0.5, suggested by Lo´pez-Leo´n et al., 1992a), the Fisher exact test for a between-year comparison of the proportion of crosses showing B drive, the ANCOVA to test temporal variation in kB and egg fertility, and its dependence on the number of B chromosomes, and the F-ratio test to analyse temporal changes in the variance of kB. We developed a Statistica® program to explore deterministically the dynamics of a drive-modifier gene (m) in a system with the following parameters: initial B chromosome frequency (from 0.1 to 1 B chromosome per host), B chromosome drive (0.8), proportion of B chromosome bivalents (0.2), initial frequency of the modifier (0.01–0.5), and dominance of the modifier (h = 0, 0.5, 1). We assumed a Mendelian transmission rate of B chromosomes through males (i.e., kB = 0.5). Female fertilities were established from data in experimental crosses (Zurita et al., 1998): 1 for m+m+ females with 0B, 0.81 for m+m+ females with 1B, 0.68 for m+m+ females with 2B, 0.5 for m+m+ females with 3B, and 0 for females with 4 or more Bs. Fertilities for m+m and mm females were parameterized depending on the m costs and h.

Results and discussion Three females (nos. 7, 8 and 13 in Table 2) out of the 16 females analysed showed kB significantly higher than 0.5, thus indicating B accumulation, but none showed kB significantly

Table 1. Number of females analysed in Torrox (Ma´laga, Spain) in 1992 (Zurita et al., 1998) and 1998 (present paper) Year

Number of B chromosomes in the female

Totals

0

1

2

3

4

1992 1998

4 8

13 10

4 4

1 1

0 1

22 24

Totals

12

23

8

2

1

46

Table 2. Results of 16 controlled crosses performed with grasshoppers collected at Torrox (Ma´laga, Spain) in 1998 Cross Bs in parents

Eggs

Embryos Fertile eggs Embryos analysed with

Mother Father 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

1 1 1 1 1 1 1 1 1 1 2 2 2 2 3 4

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0

71 149 41 83 119 127 142 96 156 88 136 130 140 13 75 92

56 55 27 59 92 97 102 78 137 81 82 61 117 10 25 30

0.789 0.369 0.659 0.711 0.773 0.764 0.718 0.813 0.878 0.920 0.603 0.469 0.836 0.769 0.333 0.326

0B

1B

2B

3B

4B

30 26 29 28 51 53 38 27 64 34 13 7 7 2 2 3

24 27 17 29 41 44 58 51 73 47 48 13 74 4 16 8

2 0 0 0 0 0 1 0 0 0 17 12 30 2 7 14

0 0 0 0 0 0 0 0 0 0 0 3 0 0 0 4

0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1

Total

Mean Bs

kB

Z

P

56 53 46 57 92 97 97 78 137 81 78 35 111 8 25 30

0.500 0.509 0.370 0.509 0.446 0.454 0.619 0.654 0.533 0.580 1.051 1.314 1.207 1.000 1.200 1.733

0.500 0.509 0.370 0.509 0.446 0.454 0.619 0.654 0.533 0.580 0.526 0.657 0.604 0.500 0.400 0.433

0.000 0.137 –1.769 0.132 –1.043 –0.914 2.335 2.717 0.769 1.444 0.453 1.859 2.183 0.000 –1.000 –0.730

1.000 0.891 0.077 0.895 0.297 0.361 0.020 0.007 0.442 0.149 0.651 0.063 0.029 1.000 0.317 0.465

Cytogenet Genome Res 106:338–343 (2004)

339 197

Fig. 1. Distribution of kB values obtained from controlled crosses performed with grasshoppers collected at Torrox (Ma´laga, Spain) in 1998 and 1992 (Zurita et al., 1998). Error bars represent minimum and maximum values, box extremes coincide with the first and third quartiles, and the dot indicates the median value.

Table 3. Estimation of the load caused by B24 in the 1992 Torrox population, based on the B frequency and egg fertility data reported by Zurita et al. (1998) 0B Number of females 4 Relative frequency 0.18 Egg fertility 0.95 Relative Fitness 1 Post selection frequency 0.18

+

1B

2B

Mean fitness

Load

13 0.59 0.81 0.86 0.51

5 0.23 0.68 0.71 0.16

0.85

0.15

lower than 0.5. This 3/16 of crosses showing B accumulation is significantly lower than the 11/18 observed in 1992 in the same population (Zurita et al., 1998) (Fisher exact test: P = 0.017). On average, kB in these 16 crosses (mean = 0.520, SEM = 0.021) did not differ significantly from the Mendelian one (t = 0.848, P = 0.410), which suggests that B24 is very close to neutralization. In order to test the temporal evolution of B drive, we compared the kB values reported by Zurita et al. (1998) with the present ones. An ANCOVA with kB as dependent variable, year as fixed factor and number of Bs in the female as a covariate, showed that kB is independent of the number of Bs (F1,31 = 1.0344; P = 0.317) but decreased significantly from 1992 (kB = 0.696) to 1998 (kB = 0.523) (F1,31 = 8.4524, P = 0.007). Variance in kB has also decreased significantly from 1992 (0.046) to 1998 (0.008) (F ratio test = 6.08, P = 0.001). This decrease in variance could be indicative of a strong selection for kB = 0.5, i.e., an increase in frequency of a putative drive modifier gene, thus forcing Bs to obey the Mendelian segregation law (Fig. 1). This result provides the first direct evidence for the neutralization of a parasitic B chromosome (B24) through the suppression of its drive in the Torrox population. The suppression had practically been completed by 1998 implying a 26 % decrease in kB from 1992 to 1998 (an average of 4.3 % per year).

340 198

Cytogenet Genome Res 106:338–343 (2004)

Our model of B chromosome evolution (Camacho et al., 1997) used polygenic modification of the drive rate, and predicted that for a B chromosome with the characteristics shown by B24 in Torrox, drive suppression should have taken place in about 40 generations. The process, however, has run much faster than expected, which raises several possible explanations: i) Torrox E. plorans populations might produce more than one generation a year, resembling the laboratory non-diapause rearing. Although we have not yet made a detailed phenology of this population, the existence of six or more generations a year is, however, very unlikely. ii) Perhaps the polygenic assumption is not valid and the suppression is based on a single gene, or a few genes of major effects. The drive data in 1992 appear to be bimodal (Fig. 3), suggesting the presence of a single modifier gene. Assuming that drive greater than 0.7 represents one homozygote (m+m+), drive of 0.55–0.7 the heterozygote (m+m) and less than 0.55 the other homozygote (mm), the suppressor gene (m) frequency would have changed from 0.36 in 1992 (three females being homozygous, seven being heterozygous and eight lacking suppressor genes) to 0.75 in 1998 (11 homozygous and five heterozygous females). If this were attributable to selection, the estimate of the annual selection coefficient is ln(0.75/0.36)/6 = 0.12 (assuming a generation per year). Previous analyses, trying to detect harmful effects of B chromosomes in natural populations of E. plorans have failed to find them at the level of mating frequency (Lo´pez-Leo´n et al., 1992b), embryo-adult viability, post-mating selection and egg fertility (Camacho et al., 1997). But these analyses were performed for the B2 chromosome in populations where it seemed to have been neutralized for a long time. In fact, laboratory crosses performed with specimens from these populations, manipulating mating frequency, showed that B chromosomes severely reduced egg fertility with mating scarcity, suggesting that this fitness component is sensitive to B presence in lowdensity populations (Muñoz et al., 1998). This was confirmed by the egg fertility decrease caused by the driving B24 variant in Torrox in 1992 (Zurita et al., 1998). An ANCOVA with egg fertility as dependent variable, year as fixed factor and number of Bs in the female as a covariate, showed that egg fertility decreased significantly from 1992 (0.806) to 1998 (0.712) (F1,42 = 5.74; P = 0.021) and also decreased significantly with increasing number of Bs in the female (F1,42 = 27.06; P ! 0.001). All these observations allow assuming that the main load caused by B24 is on egg fertility. An estimate of this load in Torrox, based on the 1992 data (Table 3), indicated a 15 % load, which creates the conditions for a fast frequency increase of a drive-modifier gene that could both restore egg fertility and control B-chromosome drive. This might explain the easiness for drive suppression in E. plorans, manifested by the absence of drive for the principal B chromosomes in the Iberian Peninsula (Lo´pez-Leo´n et al., 1992a). The average egg fertility in the 1998 sample (0.71 B 0.03) was lower than that observed in 1992 (0.81 B 0.03), implying a 9.4 % decrease in the six years, equivalent to 2.07 % per year. This is consistent with an overall cost for suppression of about 3 %. Figure 2a suggests that the main change in egg fertility between 1992 and 1998 engaged 0B females, whose fertility had remarkably decreased in these six

1.0 0.9 0.8

Egg fertility

0.7 0.6 0.5 0.4 0.3 0.2 0

A

1

2

3

4

3

4

Number of B chromosomes

1.0 0.9

Fig. 2. Effects of B chromosomes on female fitness measured by the proportion of embryos containing an embryo (egg fertility). Solid squares and lines represent the 1992 sample and open circles and broken lines the 1998 sample. Values are means and error bars represent one standard error. (A) Actual data, (B) relative egg fertilities based on normalization with respect to 0B fertility.

Relative egg fertility

0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 0

B

1

2

Number of B chromosomes

Fig. 3. Distribution of kB values in the experimental samples of females. Arrow points to the distribution mean values.

Cytogenet Genome Res 106:338–343 (2004)

341 199

A

0.85 0.80 0.75 0.70

KB

1992

0.65 0.60 0.55 1998

0.50

0

10

20

30

40

50

60

70

80

90

100

50

60

70

80

90

100

50 60 Generations

70

80

90

100

B

Mean number of Bs

2.4

1.8

1.2

0.6

0.0

C

0

10

20

30

40

0

10

20

30

40

1.0 0.9

Frequency of m

0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0

Fig. 4. Evolution of mean kB (A), mean number of Bs (B) and frequency of a drive-modifier gene (C) in a simulated population with the following starting parameters: B chromosome drive = 0.8, B frequency = 0.1, drivemodifier frequency = 0.01, no drive through males, frequency of B chromosome bivalents at meiosis = 0.2, no reproduction of individuals with more than three B chromosomes. We assumed that the drive modifier allele (m) reduce both drive and virulence. B chromosomes reduced egg fertility in m+m+ females according to this distribution: 0B = 1.0, 1B = 0.81, 2B = 0.68, 3B = 0.5. Females of mm genotype showed complete fertility (1). Fertility of heterozygous females depends on h, the dominance of the drive-modifier allele. Continuous lines represent h = 1 (dominance) with no resistance cost, broken lines h = 0 and no cost, dot lines h = 1 with a 3 % cost, and broken dot lines h = 0 with 3 % cost. In A, confidence intervals for actual 1992 and 1998 kB means are represented by min-max bars.

342 200

Cytogenet Genome Res 106:338–343 (2004)

years. This could reflect a certain cost of B drive suppression because some 0B females could harbour the suppressor genes. However, the reduction in fertility observed in 1998 could also be due to uncontrolled environmental factors acting in the E. plorans populations submitted to increased environmental stresses because of their natural environment being anthropically changed, which generally could produce a decrease in fertility and viability (Hoffmann and Parson, 1993). Relative fertilities (referred to that of 0B females) in the 1998 sample showed a typical (but not significant) tolerance response curve, indicating that tolerant genotypes would be able to carry one or two B chromosomes with less reduction in fitness (see Fig. 2b). It is also remarkable that egg fertility at population level continues being significantly lower than that observed in populations with neutralized Bs since long, e.g. B2 at Salobreña and Jete populations, where it was close to 100 % (Lo´pez-Leo´n et al., 1992a). Although tentatively, it might indicate that the E. plorans A genome seems to have ease in neutralizing B chromosome drive but is less prepared to get rid of deleterious effects caused by B chromosomes. This might simply be due to a different genetic architecture of both phenomena, i.e. single gene drive suppression but polygenic tolerance to Bs. However, a rapid drive suppression is not compatible with a model where drive (measured by kB) and virulence (measured by the reduction in fertility) are independently counteracted by the A genome. We have modelled the evolution of monogenic drive suppression by parameterizing it with data obtained from the 1992 sample (see Materials and methods and Fig. 4) and found that the condition promoting the faster reduction in drive is the coupling of drive-resistance with egg fertility, which could be conceivable if B-effects on fertility would be by-products of the B drive mechanism. For a dominant drive-modifier gene (m) causing a reduction of both B drive and egg fertility, it would take 35 generations to decrease mean kB from 0.70 to 0.52 (the observed values in 1992 and 1998, respectively), and even more if m would be recessive (see Fig. 4 for details). The inclusion of a resistance cost of around 3 % did not substantially modify the results. Although 35 generations is a high number even in the case of two generations per year, the experimental confidence intervals of estimations (see Fig. 4a) allow experimental data to fit in the model. Taking into account the inherent experimental sampling error, a few generations would be enough to produce a decrease in kB similar to that observed in the Torrox population. In addition to sampling error, other possibilities remain, at least at the theoretical level, to explain the rapid suppression of B accumulation. Fluctuations in population size that could randomly accelerate this process, other selective pressures acting against B chromosomes, such as the decrease in mating of Bcarrying males reported by Martı´n et al. (1996), or epigenetic changes in the B chromosome producing trans-generational neutralization induced by the modifier gene, are some possibilities to explore. It has been usual to attribute a cost to any allele producing resistance to a parasite (Combes, 2001), but this cost could be negligible (Brown, 2003) and not strictly necessary to maintain a polymorphism for resistant alleles in spatially structured populations (Thrall and Burdon, 2002). If a polymorphism for a

drive modifier gene exists in the host population, some individuals could be pre-adapted to a new B chromosome variant, and the increase in frequency of the modifier gene could actually be fast because it is not necessary to wait for a hopeful mutation. B24 is not the first B that invaded the Torrox population since it has recently replaced a former B variant (B2, a neutralized B lacking drive) (Henriques-Gil and Arana, 1990) by virtue of meiotic drive in females (Zurita et al., 1998). When B24 first appeared, the A genome in this population presumably contained a high frequency of suppressors against B2, as a consequence of its previous suppression. The successful invasion

by B24 suggests that these suppressors were not active against it, which might be due to some quantitative or qualitative difference in B2 and B24 mechanisms of drive. Both B chromosome types are mainly made up of two types of repetitive DNA (ribosomal DNA and a 180-bp tandem repeat DNA) with B24 harboring less ribosomal DNA but a higher amount of the 180-bp repeat (Cabrero et al., 1999). The possibility remains that the specific mechanism for B24 is based on this repetitive DNA. Anyway, the A genome has again found its pathway to suppress the drive of this new parasitic B, and the arms race goes on.

References Brown JKM: A cost of disease resistance: paradigm or peculiarity? Trends Genet 19:667–671 (2003). Cabrero J, Lo´pez-Leo´n MD, Bakkali M, Camacho JPM: Common origin of B chromosome variants in the grasshopper Eyprepocnemis plorans. Heredity 83:435–439 (1999). Camacho JPM, Cabrero J, Viseras E, Lo´pez-Léon MD, Navas-Castillo J, Alche: G-banding in two species of grasshoppers and its relationship to C, N and fluorescence banding techniques. Genome 34:638– 643 (1991). Camacho JPM, Shaw MW, Lo´pez–Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997). Camacho JPM, Sharbel TF, Beukeboom LW: B chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Camacho JPM, Cabrero J, Lo´pez-Leo´n MD, Bakkali M, Perfectti F: The B chromosomes of the grasshopper Eyprepocnemis plorans and the intragenomic conflict. Genetica 117:77–84 (2003). Cebria´ A, Navarro ML, Puertas MJ: Genetic control of B chromosome transmission in Aegilops speltoides (Poaceae). Am J Bot 81:1502–1507 (1994). Chiavarino AM, Gonzalez-Sanchez M, Poggio L, Puertas MJ, Rosato M, Rosi P: Is maize B chromosome preferential fertilization controlled by a single gene? Heredity 86:743–748 (2001). Combes C: Parasitism: The Ecology and Evolution of Intimate Interactions (Chicago University Press, Chicago 2001). Gonzalez-Sanchez M, Gonzalez-Gonzalez E, Molina F, Chiavarino AM, Rosato M, Puertas MJ: One gene determines maize B chromosome accumulation by preferential fertilisation; another gene(s) determines their meiotic loss. Heredity 90:122–129 (2003). Henriques-Gil N, Arana P: Origin and substitution of B chromosomes in the grasshopper Eyprepocnemis plorans. Evolution 44:747–753 (1990). Herrera JA, Lo´pez-Leo´n MD, Cabrero J, Shaw MW, Camacho JPM: Evidence for B chromosome drive suppression in the grasshopper Eyprepocnemis plorans. Heredity 76:633–639 (1996).

Hewitt GM: Variable transmission rates of a B chromosome in Myrmeleotettix maculatus (Thunb.). Chromosoma 40:83–106 (1973). Hoffmann AA, Parson PA: Evolutionary Genetics and Environmental Stress (Oxford University Press, Oxford 1993). Jiménez MM, Romera F, Gallego A, Puertas MJ: Genetic control of the rate of transmission of rye B chromosomes. II. 0B × 2B crosses. Heredity 74: 518–523 (1995). Jones RN: B-chromosome drive. Am Nat 137:430–442 (1991). Jones RN, Rees H: B Chromosomes (Academic Press, New York 1982). Lo´pez-Leo´n MD, Cabrero J, Camacho JPM, Cano MI, Santos JL: A widespread B chromosome polymorphism maintained without apparent drive. Evolution 46:529–539 (1992a). Lo´pez-Leo´n MD, Pardo MC, Cabrero J, Camacho JPM: Random mating and absence of sexual selection for B chromosomes in two natural populations of the grasshopper Eyprepocnemis plorans. Heredity 69:558–561 (1992b). Martı´n S, Arana P, Hernriques-Gil N: The effect of B chromosomes on mating success of the grasshopper Eyprepocnemis plorans. Genetica 97:197–203 (1996). Muñoz E, Perfectti F, Martı´n-Alganza A, Camacho JPM: Parallel effect of a B chromosome and a mite decreasing female fitness in the grasshopper Eyprepocnemis plorans. Proc R Soc Lond Ser B 265: 1903–1909 (1998). Müntzing A: Cytogenetics of accessory chromosomes (B-chromosomes). Proceedings of the 9th International Congress of Genetics. Caryologia S6:282– 301 (1954). Nur U: Maintenance of a ‘parasitic’ B chromosome in the grasshopper Melanoplus femur–rubrum. Genetics 87:499–512 (1977). Nur U, Brett BLH: Genotypes suppressing meiotic drive of a B chromosome in the mealy bug Pseudococcus obscurus. Genetics 110:73–92 (1985).

Nur U, Brett BLH: Control of meiotic drive of B chromosomes in the mealy bug Pseudococcus affinis (obscurus). Genetics 115:499–510 (1987). Nur U, Brett BLH: Genotypes affecting the condensation and transmission of heterochromatic B chromosomes in the mealy bug Pseudococcus affinis. Chromosoma 96:205–212 (1988). Parker JS, Taylor S, Ainsworth CC: The B chromosome system of Hypochoeris maculate III. Variation in B-chromosome transmission rates. Chromosoma 85:229–310 (1982). Puertas MJ, Jiménez G, Manzanero S, Chiavarino AM, Rosato M, Naranjo CA, Poggio L: Genetic control of B chromosome transmission in maize and rye, in Olmo E, Redi CA (eds): Chromosomes Today, vol 13, pp 79–92 (Birkhäuser Verlag, Basel 2000). Romera F, Jiménez MM, Puertas MJ: Genetic control of the rate of transmission of rye B chromosomes. I. Effects in 2B × 0B crosses. Heredity 66:61–65 (1991). Rosato M, Chiavarino AM, Puertas MJ, Naranjo CA, Poggio L: Genetic control of B chromosome transmission rate in Zea mays ssp. mays (Poaceae). Am J Bot 83:1107–1112 (1996). Shaw MW, Hewitt GM: The genetic control of meiotic drive acting on the B chromosome of Myrmeleotettix maculatus (Orthoptera: Acrididae). Heredity 54:259–268 (1985). Shaw MW, Hewitt GM: B chromosomes, selfish DNA and theoretical models: where next? in Futuyma D, Antonovics J (eds): Oxford Surveys in Evolutionary Biology, Vol 7 pp 197–223 (Oxford University Press, Oxford 1990). Shaw MW, Hewitt GM, Anderson DA: Polymorphism in the rates of meiotic drive acting on the chromosome of Myrmeleotettix maculatus. Heredity 55: 61–68 (1985). Thrall PH, Burdon JJ: Evolution of gene for gene systems in metapopulations: the effect of spatial scale of host and pathogen dispersal. Plant Pathol 52: 350–361 (2002). Zurita S, Cabrero J, Lo´pez-Leo´n MD, Camacho JPM: Polymorphism regeneration for a neutralized selfish B chromosome. Evolution 52:274–277 (1998).

Cytogenet Genome Res 106:338–343 (2004)

343 201

Transmission of B Chromosomes Cytogenet Genome Res 106:344–346 (2004) DOI: 10.1159/000079310

Transmission analysis of B chromosomes in Rattus rattus from Northern Africa S. Stitou, F. Zurita, R. Dı´az de la Guardia, R. Jiménez and M. Burgos Departamento de Genética and Instituto de Biotecnologı´a, Facultad de Ciencias, Universidad de Granada, Granada (Spain)

Abstract. Traditionally, B chromosomes have been classified as parasitic or heterotic, depending of whether or not they show selfish behaviour. Nevertheless, experimental evidence has been found supporting the idea that supernumerary chromosomes may evolve from parasitism to neutrality. In this work, B chromosome transmission in Rattus rattus has been analysed by performing several crosses between individuals carrying different numbers of supernumerary chromosomes.

Our results demonstrated a Mendelian transmission rate through males, but slight accumulation of the Bs through females. This parasitic behaviour is shared in populations as distant as Asia and Africa, and even in a related species in Australia, suggesting the possibility of an ancient origin of these supernumerary chromosomes.

Maintenance and evolution of B chromosomes in natural populations relies mainly in two important qualities: (1) their mode of transmission, and (2) their effects on host fitness. B chromosomes have traditionally been classified regarding these qualities as “parasitic” or “heterotic”. According to the parasitic model, B chromosomes are selfish genetic elements that decrease host fitness, thus generating a genetic conflict between the A and B chromosomes, but these selfish chromosomes are maintained in the population by virtue of their accumulation mechanisms (Östergren, 1945; Thomson, 1984; Jones, 1985; Nur et al., 1988). The heterotic model (White, 1973) does not imply a genetic conflict between the A and B chromosomes, but rather assumes that Bs are maintained because they increase the fitness of the host individual when they are at low frequency, so accumulation mechanisms are not needed. A third model proposed by Camacho and colleagues (1997) assumes a nonstable situation. Parasitic B chromosomes spread through the

population by virtue of accumulation mechanisms, but as they increase their frequency, they are neutralized by the host genome, and tend to disappear slowly unless a new parasitic variant replaces the neutralized B. Studies in mammalian B chromosomes are relatively scarce, mainly due to the low proportion (about 1 %) of mammalian species in which supernumerary chromosomes have been described (for review see Vujosˇevic and Blagojevic, 2004). This scarcity is even higher in respect to transmission studies because of the inherent difficulties in setting up directed crossings and the low number of offspring. Despite these difficulties, rodents, in which B chromosomes seem to be more frequent than in other mammals, have been more extensively studied, and there are some data regarding B transmission. In particular, the B chromosomes in Rattus rattus, have been extensively studied by various investigators (see Yosida, 1980 for a review), and molecular cytogenetic characterization has been performed in our laboratory (Stitou et al., 2000). Our previous studies have demonstrated the presence of inactive ribosomal cistrons scattered throughout these B chromosomes, suggesting that these parasitic chromosomes could have originated from one of the NOR-carrying chromosomes, and that the ribosomal genes were dispersed and inactivated by heterochromatinization and methylation. Transmission data have also been reported by Yosida (1978) in Asian populations and in a closely related species, Rattus fuscipes, from Australia by Thomson

Received 19 December 2003; manuscript accepted 16 January 2004. Request reprints from: Dr. Miguel Burgos Departamento de Genética and Instituto de Biotecnologı´a Facultad de Ciencias, Universidad de Granada, SE–18071 Granada (Spain) telephone: +34-958-243-260; fax: +34-958-244-073 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0344$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. Classification of the offspring obtained in different crosses of Rattus rattus with various combinations of B-carriers individuals

Cross

Litters

Couple

0B

1B

2B

Total

M1B × F0B

3

M0B × F1B

9

M1B × F1B

3

1 2 Total 1 2 3 4 Total 1 2 4 Total

5 3 8 8 3 1 3 15 1 5 6

5 1 6 16 4 4 2 26 3 3 6

1 1 2 4 3 9

10 4 14 24 7 6 5 42 6 12 3 21

M2B × F0B

3

1 2 Total

-

9 9 18

2 2

9 11 20

kB

0.43

0.67

0.57

0.55

kB: transmission rate per B chromosome. M: Male; F: Female.

(1984). In this paper, we report our results concerning transmission in specimens from North African populations, including crosses between individuals carrying different numbers of Bs.

Materials and methods Laboratory procedures Eight males and six females of Rattus rattus were trapped live in Fez (Morocco). Their karyotypes were determined by partial splenectomy. Spleen cells were resuspended with a manual homogenizer in 2 ml RPMI 1640 cell culture medium supplemented with 15 % fetal calf serum. Remaining fragments of tissue were let to sediment by gravity, and the supernatant transferred to a sterile 10-ml centrifuge tube. RPMI 1640 was added up to 6 ml, and the cells were treated in vitro with 30 Ìl colchicine. Cells were then processed for chromosomes preparation as described by Burgos et al. (1986). B chromosomes were easily identified in C-banded preparations (Sumner, 1972). Adult individuals with known karyotypes were then selected to establish crosses in order to investigate the transmission of the B chromosomes. Crosses were classified into four categories: male(1B) × female(0B); male(0B) × female(1B); male(1B) × female(1B) and male(2B) × female(0B). Because of the reduced litter size, we analyzed several litters from each couple, when it was possible. A total of 96 individuals from 18 litters, coming from 11 couples were analysed (Table 1). The karyotype of the offspring was also determined by partial splenectomy, as described, although a few litters were studied at embryonic stage. In this case, cells from embryos were processed as described for spleen cells. Statistical analysis The Mendelian transmission rate (0.5) was tested by the ¯2 test to the total offspring obtained in each cross type. This inevitably implies some pseudoreplication since the offspring from a same couple are not independent. In the male(1B) × female(0B) cross, the null hypothesis predicted that 1/2 of the offspring should carry a B chromosome, the same as in the reciprocal cross, i.e. male(0B) × female(1B). This implies an expected transmission rate per B chromosome (kB) equal to 0.5. In the male(1B) × female(1B) cross, 1/2 of the gametes produced by the male should carry the B, as should occurs in the female. Thus the final proportion of the offspring should be 1/4 with 0 Bs, 1/4 with 2 Bs, and 1/2 with 1 B. In the male(2B) × female(0B) cross, the frequency of the different karyotypic classes in the offspring would depend on the frequency with which the two Bs form a bivalent in spermatogenesis. Previous data from our laborato-

ry (Pretel and Dı´az de la Guardia, 1978) demonstrated that the B chromosomes of Rattus rattus ssp frugivorus from Spain form bivalents in 25 % of primary spermatocytes and behave as univalent in the remaining 75 %. If this meiotic behaviour would also take place in Moroccan males, the expected frequency of sperm with 0B, 1B and 2B chromosomes would be calculated as follows. In 1/4 of meioses, the two Bs would pair and (presumably) segregate, yielding gametes with a single B chromosome. In 3/4 of meioses, the two Bs would not pair and would segregate at random, going to opposite poles in 1/2 of anaphase I cells, and to the same pole in the remaining 1/2. Thus, the overall figures for the three expected classes of sperm would be: 0B = 0 + 3/4 × 1/4 = 3/16 1B = 1/4 + 3/4 × 1/2 = 10/16 2B = 0 + 3/4 × 1/4 = 3/16

Results and discussion The fact that B chromosomes are present in many natural populations of Rattus rattus (Yosida, 1980), suggests that transmission mechanisms of these chromosomes have probably assured their spreading. Mechanisms based on the mitotic instability of the Bs seem not to play a role in this case, as no signs of such instability have been detected (Yosida, 1980 and present study). As Table 1 shows, no meiotic drive for B chromosomes seems to occur through males, since the results obtained in the male(1B) × female(0B) cross (kB = 0.43) did not differ from those expected for a Mendelian transmission rate (¯2(1df) = 0.29; 0.7 1 P 1 0.5). Nevertheless, the reciprocal cross, i.e. male(0B) × female(1B), showed borderline significant accumulation of the B chromosome through females (kB = 0.67), as the ¯2 test led to the rejection of the hypothesis of Mendelian transmission rate (¯2(1df) = 3.93; 0.05 1 P 1 0.01). One of the males in the offspring of couple 3 had two supernumerary chromosomes, suggesting that non-disjunction of the B chromosome eventually occurs during oogenesis. Nevertheless, these non-disjunction events must occur at low frequency, as only one case was detected among a total of 42 individuals. For the former ¯2 test, this

Cytogenet Genome Res 106:344–346 (2004)

345 203

individual was considered twice because its mother transmitted two B chromosomes. Since B accumulation through females seems to be weak, in crosses where both parents carried a single B chromosome, i.e. male(1B) × female(1B), the slight accumulation through the female seemed to be diluted by the slight B elimination through males, and ¯2 did not reject the hypothesis of a Mendelian transmission rate (¯22df = 4.71; 0.1 1 P 1 0.05). The male(2B) × female(0B) crosses also suggested a Mendelian transmission rate of the B through R. rattus males (kB = 0.55). The frequencies of 0B, 1B and 2B offspring, however, did not fit to the expected from the meiotic behaviour described in Spanish specimens by Pretel and Dı´az de la Guardia (1978) (¯22df = 6.99; 0.05 1 P 1 0.01). Since most of the offspring carried a single B, we inferred that the frequency of B bivalent formation and segregation in Moroccan males is much higher than that observed in Spanish ones. In consequence, although these B chromosomes show a Mendelian transmission rate through the males, the Bs can be considered parasitic as they accumulate through the females. Yosida (1978) analysed B chromosome transmission in specimens from Asian populations and, although the types of cross in his study were not exactly comparable to those reported here, evidence for accumulation through females was also the rule, although B accumulation in Asian specimens seemed to be higher than in African ones. The similar parasitic behaviour of R. rattus B chromosomes in so distant populations from Asia and Africa might support an ancient origin of these B chromosomes. Under the scope of the theory of centromeric drive, Palestis and colleagues (2004) proposed that B chromosomes should be more frequent in mammals with acrocentric karyotypes, and demonstrated that this is the actual situation. The karyotype of R. rattus has evolved mainly through pericentric inversions and centric fusions (Yosida, 1980). Pericentric inversions do imply

neither an increase nor a decrease in number of centromeres, so they should be neutral concerning centromeric drive. Centric fusions imply a decrease in the number of centromeres, suggesting a selection “favoring less centromeres”, and making it difficult to understand why the B chromosomes of R. rattus are so widespread and have been maintained for a long period. Palestis and colleagues (2004) suggested the possibility that Bs flourishing when extra centromeres are being favored may evolve tricks that work even when extra centromeres are being disfavored. This might occur in R. rattus, specially taking into account the possible ancient origin of their supernumerary chromosomes. Rattus fuscipes is a related Australian species in which Thomson (1984) showed the absence of B accumulation through males but significant accumulation through females. Once again, the parasitic behaviour seems to be the rule, which in R. fuscipes is further supported by the harmful effect of the supernumerary chromosomes that caused a disproportionate loss of B carrier individuals before the breeding season. This might suggest a common origin of these supernumerary chromosomes in both related species, presumably taking place before the evolutionary divergence between these species (Camacho, 2004). The presence of rDNA in the Bs from African R. rattus (Stitou et al., 2000) suggest a possible test for the former hypothesis by looking for the presence of these DNA sequences in Bs from Asian R. rattus and Australian R. fuscipes. Although this kind of evidence would not be in itself conclusive, it would provide a first indication that could later be complemented with the analysis of other DNA sequences possibly shared by these Bs.

Acknowlegements We thank Dr. J.P.M. Camacho for his critical reading and very useful suggestions for writing this manuscript.

References Burgos M, Jiménez R, Dı´az de la Guardia R: A rapid, simple and reliable combined method for G-banding mammalian and human chromosomes. Stain Technol 61:257–260 (1986). Camacho JPM: B chromosomes, in Gregory TR (ed): The Evolution of the Genome (Elsevier, Amsterdam 2004). Camacho JPM, Shaw MW, Lo´pez-leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997). Jones RN: Are B chromosomes selfish? in CavalierSmith T (ed): The Evolution of Genome Size, pp 397–425 (John Wiley & Sons, London 1985). Nur U, Werren JH, Eickbush DG, Burke WD, Eickbush TH: A “selfish” B chromosome that enhances its transmission by eliminating the paternal chromosomes. Science 240:512–514 (1988).

346 204

Östergren G: Parasitic nature of extra fragment chromosomes. Botaniska Notiser 2:157–163 (1945). Palestis BG, Burt A, Jones RN, Trivers R: B chromosomes are more frequent in mammals with acrocentric karyotypes: support for the theory of centromeric drive. Proc R Soc Lond B 271:S22–S24 (2004). Pretel A, Dı´az de la Guardia R: Chromosomal polymorphism caused by a supernumerary chromosome in Rattus rattus ssp frugivorus (Rafinesque, 1814) (Rodentia, Muridae). Experientia 34:325– 327 (1978). Stitou S, Dı´az de La Guardia R, Jiménez R, Burgos M: Inactive ribosomal cistrons are spread throughout the B chromosomes of Rattus rattus (Rodentia, Muridae). Implications for their origin and evolution. Chromosome Res 8:305–311 (2000).

Cytogenet Genome Res 106:344–346 (2004)

Sumner AT: A simple technique for demonstrating centromeric heterochromatin. Expl Cell Res 75:304– 306 (1972). Thomson RL: B chromosome in Rattus fuscipes ii. The transmission of B chromosomes to offspring and population studies: Support for the “parasitic” model. Heredity 52:367–372 (1984). Vujosˇevic M, Blagojevic J: B chromosomes in populations of mammals. Cytogenet Genome Res 106: 247–256 (2004). White MJD: Animal Cytology and Evolution (Cambridge University Press, London 1973). Yosida TH: Some genetic analyses of supernumerary chromosomes in the black rat in laboratory matings. Proc Jpn Acad 54:440–445 (1978). Yosida TH: Cytogenetics of the black rat, in Karyotype Evolution and Species Differentiation (University of Tokyo Press, Tokyo 1980).

Transmission of B Chromosomes Cytogenet Genome Res 106:347–350 (2004) DOI: 10.1159/000079311

B chromosomes and Robertsonian fusions of Dichroplus pratensis (Acrididae): intraspecific support for the centromeric drive theory C.J. Bidau and D.A. Martı´ Laboratorio de Genética Evolutiva, Universidad Nacional de Misiones, Posadas (Argentina)

Abstract. We tested the centromeric drive theory of karyotypic evolution in the grasshopper Dichroplus pratensis, which is simultaneously polymorphic for eight Robertsonian fusions and two classes of B chromosomes. A logistic regression analysis performed on 53 natural populations from Argentina revealed that B chromosomes are more probably found in populations with a higher proportion of acrocentric chromosomes, as the theory predicts. Furthermore, frequencies of B-carrying

individuals are significantly negatively correlated with the mean frequency of different Robertsonian fusions per individual. No significant correlations between presence/absence or frequency of Bs, and latitude or altitude of the sampled populations, were found. We thus provide the first intraspecific evidence supporting the centromeric drive theory in relation to the establishment of B chromosomes in natural populations.

Two different types of B chromosomes have been described in the South American grasshopper Dichroplus pratensis (Melanoplinae, Acrididae) (Bidau, 1986, 1987). One of these Bs carries an active NOR and exhibits assortment-distortion with respect to the X in male meiosis (Bidau, 1986; Bidau et al., 2004). The other is mitotically unstable and its numbers vary from 0 to 5 between and within testis follicles in B male carriers (Bidau, 1987; Martı´, 2002). Nevertheless, and despite the enormous geographical distribution of the species and the large number of natural populations sampled to date (Bidau and Martı´, 2002, 2004), these B chromosomes are rare within the

species. Their frequencies are very low in marginal populations hundreds of kilometers apart, while they are virtually absent in intermediate populations except in hybrid zones (Bidau and Martı´, 2002). D. pratensis is also a classical example of Robertsonian (Rb) variation in nature. The species, which is widespread in Argentina, Uruguay and Southern Brazil, is polymorphic and polytypic for a complex system of eight centric fusions that involve the six large autosomal pairs of the 2n = 19 =/20Y standard all-acrocentric karyotype (Bidau et al., 1991). These translocations have profound effects on chiasma frequency and localisation (Bidau, 1990, 1993; Bidau and Martı´, 1995) and it was recently found that the distribution of the polymorphisms shows a central-marginal variation (Bidau and Martı´, 2002, 2004). Thus, D. pratensis offers a unique opportunity to test intraspecifically, the predictions of the centromeric drive theory of karyotypic evolution (Pardo-Manuel de Villena and Sapienza, 2001a, b) and its extension to B chromosomes as Palestis et al. (2004) have done interspecifically for mammals. Under this theory, it is hypothesized that B chromosomes should be favored in populations in which there is a bias in chromosomal segregation during female meiosis, resulting in acrocentric chromosomes driving toward the functional (oocyte) pole of the spindle that, in this case, is the more efficient one in capturing centromeres. B chromosomes add new centromeres to the cell thus, in populations where the female spin-

The research of D.A.M. was supported by a CONICET postdoctoral scholarship. C.J.B. is especially indebted to Dr Lena Geise (Universidade do Estado do Rio de Janeiro) and Dr Ilana Zalcberg (Instituto Nacional do Cancer, Rio de Janeiro) in whose laboratories this paper was written during a sabbatical leave financed by Fundaça˜o de Amparo a Pesquisa do Rio de Janeiro (FAPERJ, Brazil). This work was partially financed through grant PID 0022 CONICET to C.J.B. Received 16 January 2004; manuscript accepted 9 February 2004. Request reprints from Claudio J. Bidau at his present address: Laborato´rio de Zoologia de Vertebrados, Departamento de Zoologia Universidade do Estado do Rio de Janeiro Rua Sa˜o Francisco Xavier 524, Maracana˜ Rio de Janeiro, RJ 20550-900 (Brasil); telephone: 0055 21 2587 7980 fax: 0055 21 2587 7655; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0347$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. Characteristics of the Dichroplus pratensis populations polymorphic for B chromosomes. Rb fusions indicates the different arm combinations found in metacentrics of each population; Type indicates if populations are ecologically marginal or central, or if they belong to a hybrid zone; F is the mean frequency of different Rb fusions per individual; B frequency (%) represents the number of individuals harbouring Bs irrespective of sex or B chromosome type

Population

Latitude (S)

Altitude (masl)

Rb fusions

Type

F

B frequency (%)

Volcán Estación Mazán Carrizal La Granja Manantiales Tandil Balcarce Villa Ventana Sierra de la Ventana Cerro Ceferino El Atravesado Saldungaray Km784 Istmo Ameghino El Doradillo Puerto Madryn Lago Musters Diadema Argentina Rada Tilly

23º55' 28º44’ 28º54’ 33º30’ 33º33’ 37º13’ 37º49’ 38º04’ 38º06’ 38º06’ 38º08’ 38º12’ 40º04’ 42º27’ 42º48’ 42º49’ 45º30’ 45º47’ 45º57’

2474 646 522 125 134 171 97 161 250 456 240 242 43 55 20 18 261 326 0

None 2.5 2.5 1.6, 3.4, 2.5 1.6, 3.4, 2.5 1.6, 3.4 1.6, 3.4 1.6, 3.4, 1.2, 5.6 1.6, 3.4, 1.2, 5.6 1.2, 3.4, 5.6 1.6, 3.4, 1.2, 5.6 1.6, 3.4, 1.2, 5.6 1.6, 3.4, 5.6 1.4, 5.6 1.4, 5.6 1.4, 5.6 None None None

Marginal Marginal Marginal Central Central Central Central Hybrid zone Hybrid zone Hybrid zone Hybrid zone Hybrid zone Hybrid zone Marginal Marginal Marginal Marginal Marginal Marginal

0.00 1.00 1.00 1.72 1.61 2.00 1.80 3.00 2.33 3.00 2.69 1.73 1.20 0.25 0.15 0.26 0.00 0.00 0.00

3.0 11.0 25.0 5.5 7.1 6.7 10.0 2.0 2.2 5.6 11.0 5.0 5.0 15.8 20.0 20.0 9.1 12.1 14.3

dle polarity is reversed (i.e. the functional pole is the one that captures less centromeres), a high frequency of biarmed (metaand submetacentric) chromosomes is expected, but also, a low frequency of B chromosomes. The former hypothesis was tested in 53 natural populations of D. pratensis spanning the whole geographic range of the species.

Materials and methods For the analysis of B chromosome distribution in relation to metacentric vs acrocentric karyotypes within the species, we used our own published and unpublished data on B chromosome frequencies and Robertsonian (Rb) fusions frequencies (Bidau, 1986, 1987, 1990; Bidau and Martı´, 1995, 2002, 2004; Martı´, 2002). A total of 67 natural populations were scored but, for statistical analyses, only the 53 where at least 20 individuals had been karyotyped, were considered. Of these, 19 populations were polymorphic for one or both types of B chromosomes (Table 1). Frequency of Bs per population was calculated as the number of B carriers (regardless of sex and B chromosome type) within the total population sample. Since most populations are polymorphic for up to 4 Rb fusions, and the number of metacentrics in the karyotype varies between 0 and 6, we used the mean frequency of different Rb fusions per individual (F) as a measure of the degree of metacentricity/ acrocentricity of the karyotype. A value of F = 0 implies an all acrocentric fixed karyotype; a value of F = 3 may occur in a population where three fusions have become fixed (thus, all individuals carry 6 biarmed chromosomes), or in a polymorphic one where, if the frequency of each fusion is very high, individuals may carry from 3 to 6 biarmed autosomes (Bidau and Martı´, 1995). If the frequencies of the fusions are intermediate or low, the F value will be lower than 3 since individuals with 2, 1 or 0 fusions occur. The analyses were performed using logistic and linear regressions. To control for environmental factors that could presumably affect B frequencies in relation to Rb fusion frequencies, we also included latitude and altitude of the sampled populations as independent variables.

Results and discussion The B chromosomes of D. pratensis occur at low frequencies in 19 of 67 (29 %) populations of the species’ geographical range (Bidau, 1986; Bidau and Martı´, 2002; Martı´, 2002). The maximum observed frequency of individuals carrying B chro-

348 206

Cytogenet Genome Res 106:347–350 (2004)

mosomes was 25 % in the marginal Andean population of Carrizal. However, the distribution of Bs seems to be non-random (Fig. 1) (Bidau and Martı´, 2002). Considering the 53 populations where at least 20 individuals were karyotyped, a logistic regression of mean number of different fusions per individual per population (F) vs presence/absence of Bs indicated that populations with higher proportions of acrocentric chromosomes are more likely to harbour B chromosomes (r = – 0.322; P = 0.01646). Mean F values for the non-B and B populations were 1.90 and 1.25 respectively (Student’s t test; P = 0.01539). No statistically significant associations were found between presence/absence of Bs and either latitude (r = 0.133; P = 0.33771) or altitude (r = 0.100; P = 0.47186). Furthermore, when only the 19 populations harbouring Bs were considered, a significant negative correlation between frequency of B chromosomes and F was obtained in a multiple regression analysis using F, latitude and altitude as independent variables (r = –0.522; P = 0.02184) (Fig. 2). No significant correlations between Bs frequency and latitude (r = 0.199; P = 0.41407), and altitude (r = –0.244; P = 0.31409) were observed. A classic problem in evolutionary biology concerns the origin of karyotypic differences between species (White, 1978; King, 1993). Although chromosomal rearrangements such as Rb fusions or fissions usually accompany (and in some cases might cause) speciation, the mechanisms of fixation of the rearrangements in natural populations are controversial (White, 1978; King, 1993; Pardo-Manuel de Villena and Sapienza, 2001b). Recently, Pardo-Manuel de Villena and Sapienza (2001a, b) developed the theory of centromeric drive, that explains chromosomal evolution as a result of drive in the polarized meiosis of female mammals and other organisms. According to this theory, the functional spindle pole (the one that will give origin to the mature oocyte) may be the more or the less efficient in capturing centromeres. In each case, acrocentric or biarmed chromosomes will be favored respectively, and this fact can explain trends in karyotypic evolution that are not assessed by other models (Pardo-Manuel de Villena and Sapienza, 2001b).

Fig. 2. Linear regression of frequency of B chromosomes ( %) vs F (mean number of different fusions per individual) in 19 populations of Dichroplus pratensis. The regression equation is, Bfreq = 14.02 – 3.20 * F.

Fig. 1. Histograms of the number of Dichroplus pratensis populations with different F (mean number of different fusions per individual) values. (a) Populations without B chromosomes. (b) Populations with B chromosomes.

Palestis et al. (2004) tested this theory using mammalian B chromosomes, under the hypothesis that, since Bs are usually mantained by drive (Hewitt, 1979; Jones and Rees, 1982; Bell and Burt, 1990; Jones, 1991, 1995; Camacho et al., 2000) and they provide the cell with an extra centromere, a bias towards more centromeres in the functional pole during female meiosis should favor the establishment of B chromosomes, while a bias towards fewer centromeres should have the opposite effect. Indeed, Palestis et al. (2004) found, in a sample of 1116 mammals, that species with a higher proportion of acrocentrics in their karyotype tend to bear B chromosomes more probably than species with fewer acrocentrics. The centromeric drive theory may be tested in organisms other than mammals, since the polarity of female meiosis, that can sponsor centromeric drive, is common to most eukaryotes including insects. For example, grasshoppers have typically asymmetric oocyte spindles and B chromosomes are known to drive during female meiosis in some species (Hewitt, 1979; Cano and Santos, 1989; Santos et al., 1993). Thus, D. pratensis, being polymorphic for Bs and Rb fusions is an exceptional

model to test the centromeric drive theory as applied to B chromosomes. As already noted (Bidau and Martı´, 2002, 2004) B chromosomes in this species are more frequent in ecologically and geographically marginal populations which also have the lowest frequencies of Rb polymorphisms. In extreme marginal areas, populations have the all-acrocentric standard karyotype of 2n = 19 =/20Y (Bidau and Martı´, 2002). The central-marginal distribution of Rb fusions has been interpreted by us in terms of natural selection favoring all-acrocentric karyotypes in marginal areas and Rb polymorphisms in central parts of the range, because of the effects of Rb translocations on recombination (Bidau and Martı´, 2002). However, the origin of the tendency of D. pratensis to generate many different Rb fusions which may or may not become established in different populations, has not been determined. In the case of D. pratensis, the results of logistic regression analysis of the mean number of different Rb fusions per individual in a population vs presence/ absence of B chromosomes indicated that the centromeric drive theory as demonstrated for mammalian B chromosomes, also applies intraspecifically since Bs are more probably found (and with a higher frequency) in populations with basically acrocentric karyotypes. Furthermore, the centromeric drive theory offers a plausible explanation for the origin of differences in Rb fusion frequencies between marginal and central habitats. Central populations might have accumulated Rb fusions because of a change in polarity of the female meiotic spindle poles producing a bias towards less centromeres (thus, towards biarmed chromosomes) captured by the functional pole. Then, natural selection could have acted to mantain the resulting polymorphisms if they protected coadapted supergenes (Bidau and Martı´, 2002). But, as a consequence of the change in polarity of the female spindle, Bs found more difficulty to prosper in central populations. Our results are clearly consistent with the predictions of the centromeric drive theory, although it must be kept in mind that drive has not yet been demonstrated in D. pratensis. Furthermore, it is possible that only the mitotically stable B shows drive through females because of its tendency to co-segregate with the X during male meiosis (Bidau, 1986; Bidau et al.,

Cytogenet Genome Res 106:347–350 (2004)

349 207

2004) thus landing preferentially in females where it would show drive. The unstable B probably drives through males (Bidau, 1987). In that case, only the first B should show an association with Rb fusion frequency. However, data are at present insufficient to analyse both Bs separately. A further point of interest is that, of those populations harbouring Bs but having otherwise high Fs, six belong to two hybrid zones between chromosomal races (Table 1). Of these, five (Villa Ventana, Sierra de la Ventana, Cerro Ceferino, El Atravesado and Saldungaray) are included in the Sierra de la Ventana hybrid zone which resulted from the reproductive interaction of a Southern race, centered at the locality of Monte Hermoso and polymorphic for Rb fusions 1.2, 3.4 and 5.6, and a Northern race from central Buenos Aires province, bearing Rb fusions 1.6 and 3.4 (Chiappero et al., 2004). None of the parental races shows B chromosome polymorphisms despite

extensive sampling (Martı´, 2002). Thus, it is possible that the existence of B chromosomes within the hybrid zone resulted from the initial contact between the races when one or both still had B chromosomes which were in the process of disappearance because of drive towards fewer centromeres (and more metacentrics). The persistence of Bs in the hybrid zone would be thus a consequence of the supernumeraries being incorporated to new, hybrid genomes in which drive at female meiosis was not yet fully established.

Acknowledgements We are very much indebted to Juan Pedro Camacho for suggesting the analysis of B chromosome distribution in relation to the centromeric drive theory and to Brian Palestis, Robert Trivers and R. Neil Jones for stimulating criticism.

References Bell G, Burt A: B-chromosomes: germ-line parasites which induce changes in host recombination. Parasitology 100:S19–S26 (1990). Bidau CJ: A nucleolar-organizing B chromosome showing segregation-distortion in the grasshopper Dichroplus pratensis (Melanoplinae, Acrididae). Can J Genet Cytol 28:138–148 (1986). Bidau CJ: Influence of a rare unstable B-chromosome on chiasma frequency and nonhaploid sperm production in Dichroplus pratensis (Melanoplinae, Acrididae). Genetica 73:201–210 (1987). Bidau CJ: The complex Robertsonian system of Dichroplus pratensis (Melanoplinae, Acrididae). II. Effects of the fusion polymorphisms on chiasma frequency and distribution. Heredity 64:219–232 (1990). Bidau CJ: Causes of chiasma repatterning due to centric fusions. Braz J Genet 16:283–296 (1993). Bidau CJ, Martı´ DA: Male and female meiosis in Robertsonian heterozygotes of Dichroplus pratensis (Acrididae). Kew Chromosome Conference 4:381–396 (1995). Bidau CJ, Martı´ DA: Geographic distribution of Robertsonian fusions in Dichroplus pratensis (Melanoplinae, Acrididae): the central-marginal hypothesis reanalysed. Cytogenet Genome Res 96:66–74 (2002). Bidau CJ, Martı´ DA: Clinal variation of body size in Dichroplus pratensis (Orthoptera: Acrididae): inversion of Bergmann’s and Rensch’s Rules. Ann Entomol Soc Am 97, in press (2004).

350 208

Bidau CJ, Belinco C, Mirol PM, Tosto D: The complex Robertsonian system of Dichroplus pratensis (Melanoplinae, Acrididae). I. Geographic distribution of fusion polymorphisms. Genetique, Selection, Evolution 5:353–370 (1991). Bidau CJ, Rosato M, Martı´ DA: FISH detection of ribosomal cistrons and assortment-distortion for X and B chromosomes in Dichroplus pratensis (Acrididae). Cytogenet Genome Res 106:295–301 (2004). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Cano MI, Santos JL: Cytological basis of the B chromosome accumulation mechanism in the grasshopper Heteracris littoralis (Ramb). Heredity 62:91–95 (1989). Chiappero MB, Parise C, Marti DA, Bidau CJ, Gardenal CN: Distribution of genetic variability in populations of two chromosomal races of Dichroplus pratensis (Melanoplinae, Acrididae) and their hybrid zone. J Evol Biol 17:76–82 (2004). Hewitt GM: Grasshoppers and Crickets, in John B (ed): Animal Cytogenetics 3. Insecta 1 (Gebrüder Borntraeger, Berlin and Stuttgart 1979). Jones RN: B-chromosome drive. Am Nat 137:430–442 (1991).

Cytogenet Genome Res 106:347–350 (2004)

Jones RN: Tansley Review no. 85: B chromosomes in plants. New Phytol 131:411–434 (1995). Jones RN, Rees H: B chromosomes (Academic Press, New York 1982). King M: Species Evolution. The Role of Chromosome Change (Cambridge University Press, Cambridge 1993). Martı´ DA: Estudios sobre la Meiosis Masculina y Femenina en Especies Argentinas de Acrı´didos (Melanoplinae). PhD. Thesis, Universidad Nacional de Co´rdoba, Co´rdoba (2002). Palestis BG, Burt A, Jones RN, Trivers R: B chromosomes are more frequent in mammals with acrocentric karyotypes: support for the theory of centromeric drive. Proc R Soc London B (Suppl) 271:S22–S24 (2004). Pardo-Manuel de Villena F, Sapienza C: Female meiosis drives karyotypic evolution in mammals. Genetics 159:1179–1183 (2001a). Pardo-Manuel de Villena F, Sapienza C: Transmission ratio distortion in offspring of heterozygous female carriers of Robertsonian translocations. Hum Genet 108:31–36 (2001b). Santos JL, Del Cerro AL, Ferna´ndez A, Dı´ez M: Meiotic behavior of B chromosomes in the grasshopper Omocestus burri. A case of drive in females. Hereditas 118:139–143 (1993). White MJD: Modes of Speciation (WH Freeman, San Francisco 1978).

Population Dynamics and Evolution of B Chromosomes Cytogenet Genome Res 106:351–358 (2004) DOI: 10.1159/000079312

Cytogeography and the evolutionary significance of B chromosomes in relation to inverted rearrangements in a grasshopper species P. Colombo and V. Confalonieri Departamento de Ecologı´a, Genética y Evolucio´n, Fac. Cs. Exactas y Naturales, UBA, Buenos Aires (Argentina)

Abstract. The analysis of geographic distribution of polymorphic cytological markers, briefly termed as cytogeography, can be considered an important tool to be applied when studying the evolutionary significance of chromosome variability within a species, either to unravel the adaptive significance of chromosome polymorphisms or to investigate the parasitic nature of some genomic elements. In this article we review cytogeographical studies in Trimerotropis pallidipennis, a grasshopper species whose South American populations display geographical patterns of distribution of inversion and B chromosome polymorphisms. Several lines of evidence that issue from the analysis of the geographic distribution of polymorphic markers suggest that inverted chromosomes are special sequences that are maintained by deterministic forces. On the

other hand, the pattern of distribution of B chromosome polymorphism clearly demonstrates its selfish nature, being more frequent in those populations in central environments. We also present the analysis of 272 individuals of T. pallidipennis from Uspallata, and demonstrate that Bs in this population have some influence on body size, enlarging many of the morphometric characters of individuals and we propose it could be the consequence of its genotypic disequilibrium with one inversion. These investigations are finally discussed with regard to the models proposed for the maintenance of B chromosomes in natural populations and in relation to the possible interactions with chromosome inversions.

The analysis of the geographic distribution of polymorphic cytological markers, briefly termed as cytogeography, can be considered as an important tool to be applied when studying the evolutionary significance of chromosome variability within a species. Cytogeography not only helps to elucidate which kind of processes are operating in order to produce a particular pattern of distribution of diversity but also provides further insights into the significance of the persistence of such patterns in natural populations. Inverted rearrangements are cytological markers whose frequencies can vary between populations across the geographic

distribution of a species, and their evolutionary significance has been largely related to the consequences resulting from its polymorphic presence at the population level (Cunha and Dobzhansky, 1954; Carson, 1958; Cunha et al., 1959; Brussard, 1984; Krimbas and Powell, 1992; King, 1993; Powell, 1997; Confalonieri et al., 2002). They can lead to suppression of recombination, and, if the new array of alleles results in adaptive (epistatic) effects, these polymorphisms may be selected for and retained in populations. As in many other types of rearrangements, inversions tend to appear in many species phylogenetically related, a phenomenon called by White (1973) as “karyotypic orthoselection”. This biased tendency present in some taxonomic groups can now be attributed to the mechanism, that most probably gives rise to the majority of inversions: the transposition of mobile elements. It is now recognized that a significant portion of the genome of any eukaryote is composed of “selfish” or “parasitic” genetic elements, which have gained a transmission advantage relative to other components of an individual’s genome, but are either neutral or detrimental to the organism’s fitness (Werren

Supported by Consejo Nacional de Investigaciones Cientı´ficas y Tecnolo´gicas and Fundacio´n Antorchas. Received 16 September 2003; revision accepted 14 March 2004. Request reprints from Viviana Confalonieri, Departamento de Ecologı´a Genética y Evolucio´n, Fac. Cs. Exactas y Naturales, UBA Ciudad Universitaria, 1428 Buenos Aires (Argentina) telephone: +54 1145763300; fax: +54 1145763384 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0351$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. Samples of Trimerotropis pallidipennis analyzed from Argentina. Data from Goñi et al., 1985; Confalonieri and Colombo, 1989; Confalonieri, 1994, 1995; Matrajt et al., 1996

Ampimpa Las Gredas Famatina Chilecito Nonogasta Vichigasta Catinzaco C. Monte Balde Pescadores Chosmes El Chacay C. del Atuel Chocón P. del Inca Tunuyán Bariloche Uspallata Cacheuta San Carlos Observatorio Maipú L. Blanca Plottier Chelforó Choele Choel La Adela

Ia

Hb

Bc

Lat.d

Long.d

Alt.d

Tmaxe

Tmine

Humidityf Precip.f

2.90 4.90 6.40 6.30 6.70 6.40 6.70 7.50 6.90 7.20 7.30 6.60 4.90 3.90 0.00 6.20 0.17 1.70 5.00 5.60 6.70 7.20 0.00 4.30 4.30 5.20 5.10

1.61 2.00 1.85 1.64 1.39 1.37 0.93 0.50 1.45 1.39 1.46 2.29 2.32 2.00 0.00 0.72 0.33 1.21 2.04 1.78 0.64 0.94 0.00 2.27 2.00 1.16 1.23

0.11 0.29 0.31 0.36 0.29 0.13 0.27 0.13 0.18 0.17 0.07 0.29 0.37 0.13 0.08 0.20 0.11 0.07 0.14 0.22 0.18 0.22 0.20 0.09 0.12 0.11 0.00

66.02 67.48 67.52 67.50 67.50 67.48 67.38 64.66 66.35 66.47 66.80 69.08 68.65 68.75 69.90 68.98 71.17 69.33 69.17 69.03 69.85 68.66 69.89 68.23 66.53 65.65 64.08

26.67 28.82 28.93 29.17 29.30 29.48 29.67 30.92 33.35 33.32 33.42 33.08 34.87 39.24 32.82 33.47 41.15 32.6 33.17 33.77 32.88 33.00 40.75 38.95 39.08 39.28 39.02

2040 1924 1560 1101 934 867 737 972 440 566 554 1150 1100 381 2720 900 836 1831 1237 940 827 768 1276 271 174 131 79

27.00 22.50 – 24.30 25.50 24.00 – 26.37 23.60 23.60 – – 19.46 – 14.40 21.37 14.37 21.76 20.57 22.17 21.87 23.33 16.13 21.76 18.76 20.12 22.00

6.86 7.50 – 7.30 8.90 8.00 – 14.70 9.19 9.19 – – 4.07 – 1.80 6.97 2.40 2.56 7.90 5.47 10.57 9.20 2.43 7.03 4.43 8.47 9.46

56.33 – – 65.33 – – – 68.66 64.33 – – – 64.00 – 29.66 64.66 71.67 56.33 63.33 7.10 65.00 71.33 56.33 59.66 73.00 54.33 70.67

8.76 10.95 – 15.33 12.56 12.12 – 38.00 50.76 – – – 24.00 – 5.16 17.67 35.02 6.33 20.83 27.33 18.00 13.00 28.26 18.20 15.66 19.33 –

a

I: mean number of inverted chromosomes per male. H: mean number of heteromorphic bivalents per male. c B: B chromosome carrier frequency. d Lat.: latitude in degrees; Long.: longitude West in degrees; Alt.: altitude in meters. e Tmax: average daily maximum temperature in oC; Tmin: average daily minimum temperature in oC; –: no climatic data available. f Humidity given in %; Precip.: average daily precipitation in mm. Ten-year averages were used for the months of March, April and May for all four climatic variables; –: no climatic data available. b

et al., 1988). Mobile elements are selfish genetic elements, and they can promote specific rearrangements as inversions, duplications and translocations (Kidwell and Lisch, 1997; Zhang and Peterson, 1999; Lonig and Saedler, 2002). For example, Regner et al. (1996) demonstrated that there is an association between P-element insertion sites and inversion breakpoints in natural populations of Drosophila willistoni. Other potential examples of selfish or parasitic genetic elements include supernumerary or B chromosomes (Hurst and Werren, 2001) whose ubiquity, variation in frequencies, and patterns of geographic distribution have been the subject of many studies (Jones and Rees, 1982; Jones, 1985; Bougourd and Jones, 1997; Jones and Houben, 2003). They are extra elements to the standard A complement and their frequency in natural populations is determined by their transmission rates and effects on host fitness. To explain such matters, three models have been proposed: a) the parasitic model considers that B chromosomes are maintained in natural populations at the expense of drive, independently of the harmful effects they might have on carrier fitness (Östergren, 1945); b) the “heterotic” model by which Bs lack drive and would have an adaptive significance (White, 1973), and c) the near-neutral one, by which Bs might lack drive and not be appreciably beneficial or harmful for individual fitness, at least in low number. Nearneutrality would be a transient stage of B chromosome evolu-

352 210

Cytogenet Genome Res 106:351–358 (2004)

tion, passing through successive parasitic-neutral-parasitic in a non-equilibrium dynamic fashion (Camacho et al., 1997; Cavallaro et al., 2000). Most studies fit the parasitic model, while only a few ones reported an adaptive significance for B chromosomes (Holmes and Bougourd, 1991; Han et al., 2001). The near-neutral model would be in fact compatible with the parasitic one, and although there are now few examples supporting this model (Camacho et al., 1997; Cavallaro et al., 2000), it is probable that they will increase in numbers as more parasitic Bs are being studied through successive generations and across the geographic distribution of species. In this article we present a revision of the cytogeographical studies made in a grasshopper species, Trimerotropis pallidipennis Burmeister (Acrididae: Oedipodinae) (Vaio et al., 1979; Goñi et al., 1985; Confalonieri, 1988, 1992, 1994, 1995; Confalonieri and Colombo, 1989; Colombo and Confalonieri, 1996; Colombo, 2002) whose South American populations display geographical patterns of distribution of inversion and B chromosome polymorphisms. Like Drosophila, the genus Trimerotropis constitutes another example of “karyotypic orthoselection”, because it is cytologically characterized by a high incidence of fixed and/or polymorphic inversions (White, 1973; Hewitt, 1979; John, 1983). Most of these grasshoppers inhabit arid regions from western North America, although some species as T. ochraceipennis and T. pallidipennis also reach South

Fig. 1. Samples of Trimerotropis pallidipennis analyzed from Argentina. 1: Ampimpa, 2: Las Gredas, 3: Famatina, 4: Chilecito, 5: Nonogasta, 6: Vichigasta, 7: Catinzaco, 8: Capilla del Monte, 9: Balde, 10: Pescadores, 11: Chosmes, 12: El Chacay, 13: Caño´n del Atuel, 14: Choco´n, 15: Puente del Inca, 16: Tunuya´n, 17: Bariloche, 18: Uspallata, 19: Cacheuta, 20: San Carlos, 21: Observatorio, 22: Maipu´, 23: Laguna Blanca, 24: Plottier, 25: Chelforo´, 26: Choele Choel, 27: La Adela.

American lands (White, 1951). According to White (1973), the colonization presumably descended along the Andean dry lands of South America and was probably made by North American T. pallidipennis, carrier of a basic chromosome arrangement. This migration could have taken place 2–3 Myr ago, when the Isthmus of Panama´ rose, favoring the movement of many insects between both hemispheres (Confalonieri et al., 1998). In southern latitudes, this species became adapted to a wider ecological range, extending its distribution to lower altitudes and more humid habitats, where pericentric inversion sequences appear in polymorphic or even fixed state, B chromosomes being present or absent. This article includes the analysis of 27 populations from arid and semi-arid regions of Argentina, along latitudinal and longitudinal gradients between 26° and 41 ° Lat. S. and between 64 ° and 71 ° Long. W., respectively, in a range of altitudes from 79 to 2,720 m (Table 1 and Fig. 1). North American populations are not included in this review because they are all chromosomally monomorphic. The purpose of this article is to give an example of how the application of cytogeographic analysis, in parallel to the study of geographic distributions of protein and molecular markers, can help to elucidate the evolutionary significance, if any, of the chromosome polymorphisms under investigation. Also, it reports for the first time the study of a large sample from Uspallata (Table 1) in which the effects of B chromosomes on morphological traits and its genotypic disequilibrium with chromosome inversions were analyzed.

These investigations are finally discussed with regard to the models proposed for the maintenance of B chromosomes in natural populations and in relation to the possible interactions with chromosome inversions.

The inversion systems and their phenotypic effects The male chromosomal complement of T. pallidipennis consists of 2n = 23 members (22 autosomes + XO) grouped in three size classes: large (L1–L3), medium (M4–M8 and the X chromosome), and small (S9–S11). All three long chromosomes are submetacentric (SM), the X chromosome is metacentric (M) and the remaining ones are basically acrocentric (Vaio et al., 1979) (Fig. 2). Chromosomes 4, 6, 7 and 8 are polymorphic for seven pericentric inversions that change the basic acrocentric morphology (A) into many submetacentric (SM1, SM2, SM3, SM4 and SM5), metacentric (M) and inverted acrocentric (AI) forms (Confalonieri and Colombo, 1989). Cytological evidence from C-banding techniques (Sanchez and Confalonieri, 1993) demonstrates that rearranged chromosomes show inverted patterns of C-bands, thus supporting the assumption that these rearrangements are the result of pericentric inversions, instead of three-break centromere transpositions. The mean numbers of heteromorphic bivalents (H) and inversions (I) observed in each sample per individual are shown in Table 1. Most inversions exert a significant effect on morpho-

Cytogenet Genome Res 106:351–358 (2004)

353 211

Fig. 2. (A) Metaphase I plate of Trimerotropis pallidipennis showing the B chromosome characteristic of this species. (B) Detail of a diplotene cell of Trimerotropis pallidipennis showing the B and the X chromosome. The empty arrow points at the heterochromatic region of the B, and the full arrow points at the euchromatic region. (C) Metaphase I plate of Trimerotropis pallidipennis showing bivalent 4 with inversions SM1 and AI.

segment and a proximal isopycnotic region was observed in almost every population from Argentina (Fig. 2A, B). It is a little larger than the S9 chromosome, and, in C-banded cells, it shows two interstitial positively stained bands, which coincide with part of the heterochromatic region (Sanchez and Confalonieri, 1993). Furthermore, it is mitotically and meiotically stable. The frequencies of carriers in each sample are indicated in Table 1. In some samples, stability of these frequencies was demonstrated through successive generations during 8 years (Confalonieri, 1995). Apparently, this B chromosome has an influence on either endo- or exophenotypic characters. However, in ten populations analyzed for chiasma conditions (Ampimpa, Las Gredas, Chilecito, Nonogasta, Catinzaco, Uspallata, Maipu´, San Luis, Caño´n del Atuel and Choco´n; see Table 1, Fig. 1), mean interstitial chiasma frequency did not show significant differences when B and non-B carriers were compared (Confalonieri, 1992). In spite of this, in Maipu´, Nonogasta and San Luis it was observed that when total chiasma frequency diminishes, a redistribution of chiasmata occurs, because a tendency to form an increased number of interstitial chiasmata is evident. This fact is paradoxically related to an increase in the number of bivalents heteromorphic for pericentric inversions. Moreover, these negative correlations between total and interstitial chiasma frequencies were only significant when B carriers were excluded from the analysis, so the effect of the supernumerary chromosome would be the disruption of the negative correlation of both variables considered (Confalonieri, 1992). Likewise, B carriers of San Luis and Caño´n del Atuel samples also showed a significant decrease in total chiasmata but not in interstitial ones. In this case, interference distances between genetic exchange sites probably increase due to the effect of the supernumerary chromosome, a result rarely found among the Orthoptera (Confalonieri, 1992). Indeed, only significant effects on recombination with a tendency to the increase of chiasma frequency rather than to a reduction of it are frequent among B chromosomes (John and Hewitt, 1965a, b; Hewitt and John, 1970; Fletcher and Hewitt, 1980; Colombo, 1989; Camacho et al., 2002).

The B chromosome and its exophenotypic effects metric variables, overall size being correlated with the number of inverted sequences per individual (Colombo, 2002). Moreover, it was shown that longevity selection operates on morphometric targets affecting inversion frequencies when two samples of males from the same cohort (one of young and other of aged males) were compared (Colombo, 2003).

The B chromosome and its endophenotypic effects Notwithstanding the keener interest received by inversions in this group, supernumerary chromosome polymorphisms were documented in a considerable number of Trimerotropis species too (Weissman and Rentz, 1980). In T. pallidipennis a rod-like B chromosome with a distal heterochromatic X-like

354 212

Cytogenet Genome Res 106:351–358 (2004)

In order to find morphological traits that may be modified in B carriers, we analyzed 272 males of a highly polymorphic population from Uspallata (Fig. 1) sampled in March 1997, and demonstrated that B carriers are significantly bigger for a number of morphometrical variables than non-B carriers. Morphological characters measured were total length (it was taken from the extreme of the head to the articulation between third coxa and third femur), third tibia length, third femur length, thorax length and tegmina length (Table 2). The MANOVA between B chromosome karyotypes (as factors) and morphological traits (as dependent variables) gave a highly significant result (Wilk’s Ï = 0.939675; P = 0.0068). The individual ANOVAs were highly significant for total length (P = 0.0044), femur length (P = 0.0076), tibia length (P = 0.0189) and thorax length (P = 0.0134), but not significant for tegmina length (Ta-

Table 2. Mean values (in mm) and standard deviations (in parentheses) for all measured variables according to presence or absence of the B chromosome in the karyotype of Trimerotropis pallidipennis

0B 1B Pa a b

Total length

Tibia length

Femur length

Thorax length

Tegmina length

Nb

8.77 (0.49) 9.13 (0.53) 0.0044

9.67 (0.52) 10.03 (0.61) 0.0076

8.66 (0.54) 8.97 (0.54) 0.0189

3.76 (0.22) 3.90 (0.22) 0.0134

18.62 (1.12) 18.81 (1.19) 0.50

253 19

P: probability value for individual ANOVAs. N: number of individuals.

Table 3. Pairwise contingency tables for the detection of genotypic disequilibrium by means of the “Genepop” program (Raymond and Rousset, 1995). Data corresponding to the sample of Uspallata collected in March 1997 Chromosome pair 4 A/A A/AI 0 B 147 1B 7 P

a

SM1/A

85 15 6 5 0.0171*

Chromosome pair 6 SM1/AI

A/A M/A

6 1

105 13

a

M/M

117 31 5 1 0.1739

Chromosome pair 7

a

Chromosome pair 8

A/A SM2/A

SM2/SM2

A/A

SM3/A

172 16

10 1

101 7

89 15 7 2 0.35561

71 2 0.32514

a

SM3/SM3

SM4/A

SM3/SM4

SM4/SM4

39 1

7 2

2 0

a

Chromosome pairs bearing inversions: A = basic acrocentric; AI = Inverted acrocentric; SM = submetacentric; M = metacentric; 1 B: B carrier; 0 B: non-B carrier; P: probability; *: Significant for α = 0.05.

ble 2). In summary, it can be stated that B carriers are significantly bigger for all the measured morphometric variables, except tegmina length.

The B chromosome and its genotypic disequilibrium with inversions Taking advantage of the large number of individuals analyzed from Uspallata, we carried out gametic phase disequilibrium analyses between B chromosome karyotypes and each polymorphic pairs 4, 6, 7 and 8 (Table 3). Remarkably enough, the B carriers tend to accumulate among the SM1 carriers (Table 3); as a matter of fact, non-SM1 carriers have a B chromosome frequency of 0.03, whereas SM1 carriers bear a B chromosome frequency of 0.22. Consequently, the genotypic disequilibrium analysis between the Bs and sequences in pair 4 rendered significant results (P = 0.017). The morphology of the 4SM1 chromosome inversion is shown in Fig. 2C.

The geographic distribution of inversion frequencies and the adaptive hypothesis As previously mentioned, inversion polymorphisms cause functional crossover suppression within the mutually inverted segments of heterozygotes, and as a consequence of this, they are regarded as chromosomal devices that preserve coadapted, tightly linked genes from recombination (Carson, 1959). These gene complexes, called “supergenes” are prone to suffer progressive genetic differentiation that may enhance the adaptation of natural populations to local conditions. Several lines of evidence suggest that inversions of T. pallidipennis are special sequences that are maintained by deterministic forces, and most of them come from cytogeographic

analysis made across a wide geographic range of distribution of samples shown in Table 1 and Fig. 1. In a previous study, six samples from La Rioja province (Las Gredas, Famatina, Chilecito, Nonogasta, Vichigasta and Catinzaco), sited along a 109 km long altitudinal gradient, were analyzed, and significant clinal variation for most of the inversion frequencies was found (Confalonieri and Colombo, 1989). These significant correlations were further demonstrated when a new altitudinal gradient was analyzed from Mendoza and San Luis provinces (samples of Balde, Pescadores, Chosmes, El Chacay, Maipu´, Tunuya´n, Cacheuta, Observatorio, San Carlos, Uspallata and Puente del Inca), and also when a joint analysis was performed including all 27 samples from both clines and other distant populations not integrated to any altitudinal gradient (Confalonieri, 1994; Colombo and Confalonieri, 1996). In this case, multiple regression analyses with latitude and longitude were performed, and other environmental variables such as minimum temperature, humidity and precipitation were also evaluated (Table 1). It was demonstrated that three inversions (4AI, 7SM2, 8SM4) correlate simultaneously with altitude, latitude and minimum temperature, and two other inversions (6M and 8SM3) correlate with longitude and humidity, in such a way that the frequency distribution of these chromosome rearrangements could be predicted for unstudied regions (Colombo and Confalonieri, 1996; individual frequencies for each chromosome pair can be found in Confalonieri and Colombo, 1989; Confalonieri, 1994; Colombo and Confalonieri, 1996; Matrajt et al., 1996; Confalonieri et al., 1998). In other words, they follow similar patterns among independent geographic areas with similar ecological gradients. As the general pattern of variation of most inversions were the same, i.e., they tend to disappear toward higher altitudes and southern latitudes, the mean number of inversion frequency per individual per sample significantly correlated with altitude and latitude, being the minimum temperature the environmental variable that better ex-

Cytogenet Genome Res 106:351–358 (2004)

355 213

Table 4. Multiple regression analyses of the dependent variables B (B frequency), H (mean number of heteromorphic bivalents per individual per population) and I (mean number of inversions per individual per population) on (a): the independent geographical variables altitude (ALT), latitude (LAT) and longitude (LONG), and on (b): the independent climatic variables Tmax (average daily maximum temperature), Tmin (average daily minimum temperature), Hum. (humidity) and Prep. (precipitation) (data from Table 1) a)

b) Dependent variable

ALT

LAT

B I H

–0.23 *** –0.97 –0.37

NS

2

LONG **

*

–0.71 *** –0.96 –0.33

0.47 NS 0.046 0.03 *

2

R

*

0.35 *** 0.79 NS 0.11 **

Dependent variable

Tmax

Tmin

B I H

0.45 NS 0.22 NS 0.75

NS

Hum. NS

–0.41 * 0.67 NS –0.52

Prep. NS

0.10 NS –0.02 NS 0.76

NS

0.21 NS 0.03 NS 0.06

2

R

NS

0.10 ** 0.73 NS 0.24

***

Abbreviations: R : multiple regression coefficient; 0.05 > P > 0.01; 0.01 > P > 0.001; 0.001 > P; NS = not significant.

plains these correlations in the multiple regression analysis (Table 4). Several models have been proposed to explain clinal distribution of genetic markers, of which the main ones are ecological selection for broad clines and hybrid zones for narrow ones. Essentially, a hybrid zone is a cline between two parapatric hybridizing taxa for genes and the distinguishing characters they determine (Hewitt, 1988). These clines may originate in two ways, primarily or secondarily. In the former case, the differences evolve in a continuous distribution, for example an environmental gradient that favors different alleles on either side; natural selection progressively sharpens the incipient cline until it becomes a narrow hybrid zone between two internally coadapted genotypes (Endler, 1986). In a secondary zone, the differences evolve while the two populations are geographically isolated, so that when their ranges alter and meet, a steep cline is formed as they hybridize (Hewitt, 1988). In this latter case, deterministic forces may not be involved in the formation of clines, but are necessary for a long continuation of this pattern of variation. In T. pallidipennis, the cytogeographic analysis suggests that selection of some sort is more likely to act because of the repetition patterns of variation observed over a wide geographic area and their stability over time (Confalonieri et al., 1998). If current clines were hybrid zones, selection could be acting against recombinant genotypes based on inversion types. However, as the populations are all polymorphic except for some at the very extremes of the distribution of the species in arid and semiarid regions of Argentina, the width of the hybrid zone would seem to be very extensive, exceeding, in some cases, more than 1,000 km, and involving almost the entire distribution of populations from southern latitudes. Therefore, we proposed the hypothesis of geographically variable selection maintaining the clines, although further evidence was necessary to corroborate these conclusions. Clues came from the analysis of protein (Matrajt et al., 1996) and molecular markers (Confalonieri et al., 1998, 2002). Four populations located along an altitudinal gradient (Puente del Inca, Uspallata, Observatorio and Tunuya´n), and others outside the cline (Bariloche and Quilmes) (Table 1, Fig. 1) were phylogeographically analyzed using Restriction Site Variation (RFLP) of mitochondrial DNA (Confalonieri et al., 1998). Phylogeography has introduced a phylogenetic-historical perspective to investigate the evolution of populations, and contributes to the drawing of conclusions regarding se-

356 214

Cytogenet Genome Res 106:351–358 (2004)

quences of colonization and diversification (Avise, 2000; Lanteri and Confalonieri, 2003). We observed no geographical structuring in the unrooted tree connecting all 17 mitochondrial DNA haplotypes found. Many of them are present in most of the populations analyzed, indicating high levels of gene flow. The fact that there neither is obvious differentiation in haplotype distribution between both extremes of the clines nor between chromosomally differentiated populations, shows that the cline is not the result of a hybrid zone and reinforces the selection hypothesis (Confalonieri et al., 1998).

The geographic distribution of Bs and the parasitic hypothesis In order to gain further insights into this longstanding debate concerning the selfish, adaptive or near-neutral nature of B chromosomes, we performed a cytogeographic study of T. pallidipennis populations from Table 1 (25 samples correspond to those already reported in Confalonieri (1995), and two others (Bariloche and Tunuya´n) that are incorporated in this report). Multiple regression analysis of B carrier frequencies – which varied from 0 to 37 % – on altitude, latitude and longitude demonstrate that the supernumerary chromosome shows a different pattern of variation compared with the number of inverted sequences per male (I) (Table 4a). As a matter of fact, the frequency of B carriers in each sample is significantly associated with the latitudinal and longitudinal situation of the sample, but, conversely to most inversions, is not associated with any climatic variable (Table 4b). B chromosomes are associated with geographical variables in such a way that in more eastern longitudes and southern latitudes the supernumerary chromosome tends to disappear (Fig. 3). As previously mentioned, T. pallidipennis is endemic to North America and is one of the few trimerotropines to have successfully extended its distribution to Andean South America (Vaio et al., 1979), being adapted here to a wide altitudinal range. Rain forests and humid grasslands (in eastern localities) are not inhabited by this species and its basic requirements appear to be the prevalence of arid and semi-arid conditions. In fact, samples as Laguna Blanca, Plottier, Chelforo´, ChoeleChoel, La Adela, Choco´n and Bariloche can be considered as marginal, because they are situated at the southern border of the species range (Fig. 1). Therefore, more eastern longitudes

0.40 0.35

B-frequency

0.30 0.26 0.20 0.16 0.10 0.06 0 72 71 44

70 69

40

68

38

67 Longitude

66

32

65

28

64

Latitude

63 24

Fig. 3. B frequencies from 27 samples of T. pallidipennis from Argentina plotted against longitude West and latitude South.

and southern latitudes are most probably marginal environments for T. pallidipennis, just where the frequency of B carriers tends to be lower. This pattern of distribution is better explained by means of the parasitic model: B carriers are obviously more frequent in those areas where the species thrive and disappear in circumstances where the burden on fitness is too heavy to bear: i.e. in marginal environments. Similar situations were found in Myrmeleotettix maculatus, where B carriers are limited to populations in the south and east of Great Britain which are climatically better for grasshoppers (Hewitt and Brown, 1970; Hewitt, 1973) and in Crepis capillaris, where higher B frequencies are also the reflection of the suitability of the habitats (Parker et al., 1991).

Concluding remarks Cytogeography has been demonstrated to be an important tool to be applied in natural populations, either to unravel the adaptive significance of chromosome polymorphisms or to investigate the parasitic nature of some genomic elements. Although it is often the first step to be followed when the evolutionary significance of variation is under investigation, it can also provide concluding evidence supporting laboratory experiments that have been previously performed. For instance, Beukeboom and Werren (2000) have recently analyzed the geographic distribution of the paternal-sex-ratio (PSR) chromosome in natural populations of the parasitic wasp Nasonia vitripennis. PSR is a B chromosome that is considered to be an extreme example of selfish (or parasitic) DNA, because it causes all-male families in the parasitic wasp by inducing paternal genome loss in fertilized eggs. The authors demonstrated that PSR has a very limited geographic distribution, agreeing with the fact that PSR completely destroys the genome of its host in each generation, reducing host fitness to zero. If PSR

became common in natural populations, it could drive such populations to extinction. In T. pallidipennis several lines of evidence that issue from the cytogeographic analysis suggest that inverted chromosomes are special sequences that are maintained by deterministic forces while B chromosomes are genomic elements that clearly fit the parasitic model. We also presented the analysis of a single large sample from Uspallata, and demonstrated that Bs have some influence on body size, enlarging many of the morphometric characters of individuals. We know that increased body size often appears to confer significant advantages for adult fitness components in Drosophila (Santos et al., 1988; Hasson et al., 1993; Partridge and Fowler, 1993) and in other insects (Norry and Colombo, 1999). It has been proposed that exotermic organisms tend to be larger in colder climates, however, this does not seem to apply to T. pallidipennis, where body size in cooler climates is smaller (Colombo and Confalonieri, 1996). It is known that, in Uspallata, inversion 4SM1 increases body size (Colombo, 2002). This chromosome sequence has its highest incidence in this population, most probably as a consequence of its adaptive significance. It could be possible that, given that this inversion and the B chromosome are positively associated, the increase of body size in B carriers is due to the increased size of inversion 4SM1 carriers. If this genotypic disequilibrium is demonstrated to be genuine, then it can be considered as a very original way of “accumulation” for this selfish element, through a “hitchhiking” process with adaptive elements. Other aspects that deserve attention in relation to the parasitic model are the effects exerted by B elements on chiasma conditions. It was found that in some samples a B brings about a reduction in total chiasma frequency, although not affecting interstitial chiasma frequencies. Effects on recombination are frequent among B chromosomes, with a tendency to the increase of chiasma frequency rather than to a reduction of it. This was interpreted, in the grasshopper Eyprepocnemis plorans, in terms of increased recombination aroused by the presence of the B chromosome, that would enhance genetic variability in the offspring, thus leading to an increased tolerance to the “parasite” (i.e. the B chromosome; see Camacho et al., 2002). In E. plorans there are many varieties of B chromosomes, some of them parasitic (with drive) and some of them neutralized (without drive); the parasitic Bs produce a greater increase of chiasma frequency than the non-parasitic ones (Camacho et al., 2002). In the light of this hypothesis it is difficult to square parasitism with reduction of recombination in T. pallidipennis. A possible explanation is that interstitial chiasmata, which lead to more recombinant genotypes than terminal or proximal ones, are indeed not affected. Another possibility is that respecting the degree of parasitism which may vary among populations, this would help explain the fact that in other populations the B has no effects on chiasma conditions or phenotype. These variable characteristics of B chromosomes among different samples can be readily conciliated with a more dynamic model in which Bs are evolving through different stages (neutrality, selfishness and even heterosis) in a nonsynchronic fashion, showing then somewhat different results among populations.

Cytogenet Genome Res 106:351–358 (2004)

357 215

References Avise JC: Phylogeography: the history and formation of species (Harvard University Press, Cambridge 2000). Beukeboom LW, Werren JH: The paternal-sex-ratio (PSR) chromosome in natural populations of Nasonia (Hymenoptera: Chalcidoidea). J Evol Biol 13:967–975 (2000). Bougourd SM, Jones RN: B chromosomes: a physiological enigma. New Phytol 137:43–54 (1997). Brussard PE: Geographic patterns and environmental gradients: the central-marginal model revisited. Ann Rev Ecol Syst 15:25–64 (1984). Camacho JPM, Shaw MW, Lo´pez-Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997). Camacho JP, Bakkali M, Corral JM, Cabrero J, LopezLeon MD, Aranda I, Martin-Alganza A, Perfectti F: Host recombination is dependent on the degree of parasitism. Proc R Soc Lond B Biol Sci 269: 2173–2177 (2002). Carson HL: Genetic conditions which promote or retard the formation of species. Cold Spring Harb Symp Quant Biol 24:87–104 (1958). Cavallaro ZI, Bertollo LAC, Perfectti F, Camacho JPM: Frequency increase and mitotic stabilization of a B chromosome in the fish Prochilodus lineatus. Chromosome Res 8:627–634 (2000). Colombo PC: Effects of B-chromosomes on recombination in Cylindrotettix obscurus (Leptysminae, Acrididae). Caryologia 42:65–79 (1989). Colombo PC: Chromosome inversion polymorphisms influence morphological traits in Trimerotropis pallidipennis (Orthoptera). Genetica 114:247–252 (2002). Colombo PC: Inversion polymorphisms and natural selection in Trimerotropis pallidipennis (Orthoptera). Hereditas 139:68–74 (2003). Colombo PC, Confalonieri VA: Adaptive pattern of inversion polymorphism in Trimerotropis pallidipennis. Correlation with environmental variables: an overall view. Hereditas 125:289–296 (1996). Confalonieri V: Effects of centric shift polymorphisms on chiasma conditions in Trimerotropis pallidipennis (Oedipodinae: Acrididae). Genetica 76:171– 179 (1988). Confalonieri VA: B-chromosomes of Trimerotropis pallidipennis (Oedipodinae: Acrididae): new effects on chiasma conditions. Caryologia 45:145–153 (1992). Confalonieri VA: Inversion polymorphism and natural selection in Trimerotropis pallidipennis: correlations with geographical variables. Hereditas 121: 79–86 (1994). Confalonieri VA: Macrogeographic patterns in B-chromosomes and inversion polymorphisms of the grasshopper Trimerotropis pallidipennis. Genet Sel Evol 27:305–311 (1995). Confalonieri VA, Colombo PC: Inversion polymorphism in Trimerotropis pallidipennis (Orthoptera): clinal variation along an altitudinal gradient. Heredity 62:107–112 (1989). Confalonieri V, Sequeira A, Todaro L, Vilardi JC: Mitochondrial DNA and phylogeography of the grasshopper Trimerotropis pallidipennis in relation with clinal distribution of chromosome polymorphisms. Heredity 81:444–452 (1998). Confalonieri VA, Scataglini AA, Remis MI: Sequence differentiation among inversion rearrangements are revealed by RAPD markers in the grasshopper Trimerotropis pallidipennis (Orthoptera). Ann Entomol Soc USA 95:201–207 (2002).

358 216

Cunha AB, Dobzhansky TH: A further study of chromosomal polymorphism in Drosophila willistoni in relation to environment. Evolution 8:119–134 (1954). Cunha AB, Dobzhansky T, Pavlovsky O, Spassky B: Genetics of natural populations. XXVIII. Supplementary data on the chromosomal polymorphism in Drosophila willistoni in relation to the environment. Evolution 13:389–404 (1959). Endler JA: Natural Selection in the Wild (Princeton University Press, Princeton 1986). Fletcher HL, Hewitt GM: Effects of a B-chromosome on chiasma localization and frequency in male Euthistira brachyptera. Heredity 44:341–347 (1980). Goñi B, de Vaio E, Beltrami M, Leira M, Crivel M, Panzera F, Castellanos P, Basso A: Geographic patterns of chromosomal variation in populations of the grasshopper (Trimerotropis pallidipennis) from southern Argentina. Can J Genet Cytol 27:259– 271 (1985). Han Y, Liu X, Benny U, Kistler HC, VanEtten HD: Genes determining pathogenicity to pea are clustered on a supernumerary chromosome in the fungal plant pathogen Nectria haematococca. Plant J 25:305–314 (2001). Hasson ER, Fanara JJ, Rodrı´guez C, Vilardi JC, Reig OA, Fontdevila A: The evolutionary history of Drosophila buzzatii. XXVII. Thorax length is positively correlated with longevity in a natural population from Argentina. Genetica 92:61–65 (1993). Hewitt GM: Evolution and maintenance of B-chromosomes. Chromosomes Today 4:351–369 (1973). Hewitt GM: Animal Cytogenetics, in John B (ed): Insecta I. Orthoptera, vol. 3 (Gebrüder Borntraeger, Berlin, Stuttgart 1979). Hewitt GM: Hybrid zones: natural laboratories for evolutionary studies. Trends Ecol Evol 3:158–167 (1988). Hewitt GM, Brown FM: The B-chromosome system of Myrmeleotettix maculatus V. A steep cline in East Anglia. Heredity 25:363–371 (1970). Hewitt GM, John B: The B-chromosome system of Myrmeleotettix maculatus (Thunb). IV. The dynamics. Evolution 24:169–180 (1970). Holmes DS, Bougourd SM: B chromosome selection in Allium schoenoprasum. II. Experimental populations. Heredity 67:117–122 (1991). Hurst GD, Werren JH: The role of selfish genetic elements in eukaryotic evolution. Nat Rev Genet 2:597–606 (2001). John B: The role of chromosome change in the evolution of orthopteroid insects, in Sherma AN (ed): Chromosomes in the Evolution of Eukaryotic Groups, vol I, pp 1–114 (CRC Press, Boca Raton 1983). John B, Hewitt GM: The B-chromosome system of Myrmeleotettix maculatus (Thunb). I. The mechanics. Chromosoma 16:548–578 (1965a). John B, Hewitt GM: The B-chromosome system of Myrmeleotettix maculatus (Thunb). II. The statics. Chromosoma 17:121–138 (1965b). Jones RN: Are B-chromosomes selfish? in CavalierSmith T (ed.): The Evolution of Genome Size, pp 397–425 (John Wiley & Sons, London 1985). Jones RN, Houben A: B chromosomes in plants: escapees from the A chromosome genome? Trends Plant Sci 8:417–421 (2003). Jones RN, Rees H: B-chromosomes (Academic Press, New York 1982).

Cytogenet Genome Res 106:351–358 (2004)

Kidwell MG, Lisch D: Transposable elements as sources of variation in animals and plants. Proc Natl Acad Sci USA 94:7704–7711 (1997). King M: Species Evolution: The Role of Chromosome Change (Cambridge University Press, London 1993). Krimbas CB, Powell JR: Drosophila inversion polymorphism (C.R.C. Press, Boca Raton 1992). Lanteri AA, Confalonieri VA: Filogeografı´a: objetivos, métodos y ejemplos, in Llorente Bousquets J and Morrone JJ (eds.): Introduccio´n a la Biogeografı´a en Latinoamérica: Conceptos, teorı´as, métodos y aplicaciones. vol II, pp 185–193 (Facultad de Ciencias, UNAM, México 2003). Lonig W, Saedler H: Chromosome rearrangements and transposable elements. Annu Rev Genet 36:389– 410 (2002). Matrajt M, Confalonieri V, Vilardi J: Parallel adaptive patterns of allozyme and inversion polymorphisms on an ecological gradient. Heredity 76:346–354 (1996). Norry FM, Colombo PC: Chromosome polymorphisms and natural selection in Leptysma argentina (Orthoptera): external phenotype affected by a centric fusion predicts adult survival. J Genet 78:57–62 (1999). Östergren G: Parasitic nature of extra fragment chromosomes. Botaniska Notiser 2:157–163 (1945). Parker JS, Jones GH, Edgar LA, Whitehouse C: The population cytogenetics of Crepis capillaris IV: The distribution of B-chromosomes in British populations. Heredity 66:211–218 (1991). Partridge L, Fowler K: Direct and correlated responses to selection on thorax length in Drosophila melanogaster. Evolution 47:213–226 (1993). Powell JR: Progress and Prospects in Evolutionary Biology: The Drosophila Model (Oxford University Press, New York 1997). Raymond M, Rousset F: GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered 86:248–249 (1995). Regner LP, Pereira MSO, Alonso CEV, Abdelhay E, Valente VLS: Genomic distribution of P-elements in Drosophila willistoni and a search for their relationships with chromosomal inversions. J Hered 87:191–198 (1996). Sanchez V, Confalonieri V: Chromosome banding pattern in Trimerotropis pallidipennis (Orthoptera: Acrididae). Cytobios 73:105–110 (1993). Santos M, Ruiz A, Barbadilla JE, Quezada-Dı´az JE, Hasson ER, Fontdevila A: The evolutionary history of Drosophila buzzatii. XIV. Larger flies mate more often in nature. Heredity 61:255–262 (1988). Vaio E de, Goñi B, Rey C: Chromosome polymorphisms in populations of the grasshopper Trimerotropis pallidipennis from southern Argentina. Chromosoma 71:371–386 (1979). Weissman DB, Rentz DCF: Cytological, morphological and crepitational characteristics of the Trimerotropines (Aerochoreutes, Circotettix, and Trimerotropis). Trans Am Entomol Soc 106:253–272 (1980). Werren JH, Nur U, Wu CI: Selfish genetic elements. Trends Ecol Evol 3:297–302 (1988). White M: Cytogenetics of Orthopteroid insects. Adv Genet 4:267–330 (1951). White M: Animal cytology and evolution, 3rd ed. (Cambridge University Press, London 1973). Zhang J, Peterson T: Genome rearrangements by nonlinear transposons in maize. Genetics 153:1403– 1410 (1999).

Population Dynamics and Evolution of B Chromosomes Cytogenet Genome Res 106:359–364 (2004) DOI: 10.1159/000079313

Mitotically unstable B chromosome polymorphism in the grasshopper Dichroplus elongatus M.I. Remis and J.C. Vilardi Departamento de Ecologı´a, Genética y Evolucio´n, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Buenos Aires (Argentina)

Abstract. Dichroplus elongatus, a widespread South American phytophagous grasshopper, exhibits polymorphisms for supernumerary chromosomes and segments (SS) in natural populations in Argentina. In this paper we review the available information on B chromosome polymorphism in D. elongatus related to geographic distribution, patterns of chromosome variation and influence on sperm formation. In D. elongatus the different forms of supernumerary variants are not independent. The proportion of B-carrying individuals (B prevalence) is negatively correlated with SS10 and positively with SS6 frequencies. The analysis of population structure considering the different supernumerary variants would suggest that the patterns of chromosome variation can not be explained only by random factors. Geographic distribution was analyzed scoring the prevalence of B chromosomes in 13 natural populations collected in three different biogeographical provinces from Northwest (Las Yungas province) and East (Espinal and Pam-

peana provinces) of Argentina. The detected heterogeneity may be explained by significant differentiation between Northwest and East regions and among populations within Las Yungas and Pampeana provinces. Correlation analysis suggested that B chromosome prevalence is associated with maximum temperature and with latitude. Additional information about the nature of the patterns of B chromosome variation was obtained comparing them with those obtained at the mitochondrial DNA level. The hierarchical analysis of molecular differentiation revealed discrepancy with respect to chromosome differentiation and also suggested that the pattern of B chromosomes may not be explained by historical factors. We also discussed the probable influence on fertility of carriers considering the production of abnormal sperm formation (macro and microspermatids) in relation to the number of Bs per follicle.

In Orthoptera, as in all main groups of animals and plants, supernumerary chromosome polymorphisms have frequently been found. To analyze the origin, establishment and maintenance of these dispensable elements, several aspects of their biology have been studied exhaustively (Jones and Rees, 1982; Jones, 1995; Camacho et al., 2000).

B-chromosome evolution may be considered as the result of a series of interactions between Bs and the A complement. These interactions may also involve other supernumerary elements (knobs, supernumerary segments or C-bands) (Rhoades and Dempsey, 1973; Lo´pez Leo´n et al., 1991). Thus, the prevalence of B chromosomes is generally associated with ability of the population to tolerate this polymorphism coupled with probable accumulation mechanisms (Beukeboom, 1994; Camacho et al., 2000). In several cases, spatial chromosome differentiation is associated with B chromosome clines (Hewitt and Brown, 1970; Shaw, 1983; Parker et al., 1991; Cabrero et al., 1997). In the grasshopper Myrmeleotettix maculatus and the plant Crepis capillaris, B chromosomes were prevalent in regions of the geographical distribution of species more favorable climatically (Hewitt and Brown, 1970; Parker et al., 1991). On the contrary, in the grasshopper Eyprepocnemis plorans, the

Financial support from the Agencia Nacional de Promocio´n Cientı´fica y Técnnolo´gica (ANPCYT) (PICT 6628) and Consejo Nacional de Investigaciones Cientı´ficas y Técnicas (CONICET) (PIP N# 0722/98 and PIP No 02442) is gratefully acknowledged. Received 17 September 2003; manuscript accepted 3 March 2004. Request reprints from Maria Isabel Remis, Depto. Ecologı´a, Genética y Evolucio´n Fac. Cs. Exactas y Naturales, Univ. Buenos Aires 1428 Buenos Aires (Argentina); telephone: 54 11 45763349 fax: 54 11 45763384; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0359$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

were analyzed by means of partial correlation analysis using the STATISTICA program (Statistica Statsoft Inc. Statistica version 4.5. Tulsa, OK). Frequency data were transformed according to Christiansen et al. (1976) as: Xi = ( p1 – p1)

Fig. 1. Meiotic cells of the grasshopper Dichroplus elongatus in diplotene (A) and metaphase I (B) showing a B univalent (arrow). Bar: 10 Ìm.

冪冉

N1 p0 (1 – p0)

冊

where p0 is the mean B-prevalence, p1 represents the B prevalence in the ith population and N1 is the number of individuals sampled per population. This transformation normalizes the distribution and weights sampling sizes.

Interaction among supernumerary variants negative correlation between B chromosome frequency and altitude may be explained historically (Cabrero et al., 1997). The ability of a population to tolerate particular chromosome polymorphisms may be related to their harmful effects. B chromosomes tend to show detrimental effects on fertility (Jones, 1995). In grasshoppers, the effect of Bs on spermiogenesis leads to an increase in the production of both macro and microspermatids (e.g. Nur, 1969; Bidau, 1986; Suja et al., 1986). Dichroplus elongatus (2n = 22 + X0 in males), a widespread South American phytophagous grasshopper, exhibits polymorphisms for supernumerary chromosomes and segments in natural populations of Argentina (Remis and Vilardi, 1986; Loray et al., 1991; Clemente et al., 1994). The B chromosome of D. elongatus is acrocentric, heteropycnotic, and mitotically unstable. Its size is slightly larger than the smallest pair of the A complement (Fig. 1). In B bearing individuals, B number varies from 0 to 6 among testis follicles (Remis and Vilardi, 1986). Supernumerary polymorphic heterochromatic segments are also present in the pairs M6 (SS6), S9 (SS9) and S10 (SS10) (Loray et al., 1991; Clemente et al., 1994). In this paper we review the available results of B chromosome polymorphism analyses in D. elongatus related to geographic distribution, patterns of chromosome variation and influence on sperm formation. Population structure revealed at the chromosome level is also discussed in the light of mitochondrial DNA variation.

Data analysis The comparison of the proportion of B-carrying individuals (B prevalence) among populations was performed through Monte Carlo simulations, as described by Roff and Bentzen (1989). This method compares the extent of heterogeneity (assessed through chi-squared analysis) in the original data matrix to that estimated from repeated randomization of the original matrix. This procedure is designed to minimize the effect of empty cells on the validity of the chi-square test. The relationships between B prevalence and geographical (latitude, altitude and longitude) and climatic (medium temperature, maximum temperature, relative humidity) variables

360 218

Cytogenet Genome Res 106:359–364 (2004)

B chromosomes are assumed to spread and maintain in populations through accumulation mechanisms in mitosis and meiosis (Jones and Rees, 1982). However, these phenomena may be affected when different forms of supernumerary variants are present in the same population (Rhoades and Dempsey, 1973; Lo´pez Leo´n et al., 1991). One of the most interesting features encountered in chromosomally polymorphic populations of D. elongatus is that the different forms of supernumerary variants (chromosomes and segments) are not independent. Remis et al. (1998) analyzed seven populations of this species, five from Northwest (Raco, Tafı´ Viejo, Horco Molle, Famailla´, Campo Quijano), and two from East Argentina (Ing. Maschwitz and San Clemente) and demonstrated that the B prevalence in these populations is correlated negatively with SS10 (r = – 0.89, P ! 0.05) and positively with SS6 (r = 0.88, P ! 0.05) frequencies (Remis et al., 1998). Moreover, analysis of population structure showed different trends according to the supernumerary variant considered. The differentiation for SS9 and SS10 may be explained mainly by heterogeneity among Northwestern populations. By contrast, the frequency of SS6 and the prevalence of B’s are homogeneous within the Northwest but differ between this region and East Argentina. The distribution of neutral variants might be the consequence of gene flow among populations coupled with genetic drift generating similar differences in chromosome frequencies. This explanation seems to be untenable for D. elongatus. Our results suggest that the interactions between different forms of supernumerary variants may establish limits to the effects of gene flow and genetic drift and may be involved in non-random distribution patterns of supernumerary segments and B chromosomes in this species.

Geographical distribution of B chromosomes B chromosome prevalence in 13 natural Argentinean populations of D. elongatus collected in three different biogeographical provinces (sensu Cabrera and Willink, 1980) was considered to analyze geographic distribution of B polymorphism (Remis and Vilardi, 1986; Loray et al., 1991; Clemente et al., 1994; Remis et al., 1998) (Table 1). Four populations belong to “Las Yungas” biogeographic province, (Raco: RA, Horco

Table 1. Proportion of B-carrying individuals and geographic and climatic variables of natural populations of Dichroplus elongatus collected in Argentina. Data from Remis and Vilardi (1986), Loray et al. (1991), Clemente et al. (1994), Remis et al. (1998), Remis et al. (submitted). B

N

Latitude

Longitude

Altitude

Medium Temp. (ºC)

Maximun Temp. (ºC)

Relative Humidity (%)

a) Las Yungas Province HM RA FA CQ

0.139 0.209 0.250 0.065

79 91 20 31

26º48 26º40 27º03 24º55

65º19 65º22 65º23 65º37

550 1172 340 1500

19 16 19 16.1

25.2 20.5 25.3 20.5

76 73 80 73

b) Espinal Province CO DA PA

0.214 0.2 0

14 15 20

31º59 31º53 31º44

60º55 60º53 60º29

18 18 78

19 19 18.2

24.8 24.8 23.8

81 81 73

0 0.263 0 0.07 0.08 0

15 19 17 28 13 22

32º52 33º01 33º30 34º22 34º55 36º39

58º03 58º30 58º47 58º46 57º59 56º42

25 21 5 5 19 0

18 17.8 18 17.4 15.9 14.5

23.8 24 22.1 22.6 21.4 19.4

75 75 73 69 80 85

c) Pampeana Province Uruguayensis District

Oriental District

EP GU CE ES LP LU

Molle: HM, Famailla´: FA and Campo Quijano: CQ) and are located in Northwest Argentina. The remaining populations are located in East Argentina. Three of them belong to “Espinal” (Desvı´o Arijo´n: DA, Coronda: CO, Parana´: PA) and six to “Pampeana” biogeographic province (El Palmar: EP, Gualeguaychu´: GU, Ceibas: CE, La Plata: LP, Escobar: ES, and La Lucila: LU). The geographical distribution of B chromosomes indicates that they are widespread in the Northwest region of Argentina where all populations of Las Yungas province display this polymorphism and the average prevalence of Bs (0.167) was higher. In the East, by contrast, B chromosomes may be absent or show an extremely low prevalence, excepting the GU population. Within this region, populations of Pampeana province possess lower average prevalence of B chromosomes (0.07) with respect to populations of Espinal province (0.12). There is significant heterogeneity in B distribution when all populations were compared (Table 2a). To gain deeper insight into chromosome variation in this species we performed a hierarchical analysis of population differentiation. The heterogeneity among populations in B chromosome prevalence may be explained by significant differentiation between two main geographic regions (Northwest vs. East) (Table 2b) and within one of them (East). B chromosome prevalence does not differ significantly among populations of Las Yungas province (Table 2c). By contrast, there is a significant heterogeneity in the proportion of B-carrying individuals among populations located in the East (Table 2d). Within the East region, populations of Espinal province were homogeneous in B chromosome distribution (Table 2e) while in Pampeana province chromosome differentiation was highly significant (Table 2f). The last result may be explained by the significant differentiation among populations of Uruguayensis district (Table 2f1) since populations of the Oriental district exhibit similar B prevalence (Table 2f2). The spatial distribution of B chromosome polymorphism in the Eastern geographic region was analyzed with respect to

Table 2. Hierarchical analysis of chromosome and molecular (mitochondrial DNA) differentiation in 13 populations of Dichroplus elongatus belonging to three biogeographic provinces located in Eastern and Northwestern Argentina. The significance of chi-squared values observed was obtained using the randomization method of Monte Carlo according to Roff and Bentzen (1989). a

Comparison a) All Populations b) Northwest vs East region c) Among Northwest populations d) Among Eastern populations e) Among Espinal populations f) Among Pampeana populations f1) Among Uruguayensis populations f2) Between Oriental populations a b

2

χ P 2 χ P 2 χ P 2 χ P 2 χ P 2 χ P 2 χ P 2 χ P

b

B

MtDNA

25.36 0.01 5.62 0.02 4.90 0.18 20.36 0.01 4.73 0.11 15.17 0.008 10.69 0.008 1.74 0.36

87.0 -5 10 72.22 -5 < 10 38.6 0.004 87.3 0.0002 2.90 0.98 64.7 -5 10 18.4 0.24 2.05 0.69

Data from Remis et al. (submitted). Data from Clemente et al. (2000).

some climatic and geographic variables. Partial correlation analysis using the step-wise procedure suggested that B chromosome prevalence is associated with maximum temperature (r = 0.87, P = 0.004) and with latitude (r = 0.82, P = 0.01). In a previous work, genetic variation and phylogeography of this species were studied at mitochondrial DNA level in the same populations as those analyzed chromosomally using RFLP technique (Clemente et al., 2000). This study detected twelve different composite haplotypes for 16 polymorphic sites in the analyzed populations (Fig. 2). Haplotype 1 (H1) is

Cytogenet Genome Res 106:359–364 (2004)

361 219

entiation between districts because each district is homogeneous for mtDNA patterns. In Las Yungas there is no significant correlation between genetic and geographic distances (r = –0.48, P = 0.88). Thus, the distribution patterns of mtDNA variation observed in D. elongatus may be explained by isolation by distance when referring to the main biogeographic provinces while within Las Yungas and Pampeana provinces ecological factors seem to have contributed to the genetic differentiation among populations. The hierarchical analysis of molecular differentiation revealed discrepancy with respect to B chromosome distribution patterns, mainly in Las Yungas and Pampeana provinces. Populations from Las Yungas, with similar B chromosome prevalence, show significant heterogeneity at the mtDNA level. Moreover, populations of Uruguayensis district of Pampeana province are heterogeneous at chromosome level, but do not show evidence of restriction of gene flow analyzing mtDNA haplotype distribution.

Effects

Fig. 2. Geographic location, proportion of B-carrying individuals (pie charts), and haplotype frequencies (histograms) of the analyzed populations of Dichroplus elongatus. Raco = RA, Horco Molle = HM, Famailla´ = FA, Campo Quijano = CQ, El Palmar = EP, Gualeguaychu´ = GU, Ceibas = CE, Desvı´o Arijo´n = DA, Coronda = CO, Parana´ = PA, La Plata = LP, Escobar = ES, La Lucila = LU (Hi = i haplotype). Bar: 1000 km.

present in all sampled populations. H5 and H6 are widely distributed, whereas H12 was detected only in Famailla´. The comparison of absolute haplotype frequencies showed a significant heterogeneity of the mtDNA distribution when all thirteen populations were compared (Table 2a). The detected heterogeneity may be explained at two levels: i) by significant differentiation between Northwest and East regions (Table 2b) and ii) by significant differentiation among populations within Las Yungas (Table 2c) and Pampeana (Table 2f) provinces. In the Pampeana province two groups of populations are recognized, each of them homogeneous for mtDNA patterns. One of them includes the populations of the Uruguayensis district (EP, GU, CE, and ES) and the other is formed by those of the Oriental district (LP and LU) (Table 2f1, f2). At the levels where mtDNA heterogeneity was observed, the hypothesis of isolation by distance was tested evaluating the correlation between genetic and geographic distance matrices by the Mantel test. When all populations were considered the correlation was highly significant (r = 0.42, P = 0.001). In the Pampeana province the correlation is also significant (r = 0.54, P = 0.02), but this result is a consequence of a significant differ-

362 220

Cytogenet Genome Res 106:359–364 (2004)

There is compelling evidence that B chromosomes can show detrimental influence affecting development, fertility and fecundity of carriers (Jones and Rees, 1982; Camacho et al., 2000). In Orthoptera, the basal level of abnormal spermatids is usually very low (Suja et al., 1986). Several examples where Bs can increase the frequency of macro and microspermatids have been reported (Nur, 1969; Bidau, 1986; Suja et al., 1986; Bidau and Confalonieri, 1988). One of the significant effects of B chromosomes detected in D. elongatus, is the influence on spermiogenesis (Loray et al., 1991; Clemente et al., 1994). Due to B mitotic instability, the number of supernumerary chromosomes varies among testicular follicles. Cytogenetic analysis of individual follicles of each B-carrying individual allowed us to analyze the effect of different numbers of Bs on cells with the same genetic background. In both analyzed populations (Raco and Tafı´ Viejo) the results were consistent (Clemente et al., 1994). In each B carrier the trend was similar: the proportion of abnormal spermatids (macro- and microspermatids) was dependent on the number of Bs in the cell. Mean frequencies of macro- and microspermatids in cells with different number of Bs for both populations are summarized in Fig. 3. In Raco, the frequency of macrospermatids was significantly lower in follicles with 0 B, 2 Bs and 3 Bs with respect to 1B and 4B follicles (¯21 = 94.96, P ! 10–5 ). 0B, 2B and 3B follicles showed similar macrospermatid frequencies (¯22 = 0.83, P = 0.66). In the same way, frequencies of macrospermatids in follicles with 1 B and 4 Bs did not differ statistically (¯21 = 3.18, P = 0.08) (Fig. 3A). In Tafı´ Viejo, the frequency of macrospermatids remains similar among follicles with 1 B, 3 Bs and 4 Bs (¯22 = 0.95, P = 0.62) and among 0B and 2B follicles (¯21 = 0.60, P = 0.44). In agreement with the results found in Raco, in Tafı´ Viejo, macrospermatid frequencies were higher in follicles belonging to the first group (¯21 = 88.23, P ! 10–5 ) (Fig. 3A).

Fig. 3. Mean frequencies (in %) of macro- (A) and microspermatids (B) in follicles with different numbers of Bs in two populations of Dichroplus elongatus, Raco (RA) and Tafı´ Viejo (TV). Data from Clemente et al., 1994.

As a general feature, we observed a significant increase in macrospermatid frequencies in follicles with odd or high numbers of Bs that can be explained on mechanical grounds related to the presence of B univalent. In Raco, microspermatid frequencies were significantly different among all classes of follicles (¯24 = 333, P ! 10–5) (Fig. 3B). In follicles with odd numbers of Bs (1 or 3) the frequency of microspermatids is significantly higher than in follicles with even numbers (2 or 4) (¯21 = 157.5, P ! 10–5). Within follicles with even number of Bs the frequency of microspermatids increases with the numbers of supernumeraries (¯21 = 6.10, P = 0.01) while the opposite occurs in follicles with odd numbers of B’s (1 B vs. 3 Bs, ¯21 = 21.40, P ! 10–5 ). In Tafı´ Viejo, the frequency of microspermatids was higher in 1B follicles with respect to the other classes (¯21 = 85.24, P ! 10–5 ) which have similar microspermatid frequencies (¯23 = 1.66, P = 0.64) (Fig. 3B). As in the case of macrospermatids, significant increase in microspermatid frequencies was associated with follicles with odd or high number of Bs. The existence of microspermatids may be explained by the lagging B chromosomes or chromatids which may be excluded in the micronucleus. A cytophotometric analysis of DNA content revealed that the most frequent macrospermatids had a DNA content equivalent to diploid cells (2C) (Table 3). However, B-carrying individuals show significant increase in the frequencies of triploid (3C) and decrease in the frequency of tetraploid (4C) macrospermatids. Moreover pentaploid (5C) macrospermatids were also detected in individuals with Bs. The existence of macrospermatids with odd DNA content suggests that physiological effects related to post meiotic processes of spermatid formation including cell fusion may also be involved in the production of abnormal sperm. The effects of Bs on spermiogenesis in D. elongatus are consistent over the analyzed populations though the influence is more striking in Raco. The higher influence of Bs in this population may be considered as evidence that the environmental conditions and/or the genetic background can modify the effects of supernumerary chromosomes and hence the ability of a population to tolerate this polymorphism.

Table 3. Percent of macrospermatids with different DNA content in Band non-B-carrying individuals of Dichroplus elongatus (Clemente et al., 1994). N = number of analysed cells. DNA content macrospermatid comparison between B- and non-B-carrying individuals (¯22 = 10.37; P = 0.006) (5C macrospermatids were excluded in the analysis by the small sample size).

B-carrying Non-carrying

2C

3C

4C

5C

N

70 82.70

20 1.92

6.67 15.38

3.33 0

60 52

Whether this increase in abnormal sperm production can affect fertility of carriers in species with great sperm production or sperm replacement, as can occur in grasshoppers, remains an interesting question.

Evolutionary dynamics Interpopulation B chromosome differences depend on selective, historical, transmission and random factors (see Camacho et al., 2000). The relative importance of these factors may be obtained by analyzing the distribution patterns of B chromosomes and by comparing the population differentiation of different data sets. In D. elongatus the patterns of variation of different supernumerary variants (chromosomes and segments) do not fit expected patterns under hypotheses based on interaction between genetic drift and migration only (Remis et al., 1998). This condition might be attributed to the mitotic instability of B chromosomes that may yield a probable accumulation mechanism, but the covariation between different supernumerary variants may also contribute to the observed non-random pattern. Additional information about the nature of the patterns of B chromosome variation was obtained by comparing them with those obtained at the mitochondrial DNA level. mtDNA con-

Cytogenet Genome Res 106:359–364 (2004)

363 221

stitutes a macromolecule of fast evolution that lacks recombination and has maternal inheritance in most animals. Because of these properties, it has been used to analyze population structure related to historical factors and to propose colonization routes (Avise, 1994). In D. elongatus, the distribution of B chromosome variation is not consistent with the gene flow patterns expected according to a phylogeographic analysis based on mtDNA. Our results suggest that the non-random pattern in the frequency of B chromosomes is not explained by historical factors. In a previous paper, based on a lower number of populations from Northwest and East Argentina, we observed differences between regions that suggested a clinal pattern (Sequeira et al., 1995). In the present wider survey, we were able to show that these two regions have different characteristics with respect to B polymorphism. The partial correlation analysis indicated that B chromosome distribution in the East region is

complex because it is positively related to two variables, mean maximum temperature and latitude, which are negatively correlated with each other. The effects of Bs on spermiogenesis, the differences between regions with respect to B distribution, the non random pattern of B distribution with respect to supernumerary segments, the differences between the patterns of B chromosome and mtDNA variation, and the association of B chromosome frequency and climatic and geographical variables in the eastern region indicate that the distribution of B chromosomes in D. elongatus are not to be explained exclusively by random and historical factors. The ability of populations to bear this polymorphism may depend on the interaction between a probable non Mendelian transmission mechanism, negative effect on fertility, environmental variables and the genetic background.

References Avise JC: Molecular Markers, Natural History and Evolution (Chapman and Hall, New York 1994). Beukeboom LW: Bewildering Bs: an impression of the 1st B-chromosome conference. Heredity 73:328– 336 (1994). Bidau CJ: Effects of cytokinesis and sperm formation on a B-isochromosome in Metaleptea brevicornis (Acridinae, Acrididae). Caryologia 39:165–177 (1986). Bidau CJ, Confalonieri V: Cytophotometric study of micro and macrospermatids in three species of grasshoppers. Cytobios 53:31–41 (1988). Cabrera AL, Willink A: Biogeografı´a de América Latina, in Monografı´as cientı´ficas de la OEA. Buenos Aires, Argentina, vol. 13 (1980). Cabrero J, Lo´pez Leo´n MD, Go´mez R, Castro AJ, Martı´n Alganza A, Camacho JPM: Geographical distribution of B chromosomes in the grasshopper Eyprepocnemis plorans, along river basin, is mainly shaped by historical non-selective historical events. Chrom Res 5:194–198 (1997). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Christiansen FB, Frydenberg O, Hjorth JP, Simonsen V: Genetics of Zoarces populations. IX Geographic variation at the three phosphoglucomutase loci. Hereditas 83:245–256 (1976). Clemente M, Remis MI, Vilardi JC, Alberti A: Supernumerary heterochromatin, chiasma conditions and abnormal sperm formation in Dichroplus elongatus (Orthoptera): Intra and interpopulation analysis. Caryologia 46:321–335 (1994).

364 222

Clemente M, Remis MI, Vilardi JC: Mitochondrial DNA variation and phylogeographic relationships among Argentinian populations of Dichroplus elongatus. Ann Entomol Soc Am 93:653–663 (2000). Hewitt GM, Brown FM: The B-chromosome system of Myrmeleotettix maculatus V. A steep cline in East Anglia. Heredity 25:363–371 (1970). Jones RN: B chromosomes in plants: escapees from the A chromosome genome. New Phytol 131:411–434 (1995). Jones RN, Rees H: B Chromosomes (Academic Press, London 1982). Lo´pez Leo´n MD, Cabrero J, Camacho JPM: Meiotic drive against an autosomal supernumerary segment promoted by the presence of a B chromosome in females of the grasshopper Eyprepocnemis plorans. Genome 37:705–709 (1991). Loray MA, Remis MI, Vilardi JC: Parallel polymorphisms for supernumerary heterochromatin in Dichroplus elongatus (Orthoptera): Effects on recombination and fertility. Genetica 84:155–163 (1991). Nur U: Mitotic unstability leading to an accumulation of B-chromosomes in grasshopper. Chromosoma 27:1–19 (1969). Parker JS, Jones GH, Edgar LA, Whitehouse C: The population cytogenetics of Crepis capillaris IV. The distribution of B chromosomes in British populations. Heredity 66:211–218 (1991).

Cytogenet Genome Res 106:359–364 (2004)

Remis MI, Vilardi JC: Meiotic behaviour and dosage effect of B-chromosomes on recombination in Dichroplus elongatus (Orthoptera: Acrididae). Caryologia 39:287–301 (1986). Remis MI, Clemente M, Pensel S, Vilardi JC: Non random distribution patterns of supernumerary segments and B chromosomes in Dichroplus elongatus (Orthoptera). Hereditas 129:207–213 (1998). Rhoades MM, Dempsey E: Chromatin elimination induced by B chromosomes of maize. Heredity 64:13–18 (1973). Roff DA, Bentzen P: The statistical analysis of mitochondrial DNA polymorphisms: ¯2 and the problem of small samples. Mol Biol Evol 6:539–545 (1989). Ronderos RA: Consideraciones sobre la biogeografı´a de los Melanoplinae en Sudamerica (Orthoptera), in Proc 3rd Triennial Meeting Pan American Acridid Society (1985). Sequeira AS, Confalonieri VA, Remis MI, Vilardi JC: B-chromosome and enzyme polymorphisms in the grasshopper Dichroplus elongatus: geographical gradients that are not explained by historical factors. Evolucio´n Biolo´gica 9:283–299 (1995). Shaw MW: Rapid movement of a B chromosome frequency cline in Myrmeleotettic maculatus. (Orthoptera: Acrididae). Heredity 50:1–14 (1983). Suja JA, Gosa´lvez J, Lo´pez-Ferna´ndez C, Rufas JS: A cytogenetic analysis in Psophus stridulus (Orthoptera: Acrididae): B-chromosomes an abnormal spermatids nuclei. Genetica 70:217–224 (1986).

Population Dynamics and Evolution of B Chromosomes Cytogenet Genome Res 106:365–375 (2004) DOI: 10.1159/000079314

Geographic and seasonal variations of the number of B chromosomes and external morphology in Psathyropus tenuipes (Arachnida: Opiliones) N. Tsurusaki and T. Shimada Laboratory of Biology, Faculty of Education and Regional Sciences, Tottori University, Tottori (Japan)

Abstract. Psathyropus tenuipes (= Metagagrella tenuipes) is a harvestman that harbors B chromosomes with extremely high frequency (individuals without Bs are only 1 % of the total number of specimens so far examined) and high numbers (mean number of Bs per individual is about 4). Geographic variations of the number of Bs and external morphology of the species and the relationship between them were studied. A northward increase in the number of Bs was detected throughout the Japanese Islands, though the number also varied considerably locally. Latitudinal gradients were also found in some external characters, while there were no correlations between those external morphologies and the number of Bs. Principal

component analysis using eight morphological data for 21 populations revealed four geographical groups that reflect actual location of the populations. Populations along the Seto Inland Sea were characterized by a lower number of Bs than those in other areas. Seasonal change was also found in a population (Yatsukami in western Honshu) in both 1994 and 1995 for the number of Bs, though the number in the same population was stable at least throughout later postembryonic stages in both 1997 and 1998. Embryos contained fewer numbers of Bs than adults, suggesting that females of the species tend to lay eggs with fewer numbers of Bs.

B or supernumerary chromosomes are extra dispensable chromosomes whose number varies within populations of many organisms. The raison d’etre of B chromosomes is not yet fully understood. Some studies have proposed a selective advantage of individuals with B chromosomes or of certain frequencies of B chromosomes within a population (Robinson and Hewitt, 1976; Plowman and Bougourd, 1994), while most stud-

ies failed to show such adaptive effects. On the contrary, quite a few studies have demonstrated deleterious effects on their carrier and suggested their nature as selfish DNA (Hewitt et al., 1987; Werren et al., 1988; Shaw and Hewitt, 1990; Jones, 1991; Camacho et al., 1997; Muñoz et al., 1998). B chromosome frequency often shows differential geographical distribution (Hewitt and John, 1967; Hewitt and Brown, 1970; Kayano et al., 1970; Bourgourd and Parker, 1975, 1979; John, 1976; Jones and Rees, 1982; Semple, 1989; Parker et al., 1991; Tsurusaki, 1993; Confalonieri, 1995; Cabrero et al., 1997). A classical example is that of Myrmeleotettix maculatus in Great Britain. In this species, the frequency of individuals containing one or more B chromosomes is broadly correlated with latitude, and distribution of individuals with Bs is limited to the southern part of Great Britain (Hewitt and John, 1967; Hewitt and Brown, 1970). A similar cline was found in the plant Crepis capillaris (Asteraceae), in which B chromosomecontaining plants are only found in southern Great Britain

Supported in part by Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture, Japan, and Japan Society for the Promotion of Science to N.T. (06640901 and 13640696). Received 2 October 2003; manuscript accepted 17 March 2004. Request reprints from Nobuo Tsurusaki, Laboratory of Biology Faculty of Education and Regional Sciences Tottori University, Tottori, 680-8551 (Japan) telephone and fax: 81-857-31-5110, e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0365$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Materials and methods Psathyropus tenuipes is distributed in Japan and the Maritime Province of Far East Russia. This species is typically coastal in western Japan and usually inhabits abrasion cliffs in sandy beaches. On the other hand, the species penetrates inland in northern Japan and can be found in open habitats such as parks with lawns and shady groves in urban areas (Fig. 2). The species is univoltine and overwinters as eggs (Tsurusaki, 2003). Adults appear from late June and can be collected till November in southwestern Japan. Some survive until January to March of the next year. A low level of synchronization in the life cycle is one of the prominent features of the species (Tsurusaki, 2003) and there are some individuals still juvenile even in September. This species is gregarious and is usually found in clumps, each clump consisting of dozens of harvestmen, on the lower surface of overhanging rocks on cliff walls or hollows of tree trunks. This habit makes collecting the species very easy.

Fig. 1. B chromosomes (arrows) of Psathyropus tenuipes in a C-banded spermatogonial metaphase (A) and meiotic metaphase I (B) in the same single male with 2n = 20 ( = 18 + 2Bs).

(Parker et al., 1991). Geographic variation in the frequency of Bs has attracted many researchers because those patterns may provide a clue as to why B chromosomes are maintained in those organisms in spite of their deleterious effects. Geographic variation in the number and frequency of B chromosomes occurs in a Japanese harvestman, Psathyropus tenuipes L. Koch 1878 (Sclerosomatidae: Gagrellinae), which has formerly been known as Metagagrella tenuipes (L. Koch) (Tsurusaki, 1993). B chromosomes (Fig. 1) of the species show the following characteristics (Tsurusaki, 1993; Gorlov and Tsurusaki, 2000a, b): (1) The Bs are widespread over the whole geographic range of the species, nearly every individual possesses at least one B and the population mean for the number of Bs often exceeds six; (2) The number of Bs often fluctuates to some extent among cells from the same individual; (3) Bs vary considerably in size and morphology; (4) Bs are almost completely heterochromatic (Fig. 1), though some of them carry euchromatic segments located on terminal regions or rarely in the middle of the chromosome; (5) Bs behave as univalents at meiosis (Fig. 1); (6) Presence of a peculiar odd-even effect, suggesting differences in susceptibility to parasites between B-odd and B-even harvestmen (Gorlov and Tsurusaki, 2000a; but see discussion section). Although the B chromosomes of P. tenuipes seem to be widespread across the species range, there is also geographic variation in the average number of Bs per population with a rather wide range (Tsurusaki, 1993). Species with such high levels of B chromosome polymorphism are suitable as material to study phenotypic effects of Bs or dynamics of B chromosome polymorphism. The aims of the present study were to assess a more detailed pattern of geographic variation in the number of Bs of this species in Japanese Islands and examine possible relationships between the number of Bs and external morphology or environmental factors.

366 224

Cytogenet Genome Res 106:365–375 (2004)

Chromosome survey We surveyed chromosomes of adult males collected from a total of 14 populations in Honshu including 10 populations in Tottori Prefecture (Table 1, Fig. 2). In the Yatsukami population, at the Hamamura Coast in eastern Tottori Prefecture which faces the Sea of Japan, chromosomes were surveyed monthly from July to September in 1994 to ascertain whether the number of B chromosomes fluctuates seasonally. For this population we also surveyed chromosomes of developing embryos by using eggs laid by female adults in captivity in the autumns of 1994 and 1995. Females, collected in October and kept separately in plastic containers (24 cm in diameter, 12 cm high), laid eggs in sand beds moistened with water. Eggs dug out from the sand were checked for developmental state and if they were in a stage with limb buds (stages illustrated in Figs. 3–4 of plate 1 in Holm, 1947) they were used for chromosome preparations. We used an air-drying method with a cell dissociation process using lactic acid (see Tsurusaki, 1985; Tsurusaki and Cokendolpher, 1990) for chromosome preparations of testes. For the eggs, we used another air-drying technique with 30 % acetic acid treatment for cell dissociation (Dietrich and Mulder, 1981), which includes the following steps: (1) Hypotonic treatment: we placed a developing egg in a hollow of the depression slide filled with hypotonic solution (1 % citric acid) and left it for 15 min after removing the chorion using a dissecting needle. (2) Fixation: we removed the hypotonic solution with a Pasteur pipette and fixed the embryo immediately with methanol:acetic acid (3:1). We transferred the fixed embryo into a plastic 1.5-ml microtube with 1 ml of fixative and stored it in a freezer (–20 ° C) for more than 24 h. (3) Dissociation of cells: we replaced the fixative with 30 % acetic acid and shook the microtube vigorously with a Vortex mixer. The cell suspension was rinsed three times with fixative by resuspension and recentrifugation. (4) Slide preparation: we dropped a small amount of the cell suspension onto a slide using a micropipette and allowed it to air-dry. The number of Bs in this species fluctuates considerably among cells of the same individual (cf. Table 2), thus, chromosome number of each harvestman was represented by its modal number. Modal number of B chromosomes was closely correlated to median B number, especially when the sample size was large (see data on 20 males in Table 2, r = 0.88, P ! 0.001). Morphometrical analysis of external morphology For the morphological analyses, adult male specimens preserved in 80 % ethanol from various localities that cover the entire distribution range of the species in Japan were used. We selected 21 populations considering geographical locations and number of samples available (we tried to select populations with more than ten individuals as far as possible) for the detailed analyses. All the specimens used for chromosome preparation were also measured and counted, although data on some characters such as body length were unavailable due to severe damage of body during dissection. We selected eight morphometrical characters: (1) body length (BL), (2) cephalothorax length (CL), (3) lengths of femora of the first pair of legs (FIL), (4) width between the scent gland pores (WSG), (5) length of spine on the second abdominal tergite (SPL), (6) number of noduli on the femur of the second legs (NN), (7) number of denticles on dorsal surface of the basal segment of chelicera (NCD), (8) degree of melanism of body (DM). We measured or counted both right and left counterparts for femur I length (FIL), number of noduli (NN), and cheliceral denticles (NCD) to estimate degree of fluctuating asymmetry (FA) as a measure of developmental instability. FA

1. Is. Rishiri

Populations karyotyped

2. Cape SoyaH

Wakasakanai

Populations measured for external characters

SunagawaH

3. Toyotomi Spa

Populations karyoptyped and measured for external characters

Hokkaido Univ. CampusH

26. Yatsukami

4. MaruyamaH 12. Kamogaiso 24. Shirawara 13. Kozomi 23. Higashihama

27. Nagaobawa 28. Uno 29. R. Kaseichi 30. R. Araigawa

Botanical GardenH 5. Oirase

25. Tatsumidai

N 0 250 500 km Populations in Tottori Prefecture

6. Obanazawa

12. Uradome Coast (Kamogaiso) 10. Kurosaki

13. Kozomi 20. Is. Kokuno-jima 19. Is. Noumi-jima 14. Kawatana

Fig. 2. Map showing populations of Psathyropus tenuipes surveyed for karyotypes (solid circles) and for external characters (open circles) with records of the species (smaller circles). Population numbers correspond to those in Figs. 4 and 6. Chromosomal data on the asterisked populations were derived from Tsurusaki (1993).

Yatsukami

11. Amagozen 9. Yokohama

22. ShirahamaH 21. Ushimado

7. Awa-AmatsuH

N 8. Is. Hachijo

18. Is. NakajimaH 0

250

16. Is. Amakusa Kamishima

15. Is. Amakusa Shimojima

500

km

17. Is. Kuchinoerabu

Table 1. The number of B chromosomes of Psathyropus tenuipes in various localities surveyed in the present study. All the statistics presented here are based on the modal numbers of Bs in respective individuals, thus the number presented under “Specimens examined” equals the sample size (n). Populationa

Amagozen Point, ISHIKAWA(11) Higashihama Beach, TOTTORI(23) Shirawara Beach, TOTTORI(24) Kamogaiso Beach, TOTTORI(12) Kozomi Beach, TOTTORI(13) Tatsumidai, TOTTORI (25) Yatsukami, TOTTORI(26) Yatsukami, TOTTORI(26) Yatsukami, TOTTORI(26) Yatsukami, TOTTORI(26) Yatsukami, TOTTORI(26) Yatsukami, TOTTORI(26) Yatsukami, TOTTORI(26) Nagaobana Point, TOTTORI(27) Uno Beach, TOTTORI (28) River Kaseichi, TOTTORI (29) River Arai, TOTTORI (30) Ushimado, OKAYAMA (21) Is. Kokuno-jima, HIROSHIMA (20) Kawatana, YAMAGUCHI (14) a b

Date

25 Jul 1994 22 Sept 1994 22 Sept 1994 12 Jul 1994 1 Aug 1994 19 Aug 1994 12 Jul 1994 5 Aug 1994 9 Sept 1994 11 Oct 1994 Nov 94 – Jan 95 5 Aug 1995 11-23 Nov 95 12 Jul 1994 30 Jul 1994 25 Jul 1994 25 Jul 1994 24 Aug 1995 27 Sept 1995 27 Sept 1995

Specimens examinedb

Number of B-chromosomes min.

max.

mean

SD

median

38 6 24 1 4 12 7 17 34 10 39 eggs 20 54 eggs 2 4 1 7 35 8 4

2 2 2 4 1 1 1 0 1 4 0 1 0 4 1 2 0 0 0 4

8 7 6 4 4 7 7 7 8 8 6 7 4 6 4 2 4 5 2 7

4.5 4.3 3.9 4 2.3 2.8 3.9 2.7 3.6 6 1.4 4.7 1.1 5 1.8 2 1.6 2.2 1.2 5.5

1.29 1.63 1.16 – – 1.6 2.43 2.12 1.37 1.15 1.58 1.93 1.16 – – – 1.4 1.2 1.31 0

4 4 4 4 2 2.5 3 2 3 6 1 5 1 5 1 2 2 2 1 5.5

Numbers in parentheses correspond to those in Fig. 2. All the specimens are males except for eggs.

Cytogenet Genome Res 106:365–375 (2004)

367 225

Fig. 4. Geographic variation of the number of B chromosomes among populations. Original data for populations asterisked are in Tsurusaki (1993). Explanations for each box plot are in Fig. 3. Some dots deviated from each range bar are outliers. The difference in the number of B-chromosomes among populations is significant (Kruskal-Wallis test, P ! 0.001).

Results

Fig. 3. Seasonal variations of the number of B chromosomes retained in the Yatsukami population of Psathyropus tenuipes in 1994, 1997 and 1998. Data for 1997 and 1998 are based on Gorlov and Tsurusaki (2000a). A line in the body of the box and the ends of the box locate median and the 25th and 75th quantiles, respectively. Bars represent the range. The number of B-chromosomes significantly fluctuated among months in 1994 (Kruskal-Wallis test, P ! 0.001. The difference was significant at the same level, even when data set for July, sample size of which is less than 10, was eliminated in the analysis), while they were rather stable throughout the season in both 1997 and 1998.

was assessed by the value obtained from the following formula: (R – L)/ 0.5(R + L), where R and L represent values for the right and left sides of an individual, respectively (Müller and Swaddle, 1997). All the measurements and counts were made under a stereo-microscope with eyepiece graticule. Principal component analyses were performed by using standardized data. All the continuous measurements (5 characters) were log-transformed. All the statistical analyses were carried out with JMP (Ver. 4, SAS Institute 2000).

368 226

Cytogenet Genome Res 106:365–375 (2004)

Seasonal change of the number of Bs at Yatsukami population Mean numbers of B chromosomes at the Yatsukami population in four successive months in 1994 and in embryos of the next generation are presented in Table 1 and are shown in Fig. 3 together with data obtained in 1997 and 1998 at the same population (Gorlov and Tsurusaki, 2000a). In 1994, the number of Bs increased from August (2.7) to October (6.0). On the other hand, mean number of Bs dropped to 1.4 in embryos laid by females matured in summer 1994 and collected in October (Table 2). Unfortunately, the numbers of chromosomes retained by those females are unknown due to the difficulty in obtaining good chromosomal spreads from females with fully matured ovaries. However, there was a significant difference between the number of Bs retained in those embryos (mean 2.7, n = 39) and those exhibited by males collected in October (mean 6.0, n = 10) when females used for the rearing experiments were also collected (Mann-Whitney U test, P ! 0.0001). It is unlikely that the number of Bs differed between sexes in this generation, since it has been shown that the number of Bs does not differ between sexes, at least in subadults and younger adults just after the final molting (Tsurusaki, 1993; Gorlov and Tsurusaki, 2000a). Decrease of the number of Bs in embryos was also ascertained in additional rearing experiments using females from the same population in 1995 (Tables 1 and 2). In the experiment, a total of 101 eggs laid by six females showed a very low level of B chromosome frequency (mean with SD: 1.07

Table 2. Intraindividual variation in the number of B chromosomes in males (based on spermatogonial metaphases) and embryos (mitotic metaphases in developing eggs) of Psathyropus tenuipes represented by the number of cells showing different numbers of B chromosomes in each individual surveyed in the Yatsukami population in 1994 (for embryos, 1995 data were also included). Only individuals with more than 30 cells counted are shown (for embryos more than 10 cells). Indiv. No.a

Number of B chromosomes 0

1

2

940805-6 940805-13 940805-30juv 940909-1 940909-2 940909-8 940909-9 940909-23 940909-24 940909-26 940909-27 940909-29 940909-31 940909-33 940909-34 940909-35 941011-1 941011-6 941011-7 941011-9

10

7 5 18 2

12

941114-9egg 950126-1egg 951114-10egg

7 8 3

9 11

1

1 1

11 2

5 18 6 18 2 15 11 11 8 19 8 3 2 1

1 5 7

3

4

10 15 21 14 13 15

2 10 1 3 3 5 5 12 4 5

5 25 10 9 18 1 1 2 1 15

2 19 1 14 2 39 5 12 9

1

2 4 1

5

6

16 1 5 8 2 3 1 9 3 6 2 13

4 11 2 1 2 1 4 16 4 1 3 7

2 7 34 9 3 29

6 6 5 8 3 3

4

1 1

7

8

9

1

10

11

1

3

12

4

2 1

2 5

13 11

12 14 3 2 2

8 9 4 8 1

5

9

2

3 2 3

3

6 2 1

n

mean

SD

CV

mode

median

31 34 41 34 51 67 51 35 34 32 43 43 78 38 31 40 103 36 33 58

1.26 4.21 2.88 3.62 3.08 5.60 2.49 3.94 5.68 3.25 3.09 4.79 5.17 2.53 3.90 5.93 5.07 5.89 6.06 4.45

1.12 1.47 2.06 1.79 1.11 3.65 1.22 1.43 0.94 1.46 1.02 2.52 2.35 0.56 1.40 1.90 1.45 1.94 2.14 1.05

0.89 0.35 0.72 0.50 0.36 0.65 0.49 0.36 0.17 0.45 0.33 0.53 0.45 0.22 0.36 0.32 0.29 0.33 0.35 0.24

2 5 1 3 3 3 2 3 6 2 3 8 4 2 4 7 4 5 4 5

1 5 3 3 3 4 2 4 6 3 3 7 5 2.5 4 6.5 5 6 6 5

16 29 14

2.75 1.48 1.64

2.77 1.55 1.15

1.01 1.05 0.70

0 1 2

3 1 2

12

a

Except for one juvenile male labeled “940805-30juv” and three embryos, all the individuals are adults. First six digits of individual number represent year-month-date surveyed (e.g. 940805 denotes August 5, 1994).

B 1.16). When compared with the data obtained from males collected in August 1995 (n = 20, mean with SD: 4.7 B 1.93), the difference was significant again (Mann-Whitney U test, P ! 0.0001). Contrary to this, the number of Bs was stable (mean 6) throughout later postembryonic stages (later stages of juveniles and long period of adults) in 1997 and 1998 (Fig. 3, middle and bottom) as already reported by Gorlov and Tsurusaki (2000a, b). Gorlov and Tsurusaki (2000a) found an interesting trend that the higher frequency of males with even modal number of Bs in June–July decreased with time in 1997. However, no such trend was observed in the 1994 samples. The frequencies of B-even individuals in 1994 did not deviate much from 50 % and remained stable throughout the adult season; the frequencies of B-even individuals including 0B (excluding 0B are in parentheses) were 40.0 (40.0), 50.0 (46.7), 51.6 (51.6), and 60.0 (60.0) % in July, August, September, and October, respectively. No significant difference between months was found (¯2 test, P = 0.90). Contrary to this, frequency of B-even individuals including 0B reached as much as 84.2 % (71.4 % when 0B individuals were excluded) in embryos produced by the 1994 generation (the difference in the frequency between all the adults combined and embryos was significant, ¯2 test, P ! 0.001; though not significant when 0B individuals were excluded, ¯2 test, P 1 0.096). Dominance of B-even embryos over B-odd was also observed in eggs laid in the autumn of 1995 (frequencies of B-even including or excluding 0B individuals

are 68.5 and 48.5 %, respectively). Difference between this frequency and that obtained for males surveyed in August 1995 (40 %, n = 20) was also significant (¯2 test, P = 0.03) when 0B individuals were counted as B-even. However, it is highly probable that this high frequency of B-even in embryos is an inevitable corollary that comes from lower number of Bs (0, 1 or 2) retained in those embryos; that is, if the modal numbers of Bs are less than three in all the embryos, two of the three classes (0B, 1B, 2Bs) are even. When 0B individuals were excluded, no significant difference was found between adults and embryos in the frequency of B-even individuals in both 1994 and 1995. Geographic variation of the number of B chromosomes Data on the number of B chromosomes of P. tenuipes in various populations surveyed in the present study are summarized in Table 1. Population mean of B chromosome number varied from 1.2 of Is. Kokuno-jima in the Seto Inland Sea to 5.5 exhibited by Kawatana (Yamaguchi Pref.) facing the Sea of Japan. Variation among populations was significant (KruskalWallis test, P ! 0.001) even when only populations with more than ten specimens were used (i.e., Amagozen Point, Shirawara Beach, Tatsumidai, Yatsukami [September, 1994 data], and Ushimado) in the analysis to reduce influence of sampling errors. Population mean in the number of Bs ranged from 1.6 in River Arai (Tottori Pref.) to 5.5 in Kawatana (Yamaguchi Pref.) in the populations along the Sea of Japan coast. On the

Cytogenet Genome Res 106:365–375 (2004)

369 227

Fig. 5. Latitudinal gradients found in mean number of B chromosomes per population (A) and (B–C) five external characters (CL, FIL, SPL, NCD, NN) to latitude. In a graph (B) for CL, correlation coefficient and probability are calculated for the data excluding Is. Hachijo. When Is. Hachijo was included, correlation was not statistically significant in CL.

contrary, in populations along the Seto Inland Sea, it ranged from 1.2 in Is. Kokuno-jima (Hiroshima Pref.) to 2.2 in Ushimado (Okayama Pref.). The results in the two populations from Seto Inland Sea were close to the number (1.7) already known from Is. Nakajima (an island of the Seto Inland Sea, Ehime Pref.) (Tsurusaki, 1993). When 11 populations from the Sea of Japan side and three from the Seto Inland Sea side were compared, the difference in the number of Bs retained in a population was statistically significant (Mann Whitney U test, P ! 0.001). To analyse the general trend of the geographic variation across Japanese Islands, the present data were combined with those formerly obtained in eight populations (Tsurusaki, 1993) (Figs. 4 and 7). Although not straightforward, there was a trend for the number of Bs to be larger in the more northerly populations (correlation between latitudes of populations and the number of Bs was significant, n = 20, r = 0.58, P ! 0.01, Fig. 5A; this was still significant even when a population “Hokkaido Univ. campus, Sapporo” which is represented by only a single male with an extraordinarily high number, 18 Bs; n = 19, r = 0.50, P = 0.03). The numbers of Bs in three populations (Is. Nakajima, Is. Kokuno-jima, and Ushimado) from the Seto Inland Sea were lower (population mean ranges from 1.2 to 2.2) than almost all populations from other areas. Geographic variation of external characters Since latitudinal clines for morphological characters such as body size or length of legs, which are often exhibited as reverse to Bergmann’s rule, are known in some species of harvestmen (Suzuki, 1973a) and other various arthropods (Masaki, 1967; Johansson, 2003; Bidau and Marti, 2004), we examined latitudinal variation for eight morphological characters. Of the eight characters surveyed, FIL, SPL, NCD, NN showed significant

370 228

Cytogenet Genome Res 106:365–375 (2004)

correlations with latitude and their values decreased with increasing latitude (Fig. 5C–F). CL also tended to decrease with latitude and correlation between them was statistically significant when Is. Hachijo population, which may be a case of insular dwarfism often typical for populations in small isolated islands, was excluded (Fig. 5B, when included, correlation was not statistically significant). We conducted principal component analyses using all the morphological characters. Table 4 presents the loadings on the first two principal components. The first two components account for 65 % of the total variance. The first axis had high positive loadings for CL, FIL, and WSG. We interpreted the first component as a “size” factor. On the other hand, the second principal component showed high positive loadings to SPL, NN, and NCD and which may be summarized as a “projection-denticulation” factor. Figure 6A plots the positions of populations on the first two principal components. Four groups, which broadly correspond to actual geographical locations, were recognized for their positions on the plots, though there was a slight overlap between the “Pacific coast group” and the “Sea of Japan coast group”. When only metric characters (BL, CL, FIL, WSG, and SPL) were employed for the same analysis, a slight gap was generated between the two groups (Fig. 6B), though Kawatana (No. 14), which is located on the Sea of Japan side, was included in the “Pacific ocean group” in the plots. The first and the second principal components in the latter procedure also showed higher positive loadings to the “size”-related and “projection”-related characters, respectively (Table 4). Degree of melanism (DM), which showed only moderate or low loadings to the first two principal components, showed prominently high positive loadings (0.64) to the third principal component, which is also characterized by a high loading (0.58)

Fig. 6. Projection of 21 populations on the first two principal components based on the eight characters measured, counted, and scored (A) and only on five measured characters (B). Three populations in the Seto Inland Sea are connected by dashed lines. 1, Is. Rishiri (Hokkaido, n = 1); 2, Cape Soya (Hokkaido, n = 2); 3, Toyotomi (Hokkaido, n = 2); 4, Maruyama (Sapporo, Hokkaido, n = 12); 5, Oirase (Aomori Pref., n = 3); 6, Obanazawa (Yamagata Pref., n = 6); 7, Awa-Amatsu (Chiba Pref., n = 20); 8, Is. Hachijo (Tokyo Pref., n = 2); 9, Yokohama (Kanagawa Pref., n = 2); 10, Kurosaki

(Toyama Pref., n = 2); 11, Amagozen Point (Ishikawa Pref., n = 43); 12, Shirawara (Uradome Coast, Tottori Pref., n = 4); 13, Kozomi (Tottori city, Tottori Pref., n = 10); 14, Kawatana (Toyoura-cho, Yamaguchi Pref., n = 4); 15, Is. Shimojima (Amakusa, Kumamoto Pref., n = 3); 16, Is. Kamijima (Amakusa, Kumamoto Pref., n = 4); 17, Is. Kuchinoerabu (Kagoshima Pref., n = 1); 18, Is. Nakajima (Ehime Pref., n = 40); 19, Is. Noumi-jima (Hiroshima Pref., n = 1); 21, Ushimado (Okayama Pref., n = 36); 22, Shirahama (Wakayama Pref., n = 29).

for BL. Individuals with dark bodies predominated in the northeastern part of Japan.

was observed between population means of the number of Bs and those of any of the eight morphological characters (e.g. for the number of Bs and FIL, r = 0.28, P = 0.47, n = 9. Other morphological characters showed lower correlation than this with the number of Bs).

Relationship between the number of B chromosomes and external morphology We chose a set of data obtained for the September samples of the Yatsukami population, to analyze the relationship between the number of Bs and external morphology, since this was the sample with a sufficient number of individuals (34 males) to remove the effects of geographical and seasonal variations. There were no significant correlations between the number of Bs and each of the eight morphological characters analyzed: FIL (r = 0.12, P = 0.53), WSG (r = 0.03, P = 0.88), SPL (r = 0.19, P = 0.27), NN (r = 0.20. P = 0.39), NCD (r = nearly 0, P = nearly 1), FA of FIL (r = 0.02, P = 0.91), FA of NN (r = 0.06, P = 0.78), FA of NCD (r = 0.28, P = 0.14). Gorlov and Tsurusaki (2000a) reported that individuals of P. tenuipes with moderate numbers of Bs (3–6) tend to possess a larger body than individuals with extreme numbers of Bs (0–2 or 7–12). We failed to detect such reverse U-shaped relationships between the B frequency and external morphology in any of the eight morphological characters including body size in the 1994 specimens. Unfortunately, the number of males in the September 1994 sample was not sufficient to detect such a trend, if there was any. There were only nine populations in which both the number of Bs and external morphology were available. No correlation

Discussion It has been reported that Psathyropus tenuipes shows considerable geographic variations in coloration of body, length of a dorsal spine on the second abdominal tergite, or number of noduli on femora of legs, etc. (Suzuki 1949, 1973a, 1973b; Suzuki and Tsurusaki, 1983). Suzuki (1949) distinguished populations of the species in Hokkaido, from those in Honshu and other southern Japanese islands by having a short dorsal spine, extremely darkened body, and low number of dorsal denticles on the basal segments of chelicera, and described them as a different subspecies P. tenuipes yezoensis (originally “Gagrella japonica yezoensis”). However, analyses of external characters in the present study revealed that body size of the species represented by the lengths of cephalothorax (CL) and femora of the first legs (FIL) gradually decreases with increasing latitude (Fig. 5B, C). These trends, which conform to the so-called “reverse Bergmann’s rule”, is rather general among invertebrates with univoltine life cycles (Masaki, 1967; Bidau and Martı´, in press) and probably relates to a shorter period available for

Cytogenet Genome Res 106:365–375 (2004)

371 229

Table 3. Summary of the number of B chromosomes checked for embryos laid by respective mothers of Psathyropus tenuipes reared in the laboratory in two consecutive years (1994 and 1995)

Mother

Number of eggs prepared

min.

max.

mean

SDa

mode

median

0 0 0 0 0

2 4 3 6 2

0.55 1.00 1.50 1.97 1.33

0.82 – – 1.88 –

0 0 0/3 0 2

0 0 1.5 2 2

1.37

1.63

2.00 1.80 0.60 0.20 1.31 0.88

– 1.14 0.70 – 1.38 –

2 2 0 0 1 0/1

2 2 0.5 0 1 1

1.07

1.16

94-No.4 94-No.5 94-No.7 94-No.8 94-No.9

19 5 4 31 3

11 5 2 18 3

Total

62

39

95-No.1 95-No.4 95-No.14 95-No.19 95-No.20 95-No.24

2 14 21 21 24 19

1 10 10 7 13 8

101

54

Total a

Number of Bs in embryos

2 0 0 0 0 0

2 4 2 4 4 2

Data with more than 10 embryos were used to calculate SD.

growth in areas of higher latitudes. Three other characters, including “dorsal spine length (SPL)” and “number of dorsal denticles (NCD)” which were used for the separation of the “two subspecies” in Suzuki (1949) also showed the same trend, without any indication of discontinuities. Thus, there are no external characters that support the separation of the species into two subspecies. Instead of two groups, principal component analyses using eight morphological data of 21 populations unveiled the occurrence of four geographical groups that roughly reflect actual geographical locations: 1) northern Hokkaido, 2) Sea of Japan coast, 3) Pacific coast, and 4) Is. Hachijo. Of these, two major groups, “Sea of Japan coast” and “Pacific coast” were mainly segregated along the second principal component axis, which can be interpreted as a “projection-denticulation” factor. The number of B chromosomes in this species also varied considerably among populations with a range from 1.2 to 7 (a single male from the campus of Hokkaido University, Sapporo, showed 18 Bs) (Figs. 3 and 7). The mean number of Bs per population significantly correlated with latitude. As already stated, negative latitudinal gradients were also found for five morphological characters (Fig. 5B–F). However, there were no correlations between the mean number of Bs per population and mean values of morphological characters. Furthermore, mean number of Bs did not correlate with any of the eight morphological characters examined when they were analyzed within a single population, Yatsukami. These findings conform to the expectation that the Bs in this species might be almost genetically inactive (Tsurusaki, 1993; Gorlov and Tsurusaki, 2000b) since they are mostly heterochromatic. However, if they were completely inactive and had no effect on phenotypes, what determines the northward increase of their number? Gorlov and Tsurusaki (2000a) found that susceptibility to gregarines, which are protozoan parasites frequently found in mid-gut of harvestmen, may be different between individuals with odd and even numbers of Bs. For example, infection rate by gregarines was lower in individuals with moderate numbers

372 230

Number of eggs with countable mitotic spreads

Cytogenet Genome Res 106:365–375 (2004)

Table 4. Loadings of the parameters on the first two principal components (PC) in two different procedures: all the characters measured, counted, scored were used (8 characters) and only measured characters were analyzed (5 characters). Parameter

1 2 3 4 5 6 7 8

8 characters

5 characters

PC1

PC2

PC1

PC2

Femur I length (FIL) Body length (BL) Cephalothorax length (CL) Width between scent gland pores (WSG) Length of 2nd tergite spine (SPL) Number of denticles on chelicera (NCD) Number of noduli on femur II (NN) Degree of melanism of body (DM)

0.44 0.33 0.53 0.46 –0.05 0.27 –0.11 –0.35

0.22 –0.14 0.01 –0.18 0.63 0.45 0.56 0.01

0.42 0.43 0.58 0.54 –0.08

0.42 –0.14 0.13 –0.23 0.85

Explained variance (%)

41.1

23.9

55.0

23.2

of Bs (4–6) than in those with both extremes (0–2 or 8–12) in B-even individuals, whereas no such trend was detected in Bodd individuals (Gorlov and Tsurusaki, 2000a). The conceptual background that may generate this type of odd-even effect is rather weak, since each of these harvestmen is actually a mosaic of B-even and B-odd cells and how a particular individual is classified into B-odd or B-even simply depends on the point that whether modal number of Bs among cells was odd or even. However, if there was any relationship between having a moderate number of Bs and resistance to gregarine infection in this species as inferred by Gorlov and Tsurusaki (2000a), a northward increase in B number might be explained in the context of possible geographic variation in the abundance of gregarines. This supposition would expect a lower level of gregarine infection in populations with fewer Bs along the Seto Inland Sea coast than in the other populations, though no data have been available for the frequencies of gregarine infection in populations other than Yatsukami.

Northern Hokkaido group Populations mean of B-chromosome numbers >5 <5

Wakasakanai 1M: 6

Campus of Hokkaido Univ. 1M: 18

Maruyama 20M3F: 3–15 (7.0)

<4 <3

Botanical Garden 6M1F: 3–10 (6.2)

<2

Sunagawa 3M: 2–6 (4.7)

Sea of Japan coast group Amagozen 38M: 4.5

Yatsukami Sept. 34M: 4–7 (3.6)

Shirawara 24M: 2–6 (3.9)

Kawatana 4M: 4–7 (5.5) Awa-Amatsu 13M3F: 1–6 (3.5) Shirahama 14M6F: 4–11 (6.6)

Fig. 7. Geographic variation of the number of Bchromosomes in Psathyropus tenuipes in Japanese Islands. Number of samples and range of B chromosome number in each study population are shown, with means in parentheses. Areas occupied by each of three groups recognized by the projection of PCA (Fig. 6) are encompassed by lines.

Pacific coast group

Ushimado 35M: 0–5 (2.2)

N

Is. Kokuno-jima 8M: 0.5–2 (1.2) Is. Nakajima 26M4F: 0–3 (1.7)

Another possibility for future testing is the possible influence of parasitic mites in the number of Bs. Muñoz et al. (1998) showed in a grasshopper Eyprepocnemis plorans that females with high numbers of mites produce fewer eggs and lower egg fertility than females with fewer mites, and this effect is more intense when females bear higher numbers of Bs. Juveniles and adults of P. tenuipes are often infected by the ectoparasitic mite Charletonia southcotti on their back or legs (Kawashima, 1961). It is possible that if similar synergistic deleterious effects by B chromosomes and ectoparasitic mites on female fitness are present also in P. tenuipes, increase of the number of B chromosomes may be driven to a low level in populations with higher mite incidence. It is most likely that infection rates by mites are higher in populations along the Seto Inland Sea, where the climate is very mild, though this must be confirmed in future studies. In the Yatsukami population, the mean number of B chromosomes per individual was 6.0 and remained stable during six months from June to November in both 1997 and 1998 (Gorlov and Tsurusaki, 2000a). Analyses of meiotic and mitotic behavior of Bs failed to detect any accumulation mechanism, such as non-disjunction, in males (Gorlov and Tsurusaki,

0

250

500

km

2000b). However, the mean number of Bs in the same population increased from 2.7 to 6 during the period from August to October in 1994. On the contrary, the mean number of Bs abruptly decreased to 1.4 in embryos developed from eggs laid by the 1994 generation. The decrease of the B number in embryos was also confirmed in the rearing experiments in 1995. Some conceivable explanations for the decrease of the number of Bs in embryos are: 1) gametes (sperm or eggs) with higher number of Bs are not produced at meiosis; 2) gametes with various numbers of Bs are produced but only gametes with fewer Bs are selectively used in fertilization; 3) fertilized eggs with high numbers of Bs fail to develop; 4) the number of Bs are, in the first place, different between germ line cells represented by spermatogonial metaphases of adult males and somatic cells represented probably by most of the embryonic cells. Possibility of the first explanation is unlikely, at least in males, because various numbers of Bs can be found also in meiotic metaphases (both I and II) (cf. Table 3 in Gorlov and Tsurusaki, 2000b). Possibility of the third explanation can also be excluded because most of the eggs dug out from sand in this study were in the process of development. Moreover, the fourth hypothesis seems to be safely rejected because no significant

Cytogenet Genome Res 106:365–375 (2004)

373 231

difference has been detected between the numbers of Bs exhibited by cells of gut epithelium and that in spermatogonial metaphases of the same individual, except for the fact that most of the cells of gut epithelium are tetraploid (Gorlov and Tsurusaki, 2000b). Therefore, we consider the second hypothesis is the most probable. As there is a considerable gap between the number of Bs retained by embryos and adults, the presence of some type of B accumulation mechanism in younger stages must be envisaged. The maximum mean number of Bs in the Yatsukami population in 1994, which was attained in September, was ca. 6.0. As already stated, this number of Bs was stably encountered during adult season from June to November in 1997 and 1998 (Fig. 3). Thus, a likely scenario that accounts for all the observations concordantly would be as follows: 1) The number of Bs at the embryonic stage is low (less than two); 2) The number of Bs gradually increases during embryogenesis and earlier developmental period of juveniles by some accumulation mechanism such as mitotic non-disjunction; 3) Increase in numbers ceases after a certain value (6.0 in the Yatsukami population); 4) Females somehow lay eggs with considerably fewer numbers of Bs than they possess. The phenomenon that the number of Bs increases during embryonic and postembryonic development is known in several organisms, such as Crepis capillaris (Rutishauser and Röthlisberger, 1966), Locusta migratoria (Nur, 1969; Kayano, 1971; Viseras et al., 1990; Pardo et al., 1994, 1995).

In male L. migratoria premeiotic accumulation for the mitotically unstable B chromosome is later counteracted by a poor success in B transmission during male reproduction (Pardo et al., 1994). In P. tenuipes, individuals with both very low and high numbers of Bs tended to have a smaller body irrespective of B-odd and B-even (Gorlov and Tsurusaki, 2000a) and presence of the same trend was suggested also in the present analysis for the 1994 samples. Moreover, frequency of gregarine infection was higher in individuals with both extreme numbers than those with moderate numbers in B-even individuals (Gorlov and Tsurusaki, 2000a). These facts seem to illustrate the negative effects of having numerous B chromosomes. Stability of the mean number of Bs (6.0) throughout adult season found in 1997 and 1998 samples (Gorlov and Tsurusaki, 2000a, b) may have been generated through natural selection against individuals with extremely high numbers of Bs.

Acknowledgments We thank Dr. Susumu Otsuka (Hiroshima University) for sending us live harvestmen from the Kokuno-jima population and Dr. Ivan P. Gorlov for helpful discussions. We also thank Dr. Claudio J. Bidau, an anonymous referee, and especially Prof. Juan Pedro M. Camacho for extremely helpful comments about the article. Thanks are also due to following persons who placed new specimens used for morphological analyses at our disposal: Y. Ihara, Y. Goto, M. Ohrui, N. Nunomura, and H. Tanaka.

References Bidau CJ, Marti DA: Clinal variation of body size in Dichroplus pratensis (Orthoptera: Acrididae): inversion of Bergmann’s and Rensch’s rules. Ann Entomol Soc Am 97 (in press 2004). Bougourd SM, Parker JS: The B chromosome system of Allium schoenoprasum I. B-distribution. Chromosoma 53:273–282 (1975). Bougourd SM, Parker JS: The B chromosome system of Allium schoenoprasum III. An abrupt change in Bfrequency. Chromosoma 75:385–392 (1979). Cabrero J, Lo´pez-Leo´n MD, Go´mez R, Castro AJ, Martı´n-Alganza A, Camacho JPM: Geographical distribution of B chromosomes in the grasshopper Eyprepocnemis plorans, along a river basin, is mainly shaped by non-selective historical events. Chrom Res 5:194–198 (1997). Camacho JPM, Shaw MW, Lo´pez-Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997). Confalonieri VA: Macrogeographic patterns in B-chromosome and inversion polymorphisms of the grasshopper Trimerotropis pallidipennis. Genet Sel Evol 27:305–311 (1995). Dietrich AJJ, Mulder RJP: A light microscopic study of the development and behaviour of the synaptonemal complex in spermatocytes of the mouse. Chromosoma 83:409–418 (1981). Gorlov IP, Tsurusaki N: Analysis of the phenotypic effects of B chromosomes in a natural population of Metagagrella tenuipes (Arachnida: Opiliones). Heredity 84:209–217 (2000a).

374 232

Gorlov IP, Tsurusaki N: Morphology and meiotic/ mitotic behavior of B chromosomes in a Japanese harvestman, Metagagrella tenuipes (Arachnida: Opiliones): No evidence for B accumulation mechanisms. Zool Sci 17:349–355 (2000b). Hewitt GM, Brown FM: The B-chromosome system of Myrmeleotettix maculatus. V. A steep cline in East Anglia. Heredity 25:363–371 (1970). Hewitt GM, East TM: Effects of B chromosomes on development in grasshopper embryos. Heredity 41:347–356 (1978). Hewitt GM, John B: The B chromosomes system of Myrmeleotettix maculatus (Thunb.) III. The statistics. Chromosoma 21:140–162 (1967). Hewitt GM, East TM, Shaw MW: Sperm dysfunction produced by B-chromosomes in the grasshopper Myrmeleotettix maculatus. Heredity 58:59–68 (1987). Holm A: On the development of Opilio parietinus Deg. Zool Bidr Uppsala 25:409–422 (1947). Johansson F: Latitudinal shifts in body size of Enallagma cyathigerum (Odonata). J Biogeography 30:29– 34 (2003). John B: Population Cytogenetics, pp 76 (Edward Arnold, London 1976). Jones RN: B-chromosome drive. Am Nat 137:430–442 (1991). Jones RN, Rees H: B Chromosomes, pp 266 (Academic Press, London 1982). Kayano H: Accumulation of B chromosomes in the germ-line of Locusta migratoria. Heredity 27:119– 123 (1971). Kayano H, Sannomiya M, Nakamura K: Cytogenetic studies on natural populations of Acrida lata. I. Local variation in the frequency of B-chromosomes. Heredity 25:113–122 (1970).

Cytogenet Genome Res 106:365–375 (2004)

Kawashima K: Notes on larval mites of the genus Charletonia Oudemans, 1910 in Japan. Kyushu J Med Sci 21:15–19 (1961). Masaki S: Geographic variation and climatic adaptation in a field cricket. Evolution 21:725–741 (1967). Müller AP, Swaddle JP: Asymmetry, Developmental Stability, and Evolution, pp 291 (Oxford University Press, Oxford 1997). Muñoz E, Perfectti F, Martin-Alganza A, Camacho JPM: Parallel effects of a B chromosome and a mite that decrease female fitness in the grasshopper Eyprepocnemis plorans. Proc R Soc Lond B 265:1903–1909 (1998). Nur U: Mitotic instability leading to an accumulation of B-chromosomes in grasshoppers. Chromosoma 27:1–19 (1969). Pardo MC, Lo´pez-Leo´n MD, Cabrero J, Camacho JPM: Transmission analysis of mitotically unstable B chromosomes in Locusta migratoria. Genome 37:1027–1034 (1994). Pardo MC, Lo´pez-Leo´n MD, Viseras E, Cabrero J, Camacho JPM: Mitotic instability of B chromosomes during embryo development in Locusta migratoria. Heredity 74:164–169 (1995). Parker JS, Jones GH, Edgar LA, Whitehouse C: The population cytogenetics of Crepis capillaris IV. The distribution of B-chromosomes in British populations. Heredity 66:211–218 (1991). Plowman AB, Bougourd SM: Selectively advantageous effects of B chromosomes on germination behaviour in Allium schoenoprasum L. Heredity 72:587– 593 (1994).

Robinson WR, Hewitt G: Annual cycles in the incidence of B chromosomes in the grasshopper Myrmeleotettix maculatus (Acrididae – Orthoptera). 36:399–412 (1976). Rutishauser A, Röthlisberger E: Boosting mechanism of B chromosomes in Crepis capillaris. Chrom Today 1:28–30 (1966). SAS Institute: JMP, Ver. 4 Cary NC (2000). Schroeter GL, Hewitt GM: The effects of supernumerary chromatin in three species of grasshopper. Can J Genet Cytol 16:285–296 (1974). Semple JC: Geographical distribution of B chromosomes of Xanthisma texanum (Compositae: Astereae). II. Local variation within and between populations and frequency variation through time. Am J Bot 76:769–776 (1989). Shaw MW, Hewitt GM: B-chromosomes, selfish DNA and theoretical models: where next? in Futuyma DJ, Antonovics J (eds): Oxford Surveys in Evolutionary Biology, Vol 7, pp 197–223 (Oxford University Press, New York 1990).

Suzuki S: Studies on the Japanese harvesters. II. Harvesters from Hokkaido, with special reference to variation. J Sci Hiroshima Univ (B-1) 11:13–28 (1949). Suzuki S: Clines in Opiliones. (In Japanese) Jpn Soc Syst Zool Circular 46:6–10 (1973a). Suzuki S: Opiliones from the South-west Islands, Japan. J Sci Hiroshima Univ (B-1) 24:205–279 (1973b). Suzuki S, Tsurusaki, N: Opilionid fauna of Hokkaido and its adjacent areas. J Fac Sci Hokkaido Univ VI Zool 23: 195–243 (1983). Tsurusaki N: Taxonomic revision of the Leiobunum curvipalpe-group (Arachnida, Opiliones, Phalangiidae). I. hikocola-, hiasai-, kohyai-, and platypenissubgroups. J Fac Sci Hokkaido Univ VI Zool 24:1– 42 (1985).

Tsurusaki N: Geographic variation of the number of Bchromosomes in Metagagrella tenuipes (Opiliones, Phalangiidae, Gagrellinae). Mem Queensland Mus 33:659–665 (1993). Tsurusaki N: Phenology and biology of harvestmen in and near Sapporo, Hokkaido, Japan, with some taxonomical notes on Nelima suzukii n. sp. and allies (Arachnida: Opiliones). Acta Arachnol 52:5– 24 (2003). Tsurusaki N, Cokendolpher JC: Chromosomes of sixteen species of harvestmen (Arachnida, Opiliones, Caddidae and Phalangiidae). J Arachnol 18:151– 166 (1990). Viseras E, Camacho JPM, Cano MI, Santos JL: Relationship between mitotic instability and accumulation of B chromosomes in males and females of Locusta migratoria. Genome 33:23–29 (1990). Werren JH, Nur U, Wu C-I: Selfish genetic elements. Trends Ecol Evol 3:297–302 (1988).

Cytogenet Genome Res 106:365–375 (2004)

375 233

Population Dynamics and Evolution of B Chromosomes Cytogenet Genome Res 106:376–385 (2004) DOI: 10.1159/000079315

Spatio-temporal dynamics of a neutralized B chromosome in the grasshopper Eyprepocnemis plorans F. Perfectti,a M. Pita,b C.G. de la Vega,b J. Gosa´lvez,b and J.P.M. Camachoa a Departamento b Departamento

de Genética, Universidad de Granada, Granada; de Biologı´a, Facultad de Ciencias, Universidad Auto´noma de Madrid, Madrid (Spain)

Abstract. Spatial and temporal patterns of frequency variation for a neutralized B chromosome in the grasshopper Eyprepocnemis plorans were analyzed along six transects in the east of Spain to explore possible factors affecting the population dynamics of this polymorphism. Three parameters were employed to quantify B frequency: prevalence, load and mean frequency. Of them, load seemed to be the less sensitive parameter, probably due to its small range of variation. Prevalence, however, shows ample variation, but the mean frequency of B chromosomes per individual is the best parameter to characterize B frequency. Only river transects revealed significant differences among populations, and the use of two geographic explicit approaches (Mantel test and distograms) revealed significant

isolation by distance (IBD), especially at the Segura River mouth, presumably due to low gene flow and drift. No temporal trend was found in the Segura River transects, which is consistent with the slow changes in B frequency expected during the random walk for neutralized B chromosomes. But these transects showed a clear spatial pattern, with B1 showing lower frequency in the upper course of this river. The present results provide the first empirical evidence of IBD in the evolution of a neutralized B chromosome, and support the notion that B dynamics at this evolutionary stage is best explained by a metapopulation approach.

The grasshopper Eyprepocnemis plorans subsp. plorans shows a very widespread polymorphism for B chromosomes ranging from the west of the Iberian Peninsula (e.g. Huelva, Spain) to the Caucasus (e.g. Dhagestan) (for review, see Camacho et al., 2003). Only in the Iberian Peninsula, more than 50 B variants have been found differing in size, morphology and Cbanding (see Camacho et al., 2003), and more variants are continuously being found (Bakkali and Camacho, 2004) suggesting that this species Bs are very dynamic. The analysis of population dynamics of B chromosomes in the grasshopper E. plorans has illuminated the long-term evolution of these parasitic elements (Camacho et al., 1997). The life

cycle of a parasitic B chromosome begins with a rapid B invasion by virtue of drive leading it to a high frequency. The A chromosome response may imply the suppression of B drive which is thus neutralized to evolve through a long random walk towards extinction due to selection against individuals with many Bs. But the B may mutate and recuperate drive thus restarting the cycle and greatly prolonging the life of the B chromosome polymorphism. This has been named regeneration and has been directly witnessed in Torrox (Ma´laga, Spain) by Zurita and colleagues (1998). The most widespread B variant of E. plorans in the Iberian Peninsula, named B1, might be the oldest B chromosome in this region (Henriques-Gil et al., 1984). Its size is about half that of the X chromosome and appears positively heteropycnotic in meiotic prophase, although it shows two dark C-bands in the proximal third. These dark C-bands contain a 180-bp tandemrepeat DNA (satDNA) and the remaining long arm (the B also has a very short arm which is not always conspicuous) is made of ribosomal DNA (rDNA) (Lo´pez-Leo´n et al., 1994). B1 has been found over the whole southeastern coast, from Tarragona to Huelva, with only two exceptions: (1) the Granada and eastern Ma´laga coasts, where it has been substituted by B2, a small-

This research was partly financed by the Spanish Ministerio de Ciencia y Tecnologı´a (BOS2003-06635, BOS2002-00232, BOS2003-04263) and Plan Andaluz de Investigacio´n (CVI-165). Received 17 February 2004; manuscript accepted 19 March 2004. Request reprints from: Dr. Francisco Perfectti, Departamento de Genética Universidad de Granada, E–18071 Granada (Spain) telephone: +34-958-243-262; fax: +34-958-244-073 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0376$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Table 1. Transects analyzed with indication of the number of populations sampled

Area/Transect

Year

Number of populations

Individuals

Sampled individuals per population

Segura River

1993 1996 1998 1999 2000 2001 1992 1992 1995 1995 1996

13 8 17 13 18 17 12 16 23 10 12

239 188 576 373 451 427 243 312 421 222 270

18.4±2.5 23.5±2.4 33.9±0.9 28.7±1 25.1±0.7 25.1±0.7 20.3±2 19.5±2 18.3±1.2 22.2±2 22.5±0.9

Segura River mouth Mar Menor Lagoon Coast of Valencia Turia River Jucar River

er variant bearing relatively more satDNA but less rDNA, and (2) Fuengirola, where it has been replaced by B5, another variant carrying more satDNA (Henriques-Gil and Arana, 1990). B1’s geographical distribution also includes Morocco (Bakkali et al., 1999) and the Mallorca Island (Riera et al., 2004). B1, B2 and B5 showed a Mendelian transmission rate (Lo´pez-Leo´n et al., 1992). The specimens analysed for B1 transmission came from the east of the Iberian Peninsula. In Morocco, however, B1 showed a Mendelian transmission rate in two populations but significant accumulation in a third one, precisely the southern one (Mechra) (Bakkali et al., 2002). The only known region lacking B chromosomes in the Iberian Peninsula is an inland region at the head of the Segura River basin, which could be remnants of ancient populations never reached by the Bs. The closest B-carrying populations, downstream of the Cenajo reservoir in the Segura River, harboured B1 (Cabrero et al., 1997). Spatial patterns may be used to study a wide range of genetics processes, from migration to selection to population contraction and range expansion (Epperson, 2003). Analysis of spatial patterns of genetic variation can be used to study gene flow and natural selection (Brashaw, 1984; Slatkin, 1987) and to evaluate the relative historical influence of gene flow and drift on regional population structure (Hutchinson and Templeton, 1999). The most common spatial pattern is isolation by distance (Epperson, 2003), produced basically by a reduction in the dispersal of the individuals. Under isolation by distance (IBD), genetic differences between populations grow proportionally to the physical separation of these populations. IBD should affect in similar form all neutral genes, but selection could affect the frequency of some genes according to specific patterns (Heywood, 1991). In addition, unless migration is irrelevant, spatial patterns are highly dependent on the status of underlying spatial-temporal processes, except in cases of strong clinal selection (Epperson, 2003). On the basis of the model described at the beginning of this section, the B1 chromosome might be considered a neutralized variant since it does not drive (Lo´pez-Leo´n et al., 1992), with the above-mentioned exception of Mechra in Morocco. In this paper, we analyze spatial and temporal patterns of B1 frequency variation in six transects in the east of Spain to explore possible factors affecting the population dynamics of this neutralized B chromosome.

Materials and methods A total of 3,722 adult males of the grasshopper E. plorans were collected from populations along six transects in the Spanish provinces of Murcia, Alicante and Valencia during 1993–2001 (see Table 1 and Fig. 1). Testes were fixed in freshly prepared 3:1 ethanol:acetic acid and stored at 4 ° C. A mean of 23.4B7.3 males were analyzed per population/year. For scoring the number of Bs in each individual, squash preparations of single follicles in a drop of 45 % acetic acid were made and observed under phase contrast. Individuals were classified as 0B, 1B, 2B or 3B. Contingency ¯2 tests were done to analyze population differences in the distribution of individuals with different number of Bs in each transect. These tests were performed with the RXC program (George Carmody, University of Ottawa, Canada) by a Monte Carlo approach to calculate the statistical significance of the contingency table. Tests were conducted with 10,000 permutations. Three frequency parameters were calculated: (1) prevalence, the proportion of individuals carrying B chromosomes; (2) load, the mean number of B chromosomes in B-carrying individuals; and (3) mean frequency of the B chromosome, calculated as the average number of B chromosomes per individual considering carriers and noncarriers. Geographic maps were digitalized and distances between populations were calculated with the program ImageJ (http://rsb.info.nih.gov/ijl). A matrix of geographical distances between populations (in km) was obtained for each area sampled. For populations along the course of a river, distances were calculated following the course of the river, i.e., in a uni-dimensional space. For the other populations, distances were obtained “as the bird flies”, i.e., as straight lines in a bi-dimensional space. Three matrices of disagreement between populations (one for each genetic parameter) were obtained, where the individual values of the matrix were calculated as the absolute difference of the genetic parameter between each pair of populations. To explore possible geographical patterns, we compared the geographical matrix with each of the three genetic matrices by means of the Mantel test. For populations in a bidimensional space, geographical distances were logtransformed, following Slatkin (1993). The significance of the Mantel test was obtained by 10,000 permutations with the program zt (Bonnet and Van de Peer, 2002). When an association between a genetic parameter and the geographic distance was found, an additional analysis was performed. We calculated a measure of spatial autocorrelation based on genetic distances using SGS software (Degen et al., 2001). To adapt the B-chromosome frequency to data comparable to gene frequencies, we divided the mean B1-chromosome frequency (a value referred to individuals) by two, to obtain a value referred to as haploid data. We used the Gregorius distance (Gregorius, 1978), calculated for a single locus (B chromosome) as DG (i, j) =

1 2

™ A pi – pj A

Cytogenet Genome Res 106:376–385 (2004)

377 235

Fig. 1. Map showing the geographical location of the six analyzed transects.

where i and j are populations, and pi anq qj the frequency of the B1 chromosome in each population, because it has a simple meaning when adapted to B-chromosome frequencies (i.e., DG = 1 implies one population with zero Bs and another one with all the individuals with two B chromosomes). SGS calculates “genetic distograms” as representation of the average genetic distance of all pairs of populations belonging to a particular distance interval (DGsq). The mean genetic distance over all pairs of populations was used as a reference value. DGsq below the reference value implies a positive spatial structure, i.e. populations are genetically more similar than expected for a spatially random distribution (Degen, 2000). Values of DGsq over the reference value imply a negative structure, where populations are more divergent than expected for a spatially random distribution (Degen, 2000). Confidence intervals were calculated by 1,000 permutations. Several spatial distance intervals were used because the scale at which spatial structure is produced is a priori unknown. To explore possible temporal variation in prevalence, load and mean frequency of the B1 chromosome from the populations of the Segura River, we performed multiple regression analysis of these variables considering distance to the coast and year as independent factors. The correlation coefficient for year may be used to test for a temporal trend.

Results The mean prevalence for the different transects was 34.05 % B 1.24, and ranged from 0 to 73.91 % (see Table 2). The load ranged from 0 (an arbitrary value to indicate the absence of Bs) to 2, with a mean value of 1.13 B 0.02, and the mean B frequency from 0 to 0.916, with a mean of 0.405 B 0.017 (Fig. 2).

378 236

Cytogenet Genome Res 106:376–385 (2004)

Segura River populations These populations were sampled six times during a period of nine years, in a transect of more than 145 km along the river course. However, the capture sites were not always the same, precluding an exhaustive temporal analysis. We analyzed the null hypothesis of no differentiation among populations by using contingency ¯2 tests for each year data, i.e., using a non-explicit geographic approach. Only populations sampled the year 2000 rejected the null hypothesis (¯2 = 87.13, P = 0.002). When we compared, by the Mantel test, the matrices of distances along the river with the matrices of differences in prevalence, they did not show association in 1993 (r = –0.083, P = 0.321), 1996 (r = 0.363, P = 0.115) and 1999 (r = 0.125, P = 0.129), but they did in 1998 (r = 0.285, P = 0.029), 2000 (r = 0.224, P = 0.035) and 2001 (r = 0.314, P = 0.012). The positive sign of this association implies that more distant populations have higher differences in B1 prevalence. Data from 1993 (r = 0.002, P = 0.425), 1996 (r = –0.0002, P = 0.580), 2000 (r = 0.039, P = 0.3149) and 2001 (r = 0.047, P = 0.251) did not show association between distance and load for the B1 chromosome. However, a positive relationship was found in 1998 (r = 0.388, P = 0.001), and a negative one in 1999 (r = –0.203, P = 0.034).

1.0

mean B1 frequency

0.8

0.6

0.4

0.2

Jucar R

Turia R

Valencia

Mar Menor

Segura mouth

Segura 2001

Segura 2000

Segura 1999

Segura 1998

Segura 1996

Segura 1993

0.0

Fig. 2. Mean B1 frequency in the sampled transects. Error bars represent B one standard error.

Table 2. Mean B S.E. for prevalence, load and mean B frequency for each transect analyzed. Between parentheses are the maximum and minimum values found

Area/transect

Year

Prevalence

Load

Mean B frequency

Segura River

1993

0.263±0.048 (0–0.667) 0.328±0.045 (0.05–0.448) 0.235±0.019 (0–0.316) 0.297±0.031 (0.067–0.467) 0.364±0.030 (0.042–0.579) 0.294±0.028 (0.053–0.478) 0.259±0.028 (0.125–0.429) 0.389±0.04 (0–0.667) 0.473±0.02 (0.25–0.6) 0.286±0.073 (0–0.625) 0.469±0.057 (0.091–0.739)

1.059±0.116 (0–2) 1.348±0.111 (1–2) 1.044±0.070 (0–1.333) 1.127±0.041 (1–1.417) 1.146±0.031 (1–1.5) 1.102±0.027 (1–1.273) 1.094±0.047 (1–1.5) 1.102±0.081 (0–1.417) 1.258±0.041 (1–1.6) 0.915±0.16 (0–1.4) 1.202±0.04 (1–1.444)

0.291±0.057 (0–0.833) 0.446±0.063 (0.05–0.63) 0.260±0.022 (0–0.395) 0.339±0.041 (0.067–0.567) 0.427±0.043 (0.042–0.833) 0.329±0.035 (0.053–0.609) 0.278±0.027 (0.125–0.429) 0.461±0.05 (0–0.792) 0.608±0.04 (0.25–0.917) 0.331±0.09 (0–0.875) 0.579±0.077 (0.091–0.913)

1996 1998 1999 2000 2001 Segura River mouth

1992

Mar Menor Lagoon

1992

Valencia coast

1995

Turia River

1995

Jucar River

1996

Cytogenet Genome Res 106:376–385 (2004)

379 237

A

B 0.30

0.25

0.25

0.20

0.20 0.15 D

D

0.15

0.10 0.10 0.05

0.05 0.00

0.00

10 20 30 40 50 60 70 80 90 100110120130140

20

40

Spatial distance

80

100

120

140

Spatial distance

Segura River, 1993, 20 km interval

Segura River, 1993, 10 km interval

C

60

D 0.15

0.10

0.08 0.10 0.06 D

D 0.04 0.05 0.02

0.00

0.00

10 20 30 40 50 60 70 80 90 100 110 120

20

40

Spatial distance

Segura River, 1996, 10 km interval

Fig. 3. Distograms for Gregorius distances at the Segura River transect for years 1993, 1996 and 1998. The horizontal line represents the overall Gregorius distance mean. Lines with squares represent the mean Gregorius distance at each geographical distance interval. Continuous lines represent 0.95 confidence intervals.

100

120

Segura River, 1996, 20 km interval

0.08

0.09

0.06

0.07

D

0.04

0.02

0.00

0.05

0.03

10 20 30 40 50 60 70 80 90 100 110 120 130 Spatial distance

Segura River, 1998, 10 km interval

The relationship between differences in mean B1 frequency and distance along the river was not significant in 1993 (r = –0.053, P = 0.430) and 2001 (r = 0.171, P = 0.073), but it was positive and significant in 1996 (r = 0.526 , P = 0.013), 1998 (r = 0.265, P = 0.036), 1999 (r = 0.222, P = 0.042) and 2000 (r = 0.287, P = 0.017). In general, the data showed a positive relationship between distance and population dissimilarity in respect to B1 frequency, a situation that is usual under isolation by distance. To explore the relationship between these populations at different spatial scales, we analyzed B1 chromosome frequency data (see Materials and methods) by means of distograms. Fig. 3 and 4 show distograms with 10- and 20-km interval classes for the Segura River populations. In most years sampled, the Gregorius distances among populations did not significantly vary with geographic separation but, in several years, especially 2000 and 2001, there was a significant increase in genetic distance (i.e., dissimilarity among pairs of populations) at scales over 80 km.

380 238

80

F

E

D

60

Spatial distance

Cytogenet Genome Res 106:376–385 (2004)

0.01

20

40

60

80

100

120

140

Spatial distance

Segura River, 1998, 20 km interval

To explore possible temporal trends, we performed a multiple regression analysis to these data, considering year of sampling and distance to the coast along the river as independent factors. The analysis of the multiple regression coefficients showed that year of sampling was not associated with prevalence (P = 0.208), load (P = 0.935) and mean frequency (P = 0.935) of Bs in these populations. However, the distance to the coast was a factor explaining part of the variance of prevalence (ß = –0.282, P = 0.008) and mean frequency (ß = –0.215, P = 0.047) of B1, but not load (P = 0.668). Prevalence and mean frequency decreased with the distance to the coast (see Fig. 5). Segura River mouth populations These twelve populations were sampled in 1992 in an area of about 15 × 15 km, around the mouth of the Segura River. The contingence ¯2 test failed to show significant differences among these populations (¯2 = 25.91, P = 0.345). To explore spatial patterns, we compared the matrix of logtransformed geographic distances with the matrices of B1 dis-

A

D

B 0.20

0.20

0.15

0.15

D

0.10

0.05

0.00

0.10

0.05

0.00

10 20 30 40 50 60 70 80 90 100 110 120 130 140

20

40

Spatial distance

60

80

100

120

Spatial distance

Segura River, 1999, 10 km interval

Segura River, 1999, 20 km interval

D

C 0.4

0.30 0.25

0.3 0.20

D

D

0.2

0.15 0.10

0.1 0.05 0.0

0.00

10 20 30 40 50 60 70 80 90 100110120130140

20

40

Spatial distance

60

80

100

120

140

Spatial distance

Segura River, 2000, 20 km interval

Segura River, 2000, 10 km interval

F

E 0.20

0.15

0.15 0.10 D

D

0.10

0.05 0.05

Fig. 4. Distograms for Gregorius distances at the Segura River transect for years 1999, 2000 and 2001.

0.00

10

20

30

40

50

60

70

80

90

100 110

0.00

20

Spatial distance

Segura River, 2001, 10 km interval

similarities (prevalence, load and frequency). For prevalence and load there were no significant associations (r = 0.108, P = 0.198, and r = –0.097, P = 0.342, respectively), but there was for mean B1 frequency (r = 0.257, P = 0.037), implying an increased difference between populations in relation to geographic distance. A similar pattern was apparent with the distogram analysis (see Fig. 6). At a spatial scale of 3 km, there was significant increased similarity (i.e. lower genetic distance than expected) at low geographical distances (4–6 km class, P = 0.029), and decreased similarity at higher distances (8–10 km, P = 0.012). Similar results were found when the distance interval was 3 km (see Fig. 6), when significant deviation at 3–6 km (P = 0.019) and 9–12 km (P = 0.037) classes. This pattern is typical of isolation by distance.

40

60

80

100

120

Spatial distance

Segura River, 2001, 20 km interval

Mar Menor Lagoon populations This transect ran around the Mar Menor Lagoon, mainly along its inland shore, and included 16 sampled populations separated between a minimum of 1.7 km up to 34.97 km. As in the previous transect, the contingence ¯2 test did not show significant differences among populations (¯2 = 39.49, P = 0.661). The explicit geographic analysis using Mantel tests showed no association between log-transformed geographic distances and either prevalence, load or mean frequency (r = 0.105, P = 0.176; r = –0.107, P = 0.224; r = 0.002, P = 0.470, respectively). The spatial analysis using distograms also showed that populations were homogeneous for B frequency (see Fig. 6c) at low spatial classes, but at the maximum distance (30–35 or 30– 40 km classes) they were more similar than expected by chance. The general aspect of these distograms are compatible with

Cytogenet Genome Res 106:376–385 (2004)

381 239

Fig. 5. Mean B1 frequency along the Segura River transect in 2001. Error bars represent B one standard error.

IBD, except for the mean distance of the last geographic distance class, which could be explained because the low sample size at that scale. Valencia coastal populations Twenty-three populations were sampled in a transect parallel to the Valencia coast, in a north-south direction. In this transect, two geographic landmarks separate north and south populations: the city of Valencia and La Albufera lake. These populations did not show significant differences in B distribution (¯2 contingency test = 86.05, P = 0.516) and did not show significant association between population differences in prevalence, load or mean frequency with the geographic distance between them (Mantel tests, r = –0.045, P = 0.256; r = 0.049, P = 0.198; r = –0.006, P = 0.509). The distograms showed several significant departures from the expected random distribution of distances for 10 km intervals (at 20–30, 30–40 and 50–60 classes, see Fig. 6), but these departures were removed when a 20-km interval was used. This result seems to be more robust than the first one, at 10-km scale, since sample size (i.e. pairs of data per distance class) increases when a longer interval distance is used. Turia River populations Ten populations were sampled in 1995 in a longitudinal transect along the Turia River, starting 54 km upstream from the last population closest to the city of Valencia. These populations showed significant differences among them (contingency ¯2 test = 65.73, P ! 0.001), but this was not reflected in the

382 240

Cytogenet Genome Res 106:376–385 (2004)

result of the Mantel test comparing the matrix of geographic distances along the river with the matrices of dissimilarity in prevalence (r = 0.225, P = 0.082), load (r = –0.141, P = 0.235) and mean B frequency (r = 0.231, P = 0.088). The distogram of 10-km intervals showed no significant departures from random distribution (Fig. 7) but a slight trend to increased genetic distance with geographic distance. The distogram of 15 km classes showed that the populations separated by 0 to 15 km were more similar than expected by chance (P = 0.032) and, again, there was a positive association between geographic and genetic distances. Jucar River populations Twelve populations were sampled along 50 km of the course of this river in 1996. These populations also showed significant differences in the distribution of individuals with different numbers of Bs (contingency ¯2 test = 49.94, P ! 0.028). As in the case of the Turia River, there was no significant relationship between the matrix of geographic distances and prevalence (r = –0.058, P = 0.373), load (r = –0.189, P = 0.075) or mean B frequency (r = –0.073, P = 0.333) dissimilarity matrices. Distograms showed a general non-significant trend toward increased differences in B frequency with distance, except at the 30–40-km interval where populations were more similar than expected (P = 0.002 and P = 0.014, respectively; see Fig. 7). As this result seemed exceptional, we calculated the distogram considering the real position of these populations in a two-dimensional space, since the Jucar River has a turn that could explain the previous results: distant populations along

B

A 0.08

0.06 0.05

0.06

0.04

D

D 0.03

0.04

0.02 0.02

0.01 0.00 2

4

6

8

10

12

14

16

0.00

18

3

Spatial distance

9

12

15

18

Spatial distance

Segura River’s Mouth Distance classes: 2 km

Segura River's Mouth Distance classes: 3 km

C

D

0.20

D

0.20

0.15

0.15

D

0.10

0.05

0.10

0.05

0.00 5

10

15

20

25

30

0.00 10

35

Spatial distance

20

30

40

Spatial distance

Mar Menor Lagoon Distance classes: 5 km

Mar Menor Lagoon Distance classes: 10 km

E

F

0.20

0.15

D

D

0.10

0.00 10

0.20

0.15

0.05

Fig. 6. Distograms for Gregorius distances for Segura River mouth, Mar Menor Lagoon and Valencia coast transects.

6

0.10

0.05

20

30

40

50

60

70

80

Spatial distance Valencia coast Distance classes: 10 km

the river course may be closer in a “as the bird flies” line. When we calculated the new distogram, the previous significant positive structure was lost.

Discussion The contingency analysis of the populations in each transect showed that only in the river transects there were significant differences in the distribution of individuals with different numbers of Bs among populations. The populations in transects at low altitude (closest to the coast) showed more similarity than the high-altitude populations. If this similarity is produced by a higher rate of gene flow between these populations, this could not be determined without a geographic explicit approach. We have used two geographic explicit approaches to analyze B chromosome frequency in these populations. They have

0.00 20

40

60

80

Spatial distance Valencia coast Distance classes: 20 km

advantages and caveats. Mantel tests can show directional trends, but they may not detect non-linear variations. Correlograms and distograms can be used with confidence if there is a high number of pairs of data in each distance class (Degen, 2000), a situation that was not always possible to fulfill because of limitations in the number of populations per transect. In addition, genetic distances among populations with the larger geographic separations should not be considered nor interpreted because they are based on only a small number of findings, i.e. the most distant populations (Epperson, 1993; Legendre and Legendre, 1998). We have used three frequency parameters to account for the variability of B chromosome frequency: prevalence, load and mean frequency. Of these, load seems to be the less sensitive to variations, probably due to its small range. In fact, the Mantel test between load and geographic distance matrices only showed significant results in two years in the Segura River transects, and the signs of these correlations were different.

Cytogenet Genome Res 106:376–385 (2004)

383 241

A

B

0.30

0.4

0.25 0.3 0.20

D

D

0.15

0.2

0.10 0.1 0.05 0.00 10

20

30

40

0.0

50

15

Spatial distance

Turia River

Turia River Distance classes: 10 km

C

30

45

60

Spatial distance

D

0.4

Distance classes: 15 km

0.30 0.25

0.3 0.20

D

D

0.2

0.15 0.10

0.1 0.05 0.0 5

Fig. 7. Distograms for Gregorius distances for Turia and Jucar Rivers.

10

15

20

25

35

40

45

50

Spatial distance Jucar River Distance classes: 5 km

It is known that the prevalence of a neutralized B chromosome does not show ample variations (Camacho et al., 1997); thus, it could only be used to detect high differences between populations, as it seems to be the case in the Segura River transects. The mean frequency of the B chromosome seems to be the best parameter to characterize the frequency of the B chromosome polymorphism. In fact, it incorporates the combined information of both prevalence and load since the mean is equal to the product of prevalence and load. Different processes can produce the observed pattern of proximal populations showing higher similarity, e.g. high gene flow (migration), recolonization, descent from the same population, or local adaptation. Low migration and drift, however, could produce isolation by distance. The populations at the Segura River mouth have shown the most appealing case for IBD (see Fig. 6B for a typical representation of this process). At short geographic distances, populations are more similar than at longer distances. In addition, this trend was also manifested by the Mantel test for mean frequency of Bs. This pattern appeared for populations separated by only a few kilometers, implying that migration levels are not so important to homogenize the frequency of the B1 chromosome, but sufficient to produce IBD. However, due to low sample size (in terms of populations), this result should be considered with caution. With the increased anthropic fragmentation of natural habitats and following risk of loss of some habitats, migration should probably be reduced (Hanski, 1999) and the effects of genetic drift would be expected to increase, without however producing a clear spatial pattern because of the stochasticity of

384 242

30

Cytogenet Genome Res 106:376–385 (2004)

0.00 10

20

30

40

50

Spatial distance Jucar River Distance classes: 10 km

this process. Low gene flow could also contribute to the increase of variation among populations. However, the gene flow necessary to prevent substantial population differentiation is very low (Hanski, 1999), since values as low as Nem = 1, i.e. one individual per generation per year, are sufficient to prevent local differentiation at bidimensional spaces for some theoretical models (Maruyama, 1970, 1971). These homogenization effects of migration could explain the absence of significant differences among populations, at least at some coastal transects. Other possible explanations for the absence of spatial structure in some transects (e.g. Valencia coast) is that populations at high geographic scales of analysis are showing independent stochastic variation (drift) that is saturating the variation range of this variable. Sokal and Oden (1991) have shown that autocorrelations for shorter distances are stronger and overall less variable than when larger distance scales of analysis are used. Stochastic variation is greater for larger distance classes (Epperson, 1993), and this stochasticity could produce non significant or random distogram. The populations at the Turia River were significantly nonhomogeneous, but Mantel tests failed to reveal any linear pattern. In fact, the samples for two nearby populations at the midcourse of the river showed no B chromosomes, which could produce the significant result in the contingency test. The distograms of these populations, and those for the Jucar River transect, could also be compatible with IBD, although no significant departures from random variation have been found, which is usual with low sample size. In the Segura River transects, we have not found evidence for a temporal trend, which is consistent with the slow changes

expected from the long random walk for neutralized B chromosomes such as B1 (Camacho et al., 1997). But these transects revealed a clear spatial pattern, with B1 showing a clinal variation, with lower values of prevalence and mean frequency in the upper course of this river. This pattern was detected by the multiple regression analysis and also the Mantel test. In fact, in the headwaters of this river there are several populations without B chromosomes, which are probably isolated from the downstream populations by physical barriers (Cabrero et al., 1997). The analysis of the distograms showed although not conclusively that, in recent years, the more distant populations were more different in B1 frequency. Gene flow between upperand lower-course populations could be reduced leading to local differentiation because several reservoirs built along the Segura River could contribute to reducing the number of migrants between both groups of populations. In addition, distance classes around 80 km, in some years (i.e. 1993, 2000 and 2001, see Fig. 3 and 4) showed significant increases in genetic distance between pairs of populations. At this spatial scale, we are actually comparing the upper and lower populations, i.e. populations with high and low frequency of B chromosomes. This variation could be produced by genetic drift and reduced gene flow or by local selection, but also could reflect, at least partially, effects of selection and drive acting in the past. As Epperson (2003) remarks, IBD for neutral genes can often produce similar pattern as selection at some spatial scales. Unfortunately, we do not have unequivocal data to discriminate between these two hypotheses. The evolutionary dynamics

expected for a neutralized B chromosome (Camacho et al., 1997) is mainly determined by a random walk caused by the lost of B drive. But, since B chromosomes do not show a regular meiotic behaviour (i.e. they do not go in segregating pairs as A chromosomes), they cannot be fixed by genetic drift. Since some selection against individuals with a high number of Bs is expected, the random walk is thus biased towards B extinction. Another reason why random walks for neutralized Bs are expected to be protracted comes from a metapopulation perspective (multiple populations with some gene flow among them), since computer simulation analyses have shown that it prolongs very much the duration of this stage of B chromosome life cycle (Camacho et al., 1997). The present results provide the first empirical evidence of IBD in the evolution of a neutralized B chromosome, and it is appropriately explained by the metapopulation approach. In addition, the existence, in the Segura River, of some samples lacking Bs surrounded by Bcarrying samples, which in later samplings showed B presence, point to the possible importance of recolonization in the population dynamics of E. plorans.

Acknowledgements The authors are indebted to the students of Universidad Auto´noma de Madrid who have contributed through the years to the sampling of populations and scoring of Bs. Without their help and enthusiasm this work would have never been done.

References Bakkali M, Cabrero J, Lo´pez-Leo´n MD, Perfectti F, Camacho JPM: The B chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North Africa. I. B variants and frequency. Heredity 83: 428–434 (1999). Bakkali M, Perfectti F, Camacho JPM: The B-chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North Africa. II. Parasitic and neutralized B1 chromosomes. Heredity 88:14–18 (2002). Bakkali M, Camacho JPM: The B chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North Africa. III. Mutation rate of B chromosomes. Heredity (advance online publication 3 March) (2004). Bonnet E, Van de Peer: zt: a software tool for simple and partial Mantel tests. J Statistical Software 7:1– 12 (2002). Brashaw AD: Ecological significance of genetic variation between populations, in Dirzo R, Sarukha´n J (eds): Perspectives on Plant Population Ecology (Sinauer, Sunderland, MA 1984). Cabrero J, Lo´pez-Leo´n MD, Go´mez R, Castro AJ, Martı´n-Alganza A, Camacho JPM: Geographic distribution of B chromosomes in the grasshopper Eyprepocnemis plorans, along a river basin, is mainly shaped by non-selective historical events. Chromosome Res 5:194–198 (1997). Camacho JPM, Shaw MW, Lo´pez-Leo´n MD, Pardo MC, Cabrero J: Population dynamic of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Amer Nat 149:1030–1050 (1997).

Camacho JPM, Cabrero J, Lo´pez-Leo´n MD, Bakkali M, Perfectti F: The B chromosomes of the grasshopper Eyprepocnemis plorans and the intragenomic conflict. Genetica 117:77–84 (2003). Degen B: SGS: Spatial Genetic Software. Computer program and user’s manual. http://kourou.cirad.fr/ genetique/software.html (2000). Degen B, Petit R, Kremer A: SGS–Spatial Genetic Software: A computer program for analysis of spatial genetic and phenotypic structures of individuals and populations. J Hered 92:447–448 (2001). Epperson BK: Recent advances in correlation studies of spatial patterns of genetic variation. Evol Biol 27:95–154 (1993). Epperson BK: Geographical Genetics (Princeton University Press, Princeton 2003). Gregorius HR: The concept of genetic diversity and its formal relationship to heterozygosity and genetic distance. Math Biosci 41:253–271 (1978). Hanski I: Metapopulation Ecology (Oxford University Press, Oxford 1999). Henriques-Gil N, Arana P: Origin and substitution of B chromosomes in the grasshopper Eyprepocnemis plorans. Evolution 44:747–753 (1990). Henriques-Gil N, Santos JL, Arana P: Evolution of a complex polimorphism in the grasshopper Eyprepocnemis plorans. Chromosoma 89:290–293 (1984). Heywood JS: Spatial analysis of genetic variation in plant populations. Annu Rev Ecol Syst 22:335–355 (1991). Hutchinson DW, Templeton AR: Correlation of pairwise genetic and geographic distance measures: inferring the relative influences of gen flow and drift on the distribution of genetic variability. Evolution 53:1898–1914 (1999).

Legendre P, Legendre L: Numerical ecology. 2nd English edition (Elsevier 1998). Lo´pez-Leo´n MD, Cabrero J, Camacho JPM, Cano MI, Santos JL: A widespread B chromosome polymorphism maintained without apparent drive. Evolution 46:529–539 (1992). Lo´pez-Leo´n MD, Neves N, Schwarzacher T, HeslopHarrison TS, Hewitt GM, Camacho JPM: Possible origin of a B chromosome deduced from its DNA composition using double FISH technique. Chromosome Res 2:87–92 (1994). Maruyama T: On the fixation probability of mutant genes in a subdivided population. Genet Res 15: 221–225 (1970). Maruyama T: Analysis of population structure II. Two dimensional stepping stone models of finite length and other geographically structured populations. Ann Hum Genet 35:179–196 (1971). Slatkin M: Gene flow and the geographic structure of natural populations. Science 236:787–792 (1987). Slatkin M: Isolation by distance in equilibrium and non-equilibrium populations. Evolution 47:265– 279 (1993) Sokal RR, Oden NL: Spatial autocorrelation as an inferential tool in population genetics. Amer Nat 138:518–521 (1991) Zurita S, Cabrero J, Lo´pez-Leo´n MD, Camacho JPM: Polymorphism regeneration for a neutralized selfish B chromosome. Evolution 52:274–277 (1998).

Cytogenet Genome Res 106:376–385 (2004)

385 243

Population Dynamics and Evolution of B Chromosomes Cytogenet Genome Res 106:386–393 (2004) DOI: 10.1159/000079316

The parasitic effects of rye B chromosomes might be beneficial in the long term M. Gonza´lez-Sa´nchez, M. Chiavarino, G. Jiménez, S. Manzanero, M. Rosato and M.J. Puertas Departamento de Genética, Facultad de Biologı´a, Universidad Complutense, Madrid (Spain)

Abstract. Rye B chromosomes (Bs) have strong parasitic effects on fertility. B carrying plants are less fertile than 0B ones, whereas the Bs have no significant effects on plant vigour. On the other hand, it has been reported that B transmission is under genetic control in such a way that H line plants transmit the Bs at high frequency, whereas the Bs in the low B transmission rate line (L) fail to pair at metaphase I and are frequently lost. In the present work we analyse variables affecting vigour and fertility considering not only the number of Bs of each plant, but also its H or L status and the B number of its maternal parent. Our results show that the Bs not only decrease female fertility of the B carrier, but the fertility of its progeny, with the exception of 0B plants coming from a 4B mother, which are the most fertile. In this way B chromosomes can be

considered as a selective factor. Pollen abortion was higher in B carriers, in the progeny of B carriers and in H plants, but 4B plants coming from B carrying mothers produce less aborted pollen, indicating that a high B number is more deleterious if it is transmitted in the pollen grains. A similar result was obtained for endosperm quality estimated as grain weight, because it is negatively influenced by the Bs in 4B plants coming from a 0B mother. H plants were always less fertile than L ones, indicating that alleles increasing the loss of Bs in the L line will be probably selected as a defence of the A genome against the invasive Bs of the H line. Flower number is not affected by the Bs.

B chromosomes are enigmatic supernumerary chromosomes. They have non-Mendelian modes of inheritance and lack genes with specific phenotypic function; therefore, they are not necessary for normal development although their presence frequently affects the carrier. Considering these properties, it seems that Bs have nothing to offer to natural selection to be maintained in the long term. However, Bs exist at different frequencies in different populations giving rise to stable polymorphisms. Therefore, B chromosome evolution is interesting both in terms of genome evolution and in determining if supernumerary DNA has an adaptive or parasitic nature.

There are two traditional views about the processes that maintain B chromosome polymorphisms in populations. The heterotic model considers that low B numbers confer adaptive advantage to the carrier and therefore selection for fitness plays a major role in determining equilibrium frequencies (White, 1973). This seems to be the case of Allium schoenoprasum (chives) where Bs lack accumulation mechanisms and they are transmitted at a mean lower than Mendelian, but selection operates in favour of B-containing seeds during early stages of the life cycle (Holmes and Bougourd, 1991; Plowman and Bougourd, 1994). The contrasting opinion is that Bs are parasitic elements that posses autonomous drive processes which maintain their equilibrium against the pressure of harmful phenotypic effects. Östergren (1945) first proposed the idea of the parasitic nature of Bs. Jones (1985) proposed that Bs fulfil the features of selfish DNA. Many experiments were later carried out revealing that the Bs are parasitic in most species. These cases have been recently reviewed in Bougourd and Jones (1997), Puertas et al. (2000) and Puertas (2002). In different animal and plant species it is possible to find highly parasitic, moderate parasitic, neutral and even benefi-

Supported by grant BOS 2002-3572 of the Ministerio de Ciencia y Tecnologı´a of Spain. Received 5 November 2003; manuscript accepted 1 December 2003. Request reprints from Marı´a J. Puertas, Departamento de Genética Facultad de Biologı´a, Universidad Complutense José Antonio Novais 2, 28040 Madrid (Spain) telephone: +34 91 3945044; fax: +34 91 3944844 email: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0386$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

cial Bs (Camacho et al., 2000), which provide examples of interesting situations for a better understanding of the genetic mechanisms accounting for B dynamics in populations. Rye Bs are very invasive. This is the only plant species where the Bs undergo nondisjunction at the postmeiotic mitosis of both the female and male gametophytes, followed by preferential distribution to the gametes. This strong drive is counteracted at two levels. Firstly, the Bs have harmful effects on fertility (Romera et al., 1989; Jones, 1991; Jiménez et al., 1994). Secondly, Bs may form univalents that frequently do not reach the gametes (Jiménez et al., 1997). The variation in B transmission is mainly caused by the variation of B behaviour during meiosis, because nondisjunction occurs in almost 100 % of the cases (Jiménez et al., 2000). Rye genotypes for high (H) and low (L) B transmission rate have been selected. The Bs of 2B L plants form bivalents only in 20 % of the metaphase I cells. When B univalents divide equationally at anaphase I, they are subsequently eliminated as micronuclei. On the contrary, Bs in the H line form bivalents in nearly 90 % of the pollen mother cells and they are present in 85 % of the pollen grains (Jiménez et al., 1997). It was determined that the genes controlling rye B transmission rate are located on the Bs, being considered sites for chiasma formation (Puertas et al., 1998). Therefore, it can be concluded that rye B transmission and population polymorphism mainly depends on the Bs themselves and that a regular meiotic behaviour is essential for a B chromosome to be maintained in the long term. The implications for understanding B polymorphisms in natural populations are different in each case. Nowadays, the situation is considered as a “co-evolutionary arms race” between the mechanisms of drive of the Bs and genotypes on the As that may evolve counteracting B accumulation. This is considered an example of the so-called co-evolution of genome conflict (Frank, 2000). Camacho et al. (1997, 2000) proposed the non-equilibrium model for the co-evolution of the As and the Bs of the grasshopper Eyprepocnemis plorans where the Bs have been neutralised by the A genome. The non-equilibrium model of long-term evolution of B chromosomes is considered to be the outcome of selection on the host genome to eliminate B chromosomes or suppress their effects, and on the B ability to escape through the generation of new and more parasitic variants. This hypothesis considers B evolution as a continuous conflict between parts of the genome with different interests, so B influences may shift from parasitic to neutral and even beneficial effects. Under this hypothesis, the highly parasitic Bs of rye can be considered as slightly neutralised by the A genome, because the polymorphism is mainly controlled by the Bs themselves. It is expected that alleles on the As making the Bs less invasive will tend to increase in frequency. In the present work we try to find evidence for Camacho’s model. Our hypothesis is that, although rye Bs have a deleterious effect on the carriers, they have a long-term benefit acting as selective agents. If we find that the progeny of B carrying individuals corresponds to the best genotypes resisting B parasitic effects, we will find evidence for the existence of A genotypes opposing B chromosomes.

In this paper we report results on vigour and fertility in 0B, 2B and 4B plants belonging to the H and L lines, considering three factors: the B number of the plants used, the B number of their maternal parents and their H or L status. It has been reported that B number is negatively correlated with plant fertility (Romera et al., 1989, Jiménez et al., 1994), but a relationship between the genotypes for H and L B transmission rate and the B effects on fitness has never been determined. In this work we also consider this hypothesis. A differential B influence on vigour and/or fertility will account for the differences observed between the H and L lines and will help to understand the genetic mechanisms underlying rye B polymorphism.

Materials and methods The materials used were selected lines of rye, Secale cereale (2n = 14 + Bs), from the Puyo population, where about 60 % of the plants naturally carry Bs. It is our experience that this rye population is self-incompatible, in such a way that no seeds at all are obtained by self-pollination. The selection process was carried out following the method described in Romera et al. (1991) and Jiménez et al. (1995), consisting in crosses female 2B × male 0B whose progeny was selected for high (H) and low (L) B transmission rate. In all cases, seedling chromosome number was scored in root tips following fixation in 3:1 ethanol: acetic acid and stained by the Feulgen method. In the present experiment the individuals to be compared are 0, 2 or 4B plants, coming from 0, 2 or 4B maternal parents and belonging to either the H or the L line; that is 18 plant types. As the L line tends to lose the Bs, 4B individuals were not found in sufficient number to be used as maternal parents in this experiment, and therefore only 15 plant types were actually analysed. A limiting factor in this experiment was the number of 4B plants. We scored plants to obtain as many 4B plants possible, whereas 0B and 2B ones are easy to find. Figure 1 shows the scheme of the method followed to obtain the analysed plants. Seeds from female 2B × male 0B crosses from both the H and the L lines were germinated and scored for B number. Plants with 0B, 2 Bs and 4 Bs were grown in pots in separate greenhouses (one for H and one for L) to avoid foreign pollination. The pots were distributed in a squared arrangement in such a way that each plant was surrounded by different plant constitutions (i.e., 0B near 2B and 4B). The offspring obtained by open pollination was collected plant by plant and scored for B number. In this way both the number of Bs of every seedling and the number of Bs of its maternal parent was known. The number of Bs of the male parent is unknown. The number of Bs of the grand-maternal parent was 2B in every case. The progeny was collected from 28 0B, 37 2B and 34 4B maternal parents of the H line and 23 0B and 13 2B maternal parents of the L line. Seeds of the 15 plant types obtained were sown in a plot of our experimental field, randomising the position of 0B, 2B, 4B H and L classes. Plants are named with a letter indicating their H or L status, a number on the right indicating the B number of the scored plant and a number on the left indicating the B number of its maternal parent. For example, H 0/0 is a plant of the H line with 0Bs whose maternal parent had 0Bs. L 2/0 is a plant of the L line with 0Bs whose maternal parent had 2Bs. H 4/2 is a plant of the H line with 2Bs whose maternal parent had 4Bs, and so on. Seeds were sown at a 10 cm density and a border of a different rye variety was used to prevent edge-effects. Just before anthesis, all spikes of the border rye were eliminated. On the other hand, anthers from different individuals were excised and fixed in 3:1 ethanol: acetic acid to study pollen viability. Two anthers per plant and 500 pollen grains per anther were analysed using Alexander staining. This method distinguishes normal (fully stained) vs. aborted (empty) pollen grains. Anthers containing either bicellular or tricellular pollen grains were scored. The plants were open-pollinated. Seeds from every plant were individually collected and the number of grains, flowers and spikes were counted and the grains weighted. The following variables were estimated: female fertility as grains per flower, grains per spike and grains per plant; male fertility as

Cytogenet Genome Res 106:386–393 (2004)

387 245

H LINE

number of aborted pollen grains and vigour as flowers per spike, flowers per plant, spikes per plant and grain weight. The STATGRAPHICS computer program version 5.0 was used for the statistical analyses.

L LINE

female 2B ´ male 0B crosses

female 2B ´ male 0B crosses

Results (28) 0B, (37) 2B and (34) 4B plants MATERNAL PARENTS

(23) 0B and (13) 2B plants MATERNAL PARENTS

0B 2B 4B

0B 2B 0B

2B 4B 0B

2B 0B 2B

4B 0B 2B

0B 2B 0B

Open pollination in the H greenhouse

Open pollination in the L greenhouse

H-0/0 H-0/2 H-0/4 L-0/0 L-0/2 L-0/4

H-2/0 H-2/2 H-2/4

L-2/0 L-2/2 L-2/4

H-4/0 H-4/2 H-4/4

H-2/4 L-0/0 H-4/2 H-0/0 L-2/0 L-2/2 H-0/4 L-2/0 H-4/0 etc... (randomised position)

Open pollination in the experimental field

Fig. 1. Scheme of the process to obtain the plant types analysed.

Grains per flower (G/F), grains per spike (G/S) and grains per plant (G/P) were scored as variables of female fertility. The number of aborted pollen grains per anther (AP) was the scored variable of male fertility. Flowers per spike (F/S), flowers per plant (F/P), spikes per plant (S/P) and grain weight (GW) were scored as variables of vigour. These variables were compared in ANOVAs as independent variables, whereas the dependent variables (factors) were the number of Bs in the plants (0, 2 or 4Bs), the number of Bs of the maternal parent (0, 2 or 4 Bs) and the line (H or L). It should be noted that B nondisjunction in rye occurs in both the male and female gametophytes; therefore, the expected progeny of every cross consists in plants carrying even B numbers. Plants with odd B numbers or more than 4Bs are rare, both in experimental crosses and in open pollinated populations, and were not studied in this work. The experiment was initially designed to analyse all possible combinations of these factors but, unfortunately, it was not possible to obtain sufficient numbers of plants in some classes. The L line tends to lose the Bs forming very few 4B L plants; therefore, sufficient 4B L maternal plants were not found; consequently the factor “maternal B number” had to be considered separately in the H and L lines. For the same reason, statistical analysis considering the three factors at the same time was not carried out, because if 4B maternal parents were included, biased results would be obtained. On the other hand 0/0, 0/2,

Table 1. Mean values of G/F, AP, F/S and GW in each type of plant Plant

Grains per flower

Aborted pollen grains per anther

Mean

S.E.

No.

H-0/0 H-0/2 H-0/4

0.57 0.43 0.07

0.03 0.02 0.02

55 110 24

16.63 60.40 365.75

H-2/0 H-2/2 H-2/4

0.48 0.46 0.12

0.04 0.02 0.01

52 144 97

H-4/0 H-4/2 H-4/4

0.66 0.34 0.16

0.05 0.04 0.02

L-0/0 L-0/2 L-0/4

0.64 0.43 0.20

L-2/0 L-2/2 L-2/4

0.53 0.48 0.24

388 246

Mean

S.E.

Flowers per spike

Grain weight per plant (g)

No. plants

No. anthers

Mean

S.E.

N

Mean

S.E.

1.85 7.27 24.53

4 5 4

8 10 8

52.28 54.66 52.17

1.78 1.35 3.05

55 113 24

0.022 0.022 0.019

0.0008 0.0006 0.0016

25 42 8

45.33 68.25 237.47

4.38 9.35 12.12

3 4 9

6 8 19

59.00 58.35 52.74

1.87 1.05 1.38

52 144 97

0.022 0.023 0.020

0.0012 0.0007 0.0010

17 57 39

21 80 75

55.00 79.87 285.42

2.52 14.87 25.28

2 7 9

4 15 19

56.19 56.35 52.13

2.40 2.39 2.02

21 80 75

0.023 0.021 0.022

0.0012 0.0010 0.0009

6 25 31

0.03 0.03 0.08

91 51 10

22.70 65.25 362.75

2.62 9.94 50.03

5 2 2

10 4 4

53.98 55.02 50.80

1.29 1.97 4.50

91 51 10

0.023 0.022 0.016

0.0008 0.0012 0.0050

43 24 4

0.02 0.02 0.06

60 83 12

74.47 87.86 73.10

15.83 8.93 10.00

8 7 1

15 14 2

54.03 53.74 51.33

1.90 1.56 5.02

60 83 12

0.020 0.019 0.024

0.0008 0.0005 0.0020

28 39 7

Cytogenet Genome Res 106:386–393 (2004)

N

2/0 or 2/2 plants are frequently found in both the H and L lines but others, particularly 0/4 or 2/4 in the L line, are infrequent. For this reason the number of plants studied in some classes is lower than in others. In the case of female fertility, we show the detailed analysis of the variable G/F. The analyses of G/S and G/P will not be presented because the results are similar to G/F and this report would become unnecessarily enlarged. In addition, it seems that G/F is a better estimation of the effects of B chromosomes on female fertility than G/S or G/P. Similarly, we will present only the results obtained for the vigour variable F/S. The analysis of F/P and S/P will not be shown because they are similar to that of F/S. Table 1 shows the mean values of the variables G/F, AP, F/S and GW. Table 2 summarizes the results presented in Table 1 considering every factor separately. Grains per flower In general terms, the L line is more fertile than the H line, 0B plants are more fertile than 2B, and these more fertile than 4B ones. Plants coming from 0B maternal parents are more fertile than those coming from 2B ones and the 2B plants were more fertile than those coming from 4B mothers (Table 2). The two-way ANOVA comparing the factors “0, 2, 4 Bs in the plant” and “H or L line” shows highly significant differences, fertility decreasing when the number of Bs increases, L being more fertile than H plants and the interaction non-significant (Table 3, Fig. 2a). To compare the factors “0, 2, 4 Bs in the maternal parent” and “H or L line”, plants with a 4B mother had to be excluded because there are no 4B mothers in the L line. The two-way ANOVA shows highly significant differences, fertility decreasing when the number of Bs in the maternal parent increases, L being more fertile than H plants, and the interaction non-significant (Table 3, Fig. 2b). To compare the factors “0, 2, 4 Bs in the plant” and “0, 2, 4 Bs in the maternal parent” we consider L (Fig. 2c) and H plants (Fig. 2d) separately because there are no 4B mothers in the L line. In both cases the two-way ANOVA shows highly significant differences for Bs in the plant, fertility decreasing when the number of Bs increases, non-significant differences for Bs in the mother and significant differences for the interaction (Table 3). This result is particularly interesting. A post-hoc test shows that in both the L and H lines 0B and 2B mothers have non-significant differences, but in the H line 4/0 plants are more fertile than any other constitution, 4/4 are better than 2/4 and much better than 0/4. It is worth noting that since this result was quite surprising we repeated the comparison two consecutive years, obtaining the same result, although only the data of one year are shown in the present work. Pollen viability In the case of male fertility (estimated as the number of aborted pollen grains per anther), L is more fertile than H, and 0B plants produce less aborted pollen grains than 2B plants, whereas 4B ones are the least fertile (Table 2). Table 4 shows the ANOVAs made for this variable. The two-way ANOVA comparing the factors “0, 2, 4 Bs in the

Table 2. Summary of the results presented in Table 1, considering separately the factors line, Bs in the plant and Bs in the maternal parent Factors

Grains per flower (mean)

Aborted pollen grains (mean)

Flowers per spike (mean)

Grain weight per plant (mean)

Line

H L

0.36 0.51

164.37 90.45

55.21 54.07

0.0217 0.0209

Plant Bs

0 2 4

0.57 0.43 0.13

45.57 75.28 278.04

54.96 55.95 52.30

0.0219 0.0214 0.0208

Maternal Bs

0 2 4

0.48 0.39 0.30

127.32 122.23 183.41

53.87 55.71 54.53

0.0218 0.0211 0.0215

Table 3. ANOVAs of the variable Grains per flower Independent variable

Factors

F and P values

Grains per flower

Bs in plant and line

Plant Bs Line Interaction

F (2, 961) = 108.41 F (1, 961) = 9.43 F (2, 961) = 0.56

P < 0.0000 P = 0.0021 P = 0.57

Bs in maternal parent (4B not considered) and line

Mother Bs Line Interaction

F (1, 787) = 13.25 F (1, 787) = 43.30 F (1, 787) = 0.38

P = 0.0003 P < 0.0000 P = 0.54

Grains per flower in the H line

Bs in plant and Bs in maternal parent

Plant Bs Mother Bs Interaction

F (2, 651) = 156.96 F (2, 651) = 1.29 F (4, 651) = 8.17

P < 0.0000 P = 0.27 P < 0.0000

Grains per flower in the L line

Bs in plant and Bs in maternal parent

Plant Bs Mother Bs Interaction

F (2, 301) = 31.31 F (1, 301) = 0.03 F (2, 301) = 4.64

P < 0.0000 P = 0.86 P = 0.01

plant” and “H or L line” shows highly significant differences for the first factor and non-significant for the second, pollen abortion increasing when the number of Bs increases, the interaction being non-significant (Fig. 2e). The two-way ANOVA comparing the factors “0, 2 Bs in the maternal parent” and “H or L line”, shows significant differences only for the line, L forming less aborted pollen grains than H and the interaction being non-significant (Table 4, Fig. 2f). To compare the factors “Bs in the plant” and “Bs in the maternal parent” we consider L and H plants separately because there are no 4B mothers in the L line. In the L line (Table 4, Fig. 2g) both factors and the interaction are highly significant. In plants with a 0B mother it is found that 0B plants produce less aborted pollen than 2B, whereas 4B plants form a high proportion of aborted pollen. Interestingly, when the maternal parent was 2B, 4B plants produce the same amount of viable pollen as 0B plants. A similar effect is observed in the H line (Table 4, Fig. 2h). 0B and 2B plants produce similar amounts of aborted pollen grains both in the H or L lines, but a Scheffé post-hoc test shows that 0/4 plants produce significantly more aborted pollen than 2/4, whereas 4/4 plants are the most fertile among 4B plants. Also in this case we repeated the comparison two consecutive years, since this result was quite surprising, obtaining the same

Cytogenet Genome Res 106:386–393 (2004)

389 247

Fig. 2. Comparison of the variables G/F and AP in 0B, 2B and 4B plants, with 0B, 2B and 4B maternal parents in the H and L lines.

390 248

Cytogenet Genome Res 106:386–393 (2004)

Table 4. ANOVAs of the variable aborted pollen grains

Table 5. ANOVAs of the variable flowers per spike

Independent variable

Factors

F and P values

Aborted pollen grains

Bs in plant and line

Plant Bs Line Interaction Mother Bs Line Interaction

F (2, 139) = 79.39 F (1, 139) = 0.18 F (2, 139) = 0.40 F (1, 104) = 0.02 F (1, 104) = 6.25 F (1, 104) = 1.10

P < 0.0000 P = 0.6678 P = 0.6684 P = 0.8842 P = 0.0140 P = 0.2967

Bs in maternal parent (4B not considered) and line Aborted pollen grains in the H line

Bs in plant and Bs in maternal parent

Plant Bs Mother Bs Interaction

F (2, 87) = 143.01 F (2, 87) = 1.58 F (4, 87) = 4.38

P < 0.0000 P = 0.2127 P = 0.0028

Aborted pollen grains in the L line

Bs in plant and Bs in maternal parent

Plant Bs Mother Bs Interaction

F (2, 43) = 27.13 F (1, 43) = 16.24 F (2, 43) = 28.10

P < 0.0000 P = 0.0002 P < 0.0000

result, although only the data of one year are shown in the present work. In a few cases we found anthers with 100 % of the pollen aborted. We did not find any relation with the studied factors and these anthers were not considered. Flowers per spike Table 2 shows that all plants produce a similar mean number of flowers per spike. The two-way ANOVA comparing the factors “0, 2, 4 Bs in the plant” and “H or L line” shows nonsignificant differences for either the two factors or the interaction (Table 5). A similar result was obtained in the two-way ANOVA comparing the factors “0, 2 Bs in the maternal parent” and “H or L line”. Non-significant differences were found for the Bs in the mother, for the line and for the interaction (Table 5). As in the preceding cases, we considered L and H plants separately to compare the factors “0, 2, 4 Bs in the plant” and “0, 2, 4 Bs in the maternal parent”. In both cases, the factor “B mother” and the interaction were non-significant, although significant differences for Bs in the plant were found in the H line, 2B plants producing more flowers per spike than 0B, and 0B more than 4B ones. We consider this a random result due to a type I error because it is the only significant difference in all analyses considering flower number F/S, F/P and S/P). Grain weight per plant To study this variable, the total grain weight per plant was divided by the total number of grains per plant, obtaining the mean grain weight. This variable provides information about the quality of the endosperm. Total grain weight per plant does not provide new information because this variable is completely correlated with the variable G/P. In general terms, the mean grain weight is similar in all the plants analysed, irrespective of their H or L status, the number of Bs in the plant or the number of Bs in the maternal parent (Table 2). The two-way ANOVA comparing the factors “0, 2, 4 Bs in the plant” and “H or L line” shows non-significant differences in any case (Table 6).

Independent variable

Factors

F and P values

Flowers per spike

Bs in plant and line

Plant Bs Line Interaction

F (2, 961) = 2.05 F (1, 961) = 1.58 F (2, 961) = 0.13

P = 0.1290 P = 0.2090 P = 0.8822

Bs in maternal parent (4B not considered) and line

Mother Bs Line Interaction

F (1, 787) = 1.97 F (1, 787) = 1.13 F (1, 787) = 2.28

P = 0.1613 P = 0.2872 P = 0.1313

Flowers per spike in the H line

Bs in plant and Bs in maternal parent

Plant Bs Mother Bs Interaction

F (2, 651) = 3.63 F (2, 651) = 2.58 F (4, 651) = 0.49

P = 0.0270 P = 0.0767 P = 0.7428

Flowers per spike in the L line

Bs in plant and Bs in maternal parent

Plant Bs Mother Bs Interaction

F (2, 301) = 0.59 F (1, 301) = 0.00 F (2, 301) = 0.22

P = 0.5551 P = 0.9762 P = 0.7990

Table 6. ANOVAs of the variable grain weight (g) Independent variable

Factors

F and P values

Grain weight per plant

Bs in plant and line

Plant Bs Line Interaction

F (2, 389) = 1.18 F (1, 389) = 1.17 F (2, 389) = 1.89

P = 0.3098 P = 0.2796 P = 0.1532

Bs in maternal parent (4B not considered) and line

Mother Bs Line Interaction

F (1, 329) = 2.89 F (1, 329) = 2.25 F (1, 329) = 5.32

P = 0.0901 P = 0.1348 P = 0.0216

Grain weight per plant in the H line

Bs in plant and Bs in maternal parent

Plant Bs Mother Bs Interaction

F (2, 241) = 1.72 F (2, 241) = 0.29 F (4, 241) = 1.58

P = 0.1820 P = 0.7460 P = 0.1814

Grain weight per plant in the L line

Bs in plant and Bs in maternal parent

Plant Bs Mother Bs Interaction

F (2, 139) = 1.07 F (1, 139) = 0.44 F (2, 139) = 5.77

P = 0.3452 P = 0.5078 P = 0.0039

The two-way ANOVA comparing the factors “0, 2 Bs in the maternal parent” and “H or L line”, shows significant differences for the interaction (Table 6). In the H line there are no differences between 0B and 2B mothers, but in the L line the grain weight is lower when the maternal parent has 2 Bs. When considering L and H plants separately to compare the factors “0, 2, 4 Bs in the plant” and “0, 2, 4 Bs in the maternal parent”, non-significant differences are found in the H line. However, the L line shows non-significant differences for both factors and significant differences for the interaction (Table 6). A Scheffé post-hoc test shows that 0B and 2B plants have a similar mean GW no matter the number of Bs in their maternal parent, but the GW values in 4B plants are lower when the maternal parent is 0B.

Discussion Why do B chromosomes decrease fertility? A 0B plant does not produce 100 % of grains per flower but approximately 60 %. Failed seeds are not due to the lack of pollen but, in all probabil-

Cytogenet Genome Res 106:386–393 (2004)

391 249

ity, to gametic or zygotic lethals, or selective abortion of less favourable genotypes (Charlesworth, 1989). It is evident that B chromosomes interfere with grain formation because when plants carry 2 or 4 Bs, G/F mean decreases about 25 % and 75 %, respectively. Nevertheless, 2B H plants produce about 70 % of the seed produced by 0B H, whereas 2B L plants produce about 80 % of that produced by 0B L ones. It is also evident that a dosage effect occurs because when the plant carries 4 Bs, G/F mean is reduced about 80 % in the H line and about 63 % in the L line. Similar results are obtained on the male side, where the frequency of aborted pollen grains in H plants nearly duplicates that of L ones and that of 4B plants is more than six times higher than that of 0B. As plants of the L line are more fertile than H plants and the main difference between them is that L Bs are lost whereas H Bs are conserved at meiosis, it seems that having Bs during gametogenesis is an important cause of producing failed gametes and/or zygotes. It is not known whether the egg cell and the polar nuclei carry the same number of Bs. Häkanson (1948) made the single reported observation on female gametogenesis in rye with Bs. He observed B nondisjunction at the first postmeiotic division of the megaspore, but it is not known whether the Bs are preferentially distributed to the egg cell or whether they are also present in the polar nuclei or in other embryo sac nuclei. Consequently, it is not known whether it is more deleterious carrying Bs in the egg cell or in other embryo sac nuclei, or both cases influence equally. We also do not exactly know what the Bs are doing to decrease female fertility, but probably it is related to instabilities that Bs undergo during gametogenesis. Unfortunately, there is no comparative cytological data about 0B vs. Bs female gametogenesis, but is reasonable to think that instabilities occur such as those described on the male side (Jiménez et al., 1997, 2000). The effect of maternal parent B number on fertility has not been previously reported. How can maternal Bs exert their influence? A simple explanation is that maternal Bs might influence endosperm quality, a general negative effect on female fertility occurring with increasing number of mother Bs. However, it would be reasonable that endosperm quality would affect vigour variables, particularly grain weight. If B mother influenced grain weight, the factor “Bs in the plant” should be the significant variable in this experiment, because the weighted grains are the progeny of these plants, but this is not the case. Interestingly, “B mother number” is a nonsignificant factor in all analyses for grain weight with two exceptions. First, in the L line 2B mothers produce less grain weight; second, 4B plants with 0B mothers of the L line also produce less grain weight. These plants had to be formed from a 0B egg cell and a 4B sperm nucleus, indicating that 4B male gametes are deleterious for endosperm formation in this line. It seems therefore, that maternal parent B effect on fertility is more an imprinting effect than a simple decrease in endosperm quality. Endosperm is formed from two maternal and one paternal nuclei; consequently, the different effects that we observe may be due to the number of Bs present in each case. In the H line more polar nuclei and more triploid endosperm cells with Bs

392 250

Cytogenet Genome Res 106:386–393 (2004)

may be present, which could explain the higher negative effect of 2B mothers in fertility variables in H plants. A particularly interesting result of the present work is that obtained on female fertility of the H line, where plants coming from a 4B mother are the most fertile. This indicates that 4B plants produce few seeds, but those produced are the most fertile in the next generation. In this way the Bs could act as selective factors of the best genotypes for fertility. Fertility decrease produced by 2B plants is not as strong as that produced by 4Bs and the 2B constitution of the maternal parent does not produce this selective effect. It seems therefore that at population level, the maternal parent effect would be important only in populations where 4B plants reach a relatively high frequency. This occurs only in populations with a high frequency of plants carrying Bs, where crosses between B carriers are frequent. A similar selective action of B carrying plants is found in the variable “aborted pollen grains” where B carriers coming from maternal parents with Bs produce more viable pollen than those coming from 0B maternal parents. On the contrary 4B plants with 0B mothers are highly sterile. The explanation might be in the origin of these plants, because they must be formed from a 0B egg cell and a 4B pollen, which always comes from an abnormal meiosis and/or gametogenesis where a double nondisjunction or irregular B chromosome migration occurred. On the contrary 4B plants with 2B mother most probably come from normal 2B egg cell and 2B sperm nucleus. The general conclusion is that B instabilities occurring during male and female meiosis and gametogenesis affect not only the gametes formed from these processes themselves, but also the next generation. This is due, in all probability, to an imprinting phenomenon although the present experiment does not reveal the imprinting cause. It is remarkable that the Bs inherited on the paternal side by the 4B pollen grains influence the quality of the next generation, suggesting that imprinting in rye should be further investigated. A mere glance comparing the variables of fertility and vigour shows that B chromosomes have strong effects on fertility and no effect on vigour. 0B plants may produce nearly ten times more grain than 4B ones (maximum 0.66 G/F in H 4/0, minimum 0.07 in H 0/4). However, the range for vigour variables is much narrower (maximum 59.0 F/S in H 2/0, minimum 50.8 in L 0/4). These results have been repeatedly obtained (Puertas et al., 1985; Romera et al., 1989; Jiménez et al., 1994). In addition, it is our experience that vigour variables are most influenced by environmental conditions because the mean values strongly vary in different years (data not shown). Due to these reasons we consider that the significant difference found in F/S for the factor “Bs in the plant” is meaningless and has to be considered as a type I error. An important factor for understanding the maintenance of B polymorphisms not previously studied is the relation between the genetic control of B transmission rate and fitness effects. The present experiment was also designed to determine whether low or high B transmission is associated with lower or higher fitness. Our results show significant differences in female fertility when the factors “Bs in the plant” and “H or L

line” are compared, in such a way that low B transmission is associated with higher fitness. The evolutionary model proposed from our results is as follows. In H plants, where the Bs pair at meiosis and tend to be transmitted, the Bs have a strong parasitic effect because a strong drive is counteracted by a strong decrease in fertility. The mechanism of drive followed by open pollination produces the appearance of many 2B plants in 2B × 0B progeny and a relatively high frequency of 4B plants in 2B × 2B progeny. 4B plants are highly sterile both on the female and male sides, but their 0B descendants having gotten rid of the Bs are the most fertile. This way, alleles in the A chromosomes tolerating or resisting the deleterious B effects may be selected. However, B number has a limit because 4B plants give few progeny. The population fate mainly depends on 0 and 2B plants. When the number of Bs rises up to 4, on one hand more Bs are not transmitted due to the low 4B fertility, but on the other more tolerant or productive genotypes may be selected. In this way the Bs might have a secondary beneficial effect because genotypes for higher fertility could be selected, whereas poorer genotypes would be eliminated by the deleterious effect of a high B number. L-plant Bs are less parasitic. Their drive is much smaller because many Bs are lost at meiosis and 2B plants produce mainly 0B male and female gametes. This is probably the cause of a higher fertility in the L than in the H line, because 0B micro- and megaspores are not disturbed by the Bs during gametogenesis. 4B plants are hardly produced, but in this case the effect of a 2B carrying maternal parent is remarkable. Particularly in the case of pollen abortion, L plants carrying 0, 2 or 4 Bs show the same amount of pollen abortion, whereas in all

other cases 4B plants are much worse than any other constitution. Therefore, also in this case there is the opportunity of B tolerant alleles to be selected. In addition, seed formation under this model is not random, but a kind of selective abortion would occur due to the Bs. In B carrying plants, particularly in 4B ones, the best genotypes would be selected. We had previously reported that high or low B transmission rates occur in all types of crosses involving 0B and 2B plants, but mean transmission values show a high variance (Jiménez et al., 2000). This indicates that other variables are affecting the character in addition to the selected genes in the H and L lines. One of these effects is maternal and has already been reported by Puertas et al. (1990) and the results of the present work reinforce the role of the maternal parents in determining population structure in rye with Bs. In addition, alleles on the A chromosomes such as those predicted in the present work which tolerate B chromosomes in high numbers, seem to be important for the co-evolution of A and B chromosomes. These findings provide experimental support for better understanding the co-evolution of A and B chromosomes in rye. Camacho et al. (1997a, b, 2000) proposed a non-equilibrium model for the co-evolution of As and Bs of the grasshopper Eyprepocnemis plorans, where the host A genome tends to eliminate the Bs or suppress their effects, and on the ability of the Bs to escape through the generation of new parasitic variants. In rye, H Bs seem to be in a highly parasitic status due to their high transmission rate and deleterious effects on the carriers. This high transmission generates 4B plants in considerable frequency, which in turn provides the opportunity to select beneficial alleles for high fertility and tolerating B effects.

References Bougourd SM, Jones RN: B chromosomes: a physiological enigma. New Phytol 137:43–54 (1997). Camacho JPM, Cabrero J, Lo´pez-Leo´n MD, Shaw MW: Evolution of a near-neutral B chromosome, in Henriques-Gil N, Parker NJS, Puertas MJ (eds): Chromosomes Today, pp 301–318 vol 12 (Chapman & Hall, London 1997a). Camacho JPM, Shaw MW, Lo´pez-Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralised by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997b). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Charlesworth D: Why do plants produce so many more ovules than seeds. Nature 338:21–22 (1989). Frank SA: Polymorphism of attack and defense. Trends Ecol Evol 15:167–171 (2000). Häkanson A: Behaviour of accessory chromosomes in the embryo sac. Hereditas 34: 35–39 (1948). Holmes DS, Bougourd SM: B chromosome selection in Allium schoenoprasum. II. Experimental populations. Heredity 67:117–122 (1991). Jiménez MM, Romera F, Puertas MJ, Jones RN: B chromosomes in inbred lines of rye (Secale cereale L.) I. Vigour and fertility. Genetica 92:149–154 (1994).

Jiménez MM, Romera F, Gallego A, Puertas MJ: Genetic control of the rate of transmission of rye B chromosomes II. 0B × 2B crosses. Heredity 74: 518–523 (1995). Jiménez MM, Romera F, Gonza´lez-Sa´nchez M, Puertas MJ: Genetic control of the rate of transmission of rye B chromosomes III. Male meiosis and gametogenesis. Heredity 78:636–644 (1997). Jiménez G, Manzanero S, Puertas MJ: Relationship between pachytene synapsis, metaphase I associations and transmission of 2B and 4B chromosomes in rye. Genome 43: 232–239 (2000). Jones RN: Are B chromosomes selfish?, in CavalierSmith T (ed): The Evolution of Genome Size, pp 397–425 (Wiley, London 1985). Jones RN: B-chromosome drive. Am Nat 137:430–442 (1991). Östergren G: Parasitic nature of extra fragment chromosomes. Botaniska Notiser 2:157–163 (1945). Plowman AB, Bougourgd SM: Selectively advantageous effects of B chromosomes on germination behaviour in Allium schoenoprassum L. Heredity 72:587–593 (1994). Puertas MJ: Nature and evolution of B chromosomes in plants; A non-coding but much information-rich part of plant genomes. Cytogenet Genome Res 96:198–205 (2002).

Puertas MJ, Romera F, de la Peña A: Comparison of B chromosome effects on Secale cereale and Secale vavilovii. Heredity 55:229–234 (1985). Puertas MJ, Jiménez MM, Romera F, Vega JM, Diez M: Maternal imprinting effect on B chromosome transmission in rye. Heredity 64:197–204 (1990) Puertas MJ, Gonza´lez-Sa´nchez M, Manzanero S, Romera F, Jimenez MM: Genetic control of the rate of transmission of rye B chromosomes IV. Localisation of the genes controlling B transmission rate. Heredity 80:209–213 (1998). Puertas MJ, Jiménez G, Manzanero S, Chiavarino AM, Rosato M, Naranjo CA, Poggio L: Genetic control of B chromosome transmission in maize and rye, in Olmo E, Redi CA (eds): Chromosomes Today, pp 79–92 vol 13 (Birkhäuser, Switzerland 2000). Romera F, Vega JM, Dı´ez M Puertas MJ: B chromosome polymorphism in Korean rye populations. Heredity 62:117–121 (1989). Romera F, Jiménez MM, Puertas MJ: Genetic control of the rate of transmission of rye B chromosomes. I. Effects in 2B × 0B crosses. Heredity 66:61–65 (1991). White MJD: Animal Cytology and Evolution. 3rd Ed (Cambridge University Press, Cambridge 1973).

Cytogenet Genome Res 106:386–393 (2004)

393 251

Integration of B Chromosomes into the A Genome Cytogenet Genome Res 106:394–397 (2004) DOI: 10.1159/000079317

Interaction of B chromosomes with A or B chromosomes in segregation in insects S. Nokkala and C. Nokkala Laboratory of Genetics, Department of Biology, University of Turku, Turku (Finland)

Abstract. Additional or B chromosomes not belonging to the regular karyotype of a species are found in many animal and plant groups. They form a highly heterogeneous group with respect to their morphology and behaviour both in mitosis and meiosis. Achiasmatic mechanisms that ensure the segregation of a B chromosome from another B chromosome or from an A chromosome are reviewed. An achiasmatic mechanism characterized by the “distance pairing” of segregating univalents at metaphase I was found to be responsible for the preferential segregation of B chromosome univalents in Hemerobius marginatus L. (Neuroptera), and a mechanism characterized by the “touch and go pairing” of segregating univalents was responsible for the highly regular segregation of a B chromosome and the X chromosome in Rhinocola aceris (L.) (Psylloidea, Ho-

moptera). The latter mechanism resulted in the integration of a B chromosome to the A chromosome set as a Y chromosome in a psyllid species Cacopsylla peregrina (Frst.). Furthermore, B chromosomes can disturb the regular segregation of the achiasmatic X and Y chromosomes resulting in the formation of X0/ XY polymorphism in a population, which might precede the loss of the Y chromosome. The absence of observations on accurately functioning achiasmatic segregation mechanisms in grasshoppers (Orthoptera) was attributed to the X and B chromosomes, which re-orient one or several times during metaphase I. Apparently, these re-orientations mask any achiasmatic segregation mechanism that might operate during meiotic prophase in these insects.

B chromosomes are recognized as such because they appear in some individuals in some populations in a species causing chromosomal polymorphism. They are supernumerary or additional members of a chromosome set, non-essential to a cell or an individual but possibly harmful, at least if present in large numbers. B chromosomes have been found in numerous animal and plant species in a diverse variety of groups (Jones and Rees, 1982). B chromosomes form a highly heterogeneous group. They can be of various sizes, and may vary greatly in heterochromatin content and mitotic stability, and their effects may be beneficial, harmful or neutral. Several authors consider B chromosomes as parasitic or selfish (e.g., Östergren, 1945;

Nur 1966, 1977; Jones, 1985; Werren et al., 1987; Beukeboom, 1994). The evolutionary life cycle of B chromosomes has been recently evaluated by Camacho et al. (1997, 2000). Most prosperous are B chromosomes showing meiotic drive leading to the accumulation of B chromosomes both at the individual and population level. However, the ability to drive is regulated by drive suppressor genes in the A chromosome set. If drive suppressor genes become common in a population, the ability to drive will be neutralized and B chromosomes will follow Mendelian inheritance. During this phase of life cycle the B chromosome is subjected to random processes in the population and may be lost. B chromosomes may also be subjected to a regeneration process by which they reacquire the ability to drive. In the present study we review ways by which mitotically stable B chromosomes can ensure their existence in a population. The B chromosome can either regularize its meiotic behaviour leading to a regular B-B segregation or integrate in a segregation system with an A chromosome. The significance of these processes in karyotype evolution is also discussed.

Received 15 October 2003; manuscript accepted 19 January 2004. Request reprints from Seppo Nokkala, Laboratory of Genetics Department of Biology, University of Turku, FIN–20014 Turku (Finland) telephone: +358 2333 5572; fax: +358 2333 6680; e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0394$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

Fig. 1. The distance and touch and go pairing of B chromosome and sex chromosome univalents. (a) Metaphase I in Hemerobius marginatus male, showing distance pairing of two B chromosome univalents and the X and Y chromosomes. (b) Metaphase I in H. marginatus, showing a B chromosome bivalent and distance pairing of the X and Y chromosomes. (c) Metaphase I in Cacopsylla peregrina male, showing touch and go pairing of the X and B chromosomes (arrow). The B chromosome is more heavily stained than the X chromosome and oriented towards the upper pole. Bar = 10 Ìm.

B chromosome – B chromosome segregations B chromosomes may acquire regular meiotic behaviour, i.e., regular segregation by different ways depending on the presence or absence of euchromatin. If B chromosomes are fully heterochromatic, as most of them are (Jones and Rees, 1982), their pairing and segregation cannot be based on chiasma formation. B chromosomes of this kind are able to utilize achiasmatic segregation mechanisms that function at different stages in meiosis (for reviews, see Smith and Virkki, 1978; John, 1990). For example, mitotically stable B chromosomes in the neuropteran Hemerobius marginatus L. are largely heterochromatic. Consequently, they may show a loose association in pachytene nuclei in the male, appear as univalents in late meiotic prophase, but still show “distance pairing” at metaphase I (Fig. 1a). This was the case in 76 % of cells, indicating segregation, or they may be found as two univalent chromosomes near the same pole, i.e. show non-segregation in 24 % of cells. Evidently, this preferential segregation was due to the achiasmatic segregation mechanism characterized by the “distance pairing” of segregating chromosomes at metaphase I (Nokkala, 1986a). This mechanism is responsible for the regular segregation of the achiasmatic sex chromosomes in this species (Fig. 1a, b) (Nokkala, 1986a). If B chromosomes have euchromatic regions, chiasma formation is possible, when two B chromosomes are present in an individual. In H. marginatus B chromosomes form a chiasmatic bivalent in 33 % of cells (Fig. 1b), resulting in regular segregation at anaphase I. Hence, quite regular segregation of B chromosomes is achieved by the cooperation of both chiasma based and achiasmatic segregation mechanisms. However, only 6.4 % (N = 61) of males carried two B chromosomes in the population studied. Thus, substantial increase in the frequency of individuals carrying two B chromosomes is needed before the integration of the B chromosome as a regular member of the A chromosome set in the population would be possible.

The integration of a B chromosome into the standard genome is considered to be easier in haplodiploids, because meiosis occurs only in one sex in these groups. Arau´jo et al. (2001) have shown that in a wasp species Trypoxylon albitarse (Hymenoptera) in three populations the number of B chromosomes is limited to one per haploid genome. The authors suggest that the stabilization in the number of B chromosomes in these populations is achieved by regularizing meiotic behaviour in diploid females and the regular meiotic behaviour is able to integrate a B chromosome into the A chromosome set.

B chromosome – A chromosome segregation B chromosomes show no intrachromosomal recombination with the A chromosomes (Jones and Rees, 1982). Hence, any effect on the A chromosome segregation must be based on achiasmatic associations. Clear proof that B chromosomes exert their effect via achiasmatic segregation systems comes from Neuroptera in which the regular segregation of the X and Y chromosomes is based on an achiasmatic segregation system (Nokkala, 1986b). As determined by Nokkala (1986b) the segregation of the X and Y chromosomes in H. marginatus is highly regular, spontaneous non-segregation being low, only about 0.6 %. However, the non-segregation of the sex chromosomes was increased to 6–8 % or ten times higher in the cells that carried one or two B chromosome univalents. A B chromosome bivalent had no effect on the segregation of the sex chromosomes. This non-segregation will result in gametes without any sex chromosomes and lead to the formation of X0 males, if the Y chromosome is not carrying any essential genes for sex determination. In H. marginatus in the population sample studied one out of 61 males proved to be an X0 male with perfectly normal meiosis. This kind of polymorphic situation could precede the complete loss of the Y chromosome from the population.

Cytogenet Genome Res 106:394–397 (2004)

395 253

On the other hand, because the B chromosome is causing this non-segregation of the X and Y chromosomes, gametes which are devoid of sex chromosomes, include B chromosomes. Fertilization of an egg by this kind of gamete would lead to the formation of a male with X and B chromosome(s). Theoretically, if the B chromosome is able to take the place normally occupied by the Y chromosome in an achiasmatic segregation mechanism, the B chromosome could start to segregate regularly from the X chromosome, which could potentially lead to the replacement of the original Y chromosome by the B chromosome in a population. In this case, when present in all males, the chromosome segregating from the X chromosome could not be identified as a B any more, but it would be identified as a Y chromosome, and the integration of a B chromosome into the A chromosome set had taken place. So far we have no experimental or observational evidence that this could occur in Neuroptera. Firm evidence that a B chromosome is able to integrate into an achiasmatic segregation system with the X chromosome comes from Psylloidea (Homoptera). Species belonging to Psylloidea display X0 sex chromosome system (for a review, see Maryañska-Nadachowska, 2002). Achiasmatic segregation of a B chromosome from the X chromosome has been described in two species by Nokkala et al. (2000). In Rhinocola aceris (L.) B chromosomes are mitotically stable and show no detectable meiotic irregularities. Highly regular segregation between a B chromosome and the X chromosome was observed in populations collected from Finland, non-segregation being only 1.4 %. Similar frequencies of non-segregation were also found in populations collected from Russia, Georgia and Poland (Katowice). Details of the behaviour of the B and the X chromosomes in these males – B and X chromosomes appear as univalents in meiotic prophase cells, form a pseudopair in the center of a radial metaphase I plate and show so called “touch and go pairing”, the B chromosome causes a shift in the start of anaphase of the X chromosome at anaphase I – evidence that the B chromosome has integrated into an achiasmatic segregation system similar to that normally responsible for the regular segregation of achiasmatic prereductional X and Y in Heteroptera (Jande, 1960; Nokkala and Nokkala, unpublished) and mchromosomes in Heteroptera (Nokkala, 1986c). Similar behaviour of X and B chromosomes, but much less regular segregation, non-segregation being 24.7 %, was found in one population from Poland (Krakow). This was attributed to the presence of a different B chromosome variant in that particular population. Observations above indicate that a B chromosome must fulfill certain requirements, not known in detail at present, before achiasmatic segregation from the X chromosome can be accurate. Quite accurate segregation of an extra chromosome from the X chromosome was recently described in a psyllid species Cacopsylla peregrina (Frst.) (Nokkala et al., 2003). The extra chromosome was mitotically stable and showed regular meiotic behaviour. The extra chromosome and the X chromosome behaved quite identically to the X and B chromosomes in R. aceris, they appeared as two univalents in most prophase cells and quite regularly showed “touch and go” pairing in the center of the metaphase plate (Fig. 1c). The frequency of non-

396 254

Cytogenet Genome Res 106:394–397 (2004)

segregation was even smaller than in R. aceris, 0.45 %, equalling the frequency of spontaneous nondisjunction of achiasmatic X and Y chromosomes in the neuropteran H. marginatus (above). Since the extra chromosome in C. peregrina was found in all males from three geographically well-separated populations, there were no grounds to define it as a B chromosome any more, but it had to be defined as a Y chromosome, evidently of B chromosomal origin. This finding of a Y chromosome of B chromosomal origin in Psylloidea is well in accordance with the suggestions that in Drosophila the Y chromosome has evolved from a B chromosome (Hackstein et al., 1996; Carvalho, 2002). It is worth noticing that male meiosis in Drosophila is achiasmatic. Hence, the association between the X and Y chromosomes is achiasmatic in its nature. In all examples described above, the achiasmatic mechanisms are functioning during the first meiotic prophase. The mechanism, that is responsible for the preferential segregation of X and B chromosomes in Psylla foersteri (Flor.) (Psylloidea, Homoptera), is functioning during anaphase I (Nokkala et al., 2000). In this species, the B chromosome is mitotically unstable, resulting in intercyst variation in its number. In the cysts in which the cells are showing one B chromosome the X and B chromosomes remain as laggards when anaphase I starts, and move to the opposite poles during late anaphase I and telophase I. The accuracy of this mechanism with the B chromosome variant present was determined to be only preferential, the frequency of non-segregation being 26 %. This kind of mechanism functioning during anaphase I is responsible for the regular segregation of X and Y chromosomes in some Coleoptera and Diptera (for reviews, see Smith and Virkki, 1978; John, 1990). Preferential segregation of a B chromosome from the X chromosome has been reported in several grasshopper species, in Phaulacridium vittatum (Jackson and Cheung, 1967), in Tetrix ceperoi (Henderson, 1961), in Chorthippus binotatus (Lo´pezLeo´n et al., 1991), and in Eyprepocnemis plorans (Lo´pez-Leo´n et al., 1996). In all these cases the non-segregation of the X and B chromosomes is of the magnitude of 25 % or more. In contrast, many studies in grasshoppers have shown independent behaviour of a B chromosome and the X chromosome in segregation (e.g., John and Hewitt, 1965a, b; Westerman and Fontana, 1973; Rowe and Westerman, 1974; John and Freeman, 1974, 1975; Webb, 1976) or even non-independent assortment of the X and B chromosomes to the same pole as in Dichroplus pratensis (Bidau, 1986; Bidau et al., 2004). Since the order Orthoptera has been extensively cytologically studied, it seems unlikely that species with achiasmatic X and Y chromosomes or X and B chromosomes with accurate segregation would have escaped detection. It is conceivable that the explanation for the lack of accurate segregation is a consequence of peculiar behaviour of the X chromosome and some B chromosome univalents during metaphase I. Unlike in Neuroptera and Psylloidea, where the X chromosome and B chromosome univalents do not re-orient during metaphase I (Nokkala, 1986a, b; Nokkala et al., 2000, 2003), the X chromosome and B chromosome univalents in grasshoppers re-orient during metaphase I from one to several times (for review, see Rebello et al., 1998). Apparently, this re-orientation process masks any achiasmatic segregation mechanism that might operate during meiotic prophase.

Concluding remarks In conclusion, the evolutionary dynamics of B chromosomes and their effect on karyotype evolution seems to be more complicated than realized earlier. Kimura and Kayano (1961) and Hewitt (1973) were the first to suggest the possibility of integrating a B chromosome into the A chromosome set. Recent findings have shown that B chromosomes can integrate into the A chromosome set both as an additional member of autosomes and as a sex chromosome, especially as a Y chromosome. A Y chromosome of this kind is a morphological Y chromosome only, since it does not carry any male determining

genes. Evidently, an inverse evolutionary sequence also occurs. Green et al. (1993) and Sharbel et al. (1998) have shown that a B chromosome has evolved from a W ( = Y) chromosome in the frog species Leiopelma hochstetteri. A B chromosome may also disturb the regular segregation of the X and Y chromosomes resulting in the loss of the Y chromosome during evolution. Evidently, the effect of B chromosomes on karyotype evolution is different in different groups depending on the group-specific behaviour of the A chromosomes. Hence, the observations made for example in Neuroptera and Homoptera can not be generalized as such to grasshoppers or vice versa.

References Arau´jo SMSR, Pompolo SG, Perfectti F, Camacho JPM: Integration of a B chromosome into the A genome of a wasp. Proc R Soc Lond B 268:1127– 1131 (2001). Beukeboom LW: Bewildering Bs: an impression of the 1st B-chromosome Conference. Heredity 73:323– 336 (1994). Bidau CJ: A nucleolar-organizing B chromosome showing segregation-distortion in the grasshopper Dichroplus pratensis (Melanoplinae, Acrididae). Can J Genet Cytol 28:138–148 (1986). Bidau CJ, Rosato M, Marti DA: FISH detection of ribosomal cistrons and assortment-distortion for X and B chromosomes in Dichroplus pratensis (Acrididae). Cytogenet Genome Res 106:295–301 (2004). Camacho JPM, Shaw MW, Lo´pez-Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocdemis plorans. Am Nat 149:1030–1050 (1997). Camacho JPM, Sharbel TF, Beukeboom LW: B-chromosome evolution. Phil Trans R Soc Lon B 335:163–178 (2000). Carvalho AB: Origin and evolution of the Drosophila Y chromosome. Curr Opin Genet Dev 12:664–668 (2002). Green DM, Zeyl CW, Sharbel TF: The evolution of hypervariable sex and supernumerary (B) chromosomes in the relict New Zealand frog, Leiopelma hochstetteri. J. Evol Biol 6:417–441 (1993). Hacstein JHP, Hochstenbach R, Hauschteck-Jungen E, Beukeboom LW: Is the Y chromosome of Drosophila an evolved supernumerary chromosome? BioEssays 18:317–323 (1996). Henderson SA: The chromosomes of the British Tetrigidae (Orthoptera). Chromosoma 12:271–317 (1961). Hewitt GW: The integration of supernumerary chromosomes into the Orthopteran genome. Cold Spring Harb Symp Quant Biol 38:183–194 (1973). Jackson WD, Cheung DS: Distortional meiotic segregation of supernumerary chromosomes producing differential frequencies in the sexes in the shorthorned grasshopper Phaulacridium vittatum. Chromosoma 23:24–37 (1967).

Jande SS: Pre-reductional sex chromosomes in the family Tingidae (Gymnocerata-Heteroptera). Nucleus 3:209–214 (1960). John B: Meiosis (The Cambridge University Press, Cambridge 1990). John B, Freeman M: B-chromosome behaviour in Phaulacridium vittatum. Chromosoma 46:181– 195 (1974). John B, Freeman M: The cytogenetic structure of Tasmanian populations of Phaulacridium vittatum. Chromosoma 53:283–293 (1975). John B, Hewitt GM: The B-chromosome system of Myrmeleotettix maculatus (Thunb.). I. The mechanics. Chromosoma 16:548–578 (1965a) John B, Hewitt GM: The B-chromosome system of Myrmeleotettix maculatus (Thunb.). II. The statistics. Chromosoma 17:121–138 (1965b). Jones RN: Are B chromosomes selfish? in CavalierSmith T (ed): The Evolution of Genome Size, pp 397–425 (Wiley, London 1985). Jones RN, Rees H: B chromosomes. (Academic Press, New York 1982). Kimura M, Kayano H: The maintenance of supernumerary chromosomes in wild populations of Lilium callosum by preferential segregation. Genetics 46:1699–1712 (1961). Lo´pez-Leo´n MD, Cabrero J, Camacho JPM: Distributive pairing in the grasshopper Chorthippus binotatus. Genome 34:139–143 (1991). Lo´pez-Leo´n MD, Cabrero J, Camacho JPM: Achiasmate segregation of X and B univalents in males of the grasshopper Eyprepocnemis plorans is independent of previous association. Chrom Res 4:41–48 (1996). Maryañska-Nadachowska A: A review of karyotype variation in jumping plant-lise (Psylloidea, Sternorrhyncha, Hemiptera) and checklist of chromosome numbers. Folia biol (Krako´w) 50:135–152 (2002). Nokkala S: The nonsignificance of distance pairing for the regular segregation of sex chromosomes in Hemerobius marginatus L. (Hemerobidae, Neuroptera). Hereditas 105:135–139 (1986a). Nokkala S: The meiotic behaviour of B-chromosomes and their effect on the segregation of sex chromosomes in males of Hemerobius marginatus L. (Hemerobidae, Neuroptera). Hereditas 105:221–227 (1986b).

Nokkala S: The mechanism behind the regular segregation of the m-chromosomes in Coreus marginatus L. (Coreidae, Hemiptera). Hereditas 105:73–85 (1986c). Nokkala S, Kuznetsova V, Maryañska-Nadachowska A: Achiasmate segregation of a B chromosome from the X chromosome in two species of psyllids (Psylloidea, Homoptera). Genetica 108:181–189 (2000). Nokkala S, Grozeva S, Kuznetsova V, Maryañska-Nadachowska A: The origin of the achiasmatic XY sex chromosome system in Cacopsylla peregrina (Frst.) (Psylloidea, Homoptera). Genetica 11 (2003). Nur U: Harmful B chromosomes in a mealy bug population. Genetics 54:1225–1238 (1966). Nur U: Maintenance of a “parasitic” B chromosome in the grasshopper Melanoplus femur-rubrum. Genetics 87:499–512 (1977). Östergren G: Parasitic nature of extra fragment chromosomes. Bot Notiser 2:157–163 (1945). Rebello E, Martin S, Manzanero S, Arana P: Chromosomal strategies for adaptation to univalency. Chromosome Res 6:515–531 (1998). Rowe HJ, Westerman M: Population cytology of the genus Phaulacridium. I. Phaulacridium vittatum (Sjöst): Australian mainland populations. Chromosoma 46:197–205 (1974). Sharbel TF, Green DM, Houben A: B-chromosome origin in the endemic New Zealand frog Leiopelma hochstetteri through sex chromosome evolution. Genome 41:14–22 (1998). Smith SG, Virkki N: Animal Cytogenetics 3. Insecta 5. Coleoptera (Gebrüder Borntraeger, Berlin-Stuttgart 1978). Webb GC: Chromosome organization in the Australian plague locust Chorcoicetes terminifera. I. Banding relationships of the normal and supernumerary chromosomes. Chromosoma 55:239–246 (1976). Werren JH, Nur U, Eickbush DG: An extrachromosomal factor causing loss of paternal chromosomes. Nature 327:75–76 (1987). Westerman M, Fontana PG: Polymorphism for extra heterochromatin in Phaulacridium marginale. Heredity 31:223–229 (1973).

Cytogenet Genome Res 106:394–397 (2004)

397 255

Integration of B Chromosomes into the A Genome Cytogenet Genome Res 106:398–401 (2004) DOI: 10.1159/000079318

Imitate to integrate: Reviewing the pathway for B chromosome integration in Trypoxylon (Trypargilum) albitarse (Hymenoptera, Sphecidae) S.M.S. Rocha-Sancheza and S.G. Pompolob a Creighton

University, Department of Biomedical Sciences, Omaha, NE (USA); Federal de Viçosa (UFV), Departamento de Biologia Geral, Viçosa, MG (Brazil)

b Universidade

Abstract. B chromosomes are genomic “intruders” normally characterized by their total dispensability counteracted by a variety of drive mechanisms, which assures their presence regardless of their harmful effects on the host genome. From an evolutionary standpoint, the relationship between standard (A) and B chromosomes can go through different pathways, from an everlasting arms race to a cordial B integration. Examples underlying the first situation are fairly common; B integration, however, has been more a theoretical than a practical possibili-

ty. The B chromosome in the haplodiploid solitary wasp Trypoxylon albitarse is probably the first example of a “mimetic” B, which is being integrated into the A genome by limiting itself to one B per haploid genome, the same dosage as the A chromosomes. Here we review some of the findings underlying this hypothesis and discuss the T. albitarse B strategy as a possible mechanism for B chromosome integration as a regular member of the chromosome complement in haplodiploid organisms.

B chromosomes are genome symbionts, generally characterized by their dispensability and a variety of accumulation mechanisms (i.e. drive) assuring their maintenance regardless of their harmful effects on the host genome (Camacho et al., 2000). In its “rebel” trajectory the B chromosomes lack a regular meiotic behavior and ignore the most basic rules of Mendelian inheritance (two homologous chromosomes segregating to different gametes). In the short term, this irregularity may constitute the basis for B chromosome accumulation in the germ line and, consequently, their maintenance in natural popula-

tions (Jones, 1991). However, B chromosome drive also impedes its stabilization and integration as regular members of the standard (A) chromosome set. The genetic conflict between A and B chromosomes, characterizing polymorphisms for parasitic B chromosomes (see Camacho et al., 2000) may lead to two stable solutions, i.e. the elimination of the B chromosome or its integration as a regular member of the A genome, as a consequence of co-evolutionary changes in both counterparts (B chromosomes and A genome). In nature, co-evolutionary changes leading to parasite genome integration are evidenced, for instance, by the origin of mitochondria and plastids in eukaryotic cells (Nozaki et al., 2003; Emelyanov, 2003) and the suggested origin for the Y chromosome in Drosophila as an evolved B chromosome (Hackstein et al., 1996). A plausible mechanism for integration could come from the spontaneous translocations between A and B chromosomes that have been observed in several organisms (see Bakkali et al. 2003 for a review), especially in the grasshopper Eyprepocnemis plorans (Henriques-Gil et al., 1983; Cabrero et al., 1987; Bakkali et al., 2003). Nevertheless, those B-A interchanges turn out to be generally expensive to the host fitness, thus diminishing the proba-

This project was partially supported by grants from FAPEMIG, CNPq, CAPES, UFV, and UNICAMP. Received 15 September 2003; accepted 17 February 2004. Request reprints from: Dr. Sonia Maria S. Rocha-Sanchez Creighton University, Dept. of Biomedical Sciences 1912 California St., Criss II – Room 332, Omaha, NE 68178 (USA) telephone: +1-402-280-2175; fax: +1-402-280-2690 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0398$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

bility of frequency increase to a polymorphic status and, consequently, B fixation and integration into the host genome (Bakkali et al., 2003). A more direct mode of B integration would be to imitate A chromosomes by acquiring a regular meiosis (i.e. consistent pairing during prophase in diplo-diploid organisms), culminating with one B chromosome segregating to each pole and, thus, to each gamete. Even though it seems to be a straightforward pathway, in practice, the need for a double achievement (in both male and female meiosis) in diploid organisms might be a definitive stop sign in an integration route. In haplodiploid organisms, however, the meiosis process only takes places in the diploid sex, bringing the B chromosomes to a more promising avenue. Indeed, the ability of some B to accumulate in one sex but not in the other is strong evidence that male and female meioses do not appear to be the same from a B chromosome standpoint (for examples see Camacho et al., 2000). Contrasting with B chromosome scarcity in Hymenoptera, their study in this order has brought relevant insights to the understanding of B chromosome role and mechanism of preservation in the genome. The hymenopterans Nasonia vitripennis (Werren, 1991) and Trichogramma kaykai (Stouthamer et al., 2001) are the most dramatic examples of parasitic B chromosomes hitherto known. From the study of the B chromosome system in Trypoxylon (Trypargilum) albitarse, we have gathered evidence underlying B chromosome integration into the A genome. Currently, T. albitarse is the only known case of a B chromosome that seems to be changing its selfish and parasitic lifestyle to the “security” of an integrated life.

Fig. 1. Typical C-banding pattern on mitotic chromosomes of a Trypoxylon albitarse male (n = 16 + B). The arrow points to the B chromosome.

somal DNA within the B extension (Arau´jo et al., 2002b). Nonetheless, the similarity in banding pattern between B and A chromosome heterochromatin could provide evidence for B origin, which is still a pending issue in our current knowledge of the T. albitarse B chromosome system.

The B from the beginnings T. albitarse is a solitary, haplodiploid wasp inhabiting mud nests and showing a wide distribution over South America. The number of Trypoxylon with a known chromosome number is limited to only 12 out of 355 described species. T. albitarse is the only one with an acknowledged B chromosome system (Arau´jo et al., 2000, 2001). The first karyotype description for T. albitarse came in the early 1990s (L.F. Gomes, personal communication). In addition to the standard chromosome set (2nfemale = 32/nmale = 16), some individuals were described to carry extra chromosomes (Fig. 1), while others were mosaic (i.e. individuals carrying cell populations with both normal and increased chromosome numbers). Afterwards, the existence of a T. albitarse B chromosome system was confirmed (Arau´jo et al., 2000). Two types of B chromosomes have been described, both completely composed of G-C rich heterochromatin (Arau´jo et al., 2000). The metacentric B prevailed over the acrocentric type, which was supposed to be a variant derived by rearrangements (deletions or inversions), throughout the metacentric heterochromatin extension (Arau´jo et al., 2000, 2001). The correspondence between G-C richness and the rDNA location, already described to other B chromosomes (Green, 1988; Brockhouse et al., 1989; Lopez-Leon, et al., 1994) was not found in T. albitarse. Fluorescent in situ hybridization (FISH) using rDNA probes did not show any evidence of ribo-

Temporal variation in B frequency Over a period of 58 months an extensive sampling was carried out in nine natural populations from two different regions in Minas Gerais, Brazil (Arau´jo et al., 2000, 2001, 2002a). These populations were sampled twice (four generations in the first period and six in the second one), and the results shed light on some unique and interesting characteristics of B chromosome behavior in T. albitarse. The first sampling (February 1996 to December 1997) was characterized by a high frequency of individuals carrying one B per haploid genome (Bhg) in the Viçosa region, i.e. most females carried two B chromosomes and most males carried only one, the same as in the A chromosomes (Fig. 2a). Such suggestive results highlighted the progress of B chromosome integration as a regular member of the chromosome complement in T. albitarse. At this time, a B chromosome stabilization index (BSI or simply SI), defined as the proportion of individuals carrying one B per haploid A genome, was estimated and compared with other species SI (as estimated from previously published results; Arau´jo et al., 2001). Once more in the Viçosa region, T. albitarse B chromosomes showed a sharp evidence of stabilization, with SI values of 0.816–1.000. In fine contrast, B chromosomes were found in only three individuals in the Nova Ilha region (Fig. 2a).

Cytogenet Genome Res 106:398–401 (2004)

399 257

(Zurita et al., 1998), has affected the BSI in Viçosa (Fig. 2b), but did not change the Bhg stability (Fig. 2a). The results compiled from this extensive survey gave us strong support to hypothesize on the B chromosome integration into the A genome of T. albitarse. Even though the mechanism underlying this integration process is still unknown, it is already evident that the T. albitarse B chromosome system carries some characteristics that are unique in its category.

Imitate to integrate: is that the key?

Fig. 2. B evolution in natural populations of the wasp Trypoxylon albitarse. (a) Total number of B chromosomes per haploid A genome (Bhg). (b) General stabilization index for B chromosomes (BSI). Open squares (Bhg) or circles (BSI) joined by dotted lines represent populations analyzed on the first sampling. Populations from the second sampling are represented by filled squares or circles attached by a continuous line. Nil = N. Ilha; Amo = Amoras; Cam = Campus; Cris = Vila Cristal; Pam = Palmital; Par = Paraiso; Mar = Marrecos; Sil = Silvestre; Cha = Vila Chaves. Modified from Arau´jo et al. (2002a).

The second period of sampling (February 1998 to December 2000) was characterized particularly by an impressive increase in B chromosome frequency, and consequently Bhg, in the Nova Ilha population (Fig. 2a). This frequency alteration was particularly attributed to the metacentric B and provided strong evidence for an invasion event by this chromosome, which increased from a mean frequency of 0.133 in the first sampling to 0.883 in the second (Arau´jo et al., 2002a). Similarly, in Viçosa populations there were significant tendencies for an increase in the frequency of the metacentric B per haploid A genome (Methg) and a decrease of the acrocentric per haploid A genome (Acrohg; Arau´jo et al., 2002a). Such a replacement process, which seems to be a common event in B chromosome evolution

400 258

Cytogenet Genome Res 106:398–401 (2004)

As postulated and sometimes demonstrated for many species, B chromosomes follow several evolutionary strategies in order to persist in a population (Camacho et al., 2000). Evidence obtained from T. albitarse has strongly suggested that the achievement of an integrated status for B chromosomes could come from a combined action of drive, which is necessary for an initial invasion and frequency increase, followed by the regularization of B meiotic behavior in females, the only sex with a regular meiosis. We had postulated that once the B chromosomes reach a high frequency, the drive might be subsequently masked by a high tendency to imitate the A behavior (i.e., two B chromosomes pairing and segregating during the female meiosis in the same dosage than A chromosomes, thus forming ova each with one B). If our hypothesis is correct, a hostmediated suppression of drive (Camacho et al., 2000) is not necessary because it is achieved by the parasite itself. Nonetheless, it does not make the T. albitarse B’s life easy; the existence of a low degree of B mitotic instability and a certain rate of mutation of the metacentric B into the acrocentric one, which seems to be less fit (Arau´jo et al., 2001, 2002a), are some of the additional barriers that need to be bypassed before the B reaches the final stage toward its regularization as a “member” of the A genome.

Acknowledgements The authors thank Dr. J.P.M. Camacho and the Evolutionary Genetic Group at the University of Granada for all the support in the study of the Trypoxylon albitarse B chromosome system.

References Arau´jo SMSR, Pompolo SG, Dergam, JAS, Campos LAO: The B chromosome system of Trypoxylon (Trypargilum) albitarse (Hymenoptera, Sphecidae). 1. Banding analysis. Cytobios 101:7–13 (2000). Arau´jo SMSR, Pompolo SG, Perfectti F, Camacho JPM: Integration of a B chromosome into the A genome of a wasp. Proc R Soc Lond B 268:1127– 1131 (2001). Arau´jo SMSR, Pompolo SG, Perfectti F, Camacho JPM: Integration of a B chromosome into the A genome of a wasp, revisited. Proc R Soc Lond B 269:1475–1478 (2002a). Arau´jo SMSR, Silva CC, Pompolo SG, Perfectti F, Camacho JPM: Genetic load caused by variation in the amount of rDNA in a wasp. Chromosome Res 10:607–13 (2002b). Bakkali M, Cabrero J, Camacho JPM: B-A interchanges are unlikely pathway for B chromosome integration into the standard genome. Chromosome Res 11:115–123 (2003). Brockhouse C, Bas JAB, Fereday RM, Strauss, NA: Supernumerary chromosomes evolution in the Simulium vernum group (Diptera: Simulidae). Genome 32:516–521 (1989).

Cabrero J, Alche JD, Camacho JPM: Effects of B chromosomes of the grasshopper Eyprepocnemis plorans on nucleolar organizer regions activity. Activation of a latent NOR on a B chromosome fused to an autosome. Genome 29:116–121 (1987). Camacho JPM, Sharbel TF, Beukeboom LW: B chromosomes evolution. Phil Trans R Soc Lond B 355:163–178 (2000). Emelyanov VV: Mitochondrial connection to the origin of eukaryotic cell. FEBS Lett 270:1599–1618 (2003). Green D M: Cytogenetics of the endemic New Zeland frog, Leiopelma hochstetteri: extraordinary supernumerary chromosome variation and a unique sex-chromosome system. Chromosoma 97:55–70 (1988). Hackstein JHP, Hochstenbach R, Hauschteckjungen E, Beukeboom LW: Is the Y chromosome of Drosophila an evolved supernumerary chromosome? Bioessays 18:317–323 (1996). Henriquez-Gil N, Arana P, Santos JL: Spontaneous translocations between B chromosomes and the normal complement in the grasshopper Eyprepocnemis plorans. Chromosoma 88:145–148 (1983).

Jones RN: B–chromosomes drive. Am Nat 137:430– 442 (1991). Lopez-Leon MD, Neves N, Schwarzacher T, HeslopHarrison TS, Hewitt GM, Camacho JPM: Possible origin of a B chromosome deduced from its DNA composition using double FISH technique. Chromosome Res 2:87–92 (1994). Nozaki H, Matsuzaki M, Takahara M, Misumi O, Kuroiwa H, Hasegawa M, Shin-i T, Kohara Y, Naotake O, Kuroiwa T: The phylogenetic position of red algae revealed by multiple nuclear genes from mitochondria-containing eukaryotes and an alternative hyphotesis on the origin of plastids. J Mol Evol 56:485–497 (2003). Stouthamer R, van Tilborg M, de Jong JH, Nunney L, Luck RF: Selfish elements maintains sex in natural populations of a parasitoid wasp. Proc R Soc Lond B 268:617–622 (2001). Werren JH: The paternal-sex-ratio chromosome of Nasonia. Am Nat 137:392–402 (1991). Zurita S, Cabrero J, Lopez-Leon MD, Camacho JPM: Polymorphism regeneration for a neutralized selfish B chromosome. Evolution 52:274–277 (1998).

Cytogenet Genome Res 106:398–401 (2004)

401 259

Integration of B Chromosomes into the A Genome Cytogenet Genome Res 106:402–410 (2004) DOI: 10.1159/000079319

B chromosomes: the troubles of integration N. Granado, E. Rebollo, F.J. Sa´nchez and P. Arana Departamento de Genética, Universidad Complutense, Madrid (Spain)

Abstract. Starting with a spontaneous B-A centric fusion found in a natural population of the grasshopper Eyprepocnemis plorans, we have obtained different strains carrying the rearrangement in various conditions and doses. Using this material, we have analyzed the meiotic behavior of the translocated chromosome in living cultured spermatocytes, simulating the successive steps of a hypothetical process of integration of a

B chromosome into the standard genome via B-A centric fusion. Remarkably, the behavior of fusion heterozygotes, the initial step of the integration process, is much more regular than that of any other configuration, including homozygotes. The reasons for the failure of B chromosome integration into the normal complement by translocation are discussed.

Accessory or “B” chromosomes are dispensable, additional chromosomes appearing in polymorphic state in natural populations of numerous plants and animal species (Beukeboom, 1994). Even though their morphology, behavior, and origin may be very variable, they are generally considered as selfish elements of the genomes, efficiently self-perpetuating due to their particular mechanisms of preferential transmission to the offspring (for review see Camacho et al., 2000, and Camacho, 2004). The B chromosome polymorphism found in the grasshopper Eyprepocnemis plorans is an ancient and complex one. Up to 43 different types of Bs have been found in the Iberian Peninsula (Henriques-Gil et al., 1984; Henriques-Gil and Arana, 1990; Lo´pez-Leo´n et al., 1993), and a comparable variation occurs in Moroccan populations (Bakkali et al., 1999). The polymorphism appears to be engaged in a very dynamic process where new variants continuously arise by mutation from the old ones and may, eventually, substitute them (Henriques-Gil and Arana, 1990). In addition to the classical heterotic and parasitic models (Jones and Rees, 1982), Camacho et al. (1997) proposed a new model for B chromosome maintenance

in natural populations of E. plorans, based on numerous studies on the polymorphism in Spanish populations. In this third model, near-neutral ancient B variants are replaced by new parasitic Bs arisen by mutation that extend through preferential transmission mechanisms. These mechanisms are subsequently lost along with the harmful effects of the Bs due to the neutralizing influence of the A genome. Neutralized Bs will slowly tend to disappear from the populations due to slight selection against individuals with many B chromosomes and random drift until the whole cycle starts again. Besides disappearing or being substituted, another possible evolutionary fate for B chromosomes is postulated to be integration into the normal genome, this would lastingly guarantee the survival of the B. Evidences for the integration of B chromosomes as members of the normal complement arise from genetic and molecular analyses of the Y chromosomes of Drosophila species, that has been proposed to be, in origin, an accessory that became involved in the sexual system (Hackstein et al., 1996). In another case, the numeric stabilization brought by the acquisition of regular meiosis of the B chromosomes of the haplodiploid wasp Trypoxylon albitarse is considered to be a sign of integration (Arau´jo et al., 2001). Another mechanism for integration has been proposed to be translocation between B chromosomes and members of the normal complement (White, 1973). Especially, whole-arm translocations – centric fusions – may be a good start for integration (Bakkali et al., 2003) as the trivalents formed in meiosis of translocation heterozygotes are theoretically capable to orientate and segregate regularly and hence do not produce semisterility.

Supported by grant BOS2002-03572 from DGI, Spain. Received 3 October 2003; revision accepted 2 December 2003. Request reprints from Pilar Arana, Departamento de Genética, Facultad de Biologı´a Universidad Complutense, c/José Antonio Nova´is 2, SE–28040 Madrid (Spain) telephone: +34 91 395 4855; fax: +34 91 394 4844 e-mail: [email protected]

ABC

Fax + 41 61 306 12 34 E-mail [email protected] www.karger.com

© 2004 S. Karger AG, Basel 0301–0171/04/1064–0402$21.00/0

Copyright © 2004 S. Karger AG, Basel

Accessible online at: www.karger.com/cgr

A number of different B-A translocations have been found occasionally in samples from natural populations of Eyprepocnemis plorans (Henriques-Gil et al., 1983; Cabrero et al., 1987, Lo´pez-Leo´n et al., 1991, Bakkali et al., 2003). However, there is no evidence of spreading as all the mutations appeared in heterozygous condition and two individuals with the same translocation were never found. Therefore, there is an apparent failure of integration that Bakkali et al. (2003) explained by reduction in the fertility of individuals carrying non-centric B-A translocations. However, as these authors acknowledged, this failure of integration is, somehow, unexpected in the case of centric B-A fusions, as a neutral or near-neutral chromosomal rearrangement with regular transmission would have better chances to spread, overcoming the initial high risk of extinction due to random drift. On the other hand, our previous studies in living cultured spermatocytes of E. plorans have revealed that the X chromosome, several types of B chromosomes, and the autosomes have very different dynamic properties and behavior in the process of orientation within the meiotic spindle, and also marked differences in their modes of segregation. This variability between chromosomes is the consequence of adaptation to their particular situation in the genome: the X and the B chromosomes are natural univalents – they have no partner in the first meiotic division – whereas autosomes always form bivalents. As a consequence of chromosomal adaptation to regular transmission, the X univalent, like the main B types are very slow in their movements and undergo very few changes in direction. At anaphase I they segregate undivided in one of the daughter cells (reductional segregation). By contrast, autosomal univalents move very fast, change direction frequently, and show very irregular segregation, including equational division at anaphase I (separation of sister chromatids), migration failure, and spindle collapse (Rebollo and Arana, 1995, 1998, 2000; Rebollo et al., 1998). These characteristics are adequate for bivalent-forming chromosomes, in order to readily correct any possible initial malorientation and achieve the stable bipolar attachment that persists until anaphase I (Rebollo and Arana, 1995; Rebollo et al., 1998). If two chromosomes possessing very different behavior fuse to form a single structure, there will probably be consequences in meiotic behavior. Moreover, there might be some cytological reasons for the apparent failure of B-A translocations to expand in natural populations. We have addressed these questions within the context of B chromosome evolution, taking advantage of a spontaneous centric B-A fusion, TS10, involving B1 (an old and frequent B chromosome) and the small autosome S10, found in the natural population of Daimuz (DA). In our study, the behavior of the mutant chromosome was analyzed in a number of different meiotic structures simulating the successive steps of the integration process, as it should be taken into account that the initial rearrangement is just a starting point, and the new chromosome should accomplish successfully a series of different stages until the integration is complete. So, the TS10 compound was analyzed as a single chromosome (a univalent) as part of a heteromorphic bivalent in fusion heterozygotes, as a member of a trivalent formed by a heterozygous bivalent attached to an additional B1 chromosome, and as

a homozygous bivalent. The dynamic characteristics of the orientation movements and the modes of segregation were studied in living cultured spermatocytes of grasshopper strains obtained from the original mutant. In this way, we have checked the chances for an old, well adapted B chromosome to become integrated as a member of the normal genome by reconstructing the successive steps of the process, using the information obtained from the different configurations of the translocation in male meiosis.

Materials and methods A male carrying a spontaneous chromosome fusion – TS10 – was found in a natural population of the species Eyprepocnemis plorans from Daimuz (Valencia, Spain). The translocation involved S10, the second smallest autosome, and the most common and widespread Iberian B chromosome: B1 (Henriques-Gil et al., 1984). This mutant was backcrossed with virgin females from the same population and heterozygous males were selected among the offspring by testicular biopsy. A first group of these heterozygous males was crossed to sister females so as to obtain translocation homozygotes. Those heterozygous males carrying extra free B chromosomes were backcrossed to virgin females separately in order to establish a line with a high frequency of additional loose accessories that could form trivalent structures. The remaining males without extra B chromosomes were also crossed with virgin females from Daimuz as a source of heterozygotes. The three types of crossings were repeated during five years – one or two generations per year – until a sufficient number of individuals could be analyzed. As all the stocks were segregating, testicular biopsies were performed in every generation, and the males were used as parents according to their chromosomal constitution. In addition, translocation heterozygotes were heat treated at 44 ° C for 4 days, as described in Rebollo and Arana (1995) in order to obtain univalents by crossing over failure. In these individuals we could analyze the behavior of the TS10 compound chromosome when it is not attached to the normal S10, and compare them directly. Living spermatocyte cultures were made following the technique of Nicklas et al. (1982) from testis of young adult males. Chromosome movements were tracked under phase contrast and photographed at regular intervals. Tracks of the chromosomes were obtained from projections of these images as described in Rebollo and Arana (1995). Overall velocities as well as maximum and minimum velocities were scored for each chromosome separately by measuring the distance between successive positions of the correspondent kinetochore. Comparisons between chromosomes were performed by the non-parametrical statistical tests Kruskal-Wallis and Dunn’s (Hollander and Wolfe, 1973).

Results The structure of the translocation B1 is an acrocentric chromosome with a small euchromatic short arm (Fig. 1). Its size is approximately 45 % of the length of the X chromosome (Figs. 1 and 2). S10 is the second smallest autosome and, apparently, it has no short arm. Its length is approximately 47 % of the X chromosome. Consequently, the translocated TS10 is nearly metacentric (Figs. 1 and 2a). This is a rare condition within the E. plorans complement, as all the chromosomes of this species, including the X chromosome and the main B types, are telo- or acrocentric. At phase contrast, each arm of TS10 keeps the chromatin characteristics of the original chromosome: the B arm of TS10 is fainter than the autosomal arm in all the structures where TS10 is involved (see Figs. 3–5 and 6).

Cytogenet Genome Res 106:402–410 (2004)

403 261

Fig. 1. Structure of the TS10 centric fusion. The resulting TS10 chromosome is nearly metacentric.

Fig. 2. (a) C-banding of a TS10 heterozygous bivalent at early diplotene. The centromere of TS10 appears to be that of chromosome B1. (b) Silver staining of the heterozygous bivalent of TS10 at prometaphase I. In this case, the TS10 chromosome is bent at the centromeric region, with its kinetochore (double arrowhead) apparently pulling opposite to the S10 kinetochore (arrowhead).

Fig. 3. Tracking of a TS10 univalent in prometaphase I. Times in minutes on the lower left corner of the prints. The TS10 univalent (arrowhead) is stabilized amphitelically at the equator of the cell from the beginning of the observation, and lags at anaphase I (222 min print), provoking spindle collapse (252 min print). Note the difference in condensation between the autosomal and the B chromatin (16 min print). Bar = 10 Ìm.

Fig. 4. Tracking of a TS10 heterozygous bivalent. The bivalent is undergoing broad interpolar movements including reorientations (0 and 58 min prints) while normal bivalents are perfectly congressed. The S10 chromosome leads the movement. Note the difference in condensation between the autosomal and B regions of TS10. Transient linearity (82 min print) is followed by acquisition of bipolarity (145 min print) and correct segregation at anaphase I (190 min print). Bar = 10 Ìm.

404 262

Cytogenet Genome Res 106:402–410 (2004)

0

70

381

436

486

Fig. 5. Tracking of a TS10 trivalent. Linear configuration is maintained throughout prometaphase, S10 kinetochore (bottom arrowhead) and B1 kinetochore (top arrowhead) pulling, whereas the TS10 kinetochore (arrowhead at the middle) is trapped between them. At anaphase I (486 min print), S10 does not detach from TS10 and both chromosomes migrate to the lower pole. Bar = 10 Ìm.

Fig. 6. (a) Tracking of a TS10 homozygous bivalent and a normal autosomal bivalent in the same cell. The TS10 homozygous bivalent shows one interstitial chiasma in the S10 half of the chromosomes (see 76 min print). The differential condensation between A and B chromatin is evident in most prints. The autosomal bivalent tracked is the long one with a distal chiasma situated on the left of the spindle in 224 min and 259 min prints. The congression of the TS10 bivalent is severely impaired. The TS10 bivalent shows broad interpolar trips and two reorientations (56 and 224 min prints). At anaphase I (285 min print), the whole bivalent migrates to the upper pole. Bar = 10 Ìm. (b) Graph showing the position of the chromosomes versus time. The upper and lower continuous lines represent the position of the spindle poles and the straight line at the middle represents the position of the equator. Note the maintenance of bipolarity with small oscillations around the equator of the normal bivalent.

Cytogenet Genome Res 106:402–410 (2004)

405 263

gous (heteromorphic) bivalent, as a trivalent – in heterozygotes with an extra B chromosome – and as a homozygous bivalent. In addition to the chromosomes involved in the structural change, the X chromosome was tracked also for comparison, as this natural univalent shows perfectly regular transmission and it has been used for reference in our previous studies (Rebollo and Arana, 1995). In certain cases, autosomal bivalents were also tracked to compare with the behavior of the structures involving TS10 (see Fig. 6).

Fig. 7. Modes of anaphase I segregation of the chromosomes involved in the different configurations of the TS10 translocation. Number of living cells scored for each segregation indicated below. a equational segregation, b migration failure, c spindle collapse.

Silver staining reveals a single kinetochore (Fig. 2b) so, the counterpart of the translocation event – a small centric fragment – was presumably lost, since it was never seen, even in the original mutant. This raises the question of which of the two possible kinetochores is the one remaining in TS10 chromosome. This is a crucial issue since kinetochores are responsible for the behavior of chromosomes in the processes of orientation and segregation and, hence, in their transmission efficiency. C-banding of early prophase I bivalents suggests that it is the B1 kinetochore the one included in the translocated chromosome (Fig. 2a). Additional evidence supporting this arises from the dynamic behavior of the TS10 chromosome in living spermatocytes, as it will be addressed later. Living cell observations The meiotic behavior of the TS10 chromosome was analyzed in a number of situations: as a univalent, as a heterozy-

406 264

Cytogenet Genome Res 106:402–410 (2004)

Univalents The X univalent in all the cells analyzed in this study behaves just like any other E. plorans X chromosome previously reported: it is a static chromosome that shows slow interpolar movements and seldom reorients during prometaphase I, and its segregation at anaphase I is flawlessly reductional (i.e. the chromosome moves undivided to one of the poles). Average, maximum and minimum velocities are shown in Table 1 in relation to other chromosomes of various origins. At the other extreme, the autosome S10, like all autosomal univalents is much faster and reorients often in prometaphase I. At metaphase I it acquires amphitelic (mitotic-like) orientation by attaching each chromatid to a different pole (Fig. 7). This leads to a series of segregation irregularities. As mentioned above, the TS10 chromosome could, in principle, keep either the autosomal or the B1 kinetochore. Univalent dynamics and behavior depend on kinetochore characteristics, and these are likely to be retained, at least to a certain extent, in the translocated chromosome, so, from the behavior of the TS10 univalent we can infer the origin of its kinetochore. When the three univalents present in heat treated cells are compared, TS10 behaves like the X chromosome in terms of velocity and frequency of reorientations, and both are clearly different from the S10 autosomal univalent (Tables 1 and 2). This indicates that the TS10 kinetochore belongs to the B1 chromosome, which is as static as the X univalent, rather than to the dynamic autosome S10. Comparisons with B1, X and A chromosomes from the same populations scored in other experiments confirm this assessment (Table 1). Heterozygotes Heteromorphic bivalents are like bipartite structures. Consequently, they are capable of bipolar stabilization by opposite tension forces. However, their two kinetochores are of different nature, and this affects their behavior. Heteromorphic bivalents take longer to achieve bipolarity than normal bivalents, and, in some cases, “flip-flop” reorientations (i.e. orientation reversion after bipolarity) occurs, an event never seen in normal cells. Moreover, congression is impaired and the TS10 bivalent shows broad oscillations between the poles (Fig. 4). Very often, the TS10 chromosome appears rod-like, not showing any sign of bending at the centromeric region (an indication of attachment to the spindle). It is then possible that this chromosome does not maintain a functional kinetochore fibre all the time.

Table 1. Prometaphase velocities in m/min and frequencies of reorientation movements of the chromosomes analyzed in the different TS10 structures. Last three rows correspond to scores from other experiments where the X, B1 and autosomal univalents from Daimuz population were studied. Univalents

TS10 S10 X B1 X DA B1 DA A DA

Heterozygotes

Trivalents

Homozygotes

Max.

Min.

Mean

Average reorientations

Max.

Min.

Mean

Average reorientations

Max.

Min.

Mean Average reorientations

Max. Min. Mean Average reorientations

0.94 1.18 0.45

0.01 0.03 0.01

0.20 0.46 0.16

1.5 6.125 0.625

0.76 1.6 0.69

0.01 0.01 0.01

0.17 0.21 0.14

1.11 1.11 0.11

0.51 0.86 0.47 0.74

0.01 0.01 0.02 0.01

0.10 0.13 0.14 0.11

0.63

0.03 0.21

0.66

0.96

0.03 0.16

0.33

0.38 0.40 1.05

0.05 0.04 0.13

0.16 0.16 0.48

0.44 0.55 4.25

0.5 0.5 0.5 0.5

Table 2. Results of Dunn’s multiple range tests for the comparisons of the overall velocities of chromosomes TS10 and S10 in the different configurations of translocation. Previous Kruskal-Wallis tests yielded significant differences between configurations (H = 69.18, P ! 0.001 for TS10, and H = 83.71, P ! 0.001 for S10). Chromosome TS10a

Chromosome S10a

Configuration

heterozygotes

homozygotes

trivalents

Configuration

heterozygotes

trivalents

univalents heterozygotes homozygotes

NS

NS NS

* * *

univalents heterozygotes

*

* *

a

* = P < 0.05; NS = nonsignificant differences.

The velocity of the S10 autosome in heterozygotes is lower than that of the S10 univalent (Table 2). This indicates that the presence of an attached TS10 somewhat hinders the movements of the S10 autosome. Conversely, the TS10 member of the heteromorphic bivalent shows the same velocity as the TS10 univalent. Despite the defects in orientation, segregation of TS10 heterozygotes is not disastrous (Fig. 7). Yet, in two out of 15 cells, after anaphase separation of S10 and TS10, the latter acquired amphitelic orientation and lagged at the equator. It finally divided equationally in one of these two cells. In the other cell, TS10 migration failed. Two abnormal cells out of 15 is still a too frequent event to consider segregation of TS10 heterozygotes as regular. Trivalents Trivalents form by a chiasmatic terminal or interstitial association between the B1 portion of the TS10 heterozygous bivalent and an additional free B1 chromosome. They are very frequent in individuals with extra B chromosomes. The TS10 trivalent is a rather static structure: reorientations are scarce and the velocities of the TS10, S10 and B members of the trivalent are the lowest found for each chromosome in all the cases studied (Tables 1 and 2). Quite often, the trivalents adopt a linear configuration, with bipolar attachment of the kinetochores placed at the ends (those of S10 and B1 chromosomes) whereas the TS10 kinetochore lies at the middle of the structure (Fig. 5). Persistence of the linear configuration is the most frequent cause of malsegre-

gation of the trivalent. In six out of eleven cells, TS10 migrated together with either B1 (one cell) or S10 (five cells, Fig. 7). In the latter case, this results in aneuploidy for S10. Homozygotes In TS10 homozygotes the bivalent has one chiasma in the autosomal half of the chromosomes. This chiasma can be distal or interstitial, but the behavior is alike. Two ring bivalents with an additional chiasma in the B1 half of TS10 were also scored. TS10 homozygous bivalents are also bipartite structures capable of acquiring bipolarity. In this case, the two kinetochores are identical so, there should not be predominance of one over the other. However, this does not necessarily imply a regular behavior of the bivalent. In fact, TS10 homozygotes show more orientation irregularities than TS10 heterozygotes: reorientations occur in most cells, and perfect congression is never achieved (Fig. 6). In a first instance, the velocity of TS10 in these bivalents was scored separately for the two members, yielding an almost identical estimation for both chromosomes. Velocities of both TS10 chromosomes were then pooled for the statistical analysis. In homozygotes, the velocity of TS10 is the same as in univalents, but slightly higher than that of heterozygotes (Tables 1 and 2), which is another indication of a higher degree of instability. Irregularity shows up again in segregation behavior: the two TS10 chromosomes segregated correctly only in three out of nine cells. In approximately half of the other cells (five out of nine) the whole bivalent was included in one of the poles, which

Cytogenet Genome Res 106:402–410 (2004)

407 265

is the most severe type of nondisjunction for a bivalent. In the remaining cell, the whole structure remained at the equator showing no migration at all (Fig. 7). So, despite the equal kinetochores, the behavior of the TS10 homozygous bivalent is clearly more abnormal than that of heterozygous bivalents.

We are only going to consider cytological effects, but it should be kept in mind that B-A translocations may also produce physiological effects. For instance, the B-A translocation described by Cabrero et al. (1987) in E. plorans, triggers the activation of a latent nucleolar organizing region in the B chromosome. Effects like this may clearly have an impact on the long term fate of the rearrangement.

Discussion The chromosomes Centric fusions, i.e. whole arm translocations, are one of the chromosomal rearrangements that, in theory, do not entail a high degree of sterility in heterozygotes because trivalents in meiosis have only one way of stabilization in the spindle that coincides with genetically balanced segregation: alternate orientation. They have actually played a role in the evolution of many plant and animal groups, including grasshoppers (Bidau and Mirol, 1988). So, as acknowledged by Bakkali et al. (2003), they are the most favorable starting point for a B chromosome to become integrated into the normal genome. By contrast, the B-A translocation recently described in E. plorans by these authors is a reciprocal interchange of terminal fragments (Bakkali et al., 2003). As the same authors concluded, this type of translocations is not a good candidate for integration, as all the possible meiotic configurations necessarily bear a high probability of aneuploidy, either because univalents are formed, or because chiasmata in interstitial regions, i.e. between the centromere and the breakpoint, should occur. However, despite the favorable characteristics, B-A fusions do not spread in E. plorans populations. One explanation for that might be the selfish nature and/or the peculiar mode of transmission of the B chromosome that could impair the behavior of the autosomal part of the compound chromosome. Obviously, a recent B variant still possessing harmful effects could not be integrated in the genome as selection would also operate against the translocated chromosome, likewise, a meiotically irregular B chromosome or a B chromosome with mechanism of accumulation would produce serious disturbances in the transmission of the A member of the translocation. Yet, B1 is, in principle, a good candidate for integration as it is an ancient, near-neutral B chromosome with no accumulation mechanism in the Iberian Peninsula (Henriques-Gil et al., 1982) and, consequently, has no detectable harmful effect in low doses. Meiotically, the B1 univalent is perfectly regular, and its behavior resembles very much that of the X chromosome in male meiosis: reductional division at anaphase I and equational at anaphase II. B1 dynamics at prometaphase I is also like that of the X univalent: both are slow in motion and reorient rarely (Rebollo and Arana, 1995). When two B1 chromosomes are present in the same individual they form bivalents in 57 % of the meiocytes and segregate normally (Henriques-Gil at al., 1982), in the remaining cases the two univalents segregate at random. In female meiosis B1 behavior is similar to that observed in males (Cano et al., 1987). As S10 is a perfectly normal and regular autosome, the causes of the obviously incompetent transmission of TS10 should be searched in the event of the translocation itself, not in the chromosomes involved.

408 266

Cytogenet Genome Res 106:402–410 (2004)

The rearrangement The first step in the sequence of integration is structural heterozygosity. In TS10 heterozygotes, B1 appears as a member of a bivalent, this is, in principle, an advantage for B transmission as bipartite structures can be stabilized in the spindle by opposite tension forces, ensuring 1:1 segregation. However, B1 is already very regular as a univalent, actually, it is slightly more efficient than the TS10 heterozygous bivalent that showed few cases of abnormal segregation (see Fig. 7). This small disadvantage of the heterozygous bivalent could be attributed to the disparity of its two kinetochores. Inequality between kinetochores is evident from the fact that, in most of the orientation movements, the S10 kinetochore leads while the TS10 kinetochore seems to passively trail. This may be the source of the relative instability of the TS10 heterozygous bivalent, revealed by the broad interpolar oscillations and by the occasional incidence of orientation reversion, the so called flip-flop reorientations, that never occur in normal bivalents. Moreover, the lack of bending at the centromere of the TS10 chromosome during long periods of prometaphase I indicates that its kinetochore is not properly attached to the spindle and opposing tension to the S10 kinetochore (Fig. 4). This may be due either to a deficiency in TS10 kinetochore or to the fact that the bulk of decondensed B chromatin is hindering the interaction between this kinetochore and the microtubules. As metacentric chromosomes do not occur in E. plorans, we cannot compare the behavior of TS10 with that of normal biarmed members of the complement. An incompetent TS10 kinetochore may also be the cause of the dramatic failure in segregation of TS10 trivalents. The behavior of trivalents is important since in the natural populations where B-A chromosomal translocations occur, the frequency of B chromosomes can be quite high (around 40 % in both populations of Daimuz, Spain [Henriques-Gil et al., 1982], and Smir, Morocco [Bakkali et al., 1999]). Thus, during the process of spreading, it is very likely that some individuals bearing the translocation possess additional free B chromosomes. As B1 is the most frequent B chromosome in Daimuz, in all the individuals analyzed the extra B was always B1. Two B1 chromosomes in the same cell form one chiasma in meiosis with a high frequency (57 %, Henriques-Gil et al., 1982), in our experiments, the frequency of chiasmata is even higher since virtually all cells of TS10 heterozygotes with extra B1 chromosomes showed a trivalent, either with a proximal or a distal chiasma between the B chromosome homologous regions. So, if a fusion is to survive within the population, it should also be efficient in transmission in these circumstances. TS10 fusion significantly fails in this new step: in almost half of the cases, S10 and TS10 migrate to the same pole at anaphase I, producing aneuploid cells for the S10 autosome (see Figs. 5 and 7). The reason for this migration failure could

be the linear configuration often attained by the trivalent. Linear configurations occur because the TS10 kinetochore remains inactive trapped between the two extreme S10 and B1 kinetochores. Again, this may be favored by the relative incompetence of the TS10 kinetochore. As a consequence of linear orientation, the length of the trivalent could be excessive for the spindle to separate its elements. However, S10 is one of the smallest members of the complement of E. plorans and the trivalent does not appear to be extremely long even when the association between B1 and TS10 is distal (Fig. 5). Impairment of segregation due to an excessive length of the structure would rather occur in B-A translocations involving longer autosomes. We rather support the idea that, after release and migration of one of the chromosomes to the pole, the pulling force exerted on the structure drops, the inactive TS10 stays attached to the other chromosome by residual cohesion (Suja et al., 1999) and is passively dragged to the opposite pole. Homozygosity is the final step in the process of integration; theoretically, any mutation that passed the previous stages should have achieved a very stable situation, making up a bivalent structure, fulfilling all the requirements to orientate and segregate regularly. However, the TS10 homozygous bivalent is the most unstable configuration of the translocation. This fact obviously eliminates all the possible expectations of success for the integration of the B chromosome. Again, the defect seems to reside in the kinetochore of TS10. This time, irregularity cannot be attributed to inequality of kinetochores as both are necessarily identical. In summary, among all the structures in which the TS10 chromosome can be involved, heterozygous bivalents are the most competent for transmission, followed by the TS10 univalents, the trivalents and, finally, the homozygous bivalents (Fig. 7). According to this situation, there are several possible reasons to account for the problems of integration: E First of all, it is possible to think that the B1 kinetochore is not suitable to be an element of a complex structure because it is a chromosome adapted to univalency and it has developed a strategy consisting in slow movements and scarce reorientations. This is unfit for a normal chromosome of the A complement since for bivalent forming chromosomes it is advantageous to readily correct the initial malorientations and achieve bipolarity. This is why they evolved kinetochores that move fast and reorient frequently (Rebollo et al., 1998). However, in bivalents formed by two normal B1 chromosomes, the B1 kinetochore works normally both in males and females so, the irregularities of TS10 cannot be fully attributable to the nature of B1 kinetochore. E One could alternatively think that the functionality of the TS10 kinetochore has been damaged in the process of translocation as the breakpoint lies at or near this region. This is supported by the slightly more irregular behavior of TS10 compared to B1. Another sign of abnormality of the TS10 kinetochore is its increased doubleness in late prometaphase I compared to the remaining chromosomes (unpublished data). Doubleness of sister kinetochores before bipolar stabilization in the meiosis I spindle is a source of instability as it favors amphitelic orientation, with all its adverse consequences (Rebollo and Arana, 1995, 1998; Rebollo et al., 1998). However, it

should be noticed that if the TS10 kinetochore is actually impaired, the extent of the damage should be moderate, as both the segregation of univalents and heterozygous bivalents is rather correct. E Another factor to take into account is the difference in chromatin condensation between autosomes and B chromosomes. B1, like the X chromosome of E. plorans, is allocyclic in meiosis. This is evident in the fainter aspect under phase contrast of the B1 chromatin in all the TS10 configurations. Around the area of the breakpoint in the centromeric region of TS10, the two types of chromatin are in close contact, which may alter the structure of the chromosome and somehow disrupt the functionality of the kinetochore. Finally, it is noteworthy that the dynamic meiotic behavior of chromosome TS10 does not vary remarkably between the different configurations. By contrast, both the velocity and the frequency of reorientations of S10 greatly decrease in bivalents and trivalents compared to S10 univalent. In general, it appears that, in hybrid structures, the slowest chromosome determines the velocity of the movements. So, in both types of bivalents it is chromosome TS10 the one dictating the dynamic behavior. Whereas, in trivalents, it is B1, just slightly slower than TS10, the chromosome imposing velocity limits. This explains why trivalents are the structures showing the slowest velocity for both S10 and TS10 chromosomes. It is then possible that if the TS10 kinetochore had been that of the S10 chromosome, the behavior of the translocation would have been different, and more similar to that of a normal autosomal bivalent. Yet, this does not guarantee regularity nor success in integration since other possible effects like a potential kinetochore damage, heterogeneity of the chromatin around the breakpoint and shielding of the microtubule attachment of the TS10 kinetochore by the B chromatin would not disappear. So, in our simulation of the process of integration of a B chromosome into the normal genome through B-A centric fusions, the first and theoretically most difficult step, the primary mutation, is the best performing configuration of the translocation. Whereas, the final stage, when most problems are supposed to have been overcome, is the most irregular. This reveals the difficulty of making predictions about the future of such a chromosomal mutation only from the data of heterozygotes. Our work also reveals that, as chromosomes are adapted to their particular role in the genomes, changes that are in principle irrelevant – a genetically balanced rearrangement like centric fusion – may pointedly alter their structure and function and totally prevent a way of chromosomal evolution.

Cytogenet Genome Res 106:402–410 (2004)

409 267

References Arau´jo SMSR, Pompolo SG, Perfectti F, Camacho JPM: Integration of a B chromosome into the genome of a wasp. Proc R Soc Lond B Biol Sci 268:1127–1131 (2001). Bakkali M, Cabrero J, Lo´pez-Leo´n MD, Perfectti F, Camacho JPM: The B chromosome polymorphism of the grasshopper Eyprepocnemis plorans in North Africa I. B variants and frequency. Heredity 83: 428–434 (1999). Bakkali M, Cabrero J, Camacho JPM: B-A interchanges are an unlikely pathway for B chromosome integration into the standard genome. Chromosome Res 11:115–123 (2003). Beukeboom LW: Bewildering Bs: An impression of the 1st B-chromosome conference. Heredity 73:328– 336 (1994). Bidau CJ, Mirol PM: Orientation and segregation of Robertsonian trivalents in Dichroplus pratensis (Acrididae). Genome 30:947–955 (1988). Cabrero J, Alché JD, Camacho JPM: Effects of B chromosomes on the activity of nucleolar organizer regions in the grasshopper Eyprepocnemis plorans: activation of a latent nucleolar organizer region on a B chromosome fused to an autosome. Genome 29:116–121 (1987). Camacho JPM: B chromosomes, in Gregory TR (ed): The evolution of the genome (Elsevier, Amsterdam 2004). Camacho JPM, Shaw MW, Lo´pez-Leo´n MD, Pardo MC, Cabrero J: Population dynamics of a selfish B chromosome neutralized by the standard genome in the grasshopper Eyprepocnemis plorans. Am Nat 149:1030–1050 (1997).

410 268

Camacho JPM, Sharbel TF, Beukeboom LW: B chromosome evolution. Philos Trans R Soc Lond B Biol Sci 355:163–178 (2000). Cano MI, Jones GH, Santos JL: Sex differences in chiasma frequency and distribution in natural populations of Eyprepocnemis plorans containing B chromosomes. Heredity 59:237–243 (1987). Hackstein JHP, Hostenbach R, Hauschteck-Jungen E, Beukeboom LW: Is the Y chromosome of Drosophila an evolved supernumerary chromosome? Bioessays 18:317–323 (1996). Henriques-Gil N, Arana P: Origin and substitution of B chromosomes in the grasshopper Eyprepocnemis plorans. Evolution 44:747–753 (1990). Henriques-Gil N, Santos JL, Gira´ldez R: B-chromosome polymorphism and interchromosomal chiasma interference in Eyprepocnemis plorans (Acrididae, Orthoptera). Chromosoma 85:183–194 (1982). Henriques-Gil N, Arana P, Santos JL: Spontaneous translocations between B chromosomes and the normal complement in the grasshopper Eyprepocnemis plorans. Chromosoma 88:145–148 (1983). Henriques-Gil N, Santos JL, Arana P: Evolution of a complex B-chromosome polymorphism in the grasshopper Eyprepocnemis plorans. Chromosoma 89:290–293 (1984). Hollander M, Wolfe DA: Nonparametrical statistical methods, in Bradley RA, Hunter JS, Kendall DG and Watson GS (eds.): Nonparametric statistical methods (John Wiley & Sons, New York 1973).

Cytogenet Genome Res 106:402–410 (2004)

Jones RN, Rees H: B chromosomes (Academic Press, New York 1982). Lo´pez-Leo´n MD, Cabrero J, Camacho JPM: A nucleolus organizer region in a B chromosome inactivated by DNA methylation. Chromosoma 100: 134–138 (1991). Lo´pez-Leo´n MD, Cabrero J, Pardo MC, Viseras E, Camacho JPM, Santos JL: Generating high variability of B chromosomes in the grasshopper Eyprepocnemis plorans. Heredity 71:352–362 (1993). Nicklas RB, Kubai DF, Hays TS: Spindle microtubules and their mechanical associations micromanipulation in anaphase. J Cell Biol 95:91–104 (1982). Rebollo E, Arana P: A comparative study of orientation at behaviour of univalent in living grasshopper spermatocytes. Chromosoma 104:56–67 (1995). Rebollo E, Arana P: Chromosomal factors affecting the transmission of univalents. Chromosome Res 6: 67–69 (1998). Rebollo E, Arana P: Active role of lagging chromosomes in spindle collapse as revealed by live phase contrast and tubulin immunostaining. Chromosoma 110:292–304 (2000). Rebollo E, Martı´n S, Manzanero S, Arana P: Chromosomal strategies for adaptation to univalency. Chromosome Res 6:515–531 (1998). Suja JA, Antonio C, Debec A, Rufas JS: Phosphorylated proteins are involved in sister-chromatid arm cohesion during meiosis I. J Cell Sci 112:2957– 2969 (1999). White MJD: Animal Cytology and Evolution (3rd ed) (Cambridge University Press, London 1973).

Author Index Vol. 106, No. 2–4, 2004

Alves-Brinn, M.N. 195 Andreenkova, O.V. 284, 289 Arana, P. 402 Bakkali, M. 332, 338 Barros, E.G. 279 Benzaquem, D.C. 195 Bertollo, L.A.C. 230 Bertolotto, C.E.V. 243 Bidau, C.J. 295, 347 Birchler, J.A. 309 Blagojevic´, J. 247 Bochkaerev, M.N. 289 Borissov, Y.M. 289 Bugrov, A.G. 284 Burgos, M. 344 Burt, A. 151

Galetti, P.M., Jr. 230 Go´mez, R. 302 Gonza´lez-Sanchez, M. 386 Gosa´lvez, J. 376 Granado, N. 402 Green, D.M. 235 Houben, A. 199 Jenkins, G. 314 Jiménez, G. 386 Jiménez, R. 344 Jones, R.N. 149, 151, 314, 320 Kantama, L. 173 Karamysheva, T.V. 284, 289 Kartavtseva, I.V. 271, 289

Cabrero, J. 325, 338 Calvente, A. 302 Camacho, J.P.M. 159, 325, 332, 338, 376 Campos, L.A.O. 279 Cannas, R. 215 Caperta, A. 320 Casanova, J.C. 222 Cau, A. 215 Chiavarino, M. 386 Colombo, P. 351 Coluccia, E. 215 Confalonieri, V. 351 Corral, J.M. 338

Lamatsch, D.K. 189 Leach, C.R. 199 Lo´pez-Leo´n, M.D. 325, 338

Deiana, A.M. 215 de Jong, H. 173 de J. Silva, M.J. 257 de la Vega, C.G. 376 Delgado, M. 320 Dı´az de la Guardia, R. 344 Dı´ez, M. 149

Nanda, I. 189 Nokkala, C. 394 Nokkala, S. 394

Egozcue, J. 165 Epplen, J.T. 189 Fagundes, V. 159 Feldberg, E. 195 Fernandes-Saloma˜o, T.M. 279 Fregonezi, J.N. 184 Fuster, C. 165

ABC

Fax + 41 61 306 12 34 E-Mail [email protected] www.karger.com

Machola´n, M. 264 Manzanero, S. 386 Martı´, D.A. 295, 347 Maryañska-Nadachowska, A. 210 Mendonça, M.N.C. 195 Mesa, J.A. 338 Mitchell-Olds, T. 173 Morais-Cecı´lio, L. 320 Moreira-Filho, O. 230

Salvadori, S. 215 Sa´nchez, F.J. 402 Santos, J.L. 302 Schartl, M. 189 Schlupp, I. 189 Schmid, M. 189 Sharbel, T.F. 173 Shimada, T. 365 Sˇpakulova´, M. 222 Stitou, S. 344 Suja, J.A. 302 Tavares, M.G. 279 Teruel, M. 325 Timmis, J.N. 199 Torezan, J.M.D. 184 Tosta, V.C. 279 Trivers, R. 151 Tsurusaki, N. 365 Vanzela, A.L.L. 184 Viegas, W. 320 Viera, A. 302 Vilardi, J.C. 359 Voigt, M.-L. 173 Vujosˇevic´, M. 247

Page, J. 302 Palestis, B.G. 151 Parra, M.T. 302 Pellegrino, K.C.M. 243 Perfectti, F. 325, 338, 376 Phelps-Durr, T.L. 309 Pia´lek, J. 264 Pita, M. 376 Pompolo, S.G. 279, 398 Porto, J.I.R. 195 Puertas, M.J. 386

© 2004 S. Karger AG, Basel

Rebollo, E. 402 Remis, M.I. 359 Ribeiro, T. 320 Rigola, M.A. 165 Rocha, C. 184 Rocha-Sanchez, S.M.S. 398 Rosato, M. 295, 386 Roslik, G.V. 271, 289 Rubtsov, D.N. 284 Rubtsov, N.B. 284, 289 Rufas, J.S. 302

Wo´jcik, A.M. 264 Wo´jcik, J.M. 264 Yonenaga-Yassuda, Y. 159, 257 Zima, J. 264 Zurita, F. 344

Accessible online at: www.karger.com/cgr

411

Author Index Vol. 106, 2004 This index does not contain authors of abstracts of the 16th European Colloquium on Animal Cytogenetics and Gene Mapping or of the 38th American Cytogenetic Conference published in this volume.

Alves-Brinn, M.N. 195 Andreasson, B. 43 Andreenkova, O.V. 284, 289 Arana, P. 402 Bader, P.I. 61 Bakkali, M. 332, 338 Barclay, L. 39 Barros, E.G. 279 Beck, J. 98 Bendixen, C. 142C Benzaquem, D.C. 195 Bertollo, L.A.C. 107, 230 Bertolotto, C.E.V. 243 Bidau, C.J. 295, 347 Birchler, J.A. 309 Bjerregaard, B. 43 Blagojevic´, J. 247 Blair, R.T. 61 Bochkaerev, M.N. 289 Borissov, Y.M. 289 Breatnach, F. 49 Brenig, B. 98, 142B Bryndorf, T. 43 Bugrov, A.G. 284 Burgos, M. 344 Burt, A. 151 Buwe, A. 55 Bylund, L. 28 Cabrero, J. 325, 338 Calvente, A. 302 Camacho, J.P.M. 159, 325, 332, 338, 376 Campos, L.A.O. 279 Cannas, R. 215 Caperta, A. 320 Carty, P. 49 Casanova, J.C. 222 Catchpoole, D. 49 Cau, A. 215 Chen, K. 91 Chen, X. 91 Chiavarino, M. 386 Colombo, P. 351 Coluccia, E. 215 Confalonieri, V. 351 Corral, J.M. 338 Deiana, A.M. 215 de Jong, H. 173 de la Vega, C.G. 376 Delgado, M. 320 Distl, O. 142D Dı´az de la Guardia, R. 344

ABC

Dı´ez, M. 149 Domanski, H.A. 33 Drögemüller, C. 142D Dueholm, B. 142C Eddings, E.M. 61 Edwards, Y.H. 61 Egozcue, J. 165 Epplen, J.T. 189 Fadl El Moula, F.M. 74 Fagundes, V. 159 Fan, B. 142E Faruque, M.U. 61 Felbor, U. 55 Feldberg, E. 195 Fernandes-Saloma˜o, T.M. 279 Fregonezi, J.N. 184 Fries, R. 142B Fuster, C. 165 Galetti, P.M., Jr. 230 Gatphayak, K. 98 Gehrig, A. 74 Geurts van Kessel, A. 68 Gisselsson, D. 33 Gjerstorff, M. 142C Go´mez, R. 302 Gonza´lez-Sanchez, M. 386 Gosa´lvez, J. 376 Granado, N. 402 Green, D.M. 235 Griffin, D.K. 82, 111 Guo, Z. 91 Haberkern, G. 142A Habermann J. 142B Hamann, H. 142D Hansen, S. 142C Hexige, S. 91 Holmskov, U. 142C Houben, A. 199 Hu, P. 61 Huang, C. 91 Isaksson, M. 33 Jenkins, G. 314 Jiménez, G. 386 Jiménez, R. 344 Jones, R.N. 149, 151, 314, 320 Jonson, T. 33

Fax + 41 61 306 12 34 E-Mail [email protected] www.karger.com

Kalm, E. 142A Kantama, L. 173 Karamysheva, T.V. 284, 289 Kartavtseva, I.V. 271, 289 Kavalco, K.F. 107 Kirchhoff, M. 43 Knorr, C. 98 Knötgen, N. 55 Ko, E. 39 Kuiper, H. 142D Kytölä, S. 28 Lamatsch, D.K. 189 Larsen, J. 43 Larsson, C. 28 Leach, C.R. 199 Leuders, J. 61 Li, K. 142E Liu, B. 142E Looft, C. 142A Lo´pez-Leo´n, M.D. 325, 338 Lui, W.-O. 28 Lundsteen, C. 43 Ma, L. 91 Machola´n, M. 264 Mandahl, N. 33 Manzanero, S. 386 Martens, G.J.M. 68 Martı´, D.A. 295, 347 Martin, R.H. 39 Maryañska-Nadachowska, A. 210 Masabanda, J. 82, 111 Matsuda, Y. 82, 111 McArdle, L. 49 McDermott, M. 49 Meltzer, P.S. 61 Mendonça, M.N.C. 195 Mertens, F. 33 Mesa, J.A. 338 Mikhaail-Philips, M. 39 Mitchell-Olds, T. 173 Morais-Cecı´lio, L. 320 Moreira-Filho, O. 107, 230 Morrison, K. 61 Mullarkey, M. 49 Nanda, I. 189 Nezamzadeh, R. 142B Nishibori, M. 111 Nishida-Umehara, C. 82, 111

© 2004 S. Karger AG, Basel

Nokkala, C. 394 Nokkala, S. 394 O’Meara, A. 49 Ottzen-Schirakow, G. 142A Page, J. 302 Palestis, B.G. 151 Panagopoulos, I. 33 Parra, M.T. 302 Pazza, R. 107 Pellegrino, K.C.M. 243 Perfectti, F. 325, 338, 376 Phelps-Durr, T.L. 309 Pia´lek, J. 264 Pita, M. 376 Pompolo, S.G. 279, 398 Porto, J.I.R. 195 Puertas, M.J. 386 Rademaker, A. 39 Rahman, F.A. 74 Rebollo, E. 402 Regenhard, P. 142A Remis, M.I. 359 Ribeiro, T. 320 Rigola, M.A. 165 Robbins, C.M. 61 Rocha, C. 184 Rocha-Sanchez, S.M.S. 398 Rosato, M. 295, 386 Rose, H. 43 Roslik, G.V. 271, 289 Rubtsov, D.N. 284 Rubtsov, N.B. 284, 289 Rufas, J.S. 302 Ryan, E. 49

Speer, M.C. 61 Spötter, A. 142D Stallings, R.L. 49 Steinlein, C. 55 Stitou, S. 344 Stojic, J. 74 Suja, J.A. 302 Sun, F. 39 Tavares, M.G. 279 Teruel, M. 325 Thompson, D. 61 Timmis, J.N. 199 Torezan, J.M.D. 184 Tosta, V.C. 279 Trent, J.M. 61 Trivers, R. 151 Trpkov, K. 39 Tsudzuki, M. 82, 111 Tsurusaki, N. 365 van den Hurk, W.H. 68 van Groningen, J.J.M. 68 Vanzela, A.L.L. 184 Viegas, W. 320 Viera, A. 302 Vilardi, J.C. 359 Voigt, M.-L. 173 Vujosˇevic´, M. 247 Wang, B. 91 Wang, Y.F. 142E Weber, B.H.F. 74 Weber, G. 28 Westh, H. 43 Wo´jcik, A.M. 264 Wo´jcik, J.M. 264 Wu, X. 142E Xu, M. 142E

Salvadori, S. 215 Sa´nchez, F.J. 402 Santos, J.L. 302 Schams, G. 55 Schartl, M. 189 Schlupp, I. 189 Schmid, M. 55, 189 Schulz, H.L. 74 Schwartzberg, P.L. 61 Shan, Y. 91 Sharbel, T.F. 173 Shibusawa, M. 82, 111 Shimada, T. 365 Silva, M.J.J. 257 Sood, R. 61 Sˇpakulova´, M. 222

Accessible online at: www.karger.com/cgr

Yerle, M. 142B Yonenaga-Yassuda, Y. 159, 257 Yu, L. 91 Zhang, H. 61 Zhao, S. 91 Zhao, S.H. 142E Zima, J. 264 Zurita, F. 344