Biogeography of the West Indies: Patterns and Perspectives, Second Edition

BIOGEOGRAPHY of the WEST INDIES Patterns and Perspectives

S E C O N D

E D I T I O N

BIOGEOGRAPHY of the WEST INDIES Patterns and Perspectives

S E C O N D

E D I T I O N

Edited by

Charles A. Woods Florence E. Sergile

CRC Press Boca Raton London New York Washington, D.C.

Library of Congress Cataloging-in-Publication Data Biogeography of the West Indies : patterns and perspectives / edited by Charles A. Woods and Florence E. Sergile.—2nd ed. p. cm. Includes bibliographical references and index. ISBN 0-8493-2001-1 (alk. paper) 1. Biogeography—West Indies. 2. Natural history—West Indies. 3. Nature—Effect of human beings on—West Indies. I. Woods, Charles A. (Charles Arthur) II. Sergile, Florence E. QH109.A1 B56 2001 578′.09729—dc21

2001025275 CIP

This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with permission, and sources are indicated. A wide variety of references are listed. Reasonable efforts have been made to publish reliable data and information, but the authors and the publisher cannot assume responsibility for the validity of all materials or for the consequences of their use. Neither this book nor any part may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, microfilming, and recording, or by any information storage or retrieval system, without prior permission in writing from the publisher. All rights reserved. Authorization to photocopy items for internal or personal use, or the personal or internal use of specific clients, may be granted by CRC Press LLC, provided that $1.50 per page photocopied is paid directly to Copyright clearance Center, 222 Rosewood Drive, Danvers, MA 01923 USA. The fee code for users of the Transactional Reporting Service is ISBN 0-8493-2001-1/01/$0.00+$1.50. The fee is subject to change without notice. For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged. The consent of CRC Press LLC does not extend to copying for general distribution, for promotion, for creating new works, or for resale. Specific permission must be obtained in writing from CRC Press LLC for such copying. Direct all inquiries to CRC Press LLC, 2000 N.W. Corporate Blvd., Boca Raton, Florida 33431. Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation, without intent to infringe.

Visit the CRC Press Web site at www.crcpress.com © 2001 by CRC Press LLC No claim to original U.S. Government works International Standard Book Number 0-8493-2001-1 Library of Congress Card Number 2001025275 Printed in the United States of America 1 2 3 4 5 6 7 8 9 0 Printed on acid-free paper

Editors Charles A. Woods is Curator Emeritus at the Florida Museum of Natural History and Adjunct Professor of Zoology at the University of Florida and Adjunct Professor of Biology at the University of Vermont. He is the editor of Biogeography of the West Indies: Past, Present, and Future (1989) and Biodiversity of Pakistan (1997), and the author of many publications on various aspects of systematics, evolution, ecology, and biogeography. His interests in the West Indies have involved work on many islands, and he is currently completing a book on the mammals of the West Indies. He is also interested in the biogeography of sky islands, and has made many extended expeditions into the Himalayas and Hindu Kush and Karakoram ranges. He is completing a book on the mammals of the Western Himalayas. Dr. Woods currently lives on a farm in the mountains of northern Vermont. He is closely associated with the Vermont Leadership Center and the Bear Mountain Natural History Center. Florence E. Sergile is a visiting scientist at the Florida Museum of Natural History and the University of Florida. She is an agronomist with expertise in the fields of natural resource management and environmental education. She has spent much of her career working on the management of natural sites in Haiti. She has taught courses at the undergraduate and graduate levels in Haiti and has worked for USAID, the United Nations, and the World Bank. She was a consultant for the production of the National Environmental Action Plan (NEAP) for Haiti. During the past decade she also served as Director of Haiti-NET, a center for the conservation of the natural patrimony of Haiti. Ms. Sergile received a B.S. in agronomy from the State University of Haiti (Université d’Etat d’Haiti) in 1977 and an M.S. in Latin American studies with a major in natural resources management in 1990. She is pursuing a Ph.D. in environmental education at the University of Florida. One of her major interests is developing educational materials in the areas of conservation biology and environmental education for various target groups in Haiti and the West Indies as a whole.

Contributors Marc W. Allard Department of Biological Sciences The George Washington University Washington, D.C., U.S.A. [email protected]

Jason H. Curtis Department of Geological Sciences University of Florida Gainesville, Florida, U.S.A. [email protected]

Robert J. Asher Division of Vertebrate Paleontology American Museum of Natural History New York, New York, U.S.A. [email protected]

Daryl P. Domning Department of Anatomy Howard University Washington, D.C., U.S.A. [email protected]

Scott D. Baker Department of Biological Sciences The George Washington University Washington, D.C., U.S.A. [email protected]

Stephen K. Donovan Department of Paleontology The Natural History Museum London, U.K. [email protected]

Ross T. Bell Department of Biology University of Vermont Burlington, Vermont, U.S.A. [email protected]

Ginny L. Emerson Department of Biological Sciences The George Washington University Washington, D.C., U.S.A. [email protected]

Rafael Borroto Paéz Instituto de Ecología y Sistemática Havana, Cuba [email protected]

Julio A. Genaro Museo Nacional de Historia Natural Havana, Cuba [email protected]

Mark Brenner Department of Geological Sciences University of Florida Gainesville, Florida, U.S.A. [email protected] Jorge O. de la Cruz Grove Scientific & Engineering Orlando, Florida, U.S.A. [email protected]

Carla Ann Hass Department of Biology Pennsylvania State University University Park, Pennsylvania, U.S.A. [email protected] S. Blair Hedges Department of Biology Pennsylvania State University University Park, Pennsylvania, U.S.A. [email protected]

Donald B. Hoagland Department of Biology Westfield State College Westfield, Massachusetts, U.S.A. [email protected] David A. Hodell Department of Geological Sciences University of Florida Gainesville, Florida, U.S.A. [email protected] G. Roy Horst Department of Biology State University of New York Potsdam, New York, U.S.A. [email protected] Walter S. Judd Department of Botany and University of Florida Herbarium University of Florida Gainesville, Florida, U.S.A. [email protected]

Miriam Marmontel Sociedade Civil Mamirauá Tefé, AM, Brazil [email protected] Linda R. Maxson College of the Liberal Arts University of Iowa Iowa City, Iowa, U.S.A. [email protected] Brian K. McNab Department of Zoology University of Florida Gainesville, Florida, U.S.A. [email protected] Jacqueline Y. Miller Allyn Museum of Entomology Florida Museum of Natural History University of Florida Sarasota, Florida, U.S.A. [email protected]

C. William Kilpatrick Department of Biology University of Vermont Burlington, Vermont, U.S.A. [email protected]

Lee D. Miller Allyn Museum of Entomology Florida Museum of Natural History University of Florida Sarasota, Florida, U.S.A. [email protected]

Thomas H. Kunz Department of Biology Boston University Boston, Massachusetts, U.S.A. [email protected]

Gary S. Morgan New Mexico Museum of Natural History Albuquerque, New Mexico, U.S.A. [email protected]

Lynn W. Lefebvre U.S. Geological Survey Florida Caribbean Science Center Sirenia Project Gainesville, Florida, U.S.A. [email protected] Ross D. E. MacPhee Department of Mammalogy American Museum of Natural History New York, New York, U.S.A. [email protected]

Jose A. Ottenwalder Florida Museum of Natural History University of Florida Gainesville, Florida, U.S.A. [email protected] Roger W. Portell Division of Invertebrate Paleontology Florida Museum of Natural History University of Florida Gainesville, Florida, U.S.A. [email protected]

Pedro M. Pruna Goodgall Smithsonian Institution Academy of Sciences of Cuba Havana, Cuba [email protected]

Howard P. Whidden Department of Biology Augustana College Rock Island, Illinois, U.S.A. [email protected]

Galen B. Rathbun Department of Ornithology and Mammalogy California Academy of Sciences San Francisco, California, U.S.A. [email protected]

Jennifer L. White Department of Biology Augustana College Rock Island, Illinois, U.S.A. [email protected]

James P. Reid Biological Resources Division U.S. Geological Survey Florida Caribbean Science Center Gainesville, Florida, U.S.A. [email protected]

Laurie Wilkins Division of Mammalogy Florida Museum of Natural History Gainesville, Florida, U.S.A. [email protected]

Jonathan Reiskind Department of Zoology University of Florida Gainesville, Florida, U.S.A. [email protected]

Matthew I. Williams Department of Biological Sciences Auburn University Auburn, Alabama, U.S.A. [email protected]

Armando Rodríquez-Durán Department of Natural Sciences Inter-American University of Puerto Rico Bayamón, Puerto Rico [email protected]

Samuel M. Wilson Department of Anthropology University of Texas Austin, Texas, U.S.A. [email protected]

Florence E. Sergile Florida Museum of Natural History University of Florida Gainesville, Florida, U.S.A. [email protected] David W. Steadman Florida Museum of Natural History University of Florida Gainesville, Florida, U.S.A. [email protected] Ana E. Tejuca Museo Nacional de Historia Natural Havana, Cuba [email protected]

Elizabeth S. Wing Division of Zooarchaeology Florida Museum of Natural History Gainesville, Florida, U.S.A. [email protected] Charles A. Woods Florida Museum of Natural History University of Florida Gainesville, Florida, U.S.A. [email protected] and Bear Mountain Natural History Center Island Pond, Vermont, U.S.A. [email protected]

Acronyms and Abbreviations AMNH ATPPF BMNH BSP CM DPUH ECMU FLMNH FMNH GOH GUIA IES/ACC IGPACC IRSB ISPAN IZ JAO MARNDR MCZ MDE MNHNC MNHNH P MOE MPIH MPT MPUM mya NEAP NGO NMW NRM OA PSM rcyrbp RMNH ROUTE 2004 SEC SMF SPNS UF UMMZ UMZC UNDP USAID USNM UWI YPM ZMA ZMUH

American Museum of Natural History, New York Appui Technique à la Protection des Parcs et Forêts British Museum of Natural History Biodiversity Support Program Carnegie Museum of Natural History, Pittsburgh Departamento de Paleontología de la Universidad de la Habana, Escuela de Ciencias Biológicas Environmental Coordination and Monitoring Unit Florida Museum of Natural History, University of Florida, Gainesville Field Museum of Natural History Government of Haiti Geological Institute of the University of Amsterdam Instituto de Ecología y Sistemática, Academia de Ciencias de Cuba Instituto de Geología y Paleontología de la Academia de Ciencias de Cuba Institut Royal des Sciences Naturelles de Belgique, Bruxelles Institut de Sauvegarde du Patrimoine National Instituto de Zoología de la Academia de Ciencias de Cuba Jose A. Ottenwalder, private field collections, Santo Domingo Ministère de l’Agriculture, des Ressources Naturelles et du Développement Rural Museum of Comparative Zoology, Harvard University, Cambridge Ministère de l’Environnement Museo Nacional de Historia Natural, La Habana, Cuba Paleontological collection of the Museo Nacional de Historia Natural, La Habana, Cuba Ministry of the Environment Max-Planck-Institut für Hirnforschung, Frankfurt Most Parsimonious Tree Museum of Paleontology, University of Montana, Missoula Millions of years ago National Environmental Action Plan Nongovernmental organization Naturhistorisches Museum Wien, Wien Naturhistoriska Riksmusset, Stockholm Oscar Arredondo private collection, La Habana, Cuba Puget Sound Museum of Natural History, University of Puget Sound, Tacoma, Washington 14C years before present (i.e., before 1950, the radiocarbon datum) Rijksmuseum van Natuurlijke Historie, Leiden Project Aménagement de la Baie de Caracol à la Riviere du Massacre Sociedad Espeleológica de Cuba Forschungsinstitut und Natur-Museum Senckemberg Service des Parcs Nationaux et des Sites Naturels Florida Museum of Natural History, University of Florida, Gainesville Museum of Zoology, University of Michigan, Ann Arbor University Museum of Zoology, Cambridge, United Kingdom United Nations Development Program United States Agency for International Development National Museum of Natural History, Smithsonian Institution, Washington, D.C. Geology Museum, University of the West Indies, Mona, Jamaica Peabody Museum, Osteological Collection, Yale University Zoological Museum, Institute of Taxonomic Zoology, University of Amsterdam Zoologisches Institut und Zoologisches Museum, Universität Hamburg

Contents Chapter 1

Introduction and Historical Overview of Patterns of West Indian Biogeography ......1 Charles A. Woods

Historical Overview ...........................................................................................................................1 Acknowledgments ..............................................................................................................................6 Literature Cited ..................................................................................................................................8 Conservation Posters........................................................................................................................12 Environmental Education and Activity Books ................................................................................12 General Information.........................................................................................................................13 Conservation Exhibits ......................................................................................................................14

Chapter 2

Biogeography of the West Indies: An Overview .......................................................15 S. Blair Hedges

Introduction ......................................................................................................................................15 West Indian Biota.............................................................................................................................16 Geological History ...........................................................................................................................17 Overwater Dispersal.........................................................................................................................19 Proto-Antillean Vicariance...............................................................................................................21 The Land Bridge Model of MacPhee and Iturralde-Vinent............................................................22 Divergence Times ...................................................................................................................23 Number of Lineages Analyzed...................................................................................23 Mixture of Morphological and Immunological Data ................................................24 Taxa Are Not Discriminated in Terms of Interpretative Significance.......................24 Overrepresentation and Ambiguous Significance of Nonendemics ..........................25 Low Number of Nonendemic Lineages in the Greater Antilles ...............................25 Unknown Shaping Influence of Extinction................................................................25 Water Currents........................................................................................................................26 Inconsistencies and Problems in Model of MacPhee and Iturralde-Vinent..........................28 Evidence against a Mid-Cenozoic Land Bridge....................................................................29 Discussion and Conclusions ............................................................................................................29 Acknowledgments ............................................................................................................................30 Literature Cited ................................................................................................................................30

Chapter 3

Climate Change in the Circum-Caribbean (Late Pleistocene to Present) and Implications for Regional Biogeography............................................................35 Jason H. Curtis, Mark Brenner, and David A. Hodell

Introduction ......................................................................................................................................35 Using Oxygen Isotopes in Freshwater Carbonate Shells to Infer Past Climate.............................37 Determining the Timing of Climate Changes .................................................................................38 Late Pleistocene and Holocene Climate Change in the Circum-Caribbean...................................41 Late Pleistocene Aridity .........................................................................................................41 Early Lake Filling...................................................................................................................42

Earliest Holocene (~10,500 to ~8,500 14C yr BP) ..........................................................................43 Early to Middle Holocene (~8,500 to ~3,000 14C yr BP)...............................................................44 Late Holocene (~3,000 14C yr BP to the Present) ..........................................................................44 Summary of Circum-Caribbean Climate.........................................................................................45 Long-Term Climate Controls .................................................................................................46 Short-Term Climate Controls .................................................................................................48 Nonclimatic Controls..............................................................................................................48 Climate and Biogeography in the Circum-Caribbean.....................................................................49 Summary and Conclusions ..............................................................................................................50 Literature Cited ................................................................................................................................51

Chapter 4

Functional Adaptations to Island Life in the West Indies .........................................55 Brian K. McNab

Introduction ......................................................................................................................................55 The Adjustment of Vertebrates to Island Life .................................................................................56 Was the Fauna of the West Indies Resource Limited? ...................................................................58 Conclusion........................................................................................................................................60 Acknowledgments ............................................................................................................................60 Literature Cited ................................................................................................................................61

Chapter 5

Phylogeny and Biogeography of Lyonia sect. Lyonia (Ericaceae) ...........................63 Walter S. Judd

Introduction ......................................................................................................................................63 Phylogenetic Relationships within Lyonia sect. Lyonia..................................................................65 Biogeographical Investigation..........................................................................................................68 Methods ..................................................................................................................................68 Results ....................................................................................................................................69 Discussion...............................................................................................................................70 Literature Cited ................................................................................................................................74

Chapter 6

Patterns of Endemism and Biogeography of Cuban Insects .....................................77 Julio A. Genaro and Ana E. Tejuca

Introduction ......................................................................................................................................77 Discussion ........................................................................................................................................77 Conclusions ......................................................................................................................................81 Acknowledgments ............................................................................................................................81 Literature Cited ................................................................................................................................81

Chapter 7

Patterns in the Biogeography of West Indian Ticks ..................................................85 Jorge O. de la Cruz

Introduction ......................................................................................................................................85 Materials and Methods.....................................................................................................................85

Host-Group Specificity...........................................................................................................86 Structural Niche......................................................................................................................86 Open Field ..................................................................................................................86 The Nest .....................................................................................................................86 The West Indies Ticks......................................................................................................................87 Distribution and Relationships.........................................................................................................94 The Cosmopolitans.................................................................................................................97 The American Species............................................................................................................97 The Caribbeans.......................................................................................................................97 The North American–Antilleans ............................................................................................98 The West Indies–South Americans ........................................................................................98 The West Indies–Central Americans ......................................................................................98 The Endemics .........................................................................................................................98 Ecological Zoogeography ..............................................................................................................100 Cuba......................................................................................................................................100 The Greater Antilles .............................................................................................................100 The Lesser Antilles...............................................................................................................100 Venezuela and Panama .........................................................................................................100 Peru .......................................................................................................................................100 Madagascar ...........................................................................................................................100 Conclusion......................................................................................................................................103 Acknowledgments ..........................................................................................................................104 Literature Cited ..............................................................................................................................104

Chapter 8

The Contribution of the Caribbean to the Spider Fauna of Florida........................107 Jonathan Reiskind

Introduction ....................................................................................................................................107 Methods..........................................................................................................................................107 Results ............................................................................................................................................108 Potential Sources of the Spider Fauna.................................................................................108 Climatic Constraints .............................................................................................................111 Several Higher Taxa .............................................................................................................112 Discussion and Conclusions ..........................................................................................................112 Literature Cited ..............................................................................................................................113

Chapter 9

Rhysodine Beetles in the West Indies......................................................................117 Ross T. Bell

Introduction ....................................................................................................................................117 Dispersal Mechanisms ...................................................................................................................118 Relationships of West Indian Genera within the World Fauna.....................................................121 Fossil Evidence ..............................................................................................................................122 Interpretations of West Indian Distributions .................................................................................122 Conclusion......................................................................................................................................123 Literature Cited ..............................................................................................................................124

Chapter 10 The Biogeography of the West Indian Butterflies (Lepidoptera): An Application of a Vicariance/Dispersalist Model ................................................127 Jacqueline Y. Miller and Lee D. Miller Introduction ....................................................................................................................................127 Previous Biogeographical Studies of Butterflies...........................................................................128 Endemism of the West Indian Butterfly Fauna .............................................................................130 The Age of Butterflies and Its Biogeographical Implications ......................................................132 Are All Butterflies Effective Dispersalists?...................................................................................134 Current Studies...............................................................................................................................134 The Dispersalists ............................................................................................................................135 A Vicariance/Dispersal Model for the Biogeography of West Indian Butterflies ........................136 Late Mesozoic to Cretaceous ...............................................................................................136 Late Cretaceous to Eocene...................................................................................................138 Oligocene to Pliocene ..........................................................................................................139 Pliocene to Holocene............................................................................................................147 The Lesser Antilles ........................................................................................................................148 Summary ........................................................................................................................................148 Acknowledgments ..........................................................................................................................149 Literature Cited ..............................................................................................................................150

Chapter 11 Relationships and Divergence Times of West Indian Amphibians and Reptiles: Insights from Albumin Immunology........................................................................157 Carla Ann Hass, Linda R. Maxson, and S. Blair Hedges Introduction ....................................................................................................................................157 Materials and Methods...................................................................................................................157 Results ............................................................................................................................................159 Bufonidae..............................................................................................................................159 Hylidae..................................................................................................................................159 Amphisbaenidae ...................................................................................................................161 Anguidae...............................................................................................................................161 Iguanidae...............................................................................................................................162 Teiidae ..................................................................................................................................162 Colubridae.............................................................................................................................163 Tropidophidae.......................................................................................................................163 Typhlopidae ..........................................................................................................................164 Discussion ......................................................................................................................................165 Bufonidae..............................................................................................................................165 Hylidae..................................................................................................................................166 Amphisbaenidae ...................................................................................................................167 Anguidae...............................................................................................................................167 Iguanidae...............................................................................................................................168 Teiidae ..................................................................................................................................168 Colubridae.............................................................................................................................168 Tropidophidae.......................................................................................................................168 Typhlopidae ..........................................................................................................................169 Conclusions ....................................................................................................................................169 Acknowledgments ..........................................................................................................................170 Literature Cited ..............................................................................................................................170 Appendix: Collecting Localities and Voucher Specimens ............................................................172

Chapter 12 The Historic and Prehistoric Distribution of Parrots (Psittacidae) in the West Indies...175 Matthew I. Williams and David W. Steadman Introduction ....................................................................................................................................175 Brief Species Accounts ..................................................................................................................176 Macaws (Ara) .......................................................................................................................176 †Ara tricolor (Bechstein, 1811) — Cuban Macaw .................................................176 †Ara gossei (Rothschild, 1905) — Gosse’s Macaw................................................179 †Ara erythrocephala (Rothschild, 1905) — Red-headed Green Macaw................179 †Ara erythrura (Rothschild, 1907) — Red-tailed Blue-and-Yellow Macaw..........179 †Ara tricolor? or †Ara unknown sp. — Hispaniolan Macaw.................................179 †Ara autochthones (Wetmore, 1937) — St. Croix Macaw .....................................180 †Ara undescribed sp. — Montserrat Macaw ...........................................................180 †Ara guadeloupensis (Clark, 1905a) — Guadeloupe Macaw.................................180 †Ara cf. guadeloupensis — Marie Galante (Guadeloupe?) Macaw .......................181 †Ara atwoodi (Clark, 1908) — Dominica Macaw ..................................................181 †Ara martinica (Rothschild, 1905) — Martinique Macaw.....................................181 Macaws (Anodorhynchus) ....................................................................................................181 †Anodorhynchus purpurascens (Rothschild, 1905) — Guadeloupe Violet Macaw....181 †Anodorhynchus martinicus (Rothschild, 1905) — Martinique Macaw...................181 Parakeets (Aratinga) .............................................................................................................181 Aratinga euops (Wagler, 1832) — Cuban Parakeet ................................................181 †Aratinga chloroptera maugei (Souancé, 1856) — Puerto Rican/Mona Parakeet....182 †Aratinga undescribed sp. — Barbudan Parakeet...................................................182 †Aratinga labati (Rothschild, 1905) — Guadeloupe Parakeet ...............................183 †Aratinga undescribed spp. — Dominica, Martinique, and Barbados Parakeets......183 Parrots or Amazons (Amazona)............................................................................................183 Amazona leucocephala hesterna (Cory, 1886) — Cayman Parrot .........................183 Amazona leucocephala bahamensis (Bryant, 1867) — Rose-throated (Bahamas) Parrot.......................................................................................183 †Amazona undescribed sp. — Turks and Caicos Parrot .........................................183 †Amazona vittata gracilipes (Ridgway, 1915) — Culebra Parrot ..........................183 †Amazona vittata — Barbuda (Puerto Rican) Parrot ..............................................183 †Amazona vittata — Antigua (Puerto Rican) Parrot...............................................185 †Amazona undescribed sp. — Montserrat Parrot ....................................................185 †Amazona violacea (Gmelin, 1788) — Guadeloupe Parrot....................................185 †Amazona cf. violacea — Guadeloupe Parrot?.......................................................185 †Amazona martinicana (Clark, 1905c) — Martinique Parrot.................................186 ?Amazona versicolor (Müller, 1776) — St. Lucia Parrot .......................................186 †Amazona undescribed sp. — Grenada Parrot ........................................................186 Conclusions ....................................................................................................................................187 Acknowledgments ..........................................................................................................................187 Literature Cited ..............................................................................................................................187

Chapter 13 Early Tertiary Vertebrate Fossils from Seven Rivers, Parish of St. James, Jamaica, and Their Biogeographical Implications..................................................................191 Roger W. Portell, Stephen K. Donovan, and Daryl P. Domning Introduction ....................................................................................................................................191 Jamaican Tectonics and Paleogeography.......................................................................................192

Locality and Vertebrate Fauna .......................................................................................................194 Discussion ......................................................................................................................................196 Acknowledgments ..........................................................................................................................198 Literature Cited ..............................................................................................................................198

Chapter 14 The Sloths of the West Indies: A Systematic and Phylogenetic Review................201 Jennifer L. White and Ross D. E. MacPhee Introduction ....................................................................................................................................201 Brief Overview of Megalonychid Discoveries in the West Indies ...............................................202 Higher-Level Relationships............................................................................................................205 Cladistic Analysis...........................................................................................................................206 Data Set ................................................................................................................................206 Results ..................................................................................................................................207 Systematics.....................................................................................................................................210 Subfamily Choloepodinae Gray ...........................................................................................212 Tribe Acratocnini Varona .....................................................................................................213 Choloepodinae incertae sedis ..............................................................................................216 Tribe Cubanocnini Varona....................................................................................................217 Subfamily Megalocninae Kraglievich..................................................................................220 Tribe Megalocnini Kraglievich ............................................................................................220 Tribe Mesocnini Varona .......................................................................................................222 Megalonychidae, incertae sedis ...........................................................................................224 Megalonychidae, gen. et sp. indet........................................................................................225 Biogeographical Issues ..................................................................................................................225 Colonization of the Antilles .................................................................................................226 Distribution of Fauna across Islands....................................................................................227 Acknowledgments ..........................................................................................................................228 Literature Cited ..............................................................................................................................228 Note Added in Proof ......................................................................................................................232 Appendix I: Characters and Character States ...............................................................................233 Appendix II: List of Taxa Used in Cladistic Analysis..................................................................235 Outgroup Taxa ......................................................................................................................235 Extant Ingroup Taxa .............................................................................................................235 Extinct Ingroup Taxa ............................................................................................................235

Chapter 15 The Origin of the Greater Antillean Insectivorans ..................................................237 Howard P. Whidden and Robert J. Asher Introduction ....................................................................................................................................237 Recent Phylogenetic Studies..........................................................................................................238 Molecular Evidence..............................................................................................................238 Morphological Evidence ......................................................................................................239 Biogeographical Hypotheses..........................................................................................................243 McDowell (1958) .................................................................................................................246 Patterson (1962)....................................................................................................................246 Hershkovitz (1972) ...............................................................................................................246 MacFadden (1980)................................................................................................................247 The Land Span Hypothesis ..................................................................................................247

Conclusions ....................................................................................................................................248 Acknowledgments ..........................................................................................................................249 Literature Cited ..............................................................................................................................250

Chapter 16 Systematics and Biogeography of the West Indian Genus Solenodon ...................253 Jose A. Ottenwalder Introduction ....................................................................................................................................253 Evolutionary Relationships of West Indian Insectivores...............................................................254 Historical Surveys of the Solenodontidae .....................................................................................256 Materials and Methods...................................................................................................................257 Results ............................................................................................................................................261 Nongeographical Variation ...................................................................................................261 Variation with Age....................................................................................................261 Secondary Sexual Variation......................................................................................261 Individual Variation ..................................................................................................268 Specific Relationships (Geographical Variation) .................................................................268 Univariate Analyses ..................................................................................................268 Multivariate Analyses ...............................................................................................287 Variation in Cranial Morphology .........................................................................................290 Taxonomic Conclusions .......................................................................................................293 Systematic Accounts ......................................................................................................................294 Solenodon paradoxus ...........................................................................................................294 Solenodon cubanus...............................................................................................................302 Solenodon arredondoi ..........................................................................................................306 Solenodon marcanoi .............................................................................................................308 Late Quaternary and Recent Distribution of Solenodon ...............................................................315 Material and Methods ..........................................................................................................315 Results ............................................................................................................................................316 Solenodon paradoxus ...........................................................................................................316 Solenodon cubanus...............................................................................................................317 Solenodon marcanoi .............................................................................................................319 Solenodon arredondoi ..........................................................................................................319 Discussion ......................................................................................................................................320 Acknowledgments ..........................................................................................................................324 Literature Cited ..............................................................................................................................325

Chapter 17 Characterization of the Mitochondrial Control Region in Solenodon paradoxus from Hispaniola and the Implications for Biogeography, Systematics, and Conservation Management ................................................................................331 Marc W. Allard, Scott D. Baker, Ginny L. Emerson, Jose A. Ottenwalder, and C. William Kilpatrick Introduction ....................................................................................................................................331 Materials and Methods...................................................................................................................332 Results and Discussion ..................................................................................................................332 Acknowledgments ..........................................................................................................................334 Literature Cited ..............................................................................................................................334

Chapter 18 Insular Patterns and Radiations of West Indian Rodents ........................................335 Charles A. Woods, Rafael Borroto Paéz, and C. William Kilpatrick Introduction ....................................................................................................................................335 Materials and Methods...................................................................................................................338 Morphological Analysis........................................................................................................338 Molecular Analysis (Cytochrome b Gene) ..........................................................................341 Specimens Examined................................................................................................341 DNA Sequencing......................................................................................................341 Sequence Analysis ....................................................................................................342 Results ............................................................................................................................................342 Discussion ......................................................................................................................................343 Implications of Sequencing Data on Biogeographical and Evolutionary Hypotheses.................347 Summary of West Indian Evolutionary History and Biogeography of Rodents ..........................349 Acknowledgments ..........................................................................................................................351 Literature Cited ..............................................................................................................................352

Chapter 19 Biogeography of West Indian Bats: An Ecological Perspective .............................355 Armando Rodríguez-Durán and Thomas H. Kunz Introduction ....................................................................................................................................355 Biogeography of Antillean Bats ....................................................................................................355 Geography and Species ........................................................................................................355 Routes of Invasion................................................................................................................358 The Western Route ...................................................................................................358 The Northern Route..................................................................................................358 The Southern Route..................................................................................................359 Patterns in Bat Communities .........................................................................................................359 Body Size and Diet ..............................................................................................................360 Roosts ...................................................................................................................................360 Activity .................................................................................................................................362 Community Structuring..................................................................................................................364 Acknowledgments ..........................................................................................................................366 Literature Cited ..............................................................................................................................366

Chapter 20 Patterns of Extinction in West Indian Bats..............................................................369 Gary S. Morgan Introduction ....................................................................................................................................370 Methods and Materials...................................................................................................................370 West Indian Fossil Chiropteran Faunas .........................................................................................375 Cuba......................................................................................................................................375 Isla de Pinos .............................................................................................................376 Jamaica .................................................................................................................................376 Hispaniola .............................................................................................................................377 Ile de la Gonâve .......................................................................................................377 Puerto Rico ...........................................................................................................................378 Bahamas................................................................................................................................378 Abaco........................................................................................................................378 Andros.......................................................................................................................379 Exuma .......................................................................................................................380

New Providence........................................................................................................380 Grand Caicos ........................................................................................................................380 Cayman Islands ....................................................................................................................381 Grand Cayman..........................................................................................................381 Cayman Brac ............................................................................................................382 Lesser Antilles ......................................................................................................................382 Anguilla ....................................................................................................................382 Antigua .....................................................................................................................382 Barbuda.....................................................................................................................383 Taxonomic and Zoogeographical Review of West Indian Fossil Bats .........................................383 Family Noctilionidae ............................................................................................................383 Noctilio .....................................................................................................................383 Family Mormoopidae ...........................................................................................................383 Mormoops .................................................................................................................383 Pteronotus .................................................................................................................384 Family Phyllostomidae .........................................................................................................386 Subfamily Phyllostominae........................................................................................386 Macrotus....................................................................................................386 Tonatia.......................................................................................................387 Subfamily Brachyphyllinae ......................................................................................387 Brachyphylla..............................................................................................387 Subfamily Phyllonycterinae .....................................................................................388 Erophylla ...................................................................................................388 Phyllonycteris............................................................................................388 Subfamily Glossophaginae.......................................................................................389 Glossophaga..............................................................................................389 Monophyllus ..............................................................................................389 Subfamily Stenodermatinae......................................................................................389 Artibeus .....................................................................................................389 Stenoderma Group: Ardops/Ariteus/Phyllops/Stenoderma ......................................389 Subfamily Desmodontinae .......................................................................................390 Desmodus ..................................................................................................390 Family Natalidae ..................................................................................................................391 Natalus ......................................................................................................391 Nyctiellus ...................................................................................................391 Family Vespertilionidae ........................................................................................................393 Antrozous...................................................................................................393 Eptesicus....................................................................................................393 Lasiurus .....................................................................................................393 Myotis ........................................................................................................393 Family Molossidae ...............................................................................................................394 Molossus....................................................................................................394 Nyctinomops ..............................................................................................394 Tadarida ....................................................................................................394 Chiropteran Extinctions in the West Indies...................................................................................394 Causes of Extinctions ...........................................................................................................394 Island Extinction Patterns ..............................................................................................................398 Bahamas................................................................................................................................398 Cayman Islands ....................................................................................................................401 Greater Antilles.....................................................................................................................401 Northern Lesser Antilles ......................................................................................................402

Bat Extinctions Elsewhere in the Neotropics and in Florida........................................................402 Distributional Patterns....................................................................................................................403 Acknowledgments ..........................................................................................................................404 Literature Cited ..............................................................................................................................405

Chapter 21 The Mongoose in the West Indies: The Biogeography and Population Biology of an Introduced Species ..........................................................................................409 G. Roy Horst, Donald B. Hoagland, and C. William Kilpatrick Introduction ....................................................................................................................................409 Biogeography .................................................................................................................................410 History of Introduction.........................................................................................................410 Current Distribution .......................................................................................................................412 Population Biology ........................................................................................................................413 Methods ................................................................................................................................413 Sex Ratio and Age Distribution.....................................................................................................416 Population Densities and Habitat Use ...........................................................................................418 Summary and Conclusions ............................................................................................................421 Acknowledgments ..........................................................................................................................422 Literature Cited ..............................................................................................................................422

Chapter 22 Status and Biogeography of the West Indian Manatee ...........................................425 Lynn W. Lefebvre, Miriam Marmontel, James P. Reid, Galen B. Rathbun, and Daryl P. Domning Introduction ....................................................................................................................................425 Historical Distribution....................................................................................................................426 Present Distribution, Status, and Habitat Associations .................................................................428 West Indies ...........................................................................................................................428 Puerto Rico ...............................................................................................................428 Jamaica .....................................................................................................................431 Dominican Republic.................................................................................................432 Haiti ..........................................................................................................................434 Cuba..........................................................................................................................434 Bahamas....................................................................................................................435 Central America....................................................................................................................437 Belize ........................................................................................................................437 Guatemala .................................................................................................................439 Honduras...................................................................................................................440 Nicaragua..................................................................................................................440 Costa Rica.................................................................................................................441 Panama......................................................................................................................442 South America ......................................................................................................................444 Colombia...................................................................................................................444 Venezuela..................................................................................................................444 Trinidad.....................................................................................................................447 Guyana......................................................................................................................447 Suriname ...................................................................................................................448 French Guiana ..........................................................................................................449

Brazil.........................................................................................................................449 North America ......................................................................................................................451 United States.............................................................................................................451 Mexico ......................................................................................................................456 Biogeographical Patterns of Trichechus ........................................................................................459 Conclusions ....................................................................................................................................461 Acknowledgments ..........................................................................................................................463 Literature Cited ..............................................................................................................................463

Chapter 23 Historical Biogeography in Cuba: 19th-Century Interpretations and Misinterpretations ..............................................................................................475 Pedro M. Pruna Goodgall Introduction ....................................................................................................................................475 Enhancing the New World Image..................................................................................................476 Summary ........................................................................................................................................478 Literature Cited ..............................................................................................................................478

Chapter 24 Native American Use of Animals in the Caribbean ................................................481 Elizabeth S. Wing Introduction ....................................................................................................................................481 Material and Methods ....................................................................................................................482 Results ............................................................................................................................................490 Terrestrial Component of West Indian Faunal Samples................................................................490 Native Terrestrial Species.....................................................................................................490 Introduced Domestic and Captive Species ..........................................................................493 European Introductions ........................................................................................................495 Aquatic Marine Component of West Indian Faunal Samples.......................................................495 Coral Reef Habitats ..............................................................................................................497 Marine Species Living in Inshore, Estuarine, and Pelagic Waters .....................................499 Total Aquatic Fauna .......................................................................................................................503 Conclusions ....................................................................................................................................504 Land Vertebrates and Invertebrates ......................................................................................510 Captive and Domestic Animals............................................................................................512 Aquatic Fauna.......................................................................................................................514 Acknowledgments ..........................................................................................................................516 Literature Cited ..............................................................................................................................516

Chapter 25 The Prehistory and Early History of the Caribbean................................................519 Samuel M. Wilson Introduction ....................................................................................................................................519 Saladoid Migrations .......................................................................................................................521 Post-Saladoid Changes...................................................................................................................522 European Conquest ........................................................................................................................523 After the Arrival of Europeans ......................................................................................................524 Indigenous Legacies in the Caribbean...........................................................................................525 Literature Cited ..............................................................................................................................525

Chapter 26 Impact of Hunting on Jamaican Hutia (Geocapromys brownii) Populations: Evidence from Zooarchaeology and Hunter Surveys..............................................529 Laurie Wilkins Introduction ....................................................................................................................................529 The Bellevue Site...........................................................................................................................531 Methods..........................................................................................................................................531 Measurements of a Known-Age Sample of Hutias .............................................................531 Zooarchaeological Sample ...................................................................................................532 Hunter Survey.......................................................................................................................533 Results ............................................................................................................................................535 Known-Age Sample .............................................................................................................535 Zooarchaeological Sample ...................................................................................................535 Hunter Survey.......................................................................................................................538 Discussion ......................................................................................................................................538 Captive Breeding Arguments ...............................................................................................539 Age-Frequency Distribution .................................................................................................540 High-Density Populations ....................................................................................................540 Island Size and Structural Complexity ................................................................................541 Sustainable Hunting..............................................................................................................541 Theoretical Constraints.........................................................................................................541 Optimal Foraging..................................................................................................................542 Acknowledgments ..........................................................................................................................543 Literature Cited ..............................................................................................................................543

Chapter 27 Status of Conservation in Haiti: A 10-Year Retrospective......................................547 Florence E. Sergile and Charles A. Woods Introduction ....................................................................................................................................547 Physiography of Haiti ....................................................................................................................547 Biodiversity in Haiti.......................................................................................................................549 Threat to Biodiversity ....................................................................................................................549 Conservation Efforts ......................................................................................................................550 Biodiversity Conservation Strategy......................................................................................551 The NEAP ............................................................................................................................551 Protected Areas.....................................................................................................................552 Conservation Education........................................................................................................552 Management Plans................................................................................................................554 Nongovernmental Organizations ..........................................................................................554 Lessons Learned.............................................................................................................................554 Conclusions ....................................................................................................................................557 Acknowledgments ..........................................................................................................................557 Literature Cited ..............................................................................................................................558 Activity Materials...........................................................................................................................559 Conservation Posters......................................................................................................................560

Index ..............................................................................................................................................561

Map of the West Indies

and Historical 1 Introduction Overview of Patterns of West Indian Biogeography Charles A. Woods In 1989, I edited a book, Biogeography of the West Indies: Past, Present, and Future, based on a symposium held at the University of Florida March 2–5, 1987. This volume included contributions from 50 colleagues, and I attempted to make the book as comprehensive as possible. The book sold out quickly and has been out of print for many years. We discussed reprinting the book because demand has remained great; however, the field of West Indian biogeography is changing so rapidly, especially with the widespread use of molecular systematics and the availability of new fossil evidence, that a simple revision of the original volume seemed a missed opportunity. I decided instead to completely revise and reorganize the original volume into a new book with many new contributions. A few of the original chapters, such as the chapters on West Indian manatees, West Indian butterflies, and the status of introduced mongoose, remain, although they have been extensively revised and modified. The authors of these chapters are the leading authorities on their subjects and the sources of most of the recent contributions in their fields. However, in almost all other cases new chapters and new contributors are included. The original volume attempted to cover as many disciplines as possible and to provide an overview of the biogeography of the West Indies. I have chosen not to follow the same strategy in the new volume. So many new contributions have been made to the field in the last 10 years that it is impossible to cover all of them adequately in one volume. The first book was 878 pages in length, and an even larger volume seemed unworkable. Recent contributions in the area of tectonics (see Iturralde-Vinent and MacPhee, 1999) make some topics redundant, and the comprehensive review by Hedges on the historical biogeography of West Indian vertebrates (1996) touches on many concepts. Therefore, I have decided to make this new volume more focused, and to concentrate on fewer overall topics; the emphasis of the book is on “patterns.” It is hoped that the volume will pull together some of the more interesting patterns and trends in West Indian biogeography, and serve as a stimulus to future research as well as a source book on West Indian biogeography. I apologize to the many colleagues and students who have contacted me over the years hoping that we would reissue or revise the original volume. That volume was produced with the assistance of my friend and colleague, Dr. Ross Arnett, Jr., who died in 1999. It is a compliment to Ross’ skills as a publisher that the book was so attractive and has remained so sought after.

HISTORICAL OVERVIEW The original great contributors to West Indian biogeography were Glover M. Allen (1911), Harold E. Anthony (1916), Thomas Barbour (1914), and W. D. Matthew (1915). These biologists began the systematic study of the biogeography of the West Indies. Great contributions were also made by Dr. William L. Abbott, who made extensive collections of vertebrates in remote regions of Hispaniola (1916–1923) in addition to his collecting activities in other remote regions of the world,

0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

1

2

Biogeography of the West Indies: Patterns and Perspectives

such as the Himalayas. Most of these specimens are at the Smithsonian. Dr. Erik L. Ekman collected plants in Cuba, Haiti, and the Dominican Republic. The collections by Abbott and by Ekman led to the descriptions of many new species, and brought to light the realization of how diverse the flora and fauna of the West Indies are, with pockets of endemism occurring even on the same islands. The collections, field notes, and published works of these biologists provided the first attempts to formulate theories on the biogeography of the West Indies. Erik Ekman is remembered mainly for the plants that he collected, but he also wrote with humor and insight about his travels and experiences (1926, 1928). His personal correspondence and field notes in the archives in Stockholm are full of valuable information on the biogeography of the region. Ekman died in Santiago, Dominican Republic, on January 15, 1931 of complications following a severe attack of malaria. He is buried in Santiago de los Caballeros, where a monument to his memory in the Plaza Valerio is frequently visited by biologists and even tourists. Ekman (born in 1883 in Stockholm) received his Ph.D. in 1913 from the University of Lund in Sweden with a thesis on West Indian Vernonia (Ekman, 1914). That same year the famous German botanist Ignacio Urban of the Museum and Botanical Garden in Berlin convinced Dr. C. Lindman of the Imperial Museum of Stockholm to allow fellowship money to be used to support Ekman on a plant-collecting trip to Hispaniola. Ekman persuaded Lindman to allow him to stop first in Cuba to collect specimens and data on Vernonieae. Ekman arrived in Cuba in April 1914 and became fascinated with the island. He moved on to Hispaniola only after Urban threatened to cut off his funding. He made a brief trip to Haiti between May and September 1917. He collected over 3,000 plant specimens on that trip, but he missed Cuba and was plagued by fevers. He did not return to Haiti until 1924. During his years in Cuba he collected over 100,000 plant specimens including over 1,000 species previously unknown to Cuba. Professor Urban described 850 of these as new species. After returning to Hispaniola in 1924 Ekman worked throughout Haiti and the Dominican Republic, including the offshore islands of Navassa (Ekman, 1929a), Tortue (Ekman, 1929b), and Gonâve (Ekman, 1930a) collecting many species of plants and even a number of birds. For example, in the Dominican Republic he is reported to have collected 15,467 spermatophytes, 16,500 Pteridophytes, and 107 birds. Soon after the death of Ekman the well-known Danish fern specialist C. Christensen wrote a letter indicating that Ekman’s collection of 500 fern species from Hispaniola, 50 of which were new species, represented the largest and most complete collection of ferns from any location in the tropics. Ekman was a well-known figure in Hispaniola, and was the subject of a number of newspaper articles. He was even the subject of a chapter (“Portrait of a Scientist”) in the book The Magic Island by W.B. Seabrook (1929). Ekman greatly influenced James Bond, and was the subject of a chapter (“Basic Training”) in a book by Bond’s wife Mary Bond (1971). Ekman lived frugally (his entire support for 16 years of fieldwork was only about $14,000), and when he was not in the field, he frequently stayed with friends, such as the family of Wilhelm Buch, a pharmacist, in Port-auPrince. When he was in the field he often stayed with peasants and campesinos. The important specimens collected by Ekman form the bulk of the herbarium at the Ministry of Agriculture in Haiti (Damien), and they are an important contribution to the Botanical Garden in Santo Domingo. The specimens, papers, and photographs that Ekman left behind with the Buch family were bought by Dr. George Proctor of the Institute of Jamaica following the death of Wilhelm Buch. Ekman’s field books (“Dagbok”), journals, and personal correspondence are in Stockholm at the Academy of Sciences. I made photocopies of most of this material, which is available at the Herbarium of the University of Florida. In addition to his collections of plants, Ekman collected hundreds of bird specimens and made important notes on Solenodon and Plagiodontia. There is an excellent account of the life of Ekman by Hermano Alain (1954), also known as Dr. Alain H. Liogier, who went on to become the Director of the National Botanical Garden of the Dominican Republic. Publications by Ekman on his work in Haiti (1929a, 1929b, 1930a) and the Dominican Republic (1929c, 1930b) include valuable lists of plants and geographical observations.

Introduction and Historical Overview of Patterns of West Indian Biogeography

3

An extremely valuable review and compilation of the history of the biological investigation of the West Indies can be found in the work of David K. Wetherbee. Few authors have made more significant contributions to the historical record of biological exploration and comparative biology of any region of the world. For example, Wetherbee (1985) in his survey of the historical development of comparative zoology in the West Indies documents the identities of almost all collectors of vertebrate-type specimens in the West Indies up to 1850. Some of Wetherbee’s more valuable contributions include a biogeographical analysis (1989c) and book-length monographs on the zoological exploration of the following countries or regions of the West Indies: Dominican Republic (1986a), Haiti (1985b), Puerto Rico (1986b), the Lesser Antilles (1986c), Cuba (1985c), the Bahamas (1985d), and Jamaica (1985e). These large volumes, in addition to large volumes on the early history of botany in Hispaniola and Puerto Rico (1985a) and additional shorter works on St. Croix (1984), the Dominican Republic (1991c), Central America (1985f ), Hispaniola (1987a, 1988a), and more focused contributions on mollusks (1987d), beetles (1985h), butterflies and moths (1985i, 1987b, 1987c, 1988b, 1989b, 1991a, 1991b), scorpions (1989d), dragonflies (1989e), decapods (1989a), birds (1986d, 1988c), and fishes (1987e, 1988d, 1989f ), form a valuable record of historical explorations of the Caribbean as well as important original observations on West Indian natural history. His unpublished contributions represent a gold mine of information for biogeographers and systematic biologists working in the West Indies (see Wetherbee in the Literature Cited section). Dr. Ernest Williams and I had frequent conversations about the tremendous importance of Wetherbee’s contributions despite the lack of peer review or availability in widely read journals. Wetherbee’s works were “published” as Xeroxed manuscripts, “Copyright by David K. Wetherbee, Shelburne, Massachusetts,” with a date. They are available in a few major libraries, the best collection of which is in the Museum of Comparative Zoology at Harvard where Wetherbee maintained a long association. Wetherbee lived for most of his later years in the small and remote village of Restauracion in the Cordillera Central in the Dominican Republic, not far from the border with Haiti. In his 1985 summary of species types, Wetherbee explains his views on the status of his works. Their publication by xerography is viewed by the author as a medium for soliciting the editorial review that he was unable to find. It is hoped that publication (perhaps by co-authorships) of this material, in second editions, with adequate editorial review, might come to pass. Cooperation is invited.

I have great admiration for Wetherbee’s contributions, which are often overlooked by biologists and biogeographers interested in the Caribbean area. I hope that his works are not lost from the historical record, and that is why I have outlined them in some detail in this introduction. The final “publication” I have seen by Wetherbee is a 465-page tome (1996) on decapods in Hispaniola and 20 other contributions on the fauna of Hispaniola. It concludes with a complete bibliography of Wetherbee’s works. Wetherbee died soon after completing the 1996 tome, and before receiving acknowledgment of the importance of his work on the West Indies. He was about 76 years old when he died, and he had chosen a simple life in a tiny country house with a dirt floor (Andrei Sourakov, personal communication). It was a long way from Harvard, where he had once been a young curator of the bird collection. This eccentric but important contributor to West Indian natural history deserves to be remembered. The advancement of biogeographical and systematic studies in particular regions of the West Indies has often been associated with political or important historical events. For example, the occupation of Haiti by the U.S. Marines (1915–1934), and the building of programs in agriculture modeled after the ones in place in the United States, provided an ideal opportunity for a number of American biologists to work in Haiti during the 1920s and 1930s. During this period Philip Darlington (1935) journeyed to the top of Pic Macaya (October 1934); James Bond began a series of extensive field trips in the Massif de la Selle and other important regions of Haiti in 1927–1928; Gerrit S. Miller, Jr. (1930) and his associates from the Smithsonian collected fossil mammals

4

Biogeography of the West Indies: Patterns and Perspectives

throughout Hispaniola; Erik Ekman made his greatest botanical discoveries; and Alexander Wetmore traveled to some of the most remote reaches of Hispaniola. There is a fine historical review of early biological work in the Greater Antilles (especially Hispaniola) in Wetmore and Swales (1931). The plant and animal collections made during this period were deposited in museums in Berlin, Hamburg, and Leiden, as well as the Philadelphia Academy of Natural Sciences, the Harvard Museum of Comparative Zoology, and the Smithsonian Institution. More recently the United States took a second active role in the activities in Haiti. This began as an intense effort by the U.S. Agency for International Development (USAID) to promote biological conservation in Haiti and to protect watersheds. It was also a time of substantial financial support by the MacArthur Foundation of intense work in conservation and biodiversity in Haiti, Jamaica, and St. Lucia. The work led to the establishment of three national parks in Haiti, and to the collection of many specimens (Woods and Ottenwalder, 1992; Woods et al., 1992). Some of the contributions to the biogeography of the West Indies reported in Woods (1989a) and in this volume are based on these specimens and activities. These activities formed the basis for a national environmental action plan for Haiti (NEAP) and for a series of four widely distributed conservation posters featuring Hispaniolan plants and animals as well as a series of workbooks in French and Creole (see Chapter 27 by Sergile and Woods, this volume, and the list of conservation posters in the Literature Cited section of this introduction). This second spurt in biological activity ended with the political chaos of the U.S. embargo of Haiti. The events that have followed the embargo have not made most biological efforts in Haiti attractive to large numbers of biologists. These spurts in biological attention and the associated collections form the cornerstone of our present understanding of the flora and fauna of the Antilles. The analyses of these and other collections led to the first great syntheses of West Indian biogeography, such as the works of Darlington (1938, 1957) and Simpson (1940, 1943, 1956). The standard reference on the geologic history of the West Indies at the time was Schuchert (1935), who viewed the islands of the West Indies as having been relatively stable in geographical position throughout the Cenozoic. Rapid advances in our understanding of the geological history of the West Indies were made in the 1950s and 1960s. These revelations about the dynamic geological history of the Antilles led to bold new syntheses. The work by Rosen (1976) created a controversy as to how and when organisms dispersed from island to island, and what role plate tectonics played in biogeography. Biologists and geologists began to read one another’s papers with a keen interest as they searched for further evidence on the history of the Antilles. The results of the geological data are summarized in Pindell and Dewey (1982), while Pregill (1981a), Hedges (1982, 1996), and Iturralde-Vinent and MacPhee (1996, 1999) discuss the importance of the recent studies in plate tectonics to West Indian biogeography. Rosen (1985) made a second attempt to synthesize data from geology and biology into patterns that might explain West Indian biogeography. In addition, new collections of organisms from all regions of the Antilles began to bring to light new taxa of striking importance. The works of Olson (1976) on birds, Pregill (1981b) on reptiles, and Iturralde-Vinent and MacPhee (1996) on mammals suggest that the history of some vertebrates in the Antilles may be more ancient than previously anticipated. This hypothesis is supported by the findings of Roger Portell and his associates (see Chapter 13, this volume). The recent finding of fossil frogs, reptiles, and mammalian hair in amber from the Dominican Republic further supports these hypotheses (Poinar and Cannatella, 1987; Poinar and Poinar, 1999). Most importantly, a series of new biochemical techniques and the more widespread use of cladistics have made possible more rigorous testing of the various hypotheses on West Indian biogeography. For example, Hedges (1996) suggests a more recent radiation of herps in the West Indies based on his analysis of molecular data. During the past decade a similar pulse of activity has taken place in Cuba via a working agreement between the American Museum of Natural History in New York and the National Museum of Natural History in Cuba. A number of publications, many from the American Museum, have added significant new analyses based on new and old collections. Interpretations of this new material have resulted in new ideas on the flora and fauna of the region, on the time and rate of extinction of West Indian

Introduction and Historical Overview of Patterns of West Indian Biogeography

5

mammals, and on the tectonics of the Caribbean region (see MacPhee et al., 1989, 1999, 2000; MacPhee and Fleagle, 1991; Salgada et al., 1992; Biknevicius et al., 1993; MacPhee, 1993; MacPhee and Iturralde-Vinent, 1994, 1995a, 1995b; Iturralde-Vinent and MacPhee, 1996, 1999; MacPhee and Grimaldi, 1996; MacPhee and Rivero de la Calle, 1996; McFarlane et al., 1998a; 1998b; Queiroz et al., 1998; Flemming and MacPhee, 1999; Higuera-Gundy et al., 1999). The focal paper in this series of publications is the analysis of the paleogeography of the Caribbean region by Iturralde-Vinent and MacPhee (1999). They propose that the Aves Ridge was largely or totally emergent (= “subaerial”) during the latest Eocene/Early Oligocene (33 to 35 myBP). This would have formed a long peninsula or series of closely associated large islands including parts of the Virgin Islands, Puerto Rico, Hispaniola, and Cuba. They designate this large closely associated landmass “GAARlandia” (Greater Antilles + Aves Ridge), and propose that it could have provided the opportunity (and route) for the invasion of the Antilles by mammals and other organisms. Their model proposes island-to-island vicariance rather than continent/island vicariance as proposed by Rosen (1976, 1985) or overwater dispersal as proposed by Hedges (1996). This hypothesis forms the basis of much discussion, and also the opportunity to test the hypothesis using molecular systematics and the analysis of new fossil discoveries. If Iturralde-Vinent and MacPhee are correct, less divergent forms should be found in the western Greater Antilles (Puerto Rico and Hispaniola) and the more derived forms in Cuba. In the case of rodents, I have previously proposed that the center of rodent diversity was in Hispaniola and Puerto Rico (1989:774) and that the Aves Ridge may have been associated with the invasion of rodents into the Antilles from South America (Woods, 1990:659). Recent work on molecular systematics (see Chapter 18, this volume) supports this hypothesis, as do indications that Hispaniola may be a hot spot of biodiversity in the Caribbean (Hedges and Woods, 1993) and that mammalian diversity is high on Puerto Rico as well as Hispaniola (Woods, 1996). The status of West Indies rodents is revised in Woods (1989a, 1989b, 1989c, 1990) and Iturralde-Vinent and MacPhee (1996). The important hypothesis by Iturralde-Vinent and MacPhee will spawn many other comparisons, and will be the basis for many of the biogeographical analyses during the coming decade. The above publications represent the new wave of research and exploration in the West Indies. Many of these ideas are discussed in various chapters in this volume, which also includes the almost incredible new findings of ancient mammals in Jamaica (see Chapter 13, this volume). It also includes chapters on the biogeography of frequently overlooked creatures such as rhysodine beetles, insects found deep inside tree trunks and forest debris (see Chapter 9, this volume), butterflies (see Chapter 10, this volume), and West Indian plants (see Chapter 5, this volume). I also decided to include chapters by former graduate students at the University of Florida who have written dissertations on the mammals of the West Indies. Laurie Wilkins’ important study on the status of Geocapromys in Jamaica following a well-planned reintroduction coordinated by the Jersey Wildlife Preservation Trust and the University of Florida (see Chapter 26, this volume) complements the unpublished dissertation of Kevin Jordan on the Bahamian hutia (not represented in this volume). Together these two works represent a unique analysis of what happens on remote Caribbean islands when animals are introduced or “re-introduced,” as the case may be, and provide a broad-based comparison of large island vs. small island biogeography and biodiversity. The book also includes a comprehensive chapter by Jose Ottenwalder on the systematics, biogeography, and conservation of the enigmatic West Indian insectivores of the genus Solenodon (see Chapter 16, this volume). The distribution and history of Solenodon in the West Indies represents one of the most interesting conundrums in West Indian biogeography, and Ottenwalder’s contributrion is the most comprehensive analysis of this group to be published to date. A companion chapter on the smaller Antillean insectivores of the genus Nesophontes by Whidden and Asher represents an opportunity to compare and contrast these two genera (see Chapter 15, this volume). White and MacPhee pull together the biogeography of the now extinct West Indian sloths, a group that was clouded in an almost impenetrable taxonomic quagmire until this work (see Chapter 14, this volume). There are two papers on bats, a group reflecting some of the most interesting insular

6

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 1 David Klingener curating the University of Massachusetts Mammal Collection, which he did with pride and devotion.

patterns in the West Indies. Molecular systematics is used to reexamine the patterns of adaptive radiation in West Indian rodents, especially of the family Capromyidae (see Chapter 18, this volume). An intriguing short chapter by Pedro Pruna examines the historical interpretation of ground sloths and primates in Cuba in the context of the 19th-century version of biogeology and nationality (see Chapter 23, this volume). I have tried to make the book as taxonomically broad-based as possible; however, it clearly represents my interests as a mammalogist and mammalian biogeographer. There are more papers on mammals than on any other taxonomic group. For this I apologize to my friends and colleagues in other fields who crave information about other organisms more dear to their hearts and more relevant to their research interests. This book is not designed as the ultimate sourcebook on the biogeography of the West Indies, but rather as a primer on the “patterns” of biogeographical information now available. It strongly represents my bias, and I accept full responsibility for its limitations.

ACKNOWLEDGMENTS I would like to thank all of my colleagues who agreed to contribute chapters and who endured my continuing e-mails and calls for manuscripts and deadlines and in the long process for the book to reach its conclusion. I appreciate the assistance of the late Ross Arnett, Jr. for all he did to make the first volume possible, and for helping me make the “right” decision to completely revise the

Introduction and Historical Overview of Patterns of West Indian Biogeography

7

FIGURE 2 One of Dave’s cartoons. This one features a bat reading a copy of G.E. Dobson’s 1878 Catalogue of the Chiroptera in the collection of the British Museum in which the idea of separating the Microchiroptera based on the development of the shoulder lock was first expressed. Dave drew many such cartoons — most educational, some outrageous — and passed them on to students, colleagues, and friends.

book. To my editor of this volume, John Sulzycki, I express my sincere gratitude. He has been extremely helpful and insightful, and without his assistance and patience this volume would never have been possible. I express an extra measure of gratitude to my colleague, Florence E. Sergile, for her assistance. Florence is the lead author of Chapter 27, and the model of the type of new and dynamic biologist working in the Caribbean. She also played a major role in the editing of the various chapters, and in preparing the manuscript for publication. I could not have achieved this undertaking without the many talents of Florence. There are various people to whom this book could (or should) be dedicated. However, I have chosen to thank and remember Dr. David J. Klingener (Figure 1). Dave, a professor of zoology at the University of Massachusetts at Amherst for his entire professional career, was my major professor. He was also a teacher and friend of many professionals now working in the West Indies, and he touched the lives of many of the contributors to this volume. We all have our special memories of Dave, so I will include a few comments about our time together in the West Indies. For a more complete review of Dave’s life and contributions see Woods (1996a) and Woods and Combs (1996b). My initial exposure to the West Indies was 30 years ago in a remote corner of the southern peninsula of Haiti. There in the mountains above the town of Miragoâne was the facility of Reynolds Haitian Mines. Dave joined me there as we searched for “lost” island shrews of the Nesophontes, the very rare larger insectivore (Solenodon), and Hispaniolan hutias (Plagiodontia) (see Woods, 1976, 1981, 1983). We combined our search for these creatures with searches for caves where we dug for fossil remains, and a search for bats, which we mistnetted at night. I was a young assistant professor at the University of Vermont at the time, and what a pleasure it was to be in the field with Dave. It was there that we learned some of the most important lessons that would carry us through life. We were successful in finding Solenodon (Woods, 1976) and Plagiodontia (Woods, 1981, 1982, 1983), but the genus Nesophontes still remains “lost” and out there for other students and their professors to find (see Woods et al., 1986). During those years as young biologists we spent many an evening in the mosquito-filled

8

Biogeography of the West Indies: Patterns and Perspectives

lowland mangrove swamps near Miragoâne mist-netting for fishing bats (Noctilio). It was Dave who got malaria and described in scientific detail the most vivid hallucinations imaginable while in the depths of the fever spikes. Only an anatomist and accomplished cartoonist could come up with such descriptions (Figure 2). We spent many weeks together in southern Haiti (Ross Bell and his wife Joyce were there too, searching for rhysodine beetles and showing us black widow spiders to be found under each rock on the hillside where we were netting bats and birds). The work on birds revealed incredible site fidelity of migratory warblers and different site utilization by male and female warblers (Woods, 1975), but bats captured Dave’s greatest interest. He went on to write two important papers on the bats of the West Indies (Klingener et al., 1978; Griffiths and Klingener, 1988), and he was the person who taught me the most about West Indian bats. It was as a teacher that Dave made his greatest contributions, influencing the lives of many students and colleagues. He was a great communicator, lecturer, writer, and curmudgeon. We spent a lifetime exchanging letters, sharing lessons, and teaching and advising the same students. Dave’s lifetime was far too short; it ended in a heart attack at his home in South Deerfield on July 6, 1995. So, it is to Dave Klingener that this book is dedicated. He touched the lives of so many West Indian biologists. He was the best teacher I have ever been associated with. And he was a great companion in the field in the wilds of Hispaniola.

LITERATURE CITED Alain, H. 1954. Ekman, Explorador y Botanico Intrepido. Memorias de la Sociedad Cubana de Historia Natural 22(4):361–377. Allen, G. M. 1911. Mammals of the West Indies. Bulletin of the Museum of Comparative Zoology 54(6):174–263. Anthony, H. E. 1916. Preliminary report of fossil mammals from Porto Rico, with descriptions of a new genus of ground-sloth and two new genera of hystricomorph rodents. Annals of the New York Academy of Sciences 27:193–203. Barbour, T. 1914. A contribution to the zoogeography of the West Indies, with special reference to the amphibians and reptiles. Memoirs of the Museum of Comparative Zoology 44:209–359. Biknevicius, A. R., D. A. McFarlane, and R. D. E. MacPhee. 1993. American Museum Novitates 3079:25 pp. + 7 figures and 9 tables. Bond, M. W. 1971. Far Afield in the Caribbean: Migratory Flights of a Naturalist’s Wife. Livingston, Wynnewood, Pennsylvania. Darlington, P. J., Jr. 1935. West Indian Carabidae, 2: Itinerary of 1934. Forests of Haiti; new species; and a new key to Colpoides. Psyche 42(4):167–215. Darlington, P. J., Jr. 1938. The origin of the Greater Antilles, with discussion of dispersal of animals over water and through the air. Quarterly Review of Biology 13:274–300. Darlington, P. J., Jr. 1957. Zoogeography: The Geographical Distribution of Animals. John Wiley & Sons, New York. Ekman, E. L. 1914. West Indian Vernoniae. Arkiv för Botanik (Stockholm) 13(15):1–106 + 6 plates. Ekman, E. L. 1926. Botanizing in Haiti. United States Naval Medical Bulletin 24(1):483–497. Ekman, E. L. 1928. A botanical excursion in La Hotte, Haiti. Svensk Botanisk Tidskrift 22(1–2):200–219. Ekman, E. L. 1929a. Plants of Navassa Island, West Indies. Arkiv för Botanik (Stockholm) 22A(16):1–106 + 2 plates. Ekman, E. L. 1929b. Plants observed on Tortue Island, Haiti. Arkiv för Botanik (Stockholm) 22A(9): 1–60 pp. Ekman, E. L. 1929c. En busca del Monte Tina. Estación Agronomica de Moca, Series B (15):1–17. Ekman, E. L. 1930a. A list of plants from the island of Gonâve, Haiti. Arkiv för Botanik (Stockholm) 23A(6):1–73. Ekman, E. L. 1930b. Excursion botanica al nord-oeste de la Republica Dominicana. Estacion Agronomica de Moca, Series B (17):1–16. Flemming, C. and R. D. E. MacPhee. 1999. Redetermination of holotype of Isolobodon portoricensis (Rodentia, Capromyidae) with notes on recent mammalian extinctions in Puerto Rico. American Museum Novitates 3278:1–11 + 3 figures and 1 table.

Introduction and Historical Overview of Patterns of West Indian Biogeography

9

Griffiths, T. A. and D. J. Klingener. 1988. On the distribution of Greater Antillean bats. Biotropica 20(3):240–251. Guyer, C. and J. M. Savage. 1986. Cladistic relationships among anoles (Sauria: Iguanidae). Systematic Zoology 35:509–531. Hedges, S. B. 1982. Caribbean biogeography: implications of recent plate tectonic studies. Systematic Zoology 31:518–522. Hedges, S. B. 1996. Historical biogeography of West Indian vertebrates. Annual Review of Ecology and Systematics 1996, 27:163–196. Hedges, S. B. and C. A. Woods. 1993. Caribbean hot spot. Nature 364:375. Higuera-Gundy, A., M. Brenner, D. Hodell, J. H. Curtis, B. W. Leyden, and M. W. Binford. 1999. A 10,300 14C yr record of climate and vegetation change from Haiti. Quaternary Research 52:159–170. Iturralde-Vinent, M. A. and R. D. E. MacPhee. 1996. Age and paleogeographical origin of Dominican amber. Science 273:1850–1852. Iturralde-Vinent, M. A. and R. D. E. MacPhee. 1999. Paleogeography of the Caribbean region: implications for Cenozoic biogeography. Bulletin American Museum of Natural History 238: 95 pp. Klingener, D. J., H. H. Genoways, and R. J. Baker. 1978. Bats from southern Haiti. Annals of Carnegie Museum of Natural History 47(5):81–99. MacPhee, R. D. E. 1993. From Cuba: a mandible of Paralouatta. Evolutionary Anthropology 2(2):42. MacPhee, R. D. E. and J. Fleagle. 1991. Postcranial remains of Xenothrix mcgregori (Primates, Xenotrichidae) and other Late Quaternary mammals from Long Mile Cave, Jamaica. Pp. 287–321 in Griffiths, T. A. and D. Klingener (eds.). Contributions to mammalogy in honor of Karl F. Koopman. Bulletin American Museum of Natural History 206. MacPhee, R. D. E. and M. Rivero de la Calle. 1996. Accelerator mass spectrometry 14C age determination for the alleged “Cuban spider monkey,” Ateles (=Montaneia) anthropomorphus. Journal of Human Evolution 30:89–94. MacPhee, R. D. E. and D. A. Grimaldi. 1996. Mammal bones in Dominican amber. Nature 380:489–490. MacPhee, R. D. E., D. C. Ford, and D. A. McFarlane. 1989. Pre-Wisconsinan mammals from Jamaica and models of late Quaternary extinction in the Greater Antilles. Quaternary Research 31:94–106. MacPhee, R. D. E. and M. A. Ituralde-Vinent. 1994. First Tertiary land mammals from Greater Antilles: an early Miocene sloth (Xenarthra, Megalonychidae) from Cuba. American Museum Novitates 3094:1–13 + 4 figures and 2 tables. MacPhee, R. D. E. and M. A. Ituralde-Vinent. 1995a. Origin of the Greater Antillean land mammal fauna, 1: new Tertiary fossils from Cuba and Puerto Rico. American Museum Novitates 3141:1–31 + 11 figures and 3 tables. MacPhee, R. D. E. and M. A. Ituralde-Vinent. 1995b. Earliest monkey from Greater Antilles. Journal of Human Evolution 28:197–200. MacPhee, R. D. E., I. Horovitz, O. Arredondo, and O. J. Vasquez. 1995. A new genus for the extinct Hispaniolan monkey Saimiri bernensis Rimoli, 1977, with notes on its systematic position. American Museum Novitates 3134:1–21 + 6 figures and 12 tables. MacPhee, R. D. E., C. Flemming, and D. P. Lunde. 1999. “Last occurrence” of the Antillean insectivore Nesophontes: new radiometric dates and their interpretation. American Museum Novitates 3261:1–19 + 7 figures and 6 tables. MacPhee, R. D. E., White, J. L., and C. A. Woods. 2000. New megalonychid sloths (Phyllophaga, Xenarthra) from the Quaternary of Hispaniola. American Museum Novitates 3303:1–32. Matthew, W. D. 1915. Climate and evolution. Annals of the New York Academy of Science 24:171–213. McFarlane, D., J. Lundberg, C. Flemming, R. D. E. MacPhee, and S.-E. Lauritzen. 1998a. A second preWisconsinian locality for the extinct Jamaican rodent Clidomys (Rodentia: Heptaxodontidae). Caribbean Journal of Science 34(3–4):315–317. McFarlane, D., R. D. E. MacPhee, and D. C. Ford. 1998b. Body size variability and a Sangamonian extinction model for Amblyrhiza, a West India megafaunal rodent. Quaternary Research 50:80–89. Miller, G. S., Jr. 1930. Three small collections of mammals from Hispaniola. Smithsonian Miscellaneous Collections 82(15):1–9. Olson, S. L. 1981. Oligocene fossils bearing on the origins of the Todidae and Momotidae (Aves: Coraciiformes). Pp. 111–119 in Olson, S. L. (ed.). Collected papers in avian paleontology honoring the 90th birthday of Alexander Wetmore. Smithsonian Contributions in Paleontology 27.

10

Biogeography of the West Indies: Patterns and Perspectives

Paryski, P. E., C. A. Woods, and F. E. Sergile. 1989. Conservation strategies and the preservation of biological diversity in Haiti. Pp. 855–878 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Pindell, J. and J. F. Dewey. 1982. Permo-Triassic reconstruction of Western Pangea and the evolution of the Gulf of Mexico/Caribbean region. Tectonics 1:179–211. Poinar, G. O., Jr. and R. Poinar. 1999. The Amber Forest: A Reconstruction of a Lost World. Princeton University Press, Princeton, New Jersey. Pregill, G. K. 1981a. An appraisal of the vicariance hypothesis of Caribbean biogeography and its application to West Indian terrestrial vertebrates. Systematic Zoology 30:147–155. Pregill, G. K. 1981b. Late Pleistocene herpetofaunas from Puerto Rico. Miscellaneous Publications of the University of Kansas Museum of Natural History 71:1–72. Poinar, G. O., Jr. and D. C. Cannatella. 1987. An Upper Eocene frog from the Dominican Republic and its implication for Caribbean biogeography. Science 237:1215–1216. Queiroz, K. de, L.-R. Chu, and J. B. Losos. 1998. A second Anolis lizard in Dominican amber and the systematics and ecological morphology of Dominican amber anoles. American Museum Novitates 3249:1–23 + 9 figures and 2 tables. Rosen, D. E. 1976. A vicariance model of Caribbean biogeography. Systematic Zoology 24:431–464. Rosen, D. E. 1985. Geological hierarchies and biological congruence in the Caribbean. Annals of the Missouri Botanical Garden 72:636–659. Salgado, E. J., D. G. Calvache, R. D. E. MacPhee, and G. C. Gould. 1992. The monkey caves of Cuba. Cave Science 19(1):25–28. Schuchert, C. 1935. Historical Geology of the Antillean-Caribbean Region. John Wiley & Sons, New York. Simpson, G. G. 1940. Mammals and land bridges. Journal of the Washington Academy of Science 30:137–163. Simpson, G. G. 1943. Turtles and the origin of the fauna of Latin America. American Journal of Science 241:413–429. Simpson, G. G. 1956. Zoogeography of West Indian land mammals. American Museum of Natural History Novitates 1759:1–28. Seabrook, W. B. 1929. The Magic Island, Harcourt Brace, New York. Wetherbee, D. K. 1984. An instant survey of St. Croix, V.I. Natural History. Private (Xeroxed) publication, Shelburne, Massachusetts. 77 pp. Wetherbee, D. K. 1985a. Contributions to the early history of botany in Hispaniola and Puerto Rico. Private (Xeroxed) publication, Shelburne, Massachusetts. 216 pp. Wetherbee, D. K 1985b. Zoological exploration of Haiti for endemic species. Private (Xeroxed) publication, Shelburne, Massachusetts. 556 pp. Wetherbee, D. K. 1985c. Zoological exploration of Cuba for endemic species. Private (Xeroxed) publication, Shelburne, Massachusetts. 223 pp. Wetherbee, D. K. 1985d. Zoological exploration of the Bahamas for endemic species. Private (Xeroxed) publication, Shelburne, Massachusetts. 59 pp. Wetherbee, D. K. 1985e. Zoological exploration of Jamaica for endemic species. Private (Xeroxed) publication, Shelburne, Massachusetts. 212 pp. Wetherbee, D. K. 1985f. Zoological exploration of Central America for new vertebrate species. Private (Xeroxed) publication, Shelburne, Massachusetts. 69 pp. Wetherbee, D. K. 1985g. The historical development of comparative zoology in the West Indies. Private (Xeroxed) publication, Shelburne, Massachusetts. 75 pp. Wetherbee, D. K. 1985h. The two century search for beetles (Coleoptera) in Hispaniola. Private (Xeroxed) publication, Shelburne, Massachusetts. 56 pp. Wetherbee, D. K. 1985i. The sphinx moths (Sphingidae, Heterocerca) of Hispaniola and the 1775 paintings of Rabié. Private (Xeroxed) publication, Shelburne, Massachusetts. 69 pp. Wetherbee, D. K. 1986a. Zoological exploration of the Dominican Republic for endemic species. Private (Xeroxed) publication, Shelburne, Massachusetts. 332 pp. Wetherbee, D. K. 1986b. Zoological exploration of Puerto Rico for endemic species. Private (Xeroxed) publication, Shelburne, Massachusetts. 248 pp. Wetherbee, D. K. 1986c. Zoological exploration of the Lesser Antilles for endemic species. Private (Xeroxed) publication, Shelburne, Massachusetts. 128 pp.

Introduction and Historical Overview of Patterns of West Indian Biogeography

11

Wetherbee, D. K. 1986d. Les petits aras rouges: Ara tricolor — Hispaniolan macaw, and Ara cubensis — Cuban macaw. Private (Xeroxed) publication, Shelburne, Massachusetts. 119 pp. Wetherbee, D. K. 1987a. Further contributions to the history of Hispaniolan zoology. Private (Xeroxed) publication, Shelburne, Massachusetts. 114 pp. Wetherbee, D. K. 1987b. Life stages of Hamadrys amphichloe diasia in Hispaniola (Rhopalocera, Nymphalidae). Private (Xeroxed) publication, Shelburne, Massachusetts. 11 pp. Wetherbee, D. K. 1987c. Life stages of Archimestra teleboas and Dynamine egaea in Hispaniola (Nymphalidae, Papilionoidea). Private (Xeroxed) publication, Shelburne, Massachusetts. 14 pp. Wetherbee, D. K. 1987d. Catalog of the terrestrial and fluviatile mollusk fauna of Hispaniola and a history of the early Hispaniolan malacology. (Co-authored with William J. Clench, although Clench never saw the manuscript according to a handwritten notation by Wetherbee on my copy.) Private (Xeroxed) publication, Shelburne, Massachusetts. 89 pp. Wetherbee, D. K. 1987e. The endemic freshwater fishes of the Dominican Republic, and an historical outline of West Indian ichthyology. Private (Xeroxed) publication, Shelburne, Massachusetts. 237 pp. Wetherbee, D. K. 1988a. Hispaniolan geographic place-names referring to fauna and flora. Private (Xeroxed) publication, Shelburne, Massachusetts. 101 pp. Wetherbee, D. K. 1988b. Larval host-plants, newly determined, of several Hispaniolan butterflies (Rhopalocera) and notes on some early stages. Private (Xeroxed) publication, Shelburne, Massachusetts. 20 pp. Wetherbee, D. K. 1988c. The Hispaniolan versus Cuban origin of the type of Ara tricolor Bechstein (Psittacidae). Private (Xeroxed) publication, Shelburne, Massachusetts. 10 pp. Wetherbee, D. K. 1988d. Guide to marine-fishes that invade freshwaters in Hispaniola. Private (Xeroxed) publication, Shelburne, Massachusetts. 52 pp. Wetherbee, D. K. 1989a. Contributions on the decapod crustacea fauna of Hispaniola. Private (Xeroxed) publication, Shelburne, Massachusetts. 118 pp. Wetherbee, D. K. 1989b. Sixth contribution on larvae and/or larval host-plants of Hispaniolan butterflies (Rhopacera) and notice of “neoteny” — like pupa of Pyrgus oileus L. (Hesperiidae). Private (Xeroxed) publication, Shelburne, Massachusetts. 12 pp. Wetherbee, D. K. 1989c. The counterclockwise vortex of animal dispersal in the central West Indies: significance of the distribution of Diploglossus (Anguinidae, Reptilia) in Hispaniola. Private (Xeroxed) publication, Shelburne, Massachusetts. 7 pp. Wetherbee, D. K. 1989d. A brief guide to the partly-known fauna of alacanes (Scorpionida) of Hispaniola. Private (Xeroxed) publication, Shelburne, Massachusetts. 27 pp. Wetherbee, D. K. 1989e. A guide to the caballitos or libelulas (Odonta) of Hispaniola. Private (Xeroxed) publication, Shelburne, Massachusetts. 72 pp. Wetherbee, D. K. 1989f. A guide to freshwater fishes naturalized from abroad to Hispaniola or to the West Indies. Private (Xeroxed) publication, Shelburne, Massachusetts. 10 pp. Wetherbee, D. K. 1991a. Seventh contribution on larvae and/or larval host-plants of Hispaniolan butterflies and nocturnal activity of adult Hypanartia paulla (Fabricius) (Nymphalidae). Private (Xeroxed) publication, Shelburne, Massachusetts. 13 pp. Wetherbee, D. K. 1991b. Two centuries of exploration for Hispaniolan butterflies. Private (Xeroxed) publication, Shelburne, Massachusetts. 82 pp. Wetherbee, D. K. 1991c. Guayajayuco to Jarabacoa: zoological exploration of the Lamedero Massif, Cordillera Central, Republica Dominicana. Private (Xeroxed) publication, Shelburne, Massachusetts. 32 pp. Wetherbee, D. K. 1996. La Xaiba Prieta and la Xaiba Pinita (Epilobocera, Decapoda) in Hispaniola, and 20+ further contributions on Hispaniolan fauna. Private (Xeroxed) publication, Shelburne, Massachusetts. 465 pp. Wetmore, A. and B. H. Swales. 1931. The birds of Haiti and the Dominican Republic. Bulletin of the United States National Museum 155:1–483. Woods, C. A. 1975. Banding and recapture of wintering warblers in Haiti. Bird Banding 46(4):344–346. Woods, C. A. 1976. Solenodon paradoxus in Southern Haiti. Journal of Mammalogy 57(3):591–592. Woods, C. A. 1981. Last endemic mammals in Hispaniola. Oryx 16(2):146–152. Woods, C. A. 1982. Solenodon paradoxus; Plagiodontia aedium; Geocapromys brownii; Geocapromys ingrahami; Capromys nanus; Capromys melanurus. Pp. 99–100, 293–294, 297–299, 301–302, 303–305 in Thornback, J. and M. Jenkins (eds.). Red Data Book, Mammals. International Union Conservation of Nature and Natural Resources, Gland, Switzerland.

12

Biogeography of the West Indies: Patterns and Perspectives

Woods, C. A. 1983. Biological Survey of Haiti: Status of Endangered Birds and Mammals. National Geographic Society Research Reports 15: 759–768. Woods, C. A. 1989a. The biogeography of West Indian rodents. Pp. 741–798 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Woods, C. A. 1989b. The endemic rodents of the West Indies; the end of a splendid isolation. Pp. 11–19 in Lidicker, W. Z., Jr. (ed.). Rodents: A World Survey of Species of Conservation Concern. Occasional Papers of the IUCN Species Survival Commission (SSC) No. 4. Woods, C. A. 1989c. A new capromyid rodent from Haiti; the origin, evolution and extinction of West Indian rodents and their bearing on the origin of New World hystricognaths. Los Angeles County Museum, Science Series 33:59–89. Woods, C. A. 1990. The fossil and recent land mammals of the West Indies: an analysis of the origin, evolution and extinction of an insular fauna. Pp. 641–680 in Azzaroli, A. (ed.). Biogeographical Aspects of Insularity. Accadia Nazionale dei Lincei, Rome. Woods, C. A. 1996a. The land mammals of Puerto Rico and the Virgin Islands. Annals of New York Academy of Science 776:131–149. Woods, C. A. 1996b. Obituary — David John Klingener: 1937–1995. Journal of Mammalogy 77(3):898–900. Woods, C. A. and M. Combs. 1996. Obituary — David Klingener. Bulletin of the Society for Vertebrate Paleontology (February). Woods, C. A. and J. A. Ottenwalder. 1992. The Natural History of Southern Haiti. Florida Museum of Natural History, Gainesville. Woods, C. A. and F. E. Sergile. 1990. The literature of natural sciences in Haiti. Pp. 297–330 in Lawless, R. (ed.). Haiti, A Research Handbook. Garland Publishing, New York. Woods, C. A., J. A. Ottenwalder, and W. Oliver. 1986. Lost mammals of the Greater Antilles; the summarized findings of a ten weeks field survey of the Dominican Republic, Haiti and Puerto Rico. Dodo, Jersey Wildlife Preservation Trust. 22:23–42. Woods, C. A., F. E. Sergile, and J. A. Ottenwalder. 1992. Stewardship Plan for the National Parks and Natural Areas of Haiti. Florida Museum of Natural History, Gainesville.

CONSERVATION POSTERS Sergile, F. E., C. A. Woods, and L. Walz. 1992. Haiti Conservation Poster #1: Connaître et Protéger la Richesse Naturelle d’Haïti. Florida Museum of Natural History, Gainesville. Sergile, F. E., L. Walz, and C. A. Woods. 1992. Haiti Conservation Poster #2: Connaître et Protéger la Richesse Naturelle d’Haïti with descriptive text. Florida Museum of Natural History, Gainesville. Woods, C. A., F. E. Sergile, and L. Walz. 1993. Haiti Conservation Poster #3: Sauvons Haïti, Sa Nature et son Art. Florida Museum of Natural History, Gainesville. Woods, C. A., F. E. Sergile, J. A. Ottenwalder, and L. Walz. 1994. Haiti Conservation Poster #4: Veye bwa Peyi d’Ayiti. Yo inpòtan nèt, nè, nèt (in Creole). Florida Museum of Natural History, Gainesville.

ENVIRONMENTAL EDUCATION AND ACTIVITY BOOKS Sergile, F. S. and J. R.Mérisier 1993. Connaître et Protéger la Richesse Naturelle d’Haïti. Florida Museum of Natural History, Gainesville. 28 pp. Sergile, F. E. and C. A. Woods. 1995. Action Verte. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1995. Guide de Terrain des Aires Protégées en Haïti. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1995. Nou Pa Gen Tan Pou Pèdi. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1995. Nous n’avons plus de temps à perdre. Florida Museum of Natural History, Gainesville.

Introduction and Historical Overview of Patterns of West Indian Biogeography

13

Sergile, F. E. and C. A. Woods. 1995. Veye richès peyi d’Ayiti. Special Publication of the Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. Aux couleurs nationales: le caleçon rouge. Brochure for the national bird of Haiti. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. La Calebassine. Brochure for the national flower of Haiti. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. Ça vaut mieux qu’une mine d’or. Brochure for environmental education and exhibit on natural resources. Haiti-NET and Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. Notre Pin: Roi de nos montagnes. Brochure for the national tree of Haiti. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. Un arbre à nous: Le palmier royal. Brochure for the national tree of Haiti. Florida Museum of Natural History, Gainesville. Sergile, F. E. 1998. Anvironman. Se ki sa? Guid pou asosyasyon jèn moun nan pawòl anviwònman. ASSET/Winrock International/USAID. Sergile, F. E. and C. A. Woods. 1998. Pouki Sa Nap Plante. USFWS and Haiti-Net (Booklet). Port-auPrince. Sergile, F. E. 1999. Gestion des resources naturelles et de l’environnement. Commune de Kenscoff. Cahier d’activité pour la gestion de l’environnement dans la commune de Kenscoff. Projet pilote ASSET/Winrock/USAID, Pétionville. Sergile, F. E. 1999. Jesyon resous natirèl ak anviwònman. Komin Kenskòf. ASSET/Winrock/USAID, Petyonvil. Sergile, F. E. 1999. Jesyon resous natirèl. Bèl Fontèn. ASSET/Winrock/USAID. Sergile, F. E. 1999. Anvironman. Se ki sa? Guid pou asosyasyon jèn moun nan pawòl anviwònman. ASSET/Winrock/USAID. Sergile, F. E. 1999. Mon environnement, ma commune. Kenscoff. Cahier d’activité pour la gestion de l’environnement dans la commune de Kenscoff. Projet pilote ASSET/Winrock/USAID. Sergile, F. E. and C. Tardieu. 2000. L’environnement, C’est quoi? Guide pour les associations de jeunes sur la gestion de l’environnement. ASSET/Winrock/USAID. Sergile, F. E. 2000. Coup d’oeil sur la faune d’Haiti. Manuel pour les agents agroforestiers du programme de l’Ecole Moyenne d’Agroforesterie d’Haïti. Sergile, F. E. 2000. Coup d’oeil sur la flore d’Haïti. Manuel pour les agents agroforestiers du programme de l’Ecole Moyenne d’Agroforesterie d’Haïti. Sergile, F. E. 2000. Manuel de gestion des aires protégées. A l’usage des agents agroforestiers du programme de l’Ecole Moyenne d’Agroforesterie d’Haïti.

GENERAL INFORMATION Chevalier, F. D. and F. E. Sergile. 1999. Agenda Vert. Image Marketing: Port-au-Prince, Haiti. Dépot legal 98-12-415 Bibliothèque nationale d’Haïti. Sergile, F. E. 1996. Au nord’est du Nord’Est. Statut de l’environnement naturel d’Haiti, Numero 2. 61 pp. Sergile, F. E. 1996. Sur 1535 km: Un Océan, un golfe, une mer et un potentiel unique. Paper presented at the conference: Gestion des zones cotières en Haiti. Université Quisqueya, UNESCO. Sergile, F. E. and C. A. Woods. 1996. People, Development and Conservation. Report of the Sondeo in Macaya North. Prepared for BSP. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1998. Haiti est généreuse. Annuaire 1998 for Promo-Plus, Port-au-Prince, Haiti. Sergile, F. E. 1999. L’écologie en Haïti. Colonnes pour le Dictionnaire encyclopédique d’Haïti. Centre d’Etudes et de Culture Haitiennes. Sergile, F. E. 2000. Les aires protégées en Haïti. Colonnes pour le Dictionnaire encyclopédique d’Haïti. Centre d’Etudes et de Culture Haitiennes. 3 pp. Taylor, F. B. and F. E. Sergile. 2000. La flore d’Haiti. Colonnes pour le Dictionnaire encyclopédique d’Haïti. Centre d’Etudes et de Culture Haitiennes.

14

Biogeography of the West Indies: Patterns and Perspectives

CONSERVATION EXHIBITS Sergile, F. E. 1993. Fondation Ecologique du Nouveau College Bird. Faune et Environnement (Haiti). Sergile, F. E. 1996. Haiti-NET. Ça vaut mieux qu’une mine d’or. Sergile, F. E. 1998. L’environnement. C’est quoi? ASSET and Association des Jeunes pour la conservation de l’environnement (Jacmel, Haiti).

of the 2 Biogeography West Indies: An Overview S. Blair Hedges Abstract — The West Indies harbor a diverse flora and fauna with high levels of endemism. This, coupled with a complex geological history, has attracted interest in the historical biogeography of the region. Two major models have been proposed. The vicariance model proposes that a proto-Antillean biota connecting North and South America in the late Cretaceous was fragmented by plate tectonic movement to form the current island biotas. The dispersal model suggests that organisms dispersed over water during the Cenozoic to reach the islands. A variation on the dispersal model proposes that a dry land bridge connected the Greater Antilles with South America for a short time during the mid-Cenozoic, facilitating dispersal into the Antilles. Most biogeographical studies addressing these models have been based on well-studied groups of vertebrates. Two lines of evidence suggest that dispersal, and not vicariance or a mid-Cenozoic dry land bridge, is responsible for the origin of most lineages studied. First, most West Indian groups are characteristically depauperate at the higher taxonomic levels, yet they often have some unusually large radiations of species. This taxonomic pattern, which is reflected in the fossil record, suggests that niches left vacant by groups absent from the Antilles have been filled by other groups present. Second, times of divergence estimated by molecular clocks indicate that most lineages arrived during the Cenozoic at times when there were no continental connections with the islands. These two lines of evidence are congruent with the nearly unidirectional current flow in the West Indies that probably brought flotsam from rivers in South America to these islands throughout the Cenozoic. Despite this general pattern, a few groups appear to have arrived very early and may represent ancient relicts of the proto-Antilles. The geological history and paleogeography of the West Indies is exceedingly complex and different authors have suggested different scenarios based on the same evidence. For this reason, it is too soon to exclude any particular model of Caribbean biogeography. The geological database and fossil record will continue to improve, phylogenetic relationships will become better known, and molecular divergence time estimates soon will be available for a wide diversity of taxa. Therefore, despite shortcomings of the current models, we can look forward, in the near future, to resolving many of these long unanswered questions of Caribbean biogeography.

INTRODUCTION A significant percentage of the Earth’s known terrestrial biota is distributed on islands of the West Indies (Figure 1). Many of those species are endemic to the region, to individual islands, and even to isolated areas within some islands. Dominican amber fossils indicate with great clarity that the West Indies has been a region with high species diversity and endemism for at least 20 million years (Poinar and Poinar, 1999). In addition, the complex geological history of the region has offered many opportunities for dispersal and vicariance to affect biotas. Together, these features have made the West Indies an appealing region for the study of historical biogeography. This chapter provides a brief outline of the major hypotheses of Caribbean biogeography being debated and the current evidence bearing on them. Because vertebrates are among the best known organisms in the West Indies, they have been the focus of most biogeographical studies and will be the focus of this outline. This is not intended to be a comprehensive review of Caribbean biogeography but rather an update on the current state of the field. Williams’ (1989) earlier outline provides a useful history of the field and its personalities, and a recent review (Hedges, 1996a) is more comprehensive than this one in its treatment of West Indian vertebrates and their historical biogeography.

0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

15

16

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 1 The West Indies.

Recently, Iturralde-Vinent and MacPhee (1999) provided a detailed elaboration of their land bridge model of Caribbean biogeography that was proposed earlier (MacPhee and Iturralde-Vinent, 1994; 1995). Their model suggests that a short-lived dry land bridge in the mid-Cenozoic brought land mammals and presumably other aspects of the South American biota to the Greater Antilles. Their paleogeographical reconstructions exclude the possibility of a vicariant origin for the current biota. Moreover, while stopping short of excluding overwater dispersal altogether, they argue that “surface-current dispersal of propagules is inadequate as an explanation of observed distribution patterns of terrestrial faunas in the West Indies” (Iturralde-Vinent and MacPhee, 1999). A major focus of this outline is to examine the evidence used by Iturralde-Vinent and MacPhee (1999) to support their land bridge model and to show errors and inconsistencies in their argument. In addition, I show that their paleogeographic reconstructions of the Caribbean region have been influenced by the particular biogeographical model that they attempt to support. The current geological evidence does not exclude proto-Antillean vicariance and does not favor a dry land bridge for the mid-Cenozoic Aves Ridge any more than it favors a chain of islands. Finally, I conclude that the same biotic evidence that argues against an origin by vicariance for most lineages also argues against a mid-Cenozoic land bridge.

WEST INDIAN BIOTA Little is known of the general diversity of bacteria, fungi, and protists in the West Indies or elsewhere (Wilson, 1992; Bayuck, 1999). The flora of the West Indies has not yet undergone a comprehensive review, but there are at least 10,000 species of vascular plants, about one third of which are endemic (Adams, 1972; Gentry, 1992). It is likely that only a small fraction of the invertebrate diversity of the West Indies is known and therefore it is too soon to draw general conclusions. However, the best-known groups tend to exhibit reduced higher-level diversity and have large adaptive radiations of some taxa (Liebherr, 1988; Smith et al., 1994b; Pereira et al., 1997; Schubart et al., 1998). Vertebrates are the best-studied organisms in the West Indies; there are 1,295 described species (Table 1). Of those, endemism ranges from a low of 35% in birds to 99% in amphibians, with an average of 74%. Taxonomic diversity is poor at the higher levels, with many major groups absent,

Biogeography of the West Indies: An Overview

17

TABLE 1 Current Diversity of Native West Indian Terrestrial Vertebratesa Genera Endemic

% Endemic

Total

Endemic

% Endemic

9 4 19 49

14 6 50 204

6 1 9 38

43 17 18 19

74 174 474 425

71 172 443 150

96 99 93 35

7 9 97

32 36 342

8 33 95

25 92 28

58 90 1295

29 90 955

50 100 74

Orders

Families

Fishes Amphibians Reptiles Birds Mammals Bats Other Totals

6 1 3 15 1 4 30

b

Species

Total

Group

a

b

After Hedges (1996a), updated. Including one endemic family of birds and four of mammals.

including primary division freshwater fishes, salamanders, caecilians, marsupials, carnivores, lagomorphs, and most families of frogs, turtles, and snakes. On the other hand, some genera have undergone large radiations. For example, the frog genus Eleutherodactylus and the lizard genus Anolis each contains at least 140 West Indian species and geckos of the genus Sphaerodactylus are not far behind with approximately 85 known species. Most fossils of terrestrial organisms in the West Indies come from Quaternary deposits (Pregill and Olson, 1981; Pregill et al., 1992; Woods and Ottenwalder, 1992; Morgan, 1993) and Hispaniolan amber (Poinar and Poinar, 1999). There is not complete agreement over the dating of the amber (Poinar and Poinar, 1999), although most authors consider the major amber deposits (e.g., La Toca) to be Oligocene or Early Miocene (30 to 15 million years ago [mya]) (Grimaldi, 1995; Hedges, 1996a; Iturralde-Vinent and MacPhee, 1996). Fossils also are known from other times in the Tertiary (Cockerell, 1924; Graham and Jarzen, 1969; Graham, 1993; MacPhee and Iturralde-Vinent, 1994; 1995; Domning et al., 1997; Pregill, 1999). Dominican amber deposits contain the largest fossil assemblage of terrestrial invertebrates in a tropical environment (Poinar and Poinar, 1999). The amber ant fauna has been suggested to be more continental in taxonomic composition (Wilson, 1985) compared with the extant fauna, but such comparisons have not been made for most other invertebrate groups in amber. The fossil vertebrates found in amber are representatives of extant West Indian groups and include frogs of the genus Eleutherodactylus, lizards of the genera Anolis and Sphaerodactylus, a snake of the genus Typhlops, a capromyid rodent, a nesophontid insectivore, and a woodpecker (Poinar and Poinar, 1999). In general, these and other fossil vertebrates from the Tertiary of the West Indies reflect the same taxonomic pattern seen in the Quaternary and extant biota. Exceptions include fossil hair in Dominican amber that may have belonged to a carnivore (Poinar and Poinar, 1999) and an Eocene rhinocerotoid ungulate from Jamaica (Domning et al., 1997). The significance of the Jamaican fossil will be discussed below.

GEOLOGICAL HISTORY The Caribbean region has had a complex geological history (Dengo and Case, 1990; Donovan and Jackson, 1994). This history began when the supercontinent Pangaea separated into Laurasia (north) and Gondwana (south) in the Jurassic (~170 mya). This created the “space” for the Caribbean plate, which formed later in the mid-Cretaceous. Since that time, the Caribbean plate has been moving eastward relative to the North American and South American plates. The Antilles were formed by andesitic volcanism resulting from the subduction of the North American plate beneath the Caribbean

18

Biogeography of the West Indies: Patterns and Perspectives

plate. Initially, these were underwater volcanoes (seamounts) that enlarged with time to rise eventually above the water level as islands. It is not known precisely when the islands became emergent, but the proto-Antillean island arc more or less connected North and South America during the late Cretaceous (~100 to 70 mya). In the early Cenozoic (~60 mya) the proto-Antilles began to collide with the Bahamas platform (part of the North American plate) and fused. This initiated a transform fault south of Cuba and northern Hispaniola, adding to the geological complexity of the region. This newly defined northern edge of the Caribbean plate moved eastward carrying with it Jamaica and the southern portion of Hispaniola (south of Cul de Sac/Valle de Neiba). Eventually the two (or more) portions of Hispaniola fused in the Miocene (~10 mya). Because the Greater Antilles lie along the northern edge of the Caribbean plate where there has been mostly lateral motion during the Cenozoic, there are no active volcanoes on those islands. On the other hand, there are active volcanoes in the Lesser Antilles because they are at the leading edge of the Caribbean plate and directly above the subducting North American plate. For biogeography, it is critical to know which areas were above sea level during the geological history of the West Indies. Unfortunately, that is one of the most poorly known aspects of Caribbean geological history. This is because the exposure of dry land is the result of three interrelated factors: uplift, erosion, and sea level. Sea level fluctuations alone cannot be used as a guide, because large mountain ranges can be uplifted and eroded away in a relatively short period of time. For example, the present Blue Mountains (>2200 m) of Jamaica were uplifted only 5 to 10 mya (Comer, 1974). Although the nature of sedimentary strata provides clues to whether there was subaerial land nearby, such strata are not exposed at all locations and at all time periods. It has been claimed that no land areas in the Greater Antilles were continuously above sea level before about 45 mya (MacPhee and Iturralde-Vinent, 1994; MacPhee and Grimaldi, 1996; Iturralde-Vinent and MacPhee, 1999). However, the geological history of the region is not known in enough detail to support such speculation. In fact, other authors have claimed the opposite: “The first terrestrial (emergent) centers seem to have been in the Dominican Republic, Puerto Rico, and the Virgin Islands. In these places the date of emergence is sometime during the Albian (about 100–110 million years), and in these places emergence persisted to the present” (Donnelly, 1992). Also, the plutons of Puerto Rico were being uplifted and eroded in the early Tertiary. Larue (1994) noted that “shallow-water limestone facies are found in north- and south-central Puerto Rico, suggesting that the Central Block may have been a topographic high in the Eocene.” Even some of the best-known features of Caribbean paleogeography may need to be revised in the future. For example, it has been claimed for Jamaica that “probably no part of the island was more than a few meters above sea level at any time” between the middle Eocene and middle Miocene (Robinson, 1994). However, it seems unlikely that the major drop (160 m) in sea level at the beginning of the Oligocene (32.2 mya) (Miller et al., 1996) did not subaerially expose a similar elevation of the carbonate platform. If this happened, then most of the island would have been exposed for millions of years, at least until the platform eroded back to sea level (or subsided). Iturralde-Vinent and MacPhee (1999) make a similar point, arguing in addition that eastern Jamaica has been continuously subaerial since the Eocene and was connected at one point to southern Hispaniola. This case illustrates that paleogeographical reconstruction is difficult and that geologists with similar data can arrive at very different conclusions. The Bahamas platform has remained a relatively stable carbonate block for most of the Cenozoic (Dietz et al., 1970; Dengo and Case, 1990; Donovan and Jackson, 1994). Only barrier reefs and low islands (as seen today) are believed to have existed in the past. However, the compressional forces of the collision with the proto-Antilles during the early Cenozoic may have caused uplift along the southern margin of the Bahamas platform. Because the platform already was near sea level, any uplift would have exposed dry land for colonization by terrestrial organisms. This biogeographical possibility has not yet been explored.

Biogeography of the West Indies: An Overview

19

A large bolide (asteroid, or less likely, a comet) approximately 10 km in diameter struck the Earth in the Caribbean region at 65 mya (Hildebrand and Boynton, 1990). This well-known event almost certainly was responsible for the extinction of the dinosaurs and many other groups. Besides the global effects of the impact, the local effects are of significance to Caribbean biogeography. For example, the proto-Antilles were located only 1 to 3 crater diameters away from the impact site and apparently sustained massive waves (tsunamis) on the order of a kilometer or more in height (Maurrasse, 1991). Gigantic hurricanes (hypercanes) also would have been generated (Emanuel et al., 1994). These local effects of the bolide impact may have destroyed most or all life on the proto-Antilles at that time (Hedges et al., 1992).

OVERWATER DISPERSAL For islands that have never been connected to other landmasses (e.g., Hawaii, Galápagos), dispersal over water is the only possible biogeographical mechanism. In the case of the West Indies, the complex geological history leaves open the possibility of proto-Antillean vicariance or movement across land bridges. Nonetheless, there is evidence that overwater dispersal was the primary mechanism for the origin of the terrestrial vertebrates (Hedges, 1996a, 1996b). This evidence concerns the taxonomic composition of fauna and molecular clock estimates of divergence time between island lineages and their closest relatives on the mainland. The unbalanced taxonomic composition of the fauna (see above), with poor representation at the higher levels and enormous adaptive radiations of some groups, has been noted for over a century (Wallace, 1881; Matthew, 1918; Simpson, 1956; Darlington, 1957). This has been termed the “central problem” in Caribbean biogeography (Williams, 1989). Although it is possible to reach such a taxonomic composition by extinction of a pre-existing, diverse fauna, one would expect to see some remnants of that pre-existing complexity in the present fauna. In fact, the great radiation and morphological diversity of such groups as the ground sloths (now extinct) and hystricognath rodents, filling niches normally occupied by other orders of mammals (Morgan and Woods, 1986; Woods, 1990), supports the contention that those other orders were absent during much of the Cenozoic. A similar argument can be made for the gigantism, dwarfism, and unusual adaptations observed in many other West Indian living and extinct groups (Olson, 1978; Morgan and Woods, 1986; Pregill, 1986; Hedges, 1996a). The other evidence for dispersal as a major biogeographical mechanism comes from molecular clock studies of vertebrates. The number of amino acid differences in the protein serum albumin separating two species can be estimated using the immunological technique of micro-complement fixation (Maxson, 1992). From calibrations with the vertebrate fossil record it has been shown that such immunological distances are correlated with geological time and can be used as a molecular clock. When this method was applied to amphibians and reptiles in the West Indies (Hass, 1991; Hass and Hedges, 1991; Hass et al., 1993; Hass et al., Chapter 11, this volume) it was found that times of origin for West Indian lineages were scattered throughout the Cenozoic and not clustered during one time period (Hedges et al., 1992; Hedges, 1996b). Moreover, nearly all lineages originated more recently than would be predicted based on the vicariance model (see below). This supported an origin by overwater dispersal for most lineages of amphibians and reptiles in the West Indies. If dispersal is the predominant mechanism, then what was the source area for these lineages? The answer to this question can be obtained from phylogenies, where the source area is inferred from the location of the closest mainland relative to the West Indian lineage. Such an analysis revealed that South America was the major source area for amphibians and reptiles during the Cenozoic (Hedges, 1996b). Although the Greater Antilles, in most places, are closer to North and Central America, this South American origin agrees with the nearly unidirectional water currents in the Caribbean region, flowing from southeast to northwest (Figure 2). Thus, flotsam from rivers in South America that emptied into this current probably carried the ancestors of many Antillean

20

Biogeography of the West Indies: Patterns and Perspectives

60

40

20

AFRICA

20

10

SOUTH AMERICA 1500 KM 60

40

20

FIGURE 2 The southern half of the North Atlantic Gyre, showing the North Equatorial Current flowing from Africa to South America and the West Indies (after Hedges, 1996b). This same clockwise current flow in the North Atlantic would have operated throughout the Cenozoic because of the Coriolis force.

TABLE 2 The Origin of West Indian Terrestrial Vertebratesa Mammals Group Mechanism Dispersal Vicariance Undetermined Source South America Central America North America Other Undetermined

Fish

Amphibians

Reptiles

Birdsb

Bats

Other

Total

16 0 1

8 1 0

67 0 1

425 0 0

42 0 0

8 0 1

566 1 3

7 0 0 0 2

35 8 3 4 18

— — — — —

14 18 2 0 0

7 1 1 0 0

69 27 15 6 20

6 0 9c 2 0

a

Shown are the numbers of independent lineages (populations, species, and higher taxa), after Hedges (1996a). b The number of lineages in birds is not known, but is >300; the major source area is North America, but the specific number of lineages from each source area is not known. c Some of these lineages of fishes may have arrived from Central America.

lineages (Hedges, 1996b). In some cases, such as the endemic Cuban lizards of the genus Tarentola, flotsam probably carried them all of the way from Africa in this same current. Although molecular data generally are lacking for most other vertebrate lineages in the West Indies, some data on relationships and timing can be gleaned from the literature and fossil record. These data showed that overwater dispersal was supported for nearly all (>99%) lineages of West Indian terrestrial vertebrates (Hedges, 1996a). For nonvolant taxa, the primary source area still was South America, but most of the volant taxa (birds, bats) in the West Indies arrived from North and Central America (Table 2). How could a terrestrial vertebrate such as a frog survive a long journey (several months) across open water? Although floating mats of vegetation (flotsam) have been observed frequently (Guppy, 1917; King, 1962; Heatwole and Levins, 1972), no raft carrying an animal has been seen leaving

Biogeography of the West Indies: An Overview

21

a river in South America and later landing in the Greater Antilles. However, flotsam apparently carried green iguanas from Guadeloupe to Anguilla during September and October 1995 and a viable population was established. The entire journey was not verified but lizards were seen on the flotsam as it landed on a beach in Anguilla and circumstantial evidence suggested that the journey began in Guadeloupe at least 1 month earlier as a result of one or two hurricanes (Censky et al., 1998). Those authors elude to the importance of this observation by stating that “for overwater dispersal to be considered a realistic explanation for the distribution of species in the Caribbean, it must be demonstrated that a viable population could be established” (Censky et al., 1998). But this is not so, because many aspects of science are inferred without direct observation (e.g., existence of past life and subatomic particles). In the case of biogeography, the existence of organisms on islands (e.g., Hawaii) that never had connections with continents demonstrates that overwater dispersal must have occurred unless one evokes spontaneous generation. Whether the Greater Antillean fauna owes its origin primarily to dispersal or vicariance is another question. But the fact that dispersal is a “realistic” alternative to vicariance does not rely solely on the observation that green iguanas landed on a beach in Anguilla in 1995. If tropical storms and hurricanes have been influential in the transfer of flotsam in the Caribbean, then it is possible that the direction of transfer will not always have corresponded to the generalized water current flow. The strong winds of a hurricane, moving in a counterclockwise vortex, will move current in any direction depending on the specific track of the storm. For example, a westwardmoving hurricane passing to the north of Puerto Rico and eastern Hispaniola will bring strong winds and currents from west to east across Mona Passage. Whether this would be sufficient to carry flotsam from Hispaniola to Mona or Puerto Rico is not known, but the likelihood must be considered (also, the hurricane itself may reverse direction). Based on the number of hurricanes following such a track during the previous 50 years, it is likely that hundreds of thousands of dispersal opportunities have occurred over the last 20 million years. Some seemingly anomalous distributions of vertebrates, such as the presence of two reptiles (Anolis longiceps and Tropidophis bucculentus) with Cuban affinities on Navassa Island, may be the result of such hurricane transport. Although such phenomena may explain local distributions, it is unlikely that hurricanes would modify the direction of movement of flotsam over longer distances.

PROTO-ANTILLEAN VICARIANCE As an alternative to overwater dispersal, Rosen (1975) proposed a vicariance model of Caribbean biogeography. This model suggests that the present West Indian biota represent the fragmented remnants of an ancient biota that was continuous with those of North and South America in the late Cretaceous. Proto-Antillean vicariance cannot be eliminated on geological grounds because even the most current geological models (Dengo and Case, 1990; Donovan and Jackson, 1994) show a proto-Antillean island arc system connecting North and South America during the late Cretaceous. The question whether that island arc formed a dry land bridge or was a chain of islands has not yet been answered conclusively. Since it was proposed, the vicariance model has proven difficult to test. The original suggestion that the congruence of “tracks” (lines drawn between areas with shared faunas) supports the model is not upheld because distributional congruence could simply reflect similar patterns of dispersal as would be expected with unidirectional current patterns (Hedges, 1996a; 1996b). The same can be said of using phylogenies and area cladograms (Rosen, 1985), although the added difficulty here is that the details of land connections through time in the Greater Antilles remain poorly understood. Some cladistic biogeographers have considered dispersal to be untestable and unscientific, and have placed it in a secondary role (Nelson and Platnick, 1981; Morrone and Crisci, 1995). However, most biogeographers consider dispersal a major mechanism that cannot be ignored. The same evidence discussed above as support for overwater dispersal is the evidence that argues against vicariance as the primary mechanism explaining the origin of the West Indian fauna.

22

Biogeography of the West Indies: Patterns and Perspectives

The taxonomic composition of the current and known Tertiary fauna is depauperate at higher taxonomic levels and does not reflect a cross section of a continental biota. In addition, the times of divergence between Antillean groups and their mainland relatives suggest a more recent (Cenozoic) origin than would be predicted by vicariance. Nonetheless, several lineages of Antillean vertebrates may be quite old and could possibly date to the proto-Antilles. One is the frog genus Eleutherodactylus, which shows a time of origin in the West Indies close to the Cretaceous/Tertiary boundary (Hass and Hedges, 1991, Hedges, 1996b). Another is the xantusiid lizard genus Cricosaura that occurs in eastern Cuba. No molecular clock estimate is available for Cricosaura, contra Iturralde-Vinent and MacPhee (1999:51), but instead the older age for its lineage is inferred from mainland fossil data and the relationships of xantusiid lizards (Hedges et al., 1991; Hedges and Bezy, 1993). Even if the lineage itself is old, the relictual nature of xantusiid lizards suggests caution in using the current distribution as evidence of past distribution. Among mammals, the insectivores Solenodon and Nesophontes probably represent old lineages that might date back to the Cretaceous (MacFadden, 1980), but no molecular or fossil data have yet been offered as support of that suggestion. Even if the current West Indian fauna does not show a predominantly vicariant origin, this is not to say that a vicariant biota did not exist at earlier times. For example, the recent discovery of ungulate (rhinocerotoid) and iguanid lizard fossils from the Eocene (~50 mya) of Jamaica (Domning et al., 1997; Pregill, 1999) may be evidence of such a biota. Ungulates are not known from elsewhere in the West Indies. Whether this lineage reached Jamaica on dry land from the mainland, or dispersed across a water gap, is not known. The Oligocene submergence of Jamaica, if it occurred (see above), presumably would have eliminated most or all of the existing biota. Nonetheless, the Jamaican Eocene fossils indicate that a diverse biota may have existed on some Caribbean islands in the early Cenozoic.

THE LAND BRIDGE MODEL OF MACPHEE AND ITURRALDE-VINENT Before plate tectonics provided the mechanism for vicariance, the “land bridge” was the major alternative mechanism to dispersal. Supporters of land bridges (Scharff, 1912; Barbour, 1916; Schuchert, 1935) debated with supporters of overwater dispersal for the first half of the 20th century. The primary argument for land bridges was the seeming impossibility that some groups of organisms, such as freshwater fishes and amphibians, could disperse across salt water (see discussion above). The peninsulas of land that were erected between the islands and the mainland, based on the distributions of organisms, largely were conjectural with little or no geological evidence. After plate tectonics became accepted in the latter part of the 20th century, and paleogeography became better known, most of the proposed land bridges were not supported by geological evidence. However, the refined geological data have suggested new possibilities for past land bridges. One such possibility of a mid-Cenozoic land bridge in the Caribbean region is the Aves Ridge, now almost entirely submerged. The Aves Ridge, located just to the west of the Lesser Antilles, has long been known to have been the precursor of the present-day Lesser Antilles (Malfait and Dinkelman, 1972; Dengo and Case, 1990; Donovan and Jackson, 1994). As such, it was intimately tied to the geological evolution of the Greater Antilles and connections, in the “island arc” sense, with the adjacent continents. Biogeographers also have noted the importance of the Aves Ridge for Caribbean biogeography (Rosen, 1975; Holcombe and Edgar, 1990; Woods, 1990). In a detailed discussion of the Aves Ridge, Holcombe and Edgar (1990) stated “between middle Eocene and early Miocene time it is possible that the Aves Ridge may have been a land bridge. To have been a land bridge, the Aves Ridge would have had to have undergone about 2,000 m of subsidence. There is no direct evidence to support subsidence greater than about 1200 m, but

Biogeography of the West Indies: An Overview

23

samples of Eocene reef limestone recovered from a well (Marathon SB1) drilled on Saba Bank, which joins Aves Ridge on the north, demonstrate that the bank has subsided about 3000 m since the end of Eocene time.” Those authors show a figure of what the present Aves Ridge would look like if it were 600 m and 1000 m higher, exposing many islands, or by inference, a land bridge if subsidence had been even greater. In a separate paper in the same volume, Woods (1990) specifically proposes that this Aves Ridge land bridge (or chain of islands) provided a potential mid-Cenozoic corridor for the entry of mammals to the Greater Antilles. However, geological support for a continuous land bridge vs. a chain of islands does not exist. In a recent series of papers, MacPhee and Iturralde (1994; 1995; 1999) have championed the possibility that the Aves Ridge was a mid-Cenozoic land bridge. They refer to it as a “landspan” defined as “a subaerial connection (whether continuous or punctuated by short water gaps) between a continent and an off-shelf island (or island arc).” But for Caribbean biogeography, the distinction between a dry land bridge and an island chain is a major one. A dry land bridge will allow a cross section of the continental fauna to enter the Greater Antilles whereas an island chain will act as a filter, permitting only selected lineages to enter. Most authors discussing Caribbean biogeography have assumed that the Aves Ridge was an island chain, much like the adjacent Lesser Antilles, during the Cenozoic (Rosen, 1975; Perfit and Williams, 1989; Hedges, 1996a). This concept is not new and it fits with the taxonomic composition of the Antillean fauna. However, the suggestion of a dry land bridge would not agree with the taxonomic composition of the fauna or with molecular time estimates (see below). Although there is no geological evidence yet available to distinguish between a dry land connection and a chain of islands, the paleogeographic diagrams illustrated by Iturralde-Vinent and MacPhee clearly show a dry land connection from 35 to 33 mya, and that is the model that they emphasize. Iturralde-Vinent and MacPhee (1999) acknowledged that evidence against a dry land connection is provided by molecular clock studies and taxonomic composition of the fauna, and therefore considerable attention was given to a critique of studies supporting overwater dispersal, especially that of Hedges (1996b). The different issues that they raise will be discussed separately below.

DIVERGENCE TIMES A prediction of a dry land bridge connection is that times of divergence between Antillean groups and their mainland counterparts should cluster around 35 to 33 mya, according to the model of Iturralde-Vinent and MacPhee (1999). Molecular clock studies of West Indian vertebrates do not show this pattern, but instead show a scattering of divergence times throughout the Cenozoic (Hedges et al., 1992; Hedges, 1996b). Iturralde-Vinent and MacPhee criticize several aspects of these studies, with emphasis on the most recent study (Hedges, 1996b). None of these criticisms is valid, and I will respond to each of them below. Ironically, the evidence that they have erred in their criticisms was provided, in most cases, in the original paper (Hedges, 1996b). Number of Lineages Analyzed The first criticism of Iturralde-Vincent and MacPhee is that the number of evolutionary lineages was not correctly counted. This is not true. Information on time of origin was unavailable for 4 of the 77 lineages in my study, and the concern of Iturralde-Vinent and MacPhee (1999) was that the readers were misled into thinking that such information was available and supported dispersal. But the relevant table (Hedges, 1996b: table 3) and text are clear about information available and not available: “At least some information is available for nearly all lineages (73/77 = 95%), and of those all but one (99%) are in the Cenozoic” (Hedges, 1996b:113) (note the fraction given in the original text). Even that statement was conservative because the four lineages in question also probably arose by dispersal: “Of the four lineages for which no data on the time of origin are available (Hyla heilprini, Phyllodactylus wirshingi, Mabuya lineolata, and the Leptotyphlops

24

Biogeography of the West Indies: Patterns and Perspectives

bilenata group), all have congeneric species on mainland Central or South America and none have highly divergent morphologies that would suggest a long period of isolation. Therefore all four of those lineages likely arose in the Cenozoic by dispersal” (p. 113). In a footnote, Iturralde-Vinent and MacPhee (1999:41) comment that there were three “errors” in my tabulation of data. Again, these were not errors but confusions on the part of IturraldeVinent and MacPhee. Regarding the first purported error, they state that “Crocodylus intermedius, known from only one or two individuals, cannot be considered to be established in the West Indies.” But my criteria (Hedges, 1996b) did not consider the number of individuals — after all, some West Indian species are known only from the holotype. I excluded lineages known to be introduced by humans and C. intermedius was not in that category. Schwartz and Henderson (1991) considered C. intermedius to be part of the West Indian herpetofauna and I do not disagree with their interpretation. The second purported error involves one of the four populations of the lizard Iguana iguana. Iturralde-Vinent and MacPhee state that I. iguana “does not occur on the Cayman Islands.” This is incorrect. Schwartz and Henderson (1991) included it as part of the endemic (not introduced) Cayman herpetofauna, and its continued presence in the Cayman Islands has been confirmed (A. Echternacht, personal communication). If it is later found that it was introduced by humans (a possibility), then it would be removed from consideration as a native lineage, but in any case the statement by Iturralde-Vinent and MacPhee, that it does not occur on the Cayman Islands, is incorrect. The third purported error mentioned in the footnote concerns another lizard. Iturralde-Vinent and MacPhee state that “Mabuya bistriata is presumably a lapsus for Mabuya mabuya; M. bistriata is a Brazilian species.” There was no lapsus. As detailed in the checklist of West Indian amphibians and reptiles (Powell et al., 1996) in the same volume as my study, a taxonomic problem with M. mabuya led to the recognition of the West Indian populations as M. bistriata. Thus the use of the name M. bistriata was not an error but followed current usage. Mixture of Morphological and Immunological Data The second criticism by Iturralde-Vinent and MacPhee (1999) is that I mixed morphological and immunological (not immunodiffusion, which is another method) data, and that this obscures biogeographical inference. They state that, in the case of 40 lineages (56%), morphological data are used as a “proxy measure” of divergence time. This is not true. In a relatively small number of cases involving endemic West Indian species with congeners on the mainland, my stated assumption (see above) was that the divergence between two closely related species in the same genus (of these particular vertebrates) probably occurred in the Cenozoic and not in the Cretaceous. However, nearly all of the 40 lineages noted by Iturralde-Vinent and MacPhee involve species that have populations both in the West Indies and on the mainland. As stated in the methods, I assumed that populations of the same species most likely diverged in the Quaternary (2 to 0 mya) regardless of their morphological divergence; published support for this assumption was mentioned. Moreover, none of those time estimates was used in the figure showing times of origin (Hedges, 1996b: figure 2). Iturralde-Vinent and MacPhee were aware of this because they used this large number of nonendemics as a separate criticism (see below). Taxa Are Not Discriminated in Terms of Interpretative Significance Here, Iturralde-Vinent and MacPhee explain that different organisms disperse differently. For example, some lizards would be expected to raft rather than swim, whereas large crocodilians may not have required a raft. Of course this is true, but it is unclear why it is mentioned as a criticism because I made no claims to the contrary. However, it is worth noting that nearly all West Indian amphibians and reptiles are much smaller than a crocodilian and would most likely have dispersed by rafting.

Biogeography of the West Indies: An Overview

25

Overrepresentation and Ambiguous Significance of Nonendemics Iturralde-Vinent and MacPhee claim that I have overrepresented the number of nonendemic lineages, but they justify their claim by mentioning only three such species. However, I discussed each of the 77 lineages (including those three) separately (Hedges, 1996b) and, again, it appears that they have apparently overlooked that discussion. For Gonatodes albogularis, I mentioned that the Jamaican and Hispaniolan populations are recognized as an endemic subspecies suggesting that they are not the result of human introduction. For Hemidactylus brooki haitianus, I mentioned that the West Indian populations are considered to represent an endemic species, H. haitianus, in the accompanying checklist (Powell et al., 1996) and therefore are also not the result of human introduction. The origin of the third species in question, H. mabouia, is less clear, but that ambiguity is mentioned in the account of that species. Moreover, none of these three taxa is included in the figure of divergence times (Hedges, 1996b: figure 2). Iturralde-Vinent and MacPhee also claim that the nonendemics, in general, are overrepresented “relative to their importance.” My intention was to be objective and identify all independent lineages no matter when they arrived to the West Indies, as long as it was by natural means. A dispersal event in the Pleistocene could be just as important as a dispersal event in the Eocene. Although in my analysis these data were given equal importance, Iturralde-Vinent and MacPhee have the option not to consider them to be important. In any event, this is not an error or misrepresentation. Low Number of Nonendemic Lineages in the Greater Antilles This criticism is similar to the previous one in that Iturralde-Vinent and MacPhee place greater importance on some aspects of my analysis than others. In this case, their focus was on the Greater Antilles, so they were sensitive to the fact that Lesser Antillean lineages were included. But my study concerned the biogeography of the West Indies and therefore I was interested in the Lesser Antilles as well as the Greater Antilles. Again, there is no error or misrepresentation. Unknown Shaping Influence of Extinction The effect that the extinction of lineages has had on shaping the past and present composition of the West Indian fauna is unknown. The major problem is that there are very few Tertiary fossils. My analysis was not concerned with this question and therefore it is unclear why this was mentioned in this section of Iturralde-Vinent and MacPhee (1999). Finally, Iturralde-Vinent and MacPhee consider one possible source of error in the time estimation: phylogenetic error. This might happen when the closest mainland relative of an Antillean group is actually more distantly related, resulting in an overestimation of the divergence time. We mentioned this source of error in our original paper (Hedges et al., 1992) and noted that, because nearly all times were younger than the predicted time for vicariance, that this type of error, even if present, would not affect our conclusion. Iturralde-Vinent and MacPhee (1999) state that “it actually does matter because filling a matrix with overestimates can obscure whatever pattern — including any concentration of splits — that may exist within the phylogeny” (p. 45). Again, they have taken this out of context and misinterpreted the point. Our studies were not focused on testing a dry land bridge hypothesis in the Oligocene but rather proto-Antillean vicariance (Cretaceous) vs. dispersal (Cenozoic). So we were correct in stating that such error did not affect “our conclusion.” But at the same time, acknowledging that this source of error is a possibility is not the same as saying that our entire data set was full of this type of error. The latter is not true. Iturralde-Vinent and MacPhee further speculate that the “pre-28” mya splits might represent overestimates, in which case the absence of data points clustering at that time would not bear negatively on their model. However, all comparisons were chosen carefully, and I discussed each separately in the text (Hedges, 1996b). While a few pre-28 mya comparisons (e.g., Osteopilus,

26

Biogeography of the West Indies: Patterns and Perspectives

Typhlops, Amphisbaena) may be influenced by such phylogenetic error, most probably are not because other data were available to guide choice of sister group.

WATER CURRENTS Iturralde-Vinent and MacPhee (1999) claimed that some of the past current flow patterns “are incompatible with the history of faunal emplacement in the Caribbean region as envisaged by Hedges” (1996a, 1996b). They note that I gave “little attention to the varying paleogeographical configurations of the Caribbean region on current flow” (p. 45). This is not true, as I noted “because the Caribbean always has been north of the equator during geological history, the Coriolis Force would have produced the same clockwise current flow in the past, even while a water connection to the Pacific was in existence” (Hedges, 1996b:118). As will be seen below, the existence or not of the Aves Ridge land bridge would not alter this primary mechanism for the transport of flotsam from South America to the Antilles. Iturralde-Vinent and MacPhee (1999) present reconstructions of marine surface current patterns for four time periods during the Cenozoic (since latest Eocene) based on “slight modifications” of several primary sources. However, reference to those primary literature sources indicates that these purported slight modifications were in reality major modifications. For example, their reconstruction of 35 to 33 mya shows the Aves dry land bridge fully exposed, completely blocking current flow between the Atlantic and Pacific Oceans. However, their reference (Droxler et al., 1998) shows a continuous current flow from Atlantic to the Pacific, noting that “the Aves Swell might have been shallow enough for at least part of a 35 m.y. long interval to have modified the circulation of oceanic waters in the western North Atlantic and to have formed a partially or fully developed barrier to circulation” (p. 172). The two alternatives depend on whether there was a continuous dry land bridge (Iturralde-Vinent and MacPhee, 1999) or an island arc (Pindell, 1994). Even if the two alternatives were equally plausible (see discussion of geological evidence above), the water current flow patterns presented by Iturralde-Vinent and MacPhee are influenced by their need to explain how mammals got to the Greater Antilles. In this sense, it is circular reasoning to use such biased interpretation of surface current patterns to argue in favor of the same biogeographical model. Even Droxler et al. (1998) eluded to the influence of mammal fossils in their assessment of water current patterns: “very strong supporting evidence for this possibility [of a land bridge] comes from the islands of the Greater Antilles where fossil skeletal remains of early Miocene land mammals with South American affinities, including sloths, have been discovered” (MacPhee and Iturralde-Vinent, 1994, 1995; Iturralde-Vinent et al., 1996). However, they concluded that the part played by the exposure of the Aves Swell in “modifying the oceanic circulation and the regional and global environment is much more speculative” (p. 186). Even if the Aves Ridge formed a continuous land bridge that blocked marine current flow between the Atlantic and Pacific, this would not have prevented flotsam from reaching the Antilles. The North Atlantic Gyre would have functioned the same then as it does now, bringing currents up along the northeast coast of South America to the Caribbean (Figure 3). An equatorial countercurrent may have affected some areas along the northeast coast of South America because that region was not very far north of the equator at that time (Figure 3). However, even if this were true, at least some flotsam from northeastern South America would have been deposited on the Aves Ridge land bridge (i.e., part of the Antilles) and directly on the Greater Antilles. The attention given by Iturralde-Vinent and MacPhee to the rivers of northwestern (rather than northeastern) South America is misleading because, even today, they are less likely to be major contributors of flotsam to the Greater Antilles. Similarly misleading is the counterclockwise current direction, east of the Aves Ridge land bridge, shown by Iturralde-Vinent and MacPhee (1999: figure 10) in their water current reconstructions. Presumably this represents the Equatorial Countercurrent, but it was not illustrated in Droxler et al. (1998) — whose primary concern was paleocurrent flow in this region — and would be unlikely considering the Coriolis force (resulting in clockwise flow) and the fact that the Caribbean always has been north of the equator.

Biogeography of the West Indies: An Overview

A

27

Gulf Stream

Early Oligocene 3 6 - 3 0 M YA

Pacific Ocean Guiana Shield

B

Pacific Ocean

Gulf Stream

Pliocene/Quaternary 4 - 0 M YA

Guiana Shield

FIGURE 3 Water current patterns in the Caribbean region at two different times in the Cenozoic. Most features are based on Droxler et al. (1998), although more of the northeastern coast of South America is shown. Water current flow along the Guiana Shield (Guiana Current) is based on present-day water current patterns (Droxler et al., 1998) and inferred patterns in the past based on paleolatitude (Smith et al., 1994a). Carbonate platforms that may have affected current flow in the Caribbean are indicated with horizontal hatching. (A) Early Oligocene (36 to 30 mya). There are two possibilities. If the Aves Ridge were a dry land bridge (IturraldeVinent and MacPhee 1999; shown by dotted lines) the Guiana Current would have been deflected to the northwest along the Antillean landmasses and up to the Gulf Stream. If the Aves Ridge were a chain of islands (Droxler et al., 1998), then some current (dashed arrows) would have passed by the islands and on to the Pacific Ocean (as it did during the Miocene). In either case, rivers in northeastern South America draining into the Guiana Current would have provided a source of flotsam for the Antilles. (B) Pliocene and Quaternary (4 to 0 mya). The Guiana Current continues to flow along the northeastern coast of South America and into the Caribbean, bringing flotsam to the Antilles.

Most of northeastern South America, between the present-day Orinoco and Amazon Rivers, forms the Guiana Shield, and drainage from this region, because of its location southeast of the Lesser Antilles, is an important source of flotsam in the Caribbean (Guppy, 1917). The importance of this potential source region, and adjacent current patterns, is highlighted by the distribution and

28

Biogeography of the West Indies: Patterns and Perspectives

relationships of species occurring in northeastern South America and the Lesser Antilles (Henderson and Hedges, 1995, Hedges, 1996b: figure 4). This region also would have drained into the Atlantic during the Tertiary (Hoorn et al., 1995), but Iturralde-Vinent and MacPhee suggest that flotsam “would have been as likely to drift toward Africa as the West Indies” (p. 51). Even if true, it would only mean that about half of the millions of potential rafting organisms might be diverted elsewhere than the West Indies. However, to explain the origin of one Antillean lineage (e.g., tropidophiid snakes) requires only a single, very fortuitous rafting experience. Iturralde-Vinent and MacPhee take a similar approach in their discussion of bottle drift studies. For example, they conclude that the results “strongly imply that, given existing surface-current patterns, flotsam emitted from the Orinoco and Amazon rivers is much more likely to end up in southeastern North America or Central America than in the Greater Antilles.” But this has been known for some time (Guppy, 1917) and no one has ever claimed that all flotsam leaving South America automatically ends up in the Greater Antilles! Iturralde-Vinent and MacPhee may consider the rate of one out of every seven drift bottles released (on average) landing in the Greater Antilles to be low, but others would consider this number to be surprisingly high. In summary, Iturralde-Vinent and MacPhee do not consider that the number of rafts potentially carrying animals from South America to anywhere during the Cenozoic must have been very large (i.e., millions). This is because flotsam is quite common and animals, including amphibians, have been observed riding on flotsam (Guppy, 1917; Boyd, 1962; King, 1962; Heatwole and Levins, 1972; Censky et al., 1998). The particular destination of rafts from South America that do not land on the Greater Antilles is not of interest to understanding the origin of the Antillean fauna. It is already assumed that the vast majority of rafts and their occupants perish, and it is already known that some currents do not lead to the Antilles. For Caribbean biogeography, the most likely source of flotsam that reaches the Greater Antilles is South America, considering both past and present current patterns. The arguments given by Iturralde-Vinent and MacPhee (1999) do not change that conclusion.

INCONSISTENCIES

AND

PROBLEMS

IN

MODEL

OF

MACPHEE

AND ITURRALDE-VINENT

MacPhee and Iturralde (1994) proposed that the Aves Ridge became a land bridge in the Oligocene at 30 to 27 mya. The precise timing was based partly on uplift of the region (followed by subsidence at 27 mya) and partly on the major mid-Cenozoic sea level drop that occurred at about 30 mya (Haq et al., 1987). Presumably, this sudden drop of ~160 m fully exposed the Aves Ridge. According to their land bridge model, fauna should not have arrived prior to that time if the land bridge was the primary explanation for the origin of these endemic mammals. However, the discovery of a 34 to 33 mya sloth in Puerto Rico (MacPhee and Iturralde-Vinent, 1995) created a conundrum because it predated the land bridge. Rather than reject the land bridge as an explanation for the presence of the Puerto Rican sloth, MacPhee and Iturralde modified their model by making the land bridge an earlier event (35 to 33 mya). As an explanation, they stated “either the sea level drop is not accurately dated or was not global, or for some other reason did not affect GAARlandia [land bridge] in the way originally imagined” (MacPhee and Iturralde-Vinent, 1995:20). In the most recent version of their model, Iturralde-Vinent and MacPhee (1999:27) claim that “general tectonic uplift coincided with a major eustatic sea level drop at ca. 35 Ma” (Miller et al., 1996). However, the sea level drop shown by Miller et al. (1996) at 35 mya was not a redating of the major Oligocene drop (Haq et al., 1987) used by MacPhee and Iturralde (1994), now considered to be 32.2 mya (Miller et al., 1993), but rather another sea level drop altogether. This inconsistent use of evidence shows that their paleogeographical model was influenced by their biogeographical model (i.e., the need to have the land bridge in place before the sloth fossil date). Another inconsistency involves the definition of the land bridge itself. It is defined as a “subaerial connection (whether continuous or punctuated by short water gaps) between a continent and an off-shelf island (or island arc)” (Iturralde-Vinent and MacPhee, 1999:52). This definition is consistent with a textual description earlier in the paper (p. 31): “we argue that exposure of the ridgecrest

Biogeography of the West Indies: An Overview

29

created, for a short time ca 33–35 Ma, a series of large, closely spaced islands or possibly a continuous peninsula stretching from northern South America to the Puerto Rico/Virgin Islands Block.” However, in other places the Aves Ridge land bridge is considered to be continuous: “central to the hypothesis is the argument, sustained at length in this paper, that the Cenozoic paleogeography of the Caribbean region strongly favored emplacement over land (as opposed to over water) only once in the past 65 Ma” (p. 53). Moreover, they clearly illustrate the land bridge as a fully continuous dry land connection, with no water gaps, much like the current Isthmus of Panama (Iturralde-Vinent and MacPhee, 1999:figures 6 and 12). The difference between an island chain and a continuous land bridge is fundamental for biogeography. The former will behave as a biotic filter allowing only selected taxa to cross, whereas the latter will permit a greater diversity of terrestrial life (a cross section of a biota) to enter. But, in addition, the existence of a single water gap implies that all organisms that crossed that gap must have done so by swimming or floating on flotsam (i.e., overwater dispersal). As noted above, that the Aves Ridge was at least a chain of islands during the mid-Cenozoic is normally assumed in discussions of Caribbean biogeography and is not a new concept. The possibility that it was a continuous land bridge also has been raised previously (Woods, 1990) but, as discussed elsewhere in this chapter, the current biological evidence does not support that alternative. Finally, Iturralde-Vinent and MacPhee (1999:56) acknowledge that the taxonomic composition of the West Indian fauna, including the Tertiary mammal fossil record, supports an origin by dispersal (“low initial diversity model”) and not the transfer over land of a diverse fauna in the Oligocene. They also acknowledge that at least some sloths were adapted to marine habitats (Muizon and McDonald, 1995). This raises the question, that if the faunal evidence favors a filter and not a dry land bridge, and the geological evidence is equivocal, then why is the dry land bridge favored?

EVIDENCE

AGAINST A

MID-CENOZOIC LAND BRIDGE

As with the proto-Antillean vicariance model, evidence against a mid-Cenozoic dry land bridge connection between South America and the Antilles is the depauperate nature of the Antillean fauna and molecular clock estimates of divergence times for terrestrial vertebrates. With regard to faunal composition, Iturralde-Vinent and MacPhee (1999) concede that “all Tertiary [mammal] taxa recovered to date from these islands appear to be closely related to clades known from the Quaternary, which favors the low initial diversity model [overwater dispersal]” (p. 56). They acknowledge that the presence of a more diverse fauna on Jamaica during the Eocene (Domning et al., 1997) is not relevant to the Aves Ridge land bridge model because Jamaica was isolated and underwent submergence during the Oligocene. Concerning the available molecular clock time estimates, the data do not support a clustering of divergences around 35 to 33 mya as would be predicted by the land bridge model. Instead, divergence times are scattered throughout the Cenozoic (Hedges, 1996b). Geological data neither support nor refute the suggestion of a fully continuous dry land bridge.

DISCUSSION AND CONCLUSIONS It is tempting to consider a complex problem such as the historical biogeography of the West Indies in terms of several alternative mechanisms. However, there is no reason to exclude any of the three models discussed above based on purely geological grounds. Nonetheless, the evidence reviewed in this chapter suggests that most lineages of West Indian vertebrates arrived by overwater dispersal during the Cenozoic. If most arrived by proto-Antillean vicariance in the late Cretaceous or by a land bridge (Aves Ridge) in the mid-Cenozoic, one would expect to see a more diverse fauna resembling a cross section of the continental fauna. However, the present fauna exhibits reduced higher-level diversity, and the fossil record suggests that this pattern was similar in the past. Molecular time estimates also indicate that nearly all lineages examined arrived in the Cenozoic and not the Cretaceous. They also do not support a mid-Cenozoic land bridge because they are

30

Biogeography of the West Indies: Patterns and Perspectives

scattered throughout the Cenozoic, rather than clustered. Finally, phylogenetic evidence points to an origin from South America for most nonvolant lineages examined, and this is congruent with water current patterns in the Atlantic and Caribbean today and throughout the Cenozoic. While there is sufficient evidence now to indicate that overwater dispersal is the general pattern, it is not possible to exclude other mechanisms. For example, it is quite possible that an early Antillean fauna, now extinct (Domning et al., 1997), arose through vicariance. Also, the frogs of the genus Eleutherodactylus appear to represent an ancient lineage in the West Indies that may have originated in the late Cretaceous or early Cenozoic (Hedges et al., 1992; Hedges, 1996b). Other extant lineages such as the xantusiid lizards and insectivores also may have arrived early in the history of the Antilles. Geological data and paleogeographical reconstructions will continue to be refined and contribute to our understanding of biogeography. Nonetheless, when such reconstructions of Earth history are influenced by particular biogeographical models, that bias affects their utility. Unfortunately, the most extensive work on paleogeography of the West Indies (Iturralde-Vinent and MacPhee, 1999) falls into this category. It shows a continuous dry land bridge in the mid-Cenozoic and no land connections prior to the late Eocene. However, as discussed above, geological evidence is inconclusive with regard to both major features of their reconstruction. In this case, the paleogeographical reconstructions of Iturralde-Vinent and MacPhee, taken literally, exclude proto-Antillean vicariance and offer a dry land corridor for emplacement of a mid-Cenozoic biota. In this sense, their biogeographical model and “paleogeographical reconstruction” are one and the same. It is more useful for biogeographers to base their conclusions on unbiased reconstructions of Earth history. Although some important Tertiary vertebrate fossils have been discovered in recent years in the Antilles, these represent only a small fraction of the endemic extant lineages. In addition, fossils provide only a minimum time of origin of a lineage. The major gap in our knowledge of Caribbean biogeography is not the fossil record — which will always remain fragmentary and biased — but the phylogeny and divergence times of the extant biota. If most lineages arrived in the late Cretaceous, vicariance is a strong possibility, whereas a mid-Cenozoic arrival could be explained by a land bridge. An origin during the last 25 million years would indicate an arrival only by overwater dispersal. Unfortunately, molecular time estimates are known only for selected lineages of vertebrates, and in most of those cases, they are based on an indirect measure of time from one gene (serum albumin). Ideally, we would like to know the relationships and times of origin from multiple nuclear and mitochondrial genes for all Antillean groups of organisms. Given the limited resources for systematics, this information may not be available for all groups even in the future. Nonetheless, a major advance should come in the next decade when such sequence data become more generally available. With these data and new fossil discoveries, we can look forward in the near future to resolving many of these long-unanswered questions in Caribbean biogeography.

ACKNOWLEDGMENTS I thank the many individuals who have assisted me in the field over the years. Carla Hass offered helpful comments on the manuscript and Anthony Geneva assisted with the figures. This research was supported by grants from the U.S. National Science Foundation.

LITERATURE CITED Adams, C. D. 1972. Flowering Plants of Jamaica. The University of the West Indies, Mona, Jamaica. Barbour, T. 1916. Some remarks upon Matthew’s “climate and evolution.” Annals of the New York Academy of Science 27:1–15. Bayuck, B. 1999. Taxonomists are an endangered species in Europe. Nature 401:321.

Biogeography of the West Indies: An Overview

31

Boyd, C. E. 1962. Waif dispersal in toads. Herpetologica 18:269. Censky, E. J., K. Hodge, and J. Dudley. 1998. Over-water dispersal of lizards due to hurricanes. Nature 395:556. Cockerell, T. D. A. 1924. A fossil cichlid from the Republic of Haiti. Proceedings of the United States National Museum 63:1–3. Comer, J. B. 1974. Genesis of Jamaican bauxite. Economic Geology 69:1251–1264. Darlington, P. J. 1957. Zoogeography: The Geographical Distribution of Animals. Wiley, New York. Dengo, G. and J. E. Case (eds.). 1990. The Geology of North America. Volume H: The Caribbean Region. The Geological Society of America, Boulder, Colorado. Dietz, R. S., J. C. Holden, and W. P. Sproll. 1970. Geotectonic evolution and subsidence of Bahama Platform. Geological Society of America Bulletin 81:1915–1928. Domning, D. P., J. Emry, R. W. Portell, S. K. Donovan, and K. S. Schindler. 1997. Oldest West Indian land mammal: rhinoceratoid ungulate from the Eocene of Jamaica. Journal of Vertebrate Paleontology 17:638–641. Donnelly, T. W. 1992. Geological setting and tectonic history of Mesoamerica. Pp. 1–13 in Quintero, D. and A. Aiello (eds.). Insects of Panama and Mesoamerica. Oxford University Press, Oxford. Donovan, S. K. and T. A. Jackson (eds.). (1994). Caribbean Geology: An Introduction. University of the West Indies Publishers’ Association, Kingston, Jamaica. Droxler, A. W., K. C. Burke, A. D. Cunningham, A. C. Hine, E. Rosencrantz, D. S. Duncan, P. Hallock, and E. Robinson. 1998. Caribbean constraints on circulation between Atlantic and Pacific Oceans over the past 40 million years. Pp. 160–191 in Crowley, T. J. and K. C. Burke (eds.). Tectonic Boundary Conditions for Climate Reconstructions. Oxford University Press, New York. Emanuel, K. A., K. Speer, R. Rotunno, R. Srivastava, and M. Molina. 1994. Hypercanes: a possible link in global extinction scenarios. Eos (Supplement) 75:409 (Abstract). Gentry, A. H. 1992. Tropical forest biodiversity: distributional patterns and their conservational significance. Oikos 63:19–28. Graham, A. 1993. Contribution toward a Tertiary palynostratigraphy for Jamaica: the status of Tertiary paleobotanical studies in northern Latin America and preliminary analysis of the Guys Hill Member (Chapelton Formation, Middle Eocene) of Jamaica. Pp. 443–461 in Wright, R. M. and E. Robinson (eds.). Biostratigraphy of Jamaica. Geological Society of Jamaica, Boulder, Colorado. Graham, A. and D. M. Jarzen. 1969. Studies in neotropical paleobotany. 1. The Oligocene communities of Puerto Rico. Annals of the Missouri Botanical Garden 56:308–357. Grimaldi, D. A. 1995. The age of Dominican amber. Pp. 203–217 in Anderson, K. B. and J. C. Crelling (eds.). Amber, Resinite, and Fossil Resins. American Chemical Society, Washington, D.C. Guppy, H. B. 1917. Plants, Seeds, and Currents in the West Indies and Azores. Williams and Northgate, London. Haq, B. U., J. Hardenbol, and P. R. Vail. 1987. Chronology of fluctuating sea levels since the Triassic. Science 235:1156–1166. Hass, C. A. 1991. Evolution and biogeography of West Indian Sphaerodactylus (Sauria: Gekkonidae): a molecular approach. Journal of Zoology 225:525–561. Hass, C. A. and S. B. Hedges. 1991. Albumin evolution in West Indian frogs of the genus Eleutherodactylus: Caribbean biogeography and a calibration of the albumin immunological clock. Journal of Zoology 225:413–426. Hass, C. A., S. B. Hedges, and L. R. Maxson. 1993. Molecular insights into the relationships and biogeography of West Indian anoline lizards. Biochemical Systematics and Ecology 21:97–114. Heatwole, H. and R. Levins. 1972. Biogeography of the Puerto Rican Bank: flotsam transport of terrestrial animals. Ecology 53:112–117. Hedges, S. B. 1996a. Historical biogeography of West Indian vertebrates. Annual Review of Ecology and Systematics 27:163–196. Hedges, S. B. 1996b. The origin of West Indian amphibians and reptiles. Pp. 95–127 in Powell, R. and R. Henderson (eds.). Contributions to West Indian Herpetology: A Tribute to Albert Schwartz. Society for the Study of Amphibians and Reptiles, Ithaca, New York. Hedges, S. B. and R. L. Bezy. 1993. Phylogeny of xantusiid lizards: concern for data and analysis. Molecular Phylogenetics and Evolution 2:76–87. Hedges, S. B., R. L. Bezy, and L. R. Maxson. 1991. Phylogenetic relationships and biogeography of xantusiid lizards inferred from mitochondrial DNA sequences. Molecular Biology and Evolution 8:767–780.

32

Biogeography of the West Indies: Patterns and Perspectives

Hedges, S. B., C. A. Hass, and L. R. Maxson. 1992. Caribbean biogeography: molecular evidence for dispersal in West Indian terrestrial vertebrates. Proceedings of the National Academy of Sciences, U.S.A. 89:1909–1913. Henderson, R. W. and S. B. Hedges. 1995. Origin of West Indian populations of the geographically widespread boa Corallus enydris inferred from mitochondrial DNA sequences. Molecular Phylogenetics and Evolution 4:88–92. Hildebrand, A. R. and W. V. Boynton. 1990. Proximal Cretaceous-Tertiary boundary impact deposits in the Caribbean. Science 248:843–847. Holcombe, T. L. and N. T. Edgar. 1990. Late Cretaceous and Cenozoic evolution of Caribbean ridges and rises with special reference to paleogeography. Atti Dei Convegni Lincei (International Symposium on Biogeographical Aspects of Insularity) 85:611–626. Hoorn, C., J. Guerrero, G. A. Sarmiento, and M. A. Lorente. 1995. Andean tectonics as a cause for changing drainage patterns in Miocene northern South America. Geology 23:237–240. Iturralde-Vinent, M. A. and R. D. E. MacPhee. 1996. Age and paleogeographical origin of Dominican amber. Science 273:1850–1852. Iturralde-Vinent, M. A. and R. D. E. MacPhee. 1999. Paleogeography of the Caribbean region: implications for Cenozoic biogeography. Bulletin of the American Museum of Natural History 238:1–95. King, F. W. 1962. The occurrence of rafts for dispersal of land animals into the West Indies. Quarterly Journal of the Florida Academy of Sciences 25:45–52. Larue, D. K. 1994. Puerto Rico and the Virgin Islands. Pp. 151–165 in Donovan, S. K. and T. A. Jackson (eds.). Caribbean Geology: An Introduction. The University of the West Indies Publishers’ Association, Kingston, Jamaica. Liebherr, L. K. (ed.) 1988. Zoogeography of Caribbean Insects. Cornell University Press, Ithaca, New York. MacFadden, B. 1980. Rafting mammals or drifting islands? Biogeography of the Greater Antillean insectivores Nesophontes and Solenodon. Journal of Biogeography 7:11–22. MacPhee, R. D. E. and D. A. Grimaldi. 1996. Mammal bones in Dominican amber. Nature 380:489–490. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1994. First Tertiary land mammal from the Greater Antilles: an early Miocene sloth (Xenarthra, Megalonchidae) from Cuba. American Museum Novitates 3094:1–13. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1995. Origin of the Greater Antillean land mammal fauna, 1. New Tertiary fossils from Cuba and Puerto Rico. American Museum Novitates 3141:1–31. Malfait, B. T. and M. G. Dinkelman. 1972. Circum-Caribbean tectonic and igneous activity and the evolution of the Caribbean Plate. Bulletin of the Geological Society of America 83:251–272. Matthew, W. D. 1918. Affinities and origin of the Antillean mammals. Bulletin Geological Society of America 29:657–666. Maurrassee, F. J.-M. R. 1991. Impacts, tsunamis and the Haitian Cretaceous-Tertiary boundary layer. Science 252:1690–1693. Maxson, L. R. 1992. Tempo and pattern in anuran speciation and phylogeny: an albumin perspective. Pp. 41–57 in Adler, K. (ed.). Herpetology: current research on the biology of amphibians and reptiles. Society for the Study of Amphibians and Reptiles, Oxford, Ohio. Miller, K. G., G. S. Mountain, the Leg 150 Shipboard Party, and Members of the New Jersey Coastal Plain Project. 1996. Drilling and dating New Jersey Oligocene-Miocene sequences: ice-volume, global sea level, and Exxon records. Science 271:1092–1095. Miller, K. G., P. R. Thompson, and D. V. Kent. 1993. Integrated late Eocene-Oligocene stratigraphy of the Alabama coastal plain: correlation of hiatuses and stratal surfaces of glacioeustatic lowerings. Paleoceanography 8:313–331. Morgan, G. S. 1993. Quaternary land vertebrates of Jamaica. Geological Society of America, Memoir 182:417–442. Morgan, G. S. and C. A. Woods. 1986. Extinction and the zoogeography of West Indian land mammals. Biological Journal of the Linnean Society 28:167–203. Morrone, J. J. and J. V. Crisci. 1995. Historical biogeography: introduction to methods. Annual Reviews of Ecology and Systematics 26:373–401. Muizon, C. D. and H. G. McDonald. 1995. An aquatic sloth from the Pliocene of Peru. Nature 375:224–227. Nelson, G. and N. I. Platnick. 1981. Systematics and Biogeography: Cladistics and Vicariance. Columbia University Press, New York.

Biogeography of the West Indies: An Overview

33

Olson, S. L. 1978. A Paleontological Perspective of West Indian Birds and Mammals. Proceedings of the Academy of Natural Sciences, Philadelphia, Special Publication 13:99–117. Pereira, L. A., D. Foddai, and A. Minelli. 1997. Zoogeographical aspects of Neotropical Geophilomorpha. Entomologica Scandinavica Supplementum 51:77–86. Perfit, M. R. and E. E. Williams. 1989. Geological constraints and biological retrodictions in the evolution of the Caribbean Sea and its islands. Pp. 47–102 in Woods, C. A. (ed.). Biogeography of the West Indies. Sandhill Crane Press, Gainesville, Florida. Pindell, J. L. 1994. Evolution of the Gulf of Mexico and the Caribbean. Pp. 13–39 in Donovan, S. K. and T. A. Jackson (eds.). Caribbean Geology: An Introduction. The University of the West Indies Publishers’ Association, Kingston, Jamaica. Poinar, G., Jr. and R. Poinar. 1999. The Amber Forest. Princeton University Press, Princeton, New Jersey. Powell, R., R. W. Henderson, K. Adler, and H. A. Dundee. 1996. An annotated checklist of West Indian amphibians and reptiles. Pp. 51–93 in Powell, R. and R. Henderson (eds.). Contributions to West Indian Herpetology: A Tribute to Albert Schwartz. Society for the Study of Amphibians and Reptiles, Ithaca, New York. Pregill, G. K. 1986. Body size of insular lizards: a pattern of Holocene dwarfism. Evolution 40:997–1008. Pregill, G. K. 1999. Eocene lizard from Jamaica. Herpetologica 55:157–161. Pregill, G. K. and S. L. Olson. 1981. Zoogeography of West Indian vertebrates in relation to Pleistocene climatic cycles. Annual Review of Ecology and Systematics 12:75–98. Pregill, G. K., R. I. Crombie, D. W. Steadman, L. K. Gordon, F. W. Davis, and W. B. Hilgartner. 1992. Living and late Holocene fossil vertebrates, and the vegetation of the Cockpit Country, Jamaica. Atoll Research Bulletin 353:1–19. Robinson, E. 1994. Jamaica. Pp. 111–127 in Donovan, S. K. and T. A. Jackson (eds.). Caribbean Geology: An Introduction. University of the West Indies Publishers’ Association, Kingston, Jamaica. Rosen, D. E. 1975. A vicariance model of Caribbean biogeography. Systematics Zoology 24:431–464. Rosen, D. E. 1985. Geological hierarchies and biogeographic congruence in the Caribbean. Annals of the Missouri Botanical Garden 72:636–659. Scharff, R. F. 1912. Distribution and Origin of Life in America. Macmillan, New York. Schubart, C. D., R. Diesel, and S. B. Hedges. 1998. Rapid evolution to terrestrial life in Jamaican crabs. Nature 393:363–365. Schuchert, C. 1935. Historical geology of the Antillean-Caribbean region. John Wiley & Sons, New York. Schwartz, A. and R. W. Henderson. 1991. Amphibians and Reptiles of the West Indies. University of Florida Press, Gainesville. Simpson, G. G. 1956. Zoogeography of West Indian land mammals. American Museum Novitates 1759:1–28. Smith, A. G., D. G. Smith, and B. M. Funnell. 1994a. Atlas of Mesozoic and Cenozoic Coastlines. Cambridge University Press, Cambridge. Smith, D. S., L. D. Miller, and J. Y. Miller. 1994b. The Butterflies of the West Indies and South Florida. Oxford University Press, Oxford. Wallace, A. R. 1881. Island Life. Harper, New York. Williams, E. E. 1989. Old problems and new opportunities in West Indian biogeography. Pp. 1–46 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Wilson, E. O. 1985. Invasion and extinction in the West Indian ant fauna: evidence from Dominican amber. Science 229:265–267. Wilson, E. O. 1992. The Diversity of Life. Harvard University Press, Cambridge, Massachusetts. Woods, C. A. 1990. The fossil and recent mammals of the West Indies: an analysis of the origin, evolution, and extinction of an insular fauna. Atti Dei Convegni Lincei (International Symposium on Biogeographical Aspects of Insularity) 85:642–680. Woods, C. A. and J. A. Ottenwalder. 1992. The Natural History of Southern Haiti. Florida Museum of Natural History, Gainesville, Florida.

Change in the 3 Climate Circum-Caribbean (Late Pleistocene to Present) and Implications for Regional Biogeography Jason H. Curtis, Mark Brenner, and David A. Hodell Abstract — We present high-resolution paleoclimate reconstructions for the circum-Caribbean region spanning the late Pleistocene to present. The stable oxygen isotope signature (δ18O) of carbonate shells from 14C-dated lake sediment cores served as a proxy for shifts in the evaporation/precipitation ratio (E/P). Inferred changes in temperature over the Pleistocene–Holocene transition were based on pollen sequences. Both continental and insular archives provide a similar, coherent picture of regional climate change since the late Glacial. Late Pleistocene conditions were cool and arid, as indicated by dry lake beds, a cold/xeric-adapted flora, and relatively positive oxygen isotopic signatures. The transition into the early Holocene was marked by warmer, moister climate. Regional lakes filled, tropical forests expanded, and δ18O values in shells declined. The middle Holocene moist period terminated about 3000 BP with the onset of drier conditions. Long-term, millennial-scale variations in moisture availability were tied to the intensity of the annual cycle and position of the Inter-Tropical Convergence Zone (ITCZ). The intensity of the annual cycle was controlled by solar insolation which was, in turn, governed by orbital forcing. Late Holocene paleoclimate records also contain evidence for pronounced climate shifts of short duration, some of which probably impacted human cultures in the region. These rapid climate changes were not orbitally driven and may have been a consequence of aerosols injected into the atmosphere during volcanic eruptions, solar input variability, changes in ocean circulation, or deforestation. Our data require that discussions of West Indian biogeography consider the role that climate changes since the last Glacial played in shaping the modern distribution and abundance of the circum-Caribbean flora and fauna.

INTRODUCTION Discussions of West Indian biogeography have been preoccupied with the influence of long-term geological processes, such as plate tectonics and land emergence/submergence, on faunal colonization and extinction in the Caribbean islands (Williams, 1989). Biogeographers have proposed several models that invoke past land bridges, cross-water dispersal, and vicariance to explain the initial arrival of insular animal taxa and their contemporary distributions on geographically isolated islands. Hypothesized modes of colonization, as well as subsequent disappearances of some taxonomic groups, are sometimes tested using the fossil record. Clearly, age-old geological changes have left their mark with respect to the modern distribution and abundance of both animals and plants in the region. Interpretations of modern West Indian biogeography must, however, consider more recent factors that have affected the Caribbean biota. Humans, for example, were responsible for biotic introductions and extinctions over the last few millennia. Late Pleistocene and Holocene climate changes in the region have also played an important role in determining the modern distribution of organisms. Climate changes have influenced biotic communities directly and indirectly, through impact on human cultures. 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

35

36

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 1 Map of the circum-Caribbean region indicating the location of lakes used in this study. The numbers on the map indicate the positions of the following lakes: (1) Lakes Punta Laguna and Coba; (2) Lake Chichancanab; (3) Lake Peten-Itza; (4) Lake Valencia; (5) Lake Miragoâne.

TABLE 1 General Information about the Circum-Caribbean Lakes Used in This Study

Latitude Longitude Area (km2) Altitude (m) Date cored (d-m-y) Core length (m) Core site Zb (m) Zb max (m) Lake water δ18O 14C dating a b c d e f

Peten-Itza

Valencia

Miragoâne

Chichancanab

Coba

Punta Laguna

16°55′N 89°50′W 100 ~100a 6-VII-93 5.45 7.55 160 c 2.6‰ terr e

10°10′N 67°52′W 350 402 16-VII-94 5.68 9.4 37 3.2‰ terr

18°24′N 73°05′W 7 20 25, 28-VII-85 7.53 42 42 —d aqua f

19°50′N 88°45′W 10 ~20a 25-VI-93 4.90 6.9 12.5 3.2‰ terr

20°30′N 87°44′W 0.55 ~15a 14, 15-VIII-80 8.80 4.6 ~8 c 0.5‰ terr/aqua

20°38′N 87°30′W 0.9 14 22-VI-93 6.30 6.3 12 c 0.93‰ terr

Altitude estimated. Z = depth. Depth estimate; lakes lack detailed bathymetry. — = no isotopic information. terr = terrestrial matter used in the construction of the age model. aqua = aquatic matter used in the construction of the age model.

We present paleolimnological evidence for climate shifts that occurred in the circum-Caribbean area from the late Pleistocene to present, discuss the possible factors that may have driven these climate changes, and provide some examples of biotic responses to the alterations in temperature and moisture availability. The evidence comes from studies of lake sediment cores collected at both insular and mainland sites. Lake sediments can provide high-resolution records of past climate because they accumulate at relatively rapid rates (~0.5 to 5.0 mm yr –1) and frequently contain proxy indicators of past climate conditions. For example, pollen grains preserved in accreting lake mud can be used to “reconstruct” past vegetation assemblages, which in turn reflect prehistoric climate. Likewise, the stable oxygen isotope (δ18O) signature of sedimented carbonate shells can be utilized to infer past shifts in the relation between evaporation and precipitation (E/P). This regional paleoclimate synthesis compares δ18O records from lake sediment cores collected at several sites throughout the circum-Caribbean. We used oxygen isotope records from multiple

Climate Change in the Circum-Caribbean and Implications for Regional Biogeography

37

sites to evaluate similarities and differences in climate evolution over a broad geographical area. Principal waterbodies examined in this study included Lakes Punta Laguna, Chichancanab, and Coba on the Yucatan Peninsula, Mexico; Lake Peten-Itza, Peten, Guatemala; Lake Valencia, northern Venezuela; and Lake Miragoâne, southwestern Haiti. Study lakes are distributed around the Caribbean Sea between about 10 and 20° north latitude and between 67 and 90° west longitude (Figure 1, Table 1). Lake Miragoâne is the only insular record reported, reflecting, in part, the limited number of appropriate, natural freshwater study lakes in the West Indies (Candelas and Candelas, 1963). The investigated lakes lie at relatively low altitude, varying in elevation from 14 to 402 m above sea level. They range in surface area from 0.55 (Coba) to 350 km2 (Valencia) (Table 1). Maximum depths for the water bodies are between about 8 (Coba) and ~160 m (Lake Peten-Itza). Lakes Miragoâne and Peten-Itza are crypto-depressions, i.e., deepest water in the lakes lies below modern sea level. Sediment cores were recovered from water depths ranging between about 4.6 and 42 m. Finally, all the lakes are effectively closed hydrologically, losing most of their water to evaporation. The exceptions, Lakes Miragoâne and Valencia, at present or historically have lost a fraction of their annual hydrologic budgets to overland outflow.

USING OXYGEN ISOTOPES IN FRESHWATER CARBONATE SHELLS TO INFER PAST CLIMATE The three naturally occurring stable isotopes of oxygen are 16O, 17O, and 18O. The lightest isotope (16O) is most common, representing 99.7630% of the isotope pool. The rarest (17O) constitutes only 0.0375% of the total, while 18O accounts for 0.1995%. The three isotopes differ in mass and therefore behave differently when they enter into physical, chemical, and biological processes in the environment. These differential behaviors among the oxygen isotopes and their consequent changing relative abundance in the environment are exploited for paleoclimate reconstructions. The stable isotope (δ18O) signal in sedimented freshwater carbonate shells can be used to infer past climate conditions. The rationale for employing this approach to paleoclimate reconstruction, discussed in detail by Talbot (1990), Chivas et al. (1993), Curtis and Hodell (1993), and Holmes (1996), is reviewed briefly here. The oxygen isotope ratio (18O/16O) in sedimented carbonate shells of freshwater ostracods and gastropods is governed by two factors: (1) the δ18O of the lake water at the time the organism lived and (2) the temperature at which carbonate precipitation occurred. There is little evidence for major changes in mean temperature over the last 10,000 years. The major determinant of δ18O in freshwater shell carbonate during the Holocene has therefore been the δ18O of the lake water from which it was precipitated. The 18O/16O ratio of lake water has, in turn, been controlled by hydrologic variables. Assuming that the δ18O of regional rainfall remained fairly constant during the Holocene, relative changes in hydrologic inputs and outputs have governed the in-lake δ18O. In tropical, closed-basin lakes, i.e., those that lack significant overland outflows, the hydrologic budget and δ18O of lake water are most influenced by the relation between evaporation (E) and precipitation (P) (Fontes and Gonfiantini, 1967; Gasse et al., 1990; Lister et al., 1991). During dry periods (high E/P), the 18O/16O ratio in the water column increases, i.e., δ18O becomes more positive because H216O, with its higher vapor pressure, is preferentially lost to evaporation. Conversely, during moist periods (low E/P), the lake water 18O/16O ratio declines, i.e., δ18O becomes more negative. Ostracods and snails preserve within their carbonate shells a record of the E/P conditions that prevailed during their lifetimes. They are short-lived and on death their shells are incorporated into the lake bottom sediments, thereby preserving a stratigraphic archive of past climate change (E/P). The oxygen isotopic signature (δ18O) in sedimented shell material can be determined by mass spectrometry. Results are presented in standard delta notation, an expression of the isotopic composition of the shell material relative to the Vienna PeeDee Belemnite (VPDB) standard: 18

16

18

16

( O ⁄ O ) sample – ( O ⁄ O ) VPDB 18 - × 1000 δ O = ---------------------------------------------------------------------------18 16 ( O ⁄ O ) VPDB

38

Biogeography of the West Indies: Patterns and Perspectives

The resulting value is basically an expression of the departure of the 18O/ 16O ratio in the sample from that of the standard, expressed on a per mil (‰) basis. More positive values indicate relatively higher E/P (drier) conditions, while more negative values indicate relatively lower E/P (moister) conditions at the time the organism lived. Generally, δ18O stratigraphies from lake sediment cores are developed using shells of the same taxon collected at numerous depths throughout a profile. Various taxa can potentially fractionate differentially, or “discriminate” among the oxygen isotopes. This phenomenon, referred to as the “vital effect,” makes it difficult to interpret a composite δ18O stratigraphy generated using multiple taxa. In situations where a single taxon is not found throughout the record, oxygen isotope ratios can be measured in multiple taxa from overlapping depths to assess or correct for “vital effect.” Multiple δ18O stratigraphies from a single lake can sometimes be generated using several taxa that occupy different ecological niches. In such cases, if stratigraphic trends for all taxa are similar, one can have greater confidence in the paleoclimatic interpretations.

DETERMINING THE TIMING OF CLIMATE CHANGES Changes in the past relation between evaporation and precipitation (E/P) can be inferred from stratigraphic shifts in the δ18O of sedimented carbonate shells. To determine the timing of climate shifts requires reliable sediment chronologies. Age/depth relations for sediment cores in this study were established primarily using accelerator mass spectrometry (AMS) radiocarbon dating. In addition, three conventional radiocarbon dates were obtained from the Lake Coba core and one conventional 14C date was run on the section from Lake Miragoâne (Table 2). Counting errors associated with individual 14C dates were ±90 years for AMS samples, while error for the four conventional 14C dates were ±160 years (Table 2). Radiocarbon dates on terrestrial material (e.g., wood, charcoal, seeds) were used preferentially to develop age/depth models. Shells and organic matter of aquatic origin, as well as bulk sediment from water bodies in karst terrain, are susceptible to hard-water-lake dating error (Deevey and Stuiver, 1964). In hard-water lakes, 14C dates on lacustrine shells and organic matter can be affected by the input of “old” bicarbonate-carbon that is derived from dissolution of ancient limestone in the watershed and is devoid of 14C. This “old” carbon can be incorporated into organic matter during photosynthesis and passed up the food chain. It may also be fixed in the carbonate of calcite and aragonite shells. Bulk sediment presents dating difficulties because it can contain “old,” detrital carbonate. Detailed discussion of the core chronologies presented here (Table 2) are found in Curtis and Hodell (1993), Curtis et al. (1996, 1998, 1999), Hodell et al. (1991, 1995), Leyden et al. (1998), and Whitmore et al. (1996). Temporal resolution among the isotopic records from the six lakes varies as a consequence of inter-core differences in sedimentation rates and stratigraphic sampling intervals. There is about a threefold difference with respect to long-term, average sedimentation rate between the water body with the highest rate of sediment accumulation (Punta Laguna = 1.6 mm yr –1) and the lake with the lowest sediment accumulation rate (Valencia = 0.49 mm yr –1) (Table 3). Cores from the study lakes were sampled at 1-cm intervals, with the exception of the Lake Coba section, which was sampled at 5-cm intervals. Carbonate shells were abundant in cores from Lakes Punta Laguna, Miragoâne, Peten-Itza, and Chichancanab. Consequently, δ18O records from those basins are relatively continuous (Table 3, Figure 2). In contrast, shell material was encountered sporadically in the Coba and Valencia cores, resulting in discontinuous, lower-resolution δ18O records. The time resolution at which climatic changes can be resolved in the records differs among cores. For example, high sedimentation rates coupled with close-interval sampling enabled us to resolve multi-decadal events in the Punta Laguna core. The Valencia, Miragoâne, Peten-Itza, and Chichancanab cores yielded results that allow us to resolve climatic shifts that occur over time frames of 50 to 100 years. In contrast, slower sedimentation rate combined with broad sampling intervals in the Lake Coba core permitted only centennial–millennial resolution of climate events.

Climate Change in the Circum-Caribbean and Implications for Regional Biogeography

TABLE 2 Radiocarbon Dates for Circum-Caribbean Cores Sample Type

Depth (cm)

Accession Number

Lake Punta Laguna, Yucatan, Mexico core 22-VI-93 Aquatic gastropods 25 OS-6549 Terrestrial wood 81 OS-6550 Aquatic gastropods 83 OS-6551 Terrestrial wood 145 OS-10009 Terrestrial wood 197 OS-10010 Aquatic gastropods 246 OS-6552 Terrestrial wood 380 OS-6553 Terrestrial wood 494 OS-6554 Aquatic gastropods 600 OS-5760 Peten-Itza, Peten, Guatemala core 6-VII-93 Aquatic shell 28–30 OS-6555 Terrestrial wood 57 OS-6556 Charcoal 73–76 OS-10004 Charcoal 107.5 OS-10005 Terrestrial wood 113.5 OS-10006 Aquatic shell 190 OS-6557 Terrestrial wood 255.5 OS-10008 Terrestrial wood 340 OS-6558 Terrestrial wood 505 OS-6559 Aquatic shell 506 OS-5761 Terrestrial wood 527 OS-6560 Valencia, Venezuela core 16-VII-94 Terrestrial wood 31 OS-8854 Ostracods 31.5 OS-8855 Terrestrial wood 69.5 OS-8856 Ostracods 69.5 OS-8857 Terrestrial wood 139 OS-8858 Terrestrial wood 171 OS-8859 Terrestrial wood 231 OS-10011 Charcoal 249 OS-10012 Ostracods 253 OS-8860 Ostracods 378 OS-8861 Terrestrial wood 486 OS-8862 Terrestrial wood 511 OS-8863 Terrestrial wood 560 OS-8864 Chichancanab, Yucatan, Mexico core 25-VI-93 Pyrgophorus 15 CAMS-12900 Terrestrial seed 65 OS-3545 Pyrgophorus 65 OS-3443 Pyrgophorus 103 OS-3446 Bivalves 142 OS-2148 Pyrgophorus 238 OS-3445 Pyrgophorus 314 OS-3444 Mixed gastropods 350 OS-2051 Mixed gastropods 385 OS-2729 Bivalves 406 OS-2055 Terrestrial charcoal 421 OS-2157 Terrestrial charcoal 421 CAMS-12780 Terrestrial charcoal 421 CAMS-12781 Land snail 472 OS-2052

Radiocarbon Age (yr BP) 1320 ± 25 610 ± 50 a 1930 ± 70 965 ± 25a 1530 ± 50 a 3160 ± 30 2440 ± 45a 2840 ± 30a 3720 ± 40 985 ± 30 75 ± 25a 815 ± 25a 1260 ± 30 a 1660 ± 30 a 4200 ± 30 4870 ± 80 a 5600 ± 35a 8480 ± 55a 10250 ± 50 8840 ± 55a 185 ± 40 a 485 ± 30 1730 ± 35a 1810 ± 35 3310 ± 35a 4830 ± 40a 7670 ± 40a 8330 ± 85a 7990 ± 45 9370 ± 80 10200 ± 55a,b 9960 ± 70 a,b 12400 ± 60 a 1550 ± 60 1140 ± 35a 1600 ± 30 3200 ± 40 5210 ± 30 7100 ± 30 9040 ± 65 8680 ± 45 9530 ± 60 9500 ± 50 7560 ± 35a 7600 ± 60 a 7460 ± 60 a 9180 ± 50 a

Corrected Age (yr BP)

39

40

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 (continued) Radiocarbon Dates for Circum-Caribbean Cores Sample Type

Depth (cm)

Accession Number

Coba, Quintana Roo, Mexico core 14, 15-VIII-80 Ostracods 75 OS-59 Ostracods 335 OS-60 Bulk sedimentc 395–400 Beta-63470 Ostracods 575 OS-61 Bulk sedimentc 620–624 Beta-63471 Ostracods 720 OS-62 Bulk sedimentc 841 –846 Beta-63472 Terrestrial wood 865 –870 OS-10014 Miragoâne, Haiti core 25, 28-VII-85 210Pb 8 Ostracods 22 AA-6703 Ostracods 216 AA-5814 Ostracods 233 AA-6704 Terrestrial wood 233 AA-6705 Ostracods 321 AA-5815 Ostracods 418 AA-5816 Ostracods 520 AA-5817 Ostracods 622 AA-5818 Ostracods 671 AA-5369 Ostracods 718 AA-5952 Bulk sedimentc 753 GX-13055 a b c

Radiocarbon Age (yr BP)

Corrected Age (yr BP)

1780 ± 65 2600 ± 50 2600 ± 100 3880 ± 70 4440 ± 80 6880 ± 40 7410 ± 80 7600 ± 35a

460a 1280a 1280a 2560a 3120a 5560a 6090a

129 ± 40 1085 ± 60 2780 ± 55 2680 ± 60 1655 ± 60 4110 ± 60 4780 ± 60 6945 ± 65 9005 ± 75 9700 ± 90 10300 ± 85 10230 ± 160

129a 85a 1780a 1680a 1655a 3110a 3780a 5945a 8005a 8700a 9300a 10230a

Used in chronology of sediment core. Averaged for 10,080 14C yr BP at 498.5 cm depth in the Lake Valencia core. Conventional 14C date.

TABLE 3 Sedimentation Rates, Sample Spacing, and Sample Interval for Circum-Caribbean Cores Lake

Sedimentation Rate (mm/year)

Sample Interval (cm)a

Sample Spacing (years/sample)a

Punta Laguna Coba Miragoâne Peten-Itza Chichancanab Valencia

1.6 1.1 0.73 0.59 0.56 0.49

1 5 1 1 1 1

5.4 90 17 15 17 27

a

Isotope samples.

Robust chronologies and high sampling resolution permit good correlation of climate records from Lakes Punta Laguna, Peten-Itza, Valencia, and Chichancanab. Dating uncertainties associated with hard-water-lake correction in the Miragoâne and Coba cores suggest that correlations with the other four sections are only possible at broad timescales.

Climate Change in the Circum-Caribbean and Implications for Regional Biogeography

41

FIGURE 2 Oxygen isotopic composition of carbonate shell material (ostracods and/or gastropods) for Lakes Valencia, Miragoâne, Peten-Itza, Chichancanab, Coba, and Punta Laguna vs. radiocarbon years BP. For the Lake Valencia record,  = Heterocypris communis, + = Cytheridella boldi, × = Cypria obtua, and ▫ = Pyrgophorus sp. For the Lake Miragoâne record, + = Candona n. sp. For the Lake Peten-Itza record,  = Candona sp. and + = Cytheridella ilosvayi. In the Lake Chichancanab record,  = Cyprinotus cf. salinus and + = Physocypria xanabanica. For the Lake Coba record,  = Physocypria xanabanica and + = Cytheridella ilosvayi. In the Punta Laguna record, + = Cytheridella ilosvayi.

LATE PLEISTOCENE AND HOLOCENE CLIMATE CHANGE IN THE CIRCUM-CARIBBEAN LATE PLEISTOCENE ARIDITY Prior to ~10,500 14C yr BP, our study basins were effectively dry, precluding recovery of lacustrine sediment cores for oxygen isotopic analysis. Nevertheless, low water levels or complete desiccation of circum-Caribbean basins until ~10.5 to 8.0 14C kyr BP points to regional, late Pleistocene aridity. Paleoenvironmental studies from many lowland sites in the Northern Hemisphere Neotropics indicate that the end of the last Glacial was much drier than present (Covich and Stuiver, 1974; Bradbury, 1979; Salgado-Labouriau, 1980; Bradbury et al., 1981; Lewis and Weibezahn, 1981; Binford, 1982; Deevey et al., 1983; Leyden, 1984; Bush and Colinvaux, 1990; Piperno et al., 1990; Bush et al., 1992; Leyden et al., 1993, 1994; Street-Perrott et al., 1993; Brenner, 1994; Holmes et al., 1995). Lacustrine δ18O records from Pleistocene-age lake deposits are available from only two circumCaribbean sites, Wallywash Great Pond, Jamaica and Lake Quexil, Peten, Guatemala. Both indicate that the evaporation to precipitation ratio (E/P) was high during the late Pleistocene (Street-Perrott et al., 1993; Leyden et al., 1993, 1994; Holmes, 1998). Dry conditions, combined with relatively colder temperatures, clearly impacted regional vegetation distribution. Pollen evidence from the 36,000-year-old Lake Quexil record indicates extremely arid conditions during marine isotope Stage 2 (~24 to 12 kyr BP), with temperature depression on the order of 6.5 to 8.0°C relative to

42

Biogeography of the West Indies: Patterns and Perspectives

the present (Leyden et al., 1993). Mesic tropical forest was completely absent in the northern Guatemalan lowlands from 36 to 10.5 kyr BP (Leyden, 1984; Leyden et al., 1993, 1994). Likewise, the pollen record from Lake Valencia, Venezuela indicates that moisture availability was severely limited in the latest Pleistocene (Leyden, 1985). Markgraf (1989, 1993) reviewed paleoenvironmental results from lowland tropical and subtropical sites that indicate arid conditions from ~13,000 to ~10,000 years BP. Dry late glacial conditions extended into the northern hemisphere subtropics, as revealed by pollen records from Florida lake basins (Watts, 1975; Watts and Stuiver, 1980; Watts and Hansen, 1988, 1994; Watts et al., 1992; Grimm et al., 1993). Low moisture availability is coupled with cool temperatures in the late Pleistocene through ocean–atmosphere interactions. Low atmospheric water vapor during the last Glacial, as reflected by dry lake basins, may have decreased atmospheric absorption of infrared energy, leading to global cooling (Broecker, 1995). Air temperature and humidity are closely tied in a positive feedback loop. Lower temperatures decrease humidity, thereby reducing the greenhouse effect and amplifying cooling. Several lines of evidence suggest that both tropical air and sea surface temperatures decreased during the last glacial maximum (LGM) by about 5 to 8°C (Markgraf, 1989; Piperno et al., 1990; Bush and Colinvaux, 1990; Seltzer, 1990; Guilderson et al., 1994; Thompson et al., 1995; Stute et al., 1995; Colinvaux et al., 1996a, 1996b). Relatively cooler late Pleistocene tropical sea surface temperatures would have reduced oceanic evaporation, resulting in lower atmospheric moisture.

EARLY LAKE FILLING Following the most arid phase of the late Pleistocene, lake basins in the circum-Caribbean began to fill with water. The timing of initial lake filling was estimated from radiocarbon dates on samples just above or below the oldest lacustrine deposits. Inception of lacustrine sedimentation in our study lakes varied from ~10,500 to ~7,600 14C yr BP. The coring site in Lake Miragoâne, located at the deepest point in the lake (~42 m), was covered with water by ~10,500 14C yr BP (Higuera-Gundy, 1991, 1999; Hodell et al., 1991; Curtis and Hodell, 1993). The Lake Valencia core site, in ~9.4 m of water and some ~28 m above the maximum depth of the lake, was submerged by ~10,000 14C yr BP (Curtis et al., 1999). Previous studies of deepwater cores from Lake Valencia showed that these profundal sites were first covered by water about 10,500 14C yr BP (Bradbury et al., 1981; Lewis and Weibezahn, 1981; Binford, 1982; Leyden, 1985), suggesting it took ~500 years for water level to rise >28 m. Relatively rapid lake-level rise is also confirmed in Lake Quexil, Guatemala, by dates from the bottoms of both deepwater and shallow-water cores. Although Quexil, with a maximum depth of ~32 m, appears to have held at least some water through the arid late Glacial, lake level rose rapidly after about 10.5 14C kyr BP (Deevey et al., 1983). A core taken in about 6 m of water has a basal age of 8.4 14C kyr BP (Vaughan et al., 1985), indicating that near-modern levels were achieved within about 2 millennia. Lakes Chichancanab and Coba and the southern basin of Lake Peten-Itza filled somewhat later, in the early Holocene. The 5.45-m core from Peten-Itza was collected in ~7.5 m of water. Dates from the base of the section indicate the core site was inundated ~9,000 14C yr BP (Curtis et al., 1998). Shallower Lake Chichancanab filled at ~8,200 14C yr BP (Hodell et al., 1995) and Coba water level rose at ~7,600 14C yr BP (Leyden et al., 1996, 1998; Whitmore et al., 1996). The timing of filling for these shallow basins on the Yucatan Peninsula coincides with filling of shallow lakes in Florida (Watts, 1969; Watts and Hansen, 1988). Two processes, operating alone or in concert, were probably responsible for regional lake level rise. First, initial lake filling in the circum-Caribbean region was likely a consequence of increased moisture availability. Pollen studies confirm that climate conditions in the region became more mesic in the early Holocene (Salgado-Labouriau, 1980; Leyden, 1984, 1985, 1987; Vaughan et al., 1985; Islebe et al., 1996a; Higuera-Gundy et al., 1999). Second, water level rise in low-elevation lakes in karst terrain also may have been controlled by rising sea level, which in turn raised water

Climate Change in the Circum-Caribbean and Implications for Regional Biogeography

43

levels in freshwater aquifers (Watts, 1975; Fairbanks, 1989; Watts and Hansen, 1994). At the end of the last Ice Age, flow of glacial meltwater to the world oceans raised eustatic sea level by 121 ±5 m (Fairbanks, 1989). Rising sea level may well have influenced water levels in low-elevation, karst basins Chichancanab, Punta Laguna, Coba, and Miragoâne. It is unlikely, however, that sea level rise directly affected water stage in Lakes Valencia and Peten-Itza, which are situated at higher elevations (Table 2). Early Holocene water level rise in Lakes Chichancanab and Coba was probably due to the combined effects of sea level rise and increased rainfall. Both lakes filled during the second stage of the most recent deglaciation (Termination 1b) that began ~10,000 BP and lasted until ~6,000 BP (Fairbanks, 1989). Using ages for the oldest lacustrine sediments in Lakes Chichancanab and Coba (Hodell et al., 1995; Leyden et al., 1996, 1998; Whitmore et al., 1996), together with Holocene sea level curves (Fairbanks, 1989), we estimate the two basins filled when sea level was ~25 and ~18 m, respectively, below current level. Oldest sediments retrieved from the shallow-water site in Lake Punta Laguna are only ~3,320 14C years old, so it is impossible to establish the timing of initial lake filling using this section. On the basis of results from other northern Yucatan lakes, including Chichancanab (Hodell et al., 1995), Coba (Whitmore et al., 1996; Leyden et al., 1998) and San Jose Chulchaca (Leyden et al., 1996), it is probable that Punta Laguna first held permanent water between 8,000 and 7,000 years BP. A core collected in 16 m water from Punta Laguna in May 2000 penetrated to bedrock. Radiocarbon dates from the base of the section will resolve the question of the timing of basin filling. It is unclear whether Lake Miragoâne filled primarily as a result of rising sea level or increasing moisture availability. The lake began to fill ~10,500 14C yr BP, when sea level was ~65 meters below current level (Fairbanks, 1989; Hodell et al., 1991; Curtis and Hodell, 1993). Filling began in Lake Miragoâne earlier than it did in low-lying karst Lakes Coba and Chichancanab. Sea level rise would be expected to have affected Lake Miragoâne earlier than the other low-elevation study lakes because Miragoâne is a cryptodepression and its bottom lies ~20 m below modern sea level. The timing of Lake Miragoâne filling may be imprecise due to dating uncertainties associated with hard-water-lake error. In any event, one consequence of lake filling in the Caribbean region was that new habitats were created for aquatic organisms.

EARLIEST HOLOCENE (~10,500 TO ~8,500 14C YR BP) Only two of our study basins, Miragoâne and Valencia, yielded isotopic records for the earliest Holocene (~10,500 to ~8,500 14C yr BP) (Figure 2). During this time period, the four other study basins remained dry. Earliest Holocene δ18O values from the Miragoâne core (~10,500 to 8,500 14C yr BP) and Valencia section (~10,000 to 8,600 14C yr BP) were relatively positive, indicating the highest E/P (driest) conditions in the records (Figure 2). Trace metal (Sr/Ca and Mg/Ca) data from the Miragoâne core reflect high lakewater salinity during the earliest Holocene (Curtis, 1992; Curtis and Hodell, 1993). Pollen reconstructions from Miragoâne (Higuera-Gundy, 1991, 1999; Hodell et al., 1991) and Valencia (Salgado-Labouriau, 1980; Leyden, 1985) confirm arid latest Pleistocene conditions. Increasing moisture availability is associated with the beginning of the Holocene. The exact timing for the onset of mesic Holocene conditions in the northern hemisphere Neotropics remains unresolved. Records from some sites indicate that wetter conditions began at the Pleistocene/ Holocene boundary or earlier (Bush et al., 1992), whereas data from other localities suggest moisture availability did not increase until ~8,000 years BP (Leyden et al., 1993; Street-Perrott et al., 1993). Wetter conditions in Panama commenced as early as 10,500 years BP (Bush et al., 1992). In Jamaica, cool, dry conditions dominated until at least 9,500 years BP (Street-Perrott et al., 1993). Pollen evidence from Lake Quexil (Leyden et al., 1993) and other lowland sites in the region suggest that

44

Biogeography of the West Indies: Patterns and Perspectives

between 10,000 and 8,500 years BP, late Pleistocene grasslands were replaced by more mesic vegetation, indicating both increased warming and moisture availability (Markgraf, 1989).

EARLY TO MIDDLE HOLOCENE (~8,500 TO ~3,000 14C YR BP) By ~7,500 14C yr BP, Lakes Valencia, Peten-Itza, Chichancanab, Miragoâne, Punta Laguna, and Coba held water and were accumulating lacustrine sediments at their respective core sites. Oxygen isotope ratios in cores from Lakes Peten-Itza, Chichancanab, and Miragoâne were lowest during the early to middle Holocene (~8,500 to ~3,000 14C yr BP) (Figure 2), indicating low E/P (relatively moist conditions) and high lake levels. Lake Valencia experienced high water levels during much of the period from ~8,200 to ~3,000 14C yr BP and overflowed at a point 25 m above the present lake level (Bradbury et al., 1981; Lewis and Weibezahn, 1981; Binford, 1982; Curtis et al., 1999). When large volumes of water exited the basin through the outflow, the lake became hydrologically “open.” During that period, minor changes in E/P had little effect on the δ18O composition of Lake Valencia water. Consequently isotope-based paleoclimatic inferences for the time span are less reliable. Nevertheless, the fact that Lake Valencia was overflowing confirms that moist conditions prevailed. This period of low E/P coincides with the early to middle Holocene moist period that has been recognized by others at sites throughout the Northern Hemisphere Neotropics, including Mexico (Covich and Stuiver, 1974), Guatemala (Deevey et al., 1983; Leyden, 1984; Islebe et al., 1996b), Panama (Piperno et al., 1990), and Costa Rica (Islebe et al., 1996a). The early to middle Holocene moist period has also been documented in records from sub-Saharan African lakes that lie north of the equator (Street and Grove, 1976, 1979; Street-Perrott and Harrison, 1985; Lezine, 1989). Intersite differences in the timing of this wet interval may reflect geographical differences in its onset and termination, but may simply be a consequence of poor dating resolution in some lake cores. In contrast to the general finding of moist early to middle Holocene conditions at lowland sites in the circum-Caribbean, two localities in the Northern Hemisphere Neotropics provide evidence for dry conditions during part or all of the early and middle Holocene. Water level in Lake La Yeguada, Panama, was low from ~8,200 to ~5,800 years BP, suggesting relatively drier conditions during this period (Bush et al., 1992). Poor dating control hampers climatic interpretation of a core from Church’s Blue Hole on Andros Island, Bahamas. Unlike the rest of the Caribbean region, however, climate conditions appear to have been dry prior to about 4,630 years BP (Kjellmark, 1996). StreetPerrott et al. (1993) and Holmes et al. (1995) reported three transgressive-regressive cycles in Wallywash Great Pond, Jamaica during the Holocene, but dating of these cycles is unreliable because of hard-water-lake error, so that the timing of climate shifts remains in question.

LATE HOLOCENE (~3,000 C YR BP TO THE PRESENT) 14

Isotope records from Lakes Chichancanab, Miragoâne, and Coba display trends toward more positive δ18O values over the last ~3,000 years, indicating gradual climate drying (Figure 2). Oxygen isotopic values from the Lake Peten-Itza core show little variation during the last ~4,800 14C yr (Figure 2), and late Holocene climate inferences based on pollen from Lake Peten-Itza and other lakes on the Yucatan Peninsula are confounded because dense Maya populations in the lowlands cleared regional vegetation for agriculture (Islebe et al., 1996b; Curtis et al., 1998). Oxygen isotopic records from Lake Valencia do not reveal a clear trend in the late Holocene (Figure 2). Other proxies from Lake Valencia, however, indicate that E/P increased in the late Holocene. Sodium content in the sediments increased and the saline-tolerant ostracod Heterocypris communis reappeared in the record at ~2,140 14C yr BP. The presence of the littoral snail Pyrgophorus sp. at ~1,960 14C yr BP may also be indicative of general drying in that it suggests lake

Climate Change in the Circum-Caribbean and Implications for Regional Biogeography

45

level had dropped sufficiently to bring the shallow-water zone nearer to the coring site. On the basis of diatom and geochemical analyses, Bradbury et al. (1981) and Lewis and Weibezahn (1981) reported that salinity in Lake Valencia increased after ~3,000 14C yr BP. Animal microfossils in Lake Valencia sediment cores suggest a more complex hydrologic history involving multiple, lateHolocene rises and falls in water level (Binford, 1982). Millennial-scale climate changes are observed in all the circum-Caribbean oxygen isotopic records (Figure 2). Multi-decadal climate variations are observed throughout the Punta Laguna δ18O record, although no periodicity is apparent in the oscillations. There is, however, evidence for a series of droughts centered at 1510, 1171, 1019, 943, and 559 14C yr BP. The earliest two dry spells occurred at 585 and 862 ± 50 calendar years A.D. They coincide with two major cultural events, the Maya Hiatus that marks the boundary between the Early and Late Classic periods (~600 A.D.) and the collapse of the Classic Maya civilization in the 9th century A.D. Sediments from Lake Chichancanab also yielded oxygen isotopic and geochemical evidence for a major drought episode between ~1300 and ~1100 14C years BP (800 to 1000 A.D.) (Hodell et al., 1995). Temporal correlation between climatic events and cultural upheavals suggests a causal linkage. If indeed drought can be held responsible for the demographic collapse of Maya civilization ca. 850 A.D., it can be argued that climate change ultimately permitted the widespread regrowth of tropical forest in the region that had been largely cleared over the previous 2000 to 3000 years. Post-collapse forest recovery is documented in numerous pollen records from the region (e.g., Vaughan et al., 1985; Leyden, 1987; Islebe et al., 1996b). Other records from the lowland Neotropics also suggest drying in the late Holocene, but the timing of onset is not always coincident (Leyden, 1985; Markgraf, 1989; Burney et al., 1994; Islebe et al., 1996a; Kjellmark, 1996). Drying around Lake Miragoâne, Haiti began ~3,200 14C yr BP. Similarly, at Lake Chichancanab, Mexico, conditions became drier ~3,000 14C yr BP (Hodell et al., 1991, 1995). In contrast, drying began at about 4,500 years BP in montane Costa Rica (Islebe et al., 1996a). Dry conditions in the Bahamas from 3,200 to 1,500 years BP may have postponed human colonization of the islands (Kjellmark, 1996).

SUMMARY OF CIRCUM-CARIBBEAN CLIMATE Oxygen isotope data from circum-Caribbean lake cores yield a generally coherent pattern of regional paleoclimate. Despite potentially moderating maritime influences near the insular Miragoâne site, its paleoclimate record is remarkably similar to those from continental sites. Long-term similarities among all the records probably result from a common forcing mechanism. Conditions were dry in the late Pleistocene, but became wetter during the earliest Holocene (~10,500 to ~8,500 14C yr BP). Maximum moisture availability occurred during the early to middle Holocene (~8,500 to ~3,000 14C yr BP) and drier conditions returned in the late Holocene, from about 3,000 14C yr BP to the present (Figure 2). There are, however, notable differences among the proxy climate records. For example, the Peten-Itza and Valencia data lack evidence for late Holocene drying that is so apparent in the other lake cores (Figure 2). This could reflect climatic stability around Peten-Itza and Valencia or may simply be a consequence of the fact that they are large, deep lakes that are “insensitive” to all but the most pronounced climate changes. With their tremendously large volumes, even lake stage declines of several meters remove only a small fraction of the total water volume and therefore have little effect on the lake water δ18O signature. The isotopic signature of water in Lakes Miragoâne, Coba, and Chichancanab is probably more responsive to climatic shifts due to the relatively small basin volumes (Figure 2, Table 1). The onset of the early to middle Holocene moist period also differs among sites. Near Lakes Chichancanab and Miragoâne, the climate became wetter around 7,000 14C yr BP, whereas greater moisture became available ~1000 years later according to the Valencia record and ~2000 years later at Lake Peten-Itza (Figure 2). Evidence for the early to middle Holocene moist period is absent

46

Biogeography of the West Indies: Patterns and Perspectives

from the Coba record. Slight temporal differences among climate reconstructions may be a consequence of inaccuracies in sediment dating. Most of the chronologies, however, are robust and differences among the records may be due to local climatic and nonclimatic factors.

LONG-TERM CLIMATE CONTROLS The generally consistent pattern of millennial-scale climate shifts in the circum-Caribbean is explained by long-term changes in the seasonal distribution of solar energy. Studies of 20th century meteorology in the Atlantic region revealed correlations between years with rainfall anomalies and strength of the annual cycle (Hastenrath, 1984). Strongly seasonal years, during which the InterTropical Convergence Zone (ITCZ) moved farther north in summer (wet season) and farther south in winter (dry season), were anomalously wet. Conversely, reduced seasonality was associated with lower rainfall (Hastenrath, 1976, 1984). Hodell et al. (1991) suggested that long-term, millennialscale E/P variations in the circum-Caribbean were controlled by intensity of the annual cycle and movement of the ITCZ. These changes were forced by orbital mechanics, namely, the precessional cycle, with a characteristic period of 19,000 and 23,000 years. The intensity of the annual cycle can be expressed as the difference in seasonal insolation at the top of the atmosphere at 10°N, between summer (August) and winter (February) (Figure 3). August and February were chosen because they are the months during which there is maximum northward and southward displacement of the ITCZ and associated weather patterns (Hastenrath, 1976). Intensity of the annual cycle in the circum-Caribbean was greatest during the early Holocene (Figure 3) because perihelion occurred during Northern Hemisphere summer and aphelion occurred during Northern Hemisphere winter. In other words, the Earth’s Northern Hemisphere was tilted on its axis toward the sun as the planet passed closest to the sun during its annual solar orbit. When Earth reached maximum distance from the sun while orbiting, the Northern Hemisphere tilted on its axis away from the sun. The consequence of this planetary orientation was that the Northern Hemisphere experienced enhanced summer insolation and reduced winter insolation relative to the present. High early Holocene seasonality in the Northern Hemisphere was associated with increased northward movement of the ITCZ during summer and southward migration during winter. These conditions generated relatively high rainfall (low E/P) in the Northern Hemisphere tropics during the early Holocene. In the late Holocene, perihelion occurred during Northern Hemisphere winter and aphelion occurred during Northern Hemisphere summer, resulting in warmer winters and cooler summers. The change in orbital geometry caused a reduction in the intensity of the annual cycle (Figure 3), which led to a restricted latitudinal range of the ITCZ and higher E/P (drying) in the circum-Caribbean region. As discussed, lack of evidence for late Holocene drying in the records from Lakes Peten-Itza and Valencia may have simply been a consequence of their large volumes and relatively poor sensitivity to climate changes. Nevertheless, the data may indeed reflect relative climatic stability at those latitudes, which is consistent with the proposed mechanism of orbital forcing. Of the six study basins, Lakes Peten-Itza and Valencia lie at the lowest latitudes and closest to the ITCZ. Late Holocene reduction in the intensity of the annual cycle would have decreased the annual north/south movement of the ITCZ and associated weather systems. More northerly sites Chichancanab, Miragoâne, Coba, and Punta Laguna would have experienced substantial rainfall reduction in the late Holocene, whereas southerly sites Valencia and Peten-Itza would have continued to receive relatively abundant rainfall because of their proximity to the ITCZ. In addition to temporal shifts in summer (August) and winter (February) insolation, spring (May) and autumn (November) insolation also changed during the late Pleistocene and Holocene (Figure 3). The timing of changes in spring and autumn insolation did not coincide with changes in summer and winter insolation (Figure 3). Maximum difference between winter and summer insolation occurred ~8,000 14C yr BP while maximum difference between spring and autumn insolation occurred ~12,500 14C yr BP. The intensity of the annual cycle was mainly driven by

Climate Change in the Circum-Caribbean and Implications for Regional Biogeography

47

FIGURE 3 Changes in insolation at the top of the atmosphere at 10°N for the months of February (= ), May (= ), August (= ●), and November (= +) from 20,000 calendar years to the present (after calculations of Berger, 1978). The distance between the February and August curves is a representation of the intensity of the annual cycle.

differences in summer vs. winter insolation, but changes in spring insolation may have affected regional vegetation (Leyden et al., 1994). The decrease in springtime insolation during the early Holocene would probably have reduced spring moisture stress (Leyden et al., 1994). Reduced spring insolation may account for why δ18O and pollen data yield contradictory climatic inferences for the early Holocene portion of the Lake Peten-Itza core. The pollen record indicates that high forest was established by ~9,000 14C yr BP, suggesting relatively moist climate conditions (Islebe et al., 1996b; Curtis et al., 1998). In contrast, the δ18O record suggests fairly high E/P conditions. This discrepancy has been attributed to high fractional loss of the water budget of the lake to evaporation during the early stages of lake filling, i.e., when it was at low volume,

48

Biogeography of the West Indies: Patterns and Perspectives

despite the fact that conditions were wet enough to support high forest (Curtis et al., 1998). Alternatively, early Holocene conditions may have been relatively dry, as inferred from the δ18O record, but mesic vegetation was able to thrive because of reduced springtime water stress.

SHORT-TERM CLIMATE CONTROLS Although millennial-scale climate conditions at the study sites were controlled largely by orbital forcing, abrupt, short-term (decade-to-century) climate shifts are attributable to mechanisms other than orbital forcing. Short-term climate events, such as the droughts detected in the Punta Laguna and Chichancanab records, occurred too rapidly to have been caused by orbital forcing (Hodell et al., 1995; Curtis et al., 1996). Similar, brief events have been observed in other lake cores, such as the stage decline detected in the Valencia record at ~3,310 14C yr BP (Curtis et al., 1999) and the short episode of low δ18O values at ~9,100 and ~8,100 14C yr BP in the Lake Miragoâne record (Curtis and Hodell, 1993). Brief climate events may be recorded in sediment profiles from some lakes, but not others, because each water body has unique characteristics (e.g., volume, watershed vegetation) that make it respond in a distinctive manner to short-term forcing. Several mechanisms have been proposed to explain short-term climate fluctuations. Some mechanisms affect climate globally, whereas others have only local effects. Brief climate events can be forced by random, natural variability in the ocean–atmosphere system that does not require external forcing. These shifts may represent the extremes of natural climate variability. Short-duration climate shifts may also be a consequence of changes in solar energy reaching Earth. For example, Lean et al. (1995) used sunspot records to show that solar variability has influenced global climate since 1610 A.D. Volcanic eruptions can also force climate by injecting large amounts of gas, especially sulfur dioxide (SO2 ), high into the atmosphere (Jonas et al., 1995). Sulfur dioxide is oxidized to sulfate aerosols, mainly H2SO4H2O, in the troposphere and stratosphere. These aerosols reflect solar radiation and cause climate cooling (Jonas et al., 1995). Climate recovery after volcanic eruptions is rapid, generally taking only 2 to 3 years, and is achieved by removal of aerosols from the atmosphere in both wet and dry deposition (Jonas et al., 1995). The circum-Caribbean region is tectonically active and regional volcanic eruptions have probably influenced climate in the past (Gill, 2000). Volcanic ash does not always preserve well in tropical lake sediments, sometimes making it difficult to document prehistoric eruptions (Ford and Rose, 1995). Brief changes in ocean circulation have also been proposed as controls of decade-to-century-scale climate shifts. Small increases or decreases in North Atlantic Deep Water production can play an important role in climate of the North Atlantic region (Keigwin et al., 1991; Lehman and Keigwin, 1992; Broecker, 1994) and Africa (Street-Perrott and Perrott, 1990). Lastly, deforestation may drive regional climate change (Lean and Warrilow, 1989). Global climate models show that reduced vegetation cover may cause a weakened hydrological cycle and hence less precipitation (Lean and Warrilow, 1989). For example, the ancient Maya began clearing vegetation on the Yucatan Peninsula more than 3,000 years ago (Leyden, 1987; Islebe et al., 1996b). By the Late Classic Period (A.D. 550 to 850), the entire May Lowlands region was effectively deforested (Deevey et al., 1979). Anthropogenic deforestation may have caused the drought that led to the Maya collapse (Hodell et al., 1995; Curtis et al., 1996).

NONCLIMATIC CONTROLS Local, nonclimatic controls on basin hydrology may be responsible for differences observed among some of the lake records. These controls may include interlake differences in filling rate, morphometry, groundwater inputs and outputs, and orography. Local, nonclimatic influences on the hydrologic balance of lakes can regulate the δ18O of the lake water and can potentially lead to erroneous paleoclimate inferences. Filling rate may have exerted some control on the isotopic composition of lake water in the study basins. For instance, in the early stages of basin filling, the δ18O of lake water is high because

Climate Change in the Circum-Caribbean and Implications for Regional Biogeography

49

the water body has a small volume and loses a large proportion of its annual water budget to evaporation. Large-volume lakes such as Peten-Itza took longer to fill than small-volume lakes such as Chichancanab. Consequently, small lakes achieve oxygen isotopic equilibrium more quickly than large lakes (Lister et al., 1991). Chichancanab reached isotopic steady state in a few hundred years, whereas Peten-Itza required thousand of years to achieve isotopic equilibrium (Figure 2). The Lake Peten-Itza oxygen isotope record may also have been influenced by basin morphology. The core was collected in the smaller, shallow south basin of the lake, which was isolated from the large, deep (160 m) north basin during initial lake filling. While filling, the shallow south basin would have had a high surface area–volume ratio and δ18O of the water would have been relatively positive. Once the north basin filled and the two basins were connected, low δ18O water of the north basin would have mixed with high δ18O water of the south basin, reducing the oxygen isotopic signal in waters near the core site. The early and middle Holocene oxygen isotope records from Lakes Valencia and Miragoâne may lack some detail concerning changing E/P conditions. Overflow in Valencia was inferred from other proxy records (Bradbury et al., 1981; Lewis and Weibezahn 1981; Binford, 1982), indicating relatively wet conditions. But overland outflows during the moist period made lake water isotopic signatures less sensitive to changes in the relation between rainfall and evaporation. Thus, δ18O measures for this period are somewhat less useful for paleoclimatic inferences. Lake Valencia lies in a valley surrounded by mountains. Orography may have influenced the inferred moisture history of the basin. When clouds rise and pass over the mountains, rainout occurs and affects both the quantity and isotopic composition of precipitation. Today, rainfall in northern Venezuela is influenced by the equatorial trough during the wet season and the Northern Hemisphere trade winds during the dry season (Snow, 1976). If the isotopic composition of the source waters differs, it is possible that the isotopic composition of Lake Valencia lake water changed through time due to shifting relative contributions of precipitation from the two regions, i.e., from the Caribbean across the Cordillera Costanera to the north, or across the continent and the Serrania del Interior to the south.

CLIMATE AND BIOGEOGRAPHY IN THE CIRCUM-CARIBBEAN Modern distributions and abundances of plants and animals in the circum-Caribbean reflect climate changes that occurred within the last 20,000 years. Antillean faunal extinctions during the late Pleistocene–early Holocene transition (40,000 to 4,500 BP) (Morgan and Woods, 1986) were probably a consequence, in part, of the transition from cool–arid to warm–moist conditions (Pregill and Olson, 1981). Xeric habitats largely disappeared in the early Holocene, accounting for the disjunct or restricted modern distributions of obligate dry-adapted species, especially reptiles and birds. Fossils of xerophilic taxa have been found at geographically widespread sites, indicating they were distributed extensively in the arid late Glacial. Cool, arid conditions in the late Pleistocene are supported by various lines of evidence, including the paucity of lake basins that held water at that time. In the few late Glacial lacustrine records that do exist in the circum-Caribbean, pollen data indicate that xerophytic, cold-tolerant plant communities occupied the landscape. In northern Guatemala, floral elements that today dominate the tropical forest in the region were completely absent from the pollen record. Throughout the region, forested habitats must have been limited in areal extent and highly fragmented. Furthermore, in regions with substantial altitudinal relief, even cold-tolerant plant species were forced to lower elevations in the late Glacial, when temperatures were as much as 8°C below the present temperature. As vegetation responded to changes in temperature and available moisture, so too did the associated fauna. In the early and middle Holocene, mesic forest expanded, leading to the greater abundance of animals that occupy wetter habitats. Forest expansion also led to contact between animal and plant populations that had been geographically isolated during the previous, arid episode. For

50

Biogeography of the West Indies: Patterns and Perspectives

instance, based on pollen from the lake Miragoâne core, Higuera-Gundy et al. (1999) suggest that the ~150-km-wide strip of lowland dry forest that today separates the Massifs de La Hotte and de La Selle in southwest Haiti, was covered by mesic vegetation some time between ~5.4 and 2.5 kyr BP. Fossil vertebrate data support this hypothesis. Three species of Nesophontes that became extinct ~100 years ago show minor morphological differentiation in the massifs and in the intervening area. This suggests that formerly isolated populations of the massifs had recent contact in the Miragoâne region. Geographic overlap among the three insectivore species probably occurred in the middle Holocene, when mesic vegetation colonized the gap that previously and at present separates the massifs. Fossils from southwestern Hispaniola indicate that some extinct mammal species, including rodents, ground sloths, and a primate, persisted until ~3,000 BP (Woods, 1989a, 1989b). Of the endemic rodents known from the island, 93% are presently extinct, but most survived until ~3,000 BP (Woods, 1989a, 1989b). Over the last few millennia, four bat species from the Massif de La Selle highlands have become extinct (Morgan and Woods, 1986). Late Holocene extinctions of some highland mesophilic animal species probably predate significant human impacts in those environments. The coincidence of these faunal extinctions, with an isotopically documented drying trend and palynological evidence for loss of mesic forests after 3,000 BP, suggests that climatic drying contributed to the demise of these taxa.

SUMMARY AND CONCLUSIONS Holocene climate variability in the circum-Caribbean was inferred using δ18O records from shell carbonate in sediment cores from six regional lakes. Temporal resolution, based on radiocarbon dating of the sediment sequences, permitted climate reconstruction at millennial to centennial timescales. Following the cool, arid late Glacial, climate ameliorated and previously dry lake basins began to fill with water. Throughout the circum-Caribbean, lowland sites generally progressed from arid in the late Glacial and earliest Holocene to moister in the early to middle Holocene. Around 3,000 BP, drier conditions returned to the region. Superimposed on millennial-scale climate variability are recent, shorter-term events that are interesting to both biogeographers and anthropologists. Of particular interest are records from the Yucatan Peninsula that point to a series of droughts that occurred since the onset of drying ~3,000 BP. Periods of extreme dry conditions center on dates of 585, 862, 986, and 1051 calendar years A.D. The drought episodes at 585 and 862 A.D. coincide with major changes in Maya cultural evolution and even suggest that drought was responsible for the 9th century A.D. Maya collapse. Long-term millennial patterns of change discerned in the proxy climate records are explained by shifts in the intensity of the annual cycle. These in turn were driven by changes in insolation that are ultimately controlled by orbital precession. Short-term climate events detected in several records were too abrupt to have been caused by orbital forcing. Mechanisms driving these short-term climate changes may have included volcanic eruptions, changes in solar variability, or ocean circulation and deforestation. Climate proxy records from several sites were probably influenced to some degree by local, nonclimatic effects such as lake-filling rate, basin morphology, and orography. This study revealed patterns of climate change in the circum-Caribbean region from the late Pleistocene to the present and demonstrated climatic variability on long and short timescales. Millennial-scale variations in E/P were probably forced by orbital mechanics that were controlled by the intensity of the annual cycle and seasonal displacement of the ITCZ. Forcing mechanisms for shortterm, centennial climate variability remain to be identified. Paleoclimatic inferences presented here suggest that analyses of West Indian biogeography must be cognizant of the potential influence that latest Pleistocene and Holocene climate change has had on the distribution and abundance of the circum-Caribbean biota.

Climate Change in the Circum-Caribbean and Implications for Regional Biogeography

51

LITERATURE CITED Berger, A. 1978. Numerical values of caloric insolation from 1,000,000 YBP to 100,000 YAP (astronomical solution of Berger, 1978). Contribution 37. Institut d’Astronomie et de Géophysique G. Lemaitre, Université Catholique de Louvain-la-Neuve, Belgique. Binford, M. W. 1982. Ecological history of Lake Valencia, Venezuela: interpretation of animal microfossils and some chemical, physical and geological features. Ecological Monographs 52:307–333. Bradbury, J. P. 1979. Quaternary diatom stratigraphy of Lake Valencia, Venezuela. Pp. 276–288 in Proceedings of the Fourth Latin American Geological Congress. Fourth Latin American Geological Congress, Port of Spain, Trinidad and Tobago. Bradbury, J. P., B. W. Leyden, M. L Salgado-Labouriau, W. M., Lewis, Jr., C. Schubert, M. W. Binford, D. G. Frey, D. R. Whitehead, and F. H. Weibezahn. 1981. Late Quaternary environmental history of Lake Valencia, Venezuela. Science 214:1299–1305. Brenner, M. 1994. Lakes Salpeten and Quexil, Peten, Guatemala, Central America. Pp. 377–380 in GierlowskiKordesch, E. and K. Kelts (eds.). Global Geological Record of Lake Basins, Vol. 1. Cambridge University Press, Cambridge. Broecker, W. S. 1994. Massive iceberg discharges as triggers for global climate change. Nature 372:421–424. Broecker, W. S. 1995. Cooling the tropics. Nature 376:212–213. Burney, D. A., L. P. Burney, and R. D. E. MacPhee. 1994. Holocene charcoal stratigraphy from Laguna Tortuguero, Puerto Rico and the timing of human arrival on the island. Journal of Archaeological Science 21:273–281. Bush, M. B. and P. A. Colinvaux. 1990. A pollen record of a complete glacial cycle from lowland Panama. Journal of Vegetation Science 1:105–118. Bush, M. B., D. R. Piperno, P. A. Colinvaux, P. E. De Oliveira, L. A. Krissek, M. C. Miller, and W. E. Rowe. 1992. A 14300-yr paleoecological profile of a lowland tropical lake in Panama. Ecological Monographs 62:251–275. Candela, G. A. and G. C. Candelas. 1963. The West Indies. Pp. 435–450 in Frey, D. G. (ed.). Limnology in North America. The University of Wisconsin Press, Madison. Chivas, A. R., P. De Dekker, J. A. Cali, A. Chapman, E. Kiss, and J. M. G. Shelley. 1993. Coupled stableisotope and trace-element measurements of lacustrine carbonates as paleoclimatic indicators. Pp. 113–121 in Swart, P. K., K. C. Lohmann, J. McKenzie, and S. Savin (eds.). Climate Change in Continental Isotopic Records. American Geophysical Union, Washington, D.C. Colinvaux, P. A., P. De Oliveira, J. E. Moreno, M. C. Miller, and M. B. Bush. 1996a. A long pollen record from lowland Amazonia: forest and cooling in glacial times. Science 274:85–88. Colinvaux, P. A., K.-B. Liu, P. De Olivera, M. B. Bush, M. C. Miller, and M. Steinitz Kannan. 1996b. Temperature depression in the lowland tropics in glacial times. Climate Change 32:19–33. Covich, A. and M. Stuiver. 1974. Changes in oxygen 18 as a measure of long-term fluctuations in tropical lake levels and molluscan populations. Limnology and Oceanography 19:682–691. Curtis, J. H. 1992. Natural Variability of Late Pleistocene-Holocene Climates in the Caribbean from Isotopic and Trace Element Analysis of Lake Sediments (10,500 Years BP to Present). M.S. thesis, University of Florida, Gainesville. Curtis, J. H. and D. A. Hodell. 1993. An isotopic and trace element study of ostracods from Lake Miragoâne, Haiti: a 10,500 year record of paleosalinity and paleotemperature change in the Caribbean. Pp. 135–152 in Swart, P. K., K. C. Lohmann, J. McKenzie, and S. Savin (eds.). Climate Change in Continental Isotopic Records. American Geophysical Union, Washington, D.C. Curtis, J. H., D. A. Hodell, and M. Brenner 1996. Climate variability on the Yucatan Peninsula (Mexico) during the last 3500 years and implications for Maya cultural evolution. Quaternary Research 46:37–47. Curtis, J. H., M. Brenner, D. A. Hodell, R. A. Balser, G. A. Islebe, and H. Hooghiemstra. 1998. A multi-proxy study of Holocene environmental change in the Maya Lowlands of Peten, Guatemala. Journal of Paleolimnology 19:139–159. Curtis, J. H., M. Brenner, and D. A. Hodell. 1999. Changes in moisture availability in the Lake Valencia Basin, Venezuela (late Pleistocene to present). The Holocene 9:609–619. Deevey, E. S. and M. Stuiver. 1964. Distribution of natural isotopes of carbon in Linsley Pond and other New England lakes. Limnology and Oceanography 9:1–11.

52

Biogeography of the West Indies: Patterns and Perspectives

Deevey, E. S., D. S. Rice, P. M. Rice, H. H. Vaughan, M. Brenner, and M. S. Flannery. 1979. Mayan urbanism: impact on a tropical karst environment. Science 206:298–306. Deevey, E. S., M. Brenner, and M. W. Binford. 1983. Paleolimnology of the Peten Lake District, Guatemala, III. Late Pleistocene and Gamblian environments of the Maya area. Hydrobiologia 103:211–216. Fairbanks, R. G. 1989. A 17,000 year glacio-eustatic sea level record: influences of glacial melting rates in the Younger Dryas event and deep-ocean circulation. Nature 342:637–642. Fontes, J. C. and R. Gonfiantini. 1967. Comportement isotopique au cours de l’évaporation de deux bassins sahariens. Earth and Planetary Science Letters 3:258–266. Ford, A. and W. I. Rose. 1995. Volcanic ash in ancient Maya ceramics of the limestone lowlands: implications for prehistoric volcanic activity in the Guatemala highlands. Journal of Volcanology and Geothermal Research 66:149–162. Gasse, F., R. Téhet, A. Durand, E. Gilbert, and J. C. Fontes. 1990. The arid-humid transition in the Sahara and Sahel during the last glaciation. Nature 346:141–146. Gill, R. B. 2000. The Great Maya Droughts: Water, Life and Death. University of New Mexico Press, Albuquerque. Grimm, E. C., G. L. Jacobson, Jr., W. A. Watts, B. C. S. Hansen, and K. A. Maasch. 1993. A 50,000-year record of climate oscillations from Florida and its temporal correlation with the Heinrich Events. Science 261:198–200. Guilderson, T. P., R. G. Fairbanks, and J. L. Rubenstone. 1994. Tropical temperature variations since 20,000 years ago: modulating interhemispheric climate change. Science 263:663–665. Hastenrath, S. 1976. Variations in low-latitude circulation and extreme climatic events in the tropical Americas. Journal of the Atmospheric Sciences 33:202–215. Hastenrath, S. 1984. Interannual variability and annual cycle: mechanisms of circulation and climate in the tropical Atlantic sector. Monthly Weather Review 112:1097–1107. Higuera-Gundy, A. 1991. Antillean Vegetational History and Paleoclimate Reconstructed from the Paleolimnological Record of Lake Miragoâne, Haiti. Ph.D. dissertation, University of Florida, Gainesville. Higuera-Gundy, A., M. Brenner, D. A. Hodell, J. H. Curtis, B. W. Leyden, and M. W. Binford. 1999. A 10,300 14C-year record of climate and vegetation change in Haiti. Quaternary Research 52:159–170. Hodell, D. A., J. C. Curtis, and M. Brenner. 1995. Possible role of climate in the collapse of Classic Maya civilization. Nature 375:391–394. Hodell, D. A., J. H. Curtis, G. A. Jones, A. Higuera-Gundy, M. Brenner, M. W. Binford, and K. T. Dorsey. 1991. Reconstruction of Caribbean climate change over the past 10,500 years. Nature 352:790–793. Holmes, J. A. 1996. Trace-element and stable isotope geochemistry of non-marine ostracod shells in Quaternary palaeoenvironmental reconstruction. Journal of Paleolimnology 15:223–235. Holmes, J. A. 1998. A late Quaternary ostracod record from Wallywash Great Pond, a Jamaican marl lake. Journal of Paleolimnology 19:115–128. Holmes, J. A., F. A. Street-Perrott, M. Ivanovich, and R. A. Perrott. 1995. A late Quaternary palaeolimnological record from Jamaica based on trace-element chemistry of ostracod shells. Chemical Geology 124:143–160. Islebe, G. A., H. Hooghiemstra, and R. Van’t Veer. 1996a. Holocene vegetation and water table history in two bogs of the Cordillera de Talamanca, Costa Rica. Vegetatio 124:155–171. Islebe, G. A., H. Hooghiemstra, M. Brenner, J. H. Curtis, and D. A. Hodell. 1996b. A Holocene vegetation history from lowland Guatemala. The Holocene 6:265–271. Jonas, P. R., R. J. Charlson, and H. Rodhe. 1995. Aerosols. Pp. 127–162 in Houghton, J. T., L. G. Meira Filho, J. Bruce, H. Lee, B. A. Callander, E. Haites, N. Harris, and K. Maskell (eds.). Climate Change 1994: Radiative Forcing of Climate Change and an Evaluation of the IPCC IS92 Emission Scenarios. Cambridge University Press, Cambridge. Keigwin, L. D., G. A. Jones, S. J. Lehman, and E. A. Boyle. 1991. Deglacial meltwater discharge, North Atlantic deep circulation and abrupt climate change. Journal of Geophysical Research 96:16811–16826. Kjellmark, E. 1996. Late Holocene climate change and human disturbance on Andros Island, Bahamas. Journal of Paleolimnology 13:133–145. Lean, J., J. Beer, and R. Bradley. 1995. Reconstruction of solar irradiance since 1610: implications for climate change. Geophysical Research Letters 22:3195–3198. Lean, J. and D. A. Warrilow. 1989. Simulation of the regional climatic impact of Amazon deforestation. Nature 342:411–413.

Climate Change in the Circum-Caribbean and Implications for Regional Biogeography

53

Lehman, S. J. and L. D. Keigwin. 1992. Sudden changes in North Atlantic circulation during the last deglaciation. Nature 356:757–762. Lewis, W. M., Jr. and F. H. Weibezahn. 1981. Chemistry of a 7.5-m sediment core from Lake Valencia, Venezuela. Limnology and Oceanography 26:907–924. Leyden, B. W. 1984. Guatemalan forest synthesis after Pleistocene aridity. Proceedings of the National Academy of Sciences U.S.A. 81:4856–4859. Leyden, B. W. 1985. Late Quaternary aridity and Holocene moisture fluctuations in the Lake Valencia Basin, Venezuela. Ecology 66:1279–1295. Leyden, B. W. 1987. Man and climate in the Maya lowlands. Quaternary Research 28:407–414. Leyden, B.W., M. Brenner, D. A. Hodell, and J. H. Curtis. 1993. Late Pleistocene climate in the Central American lowlands. Pp. 165–178 in Swart, P. K., K. C. Lohmann, J. McKenzie, and S. Savin (eds.). Climate Change in Continental Isotopic Records. American Geophysical Union, Washington, D.C. Leyden, B. W., M. Brenner, D. A. Hodell, and J. H. Curtis. 1994. Orbital and internal forcing of climate on the Yucatan Peninsula for the past ca. 36 ka. Palaeogeography, Palaeoclimatology, Palaeoecology 109:193–210. Leyden, B. W., M. Brenner, T. J. Whitmore, J. H. Curtis, D. R. Piperno, and B. H. Dahlin. 1996. A record of long- and short-term climate variation from northwest Yucatan: Cenote San Jose Chulchaca. Pp. 30–50 in Fedick, S. L. (ed.). The Managed Mosaic: Ancient Maya Agriculture and Resource Use. University of Utah Press, Salt Lake City. Leyden, B. W., M. Brenner, and B. H. Dahlin. 1998. Cultural and climatic history of Cobá, a lowland Maya City in Quintana Roo, Mexico. Quaternary Research 49:111–122. Lezine, A. M. 1989. Late Quaternary vegetation and climate of the Sahel. Quaternary Research 32:317–334. Lister, G. S., K. Kelts, C. K. Zao, J. Yu, and F. Niessen. 1991. Lake Qinghai, China: closed-basin lake levels and the oxygen isotope record for ostracoda since the latest Pleistocene. Palaeogeography, Palaeoclimatology, Palaeoecology 84:141–162. Markgraf, V. 1989. Paleoclimates in Central and South America since 18,000 BP based on pollen and lakelevel records. Quaternary Science Reviews 8:1–24. Markgraf, V. 1993. Climatic history of Central and South America since 18,000 yr B.P.: comparison of pollen records and model simulations. Pp. 357–385 in Wright, H. E., Jr., J. E. Kutzbach, T. Webb III, W. F. Ruddiman, F. A. Street-Perrott, and P. J. Bartlein (eds.). Global Climates since the Last Glacial Maximum. University of Minnesota Press, Minneapolis. Morgan, G. S. and C. A. Woods. 1986. Extinction and the zoogeography of West Indian land mammals. Biological Journal of the Linnean Society 28:167–203. Piperno, D. R., M. B. Bush, and P. A. Colinvaux. 1990. Paleoenvironments and human settlements in lateglacial Panama. Quaternary Research 33:108–116. Pregill, G. K. and S. L. Olson. 1981. Zoogeography of West Indian vertebrates in relation to Pleistocene climatic cycles. Annual Review of Ecology and Systematics 12:75–98. Salgado-Labouriau, M. L. 1980. A pollen diagram of the Pleistocene-Holocene boundary of Lake Valencia, Venezuela. Reviews of Palaeobotany and Palynology 30:297–312. Seltzer, G. O. 1990. Recent glacial history and paleoclimate of the Peruvian-Bolivian Andes. Quaternary Science Reviews 9:137–152. Snow, J. W. 1976. The climate of northern South America. Pp. 295–403 in Schwerdtfeger, W. (ed.). Climates of Central and South America. Elsevier, Amsterdam. Street, F. A. and A. T. Grove. 1976. Environmental and climatic implications of late Quaternary lake-level fluctuations in Africa. Nature 261:385–390. Street, F. A. and A. T. Grove. 1979. Global maps of lake-level fluctuations since 30,000 yrs BP. Quaternary Research 12:83–118. Street-Perrott, F. A. and S. P. Harrison. 1985. Lake levels and climate reconstruction. Pp. 291–340 in Paleoclimate Data and Modeling. Wiley, New York. Street-Perrott, F. A. and R. A. Perrott. 1990. Abrupt climate fluctuations in the tropics: the influence of Atlantic Ocean circulation. Nature 343:607–612. Street-Perrott, F. A., P. E. Hales, R. A. Perrott, J. C. Fontes, V. R. Switsur, and A. Pearson. 1993. Late Quaternary palaeolimnology of a tropical marl lake: Wallywash Great Pond, Jamaica. Journal of Paleolimnology 9:3–22.

54

Biogeography of the West Indies: Patterns and Perspectives

Stute, M., M. Forster, H. Frischkorn, A. Serejo, J. F. Clark, P. Schlosser, W. S. Broecker, and G. Bonani. 1995. Cooling of tropical Brazil (5°C) during the last glacial maximum. Science 269:379–383. Talbot, M. R. 1990. A review of the palaeohydrological interpretation of carbon and oxygen isotopic ratios in primary lacustrine carbonates. Chemical Geology (Isotope Geoscience Section) 80:261–279. Thompson, L. G., E. Mosley-Thompson, M. E. Davis, P.-N. Lin, K. A. Henderson, J. Cole-Dai, J. F. Bolzan, and K.-B. Liu. 1995. Late glacial stage and Holocene tropical ice core records from Huascarán, Peru. Science 269:46–50. Vaughan, H. H., E. S. Deevey, and S. E. Garrett-Jones. 1985. Pollen stratigraphy of two cores from the Peten Lake District. Pp. 73–89 in Pohl, M. (ed.). Prehistoric Lowland Maya Environment and Subsistence Economy. Peabody Museum Papers 77, Harvard University Press, Cambridge, Massachusetts. Watts, W. A., 1969. A pollen diagram from Mud Lake, Marion County, north-central Florida. Geological Society of America Bulletin 80:631–642. Watts, W. A. 1975. A late Quaternary record of vegetation from Lake Annie, south-central Florida. Geology 3:344–346. Watts, W. A. and B. C. S. Hansen. 1988. Environments of Florida in the Late Wisconsin and Holocene. Pp. 307–323 in Purdy, B. A. (ed.). Wet Site Archaeology. The Telford Press, Caldwell, New Jersey. Watts, W. A. and B. C. S. Hansen. 1994. Pre-Holocene and Holocene pollen records of vegetation history from the Florida peninsula and their climatic implications. Palaeogeography, Palaeoclimatology, Palaeoecology 109:163–176. Watts, W. A. and M. Stuiver. 1980. Late Wisconsin climate of northern Florida and origin of species-rich deciduous forest. Science 210:325–327. Watts, W. A., B. C. S. Hansen, and E. C. Grimm. 1992. Camel Lake: a 40,000-yr record of vegetational and forest history from northwest Florida. Ecology 73:1056–1066. Whitmore, T. J., M. Brenner, J. H. Curtis, B. H. Dahlin, and B. W. Leyden. 1996. Holocene climatic and human influences on lakes of the Yucatan Peninsula, Mexico: an interdisciplinary, paleolimnological approach. The Holocene 6:273–287. Williams, E. O. 1989. Old problems and new opportunities in West Indian biogeography. Pp. 1–46 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Woods, C. A. 1989a. A new capromyid rodent from Haiti: the origin, evolution and extinction of West Indian rodents and their bearing on the origin of New World hystricognaths. Natural History Museum of Los Angeles County, California, Contributions in Science Series 33:59–89. Woods, C. A. 1989b. The biogeography of West Indian rodents. Pp. 741–798 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida.

Adaptations to 4 Functional Island Life in the West Indies Brian K. McNab Abstract — The functional adjustments made by vertebrates to facilitate long-term persistence on islands in the West Indies are examined. Evidence of these adjustments is obscured by the extended period of human occupation of these islands, an occupation that has led to an extensive extinction of the indigenous fauna. The available evidence indicates that vertebrates living on these islands made adjustments similar to those made by vertebrates found on tropical islands in the Indian and Pacific Oceans. These adjustments include (1) a reduction in body mass; (2) the evolution of flightlessness among birds; (3) the evolution of low rates of metabolism; (4) the selective evolution of torpor; and (5) the partial replacement of endotherms by ectotherms. All of these changes reduce resource requirements, which facilitate the survivorship of species on islands where the resource base limits the size of populations and where weather instabilities decrease survivorship of resident populations. Unfortunately, relatively few surviving endemic vertebrates living on West Indies islands have been studied from this viewpoint.

INTRODUCTION Biologists have been profoundly interested in the faunas living on continental and oceanic islands, starting with Charles Darwin (1839) and Alfred Russel Wallace (1880) through P.J. Darlington (1957) to Robert H. MacArthur and Edward O. Wilson (1967). Of special interest is the extent to which island faunas result from the combined effects of the capacity for long-distance dispersal, the chance event of landfall, biased by the ability to attain a foothold on an island in the presence of a resident fauna, and modified by the retention or evolution of characteristics that facilitate long-term survival on islands. This chapter examines the characteristics of a fauna that facilitate persistence on islands. The characterization of island faunas today is difficult because nearly all extant faunas have been heavily modified by humans through the extensive extinction of autochthonous elements and the translocation of alien species, especially mammalian predators, onto islands (see Steadman, 1995). Most islands were free of predators. What humans have done, then, is to convert distinctive island environments and faunas into mini-continental environments and faunas, thereby radically changing the conditions in which all further evolution and survival are to operate. Consequently, the composition of island faunas today tells us little about the characteristics required for long-term survival on islands. Because we know so little about the basic biology of the surviving island endemics, we are unable to answer unequivocally the question whether island endemics are different in any consistent, substantial manner from their continental relatives. On the islands of the Caribbean the combination of an extensive extinction of endemic vertebrates and the neglect of the physiology of the living remnants has led to our ignorance of the functional bases of faunal persistence on islands in this region. The extensive extinction of the larger endemic vertebrates on Caribbean islands occurred principally because these islands have been occupied by people for 6000 to 7000 years. This is a much longer period of human presence than in outlying Polynesia (Hawaii, Easter Island, New Zealand), which were first occupied some 800 to 1000 years ago — the last places on Earth to be occupied by Homo sapiens. Only a few isolated islands in the Pacific (Galápagos Islands, Auckland Islands, Campbell Island) and Indian (Mauritius, Réunion) Oceans were first occupied by European mariners 400 to 600 years ago. In the absence of humans, the principal problems faced by island faunas are the restricted resource base of islands and the likelihood of eventually encountering severe environmental 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

55

56

Biogeography of the West Indies: Patterns and Perspectives

catastrophes. The Caribbean region is regularly subjected to hurricanes, occasionally severe enough to threaten the survival of its faunas (Askins, 1991; Waide, 1991a, 1991b; Gannon and Willig, 1994; Pedersen et al., 1996), just as encountering typhoons (= hurricanes) and El Niño and La Niña events in the Pacific. These catastrophes have the greatest impact on small, flat islands, where little shelter exists. I argue that the shortage of resources directs the principal adjustments required of vertebrates for life on islands, and it is in meeting these requirements that island faunas attain their distinctive characteristics, especially in the absence of predators, a condition that permits the most radical adjustments.

THE ADJUSTMENT OF VERTEBRATES TO ISLAND LIFE A series of adjustments by vertebrates that facilitate long-term survival on islands has been described in vertebrates (McNab, 1994a, 1994b). The common feature in these responses is a reduction in resource requirements. This reduction is required by the limited resource base. These responses, which are not possible on continents where avian, and especially mammalian, predation is ubiquitous, are permitted by the reduced predation on islands: oceanic islands have no mammalian predators and most have no avian predators. In the face of the reduced resource base on islands, birds and mammals have responded in a variety of ways. These responses include (1) a reduction in body mass; (2) the evolution of “approachability”; (3) the evolution of flightlessness; (4) a reduction in rate of metabolism independent of a change in mass or the evolution of flightlessness; (5) the evolution of torpidity; and (6) the replacement of endotherms by ectotherms. Each of these responses to island life reduces resource requirements by means of a reduction in rate of metabolism. A reduction in body mass — The change in body mass associated with island life is complex (see Lomolino, 1985). A reduction in mass reduces the amount of energy and matter required for maintenance and activity because these requirements increase with mass. Flying foxes of the genera Pteropus and Dobsonia and flightless rails have masses that are correlated with island size (McNab, 1994b). However, under some circumstances body mass in island endemics increases, but only if the resource abundance is unusually large, either because of the presence of an abundant resource, such as breeding salmon on Kodiak Island, Alaska, or because of the absence of competitors that normally exploit a particular resource, such as the absence of grazing and browsing mammals. Thus, an increase in mass occurs in the Kodiak bear (Ursus arctos middendorffi) and in various grazing and browsing birds, including gallinules (e.g., takahe [Porphyrio mantelli] on New Zealand, P. alba on Lord Howe Island), moas (Dinornithidae) on New Zealand, large, flightless “geese” on various Hawaiian islands, and elephant birds (Aepyornithidae) on Madagascar. The evolution of “approachability” — Many island birds and mammals can be approached closely without a fright reaction. This behavior is noticeable in the Galápagos Islands both in birds and mammals, but also is present on other islands, such as the Falkland Islands (Humphrey et al., 1987). Approachability probably was characteristic of island faunas, although presumably greatly reduced as a result of human predation on naive faunas (e.g., Réunion and Socorro; Humphrey et al., 1987). The absence of “flightiness” reduces the energy expenditure of island species, a behavior that is possible only in the absence of predators. In this view, the presence of approachability and the absence of flightiness is qualitatively similar to a truly flightless condition. The evolution of flightlessness — The evolution of flightlessness in island endemic birds is most marked in the family Rallidae. Steadman (1995) suggested that every island in the South Pacific for which an extensive fossil fauna exists had one to four species of flightless rails, which led to his estimate that the evolution of flightlessness in South Pacific rails probably occurred at least 2000 times. In rails, the evolution of flightlessness is correlated with a reduction in pectoral muscle mass, which in turn is associated with a reduction in basal rate of metabolism (McNab, 1994a).

Functional Adaptations to Island Life in the West Indies

57

A similar pattern has been seen in kiwis (Apteryx) and suggested in the flightless parrot (Strigops habroptilus) in New Zealand and the flightless cormorant (Phalacrocorax harrisii) in the Galápagos (McNab, 1994a, 1996; McNab and Salisbury, 1994). Ducks also have repeatedly evolved a flightless condition on islands, including Laysan, Hawaii, South Georgia, and in the New Zealand islands (North, South, Auckland, Campbell). What little we know indicates that their flightless condition is not correlated with a marked reduction in pectoral mass or basal rate, a condition that also exists in penguins (McNab, 1994a). The retention of intermediate to large pectoral muscles in flightless ducks and penguins is associated with the use of wings for flight under water (penguins), in escape from avian predators (Auckland Island teal), or in courtship (steamer ducks). A flightless condition in island ducks may, however, be associated with a reduction in field energy expenditures because of a reduced level of activity compared to flighted species. Sailer (1999) showed that species of the fruit-dove genus Ptilinopus that live on islands in the South Pacific without goshawks (Accipiter) have smaller pectoral girdles and muscle masses than species found on islands with goshawks, which in turn have smaller pectoral girdles and muscle masses than species found on continents, where predatory birds and mammals are present. Whether basal rate of metabolism in Ptilinopus is correlated with this differentiation in pectoral girdles and muscle masses is unknown because the only measurements of energy expenditure in Ptilinopus are on continental or large-island species, which have basal rates typical of continental Ducula (McNab, 2000). A reduction in rate of metabolism — Fruit-pigeons (Ducula) and flying foxes (Pteropus and Dobsonia) that are endemic to small islands have lower basal rates of metabolism than related species that are endemic to large islands and to continents (McNab, 1994b, 2000; McNab and Bonaccorso, 2001). This reduction in basal rate is independent of the ability to fly, and in flying foxes is most marked in females (McNab and Armstrong, in press). The reduction in the basal rate of Pteropus is most marked in small-sized island endemics (e.g., P. rodricensis) and in females that belong to larger island endemics (e.g., P. hypomelanus). The smallest small-island Pteropus studied, pumilus, has a basal rate that is somewhat less depressed, which raises the question whether small endotherms that are endemic to small islands might not have to adjust their basal rates. This question is unexplored; it might apply to Ptilinopus, which is much smaller than Ducula, and would be profitably studied in some small, small-island endemic passerines. Whether the reduction in basal rate in small-island endemic endotherms is related to a change in body composition, as appears to be the case in kiwis and flightless rails, is unknown. The evolution of torpor — Bonaccorso and McNab (1997) observed that several small, nectarivorous flying foxes belonging to the genera Macroglossus and Syconycteris readily entered torpor, a behavior not known to occur in nectarivorous bats of similar or smaller mass belonging to the New World family Phyllostomidae. In contrast to insectivorous bats, which tend readily to enter torpor in cool climates and sometimes have effective endothermy in tropical environments (McNab, 1969; Bonaccorso and McNab, submitted), these nectarivores are prone to use torpor in the tropical lowlands, and show more effective endothermy in the tropical highlands and warm-temperate regions (Geiser et al., 1996). These genera are found in Southeast Asia, northern Australia, and on large and small islands from the Moluccas to the Solomons. Two related genera, Melonycteris and Notopterus, are endemics on South Pacific islands from the Bismarck Archipelago to the Solomon Islands, New Caledonia, Vanuatu, and Fiji. One of these bats, M. melanops from New Britain, has been shown to be less prone to enter torpor (Bonaccorso and McNab, 1997), possibly in association with a larger body size; Notopterus is even larger. Whether torpor in these bats facilitates their persistence on small islands is unknown. The replacement of endotherms by ectotherms — On many islands, including the Galápagos, Aldabra, Fiji, and Komodo, the largest herbivorous and carnivorous niches are occupied by reptiles (Flannery, 1993; McNab, 1994b). Some of this “replacement” of endotherms may occur because

58

Biogeography of the West Indies: Patterns and Perspectives

the appropriate endotherms never arrived on these islands, or because these islands cannot sustain indefinitely the high level of resource harvesting required by endotherms. The high requirement of endotherms is produced by their high individual expenditures and the high population levels required for long-term survivorship. The success of reptiles on islands undoubtedly reflects their low individual resource requirements, compared to endotherms of the same mass, and their ability to tolerate prolonged periods of starvation because of an appreciable increase in body size.

WAS THE FAUNA OF THE WEST INDIES RESOURCE LIMITED? The adjustments that facilitate the long-term survival of vertebrates on islands have been recognized through an examination of the fauna of South Pacific islands. This section explores the extent to which these (or other) adjustments have been made to life on the islands of the West Indies. As noted, the present fauna of the West Indies is a highly biased subsample of the pre-human fauna, most of the larger endemics having become extinct, as have all, but one, of the flightless birds. Furthermore, this inquiry is limited by the few studies that have been made of the functional biology of the living species belonging to this fauna. A reduction in body mass — A change in mass by an island endemic is difficult to detect without comparison with an appropriate continental relative, but a few observations are relevant. Megalonychid ground sloths were found in the Pleistocene and Holocene on Puerto Rico, Hispaniola, and Cuba (Morgan and Woods, 1986). One of the sloths found in Hispaniola, Acratocnus comes, was the size of living tree sloths, which possibly suggests a reduction in mass in relation to life on islands under the assumption that this species was a ground sloth. Some of the capromyid rodents found on small, flat islands, e.g., Geocapromys ingrahami from the Bahamas, have a much smaller mass than relatives on larger, high islands, e.g., G. browni from Jamaica. The diversity of hummingbirds on the Antilles may be facilitated by their small masses: the smallest hummingbird, the bee (Mellisuga helenae), is a Cuban endemic. On the other hand, the extinct caproymid Amblyrhiza inundata was huge (the size of the black bear!), which may have reflected that it was the only browsing herbivore on St. Martin. The evolution of “approachability” — Few vertebrates on Caribbean islands are approachable, but that may simply mean that the approachable populations and species either learned wariness after the arrival of humans, or they became extinct. The evolution of flightlessness — Nearly all flightless species of birds that inhabited Caribbean islands are extinct. They included, at least, an ibis (Xenicibis xympithecus) from Jamaica (Olson and Steadman, 1979), some rails (e.g., Nesotrochis spp.) on the Virgin Islands, Puerto Rico, and Hispaniola (Olson, 1974), and possibly a large owl (Ornimegalonyx oterori) from Cuba (Olson, 1985). A living rail, Cyanolimnas cerverai in the Zapata swamp of Cuba, either is flightless or nearly so (Raffaele et al., 1998). A reduction in rate of metabolism — Few vertebrates native to the West Indies have had their rates of metabolism measured. One group for which we have some data are rodents of the family Capromyidae. Measurements have been made on Capromys pilorides (McNab, 1978), Geocapromys browni (Ottenwalder, personal communication), and G. ingrahami (Jordan, 1989). These species have basal rates that are 64, 82, and 67%, respectively, of the values expected from body mass in mammals generally (McNab, 1988). These low rates cannot clearly be accounted for by food habits or any other obvious ecological factor (McNab, 1989). The restriction of capromyids to islands may well be a causative factor responsible for their low basal rates (McNab, 1994b; Arends and McNab, in press). The Greater Antilles had two endemic families of insectivores. One is the Solenodontidae, of which two species survive: Solenodon paradoxus on Hispaniola and S. cubanus on Cuba. A giant species of Solenodon was also found on Cuba (Morgan et al., 1980). Unfortunately, Solenodon is little studied, but it is undoubtedly characterized by low rates of metabolism given that these species

Functional Adaptations to Island Life in the West Indies

59

are large (~1 kg), slow moving, and tropical in distribution. I suggest that they may have rates of metabolism somewhat similar to tenrecs, given that both groups are rather large, ground-dwelling insectivores that live in tropical climates, which would give them basal rates that are only about 50% of what is expected from body mass (as is the case in tenrec Setifer). If that is the case, the low rate of metabolism probably contributed to their persistence on these islands, although it may contribute to their demise in the face of imported predators as a result of the propensity of a low rate of metabolism to depress the rate of reproduction in eutherians (McNab, 1980). The second family is the Nesophontidae, which included several large, shrew-like species that belong to the (apparently) extinct genus Nesophontes. The presence of these insectivores in a tropical environment does raise the possibility that they had low rates of metabolism similar to those of crocidurine shrews from the African and Asian tropics (see McNab, 1991). The physiological ecology of Caribbean birds has been completely neglected. One group that responds to life on small islands in the South Pacific are fruit-pigeons of the genus Ducula. In the Caribbean four species of pigeons that belong in the genus Columba appear to have converged on frugivory similar to Ducula. The only species in this group that has had its rate of metabolism measured is the white-crowned pigeon (C. leucocephala). This species has a basal rate that is 100% of the value expected from the nonpasserine curve of Aschoff and Pohl (1970). Small-island specialist Ducula have basal rates that vary between 51 and 61% of the rates expected from the Aschoff–Pohl (1970) standard, whereas mainland Ducula have basal rates between 75 and 91%; an intermediate species, D. bicolor, has a basal rate equal to 71% (McNab, 2000). The whitethroated pigeon (C. vitiensis) is found on mainlands and on smaller islands in the South Pacific; it has a basal rate that is 91% of the value expected from mass. The white-crowned pigeon in parts of its range, such as the Florida Keys, Bahamas, and Lesser Antilles, is a small-island species. It is also resident on Cuba, Jamaica, Hispaniola, and Puerto Rico and occurs in the Keys only during the breeding season (Bancroft, 1992). So, is this a small-island or a large-island species, and how does one distinguish between these island-size categories? However one classifies C. leucocephala, it clearly has a high basal rate by Ducula standards and appears not to be responding to small-island life, at least as does Ducula. Other Caribbean members of Columba, two of which, the plain pigeon (C. inornata) and the ring-tailed pigeon (C. caribaea), should be examined in relation to their restriction to large Caribbean islands, as should the scalynaped pigeon (C. squamosa), which is widely distributed on large and small islands. Caribbean columbids indeed may be more nomadic than most Pacific island species and therefore treat the Caribbean islands as one fragmented continent (J. Sailer, personal communication), thereby avoiding a commitment to small-island life. This may be facilitated by the smaller scale of the Caribbean Sea compared to the Pacific Ocean. Two other groups of birds that should be examined in the West Indies are the trogons (Trogonidae) and the todies (Todidae). Trogons have not been studied anywhere, but a few data indicate a low rate of metabolism in a continental species. Whether the two species of Caribbean trogons, one in Cuba (Prioteles temnurus) and one in Hispaniola (P. roseigaster), with Prioteles a genus unique to the West Indies, have low basal rates is unknown; it may simply be that an inherently low basal rate in trogons (personal observations) facilitates their survival in the Greater Antilles. Todies (Todidae) are also unstudied from the view of energy expenditure. This family is unique to the Greater Antilles with one species each in Cuba, Jamaica, and Puerto Rico, and two in Hispaniola. Their small size (5 to 8 g), insectivorous habits, and tropical distribution make them excellent candidates for low basal rates of metabolism and the use of torpor. Merola-Zwartjes and Ligon (2000), however, have measured high basal rates in the Puerto Rican tody (Todus mexicanus). Todies are especially interesting because they have been found in North America (Olson, 1976) and Europe (Mourer-Chauviré, 1985) during the Oligocene, but at present are relictual in the Greater Antilles. Similarly, the Antilles picolet, Nesoctites micromegas, which is quite different from other picolets (D. W. Steadman, personal communication), is limited in distribution to Hispaniola.

60

Biogeography of the West Indies: Patterns and Perspectives

The occurrence of vertebrates with a relictual distribution on islands near continents is a common phenomenon, as can be seen with tenrecs and lemurs on Madagascar, Coenocorypha snipes in New Zealand, Tasmanian devil (Sarcophilus) and thylacine (Thylacine) in Tasmania, and Solenodon on Hispaniola and Cuba, as well as the todies in the Caribbean. Most of these endotherms will probably turn out to have low rates of metabolism, a condition that may facilitate their persistence on islands, especially in the absence of competition and predation, and contribute to their absence from adjacent continents. The evolution of torpor — No studies of the propensity of Caribbean endotherms to enter to torpor have been made. I am suspicious that most insectivorous bats in the Caribbean enter torpor as they do almost everywhere else. Yet, some of the larger insectivorous bats might not enter torpor, as has been seen to be the case in some tropical environments (see McNab, 1969; Bonaccorso and McNab, submitted). One possibility for the evolution of torpor in the West Indies results from an analogy with the nectarivorous pteropodids in the New Guinea region: the phyllostomid subfamily Phyllonycterinae contains three genera and nine species of small, nectarivorous bats, which in association with their endemism on the islands of the Caribbean raises the possibility that they, unlike other members of the family Phyllostomidae, readily enter torpor. Entrance into torpor by birds tends to be confined to small species, but it has not been much studied in the tropics. Hummingbirds readily enter topor, and one would suppose that Caribbean species would do so as well, but no reason exists to suspect that Caribbean species are more prone to enter torpor than North or South American species, except possibly in relation to a small size. Merola-Zwartjes and Ligon (2000) have shown that female Puerto Rican todies (Todus mexicanus) enter torpor during the breeding season, when exposed to cool temperatures. The propensity of this species to enter torpor is undoubtedly connected with its small mass (5 to 7 g), but possibly also in relation to its restriction to an island distribution. The replacement of endotherms by ectotherms — Some reasonably large ectotherms were native to the Caribbean islands. They include rather large iguanid lizards that belong to the genus Cyclura, which are (or were) found in the Greater Antilles, the Bahamas, and the Virgin Islands. Large tortoises of the genus Geochelone were present on Cuba and Hispaniola (Williams, 1950; Auffenberg, 1967; Franz and Woods, 1983).

CONCLUSION The islands of the West Indies had a native terrestrial vertebrate fauna that shared some of the characteristics that have been described for the faunas of the South Pacific: long-term persistence in the fauna was facilitated by the reduction of resource requirements. This was accomplished in the South Pacific by evolving a small body mass, a reduction in wariness, the selective evolution of flightlessness among birds, a reduction in rate of metabolism, and the acquistion of herbivory by medium- to large-sized ectotherms. The difficulty in giving a complete analysis of these phenomena in the West Indies is that its fauna has suffered a great extinction (because humans have been on these islands for several thousand years) and because the surviving fauna has been poorly studied. In the West Indies, a reduction in mass, the evolution of flightlessness, a reduction in rate of metabolism, and the occurrence of large ectotherms were elements present in the fauna. I hope that this analysis will stimulate the interest of biologists to examine the functional bases of faunal persistence in the living remnants of the native West Indian fauna.

ACKNOWLEDGMENTS I thank Charles Woods and Jeff Sailer for reviewing an earlier draft of this chapter and Charles Woods for inviting me to submit this chapter to this volume.

Functional Adaptations to Island Life in the West Indies

61

LITERATURE CITED Arends, A. and B. K. McNab. In press. The comparative energetics of ‘caviomorph’ rodents. Comparative Biochemistry and Physiology. Aschoff, J. and H. Pohl. 1970. Rhythmic variations in energy metabolism. Federation Proceedings 29:1541–1552. Askins, R. A. and D. N. Ewert. 1991. Impact of Hurricane Hugo on bird populations on St. John, U.S. Virgin Islands. Biotropica 23:481–487. Auffenberg, W. 1967. Notes on West Indian tortoises. Herpetologica 23:34–44. Bancroft, G. T. 1992. A closer look: White-crowned Pigeon. Birding 24:21–24. Bonaccorso, F. A. and B. K. McNab. 1997. Plasticity of energetics in blossom bats (Pteropodidae): impact on distribution. Journal of Mammalogy 78:1073–1088. Bonaccorso, F. A. and B. K. McNab. Submitted. Standard energetics in leaf-nosed bats (Hipposideridae): its relationship to intermittent and protracted foraging tactics in bats and birds. Physiological Zoology, submitted. Darlington, P. J. 1957. Zoogeography: The Geographical Distribution of Animals. John Wiley & Sons, New York. Darwin, C. 1839. Journal of Researches into the Geology and Natural History of the Various Countries Visited by H. M. S. Beagle, Under the Command of Captain Fitzroy, R. N. from 1832 to 1836. J. M. Dent and Sons, London. Flannery, T. 1993. The case of the missing meat eaters. Natural History 102:41–45. Franz, R. and C. A. Woods. 1983. A fossil tortoise from Hispaniola. Journal of Herpetology 17:79–81. Gannon, M. R. and M. R. Willig. 1994. The effects of Hurricane Hugo on bats of the Luquillo Experimental Forest of Puerto Rico. Biotropica 26:320–331. Geiser, F., F. K. Coburn, G. Kortner, and B. S. Law. 1996. Thermoregulation, energy metabolism, and torpor in blossom-bats, Syconycteris australis (Megachiroptera). Journal of Zoology (London) 239:583–590. Humphrey, P. S., B. C. Livezey, and D. Siegel-Causey. 1987. Tameness of birds of the Falkland Islands: an index and preliminary results. Bird Behavior 7:67–72. Lomolino, M. V. 1985. Body size of mammals on islands: the island rule reexamined. American Naturalist 125:310–316. Merola-Zwaretjes, M. and J. D. Ligon. 2000. Ecological energetics of the Puerto Rican Tody: heterothermy, torpor, and intra-island variation. Ecology 81:990–1003. MacArthur, R. H. and E. O. Wilson. 1967. The Theory of Island Biogeography. Princeton University Press, Princeton, New Jersey. McNab, B. K. 1969. The economics of temperature regulation in neotropical bats. Comparative Biochemistry and Physiology 31:227–268. McNab, B. K. 1980. Food habits, energetics, and the population biology of mammals. American Naturalist 116:106–124. McNab, B. K. 1988. Complications inherent in scaling the basal rate of metabolism in mammals. Quarterly Review of Biology 63:25–54. McNab, B. K. 1989. On the selective persistence of mammals in South America. Pp. 605–614 in Redford, K. H. and J. F. Eisenberg (eds.). Advances in Neotropical Mammalogy. Sandhill Crane Press, Gainesville, Florida. McNab, B. K. 1991. The energy expenditure of shrews. Pp. 35–45 in Findley, J. S. and T. L. Yates (eds.), The Biology of the Soricidae. The Museum of Southwestern Biology, University of New Mexico, Albuquerque. McNab, B. K. 1994a, Energy conservation and the evolution of flightlessness in birds. American Naturalist 144:628–642. McNab, B. K. 1994b. Resource use and the survival of land and freshwater vertebrates on oceanic islands. American Naturalist 144:643–660. McNab, B. K. 1996. Metabolism and temperature regulation of kiwis (Apterygidae). Auk 113:687–692. McNab, B. K. 2000. The influence of body mass, climate, and distribution on the energetics of South Pacific pigeons. Comparative Biochemistry and Physiology 127A:309–329. McNab, B. K. and M. I. Armstrong. In press. The scaling of energetics in flying foxes of the genus Pteropus. Journal of Mammalogy 82. McNab, B. K. and F. J. Bonaccorso. 2001. The metabolism of New Guinean pteropodid bats. Journal of Comparative Physiology B. 171:201–214.

62

Biogeography of the West Indies: Patterns and Perspectives

McNab, B. K. and C. A. Salisbury. 1995. Energetics of New Zealand’s temperate parrots. New Zealand Journal of Zoology 22:339–349. Morgan, G. S. and C. A. Woods. 1986. Extinction and the zoogeography of West Indian land mammals. Biological Journal of the Linnean Society 28:167–203. Morgan, G. S., C. E. Ray, and O. Arredondo. 1980. A giant extinct insectivore from Cuba (Mammalia: Insectivora: Solenodontidae). Proceedings of the Biological Society of Washington 93:597–608. Mourer-Chauviré, C. 1985. Les Todidae (Aves: Coraciiformes) des Phosphorites du Quercy (France). Proceedings of the Koninklijke Nederlandse Akademie van Wetenschappen 88:407–414. Olson, S. L. 1974. A new species of Nesotrochis from Hispaniola, with notes on other fossil rails from the West Indies (Aves: Rallidae). Proceedings of the Biological Society of Washington 87:439–450. Olson, S. L. 1976. Oligocene fossils bearing on the origins of the Todidae and the Momotidae (Aves: Coraciiformes). Smithsonian Contributions to Paleobiology 27:111–119. Olson, S. L. 1985. The fossil record of birds. Pp. 79–252 in Farner, D. S. and J. R. King (eds.). Avian Biology, Vol. III. Academic Press, New York. Olson, S. L. and D. W. Steadman. 1979. The humerus of Xenicibus, the extinct flightless ibis of Jamaica. Proceedings of the Biological Society of Washington 92:23–27. Pedersen, S. C., H. H. Genoways, and P. W. Freeman. 1996. Notes on bats from Montserrat (Lesser Antilles) with comments concerning the effects of Hurricane Hugo. Caribbean Journal of Sciences 32:206–213. Raffaele, H., J. Wiley, O. Garrido, A. Keith, and J. Raffaele. 1998. A Guide to the Birds of the West Indies. Princeton University Press, Princeton, New Jersey. Sailer, J. K. 1999. Biogeography and Ecomorphology in Fruit-Doves (Columbidae: Ptilinopus). Master’s thesis, University of Florida, Gainesville. Steadman, D. W. 1995. Prehistoric extinctions of Pacific island birds: biodiversity meets zooarchaeology. Science 267:1123–1131. Waide, R. B. 1991a. The effect of Hurricane Hugo on bird populations in the Luquillo Experimental Forest. Biotropica 23:475–480. Waide, R. B. 1991b. Summary of the responses of animal populations to hurricanes in the Caribbean. Biotropica 23:508–512. Wallace, A. R. 1880. Island Life, or the Phenomena and Causes of Insular Faunas and Floras, Including a Revision and Attempted Solution of the Problem of Geological Climates. Macmillan, London. Williams, E. 1950. Testudo cubensis and the evolution of Western Hemisphere tortoises. Bulletin of the American Museum of Natural History 95:1–36.

and Biogeography 5 Phylogeny of Lyonia sect. Lyonia (Ericaceae) Walter S. Judd Abstract — The biogeographic relationships of 17 geographical regions of high endemism within the Caribbean region were assessed through a preliminary Brooks parsimony analysis, which employed as characters 53 varietal, specific, and supraspecific taxa of Lyonia sect. Lyonia. This monophyletic group is represented within the Greater Antilles by 25 species, many of which are narrow endemics, and the phylogeny of the group is fairly well understood. This analysis resulted in the discovery of two equally parsimonious area cladograms that differed only in that the positions of Puerto Rico and the Massif de la Hotte (of southeastern Hispaniola) are switched. The area cladograms indicate that all the Hispaniolan localities plus Puerto Rico and St. Thomas constitute a clade, with a sister area relationship expressed between the Cordillera Central/Massif du Nord and the Massif de la Selle/Sierra de Baoruco. All Cuban geographical regions form a monophyletic group (except for the Sierra de Trinidad, in central Cuba), with all the localities in the Oriente region constituting a distinct subclade. Within the Oriente region, the Sierra Maestra/Gran Piedra shows a sister group relationship to the Sierra de Nipe/Sierra de Cristal/Moa, Toa and Baracoa region. These biogeographical results suggest that the species of Lyonia sect. Lyonia growing on each island of the Greater Antilles are nearly always most closely related to others on the same island. It is likely that tectonic events, wind dispersal, and climatic changes have all influenced the present distribution of species of Lyonia sect. Lyonia.

INTRODUCTION Lyonia Nuttall (Ericaceae, Vaccinioideae, Lyonieae), a genus of 36 species (52 taxa) of trees and shrubs, occurs in eastern Asia (Japan to Pakistan, south to the Malay Peninsula), the Greater Antilles (including St. Thomas), and continental North America (eastern United States and Mexico) (Judd, 1995a). The genus is related to Pieris D. Don, Agarista D. Don, and Craibiodendron W. W. Smith, which together constitute the tribe Lyonieae (Judd, 1979, 1981; Kron and Judd, 1997, 1999). This tribe is diagnosed by the presence of bands of fibers in the phloem, a lignified leaf epidermis, biseriate-stalked gland-headed hairs, and seeds with a testa of elongated cells. Stamens with S-shaped filaments may be an additional synapomorphy. The monophyly of Lyonia is strongly supported in phylogenetic analyses employing morphological and/or molecular (rbcL and matK nucleotide sequences) characters (Kron and Judd, 1997, 1999). Morphological synapomorphies for the species of Lyonia include the presence of multicellular gland-headed hairs on the corolla and ovary, spurs borne on the filament, disintegration tissue extending onto the spurs, and the prominently thickened capsule sutures (see Judd, 1979, 1981); the last feature is especially distinctive. Other characters useful in identification are outlined in recent monographic treatments of the genus (Judd, 1981, 1990, 1995a), and the closely related genera Agarista, Craibiodendron, and Pieris also have been well studied (Judd, 1982, 1984, 1986, 1995b, 1995c; Judd and Hermann, 1990). Phylogenetic relationships within Lyonia have been investigated through a series of phylogenetic analyses employing morphology (Judd, 1979, 1981, 1995a), nucleotide sequences of the plastid genes rbcL and matK, and combined analyses (Kron and Judd, 1997, 1999). These analyses strongly support the placement of Lyonia sect. Lyonia, i.e., those members of the genus with ferruginous peltate scales, as the sister group of the remaining species. The monophyly of Lyonia sect. Lyonia

0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

63

64

Biogeography of the West Indies: Patterns and Perspectives

is well supported by the roughened filaments, tailed seeds, and the distinctive peltate scales (i.e., a lepidote indumentum) that cover all parts of these plants. Phylogenetic relationships among the species of Lyonia sect. Lyonia are fairly well understood (see Judd, 1981, 1995a), although at present they are based only upon morphological characters. This diverse group contains the majority of species within the genus, i.e., 28 species (Judd, 1995a), and is most diverse within the Greater Antilles with 12 species (16 taxa) occurring in Cuba, 10 species (11 taxa) in Hispaniola, 2 in Jamaica, 2 in Puerto Rico, and 1 in St. Thomas. Only three members of Lyonia sect. Lyonia occur in continental North America — L. squamulosa Martens & Galeotti (Mexico), and L. ferruginea (Walter) Nutt., and L. fruticosa (Michx.) G. S. Torrey (Florida, Georgia, South Carolina). With the exception of L. stahlii Urban and L. truncata Urban, all the species occurring in the Greater Antilles are restricted to a single island. Lyonia stahlii occurs on two islands but has differentiated into two geographically isolated varieties: var. costata (Urban) Judd on Hispaniola and var. stahlii on Puerto Rico. Lyonia truncata occurs on Hispaniola (vars. truncata and montecristina (Urban and Ekman) Judd) and on Puerto Rico (var. proctorii Judd). Species of Lyonia sect. Lyonia are rather narrowly endemic and often are limited to a particular mountain range, specific ecological situations, or restricted a elevational range (see Judd, 1981, 1995a). However, on each island a few taxa — such as L. truncata var. montecristina, L. stahlii var. costata on Hispaniola, or L. macrophylla (Britton) Ekman ex Urban, L. affinis (A. Richard) Urban, and L. latifolia (A. Richard) Griseb. on Cuba — are relatively widespread. Lyonia sect. Lyonia has two major centers of endemism in Hispaniola: the Cordillera Central/Massif du Nord, where eight taxa are indigenous and five are endemic, and the Massif de la Selle/Sierra de Baoruco, with six taxa, three of which are endemic (Judd, 1981, 1995a). The species occur there in a wide range of elevations, i.e., ~200 to 3175 m, and many species are seemingly elevationally isolated from their close relatives (Judd, 1981). In the Cordillera Central this pattern is best illustrated by three pairs of species: L. heptamera Urban – L. buchii Urban, L. tuerckheimii Urban – L. stahlii var. costata, and L. urbaniana (Sleumer) Jiménez – L. tinensis Urban; the first member of each species pair occurs at higher elevations and the second at lower elevations. Similar patterns can be found in the Massif de la Selle/Sierra de Baoruco, e.g., L. alpina Urban & Ekman occurs at much higher elevations than the related L. truncata. Other taxa of Hispaniola are isolated by their occurrence in mountain ranges that are separated by low areas of xerophytic vegetation, e.g., L. microcarpa Urban & Ekman and L. urbaniana, or L. truncata vars. truncata and montecristina. The two Jamaican species, L. jamaicensis (Swartz) D. Don and L. octandra (Swartz) Griseb., are also elevationally isolated in the Blue Mountains. In contrast to the species of Hispaniola and Jamaica, those of Cuba, with a few exceptions, are rather uniform with respect to elevational distribution but tend to be geographically isolated in different mountain ranges. Most species are limited to either the Oriente region (of eastern Cuba) or Pinar del Río (of western Cuba), although a single species, L. trinidadensis Judd, occurs in the mountains of Las Villas Province, near the center of the island. Lyonia is especially diverse in the mountains of the Oriente region (Judd, 1981, 1995a). Within this region, the Sierra de Cristal, Sierra Maestra, Gran Piedra region, Sierra de Nipe, Moa Plateau, Sierra de Moa, Sierra de Toa, and Baracoa region show the greatest diversity in species of Lyonia, and most of these areas have at least one endemic taxon (see Judd, 1981, 1995a). Some geographically isolated Cuban taxa include L. nipensis Urban var. nipensis – var. depressinerva Judd, L. obtusa Griseb. – L. longipes Urban, L. latifolia var. latifolia – var. calycosa (Small) Judd, L. affinis – L. elliptica (C. Wright ex Small) Alain, and L. glandulosa (A. Richard) Urban var. glandulosa – var. revolutifolia Judd – var. toaensis (Acuña & Roig) Berazaín. In contrast to the lepidote species (i.e., Lyonia sect. Lyonia), which are essentially a montane Antillean clade, the non-lepidote species of Lyonia occur primarily in moist forests of eastern North America and eastern Asia. Only L. lucida (Lam.) K. Koch of sect. Maria (DC.) C. E. Wood (see Judd 1981, 1995a) also grows in the Antilles, occurring on the acidic sands of the coastal plain of the southeastern United States and western Cuba. Continental species tend also to have very broad

Phylogeny and Biogeography of Lyonia sect. Lyonia (Ericaceae)

65

geographical ranges — see especially L. ligustrina (L.) DC., L. mariana (L.) D. Don, L. lucida, L. villosa (Wallich ex Clark) Hand.-Mazz., and L. ovalifolia (Wallich) Drude (Judd, 1981). The species of Lyonia sect. Lyonia occur in a wide variety of habitats, but characteristically prefer acid soils. They may occur, however, over limestone. For example, L. truncata, L. alpina, and L. microcarpa grow in lateritic soil filling the cracks of eroded limestone rocks, and L. stahlii var. costata grows on organic soil developed over a limestone bedrock. Many Cuban and Hispaniolan species occur on red lateritic soils developed by the weathering of underlying serpentine rocks. The species of western Cuba occur on siliceous soils; some Hispaniolan species are found on soils derived from igneous rocks. Several Caribbean taxa (especially those of cloud forests, such as L. octandra and L. stahlii) may also be found in highly organic soils. The Caribbean species occur in moist montane or cloud forests, high- or low-elevation pine forests, savannas, thickets, or dry rocky scrub. They range in elevation from nearly sea level to 3175 m. Thus, L. heptamera Urban can be found at the top of the highest peak of Hispaniola (Pico Duarte, 3175 m) while L. myrtilloides Griseb. and L. ekmanii Urban grow near sea level in Pinar del Rio, Cuba, and L. macrophylla occurs just above sea level near Moa, Cuba. Within the Greater Antilles, Lyonia sect. Lyonia shows a “Western Continental” distribution pattern; genera with this pattern are missing from the Lesser Antilles, are often most diverse in Cuba, and decrease in diversity eastward to the Virgin Islands (Judd, 1981). Howard (1973) lists numerous genera exhibiting this pattern, although biogeographical patterns are not approached from a phylogenetic standpoint, limiting a precise understanding of the underlying historical processes. Because of the existence of numerous narrowly endemic species that occupy a wide range of plant communities (and elevations), Lyonia sect. Lyonia is an ideal clade to use in studying biogeographical relationships within the Greater Antilles. Well-supported phylogenies exist for very few Antillean plant groups. Some genera that have been analyzed in the past few years include Mecranium (Melastomataceae; Skean, 1993); Pictetia (Leguminosae, Faboideae; Beyra and Lavin, 1999); Poitea (Leguminosae, Faboideae; Lavin, 1993); and Sabal (Palmae; Zona, 1990). In this chapter, I use the hypothesized phylogenetic relationships among species (and varieties) of Lyonia sect. Lyonia (see Judd, 1981, 1995a) to investigate biogeographical relationships within the Greater Antilles. Biogeographical patterns derived from geographical distributions of species (and supraspecific clades) within Lyonia sect. Lyonia are, then, briefly compared with patterns seen in Mecranium, Pictetia, Poitea, and Sabal.

PHYLOGENETIC RELATIONSHIPS WITHIN LYONIA SECT. LYONIA Cladistic relationships of the numerous species within section Lyonia were initially investigated by Judd (1981) by means of a manual, Wagner-Groundplan-Divergence analysis. Later Judd (1995a) reassessed the morphological characters employed in this analysis. A total of 29 phenotypic characters (of potential phylogenetic significance) from this taxonomic treatment were selected for a second analysis, and these characters were delimited into discrete states. The phylogenetic relationships of the Antillean species, along with L. squamulosa, L. ferruginea, and L. fruticosa, then were reanalyzed using heuristic and branch-and-bound algorithms of both PAUP 2.4.1 and Hennig86, version 1.5 (see Judd, 1995a, for methodological details). The resulting trees were rooted using Lyonia sects. Pieridopsis (Rehder) Airy Shaw and Maria as functional outgroups, along with Craibiodendron and Agarista, in sequence. A representative cladogram and strict consensus tree (of all trees found in both PAUP and Hennig86 analyses) are presented in Figure 1; relationships within the subclades designated “Cuban spp.” and “Hispaniolan spp.” are shown in Figure 2. Note that L. maestrensis Acuña & Roig was deleted from the cladistic study because mature flowers of this species have not been seen; for other details relating to this analysis see Judd (1995a). The Antillean species of Lyonia sect. Lyonia may belong to two major clades. The first is called the “Cuban group” because all the taxa within it are native to Cuba (see Figures 1 and 2; Judd, 1981: figure 2). The monophyly of the Cuban clade is supported by the apomorphy of the adaxial

66

Biogeography of the West Indies: Patterns and Perspectives

6 14

L. ferruginea 17 1 (0)

2 22 11 12 (0)

L. squamulosa

2 18 22

25

L. fruticosa

“Hispaniolan” spp.

L. alainii 7

4

11 2

A

14 12 (0) 12 16 (0)

17 4

L. tuerckheimii L. rubiginosa L. stahlii var. costata L. stahlii var. stahlii L. jamaicensis L. trinidadensis

2 18 19 21

“Cuban” spp.

L. octandra 12 (0)

L. ferruginea L. fruticosa L. squamulosa “Hispaniolan” spp.

L. alainii L. tuerckheimii L. rubiginosa

B

L. stahlii var. costata L. stahlii var. stahlii L. jamaicensis L. trinidadensis “Cuban” spp.

L. octandra FIGURE 1 Representative cladogram (A) and strict consensus (B) tree resulting from PAUP and Hennig86 analyses of cladistic relationships of selected species of Lyonia sect. Lyonia (from Judd, 1995a). “Cuban spp.” = L. affinis, L. elliptica, L. ekmanii, L. myrtilloides, L. macrophylla, L. longipes, L. obtusa, L. nipensis, L. glandulosa, and L. latifolia; “Hispaniolan spp.” = Hispaniolan species with abaxially pubescent leaves, i.e., L. truncata, L. alpina, L. tinensis, L. urbaniana, L. microcarpa, L. buchii, and L. heptamera.

leaf epidermal cells with inner periclinal walls strongly thickened and lignified. The second major clade is called the Hispaniolan group (see Judd, 1981) because all the taxa within it are native either to Hispaniola or to the adjacent islands of Puerto Rico and St. Thomas. The monophyly of this clade is less well supported; the group was paraphyletic in the initial analyses of Judd (1995a) but becomes monophyletic if leaf-margin condition (i.e., strongly and irregularly toothed) is weighted by two (see Judd, 1995a, for justifications), and this condition then becomes synapomorphic for

Phylogeny and Biogeography of Lyonia sect. Lyonia (Ericaceae)

8 (0)

21

L. microcarpa

5 8 (2)

19

13 (2)

67

L. urbaniana L. tinensis

9

19

L. alpina 2

3

13

14

L. buchii

15 5 25 (0)

16 (2)

19 (2) 26 (2)

L. heptamera

20

L. truncata 8

11 (0) 24

18 (0)

27 (0)

10

L. latifolia var. calycosa

29 14

2 23

L. latifolia var. latifolia 9

19 (0)

2

9 23

16 6

L. nipensis var. nipensis L. n. var. depressinerva L. obtusa

14

4 27

L. longipes 2 (0)

17 (0)

11

10

22 (0)

27 (0)

21 25 (0)

L. macrophylla L. myrtilloides

22 (2) 10

L. ekmanii

21 (0)

L. elliptica 2

18

19 (0) 4 11

26

28

16 6 14

L. affinis L. glandulosa var. toaensis L. g. var. revolutifolia L. g. var. glandulosa

FIGURE 2 Character state changes for Hispaniolan species of Lyonia with abaxially pubescent leaves (upper cladogram) and Cuban species of Lyonia with inner periclinal walls of epidermal cells strongly thickened and lignified (lower cladogram); see Judd (1995a) for more details. Note: Lyonia nipensis var. depressinerva is probably misplaced (see text).

these species. The phylogenetic position of L. jamaicensis, a species of low elevations of the Blue Mountains of Jamaica, is unclear. The relationships within the Cuban clade are at least partly resolved, and L. affinis, L. elliptica, and L. glandulosa are likely basal. The latter species is patristically distinctive, possessing numerous autapomorphies, e.g., 4-merous flowers with extremely small corollas, and extremely narrowly obovoid to ellipsoid capsules lacking a visible articulation with the pedicel. Lyonia latifolia vars. latifolia and calycosa form a distinctive monophyletic group, which is characterized by goldencolored peltate scales, elongated calyx lobes with the adaxial surface densely covered by peltate scales, and elongate-urceolate, densely lepidote corollas. The remaining members of the Cuban clade were considered to form the “L. obtusa – L. nipensis line” by Judd (1981), but the monophyly of this group was not supported in the computer-based analyses of Judd (1995a). Lyonia obtusa and L. longipes may be related, as indicated by their embedded leaf veins. I consider L. nipensis var. depressinerva to be most closely related to L. nipensis on the basis of their densely abaxially pubescent leaves (with nonsunken stalks of the peltate scales) and densely lepidote corollas, but

68

Biogeography of the West Indies: Patterns and Perspectives

L. nipensis var. depressinerva formed a clade with L. obtusa in the cladistic analyses (see Figure 2). I consider it likely, however, that the strongly revolute leaves and impressed secondary veins of L. obtusa and L. nipensis var. depressinerva have evolved independently, in response to the rigorous edaphic conditions occurring in the plant communities developed on the strongly lateritic soils of northern Oriente. Finally, L. trinidadensis, of the Trinidad Mountains in central Cuba, and L. octandra, of high elevations in the Blue Mountains of Jamaica, are weakly linked with the members of the Cuban clade. Within the Hispaniolan clade, L. stahlii, L. tuerckheimii, L. rubiginosa (Persoon) G. Don, and L. alainii Judd form a basal paraphyletic assemblage; these species all lack unicellular hairs on the abaxial leaf surface (except some individuals of L. rubiginosa), have obscure to laxly reticulate leaf veins, and are more or less sparsely to moderately lepidote. The derived, and clearly monophyletic group of Hispaniolan species, called the L. microcarpa – L. truncata – L. heptamera clade in Judd (1981), possess the synapomorphy of leaves with a dense layer of unicellular hairs on the abaxial leaf surface. Lyonia truncata is the sister species to the remaining members of this group. The remaining species (i.e., L. alpina, L. tinensis, L. microcarpa, L. urbaniana, L. buchii, and L. heptamera) are united by the apomorphy of the stalks of their peltate scales being not sunken into the abaxial leaf epidermis. Lyonia tinensis, L. microcarpa, and L. urbaniana are distinctive in that their leaves have a densely and finely raised-reticulate network of veins of the lower surface. Lyonia buchii and L. heptamera comprise a strongly supported monophyletic group; they share the following apomorphies: petioles lacking unicellular hairs and with medullary bundles with the xylem cylinder, leaf veins with a distinctive lignified sheath, very strongly and coarsely raised and reticulate venation of the abaxial leaf surface, 6- or 7-merous, very large, strongly carnose corollas, and very large, subglobose to shortly ovoid capsules. Lyonia rubiginosa (of St. Thomas) may be more closely related to the derived Hispaniolan species (and especially to L. truncata) than is indicated in the cladograms (Figures 1 and 2), especially if the abaxially pubescent leaves of this species are taken as synapomorphic.

BIOGEOGRAPHICAL INVESTIGATION Brooks (1981, 1985) developed an additive binary coding procedure that assumed that when several hosts were infected with one species of parasite, that group of hosts must be monophyletic, and this approach has been transferred to analogous biogeographical situations (Wiley et al. 1991; Brooks and McLennan, 1991). Zandee and Roos (1987) considered that widespread taxa should be considered indicative of monophyletic groups of areas, and this has been described as assumption 0 (in comparison with assumptions 1 and 2 of component analysis; see Forey et al., 1992). Although a single phylogeny, such as that presented here for Lyonia, cannot by itself support vicariance hypotheses, it is heuristic to consider what the distribution of various species and supraspecific clades of Lyonia suggest regarding geographical affinities within the Greater Antilles. Thus, a preliminary Brooks parsimony analysis was conducted, and it is compared with the hypothesis of the geohistory of the Greater Antilles presented by Rosen (1976, 1985). The results of this analysis are also briefly compared with published phylogenies and geographical distributions of several other genera that occur (with numerous endemics) within the Greater Antilles.

METHODS A total of 17 geographical regions were delimited and scored for the presence (or absence) of members of 53 varietal, specific, or supraspecific taxa (of Lyonia sect. Lyonia). These geographical regions (Table 1) were in nearly all cases particular mountain ranges, which were occupied by one (or more) species of Lyonia, and their delimitation from one other was not problematic (see Figures 3 and 4). The Sierra de Neiba was omitted from the analysis because only the widespread taxon L. stahlii var. costata occurs there; the Massif des Cahos was similarly omitted as it is represented

Phylogeny and Biogeography of Lyonia sect. Lyonia (Ericaceae)

69

TABLE 1 Geographical Regions Used in Brooks Parsimony Analysis 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17.

Outgroup (eastern North America) Mexico Massif de la Selle/Sierra de Baoruco (southwestern Hispaniola) Massif de la Hotte (southwestern Hispaniola) Cordillera Central/Massif du Nord (north-central Hispaniola) Sierra de Nipe (eastern Cuba) Sierra de Cristal/Micara (eastern Cuba) Moa/Toa region (eastern Cuba) Baracoa region (eastern Cuba) Sierra Maestra (eastern Cuba) Gran Piedra (eastern Cuba) Sierra de Trinidad (central Cuba) Pinar del Río (western Cuba) Isla de Pinos (western Cuba) Blue Mountains (Jamaica) Puerto Rico Saint Thomas

Note: For more details concerning delimitation of these regions see Figures 3 and 4, and Judd, 1981, 1995a.

only by L. buchii, a species of broad occurrence on Hispaniola. The Massif de la Hotte, although occupied only by L. stahlii var. costata, was included because the populations occurring in the region are distinctive in having mainly 4-merous flowers. Additionally, this region is a major center of endemism for some other Antillean genera and is, therefore, of more general interest. A list of the monophyletic taxa that were derived from the cladograms are presented in Figures 1 and 2, and these formed the “characters” employed in the Brooks parsimony analysis (see Table 2). The matrix of “characters” for each geographical region is provided in Table 3, and this was analyzed using the heuristic search algorithm of Hennig86, version 1.5 (Farris, 1988), using the ie-algorithm, which identifies one tree, certain to be of minimal length; extensive branch swapping (bb*) was applied to this tree.

RESULTS The Hennig86 search resulted in the discovery of two equally parsimonious trees of 57 steps (consistency index (CI) = 0.92, retention index (RI) = 0.95), which differ only in that the positions of Puerto Rico and the Massif de la Hotte (of southeastern Hispaniola) are switched. The strict consensus tree is shown in Figure 5. Inspection of the area cladogram (Figure 5) indicates that all the Hispaniolan localities plus Puerto Rico and St. Thomas constitute a clade, with a sister area relationship expressed among the Cordillera Central/Massif du Nord (of north-central Hispaniola) and the Massif de la Selle/Sierra de Baoruco (of southwestern Hispaniola). Thus a close biohistorical relationship between Hispaniola, Puerto Rico, and St. Thomas (of the U.S. Virgin Islands) is supported. Likewise, all the Cuban geographical regions form a monophyletic group (except for the Sierra de Trinidad, in central Cuba). All the localities in eastern Cuba (i.e., the Oriente region) constitute a clade, with the southern mountain ranges (Sierra Maestra/Gran Piedra) showing a sister group relationship to the northern mountain ranges (Sierra de Nipe, Sierra de Cristal, and mountains in the vicinity of Moa, Toa, and Baracoa). Within the “northern group” the geographically adjacent Moa/Toa region and Baracoa region constitute sister areas, as do the Sierra Maestra and Gran Piedra regions in the “southern

70

Biogeography of the West Indies: Patterns and Perspectives

1

2 3

21

a

c b

d e f

20

h g

j

i

77

76

75

FIGURE 3 Geographical areas of Cuba where Lyonia occurs (above, right): (1) Pinar del Río and Isla de la Juventud; (2) Sierra de Trinidad and Sierra de Sancti Spiritus; (3) mountains of the Oriente region. Geographical areas of Oriente (below): (a) Sierra de Nipe; (b) Sierra de Micara; (c) Sierra de Cristal; (d) Moa region; (e) Sierra de Moa; (f ) Sierra de Toa; (g) Sierra del Frijol; (h) Baracoa region; (i) Sierra Maestra; (j) Gran Piedra.

20 a

b

c d e

f g

18 74

72

70

FIGURE 4 Geographical areas of Hispaniola where Lyonia occurs: (a) Massif du Nord; (b) Cordillera Central; (c) Massif des Cahos; (d) Sierra de Neiba; (e) Massif de la Hotte; (f ) Massif de la Selle; (g) Sierra de Baoruco.

group.” The Oriente region (i.e., eastern Cuban localities) form the sister group to the closely related Pinar del Río and Isla de Pinos regions (of western Cuba). The localities of western Cuba, therefore, show the greatest affinity to those of eastern Cuba. Finally, the Sierra de Trinidad and Jamaica are weakly linked with the Cuban geographical areas.

DISCUSSION The pattern of biogeographical relationships expressed in Figure 5 is not surprising given that the cladograms for Lyonia sect. Lyonia strongly suggest that the species growing on each island of the Greater Antilles are nearly always more closely related to others on the same island. It is noteworthy that the most ancestral species tend to occur on St. Thomas, Puerto Rico, and Jamaica. In contrast, many species of the Cordillera Central or Massif de la Selle (of Hispaniola) or the mountains of

Phylogeny and Biogeography of Lyonia sect. Lyonia (Ericaceae)

71

TABLE 2 Monophyletic Taxa Used as “Characters” in Parsimony Analysis of Geographical Regions Listed in Table 1 L. heptamera; L. buchii; L. urbaniana; L. alpina; L. alainii; L. tinensis; L. microcarpa; L. truncata var. truncata; L. truncata var. montecristina; L. truncata var. proctorii; L. truncata; L. tuerckheimii; L. stahlii var. stahlii; L. stahlii var. costata; L. stahlii; L. rubiginosa; L. jamaicensis; L. octandra; L. trinidadensis; L. nipensis var. nipensis; L. nipensis var. depressinerva; L. nipensis; L. affinis; L. macrophylla; L. obtusa; L. longipes; L. latifolia var. latifolia; L. latifolia var. calycosa; L. latifolia; L. ekmanii; L. myrtilloides; L. glandulosa var. glandulosa; L. glandulosa var. revolutifolia [= range of L. glandulosa]; L. glandulosa var. toaensis; L. squamulosa; L. fruticosa + L. ferruginea; L. ferruginea + L. fruticosa + L. squamulosa clade; Hispaniolan clade (with abaxially pubescent leaves); L. microcarpa + L. urbaniana clade; L. microcarpa + L. urbaniana + L. tinensis clade; L. buchii + L. heptamera clade; Cuban clade; L. obtusa + L. longipes clade; L. nipensis + L. latifolia clade; L. obtusa + L. longipes + L, macrophylla clade; L. nipensis + L. latifolia + L. macrophylla + L. obtusa + L. longipes clade; the previous + L. myrtifolia; the previous + L. ekmanii; the previous + L. affinis; Hispaniolan clade + L. alainii + L. tuerckheimii + L. rubiginosa + L. stahlii; Cuban clade + L. trinidadensis + L. octandra; Antillean clade. Note: Lyonia elliptica was not considered due to its imperfectly known range; L. maestrensis was not included in the analysis because it is incompletely known.

TABLE 3 Data Matrix for Geographical Areas Used in Brooks Parsimony Analysis Outgroup Mexico Selle Hotte Central Nipe Cristal Moa/Toa Baracoa Maestra Piedra Trinidad Pinar Rio Isla Pinos Jamaica Puerto Rico St. Thomas

10a 0000000000 0000000000 0101001101 0000000000 1110110011 0000000000 0000000000 0000000000 0000000000 0000000000 0000000000 0000000000 0000000000 0000000000 0000000000 0000000001 0000000000

20 0000000000 0000000000 1100100000 0100100000 1100100000 0000000001 0000000001 0000000001 0000000000 0000000000 0000000000 0000000010 0000000000 0000000000 0000001100 0011100000 0000010000

30 0000000000 0000000000 0000000000 0000000000 0000000000 0101000000 0101010100 1101100000 1101100000 0010001010 0000000110 0000000000 0000000001 0000000000 0000000000 0000000000 0000000000

40 0000011100 0000100100 0000000011 0000000000 0000000011 0110000000 0010000000 0011000000 0000000000 0000000000 0000000000 0000000000 1000000000 1000000000 0000000000 0000000000 0000000000

50 0000000000 0000000000 1100000000 0000000000 1100000000 0010111111 0011111111 0011111111 0011111111 0010101111 0010101111 0000000000 0010000111 0010000111 0000000000 0000000000 0000000000

60 000 000 101 101 101 011 011 011 011 011 011 011 011 011 011 101 101

a

Two-digit numbers on top are counting devices, grouping characters in sets of ten. Note: 0 = taxon absent; 1 = taxon present.

northern Oriente (of Cuba) are morphologically distinctive, representing specialized subclades. The generalized species of each island tend to be similar morphologically and anatomically, and they usually occur in mesic to slightly xeric habitats, such as cloud forest, moist montane forest, lowelevation pine forest, or dry thickets. In contrast, the derived species of each of the islands are very different from each other and are usually adapted to more rigorous habitats, such as thickets on red lateritic soils, white-sand savannas, high-elevation pine forests on igneous soils, or pine forests/ thickets over limestone.

72

Biogeography of the West Indies: Patterns and Perspectives

Outgroup Mexico Cordillera Central Massif de la Selle Puerto Rico Massif de la Hotte Saint Thomas Sierra de Trinidad Jamaica Isla de Pinos Pinar del Rio Gran Piedra Sierra Maestra Sierra de Nipe Sierra de Cristal Moa/Toa region Baracoa region FIGURE 5 Strict consensus of two-area cladogram for Antillean regions included in Brooks parsimony analysis.

It is likely that tectonic events, wind dispersal, and climatic changes have all influenced the present distribution of species of Lyonia sect. Lyonia. Despite these diverse factors, it is worthwhile to address the fascinating biogeography of the Greater Antilles through an investigation of this plant group, which shows such a large number of species of restricted distribution in the region, and which has a fairly well-supported phylogeny. Rosen (1976, 1985) proposed the first comprehensive vicariance model for the biota of the Greater Antilles, and it is thus useful to discuss the geography of Lyonia within the framework of Rosen’s hypothesis (see also Page and Lydeard, 1994). Rosen suggested that the present biota of the region has resulted from the fragmentation of a “Proto-Antilles” archipelago that existed between North and South America in the Mesozoic. The existence of such an island archipelago is supported by the work of many geologists (e.g., Malfait and Dinkleman, 1972; Sykes et al., 1982; Perfit and Williams, 1989; Pindell and Barrett, 1990). Geological work suggests a relationship between western Cuba and southwestern Hispaniola because these two continental fragments probably were connected as a single island early in the Tertiary. Puerto Rico, north-central Hispaniola, and eastern Cuba probably also formed a single island during the same time period. Present-day areas of endemism, which presumably were involved in early Tertiary vicariant events, are eastern Cuba, western Cuba, southwestern Hispaniola, north-central Hispaniola, and Puerto Rico (see also Page and Lydeard, 1994). It is clear that Cuba and Hispaniola were formed by accretion of several different landmasses. Lyonia was probably radiating during this period, as the Ericaceae, a family of the asterid clade (within the tricolpate angiosperms), has a long fossil record, and the existence of its numerous endemics allows, at least, a preliminary testing of these general vicariance hypotheses. The results presented here strongly support the hypothesized close association of north-central Hispaniola with Puerto Rico (and St. Thomas) and also indicate a link with Cuba. Basically, the area cladogram (Figure 5) supports a sister area relationship between the two major regions: north-central Hispaniola and eastern Cuba. However, eastern Cuba shows a closer relationship to western Cuba than to southwestern Hispaniola, and the latter shows a closer relationship to north-central Hispaniola than to western Cuba. Perhaps this pattern results from the fact that Lyonia may once have been restricted to (and diversified within) the eastern Cuba – north-central Hispaniola – Puerto Rico island mass, and only later moved into southwestern Hispaniola and western Cuba, through repeated longdistance dispersal events from north-central Hispaniola and eastern Cuba, respectively. Lyonia sect.

Phylogeny and Biogeography of Lyonia sect. Lyonia (Ericaceae)

73

Lyonia is most diverse in north-central Hispaniola and eastern Cuba, lending some support to this hypothesis. Certainly, the presence of two species of Lyonia in the Blue Mountains of Jamaica results from long-distance dispersal (since this island was submerged during the Oligocene; see Buskirk, 1985). Only one species of Lyonia occurs in the Massif de la Hotte (i.e., L. stahlii var. costata), and this occurrence likely also results from a long-distance dispersal event (because the species also occurs in the adjacent Massif de la Selle, and individuals in both regions often show 4-merous flowers, an unusual condition within this species). The very small seeds of members of Lyonia sect. Lyonia are provided with “tails” and are wind dispersed, although long-distance movement of these seeds must be quite rare, as indicated by the typical limited geographical ranges shown by these species. As with many Antillean taxa, the closest relatives of these species are in Mexico and eastern North America (see Howard, 1973, for many other examples), and this pattern fits with the hypothesis that these Antillean landmasses are continental fragments that originated in the region of southern Mexico. As mentioned above, only a few of the plant genera showing numerous endemic species in the Greater Antilles have received recent phylogenetic study. The results of cladistic analyses of Mecranium, Poitea, Pictetia, and Sabal, as they pertain to Antillean biogeography, are briefly outlined below. Like Lyonia, these are all woody taxa, but they show interesting variation in fruit type and dispersal ability. The genus Mecranium J. D. Hook. (Melastomataceae), comprising 24 species, is endemic to the Greater Antilles, and shows an extremely high level of endemism within southwestern Hispaniola (and especially the Massif de la Hotte). Of the 14 species that occur in southwestern Hispaniola (Skean, 1993; and personal communication), 11 are endemic to the region; 10 species occur in the Massif de la Hotte, and 8 of these are restricted to this mountain range. This distribution pattern contrasts strongly with that of Lyonia because most species of Mecranium occur in the Massif de la Hotte, a region with only one species of Lyonia, and that one is nonendemic. The distribution and phylogenetic relationships (developed through morphology-based cladistic analysis) of Mecranium (see Skean, 1993) suggest that Cuba and Hispaniola are composite landmasses, a conclusion not apparent from the distribution of Lyonia sect. Lyonia. The phylogeny of the genus supports the view that “the ancestral species that gave rise to Mecranium possibly was isolated on the south island of Hispaniola, underwent an extensive adaptive radiation as the island was moved toward the bulk of the Greater Antilles, and species were subsequently dispersed to Jamaica, north island Hispaniola, Cuba, and Puerto Rico” (Skean, 1993). The fruits of Mecranium are purple-black, globose berries, and are presumably bird dispersed. In contrast, Lyonia sect. Lyonia is most diverse in eastern Cuba and north-central Hispaniola, and is wind dispersed. Poitea Vent. comprises 12 species and is restricted to the Greater Antilles and Dominica (see Lavin, 1993); its phylogeny has been investigated through an analysis combining morphological and chloroplast DNA data and suggests that the genus includes two subclades, the P. galegoidesalliance and the P. florida-alliance. The former is centered primarily in southwestern Hispaniola and western Cuba, while the latter occurs mainly in eastern Cuba, north-central Hispaniola, and Puerto Rico. Thus, as discussed by Lavin (1993), these results lend support to the plate tectonic relationships postulated by Rosen (1976, 1985), Pindell and Barrett (1990), Perfit and Williams (1989), and others, i.e., a link between southwestern Hispaniola and western Cuba, and one between north-central Hispaniola, eastern Cuba, and Puerto Rico. A second genus of Fabaceae, Pictetia DC., has been studied by Beyra and Lavin (1999) and the phylogeny constructed for this genus of eight species (based on morphology and nuclear ribosomal DNA sequence data) clearly supports a biogeographical relationship between Puerto Rico, central Hispaniola, and eastern Cuba; the authors explain the presence of the genus in western Cuba and north-central Hispaniola by dispersal events. Interestingly, Puerto Rico is resolved as the sister area to a north-central Hispaniola + eastern Cuba area (Beyra and Lavin, 1999). The legumes of Poitea are explosively dehiscent, while Pictetia has reduced lomented pods.

74

Biogeography of the West Indies: Patterns and Perspectives

Finally, Sabal Adans. (Arecaceae) is diverse in the circum-Caribbean region, contains three Caribbean endemics, and recently has been monographed (Zona, 1990). The morphology-based cladogram of this genus supports an Antillean clade, with a Cuban taxon (S. maritima [Kunth] Burret) placed as the sister taxon to species of Hispaniola and/or Puerto Rico (S. domingensis Beccari and S. causiarum [Cook] Beccari). The genus is, therefore, similar to Lyonia in its support for a close biogeographical relationship between Hispaniola and Puerto Rico. The drupaceous fruits of Sabal have been documented to be dispersed by birds. Common patterns in these Antillean genera include the presence of major centers of endemism in eastern Cuba, western Cuba, southwestern Hispaniola, and north-central Hispaniola. Puerto Rico also contains endemics, and this area is biogeographically linked with north-central Hispaniola. These taxa are absent or only poorly represented in Jamaica. Some biological support is seen for the geological association between eastern Cuba and north-central Hispaniola and between western Cuba and southwestern Cuba, although long-distance dispersal events clearly have occurred and tend to obscure this pattern. It does seem likely that Tertiary Antillean vicariance events have had a major influence on the present-day geographical distributions of these taxa. Finally, Lyonia is seemingly unique in its support of a close relationship of north-central with southwestern Hispaniola and of eastern with western Cuba, suggesting possibly that longer-distance dispersal events (followed by speciation) have been relatively more common in this genus than in the others studied. Additional studies of genera showing a high degree of endemism in Cuba, Hispaniola, and Puerto Rico clearly are needed, and will undoubtedly improve our understanding of the biogeography of this complex region.

LITERATURE CITED Beyra, A. B. and M. Lavin. 1999. Monograph of Pictetia (Leguminosae-Papilionoideae) and review of the Aeschynomeneae. Systematic Botany Monographs 56:1–93. Brooks, D. R. 1981. Hennig’s parasitological method: a proposed solution. Systematic Zoology 30:229–249. Brooks, D. R. 1985. Historical ecology: a new approach to studying the evolution of ecological associations. Annals of the Missouri Botanical Garden 72:660–680. Brooks, D. R. and D. A. McLennan. 1991. Phylogeny, Ecology, and Behavior: A Research Program in Comparative Biology. University of Chicago Press, Chicago. Buskirk, R. E. 1985. Zoogeographic patterns and tectonic history of Jamaica and the northern Caribbean. Journal of Biogeography 12:445–461. Farris, J. S. 1988. Hennig86 reference, version 1.5. Published by the author, Port Jefferson Station, New York. Forey, P. L., C. J. Humphries, I. L. Kitching, R. W. Scotland, D. J. Siebert, and D. M. Williams. 1992. Cladistics: A Practical Course in Systematics. Clarendon Press, Oxford. Howard, R. A. 1973. The vegetation of the Antilles. Pp. 1–28 in Graham, A. (ed.). Vegetation and Vegetational History of Northern Latin America. Elsevier Scientific, New York. Judd, W. S. 1979. Generic relationships in the Andromedeae (Ericaceae). Journal of the Arnold Arboretum 60:477–503. Judd, W. S. 1981. A monograph of Lyonia (Ericaceae). Journal of the Arnold Arboretum 62:63–209, 315–436. Judd, W. S. 1982. A taxonomic revision of Pieris (Ericaceae). Journal of the Arnold Arboretum 63:103–144. Judd, W. S. 1984. A taxonomic revision of the American species of Agarista (Ericaceae). Journal of the Arnold Arboretum 65:255–342. Judd, W. S. 1986. A taxonomic revision of Craibiodendron (Ericaceae). Journal of the Arnold Arboretum 67:441–469. Judd, W. S. 1990. A new variety of Lyonia (Ericaceae) from Puerto Rico. Journal of the Arnold Arboretum 71:129–133. Judd, W. S. 1995a. 13. Lyonia Nuttall. Pp. 222–294 in Luteyn, J. L. (ed.). Ericaceae Part II — The SuperiorOvaried Genera. Flora Neotropica Monograph 66, New York Botanical Garden, Bronx, New York. Judd, W. S. 1995b. 14. Agarista D. Don ex G. Don. Pp. 295–344 in Luteyn, J. L. (ed.). Ericaceae Part II — The Superior-Ovaried Genera. Flora Neotropica Monograph 66, New York Botanical Garden, Bronx, New York.

Phylogeny and Biogeography of Lyonia sect. Lyonia (Ericaceae)

75

Judd, W. S. 1995c. 15. Pieris D. Don. Pp. 345–350 in Luteyn, J. L. (ed.). Ericaceae Part II — The SuperiorOvaried Genera. Flora Neotropica Monograph 66, New York Botanical Garden, Bronx, New York. Judd, W. S. and P. M. Hermann. 1990. Circumscription of Agarista boliviensis (Ericaceae). Sida 14:263–266. Kron, K. A. and W. S. Judd. 1997. Systematics of the Lyonia group (Andromedeae, Ericaceae) and the use of species as terminals in higher-level cladistic analyses. Systematic Botany 22:479–492. Kron, K. A. and W. S. Judd. 1999. Phylogenetic analyses of Andromedeae (Ericaceae subfam. Vaccinioideae). American Journal of Botany 86:1290–1300. Lavin, M. 1993. Biogeography and systematics of Poitea (Leguminosae). Systematic Botany Monographs 37:1–87. Malfait, B. T. and M. G. Dinkleman. 1972. Circum-Caribbean tectonic and igneous activity and the evolution of the Caribbean plate. Bulletin of the Geological Society of America 83:251–272. Page, R. D. M. and C. Lydeard. 1994. Towards a cladistic biogeography of the Caribbean. Cladistics 10:21–41. Pindell, J. L. and S. F. Barrett. 1990. Geological evolution of the Caribbean: a plate tectonic perspective. Pp. 450–432 in Dengo, G. and J. E. Case (eds.). The Geology of North America: The Caribbean Region, Vol. H. Geological Society of America, Boulder, Colorado. Rosen, D. E. 1976. A vicariance model of Caribbean biogeography. Systematic Zoology 24:431–464. Rosen, D. E. 1985. Geological hierarchies and biogeographic congruence in the Caribbean. Annals of the Missouri Botanical Garden 72:636–659. Skean, J. D., Jr. 1993. Monograph of Mecranium (Melastomataceae: Miconieae). Systematic Botany Monographs 39:1–116. Sykes, L. R., W. R. McCann, and A. L. Kafka. 1982. Motion of Caribbean plate during last 7 million years and implications for earlier Cenozoic movements. Journal of Geophysics Research 87:10656–10676. Wiley, E. O., D. J. Siegel-Causey, D. R. Brooks, and V. A. Funk. 1991. The Compleat Cladist: A Primer of Phylogenetic Procedures. Museum of Natural History, University of Kansas, Lawrence. Zandee, M. and M. C. Roos. 1987. Component-compatibility in historical biogeography. Cladistics 3:305–332. Zona, S. 1990. A monograph of Sabal (Arecaceae: Coryphoideae). Aliso 12:583–666.

of Endemism and 6 Patterns Biogeography of Cuban Insects Julio A. Genaro and Ana E. Tejuca Abstract — The taxonomy and biogeography of insects are poorly known for most islands of the West Indies with the exception of Cuba (8,316 species) and Puerto Rico (5,066 species). It is estimated that if all insects on Cuba could be documented that the total would be close to 10,000 species. Some groups are better known than others, and it is only in these well-known groups that real levels of endemism can be calculated. In some groups endemism is very high, such as stick insects (92.8%), mutillids (90%), Cercopoidea (82%), and Trichoptera (81%). In other groups it is surprisingly low, such as dryinids (0%), agromizids (3.8%), and mosquitoes (5.9%). Large well-known groups tend to have levels of endemism between 40 and 60%, for example, butterflies (39.9%), ants (43.6%), and bees (47.3%). Cockroaches have an endemism level of 63.5%. These data do not provide complete insight into the patterns of dispersal of insects into Cuba or between major mountain ranges or offshore archipelagos. The very different levels of endemism between the various groups of insects suggest that insects colonized Cuba in a variety of ways. Additional studies on the distribution and systematics of Cuban insects are important to help us more accurately understand biogeographical patterns of Cuban insects and how the insect fauna of Cuba relates to other islands in the Greater Antilles.

INTRODUCTION Because of its geological history and geographical location as an island, Cuba has few mammal species and few vertebrates. The highest level of species abundance (and diversity) on Cuba and its associated archipelagos is represented by invertebrates (Table 1), mainly insects. While the status of insects is poorly known in most areas of the Antilles, there is an important trend toward inventorying biodiversity to better understand their natural history and the biological potential of each habitat and biogeographical region. This is important because of the rapid loss of habitats in the region, and because some species will be lost before they are ever discovered. It may not be possible ever to know the true biodiversity of insects in Cuba. The number of insects in Cuba has been estimated from as high as 25,000 species (Berovides, 1988), downward to 17,000 (Aguayo, 1951; Alvarez Conde, 1958) and 12,000 to 15,000 species (Ferrás et al., 1995). However, they have been accurately quantified only twice. Vales et al. (1992) documented 6,384 species, although this study only evaluated 10 insect orders, and is therefore not a complete record. In the study “Proyecto Pais” (Vales et al., 1998) insects were treated in more detail resulting in a figure of 7,831 species in 29 orders. However, in our opinion, even this higher figure is not a complete picture of the total number of insects on the island.

DISCUSSION This chapter provides an estimate of the number of Cuban insect species obtained from publications that list or catalog taxa. These listings have been further updated by adding new records, new species, personal communication from various specialists, and data from specimens in collections but not yet in the public record (i.e., published). We present these results as a way of integrating scattered information and laying the foundation for future studies. The total world number of species (Table 2) in our survey was obtained from Strefferud (1952), Borror and White (1970), and Hogue (1993). Based on the data available to us there are 8,316 insect 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

77

78

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 Quantitative Biodiversity of the Main Taxa of Cuban Terrestrial Invertebrates, Excluding Insects Taxa Mollusca (land snails) Annelida (earthworms) Arachnida (spiders, scorpions, mites, ticks, harvest-bugs, and others) Decapoda (land crabs) Isopoda (sowbugs) Chilopoda (centipedes) Diplopoda (millipedes) Pauropoda (pauropods) Symphyla (symphylans) Trematoda (flatworms) Nematoda (roundworms)

Number of Genera

Number of Species

159 14

1,419 21

614 17 37 17 36 2 2 100 208

1,350 33 68 43 90 2 3 160 525

TABLE 2 Number of Families, Genera, and Species of Cuban Insects, and World Number of Species According to the Order Insect Order

Families

Genera

Species

World Species

Protura Diplura Collembola Thysanura Ephemeroptera Odonata Orthoptera Dictyoptera (Blattaria) Mantodea Phasmatodea Dermaptera Isoptera Embiidina Psocoptera Zoraptera Mallophaga Anoplura Heteroptera Thysanoptera Neuroptera Megaloptera Trichoptera Diptera Lepidoptera Siphonaptera Coleoptera Strepsiptera Hymenoptera

1 3 13 3 6 7 4 4 1 2 5 3 3 16 1 4 2 36 4 9 1 12 64 65 2 91 4 49

1 7 63 8 15 41 72 33 4 8 11 14 4 19 1 19 5 323 26 28 1 26 410 762 5 964 6 474

1 19 110 10 37 80 122 81 4 14 19 31 4 28 1 39 5 603 61 74 1 90 984 1,539 6 2,615 7 1,069

500 800 6,000 750 2,139 4,950 14,500 4,000 1,500 2,500 1,100 2,100 150 1,100 22 2,675 250 23,000 4,500 4,670 250 7,000 87,000 112,000 1,100 300,000 300 105,000

Patterns of Endemism and Biogeography of Cuban Insects

79

Coleoptera Lepidoptera Hymenoptera Diptera Homoptera Heteroptera

7.2% 7.9%

31.5%

11.8%

12.9% 18.5%

FIGURE 1 Percentages of the main Cuban insect orders.

species in Cuba belonging to 29 orders (Table 2). The largest number of species were represented by beetles, butterflies, Hymenoptera, and flies (Table 2; Aguayo, 1951; and Figure 1). We believe that the estimates for the number of Cuban insects proposed by other authors (see above) are too high. In our opinion, the maximum number of species on Cuba should be around 10,000. It is important to continue to collect insects in Cuba, and elsewhere in the West Indies, before comprehensive biogeographical comparisons will be possible. Increased financial and logistical support will be necessary to put these expeditions in the field to collect insects and to be able to curate and fully document the level of insect biodiversity in Cuba. The latter phase would require the participation of many specialists in various insect groups who are not always available because of a lack of training in the taxonomy of certain poorly known groups or because of other commitments. Many areas of Cuba are very remote and rugged, which make such faunal surveys major undertakings. The methodology of collecting insects is another major consideration. Collecting has been carried out in the past mainly by traditional methods such as insect nets. Only recently have modern insect traps such as the Malaise trap, pan traps (yellow plates), and nocturnal black-light traps been utilized. Most insect surveys have been carried out in daylight hours while we now know that night collecting offers a completely different scenario. Most new taxa are mainly small-size insects that can be found even in places disturbed by humans. The best places in Cuba for identifying new insects is deep into rugged mountain ranges, on offshore keys and islands, and in wetlands such as the Zapata Swamp. The taxonomy and distribution of Cuban insects is well known in comparison with other regions of the West Indies and South America. Nevertheless, problems arise in Cuba when trying to apply this knowledge to ecological and ethological studies or when incorporating the data into management plans focused on the conservation of ecosystems and fauna. These difficulties arise from a lack of good reference collections and taxonomic specialists, as well as scattered literature, difficult access to old publications, the deposition of holotypes in foreign institutions, and a lack of practical articles allowing for species identification through keys or field guides.

80

Biogeography of the West Indies: Patterns and Perspectives

There have been several attempts to explain how invertebrates dispersed to the Antilles (Darlington, 1938; Liebherr, 1988a, 1988b) and to present explanations for distribution patterns of invertebrates within the West Indies (Darlington, 1937; Fontenla, 1992, 1994; Fontenla and Cruz, 1992). The depth of systematic knowledge varies depending on the taxonomic group and some groups are very poorly known. Zoogeographic analyses cannot be undertaken in many groups until a more complete systematic review has been completed. The taxonomic groups that have been best studied are butterflies (Lepidoptera) (Scott, 1972; Brown, 1978; Fontenla and de la Cruz, 1986, 1992; Miller and Miller, 1989; Fontenla, 1992); beetles (Coleoptera) (Darlington, 1943, 1971; Matthews, 1966; Liebherr, 1988b; Browne and Peck, 1996); dragonflies and damselflies (Odonata) (Paulson, 1982); ants (Wilson, 1988; Fontenla, 1994); bees (Hymenoptera) (Michener, 1979; Eickwort, 1988), and to a lesser extent, mayflies (Ephemeroptera) (Edmunds, 1982), caddisflies (Trichoptera), bugs (Heteroptera), and flies (Diptera) (Liebherr, 1988b). In the West Indies, geographical isolation, wide variety of soils, and differences in altitude and climate all have combined to account for high levels of endemism in land organisms. The analysis of endemism is difficult in insects because no single publication or source integrates the systematic knowledge and geographical distributions of all species. Some taxa and groups have been better studied than others, however, and it is possible to estimate endemism in the following groups: cockroaches (63.5%) (Gutiérrez, 1995); mosquitoes (5.9%) (González and Rodríguez, 1977); sirphids (30.6%) (Garcés and Rodríguez, 1998); agromizids (3.8%) (Garcés, 1998); Odonata (62%) (C. Naranjo, personal communication); stick insects (92.8%) (Moxey, 1972); Trichoptera (81.1%) (Botosaneau, 1979; 1980); Dermaptera (15.8%) (Brindle, 1971); meloids (42.8%) (Genaro, 1996); tiger beetles (40%) (P. Valdés, personal communication); bruquids (22.2%) (Alvarez and Kingsolver, 1997); Psocoptera (52.5%); Hymenoptera, dryinids (0%), scoliids (20%); tiphiids (62.5%); ants (43.6%) (Fontenla, 1997); mutillids (90%); bees (47.3%); Cicadoidea (70%); Membracidae (63%); Cercopoidea (82%); Kinnaridae (75%) (Ramos, 1988); mirids (17%) (Hernández and Stonedahl, 1997); ligaeids (27%) (Slater, 1988); butterflies (39.9%) (Smith et al., 1994). The present status of systematic knowledge allows only for an estimate of overall endemism. In many taxa is very high, while in others it is lower, and it may be zero. On average, endemism ranges between 40 and 60%. Insect groups have different dispersion patterns; even within an order there are families with different degrees of vagileness. Fauna has been shaped by the arrival of species from several parts of the world at different geological times, and following their arrival in Cuba these species adapted and evolved under insularity conditions. This flow of insects to and from the West Indies continues. The Antilles are composed of many islands and keys dissected by open water. Air currents, especially powerful forces such as hurricanes, have played an important role in the dispersion of insects. Introductions, both accidental and intentional, have also played a role in the dispersal of insects. The dragonfly Crocothemis servilia (Libellulidae) from Asia was accidentally introduced in Florida, where it is common, and arrived recently to Cuba (Flint, 1996). The African beetle Onthophagus gazella (Scarabaeidae) was introduced on purpose in the United States and is now common in the north coast of Cuba (R. B. Woodruff, personal communication). Examples of dispersal events in the opposite direction include several species of butterflies that have become established in Florida from the West Indies within the last hundred years (Scott, 1972). These examples demonstrate that faunal exchange in the West Indies is a dynamic process. We believe that many more examples will appear if in-depth studies are carried out in Cuba and the West Indies in general. The senior author (J.A.G.) is finding many species of Aculeata (Hymenoptera) in Hispaniola that were previously thought to be exclusive to Cuba. The knowledge of insect taxonomy and systematics varies from island to island in the West Indies and has been integrated for only two islands, Puerto Rico and Cuba. In Puerto Rico, the smaller island, 5,066 species were recently quantified (Maldonado, 1996). In Jamaica, there is not a reliable count of all species, although Farr (1984) provides numbers for several groups. The most critical example of a poorly known fauna is that of Hispaniola. A little smaller than Cuba, this

Patterns of Endemism and Biogeography of Cuban Insects

81

island has both more diverse habitats and the least well-known insect fauna. What is known indicates that Hispaniolan insects have a high level of endemism, and are most similar to the insect fauna of eastern Cuba.

CONCLUSIONS The insect fauna of Cuba has been well enough documented to project that about 10,000 species occur on the island. The levels of endemism vary remarkably between the various insect groups, ranging from over 90% (mutillids and stick insects) to as low as zero (dryinids). The reasons for this high level of variability are poorly understood, and await data from more complete studies of the life history and ecology of Cuban insects. Such studies should be given a high priority. The average level of endemism is close to 50%, with endemism levels for most well-known groups in the 40 to 60% range. While the insects of Cuba are relatively well known, as are the insects of Puerto Rico, insects are poorly documented and little studied in other areas of the West Indies, with major lacunae in Hispaniola and Jamaica. Based on the preliminary data available to us, it appears that the closest relatives of insects from eastern Cuba are found in Hispaniola.

ACKNOWLEDGMENTS We thank P. Alayo (moths and other insect orders); M. Diaz (Collembola); G. Garcés and D. Rodríguez (Diptera); H. Grillo (Heteroptera); E. Gutiérez (Blattaria); C. Moxey (Phasmatodea); C. Naranjo (Odonata, Ephemeroptera); I. Fernández and S. B. Peck (Coleoptera); E. Portuondo (Hymenoptera Parasitica); R. Rodríguez-Léon (Homoptera); and A. Ruiz (Ortohoptera). For information on other invertebrata taxa, we thank G. Alayón, A. Avila, N. Cuervo, L. F. Armas, W. B. Muchmore, and A. Pérez (Arachnida); C. Rodríguez (Annelida); A. Juarrero (Decapoda, Isopoda); A. Pérez-Asso (Diplopoda, Chilopoda), J. F. Milera, L. Fernández, and A. Lomba (Gastropoda). P. Alayo provided important literature. S. B. Peck offered preliminary data that complemented our observations. We also thank G. Alayón, J. L. Fontenla, E. Gutiérez, and G. Silva for their suggestions during the critical reading of the manuscript.

LITERATURE CITED Aguayo, C. G. 1951. Los orígenes de la fauna cubana. Annales de la Academia de Ciencias, Habana 88:1–23. Alvarez Conde, J. 1958. Historia de la zoología en Cuba. Publicación de la Junta Nacional de Arqueología y de Etnologia Ediciones Lex, La Habana. Alvarez, D. and J. M. Kingsolver. 1997. A preliminary list of the Bruchidae (Coleoptera) of Cuba. Entomology News 108:215–221. Berovides, V. 1988. Orden y diversidad en el mundo viviente. Editorial de Ciencia y Técnica, La Habana. Borror, D. J. and R. E. White. 1970. A Field Guide to the Insects of America North of Mexico. Houghton Mifflin, Boston. Botosaneanu, L. 1979. The caddis-flies (Trichoptera) of Cuba and of Isla de Pinos: a synthesis. Studies of the Fauna of Curaçao and Other Caribbean Islands 59:33–62. Botosaneanu, L. 1980. Trichoptères adultes de Cuba collectés par les zoologistes cubains (Trichoptera). Mitteilungen der Münchner Entomologischen Gesellschaft 69:91–116. Brindle, A. 1971. The Dermaptera of the Caribbean. Studies of the Fauna of Curaçao and Other Caribbean Islands 131:1–75. Brown, F. M. 1978. The origins of the West Indian butterfly fauna. Pp. 5–30 in Zoogeography in the Caribbean. Journal of the Academy of Natural Sciences of Philadelphia, Special Publication 13. Browne, J. and S. B. Peck. 1996. The long-horned beetles of south Florida (Cerambicidae: Coleoptera): biogeography and relationships with the Bahama Islands and Cuba. Canadian Journal of Zoology 74:2154–2169.

82

Biogeography of the West Indies: Patterns and Perspectives

Darlington, P. J., Jr. 1937. West Indian Carabidae. III: new species and records from Cuba, with a brief discussion of the mountain fauna. Memorias de la Sociedad Cubana de Historia Natural Felipe Poey 11:115–136. Darlington, P. J., Jr. 1938. The origin of the fauna of the Greater Antilles, with a discussion of dispersal of animals over water and through the air. Quarterly Review of Biology 13:274–300. Darlington, P. J., Jr. 1943. Carabidae of mountains and islands: data on the evolution of isolated faunas and on atrophy of wings. Ecological Monographs 13:37–61. Darlington, P. J., Jr. 1971. Carabidae on tropical islands, especially the West Indies. Biotropica 2:7–15. Edmund, J. F., Jr. 1982. Ephemeroptera. Pp. 242–248 in Hurlbert, S. H. and A. Villalobos-Figueroa (eds.). Aquatic Biota of Mexico, Central America and the West Indies. San Diego State University, San Diego, California. Eickwort, G. C. 1988. Distribution patterns and biology of West Indian sweat bees (Hymenoptera: Halictidae). Pp. 231–253 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Cornell University Press, Ithaca, New York. Farr, T. 1984. Land animals of Jamaica; origins and endemism. Jamaica Journal 17:3848. Flint, O. S., Jr. 1996. The Odonata of Cuba, with a report on a recent collection and checklist of the Cuban species. Cocuyo 5:17–20. Fontenla, J. L. 1992. Biogeografía ecológica de las mariposas diurnas cubanas. Patrones generales. Poeyana 427:1–30. Fontenla, J. L. 1994. Biogeografía de Macromischa (Hymenoptera: Formicidae) en Cuba. Avicennia 1:19–29. Fontenla, J. L. 1997. Lista preliminar de las hormigas de Cuba (Hymenoprera: Formicidae). Cocuyo 6:18–21. Fontenla, J. L. and J. de la Cruz. 1986. Análisis zoogeográfico de las mariposas antillanas (Lepidoptera: Rhopalocera) a nivel subespecífico. Ciencias Biológicas 15:107–122. Fontenla, J. L. and J. de la Cruz. 1992. Consideraciones biogeográficas sobre las mariposas endémicas de Cuba. Poeyana 426:1–34. Garcés, G. 1998. Lista de los agromizidos de Cuba (Diptera: Agroniyzidae). Cocuyo 7:5–7. Garcés, G. and D. Rodríguez. 1998. Lista de los sírfidos de Cuba (Diptera: Syrphidae). Cocuyo 7:7–8. Genaro, J. A. 1996. Resumen del Conocimiento sobre los meloidos de Cuba (Insecta: Coleoptera). Caribbean Journal of Sciences 32:382–386. González Broche, R. and J. Rodríguez. 1997. Lista actualizada de los mosquitos de Cuba (Diptera: Culicidae). Cocuyo 6:17–18. Gutiérrez, E. 1995. Annotated checklist of Cuban cockroaches. Transactions of the American Entomological Society 121:65–84. Hernández, L. M. and G. M. Stonedahl. 1997. Lista anotada de los míridos de Cuba (Insecta: Heteroptera). Cocuyo 6:21–23. Hogue, C. L. 1993. Latin American Insects and Entomology. University of California Press, Berkeley. Liebherr, J. K. 1988a. General patterns in West Indian insects and graphical biogeographic analysis of some circum-Caribbean Platynus beetles (Carabidae). Systematic Zoology 37:385–409. Liebherr, J. K. (ed.). 1988b. Zoogeography of Caribbean Insects. Cornell University Press, Ithaca, New York. Maldonado, J. 1996. The status of insect alpha taxonomy in Puerto Rico after the scientific survey. Pp. 201–216 in Figueroa, J. C. (ed.). The Scientific Survey of Puerto Rico and the Virgin Islands. Annals of the New York Academy of Sciences 776. Matthews, E. G. 1966. A taxonomic and zoogeographic survey of the Scarabaeidae of the Antilles (Coleoptera: Scarabaeidae). Memoirs of the American Entomological Society 21:1–134. Michener, C. D. 1979. Biogeography of the bees. Annals of the Missouri Botanical Garden 66:277–347. Miller, L. D. and J. Y. Miller. 1989. The biogeography of West Indian butterflies (Lepidoprera: Papilionoidea, Hesperiodea) a vicariance model. Pp. 229–262 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Moxey, C. F. 1972. The Stick-Insects (Phasmatodea) of the West Indies: Their Systematics and Biology. Ph.D. thesis, Harvard University, Cambridge, Massachusetts. Paulson, D. R. 1982. Odonata. Pp. 249–277 in Hurlbert, S. H. and A. Villalobos (eds.). Aquatic Biota of Mexico, Central America and the West Indies. San Diego State University, San Diego, California. Ramos, J. A. 1988. Zoogeography of the Auchenorrhynchous Homoptera of the Greater Antilles (Hemiptera). Pp. 61–70 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Cornell University Press, Ithaca, New York. Scott, J. A. 1972. Biogeography of the Antillean butterflies. Biotropica 4:32–45.

Patterns of Endemism and Biogeography of Cuban Insects

83

Slater, J. A. 1988. Zoogeography of West Indies Lygacidae (Hemiptera). Pp. 38–60 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Cornell University Press, Ithaca, New York. Smith, D. S., L. D. Miller, and J. Miller. 1994. The Butterflies of the West Indies and South Florida. Oxford University Press, New York. Stefferud, A. (ed.). 1952. Insects: The Yearbook of Agriculture. U.S. Government Printing Office, Washington, D.C. Vales, M. A., L. Montes, and R. Alayo. 1992. Estado del conocimiento de la biodiversidad en Cuba. Pp. 239–249 in Halffter, G. (ed.). La diversidad biológica de Iberoamérica. Acta zoológica Mexicana. Vales, M. A., A. Alvarez de Zayas, l. Montes, and A. Avila (eds.). 1998. Estudio nacional sobre la diversidad biológica en la República de Cuba. Editora CESYTA, Madrid. Wilson, E. O. 1988. Biogeography of the West Indian ants (Hymenoptera: Formicidae). Pp. 214–230 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Cornell University Press, Ithaca, New York.

in the Biogeography 7 Patterns of West Indian Ticks Jorge O. de la Cruz Abstract — The tick fauna of the West Indies (divided into Cuba, the Greater Antilles, and the Lesser Antilles) is compared with some continental areas (Venezuela, Panama, Peru, and Madagascar). Taxonomic inventories and host and structural niche preferences are used as zoogeographical characters. On the islands the dominants are Argasid ticks, parasites of birds, bats, and reptiles, cavernicolous and lapidicolous. In the continental conditions the dominants are Ixodid ticks, macromastophiles of open fields. The colonization of the West Indies follows three main patterns: (1) a Central America–West Indies–South America route; (2) a North America–West Indies route; and (3) an anthropogenic introduction. A fourth group with cosmopolitan distribution is not included in any of the three patterns because of lack of information.

INTRODUCTION The West Indies is a fertile ground for biogeographical research. It is amazing how much work has been devoted to study of the faunal relationships of this area. Even more amazing is the lack of agreement among the various interpretations. Although the Cuban fauna has been the best studied in the West Indies, even this database is not complete enough. More than half of the vertebrate fauna (excluding birds) has been described only in the last 30 years and invertebrates are far less well known than vertebrates. Liebherr (1988) discusses insects as a biogeographical data source and their advantage over vertebrates, but he says nothing about other invertebrates such as parasitic mites, especially ticks. Parasites have special needs that make them more complicated to collect and to analyze. They have more complex ecological constraints than most invertebrates. They not only need very specific habitats to be successful but also the presence of the “right host(s)” (an adequate systematic group within the limits of size, behavior, etc.). Not only tick systematics but also other characteristics of their natural history are clues to parasite biogeographical relationships. For these reasons, this chapter is divided into five main sections: (1) list of West Indies species of ticks; (2) West Indies tick faunal characteristics and relationships; (3) ecological biogeography; (4) historical biogeography; and (5) conclusion. Two of these terms (ecological and historical biogeography), used by Silva Taboada (1979) in his study of Cuban bats, are used differently in the following sections. A more complete discussion of the ticks of Cuba can be found in Cruz (1987). In the present discussion I provide additional information to my 1987 paper (my dissertation) and incorporate a final analysis of two other publications (Cruz, 1978, 1986).

MATERIALS AND METHODS This chapter reviews the literature of the past 40 years on the distribution and systematics of ticks. The publications on biogeography include the ticks of Panama (Fairchild et al., 1966), Venezuela (Jones et al., 1972), Cuba (Cerny, 1969), Puerto Rico (Maldonado-Carriles and Medina-Gaud, 1977), the Lesser Antilles (Morel, 1966, 1967; Kohls, 1969), Peru (Need et al., 1991), and Madagascar (Uilemberg et al., 1979). The systematic reviews include the American Ornithodorinae (Kohls et al., 1965, 1969; Jones et al., 1972) and Argasinae (Kohls et al., 1970). The list is not exhaustive in 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

85

86

Biogeography of the West Indies: Patterns and Perspectives

relation to the hosts or distribution outside the Western Hemisphere. A full list of hosts is not necessary because ticks are not really species specific. A general list is suitable to convey the idea of the relationship for biogeographical purposes. This constraint also applies to the geographical information in the sense that detailed information of the distribution of introduced species is meaningless to interpretations about patterns of West Indian biogeography. In the analysis of ecological factors two main groups were selected: the host-group specificity and the structural niche.

HOST-GROUP SPECIFICITY In this chapter, terminology of the host-group specificity varies with the host as follows. Ticks that are parasites on amphibians and reptiles are called herpetophiles; on birds they are called ornithophiles; on small mammals (rodents, insectivores, etc.) they are called micromastophiles; on large mammals they are called macromastophiles; and on bats they are called chiropterophiles. Some ticks are parasites on several kinds of hosts and so in some cases there are not clear distinctions. I follow Hoogstraal (1985) and consider the adult ticks hosts as the main ones because immature stages in almost all groups show less host specificity.

STRUCTURAL NICHE The structural niche, in this context, is the place were the ticks hide outside the host to develop some essential biological changes or process, like molts between the ontogenic stages or egg deposition. There are two main groups of structural niche for ticks: the open field and the nest. Open Field The first niche is typical for the ixodid ticks, which typically are parasites on nomadic hosts without nesting behavior. The tick biological cycle is more dependent on the hosts. The tick remains on the hosts for long periods of time. The more derivative groups have fewer stages in which the ticks can leave hosts to molt, like the so-called “one host ticks” from the genus Boophilus. In general, the ixodid ticks also have fewer developmental stages than argasids, which is an advantage for this type of biological cycle. Ixodids have only three life stages: the larval, the nymph, and the adult. There are exceptional argasid ticks, such as the Spinose ear tick, Otobius megnini (Duges, 1884), which can be part of this ecological group. They are an exception in the family because these ticks make all but the last molt (last nymph to adult) on the same host. The adults are autogenic in that they do not need any additional meals and live with the reserves built up during the younger stages. In this way the multistage, multihost argasid becomes a single-host tick. The Nest The second group, the “nest” species are typically members of the Argasidae, which are parasites on sedentary hosts with a den, nest, or place regularly visited during the year were the ticks can hide and wait. Ticks go to the host only for short periods of time to take a blood meal, and then return to their hiding places. The host contact is short and varies from a few minutes in some nymph and adult stages to a few days in the larval stage of some species. The cycles in these ticks present more developmental stages, which typically include one larva stage, two to five nymph stages, and the adult stage. By dividing the morphological changes into several nymphal stages, ticks use fewer energy reserves for each molt; therefore, it is necessary for them to hang onto the host for shorter time periods to be fed. This is an advantage since smaller meals ease the molting process. There are some deviations from these patterns. Some species have immobile first nymphs, as in some species of the subgenus Alectorobius, the autogenic species of the genus Antricola, or the coprophagous

Patterns in the Biogeography of West Indian Ticks

87

Parantricola. The deviations are in relation to the capability of the larvae to accumulate the reserves needed for the subsequent stages and their efficiency to use these reserves at the different stages. All these specialized forms have big larvae, a shorter nymphal life stage, and, in some cases, lower reproductive rates. The Antricola species have short nymph stages with short cycles and the adults probably have very low reproductive rates. The coprophagous species, P. marginatus, has meals with lower energetic contents, and thus has longer cycles, probably with more stages and larger adults. The nature of the links of these groups with their hosts and the host habitats made them more diverse and specialized. It is almost impossible to recognize differences among the “open field” species that are very clear on the “nest” species. I recognize three groups, one of which has two subgroups. The Arboricolous Their hosts use trees as nests or dens. The ticks hide under the bark or in crevices of the wood. In this group are species that are parasites on bats (that use hollow trees as refuge), on birds that nest in trees and species of the genus Argas, which are parasites on poultry and can be found on the trees used by hens to roost. The Lapidicolous They are parasites of birds, mammals, and reptiles that nest or rest on rocks or in small caves and crevices. The most common ticks of this category are Ornithodoros capensis and O. denmarki, which are parasites of terns and gulls, and O. cyclurae and O. elongatus, which are parasites of iguanas of the genus Cyclura. The Cavernicolous They are almost exclusively parasites of bats, at least in the West Indies. They represent a clearly different ecological group that I split into two catagories: the “psicrocavernicolous” and the “thermocavernicolous.” The psicrocavernicolous ticks inhabit typical caves with high humidity and low temperatures. The thermocavernicolous form a very special group that occupies “hot caves” or the “hot saloons” of some caves of the Western Hemisphere. High temperatures (over 26°C and typically around 32°C) characterize these caves, with near-saturation humidity and dense colonies of bats. These are the conditions in which the genera Antricola and Parantricola and the subgenus Ornithodoros (Subparmatus) develop their highly specialized biology.

THE WEST INDIES TICKS SUPERFAMILY IXODOIDEA MURRAY, 1877 FAMILY ARGASIDAE MURRAY, 1877 Genus Argas Latreille, 1795 Subgenus Persicargas Kaiser, Hoogstraal et Kohls, 1964 A. persicus (Oken, 1818) Hosts: Poultry, humans, Neomorphus geoffroyi(?). Distribution: Almost cosmopolitan, but many records are doubtful, especially with the resurrection of some sibling species. Recent records from Peru, U.S.A., Paraguay, Puerto Rico, Hispaniola, and Cuba. Other records from Panama, Antigua, Barbados, Trinidad, and Martinique need confirmation. Comments: A parasite of domestic poultry, with which the species spread. As the other poultry tick species, A. miniatus, it disappears for years and then can be found by the thousands in one locality, sometimes very far from the last known locality where it was found.

88

Biogeography of the West Indies: Patterns and Perspectives

A. miniatus Koch, 1844 Hosts: Poultry. Distribution: Cuba, Puerto Rico, U.S.A., Mexico and Peru. Other nonconfirmed records report Jamaica, Hispaniola, Antigua, and Martinique. Comments: See A. persicus. A. radiatus Railliet, 1893 Hosts: Poultry (including turkey), also on Coragyps atratus, Cathartes aura, herons, cormorants, warblers, and pigeons, Phalacrocorax auritus floridanus. Distribution: U.S.A., Mexico, and Cuba. Comments: As the other poultry ticks, but this species also parasitizes on wild host. Genus Ornithodoros Koch, 1844 Subgenus Alectorobius Pocock, 1907 O. cyclurae Cruz, 1986 Hosts: Cyclura nubila. Distribution: Cabo Cruz, Granma, Cuba. Comments: Known from only one larva, found on the nose of a Cuban iguana. Close to O. elongatus. O. elongatus Kohls, Sonenshine et Clifford, 1965 Hosts: Probably iguana. Distribution: Hispaniola. Comments: Known, in Miami, only from one larva found in a box from Dominican Republic, with plants and an iguana. This species is close to O. cyclurae. O. denmarki Kohls, Sonenshine et Clifford, 1965 Hosts: Puffinus lehrminieri, Sula leucogaster, Sterna anaethetus, S. fuscata, Anous stolidus. Distribution: Sand Islands, Johnston Atoll, Hawaii, U.S.A. (Florida), Mexico, Trinidad, Martinique, Dominica, Guadeloupe, Jamaica, and Cuba. Comments: A widespread species, distributed by its host, the seabirds. Probably would be found in many other localities, if collected. Studies of the distribution of seabird ornithodorine ticks, a complex of species, are greatly needed. In the West Indies, there are two species, O. denmarki and O. capensis. O. capensis Neumann, 1901 Hosts: Spheniscus demersus, Anous stolidus, Sterna fusca, Diomedea inmutabilis, Actitis macularia, Thalasseus sandvicensis, Ajaia ajaja, Sula leucogaster, Sula sp., Fregata magnificens, Stictocarbo punctatus. Distribution: Russia, Japan, New Zealand, Australia, Marshall Islands, Hawaii, Howland Islands, Sand Islands, Guam, Paget Islands, Cargado Carajos Islands, Chesterfield Islands, South Africa, U.S.A. (coast of Texas), Mexico (Revillagigedo Archipelago), Galapagos Islands, Trinidad, San Martin, Dominica, Jamaica, and Cuba. Comments: See O. denmarki. O. azteci Matheson, 1935 Hosts: Macrotus waterhousei, Artibeus jamaicensis, Brachyphylla nana, Desmodus rotundus, Phyllostomus hastatus, Trachops cyrhosus, Carollia sp., Zygmodon brevicaudata, Glossophaga soricina, G. longirostris, Artibeus sp., Macrophyllum macrophyllum, Carollia perspicillata, Peropyteryx macrotis, P. kapleri, Lonchorhina aurita.

Patterns in the Biogeography of West Indian Ticks

Distribution: Panama, Colombia, Venezuela, Trinidad, Jamaica, Cuba, Mexico, and the Lesser Antilles. Comments: The most common species on Cuban bats. O. brodyi Matheson, 1935 Hosts: Eptesicus fuscus, Myotis nigricans, Desmodus rotundus, Pteronotus parnelli, Carollia perspicillata, Carollia sp., Trachops cirrhosus, Artibeus jamaicensis, Chonopterus auriotus, Lonchorhina aurita, Pteropteryx kapleri, Rhynchonycteris sp., Natalus tumidirostris. Distribution: Mexico, Guatemala, Panama, Colombia, Venezuela, and Cuba. Comments: A species known from the Antilles after only one record from Cuba (Cerny, 1969). O. kelleyi Cooley et Kohls, 1941 Hosts: Eptesicus fuscus, Carollia perspicillata, Carollia sp., Lonchorhina aurita, Antrozous pallidus, Pipistrellus hesperus, Myotis subulatus, humans. Distribution: Canada, U.S.A., Costa Rica, and Cuba. Comments: A Nearctic species, probably distributed to Cuba with the host, E. fuscus. In Costa Rica it was found biting humans (Vargas, 1984). O. dusbabeki Cerny, 1967 Hosts: Eptesicus fuscus, Noctilio leporinus, Molossus molossus, Artibeus jamaicensis. Distribution: Isla de Pinos, Cuba Comments: Known only from the northern region of Isla de Pinos, and a record from Pilon, Mayari, Holguin province, Cuba. I reviewed one of the larva from Mexico (Dusbabek, 1970) and determined it to be an undescribed species from the O. hasei complex, but for sure not O. dusbabeki. O. tadaridae Cerny et Dusbabek, 1967 Hosts: Tadarida laticaudata, Mormoopterus minutus. Distribution: Cuba. Comments: A species very close to O. boliviensis, a South American species, also parasite of molossid bats. O. hasei Schulze, 1935 Hosts: Pteronycterix sp., Carollia sp., C. perspicillata, Uroderma bilobatum, U. magnirostris, Vampyrops helleri, Tonatia sylvicola, Rhogesia minutilla, R. tumida, Phyllostomus hastatus, Artibeus jamaicensis, A. lituratus, Brachyphylla cavernarum, Sturnira lilium, Akodon urichi, Chiroderma salvini, Mormoops megalophylla, Myotis nigricans, M. albescens, M. velifer, Mimon crenulatus, Desmodus rotundus, Neoplatymops mattogrocensis, Eumops sp., Molossus ater, M. bondae, Tadarida gracilis, Noctilio labialis, N. leporinus, Lonchorhina orinocensis, Glossophaga longirostris. Distribution: Venezuela, Brazil, Panama, Costa Rica, Bolivia, Nicaragua, Mexico, Guyana, Surinam, Martinique, Guadeloupe, Barbuda, Trinidad, Guatemala, Peru, Colombia, Dominica, Uruguay, St. Croix, and Hispaniola. Comments: It could be a complex of species (Jones et al., 1972). O. portoricensis Fox, 1947 Hosts: Rats (Rattus spp.), R. norvergicus, Sigmomys alstonis, Nectomys sp., Proechimys guyannensis, P. semispinous, Tamandua longicaudata, Marmosa robinsoni, Marmosa sp., Sylvilagus floridanus, S. braziliensis, Conepatus semistriatus, Zygmodontomys brevicaudata, Dasyprocta fuliginosa, Monodelphis brevicaudata, Mongoose (=Herpestes javanicus?), Artibeus lituratus (?), Iguana sp. (?), lizards (?), humans.

89

90

Biogeography of the West Indies: Patterns and Perspectives

Distribution: Venezuela, Panama, Colombia, Jamaica, Guadeloupe, Virgin Islands, Nicaragua, Suriname, Uruguay, Puerto Rico, Hispaniola, Argentina, Bolivia, Brazil, Paraguay, St. Croix, Guadeloupe, and Trinidad. Comments: I think this species should be present in Cuba. Its absence in collections is due to lack of investigation in the right localities (southeast coastal areas). Ornithodoros sp. (group talaje) Hosts: Eleutherodactylus cooki. Distribution: Puerto Rico. Comments: This record (from Maldonado-Carriles and Medina-Gaud, 1977) was ignored by the authors of the revisions of the New World Ornithodorinae of the last decades. No other record of Ornithodoros being a parasite on frogs is known in the Western Hemisphere. Subgenus Subparmatus Clifford, Kohls et Sonenshine, 1964 O. viguerasi Cooley et Kohls, 1941 Hosts: Phyllonycteris poeyi, Erophylla sezekorni, E. bombifrons, Brachyphylla nana, Pteronotus quadridens, P. macleayi, P. davyi, P. suapuensis, P. rubiginosa, Pteronotus sp., Mormoops megalophylla, M. blainvillei, Eptesicus fuscus, Noctilio leporinus. Distribution: Venezuela, Trinidad, Jamaica, Puerto Rico, Hispaniola, and Cuba. Comments: An important member of the hot caves community. I think all the members of the subgenus Subparmatus are specialists of this habitat, as the genera Antricola and Parantricola. Indeterminate subgenus O. natalinus Cerny et Dusbabek, 1967 Hosts: Natalus lepidus. Distribution: Isla de Pinos, Cuba. Comments: Known only from Cueva del Lago, Isla de Pinos, Cuba. Genus Antricola Cooley et Kohls, 1942 A. silvai Cerny, 1967 Hosts: Phyllonycteris poeyi, Pteronotus quadridens. Distribution: Cuba. Comments: Known only from Cueva de Colon, Caguanes, Sancti Spiritus province, Cuba. All other reviewed records of this species are misidentifications (Cruz, 1976, 1978; Cruz and Estrada-Pena, 1995). Species from this genus are another important component of the hot caves community, together with O. viguerasi, and Parantricola marginatus. A. granai Cruz, 1973 Hosts: Unknown, but certainly bats. Distribution: Cuba. Comments: Known only from Cueva del Abono, Punta Judas, Sancti Spiritus province, Cuba. A. habanensis Cruz, 1976 Hosts: Phyllonycteris poeyi, Mormoops blainvillei. Distribution: Cuba. Comments: Known from Cueva del Mudo, Catalina de Guines, and Cueva de los Murcielagos, Santa Cruz del Norte, both from Havana province, Cuba.

Patterns in the Biogeography of West Indian Ticks

A. naomiae Cruz, 1978 Hosts: Phyllonycteris poeyi. Distribution: Cuba. Comments: Known from Cueva de Santa Catalina, Camarioca, Matanzas province, Cuba. A. martelorum Cruz, 1978 Hosts: Unknown, but certainly bats. Distribution: Cuba. Comments: Known only from Cueva de los Murcielagos, Santa Cruz del Norte, Havana province, where it is found together with A. habanensis, the only two sympatric species of Antricola, but this appears to be a consequence of human activities (Cruz, 1978). A. cernyi Cruz, 1978 Hosts: Unknown, but certainly bats. Distribution: Cuba. Comments: Known only from Cueva de Castellanos, Rodas, Cienfuegos province, Cuba. A. occidentalis Cruz, 1978 Hosts: Unknown, but certainly bats. Distribution: Cuba. Comments: Known only from Cueva de los Majaes, Galalon, San Andres de Caiguanabo, Pinar del Rio province, Cuba. A. centralis Cruz et Estrada-Pena, 1992 Hosts: Unknown, but certainly bats. Distribution: Cuba. Comments: Known only from Cueva del Maja, Buenaventura, Remedios, Las Villas province, Cuba. A. armasi Cruz et Estrada-Pena, 1992 Hosts: Unknown, but certainly bats. Distribution: Cuba. Comments: Known only from Cueva de la Ventana, Guanahacabibes Peninsula, Pinar del Rio province, Cuba. A. siboney Cruz et Estrada-Pena, 1992 Hosts: Unknown, but certainly bats. Distribution: Cuba. Comments: Known only from Cueva de los Majaes, Siboney, Santiago de Cuba province, Cuba. Genus Parantricola Cerny, 1966 P. marginatus Banks, 1910 Hosts: Phyllonycteris poeyi, Mormoops blainvillei, Pteronotus quadridens, P. macleayi. Distribution: Cuba, Mexico, Puerto Rico, and Hispaniola. Comments: Another important member of the hot caves community, together with the species of the genus Antricola and O. viguerasi. This species was known only from Cuba and Mexico (Hoffmann et al., 1972), but I had the opportunity to review some materials from Cueva Vicenta, Santo Domingo, which became the first record for Hispaniola.

91

92

Biogeography of the West Indies: Patterns and Perspectives

FAMILY IXODIDAE MURRAY, 1877 Genus Ixodes Latreille, 1796 Subgenus Alloixodes Cerny, 1966 I. capromydis Cerny, 1966 Hosts: Capromys pilorides. Distribution: Isla de Pinos, Cuba. Comments: Known only from the southern region of Isla de Pinos, Cuba. Ixodes sp. Host: Parulidae Distribution: Cayo Caiman del Faro, north coast of Cuba. Comments: I determined that some larva from migratory warblers collected in the abovementioned locality by J. de la Cruz, Rafael Abreu, and Naomi Cuervo, in September 1984, was a member of the genus Ixodes, but it was impossible to determine the species. The material was confiscated by the Cuban Security (see Haemaphysalis leporispalustris) and it was impossible to make any other study. Regardless, the only known species of Ixodes from the West Indies is a parasite of rodents, and has a very different morphology. Genus Aponomma Neumann, 1899 A. quadricavum Schulze, 1941 Hosts: Epicrates striatus, E. angulifer, Alsophis cantherigerus. Distribution: Hispaniola and Cuba. Comments: The genus has only two species known in the New World. The second species is Aponomma elaphense Price, 1958, a parasite of Elaphe subocularis from North America (Price, 1958; Anderson et al., 1981; Keirans and Degenhardt, 1985). Genus Amblyomma Koch, 1844 A. dissimile Koch, 1844 Hosts: Reptiles and amphibians, mainly on larger species. There are some doubtful records on mammals. Distribution: Cuba, Hispaniola, Jamaica, Puerto Rico, Barbados, Grenada, St. Lucia, Antigua, Trinidad, Tobago, St. Augustine (Florida and Georgia), U.S.A., Mexico, Guatemala, Belize, Honduras, Costa Rica, Nicaragua, Panama, Colombia, Venezuela, Guyana, Brazil, Paraguay, Argentina. Comments: There might be some confusion between records of this species and those of A. rotundatum. Both species parasite the same hosts and both supposedly were introduced with the toad Bufo marinus in some of the West Indies (Maldonado-Capriles and MedinaGaud, 1977). On the other hand, this tick is recorded from Dominican amber, which shows the presence of the species in the West Indies long before human colonization. In addition, Morel (1967) mixes all records of ticks from reptiles and amphibians from the West Indies, naming them without a real review of the materials, and making it difficult to recognize the identity of many old records. A. albopictum Neumann, 1899 Hosts: Cyclura nubila, Iguana sp., C. cornuta, C. nubila, Leiocephalus carinatus, L. stictigaster, Alsophis cantherigerus, Epicrates angulifer. Distribution: Cuba, Hispaniola, Swan Islands, Cayman Islands. Comments: See comments on A. antillarum.

Patterns in the Biogeography of West Indian Ticks

A. antillarum Kohls, 1969 Hosts: Cyclura pinguis, C. delicatissima, C. carinata. Distribution: Virgin Islands, Dominica, Bahamas (East Caicos) (Keirans, 1985). Comments: Relative to A. albopictum, but with a curious distribution. There is a population A. albopictum in Hispaniola, which is geographically between the Bahamas and the Virgin Islands. How did the species A. antillarum move from one group of islands to the other without interacting with the Hispaniolan population of A. albopictum? It is a problem that needs to be answered in the future. A. torrei Perez, 1934 Hosts: Epicrates angulifer, Cyclura nubila, C. stejnegeri, Leiocephalus macropus, L. carinatus, L. cubensis, Anolis luteogularis, A. sagrai, domestic dog (?). Distribution: Cuba, Puerto Rico, Mona Island, Cayman Islands (Sound and Little Cayman). Comments: A relative of A. arianae. A. arianae Keirans et Garris, 1986 Hosts: Alsophis portoricensis. Distribution: Puerto Rico. Comments: An endemic species from Puerto Rico. It is close to A. torrei, another parasite of reptiles also present in Puerto Rico, but probably develops a different host species preference. A. cruciferum Neumann, 1901 Hosts: Cyclura stejnegeri, C. cornuta. Distribution: Puerto Rico (Mona Island) and Hispaniola. Comments: Another species with some relations with A. torrei. A. rotundatum Koch, 1844 Hosts: Chaeromiscus minor(?), Bufo marinus, other cold-blooded vertebrates, mainly large species. Distribution: Mexico, Guatemala, Panama, Costa Rica, Jamaica, Colombia, Peru, Bolivia, Grenada, Guadeloupe, Surinam, Martinique, Trinidad, Brazil, and Venezuela. Comments: A partenogenetic species, very close to A. dissimile (see comments on this species). A. cajennense Fabricius, 1787 Hosts: Large domestic mammals, humans, and many other species of wild mammals; occasionally on birds. Distribution: Cuba, Jamaica, Trinidad, U.S.A. (Texas and Florida), Mexico, Guatemala, Honduras, Nicaragua, Costa Rica, Panama, Colombia, Venezuela, Guyana, Brazil, Bolivia. Comments: An American species, distributed with the Brazilian Zebu. A. variegatum Fabricius, 1787 Hosts: Cattle. Distribution: Puerto Rico, Antigua, Martinique, Guadeloupe, St. Kitts, French Guyana, Suriname, Venezuela, Nicaragua (Cruz, 1992), Africa. Comments: An African species introduced to America with domestic animals. Genus Anocentor Schulze, 1937 A. nitens Neumann, 1897 Hosts: Horses, mules, cattle. Other records on some wild mammals (Odocoileus virginianus) and accidental on birds.

93

94

Biogeography of the West Indies: Patterns and Perspectives

Distribution: Cuba, Hispaniola, Jamaica, Puerto Rico, Virgin Islands (St. Thomas, St. Croix), St. Kitts, Montserrat, St. Vincent, Dominica, St. Martin, Antigua, Guadeloupe, Martinique, Trinidad, U.S.A. (Texas, Florida), Mexico, Guatemala, Costa Rica, Honduras, Panama, Colombia, Venezuela, Brazil, Bolivia, Argentina. Comments: Another American species distributed with domestic animals. Genus Rhipicephalus Koch, 1844 R. sanguineus Latreille, 1806 Hosts: Domestic dogs, accidental in humans, one record from Rattus norvergicus, and other from Hydrochoerus hydrocoeris. Distribution: Cosmopolitan. Comments: An African species distributed with the domestic dogs. Genus Boophilus Curtice, 1891 B. microplus Canestrini, 1887 Hosts: Cattle, horses, and other large mammals (deer, etc.). Distribution: From the southern states of the U.S.A. (from where it was eradicated), Central and South America, West Indies (eradicated on Puerto Rico), East and South Africa, Madagascar, Australia, and much of the southern half of Asia. Comments: The common cattle ticks have a wide distribution in the West Indies since their hosts are large domestic mammals. B. annulatus Say, 1822 Hosts: Cattle, goats, Odocoileus virginianus. Distribution: Jamaica, Puerto Rico (eradicated in the mid-1940s), Guadeloupe, Africa. Comments: Another African species distributed with domestic cattle, but less successful than B. microplus. Genus Haemaphysalis Koch, 1844 H. leporispalustris Packard, 1889 Hosts: Colinus virginianus, Agelaius phoeniceus, warbler undeterminated, Sylvilagus palustris, S. floridanus, Oryctolagus cuniculus, Dasyprocta sp., Peromyscus sp. Distribution: From Canada to Argentina, but in the West Indies there is only one record from the Lesser Antilles (Kohls, 1969) and now one from Cuba. Comments: A widespread American species, never before reported from the Great Antilles. I collected (with Naomi Cuervo and Rafael Abreu) some immature stages of this tick (together with some Ixodes sp.) from migratory warblers in Cayo Caiman del Faro, Las Villas province, but the material and the records were confiscated by Cuban Security, considered “information sensitive to the enemy” and were never allowed to be published. This record is clearly accidental since migratory birds carried the ticks. Some populations of feral rabbits in Cuba that have never been studied should have a resident tick population.

DISTRIBUTION AND RELATIONSHIPS West Indies tick fauna is represented by 45 species, from 11 genera and two families (Table 1). They should represent nine different distributional patterns (Table 2).

68.57 31.43 100%

12.50 41.67 0.00 41.67 4.17 100%

18.18 9.09 9.09 36.36 9.09 0.00 9.09 9.09 100%

24 11 35

3 10 0 10 1 24

2 1 1 4 1 0 1 1 11

Argasidae Ixodidae Total Argasidae Argas Ornithodoros Otobius Antricola Parantricola Total Ixodidae Ixodes Haemaphysalis Aponomma Amblyomma Anocentor Dermacentor Boophilus Rhipicephalus Total

%

No.

Taxon

Cuba

0 0 1 9 1 0 2 1 14

2 8 0 0 1 11

11 14 25

No.

0.00 0.00 7.14 64.29 7.14 0.00 14.29 7.14 100%

18.18 72.73 0.00 0.00 9.09 100%

44.00 56.00 100%

%

Without Cuba

2 1 1 9 1 0 2 1 17

3 14 0 10 1 28

28 17 45

No.

11.76 5.88 5.88 52.94 5.88 0.00 11.76 5.88 100%

10.71 50.00 0.00 35.71 3.57 100%

62.22 37.78 100%

%

With Cuba

Greater Antilles

0 1 0 4 1 0 1 1 8

2 5 0 0 0 7

7 8 15

No.

0.00 12.50 0.00 50.00 12.50 0.00 12.50 12.50 100%

28.57 71.43 0.00 0.00 0.00 100%

46.67 53.33 100%

%

Lesser Antilles

6 2 0 26 1 0 1 1 37

1 18 1 1 0 21

21 37 58

No.

16.22 5.41 0.00 70.27 2.70 0.00 2.70 2.70 100%

4.76 85.71 4.76 4.76 0.00 100%

36.21 63.79 100%

%

Venezuela

TABLE 1 Comparative Tick Fauna Composition from Different Regions of the World

11 2 0 21 1 3 1 1 40

2 7 0 1 0 10

10 40 50

27.50 5.00 0.00 52.50 2.50 7.50 2.50 2.50 100%

20.00 70.00 0.00 10.00 0.00 100%

20.00 80.00 100%

%

Panama No.

11 1 0 14 1 0 2 1 30

5 7 1 1 0 14

14 30 44

No.

%

36.67 3.33 0.00 46.67 3.33 0.00 6.67 3.33 100%

35.71 50.00 7.14 7.14 0.00 100%

31.82 68.18 100%

Peru

7 13 0 2 0 0 1 1 24

4 3 1 0 0 8

8 24 32

29.17 54.17 0.00 8.33 0.00 0.00 4.17 4.17 100%

50.00 37.50 12.50 0.00 0.00 100%

25.00 75.00 100%

%

Madagascar No.

Patterns in the Biogeography of West Indian Ticks 95

96

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 Distribution of Ticks in the West Indies Greater Antilles Taxon Argasidae Argas persicus A. miniatus A. radiatus Ornithodoros cyclurae O. elongatus O. denmarki O. capensis O. azteci O. brodyi O. kelleyi O. dusbabeki O. tadaridae O. hasei O. portoricensis O. sp. N. talaje O. viguerasi O. natalinus Antricola silvai A. granai A. habanensis A. naomiae A. martelorum A. cernyi A. occidentalis A. centralis A. armasi A. siboney Parantricola marginatus Total Ixodidae Ixodes capromydis Ixodes sp. Haemaphysalis leporispalustris Aponomma quadricavum Amblyomma dissimile A. albopictum A. antillarum A. torrei A. arianae A. cruciferum A. rotumdatum A. cajennense A. variegatum Anocentor nitens Boophilus annulatus B. microplus Rhipicephalus sanguineus Total

Cuba

Without Cuba

With Cuba

Lesser Antilles

+ + + + – + + + + + + + – – – + + + + + + + + + + + + + 24

+ + – – + + + + – – – – + + + + – – – – – – – – – – – + 11

+ + + + + + + + + + + + + + + + + + + + + + + + + + + + 28

+ + +

– – –

+ + +

+ + + + + + + + + + + + + + 14

+ – – + – + – + + 11

Distribution

Structural Niche

Host Affinity

– – – – – + + + – – – – + + – – – – – – – – – – – – – – 5

CO AM NA EN EN CO CO WISA WISA NAA EN EN WISA WISA EN WISA EN EN EN EN EN EN EN EN EN EN EN WISA

A A A L L L L P P P P, A A P, A L L T P T T T T T T T T T T T

O O O H H O O C C C C C C M H C C C C C C C C C C C C C

+ + +

– – +

EN NAA AM

F F F

M Z M

+ + + + + + + + + + + + + + 17

+ – – – – – + + + + + + + 9

CA AM CA CA CA EN EN WISA AM CO AM CO CO CO

F F F F F F F F F F F F F F

H H H H H H H H Z Z Z Z Z Z

Patterns in the Biogeography of West Indian Ticks

97

TABLE 2 (continued) Distribution of Ticks in the West Indies Note: Distribution is designated as cosmopolitan (CO), American species (AM), Caribbeans (CA), North American-Antilleans (NAA), West Indies-South Americans (WISA), and endemics (EN). Structural niche is designated as arboricolous (A), lapidicolous (L), psicrocavernicolous (P), termocavernicolous (T), and open fields (F). Host affinity is denoted by Herpetophile (H), Ornithophile (O), Chiropterophile (C), Micromastophile (M), Macromastophile (Z), Unknown (U).

THE COSMOPOLITANS They include parasites of domestic animals, like Argas persicus, a parasite of poultry, Rhipicephalus sanguineus, the common dog tick, and Boophilus microplus, the common cattle tick, but two species, Ornithodoros capensis and O. denmarki, are distributed by their natural hosts, terns and gulls. Many records of A. persicus have been confused with some of the numerous sibling species of the subgenus Persicargas (Kohls et al., 1970); therefore, it is impossible to give a precise distribution of any of the Persicargas species without an exhaustive review of all the old records. The tick parasites of domestic mammals are very well distributed all over the Antilles, as are their hosts. The two cosmopolitan species of Ornithodoros have been reported from Jamaica and Trinidad, but they should be found on other islands of the Antilles. Both can be considered circumtropical species (Kohls et al., 1965). Another species, mentioned by Maldonado-Carriles and Medina-Gaud (1977) as B. annulatus, from cattle in Puerto Rico, was eradicated in the mid-1940s. It is not clear to me that they are not referring to the more common species in the West Indies, B. microplus. The same species was mentioned from Jamaica.

THE AMERICAN SPECIES They are represented by four species: the common horse tick, Anocentor nitens, the Lone Star tick, Amblyomma cajennense, a cattle tick species, the toad tick, A. dissimile, and the hare tick, Haemaphysalis leporispalustris. The first two were distributed by domestic animals, as was the case in the cosmopolitan species. Amblyomma dissimile looks like an old successful species distributed with its hosts, large cold-blooded terrestrial vertebrates. In Cuba its main host are the bigger species of toads (Peltophryne spp.) but it has been reported from a wide variety of hosts outside Cuba. According to Keirans (1985) it is primarily a parasite of snakes but also parasites amphibians and is found only occasionally on iguanas. Other authors include also some mammals as occasional hosts. Amblyomma dissimile was reported from amber in the Dominican Republic, of (supposed) Eocene age (Lane, 1986; as Amblyomma sp. near testudinis). Other West Indies records are from Puerto Rico, Mona, Jamaica, Barbados, St. Lucia, Antigua, Grenada, Guadeloupe, Martinique. In the continent, it is known from Florida and Georgia to Argentina. The fourth species, H. leporispalustris, was known from migratory birds in the Lesser Antilles (Kohls, 1969) and now it is reported for the first time in Cuba. The adults are parasites on small mammals, but the immature can be found on birds (which can carry the ticks during migration). It looks as if the species is not established in Cuba or any other West Indies island.

THE CARIBBEANS The group is composed of species distributed over lands with coasts on the Caribbean Sea and the Gulf of Mexico, but never far inland. Three species represent it: Ornithodoros azteci and O. brodyi, both bat parasites, and Argas miniatus. The last species must have been distributed along with domestic chickens, but it is poorly known aside from being a chicken tick on the above-mentioned

98

Biogeography of the West Indies: Patterns and Perspectives

area (Kohls et al.,1970). In the continent, O. azteci and O. brodyi had been reported from Mexico to Venezuela. The first one has been recorded in Cuba and Jamaica (Kohls et al., 1965). The only Antillean record of O. brodyi is the Cuban one (Cerny, 1969).

THE NORTH AMERICAN–ANTILLEANS This group is represented by three species, Argas radiatus, Ornithodoros kelleyi, and Ixodes sp. The first species is a parasite of birds, including domestic species. In Cuba it has been found only in nests of cormorants. The second species is a parasite of bats, and had been reported as far south as Costa Rica (Kohls et al., 1965). The last one, Ixodes sp., is a new record from Cuba. The host was caught during migration, before it reached Cuban territory. It is a North American tick, carried by the bird. Only one species of Ixodes is reported to the West Indies, I. capromydis, but it is absolutely a different species.

THE WEST INDIES–SOUTH AMERICANS They are parasites on bats and are ecologically specific to the hot cave bats (Cruz, 1992). One species, Ornithodoros viguerasi, is distributed in the West Indies and the north coast of South America, but not Central America (Kohls et al., 1965, 1969). Other members of the same subgenus (Subparmatus), had been reported from Curaçao (O. mormoops) and Colombia and Panama (O. marinkellei) (Kohls et al., 1969).

THE WEST INDIES–CENTRAL AMERICANS As with the group cited above, they are chiropterophiles and thermocavernicolous. Parantricola marginatus is distributed in the West Indies and Mexico (Hoffmann et al., 1972), but not South America. I reviewed two collections of this species (no. RML 51193 and RML 52438), with a total of ten nymphs, two males and two females, from Cueva Vicenti, Samana, Dominican Republic, December 9, 1968, collected by F. H. Armstrong and M. L. Johnson. They were the first records of this species from Dominican Republic.

THE ENDEMICS Three species, Aponomma quadricavum, Amblyomma albopictum, and A. torrei, can be found only on Cuba and some other islands of the West Indies. Aponomma quadricavum is known from Cuba and Hispaniola; Amblyomma albopictum from Cuba, Hispaniola, and Swan Islands (Gulf of Honduras); and A. torrei from Cuba, Cayman Islands, and Puerto Rico. All are parasites on reptiles, primarily large snakes and lizards. Other species of Amblyomma, known from West Indian reptiles, are closely related to the Cuban species. The species A. antillarum is an iguana parasite in the Virgin Islands and the Bahamas (Kohls, 1969; Keirans, 1985) with a striking distribution. Its close relative A. albopictum is distributed between the two populations. Amblyomma arianae, a close relative of A. torrei, was described from Puerto Rican snakes (Keirans and Garris, 1986). Amblyomma cruciferum, a South American species that is a parasite of reptiles, has also been reported from Puerto Rico (Keirans and Garris, 1986). The Cuban endemics are the largest group, composed of 15 species: 10 species of Antricola, Ornithodoros natalinus, O. tadaridae, O. cyclurae, O. dusbabeki, and Ixodes capromydis. It is clear that almost half of the indigenous species of ticks from Cuba are local endemics. From this group, one species (O. cyclurae) is a parasite of iguanas, and one (I. capromydis) is a parasite of capromyid rodents. The remaining 13 species are parasites of bats and 10 of them, the Antricola species, are thermocavernicolous. The phylogenetic relationships of ticks at the species level have not been carefully studied. The most serious attempts have looked at generic relationships, and there is no consensus. Therefore, the relationships between Cuban and other related ticks will be considered in the sense of “appear

Patterns in the Biogeography of West Indian Ticks

99

as…” or “closer to … than to ….” I will talk only about the most evident relationships. The species with wide distributions, with many doubtful records, and those evidently distributed by humans in modern times will not be included. I will focus on the less distributed autochthonous species, which need more discussion. One species, O. cyclurae, is a nasal parasite of the Cuban iguana, Cyclura nubila. It has a close relative in Hispaniola, O. elongatus from an unknown host. Some morphological features (the shape of the dorsal setae, short, strong, and barbed; the 2/2 hypostome dentition; and the body and dorsal plate shape) and the presence of an iguana in the same container where the tick was found (Kohls et al., 1969) make me think it is also a parasite of iguanas (Cruz, 1984). No other species is close to these two species in the West Indies. Both appear highly specialized species, which is clear because of their relationship with the host and their localization (nasal parasite), together with the morphological derived characters. Another species, O. natalinus, is known from only a very special habitat of the Cueva del Lago, Nueva Gerona (Isla de Pinos). The host, the small bat Natalus lepidus, is a dweller of marginal niches, such as very small caves or caves with accumulations of CO2 , which is the situation at this locality. The tick has no clear relationship with any other species, and it was impossible to place it in any of the known subgenera (Cerny and Dusbabek, 1967; Jones and Clifford, 1972). A third species, O. dusbabeki, is also a parasite of bats on the northern region of Isla de Pinos. Its species specificity is very low and has been found in very different species of bats (Phyllostomidae, Molossidae, Noctilionidae) and in different ecological niches (hollowed trees, palm leaves, caves, human constructions). It is the only species of tick, beside O. natalinus, found on bats in the area mentioned above. In the southern region of the Isla de Pinos (south of Lanier Swamp) we found other chiropterophile ticks (O. azteci). It appears that O. dusbabeki is related to O. hasei, also a species with low host and habitat specificity. Both species had been found in the same families of bats and in the same array of habitats (tree hollows, caves, and human constructions). A fourth species, O. tadaridae, is a parasite of molossid bats, mainly from Mormopterus minutus. This bat lives in big colonies on palms (Silva, 1979) where the ticks can be found by the thousands, in all stages year round (Cruz, 1974). Of course, the tick has the same distribution in Cuba as the host. It was reported once from Mexico (Dusbabek, 1970). I reviewed Dusbabek’s material and identified it as a species very close to the Cuban one: O. hasei, a Central American species, also reported on bats from Trinidad, Martinique, Guadeloupe, and Barbuda. During a visit to the University of Mexico (January to March, 1992), I had the opportunity to study the Anita Hoffmann tick collection, and some other materials from the Laboratory of Acarology, were I found some “O. hasei” larvae. Ornithodorus hasei appears to be a complex species that needs a better review (see also Jones and Clifford, 1972). In my opinion O. tadaridae is closer to O. boliviensis, a parasite of molossid bats, found in human constructions (“huts”) in Bolivia, Venezuela, and Mexico (Jones et al., 1972). All ten species of the genus Antricola reported from Cuba are endemic, with each species inhabiting a different cave (Cruz, 1978a). There are other species of Antricola in North, Central, and South America (Cruz, 1978a; Need et al., 1991; Cruz and Estrada-Pena, 1995), and probably elsewhere in the West Indies (Cruz, 1978; Cruz and Estrada-Pena, 1995). The relationships of this group are very obscure. Some authors (Cerny, 1966; Klompen, 1989) include Parantricola in this genus, others do not (Cruz, 1974; Cruz and Dusbabek, 1989). All the representatives of the group (considered as a tribe, Antricolini, by Hoogstraal and Aeschlimann, 1982, and Hoogstraal, 1985) parasitize “hot cave” bats (Cruz, 1992). The only ixodid tick endemic to Cuba, I. capromydis, is a parasite of the endemic Cuban capromyid Capromys pilorides. I. capromydis is restricted to the southern region of the Isla de Pinos and its specific host is C. pilorides ciprianoi (considered by Woods et al., Chapter 18, this volume to be synonymous with C. p. relictus) although C. pilorides is widely distributed in Cuba and its archipelagos (Woods et al., Chapter 18, this volume). The species is the only representative of the subgenus Alloixodes, and has no clear relationship with any other members of the genus

100

Biogeography of the West Indies: Patterns and Perspectives

(Clifford et al., 1972). Ixodes capromydis shares common morphological features (cornua on all stages, palp structure of larvae and nymph and the hypostome) with the South American species, I. sigelos, a parasite of Chilean rodents. Both appear to be relicts from old species. Three other species have been reported from the West Indies but not from Cuba. The first one, Amblyomma variegatum, an African species parasitic on cattle, was introduced to Puerto Rico, some of the Lesser Antilles (Morel, 1966), and adjacent continental areas. The second species, O. portoricensis, is a parasite of rats and other small mammals. It is known from Hispaniola, Jamaica, Puerto Rico, Virgin Islands, Trinidad, St. Croix, Venezuela, Colombia, Panama, Brazil, Paraguay, Bolivia, and Argentina. It might be found in Cuba where the hosts and the appropriate ecological and colonization conditions are present. The third species is Ornithodoros sp. (group talaje) reported by Maldonado-Cariles and Medina-Gaud (1977) from Eleutherodactylus cooki from Puerto Rico. It is an unusual record since the host is a small amphibian, a host not very suitable for a tick. The account was ignored in the most recent revisions of American argasids (Kohls et al., 1965, 1969; Jones and Clifford, 1972). The species A. rotundatum mentioned by Morel (1967) is not included since he gave no convincing arguments to consider the record of this species valid. The Spinose ear tick, Otobius megnini, has been reported from different islands of the Antilles at different times by some authors, but all records were based on collections done from imported animals. No living population of this tick is known in the West Indies.

ECOLOGICAL ZOOGEOGRAPHY Ecological characters have not received the attention they deserve as biogeographical indicators. They have been mentioned as having “more or less invasive capabilities.” I found the analysis done by Henderson and Crother (1989) very useful, even if it deals with a very different subject, the predation pattern of snakes. They gave me the idea of the possible use of the ecological characters as zoogeographical indicators. I use eight different geographical units for comparison, as follows. Cuba — This island is focal to biogeographical analyses because it is the largest island in the West Indies. It is also important because of its ecological and geographical complexity, and its very wellknown vertebrate and tick faunas. The Greater Antilles — These islands are considered in two distinct groups: the Greater Antilles, sensu lato (including Cuba) and sensu stricto (excluding Cuba). The Greater Antilles include Hispaniola, Puerto Rico, Cayman Islands, Jamaica, and their satellite islands, and, of course, Cuba. I have chosen to look at the Greater Antilles in this way because some islands appear to have a distinct history and it is possible they have geological origins different from Cuba (Donnelly, 1988). Cuba was included with them to see how much Cuba influences the results. The Lesser Antilles — This group of volcanic islands is closer to continental South America than the Greater Antilles. This chain of islands offers an interesting point of comparison because of the possibility that the islands may have served as a “bridge” between the Antilles and continental South America. Venezuela and Panama — They are two units, both continental in nature and each of possible contact (directly or indirectly) of the West Indies and continental faunas (Rosen, 1975; Guyer and Savage, 1986). Peru — It is a continental area without any clear relationship with the West Indies and is a core part of the Neotropical region. Madagascar — This island has a clear relationship with its closer continental area (Africa) and has nothing in common with the West Indies, except for some aspects of historical development (Woods and Eisenberg, 1989).

Patterns in the Biogeography of West Indian Ticks

101

I recognize five groups of “habitat preferences,” as explained in Materials and Methods. Each group has special requisites for which ticks have become “preadapted.” This concept has been clearly explained by Hoogstraal and Kim (1985), but in relation to the evolution of ticks that changed host from reptiles (in the Jurassic) to mammals (in the Cretaceous). The same abilities give the ticks additional possibilities to colonize new geographical territories. One of the hardest steps of colonization for parasites is the possibility of finding an appropriate host. On “new” territories, hosts would likely be scarce. If the parasite has to leave the established host to fulfill some biological need (i.e., molts, oviposition), the lack of readily available hosts is a serious limitation to colonization and easily becomes a major cause of extinction. Then, if the host visits the same site (a den, a nest) on a regular basis (daily or seasonally), and if the ticks are “nest species,” they have greater chances for a successful colonization. Studies on the colonization on Krakatoa Atoll revealed that after volcanic eruption, seabirds were the first colonizers and soon after, their nest ticks. According to this scenario, the argasids can be considered as “pre-adapted” for overwater colonization, especially in association with the nests of birds and bats. Host preference is a complex character. First, some ticks have different host preference at different developmental stages (Hoogstraal and Kim, 1985). Second, in evolutionary time, ticks supposedly can switch from one host to another with only a few restrictions (Hoogstraal and Aeschlimann, 1982; Hoogstraal and Kim, 1985). For reasons already mentioned, ornithophiles and chiropterophiles ticks have better chances to successfully colonize offshore islands. Macromastophiles have fewer chances since their hosts have lower population densities, less nesting behavior, and few possibilities to move overseas. The most successful species of macromastophile ticks are the parasites of domestic animals, because of human actions on their distribution. Then, the “island” character can be reflected by the dominance of argasid parasites on birds and bats. Table 1 shows the dominance of argasids on islands (Cuba, 68%; Greater Antilles, with and without Cuba, 62.22 and 44%, respectively; Lesser Antilles, 46.47%) but not on continental areas (Venezuela, 36.21%; Peru, 31.82%; Panama, 20%; and Madagascar, 25%). Table 3 shows that (as would be expected) the macromastophiles dominate on continental areas (Venezuela, 41.38%; Panama, 62%; Peru, 43.18%). The situation of the Lesser Antilles (33% of macromastophiles) and Madagascar (25%) is intermediate. It is clear that the Lesser Antilles have very few species of ticks, and the five introduced species of domestic mammals became an important part of the local fauna (only 15 species in all). Madagascar has a depauperate continental tick fauna. It appears that the chiropterophiles dominate in the islands followed by the herpetophiles. Both groups, together, became the absolute dominants on islands. This pattern would be expected because of the high colonization abilities of bats and reptiles. The cavernicolous (Table 4), thermocavernicolous, and psicrocavernicolous forms have a certain level of dominance on islands also. In the Lesser Antilles the low number (two species) of psicrocavernicoles and complete lack of thermocavernicole forms can be explained by the lack of caves in this island arc as a result of their volcanic origin and geology. However, it should be noted that a lack of intensive research on the other islands of the Greater Antilles could explain the general absence of records for some species (as in the case of thermocavernicoles and some psicrocavernicoles). The thermocavernicoles (the ticks of hot caves) show a number of very interesting features. In Cuba, the hosts and the ticks are very specialized but not as much so as on adjacent continental areas. The continental bats (mormoopids and some phyllostomids) are very opportunistic and are found in very different kinds of caves. In general, the caves I have visited in Mexico were different from the close (= not large) and climatically uniform caves of Cuba. The tick populations were, as expected, less numerous in Mexico than in Cuba caves. In Cuba, the prevalent bats of hot caves are Phyllonycteris poeyi, Pteronotus macleayii, P. quadridens, and Mormoops blainvillii. Both groups, Brachyphillinae and Mormoopidae, evolved in the West Indies, from Central American ancestors (Silva, personal communication). The same pattern probably occurred for the associated ticks. Some less specialized forms of ticks came from Central America with the ancestral bats and evolved into the highly specialized thermocavernicoles. Later on, the bats returned to continental

14.29 14.29 51.43 5.71 14.29 0.00 100%

5 5 18 2 5 0 35

Herpetophile Ornithophile Chiropterophile Micromastophile Macromastophile Unknown Total 10 4 4 1 6 0 25

No. 40.00 16.00 16.00 4.00 24.00 0.00 100%

% 11 5 19 3 7 0 45

No. 24.44 11.11 42.22 6.67 15.56 0.00 100%

%

With Cuba

Greater Antilles Without Cuba

2 4 2 2 5 0 15

No. 13.33 26.67 13.33 13.33 33.33 0.00 100%

%

Lesser Antilles

6 3 12 12 24 1 58

No. 10.34 5.17 20.69 20.69 41.38 1.72 100%

%

Venezuela

b

a

5 3 5a 12 11 35

a

No.

12.86 8.57 12.86 34.29 31.43 100%

% 3 5 2b 2 14 25

b

No. 10 20 6 8 56 100%

% 6 6 6 12 17 45

No. 8.89 13.33 13.33 26.67 37.78 100%

%

With Cuba

Greater Antilles Without Cuba

Ornithodoros dusbabeki is arboricolous and psicrocavernicolous. Ornithodoros hasei is arboricolous and psicrocavernicolous.

Arboricolous Lapidicolous Psicrocavernicolous Thermocavernicolous Open fields Total

Host Affinity

Cuba

3 3 2 0 8 15

No. 16.67 20.00 10.00 0.00 53.33 100%

%

Lesser Antilles

3 7 8 3 37 58

No.

5.17 12.07 13.79 5.17 63.79 100%

%

Venezuela

TABLE 4 Comparative Tick Fauna by Structural Niche from Different Regions of the World

%

No.

Host Affinity

Cuba

8.00 4.00 10.00 14.00 62.00 2.00 100%

%

3 3 3b 2 40 50

b

No.

5.00 6.00 5.00 4.00 80.00 100%

%

Panama

4 2 5 7 31 1 50

No.

Panama

TABLE 3 Comparative Host Affinity Composition and Percentage from Different Regions of the World

4 7 2 1 30 44

No.

4 9 3 7 19 2 44

No. %

% 9.09 15.91 4.55 2.27 68.18 100%

Peru

9.09 20.45 6.82 15.91 43.18 4.55 100

Peru

3.13 12.50 6.25 53.13 25.00 0.00 100%

%

1 5 1 0 25 32

No.

3.13 15.63 3.13 0.00 78.13 100%

%

Madagascar

1 4 2 17 8 0 32

No.

Madagascar

102 Biogeography of the West Indies: Patterns and Perspectives

Patterns in the Biogeography of West Indian Ticks

103

Central America (via the Yucatan Peninsula?) carrying some of their tick parasites and became part of the actual continental populations. The genus Ornithodoros is the most diverse argasid, especially on the islands (Table 1). This might be due to some geographical influence. The ornithodorine ticks are dominant in the New World, whereas argasines are dominant in the Old World. In this analysis only islands in the Americas are included. In Ixodidae, the dominance of Amblyomma in the New World and of Haemaphysalis in Madagascar are evident. The most striking feature is the presence of Dermacentor only in Panama. The genus is clearly more diverse in the Nearctic and Palearctic regions. Its presence in Panama should represent the southern limits of a Nearctic distribution in the process of expanding its range southward.

CONCLUSION The study of West Indian ticks reveals a pattern that suggests that the West Indies is an assemblage of islands and banks of different origins, ages, and natures. It is clear that Cuba has had an independent origin and has never been connected with any continental area, or with other islands of the West Indies. This independent origin gives Cuba a more insular character in regard to its tick fauna, a character that is reflected in the composition of other taxonomic groups. The rest of the Greater Antilles appears to be characterized by a more homogenous assemblage of ticks, with many species or species groups in common with each other. At the eastern end of these islands the volcanic Lesser Antilles seem to be a bridge or series of stepping-stones between the Greater Antilles and South America, but independent of both. The different colonization patterns that influenced the composition and character of the West Indian tick fauna are as follows. 1. The invasion from Central America to the West Indies — There are species that show relationships between Central America–Cuba–the Great Antilles–the Lesser Antilles–South America. This invasion does not have a clear direction and probably went both ways. The ancestors of O. hasei-dusbabeki and O. boliviensis–tadaridae seem to have come from South America and to have become Cuban species. The genus Parantricola appears to have come from Central America to Cuba–Hispaniola. The direction of dispersal of the genus Antricola and the subgenus Subparmatus is not clear since they have representatives on both extremes and between. Other species, such as O. cyclurae-elongatus, O. natalinus, Ixodes capromydis, Amblyomma albopictum-antillarum, and A. torrei-arianae-cruciferum, have obscure relationships with the continent. They probably followed the distributions of their host species as with thermocavernicolous forms. This is certainly the oldest colonization of ticks in the West Indies and occurred between the Eocene and the Pliocene, since it escaped the invasion of the North American elements to Central America (genus Dermacentor). If the colonization were from South America through the Lesser Antilles, it would have been later than the first one from Central America. 2. The invasion from North America — The species with clear North American origin, such as Argas radiatus and O. kelleyi, arrived with their hosts, the cormorants and the bat Eptesicus fuscus, probably during some of the sea recessions of the Pleistocene. 3. Human introduction — The last colonization took place during the historical times when humans brought their domestic animals to the Antilles. In this category it is possible to include the colonization of Amblyomma rotundatum and the “redistribution” of A. dissimile and the little-known O. portoricensis. 4. Unknown origin — It is impossible at present to include the bird parasites O. capensis and O. denmarki in any zoogeographical colonizing event because of their worldwide distribution and unknown evolution.

104

Biogeography of the West Indies: Patterns and Perspectives

ACKNOWLEDGMENTS I thank everyone who helped me, directly or indirectly, to complete this difficult task. First, I thank Dr. Charles Woods for giving me the opportunity and the honor to participate in this publication and Florence Sergile for her patience and dedication revising and editing the manuscript. I also thank the staff of Grove Scientific & Engineering for allowing me to use their facilities during the elaboration of this chapter. Last, but not least, I am grateful to Dart Morales, Bruno Ferraro, and Mary Spirig, for their kind collaboration.

LITERATURE CITED Anderson, J. F., L. A. Megnarelli, and J. E. Keirans. 1981. Aponomma quadricavum (Acari: Ixodidae) collected from an infested boa, Epicrates strictus, in Connecticut. Journal of Medical Entomology 18:123–125. Cerny, V. 1966a. Nueva especie de garrapata del genero Ixodes Latreille (Ixodoidea, Ixodidae) en la Jutia Conga de la Isla de Pianos. Poeyana, seria A 24:1–9. Cerny, V. 1966b. Nuevas garrapatas (Ixodoidea) en aves y reptiles de Cuba. Poeyana, seria A 26:1–9. Cerny, V. 1969. The tick fauna of Cuba. Folia Parasitologia (Praha) 16(3):279–284. Clifford, C. M., D. E. Sonenshine, J. E. Keirans, and G. M. Kohls. 1973. Systematics of the subfamily Ixodinae (Acarina: Ixodidae). 1. The subgenera of Ixodes. Annals of the Entomological Society of America 66(3):489–500. Cooley, R. A. and G. M. Kohls. 1944. The Argasidae of North America, Central America and Cuba. The American Middland Naturalist, Monograph No. 1:1–152. Cruz, J. de la. 1974a. Notas adicionales a la fauna de garrapatas (Ixodoidea) de Cuba. I. Argasidae de las aves. Poeyana 128:1–8. Cruz, J. de la. 1974b. Notas adicionales a la fauna de garrapatas (Ixodoidea) de Cuba. II. Nuevo status para Parantricola Cerny. 1966. Poeyana 130:1–4. Cruz, J. de la. 1974c. Notas adicionales a la fauna de garrapatas (Ixodoidea) de Cuba. III. Redescripcion de Ornithorodos [sic] tadaridae Cerny y Dusbabek. 1967. Poeyana 138:1–5. Cruz, J. de la. 1976. Notas adicionales a la fauna de garrapatas (Ixodoidea) de Cuba. IV. Presencia de Argas (Persicargas persicus) (Oken, 1818). Miscellaneous Zoologia. Academia de Ciencias de Cuba 2:3. Cruz, J. de la. 1978a. Notas adicionales a la fauna de garrapatas (Ixodoidea) de Cuba. VI. Cuatro nuevas especies del genero Antricola Cooley et Kohls. 1942 (Argasidae, Ornithodorinae). Poeyana 184:1–17. Cruz, J. de la. 1978b. Composicion zoogeografica de la fauna de garrapatas (Acarina:Ixodoidea) de Cuba. Poeyana 185:1–6. Cruz, J. de la. 1984. Una nueva especie de garrapata del genero Ornithodoros (Acarina: Ixodoidea, Argasidae), parasita de la cavidad nasal de la iguana Cyclura nubila (Sauria: Iguanidae). Poeyana 277:1–6. Cruz, J. de la. 1985. Argas (Persicargas) radiatus (Acarina: Argasidae), a tick new for Cuba. Miscellaneous Zoologia. Academia de Ciencias de Cuba 25:1. Cruz, J. de la. 1986. Coeficientes de similitud zoogeografica y su aplicación a las condiciones insulares de Argasidae (Acarina) del Mediterraneo Americano. Ciencias Biologias Academia de Ciencias de Cuba 16:87–106. Cruz, J. de la. 1987. La fauna de garrapatas (Ixodoidea) de la Republica de Cuba. Doctoral dissertation, Institute of Parasitology, Ceske Budejovice, Czechoslovakia. Cruz, J. de la. 1992. Bioecologia de las Cuevas Calientes. Mundos subterraneos, UMAE, Mexico, 3:7–22. Cruz, J. de la and F. Dusbabek. 1989. Haller’s organ and anterior pit in the genera Antricola and Parantricola (Ixodoidea: Argasidae). Folia Parasitologia (Praha) 36:275–279. Cruz, J. de la and A. Estrada-Pena. 1995. Four new species of Antricola ticks (Argasidae:Antricolinae) from bat guano in Cuba and Curaçao. Acarologia 36(4):277–286. Donnelly, T. W. 1988. Geological constraints on Caribbean Biogeography. Pp. 15–37 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Cornell University Press, Ithaca, New York. Dusbabek, F. 1970. New records of parasitic mites (Acarina) from Cuba and Mexico. Mitteilungen Zoologisches Museum Berlin 46(2):273–276. Estrada-Pena, A. 1989. Indice-catalogo de las garrapatas (Acarina: Ixodoidea) en el mundo. Vol. 1: Genero Haemaphysalis. Secretariado de Publicaciones, Universidad de Zaragoza, Zaragoza.

Patterns in the Biogeography of West Indian Ticks

105

Fairchild, G. B., G. M. Kohls, and V. J. Tipton. 1966. The ticks of Panama (Acarina:Ixodoidea). Pp. 167–219 in Wenzel, R. L. and V. J. Tipton (eds.). Ectoparasites of Panama. Field Museum of Natural History, Chicago. Guyer, C. and J. M. Savage. 1986. Cladistic relationships among anoles (Sauria: Iguanidae). Systematic Zoology 35:509–531. Henderson, R. W. and B. I. Crother. 1989. Biogeographic patterns of predation in West Indian Colubrid snakes. Pp. 479–518 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Hershkovitz, P. 1966. Mice, land bridges and Latin American faunal interchange. Pp. 725–751 in Wenzel, R. L. and V. J. Tipton (eds.). Ectoparasites of Panama. Field Museum of Natural History, Chicago. Hoffmann, A., I. Bassols-Barrera, and C. Mendez. 1972. Nuevos hallazgos de acaros en Mexico. Revista de la Sociedad Mexicana de historia natural 33:151–159. Hoogstraal, H. 1985. Argasid and Nutalliellid ticks as parasites and vectors. Advances in Parasitology 24:135–238. Hoogstraal, H. and A. Aeschlimann. 1982. Tick-host specificity. Bulletin de la Société Entomologique de Suisse 55:5–32. Hoogstraal, H. and K. C. Kim. 1985. Tick and mammal coevolution, with emphasis on Haemaphysalis. Pp. 505–567 in Kim, K. C. (ed.). Coevolution of Parasitic Arthropods and Mammals. John Wiley & Sons, New York. Jones, E. K. and C. M. Clifford. 1972. The systematics of the subfamily Ornithodorinae (Acarina: Argasidae). V. A revised key to larval Argasidae of the Western Hemisphere and description of seven new species of Ornithodoros. Annals of the Entomological Society of America 65(3):730–740. Jones, E. K., C. M. Clifford, J. E. Keirans, and G. M. Kohls. 1972. The ticks of Venezuela (Acarina: Ixodoidea) with a key to the species of Amblyomma in the Western Hemisphere. Brigham Young University, Science Bulletin, Biological Series 17:1–40. Keirans, J. E. 1985. Amblyomma antillarum Kohls. 1969 (Acarina: Ixodoidea): description of the immature stages from the Rock Iguana, Iguana pinguis (Sauria: Iguanidae) in the British Virgin Islands. Proceedings of the Entomological Society of Washington 87(4):821–825. Keirans, J. E. and W. D. Degenhart. 1985. Aponomma elaphense Pine. 1959 (Acari: Ixodidae): diagnosis of the adults and nymph with first description of the larva. Proceedings of the Biological Society of Washington 98(3):711–717. Keirans, J. E. and G. I. Garris. 1986. Amblyomma arianae, n. sp. (Acarina: Ixodidae), a parasite of Alsophis portoricensis (Reptilia: Colubridae) in Puerto Rico. Journal of Medical Entomology 23(6):622–625. Keirans, J. E., C. M. Clifford, and D. Corwin. 1976. Ixodes sigelos, n. sp. (Acarina: Ixodidae), a parasite of rodents in Chile, with a method for preparing ticks for examination by scanning electron microscopy. Acarologia 18(2):217–225. Klompen, J. S. H. 1992. Comparative morphology of Argasid larvae (Acarina: Ixodida: Argasidae), with notes on phylogenetic relationships. Annals of the Entomological Society of America 85(5):541–560. Kohls, G. M. 1969a. A new species of Amblyomma from iguanas in the Caribbean (Acarina: Ixodidae). Journal of Medical Entomology 6(4):439–442. Kohls, G. M. 1969b. New records of ticks from the Lesser Antilles. Studies of the Fauna of Curaçao and Other Caribbean Islands 28:126–134. Kohls, G. M., D. E. Sonenshine, and C. M. Clifford. 1965. The systematics of the subfamily Ornithodorinae (Acarina: Argasidae). II. Identification of the larvae of the Western Hemisphere and descriptions of three new species. Annals of the Entomological Society of America 58(3):331–364. Kohls, G. M., C. M. Clifford, and E. K. Jones. 1969. The systematics of the subfamily Ornithodorinae (Acarina: Argasidae). IV. Eight new species of Ornithodoros from the Western Hemisphere. Annals of the Entomological Society of America 62(5):1035–1043. Kohls, G. M., H. Hoogstraal, C. M. Clifford, and M. N. Kaiser. 1970. The subgenus Persicargas (Ixodoidea, Argasidae, Argas). 9. Redescription and New World records of Argas (P.) persicus (Oken) and resurrection, redescription and records of A. (P.) radiatus Railliet, A. (P.) sanchezi Duges and A. (P.) miniatus Koch, New World ticks misidentified as A. (P.) persicus. Annals of the Entomological Society of America 63(2):590–606. Lane, R. S. and G. P. Poinar. 1986. First fossil tick (Acarina: Ixodidae) in New World amber. International. Journal of Acarology 12(2):75–78.

106

Biogeography of the West Indies: Patterns and Perspectives

Liebherr, J. K. 1988. The Caribbean: fertile ground for zoogeography. Pp. 1–14 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Comstock Publishing Associates, Cornell University Press, Ithaca, New York. Maldonado-Caapriles, J. and S. Medina-Gaud. 1977. The ticks in Puerto Rico (Arachnida: Acarina). Journal of Agriculture, University of Puerto Rico 61:402–404. Morel, P. C. 1966. Etude sur les tiques du bétail en Guadeloupe et Martinique. I. Les tiques et leur distribution (Acarina, Ixodoidea). Revue d’élevage et de médecine vétérinaire des pays tropicaux 19(3):307–321. Morel, P. C. 1967. Les tiques de animaux sauvages des Antilles (Acariens, Ixodoidea). Acarologia 9:341–352. Morel, P. C. and P. Fauran. 1967. Présence en Guadeloupe de l’ornithodore Alectorobius puertoricensis (Fox. 1947) (Acariens, Ixodoidea). Acarologia 9(2):338–340. Need, J. T., W. E. Dale, J. E. Keirans, and G. A. Dash. 1991. Annotated list of ticks (Acarina: Ixodidae, Argasidae) reported in Peru: distribution, hosts and bibliography. Journal of Medical Entomology 28(5):590–597. Rosen, D. E. 1975. A vicariance theory of Caribbean biogeography. Systematic Zoology 24:431–463. Schuchert, C. 1935. Historical Geology of the Antillean-Caribbean Region. John Wiley & Sons, New York. Silva Taboada, G. 1979. Los murcielagos de Cuba. Editorial Academia, Habana. Tamsitt, J. R. and I. Fox. 1970. Records of bat ectoparasites from the Caribbean region (Siphonaptera, Acarina, Diptera). Canadian Journal of Zoology 48:1093–1097. Uilemberg, G., H. Hoogstraal, and J. H. Klein. 1979. Les tiques (Ixodoidea) de Madagascar et leur rôle vecteur. Archives de l’Institut Pasteur Madagascar, Special Number:1–153. Vargas, M. M. 1984. Ocurrence of the bat tick Ornithodoros (Alectorobius) kelleyi Cooley & Kohls (Acarina: Argasidae) in Costa Rica and its relation to human bites. Revista de biologia tropical 32(1):103–107. Wilson, N. and N. W. Kale. 1972. Ticks collected from Indian River County, Florida (Acarina: Metastigmata: Ixodidae). Florida Entomologist 55(1):53–58. Woods, C. A. 1989. The biogeography of West Indian rodents. Pp. 741–798 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Woods, C. A. and J. F. Eisenberg. 1989. The land mammals of Madagascar and the Greater Antilles: comparison and analysis. Pp. 799–826 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida.

Contribution of the 8 The Caribbean to the Spider Fauna of Florida Jonathan Reiskind Abstract — Since most, if not all, the spider species of the Florida peninsula are relatively recent arrivals, either because the land had been fully submerged at some time during the Pleistocene or because that islands’ areas in the Florida archipelago during interglacial periods were small and local extinctions of the fauna were likely, an analysis of present-day distributions permits determination of the sources of the spider fauna. Dispersal during the Pleistocene played the dominant role in the origin of the peninsular Florida fauna. Climatic constraints to present distributions offer additional clues to origins. By using explicit criteria, most species can be placed in one of four origin groups: northern (far and near), western, southern (Caribbean), and autochthonous (originating on the islands of the Florida “archipelago”). In addition some spiders are just “neotropical,” either arriving along the Gulf Coast or through the West Indies, and others are cosmopolitan with recent anthropogenic factors likely responsible. This combination of historic contingency and ecological limitations make the spider fauna of Florida both diverse and somewhat limited. The contribution of the Greater Antilles to the spider fauna of Florida is relatively small, amounting to less than 10%.

INTRODUCTION Much of the terrestrial fauna of peninsular Florida is assumed to be of relatively recent origin since a large portion of the peninsula was submerged during the interglacial periods of the Pleistocene, including all of Florida south of 27°N latitude. During this epoch central and northern regions of Florida had periodically reduced land areas and many coastal islands. Isolated habitat islands were also likely during the cyclical climatic changes of the Ice Age. Climatic conditions varied with conditions during glacial periods, such as those in the Wisconsinan only 70,000 years ago, noticeably cooler and more xeric than present (Webb, 1990). The recency (i.e., within the last 1 million years) of the terrestrial fauna, including spiders, allows the use of present distributions of the spider species with representatives in Florida to infer their origins. Granted, the Pleistocene, as brief as it was, was quite complex with great fluctuations of sea levels as well as climatic conditions. The feasibility of such determinations is examined in this study and some rough estimates of origins made. Of course, only the presence of a species can be definitively demonstrated; its absence is only tentative. Thus all the data depend on the extensiveness and completeness of the survey of the spider fauna.

METHODS The most recent taxonomic revisions of genera and higher taxa were used for this study. The distributions of over 450 species occurring in peninsular Florida have been reviewed (from over 90 papers) and designated as found in one or more of five regions in Florida (Table 1). Then, using the regional designations in Table 1 and the criteria listed in Table 2, the probable source regions of each species were inferred. The farthest region in which a species is found was chosen as its putative source. For example, if a species is found in north and central Florida, the southeast United 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

107

108

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 Regions of Florida Regions

Geographical Position

Keys South Florida Central Florida North Florida Panhandle

Below 25°N 25° to 27°N 27° to 29°N 29° to Georgia border and east of Suwannee River West of Suwannee River

TABLE 2 Criteria of Source Regions Source Region

Criteria

Northern (far) (N+) Northern (near) (N–) Southern tropical (S) Western (W+) Western tropical (W–) Autochthony (A) Ambiguous Sources Neotropical (T) Nearctic (NW) Cosmopolitan (O) or Cosmotropical (OT) Disjunct distributions

Found north of 40°N and east of Mississippi River Found north of 31°N, but not north of 40°N South (Greater Antilles) (“the overwater route”) “Gulf coastal corridor” — west of Mississippi River in U.S. “Gulf coastal corridor” — Mexico (and Central America) Distribution restricted to peninsular Florida Both S and W– (i.e., Cuba vs. Mexico) N+ and W (+ and –) A widespread species, often anthropogenic factors contribute to its dispersal and distribution e.g., N and S

States and north into New England its source would be designated far northern (“N+”). If a species is found only in the Greater Antilles and south and central Florida, it would be designated “S” and its origin considered southern. But if it were to be found both in Mexico, along the Gulf Coast, and in Cuba its origin was considered ambiguously “tropical” (“T”). The distributions were recorded from revisionary studies of genera of four higher spider taxa (Table 3). The four higher taxa were chosen for study on the basis of the comprehensiveness of their taxonomic studies, the diversity of their ecological habits, and their high species diversity in peninsula Florida and adjacent regions. They are the Araneidae/Tetragnathidae (orb-weavers), Gnaphosidae (ground spiders), Lycosidae (wolf spiders), and Theridiidae (comb-foot or cob-web spiders).

RESULTS POTENTIAL SOURCES

OF THE

SPIDER FAUNA

Of course, all species of spiders or their immediate ancestors entered Florida either from the near north (the land route) or from the south (the overwater route). But within the Pleistocene epoch (about 1 million years) we might interpret the distributions of the fauna more broadly to reflect ultimate sources (Figures 1 and 2). Autochthony — New species arose in peninsular Florida and remain in place, i.e., autochthonous species. Of course they did not sprout from the brow of Zeus, but rather from ancestral or sister species that in turn came from elsewhere. Examination of their closest phylogenetic relatives will give a reasonable idea of their origins. For example, the sister group to the autochthonous Zelotes

The Contribution of the Caribbean to the Spider Fauna of Florida

109

TABLE 3 Citations of Revisions of the Florida Genera in the Four Taxa Used in the Survey Genus

Reference

Family Araneidae/Tetragnathidae Acacesia Levi (1976) Acanthepeira Levi (1976) Araneus Levi (1971a, 1973) Argiope Levi (1968) Azilia Levi (1980a) Cyclosa Levi (1977a) Dolichognatha Levi (1981) Eriophora Levi (1970) Eustala Levi (1977a) Gasteracantha Levi (1996) Gea Levi (1968) Glenognatha Levi (1980) Hyposinga Levi (1972) Kaira Levi (1977b, 1993) Larinia Levi (1975) Leucauge Levi (1980) Mangora Levi (1975) Mastophora Gertsch (1955) Mecynogea Levi (1980, 1997) Metapeira Levi (1977b) Metazygia Levi (1977a, 1995) Micrathena Levi (1985) Neoscona Berman and Levi (1971) Nephila Levi (1980) Nuctenea Levi (1974) Pachygnatha Levi (1980a) Scoloderus Levi (1976) Tetragnatha Levi (1981) Verrucosa Levi (1976) Wagneriana Levi (1976) Wixia Levi (1976)

Callilepis Cesonia Drassodes Drassyllus Eilica Gnaphosa Haplodrassus Herpyllus Litopyllus Micaria Nodocion Rachodrasssus Sergiolus Trachyzelotes Urozelotes Zelotes

Family Gnaphosidae Platnick (1975) Platnick and Shadab (1980b) Platnick and Shadab (1975b) Platnick and Shadab (1982) Platnick (1975b) Platnick and Shadab (1975c) Platnick and Shadab (1975a) Platnick and Shadab (1977) Platnick and Shadab (1980a) Platnick and Shadab (1988) Platnick and Shadab (1980a) Platnick and Shadab (1976) Platnick and Shadab (1981) Platnick and Murphy (1984) Platnick and Murphy (1984) Platnick and Shadab (1983)

Genus Arctosa Geolycosa Gladicosa Lycosa Pirata Trochosa Schizocosa Sossipus

Reference Family Lycosidae Dondale and Redner (1983) Wallace (1942a), McCrone (1963) Brady (1987) Wallace (1942b, 1947, 1950) Wallace and Exline (1978) Brady (1979) Dondale and Redner (1978) Brady (1962, 1972) Family Theridiidae

Anelosimus Agyrodes Achaearanea Chrysso Coleosoma Crustulina Dipoena Enoplognatha Episinus Euryopis Paidisca Latrodectus Paratheridula Pholcomma Phoroncidia Spintharus Steatoda Tekellina Theridion Theridula

Levi (1963e) Exline and Levi (1962) Levi (1963b) Levi (1962b) Levi (1959) Levi (1957b) Levi (1963a) Levi (1957a) Levi (1964a) Levi (1963a) Levi (1957a) McCrone and Levi (1964) Levi (1957c, 1966) Levi (1957c) Levi (1964b) Levi (1963d) Levi (1957b, 1962a) Levi (1957c) Levi (1957a, 1963c, 1980b) Levi (1966)

110

Biogeography of the West Indies: Patterns and Perspectives

50 Southern (S) Autochthonous (A) Near North (N-)

40

Far North (N+) Western Tropical (W-) Tropical (T)

Percentage of Species

30

20

10

0 Araneidae/Tetragnathidae

Gnaphosidae

Lycosidae

Theridiidae

FIGURE 1 Distributions and likely sources of species within four taxa using the criteria in Table 2.

ocala in central and north Florida, Z. duplex, has a far northern (N+) distribution (Platnick and Shadab, 1983). Unfortunately, most revisions do not yet identify the sister groups. Also, it is likely that some species designated near north (N–) represent species that have arisen in Florida and subsequently and recently dispersed north. Tropical sources — Spiders from the Neotropics could arrive either across water (from the Greater Antilles) or by a land route (from Mexico) along the Gulf Coast. By land — The Gulf coastal corridor is the land route from the Neotropics to Florida. This land passage had a significantly larger area during the glacial periods of the Pleistocene when the sea level was lower. It is the likely route taken by spiders is considered western tropical (W–) in origin. It is also the likely route for the majority of species classified as “tropical” (T), although finding a species in both Cuba and Mexico with continuous distribution along the Gulf Coast and in Florida presents an ambiguous situation. By sea — To arrive in Florida from the south (S) requires the ability to cross water because there was never a land connection to the Greater Antilles during this period. Spiders have that ability (via ballooning). Small but significant proportions of theridiids and araneids/ tetragnathids are southern in origin and likely arrived in this manner (see Figure 2). Temperate sources — Two continental boreal sources (W+ and N) are potential contributors to Florida’s fauna. All the spiders must have come through an area (N–) just north and west of the peninsula. Species found above 40°N latitude and not in the tropics can be considered to be northern (N) in origin. It is quite possible that the near northern area (N–) acted as a refuge for species at present distributed in the far northern (N+) areas. Nonetheless, a far northern present distribution still reflects a historic event involving a species from the north tolerant of cold climes. Few spiders show western origins. Ambiguous and other sources — Several species can be considered cosmopolitan or cosmotropical in distribution (e.g., Latrodectus geometricus, the brown widow) and often have anthropogenic factors responsible for their wide distribution. Florida species also found only in the near north (N–) are considered to have ambiguous origins as well. Few of the species examined had truly disjunct distributions (e.g., N and S). All these spiders were excluded from these analyses.

The Contribution of the Caribbean to the Spider Fauna of Florida

111

60 Tropical (S, W-, T) Temperate (N+ & W+)

50

40

Percentage of Species 30

20

10

0 Araneidae/Tetragnathidae

Gnaphosidae

Lycosidae

Theridiidae

FIGURE 2 Tropical vs. temperate sources of species within four taxa. Percentages may not add up to 100% as autochthonous species (A) and those from near north (N–) are excluded.

80 Warm (N-, W-, S, T, A) Cold (N+, W+, O, NW) 60

Percentage of Species

40

20

0 Araneidae/Tetragnathidae

Gnaphosidae

Lycosidae

Theridiidae

FIGURE 3 Climatic tolerances of species within four taxa found in tropical or moderate environments vs. colder climates.

CLIMATIC CONSTRAINTS The distribution of species is often limited by climatic constraints (Figure 3). A species may have the opportunity to disperse into an area but it may be physiologically constrained by the environmental temperature. Many can and do adapt quickly to these new conditions; others may not. Again, thanks to the recency of the fauna we may more easily detect those constraints before adaptations obscure them.

112

Biogeography of the West Indies: Patterns and Perspectives

Inability to tolerate cold restricts some to tropical and subtropical climates (species designated N–, W–, S, T, A) while others seem able to live in cooler climates (N+, W+, O, NW). Species intolerant of warm climates would not be found in Florida at all. In Figure 3, “warm” refers to those species found only in moderate to tropical areas while “cold” refers to those whose distributions include far northern regions.

SEVERAL HIGHER TAXA The species of the four higher taxa were analyzed with respect to their origins (Figures 1 and 2) and possible climatic constraints (Figure 3). Araneidae/Tetragnathidae (67 Floridian species) (Table 3) — Species are about equally “tolerant” of tropical and temperate climes (Figure 3) and their origins reflect this as well (Figure 2). Approximately 10% are clearly Caribbean in origin, reflecting their aerial dispersal abilities. Gnaphosidae (35 Floridian species) (Table 3) — Most species are of boreal origin with over half having clear temperate origins. Almost one half of the species are found north of 40°N and one fifth of the Florida fauna is autochthonous, reflecting their sedentary habits. It is not surprising that the distributions of many species show tolerance of a cooler climate. Lycosidae (42 Floridian species) (Table 3) — This family shows an even higher degree of autochthony (48%). Speciation in Florida could be still higher considering that 24% of the species show near north associations and may have arisen in Florida and spread north (Figure 1). While the Florida lycosid species appear intolerant of colder climates (Figure 3) that does not mean they have tropical origins (see Figure 2). This may just reflect characteristics of those species that have arisen in Florida recently. Theridiidae (74 Floridian species) (Table 3) — A predominantly tropical family (45% show clear tropical origins), their widespread dispersal abilities have obscured the origin of those “tropical” elements with over 70% of the species unable to be assigned a southern (Caribbean) vs. tropical western (Mexican) origin, although most are likely to have come via the land route through the Gulf coastal corridor.

DISCUSSION AND CONCLUSIONS The use of present distributions to ascertain the origin of the spider fauna of Florida allows a rough estimate of sources. Although of geologically recent origin, there has still been ample time for complex patterns to result from dispersal of extant species and speciation events with subsequent dispersal. In some cases the origins are quite clear, e.g., where a spider is widespread throughout eastern North America and found in north and central Florida (northern origin), or in cases of narrow distributions restricted to the Florida peninsula (autochthony) as in the case of Hogna ericeticola (the rosemary wolf spider), with a range of only 3000 ha in a distinctive habitat (Reiskind, 1987, 1996). But in most cases confidently ascribing sources of the fauna is at best an educated guess with severe limitations. The climatic tolerance of a species adds a constraint to dispersal opportunities, likely limiting the present-day distributions of several Florida species. Of course, there are many other factors: competition, other ecological constraints, etc. The generalizations on the distribution and potential sources of the four taxa examined merely reflect the obvious adaptations and historic distributions of those groups. Although the conclusions are limited by our knowledge of the distribution of the groups studied, I think it unlikely that common species in these well-studied groups would have been overlooked. Thus, to answer the original question: Can the origins of the spider fauna of peninsular Florida be determined using present distributions? Not easily in most cases and then only on a species-by-species basis, at best. The Caribbean (i.e., Greater Antilles) as a source is easier to estimate. Its contribution to the spiders of Florida, even southern Florida, is relative small, making up less than 10% of the theridiid and araneid/tetragnathid fauna. The picture could be significantly clarified if we had additional

The Contribution of the Caribbean to the Spider Fauna of Florida

113

collections throughout Florida and throughout North America and the Caribbean, more phenological studies of each of the Florida species, and studies of the phylogenetic relationships, especially of the autochthonous species.

LITERATURE CITED Berman, J. D. and H. W. Levi. 1971. The orbweaver genus Neoscona in North America. Bulletin of the Museum of Comparative Zoology 141(8):465–500. Brady, A. 1962. The spider genus Sossipus in North America, Mexico and Central America. Psyche 69(3):129–164. Brady, A. 1972. Geographic variation and speciation in the Sossipus floridana species group. Psyche 79(1–2):27–48. Brady, A. 1979. Nearctic species of the wolf spider genus Trochosa. Psyche 86(2–3):167–212. Brady, A. 1987. Nearctic species of the new wolf spider genus Gladicosa. Psyche 93:285–319. Dondale, C. D. and J. H. Redner. 1978. Revision of the Nearctic wolf-spider genus Schizocosa. Canadian Entomologist 110:143–181. Dondale, C. D. and J. H. Redner. 1983. Revision of the wolf spiders of the genus Arctosa in North and Central America. Journal of Arachnology 11(1):1–30. Exline, H. and H. W. Levi. 1962. American spiders of the genus Argyrodes. Bulletin of the Museum of Comparative Zoology 127(2):75–204. Gertsch, W. 1955. The North American bola spiders of the genera Mastophora and Agatostichus. Bulletin of the American Museum of Natural History 106(4):225–254. Levi, H. W. 1957a. The spider genera Enoplognatha, Theridion, and Paidisca in America north of Mexico. Bulletin of the American Museum of Natural History 112(1):1–124. Levi, H. W. 1957b. The spider genera Crustulina and Steatoda in North America, Central America and the West Indies. Bulletin of the Museum of Comparative Zoology 117(3):367–424. Levi, H. W. 1957c. The North American genera Paratheridula, Tekellina, Pholcomma and Archerius. Transactions American Microscopical Society 76(2):105–115. Levi, H. W. 1959. The spider genus Coleosoma. Breviora 110:1–10. Levi, H. W. 1962a. The spider genera Steatoda and Enoplognatha in America. Psyche 69(1):11–36. Levi, H. W. 1962b. More American spiders of the genus Chrysso. Psyche 69(4):209–237. Levi, H. W. 1963a. American spiders of the genera Audifia, Euryopis and Dipoena. Bulletin of the Museum of Comparative Zoology 129(2):121–186. Levi, H. W. 1963b. American spiders of the genus Arachaearanea and the new genus Echinotheridion. Bulletin of the Museum of Comparative Zoology 129(3):187–240. Levi, H. W. 1963c. American spiders of the genus Theridion. Bulletin of the Museum of Comparative Zoology 129(10):481–589. Levi, H. W. 1963d. The American spider genera Spintharus and Thwaitesia. Psyche 70(4):223–234. Levi, H. W. 1963e. The American spiders of the genus Anelosimus. Transactions of the American Microscopical Society 82(1):30–48. Levi, H. W. 1964a. American spiders of the genus Episinus. Bulletin of the Museum of Comparative Zoology 131(1):1–25. Levi, H. W. 1964b. American spiders of the genus Phoroncidia. Bulletin of the Museum of Comparative Zoology 131(3):65–86. Levi, H. W. 1966. American spiders of the genera Theridula and Paratheridula. Psyche 73(2):123–130. Levi, H. W. 1968. The spider genera Gea and Argiope in America. Bulletin of the Museum of Comparative Zoology 136(9):319–352. Levi, H. W. 1970. The ravilla group of the orbweaver genus Eriophora in North America. Psyche 77(3):280–302. Levi, H. W. 1971. The diadematus group of the orb-weaver genus Araneus north of Mexico. Bulletin of the Museum of Comparative Zoology 141(4):131–179. Levi, H. W. 1972. The orb-weaver genera Singa and Hypsosinga in America. Psyche 78(4):229–256. Levi, H. W. 1973. Small orb-weavers of the genus Araneus north of Mexico. Bulletin of the Museum of Comparative Zoology 145(9):473–552. Levi, H. W. 1974. The orb-weaver genera Araniella and Nuctenea. Bulletin of the Museum of Comparative Zoology 146(6):291–316.

114

Biogeography of the West Indies: Patterns and Perspectives

Levi, H. W. 1975. The American orbweaver genera Larinia, Cercidia, and Mangora north of Mexico. Bulletin of the Museum of Comparative Zoology 147(3):101–135. Levi, H. W. 1976. The orb-weaving genera Verrucosa, Acanthepeira, Wagneriana, Acacesia, Wixia, Scoloderus and Alpaida north of Mexico. Bulletin of the Museum of Comparative Zoology 147(8):351–398. Levi, H. W. 1977a. The American orb-weaver genera Cyclosa, Metazygia and Eustala north of Mexico. Bulletin of the Museum of Comparative Zoology 148(3):61–127. Levi, H. W. 1977b. The orb-weaver genera Metepeira, Kaira and Aculepeira in America north of Mexico. Bulletin of the Museum of Comparative Zoology 148(5):185–238. Levi, H. W. 1980a. The orb-weaver genus Mecynogea, the subfamily Metinae and the genera Pachygnatha, Glenognatha and Azilia of the subfamily Tetragnathinae north of Mexico. Bulletin of the Museum of Comparative Zoology 149(1):1–74. Levi, H. W. 1980b. Two new species of the genera Theridion and Achaearanea from North America. Transactions of the American Microscopical Society 99(3):334–337. Levi, H. W. 1981. The American orb-weaver genera Dolichognatha and Tetragnatha north of Mexico. Bulletin of the Museum of Comparative Zoology 149(5):271–318. Levi, H. W. 1985. The spiny orb-weaver genera Micrathena and Chaetacis. Bulletin of the Museum of Comparative Zoology 150(8):429–618. Levi, H. W. 1993. American Neoscona and corrections to previous revisions of Neotropical orb-weavers. Psyche 99(2–3):221–239. Levi, H. W. 1993. The orb-weaver genus Kaira. Journal of Arachnology 21:209–225. Levi, H. W. 1995. The Neotropical orb-weaver genus Metazygia. Bulletin of the Museum of Comparative Zoology 154(2):63–151. Levi, H. W. 1996. The American orb weavers of the genus Gasteracantha. Bulletin of the Museum of Comparative Zoology 155(3):89–157. Levi, H. W. 1997. The American orb weavers of the genera Mecynogea, Manogea, Kapogea and Cyrtophora. Bulletin of the Museum of Comparative Zoology 155(5):215–255. McCrone, J. 1963. Taxonomic status and evolutionary history of the Geolycosa pikei complex in the southeastern United States. American Midland Naturalist 70(1):47–73. McCrone, J. and H. W. Levi. 1964. North America widow spiders of the Latrodectus curacaviensis group. Psyche 71(1):12–27. Platnick, N. 1975a. A revision of the Holarctic spider genus Callilepis. American Museum Novitates 2573:1–32. Platnick, N. 1975b. A revision of the spider genus Eilica. American Museum Novitates 2578:1–19. Platnick, N. and J. Murphy. 1984. A revision of the spider genera Trachyzelotes and Urozelotes. American Museum Novitates 2792:1–33. Platnick, N. and M. U. Shadab. 1975a. A revision of the spider genera Haplodrassus and Orodrassus in North America. American Museum Novitates 2583:1–40. Platnick, N. and M. U. Shadab. 1975b. A revision of the spider genera Drassodes and Tivodrassus in America. American Museum Novitates 2593:1–29. Platnick, N. and M. U. Shadab. 1975c. A revision of the spider genus Gnaphosa in America. Bulletin of the American Museum of Natural History 155(1):1–66. Platnick, N. and M. U. Shadab. 1976. A revision of the spider genera Rachodrassus, Sosticus and Scopodes in North America. American Museum Novitates 2594:1–33. Platnick, N. and M. U. Shadab. 1977. A revision of the spider genera Herpyllus and Scotophaeus in North America. Bulletin of the American Museum of Natural History 159(1):1–44. Platnick, N. and M. U. Shadab. 1980a. A revision of the North American spider genera Nodocion, Litopyllus, and Synaphosus. American Museum Novitates 2691:1–26. Platnick, N. and M. U. Shadab. 1980b. A revision of the spider genus Cesonia. Bulletin of the American Museum of Natural History 165(4):335–386. Platnick, N. and M. U. Shadab. 1981. A revision of the spider genus Sergiolus. American Museum Novitates 2717:1–41. Platnick, N. and M. U. Shadab 1982. A revision of the American spiders of the genus Drassyllus. Bulletin of the American Museum of Natural History 173(1):1–97. Platnick, N. and M. U. Shadab. 1983. A revision of the American spiders of the genus Zelotes. Bulletin of the American Museum of Natural History 174(2):97–192.

The Contribution of the Caribbean to the Spider Fauna of Florida

115

Platnick, N. and M. U. Shadab. 1988. A revision of the American spiders of the genus Micaria. American Museum Novitates 2916:1–64. Reiskind, J. 1987. Status of the Rosemary Wolf Spider in Florida. Technical Report No. 28. Cooperative Fish and Wildlife Research Unit:1–13. Reiskind, J. and P. Cushing. 1996. A morphological study of a narrow hybrid zone between two wolf spiders, Lycosa ammophila and Lycosa ericeticola in north Florida. Revue Suisse de Zoologie, volume hors series:543–554. Wallace, H. K. 1942a. A revision of the burrowing spiders of the genus Geolycosa. American Midland Naturalist 27(1):1–62. Wallace, H. K. 1942b. A study of the lenta group of the genus Lycosa, with descriptions of new species. American Museum Novitates 1185:1–21. Wallace, H. K. 1947. A new wolf spider from Florida, with notes on other species. Florida Entomologist 30(3):33–38. Wallace, H. K. 1950. On Tullgren’s Florida spiders. Florida Entomologist 33(2):71–83. Wallace, H. K. and H. Exline. 1978. Spiders of the genus Pirata in North America, Central America and the West Indies. Journal of Arachnology 5:1–112. Webb, S. D. 1990. Historical biogeography. Pp. 70–100 in Myers, R. L. and J. J. Ewel (eds.). Ecosystems of Florida. University of Central Florida Press, Orlando.

Beetles 9 Rhysodine in the West Indies Ross T. Bell Abstract — The rhysodine beetles (Carabidae) are well represented in the West Indies by 17 species. They are of zoogeographical interest because of their natural history. The strategies for the separate invasions from North and South America are documented with fossil evidence. Relationships of the West Indian genera and interpretation to their distribution are discussed. Rafting seems to be the means of travel of these insects.

INTRODUCTION The Rhysodini comprise a group of over 300 species of highly modified ground beetles (Carabidae). They are of interest in zoogeography because the way of life of these beetles gives them an excellent chance of rafting across water barriers, while their chances of spreading by other means are unusually limited. The group is well represented in the West Indies, and there is evidence of at least four, and possibly six, separate invasions. Rhysodines are long, narrow beetles between 4 and 10 mm long. They appear red-brown in bright light and piceous to black in dimmer light; color is no help in separating the species. The antennae are relatively short for Carabidae, but moniliform (like chains of beads). A large hollow space within the head is connected to the exterior by a system of grooves, which divide the dorsal surface of the head into several lobes. The mentum, or lower lip, projects so far forward that it is visible in dorsal view, and entirely conceals the mandibles in ventral view. There is a ball-like “neck” or condyle between the head and the prothorax. The males have “calcars,” anteriorly directed processes at the apex of the hind, and usually also the middle tibiae, which make it easy to separate the sexes. Both larvae and adults are found within dead wood. The larvae live in short tunnels that are backfilled with wood chips, but the adults do not tunnel. An unusually thick exoskeleton and hyperdeveloped muscles enable them to force themselves into the wood, evidently by compressing the wood cells. The wood must be moist, but it can be surprisingly sound. It is amazing to see one of these beetles disappear into the wood without leaving a visible trace of its passage. Collecting rhysodines is very laborious and difficult, involving the use of saws, wedges, crowbars, and axes. The beetles can be deep within largely sound logs, in the centers of stumps, deep underground in large roots, or in small soft areas in large branches high in trees. Some species are encountered beneath bark on occasion, the basis for the inappropriate common name “wrinkled bark beetles.” If a single beetle is encountered, it usually pays to make a careful dissection of the log or root in which it is found, as rhysodines seem to be colonial, with up to 50 individuals sometimes found together. The larvae are often found in the vicinity of the adults. The soft-bodied larva lives in a short tunnel, which it fills in behind itself with wood chips. Sometimes more than one species of adult are found in a single log, and larvae may not be conspecific with adults found near them. Rhysodini adults have been seen to feed on slime molds (myxomycetes), using highly modified mouthparts (Bell, 1994), and attack the plasmodium stage within the wood. They are limited to forest regions where there is enough rainfall to permit the decay of wood and the growth of slime mold. In the tropics, they seem largely restricted to rain forests, and they are absent from areas with a pronounced dry season. In the temperate zones, they are less limited.

0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

117

118

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 New World Rhysodine Fauna

Genera Plesioglymmius (Ameroglymmius) Omoglymmius (Boreoglymmius) Clinidium (Arctoclinidium) Clinidium (Mexiclinidium) Clinidium (Protainoa) Clinidium (Tainoa) Clinidium (s. str.) Rhyzodiastes (s. str.) Rhyzodiastes (Rhyzostrix) Neodhysores

North America

Central America

West Indies

North Andes

South America South of the Amazon

– + + + – – – – – –

– – – + – – + – – –

+ – – – + + + – – –

+ – – – – – + – – –

+ – – – – – – + + +

DISPERSAL MECHANISMS Walking is one possible dispersal mechanism. It can be quite effective, as is shown by such carabid groups as genus Carabus and Tribe Cychrini. However, records for Rhysodini walking at a distance from logs are about as rare as flight records for fully winged species, being limited to a few pitfall captures. Walking abilities seem to be limited to moving from one log or stump to another nearby one in the same patch of forest. Examination of a live rhysodine shows just how inefficient is its walking ability. Unlike other carabids, a rhysodine cannot run or even walk moderately fast. The animal seems to have only a single ponderous, “low gear” gait. In addition, when the animal is away from wood, it is poorly balanced, and it frequently capsizes. Poor walking ability helps to account for the great number of species in the Andean region, for example, and subsequently their small ranges. Isolated areas of forest on continents are islands as far as rhysodines are concerned. Indeed, islands of forest that are not connected by rivers may be harder to reach than true islands for flightless species. There is a dramatic illustration of this in South America (Table 1, Figure 1). There are two distinct South American faunas, with only the winged genus Plesioglymmius present in both. The Andean region, from Ecuador to central Venezuela, has genus Clinidium, subgenus Clinidium, shared with Central America and the West Indies, a member of a Laurasian (Northern Hemisphere) genus, while eastern Brazil and northern Argentina have Rhyzodiastes, subgenera Rhyzodiastes s. str. and Rhyzostrix, members of a Gondwanian (Southern Hemisphere) genus (Figure 2). The two faunas meet along the Amazon River. Both genera occur on both banks, where rafting can carry them from one side to the other, but there are no records of Rhyzostrix north, away from the river, or records of Clinidium south from it. This presumably reflects the fact that logs do not raft upstream and that rhysodines spread very slowly without the help of rafting. Another common dispersal method for insects is flight. Over half the species of rhysodines have fully developed hind wings, and presumably can fly, but there are extremely few records of them flying or appearing at light traps. Such records as there are have been entirely within the forests in which the beetles live. The extremely thick, heavy exoskeleton must make them very slow, weak fliers. I suspect that flight is probably used mainly to reach dead wood in high trees. In the Southwest Pacific region, where there are many insular rhysodines, the fully winged taxa have not done better than vestigial winged taxa at reaching islands (the latter group belong to old, long flightless taxa, so the beetles could not have lost their wings after reaching the islands). In the West Indies all species except one belong to the totally flightless genus Clinidium. The exception

Rhysodine Beetles in the West Indies

119

FIGURE 1 Distribution of genera of Rhysodini in the Neotropical region.

FIGURE 2 Habitus, dorsal aspect: (A) Clinidium (Protainoa) extrarium B&B; (B) Clinidium (Tainoa) curvicosta Chev.; (C) Clinidium (s. str.) guildingii Kirby; (D) Plesioglymmius (Ameroglymmius) compactus B&B.

120

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 West Indian Species (by Islands) Species

Island

Subtribe: Omoglymmius Plesioglymmius (Ameroglymmius) compactus B&B Subtribe: Clinidiina Clinidium (Protainoa) extrarium B&B C. (Tainoa) curvicosta Chevrolat C. (Tainoa) chevrolati Reitter C. (Tainoa) xenopodium Bell C. (Tainoa) darlingtoni Bell C. (s. str.) incudis Bell C. (s. str.) planum Chevrolat C. (s. str.) smithsonianum B&B C. (s. str.) microfossatum B&B C. (s. str.) guildingii Kirby C. (s. str.) haitiense Bell C. (s. str.) corbis Bell C. (s. str.) jamaicense Arrow C. (s. str.) chiolino Bell C. (s. str.) trionyx Bell C. (s. str.) boroquense B&B

90º

80º

Eastern Cuba Western Cuba Eastern Cuba Eastern Cuba Central Dominican Republic Jamaica Puerto Rico Guadeloupe Dominica Martinique St. Vincent Haiti (South, mountains) Hispaniola (South and North) Jamaica (mountains) Jamaica Dominican Republic Puerto Rico

70º

Protainoa Tainoa Cl. s. str. jamaicense complex Cl. s. str. others Plesioglymmius Cl. s. str. guildingi group

20º

10º

200 Km 200 Mi.

80º

70º

60º

FIGURE 3 Distribution of Rhysodini in the West Indies.

is P. compactus, which is found on only one island, Cuba. All flightless species have reduced and highly modified eyes. Rafting within floating logs seems to be the one remaining possible means of long-distance transport. A floating log would seem to be an effective colonizing mechanism with a population

Rhysodine Beetles in the West Indies

121

of several to many rhysodines together with their slime mold food source. All West Indian rhysodines except one species belong to the subtribe Clinidiina, and to the genus Clinidium Kirby. This genus and its sister genus Rhyzodiastes have the hind wings reduced to minute vestiges, and have evidently been flightless for tens of millions of years. A third genus, Grouvellina Bell & Bell, is fully winged and no doubt flies, but it is confined to Madagascar. Rafting seems to be the only possible means for Clinidium to reach the West Indies. The rhysodine fauna of the West Indies was first monographed by Bell (1970). Bell and Bell (1978, 1979, 1982, 1985) treated the group on a world basis. Bell and Bell (1995) treated the Cuban fauna. Other papers of zoogeographical interest cover Australia (Bell and Bell, 1991) and Micronesia (Bell and Bell, 1981). Table 2 shows the 17 species of rhysodines found in the West Indies. Figure 1 shows representatives of the genera and subgenera of West Indian rhysodines, and Figure 3 shows their distributions.

RELATIONSHIPS OF WEST INDIAN GENERA WITHIN THE WORLD FAUNA Two of the seven subtribes of Rhysodini are present in the West Indies. Subtribe Omoglymmiina, with seven genera, is nearly worldwide in distribution, but is absent from Madagascar, New Zealand, and most of Africa and Australia. Genus Plesioglymmius B&B has three subgenera, two in and near Indonesia, and the third in South America, in Brazil and Venezuela. Subgenus Ameroglymmius has three species, one in eastern and southern Brazil, one in Amazonia and the Orinoco region, and the third in Cuba. Subtribe Clinidiina, with three genera, is also nearly worldwide, but is absent from Africa although represented by 15 species in Madagascar. Genus Grouvellina Bell & Bell is restricted to Madagascar. Genus Rhyzodiastes Fairmaire has a Gondwanian distribution from eastern and southern South America, Australia, New Zealand, Indonesia, and Indo China. Genus Clinidium is a Laurasian genus from North America, Japan, Europe, Central America, the West Indies, and the Andean region of South America. All species are vestigial-winged. The genus includes five subgenera, one in the United States and southern Europe, one in Mexico and Guatemala, two endemic in the West Indies, and one in Andean South America, Central America, and the West Indies. Subgenus Protainoa B&B has one species in western Cuba. Subgenus Tainoa Bell has five species in the Greater Antilles. Subgenus Clinidium s. str. has over 50 species in Andean South America, Greater and Lesser Antilles, and Central America from Guatemala south. Of the six species groups, two are present in the West Indies. Beccarii Group. Three species in Central America, Guatemala to Panama; two additional species with dubious locality labels; an unnamed fossil species from Hispaniola (see below, Fossil Evidence); C. incudis Bell of Puerto Rico (formerly placed in the Granatense Group). Guildingii Group. Many species from Andean South America, lower Central America (north to Costa Rica), and the West Indies. Divided into four or five sections, of which two reach the West Indies. Oberthueri Section. Six species. Greater Antilles except Cuba. Guildingii Section. Four species. Lesser Antilles.

122

Biogeography of the West Indies: Patterns and Perspectives

FOSSIL EVIDENCE Recently, through the courtesy of Dr. George Poinar, I was able to study two rhysodines in amber from the Dominican Republic, both males, and probably conspecific. The age of Dominican amber is estimated to be between 15 and 45 million years (Poinar, 1999). They are in Clinidium s. str., and appear to belong to the beccarii species group, with which they agree in having the anterior pronotal pit greatly enlarged, but without a central tubercle, and in having a long, acute antennal stylet. Two other features of the group are not visible, however: these would be the loss of the minor setal tufts on antennomeres V and VI, and the modified compound eyes, which are bilobed or divided into anterior and posterior units. Within the beccarii group, the amber species most resembles C. moldenkei Bell & Bell and C. sulcigaster Bell, both Central American species. As currently defined, the beccarii group is restricted to Central America (Guatemala to Panama), and is not known from the West Indies. However, C. incudis Bell of Puerto Rico, currently listed in the granatense group, probably belongs here. It has minor setae tufts on antennomeres VII–X. Such tufts were absent in all members of the beccarii group until the recent discovery of C. gilloglyi Bell & Bell, in which the tufts are located exactly as in C. incudis. The latter species also has a single ocelliform eye on each side, rather than the two seen in most members of the beccarii group. Clinidium incudis could have secondarily suppressed the development of the posterior ocelliform unit. Thus the fossil species and C. incudis could be related. This leaves open the question of whether or not their ancestors separated after reaching the Antilles. I am deferring naming the fossil form in hopes that more specimens will turn up, particularly one that will allow study of the eye structure.

INTERPRETATIONS OF WEST INDIAN DISTRIBUTIONS Interpreting the distribution of island faunas makes it necessary to estimate the probabilities of organisms reaching islands by various means of dispersal. Among Carabidae as a whole, flight, passive aerial transport, and rafting are all possible means of travel, but it is difficult to sort out which means were used in particular cases. With rhysodines the situation is more clear-cut, and rafting seems the only likely method. Relationships of West Indian rhysodines to mainland (Central and South America) species are listed in Table 3. Genus Plesioglymmius (Ameroglymmius) compactus. The restriction of this species to Cuba is enigmatic (Bell, 1995). On the mainland, Ameroglymmius is unknown either in Central America or in the Andean region, and the nearest record is from Suriname (Bell and Bell, 2000).

TABLE 3 Closest Mainland Taxa to West Indian Rhysodines West Indian Taxa Subtribe: Omoglymniina Plesioglymmius compactus Subtribe: Clinidiina Protainoa and Tainoa Clinidium planum, guildingii, smithsonianum, microfossatum C. incudis C. boroquense C. trionyx C. jamaicense complex

Related Mainland Taxa P. reichardti; Amazonia, Guyana, Venezuela Clinidium (Mexiclinidium); Mexico, Guatemala, 9 spp. C. rojasi and 3 related spp.; easternmost Andes of Venezuela C. moldenkei and C. sulcigaster; Guatemala to Panama C. oberthueri; Ecuador C. whiteheadi or C. alleni; Panama or C. jolyi or C. pilosum; western Venezuela C. oberthueri; Ecuador

Rhysodine Beetles in the West Indies

123

Genus Clinidium. This is a Northern Hemisphere genus, and the three subgenera found in the West Indies must ultimately be of North American origin. Subgenus Protainoa — C. extrarium, the only species, is an extraordinary relict, surviving in a minute area of suitable habitat in western Cuba, where no other rhysodines have been recorded. It may have evolved in place, and might date from before smaller islands assembled to make Cuba. Subgenus Tainoa — Endemic to the Greater Antilles, and the sister group to subgenus Protainoa. It probably originated on an island later incorporated into Cuba or Hispaniola. The absence of Tainoa from Puerto Rico is significant. The subgenus appears to have two sister groups, curvicosta–chevrolati and xenopodium–darlingtoni. The former is only in eastern Cuba, and the species appears to have separated relatively recently while the latter appears to have divided much earlier, with one species in Hispaniola and the other in Jamaica. Jamaica is believed to have been submerged for part of the Miocene, so the likely origin of C. darlingtoni is by rafting from Hispaniola to Jamaica in late Miocene or Pliocene. Subgenus Clinidium s. str. — Most closely related to Arctoclinidium of temperate North America, but separated geographically today by areas occupied by Mexiclinidium, Tainoa, and Protainoa. The point of origin is not obvious. South America has the most species, but the subgenus scarcely penetrates beyond the Andean region, and the folding of the Andes is fairly recent, especially in the east. Parts of Central America may be older, but the area is not favorably situated for rafting to the West Indies, which are predominantly upwind and upcurrent. Hurricanes, however, might transport logs contrary to the normal directions of winds and currents. A final possibility is origin in the islands with subsequent spread to areas that are now mainland. This will seem farfetched to workers on other groups. However, there is evidence of movements of Rhysodine groups from islands to the mainland in the area of Indonesia, while the restricted abilities of rhysodines to spread on continents do not appear to give any advantage to mainland species over insular ones. Clinidium (s. str.) beccarii Group. The fossil specimens cited above demonstrate that this group once inhabited Hispaniola. The living Puerto Rican species C. incudis Bell now appears to be a modified member of this group. It could have evolved from West Indian species also ancestral to the amber species, or the two could represent two separate invasions. It is also possible that the beccarii group ancestor evolved in the West Indies and later invaded Central America. Clinidium guildingii Group, guildingii Section. There are four very similar species in the Lesser Antilles, from Guadeloupe, Dominica, St. Vincent, and Martinique. They are obviously closely related to the rojasi Section, which is limited to coastal mountains of central and eastern Venezuela. The most likely scenario would be that the ancestor of the guildingii section was pushed northward in a hurricane to the islands. Clinidium guildingii Group, oberthueri Section. Many mainland species from western Venezuela to Ecuador and Costa Rica. Six species, Greater Antilles except for Cuba. (I formerly separated West Indian species as the “jamaicense section.” This no longer appears valid.) Four species form the closely related “jamaicense complex” of Jamaica and Hispaniola; two more isolated species are C. boroquense Bell of Puerto Rico and C. trionyx Bell & Bell of Hispaniola. Both appear related to oberthueri of Ecuador. If the section had a mainland origin, the Antillean species could represent one, two, or three invasions.

CONCLUSION Rhysodines have the potential to contribute insights into biogeographical studies because, unlike most other insects, they are restricted to rafting as a means of inter-island dispersal. Because of this, all West Indian rhysodine distributions can be explained by dispersal, and none needs to be attributed to vicariance. Rhysodine distributions reflect prevailing theories that the islands have been moving eastward relative to the American continents (Donnelly, 1988, 1989; Williams, 1989). West Indian rhysodines must have arrived over long intervals, as they differ from mainland forms in varying degrees, from two endemic subgenera to some species with similar, but distinct

124

Biogeography of the West Indies: Patterns and Perspectives

mainland relatives. In the most numerous group, Clinidium s. str., the situation is puzzling because the genus to which it belongs is a northern one, and the subgenus must have come from North America and is limited to the Andean region in South America. As the Andes, especially the northern part, is a relatively young mountain range, the Venezuela section may have a rhysodine fauna no older than the West Indian one, and thus be unable to serve as a source for the latter. The northern and northeastern Andes have many species of Clinidium s. str. and those mostly have very limited ranges, as though they may have differentiated and dispersed when the Andes were at least partly insular. An interesting point is the status of Puerto Rico, which lacks the two most speciose groups, Tainoa, and the Jamaicense complex of Clinidium s. str. This mirrors the situation in the more conventional Carabidae (Liebherr, 1988), where Puerto Rico lacks Platynus but has the relict genera Barylaus and Antilloscaris. Jamaica is known to have been completely inundated in the Miocene, yet it has a species of the subgenus Tainoa. This establishes the proposition that an ancestor rafted from Hispaniola since that time. It is also probable that the ancestor of the two Jamaican species of the Jamaicense complex of Clinidium s. str. moved in the same direction at a roughly similar time. More information will help establish a clearer picture in the future. Probably most of the West Indian species are already known, but there is one old species name “on the books” from Cuba, C. humeridens Chevrolat. We have been unable to locate the type specimen, and the original description is sufficient to show that the species is distinct from any currently known one, but is not sufficient to put it into the modern classification. There should also be relatives of C. guildingii on St. Lucia and Grenada. We badly need a more complete knowledge of the fauna of the Andean region, as well as Central America north of Costa Rica. At present, no rhysodines are known from Nicaragua, Salvador, Honduras, or Belize. Of course, more fossils and more definite information from geologists will also help.

LITERATURE CITED Bell, R. T. 1970. The Rhysodini of North America, Central America, and the West Indies. Miscellaneous Publications of the Entomological Society of America 6(6):289–324. Bell, R. T. 1994. Beetles that cannot bite; functional morphology of the head of adult rhysodines (Coleoptera: Carabidae or Rhysodidae). The Canadian Entomologist 126:667–672. Bell, R. T. and J. R. Bell. 1978. Rhysodini of the world. Part I. A new classification of the tribe, and a synopsis of Omoglymmius subgenus Nitiglymmius new subgenus (Coleoptera: Carabidae or Rhysodidae). Quaestiones Entomologicae 14(1):43–48. Bell, R. T. and J. R. Bell. 1979. Rhysodini of the world. Part II. Revisions of the smaller genera (Coleoptera: Carabidae or Rhysodidae). Quaestiones Entomologicae 15(4):377–446. Bell, R. T. and J. R. Bell. 1981. Insects of Micronesia. Coleoptera: Rhysodidae. B. P. Bishop Museum, Honolulu 15(2):51–67. Bell, R. T. and J. R. Bell. 1982. Rhysodini of the world. Part III. Revisions of Omoglymmius Ganglbauer (Coleoptera: Carabidae or Rhysodidae) and substitutions for preoccupied generic names. Quaestiones Entomologicae 18(1–4):127–259. Bell, R. T. and J. R. Bell. 1985. Rhysodini of the world. Part IV. Revisions of Rhyzodiastes Fairmaire and Clinidium Kirby, with new species in other genera (Coleoptera: Carabidae or Rhysodidae). Quaestiones Entomologicae 21:1–172. Bell, R. T. and J. R. Bell. 1991. The Rhysodini of Australia (Insecta: Coleoptera: Carabidae or Rhysodidae). Annals of Carnegie Museum 60:179–210. Bell, R. T. and J. R. Bell. 1995. The Rhysodini (Insecta: Coleoptera: Carabidae) of Cuba. Annals of Carnegie Museum 64(3):185–195. Bell, R. T. and J. R. Bell. 2000. Rhysodine beetles (Insecta: Coleoptera: Carabidae): New species, new data II. Annals of Carnegie Museum 69(2):69–91. Donnelly, T. W. 1988. Geologic constraints of Caribbean biogeography. Pp. 15–37 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Cornell University Press, Ithaca, New York.

Rhysodine Beetles in the West Indies

125

Donnelly, T. W. 1989. History of marine barriers and terrestrial connections; Caribbean paleogeographic inference from pelagic sediment analysis. Pp. 103–117 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Liebherr, J. K. 1988. Biogeographic patterns of West Indian Platynus carabid beetles. Pp. 121–152 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Cornell University Press, Ithaca, New York. Poinar, G. O. and R. Poinar. 1999. The Amber Forest: A Reconstruction of a Vanished World. Princeton University Press, Princeton, New Jersey. Williams, E. E. 1989. Old problems and new opportunities in West Indian biogeography. Pp. 1–46 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida.

Biogeography 10 The of the West Indian Butterflies (Lepidoptera): An Application of a Vicariance/Dispersalist Model Jacqueline Y. Miller and Lee D. Miller Abstract — Previous biogeographical theories and models for West Indian butterfly biogeography are reviewed. The age of butterflies, endemism of the West Indian species, and their propensities for, or possible impediments with, dispersal are discussed. A combination vicariance/dispersal model for the evolution of the Antillean butterfly fauna originally proposed in 1989 is reviewed and updated within the general constraints of current geological evidence. Additional supportive documentation for biodiversity of butterflies in the Caribbean, and particularly for the geological history of Jamaica, the southern Hispaniolan block, the Bahama Islands, and the Lesser Antilles, is also presented.

INTRODUCTION Early biogeographical hypotheses were based on the belief that landmasses and seafloors have long been in their present positions. Wallace (1876), Matthew (1915), Simpson (1952), and Darlington (1957, 1965) provide arguments for this interpretation in detail. Accordingly, organisms were distributed on these landmasses or oceans by the action of random dispersal through time. Still other biogeographers have felt it necessary to construct land bridges to distribute faunal and floral elements that could not be easily explained by other means (Schuchert, 1935). Others were not so certain. The paleogeographical reconstructions of Wegener (1915) and du Toit (1927, 1937), which utilized movable landmasses and seafloors, spurred the interest of a number of geologists (Carey, 1958; Wilson, 1963) and biologists (Cain, 1944; Croizat, 1958; Cracraft, 1973; Raven and Axelrod, 1974; Shields and Dvorak, 1979). Croizat’s significant contribution during the 1950s and later was the realization that entire biotas evolved and might be distributed in patterns that were not necessarily as random as had been assumed previously. Croizat postulated “tracks” along which entire biotas could be shown to have moved and evolved. By carefully plotting the ranges of diverse organisms, Croizat determined that some of these tracks showed frequent congruent distribution patterns in such diverse groups as insects, trees, freshwater fish, and reptiles. Certain broad, repeated distributional patterns in fauna and flora he referred to as “generalized tracks.” Croizat et al. (1974) stressed that all species are components of biotas and that the generalized track estimates the composition and distribution of the ancestral biota before it subdivided into descendant biotas. The arguments for vicariance biogeography in its various forms are found in Hennig (1966); Brundin (1972, 1981); Raven and Axelrod (1974); Rosen (1976, 1985); Savage (1973, 1974, 1983); Patterson (1981); and elsewhere. The general vicariance rationale is well articulated by Savage (1983:491–496).

0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

127

128

Biogeography of the West Indies: Patterns and Perspectives

It is generally agreed (Coney, 1982; D. L. Smith, 1985; and others) that the opening of the Gulf of Mexico and the Atlantic dates roughly from the Jurassic, and the floors of both comprised marine crustal oceanic basalt by the end of that period (Perfit and Heezen, 1978; Case et al., 1983; Perfit and Williams, 1989). Further, North and South America were totally separated early in the Cretaceous, but a connection re-formed later in that period from a series of volcanic islands connecting southern Mexico and northern South America. Utilizing the geological data summarized by Pindell and Dewey (1982), Guyer and Savage (1986) provided a cladistic analysis of the animals and presented a very plausible explanation for the distribution of anoles in the Americas. In this model, the proto-Greater Antilles were part of the Caribbean plate that formed the early Central American connection between North and South America in the Paleocene, fragmenting away in the Eocene. These fragments drifted northeastward to become the Greater Antilles. These islands, however, may be more closely related to North than to South America by their original proximity to Yucatan and later by collision with the North American plate underlying what is now Florida and the Bahamas Rise. The Greater Antilles were subject to considerable modification during the Tertiary through the complex actions of many faults and by the independent movement of several smaller plates. This fragmentation of the proto-Greater Antilles and subsequent accretion of parts elsewhere results in at least three separate blocks forming Cuba and three or four additional separate blocks accreting to form Hispaniola, each contributing its own elements to the fauna. Parts of Hispaniola were attached either to Puerto Rico or to parts of Cuba during the Tertiary, initiating further problems in the interpretation and origin of fauna and flora. Maury et al. (1990) reviewed the geological history of the Lesser Antilles. Although originally considered to be a single volcanic arc of Eocene age, the Lesser Antilles comprised the Southern Volcanic Caribbees and the two northern arcs: “Northern Volcanic Caribbees” or inner arc from Dominica to Bass Terre, Guadeloupe and the outer arc or the “Northern Limestone Caribbees,” which includes Grande Terre, Guadeloupe to Anguilla. The latter insular group has a more ancient geological history and volcanism, and these “limestone” islands appear to have a more recent terrestrial fauna with the islands of Grande Terre and Marie Galante emerging during the Pleistocene. Although there are some endemic taxa on these islands, the majority of the biota, particularly that south of Dominica, retains greater similarity to South America than to any other landmass. The modern connection between Central and South America initiated during the Cretaceous extended southward from southwestern Mexico as a complex volcanic arc–trench system, finally closing the gap between North and South America during the Pliocene, thus facilitating the “Great American faunal interchange” (Stehli and Webb, 1985). The recent geological history of Florida and the Bahamas in association with Cuba is complex. Burke (1988) indicated that during the mid-Tertiary, Cuba overrode the Bahamas rise. During periods of the Pleistocene glacial maxima, there was a large emergent Great Bahamas Bank with subsequent reflooding of the bank in the insular pattern evident today. Similarly, Florida underwent an extension and reduction of land area (Webb, 1990) with a further exchange of the fauna and flora.

PREVIOUS BIOGEOGRAPHICAL STUDIES OF BUTTERFLIES It is informative to examine previous studies on butterfly biogeography in light of the various geological and biogeographical models. The advent of Darlington’s (1957) general treatise on zoogeography provided the impetus for several papers on the biogeography of the West Indian butterflies. Like the Darlington volume, most of the butterfly studies to 1989 were based on the dispersalist model. Even the monumental work of MacArthur and Wilson (1967) was interpreted on a dispersalist model. Fox (1963) completed one of the earliest biogeographical studies on a few species of West Indian Ithomiidae. He showed that these were most closely related to Central American species; however, since the Ithomiidae are not vagile, he resorted to Schuchert’s (1935) land bridges to transport them onto the Greater Antilles. Fox, like Schuchert, attributed these land bridges to the Tertiary and gave very little significance to the Pleistocene. Shortly thereafter, Clench (1964) published

The Biogeography of the West Indian Butterflies (Lepidoptera)

129

an analysis of the West Indian Lycaenidae. This was a purely Matthewian treatment ascribing virtually all of the West Indian fauna to dispersal events during Pleistocene interglacials with contraction and subsequent extinction of the fauna during glacial maxima and the concomitant lowering of temperature. The species themselves were largely ascribed to the Pleistocene with a similar age for the evolution of the entire family. L. Miller (1965) examined the vagile West Indian Choranthus (Hesperiidae) and its relatives. These he considered to have dispersed onto the Greater Antilles largely during the Tertiary, but he did not invoke land bridges, relying instead on rare, chance dispersals. The single Antillean species of Paratrytone was attributed to invasion from approximately present-day Honduras. L. Miller (1968) briefly mentioned the West Indies in his treatment of the zoogeography of the world Satyridae, again utilizing a dispersalist model. The only West Indian satyrid genus, Calisto Huebner, was thought to have been derived from a Middle American member of a wholly Neotropical tribe. Brown and Heineman (1972) discussed Jamaica’s butterflies on a classical dispersalist model via the Yucatan Channel to Cuba and from South America to the Lesser Antilles, but they attributed some of the dispersal to events during the Tertiary. Scott (1972) listed the West Indian butterflies and made a few comments on their distribution. This, too, was a dispersalist discussion and strongly influenced by events of the Pleistocene. Scott (1986) again listed the West Indian butterflies and commented more widely on their postulated dispersal from the American continent. Riley (1975) in his Field Guide offered some speculations on the origins of parts of the West Indian butterfly fauna, including a possible African link for one or two genera. Riley’s was not a vicariance study, however, and one is left with the impression that he was referring to long-distance dispersal, including Africa to the Antilles, to account for these anomalies. Brown (1978) presented a paper on Antillean butterfly distributions during the same symposium at which Rosen (1976) presented his classic vicariance model for the Antillean fish fauna. Brown raised the possibility of vicariance, although he did not elaborate further, hinting at it only in connection with the danaid genus Anetia. He also mentioned Calisto as a possible link to African fauna, basically repeating Riley’s information. Shields and Dvorak (1979), although interesting but controversial, proposed the first, definitive vicariance model for butterflies based on the late Jurassic to early Cretaceous separation of the Americas, Africa, and the Caribbean. This model, which ascribes most of the evolution of the butterflies to this time period, was totally at odds with the conventional dispersalist model, and since some of the taxonomic relationships that were postulated are questionable, it has not achieved much acceptance. Much of the emphasis in these earlier studies was on the Pleistocene with the exception of Fox (1963), L. Miller (1965), Shields and Dvorak (1979), and, to a lesser degree, Brown (1978). This emphasis is inherent in adoption of the Matthew–Darlington model of biogeography. It requires the long-distance transport of organisms across barriers to establish themselves in new territories. Perhaps nowhere are the difficulties of such transport more apparent than in colonization of islands, and why some species are present on certain islands and absent on others. Other variables, such as the close association of host plants for butterflies and other insects present other unique problems. Several factors need to be considered to determine the feasibility of the dispersalist model. First, one must examine the organisms themselves and their endemicity. It is also necessary to analyze the fossil record to determine the actual documented ages of butterflies. Since there are very few butterfly fossils available, what may we infer from those that are extant? Other questions that must be addressed involve dispersal itself. Are all butterflies excellent dispersalists or not? In the case of disparate groups of butterflies, are they strong fliers? What is inherent in the lifestyles of butterflies that would either facilitate or discourage dispersal? Is a sedentary butterfly much less likely to leave its localized ecological niche? Some species are well-known migrants, and their dispersal capabilities should be virtually unlimited. If one seeks to postulate dispersal by hurricanes, how do such organisms behave and survive during storms (or even at the threat of them)? We will examine these aspects in some detail.

130

Biogeography of the West Indies: Patterns and Perspectives

ENDEMISM OF THE WEST INDIAN BUTTERFLY FAUNA Endemism is a well-known phenomenon in insular butterflies (Holloway, 1979; Alayo and Hernandez, 1987; Smith et al., 1994), and the butterflies of the West Indies are no exception (Table 1). Over half of the recorded species and nearly one of every eight genera are endemic to the West Indies. This statement is based on the assumption that the southern tip of Florida and the Keys are faunistically Antillean, rather than continental (Scott, 1972, 1986; Riley, 1975; Brown, 1979; Minno and Emmel, 1993; Smith et al., 1994), because some of the Cuban and Bahamian “endemics” also occur there. Since most butterflies are closely associated with specialized larval host plants, it is necessary to examine individual food plant data for the West Indian butterflies (Brown and Heineman, 1972; Scott, 1972; Riley, 1975; Shields and Dvorak, 1979; Smith et al., 1994). It is generally accepted that modern butterflies and their associated larval host plants arose in the mid to late Cretaceous (Raven and Axelrod, 1974; Common, 1975, 1990; Powell, 1980; White, 1990) and that these associations have coevolved since that age. The food plants either had to be on the islands when the butterflies arrived or they arrived on the islands by vicariance along with their butterflies. The endemic genera and the species are clearly derived from several different faunal sources (Table 2). Most of the butterflies of the Greater Antilles are most closely related to those of Central America and Mexico. This portion of the fauna may be explained either as dispersal from the mainland (most previous butterfly biogeographical studies) and/or by invoking a model similar to that proposed by Pindell and Dewey (1982) and refined by Pindell and Barrett (1990) as a basis for vicariance. The clearly North American component of the Antillean butterfly fauna and the fauna of the southern Lesser Antilles, most closely related to South America via Trinidad, are both best explained by dispersal. The Virgin Islands and northern Greater Antilles are faunistically related to Puerto Rico in part, again probably through dispersal. To determine which biogeographical model is most plausible, one must examine the present ranges of the butterflies that inhabit the islands (Table 2) and determine the dispersal potential of the butterflies themselves. Cuba and Hispaniola harbor the greatest percentage of endemic butterflies and a number of other West Indian fauna and flora discussed in this volume, but this may reflect their status as the largest Antillean islands (Alayo and Hernandez, 1987; Schwartz, 1989; Smith et al., 1994). It may equally well be a function of the geological history of these islands as points of accretion of various small plates during the Tertiary, each harboring distinctive faunas, thus conforming to a vicariance model.

TABLE 1 Endemicity of Antillean Butterfly Fauna Family

Genera No.

Endemic No.

% Endemicity

Species No.

Danaidae Ithomiidae Satyridae Nymphalidae Libytheidae Riodinidae Lycaenidae Pieridae Papilionidae Hesperiidae Total

3 1 1 34 1 1 13 13 5 49 121

0 0 1 4 0 1 1 0 0 7 14

0.0 0.0 100.0 11.8 0.0 100.0 7.7 0.0 0.0 14.3 11.6

9 2 25+ 65 3 1 32 50 22 92 301

Endemic No. 5 2 25+ 26 3 1 22 24 15 47 170

Note: Southern Florida is included in the West Indies for purposes of establishing endemicity.

% Endemicity 55.6 100.0 100.0 40.0 100.0 100.0 68.8 48.0 68.2 51.1 56.5

The Biogeography of the West Indian Butterflies (Lepidoptera)

131

TABLE 2 Affinities of West Indian Butterfly Genera Widespread Genera

Affinity with North America

Danaus (4) Lycorea (1) Doxocopa (2) Hypna (1) Memphis (4) Marpesia (3) Colobura (1) Historis (2) Archimestra* (1) Anartia (4) Biblis (1) Vanessa (3) Euptoieta (2) Heliconius (1) Dryas (1) Agraulis (1) Libytheana (4) Strymon (11) Leptotes (2) Brephidium (2) Hemiargus (4) Ascia (1) Appias (2) Eurema (23) Anteos (2) Phoebis (6) Heraclides (11) Battus (3) Epargyreus (3) Polygonus (2) Chioides (4) Urbanus (6) Astraptes (pt.)(3) Cogia (1) Nisoniades (1) Cabares (1) Antigonus (1) Achlyodes (1) Grais (1) Gesta (1) Ouleus (1) Heliopetes (1) Pyrgus (2) Cymaenes (1) Wallengrenia (4?) Hylephila (1) Panoquina (6) Nyctelius (1) Lerodea (1)

Asterocampa (1) Basilarchia (1) Phyciodes (1) Calephelis (1) Eumaeus (1) Atlides (1) Parrhasius (1) Ministrymon (1) Pontia (1) Pieris (1) Nathalis (1) Colias (1) Eurytides (4) Pterourus (pt.) (2) Papilio (1) Parides (1) Phocides (2) Autochton (2) Erynnis (1) Oarisma (2)

Affinity with Mexico and/or Central America

Affinity with Central and South America

Anetia (4) Greta (2) Anaea (1) Siderone (1) Hamadryas (3) Dynamine (2) Lucinia* (2) Adelpha (2) Junonia (3) Atlantea* (4) Antillea* (2) Hypanartia (1) Dianesia* (1) Allosmaitia (2) Chlorostrymon (2) Nesiostrymon (1) Dismorphia (2) Ganyra (2) Kricogonia (1) Zerene (1) Pterourus (pt.) (1) Aguna (1) Polythrix (1) Astraptes (pt.) (3) Burca* (4) Timochares (1) Ephyriades (3) Pyrrhocalles (2) Perichares (1) Vettius (1) Synapte (1) Rhinthon (2) Holguinia* (1) Polites (2) Atalopedes (3) Parachoranthus* (1) Choranthus* (6) Paratrytone (1) Euphyes (3) Asbolis* (1) Hesperia (1)

Calisto (25+) Archaeprepona (1) Myscelia (1) Eunica (3) Siproeta (1) Eresia (1) Eueides (1) Philaethria (1) Pseudolycaena (1) Cyanophrys (1) Electrostrymon (4) Pseudochrysops* (1) Melete (1) Aphrissa (4) Chiomara (2) Pheraeus (1) Saliana (1)

Note: Endemic genera are set off by an asterisk (*) and placed with nearest relative(s); number of Antillean species is in parentheses after generic name.

132

Biogeography of the West Indies: Patterns and Perspectives

On a purely dispersalist model, one would expect that Cuba would have a large component of species in common with the Yucatan, since the overwater distance is only 220 km across the Yucatan Channel, but this is not so. Prevailing winds would tend to pass insects from Cuba to Yucatan, rather than vice versa. The only instance reported in recent years (Shields, 1985) of a Cuban species being taken on the Mexican (or Texas) mainland is the libytheid, Libytheana motya (Boisduval & LeConte). At the same time, there are some well-documented invasions of Cuba by Mexican species, most notably Hamadryas amphinome mexicana (Lucas), which appeared in Pinar del Rio, Cuba in the 1860s and was reported by H. W. Bates. Numerous fresh specimens were taken in western Cuba in the 1930s (M. Bates, 1936; de la Torre y Callejas, 1954), indicating that the species was well established there. Currently, both H. amphicloe and H. amphinome are recorded from Cuba with infrequent strays of H. feronia observed. Although there are some old reports of Antillean species being taken in Honduras (Evans, 1952), these are unverified and probably due to mislabeling. There should have been a great influx of Cuban species on the Florida Keys, a distance of only 150 km, no matter which model is employed; and, in fact, this has happened. A number of butterflies can best be explained by waif dispersal with the lycaenids, Electrostrymon angelia angelia (Hewitson) and Ministrymon azia (W. H. Edwards), and the skipper, Asbolis capucinus (Lucas), just a few species that have become well established in the Keys and South Florida in recent years (Klots, 1951; Anderson, 1974; Smith et al., 1994). Sightings or captures have established that Strymon limenia (Hewitson), a lycaenid; Anartia chrysopelea (Huebner), a nymphalid (both Anderson, 1974); the pierid, Aphrissa orbis (Poey) (Scott, 1986); and the swallowtail, Eurytides celadon (Lucas) (C. V. Covell, Jr., personal communication) have visited the Florida Keys recently. Many such reports involve strong-flying, often migratory, taxa. Endemic species are usually not shared between islands. In such cases, endemic species are generally shared only with nearby islands. For example, Pyrgus crisia (Herrich-Schaeffer) is found both in Cuba and Hispaniola (perhaps Puerto Rico), but not in Jamaica or Florida. Thus, most of the evidence indicates these insular faunas having evolved in situ. The question must be addressed whether these faunas are the result of chance dispersals from the mainland or passive vicariance based on the mobile history of the islands, or both.

THE AGE OF BUTTERFLIES AND ITS BIOGEOGRAPHICAL IMPLICATIONS The question of how old the butterflies are has vexed researchers for many years. The problem becomes more complex when one realizes that there are fewer than three dozen unquestioned Rhopalocera fossils known, and these span most of the Tertiary (Common, 1975, 1990; Brown, 1976; Powell, 1980; Whalley, 1986; Murata, 1998). Because their delicate wings and chitinous exoskeletons require very special conditions for preservation, butterflies do not fossilize well. Hence, we have a few fragments and limited information in the fossil record. These are often too badly broken to even be recognizable as Lepidoptera. Even fewer more-or-less-complete adult casts exist and only one egg (Gall and Tiffney, 1983), and these are the basis of practically all of our knowledge about this insect order. Although there have been reports of Lepidoptera in amber from the Dominican Republic in recent years, none of this information thus far has been published. Since there are no fossil Lepidoptera actually published from the West Indies, it is necessary to extrapolate butterfly distributions with those of animal groups having congruent distributions and with better fossil records. The majority of the lepidopterous fossils are of Oligocene age, chiefly from the Aix formation of France and the Florissant beds of Colorado, although the latter is now considered as the latest Eocene (H. Meyer, personal communication). These fossils are mainly Satyridae, Nymphalidae, and Pieridae, the first two of which are considered among the most derived families in the Lepidoptera. Most of the fossils may be assigned with ease to extant genera (Common, 1990; Labandeira

The Biogeography of the West Indian Butterflies (Lepidoptera)

133

and Sepkoski, 1993), and in at least one instance, the fossil is almost indistinguishable from a present-day species (J. Miller and Brown, 1989). One of the other fossils, Doxocopa willmattae Cockerell, from the Florissant, is closely allied to an extant West Indian species. A fossil pierid, Oligodonta florissantensis Brown is morphologically similar to the present-day Andean genus, Leodonta Butler, and the satyrid, Prodryas persephone Scudder is a member of an extant, largely Old World tribe, the Parargini (L. Miller, in preparation). These fossils are even older than the Miocene fossil fish that are referable to a present-day species reported by Lundberg et al. (1986). Since fossils can be used only to give a minimum age for a taxon (Patterson, 1981), any species represented is therefore in fact much older than indicated by its fossils. Very few genera of terrestrial animals represented in the fossil record have persisted from at least Oligocene time to the present. Thus, the conclusion that at least some lineages of butterflies, even among the most apotypic families, are bradytelic is inescapable. However, for the Insecta, the preserved familial diversity increases steadily following the Permian–Triassic and continues to increase sharply throughout the middle Tertiary (Labandeira and Sepkoski, 1993). Although tetrapods and marine bivales have the lowest rates of extinction derived from the fossil record, it appears that insect families have even lower rates of familial turnover throughout much of their recent history. The fossil record for Lepidoptera supports this low rate of extinction and the postulated antiquity of Lepidoptera suggested by Carpenter (1930) and Forbes (1932), and presumably followed by Shields and Dvorak (1979), who assumed that the Lepidoptera arose or differentiated in the Jurassic. Common (1975, 1990) and Powell (1980) review the extant fossil Lepidoptera with an emphasis on the Microlepidoptera and larval hostplant associations through time. Whalley (1986) documents the lepidopteran fossils and describes one microlepidopteron from the Jurassic. He states that, although Triassic and earlier fossils have been reported, these have proven to be cicadas or some similar insects. However, Whalley does indicate that clearly the Trichoptera and the Lepidoptera had already diverged from their common stem sometime during the Jurassic. Similarly, based on biogeographical patterns, L. Miller (1968), in a dispersalist model, assigned the origin of the Satyridae to the Cretaceous. All of the above-cited reports place the origin of the Lepidoptera farther in the past than that of various orders of mammals or birds; in fact, the situation much more closely parallels that of reptiles, amphibians, and fish. Common (1975, 1990), Whalley (1986), Labandeira and Sepkoski (1993), and others note that the extant butterfly families and genera were well established by the mid-Tertiary. Because of herbivory, pollination, and the specific plant/butterfly associations, it has long been accepted that the origin of butterflies was contemporaneous with the angiosperms (Smart and Hughes, 1973; Raven and Axelrod, 1974; White, 1990) or previous to their origin (Common, 1975, 1990; Powell, 1980; Whalley, 1986). The angiosperms, long thought to be restricted to the early Cretaceous sediments of Laurasia, have been found recently in comparable deposits in southern South America (Romero and Archangelsky, 1986), thereby establishing their presence in at least West Gondwanaland. Another description of a primitive angiosperm from China (Sun et al., 1998) supports an even earlier origin in the Jurassic of this group, and clearly the early angiosperms were much more widely distributed than previously believed. Recently, Labandeira and Sepkoski (1993) presented an alternative hypothesis suggesting that, if indeed the rates of insect diversity were contemporaneous with the origin of the angiosperms, there should be an exponential increase in diversity within the following time interval. Their evidence suggests that insect diversification actually decreased with the radiation of the angiosperms, and that the earlier diversification of the Insecta probably was responsible for the rapid radiation of the angiosperms during the mid-Cretaceous. The above evidence documents that the Lepidoptera are much older than earlier authors once believed. They are old enough that they were present on both parts of the divided Pangaea during the Mesozoic, and at least the Satyridae are beginning to show patterns of distribution and evolution that are consistent with vicariance models proposed for other heterothermic animals (L. Miller, in preparation). It must be noted here that the satyrids are considered to be “advanced” compared to

134

Biogeography of the West Indies: Patterns and Perspectives

some other butterfly groups. Common (1990) also agrees that most modern butterfly groups were extant in the Cretaceous. This therefore suggests that butterfly distribution in the West Indies can be interpreted based on the fossil record and within the geological constraints presented by a modification of the Pindell and Dewey (1982) model as discussed by Perfit and Williams (1989) and later refined by Pindell and Barrett (1990). Guyer and Savage (1986) used these models in their biogeographical discussion for anoles, and we later employed them in our discussions on the biogeography of butterflies in the West Indies (Miller and Miller, 1989; Smith et al., 1994).

ARE ALL BUTTERFLIES EFFECTIVE DISPERSALISTS? The simple fact that butterflies have wings has led many to conclude that these insects must be accomplished fliers capable of long-distance flights over water. Arguments for such a classical dispersalist model for populating islands are eloquently discussed by Carlquist (1974). Overwater dispersal is surely true for a few species in selected, migratory genera, such as Vanessa, Phoebis, and some Danaus, and certainly this was how some Lepidoptera reached the Antilles. This explanation for populating the Antilles long has been employed by zoogeographers (Clench, 1964; L. Miller, 1965; Scott, 1972, for example), but it is necessary to examine the “life styles” of individual species to determine the accuracy of this argument. Shreeve (1992) discusses different variables involved in the migration and dispersal of butterflies, such as predators, parasitoids, and the competition and availability for host plant and nectar resources, while Endler (1982:644, table 35.1) lists a number of animals, including a few butterflies, with their estimated dispersal potential gleaned from various published sources. The Lepidoptera in the latter reference have dispersal distances calculated at between 10 m and 5 km, and the average flight distances vary with individual species. Although many butterflies are capable of longer flights and may readily disperse in this manner, other species are more localized and cannot readily traverse across water barriers. The Satyridae, for example, are very sedentary (Endler, 1982, lists the European species, Maniola jurtina [Linnaeus], with an effective dispersal distance of 10 m), as are the Ithomiidae (Fox, 1963). Fox employed land bridges from the mainland to the Antilles to account for the spread of these sedentary ithomiids, but if we reject Schuchert’s (1935) land bridges, we must explain how these nonvagile insects reached the islands. Many butterflies take refuge at the slightest hint of inclement weather, and the probability of their dispersal by hurricanes is thus minimized (Fox, 1963). While such species may disperse slowly over the relatively benign land given enough generations, it is extremely unlikely that they could have made long, overwater flights. Personal observations indicate it is unlikely that most Lycaenidae could accomplish this feat, in contradiction to the dispersalist model proposed by Clench (1964). The answer to the question, “are butterflies effective dispersalists,” then is “it depends.” Some butterflies have excellent dispersal potential and surely arrived in the Antilles by this means. In other instances, dispersal cannot have accounted for all of the Antillean distributions. For these species we searched for another model (1989), a composite model incorporating both dispersal and vicariance, to explain present Antillean lepidopteran distributions.

CURRENT STUDIES Based on our previous publications (Miller and Miller, 1989; Smith et al., 1994), recent field studies, specimens examined in the major museum collections, and information derived from Riley (1975), Clench (1977), Clench and Bjorndal (1980), J. Miller (in preparation), and Scott (1986), we have continued to examine the origin and distribution of West Indian butterfly fauna via both vicariance and dispersalist events. The vicariance model employed, presented originally in 1989, is based on the original tectonic model employed by Pindell and Dewey (1982) and refined by Perfit and Williams (1989) and later by Pindell and Barrett (1990). Classical dispersalist explanations are roughly similar to those outlined above and especially by Darlington (1957) and modified subsequently by Clench (1964).

The Biogeography of the West Indian Butterflies (Lepidoptera)

135

THE DISPERSALISTS Many butterfly species are adapted to long-range flight and migration, and these could be expected to have colonized the islands often. A number of these are well-documented migrants, whose flights in the continental landmasses cover thousands of kilometers every year. If the dispersalist model is correct, there might have been a continuous interchange of migrants that would potentially facilitate genetic exchange between insular and mainland populations and, therefore, would theoretically make such species phenotypically (and genetically) similar, whether they came from the Antilles or from the mainland. Still other, not quite so vagile, insects may have dispersed to the islands and subsequently subspeciated (perhaps speciated), but these would still be considered dispersalists. Much of the dispersal should be of Pleistocene age (Clench 1964), and their affinities ought to be clear. Based on the fossil record and the current distributions, those species listed here are assigned to geographical areas from whence they dispersed to the islands as follows: NA = those species that entered from North America; Mex = those that entered via Mexico; CA = those species that were derived from Central America; and SA = those species that entered from South America via Trinidad and/or the Lesser Antilles. The affinities of the West Indian genera are shown in Table 2. For further information on the Antillean distribution of the species listed, see Riley (1975) and Smith et al. (1994). Many danaids are well-documented dispersalists. The Antillean species of Danaus Kluk (mostly NA) quite possibly dispersed to the islands, usually subspeciated, and often are involved in at least some inter-island movement (Simon and L. Miller, 1986; Miller and Miller, in preparation). Lycorea Doubleday (NA, but see below) has undergone a similar dispersal, and the Lesser Antilles are regularly visited by the South American L. ceres atergatis Doubleday (Smith et al., 1994:41). Several nymphalids best can be ascribed to dispersal from mainland populations. Examples include Doxocopa laure (Drury) (CA), Marpesia petreus (Cramer) and chiron (Fabricius) (CA), Colobura dirce (Linnaeus) (CA), Historis odius (Fabricius) and acheronta (Fabricius) (CA), at least Hamadryas amphinome mexicana (Lucas) (CA), Dynamine species (Mex or CA), Eunica species (CA except heraclitus [Poey]), Adelpha iphicla (Linnaeus) (Mex), Hypolimnas misippus (Linnaeus) (SA?), Junonia species (NA), some Anartia species (Mex, SA), Biblis hyperia (Cramer) (SA), Siproeta stelenes (Linnaeus) (Mex or CA), Phyciodes phaon W. H. Edwards (NA), Eresia frisia (Poey) (CA), Vanessa species (NA), Euptoieta sp. (NA, Mex), Philaethria dido (Clerck) (CA), Agraulis vanillae (Linnaeus) (NA, SA), Dione juno (Cramer) (Mex or CA), possibly Dryas iulia (Fabricius) (SA or CA), perhaps Eueides melphis (Godart) (CA), and perhaps Heliconius charitonius (Linnaeus) (all of the above regions). Within the Lycaenidae, the following are almost certainly attributable to dispersal: Pseudolycaena marsyas (Linnaeus) (SA), Chlorostrymon species (Mex, CA), Ministrymon azia (SA), Leptotes cassius (Cramer) (probably SA), and Hemiargus hanno (Stoll) (CA). Most of the Pieridae, except species of Dismorphia, a few Eurema, and perhaps Melete salacia (Godart), appear to be dispersalists from various sources. Swallowtails, such as Heraclides thoas (Linnaeus) (CA) and cresphontes (Cramer) (NA, Mex, or CA), Papilio polyxenes Fabricius (NA), Pterourus palamedes (Drury) and troilus (Linnaeus) (NA), and probably the Eurytides sp. (derived from the NA E. marcellus [Cramer]) are the West Indian Papilionidae whose distributions are probably referable to dispersal. The distributions of several Hesperiidae best explained by a dispersalist model include Phocides pigmalion (Cramer) (CA), Proteides sp. (SA?), Epargyreus sp. (NA), Polygonus sp. (CA), Aguna asander (Hewitson) (CA), most Urbanus sp. (most areas), Autochton sp. (NA, Mex), Cabares potrillo (Lucas) (CA), Eantis mithridates (Fabricius) (CA), Timochares sp. (CA), Grais sp. (CA), Gesta gesta (Herrich-Schaeffer) (CA or SA), Chiomara sp. (SA), Erynnis zarucco (Lucas) (NA or Mex), Pyrgus oileus (Linnaeus) (Mex or CA), Perichares philetes (Gmelin) (Mex), Synapte malitiosa (Herrich-Schaeffer) (Mex), Polites sp. (NA or Mex), Hylephila phyleus (Drury) (any of the regions), Atalopedes species (NA or Mex), Calpodes ethlius (Stoll) (any of the regions), Panoquina sp. (NA, Mex, CA), Nyctelius nyctelius (Latreille) (CA or SA), Lerodea eufala (W. H. Edwards) (NA or Mex), and Saliana esperi Evans (CA).

136

Biogeography of the West Indies: Patterns and Perspectives

Theoretically, the West Indian butterfly fauna in general has been well documented (Scott, 1972, 1976; Riley, 1975), but some of these records are based on older specimens with some erroneous data. Through our efforts (Smith et al., 1994), those of others, and recent field studies, we have further refined our knowledge of the butterflies of the West Indies. Several new insects continue to be described each year. However, additional research is required to fully assess the fauna of the islands and its possible origin. In some families, lepidopterists often are still in an alpha taxonomic position, and biogeographical knowledge is equally fragmentary. Thus, the full extent of the geographical ranges of many butterflies has not yet been established, thereby making the task of delimiting either centers of origin or the assessment of potential vicariance difficult.

A VICARIANCE/DISPERSAL MODEL FOR THE BIOGEOGRAPHY OF WEST INDIAN BUTTERFLIES Numerous problems are associated with the biogeographical analysis of butterflies. In the light of phylogenetics, there is uncertainty about the status of the classification, although the recent efforts of Johnson (1991, 1993), Shuey (1986, 1994), Burns (1987, 1989), and others have provided insight into some groups. Much of the taxonomy above the species level requires refinement (L. Miller and Brown, 1983; Smith et al., 1994). To date, very few modern taxonomic and biogeographical revisions have been done, and even fewer have been published. The biogeographical analysis that follows is therefore presented in chronological sequence, and the examples employed are drawn from unrelated butterfly taxa from the West Indies whose geographical distributions show congruence with other animal groups that have usable fossil records. Our original evaluation of the West Indian fauna (1989) was based on the plate tectonic model of Pindell and Dewey (1982) and further refined through the efforts of Burke (1988), Perfit and Williams (1989), and Pindell and Barrett (1990) with minor modifications.

LATE MESOZOIC

TO

CRETACEOUS

During this period Africa and South America were still in contact (Brundin, 1981), but the continents were in the process of separating. The North and South American continents were connected during most of the Cretaceous (Pindell and Dewey, 1982), and the Antilles did not exist in their present form. To understand the biogeography of West Indian butterflies, one must consider the Mesozoic era even before the formation of the proto-Greater Antilles. During the Jurassic and the early Cretaceous, Pangaea split into a northern Laurasia and a southern continent, Gondwanaland, separated by the Tethys Sea. Later in the Cretaceous, Laurasia and Gondwanaland themselves began to fragment, and the parts to move toward their present positions. It is here that our story begins. Because of the probable age of butterflies (Whalley, 1986), we cannot accept the Jurassic–early Cretaceous vicariance of all butterfly groups postulated by Shields and Dvorak (1979), but upon reexamination, Whalley (1986) and Common (1990) support this time frame for the origin of some primitive moth groups. Certainly the recent review of Labandeira and Sepkoski (1993) supports an earlier origin for all insects. Butterflies are believed to have been established during the Cretaceous (L. Miller, 1968, in preparation; Whalley 1986), perhaps early to mid-Cretaceous. Some groups appear to be basically Laurasian and others Gondwanian (Common, 1975, 1990; Miller and Miller, 1997; L. Miller, in preparation). During part of this time Africa and South America were in contact (Brundin, 1981) and shared at least parts of the same fauna. Several butterfly groups fall into this category, including the satyrid sister groups Manataria (South America) + (the African Aeropetes + Paralethe) (Miller and Miller, 1997). These satyrids are too fragile to have been involved in significant overwater dispersal of the magnitude necessary to explain these distributions by more recent dispersal. There are African affinities in a very small proportion of the West Indian butterfly fauna. Four butterfly genera, about 4.5% of the Antillean fauna, definitely have their sister groups in the Ethiopian region (see below). Such affinities, while rare, are by no means unique to butterflies.

The Biogeography of the West Indian Butterflies (Lepidoptera)

137

FIGURE 1 Facies of Archimestra teleboas, (a) upper side; (b) under side, from the Dominican Republic. Neptidopsis ophione. (c) upper side; (d) under side, from Ghana. Structural features also support the resemblance as discussed in the text.

Flint (1977) commented on West Indian Odonata and Trichoptera and reported a small African influence on these, and recently Liebherr (1986) has described a genus of West Indian carabid beetles, Barylaus, from Hispaniola and Puerto Rico, whose nearest relatives are from Africa, Madagascar, and Central America. Although it has African ancestral relationships, the nymphalid genus Eunica is Neotropical with three species represented in the West Indies (Jenkins 1990). Two of these, monima (Cramer) and tatila Herrich-Schaeffer, are more or less widely distributed in Central America and given to moderate mass movements on the continent (Howe, 1975). These species appear to be candidates for dispersal to the islands and are virtually indistinguishable from continental examples. The third species, however, E. heraclitus (Poey), known only from Cuba, is aligned with the south Brazilian species, E. macris (Godart). The two species superficially (and structurally) bear similarity to African Sallya, the sister genus of Eunica (Jenkins 1990). All maintain the “primitive nymphaloid pattern” of Schwanwitsch (1924) and were reexamined more recently by Nijhout (1991) as the nymphalid ground plan in terms of phylogenetic analysis. In his revisionary studies, Jenkins derived a cladogram of Eunica and its relatives that places Eunica and the African Sallya as sister groups. This cladogram is more or less congruent with that of Liebherr (1986) for the Carabidae. This suggests a late Mesozoic vicariance separating the two genera on Africa and America followed by vicariance of E. heraclitus onto what is now Cuba rather early in the Tertiary. An even more dramatic example of this biogeographical pattern involves the endemic Archimestra teleboas (Menetries) from Hispaniola. The sister group of this monobasic genus is Neptidopsis from Africa and both are illustrated (Figure 1). The closest outgroups for these two genera are the Neotropical genera Mestra and Vila (D. W. Jenkins, personal communication). Mestra is represented on the islands by a pair of species, one in Jamaica and the other an apparent dispersalist from South America on the Lesser Antilles. The implications are clear: the ancestral member of this group must have been rather similar to teleboas, which participated in the African–South American vicariance late in the Mesozoic, and then vicariated onto Hispaniola in the earliest Tertiary. The nymphalid genera Archaeoprepona (Antilles and mainland tropical America) and Prepona (Central and South America), along with Agrias (American tropics) and Charaxes (Old World tropics), show a comparable distributional pattern. Charaxes and Archaeoprepona are sister genera and they in turn are the sister group of the more derived Prepona + Agrias (Johnson and Descimon, 1989). It is interesting that the most plesiomorphic American genus in this cluster is the one that is represented in the West Indies, a situation that is comparable to the Barylaus model (Liebherr, 1986). Archaeoprepona demophoon (Huebner), the West Indian species, has subspecies on Hispaniola, Cuba, and Puerto Rico. A similar pattern is evident in the lycaenid genus Brephidium, represented by three species: one from the southwestern United States to Venezuela and the Greater Antilles (Riley, 1975), one

138

Biogeography of the West Indies: Patterns and Perspectives

a

b

1 mm

c

d

FIGURE 2 Structural examples of the African affinities in the West Indian butterflies are found in the left lateral views of male genitalia of Oraidium and Brephidium species: (a) O. barberae, South Africa; (b) B. metophis, Africa; (c) B. isophthalma, Florida; (d) B. exilis, Arizona.

from Florida and as a probable stray on the Bahamas (Smith et al., 1994), and a third from South Africa (Eliot, 1973; Dickson and Kroon, 1978). The sister group of this genus, and the only other member of the Brephidium section of the Polyommatini of Eliot (1973), is the monobasic South African genus Oraidium. The male genitalia (Figure 2) are illustrated for Brephidium and Oraidium to demonstrate their very close relationship and other superficial characters also show their similarity. Thus, this is also a very old, now relict African–Neotropical vicariance pattern that is congruent with Liebherr’s pattern in beetles. In this genus, however, one must postulate extensive extirpation of these insects on intervening landmasses between the Cretaceous and the present. A possible relationship has been postulated between the American sister genera Eretris and Calisto, which is West Indian, and their putative African relatives, the Pseudonympha (Smith et al., 1994) and other African genera (Riley, 1975; Brown, 1978), but this relationship is much less close and dramatic as are the ones cited above. The possible African affinities of Calisto led Brown (1978:16) to state that it is “equally at home in the African tribe Dirini as in Pronophilini of the Andes.” However, reexamination of Dira and the Pronophilini in relation to Calisto does not support the close alignment of the African and West Indian insects shown in the examples given above; the latter are structurally members of the Pronophilini, a tribe comprising both Andean representatives and species widely distributed in the lowlands from Arizona to Patagonia. If there is an African element here, it is not prepossessing. Members of Calisto are all endemic to the Greater Antilles (Riley, 1975; Smith et al., 1994), and it is hoped that the studies of Sourakov (1996) and others in progress will provide further insight to the phylogenetic history of this genus.

LATE CRETACEOUS

TO

EOCENE

During late Cretaceous, the first division of the old Central American connection began with great faults cutting across the southern boundary of Yucatan and the northwest corner of South America. The resulting block formed the proto-Greater Antilles, and by the end of this period the block was

The Biogeography of the West Indian Butterflies (Lepidoptera)

139

completely separate from South America, but still in approximation to the Yucatan peninsula. The Jamaican and southern Hispaniolan blocks were farther to the west than the remainder of the protoGreater Antilles and either still adherent to Central America, or at least approximate to it (Perfit and Heezen, 1978; Case et al., 1984; Perfit and Williams, 1989; Pindell and Bartlett, 1990). Species dispersal between North and South America during the Cretaceous occurred across a new connection that was to become in turn the proto-Greater Antilles (Savage, 1983; Stehli and Webb, 1985; Guyer and Savage, 1986; Woods, 1989), resulting in an extensive feeder population of organisms for the original vicariance of the Antillean fauna. Pindell and Dewey (1982) and D. L. Smith (1985) propose that the proto-Greater Antilles began moving eastward relative to Mexico in the late Cretaceous, although significant movement of the Caribbean plate is questioned by Donnelly (1985, 1988). This proto-Antillean block was finally severed from the Yucatan during the Eocene. Several lepidopteran groups seem to have been part of this event, and these vicariants are usually species represented today on Cuba, Hispaniola, and Puerto Rico. Guyer and Savage (1986) have correlated these vicariance events with the present-day distribution of anoles, and their patterns show congruence with some patterns of butterfly distributions. The primitive anole genera, Chamaeleolis and Chamaelinorops, are found exclusively on Cuba and Hispaniola, respectively, and are most closely allied to the sub-Andean genus, Phenacosaurus (Guyer and Savage, 1986:524–528). Those authors ascribed these distributions to these late Mesozoic and early Tertiary vicariance events. A parallel vicariance pattern is evident in several butterfly genera. A few groups, however, such as Atlantea (Nymphalidae), Calisto (Satyridae), Lycorea (Danaidae, cleobaea), Heraclides (Papilionidae), Nesiostrymon, Terra (Lycaenidae), and Wallengrenia (Hesperiiidae), are recorded from all four islands and must date from the early vicariance although Jamaica was more closely positioned against Central America (Perfit and Heezen, 1978; Case et al., 1984; Perfit and Williams, 1989) at about the time that the respective genera divided from their mainland sister groups. For example, the closest relatives of the strange yet beautiful Cuban papilionid, Parides gundlachianus (C. & R. Felder) are based in South America, although the genus is distributed now from Mexico to Argentina, but not on other Antillean islands. The vicariance of Parides (Papilionidae) is postulated as a Cretaceous or Paleocene event with further dispersal taking place in the Tertiary on continental landmasses. Dating the Papilionidae from this time is not unprecedented: Durden and Rose (1978) described a recognizable papilionid from the middle Eocene. A similar scenario will explain the presence of the single member of the Riodinidae from the islands, though that species, Dianesia carteri (Holland), is also found on at least Andros and New Providence in the Bahamas (Harvey and Clench, 1980) and on Cuba (Alayo and Hernandez, 1987; Hernandez et al., 1998). While we postulate short-range dispersal for this species across the Old Bahamas Channel to emergent land now submerged on the Great Bahamas Bank, perhaps during the Pleistocene, the butterfly originally vicariated to Cuba. Almost the exact same pattern (reported once on New Providence, but present on Great Abaco) is shown within the genus Eumaeus (Lycaenidae) with some colonization, perhaps from Andros, of the southeasternmost Florida peninsula (Holland, 1931, and others). Despite the stands of available host plant, Zamia in the Dominican Republic, it is curiously absent. We doubt that biogeography of Eumaeus is as complicated as suggested by Shields and Dvorak (1979), who postulated a Jurassic vicariance of this genus. It is more easily explained with reference to its Central American sister-species, E. toxea (Godart) and vicariance during the early Tertiary onto Cuba. The Cuba–Andros–south Florida connection has been discussed elsewhere (Miller et al., 1992; Smith et al., 1994).

OLIGOCENE

TO

PLIOCENE

During this period the proto-Greater Antillean block fragmented, and the resulting small blocks moved about and accreted onto the islands as we know them today. Most of this accretion was completed by the end of the Pliocene. Both Hispaniola and Cuba are products of accretion; in one

140

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 3 Distribution of the genera Calisto (heavy stippling) and Eretris (vertical cross-hatching) in the West Indies and continental America. Eretris is widely distributed and found southward in the Andes to Bolivia.

case, both islands are the beneficiaries of the same early block (the eastern Cuba–northern Hispaniola block of Pindell and Dewey, 1982), which fragmented, one part going to Hispaniola and another to Cuba, apparently in the Oligocene (for details see Guyer and Savage, 1986). Most of Puerto Rico evidently became isolated early, but a small block that later split off that island accreted onto eastern Hispaniola, and southern Hispaniola separated from Nuclear Central America at a later date probably in the late Oligocene or early Miocene (Pindell and Dewey, 1982; Pindell and Barrett, 1990). Contrary to earlier speculations, the Blue Mountains of Jamaica and the La Selle massif of Haiti apparently were continuously emergent from the time of their separation from Central America (Case et al., 1984; Perfit and Williams, 1989) and were possible vehicles of vicariance. Because Hispaniola and Cuba are far more complex geologically than other Greater Antillean islands, they have greater diversity of the fauna than expected based on diversity of species vs. land area. For example, the complex satyrid genus Calisto is recorded on all of the Greater Antilles and on some of the Bahamian islands, with the greatest species diversity on Hispaniola followed by Cuba (Figure 3). A single species of Calisto inhabits Jamaica, another is found on Puerto Rico, three or four in Cuba, two of which are reported from the northwestern Bahamas, and more than 20 species on Hispaniola. Each island has one (two in Hispaniola) larger species with a more pronounced hind wing tornal lobe. These larger representatives of the genus Calisto are most closely allied to the basically sub-Andean Eretris, which has representatives in the mountains of Central America, one of which is found today in Guatemala and Chiapas. Calisto subdivided into two lineages on Hispaniola and Cuba. The species most like Eretris have tornal lobes on the hind wings and genitalia that are considered plesiomorphous; they inhabit the lowlands and appear to have evolved there. With the exception of C. anegadensis recently described from Anegada in the British Virgin Islands (Smith et al., 1991), only Cuba and Hispaniola have smaller, more round-winged species, which appear to be a later development and do not so closely approximate Eretris. These more apomorphic Calisto have no tornal lobe, genitalia that are similar to each other, and are usually restricted to montane habitats. Some of these species have reinvaded the lowlands, but generally they are restricted to forest–woodland habitats than are the primitive species. This species diversity leads to the

The Biogeography of the West Indian Butterflies (Lepidoptera)

141

conclusion that most of the evolution in the genus took place on the several separated plates that later accreted to form Cuba and Hispaniola. Certainly the complex geological history of Cuba and Hispaniola accounts in part for the greater species diversity on those islands, but the presence of the small, apomorphic forms, evolving on separate blocks that accreted to form both islands, indicates additional speciation must have taken place on these formerly separated islands as well. Sourakov (1996) recently has provided additional insight into the life histories of this complex group, and it is hoped that his phylogenetic studies in progress will provide further insight into the origin of Calisto. Evolution on the eastern Cuban–central Hispaniolan block could account for the present distribution of several organisms shared only by Cuba and Hispaniola. Examples in addition to the already mentioned group of Calisto include two species of Anetia (Danaidae), Lucinia sida (Huebner) (Nymphalidae), Melete salacia (Godart) and Aphrissa orbis (Poey) (Pieridae), and Astraptes xagua (Lucas) and habana (Lucas), and Polites baracoa (Lucas) (Hesperiidae). Many butterfly genera show a generalized distribution within the Greater Antilles that has been ascribed to past dispersal, but they are just as easily explained by late Cretaceous to Paleocene vicariance events (see the maps in Guyer and Savage, 1986:527, figure 10; Perfit and Williams, 1989). Such an explanation accounts for much of the genus Heraclides (Papilionidae) in the islands. We have already suggested that H. thoas and cresphontes might be dispersalists, although the former could as easily be a vicariant, perhaps dating from the Eocene (Guyer and Savage, 1986:527, figure 10, top right map). Perhaps this model addresses Riley’s (1975:143) comment that “It is curious that this widespread species should have reached none of the West Indies other than Cuba and Jamaica.” Other Heraclides species in the West Indies are congruent with a vicariance model. Heraclides aristodemus (Esper) is a species restricted to Cuba, Hispaniola, Puerto Rico, Little Cayman, the Bahamas, and the Florida Keys. Heraclides andraemon (Huebner) occurs naturally in Cuba, the Bahamas, the Caymans, and was introduced into Jamaica. In contrast, H. machaonides (Esper) is restricted to Hispaniola and Puerto Rico, H. thersites is known from Jamaica, H. aristor (Godart) occurs in Hispaniola, H. oxynius (Huebner) is from Cuba, H. pelaus (Fabricius) is found on all of the Greater Antilles, and H. caiguanabus (Poey) is known from eastern Cuba. The distributions given for these species approximate ones already mentioned. All of these insects are rutaceous feeders as larvae, and all were derived from the immigrant H. thoas (or H. cresphontes) stocks (Hancock, 1983; J. S. Miller, 1987a, 1987b). A cladogram of these insects suggests that H. machaonides, H. andraemon, and H. aristodemus represent early branchings of the Heraclides stock in the Antilles, whereas H. oxynius and perhaps H. pelaus represent a somewhat later development. Finally, the more derived H. oxynius and H. caiguanabus evolved, the former in the bulk of Cuba and the latter probably on the eastern Cuba plate after it split off northern Hispaniola. The evolution and the complex biogeographical history of this genus in the West Indies is currently undergoing further study, but the data appear congruent with a vicariance model with some relatively modern inter-island dispersal having taken place. This is especially true in H. aristodemus in the Bahamas. The papilionid species Battus polydamas (Linnaeus) basically is monomorphic on the mainland, but south Florida and the Antilles have 13 different subspecies (Figure 4; and Riley, 1975:141–143; Smith et al., 1994:165–166, pl. 25). In some parts throughout its range, this butterfly is not a good dispersalist, as witness the lack of occasional records of even any of the Antillean subspecies (for example, St. Lucia and St. Vincent have different subspecies although they are in physical proximity). Expanses of water as little as 21 to 25 km have been effective isolating barriers in the Lesser Antilles while the same subspecies, B. p. lucayanus, is shared in the Bahamas and south Florida. Apparently there appears to be a selective advantage to be a sedentary insect in these insular populations of B. polydamas similar to Dryas iulia (Fabricius) (Nymphalidae) in the West Indies. These Lesser Antillean subspecies of B. polydamas are postulated to be the result of the initial breakup of the ancient Central America, although the situation may be complicated by a possibly dispersalist South American origin of most of the Lesser Antilles subspecies. The vicariant scenario would require complete separation of the subspecies other than those in the Lesser Antilles by about the Oligocene–Miocene boundary.

142

Biogeography of the West Indies: Patterns and Perspectives

a

b c

d

e g f

h i j k l m

FIGURE 4 Distribution of B. polydamas in the West Indies. The stippled area is inhabited only by B. p. polydamas (Linnaeus). Island subspecies include (a) B. lucayus (Rothschild and Jordan); (b) B. cubensis (Du Frane); (c) B. jamaicensis (Rothschild and Jordan); (d) B. polycrates (Hopffer); (e) B. thyamus (Rothschild and Jordan); (f ) B. antiguus (Rothschild and Jordan); (g) B. christopheranus (Hall); (h) B. neodamas (Lucas); (i) B. dominicus (Rothschild and Jordan); ( j) B. xenodamas (Huebner); (k) B. lucianus (Rothschild and Jordan); (l) B. vincentius (Rothschild and Jordan); (m) B. grenadensis (Hall). See text for further discussion.

A complementary pattern is observed in another papilionid, B. devilliers (Godart), from Cuba and the Bahamas, which approaches the Chamaeleolis pattern, and B. zetides Munroe, which approximates the Chamaelinorops pattern of Guyer and Savage (1986). Both of these species are probably most closely allied to the Central and North American B. philenor (Linnaeus). Battus zetides is now found only in portions of Hispaniola that were parts of the southern Hispaniolan block of Pindell and Barrett (1990), which block split away from Central America during the Eocene and accreted to Hispaniola in the Pliocene or Pleistocene (Case et al., 1984; Burke et al., 1984). A congruent pattern is shown in the castniid moth, Ircila hecate (Herrich-Schaeffer), a species endemic to the southern Hispaniolan block and related to Mexican and Central American members of Athis (J. Miller, 1986). The same pattern is roughly that shown in Myscelia aracynthia (Dalman) and its sister taxon M. cyaniris Doubleday (Jenkins, 1984). Curiously, there is not an endemic Battus on Jamaica, other than a subspecies of B. polydamas (see above), nor is any castniid or Myscelia recorded from there. These congruent patterns originally suggested to us (1989) that perhaps the relative position of Jamaica depicted in the Pindell and Dewey (1982) reconstruction might be erroneous. Based on the evidence of Perfit and Williams (1989) that Jamaica in the Eocene and the Oligocene may have been positioned against the area that later drifted southeastward as Central America (Figure 5), this shift placed Jamaica nearer its present position relative to the southern Hispaniolan block. The biogeographical pattern associated with B. zetides is reminiscent of a similar distributional pattern of the only Antillean member of the hesperiid genus Paratrytone. Insects of this genus are montane or submontane most of their present continental range (L. Miller, 1964). Representative genitalia of Paratrytone are shown in Figure 6. The West Indian species had been placed in the Antillean genus Choranthus until separated from that genus by L. Miller (1964). The distribution suggests that Paratrytone were in the contiguous parts of Nuclear Central America and that portion which has drifted southward to become present-day Central America as shown in Figure 5, along

The Biogeography of the West Indian Butterflies (Lepidoptera)

PALEOCENE MX & CA

143

EOCENE

PG

A

CA

PG

A

J

SH

SA SA

OLIGOCENE

E. MIOCENE

W&C CU

CU

CA J

CA SH

ECU PR & & NH CH

H PR J SH

SA

SA

PLIOCENE CU CA J

PR

H

LA

SA

FIGURE 5 Modified Pindell and Dewey (1982) model of the evolution of the West Indies. Abbreviations: MX = Mexico; CA = Central America; PGA = proto-Greater Antilles; SA = South America; J = Jamaica; SH = southern Hispaniola; W&C CU = western and central Cuba; ECU & NH = Eastern Cuba and northern Hispaniola; PR & CH = Puerto Rico and central Hispaniola; H = Hispaniola; PR = Puerto Rico; CU = Cuba; LA = Lesser Antilles. Exceptions to the Pindell and Dewey model involve particularly the relative Eocene placement of Jamaica and the southern Hispaniola blocks to conform with the biogeography of butterflies.

with the isolated southern Hispaniolan block. At present P. batesi (Bell) is found in the La Selle mountains of Haiti (Riley, 1980:190) and in mountains in the southwestern Dominican Republic (Schwartz, 1989), both areas of high species diversity in a number of butterfly genera and that are associated with the southern Hispaniolan block (Case et al., 1984). The derivation of this genus seems clear if one accepts closer proximity of the southern Hispaniolan block to Nuclear Central America during the Eocene–Oligocene, as suggested above. The vicariance of the two ithomiids (perhaps subspecies) known from the Antilles, Greta diaphana (Drury) and G. cubana (Herrich-Schaeffer), as previously discussed, is somewhat different. These insects are represented on Jamaica, Hispaniola, and Cuba, but not Puerto Rico. They are extremely sedentary and not subject to dispersal. Their habitat requirements of a cool, dense, somewhat montane, moist tropical forest are significantly different from other close relatives of Greta from Mexico and northern Central America. This genus appears to have been part of the early Tertiary vicariance of the entire proto-Antillean block. Perhaps these insects were simply extirpated from Puerto Rico, but the evidence suggests that they were never present there since Puerto Rico appears to have been the southern part of the proto-Greater Antillean block.

144

Biogeography of the West Indies: Patterns and Perspectives

a b

1 mm

c

d

FIGURE 6 The potential evolutionary affinities of the hesperiid genera Paratrytone and Choranthus are apparent in the male genitalia of selected species: (a) P. rhexenor, Mexico; (b) P. niveolimbus, Guatemala; (c) P. batesi, Haiti; (d) C. radians, Cuba.

The genus Euphyes (Hesperiidae) is represented by two species in the Greater Antilles, excluding Puerto Rico, and on a few Bahamian islands. They are most closely related to the continental E. peneia (Godman) and more distantly allied to several strictly South American congeners (Shuey, 1986:104; 1994). That author ascribes the distribution of the group to “an old vicariant event between Cuba and Central America with subsequent speciation and dispersal” (Shuey 1986:111). Still other taxa are only restricted to Jamaica and Hispaniola, almost certainly derived from the late Eocene–Oligocene approximation of both the Jamaican and southern Hispaniolan blocks to the Mexican mainland; organisms congruent with this pattern include Danaus cleophile (Danaidae) and Aphrissa godartiana (Pieridae). Clench (1964) claims that the butterfly fauna of Puerto Rico has a “predominately Hispaniolan character” and postulates further that the very cold Pleistocene temperatures may have extirpated all of the Lycaenidae existing there prior to the Pleistocene. A few butterflies are apparently characteristic of the Puerto Rico–central Hispaniola block and are found nowhere else in the Antilles, including Heraclides machaonides (Papilionidae) and Dismorphia spio (Pieridae) (Riley, 1975). There may have been other species that are restricted today only on Hispaniola, and Clench’s (1964) assumptions about Pleistocene extirpation in Puerto Rico might be correct for these organisms, but it probably is unnecessary to invoke Pleistocene mechanisms. As additional biodiversity surveys are completed on Puerto Rico, additional Hispaniolan species may be recorded (Smith et al., 1994; Ramos, 1996). The apparent lack of species in common between Hispaniola and Puerto Rico may be simply seasonality or a lack of collecting in various microhabitats.

The Biogeography of the West Indian Butterflies (Lepidoptera)

145

FIGURE 7 The geographical distribution of the primitive danaid genus Anetia in Mexico, Central America, and the West Indies (stippled areas) reflects its past geological history. See text for further details.

In contrast, the distribution of Pyrgus crisia (Herrich-Schaeffer) does suggest that it was attached to Puerto Rico and subsequently dispersed over Hispaniola and to Cuba when those islands were in closer proximity than at present (Figure 5). Few other species of butterflies show this distributional pattern, and the relationships remain obscure. Recent records (Hernandez et al., 1998) have located this species in eastern Cuba so it is also possible that P. crisia was part of the Eastern Cuba Northern Hispaniola plate and simply dispersed to Puerto Rico, perhaps via Mona Island (Smith et al., 1988). The primitive danaid genus Anetia displays a distributional pattern that conforms to the pattern of Battus (Figure 7). The only mainland Anetia has two subspecies, one in Mexico and northern Central America (Nuclear Central American one) and a derived one from Costa Rica and Panama; all Anetia are associated with montane to submontane habitats. Ackery and Vane-Wright (1984) originally considered Anetia to be a sister group of Lycorea. Recent life history studies of Anetia (Ivie et al., 1990; Brower et al., 1992) from Hispaniola suggest that Anetia is perhaps a relict Antillean group and is most closely aligned with Euploea, a genus endemic to the Indomalayan region. Currently Cuba and Hispaniola have one endemic Anetia species each, and each shares two species; there is one recent record for Jamaica (Vane-Wright et al., 1992), and none known from Puerto Rico. This distribution suggests that the genus arose on the northern end of the proto-Greater Antilles, but perhaps excluded Puerto Rico. Perhaps most Anetia species were isolated on the eastern Cuban central Hispaniolan block during the Oligocene and evolved on the separate fragments when that block split. Geological and further biogeographical evidence suggests that the evolution of the Jamaican fauna is the result of its relatively late connection with Nuclear Central America. Jamaica, the west and central Cuban plates, and the southern Hispaniolan plate were all approximate or adjacent to Nuclear Central America in the Eocene (Figure 5). The evolution of the most spectacular of the Antillean butterflies, Pterourus homerus (Fabricius), is of major interest here. The sister taxon of P. homerus is P. garamas (Huebner), a butterfly found today chiefly in the mountains of western Mexico and Central America (Jordan, 1908 [1907–1909]). Pterourus homerus is found in the submontane forests of Jamaica (Brown and Heineman, 1972). The valvae of the male genitalia of

146

Biogeography of the West Indies: Patterns and Perspectives

a

b 1 mm

c

d

FIGURE 8 The possible evolutionary affinities of the Jamaican fauna are observed in the male valvae of selected Pterourus species; (a) P. homerus, Jamaica; (b) P. cleotas, Colombia; (c) P. garamas, Mexico; (d) P. esperanza, Mexico. See text for details of the relationships.

P. homerus and its near congeners (P. garamas, P. cleotus, P. esperanza) are illustrated (Figure 8). The morphological similarity among these taxa strongly suggests that the progenitors of P. homerus and its sister group were originally closely aligned toward the west with Mexico–Central America as shown in Pindell and Dewey (1982) and later refined by Perfit and Williams (1989) and Pindell and Dewey (1990) and that Jamaica actually was to the west of its current position, perhaps accreted to this western spur during Eocene–Oligocene. This is in agreement with the positions suggested by Burke et al. (1984), and it requires that at least part of Jamaica remain emergent, as suggested by Case et al. (1984) and Perfit and Williams (1989). There are no other Pterourus in the Antilles (Hancock, 1983; J. S. Miller, 1987a, 1987b) other than P. palamedes and troilus, apparent vagrants on Cuba (Riley, 1975). Pterourus homerus is at present found both east and west of the Blue Mountains and is generally associated with shales or calcareous rocks (T. Turner, personal communication), but it is quite possible that its progenitors were part of a vicariance event centered on that part of the Blue Mountains that was emergent during Jamaica’s early geological history. If this scenario were not true, one would have to require long-distance dispersal and evolution from the Miocene onward to account for P. homerus, and the question of why this insect is endemic only on Jamaica rather than Cuba must be addressed. Further evidence of the separation of Jamaican fauna from that of the rest of the Greater Antilles is presented by Johnson and Smith (1993), in Platynus (Coleoptera) (Liebherr, 1988) and in Eleutherodactylus (Amphibia) (Hedges, 1989). The hesperiine genus, Wallengrenia, is widely distributed throughout North and South America and the Western Antilles and is an example of a number of the vicariant events previously discussed. Two species, W. otho (J. E. Smith) and egeremet (Scudder) (after Burns, 1985) are commonly found in the United States. The Neotropical species, including those represented in the Caribbean are currently under revision (J. Miller, in preparation). Based on comparative morphological examination, the genus Wallengrenia includes two species in eastern South America, W. premnas (Wallengren) W. otho, which in turn is subdivided into two subspecies, W. o. curassavica (Snellen) and W. o. sapuca Evans. Three subspecies of W. otho are recognized from Central America. However, the greatest species diversity within the genus is in the West Indies, with four species and one new subspecies represented (Figure 9). The darker species of these, W. misera (Lucas) is from Cuba and the northern Bahamian Islands. Wallengrenia druryi (Latreille) is restricted to Hispaniola, Puerto Rico, and the southern Bahamas. The bright fulvous species, W. ophites (Mabille), is found in the Lesser Antilles southward to Trinidad.

The Biogeography of the West Indian Butterflies (Lepidoptera)

147

o m o

d op

v

o,p

FIGURE 9 The distribution of the hesperine genus Wallengrenia (after J. Miller, in preparation) incorporates a number of vicariant events. Wallengrenia otho (o) is widely distributed, as is W. premnas in South America. Antillean taxa include W. misera (vertical cross hatching and m), W. druryi (light stippling and d), W. vesuria (heavy stippling and v), and W. ophites (op). See text for additional discussion.

The present geographical range of Wallengrenia in Central America, and particularly in Mexico, is quite complex. Wallengrenia otho curassavica (Snellen) inhabits on the western slopes of the Sierra Madre Occidental, with nominate W. otho in the east. The other Caribbean species, W. vesuria (Ploetz), is endemic to Jamaica and morphologically more closely resembles western Mexican W. o. curassavica than any other Antillean population, thus tending to support our modified Jamaican biogeographical model. Another species in the Greater Antilles that has been somewhat of an anomaly and is now known to be of Mexican origin is Hesperia nabokovi (Bell & Williams), the only Hesperia recorded specifically from Hispaniola. Burns (1987, 1989) has recently reviewed this species and subsequently moved it from Atalopedes to Hesperia based on genitalic characters. Emmel and Emmel (1990) provided additional supportive documentation to this generic change with an illustrated life history of this unusual species. A similar, yet somewhat complex, distributional pattern is found in Nesiostrymon (Lycaenidae). This genus was initially thought to be monobasic, but it is now known to have at least one Mexican species (K. Johnson, 1991). Its sister group, Terra, contains a number of mainland species and a recently discovered Antillean species, T. hispaniola. The sister group of these two species also contains only mainland taxa. Johnson postulates a late Mesozoic vicariance of the Nesiostrymon and Terra from Central America and subsequent evolution on the islands during the Tertiary, not unlike the pattern shown for other genera.

PLIOCENE

TO

HOLOCENE

Current evidence appears to indicate no recent vicariance events. The only possible ones involve the Bahamas, and as we have indicated, the recent geological history of Florida and the Bahamas

148

Biogeography of the West Indies: Patterns and Perspectives

in association with Cuba is complex. Burke (1988) indicated that during the mid-Tertiary, Cuba overrode the Bahamas Rise. There was a large emergent Great Bahamas Bank during periods of the Pleistocene glacial maxima with subsequent reflooding of the bank. We have reviewed the current distributions of butterflies and species diversity of these islands (L. D. Miller et al., 1989, 1992, 1998). The southern Bahamas share far more taxa with Cuba than previous believed, and the origin of some of the Cuban endemic taxa is now in question (Miller and Simon, 1998; Hernandez et al., 1998). Similarly during the Pleistocene, Florida underwent a similar reduction and extension of land area (Webb, 1990) with a further exchange of the butterfly fauna with the Bahamas.

THE LESSER ANTILLES Maury et al. (1990) reviewed the geological history of the Lesser Antilles. Although this area was once considered a single volcanic arc of Eocene age, geologically it is far more complex with the “Southern Volcanic Caribbees” and the two northern arcs: “Northern Volcanic Caribbees” or inner arc from Dominica to Bass Terre, Guadeloupe and the outer arc or the “Northern Limestone Caribbees,” which includes Grande Terre, Guadeloupe to Anguilla. Although the latter have a more ancient geological history and volcanism, these “limestone” islands appear to have a more recent terrestrial fauna with the islands of Grande Terre, Marie Galante emerging during the Pleistocene. Pinchon and Enrico (1969) provided insight into the biodiversity of the Lesser Antilles with an emphasis on the “Antilles Françaises” with further discussion by Riley (1972). During the past 12 years, this area has been the focus of our field studies due to the veritable lack of documented records. The most obvious members of the fauna in the “Southern Volcanic Caribees” are some dispersalists that doubtless came from Trinidad (Riley, 1975; Scott, 1986; Smith et al., 1994), and the few possible vicariants seem to have their origin in northern South America. However, there are some taxa such as Dryas iulia, Wallengrenia ophites, Urbanus, and Ephyriades that are widespread throughout these islands and remain indicator species for the Lesser Antilles. In other cases, we suspect dispersal for much of the Lesser Antilles, although there are some endemic taxa present, especially on Dominica, which has the largest number of species (51). As with the Greater Antilles, land area and the availability of appropriate ecological niches play significant roles in the number of species present and species diversity among these islands (Miller and Miller, in preparation).

SUMMARY Previous biogeographical theories are discussed, and previous studies on the biogeography of West Indian butterflies are enumerated. Most of these models have relied primarily on a dispersalist type and heavily influenced by Pleistocene events, with the exception of the model postulated by Shields and Dvorak (1979), which referred a number of butterfly distributions to the late Jurassic–early Cretaceous opening of the Atlantic. We accept the findings of Common (1975, 1990), Smart and Hughes (1984), and Whalley (1986) that the origin of the butterflies occurred in the Cretaceous with some primitive moths present in the Jurassic. Labandeira and Sepkoski (1993) provide further supportive documentation for the earlier origin of all Insecta and present an alternative view for the coevolution of plant/insect relationships. A synopsis of the evidence on the age of butterflies is provided. This demonstrates that some lineages are much older than previously believed; for example, most of the Florissant (latest Eocene) fossils are congeneric with and/or very near existing species (J. Y. Miller and Brown, 1989; Common, 1990; Labandeira and Sepkoski, 1993). These data suggest that modern butterfly genera were well differentiated by the late Cretaceous to earliest Tertiary, and therefore more easily explained by a vicariance model than previously believed. Additional data suggesting that butterflies are not uniformly good dispersalists are presented. Other data and information presented on the endemicity of West Indian butterflies suggest that the fauna is rather old. A vicariance/dispersal model, originally proposed for the biogeography of West

The Biogeography of the West Indian Butterflies (Lepidoptera)

149

Indian butterflies (Miller and Miller, 1989), conformed in most respects to the Pindell and Dewey (1982) model and is updated based on the recent geological evidence presented by Perfit and Williams (1989) and Pindell and Barrett (1990). While there was probably some long-range dispersal, most of the butterfly stocks can be better ascribed to a vicariance model followed by shorterdistance dispersal interspersed with the vicariance events. Most butterfly groups are considered unlikely candidates for long-distance dispersal because of their fragility and lack of vagility. Many of the original butterfly stocks were on the proto-Greater Antilles and evolved in situ within the islands. In several insular butterfly species, there appears to be a selective advantage as a sedentary insect. A chronology is given for the evolution and vicariance of several Antillean butterfly groups. Based on present taxonomic relationships in different butterfly families and previous and present biogeographical studies, it is postulated that Jamaica did indeed occupy a more westerly position, against the extension of western Central America, and that the Southern Hispaniolan block might have been in closer contact with the Yucatan peninsula during the Eocene than originally believed (Pindell and Dewey, 1982; Perfit and Williams, 1989; Pindell and Barrett, 1990). Areas of continuous emergence are postulated to be the Blue Mountains of Jamaica and the Massif de La Selle of Hispaniola, potential refugia for the butterflies of the parts of their respective islands. This reconstruction is in closer harmony with the positions of these island masses during the Oligocene and the later positions of the two landmasses and provides supportive evidence for some of the more obvious similarities between the fauna of these insular areas and Central America than are shown on most other segments that formed the western Greater Antilles. The geological history of the Lesser Antilles is reviewed and is far more complex than originally thought with portions of this active volcanic arc ranging from the Eocene through the Pleistocene. As might be expected, our current knowledge of the biogeography of the butterfly fauna remains unclear. Although most of these butterflies originated through dispersal from South America toward the south and from Puerto Rico to the west, a number of endemic taxa are present, particularly on Dominica and St. Vincent and other genera that are biological indicators of only the Lesser Antilles. These latter butterflies would therefore indicate an older origin. The recent geological history of the Caribbean Basin is complex and that of Florida, the Bahamas, and Cuba is no exception. The fact that Cuba overrode the Bahamas Rise and that there was a large emergent Great Bahamas Bank during periods of the Pleistocene glacial maxima with subsequent reflooding of the bank have both played a significant role in the current distribution of butterflies for all three areas. The southern Bahamas share far more species with Cuba than previously believed, and the origin of some Cuban endemic taxa is now in question.

ACKNOWLEDGMENTS It has been gratifying to note the impact the publication of this chapter in the first edition has had on the study of biogeography of Lepidoptera of the region. Lepidopterists now look beyond the conventional geographical boundaries to review and locate closely aligned taxonomic groups. Our colleagues and associates continue to provide us with unpublished information for this and other studies in progress. We would particularly like to thank Dr. Dale Jenkins of Allyn Museum of Entomology, Florida; Museum of Natural History, University of Florida, Sarasota; John Shuey, Nature Conservancy, Indianapolis, Indiana; Dr. C. V. Covell, Jr., University of Louisville; Dr. Kurt Johnson, Environmental Affairs, Ethical Culture Society, New York; and Stuart J. Ramos and Luis Roberto Hernandez, Department of Biology, University of Puerto Rico, Mayaguez. Dr. Thomas W. Turner, Clearwater, Florida, and lately of Jamaica, provided valuable data on the distribution and ecology of Pterourus homerus and other endemic taxa. Special thanks are due Dr. Michael R. Perfit, Department of Geology, University of Florida, for discussing geological constraints with us in the original paper (1989). Special thanks to Dr. Herbert Meyer, Florissant Fossil Beds National Monument, who provided current information on the age of the Florissant deposits. Additional thanks are due Dr. Gerardo Lamas, Universidad Mayor de San Marcos, Museum Javier Prado, Lima, Peru

150

Biogeography of the West Indies: Patterns and Perspectives

and Dr. Johnson for discussions on diverse biogeographical theories. We would particularly like to thank our special colleagues, Dr. David Spencer Smith, Hope Entomological Collections, Oxford University, and Dr. Mark J. Simon and Stephen R. Steinhauser, both associates of Allyn Museum of Entomology, for their patience and for continuing to serve as sounding boards for our lengthy discussions on various projects on West Indian butterflies. To our colleague, Dr. Charles Woods, our special thanks, for convening the original symposium that brought together an extraordinary group of scientists with such widely divergent opinions and taxonomic experiences. Our research efforts in the West Indies have been supported in part through the generosity of private donors and in the Lesser Antilles in part through the National Geographic Society (No. 9726-92).

LITERATURE CITED Ackery, P. R. and R. I. Vane-Wright. 1984. Milkweed Butterflies: Their Cladistics and Biology. British Museum (Natural History), London. 425 pp. Alayo, P. D. and L. R. Hernandez. 1987. Atlas de las mariposas diurnas de Cuba (Lepidoptera: Rhopalocera). Editorial Cientifico-tecnica, La Habana. Anderson, R. A. 1974. Three new U.S. records and other unusual captures from the lower Florida keys. Journal of the Lepidopterists’ Society 28:354–358. Bates, M. 1936. The butterflies of Cuba. Bulletin of the Museum of Comparative Zoology, Harvard 78:63–258. Brower, L. P., M. A. Ivie, L. S. Fink, J. R. Watts, and R. A. Moranz. 1992. Life History of Anetia briarea and its bearing on the evolutionary relationships of the Danainae (Lepidoptera: Nymphalidae). Tropical Lepidoptera 3:64–73. Brown, F. M. 1976. Oligodonta florissantensis, gen. n., sp. nov. (Lepidoptera:Pieridae). Bulletin of the Allyn Museum (37):4 pp. Brown, F. M. 1978. The origins of the West Indian butterfly fauna. Pp. 5–30 in Gill, F. B. (ed.). Zoogeography in the Caribbean. Academy of Natural Sciences, Philadelphia, Special Publication 13. Brown, F. M. and B. Heineman. 1971. Jamaica and Its Butterflies. E. W. Classey, London. 478 pp. Brundin, L. Z. 1971. Phylogenetics and systematics. Systematic Zoology 21:69–79. Brundin, L. Z. 1981. Croizat’s panbiogeography versus phylogenetic biogeography. Pp. 94–138 in Nelson, G. and D. E. Rosen (eds.). Vicariance Biogeography: A Critique. Columbia University Press, New York. Burke, K. 1988. Tectonic evolution of the Caribbean. Annual Review of Earth and Planetary Sciences 16:201–230. Burke, K., C. Cooper, J. F. Dewey, P. Mann, and J. L. Pindell. 1984. Caribbean tectonics and relative plate motions. Geological Society of America Memoir 162:31–63. Burns, J. M. 1985. Wallengrenia otho and W. egeremet in eastern North America (Lepidoptera: Hesperiidae: Hesperiinae). Smithsonian Contributions to Zoology 423:1–39. Burns, J. M. 1987. The big shift: nabokovi from Atalopedes to Hesperia (Hesperiidae). Journal of the Lepidopterists’ Society 41:173–186. Burns, J. M. 1989. Phylogeny and zoogeography of the bigger and better genus Atalopedes (Hesperiidae). Journal of the Lepidopterists’ Society 43:11–32. Cain, S. A. 1944. Foundations of Plant Geography. Harper & Brother, New York. 556 pp. Carey, S. W. 1958. A tectonic approach to continental drift. Pp. 177–355 in Carey, S. W. (convenor). Continental Drift, A Symposium. Hobart University, Tasmania. Carpenter, F. M. 1930. A review of our present knowledge of the geological history of insects. Psyche 37:15–23. Carlquist, S. J. 1974. Island Biology. Columbia University Press, New York. Case, J. E., T. L. Holcombe, and R. G. Martin. 1984. Map of geological provinces in the Caribbean region. Geological Society of America Memoir 162:1–30. Clench, H. K. 1964. A synopsis of the West Indian Lycaenidae, with remarks on their zoogeography. Journal of Research on the Lepidoptera 2:247–270. Clench, H. K. 1977. A list of the butterflies of Andros, Bahamas. Annals of the Carnegie Museum 49:1–30. Clench, H. K. and K. J. Bjorndahl. 1980. Butterflies of Great and Little Inagua, Bahamas. Annals of the Carnegie Museum 49:1–30. Common, I. F. B. 1975. Evolution and classification of the Lepidoptera. Annual Review of Entomology 20:183–203. Common, I. F. B. 1990. Moths of Australia. Melbourne University Press, Melbourne.

The Biogeography of the West Indian Butterflies (Lepidoptera)

151

Comstock, W. P. 1944. Insects of Porto Rico and the Virgin Islands. Rhopalocera or butterflies. Pp. 421–622 in Scientific Survey of Porto Rico and the Virgin Islands, 12, Part 4. New York Academy of Sciences, New York. Comstock, W. P. and E. I. Huntington. 1943. Lycaenidae of the Antilles (Lepidoptera, Rhopalocera). Annals of the New York Academy of Sciences 45:49–130. Coney, P. J. 1983. Plate tectonic constraints on biogeographic connections between North and South America. Annals of the Missouri Botanical Gardens 69:432–443. Cracraft, J. 1973. Continental drift, paleoclimatology, and the evolution and biogeography of birds. Journal of Zoology (London) 169:455–545. Croizat, L. 1958. Panbiogeography. Private publication, Caracas, Venezuela. Croizat, L., G. Nelson, and D. E. Rosen. 1974. Centers of origin and related concepts. Systematic Zoology 23:265–287. Darlington, P. J. 1957. Zoogeography: The Geographic Distribution of Animals. John Wiley, New York. Darlington, P. J. 1965. Biogeography of the Southern End of the World: Distribution and History of the Far-Southern Life and Land, with an Assessment of Continental Drift. Harvard University Press, Cambridge, Massachusetts. Dickson, C. G. C. and D. M. Kroon (eds.). 1978. Pennington’s Butterflies of Southern Africa. A. Donker, Johannesburg. Donnelly, T. W. 1985. Mesozoic and Cenozoic Plate Evolution of the Caribbean region. Pp. 89–121 in Stehli, F. G. and S. D. Webb (eds.). The Great American Biotic Interchange. Plenum Press, New York. Donnelly, T. W. 1988. Geologic constraints on Caribbean biogeography. Pp. 15–37 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Comstock Publishing Associates, Cornell University Press, Ithaca, New York. Durden, C. J. and H. Rose. 1978. Butterflies of the middle Eocene: the earliest occurrence of fossil Papilionidae. Pearce-Sellard Series, Texas Memorial Museum 28:1–25. Du Toit, A. L. 1927. A geological comparison of South America with South Africa. Publication of the Carnegie Institute of Washington 381:1–158. Du Toit, A. L. 1937. Our Wandering Continents: An Hypothesis of Continental Drift. Oliver & Boyd, Edinburgh. Eliot, J. N. 1973. The higher classification of the Lycaenidae (Lepidoptera): a tentative arrangement. Bulletin of the British Museum (Natural History), Entomology 28:371–505. Emmel, T. C. and J. F. Emmel. 1990. The life history and ecology of Hesperia nabokovi in the Dominican Republic (Lepidoptera: Hesperiidae). Tropical Lepidoptera 1:77–82. Endler, J. A. 1982. Pleistocene forest refuges: fact or fancy? Pp. 641–657 in Prance, G. T. (ed.). Biological Diversification in the Tropics. Columbia University Press, New York. Evans, W. H. 1937. A Catalogue of the African Hesperiidae in the British Museum (Natural History). British Museum Trustees, London. Evans, W. H. 1949. A Catalogue of the Hesperiidae of Europe, Asia, and Australia in the British Museum (Natural History). British Museum Trustees, London. 502 pp. Evans, W. H. 1952. A Catalogue of the American Hesperiidae in the British Museum (Natural History), Part 2. British Museum Trustees, London. Evans, W. H. 1955. A Catalogue of the American Hesperiidae in the British Museum (Natural History), Part 4. British Museum Trustees, London. Flint, O. S., Jr. 1977. Probable origins of the West Indian Trichoptera and Odonata faunas. Pp. 215–223. in Crichton, M. I. (ed.). Proceedings of the Second International Symposium on Trichoptera, Reading, U.K. Forbes, W. T. M. 1932. How old are the Lepidoptera? American Naturalist 66:452–460. Fox, R. M. 1963. Affinities and distribution of the Antillean Ithomiidae. Journal of Research on the Lepidoptera 2:173–184. Guyer, C. and J. M. Savage. 1986. Cladistic relationships among anoles (Sauria: Iguanidae). Systematic Zoology 35:509–531. Hancock, D. L. 1983. Classification of the Papilionidae (Lepidoptera): a phylogenetic approach. Smithersia (2):48 pp. Harvey, D. J. and H. K. Clench. 1980. Dianesia, a new genus of Riodinidae from the West Indies. Journal of the Lepidopterists’ Society 34:127–132. Hedges, S. B. 1989. Evolution and biogeography of West Indian frogs of the genus Eleutherodactylus: slowevolving Loci and the Major Groups. Pp. 305–370 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida.

152

Biogeography of the West Indies: Patterns and Perspectives

Hennig, W. 1966. Phylogenetic Systematics. University of Illinois Press, Urbana. Hernandez, L. R., L. D. Miller, J. Y. Miller, M. J. Simon, and T. W. Turner. 1998. New records and range extensions of butterflies from eastern Cuba. Caribbean Journal of Science 34:324–327. Holloway, J. D. 1979. A Survey of the Lepidoptera, Biology and Ecology of New Caledonia. W. Junk, The Hague. Howe, W. H. 1975. Eunica. Pp. 126–127 in Howe, W. H. (ed.). The Butterflies of North America. Doubleday & Co., New York. Ivie, M. A., T. K. Philips, and K. A. Johnson. 1990. High altitude aggregation of Anetia briarea Godart on Hispaniola (Nymphalidae: Danaidae). Journal of the Lepidopterists’ Society 44: 209–214. Jenkins, D. W. 1984. Neotropical Nymphalidae. II. Revision of Mycelia. Bulletin of the Allyn Museum (87):64 pp. Jenkins, D. W. 1990. Neotropical Nymphalidae VIII. Revision of Eunica. Bulletin of the Allyn Museum 131:1–177. Johnson, K. 1991. Cladistics and biogeography of two trans-Caribbean hairstreak genera: Nesiostrymon and Terra (Lepidoptera, Lycaenidae). American Museum Novitates 3011:1–43. Johnson, K. and H. Descimon. 1989. Proper generic and species status of Antillean “Prepona” butterflies with description of a new subspecies from Puerto Rico (Nymphalidae: Charaxinae). Caribbean Journal of Science 25:45–53. Johnson, K. and D. S. Smith. 1993. A remarkable new butterfly species from Jamaica (Lepidoptera: Lycaenidae), with notes on Jamaican Endemics and their sister species. Reports of the Museum of Natural History, University of Wisconsin (Steven’s Point) 24:1–14. Jordan, K. 1908 (1907–1909). Papilionidae. Pp. 11–51 in Seitz, A. (ed.). The Macrolepidoptera of the World, Vol. 5. A. Kernan, Stuttgart. Klots, A. B. 1951. A Field Guide to the Butterflies of North America, East of the Great Plains. Houghton Mifflin, Boston, Massachusetts. Labandeira, C. C. and J. I. Sepkoski. 1993. Insect diversity in the fossil record. Science 261:310–315. Liebherr, J. K. 1986. Barylaus, a new genus (Coleoptera: Carabidae) endemic to the West Indies with Old World affinities. Journal of the New York Entomological Society 94:83–97. Liebherr, J. K. 1988. Biogeographic patterns of West Indian Platynus carabid beetles (Coleoptera). Pp. 121–152 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Comstock Publishing Associates, Cornell University Press, Ithaca, New York. Lundberg, J. G., A. Machado-Allison, and R. F. Kay. 1986. Miocene characid fishes from Colombia: evolutionary stasis and extirpation. Science 234:208–209. MacArthur, R. H. and E. O. Wilson. 1967. The Theory of Island Biogeography. Princeton University Press, Princeton, New Jersey. Matthew, G. A. 1915. Climate and evolution. Annals of the New York Academy of Science 24:171–318. Maury, R. C., G. K. Westbrook, P. E. Baker, P. Bouysse, and D. Westercamp. 1990. Geology of the Lesser Antilles. Pp. 141–146 in Dengo, G. and J. E. Case (eds.). The Caribbean Region, The Geology of North America, Vol. H. Geological Society of America, Boulder, Colorado. Miller, J. S. 1987a. Phylogenetic studies in the Papilioninae (Lepidoptera: Papilionidae). Bulletin of the American Museum of Natural History 186:365–512. Miller, J. S. 1987b. Host-plant relationships in the Papilionidae (Lepidoptera): parallel cladogenesis or colonization? Cladistics 3:105–120. Miller, J. Y. 1986. The Taxonomy, Phylogeny and Zoogeography of the Neotropical Moth Subfamily Castniinae (Lepidoptera: Castnioidea: Castniidae). Unpublished Ph.D. dissertation, University of Florida, Gainesville. Miller, J. Y. In preparation. A review of the Neotropical species of Wallengrenia Berg (Lepidoptera:Hesperiidae) with description of two new taxa. Miller, J. Y. and F. M. Brown. 1989. A new Oligocene fossil butterfly, Vanessa amerindica (Lepidoptera: Nymphalidae) from the Florissant formation, Colorado. Bulletin of the Allyn Museum 126:1–9. Miller, L. D. 1965. A review of the West Indian “Choranthus.” Journal of Research on the Lepidoptera 4:259–274. Miller, L. D. 1968. The higher classification, phylogeny and zoogeography of the Satyridae (Lepidoptera). Memoirs of the American Entomological Society 24:1–174. Miller, L. D. In preparation. The higher classification, phylogenetics, and biogeography of the Satyridae (Lepidoptera): a reappraisal. [tentative title].

The Biogeography of the West Indian Butterflies (Lepidoptera)

153

Miller, L. D. and F. M. Brown. 1983. Butterfly taxonomy: a reply. Journal of Research on the Lepidoptera 20:193–198. Miller, L. D. and J. Y. Miller. 1989. The biogeography of the West Indian Butterflies (Lepidoptera: Papilionoidea, Hesperioidea): a vicariance model. Pp. 229–262 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Miller, L. D. and J. Y. Miller. 1997. Gondwanian butterflies: the African-South America connection. Metamorphosis (Suppl. 3):42–51. Miller, L. D. and M. J. Simon. 1998. A preliminary annotated list of the butterflies of Cat Island, Bahamas. Bahamas Journal of Science 6:35–42. Miller, L. D. and M. J. Simon. 1998. Rediscovery of the rare, “endemic” Cuban butterfly, Achylodes munroei Bell, with notes on its behavior and possible origin. Caribbean Journal of Science 34:325–329. Miller, L. D. and S. R. Steinhauser. 1992. Butterflies of the Cayman Islands, with description of a new subspecies. Journal of the Lepidopterists’ Society 46:119–127. Miller, L. D., D. J. Harvey, and J. Y. Miller. 1985. Notes on the genus Euphyes, with description of a new subspecies (Lepidoptera: Hesperiidae). Florida Entomologist 68:323–325. Miller, L. D., M. J. Simon, and D. J. Harvey. 1992. The butterflies (Insecta: Lepidoptera) of Crooked, Acklins, and Mayaguana Islands, Bahamas, with a discussion of the biogeographical affinities of the southwestern Bahamas and description of a new subspecies by H. K. Clench. Annals of the Carnegie Museum 61:1–31. Minno, M. C. and T. C. Emmel. 1993. Butterflies of the Florida Keys. Scientific Publishers, Gainesville, Florida. Murata, Y. 1998. Notes of the evolutionary process of butterflies and butterfly fossils. Part 1. Butterflies. The Butterfly Society of Japan 20:4–17. Nijout, H. F. 1991. The Development and Evolution of Butterfly Wing Patterns. Smithsonian Institution Press, Washington, D.C. Patterson, C. 1981. Methods of paleobiogeography. Pp. 446–489 in Nelson, G. and D. E. Rosen (eds.). Vicariance Biogeography: A Critique. Columbia University Press, New York. Perfitt, M. R. and B. C. Heezen. 1978. The geology and evolution of the Cayman Trench. Geological Society of America Bulletin 89:1155–1174. Perfitt, M. R. and E. E. Williams. 1989. Geological constraints and biological retrodictions in the evolution of the Caribbean Sea and its islands. Pp. 47–102 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Pinchon, R. and P. Enrico. 1969. Faune des Antilles Françaises. Les papillons. Fort de France, Martinique. Pindell, J. and J. F. Dewey. 1982. Permo-Triassic reconstruction of western Pangea and the evolution of the Gulf of Mexico/Caribbean region. Tectonics 1:179–211. Pindell, J. L. and S. F. Barrett. 1990. Geological evolution of the Caribbean regions: a plate tectonic perspective. Pp. 405–432 in Dengo, G. and J. E. Case (eds.). The Caribbean Region. The Geology of North America, Vol. H. Geological Society of America, Boulder, Colorado. Powell, J. E. 1980. Evolution of larval food preferences in Microlepidoptera. Annual Review of Entomology 25:133–159. Preston, F. W. 1962. The canonical distribution of commonness and rarity. Ecology 43:185–215, 410–432. Ramos, S. J. 1996. An annotated checklist of the butterflies of Puerto Rico. Annals of the New York Academy of Sciences 776:217–236. Raven, P. H. and D. I. Axelrod. 1974. Angiosperm biogeography and past continental movements. Annals of the Missouri Botanical Garden 61:539–673. Riley, N. D. 1975. A Field Guide to the Butterflies of the West Indies. Collins Sons & Co., London. Romeo, E. J. and S. Archangelsky. 1986. Early Cretaceous angiosperm leaves from southern South America. Science 234:1580–1582. Rosen, D. E. 1976. A vicariance model of Caribbean biogeography. Systematic Zoology 24:431–464. Rosen, D. E. 1985. Geological hierarchies and biogeographic congruence in the Caribbean. Annals of the Missouri Botanical Garden 72:636–659. Savage, J. M. 1973. The geographic distribution of frogs: patterns and predictions. Pp. 349–445 in Vial, J. L. (ed.). Evolutionary Biology of the Anura. University of Missouri Press, Columbia. Savage, J. M. 1974. The isthmian link and the evolution of Neotropical mammals. Contributions in Science of the Natural History Museum of Los Angeles County 260:1–51. Savage, J. M. 1983. The enigma of the Central American herpetofauna: dispersals or vicariance? Annals of the Missouri Botanical Garden 69:464–547.

154

Biogeography of the West Indies: Patterns and Perspectives

Schuchert, C. 1935. Historical Geology of the Antillean-Caribbean Region or Lands Bordering the Gulf of Mexico and the Caribbean Sea. John Wiley & Sons, New York. Schwanwitsch, B. N. 1924. On the ground-plan of wing-pattern in nymphalids and certain other families of rhopalocerous Lepidoptera. Proceedings of the Zoological Society London 1924:509–528. Schwartz, A. 1983. Haitian Butterflies. Special Publication of the Museo Nacional de Historia Natural, Santo Domingo, Dominican Republic. Schwartz, A. 1989. The Butterflies of Hispaniola. University of Florida Press, Gainesville. Scott, J. A. 1972. Biogeography of the Antillean butterflies. Biotropica 4:32–45. Scott, J. A. 1986. Distribution of Caribbean butterflies. Papilio (new series) 3:1–26. Shields, O. 1979. Evidence for initial opening of the Pacific Ocean in the Jurassic. Palaeogeography, Palaeoclimatology, Palaeoecology 26:181–220. Shields, O. 1985. Zoogeography of the Libytheidae (Snouts or Breaks [sic]). Tokurana 9:1–58. Shields, O. 1989. Systematic position of the Libytheidae, diphylogeny of Rhopalocera, and heteroceran ancestry of Rhopalocera (Lepidoptera). Tyo`to Ga, Lepidopterological Society of Japan, 40:197–228. Shields, O. and S. V. Dvorak. 1979. Butterfly distribution and continental drift between the Americas, the Caribbean and Africa. Journal of Natural History 13:221–250. Shreeve, T. G. 1992. Monitoring butterfly movements. Pp. 120–138 in Dennis, R. L. H. (ed.). The Ecology of Butterflies in Britain. Oxford University Press, Oxford. Shuey, J. A. 1986. The Ecology and Evolution of Wetland Butterflies, Emphasis on the Genus Euphyes (Lepidoptera: Hesperiidae). Unpublished Ph.D. dissertation, Ohio State University, Columbus. Shuey, J. A. 1994. Phylogeny and biogeography of Euphyes Scudder (Hesperiidae). Journal of the Lepidopterists’ Society 47:261–278. Simon, M. J. and L. D. Miller. 1986. Observations on the butterflies of Great Inagua Island, Bahamas, with records of three species new to the island. Bulletin of the Allyn Museum (105):14 pp. Simpson, G. G. 1952. Probabilities of dispersal in geologic time. Bulletin of the American Museum of Natural History 99:163–176. Simpson, G. G. 1956. Zoogeography of West Indian mammals. American Museum Novitates 1759:1–28. Smart, J. and N. F. Hughes. 1973. The insect and the plant: progressive palaeoecological integration. Pp. 143–155 in van Emden, H. F. (ed.). Insect/Plant Relationships. Symposium of the Royal Entomological Society of London, No. 6. Smith, D. L. 1985. Caribbean plate relative motions. Pp. 17–48 in Stehli, F. G. and S. D. Webb (eds.). The Great American Biotic Interchange. Plenum Press, New York. Smith, D. S., S. J. Ramos, F. McKenzie, E. Munroe, and L. D. Miller. 1988. Biogeographical affinities of the butterflies of a “forgotten” island: Mona (Puerto Rico). Bulletin of the Allyn Museum (121):1–35. Smith, D. S., E. G. Munroe, and S. A. Ramos. 1989. Biogeographical affinities of the butterflies of the southwest Caribbean islands, San Andres and Providencia. Journal of the Lepidopterists’ Society 43:274–288. Smith, D. S., L. D. Miller, and F. McKenzie. 1991. The butterflies of Anegada, British Virgin Islands, with descriptions of a new Calisto (Satyridae) and a new Copeodes (Hesperiidae) endemic to the island. Bulletin of the Allyn Museum (133):1–25. Smith, D. S., L. D. Miller, and J. Y. Miller. 1994. The Butterflies of the West Indies and South Florida. Oxford University Press, Oxford. Sourakov, A. 1996. Notes on the genus Calisto. 1. Tropical Lepidoptera 7:91–112. Stehii, F. G. and S. D. Webb (eds.). 1985. The Great American Biotic Interchange. Plenum Press, New York. Sun, G., D. L. Dilcher, S. Zheng, and Z. Zhou. 1998. In search of the first flower: a Jurassic angiosperm, Archaefructus from northeast China. Science 282:1092–1095. Torre y Callejas, S. L. de la. 1954. An annotated list of the butterflies and skippers of Cuba. Journal of the New York Entomological Society 62:1–25, 113–128, 189–192, 207–249. Wallace, A. R. 1876. The Geographical Distribution of Animals. Vols. 1 and 2. Harpers, New York. Webb, S. A. 1990. Historical Biogeography. Pp. 70–100 in Myers, R. L. and J. J. Ewel (eds.). Ecosystems of Florida. University of Central Florida Press, Orlando. Wegener, A. 1915. Die Entstehung der Kontinente und Ozeane. Sammlung Vieweg, 23:F. Vieweg und Sohn, Brauschweig. 144 pp. Whalley, P. 1986. A review of the current fossil evidence of Lepidoptera in the Mesozoic. Biological Journal of the Linnean Society 28:253–271. White, M. E. 1990. The Flowering of Gondwana. Princeton University Press, Princeton, New Jersey.

The Biogeography of the West Indian Butterflies (Lepidoptera)

155

Wilson, J. T. 1963. Hypothesis of earth’s behavior. Nature (London) 198:925–929. Woods, C. A. 1989. The biogeography of West Indian rodents. Pp. 741–798 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida.

and 11 Relationships Divergence Times of West Indian Amphibians and Reptiles: Insights from Albumin Immunology Carla Ann Hass, Linda R. Maxson, and S. Blair Hedges Abstract — Seven families of West Indian reptiles and two families of West Indian amphibians were investigated using the immunological technique of micro-complement fixation. These data allowed the examination of relationships among members of each of these families and provided estimates of divergences times, both within the West Indies as well as between mainland and island taxa. Some of these groups are the result of a relatively recent colonization and subsequent radiation (e.g., xenodontine snakes). Other groups show deeper divergences among the West Indian species and were much earlier arrivals to these islands (e.g., amphisbaenids). When examined in conjunction with the geological history of the Caribbean, the divergence times derived from the immunological data suggest overwater dispersal as the primary mechanism for colonization of the West Indies by these terrestrial vertebrates.

INTRODUCTION The islands of the West Indies harbor a diverse array of reptiles and amphibians, ranging from the minute gecko Sphaerodactylus parthenopion to the imposing Crocodylus rhombifer, from the blind, burrowing snake Typhlops to the arboreal hylid frogs. Endemic species representing five of the six extant major reptilian lineages (turtles, crocodilians, snakes, lizards, and amphisbaenians) are found on these islands, as are members of four families of frogs (Bufonidae, Dendrobatidae, Hylidae, and Leptodactylidae). Many species are endemic to individual islands, and often are restricted to very small areas within those islands (Schwartz and Henderson, 1991). In addition to morphological studies, data obtained by looking at the variation of molecules among species, both through indirect comparisons of proteins as well as direct comparisons of nucleotide sequences, can offer insights into both the relationships among taxa as well as the timing of divergence events within groups. While there have been molecular studies of some West Indian groups (see Hedges, 1996a, for references) most groups have not been investigated. In this study, we present immunological information for seven groups of reptiles and two families of frogs. The technique of micro-complement fixation (MC’F), which allows the estimation of the number of amino acid differences between proteins, has been used to investigate relationships and divergence times in many vertebrate groups, including West Indian taxa (Hedges et al., 1992; Hass et al., 1993; Hedges, 1996a). The new data presented here extend those studies to additional groups and species of West Indian amphibians and reptiles.

MATERIALS AND METHODS Antisera were prepared against 11 species of West Indian reptiles from seven squamate families, and 9 species of amphibians, representing two anuran families (Table 1). The collection localities 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

157

158

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 Titers and Slopes for Antisera against Serum Albumin from Selected West Indian Reptiles and Amphibians Family Bufonidae

Hylidae

Amphisbaenidae Anguidae

Iguanidae Teiidae Colubridae Tropidophidae Typhlopidae

Species

No. of Rabbits

Titer

Slope

Bufo guentheri (BG) B. marinus (BM) B. peltocephalus (BP) Calyptahyla crucialis (CC) Hyla vasta (HV) Osteopilus brunneus (OB) O. dominicensis (OD) O. septentrionalis (OS) Osteocephalus taurinus (OT) Amphisbaena schmidti (AM) Diploglossus delasagra (DD) D. pleei (DP) D. warreni (DW) Wetmorena haetiana (WE) Leiocephalus schreibersi (LE) Ameiva chrysolaema (AC) A. exsul (AE) Arrhyton landoi (AR) Tropidophis haetianus (TR) Typhlops platycephalus (TY)

1 2 2 2 2 2 2 3 2 1 1 1 2 1 1 1 1 1 1 1

1/2800 1/4200 1/1400 1/2000 1/1600 1/1800 1/3000 1/4700 1/1500 1/3200 1/3000 1/4000 1/1600 1/1500 1/4200 1/1800 1/4600 1/2400 1/4400 1/2700

350 400 370 350 460 400 400 400 330 400 320 300 350 400 450 330 360 450 450 350

for these species, and the species used as antigens are listed in the Appendix. The animals were sacrificed using cryothermy (Kennedy and Brockman, 1965). In some cases, plasma samples to be used for antibody preparation were pools of multiple individuals from the same population (Appendix). Albumin was isolated from pure plasma or plasma preserved with PPS using polyacrylamide electrophoresis modified from the method of Davis (1964). Antibodies to this extracted albumin were prepared in female New Zealand white rabbits following the method of Maxson et al. (1979) as modified by Hass and Hedges (1991). When antisera were prepared in more than one rabbit, the individual rabbit antisera were pooled in inverse proportion to their titers. Hutchinson and Maxson (1986) showed that antibodies prepared using one rabbit give approximately the same estimates of immunological distance (ID) as do antibody pools. Micro-complement fixation experiments were performed using standard protocols (Maxson and Maxson, 1990). The data are reported as ID units. These data sets provide primarily one-way estimates of ID values. While reciprocal comparisons give a more accurate approximation of ID values between taxa, one-way distances are useful indicators of the degree of amino acid difference between the albumins of two species. Data sets with reciprocal ID measurements were tested for nonrandom deviations from perfect reciprocity and, when appropriate, the data were corrected by the method of Cronin and Sarich (1975); these corrected data are used in discussion of the data sets. An independent calibration of the albumin immunological clock for each group investigated in this study is not possible because of the lack of fossil information or independent geological events to use as calibration points. A “standard” calibration (1 ID unit = 0.6 million years of divergence) has been derived for a number of vertebrate groups based upon both fossil and geological information (Wilson et al., 1977; Maxson, 1992), and its consistency over diverse vertebrate lineages justifies its use in this type of study (see the more detailed discussion in Hedges, 1996a). Some of

Relationships and Divergence Times of West Indian Amphibians and Reptiles

159

the new data reported here, and their taxonomic implications, already have been discussed elsewhere (Hedges et al., 1992; Hedges, 1996a).

RESULTS BUFONIDAE We were able to examine 5 of the 11 species of Bufo endemic to the West Indies using MC’F (Table 2). The immunological data suggest that the Cuban species B. peltocephalus and B. taladai are the most closely related species examined, at an ID of 8. The other Cuban species examined, B. longinasus, was as distinct from B. peltocephalus as was the Hispaniolan species B. guentheri. Bufo guentheri and B. lemur were separated by an ID value of 18. All of the Cuban species gave ID values within the same range (31 to 38) from B. guentheri. Two mainland taxa were examined; B. granulosus appeared to be closer to the West Indian species than was B. marinus. An antiserum to B. marinus gave similar reciprocal values to the West Indian species (0 = 87 ID; approximate values were excluded from means).

HYLIDAE There were noticeable deviations in reciprocity in this data set, particularly for the Calyptahyla crucialis and Hyla vasta antisera (Table 3). Therefore, the data matrix was corrected using the method of Cronin and Sarich (1975). The most closely related species are C. crucialis and an undescribed Osteopilus species from Jamaica, with an ID value of 11. Calyptahyla crucialis and O. brunneus also showed a low mean ID value (16). These two species gave low ID values to the Jamaican species H. marianae, with higher values to H. wilderi. The Hispaniolan species O. dominicensis had an ID of 20 to both H. pulchrilineata, another Hispaniolan species, and to the Jamaican species H. marianae; the Jamaican species C. crucialis and Osteopilus sp. nov. were slightly more divergent. The Cuban species O. septentrionalis gave marginally higher average ID

TABLE 2 One-Way Immunological Distances from Bufo guentheri (BG), B. peltocephalus (BP), and B. marinus (BM) Antisera to Other West Indian Bufonids and Representative Mainland Species BG Island Hispaniola Cuba

Puerto Rico Mainland

Species Bufo guentheri (BG) B. peltocephalus (BP) B. longinasus B. taladai B. lemur B. granulosus B. marinus (BM)

BP

BM

Correction Factor 1.23 0.84 — 0 30 (37) 25 (31) 31 (38) 15 (18) — 96

44 (37) 0 46 (39) 10 (8) ~53 (~44) 62 (52) >100 (>84)

~96 79 — — — 61a 0

Note: Reciprocal ID values are in bold. Values in parentheses are corrected ID values based upon reciprocal comparisons. A dash indicates that experiment was not performed. Approximate estimates are indicated by ~. a

ID value from Maxson, 1984.

160

Biogeography of the West Indies: Patterns and Perspectives

TABLE 3 Immunological Distances from Five Antisera to Other West Indian Hylids and a Representative Mainland Hylid CC Island Jamaica

Hispaniola

Cuba Mainland

Species Calyptahyla crucialis (CC) Hyla marianae H. wilderi Osteopilus brunneus (OB) Osteopilus sp. nov. H. heilprini H. pulchrilineata H. vasta (HV) O. dominicensis (OD) O. septentrionalis (OS) Osteocephalus taurinus (OT)

OB

0.588

1.36

0 25 (18) 36 (26) 20 (15) 15 (11) — 26 (19) 73 (53) 39 (28) 43 (31) ~118 (~86)

11 (17) 13 (20) 26 (41) 0 24 (38) — 20 (32) 27 (43) 19 (30) 35 (55) 98 (156)

HV

OD

Correction Factor 1.88 0.877 21 (40) 22 (41) 42 (79) 23 (43) 29 (54) 97 (182) 24 (45) 0 26 (49) 30 (56) —a

25 (26) 19 (20) 44 (46) 34 (35) 21 (22) — 19 (20) 42 (44) 0 37 (38) ~110 (~114)

OS

OT

0.819

—

46 (46) 39 (39) 49 (49) 48 (48) 48 (48) — 40 (40) 46 (46) 37 (37) 0 78 (78)

87 — — 100 — — — —a 73 83 0

Note: Reciprocal ID values are in bold. Values in parentheses are corrected ID values following the method of Cronin and Sarich; one-way ID values also were corrected. A dash indicates that experiment was not performed. Approximate estimates are indicated by ~. a

Experiment was done but no cross reaction was seen.

TABLE 4 One-Way Immunological Distances from Amphisbaena schmidti Antiserum to Other West Indian and Mainland Amphisbaenids Island

Species

AM

Puerto Rico

Amphisbaena bakeri A. caeca A. fenestrata A. schmidti (AM) A. xera A. caudalis A. gonavensis A. innocens A. manni A. cubana Cadea blanoides A. alba Rhineura floridana

31 39 28 0 35 60 144 83 16 29 69 91 156

Hispaniola

Cuba Mainland

values to the other West Indian taxa, ranging from 37 to 49 ID. Hyla vasta, from Hispaniola, was more divergent, with IDs to the other taxa ranging from 40 to 79. Among all of the species endemic to the West Indies, H. heilprini was the most divergent. Only the H. vasta antiserum, which strongly underestimates ID values, would cross-react with H. heilprini and the adjusted ID value was 182. The West Indian taxa gave lower ID values, ranging from 73 to 156, to Osteocephalus taurinus, a mainland species (x = 96 ID).

Relationships and Divergence Times of West Indian Amphibians and Reptiles

161

TABLE 5 Immunological Distances among West Indian Members of the Family Anguidae DW Island Hispaniola

Jamaica

Cuba Puerto Rico Mainland

Species Celestus curtissi #1 C. curtissi #2 C. darlingtoni C. stenurus C. macrotus C. sp. nov. Diploglossus carraui D. warreni (DW) Sauresia agasepsoides S. sepsoides Wetmorena haetiana (WE) Celestus barbouri C. crusculus crusculus C. c. cundalli D. delasagra (DD) D. pleii (DP) Ophiodes striatus

0.72 14 (10) 13 (9) 2 (1) 14 (10) 16 (12) 10 (7) 0 0 9 (6) 12 (7) 14 (10) 13 (9) 15 (11) 15 (11) 129 (94) ~140 (~101) —

DD

DP

Correction Factor 1.3 1.06

WE

—

8 (10) 5 (6) 4 (5) 4 (5) 13 (17) 5 (6) 4 (5) 4 (5) 5 (6) 5 (6) 0 10 (13) 9 (12) 13 (17) 86 (112) 86 (112) 54

102 (108) 105 (111) 102 (108) 102 (108) 97 (103) 99 (105) 94 (100) 99 (105) 97 (103) 98 (104) 103 (109) 98 (104) 114 (121) 101 (107) 0 26 (28) —

— —a — —a — — — —a — — —a — — — 46 0 —

Note: Reciprocal ID values are in bold. Values in parentheses are corrected ID values based upon reciprocal comparisons. A dash indicates that experiment was not performed. Approximate estimates are indicated by ~. a

Experiment was done but no cross reaction was seen.

AMPHISBAENIDAE These data suggest that the closest relative to the Puerto Rican species Amphisbaena schmidti is a Hispaniolan species, A. manni (Table 4). The other Puerto Rican species ranged from 28 to 39 ID units from A. schmidti. The Cuban species A. cubana also was within this range. The Hispaniolan species A. caudalis and the Cuban species Cadea blanoides showed similar levels of divergence from A. schmidti. The Hispaniolan species A. innocens and the mainland species A. alba showed a higher level of divergence. Finally, the Hispaniolan species A. gonavensis showed a degree of divergence similar to that of a mainland species placed in another family, Rhineura floridana (Rhineuridae).

ANGUIDAE The albumin ID values show a clear dichotomy within the West Indian anguid lizards (Table 5). Two species of Diplogossus, D. delasagra (Cuba) and D. pleii (Puerto Rico), had ID values of approximately 107 units (mean of corrected values) to the other West Indian anguids examined. These two species had a mean corrected reciprocal value of 37 from each other. In contrast, the antisera against the two Hispaniolan species, Wetmorena haetiana and D. warreni, consistently gave low ID values (ranging from 0 to 17) to the species of Celestus, Sauresia, and Hispaniolan Diploglossus examined. These data do not provide sufficient resolution to examine the phylogenetic relationships among the members of this group. The mainland species Ophiodes striatus was tested against the antiserum to W. haetiana and gave an ID value of 54.

162

Biogeography of the West Indies: Patterns and Perspectives

TABLE 6 One-Way Immunological Distances from the Leiocephalus schreibersi Antiserum to Other West Indian Leiocephalus and Representative Mainland Iguanids Island Hispaniola

Cuba

Bahamas — East Plana Cay Bahamas — Great Inagua Bahamas — San Salvador Bahamas — Acklin’s Island Mainland

Species

LE

Leiocephalus schreibersi (LE) L. barahonensis #1 L. barahonensis #2 L. lunatus L. melanochlorus L. personatus L. semilineatus L. carinatus L. cubensis L. macropus L. raviceps L. stictigaster L. greenwayi L. inaguae L. loxogrammus L. punctatus Crotaphytus collaris Sceloporus spinosus Tropidurus peruvianus T. hisipidus

0 0 3 1 1 1 4 3 14 7 10 4 6 0 10 7 40 (46) 63 (58) 83 (80) 87

Note: ID values in parentheses are reciprocal values from antisera of other iguanid species to L. schreibersi.

IGUANIDAE The one-way immunological distances from the antiserum against Leiocephalus schreibersi, a Hispaniolan species, give some insights into the relationships among the members of this endemic West Indian genus (Table 6). It is clear that all of the species examined are closely related to one another. The largest immunological distance was 14 ID. There are many species that gave ID values within the error range of the technique (±2 ID units), indicating that their albumin molecules have very similar amino acid sequences. The ID values to Hispaniolan species ranged from 0 to 4 ID, while the ID values to the Cuban species ranged from 3 to 14 ID. One Bahamian species, L. inaguae, had an ID of 0 to L. schreibersi. The other Bahamian species, L. greenwayi, L. loxogrammus, and L. punctatus, had ID values within the range of those seen to Cuban species. The Leiocephalus antiserum also was used to determine ID values for some mainland species within the family Iguanidae. The lowest ID value (with a mean value of 43 for reciprocal comparisons) seen was to Crotaphytus collaris, a species that occurs in North America. Sceloporus spinosus, another North American species, gave a mean ID value of 60. The two South American Tropidurus examined, T. peruvianus and T. hispidus, gave ID values over 80.

TEIIDAE The two antisera prepared do not show any clearly defined patterns of albumin variation among the West Indian Ameiva (Table 7). Ameiva chrysolaema and A. chrysolaema #3, both from Hispaniola, are very closely related, with an ID value of 1. However, the remaining species of West Indian

Relationships and Divergence Times of West Indian Amphibians and Reptiles

163

TABLE 7 One-Way Immunological Distances from Ameiva chrysolaema (AC) and A. exsul (AE) Antisera to Other West Indian Ameiva and Representative Mainland Teiids AC Island Hispaniola

Puerto Rico Cuba Bahamas Lesser Antilles — St. Kitts Lesser Antilles — Antigua Lesser Antilles — Montserrat Mainland

Species Ameiva chrysolaema (AC) A. chrysolaema #3 A. lineolata A. taeniura A. exsul (AE) A. wetmorei A. auberi A. maynardi A. erythrocephala A. griswoldi A. pluvianotata A. ameiva Cnemidophorus uniparens Tupinambis

AE

Correction Factor 1.23 0.86 0 1 (1) 38 (47) — 44 (54) 30 (37) 50 (62) 40 (49) 37 (46) 34 (42) 42 (52) 50 (62) 53 (65) >144

63 (54) 61 (52) 47 (40) 46 (40) 0 39 (34) 64 (55) 44 (38) 70 (60) 50 (43) 58 (50) 69 (59) 73 (63) 168 (144)

Note: Reciprocal ID values are in bold. Values in parentheses are corrected ID values based upon reciprocal comparisons. A dash indicates that experiment was not performed.

Ameiva ranged from 34 to 62 ID units (corrected values). The mainland species A. ameiva was at the upper end of the range of IDs found within the West Indies. The ID value from A. exsul to A. ameiva previously has been reported to be 79 (Hedges et al., 1992); additional experiments gave a lower value (69). Two other teiid lizards were compared. Cnemidophorus uniparens gave ID values slightly higher than those seen to the mainland Ameiva, while the ID values to Tupinambis were very large, essentially at the measurement limit of the technique (Maxson and Maxson, 1986).

COLUBRIDAE All of the West Indian xenodontine snakes tested gave low ID values (20 or less) to the Arrhyton landoi antiserum (Table 8). Within the genus Arrhyton, all of the Cuban species examined gave ID values within the error limit of MC’F (±2 ID), indicating that their albumins have almost identical amino acid sequences. The Jamaican and Puerto Rican species gave slightly higher ID values, ranging from 6 to 11. However, this level of differentiation also was seen to members of three other West Indian genera, Antillophis, Hypsirhynchus, and Ialtris. The remaining three West Indian genera, Alsophis, Darlingtonia, and Uromacer, gave higher ID values (ranging from 12 to 20 ID). An ID value of 11 was reported for Darlingtonia by Hedges et al. (1992), but that value has been revised by further experiments. The South American xenodontines showed divergences ranging from 21 to 42 ID, and the Central American xenodontines were the most divergent taxa examined, with an average ID of 58.

TROPIDOPHIDAE A dichotomy in ID values among West Indian Tropidophis is obvious (Table 9). The antiserum against a T. haetianus from Jamaica gave much lower ID values (range 1 to 9) to eight species of Cuban and Bahamian Tropidophis than it did to T. haetinaus from Hispaniola. This dichotomy was

164

Biogeography of the West Indies: Patterns and Perspectives

TABLE 8 One-Way Immunological Distances from Arrhyton landoi (AR) Antiserum to Other West Indian and Mainland Xenodontine Snakes Island Cuba

Genus Arrhyton

Jamaica

Puerto Rico Cuba Hispaniola

Antillophis Hypsirhynchus Ialtris

Cuba Puerto Rico Bahamas — Nassau Lesser Antilles — Antigua Lesser Antilles — Montserrat Hispaniola

Mainland — South American Clade

Mainland — Central American Clade

Darlingtonia Alsophis

Uromacer

Liophis Oxyrhopus Thamnodynastes Xenodon Dipsas Leptodeira

Species dolichura landoi #1 (AR) landoi #2 procerum supernum #1 supernum #2 taeniatum tanyplectum vittatum callilaemum funereum polylepis exiguum andreae parvifrons ferox scalaris dorsalis #1 dorsalis #2 haetiana cantherigerus portoricensis vudii antiguae antillensis catesbyi #1 catesbyi #2 frenatus oxyrhynchus cabella melanostigma leucomelas severus catesbyi

AR 0 0 0 0 0 0 0 0 2 6 9 11 6 11 6 6 8 10 10 15 19 15 12 14 16 20 15 18 17 31 23 42 21 29 (42) 58 57

Note: The value in parentheses is a reciprocal ID value from an antiserum to Xenodon severus.

so striking, and unexpected, that multiple individuals from Hispaniola were examined to ensure that this difference was real. The ID values to those Hispaniolan snakes ranged from 23 to 29. The mainland species, T. paucisquamis, gave an ID value of 70, much larger than any values seen within the West Indies. Tropidophis does not seem to be clearly allied to any other lineage of snakes. Although the ID to Boa constrictor was lower than to the other lineages examined, that value (141) is approaching the upper limit of this technique (Maxson and Maxson, 1986).

TYPHLOPIDAE The antiserum against the Puerto Rican species Typhlops platycephalus gave low ID values (ranging from 1 to 5) to three Puerto Rican species and the two species from the Lesser Antilles (Table 10).

Relationships and Divergence Times of West Indian Amphibians and Reptiles

165

TABLE 9 One-Way Immunological Distances from Tropidophis haetianus (TR) Antiserum to Other West Indian and Mainland Tropidophiids, and Selected Representatives of Other Snake Families Island

Taxon

TR

Jamaica

Tropidophis haetianus stejnegeri #1 (TR) T. haetianus stejnegeri #2 T. haetianus stullae T. feicki T. fuscus T. maculatus T. melanurus T. pardalis T. pilsbryi T. wrighti T. canus T. haetianus haetianus #1 T. haetianus haetianus #2 T. haetianus haetianus #3 T. haetianus haetianus #4 T. haetianus haetianus #5 T. haetianus humerus T. paucisquamis Boidae: Boa constrictor Elapidae: Naja naja Pythonidae: Python molarus Colubridae: Coluber constrictor Colubridae: Arrhyton landoi

0 0 0 9 4 4 2 5 4 4 1 25 23 29 28 25 24 70 141 171 ~185 ~185 ~180

Cuba

Bahamas Hispaniola

Mainland

Note: Approximate estimated are indicated by ~.

The exception is the Puerto Rican T. rostellatus, which gave an ID value of 31. The Cuban species T. biminensis and T. lumbricalis both gave an ID value of 14. The widest range of ID values is seen among the Hispaniolan species, which ranged from 17 to 44. The Jamaican species T. jamaicensis gave an ID value within this range. Typhlops luzonensis, a species from the Phillipines, was quite divergent, at 96 ID. Species from two other scolecophidian families were included, Liotyphlops (Anomalepidae) and Leptotyphlops (Leptotyphlopidae), and both of these gave very high ID values to T. platycephalus.

DISCUSSION BUFONIDAE Two Cuban species, Bufo peltocephalus and B. taladai, shared a common ancestor approximately 5 million years ago (mya). Bufo peltocephalus diverged from the other species examined (from Cuba, Hispaniola, and Puerto Rico) about 22 to 23 mya. The Hispaniolan species B. guentheri and the Puerto Rican B. lemur diverged approximately 11 mya. The ID values from the B. guentheri antiserum give a divergence time of 19 to 23 mya from the three Cuban species examined. While the mainland affinities of this group are not yet known, the ID value to B. granulosus indicates that they had diverged from mainland taxa by about 31 mya.

166

Biogeography of the West Indies: Patterns and Perspectives

TABLE 10 One-Way Immunological Distances from Typhlops platycephalus (TY) Antiserum to Other West Indian and Mainland Typhlopids, and Selected Representatives of Other Scolecophidian Families Island Puerto Rico

Lesser Antilles Cuba Hispaniola

Jamaica Mainland

Taxon

TY

Typhlops granti T. hypomethes T. platycephalus (TY) T. richardi T. rostellatus T. guadaloupensis T. monastus T. biminensis T. lumbricalis T. capitulatus T. hectus T. pusillus T. schwartzi T. sulcatus T. syntherus T. titanops T. jamaicensis T. luzonensis Anomalepididae: Liotyphlops Leptotyphlopidae: Leptotyphlops

5 1 0 2 31 4 4 14 14 18 17 18 22 26 44 29 20 96 157 150

Maxson (1984) examined albumin ID variation in the genus Bufo and found that the Old World species (Eurasian and African) diverged from the New World species about 65 to 75 mya (~110 to 120 ID units). No West Indian toads were included in that study, but the data obtained here indicate that West Indian Bufo are much closer to New World species of Bufo than to Old World species. This does not support the recognition of a separate genus (Peltophryne) for the West Indian species. Although Graybeal (1997), in a study of cytochrome b DNA sequences in bufonids, did not significantly resolve the position of the B. peltocephalus group, she also found it to be nested among New World species of Bufo in her best supported trees.

HYLIDAE While these immunological data cannot give a detailed picture of relationships among these species of West Indian hylid frogs, general patterns are apparent. The Jamaican species, and two Hispaniolan species, Hyla pulchrilineata and Osteopilus dominicensis, appear to form a group. The Cuban species O. septentrionalis is slightly more divergent, while the Hispaniolan species H. vasta appears to be the basal taxon for this group of West Indian hylids. Within this West Indian group, the casqueheaded frogs, members of the genera Osteopilus and Calyptahyla, do not form a distinct group, as suggested by Trueb and Tyler (1974), but are interspersed among the West Indian species of Hyla. The ID values to Osteocephalus taurinus range from 73 into the 100s, with a mean ID of 96, which gives a divergence time of 58 mya, if this is the sister group to the West Indian hylid radiation. Hyla heilprini is clearly outside of the radiation of West Indian hylid frogs and most likely represents a second colonization of the West Indies by this family.

Relationships and Divergence Times of West Indian Amphibians and Reptiles

167

AMPHISBAENIDAE The results obtained for the West Indian amphisbaenids indicate that Amphisbaena schmidti last shared a common ancestor with other Puerto Rican species about 17 mya. It is more closely related to the Hispaniolan species, A. manni, and this suggests that there was a dispersal event approximately 10 mya. Details of the relationships among the species of West Indian amphisbaenids currently are being studied using sequence data from mitochondrial genes. Most of the West Indian taxa apparently diverged from mainland species by about 55 mya, based upon the immunological comparison to A. alba, a species from South America. These data led Hedges (1996a) to suggest that Cadea be synonomized within Amphisbaena, because it gave a lower ID value than did some congeners examined. Among the West Indian species, A. gonavensis is the most divergent. The level of divergence seen is close to that for a species that is placed in another family, the Rhineuridae. Until additional information is available, we cannot determine if A. gonavensis represents an earlier colonization event (about 86 mya), or is a recent colonist from a divergent mainland lineage. Although they gave different ID values from the A. schmidti antiserum, A. innocens and A. gonavensis are unusual among West Indian Amphisbaena in having a large number (2N = 50) of chromosomes; other West Indian species examined have 2N = 36 chromosomes (Cole and Gans, 1987; Hass and Hedges, unpublished). In this respect, they resemble some South American species with high numbers of chromosomes.

ANGUIDAE The recognition of the genus Celestus and the allocation of species of West Indian anguids to genera have been the subject of much debate (Boulenger, 1885; Burt and Burt, 1932; Underwood, 1959; Strahm and Schwartz, 1977; Savage and Lips, 1993). Although earlier workers considered the condition of the claw sheath to be an important character, Strahm and Schwartz (1977) primarily used the degree of development of canals in the osteoderms to allocate the diploglossine taxa to different genera. Wilson et al. (1986) determined that these osteoderm patterns are a reflection of ontogeny, with the radix more developed in older animals, and their work suggested that these patterns may be of limited use as phylogenetic characters. Savage and Lips (1993) resurrected the earlier classification based on presence (Diploglossus) or absence (Celestus) of a claw sheath. They considered the genera Sauresia and Wetmorena to be more closely related to Diploglossus because they have a claw sheath (Savage and Lips, 1993). The immunological data support the placement of the three large Hispaniolan species (anelpistus, carraui, warreni) in the genus Celestus (Savage and Lips, 1993). However, these data also indicate that the species currently recognized as Celestus, Sauresia, and Wetmorena comprise a closely related group, contra Savage and Lips (1993). Because only two antisera from species within this group were available, the immunological data cannot be used to determine relationships among the species. However, the data suggest that these species last shared a common ancestor relatively recently, within the last 10 million years. Therefore, the use of the condition of the claw sheath to determine relatedness seems to be inappropriate. Instead, a character deemed important by Underwood (1959), direct contact of the nasal and rostral scales, is in better agreement with the molecular results. Based upon the immunological data, we recommend that Sauresia and Wetmorena be synonymized within Celestus (following Hedges, 1996a). The Cuban and Puerto Rican species of Diploglossus examined appear to have diverged from each other about 22 mya; they are distantly related (64 mya) to the other West Indian species examined. The mainland species, Ophiodes striatus, appears to have diverged from the West Indian Celestus about 32 mya. Based upon the immunological data, it would appear that the West Indies were colonized at least twice by anguid lizards, assuming one colonization event for Diploglossus and another for Celestus. However, a clearer understanding of the historical biogeography of this group must await

168

Biogeography of the West Indies: Patterns and Perspectives

additional data from the mainland taxa. The fact that the West Indian Celestus are most closely related to the mainland Ophiodes than to Diploglossus, and the peculiar distribution of the mainland taxa (Savage and Lips, 1993), complicates biogeographical inferences.

IGUANIDAE Species in the genus Leiocephalus represent a relatively recent radiation. The immunological data indicate that the oldest divergences within this genus occurred less than 10 mya. Relationships among the species within this group have been investigated using data from sequences of mitochondrial genes. Those data (Hass et al., unpublished) are concordant with the patterns seen here. One Bahamian species, L. inaguae, is within the cluster of Hispaniolan species, while L. greenwayi, L. loxogrammus, and L. punctatus, also from the Bahamas, show ID values similar to those for Cuban taxa. The immunological data suggest that the closest mainland relatives of Leiocephalus are the crotaphytine lizards. This divergence dates to about 26 mya, and this group may have arisen from a colonization of the West Indies from North America, rather than South or Central America (Hedges, 1996b). These data are inconsistent with the placement of Leiocephalus within the Tropidurinae. Because of this inconsistency, and similar results obtained in other molecular studies (Macey et al., 1997), we do not follow the taxonomic recommendations of Frost and Etheridge (1989) for iguanian lizards.

TEIIDAE The ID values obtained indicate that divergences among some West Indian Ameiva are not recent. Ameiva chrysolaema and A. chrysolaema #3 diverged from each other very recently. However, the next most recent divergence for both A. exsul and A. chrysolaema is at a corrected ID value of 34 to 37, approximately 20 to 22 mya. These data do not provide a clear pattern of relationships among the West Indian members of this genus. The mainland species A. ameiva gives higher ID values to both antisera, indicating a divergence time of approximately 36 mya. However, these ID values are only slightly lower than those to the Cnemidophorus uniparens, another mainland species of teiid. The South American teiid, Tupinambis, is distantly related to the West Indian Ameiva.

COLUBRIDAE The low ID values seen indicate that divergences among the many species of West Indian xenodontines have occurred within the last 12 million years. The other Cuban species of Arrhyton could not be distinguished immunologically from A. landoi, despite morphological distinctions and sympatry among some species (Hedges and Garrido, 1992). One reciprocal ID value was available, measured from an antiserum against Xenodon severus to A. landoi. The difference in reciprocity (26 vs. 42) does suggest that the A. landoi may underestimate ID values. While these data cannot be used to determine phylogenetic relationships, they do suggest that Alsophis, Darlingtonia, and Uromacer are the most divergent genera of West Indian xenodontines. The immunological data also show that the degree of divergence to the mainland taxa is at the upper end of the divergences seen within the West Indies, supporting the hypothesis of a large monophyletic clade of West Indian xenodontines. Evidence from mitochondrial DNA sequences (Vidal et al., 2000) also supports this same monophyletic group. Both the ID data and the sequence data support a South American origin for the endemic West Indian xenodontines, perhaps as recently as 13 mya.

TROPIDOPHIDAE The immunological data suggest that the Jamaican and Cuban species of Tropidophis have diverged fairly recently, probably sharing a common ancestor within the last 6 million years. This is in sharp

Relationships and Divergence Times of West Indian Amphibians and Reptiles

169

contrast to the Hispaniolan Tropidophis, which diverged from other West Indian Tropidophis approximately 16 mya. The populations on Jamaica and Hispaniola clearly represent two different species. Because the type locality for T. haetianus is in Hispaniola, the Jamaican species should be recognized at T. jamaicensis, the oldest available name for the Jamaican populations (Schwartz and Henderson, 1991). The West Indian species last shared a common ancestor with mainland Tropidophis about 42 mya. All ID values to snakes from other families are at the upper limit of this technique and do not provide reliable information on the affinities of the Tropidophidae to other snake families.

TYPHLOPIDAE These data suggest that the majority of the Puerto Rican species and the species found in the Lesser Antilles diverged relatively recently, about 3 mya. The species on Cuba, Jamaica, and Hispaniola are more divergent, last sharing a common ancestor with the Puerto Rican species between 8 and 17 mya. Typhlops rostellata is the exception among the Puerto Rican species, and appears to have diverged from the others species on that island over 18 mya. This may represent an old Puerto Rican lineage, or that species may have colonized the island more recently, perhaps from Hispaniola. These data cannot distinguish between those alternatives. Typhlops syntherus is the most distant of the West Indian species from T. platycephalus, with a divergence time of about 26 mya. The degree of divergence between West Indian Typhlops and another member of this genus from the Philippines indicates that they have been separated for about 58 million years. The divergences between the family Typhlopidae and the other two families within the Scolecophidia are old, probably dating to the Cretaceous.

CONCLUSIONS The albumin immunological data for the different groups of West Indian amphibians and reptiles show very diverse patterns (Table 11). The data indicate that the fauna of these islands is composed of some recent radiations, such as the lizards of the genus Leiocephalus, which have diversified within the last 10 million years. This same pattern is seen within the xenodontine snakes, which diverged from mainland taxa only about 13 mya. There are some taxa where dichotomous patterns of relationships are seen. Within the anguid lizards, the West Indian members of the genus Celestus have speciated within the last 10 millon years. In contrast, the two species of Diploglossus are more distantly related, having diverged about 22 mya, and they last shared a common ancestor with the West Indian Celestus approximately 64 mya. These West Indian Celestus appear to be more closely related to some mainland taxa, with an estimated divergence time of 32 million years from Ophiodes. Within the West Indian snakes of the genus Tropidophis, the Bahamian, Cuban, and Jamaican species are closely related, having speciated within the last 6 million years. In contrast, the Hispaniolan members of this group diverged approximately 16 mya. Finally, there are groups where the majority of immunological values indicate that the divergences among the species are not recent. Within the amphisbaenians, divergences range from 17 to 41 million years. One species, Amphisbaena gonavensis, with a divergence of over 80 million years from A. schmidti, probably represents a separate colonization of the West Indies from the mainland. The lizards of the genus Ameiva also show a wide range of divergence times, from 0 to 38 mya. The oldest dates are approximately the same as the estimate divergence time from the mainland Ameiva. As first presented by Hedges et al. (1992), and discussed extensively by Hedges (1996a), these albumin immunological data support overwater dispersal during the Cenozoic as the mechanism for colonization of the West Indies by all of the groups discussed here. DNA sequence studies are now under way to elucidate the relationships within each of these groups to further enhance our understanding of West Indian biogeography.

170

Biogeography of the West Indies: Patterns and Perspectives

TABLE 11 Summary Table of Times of Origin for the West Indian Groups Examined in This Study, and of the Earliest Divergence within Each Group Time of (mya) Group

Origin

Earliest Divergence within the West Indies

Bufonidae Hylidae Amphisbaenidae Anguidae — Celestus Anguidae — Diploglossus Iguanidae Teiidae Colubridae (Xenodontinae) Tropidophidae Typhlopidae

31 ± 4.3 58 ± 5.8a 55 ± 5.6 32 ± 4.3 Comparison not available 26 ± 4.4 36 ± 4.4 13 ± 5.1 42 ± 4.6 58 ± 5.8

23 ± 4.5 34 ± 4.4 b 41 ± 4.6 c 10 ± 5.4 22 ± 4.5 8 ± 5.5 38 ± 4.4 12 ± 5.2 16 ± 4.9 26 ± 4.4

Note: The estimates of time of origin were based upon the ID value to the most closely related non-West Indian taxon (lowest ID value). If multiple estimates to a single taxon were available, the mean value was used (excluding any approximate estimates, as indicated by ~ in the previous tables). The earliest divergence time among the West Indian species was based on the highest ID value seen from an antiserum against a West Indian species to another West Indian species. Calibration error estimates were obtained following the methods described in Hedges et al. (1994). a

Hyla heilprini is considered to represent a separate lineage (see Discussion). The ID values to H. wilderi were significantly different from those to other taxa and therefore they were not used in this estimate (see Table 3). c Amphibaena gonavensis and A. innocens appear to represent a lineage that is distinct from the other West Indian amphisbaenians, so they were not used in this estimate (see Discussion). b

ACKNOWLEDGMENTS We would like to thank Sandra Buckner, Herndon G. Dowling, Richard Thomas, Ron Heyer, Robert Henderson, and Charles Ross for providing us with specimens. Tanya Miller and Joyce Stohler gave technical assistance in the lab. Collecting and export permits were obtained from authorities in each of the countries where specimens were collected. All experimental protocols involving animals were approved by the University of Maryland Institutional Animal Care and Use Committee, approval code R-86-039, and The Pennsylvania State University Institutional Animal Care and Use Committee, protocol number 1418. Financial support was provided by grants from the National Science Foundation.

LITERATURE CITED Boulenger, G. A. 1885. Catalogue of the Lizards in the British Museum (Natural History). 2nd ed. Taylor and Francis, London. Burt, C. E. and M. D. Burt. 1932. South American lizards in the collection of the American Museum of Natural History. Bulletin of the American Museum of Natural History 61:1–597. Cole, C. J. and C. Gans. 1987. Chromosomes of Bipes, Mesobaena, and other amphisbaenians (Reptilia) with comments on their evolution. American Museum Novitates 2867:1–9. Cronin, J. E. and V. M. Sarich. 1975. Molecular systematics of the New World monkeys. Journal of Human Evolution 4:357–375.

Relationships and Divergence Times of West Indian Amphibians and Reptiles

171

Davis, B. J. 1964. Disc electrophoresis II. Method and application to human serum proteins. The Annals of the New York Academy of Sciences 121:404–427. Frost, D. E. and R. E. Etheridge. 1989. Phylogenetic analysis and taxonomy of iguanian lizards (Reptilia: Squamata). University of Kansas Museum of Natural History Miscellaneous Publications 81. Graybeal, A. 1997. Phylogenetic relationships of bufonid frogs and tests of alternate macroevolutionary hypotheses characterizing their radiation. Zoological Journal of the Linnean Society 119:297–338. Hass, C. A. and S. B. Hedges. 1991. Albumin evolution in West Indian frogs of the genus Eleutherodactylus (Leptodactylidae): Caribbean biogeography and a calibration of the albumin immunological clock. Journal of Zoology (London) 225:413–426. Hass, C. A., S. B. Hedges, and L. R. Maxson. 1993. Molecular insights into the relationships and biogeography of West Indian anoline lizards. Biochemical Systematics and Ecology 21(1):97–114. Hedges, S. B. 1996a. The origin of West Indian Amphibians and Reptiles. Pp. 95–128 in Powell, R. and R. W. Henderson (eds.). Contributions to West Indian Herpetology: A Tribute to Albert Schwartz (Contributions to Herpetology, Vol. 12). The Society for the Study of Amphibians and Reptiles, Ithaca, New York. Hedges, S. B. 1996b. Historical biogeography of West Indian vertebrates. Annual Review of Ecology and Systematics 27:163–196. Hedges, S. B. and O. H. Garrido. 1992. Cuban snakes of the genus Arrhyton: two new species and a reconsideration of A. redimitum Cope. Herpetologica 48(2):168–177. Hedges, S. B., C. A. Hass, and L. R. Maxson. 1992. Caribbean biogeography: molecular evidence for dispersal in West Indian terrestrial vertebrates. Proceedings of the National Academy of Sciences, U.S.A. 89:1909–1913. Hedges, S. B., C. A. Hass, and L. R. Maxson. 1994. Towards a biogeography of the Caribbean. Cladistics 10:43–55. Hutchinson, M. N. and L. R. Maxson. 1986. Immunological evidence on relationships of some Australian terrestrial frogs (Anura: Hylidae: Pelodryadinae). Australian Journal of Zoology 34:575–582. Kennedy, J. P. and H. L. Brockman. 1965. Open heart surgery in Alligator mississippiensis Daudin. Herpetologica 21:6–15. Macey, J. R., A. Larson, N. B. Anajeva, and T. J. Papenfuss. 1997. Evolutionary shifts in three major structural features of the mitochondrial genome among iguanian lizards. Journal of Molecular Evolution 44:660–674. Maxson, L. R. 1984. Molecular probes of phylogeny and biogeography in toads of the widespread genus Bufo. Molecular Biology and Evolution 1:345–356. Maxson, L. R. 1992. Molecular perspectives on tempo and pattern in amphibian evolution. Pp. 41–57 in Adler, K. (ed.). Herpetology: Current Research on the Biology of Amphibians and Reptiles: Proceedings of the First World Congress of Herpetology. Society for the Study of Amphibians and Reptiles, Ithaca, New York. Maxson, L. R., R. Highton, and D. B. Wake. 1979. Albumin evolution and its phylogenetic implications in the plethodontid salamander genera Plethodon and Ensatina. Copeia 1979:502–508. Maxson, L. R. and R. D. Maxson. 1990. Immunological techniques. Pp. 127–155 in Hillis, D. M. and C. Moritz (eds.). Molecular Systematics. Sinauer Associates, Sunderland, Massachusetts. Maxson, R. D. and L. R. Maxson. 1986. Micro-complement fixation: a quantitative estimator of protein evolution. Molecular Biology and Evolution 3:375–388. Savage, J. M. and K. R. Lips. 1993. A review of the status and biogeography of the lizard genera Celestus and Diploglossus (Squamata: Anguidae), with a description of two new species from Costa Rica. Revista de Biologia Tropical 42(3):817–842. Schwartz, A. and R. W. Henderson. 1991. Amphibians and Reptiles of the West Indies: Descriptions, Distributions, and Natural History. University of Florida Press, Gainesville. Strahm, M. H. and A. Schwartz. 1977. Osteoderms in the anguid lizard subfamily Diploglossinae and their taxonomic importance. Biotropica 9:58–72. Trueb, L. and M. J. Tyler. 1974. Systematics and evolution of the Greater Antillean hylid frogs. Occasional Papers of the Museum of Natural History, The University of Kansas, Lawrence 24:1–60. Underwood, G. 1959. A new Jamaican galliwasp (Sauria, Anguidae). Museum of Comparative Zoology Breviora 102:1–13. Vidal, N., S. G. Kindl, A. Wong, and S. B. Hedges. 2000. Phylogenetic relationships of xenodontine snakes inferred from 12S and 16S ribosomal RNA sequences. Molecular Phylogenetics and Evolution 14:389–402.

172

Biogeography of the West Indies: Patterns and Perspectives

Wilson, A. C., S. S. Carlson, and T. J. White. 1977. Biochemical evolution. Annual Review of Biochemistry 46:573–639. Wilson, L. D., L. Porras, and J. R. McCranie. 1986. Distributional and taxonomic comments on some members of the Honduran herpetofauna. Milwaukee Public Museum Contributions in Biology and Geology 66:1–18.

APPENDIX: COLLECTING LOCALITIES AND VOUCHER SPECIMENS Numbers refer to tissue samples in the following collections: (LM = Linda Maxson; RH = Richard Highton; SBH = S. Blair Hedges). An asterisk (*) indicates species for which an antiserum was made. Bufonidae. Bufo: Hispaniola: *guentheri, Dominican Republic, Independencia, 12.2 km W Cabral (SBH 101227). Cuba: *peltocephalus, Guantánamo Bay U.S. Naval Station, Golf Course/ Nursery (SBH 161934); longinasus, Sancti Spiritus, north slope of Pico Potrerillo (LM 2782); taladai, Santiago de Cuba, La Esmajagua (SBH 190537). Puerto Rico: lemur (SBH 190648-50). Mainland: granulosus, Brazil (LM 329); marinus, Costa Rica (LM 206). Hylidae: Jamaica: *Calyptahyla crucialis, St. Elizabeth, Mandeville, Marshall’s Pen (LM 2570); Hyla marianae, Trelawny, Quick Step (RH 56382); Hyla wilderi, Trelawny, Quick Step (RH 56379); *Osteopilus brunneus, Trelawny, Quick Step (LM 1190); Osteopilus sp. nov., Trelawny, 5 mi WNW Quick Step (RH 60045). Hispaniola: Hyla heilprini, Dominican Republic, La Vega, 10.5 km W Hayaco (SBH 101105-06); Hyla pulchrilineata, Dominican Republic, El Seibo, 4.1 km S Sabana de le Mar (SBH 101086); *Hyla vasta, Haiti, Dept. de l’Ouest, Furcy (SBH 160414, 160417); *Osteopilus dominicensis, Dominican Republic, Barahona, 15.8 km S Cabral (SBH 101244). Cuba: *Osteopilus septentrionalis, United States: Florida (LM 1768). Mainland: *Osteocephalus taurinus, Peru, Cuzco Amazónico (LM 1866). Amphisbaenidae. Amphisbaena: Puerto Rico: bakeri, 5.8 km S Mora (SBH 172208); caeca, 6.8 km S Mamey (SBH 172233); fenestrata, USVI, St. Thomas, Dorothea Estate (SBH 161375); *schmidti, 12 km SSE Arecibo (SBH 172169, SBH 172171, SBH 172173); xera, Playa de Tamarindo (SBH 101727). Hispaniola: caudalis, Haiti, Grande’Anse, 11.8 km S Pestel (SBH 191845); gonavensis, Dominican Republic, Pedernales, Hoyo de Pelempito (SBH 192635); innocens, Haiti, Sud, 11 km N Camp Perrin (SBH 103823-24); manni, Dominican Republic, Hato Mayor, 9.5 km W Sabana de la Mar (SBH 102373). Cuba: cubana, Guantánamo Bay U.S. Naval Station, Nursery (SBH 161959); Cadea blanoides, Pinar del Rio, Viñales, Cueva de San Jose Miguel. Mainland: alba, Peru, Cuzco Amazónica (LM 1988); Rhineura floridana, Florida, Hillsborough, Plant City (SBH 172913). Teiidae. Ameiva: Hispaniola: *chrysolaema #1, Dominican Republic, Independencia, Tierra Nueva (SBH 102872, SBH 102874, SBH 102878); chrysolaema #2, Dominican Republic, Pedernales, 2 km S Oviedo (SBH 102628); chrysolaema #3, Dominican Republic; Barahona, vicinity of Barahona (SBH 101429); lineolata, Haiti, l’Artibonite, 1.1 S Colminy (SBH 191673); taeniura, Haiti, Sud’Est, 9.5 km E Jacmel (SBH 104391). Puerto Rico: *exsul, 12 km radius of Arecibo (SBH 172203-204); wetmorei, Isla Caja de Muertos (SBH 190731). Cuba: auberi, Guantánamo U.S. Naval Station, South Toro Cay (SBH 161973). Bahamas: maynardi, Great Inagua (SBH 192970). Lesser Antilles: erythrocephala, St. Kitts, Godwin Gut (SBH 172748); griswoldi, Antigua, Great Bird Island (SBH 192785); pluvianotata, Montserrat, St. Peter, Spring Ghut (SBH 192779). Mainland: ameiva, Peru, Cuzco Amazónico (LM 1993); Cnemidophorus uniparens (LM 2997); Tupinambis teguixin, Peru, Cuzco Amazónico (LM 2421). Anguidae. Hispaniola: Celestus curtissi #1, Dominican Republic, Pedernales, Juancho (SBH 102707); Celestus curtissi #2, Dominican Republic, Pedernales, 6.4 km SW and 0.7 km SE Juancho (SBH 102610); Celestus darlingtoni, Dominican Republic, La Vega, ca. 37 km SE Constanza (SBH 161687); Celestus macrotus, Haiti, Sud’Est, ca. 15 km W Gros Cheval (SBH 104405); Celestus stenurus, Dominican Republic, Independencia, 1 km E Tierra Nueva (SBH 102917); Celestus sp.

Relationships and Divergence Times of West Indian Amphibians and Reptiles

173

nov., Dominican Republic, Independencia, 23.9 km SE Puerto Escondido (SBH 192480); Diploglossus carraui, Dominican Republic (SBH 191573); *Diploglossus warreni, pet trade (SBH 172914); Sauresia agasepsoides, Dominican Republic, Barahona, 13.7 km (airline) E Canoa (SBH 160188-90); Sauresia sepsoides, Dominican Republic, Hato Mayor, 9.5 km W Sabana de la Mar (SBH 102369); *Wetmorena haetiana, Dominican Republic, Barahona, 15.3 km S and 6.7 km E of Cabral (SBH 102565-566). Jamaica: Celestus barbouri, Trelawny, vicinity of Quick Step (SBH 161120); Celestus crusculus crusculus, Hanover, 3.2 km SE Content (SBH 101572); Celestus crusculus cundalli, Portland, 1.3 km WSW Section (SBH 172465). Cuba: *Diploglossus delasagra, Guantánamo, 1 km SW San Luis de Potosí (SBH 191015). Puerto Rico: *Diploglossus pleii, 5.5 km N Rio (SBH 161370), about 5 km SE Maricao and 6 km NW Sabana Grande (SBH 172199-200). Mainland: Ophiodes striatus (MVZ 191047) Iguanidae. Leiocephalus: Hispaniola: *schreibersi, Dominican Republic, Independencia, Tierra Nueva (SBH 102721, SBH 102879-880, SBH 102889); barahonensis #1, Dominican Republic, Pedernales, about 2 km S Oviedö (SBH 102645); barahonensis #2, Dominican Republic, Independencia, 5.1 km SE Puerto Escondido (SBH 192536); lunatus, Dominican Republic, Altagracia, 1 km W Boca de Yuma (SBH 160123); melanochlorus, Haiti, Grande’Anse, about 3 km N Bois Sec (SBH 103721); personatus, Dominican Republic, Maria Trinidad Sanchez, 4 km SE Nagua (SBH 103024); semilineatus, Haiti, l’Ouest, 11.7 km E Thomazeau (SBH 191661-63). Cuba: carinatus, Guantánamo, Guantánamo Bay U.S. Naval Station, pump station and water tower on leeward side of bay (SBH 161965); cubensis, Matanzas, Soplillar (SBH 172490); macropus, Guantánamo, Guantánamo Bay U.S. Naval Station, pistol range on leeward side of bay (SBH 161984); raviceps, Guantánamo, Guantánamo Bay U.S. Naval Station, pistol range on leeward side of bay (SBH 161980); stictigaster, Guantánamo, Tortuguilla (SBH 190161). Bahamas: greenwayi, East Plana Cay (SBH 192972); inaguae, Great Inagua (SBH 192973); loxogrammus, San Salvador (SBH 192971), punctatus, Acklin’s Island (SBH 192975). Crotaphytus collaris (LM 2534). Sceloporus spinosus (LM 2264). Tropidurus peruvanius (LM 1556B). Tropidurus hispidus (LM 2795). Trophidophidae. Tropidophis: Jamaica: *haetianus stejnegeri #1, Trelawny, vicinity of Quick Step (SBH 103592); haetianus stejnegeri #2, Trelawny, 0.3 km W Duncans (SBH 101580); haetianus stullae, Clarendon, Portland Ridge (SBH 103593). Cuba: feicki, Pinar del Río, Soroa (SBH 172745); fuscus, Guantánamo, Minas Amores (SBH 190300); maculatus, Pinar del Río, Soroa (SBH 191543); melanurus, Pinar del Río, Soroa (SBH 172610); pardalis, La Habana; Narigon (SBH 191545); pilsbryi, Santiago de Cuba, Simpatía (SBH 191368); wrighti, Guantánamo, 2 km N La Munición (SBH 191066). Bahamas: canus, Andros (RH 54403). Hispaniola: haetianus haetianus #1, Haiti: Sud (RH 54404); haetianus haetianus #2, Domican Republic, El Seibo, 4.1 km S Sabana de la Mar (SBH 101398); haetianus haetianus #3, Dominican Republic, Samana, 6 km SSW Las Galeras (SBH 103121); haetianus haetianus #4, Haiti, Sud, 8.6 km SW Carrefour Joute on the Prequille de Port Salut (SBH 192361); haetianus haetianus #5, Dominican Republic, El Seibo, Nisibon (SBH 192455), haetianus hemurus, Dominican Republic, La Altagracia; 28 km NW Higuey (SBH 192454). Mainland: paucisquamis, Brasil, São Paulo, Boraceía (LM 908). Other taxa: Boa constrictor, pet trade (RH 54430). Naja naja, pet trade (RH 58101). Python molarus, pet trade (RH 56048). Coluber constrictor (#4). Arrhyton landoi, Guantánamo, Guantánamo Bay U.S. Naval Station, vicinity of John Paul Jones Hill (SBH 161893-895). Typhlopidae. Puerto Rico: Typhlops granti, Bosque Estatel de Guanica (SBH 172210); Typhlops hypomethes, University of Puerto Rico campus at Rio Piedras (SBH 161807); Typhlops hypomethes, University of Puerto Rico campus at Rio Piedras (SBH 172150); *Typhlops platycephalus, 12.3 km SSE Arecibo (SBH 172180); Typhlops richardi, British Virgin Islands; Guana Island (SBH 172759); Typhlops rostellatus, 12.3 km SSE Arecibo (SBH 172174). Lesser Antilles: Typhlops guadeloupensis, Guadeloupe, Pointe de la Grande’Anse (SBH 102276), Typhlops monastus, Nevis, 0.3 km N Cotton Ground (SBH 172760). Cuba: Typhlops biminensis, Guantánamo, Playites de Cajobabo (SBH 190234); Typhlops lumbricalis, Havana, National Botanical Garden (SBH 172600). Hispaniola: Typhlops capitulatus, Haiti, l’Ouest, Soliette (SBH 103826); Typhlops hectus, Dominican Republic,

174

Biogeography of the West Indies: Patterns and Perspectives

Barahona, 13.5 km SW Barahona (SBH 102665); Typhlops pusillus, Dominican Republic, Azua, 18 km NNW Azua (SBH 160284); Typhlops schwartzi, Dominican Republic, El Seibo, Nisibón (SBH 192458); Typhlops sulcatus, Dominican Republic, Pedernales, SW of Enriquillo (SBH 102438); Typhlops syntherus, Dominican Republic, Pedernales, SW of Enriquillo (SBH 102437); Typhlops titanops, Dominican Republic, Pedernales, 20 km N Pedernales (SBH 160293). Jamaica: Typhlops jamaicensis, St. Mary, 6.2 km W Oracabessa (SBH 172445). Philippines: Typhlops luzonensis, Negros Island, Negros Oriental Province, Valenica Municipality, Bong Bong Bario, Camp Lookout (SBH 194117). Mainland: Leptotyphlops, Trinidad (SBH 175446); Liotyphlops albirostris, Venezuela, Caracas (SBH 172151). Colubridae (Xenodontinae). Bahamas: Alsophis vudii, New Providence, Sandy Port (SBH 192985). Cuba: Arrhyton dolichura, Havana, National Botanical Garden (SBH 172601); *Arrhyton landoi #1, Guantánamo Bay U.S. Naval Station (SBH 161893-95, SBH 161985); Arrhyton landoi #2, Guantánamo, 3.5 km E Tortuguilla (SBH 191258); Arrhyton procerum, Matanzas, Playa Giron (SBH 191526); Arrhyton supernum #1, Guantánamo, SW slope of El Yunque de Baracoa (190230); Arrhyton supernum #2, Guantánamo, Monte Libano, ca. 20 km SSE La Tagua (SBH 191153); Arrhyton taeniatum, Guantánamo Bay U.S. Naval Station, ca. 0.2 km E Windmill Beach (SBH 171002); Arrhyton tanyplectum, Pinar del Río, 4 km NW San Vincente (SBH 191492); Arrhyton vittatum, Pinar del Río, Cueva de San Miguel (SBH 191491), Antillophis andreai, Pinar del Río, Soroa (SBH 172603); Alsophis cantherigerus, Pinar del Río, 2.0 km W Vinales (SBH 172602). Hispaniola: Antillophis parvifrons protenus, Dominican Republic, Barahona, 19.5 km SW Barahona (SBH 103086); Darlingtonia haetiana, Haiti, Grande’Anse, ca. 2–3 km S Castillon (SBH 103806-10); Hypsirhynchus ferox, Dominican Republic, Barahona, vicinity of Barahona (SBH 101393); Hypsirhynchus scalaris, Haiti, Grande’Anse, 7.2 km S Roseaux (SBH 191992); Ialtris dorsalis #1, Haiti, Grande’Anse, ca. 3 km N Bois Sec (SBH 103702); Ialtris dorsalis #2, Haiti, Grande’Anse, 7.5 km N Beaumont (SBH 192360); Uromacer catesbyi #1, Dominican Republic, Monte Plata, 2.8 km N Yamasa (SBH 101397); Uromacer catesbyi #2, Dominican Republic, La Altagracia, 4.4 km W Canada Honda (SBH 192456); Uromacer frenatus frenatus, Haiti, Grande’Anse, ca. 6 km E Jeremie (SBH 104668); Uromacer oxyrhynchus, Dominican Republic, La Altagracia, 4.4 km W Canada Honda (SBH 192457). Jamaica: Arrhyton callilaemum, St. Mary, 2.9 km N Port Maria (SBH 172463); Arrhyton funereum, St. Mary, Port Maria, 2.9 km N Port Maria (SBH 172462); Arrhyton polylepis, Portland, 0.3 km S Alligator Church (SBH 101581). Lesser Antilles: Alsophis antiguae, Antigua, Great Bird Island (SBH 192790); Alsophis antillensis, Montserrat (SBH 192791). Puerto Rico: Arrhyton exiguum, 1.9 km NE Vista Alegre (SBH 160050); Alsophis portoricensis, 1.5 km W Playa de Tamarindo (SBH 160062). Mainland: Dipsas catesbyi, Peru, Pasco, 1.5 km NW Cacazu (SBH 171139); Leptodeira sp., Panama (LM1145); Liophis cabella, Peru, Pasco, Oxapampa (SBH 171143); Liophis melanostigma, Brazil, São Paulo, Boraceia (LM 904); Oxyrhopus leucomeles, Peru, Pasco, Oxapampa (SBH 171142); Thamnodynastes sp., Peru, Madre de Dios, Tambopata Reserve (LM 1104); Xenodon severus (RH 68185).

Historic and Prehistoric 12 The Distribution of Parrots (Psittacidae) in the West Indies Matthew I. Williams and David W. Steadman Abstract — If not for human impact, three genera of psittacids (Ara, Aratinga, and Amazona) would be represented today throughout the Greater and Lesser Antilles. The Cayman Islands and Bahamas are the only regions lacking evidence of Ara and Aratinga. Guadeloupe is the only island with possible evidence for the occurrence of a fourth genus, Anodorhynchus. The growing body of information from paleontology, zooarchaeology, and post-Columbian history further suggests that multiple sympatric species of Amazona were widespread. In the other two genera, a single species was typically confined to one major island or a cluster of nearby islands. We suggest that as many as 50 to 60 endemic species of psittacids would occupy the West Indies in the absence of human influence, as compared to the 12 species (3 of Aratinga, 9 of Amazona) that survive today.

INTRODUCTION Parrots (Order Psittaciformes, Family Psittacidae) are one of the most successful groups of land birds on tropical islands. In the West Indies, indigenous species of parrots (usually endemic to a single island or island cluster; see Snyder et al., 1987) are or were represented by three genera: Ara (macaws), Aratinga (parakeets), and Amazona (amazons or simply “parrots”). A fourth genus, Anodorhynchus, also may have occurred, but the evidence currently available is inadequate to support that hypothesis. The goal of this chapter is to review briefly the past distribution of psittacids in the West Indies during the historic era (the past 500 years) and especially prehistoric times (i.e., pre-Columbian). Our geographical coverage includes the entire West Indian faunal region (see map in Raffaele et al., 1998:12). Excluded, therefore, are Trinidad, Tobago, Margarita, Aruba, Bonaire, Curaçao, and other smaller islands off the northern coast of South America. The avifaunas of these islands have only a minor West Indian influence. We do not include introduced populations, whether of species that are indigenous on other West Indian islands (such as the populations of Aratinga chloroptera introduced to Puerto Rico and Guadeloupe; see Raffaele et al., 1998:308) or of various non-West Indian psittacids that have been released over the past century in the Bahamas, Cayman Islands, Jamaica, Hispaniola, Puerto Rico, Virgin Islands, Guadeloupe, Dominica, Martinique, Barbados, and perhaps elsewhere. We believe that all of the certain or possible extinctions of indigenous West Indian psittacids are anthropogenic. Some of these losses clearly occurred in historic times, such as that of Ara tricolor in Cuba and Isla de Pinos (Isla de la Juventud). Other losses are more likely to have occurred during prehistoric human occupation of the islands (see Keegan, 1994, 2000, for a review of West Indian prehistory). In some cases we cannot be certain if the population in question was indigenous or had been transported by prehistoric peoples to the island. Such uncertainty is removed when fossils document the presence of a species before the arrival of people, as on Barbuda (see below). While acknowledging the inter-island exchange of psittacids by Amerindians at European contact (see Oviedo, 1959; Wilson, 1990), we believe it likely that most or all West Indian islands did sustain their own sets of indigenous, if not endemic, species of macaws, parakeets, and parrots.

0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

175

176

Biogeography of the West Indies: Patterns and Perspectives

We hope that this chapter will help keep alive the memory of extirpated populations or species of West Indian psittacids among those who study extant Antillean birds. With the blending of ornithology and birdwatching over the last decade or two, interest has waned in species that no longer can be seen with binoculars. Most of the species listed in Tables 1 to 4 are seldom mentioned in the ornithological literature, with Snyder et al. (1987) and Butler (1992) being conspicuous and important exceptions. The validity of some of the names or records is difficult to evaluate based on evidence in hand; we cannot be certain that every one of these species existed, although we are confident that most of them did. Our compilation of distributional data on parrots is in some measure a response to the close of the Bondian era in West Indian ornithology. Bond (1971, and various “checklists” such as those in 1950 and 1956) often ignored prehistoric and early historic records in compilations of the West Indian avifauna. Many living species of Antillean birds were also lumped with little justification by Bond. Raffaele et al. (1998) has recognized once again many of these endemic species, although we would like to point out that even this excellent new standard reference for the modern distribution of West Indian birds gives very little indication of the extent to which species of birds, parrots and otherwise, have been lost since human arrival in the Antilles. Some appreciation for these losses can be gleaned from Olson (1978, 1982), Steadman et al. (1984a), and Pregill et al. (1994).

BRIEF SPECIES ACCOUNTS All West Indian species of psittacids are listed in Tables 1 to 4, proceeding west to east in the Greater Antilles and north to south in the Lesser Antilles (Figure 1). Our brief species accounts will cover only extinct species, extirpated populations, or prehistoric records of extant populations. The current distribution and status of extant forms are summarized in Snyder et al. (1987), Butler (1992), and Raffaele et al. (1998); the former two papers also review historical distributions. Our primary contribution here is to summarize the prehistoric records, several of which have not been published before. A dagger (†) indicates an extinct taxon. We will name the extinct, undescribed species from archaeological and paleontological sites in a separate publication. Synonyms for genera are from Ridgway (1916).

MACAWS (ARA) West Indian synonyms Anodorhynchus (in part), Arara, Macrocercus, Psittacus, Sittace No species of macaws (Ara spp.) still exist anywhere in the West Indies (Table 1). Only one species of Ara, the Cuban A. tricolor, is known from whole specimens (Walters, 1995). Evidence for the others comes from prehistoric bones or from written accounts of the 17th through 19th centuries. We believe that each Greater Antillean and Lesser Antillean island once sustained one or two indigenous if not endemic species of Ara. Macaws survived into historic times on at least Cuba, Isla de Pinos, Jamaica, Hispaniola, Guadeloupe, Dominica, and Martinique, although the species-level systematics of these macaws often is poorly resolved, as detailed below. †Ara tricolor (Bechstein, 1811) — Cuban Macaw According to Bangs and Zappey (1905), the last known pair of Cuban macaws was shot in 1864 at La Vega on the Zapata Peninsula. Gundlach (in Cory, 1886; Greenway, 1958) believed that A. tricolor persisted in the swamps of southern Cuba in 1876. Wetmore (1928) identified a carpometacarpus from an undated cave deposit in Cuba as A. tricolor. There are skins of A. tricolor in the British Museum and Liverpool Museum (Salvadori, 1891, 1906b; Walters, 1995), but no modern skeletal specimens of A. tricolor exist. Wetmore’s identification was based on extrapolation from skins and the relative size of the carpometacarpus in living species of macaws; the fossils were larger than those in A. severa, a relatively small species of Ara.

FIGURE 1 The past and present distribution of macaws (Ara), parakeets (Aratinga), and parrots (Amazona) in the West Indies. † = extinct species, subspecies, or population. Based on data in Table 4.

The Historic and Prehistoric Distribution of Parrots (Psittacidae) in the West Indies 177

178

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 Prehistoric, Historic, and Modern Records of Ara in the West Indies Species

Island

Present Status

Prehistoric

Historic

Carpometacarpus from Ciego Montero cave — Wetmore, 1928

Last recorded in 1864 — Salvadori, 1906a; Ridgway, 1916:136–137; Snyder et al., 1987 Last recorded in 1860s — Bangs and Zappey, 1905 Clark, 1905d Salvadori, 1906a; Rothschild, 1905, 1907; Ridgway, 1916:137–138; Wetmore, 1937; Snyder et al., 1987. Rothschild, 1905, 1907; Ridgway, 1916:140; Wetmore, 1937; Snyder et al., 1987 Salvadori, 1906a; Rothschild, 1907; Ridgway, 1916:125; Wetmore, 1937 Clark, 1905d; Wetmore and Swales, 1931; Snyder et al., 1987; Raffaele et al., 1998 —

Extinct

—

Extinct

Clark, 1905a; Salvadori, 1906a; Ridgway, 1916:131–132; Wetmore, 1937; Snyder et al., 1987; Butler, 1992

Extinct

†Ara tricolor

Cuba

†A. tricolor

Isla de Pinos

—

†A. tricolor* †A. gossei

Jamaica Jamaica

— —

†A. erythrocephala

Jamaica

—

†A. erythrura*

Jamaica?

—

A. tricolor? and/or †Ara unknown sp.

Hispaniola

—

†A. autochthones

St. Croix

†Ara undescr. sp.

Montserrat

†A. guadeloupensis

Guadeloupe

†Ara cf. guadeloupensis

Marie Galante

†A. atwoodi

Dominica

†A. martinica * and/or †Ara undescr. sp.

Martinique

—

†Anodorhynchus purpurascens*

Guadeloupe

—

†A. martinicus*

Martinique

—

Tibiotarsus from Amerindian midden — Wetmore, 1937; Olson, 1978; Wing, 1989 Coracoid from Trants site — this chapter —

Ulna from Folle Anse site — this chapter —

Extinct

Extinct Extinct Extinct

Extinct

Extinct

Extinct

Extinct Clark, 1905a; Wetmore, 1937; Snyder et al., 1987; Butler, 1992 Rothschild, 1907; Ridgway, 1916:125; Wetmore, 1937; Snyder et al., 1987; Butler, 1992 Salvadori, 1906a; Rothschild, 1907; Ridgway, 1916:119; Wetmore, 1937 Rothschild, 1905; Salvadori, 1906a

Extinct Extinct

Extinct

Extinct

Note: † = Extinct species; * = validity of species, or of the species on this particular island, needs to be corroborated and may be doubtful; these records, therefore, are not included in Table 4.

The Historic and Prehistoric Distribution of Parrots (Psittacidae) in the West Indies

179

The juvenile plumage of Ara tricolor may have been predominantly green, which might account for several early reports of A. militaris on Cuba and Jamaica (Clark, 1905d). The overall plumage pattern of A. tricolor suggests that its nearest mainland relative may be A. macao, the Scarlet Macaw. The distribution of red and blue in the plumage is similar, as is the presence of a white facial patch that is featherless except for small crescentic lines of tiny red feathers. Ara tricolor differs from A. macao in that it lacks the yellow shoulder patch, has an all-black bill, and is much smaller. The modern range of A. macao is in lowland forest from southern Mexico through Central America to much of tropical South America. Among Caribbean islands it has been recorded, but is not currently resident, on Trinidad, a continental rather than oceanic island (ffrench, 1991:183). Thus the modern range of A. macao encompasses much of the western and southern margins of the Caribbean Sea. †Ara gossei (Rothschild, 1905) — Gosse’s Macaw Found in “the mountains” of Jamaica, one specimen was shot about 1765 near the Montego Bay area (Gosse, 1847). The fate of this specimen is unknown, but Greenway (1958:318) reported that “Such a bird was described by a Dr. Robinson, who saw a stuffed specimen.” No exact date was given for Dr. Robinson’s report. Ara gossei probably looked very similar to A. tricolor. The major difference was in the forehead, described as yellow in A. gossei and red in A. tricolor. Robinson described the preserved specimen as: “forehead, crown, and back of neck bright yellow; sides of face around eyes, anterior and lateral part of the neck, and back a fine scarlet; wing coverts and breast deep sanguine red; winglet [sic] and primaries an elegant light blue; basal half of the upper mandible black, apical half ash colored; lower mandible black; tail and feet were missing” (Greenway, 1958:318). †Ara erythrocephala (Rothschild, 1905) — Red-headed Green Macaw Greenway (1958:320) called this an “almost mythical bird” given the circumstances surrounding its description. Ara erythrocephala was said to have been found in the mountains of Trelawney and St. Anne’s parishes, Jamaica (Rothschild, 1905). The head was red, the body bright green, and the wings and greater coverts blue. The tail was scarlet and blue on top, whereas the tail and wings were intense orange-yellow underneath (Rothschild, 1905; Salvadori, 1906a; Greenway, 1958). Snyder et al. (1987) suggested that A. erythrocephala may represent A. militaris or A. ambigua, both Central American species. Especially given that two endemic species of Amazona occur in Jamaica, we see no reason why multiple species of Ara could not also have inhabited this large island of diverse habitats. †Ara erythrura (Rothschild, 1907) — Red-tailed Blue-and-Yellow Macaw Rothschild (1907:53) named Ara erythrura from the report of two large, blue and yellow parrots observed by a Reverend Comard of Jamaica in the early 1800s. Greenway (1958:319) regarded Rothschild’s description of A. erythrura as not credible because it was based on de Rochefort (1658), who had not visited Jamaica but “seems to have taken his account from du Tertre.” Greenway (1958:319) suggested that, if anything, A. erythrura is a synonym of A. martinica, a poorly documented form supposedly from Martinique (see below). †Ara tricolor? or †Ara unknown sp. — Hispaniolan Macaw Among the three species of psittacids noted by Casas (1876) on Hispaniola at the end of the 1400s was a macaw that differed from those on other islands in that it had a white forehead, not red as is seen in Ara tricolor. Macaws were said to have been common formerly in Hispaniola but rare by 1760 (Clark, 1905d). Buffon (1779 [not seen by us; in Greenway, 1958]) reported a macaw on the south coast of Hispaniola. Gosse (1847) mentioned that a small macaw reported to be A. tricolor

180

Biogeography of the West Indies: Patterns and Perspectives

was found on Haiti, although he himself had not seen it. He suggested that it represented a species of Ara other than those already known from Cuba and Jamaica (from Rothschild, 1905). †Ara autochthones (Wetmore, 1937) — St. Croix Macaw A tibiotarsus excavated from a prehistoric archaeological site on St. Croix is the basis for Ara autochthones (Wetmore, 1937). This bone was from an adult-sized, immature individual intermediate in size between A. macao and A. severa and slightly larger than in A. tricolor. Olson (1978) confirmed that the tibiotarsus is of an immature macaw and is not referable to any living species, noting further that A. autochthones was not necessarily indigenous to St. Croix because prehistoric West Indian peoples were known to keep and trade live psittacids, a particular concern with material excavated from a cultural site. Wing (1989) also suggested that A. autochthones may have been traded to St. Croix. While this is possible, there also is no reason why St. Croix could not have sustained an indigenous species of Ara, especially given the substantial evidence of indigenous macaws in both the Greater and Lesser Antilles. †Ara undescribed sp. — Montserrat Macaw A nearly complete coracoid from the Trants archaeological site on Montserrat represents a small, presumably undescribed species of Ara. The specimen is smaller than in A. ararauna and larger than in A. severa or A. manilata, although closer in size to the last two. This specimen was recovered from excavations at Trants by D. R. Watters subsequent to the recovery of numerous bird bones from this rich site reported by Steadman et al. (1984b) and Reis and Steadman (1999). †Ara guadeloupensis (Clark, 1905a) — Guadeloupe Macaw This species was superficially similar to A. macao, but smaller and with the tail entirely red (Salvadori, 1906a). du Tertre (1654; in Clark, 1905a) gave the following description: “the head, neck, underparts, and back are flame color. The wings are a mixture of yellow, azure, and scarlet. The tail is wholly red, and a foot and a half long.” The tail in A. guadeloupensis was much larger than in A. tricolor, a relatively small macaw with a tail length of ~12 in. (290 to 305 mm; Ridgway, 1916:136), although Greenway (1958:318) incorrectly claimed that A. guadeloupensis had a shorter tail than A. tricolor. Labat (1742:II:211) observed a macaw on Guadeloupe with similar plumage, stating further that the macaws and parrots of Guadeloupe were generally larger than those from other islands, although the parakeets were smaller. du Tertre (1654:294) mentioned that this species was long-lived (“live longer than a man”) but that they were “almost all subject to a falling sickness.” Thus perhaps a disease outbreak, combined with hunting pressure, could account for the extinction of A. guadeloupensis. Macaws were becoming rare in the Lesser Antilles (and presumably throughout the West Indies) even in the 1700s (Clark, 1905a). We find no evidence for the suggestion by Clark (1905a) that A. guadeloupensis also occurred on Dominica and Martinique. Based on what is attributed to Labat (Clark, 1905a:269), it would seem more likely that the Lesser Antillean macaws were endemic to each island or set of nearby islands. Christopher Columbus reported red parrots that were called “Guacamayos” by the Caribs on Guadeloupe (Clark, 1905a). Because these Caribs were able to tell Columbus the direction of the mainland, Greenway (1958:319) suggested that the parrots could have been imported to Guadeloupe. We admit this possibility, but see it as no more likely than that they were indigenous. de Rochefort (1658) mentioned three plumage patterns for macaws of the Lesser Antilles but, being pre-Linnean, did not refer to any binomial or other diagnostic names. The first had a pale yellow head, back, and wings, with the tail entirely red [Ara?]. In the second the whole body was flame and the wings were yellow, blue, and red [A. guadeloupensis]. The third pattern was “a mixture of red, white, blue, green, and black with a body size similar to a pheasant (Phasianus colchicus) [similar to A. macao?].”

The Historic and Prehistoric Distribution of Parrots (Psittacidae) in the West Indies

181

†Ara cf. guadeloupensis — Marie Galante (Guadeloupe?) Macaw An ulna from the Folle Anse archaeological site on Marie Galante represents a species of Ara that most likely, although far from certainly, is from A. guadeloupensis, an extinct species for which no skeletal (or skin) specimen exist. This ulna is slightly smaller than that in A. macao, and substantially smaller than that in A. ararauna. †Ara atwoodi (Clark, 1908) — Dominica Macaw Thomas Atwood (1791) noted a macaw from Dominica that was larger than the two local species of parrots (Amazona arausiaca, A. imperialis) and in great abundance. This species was said to have green and yellow plumage “with a scarlet coloured fleshy substance from the ears to the root of the bill.” The “chief feathers” of the wings and tail were scarlet as well. While macaws are characterized by their patch of bare skin on the face, no extant macaw (or other described extinct macaw) has a red facial patch (Clark, 1908). †Ara martinica (Rothschild, 1905) — Martinique Macaw Greenway (1958:319) and Snyder et al. (1987) both suggested that this putative species likely pertained to A. ararauna, a mainland species that could have been traded to Martinique. Snyder et al. (1987) noted, however, that an unnamed and poorly known but distinctive macaw once lived on Martinique.

MACAWS (ANODORHYNCHUS) †Anodorhynchus purpurascens (Rothschild, 1905) — Guadeloupe Violet Macaw Rothschild (1905) based his description on a paper by de Navaret (1838), which neither Greenway nor we were able to locate. Greenway (1958:320) and Snyder et al. (1987) suggested that the species was based on either a poor description of Amazona violacea (now extinct but formerly found on Guadeloupe) or of the Brazilian Anodorhynchus leari, which must have been imported to Guadeloupe. The plumage was described as entirely violet, which suggests a species of Anodorhynchus. †Anodorhynchus martinicus (Rothschild, 1905) — Martinique Macaw Rothschild (1905) described this species from an account by Bouton (1635, which we have not seen) of a macaw on Martinique that was blue above with orange underparts. Salvadori (1906a) regarded Anodorhynchus martinicus to be based on Ara ararauna. We regard both supposed species of Anodorhynchus in the Lesser Antilles as requiring further corroboration.

PARAKEETS (ARATINGA) West Indian synonyms Conurus, Euopsitta, Psittacara, Psittacus Parakeets (Aratinga) are long-tailed, often rather small psittacids that are proportionally similar to macaws of the genus Ara. Modern records of West Indian forms of Aratinga are confined to the Greater Antilles (Table 2). According to Clark (1905b) the West Indian parakeets were too small to attract much attention from early writers and, as a result, the accounts of Aratinga from the 17th and 18th centuries are brief and often lack in diagnostic information. Aratinga euops (Wagler, 1832) — Cuban Parakeet The Cuban parakeet, which still exists on Cuba itself, was once abundant on Isla de Pinos, where it was bordering on extirpation a century ago (Bangs and Zappey, 1905) and was lost shortly thereafter.

182

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 Prehistoric, Historic, and Modern Records of Aratinga in the West Indies Species

Island

Prehistoric

Historic Ridgway, 1916:160–161 Extirpated ca. 1900 — Bangs and Zappey, 1905; Marien and Koopman, 1955; Snyder et al., 1987 Ridgway, 1916:174–175 Ridgway, 1916:153–154

Aratinga euops †A. euops

Cuba Isla de Pinos

— —

A. nana A. chloroptera chloroptera †A. chloroptera maugei

Jamaica Hispaniola and offshore islands Puerto Rico and Mona

— —

†Aratinga undescr. sp.

Barbuda

†A. labati

Guadeloupe

†Aratinga undescr. sp.

Dominica

—

†Aratinga undescr. sp. †Aratinga undescr. sp.

Martinique

—

Barbados

—

—

Palatine — Pregill et al., 1994; sternum — this chapter —

Last specimen 1892, believed to be extinct shortly thereafter; perhaps extant on Mona in 1905 — Clark, 1905c; Salvadori, 1906a; Ridgway, 1916:155, Rothschild, 1905; Marien and Koopman, 1955; Snyder et al., 1987 —

Already rare before 1760 — Rothschild, 1905; Salvadori, 1906; Ridgway, 1916:175; Snyder et al., 1987 No description, exterminated before 1878 — Clark, 1905b, 1911; Snyder et al., 1987; Butler, 1992 Clark, 1905b, 1911; Snyder et al., 1987; Butler, 1992 Clark, 1905b, 1911; Snyder et al., 1987; Butler, 1992

Present Status Threatened Extinct

Common Locally common but declining Extinct

Extinct

Extinct

Extinct

Extinct Extinct

Note: Subspecies follow Ridgway (1916); † = extinct species, subspecies, or population.

†Aratinga chloroptera maugei (Souancé, 1856) — Puerto Rican/Mona Parakeet Compared to Aratinga c. chloroptera, this extinct form (recognized as a full species in Raffaele et al., 1998) was smaller, with a darker-colored bill, lighter red under primary coverts, and completely green lesser primary coverts (Ridgway, 1916:155). Only three specimens of A. c. maugei exist, all from Mona, the last collected in 1892 (Greenway, 1958:321). It was lost from Puerto Rico in the late 1800s. Rothschild (1905) regarded A. c. maugei as still living on Mona, whereas Bond (1950) reported that A. c. maugei probably was gone from Mona. †Aratinga undescribed sp. — Barbudan Parakeet A quadrate of a very large, undescribed species of Aratinga was reported from Barbuda II, a paleontological cave locality on the east coast of Barbuda, by Pregill et al. (1994). Larger than in any extant species of Aratinga, this quadrate also represented the first specimen of Aratinga from

The Historic and Prehistoric Distribution of Parrots (Psittacidae) in the West Indies

183

anywhere in the Lesser Antilles. A sternum of Aratinga recently discovered in the Vertebrate Paleontology collections at the Florida Museum of Natural History, from the nearby site of Barbuda I, is also very large and must be from the same extinct species. †Aratinga labati (Rothschild, 1905) — Guadeloupe Parakeet Thought to be endemic to Guadeloupe, Aratinga labati was named by Rothschild (1905) based on a description by Labat (1742:II:211). Aratinga labati, for which no specimen exists, was small and green overall, with a small patch of red on the crown and a pale bill (Clark, 1905b). Greenway (1958:322) believed that the species probably existed because du Tertre (1654:299, 1667:251) mentioned a third species of parrot on Guadeloupe that was “all green and big as magpies.” Hughes (1750) also noted a small, green “Parakite” [sic] on Guadeloupe. †Aratinga undescribed spp. — Dominica, Martinique, and Barbados Parakeets Known only from early travelers’ accounts (summarized in Clark, 1905b; Snyder et al., 1987), distinctive forms of parakeets once occurred on these three islands and undoubtedly all other islands in the Lesser Antilles.

PARROTS

OR

AMAZONS (AMAZONA)

West Indian synonyms Androglossa, Chrysotis, Oenochrus, Onochrus, Psittacus. Amazona leucocephala hesterna (Cory, 1886) — Cayman Parrot This subspecies has been extirpated in historic times on Little Cayman Island (Bradley 1995). It survives on Cayman Brac. Amazona leucocephala bahamensis (Bryant, 1867) — Rose-throated (Bahamas) Parrot Fossils and historic records indicate that this species, now restricted in the Bahamas to Abaco and Great Inagua, was once widespread in the island group, including the Turks and Caicos Islands (Brodkorb, 1959; Olson and Hilgartner, 1982; Carlson, 1999; Table 3, this chapter). Columbus noted flocks of parrots that would “obscure the sun” in the Bahamas (Dunn and Kelley, 1989:105). †Amazona undescribed sp. — Turks and Caicos Parrot This extinct parrot is known only from a palatine and scapula from the Coralie archaeological site on Grand Turk, where it was sympatric with the smaller A. leucocephala (Carlson, 1999). †Amazona vittata gracilipes (Ridgway, 1915) — Culebra Parrot This endemic subspecies perished sometime early this century, but we have been unable to find any details. †Amazona vittata — Barbuda (Puerto Rican) Parrot A nearly complete rostrum is from Barbuda I, an undated (but almost certainly precultural) paleontological cave locality on Barbuda. We recently discovered this specimen, collected in 1962, in the Vertebrate Paleontology collections at the Florida Museum of Natural History. It agrees with the rostrum of modern Amazona vittata from Puerto Rico.

184

Biogeography of the West Indies: Patterns and Perspectives

TABLE 3 Prehistoric, Historic, and Modern Records of Amazona in the West Indies Species Amazona leucocephala bahamensis

†A. leucocephala bahamensis

†Amazona undescr. sp.

Island

Present Status

Prehistoric

Historic

Abaco, Bahamas

—

—

Common

Great Inagua, Bahamas Crooked Island, Bahamas New Providence, Bahamas

—

—

Common

Premaxilla — Wetmore, 1938; Olson and Hilgartner, 1982 Tarsometatarsus, radius — Brodkorb, 1959; ulnae, radius, carpometacarpi, femur, tarsometatarsi — Olson and Hilgartner, 1982 Todd and Worthington, 1911 — — Six bones — Carlson, 1999

—

Extinct

—

Extinct

— Bond, 1956 Bond, 1956 —

Extinct Extinct Extinct Extinct

Acklins, Bahamas Long, Bahamas Fortune, Bahamas Grand Turk, Bahamas Grand Turk, Bahamas Cuba

Palatine, scapula — Carlson, 1999 —

—

Extinct

—

Isla de Pinos

—

—

Grand Cayman

—

—

Locally common Low but recovering Common

Cayman Brac

—

—

Common

Little Cayman

—

Bradley, 1995

Extinct

Jamaica

—

Ridgway, 1916:267–269; Pregill et al., 1991

A. agilis

Jamaica

—

Ridgway, 1916:262–263; Pregill et al., 1991

A. ventralis

Hispaniola, Grande Cayemite, Gonâve, Saona, Beata Puerto Rico Culebra

—

Ridgway, 1916:265–267

Locally common and widespread Threatened but locally common Uncommon, local

— —

Ridgway, 1916:263–265 Ridgway, 1916:265; Snyder et al., 1987 — —

A. leucocephala leucocephala A. leucocephala palmarum A. leucocephala caymanensis A. leucocephala hesterna †A. leucocephala hesterna A. collaria

A. vittata vittata †A. vittata gracilipes †A. vittata

Barbuda Antigua

†Amazona undescr. sp.

Montserrat

Rostrum — this chapter Two bones (as Amazona sp.) — Steadman et al., 1984a, Pregill et al., 1988; as A. vittata — Pregill et al., 1994 Humerus — Reis and Steadman, 1999; coracoid, humerus, ulna, femur — this chapter

—

Endangered Extinct Extinct Extinct

Extinct

The Historic and Prehistoric Distribution of Parrots (Psittacidae) in the West Indies

185

TABLE 3 (continued) Prehistoric, Historic, and Modern Records of Amazona in the West Indies Species

Island

Prehistoric

Historic

—

Rare in 18th century — Clark, 1905c; Ridgway, 1916:224; Olson, 1978; Snyder et al., 1987; Butler, 1992 — Ridgway, 1916:229–232; Butler, 1992 Ridgway, 1916:222–224; Butler, 1992 Ridgway, 1916: 231; Olson, 1978; Snyder et al., 1987; Butler, 1992 Ridgway, 1916:227–229; Butler, 1992 Ridgway, 1916:225–227; Butler, 1992 Butler, 1992

†A. violacea

Guadeloupe

†Amazona cf. violacea A. arausiaca

Marie Galante Dominica

A. imperialis

Dominica

—

†A. martinicana

Martinique

—

A. versicolor

St. Lucia

—

A. guildingii

St. Vincent

—

†Amazona undescr. sp.

Grenada

—

Tibiotarsus — this chapter —

Present Status Extinct

Extinct Endangered Endangered Extinct

Rare Rare Extinct

Note: Subspecies follow Ridgway (1916); † = extinct species, subspecies, or population.

†Amazona vittata — Antigua (Puerto Rican) Parrot Two bones were reported from the Indian Creek and Mill Reef archaeological sites on Antigua as Amazona sp. (Steadman et al., 1984a; Pregill et al., 1988). In Pregill et al. (1994) these bones were identified more precisely as A. vittata. While it has been suggested that this parrot may have been brought to the island by early human colonizers (Steadman et al., 1984a), the precultural fossil from Barbuda shows that this species is indigenous to Barbuda and therefore, presumably, to Antigua as well. It is possible that this species or species-complex once ranged from the northern Lesser Antilles to Puerto Rico. †Amazona undescribed sp. — Montserrat Parrot This small species is about the size of Amazona ventralis or A. agilis, smaller than all other West Indian species of Amazona. It is represented by five specimens (coracoid, two humeri, ulna, and femur) from the Trants archaeological site on Montserrat. One of the humeri was reported as Amazona sp. (smaller than any living Lesser Antillean species) by Reis and Steadman (1999). The other four specimens have come to light only recently, and demonstrate that an undescribed, extinct species of Amazona once inhabited Montserrat. †Amazona violacea (Gmelin, 1788) — Guadeloupe Parrot Although specimens are lacking, the early descriptions and observations of Amazona violacea (summarized in Greenway, 1958:222, 328; Snyder et al., 1987; Butler, 1992) provide a solid basis for believing that this large species did indeed exist but has been extinct since the early 1700s. †Amazona cf. violacea — Guadeloupe Parrot? A tibiotarsus from the Folle Anse archaeological site on Marie Galante represents a large species of Amazona. The fossil is much larger than in A. arausiaca, and most similar to that in A. imperialis,

186

Biogeography of the West Indies: Patterns and Perspectives

TABLE 4 Summary of Distribution of West Indian Psittacids on Major Islands or Island Groups Island Bahamas Cuba Isla de Pinos Cayman Islands Jamaica Hispaniola Puerto Rico Mona Culebra St. Croix Barbuda Antigua Montserrat Guadeloupe Marie Galante Dominica Martinique Barbados St. Lucia St. Vincent Grenada

Ara — †tricolor †tricolor — †gossei †erythrocephala †tricolor? and/or †unknown sp. — — — †autochthones — — †undescr. sp. †guadeloupensis †cf. guadeloupensis †atwoodi †martinica and/or †undescr. sp. — — — —

Number of Genera/Species

Aratinga

Amazona

—

leucocephala, undescr. sp. leucocephala leucocephala leucocephala agilis, collaria ventralis

1/2 3/3 3/3 1/1 3/5

v. vittata

euops †euops — nana c. chloroptera

3/3

†chloroptera maugei †chloroptera maugei — — †undescr. sp. — — †labati — †undescr. sp. †undescr. sp.

— †vittata gracilipes — †cf. vittata †cf. vittata †undescr. sp. †violacea †cf. violacea arausiaca, imperialis †martinicana

2/2 1/1 1/1 1/1 2/2 1/1 2/2 3/3 2/2 3/4 3/4

†undescr. sp. — — —

— versicolor guildingii †undescr. sp.

1/1 1/1 1/1 1/1

Note: † = Extinct species, subspecies, or population.

but with a slightly shorter overall length. The modern avifauna of Marie Galante shares many species with nearby Guadeloupe, so it is possible that the prehistoric tibiotarsus represents A. violacea, a large species known historically but now extinct (see above). †Amazona martinicana (Clark, 1905c) — Martinique Parrot Extinct since the 18th century, this large species was rather similar to A. violacea and the other very large Lesser Antillean species of Amazona, such as A. arausiaca (Ridgway, 1916:231; Greenway, 1958:328). ?Amazona versicolor (Müller, 1776) — St. Lucia Parrot A psittacid carpometacarpus from the Grand Anse archaeological site on St. Lucia is too fragmentary to be referred a genus. It is similar in size to the carpometacarpus in both Ara severa (extralocal) and Amazona versicolor, which is endemic to St. Lucia where it survives in low numbers (Keith, 1997). †Amazona undescribed sp. — Grenada Parrot This apparently large species is poorly known from a description by du Tertre (1667), as mentioned by Snyder et al. (1987) and Butler (1992).

The Historic and Prehistoric Distribution of Parrots (Psittacidae) in the West Indies

187

CONCLUSIONS Although many distributional gaps remain, the overall conclusion from the data presented is that at least one species in each of the three widespread West Indian psittacid genera (Ara, Aratinga, Amazona) once occurred on each major island in the Greater and Lesser Antilles (Table 4). In the Bahamas and Cayman Islands, only Amazona is known. Extinct are all species of West Indian macaws (Ara spp.), Lesser Antillean parakeets (Aratinga spp.), and parrots (Amazona spp.) between Puerto Rico and Dominica. The various extinctions probably occurred in prehistoric as well as historic times. Sympatric congeneric pairs of species may have occurred, at least locally, in Amazona and perhaps in Ara. Details of many of the species-level issues remain unresolved, although this situation can be improved through additional historical, zooarchaeological, and paleontological research on the fascinating but badly fragmented psittacid fauna of the West Indies. In the absence of both prehistoric and historic human impact, perhaps 50 to 60 species of macaws, parakeets, and parrots would inhabit the West Indies today. At least three fourths of these species already are gone.

ACKNOWLEDGMENTS We thank S. Scudder, F. Sergile, A. V. Stokes, A. Van Doorn, E. S. Wing, and C. A. Woods for their help with various aspects of our research. For access to specimens under their care, we also thank the curatorial staffs at the American Museum of Natural History, Field Museum of Natural History, Florida Museum of Natural History, National Museum of Natural History (Smithsonian Institution), and University of Michigan Museum of Zoology.

LITERATURE CITED Atwood, T. 1791. The History of the Island of Dominica. J. Johnson, London. Bangs, O. and W. R. Zappey. 1905. Birds of the Isle of Pines. American Naturalist 39:179–215. Bond, J. 1950. Check-List of Birds of the West Indies, 3rd ed. Academy of Natural Sciences, Philadelphia. Bond, J. 1956 [+ 25 supplements, 1956–1984]. Check-List of Birds of the West Indies, 2nd ed. Academy of Natural Sciences, Philadelphia. Bond, J. 1971. Birds of the West Indies, 2nd ed. Houghton Mifflin, Boston. Bradley, P. E. 1995. Birds of the Cayman Islands. Caerulea Press, Italy. Brodkorb, P. 1959. Pleistocene birds from New Providence Island, Bahamas. Bulletin of the Florida State Museum, Biological Sciences 4:349–371. Butler, P. J. 1992. Parrots, pressures, people, and pride. Pp. 25–46 in Beissinger, S. R. and N. F. R. Snyder (eds.). New World Parrots in Crisis; Solutions for Conservation Biology. Smithsonian Institution Press, Washington, D.C. Carlson, L. A. 1999. Aftermath of a Feast: Human Colonization of the Southern Bahamian Archipelago and Its Effects on the Indigenous Fauna. Ph.D. dissertation, Department of Anthropology, University of Florida, Gainesville. Casas, B. de las. 1876. Historia de las Indias, 5 vols. Madrid. Clark, A. H. 1905a. The Lesser Antillean macaws. Auk 22:266–273. Clark, A. H. 1905b. The genus Conurus in the West Indies. Auk 22:310–312. Clark, A. H. 1905c. The West Indian parrots. Auk 22:337–344. Clark, A. H. 1905d. The Greater Antillean macaws. Auk 22:345–348. Clark, A. H. 1908. The macaw of Dominica. Auk 25:309–311. Clark, A. H. 1911. A list of the birds of the island of St. Lucia. West Indian Bulletin 11:182–192. Cory, C. B. 1886. The birds of the West Indies, including the Bahama Islands, the Greater and Lesser Antilles, excepting the islands of Tobago and Trinidad. Auk 3:454–472. Dunn, O. and A. E. Kelley, Jr. 1989. The Diario of Christopher Columbus’s First Voyage to America 1492–3: Abstract by Fray Bartolomé las Casas. University of Oklahoma Press, Norman. ffrench, R. 1991. A Guide to the Birds of Trinidad and Tobago, 2nd ed. Cornell University Press, Ithaca, New York. Gosse, P. H. 1847. The Birds of Jamaica. Van Voorst, London.

188

Biogeography of the West Indies: Patterns and Perspectives

Greenway, J. C. 1958. Extinct and Vanishing Birds of the World. American Committee for International Wild Life Protection Special Publication 13. Hughes, G. 1750. Natural History of Barbadoes. London. Keegan, W. F. 1994. West Indian archaeology. 1. Overview and foragers. Journal of Archaeological Research 2:255–284. Keegan,W. F. 2000. West Indian Archaeology. 3. Ceramic age. Journal of Archaeological Research 8:135–167. Keith, A. R. 1997. The birds of St. Lucia, West Indies. British Ornithologists’ Union Check-list No. 15. Labat, J. B. 1742. Nouveau voyage aux isles de l’Amérique, contenant l’histoire naturelle de ces pays, l’origine, les moeurs, la religion & le gouvernement des habitants anciens et modernes. T. Le Gras, Paris. Marien, D. and K. F. Koopman. 1955. The relationships of the West Indian species of Aratinga (Aves, Psittacidae). American Museum Novitates 1712:1–20. Olson, S. L. 1978. A paleontological perspective of West Indian birds and mammals. Pp. 99–117 in Zoogeography of the Caribbean. Academy of Natural Sciences of Philadelphia, Special Publication 13. Olson, S. L. 1982. Biological archaeology in the West Indies. The Florida Anthropologist 35:162–168. Olson, S. L. and W. B. Hilgartner. 1982. Fossil and subfossil birds from the Bahamas. Pp. 22–56 in Olson, S. L. (ed.). Fossil Vertebrates from the Bahamas. Smithsonian Contributions to Paleobiology, No. 48. Oviedo, G. F., de. 1959. Natural History of the West Indies, edited and translated by S. A. Stoudemire. University of North Carolina Press, Chapel Hill. Pregill, G. K., D. W. Steadman, S. L. Olson, and F. V. Grady. 1988. Late Holocene Fossil Vertebrates from Burma Quarry, Antigua, Lesser Antilles. Smithsonian Contributions to Paleobiology, No. 463. Pregill, G. K., R. I. Crombie, D. W. Steadman, L. K. Gordon, F. W. Davis, and W. B. Hilgartner. 1991. Living and late Holocene fossil vertebrates, and the vegetation of the cockpit country, Jamaica. Atoll Research Bulletin 353:1–19. Pregill, G. K., D. W. Steadman, and D. R. Watters. 1994. Late Quaternary vertebrate faunas of the Lesser Antilles: Historical components of Caribbean biogeography. Bulletin of Carnegie Museum of Natural History, No. 30. Raffaele, H., J. Wiley, O. Garrido, A. Keith, and J. Raffaele. 1998. A Guide to the Birds of the West Indies. Princeton University Press, Princeton, New Jersey. Reis, K. R. and D. W. Steadman. 1999. Archaeology of Trants, Montserrat. Part 5. Prehistoric avifauna. Annals of the Carnegie Museum 68:275–287. Ridgway, R. 1916. The birds of North and Middle America (Part VII). Bulletin of the United States National Museum 50(part 7):1–543. Rochefort, C. C., de. 1658. Histoire naturelle et morale des Isles Antilles de l’Amérique. Chez Arnould Leers, Rotterdam. Rothschild, W. 1905. Untitled. (Notes on extinct parrots from the West Indies). Bulletin of the British Ornithologists’ Club 16:13–15. Rothschild, W. 1907. Extinct Birds. Hutchison, London. Salvadori, T. 1891. Catalogue of the Psittaci or Parrots in the Collection of the British Museum. British Museum of Natural History, London. Salvadori, T. 1906a. Notes on the parrots (Part V). Ibis, Series 8, 6:451–465. Salvadori, T. 1906b. Notes on the parrots (Part VI). Ibis, Series 8, 6:642–659. Snyder, N. F. R., J. W. Wiley, and C. B. Kepler. 1987. The Parrots of Loquillo: Natural History and Conservation of the Puerto Rican Parrot. Western Foundation of Vertebrate Zoology, Los Angeles, California. Steadman, D. W., G. K. Pregill, and S. L. Olson. 1984a. Fossil vertebrates from Antigua, Lesser Antilles: evidence for late Holocene human-caused extinctions in the West Indies. Proceedings of the National Academy of Sciences, U.S.A. 81:4448–4451. Steadman, D. W., D. R. Watters, E. J. Reitz, and G. K. Pregill. 1984b. Vertebrates from archaeological sites on Montserrat, West Indies. Annals of Carnegie Museum 53:1–29. Tertre, J. B., du. 1654. Histoire générale des isles St. Christophe, de la Guadeloupe, de la Martinique et autres dans l’Amérique. Chez Jacques Langlois et Emamanuel Langlois, Paris. Tertre, J. B., du. 1667. Histoire générale des Antilles habitées par les François, 3 vols. Chez Thomas Jolly, Paris. Todd, W. E. and W. W. Worthington. 1911. A contribution to the ornithology of the Bahama Islands. Annals of the Carnegie Museum 7:388–464. Walters, M. 1995. On the status of Ara tricolor Bechstein. Bulletin of the British Ornithologists’ Club 115:168–170.

The Historic and Prehistoric Distribution of Parrots (Psittacidae) in the West Indies

189

Wetmore, A. 1928. Bones of birds from the Ciego Montero deposit of Cuba. American Museum Novitates 301:1–5. Wetmore, A. 1937. Ancient records of birds from the island of St. Croix with observations on extinct and living birds of Puerto Rico. The Journal of Agriculture of the University of Puerto Rico 21:5–15. Wetmore, A. 1938. Bird remains from the West Indies. Auk 55:51–55. Wetmore, A. and B. H. Swales. 1931. The birds of Haiti and the Dominican Republic. United States National Museum Bulletin 155:1–483. Wilson, S. M. 1990. Hispaniola: Caribbean Chiefdoms in the Age of Columbus. University of Alabama Press, Tuscaloosa. Wing, E. S. 1989. Human exploitation of animal resources in the Caribbean. Pp. 137–152 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida.

Tertiary Vertebrate Fossils 13 Early from Seven Rivers, Parish of St. James, Jamaica, and Their Biogeographical Implications Roger W. Portell, Stephen K. Donovan,* and Daryl P. Domning Abstract — The Seven Rivers vertebrate site, parish of St. James, western Jamaica, is the oldest known land mammal site in the Antillean region (late early or early middle Eocene). The site represents a shallow-water, nearshore, marine paleoenvironment, most probably in an estuarine/deltaic setting, and is at least 12 million years older than the next oldest comparable site, situated in Puerto Rico. The vertebrate fauna from Seven Rivers is dominated by fully aquatic and amphibious taxa, including chondrichthyian and osteichthyian fishes, a crocodilian (possibly ?Charactosuchus kugleri), a pelomedusoid pleurodiran (side-necked) turtle, and two new species of prorastomid sirenian. However, it also includes three fully terrestrial taxa, the rhinocerotoid Hyrachyus sp., an iguanian lizard, and a possible archontan (most likely a plesiadapiform or a primate). Tectonic reconstruction suggests that in the Paleocene to early middle Eocene, the western portion of Jamaica, situated toward the eastern tip of the Nicaraguan Rise, was subaerially exposed and either very close to or connected to Central America. During this time, North American terrestrial tetrapods may have populated western Jamaica across a land bridge connection that was subaerially exposed. The first direct paleontological evidence of this comes from the discovery of terrestrial tetrapods at Seven Rivers. Indeed, these are the first Stage I (pre-inundation) terrestrial tetrapods to have been identified from the Antillean region.

INTRODUCTION Tertiary terrestrial tetrapods are very rare in the fossil record of the Antillean region. Those finds that have been made all occur in the Greater Antilles. These uncommon fossils are of particular importance for testing theories of island biogeography and Caribbean tectonics (both of which have been heavily debated for much of the 20th century). Recent significant finds have included a fascinating array of mammals from the Oligo-Miocene of Cuba, the Dominican Republic, and Puerto Rico (see, for example, MacPhee and Iturralde-Vinent, 1994, 1995a, 1995b; MacPhee and Grimaldi, 1996). These fossils are notable for their antiquity and their diversity, and include sloths, platyrrhine monkeys, rodents, and insectivores. Williams (1989:24) proposed a twofold division of Antillean biogeographical history into Stages I and II. Terrestrial faunas of Stage II are those which colonized the Antillean islands post-inundation, that is, after the islands rose above sea level for the last time. These faunas would obviously include those flightless mammals that have inhabited the Greater Antilles in the Pleistocene and Holocene, consisting solely of ground sloths, monkeys, rodents, and insectivores (Williams, 1989:table 1), while lacking survivors of the pre-inundation fauna (= Stage I). The known Oligo-Miocene taxa of the Greater Antilles represent a post-inundation, Stage II assemblage. As such, they potentially support a vicariant model for the origin of this mammal fauna (see, for example, discussion in MacPhee and Wyss, 1990:3–7), at least for these islands, although data are admittedly sparse. While at least some * Stephen K. Donovan’s contribution is © The Natural History Museum, London. 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

191

192

Biogeography of the West Indies: Patterns and Perspectives

of these taxa may also have been present in pre-inundation, Stage I assemblages, they would have been extirpated by inundation and would have had to repopulate the islands following final emergence. Thus, a true Stage I terrestrial mammal in the Greater Antilles would have to be one of a taxon that does not occur in the Quaternary biota and predates an undoubted “final” major period of inundation. The first Stage I mammal to be recognized from the Greater Antilles was recently collected from western Jamaica by the senior author (see also Domning et al., 1997). This specimen is a right dentary and dp3-m3 from the rhinocerotoid perissodactyl Hyrachyus sp. Herein, we document this fossil and the associated vertebrate fauna, and explain their importance as supporting evidence for tectonic and paleogeographical interpretations of Jamaica’s Paleogene evolution. Vertebrate specimens (and artificial casts of the same) collected from this excavation have been, and will be, deposited in the National Museum of Natural History, Smithsonian Institution, Washington, D.C. (USNM), the Florida Museum of Natural History, University of Florida, Gainesville, Florida (UF), and the Geology Museum, University of the West Indies, Mona, Jamaica (UWI). According to Domning and Clark (1993), the only Tertiary vertebrates reported from Jamaica, prior to our work, were Prorastomus sirenoides Owen, 1855 from the Eocene Stettin and Guys Hill members of the Chapelton Formation; ?Charactosuchus kugleri Berg, 1969 and unidentifiable fragments of turtle from the Guys Hill Member of the Chapelton Formation; and a supposed needlefish jaw, cf. Platybelone argalus (LeSueur, 1821) from the Pliocene Bowden Formation (Caldwell, 1965). The latter record, however, has been shown to be based on the misidentification of a shrimp claw (see Collins and Portell, 1998). Additionally, Fitch and Barker (1972) mentioned the occurrence of one “Miocene” species of fish otolith (Family Moridae) from an unstated locality (very possibly the Pliocene Bowden Formation); Fitch (1969) noted more than 110 kinds of fish otoliths from the Bowden Formation; and Clarke and Fitch (1979) reported that a 225-kg matrix sample from the Bowden Formation, collected for their study of teuthoid (cephalopod) statoliths, contained 25,000 fish otoliths. Recently, Stringer (1998) formally documented the Bowden shell bed otoliths which contained 68 species of teleost fish. Furthermore, Domning (1999) recorded the first Oligocene sea cow remains from the Browns Town Formation. Therefore, in addition to the Seven Rivers material discussed here, the depauperate Jamaican Tertiary vertebrate record comprises Eocene, Oligocene, doubtfully Miocene, and Pliocene marine taxa.

JAMAICAN TECTONICS AND PALEOGEOGRAPHY Draper (1987, 1998) proposed a model that divided the geological and tectonic evolution of Jamaica into four distinct phases (see also Robinson, 1994). During the early Cretaceous to early Cenozoic, Jamaica formed part of the Greater Antillean island arc; volcanism migrated from the central to the eastern part of the island in the late Cretaceous (Phase 1). The island was largely emergent in the latest Cretaceous–early Eocene (Phase 2), a time of intrusion and rifting (Figure 1). In the Eocene, the island became a submerged carbonate bank, perhaps similar to the Bahamas Bank at the present day (Phase 3). This phase of near-continuous limestone deposition in shallow to deeper water settings persisted throughout the mid-Cenozoic. The island was again uplifted about 10 mya and has remained tectonically active throughout the late Cenozoic (Phase 4). The early-middle Eocene was a time of marine transgression, which flooded western Jamaica (= early Phase 3). Volcanism continued, but was waning. Deposition of the Yellow Limestone Group commenced in the west (Robinson, 1988a:figure 3), spreading eastward in the early-middle Eocene. Deeper-water lithofacies were developed off the north coast and in the Wagwater graben, which flanks the southwestern Blue Mountain block in eastern Jamaica (Eva and McFarlane, 1985:figures 5, 6). The Yellow Limestone Group is a mixed sequence of limestones, evaporites, lignites, and siliciclastic rock units. It represents a succession of marginal marine to marine rocks, divided into a number of members of contrasting lithologies (Robinson, 1988a:figure 3), that were deposited as

Early Tertiary Vertebrate Fossils and Their Biogeographical Implications

193

Y PE UCA NI TA NS N UL A

MEXICO

NICARAGUA RISE CHORTIS BLOCK

CO ST A

RI CA

-P AN AM A

JAMAICA

AR C

N FIGURE 1 Reconstruction of the Central American region during the late early–early middle Eocene, redrawn after Robinson (1988b:fig. 6) and Pindell (1994:fig. 2.6k). The probable direction of migration of Hyrachyus is indicated by the arrows. White = land areas; v v v = active volcanic arc;    = shallow-water marine; stipple = deep-water marine;  = subduction zone;  = major thrust faults.

Jamaica sank below sea level. Quartzo-feldspathic sandstones with limestone lenses occur close to the paleoshoreline, with impure limestones occurring farther offshore. The succession that includes the Seven Rivers vertebrate site forms part of the Guys Hill Member of the Chapelton Formation, Yellow Limestone Group, of late-early or early-middle Eocene age. Diagnostic features of this member include the presence of dominant sandstones and associated siliciclastic sedimentary rocks, and locally abundant oysters, Carolia, and carbonized plant remains (Robinson, 1988a). Sedimentological and paleontological evidence favors an estuarine/deltaic environment of deposition for the Seven Rivers locality. Decrease in the proportion of clastic impurities through the sequence of the Yellow Limestone Group reflects the progressive submergence of the landmasses. In the late-middle Eocene, continued erosion and submergence led to the complete disappearance of exposed land areas. Total submergence led to sedimentation dominated by pure limestones of the White Limestone Group, totaling about 2.75 km in thickness (Robinson, 1994:121), which persisted until the middle-late Miocene, that is, over 30 million years. Although Perfit and Williams (1989:70) speculated that Jamaica may have been, in part, subaerially exposed during the mid-Cenozoic, available evidence supports near-continuous deposition of the White Limestone Group (for further discussion, see Domning et al., 1997:638).

194

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 2 Outline map of Jamaica showing the Seven Rivers area in relation to the cities of Montego Bay and Kingston.

LOCALITY AND VERTEBRATE FAUNA Sirenian rib fragments were first observed at Seven Rivers by J. Bryan and the senior author in 1990 (Figure 2). The exposed section is approximately 7 m thick, consisting of a sequence of mudrocks, siltstones, and fine- to medium-grained sandstones. Some units are gypsiferous or contain calcareous nodules. The associated fossil biota contains plant debris (including carbonized wood), moderately diverse benthic mollusks, benthic foraminifers, rarer asteroid ossicles, fragmentary echinoids and crustaceans, and abundant bones, particularly at certain stratigraphic horizons. Excavations at Seven Rivers have been motivated primarily by the desire to obtain further and more complete specimens of the earliest sirenians. The search for these remains has focused on the Chapelton Formation, Yellow Limestone Group, in western Jamaica, because this unit previously yielded the unique type specimen of Prorastomus sirenoides Owen, 1855. Owen’s type specimen, which comprises only the skull, mandible, and atlas vertebra, is the world’s oldest and most primitive sirenian (Savage et al., 1994). Although other, roughly coeval Jamaican localities had yielded additional sirenian remains (see Donovan et al., 1990), these provided only minimal evidence of the postcranial skeleton of the animal. It was hoped that the Seven Rivers site would yield more adequate material when annual excavations commenced in 1994. This hope of finding postcranial (as well as further cranial; Figure 3) material has now been abundantly realized and the Seven Rivers excavation continues to produce bones in gratifying numbers (Domning et al., 1995). It appears that these remains do not represent P. sirenoides, but instead they indicate the presence of at least one, and probably two, taxa of the same family that are slightly more derived. However, these are very close to Prorastomus in their stage of evolution and give a clear picture of the sort of creatures that were the prorastomid sea cows. Perhaps remarkably, these fossils confirm the accuracy of the speculative reconstruction by R. J. G. Savage (in Dixon et al., 1988), that was based only on the holotype skull of P. sirenoides that was originally described by Owen (1855). This reconstruction depicts a pig-sized, barrel-chested animal with four stout legs, stubby toes, and a long and muscular, but slender, tail that was not much modified as a swimming organ. Although these prorastomids had well-developed legs, and at least the earliest of them could support their bodies on land, it is clear that they spent most of their time in the water, where they probably fed on aquatic plants in rivers, estuaries, and lagoons. This aquatic habit is indicated by their enlarged and retracted nasal openings (which facilitated breathing at the water’s surface) and

Early Tertiary Vertebrate Fossils and Their Biogeographical Implications

195

FIGURE 3 Partial skull (rostrum missing) of undescribed species of prorastomid sirenian from the late early or early middle Eocene of Seven Rivers, parish of St. James, western Jamaica (to be deposited at the USNM): (A) dorsal view; (B) ventral view.

their typically sirenian thick, dense ribs (which provided ballast for submerging). They evidently swam by forcefully extending the spinal column, kicking backward and upward with the hind feet used simultaneously, and, perhaps, deriving some additional thrust from the tail. This is the swimming style hypothesized for early whales, such as Ambulocetus (Thewissen et al., 1994), and is also observed in otters today. Later sirenians and cetaceans, in contrast, lost the hind legs and strengthened the tail, adding a horizontal caudal fin for optimal tail-only propulsion. The lower and upper bone beds at Seven Rivers have produced sirenian fossils that represent two distinct stages in this evolutionary transition from terrestrial to fully aquatic locomotion; these exactly parallel the stages through which primitive whales were evolving at the very same time. The earlier stage is reflected in a type of sacrum that consists of at least four vertebrae, rigidly articulated or fused together like those of land mammals and strongly connected to the pelvis. In the later stage,

196

Biogeography of the West Indies: Patterns and Perspectives

the sacrum has been reduced to a single vertebra, which alone joins with the pelvis. This indicates a reduced ability to support the body’s weight out of water and an increased flexibility of the spine in the pelvic region. Together with the features of the ribs and nasal opening cited above, these modifications of the sacral vertebrae testify that the Jamaican prorastomids had already made an irrevocable commitment to aquatic life. This is not surprising, considering where they were found. Sirenians, as close relatives of such groups as proboscideans, embrithopods, desmostylians, and hyracoids, surely shared with them an origin in the Old World, presumably along the shores of the former Tethys Seaway between Eurasia and Africa. The anomalous fact that the most primitive sea cows have instead turned up in the West Indies is apparently an accident of paleontological sampling. A possible prorastomid vertebra has recently been found in the Eocene of Israel (Goodwin et al., 1998). It appears that as soon as ancestral sirenians gained some enhanced ability to swim, they were able to disperse rapidly westward along the tropical shores of Tethys to what are now Central America and the West Indies. Rare fossils from the middle and late Eocene of Florida may represent prorastomids (Savage et al., 1994), and further collecting in Eocene, or even late Paleocene, marginal marine deposits elsewhere in the Tethyan realm should eventually reveal the true history of their evolution and dispersal. Among the hundreds of sirenian bones collected from Seven Rivers, a single right dentary and dp3-m3 of a further large mammal has been collected, attributable to the rhinocerotoid perissodactyl Hyrachyus (Figure 4), close to H. affinis (Marsh, 1871). This specimen was described in detail by Domning et al. (1997), where its affinities and relationships were also discussed. This specimen is considered to be at least 12 million years older than the next oldest Antillean mammal, an early Oligocene sloth from Puerto Rico (MacPhee and Iturralde-Vinent, 1995b). The paleogeographical implications of the Jamaican Eocene Hyrachyus are discussed above and below. The Seven Rivers site has also yielded fossils of fishes, crocodilians, turtles, a lizard, and most recently a possible archontan. The fishes have yet to be studied in detail, but include sharks and rays. The crocodilians are eusuchians, but have not been more precisely identified. They may represent ?Charactosuchus kugleri Berg, 1969, described from the Dump Limestone lenticle of the Guys Hill Member, Chapelton Formation (that is, the same member as the Seven Rivers site), in the parish of Manchester, western Jamaica. The genus is otherwise known only from the Miocene of the Caribbean region, but ?C. kugleri may instead be synonymous with Dollosuchus dixoni (Owen, 1850), from the middle Eocene of England and Belgium (Domning and Clark, 1993). The turtle remains, currently under study by E. Gaffney and R. Weems, represent a pelomedusoid pleurodiran (side-necked) turtle. It is probably a podocnemidid and is similar to members of the shweboemydine group, which are known from Tertiary nearshore/fluvial or marine sediments in Venezuela, Puerto Rico, Cuba, North Africa, and Asia. The lizard (USNM 489192), an iguanian and possibly an anoloid (?Polychrotidae), consists of four dentary fragments, two of which bear a single pleurodont tooth. It represents the oldest terrestrial reptile known from the Caribbean (Pregill, 1999). During the 1999 Seven Rivers field season a second land mammal, a possible archontan currently under study by R. MacPhee et al., was discovered. It is most likely a plesiadapiform or a primate and is represented by an incomplete right petrosal (MacPhee et al., 1999).

DISCUSSION As succinctly stated by Donnelly (1988:15–16), “the Caribbean has remained one of the most controversial areas in the world for geologic reconstructions.” The complex geological history of the Caribbean region has been explained by a plethora of published evolutionary models. These models have relied on a variety of interpretations of the many sources of data available, both plate tectonic (such as Donnelly, 1988, and references therein) and otherwise (Morris et al., 1990, and references therein). Herein, we favor the interpretation of Pindell and co-workers (see, for example, Pindell and Barrett, 1990; Pindell, 1994), which has received wide acceptance, at least in its broad details. It also permits the most reasonable explanation of the occurrence of Hyrachyus, and the

Early Tertiary Vertebrate Fossils and Their Biogeographical Implications

197

FIGURE 4 Right dentary and dp3-m3 of Hyrachyus sp. (USNM 489191) from the late-early or early middle Eocene of Seven Rivers, parish of St. James, western Jamaica (after Domning et al., 1997:figure 1): (A) medial view; (B) lateral view; (C) occlusal view. Scales in cm (A and B) and mm (C).

other associated terrestrial tetrapods, in Jamaica, which we regard as strong, and independent, supporting evidence for the essential correctness of an important aspect of Pindell’s model. The crust of the Caribbean Plate is one of the largest Phanerozoic oceanic plateau basalt provinces in the world (Donnelly, 1994). Available evidence supports an origin for this plate in the Pacific (Pindell, 1990); to grossly simplify a complex process (see Pindell, 1994 for greater detail), the plate was pushed between North and South America, resulting in the subduction of the socalled “Proto-Caribbean Plate.” Perhaps the most compelling evidence for such an origin of the Caribbean Plate is that the best date we have for the opening of the Caribbean seaway is late-middle Jurassic, about 165 mya. However, obducted seafloor sedimentary rocks in southwest Puerto Rico contain microfossils that are 30 million years older, indicating that the Caribbean Plate was formed before the opening of the seaway (Montgomery et al., 1994). During the mid to late Cretaceous, an island arc, including the terranes that constitute the Greater Antilles, formed at the leading edge of the Caribbean Plate as the “Proto-Caribbean Plate” was subducted beneath it. This island arc system was disrupted and fragmented from the late

198

Biogeography of the West Indies: Patterns and Perspectives

Cretaceous onward, as the Caribbean Plate was transported eastward between the North and South American Plates. From the Paleocene to the early Eocene, at least the western portion of Jamaica, at the northeastern edge of the Nicaragua Rise (itself a topographic extension of northern Central America) was subaerially exposed and situated adjacent to the Yucatan Peninsula, from which it was separated by a transform fault (Pindell, 1994:figure 2.6j; Figure 1, this chapter) (= Phase 2 of Draper; see above). This subaerial exposure is interpreted as due to the Yucatan block preventing simple east–northeast movement of the Chortis Block–Nicaragua Rise–Jamaica, resulting in uplift and block faulting of the Nicaragua Rise. As was recognized by Donnelly (1988:28), this formed a terrestrial connection between Central America and Jamaica via the Nicaragua Rise. This connection was to be severed by the middle Eocene following submergence of the Nicaragua Rise. Only after it had moved past this “obstruction” formed by the Yucatan did Jamaica and the Nicaragua Rise enter a period of tectonic quiescence, and become a Bahamas Bank-like carbonate platform (= Phase 3 of Draper). However, during Phase 2, immigration of the North America terrestrial biota would have been facilitated by the continuous landmass of North America–Mexican Arc–Chortis Block–Nicaragua Rise–Jamaica, as indicated by the trail of arrows in Figure 1. Hyrachyus sp. from the Seven Rivers site predates the Phase 3 inundation of Jamaica and is thus part of the Stage I terrestrial mammal fauna of the island, based on the evidence of both taxonomic assignment and geology. Except for the iguanian lizard and possible archontan, all other vertebrates thus far discovered from Seven Rivers are obligate aquatic or, at best, amphibious organisms, the latter group including ?C. kugleri and prorastomid sirenians. Hyrachyus is well known from the Eocene of Eurasia and North America (Radinsky, 1969). Such a large terrestrial mammal (the size of a large dog) is unlikely to have been dispersed across broad water barriers, so its presence in Jamaica must be recognized as strong supporting evidence for an ancient landbridge connection with North America (Figure 1). Although MacPhee and Wyss (1990:3) correctly considered that the “land-bridge argument … suffers from an acute lack of supporting geological fact” for explaining the evolution of the Stage II fauna, it must now be considered a plausible explanation for at least part of the Stage I fauna, that of Jamaica.

ACKNOWLEDGMENTS Fieldwork in Jamaica was supported by National Geographic Society grants nos. 5116-93, 5327-94, and 5562-95. The additional financial support provided by Barbara and Reed Toomey is gratefully acknowledged. We thank the many collaborators who made vital contributions to the Seven Rivers excavation, including Hal Dixon, Trina MacGillivray, Simon Mitchell (all University of the West Indies, Mona), Kevin Schindler, Barbara and Reed Toomey, Kaffie Commins, Douglas Jones, Craig Oyen, and Debra Krumm (all Florida Museum of Natural History, Gainesville). Steve and Suzan Hutchens skillfully prepared many of the sea cow, turtle, and crocodile bones. Fred Grady helped to prepare the Hyrachyus mandible, which was photographed by P. Kroehler. Trevor A. Jackson (University of the West Indies, Mona) and Gary S. Morgan (New Mexico Museum of Natural History, Albuquerque) are thanked for critically reading parts of an early draft of this chapter. S. K. D. thanks Angela Milner and Jerry Hooker (both of The Natural History Museum, London) for invaluable service tracing key references. This is University of Florida Contribution to Paleobiology 507 and a contribution to Natural History Museum project #298, “Palaeoecology and Climatic History of Cainozoic Land Biota.”

LITERATURE CITED Berg, D. M. 1969. Charactosuchus kugleri, eine neue Krokodilart aus dem Eozän von Jamaica. Eclogae Geologicae Helvetiae 62:731–735. Caldwell, D. K. 1965 (1966). A Miocene needlefish from Bowden, Jamaica. Florida Academy of Sciences Quarterly Journal 28(4):339–344.

Early Tertiary Vertebrate Fossils and Their Biogeographical Implications

199

Clarke, M. and J. E. Fitch. 1979. Statoliths of Cenozoic teuthoid cephalopods from North America. Palaeontology 22:479–511. Collins, J. S. H. and R. W. Portell 1998. Decapod, stomatopod and cirripede crustacea from the Pliocene Bowden Shell Bed, St. Thomas Parish, Jamaica. Pp. 113–127 in Donovan, S. K. (ed.). The Pliocene Bowden Shell Bed, Southeast Jamaica. Contributions to Tertiary and Quaternary Geology 35(1–4). Dixon, D., B. Cox, R. J. G. Savage, and B. Gardiner. 1988. Macmillan Illustrated Encyclopedia of Dinosaurs and Prehistoric Animals. MacMillan, London. Domning, D. P. 1999. Oligocene sirenians of the Caribbean region. Appendix 1, p. 29 in Dixon, H. L. and S. K. Donovan. Report of a field meeting to the area around BrownsTown, parish of St. Ann, northcentral Jamaica, 21 February, 1998. Journal of the Geological Society of Jamaica 33:24–30. Domning, D. P. and J. M. Clark. 1993. Jamaican Tertiary marine Vertebrata. Pp. 413–415 in Wright, R. M. and E. Robinson (eds.). Biostratigraphy of Jamaica. Geological Society of America, Memoir 182, Boulder, Colorado. Domning, D. P., S. K. Donovan, H. L. Dixon, R. W. Portell, and K. S. Schindler 1995. The world’s most primitive seacow: a new sirenian site in western Jamaica. Geological Society of America, Abstracts with Programs 27(6):A386. Domning, D. P., R. J. Emry, R. W. Portell, S. K. Donovan, and K. S. Schindler 1997. Oldest West Indian land mammal: rhinocerotoid ungulate from the Eocene of Jamaica. Journal of Vertebrate Paleontology 17:638–641. Donnelly, T. W. 1988. Geologic constraints on Caribbean biogeography. Pp. 15–37 in Liebherr, J. K. (ed.). Zoogeography of Caribbean Insects. Comstock Publishing, Cornell University Press, Ithaca, New York. Donnelly, T. W. 1994. The Caribbean sea floor. Pp. 41–61 in Donovan, S. K. and T. A. Jackson (eds.). Caribbean Geology: An Introduction. University of the West Indies Publishers’ Association, Kingston, Jamaica. Donovan, S. K., D. P. Domning, F. A. Garcia, and H. L. Dixon. 1990. A bone bed in the Eocene of Jamaica. Journal of Paleontology 64:660–662. Draper, G. 1987. A revised tectonic model for the evolution of Jamaica. Pp. 151–169 in Ahmad, R. (ed.). Proceedings of a Workshop on the Status of Jamaican Geology. Journal of the Geological Society of Jamaica, Special Issue 10. Draper, G. 1998. Geological and tectonic evolution of Jamaica. Contributions to Geology, UWI, Mona 3:3–9. Eva, A. and N. McFarlane. 1985. Tertiary to early Quaternary carbonate facies relationships in Jamaica. Transactions of the 4th Latin American Geological Congress, Port-of-Spain, Trinidad, 7th–15th July, 1979, 1:210–219. Fitch, J. E. 1969. Fossil lanternfish otoliths of California, with notes on fossil Myctophidae of North America. Los Angeles County Museum, Contributions in Science 173:1–20. Fitch, J. E. and L. W. Barker. 1972. The fish Family Moridae in the eastern North Pacific with notes on morid otoliths, caudal skeletons, and the fossil record. Fishery Bulletin 70(3):565–584. Goodwin, M. B., D. P. Domning, J. H. Lipps, and C. Benjamini. 1998. The first record of an Eocene (Lutetian) marine mammal from Israel. Journal of Vertebrate Paleontology 18(4):813–815. LeSueur, C. A. 1821. Observations on several genera and species of fish, belonging to the natural family of the Esoces. Journal of the Academy of Natural Sciences of Philadelphia 2(1):124–138. MacPhee, R. D. E. and D. A. Grimaldi. 1996. Mammal bones in Dominican amber. Nature 380:489–490. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1994. First Tertiary land mammal from Greater Antilles: an early Miocene sloth (Xenarthra, Megalonychidae) from Cuba. American Museum Novitates 3094:1–13. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1995a. Earliest monkey from Greater Antilles. Journal of Human Evolution 28:197–200. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1995b. Origin of Greater Antillean land mammal fauna, 1: New Tertiary fossils from Cuba and Puerto Rico. American Museum Novitates 3141:1–30. MacPhee, R. D. E. and A. R. Wyss. 1990. Oligo-Miocene vertebrates from Puerto Rico, with a catalog of localities. American Museum Novitates 2965:1–45. MacPhee, R. D. E., C. Flemming, D. P. Domning, R. W. Portell, and B. Beatty. 1999. Eocene ?primate petrosal from Jamaica: morphology and biogeographical implications. Fifty-ninth Annual Meeting of Society of Vertebrate Paleontology — Abstracts of Papers. Journal of Vertebrate Paleontology 19(3):61A. Marsh, O. C. 1871. Notice of some fossil mammals from the Tertiary formation. American Journal of Science and Arts (3)11, 8:36–37.

200

Biogeography of the West Indies: Patterns and Perspectives

Montgomery, H., E. A. Pessagno, Jr., and J. L. Pindell. 1994. A 195 Ma terrane in a 165 Ma sea: Pacific origin of the Caribbean Plate. GSA Today 4(1):1, 3–6. Morris, A. E. L., I. Taner, H. A. Meyerhoff, and A. A. Meyerhoff. 1990. Tectonic evolution of the Caribbean region; alternative hypothesis. Pp. 433–457 in Dengo, G. and J. E. Case (eds.). The Geology of North America, Vol. H, The Caribbean Region. Geological Society of America, Boulder, Colorado. Owen, R. 1850. Monograph of the fossil Reptilia of the London Clay, and of the Bracklesham and other Tertiary beds. Part 2. Crocodilia (Crocodilius, etc.) Monograph of the Palaeontographical Society, London 5–50. Owen, R. 1855. On the fossil skull of a mammal (Prorastomus sirenoides, Owen), from the island of Jamaica. Quarterly Journal of the Geological Society 11:541–543. Perfit, M. R. and E. E. Williams. 1989. Geological constraints and biological retrodictions in the evolution of the Caribbean Sea and its islands. Pp. 47–102 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Pindell, J. L. 1990. Geological arguments suggesting a Pacific origin for the Caribbean Plate. Pp. 1–4 in Larue, D. K. and G. Draper (eds.). Transactions of the 12th Caribbean Geological Conference, St. Croix, Virgin Islands, 7th–11th August, 1989. Miami Geological Society, Miami, Florida. Pindell, J. L. 1994. Evolution of the Gulf of Mexico and the Caribbean. Pp. 13–39 in Donovan, S. K. and T. A. Jackson (eds.). Caribbean Geology: An Introduction. University of the West Indies Publishers’ Association, Kingston. Pindell, J. L and S. F. Barrett. 1990. Geological evolution of the Caribbean region; a plate-tectonic perspective. Pp. 405–432 in Dengo, G. and J. E. Case (eds.). The Geology of North America, Vol. H, The Caribbean Region. Geological Society of America, Boulder, Colorado. Pregill, G. K. 1999. Eocene lizard from Jamaica. Herpetologica 55(2):157–161. Radinsky, L. B. 1969. The early evolution of the Perissodactyla. Evolution 23:308–328. Robinson, E. 1988a. Late Cretaceous and early Tertiary sedimentary rocks of the Central Inlier, Jamaica. Journal of the Geological Society of Jamaica 24 (for 1987):49–67. Robinson, E. 1988b. Early Tertiary larger foraminifera and platform carbonates of the northern Caribbean. Pp. 5:1–5:12 in Barker, L. (ed.). Transactions of the 11th Caribbean Geological Conference, Dover Beach, Barbados, July 20–26, 1986. Energy and Natural Resources Division, National Petroleum Corporation, Barbados. Robinson, E. 1994. Jamaica. Pp. 111–127 in Donovan, S. K. and T. A. Jackson (eds.). Caribbean Geology: An Introduction. University of the West Indies Publishers’ Association, Kingston. Savage, R. J. G., D. P. Domning, and J. G. M. Thewissen. 1994. Fossil Sirenia of the West Atlantic and Caribbean region. V. The most primitive known sirenian, Prorastomus sirenoides Owen, 1855. Journal of Vertebrate Paleontology 14:427–449. Stringer, G. L. 1998. Otolith-based fishes from the Bowden Shell Bed (Pliocene) of Jamaica: systematics and palaeoecology. Pp. 147–160 in Donovan, S. K. (ed.). The Pliocene Bowden Shell Bed, Southeast Jamaica. Contributions to Tertiary and Quaternary Geology 35(1–4). Thewissen, J. G. M., S. T. Hussain, and M. Arif. 1994. Fossil evidence for the origin of aquatic locomotion in archaeocete whales. Science 263:210–212. Williams, E. E. 1989. Old problems and new opportunities in West Indian biogeography. Pp. 1–46 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida.

Sloths of the West Indies: 14 The A Systematic and Phylogenetic Review Jennifer L. White and Ross D. E. MacPhee Abstract — Megalonychid sloths are well known from the Quaternary of many West Indian islands, and some isolated remains date back as far as the early Oligocene. Phylogenetic relationships among these sloths have been unclear and controversial for numerous reasons, thus hindering biogeographical interpretations. As part of a complete systematic revision of West Indian megalonychids, we performed a cladistic analysis on 17 ingroup taxa using 69 osteological and dental characters. The analysis discovered three most-parsimonious trees that differ only in the placement of one incompletely known taxon. Two well-supported clades are identified, one of which includes the extant two-toed sloth Choloepus. Each major clade contains two or more genera, and within each genus, sister species are distributed across islands. Our results allow us to address two major biogeographical issues: the colonization of the Greater Antilles by megalonychid sloths, and the inter-island relationships of these sloths. An initial emplacement in the early Oligocene is consistent with overland dispersal across a short-lived land span connecting the developing Greater Antilles with northwestern South America. Our data suggest at least two separate invasions, and therefore a diphyletic origin of Antillean megalonychids. Inter-island distributions are explained most parsimoniously by island–island vicariance sometime before the end of the Miocene.

INTRODUCTION Until the middle Holocene or perhaps somewhat later, megalonychid sloths formed a significant component of the land mammal fauna of the insular Neotropics. All of these “Antillean sloths” are now extinct (MacPhee, 1997a; MacPhee et al., 1999). Fortunately for science, their remains — often in some abundance — have been found in Cuba, Puerto Rico, Hispaniola, La Gonâve, Ile de la Tortue, Curaçao, and, most recently, Grenada (MacPhee et al., 2000a). Many smaller islands in the Caribbean region have not been adequately surveyed (e.g., Vieques and other islands on the Puerto Rican shelf; Venezuelan Antillas Menores), and the possibility that these sloths had an even wider distribution within the West Indies needs to be seriously considered. Although there is no doubt that Antillean sloths are proximally related to the extant two-toed sloth (Choloepus) and the famous Neogene megalonychids of Argentina (Kraglievich, 1923; Scillato-Yané, 1979; Pascual et al., 1985), the history of this family in northern South America during the latter part of the Cenozoic is exceedingly obscure (Iturralde-Vinent and MacPhee, 1999). Paleontologically speaking, we know the climax and denouement of the story of sloth evolution in the West Indies, but of the early chapters, beginning with the first arrival of phyllophagans on the islands at least 32 million years ago (mya), we know next to nothing. That we are so well informed about the terminal phases of sloth evolution on these islands is largely due to the excellence of conditions for Quaternary fossil preservation in the caves that are one of the main features of Antillean karst landscapes. The trouble is, of course, that caves are evanescent structures, particularly in the tropics. Although it is possible that older karst regions on some islands may eventually yield demonstrably older faunas, we are not aware of any suitable candidates (MacPhee, 1997b). Apart from cave contexts, terrestrially derived basinal sediments in which land mammal fossils might be found are extremely rare in the West Indies. Nevertheless, things have improved in the last decade or so, with the discovery of pre-Pleistocene deposits on several islands that have yielded evidence 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

201

202

Biogeography of the West Indies: Patterns and Perspectives

of earlier faunas — regrettably not yet enough to fill many blank pages in the story, but enough to know that the plot will be interesting (e.g., MacPhee and Wyss, 1990; MacPhee and IturraldeVinent, 1994, 1995; MacPhee and Grimaldi, 1996; Domning et al., 1997; Iturralde-Vinent and MacPhee, 1999; MacPhee et al., 2000a, 2000b). It is widely accepted that all phyllophagans that have been identified in the West Indies are members of family Megalonychidae, but their phylogenetic relationships inter se have long been controversial. For example, there is much disagreement among specialists concerning the number and composition of subfamilies, tribes, genera, and species. For many taxa, hypodigms (i.e., the totality of specimens assigned to a particular species) are severely muddled as a result of numerous reassignments of material and confusing name changes. A relatively large number of species have been named on the basis of isolated cranial fragments or single limb elements, leading, in our opinion, to an unnecessary proliferation of nomina and noncomparable type specimens. Few associated skeletons have been found (or at least reported as such), and because of the number of named taxa in play it has proven difficult to connect crania with postcrania in many cases. An additional problem is that, for island megafaunal species in general, the influence of intraspecific variation in shape and size (particularly in postcrania) has been greatly underappreciated (cf. White, 1993a, 1993b; McFarlane et al., 1998). Prior to the senior author’s cladistic investigation of Antillean phyllophagans (White 1993a, 1993b; White et al., 1996), little attention had been given to the phylogenetic relationships of sloth species living on different West Indian islands. Indeed, one could examine the existing plethora of names and come to the conclusion that each island must have been separately colonized by its own sloth propagules coming directly from South America, as scarcely any islands shared the same genus-level taxa. Although the biogeographical improbability of this was obvious to some (e.g., Varona, 1974), the fact remains that the complex systematic history of Antillean sloths has never been adequately surveyed. In this chapter we attempt to resolve some of the major issues that need to be confronted in revising Antillean megalonychids, recognizing that some solutions will not be forthcoming until more basic revisory work has been completed.

BRIEF OVERVIEW OF MEGALONYCHID DISCOVERIES IN THE WEST INDIES The first discovery of an Antillean sloth to receive public notice occurred in 1861, when a partial mandible was recovered from the Chapepote casimba (i.e., hot spring) at Ciego Montero in Sierra de Jatibonico, near Cienfuegos in south-central Cuba (Figure 1). Although some observers thought the jaw might represent a hippo or a giant rodent, Joseph Leidy (1868) recognized that it was incontestably that of a sloth related to Megalonyx, which he named Megalocnus rodens. Despite this promising find, the pace of discovery of Antillean sloths was slow until the early decades of the 20th century, when, in rapid succession, a host of new finds were made in Cuba, Puerto Rico, and Hispaniola. The first intimation that a variety of megalonychid sloths had once existed in the Greater Antilles came with the publication of a paper on the sloths of Cuba by Carlos de la Torre and William D. Matthew (1915), who briefly discussed collections that had just been made (in 1911) by de la Torre and Barnum Brown at the same series of hot springs at Ciego Montero that had yielded the type jaw of M. rodens. In addition to the latter species, these authors recognized three new kinds of sloths in this material, provisionally giving them the genus-level names Microcnus, Mesocnus, and Miocnus. (To the unending frustration of later students of Antillean sloths, these names technically remained nomina nuda until 1931, when Matthew in a posthumous paper formally named and described type species for each.) Matthew (1919) emphasized that all of these taxa were closely related to the Miocene megalonychids of South America, confirming Leidy’s original insight. The next discovery of importance was by Harold E. Anthony (1916), who described the distinctive Puerto Rican species Acratocnus odontrigonus on the basis of a large quantity of material

The Sloths of the West Indies: A Systematic and Phylogenetic Review

North and Central American megalonychids

ISLA DE PINOS

Megalocnus rodens Neocnus major Neocnus gliriformis Parocnus browni Acratocnus antillensis Imagocnus zazae Species B Species C ILE DE LA TORTUE CUBA

203

Megalocnus zile Acratocnus ye Parocnus serus Neocnus comes Neocnus dousman Neocnus toupiti PUERTO RICO

GONAVE

H I S PA NIOLA Acratocnus odontrigonus Species A

Paulocnus petrifactus

Species D GRENADA CURAÇAO

500 KILOMETERS

South American megalonychids

FIGURE 1 Sketch map of the Caribbean region, showing general distribution of megalonychids on the mainland and in the West Indies (cf. Table 2). Megalonychids arose in South America, presumably in the early Paleogene. Their pre-Miocene history is poorly known, but there is evidence that by the early Oligocene they had penetrated the Antilles (species A, Puerto Rico). The oldest Cuban evidence (Imagocnus zazae) is early Miocene. By 9 mya, and perhaps well before, megalonychids were present in Central and North America, but these species were different from the ones that had penetrated the West Indies. As time went on, significant radiations of megalonychids occurred in Cuba and Hispaniola, leading to a multiplicity of species on those islands by the end of the Pleistocene. Single species are also known from the Quaternary of Puerto Rico and Curaçao, and from the late Pliocene or early Pleistocene of Grenada (species D). All mainland megalonychids (except Choloepus) are thought to have become extinct by the end of the Pleistocene; Antillean taxa held on until the middle-late Holocene (at least on some islands), but all were gone well before European arrival. For more detailed coverage of Antillean sloth localities: Cuba and satellites (Matthew and Paula Couto, 1959; MacPhee and Iturralde-Vinent, 1994); Hispaniola and satellites (Miller, 1929; MacPhee et al., 2000b); Puerto Rico (Anthony, 1918); Curaçao (Hooijer, 1964); Grenada (MacPhee et al., 2000a).

recovered from cave sites on that island. Although it was obvious that Acratocnus was a near relative of Megalocnus (and the other, then incompletely named, species identified by Matthew), it was also obvious that it was rather different. Anthony’s discovery raised the possibility that a major radiation of sloths, heretofore completely unsuspected, had occurred in the Greater Antilles.* * It should be noted that Anthony (1920, 1940) thought that there should have been sloths on Jamaica as well, and in 1919–1920 he conducted the first paleontological reconnaissance of that island in order to find out. Contrary to his expectations, he found no sloths — and neither has anyone else, leaving Jamaica as the only Greater Antillean landmass to lack phyllophagans (for discussion, see Iturralde-Vinent and MacPhee, 1999).

204

Biogeography of the West Indies: Patterns and Perspectives

This possibility was confirmed shortly thereafter by Gerrit S. Miller (1922, 1929) and his collectors, who discovered remains of medium-sized and large sloths in numerous cave sites in Haiti and the Dominican Republic. At first Miller (1922) assigned these remains to Megalocnus, albeit with a question mark. Later, realizing that two quite different species were represented in the Hispaniolan sample and that neither conformed to Megalocnus as known from Cuba, he proposed the new taxa Parocnus serus and Acratocnus comes for their reception (Miller, 1929). Although these discoveries were highly significant, very few collecting expeditions were mounted in Hispaniola after Miller’s time, and even fewer resulted in publications (e.g., Hoffstetter, 1955; Hooijer and Ray, 1964). In the late 1950s, Carlos de Paula Couto undertook an extensive study of all Cuban sloth material then housed in the AMNH and several other museums. As part of this effort he completed a manuscript, published subsequently as Matthew and Paula Couto (1959), which Matthew begun decades earlier but never finished in his lifetime. This comprehensive review recognized four genera of Cuban sloths: Megalocnus, Mesocnus, Microcnus, and Acratocnus (into which last taxon he placed all fossils previously assigned to Matthew’s Miocnus). Shortly thereafter, Oscar Arredondo proposed the erection of two new Cuban genera, Neomesocnus and Neocnus, including within the latter the new species N. major and N. minor (Arredondo, 1961). At that time Arredondo considered Microcnus to be a good genus, distinct from Neocnus. In the following year, Dirk A. Hooijer named a new genus and species, Paulocnus petrifactus, based on a partial skull and some limb bones from Curaçao (Hooijer, 1962, 1964, 1967). In 1967 Paula Couto published a review of all West Indian sloth taxa. While this comprehensive investigation built upon earlier work, it presented several new taxonomic interpretations. First, whereas Matthew and Paula Couto (1959) placed all Miocnus material in the genus Acratocnus, in his later paper Paula Couto (1967) reestablished the validity of Miocnus as a separate genus. Second, he suggested that Neomesocnus might be a synonym of Megalocnus, and that both species of Neocnus were synonyms of Microcnus gliriformis. Third, he erected the new genus Synocnus to receive the Hispaniolan material previously relegated to Acratocnus comes by Miller (1929). Without making reference to Paula Couto’s proposed synonymy of Microcnus and Neocnus, in the following year Milos Kretzoi (1968) proposed Cubanocnus as a replacement name for Microcnus s.s. (which Kretzoi had shown to be preoccupied by Microcnus, proposed as a subgenus of Botaurus [Aves] in 1877). Nevertheless, a few years later, Karl-Heinz Fischer (1971) employed the name Microcnus in his detailed morphological description of newly recovered sloth fossils from Cuba. At first, Luis S. Varona (1974) recognized Cubanocnus as the valid name for material that had been assigned previously to Microcnus and Neocnus, but shortly thereafter he abandoned this position and placed the combined hypodigms of these taxa under a single species name, N. gliriformis (Varona, 1976). In other respects Varona’s (1974) taxonomy of Cuban sloths essentially agreed with that of Paula Couto’s (1967), except that he recognized only one valid species of Cuban Megalocnus. In 1978, Néstor A. Mayo (1978a) named a new genus and two new species of sloths based on three femora collected from two localities in Cuba: Habanocnus paulacoutoi and H. hoffstetteri. Reversing Paula Couto (1967), Mayo (1978b, 1980b) rehabilitated N. major and N. minor and proposed yet another species for inclusion in this genus (N. baireiensis; Mayo, 1980a). Because of the large number of named forms from Cuba, it might be assumed that this island had a much greater diversity of Antillean sloths than did the other islands. New discoveries and new synonymies (see below) indicate that neighboring Hispaniola was also a center of sloth diversity in the Quaternary (cf. Woods, 1990). In the late 1970s and early 1980s, Charles A. Woods and collaborators from the Florida Museum of Natural History undertook several collecting trips to Haiti for the purpose of recovering Quaternary mammals. Their efforts were rewarded with the discovery of several rich sink-hole sites that yielded, in addition to other important finds (e.g., Woods, 1989), numerous remains of sloths (including several associated skeletons). This material was sorted preliminarily by Margaret A. Langworthy, but for various reasons no analyses were completed or published. As a preliminary to this chapter and various other studies now in progress,

The Sloths of the West Indies: A Systematic and Phylogenetic Review

205

the new taxa represented in the Haitian material have been named and briefly described by MacPhee et al. (2000b). Detailed description of this material, however, is reserved for a future publication. In the 1990s, R. D. E. MacPhee and Manuel A. Iturralde-Vinent (1994, 1995, in press) recovered sloth remains from Tertiary localities in Cuba and Puerto Rico. The Cuban material, all of which comes from the Early Miocene locality of Domo de Zaza, has been referred to Imagocnus zazae, a species that is in some (possibly size-related) ways strongly reminiscent of Pleistocene Megalocnus and Parocnus (= Mesocnus). The Puerto Rican find, consisting of a single proximal femur from a locality near Yauco, is not diagnostic as to family affiliation. However, parsimony considerations suggest that it is probably a megalonychid, inasmuch as no other phyllophagan family had Antillean representation as far as is now known. The Yauco locality has yielded invertebrates consistent with an early Oligocene age (MacPhee and Iturralde-Vinent, 1995; Iturralde-Vinent and MacPhee, 1999). Discoveries of apparently new sloths in western Cuba (O. Arredondo and O. Vasquez Jimenez, personal communication) have been briefly announced but not yet reported in the literature. The newest Antillean territory in which sloth fossils have been discovered is Grenada. The fossils, consisting of isolated phyllophagan teeth from the Locality 12° North, a Plio-Pleistocene lahar deposit on the southern end of the island, are described in a paper by R. D. E. MacPhee and collaborators (2000a). Although the limited material compares reasonably well in size with Paulocnus petrifactus from Curaçao, distinctive features are few and the teeth are currently allocated only to Megalonychidae, gen. et sp. indet. The importance of the Grenadian faunule (which also includes a new capybara) is that it underlines the incredibly wide distribution of Megalonychidae in the insular Neotropics during the latter part of the Cenozoic.

HIGHER-LEVEL RELATIONSHIPS In the last 15 years a number of differing taxonomic arrangements of megalonychids within Phyllophaga have been proposed, but there is no clear consensus in sight (e.g., Engelmann, 1985; Mones, 1986; Arredondo, 1988; Pascual et al., 1990; White, 1993a, 1993b; Gaudin, 1995; McKenna and Bell, 1997). Inasmuch as a serious revision of the higher-level phylogeny of megalonychids implies a revision of all of Phyllophaga, in this section we can only touch on leading issues and interpretations. Among phyllophagan specialists there is no disagreement that Antillean sloths are indisputably members of Megalonychidae, exhibiting such defining features (where known) as dental formula 5/4; premaxilla, if present (Hapalops), does not bear teeth; molars quadrangular or elliptical; diastema long; first maxillary tooth usually caniniform; mandibular symphyseal region usually elongated; limbs relatively gracile and pentadactyl; calcaneal tuberosity mediolaterally expanded; and femoral third trochanter present (Paula Couto, 1979; De Muizon and McDonald, 1995). However, disagreement is otherwise rife concerning family content and interrelationships. Formerly, the subfamily Choloepodinae (nec Choloepinae), originally proposed as a tribe by Gray (1871) for reception of the extant two-toed sloth Choloepus, was often placed in Bradypodidae. However, current taxonomic practice restricts Bradypodidae to Bradypus and places Choloepodinae (or taxon of similar rank) in Megalonychidae (Scillato-Yané, 1980; Webb, 1985; Webb and Perrigo, 1985; Wetzel, 1985; White, 1993b; Gaudin, 1995; McKenna and Bell, 1997; but see Engelmann, 1985). In addition to Choloepodinae, six other nominal subfamilies of Megalonychidae are in varying degrees of systematic usage at present: Ortotheriinae, Megalocninae, Xenocninae, Nothrotheriinae, Megalonychinae, and Ocnopodinae (Mones, 1986). The Antillean diversity has consistently been placed in two subfamilies (usually, Ortotheriinae and Megalocninae or variants thereof), suggesting a diphyletic origin for West Indian sloths. However, the content and internal organization of all megalonychid groupings vary significantly from author to author. At one extreme, Engelmann (1985:60) restricts Megalonychidae to the Antillean taxa and several genera known from North America (e.g., Megalonyx), but includes no strictly South American

206

Biogeography of the West Indies: Patterns and Perspectives

forms on the ground that they “do not exhibit those features that unite the North American megalonychids.” Carried to its logical conclusion, this position would require that all Antillean sloths derive from a proximate North American ancestry, which is at odds with the emerging paleogeographical picture as well as the reconstructed faunal history of virtually all other Antillean land mammals (cf. Iturralde-Vinent and MacPhee, 1999). At the other extreme, various authors (e.g., Kraglievich, 1923; Patterson and Pascual, 1968; Scillato-Yané, 1977, 1979; Pascual et al., 1990) have claimed that, not only are Antillean sloths South American by origin, but that the cladogeny of specific terminal branches can actually be traced back to specific Miocene taxa from the southern end of the continent (e.g., Late Miocene Amphiocnus seneum, favorably viewed as a close ancestor or sister-taxon of Megalocnus by Kraglievich, 1923, and more recently by Pascual et al., 1990). If carried to its logical conclusion, this interpretation implies that the lower-level clades known from the Antillean Quaternary must have already differentiated in South America before their propagules reached the West Indies. On its face this scenario, requiring several separate invasions of phyllophagans, is less parsimonious than one requiring only one initiator (cf. Iturralde-Vinent and MacPhee, 1999). However, actual testing of these hypotheses using real character evidence (White, 1993a, 1993b) indicates that more than one colonization apparently occurred (see Cladistic Analysis: Results). Simpson (1945) grudgingly adopted Kraglievich’s (1923) subfamilial allocation of Acratocnus and Parocnus to Ortotheriinae, and Megalocnus and Microcnus to Megalocninae, both of which contain South American genera. If interpreted cladistically, this classification would certify a diphyletic origin for Antillean sloths, a possibility that has recently been endorsed on quite different grounds (and in a different arrangement) by White (1993a, 1993b). Engelmann (1978, l985) and Webb (1985) have provided some information useful for phylogeny reconstruction, but their cladograms are not rich in characters. Webb’s (1985) cladogram shows the Greater Antillean genera as comprising a single group, but the node bearing the terminal taxa has no supporting characters. Paulocnus is included with a separate group of more derived South, Central, and North American taxa on the basis of two characters (deepened parabolic symphysis, caniniforms aligned with molariforms), but its position within this clade is not clarified. Engelmann (1985) considers Acratocnus to be the sister of the other Antillean genera on the ground that these latter possess a greater flexure of the basicranialbasifacial angle, and a “characteristic meniscoid cross-section of the lower caniniforms.” Both of these authors place Parocnus next to Megalocnus rather than Acratocnus.

CLADISTIC ANALYSIS DATA SET We developed a set of 75 characters to explore phylogenetic relationships among megalonychids (see Appendix I for characters and character states; Appendix II for taxon set). We used our own observations as well as characters from the literature; all characters derived from the literature were thoroughly checked against real specimens. Gaudin (1995) recently collected data on 85 basicranial characters of Phyllophaga. However, we were able to use only nine of these characters (eight of which provided informative results). Gaudin’s other characters were not included, either because they applied to taxa we did not study, or because we lacked appropriate material, or because Gaudin’s definitions of the morphological underpinnings (and therefore the homology) of certain characters differed from ours. Six characters were uninformative because they were constant in the ingroups surveyed; these were excluded from analysis. Interpretation and evaluation of the cladistic results are based on the remaining 69 parsimony-informative characters. We tried to confine ourselves to those continuous characters that displayed gaps in their distributions among taxa. However, as is common in fossil investigations, we often had to work with small sample sizes or fragmentary material. Therefore, it is possible that some of the gap boundaries that we have specified will have to be revised after

The Sloths of the West Indies: A Systematic and Phylogenetic Review

207

A

Bradypus tridactylus Choloepus didactylus Acratocnus odontrigonus Acratocnus antillensis Acratocnus ye Paulocnus petrifactus† Neocnus gliriformis Neocnus toupiti Neocnus dousman Neocnus comes Neocnus major Hapalops longiceps Paramylodon harlani Megalocnus rodens Megalocnus zile Parocnus browni Parocnus serus Dasypus novemcinctus Tamandua tetradactyla

B

Bradypus tridactylus Choloepus didactylus Acratocnus odontrigonus Acratocnus antillensis Acratocnus ye Paulocnus petrifactus† Neocnus gliriformis Neocnus toupiti Neocnus dousman Neocnus comes Neocnus major Hapalops longiceps Paramylodon harlani Megalocnus rodens Megalocnus zile Parocnus browni Parocnus serus Dasypus novemcinctus Tamandua tetradactyla

C

Bradypus tridactylus Choloepus didactylus Acratocnus odontrigonus Acratocnus antillensis Acratocnus ye Neocnus gliriformis Neocnus toupiti Neocnus dousman Neocnus comes Neocnus major Paulocnus petrifactus† Hapalops longiceps Paramylodon harlani Megalocnus rodens Megalocnus zile Parocnus browni Parocnus serus Dasypus novemcinctus Tamandua tetradactyla

D

Bradypus tridactylus Choloepus didactylus Acratocnus odontrigonus Acratocnus antillensis Acratocnus ye Neocnus gliriformis Neocnus toupiti Neocnus dousman Neocnus comes Neocnus major Hapalops longiceps Paramylodon harlani Megalocnus rodens Megalocnus zile Parocnus browni Parocnus serus Dasypus novemcinctus Tamandua tetradactyla

FIGURE 2 (A–C) The three most-parsimonious trees resulting from a branch-and-bound search on a data matrix of 69 characters and 19 taxa (length = 225, CI = 0.613, HI = 0.413, RI = 0.682, RC = 0.419); trees are identical except for position of Paulocnus petrifactus (taxon marked by †). (D) Single most-parsimonious tree resulting from a branch-and-bound search on same data matrix, but with Paulocnus omitted (length = 222, CI = 0.622, HI = 0.405, RI = 0.689, RC = 0.428). See text for discussion.

discovery of additional fossil material. All characters were weighted equally and were treated as unordered. Missing characters were scored as question marks and polymorphic characters were scored using the CS-&-CS convention. Phylogenetic analysis was performed using the program PAUP, version 4.0b2 (Swofford, 1998), by applying a branch-and-bound search. Tamandua and Dasypus were designated as outgroup taxa, and trees were rooted at a basal node with a basal polytomy.

RESULTS The branch-and-bound search yielded three most-parsimonious trees (MPTs) (Figures 2A–C) with tree lengths of 225 steps (CI = 0.613; HI = 0.413; RI = 0.682; RC = 0.419). Variation in the three MPTs was entirely due to the variable placement of Paulocnus, and a strict consensus tree is shown

208

Biogeography of the West Indies: Patterns and Perspectives

Bradypus tridactylus Choloepus didactylus

D

Acratocnus odontrigonus

B

Acratocnus antillensis

Paulocnus petrifactus

C

Neocnus gliriformis

A

Neocnus toupiti

Choloepodinae

Acratocnus ye

Neocnus dousman

E

Neocnus comes Neocnus major Hapalops longiceps Paramylodon harlani

Megalocnus zile

G Parocnus browni Parocnus serus

Megalocninae

Megalocnus rodens

F

Tamandua tetradactyla Dasypus novemcinctus FIGURE 3 Strict consensus of the three most-parsimonious trees depicted in Figure 2A–D. Lettered portions of the branching sequence are discussed in text. Terminal taxa included in boxes comprise all valid Antillean sloth species discussed in this chapter (plus Choloepus didactylus, one of two Recent species in this genus which together form the mainland sister-taxon of Acratocnus).

in Figure 3. When Paulocnus (which is missing 51 of the 69 informative characters) is removed, only one MPT (Figure 2D) emerges at 222 steps (CI = 0.622, HI = 0.405, RI = 0.689, RC = 0.428). In all MPTs, taxa resolve into two major groupings. One includes ((Megalocnus, Parocnus) Paramylodon). All remaining taxa fall into the second major clade, which includes ((Choloepus, Acratocnus) (Neocnus)), with Paulocnus being variably placed as sister group to (Choloepus, Acratocnus), Neocnus, or both. The sister group of this assemblage is Bradypus, followed by Hapalops. The data set obviously contains a substantial amount of homoplasy. Nevertheless, the support for many of the groupings is impressive. In the following discussion, important nodes (labeled in Figure 3) are presented along with the number of characters that define them. Monophyly of sloths is well supported and assumed here, so we do not discuss characters supporting the ingroup. Total numbers of characters defining nodes are presented for both ACCTRAN (A) and DELTRAN (D) optimization methods (Maddison and Maddison, 1992). We also note how many characters are unambiguously placed, and how many of those are unique. Identities of unambiguously placed characters and their state transformations are presented in Table 1.

The Sloths of the West Indies: A Systematic and Phylogenetic Review

209

TABLE 1 Character State Transformations of Unambiguously Placed Characters at Nodes Labeled in Figure 3 Node A Node B Node C a Node D Node E Node F Node G

21 (2→0) 25 (1→0) 3 (0→1) 18 (0→1) 6 (0→1) 2 (1→0) 5 (0→1)

31 (0→1) 29 (0→1) 4 (0→1) 40 (0→1) 7 (0→1) 27 (2→1) 8 (1→0)

36 (0→1) 33 (0→1) 6 (3→0) 69 (0→1) 9 (0→1) 44 (1→2) 13 (0→1)

53 (0→1) 38 (0→1) 9 (3→0)

56 (0→1) 40 (2→0) 12 (0→1)

74 (0→1) 47 (0→1) 17 (1→0)

26 (0→1) 51 (0→2) 16 (0→1)

53 (1→0) 57 (1→0) 17 (1→0)

18 (0→1)

70 (0→1)

72 (2→1)

75 (0→2)

Note: Identities of characters and character states are listed in Appendix I. Character states in boldface are unique states. a Characters 6, 9, 17: unambiguous when Paulocnus included; characters 3, 4, 12, 17, 70, 72, 75: unambiguous when Paulocnus excluded.

Node A — This node embraces what we consider to be the Choloepodinae, plus Bradypus and Hapalops. It is defined by 7(A)/6(D) characters (six unambiguous, two unique). Node B — This node includes the Choloepodinae, plus Bradypus. It is supported by 13(A)/6(D) characters (six unambiguous, two unique). Node C — This node includes Acratocnus, Choloepus, Neocnus, and Paulocnus, considered to form Choloepodinae in our classification. It is defined by 10(A)/11(D) characters (three unambiguous). If Paulocnus is excluded from the analysis, the number of unambiguous characters increases to seven (one unique). Node D — This node supports Acratocnini + Choloepus, and is supported by 6(A)/5(D) characters (three unambiguous, one unique). Node E — Cubanocnini is defined by 10(A)/9(D) characters (five unambiguous, one unique). Node F — This node combines the Megalocninae and Paramylodon, and is defined by 18(A)/8(D) characters (five unambiguous, one unique). Node G — Megalocninae is defined by 9(A)/13(D) characters (six unambiguous, one unique). Two aspects of our topology require special mention: the position of the extant three-toed sloth Bradypus, and the deep division within the Antillean megalonychid group. These results raise phylogenetic and biogeographical issues that will be discussed more extensively elsewhere, in conjunction with a detailed character analysis that is beyond the scope of this chapter. Originally, Bradypus was selected as an outgroup, but specifying it as such resulted in a nonmonophyletic ingroup in all of the most-parsimonious trees. In the 18 trees that are one step longer (length 226), Bradypus occupies the same position within the ingroup. This result was surprising, in light of the accumulating evidence that the tree sloths are diphyletic (Webb, 1985; Naples, 1987; White, 1993a, 1993b; Gaudin, 1995), and Gaudin’s (1995) suggestion that Bradypus is sister taxon to all other sloths. As a firmly embedded member of the ingroup, Bradypus associates closely with the choloepodines, which includes the extant Choloepus. Since many of the characters utilized in this investigation are postcranial — which is unusual for a study of sloth phylogeny — we may be sampling convergences related to locomotion. Indeed, the six unambiguous characters that support this node are all postcranial, and may be functionally related to arboreality. However, Bradypus is not the sister taxon to Choloepus (the only other fully suspensory taxon). Instead, Choloepus is more closely related to Acratocnus, Neocnus, and Paulocnus, none of which displays the extreme degree of suspensory adaptation seen in the two extant tree sloths. Plus, node C (our Choloepodinae) is supported by numerous unambiguous characters that are all cranial in nature and clearly unrelated

210

Biogeography of the West Indies: Patterns and Perspectives

to locomotor function. Therefore, we are confident in the unity of the Choloepodinae, whereas the position of Bradypus as a close relative to that clade may be driven by functional convergence to some extent. Similarly, the Megalocninae (node G) is well supported by largely cranial characters unrelated to locomotor function. In contrast, node F (uniting the mylodontid sloth Paramylodon with the Megalocninae) is largely supported by postcranial characters related to large size and terrestriality, and therefore seems to be driven partly by functional convergence. It is likely that the addition of more sloth taxa and more characters would help to resolve these issues. The wide separation between the two major Antillean subgroups Choloepodinae (node C) and Megalocninae (node G) is another result that warrants further study. Both of these clades are well supported by numerous strong characters, postcranial as well as cranial. However, in the present analysis each of them is associated with a different nonmegalonychid sister-group (Hapalops and Paramylodon, respectively). In McKenna and Bell’s (1997) classification, Hapalops is listed as a schismotheriine megatheriid and Paramylodon as a lestodontine mylodontid. No doubt these associations would be substantially modified if many more South American taxa were added to the matrix, but the basic point seems clear enough: a diphyletic origin of the Antillean sloths implies at least two separate invasions of the Antillean regions by phyllophagans. Previous cladistic analyses (White, 1993a, 1993b) have supported the same conclusion. Whether these findings will eventually require a restructuring of the classic family Megalonychidae remains to be seen; in any case, this is not a job that we can undertake here. Notwithstanding the complications presented by the placement of Bradypus and the division within the Megalonychidae, the distal branches are secure in their membership (nodes C, D, E, and G) and well supported. Variation in major branching patterns among trees that are one or two steps longer than the MPTs, or among trees with some taxa deleted, usually indicates that results are not very robust and are easily affected by the composition of the data set. However, in the present case the topology of more distal branches is very consistent across trees, suggesting that these have been characterized accurately. This gives us some confidence that the classification (Table 2) adopted here on the basis of these results is reasonably natural.

SYSTEMATICS As a basis for this presentation, we utilize McKenna and Bell’s classification for family-level (and higher) names. For a recent discussion of the higher-level affinities of Megalonychidae (which will not be discussed here), see Gaudin (1995). Below the family level, taxonomic organization and diagnoses mostly comply with our cladistic results (q.v.). In general, diagnoses for taxa at the same hierarchical level are differential, and should therefore be read in conjunction with one another. Magnorder XENARTHRA Cope, 1889 Order PILOSA Flower, 1883 Suborder PHYLLOPHAGA Owen, 1842 Superfamily MEGATHERIOIDEA Gray, 1821 Family MEGALONYCHIDAE Gervais, 1855 Since we have covered only a fraction of the taxa included in Megalonychidae by most workers, we will not take up the issue of defining this family or differentially diagnosing it from other sloth families (see Gaudin, 1995). However, it is important to repeat in this context that our cladistic results indicate that Antillean megalonychids are deeply cleaved into megalocnin and nonmegalocnin lineages — so deeply, in fact, that it seems that Antillean sloths had a diphyletic origin, arising from quite different progenitors. In the absence of an equivalently deep fossil record on the islands

The Sloths of the West Indies: A Systematic and Phylogenetic Review

211

TABLE 2 Classification of Antillean Megalonychid Slothsa,b Magnorder XENARTHRA Cope, 1889 Order PILOSA Flower, 1883 Suborder PHYLLOPHAGA Owen, 1842 Infraorder MEGATHERIA McKenna and Bell, 1997 Superfamily MEGATHERIOIDEA Gray, 1821c Family MEGALONYCHIDAE Gervais, 1855:44d [= “Famille des Mégalonycidés” Gervais, 1855:44] Megalonychidae incertae sedis Imagocnus MacPhee and Iturralde-Vinent, 1994:3e Imagocus zazae MacPhee and Iturralde-Vinent, 1994:3; Early Miocene; Cuba; Zaza sloth Gen. et sp. indet. Species Af; Early Oligocene; Puerto Rico Species B; Quaternary; Cuba Species C; Quaternary; Cuba Species Dg; ?Late Pliocene and/or Quaternary; Grenada Subfamily Choloepodinae Gray, 1871:430 [= Choloepina Gray, 1871:430; Choloepodinae Gill, 1874:24; nec Choloepidae (see Honacki et al., 1982); nec Choloepinae (see Gardner, 1993:63)h]; Quaternary; Central America, South America; Puerto Rico, Cuba, Hispaniola Tribe indet. Paulocnus Hooijer, 1962:47 Paulocnus petrifactus Hooijer, 1962:47; Quaternary; Curaçao; Curaçao sloth Tribe Choloepodini Gray, 1871:430 [= Choloepina Gray, 1871:430]; Quaternary; Central America, South America Choloepus Illiger, 1811:108; two-toed sloths, unaus Choloepus didactylus Linnaeus, 1758:35; Quaternary; South America Choloepus hoffmanni Peters, 1858:128; Quaternary; Central America, South America Tribe Acratocnini Varona, 1974:49; Quaternary; Puerto Rico, Cuba, Hispaniola Acratocnus Anthony, 1916:195; acratocnuses [= Miocnus Matthew, 1931:3; Habanocnus Mayo, 1978a:688] Acratocnus odontrigonus Anthony, 1916:195 [= Acratocnus major Anthony, 1918:412]; Quaternary; Puerto Rico; Puerto Rican acratocnus Acratocnus antillensis Matthew, 1931:4, new combination [= Miocnus antillensis Matthew, 1931:4 (introduced as nomen nudum by de la Torre and Matthew, 1915); Habanocnus hoffstetteri Mayo, 1978a:688; Habanocnus paulacoutoi Mayo, 1978a:689]; Quaternary; Cuba; Cuban acratocnus Acratocnus ye MacPhee, White, and Woods, 2000:11; Quaternary; Hispaniola; yesterday’s acratocnus Tribe Cubanocnini Varona, 1974:48 [= Neocnini Paula Couto, 1979:193]; Quaternary; Cuba, Hispaniola Neocnus Arredondo, 1961:29; neocnuses [= Cubanocnus Kretzoi, 1968:163] Neocnus gliriformis Matthew, 1931:4 [= Microcnus gliriformis Matthew, 1931:4; Cubanocnus gliriformis Kretzoi, 1968:163 (nec Microcnus Reichenow 1877, a subgenus of bird)]; Quaternary; Cuba; small Cuban neocnus Neocnus major Arredondo, 1961:32 [= Neocnus minor Arredondo, 1961:33; Neocnus baireiensis Mayo, 1980a:224]; Quaternary; Cuba; large Cuban neocnus Neocnus comes Miller, 1929:26, new synonymy [= “Acratocnus (?)” comes Miller, 1929:26; Synocnus comes Paula Couto, 1967:36]; Quaternary; Hispaniola; Miller’s Hispaniolan neocnus Neocnus dousman MacPhee, White, and Woods, 2000:13; Quaternary; Hispaniola; slow neocnus Neocnus toupiti MacPhee, White, and Woods, 2000:15; Quaternary; Hispaniola; least neocnus

212

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 (continued) Classification of Antillean Megalonychid Sloths Subfamily Megalocninae Kraglievich, 1923:54 [= Megalocni McKenna and Bell, 1997:101] Tribe Megalocnini Kraglievich, 1923:54; Quaternary; Cuba, Hispaniola Megalocnus Leidy, 1868:180; megalocnuses [= Myomorphus Pomel, 1868:665; Neomesocnus Arredondo, 1961:21] Megalocnus rodens Leidy, 1868:180 [= Myomorphus cubensis Pomel, 1868:665; Megalocnus rodens rodens Leidy, 1868:179; Megalocnus rodens casimbae Matthew, 1959 in Matthew and Paula Couto, 1959:27; Megalocnus ursulus Matthew, 1959 in Matthew and Paula Couto, 1959:30; Megalocnus junius Matthew, 1959 in Matthew and Paula Couto, 1959:30; Megalocnus intermedius Mayo, 1969:15; Neomesocnus brevirrostris Arredondo, 1961:21]; Quaternary; Cuba; Cuban megalocnus Megalocnus zile MacPhee, White, and Woods, 2000:7 [= Megalocuus? [lapsus calami] sp.? in parte, Miller, 1922:6]; Quaternary; Hispaniola; Hispaniolan megalocnus Tribe Mesocnini Varona, 1974:46; Quaternary; Cuba, Hispaniola Parocnus Miller, 1929:28, new synonymy; parocnuses [= “Megalocuus?” [lapsus calami], in parte Miller, 1922:6; Mesocnus Matthew, 1931:2] Parocnus serus Miller, 1929:29 [= “Megalocuus? [lapsus calami] sp?”, in parte Miller, 1922:6]; Quaternary; Hispaniola; Hispaniolan parocnus Parocnus browni Matthew, 1931:2 [= Mesocnus browni Matthew, 1931:2; Mesocnus torrei Matthew, 1931:2; Mesocnus herrerai Arredondo, 1977:2]; Quaternary; Cuba; Cuban parocnus a

For fuller synonymies for certain taxa, see McKenna and Bell (1997) and Gardner (1993). With the exception of the living two-toed sloth, Choloepus, sloth taxa lacking representation on islands in the Caribbean Basin are not included in this list. Bradypus, the three-toed sloth or ai, is relegated to its own (nominally megatherian) superfamily Bradypodoidea in most recent classifications. There are three extant species (Gardner, 1993): B. tridactylus (S. A. only), B. torquatus (S. A. only), and B. variegatus (also Central America). c See Gaudin (1995) and Greenwood et al. (2001) for provisional evidence that Megalonychidae is more closely related to mylodontan rather than megatherian sloths. d Although authorship of Megalonychidae is often attributed to Ameghino (1889) (cf. Gardner, 1993), Gervais’ (1855:44) “Famille des Mégalonychidés” precedes it by many decades and is available under ICZN art. 11f (iii) (see McKenna and Bell, 1997). e Monotypic/monogeneric taxon (distribution of species/genus is therefore as for genus/tribe). f See MacPhee and Iturralde-Vinent (1995). g See MacPhee et al. (2000a). h Choloepod-, not Choloep-, is the proper combining form for family-group names based on genus Choloepus. b

that might be used to test this notion, we are uncertain whether diphyly is the best explanation of our results. However, this is the conclusion to which the data we have gathered have led us. We hope to have additional insights into this problem resulting from the larger investigation we are at present undertaking. Subfamily Choloepodinae Gray, 1871:430 Diagnosis — Cranium domed; first maxillary and mandibular tooth triangular in cross section; glenoid posterior shelf present and glenoid shelf mediolaterally wide; symphyseal spout present; rostrum flared; diastema long; plane of mandibular condyles located just dorsal to toothrow; coronoid superior to condyle; femoral head spherical and extends rostral to greater trochanter; fovea for ligamentum teres centric if present (i.e., located in middle of articular surface on femoral head); third trochanter of femur a distinct lateral crest; lesser trochanter conspicuous; tibial and fibular shafts bowed; tarsus alternate; astragalar neck long; fibular facet of astragalus concave; calcaneal tuberosity mediovolarly expanded; inferior scapular angle acute; deltoid and pectoral crests of

The Sloths of the West Indies: A Systematic and Phylogenetic Review

213

humerus non-confluent; ulna gracile and anteriorly bowed. (Extracted from Anthony, 1916, and Paula Couto, 1967, 1979, with additional observations by authors.) Comment — Placing Acratocnus (tribe Acratocnini) with Neocnus (tribe Cubanocnini) in the same subfamily is similar to concepts developed by several other workers (e.g., Ameghino, 1889; Varona, 1974; Paula Couto, 1979; Mones, 1986), but differs substantially from McKenna and Bell’s (1997) tribal and subtribal divisions of Megalonychidae. The third tribe that we recognize, Choloepodini (containing Choloepus only), is not discussed here because it has been thoroughly examined in the neontological literature (e.g., Wetzel, 1985). Note — In our cladistic analysis, Bradypus is the sister-group of Acratocnini + Cubanocnini (+ Paulocnus). This association is supported by six unambiguously placed characters. Such a high degree of allegedly homoplastic similarity is indeed remarkable. Clearly, the last word on the relationship of three-toed sloths to the megalonychids has not been written. Tribe Acratocnini Varona, 1974:49 Diagnosis — As for type genus (Acratocnus). Comment — McKenna and Bell’s (1997) subtribe Acratocnina contains Synocnus (i.e., Neocnus, in parte) and is therefore paraphyletic. Acratocnus Anthony, 1916:195 Diagnosis — Pterygoid inflation absent; cranium relatively tall and domed with prominent postorbital constriction, sagittal crest, pronounced rostral mediolateral flare, and moderate airorrhynchy; glenoid ventral to superficies meatus; first maxillary tooth spike shaped, trigonal, anteriorly projecting, and curved (i.e., caniniform); last maxillary molariform convex and narrowest lingually; first mandibular caniniform straight, trigonal, and lacking posterointernal groove; last mandibular molariform convex lingually; symphyseal spout pointed and short; femoral shaft cylindrical; quadriceps femoris tubercle of tibia a long scar; prominent rectus femoris tubercle on pelvis; tibial surface of astragalus parallel sided, not divided, and posteriorly squared; fibular facet on astragalus deeply concave and funnel shaped; calcaneal tuberosity volarly expanded; humeral head globular; radius with ovoid head and long, well-developed, abrupt pronator quadratus flange; anterior border of scapula rounded. (Extracted and amended from Varona, 1974; Paula Couto, 1979). Type species = A. odontrigonus Anthony, 1916: 195. Distribution — Puerto Rico, Cuba, Hispaniola. Synonyms — Miocnus Matthew, 1931; Habanocnus Mayo, 1978a. Comment — The nomen Acratocnus has been widely used as a shelter for taxa that are, in fact, not intimately related phylogenetically (e.g., Miller, 1929; Arredondo, 1961). As reorganized here, Acratocnus strictly defined had a multi-island distribution that included Puerto Rico, Cuba, and Hispaniola — i.e., each of the three Greater Antillean islands known to have had sloths. Acratocnus odontrigonus Anthony, 1916:195 Holotype and type locality — Rostrum retaining caniniform tooth (AMNH 14170) collected at Cueva de la Ceiba, near Utuado, Puerto Rico. Diagnosis — As for genus, but differs from other Acratocnus species in exhibiting the following combination of features: pronounced airorrhynchy; femoral head foveate and proximally inclined; femoral shaft straight and cylindrical; significant gap in acetabular rim; fibula with posteriorly projecting proximal articulation; humerus with double bicipital groove; humeral trochlea flares distally; entepicondylar foramen not visible posteriorly. (Extracted from Anthony, 1916, and Paula Couto, 1967, with additional observations by authors.) Distribution — Mainland Puerto Rico only (i.e., not yet known from Vieques or other nearby islands on Puerto Rico shelf). Synonyms — A. major Anthony, 1918.

214

Biogeography of the West Indies: Patterns and Perspectives

Comment — Aeratocnus major is based on a partial skeleton including an incomplete cranium and mandible (AMNH 17169), also from Utuado area but from a different cave site. Hypodigm consists of the holotype only, no other specimens having been attributed to it. In comparing the skeletons of the two nominal species, Anthony (1926) stated repeatedly that bones of A. major were larger than those of A. odontrigonus but were not substantially different in structure. Current consensus is that A. odontrigonus is the only valid Puerto Rican sloth species from the Quaternary (Paula Couto, 1967, 1979; Varona, 1974), and that AMNH 17169 simply represents a large, aged member of that species. Acratocnus antillensis (Matthew, 1931:4), new combination Holotype and type locality — Edentulous mandible (AMNH 16680) from “the Casimba in the Sierra Jatibonico,” Cuba (Matthew, 1931:4; see also Brief Overview of Megalonychid Discoveries). Diagnosis — Agrees with A. odontrigonus for characters that define the genus, but differs from other Acratocnus species in exhibiting the following combination of features: femoral head very large and globular, proximally or anteriorly inclined; fovea for ligamentum teres absent or anteriorly located; femoral shaft with torsion; third trochanter thick and padlike; fibula with posteriorly projecting proximal articulation; distinct ridge separating cuboid and sustentacular facets of calcaneus; humeral trochlea mediolaterally flat with no distal flare; bridge over entepicondylar foramen with distinct knob; entepicondylar foramen present but not visible posteriorly. Distribution — Cuba. Synonyms — Miocnus antillensis Matthew, 1931 [introduced as nomen nudum by de la Torre and Matthew, 1915]; Habanocnus hoffstetteri Mayo, 1978a; H. paulacoutoi Mayo, 1978a. Comment — In describing the short, robust mandible of A. antillensis, with its abbreviated symphyseal spout and triangular caniniforms, Matthew (1919) drew attention to evident similarities to Puerto Rican Acratocnus, and even alluded to the possibility that they were closely related. Paula Couto advocated synonymizing Miocnus and Acratocnus (see Hoffstetter, 1955), but preserved a species-level distinction for the Cuban material (as A. antillensis; Matthew and Paula Couto, 1959:41). This was the first more-or-less explicit recognition of the fact that closely related species, nomenclaturally brigaded within the genus Acratocnus, had been present on each of the northern Greater Antilles (A. odontrigonus, including A. major, on Puerto Rico; A. antillensis on Cuba; and “A.” comes on Hispaniola). However, after completing a more detailed study of the type mandible and examining an unprepared skull attributed to Miocnus in the private collection of Oscar Arredondo, Paula Couto eventually decided to reestablish Miocnus as distinct from Acratocnus (Paula Couto, 1967). Since then the status of Miocnus as a separate genus has been widely accepted (e.g., Varona, 1974; Paula Couto, 1979; Woods, 1990). Identified material that actually belongs to A. antillensis is scarce in collections; worse, many specimens have been misidentified. To the confusion of later workers, Paula Couto (1967) in his figure 21 labeled the antillensis holotype as that of Synocnus comes, while his figure 22, said to show the mandible of M. antillensis, actually depicts a mandible of Parocnus serus. Also, three femora (AMNH 49944, 49945; MCZ 4442) that Matthew and Paula Couto (1959) included in the antillensis hypodigm should rightly be assigned to Neocnus (see below and discussion by Mayo [1978b]). To further complicate the issue, a femur (AMNH 49919) that should be assigned to A. antillensis has been repeatedly identified as anything but this taxon. Although Matthew and Paula Couto (1959, plate 35) listed it as representing Mesocnus (i.e., Parocnus). Paula Couto (1967) later stated that it probably belonged to Miocnus (i.e., Acratocnus). In a subsequent reevaluation, Mayo (1978a) stated that this femur might instead belong to Habanocnus (i.e., Acratocnus). AMNH 49919 is here assigned — one hopes definitively — to A. antillensis. Our synonymization of Habanocnus requires some defense, as this genus has been accepted by some workers (e.g., McKenna and Bell, 1997). Mayo (1978a) named a new genus and two new

The Sloths of the West Indies: A Systematic and Phylogenetic Review

215

species based on three femora collected from two localities in Cuba. Habanocnus hoffstetteri (type species) was based on a complete femur (IGPACC Nr. 421-119) from Cueva de Paredones, Prov. de La Habana, Cuba. The only other material attributed to this species is a proximal femur from the same locality (IGPACC 421-120). Habanocnus paulacoutoi was erected for a single femur (IGPACC Nr. 417-4) from Pio Domingo, Prov. de Pinar del Río, Cuba. No other newly collected material has been assigned to this species (although, as discussed above, Mayo [1978a] suggested that AMNH 49919 might represent H. paulacoutoi rather than Acratocnus [= Miocnus]). Although he provided a detailed account of species differences between H. hoffstetteri and H. paulacoutoi (e.g., in size of head, presence of fovea, shape of third trochanter, width of patellar groove), the differences he cited appear to represent nothing more than intraspecific individual variation. Similarly, although Mayo, 1978a, listed several ways in which the Habanocnus femora differ from those of other Cuban sloths, in our view they do not differ, quantitatively or qualitatively, from Hispaniolan sloth femora that we have assigned to Acratocnus. In summary, the material assigned (and sometimes diversely reassigned) over the years to A. antillensis, M. antillensis, H. hoffstetteri, and H. paulacoutoi can be comfortably accommodated within the bounds of a single genus and species (which must be A. antillensis by operation of the rule of priority). There is no hypodigmatic material other than femora to support Habanocnus, and on close study these specimens cannot be separated from those assigned to A. antillensis. Furthermore, the Cuban species is notably similar to its Hispaniolan and Puerto Rican close relatives. Acratocnus ye MacPhee, White and Woods, 2000:11 Holotype and type locality — Cranium and associated mandible (UF 170533) from Trouing Vapè Durand, Plain Formon, Département du Sud, Haiti. Hypodigm also includes numerous postcranial elements found in several different caves. Diagnosis — Agrees with A. odontrigonus for characters that define the genus, but differs from other Acratocnus species in exhibiting the following combination of features: superior aspect of cranium extremely domed along sagittal crest, forming a significant angle with rostrum; postorbital constriction not extreme; palatine foramina consistently prominent and abundant; symphyseal spout laterally pinched, extremely ventrally pinched on either side of ventral keel, and projecting anteriorly at an angle significantly different from that of anterior border of mandible; rectus tubercle of pelvis very prominent and laterally projecting, creating a right angle in posterior view; acetabular rim nearly closed and pit partly or completely filled in; femoral neck anteriorly projecting; femoral head extremely large, globular, and afoveate; femoral shaft with great torsion and reduced third trochanter; tibial shaft with prominent anteromedial muscle scar; tibia with posterolaterally projecting proximal articulation; distinct ridge separating cuboid and sustentacular facets of calcaneus; calcaneal tuberosity waisted and relatively symmetrical; humeral head extremely large; humeral trochlea mediolaterally flat with no distal flare; bridge over entepicondylar foramen with distinct knob; entepicondylar foramen slightly visible posteriorly; pectoral crest markedly projecting medially; forelimb greatly elongated; ulnar shaft with prominent anterolateral ridge (see MacPhee et al., 2000b, for discussion of A. ye). Distribution — Hispaniola. Synonyms — None. Acratocnus ye is completely distinct from “Acratocnus” comes (Miller, 1929), which is properly a member of Neocnus (see below). The “Acratocnus” metapodial described by Hooijer and Ray (1964) is probably assignable to N. comes. Comment — Yesterday’s acratocnus is very similar to A. odontrigonus in nearly all morphological respects, indicating a very close relationship (White et al., 1996). It is also noteworthy that the large, afoveate femoral head, reduced third trochanter, and long, gracile femoral shaft, all features utilized by Mayo (1978a) to distinguish Habanocnus (see A. antillensis), also occur on A. ye.

216

Biogeography of the West Indies: Patterns and Perspectives

Choloepodinae incertae sedis Paulocnus Hooijer, 1962:47 Diagnosis — As for type species. Paulocnus petrifactus Hooijer, 1962:47 (type and only species) Holotype and type locality — Skull preserving one tooth (GUIA R8222) from Tafelberg Santa Barbara, eastern Curaçao. Diagnosis — Size intermediate between that of Megalocnus and Acratocnus; zygomatic arch open; sagittal crest absent; first maxillary tooth caniniform and triangular (see below); last upper molariform trigonally shaped; symphyseal spout spatulate; first mandibular molariform (i.e., m2) subquadrate with anteroposteriorly long inner face; manus generalized; ungual phalanges laterally compressed (Hooijer, 1962; Paula Couto, 1967). Paulocnus also differs from Acratocnus in the following respects: astragalar trochlea wedge-shaped with distinct separation between medial and lateral sides; quadriceps femoris tubercle reduced; calcaneal tuberosity not volarly expanded (Hooijer, 1962; J. White, personal observation). Distribution — Curaçao. Synonyms — None. Comment — Other material in the original hypodigm as described by Hooijer (1962) includes a radius, femur, tibia, fibula, calcaneus, astragalus, and several hand and foot bones, but no further material seems to have been collected (or, at least, none has been reported). Curiously, Paulocnus is not known from Venezuela or elsewhere on the continent, despite the fact that Curaçao (which lies immediately off the South American continental shelf ) would have been separated from the mainland by only a small stretch of water from mid-Wisconsinan through early Holocene time. Perhaps megalonychid remains of late Quaternary age recently collected by John Moody and Greg McDonald in a cave in the Perija Mountains (on border between Venezuela and Colombia) will shed some much-needed light on the fate of this sloth family in northern South America (G. McDonald, personal communication). Paulocnus has considerable biogeographical importance because it is related to sloths from islands lying deeper within the Caribbean. However, the affinities of Paulocnus within Megalonychidae have not been treated in any real depth. Hooijer (1962, 1964, 1967) insisted that Paulocnus differed from other Antillean forms more than they differed among themselves (surely an overstatement when viewing Megalocnus against Neocnus, for example), and he avoided placing it anywhere in particular within the family. However, no one has properly reexamined the rather questionable characters on which Hooijer’s claims of distinctiveness are based. We note that MacPhee et al. (2000a), in reinterpreting Hooijer’s (1964) photograph of the only snout region of Paulocnus, concluded that the maxillary caniniform of this species corresponded in detail to that of other nonmegalocnin Antillean megalonychids, contra Hooijer (1964). Without citing any character evidence, Webb and Perrigo (1985) placed Paulocnus outside their own (unnamed) grouping of Antillean sloths, as the sister of a clade otherwise composed of Pliometanastes, Meizonyx, and Megalonyx. In complete contrast, McKenna and Bell (1997) placed Paulocnus in the coordinate subfamily Ortotheriinae, which implies that the Curaçao sloth is distantly, rather than closely, related to megalonychines. The badly preserved elements comprising the hypodigm of Paulocnus admit no certainty about its relationships. In our view it is probably reasonably closely related to Acratocnus, although it shows some important distinctions (e.g., elongated spout). It is incidentally important to mention that Ortotheriinae has traditionally included Antillean representation since Kraglievich (1923) first proposed the idea. However, his concept has been trimmed down over the years. At present, the only Antillean taxa regarded as ortotheriine by McKenna and Bell (1997) are Paulocnus and Habanocnus. The former, as noted, may or may not be a relative of Acratocnus; the latter is certainly so. No ortotheres from southern South America

The Sloths of the West Indies: A Systematic and Phylogenetic Review

217

were included in our investigation, so the position of this subfamily with respect to our concept of Choloepodinae is uninvestigated. Tribe Cubanocnini Varona, 1974:48 Diagnosis — As for type genus (Neocnus). Comment — Although Neocnus Arredondo, 1961 has priority over Cubanocnus Kretzoi 1968, Varona’s (1974) tribe Cubanocnini (containing Neocnus only) is valid and available (ICZN art. 40[a][i]). As the first suprageneric name to be proposed for this clade (ICZN art. 24), Cubanocnini has priority over more logical constructions (e.g., Neocnini, proposed by Paula Couto [1979:193]), even though Cubanocnus is now reduced to the rank of junior synonym of Neocnus. Neocnus Arredondo, 1961:29 Diagnosis — Small body size; cranial flexion absent; postorbital constriction weak; rostral flare slight; pterygoid inflation absent; sutural attachment area for jugal on maxilla very small (?jugal reduced); cranial glenoid at or above superficies meatus; second maxillary molariform anterolaterally concave; last maxillary molariform broadest on lingual side; mandibular caniniform grooved posterointernally; last mandibular molariform with deep lingual groove; rectus femoris tubercle inconspicuous; femoral head fovea centric; femoral shaft anteroposteriorly flat and medially bowed with prong on anterior aspect; tibial articular surface with slight separation; astragalar head well defined; astragalar trochlea wedge shaped; fibular facet of astragalus truncated and crescent shaped; humeral head spherical and skewed laterally; entepicondylar foramen visible in posterior view; humerus short and slender but with prominent and squared supracondylar ridge; deltoid and pectoral crests nonconfluent; pronator quadratus flange distally confined. (Extracted from Paula Couto, 1979, Webb and Perrigo, 1985, and Gaudin, 1995, with additional observations by authors.) Type species = N. gliriformis (Matthew, 1931). Distribution — Cuba (N. major, N. gliriformis) and Hispaniola (N. comes, N. dousman, N. toupiti). Synonyms — Cubanocnus Kretzoi, 1968. Comment — The taxonomic history of this genus is convoluted. While Paula Couto (1967) and Fischer (1971) made a case for lumping Arredondo’s N. major and N. minor into N. gliriformis, Mayo (1978b, 1980b) summarized evidence suggesting that they should remain separate species. We provisionally recognize N. gliriformis (as originally conceived) as separate from N. major (including N. minor) because of the former’s extremely small size and gracility of obviously adult specimens. There seems to be no compelling reason to recognize any additional species of Neocnus in Cuba, however. Neocnus gliriformis Matthew, 1931:4 Holotype and type locality — Partial mandible (AMNH 16882) from “the Casimba in the Sierra Jatibonico,” Cuba (see Brief Overview of Megalonychid Discoveries). Diagnosis — As for genus, but differs from other Neocnus species in exhibiting the following combination of features: cranium flattened; palatine grooves absent; ventral aspect of mandibular body convex; mandibular second molariform subtriangular; mandibular fourth molariform flat posteriorly; femoral shaft with slight torsion and reduced anterior prong; quadriceps femoris tubercle reduced; supracondylar ridge of humerus reduced; pronator quadratus flange of radius gentle and reduced; sigmoid notch of ulna unsegmented and shallow. Distribution — Cuba. Synonyms — Microcnus gliriformis Matthew, 1931. Comment — Matthew’s original concept of Microcnus (de la Torre and Matthew, 1915; Matthew, 1918, 1919) was based on a small collection consisting of a mandible and some foot bones. These elements were considered by Matthew to be similar to, but smaller than, their counterparts in living tree sloths, and hence distinctive among megalonychids generally. When

218

Biogeography of the West Indies: Patterns and Perspectives

M. gliriformis was finally validly named (Matthew, 1931), lack of a symphyseal spout was given as its main distinguishing feature. Arredondo (1961) 30 years later created the new genus Neocnus for two new species, N. major and N. minor, noting that while similar to N. gliriformis in most respects, they differed in possessing a small but definite symphyseal spout. In Paula Couto’s (1967) opinion, the spout had been present in life on the N. gliriformis type, but was later lost. Arredondo’s distinction therefore lacked a difference, and Paula Couto sank major and minor into Microcnus gliriformis. However, we regard N. gliriformis as distinguishable from the other Cuban species we recognize, N. major, by the features listed below. Neocnus major Arredondo, 1961:32 Holotype and type locality — Arredondo (1961) did not specifically identify a holotype for this species, although his descriptions repeatedly emphasized that he was founding N. major on two left mandibles (which must therefore be regarded as syntypes): IGPACC 417-5 (formerly SEC P. 318) from Cueva de Pio Domingo, near Sumidero, Prov. de Pinar del Río, Cuba; and an unnumbered specimen from Cueva de Paredones, in Alquízar, La Habana. Mayo (1980b) in effect designated the Paredones specimen as the name-bearing type (i.e., lectotype) for N. major. (The Pio Domingo specimen thus becomes a paralectotype under ICZN art. 73-74.) Diagnosis — Agrees with N. gliriformis for characters that define the genus, but differs from other Neocnus species in exhibiting the following combination of features: cranium slightly domed; second mandibular tooth subquadrate; fourth mandibular tooth convex posteriorly; symphyseal spout pointed and short; femoral shaft with slight torsion and well-developed anterior prong; distal tibial articular surface divided; astragalar trochlea tapered posteriorly; pronator quadratus flange forming abrupt lateral crest. Further descriptions may be found in Arredondo (1961) and Mayo (1978b, 1980b). Distribution — Cuba. Synonyms — Neocnus minor Arredondo, 1961; N. baireiensis Mayo, 1980a. Comment — Specimens previously assigned to N. minor and N. baireiensis (the latter consisting of a single femur) appear to fall within the range of individual variation for N. major. It may be eventually warranted to recognize N. gliriformis as the only Cuban species of the genus, if additional material indicates that all relevant differentiae of N. major are simply clinal. Neocnus comes (Miller, 1929:26), new synonymy Holotype and type locality — Proximal femur (USNM 253178, renumbered USNM 299642) collected from a cave near St.-Michel-de-l’Atalaye [or Atalye], Haiti. For comment on hypodigm, see below. Diagnosis — Agrees with N. gliriformis for characters that define the genus, but differs from other Neocnus species in exhibiting the following combination of features: sagittal crest double; cranium slightly domed; second mandibular tooth subquadrate; symphyseal spout narrow; proximal facet of tibia laterally oriented; femoral shaft with well-developed anterior prong; quadriceps femoris tubercle forming hook, with associated groove; distal tibial articular surface divided; astragalar trochlea tapered posteriorly; pronator quadratus flange forming abrupt lateral crest; ulnar shaft straight with medially hooked olecranon. Distribution — Frequent in cave faunules in Haiti and Dominican Republic. Synonyms — “Acratocnus (?)” comes Miller, 1929; Synocnus comes Paula Couto, 1967. Comment — Miller (1929, 1930) assigned a variety of elements to the hypodigm of “Acratocnus (?)” comes. Paula Couto (1967) included additional material that he believed belonged to the same taxon (skull fragment [USNM 293837], anterior portion of a mandible [USNM 293836], edentulous ramus [MNHN 1881-28]). On the basis of the now-widened hypodigm, he went on to conclude that differences from Puerto Rican Acratocnus were sufficient to warrant the creation of a new genus, Synocnus, for the Haitian fossils.

The Sloths of the West Indies: A Systematic and Phylogenetic Review

219

In reviewing this material ourselves, we have determined that Paula Couto’s (1967) hypodigm for S. comes includes more than one taxon. Although the skull and mandible unfortunately cannot now be located, Paula Couto’s (1967:40–46) description of them could well serve as a description of the homologous elements of Parocnus. In addition, the photographs in his figures 21 and 22 are reversed: the photograph presented as figure 22 (of Parocnus) depicts USNM 293836, which is actually described in the caption of figure 21 (which has instead an image of an A. antillensis mandible). Removing from consideration fossils that actually belong to Parocnus, Paula Couto’s (1967) original hypodigm is reduced to the specimens which were described as “Acratocnus?” by Miller (1929). With the much larger Hispaniolan sample now available, it is clear that Miller’s specimens correspond much more closely to Neocnus than to Acratocnus. We confirm that UF 25702, a skull from Trou Wòch Dadier assigned by Webb (1985) to “Synocnus” comes is indeed N. comes. In addition, the “Acratocnus” metapodial described by Hooijer and Ray (1964) is probably assignable to N. comes. Neocnus dousman MacPhee, White, and Woods, 2000:13 Holotype and type locality — Skull (UF 76363) from Trouing de la Scierie, Morne La Visite, Haiti. Hypodigm also includes mandible from the same locality, and postcranial elements from diverse localities in Haiti and Dominican Republic. Diagnosis — Agrees with N. gliriformis for characters that define the genus, but differs from other Neocnus species in exhibiting the following combination of features: sagittal crest consistently present; cranium flattened; lateral groove of pterygoid present; second mandibular tooth subtriangular; symphyseal spout long, narrow, and untapered; proximal fibular facet of tibia oval and posteriorly oriented; femoral shaft with slight anterior prong; quadriceps femoris tubercle forming hook with deep groove; pronator quadratus flange forming abrupt lateral crest; bicipital tuberosity anteriorly placed (see MacPhee et al., 2000b, for discussion of N. dousman). Distribution — Hispaniola. Synonyms — None. Comment — While there are discrete traits that define this new species as distinct from the larger N. comes and the smaller N. toupiti (q.v.), this species can be distinguished from its closest relatives morphometrically, thanks to the large sample sizes housed at UF. Neocnus toupiti MacPhee, White and Woods, 2000:15 Holotype and type locality — Skull (UF 156892) and various elements comprising an associated skeleton of a single individual (all from Trouing Jeremie #5, Plain Formon, Département du Sud, Haiti). Hypodigm also includes material from several other sites in Haiti. Diagnosis — Agrees with N. gliriformis for characters that define the genus, but differs from other Neocnus species in exhibiting the following combination of features: very small, extremely gracile postcranial skeleton; upper caniniform with very deep lingual groove; second mandibular tooth subtriangular; symphyseal spout long, narrow, and untapered (partly broken on holotype); angular process of mandible projecting far posteriorly; femur lacking third trochanter; femoral shaft cylindrical with reduced anterior prong; femoral head tiny; distal tibial articular surface very narrow and divided only at anterior edge; astragalus tiny with relatively long neck; ectal and sustentacular facets very close together; calcaneal tuberosity triangular; ectal facet distinctly humped; most anterior aspect of glenoid fossa of scapula pointed; supracondylar ridge reduced; pronator quadratus flange gentle and reduced; ulnar shaft extremely laterally compressed; sigmoid notch of ulna unsegmented and shallow; proximal fibular facet of tibia round, reduced, and posteriorly oriented (see MacPhee et al., 2000b, for discussion of N. toupiti). Distribution — Hispaniola. Synonyms — None.

220

Biogeography of the West Indies: Patterns and Perspectives

Comment — While morphologically very similar to N. gliriformis, this new species is much smaller — indeed, significantly smaller than both genera of extant tree sloths, and quite possibly the smallest sloth on record from any age or place. Neocnus toupiti can be distinguished from other Neocnus by a suite of unique discrete traits as well as by morphometric statistical analyses. Elements assigned to this species are clearly adult, and are smaller than obviously immature elements belonging to the larger Hispaniolan Neocnus species. We rule out sexual dimorphism as an explanation for the presence of multiple similar species of Neocnus on Hispaniola on two grounds: the three species can be distinguished by discrete morphological traits that are not associated with sexual dimorphism in other mammalian groups, and there is no evidence for sexual dimorphism in either extant sloths or in other megalonychid taxa for which there are large sample sizes. Subfamily Megalocninae Kraglievich, 1923:318 Diagnosis — Postorbital constriction absent; cranium long, of relatively uniform width, and flattened superiorly; jugal expanded; pterygoid inflation present; paroccipital process greatly enlarged and free standing (Gaudin, 1995); lateral groove of pterygoid absent (Gaudin, 1995); pronounced airorrhynchy (posterior palate flexed ventrally); mandibular coronoid process not superior to condyle, and condyles well above tooth row; last maxillary molariform medially narrow; last mandibular molariform convex; femur with nonspherical head and anteroposteriorly deep distal end; fovea for ligamentum teres posterior and eccentric (i.e., located on periphery of articular surface on femoral head); rectus femoris tubercle prominent; shaft of tibia and fibula straight; tarsus serially arranged; calcaneal tuberosity symmetrical and thick with lateral foramen and lacking volar expansion; astragalar neck very short; astragalar articular surface distinctly divided; fibular facet of astragalus flat; deltoid and pectoral crests of humerus confluent; ulnar shaft straight; coronoid process of ulna extensive and shelf-like. Type genus = Megalocnus Leidy, 1868. Comment — The traditional concept of this subfamily as defined by Kraglievich (1923) includes both Megalocnus and Parocnus (= Mesocnus; for synonymy and choice of valid name, see below) and has been supported by a number of authorities (e.g., Varona, 1974; Arredondo, 1977; Paula Couto, 1979; Mones, 1986; Pascual et al., 1990; McKenna and Bell, 1997). However, at least as many investigators have inserted Parocnus within the other major grouping of extinct megalonychids, Ortotheriinae (e.g., Simpson, 1945; Aguayo and Rivera, 1954; Hoffstetter, 1955; Matthew and Paula Couto, 1959; Arredondo, 1960; Paula Couto, 1967; Fischer, 1971). Cutting the knot, but not resolving any phylogenetic issues thereby, Arredondo (1988) erected the new subfamily Mesocninae exclusively for this genus. The possible association of Parocnus with Ortotheriinae sensu McKenna and Bell (1997) is, of course, not testable with our data because none of the members of this subfamily was included in our cladistic analysis (Acratocnus [= Habanocnus] and Paulocnus are not considered members by us). A considerably more involved problem, which cannot be discussed in detail here, is McKenna and Bell’s (1997) close association of Megalonyx and Megalocnus (to the exclusion of all other Antillean taxa) within the same subtribe (Megalonychina, within tribe Megalonychini). Parocnus is relegated to a separate subtribe in the same collocation. Although Megalonyx is certainly related to Megalocnus, and may even be the sister-group of a clade consisting of Antillean megalonychids plus Choloepus (cf. Gaudin, 1995), it seems highly improbable that the former is actually deeply embedded within the latter. At present, we know of no character evidence to support this relationship. Tribe Megalocnini Kraglievich, 1923:318 Diagnosis — As for type genus.

The Sloths of the West Indies: A Systematic and Phylogenetic Review

221

Megalocnus Leidy, 1868:180 Diagnosis — Maxillary teeth pseudorodentiform or incisiform rather than caniniform (i.e., broad and anteroposteriorly compressed); femoral head not flat; acetabular rim with large gap; scapular spine divergent at vertebral border; prescapular fossa much larger than postscapular fossa; second scapular spine near inferior angle prominent; fossa for teres major expanded into a blade; anterior scapular border ventrally concave and smoothly curved; glenoid fossa greatly angled and anteroposteriorly concave. Type species = M. rodens Leidy, 1868. Distribution — Cuba (M. rodens) and Hispaniola (M. zile). Comment — Megalocnus, the first sloth taxon identified from the West Indies, is one of the most frequently recovered mammal fossils in Cuba. MacPhee et al. (2000b) have presented evidence that true Megalocnus occurred on Hispaniola and its satellite Ile de la Tortue as well. Megalocnus rodens Leidy 1868:180 Holotype and type locality — Partial mandible from Ciego Montero, Sierra de Jatibonico, Cuba, “presumably in the collections of the Madrid museum” (Paula Couto, 1967:9), catalog number unknown. Hypodigm includes numerous specimens listed by Matthew and Paula Couto (1959). Diagnosis — Symphyseal spout absent; mandibular incisiform meniscoid; femoral neck proximally oriented and above greater trochanter; femoral shaft anteroposteriorly flat and of relatively uniform width; third trochanter absent; lesser trochanter forming low, gentle bump; distal tibial articular surface with slight separation; proximal fibular facet of tibia posteriorly located; medial trochlea of astragalus short and odontoid; navicular facet concave; calcaneal tuberosity with very slight medial expansion; humerus with large entepicondylar foramen, not visible posteriorly; humeral head spherical; distal radial articular surface smooth. (Extracted from Matthew and Paula Couto, 1959, and Paula Couto, 1967, with additional observations by authors.) Distribution — Widespread in western and central Cuba during the Quaternary, possibly with many local populations. Synonyms — Myomorphus cubensis Pomel, 1868 (based on same material as Leidy’s, whose name has priority), Megalocnus rodens rodens Leidy, 1868, Megalocnus rodens casimbae Matthew, in Matthew and Paula Couto (1959), Megalocnus ursulus Matthew, in Matthew and Paula Couto (1959), Megalocnus junius Matthew, in Matthew and Paula Couto (1959), Megalocnus intermedius Mayo, 1969, Neomesocnus brevirrostris Arredondo, 1961. Comment — Matthew thought that several species of Megalocnus existed in Cuba during the Quaternary, and had developed manuscript names and at least partial diagnoses for them before his death. Paula Couto edited and published these in their joint paper (Matthew and Paula Couto, 1959), somewhat cumbersomely, as “Matthew in schedis.” As Paula Couto noted, he chose to underscore Matthew’s authorship of these names because he doubted their validity — even as he enshrined them in the literature by officially publishing them. To preserve everyone’s good name and actual intentions, the authorship of these taxa should be given as “Matthew, in Matthew and Paula Couto (1959).” None of Matthew’s Megalocnus taxa have much current support, and their details can be quickly summarized. Megalocnus rodens rodens is based on the type mandible for the species and genus. Megalocnus rodens casimbae was founded on a different mandible (AMNH 49987) from Casimba, but is not otherwise meaningfully distinguished. Megalocnus ursulus is based on an edentulous mandible fragment (AMNH 49996), also from Casimba, that is roughly two thirds the average mandible size of (adult) M. rodens. Paula Couto (1967) suggested that that mandible is probably that of a juvenile M. rodens, a view with which we concur. Megalocnus intermedius Mayo, 1969 is based on a nearly complete cranium (DPUH 1201) from Cueva del Vaho, Prov. de La Habana. Other material attributed by Mayo to this species includes several molariform teeth, a partial radius and ulna, and a partial skeleton from Caverna de Pio Domingo, Prov. de Pinar del Río. Mayo (1969) argued that these remains represented a new species because, compared to M. rodens, they are smaller and less robust, and because dental and diastema

222

Biogeography of the West Indies: Patterns and Perspectives

dimensions are slightly different. However, he also noted that morphometric differences in the limbs of the two species were negligible, suggesting to us that the distinctions he defined to separate the two species are not taxonomically meaningful. Neomesocnus brevirrostris Arredondo, 1961 consists of a mandibular fragment (symphyseal region and alveoli of two teeth) which was found at Cueva de Paredones, Prov. de La Habana, Cuba (currently identified as No. 51 in O. Arredondo’s private collection). Although Varona (1974) maintained N. brevirrostris as a separate genus and species, the mandibular fragment is generally thought to represent a juvenile individual of Megalocnus (Paula Couto, 1967, 1979; Mayo, 1969; Fischer, 1971). Arredondo (1988) himself noted that the distinctiveness of some of the mandible’s characters may be questioned, which seems to us to put an end to the matter. In summary, current consensus recognizes that M. rodens exhibits a substantial range of intraspecific morphometric variation (Fischer, 1971; Varona, 1974; Paula Couto, 1979), and that other named forms are invalid, as they are based on individuals displaying extremes of variation. The extensive range of intraspecific variation evident in other Antillean sloth taxa that are represented by large sample sizes supports this view (White, 1993a; White et al., 1996). Megalocnus zile MacPhee, White, and Woods, 2000:7 Holotype and type locality — Scapula (left side, UF 169930) from Trou Gallery, Ile de la Tortue, Département du Nord-Ouest, Haiti. Other material referred to this species includes several molariforms and postcranial elements from Trou Gallery. A scapular fragment from the Dominican Republic confirms that this species also lived on the mainland. Diagnosis — With respect to known elements, agrees with M. rodens, but can be distinguished from the latter in that the fossa for teres major on the caudal border of the scapula is more capacious and expands abruptly beneath secondary scapular spine. Also, the femoral head of M. zile is more spherical, nearly to the degree seen in the subfamily Choloepodinae (see MacPhee et al., 2000b, for discussion of M. zile). Distribution — Hispaniola. Synonyms — “Megalocuus? sp?” [lapsus calami], in parte (Miller, 1922). Comment — In his 1922 paper, Miller tentatively suggested that some fragmentary postcranials from a cave near St.-Michel-de-l’Atalaye (Haiti) could represent Megalocnus, but later decided that they represented a distinct form (eventually denominated Parocnus serus; see below). Nevertheless, Megalocnus did in fact exist in Hispaniola, as the newly described material from Trou Gallery makes clear (MacPhee et al., 2000b). The Trou Gallery specimens correspond in size and shape to their better-known counterparts in M. rodens. Unfortunately, although large molariforms have been recovered at Trou Gallery, no incisiforms are known. It is possible that the highly specialized front teeth of M. rodens were autapomorphic, but this possibility cannot be usefully evaluated in the absence of relevant remains of the Hispaniolan species. Why M. zile was apparently a much rarer animal than M. rodens is not known. Tribe Mesocnini Varona, 1974:46 Diagnosis — As for type genus (= Parocnus Miller, 1929:28). Comment — Varona (1974) proposed Mesocnini as a tribe containing Mesocnus, Neomesocnus, and Parocnus. Neomesocnus is a synonym of Megalocnus (see above). Mesocnus and Parocnus are so similar for all important diagnostic features (see below) that a generic separation between them can no longer be sustained. The appropriate genus-level name for the two species that we recognize (P. browni and P. serus) is Parocnus (Miller, 1929; see below); however, the name of the tribe remains Mesocnini (ICZN art. 24, principle of first reviser). Nearly as many workers have preferred to place Parocnus and its allies in Megalocninae as in Ortotheriinae. Our analyses support its placement in subfamily Megalocninae, together with Megalocnus.

The Sloths of the West Indies: A Systematic and Phylogenetic Review

223

Parocnus (Miller, 1929:28), new synonymy Diagnosis — Sagittal crest double; symphyseal spout greatly elongated and spatulate; anterior maxillary teeth small and triangular; mandibular caniniform teeth with deep inner groove; molariform teeth subquadrate; mandibular mental foramina very large; femoral head medially oriented, nonspherical, and flattened; femoral shaft wide and anteroposteriorly compressed for the upper two thirds, and distally narrowed and rounded; greater trochanter level with head, with deep posteromedial concavity, and confluent with prominent third trochanter; lesser trochanter absent or inconspicuous; distal tibial articular surface with distinct separation; medial side of astragalar trochlea concave; calcaneal tuberosity ventrally excavated; scapula with rounded borders and oval-shaped glenoid fossa; pre- and postscapular fossae approximately equal in size; humeral head flattened; entepicondylar foramen of humerus absent; supracondylar ridge gentle; distal radial articular surface irregular. Type species = P. serus Miller, 1929: 29. Distribution — Cuba (P. browni) and Hispaniola (P. serus). Synonyms — “Megalocuus? sp?” [lapsus calami], in parte (Miller, 1922); Mesocnus Matthew, 1931. Comment — It might be remarked that, in justice, the genus-level name for the species accepted here should be Matthew’s Mesocnus. Unfortunately, Matthew used this name several times in print as a nomen nudum, without identifying a type species or providing a diagnosis. By the time Matthew validly published it (posthumously, in 1931), Miller (1929) had already named P. serus. Hard luck, but if browni and serus belong in the same genus, as we argue here, that genus has to be Parocnus by virtue of priority. Parocnus serus Miller, 1929:29 Holotype and type locality — Immature partial right femur, lacking epiphyses (USNM 253228), from St.-Michel-de-l’Atalaye, Haiti. Diagnosis — P. serus differs from P. browni in the following respects: acetabular rim lacks gap and is surmounted by prominent rectus femoris tubercle; navicular facet of astragalus convex; medial trochlea of astragalus less concave, less dorsally elevated; trochlear articular surface grooved and divided but continuous; ectal facet of calcaneus very concave; distal articular surface of radius irregular but single faceted. Distribution — Haiti and the Dominican Republic, including the islands of La Tortue and La Gonâve. Synonyms — Megalocuus? sp? (in parte) Miller, 1922. Comment — Miller (1929) referred a humerus, a proximal tibia and fibula, an astragalus, three calcanei, an atlas fragment, and several foot bones to the hypodigm of P. serus. Reviewing this material a quarter century later, Paula Couto, in a letter cited by Hoffstetter (1955), concluded that Miller’s Parocnus material actually represented Megalocnus (as M. serus). Matthew and Paula Couto (1959) listed part of Miller’s Parocnus material as a synonym of Megalocnus, but they also listed part of it as a synonym of Mesocnus. In Paula Couto’s (1967) later review, however, Parocnus was maintained as a separate genus, and he even added a mandibular ramus (USNM 293831) to the hypodigm. Interestingly, he speculated that, had Matthew’s nomen Mesocnus been properly published prior to 1929, Miller might have assigned his Haitian material to Mesocnus rather than coin a new genus for its reception. Varona (1974) recognized the extensive similarities between Parocnus and Mesocnus, but advocated maintaining generic distinction until more materials were found. Parocnus browni Matthew, 1931:2 Holotype and type locality — Anterior half of cranium (AMNH 16877) from Ciego Montero, Cuba. Diagnosis — Full descriptions of this material may be found in Matthew (1931), Matthew and Paula Couto (1959), and Paula Couto (1967). Features that differentiate P. browni from P. serus

224

Biogeography of the West Indies: Patterns and Perspectives

include: navicular facet of astragalus flat/concave; medial trochlea of astragalus very concave and dorsally elevated, with articular surface widely separated from that of lateral trochlea; humeral head very flattened; pronator quadratus flange of radius laterally very abrupt; distal articular surface of radius forming two distinct facets. Distribution — Various localities in Cuba, primarily Ciego Montero, Casimba (Sierra de Jatibonico), and Cueva de los Niños (Cayo Salinas). Synonyms — Mesocnus browni Matthew, 1931; M. torrei Matthew, 1931; M. herrerai Arredondo, 1977. Comment — Although M. browni and M. torrei have frequently been accepted as valid species (Varona, 1974; Paula Couto, 1979; Arredondo, 1988), Paula Couto (1967) noted that such differences as there are between them relate to size rather than morphology. In particular, he noted that M. torrei may in fact represent immature or female members of M. browni. Likewise, Fischer (1971) felt that there was not enough material available to allow the species to be definitively distinguished: their size ranges overlap, and there are no consistent discrete traits that distinguish the two. Mesocnus herrerai Arredondo, 1977 is based on a mandibular ramus from Cueva Funeraria de los Niños (IZ 6995). Arredondo noted that the mandible differs from those of browni and torrei in being narrow and in lacking ventral convexity, but it is difficult to accept the validity of this species because it is represented by so little material. Although in our classification the type of herrerai is regarded as a synonym of Parocnus browni, it is worth noting that the herrerai mandible markedly resembles that of Hispaniolan P. serus. Arredondo (1977), who noted this resemblance originally, actually speculated that Mesocnus and Parocnus may turn out to be synonymous — a prescient thought that we have now taken to its logical conclusion. Megalonychidae, incertae sedis It is convenient to list several sets of sloth remains as Megalonychidae, incertae sedis. Only one has a formal binomen at present (Imagocnus zazae). Some of the others probably represent new species and even genera, but which of them rate this distinction will have to await proper study and evaluation by the investigators concerned. Imagocnus MacPhee and Iturralde-Vinent, 1994:3 Diagnosis — As for type species. Imagocnus zazae MacPhee and Iturralde-Vinent, 1994:3 (type and only species) Holotype and type locality — Edentulous palate (MNHNH P 3014); Domo de Zaza, Prov. Sancti Spiritus, Cuba. Diagnosis — Distinctively megalonychid organization of alveoli; differs from all Antillean sloths (except Acratocnus and Parocnus) in lacking large palatal palatine foramina situated at transverse level of first molariforms. Differs from Acratocnus in being larger, in possessing a midline torus, and other features. Differs from Parocnus in having greater interalveolar breadth at level of first molariform. Distribution — Central Cuba, Early Miocene. Synonyms — None. Comment — Despite many seasons of work at Domo de Zaza, only a small number of sloth fossils have been recovered at this locality (MacPhee and Iturralde-Vinent, in press). The material now available includes a partial pelvis that is larger than any known pelvic specimen attributable to Megalocnus rodens, usually regarded as the largest known Antillean megalonychid. However, whether the size of the Zaza pelvis implies that there was another (larger) species in Cuba during the Miocene or that body size in I. zazae was simply highly variable cannot be usefully assessed at this time.

The Sloths of the West Indies: A Systematic and Phylogenetic Review

225

MacPhee and Iturralde-Vinent (1994) did not speculate in detail on the nearer affinities of I. zazae, although they noted some possibilities. In size this species must have resembled Quaternary megalocnines, although size is a very poor indicator of relationships among phyllophagans. Its upper caniniform may have been trigonal (see MacPhee and Iturralde-Vinent, 1994), but this is a primitive feature within Megalonychidae (although it is one critical way in which Imagocnus differs from Megalocnus, whose caniniforms are uniquely reniform in section). Until better material is forthcoming, it is appropriate to leave the Zaza sloth as incertae sedis (cf. McKenna and Bell, 1997). Megalonychidae, gen. et sp. indet. The remaining entities to discuss under this heading can be conveniently grouped as “gen. et sp. indet.” (Figure 1). The specimens come from different islands and vastly different time periods, and there is no reason at all to think that they represent the same lower-level taxa (although most are certainly megalonychid). Species A (Yauco sloth) MacPhee and Iturralde-Vinent (1995) recently reported the discovery of a phyllophagan at AMNH 1994/1, an early Oligocene locality near the town of Yauco in southwestern Puerto Rico. Unfortunately, the only attributable specimen is the proximal end of a femur (AMNH VP 129883), which, although diagnostically phyllophagan, is not certainly megalonychid. (However, this remains the most plausible allocation, in view of the known mammal diversity in the Greater Antilles.) Although some resemblances to the femur of Acratocnus odontrigonus are evident, the Yauco specimen is in the size range of Neocnus, indicating that very small sloths were part of the faunal picture of the Greater Antilles as early as 33 to 34 mya. Species B and C (Cuban sloths) Oscar Arredondo and Osvaldo Vasquez Jiménez (personal communication) are in the process of proposing new taxa of megalonychids based on isolated bones from ?Quaternary cave sites in the province of Pinar del Río. We omit them from discussion here because names and descriptions have not yet been formally published. Species D (Grenadian sloth) Several sloth teeth recovered from a late Cenozoic locality in southern Grenada are not sufficiently diagnostic to determine their affiliation beyond the clear fact that they are megalonychid (MacPhee et al., 2000a). The authors place the age of the specimens, with a question mark, as latest Pliocene or early Pleistocene on the basis of preliminary K/Ar dates and taphonomic considerations. A molariform in the sample is comparable in size to that of Parocnus browni, while one of the caniniforms is reminiscent of the equivalent tooth in Paulocnus petrifactus. Comparisons with the latter genus are of special interest because of the proximity of Curaçao to Grenada (as compared to the Greater Antilles), and because — uniquely in the West Indies — both islands also supported capybaras.

BIOGEOGRAPHICAL ISSUES Megalonychid sloths are known from Cuba, Hispaniola (including the islands of La Tortue and La Gonâve), Puerto Rico, Curaçao, and Grenada (Anthony, 1926; Hooijer, 1962, 1964, 1967; Paula Couto, 1967; MacPhee et al., 2000a, 2000b). The majority of fossils are probably or certainly Pleistocene, but recent discoveries of Tertiary remains indicate that sloths entered the Antilles at least as early as the Early Oligocene (MacPhee and Iturralde-Vinent, 1995). The biogeographical history of Antillean land vertebrates has been the subject of decades of debate, controversy, and new interpretations (e.g., Rosen, 1975; Williams, 1989; MacPhee and Wyss, 1990; Hedges et al., 1992; MacPhee and Iturralde-Vinent, 1994, 1995; Hedges, 1996;

226

Biogeography of the West Indies: Patterns and Perspectives

Iturralde-Vinent and MacPhee, 1999; Pregill and Crother, 1999). The cladistic analysis and systematic revision presented above bear on two major biogeographical issues relevant to sloths and other Antillean land mammals: the origin and initial colonization of terrestrial environments in the Greater Antilles, and the significance of patterns of inter-island relationships.

COLONIZATION

OF THE

ANTILLES

The last ancestor of Antillean sloths lived in South America, as did the proximal ancestors of most other Antillean land mammal clades within the orders Primates, Chiroptera, and Rodentia. The only possible exception is Insectivora (Whidden and Asher, Chapter 15, this volume). The discovery of a femur (Species A in our classification) from the early Oligocene of southwestern Puerto Rico (MacPhee and Iturralde-Vinent, 1995) gives a minimum age for land mammal emplacement on the Antillean islands of 33 to 34 mya. Other Tertiary sloth material (Imagocnus zazae) has been found in early Miocene deposits on Cuba (MacPhee and Iturralde-Vinent, 1994). Three major mechanisms have been proposed to explain colonization of the Antilles by land mammals: continent–island vicariance (e.g., Rosen, 1975), overwater dispersal (e.g., Hedges et al., 1992), and dispersal over a short-lived land span* connecting South America with the nascent Greater Antilles via the Aves Rise (e.g., MacPhee and Iturralde-Vinent, 1995). Continent–island vicariance has been largely refuted as an explanation for the initial emplacement of mammals because modern mammalian lineages had not differentiated at the time of the hypothesized vicariance event (Williams, 1989; Hedges et al., 1992; MacPhee and Iturralde-Vinent, 1995; IturraldeVinent and MacPhee, 1999). In addition, Iturralde-Vinent and MacPhee (1999) have argued that permanently terrestrial environments were not present within the Caribbean basin until the late Eocene. Therefore, any mammals that had managed to colonize any Caribbean landmasses prior to the late Eocene would not have survived. Several recent workers, especially Hedges and coworkers, have argued that overwater dispersal was a major factor in colonization of the Greater Antilles. While this mechanism may offer an apparently parsimonious explanation for the presence of some taxa currently known from the islands, its random and fortuitous nature precludes useful testing (Page and Lydeard, 1994; MacPhee and Iturralde-Vinent, 1999; Pregill and Crother, 1999). An initial emplacement date in the early Oligocene is in good agreement with the land span model proposed by MacPhee and Iturralde-Vinent (1994, 1995) and Iturralde-Vinent and MacPhee (1999), although until the fossil record improves, the argument must be carried mostly by geology and paleogeography rather than biology. During the Eocene–Oligocene transition (ca. 35 mya), the developing northern Greater Antilles (i.e., proto-Cuba, Hispaniola, and Puerto Rico) and northwestern South America were briefly connected by a land span centered on the emergent Aves Ridge. This structure (Greater Antilles Ridge + Aves Ridge) has been named GAARlandia (MacPhee and Iturralde-Vinent, 1995). The massive uplift event that apparently permitted these connections was spent by 32 mya; a general subsidence followed, ending the GAARlandia land span phase. Thereafter, Caribbean neotectonism resulted in the subdivision of existing land areas. Under this scenario, a land span lasting from 35 to 33 mya would have enabled faunal emplacement by overland dispersal during a relatively short interval of geological time. However, just because the means to disperse to the Greater Antilles existed does not demonstrate that it was utilized by the taxon of interest. To show this in an inductively plausible manner, real biological evidence is required. Although it is permissible to argue that at least one kind of sloth was in the Greater Antilles by the early Oligocene, our phylogenetic evidence does not support the idea of a unified clade arising from one megalonychid invasion. Instead, this analysis suggests at least two separate colonization events by megalonychids. As early as 1923, Kraglievich divided the Antillean genera into two separate subfamilies, both of which also included South American taxa. Kraglievich (1923) and later Pascual et al. (1990) * Subaerial connection between a continent and one or more off-shelf islands.

The Sloths of the West Indies: A Systematic and Phylogenetic Review

227

proposed that Megalocnus was a close relative of the South American Miocene taxon Amphiocnus. While neither of those claims was based on cladistic analysis, the phylogeny we present in this chapter is, and it strongly supports a diphyletic origin of Antillean megalonychids (Figure 3). Choloepodinae (including Choloepus, Acratocnus, Paulocnus, and Neocnus) is separated from Megalocninae (including Megalocnus and Parocnus) by the South American Miocene taxon Hapalops. That Choloepodinae shares a common ancestry with a Miocene taxon from South America implies that the subfamily diverged from Megalocninae well before the Miocene, and that its ancestor must have reached the Greater Antilles in a separate event. Whether there were two separate migrations across GAARlandia, presumably closely spaced in time, cannot be determined at present. Unfortunately, the Tertiary sloth material known to date cannot shed much light on the issue of diphyly. The oldest Antillean sloth fossil, a proximal femur from the early Oligocene of Puerto Rico, appears to resemble members of the Choloepodinae in that it is similar in size to the smallest species of Neocnus (MacPhee and Iturralde-Vinent, 1995). However, there is so little of it present that we do not feel comfortable allocating it to a taxon any more specific than Megalonychidae gen. + sp. indet. (see classification). Imagocnus zazae, from the Miocene of Cuba, is more certainly megalonychid. Its large size and some aspects of its morphology may link it with members of the Megalocninae rather than the Choloepodinae, but again, there is too little material present to make a definitive taxonomic allocation. Further resolution of this issue will require recovery of additional early fossil sloth material from the Greater Antilles as well as the analysis of a much larger comparative data set like the one employed by Gaudin (1995).

DISTRIBUTION

OF

FAUNA

ACROSS ISLANDS

A separate biogeographical issue, addressed in the second part of the model proposed by IturraldeVinent and MacPhee (1999), concerns how the known inter-island distribution of mammalian taxa arose. Assuming that ancestral sloths reached the landmass in the mid-Tertiary, their descendants must have become distributed throughout the islands either through island–island vicariance or by overwater dispersal. At the proposed time of emplacement, central and eastern Cuba, northern Hispaniola, and Puerto Rico were all connected (Iturralde-Vinent and MacPhee, 1999). This period coincides with fossil evidence for first appearances of the major clades of nonvolant Antillean mammals. Paleogeographical evidence suggests that eastern Cuba did not separate from northern Hispaniola until the Windward Passage was formed in the late Oligocene to early Miocene, and that Hispaniola and Puerto Rico were probably connected into the late Miocene (MacPhee and Iturralde-Vinent, 1994, 1995; Iturralde-Vinent and MacPhee, 1999). Therefore, the Antillean islands did not achieve their present geographical arrangement until the end of the Miocene, well after the earliest records of known Antillean mammal clades. Similarities in distributions of sister taxa in different taxonomic groups suggest that these distributions may have been formed by a common cause (i.e., island–island vicariance), rather than a series of random overwater dispersal events. While there are some exceptional cases of taxa whose presence cannot be explained in this manner (see Iturralde-Vinent and MacPhee, 1999), island–island vicariance seems to be the most parsimonious way to explain current faunal distributions. The phylogeny and classification presented here offers strong support for island–island vicariance as the mechanism that created the known distribution of sloth taxa across the Greater Antilles. Each of the four genera is represented on more than one island, and Acratocnus is present on three islands. Such a balanced arrangement would have required at least five separate overwater dispersal events, which we regard as highly unlikely. A much more reasonable scenario is that the four genera had already differentiated and spread before the northern Greater Antilles assumed their current configuration. As predicted by vicariance theory, the (biological) branching pattern of taxa should accord with the (geological) branching pattern of the landmasses on which they lived. One rather enigmatic result of our analysis and previous cladistic analyses (White, 1993a, 1993b; Gaudin, 1995) is the placement of Choloepus. It is now well accepted that Choloepus is

228

Biogeography of the West Indies: Patterns and Perspectives

not the closest relative of Bradypus, and most recent workers place the two-toed sloth within the Megalonychidae (e.g.; Scillato-Yane, 1980; Webb, 1985; Wetzel, 1985; White, 1993b; Gaudin, 1995; McKenna and Bell, 1997). Recent cladistic analyses, including the one presented here, not only support this placement, but also deeply embed Choloepus within the Antillean megalonychids as the sister taxon to Acratocnus, to the exclusion of other Antillean megalonychids. Choloepus is only known as a Recent taxon from South and Central America, and it has not been found in the Greater Antilles or indeed anywhere else in the Caribbean Basin. In addition, Acratocnus has not been found from the mainland. Such a close relationship between the two-toed tree sloth and Acratocnus in particular suggests that their divergence occurred after the divergence between Acratocnus and Neocnus. Whether this relationship implies that Acratocnus and Neocnus dispersed separately to the Antilles from South America while Choloepus remained on the mainland (necessitating at least three sloth invasions) or that Choloepus dispersed to South America from the Antilles cannot be determined with available material. It is our hope that larger data sets including more taxa and more characters, combined with a more extensive fossil record, will bring this issue to resolution in the future.

ACKNOWLEDGMENTS We thank Charles Woods for granting us access to the Hispaniolan sloth collection at the Florida Museum of Natural History (FLMNH), and for inviting us to contribute to this book. Loans of material were approved by S. David Webb and sent to us by Marc Frank and Brian Beatty (FLMNH). J. L. W. thanks Erika Simons (FLMNH) for help with photography and translation of German text. Patricia Wynne and Clare Flemming (AMNH) helped to prepare figures. Howard Whidden made helpful suggestions for improving earlier drafts of the manuscript.

LITERATURE CITED Aguayo, C. G. and L. H. Rivera. 1954. Sinopsis de los mamíferos cubanos. Circulación del Museo y Biblioteca Zoologicos, La Habana:1283–1324. Ameghino, F. 1889. Contribución al conocimiento de los mamíferos fósiles de la República Argentina. Actas Academia Nacional de Ciencias Córdoba 6:1–1027. Anthony, H. E. 1916. Preliminary report of fossil mammals from Porto Rico, with descriptions of a new genus of ground sloth and two new genera of hystricomorph rodents. Annals of the New York Academy of Sciences 27:193–203. Anthony, H. E. 1918. The indigenous land mammals of Porto Rico, living and extinct. Memoirs of the American Museum of Natural History new series 2:333–435. Anthony, H. E. 1920. New Mammals from Jamaica. Bulletin of the American Museum of Natural History 42:469–476. Anthony, H. E. 1926. Mammals of Porto Rico, living and extinct — Rodentia and Edentata. Scientific Survey of Porto Rico and the Virgin Islands, 9(2):97–241. Publication of the New York Academy of Sciences. Anthony, H. E. 1940. Summary of fossil land mammals of the West Indies. Proceedings of the 8th American Scientific Congress 4:359–363. Arredondo, O. 1960. Origen, evolución, y extinción del “Megalocnus rodens.” El Cartero Cubano 9–12. Arredondo, O. 1961. Descripciones preliminares de dos nuevos géneros y especies de edentados del Pleistoceno Cubano. Boletin del Grupo de Exploraciones Científicas 1:19–40. Arredondo, O. 1977. Nueva especie de Mesocnus (Edentata: Megalonychidae) del Pleistoceno de Cuba. Poeyana 172:1–10. Arredondo, O. 1988. Nueva subfamilia de Megalonychidae (Mammalia: Edentata). Miscelanea Zoologica 39:1–2. Domning, D. P., R. J. Emry, R. W. Portell, S. K. Donovan, and K. S. Schindler. 1997. Oldest West Indian land mammal: rhinocerotoid ungulate from the Eocene of Jamaica. Journal of Vertebrate Paleontology 17(4):638–641. Engelmann, G. F. 1978. The Logic of Phylogenetic Analysis and the Phylogeny of the Xenarthra. Ph.D. dissertation, Columbia University, New York.

The Sloths of the West Indies: A Systematic and Phylogenetic Review

229

Engelmann, G. F. 1985. The phylogeny of the Xenarthra. Pp. 51–64 in Montgomery, G. G. (ed.). The Evolution and Ecology of Armadillos, Sloths, and Vermilinguas. Smithsonian Institution Press, Washington, D.C. Fischer, K. 1971. Riesenfaultiere (Megalonychidae, Edentata, Mammalia) aus dem Pleistozän der Pio-DomingoHöhle in Kuba. Wissenschaftliche Zeitschrift der Humboldt-Universität zu Berlin MathematischNaturwissenschaftliche Reihe 20(4/5):609–673. Gardner, A. L. 1993. Order Xenarthra. Pp. 63–68 in Wilson, D. E. and D. M. Reeder (eds.). Mammal Species of the World: A Taxonomic and Geographic Reference. 2nd ed. Smithsonian Institution Press, Washington, D.C. Gaudin, T. J. 1995. The ear region of edentates and the phylogeny of the tardigrada (Mammalia, Xenarthra). Journal of Vertebrate Paleontology 15(3):672–705. Gervais, F. L. P. 1855. Mammifères. Animaux nouveaux ou rares recueillis pendant l’expédition dans les parties centrales de l’Amérique de Sud. P. Bertrand, Paris. Greenwood, A. D., J. Castresana, G. Feldmaier-Fuchs, and S. Paabo. 2001. A molecular phylogeny of two extinct sloths. Molecular Phylogenetics and Evolution 18:94–103. Hedges, S. B. 1996. Vicariance and dispersal in Caribbean biogeography. Herpetologica 52(3):466–473. Hedges, S. B., C. A. Hass, and L. R. Maxson. 1992. Caribbean biogeography: molecular evidence for dispersal in West Indian terrestrial vertebrates. Proceedings of the National Academy of Sciences, U.S.A. 89:1909–1913. Hoffstetter, R. 1955. Un mégalonychidé (édenté gravigrade) fossile de Saint-Domingue (Ile d’Haïti). Bulletin du Muséum National d’Histoire Naturelle, Paris, Serie 2, 27(1):100–104. Honacki, J. H., K. E. Kinman, and J. W. Koeppl (eds.). 1982. Mammal species of the world: a taxonomic and geographic reference. Allen Press and The Association of Systematic Collections, Lawrence, Kansas. Hooijer, D. A. 1962. A fossil ground sloth from Curaçao, Nertherlands Antilles. Proceedings of the Koninklijke Nederlandse Akademie van Wetenschappen, Series B 65(1):46–60. Hooijer, D. A. 1964. The snout of Paulocnus petrifactus (Mammalia, Edentata). Zoologische Mededelingen 39:79–84. Hooijer, D. A. 1967. Pleistocene vertebrates of the Netherlands Antilles. Pp. 399–406, in Martin, P. S. and H. E. Wright (eds.). Pleistocene Extinctions: The Search for a Cause. Yale University Press, New Haven, Connecticut. Hooijer, D. A. and C. E. Ray. 1964. A metapodial of Acratocnus (Edentata: Megalonychidae) from a cave in Hispaniola. Proceedings of the Biological Society of Washington 77:253–258. Iturralde-Vinent, M. A. and R. D. E. MacPhee. 1999. Paleogeography of the Caribbean region: implications for Cenozoic biogeography. Bulletin of the American Museum of Natural History 238:1–95. Kraglievich, L. 1923. Descripción de dos cráneos y otros restos del género “Pliomorphus” Ameghino, procedentes de la formacion entrerriana de las Barrancas del Río Paraná. Anales del Museo Nacional de la Historia Natural, Buenos Aires 33:1–56. Kretzoi, M. 1968. New generic names for homonyms. Vertebrata Hungarica 10(1–2):163–166. Leidy, J. 1868. Notice of some vertebrate remains from the West Indian islands. Proceedings of the Academy of Natural Sciences of Philadelphia 20:178–180. MacPhee, R. D. E. 1997a. Digging Cuba: the lessons of the bones. Natural History 106(11):50–54. MacPhee, R. D. E. 1997b. Vertebrate paleontology of Jamaican caves. Pp. 47–56 in Fincham, A. (ed.). Jamaica Underground. 2nd ed. The Press University of the West Indies, Kingston, Jamaica. MacPhee, R. D. E. and D. A. Grimaldi. 1996. Mammal bones in Dominican amber. Nature 380:489–490. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1994. First Tertiary land mammal from Greater Antilles: an early Miocene sloth (Xenarthra, Megalonychidae) from Cuba. American Museum Novitates 3094:1–13. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1995. Origin of the Greater Antillean land mammal fauna, 1: new Tertiary fossils from Cuba and Puerto Rico. American Museum Novitates 3141:1–30. MacPhee, R. D. E. and M. A. Iturralde-Vinent. In press. Domo de Zaza: paleontological and geological investigations of an early Miocene vertebrate locality in south-central Cuba. American Museum Novitates. MacPhee, R. D. E. and A. R. Wyss. 1990. Oligo-Miocene vertebrates from Puerto Rico, with a catalog of localities. American Museum Novitates 2965:1–45. MacPhee, R. D. E., C. Flemming, and D. Lunde. 1999. “Last occurrence” of the Antillean insectivore Nesophontes: new radiometric dates and their interpretation. American Museum Novitates 3261:1–19. MacPhee, R. D. E., R. Singer, and M. Diamond. 2000a. Late Cenozoic fossil mammals from Grenada, Lesser Antilles Island-Arc. American Museum Novitates 3302:1–20.

230

Biogeography of the West Indies: Patterns and Perspectives

MacPhee, R. D. E., J. L. White, and C. A. Woods. 2000b. New megalonychid sloths (Phyllophaga, Xenarthra) from the Quaternary of Hispaniola. American Museum Novitates 3303:1–32. Maddison, W. P. and D. R. Maddison. 1992. MacClade: Analysis of Phylogeny and Character Evolution. Version 3.0 manual. Sinauer Associates, Sunderland, Massachusetts. Matthew, W. D. 1918. Affinities and origin of the Antillean mammals. Bulletin of the Geological Society of America 29:657–666. Matthew, W. D. 1919. Recent discoveries of fossil vertebrates in the West Indies and their bearing on the origin of the Antillean fauna. Proceedings of the American Philosophical Society 58:161–181. Matthew, W. D. 1931. Genera and new species of ground sloths from the Pleistocene of Cuba. American Museum Novitates 511:1–5. Matthew, W. D. and C. de Paula Couto. 1959. The Cuban edentates. Bulletin of the American Museum of Natural History 117:1–56. Mayo, N. A. 1969. Nueva especie de Megalonychidae y descripción de los depósitos cuaternarios de la Cueva del Vaho, Boca de Jaruco, La Habana. Memorias de la Facultad de Ciencias de la Universidad de La Habana 3:1–58. Mayo, N. A. 1978a. Ein neues Genus und zwei neue Arten fossiler Riesenfaultiere von der Familie der Megalonychidae (Edentata: Mammalia) aus dem Pleistozän Kubas. Eclogae Geologicae Helvetiae 71/3:687–697. Mayo, N. A. 1978b. Revision of Neocnus minor, Arredondo, 1961 (Edentata: Megalonychidae) from the Pleistocene of Cuba. Proceedings of the Koninklijke Nederlandse Akademie van Wetenschappen, Series B 81(3):322–338. Mayo, N. A. 1980a. Nueva especie de Neocnus (Edentata: Megalonychidae de Cuba) y consideraciones sobre la evolución, edad, y paleoecología de las especies de este género. Actas II Congreso Argentino de Paleontología y Bioestratigrafía y I Congreso Latinoamericano de Paleontología, Buenos Aires, T. III:223–236. Mayo, N. A. 1980b. Revision de Neocnus major Arredondo, 1961 (Mammalia: Edentata del Pleistoceno de Cuba) con descripciones de un cráneo y algunos huesos postcraneales. Estúdios Geológicos 36:427–440. McFarlane, D. A., R. D. E. MacPhee, and D. C. Ford. 1998. Body size variability and a Sangamonian extinction model for Amblyrhiza, a West Indian megafaunal rodent. Quaternary Research 50:80–89. McKenna, M. C. and S. K. Bell. 1997. Classification of Mammals above the Species Level. Columbia University Press, New York. Miller, G. S. 1922. Remains of mammals from caves in the Republic of Haiti. Smithsonian Miscellaneous Collections, 74(3):1–8. Miller, G. S. 1929. A second collection of mammals from caves near St. Michel, Haiti. Smithsonian Miscellaneous Collections 81(9):1–30. Miller, G. S. 1930. Three small collections of mammals from Hispaniola. Smithsonian Miscellaneous Collections 82(15):1–10. Mones, A. 1986. Palaeovertebrata sudamericana: catálogo sistemático de los vertebrados fósiles de America de Sur. Parte I. Liste Preliminar y Bibliografía. Courier Forschungsinstitut Senckenberg 82:1–625. Muizon, C. de and H. G. McDonald. 1995. An aquatic sloth from the Pliocene of Peru. Nature 375:224–227. Naples, V. L. 1987. Reconstruction of cranial morphology and analysis of function in the Pleistocene ground sloth Nothrotheriops shastense (Mammalia, Megatheriidae). Contributions in Science 389:1–21. Publication of the Natural History Museum of Los Angeles County. Page, R. D. M. and C. Lydeard. 1994. Towards a cladistic biogeography of the Caribbean. Cladistics 10:21–41. Pascual, R., M. G. Vucetich, G. J. Scillato-Yané, and M. Bond. 1985. Main pathways of mammalian diversification in South America. Pp. 219–247 in Stehli, F. and S. D. Webb (eds.). The Great American Biotic Interchange. Plenum Press, New York. Pascual, R., M. G. Vucetich, and G. J. Scillato-Yané. 1990. Extinct and Recent South American and Caribbean edentates and rodents: outstanding examples of isolation. Atti Convegni Lincei 85:627–640. Publication of Accademia Nazionale dei Lincei, Rome. Patterson, B. and R. Pascual. 1968. Evolution of mammals on southern continents: the fossil mammal fauna of South America. Quarterly Review of Biology 43:409–451. Patterson, B., W. Segall, W. D. Turnbull, and T. J. Gaudin. 1992. The ear region in xenarthrans (=Edentata, Mammalia). Part II. Pilosa (sloths, anteaters), palaeanodonts, and a miscellany. Fieldiana Geology n. s. 24:1–79. Paula Couto, C. de 1967. Pleistocene edentates of the West Indies. American Museum Novitates 2304:1–55.

The Sloths of the West Indies: A Systematic and Phylogenetic Review

231

Paula Couto, C. de 1979. Tratado de Paleomastozoologia. Academia Brasileira de Ciências, Rio de Janeiro. Pregill, G. K. and B. I. Crother. 1999. Ecological and historical biogeography of the Caribbean. Pp. 335–356 in Crother, B. I. (ed.). Caribbean Amphibeans and Reptiles. Academic Press, San Diego, California. Rosen, D. E. 1975. A vicariance model of Caribbean biogeography. Systematic Zoology 24:431–464. Scillato-Yané, G. J. 1977. Nuevo Megalonychidae (Edentata, Tardigrada) de edad Chasiquense (Plioceno temprano) del sur de la provincia de Buenos Aires (Argentina). Su importancia filogenetica, bioestratigrafica y paleobiogeografica. Revista de la Asociacion de Ciencias Naturales del Litoral 8:45–54. Scillato-Yané, G. J. 1979. El más antiguo Megalonychinae (Edentata, Tardigrada, Megalonychidae) conocido: Holomegalonyx menendezi n. gen., n. sp., del Colhuehuapense (Oligoceno tardio) de Gaiman (Provincia de Chubut, Argentina). Ameghiniana 14:311–312. Scillato-Yané, G. J. 1980. Nuevo Megalonychidae (Edentata, Tardigrada) del “Mesopotamiense” (Mioceno tardio-Plioceno) de la Provincia de Entre Ríos. Ameghiniana 17:193–199. Simpson, G. G. 1945. The principles of classification and a classification of the mammals. Bulletin of the American Museum of Natural History 85:1–350. Swofford, D. L. 1998. PAUP* 4.0. Phylogenetic Analysis Using Parsimony (*and other methods). Sinauer Associates, Sunderland, Massachusetts. Torre, C. de la and W. D. Matthew. 1915. Megalocnus and other Cuban ground sloths. Bulletin of the Geological Society of America 26:152. Varona, L. S. 1974. Catálogo de los mamíferos vivientes y extinguidos de las Antillas. Academia de Ciencias de Cuba, La Habana. Varona, L. S. 1976. Reemplazo de Cubanocnus por Neocnus (Mammalia: Edentata). Miscelanea Zoologica 2:4. Webb. S. D. 1985. The interrelationships of tree sloths and ground sloths. Pp. 105–112 in Montgomery, G. G. (ed.). The Evolution and Ecology of Armadillos, Sloths, and Vermilinguas. Smithsonian Institution Press, Washington, D.C. Webb, S. D. and S. Perrigo. 1985. New megalonychid sloths from El Salvador. Pp. 113–120 in Montgomery, G. G. (ed.). The Evolution and Ecology of Armadillos, Sloths, and Vermilinguas. Smithsonian Institution Press, Washington, D.C. Wetzel, R. M. 1985. The identification and distribution of recent Xenarthra (= Edentata). Pp. 5–21 in Montgomery, G. G. (ed.). The Evolution and Ecology of Armadillos, Sloths, and Vermilinguas. Smithsonian Institution Press, Washington, D.C. White, J. L. 1993a. Functional and Phylogenetic Implications of the Postcranial Skeleton of Fossil Sloths for the Evolution of Arboreality in Tree Sloths. Ph.D. dissertation, State University of New York at Stony Brook, New York. White, J. L. 1993b. Phylogenetic implications of the postcranial skeleton in sloths. Journal of Vertebrate Paleontology, 13(Supplement 3):62A. White, J. L., R. D. E. MacPhee, and C. A. Woods. 1996. Hispaniolan sloths: phylogeny and functional morphology. Journal of Vertebrate Paleontology 16(Supplement 3):72A. Williams, E. E. 1989. Old problems and new opportunities in West Indian biogeography. Pp. 1–46 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Woods, C. A. 1989. A new capromyid rodent from Haiti: the origin, evolution, and extinction of West Indian rodents, and their bearing on the origin of New World hystricognaths. Pp. 59–90 in Black, C. C. and M. R. Dawson (eds.). Papers on Fossil Rodents in Honor of Albert Elmer Wood. Scientific Series of the Natural History Museum of Los Angeles County 33. Woods, C. A. 1990. The fossil and recent land mammals of the West Indies: an analysis of the origin, evolution, and extinction of an insular fauna. Atti Convegni Lincei 85:641–680. Publication of Accademia Nazionale dei Lincei, Rome.

232

Biogeography of the West Indies: Patterns and Perspectives

NOTE ADDED IN PROOF Since this chapter was sent to press, it has come to our attention that two new genera of megalonychids from Cuba have recently been formally named: Galerocnus jaimezi Arredondo and Rivero, 1997,* and Paramiocnus riveroi Arredondo and Arredondo, 2000.** Each new taxon is based on a single element. We will not attempt to assess the phylogenetic position of these taxa until we are able to study the original material.

* Arredondo, C. and M. Rivero. 1997. Nuevo genero y especie de Megalonychidae del Cuaternario Cubano. Revista Biologia 11:105–112. ** Arredondo, C. and O. Arredondo. 2000. Nuevo genero y especie de perezoso (Edentata: Megalonychidae) del Pleistoceno de Cuba. Revista Biologia 14(1):66–72.

The Sloths of the West Indies: A Systematic and Phylogenetic Review

233

APPENDIX I: CHARACTERS AND CHARACTER STATES All characters are unordered and weighted equally. Characters marked with an asterisk (*) are uninformative and were excluded from the analysis. Characters 67 through 75 were defined by Gaudin (1995). 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44.

sagittal crest: (0) absent; (1) single; (2) double/bifid postorbital constriction: (0) none; (1) moderate; (2) prominent cranial height: (0) flat; (1) domed; (2) significantly and irregularly domed rostrum mediolateral flare: (0) none; (1) slight; (2) very flared airorrhynchy (basicranial flexion): (0) none; (1) posteriorly flexed ventrally upper C1 (=M1): (0) strongly triangular; (1) mildly triangular; (2) rodentiform; (3) peglike; (4) lost upper M2: (0) anterolaterally convex; (1) anterolaterally concave; (2) none upper M5: (0) medially narrow; (1) medially wide; (2) oval; (3) none lower c1 (=m1): (0) triangular; (1) lingually concave; (2) meniscoid; (3) peglike; (4) none lower m2: (0) subtriangular; (1) subquadrate; (2) oval; (3) meniscoid; (4) none lower m4 lingual surface: (0) convex; (1) grooved; (2) multilobed; (3) none spout: (0) none; (1) pointed and short; (2) long and narrow; (3) spatulate; (4) huge condyles relative to toothrow: (0) slightly above; (1) very high caniniform relative to edge of maxilla: (0) at edge; (1) not at edge tooth row convergence: (0) parallel; (1) posterior; (2) anterior; (3) no teeth coronoid relative to condyle: (0) superior; (1) not superior; (2) absent maxillary/mandibular diastema: (0) long; (1) none; (2) short rectus femoris tubercle: (0) not prominent; (1) prominent; (2) forming a lip that projects laterally at nearly a right angle to the acetabulum acetabular rim: (0) significant gap; (1) tiny or absent gap femoral head: (0) spherical; (1) nonspherical; (2) large and globular femoral neck orientation: (0) proximal; (1) anterior; (2) medial femoral head fovea: (0) centric; (1) on posterior margin; (2) absent femoral shaft torsion; (0) none; (1) slight; (2) extreme third trochanter: (0) none; (1) forms lateral crest; (2) huge and confluent with greater trochanter greater trochanter: (0) inferior to head; (1) level with head; (2) superior to head well-developed anterior prong on femoral shaft: (0) no; (1) yes lesser trochanter: (0) nearly absent; (1) low, gentle bump; (2) conspicuous protrusion femoral shaft: (0) anteroposteriorly flat; (1) cylindrical; (2) proximally flat, distally round tibial shaft: (0) straight; (1) bowed separation of tibial articular surface: (0) anterior edge only; (1) slight; (2) distinct; (3) none proximal fibular facet of tibia: (0) posterolateral; (1) posterior; (2) lateral quadriceps femoris tubercle: (0) bump; (1) long scar; (2) hook with groove fibular shaft: (0) straight; (1) bowed calcaneal tuberosity expansion: (0) posterior; (1) posteromedial; (2) mediovolar; (3) volar calcaneal tuberosity ventral excavation: (0) no; (1) yes calcaneal tuberosity shape: (0) symmetrical and thick; (1) J-shaped; (2) symmetrical and waisted; (3) triangular tarsus: (0) serial; (1) alternate astragalar neck: (0) very short; (1) long and narrow navicular facet of astragalus: (0) concave; (1) flat; (2) convex astragalar trochlea: (0) wedge; (1) parallel and single surfaced; (2) well divided asymmetrically; (3) well divided symmetrically fibular facet of astragalus: (0) flat; (1) crescentic and slightly concave; (2) funnel-shaped ball and socket; (3) complete ball and socket medial trochlea of astragalus: (0) long and convex; (1) short and convex; (2) short and odontoid; (3) concave; (4) reduced anterior scapular border: (0) rounded; (1) ventrally concave inferior scapular angle: (0) round/obtuse; (1) acute; (2) has extra flange; (3) square

234

45. 46. 47. 48. 49. 50. 51. 52. 53. 54. 55. 56. 57. *58. *59. *60. *61. *62. 63. 64. 65. 66. 67. *68. 69. 70. 71. 72. 73. 74. 75.

Biogeography of the West Indies: Patterns and Perspectives

scapular spine: (0) does not diverge at vertebral border; (1) diverges at vertebral border prescapular (=supraspinous) vs. postscapular (=infraspinous) fossa: (0) larger; (1) equal; (2) smaller deltoid and pectoral crests: (0) confluent; (1) do not join humeral trochlea: (0) flares distally; (1) not as distal as capitulum humeral head: (0) spherical; (1) flat; (2) globular; (3) mediolaterally narrow entepicondylar foramen: (0) present; (1) absent entepicondylar foramen visible posteriorly: (0) yes; (1) no; (2) absent entepicondylar bridge knob: (0) present; (1) absent supracondylar ridge: (0) prominent; (1) gentle pronator quadratus flange of radius: (0) abrupt lateral crest; (1) minimal crest; (2) posterior; (3) gentle, reduced lateral crest radial distal articular surface: (0) smooth; (1) irregular ulnar shaft: (0) straight; (1) bowed sigmoid notch of ulna: (0) wide with huge coronoid process; (1) segmented and shallow; (2) unsegmented and shallow dentition: (0) more than 7 upper and lower teeth; (1) 5 upper and 4 lower or fewer; (2) absent coracoscapular foramen: (0) absent; (1) present zygomatic arch: (0) complete; (1) complete but not fused; (2) incomplete tibia and fibula fusion: (0) yes; (1) no premaxilla: (0) large with extensive contact with nasals; (1) reduced with small nasal contact; (2) reduced with no nasal contact mandibular symphysis: (0) not well fused; (1) well fused optic foramen within sphenorbital fissure: (0) no; (1) yes acromion and coracoid form complete arch: (0) no; (1) yes pterygoid inflation: (0) absent; (1) present tympanic external surface: (0) smooth; (1) rugose entotympanic participation in tympanic cavity floor: (0) rudimentary or absent; (1) weak participation in medial portion of floor; (2) strong, forming almost entire medial half of floor glenoid position relative to superficies meatus [defined as “the groove on the ventral surface of the squamosal lateral and dorsal to the tympanum” by Patterson et al. (1992)]: (0) at or above meatus; (1) ventral to meatus glenoid posterior shelf: (0) absent; (1) present direction of root of zygoma: (0) anterior; (1) anterolateral; (2) lateral entotympanic participation in sulcus for internal carotid artery: (0) forms lateral wall of sulcus; (1) forms lateral wall and at least part of the roof; (2) forms lateral wall, roof, and has medial ridge forming at least part of medial wall paroccipital process: (0) weakly developed or rudimentary; (1) well-developed; (2) greatly enlarged, free-standing process pterygoid lateral groove: (0) absent; (1) present shape of glenoid: (0) elongate anteroposteriorly; (1) hemispherical; (2) widened mediolaterally

The Sloths of the West Indies: A Systematic and Phylogenetic Review

235

APPENDIX II: LIST OF TAXA USED IN CLADISTIC ANALYSIS For the Antillean sloth taxa, specimens were included in accordance with the systematic revision presented in this chapter. Therefore, some specimens were reallocated by us from their initial designations, and taxonomic names reflect our reorganization. Distributions are presented for Antillean fossil sloth taxa only. See Gardner (1993) for distributions of extant taxa and McKenna and Bell (1997) for distributions of other fossil taxa.

OUTGROUP TAXA Dasypus novemcinctus (Family Dasypodidae) Tamandua tetradactyla (Family Myrmecophagidae)

EXTANT INGROUP TAXA Bradypus tridactylus Choloepus didactylus

EXTINCT INGROUP TAXA Acratocnus antillensis (Cuba) A. ye (Hispaniola) A. odontrigonus (Puerto Rico) Megalocnus rodens (Cuba) M. zile (Hispaniola) Neocnus major (Cuba) N. gliriformis (Cuba) N. comes (Hispaniola) N. dousman (Hispaniola) N. toupiti (Hispaniola) Parocnus browni (Cuba) P. serus (Hispaniola) Paulocnus petrifactus (Curaçao) Hapalops longiceps Paramylodon harlani

Origin of the Greater 15 The Antillean Insectivorans Howard P. Whidden and Robert J. Asher Abstract — The origin of the endemic Antillean insectivorans Solenodon and Nesophontes has been a subject of considerable debate. We evaluate the main biogeographical hypotheses that have been proposed for these taxa in the light of recent phylogenetic, paleontological, and geological evidence. Recent phylogenetic analyses conflict with one another in many ways, but they provide little support for origin from a North American soricid ancestor. At least four hypotheses appear viable: origin by (1) overwater dispersal of a species related to some early Tertiary North American insectivoran (such as Apternodus or Centetodon); (2) vicariance of an early Tertiary North American insectivoran on a Western Jamaica Block, with subsequent overwater dispersal to the other islands of the Greater Antilles; (3) dispersal of a Gondwanan zalambdodont insectivoran directly from Africa to the Greater Antilles; and (4) dispersal of a Gondwanan zalambdodont insectivoran across a GAARlandia land span from northwestern South America, with subsequent vicariance as GAARlandia broke up. The relationship between Solenodon and Nesophontes is unclear, and it is possible that their distributions in the Greater Antilles are the results of different mechanisms.

INTRODUCTION The islands of the West Indies are home to two unusual and endemic genera of insectivorans, Solenodon Brandt, 1833 and Nesophontes Anthony, 1916. Solenodon contains two extant species, S. paradoxus from Hispaniola and S. cubanus from Cuba (Hutterer, 1993). In addition to these extant species, Patterson (1962) described S. marcanoi on the basis of fossil remains from Hispaniola, and Morgan and Ottenwalder (1993) described S. arredondoi on the basis of fossil remains from Cuba. The eight currently recognized species of Nesophontes are known from Puerto Rico, Cuba, and Hispaniola (Hutterer, 1993); two additional undescribed species are reported from the Cayman Islands (Morgan, 1994). Although there have been suggestions that Nesophontes survived into the 20th century (Nowak and Paradiso, 1983; Morgan and Woods, 1986), a recent study concluded that the genus has probably been extinct for several hundred years (MacPhee et al., 1999b). Both the degree of affinity between Solenodon and Nesophontes and their relationships to other insectivorans have never been well established. Despite some osteological similarity between Solenodon and Nesophontes, differences in their molar cusp patterns have led many zoologists to place them in taxonomically disparate groups. Because Solenodon has zalambdodont upper molars, like tenrecids and chrysochlorids (Figures 1a–c; Maier, 1985), most early workers (e.g., Peters, 1863; Dobson, 1882–1890; Allen, 1910; Winge, 1941) considered it to be allied with these Old World zalambdodonts. In contrast, Nesophontes had dilambdodont upper molars, like soricids and talpids (Figures 1d–f), and this led Anthony (1916) to argue that it had affinities with the Soricidae rather than with Solenodon; he placed in its own family, the Nesophontidae. However, Allen (1918) noted several similarities in the skulls of Solenodon and Nesophontes, and he argued that the two genera were closely related. Allen also disputed Anthony’s claim of soricid affinities for Nesophontes, and held instead that both genera were probably related to tenrecids and chrysochlorids. In a detailed monograph on the two Antillean genera, McDowell (1958) also stressed their osteological similarity, and he argued that they were closely related. Like Allen, McDowell placed the two genera in the same family (Solenodontidae), but he allied them with the Soricidae rather than with the Tenrecidae. Most recent classifications (e.g., Simpson, 1945; Miller and Kellogg, 1955; Hutterer, 1993; McKenna and Bell, 1997) have placed these genera in separate families. Van Valen (1967) went so 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

237

238

Biogeography of the West Indies: Patterns and Perspectives

a. Solenodon

b. Chrysochloris

c. Microgale

d. Nesophontes

e. Uropsilus

f. Sylvisorex

FIGURE 1 Molar cusp patterns of insectivorans: (a–c) zalambdodont, (d–f) dilambdodont. (a, d, e, and f after Butler, 1988; b after Maier, 1985; and c after Gregory, 1910.)

far as to place the Nesophontidae near the Soricidae in the order Insectivora, and the Solenodontidae near the Tenrecidae in the order Deltatheridia (although elsewhere in the same paper, p. 276, he remarks that a special relationship between Solenodon and Nesophontes is equally likely). In this chapter, we use the terms “insectivoran” and “lipotyphlan” synonymously. Both terms refer to the six extant families of insectivorans — chrysochlorids, erinaceids, solenodontids, soricids, talpids, and tenrecids — as well as such extinct lineages as Nesophontes, apternodontids, and geolabidids. However, we recognize that several recent studies have argued against the monophyly of these taxa (e.g., Springer et al., 1997; Stanhope et al., 1998; van Dijk et al., 2001; Madsen et al., 2001; Murphy et al., 2001).

RECENT PHYLOGENETIC STUDIES Until recently, interpretations of the phylogenetic affinities of Solenodon and Nesophontes were largely subjective, without explicit analyses to back them up. However, in the past several years, a number of studies have addressed the issue of insectivoran relationships more rigorously and more explicitly. These studies have employed cladistic and other modern phylogenetic methods of analysis, and they have utilized both molecular and morphological data.

MOLECULAR EVIDENCE Several recent studies have used DNA sequence data to examine the phylogenetic relationships of insectivorans. These studies have been concerned both with the placement of insectivorans in Mammalia and with the interrelationships of the insectivoran families. Sequence data are available primarily for extant taxa and and have not been used to address either the relationship between Solenodon and Nesophontes or possible affinities between these taxa and such extinct lineages as apternodontids or geolabidids. However, a number of the molecular studies have included an array of insectivoran taxa and therefore are relevant to the biogeographical history of the Greater Antillean taxa.

The Origin of the Greater Antillean Insectivorans

239

Studies using sequence data have been nearly unanimous in concluding that the order Lipotyphla (= Insectivora) is not monophyletic (e.g., Springer et al., 1997; Stanhope et al., 1998; Emerson et al., 1999; Liu and Miyamoto, 1999; Mouchaty et al., 2000). These studies have also generally held that chrysochlorids and tenrecids are part of an African mammal clade (the Afrotheria) that also includes elephants, hyraxes, sirenians, elephant shrews, and aardvarks. In addition, molecular clock estimates based upon the sequence data indicate that the Afrotheria has been separate from other eutherian lineages for more than 90 million years (Springer et al., 1997; Stanhope et al., 1998). This implies that tenrecids and chrysochlorids have been separate from Solenodon and Nesophontes for at least as long (although divergence estimates based on a molecular clock have been disputed, e.g., Foote et al., 1999). The two published molecular analyses that have incorporated sequences from Solenodon have come to different conclusions about its affinities. Analyzing mitochondrial genes for 12S rRNA, 16S rRNA, and valine tRNA, Stanhope et al. (1998; fig. 1) found weak support (51% of bootstrap replicates in a neighbor-joining analysis) for a clade in which Solenodon is sister taxon to soricids and talpids (Figure 2a). In contrast, an analysis with greater taxonomic sampling but based strictly upon sequences of the mitochondrial gene for 12S rRNA (Emerson et al., 1999) found no support for a soricid-talpid-Solenodon clade, and instead discovered weak support for Solenodon as sister to a clade of rodents (Figure 2b). Despite the apparent strength of the molecular support for Afrotheria, some authors have been cautious in their acceptance of the group. In their analyses of sequences from nuclear (IRBP and vWF) and mitochondrial (12S rRNA) genes, and also in combined analyses of molecular and morphological data, Liu and Miyamoto (1999) found support for Afrotheria, but they also noted that the inclusion of African insectivorans was the weakest part of the group’s definition. Emerson et al.’s (1999) strict consensus tree from 12S rRNA sequences supported an African clade that included not only chrysochlorids and tenrecids, but also the Southeast Asian primate Tarsius, an arrangement that few zoologists would take seriously. Emerson et al. (1999) went on to note that the 12S rRNA data set was able to recover relatively few interordinal groupings, and that most of the ones that were recovered were not well supported. Consequently, they concluded that 12S rRNA sequences might lack the ability to resolve basal relationships within Eutheria. Also, when Stanhope et al.’s (1998) data (alignment ds34832 available at ftp://ftp.embl-heidelberg.de/pub/databases/embl/align/) are analyzed using other sequence alignments and tree-reconstruction techniques (including parsimony), the support for Solenodon being a sister taxon to soricids and talpids disappears (Asher, 2000).

MORPHOLOGICAL EVIDENCE Asher (1999b) presented a cladistic morphological analysis that directly addresses the phylogenetic placement of Solenodon and Nesophontes. Asher used 193 morphological character states from 35 living and extinct taxa, and his study was designed to test hypotheses of insectivoran relationships under different sets of assumptions for character weighting, treatment of missing data, and character ordering. The results of the analysis were ambiguous about lipotyphlan monophyly but unambiguous about rejecting the African clade: neither the set of most-parsimonious trees (MPTs) nor the 256,000 suboptimal trees that Asher evaluated contained a topology supporting an African clade. The morphological analysis also did not support McDowell’s (1958) proposed association of soricids as the sister group to Solenodon and Nesophontes; this grouping was not present in any of the MPTs, and it was found in only a few suboptimal trees. However, in the most parsimonious result for one of Asher’s eight assumption sets, Nesophontes appears alone as the sister group to soricids. Also, although Nesophontes and Solenodon were not sister taxa in any of the MPTs, for some assumption sets such a relationship required only one additional step. A topology consistently present among Asher’s MPTs, but without strong branch or bootstrap support, places Solenodon and Apternodus (and in most cases Nesophontes) as successively distant sister taxa to the Tenrecidae and usually Chrysochloridae (Figure 2c). This arrangement is in general

240

Biogeography of the West Indies: Patterns and Perspectives

a

Solenodon mole shrew Perissodactyla Carnivora Chiroptera Cetacea Ruminantia pangolin Xenarthra aardvark elephant shrew tenrec golden mole elephant manatee hyrax Primates hedgehog rabbit myomorph rodents caviomorph rodents Metatheria platypus

c

b

Solenodon myomorph rodents pangolin Megachiroptera mole flying lemur Primates* Microchiroptera dormice rabbit tree shrew armadillo caviomorph rodents Perissodactyla Suiformes Cetacea Ruminantia shrew Carnivora aardvark tarsier elephant shrew tenrecs golden mole Proboscidea Sirenia hyrax hedgehogs Metatheria

tenrecs golden moles

†Apternodus Solenodon †Nesophontes †Centetodon moles shrew hedgehogs

†Leptictis tree shrew hyrax Carnivora aardvark Xenarthra Metatheria

FIGURE 2 Cladograms from recent phylogenetic analyses that have included Solenodon, modified to emphasize the positions of Solenodon and other insectivorans. Taxa from generally accepted clades (for example, those recognized in Anderson and Jones, 1984) have been lumped together; the names of these clades begin with a capital letter. (a) Majority-rule neighbor joining bootstrap tree from Stanhope et al. (1998); (b) Strict consensus tree from Emerson et al. (1999); (c) Majority rule tree of the eight MPTs from Asher (1999b). *Primates is paraphyletic in this cladogram. † = extinct.

The Origin of the Greater Antillean Insectivorans

241

FIGURE 3 Reconstructed ventral view of the ear region of Apternodus. Dotted line represents suture between petrosal and basisphenoid/basioccipital. Rostral is at top, medial is at right. (Adapted from McDowell, 1958.)

agreement with claims that the Caribbean insectivorans have an African sister taxon. In addition, it adds the interesting twist that Apternodus, an early Tertiary North American taxon, may also be related to the extant Afro-Malagasy zalambdodonts (i.e., tenrecids and chrysochlorids). The placement of Apternodus in a clade with Solenodon and other lipotyphlans challenges McDowell’s (1958) conclusion that Apternodus played no part in the evolutionary history of Caribbean insectivorans. McDowell had argued that living insectivorans possess a conservative arterial pattern in the middle ear. Based largely on his interpretation that it departed from this pattern, he concluded that Apternodus is more likely to be related to the extinct carnivoran-like Creodonta than to living insectivorans. Specifically, “… the course of the internal carotid artery through the tympanic cavity is quite characteristic of the Lipotyphla … Indeed, although at one time [McDowell] searched diligently for differences between families in tympanic arterial pattern, he has been unable to discover any notable departures from this pattern among the Lipotyphla … Apternodus, however, shows a very different arterial pattern from that of the Lipotyphla, being perhaps more like that of creodonts in this regard” (p. 168). Many aspects of soft-tissue reconstruction in McDowell’s paper are accurate — an impressive feat, given that his reconstructions were based primarily on dry skulls. However, McDowell overestimated the conservatism of the arterial pattern through the middle ear of insectivoran-grade mammals. Furthermore, there is now better material with which to reconstruct middle ear vasculature in Apternodus than he had available in the 1950s. Figure 3 shows McDowell’s arterial reconstruction of Apternodus, based on the type specimen of A. brevirostris (AMNH 22466). He is correct in stating (p. 168) that the promontory of AMNH 22466 is “quite smooth,” and he is probably also correct in noting a very shallow groove for the stapedial artery. Compared to the vasculature of Solenodon paradoxus, reconstructed by MacPhee (1981) from a histologically sectioned individual (Figure 4), the promontory artery of Apternodus as reconstructed by McDowell travels much more medially, near the petrosal-basisphenoid suture. This medial course led McDowell to compare the arterial pattern of Apternodus to that of the

242

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 4 Reconstructed ventral view of the ear region of Solenodon. Dotted line represents suture between petrosal and basisphenoid/basioccipital. Bifurcation of the proximal stapedial artery actually takes place within the braincase in this specimen of Solenodon. Rostral is at top, medial is at right. (Adapted from MacPhee, 1981.)

oxaenid creodont Patriofelis (Denison, 1938), and to conclude that Apternodus exhibited an arterial pattern outside the range of variation seen among insectivorans. In fact, the type specimen of A. brevirostris shows very slight grooves for middle ear vasculature, and these grooves are also visible in several well-preserved Apternodus skulls with basicrania that have been discovered since McDowell’s paper was published (e.g., AMNH 74941, 74943; FMNH 1690; MPUM 6855). These grooves permit only the general conclusion that Apternodus possessed promontory and stapedial arterial distributaries. Details on the spatial relations of specific arteries based on these specimens are much more tentative. Another Apternodus basicranium, AMNH 74942, shows more clearly than other specimens a groove coursing medially from the vestibular fenestra (housing the footplate of the stapes) to the ventral apex of the promontory bone, presumably for the proximal stapedial artery. Close to the apex, this groove is met by another traveling anteriorly (for the promontory artery), and continues a short distance medially (for the internal carotid proximal to the promontory-stapedial bifurcation). The groove for the promontory artery courses farther lateral to the petrosal-basisphenoid suture than that seen in McDowell’s reconstruction for the A. brevirostris type specimen. This indicates either that Apternodus was polymorphic in the course of its promontory artery along the petrosal, or that McDowell’s reconstruction was incorrect. Since McDowell’s 1958 work, considerable progress has been made in understanding the morphology and development of the cranial vasculature in mammals. For example, several researchers (e.g., Presley, 1979; MacPhee, 1981; Wible, 1984, 1987) have questioned the argument (made by Gregory, 1910) that primitive eutherians possessed both medial and lateral entocarotid arteries. These recent workers have recognized considerable vascular diversity among mammals, and they have also noted that middle ear vessels vary in course throughout the ontogeny of an individual. Bugge (1974), for example, reported that Tenrec ecaudatus lacks an inferior stapedial ramus altogether; this is in direct contrast to McDowell’s assertion (p. 168) based on dry skulls that “in Tenrec the ramus inferior follows the normal lipotyphlan course.” Asher (1999a, 2000) has also documented the lack of a ramus inferior in multiple individuals of Tenrec and Hemicentetes, confirming previous work by Bugge (1974) on Tenrec and Hemicentetes and by MacPhee (1981) on Hemicentetes. Additional

The Origin of the Greater Antillean Insectivorans

243

arterial variants among tenrecids include the reduced superior stapedial artery of Potamogale and the intracranial stapedial bifurcation of Geogale (Asher, 1999a, 2000). Furthermore, among extant insectivorans the course of the promontory artery varies from a medial course, near the petrosal-basisphenoid suture (e.g., Microgale; MacPhee, 1981; Asher, 2000), to a lateral one, entering the braincase lateral to the anterior pole of the petrosal bone (e.g., Chrysochloris; Asher, 1999a, 2000). In sum, it is unlikely that Apternodus possessed a promontory artery that traveled any more medially than that of extant tenrecids; also, extant insectivorans are much more variable in their cranial arterial supply than McDowell estimated. Thus, the main reason given by McDowell (1958) for removing Apternodus from consideration in insectivoran phylogeny is invalid.

BIOGEOGRAPHICAL HYPOTHESES Over the years, a variety of hypotheses have been proposed to account for the presence of Solenodon and Nesophontes in the West Indies. These hypotheses have been concerned primarily with the phylogenetic affinities and possible ancestors of the Antillean taxa, but they have also speculated on the routes that the animals may have used to get to the Antilles and on the time of their arrival in the islands. We depict these hypotheses graphically in Figure 5a–d, and summarize them as follows: 1. McDowell (1958) rejected possible affinities between the Antillean taxa and either AfroMalagasy tenrecids or North American Tertiary taxa such as Apternodus and Palaeoryctes, and he argued instead for a relationship with the Soricidae. He held that Solenodontidae (including both Solenodon and Nesophontes) was derived from an unknown tropical North American Tertiary “soricoid” ancestor (his “Soricoidea” did not include talpids). McDowell did not specify how this ancestor arrived in the Antilles; we assume that he envisioned overwater dispersal (Figure 5a). 2. Patterson (1962) held that Solenodon derived from a relatively unspecialized apternodontid living on the Central American peninsula during the first half of the Tertiary (Figure 5b). Rafting to the Antilles may have taken place in the later Eocene, at roughly the same time as the hypothesized rafting of caviomorphs and platyrrhine primates from South America to the Antilles. Patterson apparently did not consider Solenodon to be closely related to Nesophontes, and he did not discuss the biogeographical origin of Nesophontes. Simpson (1956) had put forth a similar explanation, although he was less specific in his statement of relationships, suggesting only that the Antillean genera had affinities to unspecified North American Tertiary insectivorans. 3. Hershkovitz (1972) claimed that both Nesophontes and Solenodon are zalambdodont insectivorans (despite the dilambdodont molars of Nesophontes), and that they are most likely related to tenrecids. These presumed African affinities, plus the absence of near relatives in the Americas, suggested to him a late Cretaceous to early Tertiary Gondwanan origin for the lineage, with overwater dispersal to the Antilles. He may have envisioned a direct crossing from Africa to the Greater Antilles, but he is vague enough to leave open the possibility of dispersal from Africa to South America and from there to the Greater Antilles (Figure 5c). As further support for this hypothesis, Hershkovitz noted the strong African affinities and presumed African origin of the South American primates and hystricomorphous (caviomorph) rodents. 4. MacFadden (1980) built upon the ideas of Rosen (1975) to present a vicariance explanation for the Antillean presence of Solenodon and Nesophontes. MacFadden (1980) accepted McDowell’s (1958) hypothesis that the Caribbean insectivorans comprise sister taxa that were derived from a continental North American taxon. However, he differed from McDowell in considering the Recent Antillean insectivorans to be close relatives of North American fossil forms such as Apternodus, and he explained the presence of

244

Biogeography of the West Indies: Patterns and Perspectives

Early Cenozoic

a North America Nuclear Central America overwater dispersal of shrew-like form

Eurasia

Greater Antilles

South America

Africa

Early Cenozoic

b

later extinction of North American zalambdodont forms

North America Nuclear Central America overwater dispersal

Eurasia

Greater Antilles

South America

Africa

FIGURE 5 Graphic representations of four biogeographical hypotheses for the origin of the Greater Antillean insectivorans. (a) McDowell (1958); (b) Patterson (1962); (c) Hershkovitz (1972); (d) MacFadden (1980). (After MacFadden, 1980, and Mouchaty, 1999.)

the living taxa in the Antilles as being the result of plate tectonic movements. Under this hypothesis, at some point during the early Tertiary, one or more proto-Antillean islands carried an Apternodus-like ancestor eastward from southern North America (Figure 5d). Once in the Antilles, this form then dispersed between islands and underwent allopatric speciation, resulting in Solenodon and Nesophontes.

The Origin of the Greater Antillean Insectivorans

245

Early Cenozoic

c North America

Eurasia

Nuclear Central America Greater Antilles

South America

Late Mesozoic

dispersal of zalambdodont when South Atlantic was narrower

Africa

Early Cenozoic

d North America Nuclear Central America ProtoAntilles

South America

North America Nuclear Central America Greater eastward movement of Antilles Caribbean Plate

South America

Later Cenozoic extinction of North American zalambdodont forms

North America Nuclear Central America Lower Central America

Greater Antilles

South America

FIGURE 5 (continued )

We do not believe that the evidence is currently at hand to resolve the question of the biogeographical history of Solenodon and Nesophontes. Despite the recent attention from both molecular and morphological systematists, higher-level relationships among lipotyphlans remain largely unresolved, and the phylogenetic affinities of Antillean insectivorans remain a mystery. However, not all of the proposed biogeographical hypotheses are consistent with the recent phylogenetic, paleontological, and geological data. In the section below, we use the new data to assess the four hypotheses of origin stated above, and we also propose an additional hypothesis.

246

Biogeography of the West Indies: Patterns and Perspectives

MCDOWELL (1958) McDowell’s hypothesis, which calls for derivation of both Solenodon and Nesophontes from a North American shrewlike ancestor, received little support from the previously cited phylogenetic analyses. Neither molecular nor morphological analyses found a special relationship between Solenodon, Nesophontes, and soricids. Stanhope et al. (1998) did find weak support for an association between Solenodon and soricids, but Solenodon was sister taxon to a soricid-talpid clade, not just to soricids as McDowell had argued. Also, as mentioned previously, even this support disappears with a parsimony analysis of their data set. Therefore, we believe that McDowell’s hypothesis for the origin of the Antillean insectivorans can be rejected.

PATTERSON (1962) Asher’s (1999b) morphological analysis found support for affinities between Solenodon and Nesophontes and extinct North American insectivorans such as Apternodus and Centetodon, and therefore there is phylogenetic evidence that is consistent with this hypothesis. Reconstructions of paleoceanographic currents suggest that the most plausible mode of overwater dispersal from North America or Central America to the Greater Antilles would be rafting in the Loop Current of the Gulf of Mexico. In the mid-Tertiary, the Loop Current flowed north across the tip of the Yucatan Peninsula, circled in the eastern Gulf of Mexico, and then flowed down the western coast of the Florida peninsula and through the Straits of Florida to join the Gulf Stream (Mullins et al., 1987; IturraldeVinent and MacPhee, 1999). The most likely arrival point in the Greater Antilles for organisms transported by this current would therefore be the landmasses at present associated with the northern coast of Cuba. If this mechanism is correct, it is somewhat surprising that other North American mammals did not reach the Greater Antilles in a similar fashion. Other mammalian lineages that are common in the North American Tertiary, such as carnivorans, ungulates, and marsupials, are completely absent from the known record for the Antilles (with the exception of the recent discovery of Hyrachyus; see below). In addition, muroid rodents were well diversified in North America by the end of the Miocene (Baskin, 1986; Korth, 1994). This group of rodents is noted for its overwater dispersal abilities (Darlington, 1957; Baskin, 1986), yet apparently none of them dispersed to the Greater Antilles until sigmodontine rodents made it to Jamaica in the Pleistocene (Morgan and Woods, 1986; Woods, 1989). Also, despite the fact that apternodontids are present in the early Tertiary of western and central North America, there are no relevant fossils from Central America or the southeastern United States, the most likely points of departure.

HERSHKOVITZ (1972) We noted above that molecular phylogenetic analyses support an association of chrysochlorids and tenrecids with an African mammal clade that also includes elephants, sirenians, hyraxes, elephant shrews, and aardvarks. If this placement is correct, it would preclude any direct association between Solenodon and the Old World zalambdodonts, and it would therefore contradict Hershkovitz’s hypothesis that the Antillean insectivorans were derived from a zalambdodont taxon that crossed the Atlantic from Africa. However, tenrecoid affinities for Solenodon and Nesophontes do receive support from the morphological analysis: most of the MPTs in Asher’s analysis included Apternodus, Solenodon, and Nesophontes as successively distant sister taxa to tenrecids. Therefore, we believe that a Gondwanan origin for Solenodon and Nesophontes remains a viable hypothesis. Hershkovitz held that this African zalambdodont insectivoran crossed the South Atlantic roughly contemporaneously with the hypothesized dispersal of caviomorph rodents and platyrrhine monkeys (e.g., Hoffstetter, 1980; Lavocat, 1980; Aiello, 1993; George, 1993). We feel that this explanation cannot be ruled out.

The Origin of the Greater Antillean Insectivorans

247

MACFADDEN (1980) Although MacFadden’s hypothesis of affinities between the Antillean insectivorans and Tertiary North American taxa receives support from Asher’s (1999b) analysis, classic continent–island vicariance, originally proposed by Rosen (1975) and hypothesized specifically for Solenodon and Nesophontes by MacFadden (1980), is not supported by the recent geological evidence. Recent interpretations of the geological history of the Caribbean indicate that permanent subaerial landmasses were not present in the area until the beginning of the late Eocene, which is long after elements of the Caribbean plate had separated from North America (Robinson, 1994; IturraldeVinent and MacPhee, 1999). Thus, even if ancestral insectivorans had been carried out into the Caribbean on a “proto-Antilles” island in the late Mesozoic, they almost certainly could not have survived there because repeated subsidence and transgression events completely submerged any islands that may have existed prior to the late Eocene (Iturralde-Vinent and MacPhee, 1999). However, a variant of this vicariance hypothesis may provide a viable explanation for the origin of Solenodon and Nesophontes. Domning et al. (1997) recently described the rhinocerotoid Hyrachyus from late early or early middle Eocene deposits of western Jamaica. This specimen is the oldest known land mammal from any of the West Indian islands, and it is also the first Tertiary land mammal from these islands that has definite North American affinities (Domning et al., 1997). The discovery of Hyrachyus in western Jamaica is consistent with geological reconstructions that place a Western Jamaica Block close to or in contact with Central America in the early Tertiary; this western block is thought to have moved east and become incorporated into modern Jamaica at some point in the Miocene (Iturralde-Vinent and MacPhee, 1999). This raises the possibility that a North American insectivoran used Jamaica as a conduit to emigrate from North America to the other Great Antilles (MacPhee et al., 1999a). However, if insectivorans arrived in the Caribbean via western Jamaica, they must have quickly dispersed to newly emergent islands to the east because western Jamaica was submerged for most of the time between the late Eocene and the Miocene (Robinson, 1994; Iturralde-Vinent and MacPhee, 1999).

THE LAND SPAN HYPOTHESIS The possibility of a land bridge connection between the American mainlands and the Greater Antilles has been proposed at various times over the years (see the discussion in Williams, 1989). However, this idea has not received much support recently because there has been little geological evidence for such a bridge (MacPhee and Wyss, 1990). In addition, many zoogeographers considered the Antillean vertebrate fauna to be depauperate and unbalanced, and therefore more consistent with the filtering effects of overwater dispersal than with the wholesale faunal movement that would likely accompany a land bridge (e.g., Simpson, 1956; Williams, 1989). In a recent series of papers, MacPhee and Iturralde-Vinent have developed a modification of the land bridge hypothesis (MacPhee and Iturralde-Vinent, 1994, 1995; Iturralde-Vinent and MacPhee, 1999). They refer to their model as the land span hypothesis, and they make a distinction between a land bridge, which connects two continental landmasses, and a land span, which connects a continent and an off-shelf island or group of islands. In support of this hypothesis, MacPhee and Iturralde-Vinent present evidence that during the Eocene–Oligocene transition the developing Greater Antilles were connected to northwestern South America by a land span. At that time, the islands on the northern part of the Greater Antillean Ridge (central and eastern Cuba, north-central Hispaniola, Puerto Rico, and the Virgin Islands) were either joined into a single island or formed a series of islands separated by narrow water gaps. MacPhee and Iturralde-Vinent hypothesized that during the Eocene–Oligocene transition, orogenic effects and a eustatic drop in sea level exposed the Aves Ridge, a ridge in the Caribbean basin that lies between the Greater Antilles and northern South America. When the Aves Ridge became subaerial, it connected the eastern end of the Greater Antilles Ridge with northwestern South America, which was then a

248

Biogeography of the West Indies: Patterns and Perspectives

microcontinent and partly or completely separated from southern South America by shallow water barriers. This land span connection, which MacPhee and Iturralde-Vinent named “GAARlandia” (for Greater Antilles Aves Ridge), may have existed for just 1 or 2 million years, and it was probably gone by the late Oligocene. MacPhee and Iturralde-Vinent also noted that the time frame for their hypothesized land span agrees well with the appearance in the Antilles of sloths, rodents, and primates, all of which have clear South American affinities. For example, the oldest non-Jamaican Antillean land mammal fossil, a femur from what is believed to be a megalonychid sloth, was collected from early Oligocene deposits on Puerto Rico (MacPhee and Iturralde-Vinent, 1995). In addition, there are fossils of platyrrhine primates, capromyid rodents, and megalonychid sloths from the early Miocene of Cuba (MacPhee and Iturralde-Vinent, 1994, 1995). MacPhee and Grimaldi (1996) also described a small, Nesophontes-sized mammal represented by a partial axial skeleton embedded in a piece of late Oligocene/early Miocene Dominican amber. MacPhee and Grimaldi identified a number of morphological features that are consistent with this animal being an insectivoran, and on the basis of size and morphology they also ruled out other mammalian groups known from the West Indies (bats, primates, rodents, and sloths). The age and location of this fossil suggest the possibility that insectivorans may also have arrived in the Greater Antilles via a GAARlandia land span. This hypothesis offers the advantage of invoking a common mechanism to explain the origin of all known Tertiary mammalian lineages in the Antilles. However, the hypothesis requires that the Antillean insectivorans had at least a proximate origin in South America, and there are no relevant insectivoran fossils from South America prior to the PlioPleistocene interchange with North America (Simpson, 1945; McKenna and Bell, 1997). Scott (1905) had suggested that the Miocene Necrolestes from Argentina might be related to chrysochlorids. However, Patterson (1958; following Winge, 1941) noted that, among other features, this genus has five upper incisors and a robust zygoma, indicating its status as a marsupial. It is still possible that the ancestors of the Antillean insectivorans originated in Africa and dispersed across a narrower South Atlantic to South America, as has been proposed for caviomorph rodents and platyrrhine primates (see Figure 5c). If South America served just as a temporary way station on the route from Africa to the Greater Antilles, then it would not be surprising that they did not leave a record of their presence.

CONCLUSIONS We consider there to be at least four viable biogeographical hypotheses for the origin of the Greater Antillean insectivorans: 1. Origin from a Tertiary North American insectivoran that colonized the Greater Antilles by overwater dispersal from Central America or the southeastern United States. 2. Origin from a Tertiary North American insectivoran that was carried from Central America into the Caribbean on the Western Jamaica Block, with subsequent overwater dispersal to other islands of the Greater Antilles. 3. Origin from a Tertiary African zalambdodont insectivoran that dispersed across a narrower South Atlantic directly from Africa to the Greater Antilles. 4. Origin from a Tertiary insectivoran that dispersed to the Greater Antilles from the northwestern South American microcontinent across a GAARlandia land span. This would have occurred roughly contemporaneously with the dispersal of sloths, primates, and caviomorph rodents. Subsequent breakup of GAARlandia was then at least partly responsible for the present distributions. The view that seems to be most commonly accepted today — origin from a North American Tertiary form with overwater dispersal to the Greater Antilles — appears to be largely a default position, with no strong evidence in its favor but without the apparent conflicts of alternative

The Origin of the Greater Antillean Insectivorans

249

explanations. It relies on the assumption that Solenodon and Nesophontes are related to such extinct North American forms as Apternodus and Centetodon, and it receives significant support from the absence of insectivoran fossils from South America. Prior to Asher (1999b), there were no explicit phylogenetic analyses supporting affinities between the Antillean taxa and extinct North American forms such as Apternodus, and Asher’s analysis does not provide unequivocal support because it also suggests affinities to the Afro-Malagasy tenrecids. In addition, except for the special case of Hyrachyus, there is no concrete evidence that North American land mammals reached the Greater Antilles at any time in the Tertiary. If this biogeographical hypothesis is correct, we would expect future phylogenetic analyses to support the derivation of Solenodon and/or Nesophontes from Apternodus, Centetodon, or some other North American Tertiary form. Also, we might expect to find related fossil forms in Central America or the southeastern United States. The modified vicariance hypothesis would receive considerable support if insectivorans are ever discovered in the western Jamaican Eocene sediments that yielded Hyrachyus. Again, future phylogenetic analyses would be expected to link such new fossils to Solenodon and Nesophontes, and also to extinct North American taxa such as Apternodus and Centetodon. The discovery of relevant insectivoran fossils in early Tertiary deposits from Central America would be consistent with this hypothesis as well as with the overwater dispersal hypothesis. Direct dispersal from Africa to the Greater Antilles would be supported if future phylogenetic analyses provide compelling support for close affinities between the Antillean insectivorans and AfroMalagasy tenrecids — especially if the Tertiary North American forms are excluded from this relationship. The hypothesis might also be strengthened if paleogeographical and paleoceanographical discoveries make an early Tertiary crossing of the South Atlantic seem more plausible. For example, future paleogeographic reconstructions might determine that the distance to be crossed was less than previously thought, or that the direction of prevailing oceanic currents would have carried rafting animals from western Africa directly to the Antilles. One of the main arguments against possible Gondwanan affinities for the Antillean insectivorans has been the absence of insectivoran-grade placental fossils from South America that predate the Plio-Pleistocene land bridge interchange with North America. The GAARlandia hypothesis would be supported if zalambdodont insectivorans are ever discovered in early Tertiary deposits from northwestern South America. This hypothesis would also be indirectly supported if future phylogenetic analyses confirm the association between Solenodon, Nesophontes, and tenrecids that appears in many of Asher’s (1999b) MPTs — with or without affinities to such North American taxa as Apternodus and Centetodon. In conclusion, although recent years have seen much research activity in areas relevant to the origin of Solenodon and Nesophontes, the answer to this biogeographical problem remains elusive. Since there are major conflicts in the three phylogenetic analyses to specifically address the affinities of Solenodon — Stanhope et al. (1998), Asher (1999b), and Emerson et al. (1999) — there is clearly a need for additional broad-based analyses that incorporate a diversity of lipotyphlan taxa, and in particular the fossil forms. Also, phylogenetic analyses of intrageneric relationships within Solenodon and Nesophontes may find patterns of distribution that favor one or another of the biogeographical hypotheses. And there is a need for additional relevant fossils, both from the Greater Antilles and also from areas in Central and South America that are claimed as departure points by the different biogeographical hypotheses. Finally, we note again that the nature of the relationship between Solenodon and Nesophontes remains unclear. If these two lineages are not closely related, then it is quite possible that their Antillean distributions may be explained by different mechanisms.

ACKNOWLEDGMENTS We thank Ross MacPhee, Malcolm McKenna, Jennifer White, and Charles Woods for discussions of Caribbean biogeography and in particular the puzzle of Solenodon and Nesophontes. Ross MacPhee and Jennifer White provided suggestions for improving the manuscript. H. P. W.’s work

250

Biogeography of the West Indies: Patterns and Perspectives

on this project was supported in part by a Research Opportunity Award supplementing NSF Grant DEB 9020002 to Ross MacPhee, and R. J. A. was assisted by NSF Grant DEB 9800908 to Callum Ross. We also thank Charles Woods for inviting us to contribute to this volume.

LITERATURE CITED Aiello, L. C. 1993. The origin of the New World monkeys. Pp. 100–118 in George, W. and R. Lavocat (eds.). The Africa – South America Connection. Clarendon Press, Oxford. Allen, G. M. 1910. Solenodon paradoxus. Memoirs of the Museum of Comparative Zoology 40:1–54 + 9 plates. Allen, G. M. 1918. Fossil mammals from Cuba. Bulletin of the Museum of Comparative Zoology 62:133–148 + 1 plate. Anderson, S. and J. K. Jones, Jr. 1984. Orders and Families of Recent Mammals of the World. John Wiley & Sons, New York. Anthony, H. E. 1916. Preliminary diagnosis of an apparently new family of insectivores. Bulletin of the American Museum of Natural History 35:725–728. Asher, R. J. 1999a. Cranial arteries in living and extinct insectivoran mammals. Journal of Vertebrate Paleontology 19:30A. Asher, R. J. 1999b. A morphological basis for assessing the phylogeny of the “Tenrecoidea” (Mammalia, Lipotyphla). Cladistics 15:231–252. Asher, R. J. 2000. Phylogenetic History of Tenrecs and Other Insectivoran Mammals. Ph.D. dissertation, State University of New York, Stony Brook. Baskin, J. A. 1986. The late Miocene radiation of Neotropical sigmodontine rodents in North America. Pp. 287–303 in Flanagan, K. M. and J. A. Lillegraven (eds.). Vertebrates, phylogeny, and philosophy. Contributions to Geology, Special Paper No. 3, University of Wyoming, Laramie. Brandt, J. F. 1833. De Solenodonte. Novo mammalium insectivorum genere. Mémoires de l’Académie des Sciences de St. Petersbourg 6:459–478. Bugge, J. 1974. The cephalic arterial system in insectivores, primates, rodents and lagomorphs, with special reference to the systematic classification. Acta Anatomica 87:1–160. Butler, P. M. 1988. Phylogeny of the insectivores. Pp. 117–141 in Benton, M. J. (ed.). The Phylogeny and Classification of the Tetrapods, Vol. 2: Mammals. Clarendon Press, Oxford. Darlington, P. J., Jr. 1957. Zoogeography: The Geographical Distribution of Animals. John Wiley & Sons, New York. Denison, R. H. 1938. The broad-skulled Pseudocreodi. Annals of the New York Academy of Sciences 37:163–256. Dobson, G. E. 1882–1890. A Monograph of the Insectivora, Systematic and Anatomical. J. Van Voorst, London. Domning, D. P., R. J. Emry, R. W. Portell, S. K. Donovan, and K. S. Schindler. 1997. Oldest West Indian land mammal: rhinocerotoid ungulate from the Eocene of Jamaica. Journal of Vertebrate Paleontology 17:638–641. Emerson, G. L., C. W. Kilpatrick, B. E. McNiff, J. Ottenwalder, and M. W. Allard. 1999. Phylogenetic relationships of the order Insectivora based on complete 12S rRNA sequences from mitochondria. Cladistics 15:221–230. Foote, M., J. P. Hunter, C. M. Janis, and J. J. Sepkoski, Jr. 1999. Evolutionary and preservational constraints on origins of biologic groups: divergence times of eutherian mammals. Science 283:1310–1314. George, W. 1993. The strange rodents of Africa and South America. Pp. 119–141 in George, W. and R. Lavocat (eds.). The Africa – South America Connection. Clarendon Press, Oxford. Gregory, W. K. 1910. The orders of mammals. Bulletin of the American Museum of Natural History 27:1–524. Hershkovitz, P. 1972. The Recent mammals of the Neotropical region: a zoogeographic and ecological review. Pp. 311–431 in Keast, A., F. C. Erk, and B. Glass (eds.). Evolution, Mammals, and Southern Continents. State University of New York Press, Albany. Hoffstetter, R. 1980. Origin and deployment of New World monkeys emphasizing the southern continents route. Pp. 103–122 in Ciochon, R. L. and A. B. Chiarelli (eds.). Evolutionary Biology of the New World Monkeys and Continental Drift. Plenum Press, New York. Hutterer, R. 1993. Order Insectivora. Pp. 69–130 in Wilson, D. E. and D. M. Reeder (eds.). Mammal Species of the World: A Taxonomic and Geographic Reference, 2nd ed. Smithsonian Institution Press, Washington, D.C.

The Origin of the Greater Antillean Insectivorans

251

Iturralde-Vinent, M. A. and R. D. E. MacPhee. 1999. Paleogeography of the Caribbean region: implications for Cenozoic biogeography. Bulletin of the American Museum of Natural History 238:1–95. Korth, W. W. 1994. The Tertiary Record of Rodents in North America. Plenum Press, New York. Lavocat, R. 1980. The implications of rodent paleontology and biogeography to the geographical sources and origin of platyrrhine primates. Pp. 93–102 in Ciochon, R. L. and A. B. Chiarelli (eds.). Evolutionary Biology of the New World Monkeys and Continental Drift. Plenum Press, New York. Liu, F.-G. R. and M. M. Miyamoto. 1999. Phylogenetic assessment of molecular and morphological data for eutherian mammals. Systematic Biology 48:54–64. Liu, F.-G. R., M. M. Miyamoto, N. P. Freire, P. Q. Ong, M. R. Tennant, T. S. Young, and K. F. Gugel. 2001. Molecular and morphological supertrees for eutherian (placental) mammals. Science 291:1786–1789. MacFadden, B. J. 1980. Rafting mammals or drifting islands? Biogeography of the Greater Antillean insectivores Nesophontes and Solenodon. Journal of Biogeography 7:11–22. MacPhee, R. D. E. 1981. Auditory regions of primates and eutherian insectivores: morphology, ontogeny, and character analysis. Contributions to Primatology 18:1–282. MacPhee, R. D. E. and D. A. Grimaldi. 1996. Mammal bones in Dominican amber. Nature 380:489–490. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1994. First Tertiary land mammal from Greater Antilles: an early Miocene sloth (Xenarthra, Megalonychidae) from Cuba. American Museum Novitates 3094:1–13. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1995. Origin of the Greater Antillean land mammal fauna, 1: New Tertiary fossils from Cuba and Puerto Rico. American Museum Novitates 3141:1–31. MacPhee, R. D. E. and A. R. Wyss. 1990. Oligo-Miocene vertebrates from Puerto Rico, with a catalog of localities. American Museum Novitates 2965:1–45. MacPhee, R. D. E., C. Flemming, D. P. Domning, R. W. Portell, and B. Beatty. 1999a. Eocene ?primate petrosal from Jamaica: morphology and biogeographical implications. Journal of Vertebrate Paleontology 19:61A. MacPhee, R. D. E., C. Flemming, and D. P. Lunde. 1999b. “Last occurrence” of the Antillean insectivoran Nesophontes: new radiometric dates and their interpretation. American Museum Novitates 3261:1–20. Madsen, O., M. Scally, C. J. Douady, D. J. Kao, R. W. DeBry, R. Adkins, H. M. Amrine, M. J. Stanhope, W. W. de Jong, and M. S. Springer. 2001. Parallel adaptive radiations in two major clades of placental mammals. Nature 409:610–614. Maier, W. 1985. Zalambdodontic teeth of mammals as a morphological paradigm. Fortschritte der Zoologie, 30:253–256. McDowell, S. B., Jr. 1958. The Greater Antillean insectivores. Bulletin of the American Museum of Natural History 115:113–214. McKenna, M. C. and S. K. Bell. 1997. Classification of Mammals above the Species Level. Columbia University Press, New York. Miller, G. S., Jr. and R. Kellogg. 1955. List of North American Recent mammals. Bulletin of the United States National Museum 205:1–954. Morgan, G. S. 1994. Late Quaternary fossil vertebrates from the Cayman Islands. Pp. 465–508 in Brunt, M. A. and J. E. Davies (eds.). The Cayman Islands: Natural History and Biogeography. Kluwer Academic, Boston. Morgan, G. S. and J. A. Ottenwalder. 1993. A new extinct species of Solenodon (Mammalia: Insectivora: Solenodontidae) from the late Quaternary of Cuba. Annals of Carnegie Museum 62:151–164. Morgan, G. S. and C. A. Woods. 1986. Extinction and the zoogeography of West Indian land mammals. Biological Journal of the Linnean Society 28:167–203. Mouchaty, S. K. 1999. Mammalian Molecular Systematics with Emphasis on the Insectivore Order Lipotyphla. Ph.D. dissertation, Lund University, Sweden. Mouchaty, S. K., A. Gullberg, A. Janke, and U. Arnason. 2000. The phylogenetic position of the Talpidae within Eutheria based on analysis of complete mitochondrial sequences. Molecular Biology and Evolution 17:60–67. Mullins, H. T., A. F. Gardulski, S. W. Wise, Jr., and J. Applegate. 1987. Middle Miocene oceanographic event in the eastern Gulf of Mexico: implications for seismic stratigraphic succession and Loop Current/Gulf Stream circulation. Geological Society of America Bulletin 98:702–713. Murphy, W. J., E. Eizirik, W. E. Johnson, Y. P. Zhang, O. A. Ryder, and S. J. O’Brien. 2001. Molecular phylogenetics and the origins of placental mammals. Nature 409:614–618. Nowak, R. M. and J. L. Paradiso. 1983. Walker’s mammals of the world, 4th ed., Vol. 1. The Johns Hopkins University Press, Baltimore, Maryland.

252

Biogeography of the West Indies: Patterns and Perspectives

Patterson, B. 1958. Affinities of the Patagonian fossil mammal Necrolestes. Breviora 94:1–14. Patterson, B. 1962. An extinct solenodontid insectivore from Hispaniola. Breviora 165:1–11. Peters, W. 1863. Über die Säugethier-Gattung Solenodon. Abhandlungen der Königl. Akademie der Wissenschaften, Berlin. Presley, R. 1979. The primitive course of the internal carotid artery in mammals. Acta Anatomica 103:238–244. Robinson, E. 1994. Jamaica. Pp. 111–127 in Donovan, S. K. and T. A. Jackson (eds.). Caribbean Geology: An Introduction. University of the West Indies Publishers’ Association, Kingston, Jamaica. Rosen, D. E. 1975. A vicariance model of Caribbean biogeography. Systematic Zoology 24:431–464. Scott, W. B. 1905. Reports of the Princeton University Expedition to Patagonia, 1896–1899, Pp. 365–388 in Vol. 5: Paleontology etc., pt. 2. Insectivora. Princeton University, Princeton, New Jersey. Simpson, G. G. 1945. The principles of classification and a classification of mammals. Bulletin of the American Museum of Natural History 85:1–350. Simpson, G. G. 1956. Zoogeography of West Indian land mammals. American Museum Novitates 1759:1–28. Springer, M. S., G. C. Cleven, O. Madsen, W. W. de Jong, V. G. Waddell, H. M. Amrine, and M. J. Stanhope. 1997. Endemic African mammals shake the phylogenetic tree. Nature 388:61–64. Stanhope, M. J., V. G. Waddell, O. Madsen, W. de Jong, S. B. Hedges, G. C. Cleven, D. Kao, and M. S. Springer. 1998. Molecular evidence for multiple origins of Insectivora and for a new order of endemic African insectivore mammals. Proceedings of the National Academy of Sciences 95:9967–9972. van Dijk, M. A. M., O. Madsen, F. Catzeflis, M. J. Stanhope, W. W. de Jong, and M. Pagel. 2001. Protein sequence signatures support the African clade of mammals. Proceedings of the National Academy of Sciences 98:188–193. Van Valen, L. 1967. New Paleocene insectivores and insectivore classification. Bulletin of the American Museum of Natural History 135:217–284. Wible, J. R. 1984. The Ontogeny and Phylogeny of the Mammalian Cranial Arterial Pattern (Internal Carotid Artery). Ph.D. dissertation, Duke University, Raleigh, North Carolina. Wible, J. R. 1987. The eutherian stapedial artery: character analysis and implications for superordinal relationships. Zoological Journal of the Linnean Society 91:107–135. Williams, E. E. 1989. Old problems and new opportunities in West Indian biogeography. Pp. 1–46 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Winge, H. 1941. The interrelationships of the mammalian genera, Vol. 1: Monotremata, Marsupialia, Insectivora, Chiroptera, Edentata. C. A. Reitzels Forlag, Copenhagen, Denmark. Woods, C. A. 1989. The biogeography of West Indian rodents. Pp. 741–798 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida.

and Biogeography 16 Systematics of the West Indian Genus Solenodon Jose A. Ottenwalder Abstract — The study of the geographical variation of Solenodon indicates that this Greater Antillean insectivore genus is represented by four species: two living, S. cubanus from Cuba and S. paradoxus from Hispaniola, and two extinct, S. marcanoi from Hispaniola and S. arredondoi from Cuba. A new geographical population of S. paradoxus from southern Hispaniola is described. The diagnosis of S. marcanoi is revised and specimens of the original type series are re-assigned to S. paradoxus. Solenodon marcanoi shares characters of both S. paradoxus and S. cubanus, and is considered an intermediate lineage. The two extinct species were restricted, respectively, to western Cuba and to southwestern Hispaniola. It is hypothesized that elucidation of both S. marcanoi relationships and southern Hispaniola paleogeographical reconstruction might hold a key role in the interpretation of the biogeographical history of Antillean insectivores. The late Quaternary distribution of S. paradoxus in Hispaniola is insufficiently known. The discovery of new extant populations in the Dominican Republic is presented. Results of recent and previous field surveys indicate that the species is still widely dispersed in this country, but extant populations are fragmented in distribution and low in numbers. In Haiti, the species appears to survive only in the Massif de la Hotte, in the southwestern end of Peninsula of Tiburon. No single fossil or Recent records are yet known from northern Haiti, north of the Cul-deSac. Paleontological and archaeological evidence suggest that S. cubanus was well distributed throughout western and eastern Cuba. The species is now extirpated in the western and central portions of the island, and only survives in the eastern mountain areas.

INTRODUCTION The West Indian insectivores Solenodon and Nesophontes are endemic to the Greater Antilles and probably the most ancient members of the West Indian mammalian fauna. The genus Solenodon is restricted to the islands of Cuba and Hispaniola and contains the only surviving members of the Insectivora in the region. The closely related Nesophontes comprises eight extinct species known from the Holocene and late Pleistocene of Cuba, Hispaniola, the Cayman Islands, and Puerto Rico (Figure 1). The Puerto Rican species, N. edithae, which is intermediate in size between the larger Solenodon and the much smaller remaining species of Nesophontes, has been discovered in a kitchen midden in Vieques Island (Morgan and Woods, 1986; E. Wing, personal communication). Although they have fared better than other groups such as edentates and primates, insectivores have also suffered a high extinction rate recorded among other West Indian mammals (Morgan and Woods, 1986; Woods, 1989, 1990). Two of twelve species of insectivores have survived until today. Pleistocene climatic events, human exploitation, and predation pressure from exotics have been indicated as major causes of extinction of the Antillean vertebrate fauna. Increasing support for the latter two factors have been presented (Steadman et al., 1984; Woods et al., 1986; Woods, 1989). Most West Indian mammals were still extant at the time Amerindians arrived on the islands (Morgan and Woods, 1986). Association of Nesophontes with rats in cave deposits led Miller (1929) to suggest all three species of Hispaniolan Nesophontes might have survived to the beginning of this century. Both Nesophontes and Solenodon have been found in archaeological sites throughout their 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

253

254

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 1 Map of the West Indies showing distribution of Greater Antillean insectivores. Shaded areas = Solenodon and Nesophontes;  = Nesophontes.

historical ranges. Their presence in archaeological deposits is, however, virtually insignificant compared to the abundance of other groups, and they do not seem to have represented an important source of human food. Evidence from cave deposits and owl pellet accumulations indicate that Nesophontes were clearly very abundant, but not Solenodon. Therefore, Nesophontes might have been somewhat neglected as food by the Amerindians because of their small body size. Although Solenodon species were much larger, they do not seem to be more common in archaeological sites, and they are found infrequently in cave deposits. Today, Cuban and Hispaniolan Solenodon are among the few native West Indian land mammals that still survive. They have been considered among the most endangered mammals, and probably are the most threatened of all insectivores (Thornback and Jenkins, 1982; Thornback, 1983).

EVOLUTIONARY RELATIONSHIPS OF WEST INDIAN INSECTIVORES The early evolutionary history of the group was comprehensively summarized by McDowell (1958). The relationships of Solenodon and Nesophontes, among themselves and within the Insectivora, are not yet well understood. This is, in part, a reflection of the continuing problems of insectivoran classification. The group, which continues to be found among the least understood mammalian orders, has been an assemblage classically regarded as stem eutherians. In fact, the group was long considered to include elephant shrews (Macroscelididae), tree shrews (Tupaiidae), many early Tertiary mammals (Gregory, 1910), and to be related to primates (Szalay, 1975; Novacek, 1982). These conclusions were made mainly due to shared primitive resemblance, and for which the Insectivora have been regarded as a “taxonomic wastebasket” (McKenna, 1975) and “Eutheria incertae sedis” (Novacek, 1990). Following the exclusion of the Menotyphla (Butler, 1972; McKenna, 1975; Novacek et al., 1983), the Insectivora was restricted to the Lipotyphla or Recent insectivores (Butler, 1988).

Systematics and Biogeography of the West Indian Genus Solenodon

255

Separation of lipotyphlans (Insectivora sensu stricto) from tupaiid insectivores (Scandentia) (Miyamoto and Goodman, 1986), supported the traditional views for Lipotyphla to be regarded as monophyletic comprising two clades of subordinal rank: the Erinaceomorpha (hedgehogs) and the Soricomorpha (the other five families) (Saban, 1954; Butler, 1956, 1972; McKenna, 1975). Within the Soricomorpha, Butler (1988) suggested that golden moles and tenrecs form a clade and that moles and shrews cluster together, followed by solenodons. MacPhee and Novacek (1993), however, proposed three clades of subordinal rank: Soricomorpha (Soricidae, Talpidae, Tenrecidae, and Solenodontidae); Erinaceomorpha (Erinaceidae); and Chrysochloromorpha (Chrysochloridae). Rejecting a monophyletic Insectivora, Springer et al. (1997) concluded that golden moles are not part of the Insectivora, but instead belong to an “African clade” that includes hyraxes, elephants, sirenians, aardvarks, and elephant shrews. In a second paper (Stanhope et al., 1998), the same group of researchers not only confirmed earlier findings in Springer et al., but also proposed a new partitioning of Insectivora, placing golden moles and tenrecs in a new order within an African superordinal clade, and out of the classical order Insectivora (Soricomorpha), with no association with solenodons, moles, and shrews. In addition, these authors suggested that the hedgehogs, shrews, moles, and solenodons form a monophyletic group to be retained in the order Insectivora. Another recent study (Emerson et al., 1999) argued that molecular and morphological data are currently in conflict over the possible monophyly of the living members of the Insectivora (Lipotyphla sensu Butler, 1988), and that the relationships within the group remain largely unresolved, since available data are insufficient and current evidence is as yet inconclusive. Butler (1956) and McDowell (1958) included Solenodon and Nesophontes in the Soricomorpha, together with the living shrews (Soricidae), moles (Talpidae), tenrecs (Tenrecidae), and chrysocholorids (Chrysochloridae), as well as several fossil taxa, such as apternodontids (Apternodontidae) and geolabidids (Geolabididae). As such, Nesophontes and Solenodon are often considered to represent a monophyletic group derived from Eocene or Oligocene North American soricomorphs belonging to either the Apternodontidae or the Geolabididae (Matthew, 1910, 1918; Schlaikjer, 1934; Van Valen, 1967; Butler, 1972; McKenne, 1975; MacFadden, 1980; Lillegraven et al., 1981). They may have reached the Greater Antilles in the early Tertiary, either through vicariance by way of a proto-Antillean archipelago (MacFadden, 1980) or by dispersal from nuclear Central America. Van Valen (1967) considered the apternodontids as possibly ancestral to all of the extant zalambdodont lipotyphlans: solenodons, tenrecids, and chrysochlorids. However, whether the zalambdodont condition of the dentition (triangular upper molar teeth with V-shaped cusps and prominent outer styles) in these groups is homologous or convergent is a problem that as yet remains unsolved. McDowell (1958) rejected any special relationships between Antillean insectivores and apternodontids and, based on cranial similarities, suggested closer affinity between Solenodon and Nesophontes within the Soricidae than to any other soricomorph insectivore. He concluded this despite the fact that Nesophontes has a fully dilambdodont dentition (upper molar teeth with W-shaped cusps). However, Van Valen (1966) has suggested the possibility that Nesophontes may be secondarily dilambdodont. In the opinion of McKenna (1975), McDowell’s conclusions reflected a small sample and poor preservation of the material then available. Although unable to separate ancestral from derived characters, McDowell’s work represents to date the most serious attempt to clarify the affinities of the West Indian insectivores. More recently, Butler (1988) suggested the possibility that Centetodon (Geolabididae), Solenodon, and Nesophontes had a common ancestor and that Solenodon is probably not especially related to either Apternodus or to the Soricidae. Solenodon may be the only survivor of a North American branch that includes Centetodon, Nesophontes, and possibly Apternodus. In short, one Solenodontidae (McDowell, 1958; Findley, 1967; Yates, 1984) or two families, Solenodontidae and Nesophontidae (Hall, 1981; Honacki et al., 1982), have been recognized. I follow the latter arrangement in this discussion and treat West Indian Insectivores in two distinct families.

256

Biogeography of the West Indies: Patterns and Perspectives

HISTORICAL SURVEYS OF THE SOLENODONTIDAE The genus Solenodon was described in 1833 by Brandt from a single Hispaniolan specimen with an incomplete skull. Although the existence of a solenodontid in Cuba was discovered in 1836 (Poey, 1851), the animal was considered conspecific with the type from Hispaniola, S. paradoxus (Poey, 1851), until it was finally named (Peters, 1861) and critically described as a distinct species, S. cubanus, 27 years later (Peters, 1863). Whereas Peters’ separation of the two species in the same genus was generally adopted (Gundlach, 1866–1867, 1872, 1877, 1895; Dobson, 1884; True, [1884] 1885; Flower and Lydekker, 1891; Elliot, 1905; Leche, 1907; Allen, 1908, 1911; Beddard, 1909; Gregory, 1910; Miller, 1924; Webber, 1928). Dobson (1882) considered both species to represent geographical forms of one species. Disagreement concerning their generic status arose thereafter. Allen (1908) pointed out that certain characters were different enough to justify subgeneric condition, whereas Cabrera (1925) created the genus Atopogale for the Cuban species. With few exceptions (Miller and Kellogg, 1955; Hall and Kelson, 1959; Findley, 1967), most authors disregarded Cabrera’s criteria, recognizing but a single genus for the two species, and either relegating Atopogale to subgenus (Aguayo, 1950; Arredondo, 1955; Moreno, 1966; Cave, 1968; Varona, 1974; Hall, 1981; Nowak and Paradiso, 1983) or simply considering it a synonym of Solenodon (Winge, 1941; Allen, 1942; Simpson, 1945, 1956; Westermann, 1953; Vrydagh, 1954; Eisenberg and Gould, 1966; Eisenberg, 1975; Walker, 1975; Kowalski, 1976; Paula Couto, 1979; Lawlor, 1979; Corbet and Hill, 1980; Honacki et al., 1982; Yates, 1984). The validity of Atopogale was discussed by Podushcka and Podushcka (1983). Essentially, their conclusions agree with the placement of the Cuban form under Solenodon as used by most authors since the description of cubanus last century. In their evaluation of Cabrera’s characters, these authors also expressed serious doubts concerning the consistency of most characters accepted until now to distinguish Cuban from Hispaniolan solenodons. A second form of Solenodon from the northeastern mountainous region of Cuba, S. poeyanus (Barbour, 1944), was described exclusively based on external characters (coloration and claw length) of a single specimen. Aguayo (1950) and Koopman and Ruibal (1955) argued that at most this proposed form be considered as a subspecies. In agreement with these authors, Patterson (1962) expressed doubts of the validity of poeyanus beyond subspecies level (see also Arredondo, 1970a), if any, whereas Varona (1974) stated that this proposed form cannot be separated from cubanus even at subspecific rank. Some authors, however, have retained Atopogale as subgenus (Hall, 1981; Nowak, 1991), and poeyanus as a distinct geographical population (Hall, 1981). A new genus and species of a somewhat smaller solenodontid, Antillogale marcanoi, was described from late Pleistocene to Recent fossil deposits of the Dominican Republic (Patterson, 1962). But the generic validity of Antillogale was questioned by Van Valen (1967) and relegated to subgenus by Varona (1974) who placed marcanoi under Solenodon. The existence of another extinct species of Solenodon was mentioned by Arredondo (1970a), based on a femur from a late Quaternary fossil site in western Cuba. Morgan et al. (1980) illustrated and described this femur and mentioned the existence of two additional large fossil femora from western Cuba. The discovery in 1991 by Oscar Arredondo of a large partial skull in the Museo Nacional de Historia Natural de Cuba, in La Habana, allowed for detailed taxonomic comparisons of the new material with all three nominated species of Solenodon. These comparisons established the much larger extinct Cuban solenodontid as a distinct species, clearly distinguishable from any of the species already described for the genus, living or extinct (Ottenwalder, 1991), and later described as S. arredondoi by Morgan and Ottenwalder (1993). Despite the varied views and proposals concerning the taxonomic status of the different nominated species and genera in the literature, the group has not been the subject of systematic revision. In part, taxonomic studies might have been prevented in the past due to paucity of Solenodon material in collections. Furthermore, the majority of the specimens available in systematic collections until now were collected in the beginning of the century and lack adequate collecting data.

Systematics and Biogeography of the West Indian Genus Solenodon

257

During this research, new Hispaniolan material was obtained from the Dominican Republic, including the fresh remains of several specimens of very small body size. These specimens are smaller than the known Hispaniolan species, S. paradoxus, and, in fact, resemble in size the animal described by Patterson (1962) as Antillogale marcanoi. This has led some authors (Woods and Einsenberg, 1989) to suggest that A. marcanoi, thus far assumed to be extinct, appears to be alive. During the past 15 years, a number of Hispaniolan specimens have also been secured from the Massif de la Hotte, in the southwestern end of Haiti (Woods, 1986). Both fossil and Recent Solenodon specimens are represented in this material, including four skulls of S. marcanoi, until now known only from partial mandibles and limb bones.

MATERIALS AND METHODS A total of 247 Recent specimens was examined. Specimens were conventional museum specimens preserved as skins, skulls, skeletons, fluid, and/or taxidermy mounted specimens. These specimens are deposited in the following collections of Recent mammals: American Museum of Natural History, New York (AMNH); Carnegie Museum of Natural History, Pittsburgh (CM); Field Museum of Natural History, Chicago (FMNH); Florida Museum of Natural History, University of Florida, Gainesville (UF); Instituto de Ecología y Sistemática, Academia de Ciencias de Cuba, La Habana (IES/ACC); Institut Royal des Sciences Naturelles de Belgique, Brussels (IRSB); Jose A. Ottenwalder private field collections, Santo Domingo (JAO); National Museum of Natural History, Smithsonian Institution, Washington, D.C. (USNM); Museo Nacional de Historia Natural de Cuba, La Habana (MNHNC); Museum of Comparative Zoology, Harvard University, Cambridge (MCZ); Yale Peabody Museum Osteological Collection, Yale University, New Haven (YPM); Puget Sound Museum of Natural History, University of Puget Sound, Tacoma (PSM); Rijksmuseum van Natuurlijke Historie, Leiden (RMNH); Zoologisches Institut und Zoologisches Museum, Universität Hamburg (ZMUH). In this chapter, specimens will be referred to by their collection acronyms. All specimens were assigned to three age classes; Age I, juvenile; Age II, subadult; and Age III, adult. Age was established based on tooth wear and the following criteria: Juvenile — last cheektooth is not fully erupted; temporal ridges not joined to form a sagittal crest; lambdoidal crest is not well defined; basioccipital and basisphenoid are not fused. Subadult — all cheekteeth are fully erupted; temporal ridges are joined to form a weakly developed sagittal crest; lambdoidal crest is not well developed; basioccipital and basisphenoid are not completely fused; maxilla and pre-maxilla are not completely fused. Adult — all cheekteeth are fully erupted; sagittal and lambdoidal crests are well defined; basioccipital and basisphenoid are completely fused; maxilla and pre-maxilla are completely fused; traces of labial reentrant angles are usually gone. Older adults often have a more massive cranium, with more pronounced sagittal and lambdoidal crests, interorbital region, and occipital region. Five external measurements (total length, TL; head–body length, HBL; tail length, TL; ear length, EA; and hind foot length, HF) were taken directly from live animals (Dominican Republic only) and museum specimens preserved in fluid. External measurements were also obtained from labels of specimens preserved as standard museum skins, and, in the case of missing types or otherwise unavailable critical specimens, from the literature. Fifty-eight (58) cranial, dental, and postcranial measurements divided into lengths (L), breadths or widths (B), and heights or depths (H) were taken. All internal measurements were taken with dial calipers to the nearest 0.05 mm. Needlepoint dial calipers were utilized in dental measurements. There is disagreement concerning the missing premolar of Solenodon, as to whether it is the P2/2 or the P3/3. The criteria of McDowell (1958), who tentatively regarded the missing premolar as the P3/3, are followed here.

258

Biogeography of the West Indies: Patterns and Perspectives

All measurements are given in millimeters. Definitions of internal measurements and their abbreviations are given below. GLS: Greatest length of skull — Greatest distance between the posteriormost part of the skull above the foramen magnum (supraoccipital processes) and the anteriormost part of the premaxilla CBL: Condylobasal length — Greatest distance from the posteriormost part of the exoccipital condyles to the anteriormost part of the premaxillary PL: Palatilar length — Greatest distance from the anteriormost point on the border of the palate to a line connecting the posteriormost margins of the alveoli of the upper incisors PPL: Postpalatal length — Greatest distance from the anteriormost margin of the foramen magnum to the posterior border of the palate AMTR: Alveolar length of upper molar toothrow — Least distance from posterior point of alveolar margin of last molar to anterior point of alveolar margin of first molar MMTR: Length of upper molar toothrow — Least distance measured at the crowns LMTR: Length of maxillary toothrow — Least distance between the anteriormost and posteriormost margins of the alveoli of the maxillary teeth (C1-M3) MTRW: Breadth across maxillary toothrow — Least width of palate (from M1M2 to M1M2) taken at the labial margins of each toothrow AC: Anteorbital constriction — Least distance between lower anteriormost part of the fossae, taken over the opening of the canale infraorbitale ZB: Zygomatic breadth — Greatest width across zygomatic arches, measured at right angles to the longitudinal angles of cranium IC: Interorbital constriction — Least width across postorbital constriction, measured between the orbits at right angles to the long axis of the cranium SB: Squamosal breadth — Least width across the lateral margins of the squamosal bones, measured at right angles to the long axis of the cranium MB: Mastoid breadth — Greatest width across the mastoid processes, measured at right angles to the long axis of the cranium BB: Breadth of the braincase — Greatest width across braincase, measured at right angles to the long axis of the cranium CB: Condylar breadth — Greatest width across external margin of occipital condyle SH: Skull height — Perpendicular distance from a plane going through the most inferior part of the post-glenoid processes, to the highest point on cranium LC1: Maximum length of C1 WC1: Maximum width of C1 LP1: Maximum length of P1 WP1: Maximum width of P1 LP2: Maximum length of P2 WP2: Maximum width of P2 LP4: Maximum length of P4 WP4: Maximum width of P4 LM1: Maximum length of M1 WM1: Maximum width of M1 LM2: Maximum length of M2 WM2: Maximum width of M2 LM3: Maximum length of M3 WM3: Maximum width of M3 GML: Greatest mandible length — Least distance from most posterior part of condyle to anterior (lowest) point of the first incisor at its alveolus (= tip of the dentary)

Systematics and Biogeography of the West Indian Genus Solenodon

259

MTR: Mandibular toothrow — Length from anterior edge of alveolus of canine to posterior edge of alveolus of last molar P4-M3: Alveolar length of P4-M3 — Posterior point of alveolar margin of last molar to anterior point of alveolar margin of last premolar DCP: Depth through coronoid process — Least vertical height between tip of coronoid process to highest edge of lunate notch ACH: Angular-condylar height — Least distance from lowest point on angular process to highest point on condyle LC1: Maximum length of C1 WC1: Maximum width of C1 LP1: Maximum length of P1 WP1: Maximum width of P1 LP2: Maximum length of P2 WP2: Maximum width of P2 LP4: Maximum length of P4 WP4: Maximum width of P4 LM1: Maximum length of M1 WM1: Maximum width of M1 LM2: Maximum length of M2 WM2: Maximum width of M2 LM3: Maximum length of M3 WM3: Maximum width of M3 LF: Maximum length of femur MWF: Maximum width of femur, at proximal end FMW: Minimum shaft width of femur LH: Maximum length of humerus MWH: Maximum width of humerus, at distal end HMW: Minimum shaft width of humerus LU: Maximum length of ulna MWU: Maximum width of ulna, at olecranon UMW: Minimum shaft width of ulna, at lower section of diaphisis Specimens of Recent Solenodon were grouped into seven reference samples throughout the geographical range of the genus (Figure 2) as follows: (1) Peninsula de Samana–Promontorio de Cabrera, northeastern Dominican Republic (North Hispaniola); (2) Los Haitises–Sierra de Seibo–Caribbean Coastal Plain, eastern Dominican Republic (North Hispaniola); (3) Cordillera Central–Cibao Occidental Valley, central north–central Dominican Republic (North Hispaniola); (4) Peninsula de Barahona, southwestern Dominican Republic (South Hispaniola); (5) Sierra de Baoruco, southwestern Dominican Republic (South Hispaniola); (6) Massif de la Hotte, southwestern Haiti (South Hispaniola); (7) Eastern Cuba, including both the southern (Sierra Maestra) and northern ranges (Sierra de Nipe, Sierra del Cristal, Cuchillas de Moa, Toa, and Baracoa). A total of 110 specimens of the late Pleistocene, early Holocene, and Amerindian times from Cuba, Dominican Republic, and Haiti were examined. These fossil, subfossil, and kitchen midden specimens are housed at the following collections: Carnegie Museum of Natural History, Pittsburgh (CM); Florida Museum of Natural History, University of Florida (UF); Instituto de Ecología y Sistemática, Academia de Ciencias de Cuba, La Habana (IES/ACC); Museo Nacional Historia Natural, La Habana (MNHNC); Museum of Comparative Zoology, Harvard University (MCZ); National Museum of Natural History, Smithsonian Institution (USNM); Oscar Arredondo private collection, La Habana (OA). The sites from where these specimens were recovered are discussed in the section “Late Quaternary and Recent Distribution of Solenodon.”

260

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 2 Map showing geographical samples of extant Solenodon in Cuba and Hispaniola. (1) Promontorio de Cabrera–Peninsula de Samana, northeastern Dominican Republic (North Hispaniola); (2) Los Haitises–Sierra de Seibo–Caribbean Coastal Plain, eastern Dominican Republic (North Hispaniola); (3) Cordillera Central–Cibao Occidental Valley, central north-central Dominican Republic (North Hispaniola); (4) Peninsula de Barahona, southwestern Dominican Republic (South Hispaniola); (5) Sierra de Baoruco, southwestern Dominican Republic (South Hispaniola); (6) Massif de la Hotte, southwestern Haiti (South Hispaniola); (7) Eastern Cuba.

Statistical analyses were performed using the NCSS Statistical System (Version 5.0), and the Statistical Analysis System (SAS Institute, 1985). Descriptive statistics (mean, range, standard deviation, standard error, variance, and coefficient of variation) were calculated with the MEANS routine. Univariate analyses of variation with age, individual variation, secondary sexual variation, and geographical variation were performed using a single classification analysis of variance (ANOVA). The specimens from central Hispaniola, the largest sample available, were selected to study the influence of variation of age and sex on the populations. Although small, the sample from Eastern Cuba was also tested for secondary sexual variation, but analysis of variation with age in this population was prevented by insufficient sample size. The General Linear Model (GLM-ANOVA) was used to test for significant differences among or between means for each character. Subsequently, a Duncan’s Multiple Range Test was used to determine maximally nonsignificant subsets, if means were found to be significantly different. Because solenodons are very rare in collections and endangered in the wild, samples of Recent specimens available for examination are limited in number. Furthermore, most subfossil specimens had missing measurements. To maximize sample size, characters were analyzed separately in three data sets (cranial, mandibular, and limb bones) to assess multivariate relationships. The multivariate technique used was discriminant function analysis. Stepwise discriminant analysis performs a multiple discriminant analysis in a stepwise manner, selecting the variable entered by finding the variable with the greatest F value. The F value for inclusion was set at 0.01, and the F value for deletion was set at 0.05. The program also classifies individuals, placing them with the group to which they are nearest on the discriminant functions. The weight of five cranial characters was evaluated for diagnostic consistency in separating S. paradoxus from S. cubanus, and for usefulness in assessing specific relationships among and between known Solenodon species. A total of 115 specimens of living and extinct Solenodon representing all three nominated taxa plus the undescribed skull of a suspected distinct species were individually examined. Characters were not polarized but treated as having equal weight. The following character states were evaluated for analysis:

Systematics and Biogeography of the West Indian Genus Solenodon

261

Character 1. Para-nasal (os proboscis) bone support: 0 = absent; 1 = present. Character 2. Diastema I3-C1: 0 = absent; 1 = present. Character 3. Accessory cusp C1: 0 = absent; 1 = present; 2 = vestigial. Character 4. Shape P2: 0 = triangular; 1 = simple, oval or conical; 2 = intermediate. Character 5. Mesopterygoig fossa: 0 = wider posteriorly than anteriorly; 1 = wider anteriorly than posteriorly; 2 = parallel. Cranial measurements, collecting data, or photographs of 53 additional specimens also were examined. These data were not included in the statistical analysis. These specimens are found in the following mammal collections: Museum of Zoology, University of Michigan (UMMZ); British Museum (Natural History), London (BMNH); Forschungsinstitut und Natur-Museum Senckemberg, Frankfurt (SMF); Max-Planck-Institut für Hirnforschung, Frankfurt (MPIH); Naturhistorisches Museum Wien, Wien (NMW); Naturhistoriska Riksmusset, Swedish Museum of Natural History, Stockholm (NRM); University Museum of Zoology, Cambridge University, U.K. (UMZC); Zoological Museum, Institute of Taxonomic Zoology, University of Amsterdam, Amsterdam (ZMA).

RESULTS NONGEOGRAPHICAL VARIATION Three kinds of nongeographical variation were investigated: variation with age, secondary sexual variation, and individual variation. Variation with Age Age categories used in this study are referred to as Age I, juveniles; Age II, subadults; and Age III, adults. These categories are based on the criteria described above (see Materials and Methods) and on dental wear, and do not reflect reproductive age. The influence of age was tested using GLM-ANOVA. Because of insufficient sample, the Cuban population was not tested for age variation. In the sample from Hispaniola, adults, subadults, and juveniles form nonoverlapping subsets in only 3 out of 41 measurements (zygomatic breadth, maximum width of P4, minimum shaft width of humerus). Adults and subadults form an overlapping subset that differs significantly from the juvenile subset in 30 measurements. Adults averaged the largest in most measurements, except in 16, in which subadults were slightly larger. Nevertheless, only adult specimens were used in subsequent analyses. Variation with age is discussed in more detail in Ottenwalder (1991). Secondary Sexual Variation Forty-one cranial and postcranial measurements of adult males of two samples (Eastern Cuba and Central Hispaniola) were tested against those of adult females, utilizing GLM-ANOVA, to establish the existence of any significant differences in size between the sexes. The results are shown in Table 1. Although females averaged larger than males in most measurements, no significant (p < 0.05) differences were observed between males and females of S. cubanus in any of the internal and most external measurements tested. Only in hind foot length were females different from males in the Cuban sample. In the sample from the Cordillera Central–Cibao Occidental Valley region, in central Dominican Republic, females proved significantly larger than males in only two measurements (breadth across maxillary toothrow and anteorbital constriction). As in the Cuban Solenodon sample, females from Hispaniola were also somewhat larger than males in most measurements, but again, variation in size between the sexes was only slightly different. For instance, all measurements of

262

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 Secondary Sexual Variation in Cranial, Dental, and Postcranial Measurements of Recent Samples of Solenodon from Central Dominican Republic, Hispaniola (Sample 3) and Eastern Cuba (Sample 7) Sample

Sex

N

Mean ± SD

Hispaniola

M F M F

21 27 5 4

Greatest length of skull 86.1 ± 2.92 81.0–91.5 86.8 ± 1.91 82.6–90.9 77.7 ± 4.12 71.4–82.4 78.8 ± 3.03 75.5–82.6

2.2 3.4 5.3 3.9

M F M F

20 26 5 4

Condylobasal length 81.2 ± 2.88 76.0–86.6 81.0 ± 1.68 77.2–84.6 73.0 ± 3.33 68.5–77.1 75.0 ± 2.59 71.8–77.8

2.1 3.6 4.6 3.5

M F M F

21 27 5 5

37.6 37.4 33.9 34.5

Palatal length ± 1.42 34.8–40.4 ± 0.91 35.9–39.2 ± 1.43 31.8–35.7 ± 0.94 33.2–35.6

2.4 3.8 4.2 2.7

M F M F

20 25 5 4

Postpalatal 30.3 ± 1.18 30.7 ± 0.86 26.9 ± 1.51 27.6 ± 1.36

Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

M F M F

Range

length 27.6–32.3 29.0–32.6 25.0–28.8 26.0–29.3

Alveolar length of upper 20 10.3 ± 0.72 25 10.4 ± 0.66 5 8.0 ± 0.64 5 8.1 ± 0.28

CV

2.8 3.9 5.6 5.0

molar toothrow 9.1–12.4 6.3 9.5–12.9 7.1 7.3–8.8 8.1 7.6–8.4 3.5

M F M F

Length of upper molar toothrow 20 10.9 ± 0.49 9.9–11.8 24 11.2 ± 0.42 10.3–12.0 5 8.7 ± 0.62 8.0–9.6 5 8.6 ± 0.34 8.3–9.2

3.7 4.5 7.1 3.9

M F M F

21 24 5 5

Length of maxillary toothrow 26.4 ± 0.79 24.9–27.6 26.3 ± 0.60 25.2–27.3 23.5 ± 1.21 21.7–24.7 23.7 ± 0.76 22.6–24.5

2.3 3.0 5.2 3.2

M F M F

Breadth across maxillary toothrow 20 23.6 ± 0.79 22.1–25.6 3.3 25 24.2 ± 0.81 22.5–25.9 3.4 5 21.5 ± 1.44 20.3–23.9 6.7 5 21.2 ± 1.15 20.4–23.3 5.4

F

P

0.83

0.36

0.21

0.67

0.08

0.78

0.96

0.36

0.41

0.52

0.55

0.48

2.00

0.16

0.51

0.50

0.88

0.35

0.03

0.88

3.35

0.07

0.26

0.62

0.07

0.79

0.15

0.71

5.10

0.02*

0.08

0.79

Systematics and Biogeography of the West Indian Genus Solenodon

263

TABLE 1 (continued) Secondary Sexual Variation in Cranial, Dental, and Postcranial Measurements of Recent Samples of Solenodon from Central Dominican Republic, Hispaniola (Sample 3) and Eastern Cuba (Sample 7) Sample

Sex

N

Hispaniola

M F M F

M F M F

Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Mean ± SD

Range

CV

5 4 5 4

Maximum length of C1 4.6 ± 0.38 4.3–5.1 4.4 ± 0.10 4.3–4.6 4.5 ± 0.26 4.1–4.7 4.5 ± 0.33 4.1–4.8

2.3 8.2 5.8 7.4

5 4 5 4

Maximum width of C1 2.4 ± 0.10 2.3–2.6 2.4 ± 0.58 2.4–2.5 2.9 ± 0.24 2.6–3.2 2.9 ± 0.11 2.8–3.1

2.4 4.4 8.1 3.7

of WM3 6.0–7.1 6.1–7.5 4.6–5.1 4.3–5.3

5.0 4.3 4.4 7.9

M F M F

20 26 5 5

Maximum width 6.6 ± 0.28 6.7 ± 0.33 4.8 ± 0.21 4.7 ± 0.37

M F M F

21 27 5 5

Anteorbital constriction 14.0 ± 0.68 13.2–15.9 14.5 ± 0.50 13.5–15.5 14.9 ± 0.67 14.3–15.9 15.1 ± 0.79 14.5–16.4

3.5 4.9 4.5 5.3

M F M F

16 21 3 4

Zygomatic breadth 34.3 ± 1.62 31.8–37.4 35.0 ± 1.70 32.0–39.0 31.4 ± 0.74 30.5–31.9 32.5 ± 0.71 31.7–33.4

4.9 4.7 2.4 2.2

M F M F

21 27 5 5

Interorbital constriction 14.9 ± 0.60 13.9–16.5 14.8 ± 0.57 13.6–16.3 15.0 ± 0.80 14.4–16.4 15.4 ± 0.51 15.0–16.3

3.9 4.1 5.3 3.3

M F M F

21 27 5 4

Squamosal breadth 32.2 ± 1.34 30.1–34.5 32.2 ± 1.20 29.2–34.0 30.8 ± 0.76 29.8–31.9 30.9 ± 0.99 29.5–31.8

3.7 4.2 2.5 3.2

M F M F

20 27 5 4

Mastoid breadth 25.9 ± 1.01 24.0–27.6 26.0 ± 1.01 23.7–28.4 24.5 ± 0.54 23.8–25.0 24.8 ± 0.30 24.4–25.1

3.9 3.9 2.2 1.2

F

P

1.02

0.34

0.00

0.95

0.26

0.62

0.13

0.72

0.11

0.75

0.35

0.57

6.95

0.01*

0.07

0.80

1.36

0.25

4.52

0.08

0.51

0.48

0.89

0.37

0.01

0.93

0.03

0.87

0.11

0.75

0.67

0.44

264

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 (continued) Secondary Sexual Variation in Cranial, Dental, and Postcranial Measurements of Recent Samples of Solenodon from Central Dominican Republic, Hispaniola (Sample 3) and Eastern Cuba (Sample 7) Sample

Sex

N

Mean ± SD

Range

CV

Hispaniola

M F M F

21 26 5 4

Breadth of the 25.0 ± 0.96 24.9 ± 0.63 25.3 ± 0.86 24.5 ± 0.52

braincase 23.4–26.5 23.7–26.2 24.3–26.4 23.9–25.2

2.5 3.8 3.4 2.1

M F M F

20 26 5 4

Condylar breadth 17.0 ± 0.72 15.7–18.0 16.9 ± 0.73 15.3–18.4 15.9 ± 0.68 15.0–16.6 16.4 ± 0.79 15.7–17.2

4.3 4.2 4.3 4.8

M F M F

21 26 5 4

19.7 20.3 19.0 19.1

Skull height ± 1.05 17.3–21.3 ± 0.92 18.3–22.2 ± 1.11 17.8–20.6 ± 0.63 18.1–19.6

4.5 5.3 5.9 3.3

M F M F

21 27 5 4

Greatest mandible length 54.1 ± 1.94 50.9–58.1 54.5 ± 1.19 52.4–56.7 48.8 ± 2.77 44.6–51.9 49.0 ± 1.55 47.1–50.4

2.2 3.6 5.7 3.2

M F M F

21 26 5 5

Mandibular toothrow 27.3 ± 0.91 25.4–28.9 27.4 ± 0.64 26.1–28.8 24.8 ± 1.25 22.9–26.1 25.4 ± 0.84 24.5–26.3

2.3 3.3 5.1 3.3

M F M F

21 24 5 5

Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

21 27 5 4

P

0.16

0.68

2.47

0.16

0.58

0.45

1.01

0.35

3.69

0.06

0.01

0.92

0.74

0.39

0.01

0.91

0.22

0.64

0.65

0.44

2.00

0.16

0.05

0.83

process of mandible 22.3–26.0 4.2 22.2–25.7 4.9 0.82 21.4–23.9 4.2 22.2–24.2 3.7 2.00

0.37

Alveolar length 17.1 ± 0.67 17.4 ± 0.57 14.1 ± 0.53 14.1 ± 0.50

Depth through coronoid M 19 23.9 ± 1.17 F 27 24.2 ± 1.01 M 5 22.4 ± 0.94 F 5 23.2 ± 0.85

M F M F

F

of P4-M3 15.8–18.5 16.2–18.4 13.5–14.7 13.6–14.8

Angular-condylar height 15.1 ± 0.75 13.9–16.4 15.1 ± 0.77 13.4–16.9 13.2 ± 1.15 12.0–14.7 13.6 ± 0.65 13.2–14.6

3.3 3.9 3.8 3.5

5.1 4.9 8.7 4.8

0.20

0.05

0.83

0.46

0.52

Systematics and Biogeography of the West Indian Genus Solenodon

265

TABLE 1 (continued) Secondary Sexual Variation in Cranial, Dental, and Postcranial Measurements of Recent Samples of Solenodon from Central Dominican Republic, Hispaniola (Sample 3) and Eastern Cuba (Sample 7) Sample

Sex

N

Hispaniola

M F M F

20 26 5 5

Maximum length of Pm4 4.3 ± 0.21 4.0–4.9 4.3 ± 0.23 3.7–4.7 3.9 ± 0.53 3.3–4.7 3.9 ± 0.14 3.7–4.1

5.4 5.0 13.6 3.7

M F M F

20 26 5 5

Maximum width of Pm4 3.3 ± 0.15 3.1–3.7 3.3 ± 0.15 3.1–3.6 3.2 ± 0.13 3.1–3.4 3.2 ± 0.28 3.0–3.7

4.4 4.4 3.9 8.5

M F M F

19 26 5 5

Maximum length of M1 4.6 ± 0.28 4.0–5.0 4.6 ± 0.31 4.0–5.1 3.8 ± 0.15 3.6–4.0 3.7 ± 0.35 3.2–4.1

6.9 6.2 3.9 9.5

M F M F

19 26 5 5

Maximum width of M1 4.3 ± 0.15 4.1–4.6 4.3 ± 0.15 4.1–4.7 3.9 ± 0.23 3.7–4.2 3.7 ± 0.14 3.5–4.0

3.5 3.6 5.7 3.8

M F M F

20 25 5 5

Maximum length of M2 4.6 ± 0.29 4.2–5.4 4.6 ± 0.22 4.3–5.1 3.6 ± 0.10 3.4–3.7 3.7 ± 0.27 3.4–4.0

4.7 6.3 2.8 7.4

M F M F

20 25 5 5

Maximum width of M2 4.3 ± 0.17 4.1–4.6 4.3 ± 0.14 4.1–4.7 3.7 ± 0.15 3.5–3.9 3.6 ± 0.16 3.3–3.8

3.2 3.9 4.2 4.5

M F M F

20 25 5 5

Maximum length of M3 5.3 ± 0.28 4.7–5.8 5.3 ± 0.26 4.7–5.7 4.3 ± 0.16 4.1–4.5 4.1 ± 0.20 3.9–4.4

4.9 5.3 3.8 4.8

M F M F

20 25 5 5

Maximum width of M3 3.5 ± 0.15 3.3–3.8 3.5 ± 0.18 3.1–3.9 2.8 ± 0.19 2.5–3.0 2.7 ± 0.31 2.2–3.0

5.1 4.2 6.7 11.5

Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Mean ± SD

Range

CV

F

P

0.18

0.68

0.01

0.94

0.56

0.46

0.02

0.90

0.09

0.77

0.45

0.52

1.25

0.27

2.89

0.13

0.02

0.88

0.14

0.72

3.10

0.08

2.37

0.16

0.15

0.69

5.26

0.051

0.20

0.66

0.55

0.48

266

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 (continued) Secondary Sexual Variation in Cranial, Dental, and Postcranial Measurements of Recent Samples of Solenodon from Central Dominican Republic, Hispaniola (Sample 3) and Eastern Cuba (Sample 7) Sample

Sex

N

Mean ± SD

Hispaniola

M F M F

10 17 2 1

M F M F

11 17 3 1

Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Range

CV

F

P

Total length of femur 46.4 ± 1.76 43.3–48.6 47.0 ± 1.52 44.9–50.4 46.6 ± 1.41 45.6–47.6 46.5

3.2 3.8 3.0

1.12

0.30

Maximun width of femur 13.4 ± 0.53 12.3–13.9 13.5 ± 0.42 12.8–14.3 12.8 ± 0.86 12.2–13.8 12.6

3.1 4.0 6.8

0.45

0.51

M F M F

Minimum shaft width of femur 11 5.2 ± 0.24 4.9–5.6 4.4 17 5.3 ± 0.23 5.0–5.8 4.5 3 4.4 ± 0.46 4.1–4.9 10.5 1 4.5

1.05

0.32

M F M F

10 17 3 1

3.1 3.4 4.3

0.16

0.69

M F M F

11 17 3 1

3.1 3.4 4.4

0.17

0.68

M F M F

Minimum shaft width of humerus 11 5.1 ± 0.25 4.6–5.4 6.0 17 5.0 ± 0.30 4.6–5.8 5.0 3 3.9 ± 8.90 3.8–4.0 2.3 1 4.0

0.72

0.40

M F M F

6 11 2 2

2.50

0.13

1.30

0.37

M F M F

6 11 2 2

0.48

0.50

0.28

0.34

Total length of humerus 47.9 ± 1.61 45.5–49.7 48.1 ± 1.48 45.6–50.7 42.5 ± 1.84 41.1–44.6 42.6 Maximum width 17.9 ± 0.61 18.0 ± 0.56 15.0 ± 0.66 15.9

Total length 54.2 ± 2.72 52.5 ± 1.73 48.6 ± 1.15 51.0 ± 2.62

of humerus 16.7–18.5 17.0–18.8 14.4–15.7

of ulna 50.3–58.0 50.3–56.2 47.8–49.5 49.1–52.8

Maximum width of ulna 7.1 ± 0.21 6.8–7.4 7.0 ± 0.41 6.2–7.6 6.6 ± 0.56 6.1–7.2 6.9 ± 0.63 6.4–7.3

3.3 5.0 2.4 5.1

5.8 3.1 8.6 9.2

Systematics and Biogeography of the West Indian Genus Solenodon

267

TABLE 1 (continued) Secondary Sexual Variation in Cranial, Dental, and Postcranial Measurements of Recent Samples of Solenodon from Central Dominican Republic, Hispaniola (Sample 3) and Eastern Cuba (Sample 7) Sample

Sex

N

Hispaniola

M F M F

6 11 3 2

M F M F

27 22 4 6

529 549 462 426

Total length ± 27.9 485–580 ± 43.2 498–715 ± 47.4 429–530 ± 80.1 325–530

5.3 7.9 10.3 18.8

M F M F

13 8 4 6

Head-body length 296 ± 13.8 273–320 325 ± 67.3 286–490 301 ± 47.9 260–360 253 ± 55.8 195–340

4.7 20.7 15.9 22.0

M F M F

26 22 4 6

224 227 161 162

Tail length ± 14.3 202–254 ± 11.7 196–242 ± 14.4 140–170 ± 23.9 130–190

6.4 5.1 8.9 14.8

M F M F

20 17 4 6

Hind foot length 63.5 ± 4.9 56–72 64.7 ± 4.1 57–70 52.0 ± 5.0 45–56 54.2 ± 2.6 50–56

7.8 6.3 9.6 4.7

M F M F

22 15 4 6

Ear length 28.5 ± 2.2 22–31 28.9 ± 4.1 21–38 24.0 ± 8.2 15–31 28.8 ± 2.7 25–32

7.8 14.2 34.4 9.4

M F M

17 8 2

Body weight (g) 801.4 ± 88.1 620–1080 860.7 ± 165. 726–1166 769.0 ± 55.1 730–808

11.0 19.2 7.1

Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Hispaniola Cuba

Mean ± SD

Range

CV

Minimum shaft width of ulna 2.2 ± 0.16 2.0–2.4 8.5 2.0 ± 0.17 1.7–2.3 7.2 1.6 ± 0.26 1.3–1.9 16.2 1.7 ± 9.89 1.6–1.7 5.9

F

P

3.08

0.09

0.12

0.75

3.82

0.05

0.65

0.55

2.28

0.14

1.39

0.30

0.69

0.41

0.19

0.83

0.68

0.42

5.08

0.03

0.12

0.72

1.08

0.39

1.40

0.25

Note: Statistics given are number (N), mean ± standard deviation, range, coefficient of variation (CV), and F value. Means for males and females that are significantly different at P < 0.05 are marked with an asterisk.

268

Biogeography of the West Indies: Patterns and Perspectives

the lower dentition were identical for males and females from Hispaniola. Measurements of the upper teeth were also very close for both sexes, including that of the canines, often an important character in secondary sexual dimorphism in mammals. Males were then tested against females from the Dominican Republic (as one sample), and no significant differences were observed between males and females in any of the measurements. Considering these results, males and females were not treated separately in subsequent analyses. Individual Variation The majority of the internal measurements examined revealed a relatively low degree of individual variation as expressed by the coefficient of variation (Tables 1 through 3). Cranial and mandibular measurements in all populations usually had coefficients of variation of less than 5, whereas dental and limb bone measurements ranged mostly between 2 and 15. All external measurements, except hind foot length and body weight, had higher coefficients of variation, and therefore were excluded from geographical variation analysis.

SPECIFIC RELATIONSHIPS (GEOGRAPHICAL VARIATION) To establish the specific relationships of the Solenodon populations from Cuba, the Dominican Republic, and Haiti, univariate and multivariate analyses were utilized to compare the geographical samples. Univariate Analyses Standard statistics for each geographical sample of living solenodons and the results of Duncan’s multiple range test for determination of the maximally nonsignificant subsets of 41 variables are given in Table 2. The GLM-ANOVA analysis yielded highly significant differences between the seven geographical samples in all measurements with the exception of one (interorbital constriction). Results of Duncan’s test revealed geographical samples from North Hispaniola (samples 1, 2, 3) grouped alone in one subset differed significantly from all other samples in the following eight measurements: greatest length of skull, condylobasal length, palatal length, length of maxillary toothrow, length of mandibular toothrow, alveolar length of P4-M3, maximum length of P4, and total length of humerus. The samples from North Hispaniola, also assembled separately, differed significantly from the rest of the samples in two nonoverlapping subsets for two measurements (maximum width of M3 and angular-condylar height) and in two overlapping subsets for one measurement (greatest mandible length). Furthermore, the three samples from North Hispaniola grouped together with the sample from southwestern Haiti (sample 6, South Hispaniola) in a single subset, differing significantly from all other samples in the following eight measurements: length of upper molar toothrow, breadth across maxillary toothrow, maximum width of C1, maximum width of P4, maximum length of M1, maximum width of M1, maximum width of M2, maximum width of M3. The samples from South Hispaniola (samples 4, 5, 6) grouped together in 11 measurements with the Cuban population (7) differed significantly from North Hispaniolan samples, in one (angular-condylar height, maximum length of P4, total length of humerus) or in two or more overlapping subsets (greatest length of skull, condylobasal length, palatal length, length of maxillary toothrow, greatest mandible length, length of mandibular toothrow, maximum width of femur, total length of humerus). All three South Hispaniolan samples also clustered in one subset in three measurements (maximum width of M3, maximum width of P4, and total length of femur), and in two significantly different subsets in one (alveolar length of P4M3). Whereas the Haitian sample showed an intermediate position between the North and Dominican Republic south samples (4, 5) in eight measurements, the latter populations differed significantly from all other samples in length of upper molar toothrow, maximum width of C1, and maximum length of M1. These two samples also separated from the others with the Cuban population in breadth across maxillary toothrow (in one subset) and in maximum width of M1, maximum width of M2, and maximum width of M3 (in two subsets). The sample from Sierra de Baoruco (5) isolated from all other samples in one subset in P4-M3 and maximum length of M2.

Systematics and Biogeography of the West Indian Genus Solenodon

269

TABLE 2 Geographical Variation in Cranial and Postcranial Measurements of Seven Samples of Extant Solenodon Populations from North Hispaniola (Samples 1, 2, and 3, Dominican Republic), South Hispaniola (Samples 4, 5, Dominican Republic; and 6, Haiti), and Eastern Cuba (Sample 7) Range

CV

F and P Values

Sample No.

N

Mean ± SD

3 1 2 4 6 5 7

55 4 16 11 16 10 12

86.5 85.8 85.3 80.7 80.5 79.8 78.2

± ± ± ± ± ± ±

2.36 3.51 2.25 2.21 2.18 2.90 3.51

Greatest length of skull 81.0–91.5 2.7 82.7–90.9 4.1 80.9–88.4 2.6 76.3–83.1 2.7 76.2–83.5 2.7 72.3–82.6 3.6 71.4–82.8 4.5

3 1 2 6 4 5 7

53 4 16 16 11 10 12

81.1 80.3 79.9 76.4 75.7 75.2 73.9

± ± ± ± ± ± ±

2.30 3.22 2.16 1.93 2.53 3.15 2.87

Condylobasal length 76.0–86.6 2.8 77.0–84.2 4.0 75.5–82.7 2.7 73.4–79.4 2.5 71.2–78.4 3.3 67.1–78.9 4.2 68.6–77.8 3.9

3 2 1 6 4 7 5

55 16 4 19 12 14 10

37.4 37.1 37.0 35.5 34.5 34.3 34.1

± ± ± ± ± ± ±

1.15 1.05 0.89 0.94 1.10 1.07 1.44

Palatal length 34.8–40.4 3.1 35.0–38.6 2.8 36.4–38.3 2.4 34.0–37.0 2.7 32.8–35.8 3.2 31.8–35.7 3.1 30.8–35.7 4.2

1 3 2 4 6 5 7

4 52 18 11 17 10 12

31.0 30.5 30.1 29.1 29.0 28.8 27.1

± ± ± ± ± ± ±

2.05 1.02 1.22 1.4 0.97 1.36 1.27

Postpalatal 28.2–32.6 27.6–32.3 27.9–32.0 26.8–31.2 27.6–31.0 25.6–30.2 25.0–29.3

1 3 2 6 4 5 7

4 52 18 21 12 10 14

Alveolar length of upper molar toothrow 10.5 ± 0.11 10.4–10.6 1.0 10.3 ± 0.67 9.1–12.9 6.5 10.9 ± 0.38 10.4–11.7 3.5 9.7 ± 0.50 8.7–10.6 5.2 26.37*** 9.6 ± 0.68 7.9–10.7 7.1 0.0001 9.5 ± 0.60 8.4–10.4 6.3 8.2 ± 0.62 7.3–9.8 7.6

length 6.7 3.4 4.1 4.7 3.4 4.7 4.7

Results Duncan’s I I I

33.36*** 0.0001

I I I

I I I

I I I 25.94*** 0.0001

I I I

I I I

I I I 31.49*** 0.0001

I I

I I I 17.69*** 0.0001

I I

I I I

I I I I

I I I

I I I

I I I I

270

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 (continued) Geographical Variation in Cranial and Postcranial Measurements of Seven Samples of Extant Solenodon Populations from North Hispaniola (Samples 1, 2, and 3, Dominican Republic), South Hispaniola (Samples 4, 5, Dominican Republic; and 6, Haiti), and Eastern Cuba (Sample 7) Range

CV

F and P Values

Sample No.

N

Mean ± SD

3 2 1 6 4 5 7

51 18 4 18 12 10 12

Length of upper molar toothrow 11.1 ± 0.45 9.9–12.0 4.1 10.9 ± 0.38 10.4–11.7 3.5 10.9 ± 0.30 10.6–11.3 2.8 10.7 ± 0.39 10.0–11.6 3.6 57.05*** 10.3 ± 0.41 9.6–11.1 4.0 0.0001 10.1 ± 0.55 9.3–11.0 5.5 8.6 ± 0.44 8.0–9.6 5.1

3 1 2 6 4 7 5

52 4 18 21 12 14 10

26.3 25.7 25.6 24.5 24.2 23.7 23.5

± ± ± ± ± ± ±

Length of maxillary toothrow 0.76 24.5–27.6 2.9 0.75 25.1–26.8 2.9 0.93 23.6–27.5 3.6 0.75 23.5–25.7 3.1 38.08*** 0.81 23.0–25.7 3.3 0.0001 0.87 21.8–24.7 3.7 0.95 21.6–25.1 4.1

3 1 2 6 4 7 5

52 4 17 21 12 14 10

23.9 23.2 23.2 23.1 21.7 21.5 21.2

± ± ± ± ± ± ±

Breadth across maxillary toothrow 0.87 21.7–25.9 3.7 0.50 22.7–23.9 2.2 1.04 21.3–25.3 4.5 0.73 22.1–24.9 3.2 23.07*** 1.24 19.6–23.8 5.7 0.0001 1.16 20.3–23.9 5.4 1.01 19.2–22.5 4.8

7 3 1 2 6 4 5

14 55 4 17 21 12 10

15.0 14.2 13.8 13.8 13.6 13.5 13.5

± ± ± ± ± ± ±

0.72 0.65 0.34 0.81 0.61 0.40 1.08

Anteorbital constriction 14.3–16.4 4.8 12.9–15.9 4.6 13.4–14.2 2.5 12.6–15.1 5.9 12.6–14.6 4.5 12.7–14.3 3.0 11.6–14.9 8.1

3 2 1 5 7 4 6

43 15 4 9 9 11 18

34.5 33.4 33.2 32.8 32.4 32.4 32.2

± ± ± ± ± ± ±

1.68 1.79 1.15 1.06 1.31 1.26 0.89

Zygomatic breadth 31.5–39.0 4.9 30.3–35.8 5.4 31.9–34.4 3.5 31.2–34.5 3.2 30.5–35.2 4.0 30.1–34.9 3.9 30.1–34.2 2.8

Results Duncan’s I I I I I I I

I I I I I

I I I

I I I I I I I

I I I I

9.90*** 0.0001

I I I 8.07*** 0.0001

I I I I I I

I I I I I

Systematics and Biogeography of the West Indian Genus Solenodon

271

TABLE 2 (continued) Geographical Variation in Cranial and Postcranial Measurements of Seven Samples of Extant Solenodon Populations from North Hispaniola (Samples 1, 2, and 3, Dominican Republic), South Hispaniola (Samples 4, 5, Dominican Republic; and 6, Haiti), and Eastern Cuba (Sample 7) Sample No.

N

Mean ± SD

Range

CV

7 1 3 2 6 4 5

13 5 55 17 20 11 10

15.2 15.1 14.9 14.9 14.7 14.6 14.5

± ± ± ± ± ± ±

0.62 0.38 0.58 0.50 0.44 0.43 0.48

3 1 7 6 2 4 5

55 5 12 18 17 11 9

32.1 31.4 30.9 30.3 30.2 30.2 30.2

± ± ± ± ± ± ±

1.29 0.92 0.79 0.92 1.55 0.65 0.83

Squamosal 29.2–34.5 30.3–32.7 29.6–31.9 28.9–31.6 28.2–33.3 29.0–31.3 28.6–31.6

3 1 2 6 5 7 4

54 4 18 16 9 12 11

25.9 25.6 25.5 25.0 24.6 24.6 24.2

± ± ± ± ± ± ±

1.01 1.25 0.94 0.75 1.13 0.67 0.54

Mastoid breadth 23.7–28.4 3.9 23.8–26.6 4.9 23.5–27.1 3.7 23.7–26.1 3.0 22.6–26.6 4.6 23.0–25.6 2.7 23.4–25.1 2.3

7 3 1 6 2 4 5

12 54 5 19 18 11 9

25.1 24.9 24.5 24.4 24.3 24.2 24.0

± ± ± ± ± ± ±

0.82 0.79 0.59 0.64 0.75 0.51 0.93

3 2 1 6 5 7 4

53 18 4 17 10 12 11

17.0 16.8 16.7 16.3 16.2 16.1 16.0

± ± ± ± ± ± ±

0.70 0.65 0.51 0.49 0.77 0.70 0.55

Interorbital constriction 14.5–16.4 4.1 14.7–15.7 2.6 13.6–16.5 3.9 13.6–15.9 3.4 13.7–15.4 3.0 14.0–15.4 3.0 13.6–15.6 3.3 breadth 4.0 2.9 2.6 3.0 5.1 2.2 2.8

Breadth of the 24.0–26.4 23.4–26.6 23.6–25.3 23.1–25.2 23.0–25.7 23.7–25.2 22.0–25.3

F and P Values

2.02 0.06

I I I I I

I I

I I I I I

I I

11.46*** 0.0001

I I I 9.29*** 0.0001

braincase 3.3 3.2 2.4 2.7 4.85*** 3.1 0.0002 2.1 3.9

Condylar breadth 15.3–18.4 4.1 15.6–18.4 3.9 16.2–17.4 3.0 14.8–16.8 3.0 15.2–17.4 4.8 15.0–17.2 4.4 15.4–16.9 3.4

Results Duncan’s

I I I

I I I 6.95*** 0.0001

I I I

I I I I

I I I I

I I I I I

I I I I I

I I I I

I I I I I

I I I I I

272

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 (continued) Geographical Variation in Cranial and Postcranial Measurements of Seven Samples of Extant Solenodon Populations from North Hispaniola (Samples 1, 2, and 3, Dominican Republic), South Hispaniola (Samples 4, 5, Dominican Republic; and 6, Haiti), and Eastern Cuba (Sample 7) Sample No.

N

Mean ± SD

3 7 2 1 6 4 5

54 11 18 5 17 11 10

20.0 19.2 19.0 18.9 18.8 18.6 18.2

3 7 6 2 1 5 4

7 3 1 2 6 5 4

12 12 22 9 4 9 9

12 12 4 9 22 9 9

4.5 4.5 4.2 4.2 4.2 3.7 3.5

3.0 2.4 2.3 2.3 2.3 2.1 2.1

± ± ± ± ± ± ±

± ± ± ± ± ± ±

± ± ± ± ± ± ±

0.96 0.89 1.38 1.19 1.35 1.03 1.19

Range

CV

Skull height 17.3–22.2 4.8 17.8–20.6 4.7 17.0–21.3 7.3 17.4–20.5 6.3 15.2–20.7 7.2 17.3–20.5 5.6 16.5–20.4 6.6

0.37 0.27 0.28 0.19 0.27 0.20 0.24

Maximum length of C1 3.9–5.2 8.3 4.1–4.8 6.1 3.8–4.7 6.7 3.9–4.5 4.5 3.8–4.3 6.6 3.3–4.0 5.6 3.0–3.9 6.9

0.16 0.97 0.19 0.85 0.12 0.59 0.59

Maximum width of C1 2.6–3.2 5.7 2.2–2.6 4.1 2.1–2.6 8.1 2.1–2.4 3.7 2.0–2.5 5.6 2.0–2.2 2.8 2.0–2.2 2.8 Maximum width of M3 5.2–7.5 5.4 6.1–6.4 2.9 5.4–7.7 9.3 5.2–6.7 6.8 4.8–6.4 8.6 4.4–7.2 15.4 4.2–5.3 6.6

3 1 2 6 5 4 7

53 4 18 19 10 12 12

6.6 6.2 6.2 5.7 5.5 5.4 4.7

± ± ± ± ± ± ±

0.35 0.17 0.58 0.38 0.47 0.84 0.31

3 1 2 6 4 5 7

55 6 17 23 11 9 13

54.2 53.6 52.8 50.6 50.2 49.2 48.9

± ± ± ± ± ± ±

1.58 1.35 1.39 1.48 1.31 1.58 1.97

F and P Values

Results Duncan’s I I

6.76*** 0.0001

I I 19.64*** 0.0001

I I I I I I

I I I

I I I I I

I I I I I

69.66*** 0.0001

I I

I I I 39.06*** 0.0001

Greatest mandible length 50.9–58.1 2.9 51.8–55.3 2.5 50.9–55.3 2.6 47.7–52.6 2.9 38.99*** 47.4–51.6 2.6 0.0001 45.2–50.5 3.2 44.7–51.9 4.0

I I I I

I I

I I I I

I I

I I

Systematics and Biogeography of the West Indian Genus Solenodon

273

TABLE 2 (continued) Geographical Variation in Cranial and Postcranial Measurements of Seven Samples of Extant Solenodon Populations from North Hispaniola (Samples 1, 2, and 3, Dominican Republic), South Hispaniola (Samples 4, 5, Dominican Republic; and 6, Haiti), and Eastern Cuba (Sample 7) N

Mean ± SD

3 1 2 6 4 7 5

54 6 18 24 11 14 9

27.3 26.9 26.7 25.7 25.4 25.2 24.6

± ± ± ± ± ± ±

Length of mandibular toothrow 0.79 25.1–28.9 2.9 0.63 25.9–27.7 2.3 1.31 23.3–28.2 4.9 0.76 24.3–27.4 3.2 25.28*** 0.76 24.1–26.3 3.0 0.0001 0.93 23.0–26.3 3.7 0.85 23.5–26.3 3.5

1 3 2 6 4 5 7

6 52 18 24 11 9 14

17.3 17.2 16.9 16.1 16.0 15.4 14.2

± ± ± ± ± ± ±

0.46 0.68 0.74 0.51 0.53 0.59 0.44

3 1 2 4 7 6 5

53 6 17 11 14 23 9

24.1 23.3 23.0 22.9 22.5 22.5 22.2

± ± ± ± ± ± ±

Depth through coronoid process 1.09 22.2–26.2 4.5 1.08 22.0–24.5 4.7 1.31 20.6–25.0 5.7 0.79 21.5–23.9 3.5 10.96*** 1.13 20.6–24.2 5.0 0.0001 0.82 20.6–23.6 3.7 0.89 21.1–24.1 4.0

3 1 2 7 4 6 5

55 6 17 13 11 24 9

15.0 14.7 13.8 13.2 13.1 12.9 12.8

± ± ± ± ± ± ±

0.81 0.68 0.86 0.90 1.00 0.52 0.62

1 3 2 6 4 7 5

5 53 17 23 11 13 9

4.4 ± 0.27 4.3 ± 0.23 4.2 ± 0.23 3.9 ± 0.29 3.9 ± 0.38 3.9 ± 0.32 3.7 ± 0.24

Range

CV

F and P Values

Sample No.

Alveolar length of P4-M3 16.7–17.9 2.7 14.9–18.5 4.0 15.8–18.2 4.4 15.4–17.3 3.2 55.22*** 15.3–16.8 3.3 0.0001 14.6–16.7 3.8 13.5–14.8 3.1

Angular-condylar height 13.4–17.1 5.4 13.9–15.6 4.6 12.2–15.6 6.2 12.1–14.7 6.8 33.76*** 12.6–15.1 7.6 0.0001 12.0–14.0 4.0 11.9–13.8 4.8 Maximum length of P4 3.9–4.7 6.3 3.7–4.9 5.6 3.8–4.7 5.5 3.5–4.9 7.4 3.5–4.6 9.8 3.4–4.7 8.4 3.5–4.2 6.6

Results Duncan’s I I I I I I

I I I I I I I

I I

I I I I I

I I I I I

I I I I I I I

I I I 12.33*** 0.0001

I I

I I I I

274

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 (continued) Geographical Variation in Cranial and Postcranial Measurements of Seven Samples of Extant Solenodon Populations from North Hispaniola (Samples 1, 2, and 3, Dominican Republic), South Hispaniola (Samples 4, 5, Dominican Republic; and 6, Haiti), and Eastern Cuba (Sample 7) Sample No.

N

Mean ± SD

Range

CV

3 1 7 2 6 4 5

53 5 13 18 23 10 9

3.3 ± 0.17 3.3 ± 0.15 3.2 ± 0.18 3.2 ± 0.31 2.8 ± 0.20 2.7 ± 0.18 2.7 ± 0.28

Maximum width of P4 2.7–3.7 5.6 3.1–3.4 4.6 3.1–3.7 5.7 2.8–3.8 9.6 2.3–3.1 7.1 2.6–3.2 6.4 2.2–3.2 10.4

1 3 2 6 4 5 7

4 52 18 23 11 9 13

4.8 4.6 4.6 4.5 4.3 4.2 3.7

± ± ± ± ± ± ±

0.19 0.30 0.19 0.20 0.27 0.24 0.29

Maximum length of M1 4.6–5.0 4.1 4.0–5.1 6.5 4.1–4.8 4.1 4.2–5.0 4.5 4.0–4.9 6.1 4.0–4.7 5.6 3.2–4.1 7.9

3 1 2 6 7 4 5

52 4 18 23 13 10 9

4.3 4.2 4.2 4.1 3.9 3.8 3.7

± ± ± ± ± ± ±

0.17 0.85 0.22 0.18 0.19 0.29 0.26

Maximum width of M1 3.8–4.7 4.1 4.1–4.3 2.1 3.9–4.7 5.3 3.8–4.4 4.3 3.6–4.2 5.0 3.5–4.6 7.8 3.3–4.2 7.1

3 1 2 6 4 5 7

52 5 18 22 11 8 13

4.6 4.6 4.6 4.5 4.5 4.2 3.6

± ± ± ± ± ± ±

0.26 0.19 0.25 0.20 0.20 0.16 0.18

Maximum length of M2 4.0–5.4 5.6 4.4–4.9 4.1 4.1–5.0 5.4 4.1–5.0 4.6 4.2–4.8 4.5 3.9–4.4 3.9 3.4–4.0 5.2

3 1 2 6 4 5 7

52 6 18 22 10 8 13

4.3 4.2 4.2 4.1 3.9 3.7 3.6

± ± ± ± ± ± ±

0.17 0.11 0.20 0.17 0.25 0.23 0.15

Maximum width of M2 3.8–4.7 4.0 4.1–4.4 2.7 3.9–4.7 4.8 3.8–4.5 4.0 3.7–4.5 6.5 3.5–4.3 6.1 3.4–3.9 4.3

F and P Values

28.65*** 0.0001

23.81*** 0.0001

Results Duncan’s I I I I I I I

I I I I I I I

I I I 22.17*** 0.0001

35.19*** 0.0001

I I I I I

I I

I I I I I I I

33.59*** 0.0001

I I I I I I

I I

Systematics and Biogeography of the West Indian Genus Solenodon

275

TABLE 2 (continued) Geographical Variation in Cranial and Postcranial Measurements of Seven Samples of Extant Solenodon Populations from North Hispaniola (Samples 1, 2, and 3, Dominican Republic), South Hispaniola (Samples 4, 5, Dominican Republic; and 6, Haiti), and Eastern Cuba (Sample 7) Mean ± SD

Range

N

3 1 2 6 4 5 7

52 5 18 18 11 9 13

5.3 5.3 5.1 5.0 4.9 4.7 4.2

± ± ± ± ± ± ±

0.27 0.10 0.25 0.23 0.26 0.28 0.22

Maximum length of M3 4.7–5.8 5.2 5.2–5.4 1.8 4.7–5.9 4.9 4.4–5.4 4.7 4.5–5.3 5.3 4.3–5.3 6.0 3.9–4.5 5.2

3 1 2 6 4 5 7

52 5 18 18 11 9 13

3.5 3.5 3.5 3.3 3.1 3.0 2.9

± ± ± ± ± ± ±

0.19 0.17 0.19 0.11 0.30 0.19 0.39

Maximum width of M3 3.0–4.0 5.5 3.3–3.7 5.0 3.1–3.9 5.6 3.1–3.5 3.5 2.9–3.9 9.6 2.7–3.4 6.4 2.2–3.9 13.5

1 3 7 2 6 4 5

3 29 5 10 24 10 8

47.1 46.8 46.7 46.3 44.8 43.8 43.6

± ± ± ± ± ± ±

1.35 1.61 0.78 1.40 1.44 1.40 1.43

3 1 2 7 4 5 6

30 4 10 6 9 8 25

13.4 13.3 13.3 12.7 12.6 12.5 12.4

± ± ± ± ± ± ±

0.45 0.49 0.80 0.61 0.42 0.55 0.56

1 2 3 5 4 6 7

4 10 30 8 10 25 6

5.5 5.4 5.3 5.1 5.1 4.7 4.5

± ± ± ± ± ± ±

Minimum shaft width of femur 0.59 5.2–6.4 10.7 0.35 4.8–5.9 6.6 0.24 4.9–5.8 4.7 0.43 4.6–6.0 8.4 11.96*** 0.40 4.5–5.7 8.0 0.0001 0.24 4.3–5.4 5.1 0.31 4.1–4.9 6.9

Total length 45.7–48.3 43.3–50.4 45.6–47.6 44.3–48.8 42.4–47.6 41.4–45.5 41.0–45.8

CV

F and P Values

Sample No.

of femur 2.9 3.4 1.7 3.0 3.2 3.2 3.3

Results Duncan’s I I I

36.03*** 0.0001

I I I

I I I

22.99*** 0.0001

10.94*** 0.0001

Maximum width of femur 12.3–14.3 3.4 12.8–14.0 3.7 12.3–14.6 6.1 12.1–13.8 4.8 9.90*** 11.9–13.3 3.3 0.0001 11.6–13.3 4.4 11.4–13.4 4.5

I I I I I I

I I

I I I I I I I

I I I I I I I

I I I

I I I I

I I I I

276

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 (continued) Geographical Variation in Cranial and Postcranial Measurements of Seven Samples of Extant Solenodon Populations from North Hispaniola (Samples 1, 2, and 3, Dominican Republic), South Hispaniola (Samples 4, 5, Dominican Republic; and 6, Haiti), and Eastern Cuba (Sample 7) Range

CV

F and P Values

Sample No.

N

Mean ± SD

3 1 2 4 6 5 7

29 3 11 8 21 8 5

48.0 47.1 46.8 44.2 44.0 43.9 42.6

± ± ± ± ± ± ±

1.45 0.52 1.54 1.23 1.36 1.30 1.35

3 1 2 6 5 4 7

30 3 11 22 8 10 6

17.9 17.9 17.8 17.3 17.0 16.8 14.9

± ± ± ± ± ± ±

Maximum width 0.59 16.7–18.8 0.35 17.6–18.3 0.53 16.8–18.5 0.57 16.1–18.2 0.78 16.0–18.3 0.65 15.8–18.1 0.75 14.1–15.9

1 6 3 2 5 4 7

3 21 30 11 8 10 6

5.2 5.0 5.0 5.0 4.9 4.9 3.9

± ± ± ± ± ± ±

Minimum shaft width of humerus 0.28 4.9–5.4 5.5 0.23 4.5–5.4 4.5 0.29 4.6–5.8 5.7 0.35 4.4–5.5 7.1 15.25*** 0.34 4.5–5.5 7.0 0.0001 0.30 4.3–5.4 6.2 0.70 3.8–4.0 1.8

1 3 2 6 4 7 5

3 19 8 17 7 6 6

53.6 53.2 52.2 51.1 51.1 49.6 49.4

± ± ± ± ± ± ±

1.13 2.09 1.39 1.13 1.59 1.90 4.53

3 1 2 4 7 5 6

19 4 8 7 7 6 16

7.0 6.9 6.8 6.8 6.7 6.7 6.4

± ± ± ± ± ± ±

0.33 0.39 0.47 0.33 0.47 0.44 0.35

Total length of humerus 45.5–50.7 3.0 46.7–47.7 1.1 43.9–49.0 3.3 42.2–45.4 2.9 27.90*** 40.6–46.8 3.1 0.0001 41.3–45.6 3.0 41.2–44.6 3.2

Total length 52.3–54.3 50.3–58.0 50.0–54.0 49.0–53.4 49.3–53.8 47.8–52.8 40.6–53.8

of humerus 3.3 2.0 3.0 3.3 23.51*** 4.6 0.0001 3.9 5.0

of ulna 2.1 3.9 2.7 2.2 3.1 3.8 9.2

Maximum width of ulna 6.2–7.6 4.7 6.4–7.2 5.7 6.0–7.4 6.9 6.3–7.1 4.9 6.1–7.3 7.0 5.9–7.2 6.7 5.9–7.1 5.6

4.66*** 0.0006

4.49*** 0.0008

Results Duncan’s I I I I I I I

I I I I

I I I I

I I I I I I I

I I I I I

I I I I I I

I I I

I I I

Systematics and Biogeography of the West Indian Genus Solenodon

277

TABLE 2 (continued) Geographical Variation in Cranial and Postcranial Measurements of Seven Samples of Extant Solenodon Populations from North Hispaniola (Samples 1, 2, and 3, Dominican Republic), South Hispaniola (Samples 4, 5, Dominican Republic; and 6, Haiti), and Eastern Cuba (Sample 7) Sample No.

N

1 3 6 2 4 5 7

3 19 17 8 7 6 7

Mean ± SD

2.2 2.1 2.0 2.0 1.8 1.8 1.6

± ± ± ± ± ± ±

Range

CV

F and P Values

Minimum shaft width of ulna 0.28 1.9–2.5 12.8 0.19 1.7–2.4 9.1 0.19 1.7–2.3 9.5 0.13 1.9–2.2 6.4 8.90*** 0.12 1.6–2.0 6.5 0.0001 0.20 1.5–2.1 11.6 0.16 1.4–1.9 9.9

Results Duncan’s I I I

I I I

I I

I I

I I

Note: Statistics given are number (N), mean ± standard deviation, range, coefficient of variation (CV), F and P values, and results of Duncan’s multiple range test (<0.05) showing nonsignificant subsets. Sample means that are significantly different are marked with asterisks: *(<0.05), **(<0.01), ***(<0.001). See Figure 2 and text for key to sample numbers.

The Cuban sample differed significantly from all other samples in 13 measurements (PPL, AMTR, MMTR, AC, WC1, WM3, P4-M3, LM1, LM2, LM3, FMW, MWH, HMW). Eastern Cuba clustered, in one overlapping subset, with North Hispaniolan samples in four measurements (skull height, maximum length of C1, maximum width of P4, total length of femur), and with South Hispaniolan in 15 measurements (greatest length of skull, condylobasal length, palatal length, length of maxillary toothrow, breadth across maxillary toothrow, greatest mandible length, length of mandibular toothrow, angular-condylar height, maximum length of P4, maximum width of M1, maximum width of M2, maximum width of M3, total length of humerus, maximum width of femur, total length of humerus). All samples assembled in two or more overlapping subsets in the following measurements: zygomatic breadth, interorbital constriction, squamosal breadth, mastoid breadth, breadth of braincase, condylar breadth, skull height, depth coronoid process, length of ulna, maximum width of ulna, and minimum shaft width of ulna. The three samples of Recent Solenodon were tested against and between samples of fossil to sub-Recent material of the genus from cave deposits and archaeological sites of Cuba and Hispaniola. The results of the univariate analysis and Duncan’s test are shown in Table 3. The extinct S. arredondoi from Cuba is significantly larger than all other population samples in 16 of the 29 measurements available for its sample. The Haitian sample of S. marcanoi (F) differed significantly from the rest of the samples, including the S. marcanoi sample from Rancho la Guardia (G), in 41 measurements and averaged smaller in 53 of the characters. Although averaging larger than Recent S. cubanus in most measurements, the fossil sub-Recent sample from Cuba (B) nested in one subset with the Recent sample of Cuba or overlapped with Cuban and Hispaniolan Recent samples in most cranial measurements, differing only in anteorbital constriction. However, it differed significantly in mandibular and lower tooth measurements from the other samples either alone (GML, P4M3, LC1, WC1, LP1, WP1, WP2) or sharing a subset with the larger North Hispaniola sample (MTR, DCP, ACH, LP4).

278

Biogeography of the West Indies: Patterns and Perspectives

TABLE 3 Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

Range

CV

FP

D E B C F

75 37 1 12 1

86.2 ± 2.42 80.3 ± 2.36 79.9 78.2 ± 3.51 71.6

D E B C F

73 37 1 12 1

80.8 ± 2.34 75.9 ± 2.47 75.8 73.9 ± 2.87 67.2

A D B E C F

1 75 4 41 14 5

40.7 37.3 ± 1.12 35.7 ± 1.56 34.9 ± 1.25 34.3 ± 1.07 28.4 ± 1.14

D E B C F

74 38 1 12 1

30.4 ± 1.14 29.0 ± 1.18 28.7 27.1 ± 1.27 25.4

D E A B C F

74 43 1 4 14 5

Alveolar length of upper 10.3 ± 0.60 9.1–12.9 9.6 ± 0.57 7.9–10.7 9.6 8.8 ± 0.64 8.0–9.4 8.2 ± 0.62 7.3–9.8 7.1 ± 0.37 6.6–7.6

D E A C F

73 40 1 12 3

Length 11.0 ± 0.43 10.4 ± 0.51 9.7 8.6 ± 0.44 7.9 ± 0.24

A D B

1 74 4

Length of maxillary toothrow 28.0 26.1 ± 0.85 23.6–27.6 3.3 25.2 ± 0.62 24.5–26.0 2.5 85.52***

Greatest length of skull 80.9–91.5 2.8 72.3–83.5 2.9 71.4–82.8

4.5

Results Duncan’s

I I I I

55.67*** 0.0001

I Condylobasal length 75.5–86.6 2.9 67.1–79.4 3.2 68.6–77.8

3.9

I I I I

43.33*** 0.0001

I Palatal length I 34.8–40.4 33.9–37.2 30.8–37.1 31.8–35.7 27.4–30.3

3.0 4.4 3.6 3.1 5.3

I 79.07*** 0.0001

I

Postpalatal length 27.6–32.6 3.8 25.6–31.2 4.1 25.0–29.3

4.7

I I I

29.43*** 0.0001

molar toothrow 5.9 5.9 55.79*** 7.3 0.0001 7.6 5.3

of upper molar toothrow 9.9–12.0 3.9 9.3–11.6 4.9 100.98*** 8.0–9.6 5.1 0.0001 7.6–8.1 3.0

I I I

I I I

I I I

I I I

I I

I I I

I I I I I

I I I

I

Systematics and Biogeography of the West Indian Genus Solenodon

279

TABLE 3 (continued) Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

Range

CV

FP

E C F

43 14 5

24.2 ± 0.90 23.7 ± 0.87 19.2 ± 0.92

21.6–25.8 21.8–24.7 17.6–20.0

3.7 3.7 4.8

0.0001

1 3 73 43 14 4

Breadth 25.2 23.7 ± 0.75 23.7 ± 0.94 22.3 ± 1.27 21.5 ± 1.16 17.4 ± 0.25

across maxillary toothrow

A B D E C F

A B C D E F

1 3 14 76 43 5

19.0 17.1 ± 0.52 15.0 ± 0.72 14.1 ± 0.69 13.5 ± 0.69 11.5 ± 0.34

A B D C E F

1 3 62 9 38 4

39.0 34.3 ± 0.57 34.2 ± 1.75 32.4 ± 1.31 32.4 ± 1.05 24.5 ± 0.57

A B C D E F

1 2 13 77 41 5

16.3 15.7 ± 0.65 15.2 ± 0.62 14.9 ± 0.56 14.6 ± 0.45 13.7 ± 0.28

A D B C E F

1 77 1 12 38 2

35.4 31.6 ± 1.53 31.2 30.9 ± 0.79 30.3 ± 0.81 24.1 ± 1.02

D B E

76 1 36

25.8 ± 1.01 25.0 24.7 ± 0.85

22.9–24.3 21.3–25.9 19.2–24.9 20.3–23.9 17.2–17.8

3.2 4.0 5.7 5.4 1.4

Results Duncan’s I

I I I

37.83*** 0.0001

I I I

I I

I I I

Anteorbital constriction I 16.8–17.8 14.3–16.4 12.6–15.9 11.6–14.9 11.0–11.9

3.3 4.8 5.0 5.1 3.0

I 47.59*** 0.0001

I I

I I I

Zygomatic breadth I 34.0–35.0 30.3–39.0 30.5–35.2 30.1–34.9 24.0–25.0

1.7 5.1 4.0 3.2 2.4

I I I I

39.05*** 0.0001

I

Interorbital constriction 15.3–16.2 14.5–16.4 13.6–16.5 13.6–15.4 13.3–14.1

4.1 4.1 3.7 3.1 2.0

I I 9.36*** 0.0001

I I

I I I I

Squamosal breadth I 28.2–34.5 29.6–31.9 28.6–31.6 23.4–24.8

4.8 2.6 2.7 4.2

I

Mastoid breadth 23.5–28.4 4.0 22.6–26.6

3.5

I I I I

19.71*** 0.0001

12.47*** 0.0001

I I I

I I

280

Biogeography of the West Indies: Patterns and Perspectives

TABLE 3 (continued) Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

Range

CV

C F

12 1

24.6 ± 0.67 23.4

23.0–25.6

2.7

B C D E F

1 12 77 39 1

25.3 25.1 ± 0.82 24.8 ± 0.81 24.2 ± 0.69 22.1

A D F E C B

1 75 1 38 12 1

18.9 16.9 ± 0.68 16.3 16.2 ± 0.58 16.1 ± 0.70 15.3

D C E F

77 11 38 1

19.7 ± 1.17 19.2 ± 0.89 18.6 ± 1.22 16.7

A B C D E F

1 3 12 25 40 2

5.7 4.6 ± 0.22 4.5 ± 0.27 4.4 ± 0.34 3.9 ± 0.41 2.8 ± 0.18

A B C D E F

1 3 12 25 40 2

3.9 3.1 ± 0.13 3.0 ± 0.16 2.3 ± 0.12 2.2 ± 0.13 1.6 ± 0.35

FP

Results Duncan’s I

I I

Breadth of the braincase 24.0–26.4 23.0–26.6 22.0–25.3

3.3 3.3 2.8

6.74*** 0.0001

I I I I I

Condylar breadth I 15.3–18.4 14.8–17.4 15.0–17.2

4.0 3.6 4.4

Skull height 17.0–22.2 5.9 17.8–20.6 4.7 15.2–20.7 6.6

I I I I

11.16*** 0.0001

9.39*** 0.0001

I I I I

I I I I

Maximum length of C1 I 4.4–4.8 4.1–4.8 3.8–5.2 3.0–4.7 2.7–2.9

4.7 6.1 7.9 10.4 6.4

I I I

16.53*** 0.0001

I I I I

Maximum width of C1 I 3.0–3.2 2.6–3.2 2.1–2.6 2.0–2.5 1.3–1.8

4.2 5.7 5.1 5.8 22.8

I I

114.92*** 0.0001

I I I

Maximum length of P1 A B D C E F

1 4 11 5 9 3

3.4 3.3 3.1 2.8 2.1

3.6 ± 0.21 ± 0.30 ± 0.11 ± 0.11 ± 0.05

3.2–3.7 2.8–3.7 2.9–3.2 2.7–3.1 2.1–2.2

6.1 9.1 3.5 4.2 1.2

19.79*** 0.0001

I I I

I I I

I I I

Systematics and Biogeography of the West Indian Genus Solenodon

281

TABLE 3 (continued) Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

A C B D E F

1 5 4 11 9 3

2.7 2.4 ± 0.05 2.3 ± 0.12 2.1 ± 0.09 2.0 ± 0.08 1.4 ± 0.15

A D B C E F

1 11 3 5 9 3

4.9 3.9 ± 0.28 3.8 ± 0.62 3.8 ± 0.44 3.2 ± 0.18 2.7 ± 0.07

Range

CV

FP

Results Duncan’s

Maximum width of P1 I 2.4–2.5 2.2–2.4 1.9–2.2 1.8–2.2 1.3–1.5

2.1 5.1 4.5 4.4 11.3

I I

62.20*** 0.0001

I I I

Maximum length of P2 I 3.5–4.3 3.4–4.6 3.1–4.2 3.0–3.5 2.6–2.8

7.2 16.2 11.6 5.6 2.8

I I I

14.07*** 0.0001

I I

Maximum width of P2 A B C D E F

1 3 5 11 9 3

3.8 3.7 2.4 2.2 1.7

4.2 ± 0.76 ± 0.26 ± 0.18 ± 0.17 ± 0.23

I

D B E C E

11 3 9 12 4

5.5 5.0 4.8 4.5 3.6

± ± ± ± ±

0.47 0.11 0.19 0.23 0.27

Maximum length of P4 4.8–6.5 8.5 4.9–5.1 2.2 4.5–5.1 4.6 4.2–4.9 5.0 3.2–3.8 7.7

32.66*** 0.0001

D B C E F

11 3 12 9 4

6.8 6.4 6.2 5.6 4.2

± ± ± ± ±

0.47 0.69 0.44 0.26 0.43

Maximum width of P4 6.2–7.4 6.9 5.6–6.9 10.9 5.0–6.7 7.1 5.4–6.2 4.6 3.9–4.5 10.1

28.77*** 0.0001

A D B E C F

1 11 4 9 11 3

4.2 4.2 ± 0.30 4.0 ± 0.45 3.7 ± 0.30 3.5 ± 0.26 3.3 ± 0.20

3.8–3.9 3.3–3.9 2.2–2.9 2.0–2.5 1.5–2.0

2.0 7.1 7.6 7.9 13.5

I I

88.05*** 0.0001

I I I

I I I

I

I I

I I I I

Maximum length of M1 3.5–4.6 3.5–4.6 3.3–4.2 3.2–4.0 3.2–3.6

7.3 11.2 8.0 7.3 6.1

I I

7.28*** 0.0001

I I I I

I I I

282

Biogeography of the West Indies: Patterns and Perspectives

TABLE 3 (continued) Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

D A C B E F

11 1 11 4 9 3

7.0 ± 0.50 7.0 6.7 ± 0.42 6.5 ± 0.12 6.0 ± 0.35 5.0 ± 0.05

D E B A C F

11 9 1 1 11 4

3.7 ± 0.35 3.3 ± 0.20 3.2 3.1 2.6 ± 0.32 2.5 ± 0.31

Range

CV

FP

Maximum width of M1 6.4–7.8 7.3 6.1–7.4 6.3–6.6 5.5–6.4 5.0–5.1

6.3 1.9 5.9 1.1

14.87*** 0.0001

I I I I

I I I I

Maximum length of M2 3.2–4.4 9.8 2.8–3.5 6.3 17.41*** 0.0001 2.0–3.0 2.1–2.9

Results Duncan’s

I I I I

12.5 12.3

I I I

Maximum width of M2 A D C E B F

1 11 11 9 1 4

7.0 7.0 ± 0.52 6.1 ± 0.34 6.1 ± 0.38 5.8 4.7 ± 0.06

D A E C F

11 1 9 11 4

2.6 ± 0.09 2.4 2.3 ± 0.13 2.0 ± 0.13 1.7 ± 0.10

D E A C F

75 41 1 12 4

6.5 ± 0.45 5.6 ± 0.57 5.4 4.7 ± 0.31 4.0 ± 0.24

D B E C F

78 6 43 13 9

53.9 51.9 50.2 48.9 41.2

D B

78 11

Length of mandibular toothrow 27.1 ± 0.95 23.3–28.9 3.5 26.8 ± 1.16 24.4–28.7 4.3

± ± ± ± ±

6.3–8.1 5.7–6.8 5.7–6.8

7.5 5.5 6.2

4.7–4.8

1.4

I I 20.35*** 0.0001

I

Maximum length of M3 2.4–2.8 3.8 2.1–2.6 1.8–2.3 1.6–1.9

5.7 6.6 6.2

Maximum width of M3 5.2–7.7 7.7 4.4–7.2 10.3 4.2–5.3 3.6–4.2

I I I

I 50.95*** 0.0001

I I I I

I 69.07*** 0.0001

I I

6.6 6.2

Greatest mandible length 1.62 50.9–58.1 3.0 2.27 49.3–55.1 4.4 133.47*** 1.53 45.2–52.6 3.1 0.0001 1.97 44.7–51.9 4.0 2.43 38.7–46.7 5.9

I I

I I I I I

I I

Systematics and Biogeography of the West Indian Genus Solenodon

283

TABLE 3 (continued) Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

E C G F

44 14 4 15

25.4 25.2 21.9 20.0

± ± ± ±

0.87 0.93 0.74 0.42

D E B C G F

76 44 15 14 5 18

17.2 15.9 15.2 14.2 12.9 12.2

± ± ± ± ± ±

0.68 0.59 0.84 0.44 1.43 0.38

B D C E G F

7 76 14 43 3 11

24.2 23.8 22.5 22.5 17.6 16.6

± ± ± ± ± ±

Depth 1.48 1.22 1.13 0.84 1.85 1.19

B D C E G F

10 78 13 44 3 13

15.3 14.8 13.2 12.9 10.8 10.0

± ± ± ± ± ±

0.92 0.95 0.90 0.68 0.71 1.13

B C D E F

1 7 11 8 3

5.0 4.4 ± 0.19 3.8 ± 0.23 3.5 ± 0.13 2.3 ± 0.18

B C D E F

1 7 11 8 3

2.9 2.5 ± 0.28 2.3 ± 0.15 2.2 ± 0.15 1.3 ± 0.13

B C D E

6 7 11 9

4.1 3.6 3.3 2.8

Range

CV

FP

23.5–27.4 23.0–26.3 21.2–22.6 19.2–20.6

3.4 3.7 3.4 2.1

177.75*** 0.0001

Results Duncan’s I I I I

Alveolar length of P4-M3 14.9–18.5 4.0 14.6–17.3 3.7 13.0–16.1 5.7 203.90*** 13.5–14.8 3.1 0.0001 10.5–14.1 11.1 11.6–13.0 3.1 through coronoid process 22.4–26.7 6.1 20.6–26.2 5.1 20.6–24.2 5.0 91.56*** 20.6–24.5 3.7 0.0001 15.8–19.5 10.5 15.5–19.7 7.2

Angular-condylar height 13.7–16.6 6.0 12.2–17.1 6.4 12.1–14.7 6.8 87.64*** 11.9–15.1 5.3 0.0001 10.0–11.4 6.5 8.4–12.7 11.3

I I I I I I

I I I I I I

I I I I I I

Maximum length of C1 I 4.1–4.6 3.5–4.3 3.3–3.8 2.2–2.5

3.5 6.2 3.7 7.8

I 77.78*** 0.0001

I I I

Maximum width of C1

± ± ± ±

0.18 0.24 0.22 0.20

I 2.1–2.9 2.1–2.6 2.0–2.5 1.2–1.4

11.5 6.6 6.8 9.9

Maximum length of P1 3.8–4.3 4.6 3.3–3.8 5.7 3.0–3.7 6.7 2.4–3.0 7.1

I I I

25.21*** 0.0001

I

I 50.60*** 50.601

I I I

284

Biogeography of the West Indies: Patterns and Perspectives

TABLE 3 (continued) Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

Range

CV

2.5 ± 0.25 2.3

2.3–2.9

10.1

FP

F G

8 1

B C D E G F

6 7 11 9 1 8

3.2 2.9 2.5 2.2

B C D E F

7 7 11 9 7

3.9 3.7 3.3 2.8 2.4

± ± ± ± ±

0.30 0.16 0.33 0.27 0.19

Maximum length of P2 3.7–4.2 7.7 3.3–4.5 10.8 2.9–4.0 9.8 2.4–3.3 9.7 2.1–2.6 8.0

31.96*** 0.0001

B C D E F

7 7 11 9 7

3.1 2.9 2.4 2.1 1.5

± ± ± ± ±

0.12 0.14 0.08 0.09 0.08

Maximum width 2.9–3.3 2.6–3.0 2.3–2.5 2.1–2.3 1.4–1.6

255.05*** 0.0001

D B E C G F

75 6 43 13 4 10

4.3 4.3 3.9 3.9 3.2 3.0

± ± ± ± ± ±

0.24 0.25 0.31 0.32 0.15 0.15

Maximum length of P4 3.7–4.9 5.6 4.1–4.7 6.0 3.5–4.9 8.1 3.4–4.7 8.4 3.1–3.5 4.6 2.7–3.2 5.2

B D C E G F

7 76 13 42 4 10

3.3 3.3 3.2 2.8 2.3 2.0

± ± ± ± ± ±

0.21 0.21 0.18 0.21 0.14 0.14

Maximum width 3.0–3.6 2.7–3.8 3.1–3.7 2.2–3.2 2.1–2.5 1.8–2.3

D E B C G F

74 43 4 13 3 9

4.6 4.4 4.2 3.7 3.7 3.5

± ± ± ± ± ±

0.27 0.26 0.17 0.29 0.45 0.21

Maximum length of M1 4.0–5.1 5.9 4.0–5.0 5.9 4.0–4.4 4.0 3.2–4.1 7.9 3.3–4.2 12.4 3.2–3.8 6.2

± 0.22 ± 0.16 ± 0.08 ± 0.10 1.9 1.5 ± 0.17

Maximum width 3.0–3.6 2.7–3.2 2.3–2.6 2.1–2.4

of P1 6.9 5.7 3.6 4.6

Results Duncan’s I

I I

I 114.48*** 0.0001

I I I I

1.3–1.8

10.8

of P2 4.1 4.9 3.5 4.3 5.6

of P4 6.4 6.4 5.7 7.7 6.1 7.1

I

I I

I I I I

I I I I I

54.03*** 0.0001

I I I I I I

102.46*** 0.0001

I I I I I I

I I 51.23*** 0.0001

I I I I I

Systematics and Biogeography of the West Indian Genus Solenodon

285

TABLE 3 (continued) Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

D B E C G F

74 4 42 13 3 9

4.3 4.0 3.9 3.9 3.0 2.7

± ± ± ± ± ±

0.19 0.09 0.29 0.19 0.12 0.17

Maximum width 3.8–4.7 3.9–4.1 3.3–4.6 3.6–4.2 2.8–3.1 2.5–3.0

D E B C G F

75 41 5 13 3 10

4.6 4.4 3.8 3.6 3.5 3.5

± ± ± ± ± ±

0.25 0.21 0.46 0.18 0.34 0.19

Maximum length of M2 4.0–5.4 5.4 3.9–5.0 4.8 3.0–4.3 12.2 3.4–4.0 5.2 3.3–3.9 9.7 3.2–3.7 5.5

D E C B G F

76 40 13 4 2 10

4.3 4.0 3.6 3.6 3.2 2.8

± ± ± ± ± ±

0.18 0.28 0.15 0.42 0.16 0.23

Maximum width of M2 3.8–4.7 4.3 3.5–4.5 6.9 3.4–3.9 4.3 101.54*** 3.0–4.0 11.8 0.0001 3.0–3.3 4.9 2.3–3.1 8.4

D E B C F

75 38 3 13 8

5.3 4.9 4.3 4.2 3.9

± ± ± ± ±

0.27 0.27 0.23 0.22 0.19

Maximum length 4.7–5.9 4.3–5.4 4.0–4.4 3.9–4.5 3.6–4.2

of M3 5.1 5.5 5.4 5.2 4.8

90.47*** 0.0001

D E B C F

75 38 3 13 9

3.5 3.2 3.0 2.9 2.5

± ± ± ± ±

0.19 0.25 0.07 0.39 0.09

Maximum width of M3 3.0–4.0 5.4 2.7–3.9 7.8 3.0–3.1 2.3 2.2–3.9 13.5 2.3–2.6 3.7

60.85*** 0.0001

A B C D E G F

2 2 5 42 42 6 5

61.9 ± 0.59 48.0 ± 0.19 46.7 ± 0.78 46.7 ± 1.53 44.3 ± 1.49 41.3 ± 0.96 35.5 ± 0.90

Range

CV of M1 4.6 2.3 7.3 5.0 4.2 6.4

Total length of femur 57.7–66.1 9.6 47.9–48.1 4.1 45.6–47.6 1.7 43.3–50.4 3.3 41.0–47.6 3.4 39.9–42.5 2.3 34.6–36.9 2.5

FP

Results Duncan’s

I I I I

96.37*** 0.0001

I I

I I 80.12*** 0.0001

I I

I I I

I I I I I I

I I I I I

I I I

I I I

I 88.60*** 0.0001

I I I I I I

286

Biogeography of the West Indies: Patterns and Perspectives

TABLE 3 (continued) Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

A D C B E G F

2 44 6 2 42 8 9

Maximum width of femur 15.3 ± 0.38 14.9–15.4 2.5 13.4 ± 0.54 12.3–14.6 4.1 12.7 ± 0.61 12.1–13.8 4.8 51.57*** 12.7 ± 0.07 12.6–12.7 5.6 0.0001 12.5 ± 0.52 11.4–13.4 7.9 12.4 ± 0.45 12.0–13.2 3.6 10.3 ± 0.47 9.3–11.0 4.5

A D G B E F C

3 44 10 2 43 12 6

A D B E C G F

2 43 1 37 5 2 8

54.1 ± 0.30 47.6 ± 1.51 44.3 44.0 ± 1.29 42.6 ± 1.35 40.8 ± 0.95 35.0 ± 1.60

A D E G B C F

2 44 40 10 2 6 16

Maximum width of humerus 19.4± 0.80 18.9–20.0 4.1 17.9 ± 0.56 16.7–18.8 3.1 17.1 ± 0.66 15.8–18.3 3.8 54.15*** 16.8 ± 1.15 15.0–18.9 6.8 0.0001 15.8 ± 0.71 15.3–16.3 4.5 14.9 ± 0.75 14.1–15.9 5.0 14.6 ± 0.93 13.1–16.5 6.4

G A D E F B C

15 3 44 39 16 3 6

Minimum shaft width of humerus 5.2 ± 0.28 4.6–5.7 5.6 5.1 ± 0.18 4.9–5.3 3.6 5.0 ± 0.30 4.4–5.8 6.0 5.0 ± 0.29 4.3–5.5 5.7 20.02*** 4.5 ± 0.42 4.0–5.3 9.3 0.0001 4.5 ± 0.13 4.4–4.6 28.0 3.9 ± 0.70 3.8–4.0 1.8

6.5 5.3 5.3 5.2 4.9 4.6 4.5

± ± ± ± ± ± ±

Range

CV

FP

Minimum shaft width of femur 0.50 6.1–7.1 7.8 0.31 4.8–6.4 5.8 0.32 4.5–5.7 6.2 24.23*** 0.13 5.1–5.3 2.5 0.0001 0.34 4.3–6.0 7.1 0.14 4.4–4.8 3.1 0.31 4.1–4.9 6.9 Total length of humerus 51.9–56.2 5.7 43.9–50.7 3.2 40.6–46.8 41.2–44.6 40.1–41.5 32.9–37.3

2.9 3.2 2.3 4.6

Results Duncan’s

I I I

I I I I I

I I I I

I I I

I I

I I

I I 108.44*** 0.0001

I I I

I I I

I I I

I I I I

I I I I I I I

I I

Systematics and Biogeography of the West Indian Genus Solenodon

287

TABLE 3 (continued) Geographical Variation in Cranial and Postcranial Measurements of Three Samples of Recent Solenodon and Four Samples of Late Quaternary (Including Late Pleistocene, Early Holocene, Amerindian, and Post-Columbian Material) from Cuba (Samples A, B, C) and Hispaniola (D, E, F, G) Sample Code

N

Mean ± SD

Range

CV

D E C G F

30 30 6 1 2

52.9 ± 1.87 50.8 ± 2.30 49.6 ± 1.90 45.6 40.9 ± 0.84

G D C E F

1 31 7 29 3

7.2 6.9 ± 0.37 6.7 ± 0.47 6.5 ± 0.41 5.1 ± 0.94

A D G F E C

1 30 1 4 30 7

Minimum shaft width of ulna 2.5 2.1 ± 0.19 1.7–2.5 9.2 2.0 7.21*** 1.9 ± 0.10 1.8–2.0 5.1 0.0001 1.9 ± 0.21 1.5–2.3 11.1 1.6 ± 0.16 1.4–1.9 9.9

Total length of ulna 50.0–58.0 3.5 40.6–53.8 4.5 47.8–52.8 3.8

FP

20.84*** 0.0001

Results Duncan’s

I I I I

40.3–41.5

2.1

I

Maximum width of ulna 6.0–7.6 6.1–7.3 5.9–7.2 4.5–6.2

5.4 7.0 6.2 18.4

14.46*** 0.0001

I I I I I

I I I I I

I I I

Note: Sample code: (A) Cuban giant form, late Pleistocene, Cuba; (B) Solenodon cf. cubanus, late Quaternary, Cuba; (C) S. cubanus, Recent; (D) North Hispaniola, Recent; (E) South Hispaniola, Recent; (F) S. marcanoi, late Quaternary, Tiburon Peninsula, Haiti; (G) S. marcanoi, type locality, late Pleistocene, Rancho La Guardia, Dominican Republic. Statistics given are number (N), mean ± standard deviation, range, coefficient of variation (CV), F value (*<0.05, **<0.01, ***<0.001), and Duncan's multiple range test (<0.05) showing non-significant subsets.

Multivariate Analyses To maximize sample size, discriminant function analyses were run separately for three data sets: cranial, mandibular, and limb bone characters. Characters used for the analysis in each data set are listed from the most useful to the least useful in discriminating groups in Table 4. A similar arrangement of the geographical relationships of the samples, offered by the univariate analysis, is suggested by the discriminant function analysis. Examination of the distribution of individuals by the classification matrices reveals three groups: Cuba, North Hispaniola, and South Hispaniola (Table 5). All individuals in the sample from Cuba classified with their proper group in each matrix. In the matrix for cranial characters all individuals from North Hispaniola are classified in their own groups. Of three misclassified individuals from South Hispaniolan samples, two classified with other groups within the South (one from sample 4 is classified with sample 5, and one from sample 6 is classified with sample 4), whereas one individual from sample 5 is misclassified with the northern sample 1.

288

Biogeography of the West Indies: Patterns and Perspectives

TABLE 4 Cranial, Mandibular, and Limb Bone Variables Used in Discriminant Function Analysis of Recent Solenodon Samples from Cuba and Hispaniola Step

Character

F-value

U-statistic

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

Cranial variables Length upper molar toothrow Maximum width C1 Interorbital constriction Greatest length of skull Squamosal breadth Skull height Maximum length C1 Zygomatic breadth Palatal length Breadth of the braincase Length of maxillary toothrow Condylobasal length Maximum width of M3 Breadth across M2-M2 Anteorbital constriction Condylar breadth Alveolar length M1-M3 Mastoid breadth Postpalatal length

34.5 18.9 5.3 5.0 4.4 4.3 3.9 3.8 3.6 2.8 2.3 2.0 2.0 1.8 1.2 1.2 1.0 0.7 0.6

0.812 0.707 0.415 0.418 0.367 0.378 0.349 0.372 0.371 0.287 0.253 0.282 0.236 0.216 0.168 0.168 0.151 0.108 0.095

1 2 3 4 5 6 7 8 9 10 11 12 13

Mandibular variables 48.6 Alveolar length of P4-M3 26.3 Maximum width of P4 11.7 Maximum width of M2 6.6 Angular-condylar height 3.2 Depth coronoid process 2.9 Maximum width of M1 2.7 Length mandibular toothrow 2.2 Maximum length of M2 2.2 Greatest mandible length 1.5 Maximum length of M3 1.0 Maximum width of M3 0.8 Maximum length of M1 0.6 Maximum length of P4

0.730 0.596 0.399 0.274 0.161 0.396 0.140 0.114 0.113 0.083 0.057 0.047 0.034

1 2 3 4 5 6 7 8 9

Limb bone variables 14.0 Humerus total length 10.9 Femur total length 7.2 Humerus maximum width 3.7 Ulna minimum shaft width 3.4 Femur minimum shaft width 3.3 Ulna maximum width 3.1 Humerus minimum shaft width 1.3 Ulna total length 0.9 Femur maximum width

0.631 0.578 0.479 0.329 0.308 0.318 0.299 0.152 0.113

Note: Characters are listed in order of their usefulness in distinguishing groups, with the character with the greatest between-group variance and the least withingroup variance being selected first. The statistics are recalculated at each step. Analyses were run separately for each set of characters to maximize sample size.

Systematics and Biogeography of the West Indian Genus Solenodon

289

TABLE 5 Classification Matrix for Seven Samples of Solenodon from Hispaniola (Samples 1–6) and Cuba (Sample 7), Based upon the Discriminant Functions of 41 Morphometric Characters (Cranial, Mandibular, and Limb Bone) Classification Groups Sample

N

1) Samana-NH 2) Eastern-NH 3) Central-NH 4) Barahona-SH 5) Baoruco-SH 6) La Hotte-SH 7) Eastern Cuba

4 7 7 9 8 14 6

1

2

3

4

5

6

7

0 0 7 0 0 0 0

0 0 0 8 0 1 0

0 0 0 1 7 0 0

0 0 0 0 0 13 0

0 0 0 0 0 0 6

1) Samana-NH 2) Eastern-NH 3) Central-NH 4) Barahona-SH 5) Baoruco-SH 6) La Hotte-SH 7) Eastern Cuba

Mandible variables 4 3 0 1 16 1 10 2 48 7 4 36 10 0 0 1 8 0 1 0 17 0 0 0 12 0 0 0

0 0 0 6 2 0 0

0 0 1 3 5 1 0

0 3 0 0 0 16 0

0 0 0 0 0 0 12

1) Samana-NH 2) Eastern-NH 3) Central-NH 4) Barahona-SH 5) Baoruco-SH 6) La Hotte-SH 7) Eastern Cuba

Limb bone variables 2 1 1 0 8 1 4 1 18 1 3 13 5 0 1 0 5 0 0 0 14 0 0 0 4 0 0 0

0 1 1 4 1 0 0

0 1 0 0 4 0 0

0 0 0 0 0 14 0

0 0 0 0 0 0 4

Cranial variables 4 0 0 7 0 0 0 0 1 0 0 0 0 0

Note: Values indicate the number of individuals classified into each group.

In mandibular characters, the matrix shows 14 individuals from North Hispaniola misclassified with groups within the north (one from 1 in 3; one from 2 in 1; two from 2 in 3; seven from 3 in 1; and four from 3 in 2), whereas only four are misclassified with the South samples (three from 2 in 6; one from 3 in 5). Six individuals from South Hispaniola are misclassified with groups within the South (three from 4 in 5; two from 5 in 4; one from 6 in 5), and two with samples from the north (one from 4 in 3; one from 5 in 2). In the long bone matrix, North Hispaniolan samples misclassified seven individuals within other north groups (one from 1 in 2; one from 2 in 1; one from 2 in 3; three from 3 in 2; one from 3 in one), and three with South samples (one from 2 in 4; one from 2 in 5; and one from 3 in 4). Two South sample individuals are misclassified, one from 4 with sample 2, and one from 5 with sample 4. In an additional analysis, using all cranial and mandibular characters together, all individuals in each sample classified with their own group. Both cranial and overall classification matrices indicated that 100% of the Cuban and Hispaniolan populations could be accurately identified using only two characters: length of upper molar toothrow and width of upper canine. To assess the range

290

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 3 Bivariate plot of values of length of upper molar toothrow (MMTR) and width of upper canine (WC1) showing the relationship of extant Solenodon samples from Hispaniola (1 to 6) and Cuba (7).

FIGURE 4 Bivariate plot of values of width of the upper canine and length of upper molar toothrow to show the relationship of the four living and extinct Solenodon taxa. 1 = S. arredondoi; 4 = S. cubanus; 5 and 6 = S. paradoxus; 7 = S. marcanoi.

of variation among geographical populations of extant Solenodon, a bivariate plot was prepared using these two characters. The plot shows the Cuban and Hispaniolan populations well separated in two diagonally opposed clusters (Figure 3). On the left upper corner, the two Hispaniolan populations are distinguishable but overlap. Because of its reduced and fragmented condition, the fossil and sub-Recent sample could not be analyzed using multivariate techniques. When plotted, using the same two characters, both extinct species are clearly separated from the clusters of the two extant populations (Figure 4).

VARIATION

IN

CRANIAL MORPHOLOGY

In their comparisons of S. cubanus with S. paradoxus, Poduschka and Poduschka (1983) argued strongly against the consistency of the diagnostic characters proposed by previous authors (Peters, 1863; Dobson, 1882; Leche, 1907; Allen, 1910) to separate both species, but particularly those used by Cabrera (1925) to create Atopogale. Differences between the two species in cranial characters were attributed by Poduschka and Poduschka either to variation in age or to individual variation. I agree with most authors in considering Atopogale congeneric with Solenodon and with Poduschka and Poduschka in considering that Cabrera’s set of characters did not have enough generic weight. However, the following analyses show that the characters tested are consistent despite the effect of age and individual variation, and provide a reliable diagnosis when used in combination. My observations are based on the examination of a sample of 115 skulls of the four species, including Recent specimens of 91 S. paradoxus and 14 S. cubanus, plus cranial and dental material

Systematics and Biogeography of the West Indian Genus Solenodon

291

of fossil S. arredondoi, S. paradoxus, and S. marcanoi. Poduschka and Poduschka (1983) reportedly examined a sample of 87 (71 S. paradoxus and 16 S. cubanus). Upon examination of the Cuban Solenodon material in collections, including most of those studied by Poduschka and Poduschka, I have found that four of the specimens reported by them as S. cubanus either do not seem to exist or are actually S. paradoxus. Poduschka and Poduschka listed two FMNH skeletal specimens among the S. cubanus material studied. I have examined all four specimens cataloged as S. cubanus in the FMNH collection and my conclusion is that only FMNH 134, a mounted skin, represents S. cubanus. FNMH 66889 and 72809, alcohol-preserved body and alcohol-preserved head-only, respectively, are without doubt S. paradoxus. FMNH 66890 is only an axial skeleton, with no skin, no skull, no limb bones, and, therefore, it is uncertain which species it might represent. Furthermore, Poduschka and Poduschka listed one skeletal S. cubanus specimen each from Cambridge (UMZC), and Paris (MNHN). I have not seen any of these, but have examined both photographs and measurements of the UMZC specimens and believe all three are clearly S. paradoxus. To my knowledge (M. Tranier, personal communication) all three Solenodon in Paris are mounted specimens, without skull, skeleton, or fluid preserved parts. In addition to the Recent specimens mentioned above, I examined newly discovered fossil material of four S. marcanoi (the first skulls known for this species) and one Solenodon sp. Characters of the external anatomy (hair, claws) have been debated previously by many authors (Dobson, 1882; Allen, 1908, 1910) and need no further discussion. Morphometric characters, for which an answer might have been given already in any of the several tables presented here testing the effect of age, sex, and individual variation on size, need no further discussion. Solenodon paradoxus is, in fact, larger than S. cubanus in overall body size, weight, and most cranial and dental measurements, despite individual variability. Five qualitative characters in Cabrera’s criteria were investigated: 1. Prenasal or paranasal or “os proboscis” bone present in S. paradoxus, but missing in S. cubanus — All previous authors agree that this bone is absent in every known skull of the Cuban species. The bone was not detected by X-ray examination of the only complete alcohol-preserved specimen known of S. cubanus (Eisenberg and Gonzales, 1985). According to Poduschka and Poduschka, this bone develops only with advancing age, and its absence in the X-rayed animal is not valid evidence because the age of the specimen is unknown. Furthermore, they concluded that all specimens of S. cubanus they examined might have been young animals. I have examined the same specimens these authors studied, plus most of the specimens in Cuban collections. To my knowledge, and using, as did Poduschka and Poduschka, the maxillary suture as a criterion, only two specimens appear to be subadults; one is in the Instituto de Ecología y Sistemática of the Cuban Academy of Science (IES 1.480), and the other is, according to Poduschka and Poduschka, the type used by Peters. Their measurements suggest that both specimens have already attained adult size. The alcohol-preserved specimen examined by Eisenberg and Gonzales (USNM 15527) and a presumed S. cubanus in London (BMNH 98.1.20.3, skin and skull) are the only juvenile–subadult specimens. In my opinion the rest of the specimens are adults or at least young adults, and all of them lack the prenasal or os proboscis bone. In contrast, this bone is present in adult, subadult, and juvenile specimens of S. paradoxus. All Hispaniolan animals either possess the bone or, if it was lost in preparation, its articular socket in front of the premaxilla is evident. In S. cubanus this portion of the premaxilla differs from S. paradoxus in being square shaped and slightly projected forward, whereas in the Hispaniolan species the anterior part of the premaxilla above the I1 is invaginated to receive the os proboscis bone. The presence of the prenasal in seven skulls with deciduous dentition and five immature alcohol-preserved specimens of S. paradoxus (4 weeks to 5 months old) suggest that this bone, at least in this species, develops at a very early age. [The absence of an os proboscis in the recently described holotype of S. arredondoi and its presence in S. marcanoi (Ottenwalder, 1991) further

292

Biogeography of the West Indies: Patterns and Perspectives

2.

3.

4.

5.

support the conclusion that this is a key character in separating Cuban (cubanus, arredondoi) from Hispaniolan (marcanoi, paradoxus) solenodons.] Mesopterygoid fossa wider anteriorly than posteriorly in S. paradoxus, and the inverse in S. cubanus — This character was considered by Poduschka and Poduschka “a trifling quantitative feature.” There is indeed slight variability in the shape of the mesopterygoid fossa. However, the condition described for S. cubanus is consistent in 100% of the specimens examined. In most specimens of S. paradoxus, the pterygoid fossa is broadly anteriorly at the posterior edge of the palate and then becomes slightly narrower posteriorly, although in some skulls the pterygoid fossa is essentially parallel sided. In S. paradoxus, 96% of the specimens examined met the species criteria for this character state, while the remaining skulls exhibit an equal width in the anterior and posterior ends of the fossa, but none approaching the condition in S. cubanus. In addition, the pterygoid processes are more expanded posteroventrally in S. cubanus. In fact, the most prominent differences among species of the genus Solenodon are found perhaps in the pterygoid region (Morgan and Ottenwalder, 1993). The opening for the internal nares posterior and dorsal to the palate is much smaller and more compressed in S. arredondoi and S. cubanus than in S. paradoxus. The anterior portion of the pterygoid fossa is also much narrower in the two Cuban species, but is markedly broader posteriorly at the level of the postglenoid processes. The pterygoid processes are much larger and better developed in the two Cuban species, S. cubanus and the extinct S. arredondoi from Cuba, than in S. paradoxus. The pterygoid processes form a high, thin wall for the pterygoid fossa in two Cuban species, extending ventrally and posteriorly to about the same level as the postglenoid processes. The reduced pterygoid processes of S. paradoxus do not extend nearly as far postventrally. Presence of a diastema between I3 and C1 in S. cubanus, while I3 is in contact with C1 in S. paradoxus — Poduschka and Poduschka agreed on this difference, but pointed out that some S. paradoxus have the diastema. My analysis indicates that 77% of the S. paradoxus sample lack the diastema, whereas the remaining 33% show a slightly variable but, on the average, much reduced diastema. In S. cubanus the I3-C1 diastema is constant and much larger. In addition, S. cubanus also exhibits smaller but distinct diastemata between I2-I3 and often between C1-P1, which are lacking in S. paradoxus. The presence of the diastema in S. paradoxus appears to be more related to geographical region than to individual variation. This is suggested by the fact that this tendency was most noticeable in specimens from South Hispaniola, and from the eastern portion of the Dominican Republic (Los Haitises, Nisibón, Sierra del Seibo-Hato Mayor, Boca de Yuma). C1 with anterior accessory cusp in S. paradoxus; accessory cusp lacking in C1 of S. cubanus — All specimens can be accurately identified with this character. It is without doubt one of the most important diagnostic features distinguishing Hispaniolan from Cuban solenodons. P2 simple, oval or conical in S. paradoxus, triangular in S. cubanus — This feature exhibits the higher variability in S. paradoxus, and I agree with Poduschka and Poduschka in the existence of both conditions in either side of the maxilla of several specimens. Except for one specimen, both left and right P2 in S. cubanus are strongly triangular in shape and much wider than in S. paradoxus. Both lower and upper premolars, but the last (P4), are appreciably wider in S. cubanus than in S. paradoxus. In the extinct S. arredondoi, these characters match the conditions of S. cubanus as could be expected from geographical affinity. This is not the case, however, between S. marcanoi and S. paradoxus. Examination of four S. marcanoi skulls indicates that this extinct species shares Cuban and Hispaniolan features. As in S. paradoxus, the mesopterygoid fossa is wider anteriorly than posteriorly, the pterygoid plate is projected medially, and the anterior invagination in front of the lower premaxilla resembles the socket where the paranasal (os proboscis)

Systematics and Biogeography of the West Indian Genus Solenodon

293

bone articulates in S. paradoxus. As in S. cubanus, a relatively large diastema between I3-C1, and smaller diastemata between I2-I3 and C1-P1 are obvious. In the only two existing specimens of S. marcanoi with upper canines, the accessory cusps are lacking in one and are virtually vestigial in the other. Furthermore, the second upper premolar is triangular in shape, although reduced and laterally compressed.

TAXONOMIC CONCLUSIONS I interpret the evidence univariate and multivariate analyses as confirming that the genus Solenodon is represented by two living species, S. cubanus from Cuba and S. paradoxus from Hispaniola, and two extinct species, S. arredondoi from Cuba and S. marcanoi from Hispaniola (Ottenwalder, 1991). These analyses also reveal the existence of at least two distinct extant Solenodon populations in Hispaniola, one from North Hispaniola (Peninsula de Samana–Cabrera Promontory, Los Haitises–Sierra del Seibo–Boca de Yuma–Caribbean Coastal Plain and Cordillera Central in the Dominican Republic) and another from South Hispaniola (Peninsula de Barahona and Sierra de Baoruco in the Dominican Republic, and Massif de la Hotte in Haiti). Although these data suggest that the Haitian sample could represent an intermediate population between the North and South populations, the results of the analyses presented here indicate that the Massif de la Hotte sample is more closely related to the Barahona and Baoruco samples in southwestern Dominican Republic (South Hispaniola). This biogeographical trend is suggestive of a Hispaniola paleoisland distribution of Solenodon. The concept of north and south island faunas in Hispaniola, first envisioned by Mertens (1939) and later developed by Williams (1961), has been discussed in detail by Schwartz (1980) in his analysis of the distributional patterns of the Hispanolan herpetofauna and referred to by many authors since. The present island of Hispaniola is derived from the fusion of two paleoislands along a relatively narrow (~25 km) marine strait that is now the Cul-de-Sac–Valle de Neiba plain; the former portion of this plain lies in Haiti and the latter in the Dominican Republic (Figure 2). The south island, the smaller of the two (9,550 km2), is a composite of three major mountain ranges, the Massif de la Hotte, the Massif de la Selle and the Sierra de Baoruco, and of the Península de Barahona, a xeric extension (85 km) to the south of the Baoruco mountains. The larger (67,700 km2) and more physiographically diverse north island comprises most of Hispaniola. Despite the higher complexity of its relief, Solenodon is unknown on the Haitian portion of the north island. This region is, therefore, irrelevant to the present discussion. The Dominican portion includes the Cordillera Central, the largest mountain range of Hispaniola, and several less extensive ranges (Cordillera Septentrional, Cabrera Promontory, Samana Peninsula, Sierra de Yamasa, Sierra Oriental, Los Haitises). It also contains the largest number of Solenodon populations still surviving on Hispaniola (Ottenwalder, 1985, 1999). A third “island mass” (the northern portion of Dominican Republic north of the Cibao Valley to the coast, and extending from Manzanillo Bay in the northwest to Samana Bay in the northeast) is also generally accepted as part of the makeup of present-day Hispaniola. This additional segment, however, does not embody a significant zoogeographical identity, and in this sense, is generally conceived as an intrinsic part of the north island of Hispaniola. In addition to the Cordillera Septentrional, the third “island segment” of Hispaniola includes the Cabrera Promontory and the Samana Peninsula. The Solenodon sample from these two latter regions (sample 1) of the Dominican Republic does not differ significantly from the other two North Hispaniolan samples, which therefore appear to support the notion of reduced zoogeographical importance of this third Hispaniolan division. The three samples of Recent Solenodon were also tested against and between samples of fossil to sub-Recent material of the genus from cave deposits and Amerindian sites of Cuba and Hispaniola. This material, mostly single-bone specimens of late Pleistocene age, represent at least 90% of the late Quaternary Solenodon known to have been collected until now. It includes (1) material referred to the large extinct Solenodon from Cuba (Arredondo, 1970a; Morgan et al., 1980; Ottenwalder,

294

Biogeography of the West Indies: Patterns and Perspectives

1991; Morgan and Ottenwalder, 1993); (2) material collected in Cuba since 1949, mentioned in the literature either as Solenodon cf. S. cubanus or as a possible new species (Allen, 1918; Aguayo, 1950; Arredondo, 1951, 1955, 1970a; Koopman and Ruibal, 1955; Varona and Arredondo, 1979) plus additional new material; and (3) the material used by Patterson (1962) in the description of Antillogale marcanoi, plus previously unknown material from the type locality (Rancho la Guardia) and from southwestern and southeastern Haiti, both attributable to this extinct species. Comparison of the three geographical samples of Recent Solenodon with four late Quaternary samples of the genus, using univariate analysis, indicate the existence in Cuba and Hispaniola of two species in each island, one large and one small. Of the four Solenodon taxa, the two species on the extremes of the size range of the genus, the large Cuban S. arredondoi and the small Hispaniolan S. marcanoi, are extinct, whereas the two species of intermediate size (S. cubanus, S. paradoxus) are extant.

SYSTEMATIC ACCOUNTS Order Insectivora Bowdich, 1821 Suborder Soricomorpha Saban, 1954 Family Solenodontidae Dobson, 1882 Genus Solenodon Brandt, 1833 Solenodon Brandt, 1833. Mem. Acad. Imp. Sci., St. Petersbourg, ser. 6, Sci. Math. Phys. Nat., 2:459. Type species: Solenodon paradoxus Brandt Definition: Diagnosis and general characters as for the family. General form of body that of a large shrew; snout elongate, tip bare, nostrils opening laterally; eyes small; ears small but visible above pelage; pelage coarse; tail long, only sparsely haired, nearly naked; pinna present, well developed; ventral and cranial glands; one pair of inguinal mammae; penis retractable, testes abdominal; skull elongate, rostrum somewhat tubular; zygomatic arch present but incomplete, with only maxillary and squamosal roots present; auditory bulla absent; lacrimal foramen large, extending above dorsal extremity of occipital condyle; alisphenoid and transverse canals present; lambdoidal and, to a less extent, sagittal crests pronounced; I1 and I2 greatly enlarged, I1 directed slightly backwards, I2 with a deep lingual groove; upper molars zalambdodont, tritubercular, with high paracone, and low internal paracone and hypocone, metacone absent; milk dentition calcified, functional; pubic bones united in short symphysis. Dentition I 3/3, C 1/1, P 3/3, M 3/3 = 40. Solenodon paradoxus Brandt 1833 Distribution: This species occurs only in the Dominican Republic and Haiti (Hispaniola). Diagnosis: S. paradoxus can be distinguished from S. cubanus both by size and morphology. S. paradoxus differs from S. arredondoi and from S. cubanus in the presence of a small, rounded bony structure (os proboscis) placed horizontally in front of the premaxilla for the support of the proboscis; skull almost cylindrical in shape; mesopterygoid fossa wider anteriorly than posteriorly; lack of diastema between I3 and C1 and between C1 and P1; presence of accessory cusp in C1. P2 simple with oval, conical, or infrequently, triangular base; first two upper and lower premolars more laterally compressed. Solenodon paradoxus differs from S. marcanoi in the absence of distinct diastema between I3 and C1 and between C1 and P1; presence of accessory cusps on C1, P1, and P2; P2 primarily simple, oval or conical. Comparisons: In overall size, S. paradoxus is larger than S. cubanus and S. marcanoi, and only smaller than S. arredondoi (Figure 5). S. paradoxus is larger than S. cubanus in most cranial (GLS, CBL, PL, PPL, AMTR, MMTR, LMTR, MTRW, ZB, MB, CB, WM3), mandibular (GML, MTR, P4M3, DCP, ACH, LP4, LM1, WM1, LM2, WM2, LM3, WM3), and long bone (MWF, FMW, LH, MWH, HMW, LU, MWU, UMW) measurements studied (Tables 1 through 3). Both species overlap

Systematics and Biogeography of the West Indian Genus Solenodon

295

FIGURE 5 Lateral view of skull of living and extinct Solenodon showing relative size and dentition profile: (a) Solenodon arredondoi (MNHNC 421/123); (b) S. paradoxus, North Hispaniola (JAO 721); (c) S. cubanus (USNM 37983); (d) S. paradoxus, South Hispaniola (JAO 314); (e) S. marcanoi (UF 128162).

in squamosal breadth, skull height, length of C1, width of P4, and femur length. In anteorbital constriction, interorbital constriction, breadth of braincase, and width of C1, S. cubanus is larger, or at least slightly larger, than S. paradoxus. The differences in pelage and coloration between the two living species have been discussed in detail previously (Peters, 1863; Gundlach, 1877; Dobson, 1882; Allen, 1908). Solenodon paradoxus is significantly smaller than S. arredondoi in 16 (palatal length, length of maxillary toothrow, anteorbital constriction, zygomatic breadth, squamosal breadth, condylar breadth, maximum length of C1, maximum width of C1, maximum width of P1, maximum length of P2, maximum width of P2, total length of femur, maximum width of femur, minimum shaft width of femur, total length of humerus, and maximum width of humerus) of the 29 measurements

296

Biogeography of the West Indies: Patterns and Perspectives

available for its sample (Table 3). Solenodon arredondoi overlaps with S. paradoxus in alveolar length of upper molar toothrow, breadth across maxillary molar toothrow, interorbital constriction, maximum length of P1, maximum length of M1, maximum width of M1, maximum width of M2, minimum shaft width of humerus, and minimum shaft width of ulna. Solenodon paradoxus is significantly larger than S. arredondoi in maximum length of M3 and maximum width of M3, and averages larger than S. arredondoi in length of upper molar toothrow and maximum length of M2. Solenodon paradoxus is significantly larger than S. marcanoi in 41 cranial, mandibular, dental, and limb bone measurements (Table 3). It also averages larger than S. marcanoi in 12 additional measurements, with only minor overlap in condylar breadth, maximum length of P2, maximum length of P1, maximum length of P2, maximum length of P4, maximum width of femur, mastoid breadth, maximum length of M1, minimum shaft width of ulna). Geographical variation: Standard statistics for the North and South Hispaniolan samples are given in Table 2 (for 41 characters) and Table 3 (for 58 characters). Univariate analysis and the results of Duncan’s test of 41 measurements of extant Solenodon (Table 2) revealed a geographical pattern in which samples from North Hispaniola differed significantly from South Hispaniolan samples in 12 measurements: greatest length of skull, condylobasal length, palatal length, length of maxillary toothrow, maximum width of M3, greatest mandible length, length of mandibular toothrow, alveolar length of P4-M3, angular condylar height, maximum length of P4, maximum width of femur, and total length of humerus. The three samples from North Hispaniola also grouped in a single subset with the sample from Haiti (South Hispaniola), differing significantly from all other samples in eight measurements (length of upper molar toothrow, breadth across maxillary toothrow, maximum width of C1, maximum width of P4, maximum length of M1, maximum width of M1, maximum width of M2, maximum width of M3). The samples from South Hispaniola grouped together in 11 measurements with the Cuban sample, differing significantly from North Hispaniolan samples in angular-condylar height, maximum length of P4, greatest length of skull, condylobasal length, palatal length, length of maxillary toothrow, greatest mandible length, length of mandibular toothrow, maximum width of femur, total length of humerus. All three samples from South Hispaniola also clustered alone in one or two subsets in four measurements (maximum width of M3, maximum width of P4, total length of femur, alveolar length of P4-M3). The Haitian sample shows an intermediate condition, in eight measurements, between North Hispaniolan samples and the two other South Hispaniolan samples (Peninsula de Barahona and Sierra de Baoruco, Dominican Republic). These two South island populations differed significantly from all other samples in length of upper molar toothrow, maximum width of C1, and maximum length of M1. The Peninsula de Barahona and Sierra de Baoruco samples also separated from the others, together with the Cuban sample, in breadth across maxillary toothrow, maximum width of M1, maximum width of M2, and maximum width of M3. The sample from Sierra de Baoruco isolated in one subset from all other samples in two characters, P4-M3 and maximum length of M2. Univariate analysis among and between all living and extinct samples of Solenodon (58 characters) shows the North and South populations differing significantly in 28 measurements, grouped in nonoverlapping subsets in 8 additional measurements, and overlapping in 22 characters. Furthermore, univariate analysis of 41 characters for the six Hispaniolan samples alone revealed highly significant (P < 0.01) differences among and between the two populations in all but two measurements (interorbital constriction and minimum shaft width of humerus). Both populations were clearly separated in 17 measurements. The population from Haiti grouped with the North Hispaniolan samples in all eight upper molar and canine characters, differing significantly from the other two South Hispaniolan samples. Multivariate analysis of the S. paradoxus populations, using discriminant function analysis of 45 characters, reveal similar patterns of geographical variation. The classification matrix indicated that 100% of the individuals could be correctly identified using two characters, width of the P4 and angular-condylar height of the mandible. A bivariate plot of these two measurements of the

Systematics and Biogeography of the West Indian Genus Solenodon

297

FIGURE 6 Bivariate plot of values of width of the last lower premolar and angular-condylar height of the mandible to show the relationship of samples from northern (1, 2, 3) and southern (4, 5, 6) Hispaniola.

TABLE 6 Cranial, Mandibular, and Limb Bone Characters Indicated by Discriminant Function Analysis of Six Geographical Samples of Extant (Recent) S. paradoxus from Hispaniola Matrix Top Ranked Characters Skull and mandible variables (32) Angular-condylar height Maximum length C1 Skull variables only (18) Maximum length of C1 Skull height Mandible variables only (13) Angular-condylar height Maximum width of M2 Maximum width of P4 Limb bone variables only (9) Humerus total length Femur minimum shaft width

F-value

U-statistic

14.3 8.8

0.653 0.543

17.1 6.4

0.666 0.445

32.9 9.0 8.6

0.629 0.320 0.312

13.3 3.9

0.590 0.346

Percent Reduction in Class 100

95

70

72

Note: Characters were ranked in order of their usefulness in distinguishing groups, with the character with the greatest between-group variance and the least withingroup variance being selected first. The statistics were recalculated at each step. Number of variables analyzed in each matrix is indicated in parentheses.

Hispaniolan populations is presented in Figure 6. The South populations are found on the lower left and the North populations on the upper right of the horizontal variate. Separate analyses of sets of cranial, mandibular, and limb bone characters using discriminant functions (Table 6) and classification matrices (Table 7) indicate that North and South populations might not be accurately distinguished using mandibles and limb bones alone. Taxonomic conclusions: The S. paradoxus populations from North Hispaniola are larger than the populations from South Hispaniola in most cranial, mandibular, dental, and limb bone measurements investigated. The Haitian population has the cranial, mandibular, and limb bone dimensions of the two other South Hispaniola populations in the Dominican Republic (Peninsula de

298

Biogeography of the West Indies: Patterns and Perspectives

TABLE 7 Classification Matrix for Six Samples of Extant S. paradoxus from Hispaniola (Samples 1–5, Dominican Republic; Sample 6, Haiti), Based upon the Discriminant Functions of 41 Morphometric Characters Classification Groups Sample

N

1) Samana, NH 2) Eastern, NH 3) Central, NH 4) Barahona, SH 5) Baoruco, SH 6) La Hotte, SH All

Skull and mandible 4 7 6 8 6 13 44

1) Samana, NH 2) Eastern, NH 3) Central, NH 4) Barahona, SH 5) Baoruco, SH 6) La Hotte, SH All

Skull variables 4 7 7 9 8 14 49

1

2

3

4

5

6

variables (32) 4 0 0 0 7 0 0 0 6 0 0 0 0 0 0 0 0 0 4 7 6

0 0 0 8 0 0 8

0 0 0 0 6 0 6

0 0 0 0 0 13 13

only (18) 4 0 0 7 0 0 0 0 0 0 0 0 4 7

0 0 7 0 0 0 7

0 0 0 8 0 1 9

0 0 0 1 8 0 9

0 0 0 0 0 13 13

1) Samana, NH 2) Eastern, NH 3) Central, NH 4) Barahona, SH 5) Baoruco, SH 6) La Hotte, SH All

Mandible variables only (13) 4 3 0 16 1 10 48 5 5 10 0 0 8 0 1 17 0 0 103 9 16

1 3 37 1 0 0 42

0 0 0 6 2 0 8

0 0 1 3 5 1 10

0 2 0 0 0 16 18

1) Samana, NH 2) Eastern, NH 3) Central, NH 4) Barahona, SH 5) Baoruco, SH 6) La Hotte, SH All

Limb bone variables only (9) 2 1 1 8 1 4 18 1 3 5 0 0 5 0 0 14 0 0 52 3 8

0 1 13 0 0 0 14

0 1 1 4 1 0 7

0 1 0 1 4 0 6

0 0 0 0 0 14 14

Note: Values indicate the number of individuals classified into each group. NH, North Hispaniola; SH, South Hispaniola. Number of variables analyzed in each matrix is indicated in parentheses.

Barahona and Sierra de Baoruco), but the measurements of the upper molars and canines in the population from the Massif de la Hotte are similar to the North Hispaniola samples. The population from the southwestern Dominican Republic is certainly the smallest population of S. paradoxus, with some specimens approaching the skull dimensions of S. marcanoi. The Haitian population seems more closely related to these two latter populations, although their differences indicate that

Systematics and Biogeography of the West Indian Genus Solenodon

299

the southwestern Haiti and southwestern Dominican Republic populations were isolated from each other for a long time in the past. This is expected because most surviving populations in Hispaniola occur at, or in the proximity of, relevant mountain ranges. The same could be said of S. cubanus, which is suggestive of an island refugia phenomenon. Based of the results of these analysis, I believe the Solenodon populations from South and North Hispaniola represent different geographical forms. The possibility also exists that the Haitian sample might represent a phenetically identifiable population from those of North Hispaniola (samples 1, 2, and 3) and south Dominican Republic (samples 4 and 5), and therefore a separately evolving lineage. However, considering that available data are inconclusive, and that supporting genetic information is lacking, I have chosen not to appraise the amount of differentiation, nor to recognize the Haitian sample as a separate population for the time being. Hence, the population from Haiti (Massif de la Hotte) is here combined with the two samples from southwestern Dominican Republic (Peninsula de Barahona and Sierra de Baoruco) to represent a new subspecies of S. paradoxus from South Hispaniola. Solenodon paradoxus woodi, new subspecies Holotype: Adult male, skin, skull and skeleton, UF 30135; from Bucan de Tuí, S. Oviedo, Península de Barahona, Provincia Pedernales, Dominican Republic. Obtained by Jose A. Ottenwalder on 23 March 1977. Skin, skull, post-cranial skeleton. Collector’s Field Series No. JAO 462. Measurements of the holotype: External, cranial, and postcranial measurements (in mm) of the holotype are as follows: TL, 502; TA, 219; HF, 57; EA, 25; GLS, 79.9; CBL, 74.2; PL, 33.2; PPL, 28.5; AMTR, 7.9; MMTR, 10.3; LMTR, 23.5; MTRW, 22.7; AC, 13.5; ZB, 33.5; IC, 14.5; SB, 31.3; MB, 23.8; BB, 23.9; CB, 15.6; SH, 17.7; LC1, 3.7; WC1, 2.1; WM3, 4.8; GML, 49.3; MTR, 24.7; P4-M3, 15.7; DCP, 22.9; ACH, 12.3; LP4, 3.9; WP4, 2.6; LM1, 4.3; WM1, 3.7; LM2, 4.7; WM2 3.7; LM3, 4.9; WM3, 3.0; LF, 41.4; MWF, 12.6; FMW, 4.9; LH, 42.8; MWH, 16.6; HMW, 5.4. Body weight, 795 g. Distribution: South Hispaniola; including Peninsula de Barahona and Sierra de Baoruco in the Dominican Republic and Peninsula de Tiburon (Departement du Sud and Departement de l’Ouest) in Haiti. A possible invader of the north island in the Dominican Republic. Comparisons: Solenodon paradoxus woodi (Figures 6 and 7) is distinguished from S. paradoxus paradoxus by its smaller cranial, mandibular, and postcranial size (Tables 2 and 3). It is particularly smaller than the nominate form in greatest length of skull, condylobasal length, palatal length, length of maxillary toothrow, maximum width of M3, greatest mandible length, length of mandibular toothrow, alveolar length of P4-M3, angular condylar height, maximum length of P4, maximum width of femur, and total length of humerus. In size, the southern Hispaniola Solenodon is similar to S. cubanus, both differing significantly from North Hispaniolan populations, in the same measurements separating the two Hispaniolan subspecies. All three South Hispaniolan populations show little overlap with other populations in maximum width of M3, maximum width of P4, total length of femur, alveolar length of P4-M3. Within South Hispaniola, the two populations from the southwestern Dominican Republic are smaller than any other living population and more closely related to each other, whereas the Haitian population is slightly larger, and resembles the north island S. paradoxus in some upper dentition characters. The populations from Sierra de Baoruco and Peninsula de Barahona show little overlap with all other samples and are the smallest in length of upper molar toothrow, maximum width of C1, and maximum length of M1. These two latter populations show approximation to S. cubanus in four measurements: breadth across maxillary toothrow, maximum width of M1, maximum width of M2, and maximum width of M3. The population from Sierra de Baoruco is also noticeably smaller than all other populations in P4-M3 and maximum length of M2. The population from southern Haiti resembles the North Hispaniola populations in length of upper molar toothrow, breadth across maxillary toothrow, maximum width of C1, maximum width of P4, maximum length of M1, maximum width of M1, maximum width of M2, maximum width of M3.

300

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 7 Dorsal and ventral views of skull showing differences in size between representative specimens of two geographic populations of S. paradoxus from Hispaniola: (a) Solenodon paradoxus paradoxus, North Hispaniola (JAO 721); (b) S. paradoxus woodi, South Hispaniola (JAO 476).

Remarks: Differences in size between the populations of the two geographical divisions have been demonstrated. However, the presence of some South Hispaniolan-sized individuals in North Hispaniola, and vice versa, might raise some questions whether large and small S. paradoxus merely represent ecomorphs. This would lead to further questions concerning the geographical, and therefore reproductive, isolation of the two proposed forms. Unfortunately there is little genetic data on the geographical variability of Solenodon. Conservative mammalian insectivores are known to exhibit a marked degree of within-group morphological variation. Individual variability in the ontogeny of tooth replacement and growth rates is associated with an inflated number of species of shrew tenrecs of the genus Microgale (MacPhee, 1987). This is not the case with Solenodon, since sex and age factors have been evaluated, and no individuals (only geographical populations) have been tested here. Furthermore, the differences detected between the two populations are based on an adequate sample (considering the rarity of Solenodon). Steps were also taken to minimize the chances of introducing artificial variability in the data. Only measurements taken by the author were used in statistical analyses, even at the expense of excluding invaluable data (i.e., measurements taken by others) from important specimens to which I had no access for measuring. Because of their rarity, several European museums were reluctant to send Solenodon material on loan, and this includes some of the few putative specimens of S. cubanus in collections. Habitat and ecology: Relevant information on and description of the habitat and ecology of S. paradoxus woodi in the southwestern Dominican Republic are presented by Ottenwalder (1985, 1999), and by Woods and Ottenwalder (1992) in the southwestern Haiti range of the subspecies. Etymology: This new subspecies is named for my colleague and former professor Charles A. Woods in recognition of his contributions and efforts both as a field biologist and as the author of many publications on West Indian mammals and the conservation of Haitian and Hispaniolan biodiversity. Specimens examined (65): DOMINICAN REPUBLIC: El Narajo, S Cabral, Barahona Province, 1 (JAO); Bucán de Isidro, S Oviedo, Pedernales Province, 5 (JAO); Bucán de Tuí, S Oviedo, Pedernales Province, 1 (UF), 2 (JAO); near Laguna La Rabiza, S Oviedo, Pedernales Province, 4 (JAO); Sabana de Sanson, 8 km SW Oviedo, Pedernales Province, 1 (JAO); El Acetillar, 30 km N Cabo Rojo, Pedernales Province, 1 (JAO); Las Mercedes, NE Pedernales, Pedernales Province, 4 (JAO); La Azucena, S Pedernales, Pedernales Province, 1 (JAO); Avila, N Pedernales, Pedernales Province, 2 (JAO); 2 km N El Manguito, Avila, N Pedernales, Pedernales Province, 3 (JAO); Mencía

Systematics and Biogeography of the West Indian Genus Solenodon

301

(= La Colonia), N Pedernales, Pedernales Province, 5 (JAO); El Aguacate, 5 km O Las Cruces, Sierra de Baoruco, Independencia Province, 1 (JAO); Trujín (= Oviedo) 2 (USNM). HAITI (Départements de la Grande Anse and du Sud): 2 mi E Duchity, east of Rivière Glace, 2 (UF); Nan Canal, 2 mi NW Duchity, 2 (UF); Nan Rete, 3 mi SW Duchity, Département du Sud, 2 (UF); Vete Shalme, near Rivière Glace, 1 mi SE Duchity, 1 (UF); near Rivière Glace, 3 mi SE Duchity, 1 (UF); Cadet, 4 km WSW Duchity, 1 (UF); La Fiere, 2.5 km SSE Duchity, 1 (UF); Anbaso, W Catiche, 3.2 km S Duchity, 2 (UF); Duchity, 17 (UF); Catiche, 1 (UF); 27 km NW Les Cayes, Département du Sud, 2 (UF). Late Quaternary material of S. paradoxus from cave deposits in southwestern Haiti is tentatively assigned to S. paradoxus woodi, which includes one skull fragment (UF 125176); three proximal femora and sacral vertebrae (UF uncataloged), all from Sa Wo; and one R proximal humerus missing distal end (UF 128963) from Trouing Marassa. However, three ulna from Trouing Jeremy #1 (UF 128173-128175, one complete, two proximal) seem larger than those of Recent specimens. UF 128173 is actually above the size range of the North population in total length (54.9). A large amount of the material collected during the FMNH paleontological expedition to Haiti was still unsorted and uncataloged at the time of this study. An undetermined amount of Solenodon material is found in these collections. Solenodon paradoxus paradoxus Brandt 1833 Solenodon paradoxus Brandt, 1833. Mem. Acad. Imp. Sci., St. Petersbourg, ser. 6, Sci. Math. Phys. Nat., 2:459. Holotype: Skin and incomplete skull of subadult male from “Hispaniola,” Zoological Museum of the Academy of Sciences of St. Petersburg (Zoological Institute of Leningrad #982), obtained by Jaegerus. Measurements of the holotype: The type was not available for examination. The following external measurements are taken from Brandt (1833) (factor from inches, 2.54): total length, 520; head–body length, 292; tail length, 229; ear length, 25; hind foot, 50. Cranial measurements are from Peters (1863) as given by Allen (1908): basal length, 74.3; palatal length, 44; breadth at zygomatic process of maxilla, 31.5; breadth at zygomatic process of squamosal, 30.3; interorbital breadth, 17.7; breadth of rostrum at anterior border of canines, 8.7; breadth across maxillary toothrow, 23; length of upper toothrow, 39; length of P4-M3 (given as P3-M3), 15.3; mandibular height at coronoid, 25.5; length of lower toothrow, 33; length of P4-M3 (given as P3-M3), 17. Not all these are comparable with the measurements used here. Distribution: Known from the Dominican Republic, north of the Neiba Valley. Apparently a recent invader to the south island of Hispaniola (sensu Schwartz, 1980). Comparisons: The nominate subspecies, S. paradoxus paradoxus, from North Hispaniola, can be distinguished from the new geographical subspecies from South Hispaniola, S. paradoxus woodi, by its larger overall size (Figures 7 and 8). See Comparisons and Geographic Variation under S. paradoxus. See also Comparisons for S. paradoxus woodi. Remarks: In his description, Brandt gave Hispaniola as the origin of the type specimen. Later authors (Peters, 1863; Leche, 1907; Allen, 1908) probably referred to it as coming from Haiti because the name Haiti was also used around the turn of the century to include the whole island of Hispaniola. The specimen must have been obtained by the donor on, or prior to, 1832, as Brandt first presented the specimen to the Academy of St. Petersburg in December of that year. The maxillarpremaxillar suture of the type was still unfused (Peters, 1863; Podushcka and Podushcka, 1983), which indicates that it is not a full-grown animal, and therefore presumably a subadult. Lacking further pertinent information, and on the basis of available evidence (namely external and cranial measurements and approximate age), I believe the North Hispaniola population is better represented by the type specimen of S. paradoxus. Specimens examined (128): DOMINICAN REPUBLIC: Rio Limpio, Loma de Cabrera, Dajabón Province, 1 (JAO); Arroyo de Agua, Mata Grande, Cacique, Monción, Santiago Rodriguez Province,

302

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 8 Lateral views of the skull and mandible in representative specimens of geographical populations of Solenodon from Hispaniola: (a) Solenodon paradoxus paradoxus, northern Hispaniola (JAO 721); (b) S. paradoxus woodi, southern Hispaniola (JAO 476).

2 (JAO); Jaiqui Picado, San Jose de las Matas, Santiago Province, 13 (JAO); La Cuesta, San Jose de las Matas, Santiago Province, 8 (7 PSM, 1 ZMUH); near Santiago, Santiago Province, 2 (USNM); La Vega, La Vega Province, 64 (1 UF, 46 MCZ, 4 FMNH, 7 USNM, 1 CMNH, 1 RMNH, 4 IRSNB); El Mogote, Jarabacoa, La Vega Province, 1 (JAO); Cordillera Central, 4 (AMNH); Loma Alta, Cabrera, María Trinidad Sanchez Province, 2 (JAO); Los Hoyos, SW Cabrera, María Trinidad Sanchez Province, 1 (JAO); La Confluencia, Cabrera, María Trinidad Sanchez Province, 1 (JAO); Rio Guaraguao headwaters, Arenoso, Duarte Province, 1 (JAO); El Naranjito, N Sanchez, Samana Province, 1 (JAO); Rio San Juan, Samana Province, 1 (USNM); Laguna, Samana Province, 1 (USNM); San Lorenzo, Samana Province, 1 (AMNH); Hidalgo, Los Haitises, San Cristobal Province, 1 (JAO); Monte Bonito, Los Haitises, San Cristobal Province, 2 (JAO); San Cristobal, 1 (AMNH); El Centro, SW Sabana de la Mar, El Seibo Province, 3 (MCZ); Loma El Cavao, S. El Valle, Sabana de la Mar, El Seibo Province, 1 (JAO); Sabana de la Mar, El Seibo Province, 1 (ZMUH); Guamira, Machado, NW Hato Mayor, El Seibo Province, 1 (JAO); near Hato Mayor, El Seibo Province, 3 (PSM); S. Miches, El Seibo Province, 3 (PSM); Candelaria, NW El Seibo, El Seibo Province, 1 (JAO); El Seibo Province, 3 (AMNH); Las Cañas, Nisibón, La Altagracia Province, 2 (JAO); Boca de Yuma, La Altagracia Province, 1 (JAO); Punta Caletón Hondo, Granchorra, La Altagracia Province, 1 (JAO); Las Cañas-La Ureña, E. Santo Domingo, Distrito Nacional, 1 (JAO). Solenodon cubanus Distribution: This species occurs only on the island of Cuba. No records are known elsewhere in the Cuban Archipelago outside the main island. Diagnosis: Solenodon cubanus can be distinguished from the Hispaniolan solenodons, S. paradoxus and S. marcanoi, primarily by morphology, as well as by size (Tables 1, 2, 3). Solenodon cubanus is considerably smaller than S. arredondoi, and can be readily separated from it also by morphology (Table 3; Figures 8 and 9). Detailed diagnostic comparisons between S. arredondoi and S. cubanus are presented by Morgan and Ottenwalder (1993). Solenodon cubanus differs from S. paradoxus and S. marcanoi in the more constricted internal narial opening and anterior portion of pterygoid fossa, the much larger posteroventrally expanded pterygoid processes, the relatively broader frontals at the anterior edge of the orbits, the much broader frontal region, the greatly enlarged and inflated upper canines, the strong lingual expansion of first two upper premolars, and the somewhat larger first two lower premolars and lower canines. From S. paradoxus,

Systematics and Biogeography of the West Indian Genus Solenodon

303

it can be distinguished by the presence of a diastema between I3 and C1 as well as smaller diastemas between I2-I3 and C1-P1, and lack of accessory cusps on C1, P1, and P2. From the extinct Hispaniolan S. marcanoi, which in some characters shows an intermediate condition between S. cubanus and S. paradoxus (see account for S. marcanoi), S. cubanus can be clearly differentiated by its much larger size (Table 3). Comparisons: In addition to internal morphology, the two living species, which occur in different islands, can be readily distinguished by overall size, weight and by coloration. Solenodon cubanus (Figure 5) is smaller than the North Hispaniolan form, S. paradoxus paradoxus, in most cranial (GLS, CBL, PL, PPL, AMTR, MMTR, LMTR, MTRW, ZB, MB, CB, WM3), mandibular (GML, MTR, P4M3, DCP, ACH, LP4, LM1, WM1, LM2, WM2, LM3, WM3), and long bone (MWF, FMW, LH, MWH, HMW, LU, MWU, UMW) measurements studied (Tables 1 through 3). Both overlap in squamosal breadth, skull height, length of C1, width of P4, and femur length. Although closer in size, S. cubanus is also significantly smaller than the new geographical form of S. paradoxus from South Hispaniola (see above description for S. paradoxus woodi) in postpalatal length, alveolar length of upper molar toothrow, length of upper molar toothrow, width of M3, alveolar length of P4-M3, length of M1, length of M2, length of M3, minimum shaft width of femur, maximum width of humerus, and minimum shaft width of humerus. The South Hispaniolan Solenodon either overlap or are slightly larger than S. cubanus in most measurements (GLS, CBL, PL, LMTR, MTRW, ZB, MB, CB, GML, MTR, DCP, ACH, LP4, WM1, WM2, WM3, MWF, LH, LU, MWU, UMW). In anteorbital constriction, interorbital constriction, breadth of braincase, and width of C1, S. cubanus is larger, or at least slightly larger, than both northern and southern Hispaniola Solenodon. The Cuban species is also larger than the South Hispaniola populations in squamosal breadth, skull height, length of C1, width of P4, and femur length. The differences in pelage and coloration between the two living species have been described in detail previously (e.g., Peters, 1863; Gundlach, 1877; Dobson, 1882; Allen, 1908, 1910). Geographical variation: Standard statistics for the Recent Cuban sample are given in Tables 1 through 3, and for the late Quaternary sample in Table 3. Recent S. cubanus is known only from the eastern portion of Cuba. The sample available was analyzed for geographical differences between northeastern and southeastern populations. Univariate analysis yielded no significant results. Because of missing data and consequent small or nonexisting samples, the late Quaternary sample was rejected for multivariate analysis. Taxonomic conclusions: Only one adult specimen from Sierra Maestra (adult female USNM 37983/15526) was available for comparison with the north population of Eastern Cuba, including the type specimen of S. poeyanus. I found no differences between the specimens of the two geographical regions of eastern Cuba, not even to justify subspecific distinction. Among the samples of S. cubanus I was able to examine in both American and Cuban collections, three adult specimens (USNM 300634, adult male from La Iberia, Baracoa; IES/ACC 1478, adult female from Mayarí, Holguín; and MCZ 46306, adult, unknown) are noticeably larger than the rest of the Cuban material. Of these, at least the first two are from the northeastern region. The single adult specimen from Sierra Maestra is certainly smaller than these two, and so are the type of S. poeyanus (adult female from near Nipe Bay), and all three known additional northeastern specimens. Measurements of the S. poeyanus and of the Sierra Maestra specimens are, respectively, GLS, (78.7), 77.4; CBL, (74.2), 74.1; PL, 35.6, 34.5; PPL, (27.1), 27.5; AMTR, 8.1, 7.9; MMTR, 8.5, 8.3; LMTR, 24.4, 23.3; MTRW, 21.4, 20.7; AC, 15.2, 14.7; ZB, 33.4, 32.2; IC, 15.0, 15.3; SB, (30.9), 30.8; MB, (24.6), 24.7; BB, (25.3), 24.5; CB, (16.0), 15.7; SH, (19.6), 19.6; LC1, 4.8, 4.65; WC1, 3.05, 2.86; WM3, 4.5, 4.4; GML, (49.4), 48.3; MTR, 26.2, 24.5; P4-M3, 14.8, 13.8; DCP, 24.2, 22.3; ACH, (12.9), 13.3. The skull of S. poeyanus is not complete. Measurements in parenthesis represent good approximations. In Barbour’s (1944) description, the specimen was erroneously identified as MCZ 6957. The correct collection number for the type of S. poeyanus is MCZ 6597. The fossil/sub-Recent sample (B) is significantly larger than Recent S. cubanus in most mandibular and premolar measurements (GML, MTR, P4M3, DCP, ACH, LC1, WC1, LP1, WP1, WP2,

304

Biogeography of the West Indies: Patterns and Perspectives

LP4, LM1), except one cranial measurement (anteorbital constriction). None of the lower maxillas examined approaches the occlusion area of the skull of the new giant form. On the other hand, none of the five partial skulls in the late Quaternary sample matches the size of the large mandibles, nor does any Recent specimen. These mandibles might be either very large S. cubanus or small individuals of the new extinct Solenodon. The possibility also exists that such mandibles might represent an intermediate population. Considering the paucity of the material available, I have chosen not to assign the material in question to any of the taxa recognized here, and to maintain its taxonomic status, for the time being, as Solenodon cf. S. cubanus. Solenodon cubanus Peters 1861 Solenodon cubanus Peters, 1861. Monatsb. Akad. Wiss. Berlin, p. 169 Atopogale cubana Cabrera, 1925. Genera mammalium: Insectivora, Galiopithecia, Mus. Nac. Cien. Nat., Madrid, p. 177 Solenodon cubanus Varona, 1974. Acad. Cien. Cuba, p. 7 Holotype: Adult female from the mountains near Bayamo, Provincia Granma, Cuba; Berlin Academy of Sciences. Obtained by J. Gundlach. Measurements of the holotype: The type was not available for examination in this study. The following measurements are from Peters (1863): head and body length, 280; length of tail 190; height of ear, 30; length of hind foot, 56; occipito-nasal length, 87; basal length, 73.7; palatal length, 45; breadth at zygomatic process of maxilla, 34.7; breadth at zygomatic process of squamosal, 33.5; interorbital breadth, 19.6; length of upper toothrow, 39; length of P4-M3 (given as P3-M3), 12.2; mandible height at coronoid, 28; length of lower toothrow, 30.5; length of P4-M3 (given as P3-M3), 14. [With some exceptions, the above measurements are not useful for comparisons with those presented here as they differ from those described here in Materials and Methods.] Distribution: The Recent distribution of this species is restricted to the eastern portion of Cuba. It is known from a number of late Pleistocene–early Holocene and Amerindian sites throughout the western and eastern regions of Cuba. Its past existence in the central portion of the island is only confirmed from Sierra de Cubitas. Diagnosis: Solenodon cubanus can be distinguished from the Hispaniolan solenodons, S. paradoxus and S. marcanoi, primarily by morphology, as well as by size (Tables 1 through 3). Solenodon cubanus differs from S. paradoxus and S. marcanoi in the more constricted internal narial opening and anterior portion of pterygoid fossa, the much larger posteroventrally expanded pterygoid processes, the relatively broader frontals at the anterior edge of the orbits, the much broader frontal region, the greatly enlarged and inflated upper canines, the strong lingual expansion of first two upper premolars, and the somewhat larger first two lower premolars and lower canines. From S. paradoxus, it can be distinguished by the presence of a diastema between I3 and C1 as well as smaller diastemas between I2-I3 and C1-P1, and lack of accessory cusps on C1, P1, and P2. From the extinct Hispaniolan S. marcanoi, which in some characters shows an intermediate condition between S. cubanus and S. paradoxus (see account for S. marcanoi), S. cubanus can be clearly differentiated by its much larger size (Table 3). Solenodon cubanus is considerable smaller than the other Cuban solenodon, S. arredondoi, and can be readily separated from it also by morphology (Table 3; Figures 8 and 9). For detailed diagnostic comparisons of S. arredondoi and S. cubanus, see Comparisons (below). Comparisons: Solenodon cubanus, S. arredondoi (characters from type skull only), S. paradoxus and S. marcanoi all present very similar skull architecture, but are distinguished from each other by a number of morphological features. The two Cuban species are closer in resemblance as expected by geography. Relevant skull and upper dentition characters common to both Cuban species, S. cubanus and S. arredondoi, and that separate them from the two Hispaniolan Solenodon, S. paradoxus and S. marcanoi, include the more constricted internal narial opening, the expanded

Systematics and Biogeography of the West Indian Genus Solenodon

305

FIGURE 9 Dorsal and ventral views of skull in living and extinct species of Solenodon from Cuba: (a) Solenodon arredondoi (MNHNC 421/123); (b) S. cubanus (USNM 37983).

pterygoid processes, the absence of an os proboscis, and the noticeably inflated C1. Obviously the most prominent difference between the two Cuban species is the much larger size of S. arredondoi compared to S. cubanus. Other important cranial and dental characters that distinguish them include internal narial opening and anterior portion of pterygoid fossa more constricted in S. arredondoi than in S. cubanus. The pterygoid processes are better developed in S. arredondoi, projecting somewhat ventrally and posteriorly, than in S. cubanus. The interorbital constriction in the type skull of S. arredondoi is more prominent than in any of the skulls of S. cubanus examined. C1 is relatively more inflated in S. arredondoi than in S. cubanus. Specimens examined: CUBA; Recent (19). Near Nipe Bay, Holguín Province, 1 (MCZ); Sierra La Boca, Mayarí, Holgun Province, 2 (IES/ACC); Cabezada Rio Nibujón, Cerra La Iran, Baracoa, Guantánamo Province, 1 (IES/ACC); La Iberia, Baracoa, Guantánamo Province, 3 (2 IES/ACC, 1 USNM); Baracoa, Guantánamo Province, 1 (IES/ACC); Sierra Maestra, Granma Province, 2 (USNM); Cuba, 10 (4 USNM, 3 MCZ, 2 NMNH, 1 FMNH). Late Quaternary referred material: OA 35, partial skull with R P1 and L P4, Cueva de José Brea, Sierra Pan de Azucar, Pinar del Río Province. OA 83, mandibular fragment with P2; OA 85, mandibular fragment (edentate); IES/ACC 208, partial L mandible with alveoli of P4-M3; IES/ACC 620, L femur; IES/ACC 2599-3678, L femur; IES/ACC 622, R humerus, missing proximal head; IES/ACC, uncataloged, R humerus, partial, missing proximal portion; IES/ACC 621, L humerus, complete; IES/ACC 2325-3645, partial skull, rostrum, and almost complete palate with R P1, P2, and M1; all from Cueva Paredones, Ceiba de Agua, San Antonio de los Baños, La Habana Province. OA 8525, L mandible fragment (edentate), Residuario San Martín, Boca de Jaruco, La Habana Province. OA uncataloged, L C1, Reparto América, Calabazar, Ciudad Habana, La Habana Province. OA uncataloged, partial skull (with R I1, C1-M2 and L I1, C1, P1, M2) and associate R mandible (with I1-I3, P1-M3), from Cueva del Túnel, La Salud, La Habana Province. OA uncataloged, partial L mandible with P1-M2, Cueva del Círculo, Sierra de Cubitas, Camaguey Province. MCZ 7054, R mandible with I2 through M1 but I3, plus 6 isolated teeth, Cueva del Indio (Cueva #1), near Banao, Camaguey Province. OA uncataloged, R mandible with P1-P2, Mayarí, Holguin Province; OA uncataloged, L mandible (edentate), Cueva de los Panaderos, Gibara, Holguin Province. IES/ACC uncataloged, partial skull with L P1-P2 and R P1, M1, from Los Negros, 25 km S Baire, Santiago de Cuba Province. OA uncataloged, partial L mandible with P2, La Gloria, Santiago de Cuba Province. MCZ 10065, R mandible, Cueva San Lucas, Meseta (= Gran Sierra) de Maisi, Guantánamo Province.

306

Biogeography of the West Indies: Patterns and Perspectives

TABLE 8 Mandibular Measurements of Recent S. cubanus (Mean, Sample, Range) and Selected Late Quaternary Material from Cuba Character GML MTR P4M3 DCP ACH

Recent Solenodon cubanus 48.9 (13) 44.7–51.9 25.2 (14) 23.0–26.3 14.2 (14) 13.5–14.8 22.5 (14) 20.6–24.2 13.2 (13) 12.1–14.7

Late Quaternary OA 306E

IES 228

OA 22

IES 3646

OA 124/152

55.1

—

53.2

53.2

—

27.7

28.7

27.4

27.1

27.2

15.7

16.1

15.3

15.5

15.4

24.5

25.3

—

24.1

26.7

15.1

16.6

16.2

15.2

16.3

Note: See text for character code.

Solenodon cf. S. cubanus Referred material: OA 306E (+31), matched mandibles with L P1-P4 and R M2, and associated proximal humerus, Caverna de Pío Domingo, Ensenada Pica-Pica, Sumidero, Pinar del Río Province. IES/ACC 1308-3677, partial R mandible, from alveoli I1 to alveoli M2, edentate; IES/ACC 228, R mandible missing tip from anterior edge of alveoli of I3, edentate; IES/ACC uncataloged, L mandible, edentate; IES/ACC 2598-3646, L mandible with I1 and I2; IES/ACC 2595, partial L mandible, edentate; all from Cueva Paredones, Ceiba de Agua, San Antonio de los Baños, La Habana Province. OA uncataloged, L mandible with P2, Cueva de Calero, Camarioca, Matanzas Province. OA 124-152, L mandible with P1, P2, and P4, Caimanes III, 1.5 km from bay shore, about 150 m from Río Caimanes, Santiago de Cuba Province. Remarks: Larger and more massive than average Recent S. cubanus. Measurements of selected specimens are given in Table 8. IES/ACC 1308-3677, OA 306E, and OA 124-152, all appear to be from adult animals and might approach the mandible size of S. arredondoi. With exception of the material from Caverna Pio Domingo in Pinar del Río, Cueva de Calero in Matanzas, and Caimanes III in Santiago de Cuba, most of the specimens are from Cueva Paredones (a fossil site which is both the type locality of S. arredondoi and an important cave deposit for late Pleistocene S. cubanus). Solenodon arredondoi Distribution: Only known from La Habana and Pinar del Río provinces, western Cuba. For discussion on specific localities see Morgan et al. (1980), Ottenwalder (1991), and Morgan and Ottenwalder (1993). Comparisons: Solenodon arredondoi is significantly larger than all other Solenodon samples in 16 (palatal length, length of maxillary toothrow, anteorbital constriction, zygomatic breadth, squamosal breadth, condylar breadth, maximum length of C1, maximum width of C1, maximum width of P1, maximum length of P2, maximum width of P2, total length of femur, maximum width of femur, minimum shaft width of femur, total length of humerus, and maximum width of humerus) of the 29 measurements available for its sample. It overlaps with the remaining samples in alveolar length of upper molar toothrow, length of upper molar toothrow, breadth across maxillary molar toothrow, interorbital constriction, maximum length of P1, maximum length of M1, maximum width of M1, maximum length of M2, maximum width of M2, maximum length of M3, maximum width of M3, minimum shaft width of humerus, and minimum shaft width of ulna.

Systematics and Biogeography of the West Indian Genus Solenodon

307

FIGURE 10 Lateral views of the skull and mandible in living and extinct species of Solenodon from Cuba: (a) S. arredondoi, skull only (MNHNC 421/123); (b) S. cubanus (USNM 37983).

Geographical variation: Analysis of geographical variation was precluded by small sample available. Solenodon arredondoi Morgan and Ottenwalder 1993 Solenodon arredondoi Morgan and Ottenwalder 1993, Ann. Carnegie Mus., 62:154 Holotype: Nearly complete skull, MNHNC 421/123, lacking only the braincase, with R M1 and M3, and L C1, P1, P2, M1, M2 (Figures 5, 9, 10, and 14). Type locality and age: Cueva Paredones, 3 km southwest of Ceiba de Agua, San Antonio de los Baños, Provincia La Habana, Cuba; a Late Pleistocene fossil cave deposit, as suggested by the known associate vertebrate fauna. Measurements of the holotype: Antorbital constriction, 19.0; zygomatic breadth, 39.0; interorbital constriction, 16.3; squamosal breadth, 35.4; palatal length, 40.7; palatal breadth, 25.2; alveolar length of maxillary toothrow, 28.0; length of M1-M3, 9.7; length of C1, 6.2; width of C1, 4.0; length of P1, 4.0; width of P1, 2.9; length of P2, 5.2; width of P2, 4.2; length of M1, 4.5; width of M1, 7.5; length of M2, 3.3; width of M2, 7.3; length of M3, 2.2; width of M3, 5.8. Distribution: In addition to the type locality this new Solenodon is also known from Abra de Andres, Altura de Esperón, Sierra del Anafe, northeast of Guanajay, Provincia La Habana, and from Caverna de Pío Domingo, Ensenada Pica-Pica, Sierra de Sumidero, Provincia Pinar del Río. Diagnosis: Solenodon arredondoi can be separated by all other species in the genus by its larger size. It differs from the two Hispaniolan and from the single extant Cuban species in morphology and size (see Diagnosis for S. paradoxus, S. cubanus, and S. marcanoi), being closer in morphology to the Cuban Solenodon. It can be distinguished from the two Hispaniolan species, S. paradoxus and S. marcanoi, in the absence of an os proboscis, the relatively broader frontals at the anterior edge of the orbits, more pronounced interorbital constriction, constricted internal narial opening and anterior portion of pterygoid fossa, much larger posteroventrally expanded pterygoid processes, and greatly enlarged and inflated C1 (Ottenwalder, 1991, Morgan and Ottenwalder, 1993). Additional characters separating S. arredondoi from S. paradoxus include the presence of a diastema between I3 and C1 as well as smaller but distinct diastemata between I2 and I3 and C1 and P1, strong lingual expansion of P2, and lack of anterior accessory cusps on C1, P1, and P2. In addition to its larger size, S. arredondoi can be distinguished from the other Cuban species, S. cubanus, by its more prominent pterygoid process, narrower internal narial opening, comparatively more inflated C1, and broader upper premolars, wider anteorbital region at lacrimal foramen, proportionally larger diameter and massiveness of rostrum (Ottenwalder, 1991; Morgan and Ottenwalder, 1993). Referred material: USNM 299480, partial L femur from Abra de Andres, Altura de Esperón, Sierra del Anafe, northeast of Guanajay, Provincia La Habana, Cuba. Collected by Oscar Arredondo and Cesar García del Pino on 15 March 1958 (Arredondo, 1970a; Morgan et al., 1980). OA 301.E, partial associate skeleton, including L humerus, R radius, R innominate, L femur, R proximal and distal tibia, and L calcaneus. Caverna de Pío Domingo, Ensenada Pica-Pica, Sierra de Sumidero,

308

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 11 Dorsal view of skull of living and extinct Solenodon from Hispaniola: (a) S. marcanoi (UF 128162); (b) S. paradoxus woodi, South Hispaniola (JAO 314); (c) S. paradoxus paradoxus, north Hispaniola (JAO 721).

Provincia Pinar del Rio, Cuba. Collected by Oscar Arredondo and J. N. Otero, January 1954 (Morgan et al., 1980). IES/ACC 278, complete R humerus; MNHNC uncataloged, R proximal humerus, collected by Manuel Iturralde in April 1991; IES/ACC 2431-3675, incomplete edentated palate; IES/ACC uncataloged, occipital including condyles and posteriormost portion of supraoccipital with lambdoidal crest; all from the type locality, Cueva Paredones, Ceiba de Agua, Provincia La Habana. Comparisons: Detailed description and comparisons for S. arredondoi with all other members of the genus Solenodon are presented by Ottenwalder (1991) and Morgan and Ottenwalder (1993). Solenodon marcanoi Distribution: Quaternary of Hispaniola; late Pleistocene–early Holocene of Dominican Republic, and late Pleistocene throughout post-Columbian of Haiti. Comparisons: Solenodon marcanoi (Figures 5 and 11 through 14) is significantly smaller than all other species of Solenodon in 41 cranial, mandibular, dental, and limb bone measurements (Table 3). It also averages smaller than other extinct and living Solenodon in 12 additional measurements, with only minor overlap with the South Hispaniolan form (condylar breadth, maximum length of P2, maximum length of P1, maximum length of P2, maximum length of P4, maximum

Systematics and Biogeography of the West Indian Genus Solenodon

309

FIGURE 12 Ventral view of skull of living and extinct Solenodon from Hispaniola: (a) S. marcanoi (UF 128162); (b) S. p. woodi, South Hispaniola (JAO 314); (c) S. p. paradoxus, North Hispaniola (JAO 721).

width of femur) and with S. cubanus (postpalatal length, maximum length of M2, maximum length of M1, maximum length of M2, maximum width of humerus) or both (mastoid breadth, maximum length of M1, minimum shaft width of ulna). In skull appearance (Figures 11 through 13), a few exceptionally cryptic South Hispaniolan animals (S. p. woodi) approach marcanoi, but both are easily separated, among a number of characters, primarily by the larger teeth and broader skull of the former. There is much overlap in the size of the limb bones. Although the femur, humerus, and ulna in some South Hispaniolan and Cuban animals resemble S. marcanoi in overall size, the limb bones of S. marcanoi are shorter in length, but their width is certainly not noticeably larger as previously considered (Patterson, 1962). Geographical variation: The results of univariate analysis between the samples of S. marcanoi from Haiti (F) and the type locality in Sierra de Neiba, Dominican Republic (G) are shown in Table 3. Only 21 measurements of the latter fossil sample (including the type series plus further collections referred to S. marcanoi from the same cave site) are available for comparison. On the basis of this material, the sample from Rancho la Guardia is significantly larger than the S. marcanoi sample from southwestern Haiti in six mandibular and dental measurements (length of mandibular toothrow, alveolar length of P4-M3, maximum width of P1, maximum width of P4, maximum width of M1, maximum width of M2). Both samples overlap in length of mandibular toothrow, depth through coronoid process, angular condylar height, maximum length of P1, maximum length of P4, maximum length of M1, maximum length of M2.

310

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 13 Lateral view of skull and mandibles of living and extinct Solenodon from Hispaniola: (a) S. marcanoi (skull UF 128162, mandible UF 128165); (b) S. p. woodi, South Hispaniola, (JAO 314); (c) S. p. paradoxus, North Hispaniola (JAO 721).

A closer examination of Haitian samples revealed that the two mandibles from the Massif de la Selle (UF 128964 from Trouing Marassa, and UF 125173 from Trouing de la Scierie, La Visite, Département de l’Ouest, Haiti) are actually much larger than the mandibles from Camp Perrin (Sa Wo, Département du Sud) and from the Massif de La Hotte (Trouing Jeremy #1, #5, and #8, Formon, Départements du la Grande’Anse and du Sud, Haiti) and resemble in size those of the type locality in Sierra de Neiba. The results of the analysis also show that the type locality sample is significantly larger than the Haitian sample in all (9) limb bone measurements but one, and that it overlaps primarily with the South Hispaniolan and Cuban samples. Taxonomic conclusions: Despite the size differences in mandibular and lower teeth measurements between La Selle-Neiba samples and La Hotte, there is no doubt about the identity of these mandibles; specimens from all three areas represent S. marcanoi. Unfortunately, the scarcity of Massif de la Selle material precludes any reasonable judgment about the possible differences between this and the samples from the type locality in Dominican Republic and from La Hotte region in Haiti. Additional material would be desirable for an adequate evaluation of their geographical relationships. Close examination of the limb bones, however, indicates that some of the specimens from the type locality that have been assigned to S. marcanoi, including specimens of the type series (MCZ 20325, MCZ 20329, MCZ 20321, MCZ 7263, MCZ 7265) and further collections attributed to this taxon (CM 35036, UF uncataloged), are close in size to the S. paradoxus population from South Hispaniola, and probably represents S. paradoxus (Figure 14, Tables 9 through 11). Fossil or subfossil material of S. paradoxus is known from Rancho la Guardia. Because the existence of the smaller S. paradoxus population from South Hispaniola was previously unknown, comparison of the S. marcanoi type series with S. paradoxus (Patterson, 1962) was based exclusively on North Hispaniolan specimens; MCZ 12384, MCZ 12416, and MCZ 34828 are all from the Cordillera Central region in the Dominican Republic. The proportional dimensions of the femora and humerus of the different Solenodon taxa, as presented in this study, are shown for comparison in Figure 15.

Systematics and Biogeography of the West Indian Genus Solenodon

311

FIGURE 14 Femur (F, a–d), humerus (H, e–g), and ulna (U, h–i) in “small” Hispaniolan Solenodon. Late Pleistocene material from Rancho La Guardia, Dominican Republic (type locality), attributed to S. marcanoi: (a) MCZ 20321; (b) CM 35036; (e) MCZ 7263; (h) MCZ 7265. Recent material of extant South Hispaniolan population of S. p. woodi from Sierra de Baoruco, Dominican Republic: (c, f, i) JAO 314. Late Quaternary material of S. marcanoi from Massif de la Hotte, Haiti: (d, g, j) UF 128174.

Solenodon marcanoi Patterson 1962 Antillogale marcanoi Patterson, 1962. Breviora, 165:2 Solenodon (marcanoi) Van Valen, 1967. Bull. Amer. Mus. Nat. Hist., 135 (5): p. 255 Solenodon marcanoi Varona, 1974. Acad. Cien. Cuba. p. 7 Holotype: MCZ 7261, partial R mandible with P2-M2. Obtained by Bryan Patterson in 1958. Type locality and age: Cave 2 km SE Rancho la Guardia, Hondo Valle, Elias Piña Province, Dominican Republic. Late Pleistocene.

312

Biogeography of the West Indies: Patterns and Perspectives

TABLE 9 Femoral Measurements of a Sample of S. marcanoi from La Hotte in Haiti (Mean, Range, Sample); Attributed “S. marcanoi” Specimens of the Type Series from Rancho la Guardia, Sierra de Neiba, Dominican Republic; and Recent S. paradoxus woodi from South Hispaniolaa Population Sample

Massif de la Hotte (UF)

Total Length

Maximum Width

S. marcanoi 35.5 10.3 34.6–36.9 9.3–11.0 (5) (9)

Minimum Width 4.6 4.4–4.8 (12)

“S. marcanoi” Sierra de Neiba MCZ 20321 CM 35036

South Hispaniola (JAO) JAO 314 UF 30135 (type) UF 18818

42.5 41.21

12.6 12.1

S. paradoxus woodi 44.3 12.5 41.0–47.6 11.4–13.4 (42) (42) 41.0 11.6 41.4 12.6 42.4 11.4

5.2 5.4

4.9 4.3–6.0 (43) 4.6 4.9 5.0

Note: All Recent specimens are adults. a

Specimens from Sierra de Baoruco and Peninsula de Barahona, Dominican Republic, mean, range, sample; JAO 314 from Sierra de Baoruco, Dominican Republic; JAO 462 [type of S. p. woodi] from Peninsula de Barahona, Dominican Republic; UF 18818 from Duchity, Dept. du Sud, southwestern Haiti.

Measurements of holotype: Mandibular toothrow, 21.4; alveolar length of P4-M3, 12.8; length of P4, 3.5; width of P4, 2.4; length of M1, 3.6; width of M1, 3.1; length of M2, 3.4; width of M2. Distribution: Known from the massifs of La Hotte and La Selle in Haiti, and from Sierra de Neiba in the Dominican Republic. Revised diagnosis: Significantly smaller than S. arredondoi, S. paradoxus, and S. cubanus in cranial, mandibular, dental, and limb bone dimensions. In morphology, S. marcanoi shows an intermediate condition between Cuban and Hispaniolan taxa (Ottenwalder, 1991). As in S. paradoxus, it differs from the two Cuban species, from which is geographically separated, in mesopterygoid fossa being wider anteriorly than posteriorly; pterygoid processes reduced, oriented inward or at a converging angle; presence of the os proboscis socket in from of the premaxilla; upper and lower unicuspid and bicuspid dentition laterally compressed. As in S. cubanus, it differs from S. paradoxus in the presence of a distinct diastema between I3 and C1 and between C1 and P1; rostrum short, of reduced diameter; accessory cusps on C1, P1, and P2 are absent or vestigial; P2 triangular, although not lingually expanded. Remarks: The new material of S. marcanoi from southwestern Haiti provides the opportunity for clarification of the interspecific relationships of Solenodon, and might also prove useful in the illumination of their evolutionary relationships. Although a detailed redescription of the skull, mandible, dentition, and postcranial skeleton of S. marcanoi will be presented elsewhere, I must comment that upon examination of the skulls, I believe Antillogale is certainly not much different from Solenodon.

Systematics and Biogeography of the West Indian Genus Solenodon

313

TABLE 10 Humeral Measurements of a Sample of S. marcanoi from Massif de la Hotte in Haiti (Mean, Range, Sample); Attributed “S. marcanoi” Specimens of the Type Series from Rancho la Guardia, Sierra de Neiba, Dominican Republic; and Recent S. paradoxus woodi from South Hispaniola Population Sample

Massif de la Hotte (UF)

Total Length

Maximum Width

S. marcanoi 35.0 14.6 32.9–37.3 13.1–16.5 (8) (16)

Minimum Width

4.5 4.0–5.3 (16)

“S. marcanoi” Neiba MCZ 7263 MCZ 7264

South Hispaniola (JAO) JAO 314 UF 30135 (type) UF 18818

40.1 —

17.6

S. paradoxus woodi 44.0 17.1 40.6–46.8 15.8–18.3 (37) (40) 41.3 16.0 42.9 16.6 40.6 16.6

5.5 5.1

5.0 4.3–5.5 (39) 4.6 5.4 5.4

a

Specimens from Sierra de Baoruco and Peninsula de Barahona, mean, range, sample; JAO 314 from Sierra de Baoruco, southwestern Dominican Republic; UF 30135 [type of S. p. woodi] from Peninsula de Barahona, southwestern Dominican Republic; UF 18818 from Duchity, Dept. du Sud, southwestern Haiti. Note: All Recent specimens are adults.

Referred material (Ottenwalder, 1991): MCZ 7261, partial R mandible with P2-M2 (type specimen); MCZ 7262, L mandible with P4-M2; MCZ 7264, L humerus lacking proximal epiphysis; MCZ 7266, partial L mandible; MCZ 20320, L mandible with I3,P1; MCZ 20324, proximal R femur; MCZ 20322, R humerus; MCZ 20327, R distal humerus; MCZ 20328, distal humerus (2); MCZ 20323, L femur; MCZ 20326, calcaneum; MCZ 20325, ulna; MCZ 20329, distal humerus; MCZ 20321, R femur; MCZ 7263, R humerus; MCZ 7265, R ulna; from Cave 2 km SE Rancho la Guardia, Hondo Valle, Elias Piña Province, Dominican Republic. Late Pleistocene. 1958. Collected by Bryan Patterson. CM 35036, R femur, from Cave 2 km SE Rancho la Guardia, Hondo Valle, Elias Piña Province, Dominican Republic. Late Pleistocene. UF 128162, complete skull missing R I3,P2,M3, and L I2,I3,P1; UF 128964, complete mandible with I3-M3; from Trouing Marassa (= Trujin Bridge, 18°17′N, 72°17′N; UTM-YR878297), La Visite, Département de l’Ouest, Haiti. July 1983. Late Pleistocene–Holocene. Collected by Dan Cordier. UF 125174, partial skull and associate partial skeleton, including R humerus, R radius, L and R ulna, L and R innominate, L and R femur, and R tibia; from Trouing Carfinéys, 2 km E of Cavalier, Département du Sud, Haiti; 950 m. September 1984. Late Quaternary. Collected by Dan Cordier. UF 125173, L mandible with M2-M3; from Trouing de la Scierie, La Visite, Département de l’Ouest, Haiti. September 1983. Late Quaternary. Collected by Dan Cordier.

314

Biogeography of the West Indies: Patterns and Perspectives

TABLE 11 Ulna Measurements of a Sample of S. marcanoi from Massif de La Hotte, Southwestern Haiti (Mean, Range, Sample); Attributed “S. marcanoi” Specimens of the Type Series from Rancho la Guardia, Sierra de Neiba, Dominican Republic; and Recent S. paradoxus woodi from South Hispaniola Population Sample

Hotte

Total Length

Maximum Width

S. marcanoi 40.9 5.1 40.3–41.5 4.5–6.2 (2) (3)

Minimum Width

1.9 1.8–2.0 (4)

“S. marcanoi” Neiba MCZ 7265 UF uncataloged

South Hispaniola JAO 314 JAO 445 UF 18820

45.6 41.3

7.2 —

S. paradoxus woodi 50.8 6.5 40.6–53.8 5.9–6.2 (30) (29) 40.6 5.9 49.3 6.8 49.0 6.4

2.0 2.2

1.9 1.5–2.3 (30) 1.7 1.8 2.2

a

SH sample from Sierra de Baoruco and Peninsula de Barahona, mean, range, sample; JAO 314 from Sierra de Baoruco, Dominican Republic; JAO 445 from Peninsula de Barahona, Dominican Republic; UF 18820 from 27 km NW Les Cayes, southwestern Haiti. Note: All Recent specimens are adults.

UF 128163, partial skull with R I1, P4-M2, and L I1,P4-M3; UF 128164, R mandible with I2-M3; UF 128165, L mandible with I2-M3; UF 128166, R mandible with P4-M2; UF 128167, R mandible with P1-M1; UF 128168, L mandible with P2,P4,M2,M3. UF 128169, L mandible with P1; UF 128170, R humerus; UF 128171, R humerus; UF 128172, L humerus; from Trouing Jeremy #1 (18°20′N, 74°02′W; UTM-XR030274), Formon, Massif de la Hotte, Département du Sud, Haiti. January 1984. Late Pleistocene– Holocene. Collected by Dan Cordier. UF 128180, partial skull with L I1, P4-M2 and R I1, P1-P4, M2, M3; UF 128181, rostrum; UF 128182, anterior fragment of rostrum; UF 128183, L maxilla fragment, edentate; UF 128184, R mandible with P1-M3; UF 128185, L mandible with P1,P4-M2; UF 128186-128188, L mandibles, edentated; UF 128189, R mandible with M3; UF 128190-128191, R and L humerus; UF 128192128193, R distal humerus (2); UF 128194, L femur; UF 128195, L mandible with P1-M3; UF 128196, R mandible with I1, I2, C1; from Trouing Jeremy #5 (18°21′N, 74°01′W; UTM-XR030277), Formon, Massif de la Hotte, Département du Sud, Haiti. January 1984. Late Pleistocene–Holocene. Collected by Dan Cordier. UF 128197, R humerus; UF 128198, L humerus; UF 128199, L femur; from Trouing Jeremy #8 (18°21′N, 74°01′W; UTM-XR030277), Formon, Massif de la Hotte, Département du Sud, Haiti. February 1984. Late Pleistocene–Holocene. Collected by Dan Cordier. UF 125175, partial skull; UF 125177, R mandible; UF 125178, R mandible fragment, edentated; UF 125179, R mandible with M3; UF 125180, L mandible, edentated; UF 125181, L mandible with

Systematics and Biogeography of the West Indian Genus Solenodon

315

FIGURE 15 Femora (F, a–e) and humeri (H, a–e) of known living and extinct Solenodon: (a) S. arredondoi, Cuba, femur OA 301E, humerus IES/ACC 278; (b) S. cubanus, Cuba, USNM 49508; (c) S. p. paradoxus, Dominican Republic, North Hispaniola, JAO 219; (d) S. p. woodi, Dominican Republic, South Hispaniola, JAO 314; (e) S. marcanoi, Haiti, South Hispaniola, UF 128174.

P2, P4; UF 125182, R mandible with P4-M2; UF 125183, L mandible with P4; UF 125184, R mandible, edentated; from Trou Woche Sa Wo, Camp Perrin, Département du Sud, Haiti. April 1983. Late Quaternary. Collected by M. K. Langworthy. UF uncataloged, R femur (2), L femur (3), L humerus (6), R humerus (1), complete ulna (1), partial ulna (3); from Trou Woche Sa Wo, Camp Perrin, Département du Sud, Haiti. 11–14 February 1978 (6–12″). Collected by Charles A. Woods. Sa Wo, 11–14 Feb. 1978. (6–12″). Collected by Charles A. Woods. UF uncataloged, R femur (2), L femur (3), L humerus (6), R humerus (1), 1 complete ulna [S. paradoxus?], partial ulna (3).

LATE QUATERNARY AND RECENT DISTRIBUTION OF SOLENODON MATERIAL

AND

METHODS

Field surveys, museum collections, zoological park records, and an extensive review of the literature were used to establish the historical and present distribution of the different species of Solenodon in Cuba, Haiti, and the Dominican Republic. Field surveys were conducted in the Dominican Republic using the methodology described in Ottenwalder (1985). A total of 300 Recent and 110 late Quaternary specimens, nearly the all of the Solenodon material known to exist in paleontological and Recent mammal collections in North America, Cuba, the Dominican Republic, and Europe, was examined for data on collection locality. During four trips to Cuba, I also conducted interviews with scientists, examined private collections, and reviewed published and unpublished literature not available elsewhere. For late Quaternary material, chronology was established by faunal association or human evidence as defined in Morgan and Woods (1986). New distributional records are included in the figures.

316

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 16 Distribution of S. paradoxus in the Dominican Republic and Haiti.  = Recent;  = Amerindian sites; = Late Quaternary deposits.

RESULTS Solenodon paradoxus The past and present localities of S. paradoxus in the Dominican Republic and Haiti are shown in Figure 16. Results of previous surveys in the Dominican Republic, establishing the known range of the species up to 1983, were described by Ottenwalder (1985). The existence of additional localities where the species survives was established in the following regions of the country: 1. Cordillera Central — Foraging tracks and reports of Solenodon were obtained from several localities during 2-week trips by horse across the interior mountains of the range between the San Juan Valley, on the south, and the Cibao Occidental Valley, on the north. 2. Cabrera Promontory — Four specimens were salvaged, and tracks and reports were obtained from this region, located in the northeastern portion of the country. 3. Distrito Nacional — One specimen was salvaged and reports obtained from a site located 17 km east of Santo Domingo, near the freeway connecting the city and the international airport. The site is a fairly disturbed secondary growth of low, open, scrub forest on Quaternary reef limestone. Archaeological evidence suggests that Solenodon was utilized as food by Amerindians in the same area where Santo Domingo, the capital city, is today. 4. Samana Peninsula — Observations of animals, signs, and reports were recorded. A live adult male was captured for captive studies. 5. Sierra de Martín García — Foraging tracks and reliable reports. 6. Sierra de Yamasa — Several animals were killed in Los Cacaos and Las Guacáras, in the vicinity of the extensive gold mining operation of Pueblo Viejo. Reports were also obtained from the northern slopes of the Cordillera Septentrional (south of Sosua), and from the southernmost slopes of the Cordillera Central northwest of San Cristobal. None of these reports, however, is reasonably recent and further efforts to search for the species should be undertaken to investigate the possibility that Solenodon might still survive in these regions. The range and status of S. paradoxus in Haiti was unknown until 1973 (Woods, 1976, 1981, 1983, 1989). Since then, the species has only been found to survive in the Massif de la Hotte, on the southwestern end of the country. Here, S. paradoxus is restricted to an elevated (800 to

Systematics and Biogeography of the West Indian Genus Solenodon

317

FIGURE 17 Distribution of S. cubanus.  = Recent;  = Amerindian sites;  = reports only.

= Late Quaternary deposits;

900 m) karstic plateau between Pic Macaya and Duchity, extending from the Camp Perrin on the south to Beaumont on the north. Until now, most specimens from that area have come from Plain Martin, comprising a radius of 5 mi within the perimeter of the Catiche–Duchity region. An adult female captured in April 1982 near Beaumont might be the last known animal caught alive. Late Pleistocene to post-Columbian material have been collected from the cave deposits of Trouing Jeremy and Sa Wo, near Camp Perrin (Massif de la Hotte), and from Morne la Visite (Massif de la Selle). At least some of the specimens collected in the 1800s and early 1900s, labeled to have come from the island of “Haiti,” “Santo Domingo,” or “Hispaniola,” must have originated from Haitian territory. To my knowledge, the only confirmed Haitian animals are a series of 12 specimens in the collection of the Max Planck Institute (MPIH) that were obtained from that country in the early 1960s (H. Stephan, personal communication). There is also a somewhat obscure record by Sanderson (1939, p. 117) from Fonds Parisiens, on the south side of Lake Azueï (Etang Saumâtre): “It was there, between some cactus bushes, that we found the decaying remains of the only Solenodon we saw in Haiti. It had been dead a long time, and even my collector’s enthusiasm was unable to extract from the mass more than a few teeth and some claws-monstrous mole-like that could dig even in Haitian soil.” Although a rather marginal habitat for S. paradoxus, the locality is at the foothills of the northern slopes of the Massif de la Selle, where Solenodon was known to occur at higher elevations in the recent past. Solenodon cubanus Previous information about the distribution of S. cubanus is given by Varona (1983) and Abreu et al. (1990). The known late Quaternary and Recent localities of the species are presented in Figure 17. Historically, live animals have only been known from eastern Cuba. With the exception of the holotype (Sierra Almiqui, Sierra de Nipe) most of the live specimens collected between the early 1830s and 1889 came from the area of Bayamo (Poey, 1851; Gundlach, 1866–1867, 1872, 1877, 1895) and the southern slopes of Sierra Maestra (True, 1886). Since then, apparently all further specimens have originated from the northeastern portion: Cuchillas de Baracoa (Allen, 1942; Barbour, 1944); Sierra de Toa (Barbour, 1944); Sierra de Nipe (Barbour, 1944); Cuchillas de Moa (Bofill, 1948); Sierra del Cristal (Granma, 1974). The existence of Solenodon in several localities (Buenos Aires, Naranjos, Cimarrones) of Sierra del Escambray (Sancti Spiritus Province, central Cuba) reported by Sagra (1845) was questioned by Poey (1851) but later supported by Gundlach (1866–1867, 1872, 1877, 1895). More recently, Varona (1983) reported “relatively fresh osteological

318

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 18 Distribution of S. marcanoi in the Dominican Republic and Haiti.  = late Pleistocene.

= Late Quaternary deposits;

material” obtained in Escambray in 1975. Its occurrence in Sierra de los Organos (Pinar del Río Province, western Cuba) was speculated by Varona (1983). The species has been found in the following archaeological sites: Cueva de José Brea, Sierra Pan de Azucar, Pinar del Río Province (Aguayo, 1950); Cueva de la Santa, Bacuranao, Colinas de Villareal, La Habana Province (Arredondo, 1970a); Cueva Funche, Península de Guanacahibes (Gonzalez, 1981). Late Pleistocene–early Holocene material of S. cubanus is known from Cueva San Lucas, Gran Sierra de Maisí (Allen, 1918); Cueva Paredones, San Antonio de los Baños, La Habana (Arredondo, 1955); Cueva de Tarará, Guanabacoa, La Habana (Arredondo, 1955); Cueva del Indio, Sierra de Cubitas, Camaguey Province (Koopman and Ruibal, 1955); Cueva del Tunel, La Habana (Arredondo, 1970a, Arredondo y Varona, 1974; Varona y Arredondo, 1979). Unpublished material was examined from the following archaeological sites not included in Abreu et al. (1990): 1. Residuario San Martín, Boca de Jaruco, La Habana Province; collected by O. Arredondo in 1987 2. La Gloria, Santiago de Cuba Province; collected 17 February 1990 by Ramon Navarrete Pujols 3. Los Negros, 25 km S Baire, Santiago de Cuba Province; collected 19 March 1976 by Ulises Feria Bencosme 4. Cueva Los Panaderos, Gibara, Holguin Province; collected “in the 1960s” by Milton Pino 5. Cueva del Circulo, Sierra de Cubitas, Camaguey Province; collected by Grupo Yarabey Additional material, tentatively referred as Solenodon cf. S. cubanus, has been obtained recently from Cuban kitchen middens: 1. Cueva de Calero, Camarioca, Matanzas Province, collected 1988 by Aida Martinez 2. Caimanes III, 1.5 km from bay litoral and 150 m from Río Caimanes, Santiago de Cuba Province, collected by F. M. A. and Ramon Navarrete Pujols. More recently, late Quaternary material of Solenodon was collected from Cueva del Mono Fósil, Sierra de Galeras, Cordillera de Guaniguanico, Pinar del Río Province (Jaimez, 1989) among the associated fauna of the newly described Cuban howler monkey, Paralouatta varonai (Rivero and Arredondo, 1991).

Systematics and Biogeography of the West Indian Genus Solenodon

319

FIGURE 19 Map of Cuba showing the known distribution of S. arredondoi (late Pleistocene deposits).

Solenodon marcanoi Before its discovery in several cave deposits in Haiti (Morgan and Woods, 1986; Woods, 1989), the distribution of S. marcanoi was restricted to the type locality in the Dominican Republic (Patterson, 1962) (Figure 18). In Haiti, all S. marcanoi deposits have a late Quaternary range, and well-preserved skulls have been found with Rattus at sinkholes on the Plain of Formon (Woods, 1989), indicating that this species was still extant during post-Columbian times. In Rancho de la Guardia, S. marcanoi deposits are aged late Pleistocene, suggesting the possibility of its earlier extinction in north Hispaniola. Solenodon arredondoi The distribution of the giant Cuban Solenodon is illustrated in Figure 19. The skull type and two other previously unknown specimens come from Cueva Paredones, a late Pleistocene cave deposit located about 3 km SW Ceiba de Agua, San Antonio de los Baños, in La Habana Province. According to a sketch map of the cave provided by Manuel Iturralde, the right proximal humerus (MNHNC unnumbered) he collected in April 1991 was found approximately 350 m from the cave entrance, and 180 m past the Salón del Pozo, a gallery known for the large number of fossils produced in the past (Cueva Paredones extends for approximately 500 m). Extensive collections of Cuban fossil vertebrates, including a number of new species of extinct birds and mammals, have been obtained from Paredones during the past 40 years (Arredondo, 1961, 1970b, 1971, 1982, 1984; Brodkorb, 1969). Among the associated fauna collected from this cave, material referrable to S. cubanus has been found in much larger number than the giant form. Several mandibles intermediate in size between the two species, and tentatively assigned to Solenodon cf S. cubanus, have also been obtained from this cave and might represent the giant species. The fauna associated with the Solenodon material includes the following fossil or extinct genera: Nesophontes, Megalocnus, Miocnus, Neocnus, Mesocnus, Heteropsomys, Geocapromys, Ornimegalomys, Tyto, Antillovultur, and Titanohierax. Abra de Andrés, site of the largest known Solenodon femur, has been previously described by Morgan et al. (1980). The third known locality, Caverna de Pío Domingo (OA 301.E), Pinar del Río Province, is also late Pleistocene in age. This material, a partial skeleton, was found on a surface bone matrix bounded on travertine and calcareal concretions (O. Arredondo, 1955, 1976; personal communication, 1990). Excluding Tyto, Antillovultur, and Titanohierax, its associated fauna is similar that of Paredones. All three localities are Late Pleistocene deposits, and located in the two westernmost Cuban provinces, Pinar del Río and La Habana, which suggests that the giant Cuban Solenodon might have been restricted to western Cuba.

320

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 20 Dorsal profiles of the skull of the known species of Solenodon suggesting size-grade niches in the radiation of the group, and comparison of the relative size of the different Solenodon species with the largest species in the genus Nesophontes: (a) S. arredondoi (MNHNC 421/123); (b) S. cubanus (USNM 37983); (c) Nesophontes edithae, Puerto Rico (UK uncataloged, University of Kansas); (d) S. p. paradoxus, North Hispaniola (JAO 721); (e) S. p. woodi, South Hispaniola (JAO 476); (f ) S. marcanoi (UF 128162).

DISCUSSION The four species of Solenodon are similar in appearance. In their radiation, inter-island (Cuban and Hispaniolan) populations evolved distinctive morphological features, whereas within-island populations are separated primarily by size, in addition to morphology, presumably a response to niche partitioning and island area as major selective forces (Figure 20). In Cuba, the larger island, both the large and small species (S. arredondoi and S. cubanus) are larger, respectively, than the large and small species (S. paradoxus and S. marcanoi) from Hispaniola, the smaller island. In Hispaniola, it is noticeable that south Hispaniola populations are smaller than north Hispaniola populations of Solenodon, to the extent that some S. paradoxus from southern Dominican Republic resemble S. marcanoi. A tendency for reduction in body size is obvious in the S. paradoxus populations found south of the Neiba Valley–Cul de Sac Plain. Several adult specimens of S. p. woodi from Sierra de Bahoruco are very close to S. marcanoi both in skull shape (Figures 11 through 13) and in a number of cranial dimensions. Analyses of cranial traits for the four species of Solenodon indicate that S. marcanoi shares characters of both S. paradoxus and S. cubanus. Thus, S. marcanoi either represents an intermediate form between the two species or is ancestral to both, which raises the old problem of primitive vs. derived characters in West Indian insectivores. The two extant species of Solenodon were presumably widely distributed in the past. Current data show that relictual populations of S. cubanus are at present restricted to eastern Cuba, whereas the Hispaniolan species exhibit a larger distribution and a larger number of surviving, although fragmented, populations. Solenodon paradoxus is still widely dispersed throughout Hispaniola, utilizing a gradient of habitats and elevations, and reduced populations have been found surviving under a moderate degree of disturbance. Solenodon cubanus is now constrained to humid montane forest, and appears to be more fossorial in habits than S. paradoxus, which at least seasonally seems to be more active aboveground. A shift to more readily available food sources, and perhaps to a

Systematics and Biogeography of the West Indian Genus Solenodon

321

more diverse prey assemblage, is suggested by changes in its dentition, which might be interpreted as specialization. Solenodon paradoxus may represent a more specialized, derived form, both morphologically and ecologically. The enlarged upper and lower premolars, and massive upper canines of Cuban solenodons are suggestive of an omnivore–insectivore ancestry whose dentition was capable of crushing and food generalism. The following characters of Cuban Solenodon might represent the primitive condition: (1) the first two lower premolars are highly enlarged and inflated; (2) the frontal region is much broader at the anterior edge of the orbits (Figures 9 and 10); (3) the upper canines are greatly enlarged and inflated and lacking anterior accessory cusps (Figure 4). In S. paradoxus, these characters represent derived conditions; first two lower premolars laterally compressed and not lingually expanded; skull cylindrical, frontal broadening is lost (Figure 11); upper canine laterally compressed; accessory cusps in upper canine and premolars (Figure 5). Judging by its skull and femora, S. arredondoi possibly attained a size similar to that of Didelphis, and it has been considered one of the two largest known insectivores, living or extinct (Morgan et al., 1980). Among other features, its humerus, as in other members of the genus, is of primitive fossorial condition. Its distribution was apparently restricted to western Cuba. Elucidation of the origin, mechanisms and timing of entrance, colonization, radiation, and relationships of insectivores in the Greater Antilles are still largely unresolved. At present, their biogeographical history probably represents one of the most puzzling issues among the mammalian fauna of the region. A number of hypotheses were offered during the course of the 20th century, but only during the last 20 years has geological data been seriously and increasingly incorporated into the discussion. Thus far, and in view of the lack of other evidence, most authors agree with the assumption that they are descended from North American insectivores, and that Antillean insectivores represent a monophyletic group (McDowell, 1958; MacFadden, 1980; Lillegraven et al., 1981; Morgan and Woods, 1986; Iturrade-Vinent and MacPhee, 1999). Both dispersal and vicariance have been involved (vicariance followed by inter-island dispersal by MacFadden, 1980; dispersal followed by island–island vicariance by MacPhee and Iturralde-Vinent, 1995). One colonization event for West Indian insectivores is proposed by Morgan and Woods (1986), and a minimum of two initiators or propagules are estimated for the group by MacPhee and Iturralde-Vinent (1995), inferring subdivision of founder clades isolated by water barriers (vicariant events) that followed dispersal and emplacement in the region. According to MacFadden (1980), insectivores may have reached the Greater Antilles in the early Terciary either through vicariance by way of a proto-Antillean archipelago, or by dispersal from nuclear Central America. Perfit and Williams (1989) hypothesized that the Solenodon ancestor might have entered the Greater Antilles from North America, through Cuba or Yucatan, either by vicariance or dispersal. The probability of movements of land mammals to the Greater Antilles from Yucatan (across the Yucatan Channel) or from Central America (Nicaragua Rise) have, however, been diminished by recent paleogeographical analyses (MacPhee and Iturralde-Vinent, 1995, 1999). Chances for entry through the Nicaraguan Rise via Jamaica are reduced because of the limited contact Jamaica had with the rest of the Greater Antilles (Morgan, 1994; MacPhee and Iturralde-Vinent, 1995, 1999). On the other hand, a land connection did not exist between western Cuba and Yucatan during the Terciary (Holcombe et al., 1990; MacPhee and Iturralde-Vinent 1995; Iturralde-Vinent and MacPhee, 1999). Several major events in Greater Antillean paleogeography have been generally assumed (in addition to these latter authors, see among others, Pindell and Dewey, 1982; Guyer and Savaye, 1986; Perfit and Williams, 1989; Pindell and Barrett, 1990; Williams, 1989; Donnelly, 1990; Holcombe and Edgar, 1990): 1. Eastern Cuba and northern Hispaniola were physically connected during the early Oligocene, until late Oligocene. 2. Puerto Rico was connected to north-central Hispaniola during middle Eocene, until late in the Miocene.

322

Biogeography of the West Indies: Patterns and Perspectives

3. Southern and northern Hispaniola were separated for a long time, until suturing along the Cul-de-Sac–Neiba Valley materialized shortly after middle Miocene (according to Donnelly, 1990); neither the time nor the fact of the fusioning have been adequately substantiated. 4. During the early Cenozoic, Jamaica (presumably accompanied by southern Hispaniola) was probably isolated from the rest of the Greater Antilles. Movement of these two landmasses toward the other Antillean elements presumably took place during the late Cenozoic. 5. Whereas there was no general submergence for most Antillean islands, Jamaica underwent total submergence and repeated emergence events from middle Eocene and all of the Oligocene, until middle Miocene. Submergence for southern Hispaniola was only partial. In a series of papers involving detailed Greater Antillean paleogeographical reconstructions and fossil evidence, MacPhee and Iturralde-Vinent (1994, 1995) and Iturralde-Vinent and MacPhee (1999) have contributed a noticeable attempt to the interpretation of the historical biogeography of Antillean land mammals as well as extensive supporting analyses of current geological data. The proposed two-phased land span/vicariance model argues that Cenozoic paleogeography of the Caribbean favored dispersal over land. It is hypothesized that during the Eocene–Oligocene transition, the Aves Ridge emerged for an interval of 1 or 2 million years, at a time when the islands of the northern part of the Greater Antillean Ridge (central and eastern Cuba, north-central Hispaniola, Puerto Rico, Virgin Islands) were closely grouped, conforming either a single large island or a series of islands separated by very narrow water gaps. Connection of the Greater Antillean Ridge with the Aves Rise formed the “GAARlandia land span,” which was briefly linked to northwestern South America. The land span presumably allowed for dispersal of land mammals from northwestern South America to the Greater Antilles during a restricted time period in the midCenozoic. The second phase resulted in the subdivision of the islands, and attempts to explain how the distribution of faunal elements might have been produced via island–island vicariance. These authors suggest that multi-island distribution of lower-level monophyletic units, particularly sloths and insectivores, might support this inference of island–island vicariance. Among other relevant conclusions, MacPhee and Iturralde-Vinent infer that (1) the existing Greater Antilles are no older than middle Eocene; (2) on-island lineages forming the existing Antillean fauna must be all younger than middle Eocene; and (3) most mammals entered the Greater Antilles around the Eocene–Oligocene transition. If, in fact, S. marcanoi represents an intermediate species between S. cubanus and S. paradoxus, and if S. marcanoi is restricted to South Hispaniola, then a connection between Cuba and South Hispaniola is missing. As inferred in MacFadden’s model (“On the Greater Antilles, inter-island dispersal occurred, resulting in, for example, the presence of Caribbean insectivores on Cuba”), arrival of solenodontids into Cuba may have resulted from their dispersal from other existing Antillean landmasses. Jamaica is excluded because of the absence of Solenodon and Nesophontes in the mammalian record of that island, and the assumed sequence of submergence–emergence events of Jamaica until the late Eocene. Thus, derivation either through South Hispaniola (or north-central Hispaniola?) should be considered. Under current knowledge, derivation via south Hispaniola seems unlikely since southern and northern Hispaniola presumably joined after the mid-Miocene, perhaps early Pliocene, and only after eastern Cuba and northern Hispaniola began to drift apart late in the Oligocene. It is assumed that Solenodon initiators were probably already on these islands, much earlier than the time South Hispaniola and Jamaica approached their current positions. If, on the other hand, Cuban Solenodon are in fact older that Hispaniolan Solenodon, then ancestral insectivores entered the Greater Antilles from North America through Cuba. Again, the suggested intermediate relationship of S. marcanoi (and, therefore, implications of a hypothetical connection between Cuba and south Hispaniola, for which there is no evidence that it ever existed) is not easily explained and would be difficult to sustain in view of current geological information.

Systematics and Biogeography of the West Indian Genus Solenodon

323

The presence of endemic species of Nesophontes in the Cayman Islands, presumably derived from one of the Cuban species of the genus (Morgan, 1994), is another example of the Antillean insectivore riddle. According to current data, these islands are possibly very recent and unlikely to have had any land connections with Cuba or Jamaica during the Eocene–Oligocene transition (Iturralde-Vinent and MacPhee, 1999). While these and other critical questions remain to be answered, it is suggested that both S. marcanoi and South Hispaniola seem to be important, if not critical, for adequate clarification of Solenodon relationships. Despite advances in our knowledge of the fossil record of the Greater Antilles and much more complete paleogeographical data, two central topics continue to be elusive: the biogeographical history of Greater Antillean insectivores and the paleogeography of southern Hispaniola and Jamaica. MacPhee and Iturralde-Vinent acknowledge the shortcomings in data in both of these areas. It is not only the paleogeography of southern Hispaniola and Jamaica that remains conjectural. To date, there is no reasonable explanation for the geological similarity shared by eastern Jamaica (Blue Mountains Block), Cuba, and southern Hispaniola. The origin of eastern Jamaica is also controversial and that area may not always have been a part of the Greater Antilles. All of the major clades of Antillean mammals known from the Quaternary (megalonychid sloths, pitheciine primates, and capromyid rodents) are now known to have existed on one or more Greater Antillean landmasses during the early Miocene (Iturralde-Vinent and MacPhee, 1999) with one major exception (solenodontid insectivores). The lack of fossil insectivores from the Miocene may be due to the paucity of the fossil record and the difficulty of recovering fossils from small mammals rather than an actual absence of insectivores in the Greater Antilles during the Miocene. Iturralde-Vinent and MacPhee (1999) indeed concede that the solenodontid colonization is not well explained by the GAARlandia land span or any other model, and that their elucidation will require additional geological, paleogeographical, and paleontological research. Several gaps are notorious in the distribution pattern of S. paradoxus. The species is absent from northern Haiti both in the fossil and living record, and is unknown from cave deposits in Hispaniola with the exception of but one site, Rancho de la Guardia, in Sierra de Neiba. Until relatively recently, the known distribution of S. paradoxus in the Dominican Republic was fairly limited in the north and unknown in the south. Because of its presence in the Cordillera Central of the Dominican Republic, its existence in the Massif du Nord, the Haitian extension of the Dominican range, is to be expected. Solenodon is extant in the mountains near Restauración, on the border with Haiti. Even if the species was extirpated by human activities in recent times, evidence of its historical presence must exist somewhere north of the Cul-de-Sac in Haiti. The Hispaniolan Solenodon is known from Amerindian sites in the north, central, and eastern portions of the Dominican Republic, but only exceptionally has been found in older, fossil deposits. Paleontologically, the vertebrate fauna of the Dominican Republic has been only superficially explored. In part, the rarity of Solenodon in the fossil record of the country is due to a lack of systematic paleontological surveys and collection. The same argument applies to S. marcanoi, which would appear restricted to south Hispaniola, except for its presence in fossil deposits of the type in Rancho la Guardia, Hondo Valle, Sierra de Neiba, north Hispaniola, and just across to the north of the Neiba Valley in the Dominican Republic, very close to the political border with Haiti. The type locality is relatively close to the Massif de la Selle localities and far off from the Massif de la Hotte known fossil sites. In the northernmost range of its distribution and north of the Neiba Valley, in Rancho la Guardia, S. marcanoi specimens are larger than the specimens examined from the Massif de la Selle and significantly larger from the Massif de la Hotte specimens. Furthermore, the S. marcanoi material from the Massif de la Selle, on the southeastern Haitian border, is slightly smaller but close in size to the type locality material, in Rancho la Guardia, and much larger than the specimens examined from southwestern Haiti (Massif de la Hotte and Camp Perrin). These data suggest a tendency for reduction in body size in S. marcanoi from east to west that might be related to a peninsular effect toward the end

324

Biogeography of the West Indies: Patterns and Perspectives

of the Tiburon Peninsula. This effect might have been increased by a drastic reduction of landmass in pre-Pleistocene times, when the Massif de la Hotte and the Massif de la Selle-Sierra de Baoruco block were separated by a deep marine passage along the Jacmel-Fauché depression (Marrausse, 1982; Woods, 1989). The La Selle-Baoruco block was an isolated island until at least the earlylate Pliocene. The combination of reduced island size and isolation might also account for the tendency of southern S. paradoxus, particularly the Baoruco-Barahona population, to be smaller in body size, and thus, for its apparent convergence toward S. marcanoi size. If Solenodon entered northern Hispaniola from southeastern Cuba, it could be predicted that larger S. marcanoi should be found in fossil deposits of north Hispaniola. The geographical range of S. cubanus has contracted dramatically during historical times. Evidence from cave and archaeological deposits indicates that the species was widely distributed in the western and eastern ends of Cuba until the recent past. At present, there seems to be no explanation for its absence from most of central Cuba. Except for Sierra de Cubitas and Sierra del Escambray there are no indications of the existence of Solenodon in that portion of the island. Solenodon certainly moved across central Cuba, either from west to east or from east to west. This passage is supported by its presence in cave and Indian deposits in Sierra de Cubitas. Much of central Cuba is characterized by lowlands, which probably underwent submergence in Pleistocene times. It might also be possible that the two extremes of the island are better known because of the higher research opportunities and resources available in La Habana on the west and in Santiago de Cuba on the east. The western portion is also the only known range of S. arredondoi, which is restricted to Pinar del Río and La Habana provinces. However, a wider distribution for this species could be not be precluded.

ACKNOWLEDGMENTS I thank John F. Eisenberg and Charles A. Woods for their guidance, support, and advice. I am grateful to the many people and institutions in the Dominican Republic that provided me with assistance, support, information, and field companionship. In particular I thank Ernesto Rupp, Angelica Espinal, Alfonso Ferreira, Roberto María, Sixto Inchaustegui, Bienvenido “Blanco” Turbí, Tomas Vargas, Gloria Santana, Onaney Valera, Ricardo García, Ivon Arias, and the staff of the Parque Zoologico Nacional of Santo Domingo (ZOODOM), the Departamento de Vida Silvestre, and Dirección Nacional de Parques. I am thankful to Kent Vliet, Kevin Jordan, Laurie Wilkins, Gary Morgan, Florence Sergile, Dick Franz, Julian Duval, F. Wayne King, Robert W. Woodruff, Mel Sunquist, and Brian McNab for their friendship and support. I am grateful to Missy Woods, Perran Ross, and the staff of the Florida Museum of Natural History for their hospitality in Gainesville. I thank Oscar Arredondo, Jose Fernandez Milera, Gilberto Silva Taboada, Rosendo Martinez, Jorge de la Cruz and Luis de Armas for their assistance and collaboration in Cuba. I also thank the staff of Instituto de Ecología y Sistemática, Academia de Ciencias de Cuba, and the Museo Nacional de Historia Natural de Cuba, in La Habana, for their hospitality. I thank the curators and staff of North American and European systematic collections (Guy Musser, Karl F. Koopman, P. D. Jenkins, Rainer Hutterer, Albert Sanders, Hugh Genoways, Suzanne McLaren, Robert Timm, Bruce Patterson, Xavier Misonne, Murray L. Johnson, Ellen Kritzman, Heinz Stephan, Ernest E. Williams, Maria Rutzmoser, M. Tranier, Erik Ahlander, F. Spitzenberger, Kurt Bauer, Chris Smeenk, H. Felten, Gerhard Storch, George Baumgardner, Richard Thorington, Jr., Phillip Angle, Jeremy Jacobs, Philip Myers, Marian Skupski, Adrian Friday, P. J. H. van Bree, H. Schliemann, and B. W. Woloszyn) who over the years make specimens and critical information available to me. I am indebted to Patricia Erickson for her assistance in scanning the figures on short notice. This study was supported by grants from Wildlife Conservation Society/NYZS. During my stay in Gainesville, I received partial support from grants from John F. Eisenberg, Charles A. Woods, and the Program for Studies in Tropical Conservation.

Systematics and Biogeography of the West Indian Genus Solenodon

325

LITERATURE CITED Abreu, R. M., A. Rams, and J. de la Cruz. 1990. El almiquí (Solenodon cubanus). Algunos aspectos de su historia, biología y conservación. Poeyana 410:1–20. Aguayo, C. G. 1950. Observaciones sobre algunos mamíferos cubanos extinguidos. Boletín de Historia Natural. Sociedad Felipe Poey 3:121–134. Allen, G. M. 1910. Solenodon paradoxus. Memoirs of the Museum of Comparative Zoology 40(1):1–54. Allen, G. M. 1911. Mammals of the West Indies Bulletin of the Museum of Comparative Zoology, Harvard 54(6):175–263. Allen, G. M. 1918. Fossil mammals from Cuba. Bulletin of the Museum of Comparative Zoology 62(4):133–148. Allen, G. M. 1942. Extinct and vanishing mammals of the Western Hemisphere. American Committee for International Wildlife Protection. Special Publications 11:1–620. Allen, J. A. 1908. Notes on Solenodon paradoxus Brandt. Bulletin of the American Museum of Natural History 24:505–517. Arredondo, O. 1951. Sorprendente hallazgo del almiquí en Pinar del Río. Lux. La Habana, 15–17. Arredondo, O. 1955. Contribución a la paleontología de la Sociedad Espeleologica de Cuba. Boletín de la Sociedad Espeleologica de Cuba 1(2):3–31. Arredondo, O. 1961. Descripciones preliminares de dos nuevos géneros y especies de edentados del Pleistoceno cubano. Boletín del Grupo de Exploraciones Científicas. La Habana 1(1):19–36. Arredondo, O. 1970a. Dos nuevas especies subfosiles de mamiferos (Insectivora: Nesophontidae) del Holoceno Precolombino de Cuba. Memoria de la Sociedad de Ciencias Naturales La Salle 30(86):122–152. Arredondo, O. 1970b. Nueva especie de ave pleistocénica del orden Accipitriformes (Accipitridae) y nuevo genero de las Antillas. Universidad de La Habana. Serie de Ciencias Biológicas 4(8):1–19. Arredondo, O. 1971. Nuevo genero y especie de ave fosil (Accipitriformes: Vulturidae) del Pleistoceno de Cuba. Memorias de la Sociedad de Ciencias Naturales La Salle 31 (90):309–323. Arredondo, O. 1976. The great predatory birds of the Pleistocene of Cuba. Pp. 169–197 in Olson, S. L. (ed.). Collected Papers in Avian Paleontology Honoring the 90th birthday of Alexander Wetmore. Smithsonian Contributions to Paleobiology 27:1–211. Arredondo, O. 1982. Los strigiformes fósiles del Pleistoceno cubano. Boletín de la Sociedad de Ciencias Naturales La Salle 140:33–55. Arredondo, O. 1984. Sinopsis de las aves halladas en depósitos fosilíferos pleisto-holocénicos de Cuba. Instituto de Zoología, Reporte de Investigación 17:1–35. Arredondo, O. and L. Varona. 1974. Nuevos género y especie de mamífero (Carnivora: Canidae) del Cuaternario de Cuba. Poeyana 131:1–12. Barbour, T. 1944. The solenodons of Cuba. Proceedings of the New England Zoological Society 23:1–8. Beddard, F. E. 1909. Mammalia. Macmillan, London. Bofill, J. 1948. Datos y documentos que sobre el Almiqui Solenodon cubanus Peters existen en este Museo. Pp. 1–5 in Boytel (ed.). Publicaciones Ocasionales del Museo municipal “Emilio Bacardi Moreau,” Biología (Sección de Historia Natural) 3. Brandt, J. F. 1833. De solenodonte. Novo mammalium insectivorum genere. Mémoires de l’Académie des Sciences de St. Petersbourg 6(2):459–478. Brodkorb, P. 1969. An extinct Pleistocene owl from Cuba. Quarterly Journal of the Florida Academy of Science 31(2):112–114. Butler, P. M. 1956. The skull of Ictops and the classification of the Insectivora. Proceedings of the Zoological Society of London 126:453–481. Butler, P. M. 1972. The problem of insectivore classification. Pp. 253–265 in Joysey, K. A. and T. S. Kemp (eds.). Studies in Vertebrate Evolution. Oliver and Boyd, Edinburgh. Butler, P. M. 1988. Phylogeny of the insectivores. Pp. 117–141 in Benton, M. J. (ed.). The Phylogeny and Classification of the Tetrapods, Volume 2: Mammals. Systematics Association Special Volume 35B. Clarendon Press, Oxford. Cabrera, A. 1925. Genera mammalium. Insectivora, Galeopithecia. Madrid. Cave, A. J. F. 1968. The hyoid arch of Solenodon cubanus. Journal of Zoology, London 155:451–460. Corbet, G. B. and J. E. Hill. 1980. A world list of mammalian species. British Museum (Natural History) and Comstock Publishing Associates, London.

326

Biogeography of the West Indies: Patterns and Perspectives

Dobson, G. E. 1882. A Monograph of the Insectivora. Systematic and Anatomical. Part I. Erinacidea, Centetidae, and Solenodontidae. John Van Voorst, London. Dobson, G. E. 1884. On some peculiarities in the geographical distribution and in the habits of certain mammals inhabiting continental and oceanic islands. Annals and Magazine of Natural History 9:153–159. Donnelly, T. W. 1990. Caribbean biogeography: Geological considerations bearing on the problem of vicariance vs. dispersal. Pp. 595–609 in Azzaroli, A. (ed.). Biogeographical aspects of insularity. Atti Convegni Lincei 85. Accademia Nazionale dei Lincei, Rome. Eisenberg, J. F. 1975. Tenrecs and solenodons in captivity. International Zoo Yearbook 15:6–12. Eisenberg, J. F. and N. Gonzalez Gotera. 1985. The natural history of Solenodon cubanus. Acta Zoologica Fennica 173:275–277. Eisenberg, J. F. and E. Gould. 1966. The behavior of Solenodon paradoxus in captivity with comments on the behavior of other insectivora. Zoologica 51:49–58. Elliot, D. G. 1905. A check list of mammals of the North American continent, the West Indies, and the neighboring seas. Field Columbian Museum, Publication 105, Zoological Series Vol. 6. Emerson, G. L., C. W. Kilpatrick, B. E. NcNiff, J. A. Ottenwalder, and M. W. Allard. 1999. Phylogenetic relationships of the order Insectivora based on complete 12S rRNA sequences from mitochondria. Cladistics 15:221–230. Findley, J. S. 1967. Insectivores and dermopterans. Pp. 87–108 in Anderson, S. and J. K. Jones, Jr. (eds.). Recent Mammals of the World: A Synopsis of the Families. Ronald Press, New York. Flower, W. H. and R. Lydekker. 1891. An Introduction to the Study of Mammals Living and Extinct. Adam and Charles Black, London. González, N. 1981. El record subfosil mas occidental del Almiquí, Solenodon cubanus (Insectivora: Solenodontidae). Academia de Ciencias de Cuba. Miscelanea Zoológica 12:2–3. Gregory, W. K. 1910. The orders of mammals. Bulletin of the American Museum of Natural History 27:1–524. Gundlach, J. 1866–1867. Revista y Catálogo de los mamíferos Cubanos. Pp. 40–56 in Poey, F. (ed.). Repertorio fisico-natural de la Isla de Cuba. Tomo 2. La Habana. Gundlach, J. 1872. Catalogo de los mamíferos cubanos. Anales de la Sociedad Española de Historia Natural. Tomo 1:231–258. Gundlach, J. C. 1877. Contribución a la mammalogía cubana. G. Montiel y Cia., La Habana. 53 pp. Gundlach, J. C. 1895. Notes on Cuban mammals. Proceedings of the Linnean Society of New York 7:13–20. Guyer, C., and J. M. Savage. 1986. Cladistic relationships among anoles (Sauria: Iguanidae). Systematic Zoology 35:509–531. Hall, E. R. 1981. The Mammals of North America, 2nd ed. John Wiley & Sons, New York. Hall, E. R. and K. R. Kelson. 1959. The Mammals of North America. Ronald Press, New York. Holcombe, T. L. and N. T. Edgar. 1990. Late Cretaceous and Cenozoic evolution of Caribbean ridges and rises with special reference to paleogeography. Pp. 611–626 in Azzaroli, A. (ed.). Biogeographical Aspects of Insularity. Accademia Nazionale dei Lincei, Rome. Holcombe, T. L., J. W. Ladd, G. Westbrook, N. N. T. Edgar, and C. L. Bowland. 1990. Caribbean marine geology; ridges and basins of the plate interior. Pp. 231–260 in Dengo, G. and J. E. Case (eds.). The Geology of North America, Vol. H, The Caribbean Region. Geological Society of America, Boulder, Colorado. Honacki, J. H., K. E. Kiman, and J. W. Koeppi. 1982. Mammal Species of the World: A Taxonomic and Geographic Reference. Assoc. Syst. Collections, Lawrence, Kansas. Iturralde-Vinent, M. A. and R. D. E. MacPhee. 1999. Paleogeography of the Caribbean region: implications for Cenozoic biogeography. Bulletin of the American Museum of Natural History, 238:1–95. Jaimez, E. 1989. Casimba. Boletín del grupo espeleológico “Pedro Borás.” Año 1, No. 1:5. Koopman, K. F. and R. Ruibal. 1955. Cave-fossil vertebrates from Camaguey, Cuba. Breviora 46:1–8. Kowalski, K. 1976. Mammals: An Outline of Theriology. Polish Scientific Publications, Warszana. Lawlor, T. E. 1979. Handbook to the Orders and Families of Living Mammals, 2nd ed. Mad River Press, Eureka, California. Leche, W. 1907. Zur Entwicklungsgeschichte des Zahnsystems der Sügetiere. 2. Teil: Phylogenie, 2. Heft: Die Familien der Centetidae, Solenodontidae und Chrysochloridae. Schweizerbartsche Verlagsbuchhandlung, Stuttgart. Lillegraven, J. A., M. C. McKenna, and L. Krishtalka. 1981. Evolutionary relationships of Middle Eocene and younger species of Centetodon (Mammalia, Insectivora, Geolabidae), with a description of the dentition of Ankylodon. University of Wyoming Publications 45:1–115.

Systematics and Biogeography of the West Indian Genus Solenodon

327

MacFadden, B. J. 1980. Rafting mammals or drifting islands? Biogeography of the Greater Antilles insectivores Nesophontes and Solenodon. Journal of Biogeography 7:11–22. MacPhee, R. D. E. 1987. The shrew tenrecs of Madagascar: Systematic revision and Holocene distribution of Microgale (Tenrecidae, Insectivora). American Museum Novitates 2889:1–45. MacPhee, R. D. E. and M. J. Novacek. 1993. Definitions and relationships of Lipotyphla. Pp. 13–31 in Szalay, F. S., M. J. Novacek, and M. C. McKenna (eds.). Mammal Phylogeny: Placentals. Springer-Verlag, New York. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1994. First Terciary land mammals from Greater Antilles: an Early Miocene sloth (Xenarthra, Megalonychidae) from Cuba. American Museum Novitates 3094:1–13. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1995. Origin of the Greater Antillean land mammal fauna, 1: New Terciary fossils from Cuba and Puerto Rico. American Museum Novitates 3141:1–31. Marrausse, F. 1982. Survey of the geology of Haiti; guide to field excursions in Haiti. Florida Geological Society Special Publication:1–103. Matthew, W. D. 1910. On the skull of Apternodus and the skeleton of a new artiodactyl. Bulletin of the American Museum of Natural History 28:33–42. Matthew, W. D. 1918. Affinities and origin of the Antillean Mammals. Bulletin of the Geological Society of America 29:657–666. McDowell, S. B. 1958. The Greater Antillean insectivores. Bulletin of the Amererican Museum of Natural History 115(3):113–214. McKenna, M. C. 1975. Toward a phylogenetic classification of the Mammalia. Pp. 21–46 in Szalay, F. S. and W. P. Luckett (eds.). Phylogeny of the Primates. Plenum Press, New York. Mertens, R. 1939. Herpetologische Ergebnisse einer Reise nach der Insel Hispaniola Westindien. Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft 449:1–84. Miller, G. S., Jr. 1924. List of North American Recent mammals, 1923. U.S. National Museum of Natural History Bulletin 128:1–673. Miller, G. S., Jr. 1929a. A second collection of mammals from caves near St. Michel, Haiti. Smithsonian Miscellaneous Collections 81(9):1–30. Miller, G. S., Jr. and R. Kellogg. 1955. List of North American Recent mammals. U.S. National Museum of Natural History Bulletin 205. Smithsonian Institution, Washington, D.C. Miyamoto, M. M. and M. Goodman. 1986. Biomolecular systematics of eutherians mammals: phylogenetic patterns and classification. Systematic Zoology 35(2):230–240. Moreno, A. 1966. La fauna de Cuba III: Los mamíferos. Boletín del Jardín Zoológico, La Habana 1(5–6):13–15. Morgan, G. S. 1994. Late Quaternary fossil vertebrates from the Cayman islands. Pp. 465–508 in Brunt, M. A. and J. E. Davies (eds.). The Cayman Islands: Natural History and Biogeography. Kluwer Academic, Boston. Morgan, G. S., C. E. Ray, and O. Arredondo. 1980. A giant extinct insectivore from Cuba (Mammalia: Insectivora: Solenodontidae). Proceedings of the Biological Society of Washington 93(3):597–608. Morgan, G. S. and C. A. Woods. 1986. Extinction and the zoogeography of West Indian land mammals. Biological Journal of the Linnean Society 28:167–203. Morgan, G. S. and J. A. Ottenwalder. 1993. A new extinct species of Solenodon (Mammalia: Insectivora: Solenodontidae) from the Late Quaternary of Cuba. Annals of Carnegie Museum 62:151–164. Novacek, M. J. 1982. Information for molecular studies from anatomical and fossil evidence on higher eutherian phylogeny. Pp. 3–41 in Goodman, M. (ed.). Macromolecular Sequences in Systematic and Evolutionary Biology. Plenum Press, New York. Novacek, M. J. 1990. Morphology, paleontology, and the higher clades of mammals. Pp. 507–543 in Genoways, H. H. (ed.). Current Mammalalogy. Plenum Press, New York. Novacek, M. J., M. C. McKenna, N. A. Neff, and R. L. Cifelli. 1983. Evidence from the earliest known erinaceomorph basicranium that insectivorans and primates are not closely related. Nature 306:683–684. Nowak, R. M. 1991. Walker’s Mammals of the World, 5th ed. John Hopkins University Press, Baltimore, Maryland. Nowak, R. M. and J. L. Paradiso. 1983. Walker’s Mammals of the World, 4th ed. Johns Hopkins University Press, Baltimore, Maryland. Ottenwalder, J. A. 1985. The Distribution and Habitat of Solenodon in the Dominican Republic. Master Sc. thesis, University of Florida, Gainesville.

328

Biogeography of the West Indies: Patterns and Perspectives

Ottenwalder, J. A. 1991. The Systematics, Biology and Conservation of Solenodon. Ph.D. dissertation, University of Florida, Gainesville. Ottenwalder, J. A. 1999. Observations on the habitat and ecology of the Hispaniolan Solenodon (Solenodon paradoxus) in the Dominican Republic. Pp. 123–168 in Ecologia de les illes. Monografies de la Societat d’Historia Natural de les Balears No. 6, and Monografia de l’Institut d’Estudis Balearics No. 66. Patterson, B. 1962. An extinct solenodontid insectivore from Hispaniola. Breviora 165:1–11. Paula Couto, C. 1979. Tratado de paleomastozoologia. Academia Brasileira de Ciencias, Rio de Janeiro. Perfit, M. R. and E. E. Williams. 1989. Geological constrains and biological retrodictions in the evolution of the Caribbean sea and its islands. Pp. 47–102 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Peters, W. H. 1861. Note in Monatsber. Königlichen Akademie der Wissenschaften zu Berlin 1861:169. Peters, W. 1863. Die Saugethier-Gattung Solenodon. Abhandlungen der Königlichen Akademie der Wissenschaften zu Berlin: 1–22. Pindell, J. and J. F. Dewey. 1982. Permo-Triassic reconstruction of Western Pangea and the evolution of the Gulf of Mexico/Caribbean Region. Tectonics 1(2):179–211. Pindell, J. L. and S. F. Barrett. 1990. Geological evolution of the Caribbean Region: a plate tectonic perspective. Pp. 405–432 in Dengo, G. and J. E. Case (eds.). The Geology of North America: Vol. H, The Caribbean Region. Geological Society of America, Boulder, Colorado. Poduschka, W. and C. Podushcka. 1983. The taxonomy of the extant Solenodontidae (Mammalia: Insectivora): a synthesis. Aus den Sitzungsberichte der Österreichische Akademie der Wissenschaften MathematischNaturwissenschaftliche Klasse Abt. I, 192. Band 5, bis 10. Heft, p. 225–238. In Kommission bei Springer-Verlag, Wien. Poey, F. 1851. Memorias sobre la historia natural de la isla de Cuba. Barcina, Habana 1:1–463. Rivero, M. and O. Arredondo. 1991. Paralouatta varonai, a new Quaternary platyrrhine from Cuba. Journal of Human Evolution 21:1–11. Saban, R. 1954. Phylogénie des insectivores. Bulletin du Musée National d’Histoire Naturelle, Paris, Série 2, 26:419–432. Sanderson, I. T. 1939. Caribbean Treasure. Viking Press, New York. Schlaikjer, E. M. 1934. A new fossil zalambdodont insectivore. American Museum Novitates 698:1–8. Schwartz, A. 1980. The herpetogeography of Hispaniola, West Indies Studies. Fauna of Curaçao and Caribbean Islands 189:86–127. Simpson, G. G. 1945. The principles of classification and a classification of mammals. Bulletin of the American Museum of Natural History 85:1–350. Simpson, G. G. 1956. Zoogeography of West Indian land mammals. American Museum Novitates 1759:1–28. Springer, M. S., G. C. Cleven, O. Madsen, W. W. de Jong, V. G. Waddell, H. M. Amrine, and M. J. Stanhope. 1997. Endemic African mammals shake the phylogenetic tree. Nature 388:61–64. Stanhope, M. J., V. G. Waddell, O. Madsen, W. W. de Jong, S. B. Hedges, G. C. Cleven, D. Kao, and M. S. Springer. 1998. Molecular evidence for multiple origins of Insectivora and for a new order of endemic African mammals. Proceedings National Academy of Sciences U.S.A. 95:9967–9972. Steadman, D. W., G. K. Pregill, and S. L. Olson. 1984. Fossil vertebrates from Antigua, Lesser Antilles: evidence for late Holocene human-caused extinctions in the West Indies. Proceedings National Academy of Sciences U.S.A. 81:4448–4451. Szalay, F. S. 1975. The origins of primate higher categories; an assessment basicranial evidence. Pp. 91–123 in Luckett, W. P. and F. S. Szalay (eds.). Phylogeny of the Primates: A Multidisciplinary Approach. Plenum Press, New York. Thornback, J. 1983. Towards a mammal conservation strategy. Report to the 59th SSC Meeting, International Union for the Conservation of Nature. Harare, Zimbabwe. 11 pp. Thornback, J. and M. Jenkins. 1982. The IUCN Mammal Red Data Book. Part 1. Unwin Brothers, Surrey, U.K. True, F. W. (1884) 1885. A provisional list of the mammals of North and Central America and the West Indian islands. Proceedings of the U.S. National. Museum, Vol. 7, Appendix, pp. 3–27. True, F. W. 1886. The almiqui. Science. Serie 1, 8:282. Van Valen, L. 1966. Deltatheridia, a new order of mammals. Bulletin of the American Museum of Natural History 132(1):1–126. Van Valen, L. 1967. New Paleocene insectivores and insectivore classification. Bulletin of the American Museum of Natural History 135(5):217–284.

Systematics and Biogeography of the West Indian Genus Solenodon

329

Varona, L. S. 1974. Catálogo de los mamiferos vivientes y extinguidos de las Antillas. Academia de Ciencias, Cuba. Varona, L. S. 1983. Remarks on the biology and zoogeography of the Solenodon (Atopogale) cubanus Peters, 1861 (Mammalia, Insectivora). Bijdragen tot de Dierkunke 53(1):93–98. Varona, S. and O. Arredondo. 1979. Nuevos taxones fosiles de Capromyidae (Rodentia: Caviomorpha). Poeyana 95:1–51. Vrydagh, J. M. 1954. Le solenodon de Cuba. Pp. 107–112 in Les fossiles de demain. Paris. Walker, E. P. 1975. Mammals of the World, 3rd ed. Johns Hopkins University Press, Baltimore, Maryland. Webber, M. 1928. Die Saugetiere. Einführung in die Anatomie und Systematik der recenten und fossilen Mammalia. Band II, Systematischer Teil. Verlag von Gustav Fischer, Jena. Williams, E. E. 1961. Notes on Hispaniola herpetology. 3. The evolution and relationships of the Anolis semilineatus group. Museum of Comparative Zoology, Breviora 136:1–8. Williams, E. E. 1989. Old problems and new opportunities in West Indian biogeography. Pp. 1–46 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Winge, H. 1941. The Interrelationships of the Mammalian Genera. Vol. 1. C. A. Reitzels Forlag, Copenhagen. 418 pp. Woods, C. A. 1976. Solenodon paradoxus in Southern Haiti. Journal of Mammalogy 57(3):591–592. Woods, C. A. 1981. Last endemic mammals in Hispaniola. Oryx 16:146–152. Woods, C. A. 1983. Biological survey of Haiti: status of the endangered birds and mammals. National Geographic Society Research Report 15:759–769. Woods, C. A. 1986. The Mammals of the National Parks of Haiti. Report to USAID/Haiti of project 521-0169-C-003083-00. Woods, C. A. 1989. A new capromyid rodent from Haiti: the origin, evolution, and extinction of West Indian rodents and their bearing on the origin of the New World hystricognaths. Pp. 59–89 in Black, C. C. and M. R. Dawson (eds.). Papers on Fossil Rodents: In Honor of Albert Elmer Wood. Natural History Museum of Los Angeles County, Science Series 33. Woods, C. A. 1990. The fossil and Recent land mammals of the West Indies: an analysis of the origin, evolution, and extinction of an insular fauna. Pp. 641–680 in Azzaroli, A. (ed.). Biogeographical Aspects of Insularity. Accademia Nazionale dei Lincei, Rome. Woods, C. A. and J. F. Eisenberg. 1989. The land mammals of Madagascar and the Greater Antilles: comparisons and analysis. Pp. 799–826 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Woods, C. A. and J. A. Ottenwalder. 1992. The Natural History of Southern Haiti. University of Florida, Gainesville. Woods, C. A., J. A. Ottenwalder, and W. W. Oliver. 1986. Lost mammals of the Greater Antilles. Dodo, Journal, Jersey Wildlife Preservation Trust, 22:23–42. Yates, T. L. 1984. Insectivores, elephant shrews, tree shrews, and dermopterans. Pp. 117–144 in Anderson, S. and J. K. Jones (eds.). Orders and Families of Recent Mammals of the World. John Wiley & Sons, New York.

of the 17 Characterization Mitochondrial Control Region in Solenodon paradoxus from Hispaniola and the Implications for Biogeography, Systematics, and Conservation Management Marc W. Allard, Scott D. Baker, Ginny L. Emerson, Jose A. Ottenwalder, and C. William Kilpatrick Abstract — Solenodon is an endangered genus of insectivoran containing two extant species restricted to two islands of the West Indies. To date, no genetic markers are available to aid in the conservation management of these endangered species. Thus, we provide variable mitochondrial markers in the 5′ end of the control region to be used in the conservation management of S. paradoxus from Hispaniola. Three individuals were sequenced and all clones (n = 3) sequenced for each individual were identical, indicating an absence of heteroplasmy. Sequence lengths of 424 bp were examined for each of the three individuals. Six variable positions in the sequences defined three haplotypes with a nucleotide diversity (π) of 0.953%. The nucleotide diversity is high relative to other endangered species or populations that are protected. The observed level of nucleotide diversity may have resulted from the inclusion of material from specimens that are either geographically or reproductively isolated. Control region R1 repeat structure was compared with patterns reported for other Insectivora. Solenodon was unique in showing only one repeat and a possible second imperfect repeat.

INTRODUCTION Solenodon is an endangered insectivoran genus endemic to the islands of Cuba and Hispaniola. Two surviving species of Solenodon are at present found in the Caribbean, S. cubanus in Cuba and S. paradoxus on Hispaniola. However, additional species occurred on both islands in the past (Ottenwalder, Chapter 16, this volume). On Hispaniola, solenodons have suffered dramatic reductions in number primarily due to habitat destruction and predation by introduced carnivores, mainly domestic dogs (Ottenwalder, Chapter 16, this volume). Additionally, solenodons have a litter size of one or, exceptionally, two individuals, thus limiting their ability to recover population numbers and to repopulate rapidly a given area under conditions of disturbance (Ottenwalder, Chapter 16, this volume). The combined effects of habitat alteration, predation, and small litter size have contributed to the decline of Solenodon populations on Hispaniola (Ottenwalder, Chapter 16, this volume). The reduced Solenodon population is thought to be highly endangered and the degree of genetic diversity found within that population is unknown. This study is the first step to quantify the level of genetic diversity present in a Solenodon sample from the Dominican Republic. Fresh material is difficult to obtain; thus, only three specimens were examined in this report. 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

331

332

Biogeography of the West Indies: Patterns and Perspectives

In an attempt to uncover genetic variation to be used in the conservation management of this species, the 5′ end of the mitochondrial control region (CR) was sequenced. The control region is a noncoding portion of the mitochondrial DNA (mtDNA) located between the genes for tRNA Proline and tRNA Phenylalanine in mammals (Anderson et al., 1982). The CR is the most rapidly evolving portion of the mammalian mitochondrial genome (Aquadro and Greenberg, 1983). In several studies of shrews (Stewart and Baker, 1994; Fumagalli et al., 1996), a high degree of sequence divergence was reported in this region. In addition, these authors reported sequence length heteroplasmy with variation attributed to a 78 to 79 bp tandemly repeated sequence, R1 repeat, and a 12 to 14 bp R2 repeat further downstream (Stewart and Baker, 1994; see Fumagalli et al., 1996, for a detailed description of this region). Variation associated with heteroplasmy and genome size resulting from R2 repeats but not R1 repeats in the control region has been observed in moles, Talpa europaea (Mouchaty et al., 2000), hedgehogs, Erinaceus europaeus (Krettek et al., 1995), and tenrecs, Echinops telfairi (Mouchaty et al., 2000). In this study we examine the 5′ end of the mitochondrial control region, which includes the R1 but not the R2 repeat regions.

MATERIALS AND METHODS Tissue samples of three Solenodon were collected in the Dominican Republic and prepared using ORCA Research, Inc., Nucleic Acid Extraction Kit (IsoQuick). Mitochondrial control region was amplified from genomic DNA by PCR using primers L15926 (TCAAAGCTTACACCAGTCTTGTAAACC) and HCDOM (TGGGCTGATTAGTCATTAGTCCATCGA; Kocher et al., 1989). The optimized thermocycling conditions for these primers were as follows: 94°C for 1 min, 45°C for 1 min, and 72°C for 1 min 20 s, for a total of 35 cycles. To better assess heteroplasmy, cloning was utilized to retrieve individual haplotypes. The TA Cloning method was employed using the pBluescript II sk (–) vector. This vector was blunt end digested with EcoRV, ethanol precipitated, and then subjected to the addition of 3′ deoxythymidine residues using Taq DNA polymerase during a 2-h incubation at 72°C. The vector was phenol/chloroform extracted and ethanol precipitated to remove reagents. DNAs amplified for insertion into the vector were purified through Centricon-100 centrifugal filter devices (Amicon, Millipore) prior to ligation. Ligations and transformations followed standard protocols (Sambrook et al., 1989). Transformed colonies were picked and grown overnight in 4 ml of 2× Luria Bertani medium plus ampicillin. Two microliters of the overnight culture were used as the template in a subsequent PCR that included the same primers under the conditions originally used to produce the amplicon for ligation. This PCR amplification indicated whether the insert was present for a particular clone. If a positive result was obtained, plasmid DNA was extracted and subsequently sequenced using primers L15926 and HCDOM. Plasmid DNA was isolated and purified using the Promega Wizard Plus Minipreps DNA Purification System. Cycle sequencing followed a modified version of the recommended protocol for the ABI PRISM BigDye Terminator Cycle Sequencing Kit. Approximately 100 to 150 ng of template plasmid DNA was used in a 10-µl reaction containing 2 µl of reaction mix. Cycle sequencing products were then purified through Sephadex G-50 columns and dried in a vacuum centrifuge. The final purified product was resuspended in loading dye and run on an ABI PRISM 377 DNA Sequencer. Three clones for each of three individuals were sequenced using these methods. Contiguous sequences were assembled and aligned using MacVector and AssemblyLIGN sequence analysis software (Eastman Kodak Company). Nucleotide diversity, π, was calculated according to Nei (1987:equation 10.6) using the program Arlequin (Schneider et al., 2000).

RESULTS AND DISCUSSION All clones sequenced for each individual were identical, indicating that no heteroplasmy was observed in this population of solenodons, although this may be due to the small sample size

Characterization of the Mitochondrial Control Region in Solenodon paradoxus

333

TABLE 1 Control Region mtDNA Haplotypes for Solenodon paradoxus Individuals Nucleotide Position Individual

Site 71

Site 73

Site 83

Site 112

Site 141

Site 375

1a 2b 3b

C T T

T C T

G G A

G G A

C T T

G G A

Note: Variable sites are listed 5′ to 3′ for the haplotypes and correspond to GenBank accession numbers AF319624–AF319632. Locality information for sampled individuals include (a) Dominican Republic and (b) Dominican Republic, North Hispaniola: 1 km Loma de la Jagua, Cabrera Promontory.

examined. For each of the three individuals, 424 bp were sequenced (GenBank accession numbers AF319624-AF319632). Six variable positions defined three haplotypes. The variable sites were located at positions 71, 73, 83, 112, 141, and 375 (with reference to GenBank accession number AF319632). All differences were transitions (Table 1). Three, four, and five differences were observed between the pairwise comparisons of individuals (Table 1). Nucleotide diversity (π) was determined to be 0.953% for solenodons (±0.809% standard deviation). Solenodon paradoxus sequences displayed no obvious repeat structure in contrast to the multiple tandem repeats found in all three subfamilies of shrews (Stewart and Baker, 1994; Fumagalli et al., 1996). A portion of the solenodon sequence aligned with the R1 repeat found in shrews. The particular sequence was observed once in Solenodon CR from position 180 to 201, with a possible second imperfect repeat from position 92 to 119, whereas the same sequence was repeated from 1 to 9 times in members of the Soricidae. Moles, hedgehogs, and tenrecs show no repeat structure for R1 repeats but show genome size variation and heteroplasmy associated with R2 repeats (Krettek et al., 1995; Mouchaty et al., 2000; see also Savolainen et al., 2000). Future work should collect sequences further downstream from our data to look for R2 repeats in Solenodon as well as R1 and R2 repeat structure in the insectivoran family Chrysochloridae. The S. paradoxus population on Hispaniola of the Dominican Republic, although endangered, appears to possess genetic variability which may be useful for the conservation management of the species. Nucleotide diversity is high relative to other endangered species or populations that are protected (e.g., harbor seals; Stanley et al., 1996), although generally lower than nonthreatened mammals (e.g., Japanese brown bears; Matsuhashi et al., 1999). The level of sequence divergence, however, is within the range reported for Steller sea lions (Bickham et al., 1996), which included samples from two genetically differentiated populations. Ottenwalder (Chapter 16, this volume) observed considerable morphological variation among the Solenodon from Hispaniola and concluded that three forms were represented within recent and fossil material, including the extinct species S. marcanoi and two extant subspecies of S. paradoxus. These two subspecies differ in size and Ottenwalder (Chapter 16, this volume) suggested that their geographical isolation was associated with the paleo north and south islands discussed in detail by Schwartz (1980). Although these two subspecies appear to be restricted to undisturbed areas of either northern Hispaniola (S. p. paradoxus) or southern Hispaniola (S. paradoxus woodi), Ottenwalder (Chapter 16, this volume) noted the presence of some individuals within the size range characterizing South Hispaniolan individuals in North Hispaniola, and vice versa, and he questioned the reproductive isolation of these two forms. The level of nucleotide diversity observed in our paper may result from the inclusion of material from specimens that are reproductively isolated. Two samples from the same locality (Dominican Republic, North Hispaniola: 1 km Loma de la Jagua, Cabrera Promontory) did show considerable genetic differences (Table 1, individuals 2 and 3). Unfortunately, we are not able to associate our sequence data with individual voucher specimens.

334

Biogeography of the West Indies: Patterns and Perspectives

With the observed level of genetic variability and larger sample sizes, one should be able to determine whether population substructuring exists on the island of Hispaniola. Further molecular analyses of additional material may help confirm the number of extant subspecies on Hispaniola and whether the species distinction is warranted when compared to Cuban taxa.

ACKNOWLEDGMENTS We thank C. Thirurathukal for providing helpful technical assistance and S. Mouchaty for her comments regarding insectivoran mtDNA control regions. This research was conducted under a U.S. Fish and Wildlife permit for endangered species, and was funded by a Research and Education for Undergraduates supplement to National Science Foundation grant DEB-9629319 to M.W.A.

LITERATURE CITED Aquadro, C. F. and B. D. Greenburg. 1983. Human mitochondrial DNA variation and evolution: analysis of nucleotide sequences from seven individuals. Genetics 103:87–312. Anderson, S., M. H. L. De Bruijn, A. R. Coulson, E. C. Eperon, R. Sanger, and I. G. Young. 1982. Complete sequence of bovine mitochondrial DNA: conserved features of the mammalian mitochondrial genome. Journal of Molecular Biology 156:83–717. Bickham, J. W., J. C. Patton, and T. R. Loughlin. 1996. High variability for control-region sequences in a marine mammal: implications for conservation and biogeography of Steller sea lions (Eumetopias jubatus). Journal of Mammalogy 77:95–108. Fumagalli, L., P. Taberlat, L. Favre, and J. Hausser. 1996. Origin and evolution of homologous repeated sequences in the mitochondrial DNA control region of shrews. Molecular Biology and Evolution 13:31–46. Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paabo, F. X. Villablanca, and A. C. Wilson. 1989. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proceedings of the National Academy of Sciences U.S.A. 86:6196–6200. Krettek, A., A. Gullberg, and U. Arnason. 1995. Sequence analysis of the complete mitochondrial DNA molecule of the hedgehog, Erinaceus europaeus, and the phylogenetic position of the Lipotyphla. Journal of Molecular Evolution 41:952–957. Matsuhashi, T., R. Masuda, T. Mano, and M. C. Yoshida. 1999. Microevolution of the mitochondrial DNA control region in the Japanese brown bear (Ursus arctos) population. Molecular Biology and Evolution 16:676–684. Mouchaty, S., A. Gullberg, A. Janke, and U. Arnason. 2000. Phylogenetic position of the Talpidae within Eutheria based on analysis of complete mitochondrial sequences. Molecular Biology and Evolution 17:60–67. Mouchaty, S., A. Gullberg, A. Janke, and U. Arnason. 2000. Phylogenetic position of the Tenrecs (Mammalia: Tenrecidae) of Madagascar based on analysis of the complete mitochondrial genome sequence of Echinops telfairi. Zoologica Scripta 29:307–317. Nei, M. 1987. Molecular Evolutionary Genetics. Columbia University Press, New York. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Plainview, New York. Savolainen, P., L. Arvestad, and J. Lundeberg. 2000. MtDNA tandem repeats in domestic dogs and wolves: mutation mechanisms studied by analysis of the sequences of imperfect repeats. Molecular Biology and Evolution 17:474–488. Schneider, S., D. Roesske, and L. Excoffier. 2000. Arlequin ver. 2.000: A software for population genetic data analysis. Genetics and Biometry Laboratory, University of Geneva, Switzerland (http://lgb.unige.ch/ arlequin/). Schwartz, A. 1980. The herpetogeography of Hispaniola, West Indies. Studies of the Fauna of the Curaçao and Caribbean Islands 189:86–127. Stanley, H. F., S. Casey, J. M. Carnahan, S. Goodman, J. Harwood, and R. K. Wayne. 1996. Worldwide patterns of mitochondrial DNA differentiation in the harbor seal (Phoca vitulina). Molecular Biology and Evolution 13:368–382. Stewart, D. T. and A. J. Baker. 1994. Patterns of sequence variation in the mitochondrial control region of shrews. Molecular Biology and Evolution 11:9–21.

Patterns and Radiations 18 Insular of West Indian Rodents Charles A. Woods, Rafael Borroto Paéz, and C. William Kilpatrick Abstract — Systematic relationships and biogeography of West Indian capromyid rodents are examined using data from molecular (cytochrome b gene) and morphological sources. Cladistic analyses using PAUP* indicate that the genus Plagiodontia from Hispaniola is basal to all other capromyids. The Capromyinae from Cuba and the western Antilles is more derived than are the Plagiodontinae from Hispaniola. Paleogeographical reconstructions of the Antilles indicate that it is likely that a land connection (or stepping-stone series of closely associated islands) linked northern South America and the central Greater Antilles approximately 33 million years ago along the Aves Ridge. Vicariance rather than dispersal may account for some of the distribution patters observed, with plagiodontines splitting off 33 myBP, capromyines splitting into Geocapromys and Capromys (sensu lato) 28 myBP, and capromyines splitting into Mysateles and Mesocapromys vs. Capromys 16.5 myBP. Subspecies level splits between Cuba and the Isla de Pinos occurred 3.96 myBP for Capromys subspecies and 1.32 myBP for Mysateles. The two different estimates of the time of the vicariance event that separated Isla de Pinos from Cuba of 3.96 myBP for Capromys and 1.32 myBP for Mysateles suggest that this event was not complete. We suspect that the date for Capromys is a more accurate estimate of the vicariance event, but that Mysateles was able to maintain gene flow between the island and the mainland at some level that slowed the rate of divergence.

INTRODUCTION Our knowledge of West Indian rodents has expanded in the decade since the publication of the last overview of the status and biogeography this group (Woods, 1989a). MacPhee and Iturralde-Vinent (1995) described a new rodent from Cuba (Zazamys veronicae) that they propose is a member of the capromyid subfamily Isolobodontinae. They conclude that the Doma de Zaza locality for Zazamys is early Miocene in age. If Zazamys is an isolobodontine, this would expand the known distribution of the Isolobodontinae to beyond Hispaniola where two well-differentiated species are known. One of the species, Isolobodon portoricensis, is also known from La Gonâve, Ile de la Tortue (both of the Hispaniola region), Mona Island between Hispaniola and Puerto Rico, Puerto Rico proper, Vieques island east of Puerto Rico, as well as St. Thomas and St. Croix. As pointed out by Flemming and MacPhee (1999), no other West Indian rodent species is known to have had such a widespread distribution. No capromyid subfamily has a range extending throughout the Greater Antilles. If MacPhee and Iturralde-Vinent (1995) are correct that Zazamys is an isolobodontine and Flemming and MacPhee (1999) are correct that it is unlikely that humans were responsible for the distribution of I. portoricensis eastward beyond Hispaniola, then the Isolobodontinae would have an exceptionally broad natural range. If so, it would be reasonable to speculate that this group might be at the base of the radiation of capromyids in the Antilles. This chapter builds on the conclusions expressed in the chapter on rodents (Woods, 1989a) in the 1989 biogeography volume. Since that time we have acquired a much broader knowledge of the diversity of West Indian rodents (see Table 1 for a list of currently recognized taxa, with notations as to mass, diploid chromosome number, and status). In the original analysis, the emphasis was on morphological data; that analysis was of 82 morphological features from 18 taxa. The data set is presented again in this chapter because the original volume is out of print and difficult to find, and because we have re-analyzed the data using more current versions of PAUP and with different outgroups. The original morphological analysis suggested that the center of origin of the family 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

335

336

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 List of West Indian Endemic Rodents Taxon Capromyinae Capromys acevedoa C. antiquus C. arredondoi C. garridoi C. latus C. pappus C. robustus C. pilorides C. p. pilorides C. p. relictus (+ ciprianoi) C. p. doceleguas C. p. gundlachianus C. p. spp. Capromys sp. Mesocapromys angelcabrerai M. auritus M. barbouri M. beatrizae M. delicatus M. gracilis M. kraglievichi M. minimus M. nanus M. sanfelipensis M. silvai Mysateles jaumei M. melanurus c M. meridionalis M. p. prehensilis M. p. gundlachi Mysateles sp. (?) g Geocapromys columbianus G. megas G. pleistocenicus G. brownii G. ingrahami G.i. abaconis G.i. ingrahami

G.i. irrectus G. thoracatus Geocapromys sp. Plagiodontinae Plagiodontia aedium

2n Number

40

40

36

34 34

88

Mass (g)

Distribution

Cuba Cuba Cuba Off Cuba (small islet NW of Cayo Largo) Cuba Isla de Pinos Cuba 3782 Cuba Cuba 3511–4860 N. and S. Isla de Pinos Archipiélago Jardines de la Reina Archipiélago Sabana-Camaguey Cayo Campo (Archipiélago de los Canarreos) Cayman Islands 483 Off Cuba (Cayo Salinas in C. de Ana María) 708 Off Cuba (Cayo Fragoso) Cuba Cuba Cuba Cuba Cuba Cuba Cuba, Isla de Pinos Off Cuba (Cayo Juan Garcia) Cuba Cuba 1231 Cuba SW Isla de Pinos 1799 Cuba 1660 N. Isla de Pinos Far eastern Cuba Cuba, Isla de Pinos, off Cuba Cuba Cuba, Isla de Pinos 1741 Jamaica Bahamas Great Abaco 738 East Plana Cay Little Wax Cay Waderick Wells Cay Andros, Cat, Eleuthera, Great and Little Exuma, and Long Little Swan Cayman Islands Hispaniola

Status

Extinct Extinct Extinct Living, CR Extinct Extinct Extinct Living Abundant CR Abundant Abundant CR Extinct Living, CR Living, CR Extinct Extinct Extinct Extinct Extinct Extinct Living, CRb Living, CR Extinct Extinct Living, VUd Living, CRe Living Living, CRf Unknown Extinct Extinct Extinct Living, VU Living,VU Extinct Living Introduced 1973 Introduced 1981 Extinct Extinct Extinct Living, VU

Insular Patterns and Radiations of West Indian Rodents

337

TABLE 1 (continued) List of West Indian Endemic Rodents Taxon P. a. aedium P. a. hylaeum P. araeum P. ipnaeum P. spelaeum P. velozi Rhizoplagiodontia lemkei Isolobodontinae Isolobodon portoricensis I. montanus Zazamys veronicae Hexolobodontinae Hexolobodon phenax H. poolei Hexolobodon sp. Family incertae sedis Heptaxodontinae Quemisia gravis Elasmodontomys obliquus Amblyrhiza inundata Clidomyinae Clidomys osborni C. parvus Echimyidae Heteropsomyinae Boromys offella B. torrei Brotomys contractus B. voratus Heteropsomys antillensis H. insulans Puertoricomys corozalus Muroidea Sigmodontinae Oryzomys antillarum O. victus Oryzomys sp. Megalomys desmarestii M. luciae M. audreyae Undescribed species A i Undescribed species B i

2n Number

Mass (g) 936

±1000 ±1500

Distribution

Status

S. Hispaniola N. Hispaniola Hispaniola Hispaniola Hispaniola Hispaniola Hispaniola

Threatened Rare Extinct Extinct Extinct Extinct Extinct

Hispaniola Hispaniola Cuba

Living, CRh Extinct Extinct

Hispaniola Hispaniola S. Hispaniola

Extinct Extinct Extinct

N. Hispaniola Puerto Rico 50–200 kg Anguilla and St. Martin

Extinct Extinct Extinct

Jamaica Jamaica

Extinct Extinct

Cuba, Isla de Pinos, off Cuba Cuba, Isla de Pinos Hispaniola Hispaniola Puerto Rico Puerto Rico Puerto Rico

Extinct Extinct Extinct Extinct Extinct Extinct Extinct

Jamaica St. Vincent Barbados Martinique St. Lucia Barbuda Montserrat and Anguilla St. Eustatius and St. Kitts Montserrat Antigua Barbuda Guadeloupe Marie Galante

Extinct Extinct Extinct Extinct Extinct Extinct Extinct Extinct Extinct Extinct Extinct Extinct Extinct

338

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 (continued) List of West Indian Endemic Rodents Summary 4 Families 19 Genera 64 Species 12 Subspecies described

3 extinct 14 extinct 51 extinct

Note: CR = Critically endangered; VU = vulnerable; NT = near threatened (1996 IUCN Red List). a b c d e f g h i

Macrocapromys is not separable from Capromys. Possibly already extinct. Mysateles arboricolus from near El Coco (Holguín area) is a young female M. melanurus. Abreu, R. M. and V. Berovides, 1997. Borroto, R. and I. Ramos, 1997. Borroto, R., I. Ramos, C. Mancina and J. Fernández, 1998. Molecular data indicates that this specimen is M. melanurus. Isolobodon portoricensis is probably extinct although the authors have records of unconfirmed recent sightings. See Steadman et al., 1984a, 1984b.

Capromyidae was in the central Antilles in the region of Hispaniola rather than eastward from Puerto Rico and beyond or westward from Cuba and Central America. Here we propose to reexamine the original morphological data and to expand the analysis to include a new data set derived from nucleotide sequences of cytochrome b.

MATERIALS AND METHODS MORPHOLOGICAL ANALYSIS An analysis of 82 morphological features on 18 separate taxa was undertaken using the computer software program PAUP* (version 4.0b4, Swofford, 1999). The morphological features analyzed are listed in Table 2, and include 33 dental, 16 cranial, 4 mandibular, 3 postcranial, and 26 muscle characters. All features were scored as present or absent; variable character states were given a score of 1 to 5. The data set used in the PAUP* analysis is presented in Table 3. The species included in the cladistic analysis are the following: Hispaniola – Plagiodontia aedium, P. araeum, Rhizoplagiodontia lemkei, Isolobodon portoricensis, I. montanus, Hexolobodon phenax, Brotomys voratus Cuba – Capromys pilorides, Mesocapromys nanus, Boromys torrei Bahamas – Geocapromys ingrahami Jamaica – Geocapromys brownii Puerto Rico – Puertoricomys corozalus, Heteropsomys insulans, Homopsomys antillensis, Elasmodontomys obliquus South America – Proechimys iheringi, P. semispinosis. The following taxa were also investigated, but not included in the cladistic analysis: Hispaniola – Plagiodontia velozi, Quemisia gravis Jamaica – Clidomys parvus St. Martin –Amblyrhiza inundata Martinique – Megalomys desmarestii Lesser Antilles – Megalomys sp., Oryzomys sp.

Insular Patterns and Radiations of West Indian Rodents

339

TABLE 2 Characters and Character States Used in the Cladistic Analysis

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. 25. 26. 27. 28. 29. 30. 31. 32. 33. 34. 35. 36. 37. 38. 39. 40. 41. 42. 43. 44. 45. 46. 47. 48. 49. 50.

Character

State

Deciduous molar replaced Deciduous molar position re: zygoma Cement in reentrant folds Cement surrounding theme Cement in bands Amount of cement Cheek teeth hypsodont Cheek teeth hypselodont Upper reentrants with pattern P/Ms/Mt:H Upper reentrants with pattern P/Ms/Mt:H/P Upper reentrants with pattern P/Ms:H Upper reentrants with pattern P/Ms:H/P Upper reentrants with pattern Ms:H Upper reentrants with pattern Mt:H Upper reentrants with pattern Ms/Mt:H Upper deciduous molar with pattern P/Ms/Mt:H Upper deciduous molar with pattern P/Ms:H Upper deciduous molar with pattern Ms:H Upper deciduous molar with pattern P/Mt:H Upper deciduous molar with pattern P/Ms:H/P Lower deciduous molar elongated Reentrant folds form from inside Lower Deciduous molar differs from molars Upper Deciduous molar differs from molars Incisors procumbent Reentrant folds lamellar Upper/lower reentrants differ Reentrants form from outside Lower cheek teeth sigmoid Upper cheek teeth sigmoid Mandibular foramen medial Mandibular foramen in fossa Mandibular foramen height Cheek teeth flat Maxillary toothrow converge Reentrant folds oblique Hook on zygoma dorsomedial Pterygoid winglike Incisive foramen suture Incisive foramen distinct Incisive foramen connection Paroccipital process free Paroccipital process longer bullae Paroccipital process Lateral process Lateral process independent bullae Bulla forms tip of lateral process Pterygoid fossa re: M3 Mesopterygoid fossa Supraorbital ridge

Always(0), late(1), sometimes(2), never(3) Rear(0), middle(1), anterior(2) No(0), yes(1) No(0), yes(1) No(0), yes(1) Absent(0), thin(1), moderate(2), thick(3) No(0), yes(1) No(0), briefly(1), longtime(2), always(3) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), slight(1), great(2) No(0), Juv(1), sometimes(2), always(3) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) High(1), middle(2), low(3), bottom(4) No(0), grading to very(5) No(0), grading to very(5) No(0), yes(1) No(0), yes(1) No(0), yes(1) Anterior(1), mid(2), rear(3) No(0), yes(1) Broad(0), narrow(1), missing(2) No(0), yes(1) No(0), yes(1) Short(1), medium(2), long(3) None(0), slight(1), moderate(2), huge(3) No(0), yes(1) No(0), yes(1) Lateral(1), middle(2), medial(3) Rear M3(1), M3(2), rear M2(3), M2(4) No(0), yes(1)

340

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 (continued) Characters and Character States Used in the Cladistic Analysis

51. 52. 53.

Character

State

Post orbital process Ventral canal of IO foramen Mental foramen of jaw

No(0), slight(1), large(2) No(0), slight(1), deep(2), flange(3) None(0), slight(1), large(2)

Postcranial 54. Five sacral vertebrae fused 55. Acromion process elongated 56. Cervical vertebrae C2+3 fused

No(0), yes(1) No(0), yes(1) No(0), yes(1)

Musculature 57. M. cutaneus maximus interdigitates on thorax 58. M. cutaneus maximus with humeral head 59. M. cutaneus maximus pars thoracoabdominalis perpendicular to pars dorsalis 60. M. cutaneus maximus sweeps over knee 61. M. cutaneus maximus pars femoralis extends to tail 62. M. masseter superficialis pars anterior 63. M. masseter superficialis pars anterior massive 64. M. masseter posterior large with associated jugal fossa 65. M. masseter medialis pars posterior separated by masseteric nerve 66. M. glossophryngeus large with two insertions 67. M. cricothyroideus long and thin 68. M. cricothyroideus multiparted 69. M. hyoglossus with origin free floating 70. M. styloglossus with origin on pterygoid process 71. M. genioglossus with insertion free floating 72. M. sternohyoideus with insertion free floating 73. M. sternohyoideus origin separate from M. sternothyroideus 74. M. omohyoideus lost 75. M. thyrohyoideus insertion free floating 76. M. scalenus anticus present 77. M. supraspinosus and infraspinosus fused 78. M. pectoralis major with two layers 79. M. latissimus dorsi and teres major with separate insertions 80. Latissimus Achselbogen present 81. M. coracobrachialis middle and long heads divided by median nerve 82. M. brachioradialis present

No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1) No(0), yes(1)

Note: Coded polarities of character states are given in parentheses.

For all other taxa discussed data were gathered from published accounts. The revised classification of these rodents is presented below, and summarized in Table 1. Some of the data in Table 2 have been previously discussed and analyzed in a series of separate cladograms (Woods and Hermanson, 1985) to evaluate the importance of different categories of morphological features, such as dental, cranial, postcranial, muscular, and biochemical. One conclusion of that study was that dental features are variable and more subject to convergence than are other kinds of data, such as muscle morphology and blood proteins. Most West Indian rodents are extinct and known mainly as dental remains, however, and so by necessity many dental characters have been included in the cladistic analysis that forms the basis of this study. Characters from other anatomical regions have been included in the present analysis (Table 2) to minimize any possible errors resulting from a heavy reliance on dental features.

Insular Patterns and Radiations of West Indian Rodents

341

TABLE 3 Data Set for 82 Morphological Characters Listed in the Sequence That They Occur in Table 2 Taxon

Character State

Plagiodontia aedium P. araeum Rhizoplagiodontia lemkei Capromys pilorides Mesocapromys nanus Geocapromys brownii G. ingrahami Isolobodon portoricensis I. montanus Hexolobodon phenax Brotomys voratus B. torrrei Heteropsomys insulans H. antillensis Puertoricomys corozalus Proechimys iheringi P. semispinosus Elasmodontomy obliquus

2011011300000100001010000011010155010021111321032010011010010111010111110111100100 30110113000001000000100000110101550100212113210310100110************************** 32110111000000110000000101110001440110200**2***22**00*10************************** 3011031300100000100010001001000143101020111321012110011010010101011111111111100100 30110313001000001000100010010001431011301101110121000110************************** 3011031300100000100010101001000143201020111221012111011010010101010111111111100100 3011031300100000100010101001000143201021210121012111011010010101010111111111100100 32111213000010001000101110110000355011300102210221110*10************************** 32111213000010001000101113110000355111311102210321110*10************************** 32110212000100000001100012110000305010301112310220100*10************************** 300000000001000000011010101100001000**101101210220100*10************************** 300000000001000000011010101100001000**301001110240010*10************************** 310000000000100001001110100011001000**201111210250100*10************************** 310000000000100001001110100011001000**201111210330200*10************************** 3*000000************11**10*01*0030******************0***************************** 30000000100010010100010020011100***01010000221024100**10************************** 3000000010000001000001001001000030100120000221014202*010************************** 0311011200000000100010000311111054510020011331033021*010**************************

Note: * Indicates missing data.

MOLECULAR ANALYSIS (CYTOCHROME b GENE) Specimens Examined Twenty specimens of rodents of the family Capromyidae were examined from the following localities. Capromys pilorides ciprianoi (n = 2): Cuba, Isla de Pinos, Hato Milian, Punta de Piedra Capromys pilorides pilorides (n = 2): Cuba, Pinar del Río Province, 3 km W La Bajada Capromys pilorides relictus (n = 2): Cuba, Isla de Pinos, Estero del Soldado Geocapromys brownii (n = 1): Jamaica, captive born Geocapromys ingrahami (n = 2): Bahamas, East Plana Cay Mesocapromys angelcaberai (n = 1): Cuba, Cayo Salinas Mysateles gundlachi (n = 2): Cuba, Isla de Pinos, La Esperanza Mysateles melanurus (n = 3): Cuba, Guantánamo Province, Parque National Alejandro von Humboldt (2); Granma Province, Guisa (1) Mysateles prehensilis (n = 2): Cuba, Pinar del Rio Province, 3 km W La Bajada Mysateles sp. (n = 2): Cuba, Guantánamo Province, Monte Verde Plagiodontia aedium (n = 2): Hispaniola, captive born. Sequences were also included for two outgroup taxa Octodon degus (AF007059; Lessa and Cook, 1998) and Thrichomys apereoides (U34855; Lara et al., 1996). DNA Sequencing DNA was extracted and purified from samples of soft tissue (liver, spleen, and kidney) stored in 95% ethanol. The tissue was removed from the ethanol, washed with several volumes of distilled water, and soaked in lysis buffer (Longmire et al., 1991) for 24 h. The tissue was frozen in liquid

342

Biogeography of the West Indies: Patterns and Perspectives

nitrogen and ground to a fine powder (Sibley and Ahlquist, 1981). The DNA was extracted and purified by the conventional proteinase K/phenol/chloroform methods outlined by Sibley and Ahlquist (1981) and Blin and Stafford (1976). The fine powder was rehydrated in a microfuge tube with 700 µl of distilled water and the DNA was released from the cells by the addition of 70 µl of 10% SDS and 5 µl of proteinase K (20 mg/ml). The rehydrated tissue powder was incubated at 55°C for 10 to 48 h with any solid bits of tissue being mechanically reduced with a dounce tissue grinder after a few hours of incubation. Proteins were removed from the samples with two extractions with 700 µl of a 1:1 mixture of buffered phenol and chloroform-isoamyl alcohol (24:1) followed by two extractions with only chloroform-isoamyl alcohol (24:1). The DNA was precipitated with the addition of 20 µl of 0.5 M sodium chloride and at least 900 µl of cold 100% ethanol. The precipitated DNA was cooled to –70°C for 10 min and pelleted by centrifugation at 9,000 rpm at room temperature for 1 min. The pelleted DNA was washed with 1 ml of cold 70% ethanol and air-dried. The dried DNA was resuspended in 100 µl of distilled water and stored at 4°C. A portion of the cytochrome b gene was amplified via the polymerase chain reaction (PCR; Saiki et al., 1988) using the following parameters: 35 cycles of 94°C (1 min) denaturing, 50°C (1 min) annealing, and 72°C (1 min, 10 s) extension. Amplification reactions were performed in 25 µl volumes using PCR beads (Amersham Pharmacia Biotech), 0.5 µM of each primer, and 2.5 µl of DNA template. Amplification was accomplished with the use of primers (numbered in reference to Mus; Bibb et al., 1981) L-14115 GATATGAAAAACCATCGTTG and H-14541 CAGAATGATATTTGTCCTCA (Sullivan et al., 1997). Double-stranded PCR products were purified using PEG precipitation (Maniatis et al., 1982). Sequencing was performed on an Applied Biosystems 373 automated DNA sequencer using dye terminator (ABI PRISM) cycle sequencing. Excess dye-labeled terminators were removed with G50 Sephadex spin columns and the cycle sequencing products were dried in a SpeedVac and stored at –80°C until fractionated on the automated sequencer. Sequence Analysis Nucleotide sequences of cytochrome b were aligned by eye against published sequence for Mus (Bibb et al., 1981). Percent sequence divergence and two estimates of genetic distances were calculated using PAUP (version 4.0b4, Swofford, 1999) following the methods of Kimura (1980) and Tamura and Nei (1993). These distances were chosen to facilitate comparisons of divergence levels with those reported for other hystricognath rodents (Lara et al., 1996; Lessa and Cook, 1998) and between species within genera of mammals (Johns and Avise, 1998). Nucleotide positions were treated as unordered, discrete characters with four possible character states: A G C T in all maximum parsimony analyses using PAUP* (version 4.0b4, Swofford, 1999). At least 20 heuristic searches, each employing the tree-bisection branch switching method and a randomized input order of taxa, was used to estimate the most-parsimonious trees. Consensus trees were constructed from the equally most-parsimonious trees using the strict and majority rule options of PAUP*. Nodal support was determined by bootstrap support values (Felsenstein, 1985) using PAUP* and Bremer support indices (Bremer, 1994) using Autodecay (Eriksson, 1997). Sequences of the first 415 bases of cytochrome b of the capromyid rodents examined in this study can be obtained upon request from C. W. K.

RESULTS The first 415 bases of the mitochondrial cytochrome b gene were aligned and analyzed from 20 specimens of 11 taxa of capromyid rodents and two outgroup taxa. Sequence divergence (uncorrected p) between taxa of Capromyidae ranged from 0.4 to 17.4%. The lowest level of sequence divergence (0.4%) was observed between the two subspecies of Capromys pilorides (ciprianoi and relictus) inhabiting the Isla de Pinos. This level of sequence divergence is similar

Insular Patterns and Radiations of West Indian Rodents

343

TABLE 4 Pairwise Estimates of Sequence Divergence Based on the First 415 Bases of the Cytochrome b within and between the Genera and Major Groups of Mysateles Taxon

Capromys

Mesocapromys

Mysateles A

Mysateles B

Geocapromys

Plagiodontia

Capromys Mesocapromys Mysateles A Mysateles B Geocapromys Plagiodontia

1.300 0.141 0.098 0.139 0.141 0.146

11.800 ––– 0.090 0.033 0.158 0.174

8.600 8.200 1.200 0.082 0.146 0.140

11.500 3.200 7.500 1.200 0.142 0.168

12.000 13.300 12.400 12.100 6.000 0.203

12.6 14.6 12.4 14.3 16.6 —

Note: The percent sequence divergence between taxa is above the diagonal, percent sequence divergence within taxa is on the diagonal and Tamura-Nei (Tamura and Nei, 1993) genetic distance is below the diagonal. Mysateles A includes M. prehensilis and M. gundlachi and Mysateles B includes M. melanurus and a specimen that was not designated to species.

to what was observed within subspecies of C. pilorides (X = 0.2%, range 0.0 to 0.5%). The sequence divergence between the Cuban mainland subspecies C. pilorides pilorides and Isla de Pinos forms of C. pilorides was 1.8%. A similar level of sequence divergence (1.2%) was observed between the western Cuban mainland form, Mysateles prehensilis, and M. gundlachi from the Isla de Pinos. Sequence divergence between Mesocapromys angelcaberai and Mysateles melanurus was 3.2% but was 8.0 and 8.3% when compared with M. prehensilis and M. gundlachi, respectively. Levels of divergence among C. pilorides and the various species of Mysateles ranged from 8.6% to 8.7% for M. gundlachi and M. prehensilis to 11.5% for M. melanurus, whereas the level of divergence between C. piloridies and Mesocapromys angelcabrerai was 11.8% (Table 4). The level of sequence divergence among capromyids inhabiting different islands ranged from 6% between Geocapromys brownii and G. ingrahami (Table 4) to 17.4% between Plagiodontia aedium and G. brownii. Table 4 provides a summary of the estimates of the percent sequence divergence and genetic distance (Tamura and Nei, 1993) within and between major groups and genera whereas Table 5 provides Kimura 2-parameter (Kimura, 1980) estimates of sequence divergence and Tamura-Nei genetic distance within and between all taxa of capromyids examined. Of the 415 aligned bases in this data set, 108 phylogenetically informative sites were identified. Maximum parsimony analysis of these 108 phylogenetically informative characters resulted in 14 equally parsimonious trees with a tree length of 238 steps. In the strict consensus of these 14 trees Plagiodontia is the sole member of the basal clade and all of the other taxa are included in a polytomy containing four clades (Figure 1). Capromys and Geocapromys each form monophyletic clades within this polytomy. Mysateles, however, is placed in two distinct clades, one containing M. prehensilis and M. gundlachi and the second containing M. melanurus, an unidentified specimen of Mysateles, and Mesocapromys angelcaberai (Figure 1). All four of these clades are well supported by bootstrap values and Bremer decay indices (Figure 1). Of the 82 morphological characters examined (Table 2), 46 were phylogenetically informative. Maximum parsimony analysis with equal weighting for all phylogenetically informative characters resulted in 27 equally parsimonious trees (Figures 2 and 3) of 136 steps.

DISCUSSION The analysis of cytochrome b sequence data allow us to make several comments about the taxonomic relationships within the Capromyidae. First, there is no genetic evidence to support the recognition of more than a single subspecies of C. pilorides on the Isla de Pinos in spite of morphological differences that suggest distinct morphotypes exist (see Borroto et al., 1992, for a

344

Biogeography of the West Indies: Patterns and Perspectives

TABLE 5 Pairwise Estimates of Sequence Divergence Based on the First 415 Bases of Cytochrome b with Kimura-2 Parameter (Kimura, 1980) Estimates above and Tamura-Nei (Tamura and Nei, 1993) Distances below the Diagonal Taxon

Cpp

Cpc

Cpr

Mp

Mg

Gi

Gb

Pa

Ma

MM

Msp

Cpp Cpc Cpr Mp Mg Gi Gb Pa Ma Mm Msp

0.000 0.017 0.019 0.099 0.099 0.145 0.140 0.148 0.147 0.147 0.143

0.017 0.005 0.004 0.100 0.096 0.142 0.138 0.142 0.137 0.136 0.134

0.018 0.004 0.002 0.097 0.097 0.143 0.139 0.147 0.138 0.137 0.134

0.095 0.095 0.093 — 0.012 0.136 0.150 0.136 0.088 0.083 0.079

0.095 0.092 0.093 0.012 0.003 0.142 0.157 0.143 0.091 0.088 0.079

0.140 0.137 0.138 0.133 0.139 0.000 0.065 0.188 0.165 0.149 0.143

0.153 0.130 0.131 0.142 0.148 0.064 — 0.217 0.151 0.138 0.139

0.144 0.138 0.142 0.134 0.140 0.180 0.204 — 0.174 0.172 0.164

0.137 0.128 0.129 0.086 0.089 0.158 0.142 0.166 — 0.030 0.035

0.137 0.127 0.128 0.081 0.086 0.144 0.131 0.165 0.030 0.011 0.013

0.134 0.125 0.125 0.077 0.077 0.139 0.132 0.158 0.035 0.013 —

Note: Taxa designations: Cpc = Capromys pilorides ciprioni; Cpp = Capromys pilorides pilorides; Cpr = Capromys pilorides relectus; Gb = Geocapromys brownii; Gi = Geocapromys ingrahami; Ma = Mesocapromys angelcaberai; Mg = Mysateles gundlachi; Mm = Mysateles melanurus; Mp = Mysateles prehensilis; Msp = Mysateles sp.; Pa = Plagiodontia aedium.

description of the morphological distinctions). The estimates of sequence divergence (Table 5) observed between C. p. ciprianoi and C. p. relictus are comparable to the level of sequence divergence observed within C. p. ciprianoi. Thus all Capromys on the Isla de Pinos should be recognized as a single taxon and the valid name for this taxon would be C. p. relictus because it is the oldest name, dating to G. M. Allen in 1911. The genetic data, however, do support the recognition of C. p. pilorides and C. p. relictus (which would include C. p. ciprianoi) as distinct subspecies (Figure 1). Second, both the estimates of sequence divergence (Table 4) and the parsimony analysis support recognition of two distinct species of Geocapromys. However, other species designations do not appear to be warranted. Mysateles prehensilis from the mainland of western Cuba and M. gundlachi from Isla de Pinos have slightly less sequence divergence (Table 4) than what was observed between C. p. pilorides from the Cuban mainland and C. p. relictus from Isla de Pinos. These two taxa of Mysateles form a monophyletic clade (Figure 1) and should be recognized as subspecies of M. prehensilis (M. p. prehensilis and M. p. gundlachi). Likewise, the undescribed form of Mysateles (Mysateles sp.) genetically appears to be a specimen of M. melanurus (Table 5) and (Figure 1). Third, Mysateles as it is currently recognized does not appear to form a monophyletic group. Parsimony analysis places the forms of Mysateles within two distinct clades (Figure 1). Mesocapromys angelcabrerai is the sister taxon of Mysateles melanurus in one clade whereas the two subspecies of M. prehensilis are contained in the other clade (Figure 1). The level of sequence divergence (Tables 4 and 5) observed between Mesocapromys and Mysateles melanurus suggest that these taxa are congeneric if not conspecific. Plagiodontia appears as the basal lineage of the capromyids (Figure 1) and the observed levels of sequence divergence (Tables 4 and 5) support its recognition as a distinct genus. The difficult question that remains is how many other genera of capromyid rodents are represented among the taxa sampled in this study. The parsimony analysis (Figure 1) provides little help with an unresolved polytomy containing four clades. One possibility would be that each of the four clades represents a distinct genus (Capromys, Mysateles, Geocapromys, and Mesocapromys, including Mysateles melanurus), most of which are monotypic. However, the Kimura 2-parameter levels of sequence

Insular Patterns and Radiations of West Indian Rodents

345

Octodon Thrichomys Capromys p. pilorides Capromys p. pilorides Capromys p. ciprianoi Capromys p. relictus Capromys p. relictus Capromys p. ciprianoi Mysateles prehensilis Mysateles gundlachi Mysateles gundlachi Mysateles gundlachi Mysateles gundlachi Geocapromys ingrahami Geocapromys ingrahami G. brownii Mesocapromys angelcabrerai Mysateles melanurus Mysateles melanurus Mysateles melanurus Mysateles sp. Plagiodontia aedium

FIGURE 1 Strict consensus of 14 equally parsimonious trees of 238 steps (CI = 0.588, RI = 0.795). Branch lengths are shown above the branches and bootstrap and Bremer support indices are below the branches.

divergence (Table 5) are well within the range and near the mean of 0.112 for congeneric species of mammals reported by Johns and Avise (1998). In addition, the levels of Tamura-Nei distance observed among Capromys and Mysateles prehensilis (Tables 4 and 5) are within the range observed among species of Ctenomys (Lessa and Cook, 1998) and are well below the levels seen between genera of echimyid rodents (Lara et al., 1996). It is hoped that additional sequence data from the cytochrome b and other genes will allow further resolution of the systematic relationships among the taxa of capromyid rodents. Molecular data may be used to obtain independent estimates of the divergence times of both capromyids inhabiting different islands and taxa within Cuba. Irwin et al. (1991) observed that third position transversions in cytochrome b accumulate at an approximately linear rate without

346

Biogeography of the West Indies: Patterns and Perspectives

Plagiodontia aedium Plagiodontia araeum Elasmodontomys Rhizoplagiodontia Capromys pilorides Mesocapromys nanus Geocapromys brownii Geocapromys ingrahami Isolobodon portoricensis Isolobodon montanus Hexolobodon phenax Boromys voratus Boromys torrei Heteropsomys insulans Heteropsomys antillensis Puertoricomys corozalus Proechimys semispinosus Proechimys iheringi FIGURE 2 Strict consensus of 27 equally parsimonious trees of 136 steps (CI = 0.529, RI = 0.672) based on morphological data of capromyid, echimyid, and heptaxodontid taxa. Branch lengths are shown above the branches and bootstrap values are below the branches (with Elasmodontomys as an outgroup).

significant saturation for tens of millions of years. Therefore, levels of genetic divergence observed in third position transversions among all pairwise comparisons were used to estimate divergence times. Several molecular clocks for cytochrome b have been suggested (Irwin et al., 1991; Smith and Patton, 1993) and the selection of the suitable clock rate is problematic. We have used both the rate of Smith and Patton (1993) of 1.8%/MA as this rate was found to have the best correspondence with the fossil data for the hystricognath family Ctenomyidae (Lessa and Cook, 1998). These molecular data suggest that Plagiodontia on Hispaniola diverged from other capromyid rodents about 20 myBP and the Geocapromys diverged approximately 17 myBP. Mesocapromys (including Mysateles melanurus) diverged from Capromys about 15 myBP, whereas Mysateles prehensilis diverged about 10 myBP. The divergence of the forms of Capromys on Isla de Pinos from the Cuban mainland taxon occurred about 2.4 myBP whereas the divergence between the Cuban mainland and the Isla de Pinos taxa of Mysateles occurred about 0.8 myBP.

Insular Patterns and Radiations of West Indian Rodents

347

Plagiodontia aedium Plagiodontia araeum Rhizoplagiodontia lemkei Capromys pilorides Mesocapromys nanus Geocapromys brownii Geocapromys ingrahami Isolobodon portoricensis Isolobodon montanus Hexolobodon phenax Boromys voratus Boromys torrei Heteropsomys insularis Heteropsomys antillensis Puertoricomys corozalus Proechimys iheringi Proechimys semispinosus Elasmodontomys obliquus

FIGURE 3 Strict consensus of 27 equally parsimonious trees of 136 steps (CI = 0.529, RI = 0.672) based on morphological data of capromyid, echimyid, and heptaxodontid taxa. Branch lengths are shown above the branches and bootstrap values are below the branches (with Proechimys as an outgroup).

IMPLICATIONS OF SEQUENCING DATA ON BIOGEOGRAPHICAL AND EVOLUTIONARY HYPOTHESES In 1989 Woods (1989a, 1989b) proposed that rodents dispersed to the Antilles from the south, and that Hispaniola and Puerto Rico were the centers for the adaptive radiation of capromyids. The finding of Zazamys on Cuba confirms the presence of well-defined capromyids in the western Antilles as far back as the early Miocene (MacPhee and Iturralde-Vinent, 1995). The comprehensive analysis of Caribbean paleogeography by Iturralde-Vinent and MacPhee (1999) reconstructs the positions and relationships of the major landmasses of the Caribbean throughout the Cenozoic. They propose that the Aves Ridge was an above-water land span between the Greater Antilles and northern South America between 33 to 35 mya. They refer to this united landmass as GAARlandia, and it would have provided a land bridge connecting South America and points as far to the west as the Blue Mountains in what would become Jamaica and central Cuba. Woods (1989a, 1990) proposed a similar “link” between northern South America and the central Antilles via the

348

Biogeography of the West Indies: Patterns and Perspectives

Aves Ridge based on the geological interpretations of Holcombe and Moore (1977) and Holcombe and Edgar (1990), who suggested that the Aves Ridge was emergent until the early Miocene when it was between 500 and 1000 m higher than its present relationship with the ocean surface. In either scenario the Aves Ridge would have provided an opportunity for a fairly easy dispersal of protocapromyids into the Antilles, either directly via GAARlandia as Iturralde-Vinent and MacPhee (1999) propose, or by a series of short overwater dispersals of 65, 30, 60, 10, 20, 120, and finally 150 km between South America in the region of Isla Margarita and the Saba Bank just east of Puerto Rico (see Woods, 1989a:768–769; 1990 and Iturralde-Vinent and MacPhee, 1999:figure 6 and pp. 31, 52–59, for an in-depth discussion of the paleogeography of the Aves Ridge). If the center of capromyid evolution was in the region of the Aves Ridge (now totally submerged) and Puerto Rico and Hispaniola, it should be possible to find genetic evidence to support this pattern when extant capromyids are analyzed. Our data clearly support the hypothesis that Hispaniola (i.e., the central Antilles) contains capromyids more basal in the pattern of adaptive radiation of this group of rodents. The analysis of cytochrome b sequences confirms that Plagiodontia aedium is basal to all other capromyids examined (Figure 1). The genus Plagiodontia, with five and maybe six currently recognized species, is totally confined to Hispaniola and its closest archipelagos (such as La Gonâve Island). The closest known relative (= sister group) of P. aedium is the now extinct Rhizoplagiodontia lemkei, which is also known only from Hispaniola (Woods, 1989b). As noted above, the calibration of the molecular clock for cytochrome b is problematic. For murid rodents in South America the rate of substitution has been estimated to be 1.8% per million years (Smith and Patton). Based on this clock Plagiodontia diverged from the remaining capromyids approximatley 20 mya. If the estimates of vicariance events of GAARlandia by Iturralde-Vinent and MacPhee (1999) are correct, then this estimate is 12 to 13 million years too late. Capromyids, like all hystricognath rodents, have unusually low metabolic rates, long gestation times, give birth to few young, which tend to be born in a precocial state, and to be long lived. So, it is probable that the molecular clock in capromyids runs more slowly than in murids. The estimate of 0.5% per million years (Irwin et al., 1991) would give a figure of 75.4 million years for the divergence of Plagiodontia, which is clearly too far back in time. We were not able to include sequence data from Isolobodon portoricensis (which is “probably” extinct in our opinion). There is some evidence that it still survives on Ile de la Tortue where its remains are common (while remains of Plagiodontia have never been collected in spite of extensive collecting) and where there are very recent reports of “zagoutis” (Haitian Creole for hutia) (Woods et al., 1986). MacPhee and Iturralde-Vinent (1995) propose that the Isolobodontinae is an ancient capromyid group in the Antilles, and that the presence of Zazamys on Cuba is an example of island–island vicariance as the time of the breakup of GAARlandia. We wish that we were able to test this interesting hypothesis via sequencing, but lacked the tissue necessary to include the taxon in this analysis. It is possible that sequences can be obtained from relatively fresh looking skeletal material collected in cave and kitchen midden sites. Flemming and MacPhee (1999) have examined the status of I. portoricensis, and have dated bones collected from two different sites in Puerto Rico as 1,080 ± 50 rcyrbp and 620 ± 60 rcyrbp. They do not believe that there is evidence to support close cultural ties to Isolobodon, nor that it survived into the time of European colonization. If we set the molecular clock for capromyids on the basis of the vicariance of Hispaniola in GAARlandia (Iturralde-Vinent and MacPhee, 1999) at 33 mya then we can recalibrate the cytochrome b molecular clock and recalculate the times of divergence of other capromyids. Assuming that Plagiodontia diverged from the remaining capromyids in the analysis 33 mya, then Geocapromys, with a known range that includes the Bahamas, Cuba, Jamaica, the Cayman Islands, and Little Swan Island far out in the western Caribbean, diverged from the remaining forms at approximately the same time (28 mya). Like Plagiodontia, the radiation of Geocapromys is a distinct and well-defined clade according to molecular data (Figure 1) even though there is a great deal of morphological similarity (see figures 3a and 3b in Woods, 1989a). Within the radiation of Cuban capromyids (sensu lato) there appears to be a split of ancient origin. The small hutias of

Insular Patterns and Radiations of West Indian Rodents

349

the genus Mesocapromys (less than 800 g) and the dark and similar Mysateles melanurus (1,231 g) from the eastern highlands form another natural clade that separated from remaining capromyids about 16.5 myBP. These clades are easily discernible in Figure 1. The isolation of the Geocapromys (28 myBP) and the split between Capromys and Mesocapromys/Mysateles melanusus (16.5 myBP) may relate to old vicariance events on the long and geographically diverse island of Cuba. The Isla de Pinos, 50 km off the southwestern coast of Cuba, was frequently attached to the Cuban mainland during the past. As sea levels changed during the late Pleistocene, for example, a maximum depression of –118 m 20,000 years ago would have resulted in the Isla de Pinos being part of a broad expanded coastal plain well within the mainland of Cuba. Earlier in the Pleistocene (125,000 years ago in the mid-Sangamonian) sea levels were 6 to 20 m above the present level, and many parts of the current Isla de Pinos would have been flooded (see figure 1 in Biknevicius et al., 1993). In addition, the island is quite diverse in geomorphology. The northern areas of the island are well forested and diverse in topography with many upland regions. The most significant upland regions are near Nueva Gerona in the north (Sierra de Casas and Sierra de Caballos). The highest elevation (310 m) is in the north in the Sierra de la Cañada. Much of the northern mountainous part of Isla de Pinos would remain untouched if the sea level rose 20 m. The southern part of Isla de Pinos (south of a well-defined band of swampland crossing the island), however, is low lying and characterized by extensive karst exposures. Most if not all of this area would be inundated by rising sea levels. The arboreal prehensile-tailed hutia of the northern Isla de Pinos (Mysateles gundlachi) diverged from the mainland form (M. prehensilis) less than 1.32 myBP, and is not distinct enough to be considered a valid species (= M. prehensilis gundlachi). This would imply an incomplete vicariance event between western Cuba and the nearby Isla de Pinos during the mid- to late Pleistocene as sea levels fluctuated and prehensile-tailed hutias occupied a continuous forest zone at times of low sea levels. However, the larger, heavy-bodied Capromys pilorides group (a superspecies in the view of John Eisenberg, personal communication) split into a mainland and insular Isla de Pinos dicotomy 3.96 myBP, indicating a more complete vicariance event.

SUMMARY OF WEST INDIAN EVOLUTIONARY HISTORY AND BIOGEOGRAPHY OF RODENTS Analyses of morphological (Woods, 1989a) and molecular data sets indicate support for the hypothesis that capromyid rodents evolved in the central Greater Antilles (Tables 4, 5, and Figures 1 through 3). The known date for Zazamys in Cuba proves that the start of the invasion of rodents into the Antilles had to be before the early Miocene. The analysis of the mitochondrial cytochrome b gene indicates a level of divergence that is consistent with this level of antiquity. The most parsimonious explanation for how rodents entered the Antilles is that they traveled from northern South America along the axis of the present-day Aves Ridge. If Iturrlade-Vinent and MacPhee (1999) are correct in their assertion that there was a brief period 33 to 35 myBP when the Aves Ridge and main units of the Greater Antilles (= GAARlandia) were united and the Aves Ridge proper was above sea level, then the initial dispersal would have been less difficult than previously proposed. By this hypothesis, 33 myBP is an important window in time. However, it is possible that the dispersal was not necessarily limited to that brief episode 33 myBP, and that an earlier island–island dispersal event could have occurred and been a major component in the early adaptive radiation of capromyids. In this chapter we have not addressed the important question of what group of South American rodents capromyids are most closely related to, and what the relationships are between capromyids and intra-Caribbean echimyids and the large and distinctive heptaxodontid rodents of Jamaica, Hispaniola, Puerto Rico, and the northern Lesser Antilles. Those relationships were discussed by Woods (1989a) but remain unresolved (see Figures 2 and 3 for an indication of how echimyids group with capromyids and Elasmodontomys). What is resolved is the confirmation that the radiation of capromyid rodents dates back to at least the early Miocene, and that the basal

350

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 4 Map of the distribution of capromyids in the West Indies.

lineage of capromyids (sensu stricto) is the subfamily Plagiodontinae. Vicariance events probably account for the major branches of the radiation of capromyids. If MacPhee and Iturralde-Vinent (1995) are correct that Zazamys is a member of the capromyid subfamily Isolobodontinae, then this radiation too is very ancient. Such an interpretation is supported by the cladistic analyses of morphological data in Woods (1989a:figures 3a, 3b), which indicate that the sister group for the two Hispaniolan species of Isolobodon is Elasmodontomys (a “heptaxodontid”) from Puerto Rico, and that Hexolobodon (from Hispaniola) is part of the same radiation. If Proechimys iheringi is used as the outgroup then Elasmodontomys clusters with Plagiodontia and Rhizoplagiodontia (Figure 2). Although this cladogram (Figure 2) is not inconsistent with the hypothesis that the plagiodontines are at the base of the capromyid radiation and that the ancient center of that radiation is Hispaniola and Puerto Rico, it provides no support that the plagiodontine radiation is more ancient than other capromyid radiations. In this morphological analysis (Figure 2) Capromys, Mesocapromys, and Geocapromys group together as a natural group, whereas the two species of Isolobodon group off by themselves, as does Hexolobodon in an unresolved part of the cladogram in the general area of the West Indian echimyids. If Elasmodontomys is used as the outgroup (Figure 3), the plagiodontines appear to represent the basal radiation of the capromyids. In this analysis, however, the echimyids appear to be part of the capromyid radiation (Figure 3). The same basic relationships are seen among Capromys, Mesocapromys, Geocapromys, Isolobodon, and Hexolobodon regardless of which of the two taxa is used as an outgroup (Figures 2 and 3). In all of these analyses (based on either molecular or morphological data), the Plagiodontinae either consistently rank as the basal groups in the cladistic analysis of the capromyid radiation (Figures 1 and 3) or as part of an unresolved polytomy (Figure 2). Molecular data would go a long way in resolving these biogeographical conundrums, but so far remain unavailable because all these taxa are extinct and no molecular data are available. However, for the taxa analyzed in this chapter a pattern emerges that points clearly to the conclusion

Insular Patterns and Radiations of West Indian Rodents

351

FIGURE 5 Map of the distribution of surviving capromyids in Cuba and associated archipelagos. Note: The exact distributions of Mysateles prehensilis and M. melanurus on the Cuban mainland have not been determined with certainty.

FIGURE 6 Map of the distribution of capromyids in Hispaniola.

that capromyid rodents invaded the Greater Antilles from northern South America, and that the most ancient living representatives of that radiation are found in Hispaniola and Puerto Rico (see Woods, 1996, for a discussion of the Recent mammals of Puerto Rico). The patterns of distribution of capromyids in the West Indies are plotted in Figures 4 through 6.

ACKNOWLEDGMENTS We thank Guy Musser of the American Museum of Natural History, Richard Thorington of the U.S. National Museum, Farish Jenkins of the Harvard Museum of Natural History, and Luis Chanlatte Baik of the University of Puerto Rico for the loan of specimens. We also thank the late Ada Camacho of the Institute of Ecology and Systematics in Cuba who helped collect and facilitate the analysis of the tissue, and Andras Demeter who worked with us in the field. We thank our colleagues in Cuba who have made it possible for us to analyze the specimens of Capromys, Mysateles, and Mesocapromys. We thank John Eisenberg and Brian McNab of the University of Florida for stimulating discussions on the comparative biology and evolution of capromyids. This study was supported in part by Grants DEB 7811388, DEB 8216825, EAR 8212745, and VT-EPSCoR from NSF and by grants from the University of Vermont, Earthwatch, USAID, and the MacArthur Foundation.

352

Biogeography of the West Indies: Patterns and Perspectives

LITERATURE CITED Abreu, R. M. and V. Berovides. 1997. Hoja de datos del taxon Capromys (Mysateles) melanurus. Report on Conservation Assessment and Management Plan. Workshop for Selected Cuban Species II. CBSG, Apple Valley, Minnesota. Bibb, M. J., R. A. van Etten, C. T. Wright, M. W. Walberg, and D. A. Clayton. 1981. Sequence and gene organization of mouse mitochondrial DNA. Cell 26:167–180. Biknevicius, A. R., D. A. McFarlane, and R. D. E. MacPhee. 1993. Body size in Amblyrhiza inundata (Rodentia: Caviomorpha), an extinct megafaunal rodent from the Anguilla bank, West Indies: estimates and implications. American Museum Novitates 3079:1–25. Blin, N. and D. W. Stafford. 1976. A general method for isolating high molecular weight DNA from eukaryotes. Nucleic Acids Research 3:2303–2308. Borroto, R. and I. Ramos. 1997. Current status of the Carbali hutia (Mysateles meridionalis) from south of Isla de la Juventud. Report on Conservation Assessment and Management Plan. Workshop for Selected Cuban Species II. CBSG, Apple Valley, Minnesota. Borroto, R., A. Camacho, and I. Ramos. 1992. Variation in three populations of Capromys pilorides (Rodentia: Capromyidae), and the description of a new subspecies from the south of the Isle of Youth (Cuba). Miscelanea Zoologica Hungarica 7:87–99. Borroto, R., I. Ramos, C. Mancina, and J. Fernández 1998. Hoja de datos del taxon Mysateles gunlachi. Pp. 71–77 in Perez, E., E. Osa, Y. Matamoros, and U. S. Seal (eds.). Report on Conservation Assessment and Management Plan. Workshop for Selected Cuban Species III. CBSG, Apple Valley, Minnesota. Bremer, K. 1994. Branch support and tree stability. Cladistics 10:295–304. Eriksson, T. 1997. Autodecay. Version 3.03. Botaniska Institutionen, Stockholm University, Stockholm. Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783–791. Flemming, C. and R. D. E. MacPhee. 1999. Redetermination of holotype of Isolobodon portoricensis (Rodentia, Capromyidae), with notes on recent mammalian extinctions in Puerto Rico. American Museum Novitates 3278:1–11. Holcombe, T. L. and N. T. Edgar. 1990. Late Cretaceous and Cenozoic evolution of Caribbean ridges and rises with special reference to paleogeography. Pp. 611–626 in Azzaroli, A. (ed.). Biogeographical Aspects of Insularity. Accademia Nazionale dei Lincei, Rome. Holcombe, T. L. and W. S. Moore. 1977. Paleocurrents in the eastern Caribbean: geologic evidence and implications. Marine Geology 23:35–56. Irwin, D., T. D. Kocher, and A. C. Wilson. 1991. Evolution of the cytochrome b gene of mammals. Journal of Molecular Evolution 32:128–144. Iturralde-Vinent, M. A. and R. D. E. MacPhee. 1999. Paleogeography of the Caribbean region: implications for Cenozoic biogeography. Bulletin of the American Museum of Natural History 238:1–95. Johns, G. C. and J. C. Avise. 1998. A comparative summary of genetic distances in the vertebrates from the mitochondrial cytochrome b gene. Molecular Biology and Evolution 15:1481–1490. Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16:111–120. Lara, M. C., J. L. Patton, and M. N. da Silva. 1996. The simultaneous diversification of South American echimyid rodents (Hystricognathi) based on complete cytochrome b sequences. Molecular Phylogenetics and Evolution 5:403–413. Lessa, E. P. and J. A. Cook. 1998. The molecular phylogenetics of tuco-tucos (genus Ctenomys, Rodentia: Octodontidae) suggests an early burst of speciation. Molecular Phylogenetics and Evolution 9:88–99. Longmire, J. L., R. E. Ambrose, N. C. Brown, T. J. Cade, T. Maechtle, W. S. Seegar, F. P. Ward, and C. M. White. 1991. Use of sex-linked minisatellite fragments to investigate genetic differences and migration of North American populations of the peregrine falcon (Falco peregrinus). Pp. 217–229 in Burke, T., G. Dolf, A. Jeffreys, and R. Wolff. (eds.). DNA Fingerprinting: Approaches and Applications. Birkhauser Press, Basel, Switzerland. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular Cloning. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York. MacPhee, R. D. E. and M. A. Iturralde-Vinent. 1995. Origin of the Greater Antillean land mammal fauna, 1: new Tertiary fossils from Cuba and Puerto Rico. American Museum Novitates 3141:1–31.

Insular Patterns and Radiations of West Indian Rodents

353

Saiki, R. K., D. H. Gelfand, S. Stoeffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239:487–491. Sibley, C. G. and J. E. Ahlquist. 1981. The phylogeny and relationships of the ratite birds as indicated by DNA-DNA hybridization. Pp. 301–335 in Scudder, G. G. E. and J. L. Reveal (eds.). Evolution Today. Carnegie-Mellon University, Pittsburgh, Pennsylvania. Smith, M. F. and J. L. Patton. 1993. The diversification of South American murid rodents: evidence from mitochondrial DNA sequence data for the akodontine tribe. Biological Journal of the Linnean Society 50:149–177. Steadman, D. W., G. K. Pregill, and S. L. Olson. 1984a. Fossil vertebrates from Antigua, Lesser Antilles: evidence for late Holocene human-caused extinctions in the West Indies. Proceedings of the National Academy of Sciences U.S.A. 81:4448–4451. Steadman, D. W., D. R. Watters, E. J. Reitz, and G. K. Pregill. 1984b. Vertebrates from archaeological sites on Montserrat, West Indies. Annals of the Carnegie Museum of Natural History 53:1–29. Sullivan, J., J. A. Markert, and C. W. Kilpatrick. 1997. Phylogeography and molecular systematics of the Peromyscus aztecus species group (Rodentia: Muridae) inferred using parsimony and likelihood. Systematic Biology 46:426–440. Swofford, D. L. 1999. PAUP*. Phylogenetic Analysis Using Parsimony (*and other methods). Version 4.0b4. Sinauer Associates, Sunderland, Massachusetts. Tamura, K. and M. Nei. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10:512–526. Woods, C. A. 1989a. The biogeography of West Indian Rodents. Pp. 741–798 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Woods, C. A. 1989b. A new capromyid rodent from Haiti; the origin, evolution and extinction of West Indian rodents and their bearing on the origin of New World hystricognaths. Los Angeles County Museum, Science Series 33:59–89. Woods, C. A. 1990. The fossil and Recent land mammals of the West Indies: an analysis of the origin, evolution and extinction of an insular fauna. Pp. 641–680 in Azzaroli, A. (ed.). Biogeographical Aspects of Insularity. Accademia Nazionale dei Lincei, Rome. Woods, C. A. 1996. The land mammals of Puerto Rico and the Virgin Islands. Annals of New York Academy of Sciences 776:131–149. Woods, C. A. and J. W. Hermanson. 1985. Myology of hystricognath rodents: an analysis of form, function and phylogeny. Pp. 515–548 in Luckett, W. P. and J. L. Hartenberger (eds.). Evolutionary Relationships among Rodents. Plenum Press, New York. Woods, C. A., J. A. Ottenwalder, and W. Oliver. 1986. Lost mammals of the Greater Antilles; the summarized findings of a ten weeks field survey of the Dominican Republic, Haiti and Puerto Rico. Dodo, Jersey Wildlife Preservation Trust 22:23–42.

of West Indian 19 Biogeography Bats: An Ecological Perspective Armando Rodríguez-Durán and Thomas H. Kunz Abstract — The West Indies forms a zoogeographically distinct region within the Neotropics. Modern bat faunas in these islands are likely the consequence of overwater dispersal rather than random assemblages from tropical mainland source pools. Of the 56 extant species of bats known from the West Indies, 28 (50%) are endemic. The core community is represented by six species (Monophyllus redmani, Brachyphylla cavernarum, Artibeus jamaicensis, Noctilio leporinus, Tadarida brasiliensis, and Molossus molossus). Proximity to mainland sources, presence of caves, diversity of food resources, existence of “gatekeeper” islands, and island area all are important in defining species-packing patterns.

INTRODUCTION A number of excellent reviews have been published on the biogeography of West Indian bats. However, we believe that the body of knowledge massed to date, although incomplete, warrants a reexamination of patterns, which may lead to a better understanding of the forces that have structured these insular communities. As with previous biogeographical accounts, we have made a number of taxonomic and geographical decisions. For decisions concerning named taxa, we follow Baker et al. (1984), but have incorporated some changes introduced by Silva-Taboada (1979), Jones (1989), and Koopman (1989). Disagreements were settled by following Koopman (1993) and Nowak (1994).

BIOGEOGRAPHY OF ANTILLEAN BATS The West Indies forms a zoogeographically distinct region within the Neotropics. Although most islands within the archipelago are small and remote, thus faunistically depauperated, levels of endemism at the specific level (50%) are high (Table 1).

GEOGRAPHY

AND

SPECIES

Pending additional studies, we provisionally follow Genoways et al. (1998) in recognizing a boundary delineating the West Indies faunal subregion as “Koopman’s Line.” This faunal boundary excludes Grenada and the Grenadines, based on significant differences in genetic distances observed between populations of Artibeus jamaicensis in Grenada and other islands to the south (see Phillips et al., 1989; Pumo et al., 1996; Genoways et al., 1998). To the south, this region also excludes the islands of Trinidad, Tobago, Margarita, Aruba, Bonaire, and Curaçao. To the west, it excludes Isla Cozumel, Isla Mujeres, Halfmoon Cay, Roatan, Bonacca, and San Andreas. To the north, Koopman’s Line includes all of the Bahamas (Genoways et al., 1998). Nine of the ten bat species found in the Bahamas are shared with Cuba, and 60% are West Indian endemics. Reports of extant populations of A. jamaicensis and Molossus molossus in south Florida and the Florida Keys suggest recent dispersal events from Cuba and/or Jamaica (reviewed in Genoways et al., 1998). Fossil taxa of the West Indies are mostly from the late Pleistocene or Holocene and therefore are essentially part of the modern fauna (Baker and Genoways, 1978). Because they are not part of extant communities we will consider the fossil record separately 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

355

Emballonuridae Pteropteryx macrotis Noctilionidae Noctilio leporinus Mormoopidae Pteronotus davyi P. parnellii P. quadridens * P. macleayi * Mormoops blainvillii * Phyllostomidae Micronycteris megalotis Macrotus waterhousii Brachyphylla nana * B. cavernarum * Erophylla sezekorni * E. bombifrons * Phyllonycteris poeyi P. obtusa * P. aphylla * Glossophaga soricina G. longirostris Monophyllus redmani * M. plethodon * Phyllops falcatus * P. haitiensis * Ariteus flavescens * Sternoderma rufum * Anoura geoffroyi Carollia perspicillata Sturnira lilium S. thomasi * Chiroderma improvisum *

Taxon

Island

•



•    

•  E •  • • •   •  • • •  • • • • • •

•



•    

•   •  •  • • • •  •  • • • • • • • •

•   • •  •  • • •  • •  • • • • • • •

•   • 



•

• E •  •  • • • • •  E • • •  • • • • •

•   • 



•

• • •  • • • • • • • • • • • • • • • • • •

• • • • •



•

• • •  • • • • • • • •  • • • • • • • • •

• • • • •



•

• • •  • • • • • • • • • • • • • • • • • •

• • • • •

•

• • •  • • • • • • • • • • • • • • • • • •

• • • • •



•

• E •  • • • • • • • •  • • • • • • • • •

• E • • E



•

• • •  • • • • • • • •  • • • • • • •  

• • • • •



•

• • •  • • • • • • • •  • • • • • • •  

• • • • •



•

• • •  • • • • • • • •  • • • • • •  • •

 • • • •

 • • • • • • •  • • • • • • • •  • • • • • •  • •



•



•

• • •  • • • • • • • •  • • • • • •  • •

• • • • •



•

• • • • • • • •  • • • • • • • •  • • • • • • • • •

 • •  • • • • • •  •  • • • • • •  • •



•

•  • • •



•

• • • • • • • • • •  • • • • • • • • • • •

• • • • •



•

 • • • • • • • • •  • • • • • •    • •

 • • • •





G G C C C C C C C C C C C T T T T C G T T T

C C C C C

G

G

SP MZ LP LP MP MP MP MP MP SP SP SP SP SP SP SP MP SP SP SP MP LP

MZ MZ SZ SZ SZ

LZ

SZ

CUB JAM HIS PRB SCX SMB SAB SKB ANB MON GUA DOM MAR SLU SVI BAR GRE GRA Roosting Diet/Size

TABLE 1 Distribution of Bats in the West Indies

356 Biogeography of the West Indies: Patterns and Perspectives

  •

  •

• • •  • • • • • •  •

• •     •  21

E  

   • •  • • •  • •

    •    26

• •   • • •  18

• • • •  • • • •  • •

•  • •

•  • •

•  • •

• • •  • • •  13

• • • •  • • • •  • •

• • •

•  • •

• • • • • • •  4

• • •

• • • • • • • •

• • •

•  • •

• • •  • • •  7

• • • • • • • • • • • •

 • •

•  • •

• • • • • • • • 3

• • • • • • • • • • • •

 • •

•  • •

• • •  • • •  6

• • • • • • • • • • • •

• • •

•  • 

• • •  • • •  7

• • • • • • • • • • • •

 • •

•  • •

• • •  • • •  10

• • • • • • • • • • • •

 • •

•  • 

• • •  • • •  11

• • • • • • • • • • • 

 • •

•  • 

• • •  • • •  12

• • • • • •  • •  • •

 • •

•  • 

• • •  • • •  10

• • • • • • •  • • • •

• • •

•  • 

• • •  • • •  8

• • • • • • • • • • • •

• • •

•  • 

• • •  • • •  12

• • • • • • • • • • • •

• • •

•   

• • • • • • •  7

• • • • • • •  •  • •

• • •

•  • •

• • • • • • •  4

• •

• • • • • • • • •

• • •

•  • •

• • • • • • •  13

• • • • • • • •  • • •

• • •

   •

G G G C G G G G

G T T T T G G G G G C C

C C C

T G G T

SZ SZ MZ SZ LZ LZ LZ SZ

SZ MZ SZ SZ SZ MZ SZ SZ SZ MZ MZ MZ

SZ SZ SZ

SP LP LP MP

Note: The check mark () indicates where the bat has been reported, the asterisk (*) next to a name indicates that the species is endemic to the West Indies, and E indicates where the species has been extirpated. Roosting behavior is designated as cave-dwelling (C), tree-dwelling (T), or generalist (G). Diet/size guild is denoted by a combination of the letters L, M, and S, referring to large, medium, or small species; and P or Z indicating phytophagous or zoophagous species. Islands: CUB = Cuba; JAM = Jamaica; HIS = Hispaniola; PRB = Puerto Rico Bank; SCX = St. Croix; SMB = St. Martin Bank; SAB = Saba; SKB = St. Kitts Bank; ANB = Antigua Bank; MON = Montserrat; GUA = Guadeloupe; DOM = Dominica; MAR = Martinique; SLU = St. Lucia; SVI = St. Vincent; BAR = Barbados; GRE = Grenadines; GRA = Grenada.

Artibeus cinereus A. jamaicensis A. lituratus Ardops nichollsi * Natalidae Natalus stramineus N. micropus * N. lepidus * Vespertilionidae Nycticeius humeralis Lasiurus intermedius L. pfeifferi * L. degelidus * L. minor * Antrozous pallidus Myotis dominicensis * M. martiniquensis * M. nigrican Eptesicus fuscus E. lynii * E. guadeloupensis * Molossidae Mormopterus minutus * Nyctinomops laticaudata N. macrotis Tadarida brasiliensis Eumops auripendulus E. glaucinus E. perotis Molossus molossus Total

Biogeography of West Indian Bats: An Ecological Perspective 357

358

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 Species Extirpated from the West Indies and Islands from Which Fossils Have Been Reported Species

Location

Pteronotus pristinus Mormoops megalophylla M. magna Toniata bidens Phyllonycteris major Artibeus anthonyi Phyllops vetus Desmodus rotundus

Cuba Cuba, Bahamas, Hispaniola Cuba Jamaica Puerto Rico, Antigua Cuba Cuba Cuba

(Table 2). Recent fossil assemblages reported from south Florida and the Florida Keys include other taxa with West Indian affinities, including Eumops glaucinus, Mormoops megalophylla, and Pteronotus sp. (Genoways et al., 1998). Taxonomic questions and presence/absence data raise another set of problems. Conclusions could be biased by choosing incorrect taxonomies, or because of incomplete data sets. For example, as recently as 1996, P. parnelli, Micronycteris megalotis, and Tadarida brasiliensis were recorded for the first time in St. Vincent (Vaughan and Hill, 1996), thus increasing the list of bats for this 345 km2 island from 9 to 12 species. Sturnira thomasi was recently recorded for the first time in Montserrat (Pedersen et al., 1996; Genoways et al., 1998). Taxonomic questions, although important, present lesser problems for our analysis. Varona’s (1974) conservative classification of the genera Ariteus, Stenoderma, Phyllops, and Ardops into a single genus Stenoderma (which we are not adopting) would raise the species–genus ratio, but would have little practical effect on the way a community is visualized without negating the fact that a community with ten species in ten genera is more diverse than one with ten species in one genus. On the other hand, Koopman’s (1989) argument for the inclusion of all Greater Antillean Eptesicus into E. serotinus (not followed here) does have the effect of reducing the number of species, especially the endemic species. However, for all practical purposes the relevance of this decision is irrelevant to our discussion, since these almost indistinguishable sibling species on different islands would be considered ecologically equivalent.

ROUTES

OF INVASION

Dispersal over water rather than vicariance events is likely to be the primary source of modern, West Indian bat faunas (Baker and Genoways, 1978; Jones, 1989; Koopman, 1989; Genoways et al., 1998). Although a limited vicariance model best explains the distribution of early Antillean colonizers (Griffiths and Klingener, 1988), three routes of overwater dispersal can be identified. The Western Route The western route from the Honduran bank to Jamaica and from Yucatan to Cuba is the main source of West Indian immigrants, with these two islands as major centers of endemism (SilvaTaboada, 1979). The Northern Route A northern route from Florida to Cuba directly, or through the Bahamas, has been postulated for species such as Eptesicus fuscus, Tadarida brasiliensis, and Lasiurus borealis. However, these

Biogeography of West Indian Bats: An Ecological Perspective

359

species could have invaded from the west as well. One reason for the relative unimportance of Florida as a source habitat is its depauperate bat fauna. Florida has 15 species of bats (Whitaker, 1998) as compared to the Yucatan Peninsula and south-central Mexico to the west with at least 67 (Arita and Ortega, 1998) and Trinidad to the south with more than 64 species (Goodwin and Greenhall, 1961; Carter et al., 1981). The Southern Route The southern route represents the invasion from South America through the Lesser Antilles. Some 14 species, including four endemics are derived from this route, although five reach only as far as Grenada. From a zoogeographical perspective, Grenada can be excluded from the West Indies (Koopman, 1989; Genoways et al., 1998), since it has a completely continental fauna, lacking any West Indian endemics. Artibeus jamaicensis and Molossus molossus are common throughout the Antilles and probably invaded from the south as well as the west (Jones, 1989; Phillips et al., 1989; Genoways et al., 1998). The same may be true for Pteronotus parnelli (Vaughan and Hill, 1996). A probable reason for the relative unimportance of this route is that the small, xeric Grenadines serve as a filter for the large pool of bats in South America (Phillips et al., 1989; Genoways et al., 1998).

PATTERNS IN BAT COMMUNITIES Bat communities have been compared based on different guild structures. For example, Findley (1995) compared Central American bat communities based on eight guilds: forest and clearing aerial insectivores, open-air insectivores, water bats, gleaning insectivores–carnivores–omnivores, nectarivores, ground-story frugivores, canopy frugivores, and sanguivores. Willig and Gannon (1996) compared 14 Neotropical communities based on taxonomy and feeding guilds, namely, nectarivore, frugivore, aerial insectivore, gleaning carnivore, molossid insectivore, sanguinivore, and piscivore. When this scheme is applied, aerial insectivores and frugivores are the dominant classes in the West Indies, as is the case in most of the 14 communities examined by Willig and Gannon (1996). The inclusion of all frugivores into a single guild in the latter scheme seems justified based on the observed overlap between canopy and understory frugivores. However, the same argument also could be made for aerial insectivores. Although the degree of overlap remains to be examined, it is possible to observe Pteronotus quadridens, Eptesicus fuscus, and Molossus molossus foraging sympatrically in large clearings along ravines, or to observe Tadarida brasiliensis foraging in the understory, immediately after nightly emergence (Whitaker and Rodríguez-Durán, 1999). Kalko (1997) and Schnitzler and Kalko (1998) proposed a standardization of guilds based on the dominant sensory and motor adaptations of bats. The resulting scheme consists of ten guilds, based on the recognition of four separate guilds of aerial insectivores. Some of the same difficulties mentioned above remain unsolved under this system, but Kalko (1997) points out that this suite of guilds should not be considered definitive. The assignment of nectarivores to a single feeding guild poses another problem (Willig et al., 1993). Individual Monophyllus redmani have been captured with their stomachs full of nectar (SilvaTaboada, 1979), but upon examination of the feces it is often difficult to distinguish the contents from that of an aerial insectivore (Silva-Taboada, 1979; Rodríguez-Durán and Lewis, 1987). Moreover, large frugivores such as Brachyphylla show large amounts of pollen and insects in their stomachs (Silva-Taboada, 1979), and Artibeus jamaicensis, another large frugivore, has been observed displacing M. redmani from banana (Musa) flowers to drink the dripping nectar (A. Rodríguez-Durán, personal observation). The high level of insect consumption by low-intensity echolocating phyllostomids raises another important question. How do these “whispering” bats capture insects? Although perhaps it is not technically possible for M. redmani to detect and capture flying insects, this bat may be able to employ aerial hawking (R. Houston, personal communication). Another possibility is that this

360

Biogeography of the West Indies: Patterns and Perspectives

bat obtains insects from flowers, or it gleans them from foliage. Monophyllus redmani has been observed hovering in the foliage surrounding flowers (A. Rodríguez-Durán, personal observation). If aerial hawking does indeed occur, another guild would need to be added to those represented in the West Indies. The gleaning carnivore and the sanguinivore guilds have no reported representatives in the West Indies, although Desmodus rotundus is known from the fossil record in Cuba. The absence of sanguinivores is easily understood based on the historical lack of large mammals or birds in sufficient numbers to sustain populations of these bats. On the other hand, anoline lizards (Reagan, 1996) and leptodactylid frogs (Stewart and Woolbright, 1996), which could serve as a resource for gleaning carnivores, are very abundant. Densities of small frogs of the genus Eleutherodactylus in Puerto Rico and Jamaica are the highest recorded for frogs anywhere in the world (Stewart and Woolbright, 1996), and theoretically could support populations of carnivorous bats.

BODY SIZE

AND

DIET

Albeit with some overlap, body size and diet are categories used to separate most faunas into clearly distinguishable classes (e.g., Case et al., 1983; Fleming, 1991). In comparing the bat faunas among different islands within the West Indies, we have classified each species of bat as small (forearm [FA] < 45 mm), medium (45 mm > FA < 50 mm) or large (FA > 50 mm), zoophagous or phytophagous bats (Table 3). As with guild classes discussed above, there are some blurry boundaries to this scheme. Some bats are omnivores, or the range of forearm length of a species may cross boundaries, especially in species with wide distributions. In any event, a species will always lean more heavily toward one category. Similar problems were confronted in the examination of other Neotropical bat faunas (Willig et al., 1993). Despite its limitations (Willig, 1986), comparison of bat faunas on the basis of feeding guilds provide valuable insights into the speciespacking patterns of different communities. Graphical representation of the faunas of the Greater Antilles and of the Lesser Antilles, with species richness similar to that of Puerto Rico (Figure 1), reveals a packing pattern consisting of a central cluster of similar values and lesser numbers of off-centered ones. This familiar packing pattern often rises from products of random variables (May, 1981), and has been documented for organisms as disparate as birds and diatoms (May, 1981) and for equivalent guilds from distant localities (Pianka, 1988). As with most bat faunas compared to date (Findley, 1995), the dominant taxa on most islands are small and zoophagous, although small phytophagous species are common in St. Vincent and especially in Grenada. The two latter islands are the southernmost of the West Indies, and are closer to South America than are the rest of the Lesser Antilles. Grenada hosts no endemic Antillean species, a fact that compelled Koopman (1989) to omit this island from his analysis of the West Indies. This same argument led Genoways et al. (1998) to exclude Grenada and the Grenadines from the West Indian faunal region, a decision that was strengthened by significant genetic distances observed between populations of Artibeus jamaicensis on Grenada and islands to the north. The faunal differences among islands (Figure 1) are not statistically significant (G-Test of Independence; p > 0.05), although total G is suspiciously higher when St. Vincent and Grenada are considered.

ROOSTS Roosts may limit the geographical occurrence of bats (Kunz, 1982; Arita, 1993). When Antillean bats are examined with respect to roosting preferences, few major differences stand out among islands (Table 4), and again the largest deviation occurs in Grenada with its continental fauna (Genoways et al., 1998). Although two islands host less than 30% of cave-dwelling bats, cavedwellers comprise over 40% of the fauna on most islands. Interestingly, Peropteryx macrotus is the only cave-dwelling member of the family Emballonuridae known to have reached the Antilles

2 2 2 11 6 3

Large phytophagous Medium phytophagous Small phytophagous Small zoophagous Medium zoophagous Large zoophagous

1 2 3 8 4 3

JAM

2 2 2 7 4 1

HIS 2 2 1 5 2 1

PRB 2 0 0 1 0 1

SCX 2 0 1 3 0 1

SMB 2 0 0 1 0 0

SAB 2 1 0 2 0 1

SKB 2 0 1 3 0 1

ANB 3 2 1 3 0 1

MON

Island

3 2 1 3 1 1

GUA 2 1 2 4 2 1

DOM 2 1 2 3 1 1

MAR

2 1 2 2 0 1

SLU

3 1 4 2 1 1

SVI

2 0 1 2 1 1

BAR

1 0 1 1 0 1

GRE

2 0 6 3 1 1

GRA

Note: See Table 1 and text for details. Islands: CUB = Cuba; JAM = Jamaica; HIS = Hispaniola; PRB = Puerto Rico Bank; SCX = St. Croix; SMB = St. Martin Bank; SAB = Saba; SKB = St. Kitts Bank; ANB = Antigua Bank; MON = Montserrat; GUA = Guadeloupe; DOM = Dominica; MAR = Martinique; SLU = St. Lucia; SVI = St. Vincent; BAR = Barbados; GRE = Grenadines; GRA = Grenada.

CUB

Size/Diet Category

TABLE 3 Size/Diet Guilds for the West Indies

Biogeography of West Indian Bats: An Ecological Perspective 361

362

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 1 Number of species of bats in Cuba, Jamaica, Hispaniola, Puerto Rican bank, Guadeloupe, Dominica, St. Vincent, and Grenada categorized as large phytophagous (LP); medium phytophagous (MP); small phytophagous (SP); small zoophagous (SZ); medium zoophagous (MZ); and large zoophagous (LZ). See text for details.

(Baker and Genoways, 1978), and it is considered a relatively recent invader either from Trinidad or the South American mainland (Genoways et al., 1998). In a region where over 100 hurricanes have affected some islands since 1508 (Colón, 1977), cave-roosting habits should be an asset. Marked reductions in bat populations have been reported following severe cyclones (Rainey, 1998). Hurricane Hugo in 1989 caused marked declines in populations of Artibeus jamaicensis, Stenoderma rufum, and Monophyllus redmani in Puerto Rico (Gannon and Willig, 1994). The cave-dwelling A. jamaicensis and M. redmani returned to predisturbance levels within 2 years, although tree-roosting S. rufum declined to about 30% of prehurricane levels, and had not recovered after 3 years (Gannon and Willig, 1994). In Montserrat, Pedersen et al. (1996) reported a 20-fold decrease in bat populations compared to levels observed before Hurricane Hugo. Caves provide critical habitat for bats during a hurricane, but the widespread devastation caused by this natural phenomenon still may take its toll on bats, especially on phytophagous species. Waide (1992a, 1992b) found that frugivorous and nectarivorous birds faced food shortages after Hurricane Hugo, but omnivorous and insectivorous species were not affected, or exhibited relative increases in abundance. Similar results were obtained for the bat fauna of Montserrat (Pedersen et al., 1996). Gannon and Willig (1994) found that the home range size of frugivorous bats increased fivefold following Hurricane Hugo. After Hurricane Georges in 1998, higher than usual mortality was observed in caves that hosted large populations of bats in Puerto Rico, and aggressive interactions increased at flowering banana (Musa) plants with flowers (A. Rodríguez-Durán, personal observation). Larger islands may also offer buffer zones that are not seriously affected by hurricanes and later can serve as habitats for areas that have been devastated.

ACTIVITY Time is a resource that may be partitioned by bats (Kunz, 1973; Swift and Racey, 1983). In the West Indies, large assemblages of bats in caves have been documented for Jamaica (Goodwin, 1970), Cuba (Silva-Taboada, 1977, 1979), and Puerto Rico (Rodríguez-Durán, 1998). Nonrandom patterns of association among these cave-dwelling bats may be promoted by differences in patterns of activity of coexisting species (Silva-Taboada, 1979; Rodríguez-Durán and Lewis, 1987; Rodríguez-Durán, 1998). These differences in times of nightly emergence may also influence rates

b

12 2 7 21

JAM

10 2 6 18

HIS 7 2 4 13

PRB 1 0 3 4

SCX 4 0 3 7

SMB 2 0 1 3

SAB 2 1 3 6

SKB 4 0 3 7

ANB

Tree-dwellers include bats that roost in both foliage and tree-holes. Generalists are bats that use more than one kind of roost, most often anthropogenic structures.

11 3 12 26

Cave-dwellers Tree-dwellers Generalists Total

a

CUB

Roosting Behavior

TABLE 4 Roosting Behavior of the Bats of the West Indies

4 3 3 10

MON

Island

5 3 3 11

GUA 5 2 5 12

DOM

4 2 4 10

MAR

3 2 3 8

SLU

5 2 5 12

SVI

2 0 5 7

BAR

1 0 3 4

GRE

3 2 8 13

GRA

Biogeography of West Indian Bats: An Ecological Perspective 363

364

Biogeography of the West Indies: Patterns and Perspectives

TABLE 5 Characterization of Bats from Cuba and Puerto Rico Based on Time of Departure from Roosts Species Mormopterus minutus Noctilio lepidus Pteronotus quadridens Molossus molossus Eptesicus fuscus Tadarida brasiliensis Eumops glaucinus Pteronotus macleayi P. parnellii Noctilio leporinus Artibeus jamaicensis Mormoops blainvillii Macrotus waterhousi Monophyllus redmani Phyllonycteris poeyi Brachyphylla nana Erophylla bombifrons

Category

Diet

Vespertine Vespertine Vespertine Vespertine Vespertine Vespertine Crepuscular Crepuscular Crepuscular Crepuscular Crepuscular Nocturnal Nocturnal Nocturnal Nocturnal Nocturnal Nocturnal

Insects Insects Insects Insects Insects Insects Insects Insects Insects Fish/insects Fish/leaves Insects Insects Nectar/fruits/insects Nectar/pollen Nectar/pollen Fruit/nectar

Note: See text for details.

of predation on bats (Silva-Taboada, 1979; Rodríguez-Durán and Lewis, 1985; Rodríguez-Durán and Kunz, 1992; Rodríguez-Durán, 1996). When compared to the mainland Neotropics, nocturnal predators are few in the West Indies, and this may be one reason lunar phobia has not been observed in populations of S. rufum (Gannon and Willig, 1997). Silva-Taboada (1979) arranged 16 species of Cuban bats based on their times of departure and return to roosts (Table 5). Bats were classified as vespertine when departing near sunset (light intensity at 500 to 900 Lux), crepuscular when departing slightly after sunset (38 to 187 Lux), and nocturnal when departing over 30 min after sunset (0 Lux). These patterns of activity correspond to those observed for four species of bats in Puerto Rico (Rodríguez-Durán and Lewis, 1987; Rodríguez-Durán, 1996). It is evident from Table 5 that most insectivorous bats are active around dusk, a behavior that corresponds with the peak of insect activity at this time. Two insectivorous species are nocturnal, and examination of their diet reveals a preponderance of moths (SilvaTaboada, 1979; Rodríguez-Durán and Lewis, 1987), which are known to be proportionately more abundant after the peak of insect abundance at dusk (Silva-Taboada, 1979; Rodríguez-Durán, 1984).

COMMUNITY STRUCTURING West Indian bat faunas are not random assemblages from tropical mainland source pools (Fleming, 1982; McFarlane, 1989, 1991; Genoways et al., 1998). The absence from the West Indies of many species potentially capable of crossing wide water gaps suggests that differences in dispersal abilities alone cannot explain the observed distribution and diversity patterns (Fleming, 1982). Based on the relationship between island area and the species–genus ratio, and on the structured pattern of species co-occurrence, interspecific competition may be one factor that produces these faunas (McFarlane, 1989, 1991). Fleming (1982), however, suggested that noncompetitive deterministic factors, such as area, distance from biogeographical source, and habitat diversity, may account for 66% of the faunal similarity between bats and birds in the West Indies. He proposed that major

Biogeography of West Indian Bats: An Ecological Perspective

365

differences in resource availability between mainland and island habitats (e.g., Janzen, 1973) could better account for the absence of certain groups. The fact that Cuba and Jamaica are above their predicted equilibrium number of species, and Hispaniola and Puerto Rico are below, demonstrates, as Griffiths and Klingener (1988) postulated, that the relatively recent decreases in sea level during the Pleistocene may not have allowed enough time for eastward dispersal of some species. In reviewing several studies on the structure of bat communities, Findley (1993) concluded that bats do not provide support for competition as a dominant factor in structuring these communities. He argued that diversity of bat communities could largely be explained by historical and geographical factors, without denying some importance to resources in differentiating bats in ways that allow the allocation of those resources (Findley, 1993). However, community structures indistinguishable from those produced by stochastic processes must be interpreted within the context of the continental systems where they were described, and where local extinctions resulting from competitive interactions might be blurred by immigration from source habitats (Willig and Moulton, 1989). In this context, archipelagos provide better models than continents for examining the relative importance of deterministic (i.e., area, habitat diversity, distance from source habitats, and competition) and stochastic (i.e., dispersal and persistence independent of interaction) factors in structuring bat communities. Among the potential patterns that could be produced by competition, size assortment (i.e., the effect of the presence of one species on the probability of persistence of a morphologically similar species) is easier to detect with limited data than is size adjustment (i.e., shift in morphological characteristics to minimize competition). Inter-island morphological differences are known to occur among West Indian bats (Genoways et al., 1981, 1998; Genoways, 1998). However, the importance of these shifts in morphological characteristics, in the context of community structure, remains to be determined. Morphological shifts also occur with respect to mainland populations, and could be associated with differences in diet (Whitaker and Rodríguez-Durán, 1999). West Indian phyllostomid communities differ somewhat from mainland communities. Core phyllostomid species of island communities, defined on the basis of abundance and broad ecological tolerance, include one small nectarivore (omnivore) and two frugivores (Fleming, 1986). When all bats are considered, a fish-eating species and two small insectivores are added to this core community (Table 1). Thus, although small insectivores are the main component of the West Indian bat faunas (Figure 1), the core community consists of one species of Monophyllus, one species of Brachyphylla, A. jamaicensis, Noctilio leporinus, Tadarida brasiliensis, and Molossus molossus. Insectivorous bats have lower mass-specific metabolic rates than other species (McNab, 1982), a relationship that has been used to explain the higher proportion of nonpasserine land birds on Caribbean islands compared with the tropical mainland (Faaborg, 1977). As island size and habitat complexity increase in the Greater Antilles, three mormoopids, one species of Erophylla, and one species of Macrotus are added to the core community of bats. Cavedwelling, endemic mormoopids, and especially Monophyllus and Erophylla, show marked reductions in mass-specific metabolic rates relative to expected values (Rodríguez-Durán, 1995), and several other species of endemic phyllostomids and natalids seem especially adapted to roosting in warm caves (Silva-Taboada, 1977, 1979; Sampedro-Marín et al., 1977) that could promote reduced metabolic rates (Rodríguez-Durán, 1995). Similarly, some species of flying foxes (Pteropus) on small islands show a general trend toward small body size and low mass-specific metabolic rates (McNab, 1994). The nonrandomness of bat assemblages in caves (Rodríguez-Durán, 1998) and differences in activity (above) and packing patterns in morphospace (Silva-Taboada, 1979; Rodríguez-Durán et al., 1993) suggest that bats have differentiated in ways that contribute to resource partitioning. Based upon the consumption of hard-bodied vs. soft-bodied arthropods and skull robustness, the statistical analysis of insectivorous species in Puerto Rico produced two groups, one containing E. fuscus and Molossus molossus and the other containing all the mormoopids plus T. brasiliensis (RodríguezDurán et al., 1993). Density compensation is another phenomenon commonly exhibited by island populations. A variety of factors can produce densities on islands higher than, comparable to, or lower than

366

Biogeography of the West Indies: Patterns and Perspectives

densities in similar mainland habitats (MacArthur et al., 1972). Bat densities are poorly known in most habitats. However, populations of bats in caves of the more diverse islands of Cuba and Jamaica may have lower densities (Goodwin, 1970; Silva-Taboada, 1979) than similar caves in Puerto Rico (Rodríguez-Durán and Lewis, 1987; Rodríguez-Durán, 1996). However, these differences cannot immediately be ascribed to ecological release due to reduced species diversity, since densities in Puerto Rican caves are similar to those in more speciose regions of Mexico (Bateman and Vaughan, 1974; Aguilar-Morales and Ruiz-Castillo, 1995). In summary, both deterministic and stochastic factors appear to influence the structure of bat communities in the West Indies, supporting the hypothesis that most patterns and processes in ecology and biogeography are influenced by several key, hierarchical variables, rather than by single-factor explanations (Ruggiero et al., 1998). Proximity to mainland sources, presence of caves, diversity of food resources, existence of “gatekeeper” islands, and island area, all play a part in defining packing patterns. However, clear nonrandom patterns of activity, roosting, and distribution in ecomorphological space, as well as shifts in the way some species may fit into insular as compared to mainland communities (Whitaker and Rodríguez-Durán, 1999), point toward resources as an important player in defining these packing patterns. The role of competition remains unclear because of lack of information on geographical variation in body size and population responses to competition.

ACKNOWLEDGMENTS This manuscript benefited greatly from discussions with M. Gannon, H. Genoways, W. Lancaster, N. Vaughan, and M. Willig. We are grateful to H. Genoways and B. McNab for helpful comments and suggestions on an earlier version of this manuscript. We thank I. Rivera for typing the manuscript. Important logistic support was provided by B. Valentín and A. A. Rodríguez. The Inter American University of Puerto Rico provided important release time to A. R.-D. We thank Charles “Woody” Woods for inviting us to contribute this chapter. This chapter is dedicated to the memory of J. Knox Jones, Jr., the academic father and grandfather of T. H. K and A. R.-D., respectively.

LITERATURE CITED Aguilar-Morales, S. and A. Ruiz-Castillo. 1995. Una comunidad de murciélagos en una “Cueva de calor” como factor determinante en el sotenimiento de la diversidad animal cavernicola. Unpublished thesis, Universidad Nacional Autonoma de México, Mexico City. Arita, H. 1993. Conservation biology of the cave bats of Mexico. Journal of Mammalogy 74:693–702. Arita, H. T. and J. Ortega. 1998. The Middle American bat fauna: conservation in the Neotropical Nearctic border. Pp. 295–308 in Kunz, T. H. and P. A. Racey (eds.). Bat Biology and Conservation. Smithsonian Institution Press, Washington, D.C. Baker, R. J. and H. H. Genoways. 1978. Zoogeography of Antillean bats. Academy of Natural Sciences of Philadelphia, Special Publication 13:57–97. Baker, R. J., J. A. Groen, and R. D. Owen. 1984. Field key to Antillean bats. Occasional Papers, The Museum, Texas Tech University 94:1–18. Bateman, G. C. and T. A. Vaughan. 1974. Nightly activities of mormoopid bats. Journal of Mammalogy 55:45–65. Carter, C. H., H. H. Genoways, R. S. Loregnard, and R. J. Baker. 1981. Observations on bats from Trinidad, with a checklist of species occurring on the island. Occasional Papers, The Museum, Texas Tech University 72:1–27. Case, T. J., J. Faaborg, and R. Sidell. 1983. The role of body size in the assembly of West Indian bird communities. Evolution 37:1062–1074. Colón, J. A. 1977. Climatología. Pp. 47–122 in de Galiñanes, M. T. B. (ed.). Geovisión de Puerto Rico. Editorial universitaria, Universidad de Puerto Rico. Faaborg, J. 1977. Metabolic rates, resources, and the occurrence of nonpasserines in terrestrial avian communities. The American Naturalist 111:903–916.

Biogeography of West Indian Bats: An Ecological Perspective

367

Findley, J. S. 1993. Bats: A Community Perspective. Cambridge University Press, Cambridge, U.K. Fleming, T. H. 1982. Parallel trends in the species diversity of West Indian birds and bats. Oecología 53:56–60. Fleming, T. H. 1986. The structure of Neotropical bat communities: a preliminary analysis. Revista Chilena de Historia Natural 59:135–150. Fleming, T. H. 1991. The relationship between body size, diet, and habitat use in frugivorous bats, genus Carollia (Phyllostomidae). Journal of Mammalogy 72:493–501. Gannon, M. R. and M. R. Willig. 1994. The effects of Hurricane Hugo on bats of the Luquillo Experimental Forest of Puerto Rico. Biotropica 26:320–331. Gannon, M. R. and M. R. Willig. 1997. The effect of lunar illumination on movement and activity of the red fig-eating bat (Stenoderma rufum). Biotropica 29:525–529. Genoways, H. H. 1998. Two new subspecies of bats of the genus Sturnira for the Lesser Antilles, West Indies. Occasional Papers, Museum of Texas Tech University 177:1–7. Genoways, H. H., R. C. Dowler, and C. H. Carter. 1981. Intraisland and interisland variation in Antillean population of Molossus molossus (Mammalia: Molossidae). Annals of the Carnegie Museum 50:475–492. Genoways, H. H., C. J. Phillips, and R. J. Baker. 1998. Bats of the Antillean island of Grenada: a new zoogeographic perspective. Occasional Papers, Museum of Texas Tech University 177:1–28. Goodwin, G. G. and A. M. Greenhall. 1961. A review of the bats of Trinidad and Tobago. Bulletin of the Museum of Natural History 122:187–302. Goodwin, R. E. 1970. The ecology of Jamaican bats. Journal of Mammalogy 51:571–579. Griffiths, T. A. and D. Klingener. 1988. On the distribution of Greater Antillean bats. Biotropica 20:240–251. Janzen, D. H. 1973. Sweep samples of tropical foliage insects: effects of seasons, vegetation types, elevation, time of day, and insularity. Ecology 54:687–702. Jones, J. K., Jr. 1989. Distribution and systematics of bats in the Lesser Antilles. Pp. 645–660 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Kalko, E. K. 1997. Diversity in tropical bats. Pp. 13–43 in Ulrich, H. (ed.). Tropical Biodiversity and Systematics. Proceeedings of the International Symposium on Biodiversity and Systematics in Tropical Ecosystems, Bonn, 1994. Zoologisches Forschungsinstitut und Museum Alexander Koening, Bonn, Germany. Koopman, K. F. 1989. A review and analysis of the bats of the West Indies. Pp. 635–644 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Koopman, K. F. 1993. Order Chiroptera. Pp. 137–241 in Wilson, D. E. and D. M. Reeder (eds.). Mammal Species of the World. Smithsonian Institution Press, Washington, D.C. Kunz, T. H. 1973. Resource utilization: temporal and spatial components of bat activity in central Iowa. Journal of Mammalogy 54:14–32. Kunz, T. H. 1982. Roosting ecology of bats. Pp. 1–56 in Kunz, T. H. (ed.). Ecology of Bats. Plenum Press, New York. MacArthur, R. H., J. M. Diamond, and J. R. Karr. 1972. Density compensation in island faunas. Ecology 53:330–342. May, R. M. 1981. Theoretical Ecology. Sinauer Associates, Sunderland, Massachusetts. McFarlane, D. A. 1989. Patterns of species co-occurrence in the Antillean bat fauna. Mammalia 53:59–66. McFarlane, D. A. 1991. The species–genus relationship in Antillean bat communities. Mammalia 55:363–369. McNab, B. K. 1982. Evolutionary alternatives in the physiological ecology of bats. Pp. 151–200 in Kunz, T. H. (ed.). Ecology of Bats. Plenum Press, New York. McNab, B. K. 1994. Resource use and the survival of land and freshwater vertebrates on oceanic islands. American Naturalist 144:643–660. Nowak, R. M. 1994. Walker’s Bats of the World. Johns Hopkins University Press, Baltimore, Maryland. Pedersen, S. C., H. H. Genoways, and P. W. Freeman. 1996. Notes on bats from Montserrat (Lesser Antilles) with comments concerning the effects of Hurricane Hugo. Caribbean Journal of Science 32:206–213. Phillips, C. J., D. E. Pumo, H. H. Genoways, and P. E. Ray. 1989. Caribbean island zoogeography: a new approach using mitochondrial DNA to study Neotropical bats. Pp. 661–684 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Pianka, E. R. 1988. Evolutionary Ecology. Harper & Row, New York. Pumo, D. E., I. Kim, J. Remsen, C. J. Phillips, H. H. Genoways. 1996. Molecular systematics of the fruit bat, Artibeus jamaicensis: origin of an unusual island population. Journal of Mammalogy 77:491–503.

368

Biogeography of the West Indies: Patterns and Perspectives

Rainey, W. E. 1998. Conservation of bats on remote Indo-Pacific islands. Pp. 326–341 in Kunz, T. H. and P. A. Racey (eds.). Bat Biology and Conservation. Smithsonian Institution Press, Washington, D.C. Reagan, D. P. 1996. Anoline lizards. Pp. 321–346 in Reagan, D. P. and R.B. Waide (eds.). The Food Web of a Tropical Rain Forest. The University of Chicago Press, Chicago. Rodríguez-Durán, A. 1984. Community Structure of the Bat Colony at Cueva Cucaracha. M.S. thesis, University of Puerto Rico, Mayaguez. Rodríguez-Durán, A. 1995. Metabolic rates and thermal conductance in four species of Neotropical bats roosting in hot caves. Comparative Biochemistry and Physiology, A 110:347–355. Rodríguez-Durán, A. 1996. Foraging ecology of the Puerto Rican boa (Epicrates inornatus): bat predation, carrion feeding, and piracy. Journal of Herpetology 30:533–536. Rodríguez-Durán, A. 1998. Nonrandom aggregations and distribution of cave-dwelling bats in Puerto Rico. Journal of Mammalogy 79:141–146. Rodríguez-Durán, A. and T. H. Kunz. 1992. Pteronotus quadridens. Mammalian Species 395:1–4. Rodríguez-Durán, A. and A. R. Lewis. 1985. Seasonal predation by Merlins on sooty mustached bats in Western Puerto Rico. Biotropica 17:71–74. Rodríguez-Durán, A. and A. R. Lewis. 1987. Patterns of population size, diet, and activity time for a multispecies assemblage of bats at a cave in Puerto Rico. Caribbean Journal of Science 23:352–360. Rodríguez-Durán, A., A. R. Lewis, and Y. Montes. 1993. Skull morphology and diet of Antillean bat species. Caribbean Journal of Science 29:258–261. Ruggiero, A., J. H. Lawton, and T. M. Blackburn. 1998. The geographic ranges of mammalian species in South America: spatial patterns in environmental resistance and anisotropy. Journal of Biogeography 25:1093–1103. Sampedro-Marín, A., O. Torres-Fundora, and A. Valdés de la Osa. 1977. Observaciones ecológicas y etológicas sobre dos especies de murciélagos dominantes en las “Cuevas Calientes” de Cuba. Poeyana 160:1–18. Schnitzler, H.-U. and E. K. Kalko. 1998. How echolocating bats search and find food. Pp. 183–196 in Kunz, T. H. and P. A. Racey (eds.). Bat Biology and Conservation. Smithsonian Institution Press, Washington, D.C. Silva-Taboada, G. 1977. Algunos aspectos de la selección de habitat en el murciélago Phyllonycteris poeyi Gundlach in Peters 1861 (Mammalia:Chiroptera). Poeyana 168:1–10. Silva-Taboada, G. 1979. Los murciélagos de Cuba. Editorial de la Academia de Ciencias de Cuba, Habana. Stewart, M. M. and L. L. Woolbright. 1996. Amphibians. Pp. 273–320 in Reagan, D. P. and R. B. Waide (eds.). The Food Web of a Tropical Rain Forest. University of Chicago Press, Chicago. Swift, S. M. and P. A. Racey. 1983. Resource partitioning in two species of vespertilionid bats (Chiroptera) occupying the same roost. Journal of Zoology (London) 200:249–259. Varona, L. S. 1974. Catálogo de los mamíferos vivientes y extinguidos de las Antillas. Editorial de la academia de ciencias de Cuba, Habana. Vaughan, N. and J. E. Hill. 1996. Bat (Chiroptera) diversity and abundance in banana plantations and rain forest, and three new records for St. Vincent, Lesser Antilles. Mammalia 60:441–447. Waide, R. B. 1992a. The effect of Hurricane Hugo on bird populations in the Luquillo Experimental Forest, Puerto Rico. Biotropica 23:475–480. Waide, R. B. 1992b. Summary of the response of animal populations to hurricanes in the Caribbean. Biotropica 23:508–512. Whitaker, J. O., Jr. 1998. Mammals of the Eastern United States. Cornell University Press, Ithaca, New York. Whitaker, J. O., Jr. and A. Rodríguez-Durán. 1999. Seasonal variation in the diet of Mexican free-tailed bats, Tadarida brasiliensis antillularum (Miller) from a colony in Puerto Rico. Caribbean Journal of Science 35:23–28. Willig, M. R. 1986. Bat community structure in South America: a tenacious chimera. Revista Chilena de Historia Natural 59:151–168. Willig, M. R. and M. R. Gannon. 1996. Mammals. Pp. 399–432 in Reagan, D. P. and R. B. Waide (eds.). The Food Web of a Tropical Rain Forest. University of Chicago Press, Chicago. Willig, M. R. and M. P. Moulton. 1989. The role of stochastic and deterministic processes in structuring Neotropical bat communities. Journal of Mammalogy 70:323–329. Willig, M. R., G. R. Camilo, and S. J. Noble. 1993. Dietary overlap in frugivorous and insectivorous bats from edaphic cerrado habitats of Brazil. Journal of Mammalogy 74:117–128.

of Extinction 20 Patterns in West Indian Bats Gary S. Morgan Abstract — The Recent and late Quaternary chiropteran fauna of the West Indies is composed of 57 species, including 27 species that are either extinct or have undergone local extinction (i.e., extirpation). Cuba has the largest bat fauna of the West Indian islands — 33 species, including 26 living species, four extinct species (Mormoops magna, Pteronotus pristinus, Phyllops vetus, and Artibeus anthonyi), and three extirpated species, two of which, M. megalophylla and the vampire Desmodus rotundus, are now restricted to the mainland Neotropics. Jamaica has 24 species of bats — 21 extant species and three extirpated species, two of which, M. megalophylla and Tonatia sauophila, are no longer found in the West Indies. Hispaniola has 21 species of bats — 18 living species and three species extinct on the island, including a large extinct Pteronotus and two locally extinct species, Lasiurus intermedius and M. megalophylla. Puerto Rico has 16 species of bats — 13 living species, one extinct species Phyllonycteris major, and two locally extinct species, the Lesser Antillean Monophyllus plethodon and Macrotus waterhousii. In the Bahamas Archipelago, fossil bat faunas are known from Abaco, Andros, Exuma, New Providence, and Grand Caicos. Abaco on the Little Bahama Bank has 13 species of bats, including eight species known only from fossil deposits and now locally extinct. New Providence on the Great Bahama Bank has 14 species, including 10 species now extinct on the island. In the Cayman Islands, 4 of the 12 species of bats recorded from Grand Cayman are locally extinct, whereas two of the eight bats from Cayman Brac are no longer found on the island. Three islands in the northern Lesser Antilles have fossil bat faunas, including Anguilla, Antigua, and Barbuda. The Lesser Antillean fossil bats include one extinct species, P. major and three locally extinct species, Mormoops blainvillii, Pteronotus parnellii, and Macrotus waterhousii. The three locally extinct species are now restricted to the Great Antillean region, indicating that these three bats had a wider distribution in the West Indies during the late Quaternary. Pteronotus major is otherwise known only from Puerto Rico. The extinctions of Antillean bats are most prevalent among specialized or obligate cave-dwelling species in the families Mormoopidae and Natalidae, and the phyllostomid subfamilies Brachyphyllinae, Phyllonycterinae, and Glossophaginae. Among the 27 species of West Indian bats that underwent late Quaternary extinctions, 17 species (63%) belong to these five groups of cave-dwelling bats that roost in the hot, humid microenvironment deep within large cave systems. Moreover, among the 69 chiropteran extinction events in the West Indies, 52 extinction events (75%) involved obligate cave-dwelling bats. All eight Antillean species in the mormoopid genera Mormoops and Pteronotus suffered extinctions. Mormoops magna, P. pristinus, and a large Pteronotus are extinct; M. megalophylla no longer occurs in the West Indies; and the remaining four species have undergone numerous local extinctions, particularly on small islands. Mormoops blainvillii went extinct on seven islands — Gonâve, and three islands each in the Bahamas and northern Lesser Antilles. Pteronotus parnellii disappeared from six islands — Isla de Pinos, Gonâve, Abaco, and New Providence in the Bahamas, Grand Cayman, and Antigua. Four of the five species of West Indian natalids suffered local extinctions. The most numerous extinctions occurred in Natalus major, which disappeared from seven islands — Cuba, Isla de Pinos, four islands in the Bahamas, and Grand Cayman. Among specialized cave-dwelling phyllostomids — Phyllonycteris major is extinct; P. poeyi is extirpated on two islands in the Bahamas and Cayman Brac; Brachyphylla nana went extinct on Jamaica, two islands in the Bahamas, and Cayman Brac; and Monophyllus redmani disappeared from five islands, including Gonâve, three islands in the Bahamas, and Grand Cayman. The extinctions/extirpations of 17 species of specialized cave-dwelling bats in the West Indies are almost certainly related to changes in the size, distribution, and ecology of caves. The disappearance of large cave systems, through flooding from rising sea levels or erosional collapse, apparently led to widespread extinctions of bats on small islands, such as the Bahamas and Caymans. Changes in cave microclimates related to overall climatic change presumably led to the extinction of certain cavernicolous bats on the large islands of the Greater Antilles. The extinctions of ten other species of bats that are either facultative cave dwellers or roost in trees are more difficult to explain. Among the facultative cave dwellers, two gleaning insectivores, Tonatia saurophila and Macrotus waterhousii, suffered local extinctions in the West Indies. Tonatia saurophila disappeared from Jamaica and now survives only on the Neotropical mainland, whereas M. waterhousii went extinct in Puerto Rico and several islands in the northern Lesser Antilles. The vampire D. rotundus occurs in the West Indies only in fossil deposits on Cuba, and its disappearance from that island probably resulted from the extinction of its primary “prey,” small ground

0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

369

370

Biogeography of the West Indies: Patterns and Perspectives

sloths of the family Megalonychidae. The biogeographical distribution of West Indian bats has been strongly influenced by extinctions. The two most significant patterns are the widespread extinctions of cave-dwelling species on small islands, particularly in the Bahamas, Caymans, and northern Lesser Antilles, and the blurring of the boundary between the Great Antillean and Lesser Antillean faunal regions resulting from the late Quaternary extinction of at least four Greater Antillean species in the northern Lesser Antilles.

INTRODUCTION The West Indies supported an impressive diversity of land mammals during the late Quaternary, especially considering that they are oceanic islands (Varona, 1974; Morgan and Woods, 1986). Prior to the arrival of humans in the early Holocene, about 7000 years ago, 76 species of terrestrial or nonvolant mammals (i.e., nonbats) inhabited the West Indies. Of the 76 recognized species of terrestrial mammals recorded from the West Indies, 67 species (88%) have gone extinct since the late Pleistocene (Morgan and Woods, 1986), whereas only 6 of the 57 species of bats (11%) disappeared during this same time interval. An additional 21 species of bats (37%) suffered localized extinction or extirpation on one or more islands, including 4 mainland species no longer found in the West Indies and 17 species that went extinct on certain islands but still survive elsewhere in the West Indies. Most previous studies on mammalian extinctions in the West Indies have concentrated on the terrestrial component of the fauna, including ground sloths, insectivores, primates, and rodents, while the bats have been discussed only briefly. There are numerous papers on terrestrial mammals from each of the four Greater Antilles, but only a few papers that review fossil chiropteran faunas from these same islands. Fortunately, there are several significant papers on fossil bats from three of the Greater Antilles: Cuba (Koopman and Ruibal, 1955; Silva, 1974, 1979), Jamaica (Koopman and Williams, 1951; Williams, 1952; Morgan, 1993), and Puerto Rico (Anthony, 1917b, 1925; Reynolds et al., 1953; Choate and Birney, 1968). For the fourth island, Hispaniola, there are several small published fossil bat faunas (Miller, 1929a, 1929b, 1930) and a major unpublished fossil chiropteran fauna that is briefly reviewed here. Fossil bats are also known from Isla de Pinos (Silva, 1979) and Ile de la Gonâve (Koopman, 1955), islands located off the coasts of Cuba and Hispaniola, respectively. The record for the remainder of the West Indies is spotty. Fossil bats are known from six islands in the Bahamas archipelago, including Abaco, Andros, Cat, Exuma, New Providence, and Grand Caicos (Morgan, 1989; this chapter); Grand Cayman and Cayman Brac in the Cayman Islands (Morgan, 1994a); and Anguilla, Antigua, Barbuda, and St. Martin in the Lesser Antilles (Pregill et al., 1988, 1994). This chapter summarizes the fossil chiropteran faunas from all islands in the West Indies (see Table 1) and offers several hypotheses to explain the observed patterns of extinction.

METHODS AND MATERIALS The West Indies as recognized in this chapter deviates somewhat from the traditional geographical definition because of zoogeographical considerations. Specifically, the West Indies is composed of the four Greater Antillean islands of Cuba, Jamaica, Hispaniola, and Puerto Rico, and their numerous satellite islands (e.g., Isla de Pinos, Gonâve), the Virgin Islands, the Bahamas, Turks and Caicos Islands, Cayman Islands, Swan Islands, Providencia, and all islands of the Lesser Antilles south to St. Vincent and Barbados. Grenada and the Grenadines, the southernmost islands in the Lesser Antilles, are excluded from the West Indies because these islands possess no endemic species of Antillean bats. Trinidad, Tobago, Margarita, and the Netherlands Antilles (Aruba, Bonaire, and Curaçao) are also excluded from this biogeographical concept of the West Indies, as these islands possess an exclusively South American bat fauna. Tobago has an extensive fossil bat fauna that is discussed below because it exhibits many of the same extinction patterns seen on islands in the West Indies (Eshelman and Morgan, 1985). Figure 1 shows a map of the islands mentioned in the text.

Patterns of Extinction in West Indian Bats

371

TABLE 1 Distribution of Recent and Fossil Bats in the West Indies Island Species Family Noctilionidae Noctilio leporinus Family Mormoopidae Mormoops blainvillii M. magna† M. megalophylla # Pteronotus macleayii P. parnellii P. pristinus†a P. quadridens Pteronotus sp.†b Family Phyllostomidae Subfamily Phyllostominae Macrotus waterhousii Tonatia saurophila# Subfamily Brachyphyllinae Brachyphylla cavernarum B. nana Subfamily Phyllonycterinae Erophylla bombifrons E. sezekorni Phyllonycteris aphylla P. major† P. poeyi Subfamily Glossophaginae Glossophaga soricina Monophyllus plethodon M. redmani Subfamily Stenodermatinae Ariteus flavescens Artibeus anthonyi† A. jamaicensis Phyllops falcatus P. vetus† Stenoderma rufum Subfamily Desmodontinae Desmodus rotundus # Family Natalidae Natalus major N. micropus N. stramineus N. tumidifrons Nyctiellus lepidus Family Vespertilionidae Antrozous pallidus Eptesicus fuscus Lasiurus borealis L. intermedius Myotis cf. M. austroriparius+

CUB PIN JAM HIS GON PUR ABA AND EXU NEP GCA CAY CAB ANG ANT BAR

XF

XF

X

X

—

XF

—

—

—

—

—

—

—

—

—

XF

XF F F XF XF F XF —

— — — X F* — — —

XF XF — — F F X — XF XF — — X XF — F

F* — — — F* — — —

XF — — — XF — X —

F* — F — F* — F* —

— — F — — — F* —

F* — — — — — — —

F* — — F* F* — F* —

— — — — — — — —

— — — — F* — — —

— — — — — — — —

F* — — — — — — —

F* — — — F* — — —

F* — — — — — — —

XF —

XF —

XF XF F —

F* —

F* —

XF —

XF —

XF —

XF —

F* —

XF —

XF —

F* —

— —

F* —

— XF

— XF

— F*

— XF

— —

XF —

— —

— F*

— —

— F*

— XF

— XF

— F*

X —

XF —

X —

— XF — — XF

— XF — — XF

— XF XF — XF — — — — XF

— — — — —

X — — F —

— XF — — F*

— XF — — —

— XF — — —

— XF — — F*

— X — — —

— XF — — —

— XF — — F*

— — — — —

— — — F —

— — — — —

— — XF

— XFc — — — — XF XF XF

— — F*

— F* XF

— — F*

— — F*

— — —

— — F*

— — XF

— — F*

— — —

— X —

— XFd —

— X —

— F XF XF F —

— XF — — XF XFc F* — F — — —

— — XF XF — —

— — XF — — —

— — XF — — XF

— — — — — —

— — — — — —

— — — — — —

— — — — — —

— — — — — —

— — X X — —

— — X X — —

— — X — — —

— — X — — —

— — X — — —

F

—

—

—

—

—

—

—

—

—

—

—

—

—

—

—

F* XF — — XF

F* X — — X

XF XF X XF — — — — — —

— — — — —

— — — — —

F* — — X —

F* — — XF F*

— — — F* XF

F* — — F* —

F* — — — —

F* F* — — —

— — — — —

— — X — —

— — XF — —

— — — — —

XF XF XF XF —

— XF — XF —

— — XF XF X XF — F* — —

— — — — —

— XF X — —

— XF — — F

— XF X — —

— XF — — —

— XF — — —

— — —f — —

— — XF XF*e — — — — — —

— — — — —

— — — — —

— — — — —

372

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 (continued) Distribution of Recent and Fossil Bats in the West Indies Island Species Nycticeius humeralis Family Molossidae Eumops auripendulus E. glaucinus E. perotis Molossus molossus Mormopterus minutus Nyctinomops laticaudatus N. macrotis Tadarida brasiliensis

CUB PIN JAM HIS GON PUR ABA AND EXU NEP GCA CAY CAB ANG ANT BAR X

—

—

— X X X X X XF XF

— X — X — — X XF c — — — — — X X XFc

—

—

—

—

—

—

—

—

—

—

—

—

—

— — — X — — XF XF

— — — X — — — —

— — — X — — — XF

— — — — — — — XF

— — — — — — — —

— — — — — — — X

— — — — — — — F*

— — — — — — — F*

— — — X — — — XF

— — — X — — — —

— — — X — — — —

— — — XF — — — XF

— — — X — — — X

Note: This table is not intended to be a complete listing of the Recent chiropteran fauna of the West Indies as it includes only those islands from which fossil chiropteran faunas of two or more species are known. Most islands in the Lesser Antilles are not included in this table because they lack fossil bats. The families and subfamilies are listed in order following Koopman (1993). The genera and species within each family or subfamily are in alphabetical order. Abbreviations and symbols used in this table are as follows: X = species present in Recent fauna of the island indicated; F = species occurs as a fossil on the island indicated; — = species absent from both Recent and fossil faunas of the island indicated; † = extinct species; # = species extirpated in the West Indies, but still extant in the mainland Neotropical region; + = species extirpated in the West Indies, but still extant in the mainland Nearctic region; * = species extirpated on this island, but still extant elsewhere in the West Indies. Islands: CUB = Cuba; PIN = Pinos; JAM = Jamaica; HIS = Hispaniola; GON = Gonâve; PUR = Puerto Rico; ABA = Abaco; AND = Andros; EXU = Exuma; NEP = New Providence; GCA = Grand Caicos; CAY = Grand Cayman; CAB = Cayman Brac; ANG = Anguilla; ANT = Antigua; BAR = Barbuda. a Pteronotus pristinus also has been tentatively identified from a late Pleistocene fossil deposit in southernmost Florida (Morgan, 1991). b A large species of Pteronotus is represented by a mandible from Cerro de San Francisco in the Dominican Republic. This mandible is considerably larger than mandibles of P. parnellii that occur in the same fossil deposit. This specimen is considered an undescribed species, although it may possibly belong to one of the mainland subspecies referred to P. parnellii. c Four species from Jamaica, Artibeus jamaicensis, Glossophaga soricina, Tadarida brasiliensis, and Molossus molossus, were listed by Koopman and Williams (1952) as occurring in their surface and subsurface layers in cave deposits, but it is unclear if these species actually were derived from fossil deposits or Recent owl pellet deposits. All four species are still extant in Jamaica. d Monophyllus plethodon is only tentatively identified from fossil deposits on Antigua, although it is known as a living species on the island. Pregill et al. (1988) identified specimens from Burma Quarry as Monophyllus/Glossophaga. e Although Eptesicus fuscus is known as both a fossil and Recent species from Cayman Brac, an extirpated population is noted ( *) because the fossils represent the very small undescribed subspecies of E. fuscus currently known only from Grand Cayman, whereas the living population on Cayman Brac belongs to the larger Cuban subspecies, E. fuscus dutertreus (Morgan, 1994a, 1994b). f According to Koopman et al. (1957) and Buden (1985), this record of Lasiurus borealis is based on a specimen that gives “Caicos Islands” as a locality, but does not specify which island. Although this specimen could very well have come from Grand Caicos, it is not recorded as present on the island pending the discovery of a specimen with proper locality data.

The faunal subdivisions of the West Indies and the names of certain islands or islands groups are clarified here to eliminate any confusion regarding their usage. The terms Antillean, Caribbean, and West Indian, used in a faunal sense, are intended to be synonyms, and thus encompass all islands defined above as part of the West Indies, including the Bahamas, which possess a West Indian fauna but are not located in the Caribbean Sea. The two major biogeographical subdivisions of the West Indies, the Greater Antillean region and the Lesser Antillean region, share only a few species of bats. The Lesser Antillean region extends from the islands of Anguilla and Saba in the north to St. Vincent and Barbados in the south. Fossil bats have been reported from only four islands

Patterns of Extinction in West Indian Bats

373

FIGURE 1 Map of the West Indies identifying all islands mentioned in text.

in the Lesser Antilles, all located at the northern end of the island chain, including Anguilla and St. Martin on the St. Martin Bank and Antigua and Barbuda on the Antigua Bank. The boundary between the Greater Antilles and Lesser Antilles is the Anegada Passage, a deep water barrier about 100 km wide that separates the St. Martin Bank on the Lesser Antillean side of the passage from the Puerto Rican Bank on the Greater Antillean side. The Greater Antillean region includes Cuba, Jamaica, Hispaniola (including Haiti which occupies the western third of the island and the Dominican Republic the eastern two thirds) and Puerto Rico, and their major satellite islands, as well as the Bahamas and Cayman Islands. The term Bahamas in this chapter refers to all islands of the Bahamas archipelago, and thus includes the politically separate Turks and Caicos Islands located at the southeastern end of the archipelago (Morgan, 1989). The major satellite islands are located on the “continental shelf” of the four Greater Antilles and are separated from the large islands by water depths less than 100 m. These satellites would have been connected to their respective Greater Antillean island during low sea level stands, in particular during the maximum extent of the last or Wisconsinan glaciation (Bloom, 1983). They are land bridge islands, in a sense, and have a similar relationship to their respective Greater Antillean island as do the true continental or land bridge islands, such as Trinidad and Tobago, to the mainland to which they were connected during the late Pleistocene. The primary satellite island of Cuba, and the only one known to have fossil bats, is the Isla de Pinos (called the Isle of Pines in the older literature and more recently Isla de la Juventud) located off the southwestern coast of Cuba. Jamaica has no significant satellite islands. Hispaniola has two major satellites, Ile de la Gonâve off the western coast of Haiti and Ile de la Tortue off the northern coast of Haiti. Fossil bats are known from Gonâve, but not Tortue. Puerto Rico has the largest number of satellites, including Vieques, Culebra, the American Virgin Islands of St. John and St. Thomas, and the British

374

Biogeography of the West Indies: Patterns and Perspectives

Virgin Islands of Anegada, Tortola, and Virgin Gorda. All of these islands are located on the Puerto Rican bank, which extends more than 150 km east from the main island, and would have been connected to Puerto Rico during the late Pleistocene. None of Puerto Rico’s satellite islands are known to have fossil deposits, nor does St. Croix, which is situated south of the Puerto Rican bank. The conclusions presented in this study rely heavily on the quality of both the Recent and paleontological surveys of bats on various West Indian islands. Among the Greater Antilles, only the Recent chiropteran fauna of Cuba has been studied in a monographic fashion (Silva, 1979). However, considerable fieldwork on bats has been conducted on all four of these islands, including extensive mist-netting over the past three decades, and thus it is unlikely that more than a few species will be added to their faunas. The Lesser Antilles have been fairly thoroughly collected, but only the northernmost of these islands are critical to the current study, as this is the only part of the Lesser Antilles from which fossil bat faunas are known. Beginning in the 1960s and continuing through the 1980s, there was a flurry of field activity in the West Indies concentrating on the distribution and taxonomy of bats. Most of the distributional data from these several decades of active field study are summarized in two major papers on the biogeography of the West Indian chiropteran fauna by Baker and Genoways (1978) and Koopman (1989). These two papers include not only tables listing all species of Recent bats from the West Indies and the islands on which they are known to occur, but also extinct species and extirpated populations of bats, although their data on fossil bats are incomplete. The distributional data used herein for the Recent species of West Indian bats follow Baker and Genoways (1978) and Koopman (1989), with the exception of more recently published studies that provide new information on the distribution of certain species. My only major departure from the papers by Baker and Genoways (1978) and Koopman (1989) relates to several satellite islands and small island groups, in particular Isla de Pinos, Gonâve, the Bahamas, and Cayman Islands. Baker and Genoways (1978) and Koopman (1989) did not list the bats of Isla de Pinos and Gonâve. However, documenting the Recent bat faunas of Isla de Pinos and Gonâve, which are essentially less diverse subsets of the bats found on Cuba and Hispaniola, respectively (Table 1), is important to the current study because both islands have important fossil chiropteran faunas. Baker and Genoways did not include the Cayman Islands in their list and both they and Koopman combined all Bahamian bats into a single fauna. Although Koopman did include the Caymans, he combined the faunas from the three islands. Since six islands in the Bahamas (Morgan, 1989) and two of the Cayman Islands (Morgan, 1994a) are known to have fossil bats, it is important to document the Recent bat faunas of the individual islands in each of those island groups. Current published lists of Recent bats are available for the Bahamas (Buden, 1986; Morgan, 1989) and Cayman Islands (Morgan, 1994b). Species continue to be added to the faunas of individual islands in the Bahamas (this chapter adds two bats to the Recent fauna of Abaco). The late Quaternary chiropteran fauna of the Bahamas should also increase significantly, as fewer than half of the major islands is this group have been surveyed for fossil cave deposits. Certainly, more fossil chiropteran faunas will be discovered in the West Indies and unpublished bat fossils already housed in museums will be studied. However, considering the large body of data currently available (see Table 1), it is unlikely that the major conclusions reached in the current study will be altered significantly by new discoveries. There are very few dates on fossil deposits from West Indian caves. Any published radiocarbon dates or other absolute dates associated with fossil bat faunas are cited. The age of most of these cave deposits is presumed to be late Quaternary, here defined as including both the late Pleistocene and the early Holocene (between about 5,000 and 20,000 years ago). Most of these faunas appear to pre-date the arrival of Amerindians into the West Indies about 7,000 years ago (Rouse, 1989). Although seldom associated with cultural remains, bats are known from archaeological sites on Grand Caicos (Morgan, 1989) and Montserrat (Steadman et al., 1984). There are several differences between this chapter and papers of previous authors who have concentrated primarily on the biogeography of the Recent West Indian chiropteran fauna. Only those Antillean islands from which fossil bats are known will be discussed in any detail, effectively

Patterns of Extinction in West Indian Bats

375

excluding most of the Lesser Antilles. The primary biogeographical focus will be on extinction and how late Pleistocene and Holocene extinctions affected the current distribution of West Indian bats. The geographical origin of the West Indian chiropteran fauna has already been discussed in detail (Baker and Genoways, 1978; Koopman, 1989) and will be touched upon only briefly here, and then principally in the context of extinctions. This chapter is divided into three sections, including a brief review of fossil chiropteran faunas from the individual islands, a taxonomic review of the bat genera and species represented in the Antillean fossil record, and a discussion of the causes of bat extinctions in the West Indies and how those extinctions have affected biogeographical patterns.

WEST INDIAN FOSSIL CHIROPTERAN FAUNAS This section includes a brief review of the fossil sites upon which the distributional data for late Quaternary bats from the West Indies is based. Each of the major islands (e.g., the four Greater Antilles) or island groups (e.g., Bahamas, Cayman Islands, and Lesser Antilles) from which fossil bats are known are discussed under separate headings. No attempt is made to exhaustively review the literature on fossil bats from each of the islands. Several key summary papers are cited, which in turn review the literature for the specific island under discussion. With several exceptions, most of the following data are taken from the published literature. Two extensive and previously unpublished fossil chiropteran faunas housed in the vertebrate paleontology collections of the Florida Museum of Natural History (FLMNH) are discussed, including a cave at Cerro de San Francisco in the Dominican Republic and Hole in the Wall Cave on Abaco in the Bahamas.

CUBA Bats fossils have been known from late Quaternary cave deposits in Cuba since early in the 20th century (e.g., Anthony, 1917a, 1919), but only a few major sites have been published, including two caves in the Sierra de Cubitas in Camaguey Province (Koopman and Ruibal, 1955) and Masones Cave and Jagüey Cave in Trinidad in Las Villas Province (Silva, 1974). All four of these caves are located in central Cuba. Koopman and Ruibal (1955) reported ten species of bats from the two caves in Camaguey, only one of which, Natalus primus (now considered a synonym of N. major) is no longer found in Cuba. Silva (1974) reported 15 species of bats from Masones Cave and Jagüey Cave, including two new extinct species of mormoopids, Mormoops magna and Pteronotus pristinus, and the first West Indian record of M. megalophylla. Other extinct Antillean populations of M. megalophylla have since been identified from Jamaica, Hispaniola, and Abaco and Andros in the Bahamas (Morgan, 1989; this chapter). The fossil deposits in Masones Cave and Jagüey Cave are composed of thousands of fossils, almost all of which are from cave-dwelling bats. The remainder of the vertebrate fauna from these two caves consists of snakes and a capromyid rodent. Apparently, these caves sampled large bat roosts located deep within extensive cave systems. The bat fossils were discovered when the caves were being dynamited during guano exploitation (Silva, 1974). Two other extinct species and one extirpated species of bats are known from cave deposits elsewhere in Cuba. Anthony (1917a) described an extinct species of small stenodermatine, Phyllops vetus, from Daiquirí Cave in Oriente Province, eastern Cuba. This species has since been identified from a cave on the Isla de Pinos (Silva, 1979). Woloszyn and Silva (1977) described an extinct species of large stenodermatine, Artibeus anthonyi, from five cave deposits located throughout Cuba. Pteronotus vetus and A. anthonyi are both fruit bats that probably roosted in trees, and presumably were deposited in caves through the feeding activity of owls. The extant vampire bat Desmodus rotundus does not occur in the Recent fauna of the West Indies, but is known from cave fossil deposits in Las Villas Province, central Cuba (Koopman, 1958) and in La Habana Province, western Cuba, from which the extinct subspecies D. rotundus puntajudensis was described (Woloszyn and Mayo, 1974). The Cuban chiropteran fauna is composed of 33 species, including 26 extant species and 7 species (21%) no longer found on the island (Silva, 1979). Four of these seven species are extinct

376

Biogeography of the West Indies: Patterns and Perspectives

(M. magna, P. pristinus, Phyllops vetus, and A. anthonyi) and three species are extirpated, of which two are now extant only in the mainland Neotropics (M. megalophylla and D. rotundus) and one is still found elsewhere in the Greater Antilles (Natalus major). Isla de Pinos Isla de Pinos is a large island located about 50 km off the southern coast of Pinar del Río, the westernmost province of Cuba. Isla de Pinos is separated from the Cuban mainland by water less than 100 m in depth and would almost certainly have been connected to Cuba during the low sea level stand of the last glacial. Isla de Pinos supports a Recent chiropteran fauna of 14 species, representing a subset of the Cuban fauna (Silva, 1979; see Table 1). There is one major cave fossil deposit known from Isla de Pinos, Cueva del Abuelo, that has produced a fossil chiropteran fauna of 13 species, including four species no longer found on the island, two of which are extinct in Cuba as well (Silva, 1979). Two of the bats from Cueva del Abuelo that are extinct on Isla de Pinos, Pteronotus parnellii and Phyllops falcatus, still live in Cuba. Of the remaining two species, Phyllops vetus is extinct and N. major is extipated from Cuba, but still survives in Jamaica and Hispaniola. A total of 18 species of bats are known from Isla de Pinos, 14 extant species and four species (22%) known only from cave fossil deposits.

JAMAICA Koopman and Williams (1951) described the fossil chiropteran faunas from Jamaica collected by H. E. Anthony in 1919 and 1920. Williams (1952) provided additional information on fossil bats that he, Koopman, and others collected in Jamaica in 1950. Morgan (1993) summarized the Jamaican fossil chiropteran record and added several new records based on the extensive, and mostly unpublished, Jamaican fossil collections in the FLMNH. Koopman and Williams (1951) reported 15 species of bats from two cave deposits in Jamaica, Wallingford Roadside Cave in the western part of the island and Dairy Cave along the northern coast. They divided these 15 species of bats into two groups; the first group of seven species were derived from an older stratigraphic unit they termed the “lizard layers” and the second group of eight species were derived from surface and subsurface layers they termed the “Oryzomys strata” after the now-extinct rice rat that was abundant in that unit. The fossil bats from the “lizard layers” included five species still extant in Jamaica (Mormoops blainvillii, Phyllonycteris aphylla, Ariteus flavescens, Natalus major, and Eptesicus fuscus) and two extirpated species, one that still occurs elsewhere in the Greater Antilles (Brachyphylla nana) and one now found only in the mainland Neotropics (Tonatia saurophila). The eight species from the surface and subsurface layers, which Koopman and Williams (1952) regarded as essentially Recent, consisted entirely of bats that still inhabit Jamaica. Williams (1952) reported on the fossil bats recovered from one new fossil site, Portland Cave on the southern coast of Jamaica, as well as additional material from Dairy Cave. Williams named the “bat layers” for strata rich in fossil bats that were intermediate in stratigraphic position, and presumably age as well, between the older “lizard layers” and the younger “Oryzomys strata.” Of the eight species of bats Williams (1952) identified from his “bat layers” B. nana is the only species no longer found in Jamaica. Morgan (1993) reported M. megalophylla from Swansea Cave in central Jamaica. Mormoops megalophylla is a mainland species in the Recent fauna, but is represented by five locally extinct populations in the Greater Antillean region. The Recent and fossil chiropteran fauna of Jamaica is composed of 24 species, including 21 extant species and three species (12.5%) no longer found on the island (Koopman and Williams, 1951; Williams, 1952; Koopman, 1989; Morgan, 1993). All three of the species that underwent localized extinction on Jamaica still survive elsewhere: M. megalophylla and T. saurophila are extant in the mainland Neotropics and B. nana inhabits Cuba, Hispaniola, Grand Cayman, and the Caicos Islands.

Patterns of Extinction in West Indian Bats

377

HISPANIOLA The fossil chiropteran fauna of Hispaniola is poorly known. Miller (1929a) recorded nine species of bats from cave deposits near St. Michel in northern Haiti, all of which still inhabit Hispaniola. Miller (1929b) reported three species of bats, all Recent Hispaniolan species, from a fossil deposit in San Gabriel Cave on the Samana Peninsula in the eastern Dominican Republic. Miller (1930) identified two bats from a cave deposit on the Massif la Selle in southern Haiti and two species from a fossil site near Constanza in the central Dominican Republic. Large undescribed samples of fossil bats from numerous cave deposits in Haiti and the Dominican Republic are housed in the vertebrate paleontology collections of the FLMNH. The richest of these fossil deposits with regard to bats is a cave at Cerro de San Francisco, about 5 km east of Banica in the westernmost Domincan Republic, not far from the Haitian border. The large samples of lizards (Etheridge, 1965) and birds (Bernstein, 1965) from Cerro de San Francisco have been published, whereas the incredibly abundant sample of bats has been sorted and identified, but not previously published. Other mammals from Cerro de San Francisco include three species of the extinct insectivore Nesophontes and the rodents Brotomys and Isolobodon. There are thousands of bat fossils in the Cerro de San Francisco cave deposit. The most abundant species in this site is the small stenodermatine fruit bat, Phyllops falcatus, which is represented by more than 500 skulls, as well as large numbers of mandibles and postcranial elements. Phyllos falcatus is a tree-roosting species, suggesting that this deposit was formed at least in part through the feeding activity of barn owls. The chiropteran fauna from Cerro de San Francisco consists of 18 species, including 15 species that currently inhabit Hispaniola and three species that are no longer found on the island: Mormoops megalophylla, Pteronotus sp., and Lasiurus intermedius. Only three extant species of Hispaniolan bats are absent from Cerro de San Francisco: Noctilio leporinus, L. borealis, and Molossus molossus. Lasiurus borealis is present in fossil deposits in southwestern Haiti, whereas the other two species as yet have no fossil record in Hispaniola. A large species of Pteronotus identified from Cerro de San Francisco is considerably larger than P. parnellii from this same deposit and may represent an extinct species. No Pteronotus of comparable size is currently known from the West Indies. The record of M. megalophylla from Cerro de San Francisco has been mentioned elsewhere (Morgan, 1989). As noted above, this species is no longer found in the West Indies, but is widely distributed in the mainland Neotropics. Fossils from Cerro de San Francisco document the first record of the yellow bat L. intermedius from Hispaniola. This large species of Lasiurus is known elsewhere in the West Indies from Cuba, and also occurs from the southeastern United States to Central America. The Recent and fossil chiropteran fauna of Hispaniola is composed of 21 species, including 18 living species and three species (14%) no longer found on the island. A large Pteronotus may represent an extinct species and the other two species that underwent localized extinction on Hispaniola are still extant; M. megalophylla in the mainland Neotropics and L. intermedius in Cuba, the southeastern United States, and Middle America. Ile de la Gonâve Koopman (1955) reported five species of bats from a cave fossil deposit near En Café on Ile de la Gonâve, located about 25 km off the west coast of Haiti. Water depths between Gonâve and Haiti are less than 100 m, indicating that Gonâve would have been connected to the Hispaniolan mainland during the low sea level stand of the last glacial. Only two species of Recent bats have been reported from Gonâve, Artibeus jamaicensis and Molossus molossus (Koopman, 1955). Artibeus jamaicensis was also identified from the fossil deposit, but the other four species, including Mormoops blainvillii, Pteronotus parnellii, Macrotus waterhousii, and Monophyllus redmani, were recorded from Gonâve only as fossils, although all four of these bats still occur on Hispaniola. The most interesting aspect of the Gonâve fossil bat fauna is the presence of the smallest known subspecies of P. parnellii, described as the new form P. parnellii gonavensis by Koopman (1955). Previously, the Hispaniolan subspecies P. parnellii pusillus was the smallest known representative of this species.

378

Biogeography of the West Indies: Patterns and Perspectives

PUERTO RICO Some of the first fossil cave deposits described from the West Indies were those studied by Anthony (1917b, 1925) from Puerto Rico. Although Anthony concentrated on the large and well-preserved samples of extinct terrestrial mammals present in these cave deposits (e.g., the small ground sloth Acratocnus odontrigonus, the large insectivore Nesophontes edithae, and the rodent Elasmodontomys obliquus), he did identify the fossil bats as well. Anthony (1917b, 1925) reported eight species of bats from a fossil deposit in Cueva Catedral in central Puerto Rico. Two of these species, Phyllonycteris major and Monophyllus plethodon, are no longer found in Puerto Rico. Phyllonycteris major is an extinct species and M. plethodon is now restricted to the Lesser Antilles. Reynolds et al. (1953) reported six species of bats from Cueva Monte Grande in western Puerto Rico, all of which still occur on the island. Choate and Birney (1968) identified 12 species of bats from three caves, Cueva de Clara, Cueva del Perro, and Cueva de Silva, all located near Cueva Catedral in central Puerto Rico. The bat fauna from Cueva de Clara included nine species that still occur on Puerto Rico and three species, Macrotus waterhousii, Monophyllus plethodon, and P. major, no longer present on the island (Choate and Birney, 1968). Macrotus waterhousii is one of the most common and widespread bats in the western Caribbean, but is no longer found east of Hispaniola. In contrast, Monophyllus plethodon is a Lesser Antillean species that extended its range westward to include Puerto Rico in the late Quaternary. The closest living population of M. plethodon is on St. Martin in the northern Lesser Antilles. Phyllonycteris major is the largest species in the endemic Antillean genus Phyllonycteris, and is the only extinct form in that genus. The chiropteran fauna of Puerto Rico totals 16 species, 13 extant species, and three species (19%) no longer found on the island. Of the three locally extinct bats on Puerto Rico, one species, P. major is extinct and two species, Macrotus waterhousii and Monophyllus plethodon, are still extant elsewhere in the West Indies.

BAHAMAS Morgan (1989) summarized the fossil record of bats in the Bahamas, primarily based on fossils from caves on Andros and New Providence on the Great Bahama Bank, as well as a cave on Grand Caicos. Morgan also reported an extirpated population of the Bahamian funnel-eared bat, Natalus tumidifrons, from a cave deposit on Cat Island on the Great Bahama Bank. The Cat Island record of N. tumidifrons is not listed in Table 1 because that table is limited to faunas containing two or more species of bats. Koopman (1951) and Koopman et al. (1957) reported bat fossils from caves on Exuma on the Great Bahama Bank. The current report also includes new data from two caves on Abaco, the first record of fossil bats from the Little Bahama Bank. Abaco No fossil bats have been reported previously from either of the two large islands that occupy the Little Bahama Bank, Abaco (including both Great Abaco and Little Abaco) and Grand Bahama. In January 1989, Gary Morgan excavated two cave deposits on Abaco that produced large samples of fossil bats. The fossil chiropteran faunas from these two sites are briefly reviewed here. Papers on the distribution of bats in the Bahamas (e.g., Buden, 1986; Morgan, 1989) listed only three extant species from Abaco, Erophylla sezekorni, Natalus tumidifrons, and Tadarida brasiliensis. Living specimens of these three species, as well as two species not before recorded from Abaco, Macrotus waterhousii and Eptesicus fuscus, were collected in January 1989. The presence of M. waterhousii and E. fuscus on Abaco is not unexpected as they are two of the most widespread bats in the Bahamas. Hole in the Wall Cave is located at the southern end of Abaco about 0.5 km west of the Imperial Lighthouse. This is probably the same cave earlier referred to as the Imperial Lighthouse Cave, which is the type locality for an extinct subspecies of the Bahamian hutia, Geocapromys ingrahami abaconis (see Lawrence, 1934; Morgan, 1989). The fossil deposits in Hole in the Wall Cave have produced

Patterns of Extinction in West Indian Bats

379

12 species of bats, including four species that still live on Abaco and eight species that no longer occur on the island (Table 1). All eight of the bats now extinct on Abaco represent extirpated populations, two of which, Mormoops megalophylla and Myotis cf. M. austroriparius, are absent from the Recent fauna of the West Indies. Mormoops megalophylla still lives in the mainland Neotropics and Myotis austroriparius is restricted to the southeastern United States. Although the tentative identification of M. austroriparius from Abaco is based on a fragmentary specimen, it clearly belongs to Myotis, a genus never before reported in the Recent or fossil fauna from the Greater Antilles, Bahamas, or Cayman Islands. The closest population of M. austroriparius inhabits the Florida peninsula, about 200 km west of Abaco. The six other extirpated bat species from Hole in the Wall Cave, including Mormoops blainvillii, Pteronotus parnellii, P. quadridens, Phyllonycteris poeyi, Monophyllus redmani, and Natalus major, still survive elsewhere in the West Indies. All six of these species have been identified from fossil deposits on New Providence (Morgan, 1989), located less than 100 km south of Abaco but separated from it by deep water. The closest extant populations for five of these species, Mormoops blainvillii, Pteronotus parnellii, P. quadridens, Phyllonycteris poeyi, and Monophyllus redmani, are in Cuba. M. redmani also occurs in the southeastern Bahamas (Buden, 1986), with the closest living population on Crooked Island about 450 km southeast of Abaco; however, Cuba is actually closer. Natalus major is extirpated from Cuba as well, and currently is known only from Jamaica and Hispaniola. A second cave fossil deposit from Abaco, Long Bay Cave, is located about 30 km north of Hole in the Wall Cave. The fossil vertebrate fauna from Long Bay Cave consists almost exclusively of bats. Five species of bats have been identified from this fauna: Pteronotus parnellii, Macrotus waterhousii, Erophylla sezekorni, Monophyllus redmani, and N. major, all of which are also known from Hole in the Wall Cave. Three of these species, P. parnellii, M. redmani, and N. major, are now extirpated from Abaco. The fossil sample is dominated by N. major, an uncommon species in most other Bahamian fossil sites (Morgan, 1989). The chiropteran fauna of Abaco is composed of 13 species, including five extant species and eight species (62%) no longer found on the island. Only one of the five Recent species, N. tumidifrons, is absent from the fossil deposits in Hole in the Wall Cave and Long Bay Cave. All eight of the extirpated species are still extant, including one species in the southeastern United States, Myotis cf. M. austroriparius; one species in the mainland Neotropics, Mormoops megalophylla; and six species elsewhere in the West Indies; M. blainvillii, P. parnellii, P. quadridens, Monophyllus redmani, Phyllonycteris poeyi, and N. major. Andros Morgan (1989) reported fossils of bats and the Bahamian hutia, Geocapromys ingrahami, from Ashton Cave, Coleby Bay Cave, and King Cave, all of which are located on the northeastern corner of Andros just inland from Morgans Bluff. The combined chiropteran fauna from these three caves totals ten species, six of which no longer occur on the island (see Table 1), including Mormoops megalophylla, Pteronotus quadridens, Brachyphylla nana, Monophyllus redmani, Natalus major, and Nyctiellus lepidus. The remaining four species identified in the fossil deposits, Macrotus waterhousii, Erophylla sezekorni, Natalus tumidifrons, and Eptesicus fuscus, along with red bat, Lasiurus borealis, constitute the extant bat fauna of Andros. The presence of a living population of N. tumidifrons on Andros was documented fairly recently (Anderson, 1990). The absence of L. borealis from the fossil deposits is not unexpected because members of the genus Lasiurus generally roost in trees and, as such, tend to be rare in cave fossil deposits in the West Indies and elsewhere (Morgan, 1985a). The chiropteran fauna of Andros is composed of 11 species, five extant species and six locally extinct species (55% of fauna). Among the extirpated bats, one is extinct in the West Indies (Mormoops megalophylla), one is found in Cuba (Pteronotus quadridens), two occur elsewhere in the Bahamas (Monophyllus redmani and Nyctiellus lepidus), and one is now found only in Jamaica and Hispaniola (Natalus major).

380

Biogeography of the West Indies: Patterns and Perspectives

Exuma Koopman et al. (1957) reported seven species of bats from Exuma (which includes both Little Exuma and Great Exuma), including two species, Mormoops blainvillii and Natalus tumidifrons, known only from cave fossil deposits. Fossil bats have been reported from two cave deposits in the Exumas, Upper Pasture Cave on Little Exuma and Max Bowes Cave near the Forest settlement on Great Exuma (Koopman, 1951; Hecht, 1955; Koopman et al., 1957). Two bats were recovered from Upper Pasture Cave, including one species, M. blainvillii, no longer found in the Bahamas. The closest extant population of M. blainvillii is in Cuba, although fossils of this species are also known from Abaco and New Providence. Four species of bats were identified from Max Bowes Cave, including one species, N. tumidifrons, no longer found on Exuma, but extant elsewhere in the Bahamas. Natalus tumidifrons is the only endemic bat in the Bahamas where it has a very spotty Recent distribution. It is known from one island on the Little Bahama Bank (Abaco), one island on the Great Bahama Bank (Andros, new record; see Anderson, 1990), and San Salvador. Locally extinct populations of N. tumidifrons are known from Cat, Exuma, and New Providence (Morgan, 1989). The chiropteran fauna of Exuma is composed of seven species, including five extant species and two bats (29%), M. blainvillii and N. tumidifrons, no longer found on the island. New Providence Four caves on New Providence have produced fossil bats, Banana Hole, East Cave, Hunts Cave, and Sir Harry Oakes Cave (Morgan, 1989). Banana Hole, located on the western end of New Providence, is the best-known fossil deposit in the Bahamas. The fossil amphibians and reptiles (Etheridge, 1966; Pregill, 1982), birds (Brodkorb, 1959; Olson and Hilgartner, 1982), and mammals (Morgan, 1989) from Banana Hole have been studied. A bone collagen radiocarbon date of 7,980 ± 230 years BP on Geocapromys postcranial bones from Banana Hole confirms an early Holocene age for the deposit (Morgan, 1989). Twelve species of bats have been identified from Banana Hole (Table 1), only three of which still live on New Providence. The nine bats no longer found on New Providence include three mormoopids, Mormoops blainvillii, Pteronotus parnellii, and P. quadridens; three phyllostomids, Brachyphylla nana, Phyllonycteris poeyi, and Monophyllus redmani; two natalids, Natalus major and N. tumidifrons; and one molossid, Tadarida brasiliensis. Of the nine species now extinct on New Providence, all but the two natalids occur in Cuba at the present time. Natalus major is known from fossil deposits in Cuba, but is now locally extinct there and N. tumidifrons is endemic to the Bahamas, although the closely related N. micropus still inhabits Cuba. Three of the four living species of bats recorded from New Providence, Macrotus waterhousii, Erophylla sezekorni, and Eptesicus fuscus, also occur in Banana Hole. The fourth extant bat known from New Providence, Lasiurus borealis, does not occur in Banana Hole. The only locally extinct species found in the other three caves on New Providence that is not present in Banana Hole is Pteronotus macleayii from Hunts Cave. Pteronotus macleayii is now known only from Cuba and Jamaica. The chiropteran fauna of New Providence totals 14 species, four living species and ten species (71%) now extinct on the island. Among the ten locally extinct species, all but the two natalids are still found in Cuba. Fossils of N. major are known from Cuba as well, but this species now occurs only on Jamaica and Hispaniola. Four of the extirpated species, B. nana, Monophyllus redmani, N. tumidifrons, and T. brasiliensis, are known from the Recent fauna of other islands in the Bahamas.

GRAND CAICOS The largest and most centrally located of the Caicos Islands is identified as Grand Caicos on most West Indian maps; however, residents of the Caicos Islands and some authors (e.g., Buden, 1986) call this same island Middle Caicos. A cave deposit associated with an Amerindian archaeological site in Conch Bar Cave on Grand Caicos has produced five species of bats, including three species

Patterns of Extinction in West Indian Bats

381

no longer found on the island: Macrotus waterhousii, Natalus major, and Tadarida brasiliensis. The bat fossils have a different preservation than the remainder of bones from Conch Bar Cave, and probably are significantly older than the archaeological material. Macrotus waterhousii is one of the most widespread bats in the Bahamas archipelago and has been recorded from three of the Caicos Islands (Providenciales, North Caicos, and East Caicos), but not Grand Caicos. The fossils from Grand Caicos belong to the large Hispaniolan subspecies M. w. waterhousii rather than to the smaller M. w. minor found in the northern Bahamas and Cuba (Morgan, 1989). Natalus major no longer occurs in the Bahamas archipelago, but still inhabits Hispaniola, located about 200 km south of the Caicos Islands. Tadarida brasiliensis has a rather spotty distribution in the Bahamas, but is currently unknown from the Caicos Islands (Buden, 1986; Morgan, 1989). The chiropteran fauna of Grand Caicos consists of six species (Table 1), three extant and three locally extinct (50% of fauna), M. waterhousii, N. major, and T. bradiliensis.

CAYMAN ISLANDS The late Quaternary vertebrate fauna and Recent chiropteran fauna of the Cayman Islands were recently reviewed (Morgan, 1994a, 1994b). Caves on two of the three islands, Grand Cayman and Cayman Brac, have produced substantial numbers of fossil bats. The largest sample of fossil bats known from the Cayman Islands, from Dolphin Cave on Grand Cayman, was discovered in 1993 after the above-cited review was already in press. This synopsis includes previously unpublished bats from Dolphin Cave. Grand Cayman Three caves on Grand Cayman have large samples of fossil bats, Bodden Cave (also known as Pirate’s Cave) near Bodden Town just inland from the south coast, Crab Cave near East End on the eastern end of the island, and Dolphin Cave just inland from the north coast (Morgan, 1994a). Dolphin Cave has by far the richest sample of fossil bats known from the Cayman Islands, with eight species represented by literally thousands of jaws, teeth, and postcranial elements. Dolphin Cave contains two large fossil deposits that appear to have formed under different depositional conditions. Fossils from the entrance room deposit were briefly mentioned by Morgan (1994a). The entrance room has numerous fossils of the hutias Capromys and Geocapromys, the extinct insectivore Nesophontes, birds, and reptiles, but only a few bats. In 1993 a small room was discovered in Dolphin Cave about 50 m beyond the entrance deposit that was covered with a thin layer (about 20 cm) of dark, powdery sediments reminiscent of bat gauno. These sediments contained huge numbers of bat bones, along with small samples of capromyid rodents, Nesophontes, small birds, and lizards. Eight species of bats have been identified from Dolphin Cave, four of which are no longer found in the Caymans: Pteronotus parnellii, Monophyllus redmani, Natalus major, and N. micropus. All four of these species still occur in Jamaica. Three of these four bats live in Cuba and the fourth species, N. major, is known as a fossil from Cuba but is absent from the Recent fauna of that island. The Grand Cayman N. micropus represents the only extirpated population of that species, although there are several locally extinct populations of the closely related N. tumidifrons from the Bahamas (Morgan, 1989). Locally extinct populations of N. major are known from four islands in the Bahamas (Morgan, 1989), as well as Cuba and Isla de Pinos (Silva, 1979). Seven species of bats have been identified from Bodden Cave, including two species no longer found in the Caymans, N. major and N. micropus. All seven of these species are also present in Dolphin Cave. Three species of bats are known from Crab Cave, one of which, P. parnellii, is no longer found on Grand Cayman. The chiropteran fauna of Grand Cayman consists of 12 species, eight living species and four species (33%) known only from fossil deposits. All four of these extirpated species, P. parnellii, M. redmani, N. major, and N. micropus, are still extant in the Greater Antilles.

382

Biogeography of the West Indies: Patterns and Perspectives

Cayman Brac Among the numerous cave deposits known from Cayman Brac only two sites have fairly large samples of fossil bats, Patton’s Fissure, a short distance inland from the northeastern coast, and Pollard Bay Cave, just inland from the southeastern coast (Morgan, 1994a). Five species of bats have been identified from Patton’s Fissure, three of which no longer occur on Cayman Brac, Phyllonycteris poeyi, Brachyphylla nana, and a very small Eptesicus. Other locally extinct populations of P. poeyi are known from Abaco and New Providence in the Bahamas. The closest extant populations of P. poeyi are in Cuba and Isla de Pinos. Brachyphylla nana is no longer present on Cayman Brac (Morgan, 1994b), although this species still survives on Grand Cayman. The Eptesicus fossils from Patton’s Fissure are very similar to the undescribed Recent subspecies of E. fuscus from Grand Cayman, which appears to be the smallest known form of the species (Morgan, 1994b). Recent specimens of E. fuscus from Cayman Brac (Morgan, 1994b) belong to the larger Cuban subspecies E. fuscus dutertreus. Apparently, the small endemic E. fuscus inhabited Cayman Brac in the late Pleistocene, then disappeared and was replaced with the larger Cuban form. Pollard Bay Cave has four species of bats, two of which, B. nana and E. fuscus, are extirpated from the island. The E. fuscus fossils from this cave are the small endemic Cayman form. The Pollard Bay Cave Brachyphylla fossils are larger than Recent specimens of B. n. nana from Grand Cayman and fossils from Patton’s Fissure, and are more similar to Jamaican fossils referred to the Hispaniolan form B. nana pumila by Koopman and Williams (1951). The fauna of Cayman Brac is composed of eight species, six extant species and two species (25%), B. nana and P. poeyi, and one subspecies, the small undescribed Caymanian E. fuscus, no longer found on the island.

LESSER ANTILLES Pregill et al. (1994) summarized the late Quaternary vertebrate fauna of the Lesser Antilles. They reported bats from fossil deposits on four islands in the northern Lesser Antilles, Anguilla, St. Martin, Antigua, and Barbuda. The only thoroughly analyzed fossil chiropteran fauna from the Lesser Antilles is from Burma Quarry on Antigua (Pregill et al., 1988); however, there are substantial unstudied samples of fossil bats from Anguilla and Barbuda (Pregill et al., 1994). The fossil bat faunas listed in Table 1 for Anguilla and Barbuda are almost certainly incomplete. Macrotus waterhousii, a species that no longer occurs in the Lesser Antilles, is known from a cave deposit on St. Martin. The closest extant population of this bat is in Hispaniola. Brachyphylla cavernarum is known from an archaeological site on Montserrat (Steadman et al., 1984). Anguilla Pregill et al. (1994) reported two species of bats, Mormoops blainvillii and Macrotus waterhousii, from cave deposits near Little Bay on Anguilla. Neither species at present occurs on Anguilla. Momoops blainvillii is now restricted to the Greater Antilles and Macrotus waterhousii is not found east of Hispaniola. Mormoops blainvillii is also known from Antigua and Barbuda and Macrotus waterhousii has been identified from St. Martin and Barbuda. Pregill et al. (1994) mentioned unstudied samples of fossil bats from Center Cave and the Fountain on Anguilla. Antigua Pregill et al. (1988) reviewed the fossil vertebrates from Burma Quarry on Antigua. Radiocarbon dates on the Burma Quarry deposits are late Holocene in age, ranging from 2,560 to 4,300 years BP; however, this is a noncultural site deposited in a limestone fissure (Pregill et al., 1988, 1994). Eight species of bats occur in Burma Quarry (Pregill et al., 1988), including three species, Pteronotus parnellii, Mormoops blainvillii, and Phyllonycteris major, that are no longer found on Antigua. Pteronotus parnellii and M. blainvillii are both Greater Antillean species that had considerably broader ranges in the West Indies during the late Quaternary and Phyllonycteris major is an extinct

Patterns of Extinction in West Indian Bats

383

species known elsewhere only from fossil deposits in Puerto Rico. The total chiropteran fauna from Antigua consists of ten species, including seven living species and three species (30%) no longer found on the island, two of which are extirpated from Antigua and one of which is extinct. Barbuda The richest fossil deposits in the Lesser Antilles are from Barbuda (Pregill et al., 1994). However, the bat fossils from Barbuda remain mostly unstudied. Three species of bats have been identified from fossil deposits in Barbuda, Mormoops blainvillii and Macrotus waterhousii from caves at Two Foot Bay (specimens in the FLMNH) and Noctilio leporinus from Castle Bay Cave (Pregill et al., 1994). Significant unstudied samples of fossil bats, especially from the caves in the vicinity of Two Foot Bay, suggest that this faunal list will eventually increase. Two of the three fossil bats from Barbuda, Mormoops blainvillii and Macrotus waterhousii, are locally extinct, both of which are now restricted to the Greater Antilles.

TAXONOMIC AND ZOOGEOGRAPHICAL REVIEW OF WEST INDIAN FOSSIL BATS This section consists of a brief review of the taxonomy and distribution of the genera and species of bats recorded from fossil deposits in the West Indies. Genera that are unknown from the West Indian fossil record (e.g., Nycticeius, Eumops, and Mormopterus) are not discussed.

FAMILY NOCTILIONIDAE Noctilio The fishing bat, Noctilio leporinus, is one of the most widespread bats in the West Indies, but is rare in Antillean cave fossil deposits. N. leporinus is known as a fossil from Cuba, Isla de Pinos, Puerto Rico, and Antigua. There are no extinct populations of this species in the West Indies.

FAMILY MORMOOPIDAE Mormoops Three species of Mormoops are known from fossil deposits in the West Indies: M. blainvillii, M. magna, and M. megalophylla. Mormoops blainvillii is currently restricted to the four Greater Antilles, but locally extinct populations are known from seven other West Indian islands, including Abaco, Exuma, and New Providence in the Bahamas; Gonâve; and Anguilla, Antigua, and Barbuda in the Lesser Antilles (Figure 2). Mormoops blainvillii survives only on the four largest islands in the West Indies and has disappeared from seven smaller islands. It may be significant that all seven of these smaller islands are situated on submarine banks that were part of considerably larger islands during the low sea level stand of the last glacial. Mormoops blainvillii is absent in both the Recent and late Quaternary faunas of smaller islands such as the Cayman Islands that are not located on large submarine banks. Mormoops magna, the largest known member of the genus, is an extinct species known only from Cuba (Silva, 1974). Mormoops megalophylla is no longer extant in the West Indies, but locally extinct populations of this species are known from Cuba, Jamaica, Hispaniola, Abaco, and Andros (Figure 3). The current distribution of M. megalophylla is from southern Arizona and Texas south through Mexico and Central America to northern South America and Trinidad (Smith, 1972). Other fossil occurrences of M. megalophylla from outside the modern range of the species include the late Pleistocene of Florida (Ray et al., 1963; Morgan, 1991), Tobago (Eshelman and Morgan, 1985), and Bahia, Brazil (Czaplewski and Cartelle, 1998). Czaplewski and Cartelle (1998) noted that fossil humeri of M. megalophylla from Brazil were similar in size to humeri of M. magna from Cuba. A thorough study of fossil and Recent specimens of M. megalophylla from throughout the Recent and late Pleistocene range of this species will be necessary to determine the extent of geographical

384

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 2 Distribution of Recent and locally extinct populations of Mormoops blainvillii. Recent distribution indicated by black-filled areas, extinct populations by stippling. Locally extinct populations of M. blainvillii are known from Abaco, New Providence, and Exuma in the Bahamas, Gonâve, and Anguilla, Antigua, and Barbuda in the northern Lesser Antilles. See Figure 1 for names and location of islands.

and perhaps chronological variation present. Clearly there are three species of Mormoops in the late Pleistocene of Cuba (Silva, 1974); however, clarification of the taxonomy and relationships of the two larger species, M. magna and M. megalophylla, requires further study. Pteronotus Four species of Pteronotus currently inhabit the West Indies: P. davyi, P. macleayii, P. parnellii, and P. quadridens. Five species of Pteronotus are represented in Antillean late Quaternary deposits, including P. macleayii, P. parnellii, and P. quadridens, the extinct species P. pristinus, and one species of unknown affinities. Pteronotus parnellii occurs on the four Greater Antilles, and in the mainland Neotropics from Mexico to northern South America. Pteronotus parnellii is also represented by six locally extinct populations in the West Indies, including Isla de Pinos, Gonâve, Abaco, New Providence, Grand Cayman, and Antigua (Figure 4). There are two other late Pleistocene records of P. parnellii from outside its modern range, including Tobago (Eshelman and Morgan, 1985) and Bahia, Brazil (Czaplewski and Cartelle, 1998). A partial bat skeleton from the early Pleistocene of El Salvador in Central America was tentatively referred to P. parnellii (Webb and Perrigo, 1984). The mainland and West Indian representatives of P. parnellii are considered the same species, although there is substantial size variation among the various populations (Smith, 1972), with the West Indian forms generally smaller. The endemic subspecies, P. parnellii pusillus, from Hispaniola and the extinct subspecies, P. parnellii gonavensis, from Gonâve (Koopman, 1955) are the two

Patterns of Extinction in West Indian Bats

385

FIGURE 3 Occurrence of extinct populations of Mormoops megalophylla. Locally extinct West Indian populations of M. megalophylla, indicated by stippling, are known from Cuba, Jamaica, Hispaniola, and Abaco and Andros in the Bahamas. Extinct populations also are known from Florida, Tobago, and Brazil (not shown). The Recent distribution of M. megalophylla (not indicated on map) is restricted to the mainland from the southwestern United States to northern South America. See Figure 1 for names and location of islands.

smallest members of the species. A fossil mandible of Pteronotus from the Cerro de San Francisco in the Domincan Republic complicates the situation. This mandible is far larger than any other mandible of P. parnellii from Cerro de San Francisco, and is comparable in size with mainland specimens of P. parnellii rubiginosus, the largest subspecies of P. parnellii (Smith, 1972). It is unlikely that Hispaniola supported two sympatric subspecies of P. parnellii of widely different size during the late Quaternary. Thus, it is possible that the West Indian and mainland Pteronotus currently referred to P. parnellii may actually represent distinct species, and that the large mainland species inhabited Hispaniola during the late Quaternary. Further study of the fossil and Recent specimens of P. parnellii from the West Indies and comparison of these forms with mainland P. parnellii will be necessary to determine their taxonomic status. Two other extant species of Pteronotus are endemic to the Greater Antilles: P. quadridens (= P. fuliginosus) occurs on all four of the Greater Antilles and P. macleayii is restricted to Cuba, Isla de Pinos, and Jamaica. There are three locally extinct populations of P. quadridens in the West Indies, all in the Bahamas, including Abaco, Andos, and New Providence. The only extirpated population of P. macleayii is from New Providence. The fourth extant Antillean Pteronotus, P. davyi, is principally a mainland form, but does occur on three islands in the Lesser Antilles: Dominica, Martinique, and Marie Galante. No fossils of P. davyi are known from the Lesser Antilles, although Eshelman and Morgan (1985) did identify fossils of this bat from Tobago where it no longer occurs.

386

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 4 Distribution of Recent and locally extinct West Indian populations of Pteronotus parnellii. Recent distribution indicated by black-filled areas, extinct populations by stippling. Mainland distribution is not indicated on this map. Locally extinct populations of P. parnellii are known from Abaco and New Providence in the Bahamas, Isla de Pinos, Gonâve, Grand Cayman, and Antigua. See Figure 1 for names and location of islands.

Silva (1974) described the extinct species P. pristinus from the late Quaternary of Cuba. The only other record of this species, which is intermediate in size between P. macleayii and P. parnellii, is from a late Pleistocene cave deposit in southern Florida (Morgan, 1991). The Florida fossils represent the first Nearctic record of Pteronotus. Considering the close proximity of Cuba to southern Florida, barely 150 km separated them during the late Pleistocene, the presence of a Cuban bat in Florida is not unexpected.

FAMILY PHYLLOSTOMIDAE Subfamily Phyllostominae Macrotus Macrotus waterhousii is one of the most widely distributed bats in the Greater Antillean region where it is known from Cuba, Jamaica, Hispaniola, all three of the Cayman Islands, and 17 islands in the Bahamas. This species also occurs in Mexico and Guatemala. Locally extinct populations of M. waterhousii are known from Puerto Rico, Gonâve and Grand Caicos in the Greater Antillean region, and from Anguilla, Barbuda, and St. Martin in the Lesser Antilles (Figure 5). Macrotus waterhousii occurs on three islands in the Caicos group and on Hispaniola, and thus it is likely

Patterns of Extinction in West Indian Bats

387

FIGURE 5 Distribution of Recent and locally extinct populations of Macrotus waterhousii. Recent distribution indicated by black-filled areas (does not include mainland distribution in Mexico and Guatemala), extinct populations by stippling. Locally extinct populations of M. waterhousii are known from Grand Caicos, Gonâve, Puerto Rico, and Anguilla, St. Martin, and Barbuda in the northern Lesser Antilles. See Figure 1 for names and location of islands.

that this species will eventually be found on both Grand Caicos and Gonâve. The extirpated populations of M. waterhousii from Puerto Rico and the northern Lesser Antilles clearly represent a contraction in its geographical range since the late Quaternary. Tonatia Tonatia saurophila is known in the West Indies only by late Quaternary fossils from Jamaica (Koopman and Williams, 1951). Koopman (1976) synonymized T. saurophila with the mainland Neotropical species T. bidens. Most subsequent authors have regarded the Jamaican Tonatia as an extinct subspecies of T. bidens (e.g., Baker and Genoways, 1978; Koopman, 1989, 1993). However, a recent taxonomic review of the T. bidens complex (Williams et al., 1995) revealed that there are actually two species in this group. T. saurophila is the oldest available name for the species that occurs from southern Mexico to Peru, northern Brazil, and Trinidad, as well as Jamaica. The nominate race, T. s. saurophila, is represented only by the Jamaican fossils. Subfamily Brachyphyllinae Brachyphylla The subfamiles Brachyphyllinae and Phyllonycterinae are both endemic to the West Indies and are generally considered to be closely related. Most previous workers have combined them into a single

388

Biogeography of the West Indies: Patterns and Perspectives

subfamily, with both names having been used at various times. I follow Koopman (1993) in considering the Brachyphyllinae a monogeneric subfamily including only the genus Brachyphylla. The Phyllonycterinae, including the genera Erophylla and Phyllonycteris, is discussed below. There is little agreement on the taxonomic status of the species of Brachyphylla. Silva (1976, 1979), Swanepoel and Genoways (1978), Morgan (1989), and Koopman (1993) recognized the smaller form B. nana from Cuba, Isla de Pinos, Hispaniola, Grand Cayman, and Grand Caicos as a distinct species from the larger B. cavernarum from Puerto Rico, the Virgin Islands, and the Lesser Antilles. Varona (1974) and Buden (1977) placed all Antillean populations of Brachyphylla in B. cavernarum. Two species, B. cavernarum and B. nana, are recognized here. There are two subspecies of B. nana, B. n. nana from Cuba, Isla de Pinos, and Grand Cayman and B. n. pumila from Hispaniola and Grand Caicos. There are several morphological characters that distinguish the two subspecies of B. nana, including differences in size, breadth of the rostrum, and certain dental features. Both the upper and lower molars of B. n. nana are essentially smooth, whereas the enamel on the molars is highly crenulated in B. n. pumila. Although nana and pumila are tentatively regarded as subspecies of B. nana, a more detailed morphological analysis may eventually show them to be distinct species. Whether these two forms are recognized as subspecies of B. nana or as distinct species is not critical to this analysis. It is important that the two forms are separated at some taxonomic level, allowing a more precise determination of their zoogeographical relationships. There are four locally extinct populations of B. nana in the Greater Antillean region. Specimens from Andros and New Providence are closer in size and dental characters to B. n. nana from Cuba (Morgan, 1989), whereas fossils from Jamaica are more similar to B. nana pumila from Hispaniola (Koopman and Williams, 1951; Morgan, 1993). Fossils from Cayman Brac appear to represent both forms. Large fossils from Pollard Bay Cave are more similar to B. n. pumila and smaller fossils from Patton’s Fissure are more like B. n. nana from Grand Cayman and Cuba (Morgan, 1994a, 1994b). Three fossil mandibles of B. nana from Conch Bar Cave on Grand Caicos are distinctly larger than those of Recent B. nana pumila from either Grand Caicos or Hispaniola, but do have the crenulated enamel and other dental features of the Hispaniolan form (Morgan, 1989). Extirpated populations of B. nana from Jamaica, Cayman Brac, and Grand Caicos average larger than Recent specimens of B. nana, and are thus intermediate in size between B. nana and B. cavernarum. These large specimens suggest a more complex evolutionary history for Brachyphylla in the West Indies than previously recognized. Subfamily Phyllonycterinae Erophylla There are two Recent species of Erophylla, both of which are restricted to the Greater Antillean region. Erophylla sezekorni occurs on Cuba, Jamaica, Grand Cayman, Cayman Brac, and 17 islands in the Bahamas. Erophylla bombifrons is found on Hispaniola and Puerto Rico. Buden (1976) synonymized the two species of Erophylla, but Koopman (1993) noted that differences between these two forms in the shape of the rostrum, inflation of the braincase, size of the ears, and fur coloration justify the distinction of E. bombifrons and E. sezekorni as separate species. No extirpated populations of Erophylla are known, even though this genus is common in fossil deposits throughout the Greater Antilles, Bahamas, and Cayman Islands. Phyllonycteris Three species of Phyllonycteris are known from the West Indies: P. aphylla, P. major, and P. poeyi. Phyllonycteris aphylla is endemic to Jamaica where it is known as a living animal and in late Quaternary fossil deposits (Koopman and Williams, 1951). Phyllonycteris poeyi occurs on Cuba, Isla de Pinos, and Hispaniola. Phyllonycteris obtusa from Hispaniola was long recognized as a distinct species, but Morgan (1989, 1994a) and Koopman (1993) both pointed out that this form is conspecific with P. poeyi. Locally extinct populations of P. poeyi have been reported from Abaco,

Patterns of Extinction in West Indian Bats

389

New Providence, and Cayman Brac (Morgan, 1989, 1994a). Phyllonycteris major, the largest member of the genus, is an extinct species first described from fossil deposits in Puerto Rico (Anthony, 1917b, 1925; Choate and Birney, 1968), and more recently identified from the late Holocene Burma Quarry site on Antigua (Pregill et al., 1988). Subfamily Glossophaginae Glossophaga Two species of Glossophaga are known from the West Indies. Glossophaga soricina is a widespread Neotropical bat that also occurs on Jamaica and G. longirostris is a South American species recorded from St. Vincent in the southern Lesser Antilles. Glossophaga soricina is known from surface and subsurface cave deposits in Jamaica, presumably of late Holocene age (Koopman and Williams, 1951). Its absence from older fossil deposits in Jamaica suggests that this species may have reached the island rather recently. Monophyllus Monophyllus is the only endemic Antillean genus in the Glossophaginae. There are two recent species in the genus. Monophyllus redmani occurs on the four Greater Antilles and in the southern Bahamas and the larger M. plethodon is a Lesser Antillean endemic. Although the two species have nonoverlapping ranges at present, an extirpated population of M. plethodon is known from late Quaternary cave deposits in Puerto Rico where it occurs in association with M. redmani, the species currently found on the island (Choate and Birney, 1968). Five locally extinct populations of M. redmani are known from small islands in the Greater Antillean region, including Gonâve, Abaco, Andros, New Providence, and Grand Cayman (Figure 6). Subfamily Stenodermatinae Artibeus Three species of Artibeus, A. anthonyi, A. jamaicensis, and A. lituratus, are known from the West Indies. Artibeus lituratus occurs in the West Indies only on St. Vincent in the southern Lesser Antilles where it is clearly an invader from northern South America. Artibeus anthonyi is an extinct species known only from the late Quaternary of Cuba (Woloszyn and Silva, 1977; Silva, 1979). Artibeus anthonyi was distinguished from A. jamaicensis principally by its larger size. Further comparisons with large mainland species of Artibeus, such as A. lituratus, probably are warranted. Artibeus jamaicensis is one of the most widespread Recent bats in the West Indies. It occurs throughout the Greater Antilles and Lesser Antilles (Baker and Genoways, 1978; Koopman, 1989), with the exception of the northern Bahamas (Morgan, 1989). The absence of Recent or extirpated populations of A. jamaicensis in the northern Bahamas, which are the only West Indian islands located north of the Tropic of Cancer, suggests that the subtropical climate of this region may not be suitable for frugivorous bat such as A. jamaicensis. Late Quaternary fossil deposits on Jamaica, Grand Cayman, and Cayman Brac lack A. jamaicensis, suggesting that this bat may have arrived on those islands rather recently (Koopman and Williams, 1951; Williams, 1952; Morgan, 1994a). Stenoderma Group: Ardops/Ariteus/Phyllops/Stenoderma Varona (1974) placed all four endemic genera of small Antillean stenodermatines, Ardops, Ariteus, Phyllops, and Stenoderma, in the genus Stenoderma. Nonetheless, most students of West Indian Chiroptera (e.g., Baker and Genoways, 1978; Koopman, 1989, 1993; Morgan, 1994a) have regarded these four genera as distinct. These genera are certainly closely related, as indicated by their extremely shortened rostrum and presence of a white spot on the shoulder, but they are distinguished by cranial and dental characters comparable to those used to separate other genera of Neotropical stenodermatines. They probably represent a single invasion of the West Indies with subsequent geographical differentiation into the four Recent genera.

390

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 6 Distribution of Recent and locally extinct populations of Monophyllus redmani. Recent distribution indicated by black-filled areas, extinct populations by stippling. Locally extinct populations of M. redmani are known from Abaco, Andros, and New Providence in the Bahamas, Grand Cayman, and Gonâve. See Figure 1 for names and location of islands.

Ardops nichollsi is a Lesser Antillean endemic that is unknown as a fossil. Stenoderma rufum occurs as a living animal on Puerto Rico and the Virgin Islands and in late Quaternary fossil deposits on Puerto Rico (Anthony, 1925; Choate and Birney, 1968). Ariteus flavescens is known from both the Recent and late Quaternary fauna of Jamaica (Koopman and Williams, 1952). Two extant species and one extinct species of Phyllops have been described. Phyllops falcatus is known as a living animal in Cuba (Silva, 1979), Grand Cayman, and Cayman Brac (Morgan, 1994b) and P. haitiensis occurs on Hispaniola. Koopman (1989) and Morgan (1994b) synonymized P. haitiensis with P. falcatus, recognizing the former as a subspecies of P. falcatus. Phyllops falcatus is common in cave deposits in Cuba and Hispaniola, but is unknown in fossil deposits in the Cayman Islands suggesting that this species reached the Caymans in the late Holocene. The only extirpated population of P. falcatus is from Isla de Pinos. The extinct species P. vetus occurs in late Quaternary cave deposits in Cuba and Isla de Pinos (Silva, 1979). Subfamily Desmodontinae Desmodus Vampire bats are unknown from the Recent fauna of the West Indies, but fossils of the extant vampire, D. rotundus, have been described from two late Quaternary localities in Cuba. Koopman

Patterns of Extinction in West Indian Bats

391

(1958) reported a partial skull of D. rotundus from Cueva Lamas near La Habana in western Cuba and Woloszyn and Mayo (1974) described a nearly complete vampire bat skull from the Cueva del Centenario de Lenin near Punta Judas on the coast of Las Villas Province in central Cuba. Woloszyn and Mayo (1974) described the vampire skull from Cueva del Centenario de Lenin as a new subspecies, D. rotundus puntajudensis, characterizing this form as somewhat smaller and more delicate than the geographically closest surviving subspecies, D. rotundus murinus from Mexico. The type of D. rotundus puntajudensis came from a deposit of middle Holocene age (between 5 and 7.5 yBP), whereas the vampire skull from Cueva Lamas is somewhat older, presumably late Pleistocene (Woloszyn and Mayo, 1974). Previous authors have suggested that the extinct Cuban vampire bat fed on the blood of the small megalonychid ground sloths that inhabited Cuba in the late Quaternary, and that the extinction of the sloths led to the disappearance of the vampires (Koopman, 1958; Woloszyn and Mayo, 1974).

FAMILY NATALIDAE Since Dalquest’s (1950) review of the Natalidae, almost all authors have recognized a single genus in the family, Natalus, which includes three subgenera: Natalus (including N. major, N. stramineus, and N. tumidirostris), Chilonatalus (including N. micropus and N. tumidifrons), and Nyctiellus (including N. lepidus). Natalus (Nyctiellus) lepidus is quite distinct from all other natalids in a number of cranial and dental characters, and is here recognized as a distinct genus. The characters used to distinguish Nyctiellus are discussed below under the generic heading. Natalus There is some disagreement on the number of species of Natalus in the West Indies. Koopman (1993) recognized four species: N. lepidus, N. micropus, N. stramineus, and N. tumidifrons. Four species of Natalus are recognized here as well, although not the same four species listed by Koopman. Morgan (1989) made a strong case for placing N. lepidus in the separate genus Nyctiellus (see discussion below). Koopman (1993) followed Varona (1974) and Silva (1979) in synonymizing the Greater Antillean species N. major with N. stramineus, a species known from the Lesser Antilles and on the mainland from Mexico south to Brazil. Morgan (1989) pointed out that numerous morphological characters distinguish N. major from N. stramineus, including larger size; rostrum less inflated and more tapered anteriorly with smaller nasal opening; more strongly constricted interorbital region; braincase more inflated and more sharply elevated above the rostrum; and better developed sagittal crest. Natalus major is a Greater Antillean endemic now found only on Jamaica and Hispaniola. There are also seven extinct populations of N. major from Cuba, Isla de Pinos, Abaco, Andros, New Providence, Grand Caicos, and Grand Cayman (Figure 7). Pregill et al. (1988) reported fossils of N. stramineus from Antigua, an island where this species still occurs. Natalus micropus and N. tumidifrons are recognized as distinct species following Ottenwalder and Genoways (1982). Natalus micropus is found on Cuba, Isla de Pinos, Hispaniola, and Jamaica, with a single extirpated population on Grand Cayman (Morgan, 1994a). Natalus tumidifrons is endemic to the Bahamas where it has previously been collected only on Abaco and San Salvador (Buden, 1986; Morgan, 1989). There is also a more recent record of this species from Andros (Anderson, 1990). Locally extinct populations of N. tumidifrons are known from late Quaternary cave deposits on Cat, Exuma, and New Providence on the Great Bahama Bank (Morgan, 1989). Nyctiellus The recognition of Nyctiellus as a distinct genus is a departure from most recent taxonomic treatments (e.g., Koopman, 1993). A morphological review of the Natalidae in an attempt to identify a new early Miocene member of the family from Florida (Morgan and Czaplewski, in preparation) has led to the recognition of a number of characters that distinguish Nyctiellus at the generic level from all other natalids, including the early Miocene form. The cranial, dental, and postcranial

392

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 7 Distribution of Recent and locally extinct populations of Natalus major. Recent distribution indicated by black-filled areas, extinct populations by stippling. Locally extinct populations of N. major are known from Abaco, Andros, New Providence, and Grand Caicos in the Bahamas, Cuba, Isla de Pinos, and Grand Cayman. See Figure 1 for names and location of islands.

characters that distinguish N. lepidus from all other natalids are discussed in more detail by Morgan (1989). Only a brief synopsis of these characters is presented here. Besides small size, the most conspicuous characters that distinguish N. lepidus from Natalus are the lower, less inflated, and less dorsally inflected braincase and the broader, deeper, and more inflated rostrum. Other diagnostic cranial characters of N. lepidus are the greatly reduced cleft in the premaxilla, which allows the first pair of upper incisors to nearly meet along the midline, the deep, robust zygomatic arches, the presence of a single, deep, round pit along the midline in the basicranial region immediately posterior to the palate, and the greatly inflated and enlarged tympanic bulla. Characteristic dental features are the spatulate or leaf-shaped upper incisors, small upper canines, reduction of the first upper and lower premolars to tiny buttonlike teeth, and the broader talonid compared to the trigonid on the lower molars. Many of the characters of Nyctiellus involve striking differences in morphology compared with Natalus (e.g., shape of braincase and rostrum, robust zygomatic arches, presence of single deep midline basicranial pit, greatly inflated tympanic bullae, form of upper incisors, and reduction of canines and anteriormost premolars). All other species of Natalus are much more similar to one another than any is to Nyctiellus. The characters that distinguish Nyctiellus are comparable to generic-level characters within the Vespertilionidae. Nyctiellus lepidus currently is restricted to Cuba, Isla de Pinos, and Cat, Eleuthera, Exuma, and Long on the Great Bahama Bank. The only known extirpated population of N. lepidus is from Andros (Morgan, 1989).

Patterns of Extinction in West Indian Bats

393

FAMILY VESPERTILIONIDAE Antrozous One species of Antrozous is known from Cuba, the only member of this genus in the West Indies. Antrozous koopmani was named as a Cuban endemic (Orr and Silva, 1960), but since was synonmyized with the mainland species A. pallidus (Martin and Schmidly, 1982; Koopman, 1993), which occurs in the western United States and Mexico. Fossils of this species are known from three late Quaternary cave deposits in Cuba (Silva, 1979). Eptesicus There are two species of Eptesicus in the West Indies, E. fuscus and E. guadeloupensis. Koopman (1989, 1993) regarded the small Jamaican form E. lynni as a subspecies of E. fuscus. Eptesicus guadeloupensis is found only on Guadeloupe in the Lesser Antilles and has no fossil record. Eptesicus fuscus occurs on all four of the Greater Antilles, Grand Cayman, Cayman Brac, nine islands in the Bahamas, and Dominica, and is also very widely distributed on the mainland in both the Nearctic and Neotropical regions. Fossils of E. fuscus are known from most islands in the Greater Antillean region (Table 1). There is only one extirpated population of this species from the West Indies. The smallest known subspecies of E. fuscus is from Grand Cayman and occurs as a fossil on Cayman Brac, but has been replaced in the Recent fauna of Cayman Brac by the larger Cuban form, E. fuscus dutertreus (Morgan, 1994a, 1994b). Lasiurus Two species of Lasiurus are known from the West Indies, L. borealis and L. intermedius. Lasiurus borealis is known from the four Greater Antilles and eight islands in the Bahamas, and as a fossil from Cuba and Hispaniola. There are no extirpated populations of red bats in the West Indies. Lasiurus intermedius is known in the West Indies only on Cuba (listed as L. insularis by Silva, 1979, but regarded as a synonym of L. intermedius by Koopman, 1993), and also occurs from the southeastern United States as far south as Honduras. The only known extirpated population of L. intermedius in the West Indies is from Hispaniola where it has recently been identified from the Cerro de San Francisco cave deposit in the Dominican Republic. Both West Indian species of Lasiurus typically roost in trees, and thus their rarity in cave fossil deposits is not unexpected. Fossils of Lasiurus are also uncommon in Florida late Pleistocene cave deposits (Morgan, 1985a, 1991). Myotis Two endemic species of Myotis occur in the West Indies, both of which are restricted to the Lesser Antilles and appear to be related to the mainland Neotropical species M. nigricans. Myotis dominicensis occurs on Dominica and possibly St. Martin and M. martiniquensis is known from Martinique and Barbados. Neither of these two species is known in the West Indies as a fossil. The first fossil of Myotis from the West Indies recently was identified from Abaco in the northern Bahamas. This is obviously an extralimital record, as the genus Myotis has never before been reported in the Recent or fossil fauna of the Bahamas or Greater Antilles. The closest Myotis occurs to the Bahamas is on the Florida peninsula, about 200 km west of Abaco. Although the Abaco record is based only on a distal humerus, this specimen compares very closely in size and morphology to M. austroriparius, and is tentatively referred to that species pending further comparisons. Myotis austroriparius is currently restricted to the southeastern United States, but is unknown from the southern half of the Florida peninsula, presumably because dry caves are now absent from this region. This species has been identified from two late Pleistocene cave deposits in southernmost peninsular Florida (Morgan, 1991), suggesting it was more widespread during the late Quaternary, apparently including Abaco which has an abudance of caves. Myotis austroriparius is one of the few North American Myotis that does not hibernate. Florida populations of M. austroriparius are active throughout the year, presumably because the ambient temperature of Florida caves is too high to permit effective hibernation (McNabb, 1974). Caves in the Bahamas also would be too warm for hibernation, and thus M. austroriparius would be one of the few Nearctic members of this genus that could survive there.

394

Biogeography of the West Indies: Patterns and Perspectives

FAMILY MOLOSSIDAE Molossus Molossus molossus is one of the most widespread bats in the West Indies, although it does not occur in the Bahamas (Buden, 1986; Morgan, 1989). Molossus molossus is represented in the Antilles as a fossil only from Jamaica and Antigua (Table 1). This bat does not roost in caves and flies so rapidly that it is rarely preyed upon by owls, both of which would help to explain its rarity in the fossil record. Nyctinomops Two species of Nyctinomops, N. laticaudatus and N. macrotis, are known from the Recent fauna of the West Indies. Both of these species previously were placed in the genus Tadarida (e.g., Silva, 1979), but were transferred to Nyctinomops by Freeman (1981). In the West Indies, N. laticaudatus is restricted to Cuba and is unknown as a fossil. This species also occurs in the mainland Neotropics from Mexico to Brazil. Nyctinomops macrotis occurs on Cuba, Jamaica, and Hispaniola, and from the southwestern United States south to Argentina. There are no extirpated populations of N. macrotis in the West Indies, but fossils have been identified from Cuba and Hispaniola. Tadarida Tadarida brasiliensis is one of the most widely distributed of West Indian bats, and unlike M. molossus, does occur throughout the Bahamas. Tadarida brasiliensis roosts in caves on most Antillean islands, and thus is fairly common in fossil deposits. There are only two locally extinct populations of T. brasiliensis in the West Indies, from New Providence and Grand Caicos.

CHIROPTERAN EXTINCTIONS IN THE WEST INDIES CAUSES

OF

EXTINCTIONS

Morgan and Woods (1986) reviewed the extensive extinctions that have decimated the mammalian fauna of the West Indies since the end of the Pleistocene. Among the 76 species of terrestrial mammals (i.e., non-bats) recorded from the late Quaternary of the West Indies, only nine species survive to the present time, including five species from Cuba — four species of capromyid rodents, Capromys melanurus, C. nanus, C. pilorides, and C. prehensilis, and the primitive solenodontid insectivore Solenodon cubanus; two species from Hispaniola — the capromyid Plagiodontia aedium and the solenodontid S. paradoxus; one species from Jamaica — the capromyid Geocapromys brownii; and one species from East Plana Cay in the Bahamas — the capromyid G. ingrahami. There are five other recently extinct mammals (i.e., species that originally were described from living animals) that have disappeared only within the past 100 years or so. Their extinction was almost certainly caused by humans or introduced mammals (e.g., dogs, cats, mongoose, rats). These recently extinct species include the capromyid rodent G. thoracatus from Little Swan Island and four murid rodents, Oryzomys antillarum from Jamaica, O. victus from St. Vincent, and the giant rice rats, Megalomys desmaresti from Martinique and M. luciae from St. Lucia (Morgan, 1985b, 1993; Morgan and Woods, 1986). The remaining 62 species of West Indian land mammals went extinct during the Late Quaternary, sometime between the last interglacial (about 130 ka) and the first appearance of Europeans about 500 years ago. Some of these extinctions were unrelated to humans, as they occurred prior to the first arrival of Amerindians in the West Indies about 7000 years BP (Rouse, 1989). Examples of these earlier prehuman extinctions are the giant rodent Amblyrhiza inundata from Anguilla in the Lesser Antilles (McFarlane et al., 1998) and the large rodents Clidomys osborni and C. parvus from Jamaica (Morgan and Woods, 1986; MacPhee et al., 1989; Morgan, 1993; McFarlane et al., 1998). Most terrestrial mammal extinctions and all of the bat extinctions in the West Indies fall into the time period in the late Pleistocene and Holocene where a number of causes of extinction may be applicable. The following paragraphs will explore the

Patterns of Extinction in West Indian Bats

395

causes of extinction that help to explain the disappearance of six species of bats in the West Indies and the local extinction of 21 other species of bats. Unlike many of the land mammals that went extinct in the West Indies during the late Quaternary, bats were not hunted by aboriginal peoples. Bats rarely appear in Amerindian kitchen midden sites in the West Indies, and then probably only incidentally (Wing and Reitz, 1982). It is also unlikely that predation by introduced mammals had a detrimental effect on bats in the West Indies, as these species rarely prey on bats. Environmental degradation probably had little influence on bats prior to the past 50 years. Nonhuman factors (e.g., climatic change) were primarily responsible for the extensive late Quaternary extinctions of Antillean bats. The Recent and late Quaternary chiropteran fauna of the West Indies is composed of 57 species, which includes 47 species that still inhabit the region, six extinct species, and four species that are now restricted to the mainland of North America and/or South America. There are 17 additional species that still occur in the West Indies, but have suffered local extinction on certain islands, with a consequent reduction in their geographical range. In all, 27 species of bats recorded from West Indian late Quaternary fossil deposits are either extinct or have undergone local extinction or extirpation, constituting 47% of the fauna. Among the 27 species of bats that have suffered extinctions, 17 species (63%) are specialized or obligate cave-dwelling bats (including all members of the Mormoopidae, Natalidae, Brachyphyllinae, and Phyllonycterinae, as well as the glossophagine phyllostomid Monophyllus) that roost in hot, humid chambers deep within large caves (Silva and Pine, 1969; Goodwin, 1970). The roosting preferences of totally extinct species are presumed to be similar to those of their closest surviving relatives (e.g., the extinct mormoopids Mormoops magna and Pteronotus pristinus and the phyllonycterine Phyllonycteris major are considered to have been obligate cave dwellers, as all living members of these two groups roost exclusively in caves). These figures are even more striking when total extinction events are analyzed; 52 of the 69 (75%) recorded chiropteran extinction events in the West Indies involved obligate cavernicolous bats. Five of the remaining ten species of bats that underwent extinctions, representing 11 extinction events, are facultative cave dwellers (i.e, they generally roost near the entrance in small dimly lit caves, but often roost outside of caves in hollow trees, under rock overhangs, in buildings, under bridges, etc.). Five additional species, representing six extinction events, are tree-roosting bats. There are two probable explanations for the widespread extinctions of cave-dwelling bats in the West Indies: (1) There has been a change in the size and occurrence of caves resulting from the postglacial rise in sea level and the flooding of low-lying areas. (2) Cave environments on some islands have been altered since the late Pleistocene, probably reflecting overall climatic change. Both of these factors probably contributed to the local extinction of cave-dwelling bats on small islands in the West Indies such as the Bahamas and Cayman Islands. Bat extinctions on the Greater Antilles were more likely related to changes in cave environments. Extinctions of cave-dwelling bats occurred throughout the West Indies in the late Pleistocene and Holocene, most notably on Cuba and on numerous smaller islands including Isla de Pinos, Gonâve, Bahamas, Cayman Islands, and several islands in the northern Lesser Antilles. Five groups of bats were particularly susceptible to these extinctions, including mormoopids, natalids, brachyphyllines, phyllonycterines, and glossophagines. Most of these bats are not only obligate cave dwellers, but also prefer specialized cave environments. There are two general types of microenvironments in West Indian caves (Silva and Pine, 1969). The first type or variable microenvironment is found in caves that are small in size or have many openings, are often dimly lit, and have variable temperature and humidity. The caves found on most small islands in the West Indies are characterized by a variable microclimate. The second type or stable microenvironment is usually found deep within large caves and is characterized by complete darkness and limited airflow. The stable microenvironment is subdivided into two phases, the hot phase with high temperature and humidity (“hot caves” or cuevas calientes of Silva, 1979) and the temperate phase with somewhat milder temperatures and lower humidity.

396

Biogeography of the West Indies: Patterns and Perspectives

In Cuba, the bats that favor the hot, climatically stable portions of large caves include four mormoopids (Mormoops blainvillii, Pteronotus macleayii, P. parnellii, and P. quadridens), the brachyphylline Brachyphylla nana and the phylloncyterines Phyllonycteris poeyi and Erophylla sezekorni. Two species of natalids, Natalus micropus and Nyctiellus lepidus, and the glossophagine Monophyllus redmani are found in more temperate, but stable portions of caves (Silva and Pine, 1969). All of these specialized cave-dwelling bats, along with one extinct and one extirpated species of Mormoops (M. magna and M. megalophylla, respectively), an extinct species of Pteronotus (P. pristinus), and an extirpated species of Natalus (N. major), were identified from two cave fossil deposits in central Cuba, Masones Cave and Jagüey Cave (Silva, 1974). These correspond to the “type D” fossil deposits of Woloszyn and Silva (1977), which are dominated by bats found in the stable cave microenvironment. Goodwin (1970) described the ecology of the bat fauna from St. Clair Cave, Jamaica, an extensive cave system in which chambers deep within the cave exhibit the hot phase of the stable microenvironment. Nine species of bats were found roosting in St. Clair Cave about 1500 m from the entrance. Airflow in this portion of the cave was negligible, temperature was 30°C, relative humidity was near 100%, and the air was permeated with the smell of hydrogen sulfide generated by the decaying bat guano. The bats occupying this hot, humid environment in St. Clair Cave were Mormoops blainvillii, Pteronotus macleayii, P. parnellii, P. quadridens, Phyllonycteris aphylla, Erophylla sezekorni, Monophyllus redmani, Natalus major, and N. micropus. With several exceptions, these are the same species found in cuevas calientes in Cuba (Silva and Pine, 1969; Silva, 1979). Phyllonycteris aphylla of Jamaica is replaced by the closely related P. poeyi in Cuba and N. major is extinct in Cuba. The natalids and M. redmani are found in the hot phase in St. Clair Cave, but occur in the temperate phase in Cuban caves. The specialized cave-dwelling bats that roost in the stable microenvironment in large caves in Cuba and Jamaica include almost all of the species that suffered local extinctions in the Bahamas and Cayman Islands (Table 1). All nine of the bats found in the hot phase in St. Clair Cave, Jamaica, or closely related congeners in the case of N. tumidifrons and P. poeyi, occur in fossil deposits on New Providence, Bahamas (Morgan, 1989). Remarkably, only one of these nine species, Erophylla sezekorni, still inhabits New Providence. The four bats that have undergone local extinction on Grand Cayman, Pteronotus parnellii, M. redmani, N. major, and N. micropus, are all found in St. Clair Cave. The concentration of extinctions in the West Indies among bats that roost in the hot phase of the stable cave microenvironment is certainly not coincidental and must reflect a significant change either in the size and distribution of caves or in their microenvironments, particularly on small islands where these local extinctions are most evident. Among the five major groups of Antillean cave-dwelling bats, the Mormoopidae and Natalidae have suffered the most numerous extinctions. All eight species of West Indian mormoopids listed in Table 1 have sustained some level of extinction: three species are extinct (Mormoops magna, Pteronotus pristinus, and a large undescribed Pteronotus), one species is extinct in the West Indies (M. megalophylla, known from five extinct populations in the West Indies), and four species are represented by one or more locally extinct populations (number of extinctions follows the species name), but still survive in the Greater Antilles (M. blainvillii, seven; P. parnellii, six; P. quadridens, three; P. macleayii, one). Mormoopids no longer occur in the northern Lesser Antilles, although two Greater Antillean members of this family, M. blainvillii and P. parnellii, have been identified from a fossil deposit in Antigua and M. blainvillii is also known from Anguilla and Barbuda. Four of the five species of natalids listed in Table 1 have undergone local extinctions (number of extinctions follows the species name) in the West Indies (N. major, seven, N. tumidifrons, two; N. micropus, one; Nyctiellus lepidus, one). Local extinctions of natalids were concentrated in the Greater Antillean region, with most occurring in the Bahamas and on Grand Cayman (Table 1). The only natalid to have disappeared from a Greater Antillean island is Natalus major, which is locally extinct in Cuba and on Isla de Pinos. Natalids are conspicuously absent from the Recent

Patterns of Extinction in West Indian Bats

397

and fossil fauna of Puerto Rico. The other three islands in the Greater Antilles each support two living species of natalids. Brachyphyllines and phyllonycterines underwent fewer extinctions than did mormoopids and natalids, but there is one extinct species in this group, Phyllonycteris major, and there are several locally extinct populations of P. poeyi and Brachyphylla nana. Phyllonycteris major originally was described from fossil deposits in Puerto Rico (Anthony, 1917b) and since was identified from Burma Quarry in Antigua (Pregill et al., 1988, 1994). Phyllonycteris poeyi has disappeared from Cayman Brac (Morgan, 1994a), Abaco, and New Providence (Morgan, 1989). Brachyphylla nana went extinct on Jamaica, Cayman Brac, Andros, and New Providence. Among the four species of Antillean glossophagine nectar bats, both species of Monophyllus have suffered local extinctions. Monophyllus plethodon, a Lesser Antillean species in the Recent fauna, is known from an extinct population on Puerto Rico. The Greater Antillean species, M. redmani, is represented by five extinct populations on small islands in the Greater Antillean region, including Gonâve, Abaco, Andros, New Providence, and Grand Cayman. The ten other species of bats that have undergone extinctions in the West Indies are not obligate cave dwellers. These ten species account for 37% of the bats that suffered extinctions in the West Indies, but only 25% of the total extinction events. They include two phyllostomines (Macrotus waterhousii and Tonatia saurophila), three stenodermatines (Artibeus anthonyi, Phyllops falcatus, and P. vetus), one desmodontine (Desmodus rotundus), three vespertilionids (Eptesicus fuscus, Lasiurus intermedius, and Myotis austroriparius), and one molossid (Tadarida brasiliensis). Half of these bats no longer occur in the West Indies: A. anthonyi and P. vetus are extinct; T. saurophila and D. rotundus survive in the Neotropical region; and M. austroriparius occurs in the Nearctic region. Macrotus waterhousii, D. rotundus, E. fuscus, Myotis austroriparius, and T. brasiliensis are facultative cave dwellers that generally roost in small caves with a variable microclimate, but often roost outside of caves in buildings or in hollow trees. Tadarida saurophila roosts primarily in hollow trees (Goodwin and Greenhall, 1961). Phyllops falcatus and L. intermedius roost in the foliage of trees, as likely did the extinct species, A. anthonyi and P. vetus, based on the roosting habits of their closest living relatives, A. lituratus and P. falcatus, respectively. The extinctions/extirpations of the 17 species of specialized cave-dwelling bats in the West Indies are almost certainly related to changes in the size, distribution, and ecology of caves. However, the extinctions among the ten other species of bats that are either facultative cave dwellers or roost in trees are more difficult to explain, and probably resulted from a variety of causes. The disappearance of the vampire bat, D. rotundus, from Cuba probably was related to the extinction of its primary “prey,” ground sloths of the family Megalonychidae (Koopman, 1958; Woloszyn and Mayo, 1974), the only large terrestrial mammals known from late Quaternary fossil deposits in Cuba. Artibeus anthonyi and P. vetus are the only extinct species of frugivorous bats in the Antillean fossil record. Artibeus anthonyi is a large bat similar in size to the mainland species A. lituratus, whereas P. vetus is a small bat about the same size as the extant P. falcatus from Cuba. It is curious that there were two small, sympatric stenodermatines (P. vetus and P. falcatus) in Cuba during the late Quaternary, as no other Antillean island is known to support more than one member of the Stenoderma group in either the Recent or late Quaternary fauna. The limited number of documented extinctions/extirpations of stenodermatine fruit bats in the Antillean fossil record may be related to their tree-roosting habits, as arboreal mammals in tropical regions tend to have a poor fossil record. However, certain Antillean cave deposits contain large samples of stenodermatines (e.g., P. falcatus from Cerro de San Francisco in the Dominican Republic), presumably resulting from predation by barn owls. There are just two phyllostomines in the West Indies, the extant species, Macrotus waterhousii, represented by six locally extinct populations, especially in the northern Lesser Antilles, and one extirpated species, Tonatia saurophila, known only from fossil deposits in Jamaica. Phyllostomines clearly exhibited a tendency for undergoing local extinctions in the West Indies, although the reason for this is unclear.

398

Biogeography of the West Indies: Patterns and Perspectives

ISLAND EXTINCTION PATTERNS BAHAMAS Fossil deposits in the Bahamas record the most extensive chiropteran extinctions of any islands in the West Indies. Among the 15 species of bats identified from late Quaternary cave deposits in the Bahamas, eight species are no longer found anywhere in that island group. None of these species are extinct; six still survive in the Greater Antilles and Mormoops megalophylla and Myotis austroriparius are found on the mainland. Six additional species have undergone local extinction on one or more islands in the Bahamas, but still occur elsewhere in the Bahamas archipelago. Erophylla sezekorni and Eptesicus fuscus are the only species of bats known from the Bahamian fossil record that are not represented by at least one locally extinct population. Most of the fossil bats from the Bahamas have been identified from cave deposits on three islands: 13 species are known from New Providence, 12 species from Abaco, and 11 species from Andros (Morgan, 1989; this chapter). The Bahamas are the most extensive area of shallow submarine banks in the West Indies. Consequently, glacioeustatic changes in sea level had a much more significant affect on this island group than on any other region of the West Indies. When sea level was 120 m lower than present during the maximum extent of the last or Wisconsinan glaciation approximately 17 yBP (Bloom, 1983), most of the Bahamas were consolidated into four major islands (conforming to the presentday boundaries of the Great Bahama Bank, Little Bahama Bank, Crooked-Acklins Bank, and Caicos Bank), each exceeding 2,000 km2 in area. All islands on the Great Bahama Bank would have been connected into one large island, termed Great Bahama Island by Morgan (1989). After Cuba, Great Bahama Island was the second largest island in the West Indies in the late Pleistocene, with a land area in excess of 100,000 km2. The two major islands on the Little Bahama Bank, Abaco and Grand Bahama, were connected into a single large paleoisland in the late Pleistocene, Little Bahama Island (Morgan, 1989). Little Bahama Island was similar in size to present-day Jamaica and Puerto Rico (approximately 10,000 km2). The two large Bahamian paleoislands supported diverse chiropteran faunas in the late Pleistocene and early Holocene. The 15 species of bats recorded from late Quaternary deposits on Great Bahama Island (combined faunas from Andros and New Providence in Table 1) represent a larger fossil chiropteran fauna than is known from Puerto Rico (12 species) and only slightly smaller than the fossil bat faunas from Hispaniola (19 species) and Jamaica (20 species). In comparison, the combined Recent bat fauna of the six major islands on the Great Bahama Bank (Andros, Cat, Eleuthera, Exuma, Long, and New Providence) is seven species, and only one of the individual islands (Long) has as many as six species. Based only on two cave faunas from Abaco, Little Bahama Island had 12 species of bats in the late Quaternary, which is equivalent to the fossil bat fauna from Puerto Rico. The discovery of new cave deposits on the Little Bahama Bank, particularly on Grand Bahama where no fossils are currently known, probably will add several species to the chiropteran fauna of Little Bahama Island. The two islands on the present-day Little Bahama Bank, Abaco and Grand Bahama, have a combined Recent fauna of five species. During the late Pleistocene, Great Bahama Island and Little Bahama Island were huge platforms of porous limestone ranging up to nearly 200 m in elevation. Based on these geological conditions, coupled with a subtropical climate, it is likely that a vast karst terrain developed on these two islands. Extensive cave systems much larger than any known in the Bahamas today almost certainly occurred on Great Bahama Island and Little Bahama Island, as indicated by the former presence of an entire suite of specialized cave-dwelling bats that are now primarily restricted to hot caves in the Greater Antilles. Of the 15 species of bats recorded from late Quaternary fossil deposits on Great Bahama Island, 12 are obligate cave dwellers, including five mormoopids, three natalids, one brachyphylline, two phyllonycterines, and one glossophagine. This is comparable to the Recent fauna of cave-dwelling bats in Jamaica and Hispaniola, and includes four more cavernicolous

Patterns of Extinction in West Indian Bats

399

species than are now found in Puerto Rico. All of these groups of cavernicolous bats have tropical affinities, yet they flourished in the Bahamas during a cooler and drier period than the present (Pregill and Olson, 1981). This suggests the most important factor determining the distribution of specialized cave-dwelling bats in the West Indies may be the presence of appropriate caves for daytime roosts, in particular, large cave systems that possess the hot phase of the stable microenvironment. The diverse fossil bat faunas from Abaco, Andros, and New Providence were collected from small caves with variable microclimates that would not now be suitable for habitation by these same species. With the rise in sea level in the late Pleistocene and early Holocene, many of the large cave systems in the Bahamas became flooded, whereas other large caves probably were destroyed by erosion. The disappearance of large caves probably was responsible for the local extinction of 9 of the 12 species of obligate cave-dwelling bats recorded from late Quaternary deposits on the islands of the Great Bahama Bank and Little Bahama Bank, seven of which are extinct in the Bahamas. The postglacial rise in sea level flooded low-lying areas throughout the Bahamas, fragmenting the large islands into the approximately 20 primary islands (over 100 km2 in area) and hundreds of small cays that comprise the current geography of the Bahamas. The drastic reduction in land area that occurred over a relatively short period of time, particularly with the fragmentation of the two largest paleoislands, Great Bahama Island and Little Bahama Island, had a substantial effect on bat faunas. The disappearance of large cave systems on these paleoislands almost certainly accounted for the local extinction of certain species of cave-dwelling bats; however, the reduction in island size and lower elevations, both of which probably contributed to a decline in habitat diversity, may have played a role in some extinctions as well. Even if suitable caves for some obligate cave-dwelling bats still existed on certain islands in the Bahamas, it is highly unlikely that these small islands could support the bat diversity documented from Great Bahama Island and Little Bahama Island in the late Pleistocene and early Holocene. In their classic treatise on island biogeography, MacArthur and Wilson (1967) documented the correlation between island size and species diversity for several groups of vertebrates (e.g., amphibians, reptiles, and birds) in the West Indies and on island groups elsewhere in the world. They hypothesized that larger island size alone was not the principal factor determining higher species diversity, but that larger islands tended to have a greater number of habitats, which in turn led to higher species diversity than smaller islands. Morgan and Woods (1986) demonstrated that for most Antillean islands there is a strong correlation between island size and mammalian species diversity. The mammalian species diversity is more or less equivalent to the chiropteran species diversity in the West Indies, as only two Antillean islands, Cuba and Hispaniola, support more than one extant species of terrestrial mammal. Minor deviations from this trend usually can be explained by obvious factors. For example, among the Greater Antilles, Cuba and Jamaica have somewhat larger chiropteran faunas than are predicted from the species–area curve, whereas Hispaniola and Puerto Rico have less diverse bat faunas than predicted. Cuba and Jamaica are closer to the Neotropical mainland and thus would more likely be colonized. Predictably, both Cuba and Jamaica possess mainland species of bats not found on other Antillean islands. Hispaniola and Puerto Rico have no mainland bats that are not also found in Cuba and/or Jamaica. Compared to other West Indian islands of similar size, the individual islands in the Bahamas have fewer species of bats than would be predicted on the basis of their area alone. Furthermore, within the present-day Bahamas, there is no correlation between the size of an island and the number of species of bats known to inhabit that island (Morgan, 1989). The six major islands on the Great Bahama Bank have from four to six species of bats, with the number of species seemingly random with regard to island size. For example, Long Island, with an area of 337 km2, is the eighth largest island in the Bahamas, yet it has more species of bats (six) than any other Bahamian island. Andros, the largest island in the Bahamas with a land area of 4,144 km2, is over ten times larger than Long Island, but has only five species of bats.

400

Biogeography of the West Indies: Patterns and Perspectives

The low diversity and the randomness of the species–area curves for the Recent bat faunas on individual Bahamian islands may be biogeographical artifacts that originated with the extensive late Quaternary extinctions. Certainly, bat extinctions were more prevalent in the Bahamas during the late Quaternary than on any other West Indian islands, regardless of size. The seven extant species of bats known from the Great Bahama Bank (Macrotus waterhousii, Erophylla sezekorni, Natalus tumidifrons, Nyctiellus lepidus, Eptesicus fuscus, Lasiurus borealis, and Tadarida brasiliensis) comprise a subset of the 15 species known from fossil deposits on Great Bahama Island, with the exception of L. borealis. Lasiurus borealis may have colonized the Bahamas during the Holocene; however, the rarity of tree bats in the fossil record suggests that it probably was present in the late Quaternary, but has not yet been recorded as a fossil. The Recent bat faunas of the Great Bahama Bank islands consist primarily of widespread species with broad ecological tolerances (e.g., M. waterhousii, E rophylla sezekorni, Eptesicus fuscus, L. borealis, and T. brasiliensis) that managed to survive following the breakup of Great Bahama Island. The two other Great Bahama Bank bats are cave-dwelling natalids that have a spotty distribution in the Bahamas. Natalus tumidifrons occurs on three islands, including one Great Bahama Bank island (Andros), one Little Bahama Bank island (Abaco), and the small isolated island of San Salvador; N. lepidus occurs on four Great Bahama Bank islands (Cat, Eleuthera, Exuma, and Long). Therefore, it would appear that the history of the chiropteran faunas on the six large Great Bahama Bank islands is one of extensive extinctions during the late Quaternary, but almost no colonizations during the Holocene. The Recent faunas of these islands consist of from four to six species among the seven bats listed above, including no more than two obligate cave-dwelling bats on any island (including Erophylla sezekorni and one of the two natalids, but not both — Nyctiellus lepidus and Natalus tumidifrons are not sympatric on any island in the Bahamas). The Little Bahama Bank and Great Bahama Bank are separated from the Florida peninsula by less than 100 km, suggesting that the distance from a potential mainland source area was not an important factor in determining their bat faunas. Apparently, other factors have had a more significant influence on Recent bat species diversity (or lack thereof) in the Bahamas than has island size or proximity to the mainland. Morgan (1989) suggested that the depauperate bat faunas in the Bahamas might be related in part to their more northerly location compared to the remainder of the West Indies. The Bahamas are the only islands in the West Indies not entirely located within the tropics (more than half of the major islands in the Bahamas are north of the Tropic of Cancer). Two species of common Neotropical bats, the house bat Molossus molossus and the fruit bat Artibeus jamaicensis, are found throughout the West Indies, but are absent from most of the Bahamas, except for the limited occurrence of A. jamaicensis on four islands in the southern Bahamas (south of the Tropic of Cancer). The composition of the Bahamian late Quaternary bat fauna suggests that ecological conditions were somewhat different in the Bahamas than in the Greater Antilles. The predominant habitats on the large Bahamian paleoislands during the late Quaternary probably consisted of dry savannas and grasslands. This ecological hypothesis is supported both by the evidence of a cooler, drier climate in the Bahamas during the late Pleistocene (Pregill and Olson, 1981; Pregill, 1982) and by the presence in Banana Hole on New Providence of certain species of birds that favor open grassland or prairie habitats, but which are now extinct in the Bahamas (Olson and Hilgartner, 1982). Among the 15 species of fossil bats from Great Bahama Island, 11 are insectivorous (five mormoopids, three natalids, Macrotus waterhousii, Eptesicus fuscus, and T. brasiliensis), three are primarily pollenivorous (Brachyphylla nana, Erophylla sezekorni, and Phyllonycteris poeyi) according to Silva and Pine (1969), and one is nectarivorous (Monophyllus redmani). No strictly frugivorous bats occur in Bahamian fossil sites, even though four species of fruit bats are known from cave deposits in Cuba, which was located within 50 km of the southern edge of Great Bahama Island in the late Pleistocene (Morgan, 1989). The absence of fruit bats from the Recent and Quaternary fauna of the Great Bahama Bank and Little Bahama Bank probably results from the lack of a yearround fruit source sufficient to maintain a resident population of frugivorous bats, a factor almost certainly related to the less tropical climate of this region compared to the Greater Antilles. The

Patterns of Extinction in West Indian Bats

401

cooler, drier climate in the late Pleistocene would have been even less favorable for frugivorous bats than is the present climate of the Bahamas.

CAYMAN ISLANDS Eight species of bats currently are found on Grand Cayman (Morgan, 1994b), only two of which, Brachyphylla nana and Erophylla sezekorni, are obligate cave dwellers. Four additional species of specialized cave-roosting bats are found in late Quaternary cave deposits on Grand Cayman, Pteronotus parnellii, Natalus major, N. micropus, and Monophyllus redmani, and one additional species, Phyllonycteris poeyi, occurs as a fossil on Cayman Brac, but not Grand Cayman. This substantial extinct fauna of cavernicolous bats suggests that the Cayman Islands possessed larger cave systems in the late Quaternary than are found in the islands today. The Cayman Islands are the tops of steep-sided submarine mountains, and thus experienced only a moderate increase in land area during the late Pleistocene low sea level stand. When sea level was 120 m lower in the late Pleistocene, Grand Cayman, the largest of three Cayman Islands, would have been about 150 m in elevation (maximum of 30 m at present) and about 230 km2 in land area (a 30% increase over the current 185 km2). The Cayman fossil cave bat fauna was not nearly as extensive as that documented from late Quaternary deposits on Abaco, Andros, and New Providence. These three Bahamian islands are located on large, shallow submarine banks that became part of Greater Antilles–sized islands during the late Pleistocene low sea level stand. In particular, the Caymans did not support the large fauna of mormoopids found on Great Bahama Island, which included four species in this family not found in the Caymans (Mormoops blainvillii, M. megalophylla, Pterontous macleayii, and P. quadridens). This suggests that the diversity of mormoopids may be related to island size or the size of cave systems, or perhaps a combination of these two factors. Unlike the Bahamas, the Cayman Islands experienced several colonizations by bats during the Holocene, which mostly offset the loss of cavernicolous species. The late Quaternary bat fauna from Grand Cayman is nine species, only one fewer species than is present in the Recent fauna. However, there has been considerable faunal turnover, with the disappearance of the four cave-dwelling species mentioned above and the colonization by two frugivorous bats, Artibeus jamaicensis and Phyllops falcatus, that are absent from the fossil cave deposits. A third species present in the Recent Grand Cayman fauna, Molossus molossus, is also absent from fossil deposits, but this bat does not roost in caves and is rare as a fossil throughout the West Indies.

GREATER ANTILLES Bat extinctions on the four Greater Antilles were not as numerous as in the Bahamas and Cayman Islands, and were more likely related to climatic changes, as large cave systems with hot, climatically stable microenvironments are still found on all four of the large islands. There are seven extinct/ extirpated species of bats from Cuban late Quaternary deposits. Jamaica, Hispaniola, and Puerto Rico each has three species that are absent from the Recent fauna, although not the same three species. In comparison, two islands in the Bahamas have more locally extinct species of bats than any of the Greater Antilles, including New Providence (ten species) and Abaco (eight species), and one other island in the Bahamas, Andros (six species), and Grand Cayman (four species), have more extirpated species of bats than are found in Jamaica, Hispaniola, and Puerto Rico. There are several factors involved in the extinction of Antillean bats; however, all other things being equal, there appears to be a bias in favor of extinctions on smaller islands. Cuba has the most diverse chiropteran fauna of the Greater Antilles and also suffered the largest number of extinctions. Of the 33 species of bats known from Cuba (Table 1), 26 are extant and seven are recorded only from late Quaternary fossil deposits. Four of the seven species now extinct in Cuba, Mormoops magna, M. megalophylla, Pteronotus pristinus, and Natalus major, are specialized cave-dwelling bats, presuming that the ecological requirements of the two extinct mormoopids (M. magna and P. pristinus) were similar to the living members of the family. Silva (1974) suggested

402

Biogeography of the West Indies: Patterns and Perspectives

that cave habitats in Cuba were saturated or fully exploited by bats during the late Quaternary. The subsequent disappearance of four cavernicolous bats suggests that climatic changes may have led to changes in cave environments, limiting the number of bats that could occupy these caves. The Cuban late Quaternary fauna of seven mormoopids and three natalids was impressive, especially considering that the entire mainland Neotropical region supports only five species of mormoopids (one Mormoops and four Pteronotus) and two allopatric species of Natalus. Four species of mormoopids and two natalids still live in Cuba. The other three bats no longer found in Cuba are the presumed tree-roosting fruit bats, Artibeus anthonyi and Phyllops vetus, both extinct, and the vampire, Desmodus rotundus, a facultative cave dweller now restricted to the mainland Neotropics. Of the 24 species of bats known from Jamaica 3 no longer occur on the island, including Tonatia saurophila, M. megalophylla, and Brachyphylla nana. Mormoops megalophylla and B. nana belong to the large group of specialized cave-dwelling bats that underwent extensive local extinctions throughout the West Indies. The extinct Jamaican Tonatia saurophila represents the only West Indian record of this bat, a species now restricted to the mainland Neotropics. Hispaniola has a chiropteran fauna of 21 species, including 18 extant species and 3 species extinct on the island. The three extinct/ extirpated species include two specialized cave dwellers, M. megalophylla and an undescribed species of Pteronotus, and the tree-roosting bat Lasiurus intermedius. Puerto Rico supports only 13 species of Recent bats, the least diverse chiropteran fauna of the four Greater Antilles. Three additional species are no longer found on the island, Phyllonycteris major, Macrotus waterhousii, and Monophyllus plethodon, for a total of 16 species. The extinct P. major presumably was a specialized cave dweller, as is M. plethodon. Macrotus waterhousii roosts in caves with a variable microclimate.

NORTHERN LESSER ANTILLES Fossil bat faunas from the Lesser Antilles seem to reflect the same general extinction trends observed in the Greater Antillean region. Among the one extinct (Phyllonycteris major) and three extirpated (Mormoops blainvillii, Pteronotus parnellii, and Macrotus waterhousii) bats recorded from Lesser Antillean fossil deposits, three of the four species, Phyllonycteris major and the two mormoopids, are obligate cave dwellers. Macrotus waterhousii is a facultative cave dweller that disappeared from Puerto Rico and the northern Lesser Antilles during the late Quaternary, but suffered just two minor local extinctions in the Greater Antillean region. The four Lesser Antillean islands from which fossil bats are known (Pregill et al., 1994) are located on two large submarine banks at the northern end of the island chain, Anguilla and St. Martin on the St. Martin Bank and Antigua and Barbuda on the Antigua Bank, that coalesced into two rather sizable islands in the late Quaternary. As in the Bahamas, it appears that during the late Quaternary there were extensive cave systems on these two large paleoislands in the northern Lesser Antilles that became flooded with the postglacial rise in sea level in the late Pleistocene and early Holocene. However, it is noteworthy that three of the extirpated species, P. major, M. blainvillii, and Pteronotus parnellii, apparently survived into the late Holocene (between 2560 and 4300 years BP) on Antigua (Pregill et al., 1988).

BAT EXTINCTIONS ELSEWHERE IN THE NEOTROPICS AND IN FLORIDA Late Quaternary extinctions of cave-dwelling bats also occurred in several other areas in the Neotropical region outside the geographical scope of the present study. Tobago, a continental or land bridge island located in the southeastern corner of the Caribbean Sea (Figure 1), has rich fossil cave deposits that contain bats (Eshelman and Morgan, 1985). Robinson Crusoe Cave, a small coastal cave on the southwestern tip of Tobago, has produced large fossil samples of six species of obligate cave-dwelling bats, including five mormoopids (Mormoops megalophylla, Pteronotus davyi, P. gymnonotus, P. parnellii, and P. personatus) and the natalid Natalus tumidirostris. None of these six bats occurs in the modern fauna of Tobago, as this island has just a few small caves with a variable microclimate. Four of these bats still inhabit nearby Trinidad, whereas the closest

Patterns of Extinction in West Indian Bats

403

surviving populations of P. gymnonotus and P. personatus are in Venezuela. Mormoops megalophylla, P. davyi, P. parnellii, and N. tumidirostris have been found roosting together in the Mt. Tamana Caves in central Trinidad, which are large, dark, humid caves (Goodwin and Greenhall, 1961). Mormoopids and natalids are the same groups of bats that suffered the most extensive extinctions in the Greater and Lesser Antilles, suggesting that, as in the Bahamas, Tobago possessed extensive caves in the late Pleistocene that have since been flooded or destroyed by erosion. There is evidence for the former existence of large caves in Tobago, particularly in the cliff-forming limestones along the southwestern coast of the island. Fossils of large mammals from Robinson Crusoe Cave, including the glyptodont Glyptodon, indicate a late Pleistocene age for these deposits. The presence of glyptodonts also provides strong evidence that Tobago was connected to both Trinidad and to South America during the late Pleistocene low sea level stand. Czaplewski and Cartelle (1998) reported 27 taxa of bats from five late Pleistocene caves in Bahia, Brazil, one of which, Toca da Boa Vista, is the largest cave in Brazil with over 64 km of surveyed passageways. Fossil deposits in Toca da Boa Vista contained three species of mormoopids, M. megalophylla, P. davyi, and P. parnellii, and the natalid Natalus sp. Pteronotus davyi and P. parnellii are currently present but uncommon in northeastern Brazil, whereas M. megalophylla and Natalus are now restricted to northern South America. This cave contained large fossil samples of M. megalophylla and P. parnellii, suggestive of some West Indian fossil deposits, indicating that cave microclimates have undergone changes in South America since the late Quaternary as well. Mormoopids are currently absent from Florida, but two members of this family, M. megalophylla and P. pristinus, are known from late Pleistocene cave deposits in the southern part of the state (Morgan, 1991). Southern peninsular Florida is located less than 100 km from the western edges of both the Great Bahama Bank and Little Bahama Bank and 150 km from the northern coast of Cuba. The extinct P. pristinus is otherwise known only from Cuba (Silva, 1974). The closest extant population of M. megalophylla is in the southwestern United States, although this species did occur on Abaco and Andros in the late Quaternary. Another cave-dwelling bat currently unknown from southern Florida, Myotis austroriparius, also occurs in these same cave deposits. During the late Wisconsinan low sea level, the southern third of the Florida peninsula consisted of a massive block of porous limestone more than 100 m in elevation. It is very likely that an extensive karst terrain developed in this region during the late Pleistocene, including the presence of large cave systems. The absence of dry caves in southern Florida at the present time suggests that the disappearance of these three bats was related to the postglacial rise in sea level and the consequent flooding of these large caves (Morgan, 1991).

DISTRIBUTIONAL PATTERNS Analyzing the biogeographical affinities of the Antillean bat fauna is not simply an exercise in determining the distributional patterns of the Recent species. In the late Pleistocene and into the early Holocene, the distribution of certain species of bats in the West Indies was very different than it is at present. The most obvious example of these changing distributional patterns is the blurring of the boundary between the Greater Antillean and Lesser Antillean faunal regions. At present, the Anegada Passage forms a fairly clear zoogeographical boundary between these two regions. Only a few species of bats occur on both sides of the Anegada Passage, primarily very widespread species (e.g., Noctilio leporinus, Artibeus jamaicensis, Molossus molossus, and Tadarida brasiliensis) that are also widely distributed in the mainland Neotropics. Brachyphylla cavernarum is the only Antillean endemic bat that occurs in both the Greater and Lesser Antilles at the present time. Brachyphylla cavernarum is principally a Lesser Antillean species, but it also occurs in the Recent fauna of Puerto Rico and the Virgin Islands (Koopman, 1975). Late Quaternary fossil deposits from Puerto Rico and several islands in the northern Lesser Antilles, including Anguilla, Antigua, and Barbuda, demonstrate that this boundary has not always been so distinct. One endemic Lesser Antillean bat, Monophyllus plethodon, extended its range westward to Puerto Rico in the late

404

Biogeography of the West Indies: Patterns and Perspectives

Quaternary, while three Greater Antillean species, Mormoops blainvillii, Pteronotus parnellii, and Macrotus waterhousii, extended their ranges eastward into the northern Lesser Antilles. A fourth bat, the extinct Phyllonycteris major, was first described from Puerto Rico (Anthony, 1917) and later reported from a fossil deposit on Antigua (Pregill et al., 1988, 1994). The two other species of Phyllonycteris are endemic to the Greater Antilles, suggesting that P. major was a Puerto Rican endemic that extended its range eastward into the Lesser Antilles. Five species of bats now restricted to either the Greater or Lesser Antilles crossed the Anegada Passage in the Late Quaternary, which although not a particularly large number does constitute a significant percentage of the faunas of the small islands in the northern Lesser Antilles. Significant unstudied bat faunas are known from Anguilla and Barbuda (Pregill et al., 1994), and thus even more Greater Antillean species may be discovered on those two islands. This would not be surprising considering that these islands are located just a few hundred kilometers east of the Puerto Rican Bank. Not all of the distributional changes that affected West Indian bats between the late Quaternary and the Recent involved extinctions. Several species seem to have increased their ranges in the West Indies during this time period. Four species of bats, A. jamaicensis, Glossophaga soricina, T. brasiliensis, and Molossus molossus, are known only from surficial cave deposits in Jamaica that are probably late Holocene in age (Koopman and Williams, 1951; Williams, 1952). The antiquity of the two molossids in Jamaica is difficult to evaluate as members of this family are uncommon in Antillean fossil cave deposits, but the two phyllostomids, in particular A. jamaicensis, are common cave dwellers that should have appeared in older cave deposits, if indeed they inhabited the island prior to the late Holocene. Koopman and Williams (1951) and Williams (1952) hypothesized that A. jamaicensis was a late arrival to the island. Artibeus jamaicensis and Phyllops falcatus are totally absent from the numerous late Quaternary fossil cave deposits on Grand Cayman and Cayman Brac, yet these two species are common in modern barn owl deposits on the same two islands, suggesting that they dispersed to the Cayman Islands from Cuba in the late Holocene (Morgan, 1994a). Artibeus jamaicensis is not known from any fossil deposits in the northern Lesser Antilles (Pregill et al., 1994), but occurs in the Recent fauna of most of these islands (Koopman, 1989). Dates as young as 2560 years BP for the Burma Quarry in Antigua (Pregill et al., 1988) suggest that A. jamaicensis arrived on that island in the late Holocene. Perhaps a change to more mesic, forested conditions in the West Indies during the mid to late Holocene (Pregill and Olson, 1981) permitted the widespread dispersal of A. jamaicensis, and perhaps other species of bats as well.

ACKNOWLEDGMENTS First and foremost, I would like to thank my friend and colleague the late Karl F. Koopman for helping to develop my interest in bats, particularly West Indian bats. A visit to the American Museum of Natural History early in my career to identify fossil bats and other fossil vertebrates from the Cayman Islands included several days in Karl’s office studying the AMNH bat collections, using his extensive bat library, and most importantly, learning everything I possibly could on chiropteran taxonomy, morphology, and biogeography “at the wing of the master.” Thanks to this early session with Karl, and many more thereafter, I developed a fascination with the taxonomy, biogeography, and fossil history of bats that continues to this day. I wish Karl were still here so I could thank him personally. Barbara and Reed Toomey provided great help and excellent company in 1993 collecting fossil bats in Dolphin Cave on Grand Cayman. I am especially grateful to Barbara for insisting that I sample those dark, wet sediments in the back of Dolphin Cave that eventually produced thousands of bat fossils. Thanks to Ian Lothian, Rosemarie Gnam, and the Operation Raleigh Crew for helping me collect fossil and Recent bats from caves on Abaco in the Bahamas in 1989. Clayton Ray, Stanley Rand, and Eugenio Marcano collected the fossil bats from Cerro de San Francisco Cave in the Dominican Republic in 1958.

Patterns of Extinction in West Indian Bats

405

LITERATURE CITED Anderson, K. W. 1990. Bats of San Salvador Island. Bahamian Field Station, Occasional Paper Number 1:1–4. Anthony, H. E. 1917a. A new rabbit and a new bat from Neotropical regions. Bulletin of the American Museum of Natural History 37:335–337. Anthony, H. E. 1917b. Two new fossil bats from Porto Rico. Bulletin of the American Museum of Natural History 37:565–568. Anthony, H. E. 1919. Mammals collected in eastern Cuba in 1917, with descriptions of two new species. Bulletin of the American Museum of Natural History 41:625–643. Anthony, H. E. 1925. Mammals of Porto Rico, living and extinct — Chiroptera and Insectivora. New York Academy of Sciences, Scientific Survey of Porto Rico and the Virgin Islands 9:1–96. Baker, R. J. and H. H. Genoways. 1978. Zoogeography of Antillean bats. Pp. 53–97 in Gill, F. B. (ed.). Zoogeography in the Caribbean. Academy of Natural Sciences of Philadelphia, Special Publication 13. Bernstein, L. 1965. Fossil birds from the Dominican Republic. Quarterly Journal of the Florida Academy of Sciences 28:271–284. Bloom, A. L. 1983. Sea level and coastal morphology of the United States through the late Wisconsin glacial maximum. Pp. 215–229 in Porter, S. C. (ed.). Quaternary Environments of the United States. Vol. 1. The Late Pleistocene. University of Minnesota Press, Minneapolis. Brodkorb, P. 1959. Pleistocene birds from New Providence Island, Bahamas. Bulletin of the Florida State Museum 4(11):349–371. Buden, D. W. 1976. A review of the bats of the endemic West Indian genus Erophylla. Proceedings of the Biological Society of Washington 89:1–16. Buden, D. W. 1977. First records of bats of the genus Brachyphylla from the Caicos Islands, with notes on geographic variation. Journal of Mammalogy 58:221–225. Buden, D. W. 1986. Distribution of mammals of the Bahamas. Florida Field Naturalist 14:53–63. Choate, J. R. and E. C. Birney. 1968. Sub-recent Insectivora and Chiroptera from Puerto Rico, with the description of a new bat of the genus Stenoderma. Journal of Mammalogy 49:400–412. Czaplewski, N. J. and C. Cartelle. 1998. Pleistocene bats from cave deposits in Bahia, Brazil. Journal of Mammalogy 79:784–803. Dalquest, W. W. 1950. The genera of the chiropteran family Natalidae. Journal of Mammalogy 31:436–443. Eshelman, R. E. and G. S. Morgan. 1985. Tobagan Recent mammals, fossil vertebrates, and their zoogeographical implications. National Geographic Society Research Reports 21:137–143. Etheridge, R. 1965. Fossil lizards from the Domincan Republic. Quarterly Journal of the Florida Academy of Sciences 28:83–105. Etheridge, R. 1966. Pleistocene lizards from New Providence. Quarterly Journal of the Florida Academy of Sciences 28:349–358. Freeman, P. W. 1981. A multivariate study of the family Molossidae (Mammalia, Chiroptera): morphology, ecology, and evolution. Fieldiana Zoology n. s. 7:1–173. Goodwin, G. G. and A. M. Greenhall. 1961. A review of the bats of Trinidad and Tobago. Bulletin of the American Museum of Natural History 122(3):187–302. Goodwin, R. E. 1970. The ecology of Jamaican bats. Journal of Mammalogy 51:571–579. Hecht, M. K. 1955. The comparison of recent and fossil amphibian, reptilian, and mammalian faunas in the Bahamas. American Philosophical Society Yearbook for 1954:133–135. Koopman, K. F. 1951. Fossil bats from the Bahamas. Journal of Mammalogy 32:229. Koopman, K. F. 1955. A new subspecies of Chilonycteris from the West Indies, and a discussion of the mammals of La Gonâve. Journal of Mammalogy 36:109–113. Koopman, K. F. 1958. A fossil vampire bat from Cuba. Museum of Comparative Zoology. Breviora 90:1–4. Koopman, K. F. 1975. Bats of the Virgin Islands in relation of those of the Greater and Lesser Antilles. American Museum Novitates 2581:1–7. Koopman, K. F. 1976. Zoogeography. Pp. 39–47 in Biology of Bats of the New World Family Phyllostomatidae. Part I. Special Publications, The Museum, Texas Tech University 10. Koopman, K. F. 1989. A review and analysis of the bats of the West Indies. Pp. 635–644 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Koopman, K. F. 1993. Order Chiroptera. Pp. 137–241 in Wilson, D. E. and D. M. Reeder (eds.). Mammal Species of the World, a Taxonomic and Geographic Reference, 2nd ed. Smithsonian Institution Press, Washington, D.C.

406

Biogeography of the West Indies: Patterns and Perspectives

Koopman, K. F. and R. Ruibal. 1955. Cave-fossil vertebrates from Camaguey, Cuba. Museum of Comparative Zoology, Breviora 46:1–8. Koopman, K. F. and E. E. Williams. 1951. Fossil Chiroptera collected by H. E. Anthony in Jamaica, 1919–1920. American Museum Novitates 1519:1–29. Koopman, K. F., M. K. Hecht, and E. Ledecky-Janecek. 1957. Notes on the mammals of the Bahamas with special reference to the bats. Journal of Mammalogy 38:164–174. Lawrence, B. 1934. New Geocapromys from the Bahamas. Occasional Papers of the Boston Society of Natural History 8:189–196. MacArthur, R. H. and E. O. Wilson, 1967. The Theory of Island Biogeography. Princeton University Press, Princeton, New Jersey. MacPhee, R. D. E., D. C. Ford, and D. A. McFarlane. 1989. Pre-Wisconsinan mammals from Jamaica and models of late Quaternary extinction in the Greater Antilles. Quaternary Research 31:94–106. Martin, C. O. and D. J. Schmidly. 1982. Taxonomic review of the pallid bat, Antrozous pallidus (Le Conte). Special Publications, The Museum, Texas Tech University Press 18:1–48. McFarlane, D. A., R. D. E. MacPhee, and D. C. Ford. 1998a. Body size variability and a Sangamonian extinction model for Amblyrhiza, a West Indian megafaunal rodent. Quaternary Research 50:80–89. McFarlane, D. A., J. Lundberg, C. Flemming, R. D. E. MacPhee, and S.-E. Lauritzen. 1998b. A second preWisconsinan locality for the extinct Jamaican rodent Clidomys (Rodentia:Heptaxodontidae). Caribbean Journal of Science 34:315–317. McNabb, B. K. 1974. The behavior of temperate cave bats in a subtropical environment. Ecology 55:943–958. Miller, G. S., Jr. 1929a. A second collection of mammals from caves near St. Michel, Haiti. Smithsonian Miscellaneous Collections 81(9):1–30. Miller, G. S., Jr. 1929b. Mammals eaten by Indians, owls, and Spaniards in the coast region of the Dominican Republic. Smithsonian Miscellaneous Collections 82(5):1–16. Miller, G. S., Jr. 1930. Three small collections of mammals from Hispaniola. Smithsonian Miscellaneous Collections 82(15):1–10 Morgan, G. S. 1985a. Fossil bats (Mammalia: Chiroptera) from the late Pleistocene and Holocene Vero fauna, Indian River County, Florida. Brimleyana 11:97–117. Morgan, G. S. 1985b. Taxonomic status and relationships of the Swan Island hutia, Geocapromys thoracatus (Mammalia: Rodentia: Capromyidae), and the zoogeography of the Swan Islands vertebrate fauna. Proceedings of the Biological Society of Washington 98:29–46. Morgan, G. S. 1989. Fossil Chiroptera and Rodentia from the Bahamas, and the historical biogeography of the Bahamian mammal fauna. Pp. 685–740 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Morgan, G. S. 1991. Neotropical Chiroptera from the Pliocene and Pleistocene of Florida. Bulletin of the American Museum of Natural History 206:176–213. Morgan, G. S. 1993. Quaternary land vertebrates of Jamaica. Pp. 417–442 in Wright, R. M. and E. Robinson (eds.). Biostratigraphy of Jamaica. Geological Society of America Memoir 182. Morgan, G. S. 1994a. Late Quaternary fossil vertebrates from the Cayman Islands. Pp. 465–508 in Brunt, M. A. and J. E. Davies (eds.). The Cayman Islands: Natural History and Biogeography. Kluwer Academic Publishers, Dordrecht, the Netherlands. Morgan, G. S. 1994b. Mammals of the Cayman Islands. Pp. 435–463 in Brunt, M. A. and J. E. Davies (eds.). The Cayman Islands: Natural History and Biogeography. Kluwer Academic Publishers, Dordrecht, the Netherlands. Morgan, G. S. and C. A. Woods. 1986. Extinction and the zoogeography of West Indian land mammals. Biological Journal of the Linnean Society 28:167–203. Morgan, G. S. and Czaplewski, N. J. In preparation. A new bat in the Neotropical family Natalidae from the early Miocene of Florida. Olson, S. L. and W. B. Hilgartner. 1982. Fossil and subfossil birds from the Bahamas. Pp. 22–56 in Olson, S. L. (ed.). Fossil Vertebrates from the Bahamas. Smithsonian Contributions to Paleobiology 48. Orr, R. T. and G. Silva Taboada. 1960. A new species of bat of the genus Antrozous from Cuba. Proceedings of the Biological Society of Washington 73:83–86. Ottenwalder, J. A. and H. H. Genoways. 1982. Systematic review of the Antillean bats of the Natalus micropuscomplex (Chiroptera: Natalidae). Annals of Carnegie Museum 51(2):17–38.

Patterns of Extinction in West Indian Bats

407

Pregill, G. K. 1982. Fossil amphibians and reptiles from New Providence Island, Bahamas. Pp. 8–21 in Olson, S. L. (ed.), Fossil Vertebrates from the Bahamas. Smithsonian Contributions to Paleobiology 48. Pregill, G. K. and S. L. Olson. 1981. Zoogeography of West Indian vertebrates in relation to Pleistocene climatic cycles. Annual Review of Ecology and Systematics 12:75–98. Pregill, G. K., D. W. Steadman, S. L. Olson, and F. V. Grady. 1988. Late Holocene fossil vertebrates from Burma Quarry, Antigua, Lesser Antilles. Smithsonian Contributions to Zoology 463:1–27. Pregill, G. K., D. W. Steadman, and D. R. Watters. 1994. Late Quaternary vertebrate faunas of the Lesser Antilles: Historical components of Caribbean biogeography. Bulletin of the Carnegie Museum of Natural History 30:1–51. Ray, C. E., S. J. Olsen, and H. J. Gut. 1963. Three mammals new to the Pleistocene fauna of Florida, and a reconsideration of five earlier records. Journal of Mammalogy 44:373–395. Reynolds, T. E., K. F. Koopman, and E. E. Williams. 1953. A cave faunule from western Puerto Rico with a discussion of the genus Isolobodon. Museum of Comparative Zoology Breviora 12:1–7. Rouse, I. 1989. Peopling and repeopling of the West Indies. Pp. 119–136 in Woods, C. A. (ed.), Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Silva Taboada, G. 1974. Fossil Chiroptera from cave deposits in central Cuba, with description of two new species (genera Pteronotus and Mormoops) and the first West Indian record of Mormoops megalophylla. Acta Zoologica Cracoviensia 19:33–73. Silva Taboada, G. 1979. Los murciélagos de Cuba. Editorial Academia, La Habana, Cuba. Silva Taboada, G. and R. H. Pine. 1969. Morphological and behavioral evidence for the relationship between the bat genus Brachyphylla and the Phyllonycterinae. Biotropica 1:10–19. Smith, J. D. 1972. Systematics of the chiropteran family Mormoopidae. University of Kansas Museum of Natural History, Miscellaneous Publications 56:1–132. Steadman, D. W., D. R. Watters, E. J. Reitz, and G. K. Pregill. 1984. Vertebrates from archaeological sites on Montserrat, West Indies. Annals of Carnegie Museum 53:1–29. Swanepoel, P. and H. H. Genoways. 1978. Revision of the Antillean bats of the genus Brachyphylla (Mammalia: Phyllostomatidae). Bulletin of the Carnegie Museum of Natural History 12:1–53. Varona, L. S. 1974. Catálogo de los mamíferos vivientes y extinguidos de las Antillas. Academia de Ciencias de Cuba, La Habana, Cuba. Webb, S. D. and S. C. Perrigo. 1984. Late Cenozoic vertebrates from Honduras and El Salvador. Journal of Vertebrate Paleontology 4:237–254. Williams, E. E. 1952. Additional notes on fossil and subfossil bats from Jamaica. Journal of Mammalogy 33:171–179. Williams, S. L., M. R. Willig, and F. A. Reid. 1995. Review of the Tonatia bidens complex (Mammalia: Chiroptera), with descriptions of two new subspecies. Journal of Mammalogy 76:612–626. Wing, E. S. and E. J. Reitz. 1982. Prehistoric fishing economies of the Caribbean. New World Archaeology 5:13–32. Woloszyn, B. W. and N. A. Mayo. 1974. Postglacial remains of a vampire bat (Chiroptera: Desmodus) from Cuba. Acta Zoologica Cracoviensia 19:253–265. Woloszyn, B. W. and G. Silva Taboada. 1977. Nueva especie fósil de Artibeus (Mammalia: Chiroptera) de Cuba, y tipificación preliminar de los depósitos fosilíferos cubanos contentivos de mamíferos terrestres. Poeyana 161:1–17.

Mongoose in the West 21 The Indies: The Biogeography and Population Biology of an Introduced Species G. Roy Horst, Donald B. Hoagland, and C. William Kilpatrick Abstract — The small Indian mongoose (Herpestes javanicus) was introduced into the West Indies in the early 1870s and, to date, has been spread to 29 islands. Although most of these subsequent introductions occurred prior to 1900, the source of mongooses and the date of introductions can be established for at least 12 islands. The size of the founding populations, however, can be established for only five West Indian islands. In this study, mongoose population dynamics were investigated by mark–recapture techniques on the islands of St. Croix (1983–1986; 1991–1994), Jamaica (1986), and Puerto Rico (1992–1998). Absolute identification of individual animals on St. Croix (1991–1994) and Puerto Rico (1992–1998) was made possible by surgically implanting electronic microchips. The sex ratio for populations on St. Croix and Jamaica was not significantly different from the expected 1:1; however, the Puerto Rico population was male biased probably as the result of shorter trapping episodes. Individuals from St. Croix, Jamaica, and Puerto Rico were placed in one of four age classes by tooth-wear criteria. Our early work (prior to 1991) on St. Croix and Jamaica had suggested major differences in age structure between these islands and raised some question about the validity of age determination by tooth-wear. Our more recent studies (1991–1998) using PIT tags have provided accurate information on the minimal ages of individuals, which can be compared with the age inferred from tooth-wear. Major differences were observed in the patterns of tooth-wear and hence age structure inferred from tooth-wear of populations on St. Croix and Puerto Rico. Age structure determined from minimal age of animals inferred from mark–recapture data, however, revealed no major differences in age structure between these two populations. Before tooth-wear can be used to estimate the age of individuals, each population must be examined to determine the extent of correlation between age and tooth-wear. Population densities averaged 6.4 (range 2 to 14) animals/ha on St. Croix, 2.6 (range 1 to 7) animals/ha on Jamaica, and 4.6 (range 2 to 9) animals/ha on Puerto Rico. Comparisons of these population densities of mongoose with those reported for other islands indicate an indirect correlation between population densities and island size.

INTRODUCTION The small Indian, or more properly, the small Asian mongoose, Herpestes javanicus, is an Old World carnivore that was introduced during the 19th century onto islands of the Caribbean Sea, Pacific Ocean, and other areas by owners of sugarcane plantations to control the rapidly expanding rat populations (Hoagland et al., 1989). This small carnivore has flourished in most habitats where it has been introduced. The systematics and nomenclature of the small Asian mongoose has been recently revised. Two forms, H. auropunctatus and H. javanicus, which were reported to differ in size and to occur in sympatry in Malaya (Chasen, 1940), were considered specifically distinct by Ellerman and Morrison-Scott (1951). This nomenclature has been widely followed and introduced populations have been recognized as H. auropunctatus (Hoagland et al., 1989; Nellis, 1989) since they were derived from the more northern form (H. auropunctatus). The specific name auropunctatus means gold-spotted and accurately describes the pelage of this mongoose in which the hair is short and alternately banded gray-brown and yellow, giving a speckled appearance. Wells (1989) concluded 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

409

410

Biogeography of the West Indies: Patterns and Perspectives

that in Malaya there is no evidence for sympatry and that the reported size difference between the two forms was an error due to sexual dimorphism. Consequently, these two forms have been synonymized as the small Asian mongoose (H. javanicus) (Corbet and Hill, 1992; Wozencraft, 1993) as was done by Pocock (1941) and Lekagul and McNeely (1977). Although the native range of the small Asian mongoose extends throughout southern Asia from Iraq and Iran through Pakistan, India, Nepal, and southern China to the Malaysian Peninsula (Corbet and Hill, 1992; Wozencraft, 1993), very little is known of the biology of this animal in the Old World. Most published studies concerning the ecology and population biology of H. javanicus have been conducted on introduced insular populations in the Western Hemisphere. Nellis and Everard (1983) reviewed the available literature on the food habits of the small Indian mongoose and concluded that this animal is an opportunistic, omnivorous carnivore that prefers to eat small rodents and birds. Most food habit studies, however, indicated that insects are the most common food item in mongoose stomachs (Seaman, 1952; Wolcott, 1953; Pimentel, 1955). Cavallini and Serafini (1995) found vertebrates and plant matter (mostly fruit) to dominate the winter diet of an Adriatic population and suggested that these animals are generalists. Most population studies of the small Asian mongoose, to date, have concentrated on the mongoose as a nuisance or on its role as a vector in disease transmission (Nellis and Everard, 1983). Few studies have examined the similarities and differences among various insular mongoose populations, other than indicating their densities and habitats. Hoagland et al. (1989) examined the densities of rodents and mongooses in a number of habitats on Jamaica and St. Croix and concluded that the mongoose, as a method of rodent control, had an effect only on the Norway rat. Hoagland et al. (1989) reported major differences in age structure between populations on St. Croix and Jamaica. This chapter presents the results of population biology studies of H. javanicus on the islands of St. Croix (U.S. Virgin Islands), Jamaica, and Puerto Rico. The major objectives of this chapter are (1) to review the current distribution of H. javanicus in the West Indies; (2) to reconstruct from the literature the history of the introductions of H. javanicus into the West Indies; (3) to compare and contrast the population demographics and habitats of mongoose populations on different islands; and (4) to establish more precisely the age structure of these populations.

BIOGEOGRAPHY HISTORY

OF INTRODUCTION

The first introduction of the mongoose into the West Indies is reported to have occurred in 1870 (Urich, 1914; Myers, 1931; Husson, 1960b) when an unknown number of animals from India (Urich, 1914) was introduced to Trinidad. These animals arrived by ship and some escaped in Port-of-Spain before the others were released on a sugarcane estate in the Naparimas district (Urich, 1914). The best-documented introduction of the small Asian mongoose is of nine animals, four males and five females (one of which was pregnant), that were imported from Calcutta in 1872 and arrived in Jamaica on February 13 aboard the East-Indian ship Merchantman (Espeut, 1882). These animals were released on the Spring Garden Estate and within a few months young mongooses were reported (Espeut, 1882). This event may represent the only successful New World introduction of mongooses from the Old World. Espeut (1882) indicated that several other Jamaican planters obtained mongooses from India, but the animals were few in number and in some cases were known to have died without leaving progeny. Mongooses were trapped on the Spring Garden Estate and sold to other Jamaican planters. Espeut and other planters sent animals to Cuba, Puerto Rico, Grenada, Barbados, and Santa Cruz (Trinidad) (Espeut, 1882). From 1870 to 1898 little was reported of the mongooses on Trinidad, although Urich (1914) suggested the possibility of additional introduction. According to Urich (1914), the Proceedings of

The Mongoose in the West Indies

411

TABLE 1 History of Introductions of the Small Asian Mongoose Introduced Population

Date of Introduction

Origin

No.

Ref.a

Trinidad

1870 by 1882 1872 1882–1884 1910 or 1952 1882 by 1895 1877 1885–1889 1876–1879 1880–1885 1889 1884 by 1899 by 1900 by 1900 1882 by 1899 by 1900 by 1900 by 1900 by 1900 by 1900 by 1900 1920–1925

India Jamaica India Jamaica St. Croix Jamaica Jamaica Jamaica Guadeloupe Jamaica (Jamaica) (Jamaica) Jamaica Jamaica (Jamaica) (Barbados) Jamaica (Puerto Rico) ? ? (Guadeloupe) (Jamaica) (Jamaica) (Guadeloupe) Jamaica

? 5 9 4–8 4 (20) ? (20) (20) 14 ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?

1, 2, 3, 4 3 5 5, 6 7, 19 5, 8 9 9, 10, 11 12 5, 9, 13, 14 5, 12 15 16 10 9, 17 9, 17 18 10 4, 17 18 17, 18 4, 17 4, 17 4, 17 20

Jamaica St. Croix Buck Island Barbados Hispaniola Puerto Rico St. Martin Grenada Guadeloupe Martinique St. Kitts St. Thomas St. Vincent St. Lucia Cuba Vieques Tortola Carriacou Desirade Nevis Antigua Marie Galante Goat Island

Note: Information in parentheses is inferred from references. a

References: (1) Husson, 1960a; (2) Myers, 1931; (3) Urich, 1914; (4) Westerman, 1953; (5) Espeut, 1882; (6) Heyliger, 1884; (7) Nellis et al., 1978; (8) Feilden, 1890; (9) Allen, 1911; (10) Palmer, 1898; (11) Colon, 1930; (12) Husson, 1960b; (13) Groome, 1970; (14) Jonkers et al., 1969; (15) Hill, 1899; (16) Burdon, 1920; (17) Hinton and Dunn, 1967; (18) Barbour, 1930; (19) Nellis and Everard, 1983; (20) Lewis, 1944.

the Agriculture Society of Trinidad records a letter objecting to an introduction of five mongooses to Santa Cruz, Trinidad, in 1898. First, it seems likely that the five Santa Cruz specimens mentioned in the Proceedings of the Agriculture Society of Trinidad are the animals from Jamaica identified by Espeut (1882). Introduction of the mongooses to Santa Cruz thus appears to have occurred by 1882. Second, the reports of animals being obtained from Jamaica for introduction to Santa Cruz and the lack of reports on the mongoose in Trinidad between 1870 and 1898 indicates that the earlier introductions of the mongoose to Trinidad may not have been successful. Between 1876 and 1879, seven pairs of mongooses from Jamaica were introduced to Grenada (Allen, 1911; Jonkers et al., 1969; Groome, 1970). Two to four pairs of mongooses from Jamaica were also introduced to St. Croix between 1882 and 1884 (Heyliger, 1884). Additional introduction of mongooses from Jamaica to Barbados, Hispaniola, Puerto Rico, St. Kitts, St. Thomas, and Cuba occurred between 1877 and 1899 (Table 1). Jamaica was also probably the source of mongooses introduced to Guadeloupe, Martinique, St. Vincent, Nevis, and Antigua (Table 1). Mongooses from Jamaica were introduced to Goat Island between 1920 and 1925, according to Lewis (1944).

412

Biogeography of the West Indies: Patterns and Perspectives

Guadeloupe was the source of mongooses introduced to St. Martin and probably Desirade and Marie Galante (Table 1). Barbados and Puerto Rico were the probable sources of animals introduced to St. Lucia and Vieques, respectively (Palmer, 1898; Hinton and Dunn, 1967). The mongoose population inhabiting Buck Island was introduced from St. Croix either in 1910 (Nellis and Everard, 1983) or in 1952 (Nellis et al., 1978). Mongooses from Jamaica have also been introduced to Hawaii (Palmer, 1898; Bryan, 1915; Kramer, 1971), Fiji (Gorman, 1975), British Guiana (Westerman, 1953; Hinton and Dunn, 1967), and Colombia (Seaman, 1952). The mongooses in Suriname were reportedly imported from Barbados (Husson, 1960a; Husson, 1978). Genetic variation and genetic structure of five introduced insular populations of the small Asian mongoose were examined by Hoagland and Kilpatrick (1999). Levels of average heterozygosity were comparable to those reported for other mammals and were not significantly different among populations with founding sizes ranging from 4 to approximately 300 individuals. Although the initial founding of the Jamaican population likely did not contain all of the alleles present in native populations of the small Asian mongoose, further reduction in genetic variability due to additional founding events is not evident. This absence of observed reduction of genetic variation with subsequent founder events was explained by the absence of rare alleles in the source populations (Jamaica or Hawaii) and by rapid population growth of the introduced populations.

CURRENT DISTRIBUTION By 1882, 10 years after the small Asian mongoose had been introduced onto Jamaica, the population had increased greatly and became a source for other introductions (Espeut, 1882). Allen (1911) reported the mongoose was present on 11 islands of the West Indies (Table 2), extending its known distribution in the West Indies to the islands of St. Lucia, St. Vincent, St. Thomas, St. Croix, Vieques, and Hispaniola. Barbour (1930) not only indicated 17 islands on which the mongoose was known to occur in the West Indies (Table 2) but also listed a number of islands, including Water Island, Jost van Dyke, Tobago, and others, as free of the mongoose. The mongoose was reported by Barbour (1930) to occur on seven additional West Indian islands (Tortola, St. Kitts, Nevis, Antigua, Guadaloupe, Maria Galante, and Martinique), probably to occur on Desirade, and possibly on St. Martin. He also reported two unsuccessful attempts to introduce the mongoose to Dominica in the 1880s, once when the animals died in transit and again when ten mongooses were introduced to northern Dominica, but perished. Varona (1974) listed 21 islands of the West Indies where the mongoose occurs (Table 2). In addition to the 18 islands reported by Allen (1911) and Barbour (1930) as supporting mongoose populations, Varona (1974) reported the distribution of the mongoose to include the islands of St. John, St. Martin, and Desirade. Nellis and Everard (1983) list 27 islands on which the mongoose occurs (Table 2) and 38 islands from which the mongoose was absent. They reported that the mongoose now occurs on Water Island and Jost van Dyke, although Barbour (1930) had reported these islands were free of the mongoose. Three additional islands (Buck Island, Beef Island, and Louango) were reported by Nellis and Everard (1983) to support mongoose populations in addition to the 21 islands reported by Varona (1974) and Trinidad reported by Espeut (1882). The mongoose is also known to inhabit Goat Island (Jamaica) (Lewis, 1944) and Gonâve (Hispaniola) (C. A. Woods, personal communication). The small Asian mongoose at present occurs on all islands of the Greater Antilles, 20 islands of the Lesser Antilles, and five small islands near larger islands that support mongoose populations. This carnivore has also been introduced and at present occurs in Surinam (Husson, 1960a, 1978), Guyana (Westerman, 1953; Hinton and Dunn, 1967), French Guiana (Hinton and Dunn, 1967), and Colombia (Seaman, 1952). In addition, the mongoose reportedly has also been been introduced into Panama (West, 1972) and stray animals have been captured in Florida (Nellis et al., 1978) and Kentucky

The Mongoose in the West Indies

413

TABLE 2 Reported Distribution of the Mongoose Herpestes javanicus in the West Indies Island Cuba Jamaica Hispaniola Puerto Rico Vieques St. Thomas Water Island St. John Jost van Dyke St. Croix Buck Island Tortola St. Martin St. Kitts Nevis Antigua Guadalupe La Desirade Maria Galante Dominica Martinique St. Lucia St. Vincent Grenada Barbados Trinidad Beef Island Lovango Total a b

Allen (1911)

Barbour (1930)

Varona (1974)

Nellis and Everard (1983)

+ + + + + +

+ + + +

+ + + + + +

+ + + + + + + + + + + + + + + + + + + – + + + + + + + + 27

+ –

+ +

– +

+

+ + + +

+ ? + + + + ? + +b + + + + +

+ + + + + + +a + +b + + + + +

11

17

21

Deseada. Introduction unsuccessful.

(Jackson, 1921). Introduced populations are also known to occur on the Hawaiian Islands of Hawaii, Maui, Molokai, Oahu, and the two small islands of Mokuoleo and Ford near Oahu (Tomich, 1969a), on the Fijian Island of Viti Levu (Gorman, 1975), on the Adriatic Island of Korcula (Croatia) (Tvrtkovic and Krystufek, 1990), on Mafia (Tanzania) (Nellis, 1989), on Mauritius (Corbet and Hill, 1992), on Ambon (Moluccas) (Corbet and Hill, 1992), and on Okinawa, Japan (Wozencraft, 1993).

POPULATION BIOLOGY METHODS Mongoose population dynamics were investigated by recapture techniques on St. Croix, U.S. Virgin Islands, from 1983 to 1986 and again from 1991 to 1994, on Puerto Rico from 1992 to 1998, and on Jamaica in 1986. Details of the trapping methods and trapping periods used for the earlier work (1983–1986) were described by Hoagland et al. (1989). The second study on St. Croix and the study on Puerto Rico used trap lines rather than grids because there was no significant difference

414

Biogeography of the West Indies: Patterns and Perspectives

in trapping results using either method and trap lines were more efficient. Mongooses were captured with Tomahawk live traps (15 × 15 × 45 cm) baited with fish or chicken parts. Traps were checked daily in the morning (08:00 to 11:00) and again in the late afternoon (15:00 to 18:00). The site at which an animal was captured was recorded and the trap with animal was transported to a central processing area. The ears of each animal were carefully examined for evidence of previous marking from our earlier study (Hoagland et al., 1989). Each mongoose caught was weighed, sexed, and assigned to an age class according to tooth-wear criteria (Pearson and Baldwin, 1953) and eye color. Age class 1 consists of juveniles, which generally are less than 1 year of age. All teeth are sharp, eyes are blue-gray to green, and body weight is generally below 200 g. Testes are not descended in males and nipples are minute in females. All other age classes have orange eyes, are sexually mature adults, and are differentiated by relative tooth-wear. Animals in age class 2 correspond to Pearson and Baldwin’s (1953) age class 2 and are characterized by sharp or slightly rounded teeth and distinct cusps on the first molars. Animals in age class 3 correspond to Pearson and Baldwin’s age classes 3 to 6 and are characterized by worn and rounded teeth, blunt or “flattopped” canines, and an absence of cusps on the first molars. Mongooses in age class 4 correspond to Pearson and Baldwin’s age classes 7 and 8 and are characterized by badly worn, broken, and missing teeth. Females were checked visually for evidence of pregnancy or lactation and the general condition of each animal was noted, such observations as rough, dirty, or unkept pelage; undernourished; diarrhea; or other signs of poor health. In an attempt to resolve the differences in age structure (inferred from tooth-wear) among islands (Hoagland et al., 1989), we initiated an extensive trapping program using a passive integrated transponders (PIT) tag marking method in conjunction with tooth-wear evaluation on populations as nearly identical as possible on St. Croix from 1991 to 1994 and on Puerto Rico from 1992 to 1998. Captured mongooses were marked with PIT tags. Permanent electronic identification tags (®Biosonics, Seattle, WA and Destron/IDI, Boulder, CO) were surgically implanted into the subcutaneous connective tissue of the left inguinal region of mongooses tranquilized with ketamine hydrochloride (10 mg/kg)(Ketaset™). These implants have been shown to be totally innocuous in an extensive evaluation by Ball et al. (1990). Recovery from the tranquilizer was usually complete within 10 to 30 min and the animals were released 4 to 24 h later at the site of capture. Subsequently captured mongooses were checked for a PIT tag with a microchip reader and either marked with a PIT tag or the identification recorded if already marked. Both the St. Croix (1991–1994) and the Puerto Rico populations were sampled at intervals from 4 to 12 months. Each sampling episode was 5 to 13 days long. A total of 237 animals were PIT-tagged on Puerto Rico and 246 tagged on St. Croix. After eliminating from our PIT tag mark–recapture data those animals captured only once (tagged and never recovered), those captured late in the study as juveniles and never recovered again as adults, and those captured again but in the same sampling episode, the remaining data were used to estimate an absolute minimal age by assuming an animal was the age indicated by its tooth-wear at the time it was first captured. The time between a subsequent capture was added to the initial tooth-wear estimate age to determine the minimal age. Absolute minimal age could be determined for 79 animals on St. Croix and 80 animals on Puerto Rico. This includes 12 juveniles (presence of deciduous teeth) from St. Croix and 8 juveniles from Puerto Rico (Table 3). Minimal age for mongooses first captured as juveniles was taken simply as the time period between the first and last captures. All other animals for which minimal age was estimated had class 2 teeth when initially captured and were assumed to be no less than 1 year of age at that time. Correlation analysis between tooth-wear and minimal known age was used to examine the utility of tooth-wear in estimating age. Population sizes and their standard errors for each grid were estimated by the Lincoln Index, Fisher-Ford model, Jolly-Seber stochastic model, and Bailey’s model (Bailey, 1951; Begon, 1979; Blower et al., 1981; Seber, 1982). Significant deviations from an expected 1:1 sex ratio were tested by Fisher’s exact probability or Yate’s corrected chi-square.

The Mongoose in the West Indies

415

TABLE 3 Minimal Age Estimate of Mongooses Captured and Marked as Juveniles First Capture PIT Tag Number

Sex

Date

Weight (g)

DOBO6 D5135 D6735 D613D D535A D621B D6013 E2D23 D5129 5321C D631D 35E18

F M M M F F M M F M M F

92-01-05 92-05-31 92-06-03 92-06-06 92-08-03 92-08-04 92-08-07 92-08-07 92-08-09 93-07-20 93-07-20 93-07-24

220 190 220 140 420 190 210 300 130 400 340 250

32308 34B58 41B38 82F4F D2509 E131A E346E E4751

M F M F M M M F

91-04-04 96-01-02 91-04-03 91-04-06 92-08-16 91-04-04 92-01-09 96-01-05

420 350 430 380 260 430 480 350

a

Last Capture Weight (g)

Tooth Weara

Minimal Age (months)

St. Croix 1 94-01-10 1 93-07-24 1 93-01-16 1 93-01-16 1 94-01-11 1 93-01-09 1 94-01-12 1 94-01-14 1 94-01-14 1 94-01-09 1 94-01-13 1 94-01-09

440 580 560 460 480 320 880 480 460 580 480 380

3 2 2 2 2 2 2 2 2 2 2 2

25 15 8 8 18 6 18 18 18 6 6 6

Puerto Rico 1 92-08-17 1 96-05-27 1 91-08-10 1 98-01-15 1 98-01-12 1 92-01-11 1 94-01-02 1 97-01-12

700 400 600 560 840 700 740 550

2 2 2 2 2 2 2 2

18 6 5 81 65 10 24 13

Tooth Weara

Date

Age class (see text).

Description of habitats sampled on St. Croix and Jamaica was provided by Hoagland et al. (1989). Subsequent work on St. Croix (1991–1994) has been concentrated in the thorn-scrub, back beach identified as the West End (actually the Sandy Point Wildlife Refuge) in Hoagland et al. (1989). Work in Puerto Rico has been performed at the Cabo Rojo Wildlife Refuge located at the extreme southwest end of the island 8 km from Boqueron. The refuge consists of approximately 290 ha at an elevation of 1 to 17 m, at latitude 21° N and 66° W. This parcel of land was acquired by the U.S. government in 1942 and was the site of a large radio intelligence operation before becoming a wildlife refuge. The entire property was securely fenced and what was mixed farmland and pasture has been allowed to enter secondary succession. This succession has been in progress for 5 decades, disturbed only by occasional grass fires, which were extinguished as quickly as possible. As a result the site is now mixed grassland and thornbush forest dominated by several exotic species of acacia (Acacia ssp., Prosopsis juliflora) interspersed with more open meadows now dominated by several species of exotic bunchgrass (Panicum maximum) as well as large patches of short thin turf grass (Dicanthium annulatum). The refuge contains three artificial ponds each less than 1 ha in area and less than 1 m deep. Two of these ponds have contained at least some water continuously for the past decade, the third contains little or no water during the dry season. Rainfall varies from year to year. The most precipitation occurs from September to January, with relatively little precipitation from March to June. Temperature ranges between 21 and 38°C. Both the St. Croix and Puerto Rico sites are less than 1 km from the open sea and are regularly ravaged by tropical storms ranging from mildly severe to the extreme of Hurricane Hugo. Even though both

416

Biogeography of the West Indies: Patterns and Perspectives

of these refuges are open to the public, trapping operations were never disturbed as the refuge receives minimal visitation (rarely more than two or three birdwatchers a day).

SEX RATIO AND AGE DISTRIBUTION Hoagland et al. (1989) reported a female:male sex ratio of 272:300 on St. Croix and equal distribution of males and females in the sample of 104 individuals from Jamaica. Of the 246 mongooses captured on St. Croix between 1991 and 1994, 121 were female and 125 were male. The estimated sex ratios from each of these three samples does not differ significantly from an expected sex ratio of 1:1. Of the 237 individuals captured on Puerto Rico, 94 were female and 143 were males. This is a significant deviation from the expected. Numerous studies have reported male-biased sex ratios in introduced insular mongoose populations (Baldwin et al., 1952; Pearson and Baldwin, 1953; Pimental, 1955; Tomich, 1969b; Nellis and Everard, 1983; Coblentz and Coblentz, 1985), yet the statistical significance of those biases was reported only for the St. John, U.S. Virgin Islands, population (Coblentz and Coblentz, 1985). Generally, the greater male bias in those studies was produced by removal trapping, whereas mark–recapture trapping yielded sex ratios closer to 1:1. In the St. John study, the authors found the first few months of removal trapping produced significantly more males, but later months yielded significantly more females. The greater male bias produced by removal trapping might be explained by the greater average distance normally traveled by males than by females (Tomich, 1969b; Gorman, 1979). If all local animals are removed from a trapping area, it is more likely that males will move into the area before females because of their greater mobility. Further evidence is supplied by Coblentz and Coblentz (1985), who reported a significantly greater proportion of females captured later in their study. Trapping periods (or episodes) were generally several days shorter on Puerto Rico than were used on either Jamaica or St. Croix and the male-biased sex ratio observed on Puerto Rico is likely a result of this shorter sampling period. Trapping efforts in St. Croix and Jamaica indicate local fluctuations in sex ratio; however, the overall sex ratio does not appear to deviate significantly from 1:1. Sex ratios of mongooses in insular populations generally do not appear to deviate from 1:1 and many reported deviations are probably a result of biased trapping technique. Approximately 10% of the mongooses captured on St. Croix between 1983 and 1986 were juveniles; 80% of the adults were assigned equally to age classes 2 and 3 and the remaining 20% were adults assigned to age class 4. Age class 1 is underrepresented in Figure 1 because very young mongooses do not leave the nest and many juveniles might escape from live traps undetected. The Jamaican mongoose population appeared younger than the St. Croix population. Juveniles were 5 to 7% more abundant in the Jamaican population and animals in age class 2 were 18 to 23% more abundant. Animals in age class 3 were 9 to 16% less abundant and those in age class 4 were 13 to 14% less abundant on Jamaica. An August population was separated from the St. Croix data for comparison with the late July and August Jamaican sample. Trends similar to those observed for age class distributions over all of the sampling periods were observed on St. Croix (Figure 1) as well. The sex ratios in each of the four age classes likewise did not differ significantly from 1:1 (Figure 1). The greater proportion of juvenile mongooses captured on Jamaica than on St. Croix may result from the use of slightly smaller, more escape-proof traps on Jamaica. However, the greater abundance of animals in age class 2 and lower abundance of animals in age classes 3 and 4 on Jamaica compared with St. Croix is not likely to be attributable to trap differences. The age class distribution on St. Croix is similar to that reported for Hawaii (Pearson and Baldwin, 1953), whereas the age class distribution on Jamaica is more similar to an earlier study conducted on St. Croix (Nellis and Everard, 1983). The discrepancy between the present results and those of Nellis and Everard (1983) for the St. Croix population might be explained by the greater number of juveniles sampled in that study. Recalculating those data after removing the juvenile data, however, confirms a younger

The Mongoose in the West Indies

60

417

JA

= males

n for JA = 97

= females

n for SA = 212 n for ST = 572

50 SA ST 40

SA

ST

Percent JA

30

20

JA

SA SA

ST ST

10 JA 0 1

2

3

4

Age class

FIGURE 1 Distribution of mongoose age classes on Jamaica during August (JA), on St. Croix during August (SA), and on St. Croix during all months sampled (ST).

St. Croix population in that study. An alternative explanation may be in the smaller number of habitats sampled by Nellis and Everard on St. Croix. In addition, their age determination was based exclusively upon eye lens weights and not on the tooth-wear criteria. The St. Croix mongoose population appears to be older than the Jamaican population, which appears older than the Puerto Rico population (Figure 2). About 15% of all St. Croix adults have extremely badly worn teeth or no teeth at all, whereas only one mongoose (1%, n = 97) captured on Jamaica displayed badly worn teeth and only three mongooses (1%, n = 280) on Puerto Rico had badly worn teeth (age class 4). Over 90% of the mongooses on Puerto Rico are 2 years or younger, whereas only about 65 to 70% of the St. Croix or Jamaica populations are in these age groups (Figure 2). Even casual observation of the tooth-wear aging data for Puerto Rico compared with the St. Croix data (Figure 2) showed marked differences in “implied” age in these two populations. It appeared that nearly all of the animals from Puerto Rico are in age class 2, or no more than 2 years of age, whereas the data from St. Croix suggest a much older population with over 37% of the individuals over 2 years of age (Figure 2). This apparent discrepancy in age seemed odd since both populations are from the same gene pool (both derived from the Jamaican population) and are living in almost identical habitats, at the same altitude and latitude, less than 200 km apart, on semiprotected refuges and have practically the same food items available. Are these observed differences truly the results of different age structure on these islands or do they result from differences in tooth-wear? The work of Pearson and Baldwin (1953) on aging Hawaiian mongooses by tooth-wear was not based on known age specimens, but relied on the correlation of the degree of tooth-wear with certain suture closure and the birth of young predominantly in April and July. The use of PIT tags has provided us with unambiguous, permanent marking of two populations: Sandy Point, St. Croix and Cabo Rojo, Puerto Rico. A total of 20 juvenile animals have been marked and recaptured at least once (Table 3). Nearly all of these animals had class 2 teeth when last captured (inferred age from tooth-wear of less than 2 years of age), although their minimal ages range from 6 to 18 months for St. Croix and 5 to 81 months for Puerto Rico

418

Biogeography of the West Indies: Patterns and Perspectives

100

90

238 St. Croix

n = 232

Jamaica

n = 97

Puerto Rico

n = 280

80

% in each age group

70

60

54 117

50

40

30

20

57

28

14

27

24

30

10

15 1

3

0

age in years

class 1 less than 1 yr

class 2 1 to 2 yrs

class 3 2 to 3 yrs

class 4 more than 3 yrs

FIGURE 2 Age in years of the St. Croix population (diagonal bars), the Jamaican population (solid bar) and the Puerto Rico population (narrow diagonal bars), as determined by the traditional toothwear methods. Numbers above each bar = number of individuals in that group.

(Table 3). Marked animals from Puerto Rico known to be at least 5 and 6 years old still had class 2 teeth. Of the animals for which minimal age was estimated to be at least 3 years, 85% of those from Puerto Rico had class 2 teeth and 15% had class 3 teeth, whereas only 9% of those from St. Croix had class 2 teeth and 91% had class 3 or class 4 teeth (Figure 3). For those animals found to be at least 4 years of age, 62% of those on Puerto Rico had class 2 teeth and only 13% had class 4 teeth, whereas 67% of those from St. Croix had type 4 teeth (Figure 3). Clearly, tooth-wear is not well correlated with age in the Puerto Rico population. Although tooth-wear seems to be better correlated with age in the St. Croix population, misclassification of 25% of the population in older age classes (Figure 3) indicates that this method has limited utility. Although the age structure estimated by tooth-wear suggested major differences among populations (Figure 2), estimates based on minimal known age animals from St. Croix and Puerto Rico give rather similar results (Figure 4). Juveniles make up about 9 to 12% of each population. Of the known age sample of each population, 58 to 60% are 2 years of age, 25 to 27% are 3 years of age, and 10 to 15% are 4 years of age.

POPULATION DENSITIES AND HABITAT USE St. Croix mongoose population estimates derived from the Lincoln Index, Fisher-Ford model, Jolly-Seber stochastic model, and the Bailey model for the August 1983 and January 1984 sampling periods were all similar and had overlapping standard errors. Therefore, only the Lincoln Index was used to estimate population sizes for all other sampling periods. The average capture of unique individuals per grid varied from 7.5 to 22.6 mongooses, whereas estimates of population size from mark–recapture data were from 21 to 130% higher. The average number of mongooses per hectare

The Mongoose in the West Indies

419

50 PR

STX

45

= number of Individuals = class 2 teeth

40 = class 3 teeth 35

= class 4 teeth class 1 not included

30 Number of Individuals 25 STX

PR 20

15

STX

PR

10 STX

PR 5 1 0

* 2

3

4

5

Minimum age in years

FIGURE 3 Number of animals (Puerto Rico [PR] on the left; St. Croix [STX] on the right) in each minimum age group and number in each group showing the specific patterns of tooth-wear.

A

B

90 St. Croix 80 Puerto Rico 70

60

50

percent 40

30

20

10

0 Juvenile

Adult

1-2

2-3

3 - 5

minimal age in years

FIGURE 4 Age structure of two populations inferred from deciduous or permanent teeth (A) and minimal age determinations (B) from mark–recapture studies.

420

Biogeography of the West Indies: Patterns and Perspectives

TABLE 4 Estimated Average Mongoose Population Densities on Five Caribbean Islands

Island

Area (km2)

Highest Elevation (m)

St. Croix Grenada Trinidad Puerto Rico Jamaica

270 310 4,800 8,900 11,430

350 840 940 1,100 2,526

Animal Density (No./ha)

Ref.a

Number of Terrestrial Vertebrate Speciesb

6.4 6.6 2.5 2.5 2.6

1 2 2 3 1

197 208 417 338 307

a

References: 1, this study; 2, Nellis and Everard, 1983; 3, Pimental, 1955. References: Herptiles: Gosse, 1851; Groome, 1970; Kenny, 1969, 1977; Lazell, 1966; Lynn and Grant, 1940; Nellis and Everard, 1983; Schwartz and Fowler, 1973; Schwartz and Thomas, 1975; Schwartz et al., 1978; Underwood and Williams, 1959; Underwood, 1962. Birds: Bond, 1980; French, 1976; Gosse, 1847, 1849; Lack, 1976; Raffaele, 1983. Mammals: Goodwin and Greenhall, 1961; Gosse, 1851; Hall, 1981; Lindblad, 1969; Varona, 1974. b

on St. Croix varied from two in some dry grass-scrub, thorn-scrub, and desert-scrub habitats to approximately 14 in a mesic deciduous forest habitat. The mean average density on St. Croix was estimated to be 6.4 mongooses/ha (Table 4). The mesic deciduous forest was the most preferred habitat while the desert-scrub grassland was the least preferred. The total number of individual mongooses captured in each location on Jamaica varied from 3 to 33. Population estimates were lower than actual abundance on four grids, equal to the abundance on one grid, and higher on three grids. The lowest estimated density, 0.6 mongoose/ha, was recorded from a cultivated garden–scrub-forest habitat, whereas the greatest density, 6.8 animals/ha, was observed in a mixed plantation of coconuts and bananas. The mean average density on Jamaica was estimated to be 2.6 mongooses/ha (Table 4). The dry scrub-grassland and mixed coconut and banana habitats were the most preferred while the sugarcane field was least preferred. Marked differences in mongoose density were observed within the Cabo Rojo Wildlife Refuge on Puerto Rico. Densities were highest (as many as 8 animals/ha) in semiwooded habitats, lower (2 to 5 animals/ha) in more heavily wooded areas, and lower still (0 to 2 animals/ha) in the open grasslands. In the densely populated semiwooded areas, densities increased with proximity to ponds. The average density for Cabo Rojo was estimated to be 4.6 animals/ha. Mongooses were captured in similar habitats on St. Croix and Jamaica, but density estimates for the St. Croix population were consistently greater than for the Jamaican population. The greatest average density on St. Croix was recorded in a mesic deciduous forest habitat and was approximately four times greater than that of a similar habitat on Jamaica. The grassland-scrub and thorn-scrub habitats on St. Croix yielded densities two or three times greater than the density of similar habitats on Jamaica. Averaging all estimates for all habitats sampled revealed a St. Croix mongoose population density similar to that of the population density of Grenada (Nellis and Everard, 1983) and approximately two and one-half times greater than the Jamaica, Trinidad (Nellis and Everard, 1983), and Puerto Rico (Pimental, 1955) populations densities (Table 4). The St. Croix grassland habitats supported average densities for that island, whereas similar habitats on Jamaica supported greaterthan-average densities for that island. A mesic deciduous forest habitat on Jamaica supported an average Jamaican mongoose density, whereas similar habitats on St. Croix yielded the greatest

The Mongoose in the West Indies

421

average densities. On both islands, thorn-scrub habitats supported lower-than-average mongoose population densities for their respective islands. These data indicate mongooses generally prefer drier habitats, as previously reported by Pocock (1941), for their native range in Northern India and also many Caribbean Islands (Pimental, 1955; Nellis and Everard, 1983) and Pacific Islands (Baldwin et al. 1952; Pearson and Baldwin, 1953; Tomich, 1969b; Gorman, 1975, 1979). On the islands of St. Croix and Grenada (Nellis and Everard, 1983), however, mongooses have expanded their ranges into, and have flourished in, most habitats. In an effort to identify causal factors for the trends observed in insular mongoose population demographics, the ecologicalal diversity of each island was estimated by two variables. The first variable is based upon physiographic diversity and is represented by the highest elevation of each; the second variable is a compilation of the terrestrial vertebrates inhabiting each island (Table 4). St. Croix has the least variation in elevation and a high mongoose population density, whereas Jamaica has the highest elevation and a low population density (Table 4). The correlation coefficient between mongoose densities and elevations is –0.59. The diversity of terrestrial vertebrates on St. Croix and Grenada is low, whereas on Jamaica, Trinidad, and Puerto Rico it is high (Table 4). The correlation coefficient between mongoose densities and the number of species of terrestrial vertebrates is –0.90. Although vertebrate faunal diversity does appear to be negatively correlated with mongoose densities, a greater correlation coefficient (–0.98) is observed between mongoose densities and the log of island size. Smaller islands support high mongoose densities and low vertebrate diversity, whereas large islands support low mongoose densities and high vertebrate diversity.

SUMMARY AND CONCLUSIONS The small Asian mongoose was introduced to the West Indies a little more than 100 years ago. Although two independent introductions from India seem to have occurred in the 1870s, only the introduction onto Jamaica appears to have been successful. In the 18 years following 1882, the small Asian mongoose was introduced to all islands of the Greater Antilles and at least 17 islands of the Lesser Antilles. At present, the small Asian mongoose is known to occur on 29 islands of the West Indies. With the exception of the data for Puerto Rico, the sex ratio determined from the mark–recapture studies reported in this chapter do not deviate significantly from a 1:1 ratio. The male-biased sex ratio for Puerto Rico may well be explained by the shorter-trapping episode used on this island as compared with the other two islands. Previous reports of a male-biased sex ratio of introduced, insular populations of the mongoose appear to be a result of the removal-trapping technique or trapping episodes of only a few days in duration. The differences in age structure of the mongoose populations of St. Croix, Puerto Rico, and Jamaica appear to be an artifact of differences in toothwear among populations. Tooth-wear would appear to have only limited utility on a few islands such as Hawaii and St. Croix where tooth-wear is somewhat correlated with age. Using this method without determining the relationship between tooth-wear and age for every population can result in very misleading pictures of age structure. Mongooses were captured in similar habitats on St. Croix, Jamaica, and Puerto Rico but density estimates for the St. Croix population were consistently higher. This difference among islands appears to be associated not with the ecological diversity of the islands, but with the size of the islands. Small islands, such as St. Croix and Grenada, support higher population densities of mongooses and more uniformly high densities in all habitats. During the past 100 years the mongoose has been able to colonize and establish populations with relatively high densities in most habitats on small islands. At present, many areas on larger islands either support no mongoose populations or populations with relatively low density. In the future, we predict that the population growth will push the small Asian mongoose into most habitats as population densities increase on these larger islands.

422

Biogeography of the West Indies: Patterns and Perspectives

ACKNOWLEDGMENTS This research was supported by grants from the Center for Field Research to Horst and Kilpatrick, by funds from the University of Vermont to Kilpatrick, and grants from the Potsdam College Foundation and SUNY Research Foundation to Horst. The authors wish to thank the more than 150 Earthwatch volunteers and students who aided in many ways in the collection of population data for mongooses and rodents from St. Croix, Puerto Rico, and Jamaica. The authors also wish to thank Steven J. McKay for his technical assistance in estimating population sizes from our mark–recapture data. We are also indebted to Ms. Ann Haynes, Acting Director of the Natural Resource Conservation Division of Jamaica, Dr. J. D. Woodley, Director of the Discovery Bay Marine Laboratory, University of the West Indies, and Mr. Mike Evans, Sandy Point Wildlife Refuge in St. Croix (U.S. Fish and Wildlife Service), for their cooperation and support. We are especially indebted to Kenneth Foote, James Oland, and Susan Rice of the Cabo Rojo Wildlife Refuge in Puerto Rico (U.S. Fish and Wildlife Service) for their assistance and for providing living and working facilities.

LITERATURE CITED Allen, G. M. 1911. Mammals of the West Indies. Bulletin Museum Comparative Zoology at Harvard College 54:175–263. Bailey, N. T. J. 1951. On estimating the size of mobile populations from recapture data. Biometrika 38:293–236. Baldwin, P. H., C. W. Schwartz, and E. R. Schwartz. 1952. Life history and economic status of the mongoose in Hawaii. Journal of Mammalogy 33:335–356. Ball, D. J., R. L. Robinson, R. E. Stoll, and G. E. Visscher. 1990. Chronic evaluation in rodents to microchip implant used for animal identification. Technical report, Sandoz Research Institute, East Hanover, New Jersey. Barbour, T. 1930. Some faunistic changes in the Lesser Antilles. Proceedings of New England Zoological Club 11:73–85. Begon, M. 1979. Investigating Animal Abundance. Edward Arnold, London. Blower, J. G., L. M. Cook, and J. A. Bishop. 1981. Estimating the Size of Animal Populations. George Allen & Unwin, London. Bond, J. 1980. Birds of the West Indies, 4th ed. Houghton Mifflin, Boston. Bryan, W. A. 1915. Natural history of Hawaii. The Hawaiian Gazette Col. Ltd., Honolulu. Burdon, K. J. 1920. A Handbook of St. Kitts — Nevis. The West India Committee, London. Cavallini, P. and P. Serafini. 1995. Winter diet of the small Indian mongoose, Herpestes auropunctatus, on an Adriatic island. Journal of Mammalogy 76:569–574. Chasen, F. N. 1940. A handlist of Malaysian mammals: a systematic list of mammals of the Malay Peninsula, Sumatra, Borneo, and Java including the adjacent small islands. Bulletin of the Raffes Museum (Singapore) 15:1–209. Coblentz, B. E. and B. A. Coblentz. 1985. Reproduction and the annual fat cycle of the mongoose on St. John, U.S. Virgin Islands. Journal of Mammalogy 66:560–563. Colon, E. D. 1930. Datos Sobre la Historia de la Agricultura de Puerto Rico Antes 1898. Privately printed, San Juan, Puerto Rico. Corbet, G. B. and J. E. Hill. 1992. The Mammals of the Indomalayan Region. Oxford University Press, New York. Ellerman, J. R. and T. C. S. Morrison-Scott. 1951. Checklist of Palaearctic and Indian mammals 1758 to 1946. Trustees of the British Museum (Natural History). London. Espeut, W. B. 1882. On the acclimatization of the Indian mongoose in Jamaica. Proceedings of the Zoological Society of London 1882:712–714. Feilden, H. W. 1890. Notes on the terrestrial mammals of Barbados. Zoologist 14:52–55. French, R. 1976. A Guide to the Birds of Trinidad and Tobago. Asa Wright Nature Center, Cornell Laboratory of Ornithology, Ithaca, New York. Goodwin, G. G. and A. M. Greenhall. 1961. A review of the bats of Trinidad and Tobago. Bulletin American Museum Natural History 122:187–301.

The Mongoose in the West Indies

423

Gorman, M. L. 1975. The diet of feral Herpestes auropunctatus in the Fijian Islands. Journal of Zoology, London 178:237–246. Gorman, M. L. 1979. Dispersion and foraging of the small Indian mongoose, Herpestes auropunctatus. Journal of Zoology, London 187:65–73. Gosse, P. H. 1847. The Birds of Jamaica. Van Vorst, London. Gosse, P. H. 1849. Illustrations of the Birds of Jamaica. Van Vorst, London. Gosse, P. H. 1851. A Naturalist’s Sojourn in Jamaica. Longmans, London. Groome, J. R. 1970. A Natural History of the Island of Grenada, W.I. Caribbean Printers, Trinidad. Hall, E. R. 1981. The Mammals of North America, 2nd ed. John Wiley & Sons, New York, 2:601–1181. Heyliger, W. H. 1884. Notice. St. Croix Avis (newspaper), February 20, 1884. Hill, R. T. 1899. Cuba and Puerto Rico with the Other Islands of the West Indies. The Century Co., New York. Hinton, H. E. and A. M. S. Dunn. 1967. Mongooses: Their Natural History and Behavior. University of California Press, Berkeley. Hoagland, D. B. and C. W. Kilpatrick. 1999. Genetic variation and differentiation among insular populations of the small Indian mongoose (Herpestes javanicus). Journal of Mammalogy 80:169–179. Hoagland, D. B., G. R. Horst, and C. W. Kilpatrick. 1989. Biogeography and population biology of the mongoose in the West Indies. Pp. 611–633 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future, Sandhill Crane Press, Gainesville, Florida. Husson, A. M. 1960a. Het voorkomen van de mungo in Suriname. Lutra 2:12–13. Husson, A. M. 1960b. De Zoogdieren van de Nederlandse Antillen. Fauna Nederlandse Antillen, The Hague. Husson, A. M. 1978. The Mammals of Suriname. Brill, Leiden. Jackson, H. H. T. 1921. A mongoose in Kentucky. Journal of Mammalogy 2:234–235. Jonkers, A. H., F. Alexis, and R. Loregnard. 1969. Mongoose rabies in Grenada. West Indian Medical Journal 18:167–170. Kenny, J. S. 1969. The Amphibia of Trinidad. Studies on the Fauna of Curaçao and Other Caribbean Islands 29:1–78. Kenny, J. S. 1977. The Amphibia of Trinidad. Addendum. Studies on the Fauna of Curaçao and Other Caribbean Islands 51:92–95. Kramer, R. J. 1971. Hawaiian Land Mammals. Charles E. Tuttle Co., Tokyo. Lack, D. 1976. Island Biology Illustrated by the Land Birds of Jamaica. Blackwell Scientific Publishers, Oxford. Lazell, J. D., Jr. 1966. Studies on Anolis reconditus. Bulletin of the Institute of Jamaica, Science Series 18:1–15. Lekagul, B. and J. A. McNeely. 1977. Mammals of Thailand. Association for the Conservation of Wildlife, Sahakambhat Co., Bangkok. Lewis, C. B. 1944. Notes on Cyclura. Herpetologica 6:93–98. Lindblad, J. 1969. Journey to Red Birds, translated by Gwynne Vevers. Hill and Wang, New York. Lynn, W. G. and C. Grant. 1940. The herpetology of Jamaica. Bulletin of the Institute of Jamaica, Science Series 1:1–148. Myers, J. G. 1931. A Preliminary Report on an Investigation into the Biological Control of West Indian Insect Pests. Empire Marketing Board, H. M. Stationery Office, London. Nellis, D. W. 1989. Herpestes auropunctatus. Mammalian Species 342:1–6. Nellis, D. W. and C. O. R. Everard. 1983. Biology of the mongoose in the Caribbean. Studies of the Fauna of Curaçao and Other Caribbean Islands 195:1–162. Nellis, D. W., N. F. Eichbolz, T. W. Regan, and C. Feinstein. 1978. Mongoose in Florida. Wildlife Society Bulletin 6:249–250. Palmer, T. S. 1898. The danger of introducing noxious animals and birds. Yearbook U.S. Department of Agriculture 1898:87–110. Pearson, O. P. and P. H. Baldwin. 1953. Reproduction and age structure of a mongoose population in Hawaii. Journal of Mammalogy 34:436–447. Pimental, D. 1955. Biology of the Indian mongoose in Puerto Rico. Journal of Mammalogy 36:62–68. Pocock, R. I. 1941. The Fauna of British India. Vol. II. Taylor and Francis, London. Raffaele, H. A. 1983. A Guide to the Birds of Puerto Rico and the Virgin Islands. Fondo Educativo Interamericano, San Juan. Schwartz, A. and D. C. Fowler. 1973. The anura of Jamaica: a progress report. Studies of the Fauna of Curaçao and Other Caribbean Islands 142:51–142. Schwartz, A. and R. T. Thomas. 1975. A checklist of West Indian amphibians and reptiles. Carnegie Museum Natural History Special Publication 1:1–216.

424

Biogeography of the West Indies: Patterns and Perspectives

Schwartz, A., R. T. Thomas, and D. C. Fowler. 1978. First supplement to a checklist of West Indian amphibians and reptiles. Carnegie Museum Natural History Special Publication 5:1–35. Seaman, G. A. 1952. The mongoose and Caribbean wildlife. Transactions of the North American Wildlife Conference 17:188–197. Seber, G. A. F. 1982. The Estimation of Animal Abundance and Related Parameters. Charles Griffin & Co. Ltd., London. Tomich, P. Q. 1969a. Mammals of Hawaii. Bishop Museum Special Publication 57:1–238. Tomich, P. Q. 1969b. Movement patterns of the mongoose in Hawaii. Journal of Wildlife Management 33:576–584. Tvrtkovic, N. and B. Krystufek. 1990. Small Indian mongoose Herpestes auropunctatus (Hudgson, 1836) on the Adriatic Island of Yugoslavia. Bonner Zoologische Beiträge 41:3–8. Underwood, G. 1962. Reptiles of the Eastern Caribbean. Unpublished document. Department of Extra Mural Studies, University of the West Indies, St. Augustine, Trinidad. Underwood, G. and E. Williams. 1959. The anoline lizards of Jamaica. Bulletin of the Institute of Jamaica, Science Series 9:1–48. Urich, F. W. 1914. The mongoose in Trinidad and methods of destroying it. Board of Agriculture Trinidad and Tobago Circular 12:5–12. Varona, L. S. 1974. Catalogo de los Mamiferos Viventes y Extinguidos de los Antillas. Academia de Ciencias De Cuba, Havana. Wells, D. R. 1989. Notes on the distribution and taxonomy of peninsular Malaysian mongoose (Herpestes). Natural History Bulletin of the Siam Society 37:87–97. West, G. P. 1972. Rabies in Animals and Man. David & Charles, Newton Abbot, Devon. Westerman, J. H. 1953. Nature preservation in the Caribbean. Publication of the Foundation for Scientific Research in Surinam and the Netherland Antilles 9:1–106. Wolcott, G. N. 1953. The food of the mongoose (Herpestes javanicusauropunctatus Hodgson) in St. Croix and Puerto Rico. Journal of Agriculture, University of Puerto Rico 37:241–247. Wozencraft, W. C. 1993. Order Carnivora. Pp. 279–348 in Wilson, D. E. and D. M. Reeder (eds.). Mammal Species of the World, A Taxonomic and Geographic Reference. Smithsonian Institution Press, Washington, D.C.

and Biogeography 22 Status of the West Indian Manatee Lynn W. Lefebvre, Miriam Marmontel, James P. Reid, Galen B. Rathbun, and Daryl P. Domning Abstract — We review historical and recent information on the distribution, status, and habitat associations of the West Indian manatee, Trichechus manatus, summarize threats to its continued survival, and discuss some biogeographical patterns of trichechids. Historical accounts indicate that manatees were once more common and that hunting has been responsible for declining numbers throughout much of their range. Small numbers occur throughout the Greater Antilles, where opportunistic taking by fishermen is a major source of mortality. Populations in Haiti, the Dominican Republic, and Jamaica are particularly vulnerable. Manatees have not been documented to occur in the Lesser Antilles since the 18th century, except for rare sightings in the Virgin Islands. Manatee sightings in the Bahamas are also rare; however, a recent dispersal from the northwest coast of Florida to the Bahamas has been documented. Manatees are relatively abundant in Belize compared with other countries of Central America. They persist in some of the large river systems of South America: the Río Magdalena in Colombia, Río Orinoco in Venezuela, and probably the Río Mearim in Brazil. They are absent or scarce along most of the South American coast, except in the extensive coastal wetlands of Guyana and Suriname. At present, there are only three regions in Mexico where manatees are still commonly found. Manatees are widely distributed on both coasts of Florida, and some venture westward along the Gulf coast and northward along the Atlantic coast of the southeastern United States, primarily during the warm season. Heated industrial effluents along both coasts have influenced manatee distribution and migratory patterns in the United States. Illegal killing continues to threaten the survival of manatees in many countries. Despite protective measures to regulate boating activity, collision with boats is still the major cause of human-related manatee mortality in Florida. Habitat alteration is a growing concern in all countries. Manatees in the Greater Antilles and Central and South America belong to the same subspecies, T. manatus manatus. However, results of recent genetic analysis indicate greater similarity between the Florida manatee, T. manatus latirostris, and manatees in the Dominican Republic and Puerto Rico, than between the latter and manatees in South America. The highest genetic diversity is found along the northern coast of South America, at the core of the species’ range; marginal populations (in Florida, Mexico, and Brazil) were each found to be monomorphic (only one haplotype apiece) although distinct from one another. Salinity, temperature, water depth, currents, shelter from wave action, and availability of vegetation are important determining factors of manatee distribution. The association of T. manatus with freshwater sources is a highly consistent pattern. Throughout most of their range, manatees appear to prefer rivers and estuaries to marine habitats. The Amazonian species, T. inunguis, may be restricted to the Amazon River because of intolerance of salinity. Cool winters and gaps in suitable habitat on the northern Gulf coast, and the Straits of Florida to the south, serve as geographical barriers that isolate the Florida subspecies. Manatees in northeastern Brazil, at the southern end of the species’ range, may also be geographically isolated. Unlike the Florida subspecies, they no longer inhabit the subtropical to temperate portion of their historical range.

INTRODUCTION There are four living species of the mammalian order Sirenia (sea cows): the dugong (Dugong dugon) and three manatees (Trichechus spp.). The dugong inhabits tropical and subtropical coastal waters in the Indian and western Pacific Oceans. The Amazonian manatee (T. inunguis) occurs only in fresh water in the Amazon River system, and the West African manatee (T. senegalensis) occurs in both freshwater and coastal marine habitats of tropical West Africa. The West Indian manatee (T. manatus) is the most widely distributed of the three trichechids. The common name “West Indian manatee” is not fully descriptive of the range of T. manatus, which includes the coasts and many of the rivers of Florida, the Greater Antilles, eastern Mexico and Central America, and northern and northeastern South America. The purpose of this chapter is to review historical and recent information on the distribution, status, and habitat associations of T. manatus, to summarize threats 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

425

426

Biogeography of the West Indies: Patterns and Perspectives

to continued survival of this species and conservation efforts throughout its range, and to discuss some of its biogeographical patterns. We incorporated much of the information presented in Lefebvre et al. (1989), rather than simply updating that work. Two types of citations are used for unpublished communications: personal communication refers to a written communication (i.e., by letter) or a spoken communication between the cited individual and one of the authors, and unpublished reports appear in the Literature Cited section.

HISTORICAL DISTRIBUTION Historical accounts indicate that manatees were once more common and that hunting has in part been responsible for declining manatee numbers throughout their range (Thornback and Jenkins, 1982). McKillop (1985) pointed out that early reports of manatee distribution and exploitation, such as Dampier’s (1699), may demonstrate that manatees were previously more common and a reliable meat source, whereas current ethnographic accounts indicate that in many areas manatees are now scarce, difficult to capture, and not a major food source. Nevertheless, many of the areas where manatees were hunted prehistorically and historically still have manatees. The historical uses of manatee meat, oil, bones, and hide have been described by many authors, for example, True (1884), Allen (1942), Rouse (1964), Bertram and Bertram (1973), and Husar (1977) (see also Domning, 1996, for a comprehensive bibliography of this and other aspects of manatee biology). It is probably fair to say that if manatee meat had not been highly esteemed by pre-Columbian inhabitants and early explorers of the West Atlantic region, we would know much less about the former range and abundance of this species. With the possible exception of Cuba, little historical evidence exists that manatees were ever very abundant in the Greater Antilles (Figure 1). In 1494 Columbus reportedly found freshwater springs in the Bahía de Cochinos, Cuba, which attracted “swarms” of manatees (Morison, 1942). Fernández de Oviedo, as reported by Cuní (1918), described the use of tethered remoras by Indians to locate and capture manatees on the coast of Cuba in 1520, and noted hunting of manatees by Spaniards with crossbows. Acosta also saw manatees in Cuba, as well as “St. Dominicke, Portrique and Jamaique” (Hispaniola, Puerto Rico, and Jamaica) in 1588, and ate manatee meat in Hispaniola (Baughman, 1946). Dampier (1699) saw manatees in Cuba and had heard of their occurrence on the north coast of Jamaica. According to Cuní (1918), manatees were abundant in the river mouths and estuaries of Cuba before 1866, but since then they have been reduced in numbers. Gundlach (1877) also described manatees in earlier times in Cuba as very abundant, but in his day as much reduced although not rare. Barrett (1935) optimistically concluded that manatees were once plentiful in estuaries on the central north coast of Puerto Rico because a town there was named Manatí by the Spanish. Evermann (1902) described the manatee in Puerto Rico as being “of very rare occurrence.” Although Fewkes (1907) lists the manatee as one of many species that contributed to the Puerto Rican diet, he reported that fish, crabs, and small mammals were the most important food animals in the West Indies. Sloan (1725, quoted in Murray, 1991) said that manatees had formerly been frequent in Jamaica, but owing to overhunting they had already become rare by the time of his visit to the Caribbean in 1687–1689. Duerden (1901) did not mention manatees in his account of fisheries in Jamaica, the Bahamas, or the Leeward Islands (the northern Lesser Antilles), whereas he specifically mentioned them in his coverage of Trinidad and Tobago. Both Duerden (1901) and Neish (1896) reported that eight manatees had been captured in the vicinity of Old Harbour, Jamaica in the previous 7 to 10 years; Neish described them as uncommon, and Duerden seemed unimpressed with the manatee’s potential for greater economic importance, noting that they are “very slow breeders.” A small number of manatee bones or bone fragments have been recovered at Amerindian sites in Jamaica (Wing and Reitz, 1982), Haiti (E. S. Wing, personal communication, 1987), the Dominican Republic (Miller, 1929), Puerto Rico (E. S. Wing, personal communication, 1987), and Vieques Island off Puerto Rico (Narganes-S., 1982). Rouse (1986:133) speculated that flint points crafted by Amerindians in Hispaniola 3,000 to 5,000 years ago were used as spear heads for hunting

Status and Biogeography of the West Indian Manatee

427

manatees, since he assumed that large land mammals were absent. However, Rouse (1986) noted that early inhabitants of Cuba and Hispaniola were oriented primarily toward the land, and he may have overlooked ground sloths as an alternative prey species (Morgan and Woods, 1986). Manatees were commercially exploited in Suriname (de Jong, 1961; Husar, 1977), Guyana (de Jong, 1961; Bertram and Bertram, 1973), and Brazil (Domning, 1982a) for export to the West Indies during the 17th through 19th centuries, which suggests that manatees may not have been very abundant historically around these islands. In the Lesser Antilles, manatee remains have been identified at Amerindian archaeological sites on six islands: St. Croix, St. Kitts, Barbuda, Antigua, St. Lucia, and Grenada (Miller, 1918; Ray, 1960; Wing et al., 1968; Wing and Reitz, 1982; Watters et al., 1984; Steininger, 1986). Vertebrate remains collected at other excavation sites on St. Kitts, Antigua, St. Lucia, and Barbados did not include manatees (Wing, 1967; Wing et al., 1968; Wing and Scudder, 1980). Except for rare sightings in the Virgin Islands (e.g., D.W. Peterson, 1982, personal communication; Mignucci-Giannoni, 2000), manatees have not been documented to occur in the Lesser Antilles since the 18th century (Allen, 1942; Ray, 1960). Several 19th-century authors included the Islands of Marie-Galante and Martinique in the manatee’s range, but gave no new documentation of their presence (Ray, 1960). The evidence for recent large-scale reductions in Central and South American manatee numbers is stronger. Notable declines are thought to have occurred in Honduras (Klein, 1979; Rathbun et al., 1983), Costa Rica and Panama (Husar, 1977; O’Donnell, 1981), Venezuela (Bertram and Bertram, 1973; Mondolfi, 1974; O’Shea et al., 1986), and Brazil (Domning, 1982a). Dampier (1699) saw manatees along the coasts of Mexico and Central America, and heard of great numbers occurring in the rivers of Suriname. Historical accounts exist for manatees along the coast of Guatemala (Bradley, 1983). Barrett (1935) claimed that one of the best-known “herds” of manatees on the Caribbean coast inhabited the Indio River and its bayous in Nicaragua (Figure 2), where hunters took many. Von Frantzius reported manatees to be very common in several rivers in Costa Rica in 1868 (Allen, 1942). The Bahía Almirante and Bocas del Toro area were documented as a region where buccaneers were familiar with manatees and provisioned themselves with manatee meat during the 1600s (Dampier, 1699; O’Donnell, 1981). Although manatees currently persist in this region, their numbers have been severely depressed (Husar, 1977; O’Donnell, 1981). Maack reported in 1874 that manatees were frequently caught in the Atrato and Cacarica Rivers in Colombia (Figure 3) (Allen, 1942). True (1884) cited Brandt’s 1868 literature review of manatee abundance in South America, which indicated that in many regions, particularly around river mouths or other places where shelter was lacking, manatees were disappearing or extirpated. In the upper reaches of rivers, however, Brandt concluded that hunting pressure may have been less severe (True, 1884). By the end of the 19th century, West Indian manatees disappeared from much of the east coast of Brazil (Whitehead, 1977). Manatees historically occurred along the entire Mexican coast of the Gulf of Mexico and Caribbean Sea (Campbell and Gicca, 1978). Manatee meat contributed to the prehistoric diet in at least two sites in Mexico, near Alvarado and in northern Quintana Roo (Figure 2) (McKillop, 1985). Baughman (1946) cited several 16th- and 17th-century authors who reported manatees along the coast of Yucatan. Middens (A.D. 400–700) on Moho Cay near what is now Belize City have yielded the largest number of manatee bones of all greater Caribbean prehistoric sites thus far investigated (McKillop, 1985). Manatee remains have been reported from several other coastal and inland archaeological sites in Belize (Bradley, 1983), and manatees from Belize were provided to 17thcentury privateers as a meat source (O’Donnell, 1981). Prehistoric evidence exists for the occurrence of manatees at the Islas de la Bahía in the offshore Caribbean near present-day Honduras (Strong, 1935), but they are no longer found in the region (Klein, 1979; Rathbun et al., 1983). Hartman (1972, 1974) believed that hunting during the 17th through the 19th centuries reduced the number of manatees in Florida to a few relict groups, but he presented no evidence of their former greater abundance. Harlan (1824) cited Burrows’ description of considerable numbers of manatees about the mouths of rivers near “the capes of East Florida” (according to Moore, 1956, the south end of Key Biscayne in the Miami area; Figure 4). Allen (1942) concluded that evidence

428

Biogeography of the West Indies: Patterns and Perspectives

of manatees having once been much more abundant in Florida was subjective and unconvincing, although he stated, without reference to a specific source, that the manatee had become rather scarce in many parts of Florida by about 1890. He may have been overly influenced by information from Bangs (1895), who described the winters of 1894 and 1895 as exceptionally cold, resulting in freeze-related manatee mortality in the Sebastian River. Excessive drainage of wetlands has also been blamed for the manatee’s disappearance from some regions of Florida (Trumbull, 1949). Cumbaa (1980) determined that aboriginal use of manatees in Florida was almost exclusively restricted to inland and coastal riverine sites, and concluded that manatees were not abundant enough to supply a stable food resource to the Paleo-Indians of Florida. In 1773, Bartram (1791) found skeletal remains of a manatee that he thought had been killed by Indians at Manatee Spring on the Suwannee River. There are few other records of manatees using the Gulf coast of Florida from the Suwannee River south to the Chassahowitzka River before the mid-1900s (Powell and Rathbun, 1984). Allen (1942) attributed a slow increase in manatee numbers in Florida to an 1893 state law that prohibited their killing.

PRESENT DISTRIBUTION, STATUS, AND HABITAT ASSOCIATIONS WEST INDIES Puerto Rico Manatees occur along the entire coast of Puerto Rico, but are unevenly distributed (Figure 1). Aerial surveys flown during the late 1970s and mid-1980s documented the greatest concentrations along the south-central and eastern shores and none on the northwestern shore (Powell et al., 1981; Rathbun et al., 1985a). During 10 monthly surveys flown from June 1978 through March 1979, a mean of 22.6 ± 12.6 manatees was sighted, with a range of 11 to 51 (Powell et al., 1981). In 12 monthly surveys flown from March 1984 through March 1985, a mean of 43.6 ± 13.1 was sighted, with a range of 20 to 62 (Rathbun et al., 1985a). Both Powell et al. (1981) and Rathbun et al. (1985a) reported that slightly over one third of their sightings came from around the Roosevelt Roads Naval Station on the eastern end of the island, and the northwestern shore of neighboring Vieques Island (Figure 1). In both of these surveys, a similar proportion of calves were seen: 6.4 ± 4.9% (Powell et al., 1981) and 7.6% (Rathbun et al., 1985a). The U.S. Fish and Wildlife Service’s (USFWS) Caribbean Field Office conducted aerial surveys from 1984 through 1999 (Jorge Saliva, USFWS, personal communication, 2000). As in previous surveys, the greatest numbers of manatees were seen along the south-central and eastern coasts. Counts from these island-wide flights ranged from 43 to 101 individuals. Comparisons among these and earlier survey results may not be entirely valid because of differences in observers, methods, and survey conditions. However, the number of manatees in Puerto Rico probably has not declined, and may have increased, since 1978. Except for Vieques Island, manatees are rarely reported from the islands offshore of Puerto Rico. A manatee was entangled in a fishing net off Culebra Island in 1982 (Jimenez, 1982), and one was reported there in 1999 (Caribbean Stranding Network, personal communication). Manatees have never been reported for Mona and Desecheo Islands (Powell et al., 1981). A total of 79 manatee carcasses were recovered in Puerto Rico from 1974 through 1995, 35 since 1990 (Mignucci-Giannoni et al., 2000). Carcasses were recovered from all coasts, with the highest number of records from the north, northeast, and south coasts. The greatest concentrations occurred in the areas of Fajardo/Ceiba, Bahia de Jobos, Toa Baja, Guayanilla, Cabo Rojo, and Río Grande/Luquillo. The lowest numbers were in the northwest and extreme southeast coasts, Vieques Island, and Culebra Island. In 1998, a death was documented in St. Thomas, U.S. Virgin Islands; this animal was probably a stray from Puerto Rico.

FIGURE 1 Distribution of the West Indian manatee (Trichechus manatus) in the Greater Antilles.

Status and Biogeography of the West Indian Manatee 429

430

Biogeography of the West Indies: Patterns and Perspectives

Of the 79 deaths recorded in Puerto Rico since 1974 (Mignucci-Giannoni et al., 2000), 39 (49%) were human-related, including 14 (18%) caused by watercraft collisions, two (2.5%) following accidental entanglement in fishermen’s nets, and 19 (24%) illegally hunted and killed. A total of 17 cases (21%) involved dependent calves, and in 21 cases (27%) cause of death was not determined. Manatees are protected by the U.S. Marine Mammal Protection Act and Endangered Species Act, as well as by several Commonwealth of Puerto Rico laws: La Ley de Pesca del Estado Libre Associado (1943), La Ley de Vida Silvestre (1977), and the Regulation to Govern the Management of Threatened and Endangered Species in the Commonwealth of Puerto Rico (1985) (D. Mignogno, personal communication, 1987). Although hunting pressures are believed to have subsided with the adoption of federal regulations and improvements in the island’s economic status, poaching has been documented as recently as 1995. As part of recovery efforts, the Caribbean Stranding Network has coordinated the rescue and rehabilitation of injured and orphaned manatees since 1990 (Mignucci-Giannoni, 1998). A successful public education campaign in the early 1990s to promote manatee conservation centered on an orphaned manatee named Moises that was rescued, rehabilitated, and release to the wild. Mortality studies and rescue and rehabilitation efforts have yielded additional life history information on manatees in Puerto Rico, including diet (Mignucci-Giannoni and Beck, 1998), population genetics (García-Rodríguez et al., 1998), parasitology (Mignucci-Giannoni et al., 1999), and hematology (Montoya-Ospina, 1994; Jiménez-Marrero et al., 1999). Two recent radio-tracking studies of manatees in Puerto Rico have revealed regional movement patterns. From 1992 through 1996, the U.S. Geological Survey’s Sirenia Project tagged seven manatees at the Naval Station Roosevelt Roads (NSRR), a known high-use area. Most remained near, or frequently returned to, the waters of NSRR; however, one individual swam 50 km south to Puerto Patillas and another individual ranged 40 km north to Luquillo. Four of the seven tagged manatees repeatedly traveled 9 km offshore to Vieques Island. The tagged manatees used specific areas, such as feeding sites in Pelican Cove and Ensenada Honda and the freshwater discharge at the Cape Hart sewage treatment plant. Although seagrass beds extend several kilometers offshore and to depths of over 20 m, most locations and documented feeding areas were close to shore and often in water only 1.5 to 3 m deep (Lefebvre et al., 2000). The U.S. Geological Survey’s Sirenia Project, U.S. Fish and Wildlife Service’s Caribbean Field Office, and the Caribbean Stranding Network collaborated to radio-tag four manatees in western Puerto Rico from 1997 to 2000. These individuals were captured at the Río Guanajibo near Mayagüez, and primarily used the waters from Mayagüez south to Boquerón. Feeding areas were documented in shallow, nearshore waters, and in seagrass beds over 1 km offshore. One individual traveled 210 km north and east along the coast to just east of San Juan, where he remained for several weeks before returning to the Río Guanajibo. Evermann (1902) recognized the association between animal distribution and the physical environment of Puerto Rico. He attributed the rarity of manatees “… to the absence of broad sluggish rivers in which it finds its favorite environment.” Barrett (1935) related a decline in manatees along the north coast of Puerto Rico in part to “silting-up” of river mouths, which prevented manatees from grazing on shoreline grasses in river estuaries. Powell et al. (1981) also recognized that manatee distribution in Puerto Rico is influenced by the availability of fresh water. Almost all manatees seen during their nearshore surveys were in the ocean; however, 85.8% of the sightings were within 5 km of natural or artificial freshwater sources. Interviews indicated that manatees visit the mouths of the Loíza and Fajardo Rivers, and after heavy rains they may ascend these rivers for short distances. Powell et al. (1981) concluded that other Puerto Rican rivers are too shallow for manatees to ascend; however, manatees have been reported to swim about 1 km up the Río Loco, near Guanica (Jorge Saliva, USFWS, personal communication, 2000). Manatees have been observed by the third author on numerous occasions drinking fresh water flowing out of the mouth of the Río Blanco, Río Humacao, and Río Guanajibo. Rathbun et al. (1985a) did not

Status and Biogeography of the West Indian Manatee

431

detect any dramatic seasonal shifts in distribution along the coast, nor was there a significant correlation between total monthly rainfall and the total number of manatees seen per month. Powell et al. (1981) noted the association of manatee distribution and seagrasses, describing Thalassia, Syringodium, and Halodule as probably the most important manatee foods in Puerto Rico. Seagrass beds are relatively sparse along the northwest coast where no manatees were seen, and are extensive on the eastern and southern coasts of the island (Powell et al., 1981). Deep waters close to shore and a lack of embayments also result in less favorable manatee habitat along the north coast. Powell et al. (1981) first documented that manatees use the Cape Hart sewage treatment plant effluent at Roosevelt Roads Naval Station as a source of fresh water for drinking. Rathbun et al. (1985a) further documented the importance of these outfalls by demonstrating that manatees are likely to be present at any time, showing no seasonal, tidal, or diurnal changes in their preference for this site. Rathbun et al. (1985a) also noted the association of manatees and seagrass beds, and suggested that the higher incidence of cow/calf pairs observed at Roosevelt Roads Naval Station and northwestern Vieques Island may have been related to the abundance of seagrass beds at this site, the availability of fresh water at Cape Hart, and the protection from human harassment provided by security procedures at the naval base. Jamaica Manatees occur primarily along the southern coast, to the west of Kingston (Fairbairn and Haynes, 1982) (Figure 1). Between May 1981 and April 1982, 13 aerial surveys were conducted along the entire coastline, and manatees were observed primarily in Portland Bight, off the parishes of St. Catherine and Clarendon, and off St. Elizabeth and Manchester Parishes, between the Black River and the Rio Minho (Fairbairn and Haynes, 1982). Two were observed off St. Thomas Parish, on the eastern end of the island, and one off St. Ann Parish. The range in number of manatees seen during the monthly surveys was 1 to 13, with a mean of 6 (Fairbairn and Haynes, 1982). The average number of manatees seen per flight hour in Jamaica (1.27) was higher than the number seen per hour in Haiti (0.64), where only one entire-coast survey was flown, but much lower than the average number per hour seen in Puerto Rico (9.1) (Hurst, 1987). Powell (1976) conducted an aerial survey of the coast from St. Mary Parish clockwise to St. Elizabeth Parish in September 1976, and saw only one manatee, at Alligator Reef off Manchester Parish. Powell (1978) reported piscivory from fishermen’s nets by manatees off St. Mary and Trelawny Parishes on the north coast, near Port Maria and Rio Nuevo. The Natural Resources Conservation Authority (NRCA) conducted an aerial survey (5.5 h) on 10–11 April 1993. Eight manatees, all adults, were sighted, including three of four semicaptive manatees in the Alligator Hole River, Clarendon. A cavorting group of four manatees was observed at Fisherman’s Bay, west of Port Morant, St. Thomas. The eighth manatee was sighted on the northeast coast, at Unity Bay, near the town of Port Antonio, Portland (NRCA, 1993). Four sightings were reported off the coast of Trelawny by Trelawny Environmental Protection Association in 1992 (NRCA, 1993). A 2-day aerial survey of the entire coast was conducted in June 1998 (J. A. Powell, personal communication, 2000). A total of 11 manatees were seen, including two calves. On the northern coast, a cow and calf were seen in Half Moon Bay near Falmouth, and three manatees were observed feeding in Turtle Crawle Harbour near Port Antonio. On the southern coast, a cow and calf were sighted in Galleon Harbour, in the northeastern portion of Portland Bight. A single manatee was seen near Macarry Bay, two adults near Great Pedro Bay, and one at Starve Gut Bay near the Black River. Manatees in Jamaica are protected by the Wild Life Protection Act (1971), which prohibits hunting and possession of protected species (Shaul and Haynes, 1986). Law enforcement efforts, however, are inadequate (A. Haynes-Sutton, personal communication, 1987). Despite public education on the manatee’s protected status, Jamaican fishermen continue to take and sell manatees illegally (Hurst, 1987; NRCA, 1993). Deliberate capture of manatees is most frequent in regions that are

432

Biogeography of the West Indies: Patterns and Perspectives

economically depressed (A. Haynes, personal communication, 1986). At least three manatees were captured on the south coast of Jamaica in 1985; two were killed for meat and one was rescued by the Natural Resources Conservation Department and released in the Alligator Hole River (Hurst, 1987). In 1987, at least one manatee was killed illegally at Alligator Pond (A. Haynes-Sutton, personal communication, 1987). Hurst (1987) believed that fishermen are responsible for nearly all human-related manatee mortality in Jamaica. Manatees are captured following accidental entanglement in gill nets and beach seines; fishermen claim that manatees frequently drown before their presence is noted (Shaul and Haynes, 1986). Females and juveniles may be more susceptible to capture by beach seining (NRCA, 1993). Hurst (1987) attempted to estimate net entanglement losses from fishing boat statistics, and concluded that St. Elizabeth Parish has the greatest potential for fishing-related mortality. Interviews with local residents indicated that manatee numbers were generally believed to have declined in recent years (Crombie, 1975a; Powell, 1976). Major threats continue to include poaching for food and incidental taking in fishnets and other devices (A. Donaldson, NRCA, personal communication, 1993). There are approximately 12,000 registered full-time fishermen in Jamaica, and 23% of the total coastal catch is by gill nets and beach seines (NRCA, 1993). Gill nets were identified in every area considered good manatee habitat during the 1993 aerial survey (A. Donaldson, NRCA, personal communication, 1993). Destruction of mangrove swamps by commercial, agricultural, and residential development, most notably along the coast of St. Catherine, has also caused concern. Pollution from thermal and industrial discharge, siltation, and dredging operations have affected seagrass beds, thus threatening manatees’ food source (NRCA, 1993). The south coast of Jamaica has extensive areas of shallow water, numerous bays and other areas of calm water, freshwater sources, and seagrass beds, which create favorable habitat for manatees (Hurst, 1987). The north coast has a deep and rugged shoreline, but also has a number of river mouths. Manatees have been observed feeding on Ceratophyllum and the starchy root of Phragmites in the rivers of south Clarendon and Manchester Parishes (Shaul and Haynes, 1986). Several manatees in the Alligator Hole River were observed feeding on Ceratophyllum, Potamogeton, and Phragmites, and seemed to prefer the lower part of the river, where the undercut banks provide cover (Hurst, 1987; Domning, 1989). Four manatees were impounded in the Alligator Hole River as part of an NRCA program, Operation Sea Cow, initiated in 1980 to publicize manatees and encourage research and conservation. However, these objectives have been difficult to accomplish because public access to the site is limited and the manatees, all female, are isolated from the already small free-ranging population (Domning, 1989). One of the manatees died and food in the river has become scarce. Plans have been made to radio-tag, release, and monitor the remaining manatees (Domning, 1998a). Dominican Republic Husar (1977) reported manatees to be distributed along the southwest and the entire north coasts of the Dominican Republic (Figure 1), with the greatest concentrations occurring in Bahía de Neiba and near Las Terrenas. Belitsky and Belitsky (1980) conducted six entire-coast aerial surveys every other month from February through December 1977. Manatees were sighted along the north coast from Manzanillo to Miches, and along the southwest coast from Isla Beata to Bahía de Ocoa; the only sighting outside of these areas was northwest of Isla Saona on the southeast coast. Belitsky and Belitsky’s (1980) surveys indicated that manatees were more common around Monte Cristi than Las Terrenas on the north coast, and common in Bahía de Ocoa as well as Bahía de Neiba on the southwest coast, but in general, their findings conform to the report by Husar (1977). The mean number of sightings per survey on the north coast was 12.3 (range = 2 to 30), and the mean on the southwest coast was 7.5 (range = 1 to 11). Seasonal changes in distribution and abundance were not apparent. Interviews indicated that manatees occur in several other areas: on the east coast, from Boca de Yuma south to Isla Saona; near Nizao on the south coast; in coastal waters between

Status and Biogeography of the West Indian Manatee

433

Isla Beata and the mainland; and near Pedernales (Belitsky and Belitsky, 1980). Local fishermen and residents also reported that manatees once ranged over more extensive areas of the coastline, and Belitsky and Belitsky (1980) attributed apparently reduced numbers to hunting pressure and degradation of habitat by land development. Currently, the most important areas for manatees in the Dominican Republic are the coastal lagoons, estuaries, rivers, and creeks of the north coast, especially near Monte Cristi and in Samana Bay, and the southwest coast from Ocoa Bay to Barahona. Between August and December 1994, and December and July 1996, a systematic survey was conducted of coastal sites in the Dominican Republic (Ottenwalder and Leon, 1999). Researchers interviewed 418 people, predominantly fishermen (81% of sample), fish and wildlife inspectors, coast guards, park rangers, and people who buy and sell fish in the market. Although 90% of those interviewed knew what a manatee was, 83% believed that there were more manatees in the past. Many of those interviewed indicated that availability of fresh water and submerged vegetation is important in manatee distribution. Most (74%) reported that manatees are good to eat, although few claimed to know where meat could be obtained. A total of 95% knew that manatees are protected by law. Manatees are still exploited for their meat and bones in the Dominican Republic, and they are currently considered one of the most endangered species on the island (Ottenwalder, 1995). The most significant source of mortality is illegal, opportunistic take by net capture. Approximately 5 to 15 manatees are captured annually along the coast of the island. Preliminary analysis of aerial survey data collected in 1995 (Ottenwalder, 1995) suggests that the number of manatees has decreased since the 1977 surveys conducted by Belitsky and Belitsky (1980). Ottenwalder (2000, personal communication) guesses that there are fewer than 200 manatees in the Dominican Republic. Most of the river mouths in the Dominican Republic are periodically blocked by sandbars, and manatee habitat has been described as coastal marine rather than estuarine (Belitsky and Belitsky, 1980). Fishermen frequently report that manatees are attracted to springs and river mouths, to drink fresh water (J.A. Ottenwalder, 1987, personal communication). Interviews conducted in 1975 indicated that manatees frequent river mouths on the north coast during the rainy season, and are regular visitors to Río San Juan and Río Yasica (Campbell and Irvine, 1975). Manatees were seen within 1 km of springs northwest of Isla Saona (Tres Hermanas), in Bahía de Samaná (La Guázuma), and near Barahona (Playa de Saledilla) during at least one aerial survey (Belitsky and Belitsky, 1980). Manatees were reported to visit the Massacre, Yaque del Norte, San Juan, Bajabonico Isabela, and Yaque del Sur rivers; however, none was seen in aerial surveys or site visits to these rivers (Belitsky and Belitsky, 1980). Reports of manatees at other river mouths or springs include Playa Grande, northeast of Río San Juan; Playa de Rincón and Bahía de Rincón; Río Caño del Agua near Barahona; Río Cosón and Arroyo Cañada Salada, near Punta Cosón, Samaná; La Poza, east of Las Terrenas, Samaná; Bahía de Manzanillo; Los Patos y Bahía Regalada, Barahona; Estero Hondo y Punta Rucia, Puerto Plata; and Bahía de Yuma (J. A. Ottenwalder, personal communication, 1987). Crombie (1975b) conducted a helicopter survey of the coast between El Peñón and Boca de Yuma, including Isla Saona. He found the coast near Peñón (the site of Tres Hermanas springs), Bahía de Palmillas, and the south coast of Isla Saona to have the most suitable manatee habitat in this area (shallow, calm waters, with a few small Thalassia beds). The sources of manatee mortality in the Dominican Republic are poaching and shark predation (the latter may actually be scavenging) (Belitsky and Belitsky, 1980). Five manatees were taken in 1976: three near Nizao, one east of Monte Cristi, and one near Pedernales (Belitsky and Belitsky, 1980). Manatees were frequently sighted by fishermen in Bahía de Samaná and occasionally caught accidentally in their nets (Mortensen, personal communication, 1975). Interviews conducted by Campbell and Irvine (1975) indicated that manatee meat is highly prized by fishermen in Bahía de Samaná, and that manatees are rarely seen on the north side of the bay, possibly because of fishing pressure. The Dominican Republic has officially protected manatees since 1962 (Law No. 5914, Article No. 45) and is a signatory of CITES since 1987 (Secretaria de Estado de Agricultura, 1993).

434

Biogeography of the West Indies: Patterns and Perspectives

However, law enforcement is not entirely effective (Ottenwalder, 1995). Commerce in polished and carved manatee bones and manatee oil in Santo Domingo markets may pose a significant threat to manatees (Mignucci-Giannoni, 1991). Infrequent boat strikes have been reported (Secretaria de Estado de Agricultura, 1993). A nonprofit private organization, Prospectiva Ambiental Dominicana, has conducted research on manatees and produced and distributed educational materials. They have recommended measures to protect manatees, including enforcement of regulations to stop illegal taking; protecting preferred habitats by creating manatee sanctuaries; integrating coastal communities and fishermen into conservation efforts; conducting research to determine status, distribution, and exploitation of manatees and their habitats; and establishing a manatee rescue and rehabilitation program (Ottenwalder, 1995). Haiti One entire-coast aerial survey was conducted in May 1982, and eight manatees were observed (Rathbun et al., 1985b). Manatee sightings occurred within a very small portion of the western coastline, between Gonaïves and Montrouis (Figure 1). Interviews with coastal residents in 1982 and 1983 indicated that few people under 50 years old had firsthand knowledge of manatees, and the only other area where manatees were reported to have occurred recently was in the Bay of Jacmel in 1977 and 1978. Ottenwalder (1995) describes the manatee population along Haiti’s coast as drastically reduced, and facing an uncertain destiny. Manatees are caught opportunistically in beach seines; however, traditional hunting apparently is no longer practiced, probably because of a decline in manatee numbers over the past 50 years (Rathbun et al., 1985b). The status of manatees in Haiti is extremely tenuous because their known range is so restricted, and the areas where they occur are important to fishermen in this densely populated and economically depressed country. Several areas were identified as having shallow and protected waters, extensive submerged vegetation, and rivers (Figure 4), including the area where manatees were observed at the mouth of the Riviere de l’Arbonite. Woods and Ottenwalder (1992) recommended the establishment of a new national park at the delta of the Riviere de l’Arbonite, around the Baie de la Tortue and Baie de Grand Pierre, to increase protection of this endangered species. The extremely tenuous status of the manatee in Haiti heightens the need for manatee conservation efforts in the neighboring Dominican Republic. Cuba Manatees occur along both the north and south coasts of Cuba, and in 1978 were reported to be most frequently seen in the Río Hatiguanico in the Zapata Swamp and in Ensenada de la Broa (Figure 1) (Thornback and Jenkins, 1982). Fishermen were surveyed to determine manatee distribution and abundance in western Cuba between February 1984 and February 1985 (Estrada and Ferrer, 1987). Manatees reportedly occur from Mariel to Cabo San Antonio on the north coast and from Cortes to Bahía de Cochinos on the south coast (A. R. Estrada, personal communication, 1986). There are three areas where manatees are particularly abundant: Golfo de Guanahacabibes, between Cortes and La Coloma, and Ensenada de la Broa/Río Hatiguanico (Estrada and Ferrer, 1987). Sightings were most commonly of solitary manatees, groups of four or more, and pairs, in that order. A comprehensive interview survey of 301 anglers was conducted countrywide in the late 1980s (except for the area between Jamainitas and Punta Hicacos) (A. R. Estrada, personal communication, 1993; L. T. Ferrer, personal communication, 1993). This survey indicated that manatees are distributed along both coasts, with greater concentrations in the Ensenada de la Broa–Río Hatiguanico–southern coast of Zapata Peninsula region (Matanzas Province). The 12 areas with a greater abundance of manatees were identified: Ensenada de Guadiana–Puerto Esperanza; Bahía de Cárdenas; Carahatas–Caibarién; Turiguanó; Nuevitas–Puerto Padre; Gibara–Cayo Saetía on the northern coast; Siguanea and Punta del Este (Isla de la Juventud); Ensenada de la Broa;

Status and Biogeography of the West Indian Manatee

435

Casilda–Tunas de Zaza; Golfo de Ana María; Golfo de Guacanayabo–Ensenada de Mora; and Baitiquirí, on the southern coast. Aerial surveys have been conducted over the Ensenada de la Broa–Río Hatiguanico–Zapata Peninsula region: four 80-min flights in November 1986 with a total of 25 manatee sightings; four 80-min (approx. 96-km) flights in July 1987 with 39 manatee sightings; and four 70-min (approx. 159-km) flights in July 1992 with 20 manatee sightings (A. R. Estrada, personal communication, 1993; L. T. Ferrer, personal communication, 1993). Eight 1-h (approx. 93-km) surveys were flown between October 1985 and January 1986 between the mouths of the rivers Jatibonico del Sur and AgabamaManatí, south of Sancti Spíritus Province, with a total of 44 manatee sightings. Flights over Ensenada de la Broa and the southern coast of Sancti Spíritus Province between 1985 and 1987 resulted in 59 manatee sightings during 9.5 h (1425 km) in Ensenada, and 39 sightings during 5.75 h (990 km) in Sancti Spíritus (Wotzkow, 1990). All but two of the sightings were of adults. Cuba has extensive areas of shallow, protected coastal waters and many rivers on both the north and south coasts. Cuni (1918) described the habitat of manatees in Cuba as more riverine than marine and noted manatees feeding on riverbank grasses with part of their bodies out of water. He also noted their use of freshwater springs. Estrada and Ferrer (1987) reported that manatees were most frequently sighted along sheltered coasts with extensive shallow areas offshore. They acknowledged that changes in riverine habitat, caused by damming, erosion related to deforestation, and pollution may have resulted in the manatee’s shift to a more marine existence in Cuba. Estrada and Ferrer (1987) noted that almost no reports were received of animals in inter waters, and concluded that, like manatees in the Dominican Republic and Puerto Rico, Cuba’s manatees occupy coastal marine habitat, where they feed in large meadows of aquatic plants. Interviews indicated that Syringodium filiforme and Thalassia testudinum are preferred by manatees (Estrada and Ferrer, 1987). Varona (personal communication, 1975) described the status of the manatee in Cuba as rare and declining alarmingly, because of pollution and pursuit by humans for its flesh, fat, and hide. In contrast, Estrada and Ferrer (1987) reported that more than 50% of those interviewed had seen a manatee within the last year, and believed that manatees were abundant and had increased in number in the last 10 years. However, Estrada (personal communication, 1994) expressed concern about the manatee’s status in more recent years. Interviews identified accidental drowning in fishing nets as the main cause of mortality of manatees in Cuba (Ferrer and Estrada, 1988). Underwater explosions related to petroleum extraction have also caused some manatee deaths. Manatees in Cuba have been legally protected since 1936 by Decree 707, Article 39. The Fishing Law of 1955, Decree 2724, Article 75, also prohibits any taking of manatees. Manatees have been listed as a threatened species in Cuba since 1973 (A. R. Estrada, personal communication, 1993). In 1982, the Ministry of Fisheries permanently prohibited the capture of manatees in all national territory, with punishment including fines and loss of catch, fishing gear, and boat. However, no research, conservation, or management of the species has been implemented (A. R. Estrada, personal communication, 1993; L. T. Ferrer, personal communication, 1993). Estrada and Ferrer (1987) recommended that studies be initiated in the areas of greatest manatee abundance to facilitate management and conservation efforts. From May 19 to 20, 1994, a National Workshop on the Protection and Management of Manatees was held in La Habana. Several governmental and nongovernmental institutions met for 2 days to discuss a draft National Plan for the Protection of Manatees in Cuba, which included a number of short-term and mid-term objectives and activities. It is unknown to what extent the plan has been implemented. In general, Cuba has only recently recognized the need to study and protect marine fauna and habitat (A. R. Estrada, personal communication, 1993). Bahamas Manatees rarely occur in the Bahamas. The first recorded sighting was in 1904 in the Bimini Islands (Allen, 1942). Odell et al. (1978) observed a manatee in a boat basin at West End, Grand Bahama

436

Biogeography of the West Indies: Patterns and Perspectives

Island, in September 1975, and reported several other probable sightings on Grand Bahama Island between 1965 and 1977. A dead manatee, possibly the same one observed in September, was found at Freeport, Grand Bahama Island, in November 1975 (Odell et al., 1978). Reports of manatees in the Bahamas increased in the 1990s. The Bahamas National Trust logged 25 reports of sightings throughout the islands from 1995 through 1999, many gathered by the Bahamas Marine Mammal Survey (Lynn Gape, Bahamas National Trust, personal communication). On 15 November 1995, a dead manatee was recovered from the intake of a pumping station on Great Inagua at the southern end of the Bahamas. Other reports were from the northern Bahamas, including Cat Island, Highbourne Cay and Staniel Cay (Exumas), Eleuthera Island, New Providence Island, Andros Island, Great Harbour Cay (Berry Islands), Bimini, and many of the Abaco Islands. Residents of Walkers Cay (Abaco Islands) and Andros Island claim manatees were not seen before the 1990s. Between June 1997 and March 1998, sightings of one or two manatees were frequently reported in the Abaco chain of cays, including records from Tilloo Cay, Harbortown, Great Guana Cay, Man of War Cay, Little Abaco Cay, Black Sound Cay, and Walkers Cay. Two manatees, one with recent propeller scars, were given fresh water from hoses at the Man of War Marina on 15 February 1998. The same two manatees, identified by photographs of their scar patterns, appeared on 2 and 17 March at Walkers Cay and drank fresh water at the marina docks. These individuals may account for most of the recent sightings in the Abacos as they traveled among the islands. After the 17 March 1998 sighting at Walkers, no additional reports from the Abacos were received through December 1999. A manatee was reported in Bimini on 21 March 1996. Also in Bimini, during late winter 1998, a manatee was seen almost daily for 6 weeks and given fresh water from the marina hoses. From 17 November 1998 to 17 December 1999, a manatee (nicknamed Gina) was routinely seen in the harbor of the U.S. Navy’s Atlantic Undersea Testing and Evaluation Center (AUTEC) at Andros Island. This small adult female frequented the pier and boat ramp area, drank fresh water from hoses when it was provided, and approached divers. The longest documented period away from AUTEC was for 35 days between 10 April and 2 May. On 31 December 1999, residents on Great Harbour Cay in the Berry Islands observed a manatee in their marina (Reid, 2000). Sightings of this healthy and relatively tame, small adult female continued almost daily as she returned to drink fresh water from hoses at the marina. Using photographs of her distinctive scar patterns, she was identified as the same manatee that was seen at AUTEC in Andros during 1999. Her rate of travel, 145 km in 13 days, is similar to manatees in Florida. Several months after Gina was first sighted at Great Harbour Cay, an adult male manatee was frequently seen with her in the marina basin. Based on an analysis of photographs (Beck et al., 1995), Gina, as a calf with her mother, was in the Homosassa River on the Gulf coast of Florida in winter 1993, and again as an independent juvenile during winter 1994. This provides the first documentation for the Florida origin of Bahamas waifs. The movements of another manatee in Florida suggest a mechanism and route for manatees getting to the Bahamas. In 1998, an orphaned manatee calf named Mo that had been raised in captivity was radio-tagged and released at Crystal River, just north of the Homosassa River. Mo soon wandered offshore and drifted south approximately 480 km (300 mi) with offshore currents and was rescued in deep water 20 mi northwest of the Dry Tortugas, well outside normal manatee distribution. Gina probably had a similar misadventure offshore of Florida’s west coast, perhaps disoriented by a storm, eventually drifting into the Gulf Stream south of the Florida Keys and east onto the Great Bahama Bank. Because of the deep waters and strong currents separating Florida and the Bahamas, it is unlikely that manatees deliberately or repeatedly traveled between them. Odell et al. (1978) described the habitat at West End as “ideal” for manatees because of the presence of extensive Thalassia beds, but noted the possibility that limited freshwater sources in the Bahamas could restrict the distribution and size of a resident group of manatees, if one existed there. Limited sources of fresh water are believed to have been the main factor restricting manatee numbers in the Bahamas. Due to the karst topography typical of most of the islands, there is little steam flow runoff accessible to manatees. Natural sources of fresh water do occur on Andros Island,

Status and Biogeography of the West Indian Manatee

437

the largest in the Bahamas, but most fresh water is held inland as groundwater with no natural drainage to the marine waters. Fresh Creek may provide access to these inland fresh waters, provided manatees could navigate the uppermost reaches of this shallow tidal creek. Blue holes and submarine vents in shallow water off Andros are flushed with marine waters during tidal cycles but some may occasionally discharge fresh water. Although reports of sightings have increased, manatee numbers in the Bahamas are quite low. Manatees seen in the Bahamas may be strays from Florida, as documented above. Likewise, the Greater Antilles is a likely source for manatees found at Great Inagua or other southeastern Bahamas cays. There are no recorded observations of young calves in the Bahamas so the small numbers may not have allowed for reproduction. The prospect exists for an increase in the numbers of manatees in the Bahamas due to the apparent absence of hunting, immigration of waifs from outside the region, and reproduction. As manatees become tolerant of human presence and begin to utilize artificial sources of fresh water at marinas, resident groups may become established at some locations. Hunting of manatees for food has not been described for the Bahamas. Bahamas regulations, enforced by the Department of Fisheries, include protection for manatees. Manatees have not been recovered dead due to boat strikes, but some individuals bear scars and wounds typical of propeller injuries. Boat speed restrictions in selected areas used by manatees may be warranted.

CENTRAL AMERICA Belize Charnock-Wilson (1968, 1970) reported that aerial sightings of manatees were common in Belize (Figure 2), and that the outlook for the species was good there in comparison with other areas. In September 1977, Bengtson and Magor (1979) completed five aerial surveys of the shoreline, major rivers, prominent keys, and coastal and inland lagoons of Belize. They reported 101 sightings during 10 h of search time, which was the greatest rate of aerial survey sightings outside of Florida at that time. They reported 8.9% calves. In 1989 the major areas of manatee concentration, based on the 1977 survey, were flown again (O’Shea and Salisbury, 1991). A total of 102 manatees were sighted during 5.4 h of search time, with 10.6% calves (corrected for biases). In January and May 1994 and January 1995, aerial surveys of Belize and Chetumal Bay, Mexico, were completed (Morales et al., 2000). The analyses of these data did not use political boundaries, so the results are not easily compared with the earlier surveys of Belize. An average of 215 manatees per survey was seen, with 7.4% calves. In 1997, four surveys of Belize were completed in January, April, August, and December (Auil, 1998). The average number of sightings per survey was 272, with a range of 231 to 318. The average percentage of calves was 7.3%, with a range of 4.7 to 10.5%. Manatees are seen all along the Belize coast, but particularly important areas (north to south) include the New River and Shipstern Lagoon area in southern Chetumal Bay; the Belize River and associated offshore keys near Belize City; the Southern Lagoon area; the Commerce Bight, and Freshwater Creek and Sapdilla lagoons south of Dangriga; the Placentia and Indian Hill lagoons area; and the Deep River and Port Honduras region (Bengtson and Magor, 1979; O’Shea and Salisbury, 1991; Auil, 1998; Morales et al., 2000). Manatees sighted from aerial surveys are associated (in decreasing order) with rivers, lagoons, cays, and open coast habitats (Morales et al., 2000). Several radio-tagged manatees in Southern Lagoon are currently being monitored via satellite and conventional ground-based methods (J. A. Powell, personal communication), which should contribute significant ecological and life history information. O’Shea and Salisbury (1991) concluded that “… Belize remains one of the last strongholds for this species in this part of the world,” which continues to be the case based on more recent information (Auil, 1998, Morales et al., 2000). In general, low human population densities, associated activities (Auil, 1998), and favorable manatee habitats contribute to these optimistic findings. The long offshore barrier reef shields most of the irregular coastline, which has numerous large

FIGURE 2 Distribution of the West Indian manatee (Trichechus manatus) in Mexico and Central America.

438 Biogeography of the West Indies: Patterns and Perspectives

Status and Biogeography of the West Indian Manatee

439

rivers and lagoons, from strong tidal currents and significant wave action. The southern coast of Belize, however, is less sheltered, and the rivers and creeks are faster flowing and rockier, which results in fewer manatees using this region (Charnock-Wilson, 1968; Auil, 1998). Manatees have been protected in Belize since 1935 (O’Shea and Salisbury, 1991), and they have been listed as endangered under the Belize Wildlife Protection Act of 1981 (Auil, 1998). Considerable poaching activity, however, has apparently occurred during the entire period of protection. In addition, manatees are occasionally caught and killed incidentally in fishing nets and traps, and struck and killed by boats and barges (Auil, 1998). Poaching, however, appears to be the biggest source of human-caused mortality. During the 1960s through 1980s, it was believed that illegal killing had declined due to the loss of desire to hunt or eat manatees, or to their decline in abundance (Charnock-Wilson, 1968, 1970; Murie, 1935, cited in O’Donnell, 1981). However, Charnock-Wilson et al. (1974) reported 12 manatees killed at Ambergris Cay for sport and for the sale of meat at San Pedro. Matola (personal communication) observed that poaching attempts continued near Ambergris Cay in 1986, and that manatees were still being eaten along the Manatee River. In 1995, 11 separate butchering sites, with at least 35 manatee carcasses, were discovered in the Port Honduras area (Bonde and Potter, 1995). In 1997, five more recent carcasses were found in the Deep River area, and another “heap” of fresh bones was discovered near Punta Negra (Maheia, 1997; Domning, 1997a). Despite attempts to curtail the poaching (Auil, 1998), it continued into 1998, with additional evidence that the meat was being taken to Guatemala for sale, rather than being sold or consumed in Belize (Bonde, 1998). The Belize Manatee Recovery Plan (Auil, 1998) is similar in structure and content to recovery plans for endangered species in the United States. It reviews the current status and biology of manatees in Belize, discusses in depth the known and potential conservation problems, and develops actions and funding mechanisms designed to effect long-term conservation solutions for manatees. In addition to human-caused mortality reviewed above, the plan focuses on several indirect potential problems, including coastal zone development for an expanding human population and the impacts of a rapidly increasing tourist industry. The recovery plan has been endorsed by the Belize Ministry of Natural Resources and the Environment, which is also committed to implementing many activities in the plan. Guatemala Guatemala (Figure 2) has the smallest Caribbean coastline in Central America and a small number of manatees. Within the Lago Izabal/Río Dulce system, the wetlands at the mouths of the Río Polochic and Río Oscuro on the western side of the lake were considered the best manatee habitat, although numbers there may have been greatly reduced by the late 1970s (Janson, 1978, 1980). Quintana (1993) conducted aerial surveys in five areas during January, March, April, and May 1992. The five areas surveyed represented most of the available manatee habitat in Guatemala: the Caribbean coast, inland lakes (Izabal and El Golfete), and three river systems (Dulce, Sarstún, and Motágua). During 40 h of total survey time, 73 manatees (66 adults and seven calves) were sighted. Calves were frequently observed in Cayo Padre. Group sizes ranged from 1 to 8 (n = 24), and Quintana (1993) estimated the manatee population in Guatemala to be 53 ± 44 (95% confidence interval). Quintana (1993) also concluded that Lago Izabal provides the best habitat for manatees, particularly between Punta Chapín and Cayo Padre. This area was characterized by numerous shallow canals and lagoons (mean depth of 2 m), a mean water temperature of 29°C, freshwater aquatic vegetation including Chara sp., Nymphaea ampia, and Pistia stratiotes, and relatively little boat traffic. El Golfete may serve as a corridor between Lago Izabal and the coastal areas (Quintana, 1993). Presence of manatees in coastal areas tends to increase during the winter (May), when salinity declines. El Golfete has heavy boat traffic, and manatees are occasionally hit by boats (Quintana, 1993). Manatees in Guatemala have been protected since 1959, and Guatemala is a signatory of CITES. Mortality caused by gillnets, hunting, and boat collisions has been reported (Quintana, 1993).

440

Biogeography of the West Indies: Patterns and Perspectives

Shooting or hunting was reported from near Cayo Piedra in El Golfete and Laguna Perdida on the Río Motagua during 1986 (Grisko, personal communication), and three manatees (including a calf) were killed for their meat in Lago Izabal and Livingston in the early 1990s (Quintana, 1993). A manatee reserve, the Biotopa para la Conservación del Manatí Chocón-Machacas, was established in 1979, and encompasses the northeastern shore and surrounding habitat of El Golfete. This was the first manatee reserve designated anywhere in Central or South America, and is indicative of the desire of Guatemala to protect manatees. Given the reports of severely depressed numbers and continued hunting, the outlook for manatees in Guatemala is not good. Their more substantial numbers in neighboring Belize, however, could provide sources for natural recolonization should conditions become more hospitable in Guatemala through the continued existence of the Biotopa Chocón-Machacas reserve, stronger enforcement of laws, and increased educational efforts. Quintana (1993) further recommended more intensive surveys of Lago Izabal, determining the distribution of aquatic vegetation in Lago Izabal, and maintaining protection of El Golfete as a manatee travel corridor. Honduras Manatees are found in four regions along the coast of Honduras: the area between the Chamalecon and Punta Sal rivers, west of Bahia de Tela; the area between Río Colorado and Porvenir, west of La Ceiba; Laguna Bacalar, Laguna Ibans, Laguna Brus, and Río Platano in and near the Reserva de Biosfera; and Laguna de Karatasca (Klein, 1979; Rathbun et al., 1983; Cerrato, 1993) (Figure 2). The rivers and lakes of eastern Honduras provide the most extensive habitat for manatees (Klein, 1979), although relatively few sightings were made there during an aerial survey in 1979 (Rathbun et al., 1983). Rathbun et al. (1983) observed manatees 46 times in 16 h of aerial surveys in 1979 and 1980 at the following locations: the coast near Zambuco, Laguna de Boca Cerada, Laguna de Tansin, and mouths of the Río Lecan, Río Cuero, and Río Salado. Most of the sightings were not offshore, but at coastal lagoons and rivers. Reports of manatee sightings and killings during the mid-1970s also exist for the mouth of the Río Chamelecón near Puerto Cortés, and the Río Congrejal near La Ceiba (Klein, 1979). Cerrato (1993) guessed that the number of manatees in Honduras was approximately 120 to 140 individuals, based on direct counts from boats or planes, interviews with fishermen, and surveys conducted by Rathbun et al. (1983). The regions where manatees occur are sheltered, have access to fresh water, and are characterized by abundant aquatic vegetation. The remainder of the Honduran coast is characterized by strong surf, steep shorelines, and a lack of broad, slow-moving rivers, and does not provide suitable habitat. Manatees that utilize the wetlands along the borders with Guatemala and Nicaragua may migrate seasonally (Cerrato, 1993). Reports based on interviews made during the 1970s are unanimous in the conclusion that manatee abundance has declined markedly in Honduras (Klein, 1979; Rathbun et al., 1983). This decline is the result of widespread gillnetting, both incidental and intentional, and habitat degradation (Cerrato, 1993). Manatees have been protected by law in Honduras since 1959 (Article 49 of Fisheries Law, Decree No. 154), but enforcement has not been effective. Manatees may have become nocturnal in response to hunting pressure (Rathbun et al., 1983); nevertheless, a substantial illegal take has continued into the 1980s (G. Cruz, unpublished data). Small calves were observed during the 1979–1980 aerial surveys, and there is extensive remaining favorable habitat. Effective law enforcement is therefore a major key to the recovery of manatees in Honduras. A national program for environmental education and manatee conservation is lacking (Cerrato, 1993). Some local educational efforts have been conducted in Refugio de Vida Silvestre and Parque Nacional Punta Sal, west of Ceiba. Nicaragua Two aerial surveys were flown in 1992 over the main rivers and lagoons along the northern half of Nicaragua’s coast (Carr, 1994) (Figure 2). A total of 71 manatee sightings were made, primarily

Status and Biogeography of the West Indian Manatee

441

in Bismuna and Waunta lagoons (Carr, 1994). The sighting rate of four manatees/h is one of the highest for the Caribbean region, indicating good habitat and a healthy population (Carr, 1994). A study of manatee distribution along the southern half of the coast, based on boat surveys for feeding signs and interviews of local inhabitants, determined that manatees are widely distributed along the lower tracts (up to 60 km inland) of the region’s waterways (Jiménez and Cateula, 1998; Jiménez, 2000a). Manatees appear to be currently absent from Lago de Nicaragua (Jiménez, 2000a), and have been described as scarce in or absent from areas they previously occupied (Nietschmann, 1979; Jiménez, 2000a). Nietschmann (1979) reported a manatee sighting off Set Net, one of the Pearl Cays. The Caribbean coast of Nicaragua comprises some of the finest and most extensive habitat for manatees in Central America (Carr, 1994; Jiménez, 2000a). The Miskito lowlands stretch over nearly the entire eastern coast of the country, and consist of wetlands with numerous long, slowmoving rivers emptying into many interconnected coastal lagoons. The extensive floodplains of eastern Nicaragua are as wide as 100 km in some areas (Jiménez, 2000a). Large, estuarine lagoons and bays occur along the coast primarily in the northern half of the country. Manatees appear to migrate from one lagoon to another, and from lagoons into rivers during the dry season (Jiménez, 2000a). Shallow waters with lush seagrass beds extend far offshore (Phillips et al., 1982). Extremely high rainfall creates a corridor of brackish to fresh water parallel to the coast (Murray et al., 1982), which may attract manatees. Human population density in coastal Nicaragua has been relatively low. Manatees have been protected in Nicaragua since 1956 under general hunting laws (Legislative Decree 306). However, manatees have been a traditional food source for indigenous people in this area, who hunt them using harpoons (Nietschmann, 1972; Loveland, 1976; Carr, 1994; Jiménez, 2000a). A small group of fishermen reported that nine manatees were killed in Waunta Lagoon in February 1992 (Carr, 1994), and Jiménez (2000a) estimated that over 30 manatees/year are taken by poachers in Nicaragua. Another threat is the use of gillnets in lagoons used by manatees, despite legal prohibition (Jiménez and Cateula, 1998; Jiménez, 2000a). Eastern Nicaragua lacks industrial or intensive agricultural activities; however, gold mining could contaminate river waters with toxic elements such as heavy metals and arsenic (Jiménez, 2000a). In 1998, the activities of a wood treatment plant of a logging company were discharging toxic chemicals into rivers, potentially harming manatee habitat downstream (Domning, 1998b). In 1991, the federal government established the Miskito Coast Biological Reserve (Carr, 1994), a 5,000-ha protected area including vital coastal wetlands and lagoons. The Southeastern Nicaragua Biosphere Reserve was established in 1999, and is somewhat better protected than the Miskito Coast Reserve, especially on the San Juan and Indio rivers (Jiménez, 2000b). In general, law enforcement personnel are lacking in Nicaragua, and educational programs have been minimal (Jiménez, 2000a). Costa Rica Manatees probably continue to occur in reduced numbers in two areas of favorable habitat along the eastern coast of Costa Rica (Figure 2). The most extensive of these areas is the broad coastal plain of northeastern Costa Rica (Llanura de Tortuguero). A few manatees may also occur in southeastern Costa Rica, at the mouth of the Río Sixaola on the Panama border, at the mouth of the Río Estrella, and in Laguna Gandoca (O’Donnell, 1981). The area between Limón and Panama is generally less favorable habitat, with mountains reaching to the sea and few large rivers or lagoons. D. E. Wilson (1974) and O’Donnell (1981) conducted interviews and site visits in the 1970s, which suggested that few, if any, manatees occurred in this region. These investigators also made overflights in northeastern Costa Rica between Tortuguero and Barra del Colorado without observing manatees. Through interviews, however, they concluded that this area contained the last noteworthy but small group of manatees in Costa Rica. Wilson and O’Donnell agreed that much

442

Biogeography of the West Indies: Patterns and Perspectives

of the habitat along the inland waterways and rivers of the Tortuguero region seemed to provide favorable conditions for manatees. Sightings were made during the 1970s in Tortuguero National Park, Río Servulo, Laguna Penitencia, Laguna Yaqui, Laguna Coronel, the lower Río San Carlos, Río Sierpe, and around Parismina (O’Donnell, 1981). Manatees were thought to be absent or very rare in the Río Sarapiqui, Río Puerto Viejo, and the middle Río San Juan, although small numbers may exist in Lago Arenal far up the Río San Carlos (D. E. Wilson, 1974; O’Donnell, 1981). Evidence of a decline began to be apparent in the 1950s (O’Donnell, 1981). Reynolds et al. (1995) concluded that manatees were rare in Tortuguero and along the northeastern coast, based on 60 h of boat surveys in 1984 and 6 h of aerial surveys in 1991. Interviews indicated that manatees had been common in the 1940s, but had declined precipitously since the 1950s (supporting O’Donnell’s 1981 findings). Jiménez (1998) and Smethurst and Nietschmann (1999) indicate that manatees may be more abundant in Tortuguero than previously thought. The latter authors conducted more intensive boat surveys (3500 person hours) and interviews from 1996 to 1998, making 29 manatee sightings and documenting 61 others through interviews. Anecdotal information suggests that manatees in Costa Rica migrate downriver in the dry season and upriver in the wet season, prefer quiet canals, have nocturnal or crepuscular activity peaks, prefer “grasses” as food, and are occasionally preyed upon by sharks (Reynolds et al., 1995). Smethurst and Nietschmann (1999) identified deep holes in the river around which manatees aggregate (“blowing holes”) and suggested that manatees avoid areas of heavy boat traffic and favor areas where degradation is minimal. Manatees in Tortuguero occur especially in Caño Servulo and Agua Fria/Cuatro Esquinas, where environmental degradation has been minimal (Reynolds et al., 1995; Smethurst and Nietschmann, 1999). The manatee is probably one of Costa Rica’s rarest wildlife species because of past and present hunting pressure (Vaughan, 1983). Deforestation caused by logging, banana cultivation, and cattle ranches have greatly increased sedimentation in rivers and lagoons, making it difficult for manatees to enter the Tortuguero river system (Smethurst and Nietschmann, 1999). Other threats include heavy boat traffic, pollution, net entanglement, and ingestion of discarded plastic banana bags (Reynolds et al., 1995; Jiménez, 1998; Smethurst and Nietschmann, 1999). Habitat was destroyed by dredging and dynamiting in the construction of Tortuguero canals from 1963 to 1972 (Smethurst and Nietschmann, 1999). Tortuguero National Park is the most important protected area for the manatee (Vaughan, 1983), although protection is less than ideal because many of its rivers extend outside of park boundaries (Smethurst and Nietschmann, 1999). Other protected areas include the Barra del Colorado Wildlife Refuge and the Gandoca-Manzanillo Refuge (A. Vásquez R., personal communication, 1993). Law 7317 (Ley de Conservación de la Fauna Silvestre) of October 1992 penalizes hunting and commerce in manatee products (Reynolds et al., 1995). Smethurst and Nietschmann (1999) point out that an integrated effort, involving local people, ranchers, logging companies, banana growers, and government entities, will be necessary to prevent further decline of Costa Rica’s manatee population. In addition, public education, continued interviews with fishermen, characterization of habitat, and development of research and conservation plans are needed (Reynolds et al., 1995). A regional conservation effort with neighboring Panama and Nicaragua will ultimately be needed (Reynolds et al., 1995). Panama Panama has the longest Caribbean coastline of the Central American countries. Information on the present distribution and abundance of manatees in Panama is scant. The range is apparently fragmented by habitat discontinuities and possible depletion. Most of the current reports suggest that manatees continue to exist in regions of optimal habitat (lower reaches of large, slow-moving rivers and protected lagoons) but are seldom seen elsewhere.

Status and Biogeography of the West Indian Manatee

443

The region from the Costa Rican border to Punta Valiente may constitute the most favorable habitat (Figure 2). O’Donnell (1981) received reports of manatees in the lower parts of the following rivers in this region: Río Sixaola, Río San San, and Río Changuinola. MacLaren (1967) reported on the capture of nine manatees from the Río Changuinola in 1963–1964 as part of a translocation project. Montgomery (1980) observed a few manatees in the lower Río San San during a series of brief overflights of this region, but did not observe them elsewhere in very limited surveys of the Changuinola area and the coast to the Río Guarumo, including the Laguna Chiriquí. Manatees observed feeding on seagrass beds in the Boca del Dragón area by fishermen are thought to move between that area and the Río Changuinola, rather than east to the Bahía Almirante (O’Donnell, 1981). No reports of manatees in the Laguna Chiriqui reached O’Donnell, although he was told that manatees persisted in the sparsely settled, heavily vegetated lower reaches of the Río Manatí. The coastline east of Punta Valiente to Río Coclé del Norte lacks large lagoons, and the rivers are settled at their mouths and swifter than in the Bocas del Toro region. Manatees are currently only known from the relatively uninhabited Río Veraguas in this region (O’Donnell, 1981). Manatees apparently enter the Río Coclé del Norte and Río Miguel de la Borda only in the dry season, when they remain in the lower reaches. None has been reported from the Río Indio. Manatees occurred in the Río Chagres prior to the construction of the Panama Canal (MacLaren, 1967). The number occupying the canal system may have been augmented by the translocation of nine manatees from the Río Changuinola area to the Río Chagres in the 1960s, and manatees may now reach as far as the Pacific Ocean (MacLaren, 1967; Schad et al., 1981; Montgomery et al., 1982; Muizon and Domning, 1985). There is almost no information on the distribution of manatees over the long stretch of Caribbean coastline extending from Colón to the Colombian border. The mountains come close to the shore along this coast, which is marked by swift and shallow rivers and an absence of lagoons or extensive swamplands. This lack of information coupled with uncharacteristic habitat may indicate an absence of manatees. Replicate aerial surveys were conducted during 1987 in the Bocas del Toro Province along the Caribbean coast (Mou Sue et al., 1990). A total of 70 manatee sightings (15.7% calves) were made in 22 surveys, in 54 h of flight time. The majority of sightings were made in the lower reaches of rivers, particularly Río San San, or in riverine lagoons. Sightings were also made in Río Mananti and Río Cana. The lack of sightings in other Bocas del Toro rivers is probably related to poor visibility rather than absence of manatees. For example, interviews indicated that manatees are relatively common in the turbid, vegetation-covered canals and lagoons of Río Changuinola, although none was seen in the 1987 surveys. Two adults and one calf were observed in Ensenada de Soropta, 10 km northeast of the mouth of the Río Changuinola (Mou Sou et al., 1990). This area is characterized by the presence of seagrass patches and coral reef. During 5.5 survey hours, only one manatee was observed in Lago Gatun, but interviews suggested they occur in other areas of the lake and the Panama Canal (Mou Sue et al., 1990). Presence of manatees on the Pacific coast was not confirmed. Manatees were not observed in 11.5 survey hours along the Caribbean coast outside Bocas del Toro Province, between Punta Valiente and Ustopo. The authors concluded that the resident manatee population in Panama is centered in Bocas del Toro and in Gatun Lake and associated waters. True grasses (Poaceae) seem to be an important food for manatees in Panama’s rivers. Interviewees reported observing manatees feeding on shore grasses, and Mou Sue et al. (1990) observed numerous patches of grazed shore grasses along the Río San San. Panama is signatory of the CITES and Ramsar conventions, under which the San San area is listed as a wetland of international importance (Viquez, 1993). Despite protection by Executive Decree No. 23 of January 1967 and Resolution DIR-002-80 of the Department of Natural Resources, manatees are still killed by people in Panama and the meat illegally sold. Incidental drowning in gill nets does not seem to represent a major problem in Panama, so poaching may be the most crucial danger to manatees. Poaching has been reported in the Río San San, Sixaola, and probably

444

Biogeography of the West Indies: Patterns and Perspectives

the Río Changuinola (Mou Sue et al., 1990). Occasional killing was also reported from western Gatun Lake and in rivers of the Veraguas and Colon provinces. Future habitat degradation caused by operation of banana plantations and settlement following road construction for a new pipeline may put additional pressure on the manatee population (Mou Sue et al., 1990). The Changuinola region, between the San San and Changuinola rivers, is an area of intense cattle-ranching and banana plantation activities that degrade water quality. Other potential threats to manatees include the alteration of the San San wetlands (Bocas del Toro) for peat exploitation, the construction of a road connecting Isla de Colón to the continent to promote tourism, and the implantation of a hydroelectric project in the Teribe and Changuinola rivers (Viquez, 1993). Mou Sue et al. (1990) recommended that the small remaining manatee population in Panama be protected by providing reserve status to some of the unsettled rivers used by manatees, enforcing hunting regulations, promoting conservation education, reducing water pollution, and maintaining a ban on gill-net fishing in rivers. Education programs oriented to adult communities are lacking (Viquez, 1993).

SOUTH AMERICA Colombia Montoya-Ospina et al. (in press) conducted interviews from 1989 to 1995 and reviewed historical and recent information on manatee status, distribution, and causes of mortality in Colombia (Figure 3). Their findings generally support those of earlier researchers, who reported that the upper reaches of the Río Magdalena between Baranquilla and Bogotá, and the Río Atrato and its confluence with Bahía Candelaria appeared to have the largest remaining groups (Powell and Gicca, 1975; Husar, 1977). Although Husar (1977) reported small numbers of manatees within the Parque Naciónal Isla de Salamanca, there is no recent information on sightings or captures in the park (Montoya-Ospina et al., in press). A pair of captive manatees from the Río Magdalena was introduced to a pond in the park in March 1997 as part of a government education program. Manatees in Colombia are in danger of extirpation because of hunting. Their skin, fat, and bones are currently used in a variety of products, including hammocks, candles, and asthma and snake bite cures (Montoya-Ospina et al., in press). They have been protected from hunting since 1969 under Resolution 574 of INDERENA, Colombia’s natural resource agency. More recently, Colombia has adopted Law 17 (1981) and Law 165 (1994), and has become a signatory of CITES and the Biologic Diversity Treaty of 1992; however, funding continues to be inadequate for effective law enforcement, research, and education efforts. Law 99 (1993) allowed military and police corps personnel to enforce wildlife regulations, and established a central agency, the Ministerio del Medio Ambiente (MMA), to determine general policy for conducting wildlife management. The MMA prepared a National Recovery Plan in 1998, but a national agreement on the priorities for the conservation of manatees in Colombia has not yet been established (Montoya-Ospina et al., in press). In some cases, local communities enforce protection, for example, in Ciénaga de Paredes. Because of its geographical location, the city of Magangué may be a very important target for development of manatee education and research programs (Montoya-Ospina et al., in press). In 1991, the Corporación Autónoma Regional de los Valles del Sinu y del San Jorge (CVS) started a rescue and rehabilitation program for calves and adults, and educational programs. Venezuela There has been little research on manatees in Venezuela because of the remoteness of their habitat and poor visibility in the waters where they live (Delgado, 1995). Manatees occur in reduced numbers in parts of Lago de Maracaibo, and in greater abundance in the Orinoco River system and in drainages of eastern Venezuela along the Golfo de Paria (Mondolfi, 1974; O’Shea et al., 1986) (Figure 3). O’Shea et al. (1986) conducted interview and aerial surveys of potential manatee habitat

FIGURE 3 Distribution of the West Indian manatee (Trichechus manatus) in South America.

Status and Biogeography of the West Indian Manatee 445

446

Biogeography of the West Indies: Patterns and Perspectives

throughout Venezuela in early 1986. Aerial surveys yielded poor results in most areas because of water turbidity, and possibly because of low numbers and dry season inactivity. A small number of manatees exist in Lago de Maracaibo, centered northwest of Maracaibo City in the Río Limón/Laguna Sinamaica region and on the southwestern part of the lake bordering the extensive swamps of the Cienaga Juan Manuel de Aguas Claras y Aguas Negras. O’Shea et al. (1986) concluded that there are no resident manatees along the Caribbean coast between Lago Maracaibo and the Boca del Dragón separating Trinidad and Venezuela, and that no historical evidence exists for their former occurrence on this coast. In 1990, however, a manatee accidentally drowned in fishing nets at the mouth of the Neverí River, in Barcelona (Anzoátegui State), and one was sighted in 1991 in the harbor of Puerto Cabello (Carabobo State) (Ojeda et al., 1993; Delgado, 1995). The northern coast of Venezuela is characterized by long, often desert stretches of rocky, mountainous coastline with high-energy beaches, deep water, and relatively cool sea surface temperatures; pockets of habitat that are suitable for manatees (sheltered lagoons and bays with freshwater input) have been settled by people for centuries (O’Shea et al., 1986). The general absence of manatees along the extensive Caribbean coast of Venezuela appears to be the result of habitat unsuitability, and represents a major discontinuity in the range of this species. Eastern Venezuela provides a dramatic contrast to the Caribbean coastline, however, with frequent reports of continued manatee occurrence, numerous broad, slow-moving rivers, estuaries, mangrove swamps, and warmer waters. Mondolfi and Müller (1979) reported more than 30 locations inhabited by manatees in the states of Sucre, Monagas, and Delta Amacuro. Manatees continue to occur in most of the waterways of the extensive Orinoco delta and throughout the middle Orinoco and its tributaries as far as depths and currents allow (O’Shea et al., 1986; Correa-Viana, 1995). Strong seasonal fluctuations in rainfall and water levels may have a dramatic impact on manatee ecology in this region. Manatees have been reported to feed on 18 plant species in Venezuela, including mangrove (Avicennia and Rhizophora), grasses, sedges, Montrichardia arborescens, and Eichhornia (O’Shea et al., 1986). In 1992, a group of English students associated with Project Mermaid recorded 11 sightings of manatees during a period of 19 days in Caño La Brea, a mangrove-lined tributary of the San Juan River running into Golfo de Paria (Sucre State, northeastern Venezuela) (K. Gotto, personal communication, 1993). In the same year, studies by PROFAUNA recorded two live and one dead manatee in Caño La Brea. PROFAUNA also reported three and two manatees in Laguna de Taguache (southern Anzoátegui State) in 1992 and 1993, respectively, and one where the Tigre River meets the Morichas Largo River, in Monagas State in 1993 (Ojeda et al., 1993). Hunting for local markets in Venezuela was relatively heavy during the middle of the present century and resulted in a reduction in manatee abundance within their current range (Mondolfi, 1974; Mondolfi and Müller, 1979; O’Shea et al., 1986). Hunting activities appear to have declined substantially in recent years in response to laws protecting the species, education campaigns, and a general lack of interest in manatee hunting by the younger generations (O’Shea et al., 1986). Manatees are protected in Venezuela by Ley de Protección a la Fauna Silvestre of 1970 (Articles 11 and 77) and Resolución MARNR (Ministry of the Environment and Renewable Natural Resources) No. 127 of 1978 (Ojeda et al., 1993); however, illegal hunting by the indigenous Warao and some fishermen continues (Ojeda et al., 1993). Four national parks encompass areas of known manatee occurrence: Ciénagas del Catatumbo (Zulia State), Mariusa (Delta Amacuro), Santos Luzardo (Apure State), and Turuépano (Sucre State). The park boundaries, however, have not been well defined, which has allowed the development of activities that are incompatible with the conservation of natural environments (Delgado, 1995). For example, seismic prospecting within Turuépano National Park has impacted habitat important to manatees and other aquatic mammals. Construction of dams, drainage of wetlands, development of the Orinoco–Apure region, construction of river ports, increase in river traffic, petroleum exploitation, deforestation (including exploitation of mangroves), and other habitat disturbance and destruction threaten the future existence of the manatee in Venezuela (Correa-Viana, 1995).

Status and Biogeography of the West Indian Manatee

447

The waters of eastern Venezuela and the Orinoco system provide some of the largest continuous manatee habitat anywhere within the species’ range. If hunting pressure and development impacts can be controlled, Venezuela has the potential to provide a major stronghold for manatees in the future. In 1992, during an International Symposium on Dolphins and other Aquatic Mammals of Venezuela, held in Caracas, an action plan for research and protection of manatees was written (Ojeda et al., 1993). Law enforcement, education, and research programs were recommended, as were formation of a group of experts to advise officials on aquatic mammal conservation issues and reevaluation of national park boundaries in light of their intended purpose (Delgado, 1995). Strict regulations on the use of nets and other fishing gear, particularly in the Orinoco River basin, education of fishermen, and monitoring of habitat important to manatees have also been recommended (Correa-Viana, 1995). Trinidad Information on manatees in Trinidad was obtained by Bindernagel in the early 1980s (Garrett, 1984; Hislop, 1985), and more recently by Boyle and Khan (1993). A survey of accessible locations and discussions with local residents indicated that there are possibly 25 to 30 manatees in Trinidad, located in rivers and along the eastern coast of the island (Boyle and Khan, 1993). A small number of manatees are present in Nariva Swamp, a large, freshwater swamp extending about 20 km north from Guataro Point to Manzanillo Bay. During the dry season, much of the swamp becomes inaccessible to manatees, which may become trapped in ponds. Manatees in Nariva Swamp are reported to feed upon water hyacinth (Eichhornia crassipes), water lettuce (Pistia stratiotes), cascadura grass (Leersia hexandra), Kharmi bhaji (Ipomoea aquatica), and pennywort (Hydrocotyle umbellata) (Boyle and Khan, 1993). Manatees have also been reported in the North Orepouche, Charamel, and Otoire Rivers. Although poaching is occasionally reported, the primary threat to manatees in Trinidad is loss of habitat through agriculture and development (Boyle and Khan, 1993; Amour, 1993). Quarrying, dredging, and logging along the North Orepouche River have resulted in heavy siltation. All of Trinidad’s east coast is vulnerable to oil pollution from ocean freighters, and oil can be seen on many of the beaches along this coast. Red tides have occurred along the east coast, and could potentially cause mortality in Trinidad’s small manatee population, as it has in Florida. Although not specifically named, manatees in Trinidad can be viewed as a protected species under the Conservation of Wildlife Act Chapter 67:01, the Fisheries Act Chapter 67:51, and the Archipelagic Waters and Exclusive Economic Zone Act No. 24 (Toppin-Allahar, 1993). Protection of habitat is provided under the Forest Act Chapter 66:01. The Nariva Swamp was named as a Ramsar site in April 1993. While the Ramsar Convention on Wetlands of International Importance for waterfowl habitat also affords some protection for manatee habitat, law enforcement efforts and habitat protection are generally inadequate, and manatees in Trinidad are still threatened with extinction (Amour, 1993). The Manatee Subcommittee of the Trinidad and Tobago Field Naturalist’s Club was formed in 1991 to develop public education programs for schools (Boyle and Khan, 1993). A Trinidad and Tobago Conservation Trust Fund has been proposed to establish organized research, management, and conservation efforts for manatees and their habitat. Guyana Current information is lacking on manatees in Guyana (Figure 3), and a systematic survey is needed. Manatees occurred all along the coast, but were most frequently reported in river or canal mouths (Bertram and Bertram, 1973). The greatest concentrations occurred in the eastern region, on both sides of the border with Suriname (Husar, 1977). Considerable numbers of manatees were noted in the Canje and Abary Rivers, particularly in wet savannahs in their upper reaches (Bertram and Bertram, 1973). Manatees were also reported in the Courantyne, Berbice, Demerara, Essequibo, Pomeroon, Arapiako, Akawini, Waini, Barima, and Kaituma Rivers.

448

Biogeography of the West Indies: Patterns and Perspectives

Manatees in Guyana apparently consume a wide variety of marine, estuarine, and freshwater vegetation; Montrichardia arborescens, an aquatic herb, was specifically noted by Bertram and Bertram (1964). Allsopp (1969) noted a wide variety of freshwater aquatic plants consumed by manatees in canals. Rivers with large masses of floating grass were described as providing the most suitable environment for manatees (Bertram and Bertram, 1964). Bertram and Bertram (1963) estimated that there were some thousands of manatees in Guyana, yet their numbers were generally believed to be much reduced from former times. Manatees have been protected in Guyana since 1956 (Fisheries Ordinance No. 30, Revised No. 13, 1961), and hunting no longer appeared to be a serious problem (Bertram and Bertram, 1973; Husar, 1977). Accidental entanglement in fishermen’s nets may have resulted in some deaths, but manatees were not a welcome catch as they could cause considerable damage to nets (Roth, 1953). Motorboat strikes may have become an increasing problem in Guyana (Roth, 1953; Bertram and Bertram, 1964). Manatees were used experimentally for biological weed control in Guyana since 1916 (Allsopp, 1960; Bertram and Bertram, 1963; National Science Research Council of Guyana and National Academy of Sciences, 1973). The establishment of an international center for manatee research and conservation in Georgetown was proposed in the early 1970s (National Science Research Council of Guyana, 1974). Suriname Little information exists on current manatee status and distribution. Manatees reportedly occurred in most of the coastal plain rivers of Suriname (Figure 3), usually not farther than 60 km inland (Bertram and Bertram, 1973; Husson, 1978). Duplaix and Reichart (1978) reported the greatest concentrations in Nanni Creek and the Coesewijne, Tibiti, and Cottica Rivers. However, they believed that manatees were easier to observe in these smaller creeks and rivers than in broader rivers such as the Corantijn, lower Saramacca, and Commewijne. Manatees have also been observed or reported in the Maratakka, Nickerie, Wayambo, Coppename, and Surinamee Rivers (Husson, 1978; Duplaix and Reichart, 1978). In 1966 and 1971, Dekker (1978) visited tidal areas of the Commewijne, Cottica, and Cassiwinica Rivers, and upstream, freshwater areas of the Coesewijne River and Nanni Creek. He recommended the Coesewijne River and Nanni Swamp as nature reserves for the manatee in Suriname. Mangrove forests provided manatee habitat in the flat coastal regions and river estuaries of Suriname (Duplaix and Reichart, 1978). Husson (1978) stated that manatees had never been found in the open ocean off the coast of Suriname. Swamp forests behind the mangroves were also inhabited by manatees, which grazed on stands of Montrichardia arborescens along the banks at high tide (Duplaix and Reichart, 1978). Dekker (1974, 1978) believed that manatees in Suriname favored fresh water because of their preference for “Mokko mokko” (Montrichardia), although many other plant species were also eaten. They could be heard grazing on bank plants, sometimes for hours at a time (Dekker, 1978). Savannah swamps, or floating savannahs, were found in upper river reaches, and were characterized by Cyperus and Montrichardia. Husson (1978) also noted Montrichardia as a manatee food in Suriname, as well as Machaerium lunatum, Caladium arborescens, and Panicum. In contrast to Bertram and Bertram’s (1973) findings in Guyana, Duplaix and Reichart (1978) reported that manatees were not found in the floating savannahs, but in the small creeks transecting them. Seasonal flooding undoubtedly made vegetation in the floating savannahs accessible to manatees. Rapids in the upstream portions of Suriname’s rivers prevented manatees from traveling farther upriver (Duplaix and Reichart, 1978). Duplaix and Reichart (1978) interviewed 89 residents, primarily Amerindians, and found that although some people believed the manatee had become more common in recent years because it was no longer hunted, former hunters described the manatee as having disappeared from its usual haunts over the past 30 years. Manatees are still poached for food or for the alleged medicinal powers of the ear bones (Department of Nature Conservation, 1993).

Status and Biogeography of the West Indian Manatee

449

Manatees receive some protection under Suriname’s Nature Protection and Game Ordinances. Suriname ratified the CITES convention in 1981. Although no reserve has been created specifically for manatees, they were found in the estuary and mangrove swamps of the Coppename River Nature Reserve, covering 10,000 ha (Duplaix and Reichart, 1978). None of the manatees observed bore propeller scars, but commercial river traffic was heavy and the increasing use of outboard motors by fishermen and hunters was anticipated to eventually become a problem (Duplaix and Reichart, 1978). Some incidental taking in nets was also likely to occur. Duplaix and Reichart (1978) suggested that more vigorous enforcement of existing conservation laws and protection of areas with the highest manatee density, such as Nanni Creek, the upper Coesewijne River, and the Perica River, were needed to improve the status of the manatee in Suriname. French Guiana The absence of a broad coastal plain in French Guiana (Figure 3) led Bertram and Bertram (1964) to conclude that there was little suitable manatee habitat in this country. We know of no aerial survey or interview studies on manatee abundance or distribution in French Guiana. Brazilian hunters in the vicinity of Río Oiapoque on the Brazilian border reported manatees in the rivers Approuague, Mahury, Laughan, and Ouanary, as well as in some of the smaller rivers in eastern French Guiana (Best and Teixeira, 1982). Brazil Systematic survey data are generally lacking for Brazil (Figure 3), although interviews of fishermen and coastal residents have been conducted in some areas, particularly northeastern Brazil. On the north coast, T. manatus occurs along the coast of Amapá north of Cabo Norte, in the Rio Mearim in Maranhão (Domning, 1981a), and along the coast of Rio Grande do Norte. The species seems to have been exterminated from the coast of Pará, and may be absent from the Marajó region, where the presence of T. inunguis has been confirmed (Domning, 1981a, 1982a). Banks (1985), however, noted a 1983 report by Catuetê and Duarte of the coexistence of T. manatus and T. inunguis at the mouth of the Rio Amazonas. Borôbia and Lodi (1992) cite Albuquerque (1983) as suggesting that both species coexist in the mouth of the Amazon River, despite lack of supporting evidence. In an interview survey of Amapá, Best and Teixeira (1982) were able to positively identify only one T. manatus specimen, in the vicinity of the Rio Oiapoque. Hunter interviews indicated that manatees occur in the mouths of the rivers Oiapoque, Uaça, and Cassiporé. Interviewees reported that manatees are common along all of the Amapá coastline, whereas Domning (1981a) reported that the results of his interviews with Amapá residents, also conducted in 1978, were inconclusive. The seasonally flooded mangrove swamps of the Amapá coast have little or no submergent vegetation; thus manatees appear to depend upon floating and shoreline species such as mangrove (Avicennia and Rhizophora), aninga (Montrichardia arborescens), cai-seca (Rhabdadenia biflora), paraturá (Spartina brasiliensis), and mururé (Eichhornia) (Domning, 1981a; Best and Teixeira, 1982). Trichechus manatus has a disjunct distribution on the northeastern coast east of Maranhão, from the state of Piauí to Alagoas (Lima et al., 1992). Manatees were observed during 10 of 18 boat surveys or observations from reefs conducted in the Mamanguape estuary, Paraíba, from February through April 1986 (Borôbia and Lodi, 1992). A total of 20 manatee sightings were made during approximately 47 h of observation. Most of the sightings (70%) were made in March and April, inside the reefs that protect the Mamanguape estuary. No more than three manatees were observed in a single survey. Interviews with local residents and fishermen indicated that manatees frequent the mouth of the Rio Mamanguape from January through March, and also occur upriver to the Rio Tinto, where the water is much less saline. At high tide, manatees were sighted along the reef edges making repeated dives where seagrass beds were known to occur. Six manatees were sighted on the ocean side of the reefs, despite the continuous wave action (Beaufort 2). These observations differ from the general pattern of manatee preference for protected waters (Borôbia and Lodi, 1992).

450

Biogeography of the West Indies: Patterns and Perspectives

An adult manatee was captured in nets at Bessa Beach in João Pessoa, Paraíba, in March 1982 (O Norte, 19 March 1982, p. 3). A total of 21 deaths and 12 strandings of dependent calves were recorded between 1988 and 1996 for the states of Paraíba, Pernambuco, Río Grande do Norte, and Ceará. Approximately 56% of the deaths were caused by fishing activities (nets or corrals) (Paludo, 1997). After interviewing coastal fishermen, Jackson (1975) concluded that manatees occurred as far south as Mangue Seca, Bahía, just south of Sergipe, but were no longer present in Espírito Santo, the historical (17th-century) southern limit of their range (Ruschi, 1965; Figure 3). Jackson believed that Alagoas provided the most favorable manatee habitat on the east coast because of numerous estuaries between Maceió and Penedo, and because inshore waters are protected by reefs running parallel to the coast. Banks and Albuquerque described beds of Halodule wrightii as natural pastures for T. manatus in Pernambuco (Banks, 1985). After extensive surveys and interviews in northeastern Brazil from 1990 to 1991, Lima et al. (1992) confirmed the presence of manatees along 2000 km in three discontinuous coastal bands: from Piauí to western Ceará, from eastern Ceará to northern Pernambuco, and in Alagoas. The authors reported the lack of manatee records for the state of Sergipe, which they considered the recent southern limit of the species’ distribution. Lima (1997) estimated the northeastern manatee population at 278 individuals, with the greatest concentrations around the Mamanguape estuary. Best and Teixeira (1982) were unable to find any practicing manatee hunters south of Oiapoque, Amapá, and residents of Amapá interviewed by Domning (1981a) claimed that manatees were seldom captured, perhaps no more than two or three a year. Domning (1982a) reported evidence of exploitation of manatees, presumably for meat, in the states of Alagoas (in 1959) and Bahía (in 1964). Although occasional hunting for meat may still occur (Borôbia and Lodi, 1992), the last record of hunting with a harpoon is said to have occurred in 1987, in Barra do Mamanguape (Paludo, 1997). Currently, the stranding of calves along Río Grande do Norte coast, with subsequent intentional killings, is the main cause of death of manatees in northeastern Brazil (Lima, 1997). Other threats include illegal hunting and incidental nettings. Industrial residues and residues from sugarcane plants (for production of sugar and alcohol as fuel) occur throughout the northeastern region, as well as silting and felling of mangrove swamps for agricultural and development purposes (R.T. de Almeida, personal communication, 1991; Borôbia and Lodi, 1992). The trend toward grand tourist development projects, with the construction of roads and haphazard occupation of the northeastern seashore, may cause detrimental effects to the manatee population (Paludo, 1997). The Mamanguape Estuary was declared an Area of Environmental Protection in 1993, with the objective of protection and conservation of the manatee and its habitat. Likewise, the Paripueiras Marine City Park was established in Alagoas (Paludo, 1997). Domning (1981a) and Best and Teixeira (1982) recommended that a manatee reserve be established to include the Amapá coast near Cabo Norte and adjacent inland lakes, as this area may be the only place in the world where two sirenian species occur in close proximity (Domning, 1981a). Domning (1981a) also recommended that the lower Río Mearim in Maranhão be included in a reserve, because it provides large areas of undisturbed floating meadows in lakes and channels off the main river. Cabo Orange, Amapá, has been proposed as the site of a national park (Best and Teixeira, 1982). Both manatee species have been fully protected in Brazil since 1967 (under Lei No. 5.197, 1967, Portaria No. 3.481, 1973, and Portaria no. N-011, 1986); however, enforcement of these laws is almost impossible because of the lack of enforcement personnel and the large areas involved. An educational and research program was started in 1980 by the then Brazilian department of environmental protection through the Manatee Center. The first buildings were in Barra do Mamanguape, but soon new bases were created in Paripueira (Alagoas), Sagi Beach and Natal (Grande do Norte), and Cajueiro da Praia (Piauí). Currently the headquarters are located on Itamaracá Island, in Pernambuco State. After 10 years the project became the Brazilian Institute of Renewable Natural Resources’ (IBAMA) National Center for the Conservation and Management of Sirenians, or Manatee Center. A massive educational campaign conducted by the Manatee Project resulted in a change of attitude among manatee hunters. In Barra do Mamanguape, besides environmental

Status and Biogeography of the West Indian Manatee

451

education, the project has invested in community development programs for fishermen and local inhabitants. In Itamaracá there is a rehabilitation center where stranded calves are raised for later release. The first pair of rehabilitated, captive-reared manatees was released in Alagoas in 1994, and their readjustment to the wild was successfully monitored by VHS and satellite telemetry (Paludo, 1997). In late 1997 a workshop was convened in Barra de Mamanguape by the Manatee Center in order to review the status of knowledge and to plan strategic actions for research and conservation on manatees (Centro Nacional de Conservação e Manejo de Sirênios, 1997). Suggestions for specific projects were also included in the Brazilian aquatic mammal action plan (IBAMA, 1997).

NORTH AMERICA United States The Florida manatee (T. m. latirostris) is a subspecies of the West Indian manatee. Although Florida was once considered to be the northern limit of the manatee’s year-round range, sightings outside of Florida have increased in recent years, even during winter months. Manatees are frequently reported in the coastal rivers of Georgia and South Carolina in the warm season (Figure 4). Sightings on the Atlantic coast drop off markedly north of South Carolina, with the northernmost record from Rhode Island (Reid, 1996). The Suwannee River was previously described as the northern limit of the manatee’s usual range on the Gulf coast of Florida (Powell and Rathbun, 1984); more recently, the Wakulla River has been described as the northwestern limit of the manatee’s typical warmseason range on this coast (O’Shea and Kochman, 1990). Between 1992 and 1997, the number of manatee sightings west of Florida increased, particularly in Texas and Louisiana in 1995 (Schiro and Fertl, 1996). The 1995 warm season was a notably active one for major storms in the eastern Gulf of Mexico, which may have contributed to a broader distribution of manatees along the Gulf coast (C.A. Langtimm and C.A. Beck, personal communication, 2000). In recent years, sightings have also increased in rivers and along the coast of North Carolina, where they were first reported in 1919 (Schwartz, 1995). Schwartz (1995) and Schiro and Fertl (1996) noted that increased public awareness rather than an increase in the manatee population may account for this upward trend in sightings. Alternatively, storm events and a climatic trend of warmer winters and summers may help to explain increased extralimital movements by manatees on both the Gulf and Atlantic coasts. Manatees occur along most of the Atlantic and Gulf coasts of Florida from April through October (the warm season). Warm season areas of abundance on the Atlantic coast are the St. Johns River, the Banana and Indian Rivers to Jupiter Inlet, and the rivers, canals, and western coast of upper Biscayne Bay (Bengtson, 1981; Shane, 1983; Kinnaird, 1985; Marine Mammal Commission, 1988). Manatees are most abundant on the Gulf coast in the lower Suwannee River and several other rivers in the Big Bend region, the Manatee and Little Manatee Rivers and east coast of Tampa Bay, Sarasota Bay to Lemon Bay, the Charlotte Harbor/Matlacha Pass/San Carlos Bay region, and in the creeks, rivers, bays, and coast of the Everglades and Ten Thousand Islands region (Moore, 1951; Hartman, 1974; Odell, 1979; Rose and McCutcheon, 1980; Irvine et al., 1982). Sightings and salvage records document manatee occurrence in Lake Okeechobee, particularly the Rim Canal (Beeler and O’Shea, 1988); however, relatively little is known about manatee use of this region. Manatees can access and exit the lake through the Caloosahatchee River on the western side and St. Lucie River on the east, and utilize canals that feed into and drain the lake. When ambient water temperatures drop below about 20°C in autumn and winter, manatees migrate to natural or anthropogenic warm-water sources (Powell and Waldron, 1981; Irvine, 1983; Shane, 1983; Powell and Rathbun, 1984; Deutsch et al., 1998). Hartman (1979) believed that manatees began to frequent the headwaters of the Crystal and Homosassa Rivers in the early 1960s. Here their winter numbers have increased markedly over the last 20 years (Powell and Rathbun, 1984; Rathbun et al., 1995), with a record high count of 386, determined by aerial survey in

FIGURE 4 Distribution of the West Indian manatee (Trichechus manatus) in the United States.

452 Biogeography of the West Indies: Patterns and Perspectives

Status and Biogeography of the West Indian Manatee

453

November 2000 (Joyce Kleen, Chassahowitzka National Wildlife Refuge Complex, personal communication). Likewise, the number of manatees using Blue Spring on the St. Johns River has increased from fewer than 20 in the mid-1970s to a total count of 146 during the winter of 2000–2001 (Wayne Hartley, Blue Spring State Park, personal communication). Before the proliferation of coastal electrical-generating power plants in the 1950s to 1960s, Moore (1951) believed that the northern limit to the normal winter range of manatees was the Sebastian River on the Atlantic coast and Charlotte Harbor on the Gulf coast. Now, in addition to their use of warm-water springs, hundreds of manatees seek refuge from cold each winter in the warm-water discharges of power plants or other industrial sites (Reynolds and Wilcox, 1994; Reynolds, 2000). Manatees frequently return to the same winter ranges each year (Rathbun et al., 1983; Powell and Rathbun, 1984; Deutsch et al., 1998), and some also return to the same summer ranges (Bengtson, 1981; Shane 1983; Zoodsma 1991). Individual manatees may use different aggregation sites within winters, and use of sites as far as 850 km apart between winters has been documented (Reid and Rathbun, 1986). The highest statewide, aerial survey-based count of manatees was 3276 in January 2001 (Table 1). On the Atlantic coast, 78 radio-tagged manatees were tracked over a 12-year period (1986–1998) to provide information for the development of effective conservation strategies (Deutsch et al., 2000). Most manatees migrated seasonally over large geographical areas between northerly warmseason regions and southerly winter ranges. Manatees were consistent in their seasonal movement patterns across years, showing strong site fidelity to warm-season and winter ranges. Seasonal movements of four immature manatees that were tracked with their mothers as dependent calves, and also after weaning as independent subadults, showed strong natal philopatry to specific warmseason and winter ranges and migratory patterns (Deutsch et al., 2000). Despite these conservative behavioral traits, manatees also exhibited considerable individual variation in movement patterns, and adaptability to human-altered habitats. Deutsch et al. (2000) concluded that, in addition to reduction of human-caused mortality, manatee population recovery depends on the ability to protect key habitats, and to keep the pace of habitat alteration within the manatee’s ability to adapt. The Florida manatee population shows genetic differentiation between the Gulf and Atlantic coasts, but not within coasts (Garcia, 2000). This finding differs somewhat from that of McClenaghan and O’Shea (1988), who found no differentiation among regions, within or between coasts. Both studies support the conclusion that the manatee’s north–south seasonal migrations, promiscuous mating system, and wide-ranging movement patterns of individuals on both coasts contribute to the high rate of gene flow among regions within Florida (McClenaghan and O’Shea, 1988). However, in contrast to McClenaghan and O’Shea (1988), Garcia-Rodriguez et al. (1998) and Garcia-Rodriguez (2000) conclude that the low level of genetic variability observed in Florida manatees suggests that this population has been subjected to bottlenecks in population size that are characteristic of some endangered species. Progress in research on manatee population biology was evaluated at a workshop held in Gainesville, Florida, in 1992. Six working groups discussed the topics of aerial survey and estimation of population size, reproduction, age structure, mortality, photoidentification, estimation of survival, and integration and modeling of population data (O’Shea and Ackerman, 1995). Longterm life history data obtained through documented sightings and resightings of individual manatees have formed the basis for estimates of adult survival, reproduction, and population growth (Beck and Reid, 1995; Eberhardt and O’Shea, 1995; Rathbun et al., 1995; O’Shea and Hartley, 1995; Langtimm et al., 1998). Estimated population traits of the Florida manatee are presented in Table 1. Although many valuable, long-term databases have been developed, gaps in information include age-specific estimates of reproduction characteristics, sampling effort for life history data, particularly in southwestern Florida from Tampa Bay through the Everglades, differences in characterization of some reproduction traits based on carcass examination and resightings of known individuals, reproductive physiology, and mating and social behavior (O’Shea and Ackerman, 1995). Another important gap is information on survival of juveniles and subadults (Langtimm et al., 1998).

454

Biogeography of the West Indies: Patterns and Perspectives

TABLE 1 Estimates of Manatee Life History Traits and Other Statistics Life History Trait Maximum life expectance Gestation Litter size % Twins Sex ratio at birth Calf survival Annual adult survival

Age of first reproduction (female) Mean age first reproduction (female) Spermatogenesis (male) Proportion pregnant Proportion nursing first-year calves during winter season

Source

Blue Spring Crystal River Blue Spring Crystal River Atlantic coast Blue Spring Crystal River

Salvaged carcasses Blue Spring Mean Blue Spring Crystal River Atlantic coast

Calf dependency Interbirth internal Highest number of births Highest frequency in mating herds No. verified carcasses in Floridaª No. documented in ID catalogb Highest count (aerial surveys)ª

Data 60 years 11–14 months 1 1.79% 1.40% 1:1 60% 67% 90% 96% 96% 3–4 years 5 years 2–3 years 33% 41% 36% 30% 36% 38% 1.2 years 2.5 years May to September February to July 4043 (1974–2000) >1400 (1975–2001) 3276 in January 2001

Note: Except as noted, information was obtained from O’Shea et al., 1995. a

Data provided by the Florida Marine Research Institute, Florida Fish and Wildlife Conservation Commission. b Data provided by the U.S. Geological Survey.

Regional and seasonal fluctuations in manatee abundance do not necessarily indicate changes in the statewide population trend, as manatees on both coasts of Florida migrate seasonally (Hartman, 1974) and are capable of moving great distances (Reid and Rathbun, 1986; Deutsch et al., 1998). Furthermore, the population size cannot be directly estimated because of environmental, survey-related, and manatee behavior-related factors (Lefebvre et al., 1995). Trend analyses of temperature-adjusted aerial survey counts show promise for providing insight to general patterns of population growth in some regions, although the estimated rates of change in counts may not be an accurate reflection of actual population rates (Garrott et al., 1994; Craig et al., 1997; Eberhardt et al., 1999). Strip-transect aerial survey methods have been applied to estimate the number of manatees in the Banana River during the warm season, and could be used to detect a 5% annual rate of change in <4 years with power ≥0.75 (Miller et al., 1998). Models based on adjusted counts (Eberhardt et al., 1999) and survival and reproduction rate estimates (Eberhardt and O’Shea, 1995) indicate that population growth on the Atlantic coast has been marginal at best from the late 1970s through the early 1990s. In contrast, the smaller groups

Status and Biogeography of the West Indian Manatee

455

of manatees that overwinter in the Crystal and Homosassa Rivers and at Blue Spring show higher rates of population growth (Table 1). Preliminary estimates of adult survival rates in southwest Florida (Tampa Bay to the Caloosahatchee River) are similar to those for the Atlantic coast (Holly Edwards and Bruce Ackerman, Florida Fish and Wildlife Conservation Commission, personal communication, 2000). Population viability analysis, based on reproduction and survival data from a sample of 1212 carcasses obtained in 1976–1991, projected a slightly negative population growth rate and unacceptably low probability of persistence over 1000 years (Marmontel et al., 1997). Thus, the fate of the Florida manatee population seems to hang in a delicate balance, with an ever-increasing number of carcasses recovered annually and the human population increase showing no signs of slowing down. “A turning point may soon be reached, if it has not already; … no prudent alternatives exist to maintaining proactive, vigorous management aimed at mortality reduction” (O’Shea and Ackerman, 1995). Hartman (1979) listed several factors that influence manatee distribution in Florida: (1) availability of aquatic vegetation; (2) proximity to channels of at least 2 m in depth; (3) recourse to warm water during cold weather; and (4) a source of fresh water. He concluded that the Florida manatee’s preferred habitats are rivers and estuaries (<25 ppt salt). The rare occurrence of manatees in Florida Bay and in the area between Tampa Bay and the Chassahowitzka River may be related to shallowness and low freshwater input. Although manatees can tolerate a wide range of salinities (Ortiz et al., 1998), they prefer habitats where osmotic stress is minimal or where fresh water is periodically available (O’Shea and Kochman, 1990). Manatees feed on a wide variety of freshwater aquatic plants, particularly Hydrilla verticillata in the Crystal River headwaters (Hartman, 1979) and Hydrilla, Eichhornia, Vallisneria, Najas, Paspalum, and floating grasses in the St. Johns River (Bengtson, 1981). The manatee’s capacity for flexibility and opportunism in foraging is well illustrated by their use of live oak (Quercus virginiana) acorns in the St. Johns River during the winter (O’Shea, 1986). The coastal salt marshes from northeastern Florida to South Carolina provide abundant forage for manatees. They typically feed during the higher stages of the tide cycle on Spartina alterniflora, which lines the extensive network of tidal creeks and rivers (Baugh et al., 1987; Zoodsma, 1991). Radio-tracked manatees in Crystal and Homosassa Rivers typically left warm-water springs during the day and moved downriver at dusk to feed on submerged vegetation (Ruppia maritima and Potamogeton pectinatus), returning to a warm-water source by morning (Rathbun et al., 1990). Manatees seen during aerial surveys near the mouths of the Suwannee, Withlacoochee, Crystal, Homosassa, and Chassahowitzka rivers often feed on beds of R. maritima or Halodule wrightii growing adjacent to channels (Powell and Rathbun, 1984). Manatees frequently used those areas of a river that had shallow, vegetated shelves or sandbars next to a channel (Powell and Rathbun, 1984). Manatees radio-tracked in Charlotte Harbor, Matlacha Pass, and San Carlos Bay were frequently located along the edges of seagrass beds (Lefebvre and Frohlich, 1986), supporting Hartman’s (1979) suggestion that manatees tend to stay close to deeper water while in shallow-water situations. Because of their broad distribution and migratory patterns, manatees in Florida utilize a wider diversity of food items and are probably less specialized in their feeding strategies than manatees in tropical regions (Lefebvre et al., 2000). Nevertheless, seagrasses appear to be a staple of their diet in coastal areas (Ledder, 1986; Provancha and Hall, 1991; Kadel and Patton, 1992; Lefebvre et al., 2000), and manatees may return to specific seagrass beds to graze on new growth (Koelsch, 1997; Lefebvre et al., 2000). In Florida, as well as other countries within the manatee’s range, seagrasses may be their most long-term, widely available, stable food resource, whereas freshwater vegetation can be more ephemeral (e.g., Terrell and Canfield, 1996; Mataraza et al., 1999) or limited in availability in local areas of high manatee use (Smith, 1993). Human-related impacts are concentrated along the coasts and rivers, and seagrass bed coverage has declined in some regions of Florida through human-related activities (Lewis, 1987; Busby and Virnstein, 1993; Fletcher and Fletcher, 1995). From 1974 through 2000, 4043 dead manatees were recovered in Florida by the Florida Fish and Wildlife Conservation Commission and cooperators with the U.S. Fish and Wildlife Service,

456

Biogeography of the West Indies: Patterns and Perspectives

University of Miami, University of Central Florida, and Kissimmee Diagnostics Laboratory. (Table 1). The major known cause of manatee mortality is collision with boats (Wright et al., 1995). Other human-related causes are entrapment in water-control structures and navigation locks, drowning in commercial fishing nets, infection resulting from entanglement in fishing gear, and vandalism (O’Shea et al., 1985). High winter mortality in 1977, 1981, and 1989 was related to exceptionally cold weather (O’Shea et al., 1985; Ackerman et al., 1995), and die-offs of manatees in southwest Florida in 1963, 1982, and 1996 were associated with red tide (Gymnodinium breve) outbreaks (Layne, 1965; Buergelt et al., 1984; O’Shea et al., 1991; Landsberg and Steidinger, 1998; Bossart et al., 1998). Manatees are thus vulnerable to both human-related and natural threats, and their vulnerability is increased in areas where large aggregations assemble. Manatees in Florida have been protected by law since 1893. They are currently protected under the U.S. Marine Mammal Protection Act (1972) and are listed as endangered under the Endangered Species Act (1973). Manatee protection and conservation are primarily the responsibility of the U.S. Fish and Wildlife Service and the Florida Fish and Wildlife Conservation Commission. The U.S. Marine Mammal Commission provides guidance and oversight to the agencies involved in manatee research and management. Reynolds (1999) provided a comprehensive summary of the research and management activities of federal and state agencies, private organizations, and individuals involved in manatee conservation and recovery. Reynolds (1995) divided the history of manatee conservation into three eras. From the late 1960s until 1980, various research and management activities were initiated, culminating in the first draft of the Florida Manatee Recovery Plan in 1980. From 1980 to 1989, cooperative state and federal research programs expanded, and management activities were coordinated by the U.S. Fish and Wildlife Service’s Manatee Coordinator. The first revision of the Recovery Plan in 1989 marked the beginning of the third era, in which research and management activities became more focused, and interagency coordination efforts increased. The Recovery Plan was revised again in 1996, and is currently undergoing its third revision. The Florida Manatee Recovery Plans (1980, 1989, and 1996) have successfully guided the growing number of agencies, institutions, organizations, and individuals involved in manatee research, management, and conservation, and have served as models for development of manatee conservation plans in other countries. The primary ways in which the State of Florida has addressed manatee protection are through the development of boat speed regulatory zones and county manatee protection plans (Reynolds, 1999). Unfortunately, some of the counties with the highest incidence of boat-related manatee deaths have also had the greatest difficulty developing effective management plans. Additional measures will clearly be required to achieve population recovery goals. One of the alternative, recommended strategies is the creation of a system of reserves in the most essential habitat areas (Reynolds and Gluckman, 1988; Reynolds, 1999). Under the authority of the Endangered Species Act (1973), the U.S. Fish and Wildlife Service’s Refuge Management Authority Act, and the Florida Manatee Sanctuary Act (1978), the Florida Fish and Wildlife Conservation Commission has established 23 no-entry and motorboat-prohibited zones, and additional sites are being evaluated for inclusion in a network of protected areas. Sanctuaries, which exclude boats and people, appear to be an effective way to protect manatees from mortality and harassment (Reynolds and Gluckman, 1988; Buckingham et al., 1999). Population and life history information indicates that the long-term prognosis for the Florida manatee could be good, provided that strong efforts are continued to reduce mortality, improve habitat quality, and prevent or minimize the impact of potential catastrophes (Lefebvre and O’Shea, 1995; Marmontel et al., 1997). Mexico Historically, manatees occurred along the entire eastern coast of Mexico (Figure 2) from Texas south to Belize (Colmenero-Rolón and Hoz-Zavala, 1986; Colmenero-Rolón, 1991). By the 1970s through the 1980s, however, they had largely disappeared from about Nautla, in the state of Veracruz, north to Texas (Colmenero-Rolón, 1986). However, as recently as 1985 sightings were reported

Status and Biogeography of the West Indian Manatee

457

TABLE 2 Summary of Aerial Surveys in the State of Quintana Roo, Mexico Region

Manatees/h

Ref.

Notes

Holbox to Tulum Holbox to Cancun Cancun to Tulum

0 0 2.7

Colmenero-R. and Zarate, 1990 Morales-V. and Olivera-G., 1997 Morales-V. and Olivera-G., 1997

Biosphere Sian Ka’an

1.4

Colmenero-R. and Zarate, 1990

Biosphere Sian Ka’an

2.3

Morales-V. and Olivera-G., 1994b

0 11.6 12.3 20.4

Colmenero-R. and Zarate, 1990 Colmenero-R. and Zarate, 1990 Morales-V. and Olivera-G., 1994a Morales-V., 2000b

1987–1988, n = 7 surveys 1993–1995, n = 3 surveys 1992–1996, n = 7 surveys; seen in or near springs at Xpuha, Xelha, and Tancah 1987–1988, n = 5/6 surveys; Ascension Bay = 11 of 14 sightings 1992–1994, n = 5 surveys; Ascension Bay = 15 of 16 sightings 1987–1988, n = 3 surveys 1987–1988, n = 8 surveys 1990, n = 2 surveys 1992–1997, mean of 14 surveys

Punta Herrero to Bacalar Chico Chetumal Bay Chetumal Bay Chetumal Bay

Note: For ease of comparison between surveys and areas, the number of manatees sighted per survey hour (pooled for all surveys, unless noted as averaged from all surveys) are presented.

from the Soto La Marina in the state of Tamaulipas (Lazcano-Barrero and Packard, 1989). At present, there are only three regions in Mexico where manatees are still commonly found. In decreasing order of importance, these are the vast wetland systems in the states of Tabasco, Campeche, and Chiapas; the southeastern Caribbean coast on the Yucatan Peninsula in the state of Quintana Roo; and the river, lake, and wetland system at Alvarado in Veracruz (Villa and Colmenero-Rolón, 1981; Colmenero-Rolón, 1984; Colmenero-Rolón and Hoz-Zavala, 1986). Historically, manatees occasionally were seen during the summer in Texas, and Gunter (1942) proposed that these were seasonal migrants from northern Mexico. During the 1970s and 1980s, sightings in Texas seem to have declined (Powell and Rathbun, 1984; Rathbun et al., 1990), which is probably due to their extirpation in northern Mexico (Alvarez, 1963; Colmenero-Rolón, 1984; Powell and Rathbun, 1984). Once it was realized that the state of Quintana Roo had some of the more important manatee areas remaining in Mexico (Colmenero-Rolón, 1984; Colmenero-Rolón and Hoz-Zavala, 1986), several aerial surveys were completed that showed that they are common only in three regions of the state. In decreasing order of importance, these are the Chetumal Bay area next to Belize, the Biosphere Reserve Sian Ka’an, and the coast between the towns of Playa del Carmen and Tulum (Table 2). The trend along the eastern shore of the Yucatan Peninsula is for increasing abundance from north to south, culminating in Belize, where manatees are particularly abundant (MoralesVela et al., 2000). The manatee population in Chetumal Bay is thought to be between 90 and 130 (Morales-Vela and Olivera-Gomez, 1994a; Morales-Vela, 2000b), while the number in the rest of Quintana Roo, based on Morales-Vela and Olivera-Gomez (1994b, 1997), Ortega-Argueta (1997), and Morales-Vela (personal communication) probably does not exceed 30 to 40 animals. However, estimating manatee abundance in Quintana Roo is difficult, not only because manatees are generally troublesome to count (e.g., Lefebvre and Kochman, 1991), but also because they undoubtedly travel freely between Belize and Mexico (Morales-Vela et al., 2000). Although manatees are common in coastal and inland areas of Tabasco, Campeche, and Chiapas, they are much more difficult to observe in complicated river, lake, and wetland systems (Colmenero-Rolón, 1986). No aerial surveys have been completed in this region, and there are no estimates of manatee abundance (Morales-Vela, personal communication).

458

Biogeography of the West Indies: Patterns and Perspectives

Colmenero-Rolón (1986) suggested that ideal manatee habitat in Mexico is characterized by average water temperatures above 22°C, and average rainfall above 1000 mm. Manatee habitats in the southern Bahia de Campeche meet these criteria. Lluch-Belda (1965) and Colmenero-Rolón (1986) worked in this region, and they describe seasonal movements of manatees in relation to patterns of seasonal rainfall and food availability. During the dry season (February through mid-May) manatees are found in the lower parts of the major rivers and along the coast of Tabasco. When the heavy rains begin in late May the animals move upriver, but they are prevented from reaching the lakes and small tributaries farther inland by swift and turbulent water. When the rains moderate in November through January, the animals are able to move up into the lakes and streams and feed on the abundant emergent aquatic vegetation (i.e., Paspalum sp., Chloris sp., Panicum sp., Eichhornia crassipes) that becomes available during high water. As the water levels drop in these inland areas during the dry months, food becomes limited and the manatees move down toward the coast again. Although fishermen traditionally took advantage of the seasonal migrations, and captured manatees while they were in the shallow, restricted inland lakes and creeks (Lluch-Belda, 1965), Colmenero-Rolón (1986) reported that most fishermen now respect the laws protecting manatees. In the area of Chetumal Bay, aerial surveys (Table 2; Morales-Vela et al., 2000) and radiotagged manatees monitored by satellites and conventional ground-based observers (Morales-Vela et al., 1996; Morales-Vela, 2000a) show that animals are closely associated with shorelines, even in the bay, which has an average depth of only about 3 m. Manatees are particularly abundant in and around Laguna Guerrero on the western shore of the bay, in and near the Hondo next to the city of Chetumal, and in the area of Dos Hermanos south to Punta Calentura on the eastern shore of the bay. Six radio-tracked manatees in Chetumal Bay were each monitored between 73 and 1697 days, and none left the bay. Their movements, however, were variable, with the maximum distance between extreme locations for the single male being 51.0 km, and for the five females varying from 8.5 to 48.5 km (Morales-Vela, 2000a). Axis-Arroyo et al. (1998), using visual surveys from boats, found that manatee movements in Chetumal Bay were associated (in decreasing order of importance) with food distribution, wind intensity, other manatees, water depth, salinity, water and air temperature, and cloudiness. The relatively low importance of water and air temperatures is in contrast to the situation in Florida, but expected because the water temperatures in Chetumal Bay never dropped below 20°C (Axis-Arroyo et al., 1998). The northeastern coast of the Yucatan Peninsula has few rivers because the region is relatively dry and low, with porous soils. Under these conditions, low manatee abundance would be expected because of their apparent need for fresh water (Lluch-Belda, 1965). The coast between Playa del Carmen and Tulum is unusual, however, in that manatees are attracted to fresh water from several artesian springs that occur just inland of the shore (cenotes) and in small inlets (caletas) (LluchBelda, 1965; Gallo-Reynoso, 1983; Morales-Vela and Olivera-Gomez, 1997). But these springs do not attract large manatee aggregations as similar sites do in Florida (Bengtson, 1981; Rathbun et al., 1990; Reid et al., 1991), because manatees in Quintana Roo do not need, and are not attracted to, warm water. Manatees have a long history of legal protection in Mexico, starting in 1921 (Colmenero-Rolón, 1991). In the recent past, illegal poaching was thought to be among the more-pressing conservation problems facing manatees in Mexico (see reviews in Lefebvre et al., 1989; Colmenero-Rolón and Zarate, 1990). Although some poaching is still reported, problems characteristic of a more affluent and expanding human population are increasing in importance, including incidental entrapment in fishing gear and being struck and killed by motor boats (Morales-Vela et al., 1996). Habitat alteration is also becoming a major concern, as illustrated by the declining use of the cenotes and caletas in Quintana Roo by manatees as these sites are developed for the rapidly expanding tourist industry (Gallo-Reynoso, 1983; Morales-Vela and Olivera-Gomez, 1997; Ortega-Argueta, 1997). The need for conservation planning, however, has not gone unnoticed by Mexicans, and has resulted in an impressive array of actions. These include the creation of the biosphere reserve at Sian Ka’an in 1986 (López-Ornat and Consejo-Dueñas, 1988), a manatee recovery plan (Colmenero-Rolón, 1991), the

Status and Biogeography of the West Indian Manatee

459

production of educational materials (e.g., Morales-Vela and Olivera-Gomez, 1992), numerous conservation recommendations (e.g., Morales-Vela et al., 1996, 2000), the establishment of the first manatee protected area in Mexico in Chetumal Bay (Morales-Vela et al., 2000), and the creation of the “Comite Consultivo para la Proteccion y Recuperacion del Manatí del Caribe en México” (Colmenero-Rolón, 1998). The goal of this committee is to define strategies and policies for manatee conservation and research in Mexico. At the same time, Mexicans are developing a conservation culture, as exemplified by the effort to rescue, rather than eat, manatees trapped in a drying lake in Chiapas during the drought of 1995 (Morales-Vela and Olivera-Gomez, 1996).

BIOGEOGRAPHICAL PATTERNS OF TRICHECHUS Domning (1982b) pointed out that, although manatees comprise three of the four living species of the order Sirenia, their representation in the fossil record is minute compared to that of the family Dugongidae. Early sirenians had a “pan-Tethyan” distribution and gave rise to dugongids in the middle Eocene (Domning et al., 1982). Manatees do not emerge in the fossil record until the Miocene (Domning, 1982b, 1997b). Domning (1982b) speculated that early manatees arose in South America as coastal river and lagoon inhabitants in contrast to the more marine dugongids, their contemporaries in the New World. Manatees developed a unique process of tooth replacement, adapted to a more abrasive diet including true grasses (Gramineae), which may have allowed them to outcompete dugongids (Domning, 1982b). The latter disappeared from the western Atlantic at the end of the Pliocene. Trichechus inunguis probably evolved in isolation in the Amazon basin following the Miocene Andean orogeny, and exhibits more derived characters than the other two species of manatees (Domning, 1982b). Whether competition or some other factor maintains the apparent parapatry of T. inunguis and T. manatus at the mouth of the Amazon River is unknown (Domning, 1981a). The great similarity between T. manatus and T. senegalensis led Simpson (1932) and later Domning (1982b) to conclude that manatees dispersed between the South American and African continents relatively recently, in the Pleistocene or Pliocene. Simpson (1932), however, suggested that manatees dispersed from Africa to South America, whereas the present fossil record better supports dispersal in the opposite direction. Fossil remains of T. manatus are known from the early Pleistocene of Florida (Hulbert and Morgan, 1989), and (especially) from the late Pleistocene of Florida and elsewhere in the southeastern and eastern United States (Domning, 1982b). The late Pleistocene records extend as far north as New Jersey (Gallagher et al., 1989), and even up the Mississippi River as far as Arkansas (Domning, unpublished data). Manatees have never been documented in the Mississippi or its tributaries in historic times; however, the New Jersey range record has recently been surpassed by a Florida manatee that was radio-tracked to Rhode Island and back in 1995 (Reid, 1996). The remainder of the species’ range has thus far produced only one occurrence of possible Pleistocene age, in Jamaica (Domning, unpublished data). The late Pleistocene manatees from the southeastern United States are morphologically distinct from any other known manatees, and are probably best regarded as a separate subspecies of T. manatus (Domning, 1982b, and unpublished data). This still unnamed fossil subspecies may have evolved from Antillean manatees that colonized Florida from the south at a time climatically similar to today; it presumably became extinct during the subsequent, end-Pleistocene glacial stage, which would have rendered Florida uninhabitable by manatees. Postglacial warming allowed this sequence of events to be repeated, resulting in the evolution of T. m. latirostris. Owing to the peculiar geographical configuration of southeastern North America, such ephemeral subspecies may have evolved several times during the Pleistocene on the northern margin of the species’ range, as climatic zones shifted repeatedly north and south. Although recent records of manatees from the Lesser Antilles are lacking, prehistoric and early historical evidence indicates that manatees have occurred there. Thus, it is possible that linkage between T. m. manatus in the Greater Antilles and in South America has been maintained by

460

Biogeography of the West Indies: Patterns and Perspectives

wanderers that island-hopped across the Lesser Antilles. Dispersal may also occur between the Greater Antilles and Mexico and Central America. The North Equatorial Current, flowing from east to west through the Caribbean Sea and northward offshore of Yucatan, would tend to favor a Yucatanto-Cuba crossing more than a Venezuela-to-Puerto Rico crossing, although manatees may not necessarily depend upon favorable currents to cross open ocean. An extensive area of shallow water (Miskito Bank) between the Honduras–Nicaragua border and Jamaica (Figure 2) might help to promote ocean crossing between Central America and the Antilles. Such a crossing is known for green sea turtles (Nietschmann, 1972; Carr et al., 1978). Allen (1942) suggested that manatees originally extended their range to the West Indies by way of the Yucatan Peninsula and the intervening shallows. Reynolds and Ferguson (1984) sighted two manatees 61 km northeast of the Dry Tortugas in the Gulf of Mexico, and suggested that they could be wanderers from Florida, Cuba, or Yucatan. Genetic studies do not yet provide decisive support for any of these scenarios, as data from Central American populations are lacking, and no mitochondrial DNA haplotypes are shared by manatee populations in the West Indies and South America (Garcia-Rodriguez et al., 1998; see below). West Indian haplotypes are more similar to ones from Colombia than from Venezuela, Guyana, or Brazil. In addition to historical geography, physical and biological environmental factors such as salinity, temperature, water depth, currents, shelter from wave action, and availability of vegetation are important determining factors of manatee distribution. The rarity of offshore sightings of manatees in locations that apparently lack dependable freshwater sources, such as the Bahamas, suggests that their distribution is influenced by the availability of fresh water. Ortiz et al. (1998) report that “manatees may be susceptible to dehydration after an extended period if freshwater is not available.” Seasonal shifts in manatee distribution and their use of available warm-water sources in Florida suggest that energetic requirements also influence the range limits of manatees (Irvine, 1983). The average lower limit of thermal neutrality is approximately 24°C (Irvine, 1983). Whitehead (1977) described the full range of T. manatus as falling within the northern and southern limits of the 24°C mean annual isotherm. The Florida manatee’s low metabolic rate (15 to 22% of predicted weight-specific values) and high thermal conductance suggest that manatees could not survive in winter water temperatures in most of Florida (Irvine, 1983), much less farther north, without access to warm-water refuges. The cold Labrador Current, flowing southwest along the northeast Atlantic coast, meets the warm Florida Current in the area of Cape Hatteras; relatively few manatees are reported north of Cape Hatteras (Rathbun et al., 1982). Natural and artificial warm-water refuges ameliorate the effects of winter temperatures on manatees, and may have allowed a recent northward winter range extension in Florida (Hartman, 1979; Shane, 1983, 1984). While it has long been clear that Florida is marginal habitat for manatees in regard to temperature, it is less noted that the same may be true in regard to an aspect of feeding ecology. The teeth of Florida manatees are typically far more heavily worn than those of Antillean manatees. This may be related to a less fibrous diet (more seagrasses than true grasses), resulting in slower tooth replacement, in combination with heavy tooth wear resulting from feeding on quartz sand bottoms rather than the softer calcareous sand prevalent in much of the Antilles (Domning, 1982b). Whether Florida manatees suffer any nutritional stress caused by tooth wear with age remains to be investigated. Surprisingly, the much more complex teeth of manatees were not demonstrated to be more efficient at masticating seagrasses than the simple, peglike teeth of dugongs (Marsh et al., 1999). Extensive gaps in suitable habitat, such as the northern coast of the Gulf of Mexico and the Caribbean coast of Venezuela, may represent geographical barriers. The absence of manatees along the Caribbean coast of Venezuela may be related to cooler water temperatures, and the scarcity of sheltered lagoons and fresh water (O’Shea et al., 1986). Deep water and strong currents in the Straits of Florida may be effective barriers to gene flow between T. m. latirostris in Florida and T. m. manatus in the Antilles (Domning and Hayek, 1986). The geo-oceanography of the northern Gulf of Mexico, in addition to cool winters, may contribute to the scarcity of manatees in this region. From the Florida panhandle westward to northern Mexico, the regional coastal type is

Status and Biogeography of the West Indian Manatee

461

alluvial: smooth shorelines with sandy beaches interrupted by deltas (Price, 1954). The Gulf shoreline in peninsular Florida is drowned karst or biogenous, and is characterized by mangrove swamps and marshes, with few sandy beaches (Price, 1954). Along much of the karst shoreline springs are common in streams and offshore, because of artesian groundwaters (Price, 1954). Although Louisiana has extensive salt marsh (dominated by Spartina and Juncus), Alabama and Mississippi have relatively little salt marsh. Discontinuity of suitable habitat along the northern Gulf of Mexico may discourage intentional manatee migration west of Florida; however, hurricanes and severe storms may promote accidental dispersal. Domning (1981b) proposed that the lack of diversity among sirenians is a direct result of their coevolution with a relatively undiversified food base, the seagrasses. While the distribution of sirenians is clearly parallel to the distribution of seagrasses in tropical and subtropical regions (Brasier, 1975; McCoy and Heck, 1976), the origin and evolution of modern manatees is theoretically linked to their specializations for feeding on true grasses found in freshwater or estuarine systems (Domning, 1982b), and they are known to eat a wide variety of aquatic and semiaquatic macrophytes (Best, 1981). The relative contributions of freshwater and marine macrophytes to the geographical distribution of the West Indian manatee are unknown. The distribution of T. manatus is probably not influenced by the distribution of particular plant species, as the manatee is highly opportunistic in selecting foods, and many of the freshwater and marine plants consumed by the West Indian manatee have a wide distribution. The newest tool in the study of manatee biogeography is the analysis of mitochondrial DNA (mtDNA). Garcia-Rodriguez et al. (1998) sampled the mtDNA of West Indian manatees and identified 15 distinct haplotypes among 86 individuals from Florida, Puerto Rico, the Dominican Republic, Mexico, Colombia, Venezuela, Guyana, and Brazil (Figure 5). These haplotypes were distributed in a complex pattern, but the following generalizations seem warranted. The highest genetic diversity is found along the northern coast of South America, at the core of the species’ range; marginal populations (in Florida, Mexico, and Brazil) were found to be monomorphic (only one haplotype apiece) although distinct from each other. Manatees in Mexico, Colombia, and Venezuela share at least one haplotype, as do manatees in Guyana and northeastern Brazil. However, throughout the species’ range, populations from neighboring areas show striking differences, indicating limited long-distance gene flow and significant efficacy of barriers such as stretches of open water and unsuitable coastal habitat. Three distinctive mtDNA lineages were identified within the species, corresponding approximately to (1) Florida and the West Indies; (2) the Gulf of Mexico and Caribbean mainland coasts and rivers; and (3) the Atlantic coast of South America. The Florida haplotype occurs also in the Greater Antilles, suggesting that the Florida population originated by colonization from that region, as proposed above. The Antillean subspecies would therefore be paraphyletic with respect to its derivative, the Florida subspecies, as these are currently defined. Further studies of this sort, and especially increases in the number and sizes of the samples analyzed, will no doubt add many details to the history of manatee distribution on both evolutionary and ecological timescales — a history that is more complicated than it has hitherto seemed.

CONCLUSIONS Water temperature determines the northern limit of the West Indian manatee’s range, while loss of suitable habitat appears to limit the southern range more than temperature. Manatees range well north of the tropical zone on the east coast of the United States, whereas none is known to occur today south of the State of Alagoas in Brazil, which lies within the tropical zone in the Southern Hemisphere. The winter range of manatees in temperate regions of the United States is generally restricted to areas with natural or anthropogenic sources of warm water (20°C). The association of manatees with freshwater sources is an overwhelmingly consistent pattern, from Columbus’ report of their attraction to springs in Bahía de Cochinos, Cuba to the recent distribution surveys in various countries throughout their range. Manatees in Florida and Central

FIGURE 5 Distribution of 15 genetic haplotypes of the West Indian manatee. Three distinctive lineages were observed, corresponding approximately to Florida and the West Indies, the Caribbean coast and rivers of South America, and the Atlantic coast of South America. (Arrows indicate countries, not exact locations, from which samples were obtained for genetic analysis.) (From Garcia-Rodgriquez et al., Phylogeography of the West Indian Manatee (Trichechus manatus): How many populations and how many taxa? Mol. Ecol., 7: 1137–1149, 1998. With permission of Blackwell Scientific Ltd.)

462 Biogeography of the West Indies: Patterns and Perspectives

Status and Biogeography of the West Indian Manatee

463

and South America are frequently found in rivers and estuaries, while those in the Greater Antilles may of necessity occupy more marine environments. The association of manatees with shallow, protected coasts has also been noted by many authors. The occurrence of seagrasses and other submerged vegetation in shallow water accounts for part of this association. Extensive, unprotected coastlines with unvegetated sandy beaches or rocks may act as geographical barriers in some parts of the manatee’s range. Humans have undoubtedly influenced the distribution of manatees by depredation and alteration of habitat. Although hunting may have caused the manatee’s disappearance from portions of its former range, the species persists in some regions despite a long history of exploitation by people. In these regions, for example, Guyana and Belize, the abundance of suitable habitat may have supported greater densities of manatees than areas where manatees have apparently been extirpated, such as the Lesser Antilles. The West Indian manatee has fared better than the extinct Caribbean monk seal (Monachus tropicalis) (Kenyon, 1981; LeBouef et al., 1986), and the many species of land mammals in the West Indies that have become extinct since the late Pleistocene, largely as a result of human activities (Morgan and Woods, 1986; Woods and Ottenwalder, 1992). Manatees have adapted to hunting pressure by developing highly secretive behavior, and because they are totally aquatic and relatively far ranging, they have thus far been less susceptible to complete extirpation than many terrestrial species. Manatees are, however, increasingly vulnerable to human activities, and new sources of mortality may overshadow the former threat of hunting. The increased and widespread use of nylon and polyester gill nets is of particular concern because manatees may be unable to avoid nets in some locations, e.g., river mouths, and although incidentally caught they are often peremptorily slaughtered. The already high rate of boat-strike mortality in Florida may continue to increase with human population growth, and boat-strike deaths are now reported for other countries in the species’ range. Only through strengthening of existing conservation efforts and improving enforcement of protective laws will manatees have a chance to endure.

ACKNOWLEDGMENTS The significant contributions of T. J. O’Shea to the earlier version of this paper are gratefully acknowledged. Maps were prepared by D. E. Easton. K. A. Ausley assisted with manuscript preparation and proofreading. Helpful reference material was provided by R. K. Bonde, M. Borôbia, R. I. Crombie, C. K. Dodd, W. J. Kenworthy, and M. Moyer. A. M. Caracausa and A. I. GarciaRodriguez translated several articles and letters from Spanish to English. A. A. Mignucci-Giannoni, B. Morales-Vela, J. A. Powell, J. A. Ottenwalder, E. Quintana, J. E. Reynolds III, J. Saliva, and J. A. Valade reviewed selected country accounts. Discussions with B. J. MacFadden were helpful in writing the biogeography section.

LITERATURE CITED Ackerman, B. B., S. D. Wright, R. K. Bonde, D. K. Odell, and D. J. Banowetz. 1995. Trends and patterns in mortality of manatees in Florida, 1974–1991. Pp. 223–258 in O’Shea, T. J., B. B. Ackerman, and H. F. Percival (eds.). Population Biology of the Florida Manatee (Trichechus manatus latirostris). Information and Technology Report 1, National Biological Service, Washington, D.C. Allen, G. M. 1942. Extinct and Vanishing Mammals of the Western Hemisphere. American Committee for International Wildlife Protection, Special Publication No. 11. Intelligence Printing, Lancaster, Pennsylvania. Allsopp, W. H. L. 1960. The manatee: ecology and use for weed control. Nature 188(4752):762. Allsopp, W. H. L. 1969. Aquatic weed control by manatees — its prospects and problems. Pp. 344–351 in Obeng, L. E. (ed.). Man-Made Lakes. Ghana University Press, Accra.

464

Biogeography of the West Indies: Patterns and Perspectives

Alvarez, T. 1963. The recent mammals of Tamaulipas, Mexico. University of Kansas Publication Museum of Natural History 14(15):363–473. Amour, K. 1993. Status of the West Indian manatee (Trichechus manatus) in Trinidad and Tobago. Wildlife Section, Forestry Division, Ministry of Agriculture, Land and Marine Resources. Unpublished report. Auil, N. 1998. Belize manatee recovery plan. UNDP/GEF Coastal Zone Management Project No. BZE/92/G31, United Nations Environmental Program, Caribbean Environment Program, Kingston, Jamaica. Axis-Arroyo, J., B. Morales-Vela, D. Torruco-Gomez, and M. E. Vega-Cendejas. 1998. Variables asociadas con el uso de hábitat del manatí del Caribe (Trichechus manatus), en Quintana Roo, México (Mammalia). Revista de Biologia Tropical 46:791–803. Bangs, O. 1895. The present standing of the Florida manatee, Trichechus latirostris (Harlan) in the Indian River waters. American Naturalist 29:783–787. Banks, N. 1985. Sinopse cronológica dos estudos sobre o peixe-boi, no Brasil. Fifth Northeast Zoology Meeting, Natal, Río Grande do Norte, Brasil. Abstract. Barrett, O. W. 1935. Notes concerning manatees and dugongs. Journal of Mammalogy 16:216–220. Bartram, W. 1791. Travels through North and South Carolina, Georgia, East and West Florida. James and Johnson, Philadelphia. (Republished 1955, Dover Publications, Inc., New York.) Baugh, T. M., J. A. Valade, and B. J. Zoodsma. 1987. Manatee use of Spartina alterniflora in Cumberland Sound. Marine Mammal Science 5(1):88–90. Baughman, J. L. 1946. Some early notices on American manatees and the mode of their capture. Journal of Mammalogy 27:234–239. Beck, C. A. and J. P. Reid. 1995. An automated photo-identification catalog for studies of the life history of the Florida manatee. Pp. 120–134 in O’Shea, T. J., B. B. Ackerman, and H. F. Percival (eds.). Population Biology of the Florida Manatee (Trichechus manatus latirostris). Information and Technology Report 1, National Biological Service, Washington, D.C. Beeler, I. E. and T. J. O’Shea. 1988. Distribution and mortality of the West Indian manatee (Trichechus manatus) in the southeastern United States: a compilation and review of recent information. Vols. 1 and 2. National Technical Information Service, PB88-207980/AS, Springfield, Virginia. Belitsky, D. W. and C. L. Belitsky. 1980. Distribution and abundance of manatees (Trichechus manatus) in the Dominican Republic. Biological Conservation 17:313–319. Bengtson, J. L. 1981. Ecology of Manatees (Trichechus manatus) in the St. Johns River, Florida. Ph.D. thesis, University of Minnesota, Minneapolis. Bengtson, J. L. and D. Magor. 1979. A survey of manatees in Belize. Journal of Mammalogy 60:230–232. Bertram, G. C. L. and C. K. R. Bertram. 1963. The status of manatees in the Guianas. Oryx 7:90–93. Bertram, G. C. L. and C. K. R. Bertram. 1964. Manatees in the Guianas. Zoologica (New York Zoological Society) 49:115–120. Bertram, G. C. L. and C. K. R. Bertram. 1973. The modern Sirenia: their distribution and status. Biological Journal of the Linnean Society 5:297–338. Best, R. C. 1981. Foods and feeding habits of wild and captive Sirenia. Mammal Review 11:3–29. Best, R. C. and D. M. Teixeira. 1982. Notas sobre a distribuiçao e “status” aparentes dos peixes-bois (Mammalia: Sirenia) nas costas amapaenses brasileiras. Boletim Fundaçao Brasileira para a Conservaçao da Natureza, Río de Janeiro, 17:41–47. Bonde, R. K. 1998. Poachers take more manatees in Port Honduras. Pp. 6–7 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 30. Bonde, R. K. and C. Potter. 1995. Manatee butchering sites in Port Honduras. P. 7 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 24. Borôbia, M. and L. Lodi. 1992. Recent observations and records of the West Indian manatee Trichechus manatus in northeastern Brazil. Biological Conservation 59:37–43. Bossart, G. D., D. G. Baden, R. Y. Ewing, B. Roberts, and S. D. Wright. 1998. Brevetoxicosis in manatees (Trichechus manatus latirostris) from the 1996 epizootic: gross, histologic and immunohistochemical features. Toxicologic Pathology 26(2):276–282. Boyle, C. and J. Khan. 1993. National report on the status of the West Indian manatee population in Trinidad and Tobago. Manatee Subcommittee, Trinidad and Tobago Field Naturalist Club. Unpublished report. Bradley, R. 1983. The pre-Columbian exploitation of the manatee in Mesoamerica. Papers in Anthropology, University of Oklahoma 24:1–82. Brasier, M. D. 1975. An outline history of seagrass communities. Palaeontology 18:681–702.

Status and Biogeography of the West Indian Manatee

465

Buckingham, C. A., L. W. Lefebvre, J. M. Schaefer, and H. I. Kochman. 1999. Manatee response to boating activity in a thermal refuge. Wildlife Society Bulletin 27(2):514–522. Buergelt, C. D., R. K. Bonde, C. A. Beck, and T. J. O’Shea. 1984. Pathologic findings in manatees in Florida. Journal of the American Veterinary Medical Association 185:1331–1334. Busby, D. S. and R. W. Virnstein 1993. Executive summary. Pp. iii–viii in Morris, L. J. and D. A. Tomasko (eds.). Submerged Aquatic Vegetation and Photosynthetically Active Radiation. Special Publication SJ93SP13, St. Johns River Water Management District, Palatka, Florida. Campbell, H. W. and D. Gicca. 1978. Reseña preliminar del estado actual y distribución del manatí (Trichechus manatus) en México. Anales Instituto de Biologia, Universidad Nacional Autónoma de México, Serie Zoología 49:257–264. Campbell, H. W. and B. I. Irvine. 1975. Manatee survey in Dominican Republic, Feb.14–25, 1975. U.S. Fish and Wildlife Service. Unpublished report. Carr, A., M. H. Carr, and A. B. Meylan. 1978. The ecology and migrations of sea turtles, 7. The West Caribbean green turtle colony. Bulletin of the American Museum of Natural History 162:1–46. Carr, T. 1994. The manatees and dolphins of the Miskito Coast Protected Area, Nicaragua. Marine Mammal Commission Report PB94-170354. Gainesville, Florida. Centro Nacional de Conservação e Manejo de Sirênios 1997. Reunião de trabalho sobre pesquisa para a conservação do peixe-boi no Brasil, Barra de Mamanguape 6–8 Nov. 1997. Cerrato, C. A. 1993. Estado del manati en Honduras. Report to Unidad de Coordinacion Ambiental, Programa Ambiental del Caribe del Programa de las Naciones Unidas para el Medio Ambiente. Cuidad Universitaria Tegucigalpa, Honduras. 14 pp. Charnock-Wilson, J. 1968. The manatee in British Honduras. Oryx 9:293–294. Charnock-Wilson, J. 1970. Manatees and crocodiles. Oryx 10:236–238. Charnock-Wilson, J., C. K. R. Bertram, and G. C. L. Bertram. 1974. The manatee in Belize. Belize Audubon Society Bulletin 6:1–4. Colmenero-Rolón, L. C. 1984. Nuevos registros del manatí (Trichechus manatus) en el sureste de México. Anales Instituto de Biología, Universidad Nacional Autónoma de México, Serie Zoología 54:243–254. Colmenero-Rolón, L. C. 1986. Aspectos de la ecología y comportamiento de una colonia de manatíes (Trichechus manatus) en el municipio de Emilia no Zapata, Tabasco. Anales Instituto de Biología, Universidad Nacional Autónoma de México, Serie Zoología 56:589–602. Colmenero-Rolón, L. C. 1991. Propuesta de un plan de recuperacion para la poblacion del manatí Trichechus manatus de México. Anales Instituto de Biología, Universidad Nacional Autónoma de México, Serie Zoología 62:203–218. Colmenero-Rolón, L. C. 1998. Manatee recovery committee established. P. 6 in Domning, D. P. (ed.). Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 29. Colmenero-Rolón, L. C. and M. E. Hoz-Zavala. 1986. Distribución de los manatíes, situación y su conservación en México. Anales Instituto de Biología, Universidad Nacional Autónoma de Mexico, Serie Zoología 56:955–1020. Colmenero-Rolón, L. C. and B. E. Zarate. 1990. Distribution, status and conservation of the West Indian manatee in Quintana Roo, Mexico. Biological Conservation 52:27–35. Correa-Viana, M. 1995. El manatí: revisión de su distribución y abundancia actuales. Pp. 139–144 in Delfines y Otros Mamiferos Acuáticos de Venezuela. Academia de Ciencias Fisicas, Matamaticas, y Naturales and Fundacion para el Desarorollo de las Ciencias Fisicas, Matamaticas, y Naturales, Caracas, Venezuela. Craig, B. A., M. A. Newton, R. A. Garrott, J. E. Reynolds III, and J. R. Wilcox. 1997. Analysis of aerial survey data on Florida manatee using Markov Chain Monte Carlo. Biometrics 53:524–541. Crombie, R. I. 1975a. A report on the status and distribution of the manatee, Trichechus manatus, in Jamaica. U.S. Fish and Wildlife Service. Unpublished report. 9 pp. Crombie, R. I. 1975b. Manatee survey of the southeastern tip of the Republica Dominicana. U.S. Fish and Widllife Service. Unpublished Report. 10 pp. Cumbaa, S. L. 1980. Aboriginal use of marine mammals in the southeastern United States. Southeastern Archaeological Conference Bulletin 17:6–10. Cuní, L. A. 1918. Contribución al estudio de los mamíferos acuaticos observados en las costas de Cuba. Memorias de la Sociedad Cubana de Historia Natural “Felipe Poey” 3:83–126. Dampier, W. A. 1699. A New Voyage Round the World. Vol. I, 4th ed. James Knapton, London.

466

Biogeography of the West Indies: Patterns and Perspectives

Dekker, D. 1974. On the natural history of manatees (Trichechus manatus) from Suriname for the Amsterdam Zoo. Aquatic Mammals 2:1–3. Dekker, D. 1978. Suriname, a last refuge for the manatee. Suralco Magazine 10(3):1–4. Delgado, J. R. 1995. Status of the manatees in Venezuela. Pp. 159–165 in Delfines y Otros Mamiferos Acuáticos de Venezuela. Academia de Ciencias Fisicas, Matamaticas, y Naturales and Fundacion para el Desarorollo de las Ciencias Fisicas, Matamaticas, y Naturales, Caracas, Venezuela. Department of Nature Conservation. 1993. National report of Suriname on the status of the West Indian manatee population in Suriname. Suriname Forest Service and Foundation for Nature Preservation in Suriname, Ministry of Natural Resources. Paramaribo, Suriname. Deutsch, C. J., R. K. Bonde, and J. P. Reid. 1998. Radio-tracking manatees from land and space: tag design, implementation and lessons learned from long-term study. Marine Technology Society Journal 32(1):18–29. Deutsch, C. J., J. P. Reid, R. K. Bonde, D. E. Easton, H. I. Kochman, and T. J. O’Shea. 2000. Seasonal movements, migratory behavior, and site fidelity of West Indian manatees along the Atlantic coast of the United States as determined by radio-telemetry. Work Order No. 163. Florida Cooperative Fish and Wildlife Research Unit, U.S. Geological Survey and University of Florida. Unpublished report. 1–119 + appendices. Domning, D. P. 1981a. Distribution and status of manatees Trichechus spp. near the mouth of the Amazon River, Brazil. Biological Conservation 19:85–97. Domning, D. P. 1981b. Sea cows and sea grasses. Paleobiology 7:417–420. Domning, D. P. 1982a. Commercial exploitation of manatees Trichechus in Brazil c. 1785–1973. Biological Conservation 22:101–126. Domning, D. P. 1982b. Evolution of manatees: a speculative history. Journal of Paleontology 56:599–619. Domning, D. P. 1989. Alligator Hole River Project. Pp. 6–7 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 12. Domning, D. P. 1996. Bibliography and index of the Sirenia and Desmostylia. Smithsonian Contributions to Paleobiology No. 80: iii + 611. Domning, D. P. 1997a. More manatee poaching. Pp. 7–8 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 28. Domning, D. P. 1997b. Sirenia. Pp. 383–391 in Kay, R. F., R. H. Madden, R. L. Cifelli, and J. J. Flynn (eds.). Vertebrate Paleontology in the Neotropics: The Miocene Fauna of La Venta, Colombia. Smithsonian Institution Press, Washington, D.C. Domning, D. P. 1998a. Status of captive manatees in the Alligator Hole River. P. 6 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 29. Domning, D. P. 1998b. Logging threatens coastal environment. Pp. 6–7 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 29. Domning, D. P. and L. C. Hayek. 1986. Interspecific and intraspecific morphological variation in manatees (Sirenia: Trichechus). Marine Mammal Science 2:87–144. Domning, D. P., G. S. Morgan, and C. E. Ray. 1982. North American Eocene sea cows (Mammalia: Sirenia). Smithsonian Contributions to Paleobiology 52:1–69 Duerden, J. E. 1901. The marine resources of the British West Indies. West Indian Bulletin 2:123–127. Duplaix, N. and H. A. Reichart. 1978. History, status and protection of the Caribbean manatee Trichechus m. manatus in Suriname. Rare Animal Relief Effort and United States Fish and Wildlife Service. Unpublished report. 1–23 + 10 appendices. Eberhardt, L. L. and T. J. O’Shea. 1995. Integration of manatee life-history data and population modeling. Pp. 269–279 in O’Shea, T. J., B. B. Ackerman, and H. F. Percival (eds.). Population Biology of the Florida Manatee (Trichechus manatus latirostris). National Biological Service, Information and Technology Report 1:1–289. Eberhardt, L. L., R. A. Garrott, and B. L. Becker. 1999. Using trend indices for endangered species. Marine Mammal Science 15(3):766–785. Elizondo, C. L. H. 1993. El manati (Trichechus manatus) en Costa Rica. Base de Datos Conservación. Instituto Nacional de Biodiversidad-Convenio INBIO-TNC. Unpublished report. Pp. 94–95 + maps. Estrada, A. R. and L. T. Ferrer. 1987. Distribución del manatí antillano, Trichechus manatus (Mammalia: Sirenia), en Cuba. I. Región occidental. Poeyana 354:1–12.

Status and Biogeography of the West Indian Manatee

467

Estrada, A. R. and L. T. Ferrer. 1993. Informe sobre el estado del manati antillano en Cuba. Unpublished report prepared for UNEP. 1–4. Evermann, B. W. 1902. General report on the investigations in Porto Rico of the United States Fish Commission Steamer Fish Hawk in 1899. Bulletin of the United States Fish Commission 20:24–25. Fairbairn, P. W. and A. M. Haynes. 1982. Jamaican surveys of the West Indian manatee (Trichechus manatus), dolphin (Tursiops truncatus), sea turtles (Families Cheloniidae and Dermochelydae) and booby terns (Family Laridae). United Nations Food and Agriculture Organization Fisheries Report 278:289–295. Ferrer, L. T. and A. R. Estrada. 1988. Primer record de mortalidad del manatí en aguas cubanas. Miscelanea Zoologica 41:1–2. Fewkes, J. W. 1907. The aborigines of Porto Rico and neighboring islands. Annual Report of the Bureau of American Ethnology 25:48–50 and 192–193. Fletcher, S. W. and W. W. Fletcher. 1995. Factors affecting changes in seagrass distribution and diversity patterns in the Indian River Lagoon complex between 1940 and 1992. Bulletin of Marine Science 57:49–58. Gallagher, W. B., D. C. Parris, B. S. Grandstaff, and C. DeTample. 1989. Quaternary mammals from the continental shelf off New Jersey. Mosasaur: Journal of the Delaware Valley Paleontological Society 4:101–110. Gallo-Reynoso, J. P. 1983. Notas sobre la distribución del manatí (Trichechus manatus) en las costas de Quintana Roo. Anales Instituto de Biología, Universidad Nacional Autónoma de México, Serie Zoología 53:443–448. Garcia-Rodriguez, A. I. 2000. Genetic Studies of the West Indian Manatee (Trichechus manatus). Ph.D. thesis, University of Florida, Gainesville. Garcia-Rodriguez, A. I., B. W. Bowen, D. P. Domning, A. A. Mignucci-Giannoni, M. Marmontel, R. A. Montoya-Ospina, B. Morales-Vela, M. Rudin, R. K. Bonde, and P. M. McGuire. 1998. Phylogeography of the West Indian manatee (Trichechus manatus): how many populations and how many taxa? Molecular Ecology 7(9):1137–1149. Garrott, R. A., B. B. Ackerman, J. R. Cary, D. M. Heisey, J. E. Reynolds III, P. M. Rose and J. R. Wilcox. 1994. Trends in counts of Florida manatees at winter aggregation sites. Journal of Wildlife Management 58(4):642–654. Gundlach, J. 1877. Contribución a la Mamalogia Cubana. Montiel y Compañía, Habana. Gunter, G. 1942. Further miscellaneous notes on American manatees. Journal of Mammalogy 23:89–90. Gunter, G. 1954. Mammals of the Gulf of Mexico. Fishery Bulletin of the United States Fish and Wildlife Service 55:543–551. Harlan, R. 1824. On a species of Lamantin resembling the Manatus Senegalensis (Cuvier) inhabiting the coast of East Florida. Journal of the Academy of Natural Sciences of Philadelphia 3:390–394. Hartman, D. S. 1972. Manatees. Sierra Club Bulletin 57:20–22. Hartman, D. S. 1974. Distribution, status and conservation of the manatee in the United States. National Technical Information Service Publication PB81-140725, Springfield, Virginia. Hartman, D. S. 1979. Ecology and behavior of the manatee (Trichechus manatus) in Florida. American Society of Mammalogists Special Publication 5:1–153. Hatt, R. T. 1934. A manatee collected by the American Museum Congo Expedition, with observations on the recent manatees. Bulletin American Museum of Natural History 66:533–566. Hislop, G. 1985. Trinidad and Tobago. P. 8 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 3. Hulbert, R. C., Jr. and G. S. Morgan. 1989. Stratigraphy, paleoecology and vertebrate fauna of the Leisey Shell Pit Local Fauna, Early Pleistocene (Irvingtonian) of southwestern Florida. Papers in Florida Paleontology No. 2:1–19. Hurst, L. A. 1987. Review of the Status and Distribution of the West Indian Manatee (Trichechus manatus) in Jamaica, with an Evaluation of the Aquatic Vegetation of the Alligator Hole River. M.S. thesis, University of Florida, Gainesville. Husar, S. L. 1977. The West Indian Manatee (Trichechus manatus). U.S. Fish and Wildlife Service, Wildlife Research Report 7. U.S. Government Printing Office, Washington, D.C. Husson, A. M. 1978. The mammals of Suriname. Zoölogische Monographieën van het Rijksmuseum van Natuurlijke Historie No. 2:334–339. IBAMA 1997. Mamíferos aquáticos do Brasil: Plano de ação. Brasília.

468

Biogeography of the West Indies: Patterns and Perspectives

INDERENA 1993. Informe del estado actual del manati antillano (Trichechus manatus) en Colombia. Division de Fauna Terrestre. Santafé de Bogotá. Irvine, A. B. 1983. Manatee metabolism and its influence on distribution in Florida. Biological Conservation 25:315–334. Irvine, A. B., F. C. Neal, P. T. Cardeilhac, J. A. Popp, F. H. White, and R. L. Jenkins. 1980. Clinical observations on captive and free-ranging West Indian manatees, Trichechus manatus, in Florida. Aquatic Mammals 8:2–10. Irvine, A. B., J. E. Caffin, and H. I. Kochman. 1982. Aerial surveys for manatees and dolphins in western peninsular Florida. Fishery Bulletin 80:621–629. Jackson, J. F. 1975. Preliminary status survey of Trichechus in northeastern Brazil. Unpublished report for the U.S. Fish and Wildlife Service 1–6 + map. Janson, T. 1978. Ecology and conservation of the Guatemalan manatee. Marine Mammal Information, Oregon State University:3. Abstract. Janson, T. 1980. Discovering the mermaids. Oryx 5:373–379. Jiménez, J. C. 1982. Letter to editor, San Juan Star Magazine, June 6, 1982. Jiménez-Marrero, N. M., I. Méndez-Matos, R. A. Montoya-Ospina, E. H. Williams, L. Bunkley, and A. A. Mignucci-Giannoni. 1998. Rangos de referencia de immunoglobulina G en individuos de tres poblaciones des manatí (Trichechus manatus). Caribbean Journal of Science 34(3–4):313–315. Jiménez Pérez, I. 1998. Ecology and Conservation of the West Indian Manatee in Northeastern Costa Rica. M.S. thesis in Wildlife Management and Conservation, submitted to Regional Wildlife Management Program for Mesoamerica and the Caribbean, Universidad Nacional, Costa Rica. Jiménez Pérez, I. 2000a. Conservation status of the West Indian manatee (Trichechus manatus) in Nicaragua. Unpublished report. Jiménez Pérez, I. 2000b. Los Manatíes del Río San Juan y los Canales de Torteguero: Ecología y Conservación. Asociación Comunidades Ecologistas la Ceiba, Amigos de la Tierra, Costa Rica. Jiménez Pérez, I. and M. A. Cateula. 1998. Estado de conservación del manatí (Trichechus manatus) en la Gran Reserva Biológica Indio Maíz, Nicaragua. Unpublished report. Jong, C. de 1961. Manatee hunters in Guiana in past centuries. Surinaamse Landbouw 9:93–100. Kadel, J. J. and G. W. Patton. 1992. Aerial studies of the West Indian manatee (Trichechus manatus) on the west coast of Florida from 1985–1990: a comprehensive six year study. Mote Marine Laboratory Technical Report No. 246:1–17+ appendices. Kenyon, K. W. 1981. Monk seals — Monachus. Pp. 195–220 in Ridgway, S. H. and R. J. Harrison (eds.). Handbook of Marine Mammals, Vol. 2 Seals. Academic Press, London. Kinnaird, M. F. 1985. Aerial census of manatees in northeastern Florida. Biological Conservation 32:59–79. Klein, E. H. 1979. Review of the status of manatee (Trichechus manatus) in Honduras, Central America. Ceiba 23(1):21–28. Koelsch, J. A. 1997. The Seasonal Occurrence and Ecology of Florida Manatees (Trichechus manatus latirostris) in Coastal Waters near Sarasota, FL. Master’s thesis, University of South Florida, Tampa. Landsberg, J. H. and K. A. Steidinger. 1998. A historical review of Gymnodinium breve red tides implicated in mass mortalities of the manatee (Trichechus manatus latirostris) in Florida, USA. Pp. 97–100 in Raguera, B., J. Blanco, M. L. Fernández, and T. Wyatt (eds.). Harmful Algae. Xunta de Galicia and Intergovernmental Oceanographic Commission of UNESCO. Langtimm, C. A., T. J. O’Shea, R. Pradel, and C. A. Beck. 1998. Estimates of annual survival probabilities for adult Florida manatees (Trichechus manatus latirostris). Ecology 79(3):981–997. Layne, J. N. 1965. Observations on marine mammals in Florida waters. Bulletin Florida State Museum 9:131–181. Lazcano-Barrero, M. A. and J. M. Packard. 1989. The occurrence of manatees (Trichechus manatus) in Tamaulipas, Mexico. Marine Mammal Science 5:202–205. LeBouef, B. J., K. W. Kenyon, and B. Villa-Ramirez. 1986. The Caribbean monk seal is extinct. Marine Mammal Science 2(1):70–72. Ledder, D.A. 1986. Food Habits of the West Indian Manatee (Trichechus manatus latirostris) in South Florida. M.S. thesis, University of Miami, Coral Gables, Florida. Lefebvre, L. W. and R. K. Frohlich. 1986. Movements of radio-tagged manatees in southwest Florida, January 1985–March 1986. United States Fish and Wildlife Service and Florida Department of Natural Resources. Unpublished report: 1–87.

Status and Biogeography of the West Indian Manatee

469

Lefebvre, L. W. and H. I. Kochman. 1991. An evaluation of aerial survey replicate count methodology to determine trends in manatee abundance. Wildlife Society Bulletin 19:298–309. Lefebvre, L. W. and T. J. O’Shea. 1995. Florida manatees. Pp. 267–269 in Our Living Resources — Coastal and Marine Ecosystems. National Biological Service, U.S. Government Printing Office, Washington, D.C. Lefebvre, L. W., T. J. O’Shea, G. B. Rathbun, and R. C. Best. 1989. Distribution, status and biogeography of the West Indian manatee. Pp. 567–610 in Woods, C. A. (ed.). Biogeography of the West Indies; Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Lefebvre, L. W., B. B. Ackerman, K. M. Portier, and K. H. Pollock. 1995. Aerial survey as a technique for estimating manatee population size and trend — problems and prospects. Pp. 63–74 in O’Shea T. J., B. B. Ackerman and H. F. Percival (eds.). Population Biology of the Florida Manatee (Trichechus manatus latirostris). Information and Technology Report 1, National Biological Service, Washington, D.C. Lefebvre, L. W., J. P. Reid, W. J. Kenworthy, and J. A. Powell. 2000. Characterizing manatee habitat use and seagrass grazing in Florida and Puerto Rico: implications for conservation and management. Pacific Conservation Biology 5(4):289–298. Lima, R. P. de 1997. Peixe-boi marinho (Trichechus manatus): distribuição, status de conservação e aspectos tradicionais ao longo do litoral nordeste do Brasil. M.Sc. dissertation, Universidade Federal de Pernambuco, Recife. Lima, R. P. de, D. Paludo, R. J. Soavinski, K. G. Silva, and E. M. A. Oliveira. 1992. Levantamento da distribuição, ocorrência e status de conservação do peixe-boi marinho (Trichechus manatus manatus, Linnaeus, 1758) no litoral nordeste do Brasil. Peixe-boi – coletânea de trabalhos de consrevação e pesquisa de sirênios no Brasil 1(1):47–72. Lluch-Belda, D. 1965. Algunas notas sobre la biología del manatí. Anales del Instituto Nacional de Investigaciones Biológico-Pesqueras, México 1:405–419. López-Ornat, A. and J. J. Consejo-Dueñas. 1988. Implementación de un programa de conservación de los humedales de Quintana Roo (México): un proceso dinámico de cinco años. Pp. 351–356 in Anónimo (ed.). Ecología y conservación del Delta de los ríos Usumacinta y Grijalva. Memorias, INIREB-TABASCO. Loveland, F. O. 1976. Tapirs and manatees: cosmological categories and social process among Rama Indians of eastern Nicaragua. Pp. 67–82 in Helms, M. W. and F. O. Loveland (eds.). Frontier Adaptations in Lower Central America. Philadelphia Institute for the Study of Human Issues, Philadelphia, Pennsylvania. MacLaren, J. P. 1967. Manatees as a naturalistic biological mosquito control method. Mosquito News 27(3):387–393. Maheia, W. 1997. Manatee poaching continues in Belize. Pp. 7–8 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 27. Marine Mammal Commission. 1988. Preliminary assessment of habitat protection needs for West Indian manatees on the east coast of Florida and Georgia. Marine Mammal Commission, Washington, D.C. Marmontel, M., S. R. Humphrey, and T. J. O’Shea. 1997. Population viability analysis of the Florida manatee (Trichechus manatus latirostris), 1976–1991. Conservation Biology 11(2):467–481. Marsh, H., T. J. O’Shea, and R. C. Best. 1986. Research on sirenians. Ambio 15:177–180. Marsh, H., C. A. Beck, and T. Vargo. 1999. Comparisons of the capabilities of dugongs and West Indian manatees to masticate seagrasses. Marine Mammal Science 15(1):250–255. Mataraza, L. K., J. B. Terrell, A. B. Munson, and D. E. Canfield, Jr. 1999. Changes in submersed macrophytes in relation to tidal storm surges. Journal of Aquatic Plant Management 37:3–12. McClenaghan, L. R., Jr. and T. J. O’Shea. 1988. Genetic variability in the Florida manatee (Trichechus manatus). Journal of Mammalogy 69:481–488. McCoy, E. D. and K. L. Heck, Jr. 1976. Biogeography of corals, seagrasses and mangroves: an alternative to the center of origin concept. Systematic Zoology 25(1):201–210. McKillop, H. I. 1985. Prehistoric exploitation of the manatee in the Maya and circum-Caribbean areas. World Archaeology 16(3):337–353. Mignucci-Giannoni, A. A. 1991. Outlook for manatee survival grim unless rapid action is taken. Pp. 7–8 in Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 15. Mignucci-Giannoni, A. A. 1998. Marine mammal captivity in the northeastern Caribbean, with notes on the rehabilitation of stranded whales, dolphins and manatees. Caribbean Journal of Science 34(3–4):191–203.

470

Biogeography of the West Indies: Patterns and Perspectives

Mignucci-Giannoni, A. A. and C. A. Beck. 1998. The diet of the manatee (Trichechus manatus) in Puerto Rico. Marine Mammal Science 14(2):394–397. Mignucci-Giannoni, A. A., C. A. Beck, R. A. Montoya-Ospina, and E. H. Williams. 1999. Parasites and commensals of the West Indian manatee from Puerto Rico. Journal of the Helminthological Society of Washington 66(1):67–69. Mignucci-Giannoni, A. A., R. A. Montoya-Ospina, N. M. Jimenez-Marrero, M. A. Rodriguez-Lopez, E. H. Williams, and R. K. Bonde. 2000. Manatee mortality in Puerto Rico. Environmental Management. 25(2):189–198. Miller, G. S. 1918. Mammals and reptiles collected by Theodoor de Booy in the Virgin Islands. Proceedings U.S. National Museum 54(2244):507–511. Miller, G. S. 1929. Mammals eaten by Indians, owls and Spaniards in the coast region of the Dominican Republic. Smithsonian Miscellaneous Collection 82(5):1–16. Miller, K. E., B. B. Ackerman, L. W. Lefebvre, and K. B. Clifton. 1998. An evaluation of strip-transect aerial survey methods for monitoring manatee populations in Florida. Wildlife Society Bulletin 26(3):561–570. Mondolfi, E. 1974. Taxonomy, distribution and status of the manatee in Venezuela. Memoria de la Sociedad de Ciencias Naturales La Salle 97(34):5–23. Mondolfi, E. and C. Müller. 1979. Investigación y conservación del manatí en Venezuela. Vols. 1 (55 pp.) and 2 (88 pp.). Fundación para la Defensa de la Naturaleza. Unpublished report. Montgomery, G. B., N. B. Gale, and W. P. Murdoch, Jr. 1982. Have manatee entered the eastern Pacific Ocean? Mammalia 46:267–258. Montgomery, G. G. 1980. Status of the manatee (Trichechus manatus) in Bocas del Toro Province, Panama. Smithsonian Tropical Research Institute, Balboa, Panama. Montoya-Ospina, R. A. 1994. Preliminary Blood Chemistry Reference Ranges for Antillean Manatees, Trichechus manatus, from Puerto Rico and Colombia. Master of Science thesis, Department of Marine Sciences, University of Puerto Rico, Mayagüez, Puerto Rico. Montoya-Ospina, R. A., C. Caicedo-Herrera, S. L. Millán-Sánchez, A. A. Mignucci-Giannoni, and L. W. Lefebvre. In press. Status of the West Indian manatee, Trichechus manatus, in Colombia. Biological Conservation. Moore, J. C. 1951. The range of the Florida manatee. Quarterly Journal of the Florida Academy of Sciences 14:1–19. Moore, J. C. 1956. Observations of manatees in aggregations. American Museum Novitates 1811:1–24. Morales-Vela, B. 2000a. Distribución, movimientos y reproduccion de manatí es radio-marcados en la bahia de Chetumal, México. Chapter in draft Ph.D. thesis: Distribución, abundancia y uso de habitat por el manatí en Quintana Roo y Belize, Facultad de Ciencia, Universidad Nacional Autónoma de México. Morales-Vela, B. 2000b. Tendencia poblacional de manatíes es y su distribución en la bahia de Chetumal, Quintana Roo, México. Chapter in draft Ph.D. thesis: Distribución, abundancia y uso de habitat por el manatí en Quintana Roo y Belize, Universidad Nacional Autónoma de México. Morales-Vela, B. and L. D. Olivera-Gomez. 1992. De sirenas a manatí es. Centro de Investigaciones de Quintana Roo (CIQRO), Chetumal, México. Morales-Vela, B and L. D. Olivera-Gómez. 1994a. Distribución espacial y estimacion poblacional de los manatí es en las Bahia de Chetumal, Quintana Roo, México. Revista de Investigaciones Cientifica, Universidad Nacional Autónoma de México, Serie Ciencias del Mar 2 (No. especial SOMEMMA, 2):27–34. Morales-Vela, B. and L. D. Olivera-Gómez. 1994b. Distribución y abundancia del manatí en la Reserva de la Biosfera Sian Ka’an, Quintana Roo, México: (1992–1994). Sian Ka’an Serie Documentos (2):55–59. Morales-Vela, B. and L. D. Olivera-Gómez. 1996. Manatee rescue in Chiapas. P. 11 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 25. Morales-Vela, B, L. D. Olivera-Gómez, and P. Ramirez-Garcia. 1996. Conservacion de los manatíes en la region del Caribe de México y Belize. Informe técnico preparado por El Colegio del la Frontera Sur. ECOSUR Informe Técnico Numero MM01-CONACyT N9301-2017. Morales-Vela, B. and L. D. Olivera-Gómez. 1997. Distribución del manatí (Trichechus manatus) en la costa norte y centro-norte del estado de Quintana Roo, México. Anales Instituto de Biologia, Universidad Nacional Autonoma de México, Serie Zoologia 68:153–164.

Status and Biogeography of the West Indian Manatee

471

Morales-Vela, B., D. Olivera-Gómez, J. E. Reynolds III, and G. B. Rathbun. 2000. Distribution and habitat use by manatees (Trichechus manatus manatus) in Belize and Chetumal Bay, Mexico. Biological Conservation 95:67–75. Morgan, G. S. and C. A. Woods. 1986. Extinction and the zoogeography of West Indian land mammals. Biological Journal of the Linnean Society 28:167–203. Morison, S. E. 1942. Admiral of the Ocean Sea: A Life of Christopher Colombus. Little, Brown, Boston. 680 pp. Mou Sue, L. L., D. H. Chen, R. K. Bonde, and T. J. O’Shea. 1990. Distribution and status of manatees (Trichechus manatus) in Panama. Marine Mammal Sciences 6(3):234–241. Muizon, C. D. and D. P. Domning. 1985. The first records of fossil sirenians in the southeastern Pacific Ocean. Mammalia 46:257–258. Murie, A. 1935. Mammals from Guatemala and British Honduras. Miscellaneous Publications of the Museum of Zoology University of Michigan 26:1–30. Murray, J. A. (ed.). 1991. The Islands and the Sea: Five Centuries of Nature Writing from the Caribbean. Oxford University Press, New York. Murray, S. P., S. A. Hsu, H. H. Roberts, E. H. Owens, and R. L. Crout. 1982. Physical processes and sedimentation on a broad, shallow bank. Estuarine, Coastal and Shelf Science 14:135–137. Narganes-S., Y. M. 1982. Vertebrate Faunal Remains from Sorce, Vieques. M.S. thesis, University of Georgia, Athens. National Science Research Council of Guyana and National Academy of Sciences, USA. 1973. Some prospects for aquatic weed management in Guyana. Workshop on Aquatic Weed Management and Utilization. Georgetown, Guyana. National Science Research Council of Guyana. 1974. An international centre for manatee research. Georgetown, Guyana. Natural Resources Conservation Authority. 1993. Jamaica — National report on the status of the West Indian manatee (Trichechus manatus manatus). Unpublished report prepared for UNEP. 1–8 + map. Neish, W. D. 1896. The manatee, Manatus australis. Journal of the Institute of Jamaica 2:287–288. Nietschmann, B. 1972. Hunting and fishing focus among the Moskito Indians, eastern Nicaragua. Human Ecology 1:41–67. Nietschmann, B. 1979. Ecological change, inflation and migration in the far western Caribbean. Geographic Review 69:1–24. Odell, D. K. 1979. Distribution and abundance of marine mammals in the waters of the Everglades National Park. National Park Service Biological Series 5:673–678. Odell, D. K., J. E. Reynolds, and G. Waugh. 1978. New records of the West Indian manatee (Trichechus manatus) from the Bahama Islands. Biological Conservation 14:289–293. O’Donnell, D. J. 1981. Manatees and Man in Central America. Ph.D. dissertation, Department of Geography, University of California, Los Angeles. Ojeda C., M. M., J. Porras, H. Gonzalez, and J. Ojasti. 1993. Estado actual del manati antillano Trichechus manatus en Venezuela — informe nacional. Republica de Venezuela, Ministe del Ambiente y de los Recursos Naturales Renovables (M.A.R.N.R.). Unpublished report prepared for UNEP. Ortega-Argueta, A. 1997. Uso de caletas y cenotes por el manatí del Caribe Trichechus manatus manatus (Linnaeus 1758) y el impacto del turismo en Quintana Roo, México. Tesis profesional, Facultad de Biología, Universidad Veracrusana, Xalapa, Veracruz, México. Ortiz, R. M., G. A. J. Worthy, and D. S. MacKenzie. 1998. Osmoregulation in wild and captive West Indian manatees (Trichechus manatus). Physiological Zoology 71(4):449–457. O’Shea, T. J. 1986. Mast foraging by West Indian manatees (Trichechus manatus). Journal of Mammalogy 67:183–185. O’Shea, T. J. and B. B. Ackerman. 1995. Population biology of the Florida manatee: an overview. Pp. 280–288 in O’Shea, T. J., B. B. Ackerman, and H. F. Percival (eds.). Population Biology of the Florida Manatee (Trichechus manatus latirostris). National Biological Service, Information and Technology Report 1:1–289. O’Shea, T. J. and W. C. Hartley. 1995. Reproduction and early-age survival of manatees at Blue Spring, Upper St. Johns River, Florida. Pp. 157–176 in O’Shea, T. J., B. B. Ackerman, and H. F. Percival (eds.). Population Biology of the Florida Manatee (Trichechus manatus latirostris). National Biological Service, Information and Technology Report 1:1–289.

472

Biogeography of the West Indies: Patterns and Perspectives

O’Shea, T. J. and H. I. Kochman. 1990. Florida manatees: distribution, geographically referenced data sets and ecological and behavioral aspects of habitat use. Pp. 11–22 in Reynolds, J. E. III and K. D. Haddad (eds.). Report of the Workshop on Geographic Information Systems as an Aid to Managing Habitat for West Indian manatees in Florida and Georgia. Florida Marine Research Publications 49:1–57. O’Shea, T. J. and C. A. Salisbury. 1991. Belize — a last stronghold for manatees in the Caribbean. Oryx 25:156–164. O’Shea, T. J., C. A. Beck, R. K. Bonde, H. I. Kochman, and D. K. Odell. 1985. An analysis of manatee mortality patterns in Florida, 1976–81. Journal of Wildlife Management 49:1–11. O’Shea, T. J., M. Correa-Viana, M. E. Ludlow, and J. G. Robinson. 1986. Distribution and status of the West Indian manatee in Venezuela. I.U.C.N. Contract Report 9132, Gland, Switzerland. O’Shea, T. J., G. B. Rathbun, R. K. Bonde, C. D. Buergelt, and D. K. Odell. 1991. An epizootic of Florida manatees associated with a dinoflagellate bloom. Marine Mammal Science 7(2):165–179. Ottenwalder, J. A. 1995. Situación del manatí en la República Dominicana. Dominican Business 32:41–44. Ottenwalder, J. A. and Y. Leon. 1999. Resultados del análisis inicial de los surveys (entrevistas) de manatí conducidas en la costa de República Dominicana entre 1994 y 1996. Unpublished report. Packard, J. M. 1981. Abundance, distribution and feeding habits of manatees (Trichechus manatus) wintering between St. Lucie and Palm Beach Inlets, Florida. U.S. Fish and Wildlife Service Contract Report No. 14-16-004-80-105. Packard, J. M. 1983. Proposed Research/Management Plan for Crystal River manatees. Vol. I. Summary. Technical Report No. 7. Florida Cooperative Fish and Wildlife Research Unit, University of Florida, Gainesville. Packard, J. M. and P. M. Rose. 1985. Strategies for protection of non-exploited Sirenia populations. Fourth International Thelogical Congress. Abstract. Packard, J. M. and O. F. Wetterqvist. 1986. Evaluation of manatee habitat systems on the northwestern Florida coast. Coastal Zone Management Journal 14:279–310. Paludo, D. 1997. Estudos sobre a ecologia e conservação do peixe-boi marinho Trichechus manatus manatus no nordeste do Brasil. M.Sc. dissertation, Universidade Federal da Paraíba, João Pessoa, Brasil. Phillips, R.C., R. L. Vadas, and N. Ogden. 1982. The marine algae and seagrasses of the Moskito Bank, Nicaragua. Aquatic Botany 13:187–195. Powell, J. A. 1976. Jamaica trip report. U.S. Fish and Wildlife Service. Unpublished report. Powell, J. A. 1978. Evidence of carnivory in manatees (Trichechus manatus). Journal of Mammalogy 59:442. Powell, J. A. and D. F. Gicca. 1975. Colombia, South America trip report. U.S. Fish and Wildlife Service. Unpublished report. Powell, J. A. and G. B. Rathbun. 1984. Distribution and abundance of manatees along the northern coast of the Gulf of Mexico. Northeast Gulf Science 7:1–28. Powell, J. A. and J. C. Waldron. 1981. The manatee population in Blue Spring, Volusia County, Florida. Pp. 41–51 in Brownell, R. L. and K. Ralls (eds.). The West Indian Manatee in Florida. Florida Department of Natural Resources Tallahassee. Unpublished report. 155 pp. Powell, J. A., D. W. Belitsky, and G. B. Rathbun. 1981. Status of the West Indian manatee (Trichechus manatus) in Puerto Rico. Journal of Mammalogy 62:642–646. Price, W. A. 1954. Shorelines and coasts of the Gulf of Mexico. Pp. 39–65 in Galtsoff, P. S. (ed.). Gulf of Mexico — its origin, water and marine life. Fishery Bulletin of the Fish and Wildlife Service 89, Vol. 55:1–604. Provancha, J. A. and C. R. Hall. 1991. Observations of associations between seagrass beds and manatees in east central Florida. Florida Scientist 54(2):87–98. Quintana Rizzo, E. 1993. Estimación de la distribución y el tamaño poblacional del manati Trichechus manatus (Trichechidae-Sirenia) en Guatemala. M.Sc. thesis, Universidad de San Carlos de Guatemala, Facultad de Ciencias Quimicas y Farmacia, Guatemala. 80 pp. Rathbun, G. B., R. K. Bonde, and D. Clay. 1982. The status of the West Indian manatee on the Atlantic coast north of Florida. Pp. 152–165 in Odom, R. R. and J. W. Guthrie (eds.). Proceedings of the Nongame and Endangered Wildlife Symposium. Georgia Department of Natural Resources, Technical Bulletin WL 5. Rathbun, G. B., J. A. Powell, and G. Cruz. 1983a. Status of the West Indian manatee in Honduras. Biological Conservation 26:301–308.

Status and Biogeography of the West Indian Manatee

473

Rathbun, G. B., J. A. Powell, and J. P. Reid. 1983b. Movements of manatees (Trichechus manatus) using power plant effluents in southern Florida. Florida Power and Light Co. Contract Report, Cooperative Agreement No. 14-16-0009-82-906. Rathbun, G. B., T. Carr, N. M. Carr, and C. A. Woods. 1985a. The distribution of manatees and sea turtles in Puerto Rico. National Technical Information Service PB86-1518347AS, Springfield, Virginia. Rathbun, G. B., C. A. Woods, and J. A. Ottenwalder. 1985b. The manatee in Haiti. Oryx 19:234–236. Rathbun, G. B., J. P. Reid, and G. Carowan. 1990. Distribution and movement patterns of manatees (Trichechus manatus) in northwestern peninsular Florida. Florida Marine Research Publications (48):1–33. Rathbun, G. B., J. P. Reid, R. K. Bonde, and J. A. Powell. 1995. Reproduction in free-ranging Florida manatees. Pp. 135–156 in O’Shea, T. J., B. B. Ackerman, and H. F. Percival (eds.). Population Biology of the Florida Manatee (Trichechus manatus latirostris). National Biological Service, Information and Technology Report 1. Ray, C. E. 1960. The manatee in the Lesser Antilles. Journal of Mammology 41:412–413. Reid, J. P. 1996. Chessie the manatee: from Florida to Rhode Island. Argos Newsletter No. 51:13. Reid, J. P. 2000. Florida manatee now resident in the Bahamas. Pp. 7–8 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 33. Reid, J. P. and G. B. Rathbun. 1986. 1985 manatee identification catalog update. U.S. Fish and Wildlife Service and Florida Power and Light Co. Unpublished report. Reid, J. P., G. B. Rathbun, and J. R. Wilcox. 1991. Distribution patterns of individually identifiable West Indian manatees (Trichechus manatus) in Florida. Marine Mammal Science 7:180–190. Reynolds, J. E., III. 1995. Florida manatee population biology: research progress, infrastructure and applications for conservation and management. Pp. 6–12 in O’Shea, T. J., B. B. Ackerman, and H. F. Percival (eds.). Population Biology of the Florida Manatee (Trichechus manatus latirostris). National Biological Service, Information and Technology Report 1:1–289. Reynolds, J. E., III. 1999. Efforts to conserve manatees. Pp. 267–295 in Twiss, J. R., Jr. and R. R. Reeves (eds.). Conservation and Management of Marine Mammals. Smithsonian Institution Press, Washington, D.C. Reynolds, J. E., III. 2000. Distribution and abundance of Florida manatees (Trichechus manatus latirostris) around selected power plants following winter cold fronts: 1999–2000. Florida Power and Light Company, Order Number: B93135-00139. Reynolds, J. E., III and J. C. Ferguson. 1984. Implications of the presence of manatees (Trichechus manatus) near the Dry Tortugas Islands. Florida Scientist 47:187–189. Reynolds, J. E., III and C. J. Gluckman. 1988. Protection of West Indian manatees (Trichechus manatus) in Florida. Final Report to the U.S. Marine Mammal Commission. NTIS Report PB88-222922/AS:1–85. Reynolds, J. E., III and J. R. Wilcox. 1994. Observations of Florida manatees (Trichechus manatus latirostris) around selected power plants in winter. Marine Mammal Science 10(2):163–177. Reynolds, J. E., III, W. A. Szelistowski, and M. A. Leon. 1995. Status and conservation of manatees Trichechus manatus manatus in Costa Rica. Biological Conservation 71:193–196. Rose, P. M. and S. P. McCutcheon. 1980. Manatees (Trichechus manatus): abundance and distribution in and around several Florida power plant effluents. Florida Power and Light Co. Contract 31534-86626. Rosen, D. E. 1975. A vicariance model of Caribbean biogeography. Systematic Zoology 24:431–464. Roth, V. 1953. Notes and observations on animal life in British Guiana. Daily Chronicle, Ltd., Guiana Edition No. 3:69–73. Georgetown, British Guiana. Rouse, I. 1964. Prehistory of the West Indies. Science 144:499–513. Rouse, I. 1986. Migrations in Prehistory. Yale University Press, New Haven, Connecticut. Ruschi, A. 1965. Lista dos mamíferos do estado do Espírito Santo. Boletim do Museu de Biología No. 24A:29. Schad, R. C., G. Montgomery, and D. Chancellor. 1981. La distribución y frequencia del manatí en el Lago Gatun y en el Canal de Panama. ConCiencia 8:1–4. Schiro, A. J., L. P. May, and D. C. Fertl. 1996. Manatee occurrence in the northwestern Gulf of Mexico. Journal of the American Cetacean Society 30(1). Schwartz, F. J. 1995. Florida manatees, Trichechus manatus (Sirenia: Trichechidae) in North Carolina 1919–1994. Brimleyana 22:53–60. Secretaria de Estado de Agricultura, Republica Dominicana 1993. El estado del manatí en l Republica Dominicana. Unpublished report to UNEP:1–36 + appendices. Shane, S. H. 1983. Abundance, distribution and movements of manatees (Trichechus manatus) in Brevard County, Florida. Bulletin of Marine Science 33:1–9.

474

Biogeography of the West Indies: Patterns and Perspectives

Shane, S. H. 1984. Manatee use of power plant effluents in Brevard County, Florida. Florida Scientist 47:180–187. Shaul, W. and A. Haynes. 1986. Manatees and their struggle to survive. Jamaica Journal 19:29–36. Simpson, G. G. 1932. Fossil Sirenia of Florida and the evolution of the Sirenia. Bulletin of the American Museum of Natural History 59:419–503. Sloane, H. 1725. A voyage to the islands Madera, Barbados, Nieves, St. Christophers and Jamaica, with the natural history of the herbs and trees, four-footed beasts, fishes, birds, insects, reptiles, &c. of the last of those islands. Vol. 2. Printed by B. M. for the author, London. Smethurst, D. and B. Nietschmann. 1999. The distribution of manatees (Trichechus manatus) in the coastal waterways of Tortuguero, Costa Rica. Biological Conservation 89:267–274. Smith, K. N. 1993. Manatee habitat and human-related threats to seagrass in Florida: a review. Report of the Department of Environmental Protection, Tallahassee, Florida:1–38. Steininger, F. F. 1986. Erste Ergebnisse über Untersuchungen zu Ernährungsstrategien des ArawakenSiedlungsplatzes Pointe der Caille, NNW Vieux Fort, St. Lucia, West Indies. Mitteilungen der Prähistorischen Kommission Österreichischen Akademie der Wissenshaften 23:37–50. Strong, W. D. 1935. Archaeological investigations in the Bay Islands, Spanish Honduras. Smithsonian Miscellaneous Collection 92:1–176. Terrell, J. B. and D. E. Canfield, Jr. 1996. Evaluation of the effects of nutrient removal and the “Storm of the Century” on submersed vegetation in Kings Bay – Crystal River, Florida. Journal of Lake and Reservoir Management 12(5):394–403. Thornback, J. and M. Jenkins 1982. Caribbean manatee. Pp. 429–438 in Red Data Book. Vol. 1. Mammalia. International Union for Conservation of Nature and Natural Resources, Morges, Switzerland. Toppin-Allahar, C. 1993. The law and the conservation of the manatee. Unpublished report for the Trinidad and Tobago Field Naturalists Club. True, F. W. 1884. The Sirenians or seacows. The Fisheries and Fishery Industries of the United States, Sec. 1, Natural History of Useful Aquatic Animals, Part 1, Art. C, pp. 114–136. Trumbull, S. 1949. Sea cows making comeback. Audubon Magazine 51:337. Vaughan, C. 1983. A report on dense forest habitat for endangered wildlife species in Costa Rica. U.S. Department of Interior Contract No. 14-16-0009-79-055 and National University of Costa Rica Research Project No. 782085. Unpublished report. Viquez, D. 1993. Situación del manati (Trichechus manatus) en la Republica de Panama – Informe Nacional. Ministe de Planificación y Política Económica. Comision Nacional del Medio Ambiente, Panama. Watters, D. R., E. J. Reitz, D. W. Steadman, and G. K. Pregill. 1984. Vertebrates from archaeological sites on Barbuda, West Indies. Annals of the Carnegie Museum 53:383–412. Whitehead, P. J. P. 1977. The former southern distribution of New World manatees (Trichechus spp.). Biological Journal of the Linnean Society 9:165–189. Wilson, D. E. 1974. Status report on manatees of Costa Rica. U.S. Fish and Wildlife Service. Unpublished report. Wing, E. S. 1967. Aboriginal fishing in the Windward Islands. Proceedings of the Second International Congress of Pre-Columbian Cultures of the Lesser Antilles:103–107. Wing, E. S. and E. J. Reitz. 1982. Prehistoric fishing communities of the Caribbean. Journal of New World Archaeology 5:13–32. Wing, E. S. and S. Scudder. 1980. Use of animals by the prehistoric inhabitants on St. Kitts, West Indies. Proceedings of the Eighth International Congress of the Pre-Columbian Cultures of the Lesser Antilles. Arizona State University Anthropological Research Papers No. 22:237–245. Wing, E. S., C. Hoffman, and C. Ray. 1968. Vertebrate remains from Indian sites on Antigua, West Indies. Caribbean Journal of Science 8:123–139. Woods, C. A. and J. A. Ottenwalder. 1992. The natural history of southern Haiti. Florida Museum of Natural History. Prepared for USAID/Haiti under contract number 521-0191-A-00-7107:1-211. Wotzkow, C. 1990. Distribution and status of manatees in Cuba. Pp. 5–6 in Domning, D. P. (ed.). Sirenews, Newsletter of the IUCN/SSC Sirenia Specialist Group, No. 13. Wright, S. D., B. B. Ackerman, R. K. Bonde, C. A. Beck, and D. J. Banowetz. 1995. Analysis of watercraftrelated mortality of manatees in Florida, 1979–1991. Pp. 259–268 in O’Shea, T. J., B. B. Ackerman, and H. F. Percival (eds.). Population Biology of the Florida Manatee (Trichechus manatus latirostris). Information and Technology Report 1, National Biological Service, Washington, D.C. 1–289. Zoodsma, B. J. 1991. Distribution and Behavioral Ecology of Manatees in Southeastern Georgia. M.S. thesis, University of Florida, Gainesville.

Biogeography 23 Historical in Cuba: 19th-Century Interpretations and Misinterpretations Pedro M. Pruna Goodgall INTRODUCTION In 1860, the mandible or jawbone of what was eventually described as a giant sloth was found in central Cuba. Twenty-eight years later the mandible of what was thought to be a fossil man was unearthed in a cave, also in central Cuba. Both events had a bearing on later discussions regarding two somewhat interconnected problems: the historical origins of the Cuban fauna and the antiquity of humans on the island. The giant sloth was a remarkable finding at the time because the only previously known remains of giant sloths came from the South and North American continents, and it was puzzling to find fossils of such large mammals on an island lying so far off the mainland. The Spanish geologist Manuel Fernández de Castro (1825–1895), who lived in Cuba for many years, turned this piece of evidence (as well as other fossils) into the main argument for his hypothesis on the continental origin of Cuban mammals and of Cuba itself. Fernández de Castro (1864) formulated his theory in 1864 and fully expounded it before the Fourth International Congress of Americanists (Madrid, 1881). Since then, the presence of fossil giant sloths (which have also been found in Hispaniola and Puerto Rico) has been important evidence in the hypothesis of an ancient land connection between the Greater Antilles and the South American continent. The alternative hypothesis is that sloths traveled to the Greater Antilles on land fragments (“rafts”) carried to sea by large rivers. In 1888, Luis Montané (1849–1936), a Havana physician, who had acquired some knowledge of anthropology while studying in France, found what he thought was a Cuban fossil man, although the European specialists to whom he showed these remains in 1906 were rather ambiguous in the assessment of their true age. Since he did not find a warm reception in Europe, Montané decided this was an “American problem” and took the bone to a scientific congress in Buenos Aires in 1910 (Montané, 1911). There the Argentinean paleontologist Florentino Ameghino (1854–1911) described the bone as belonging to a new fossil man, which he called Homo cubensis. In the same paper in which he described this new fossil man, Ameghino also referred to the presumed continental affinities of Cuba as follows: The remains of fossil mammals discovered in Cuba and on several of the small Antillean islands are a part of the fauna of xenarthrans and rodents typical to South America. Therefore, in a bygone geological epoch, the Antilles were a continuous land that formed a northern extension of South America (Ameghino, 1934).

0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

475

476

Biogeography of the West Indies: Patterns and Perspectives

Ameghino felt that a connection with South America was essential to explain the presence in Cuba of what he regarded as an offshoot in the tree of human evolution. According to Ameghino, the simian ancestors of humans had originated in South America or, to be more precise, in Argentina itself. As a result of these developments, Cuban historical geology was offered a paleontological scenario stressing connections with the continent as an alternative to the apparently more conservative and rarely sustained view that Cuba never had been united with the continent and that humans arrived on the island rather recently. Francisco Pelayo, who studied Fernández de Castro’s theory of continental affinities, has pointed out that similar views were held by some prominent Cuban and Spanish authors, such as the naturalists Felipe Poey (1799–1891) and Miguel Rodríguez Ferrer (1815–1889) (Pelayo, 1995). Actually, the idea that Cuba had been united at one time with South America was predominant among Cuban naturalists during the last decades of the 19th century and the first decades of the 20th century. Since the question of the antiquity of humans in the Americas was far from resolved, the idea that humankind had originated in South America — although controversial and perhaps unacceptable for most European paleontologists — remained a debatable matter, especially since Ameghino considered his fossil men from Argentina to be older than Neanderthal and even Java (Pithecanthropus) men. With the help of his brother Carlos, who did most of the fieldwork, Florentino Ameghino described innumerable fossils from several geological formations, discovered by Carlos in Patagonia. We now know these formations are geologically equivalent to the European Eocene to Oligocene, but Florentino thought they were millions of years older (Cretaceous). The Ameghinos considered the Pampean formation to correspond to the European Pliocene, whereas it is actually equivalent to the Pleistocene. Simpson (1980) analyzes why Ameghino was misled into assuming these geological formations to be much older than they actually are. A problem with Ameghino’s hypothesis of a New World origin of humans was that there were no known anthropoid apes in South America. This did not deter Ameghino, however, who proposed an elaborate path for human evolution that circumvented Old World anthropoid apes and derived the remote ancestors of humans from fossil South American monkeys of the family Homunculidae. According to Ameghino, who was a polygenist, Homo cubensis and the Argentinian primeval human Homo pampaeus originated independently from this common stock.

ENHANCING THE NEW WORLD IMAGE What cultural significance did these ideas have, if any, at the time? They obviously may have had a self-enhancing function, but they also may have had an impact on the image the Americas tried to project on the Old World. The discovery of giant sloths in the Americas was perhaps the first fact to be utilized against Buffon’s view that the natural environment of the American continent was clearly feeble and depressed in comparison with that of Europe (a view that was later espoused by other authors, including the philosopher Hegel). Buffon believed there were fewer species of quadrupeds in the American continent than in Europe, and that American animals were generally smaller or, at least, not as strong as their European counterparts. He also thought animals transported from Europe to the New World had degraded under the influence of a clearly inferior environment. Buffon submitted that these conditions had brought about the moral and material degradation of the European conquerors themselves. An obvious implication of such an assessment was that the New World would never be capable of an independent existence and would always need European protection and surveillance. One of the first Americans to oppose Buffon’s views was Thomas Jefferson in his Notes on Virginia (1785) (Gerbi, 1973). The original analysis of Buffon’s views and Jefferson’s response was offered by Antonello Gerbi (1960): La Disputa del Nuevo Mundo, Fondo de Cultura Económica, Mexico and Buenos Aires.

Historical Biogeography in Cuba: 19th-Century Interpretations and Misinterpretations

477

Jefferson was incensed by Buffon’s prejudice toward the New World. He considered the remains of a large animal, sent to him in 1796, as proof that the New World was capable of sustaining mammals even larger than their Old World counterparts. Jefferson thought the remains belonged to a still extant lion or some other felid. The remains were actually those of a giant sloth, which still retains the name Jefferson gave it, Megalonyx (“big claw”). Another still larger sloth, called Megatherium, had been found years before in what is now Argentina (López Piñero and Glick, 1993). Jefferson’s original arguments tried to enhance the image of the Americas by downplaying the differences between the Old and the New World: America was equally capable of sustaining large animals and would of course be capable of sustaining a large human population under conditions similar to those of Europe. Fernández de Castro may have been trying to extend the same arguments to Cuba, not only for the sake of putting an end to the “magnificent isolation” imposed upon the island by its colonial status (Pelayo, 1995), but also because Cuba was trying to attract new immigrants and it was important to prove that in this race for an increase in white population Cuba could be as competitive as other American countries. If this interpretation is true, then Fernández de Castro’s theory of continental affinities may have been used for an image-building process for Cuba. A certain biased historical interpretation of nature, therefore, may have become a part of a culture that not only was actively trying to escape from “isolation,” but also may have been linked with migration issues that are far from being politically or ideologically neutral. Fernández de Castro, who was a Spaniard by birth and sentiment and was elected to the Spanish parliament in the 1880s as a representative of the Cuban province of Santa Clara, favored migration to Cuba from Spain. Fernández de Castro was a founding member of the first Academy of Sciences Cuba, the Academy of Medical, Natural and Physical Sciences of Havana created in 1861. Some of his most important papers were published in the Academy’s Annals. The Academy also provided a haven for the development of anthropological and archaeological research and backed the creation of an Anthropological Society in 1877. Discussions within the Academy provided a mirror image of the much broader political and ideological debates that took place in Cuban society in the second half of the 19th century. The Academy took part in the ongoing process of building a national culture of which science was an essential element. Although the Academy’s role in this process focused primarily on the institutionalization of science within the existing political framework, it was not limited to the formation of what I have called elsewhere a “national science in a colonial context” (Pruna, 1994). Thanks to the fact that some distinguished physicians and naturalists were also writers of poetry and fiction, or popularizers of science, scientific theories and debates within the Academy, and within several scientific societies that were connected with the Academy, extended into the Cuban literary scene. Among the naturalists who played a prominent role through a series of articles and books was Felipe Poey, who was eulogized while still alive by the American educator and naturalist David Starr Jordan (1878). The incorporation of nature into the national image is one of the most remarkable contributions of scientific literature to the nation-building process. During this process, certain places, landscapes, plants, and animal species were translated into metaphorical images of the nation itself. This seems to be a rather elaborate procedure, which takes place, at least primarily, at the interface between popular and learned culture. The natural history essay is an expression of this tendency in learned culture. I do not believe this literary genre should be defined today as it was in 1924 as “an essay that is based upon, and has for its major interest the literary expression of scientifically accurate observations of the life history of the lower orders of nature, or of other natural objects” (Hicks, 1924). Actually, the natural history essay cannot be adequately understood outside the historical thought style of its authors, a style that is conditioned by philosophical currents and underlying ideological concerns. This is, at least, the contemporary stance on this matter, which seems to be more realistic than the purported direct relationship between scientific observation and literary expression. One of the best and most influential contemporary examples of this genre, Rachel Carson’s Silent Spring, which envisions living nature as a victim of the follies of humankind, is certainly

478

Biogeography of the West Indies: Patterns and Perspectives

one of the most crucial and soaring metaphors of the self-destructive forces of modern society. One must not forget, however, that the construction and diffusion of such complex metaphors, largely a prerogative of institutionalized and family education until the mid-19th century, has since become an increasingly important function of the mass media. The truly global perspective of many of the finest examples of natural history essays in modern literature is primarily a feature of the last decades of the 20th century, when society and the social metaphors of nature have tended to become more increasingly global. Nevertheless, at least until very recent times, such an apparently global subject as the origin of humans has been frequently tainted by national and racial prejudice. The problem of “the antiquity of man,” as it was frequently called a century ago, can hardly be fully understood without taking into consideration power and national prestige. Neanderthal, Heidelberg, Cro-Magnon, Java, and even the infamous Piltdown refer not only to fossil men, but are also site names with geopolitical implications — German, French, Dutch-Colonial, and British locations, respectively. Under the pressure of national interests, which had became part of the individual scientist’s consciousness, the search for fossil men, while essentially remaining a serious inquiry into the past, also became part of an international fad. Every paleontologist dreamed of finding Adam in his own backyard. There is an unmistakably jocular tone in the “scientific novel” (as it was called) Looking for the Link (En busca del eslabón), published by the Cuban writer Francisco Calcagno, a physician and a member of the Anthropological Society of Cuba. The plot of the novel is a worldwide search for the “missing link” by an expedition led by a Yankee captain, with a Cuban naturalist on board. The novel was published in 1888, the same year Montané found his “fossil man” in central Cuba (Calcagno, 1963). This is, of course, a coincidence, but one that reveals the underlying cultural concerns about the place of origin of modern humans.

SUMMARY Cultural concerns, be they of a national or a global character, seem to somehow escape from the constraints placed by science on the interpretation of “hard facts,” and this should only be expected, since cultural concerns cover a much broader spectrum than strictly scientific matters do. Questions such as the antiquity of man in the Americas are still reflected in the mass media as problems somehow related to national prestige, but most of their former national or regional overtones have disappeared, and have instead become an important part of a global picture of the coevolution of nature and human society on our planet, a picture that purports not only to adequately reflect reality, but also pretends to teach us a lesson on how to behave toward nature.

LITERATURE CITED Ameghino, F. 1934. Otra nueva especie extinguida del género Homo. Pp. 401–404 in Obras Completas y Correspondencia Científica, Vol. 18. (Taller de Impressiones Oficiales, La Plata. Published originally as a pamphlet in Buenos Aires in 1910.) Calcagno, F. 1963. En busca del eslabon. Editorial Letras Cubanas, Havana. (Originally published in Barcelona in 1888.) Fernández de Castro, M. (1864). De la existencia de grandes mamíferos fósiles en la Isla de Cuba. Anales de la Real Academia de Ciencias Médicas, Físicas y Naturales de la Habana, vol. 1, pp. 17–21, 54–60, 96–107. (Published as a pamphlet in 1865.) Hicks, P. M. 1924. The Development of the Natural History Essay in American Literature. University of Pennsylvania, Philadelphia, p. 6. Jordan, D. S. 1878. A sketch of Professor Poey. The Popular Science Monthly August:547–552. López Piñero, J. M. and T. F. Glick. 1993. El Megaterio de Bru y el Presidente Jefferson. Instituto de Estudios Documentales sobre al Ciencia (Universidad de Valencia-C.S.I.C.), Valencia.

Historical Biogeography in Cuba: 19th-Century Interpretations and Misinterpretations

479

Montané, L. 1911. El Congreso Científico Internacional de Buenos Aires. Imprenta Avisador Comercial, Havana, p. 16. Pelayo, F. 1995. La conexión terrestre entre Cuba y el continente americano: una alternativoa paleontológica a la deriva continental. Antilia (revista electrónica de Historia de la Biologia, publicada por la Facultad de Biología de la Universidad Complutense, Madrid), vol. 1, artículo No. 4. Pruna, P. M. 1994. National Science in a Colonial Context: The Royal Academy of Sciences of Havana, 1861–1898. Isis 85(3):412–426. Simpson, G.G. 1980. Splendid Isolation. Yale University Press, New Haven, Connecticut.

24

Native American Use of Animals in the Caribbean Elizabeth S. Wing

Abstract — Preserved animal remains excavated from archaeological sites can inform us about aspects of past economies, including which animals were used for food and for social functions. The data show a pattern of diverse exploitation augmented by introductions of mammals and birds, both domestic and tame. Decline of some resources that were used intensively by Ceramic Age people was followed by a shift in emphasis to other resources, probably requiring technological change. The resources that were overexploited during early occupation of a site were reef fishes and land crabs. As these declined, inshore and pelagic fishes, particularly tuna, and mollusks become more abundant in the deposits. Introduced animals are most abundant on islands close to the mainland and large islands, suggesting they were not free from island biogeographical limitations. European introductions changed the native flora and fauna forever.

INTRODUCTION Animal remains excavated from archaeological sites provide information about the nature of preColumbian and early historical exploitation of animal resources in the Caribbean. Those durable parts of most of the animals represented in archaeological deposits are food refuse. Animal use by people living in pre-industrial conditions was dictated by the animals that were available and the human motivation and technology to procure them. Species most frequently used were those that lived close to human habitations as well as the tame, captive, and domestic species that were maintained. Faunal assemblages from sites on islands throughout the Caribbean provide opportunities to examine the choices different people made in establishing themselves on islands and adapting to use of island resources. Human modification of the environment in the West Indies began early in prehistoric times and continues today. The history of the changes wrought by humans has now been documented for a number of islands. For example, a major portion of the native mammal species became extinct after the European expansion into the Caribbean. By 1965 approximately one fifth of the flowering plant species from islands such as Antigua and Barbuda were alien species deliberately or accidentally introduced (Harris, 1965:53; Morgan and Woods, 1986). Most of the arable land of these islands is under cultivation or urban development today. Land clearing began with the Amerindian cultivation of crops of which manioc is a well-known staple (Newsom, 1993). This chapter does not discuss the history of plant use in the Caribbean, but suffice it to say that land clearing, plant cultivation, and harvest modified the environment and affected terrestrial animal populations. Both the exploitation and introduction of plants and animals had profound effects on the native flora and fauna. The intent of most animal procurement is use as a source of food, although other uses of animals and animal products exist. In the Bahamas, where the native rock is relatively soft limestone, marine molluscan shell was used as a raw material for tools. The manufacture of tools from shell would not necessarily preclude consumption of the soft parts of the animal for food. Written accounts and archaeological remains document the development of a Spanish hide trade industry in Haiti based on cattle (Bos taurus) introduced in the early 16th century (Reitz, 1986). In addition to hides, tallow, glue, and gelatin were probably extracted from the beef carcasses and the meat jerked or dried for preservation (Reitz, 1986). The many roles and uses of domestic animals contributed to the pattern of life in the Caribbean and elsewhere. 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

481

482

Biogeography of the West Indies: Patterns and Perspectives

The sources of traditions of foodways and patterns of animal use by the people of the Caribbean were derived, as were the people themselves, from continental mainlands. These mainland traditions developed where land animals are abundant and species are diverse. These traditions were then modified as a result of experiences gained during life on the island chain. The continents from which people moved into the islands were initially from Middle America, then from northeastern South America, and finally from the Iberian Peninsula (Rouse, 1992). In this chapter, only the South American and Spanish adaptations to Caribbean Island life are discussed simply because too little archaeological evidence of animal use exists for the earliest Casimiroid people who migrated to the western Caribbean islands from Middle America.

MATERIAL AND METHODS The data upon which this chapter is based are a series of faunal samples excavated from archaeological sites in the Caribbean (Table 1, Figure 1). These samples are chosen to represent sites from different time periods as well as different regions of the Caribbean. Preference is given to those samples recovered using fine-gauge screen and which include both vertebrates and invertebrates for as complete a representation of taxa and range in sizes as possible. Vertebrate and invertebrate remains are often studied by different people using incompatible methods of quantification, thereby losing the integrity of the complete faunal assemblage. Another limitation is that faunal assemblages of adequate size from different activity areas and time periods are not always available. Regrettably, some very important islands such as Cuba are not included because I lack the samples and publications of comparable studies. Clearly more samples are necessary to document the full range of human adaptation to life throughout the Caribbean but this may serve as a starting point.

TABLE 1 Archaeological Sites upon Which This Chapter Is Based, Their Locations, Approximate Dates of Deposits, Archaeologists, and Reference to Faunal Study Site Name

Location

Dates BP

MC-6

Middle Caicos; south coast

725

Shaun Sullivan

MC-12

Middle Caicos; north coast

725

Shaun Sullivan

En Bas Saline Maisabel Lujan Tutu

458 1350 and 1850 1050 560 and 1380

Kelbey’s Ridge

Haiti; north coast Puerto Rico; north coast Vieques Island; south coast St. Thomas; east central (2 km inland) St. Martin; north central (2 km inland) Saba

Golden Rock Sulphur Ghaut (JO-2)

St. Eustatius Nevis; southwest coast

Indian Castle (GE-1)

Nevis; southeast coast

Hichman’s (GE-5)

Nevis; southeast coast

Hope Estate

Hichman’s Shell Heap (GE-6) Nevis; southeast coast Chancery Lane

Barbados; south coast

Excavator(s)

Kathleen Deagan Peter Siegel Virginia Rivera Elizabeth Righter

Ref. Wing and Scudder, 1983 Wing and Scudder, 1983 Wing, 2000 deFrance, 1990 Wing and Quitmyer Wing, de France, and Kozuch Wing, 1995

1415 and 1760 Jay Haviser and Christophe Henocq 600 and 1280 Menno Hoogland and Wing, 1996 Corine Hofman 1300 Aad Versteeg van der Klift, 1992 1050 Samuel Wilson Kozuch and Wing, in preparation 1280 Samuel Wilson Kozuch and Wing, in preparation 1660 Samuel Wilson Kozuch and Wing, in preparation 2550 Samuel Wilson Kozuch and Wing, in preparation 800 and 1500 Peter Drewett Wing, 1991

Native American Use of Animals in the Caribbean

483

FIGURE 1 Map of the West Indies showing the archaeological sites upon which this chapter is based.

Innate differences in samples may be the result of differences in prehistoric disposal patterns. Today in the Turks and Caicos islands conch meat is a commercial product, dried and sold in the northern Bahamas. Fishermen row out to the inshore grass beds, use glass-bottomed buckets to find conchs, scoop them up with long rakes, extract the meat on the spot, and toss the shells overboard. No evidence that would preserve in the archaeological record of this enterprise is brought back to the home site where the meat is sun-dried and eaten or sold. Likewise, the present-day scarcity of conch shell in the sites on Middle Caicos may not be a true reflection of the use of conch in the past. Another source of bias is the condition of preservation. Bone preservation is closely correlated with the acidity of the soil. The more acidic the soil, the greater the loss of bone. Consequently, bone is usually well preserved in coastal shell middens where the calcium carbonate of the shells raises the pH of the site matrix. Bone is sometimes less well preserved in inland sites where shell is absent. Biases also result from the methods of excavations and recovery. Early archaeological procedures directed toward establishing chronologies based on pottery styles employed a recovery strategy using coarse-gauge screen (6 mm or larger) to sieve deposits. Archaeologists have come to realize that much of the plant and animal remains are lost by this method. Improved recovery of biological remains is now achieved with the use of finer-gauge (1-mm) screens. Strides have also been made in zooarchaeological methods, including the awareness of the biases introduced by various factors of deposition and recovery. Standard zooarchaeological techniques are used in the presentation and quantification of the data from the faunal samples discussed in this chapter (Reitz and Wing, 1999). Identifications are made by comparison with modern reference specimens in the collections of the Florida Museum of Natural History. Several methods of quantification are used and each method provides different information. The calculated minimum numbers of individuals (MNI) attempts to present a count

484

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 Allometric Constants Used to Estimate Body Weight or Standard Lengths Measurement (1) X = skeletal weight of mammals in kg Y = total weight in kg (2) X = skeletal weight of turtle in kg Y = total weight in kg (3) X = shell weight of marine bivalves Y = soft tissue weight (4) X = shell weight of marine snails Y = total weight (5) X = width of femur head in mammals Y = total weight (6) X = total length of coracoid in Columbidae Y = total weight (7) X = anterior width of anterior vertebrae of lizards Y = total weight (8) X = anterior width of anterior vertebrae of snakes Y = total weight (9) X = width of teleost atlas Y = total weight (10) X = aperture height of marine snails Y = total weight (11) X = merus height of land crabs Y = total weight

N

Slope b

Y Intercept a

R2

Ref.

97

0.9000

1.12000

0.94

Reitz and Wing, 1999

26

0.6800

0.51000

0.55

Reitz and Wing, 1999

80

0.6800

0.01800

0.83

Reitz and Wing, 1999

59

1.0100

0.16400

0.99

Reitz and Wing, 1999

59

2.7800

0.69600

0.97

Reitz and Wing, 1999

13

2.5035

1.43130

0.93

This chapter

18

2.7566

0.88409

0.97

This chapter

18

2.6463

1.32410

0.94

This chapter

43

2.5300

0.87200

0.87

This chapter

59

1.9300

–1.64000

0.96

Reitz and Wing, 1999

25

1.8420

0.50800

0.90

deFrance, 1990

Note: These constants use the formula log Y = log a + b(log X) where X is the measurement or weight of the skeletal, shell, or exoskeletal element and Y is the estimated body weight or length derived from using the appropriate allometric constants. Lengths are in mm, weight is in g unless indicated otherwise.

of the numbers of individuals that can be accounted for by the identified remains. This is usually presented in relative terms by percentage. In addition, weights and measurements are taken of these remains. Standard measurements are taken in millimeters (mm) for skeletal or shell dimensions or grams (g) for the weight of the identified remains. Measurements include the width of the head of the femur in mammals; the length of the coracoid in pigeons (Columbidae); width of the centrum of snake, lizard, and fish vertebrae; the height of the aperture of gastropods; the height of the merus of land crabs; and the weights of the remains of each class. These measurements are taken to estimate the live body weight of the represented animals by applying appropriate allometric formulas. These formulas are constructed using known body weight and skeletal or shell dimensional data associated with modern comparative specimens of the species encountered in the archaeological sites (Table 2). The estimates of MNI and body weight can provide an indication of the relative contributions of the represented taxa to prehistoric economies. Caribbean sites have faunal assemblages that are rich in numbers of taxa and the majority animals from coastal sites are aquatic (Tables 3A and B). An organizing procedure that takes into account the size of the represented species, their abundance in the sample, and their position in the food web is an analysis of the mean trophic level of a catch (Pauly et al., 1998). Pauly and his colleagues analyzed the annual fishery catches over the past 40 years, from 1950 to 1990, in terms of the mean trophic levels of the species that make up these catches. Unfortunately, annual deposits of archaeological remains cannot be distinguished. Instead, deposits are usually viewed as averages for several years, allowing only comparisons between early and late deposits of a site or group of

Native American Use of Animals in the Caribbean

485

TABLE 3A Summary of Faunal Data Based on Minimum Numbers of Individuals (MNI) from the West Indies Vertebrate

Invertebrate

Land

Site Name

Provenience

MC-6 MC-12 En Bas Saline Maisabel

Total Total Fea 4, lv 9, FS 3881 N32E32, lv 20-40 N96W13, lv 0-160 Lujan Midden A and B Tutu N2036E1842, lv B N2044E1837, lv I Hope Estate A 3 and 5, lv 3 and 4 Unit 16, zone 18 Kelbey’s Rdg. II Period 3 Kelbey’s Rdg. I Period 1 Golden Rock Total Sulphur Ghaut JO-2, 9N, lv 20-40 Indian Castle GE-1, 95-2, lv 20-40 Hichman’s GE-5 55,-15, lv 20-40, 50-60 Hichman’s SH GE-6, total Chancery Lane Trench 2/1,2 and 3/3,4 Trench 2/5

Aquatic Subtotal Land Aquatic Subtotal Dates BPa MNI % MNI % MNI MNI % MNI % MNI 725 17 12 725 5 4 458 10 13 1,350 11 15 1,850 18 23 1,050 39 20 560 17 11 1,380 9 7 1,415 48 54 1,760 33 47 600 63 30 1,280 30 15 1,300 103 20 1,050 16 9 1,280 21 17 1,660 33 52 2,550 9 6 800 6 9 1,500 0 0

122 88 121 96 65 87 62 85 62 77 160 80 134 89 113 93 41 46 37 53 148 70 172 85 422 80 158 91 105 83 31 48 145 94 58 91 15 100

139 126 75 73 80 199 151 122 89 70 211 202 525 174 126 64 151 64 15

10 51 17 0 6 na 44 88 46 149 8 1,090 na 183 32 112 0 16 1

1 0 9 16 62 60 42 3 39 5 10 56

na na 1,383 99 29 100 63 91 na 238 84 55 38 31 40 202 58 242 97 1,735 61 na 3351 95 300 90 87 44 614 100 na na

na na 1,400 29 69 na 282 143 77 351 250 2,825 na 3,534 332 199 614 na na

Sample Total MNI na na 1,475 102 149 na 433 265 166 421 461 3,027 na 3,708 458 263 765 na na

TABLE 3B Summary of the Faunal Data Based on Estimates of Biomass from the West Indies Vertebrate Site Name MC-6 MC-12 En Bas Saline Maisabel Lujan Tutu Hope Estate Kelbey’s Rdg. II Kelbey’s Rdg. I Golden Rock Sulphur Ghaut Indian Castle Hichman’s GE-5 Hichman’s SH Chancery Lane

Dates BPa

Land

%

Reef

%

Inshore, Pelagic

%

Total

Invertebrate Total

Total

725 725 458 1,350 1,850 1,050 560 1,380 1,415 1,760 600 1,280 1,300 1,050 1,280 1,660 2,550 800 1,500

10,283 13,323 6967 2,890 5,883 56,830 18,796 2,830 18,861 8,932 12,429 15,640 22,757 9,438 4,845 10,715 2,945 22,930 0

10 9 24 24 30 34 48 4 43 26 13 10 12 17 13 24 3 45 0

30,385 113,850 14,313 1,296 8,333 88,225 6,274 65,831 15,939 17,502 58,985 129,592 72,944 30,535 24,956 24,230 56,709 13,718 2,982

31 80 49 11 43 14 16 82 37 52 64 83 39 56 65 54 67 27 59

57,438 14,621 7,892 7,953 5,297 23,749 14,049 11,645 8,590 7,449 21,372 10,627 91,160 14,778 8,662 10,301 25,364 14,189 2,106

59 10 27 66 27 14 36 15 20 22 23 7 49 27 23 23 30 28 41

98,147 141,794 29,172 12,139 19,513 168,804 39,119 80,306 43,390 33,883 92,786 155,859 186,861 54,751 38,463 45,246 85,018 50,837 5,088

na na 23,798 237 3,951 na 7,589 23,571 na 28,694 na na na 7,782 3,797 4,458 51,578 na na

na na 52,970 12,376 23,464 na 46,708 103,877 na 62,577 na na na 62,533 42,260 49,704 136,596 na na

Note: na indicates that data are not available. a

Dates BP are approximate.

486

Biogeography of the West Indies: Patterns and Perspectives

sites. In archaeological deposits, such comparisons are based on the estimated sizes of the animals in the sample and the species composition of the surviving remains. The mean trophic level of the catch can then be estimated in a three-step process (Wing, 2001): 1. The first step is to estimate the average live weight of the individuals represented by their skeletal or shell remains in each taxon within each sample. I use appropriate allometric formulas to estimate these average body weights based on the independent variable, which is either average weights or measurements of the skeletons or shells of each taxon in each sample (Table 2). For example, average measurements of the width of the vertebral centrum for each identified fish species at each site can be used to estimate their average weights (Tables 4 through 22). When no measurement is available for a particular species, I used the average vertebral measurement for unidentified fishes in that sample on the assumption that the unidentified vertebrae come from a cross section of the identified species. The height of the aperture of marine snails is used in the same way to estimate their body weight. The estimated average body weight of other mollusks is based on the average individual shell weight, which we determine by dividing the total shell weight for each species by its minimum numbers of individuals. This probably slightly underestimates the contribution of mollusks because some are identified from broken shell. For animals with determinate growth such as mammals and birds I used published or laboratory records of the weight of each species. 2. The second step is to estimate the biomass of the catch for each species, which I did by multiplying the average estimated weight of the individuals in each species by the minimum numbers of individuals of that species. This procedure is followed for all animals except for sea turtles (Cheloniidae), manatee (Trichechus manatus), monk seals (Monachus tropicalis), and pig (Sus scrofa). Only very small fragments of these large animals were recovered and identified from these sites. Instead of attempting to estimate their whole body weight, I estimated the size of an animal that would be supported by the recovered skeletal remains. The reason for this departure is the probability that the carcasses of these large animals were shared throughout the community whereas the small fishes and mollusks were eaten entirely by the people who produced the deposit. If, as I believe, the large animals were shared by the people of the whole community, then an estimate of the whole weight of these animals would overemphasize their contribution to the catch of only one segment of the community. Therefore, to make an accurate estimate of the catch for the whole community, it would be necessary to know the estimated weight of the small animals consumed entirely by the other households that shared the large animals. 3. The third step is to multiply the biomass of each species by the mean trophic level index (http://www.fishbase.org/trophic.t.htm). These indices derived from feeding behaviors are in the range from 1 to 5, with 1 a producer (a plant) and 5 a top predator. Each step in these estimates is presented for each site (Tables 4 through 22). These tables include the average measurement used in the allometric formula to estimate biomass. The allometric constants used are indicated by a number in parentheses, which corresponds to their listing on Table 2. These tables also include the minimum numbers of individuals of each species and the trophic level as published on the Internet (www.fishbase.org). No trophic level figures are presented for terrestrial animals. In order to evaluate the terrestrial component of the faunal assemblages in a comparable fashion, I estimated the trophic level based on feeding behaviors in the literature for each species and gave each of them a score in the same framework as was developed for aquatic organisms (Steadman et al., 1980; 1997). Rodents and pigeons both feed on plants and have a low score of 2.1 comparable to herbivorous fish such as mullet (Mugil spp.).

Native American Use of Animals in the Caribbean

487

TABLE 4 Data for Calculation of Mean Trophic Levels of Vertebrates for MC-6, 450 to 1000 BP Taxon Terrestrial Geocapromys (5a ) Ardeidaeb Pandion b Anolis b Cyclura (7)

Measurement

8.10

4.90

Biomass

MNI

Biomass × MNI

TL

TLijYij

1,666 877 1,000 8 612

1 1 1 1 11

1,666 877 1,000 8 6,732

2.1 3.5 4.0 3.5 2.1

3,499 3,070 4,000 28 14,137

Total terrestrial Reef Epinephelus (9) Lutjanus (9) Haemulon (9) Halichoeres (9c) Scarus (9) Sparisoma (9) Acanthurus (9) Balistes (9c) Lactophrys (9c) Diodon (9c)

10,283

6.75 6.50 3.90 5.10 5.60 6.10 5.40 5.10 5.10 5.10

934 849 233 459 582 723 531 459 459 459

5 12 10 1 9 7 2 1 1 1

Total reef Inshore, pelagic Cheloniidae (2) Ginglymostoma (9c) Carcharhinus (9c) Albula (9) Gymnothorax (9c) Belonidae (9) Centropomus (9c) Caranx (9) Selene (9c) Eucinostomus (9) Gerreidae (9) Calamus (9c) Sciaenidae (9c) Sphyraena (9) Sphoeroides (9c)

4,670 10,188 2,330 459 5,238 5,061 1,062 459 459 459

24,734

3.8 4.6 3.5 3.6 3.5 3.5 3.5 3.0 3.2 3.2

30,385

151.40 5.10 5.10 7.50 5.10 3.60 5.10 6.90 5.10 2.30 3.50 5.10 5.10 6.50 5.10

896 459 459 1,219 459 190 459 987 459 61 177 459 459 849 459

[4] 1 1 37 1 3 1 3 1 10 4 2 1 3 1

896 459 459 45,103 459 570 459 2,961 459 610 620 918 459 2,547 459

17,746 46,865 8,155 1,652 18,333 17,714 3,717 1,377 1,469 1,469 118,497

2.1 3.6 4.0 3.0 3.5 3.2 3.5 3.3 3.3 3.3 3.3 3.4 3.3 4.5 3.5

1,882 1,652 1,836 135,309 1,607 1,824 1,607 9,771 1,515 2,013 2,046 3,121 1,515 11,462 1,607

Total inshore and pelagic

57,438

178,767

Total vertebrates

98,106

321,998

a b c

Data from Bellevue site. Data from the literature. Mean vertebral width of unidentified fishes.

488

Biogeography of the West Indies: Patterns and Perspectives

TABLE 5 Data for the Calculation of Mean Trophic Levels of Vertebrates for MC-12, 450 to 1000 BP Taxon Terrestrial Canis (5a) Laridaeb Cyclura (7) Iguanidae (7)

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

16.00

11,052 435 612 612

1 1 2 1

11,052 435 1,224 612

3.0 3.0 2.1 2.1

33,156 1,305 2,570 1,285

4.90 4.90

Total terrestrial Reef Serranidae (9) Lutjanidae (9) Haemulon (9) Halichoeres (9 c) Scarus (9) Sparisoma (9) Acanthurus (9) Balistes (9c) Lactophrys (9c) Diodon (9c)

13,323

11.09 9.40 9.08 6.69 7.18 6.23 4.96 6.69 6.69 6.69

3,279 2,158 1,977 913 1,091 762 428 913 913 913

6 3 7 6 10 60 4 4 1 6

Total reef Inshore, pelagic Cheloniidae (2) Dasyatis (9c) Albula (9) Carangidae (9) Sphyraena (9c)

16.75 6.69 7.25 6.03 6.69

201 913 1,119 702 913

[1] 1 10 2 1

Total vertebrates

b c

3.8 4.6 3.5 3.6 3.5 3.5 3.5 3.0 3.2 3.2

113,850

Total inshore and pelagic

a

19,674 6,474 13,839 5,478 10,910 45,720 1,712 3,652 913 5,478

38,316

201 913 11,190 1,404 913

74,761 29,780 48,437 19,721 38,185 160,020 5,992 10,956 2,922 17,530 408,304

2.1 3.5 3.0 3.3 4.5

422 3,196 33,570 4,633 4,109

14,621

45,930

141,794

492,550

Data from the Silver Sands site. Data from the literature. Mean vertebral width of unidentified fishes.

Boobies (Sulidae) and shearwaters (Puffinus lherminieri), which feed on herrings (Clupeidae), anchovies (Engraulidae), flying fishes (Exocoetidae), and squid (Cephalopoda), are given a score of 3.5 comparable to grunts and groupers. At the top of the food chain among the terrestrial species is the osprey (Pandion haliaetus) with a score of 4 comparable to snappers. Estimates derived as described approximate as closely as possible present-day fish landings that are used to evaluate the mean trophic levels of our modern fisheries (Pauly et al., 1998). Incorporating trophic level estimates for the terrestrial species permits evaluation of that component of the fauna for a more complete understanding of the animal portion of past economies. The formula for calculating mean trophic level (TL) is as follows: TL i = Σ ijTLijYij /ΣYij

Native American Use of Animals in the Caribbean

489

TABLE 6 Data for Calculation of Mean Trophic Levels for En Bas Saline, 500 BP Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

2.1 2.1 2.1 2.5 3.0 2.1

630 7,741 527 65 1,500 4,628

Vertebrates Terrestrial Brotomys a Isolobodon (5b) Rattus a Sus (1) Trachemys a Cyclura (7b)

8.40 1.00 7.80

300 1,843 251 26 500 2,204

1 2 1 1 1 1

Total terrestrial Reef Holocentrus (9) Serranidae (9) Lutjanidae (9) Haemulon (9) Pomacanthus (9c) Halichoeres (9c) Scaridae (9) Acanthurus (9c) Balistes (9) Lactophrys (9c) Diodon (9c)

6,967 4.90 4.30 4.60 5.20 3.50 3.50 5.00 3.50 9.20 3.50 3.50

415 298 354 483 177 177 437 177 2,044 177 177

2 10 8 4 3 1 4 5 1 1 1

Total reef Inshore, pelagic Cheloniidae (2) Carcharhinus (9c) Gymnothorax (9c) Clupeidae (9) Belonidae (9c) Hemiramphidae (9) Centropomus (9) Caranx (9) Calamus (9c) Chaetodipterus (9c) Mugil (9) Sphyraena (9)

300 3,686 251 26 500 2,204

830 2,980 2,832 1,932 531 177 1,748 885 2,044 177 177

15,091 3.5 3.8 4.6 3.5 3.0 3.6 3.5 3.5 3.0 3.2 3.2

14,313 2.15 3.50 3.50 2.10 3.50 2.00 7.50 3.70 3.50 3.50 4.70 8.20

50 177 177 49 177 43 1,219 204 177 177 374 1,527

[1] 1 1 1 1 10 2 3 1 1 1 2

Total inshore, pelagic Total vertebrates

50 177 177 49 177 430 2,438 612 177 177 374 3,054

2,905 11,324 13,027 6,762 1,593 637 6,118 3,098 6,132 566 566 52,728

2.1 4.0 3.5 2.6 3.2 3.1 3.5 3.3 3.4 3.3 2.0 4.5

105 708 620 127 566 1,333 8,533 2,020 602 584 748 13,743

7,892

29,689

29,172

97,508

Invertebrates Terrestrial Gecarcinidae (11d ) Marine Strombus (4) Small snails (4) Miscellaneous clams (3)

8.50

166

17

2,822

3.0

8,466

94.60 0.30 5.70

144 0.4 16.3

38 373 942

5,472 149 15,355

2.1 2.1 2.1

11,491 313 32,245

Total invertebrates

23,798

52,515

Total

52,970

150,023

a b

Data from the literature. Data from Lujan site estimate.

c d

Mean vertebral width of unidentified fishes. Data from late occupation at Tutu estimate.

490

Biogeography of the West Indies: Patterns and Perspectives

where TLi is the mean trophic level for year i and Yi is the landings by the trophic levels of the individual species groups j. A summary of the mean trophic levels of reef fishes, inshore and pelagic vertebrates, terrestrial vertebrates, total aquatic vertebrates for 19 deposits and total aquatic faunas for ten samples is presented in Table 23. The categories of fishes associated with coral reefs follow Sale (1991). Exceptions to this is placement of very small grunts (Haemulidae), those estimated to be smaller than 150 mm standard length, in the nursery grounds in inshore waters rather than the reef (Sedberry and Carter, 1993). The percentage of the estimated biomass of each of these faunal components is also presented in order to provide a guide to their importance in the deposits (Table 3B).

RESULTS Some of the prominent features of the faunal data presented here and information from the literature are most easily discussed in two segments: one describes the terrestrial component and the other the aquatic component of the samples. Aquatic vertebrates make up more than 50% of the vertebrate faunal assemblages based on estimated biomass and more than 46% based on MNI. The differences between these two sets of values result from differences between the estimated sizes and numbers of species in the faunas. Reef fishes are a very abundant aquatic component and are discussed separately from marine vertebrates living in inshore and pelagic waters and the total aquatic fauna that includes mollusks. Among terrestrial animals an important distinction can be made between native species such as the land crabs (Gecarcinidae) and the rice rats (Oryzomyini) in the Lesser Antilles and introduced tame and domestic ones such as agouti (Dasyprocta leporina) and domestic dogs (Canis familiaris). These components of the faunas are, of course, interrelated and form an integrated part of the West Indian economies from the perspective of animal uses.

TERRESTRIAL COMPONENT OF WEST INDIAN FAUNAL SAMPLES NATIVE TERRESTRIAL SPECIES Native species that are repeatedly found or abundantly represented in West Indian faunal samples are rice rats and capromyid rodents, a number of pigeons, flightless birds, seabirds, or shorebirds that nest in rookeries, nesting sea turtles, iguanid lizards, and land crabs. Other rodents, insectivores, smaller birds, and reptiles occur in sites but are neither abundant in any one site nor frequently encountered in sites studied thus far (Morgan and Woods, 1986; Pregill, Steadman and Watters, 1994). Rice rats and capromyid rodents were widely and intensively exploited. Rice rats are represented in all Lesser Antillean sites studied and in some sites on Jamaica (White Marl, Rio Nuevo, Bellevue). The Lesser Antillean rice rats include described and undescribed species of at least two genera. The capromyids that were important in prehistoric economies are Capromys in Cuba; Geocapromys in Jamaica and some Bahaman sites; and Isolobodon in Hispaniola, Puerto Rico, Vieques Island, and the Virgin Islands. These moderately large rodents are most abundant in sites located inland. For example, G. brownii remains constitute a major portion, 89% of the MNI, of the vertebrate fauna at the Bellevue site located on the inland side of the city of Kingston, Jamaica, over 6 km from the shore. Birds that predominate in archaeological sites in the West Indies are all moderately large and tend to live or nest on or near the ground. Species most frequently encountered are shearwaters (Puffinus spp.), boobies (Sula spp.), purple and common gallinules (Porphyrula martinica and Gallinula chloropus), and pigeons. Many other species have been identified especially through research by Steadman (Pregill et al., 1994) and Olson (1978).

Native American Use of Animals in the Caribbean

491

TABLE 7 Data for Calculation of Mean Trophic Levels for Maisabel (N32E32 20-40), 1350 BP Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

1,843 300 153 11 10 573

2.1 2.1 2.1 2.1 3.5 3.5

3,870 630 321 23 35 2,006

Vertebrates Terrestrial Isolobodon (5a) Echimyidae b Zenaida b Emberizidae b Anguilidae (7c) Indeterminate snake (8a)

8.4

1,843 300 153 11 10 191

1.1 2.3

1 1 1 1 1 3

Total terrestrial Reef Holocentrus (9) Epinephelus (9) Lutjanus (9d ) Haemulon (9) Labridae (9) Scaridae (9) Acanthurus (9) Balistidae (9d ) Lactophrys (9d )

2,890 3.0 3.1 1.9 3.0 1.5 1.5 3.0 1.9 1.9

120 130 38 120 21 21 120 38 38

1 2 2 2 4 2 3 2 1

Total reef Inshore, pelagic Lamniforme (9) Muraenidae (9) Harengula (9) Exocoetidae (9) Strongylura (9) Tylosaurus (9) Caranx (9) Mugil (9d ) Gobiomorus (9) Gobiidae (9) Scombridae (9)

120 260 76 240 84 42 360 76 38

6,885 3.5 3.8 4.6 3.5 3.6 3.5 3.5 3.0 3.2

1,296 5.8 1.9 1.9 2.0 2.8 5.4 4.8 1.9 1.9 1.3 7.9

636 38 38 43 101 531 394 38 38 15 1,390

1 1 10 2 2 2 2 1 11 9 3

Total inshore and pelagic Total vertebrates

636 38 380 86 202 1,062 788 38 418 135 4,170

420 988 350 840 302 142 1,260 228 122 4,652

4.0 3.5 2.6 3.1 3.2 3.2 3.3 2.0 2.1 3.2 3.8

2,544 133 988 267 646 3,398 2,600 76 878 432 15,846

7,953

27,808

12,139

39,345

Invertebrates Marine Bivalves (3) Cittarium (4) Marine snails (4)

5.9 8.6 8.1

Total invertebrates Total a b c d

Data from the Lujan site. Data from the literature. Data from the Hope Estate site. Mean vertebral width of unidentified fishes.

9.4 12.8 9.3

4 1 20

38 13 186

2.1 2.1 2.1

79 27 391

237

497

12,376

39,842

492

Biogeography of the West Indies: Patterns and Perspectives

TABLE 8 Data for Calculation of Mean Trophic Levels for Maisabel (N96W13 0-160), 1850 BP Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

1,843 318 197 11 500 8 2,204 10 792

2.1 2.1 2.1 2.1 3.0 3.5 2.1 3.5 3.5

3,870 668 414 23 1,500 28 4,628 35 2,772

Vertebrates Terrestrial Isolobodon (5a ) Columba b Columbidae (6c ) Emberizidaeb Trachemys b Anolis b Iguanidae (7a ) Anguidae (7c) Indeterminate snake (8c )

8.4 30.8

7.8 1.1 2.6

1,843 318 197 11 500 8 2,204 10 264

1 1 1 1 1 1 1 1 3

Total terrestrial Reef Holocentrus (9d ) Epinephelus (9) Lutjanidae (9) Haemulidae (9) Labridae (9d ) Scaridae (9d ) Acanthurus (9d ) Balistidae (9) Ostraciidae (9d ) Diodon (9d )

5,883

2.2 3.6 4.9 4.2 2.2 2.2 2.2 6.8 2.2 2.2

55 190 415 281 55 55 55 951 55 55

1 4 6 5 6 3 2 3 1 2

Total reef Inshore, pelagic Harengula (9) Clupeidae (9) Hemiramphidae (9) Strongylura (9) Belonidae (9d ) Centropomus (9) Caranx (9) Trachinotus (9d ) Gerreidae (9) Sciaenidae (9d ) Mugil (9) Gobiomorus (9) Scombridae (9e )

55 760 2,490 1,405 330 165 110 2,853 55 110

13,938

3.5 3.8 4.6 3.5 3.6 3.5 3.5 3.0 3.2 3.2

8,333

2.3 1.6 1.7 1.5 2.2 4.4 2.5 2.2 2.3 2.2 3.4 1.9 7.4

61 25 29 21 55 316 76 55 61 55 165 38 1,178

2 2 1 1 2 5 4 1 1 3 2 3 2

Total inshore and pelagic Total vertebrates

122 50 29 21 110 1,580 304 55 61 165 330 114 2,356

193 2,888 11,454 4,918 1,188 578 385 8,559 176 352 30,691

2.6 2.6 3.1 3.2 3.2 3.5 3.3 3.3 3.3 3.3 2.0 2.1 3.8

317 130 90 67 352 5,530 182 182 201 545 660 239 8,953

5,297

17,448

19,513

62,077

Invertebrates Terrestrial Gecarcinidae (11)

11.0

267

6

1,602

3.0

4,806

Native American Use of Animals in the Caribbean

493

TABLE 8 (continued) Data for Calculation of Mean Trophic Levels for Maisabel (N96W13 0-160), 1850 BP Taxon Marine Bivalves (3) Cittarium (4) Strombus (4) Marine snails (4)

Measurement

Biomass

MNI

1.6 210.0 78.0 12.0

3 323 119 18

3 4 2 45

Total invertebrates Total a b c d e

Biomass × MNI

TL

TLijYij

9 1,292 238 810

2.1 2.1 2.1 2.1

19 2,713 500 1,701

3,951

9,739

23,464

71,816

Data from the Lujan site. Data from the literature. Data from the Hope Estate site. Mean vertebral width of unidentified fishes. Mean vertebral width of Scombridae from unit N98W13 60-70.

Land crabs are the terrestrial animals that have received much attention from archaeologists. Their remains are exceedingly abundant typically in the deposits associated with early Ceramic Age people. Their remains were so noticeable that Rainey (1940) in his archaeological survey of Puerto Rico described this earlier culture as the “crab culture” followed by the “shell culture.” This engendered much speculation about the causes for the shift.

INTRODUCED DOMESTIC

AND

CAPTIVE SPECIES

One fully domestic animal that accompanied humans around the world is the dog. Dog remains have been recorded from sites on Grenada, Barbados, St. Lucia, Monserrat, Antigua, St. Kitts, St. Eustatius, Saba, St. Martin, Virgin Islands, Vieques, Puerto Rico, Hispaniola, Cuba, Jamaica, Middle Caicos, and probably other islands. On close examination, dog remains are relatively more abundant in the Windward Island sites than the Leewards and more abundant in sites on large islands than on small ones. Many of the dog remains are associated with human burials. Examples of this association come from the Silver Sands site in Barbados and Sorcé on Vieques Island. Since many dogs are associated with burials, their remains are not frequently found in midden deposits and therefore their recorded abundance may be underrepresented. The guinea pig, Cavia porcellus, is the other fully domestic animal found in prehistoric West Indies. It has a spotty distribution, which includes Hispaniola, Puerto Rico, Vieques Island, Antigua, and Curaçao (Miller, 1929; Wing et al., 1968). They are all associated with relatively late prehistoric deposits and are usually not abundant. Other animals such as the agouti, opossum (Didelphis marsupialis), and armadillo (Dasypus novemcinctus) can be thought of as tame captive animals that were moved into the West Indies from the South American mainland. Of these, the armadillo has only been found in Grenada and the opossum is recorded from the southernmost islands, Grenada and St. Lucia. The agouti is much more widely distributed, reported from sites in Grenada, St. Lucia, Martinique, Marie Galante, Antigua, Nevis, St. Kitts, St. Eustatius, Saba, and St. Martin. Their distribution has characteristics that relate to their management. Agouti are absent from all Preceramic sites reported and they are absent from Barbados. The relative abundance of agouti declines north of St. Kitts, and has not been found thus far in the Virgin Islands. There is a reputed agouti from Vieques

494

Biogeography of the West Indies: Patterns and Perspectives

TABLE 9 Data for the Calculation of Mean Trophic Levels of Vertebrates for Lujan midden A and B, Late Occupation Taxon Terrestrial Nesophontes a Isolobodon (5) Cavia (5) Canis (5) Puffinus a Casmerodius a Pandion a Porphyrula a Fulica a Columbidae a Iguanidae (7) Indeterminate snake (8)

Measurement

8.4 4.4 16.1

7.8 2.3

Biomass

MNI

Biomass × MNI

TL

TLijYij

300 1,843 305 11,245 645 877 1,000 180 545 153 2,204 191

3 18 2 1 1 1 1 1 2 2 3 1

900 33,174 610 11,245 645 877 1,000 180 1,090 306 6,612 191

3.5 2.1 2.1 3.0 3.5 3.5 4.0 2.5 2.5 2.1 2.1 3.5

3,150 69,665 1,281 33,735 2,258 3,070 4,000 450 2,725 643 13,885 669

Total terrestrial Reef Epinephelus (9) Serranidae (9) Lutjanidae (9) Haemulon (9) Holocanthus (9) Pomacanthus (9) Halichoeres (9) Lachnolaimus (9) Scarus (9) Sparisoma (9) Acanthurus (9) Balistidae (9) Lactophrys (9) Diodon (9)

56,830

7.8 5.0 5.0 4.4 3.8 6.0 5.0 8.0 5.4 4.5 5.0 7.1 8.8 5.0

1,346 437 437 316 218 693 437 1,435 531 335 437 1,061 1,826 437

13 3 9 12 1 2 3 18 5 24 5 13 2 6

Total reef Inshore, pelagic Trichechus (1) Cheloniidae (2) Lamniformes (9) Rajiformes (9) Albula (9) Elops (9) Megalops (9) Muraenidae (9) Strongylura (9) Tylosaurus (9) Belonidae (9) Centropomus (9) Malacanthus (9) Carangidae (9)

17,498 1,311 3,933 3,792 218 1,386 1,311 25,830 2,655 8,040 2,184 13,793 3,652 2,622

135,531

3.8 3.5 4.6 3.5 3.0 3.0 3.6 3.6 3.4 3.5 3.5 3.0 3.2 3.2

88,225

0.5 2.0 6.5 6.2 8.4 6.2 6.9 4.0 3.9 4.4 4.4 7.5 5.4 4.7

14 47 849 753 1,623 753 987 248 233 316 316 1,219 531 374

1 [4] 2 3 1 4 2 2 1 2 2 2 1 3

14 47 1,698 2,259 1,623 3,012 1,974 496 233 632 632 2,438 531 1,122

66,492 4,589 18,092 13,272 654 4,158 4,720 92,988 9,027 28,140 7,648 41,379 11,686 8,390 311,235

2.1 2.1 4.0 3.5 3.0 3.0 3.0 3.5 3.2 3.2 3.2 3.5 3.5 3.3

29 99 6,792 7,907 4,869 9,036 5,922 1,736 746 2,022 2,022 8,533 1,859 3,703

Native American Use of Animals in the Caribbean

495

TABLE 9 (continued) Data for the Calculation of Mean Trophic Levels of Vertebrates for Lujan midden A and B, Late Occupation Taxon Gerreidae (9) Sparidae (9) Mugil (9) Sphyraena (9) Scombridae (9) Total inshore and pelagic Total vertebrates a

Measurement

Biomass

MNI

5.0 4.1 5.7 6.2 5.0

437 265 609 753 437

1 5 3 4 1

Biomass × MNI

TL

TLijYij

437 1,325 1,827 3,012 437

3.3 3.4 2.0 4.5 3.8

1,442 5,405 3,654 13,554 1,661

23,749

80,991

168,804

527,757

Data from the literature.

Island but this cannot be confirmed. The agouti still exists as an established wild species on some islands such as Dominica. Native West Indian animals were moved from one island to another by Amerindians, in addition to the introduced animals from the South American mainland. The large rodent, Isolobodon portoricensis, is believed to be native only to Hispaniola and introduced to Puerto Rico, Vieques Island, and the Virgin Islands (Miller, 1929; Morgan and Woods, 1986). Olson (1982a, 1982b) has reviewed the cases that can be made for the trade and transport of a number of West Indian birds and mammals. Evidence suggests that people transported the Cuban Capromys pilorides to Hispaniola and Geocapromys ingrahami to some of the Bahaman Islands. The flightless rail, Nesotrochis debooyi, may have been reared in captivity and transported to the Virgin Islands. The macaw, Ara autochthones, may have been traded to St. Croix.

EUROPEAN INTRODUCTIONS The earliest finds of European animals are pigs and rats (Rattus rattus) in the site of En Bas Saline, Haiti. These were followed by cattle that prospered in the early 16th-century town of Puerto Real (Reitz and Ruff, 1994). Other European animals that were introduced to the Caribbean in the historic period are Old World dogs, cats (Felis catus), sheep (Ovis aries), goats (Capra hirca), horses (Equus caballus), and chickens (Gallus gallus). These introductions to the New World were live animals. In addition, some animal products such as smoked, salted, and/or dried meat were also introduced. Cod fish remains associated with historic sites in Old San Juan, Puerto Rico (Kozuch, 1992) must have originated from northern fisheries.

AQUATIC MARINE COMPONENT OF WEST INDIAN FAUNAL SAMPLES Aquatic resources used by the prehistoric populations are species rich, constitute the numerically most important component of coastal faunas, and include species usually found in several different habitats. These marine faunas include primarily fishes and mollusks and secondarily marine crabs, lobsters, and sea urchins. Many animals move between habitats either as they mature or on a daily or yearly migration. However, the major habitats in which most animals are found are the rocky intertidal coral reefs, inshore seagrass meadows, and pelagic waters.

496

Biogeography of the West Indies: Patterns and Perspectives

TABLE 10 Data for the Calculation of Mean Trophic Levels for Tutu, Late Occupation Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

5 1 1 2 3

9,214 545 197 8,816 24

2.1 2.5 2.1 2.1 3.0

19,352 1,363 414 18,534 72

Vertebrates Terrestrial Isolobodon (5a) Fulica b Columbidae (6 c ) Iguanidae (7 c ) Small lizards b

8.40 30.80 7.80

1,843 545 197 2,204 8

Total terrestrial Reef Holocentrus (9) Epinephelus (9) Lutjanus (9) Haemulon bonariense (9) Microspathodon (9) Labridae (9) Scarus (9) Sparisoma (9) Acanthurus (9) Balistidae (9) Lactophrys (9) Diodon (9)

18,796

2.60 3.20 2.96 3.00 2.60 2.60 2.50 2.50 2.20 5.60 2.60 2.60

84 141 116 120 84 84 76 76 55 582 84 84

2 5 13 1 1 3 3 17 3 2 3 4

Total reef Inshore and pelagic Cheloniidae (2) Rajiformes (9) Elops (9) Gymnothorax (9) Clupeidae (9) Exocoetidae (9) Strongylura (9) Tylosaurus (9) Belonidae (9) Atherinidae (9) Diplectrum (9) Carangidae (9) Ocyurus (9) Eucinostomus (9) Anisotremus (9) Haemulon (9) Orthopristis (9) Haemulidae (9) Calamus (9) Sparidae (9) Mugil (9) Mulloidichthys (9)

168 705 1,508 120 84 252 228 1,292 165 1,164 252 336

39,735

3.5 3.8 4.6 3.5 2.1 3.6 3.4 3.5 3.5 3.0 3.2 3.2

6,274

13.50 5.60 2.70 2.30 1.60 1.80 1.80 3.40 2.60 2.00 1.80 5.40 4.50 1.50 2.30 2.10 1.40 1.40 1.70 2.10 2.80 2.10

173 582 92 61 25 33 33 165 84 43 33 531 335 21 61 49 18 18 29 49 101 49

[2] 4 2 2 5 2 2 2 2 1 1 8 1 1 1 18 1 1 8 1 3 1

173 2,328 184 122 125 66 66 330 168 43 33 4,248 335 21 61 882 18 18 232 49 303 49

588 2,679 6,937 420 176 907 775 4,522 158 3,492 806 1075 22,535

2.1 3.5 3.0 3.5 2.6 3.1 3.2 3.2 3.2 2.8 3.5 3.3 4.6 3.3 3.5 3.5 3.5 3.5 3.4 3.4 2.0 3.2

363 8,148 552 427 325 205 211 1,056 538 120 116 14,018 1,541 69 214 3,087 63 63 789 167 606 157

Native American Use of Animals in the Caribbean

497

TABLE 10 (continued) Data for the Calculation of Mean Trophic Levels for Tutu, Late Occupation Taxon Sphyraena (9) Gobiomorus (9) Euthynnus (9)

Measurement 2.70 3.30 8.40

Biomass

MNI

92 153 1,623

2 5 2

Total inshore and pelagic Total vertebrate

Biomass × MNI

TL

TLijYij

184 765 3,246

4.5 2.1 3.8

828 1607 12,335

14,049

47,605

39,119

109,875

Invertebrates Terrestrial Gecarcinidae (11)

8.50

166

32

5,312

3.0

15,936

Marine Codakia (3) Small bivalves (3) Cittarium (10) Small snails (4)

6.30 0.38 45.80 0.78

10 1 37 1

16 16 56 29

160 16 2,072 29

2.1 2.1 2.1 2.1

336 34 4,351 61

Total invertebrates Total aquatic a b c

7,589

20,718

46,708

130,593

Data from Lujan site. Total weight estimate from literature. Data from Hope Estate site.

CORAL REEF HABITATS Coral reef habitats are renowned for their diverse vertebrate and invertebrate faunas. Two kinds of reefs are typical of tropical seas: barrier reefs separating the ocean from inshore lagoons and patch reefs found in shallow waters. The families of fishes used by people and associated with this habitat are squirrelfishes (Holocentridae), groupers (Serranidae), snappers (Lutjanidae), grunts (Haemulidae), angelfishes (Pomacanthidae), damselfishes (Pomacentridae), wrasses (Labridae), parrotfishes (Scaridae), surgeonfishes (Acanthuridae), triggerfishes (Balistidae), boxfishes (Ostrachiidae), and puffers (Tetraodontidae) (Sale 1991:8–9). Some of these fishes inhabit the inshore waters as juveniles, including grunts that are under 150 mm standard length (Ogden and Ehrlich, 1977). Therefore, size must be taken into account when fishes are associated with a particular habitat. These fishes are abundant in West Indian faunal samples. Measures of the importance of reef fishes in the aquatic faunas are the numbers of reef taxa and the estimates of reef fish biomass among aquatic vertebrates. The estimated reef fish biomass is more that 50% of the estimated vertebrate biomass in 10 out of 19 faunal samples or 53% of those reviewed here. Estimated reef fish biomass is greater in the early deposits of all but one of the six pairs of deposits from early and later occupations at the same or nearby locations (Table 3b). By any measure reef fishes were a focus of the prehistoric fishing enterprise. In a survey of reef fishes from Lesser Antillean site two trends were noticed: a decline in size of territorial reef species and a shift from dominance of predators, high in the food web, to an increase in prey species, lower on the food web (Wing and Wing, 2001). This trend can also be demonstrated by the results of the trophic level analysis (Table 23; Figure 2). The reef fish faunas from five out of the six pairs of sites analyzed in this way show a decline in the mean trophic level

498

Biogeography of the West Indies: Patterns and Perspectives

TABLE 11 Data for the Calculation of Mean Trophic Levels for Tutu, Early Occupation Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

1,843 197 612 8 170

2.1 2.1 2.1 3.5 3.5

3,870 414 1,285 28 595

Vertebrates Terrestrial Isolobodon (5 a ) Columbidae (6 b ) Cyclura (7 c ) Anolis d Indeterminate snake (8 a )

8.40 30.80 4.90 2.20

1,843 197 612 8 170

1 1 1 1 1

Total terrestrial Reef Epinephelus (9) E. morio (9) Mycteroperca (9) Lutjanus (9) L. mahogoni (9) Haemulon (9) Labridae (9) Sparisoma (9) S. viride (9) Acanthurus (9) Balistes (9) Diodon (9)

2,830

11.90 13.10 4.90 6.80 6.20 4.50 7.00 4.80 5.30 3.00 8.30 4.00

3,919 4,997 415 951 753 335 1,024 394 506 120 1,575 248

8 1 2 4 1 14 8 4 8 1 3 3

Total reef Inshore and pelagic Cheloniidae (2) Clupeidae (9) Exocoetidae (9) Hemiramphus (9) Tylosaurus (9) Belonidae (9) Caranx (9) C. crysos (9) Ocyurus (9) Gerreidae (9) Calamus (9) Kyphosus (9) Sphyraena (9) Dormitator (9)

31,352 4,997 830 3,804 753 4,690 8,192 1,576 4,048 120 4,725 744

6,192

3.8 4.3 3.9 4.6 4.6 3.5 3.6 3.5 3.5 3.5 3.0 3.2

65,831

31.40 1.80 2.00 2.10 6.30 3.60 4.00 3.40 4.80 4.10 3.10 3.70 4.00 1.80

172 33 43 49 784 190 248 165 394 265 130 204 248 33

2 2 4 4 1 3 1 18 13 1 3 1 1 2

Total inshore and pelagic Total vertebrates

344 66 172 196 784 570 248 2,970 5,122 265 390 204 248 66

119,138 21,487 3,237 17,498 3,464 16,415 29,491 5,516 14,168 420 14,175 2381 247,390

2.1 2.6 3.1 3.1 3.2 3.2 4.0 3.3 4.6 3.3 3.4 2.1 4.5 2.1

722 86 533 608 2,509 1,824 992 9,801 23,561 875 1,326 428 1,116 139

11,645

44,520

80,306

298,102

Invertebrates Terrestrial Gecarcinidae (11)

10.80

258

85

21,930

3.0

65,790

Marine Small bivalves (3) Cittarium (10)

5.64 80.60

9 110

5 14

45 1,540

2.1 2.1

95 3,234

Native American Use of Animals in the Caribbean

499

TABLE 11 (continued) Data for the Calculation of Mean Trophic Levels for Tutu, Early Occupation Taxon Small snails (4)

Measurement 1.48

Biomass 2.17

Total invertebrates Total aquatic a b c d

MNI 26

Biomass × MNI

TL

TLijYij

56

2.1

118

23,571

69,237

103,877

367,339

Data from the Lujan site estimate. Data from Hope Estate site estimate. Data from MC-6 site estimate. Total weight estimate from literature.

in the later deposits. This decline occurs after a period of prior occupation with reef fish exploitation in all time periods and in a variety of island settings represented by these sites.

MARINE SPECIES LIVING

IN INSHORE,

ESTUARINE,

AND

PELAGIC WATERS

The shallow inshore waters harbor a great number of vertebrates and invertebrates that were used in the past as they still are today. The major fish families that are associated with these habitats are tarpons (Elopidae), bonefish (Albulidae), snooks (Centropomidae), some jacks (Carangidae), mojarras (Gerreidae), porgies (Sparidae), drums (Sciaenidae), and sleepers (Eleotridae). Some of these fishes may be migratory coming in close to shore at particular times of the year or during parts of their life cycles. Many sites in the Caribbean are located close to the shore and beside some freshwater source. When the fresh water forms a permanent or seasonal stream, estuarine conditions prevail. Rocky headlands that embrace coves with shallow water and seagrass meadows are suitable habitats for many of these inshore fishes. Rocky promontories washed by ocean waves provide suitable habitats for many intertidal mollusks such as West Indian top snails (Cittarium pica) and nerites (Neritidae) so common in West Indian middens. Fishes living in pelagic waters are those that live in the open ocean or surface of the sea. Some fishes such as herrings and needlefishes (Belonidae) are pelagic swimming in coastal waters and mangrove lagoons. Other pelagic fishes such as the tunas (Scombridae), particularly the most common species found in West Indian site, the little tunny (Euthynnus alletteratus), come close to shore particularly where the island shelf is narrow and where currents are swift near shoals. Inshore and pelagic fishes are generally not territorial but rather have populations that range over a wide area. They do not show a decline in size in the later deposits of paired samples (Wing and Wing, 2001). The relative abundance of this group of aquatic animals in faunal samples is influenced by the characteristics of the shoreline. The site, MC-6, located on the edge of the large shallow lagoon on the south side of Middle Caicos, has abundant remains of bonefish in the assemblage (Wing and Scudder, 1983). In addition to bonefish and other lagoonal species, small-sized sea turtles were probably caught while they were feeding on the shallow seagrass meadows. Bonefish and sea turtles are both low in the food web and dominate the mean trophic level for the inshore and pelagic component of the aquatic resources at this site. In the majority of other sites, the mean trophic level for the inshore and pelagic component is higher or only slightly lower in the later deposits of pairs of samples from the same site (Table 23, Figure 3). In most cases, tuna with a large estimated size and a high trophic level, 3.8, dominated

500

Biogeography of the West Indies: Patterns and Perspectives

TABLE 12 Data for the Calculation of Mean Trophic Levels of Vertebrates for Hope Estate, Late Occupation Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

3.1 16.0

115 11,052 2,338 197 104 10 264

25 1 1 10 3 5 1

2,875 11,052 2,338 1,970 312 50 264

2.1 3.0 3.4 2.1 3.5 3.5 3.5

6,038 33,156 7,949 4,137 1,092 175 924

Terrestrial Oryzomyini (5) Canis familiaris (5 a ) Phoenicopterus b Columbidae (6) Mimidae b Ameiva spp. (7) Alsophis (8)

30.8 1.1 2.6

Total terrestrial Reef Holocentrus (9 c ) Epinephelus (9) Lutjanus (9) Haemulon (9) Labridae (9) Scaridae (9) Balistidae (9 c )

18,861

4.4 6.2 4.2 5.4 6.9 5.4 4.4

316 753 281 531 987 531 316

1 4 1 6 4 8 3

Total reef Inshore and pelagic Cheloniidae (2) Belonidae (9) Caranx (9) Scombridae (9)

29.5 5.4 4.4 10.3

295 531 316 2,719

Total vertebrate

b c

3.5 3.5 4.6 3.5 3.6 3.5 3.0

15,939

Total inshore and pelagic

a

316 3,012 281 3,186 3,948 4,248 948

53,471

[4] 3 4 2

295 1,593 1,264 5,438

1,106 10,542 1,293 11,151 14,213 14,868 2,844 56,017

2.1 3.2 3.3 3.8

620 5,098 4,171 20,664

8,590

30,553

43,390

140,041

Data from Silver Sands site estimates. Data from the literature. Indicates estimates using size data for Carangidae.

this component of the fauna from the late deposits as, for example, at Maisabel on the north coast of Puerto Rico and Hope Estate on St. Martin. The late deposit from Nevis shows a slight decline in the mean trophic level of this component. The faunal remains from Tutu Archaeological Village on St. Thomas differ from these in showing a steep decline in the mean trophic levels for both the reef fish and the inshore and pelagic components (Figures 2 and 3). Comparisons can be made between the average mean trophic levels of deposits from sites that are new to a location and those that followed a period of occupation. The average mean trophic level of the reef fish component from sites in pristine locations is 3.66 (range 3.45 to 3.76) while the comparable value from deposits of sites that were previously occupied is 3.52 (range 3.44 to 3.59). The average mean trophic level for the inshore and pelagic component from sites in pristine locations is 3.46 (range 3.24 to 3.82) compared with 3.65 (range 3.39 to 3.92) for deposits from sites that were previously occupied.

Native American Use of Animals in the Caribbean

501

FIGURE 2 Mean trophic levels of reef fishes in early and late deposits of archaeological sites.

FIGURE 3 Mean trophic levels of inshore and pelagic fishes and other marine vertebrates in early and late deposits of archaeological sites.

502

Biogeography of the West Indies: Patterns and Perspectives

TABLE 13 Data for the Calculation of Mean Trophic Levels for Hope Estate, Early Occupation Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

2 1 2 18 6 1 1 1

274 2,338 870 3,546 624 884 10 386

2.1 3.4 3.0 2.1 3.5 2.1 3.5 3.5

575 7,949 2,610 7,447 2,184 1,856 35 1,351

Vertebrates Terrestrial Oryzomyini (5) Phoenicopterus a Larus a Columbidae (6) Mimidae a Iguana (7 b ) Ameiva (7) Alsophis (8)

3.30

137 2,338 435 197 104 884 10 386

30.80 5.60 1.10 3.00

Total terrestrial Reef Serranidae (9) Lutjanus (9) Anisotremus (9) Haemulidae (9) Halichoeres (9) Labridae (9) Scaridae (9) Balistidae (9) Diodon (9)

8,932

6.80 5.80 5.20 4.80 4.80 7.30 7.30 6.40 5.20

951 636 483 394 394 1,138 1,138 816 483

4 3 1 4 2 1 5 2 1

Total reef Inshore and pelagic Cheloniidae (2) Belonidae (9) Caranx (9) C. crysos (9) Sparidae (9) Polydactylus (9)

3,804 1,908 483 1,576 788 1,138 5,690 1,632 483

24,007

3.5 4.6 3.5 3.5 3.6 3.6 3.5 3.0 3.2

17,502

5.10 7.50 5.90 4.10 5.20 5.20

89 1,219 664 265 483 483

1 3 1 6 1 2

Total inshore and pelagic Total vertebrates

89 3,657 664 1,590 483 966

13,314 8,777 1,691 5,516 2,837 4,097 19,915 4,896 1,546 62,589

2.1 3.2 3.3 3.3 3.4 3.3

187 11,702 2,191 5,247 1,642 3,188

7,449

24,157

33,883

110,753

Invertebrates Terrestrial Gecarcinidae (11)

11.27

279

102

28,458

Marine Small bivalves (3) Cittarium (10) Small snails (4)

1.23 24.30 0.92

1 37 1

115 1 84

115 37 84

3

2.1 2.1 2.1

85,374

242 78 176

Total invertebrates

28,694

85,870

Total

62,577

196,623

a b

Data from the literature. Data from Kelbey’s Ridge site estimate.

Native American Use of Animals in the Caribbean

503

TABLE 14 Data for the Calculation of Mean Trophic Levels of Vertebrates for Kelbey’s Ridge, Late Occupation Taxon Terrestrial Brachyphylla a Oryzomyini (5) Puffinus a Sula b Columbidae (6 b ) Margarops a Iguana (7)

Measurement

3.5

30.8 3.3

Biomass

45 181 645 860 197 104 206

MNI

1 48 1 2 1 1 5

Total terrestrial Reef Holocentrus (9) Serranidae (9 c ) Lutjanidae (9 c ) Haemulidae (9) Labridae (9) Scaridae (9) Acanthurus (9) Balistidae (9) Ostraciidae (9) Diodon (9)

TL

TLijYij

45 8,688 645 1,720 197 104 1,030

2.5 2.1 3.5 3.5 2.1 3.5 2.1

113 18,245 2,258 6,020 414 364 2163

12,429

4.9 4.6 5.2 4.9 4.9 6.7 4.2 5.7 5.6 4.9

415 354 483 415 415 916 281 609 582 415

1 21 8 3 11 16 42 20 2 4

Total reef Inshore and pelagic Cheloniidae (2) Sharks (9) Muraenidae (9) Belonidae (9) Carangidae (9 c )

Biomass × MNI

415 7,434 3,864 1,245 4,565 14,656 11,802 12,180 1,164 1,660

29,577

3.5 3.8 4.6 3.5 3.6 3.5 3.5 3.0 3.2 3.2

58,985

6.9 8.9 4.9 5.2 4.0

110 1,879 415 483 248

[3] 10 3 1 3

110 18,790 1,245 483 744

1,453 28,249 17,774 4,358 16,434 51,296 41,307 36,540 3,725 5,312 206,448

2.1 4.0 3.5 3.2 3.3

231 75,160 4,358 1,546 2,455

Total inshore and pelagic

21,372

83,750

Total vertebrates

35,461

118,639

a b c

Data from the literature. Data from Hope Estate site estimate. Data from the nearby site of Spring Bay estimate.

TOTAL AQUATIC FAUNA The total aquatic fauna includes higher marine vertebrates such as sea turtles, manatees, and monk seal, as well as fishes and mollusks (Table 3). For those pairs of sites from which we have complete faunal samples mollusks are relatively more abundant and land crabs less abundant in the later deposits. Mollusks are on the whole filter feeders that live on detritus and plants placing them low on the food web. Their increased abundance in the later deposits of paired site reduces the mean trophic levels for those later samples.

504

Biogeography of the West Indies: Patterns and Perspectives

TABLE 15 Data for the Calculation of Mean Trophic Levels of Vertebrates for Kelbey’s Ridge, Early Occupation Taxon Terrestrial Brachyphylla a Oryzomyini (5) Procellariidae a Sula a Iguana (7)

Measurement

Biomass

3.5

5.6

MNI

45 181 645 860 884

1 10 1 5 10

Total terrestrial Reef Holocentrus (9) Serranidae (9) Lutjanidae (9) Haemulidae (9) Labridae (9 b ) Scaridae (9) Acanthurus (9) Balistidae (9) Diodon (9)

4.1 8.9 4.3 5.6 5.9 6.8 3.3 6.2 5.6

265 1,879 298 582 664 951 153 753 582

11.3 11.9 4.8 3.6 7.3

3,438 3,919 394 190 1,138

Total vertebrates

a

TLijYij

45 1,810 645 4,300 8,840

2.5 2.1 3.5 3.5 2.1

113 3,801 2,258 15,050 18,564

8 26 22 5 23 28 11 27 9

2,120 48,854 6,556 2,910 15,272 26,628 1,683 20,331 5,238

39,786

3.5 3.8 4.6 3.5 3.6 3.5 3.5 3.0 3.2

129,592

Total inshore and pelagic

a

TL

15,640

Total reef Inshore and pelagic Carcharhinus (9) Megalops (9) Belonidae (9) Carangidae (9) Kyphosus (9)

Biomass × MNI

1 1 3 5 1

3,438 3,919 1,182 950 1,138

7,420 185,645 30,158 10,185 54,979 93,198 5,891 60,993 16,762 465,231

4.0 3.0 3.2 3.3 2.1

13,752 11,757 3,782 3,135 2,390

10,627

34,816

155,859

539,833

Data from the literature. Data from nearby site of Spring Bay estimate.

CONCLUSIONS It is difficult to escape the conclusion that more detailed studies of faunal samples from Caribbean sites using the latest research techniques are needed to fully understand the relative importance of vertebrates and invertebrates in prehistoric and early historic economies. Equally important is a consideration of the uses of plants for a more complete understanding of the subsistence systems and the extent and history of human manipulation of island environments. Lee Newsom (1993) has made great strides toward documenting incipient agriculture in the West Indies and integrating those data with other economic indicators. However, a particularly large gap exists in the full study of faunas associated with complex sites in the Greater Antilles, particularly those on the interiors of those islands. The review presented here only begins to provide an understanding of some aspects of prehistoric economies.

Native American Use of Animals in the Caribbean

505

TABLE 16 Data for Calculation of Mean Trophic Levels of Vertebrates for Golden Rock, A.D. 500–800 Taxon Terrestrial Chiroptera a Oryzomyini (5) Dasyprocta (5 c ) Phaethontidae a Ardeidae a Columbidae (6 b ) Anolis a Iguana (7 a ) Ameiva (7 b ) Indeterminate Snake (8)

Measurement

3.6 9.5

30.8 5.6 1.1 2.0

Biomass

45 195 2,595 578 877 197 8 884 10 116

MNI

Biomass × MNI

TL

TLijYij

1 66 2 1 1 5 7 2 4 3

45 12,870 5,190 578 877 985 56 1,768 40 348

2.5 2.1 2.1 3.5 3.5 2.1 3.5 2.1 3.5 3.5

113 27,027 10,899 2,023 3,070 2,069 196 3,713 34 1,218

Total terrestrial Reef Holocentridae (9) Serranidae (9) Lutjanidae (9) Haemulidae (9) Labridae (9) Scaridae (9) Acanthurus (9) Balistidae (9) Diodon (9 a )

22,757

3.9 5.3 5.0 5.2 4.8 4.5 3.6 6.5 4.2

233 506 437 483 394 335 190 849 281

11 65 15 20 17 19 6 8 1

Total reef Inshore and pelagic Cheloniidae (2) Chondrichthys (9 a ) Hemiramphus (9) Belonidae (9) Trachurus (9) Caranx (9) Sparidae (9 a ) Sciaenidae (9 a ) Mullidae (9 a ) Kyphosidae (9) Scombridae (9)

118.2 4.2 2.1 4.3 3.3 3.4 4.2 4.2 4.2 3.1 11.7

758 281 49 298 153 165 281 281 281 130 3,754

[3] 2 10 4 187 34 2 1 1 2 14

Total vertebrates

a a a a

3.5 3.8 4.6 3.5 3.6 3.5 3.5 3.0 3.2

72,944

Total inshore and pelagic

a

2,563 32,890 6,555 9,660 6,698 6,365 1,140 6,792 281

50,362

Data from the literature. Data from Hope Estate site estimate. Data from modern specimen from Trinidad. Data from Kelbey’s Ridge site estimate. Mean vertebral width of unidentified fishes from Golden Rock.

758 562 487 1,192 28,611 5,610 562 281 281 260 52,556

8,971 124,982 30,153 33,810 24,113 22,278 3,990 20,376 899 269,572

2.1 4.0 3.1 3.2 3.3 3.3 3.4 3.3 3.2 2.1 3.8

1,592 2,248 1,510 3,814 94,416 18,513 1,911 927 899 546 199,713

91,160

326,089

186,861

646,023

506

Biogeography of the West Indies: Patterns and Perspectives

TABLE 17 Data for the Calculation of Mean Trophic Levels at Sulphur Ghaut Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

9 2 2 1

2,106 5,190 2,042 100

2.1 2.1 2.1 3.5

4,423 10,899 4,288 350

Vertebrates Terrestrial Oryzomyini (5) Dasyprocta (5 a ) Iguana (7) Indeterminate snake (8)

4.00 9.50 5.90 1.80

234 2,595 1,021 100

Total terrestrial Reef Holocentrus (9) Serranidae (9) Lutjanidae (9) Haemulidae (9) Labridae (9) Sparisoma (9 b ) Acanthurus (9) Balistidae (9) Ostraciidae (9) Diodon (9)

9,438

3.40 5.20 4.30 3.70 3.90 4.40 4.20 4.70 3.30 3.30

165 483 298 204 233 316 281 374 153 153

4 20 6 62 4 5 6 3 2 1

Total reef Inshore and pelagic Clupeidae (9 b ) Exoceotidae (9) Belonidae (9) Selar (9) Carangidae (9) Eucinostomus (9) Gerres (9) Bairdiella (9) Sphyraena (9 b ) Scombridae (9)

660 9,660 1,788 12,648 932 1,580 1,686 1,122 306 153

19,960

3.5 3.5 4.6 3.5 3.6 3.5 3.5 3.0 3.2 3.2

30,535

2.20 2.20 4.20 3.40 4.10 2.70 2.80 3.30 4.50 9.60

55 55 281 165 265 92 101 153 335 2,276

4 6 3 11 2 11 1 1 2 4

Total inshore and pelagic Total vertebrates

220 330 843 1,815 530 1,012 101 153 670 9,104

2,310 33,810 8,225 44,268 3,355 5,530 5,901 3,366 979 490 108,234

2.6 3.1 3.2 3.2 3.3 3.3 3.3 3.3 4.5 3.8

572 1,023 2,698 5,808 1,749 3,340 333 505 3,015 34,595

14,778

53,638

54,751

181,832

Invertebrates Marine Arca (3) Donax (3) Bivalves (3) Cittarium (4) Strombus (4) Snails (4)

10.96 0.60 6.07 33.14 88.95 2.13

16.3 1.3 9.6 50.1 135.7 3.1

Total invertebrates Total a b

Data from modern specimen from Trinidad. Measurements from the contemporary GE-1 site.

49 2,971 36 30 4 235

799 3,862 346 1,503 543 729

2.1 2.1 2.1 2.1 2.1 2.1

1,678 8,110 727 3,156 1,140 1,531

7,782

16,342

62,533

198,174

Native American Use of Animals in the Caribbean

507

TABLE 18 Data for the Calculation of Mean Trophic Levels for the Indian Castle Site, Late Occupation Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

1 8 1 2 1 2 2

45 1,400 2,595 16 223 90 476

2.5 2.1 2.1 3.5 2.1 3.5 3.5

113 2,940 5,450 56 468 315 1,666

Vertebrates Terrestrial Brachyphylla a Oryzomyini (5) Dasyprocta (5b ) Anolis a Iguana (7) Ameiva (7) Indeterminate snake (8)

45 175 2,595 8 223 45 238

3.6 9.5 3.4 1.9 2.5

Total terrestrial Reef Holocentrus (9) Epinephelus (9) Serranidae (9) Lutjanidae (9) Haemulidae (9) Microspathodon (9) Labridae (9) Scaridae (9) Acanthurus (9) Balistidae (9)

4,845 4.5 3.2 6.0 3.4 4.1 3.7 3.7 4.4 2.4 7.5

335 141 693 165 265 204 204 316 68 1,219

4 6 12 4 6 1 7 12 28 4

Total reef Inshore, pelagic Clupeidae (9) Exocoetidae (9) Belonidae (9) Caranx (9) Selar (9) Gerreidae (9) Mullidae (9) Sphyraena (9) Scombridae (9)

1,340 846 8,316 660 1,590 204 1,428 3,792 1,904 4,876

11,008 3.5 3.8 3.5 4.6 3.5 2.1 3.6 3.5 3.5 3.0

24,956 2.2 1.9 4.5 4.8 3.0 3.7 3.7 4.5 8.6

55 38 335 394 120 204 204 335 1,723

3 1 3 3 3 1 1 1 3

Total inshore and pelagic Total vertebrate

165 38 1,005 1,182 360 204 204 335 5,169

4,690 3,215 29,106 3,036 5,565 428 5,141 13,272 6,664 14,628 85,745

2.1 3.1 3.2 4.0 3.2 3.3 3.2 4.5 3.8

347 118 3,216 4,728 1,188 673 653 1,508 19,642

8,662

32,073

38,463

128,826

Invertebrates Terrestrial Gecarcinidae (11)

6.2

93

11

1023

3.0

3,069

Marine Small bivalves (3) Cittarium (4) Strombus (4) Small snails (4) Lobster (11)

1.97 16.57 149.9 2.3 6.2

4 25 230 3 93

66 23 3 167 8

264 575 690 501 744

2.1 2.1 2.1 2.1 2.7

554 1,208 1,449 1,052 2,009

Total invertebrate Total a b

Data from the literature. Data from modern specimen from Trinidad.

3,797

9,341

42,260

138,167

508

Biogeography of the West Indies: Patterns and Perspectives

TABLE 19 Data for the Calculation of Mean Trophic Levels for the Hichman’s Site, Early Occupation Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

3,325 5,190 170 153 985 892

2.1 2.1 3.5 2.1 2.1 2.1

6,983 10,899 595 321 2,069 1,873

Vertebrates Terrestrial Oryzomyini (5) Dasyprocta (5a) Anous b Zenaida b Columbidae (6c ) Iguana (7)

3.60 9.50

30.80 3.40

175 2,595 170 153 197 223

19 2 1 1 5 4

Total terrestrial Reef Holocentrus (9 d ) Epinephelus (9) Serranidae (9) Lutjanidae (9) Haemulon (9 d ) Halichoeres (9) Sparisoma (9) Acanthurus (9 d ) Balistes (9) Diodon (9)

10,715

3.40 7.70 7.70 9.30 3.60 7.20 9.90 5.50 7.20 7.20

165 1,303 1,303 2,100 190 1,099 2,460 556 1,099 1,099

1 3 5 1 3 2 2 1 2 1

Total reef

165 3,909 6,515 2,100 570 2,198 4,920 556 2,198 1,099

22,740

3.5 3.8 3.5 4.6 3.5 3.6 3.5 3.5 3.0 3.2

24,230

Inshore, pelagic Monachus (1) Cheloniidae (2) Clupeidae (9 d ) Belonidae (9) Caranx (9) Scombridae (9)

6.74 8.54 2.20 5.20 6.50 10.30

147 127 55 483 849 2,719

1 [2] 1 2 1 3

147 127 55 966 849 8,157

578 14,854 22,803 9,660 1,995 7,913 17,220 1,946 6,594 3,517 87,080

3.5 2.1 2.6 3.2 4.0 3.8

515 267 143 3,091 3,396 30,997

Total inshore and pelagic

10,301

38,409

Total vertebrates

45,246

148,229

Invertebrates Terrestrial Gecarcinidae (11) Marine Chama (3) Cittarium (4) Charonia (4) Small snails (4) Mythrax (11)

8.55

168

11

1848

3.0

5,544

40.95 87.55 419.50 1.95 8.55

54 134 650 3 168

2 10 1 60 2

108 1,336 650 180 336

2.1 2.1 2.1 2.1 2.6

227 2,806 1,365 378 874

Total invertebrates Total a b c d

Data Data Data Data

from from from from

modern specimen from Trinidad. the literature. Hope Estate site estimate. other samples on Nevis.

4,458

11,194

49,704

159,423

Native American Use of Animals in the Caribbean

509

TABLE 20 Data for the Calculation of Mean Trophic Levels for the Hichman’s Shell Heap Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

7 2

1,225 1,720

2.1 3.5

2,573 6,020

Vertebrates Terrestrial Oryzomyini (5) Sula a

3.60

175 860

Total terrestrial Reef Holocentrus (9) Epinephelus (9) Serranidae (9) Lutjanidae (9) Haemulon (9) Labridae (9) Scarus (9) Sparisoma (9) Acanthurus (9) Balistidae (9) Ostraciidae (9) Diodon (9)

2,945

5.40 5.50 5.50 5.40 3.60 5.40 6.40 6.40 5.50 5.40 5.40 5.40

531 556 556 531 190 531 816 816 556 531 531 531

1 3 13 3 7 5 5 30 16 4 1 3

Total reef Inshore, pelagic Monachus (1) Cheloniidae (2) Muraenidae (9) Belonidae (9) Malacanthus (9) Carangidae (9) Sparidae (9) Sphyraena (9) Scombridae (9)

531 1,668 7,228 1,593 1,330 2,655 4,080 24,480 8,896 2,124 531 1,593

8,593

3.5 3.8 3.9 4.6 3.5 3.6 3.4 3.5 3.5 3.0 3.2 3.2

56,709

4.58 36.39 3.90 5.30 5.40 8.70 3.50 4.50 9.90

104 340 233 506 531 1,774 177 335 2,460

[2] [5] 2 18 2 4 4 12 1

104 340 466 9,108 1,062 7,096 708 4,020 2,460

1,859 6,338 28,189 7,328 4,655 9,558 13,872 85,680 31,136 6,372 1,699 5,098 201,784

4.0 2.1 3.5 3.2 3.5 3.3 3.4 4.5 3.8

416 714 1,631 29,146 3,717 23,417 2,407 18,090 9,348

Total inshore and pelagic

25,364

88,886

Total vertebrates

85,018

299,263

Invertebrates Marine Arca (3) Bivalves (3) Cittarium (4) Snails (4) Total invertebrates Total a

Data from the literature.

32.00 5.38 87.00 0.56

43 9 133 1

226 6 314 44

9,718 54 41,762 44

2.1 2.1 2.1 2.1

20,408 113 87,700 92

51,578

108,313

136,596

407,576

510

Biogeography of the West Indies: Patterns and Perspectives

TABLE 21 Data for the Calculation of Mean Trophic Levels of Vertebrates for the Chancery Lane Site, Late Occupation Taxon

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

Terrestrial Oryzomyini (5) Canis familiaris (5) Indeterminate snake (8b )

3.60 16.00 2.50

175 11,052 238

2 2 2

350 22,104 476

2.10 3.00 3.50

735 66,312 1,666

Total terrestrial Reef Epinephelus sp. (9c ) Lutjanus sp. (9c ) Haemulon sp. (9c ) Halichoeres sp. (9c ) Bodianus sp. (9c ) Scarus sp. (9c ) Sparisome sp. (9c ) Acanthurus sp. (9) Balistidae (9c )

22,930

4.60 4.60 4.60 4.60 4.60 4.60 4.60 1.90 4.60

354 354 354 354 354 354 354 38 354

3 1 1 2 1 6 20 7 4

Total reef

1,062 354 354 708 354 2,124 7,080 266 1,416

68,713

3.80 4.60 3.50 3.60 3.60 3.40 3.50 3.50 3.00

13,718

Inshore and pelagic Cheloniidaea Indeterminate shark Clupeidae (9) Exocoetidae (9) Centropomus sp. (9c ) Caranx latus (9) Caranx cf. ruber (9) Scombridae (9)

9.00 2.20 2.80 4.60 8.80 4.15 9.70

1,933 55 101 354 1,826 273 2,336

1 1 4 1 1 1 4

1,933 55 404 354 1,826 273 9,344

4,036 1,628 1,239 2,549 1,274 7,222 24,780 931 4,248 47,907

4.00 2.60 3.10 3.50 4.00 4.10 3.80

7,732 143 1,252 1,239 7,304 1,119 35,507

Total inshore and pelagic

14,189

54,296

Total vertebrates

50,837

170,916

a b c

No measurement is available. Data based on meaurement from Nevis GE-1 site. Mean vertebral width of unidentified fishes.

LAND VERTEBRATES

AND INVERTEBRATES

The general trend during the Ceramic Age in the Lesser Antilles is an increase of land vertebrates, primarily of rice rats, and decrease in land crabs through time. During this time period human population growth, as measured by increased numbers and sizes of archaeological sites, probably drove environmental changes such as intensification of agriculture and increased land clearing around the later sites. The relative abundances of rice rats fluctuates, perhaps as a response to these environmental changes, which may have improved the habitats for rice rats resulting in population growth (Jones, 1985). Greater hunting intensity possibly responding to greater human population densities resulted in the relative increase of their remains in many later deposits. At the same time increased feasting on land crab resulted in a decline in their abundances seen in later deposits of

Native American Use of Animals in the Caribbean

511

TABLE 22 Data for the Calculation of Mean Trophic Levels of Vertebrates for the Chancery Lane Site, Early Occupation Taxon Reef Haemulon sp. (9a) Halichoeres sp. (9a) Scarus sp. (9) Sparisoma sp. (9) Acanthurus sp. (9) Balistidae (9a)

Measurement

Biomass

MNI

Biomass × MNI

TL

TLijYij

3.80 3.80 4.75 4.75 3.70 3.80

218 218 384 384 204 218

1 1 2 3 2 1

218 218 768 1,152 408 218

3.5 3.6 3.4 3.5 3.5 3.0

763 785 2,611 4,032 1,428 654

Total reef Inshore and pelagic Albula vulpes (9) Belonidae (9) Caranx cf. crysos (9a) Caranx sp. (9a) Scombridae (9)

2,982

5.50 4.10 3.80 3.80 6.50

556 265 218 218 849

1 1 1 1 1

556 265 218 218 849

10,273

3.0 3.2 3.3 3.3 3.8

1,668 848 719 719 3,226

Total inshore and pelagic

2,106

7,180

Total vertebrates

5,088

17,453

a

Mean vertebral width of unidentified fishes.

so many sites. The decline in abundance is accompanied by decrease in average size documented in the remains from the Tutu Village site on St. Thomas. These demographic changes point to overexploitation of land crabs throughout the West Indies (Wing, 1995). The life history of land crabs makes them vulnerable to intensive human predation. Adult land crabs produce prodigious numbers of eggs that develop in the plankton stream. Their recruitment onto islands depends on sources of new populations. Ocean currents may sweep past isolated islands not providing propagules to maintain high enough population levels of this intensively exploited resource (Wolcott, 1988; Roberts, 1997). With fewer adults in the population the sources of new populations would be reduced. With the decline in the abundance of gecarcinid land crabs a modest increase in land hermit crabs (Coenobita clypeatus) can also be seen in some Lesser Antillean sites (Antigua, Saba, St. Thomas) (Wing, 1995). Land hermit crabs are generally smaller than gecarcinid land crabs and may have replaced a valued but declined resource. Evidence for increase in the abundance through time of the large endemic rodents in the Greater Antilles comparable to the relative increase of rice rats in the Lesser Antilles is not available. More detailed studies of faunal remains from Greater Antillean sites, particularly those located inland, will provide information on changes in the abundance of these animals. Moderately large ground nesting birds predominate in West Indian sites. Shearwaters and boobies are oceanic birds that nest along the shores of West Indian islands and were probably caught on the nest. None of their bones has medullary bone indicating skeletal remains of a laying female or immature bone of a nestling to substantiate capture of these birds on the nest. However, capture of these birds at sea poses great difficulties to the subsistence hunter. Two other commonly encountered birds, the purple and common gallinules, are associated with marshes and swamps and nest near or on the ground (Pregill et al., 1994). The pigeons are a family of birds widely represented

512

Biogeography of the West Indies: Patterns and Perspectives

TABLE 23 Summary of Mean Trophic Levels for Land Vertebrates, Reef Fishes, Inshore and Pelagic Fishes, Total Vertebrates, and Total Fauna, Which Includes Both Vertebrates and Invertebrates for Sites Discussed in This Chapter Site

Land Vertebrates

Reef Fishes

Inshore or Pelagic

Total Vertebrates

Total Fauna

MC 6 MC 12 En Bas Saline Maisabel late Maisabel early Lujan Tutu late Tutu early Hope Estate late Hope Estate early Kelbey’s late Kelbey’s early Golden Rock Sulphur Ghaut Indian Castle late Hichman’s early Hichman’s Shell Chancery Lane late Chancery Lane early

2.41 2.88 2.17 2.38 2.37 2.39 2.11 2.19 2.84 2.69 2.38 2.54 2.21 2.12 2.27 2.12 2.92 3.00 0.00

3.90 3.59 3.68 3.59 3.68 3.53 3.59 3.76 3.52 3.58 3.50 3.59 3.70 3.55 3.44 3.59 3.56 3.49 3.45

3.11 3.14 3.76 3.50 3.29 3.41 3.39 3.82 3.56 3.24 3.92 3.28 3.58 3.63 3.70 3.73 3.50 3.83 3.41

3.28 3.47 3.34 3.24 3.18 3.13 2.81 3.71 3.23 3.27 3.35 3.46 3.46 3.32 3.35 3.28 3.52 3.36 3.43

— — 2.83 3.22 3.06 — 2.80 3.54 — 3.14 — — — 3.17 3.27 3.21 2.98 — —

Mean trophic level

2.32

3.59

3.52

3.33

3.12

in Antillean sites. They can be attracted to the home site with feed and may have been habituated to areas disturbed by people; this is, however, difficult to prove. Sea turtles and iguanid lizards are associated with the remains from many sites throughout the West Indies. They were clearly important to the Amerindian diet, esteemed for food in the past as they are today. It is likely that most sea turtles were caught while they were on the beaches laying eggs. Sea turtle eggs were probably also eaten although we have no evidence for this. The small sizes of sea turtles at some sites such as MC-6 in Middle Caicos indicate they were probably caught while feeding in seagrass meadows (Wing and Scudder, 1983).

CAPTIVE

AND

DOMESTIC ANIMALS

Changes in the native biota of the islands began with the colonization by people and the plants and animals they introduced. The introduction of domestic and tame land animals is a means of enriching an otherwise meager land fauna and maintaining contact with familiar animals, thereby playing a role in human adaptation to the island environment. Domestic animals are the result of controlled selection and breeding by humans and thus may be thought of as “man-made animals” (Clutton-Brock, 1981). Captive animals are presumably tame and breed in isolation from the wild populations from which they were taken. In most cases the size or morphology of the teeth and skeletons of tamed animals cannot be distinguished from their wild relatives. For this reason exploitation of captive animals is usually difficult to detect in the fragmentary archaeological remains. However, captivity and transport of animals can be documented throughout the Caribbean by the occurrence of species in archaeological contexts where no history of natural occurrence exists in the fossil record on the same island (Olson, 1982a; Morgan and Woods, 1986). Tamed animals are of particular interest in studies of animal domestication because all domestic animals

Native American Use of Animals in the Caribbean

513

went through a stage when they were tamed but not all tamed animals became domestic. Why some tamed animal became domestic is at the heart of our understanding of the process of domestication. Both captive tame and domestic animals fill a variety of roles in human culture. Not all of these animals were kept only as a source of meat. Dogs are used for companionship in this world and the next. They are also used for guarding and assist in hunting. Most dog remains are found in burials and sometimes associated with human burials suggesting that they had a special role in ritual life in the Caribbean. Furthermore, dog teeth, usually the canines, were drilled piercing the root so that they could be strung. One particularly large necklace made up of 4000 teeth, of which most were dog teeth, is believed to be associated with a human burial in Hispaniola (Rímoli, 1977). Guinea pigs are traditionally used for divination and sacrifice in addition to food in the Andes where they were first domesticated (Morales, 1995). Their center of abundance in the Caribbean is the Greater Antilles, Hispaniola, and Puerto Rico. In some Puerto Rican sites they are abundant enough to be thought of as a regular food item. However, their presence on Vieques Island and two sites on Antigua suggests that they were an item of trade, probably from the closest source, Puerto Rico. It is impossible to say what was exchanged for these animals although Antigua has a source of chert widely traded throughout the northern Lesser Antilles, and Vieques was a center for lapidary work. Since guinea pigs are relatively rare in most sites, suggesting that they were not an important food source, some of the Andean cultural traditions of divination and sacrifice may have accompanied these animals into the Caribbean. If they were used for ritual purposes, their remains would not be deposited primarily in midden contexts. Although the impact of the Amerindian introductions of animals on the West Indian land faunas is difficult to measure, the historic introductions of plants, plantation cultivation, and animals profoundly affected the biota of the islands. These introductions coincided with the first Spanish encounter with the Caribbean Islands. In fact, it would appear that while the Santa Maria, Columbus’ flagship, foundered on rocks during the fateful Christmas night in 1492, rats were fleeing the ship for safer ground in what is now Haiti. Their remains, along with the remains of pigs, are identified in a faunal sample from the site of En Bas Saline, which is thought to be the location where Columbus’ sailors erected a fortified settlement called Navidad (Deagan, personal communication). Other European domestic animals accompanied the rat and pig and prospered in the New World setting. Cattle were introduced to Puerto Real, a town close to En Bas Saline founded in 1502 and officially closed in 1578 (Reitz, 1986). In that short span of time, cattle and pigs became feral and multiplied to such an extent that cow hides and other carcass products formed the basis of a commercial enterprise while pigs became a major food item in the town (McEwan, 1983). They thrived in the Caribbean islands in the absence of competitors or predators. Other European animals that were introduced are not as abundantly represented in early 16th-century sites as cattle and pigs; however, in time they played their part in exterminating much of the native West Indian land fauna. Some animals were introduced for purposes other than food or they simply accompanied people. Rats were not domestic but accompanied humans throughout the world and made an early appearance in the Islands. During the sugar plantation days Indian mongoose (Herpestes javanicus) were introduced to control rats and snakes. All these animals established wild populations that dominated the native fauna and contributed to the extinction of many species. Domestic dogs and captive animals that were introduced prior to European colonization have a distribution that corresponds to island biogeographical principles (Wing and Wing, 1995). The greatest diversities and abundances of these captive animals are closest to the South American mainland. The numbers of species and the relative abundance of the most widespread one, the agouti, decline in the Lesser Antilles with distance from the mainland. The Greater Antilles with their richer species composition were also a source of captive animals. These were carried out to the Virgin Islands and their numbers decline with distance from the larger islands. Despite the numbers of animals that were captive and transported from island to island only the hutia, Isolobodon portoricensis, was intensively used and could have contributed in a major way to the prehistoric diet. The hutia is a captive animal whose size changed under captive conditions

514

Biogeography of the West Indies: Patterns and Perspectives

(Reynolds et al., 1953). Even this successful management did not result in an animal that was spread throughout the Caribbean or that survived the European colonization. Changes through time are an outcome of human population growth outstripping the local resources (Wilson, 1989). Intensification of agriculture was a response to decline in some resources such as the land crabs and some marine resources (Newsom, 1993). Agricultural intensification included landscape changes such as terraces in the Greater Antilles and incorporation of new crops. Neither domestic nor captive animals increase in abundance in the later deposits of the sites reported here. Exceptions are the hutia that probably did contribute substantially to the prehistoric diet in some sites in the Greater Antilles, suggesting that they were more successfully managed. The coney, Geocapromys brownii, in Jamaica was either managed successfully or reliably caught and was also significant to the prehistoric economy, particularly in inland sites such as Bellevue. However, most managed animals are not abundantly represented, which suggests that they did not augment the diet. This may have been because food shortages were not critical, these managed animals had other important social functions, or they could not be reared successfully in sufficient numbers to be a regular food source. Even with an island fauna that is less diverse than most mainland faunas, one might think that life on islands surrounded by a sea full of fishes and other marine animals would never see shortages of meat. However, subsistence technology of the Ceramic Age people and choices of food set some limitations on animals that were exploited. Although Amerindians were competent seafaring people, they probably still exploited food resources close to the occupation site simply to maximize the cost benefits of the catch. We have no evidence other than the introduction of domestic and captive animals that species were caught in habitats distant from the sites. Animals apparently were not transported across the Anegada passage, either from the Greater Antilles and Virgin Islands to the Lesser Antilles or vice versa. The exceptions to transport across the Anegada Passage are domestic dogs that accompanied people throughout the Caribbean, guinea pigs carried to the eastern Greater Antilles and Antigua, and a pond turtle moved from the eastern Greater Antilles to Saba. Fishes typically occurring in oceanic water and living distant from shore have not been identified from archaeological deposits. Most of the fishes caught and the mollusks gathered come from habitats close to shore. Some of these habitats are occupied by territorial organisms that can be affected by intensive exploitation. Other habitats are inhabited by fishes with huge oceanic population reservoirs less easily affected by fishing focused in one small corner of this habitat. Detailed study of the different components of the marine fauna provides insights into human adaptation to island life and the impact of human exploitation on local animal populations.

AQUATIC FAUNA Marine fishes and mollusks predominate in the aquatic fauna and are associated with a variety of habitats close to the coast such as rocky intertidal, coral reefs, inshore seagrass meadows, and pelagic waters. Animals associated with all of these habitats are found in every faunal assemblage; however, the relative abundance of animals changes through time. These changes in the demography of territorial reef fishes, an increase in the importance of inshore and pelagic fishes and a relative increase in mollusks, are encountered between early and late deposits (Wing and Wing, 2001; Wing, 2001). Standard quantification, measurements, and mean trophic level analysis provide data that reveal those changes. Mean trophic level analysis as conceived by Pauly and his colleagues (1998) takes into account the composition of a catch and the position of the species in the food web. Application of mean trophic level analysis to archaeological remains can chart trends of change in size and relative abundances of predators and prey species within a sequence of occupation (Wing, 2001). A decline in the mean trophic levels of territorial reef fishes can be seen through time in most pairs of deposits studied. The observed mean trophic level values decline at different rates probably depended on the intensity and duration of the fishing enterprise, the size of the reefs, the source

Native American Use of Animals in the Caribbean

515

of fish larvae for maintenance of fish stocks, and the prehistoric fishing technology employed (Figure 2). The least change is seen in the pair of deposits from Chancery Lane on the south coast of Barbados. The early deposit from Chancery Lane is very small and may not be representative. The early occupation at the site was small and apparently did not impact the reef fauna. Fishing technology can affect the composition of the catch. For example, if hook and line are used exclusively, one would anticipate only predatory fishes that will take a baited hook or a lure and their size would be determined by the size of the hook and the strength of the line. The fish species composition in the prehistoric deposits is typically a mix of predator and prey species and the size of the majority falls within a narrow size range with occasional large carnivores. Both traps and nets will catch a wide spectrum of species; however, nets are not practical to use in a coral reef. Traps are widely used today among reefs where they take a great variety of species, both herbivores and carnivores. The catch is usually within a narrow size range; the upper limits determined by the size of the trap opening and the lower limits by the gauge of the construction material. The reef fishes encountered in the archaeological deposits correspond to the typical trap catch in respect to the species richness and composition and their small size range. The occasional large carnivore may have been caught on a hook and line augmenting fishes caught by traps. No remains of fishing equipment have been identified in West Indian sites to substantiate this hypothesis. The decrease in the sizes of fishes and the species composition has been studied by fisheries biologists in examining fishing pressures on reefs and the effects of marine reserves in maintaining fish stocks (Russ, 1991; Roberts, 1995). Comparisons of fished and unfished reefs show declines in the sizes of fish biomass and a disproportionally great decline in predatory fishes such as grouper, grunts, and snapper relative to herbivores such as surgeonfishes and parrotfishes (Russ, 1991; Roberts, 1995). Another study of trap fishing on two reefs in Haiti showed that the “modal sizes of scarids and chaetodeontids (the most abundant groups in the catch) were significantly lower on the more heavily exploited reef” (Russ, 1991:610). In most studies of modern fishing on reefs a decline in the size of the fishes has been observed and predatory species are the most vulnerable. Fishing intensity that has reached “a point where fishes are caught before they have time to grow” is termed growth overfishing (Russ, 1991:605). These differences in fish populations between the unfished and fished reefs are just the changes we see through time among the reef fishes in successive archaeological deposits. The reef fishes from the later deposits at Tutu show a particularly great decline in size as is reflected in the change in the mean trophic levels. The sizes of the reef fishes in the later deposit are all small; the mean estimated biomass of each individual is 134 g (range 18 to 141 g plus two large triggerfishes weighing an average estimated 582 g). These are very small fishes, probably immature. It is difficult to think of a reason such small individuals would be selected if larger ones were available. “If fishing reduces the size of the adult stock to a point where production of larvae and subsequent recruitment are impaired, the effect is termed recruitment overfishing” (Russ, 1991:605). At least in the later deposits at Tutu fishing was probably intensive enough to be called recruitment overfishing. The whole issue of fishing pressure on reefs is complicated by the recruitment of most fishes come from beyond the reef (Roberts, 1997). The reefs on some islands are positioned downstream from a source of larvae and would be able to maintain fish populations better than those islands washed by currents with fewer propagules. Therefore, the location of an island either up- or downstream from a source of new recruits to the reef could withstand fishing pressures differently. In the later deposits where we see evidence for growth or recruitment overfishing we also see an increase in the mean trophic levels of the inshore and pelagic component of the marine fauna in three of the six pairs of sites and only a slight decline in two pairs. In most cases the animals that dominate this increase in the later deposits are the tuna, primarily the little tunny. Most of the tuna are large fishes estimated to weigh on average 2229 g (range 1000 to 3700 g). Their large size and position in the food web (index 3.8) affects the general increase in the mean trophic level of this component of aquatic vertebrates. The decline in the mean trophic level of reef fishes is

516

Biogeography of the West Indies: Patterns and Perspectives

balanced by the increase in the mean trophic level of the inshore and pelagic component showing little overall vertebrate change at Maisabel, Hope Estate, Kelbey’s Ridge, southeastern Nevis (Hichman’s and Indian Castle), and Chancery Lane. The generally higher, or at least not substantially lower, mean trophic levels in the later deposits suggest that the fishing enterprise focused toward a greater emphasis on the inshore and pelagic species at the same time as the general decrease in the percentage of the reef fish biomass. This change required a technological innovation to successfully capture tuna, a seasonal resource relatively close to shore usually taken with hook and line. This would require scheduling and perhaps also preparation for storage for use during times when tuna were less easily caught. The one exception is the substantial decline in the mean trophic level of all components in the late deposits at Tutu Archaeological Village. Tuna are present but all of the other fishes in the inshore and pelagic component are small, probably accounting for the decline in the mean trophic level. This is further evidence of stress on the resources by the Tutu villagers. Increase in mollusks relative to land crabs in later deposits and an overall decline in mean trophic level at Tutu and southeastern Nevis suggests a shift to greater uses of shellfish. A decline in the mean trophic level would follow the increased use of mollusks that are low in the food web. The most numerically important shellfish found in the deposits live on rocks in the intertidal region and collecting them may have accompanied the inshore fishing activities that gained emphasis in the later deposits. The Archaic deposit on Nevis, Hichman’s Shell Heap, has a low mean trophic level for aquatic fauna. The large numbers of West Indian top snails at this site are probably responsible for this low trophic level. Faunal data from West Indian sites are beginning to show both the flexibility of people in their food quest as well as the limitations set by island biogeography. The flexibility of the Ceramic Age people is demonstrated by their introduction of animals used for various purposes. They also exploited a wide array of wild resources. They shifted from a focus on one set of resources such as the reef fishes to others such as inshore and pelagic fishes and intensified shellfish gathering when the first set of resources declined. This probably required a technological change but it permitted procurement of increased animal protein to meet the demands of a growing population. Despite this flexibility we see the animals introduced as captive animals and domestic dogs were subject to limitations of island biogeography. This suggests difficulties in maintaining these animals. European domestic animals ultimately flourished in the Greater Antilles and eventually throughout the West Indies, thereby changing the West Indian fauna forever.

ACKNOWLEDGMENTS This research was supported by National Science Foundation Grant BNS 8903377, Virgin Islands Division of Archaeology and Historic Preservation, L’Association Archéologique Saint Martin, and funds from Samuel Wilson. I am also grateful to the archaeologists who entrusted faunal samples to us for study. This work could not have been accomplished without the help with identifications from Susan deFrance, Laura Kozuch, Nathalie Serrand, and Sylvia Scudder; with editing, also by Sylvia; preparation of graphs by Irv Quitmyer; and focusing ideas through discussions with Elizabeth Reitz and Stephen Wing. I gratefully acknowledge them all.

LITERATURE CITED Clutton-Brock, J. 1981. Domesticated Animals from Early Times. University of Texas Press, Austin, Texas. deFrance, S. D. 1990. Zooarchaeological investigations of an early Ceramic Age frontier community in the Caribbean, the Maisabel Site, Puerto Rico. Antropológica 73–74:3–180. Harris, D. R. 1965. Plants, Animals, and Man in the Outer Leeward Islands, West Indies. University of California Publications in Geography Vol. 18.

Native American Use of Animals in the Caribbean

517

Jones, A. R. 1985. Dietary change and human population at Indian Creek, Antigua. American Antiquity 50(3):518–536. Kozuch, L. 1992. Alimentación y estatus: restos animales de Viejo San Juan, Puerto Rico [Animal remains from Old San Juan, Puerto Rico]. Report submitted to Oficina estatal de preservacion historia, San Juan, Puerto Rico. Kozuch, L. and E. S. Wing. In preparation. Animal remains for archeological sites on Nevis. Submitted to S. Wilson, University of Texas, Austin. 17 ms. pp. + 6 figures and 16 tables. McEwan, B. G. 1983. Spanish Colonial Adaptation on Hispaniola: The Archaeology of Area 35, Puerto Real, Haiti. Unpublished Master’s thesis, University of Florida, Gainesville. Miller, G. S., Jr. 1929. Mammals eaten by Indians, owls, and Spaniards in the coast region of the Dominican Republic. Smithsonian Miscellaneous Collections 82(5):1–16. Morales, E. 1995. The Guinea Pig: Healing, Food, and Ritual in the Andes. University of Arizona Press, Tucson. Morgan, G. S. and C. A. Woods. 1986. Extinction and the zoogeography of West Indian land mammals. Biological Journal of the Linnean Society 28:167–203. Newsom, L. A. 1993. Native West Indian Plant Use. Ph.D. dissertation, Department of Anthropology, University of Florida, Gainesville. Ogden, J. C. and P. R. Ehrlich. 1977. The behavior of heterotypic resting schools of juvenile grunts (Pomadasyidae). Marine Biology 42:273–280. Olson, S. L. 1978. A paleontological perspective of West Indian birds and mammals. Pp. 99–117 in Gill, F. B. (ed.). Zoogeography in the Caribbean. The Leidy Medal Symposium, Academy of Natural Sciences of Philadelphia Special Publication No. 13. Olson, S. L.1982a. Biological archaeology of the West Indies. The Florida Anthropologist 35(4):162–168. Olson, S. L. 1982b. Fossil vertebrates from the Bahamas. Smithsonian Contribution to Paleobiology 4:1–60. Pauly, C., Christensen, V., Dalsgaard, J. Froese, R. and F. Torres, Jr. 1998. Fishing down marine food webs. Science 279:860–863. Pregill, G. K., D. W. Steadman, and D. R. Watters. 1994. Late Quaternary vertebrate faunas of the Lesser Antilles: historical components of Caribbean biogeography. Bulletin of Carnegie Museum of Natural History, Pittsburg No. 30. Rainey, F. G. 1940. Porto Rican archaeology: scientific survey of Porto Rico and the Virgin Islands. New York Academy of Sciences 18(1):1–208. Reitz, E. J. 1986. Cattle at Area 19, Puerto Real, Haiti. Journal of Field Archaeology 13:317–328. Reitz, E. J. and B. Ruff. 1994. Morphometric data for cattle from North America and the Caribbean prior to the 1850s. Journal of Archaeological Science 21:699–713. Reitz, E. J. and E. S. Wing. 1999. Zooarchaeology. University of Cambridge Press, Cambridge. Reynolds, T. E., K. F. Koopman, and E. E. Williams. 1953. A cave faunule from western Puerto Rico with a discussion of the genus Isolobodon. Breviora 12:1–8. Rímoli, R. O. 1977. Nuevas citas para mamiferos precolombinos en la Hispaniola. Universidad Autonoma de Santo Domingo, Cuadernos del CENDIA 259(5):1–15. Roberts, C. M. 1995. Rapid build-up of fish biomass in a Caribbean marine reserve. Conservation Biology 9(4):815–826. Roberts, C. M. 1997. Connectivity and management of Caribbean coral reefs. Science 278:1454–1457. Rouse, I. 1992. The Taínos: Rise and Decline of the People Who Greeted Columbus. Yale University Press, New Haven, Connecticut. Russ, G. R. 1991. Coral reef fisheries: effects and yields. Pp. 601–635 in Sale, P. F. (ed.). The Ecology of Fishes on Coral Reefs. Academic Press, San Diego. Sale, P. F. 1991. Ecology of coral reef fishes. Pp. 3–15 in Sale, P. F. (ed.). The Ecology of Fishes on Coral Reefs. Academic Press, San Diego. Sedberry, G. R. and J. Carter. 1993. The fish community of a shallow tropical lagoon in Belize, Central America. Estuaries 16(2):189–215. Steadman, D. W., S. L. Olson, J. C. Barber, C. A. Meister, and M. E. Melville. 1980. Weights of some West Indian birds. Bulletin British Ornithological Club 100(2):155–158. Steadman, D. W., R. L. Norton, M. R. Browning, and W. J. Arendt. 1997. Birds of St. Kitts, Lesser Antilles. Caribbean Journal of Science 33(1–2):1–20. van der Klift, H. M. 1992. Faunal remains of Golden Rock. Pp. 74–83 in Versteeg, A. H. and K. Schinkel (eds.). The Archaeology of St. Eustatius: The Golden Rock Site. St. Eustatius Historical Foundation, No. 2 and Foundation for Scientific Research in the Caribbean Region, No. 131.

518

Biogeography of the West Indies: Patterns and Perspectives

Wilson, S. M. 1989. The prehistoric settlement pattern of Nevis West Indies. Journal of Field Archaeology 16(4):427–450. Wing, E. S. 1995. Land crab remains in Caribbean sites. Pp. 105–112 in Proceedings of the XVIth International Congress of Caribbean Archaeology, Guadeloupe. Wing, E. S. 1996. Vertebrate remains from the sites of Spring Bay and Kelbey’s Ridge, Saba, Netherlands West Indies. Pp. 261–279 in Hoogland, M. L. P. In Search of the Native Population of Pre-Columbian Saba, Part 2. Ph.D. dissertation, Rijksuniversiteit, Leiden. Wing, E. S. 2000. Economy and Subsistence, I: Animal remains from sotes on Barbados and Tortola. Chapter 11, pp. 147–153 in Drewett, P. L. Prehistoric Settlements in the Caribbean. Archetype Publications for the Barbados Museum and Historical Society, St. Michael, Barbados. Wing, E. S. 2001. The sustainability of resources used by native Americans on five Caribbean islands. International Journal of Osteoarchaeology 11:112–126. Wing, E. S. and S. J. Scudder. 1983. Animal exploitation by prehistoric people living on a tropical marine edge. Pp. 197–210 in Grigson, C. and J. Clutton-Brock (eds.). Animals and Archaeology. BAR International Series 183, Oxford. Wing, E. S. and S. R. Wing. 1995. Prehistoric Ceramic Age adaptation to varying diversity of animal resources along the West Indian archipelago. Journal of Ethnobiology 15(1):119–148. Wing, E. S. and S. R. Wing 1997. The introduction of animals as an adaptation to colonization of islands: an example from the West Indies. Anthropozoologica No. 25, 26:269–278. Wing, S. R. and E. S. Wing. 2001. Prehistoric Fisheries in the Caribbean. Coral Reefs. Springer-Verlag, New York. Wing, E. S., C. E. Ray, and C. A. Hoffman, Jr. 1968. Vertebrate remains from Indian sites on Antigua, West Indies. Caribbean Journal of Science 8(3–4):123–139. Wolcott, T. G. 1988. Ecology. Pp. 55–96 in Burggren, W. W. and B. R. McMahon (eds.). Biology of the Land Crabs. Cambridge University Press, Cambridge.

Prehistory and Early 25 The History of the Caribbean Samuel M. Wilson Abstract — This chapter reviews the human history of the Caribbean from its first period of colonization, 6000 years ago, to the period of European conquest and its aftermath. Several periods of migration into the region are discussed, beginning with the first migrations from Central America. Later migrations came from northeastern South America around 4000 years ago, and again from that point of origin between 2500 and 2000 years ago. In the last centuries before the arrival of Europeans, complex societies with polities of dozens of allied villages emerged. The complex ethnic mosaic of the indigenous Caribbean, not so different from the present-day situation, is briefly described.

INTRODUCTION Compared to other parts of the Americas, humans came relatively late to the islands of the Caribbean, arriving around 6000 years ago. They brought with them many mainland plants and animals that had a profound impact on the endemic flora and fauna. Over time, several additional groups of human migrants came into the Caribbean, supplanting or joining the existing populations. Each group brought new species and new techniques for exploiting the land and sea. Through many millennia the islanders came to know the island environments intimately. By the time Columbus arrived more than 200 generations of indigenous Caribbean people had come and gone, passing on their knowledge of and relationship with Caribbean environments to their children. This chapter presents an overview of the archaeological evidence for the human occupation of the West Indies. Despite a century of research on Caribbean prehistory, many parts of this story are unknown or imperfectly known. This account emphasizes the historical processes at work in the Caribbean, both the migrations of new people into the islands and the long periods of cultural interaction and cultural divergence that took place. Finally, it details the ways in which the indigenous peoples’ adaptations to Caribbean environments have been maintained by their descendants, and passed on to more recent Caribbean immigrants whose origins were in Africa and Europe. The earliest radiocarbon dates from the Caribbean range from 3500 to 4000 years B.C., and come from archaeological sites located in Cuba, Haiti, and the Dominican Republic (Figure 1). These first migrants brought with them a stone tool technology based on large chert blades, and they found stone sources of sufficient quality to continue to make their macroblade tools in the Greater Antilles. One of the closest places in terms of distance, and the closest in terms of similarities in contemporary artifact assemblages, is the Yucatan Peninsula. Figure 2 shows a comparison of radiocarbon dates from archaeological sites in Belize with some of the earliest dates from the Greater Antilles. While other points of origins have been suggested for the first colonists — northern South America and Florida, for example — at present the Yucatan Peninsula seems to be the most likely source (for discussions see Wilson et al., 1998). When people first moved into the Greater Antilles, they made their living by hunting, fishing, and collecting wild foods, just as they had in Central America. They nevertheless had to make significant changes in their diet. Some of the island plants and animals that could be used for food were different, and they had to adjust to other differences, such as a lack of large land mammals. Apart from their distinctive stone tools, and a few famous sites, little is known about the way of life of these early Caribbean migrants. It is a priority for Caribbean archaeologists to explore this 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

519

520

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 1 Map of the West Indies showing major migrations.

early period of human occupation to understand the interaction of people with extinct plants and animals, and in general to understand better this period of adaptation to island environments. At present, early sites are known from Cuba and Hispaniola (Haiti and the Dominican Republic). By around 2000 B.C. a number of regional variants had appeared, based on the presence and absence of distinctive stone tools and other artifacts (Veloz Maggiolo and Vega, 1982). Related sites extend through Puerto Rico and into the eastern Caribbean, although it is not completely clear that these people came from the Greater Antilles (Lundberg, 1980). Distinctive additions to some of the these artifact assemblages were implements made of ground stone — axes, bowls, and carved objects of art (Veloz Maggiolo, 1976; Rouse, 1992). Also around 2000 B.C. another group migrated into the Lesser Antilles and Puerto Rico from Trinidad and mainland South America. Like the people living in the Greater Antilles, they also did not rely on domesticated plants or animals. They lived as fisher–collectors on the wild foods of the sea and coastal regions, and traveled widely through the archipelago. Their sites are mostly coastal, consisting of shell scatters or shell mounds. Most of their tools and material goods were likely made of wood or woven material that has not survived. What have survived are axes or adzes made

The Prehistory and Early History of the Caribbean

521

FIGURE 2 A comparison of radiocarbon dates from archaeological sites in Belize with some of the earliest dates from the Greater Antilles.

of the thick flares of conch shells and small flint flakes and tools (Lundberg, 1989; Davis, 1993; Drewett, 1995). Over time, and probably with continued interaction with both the inhabitants of the Greater Antilles and the South American mainland, the occupants of the Lesser Antilles developed an elaborate tradition of objects made of ground stone. These were primarily axes, but they also included other objects carefully carved whose functions apart from symbolic ones are unclear (Fewkes, 1907; Loven, 1935; Harris, 1983). Archaeologists have termed these sites “Preceramic” or “Archaic” because the people did not make pottery or live in permanent villages. Their sites are widespread, and with more careful and sophisticated techniques archaeologists are learning more about these people and their interactions with Caribbean environments. For example, archaeologist and paleoethnobotanist Lee Newsom has found macrobotanical evidence for primrose (Oenothera sp.), which was probably used as a medicinal plant, on a Preceramic site on Nevis (Newsom, 1993). Between 2000 and 1500 B.C. Puerto Rico and the northernmost Lesser Antilles were likely an area of interaction for people with very different origins and histories (Veloz Maggiolo et al., 1974; Lundberg, 1991; Rouse, 1992:49–70). However, little is know of the long period of interaction between these two (or more) Archaic groups who lived in the Caribbean prior to the arrival of ceramics-using horticulturalists from South America.

SALADOID MIGRATIONS In the last 500 years B.C., a new group or groups of people moved into the Lesser Antilles and Puerto Rico. They came from the Orinoco and other rivers along the northeastern coast of South America. In terms of the material remains they left behind, the appearance of the “Saladoid” people was very obvious. (The term Saladoid was coined by Irving Rouse in 1964 to refer to the ceramic series that was comparable to what was found at the Venezuelan site of Saladero.) In contrast to the smaller sites of their predecessors, Saladoid people lived in large, permanent sites, dense with debris and marked by unmistakable white-on-red painted and zone-incised-crosshatched pottery.

522

Biogeography of the West Indies: Patterns and Perspectives

Saladoid sites are similar from island to island and at first archaeologists saw them as part of a relatively coherent and contemporaneous wave of migration from South America. As archaeologists have excavated more sites and run more radiocarbon dates, the picture has become more complex. Dates for the earliest sites with ceramics on the islands of the Lesser Antilles range from around 500 B.C. to A.D. 100 (Haviser, 1997) with little chronological continuity from island to island. There is greater variability in the ceramics at these sites as well, further suggesting that there may have been two or more migrations, possibly with additional cultural divergence once people were established in the Caribbean (Rodríguez, 1997:81). Indeed, there may have been an ongoing interaction between island and mainland populations, with multiple moves up and down the island arc. By the last 100 years B.C., and lasting until around A.D. 600, a permanent Saladoid occupation was in place from Trinidad, through the Lesser Antilles and Puerto Rico, to the eastern tip of the Dominican Republic. They cultivated domesticated plants such as cassava or yuca (Manihot) that they brought with them from the mainland, and also lived on the wild animals of the land, littoral, and sea. They lived in pole and thatch houses, large enough to shelter extended families (Versteeg, 1987). Their settlements are widely spaced throughout the Lesser Antilles and Puerto. They chose settings with abundant resources and fresh water, but apparently preferred to have some distance between themselves and neighboring communities (for extensive discussion of Saladoid period, see Siegel, 1989). On Puerto Rico, and especially on the east coast of the Dominican Republic, the Saladoid people would have been in contact with the Preceramic or Archaic people who had already lived there for a very long time. There is artifactual evidence that the period of interaction between these two groups lasted for several centuries on Hispaniola (Rouse, 1992:90–104).

POST-SALADOID CHANGES Important changes took place in the Lesser and Greater Antilles between 500 and 1000 A.D. In the Lesser Antilles there were changes in pottery manufacture, food-gathering behavior, house construction, and settlement organization. In most parts of the Antilles, there is also evidence of population growth. While Saladoid sites had been fairly widely scattered, but occupied for long periods, the later sites appear to be far more numerous, but perhaps less permanent (Versteeg et al., 1993). The same sort of population growth took place in the Greater Antilles, and new areas were occupied more intensively than ever before. The upland interior of Puerto Rico was occupied by village-dwelling farmers, as was Jamaica, Hispaniola, and the eastern end of Cuba. The colonization of the Bahamas also began in this period. Rouse has grouped the various kinds of ceramics produced in this period under the series “Ostionoid,” named for the site of Ostiones. Ostionoid pottery is found through the Greater Antilles and northern Lesser Antilles. It is generally plainer and less well made than Saladoid pottery, and in most areas is characterized by red or orange-red paint on the outside. Between 500 and A.D. 1000 other major changes occurred in the Caribbean. The first clear signs of increasing social and political complexity date to this period (Alegría, 1983). In Puerto Rico the first stone-lined ceremonial plazas or ball courts were built (Figure 3). These elaborate installations were the focus of group activity for communities that were much larger than the Saladoid groups, and they reflect the emergence of more complex polities. At the same time, there is increasing evidence of the kinds of artifacts that reflect personal status and power, suggesting that the social differentiation that the Spanish witnessed in the late 15th century was developing at least by the 8th century. The period between A.D. 700 and the period of European conquest, and especially after A.D. 1200, saw the fluorescence of the Taíno chiefdoms. An important characteristic of this period was the continued cultural interaction and change among the Greater Antillean groups. Although pottery, horticulture, and sedentary village life were adopted across Hispaniola, Jamaica, Cuba, and the

The Prehistory and Early History of the Caribbean

523

FIGURE 3 The Taíno ball court at Caguana, Utuado, Puerto Rico.

Bahamas, there was no homogeneity in language and culture. One important subgroup comprised the descendants of the Archaic people who had lived on the islands for millennia. It now appears that in some places their descendants persisted as a self-identified minority among the people encountered by Columbus (Wilson, 1993). In other places, throughout Hispaniola and beyond, the legacy and impact of the Archaic people played an important role in the emergence of a Taíno cultural identity. That is, the people of the Greater Antilles encountered by Columbus had a complex history with both Archaic and Saladoid roots, and the explosion of expressive culture exhibited by the Taíno comes out of this conjunction. The indigenous people of the Caribbean were far more culturally diverse than Columbus and the Europeans realized. In 1492 the cultural diversity of the Greater and Lesser Antilles can be described as a cultural mosaic or matrix (Wilson, 1993; Whitehead, 1995a). In the Lesser Antilles in the centuries before European contact there was also a great deal of cultural diversity, and significant interaction and trade both with the Greater Antilles and the South American mainland. The Leeward Islands, densely populated until about A.D. 1200, saw a significant loss of population, or perhaps even abandonment (Corinne Hofman, personal communication, 1999; Wilson, in preparation). To the south the Windward Islands had a complex mélange of groups with shifting and permeable boundaries and varying degrees of interaction with mainland and other island groups (Allaire, 1987; Hulme and Whitehead, 1992; Boomert, 1995; Whitehead, 1995b).

EUROPEAN CONQUEST In 1492 Columbus’ ships arrived in the Bahamas, and then sailed along the northeastern coast of Cuba before crossing to Haiti. There, and later in the rest of the Greater Antilles, they found large populations of people they came to call the Taíno. These people lived in villages numbering into the thousands of inhabitants, under the authority of village leaders. Regional polities or confederations linked 70 or more of these villages. They interacted through trade, the ball game, and giftgiving, and they cooperated in wars fought with other cacicazgos or chiefdoms. Hispaniola had five large cacicazgos, and many smaller ones (Wilson, 1990). Caciques, or chiefs, as well as men and women of high status, were given special treatment. They were carried on litters or on the backs of their servants, and some caciques had an accompanying spokesman to speak for him. The Taíno elite were adorned with gold jewelry and other elaborate objects made of beads, bone, feathers, and woven cotton.

524

Biogeography of the West Indies: Patterns and Perspectives

Although the Spaniards had no experience with this form of social organization and did not recognize it, the Taíno were matrilineal. Descent and inheritance were passed through the female line, and the highest ranking person in the social system was the senior woman in the dominant matriline. In most cases, however, men held the office of cacique, reflecting the distinction between social hierarchy and political power. The cacicazgos required some degree of centralized decision making in warfare with other groups and perhaps in economic matters as well. Interior cacicazgos had specialists on the coasts drying fish for transport up the rivers. The Taíno also used a form of intensive cultivation of manioc in conucos, mounded and fertilized planting beds. The Taíno cacicazgos interacted with one another through occasional warfare, but also through the ball game. Ball court complexes were sometimes located in areas between polities as well as in the centers of polities, and these may have served as places to assemble for ceremonies, trade, elite marriages, and other forms of interaction. The Taíno traveled between polities, and also from island to island in large, ocean-going canoes, some of which could hold up to 100 people (Bartolomé de Las Casas and Gonzalo Oviedo y Valdez are two very important observers of Taíno life; other primary sources are discussed in Wilson, 1990). The expressive creativity of the Taíno was a dominant characteristic of their cultural blossoming, which was still in full swing at the time of European conquest. This creativity can be seen in Taíno ceramics, stone and wood carving, weaving, beadwork, and other media. Taíno art often combined themes of traditional mythology with the transformational experiences of shamanic trances in experimental and innovative ways (McGinnis, 1997). The Taíno expressed equal creativity in their dynamic social and political institutions. It can be argued that this creative explosion is related to the fact that the Greater Antilles was the scene of a long period of cultural interaction and synthesis between the descendants of the Saladoid people and the Central American migrants who had occupied the Greater Antilles for thousands of years. The culturally plural environment favored innovation over conservatism and gave an advantage to individuals or families who could attract multiple constituencies.

AFTER THE ARRIVAL OF EUROPEANS The Taíno fluorescence was cut short by the arrival of Columbus and those who came after him. Hispaniola, and later Puerto Rico, Cuba, and Jamaica, became European footholds in the Americas, and the people of these islands bore the brunt of the first wave of European conquest. The discovery of gold in Hispaniola led to a harsh system of forced tribute payments that disrupted the subsistence economy and resulted in famine. This system became a prototype for other conquests of indigenous people. More devastating were the epidemics the Europeans brought with them. Disease, warfare, and famine destroyed the Taíno chiefdoms in a decade and, by the repartamiento of 1514, had reduced the indigenous population, which may have numbered in the millions, to a few thousand (Cook and Borah, 1971; Henige, 1978; Wilson, 1990). The Greater Antilles were important to the European colonial enterprise for gold, and later cattle, but the significance of the region was soon eclipsed by Mexican and Andean projects and it became a colonial backwater. The Lesser Antilles fared slightly better in the early conquest period. The Lesser Antillean people were hunted by European slavers seeking to replace dying indigenous populations in the Greater Antilles, and the populations of whole islands were killed in raids. In general, however, the people of the Lesser Antilles were more successful in surviving European conquest than those in the big islands (Kiple and Ornelas, 1996). To a great extent this was because people in the Lesser Antilles were better able to survive the waves of epidemics that had such a devastating impact on the more densely populated Greater Antilles. Also, the people of the Lesser Antilles were highly mobile and could escape or attack by canoe. Their effective resistance to colonization kept Europeans out of most of the islands for about 130 years after Columbus. During that time the various European groups — English, Dutch, French, Danish, Spanish, and others — who interacted with the islanders conceived and perpetuated the view of the indigenous people of the Lesser Antilles

The Prehistory and Early History of the Caribbean

525

as “Caribs,” an ethnic designation that originated in Columbus first voyage (Allaire, 1996). The “Island Caribs” played an important role, as allies and enemies, in the European colonization of the Lesser Antilles. Their descendants still live on some of the islands, and in Central America, where the Garifuna people were moved in the 18th century (Davidson, 1980; Gordon, 1998).

INDIGENOUS LEGACIES IN THE CARIBBEAN One important dimension of continuity between the pre- and post-conquest Caribbean is the characteristic ethnic heterogeneity of the region. Today the Caribbean is one of the most ethnically diverse regions in the world, with dozens of languages and cultural affiliations. In large part this is an artifact of the colonial competition for the islands from the 16th through the 20th centuries, but it may also reflect something of the nature of the archipelago: from the earliest human colonizations of the Caribbean, the open sea between the islands facilitated travel, rather than hindered it (Watters and Rouse, 1989). The sea linked villages with one other and populations with their distant relatives. Scattered groups are still part of a community linked by the sea. The legacy of the indigenous people in the Caribbean is more pervasive than this parallel might suggest. In both the Greater and Lesser Antilles there was interaction between the indigenous people and the African and European groups who moved into the islands. This period of overlap was longer and more significant in some areas than others, but in all areas there is significant continuity of pre-conquest culture and way of life. This continuity in economic patterns, language, myth, and even genetic makeup exists throughout the Caribbean, but is most evident in the Lesser Antilles, where indigenous groups were less devastated by the first wave of European conquest and still survive. The detailed list of holdovers, particularly in food names and food preparation practices, is considerable (Wilson, 1997), but it does not capture the more pervasive human–land relationship that was adopted by the most recent wave of human migration to the islands.

LITERATURE CITED Alegría, R.E. 1983. Ball Courts and Ceremonial Plazas in the West Indies. Yale University Publications in Anthropology No. 79, Yale University, New Haven, Connecticut. Allaire, L. 1987. Some comments on the ethnic identity of the Taíno–Carib frontier. Pp. 127–133 in Auger, R., M. F. Glass, S. MacEachern, and P. H. McCartney (eds.). Ethnicity and Culture. Archaeological Association, University of Calgary, Calgary. Allaire, L. 1996. Visions of cannibals: distant islands and distant lands in Taíno world image. Pp. 33–49 in Paquette, R. L. and S. L. Engerman (eds.). The Lesser Antilles in the Age of European Expansion. University Press of Florida, Gainesville. Boomert, A. 1995. Island Carib archaeology. Pp. 23–35 in Whitehead, N. L. (ed.). Wolves from the Sea. KITLV Press, Leiden, the Netherlands. Cook, S. F. and W. Borah. 1971. The aboriginal population of Hispaniola. Pp. 376–410 in Cook, S. F. and W. Borah (eds.). Essays in Population History, Vol. 1: Mexico and the Caribbean. University of California Press, Berkeley. Davidson, W. V. 1980. The Garifuna of Pear Lagoon: ethnohistory of an Afro-American enclave. Nicaragua Ethnohistory 27(1):31–47. Davis, D. D. 1993. Archaic blade production on Antigua, West Indies. American Antiquity 58(4):688–697. Drewett, P. L. 1995. Heywoods: reconstructing a Preceramic and later landscape on Barbados. Proceedings of the Fifteenth International Congress for the Study of Pre-Columbian Cultures of the Lesser Antilles: 273–282. Fewkes, J. W. 1907. The aborigines of Porto Rico and neighboring islands. Bureau of American Ethnology Annual Report 25:1–220. Gordon, E. T. 1998. Disparate Diasporas: Identity and Politics in an African Nicaraguan Community. University of Texas Press, Austin. Harris, P. 1983. Antillean axes/adzes: persistence of an archaic tradition. Proceedings of the Ninth International Congress for the Study of Pre-Columbian Cultures of the Lesser Antilles: 257–290.

526

Biogeography of the West Indies: Patterns and Perspectives

Haviser, J. B. 1997. Settlement strategies in the early Ceramic Age. Pp. 59–69 in Wilson, S. M. (ed.). The Indigenous People of the Caribbean. University Press of Florida, Gainesville. Henige, D. 1978. On the contact population of Hispaniola: history as higher mathematics. Hispanic American Historical Review 58(2):217–237. Hulme, P. and N. L. Whitehead. 1992. Wild Majesty: encounters with Caribs from Columbus to the present day. Clarendon Press, Oxford. Kiple, K. F. and K. C. Ornelas. 1996. After the encounter: disease and demographics in the Lesser Antilles. Pp. 50–69 in Paquette, R. L. and S. L. Engerman (eds.). The Lesser Antilles in the Age of European Expansion. University Press of Florida, Gainesville. Las Casas, B. de. 1951. Historia de Las Indias. Fondo de Cultura Economica, Mexico. Loven, S. 1935. The Origins of Tainan Culture, West Indies. Elanders Bokfryekeri Akfiebolag, Göteborg. Lundberg, E. R. 1980. Old and new problems in the study of Antillean aceramic traditions. Proceedings of the Eighth International Congress for the Study of Pre-Columbian Cultures of the Lesser Antilles, 131–138. Lundberg, E. R. 1989. Preceramic Procurement Patterns at Krum Bay, Virgin Islands. University of Illinois, Lundberg, E. R. 1991. Interrelationships among Preceramic Complexes of Puerto Rico and the Virgin Islands. Proceedings of the Thirteenth International Congress for the Study of Pre-Columbian Cultures of the Lesser Antilles: 73–85. McGinnis, S. A. M. 1997. Ideographic Expression in the Precolumbian Caribbean. Ph.D. dissertation, University of Texas, Austin. Newsom, L. A. 1993. Native West Indian Plant Use. Ph.D. dissertation, University of Florida, Gainesville. Oviedo y Valdez, G. F. 1959. Historia General y Natural de las Indias (5 vols.). Biblioteca de Autores Españoles (Vols. 117–121), Gráficas Orbe, Madrid. Rodríguez, M. 1997. Religious beliefs of the Saladoid people. Pp. 80–87 in Wilson, S. M. (ed.). The Indigenous People of the Caribbean. University Press of Florida, Gainesville. Rouse, I. 1964. Prehistory of the West Indies. Science 144(3618):369–375. Rouse, I. 1992. The Taínos: Rise and Decline of the People Who Greeted Columbus. Yale University Press, New Haven, Connecticut. Siegel, Peter E. (ed.). 1989. Early Ceramic Population Lifeways and Adaptive Strategies in the Caribbean. BAR International Series, No. 506. Oxford University Press, Oxford. Veloz Maggiolo, M. 1976. Medioambiente y adaptacion humana en la prehistoria de Santo Domingo (Vol. 2). Coleccion Historia y Sociedad 30. Universidad Autónoma de Santo Domingo, Santo Domingo. Veloz Maggiolo, M. and B. Vega. 1982. The Antillean Preceramic: a new approximation. Journal of New World Archaeology 5(1):33–44. Veloz Maggiolo, M., J. González Colón, and E. Maiz 1974. El precerámico de Puerto Rico a la luz de los hallazgos de Cayo Cofresí. Actas del XLI congreso internacional de Americanistas 41(3):786–801. Versteeg, A. 1987. Archaeological Research on St. Eustatius. Indian Farmers in the Netherlands Antilles in the Fifth Century A.D. Netherlands Foundation for the Advancement of Tropical Research, Report for the Year 1986, 25–40. Versteeg, A. H. and K. Schinkel. 1992. The Archaeology of St. Eustatius: The Golden Rock Site. Publication No. 2. St. Eustatius Historical Foundation, Oranjestat. Versteeg, A. H., K. Schinkel, and S. M. Wilson. 1993. Large-scale excavations versus surveys: examples from Nevis, St. Kitts, and St. Eustatius in the Northern Caribbean. Analecta Praehistorica Leidensia 26:139–161. Watters, D. R. and I. Rouse. 1989. Environmental diversity and maritime adaptations in the Caribbean area. Pp. 129–144 in Siegel, P. E. (ed.). Early Ceramic Population Lifeways and Adaptive Strategies in the Caribbean. Vol. 506. B.A.R. International Series. Oxford University Press, Oxford. Whitehead, N. L. 1995. Ethnic plurality and cultural continuity in the native Caribbean: remarks and uncertainties as to data and theory. Pp. 91–111 in Whitehead, N. L. (ed.). Wolves from the Sea. Readings in the Anthropology of the Native Caribbean. KITLV Press, Leiden, the Netherlands. Whitehead, N. L. 1995. Wolves from the Sea: Readings in the Anthropology of the Native Caribbean. KITLV Press, Leiden, the Netherlands. Wilson, S. M. 1986. The Conquest of the Caribbean Chiefdoms: Sociopolitical Change on Prehispanic Hispaniola. Notes, unpublished Ph.D. dissertation. Department of Anthropology, University of Chicago. Wilson, S. M. 1993. The cultural mosaic of the indigenous Caribbean. Proceedings of the British Academy 81:37–66.

The Prehistory and Early History of the Caribbean

527

Wilson, S. M. 1990. Hispaniola: Caribbean Chiefdoms in the Age of Columbus. University of Alabama Press, Tuscaloosa. Wilson, S. M. 1997. The legacy of the indigenous people of the Caribbean. Pp. 206–213 in Wilson, S. M. (ed.). The Indigenous People of the Caribbean. University Press of Florida, Gainesville. Wilson, S. M. In preparation. The Prehistory of Nevis, a Small Island in the Lesser Antilles. Manuscript in preparation for submission to Yale University. Publications in Anthropology. Wilson, S. M., H. B. Iceland, and T. R. Hester. 1998. Preceramic connections between Yucatan and the Caribbean. Latin American Antiquity 9(4):342–352.

of Hunting on Jamaican 26 Impact Hutia (Geocapromys brownii) Populations: Evidence from Zooarchaeology and Hunter Surveys Laurie Wilkins Abstract — People have been linked with hutias of the family Capromyidae throughout human history in the Greater Antilles. Of 26 known species, 19 have been found in pre-Columbian archaeological deposits throughout the Greater Antilles, the Bahamas, and the Cayman Islands, and surviving species continue to be hunted today. Jamaican inland archaeological sites contain a greater number of terrestrial vertebrates, predominantly the endemic Jamaican hutia (Geocapromys brownii), in contrast to coastal sites that are dominated by marine species. Zooarchaeological remains of hutias at the Bellevue site, which represent 81.7% of the total terrestrial vertebrate sample, were examined to gain a better understanding of the population and insight into the hunting strategy of Amerindians who resided there 1100 years BP. Hutia bones and teeth were measured and compared to a sample of known-age, captive-bred individuals (N = 12). Mandibular tooth row (MTR) measurements provided a good correlation of size with age in the known-age sample, and was used to estimate the ages of 47 mandibles present in three strata of Bellevue site using regression analysis. The same measurement (MTR) of a captive population was used to model a growth curve using von Bertalanffy’s growth equation. Analysis of variance (ANOVA) showed no significant difference among three layers of the Bellevue site, all of which consisted of a greater percentage of subadults and young adults than either juveniles or mature adults. Overall, the study revealed no unusual growth or age profiles to suggest the Bellevue hutias differed from a natural free-living population. Neither was there any shift in the selection of animals by hunters over time, as reflected in three depositional layers. These results are considered in the context of what is known of Jamaican hutia biology and current hunting practices. The tolerance of natural populations to hunting pressure over time is evaluated through a hunter model developed for a specific population of hutias in an area of Jamaica where hunting prevails.

INTRODUCTION Zooarchaeological remains provide an understanding of the nature of the pre-Columbian exploitation of animal resources in the Caribbean (Wing, 1989). Such preserved faunal material often contributes information on animal community structure and population dynamics (Scudder, 1991; Steadman, 1995), and the age, growth, and development pattern of the organisms themselves (Jones et al., 1990). Furthermore, knowledge of biology, population structure, and tolerance to hunting pressure of a species may influence the interpretation of archaeological finds. The endemic hutia, Geocapromys brownii, also known as the Indian coney, is the only surviving terrestrial mammal on the island of Jamaica. A large nocturnal herbivore weighing up to 2,000 g, Jamaican hutias normally live in social family groups of two to six individuals, although as many as eight or even ten have been reported from the same burrow system (Anderson et al., 1983). As with the other species in the Greater Antilles, large size, herbivorous diet, communal habits, and lack of predator defenses have made Jamaican hutias vulnerable to hunters since humans arrived

0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

529

530

Biogeography of the West Indies: Patterns and Perspectives

N

AD

E NH

Negril R

iver

AR

BO

UR

S.

B

L

IL

EM

OU

NT AIN

S

S.

?

TO ET

LU

Kingston

WHITE MARL

kilometers

EB

MT

20

TH

BELLEVUE

OW CR

10

k lac

R.

HN JO

MT

HILLS

18º

0

DR YH

ED THE R

THE COCKPIT COUNTRY

I

H LP

DO

18º

? HELLSHIRE

AZ

Zooarchaeology sites

BR

RODNEY'S HOUSE

Midden deposits Current distribution 78º

77º

FIGURE 1 Location of Rodney’s House, White Marl, and Bellevue archaeological sites in relation to preColumbian distribution and current population centers.

on the island. The Jamaican hutia and the Bahamian hutia (G. ingrahami) are two surviving species of seven Geocapromys described from Cuba, the Cayman Islands, Jamaica, and the Bahamas (Varona and Arrendondo, 1979; Morgan, 1985, 1989a, 1989b, 1993, 1994a, 1994b; Morgan and Woods, 1986). The Swan Island hutia (G. thoractacus) became extinct as recently as the 1950s (Clough, 1976; Morgan, 1985). Geocapromys are part of the larger family of capromyid rodents endemic to the Caribbean. Fish and shellfish dominate coastal archaeological sites of Jamaica, as they do with most localities in the Caribbean (Wing and Reitz, 1982; Wilson, 1989). In contrast, the inland sites of Rodney’s House, White Marl, and Bellevue, located approximately 1 km, 5 km, and 10 km, respectively, from the south coast of Jamaica (Figure 1), show a greater dependence on terrestrial resources as distance from the coast increases. Land vertebrates comprise 35, 62, and 89% minimum number of individuals (MNI) of the samples, respectively. Hutias are the dominant species in all three sites with 18.7, 50.1, and 81.7% of the vertebrate sample (Wing, 1972, 1989, 1993; Scudder, 1991). The sites are pre-Columbian occupations that date from 1300 to 500 years BP (A.D. 700–1500), with Bellevue representing the shortest occupation period of 100 years (1000 to 1100 years BP) (Wing, 1993). The faunal assemblage of Bellevue includes inland species such as the Jamaican rice rat (Oryzomys antillarum) and the Jamaican iguana (Cyclura collei), in addition to abundant hutia (G. brownii). Together with the White Marl site, Bellevue illustrates an adaptation to the use of locally available terrestrial resources as humans moved inland from the coast (Wing, 1977; Scudder, 1991). The abundance of hutia remains suggests intensive exploitation, or perhaps even captive management of the species (Wing, 1989, 1993). The rich Bellevue sample provides an opportunity to examine the age structure of the hutia population present in the site and any changes in exploitation levels the site may have undergone over time. Through an analysis of skeletal material, this study seeks to determine if the age structure of hutias excavated from Bellevue, as defined by body size, is the same as would be expected to occur in a random sample from a natural population. Differences may reveal an effect that hunting pressure or perhaps captive management has had on size or age profile of the Bellevue population. One possibility to consider is that animals maintained in captivity might be removed from a captive group at an optimal size given a specific growth rate for the species. This growth rate is predictable from morphometric data taken from a modern captive-bred population. Much of what is known about this nocturnal herbivore has been learned from modern-day hunters. Few others would venture into the inhospitable regions where hutia still survive, namely,

Impact of Hunting on Jamaican Hutia (Geocapromys brownii) Populations

531

Hellshire Hills along the xeric south coast, the red hills of central St. Catherine’s Parrish, and the rugged woodlands of the John Crow Mountains. A hunter survey conducted during a previous study of hutias (Oliver and Wilkins, 1988; Wilkins, 2000) provides a background in which to evaluate the results of the zooarchaeology study.

THE BELLEVUE SITE Bellevue site is located in St. Andrew’s Parrish, approximately 10 km north of the coast at Kingston Harbor, in the Mannings Hill area. At an elevation of 412 m, its position was easily defensible and an excellent location for a pre-Columbian settlement. The village site covered approximately three quarters of an acre situated on slightly sloping, well-drained land with an estimated 15 acres of adjoining cultivable land. It is characterized by extensive pockets of deep, loose soil suitable for the cultivation of cassava, tobacco, cotton, and possibly maize (Medhurst and Clarke, 1976). Currently, there is no source of fresh water in the vicinity, but Medhurst (1977) mentions the presence of a recently dried-up pond and several springs within 2 km of the site. Howard Clarke and Colin Medhurst excavated Bellevue during 1974 and 1975 and Elizabeth Wing (1977) later analyzed faunal material. Early Amerindian subsistence strategies on the south coast of Jamaica have been considered in a comparison of Bellevue to White Marl and Rodney’s House, both in St. Catherine’s Parrish (Scudder, 1991).

METHODS Observations of living captive hutias and studies of museum specimens suggest a wide range of individual variation in size that is not related to sexual dimorphism but may be the result of delayed maturation due to a long growing period (Morgan, personal communication, 1985). Geocapromys species are long-lived, the Jamaican hutia (G. brownii) living an average of 10 years in captivity (Jersey Wildlife Zoo records), and the Bahamian hutia (G. ingrahamii) known to live at least 9 years in the wild (Clough, 1985; Jordan, 1989). In skeletons of known-age Jamaican hutias, limb epiphyses remain unfused and cranial sutures distinct for several years suggesting that animals continue to increase in size after sexual maturation. Likewise, ever-growing molars become longer and broader with age, possibly due to wear patterns as animals grow older. Cranial, dental, and skeletal measurements, along with degree of epiphyseal fusion, are anatomical features that can be used to assign individuals to relative age classes.

MEASUREMENTS

OF A

KNOWN-AGE SAMPLE

OF

HUTIAS

Cranial and postcranial measurements were taken on 12 known-age hutia skeletons in the collections of the Florida Museum of Natural History. The animals were raised in captivity at the Jersey Wildlife Zoo, Channel Islands, Great Britain. The sample included four juveniles (3 weeks to 7 months), four young adults (10 to 14 months), and six adults (3.5 to 8 years). The elements and measurements taken were as follows: FL: total femur length FLE: femur length from head to distal condyle (at the epiphyseal suture) FDW: femur minimum width of diaphysis FNW: minimum width of neck of the femur head FHD: diameter of femur head HL: humerus length HDW: humerus distal width

532

Biogeography of the West Indies: Patterns and Perspectives

HHD: humerus diameter of head HDP: humerus width at deltoid process HDD: humerus distal end of the deltoid process to distal end humerus MTR: mandibular tooth row MTP4: mandible thickness at P4 LP4: length of P4 at occlusal surface MDL: mandible diastema length IW: width of single lower incisor In preliminary regression analysis, only lower premolar (LP4) and mandibular tooth row (MTR) measures correlated well with age. To describe a growth pattern for hutias, MTR was fitted to von Bertalanffy’s growth function to calibrate a growth curve for the Jamaican hutia (von Bertalanffy, 1938), using the NLIN procedure of SAS (1985): MTR t = MTR ∞ [ 1 – e

–k ( t – t0 )

]

where t = time (age in years); MTRt = mandibular tooth row measurement at t; MTR ∞ = maximum asymptotic MTR; k = growth constant at t0 when MTR = 0.

ZOOARCHAEOLOGICAL SAMPLE Identical measurements to those above for captive individuals were taken for femora, humeri, mandibles, and individual teeth recovered from three levels of the Bellevue site and housed at the Florida Museum of Natural History Zooarchaeology Laboratory. The original sample consisted of 965 hutia skeletal elements, representing 84 minimum number of individuals (MNI), considering all paired elements and size set (Wing and Brown, 1979). Of these, 219 skeletal elements were measured for this analysis. Two methods were used to age the bones. In the first, skeletal elements were assigned to one of three general age classes that correspond to juvenile (<10 months), young adult (10 to 14 months), or adult (>14 months) by comparing their measurements to those of known-age animals (Table 1). The young adult class was intentionally kept narrow since it is the optimal time to harvest either from a captive or wild population. In the second method, specific ages were assigned to each complete mandible using the MTR measurement. Estimated age for each element was defined by the following allometric relationship (Peters, 1983:10–23; Reitz et al., 1985): Y = aXb

or

log Y = log a + b(log X)

where Y = the predicated age; a = Y intercept; X = MTR, the independent variable; and b = the slope. The Y-intercept (a) of a natural log–log plot is determined using the least-squares criterion to determine the best fit from empirical data of the known-age sample. The slope of the line (b) indicates proportional changes with size. Allometric estimates can be useful where the goal is to examine archaeological data as samples of a population. The ability to reconstruct the size range of animals in a midden may provide information about hunting pressure on the wild populations or may infer other ways in which the animals were being used (Reitz et al., 1985). To describe the variation present in the site, one-way analysis of variance (ANOVA) was used to compare two separate response variables (LP4 and MTR) among three strata. The samples for each variable were tested for normality (Shapiro–Wilk statistic) and homogeneity of variance (Levine statistic) prior to the ANOVA.

Impact of Hunting on Jamaican Hutia (Geocapromys brownii) Populations

533

TABLE 1 Age Class Estimate Based on Range of Skeletal Measurements Taken for Captive-Bred, Known-Age Geocapromys brownii Individuals Femura Age Classb

FL1

FLE2

Juvenile Young adult Adult

<55.0 55.0–74.0 ≥75.0

<49.0 49.0–68.9 ≥69.0

FDW3 <5.2 5.2–6.8 ≥6.9

Humerusc 1

Juvenile Young adult Adult

HL <39.9 40.0–51.0 ≥52.0

HDD2 <20.3 20.4–26.5 ≥26.6

HDP3 <4.0 4.1–4.9 ≥5.0

Mandibled 1

Juvenile Young adult Adult

LP4 <3.8 3.8–5.1 ≥5.2

MTR2 <12.0 12.0–17.5 ≥17.6

IW3 <2.2 2.2–2.8 ≥2.9

Note: Skeletal measurements in mm. 1,2,3 refer to ranked measurements in order of goodness of fit in comparison with known-age captive animals determined by visual inspection. a Femur measurements are FL = total femur length, FLE = femur length to epiphyses, FDW = femur minimum width diaphases. b Age classes are juvenile (<10 months), young adult (10–14 months), and adult (>14 months). c Humerus measurements are HL = humerus total length, HDD = distal of deltoid process to distal end of humerus, HDP = width at deltoid process. d Dentary measurements are MTR = mandibular tooth row, LP = 4 length of fourth premolar, IW = incisor width.

HUNTER SURVEY Jamaican hutia (coney) hunters were surveyed during field studies conducted in 1987–1988. Although hunters throughout the island were questioned (Oliver and Wilkins, 1988), only seven current or previous hunters resided in the John Crow Mountains, an area with a strongly developed hunting tradition. They were asked about the method of capture, characteristics of the catch (number captured, sex, and age), size of catchment area, as well as the habits and social organization of the hutia (Wilkins, 2000). In addition, hunters were queried about the status of the animals and whether they perceived an increase or decrease in the population. A model was developed to evaluate the effects of hunting when a specific population of hutias, a specific population of hunters, and a specific area are defined. Very little ecological data exist for wild living hutias, so several population parameters were estimated, including mortality and population growth, some based on studies of the closely related Bahamian species G. ingrahami (Table 2).

534

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 Population Parameters for Two Extant Species of Geocapromys Measurement

Value

Ref.

Geocapromys brownii — Jamaican hutia X weight M (N = 15)a 1.71 kg Wilkins, unpublished data X weight F (N = 11) 1.26 kg Wilkins, unpublished data X weight F, M 1.50 kg Wilkins, unpublished data 1.5 Oliver et al., 1987 Litter sizeb No. litters/yr 2 Oliver et al., 1987 First age of reproduction M, Fc 1 yr JWPT Zoo Records; Oliver et al., 1987 Last age of reproductiond M, F (N = 6) 9 yrs JWPT Zoo Records 8–12 yrs JWPT Zoo Records Longevity (N = 8)e Density (theoretical) 900/km2 (9/ha) Robinson and Redford, 1986 Population growth/ 1.98; 1.44 individual/yrf Geocapromys ingrahami — Bahamian hutia X weight M, F (N = 98) 0.70 kg Howe and Clough, 1971; Clough, 1972 Robinson and Redford, 1986 Density (theoretical) 5000/km2 Density (Little Wax Cay)g >5000/km2 (65/ha) Jordan, 1989 Density (East Plana Cay) 2586 km2 (26/ha) Clough, 1969 a

Captive animals slated for reintroduction were weighed before release. Additional weights obtained from three wild caught individuals included. b Based on 61 litters of 95 young born at Jersey Wildlife Preservation Trust; 34 singles, 10 twins, and 7 triplets. Hunters reported captures of 1 to 2 infants in family group. c Oliver estimates M at 12 months and F at 9 months. d One M fathered offspring at 10+ yrs; no other parent was older than 9 yrs. e Single M was wild caught as an adult in 1972 and was reintroduced to Jamaica in 1987. Oldest living animals in captivity are 9+ yrs. f λ = N + 1/N (various authors). λ = 1.98 is based on reproductive potential of all adult t t breeding females in population; λ = 1.44 describes the situation when only half the breedingage female population reproduces. g Jordan (personnal communication) believes this population has not stabilized as yet.

Density for the Jamaican hutia was estimated by using the herbivore–grazer diet classification of Robinson and Redford (1986). Average weight, litter sizes, and number of litters/year, longevity, and first and last age of reproduction are based on information from captive populations, although weights of three wild captured animals were included. For purposes of the model, the following assumptions were made (l) an annual mortality of 10%, such that only 35% of any cohort would survive to age 10; and (2) a stable age distribution, so that only 80% of the population would be of breeding age, the other 20% representing individuals that would be too young (<1 year) or too old (>9 years) to reproduce. The 10% mortality estimate includes death from any natural cause, such as accident, disease, or even occasional predation by the Jamaican barn owl (Tyto alba) or the Jamaican boa (Epicrates subflavus), which might be natural predators of young hutias. This mortality estimate does not include predation by humans or dogs since the objective of this study is to isolate human predation to evaluate its effect on populations. In developing the habitat/hunter model, several values were varied to produce a broader range of options to explore the effect of hunting in the John Crow Mountains: (1) three values of density — carrying capacity, one-half carrying capacity, and one-fourth carrying capacity; (2) two values of available habitat — the

Impact of Hunting on Jamaican Hutia (Geocapromys brownii) Populations

535

Mandibular Tooth Row (mm)

Von Bertalanffy Growth Curve 22 ?

20 18 16 14 12

Predicted

Observed

5

7

10 0

1

2

3

4

6

8

9

Age (years)

FIGURE 2 Observed values and predicted growth rate of Jamaican hutia (Geocapromys brownii) based on von Bertalanffy’s growth equation Lt = L∞ [1 – e–K(t – t 0)] derived from mandibular tooth row measurement of known-age, captive-bred individuals. The fit of the observed to predicted curves was high (r2 = 0.968, P = 0.001). Asymptote of MTR = 19.73 mm.

estimate of 76.5 km2 available forested land in the higher peaks of the John Crow Mountains (Kelly, 1986), and that amount doubled to include lowland forest that was present at some time in the past; (3) two rates of population growth (λ = rate of growth per individual per year) are included — λ = 1.98 describes the situation in which all adult females are producing the maximum number of offspring each year (number of breeding females × 1.5 litter size × 2 litters/year) and λ = 1.44 when only one half of the breeding-age females are reproductively active.

RESULTS KNOWN-AGE SAMPLE The relationship of MTR to age was modeled according to the von Bertalanffy growth function. The fit of the observed data to the predicted curve was high (r2 = 0.968, P = 0.001), primarily because the sample was small. Growth is rapid for the first year and then slows, but MTR continues to increase in size until sometime between 2 and 3 years of age, as shown in the von Bertalanffy growth curve (Figure 2). The function estimated the asymptote of MTR at 19.73 mm, k = growth constant of +1.50, t0 = 0.4664). There was a gap in the known-age sample between 14 months and 3.5 years that obscures the exact age at which the asymptote is reached and growth ceases. Epiphyseal sutures were visible but beginning to remodel in a 3.5-year-old captive female indicating no further growth potential.

ZOOARCHAEOLOGICAL SAMPLE The results of the age frequency distribution of femora, humeri, and mandible based on visual comparison with known-age individuals are somewhat ambiguous (Table 3). Data for mandibles indicate more young adults (N = 51, 70.8%) than there are mature adults (N = 19, 26.4%) or juveniles (N = 2, 2.8%). The results are similar for humeri with 52 (72.2%) young adults compared with one mature adult (1.4%) and 19 (26.4%) juveniles. However, for the femora, the number of adults is higher (N = 34, 48%) than young adults (N = 31, 43%) and considerably higher than the juveniles (N = 6, 8.4%). In general, however, young animals (subadults and young adults) dominate

536

Biogeography of the West Indies: Patterns and Perspectives

TABLE 3 Frequency Distribution of Aged Skeletal Elements of Jamaican hutias (Geocapromys brownii ) from Combined Levels of Bellevue Site Age Classesa Juvenile

Young Adult

Adult

Sample

n

(%)

n

(%)

n

(%)

Mandible Femur Humerus

2 6 19

(2.8) (8.4) (26.4)

51 31 52

(70.8) (43.7) (72.2)

19 34 1

(26.4) (47.9) (1.4)

Total 72 71 72

Note: Age estimates are based on size and growth patterns observed in known-age zoo animals (see Table 1). a

Age classes = juvenile (<10 months), young adult (10–14 months), adult (>14 months).

TABLE 4 Average Predicted Age of Individuals by Bellevue Site Level Based on MTR Measure Level

n

Mean Age (years)

Standard Deviation

Min.

Max.

1 2 3 All levels combined

6 33 8 47

1.301 1.196 1.545 1.270

0.68 0.74 0.82 0.74

0.60 0.44 0.44 0.44

2.41 4.01 3.12 4.01

Note: No significant difference between three levels (one-way ANOVA).

the samples, followed by mature adults, and last the juveniles, and the number of individuals when all skeletal elements are considered remained constant over time. The original MTR and LP4 variables satisfied assumptions of normality and homogeneity of variances. Separate one-way ANOVAs detected no significant difference among three strata in either response variable. An estimated age was assigned to mandibles in each level of the site based on MTR measurement, which provided a good correlation in regression analysis (r2 = 0.95, P = 0.05). Young animals dominate all three levels), corresponding to the distribution of ages determined by visual inspection. The mean predicted age is similar for Levels I and II, at 1.301 years (approximately 13 months) and 1.196 years (14.3 months), respectively. Level III shows the mean age of 1.54 (18 months) to be slightly older than that of the other two levels, but it was not significant (Table 4). The age distribution for each level is shown by the box plots (Figure 3). Since there were no differences among strata shown by the ANOVA, the predicated age data were pooled. The frequency distribution of ages shows animals from approximately 0.56 years (6.7 months) to 1.6 years (19.2 months) dominate the site (Figure 4). The minimum age represented is 0.44 years (5.28 months) (Table 4). Also, recall that animals could only be assigned an age up to the predicted asymptote which, given the absence of some data points, may be anywhere from 18 months to 3 years, based on the known-age samples and the growth curve. Once growth ceases, animals may be referred to as mature adults of unknown age.

Impact of Hunting on Jamaican Hutia (Geocapromys brownii) Populations

537

FIGURE 3 Box and whisker plots of three levels of Bellevue for age (as estimated from MTR). The dark line is median, box bounds are the 50% interquartile range, and the whiskers show the range of measurements excluding outliers (37 and 38).

FIGURE 4 Frequency distribution of predicted age sample (from MTR) when three strata of Bellevue site are pooled (n = 47). Age is shown in years. Note that growth ceases somewhere between 2 and 3 years of age. All estimates after age 2 may be considered adult. The age-frequency distribution is similar to that of a survivorship curve for a general mammal with a life span of 10 years.

538

Biogeography of the West Indies: Patterns and Perspectives

TABLE 5 Hunting Profile, John Crow Mountains, Jamaica I

Assumption Completely forested Partially forestedd Partially forested Partially forested Completely forested 1/2 breeding females Partially forested 1/2 breeding females Partially forested 1/2 breeding females a b c d

II

III

IV

V

VI

λ

First Annual Production — 10% Mortality

VII Max. Allowable Capture Animals/yra

VIII Max. No. of Hunters HR 312 Animals/yrb

Suitable Habitat (km2)

Density/ km2

Initial Population Size

153.0 c 76.5 76.5 76.5

900 900 450 225

137,700 68,850 34,425 17,212

1.98 1.98 1.98 1.98

245,382 122,691 61,345 30,672

107,682 53,844 26,920 13,460

345 172 86 43

153.0

900

137,700

1.44

178,460

40,760

130

76.5

900

68,850

1.44

89,230

30,294

97

76.5

450

34,425

1.44

49,572

10,190

32

Maximum number of animals that could be captured without reducing initial population numbers. Maximum number of hunters taking 312 animals per year to maintain population numbers. Double estimated forested area to include lowland forests that have been eliminated. Kelly, 1987.

HUNTER SURVEY The density estimate for G. brownii extrapolated from Robinson and Redford (1986) using the herbivore–grazer diet classification and mean weight of 1.49 kg is 900 animals/km2, assumed to be at carrying capacity. To test its reliability, the same methodology was used to generate a density estimate for the Bahamian hutias G. ingrahami, for which published densities do exist. The two species are similar in diet, ecology, behavior, and reproductive potential (Table 2). The estimated density using the same method for G. ingrahami, adjusting for mean average weight is approximately 5000/km2. Reported densities for this species on two different islands are >5000/km2 on Little Wax Cay (Jordan, 1989) and 2586/km2 on East Plana Cay (Clough, 1969, 1972). The higherdensity estimate is on an island with lush forage to which animals were reintroduced, whereas the East Plana Cay population is at carrying capacity and limited by poor-quality forage (Jordan, 1989). Using the same logic, a pre-Columbian population of Jamaican hutias at carrying capacity might be half that predicted by the model, so a density of 450 animals/km2 was considered in the hunting profile along with other variables. The hunting profile for the John Crow Mountains is based on various environmental parameters (Table 5). Column VII represents the capture number below which populations would decline if taken by hunters in each situation. Column VIII specifies the upper limit of the number of hunters that the population will tolerate in any one year. The values are based on an actual harvest rate of 6 animals/week or 312 animals/year, reported by one hunter. An increase in the number of animals captured per hunter or a greater number of hunters would result in a population decline in that year. Depending on which variables were used, Column VIII of the hunter profile illustrates that anywhere from a minimum of 32 to a maximum of 345 hunters operating within the John Crow Mountains could decimate local populations of hutias, assuming that healthy populations existed.

DISCUSSION The Bellevue site contains the highest frequency of hutia (G. brownii) remains found thus far on the island of Jamaica. This abundance, along with the presence of the Jamaican iguana (Cyclura collei)

Impact of Hunting on Jamaican Hutia (Geocapromys brownii) Populations

539

and other terrestrial species, suggests harvest by Amerindian hunters who are depending on a localized fauna (Scudder, 1991). Yet a constant age structure and frequency of hutia occurrence over time, as reflected in three horizons of the site, implies a stable population at Bellevue, one that is not being overexploited. It is possible that pre-Columbian populations of hutias existed in high densities, and the rugged limestone karst environment of the south coast where hutias survive today may have supported this high-density population. Wing (1989, 1993) suggests this level of exploitation could also be an indication of some degree of captive management. However, captive exploitation of naturally occurring species is normally difficult to detect in measurements of fragmentary archaeological remains (Wing, 1989). Given the short occupancy time of 100 years, there might not be any selection process that would change the nature of the deposition among strata.

CAPTIVE BREEDING ARGUMENTS Among the arguments that would favor captive management of the hutia by Amerindians are (1) the transport and apparent captivity of other animals throughout the Caribbean, including Isolobodon portoricensis, another hutia of the family Capromyidae, endemic to Hispaniola but transported to Puerto Rico and the Virgin Islands (Reitz, 1985; Wing, unpublished manuscript, 1985; Quitmyer and Kozuch, 1996) and (2) the general paucity of exploitable terrestrial resources in Jamaica. The possible decimation of natural populations of animals after humans migrated to the island might be a further incentive to manage a captive stock. There are equally strong arguments against the idea of captive management. The first and most compelling is the low reproductive potential of G. brownii. The combination of a slow growth rate, long gestation period, small average litter size of 1.5, and an annual recruitment of only 1.98 individuals per mating pair per year (Table 2) would require a relatively large colony to be maintained in order for it to be productive. Estimated recruitment of 1.98 individuals/year is based on the reproductive potential of all adult breeding females in the population, considered unlikely because of regulatory mechanisms of density dependent populations. We might predict a lower recruitment in natural populations of Jamaican hutia than in captive populations. The social organization of a long-lived species, with overlapping generations and extended families, would further reduce population growth, because not all females of breeding age would be reproductively active. As an example of this, Jordan (1989) estimated recruitment for the Bahamian hutia population on Little Wax Cay at 1.68 given a 20% mortality rate in what for hutias would be considered optimal habitat. One could hypothesize that a managed population of hutias at Bellevue would reflect a management strategy in which animals would be culled from a captive herd at the time they reach a moderate size for the shortest growing period. Accordingly, von Bertalanffy’s growth function would estimate that age to be 8 to 12 months old. The assemblage of hutias at Bellevue does show a predominance of young animals, but ages ranging from 6.7 months to 20 months were common and older adults (of unknown age) were also present. One would also expect to see large site-level differences in the age structure if there had been a shift in procurement patterns from wild capture to captive breeding, perhaps with an intervening period of fewer animals, but none was found. If Amerindians did attempt to manage hutias for a more reliable resource base, they were probably not willing or able to maintain strict resource management guidelines and the level of care required to bring enough animals through 9 months of feeding and maintenance. There might also be a decline in the (captive) population consistent with problems in management that would include overcrowding, disease, and inadequate food (Elizabeth Wing, personal communication). When all skeletal elements were combined in each level, there was a consistent number of individuals represented (n = 71 or 72). There were no shifts in the composition of the Bellevue hutia population through time. Neither the frequency of species occurrence nor the age structure of the population changed significantly during the 100-year occupation of the site. This leaves open other biological or environmental explanations for the stable age structure of this assemblage over time.

540

Biogeography of the West Indies: Patterns and Perspectives

AGE-FREQUENCY DISTRIBUTION The age structure of the hutias from Bellevue could and probably does represent a natural population. Unfortunately, there is no contemporary age profile available for comparison. A theoretical mammalian age-frequency profile assumes the probability of death remains constant with age. Therefore, it consists of a stepwise distribution of ages with the greatest number being juveniles, followed by subadults and young adults, each successive age class represented by fewer and fewer individuals (Begon et al., 1990:138). The pooled age profile generated for the Bellevue population differs from the expected survivor curve for a general mammal in the complete absence of animals younger than 0.44 years and the older adults whose ages could not be estimated. The latter may be among those larger (older) animals at the low end of the distribution (Figure 4). An attritional age-frequency distribution described for fossil sites is the result of selective killing of the most vulnerable individuals of a population (Voorhies, 1969). Often these are the very young or very old individuals. The death assemblage of Bellevue hutias over the 100-year occupied period of the site shows all age classes being captured except for the very young. Current hunting strategies using dogs and pot traps do not target any particular age group of animals (Oliver, 1982; Oliver and Wilkins, 1988; Wilkins, 2001). Hunters reported all ages and both sexes are captured with dogs. Similarly, traps set at burrows will capture entire family groups. In large burrow systems these would consist of overlapping generations and animals consisting of a range of sizes. Working with live captive and natural populations of Bahamian hutias, Jordan (1989) was able to model the growth rate of Bahamian hutias up to 1 year using incisor width. He trapped a greater number of subadults and young adults, both male and female in the age group of 7 to 10 months, than either mature adults or juveniles, but found fewer mature females than expected. He accounted for the uneven sex ratio and fewer very young animals by suggesting that mother and infant remained in or close to home dens for longer periods of time. The absence of very young animals at Bellevue may be due to a combination of preservational factors and fewer captures of infants and very young animals by hunters.

HIGH-DENSITY POPULATIONS Hutias reach extremely high densities in the Bahamas. In less than 20 years Bahamian hutias reintroduced to Little Wax Cay in the 1970s reached a density of 65/ha (> 5000/km2), in the absence of competition or any human or exotic animal predation (Jordan, 1989). Clough (1969) estimated a density of 26 animals/ha (2586/km2) for Bahamian hutias on East Plana Cay, the location of a relictual population of hutias, presumably at carrying capacity. Hutias on East Plana Cay were so numerous and so docile that they could be caught by hand (Clough, personal observation, 1972). The population of Bahamian hutias on East Plana Cay is a good example of a natural population with no history of exploitation or any introduced predators. Likewise, early historic accounts reported the now-extinct Little Swan Island hutia (G. thoracatus) to be extremely abundant. Lowe (1911:114) “… saw at least a dozen others (than those he captured) running about and bolting into big crevasses with which the island is seamed.” Also, Lord Moyne (1938: 82) states “… four men from the western island with neither nets nor traps caught twelve alive for us in about two hours” (cited in Morgan, 1985). Unfortunately, density estimates for the Jamaican hutia do not exist but have been estimated from 450/km2 to 900/km2 at carrying capacity, which might describe a population early in the history of human presence on Jamaica. If Jamaican hutias were as numerous as the model predicts and as their conspecifics in the Bahamas and Swan Islands, they might be able to withstand predation in numbers that would explain the deposition at the Bellevue site. They have survived perhaps greater hunting pressure and severely degraded environments since then with the European expansion that followed (Crosby, 1986).

Impact of Hunting on Jamaican Hutia (Geocapromys brownii) Populations

ISLAND SIZE

AND

541

STRUCTURAL COMPLEXITY

To explore why one island species is more vulnerable to extinction than another, it may be necessary to make a distinction between relatively small vulnerable islands such as Little Swan Island and the islands of the Bahamas, and Jamaica, which is large, rugged, and structurally complex. Hutias are not uniformly distributed in any given region of the Jamaica, but have specific microhabitat requirements, at least today. They are dependent upon karst landscape features that afford protection. No doubt their presence in these limestone fortresses is the reason for their continued survival in certain areas of the island, even in the face of sustained hunting pressure. Present-day hunters stated that animals were absent from certain areas of Jamaica because there were “no good coney holes.” There might also be other microhabitat features that would contribute to lack of a uniform distribution. Again, Jordan (1989) showed that Bahamian hutias were more numerous in areas near fresh water and the presence of preferred browse. Today animals persist in small pockets where optimal limestone features and suitable habitat exists. Where hunting pressure has subsided, in the highly karstified regions of Worthy Park and Coco Ree in central St. Catherine’s Parrish, animals are increasing in number and are becoming a pest species on local gardens (Wilkins, personal observation). Thus, despite centuries of exploitation, G. brownii have survived on Jamaica in those areas that afford them protection from hunters and dogs.

SUSTAINABLE HUNTING Hutias have been hunted in Jamaica continuously since humans arrived on that island. More widely distributed in the past, today they are found in only two areas where their survival is not immediately threatened, namely, Worthy Park and Coco Ree in central St. Catherine’s Parrish and John Crow Mountains in the eastern part of the island (Oliver, 1982; Oliver and Wilkins, 1988). The impact that hunting has had on hutias is written in the record of local extinctions of the species throughout the island. There is no way to know how many hunters actively hunted in any given community, or how many animals they regularly captured, either now or in the distant past at Bellevue. Hunters talk about the days when 20 hunters in each community would be involved in subsistence hunting. The profile (Table 5) provides several options to explore. With the exception of Assumption I, with 345 men hunting, all other scenarios would be possible and even reasonable. The figures in Column VIII are the maximum number of hunters allowable in order to maintain hutia numbers. As an example, using scenario 3, partially forested, with fewer than 225 conies/km2 even with maximum population growth, if 86 hunters were to take 312 animals/year, that could decimate the populations. This would explain the absence of hutia populations today in areas where they once existed, even where apparent suitable habitat remains, such as the Cockpit Country.

THEORETICAL CONSTRAINTS Unfortunately, direct archaeological tests of theoretical predictions are often constrained by both preservation biases and the limits of inferential techniques (W. Keegan, 1992). Our sample of known-age animals was small and therefore does not describe the overall range of size variability. Nor is it possible to identify sex, nutrition, or health parameters from archaeological bones. We also assume a relatively stable environment from one location to another. It is clear from descriptions of Bahamian hutias on two different islands that density-dependent factors such as competition may limit resources and can affect the growth and development of free-ranging populations (Jordan, 1989). The description of the physical site of Bellevue does not support a theory of high human population density, with perhaps no more than 40 to 60 individuals (W. Keegan, personal communication). However, the presence of contemporaneous pre-Columbian human communities at White

542

Biogeography of the West Indies: Patterns and Perspectives

Marl and Rodney’s House, and perhaps other yet undiscovered communities, would increase those numbers. Yet it seems unlikely that hunting pressure such as described by the profile would exist. Even a minimal number of hunters (n = 32) would not have been present. The hunter model is based on a different habitat and hutia population than Bellevue, but the hutia density that the two habitats can support may be similar. Early surveys and hunter accounts from Hellshire Hills, not far from the three archaeological sites under discussion, report high densities of hutia based on hunting success and pellet counts (Oliver, 1982). Although there is no indication from the depositional assemblage that hutia populations at Bellevue were severely depleted by Amerindians, it might be prudent to examine another scenario. As stated before, a consistent age distribution and frequency of occurrence imply a stable population over time. It is possible for the age structure to remain the same, even with nonsustainable exploitation, at least in the short term. Using either dogs or traps, hunting success would not be biased toward one age group or another, but would reflect the frequency of their natural occurrence, whether the animals were in the den or out foraging. Hunters today report that they catch all ages of hutia when they hunt, although exact percentages are not available. Other variables that would contribute to this view are a more intense hunting effort or hunting effort over a larger or more distant region. Preservational bias could obsure the actual situation. Examination of the other archaeological sites of longer occupation, namely, Rodney House (A.D. 700–1000) and White Marl (A.D. 800–1500), reveals that patterns of faunal use fluctuate over time. At Rodney House, there is a general shift toward marine organisms with concomitant decrease in abundance of terrestrial and esturine crabs and hutias over time. Both crabs and hutias recover in later levels, although presence of crabs remains low compared to their original high numbers in earlier levels (Scudder, 1991). Likewise, White Marl exhibits a dramatic shift from land to marine species, although a brief examination of hutia remains at White Marl, as at Bellevue, do not show a dramatic shift in the age classes. These resource shifts may indicate overexploitation of terrestrial species (Scudder, 1991). One indication of this is that land crabs, being less resilient than hutias, do not recover once their populations decline, whereas hutias are able to recover or recolonize, given the nature of the habitat utilization in the predominantly karst terrain.

OPTIMAL FORAGING Many archaeological samples document the use of faunal assemblages closest to the habitation site (Wing, 1989). A comparison of Rodney’s House with the White Marl and Bellevue sites shows a clear continuum of coastal to inland localized adaptation, with Rodney’s House (marine edge) yielding the highest proportion of marine fish, and Bellevue (inland hills) contrasting with a larger proportion of terrestrial species. White Marl is intermediate in its location and in the ratio of terrestrial/marine taxa (Scudder, 1991). The increased frequency of hutias and other terrestrial resources in sites successively farther removed from the resources of the sea reflects a dependence on local resources, particularly since these areas until very recently supported good populations of hutias (Oliver, 1982; Oliver and Wilkins, 1988). All three sites were in proximity of fertile land, fresh water, and there is evidence of horticultural activity (Silverberg et al., 1972; Scudder, 1991). In prehistoric hunting communities in the tropics, animals regularly attracted to cultivated crops were hunted in house gardens and nearby fields, thereby concentrating the supply of animal proteins from herbivorous species (Linares, 1976). This scenario accounts for incidental hutia kills today even where large-scale hunting has subsided. The low recruitment rate of the Jamaican hutia would imply that it would be neither practical nor productive to maintain large numbers in captivity. Rather, the combination of high density, rugged landscape, and horticulture that would attract browsing hutias to nearby gardens provides an explanation for the high frequencies of individuals observed at Bellevue and perhaps other south coast Jamaican archaeological sites.

Impact of Hunting on Jamaican Hutia (Geocapromys brownii) Populations

543

ACKNOWLEDGMENTS Elizabeth Wing, Florida Museum of Natural History (FLMNH) Zooarchaeology Collection, provided the inspiration and the material for the zooarchaeological study. Irvy Quitmyer, Timothy Young, and Fahong Yu, all of FLMNH, Pamela Schofield of University of Southern Mississippi, and Markus Tellkamp, University of Florida, Zoology Department, contributed their knowledge of methodology and statistics. As always, Kevin Jordan of Daytona Beach Community College shared his knowlege and lent his support to my various hutia projects. Irvy Quitmyer provided invaluable assistance in the preparation of the manuscript, as did Sylvia Scudder, who reviewed an earlier version. The work in Jamaica could not have been accomplished without the friendship and support of Pam and Jamie Williams and Mark and Lowayne Jefferson, and the hospitality of Michael and Barbara Williams and Kenny Benjamin. William Oliver, then of Jersey Wildlife Preservation Trust, accompanied me in the field and shared his knowledge and resources of hunters and their territories. A very special thanks to Ann and Robert Sutton and Karen Harvey of the Jamaica Conservation and Development Trust, and Eric Garroway and Peter Vogel of the University of West Indies who encouraged me to review the conservation status of the Jamaican hutia. I am particularly indebted to Owen and Mikey Slue and Edwin Duffas, who were my knowledgeable guides and companions. Among the many other hunters and guides who shared their knowledge of hutias and Jamaica’s woodlands, I thank Leopold Shelton, Alvin Comrie, Aston Faulkner, Leroy Henry, David Malcolm, Sharon McCalpin, Vincent Mendez, Alvin Morgan, and Orlando Wilson. Charles Woods of FLMNH facilitated my involvement in Jamaica, an experience for which I will always be grateful. John Eisenberg encouraged me to see the project through. Jersey Wildlife Preservation Trust, Wildlife Preservation Trust International, and the Department of Natural Sciences, FLMNH provided the necessary financial support.

LITERATURE CITED Anderson, S., C. A. Woods, G. S. Morgan, and W. L. R. Oliver. 1983. Geocapromys brownii. Mammalian Species 201:1–5. Begon, M., J. L. Harper, and C. R. Townsend. 1990. Ecology, Individuals. Populations and Communities, 2nd ed. Blackwell Scientific Publications, Boston. Clough, G. 1969. The Bahaman Hutia: a rodent refound. Oryx 10 (2):106–108. Clough, G. 1972. Current status of two endangered Caribbean rodents. Biological Conservation 10:43–47. Clough, G. 1976. Biology of the Bahaman Hutia, Geocapromys ingrahami. Journal of Mammalogy 53:807–823. Clough, G. 1985. A rather remarkable rodent. Animal Kingdom 88(3):41–45. Clough, G. C. and R. J. Howe. 1971. The Bahamian hutia Geocapromys ingrahami in captivity. International Zoological Yearbook 11:89.93. Crosby, A. W. 1986. Ecological Imoerialism: The Biological Expansion of Europe, 900–1900. Cambridge University Press, Cambridge. Fernandez de Oviedo y Valdes, G. 1555. Historia general y natural de las Indias. Vols. 117–121 in Perez de Tudela Bueso, Juan (ed.). Biblioteca de autores españoles desde la formacion del lenguaje hasta nuestros dias. Ediciones Atlas, Madrid, 1959. Jones, D. S., I. R. Quitmyer, W. S. Arnold, and D. C. Marelli. 1990. Annual shell banding, age, and growth rate of hard clams (Mercenaria spp.) from Florida. Journal of Shellfish Research 9(1):215–225. Jordan, K. 1989a. A Summary of Conservation Trends in the Bahamas. Pp. 839–844 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present and Future. Sandhill Crane Press, Gainesville, Florida. Jordan, K. 1989b. An Ecology of the Bahamian Hutia (Geocapromys ingrahami). Unpublished Ph.D. dissertation, Department of Zoology, University of Florida, Gainesville. Jordan, K., L. Wilkins, G. Morgan, and R. Franz. 1990. A survey of the Hutias, herpetofauna, and fossil vertebrates of the Exuma Cays Land and Sea Park. Report to the Bahamas National Trust. Keegan, W. F. 1989. Creating the Guanahatabey (Ciboney): the modern genesis of an extinct culture. Antiquity 63:373–379.

544

Biogeography of the West Indies: Patterns and Perspectives

Keegan, W. F. 1992. On the Edge of the New World: The People Who Discovered Columbus. University of Florida Press, Gainesville. Kelly, D. L. 1986. Native Forest on West Limestone in North-eastern Jamaica. Pp. 31–42 in Thompson, D. A., P. K. Bretting, and M. Humphreys (eds.). Forests of Jamaica. Papers from the Caribbean Regional Seminar on Forests of Jamaica, held in Kingston, Jamaica, 1983. Jamaican Society of Scientists and Technologists. Linares, O. F. 1976. “Garden Hunting” in the American tropics. Human Ecology 4:331–349. Medhurst, C. W. 1977. The Bellevue Site, K-13, analysis of mollusc shell. Archaeology — Jamaica 77(1):8–9. Medhurst, C. W. and H. Clarke. 1976. The Bellevue Site. Archaeology — Jamaica 76(3–4):3–23. Morgan, G. S. 1985. Taxonomic status and relationships of the Swan Island Hutia, Geocapromys thoracatus (Mammalia: Rodentia: Capromyidae), and the Zoogeography of the Swan Islands Vertebrate Fauna. Proceedings of the Biological Society of Washington 98:29–46. Morgan, G. S. 1989a. Fossil Chiroptera and Rodentia from the Bahamas, and the historical biogeography of the Bahamian mammal fauna. Pp. 685–740 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Morgan, G. S. 1989b. Geocapromys thoracatus — mammalian species. American Society of Mammalogists 341:1–5. Morgan, G. S. 1993. Quaternary land vertebrates of Jamaica. Pp. 417–442 in Wright, R. M. and E. Robinson (eds.). Biostratigraphy of Jamaica. Geological Society of America Memoir 182, Boulder, Colorado. Morgan, G. S. 1994a. Mammals of the Cayman Islands. Pp. 435–463 in Brunt, M. A. and J. E. Davies (eds.). The Cayman Islands: Natural History and Biogeography. Kluwer Academic Publishers, Amsterdam, the Netherlands. Morgan, G. S. 1994b. Late Quaternary fossil vertebrates from the Cayman Islands. Pp. 465–508 in Brunt, M. A. and J. E. Davies (eds.). The Cayman Islands: Natural History and Biogeography. Kluwer Academic Publishers, Amsterdam, the Netherlands. Morgan, G. S. and C. A. Woods. 1986. Extinction and the zoogeography of West Indian land mammals. Biological Journal of the Linnean Society 28:167–203. Oliver, W. L. R. 1982. The coney and the yellow snake. Dodo, Journal of Jersey Wildlife Preservation Trust 19:6–33. Oliver, W. L. R. and L. Wilkins. 1988. Current status of the Jamaican hutia Geocapromys brownii: a preliminary report on the 1988 field survey. Dodo, Journal of Jersey Wildlife Preservation Trust 25:7–15. Olson, S. L. 1982. Fossil vertebrates from the Bahamas. Smithsonian Contribution to Paleobiology 4:1–60. Peters, R. H. 1983. The Ecological Implications of Body Size. Cambridge University Press, New York. Quitmyer, I. R. and L. Kozuch. 1996. Phase II Zooarchaeology at Finca Valencia (NCS-1) and Site NCS-4, northwest Puerto Rico. Report prepared for LAW Caribe, San Juan, Puerto Rico. Reitz, E. J. 1985. Appendix C: Vertebrate fauna from El Bronce archaeological site, Puerto Rico. Pp. C1–C20 in Robinson, L. S., E. R. Lundberg, and J. B. Walker. El Bronce final report phase 2, Prepared for the U.S. Army Corps of Engineers, Jacksonville District by Archaeological Services, Inc., Fort Myers, Florida. Reitz, E. J. and E. S. Wing. 1999. Zooarchaeology. Cambridge University Press, Cambridge. Reitz, E. J., I. R. Quitmyer, H. S. Hale, S. J. Scudder, and E. S. Wing. 1985. Application of allometry to zooarchaeology. American Antiquity 52(2):304–317. Rimoli, R. O. 1982. Estudio comparativo de la dieta en sitios precolombinos de la Española. Zooarqueologia, Boletin del Museo del Hombre Dominicano 10(17):141–145. Robinson, J. G. and K. H. Redford. 1986. Body size, diet, and population density of Neotropical forest mammals. The American Naturalist 128:665–680. SAS Institute, Inc. 1985. SAS User’s Guide: Statistics. SAS Institute, Inc., Cary, North Carolina. Scudder, S. J. 1991. Early Arawak subsistence strategies on the South Coast of Jamaica. Pp. 297–312 in Ayubi, E. N. and J. B. Haviser (eds.). Proceedings of 13th International Congress for Caribbean Archaeology. Report of Archaeological Anthropological Institute of the Netherlands Antilles, No. 9. Silverberg, J. and R. L. Vanderwall. 1972. The White Marl Site in Jamaica. Report of the 1964 Robert R. Howard Excavation. Department of Anthropology, University of Wisconsin, Milwaukee. Steadman, D. W. 1995. Prehistoric extinctions of Pacific Island birds: biodiversity meets zooarchaeology. Science 267:1131.

Impact of Hunting on Jamaican Hutia (Geocapromys brownii) Populations

545

Steadman, D. W., D. R. Watters, E. J. Reitz, and G. K. Pregill. 1984a. Vertebrates from archaeological sites on Montserrat, West Indies. Carnegie Museum of Natural History, Annals 53:1–29. Steadman, D. W., G. D. Pregill, and S. L. Olson. 1984b. Fossil vertebrates from Antigua, Lesser Antilles: evidence for late Holocene human-caused extinctions in the West Indies. Proceedings National Academy of Science U.S.A. 81:4448–4451. Varona, L. S. 1974. Catálogo de los mamiferos vivientes y extinguidos de las Antillas. Academia de Ciencias de Cuba, La Habana, Cuba. Varona, L. S. and O. Arredondo. 1979. Nuevos taxones fosiles de Capromyidae (Rodentia: Caviomorpha). Poeyana 195:1–51. von Bertalanffy, L. 1938. A quantitative theory of organic growth (inquiries on growth laws, II). Human Biology 10:181–213. Vorhies, M. R. 1969. Taphonomy and population dynamics of an early Pliocene vertebrate fauna, Knox County, Nebraska. University of Wyoming Contributions to Geology, Special Paper 1:1–69. Wilkins, L. 1987. Research activities concerning the Jamaican Hutia. Report submitted to Jersey Wildlife Preservation Trust, Channel Islands. Wilkins, L. 2001. Status of the Jamaican Hutia (Geocapromys brownii), and a Reintroduction of a CaptiveBred Population. Unpublished Master’s thesis, Department of Latin American Studies, University of Florida, Gainesville. Wilson, S. 1989. The prehistoric settlement pattern Nevis, West Indies. Journal of Field Archaeology 16(4):427–450. Wing, E. S. 1969. Vertebrate remains excavated from San Salvador Island, Bahamas. Caribbean Journal of Science 9(1–2):25–29. Wing, E. S. 1972. Identification and interpretation of faunal remains. Pp. 18–35 in Silverberg, J. (ed.). The White Marl Site in Jamaica. Report of the 1964 Robert R. Howard Excavation. Department of Anthropology, University of Wisconsin, Milwaukee. Wing, E. S. 1977. Use of animals by the people inhabiting the Bellevue site. Archaeology — Jamaica 77(1):2–7. Wing, E. S. 1989. Human exploitation of animal resources in the Caribbean. Pp. 137–152 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Wing, E. S. 1993. The realm between wild and domestic. Pp. 243–250 in Clason, A., S. Payne, and H.-P. Uerpmann (eds.). Skeletons in Her Closet, Festschrift for Juliet Clutton-Brock. Oxbow Monograph 34, Oxford, U.K., 259 pp. Wing, E. S. and A. B. Brown. 1979. Paleonutrition. Academic Press, New York. Wing, E. S. and E. J. Reitz. 1982. Prehistoric fishing economies of the Caribbean. New World Archeology 5:13–323. Wing, E. S. and S. Scudder. 1983. Animal exploitation by prehistoric people living on the tropical marine edge. Pp. 197–210 in Clutton-Brock, J. and C. Grigson (eds.). Animals and Archeology: Shell Middens, Fishes and Birds. Vol. 2. BAR International Series 183, Oxford University Press, Oxford, 260 pp.

of Conservation in Haiti: 27 Status A 10-Year Retrospective Florence E. Sergile and Charles A. Woods Abstract — Haiti is one of the most biologically significant but also one of the most environmentally degraded countries in the West Indies. It faces serious conservation and research problems because of its economic situation and political decisions. Over the last 10 years conservation efforts have slowly developed. A number of conservation actions have emerged in the public and private sectors because an increasing number of decision makers have become aware of the relationship between managed ecosystems and economic growth. A national environmental action plan was published and Haiti ratified some biodiversity conventions. Many environmental projects are being developed at regional levels involving local communities. However, conservation is difficult in a short-term span and inadequate low resources; many projects are hindered by political turmoil and expectations remain unfulfilled because of shortsighted policies. As environmental degradation and species extinction continue at alarming rates throughout the world, Haiti is struggling between compromises to keep and allocate resources to build conservation programs in times of difficult socioeconomic hardships. Lessons learned from these efforts can serve as examples for the West Indies.

INTRODUCTION The study of biogeography depends on the presence of a representative sample of the natural flora and fauna of a region. Many modern systematic analyses rely on biochemical or even behavioral data; therefore living and extant examples of island endemics are especially important in seeking to reconstruct the phylogenetic history of West Indian plants and animals. Many surviving endemic species in the West Indies are threatened or endangered. This is especially true for Haiti where even fossils are vulnerable because of erosion and poor land management. Without active conservation efforts many more species will become extinct and disappear before anything is known of their biogeography. Since the publication of our first review of conservation strategies in Haiti (Paryski et al., 1989), the hope that Haiti would be able to protect its biological diversity has slowly become reality by a combination of government commitment and a countrywide campaign in environmental education. The actual application of effective conservation strategies has been a difficult task in Haiti because of limited financial resources and ongoing political turmoil. However, increasing numbers of people at all levels are becoming aware of the importance of the natural patrimony of their country in their everyday lives and its role in sustainable development. In this chapter we review the impact of the last 10 years of conservation activities in Haiti and offer our recommendations for future goals and activities.

PHYSIOGRAPHY OF HAITI The Republic of Haiti shares the island of Hispaniola with the Dominican Republic. The country has an area of 27,750 km2. The coastline is 1,800 km in length and the continental plateau along the Atlantic and Caribbean coasts is 5,000 km2 (Figure 1, Table 1). Over 80% of the land area has slopes in excess of 25% and many mountain peaks in Haiti are over 2,000 m. The highest point is Pic la Selle (2,674 m) in the Massif de la Selle. A series of low ranges, some rather isolated from one another, make up the southern peninsula of the country. The towering Massif de la Hotte range of southwestern Haiti originates 165 km west of the termination of the Massif de la Selle and 0-8493-2001-1/01/$0.00+$1.50 © 2001 by CRC Press LLC

547

548

Biogeography of the West Indies: Patterns and Perspectives

FIGURE 1 Map of conservation efforts in protected areas. Areas: 1 = Baie de Fort-Liberté – Rivière du Massacre delta; 2 = Lagon-aux-boeufs; 3 = Baie de l’Acul; 4 = Coquillage; 5 = Pointe Ouest; 6 = Petit Paradis; 7 = Artibonite Delta; 8 = Bassin Zim; 9 = Etang Bois-Neuf; 10 = Langue Blanche and Pointe Ouest; 11 = Les Arcadins; 12 = Trou Caïman; 13 = Lac Azuei; 14 = Etang de Miragoane; 15 = Baie de St. Louis du Sud/Grosse Cayes; 16 = Iles Cayémites and Baradères; 17 = Pointe Diamant; 18 = La Navase; 19 = La Citadelle, Sans-Soucis, les Ramiers; 20 = Forêt des Pins; 21 = Parc National La Visite; 22 = Réserve Macaya.

TABLE 1 Geographical Features Total Area 5 satellite islands Gonâve Tortue Ile-à-vache Cayemites (2 islands) La Navase Coastline Mangrove Continental plateau Highest peak Largest inland water Wetlands

27,750 km2 954 km2 670 km2 180 km2 52 km2 45 km2 7 km2 1,800 km 143 km2 5,000 km2 2,674 m (La Selle) (113 km2) Lac Azuei 793 km2

Status of Conservation in Haiti: A 10-Year Retrospective

549

extends to the southwestern tip of the southern peninsula. The highest point in this range is Pic Macaya (2,347 m). In northern Haiti the Central Plateau is surrounded by three mountain ranges: the Chaîne des Matheux and the Chaîne du Trou d’Eau in the south and the Montagnes Noires in the north. Farther north, the Massif du Nord extends to the northwestern peninsula. The physiographical complexity of Haiti creates a heterogeneous terrain and causes much variation in local climatic regimes. The lowland and piedmont regions of Haiti are tropical in climate. The mountains are cool throughout the year and characterized by abundant rainfall (2,000 to 3,000 mm). The prevailing winds are from the northeast from April to June and from the northwest from October to November. Because of the location of Haiti on the western third of Hispaniola, a major part of the country is in the rain shadow of the high mountains of the Dominican Republic, which shield much of Haiti from the moist Trade Winds blowing from the northeast. These zones are dry or arid and receive less than 750 mm of rainfall/year, whereas in the Massif du Nord west of Cap-Haitien, the Montagnes Noires, and the Massif de la Selle rainfall can exceed 2,000 mm/year. The most abundant rainfall occurs in the Massif de la Hotte of far southwestern Haiti, which is nearly surrounded by water and is far removed from the rain shadow of the Cordillera Central. Over 3,000 mm of rain falls in a broad belt extending 35 km east and west from Pic Macaya. Along with topographical and climatic features, edaphic (soil) conditions also have a significant impact on the distribution and diversity of plants and animals in Haiti.

BIODIVERSITY IN HAITI Haiti has one of the highest levels of biodiversity in the West Indies (Hedges and Woods, 1993). Nine life zones from arid to cloud forest have been identified based on humidity, precipitation, evapotranspiration, altitude, and temperature (Holdridge, 1947; OAS, 1972). Inside these life zones are complex ecosystems affected not only by climatic and topographical features but also by edaphic conditions. The OAS (1972) has identified a mosaic of more than 64 types of soils. These soils range from thin to deep, igneous to sedimentary, and support a mesophytic mixture of plant life. The flora of Haiti is composed of 5,000 vascular plants with more than 300 Rubiaceae, 300 orchids (Dod, 1992), 300 Graminacea, 330 Asteraceae, and 200 Melastomataceae (Barker and Dardeau, 1930; Logier, 1982). Approximately 37% of the plants are endemic (Ekman, 1929). The country also has a rich fauna with more than 2,000 species. A high rate of endemism is noted on the mainland and adjacent satellite islands. For example, of the 303 West Indian species of butterflies, 163 are found in Haiti; of the 126 known species of frogs, 54 (43%) are endemic; of the 212 mollusks, 96% are endemic; and 100% of the terrestrial mammals are endemic. There are 230 species of birds; there are 75 species resident in and 24 species endemic to Hispaniola (Woods, 1987; Raffaele et al., 1998). One species, the gray-crowned palm tanager, is endemic only to the mountains of the southern peninsula. Haiti has six important satellite islands along its coastline (Figure 1; Table 1). The largest of these offshore islands are La Gonâve (670 km2) and La Tortue (180 km2). A number of species not found on Hispaniola proper occur on these islands. For example, La Gonâve has 17 endemic plants (Robart, 1987) and La Tortue has 26, as well as a number of species found only in Cuba and the Bahamas.

THREAT TO BIODIVERSITY Many species are vulnerable, threatened, or endangered in Haiti because of human conflicts for the same space and limited resources. It is difficult to document the exact nature of the original natural ecosystems of the country, but exceptional ecological diversity has been noted since the first biophysical inventories (Tippenhauer, 1893; Ekman, 1926, 1929; Wetmore and Swales, 1931). Unfortunately, Haiti has been subjected to overexploitation of its natural resources ever since the

550

Biogeography of the West Indies: Patterns and Perspectives

TABLE 2 Potential and Actual Land Use in Haiti Description

Potential Use (ha)

Actual Use (ha)

Productive land for intensive agriculture and annual crops Mountain land for perennial crops and forests Marginal and nonagricultural land including water bodies, villages, roads, etc. Total

1,163,000 1,482,000 126,000 2,771,000

1,700,000 250,000 820,000 2,770,000

first humans arrived on the island (Lasserre et al., 1985; Robart, 1987; Magny, 1991; Lowental et al., 1998; MDE, 1999). Today the population is estimated to be 7.4 million with a 2.3% growth rate; 70% of the population is directly dependent on the land and 2% depends on fisheries and marine resources for their income. More than 60% of the land consists of steep mountains unsuitable for annual and staple crops. Approximately 61% of the land is intensively utilized for annual crop and pasture (Erlich et al., 1985; Lassere et al., 1985). Only 9% of the country consists of forested areas (despite intense reforestation efforts supported by the international community). Native and endemic species of Haiti are used every day by the population for lumber, fuel, fences, pasture, traditional medicine, essential oil, recreation, shade for coffee and cocoa, food, and as a source of revenue. The pressure on the land is very intense and difficult to control. The country is one of the poorest and most densely populated nations in the world. The economic balance is negative (–8,342,000 gourdes for fiscal year 1996–1997), inflation rates are higher than 20% and 60% of the population is unemployed and lives below the poverty line. Per capita income is $250. Population density is 662 people/km2 of arable land (see land potential and utilization in Table 2). Each year the population increases by about 2%, meaning it will double every 35 years. Most of this expanding human population lives in rural areas where agricultural production has decreased during the past 20 years, and where soils are thinner than 5 cm. Haiti’s remaining plants and animals are increasingly threatened by poverty and by a lack of knowledge about the importance of the natural patrimony. Poverty affects the private as well as the public sector. The impact of the growing population on the countryside (the mountains and the coastal zones) is especially significant. Habitat destruction by human activities, the introduction of exotic species that successfully compete with endemics for the same ecological niches or that prey on endemics, and the commercial export of plants and animals, particularly of coral, turtles, parrots, and boas, has impoverished many life zones. At the structural and institutional levels, the lack of financial resources has weakened the best management and enforcement policies. The Ministry of the Environment (MDE) and the Ministry of Agriculture and Natural Resources (MARNDR) receive, respectively, 12 million gourdes (0.25% of the national budget) and 120 million gourdes to carry out all of their programs (including salaries) (Banque Mondiale, 1998). Despite these economic hardships, a number of dedicated technicians in these institutions have struggled hard to implement conservation programs and protect the environment.

CONSERVATION EFFORTS Environmentalists and resource managers have sought new solutions to slow down the alarming rates of habitat loss (and extinction) in Haiti. The lessons learned from these efforts in Haiti can serve as examples elsewhere in the West Indies. In the face of extremely difficult socioeconomic hardships, political instability, and an alarming rate of environmental degradation, national and international organizations in Haiti responded to the threats confronting Haiti’s natural patrimony in various ways. Beginning in the late 1980s programs were under way to increase the capability

Status of Conservation in Haiti: A 10-Year Retrospective

551

of the Haitian Government (GOH) in the area of environmental protection and the management of natural resources. Various research activities were also designed and funded by international organizations (USAID, the MacArthur Foundation) to document the importance of the natural patrimony. The GOH created a Ministry of Environment in 1995 to elaborate and implement a National Environmental Action Plan (NEAP), to manage protected areas, and to promote environmental studies and environmental education.

BIODIVERSITY CONSERVATION STRATEGY In early 1997 the Haitian and Dominican governments initiated meaningful exchanges of personnel and information between the two countries to facilitate the preparation of joint sustainable development projects. A formal “coordination system” for the management of regional and/or insular projects was identified and is being carried out by the “Commission Mixte Haitiano-Dominicaine.” During a series of binational meetings, the need for insular strategy was identified and the “Subcommission on Biodiversity” was created. In September 1997 both governments prepared guidelines for a binational strategy to promote the conservation of biodiversity for the whole island. Haiti and the Dominican Republic have expressed their intentions to maintain and sustain the Hispaniolan collaboration as institutional capabilities improve and additional Global Environmental Fund (GEF) projects are developed. Several studies and collaborative efforts with an emphasis on the conservation of biodiversity have been undertaken on the Haitian–Dominican frontier zone. The La Selle/Bahoruco, Azuei/Enriquillo lakes, Monte-Christi/Fort-Liberté/Baie de l’Acul (in the north), Peligre Watersheds/Nalga de Maco, and Anse-a-Pitres/Jaragua National Park ecological complexes all have been proposed as sites for the joint conservation of natural ecosystems and the protection of endemic species such as orchids, flamingos, West Indian whistling ducks, manatees, crocodiles, mangroves, fish and endemic aquatic, lowland and mountain birds such as Black-capped petrels, and migratory species such as North American warblers and the Bicknell’s thrush. During a conference on protected-area management and biodiversity facilities in Haiti (Colloque sur la gestion des aires protégées et le financement de la biodiversité en Haïti) in February 1997, biodiversity conservation became an integral part of forestry, watershed management, ecotourism, and hillside agriculture. The preparation of the conservation strategies and insular ecosystem conservation have also been identified as priority actions by the NEAP. Haiti signed the Convention on Biodiversity in June 1992 and ratified it in August 1996. The country also ratified the UN World Monument Heritage, the Convention on Desertification Control, and the UN Framework on Climate Change. Plans exist to assess and propose revisions to national legal and fiscal frameworks for forestry, wetlands, coastal zones, and wildlife. These plans were revised and clarified during the completion of the national environmental action plan (NEAP), with the ATPPF (Technical Assistance to the Protection of Parks and Forest) project and provisions exist for specific actions in the National Biodiversity Strategy and Action Plan.

THE NEAP Published in 1999, the production of the NEAP was a long process involving participatory actions and decisions at the local level (MDE, 1998, 1999). It was funded by a consortium of international donors with GOH matching funds and produced by local efforts. Between 1995 and 1999, the United States (acknowledging the importance of environmental impact studies in reconstructing Haiti) supported this official environmental management plan. The Economic Growth Division at the U.S. Agency for International Development (EG/USAID) provided funding and technical support for the many phases involving participatory decision making and for the actual publication of the NEAP. Rapid environmental assessment for 93 communes (MDE, 1996–1998, unpublished documents) identified the need for the preservation of biodiversity and the development of protected areas.

552

Biogeography of the West Indies: Patterns and Perspectives

The Environmental Coordination and Monitoring Unit (ECMU) of the United Nations provided technical and advisory support, as well as environmental publications such as a compendium of environmental laws on the protection and utilization of biodiversity (Victor, 1995). The World Bank supported technical consultations for the Haitian technicians, the project coordinator and funding for more than 20 technical conferences. The Canadian International Development Agency (CIDA) supported the “awareness campaigns” encouraging local participation in the decision-making process at the regional level. Ten national environmental programs are identified and include the management of biodiversity in situ (in protected areas) and ex situ. Although conservation is included as a program per se, other programs such as environmental education and management of strategic watersheds, marine resources, and coastal areas are included to develop strategies to manage biodiversity. Regional and national workshops that were part of the NEAP process created a consensus from local governments (mayors, deputies, and senators) and civil society (advocacy groups, activists, school teachers) to increase the 400 km2 (1.44%) of Haiti’s landmass in protected areas to 2%. However, effective management of protected areas is far from optimal because of a lack of financial resources, savoir-faire, and the lack of a clear focus on the established priorities.

PROTECTED AREAS GOH has identified 31 sites as to be protected (Figure 1; Table 2) and four protected areas are already officially designated and under management. These already existing sites are the Macaya National Park in the Massif de la Hotte, the La Visite National Park and the Pine Forest Reserve in the Massif de la Selle, and the Historical National Park La Citadelle, Sans Souci, Les Ramiers in the Massif du Nord. These protected areas cover about 41,500 ha (1.50% of the country), and include wet and cloud forest areas designed to protect endemic hot spots. Five stewardship and species recovery plans are available for these protected areas (Woods and Harris, 1986; Sergile, 1990; Sergile et al., 1992; Woods and Ottenwalder, 1992; Sergile and Woods, 1996). In 1990, USAID allocated an additional $750,000 (on top of the $1.3 million already spent) to extend the successful Macaya Biosphere Reserve project (Sergile et al., 1992) until April 1992. Because of political instability and internal USAID reengineering, this project was carried out in the Massif de la Hotte area by UNICORS (Union des coopératives de la région du Sud), a local nongovernmental organization (NGO), with technical and financial support of USAID and the Biodiversity Support Program (King and Buffum, 1997). Meanwhile, the Forest and Environmental project originally planned by the World Bank in the late 1980s was reactivated and finalized under the ATPPF project. It is designed to manage the Macaya Biosphere Reserve, the La Visite National Parc, the Forêt des Pins (Pine Forest), and biodiversity ex situ. An important component of the biodiversity conservation plan for the area around Pic La Selle addresses corridors to link the Morne d’Enfer area to the west with the Forêt des Pins in the east. Because of the nature of local participation (i.e., local decision-making processes) requested in many development projects, this project was not launched until 1996. It is comanaged by the cabinet of the MDE and two services of the Ministry of Agriculture, Natural Resources and Rural Development (MARNDR): the SPNS (National Parks and Natural Sites Service) and the Service des Forêts (Forest Service). In all, 33 protected areas in different ecosystems are identified (Figure 1, Table 3). The participatory model developed during the production of the NEAP is also used in the production of the Biodiversity Conservation Strategy (MDE, 1997, 1998).

CONSERVATION EDUCATION Since 1990, an increasing number of people in Haiti have become aware of the importance of fauna, flora, and protected areas due to active programs in environmental education and the widespread distribution of conservation posters and information on the importance of the natural patrimony. These activities include nonformal and formal education. Ecology and its related concepts are new in Haiti as is the concept of the importance of conservation in sustainable development. Educational

Status of Conservation in Haiti: A 10-Year Retrospective

553

TABLE 3 Area To Be Protected for Management of Biodiversity Identified Areas To Be Protected and Location

Area Proposed

Baie de Fort-Liberté – Rivière du Massacre delta; East of Cap-Haïtien Lagon-aux-boeufs; East of Fort-Liberté

1,500

3.

Baie de l'Acul; West Cap-Haïtien

1,000

4. 5. 6. 7.

Coquillage West Ile de la Tortue Pointe Ouest; West Ile de la Tortue Petit Paradis; Northwest of Gonaïves Artibonite Delta; South of Gonaïves

25 25 100 500

8.

Bassin Zim; Plateau Central

600

9.

Etang Bois-Neuf; West of St. Marc

100

10.

Langue Blanche et Pointe Ouest; West of La Gonâve Les Arcadins; East of la Gonâve Trou Caïman; Northeast of Port-au Prince Lac Azuei; East of Port-au-Prince (Plaine du Cul-de-Sac)

100

1. 2.

11. 12. 13.

14. 15. 16. 17. 18.

Etang de Miragoâne; West of Miragoâne Baie de St. Louis du Sud/Grosse Cayes; East of les Cayes Iles Cayémites et Baradères; East of Jérémie Pointe Diamant La Navase Total area (ha)

650

10 10,00 15,000

1,200 100 200 25 667 22,802

Features Subtropical dry forest; estuarine bay and river delta, mangrove, sea turtles, manatees, crocodiles; development of tourism Subropical dry forest; estuarine lagoon; mangrove and wetland ecosystems; flamingos and migratory water fowls; marine and fresh water fishes; mollusks; hunting site Subtropical humid forest; estuarine bay; mangroves, swamps and coral reefs; development of fisheries Mangrove; coral reefs Subtropical humid forest; coral reefs, sea turtles Lagoon; mangrove, marshes, and desert ecosystems Estuarine system; mangrove, swamps, marshes; flamingos, crocodiles, and waterfowls; development of fisheries, hunting site Mountain ecosystem in the subtropical humid forest; waterfall (40 m) on the River Samana; endemic flora and fauna to be identified; development of ecotourism Wetland and brackish water ecosystem in the subtropical dry forest; migratory ducks, water fowls, fresh waterfish; Taíno archaeological site; hunting site Mangrove and crocodiles Three keys and coral reefs; tourism Subtropical dry forest; freshwater lake (Cul-de-Sac); wetland ecosystems, flamingos, and migratory waterfowls; hunting site Subtropical dry forest; brackish water lake (113 km2); mangrove ecosystems; waterfowls, migratory birds, flamingos, West Indian dendrogcyna, American crocodiles; hunting site and development of aquaculture Subtropical humid forest; two freshwater lakes (1.3 and 7.6 km2; 41 m); eight endemic fishes; wetland flora and fauna; waterfowls Coral reefs; migratory species, crustaceans Mangrove, coral reef, and coastal zone system; flamingo, Ridgway hawk Lagoon, swamp, and crocodiles Coral reef, endemic species

Note: “Forest” refers to Holdridge biological zones (OAS, 1972); excluded are geological sites, mineral springs, and archaeological sites that are selected in the list of 31 areas to be protected.

materials for different target groups (decision makers, local leaders, and future managers of protected areas) have been developed to promote these concepts. Nonformal education was developed by HaitiNET, an NGO of the Florida Museum of Natural History with funding via grants from the MacArthur Foundation, BSP, and USFWS. Four conservation posters have been produced (see Conservation Poster section after Literature Cited) along with a series of brochures and workbooks for different target groups including politicians, school children, and farmers (see Activity Material after Literature Cited). These materials have been widely distributed and have influenced international celebrations

554

Biogeography of the West Indies: Patterns and Perspectives

such as Earth Day and Environment Day. School children collected information on threatened flora and fauna and shared their research with their peers, newspapers, and radio and television shows. After receiving training in natural resources management, high school students identified needs to network and to promote turtle, bird, and mangrove conservation. Because financial resources are limited, only the southeastern region of Haiti has been covered by the ASSET project. Formal environmental education at a professional level is supported by the Ecole Moyenne d’Agroforesterie as an intergral part of the ATPPF project. In 2000, the Ecole Moyenne d’Agroforesterie certified its first class of 25 technicians under the program that provided training in biodiversity and protected-areas management.

MANAGEMENT PLANS Donor organizations (both private and governmental) are continuing to develop projects in Haiti and finance studies that document the extent of environmental degradation. Their goal is to provide information that will facilitate positive steps to solve the environmental problems faced by Haiti at different levels, and to protect the natural environment of the country. These projects also identified the need for blueprints and stewardship plans at the local level. At the present time 13 rapid assessments, environmental profiles, and management plans are available and focus on the following areas: the coastal zone, Ile de la Tortue (Sergile and Woods, 1998), the upper watershed of the Riviere Grise and Riviere Blanche (Lowenthal et al., 1998), the northern and northeastern coastal region (Ottenwalder et al., 1990; Ménanteau and Vanney, 1997), the la Citadelle area (Sergile, 1990), the La Visite national parks (Woods and Harris, 1986; Woods et al., 1992), Macaya (north and south) (World Bank 1990; Woods et al., 1992; Sergile and Woods, 1996), the coastal zone (UNESCO, 1998), and Lac Azuei (Thorbjarnarson, 1988). The MDE with assistance from the Inter-American Development Bank (IBD) is preparing an action plan for the management of coastal resources. The ASSET project funded by USAID, as part of its goal to implement the NEAP, helped local groups propose biodiversity management plans for turtles, mangroves, and wetlands in southeastern Haiti including the Bassin Bleu area and the coastal zone between Jacmel-Marigot and the Milot region (north) (ASSET/Winrock International, 2000).

NONGOVERNMENTAL ORGANIZATIONS A number of NGOs have emerged that focus on the protection and conservation of nature. The NGOs most dedicated to the protection of biodiversity are the following. FOPROBIM (Fondation pour la protection de la biodiversité marine) played a major role in the protection of the Arcadins along with CEFET (Centre de formation et d’enseignement technique). These agencies have worked in close collaboration with associations of fishermen in training fishermen in sustainable fishing and understanding marine biodiversity. In 1999, USAID/ASSET supported the FHE (Foundation haïtenne pour l’environnement) with $600,000 funding. This foundation is a collaborating effort between Haitian citizens (41 members) and the MDE. (For more information see [email protected]; Samba Guissé, personal communication.) The success of these efforts cannot be measured simply by quantitative performance indicators (number of farmers, hectares under protection, etc.), or simply by short-term economic indicators as proposed by USAID (USAID, 1999). Qualitative factors (behavioral changes, specific actions, types of partners, etc.) should also be taken into consideration in evaluations of the success of these conservation programs.

LESSONS LEARNED Efforts to promote the conservation of biodiversity and to encourage sustainable development have been successful in Haiti. One major factor in this success is the inclusion of a wide circle of the

Status of Conservation in Haiti: A 10-Year Retrospective

555

Haitian population in the decision-making process. Another major factor is the increased number of programs in Haiti that promote environmental education. Local participation and environmental education are now the cornerstones of most new GOH and NGO projects in Haiti. The link between ecology and economics is the protocol for all GEF small and medium-size grants that emphasize conservation, sustainable development, and the preservation of biodiversity. Conservation efforts in the southern Massif de la Hotte, for example, which started out as an attempt to create Parc National Pic Macaya, have now been expanded to include the northern part of the Massif de la Hotte and the establishment of a biosphere reserve in the whole area. Many of the newly formed political parties in Haiti are including environmental concerns in their platforms and are willing to set aside areas designed to protect biodiversity (Toussaint, 1997, 1998; MDE, 1998, 1999). Another promising development in Haiti is that many young students are attracted by environmental and conservation programs. The main reason for increased acceptance of these conservation efforts is the recognition in Haiti that conservation in not an obstacle to development but an important element in reforestation, water management, and soil conservation, and therefore to economic growth. However, the new awakening of a conservation ethic in Haiti is not a total success. The flush of optimism and environmental awareness that resulted from increased funding and environmental education are increasingly being displaced by the consequences of the unfortunate political events of the past 12 years, and the resulting international political countercurrents. The majority of international aid agencies have withdrawn help or decided to change the emphasis of their funding. Financial resources are increasingly being committed to nongovernmental agencies to alleviate poverty, build democracy, and prevent disease. Haiti has many problems, and these funding priorities are clearly aimed at the core of the social problems facing Haiti. However, this new trend isolates the government of Haiti from being able to continue to manage one of the most essential cornerstones of the country, the environment of Haiti. These changes in funding priorities mean that there is no support for the MDE or the SPNS, nor funds to train the next generation of personnel with the tools needed to take charge of their own environmental destiny. For example, the ASSET project was originally conceived (in 1996) to have the important mission of transforming the environment. During the past year the project was re-directed to emphasize agriculture. Conservation projects are becoming “cassava planting projects” such as what occurred in the case of the Macaya biosphere reserve project after 1992. Part of this shift in emphasis is a natural consequence of the serious problems facing Haiti, and the need to set priorities. However, part of the problem is a result of shortsighted policies on the part of USAID. This organization, as well as other donor groups, began a process to link development with sustainable agriculture and preservation of Haiti’s natural patrimony. Such a process takes time, and requires the training of at least one generation of people to take over the vision. USAID was a major player in this concept. USAID raised expectations, it built critical infrastructure, such as roads into the few remaining wild areas in Haiti, and financed the building of structures in these remote areas designed to facilitate conservation activities. However, changing priorities and changing personnel and project officers (a serious problem with USAID-backed projects) left expectations unfulfilled, natural areas exposed to exploitation by roads, and long-term sustainable development schemes floundering before they had the chance to become sustainable. In short, priorities shifted and funding evaporated before the job was done. The contrast between the status of conservation programs in Haiti and similar programs in other Caribbean countries provides distressing evidence of the damaging effects of superficial decision making that focuses on short-term returns without addressing real sustainability and environmental impact issues. The construction of roads, for example, such as those of Le Prêtre-Formond in 1991, Furcy-Seguin in 1999, and Cayes-Jérémie in 2000, have been very detrimental to biodiversity because they opened up a vein in which forest products and short-term nonsustainable slash-andburn agriculture could easily and quickly take hold and severely damage a region. If roads are important to development, they are detrimental to conservation when a strong conservation infrastructure is still embryonic. This awareness of the need for long-term commitments to building

556

Biogeography of the West Indies: Patterns and Perspectives

sound programs to protect biodiversity is widespread in the Antilles. In the Dominican Republic conservation programs have been sustained and supported for decades. This long-term commitment to protecting vulnerable natural areas where roads have been built to improve infrastructure is also showcased in Cuba. Perhaps the best example of this is in Puerto Rico, where the excellent infrastructure of the Caribbean National Forest is coordinated with close supervision of the natural resources of the region. These coordinated efforts to protect the environment also provide opportunities for training and environmental education. Species inventories, climatic measurement, and parks management are just some of the areas where resources are protected at the same time that personnel are trained and commitment sharpened. In Haiti such follow-up activities would open opportunities to very dedicated young technicians throughout the country. International sanctions such as the embargo that was imposed on Haiti from 1991 to 1994, as well as the sudden and deep cuts in environmental projects by the international community over the past 10 years, have impeded efforts to conserve the flora and fauna of the country. Serious conservation actions have been limited by low budgets, changing and contradictory government priorities and policies, and a lack of trained personnel. Institutional capacity building and training are essential if a country with no historical experience in the stewardship of natural resources is to assume the heavy responsibility of conserving biodiversity and building up its economy (sustainable development) at the same time. The struggle to develop conservation programs is more difficult in Haiti than in any other country or island in the West Indies because, in addition to the other problems discussed above, language and literacy are major problems. The bottom line is that programs with a long time span (5 years at least) must be designed and funded in order to see results. It is critical to build on success and not on failure. In this regard, short-term funding and rapidly changing funding priorities may have done as much damage as they have done good. The NEAP is a user-friendly document that has been widely distributed throughout Haiti. At the MDE level, its ten major programs include biodiversity management that desperately needs to be implemented. Such programs in a poor and inexperienced country such as Haiti require international participation, which currently is denied because of political instability. Funds for environmental actions, implemented with support and participation of local citizens, and championed by USAID through projects such as the ASSET project, have been withdrawn because of political irregularities surrounding the communal elections in Haiti. Political chaos has had a direct impact on the loss of biodiversity as seen in environmental degradation at La Visite and Macaya (Woods and Sergile, 1995; King and Buffum, 1997). The extraction of forest products (wood, plants, and animals) in wooded areas is carried out not only by the poor farmers living in the vicinity, but also by politically connected businessmen. At the institutional level, state legislation fails to assign the final responsibility for the management of biodiversity and protected areas to a single government agency. This results in conflicts between MARNDR and MDE as to which group has the primary responsibility. The forestry and protected area project, taken over by ATPPF, will be terminated in September 2001. Although they were allotted funding, the EMAF (forestry school), MARNDR, and MDE do not have sufficiently trained staff or sufficient funds to effectively train the support staff necessary to manage and protect the protected areas. As a result of these experiences we believe that there is an inherent conflict of interest in assigning responsibility for national parks and the protection of natural patrimony to either MARNDR or MDE. MARNDR is primarily responsible for the utilization of forest and potential croplands. The MDE is primarily responsible for environmental conditions in a country overwhelmed with pollution and overpopulation. Neither organization is in a position to place high priority to the preservation of biodiversity, which often conflicts with economic growth and development. That the MDE is focusing on solving urban environmental problems may be a golden opportunity for the reorganization and consolidation of responsibilities for conservation and the preservation of biodiversity in Haiti. Haiti needs a strong advocate for national parks and the preservation of its fragile flora and fauna. We believe that the creation of an independent National

Status of Conservation in Haiti: A 10-Year Retrospective

557

Parks Service is long overdue. Haiti is at an important crossroads. It can pick up the pieces and establish new and better programs to preserve and protect its important natural patrimony. Or the priorities of the MDE will be viewed as just another sad example of the lack of sustainable support for environmental programs in a country struggling with so many monumental issues. That final lesson is still to be learned.

CONCLUSIONS The above discussion makes it abundantly clear that Haiti faces challenging issues if it is going to be able to solve its conservation problems. The political paralysis gripping Haiti has resulted in an accelerating ecological decline. The conservation of biological diversity was advanced in Haiti during the 1980s and many lessons can be learned from successes in establishing national parks where previously there were none, and in watching an environmental awareness program rapidly take root. It is remarkable how much success Haiti achieved in a brief decade or two with initial support from the international community. However, short-term commitment has been disastrous to the goals of long-term biodiversity management. Where local involvement in environmental planning, environmental education, and natural resource management created a time of optimism and increased expectations, conservation efforts blossomed. The national parks were sustainable in the midst of great pressure on the already fragile natural ecosystem and broken economy. This is a powerful lesson for the entire region. If conservation can be accepted and supported in Haiti, with all its problems and an already terribly fragile ecosystem, then the pattern can be repeated and sustained on other island nations in the West Indies. However, there is a contrary lesson too. Support must be long-term, not short-term. If not, the process is not complete, the needed personnel are not trained, and the institutions do not become strong enough to maintain the difficult task of saying no to pressures to exploit rather than protect forests, steep mountain slopes, and endemic plants and animals. The international community can be helpful, and indeed essential, if it follows the first priority outlined above. The evidence in Haiti of this success is clear to see, and an inspiration to all who seek to protect biodiversity in the West Indies. The international community can also have a negative impact if it does not accept the responsibility of long-term support of fledgling conservation programs, and especially if it does the easy part first — building roads and buildings and helping purchase vehicles and computers — but does not follow through with the emphasis on stewardship that makes it possible to actually protect the fragile and in many cases irreplaceable habitat and biosphere. Unfortunately, in Haiti there are lessons to be learned about failure, as well as about remarkable successes.

ACKNOWLEDGMENTS We thank Mike Jenkins of the MacArthur Foundation, Dr. Herbert Raffaele and the staff of the Division of International Conservation of the U.S. Fish and Wildlife Service, the Biodiversity Support Program, and the International Foundation for the Conservation of Birds for their support of conservation efforts in Haiti. We thank Edmond Magny and Dalberg Claude of MARNDR; Ronald Toussaint and Louis Buteau of MDE and ATPPF; and Gysèle Hyvert and Harold Gaspard of the Route 2004/UNDP project. We also thank the following individuals who contributed to conservation in Haiti: Philippe Bayard, Fabienne Boncy Taylor, Florence Dufort Chevalier, and Hans Charles. We are also appreciative of the support of the Florida Museum of Natural History, the University of Florida, and the University of Vermont. This chapter is dedicated with appreciation to Albert Mangones who founded ISPAN, the first institution responsible for the management of national parks in Haiti, and who championed the first national park at the Citadelle, Sans Soucis, Les Ramiers.

558

Biogeography of the West Indies: Patterns and Perspectives

LITERATURE CITED ASSET/Winrock International. 2000. Quarterly Report, January to March 2000. Prepared for USAID. Unpublished. Banque Mondiale. 1998. Haiti: Les défis pour le soulagement de la pauvreté. Vol. II: documents techniques. Rapport # 17242-HA. Banque Mondiale. Barker, H. D. and W. S. Dardeau 1930. La Flore d’Haïti. Port-au-Prince: Service Technique du Département de l’Agriculture et de l’Enseignement Professionnel. Cochran, D. 1941. The herpetology of Hispaniola. U.S. National Museum of Washington 177:1–398. Dod, D. 1984. List of orchids of Haiti. Unpublished. Ekman, E. L. 1926. Botanizing in Haiti. U.S. Naval Medical Bulletin 24:483–497. Ekman, E. L. 1929. Plants observed on Turtle Island, Haiti. Arkiv för Botanik 22A(9). Erlich, M., F. Conway, N. Adrien, F. LeBeau, L. Lewis, H. Lauwerysen, I. Lowenthal, Y. Mayda, P. Paryski, G. Smucker, J. Talbot, and E. Wilcox. 1985. Haiti — Country environment profile — A field study. USAID contract. USAID – Erlich No. 521-0122-C-00-4090-00. Cooperative agreement USAID – IIED NO. DAN-5517-A-00-2066-00. Hedges, S. B. and C. A. Woods. 1993. Caribbean Hot Spot. Nature 364:375. Holdridge, L. R. 1947. The Pine Forest and Adjacent Mountain Vegetation of Haiti Considered from the Standpoint of a New Climatic Classification of Plant Formations. Unpublished Ph.D. dissertation, University of Michigan, Ann Arbor. 186 pp. King, W. and W. Buffum. 1997. Management of protected areas in Haiti. Lessons learned from the Macaya project. Unpublished report. USAID, Port-au-Prince, Haiti. Lasserre, G., P. Moral, and P. Usselmann. 1985. Atlas d’Haïti. Centre d’Etudes de Géographie Tropicale (CNRT), Bordeaux, France. Liogier, A. H. 1982. La flora de la Espanola Universidad Central del Este, Centenario de San Pedro de Macoris. San Pedro de Macoris, R.D. Lowenthal, I., G. Condé, N. Généreux, Y. Jean, F. Joseph, Y.-F. Pierre, F. Sergile, and J. Sève. s.d. [1998]. The upper watershed of Riviere Grise and Blanche. A rapid assessment. ASSET/Winrock International. Unpublished. Magny, E. 1991. Haiti, Ressources Naturelles, Environnement: Une Nouvelle Approche. Editions Henri Deschamps, Haiti. MDE (Ministère de l’environnement). 1997. Plans d’actions communaux. Série de 93 communes. Unpublished. MDE (Ministere de l’environnement). 1998a. Esquisse du Plan d’action pour l’environnement. Ministère de l’environnement. Port-au-Prince, Haiti. MDE (Ministère de l’environnement). 1998b. Stratégies nationales de gestion de la diversité biologique. Proposition d’activités habilitantes au Fonds pour l’Enviromment Mondial, Banque Mondiale. MDE (Ministère de l’environnement). 1999. Plan d’action pour l’environnement. Commission Interministerielle sur l’Environnement and Ministere de l’environnement, Port-au-Prince. Menanteau, L. and J. Vanney, 1997. Atlas côtier du nord-est d’Haïti. Environnement et patrimoine culturel de la région de Fort-Liberté. Projet Route 2004. Ministère de la Culture (Haïti)/PNUD. Ministère de la planification, de la cooperation externe et de la fonction publique. 1991. Environnement et développement. Rapport preparé dans le cadre de la conférence des Nations-Unies sur l’Environnement et le Développement. Rio de Janeiro, Brasil. OAS (Organisation of the American States). 1972. Haiti, Mission intégrée. Organisation des Etats Americains, Washington, D.C. Ottenwalder, J. A., C. A. Woods, G. Rathbun, and J. Thorbjarnarson. 1990. Status of the greater flamingo in Haiti. Colonial Waterbirds 13(2):115–123. Paryski, P. E., C. A. Woods, and F. Sergile. 1989. Conservation strategies and the preservation of biological diversity in Haiti. Pp. 885–878 in Woods, C. A. (ed.). Biogeography of the West Indies: Past, Present, and Future. Sandhill Crane Press, Gainesville, Florida. Raffaele, H., J. Wiley, O. Garrido, A. Keith, and J. Raffaele. 1998. A Guide to the Birds of the West Indies. Princeton University Press, Princeton, New Jersey. Robart, G. 1987. Etude écologique de l’Ile de la Gonâve (Haiti-antilles). Processus d’anthropisation d’un ensemble insulaire tropical. Documents de cartographie écologique, Grenoble, Vol. 30, 81–112. Sergile, F. E. 1990. The Biosphere Reserve Henry Christophe: Potential for the Management and Conservation of Natural Resources in Haïti. M.A. thesis, University of Florida, Gainesville.

Status of Conservation in Haiti: A 10-Year Retrospective

559

Sergile, F. E. 1997. L’environnement naturel de l’extrême nord-est. In Atlas côtier du nord-est d’Haïti. Environnement et patrimoine culturel de la région de Fort-Liberté. Projet Route 2004. Ministère de la Culture (Haïti)/PNUD. Sergile, F. E. and C. A. Woods. 1995. Biodiversié and Formation. Florida Museum of Natural History, Gainesville. 22 pp. Sergile, F. E. and C. A. Woods. 1996. People, Development and Conservation. Report of the Sondeo in Macaya North. Prepared for the Biodiversity Support Program. Unpublished. Sergile, F. E. and C. A. Woods. 1998. Ile de la Tortue. Profil de l’environnement. Préparé pour le projet PNUD/UNOPS HAI/92/001. Unpublished. Port-au-Prince, Haiti. Sergile, F. E., C. A. Woods, and P. E. Paryski. 1992. Final Report of the Macaya Biosphere Reserve Project. Florida Museum of Natural History, Gainesville. Thorbjarnason, J. B. 1988. Status and ecology of the American crocodile in Haiti. Bulletin of the Florida Museum of Natural History 1:1–86. Tippenhauer, L. G. 1893. Die Insel Haiti. Leipzig, Germany. Toussaint, J. R. 1997. Plan d’action pour la gestion et la conservation de la biodiversité en Haïti. Unpublished. Toussaint, J. R. 1998. La situation de la biodiversité d’Haïti à l’aube de 1998. Quel bilan? Pp. 137–144 in UNOPS (eds.). La gestion de l’environnement en Haïti. Réalités et perspectives. PNUD/UNOPS/HAI/92/001. Unité de coordination et de suivi de l’environnement, Port-au-Prince, Haiti. UNESCO (United Nations Education, Sciences and Culture Organization). 1998. Les côtes d’Haïti. Evaluation des resources et impératif de gestion. Résultats d’un séminaire et des activités de terrain correspondants. Dossiers régions côtières et petites îles 2. UNESCO, Paris. USAID. 1999. 1999–2000 Strategic Plan. USAID, Port-au-Prince, Haiti. Victor, J. A. 1995. Code des lois haïtiennes de l’environnement. PNUD/HAI/92/001, ECMU, Port-au-Prince, Haiti. Victor, J. A. 1997a. Le cadre legal et institutionel des aires protégées en Haïti. Pp. 38–57 in Ministère de l’Environnement (ed.). Haiti dans le dernier carré. Actes du colloque sur la gestion des aires protégées et le financement de la conservation de la biodiversité en Haiti. MDE, Port-au-Prince, Haiti. Victor, J. A. 1997b. Pourquoi la législation de l’environnement n’est pas respectée en Haïti. Pp. 131–139 in Association Haitienne du génie sanitaire et des sciences de l’environnement, premier congres national du génie sanitaire et des sciences de l’environnement, 12–13 décember 1996, Port-au-Prince, Haiti. Wetmore, A. and B. H. Swales. 1931. The birds of Haiti and the Dominican Republic. Bulletin of the U.S. National Museum 155(4):i–v; 1–483. Wiener, J. 1998. Situation de l’écosystème marin. Pp. 121–128 in UNOPS (eds.). La gestion de l’environnement en Haïti. Réalités et perspectives. PNUD/UNOPS/HAI/92/001. Unité de coordination et de suivi de l’environnement, Port-au-Prince, Haiti. World Bank. 1990. Forest and Environment. Project strategies. Unpublished. Woods, C. A. 1987. The threatened and endangered birds of Haiti: lost horizons and new hopes. Pp. 385–430 in Proceedings of the Second Delacour/IFCB Symposium 2:385–430. Woods, C. A. and L. Harris. 1986. Stewardship plan of the national parks of Haiti. USAID, Port-au-Prince, Haiti. Woods, C. A. and J. A. Ottenwalder. 1992. The Natural History of Southern Haiti. Florida Museum of Natural History, Gainesville. Woods, C. A. and F. E. Sergile. 1990. Natural sciences. Pp. 297–329 in Lawless, R. (ed.). Haïti. A Research Handbook. Garland Publishing, New York. Woods, C. A. and F. E. Sergile. 1995. The lessons of la Visite. Florida Museum of Natural History, Gainesville. Woods, C. A., F. E. Sergile, and J. A. Ottenwalder. 1992. Stewardship plan for the national parks and protected areas of Haiti. Florida Museum of Natural History, Gainesville.

ACTIVITY MATERIALS Chevalier, F. D, F. E. Sergile, and C. A. Woods. 1997. Haiti est généreuse. Annuaire 1998 Promo-Plus, Port-au-Prince, Haiti. Sergile, F. E. 1999. Mon environnement, ma commune. Kenscoff. Cahier d’activité pour la gestion de l’environnement dans la commune de Kenscoff. Projet pilote ASSET/Winrock/USAID. Sergile, F. E. 1999. Anvironman. Se ki sa? Guid pou asosyasyon jèn moun nan pawòl anviwònman. ASSET/Winrock/USAID.

560

Biogeography of the West Indies: Patterns and Perspectives

Sergile, F. E. and J. R. Mérisier. 1994. Connaître et protéger la richesse naturelle d’Haïti. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. Tardieu. 2000. L’environnement, C’est quoi? Guide pour les associations de jeunes sur la gestion de l’environnement. ASSET/Winrock/USAID. Sergile, F. E. and C. A. Woods. 1995. Guide de Terrain des Aires Protégées en Haïti: Action, Biodiversité, Créativité, Développement. Special Publication of the Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1995. Nou Pa Gen Tan Pou Pédi. Aksyon, Biodivèsité, Developman ak Kreyativite. Special Publication of the Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1995. Nous n’avons plus de temps à perdre. Special Publication of the Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1995. Veye richès peyi d’Ayiti. Special Publication of the Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1995. La Visite: Une leçon particulière. Special Publication of the Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. Ça vaut mieux qu’une mine d’or. Brochure for environmental education and exhibit on natural resources. Haiti-NET & Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. Aux couleurs nationales: le caleçon rouge. Brochure for the national bird of Haiti. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. La Calebassine. Brochure for the national flower of Haiti. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. Un arbre à nous: Le palmier royal. Brochure for the national tree of Haiti. Florida Museum of Natural History, Gainesville. Sergile, F. E. and C. A. Woods. 1996. Notre Pin: Roi de nos montagnes. Brochure for the national tree of Haiti. Florida Museum of Natural History, Gainesville.

CONSERVATION POSTERS Sergile, F. E., C. A. Woods, and L. Walz. 1992. Connaître et protéger la richesse naturelle d’Haïti. Conservation poster (24 × 36), Florida Museum of Natural History, Gainesville. Sergile, F. E., L. Walz, and C. A. Woods. 1992. Connaître et protéger la richesse naturelle d’Haïti. Conservation poster (24 × 36, with descriptive text). Florida Museum of Natural History, Gainesville. Woods, C. A., F. E. Sergile, and L. Walz. 1993. Sauvons Haïti, sa nature et son art. Conservation poster (24 × 36), Florida Museum of Natural History, Gainesville. Woods, C. A., F. E. Sergile, J. A. Ottenwalder, and L. Walz. 1994. Veye bwa peyi d’Ayiti. Yo inpòtan nèt, nè, nèt. Conservation poster (24 × 36), Florida Museum of Natural History, Gainesville.

Index A Abaco, bat fossil sites, 378–379 Abbott, W. L., 1 Academy of Sciences Cuba, 477 Annals, 477 Accipiter, 57 Acosta, J. de, 426 Acratocnus antillensis, description, 214–215 cladistics, 208, 209 comes, 58, 204 description, 213 odontrigonus, 202, 203, 213–214, 378 phylogeny, 206, 227, 228 ye, description, 215 Adaptations, functional, 55–60 Adaptive radiation, 16, 19 Adelpha iphicla, 135 Aepyornithidae, 56 Aerosals, 35, 48 Affinities, 131, 136–137 Africa Barylaus, 137 butterfly groups, 136–137 insectivoran relationships, 239, 241, 243, 246, 249 African beetle (Onthophagus gazella), 80 Afrotheria, 239 Agencies Belize Ministry of Natural Resources and the Environment, 439 Canadian International Development Agency (CIDA), 552 Colombia Ministerio del Medio Ambiente (MMA), 444 Economic Growth Division (USAID), 551 Florida Fish and Wildlife Conservation Commission, 455–456 Forestry school (EMAF, Haiti), 556 Inter-American Development Bank, 554 Ministry of Agriculture and Natural Resources (MARNDR, Haiti), 550, 556 Ministry of the Environment (MDE, Haiti), 550, 552, 554, 555, 556, 557 Natural Resources Conservation Authority (NRCA), 431, 432 United Nations, Environmental Coordination and Monitoring Unit (ECMU), 552 U.S. Agency for International Development (USAID), 4, 551, 552, 554, 555, 556 U.S. Fish and Wildlife Service, 455, 456, 553 Caribbean Office, 428, 430 U.S. Geological Survey’s Sirenia Project, 430 U.S. Marine Mammal Commission, 456

World Bank, 552 Agouti (Dasyprocta leporina), 490, 493, 495, 513 Agraulis vanillae, 135 Agrias, 137 Agriculture, 3, 514 Agriculture Society of Trinidad, 411 Agromizids, 80 Aguayo, C. G., 256 Aguna asander, 135 Alain, H., 2 Albian, 18 Albumin immunology, 157–170 Alectorobius, 86–87 Allen, G. M., 1, 237, 412, 426 Allen, J. A., 256 Allsopp, W. H. L., 448 Alsophis, 163, 168 Amazona (parrots or amazons), 175, 183–186, 187 leucocephala bahamensis (Rose-throated (Bahamas) parrot), 177, 183, 184 leucocephala hesterna (Cayman parrot), 177, 183, 184 martinicana (Martinique parrot), 177, 185, 186 undescribed sp. (Grenada parrot), 177, 185, 186 undescribed sp. (Montserrat parrot), 177, 184, 185 undescribed sp. (Turks and Caicos parrot), 177, 183, 184 versicolor? (St. Lucia parrot), 177, 185, 186 violacea (Guadeloupe parrot), 177, 185 cf. violacea (Guadeloupe parrot?), 177, 185, 186 vittata (Antigua (Puerto Rican) parrot), 177, 184, 185 vittata (Barbuda (Puerto Rican) parrot), 177, 183, 184 vittata gracilipes (Culebra parrot), 177, 183, 184 Amazon River, 27, 28 Amber ant fauna, 17 deposit dating, 17 Dominican fossils, 17, 122, 132 rhysodine beetles, 122 Amblyomma spp., 92–93, 97, 98, 100 colonization, 103 distribution, 95, 96, 103 Amblyrhiza inundata adaptation to island life, 58 extinction, 394 Ambulocetus (early whale), 195 Ameghino, C., 476 Ameghino, F., 475, 476 Ameiva, 162, 163, 168 ameiva, 163, 168 chrysolaema, 162, 168 exsul, 163, 168 leberi, 162, 168 spp., 169

561

562

Biogeography of the West Indies: Patterns and Perspectives

Amphibians, see also scientific names relationships/divergence times, 157–170, 172–174 Amphiocuns, 227 Amphisbaena, 161 cubana, 161 gonavensis, 161, 167, 169 innocens, 161, 167 manni, 161, 167 schmidti, 161, 167, 169 Amphisbaenidae, 158, 160, 161, 167 Analysis of variance (ANOVA) Geocapromys, 532, 536 Solenodon, 260 Anartia chrysopelea, 132 Anartia species, dispersal, 135 Anchovies (Engraulidae), 488 Andros, 379 Anegada Passage, 403, 404, 514 Anetia distribution, 145 origin, 129, 145 spp., 141 Anguidae, 158, 161, 167–168 Anguilla, bat fossil sites, 382 Anocentor nitens, 93–94, 95, 96, 97 Anodorhynchus (macaws), 175, 181, 187 martinicus (Martinique macaw), 181 purpurascens (Guadeloupe violet macaw), 181 Anolis distribution in Americas, 128 longiceps, hurricane transport, 21 origin, 17 Anthony, H. E., 1, 202, 203, 237, 375, 378 Anthropological Society (Cuba), 477 Antilles picolet (Nesoctites micromegas), 59 Antillogale marcanoi, 256 validity, 256, 257 validity of genus, 256 Antillophis, 163 Antilloscaris, 124 “Antiquity of man,” 478 Antricola spp., 90–91, 95, 96, 98 colonization, 103 life cycle, 86, 87 Antrozous, 393 Ants amber, 17 Cuba, 80 Aphelion, 46 Aphrissa godartiana, origin, 144 orbis, 132, 141 Aponomma spp., 92, 95, 96, 98 “Approachability,” 55, 56, 58, 60 Apternodus, 239, 241, 243, 246, 249, 255 brevirostris, 241, 242 Aquatic habitat, early lake filling, 43 Ara (macaws), 175–181, 187 atwoodi (Dominica macaw), 177, 178, 181 autochthones (St. Croix macaw), 177, 178, 180, 495

cf. guadeloupensis (Marie Galante (Guadeloupe?) macaw), 177, 178, 181 erythrocephala (Red-headed green macaw), 177, 178, 179 erythrura (Red-tailed blue-and-yellow macaw), 177, 178, 179 gossei (Gosse’s macaw), 177, 178, 179 guadeloupensis (Guadeloupe macaw), 177, 178, 180 martinica (Martinique macaw), 177, 178, 181 tricolor?/unknown sp. (Hispaniolan macaw), 177, 178, 179–180 tricolor (Cuban macaw), 176, 177, 178, 179 undescribed sp. (Montserrat macaw), 177, 178, 180 Araneidae/Tetragnathidae (orb-weavers), 108, 109, 110, 111–112 Aratinga (parakeets), 175, 181–183, 187 chloroptera maugei (Puerto Rican/Mona parakeet), 177, 182 euops (Cuban parakeet), 177, 181, 182 labati (Guadeloupe parakeet), 177, 182, 183 undescribed sp. (Barbudan parakeet), 177, 182–183 undescribed spp. (Dominica, Martinique, Barbados parakeets), 177, 182, 183 Arboricolous ticks, 87, 102 Archaeoprepona Charaxes, as sister genera, 137 genus, origins, 137 Archaic (Preceramic) people, 522, 523 Archimestra teleboas, origins, 137 Ardops, and Stenoderma, 358 Argasidae and colonization, 103 distribution, 95, 96, 97, 98 and hosts, 86–87 tick family, 87–91, 95, 96 Aridity, late Pleistocene, 41–42 Ariteus flavescens, 376 and Stenoderma, 358 Armadillo (Dasypus novemcinctus), 493 Arnett, R. Jr., 1 Arredondo, O., 204, 256, 259 Arrhyton landoi, 163, 164, 168 Artibeus anthonyi, 375, 376, 397, 402 jamaicensis core community, 365 diet, 359 as extant species, 377 in Florida, 355 fossils, 404 genetic distances, 355 and Hurricane Hugo, 362 invasion route, 359 lituratus, 397 review, 389 Asbolis capucinus, 132 Asher, R. J., 239–240, 246 ASSET project (Haiti), 554, 555, 556 Asteroid/comet (bolide) event, 19 Astraptes spp., 141

Index Atalopedes species, 135 Athis, 142 Atlantea, origin, 139 Atopogale, 256, 290 Atwood, T., 181 Autochthony, 108, 110, 112 Autochton sp., 135 Aves Ridge, see Land bridge/span model Aves Swell, 26 Avicennia, 446, 449 Avise, J. C., 345 Axelrod, D. I., 127

B Bacteria, 16 Bahamas bat extinctions, 398–401 bat fossil sites, 378 delay in human colonization, 45 manatee, 435–437 Bahamas platform, 18 Bahamian hutia, see Geocapromys ingrahami Bailey’s model, 414, 418 Baker, R. J., 355, 374 Baldwin, P. H., 414, 417 Ball courts, 522, 523 Ball, D. J., 414 Bangs, O., 176, 428 Banks, N., 450 Barbour, T., 1, 412 Barbuda, 383 Barker, L. W., 192 Barrett, O. W., 426, 427, 430 Barrett, S. F., 130, 134, 136 Bartram, W., 428 Barylaus Africa, 137 Puerto Rico, 124 Bates, H. W., 132 “Bat layers,” Jamaica caves, 376 Bats, see also scientific names activity, 362, 364 adaptations to island life, 56, 57, 60 assemblages deterministic factors, 364 stochastic factors, 365–366 biogeography, 355–366 community patterns, 359–364 community structuring, 364–366 Cuba fossils, 375–376 diet and size, 360, 361 distribution, 371–372, 403–404 extinctions, 394–403 Bahamas, 398–401 causes, 394–398 Cayman Islands, 401 Greater Antilles, 401–402 neotropics and Florida, 402–403 Northern Lesser Antilles, 402

563 flying foxes, adaptations to island life, 56, 57 geographical coverage of extinction study, 370, 372–375 geography and species, 355–358 guilds, 359–360, 361 interspecific competition, 364, 366 Isla de Pinos fossils, 376 patterns of extinction, 369–404 previous collections, 374 review of fossil sites, 375–383 Abaco, 378–379 Andros, 379 Anguilla, 382 Antigua, 382–383 Bahamas, 378 Barbuda, 383 Cayman Brac, 382 Cayman Islands, 381 Cuba, 375–376 Exuma, 380 Grand Caicos, 380–381 Hispaniola, 377 Ile de la Gonâve, 377 Isla de Pinos, 376 Jamaica, 376 Lesser Antilles, 382 New Providence, 380 Puerto Rico, 378 roosts, 360, 362, 363 routes of invasion, 358–359 size and diet, 360, 361 taxonomic/zoogeographic review of fossils, 383–394 as tick hosts, 87, 98, 99, 101 “whispering,” 359 Battus polydamas, 141 polydamas lucayanus, 141 spp., distribution, 141–142, 145 Baughman, J. L., 427 Belitsky, C. L., 432, 433 Belitsky, D. W., 432, 433 Belize, 437–439 Bell, J. R., 122 Bell, R. T., 122 Bell, S. K., 210 Bengtson, J. L., 437 Bertram, C. K. R., 426, 448, 449 Bertram, G. C. L., 426, 448, 449 Best, R. C., 450 Biblis hyperia, 135 Biodiversity Cuba, 77, 78 Haiti, 4 Biodiversity Conservation Strategy, 552 Biodiversity Support Program (BSP), 552, 553 Biogeography of the West Indies: Past, Present, and Future (Woods, editor), 1 Biologic Diversity Treaty of 1992, 444 Biosphere Reserve Sian Ka’an (Mexico), 457, 458 Biotic filter, 23, 29 Birds (grazing/browsing), and body mass, 56 Birney, E. C., 378

564

Biogeography of the West Indies: Patterns and Perspectives

Bivariate plot, 290 Bjorndal, K. J., 134 Blue mountains (Jamaica), 18, 140, 146 Boa constrictor, 164 Boa, Jamaican (Epicrates subflavus), 534 Body mass reduction, 55, 56, 58, 60 Bolide (asteroid/comet) event, 19 Bond, J., 2, 3, 176, 182 Bond, M. W., 2 Boobies (Sulidae) mean trophic level, 488 Native American use, 490, 511 Boophilus as “one host tick,” 86 spp., 94, 95, 96, 97 Borror, D. J., 77 Bos taurus (cattle), 481, 495, 513 Botanical Garden and Museum in Berlin, 2, 4 National Botanical Garden of the Dominican Republic, 2 Bottle drift studies, 28 Boyle, C., 447 Brachyphylla cavernarum, 382, 403 core community, 365 diet, 359 nana, 376, 379, 380, 382, 396, 402 subspecies, 382 review, 387–388 Bradbury, J. P., 45 Bradypus, 208, 209, 228 Brandt, J. F., 256, 301 Brazil, 449–451 Brephidium spp., origin, 137–138 Brooks, D. R., 68 Brooks parsimony analysis, 63, 68, 69 Brotomys, 377 Brown, F. M., 129 Brown widow (Latrodectus geometricus), 110 Brundin, L. Z., 127 Bruquids, in Cuba, 80 Bryan, J., 194 Buch, W., 2 Buden, D. W., 388 Buffon, G. L., 476, 477 Bufo, 157, 158, 159, 165–166 granulosus, 159, 165 guentheri, 159, 165 lemur, 165 longinasus, 159 marinus, 159 peltocephalus, 159, 165, 166 taladai, 159, 165 Bufonidae, 157, 158, 159, 165–166 Bugge, J., 242 Burke, K., 136, 148 Burns, J. M., 136 Butler, P. J., 176, 186 Butterflies, see also scientific names age of, 132–134

Cuba, 80 dispersalists, 134–136 endemism, 130–132 Lesser Antilles, 148 previous biogeographical studies, 128–129 vicariance/dispersalist model, 127–149

C Cabares potrillo, 135 Cabrera, A., 256, 290 Cacicazgos, 523, 524 Cadea blanoides, 161 Caladium arborescens, 448 Calcagno, F., 478 Calisto distribution, 140–141 origin, 129, 138, 139 Calpodes ethlius, 135 Calyptahyla crucialis, 159 Canis familiaris (dogs), 490, 493, 495, 513, 514, 516 Capra hirca (goats), 495 Capromys, 345, 381, see also Rodents divergence, 346 and extinction, 394 life cycle, 348 metabolic rate reduction, 348 Native American use, 490 pilorides, 99, 342, 343, 344, 495 ciprianoi, 342, 344 metabolic rate reduction, 58 relictus, 342, 344 relationships, 345, 350 Carabidae, rhysodine beetles, 117–124 Carbonate platforms, 27 Carbonate shells (freshwater), 37–38 Caribbean monk seal (Monachus tropicalis), 463 Caribbean plate movement of, 197–198 space for, 17 and volcanoes, 18 Caribbean Stranding Network, 430 “Caribs,” 525 Carlquist, S. J., 134 Carolia (oysters), 193 Carpenter, F. M., 133 Carson, R., 477 Cartelle, C., 383 Casas, B. de las, 179 Cascadura grass (Leersia hexandra), 447 Casimiroid people, 482 Cats (Felis catus), 495 Cattle (Bos taurus), 481, 495, 513 Cavallini, P., 410 Cavernicolous ticks, 87, 101, 102 Caves bat extinctions, 394–397, 398–399 and tick hosts, 87, 101 Cavia porcellus (guinea pig), 493, 513, 514 Cayman Brac, 382

Index Cayman Islands bat extinctions, 401 bat fossil sites, 381 Iguana iguana, 24 CEFET (Centre de formation et d’enseignement technique), 554 Celestus species, 161, 167, 168, 169 Centetodon, 246, 249, 255 Central Block, 18 “Central problem,” 19 Centre de formation et d’enseignement technique (CEFET), 554 Ceramic Age people, 514, 516 Ceratophyllum, 432 Cercopoidea, 80 Chamaeleolis, 139, 142 Chamaelinorops, 139, 142 ?Charactosuchus kugleri, 192, 196, 198 Charaxes and Archaeoprepona, 137 Charnock-Wilson, J., 437 Chichancanab, Lake (Mexico) climate change, 36–37, 45, 46, 48, 49 early lake filling, 42–43 in Holocene, 44 timing of climate changes, 38, 39, 40, 41 Chickens (Gallus gallus), 495 Chiefs (Taíno caciques), 523, 524 Chiomara sp., 135 Chiropterophiles, 86, 101, 102 Chivas, A. R., 37 Chloris sp., 458 Chlorostrymon species, 135 Choate, J. R., 378 Choloepodinae, 211–220 Choloepus, 201, 208, 209, 227–228 Choranthus (Hesperiidae) origin, 129, 142–143 relation to Paratrytone, 144 Christensen, C., 2 Chrysochlorids, 237, 238, 239, 246, 255 Cicadoidea, 80 CITES, 433–434, 439, 443, 444, 449 Cittarium pica, 499 Cladistics biogeographers, 21 current work, 4 and dispersal model, 21 Eunica and relatives, 137 Heraclides spp., 141 insectivorans, 239–241 Lyonia sect. Lyonia, 63, 65–68 rodents, 338–341, 345, 346, 347 sloths, 206–210 Clark, A. H., 180, 181 Clarke, H., 531 Clarke, M., 192 Clark, J. M., 192 Classification bats, 383–394 Florida spiders, 109 parrots, 176–187

565 rhysodine beetles, 121 rodents, 336–338 sloths, 210–225 Solenodon, 294–315 ticks, 87–94 Clench, H. K., 128–129, 134, 144 Clidomys spp., 394 Climate, 111–112 Climate changes and biogeography, 49–50 in late Pleistocene and Holocene, 41–45, 50 local conditions effects on, 48–49 Lyonia sect. Lyonia, 72 overview, 35–37, 45–49 timing of changes, 38–41 use of oxygen isotopes in studying, 37–38 Climate controls, 46–48 Clinidium, subgenus Clinidium, distribution, 118 Clinidium genus distribution, 121 flightlessness, 121 origin, 123 Clinidium guildingii Group, origins, 123 Clinidium species boroquense, 123 darlingtoni, 123 extrarium, 123 gilloglyi, 122 humeridens, 124 incudis, 122, 123 moldenkei, 122 oberthueri, 123 sulcigaster, 122 Clinidium s. str., origins, 123, 124 Clinidium (s. str.) beccarii Group, 121, 122, 123 Clinidium subgenus Protainoa, origins, 123 Clinidium subgenus Tainoa, origins, 123, 124 Cnemidophorus uniparens, 163, 168 Coba, Lake (Mexico) climate change, 36–37, 45, 46 early lake filling, 42–43 timing of climate changes, 38, 40, 41 Coblentz, B. A., 416 Coblentz, B. E., 416 Cockroaches, 80 Coenobita clypeatus (hermit crab), 511 Coenocorypha (snipes), 60 Coleoptera (beetles), 80 Colmenero-Rolón, L. C., 458 Colobura dirce, 135 Colombia, 444 Colonization of islands, 55 Colubridae, 158, 163, 168 Columba spp. (pigeon), 59 Columbus, C., 180, 183, 426, 513, 519, 523, 524 Comard, Reverend, 179 Comet/asteroid (bolide) event, 19 “Commission Mixte Haitiano-Dominicaine,” 551 Common, I. F. B., 133, 134, 136 Congruence of “tracks,” 21 Conservation, see Haiti, conservation; Manatee, conservation

566

Biogeography of the West Indies: Patterns and Perspectives

Conucos, 524 “Coordination system,” Haiti/Dominican Republic, 551 Coriolis force, 26 Cormorant (Galápagos), 57 Corporación Autónoma Regional de los Valles del Sinu y del San Jorge (CVS), 444 Costa Rica, 441–442 Crabs, hermit (Coenobita clypeatus), 511 Crabs, land (Gecarcinidae) “crab culture”/“shell culture,” 493 Native American use, 490, 493, 503, 510–511, 514, 516 Cretaceous, butterflies, 136–139 Cricosaura (xantusiid lizard), 22 Crocodilians, 196 Crocodylus intermedius, 24 rhombifer, 157 Crocothemis servilia, 80 Croizat, L., 127 Cro-Magnon man, 478 Cronin, J. E., 158 Crotaphytine lizards, and Leiocephalus, 168 Crotaphytus collaris, 162 Cruz, J. de la, 85 Crypto-depressions, 37 Cuba bat fossil sites, 375–376 biodiversity, 77, 78 Chamaeleolis, 139, 142 conservation, 556 Ekman’s work, 1–2 historical biogeography, 475–478 insects, 77–81 and isolation, 477 manatee, 434–435 sloths, 201, 202, 203, 204, 205, 226, 227 “Cuban group” (clade), Lyonia sect. Lyonia, 65, 66, 67, 69 Cubanocnus, 204 “Cuban spp.,” Lyonia sect. Lyonia, 65, 66 Cumbaa, S. L., 428 Cuní, L. A., 426, 435 Curaçao, 201, 203 Current flow dispersal model, 19–21, 26–28, 30 Loop Current, 246 Curtis, J. H., 37, 38 CVS (Corporación Autónoma Regional de los Valles del Sinu y del San Jorge), 444 Cyanolimnas cerverai, 58 Cyclura (iguanid lizards) as endotherm replacement, 60 and humans, 530, 538–539 Cyperus, 448 Czaplewski, N. J., 383

D “Dagbok” (Ekman), 2 Dampier, W. A., 426, 427 Danaidae, 139

Danaus cleophile, origin, 144 dispersal, 134, 135 Darlingtonia, 163, 168 Darlington, P. J., 3, 4, 55, 127, 128, 134 Darwin, C., 55 Dasyprocta leporina (agouti), 490, 493, 495, 513 Dasypus novemcinctus (armadillo), 493 Deforestation, 48, 442, 450 Dekker, D., 448 Density compensation, 365–366 Dermaptera, 80 Desmodus review, 390–391 rotundus, 376, 397 Cuba, 375 fossil records, 360 rotundus puntajudensis, 375 Deutsch, C. J., 453 Dewey, J. F., 4, 128, 130, 134, 136, 139 evolution of West Indies, 142–143 and Pterourus origins, 146 Dianesia carteri, 139 Dilambdodonts, 237, 238, 255 Dinornithidae (moas), 56 Dinosaurs, 19 Dione juno, 135 Diploglossus spp., 161, 167, 168, 169 Diptera (flies), 80 Dira, 138 Dismorphia dispersal, 135 spio, origin, 144 Dispersal butterflies, 135 by wind, 72, 73 of insects, 80 overwater, 35 butterflies, 134 current flow, 19–21, 26–28, 30, 246 evidence for, 19–21 flotsam, 19–21, 24 insectivorans, 243, 246, 247, 249 rhysodine beetles, 120–121, 123 sloths, 227, 475 spiders, 110 taxa differences, 24 Dispersal model, 226 and butterflies, 128–129 description, 15 evidence for, 19–22, 30 and Solenodon, 321, 322 Dispersal/vicariance model, butterflies, 127–149 La Disputa de Nuevo Mundo (Gerbi), 476 Divergence times, 23 Diversity bacteria, 16 Cuba, 140–141 current, 15 fungi, 16 genetic, 331–334

Index Haiti, 549–550 Hispaniola, 140–141 human, 523, 524, 525 and island size, 399, 421 land mammals, 370 Lesser Antilles, 148 protists, 16 terrestrial vertebrates, 17 Dobsonia (flying foxes), 56, 57 Dogs (Canis familiaris), 490, 493, 495, 513, 514, 516 Dominican Republic conservation, 551, 556 Ekman’s work, 1–2 manatees, 432–434 sloths, 204 terrestrial (emergent) center, 18 Dominican Republic/Haiti “coordination system,” 551 “Subcommission on Biodiversity,” 551 Domming, D. P., 192, 196, 449, 450, 459, 461 Donnelly, T. W., 139, 196, 198 Doxocopa laure, dispersal, 135 willmattae, fossil, 133 Draper, G., 192 Droughts in late Holocene, 45, 50 Maya collapse, 45, 48 Droxler, A. W., 26 Dryas iulia dispersal, 135, 141 in Lesser Antilles, 148 Dryinids, 80, 81 Ducks, 57 Ducula spp. (fruit-pigeons), 57, 59 Duerden, J. E., 426 Dugong (Dugong dugon), 425 Duncan’s Multiple Range Test, 260, 268–287 Duplaix, N., 448, 449 Durden, C. J., 139 Du Toit, A. L., 127 Dvorak, S. V., 129, 136, 139 Dynamine species, 135

E Eantis mithridates, 135 Ear area studies, insectivorans, 241–243 Echinops telfairi (tenrec), 332 Ecole Moyenne d’Agroforesterie, 554, 556 Ecological zoogeography (ticks), 100–103 Ectotherms, replacement of endotherms, 55, 57–58, 60 Edgar, N. T., 22, 348 Eichhornia, 446, 449, 455 Eichhornia crassipes (water hyacinth), 447, 458 Ekman, E. L., 1–2, 3 Elasmodontomys, 349, 350, 378 Electrostrymon angelia angelia, 132 Eleutherodactylus (frog) and carnivorous bats, 360

567 cooki, as tick host, 100 fossil, 17 origin, 22, 30, 146 radiation, 17 Eliot, J. N., 138 Ellerman, J. R., 409 El Niño and La Niña events, 56 Embargo, on Haiti, 4, 556 Emergent centers, first terrestrial, 18 Emerson, G. L., 239 Endemic species, 25 Endemism butterflies, 130–132 Cuban insects, 77, 80, 81 Haiti, 547, 549 history of, 15 Lyonia sect. Lyonia, 64, 65, 69 Mercranium, 73 Pictetia, 73 Poitea, 73 rodents, 336–338 Sabal, 74 Endler, J. A., 134 Engelmann, G. F., 205, 206 Enrico, P., 148 Environmental catastrophes, see also Hurricanes and survival of species, 19, 55–56 Epargyreus sp., dispersal, 135 E/P (climate indicator), 37–38, 41–44, 49, 50 Ephemeroptera (mayflies), 80 Ephyriades, 148 Epicrates subflavus, (Jamaican boa), 534 Epidemics, and Europeans, 524 Eptesicus, 382 Eptesicus serotinus, 358 fuscus, 376, 378, 382, 397, 398 diet, 365 foraging, 359 invasion route, 358 subspecies, 382 as tick host, 103 review, 393 serotinus, 358 Equus caballus (horses), 495 Eresia frisia, 135 Eretris distribution, 140–141 relationship to Calisto, 138 Erinaceids, 238 Erinaceus europaeus (hedgehog), 332 Erophylla metabolic rate, 365 review, 388 sezekorni, 378, 379, 380, 396, 398 Erophylla sp., 365 Erosion, and dry land, 18 Erynnis zarucco, dispersal, 135 Espeut, W. B., 410, 411, 412 Estrada, A. R., 435 Etheridge, R. E., 168 Eueides melphis, 135

568

Biogeography of the West Indies: Patterns and Perspectives

Eumaeus, 139 Eumops glaucinus, 358 Eunica spp. dispersal, 135 origin, 137 Euphyes spp., origin, 144 Euploea, 145 Euptoieta sp., 135 Eurema, 135 Eurytides celadon, 132 sp., dispersal, 135 Euthynnus alletteratus, 499 Evaporation (E), and paleoclimate reconstruction, 37–38 Everard, C. O. R., 410, 412, 416, 417 Evermann, B. W., 426, 430 Excavation methods, 483 Extinction butterflies, 133 by humans, 35, 55, 58, 60, 394 by large bolide, 19 and climate change, 49–50 dispersal model, 25 insectivores, 253, 331 Exuma, 380

F Felis catus (cats), 495 Ferguson, J. C., 460 Fernández de Castro, M., 475, 476, 477 Ferrer, L. T., 435 Fewkes, J. W., 426 FHE (Foundation haïtenne pour l’environement), 554 Findley, J. S., 359 Fisher-Ford model, 414, 418 Fisher’s exact probability, 414 Fishes Jamaican fossils, 192, 196 Native American use, 497, 499–500, 514–516 Fishes, flying (Exocoetidae), 488 Fitch, J. E., 192 Fleming, T. H., 364 Flemming, C., 335, 348 Flightless birds as adaptation to island life, 55, 56–57, 58, 60 Native American use, 490, 495 Flint, O. S., Jr., 137 Flora, 16 Florida bats, 403 filling of lake basins, 42 manatee, 451–456 spider fauna from the Caribbean, 107–113 Flotsam, see Dispersal, overwater Fondation pour la protection de la biodiversité marine (FOPROBIM), 554 FOPROBIM (Fondation pour la protection de la biodiversité marine), 554

Forbes, W. T. M., 133 Forest and Environmental project, 552 Forey, P. L., 68 Fossils, see also Bats, review of fossil sites; Geocapromys brownii; Humans, Native Americans butterflies, 132–134 capromyid, 17, 381 evidence of climate change, 50 Jamaican vertebrates from Tertiary, 191–198 Lepidoptera, 132 manatee, 459 Quaternary deposits, 17 rhysodine beetles, 122 sloths, 28, 477 Foundation haïtenne pour l’environement (FHE), 554 Fourth International Congress of Americanists, 475 Fox, R. M., 128 Freeman, P. W., 394 Frost, D. E., 168 Fruit-dove (Ptilinopus), 57 Functional adaptations, to island life, 55–60 Fungi, 16

G GAARlandia, see Land bridge/span model Galápagos Islands, 56, 57–58 Galerocnus jaimezi, 232 Gallinules Gallinula chloropus, 490, 511 Porphyrula martinica, 490, 511 Gallus gallus (chickens), 495 Gannon, M. R., 359, 362 Garcia-Rodriguez, A. I., 453, 461 Garifuna people, 525 Gastropods (freshwater), 37 Gaudin, T. J., 206 “Geese,” flightless, adaptations to island life, 56 GEF (Global Environmental Fund), 551, 555 General Linear Model (GLM-ANOVA), 260, 261, 268 Genetic diversity, 331–334 Genoways, H. H., 355, 374, 388, 391 Geocapromys brownii, see also Rodents divergence, 343, 394 hunting impact, 529–542 captive breeding, 530, 539 hunter survey, 533–535, 538 methods of study, 531–535 stable age structure explanation, 539–542 zooarchaeological sites, 529–531, 536, 537, 538 life cycle, 529, 539 Native American use, 490, 514 divergence, 346, 348, 350 and extinction, 394 fossils, 381 ingrahami, 343, 379, 394, 495, 530, 531 abaconis, 378–379 population densities, 533, 538

Index Native American use, 490 spp. metabolic rate reduction, 58 re-introduction, 5 thoractacus (Swan Island hutia), 530, 540 Geochelone (tortoises), 60 Geogale, 243 Geographic regions, Lyonia sect. Lyonia study, 68–69 Geological history, summary, 17–19, 128 Gerbi, A., 476 Gesta gesta, 135 Gina (manatee), 436 Global Environmental Fund (GEF), 551, 555 Glossophaga, 389, 404 Gnaphosidae (ground spiders), 108, 109, 110, 111–112 Goats (Capra hirca), 495 Gonatodes albogularis, dispersal model, 25 Gonâve Ekman’s work in, 2 sloths, 201, 203 Gondwana, formation, 17, 136 Goodwin, R. E., 396 Gosse, P. H., 179 Grais sp., 135 Gramineae (true grasses), 459 Grand Caicos, 380–381 Grazing/browsing birds, and body mass, 56 “Great American faunal interchange,” 128 Greater Antilles bat extinctions, 401–402 butterflies, 127–148 Greenway, J. C., 179, 180, 181 Grenada, 201, 203, 205 Greta spp., 143 Griffiths, T. A., 365 Grimaldi, D. A., 248 Grouvellina, 121 Grunts (Haemulidae), 490 Guatemala, 439–440 Guiana Current, 27 Guiana Shield, 27–28 Guinea pig (Cavia porcellus), 493, 513, 514 Gundlach, J., 426 Gunter, G., 457 Guyana, 447–448 Guyer, C., 128, 134, 139 Gymnodinium breve (red tides), 447, 456

H Habanocnus hoffstetteri, 204 paulacoutoi, 204 Haemaphysalis leporispalustris, 94, 95, 96, 97 Haiti agricultural programs, 3 biodiversity, 4, 549–550 conservation, 4, 547–557 with Dominican Republic, 551

569 education, 552–554 efforts, 550–557 and political instability, 550, 555, 556, 557 and socioeconomic hardships, 550, 555 Ekman’s work, 1–2 endemics, 547, 549 government (GOH), 550, 551, 552, 555 management plans, 554 manatee, 434 need for National Parks Service, 556–557 physiography, 547–549 protected areas, 548, 551, 552, 553 sloths, 204–205 Haiti-NET, 553 Halodule, 431 Halodule wrightii, 450, 455 Hamadryas amphicloe, 132 amphinome, 132 amphinome mexicana, 132, 135 feronia, 132 Hapalops, cladistics, 208, 210 Harlan, R., 427 Hartman, D. S., 451, 455 Hedgehog (Erinaceus europaeus), 332 Hedges, S. B., 1, 4, 23, 163, 167, 169, 226 Hegel, G. W. F., 476 Heidelberg man, 478 Heineman, B, 129 Heliconius charitonius, 135 Hemiargus hanno, 135 Hemicentetes, 242 Hemidactylus spp., 25 Hennig86, 65, 66, 69 Hennig, W., 127 Heptaxodontid rodents, 349, 350 Heraclides cresphontes, dispersal, 135, 141 machaonides, origin, 144 origin, 139 spp., origins, 141 thoas, dispersal, 135, 141 Herbarium Ministry of Agriculture in Haiti, 2 University of Florida, 2 Herpestes auropunctatus, 409–410 Herpestes javanicus age determination, 414 age distribution, 415, 416–418, 419 biogeography/population biology, 409–422 current distribution, 412–413 diet, 410 genetic variation/structure, 412 habitats sampled, 415–416 habitat use, 418, 420–421 history of introduction, 409–412, 513 methods of study, 413–416 population biology, 413–416 population densities, 418, 420–421 sex ratio, 416

570

Biogeography of the West Indies: Patterns and Perspectives

Herpetophiles, 86, 101, 102 Herrings (Clupeidae), 488 Hershkovitz, P., 243, 244, 245, 246 Hesperia nabokovi, 147 Heteroplasmy, 332 Heteroptera (bugs), 80 Hexolobodon, 350 Higuera-Gundy, A., 50 Hispaniola bat fossil sites, 377 Chamaelinorops, 139, 142 Ekman’s work, 2 insects in, 80–81 sloths, 201, 203, 204, 227 “Hispaniolan group” (clade), Lyonia sect. Lyonia, 66–67, 68, 69 “Hispaniolan spp.,” Lyonia sect. Lyonia, 65, 66 Historis acheronta, 135 odius, 135 History, human, 370, 394, 519–525 Europeans, 523–525 indigenous legacies, 525 migration from Central America, 519–520 migration from Trinidad/South America, 520–521 post-Saladoid changes, 522–523 Saladoid migration, 521–522 Hoagland, D. B., 410, 412, 413, 416 Hodell, D. A., 37, 38 Hogna ericeticola (rosemary wolf spider), 112 Hogue, C. L., 77 Holcombe, T. L., 22, 348 Holmes, J. A., 37 Holocene bats, 398, 400, 401, 403, 404 butterflies, 147–148 climate changes, 43–45 sloths, 201 Homo cubensis, 475, 476 pampaeus, 476 Honduras, manatee, 440 Hoogstraal, H., 86, 101 Hooijer, D. A., 204 Horses (Equus caballus), 495 Hosts (of ticks), 85, 86, 87–94, 97–101, 103 Humans effects on parrots, 175–176, 187 extinctions by, 35, 55, 58, 60, 394 history, 370, 394, 519–525 Native Americans, use of animals, 481–516 aquatic fauna, 514–516 archaeological sites, 482, 483 bias in study, 483 biomass estimates, 485, 486 captive/domestic animals, 512–514 European introductions, 495 from coral reefs, 497, 499 from inshore, estuarine, pelagic waters, 499–500 introduced domestic/captive species, 493, 495 land vertebrates/invertebrates, 510–512

material/methods of study, 482–484, 486, 488, 490 mean tropic levels, 484, 486–512 native terrestrial species, 490, 493 overfishing, 515 presence on islands, 55 Hummingbirds reduction in body mass, 58 and torpor, 60 Hurricanes bats, 362 butterfly transport, 129, 134 effects on islands, 415 gigantic (hypercanes), 19 insect dispersal, 80 overwater dispersal, 21 rhysodine beetles transport, 123 survival of species, 56 Hurst, L. A., 432 Husar, S. L., 426, 432, 444 Husson, A. M., 448 Hutia, see Geocapromys; Isolobodon Hydrilla, 455 Hydrilla verticillata, 455 Hydrocotyle umbellata (pennywort), 447 Hyla heilprini, 159, 160, 166 marianae, 159 pulchrilineata, 159 vasta, 159, 160, 166 wilderi, 159 Hylephila phyleus, 135 Hylidae, 157, 158, 159–160, 166 Hymenoptera (bees), 80 Hypercanes (gigantic hurricanes), 19 Hypolimnas misippus, 135 Hypsirhynchus, 163 Hyrachyus sp. (rhinocerotoid perissodactyl) discovery, 246, 247 as Stage I mammal, 192, 196, 198, 249

I Ialtris, 163 Ibis, 58 Iguana iguana, 24 Iguanas, green, 21 Iguanidae, 158, 162, 168 Iguanid lizards as endotherm replacement, 60 fossils, 22, 196, 198 Native American use, 490, 512 Ile de la Gonâve, 377 Ile de la Tortue, 201, 203 Image, New World, 476–478 Imagocnus zazae Cuba, 203, 205, 226 description, 224 Immunological data, 24 Immunological distance (ID), 158 Incertae sedis, 224–225

Index Indian coney, see Geocapromys brownii Insectivorans, see also scientific names evolutionary relationships, 254–255 origin, 237–249 phylogenetic studies, 238–243 Insect nets, 79 Insects, 77–81 Insolation, 35, 46–48, 50 Inter-Tropical Convergence Zone (ITCZ), 46, 50 Introductions (of species) by humans, 35, 55, 481, 495, 512–514, 550 European, 495 and extinctions, 394 insects, 80 mongoose, 409–412 plants, 481 Solenodon, 331 Invertebrates adaptive radiation, 16 diversity, 16 Ipomoea aquatica (Kharmi bhaji), 447 Ircila hecate, 142 Irwin, D., 345 Isla de Pinos, 376 Island chain as biotic filter, 23, 29 vs. land bridge, 22, 23, 29 Isolobodon fossils, 377 Native American use, 490, 495, 513 portoricensis, 335, 348, 495 relationship, 350 Ithomiidae dispersal, 134 and land bridges, 128 Iturralde-Vincent, M. A. and Cricosaura, 22 data shortcomings, 323 hypothesis, 5, 227 Isolobodontinae, 348 land bridge model, 16, 22–30, 226 land bridge and rodents, 347, 348 land mammals, 321, 322 land span hypothesis, 247–248 paleographical reconstruction, 18 plate tectonics, 4 sloths, 205 Zazamys veronicae, 335, 350 Ixodes spp., 95, 96, 103 Ixodes spp. (ticks), 92, 98, 99, 100 Ixodidae, 92–94, 95, 96 Ixodid ticks, 86 Ixodoidea, 87–94

J Jackson, J. F., 450 Jamaica area above sea level, 18 bat fossil sites, 376

571 blue mountains, 18, 140, 146 cave “bat layers,” 376 cave “lizard layers,” 376 ?Charactosuchus kugleri, 192, 196, 198 in early Holocene, 43 Eocene fossils, 22 manatee, 431–432 mongoose study, 409–421 Rhysodine beetles, 124 tectonics/paleogeography, 192–193, 196–198 vertebrate fossils from Tertiary, 191–198 Jamaican barn owl (Tyto alba), 534 Jamaican boa (Epicrates subflavus), 534 Jamaican hutia, see Geocapromys brownii Java (Pithecanthropus) men, 476, 478 Jefferson, T., 476, 477 Jenkins, D. W., 137 Jiménez, P. I., 442 Johns, G. C., 345 Johnson, K., 136, 146 Jolly-Seber stochastic model, 414, 418 Jones, J. K., Jr., 355 Jordan, D. S., 477 Jordan, K., 541 Judd, W. S., 65, 66, 67 Junonia species, 135

K Kalko, E. K., 359 Karst landscape, and Geocapromys, 541 Khan, J., 447 Kharmi bhaji (Ipomoea aquatica), 447 Kilpatrick, C. W., 412 Kim, K. C., 101 Kinnaridae, 80 Kiwis, 57 Klingener, D. J., 6, 7, 8 Kodiak bear (Ursus arctos middendorffi), 56 Koopman, K. F., 256, 355, 358, 404 bat distribution, 374, 375 bat fossils, 376, 377, 378, 380 bat taxonomy, 388, 390, 391, 393 “Koopman’s Line,” 355 Kraglievich, L., 206, 226 Kretzoi, M., 204

L Labandeira, C. C., 133, 136 Labat, J. B., 180 Lake filling, 42–43 Lake sediment cores, 36–37 Land bridge/span model animal distribution, 22–30, 35, 475 butterfly dispersal, 128, 134 dispersal of mammals, 5, 322 insectivoran origins, 247–248, 249 Jamaican fossils, 198

572

Biogeography of the West Indies: Patterns and Perspectives

modification of hypotheses, 28, 247–248 paleogeography, 16, 22–23, 127 rodents, 347–348 Solenodon, 322, 323 timing, 226, 227, 349 Langworthy, M. A., 204 Lapidicolous ticks, 87, 102 Larval hostplant associations, 129, 133 Lasiurus borealis Hispaniola, 377 invasion route, 358 intermedius, 377, 397, 402 review, 393 Latrodectus geometricus (brown widow), 110 Laurasia, 17, 136 Leersia hexandra (cascadura grass), 447 Lefebvre, L. W., 426 Legislation, conservation Archipelagic Waters and Exclusive Economic Zone Act (Trinidad), 447 Article 49 of Fisheries Law, Decree No. 154 (Honduras), 440 Belize Wildlife Protection Act of 1981, 439 Conservation of Wildlife Act (Trinidad), 447 Decree 707, Article 39 (Cuba), 435 Decree 2724, Article 75 (Cuba), 435 Endangered Species Act (U.S.), 430, 456 Executive Decree No. 23 (1967, Panama), 443 Fisheries Act (Trinidad), 447 Fisheries Ordinance No. 30, Revised No. 13 (1961, Guyana), 448 Fishing Law of 1955 (Cuba), 435 Florida manatee law (1893), 428, 546 Florida Manatee Sanctuary Act of 1978, 456 Forest Act (Trinidad), 447 Law 17 (1981, Colombia), 444 Law 165 (1994, Colombia), 444 Legislative Decree 306 (1956, Nicaragua), 441 La Ley de Pesca del Estado Libre Associado (1943), 430 Ley de Protección a la Fauna Silvestre of 1970 (Venezuela), 446 La Ley de Vida Silvestre (1977, Puerto Rico), 430 Regulation to Govern the Management of threatened and Endangered Species in the Commonwealth of Puerto Rico, 430 Resolución MARNR No. 127 of 1978 (Venezuela), 446 Resolution 574 of INDERENA (1969, Colombia), 444 Resolution DIR-002-80 (Panama), 443 Suriname’s Nature Protection and Game Ordinances, 449 U.S. Fish and Wildlife Service’s Refuge Management Authority Act, 456 U.S. Marine Mammal Protection Act of 1972, 430, 456 Wild Life Protection Act (1971, Jamaica), 431 Leidy, J., 202 Leiocephalus greenwayi, 162, 168 inaguae, 162, 168 loxogrammus, 162, 168 punctatus, 162, 168 schreibersi, 162

Leodonta genus, 133 Lepidoptera, see Butterflies Leptotes cassius, 132, 135 Leptotyphlops bilenta, 23–24 sp., 165 Lerodea eufala, 135 Lesser Antilles bat fossil sites, 382 butterflies, 148 Leyden, B. W., 38 Libytheana motya, 132 Liebherr, J. K., 85, 137, 138 Ligaeids, 80 Ligon, J. D., 59, 60 Lincoln Index, 414, 418 Lindman, C., 2 Lineages analyzed, dispersal, 23–24 Liogier, A. H., 2 Liotyphlops sp., 165 Lipotyphlan, see Insectivorans Lips, K. R., 167 Liu, F.-G. R., 239 “Lizard layers” (Jamaica caves), 376 Lluch-Belda, D., 458 Looking for the Link (Calcagno), 478 Lycaenidae dispersal, 134 and dispersal model, 129 Lycorea ceres atergatis, dispersal, 135 cleobaea, 139 dispersal, 135 origin, 139 Lycosidae (wolf spiders), 108, 109, 110, 111–112 Lyonia sect. Lyonia biogeography, 63, 68–74 description, 63–64, 67, 68 distribution, 63, 64–65, 69–71 phylogeny, 65–68

M Mabuya bistriata, disperal model, 24 lineolata, origin of, 23–24 mabuya, disperal model, 24 MacArthur Foundation, support in Haiti, 4, 551, 553 MacArthur, R. H., 55, 128, 399 Macaws (Anodorhynchus), 175, 181, 187 (Ara), 175–181, 187 Macaya Biosphere Reserve project, 552 MacFadden, B. J., 243–244, 245, 247, 321 Machaerium lunatum, 448 MacLaren, J. P., 443 MacPhee, R. D. E. Cricosaura, 22 data shortcomings, 323 hypothesis, 5, 227

Index insectivoran studies, 242, 255 Isolobodon portoricensis, 335, 348 Isolobodontinae, 348 land bridge model, 16, 22–30, 198, 226 land bridge and rodents, 347, 348 land mammals, 321, 322 land span hypothesis, 247–248 paleographical reconstruction, 18 plate tectonics, 4 Seven Rivers mammal, 196 sloths, 205 Zazamys veronicae, 335, 350 Macroglossus (flying foxes), 57 Macromastophiles, 86, 101, 102 Macrotus waterhousii, 378, 379, 380, 381, 383, 402 colonization, 404 and extinction, 397 as fossil, 377, 378, 382 review, 386–387 subspecies, 381 The Magic Island (Seabrook), 2 Magor, D., 437 Malaise trap, 79 Manatee aerial surveys in Quintana Roo (Mexico), 457 analysis of mitochondrial DNA (mtDNA), 461 biogeographical patterns, 459–461 biogeography, 459–461 conservation, see also Legislation, conservation Bahamas Marine Mammal Survey, 436 Belize Manatee Recovery Plan, 439 Biologic Diversity Treaty of 1992, 444 Biosphere Reserve Sian Ka’an, Mexico, 457, 458 Brazilian aquatic mammal action plan (IBAMA), 451 Caribbean Stranding Network, 430 CITES, 433–434, 439, 443, 444, 449 “Comite Consultivo para la Proteccion y Recuperacion del Manatí del Caribe en México,” 459 Corporación Autónoma Regional de los Valles del Sinu y del San Jorge (CVS), 444 Florida Manatee Recovery Plan, 456 Manatee Center (Brazil), 450 Manatee Subcommittee of the Trinidad and Tobago Field Naturalist’s Club, 447 National Recovery Plan (Colombia), 444 National Workshop on the Protection and Management of Manatees (Cuba), 435 Operation Sea Cow, 432 PROFAUNA, 446 Project Mermaid, 446 Prospectiva Ambiental Dominicana, 434 protected area (Mexico), 459 public education, 430, 446, 447, 450–451, 459 Ramsar conventions, 443, 447 recovery plan (Mexico), 458 U.S. Geological Survey’s Sirenia Project, 430 freshwater need, 430, 431, 436, 440, 455, 458, 460, 461 genetic diversity, 461, 462 historical distribution, 426–428 life history traits, 454

573 Native American use, 486, 503 present distribution/status/habitat, 428–459 Bahamas, 435–437, 460 Belize, 437–439 Brazil, 449–451 Colombia, 444 Costa Rica, 441–442 Cuba, 434–435 Dominican Republic, 432–434 Guatemala, 439–440 Guyana, 447–448 Haiti, 434 Honduras, 440 Jamaica, 431–432 Mexico, 456–459 Nicaragua, 440–441 Panama, 442–444 Puerto Rico, 428–431 Suriname, 448–449 Trinidad, 447 United States, 451–456 Venezuela, 444–447 status/biogeography, 425–463 teeth, 460 threats cold temperatures, 428, 456, 460 dredging, 432 entanglement in fishermen’s nets, 430, 432, 433, 434, 435, 440, 442, 448, 450, 456, 458 exploitation for bones, 433, 434, 448 exploitation for oil, 434 habitat destruction/disturbance, 432, 433, 442, 444, 446, 447, 450, 455, 458 hunting, 426–428, 430, 433, 441, 442, 444, 446, 450 petroleum extraction explosions, 435 poaching, 430, 431–432, 433, 435, 439, 443–444, 448, 458 pollution, 432, 435, 442, 447, 450 shark predation, 433 siltation, 430, 442, 447, 450 stranding, 450 watercraft collisions, 430, 448, 449, 456, 458 wetland drainage, 428 Trichechus inunguis (Amazonian manatee), 425, 449, 459 Trichechus senegalensis (West African manatee), 425, 459 Mandibular tooth row (MTR) measurements, 532, 535, 536 Manioc, 481, 524 Maniola jurtina, 134 Markgraf, V., 42 Mark–recapture technique, 414 Marpesia chiron, 135 petreus, 135 Matrilineal society, 524 Matthew, G. A., 127 Matthew, W. D., 1, 202, 204 Maury, R. C., 128, 148 Maya civilization, 44–45, 48 Mayo, N. A., 391

574

Biogeography of the West Indies: Patterns and Perspectives

McClenaghan, L. R., Jr., 453 McDowell, S. B., Jr. hypothesis, 243, 244, 245, 246, 255 insectivorans, 239, 241 McKenna, M. C., 210, 255 McKillop, H. I., 426 Mayflies (Ephemeroptera), 80 Mean trophic levels, 484, 486–512 calculation, 486, 488, 490 Hichman’s shell heap, 509 Hichman’s site, 508 marine vertebrates, 501 site En Bas Saline, 489 site Indian Castle, 507 site Maisabel, 491–493 site Sulphur Ghaut, 506 site Tutu, 496–499 summary, 512 vertebrates at site Chancery Lane, 510–511 vertebrates at site Golden Rock, 505 vertebrates at site Hope Estate, 500, 502 vertebrates at site Kelbey’s Ridge, 503–504 vertebrates at site Lujan, 494–495 vertebrates at site MC-6, 487 vertebrates at site MC-12, 488 Medhurst, C. W., 531 Megalocninae, sloths, 206, 220–225 Megalocnus cladistics, 208 comparison, 204, 205, 227 description, 221 phylogeny, 206, 227 rodens description, 221–222 discovery, 202, 203 zile, description, 222 Megalomys spp., extinction, 394 Megalonychid sloths, see Sloths Megalonyx (“big claw”), 477 Megatherium, 477 Melete salacia, dispersal, 135, 141 Mellisuga helenae (bee hummingbird), 58 Meloids, 80 Melonycteris, 57 Membracidae, 80 Mercranium, 65, 73 Merola-Zwaretjes, M., 59, 60 Mertens, R., 293 Mesocapromys angelcaberai, 343, 344 divergence, 346, 349, 350 Mesocnus, 202, 204 Mesozoic (late), 136–138 Mestra, 137 Metabolic rate reduction, 55, 57, 58–60 Mexico, 456–459 Microcnus discovery, 202, 204 gliriformis, 204 phylogeny, 206 Micro-complement fixation (MC’F), 19, 157–159

Microlepidoptera, 133 Micromastophiles, 86, 102 Micronycteris megalotis, 358 Midden sites, 395, 513 insectivores, 253, 259 manatees, 427 rodents, 348 Miller, G. S., Jr., 3, 204, 253, 377 Miller, J., 134 Miller, L., 129, 133 Minimum numbers of individuals (MNI), 483–484, 485, 530 Ministrymon azia, 132, 135 Miocene Aves Ridge, 22 capromyid rodents, 349 formation of Antilles, 18 Miocnus, 202 Miragoâne, Lake (Haiti) climate change, 36–37, 45, 46, 49 early lake filling, 42–44 in Holocene, 43–45 timing of climate changes, 38, 40, 41 Mirids, 80 Mitochondrial Control Region (CR) study, 332–334 Miyamoto, M. M., 239 Moises (manatee), 430 Molecular clock evidence Afrotheria, 239 dispersal model, 15, 19, 23, 29 limitations, 30 Mollusks, 499, 503, 514, 516 Molossus, review, 394 Molossus molossus, 377, 404 core community, 365 in Florida, 355 foraging, 359 invasion route, 359 Monachus tropicalis (Caribbean monk seal), 463, 486, 503 Mondolfi, E., 446 Mongoose, small Asian, see Herpestes javanicus Monophyllus metabolic rate, 365 plethodon, 378, 397, 402, 403 redmani, 379, 380, 381, 390, 397 caves, 396, 401 diet, 359, 360 Hurricane Hugo, 362 review, 389, 390 sp., core community, 365 Montané, L., 475, 478 Montgomery, G. G., 443 Montoya-Ospina, R. A., 444 Montrichardia, 448 Montrichardia arborescens, 446, 448, 449 Moore, J. C., 453 Moore, W. S., 348 Morgan, G. S., 256, 315, 378, 379, 381, 388 bat taxonomy, 390, 391 diversity, 399, 400 Mormoopids, core community, 365

Index Mormoops blainvillii, 376, 377, 379, 380, 382, 383 caves, 396 distribution, 384, 385, 404 ticks, 101 distribution, 383–384 magna and caves, 395, 396 Cuba, 375, 376 megalophylla, 376, 379, 396, 398, 402, 403 Cuba, 375 Florida, 358 Hispaniola, 377 review, 383–384 Morrison-Scott, T. C. S., 409 Mosquitoes, 80 Mou Sue, L. L., 444 Moyne, Lord, 540 Müller, C., 446 Mullet (Mugil) spp., 486 Multivariate analyses, 287–290 Museums American Museum of Natural History, New York, 4, 204, 257 Botanical Garden, Berlin, 2, 4 British, London, 176, 261 Carnegie Museum of Natural History, Pittsburgh, 257, 259 Comparative Zoology, Harvard, 3, 4, 257, 259 Field Museum of Natural History, Chicago, 257 Florida Museum of Natural History, Gainesville, 183, 192, 204, 257, 259, 483, 532 bats, 375, 376, 377 Haiti, 553 Forschungsinstitut und Natur-Museum Senckemberg, Frankfurt, 261 Geology Museum, Jamaica, 192 Instituto de Ecología y Sistemática, Cuba, 257, 259, 291 Institut Royal des Sciences Naturelles de Belgique, Brussels, 257 Liverpool, 176 Max-Planck-Institut für Hirnforschung, Frankfurt, 261 Museum of Natural History, Leiden, 4, 257 National Museum of Natural History, Cuba, 4, 256, 257, 259 Naturhistorisches Museum Wien, 261 Philadelphia Academy of Natural Sciences, 4 Puget Sound Museum of Natural History, Tacoma, 257 Smithsonian Institution, Washington, D.C., 1, 3, 4, 192, 257, 259 Swedish Museum of Natural History, Stockholm, 261 University Museum of Zoology, Cambridge, 261 Yale Peabody Museum, Cambridge, 257 Zoological Museum, University of Amsterdam, 261 Zoologisches Institut und Zoologisches Museum, Hamburg, 4, 257 Zoology, University of Michigan, 261 Mutillids, 80, 81 Myotis austroriparius, 379, 397, 398, 403 review, 393

575 Mysateles divergence, 346 gundlachi, 343, 344, 349 melanurus, 343, 344, 346, 349 prehensilis, 343, 344, 345, 349 Myscelia spp., 142

N Najas, 455 Natalus major, 375, 376, 379, 380, 381, 396, 401 micropus, 380, 381, 396, 401 primus, 375 review, 391, 392 sp., 403 tumidifrons, 378, 379, 380, 396, 403 National Environmental Action Plan (NEAP), Haiti, 4, 551–552, 556 Navaret, de, 181 Navassa, 2 NCSS Statistic System, 260 Neanderthal men, 476, 478 NEAP (National Environmental Action Plan), Haiti, 4, 551–552, 556 Neish, W. D., 426 Nellis, D. W., 410, 412, 416, 417 Neocnus, 227, 228 cladistics, 208, 209 comes, 218–219 Cuban genera, 204 description, 217 dousman, 219 gliriformis, 204, 217–218 major, 204, 218 minor, 204 toupiti, 219–220 Neomesocnus, 204 Neptidopsis ophione, 137 Nesiostrymon distribution, 147 origin, 139 Nesoctites micromegas (Antilles picolet), 59 Nesophontes distribution, 253–254 edithae, 253, 378 skull, 320 fossils, 381 as “lost” island shrews, 7 origin, 22, 30, 237–249, 254–255 Nesophontid insectivore adaptation to island life, 59 climate change, 50 fossil, 17, 377 origin, 22, 30 Nest niche ticks, 86 New Providence, 380 Newsom, L. A., 504, 521 New World image, 476–478 NGOS (nongovernmental organizations), 552, 553, 554, 555

576

Biogeography of the West Indies: Patterns and Perspectives

Nicaragua, 440–441 Niche, structural, 86, 102 Nietschmann, B., 441, 442 Nijhout, H. F., 137 Noctilio leporinus, 365, 383 Nocturnal black-light traps, 79 Nonendemic species, 25 Nongovernmental organizations (NGOS), 552, 553, 554, 555 North American plate, 17, 18 North Atlantic Gyre, 26 Northern Lesser Antilles, 402 “Northern Limestone Caribbees,” 128, 148 “Northern Volcanic Caribbees,” 128, 148 Notes on Virginia (Jefferson), 476 Notopterus, 57 Novacek, M. J., 255 Nowak, R. M., 355 Nyctelius nyctelius, 135 Nyctiellus lepidus, 379, 396 review, 391–392 Nyctinomops, review, 394 Nymphalidae fossils outside West Indies, 132 origin, 139

O OAS (Organization of American States), 549 Odell, D. K., 435, 436 Odonata (dragonflies/damselflies), 80 O’Donnell, D. J., 441, 443 Oligocene amber deposits, 17 butterflies, 139–147 Jamaica, 18 land bridge, 25, 28, 29 Oligodonta florissantensis, 133 Olson, S. L., 4, 176, 180, 490 Onthophagus gazella (African beetle), 80 Open field niche, ticks, 86, 102 Ophiodes, 161, 167, 168, 169 Opossum (Didelphis marsupialis), 493 Optimal foraging, by humans, 530, 542 Oraidium, 138 Orbital forcing, 35, 46–48, 50 Organization of American States (OAS), 549 Orinoco River, 27, 28 Ornimegalonyx oterori, 58 Ornithodoros spp., 88–90, 97, 98, 99, 100 colonization, 103 distribution, 95, 96, 103 hosts, 87 Ornithophiles, 86, 101, 102 Ortiz, R. M., 460 Ortotheriinae, 206 Oryzomys spp., 394 O’Shea, T. J., 437, 446, 453 Osprey (Pandion haliaetus), 488 Ostecephalus taurinus, 160, 166

Osteopilus brunneus, 159 dominicensis, 159, 166 septentrionalis, 159, 166 Ostracods (freshwater) late Holocene, 44 shell records of E/P conditions, 37 Otobius megnini (Spinose ear tick), 86, 100 Ottenwalder, J. A., 257, 300, 333, 391, 433, 434 Overfishing, 515 Overview, West Indian biogeography, 1–8, 15–23 Overwater dispersal, see Dispersal, overwater Ovis aries (sheep), 495 Owen, R., 194 Owl, 58 Oxygen isotope (stable) 18O, 35, 36, 37–38, 41 Oysters (Carolia), 193

P Paleogeographical reconstruction, 28, 30 Paleogeography, assumed events, 321–322 Panama, 442–444 Pangea and butterflies, 133 separation, 17, 136 Panicum sp., 448, 458 Panoquina sp., 135 Pan traps (yellow plates), 79 Papilio polyxenes, 135 Parakeets (Aratinga), 175, 181–183, 187 Paramiocnus riveroi, 232 Paramylodon, 208, 210 Parantricola marginatus, 91, 95, 96, 98 life cycle, 86–87 Parasites difficulty in studying, 85 infections and monophyletic hosts, 68 Paratrytone origin, 129, 142–143 relation to Choranthus, 144 Parides gundlachianus, origin, 139 Parocnus (= Mesocnus), 205 brownii, description, 223–224 cladistics, 208 description, 223 phylogeny, 206, 227 serus, 204, 223 Parrots or amazons (Amazona), 175, 183–186, 187 Parrots (Psittacidae) distribution, 175–187 flightless (New Zealand), 57 human effects on, 175–176, 187 Parsimony analysis insectivorans, 239–241, 246 Lyonia sect. Lyonia study, 63, 68, 69 rodents, 338–341, 345, 346, 347 sloths, 206–210 Pascual, R., 226–227

Index Paspalum, 455, 458 Passive integrated transponders (PIT), 414, 417 Patriofelis, 242 Patterson, B. Antillogale marcanoi, 257 biogeography hypothesis (insectivorans), 243, 244, 245, 246 Solenodon, 256, 257 Patterson, C., 127 Patton, J. L., 346 Paula Couto, C. de, 204 Paulocnus, 227 cladistics, 207, 208, 209 petrifactus, 204, 205, 216–217 Pauly, C., 484, 514 PAUP Lyonia sect. Lyonia, 65, 66 rodent study, 335, 338 sloth study, 207 Pearson, O. P., 414, 417 Pedersen, S. C., 362 Pelayo, F., 476 Peltophryne, 97, 166 Penguins, 57 Perfit, M. R., 134, 136, 142, 146 Perichares philetes, 135 Perihelion, 46 Peropteryx macrotus, 360 Persicargas spp., 97 Peten-Itza, Lake (Guatemala) climate change, 36–37, 45, 46, 49 early lake filling, 42–43 timing of climate changes, 38, 39, 40, 41 Phenacosaurus, 139 Philaethria dido, 135 Phocides pigmalion, 135 Phoebis, 134 Phragmites, 432 Phyciodes phaon, 135 Phyllodactylus wirshingi, 23–24 Phyllonycteris aphylla, 376, 396 major, 378, 382, 395, 397, 402, 404 poeyi, 101, 379, 380, 382, 396, 397 review, 388–389 Phyllophaga, 205, 206 Phyllops falcatus, 376, 377, 397, 404 and Stenoderma, 358 vetus, 375, 376, 397, 402 Phylogenetic error, 25–26 Phylogenetic studies, insectivorans, 238–243 Phylogeny, Lyonia sect. Lyonia, 63, 65–68 Picolets, distribution, 59 Pictetia, and vicariance model, 65, 73 Pieridae dispersal, 135 fossils outside West Indies, 132 Pigeons, 486, 490, 511 Pigeons (Columba spp.), 59 Pigeons, fruit (Ducula spp.), 57, 59

577 Pig (Sus scrofa), 486, 495, 513 Piltdown man, 478 Pinchon, R., 148 Pindell, J., 4, 128, 130, 134, 136, 139 evolution of West Indies, 142–143 model and Jamaican fossils, 196–197 Pterourus origins, 146 Pistia stratiotes (water lettuce), 447 Pithecanthropus (Java men), 476, 478 Plagiodontia, 344, 346, 348, 350 aedium, 343, 348, 394 Ekman’s work, 2 Plate tectonics, importance, 4, 22 Platybelone argalus, 192 Platynus, 124, 146 Pleistocene Florida, 107 sloths, 225 Pleistocene (late), aridity, 41–42 Plesioglymmius compactus, distribution, 120, 122 genus, distribution, 118, 121 Pliocene, butterflies, 139–148 Poduschka, C., 256, 290, 291 Poduschka, W., 256, 290, 291 Poey, F., 476, 477 Poinar, G. O., 122 Poitea, 65, 73 Polites baracoa, origins, 141 sp., dispersal, 135 Pollen records, 42, 44, 47, 49 Polygonus sp., 135 Porphyrio spp. (gallinules), 56 Portell, R., 4 Posters, conservation, 4, 553 Potamogale, 243 Potamogeton, 432 Potamogeton pectinatus, 455 Pottery, 521, 522, 524 Powell, J. A., 428, 430, 431 Powell, J. E., 133 Preceramic (Archaic) people, 522, 523 Precessional cycle, 46–48, 50 Precipitation (P), 37–38 Predators, 56 Pregill, G. K., 4, 176, 182, 382 Preponia, 137 Primrose (Oenothera) sp., 521 Prioteles spp. (trogons), 59 Proctor, G., 2 Prodryas persephone, 133 Proechimys iheringi, 350 Pronophilini, 138 Prorastomus description/evolution, 194–196 Jamaican fossils, 194–196 sirenoides, from Jamaica, 192, 194 Prospectiva Ambiental Dominicana, 434 Proteides sp., 135 Protists, 16

578

Biogeography of the West Indies: Patterns and Perspectives

Proto-Antillean island arc paleogeography, 21 and present biota, 72–73 “Proyecto Pais” (Vales), 77 Pseudolycaena marsyas, 135 Psicrocavernicolous ticks, 87, 101, 102 Psittacidae (parrots), 175–187 Pteronotus davyi, 403 gymnonotus, 403 macleayii, 101, 380, 396 parnelli, 377, 379, 380, 381, 402 caves, 396, 401 distribution, 376, 382, 403, 404 invasion route, 359 St. Vincent, 358 subspecies, 377 personatus, 403 pristinus, 375, 376, 395, 396, 403 quadridens, 359, 379, 380, 396 and ticks, 101 review, 384–386 sp., 358, 377, 396 vetus, Cuba, 375 Pteropus metabolic rate, 365 size, 365 spp. (flying foxes), adaptations to island life, 56, 57 Pterourus palamedes, dispersal, 135 spp., 145–146 troilus, dispersal, 135 Ptilinopus (fruit-dove), 57 Puerto Rico bat fossil sites, 378 conservation, 556 manatee, 428–431 mongoose study, 409–421 Rhysodine beetles, 124 sloths, 201, 203, 205, 227 terrestrial (emergent) center, 18 Puffinus lherminieri, see Shearwaters Punta, Laguna (Mexico), 36–37, 39, 46 early filling of lake, 43 in Holocene, 44–45 timing of climate changes, 38, 39, 40, 41 Pyrgus crisia, origin, 132, 145 oileus, dispersal, 135

Q Quaternary bats, 400, 401, 402, 404 sloth fossils, 201 Quaternary (late)/Recent, Solenodon distribution, 315–320 Quercus virginiana (live oak), 455 Quexil, Lake (Guatemala) early lake filling, 42, 43 in Holocene, 43–44

Pleistocene (late) aridity, 41 Quintana, R. E., 439, 440

R Radiocarbon dating accelerator mass spectrometry (AMS), 38 conventional, 38 core dates, 39–40 Raffaele, H., 175, 176 Rafting, see Dispersal, overwater Rail, flightless (Nesotrochis debooyi), 495 Rainey, F. G., 493 Rainfall increase, and early lake filling, 43 Rallidae, 56 Rathbun, G. B., 428, 430, 431, 440 Ratio 18O/16O, 37–38 Rats (Rattus rattus), 495 rice, 490, 510, 530 Raven, P. H., 127 Recent/Quaternary (late), Solenodon distribution, 315–320 Redford, K. H., 538 Red tide (Gymnodinium breve), 447, 456 Reduction in resource requirements, 55–60 Reichart, H. A., 448, 449 Reis, K. R., 180, 185 Relictual distribution, 59–60 Repartamiento of 1514, 524 Reptiles, see also scientific names relationships/divergence times, 157–170, 172–174 Reynolds, J. E., III, 442, 456, 460 Rhabdadenia biflora (cai-seca), 449 Rhineura floridana, 161 Rhipicephalus sanguineus, 94, 95, 96, 97 Rhizophora, 446, 449 Rhizoplagiodontia, 350 lemkei, 348 Rhysodine beetles, 117–124, see also scientific names description, 117, 119 dispersal mechanisms, 118, 120–121, 123 distribution, 118, 119–121, 122–124 Rhyzodiastes distribution, 118, 121 flightlessness, 121 Ridgway, R., 176 Riley, N. D., 129, 134, 135, 141, 148 Riodinidae, 139 Robinson, J. G., 538 Rochefort, C. C. de, 179, 180 Rodents, see also scientific names adaptations to island life, 58 capromyid fossil, 17, 381 cladistics, 338–341, 345, 346, 347 classification, 336–338 distribution, 335, 350, 351 DNA sequencing, 341–342 endemics, 336–338 heptaxodontid, 349, 350 hystricognath, 17

Index insular patterns and radiations, 335–351 molecular analysis, 341, 343, 344 morphological/molecular studies, 342–343 Native American use, 486, 490 reduction in body mass, 58 relationships, 343–351 Rodríguez Ferrer, M., 476 Roos, M. C., 68 Rose, H., 139 Rosemary wolf spider (Hogna ericeticola), 112 Rosen, D. E., 4, 21, 68, 72, 127, 243, 247 Rothchild, W., 179, 181 Rouse, I., 426, 427 Ruibal, R., 256, 375 Ruppia maritima, 455

S Sabal, 65, 73 Saladoid migration, 521–522 Sale, P. F., 490 Saliana esperi, 135 Salinity, 44–45 Salisbury, C. A., 437 Sanderson, I. T., 317 San Jose Chulchaca, Lake (Mexico), 43 Sarcophilus (Tasmanian devil), 60 Sarich, V. M., 158 Satyridae distribution, 133 fossils outside West Indies, 132 origin, 139 Sauresia spp., 161, 167 Savage, J. M., 127, 128, 134, 139, 167 Savage, R. J. G., 194 Sceloporus spinosus, 162 Schnitzler, H.-U., 359 Schuchert, C., 4, 128, 134 Schwanwitsch, B. N., 137 Schwartz, A., 293, 333 Scott, J. A., 129, 134 Seabrook, W. B., 2 Seagrass, 430, 431, 455 Sea level areas above, 18 and Bahamas, 398–399 early lake filling, 43 land bridge, 28, 247 Seamounts, 18 Sea turtles (Cheloniidae), 486, 490, 499, 503, 512 Sedimentation rates, 40 Sediment cores, 35, 36, 37, 38 Sepkoski, J. I., 133, 136 Serafini, P., 410 Seven Rivers site, Jamaica, 191–198 Shearwaters (Puffinus lherminieri), 488 Native American use, 490, 511 Sheep (Ovis aries), 495 Shields, O., 129, 133, 136, 139 Shreeve, T. G., 134

579 Shuey, J. A., 136 Silent Spring (Carson), 477 Silva Taboada, G., 85, 375, 386, 396, 401 bat activity time, 364 bat taxonomy, 355, 388, 391 Simpson, G. G., 4, 127, 206, 459, 476 Siproeta stelenes, 135 Sirphids, 80 Slave trade, 524 Sloth, giant, 475, 476 Sloths, see also scientific names biogeography, 225–228 cladistics, 206–210 colonization of Antilles, 226–227 diphyletic origin, 205, 206, 210, 212, 226 distribution, 201–202, 203–205, 227–228 fossils, 28, 477 higher level relationships, 205–206 overview of discoveries, 202–205 reduction in body mass, 58 species A, B, D, 225 systematic/phylogenetic review, 201–228, 232–235 systematics, 210–225 Smethurst, D., 442 Smith, D. L., 139 Smith, D. S., 135, 146 Smith, M. F., 346 Snipes (Coenocorypha), 60 Snyder, N. F. R., 175, 176, 181, 186 Solar energy, and climate change, 35, 46–48, 50 Solenodon arredondoi, 237, 256 cranial morphology, 291–292, 295, 305, 307, 320 description, 306–308 distribution, 306, 319, 323, 324 as extinct species, 293, 294 size, 277, 320 cubanus cranial morphology, 290–293, 295, 305, 307, 320 description, 302–306 cf. cubanus, description, 306 cubanus distribution, 237, 302, 317–318 as extant species, 293, 294 habitat, 320 historical surveys, 256 secondary sexual variation, 261 size, 277, 320 distribution, 253–254 late Quaternary and Recent, 315–320 Ekman’s work, 2 evolutionary relationships, 254–255 extinction, 253, 331 femur, 311, 312, 315 historical surveys, 256–257 humerus, 311, 313, 315 marcanoi, 237, 256, 333 cranial morphology, 291–293, 295, 308, 309, 310 description, 308–315 distribution, 308, 318, 319 as extinct species, 293, 294

580

Biogeography of the West Indies: Patterns and Perspectives

size, 277, 320 origin, 22, 237–249, 254–255 overview, 5, 7 paradoxus cranial morphology, 290–293, 295, 300, 302 description, 294–299 distribution, 237, 294, 316–317, 323 as extant species, 293, 294 genetic diversity study, 331–334 habitat, 320 paradoxus, description, 301–302, 308, 309, 310, 320 size, 257, 320, 324 woodi, description, 299–301, 308, 309, 310, 320 poeyanus, early classification, 256 radiation, 320–324 rarity, 254 size reduction, 320 spp., and adaptation to island life, 58–59, 60 systematic accounts, 294–315 systematics/biogeography, 253–324 systematics/biogeography study materials, 257–261 systematics/biogeography study methods, 257–261 measurements taken, 257–259 systematics/biogeography study results, 261–294 geographical variation, 268–290 nongeographical variation, 261–268 taxonomic conclusions, 293–294, 297–299, 303–304, 310 ulna, 311, 314 undescribed species, Cayman Islands, 237 variation with age, 261 cranial morphology, 290–293 individual, 268 secondary sexual, 261–268 Solenodontidae, see also Solenodon historical surveys, 256–257 Soricids, 238, 239, 243, 246, 255 Sourakov, A., 138, 141 Sources, Florida spiders, 107–113 “Southern Volcanic Caribbees,” 128, 148 Spartina alterniflora, manatee food, 455 brasiliensis (paraturá), and manatees, 449 Sphaerodactylus fossils, 17 parthenopion, 157 radiation, 17 Spider fauna (Florida), 107–113 Springer, M. S., 255 Squid (Cephalopoda), 488 Stable oxygen isotopes, 37 Stages I and II, Antillean biogeographical history, 191–192, 198 Stanhope, M. J., 239 St. Croix, mongoose study, 409–421 Statistical Analysis System (SAS), 260 Steadman, D. W., 176, 180, 185, 490 Stenoderma conservative classification, 358 and Hurricane Hugo, 362

Stenoderma Group and extinction, 397 review, 389–390 Stick insects, 80, 81 Stratigraphies, lake sediment cores, 38 Strefferud, A. (ed.), 77 Stringer, G. L., 192 Strymon limenia, 132 Sturnira thomasi, 358 “Subcommission on Biodiversity,” 551 Sugarcane plantations, 409–412 Sulphur dioxide, 48 Sunspot records, 48 Suriname, 448–449 Sus scrofa (pig), 486, 495, 513 Swales, B. H., 3–4 Swanepoel, P., 388 Swan Island hutia (Geocapromys thoractacus), 530, 540 Syconycteris (flying foxes), and torpor, 57 Synapte malitiosa, 135 Synocnus, 204 Syringodium, 431 Syringodium filiforme, 435

T Tadarida, review, 394 Tadarida brasiliensis, 378, 380, 381, 397, 404 core community, 365 diet, 365 foraging, 359 invasion route, 358 in St. Vincent, 358 Taíno people, 522–524 Talbot, M. R., 37 Talpa europaea (mole), 332 Talpids, 238, 239, 255 Tarentola, 20 Tarsius, 239 Tasmanian devil (Sarcophilus), 60 Taxonomic composition, 15, 19, 29 Tectonic events, Lyonia sect. Lyonia, 72 Teeth age of Solenodon specimens, 257 manatees, 460 molar cusps, insectivorans, 238 Teiidae, 158, 162–163, 168 Teixeira, D. M., 450 Tenrec ecaudatus, 242 Tenrec (Echinops telfairi), 332 Tenrecids and distribution, 60 genetic variation, 332 and metabolic rate, 59 origins, 237, 238, 239, 246, 255 Terra, 139, 147 Terrestrial (emergent) centers, 18 Tertiary fossils, 17, 30 fossils from Jamaica, 191–198

Index mammal taxa, 29 Tertre, J. B. du, 179, 180, 186 Thalassia, 431 Thalassia testudinum, 435 Theridiidae (comb foot or cob-web spiders), 108, 109, 110, 111–112 Thermocavernicolous ticks, 87, 101, 102 Thylacine (thylacine), 60 Ticks arboricolous, 87, 102 caverniculous, 87 colonization, 103 distribution, 87–100 and ecological zoogeography, 100–103 endemics, 98–100 lapidicolous, 87, 102 methods/materials in study, 85–87 patterns in biogeography, 85–103 relationships, 94–100 species list, 87–94 Timochares sp., 135 Todidae, 59, 60 Todus mexicanus, (Puerto Rican tody), 59, 60 Tonatia review, 387 saurophila, 376, 397, 402 Tools, early human, 519, 520–521 Torpor, 55, 57, 60 Torre, C. de la, 202 Tortoises, 60 Tortoises (Geochelone), 60 “Tracks,” vicariance model, 21, 127 Trichechus inunguis (Amazonian manatee), 425, 449, 459 manatus latirostris (Florida manatee), 451–456, 459, 460 manatus (West Indies manatee), see Manatee senegalensis (West African manatee), 425, 459 Trichoptera (caddisflies), 80 Trinidad, 447 Trogonidae, 59 Tropidophidae, 158, 163–164, 168–169 Tropidophis bucculentus, hurricane transport, 21 spp., 163, 164, 168–169 Tropidurus hispidus, 162 peruvianus, 162 True, F. W., 426 Tsunamis, 19 Tupinambis sp., 162, 168 Turtles, 196 Typhlopidae, 158, 164–165, 169 Typhlops, 17, 164–166, 169 Tyto alba (Jamaican barn owl), 534

U Ungulate (rhinocerotoid) fossil, 22 United States manatee, 451–456

581 occupation of Haiti, 3 Univariate analyses, Solenodon study, 268–287 University of Florida, 1, 2 Uplift and dry land, 18 land bridge, 28 Urban, I., 2 Urbanus dispersal, 135 in Lesser Antilles, 148 Urich, F. W., 410 Uromacer, 163, 168 Ursus arctos middendorffi (Kodiak bear), 56

V Valencia, Lake (Venezuela) climate change, 36–37, 45, 46, 49 early lake filling, 43 in Holocene, 43–44 timing of climate changes, 38, 39, 40, 41 Vales, M. A., 77 Vallisneria, 455 Vanessa, 134, 135 Van Valen, L., 237, 255, 256 Varona, L. S., 204, 256, 358, 391, 412, 435 Venezuela, manatee, 444–447 Vernonieae, 2 Vicariance/dispersal model, butterfly studies, 127–149 Vicariance model, 35, 226 description, 15 evidence against, 15, 19–22, 28–29 land bridge, 22–30 literature supporting, 127 Lyonia sect. Lyonia, 68, 72–73, 74 original proposal, 21 Solenodon, 321, 322, 323 support from terrestrial fauna, 191–192 Vienna PeeDee Belemnite (VPDB) standard, 37–38, 41 Vila, 137 Virgin Islands, 18 “Vital effect,” 38 Volcanoes active vs. inactive areas, 18 climate control, 35, 48 formation of Antilles, 17–18 Von Bertalanffy growth curve, 535

W Wagner-Groundplan-Divergence analysis, Lyonia sect. Lyonia, 65 Wallace, A. R., 55, 127 Wallengrenia ophites, in Lesser Antilles, 148 origin, 139 spp., distribution, 146–147 Water currents, 19–21, 26–28, 30, 246 Water hyacinth (Eichhornia crassipes), 447, 458 Watters, D. R., 180

582

Biogeography of the West Indies: Patterns and Perspectives

Webb, S. D., 206 Wegener, A, 127 Wells, D. R., 409 West Indies manatee (Trichechus manatus), see Manatee Wetherbee, D. K., 2–3 Wetmore, A., 3–4, 176 Wetmorena, 161, 167 Whale (Ambulocetus), 195 Whalley, P., 133, 136 White, J. L., 206 White Limestone Group, 193 White, R. E., 77 Whitmore, T. J., 38 Williams, E. E., 3, 15, 404 bat fossils, 376 plate tectonic model, 134, 136, 142, 146 Solenodon, 293 Stage I and Stage II, 191 Willig, M. R., 359, 362 Wilson, D. E., 441 Wilson, E. O., 55, 128, 399 Wilson, L. D., 167 Wilson, S. M., 519 Wing, E. S., 180, 531, 539 Woloszyn, B. W., 375, 391, 396 Woodpeckers, 17 Woods, C. A., 1 chronology, 315 diversity and island size, 399 land bridge, 347

manatees, 434 rodents, 347 sloths, 204 “Wrinkled bark beetles,” 117 Wyss, A. R., 198

X Xantusiid lizards, 22, 30 Xenicibis xympithecus, 58 Xenodon severus, 168

Y Yate’s corrected chi-square, 414 Yellow Limestone Group, 192–193, 194

Z Zalambdodonts, 237, 238, 241, 246, 248, 255 Zandee, M., 68 Zappey, W. R., 176 Zazamys, 349, 350 new discovery, 335, 347, 348 veronicae, 335 Zelotes duplex, origin, 110 ocala, origin, 108, 110