Biometals

Biometals (2010) 23:1–17 DOI 10.1007/s10534-009-9262-z

EfeO-cupredoxins: major new members of the cupredoxin superfamily with roles in bacterial iron transport Mohan B. Rajasekaran Æ Sanjay Nilapwar Æ Simon C. Andrews Æ Kimberly A. Watson

Received: 15 May 2009 / Accepted: 10 August 2009 / Published online: 23 August 2009 ! Springer Science+Business Media, LLC. 2009

Abstract The EfeUOB system of Escherichia coli is a tripartite, low pH, ferrous iron transporter. It resembles the high-affinity iron transporter (Ftr1pFet3p) of yeast in that EfeU is homologous to Ftr1p, an integral-membrane iron-permease. However, EfeUOB lacks an equivalent of the Fet3p component— the multicopper oxidase with three cupredoxin-like domains. EfeO and EfeB are periplasmic but their precise roles are unclear. EfeO consists primarily of a C-terminal peptidase-M75 domain with a conserved ‘HxxE’ motif potentially involved in metal binding. The smaller N-terminal domain (EfeO-N) is predicted to be cupredoxin (Cup) like, suggesting a previously unrecognised similarity between EfeO and Fet3p. Our structural modelling of the E. coli EfeO Cup domain identifies two potential metal-binding sites.

Site I is predicted to bind Cu2? using three conserved residues (C41 and 103, and E66) and M101. Of these, only one (C103) is conserved in classical cupredoxins where it also acts as a Cu ligand. Site II most probably binds Fe3? and consists of four well conserved surface Glu residues. Phylogenetic analysis indicates that the EfeO-Cup domains form a novel Cup family, designated the ‘EfeO-Cup’ family. Structural modelling of two other representative EfeO-Cup domains indicates that different subfamilies employ distinct ligand sets at their proposed metal-binding sites. The *100 efeO homologues in the bacterial sequence databases are all associated with various iron-transport related genes indicating a common role for EfeO-Cup proteins in iron transport, supporting a new copper-iron connection in biology.

Electronic supplementary material The online version of this article (doi:10.1007/s10534-009-9262-z) contains supplementary material, which is available to authorized users.

Keywords Iron transport ! Homology modelling ! Cupredoxin ! Electron transfer ! GRID prediction ! Metal binding site ! DUF451 ! Peptidase-M75

M. B. Rajasekaran ! S. C. Andrews (&) ! K. A. Watson School of Biological Sciences, University of Reading, Whiteknights, Reading RG6 6AJ, UK e-mail: [email protected] M. B. Rajasekaran ! K. A. Watson Structural Biology Unit at The Biocentre, University of Reading, Reading RG6 6AJ, UK S. Nilapwar Manchester Interdisciplinary Biocentre, University of Manchester, Manchester M1 7DN, UK

Introduction Many major biological processes depend upon iron including oxygen transport and storage, nitrogen fixation, photosynthesis, DNA biosynthesis and the citric acid cycle (Andrews et al. 2003). The predominant environmental form of iron is the poorly soluble ferric form (10-18 M at pH 7.0). Relatively soluble (0.1 M at pH 7.0) ferrous iron is mainly restricted to anaerobic/microaerobic niches or low pH

123

2

environments. Unsurprisingly, the low solubility of ferric iron leads to problems of poor bioavailability. In addition, iron can cause toxicity in the presence of oxygen due to its tendency to engage in Fenton chemistry generating highly-reactive free-radical species. Thus, under aerobic conditions, iron causes problems of both availability and toxicity (Andrews et al. 2003; Carrondo 2003; Chiancone et al. 2004). Consequently, organisms have developed various strategies that allow them to acquire sufficient iron for growth whilst avoiding any deleterious effects caused by iron toxicity. Bacteria often employ a range of iron transporters, with specificities for alternative sources of iron, to enable them to overcome low iron availability. Within bacteria, the most common type of iron uptake system appears to involve siderophore-dependent transporters. These utilise extracellular chelators (siderophores) as ferric-iron solubilising agents. For Gram-negative bacteria, the resulting ferri-siderophore complexes are translocated across the outer-membrane (OM) by a TonB-dependent OM receptor (TBDR) (Andrews et al. 2003; Braun et al. 1998; Stintzi et al. 2000). The complexes are then bound by corresponding periplasmic-binding proteins and delivered to innermembrane ABC-transporters. Host iron-containing compounds [transferrin, lactoferrin, haemoglobin, haem, haem-haemopexin] (Andrews et al. 2003; Bracken et al. 1999; Wandersman and Delepelaire 2004) can also be directly acquired by similar transporters involving binding of the host iron complexes to specific TBDRs. In contrast to ferric iron, ferrous iron can be directly imported using FeoAB transporters, which are thought to function under anaerobic-microaerophilic conditions (Cartron et al. 2006; Hantke 1987). In addition, metal-type ABC transporters like (Kehres et al. 2002) [e.g. SitABCD of Salmonella typhimurium] and NRAMPlike transporters (Kehres et al. 2000; Makui et al. 2000) [e.g. MntH of Escherichia coli] also translocate Fe2?, although these systems appear to have greater affinity for Mn2? than Fe2?. ZupT in E. coli also has affinity for Fe2?, along with a range of other divalent metals (Grass et al. 2002). Recently, a new type of ferrous-iron transporter, designated EfeUOB, has been identified in E. coli. It consists of three protein components and acts mainly at low pH (Cao et al. 2007). Homologous systems are present in many other bacteria including Bacillus

123

Biometals (2010) 23:1–17

subtilis and Neisseria meningitides (Baichoo et al. 2002; Grifantini et al. 2003; Ollinger et al. 2006). EfeUOB resembles the high-affinity Fe2? uptake system (Fet3p-Ftr1p) found in fungi (such as Sacchromyces cerevisiae) and some algae (Askwith and Kaplan 1997, 1998; De Freitas et al. 2003; Fang and Wang 2002; Fu et al. 2004; Paronetto et al. 2001) in that EfeU is homologous to Ftr1p, and both systems are ferrous-iron transporters. Ftr1p is a polytopic, cytoplasmic-membrane located, ferric permease containing seven transmembrane helices (TMH), belonging to the oxidase dependent Fe2? transporter family (Debut et al. 2006). It possesses two ‘RExxE’ motifs, one in TMH 1 and the other in TMH 4, both of which are required for iron-uptake function (Severance et al. 2004; Stearman et al. 1996). These are thought to form an iron-binding site, with the conserved Glu residues acting as the direct ligands. Fet3p is a multicopper ferroxidase and is absolutely required for high-affinity Fe2? uptake. It has three cupredoxinlike domains binding four copper ions and belongs to the multi-copper oxidase family (De Silva et al. 1995). This protein is anchored to the outer face of the cytoplasmic (or inner) membrane and closely associates with Ftr1p. The mechanism of Fet3p-Ftr1p iron transport involves reduction of environmental ferric ion to ferrous ion by means of the ferric/cupric reductases, Fre1p/Fre2p. The ferrous iron thus generated is bound by Fet3p and re-oxidised, using oxygen as the oxidant, to the ferric form which is then transferred to Ftr1p for translocation across the cytoplasmic membrane into the cytosol. EfeUOB is encoded by a three gene operon, efeUOB, that is Fe2?-Fur repressed and alkalirepressed (acid induced) by CpxAR. EfeU, like Ftr1p, is predicted to be located within the cytoplasmic membrane and to contain seven TMHs. EfeU possesses 27% amino acid sequence identity with Ftr1p and the two ‘RExxE’ motifs are conserved. EfeB is a periplasmic haem-containing peroxidaselike protein (Cartron et al. 2007) that is exported into the periplasm by the Tat pathway (Sturm et al. 2006). EfeO is also periplasmic and contains a predicted Nterminal signal sequence suggesting export to the periplasm in a Sec-dependent manner. EfeO consists of a C-terminal peptidase-M75 (M75) domain (*225 residues) and an N-terminal domain of *100 residues that appears to resemble the copper-containing cupredoxins.

Biometals (2010) 23:1–17

In this study, the amino acid sequences of cupredoxins (Cup) and domains resembling the EfeO N-terminal domain (the EfeO-Cup domain) were compared and their phylogenetic relationship analysed. Results suggest that EfeO-Cup-like domains represent a distinct new bacterial group within the cupredoxin superfamily and form two sub-groups: Cup-M75 proteins and solo-Cup proteins. Structural modelling of representative EfeO-Cup-like domains indicates either one or two novel metal-binding sites (distinct from the Cu-site of classical cupredoxins) employing different sets of conserved ligands in each case, with one site favouring Cu2? and the other preferring Fe3?. These findings provide a new insight into the biochemical properties of EfeO and related proteins and suggest a potential iron uptake role as iron-binding and/or electron-transfer components.

Materials and methods Secondary structure prediction, domain topology and multiple sequence alignment The amino acid sequence of EfeO used in this study is from E. coli K-12 and is available at Uniprot Knowledgebase (Bairoch et al. 2005) (UniprotKB/ SwissProt accession no: P0AB24). The SignalP server (Bendtsen et al. 2004) was used to predict the signal peptide cleavage site in EfeO. GeconcT (Ciria et al. 2004), was used to identify genes neighbouring efeO and efeO homologues. Domain predictions were obtained using various databases and servers: Superfamily (Gough et al. 2001), INTERPRO (Mulder et al. 2007), Pfam (Finn et al. 2006), SCOP (Murzin et al. 1995) and DomFOLD (Jones et al. 2005; Marsden et al. 2002; Ward et al. 2004) [incorporating DomSSEA, DISOPRED, mGenTHREADER and nFOLD]. The presence of low complexity regions in EfeO amino-acid sequence was indicated by NCBI-BLAST (Wheeler et al. 2006) and the Pfam database. The prediction of disordered regions in EfeO was performed by PrDOS (Ishida and Kinoshita 2007) and RONN (Yang et al. 2005). EfeO homologues (125 sequences) were identified using EBI-WU-BLAST2 (Altschul et al. 1990) using the default settings. Multiple-sequence alignments for either the Cup or peptidase-M75 domains (101 sequences containing Cup domain, and 92 sequences

3

containing peptidase-M75 domain) were achieved using EBI-CLUSTALW (Thompson et al. 1994). Secondary-structure predictions were obtained using the PSIPRED (Bryson et al. 2005) and Jpred servers (Cuff et al. 1998). Multiple-sequence alignments obtained from EBI-CLUSTALW were analysed using GENEDOC (Nicholas et al. 1997) to generate improved alignments satisfying secondary structure element locations. Phylogenetic analysis was carried out using MEGA4 version software (Tamura et al. 2007) and the multiple-sequence alignments obtained above. The Neighbour-joining method with default settings was employed for the construction of trees. Structural modelling of the Cup domain of EfeO and its select homologues A search for suitable structural templates was performed using local similarity search algorithms (NCBI-BLAST, EBI-WU-BLAST2) against the Protein Data Base (PDB) (Berman et al. 2000) and fold recognition tools [Phyre (Kelley et al. 2000), mGenTHREADER (Bryson et al. 2005)] using the default settings. Amicyanin (Carrell et al. 2004) from Paracoccus denitrificans (PDB id: 1SFD) was the nearest structural homologue for EfeO according to mGENTHREADER (Table S3). Based on the multiple sequence alignment (Fig. 5a) and the mGENTHREADER result (Table S3), modelling of the EfeO homologues: Jan and Buc2 from domain I & V organisation (Janibacter sp. and Burkholderia cepacia, Table S1), respectively, was performed. For all models, amicyanin was used as the template, in order to maintain the sequence and structural alignment found between these homologues. The comparative modelling program, MODELLER (Marti-Renom et al. 2000), was used to construct all three theoretical models. The three models herein are referred to as Cupecoli, Cupjani and Cupburk, respectively. The validation programs PROCHECK (Laskowski et al. 1993), and MODFOLD (ModFOLDclust v 1.1) (McGuffin 2007; McGuffin 2008) were used for assessing the overall stereochemical quality of the models and selecting the final model in each case. The overall structural superimpositions and local superimpositions of metal binding sites between pairs of structures were performed using the program LSQKAB as provided by CCP4 (Collaborative Computational Project 1994).

123

4

Metal-binding site prediction for the Cup domain of EfeO and selected homologues by GRID The program GRID (Goodford 1985) was used to predict potential metal binding sites for amicyanin (PDB id: 1SFD), as a control, the Cup domain of EfeO from E. coli (Cupecoli), and the Cup domain from B. cepacia (Cupburk) and Janibacter sp. (Cupjani). GRID predicts energetically favourable interactions between a probe (i.e. a small biologically active species such as water, carbohydrates, metals) and a protein. The results are represented in the form of 3-dimensional (3D) energy contours, showing the location of energetically favourable binding sites. The interaction energy EXYZ of the probe at each xyz position on the GRID is calculated as a summation of energy components, specifically van der Waals, hydrogen bond, electrostatic interactions and a hydrophobic term as defined by Exyz = RElj ? REel?REhb. Contours at negative energy levels indicate favourable regions of attraction representing the most likely points of interaction between a probe (in this case, metal) and the protein. In this work, interactions between each of the Cup domains, Cupecoli, Cupjani and Cupburk, and their structural homologue amicyanin (PDB id: 1SFD) against relevant metal cation probes (Fe2?, Cu2?, Zn2?, Mg2?, Fe3?) were carried out by GRID. All HETATM records (i.e. all non-protein atoms such as water, Cu2?, sulphate, etc.) were first removed from the PDB file for amicyanin. There were no HETATM records in the homology models for Cupecoli, Cupjani and Cupburk. The program GRIN, the first step in the GRID calculation, was used to prepare each of the atomic coordinate files by removing hydrogens (in the case of the homology models) adding counterions (Na? was used in each case) to neutralise the overall charge on the protein taking care not to include counterions near any potential binding sites, and including the associated energy variables to individual atom types as defined in GRIN. The move directive in GRID was set to -1 to allow the counterions to move in response to the probe. The GRID calculations were performed in two stages; firstly, over the entire protein using a grid spacing ˚ , and secondly, over those regions (NPLA) of 1 A highlighted by this first run which indicated the most promising regions for metal binding using a grid ˚ . GRID allows assignment of the spacing of 0.5 A

123

Biometals (2010) 23:1–17

metal cation probes (JTYPE) to reflect the fact that these metals do not participate in hydrogen bonding and to emphasise the relative hardness or softness of the metal thus affecting the type of interaction. For example, a metal that interacts favourably with nitrogen and sulphur ligands but not oxygen would be assigned JTYPE 113. In GRID, metal cation probes by default are assigned JTYPE 110. For amicyanin and site I of Cupecoli, Cupjani and Cupburk, all metal probes were assigned JTYPE 113, to reflect the increased number of sulfhydryl ligands found at site I for each of these proteins. For site II in Cupecoli, all metals probes were assigned a JYTPE of 111, favouring interaction with oxygen ligands. All other GRID parameters used were default. The program MINIM, provided as part of the GRID package, was used to convert the GRID output to a readable format suitable for input to PYMOL (Delano 2002) for graphical viewing and interpretation.

Circular dichroism (CD) spectroscopy of EfeOecoli The CD measurements for the mature EfeOecoli protein were carried out using a JASCO J-810 spectropolarimeter. CD spectra of EfeOecoli at 3.2 mg/ml in 30 mM MES buffer (pH 6.0) were measured at 25"C with a 0.01 cm pathlength cell in the far UV (190–260 nm) region, at a bandwidth of 1 nm using an average of four scans. The raw spectral data, ellipticity (h), were expressed as mean residue ellipticity, [h]mrwk (deg cm2 dmol-1), according to the equation: ½h#mrwk ¼ MRW % hk =10 % d % c where ‘MRW’ (mean residue weight for peptide bond) is described as M/N - 1 and M is the molecular weight of the mature EfeOecoli (M = 38,313 Da), ‘N’ is the total number of amino acids (N = 349), ‘hk’ is the observed ellipticity in degrees at each wavelength, ‘d’ is the path length of the cuvette (0.01 cm), ‘c’ is the concentration of the protein in (3.2 mg/ml, in this case). The raw CD spectral data for EfeOecoli were submitted to the DICHROWEB (Whitmore and Wallace 2004) server for qualitative and quantitative secondary structure analysis. The dataset SP175, (Lees et al. 2006) consisting of 72 reference proteins ˚ from high resolution crystal structures (average 1.9 A resolution) of type b and mixed a/b, was used as the

Biometals (2010) 23:1–17

reference set for the analysis with an aim to reduce the spectral variability in the b-sheets of proteins.

Results and discussion Domain topologies The domain analysis results from the Superfamily server, Pfam (PF04302), DomFOLD and the INTERPRO database (IPR008972) indicate the presence of a cupredoxin (Cup) like domain at the N-terminus of the E. coli EfeO protein (residues 8–116) and a ‘peptidaseM75’ domain (M75, residues 135–372; Pfam PF09375, also known as ‘DUF451’) in the C-terminal region. Signal P predicted an N-terminal signal sequence for EfeO with the most likely cleavage site between residues 26 and 27 (ANA-AD). Together, the above predictions strongly suggest a two-domain organisation for EfeO of E. coli K-12 (EfeOecoli): an N-terminal Cup-like domain (Cupecoli) and a C-terminal M75 domain (M75ecoli) separated by a flexible linker (Fig. 1 and Supplementary Information). WU-BLAST2 analysis of the non-redundant database using the EBI site revealed 125 proteins displaying significant (E-value threshold 10) aminoacid sequence similarity ([20% identity) to EfeOecoli, all of which are from bacteria and possess either an M75 domain or a Cup domain. Of these, five domain organisations (I–V) are apparent (Fig. 1). The most common organisation (I) is that observed for E. coli consisting of an N-terminal Cup

Fig. 1 Domain topology of EfeO. Five domain topologies (I–V) are apparent for EfeO homologues. The unknown domain found in the Listeria and B. subtilis proteins is indicated as ‘Dom X’ (Domain X). The putative flexible linker region is indicated (not to scale). The SignalP-predicted signal peptide cleavage site for EfeO of E. coli K-12 is between

5

domain plus a C-terminal M75 domain (65 examples). All such proteins appear to possess an appropriately positioned signal sequence and so all are expected to be secreted. The second most common organisation (V) consists of an isolated Cup domain (without any C-terminal M75 domain, 34 examples) which implies that the N-terminal Cup domain can function independently of the M75 domain. The third most common domain organisation (II) comprises an isolated M75 domain (apparently secreted) without any Cup domain (18 examples). This indicates that the Cup domain may not be essential for the iron uptake process mediated by EfeO-like proteins. The fourth most frequent domain arrangement (III) contains an undefined N-terminal domain (*130 residues, designated ‘domain X’, found in B. subtilis and Listeria species) linked to a C-terminal M75 domain (seven examples) and so also lacks a recognisable Cup domain, again indicating that the Cup domain is not essential for EfeO function. Note that the B. subtilis efe-like locus, ywbLMN, has been shown to have a role in iron uptake (Baichoo et al. 2002; Ollinger et al. 2006) yet the protein corresponding to EfeO (YwbM), lacks the Cup domain. A signal sequence is predicted for the B. subtilis protein indicating these class III EfeO proteins are secreted. Finally, there is just one example of the class IV domain organisation where an N-terminal Ftr1p/EfeU-like domain is followed by a central Cup domain which is in turn followed by a C-terminal M75 domain giving an ‘EfeU-EfeO fusion’ protein. This fusion

residues 26 and 27. The predicted N-terminal Cup-like domain of EfeOecoli extends from residue 30 to 116 followed by the Cterminal M75 domain (135–372). The low complexity region between the two domains (117–134) is also predicted by Pfam and the disorder prediction tools RONN and PrDOS

123

6

suggests that EfeU and EfeO interact during the iron uptake process. Genetic context analysis Seven gene organisations (from 58 loci) were identified for efeO homologues, all of which consisted of genes encoding M75 domains and/or Cup-M75 domain fusions (Fig. 2a). The most frequent arrangement is efeUOIB (type A; 29 cases found in proteobacteria, actinobacteria and firmicutes), as found for E. coli. Given the similar genetic organisation and composition, it is highly likely that all 29 of these loci specify analogous ferrous-iron transporters. The next most common arrangement is efeOIIBU (type B; 13 cases found in firmicutes) where efeU is located at the end of the efe operon and the efeO gene is of class II (i.e. it does not specify a Cup domain). Such systems thus lack any Cup domain indicating, as suggested above, that this

Fig. 2 Schematic representations of the genetic contexts of efeO-like loci. Loci containing genes specifying a EfeO-like M75 domains (domain organization I–IV; Fig. 1) or b soloCup domains (of domain V organization; Fig. 1). The EfeOecoli amino acid sequence was used as input for Gene Context Tool 2 analysis, using default variables to search 580 genomes for sequence similarity (probability score minimum of 1 9 10-10). A total of 58 matches were reported and seven genetic organizations were observed (A–G). Slight differences in the total number of matches discovered in Figs. 1, 2 reflect

123

Biometals (2010) 23:1–17

domain is not essential for function of Efe transporters. The next most common gene arrangement is efeUOIBOII (type C; 9 cases all from proteobacteria) which also resembles the type A organisation except for the presence of an additional efeO gene, at the end of the operon, which is of class II (lacking the Cup domain). The presence of two efeO genes, each specifying a different class of EfeO protein, indicates that EfeOI and EfeOII may have distinct, but related, functions in transport. The fourth most common organisation is efeUOIIIB (type G; 3 cases from actinobacteria) which again resembles the type A arrangement except that the efeO gene encodes a class III EfeO protein containing domain X in place of the Cup domain. In addition, there are three other gene organisations that are found only once or twice: efeOIBU; efeUOIVB; and efeOIIB. Interestingly, all seven arrangements include an efeB homologue along with efeO, and in all but one case there is also an efeU equivalent. This indicates that EfeO is functionally

differences in cutoff scores applied and the sequence databases utilized. b Gene context analysis for the solo-Cup domain. Among the 38 matches obtained, three distinct gene organizations (H–J) were apparent. The presence of two solo-Cup domain gene clusters (of the H and I organizations) in B. cenocepacia, B. cepacia and B. pseudomallei, is indicated with thick and dotted black lines. ‘Rr’ and ‘His_kin’ indicate genes specifying a histidine kinase and response regulator from the two component signal transduction systems

Biometals (2010) 23:1–17

7

The above analyses indicate that the M75 domain of EfeO is crucial for EfeUOB transporters. Indeed, no loci could be found where efeU- and efeB-like genes are both present in the absence of an M75-encoding efeO-like gene. To date, the only other characterized member of the peptidase-M75 family is the Zn-containing membrane-located metallopeptidase ‘imelysin’ protein from Pseudomonas aeruginosa. Secondary-structure prediction for the M75 domain of EfeO (residues 135–372) using Jpred and PSIPRED indicates a high a-helix content (55 and 65%, respectively) and no b-strand composition. Furthermore, quantitative estimation based on the far-UV

CD spectrum of EfeOecoli (Fig. S1; residues 27–375) indicates a secondary structure composition of 48% a-helix, 13% b-strand and 39% random coil or turn. Subtraction of the anticipated secondary structure contribution of the EfeO Cup domain (50% b-strand; Fig. 4) from the CD-derived composition suggests that all the b-strands of EfeO are contributed by the Cup domain whereas all the a-helices are within the M75 domain, consistent with the PSIPRED and Jpred predictions. Alignment of the amino acid sequence of the M75 domain of E. coli (K-12) EfeO with that of 91 EfeOhomologues (65 class I, 18 class II, 7 class III and one class IV sequences; Table S1; Fig. 3 and S2) shows that the highly conserved HxxE motif, that acts as a potential Zn-binding site for M75 metallopeptidases, is completely conserved within the M75-domain of EfeO proteins. This suggests that the M-75 domain is likely to be metal binding with the HxxE motif corresponding, at least in part, to a metal-binding site (here designated ‘site III’). The above observations would be consistent with a role for the M75 domain of EfeO in specific inter-protein iron transfer, with the peptidase similarity providing protein–protein interaction capacity (perhaps with EfeU) and the HxxE motif acting as part of an Fe2?-binding site enabling delivery of iron to EfeU.

Fig. 3 Multiple-sequence alignment of a region of the M75 domain (residues 196–258) of EfeO from E. coli K-12 with selected homologues. The M75 domain region of class I, II, III and IV domain organization members were aligned and manually edited using EBI-CLUSTALW and GENEDOC software, respectively. The HxxE motif (site III), a potential zinc-binding site for the M75 metallopeptidases, is fully conserved. Absolutely conserved residues are shown in white

bold letters against a black background whereas 80 and 60% conserved residues are shown in white or black bold type against a grey background, respectively. Residue numbers are based on those of EfeOecoli. Representatives from all four domain organizations are shown here for simplicity and the complete alignment with all members is provided in the supplementary material (Fig. S2). A description of each protein is provided in Table S1

dependent upon both EfeB and EfeU, and is consistent with a similar biological function for all 58 loci in ferrous iron uptake (Cao et al. 2007). Gene-context analysis for those genes encoding a solo-Cup domain of the EfeO family (solo-Cup, domain V organisation), all from proteobacteria, revealed 38 gene clusters containing solo-Cup encoding genes. These divide into three major types (H–J; Fig. 2b), all possessing features suggestive of an iron (or metal) transport function and are discussed further in the Supplementary Information. The peptidase-M75 domain of EfeO

123

8

The cupredoxin (Cup) domain of EfeO The Cup domain of the EfeO proteins is not fully conserved, it is present in more than 70% of all cases observed, indicating an important, although not vital, function in ferrous transport. In addition, it is found as a solo domain associated with 38 potential bacterial iron/metal transporters which is again indicative of an important iron (or metal) transportrelated function. Cupredoxins (blue-copper proteins) are copper-containing, mono-domain, electron-transfer proteins possessing a ‘Greek key’ b-barrel topology. They generally contain a single ‘type I’ (or ‘blue-copper binding’) copper ion acting as a highpotential ([250 mV) electron carrier. The copper is held in a distorted tetrahedral fashion by one conserved Cys and two conserved His residues, together with one or two variable axial ligands (e.g. Met, Gln, Leu) (Adman 1991; Carrell et al. 2004; Dennison 2005; Messerschmidt et al. 2001). The so called ‘multicopper oxidases’ (MCO) possess two, three or six cupredoxin domains (Adman et al. 1995; Suzuki et al. 2000; Messerschmidt et al. 1993; Ducros et al. 2001; Zaitseva et al. 1996). Such proteins either function as oxidases or reductases and typically possess four Cu atoms classified into three types: a type I, II and III (Solomon et al. 1996). Since only a single Cup domain is found within EfeO proteins, this domain would appear more closely similar to the cupredoxins suggesting a role in electron transfer. Sequence conservation and phylogenetic relationships of the Cup domains of EfeO proteins A multiple-sequence alignment of the Cup domain of 119 EfeO-like sequences and cupredoxins (Fig. 1) (Table S1; Fig. 4 and S3) shows that the sequences fall into three major groups on the basis of shared conservation, designated Cup-I (Cup domains from class I and IV EfeO proteins), Cup-II (solo domain Cup proteins from class V EfeO proteins) and Cup-III (classical cupredoxin proteins). Unsurprisingly, these three groups form three distinct clads in the corresponding phylogenetic tree (Fig. S4). The defined secondary-structure elements of cupredoxins appear well conserved with few interruptions caused by insertions or deletions. In addition, the predicted

123

Biometals (2010) 23:1–17

secondary structure for the Cup domain of EfeO and its homologues matches the defined structure well (80%), suggesting an accurate alignment has been achieved (Fig. 4 and S3). Thus, all of the proteins included in Fig. 4 (and S3) are likely to adopt a cupredoxin fold. Only three residues are absolutely conserved (G51, G97 and Y99), which indicates the divergence of these sequences (Fig. S3; see Table 1 for roles played by such residues). Of particular note is the manner in which the patterns of conserved residues acting as defined, or potential, Cu ligands varies between the three distinct groups (Fig. 4). For the Cup-I group (class I and IV EfeO Cup domains), only the Cys (position 103) is conserved among the four Cu ligands (two His and one Cys and one Met) typically employed by cupredoxins. However, an alternative potential ligand (C41) is highly conserved in the CupI proteins, but not in the other groups, indicating that this residue may act as a novel metal ligand for members of this group. An EEREN motif (residues 77–81) is also highly conserved in the Cup-I group only, that may also contribute to metal binding. For the Cup-II group, a different pattern of potential metal ligands is observed. Of the four classical type I Cu ligands, only H106 is conserved. However, there is a well conserved Asp residue at the same position as the Cys residue normally employed as a Cu ligand in cupredoxins (position 103) which could therefore act as a metal ligand for Cup-II proteins. In addition, there is an absolutely conserved RKEKV motif (residues 77–81) that replaces the (E/D)EREN motif observed in the Cup-I group and this may also contribute to metal binding through its Glu residue. Both the Cup-I and -II groups share a very well conserved E(W/F)E motif (66–68) that may also act in metal binding. This motif is absent from the classical cupredoxins of the Cup-III group suggesting a specific purpose within the EfeO-like Cup proteins. It is interesting that both the Cup-I and -II proteins possess just one of the four highly conserved Cu ligands employed by the Cup-III proteins, but the identity of the conserved residue is different in each case. This highlights the cupredoxin-like nature the Cup-I and -II proteins but also indicates that they have each evolved in a different manner presumably to perform somewhat different functions.

Biometals (2010) 23:1–17

9

Fig. 4 Multiple-sequence alignment of the Cup domain of EfeO from E. coli K-12 with related proteins. a The complete alignment (Fig. S3) includes 65 and 34 EfeO-like Cup-I and Cup-II domains, respectively, together with 19 classical (CupIII) cupredoxins from the ‘copper bind’ family (PF00127). Representatives from each species for the three families are shown here for simplicity. Alignment of the Cup-I and -II domains was achieved as for Fig. 3. The ‘copper bind’ cupredoxin alignment was taken from Pfam and then aligned with the Cup-I and -II sequences to generate a final combined alignment. The sequences are organized into three groups (Cup-I, -II and -II) on the basis of sequence similarity and phylogeny, with the Cup-I family further divided into four subfamilies: Cup-IA, IB, IC, ID (Fig. S4). Conserved known (or potential) metal ligands for each families are indicated in bold

letters at the bottom of the alignment. The consensus defined secondary structure (b-strands only) for 19 classical cupredoxins (Cup-III proteins) is indicated by grey arrows, and that predicted by PSIPRED and Jpred for the Cup domain of EfeOecoli is shown with black arrows on the bottom of the alignment. The conserved motifs and potential metal ligands in the case of Cup I–III families are highlighted with dotted boxes whereas the potential metal ligands which are common among these families are in solid-line boxes. b Pairwise sequencestructure based alignment between Cupecoli and P. denitrificans amicyanin. The pair-wise alignment was generated using mgenTHREADER and this alignment was used to generate the homology model of Cupecoli (Fig. 5). The b-strands for Cupecoli and amicyanin are indicated with black and grey arrows, respectively

Structural modelling of the Cup domain of EfeO and select homologues

used to find structural homologues of Cupecoli (residues 27–116). Phyre and mGenTHREADER gave highest predicted matches for amicyanin, a known cupredoxin, from P. denitrificans (PDB id: 1SFD), and the derived structural alignment gave a sequence identity of 18%. PSIPRED and Jpred evaluation of the alignment of secondary structural elements for EfeO and amicyanin gave an overall agreement of 90%, with slight differences in the third and fourth b-strands of Cupecoli (III and IV; Fig. 5b). MODELLER was used to construct an amicyanin-based model for Cupecoli (Table S3). There were no irregularities in the stereochemical parameters according

Although the above sequence comparison indicates that there are two major types of EfeO-like Cup domain and that each has a unique pattern of potential metal ligands, it remains unclear whether the observed motifs occupy positions within the corresponding tertiary structures that would allow them to form metal-binding sites. To determine whether this is possible, a structural model was generated of the Cup domain of EfeO from E. coli K-12. A protein fold recognition method (McGuffin et al. 2001) was

123

10

Biometals (2010) 23:1–17

Table 1 Summary of the GRID predicted metal binding ligands for site I & site II of Cupecoli, Cupburk, Cupjani and the known copper binding site of amicyanin (PDB id: 1SFD)

program LSQKAB as provided by CCP4, gave an ˚ (Fig. 5a). RMS deviation of 0.7 A

GRID probe Residues in contact with GRID probe

The Cupecoli domain model structure

41 62 66 68 77 78 80 101 103 106 111 Cu site: amicyanin Cu2?

H

C

H

a

H

C

H

Cu2?

M

Site I Cupecoli (Cup-IA) Cu2? Fe2?

C C

E E

M M

C C

Zn2?

C

E

M

C

E

M

C

Mg

2?

C

Fe3?

E

C

Cupjani (Cup-ID) Cu2?

C

E

C

Fe2?

C

E

C

2?

Zn

C

E

C

Mg2?

C

E

C

E

C

Cu2?

E

D

H

Mg2?

E

D

H

2?

Fe

E

D

H

Zn2?

E

D

H

Fe3? Site II

E

D

Fe3? Cupburk (Cup-II)

Cupecoli (Cup-IA) Fe3?

E

E

E

E

Fe2?

E

E

E

E

Cu2?

E

E

E

E

Zn2?

E

E

E

E

Mg2?

E

E

E

E

a

Crystallographic copper for amicyanin. The preferred metals for the different binding sites in each protein are listed, according to their relative interaction energies for the respective M2? and M3? probes used. Residues in bold are potential Cup-I/II Cu ligands that are conserved in classical cupredoxins (e.g. amicyanin)

to a PROCHECK analysis, and the Ramachandran plot showed 95% of residues in the most favoured regions with no residues in the disallowed regions suggesting a stereochemically accurate model. A pairwise Ca structural superimposition between the Cupecoli model and amicyanin (1SFD), using the

123

The Cupecoli domain structural model consists of seven b-strands (strand I, residues 32–36; II, 52–59; III, 65–70; IV, 75–81; V, 88–94; VI, 98–103; VII, 110–116) accounting for 50% of the Cup portion of the EfeOecoli polypeptide (Fig. 5a). The b-strands are organised into two sheets forming a Greek key b-barrel structure typical of cupredoxins. In accordance with the multiple-sequence alignment (Fig. 4), the model suggests a metal-binding site (designated site I) comprising two conserved Cys residues (residues 41 and 103), the conserved E66 residue, and the partially-conserved M101, all of which appear to be in close structural proximity (Fig. 5b). A comparison between the site I motif of Cupecoli (C41, E66, M101 and C103) and the copper-binding site of classical cupredoxins (amicyanin, azurin and pseudoazurins) (Carrell et al. 2004; Crane et al. 2001; Inoue et al. 1999) shows both sequence and structural conservation for these proteins of a single Cys residue (Cys103; Fig. 4 alignment, Fig. 5b, c), supporting a role for this Cys in metal binding for Cupecoli. The two His residues involved in copper binding in cupredoxins, as mentioned above, are not conserved in Cupecoli. These His residues superimpose with two Leu residues in the Cupecoli model. However, C41 of Cupecoli is well conserved in Cup-I sequences and together with C103 forms part of putative metal binding site I in Cupecoli. The potential role of Cys residues as ligands in metal binding is well known (Cobbett and Goldsbrough 2002; Kojima et al. 1999; Klaassen et al. 1999; Murphy and Taiz 1995; Palmiter 1998; Solioz and Vulpe 1996). The Met residue (M111 in amicyanin) that usually occurs as an axial ligand in cupredoxins is not present in the Cupecoli model; instead there is a Pro. However, an alternative residue, M101, appears able to act as a distal ligand at site I in the model. The final residue in site I, E66, structurally replaces the Asn residue (not a Cu ligand in classical cupredoxins) typically observed in other cupredoxins. It is possible that the carboxylate (or carbonyl) of E66 of Cupecoli could perform a role in metal binding at site I. The Cupecoli model contains a negatively-charged cluster of residues (E68, 77, 78 and 80) on the protein

Biometals (2010) 23:1–17

11

(A)

(B)

(C)

Fig. 5 Cup domain homology models and metal-binding site prediction for the Cup domain of EfeO from E. coli K-12. a The Cupecoli domain homology model (orange) was generated using amicyanin of P. denitrificans (PDB id: 1SFD) as template (blue). The b-strands are numbered: S1S7. b Structural comparison of representatives from the Cup-IA (Cupecoli), Cup-ID (Cupjani), Cup-II (Cupburk) and Cup-III (amicyanin) groups, based on the homology models and the crystallographic structure of amicyanin. The comparison demonstrated conservation of two residues (E66 and C103) for Cupecoli (green) and Cupjani (green), conservation a His residue (H106) between Cupburk (green) and amicyanin (red). A conserved Asp residue, found only in the Cup-II family (as represented by Cupburk), structurally superimposes with the otherwise highly conserved C103 in the remaining Cup family members. Residue numbering is according to EfeO and the view is approximately 90" rotated in the y axis with respect to the view in A. c Close up view of the copper-binding site in the crystallographically determined amicyanin structure. Metalbinding residues (H62, C103, H106, M111) are shown as red sticks and surrounding residues, forming a hydrophobic patch

(D)

(P52, M71, P96) are shown as grey sticks. The crystallographic and GRID predicted position for copper are represented as green and yellow spheres, respectively. d Close up view of the predicted metal-binding sites showing specific residues, according to GRID, for the Cupecoli domain. According to GRID, site I has preference for an M2? (with preference for Cu2?, indicated by a green sphere) in tetrahedral geometry (C41, E66, M101 and C103) and site II has preference for Fe3? (indicated by a magenta sphere) in square planar geometry (E68, 77, 78 and 80), highlighted with red and blue sticks (respectively) with a surrounding hydrophobic patch of residues (V36, I56, L65, W67) shown as grey sticks. The views in the case of c and d are approximately 90" rotated in the x axis with respect to the view in b. Structural comparisons of amicyanin and the third Cup domain (residues 382–500) of Fet3p (the third Cup domain of Fet3p was selected because, unlike the other two, it has a type 1 copper centre) with Cupecoli, show an overall similarity in fold but with much ˚ , and RMSD closer similarity to the amicyanin (RMSD 0.7 A ˚ , respectively) reflecting the corresponding sequence 2.8 A identities (18 and 6%, respectively) (Color figure online)

123

12

surface, adjacent to the proposed copper binding site. Three of these residues (E68, 78 and 80) are absolutely or highly conserved in the Cup-I group. This negative patch of Glu residues represents a second potential metal-binding motif, designated site II (Fig. 5d; Pastore et al. 2007; Taylor et al. 2005; Fang and Wang 2002). And finally, there is a hydrophobic patch comprised mainly of residues V34, I56, I57, L65 and W67 surrounding and below site I (Fig. 5d). A similar hydrophobic patch (M28, Met51, M71, P52, P94, P96 and F97), surrounding an exposed His residue, is also seen in amicyanin and acts as potential electron transfer site (Durley et al. 1993). Collectively, these highly conserved residues and motifs in the Cup-I proteins may play a significant role in metal binding and electron transfer as part of the EfeUOB-mediated iron uptake process. Structural comparison of the metal-binding sites of Cup-IA, Cup-ID, Cup-II and Cup-III proteins It is interesting to observe that while all four site I ligands (C41, E66, M101, C103) found in the Cup-IA group proteins (e.g. Cupecoli) are conserved in the Cup-IB group, only three out of four site I ligands (all but M101) are conserved in Cup-IC and Cup-ID groups. For the solo-domain Cup-II proteins, C41 and M101 are absent and C103 is replaced with an Asp. This leaves E66 as the only conserved potential ligand at site I for the EfeO-Cup family as a whole. However, there are other well-conserved residues that could act as alternative potential metal ligands for the Cup-IC, D and -II proteins (Fig. 4). In order to explore the distinctive features of the various EfeO-like Cup domains in more detail, representative proteins from the Cup-IC, D (Cupjani) and Cup-II groups (Cupburk) were selected for model building and structural comparison with Cupecoli and amicyanin (Cup-IA and -III groups). Both Cupjani and Cupburk produced classical cupredoxin folds with RMSD values of 0.5 and 0.9, respectively, when superimposed upon the amicyanin structure (Table S3). Comparison of the site I region in the three model structures indicates that all have the potential to bind metal but, as expected, would employ slightly different ligand sets. Residues E66 and C103 of Cupjani (Cup-ID) are well conserved within the Cup-IC-D groups and align structurally with the corresponding site I residues in the Cup-IA and -II structures, and so could contribute

123

Biometals (2010) 23:1–17

to metal binding at site I (Fig. 5b). In addition, potential ligand C41, which is well conserved in the Cup-I group, may also act as a metal ligand at site I for Cupjani. For Cupburk (Cup-II), although potential ligand, C103, is replaced by an Asp (conserved in Cup-II proteins), D103 could still act as a metal ligand at this site (Fig. 5b). The absence of potential ligand C41 is compensated by the presence of H106 which is structurally aligned with the same residue in the Cu-binding site of amicyanin. This residue is highly conserved in the Cup-II and -III proteins only. This suggests a plausible, yet distinct, metal binding motif at site I of the Cup-II proteins comprising three residues: E66, D103 and H106 (Fig. 5b). Structural superimposition of the predicted site II metal-binding residues (EWE—EEREN; potential metal ligands non-subscripted) of Cupecoli, with the equivalent residues in the other two models, Cupjani (EFY—GEVEN) and Cupburk (EWE—RKEKV), shows that two of the four proposed ligands of this site are well conserved in Cupjani (and other Cup-ID proteins) with one of the other two replaced with Tyr, an alternative potential metal ligand. However, in Cupburk (and other Cup-II protein) site II is poorly conserved with just one of the four Glu ligands in Cupecoli present, and none of the three alternative residues are likely to be able to bind metal (Fig. 4). This suggests that site II is unlikely to be a metalbinding site in the solo-Cup-II domain proteins, but could be in all of the Cup-I proteins. GRID prediction of metal-binding sites in Cup-IA, Cup-ID, Cup-II and Cup-III proteins To further assess the validity of these potential metalbinding sites, the program GRID was used to predict possible metal (Cu2?, Zn2?, Fe2?, Fe3?, Mg2?) binding sites for each of the three Cup domain models as well as amicyanin. For amicyanin, the top ˚ of the most favourable interaction site was within 2 A 2? known crystallographic position for Cu and showed interaction with three of the four key residues (H62, C103, H106) known to bind copper (Fig. 5c). For Cupecoli, GRID predicted two favourable metalbinding sites corresponding to sites I and II (Table 1; Fig. 5d). GRID identified site I as a mononuclear divalent-metal (Cu2?, Fe2?, Zn2? or Mg2?) binding site (Fig. 5d) with an energetically favoured interaction with Cu2? employing all four site I ligands,

Biometals (2010) 23:1–17

namely C41, E66, M101 and C103. These residues are in agreement with the potential metal ligands predicted above. In addition, GRID predicted a potential interaction of a trivalent Fe3? at site I, however, only two (C103 and E66) of the four potential ligand residues are predicted to interact with the trivalent metal. This suggests a potential of site I in EfeO to support either a trivalent or divalent metal, but with a preference of Cu2? over Fe3?. Analogous GRID calculations for Cupjani (Cup-ID) showed an equal preference for Cu2? and Fe2? at site I, with the three anticipated metal-binding ligands (C41, E66, C103) suggested in the multiple sequence alignment (Fig. 4) interacting with the metal (Table 1). For the Cupburk domain model (Cup-II), the GRID predictions also showed a preference for Cu2? at site I, again showing energetically favourable interactions (Table 1) with the three conserved metal-binding residues (E66, C103 and H106) indicated by the multiple sequence alignment (Fig. 4). As with Cupecoli, both the Cup-II and -ID models also show potentially favourable interactions with Fe3? at site I (Table 1) but only two of the three possible ligands are predicted. In addition to the potential Cu2?-binding site I, GRID also predicted a second metal-binding site (matching site II) for Cupecoli with a preference for Fe3? involving residues E68, E77, E78 and E80 (corresponding to the EWE—EEREN motif, see above). In contrast, there were no analogous GRID interactions predicted for an equivalent site II in either Cupburk (EWE—RKEKV) or Cupjani (EFY—GEVEN).

Conclusion Sequence comparison coupled with homology modelling suggest that the Cupecoli domain contains two ˚ well-conserved metal-binding sites separated by 12 A with site I binding Cu2? and site II favouring Fe3?. Potential Cu-binding site I differs from that of the well characterised cupredoxins since Cupecoli employs ligand-residues that are mostly distinct from those of classical cupredoxins and the site is located in a slightly different region of the structure. The predicted Fe3?-binding site II has no apparent equivalent in the cupredoxins and it is therefore probable that, if this site is genuine, it represents an adaptation to enable the iron-transport associated function of EfeO.

13

From 125 Cupecoli homologous, two major types of EfeO-like Cup domain were recognisable on the basis of domain organisation, metal-binding sites, phylogeny and genetic co-localisation. One type (Cup-I) is composed of two domains, an N-terminal Cup domain and a C-terminal peptidase-M75 domain (e.g. EfeO of E. coli), and the other (Cup-II) consists of a Cup domain only. All appear to be secreted beyond the cytoplasmic membrane and nearly all are encoded by genes adjacent to ftr1/efeU homologues suggesting interaction of the Cup domain with the Ftr1p-like ferric permease. All of the Cup-I proteins were additionally associated with an EfeB homologue, although in some cases the EfeO proteins consist of an M75 domain only. The Cup-II solo domain proteins lack the predicted Fe3?-binding site II of the Cup-I proteins, employ a different set of ligands at the proposed Cu-binding site I and in no case are they associated with EfeB-like or M75domain proteins. Instead, they tend to be associated with a cytosolic polyferredoxin and a periplasmic iron-transporting ‘p19’ protein. These differences in domain organisation, predicted metal-binding sites and transporter composition indicate a functional distinction between the Cup-I and Cup-II systems. Phylogenetic analysis (Fig. S4) shows that the EfeOlike Cup-I and -II proteins populate two distinct, but related, branches of the cupredoxin superfamily. The tree organisation suggests that the EfeO-Cup proteins form a major new cupredoxin sub-family. As far as we are aware, there is no other well defined case of a cupredoxin domain (excluding MCOs) functioning as part of any type of transporter, yet the data presented here strongly suggest that all the EfeO-like Cup proteins are components of iron (or metal) transporters. Thus, we suggest that the EfeO-like Cup proteins represent a new family of cupredoxins with all known members serving roles in iron transport. A proposed mechanism of action for EfeO in the iron transport process is presented in Fig. 6. The model suggests that ferrous iron initially binds to EfeO and is then oxidised prior to transfer to EfeU. The electrons released from the ferroxidation process are delivered initially to the copper at site I, and are then passed on to the haem group of EfeB for disposal by combination with an unknown oxidant (which is unlikely to be molecular oxygen). Two potential ironbinding sites (II and III) are suggested for EfeO, one in the Cup domain and the other in the M75 domain—

123

14

(A)

Biometals (2010) 23:1–17

(B)

(C)

Fig. 6 Schematic representation of three types of Ftr1p/EfeUdependent ferrous-iron transporter and the suggested mechanisms employed. Three types of defined or putative Ftr1p/ EfeU—dependent transporter are shown: a the Cup-I type, exemplified by EfeUOB of E. coli; b the Cup-II type, for which the poorly characterised C. jejuni system is the best known example; and c the well characterized Ftr1p-Fet3p type, typified by the corresponding system of S. cerevisiae. In each case, environmental ferrous ion is the initial substrate and is first engaged within the intermembrane space (periplasm) by a specific ferrous iron binding protein (EfeO-M75, p19 or Fet3p). The ferrous iron is then oxidised and the released electrons delivered to an oxidant (such as molecular oxygen) via a Cu site (located in EfeO-Cup, solo-Cup or Fet3p). The oxidised iron is then transferred to the Ftr1p ferric-iron permease for translocation across the CM. For the Ftr1p-Fet3p system,

ferrous-iron binding and disposal of electrons released through ferrous-iron oxidation occur within a single protein (Fet3p). For the other two systems, it is suggested that these processes are mediated by different components. In the case of the Cup-I system, EfeB (a DyP haem peroxidise) is proposed to function as the reductase using its haem (Hm) group as an intermediate electron acceptor, whereas for the Cup-II system the Pfr (polyferredoxin) is suggested to fulfil this purpose employing its four [4Fe-4S] clusters to accept and pass on electrons to an intracellular acceptor. The extracellular ferric-iron reductases, Fre1p and Fre3p, are indicated for the Frt1p-Fet3p system. Equivalent reductases have not yet been indentified for bacteria. Subcellular locations are indicated: CM, cytoplasmic membrane; IMS/P, intermembrane space/periplasm; and OM/ CW, outer membrane/cell wall

this indicates that iron may bind to one site initially, and then move to the other site following oxidation. The transfer of iron between sites III and II could be mediated by the proposed inter-domain mobility of EfeO enabled by the inter-domain flexible linker. This mobility could also assist the proposed site I mediated electron transfer between the M75 domain and EfeB. As there are examples where the Cup domain is absent in EfeUOB-like transporters, it seems likely that the M75 domain would provide the primary ferrous-iron-binding site and that the proposed role of the Cup domain in electron transfer is

not an essential requirement. This suggests that if iron does move between sites III and II then it is most likely to transfer in the site III to II direction, possibly following oxidation of the iron bound at site III. Thus, the presence of the Cup domain could enhance the efficiency of the iron transport process by increasing the rate of electron exchange, by acting as an intermediary in the transfer of iron from the M75 domain to EfeU and by increasing the availability of site III for ferrous iron binding. In cases where there are two EfeO proteins (with and without a Cup domain) it is possible that the two

123

Biometals (2010) 23:1–17

EfeO proteins offer different metal affinities or selectivities. For the solo EfeO-Cup proteins, the compositions of the corresponding iron transport systems differ considerably to those of the EfeUOB-like systems (Fig. 6). The differences in composition likely reflect the use of a distinct mechanism and/or discrete oxidants for the two types of transporter. It is possible that the p19 protein functionally replaces the M75 domain in ferrous-iron binding and that the polyferredoxin takes the place of EfeB in disposing of electrons, whereas the Cup protein retains its role in electron transfer. However, if this model is true it is unclear how electrons could pass from the periplasmic components to the polyferredoxin, unless the Ftr1p/EfeU homologue is able to mediate this. Clearly, an understanding of the details of these two types of bacterial transporter will require further study. A major presumption is that the Cup-I and Cup-II transporter systems both utilise ferrous iron as substrate but deliver iron across the cytosolic membrane in the ferric form and so thus engage in ferroxidation. This assumption of a ferroxidation step is based upon the established mechanism employed by the related Ftr1p-Fet3p system and on the apparent inclusion of redox components (cupredoxins, haem peroxidases, polyferredoxins) within the Cup-I and Cup-II systems. However, the purpose of such a oxidation step within the transport processes mediated by these transporters is not clear. It is possible that an oxidation step would provide the driving force to energise the translocation process, or that the inclusion of a redox step enhances transport specificity. Currently, the energy mode employed by the Ftr1p-Fet3p system is unknown so ferroxidation remains a possibility. Indeed, a combination of enhanced specificity along with energy provision would provide a very satisfactory justification for the utilisation of a ferroxidation step within the iron-translocation pathways of the Ftr1p/EfeU-dependent transporters, as depicted in Fig. 6. Acknowledgments We thank Peter Goodford and Jim Dunwell for helpful discussions in the preparation of the manuscript. We also thank Liam McGuffin for the helpful discussions related with the evaluation of structural models. Authors thank FELIX trust, Biotechnology and Biological Sciences Research (BBSRC) and Lister Institute of Preventive Medicine for providing funding for this study. We thank Sue Mitchell and Nick Spencer (Structural Biology Unit, The Biocentre) for technical support.

15

References Adman ET (1991) Copper protein structures. Adv Protein Chem 42:145–197 Adman ET, Godden JW, Turley S (1995) The structure of copper-nitrite reductase from Achromobacter cycloclastes at five pH values, with NO2- bound and with type II copper depleted. J Biol Chem 270:27458–27474 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410 Andrews SC, Robinson AK, Rodriguez-Quinones F (2003) Bacterial iron homeostasis. FEMS Microbiol Rev 27: 215–237 Askwith C, Kaplan J (1997) An oxidase-permease-based iron transport system in Schizosaccharomyces pombe and its expression in Saccharomyces cerevisiae. J Biol Chem 272:401–405 Askwith C, Kaplan J (1998) Iron and copper transport in yeast and its relevance to human disease. Trends Biochem Sci 23:135–138 Baichoo N, Wang T, Ye R, Helmann JD (2002) Global analysis of the Bacillus subtilis Fur regulon and the iron starvation stimulon. Mol Microbiol 45:1613–1629 Bairoch A, Apweiler R, Wu CH, Barker WC, Boeckmann B, Ferro S, Gasteiger E, Huang H, Lopez R, Magrane M, Martin MJ, Natale DA, O’Donovan C, Redaschi N, Yeh LS (2005) The universal protein resource (UniProt). Nucleic Acids Res 33:D154–D159 Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved prediction of signal peptides: SignalP 3.0. J Mol Biol 340:783–795 Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE (2000) The protein data bank. Nucleic Acids Res 28:235–242 Bracken CS, Baer MT, Abdur-Rashid A, Helms W, Stojiljkovic I (1999) Use of heme-protein complexes by the Yersinia enterocolitica HemR receptor: histidine residues are essential for receptor function. J Bacteriol 181:6063–6072 Braun V, Hantke K, Koster W (1998) Bacterial iron transport: mechanisms, genetics, and regulation. In: Sigel A, Sigel H (eds) Metal ions in biological systems. Dekker, New York, pp 67–145 Bryson K, McGuffin LJ, Marsden RL, Ward JJ, Sodhi JS, Jones DT (2005) Protein structure prediction servers at University College London. Nucleic Acids Res 33:W36–W38 Cao J, Woodhall MR, Alvarez J, Cartron ML, Andrews SC (2007) EfeUOB (YcdNOB) is a tripartite, acid-induced and CpxAR-regulated, low-pH Fe2? transporter that is cryptic in Escherichia coli K-12 but functional in E. coli O157:H7. Mol Microbiol 65:857–875 Carrell CJ, Sun D, Jiang S, Davidson VL, Mathews FS (2004) Structural studies of two mutants of amicyanin from Paracoccus denitrificans that stabilize the reduced state of the copper. Biochemistry 43:9372–9380 Carrondo MA (2003) Ferritins, iron uptake and storage from the bacterioferritin viewpoint. EMBO J 22:1959–1968 Cartron ML, Maddocks S, Gillingham P, Craven CJ, Andrews SC (2006) Feo—transport of ferrous iron into bacteria. Biometals 19:143–157

123

16 Cartron ML, Mitchell SA, Woodhall MR, Andrews SC, Watson KA (2007) Preliminary X-ray diffraction analysis of YcdB from Escherichia coli: a novel haem-containing and Tat-secreted periplasmic protein with a potential role in iron transport. Acta Crystallogr Sect F 63:37–41 Chiancone E, Ceci P, Ilari A, Ribacchi F, Stefanini S (2004) Iron and proteins for iron storage and detoxification. Biometals 17:197–202 Ciria R, Abreu-Goodger C, Morett E, Merino E (2004) GeConT: gene context analysis. Bioinformatics 20:2307– 2308 Cobbett C, Goldsbrough P (2002) Phytochelatins and metallothioneins: roles in heavy metal detoxification and homeostasis. Annu Rev Plant Biol 53:159–182 Collaborative Computational Project N (1994) The CCP4 suite: programs for protein crystallography. Acta Crystallogr D B 50:760–763 Crane BR, Di Bilio AJ, Winkler JR, Gray HB (2001) Electron tunneling in single crystals of Pseudomonas aeruginosa azurins. J Am Chem Soc 123:11623–11631 Cuff JA, Clamp ME, Siddiqui AS, Finlay M, Barton GJ (1998) JPred: a consensus secondary structure prediction server. Bioinformatics 14:892–893 De Freitas J, Wintz H, Kim JH, Poynton H, Fox T, Vulpe C (2003) Yeast, a model organism for iron and copper metabolism studies. Biometals 16:185–197 De Silva DM, Askwith CC, Eide D, Kaplan J (1995) The FET3 gene product required for high affinity iron transport in yeast is a cell surface ferroxidase. J Biol Chem 270:1098–1101 Debut AJ, Dumay QC, Barabote RD, Saier MH Jr (2006) The iron/lead transporter superfamily of Fe2?/Pb2? uptake systems. J Mol Microbiol Biotechnol 11:1–9 Delano W (2002) The PyMOL molecular graphics system. www.pymol.org. Accessed Apr 2009 Dennison C (2005) Investigating the structure and function of cupredoxins. Coord Chem Rev 249:3025–3054 Ducros V, Brzozowski AM, Wilson KS, Ostergaard P, Schneider P, Svendson A, Davies GJ (2001) Structure of ˚ resolution: the laccase from Coprinus cinereus at 1.68 A evidence for different type 2 Cu-depleted isoforms. Acta Crystallogr D 57:333–336 Durley R, Chen L, Lim LW, Mathews FS, Davidson VL (1993) Crystal structure analysis of amicyanin and apoamicyanin ˚ and 1.8 A ˚ resofrom Paracoccus denitrificans at 2.0 A lution. Protein Sci 2:739–752 Fang H-M, Wang Y (2002) Characterization of iron-binding motifs in Candida albicans high-affinity iron permease CaFtr1p by site-directed mutagenesis. Biochem J 368:641–647 Finn RD, Mistry J, Schuster-Bockler B, Griffiths-Jones S, Hollich V, Lassmann T, Moxon S, Marshall M, Khanna A, Durbin R, Eddy SR, Sonnhammer EL, Bateman A (2006) Pfam: clans, web tools and services. Nucleic Acids Res 34:D247–D251 Fu Y, Lee H, Collins M, Tsai HF, Spellberg B, Edwards JE Jr, Kwon-Chung KJ, Ibrahim AS (2004) Cloning and functional characterization of the Rhizopus oryzae high affinity iron permease (rFTR1) gene. FEMS Microbiol Lett 235:169–176

123

Biometals (2010) 23:1–17 Goodford PJ (1985) A computational procedure for determining energetically favorable binding sites on biologically important macromolecules. J Med Chem 28:849–857 Gough J, Karplus K, Hughey R, Chothia C (2001) Assignment of homology to genome sequences using a library of hidden Markov models that represent all proteins of known structure. J Mol Biol 313:903–919 Grass G, Wong MD, Rosen BP, Smith RL, Rensing C (2002) ZupT is a Zn(II) uptake system in Escherichia coli. J Bacteriol 184:864–866 Grifantini R, Sebastian S, Frigimelica E, Draghi M, Bartolini E, Muzzi A, Rappuoli R, Grandi G, Genco CA (2003) Identification of iron-activated and -repressed Fur-dependent genes by transcriptome analysis of Neisseria meningitidis group B. Proc Natl Acad Sci USA 100:9542–9547 Hantke K (1987) Ferrous iron transport mutants in Escherichia coli K12. FEMS Microbiol Lett 44:53–57 Inoue T, Nishio N, Suzuki S, Kataoka K, Kohzuma T, Kai Y (1999) Crystal structure determinations of oxidized and reduced pseudoazurins from Achromobacter cycloclastes. Concerted movement of copper site in redox forms with the rearrangement of hydrogen bond at a remote histidine. J Biol Chem 274:17845–17852 Ishida T, Kinoshita K (2007) PrDOS: prediction of disordered protein regions from amino acid sequence. Nucleic Acids Res 35:W460–W464 Jones DT, Bryson K, Coleman A, McGuffin LJ, Sadowski MI, Sodhi JS, Ward JJ (2005) Prediction of novel and analogous folds using fragment assembly and fold recognition. Proteins 61:143–151 Kehres DG, Zaharik ML, Finlay BB, Maguire ME (2000) The NRAMP proteins of Salmonella typhimurium and Escherichia coli are selective manganese transporters involved in the response to reactive oxygen. Mol Microbiol 36:1085–1100 Kehres DG, Janakiraman A, Slauch JM, Maguire ME (2002) SitABCD is the alkaline Mn2? transporter of Salmonella enterica Serovar Typhimurium. J Bacteriol 184:3159–3166 Kelley LA, MacCallum RM, Sternberg MJ (2000) Enhanced genome annotation using structural profiles in the program 3D-PSSM. J Mol Biol 299:499–520 Klaassen CD, Liu J, Choudhuri S (1999) Metallothionein: an intracellular protein to protect against cadmium toxicity. Annu Rev Pharmacol Toxicol 39:267–294 Kojima T, Binz PA, Ka¨gi JHR (1999) Nomenclature of metallothionein: proposal for a revision. In: Klaassen CD (ed) Metallothionein IV. Birkhauser, Boston, pp 7–13 Laskowski RA, MacArthur MW, Moss DS, Thornton JM (1993) PROCHECK: a program to check the stereochemical quality of protein structures. J Appl Crystallogr 26:283–291 Lees JG, Miles AJ, Wien F, Wallace BA (2006) A reference database for circular dichroism spectroscopy covering fold and secondary structure space. Bioinformatics 22:1955–1962 Makui H, Roig E, Cole ST, Helmann JD, Gros P, Cellier MF (2000) Identification of the Escherichia coli K-12 Nramp orthologue (MntH) as a selective divalent metal ion transporter. Mol Microbiol 35:1065–1078

Biometals (2010) 23:1–17 Marsden RL, McGuffin LJ, Jones DT (2002) Rapid protein domain assignment from amino acid sequence using predicted secondary structure. Protein Sci 11:2814–2824 Marti-Renom MA, Stuart AC, Fiser A, Sanchez R, Melo F, Sali A (2000) Comparative protein structure modeling of genes and genomes. Annu Rev Biophys Biomol Struct 29:291–325 McGuffin L (2007) Benchmarking consensus model quality assessment for protein fold recognition. BMC Bioinformatics 8:345 McGuffin LJ (2008) The ModFOLD server for the quality assessment of protein structural models. Bioinformatics 24:586–587 McGuffin LJ, Bryson K, Jones DT (2001) What are the baselines for protein fold recognition? Bioinformatics 17:63–72 Messerschmidt A, Luecke H, Huber R (1993) X-ray structures and mechanistic implications of three functional derivatives of ascorbate oxidase from zucchini: reduced, peroxide and azide forms. J Mol Biol 230:997–1014 Messerschmidt A, Huber R, Poulos T, Wieghardt K (2001) Handbook of metalloproteins. Wiley, New York Mulder NJ, Apweiler R, Attwood TK et al (2007) New developments in the InterPro database. Nucleic Acids Res 35:D224–D228 Murphy A, Taiz L (1995) Comparison of metallothionein gene expression and nonprotein thiols in ten arabidopsis ecotypes (Correlation with copper tolerance). Plant Physiol 109:945–954 Murzin AG, Brenner SE, Hubbard T, Chothia C (1995) SCOP: a structural classification of proteins database for the investigation of sequences and structures. J Mol Biol 247:536–540 Nicholas KB, Nicholas HB, DW D (1997) GeneDoc: analysis and visualization of genetic variation. EMBNEW. NEWS 4:14. www.nrbsc.org/gfx/genedoc. Accessed Feb 2009 Ollinger J, Song KB, Antelmann H, Hecker M, Helmann JD (2006) Role of the Fur regulon in iron transport in Bacillus subtilis. J Bacteriol 188:3664–3673 Palmiter RD (1998) The elusive function of metallothioneins. Proc Natl Acad Sci USA 95:8428–8430 Paronetto MP, Miele R, Maugliani A, Borro M, Bonaccorsi di Patti MC (2001) Cloning of Pichia pastoris Fet3: insights into the high affinity iron uptake system. Arch Biochem Biophys 392:162–167 Pastore C, Franzese M, Sica F, Temussi P, Pastore A (2007) Understanding the binding properties of an unusual metalbinding protein-a study of bacterial frataxin. FEBS J 274:4199–4210 Severance S, Chakraborty S, Kosman DJ (2004) The Ftr1p iron permease in the yeast plasma membrane: orientation, topology and structure–function relationships. Biochem J 380:487–496 Solioz M, Vulpe C (1996) CPx-type ATPases: a class of P-type ATPases that pump heavy metals. Trends Biochem Sci 21:237–241

17 Solomon EI, Sundaram UM, Machonkin TE (1996) Multicopper oxidases and oxygenases. Chem Rev 96:2563– 2606 Stearman R, Yuan DS, Yamaguchi-Iwai Y, Klausner RD, Dancis A (1996) A permease-oxidase complex involved in high-affinity iron uptake in yeast. Science 271: 1552–1557 Stintzi A, Barnes C, Xu J, Raymond KN (2000) Microbial iron transport via a siderophore shuttle: a membrane ion transport paradigm. Proc Natl Acad Sci USA 97:10691– 10696 Sturm A, Schierhorn A, Lindenstrauss U, Lilie H, Bruser T (2006) YcdB from Escherichia coli reveals a novel class of Tat-dependently translocated hemoproteins. J Biol Chem 281:13972–13978 Suzuki S, Kataoka K, Yamaguchi K (2000) Metal coordination and mechanism of multicopper nitrite reductase. Acc Chem Res 33:728–735 Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599 Taylor AB, Stoj CS, Ziegler L, Kosman DJ, Hart PJ (2005) The copper-iron connection in biology: structure of the metallo-oxidase Fet3p. Proc Natl Acad Sci USA 102:15459– 15464 Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680 Wandersman C, Delepelaire P (2004) Bacterial iron sources: from siderophores to hemophores. Annu Rev Microbiol 58:611–647 Ward JJ, Sodhi JS, McGuffin LJ, Buxton BF, Jones DT (2004) Prediction and functional analysis of native disorder in proteins from the three kingdoms of life. J Mol Biol 337:635–645 Wheeler DL, Barrett T, Benson DA et al (2006) Database resources of the National Center for Biotechnology Information. Nucleic Acids Res 34:D173–D180 Whitmore L, Wallace BA (2004) DICHROWEB, an online server for protein secondary structure analyses from circular dichroism spectroscopic data. Nucleic Acids Res 32:W668–W673 Yang ZR, Thomson R, McNeil P, Esnouf RM (2005) RONN: the bio-basis function neural network technique applied to the detection of natively disordered regions in proteins. Bioinformatics 21:3369–3376 Zaitseva I, Zaitsev V, Card G, Moshkov K, Bax B, Ralph A, Lindley P (1996) The X-ray structure of human serum ˚ : nature of the copper centres. J ceruloplasmin at 3.1 A Biol Inorg Chem 1:15–23

123

Biometals (2010) 23:19–30 DOI 10.1007/s10534-009-9263-y

Elevated zinc induces endothelial apoptosis via disruption of glutathione metabolism: role of the ADP translocator Dean A. Wiseman Æ Shruti Sharma Æ Stephen M. Black

Received: 23 January 2009 / Accepted: 13 August 2009 / Published online: 22 September 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Zinc is the second-most abundant transition metal within cells and an essential micronutrient. Although adequate zinc is essential for cellular function, intracellular free zinc (Zn2?) is tightly controlled, as sustained increases in free Zn2? levels can directly contribute to apoptotic endothelial cell death. Moreover, exposure of endothelial cells to acute nitrosative and/or oxidative stress induces a rapid rise of Zn2? with mitochondrial dysfunction and the initiation of apoptosis. This apoptotic induction can be mimicked through addition of exogenous ZnCl2 and mitigated by zinc-chelation strategies, indicating Zn2?-dependent mechanisms in this process. However, the molecular mechanisms of Zn2?mediated mitochondrial dysfunction are unknown. Here we report that free Zn2? disrupts cellular redox status through inhibition of glutathione reductase, and induces apoptosis by redox-mediated inhibition of the mitochondrial adenine nucleotide transporter (ANT). Inhibition of ANT causes increased mitochondrial oxidation, loss of ADP uptake, mitochondrial translocation of bax, and apoptosis. Interestingly, pre-incubation with glutathione ethyl ester protects endothelial

D. A. Wiseman ! S. Sharma ! S. M. Black (&) Vascular Biology Center, Medical College of Georgia, 1459 Laney Walker Blvd CB-3210, Augusta, GA 30912-2500, USA e-mail: [email protected]

cells from these observed effects. We conclude that key mechanisms of Zn2?-mediated apoptotic induction include disruption of cellular glutathione homeostasis leading to ANT inhibition and decreases in mitochondrial ATP synthesis. These pathways could represent novel therapeutic targets during acute oxidative or nitrosative stress in cells and tissues. Keywords Mitochondrial dysfunction ! Apoptosis ! Redox status

Introduction Understanding the nature of how cells transduce, interpret, and respond to stress signals, both in terms of extracellular perception as well as signals from within, is fundamental for discovering and developing new therapies and interventions for situations where cells, tissues, and organs lose the ability to maintain homeostatic balance. It is now apparent reactive oxygen and nitrogen species (ROS, RNS, respectively) serve as signal transduction molecules in biological systems. ROS such as hydrogen peroxide (H2O2) and superoxide (O2•-) are also increasingly understood to have complex and highly nuanced signal transduction roles in cells and tissues (Forman and Torres 2001). However, these same chemical species can also initiate signaling pathways that result in apoptosis (Bauer 2000). We, and others,

123

20

have previously reported that exposure of pulmonary artery endothelial cells to elevated levels of ROS and/ or RNS leads to significant elevation in intracellular free zinc (Zn2?) (Tang et al. 2001; Wiseman et al. 2006, 2007; Bernal et al. 2008). Zinc is the secondmost common transition metal in cells (Atwood and Steed 2004), and zinc ions function in multiple different intracellular processes. It is estimated that at least 3% of the known human genes encode proteins containing zinc-finger domains (Maret 2003). However, the concentration of unbound ‘‘free’’ intracellular zinc is typically found at picomolar levels (Simons 1991). Thus, although Zn2? is classified as ‘‘redox inert,’’ if not adequately sequestered it can also function as a potent disruptive molecule within cells. Here, we present data that demonstrate that the effect of Zn2? on mitochondrial dysfunction is indirect. Further, we show that a key mechanism for this indirect effect is disruption of glutathione homeostasis. Interestingly, we find that a direct consequence of Zn2?-mediated depletion of reduced cellular glutathione is the inhibition of mitochondrial adenine nucleotide transport. Together, these data illustrate a cell-death mechanism whereby mitochondrial dysfunction is initiated through a Zn2?-induced loss of cellular antioxidant capacity, resulting in mitochondria deprived of adequate metabolites for normal function.

Biometals (2010) 23:19–30

CO-BRL, Gaithersburg, MD) and incubated overnight. During serum deprivation, no exogenous sources of Zn2? are available to the cells. Cells were pretreated for 2 h with SF/PRF-DMEM ± glutathione ethyl ester (GSH-EE, 2 mM, Sigma, St. Louis, MO), and then exposed 0–4 h with 0–1 mM ZnCl2 (200 mM in PBS, diluted in SF/PRF-DMEM), 0–1 mM N-[2-aminoethyl]-N-[2-hydroxy-2-nitrosohydrazino]-1,2-ethylenediam-ine (spermine NONOate; Calbiochem, San Diego, CA) in SF/PRF-DMEM. Doses were selected to examine the entire range of potential response in PAECs as we (Wiseman et al. 2006, 2007), and others (Koh and Choi 1994) previously described. At designated time points, cells were subjected to immediate analysis, unless noted. Mitochondrial isolation PAECs were scraped, washed PBS, and pelleted by centrifugation 8509g at 4"C for 2 min. Mitochondria were isolated via the manufacturer’s protocol (Pierce Biotechnology, Rockford, IL). Mitochondrial fractions were resuspended in 0.25 M sucrose, 10 mM Tris-C1, pH 7.4, and 0.5 mM EDTA. In order to avoid potential issues with chelation of Zn2? ions by EDTA, immediately prior to the beginning of each experiment, mitochondrial fractions were centrifuged and resuspended in EDTA-free buffer, and assayed as described below.

Materials and methods Fluorescence microscopy Cell culture Primary cultures of ovine fetal pulmonary artery endothelial cells (PAECs) were isolated and identified as described previously (Wedgwood et al. 2003). Cells between passages 3–10 were maintained in DMEM supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), antibiotics and antimycotics (MediaTech, Herndon, VA) at 37"C with 5% CO2– 95% air. Cells were seeded at *50% confluence, and at *90% confluence. Before experimental treatment, except as noted, cells were trypsinized, counted, re-plated in 6-, 24-, or 96-well plates (Costar, Corning, NY) at a density of 5 9 105 cells/cm2, and incubated 18 h. Cells were serum starved in serumfree, phenol red-free DMEM (SF/PRF-DMEM, GIB-

123

A PC-based imaging system consisting of: an Olympus IX51 microscope equipped with a charge-coupled camera (Hamamatsu Photonics, Hamamatsu City, Japan) was used for acquisition of fluorescent images. Fluorescent-stained cells were observed using appropriate excitation and emission, measuring at least 300 cells per sample, and the average fluorescent intensities (to correct for differences in cell number) were quantified using ImagePro Plus v5.0 software (Media Cybernetics, Silver Spring, MD). High-resolution cellular images were obtained using an Applied Precision, Inc. (Issaquah, WA) DeltaVisionTM imaging system, fitted with an environmental control chamber. Data obtained were quantified using DeltaVisionTM software and compared by statistical analysis.

Biometals (2010) 23:19–30

Detection of bax translocation Ten hours following treatment, mitochondria were isolated and resuspended in lysis buffer (20 mM Tris base, pH 7, 2.5 mM EDTA, 1% Triton-X, 1:100 protease inhibitor cocktail [Sigma]). Lysates were assayed for protein concentration by BCA protein assay (Pierce Biotechnology, Rockford, IL) and normalized for concentration. Sixty microgram of mitochondrial protein per sample was subjected to SDS–PAGE and analyzed by standard Western blot analysis as described previously (Brennan et al. 2003) using anti-bax antibody (Cell Signaling Technology, Boston, MA). Detection of apoptotic events PAECs in 96-well plates were treated as described. Caspase activation was visualized by co-treating cells with 1 lM CaspACE FITC-vad-FMK (Promega, Madison, WI). This fluorescent analog of the pancaspase inhibitor N-benzyloxycarbonyl-Val-Ala-Aspfluor-omethylketone (Z-vad-FMK) readily enters cells and binds irreversibly to activated caspases. After treatment, cells were washed with ZnCl2-free DMEM and incubated overnight in PRF-DMEM media with 1% FBS. Eighteen hours post-exposure, cells were incubated in media with 10 lM FITCconjugated caspase inhibitor (FITC-vad-FMK). After 20 min incubation at 37"C in dark conditions, cells were washed with fresh media and visualized using fluorescence microscopy. A second method involved TUNEL analysis. PAECs were incubated for *18 h in PRF-DMEM supplemented with 1% FBS. Following incubation, analysis was performed as we have previously described (Wedgwood and Black 2003). EPR detection of mitochondrial O2•- levels Mitochondrial-specific O2•- production was measured using electron paramagnetic resonance (EPR) spectroscopy with spin probe, 1-hydroxy-3-methoxycarbonyl-2,2,5,5-tetramethyl-pyrrolidine•HCl (CMH, Alexis Biochemicals, San Diego, CA) as described (Wiseman et al. 2007). Following exposure, mitochondrial isolation was performed as described above. Mitochondrial fractions were incubated for 1 h in the presence of CMH (PBS, pH 7.4 ? 25 lM deferrioxamine mesylate [Calbiochem], CMH 5 mg/ml).

21

Thirty five microliter of sample was loaded into a 50 ll capillary tube and analyzed with a MiniScope MS200 EPR (Magnettech, Berlin, Germany) at a microwave power of 40 mW, modulation amplitude of 3,000 mG, and modulation frequency of 100 kHz. EPR spectra were analyzed measured for amplitude using ANALYSIS software (v2.02; Magnettech). Detection of cellular and mitochondrial redox status PAECs were plated into 10 cm dishes at a density of *15,000 cells/cm2 (*1.25 9 106 cells per dish) and transfected with expression constructs of roGFP, redox-sensitive GFP analogs where surface-exposed residues are substituted with serine, allowing the ability to monitor the cellular thiol redox status of cells. These GFP analogs demonstrate a redoxspecific shift in fluorescence spectra directly correlated to cellular oxidation status (Hanson et al. 2004). Redox-sensitive constructs (generously provided by S. James Remington, University of Oregon) delivered either general cytosolic roGFP expression (‘‘cRo,’’ Fig. 3a), or expression of roGFP specifically within mitochondria (‘‘mRo,’’ Fig. 3a). Transfections were performed via Effectene# lipid-based delivery protocols (Qiagen). Following transfection with either cRo or mRo constructs, cells were subdivided into three groups and re-plated onto cover glass. One group was treated as described above to assess cellular redox status for up to 4 h post-onset of exposure, while the other two groups were used to calibrate maximal reduction (using 1 mM dithiothreitol, Sigma) and maximal oxidation (using 1 mM t-butyl hydroperoxide, Sigma) (Farrow et al. 2008), and cellular fluorescence at 470 and 360 nm excitation wavelengths in order to determine the ratio of reduced versus oxidized GFP for up to 4 h. In addition, an untransfected sample of cells was quantified to determine nonspecific background. Each experimental group was evaluated as a percentage of oxidation, relative to fluorescence values obtained for fully reduced and fully oxidized conditions. Measurement of glutathione reductase activity The assay for glutathione reductase activity is based on oxidation of NADPH to NADP? catalyzed by a limiting concentration of glutathione reductase. One

123

22

GR activity unit is defined as the amount of enzyme catalyzing reduction of one micromole of GSSG per minute at pH 7.6 and 25"C. Given that one molecule of NADPH is consumed for each molecule of GSSG reduced, reduction of GSSG is determined indirectly by measurement of NADPH consumption, observed as a decrease in absorbance at 340 nm (A340) over time. Briefly, PAECs were treated and harvested by scraping and centrifugation at 1,0009g for 10 min at 4"C. Cell pellets were homogenized in 200 ll of icecold KPO4 buffer (100 mM, 0.1% BSA, 5 mM EDTA, pH 7.5) and centrifuged at 10,0009g for 15 min at 4"C, and supernatants kept on ice for immediate assay. To each sample, a known amount of NADPH was added, and A340 was continuously monitored 60 s. Extinction coefficients were calculated and activity determined via comparison to known standards of purified glutathione reductase. To determine if the effect of Zn2? is acting directly upon the glutathione reductase enzyme, samples of purified glutathione reductase was exposed or not to 50 lM ZnCl2 and analyzed as described. Determination of cellular GSH:GSSG ratio This assay used is based on reaction of GSH with DTNB (Ellman’s reagent, [5,50 -dithiobis-2-nitrobenzoic acid]), which produces a detectable product with a maximal absorbance at 412 nm. The rate of product formation is proportional to the concentration of GSH. As GSH typically far exceeds the amount of oxidized GSSG within cells, this assay uses a thiolscavenging reagent, 1-methyl-2-vinylpyridinium trifluoromethanesulf-onate1 (M2VP) to scavenge GSH. Samples are then incubated with a known amount of purified glutathione reductase in the presence of DTNB, and ratios calculated according to the manufacturer’s protocol (Oxis International). For both GSSG and GSH, absorbance curves were generated and concentrations were extrapolated via comparison to known GSH standards.

Biometals (2010) 23:19–30

St. Louis, MO). Mitochondrial isolates were volume adjusted to 800 ll, pH 7.8. Hundred microliter of ATP Assay Mix solution was added to isolates, and allowed to incubate at room temperature for *3 min, during which any endogenous ATP is hydrolyzed, decreasing background signal. The assay was performed by rapidly adding 100 ll of either ATP standard or ADP, with mixing, and measured with a luminometer. Negative controls were performed using mitochondrial-free reactions and mitochondrial fractions absent of exogenous ADP. In addition, we directly measured mitochondrial adenine uptake. [3H]ADP uptake was measured by carboxyatractyloside inhibitor stop-technique described previously (Chan and Barhour 1979). Approximately 50 lg of mitochondria were suspended in 200 ll buffer containing 116 mM KC1, 21 mM Tris/HCI, pH 7.4, 1.05 mM EDTA (KCl buffer), 5.26 mM 2-oxoglutarate, and 5.26 lM p-ruthenium red. Following 5-min incubation at RT, 10 pg oligomycin was added to the suspension and chilled to 2"C. Various concentrations (5 ll) of [3H]ADP were added to 45 l aliquots of mitochondrial suspension under constant mixing. After 12 s, reactions were stopped by 10 ll injection of 200 lM p-carboxy-atractyloside, and mitochondria were pelleted at 12,0009g for 4 min. Supernatant was removed and mitochondria were washed with 200 ll KC1 buffer containing 10 nM carboxyatractyloside and re-pelleted. The mitochondrial pellet was dissolved in 100 ll of 2% SDS, transferred to a scintillation vial containing 3.0 ml of counting fluid, and counted by liquid scintillation. Statistical analyses Statistical calculations were performed using GraphPad Prism V. 4.01 software. The mean ± SD was calculated for all samples and significance determined by either by the unpaired t test or ANOVA. For ANOVA, Neuman-Kuehls post-hoc testing was utilized. A value of P \ 0.05 was considered significant.

Determination of mitochondrial ATP production Results Following exposure to Zn2? (500 lM, 4 h), isolated mitochondria were incubated in physiological conditions with exogenous ADP (100 lM, Sigma, St. Louis, MO) in the presence of ATP-dependent luciferase, according to the manufacturer’s protocol (Sigma,

123

Our previous findings indicate that pulmonary artery endothelial cells (PAECs) undergo mitochondrial dysfunction and apoptosis when exposed to either oxidative or nitrosative stress, and this effect can be

Biometals (2010) 23:19–30

mimicked if cells are exposed in the same fashion to exogenous Zn2?. Initially, we determined if elevated intracellular Zn2? induces mitochondrial dysfunction via a direct or indirect mechanism. Isolated mitochondrial fractions (from *2 9 107 cells) were suspended in metabolic buffer (free from metal chelators, such as EDTA) and acutely exposed to either ZnCl2 (Fig. 1a) or spermine NONOate (Fig. 1b, as a positive control) or for 1 h and superoxide levels determined using the spin-trap, CMH, a cyclic hydroxylamine with relatively specific affinity for O2•- (Fink and Dikalov 2002). CMH-O2•- products were detected by EPR analysis as we have described (Wiseman et al. 2006). Our data indicate that although NO increases mitochondrial-derived O2•- (Fig. 1b), Zn2? alone does not (Fig. 1a), indicating that Zn2?-mediated mitochondrial dysfunction occurs indirectly. Previous studies show an important role for reduced GSH in maintaining mitochondrial function (Garcia-Ruiz et al. 1995). Thus, we next determined if the indirect effect of free Zn2? on mitochondrial function could be due to alterations in cellular GSH homeostasis. We found that Zn2? exposure caused a decrease in the GSH-to-GSSG ratio (Fig. 2a). As the rate-limiting enzyme in the homeostatic maintenance of cellular GSH-to-GSSG ratio is glutathione reductase (GR), we next ascertained if the mechanism by which increased free Zn2? produces elevated GGSG is mediated through inhibition of glutathione reductase (GR) enzymatic activity. Our data indicate that elevated free Zn2? leads to the inhibition of GR activity in PAECs (Fig. 2b). Furthermore, to verify that Zn2? is a direct biochemical inhibitor of GR, we determined if Zn2? inhibits GR in vitro. We found the presence of Zn2? directly inhibits the ability of GR to reduce GSSG to GSH (Fig. 2c). In order to examine the effect of the decreased GSH-to-GSSG ratio induced by elevated free Zn2? on cellular redox status, we utilized redox-sensitive GFP constructs targeted to either cytosol (‘‘cRo’’) or to mitochondria (‘‘mRo’’) (Fig. 3a). Following transfection with either cRo or mRo redox-sensitive GFP, we exposed PAECs to Zn2? (0–1 mM ZnCl2) and monitored average cellular fluorescence for 4 h. Firstly, we observed a dose-dependent, significant shift in mitochondrial roGFP to a more oxidized state (Fig. 3b). Secondly, we observed a shift in both cytosolic and mitochondrial redox status to a more oxidized state, but mitochondrial oxidation occurred

23

Fig. 1 Zinc does not directly increase mitochondrial superoxide generation. Mitochondria were isolated from PAECs as described in ‘‘Methods and materials’’ and resuspended in EDTA-free physiological buffer containing either a 0–1 mM ZnCl2 or b 0–1 mM Spermine NONOate (as a positive control) and incubated at 37"C for 2 h. Following incubation, superoxide levels were determined using EPR. The direct addition of ZnCl2 does not increase mitochondrial superoxide levels while the NO donor does. Graphs represent mean amplitude of superoxide-CMH product EPR waveforms (n = 5), with representative individual waveforms illustrated above. Error bars represent ±SEM. * P \ 0.05 versus control samples; ! P \ 0.05 versus previous dose

earlier (Fig. 3c). Lastly, in cells treated with 1 mM glutathione ethyl ester prior and during onset of exposure to Zn2?, we found significant protection of

123

24

Biometals (2010) 23:19–30

Fig. 2 Zinc-mediated disruption of glutathione homeostasis is mediated by the inhibition of glutathione reductase activity. PAECs exposed to ZnCl2 (0–1 mM) were analyzed to determine GSH-to-GSSG ratio (a) and GR enzymatic activity (b). ZnCl2 causes a dose dependent decrease in the GSH-toGSSG ratio that is correlated with a decrease in GR activity.

Confirming the ZnCl2 mediated inhibition of GR, purified bovine GR was inhibited in vitro when exposed to ZnCl2 (0–100 lM, c). Graph represents average enzymatic activity versus control reaction over 5 min. Error bars ±SD (n = 4). * P \ 0.05 versus control; ! P \ 0.05 versus previous dose

mitochondrial roGFP from Zn2?-induced oxidation (Fig. 3d). GSH is known to be important in preventing oxidation and subsequent inhibition of the adenine nucleotide translocator (ANT) protein in neuronal cells (Vesce et al. 2005). Thus, we next we determined if the shift of the mitochondria to a more oxidized environment had an effect on ANT function. We utilized two assays to measure of ANT function: Initially we examined the ability of mitochondrial isolates to oxidatively phosphorylate ADP into ATP. We found that mitochondria isolated from Zn2?treated PAECs have a significantly diminished capacity to generate ATP relative to controls (Fig. 4a). However, preloading with exogenous GSH (in the form of cell-permeant GSH-ethyl ester [GSH-EE]) restored ANT activity (Fig. 4a). To corroborate this finding, we incubated mitochondrial isolates in the presence of [3H]-ADP, and determined the rate of adenine translocation into mitochondria. We found that Zn2?-exposed mitochondria showed significant, dose-dependent reductions in ADP translocation rate. Furthermore, GSH-EE pre-incubation significantly

protected ANT function from Zn2?-mediated effects (Fig. 4b). To determine if glutathione could ultimately protect PAECs from apoptotic events induced by increased free Zn2?, we examined translocation of pro-apoptotic bax proteins to mitochondria. We found pre-incubation of PAECs with GSH-EE maintained the morphology of PAECs exposed to Zn2? (Fig. 5a). We also observed significant reductions in Zn2?-mediated bax translocation to mitochondria (Fig. 5b). Furthermore, when we examined caspase activation, which we previously found to be elevated in PAECs following acute Zn2? exposure, GSH-EEpreloaded cells showed significant resistance to Zn2? (Fig. 5c). Similarly, GSH-EE preloaded cells had significantly fewer TUNEL positive nuclei versus Zn2?-exposed cells alone (Fig. 5d).

123

Discussion There is an increasing understanding regarding the role of intracellular free zinc (Zn2?) in mediating cell

Biometals (2010) 23:19–30

25

Fig. 3 Exogenous zinc induces a rapid oxidation of the mitochondrial environment. PAECs were transfected with DNA expression constructs of redox sensitive GFP targeted either to the cytosolic (‘‘cRho’’) or mitochondrial (‘‘mRho’’) compartments. a High-resolution fluorescent microscopic images of cells counterstained with MitoTrackerTM Red mitochondrial-specific fluorescent marker demonstrate the non-specific and mitochondrial-specific expression of GFP in cRho or mRho-transfected cells, respectively (bar = 15 lm). b Real-time fluorescent analysis of mRho within ECs incubated at 37"C, 5% CO2 in DMEM ± 0–1 m ZnCl2. c Although both

compartments exhibit a shift to a more oxidized environment on exposure to ZnCl2, the mitochondria appears to be more susceptible, as mRho oxidation occurs more rapidly than cRho. d mRho oxidation is protected from Zn2?-induced oxidation through pre-incubation with glutathione ethyl ester (1 mM, 2 h). Graphs represent mean intracellular ratio of reduced versus oxidized Rho-GFP (three independent replicates) relative to intensity of fully reduced samples (100%, 1 mM DTT, 1 h) and fully oxidized cells (0%, 1 mM t-BH, 1 h) at the onset of the experiment. Error bars represent ±SD. * P \ 0.05 versus control; ! P \ 0.05 versus RhoGFP ? ZnCl2

protection versus cell death. Zn2? is the second-most abundant transition metal in biological systems, and although it is thought to be redox inert, it is kept under extraordinarily tight control. With multiple functional roles within cells (Nyborg and Peersen 2004), free Zn2?, like other transition metals such as calcium, demonstrates different effects depending on its concentration. Thus, free Zn2? could represent a form of biological ‘‘rheostat’’ whereby relatively low release events serve a signaling and/or protective role, while a more profound release within the cell triggers cell death responses. We have previously demonstrated that Zn2?, when elevated to high

enough levels, induces apoptosis in endothelial cells (Wiseman et al. 2006, 2007). In this study, we identify new key events by which elevations in free Zn2? contribute to induction of mitochondrial dysfunction and the apoptotic process. Specifically, we show that elevated Zn2? concentrations disrupt glutathione homeostasis though inhibition of glutathione reductase enzymatic activity. Interestingly, with decreased endogenous reduced glutathione, we observe an associated loss of mitochondrial import of ADP, measured not only by the ability of mitochondria to synthesize ATP in physiological conditions, but also by direct measurement of [3H]-ADP uptake.

123

26

Biometals (2010) 23:19–30 Fig. 5 Elevation of reduced intracellular glutathione protects c ECs from Zn2?-induced induction of apoptosis. The analysis of cell morphology using brightfield microscopy shows extensive cell rounding and reduced plate adherence 18 h after an acute exposure to exogenous Zn2? (ZnCl2, 0–1 mM), whereas cells pre-incubated in 1 mM glutathione ethyl ester (GSH) generally retain a morphology similar to that of untreated cells (a). PAECs were exposed to increasing concentrations of ZnCl2 (0–1 mM, 4 h) in the presence and absence of a GSH-EE (1 mM). After an additional 12 h the cells were analyzed for mitochondrial bax translocation (b), caspase activation (c), and the presence of apoptotic nuclei (d). The increases in mitochondrial bax translocation, caspase activation, and apoptotic nuclei induced by Zn2? are reduced in the presence of GSH-EE. Graphs represent mean ± SD (n [ 3). * P \ 0.05 versus control; ! P \ 0.05 versus next lesser dose; " P \ 0.05 versus control DMEM pre-incubation

Fig. 4 Zinc-mediated oxidation of the mitochondrial environment leads to the inhibition of adenine nucleotide translocator activity and this is prevented by reduced GSH. PAECs were exposed to increasing concentrations of ZnCl2 (0–1 mM, 2 h) in the presence and absence of a cell permeable GSH analogue (glutathione ethyl ester [GSH-EE], 1 mM), then ANT activity determined using either an ATP synthetic activity assay (a) or [3H]-ADP mitochondrial uptake (b). Both ATP generation and [3H]-ADP uptake is inhibited by ZnCl2 and this is prevented by preincubation with GSH-EE. The ‘‘buffer’’ sample represents mitochondrial fraction in reaction buffer in the absence of ADP. Graphs represent mean ± SD (n = 4). * P \ 0.05 versus control; ! P \ 0.05 versus previous dose; " P \ 0.05 versus Zn2? in the absence of GSH-EE

Importantly, this entire process was reversed by supplementation with glutathione ethyl ester, and allowed endothelial cells to withstand extremely high Zn2? concentrations. Here our data not only corroborate the findings of others, which show Zn2?mediated disruption of glutathione homeostasis, but also extend understanding of this process to include a novel specific outcome of glutathione disruption: inhibition of ADP transport into mitochondria. This new finding explains how Zn2?, or any other stimulus

123

which deprives mitochondria the ability to import metabolites like ADP properly, could trigger a negative cycle of mitochondrial dysfunction with subsequent generation of superoxide, increased oxidative stress, and ultimately apoptosis. This mechanism also provides an explanation for why mitochondrial uncoupling proteins such as UCP-2 can provide protective effects during periods of cell stress, and oxidative stress in particular (Echtay et al. 2002). Furthermore, this role of Zn2? levels contributing to glutathione deprivation and oxidative stress appears to be evolutionarily conserved in both animals and plants (Lange et al. 2002; Bittsanszky et al. 2005), indicating that although we utilized a pulmonary cell model system, this mechanism has broad applicability. Adenine nucleotide translocase (ANT) is the major mitochondrial carrier facilitating ADP and ATP transport across the inner mitochondrial membrane (Shertzer and Racker 1976). In mammals, there are multiple isoforms of ANT, including four known in humans, and these isoforms appear to be differentially expressed across tissues. In addition to functioning as a nucleotide transporter, ANT complexes are involved in regulation of apoptosis (Lunardi and Attardi 1991). Specific interaction of ANT protein with both pro- and anti-apoptotic proteins have been reported and demonstrate a highly complex, nuanced mechanism of cell death regulation (Belzacq et al. 2003). Notably, sulfhydryl moieties within the ANT peptide appear to be required for proper ANT activity (Li et al. 2006), and thus represent a significant vulnerability in the face of loss of oxidative protection from glutathione. Previous studies report that

Biometals (2010) 23:19–30

ANT proteins can be oxidatively modified even under relatively mild conditions (Giron-Calle et al. 1994). Therefore, given our data demonstrating that the

27

mitochondrial are rapidly altered to a more oxidized environment during exposure to free Zn2?, we speculate that Zn2?-mediated inhibition of glutathione

123

28

homeostasis allows inappropriate oxidation of ANT, with subsequent reduction of adenine nucleotide transport. Although our data indicate that elevated Zn2? can have a pathologic effect on PAEC it must be emphasized that these findings should not be misconstrued as suggesting that dietary supplementation of zinc is necessarily harmful. Oral zinc intoxication events are rare in humans, and are normally only observed following ingestion of zinc-containing items such as coins (Bennett et al. 1997). This is likely due to the fact that the diet is the single biological source of zinc and metals, and a highly regulated uptake and dietary excretion mechanisms in place which mitigates all but extreme levels of uptake. As intracellular Zn2? has both catalytic roles and structural roles in proteins, despite being considered ‘‘redox inert,’’ Zn2? can bind to cysteine residues to create protein folds important in protecting molecules from oxidation. From both our previous data showing Zn2?-mediated increases in mitochondrial-derived superoxide, as well as data presented here with redox-sensitive GFP, Zn2? appears to be both directly and specifically involved in regulation of cellular redox homeostasis. Several reports have concluded that zinc serves as a cytoprotective agent, defending cells against both oxidative insult and against stimuli that induce apoptosis (Zalewski et al. 1991; Bao and Knoell 2006). Indeed, a recent study found that lowlevel zinc release enhances glutathione synthesis through an Nrf2-mediated transcriptional mechanism (Cortese et al. 2008), seemingly in contradiction to our current findings. However, this same report shows that above a given threshold, similar to our own findings, cell viability drops precipitously. Thus, our data here actually corroborate and extend what was reported. Together these findings suggest that cellular Zn2? release is important cell fate determinant in the face of stress. Furthermore, these data reinforce that Zn2? level must remain within a specific physiological window, and both sub- and super-optimal intracellular Zn2? can result in similar apoptotic consequences. The complexity and difficulty of elucidating Zn2?-specific roles in this mechanism are further illustrated in reports where Zn2? is concluded to serve as a caspase and/or procaspase enzymatic inhibitor (Truong-Tran et al. 2001; Peterson et al. 2009). There are multiple possibilities for this apparent ‘‘zinc paradox,’’ where Zn2? serves simultaneously as both a pro- and/or anti-

123

Biometals (2010) 23:19–30

antiapoptotic regulator. We speculate that this paradox is the result of differences in cellular availability of zinc homeostatic mechanisms (i.e., zinc transporters, metallothionein, etc.), antioxidant systems, and ultimately different proteomic milieus across cells, even similar cells in different metabolic circumstances. The presence—even transient presence—of a particularly zinc-sensitive protein within a cell could potentially have significant impact on how zinc manifests pathological or beneficial effect. Clearly, further examination and clarification of the fundamental biochemical interaction of Zn2? and proteins in the context of cellular physiology is merited. Also notable is the significance of glutathione homeostasis during Zn2?-mediated oxidative stress, despite the fact that several intracellular antioxidant systems are known. These include the thioredoxin (Watson et al. 2004) and peroxyredoxin (Novoselov et al. 2000) antioxidant systems, along with canonical systems of superoxide dismutase and catalase (Machlin and Bendich 1987). As we find that addition of exogenous GSH protects cells from an apoptotic induction, this suggests the glutathione system is more important than these other systems. We further speculate that if glutathione levels could be enhanced, this might provide a comprehensive mechanism to protect cells from the induction of apoptosis. It would also be interesting to determine if enhancing GSH levels can protect cells from necrotic cell death. However, further studies will be required to evaluate GSH as a therapeutic agent. It should be noted that the doses of exogenous Zn2? used here and in our previously published studies appear to be high, and the highest doses administered are likely unattainable in normal physiological situations. This is due to the difficulty of raising intracellular Zn2? without need of chemical agents, notably zinc pyrithione (bis(2pyridylthio)zinc 1,10 -dioxide), thus allowing Zn2? doses that are more ‘‘physiological’’ (Tang et al. 2001). However, while use of these compounds is possible, they are extremely toxic to cells and introduce the possibility of confounding pharmacological effects which may be mistakenly attributed to Zn2?. Furthermore, using ZnCl2 in our ‘‘direct’’ fashion is both direct and effective, given that chloride ions are already present in multiple millimolar concentrations, so addition of up to one additional millimole of chloride is relatively innocuous, especially when compared to potential effects

Biometals (2010) 23:19–30

of anions of other zinc compounds, such as sulfate, although relatively abundant, are orders of magnitude more rare than chloride (Markovich 2001). So as long as pH and osmotic pressures are accounted for, this system provides a simple, repeatable method of modulating intracellular Zn2?. It should also be noted that our ability to protect cells even in the face of super-physiological levels of exposure further reinforces the validity of this protective mechanism. The ramifications of this robust protection may have particular significance in instances of acute respiratory distress syndrome (ARDS) where patients are exposed to toxic levels of metal fumes (Frutos-Vivar et al. 2004) or exposure to aerosolized zinc nanoparticles in smoke (Wilson et al. 2007). Indeed, we speculate that virtually any non-enteric delivery of bioavailable zinc particles/ions may pose a potential hazard, as illustrated by recent events involving nasal neuroreceptor toxicity arising from popular over-thecounter nasally-delivered cold remedies containing significant concentrations of bioavailable zinc, and that caution is merited. In conclusion, this study illustrates potentially new avenues for understanding the specific role of intracellular Zn2? as a key mediator of the cell-fate decision, and the specific mechanism by which Zn2? can function in a pro-apoptotic role. We speculate that developing novel methods of intervention based on reducing free Zn2? levels could be considered in cases of acute cellular oxidative or nitrosative stress. Acknowledgments This research was supported by a Ruth L. Kirschstein National Research Service Award Individual Fellowship, F32HL090198 (to D. A. Wiseman); National Institute of Health Grants HL-60190, HL-67841, HL-72123, HL084739, R21HD057406, and HL-70061, a Transatlantic Network Development Grant from Fondation LeDucq (all to S. M. Black), and an AHA Southeast affiliates Beginning Grant In Aid Award (09BGIA2310050, to S. Sharma).

References Atwood JL, Steed JW (2004) Encyclopedia of supramolecular chemistry. M. Dekker, New York Bao S, Knoell DL (2006) Zinc modulates airway epithelium susceptibility to death receptor-mediated apoptosis. Am J Physiol Lung Cell Mol Physiol 290:L433–L441 Bauer G (2000) Reactive oxygen and nitrogen species: efficient, selective, and interactive signals during intercellular induction of apoptosis. Anticancer Res 20:4115–4139 Belzacq AS, Vieira HL, Verrier F, Vandecasteele G, Cohen I, Prevost MC, Larquet E, Pariselli F, Petit PX, Kahn A,

29 Rizzuto R, Brenner C, Kroemer G (2003) Bcl-2 and Bax modulate adenine nucleotide translocase activity. Cancer Res 63:541–546 Bennett DR, Baird CJ, Chan KM, Crookes PF, Bremner CG, Gottlieb MM, Naritoku WY (1997) Zinc toxicity following massive coin ingestion. Am J Forensic Med Pathol 18:148–153 Bernal PJ, Leelavanichkul K, Bauer E, Cao R, Wilson A, Wasserloos KJ, Watkins SC, Pitt BR, St Croix CM (2008) Nitric oxide-mediated zinc release contributes to hypoxic regulation of pulmonary vascular tone. Circ Res 102: 1575–1583 Bittsanszky A, Komives T, Gullner G, Gyulai G, Kiss J, Heszky L, Radimszky L, Rennenberg H (2005) Ability of transgenic poplars with elevated glutathione content to tolerate zinc(2?) stress. Environ Int 31:251–254 Brennan LA, Wedgwood S, Bekker JM, Black SM (2003) Nitric oxide activates p21ras and leads to the inhibition of endothelial NO synthase by protein nitration. DNA Cell Biol 22:317–328 Chan SHP, Barhour KL (1979) Membrane bioenergetics: based on the international workshop held at Cranbrook Schools, Bloomfield Hills, Michigan, July 5–7, 1979 in honor of Efraim Racker. Addison-Wesley, Reading Cortese MM, Suschek CV, Wetzel W, Kroncke KD, KolbBachofen V (2008) Zinc protects endothelial cells from hydrogen peroxide via Nrf2-dependent stimulation of glutathione biosynthesis. Free Radic Biol Med 44:2002– 2012 Echtay KS, Murphy MP, Smith RA, Talbot DA, Brand MD (2002) Superoxide activates mitochondrial uncoupling protein 2 from the matrix side. Studies using targeted antioxidants. J Biol Chem 277:47129–47135 Farrow KN, Groh BS, Schumacker PT, Lakshminrusimha S, Czech L, Gugino SF, Russell JA, Steinhorn RH (2008) Hyperoxia increases phosphodiesterase 5 expression and activity in ovine fetal pulmonary artery smooth muscle cells. Circ Res 102:226–233 Fink B, Dikalov S (2002) Detection of superoxide with new cyclic hydroxylamine CMH in plasma, cells, isolated heart. Free Radic Biol Med 33:S366 Forman HJ, Torres M (2001) Redox signaling in macrophages. Mol Asp Med 22:189–216 Frutos-Vivar F, Nin N, Esteban A (2004) Epidemiology of acute lung injury and acute respiratory distress syndrome. Curr Opin Crit Care 10:1–6 Garcia-Ruiz C, Colell A, Morales A, Kaplowitz N, FernandezCheca JC (1995) Role of oxidative stress generated from the mitochondrial electron transport chain and mitochondrial glutathione status in loss of mitochondrial function and activation of transcription factor nuclear factor-kappa B: studies with isolated mitochondria and rat hepatocytes. Mol Pharmacol 48:825–834 Giron-Calle J, Zwizinski CW, Schmid HH (1994) Peroxidative damage to cardiac mitochondria. II. Immunological analysis of modified adenine nucleotide translocase. Arch Biochem Biophys 315:1–7 Hanson GT, Aggeler R, Oglesbee D, Cannon M, Capaldi RA, Tsien RY, Remington SJ (2004) Investigating mitochondrial redox potential with redox-sensitive green fluorescent protein indicators. J Biol Chem 279:13044–13053

123

30 Koh JY, Choi DW (1994) Zinc toxicity on cultured cortical neurons: involvement of N-methyl-D-aspartate receptors. Neuroscience 60:1049–1057 Lange A, Ausseil O, Segner H (2002) Alterations of tissue glutathione levels and metallothionein mRNA in rainbow trout during single and combined exposure to cadmium and zinc. Comp Biochem Physiol C Toxicol Pharmacol 131:231–243 Li Q, Sato EF, Kira Y, Nishikawa M, Utsumi K, Inoue M (2006) A possible cooperation of SOD1 and cytochrome c in mitochondria-dependent apoptosis. Free Radic Biol Med 40:173–181 Lunardi J, Attardi G (1991) Differential regulation of expression of the multiple ADP/ATP translocase genes in human cells. J Biol Chem 266:16534–16540 Machlin LJ, Bendich A (1987) Free radical tissue damage: protective role of antioxidant nutrients. Faseb J 1:441–445 Maret W (2003) Cellular zinc and redox states converge in the metallothionein/thionein pair. J Nutr 133:1460S–1462S Markovich D (2001) Physiological roles and regulation of mammalian sulfate transporters. Physiol Rev 81:1499– 1533 Novoselov VI, Amelina SE, Kravchenko IN, Novoselov SV, Yanin VA, Sadovnikov VB, Fesenko EE (2000) The role of peroxyredoxin in the antioxidant system of respiratory organs. Dokl Biophys 373–375:64–66 Nyborg JK, Peersen OB (2004) That zincing feeling: the effects of EDTA on the behaviour of zinc-binding transcriptional regulators. Biochem J 381:e3–e4 Peterson QP, Goode DR, West DC, Ramsey KN, Lee JJ, Hergenrother PJ (2009) PAC-1 activates procaspase-3 in vitro through relief of zinc-mediated inhibition. J Mol Biol 388:144–158 Shertzer HG, Racker E (1976) Reconstitution and characterization of the adenine nucleotide transporter derived from bovine heart mitochondria. J Biol Chem 251:2446–2452 Simons TJ (1991) Intracellular free zinc and zinc buffering in human red blood cells. J Membr Biol 123:63–71 Tang ZL, Wasserloos K, St Croix CM, Pitt BR (2001) Role of zinc in pulmonary endothelial cell response to oxidative

123

Biometals (2010) 23:19–30 stress. Am J Physiol Lung Cell Mol Physiol 281:L243– L249 Truong-Tran AQ, Carter J, Ruffin RE, Zalewski PD (2001) The role of zinc in caspase activation and apoptotic cell death. Biometals 14:315–330 Vesce S, Jekabsons MB, Johnson-Cadwell LI, Nicholls DG (2005) Acute glutathione depletion restricts mitochondrial ATP export in cerebellar granule neurons. J Biol Chem 280:38720–38728 Watson WH, Yang X, Choi YE, Jones DP, Kehrer JP (2004) Thioredoxin and its role in toxicology. Toxicol Sci 78:3– 14 Wedgwood S, Black SM (2003) Molecular mechanisms of nitric oxide-induced growth arrest and apoptosis in fetal pulmonary arterial smooth muscle cells. Nitric Oxid 9:201–210 Wedgwood S, Mitchell CJ, Fineman JR, Black SM (2003) Developmental differences in the shear stress-induced expression of endothelial NO synthase: changing role of AP-1. Am J Physiol Lung Cell Mol Physiol 284:L650– L662 Wilson MR, Foucaud L, Barlow PG, Hutchison GR, Sales J, Simpson RJ, Stone V (2007) Nanoparticle interactions with zinc and iron: implications for toxicology and inflammation. Toxicol Appl Pharmacol 225:80–89 Wiseman DA, Wells SM, Wilham J, Hubbard M, Welker JE, Black SM (2006) Endothelial response to stress from exogenous Zn2? resembles that of NO-mediated nitrosative stress, and is protected by MT-1 overexpression. Am J Physiol Cell Physiol 291:C555–C568 Wiseman DA, Wells SM, Hubbard M, Welker JE, Black SM (2007) Alterations in zinc homeostasis underlie endothelial cell death induced by oxidative stress from acute exposure to hydrogen peroxide. Am J Physiol Lung Cell Mol Physiol 292:L165–L177 Zalewski PD, Forbes IJ, Giannakis C (1991) Physiological role for zinc in prevention of apoptosis (gene-directed death). Biochem Int 24:1093–1101

Biometals (2010) 23:31–41 DOI 10.1007/s10534-009-9264-x

Zinc activates neutrophils’ oxidative burst Marisa Freitas Æ Grac¸a Porto Æ Jose´ L. F. C. Lima Æ Eduarda Fernandes

Received: 3 May 2009 / Accepted: 25 August 2009 / Published online: 17 September 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Zinc has been shown to disturb the innate host defense response by interfering in the activation of neutrophils and subsequent oxidative burst, although the exact role of this metal, either as an activator or inhibitor, remains a matter of controversy among research groups. These apparent discrepancies may be due to experimental settings, through modification of zinc availability to neutrophils, or to inaccurate detections of reactive species. Thus, the main objective of the present study was to provide clarification on the role of zinc on the activation of human neutrophils and the subsequent oxidative burst. For that purpose, different detection methods and incubation media were used. The obtained results showed that phosphate buffers (PBS and HBSS) complex with zinc and interfere with the results obtained with this metal. By using Tris-G, it was clearly demonstrated that zinc, at low concentrations (5–12.5 lM), activates NADPH oxidase, mainly via protein kinase C, leading to the formation of superoxide radical (O2•-). Higher concentrations of zinc

results on a rapid dismutation of O2•- to oxygen and hydrogen peroxide, which in turn is used by myeloperoxidase to generate hypochlorous acid (HOCl). Keywords Human neutrophils ! Oxidative burst ! Zinc ! Protein kinase C ! NADPH oxidase Abbrevations PMN ROS RNS PKC ABAH PMA PBS HBSS Tris-G APF HRP Amplex Red DPI Go¨6983

Polymorphonuclear leukocytes Reactive oxygen species Reactive nitrogen species Protein kinase C 4-Aminobenzoyl hydrazide Phorbol myristate acetate Dulbecco’s phosphate buffer saline Hank’s balanced salt solution Tris buffer saline 6-(40 -Amino)phenoxy-3H-xanthen-3on-9-yl]benzoic acid Horseradish peroxidase 10-Acetyl-3,7-dihydroxyphenoxazine Diphenyleneiodonium chloride 3-[1-[3-(Dimethylamino)propyl]-5methoxy-1H-indol-3-yl]-4-(1H-indol3-yl)-1H-pyrrole-2,5-dione

M. Freitas ! J. L. F. C. Lima ! E. Fernandes (&) REQUIMTE, Departamento de Quı´mica-Fı´sica, Faculdade de Farma´cia, Universidade do Porto, Rua Anı´bal Cunha 164, 4099-030 Porto, Portugal e-mail: [email protected]

Introduction

G. Porto Servic¸o de Hematologia Clı´nica, Hospital Geral de Santo Anto´nio, Porto, Portugal

Zinc is one of the most abundant transition metals in the earth’s crust. It is also a relevant trace element in

123

32

the human body, through its involvement in many biological pathways as a constituent of functional proteins, namely as a catalytic component of approximately 300 enzymes (Parkin 2004). The ensuing relevance for cell division and differentiation, as well as for programmed cell death, for gene transcription, for biomembrane functioning, and obviously for many enzymatic activities, has led zinc to be considered as a leading element in assuring correct functioning of various tissues, organs and organ systems in man and animals (Maret and Sandstead 2006; Parkin 2004; Rink and Gabriel 2001; Stefanidou et al. 2006). Most reports in the literature referring to zinc indicate this metal as being relatively non-toxic and that animals, including humans, exhibit considerable tolerance to high zinc intake (Fosmire 1990). Nevertheless, in spite of its safety, some reports suggest that zinc may disturb the innate host defense response, by interfering in the activation of neutrophils and subsequent oxidative burst (Benoni et al. 1998; Lindahl et al. 1998; Takeyama et al. 1995). Furthermore, is has also been argued that zinc inhibits superoxide radical (O2•-) production (DeCoursey et al. 2003; Henderson et al. 1988). We hypothesised that these apparent discrepancies may be related to possible zinc concentration-dependent effects on neutrophils’ NADPH activation pathways, or in the quantitative and/or qualitative ensuing formation of reactive oxygen species (ROS) and reactive nitrogen species (RNS). A frequently overlooked bias in metal research is that even when similar concentrations of a metal are tested in vitro assays, its effective concentrations may be highly dependent on the metal-complexation potential of the incubation media (Frasco et al. 2005). Zinc research corresponds to a paradigmatic example, as it was previously shown that phosphate avidly complexes zinc (Zhang 1996). The aim of the present study was to provide clarification on the role of zinc chloride in the activation human neutrophils and the consequent oxidative burst. For that purpose, we used different methods for the identification of the ROS and RNS produced during the oxidative burst, and applied incubation media with different phosphate concentrations, in order to understand the apparent contradictory results reported in literature. Having confirmed the zinc stimulatory effect, the pathways leading to zinc-induced activation of NADPH

123

Biometals (2010) 23:31–41

oxidase were evaluated, underlining its involvement with protein kinase C (PKC) activation.

Materials and methods Reagents The following reagents were obtained from Sigma Chemical Co. (St. Louis, USA): Dulbecco’s phosphate buffer saline (PBS), Hank’s balanced salt solution (HBSS), luminol, cytochrome c from horse heart, potassium chloride, zinc chloride, N-nitro-Larginine methyl ester (L-NAME), diphenyleneiodonium chloride (DPI), 2-[6-(40 -amino)phenoxy-3H-xanthen3-on-9-yl]benzoic acid (APF), horseradish peroxidase (HRP), 10-acetyl-3,7-dihydroxyphenoxazine (Amplex Red), 3-[1-[3-(dimethylamino)-propyl]-5methoxy-1H-indol-3-yl]-4-(1H-indol-3-yl)-1H-pyrrole2,5-dione (Go¨6983), and phorbol myristate acetate (PMA). Tris(hydroxymethyl)-aminomethane (Tris) and mannitol was obtained from Riedel de Hae¨n (Germany). 4-Aminobenzoyl hydrazide (ABAH) was purchased from Calbiochem (San Diego, CA, USA). The chemical composition of buffering media is presented in Table 1. Equipment All determinations were performed in a microplate reader (Synergy HT, BIO-TEK), using colorimetric, fluorimetric or chemiluminometric detection.

Table 1 Composition of incubation media used to test neutrophils (pH = 7.4) Composition (mM)

PBS

HBSS

Tris-G

CaCl2!2H2O MgCl2!6H2O

0.90 0.49

1.26 –

1.26 –

KCl

2.68

5.37

5.37

MgSO4

–

0.81

0.81

NaCl

140

140

140

KH2PO4

1.21

0.36

–

Na2HPO4

8.10

0.34

–

NaHCO3

–

4.17

–

D-Glucose

–

5.55

5.55

Tris

–

–

25

Biometals (2010) 23:31–41

Isolation of human neutrophils by the gradient density centrifugation method Venous blood was collected from healthy human volunteers by antecubital venipuncture, into vacuum tubes with EDTA. The isolation of human neutrophils from whole blood was performed by the gradient density centrifugation method, using Histopaque solutions 1077 and 1119 in polypropylene 12 mL centrifuge tubes, as reported by Freitas et al. (2008). Briefly, 3 mL of Histopaque 1077 was carefully layered on top of 3 mL of Histopaque 1119 in a 12 mL polypropylene tube. Subsequently, 6 mL of the collected blood was decanted on this discontinuous density gradient. The tube was centrifuged at 890g for 30 min at 20"C. Once the centrifugation was complete the neutrophils were carefully removed using a Pasteur pipette. The neutrophils pellet was removed and doubled in volume using PBS without Ca2? and Mg2? (this reduces the viscosity of the Histopaque-neutrophils suspension so that the cells can be centrifuged without the need for high g forces). The neutrophils suspension was then centrifuged at 870g for 5 min at 4"C. The supernatant was decanted and a mixture of 1.25 mL of PBS without Ca2? and Mg2? ? 5.25 mL of sterile distilled water was added to the neutrophils pellet to lyse any remaining red blood cells. The tube was gently inverted for 1.30 min, after which isotonicity was reestablished by adding 2.2 mL of 3% NaCl. This suspension was then submitted to a new centrifugation at 870g for 5 min at 4"C after which the supernatant was decanted and the neutrophils pellet resuspended in PBS with Ca2? and Mg2?. The time taken from venipuncture to the start of the different assays was about the same in all experiments (2 h). Isolated neutrophils were kept in ice until use. The neutrophils were used from one volunteer per experiment. Cell viability and cell yield were evaluated by the Trypan blue exclusion method, using a neubauer chamber and an optic microscope (409). Oxidative burst in human neutrophils Upon activation, neutrophils initiate an oxidative burst by consuming molecular oxygen, resulting in the formation of O2•- through the activity of the plasma membrane bound enzyme NADPH oxidase. O2•rapidly undergoes either spontaneous- or enzyme-

33

catalyzed dismutation (by microorganism-derived superoxide dismutase, SOD) to hydrogen peroxide and oxygen (2O2•- ? 2H? ? H2O2 ? O2; Babior 1999). Concomitantly, myeloperoxidase (MPO), a heme protein present in azurophil granules of neutrophils is released, upon cell activation, into the phagolysosome or into the extracellular space. This enzyme considerably contributes to the bactericidal capabilities of these cells via formation of HOCl from H2O2 and chloride ions (Hampton et al. 1998; Witko-Sarsat et al. 2000). H2O2 also contributes to the formation of hydroxyl radicals (HO!), especially in the presence of metal ions (usually iron), through the Fenton or Haber–Weiss reactions (Mladenka et al. 2006). In addition, H2O2 can react with HOCl, to yield another highly reactive ROS, singlet oxygen (1O2; Costa et al. 2008; Miyamoto et al. 2007). Likewise ROS, the production of RNS is also highly increased in the event of inflammatory processes, and contributes to the antimicrobial activity. Inducible nitric oxide synthase (iNOS) transforms ! L-arginine into nitric oxide ( NO) and L-citrulline. The ! rapid reaction of NO with O2•- leads to the formation of peroxynitrite anion (ONOO-; Denicola and Radi 2005). !NO or ONOO- could also react with H2O2 to generate 1O2 (Costa et al. 2008; Miyamoto et al. 2007). Some of the above mentioned reactive species were measured by using their ability to react with chemiluminometric, fluorimetric and colorimetric probes as described below. Luminol amplified chemiluminescence assay The chemiluminometric probe luminol has been thoroughly studied and used for monitoring reactive species production by neutrophils, namely O2•-, H2O2, HO!, HOCl, !NO, and ONOO- (Freitas et al. 2009a). The measurement of neutrophils’ oxidative burst was undertaken by chemiluminescence, by monitoring the oxidation of luminol by neutrophilgenerated reactive species, according to a previously described procedure (Freitas et al. 2008). Reaction mixtures contained neutrophils and the following reagents at the indicated final concentrations (in a final volume of 200 lL): luminol (50 lM when HBSS was used and 500 lM with the other buffers, as proposed by Freitas et al. (2009b), buffer used to test neutrophils (PBS, HBSS, Tris-G), zinc (0–1,000 lM) and

123

34

neutrophils (final suspension = 1 9 106 cells/mL). In a set of experiments, the effect of the NADPH oxidase inhibitor diphenyleneiodonium chloride (DPI; 10 or 20 lM, 5 min before zinc) was tested against the highest zinc concentration studied (1,000 lM). The reaction mixture was subjected to continuous soft shaking and incubated at 37"C during the course of the assays. Kinetic readings were initiated immediately after cell stimulation. Measurements were taken at the peak of the curve, which varied depending on the buffer saline used. Effects are expressed as chemiluminescence arbitrary units/min. Cytochrome c reduction assay The cytochrome c reduction assay consists in following, colorimetrically, the reduction of cytochrome c by O2•- (Freitas et al. 2009a). The measurement of neutrophils’ oxidative burst was undertaken by colorimetry, through monitoring the reduction of cytochrome c by O2•-, at 550 nm, according to a previously described procedure, with some modifications (Freitas et al. 2009b). Reaction mixtures contained neutrophils and the following reagents at the indicated final concentrations (in a final volume of 200 lL): cytochrome c (50 lM), buffer used to test neutrophils (PBS, HBSS, Tris-G), zinc (0–1,000 lM) and neutrophils (final suspension = 1 9 106 cells/mL). In a set of experiments, the effect DPI (10 or 20 lM, 5 min before zinc) was tested against the zinc concentration that stimulates neutrophils (5 lM). The reaction mixture was subjected to continuous soft shaking and incubated at 37"C during the course of the assays. Kinetic readings were initiated after a lag time of 5 min. Effects are expressed as absorbance arbitrary units/min.

Biometals (2010) 23:31–41

5 min before zinc, was tested against the zinc concentration that provided the best response. The excitation and emission wavelengths used were 530 and 590 nm, respectively. The reaction mixture was subjected to continuous soft shaking and incubated at 37"C during the course of the assays. Kinetic readings were initiated after a lag time of 5 min. Effects are expressed as fluorescence arbitrary units/min. APF (2-[6-(40 -amino)phenoxy-3H-xanthen-3-on9-yl]benzoic acid) assay 2-[6-(40 -amino)phenoxy-3H-xanthen-3-on-9-yl]benzoic acid (APF) is a non-fluorescent derivative of fluorescein, which is oxidized by highly reactive ROS and RNS like HO!, HOCl and ONOO- (Freitas et al. 2009a). To distinguish which specie(s) is(are) involved in the measured oxidative burst we used a MPO inhibitor (ABAH), a NOS inhibitor (L-NAME) and a specific scavenger of HO! (mannitol). Reaction mixtures contained neutrophils and the following reagents at the indicated final concentrations (in a final volume of 275 lL): neutrophils (final suspension = 3 9 106 cells/mL) resuspended in Tris-G incubated at 37"C with one of the inhibitors of the enzymes responsible for the generation of reactive species [ABAH (500 lM) or L-NAME (5 mM) or the scavenger of reactive species mannitol (30 mM)]. After 5 min, APF (2 lM) and zinc (1,000 lM) were added. The excitation and emission wavelengths used were 485 and 528 nm, respectively. The reaction mixture was subjected to continuous soft shaking and incubated at 37"C during the course of the assays. Kinetic readings were initiated after a lag time of 5 min. Effects are expressed as fluorescence arbitrary units/min.

Amplex Red assay Amplex Red is a highly sensitive and chemically stable fluorimetric probe for the extracellular detection of H2O2 (Freitas et al. 2009a). Reaction mixtures contained the following reagents at the indicated final concentrations (in a final volume of 200 lL): neutrophils (final suspension = 1 9 106 cells/mL) resuspended in Tris-G, zinc (0–1,000 lM), HRP (0.25 U/mL), Amplex Red (25 lM). In a set of experiments, the effect of catalase (which catalyzes the reaction 2H2O2 ? 2 H2O ? O2), (500 U/mL),

123

Influence of zinc on the activation of neutrophils by phorbol myristate acetate or formyl-methionylleucyl-phenylanine The influence of zinc on the activation of neutrophils by phorbol myristate acetate (PMA) or formylmethionyl-leucyl-phenylanine (fMLP) was evaluated at the same conditions as above, except that neutrophils (final suspension = 1 9 106 cells/mL or 2 9 106 cells/mL, in case of PMA or fMLP, respectively) were activated by PMA (16 nM) or fMLP (5 lM) at

Biometals (2010) 23:31–41

*

10000

5000

5

25

0

50 10 0 25 0 50 10 0 00 + 10 10 DP 00 I 00 +D (10 PI µM ) (2 0µ M )

A crucial observation of the present study was that the activation of human neutrophils’ oxidative burst by zinc varies according to the incubation media used to resuspend neutrophils and the methodology used to detect reactive species. When HBSS and PBS were used, no stimulation of neutrophils by zinc

***

12 .

Activation of human neutrophils’ oxidative burst by zinc

***

5

Results

15000

5

Statistics were calculated using GraphPad PrismTM (version 5.0; GraphPad Software). Results are expressed as mean ± standard error of the mean (SEM; from at least five individual experiments, performed in triplicate in each experiment). Statistical comparisons between groups were estimated using the one-way analysis of variance (ANOVA), followed by the Bonferroni’s post-hoc test. In all cases, P values lower than 0.05 were considered as statistically significant.

2.

Statistical analysis

an k

The purpose of this study was to evaluate the contribution of PKC to the zinc stimulatory effect, by using the PKC specific inhibitor 3-[1-[3-(dimethylamino) propyl]-5-methoxy-1H-indol-3-yl]-4-(1H-indol-3-yl)1H-pyrrole-2,5-dione (Go¨6983). Neutrophils (final suspension = 1 9 106 cells/mL) were pre-incubated with two concentrations of Go¨6983 (250 and 500 nM), for 5 min, at 37"C, before stimulation by zinc. After incubation, the following reagents were added at the indicated final concentrations (in a final volume of 200 lL): luminol (500 lM) and zinc (1,000 lM). The reaction mixture was subjected to soft shaking and the temperature of incubation was maintained at 37"C during the course of the assays. Kinetic readings were initiated immediately after cell stimulation. Measurements were taken at the peak of the curve. Effects are expressed as chemiluminescence arbitrary units/min.

Bl

Evaluation of PKC contribution to the activation of human neutrophils by zinc

(0–1,000 lM) was detected by any of the methodologies tested (graphical data not shown). However, when Tris-G was used as incubation medium, a significant activation was observed with the different probes used. It was demonstrated that the concentrations of the metal that originate the oxidative burst signal are highly dependent on the technique used. The chemiluminescence technique revealed that neutrophils were activated at concentrations of zinc from 250 to 1,000 lM (Fig. 1). Under these experimental conditions, the NADPH oxidase inhibitor DPI (10 or 20 lM, 5 min before zinc) completely prevented the oxidative burst induced by zinc at the 1,000 lM concentration. The use of cytochrome c to measure neutrophils’ oxidative burst showed that the stimulation of neutrophils by zinc occurs at lower concentrations, 5 to 12.5 lM. Also in this study, DPI (10 lM) decreased the signal close to the blank assay. In turn, higher concentrations of zinc ([100 lM) reduced the oxidative burst mediated signal (Fig. 2). Figure 3 shows that 5–12.5 lM of zinc tendentially increases the amount of H2O2 produced by neutrophils. The signal provided by 5 lM of zinc was inhibited by catalase (500 U/mL) showing that Amplex Red is detecting H2O2. In contrast, higher zinc concentrations (from 500 to 1,000 lM) decrease the H2O2-mediated fluorescence signal. Figure 4

Arbitrary chemiluminescent units/min

37"C, just before the addition of zinc (0–1,000 lM). Luminol (500 lM) was used as probe.

35

[Zn2+] µM

Fig. 1 The effect of zinc on human neutrophils’ oxidative burst, measured by luminol and the effect of the NADPH oxidase inhibitor DPI (10 and 20 lM). * P \ 0.05, *** P \ 0.001 compared to blank assay. Values are given as mean ± SEM (n C 6)

123

Biometals (2010) 23:31–41

BA

H

10 00 (5 00 µM )

50 0

25 0

[Zn2+] µM 10

00

+A

[Zn2+] µM

10 00

50 0

25 0

10 0

50

25

5

12 .5

2. 5

Bl an k

0

0 50

*** ***

10 0

***

50000

25

**

*

100000

5

2

***

150000

12 .5

4

200000

2. 5

**

Bl an k

Absorbance arbitrary units/min

6

Fluorescence arbitrary units/min

36

Fig. 4 The effect of zinc on human neutrophils’oxidative burst, measured by APF and the inhibitory effect of ABAH (500 lM) in neutrophils activated by 1,000 lM of zinc. * P \ 0.05, *** P \ 0.001 compared to blank assay. Values are given as mean ± SEM (n C 6)

600000

Influence of zinc on the activation of human neutrophils by PMA or fMLP 400000

200000

00

U

/m

10

L)

00

0

0

0

50

25

10

50

.5

5

5

25

12

Bl

an

k

0

2.

Fluorescence arbitrary units/min

Fig. 2 The effect of zinc on human neutrophils’ oxidative burst, measured by cytochrome c and the effect of the NADPH oxidase inhibitor DPI (10 lM); *** P \ 0.001 and ** P \ 0.01 compared to blank assay. Values are given as mean ±SEM (n C 6)

2+

5+

ca

ta

la

se

(5

[Zn ] µM

Fig. 3 The effect of zinc on the production of H2O2 by human neutrophils, measured by Amplex Red and the inhibitory effect of catalase (500 U/mL). Values are given as mean ± SEM (n C 6)

reveals that zinc, from 500 to 1,000 lM, significantly increased the APF-mediated fluorescence signal. A MPO inhibitor- ABAH, a NOS inhibitor-L-NAME and a specific scavenger of HO.-mannitol were used to distinguish which species is involved on burst induced by zinc. ABAH (5 mM) and mannitol (30 mM) had no effect on neutrophils activated up to 1,000 lM of zinc (graphical data not shown). Only the inhibitor of MPO decreased the signal to values close to the blank assay (without zinc; Fig. 4).

123

Figure 5 shows the results obtained from the study of the effect of zinc on the activation of human neutrophils by PMA (16 nM) or fMLP (5 lM). This study was performed using Tris-G as incubation media and the technique used to measure the oxidative burst was luminol amplified chemiluminescence. Figure 5a shows that zinc had no effect on neutrophils stimulated by PMA. In contrast, Fig. 5b reveals that zinc tendentially augments the signal provided by the activator fMLP. As a representative example, neutrophils stimulated by fMLP originated 10,551 ± 2,076 arbitrary chemiluminescence units while fMLP ? 500 lM of zinc increased the signal to 22,108 ± 2,469 (mean ± SEM). Contribution of PKC to the activation of human neutrophils by zinc The results obtained from the study of the contribution of PKC to the activation of human neutrophils by zinc shows that the PKC specific inhibitor Go¨6983 inhibited the response of neutrophils to zinc in a concentration-dependent manner. At 500 nM, Go¨6983 provided a complete inhibition of zinc-induced luminol oxidation (Fig. 6).

6

A

2

0

5 3

62

98

3

o6

98

G

+G o6

*

12

5 nc (

n

zi

nc zi

20000

0

The results obtained in the present study clearly demonstrate that zinc activates human neutrophils’ oxidative burst in vitro. Previous studies provided contradictory results about the effect of zinc on NADPH oxidase activation and consequently on production of reactive species, with some authors indicating that zinc induces neutrophils’ oxidative burst (Benoni et al. 1998; Lindahl et al. 1998; Takeyama et al. 1995) while in turn, others argued that zinc inhibits O2•- production (DeCoursey et al. 2003; Henderson et al. 1988).

nM 25

0

12 5

98 3 o6 nc +G

zi

nc

+G

o6 98 3

nc (1 0 zi

Discussion

nM

)

fM

5000

µM

an Bl

LP fM

LP fM

Fig. 5 The effect of zinc on neutrophils’ oxidative burst, stimulated by PMA (16 nM) (a) or fLMP (5 lM) (b), measured by luminol and using Tris-G as incubation media. * P \ 0.05 compared to blank assay. Values are given as mean ± SEM (n C 6)

10000

00

+Z ( n 2+ 5 µ M LP (2 fM .5 ) + LP Zn 2 µM + +Z ) fM n 2+ (5 µ LP (1 M) 2 + fM Zn 2 .5 µ + M LP fM +Z (25 ) LP n 2+ µM ) + fM Zn 2 (50 + µM LP ( 1 fM +Zn 2 00 ) µM + LP ( + ) fM Z 25 LP n 2+ 0 µ M +Z (5 n 2+ 00 ) (1 µM 00 ) 0 µM )

0

***

nk

5000

B

Bl a

10000

Arbitrary chemiluminescent units/min

15000 15000

zi

*

zi

25000

nM

nM

an

B

Bl

30000

µM

k

Bl P an PM MA k A + Z (1 6 n PM n 2+ M ) (2 PM A+Z .5 µ M n 2+ A +Z (5 ) PM n 2+ µM (1 ) A 2. + 5 PM Zn 2+ µM ) (2 A PM +Zn 2 5 µ M + A ) (5 + PM Zn 2+ 0 µ M A (1 ) + 0 P M Z n 2+ 0 µ M (2 A ) PM +Zn 2 50 µ + M A ) +Z (50 n 2+ 0 µ M (1 ) 00 0 µM )

0

*** 4

c+

10000

***

.5

20000

A

)

30000

Absorbance arbitrary units/min

40000

37

k

Arbitrary chemiluminescent units/min

Arbitrary chemiluminescent units/min

Biometals (2010) 23:31–41

Fig. 6 The inhibitory effect of Go¨6983 on human neutrophils’oxidative burst: a Induced by zinc (1,000 lM) and using luminol as detection method; b Induced by zinc (5 lM) and using cytochrome c as detection method. *** P \ 0.001 compared to the blank assay. Values are given as mean ± SEM (n C 6)

It was shown that the ability of zinc to activate human neutrophils in vitro depends on the presence or absence of phosphate in the buffer used in the assay system. Indeed, when phosphate was used in the incubation media (PBS and HBSS), zinc was not

123

38

able to induce neutrophils’ oxidative burst at any of the concentrations tested (0–1,000 lM). The detection of zinc-induced oxidative burst was only possible when neutrophils were tested in Tris-G, since this incubation media is phosphate-free. When different concentrations of phosphates were added to Tris-G, the activation of neutrophils by zinc decreased in a phosphate-concentration dependent manner (graphical data not shown). Collier (1979) quantified free Zn2? concentration in different buffers. The absorbance change at 620 nm is linear with Zn2? concentration. Phosphate buffers had an Abs = 0.072 and Tris buffer an Abs = 0.585 revealing that despite of Tris-binding some of free Zn2?, phosphate buffers had a much stronger binding effect on zinc when compared with Tris, reducing its effective concentrations. This interference could be somehow foreseen, though it is often ignored by those studying the biological effects of metals. More recently, it was clearly demonstrated that phosphate buffers deeply interfere with the biological activity of several other metals in vitro (Frasco et al. 2005). Using Tris-G for testing neutrophils, zinc concentrations as low as 5 lM were shown to stimulate neutrophils’ oxidative burst. Human plasma free levels of free zinc have been reported to lie around 12–16 lM, for a total body content of zinc around 2– 4 g (Rink and Gabriel 2001). Though most of plasma free zinc will be complexed by plasma phosphates, it may reach sufficient concentrations to stimulate neutrophils in case of hypophosphatemia, which is characteristic of certain subgroups of patients, such as those who are hospitalized (2.2–3.1%) or admitted to intensive care units (28.85–33.9%), and those with sepsis (65–80%), chronic alcoholism (2.5–30.4%), major trauma (75%), and chronic obstructive pulmonary disease (21.5%; Brunelli and Goldfarb 2007). In addition, plasma levels of free zinc may increase significantly in specific groups of risk, as it happens with industrial workers from petroleum refineries and diesel distribution, smelters, and chemical plants (Dawson et al. 2000; Muzyka et al. 2002). The use of different detecting probes to measure zinc-activated oxidative burst also provided different results, which proved to be complementary and determinant for a better understanding of its mechanism of action. The results obtained in the luminol amplified chemiluminescence assay revealed that zinc stimulates neutrophils’ oxidative burst from 100 to

123

Biometals (2010) 23:31–41

1,000 lM (P \ 0.001). Importantly, the NADPH oxidase inhibitor DPI completely prevented the zinc-activated oxidative burst, indicating the essential role of this enzyme in the observed formation of reactive species. Since the studied reactive species are formed downstream of NADPH oxidase activation, and contribute to luminol chemiluminescence, these results, together with those obtained in the cytochrome c assay system, at lower concentrations, allows the conclusion that zinc activates human neutrophils’ oxidative burst in vitro. Zinc had no effect on neutrophils previously stimulated with PMA, which suggests common activating mechanisms. In contrast, when fMLP was used, zinc tendentially increases the signal, suggesting different activating mechanisms. By using cytochrome c, the colorimetric signal increased when neutrophils were challenged with zinc at 2.5–12.5 lM. In contrast, zinc, from 100 to 1,000 lM, decreased the colorimetric signal in the assay system. Interestingly, these results are negatively correlated to those obtained for luminol amplified chemiluminescence, but are in agreement with those obtained by Hasegawa et al. (2000) (Hasegawa et al. 2000), who studied the effects of zinc on lucigenin and luminol-dependent chemiluminescence of human neutrophils stimulated by PMA. These authors reported that zinc, at the concentrations window of 10–1,000 lM, lead to a decrease of the lucigenin-dependent chemiluminescence response, while that of luminol-dependent chemiluminescence increased. That divergent response between cytochrome c and luminol could be explained by with the wider capacity of luminol to detect the different reactive species formed, independently to the interconversion among them. The decrease of the cytochrome c-mediated colorimetric signal when zinc concentrations are increased, could reflect a zincdependent faster conversion of O2•- into the other related reactive species. This radical is quickly converted to H2O2 and O2, either spontaneously or by the enzyme SOD. Considering that, under the present experimental conditions, SOD is not present in the phagosome, this catalysis is probably not enzyme-related. The discrepancy of responses among luminol and cytochrome c emphasizes the importance of the use of different methodologies to detect oxidative burst, in order to avoid erroneous conclusions. Indeed, if only cytochrome c was used the results would indicate, like in other reports

Biometals (2010) 23:31–41

(DeCoursey et al. 2003), that zinc decreases O2•production in human neutrophils. The enzymatic complex NADPH oxidase is considered electrogenic because, when activated, transfers electrons from intracellular NADPH to molecular oxygen, producing O2•- in the extracellular or intraphagosomal space (Cross and Segal 2004). This charge movement must be compensated to prevent an extreme depolarization that would directly inactivate NADPH oxidase. It is generally assumed that a proton efflux compensates the charge movement induced by electron translocation (DeCoursey et al. 2003; Henderson et al. 1988). However, Ahluwalia et al. (Ahluwalia et al. 2004) have reported that the foremost ionic conductance in PMA-stimulated human neutrophils and eosinophils is a K? conductance through large-condutance Ca2? activated K? (BK) channels. Neverthless, Femling et al. (2006) and Essin et al. (2007) have recently found no evidence that BK channel inhibition affected O2•production by stimulated neutrophils or compromised their killing function. The assumption that the charge induced by electron translocation, through the NADPH oxidase, is largely compensated by proton fluxes is supported by the fact that both zinc and cadmium, known as proton blockers, were also referred to inhibit O2•- production (Cross and Segal 2004). However, the concentrations of zinc needed to inhibit O2•- production were higher than those required to block proton channels, raising the possibility that these metal directly inhibits NADPH oxidase or affect other processes (DeCoursey et al. 2003). The results obtained in the present study with luminol and the complete inhibition of oxidative burst by DPI (NADPH oxidase inhibitor) of neutrophils activated by 1,000 lM of zinc, allows the conclusion that zinc (up to 1,000 lM) does not inhibit NADPH oxidase. Results depicted in Figs. 1 and 2 clearly show that the concentrations of zinc that decrease the signal of cytochrome c originated an increased of the chemiluminescence signal, indicating that higher concentrations of zinc can accelerate the dismutation of O2•-. Ahluwalia et al. (2004) studied the interference of zinc in the xanthinexanthine oxidase system and revealed that 3 mM of zinc induced the dismutation of O2•- into H2O2 and O2. Once again, Femling et al. (2006) disagree with that hypothesis. The later authors assessed H2O2 production, and observed a progressive and profound

39

reduction of H2O2 production. At 1,000 lM, zinc inhibited H2O2 release by *90%. Thus, these authors concluded that the inhibition of H2O2 release by zinc was due to reduction of NADPH oxidase activity via inhibition of the proton current. We also performed a study to measure H2O2 in zinc-stimulated neutrophils. Our results corroborate those obtained by Femling et al. (2006) since higher concentrations of zinc, from 50 to 1,000 lM, decreased the signal. In contrast, the fluorescence signal tends to be higher with zinc concentrations from 2.5 to 25 lM. However, our conclusions differ from those of Femling et al. (2006), since it seems that higher concentrations of zinc promote the conversion of O2•- into other reactive species beyond H2O2. According to Irato and Albergoni (2005) a greater availability of zinc leads to decrease in the catalase activity. We speculate that this inhibition of catalase augmented H2O2 levels, which then may be rapidly transformed in other reactive species. As such, we performed a study with APF, a fluorescent probe that reacts with HO!, HOCl and ONOO-. To distinguish which species are involved on the measured oxidative burst, we used a MPO inhibitor- ABAH, a NOS inhibitor-L-NAME and a specific scavenger of HO!-mannitol. Only the inhibitor of MPO decreased the signal down to the blank assay (without added zinc), indicating that zinc promotes the dismutation of O2•- to O2 and H2O2, which in turn is used by MPO to generate HOCl. These results are in agreement with Hasegawa et al. (2000) who studied the effect of zinc on human neutrophils stimulated by PMA using luminol and an inhibitor of MPO. The authors observed that the MPO inhibitor prevented PMA-induced luminol amplified chemiluminescence response in a zinc concentrationdependent manner, suggesting that HOCl is involved in the process. Also, Takeyama et al. (1995) reported that the addition of zinc, at 1,000 lM, increased the intracellular MPO activity. Protein kinase C (PKC) can be considered a major mediator in the activation of the NADPH oxidase (Dekker et al. 2000). This enzyme constitutes the primary source of oxidizing agents used by neutrophils to kill invading microorganisms (Freitas et al. 2009a). Neutrophils express only five different PKC isotypes: a, bI, bII, d, and f, which are inhibited by Go¨6983 (Remijsen et al. 2006). PKC contain zinc finger structures that are important for its enzymatic activity (Beyersmann and Haase 2001). For that

123

40

reason, zinc could have regulatory effects on PKC activity. According to Csermely et al. (1988), zinc activates PKC in T-lymphocytes and causes a translocation to the plasma membrane, a central event in the activation of PKC. Zinc-induced NADPH oxidase activation has already been described (Benoni et al. 1998; Kauppinen et al. 2008; Noh and Koh 2000; Suh et al. 2008; Takeyama et al. 1995). Inclusively, Noh and Koh (2000) reported that zinc induces and activates NADPH oxidase in cortical neurons and astrocytes in a PKC-dependent manner. Our results are in agreement with those obtained by Noh and Koh (2000) since the PKC specific inhibitor Go¨6983 decreased the response of neutrophils to zinc in a concentration dependent manner. This finding indicates that zinc induces oxidative burst in neutrophils via activation of PKC, precluding a significant contribution of other cellular pathways for ROS generation mediated by this metal. In conclusion, in the present study we demonstrated that zinc activates human neutrophils’ oxidative burst in vitro, and that the use of phosphates to buffer the incubation media precludes this effect, probably due to the formation of phosphate–zinc complexes. Thus, the use of a phosphate-free incubation media is recommended for evaluating the influence of metals on neutrophils’ oxidative burst. In addition, the use of different methods to detect reactive species is essential to avoid erroneous conclusions, as demonstrated in the present study. It was clearly demonstrated that lower concentrations of zinc (5–12.5 lM) activate NADPH oxidase, mainly via PKC, leading to the formation of O2•-. Higher concentrations of zinc results on a rapid dismutation of O2•- to O2 and H2O2, which in turn is used by MPO to generate HOCl. Acknowledgments Marisa Freitas acknowledges Fundac¸a˜o para a Cieˆncia e Tecnologia (FCT) and Fundo Social Europeu (FSE) her PhD grant (SFRH/BD/28502/2006).

References Ahluwalia J, Tinker A, Clapp LH, Duchen MR, Abramov AY, Pope S, Nobles M, Segal AW (2004) The large-conductance Ca2?-activated K? channel is essential for innate immunity. Nature 427:853–858 Babior BM (1999) NADPH oxidase: an update. Blood 93:1464–1476

123

Biometals (2010) 23:31–41 Benoni G, Cuzzolin L, Marrella M, Crivellente F, Adami A, Bertaso C, Velo G, Milanino R (1998) Neutrophil behavior following exposure to in vivo or in vitro zinc in normal and acutely-inflamed rats: studies on lysozyme secretion, superoxide anion release and platelet adhesion. Inflammation 22:175–189 Beyersmann D, Haase H (2001) Functions of zinc in signalling, proliferation and differentiation of mammalian cells. Biometals 14:331–341 Brunelli SM, Goldfarb S (2007) Hypophosphatemia: clinical consequences and management. J Am Soc Nephrol 18: 1999–2003 Collier HB (1979) Binding of Zn2? by buffers. Clin Chem 25:495–496 Costa D, Gomes A, Lima JL, Fernandes E (2008) Singlet oxygen scavenging activity of non-steroidal anti-inflammatory drugs. Redox Rep 13:153–160 Cross AR, Segal AW (2004) The NADPH oxidase of professional phagocytes–prototype of the NOX electron transport chain systems. Biochem Biophys Acta 1657:1–22 Csermely P, Szamel M, Resch K, Somogyi J (1988) Zinc can increase the activity of protein kinase C and contributes to its binding to plasma membranes in T lymphocytes. J Biol Chem 263:6487–6490 Dawson EB, Evans DR, Harris WA, Powell LC (2000) Seminal plasma trace metal levels in industrial workers. Biol Trace Elem Res 74:97–105 DeCoursey TE, Morgan D, Cherny VV (2003) The voltage dependence of NADPH oxidase reveals why phagocytes need proton channels. Nature 422:531–534 Dekker LV, Leitges M, Altschuler G, Mistry N, McDermott A, Roes J, Segal AW (2000) Protein kinase C-beta contributes to NADPH oxidase activation in neutrophils. Biochem J 347:285–289 Denicola A, Radi R (2005) Peroxynitrite and drug-dependent toxicity. Toxicology 208:273–288 Essin K, Salanova B, Kettritz R, Sausbier M, Luft FC, Kraus D, Bohn E, Autenrieth IB, Peschel A, Ruth P, Gollasch M (2007) Large-conductance calcium-activated potassium channel activity is absent in human and mouse neutrophils and is not required for innate immunity. Am J Physiol Cell Physiol 293:C45–C54 Femling JK, Cherny VV, Morgan D, Rada B, Davis AP, Czirjak G, Enyedi P, England SK, Moreland JG, Ligeti E, Nauseef WM, DeCoursey TE (2006) The antibacterial activity of human neutrophils and eosinophils requires proton channels but not BK channels. J Gen Physiol 127: 659–672 Fosmire GJ (1990) Zinc toxicity. Am J Clin Nutr 51:225–227 Frasco MF, Fournier D, Carvalho F, Guilhermino L (2005) Do metals inhibit acetylcholinesterase (AChE)? Implementation of assay conditions for the use of AChE activity as a biomarker of metal toxicity. Biomarkers 10:360–375 Freitas M, Porto G, Lima JL, Fernandes E (2008) Isolation and activation of human neutrophils in vitro. The importance of the anticoagulant used during blood collection. Clin Biochem 41:570–575 Freitas M, Lima JL, Fernandes E (2009a) Optical probes for detection and quantification of neutrophils’ oxidative burst. A review. Anal Chim Acta 649:8–23

Biometals (2010) 23:31–41 Freitas M, Porto G, Lima JL, Fernandes E (2009b) Optimization of experimental settings for the analysis of human neutrophils oxidative burst in vitro. Talanta 78:1476–1483 Hampton MB, Kettle AJ, Winterbourn CC (1998) Inside the neutrophil phagosome: oxidants, myeloperoxidase, and bacterial killing. Blood 92:3007–3017 Hasegawa H, Suzuki K, Nakaji S, Sugawara K (2000) Effects of zinc on the reactive oxygen species generating capacity of human neutrophils and on the serum opsonic activity in vitro. Luminescence 15:321–327 Henderson LM, Chappell JB, Jones OT (1988) Superoxide generation by the electrogenic NADPH oxidase of human neutrophils is limited by the movement of a compensating charge. Biochem J 255:285–290 Irato P, Albergoni V (2005) Interaction between copper and zinc in metal accumulation in rats with particular reference to the synthesis of induced-metallothionein. Chem Biol Interact 155:155–164 Kauppinen TM, Higashi Y, Suh SW, Escartin C, Nagasawa K, Swanson RA (2008) Zinc triggers microglial activation. J Neurosci 28:5827–5835 Lindahl M, Leanderson P, Tagesson C (1998) Novel aspect on metal fume fever: zinc stimulates oxygen radical formation in human neutrophils. Hum Exp Toxicol 17:105–110 Maret W, Sandstead HH (2006) Zinc requirements and the risks and benefits of zinc supplementation. J Trace Elem Med Biol 20:3–18 Miyamoto S, Ronsein GE, Prado FM, Uemi M, Correa TC, Toma IN, Bertolucci A, Oliveira MC, Motta FD, Medeiros MH, Mascio PD (2007) Biological hydroperoxides and singlet molecular oxygen generation. IUBMB Life 59:322–331 Mladenka P, Simunek T, Hubl M, Hrdina R (2006) The role of reactive oxygen and nitrogen species in cellular iron metabolism. Free Rad Res 40:263–272

41 Muzyka V, Bogovski S, Viitak A, Veidebaum T (2002) Alterations of heme metabolism in lymphocytes and metal content in blood plasma as markers of diesel fuels effects on human organism. Sci Total Environ 286: 73–81 Noh KM, Koh JY (2000) Induction and activation by zinc of NADPH oxidase in cultured cortical neurons and astrocytes. J Neurosci 20:RC111 Parkin G (2004) Synthetic analogues relevant to the structure and function of zinc enzymes. Chem Rev 104:699–767 Remijsen QF, Fontayne A, Verdonck F, Clynen E, Schoofs L, Willems J (2006) The antimicrobial peptide parabutoporin competes with p47(phox) as a PKC-substrate and inhibits NADPH oxidase in human neutrophils. FEBS Lett 580:6206–6210 Rink L, Gabriel P (2001) Extracellular and immunological actions of zinc. Biometals 14:367–383 Stefanidou M, Maravelias C, Dona A, Spiliopoulou C (2006) Zinc: a multipurpose trace element. Arch Toxicol 80: 1–9 Suh SW, Hamby AM, Gum ET, Shin BS, Won SJ, Sheline CT, Chan PH, Swanson RA (2008) Sequential release of nitric oxide, zinc, and superoxide in hypoglycemic neuronal death. J Cereb Blood Flow Metab 28:1697–1706 Takeyama Y, Ogino K, Segawa H, Kobayashi H, Uda T, Houbara T (1995) Effects of zinc on production of active oxygen species by rat neutrophils. Pharmacol Toxicol 76:50–55 Witko-Sarsat V, Rieu P, Descamps-Latscha B, Lesavre P, Halbwachs-Mecarelli L (2000) Neutrophils: molecules, functions and pathophysiological aspects. Lab Invest 80:617–653 Zhang XG (1996) Corrosion and electrochemistry of zinc. Plenum Press, New York

123

Biometals (2010) 23:43–49 DOI 10.1007/s10534-009-9265-9

Advanced glycation end products and antioxidant status in nondiabetic and streptozotocin induced diabetic rats: effects of copper treatment S. Civelek Æ R. Gelis¸ gen Æ G. Andican Æ A. Seven Æ ¨ zdog˘an Æ G. Burc¸ak S. H. Ku¨c¸u¨k Æ M. O

Received: 29 January 2008 / Accepted: 28 August 2009 / Published online: 19 September 2009 ! Springer Science+Business Media, LLC. 2009

Abstract The effects of Cu(II) supplementation on glycemic parameters, advanced glycation end products (AGEs), antioxidant status (glutathione; GSH and total antioxidant capacity; TAOC) and lipid peroxidative damage (thiobarbituric acid-reactive substances, TBARS) were investigated in streptozotocin (STZ) induced diabetic rats. The study was carried out on Wistar albino rats grouped as control (n = 10), CuCl2 treated (n = 9), STZ (n = 10) and STZ,CuCl2 treated (n = 9). STZ was administered intraperitoneally at a single dose of 65 mg/kg and CuCl2, 4 mg copper/kg, subcutaneously, every 2 days for 60 days. At the end of this period, glucose(mg/dl), Cu(lg/dl), TBARS(lmol/l), TAOC(mmol/l) were measured in plasma, GSH(mg/gHb) in erythrocytes and glycated hemoglobin (GHb)(%) in blood. Plasma AGE-peptides(%) were measured by HPLC flow system with spectrofluorimetric and spectrophotometric detectors connected on-line. Data were analyzed by the nonparametric Kruskal–Wallis and Mann–Whitney U test. In the STZ group glucose, GHb and AGE-peptide levels were all significantly higher than the control

group (P \ 0.01, P \ 0.05, and P \ 0.01, respectively). CuCl2 treated group had significantly lower glucose but significantly higher GHb, TAOC and TBARS levels than the control group (P \ 0.05, P \ 0.001, P \ 0.05 and P \ 0.001, respectively). STZ,CuCl2 treated group had significantly higher GHb, TAOC and TBARS levels compared with the control group (P \ 0.001, P \ 0.05 and P \ 0.05, respectively); but only TAOC level was significantly higher than the STZ group (P \ 0.01). This experimental study provides evidence that copper intake increases total antioxidant capacity in both nondiabetic and diabetic states. However despite the potentiated antioxidant defence, lipid peroxidation and glycation enhancing effects of CuCl2 are evident under nondiabetic conditions. Keywords STZ ! Diabetes mellitus ! Advanced glycation end products ! Glycation ! Copper Introduction

S. Civelek ! R. Gelis¸ gen ! G. Andican ! ¨ zdog˘an ! G. Burc¸ak A. Seven ! S. H. Ku¨c¸u¨k ! M. O Department of Biochemistry, Cerrahpas¸ a Medical _ Faculty, Istanbul University, Istanbul, Turkey S. Civelek (&) Fevzipas¸ a Caddesi, Emirbuhari Sokak, No: 15 Daire: 6 Fatih, Istanbul, Turkey e-mail: [email protected]

Increased oxidative stress promotes protein glycation (Selvaraj et al. 2002). As free Cu ions are highly redox active and thus might contribute to oxidative tissue damage, in vivo availability of catalytic Cu is usually restricted to a great extent (Cooper et al. 2005). However, glycation due to chronic hyperglycemia has been reported to damage the Cu-binding properties of

123

44

ceruloplasmin and albumin, the main Cu-binding proteins in plasma (Linder 1991; Islam et al. 1995; Argirova and Ortwerth 2003). On one hand, glycation lowers the capacity of these proteins to bind metal ions in strong complexes (Argirova and Ortwerth 2003). On the other hand, the redox active glycochelates are sites for reactive oxygen species (ROS) production (Eaton and Qian 2002). Thus, for restriction of glycoxidation related pathologies in diabetes mellitus, chelation of Cu-ions by clinically acceptable compounds is suggested (Cooper et al. 2005). However, it is also known that copper sulfate treatment started prior to streptozotocin (STZ) injection is beneficial in diabetic mice. It causes preservation of b-cell function (Sitasawad et al. 2001). As yet, it is not known whether Cu intake in the diabetic condition is beneficial or not. This study aims to investigate and compare the effects of Cu treatment on glycemic parameters, advanced glycation end products (AGEs), antioxidant status parameters namely glutathione (GSH) and total antioxidant capacity (TAOC) and lipid peroxidative damage marker, thiobarbituric acid-reactive substances (TBARS) in STZ induced diabetic rats with respect to nondiabetic controls.

Biometals (2010) 23:43–49

confirmed by the presence of hyperglycemia and glycosuria. Diabetic rats manifested polyphagia and glycosuria throughout the experimentation period. Three days after STZ injection, the rats, in groups CuCl2 treated and STZ,CuCl2 treated, started receiving copper subcutaneously at a dose of 4 mg/kg body weight, on every alternate day for 60 days. Copper solutions were prepared immediately before use. At the end of this period, the rats were weighed and killed by decapitation under ether anesthesia (50 mg/kg) after an 8 h fast. Heparinized blood samples were obtained by cardiac puncture. A small aliquot was refrigerated for GHb assay on the following day. After centrifugation at 2,5009g for 5 min, plasma glucose and erythrocyte GSH analyses were done immediately. The samples were stored at -80"C until analysis for TBARS, TAOC, AGE-peptides and Cu. Biochemical analysis Assay of glucose and GHb Glucose was determined using GOD-PAP (Randox) and GHb, by boronic affinity chromatography (Sigma) kits. Assay of AGE

Materials and methods Animal treatment and diabetes induction Male, young adult Wistar albino rats (2.5–3 months, n = 38 weighing 180–200 g) were used in this study. The rats cared for in accordance with the Guide for the Care and Use of Laboratory Animals (Committee on Care and Use of Laboratory Animals 1985) received standard chow diet (20–30 g/rat/day) and water ad libitum during the experimental period of 60 days. The following experimental groups were designed: Control group (control, n = 10); Cu treated group (CuCl2, n = 9); STZ administered group (STZ, n = 10) and STZ administered and Cu treated group (STZ,CuCl2, n = 9). Diabetes was induced by intraperitoneal injection of a single dose of streptozotocin (STZ) (65 mg/kg body weight) (Sigma-Aldrich) freshly dissolved in citrate buffer (pH = 4.5) after an overnight fast. Control rats were injected citrate buffer alone. Three days after STZ injection, development of diabetes was

123

Fluorescent AGE-peptides present in plasma were measured by spectrofluorimetry (kex: 247 nm, kem: 440 nm) and the related peptides by spectrophotometry at 280 nm, in a HPLC flow system with spectrofluorimetric and spectrophotometric detectors connected on-line (Wrobel et al. 1997; Forbes et al. 2004). Briefly, 20 ll plasma was added to 480 ll of 0.15 mmol/l trichloroacetic acid and 100 ll chloroform. Samples were shaken vigorously, centrifuged, and 20 ll of the aqueous layer was then injected into the flow system, consisting a Hewlett Packard high pressure pump (Series 1050 high-performance liquid chromatograph), with integrated sample injector (loop 20 ll) and multiple wavelength spectrophotometric detector (Series 1100) and spectrofluorimetric detector (HP 1046A). Chemstation (Series 1100) was used for data processing. Samples were run in triplicate. The assay was calibrated against AGE-peptide obtained from enzymatic hydrolysis of AGE-BSA (10 g/l). Albumin was incubated for 60 days with glucose to prepare AGE-albumin. Albumin was also

Biometals (2010) 23:43–49

incubated in glucose-free medium under similar conditions. AGE-albumin and albumin were hydrolysed by proteinase K to prepare AGE-peptides and peptide calibrators, respectively. The AGE content of the AGE-peptide calibrator was accepted as 100% and by dilution with the peptide calibrator, different concentrations of the calibrator was prepared. Assay of copper Cu in plasma was determined by flameless atomic absorption spectrophotometry (atomic absorption spectrophotometer, model AA-6800; Shimadzu). The standard, diluted plasma sample is delivered onto a pyroltically coated carbon tube. A temperature program was initiated, and the instrument in turn dries, ashes, and then atomizes the sample. The vaporized neutral atoms absorb light from a copper hollow cathode lamp set at 324.7 nm. The absorbance was directly related to the concentration of copper, expressed in micrograms per deciliter in sample Alcock (1987) and Shimatzu Corp (1998). Assay of thiobarbituric acid-reactive substances (TBARS) Lipid peroxidation end product was determined as TBARS according to a modification of the method of Buege and Aust (1978). One volume of plasma was mixed thoroughly with two volumes of a stock solution of 15% w/v trichloroacetic acid, 0.375% w/v thiobarbituric acid, and 0.25 mol/l hydrochloric acid. The mixture was heated for 30 min in a boiling water bath. After cooling, the flocculent precipitate was removed by centrifugation at 1000 g for 10 min. The absorbance of the sample was determined at 535 nm and the TBARS concentration was calculated using the extinction coefficient, 1.56 9 105 M-1 cm-1. Assay of glutathione (GSH) GSH was measured in erythrocyte lysate. Erythrocytes were separated and washed three times in 5 ml of sterile 9 g/l NaCl solution and hemolyzed by diluting four-fold with water. Erythrocyte GSH concentration was determined according to the method of Beutler et al. (1963) using metaphosphoric acid for protein precipitation and 5,50 dithiobis 2-nitrobenzoic acid for color development. GSH concentration was

45

calculated using 1.36 9 104 M-1 cm-1 as the molar absorption coefficient and was expressed as mg/g Hb. Assay of total antioxidant capacity (TAOC) TAOC was measured using a Randox 2332 kit, according to the method of Miller et al. (1993). ABTS (2,20 -azino-di-[3-ethylbenzthiazoline sulphonate]) is incubated with metmyoglobin and H2O2 to produce a radical cation with an absorbance at 734 nm. This absorbance is inversely proportional to the total antioxidant capacity of plasma.

Statistical analysis All results were expressed as a median (range). Data were analyzed by non-parametric Kruskal–Wallis and Mann–Whitney U test. Correlations were analyzed by Pearsons test. The limit of statistical significance was set at P \ 0.05.

Results Biochemical data of the study groups at the end of the experimental period of 60 days and the statistical evaluation are shown in Table 1. CuCl2 and STZ,CuCl2 treated groups displayed significantly higher median serum Cu levels (227 and 222 lg/dl, respectively) when compared with the control group (189.1 lg/dl) (P \ 0.01, P \ 0.01, respectively). Although no significant difference was noted in median Cu levels between STZ,CuCl2 treated (222 lg/dl) and STZ groups (212 lg/dl), a slight tendency to higher levels was apparent in the STZ,CuCl2 treated group. CuCl2 treated group had significantly lower plasma glucose but higher GHb, TAOC and TBARS levels than the control group (147 vs. 169.5 mg/dl, P \ 0.05; 4.95 vs. 3.07%, P \ 0.001; 1.06 vs. 0.76 mmol/l, P \ 0.05 and 9.23 vs. 6.85 lmol/l, P \ 0.001, respectively). STZ administered rats had significantly higher concentrations of both glucose and the early glycation product GHb than the control group (205 vs. 169.5 mg/dl, P \ 0.01; 4.65 vs. 3.07%, P \ 0.001, respectively). These findings reflected the establishment of diabetes mellitus in STZ administered rats. In

123

46

Biometals (2010) 23:43–49

diabetic rats circulatory AGE-peptides were at significantly higher concentration than nondiabetic rats (21.9 vs. 14.1%, P \ 0.01). STZ,CuCl2 group had significantly higher GHb, TAOC and TBARS levels compared with the control group (6.3 vs. 3.07%, P \ 0.001; 1.1 vs. 0.76 mmol/l, P \ 0.05 and 7.8 vs. 6.85 lmol/l, P \ 0.05, respectively). Only plasma TAOC level was found to be significantly higher in the STZ,CuCl2 treated group compared with the STZ group (1.1 vs. 0.87 mmol/l, P \ 0.01). Pearson correlation analysis results are shown in Table 2. In the CuCl2 treated group, glucose was found to be negatively correlated with both GHb and AGEs (r = -0.783, P \ 0.05; r = -0.722, P \ 0.05, respectively); TBARS was observed to be positively correlated with AGEs (r = 0.679, P \ 0.05). In the

STZ group; copper was positively correlated with glucose and negatively with GSH (r = 0.928, P \ 0.05; r = -0.956, P \ 0.05, respectively); TAOC was found to be negatively correlated with AGEs (r = -0.765, P \ 0.05) (Figs. 1, 2). In the STZ,CuCl2 treated group; positive correlations were observed between Cu and TAOC (r = 0.885, P \ 0.05) and between GHb and AGEs (r = 0.914, P \ 0.05) (Figs. 3, 4, respectively), and negative correlations of GSH and with both glucose and TBARS (r = -0.749, P \ 0.05; r = -0.863, P \ 0.05).

Discussion In this experimental study we investigated the effects of CuCl2 intake on glycemic parameters, circulatory

Table 1 Biochemical parameters in the experimental groups median (minimum–maximum) Control Cu (lg/dl) Glucose (mg/dl)

STZ

CuCl2

189.1 (169.3–211.8)

212 (161.9–262.8)

169.5 (147–190)

a

GHb (%) AGE (%)

3.07 (2.12–4.23) 14.1 (11.12–19.21)

TAOC (mmol/l)

0.76 (0.43–1.3)

205 ** (190–276)

147 * (131–186)

a

4.65 * (2.95–11.86) 21.9a** (15.17–24.8) 0.87 (0.58–1.13)

3.15 (2.5–4.41)

2.81 (1.32–3.87)

TBARS (lmol/l)

6.85 (5.67–8.28)

8.13 (5.6–10.8)

Versus control group

b

Versus STZ group

227a** (212.4–269.8) a

GSH (mg/gHb) a

STZ,CuCl2

a

4.95 *** (3.5–6.3) 17.7 (9.17–31.7) 1.06a* (0.79–1.34) 2.13 (1.26–4.44) 9.23a*** (7.5–13.1)

222a** (212.5–274) 195 (128–212) a

6.3 *** (4.7–8.6) 13 (9.64–38.01) 1.1a*,b** (0.99–1.52) 2.56 (1.37–5.75) 7.8a* (6.2–9.6)

* P \ 0.05; ** P \ 0.01; *** P \ 0.001 Table 2 Pearson correlation coefficients in CuCl2 and STZ,CuCl2 treated, STZ groups Groups

Glucose

TBARS

Cu

TAOC

GHb

r = -0.783* r = -0.722*

– r = 0.679*

– –

– –

– –

Cu

r = 0.928*

–

–

–

–

GSH

–

–

r = -0.956*

–

–

AGE

–

–

–

r = -0.765*

–

CuCl2 Ghb AGE STZ

STZ,CuCl2 TAOC

–

–

r = -0.885*

–

–

GSH

r = -0.749*

r = -0.863*

–

–

–

AGE

–

–

–

–

r = 0.914*

* Correlation is significant at the P \ 0.05 level

123

Biometals (2010) 23:43–49

47

AGE-peptides and oxidative stress related parameters in diabetic and nondiabetic states. Previously, the beneficial effect of supplementation with CuSO4 (20 lg/0.2 ml) intraperitoneally on every alternate day for 30 days) was reported in STZ-diabetic mice (Sitasawad et al. 2001). In this study, the rats were supplemented with CuSO4 before multiple-dose STZ treatment (IDDM) and the effects were evaluated at 10 weeks. CuSO4 supplementation prior to diabetes induction kept the levels of lipid peroxidation and blood glucose within the normal range (Sitasawad et al. 2001). However in another study high Cu intake (60 mg/kg of Cu, by gastric tube, twice a week, for 30 days) in diabetic condition has been reported to cause renal toxicity, high urinary glucose output and

reduction in blood glucose levels (Galhardi et al. 2004). In the presented study we started the CuCl2 treatment (4 mg Cu/kg body weight, subcutaneously on every alternate day for 60 days) on the third day of diabetes induction and continued it throughout the experimentation period of 60 days. CuCl2 treated groups displayed significantly higher serum Cu levels when compared with the control group and a slight tendency to higher levels was also apparent in the STZ,CuCl2 treated group when compared with the STZ group. In the STZ group on 60th of STZ injection, in accordance with hyperglycemia, GHb 280 270

280

Cu(µg/dL)

260

Cu(µg/dL)

260 240

250 240

220

230

200

220

180

210 1,0

1,1

1,2

1,3

1,4

1,5

1,6

TAOC(mmol/L)

160 180

200

220

240

260

280

Glucose(mg/dL) Fig. 1 Correlation between plasma copper and glucose in the ‘‘STZ’’ group (correlation coefficient r = 0.928; P = 0.023)

Fig. 3 Correlation between plasma copper and TAOC in the ‘‘STZ ? CuCl2’’ group (correlation coefficient r = 0.885; P = 0.046)

40

25 24

AGE(%)

30

AGE(%)

23 22

20

21 20 10

19

,5

,6

,7

,8

,9

1,0

1,1

1,2

TAOC(mmol/L) Fig. 2 Correlation between plasma TAOC and AGE in the ‘‘STZ’’ group (correlation coefficient r = -0.765; P = 0.045)

4

5

6

7

8

9

GHb(%) Fig. 4 Correlation between blood GHb and plasma AGE in the ‘‘STZ ? CuCl2’’ group (correlation coefficient r = 0.914; P = 0.030)

123

48

and circulatory AGEs were all at significantly higher concentrations compared with the control group. We noted a slight tendency to higher levels of both Cu and TBARS in the STZ group. Further, blood Cu was correlated positively with blood glucose and negatively with erythrocyte glutathione. The former correlation might be consistent with the increased release of Cu ions from the glycated form of Cucontaining enzymes in diabetic rats (Lin 1996) and the latter might reflect the increased GSH consumption by the increased free radical generation in the presence of Cu ions (Yoshida et al. 1995). In the STZ,CuCl2 treated group we observed that plasma glucose was negatively correlated with glutathione, which in turn was negatively correlated with TBARS. As stated above, high Cu intake in diabetic condition has been reported to reduce the blood glucose levels and this was explained by the increased urinary glucose output (Galhardi et al. 2004). The mechanism underlying renal toxicity was explained by oxidative stress and lipid peroxidation (Galhardi et al. 2004). We observed the highest GHb values and a positive correlation between GHb and AGEs in the STZ,CuCl2 treated group. These findings are all consistent with the fact that hyperglycemia increases oxidative stress, lipid peroxidation and protein glycation (Abou-Seif and Youssef 2004). As to the effects of CuCl2 treatment in the nondiabetic state, we observed substantially lower plasma glucose but higher GHb levels in the treated rats, than the untreated. Furthermore within this group we observed that glucose was negatively correlated with both GHb and AGEs. These findings suggest the presence of factors other than glucose contributing to glycation of hemoglobin and the relative importance of this non-glucose contribution in CuCl2 treated nondiabetic rats. We have noted a tendency to lower glucose but higher GHb values but in the STZ,CuCl2 treated group when compared with the STZ group. In a very recently published paper, it had been shown that lipid peroxidation can contribute to glycation of hemoglobin in nondiabetic renal failure patients. It is well established that Cu ions induce lipid peroxidation (Selvaraj et al. 2005). Accordingly we observed that TBARS values were significantly higher in the CuCl2 treated group than the control group. The highest TBARS and the lowest GSH values were recorded in this group. Additionally, TBARS was positively correlated with AGEs. Taken together, these findings

123

Biometals (2010) 23:43–49

are all indicative of adverse effects of CuCl2 in the nondiabetic state. Metal-catalyzed oxidation reactions and glycation are closely related and potentially accelerate each other (Argirova and Ortwerth 2003). On the other hand, we observed that total antioxidant capacity values was significantly higher in CuCl2 treated groups than the untreated. Importantly, among all the parameters measured in this study total antioxidant capacity was the only parameter, displaying significant difference between STZ,CuCl2 treated and STZ groups. The increase in total antioxidant capacity might be due to elevation in CuZnSOD activity. Trace elements such as Cu and Zn have been reported to be important in antioxidant defence (CuZn SOD) in diabetes mellitus (Eizirik et al. 1996; Sitasawad et al. 2001; Hussein et al. 2007). To conclude, this experimental study provides evidence that copper intake increases total antioxidant capacity in both nondiabetic and diabetic states. However despite the potentiated antioxidant defence, lipid peroxidation and glycation enhancing effects of CuCl2 are evident under nondiabetic conditions. Considering these effects, further studies addressing the effects of copper in diabetes are needed. Acknowledgment This work was supported by the Research Fund of Istanbul University, project no: 1180/070998.

References Abou-Seif MA, Youssef AA (2004) Evaluation of some biochemical changes in diabetic patients. Clin Chim Acta 346:161–170 Alcock NW (1987) Copper. In: Pesce AJ, Kaplan LA (eds) Methods in clinical chemistry. Mosby, St Louis, pp 527– 538 Argirova MD, Ortwerth BJ (2003) Activation of protein-bound copper ions during early glycation: study on two proteins. Arch Biochem Biophys 420:176–184 Beutler E, Durgn O, Kelly BM (1963) Improved method for the determination of blood glutathione. J Lab Clin Med 51:882–888 Buege JA, Aust SD (1978) Microsomal lipid peroxidation. Methods Enzymol 52:302–310 Committee on Care and Use of Laboratory Animals (1985) Guide for the care and use of laboratory animals. Institute of Laboratory Animal Resources, National Research Council, Washington Cooper GJ, Chan YK, Dissanayake AM et al (2005) Demonstration of a hyperglycemia-driven pathogenic abnormality of copper homeostasis in diabetes and its reversibility by selective chelation: quantitative comparisons between the biology of copper and eight other nutritionally essential

Biometals (2010) 23:43–49 elements in normal and diabetic individuals. Diabetes 54:1468–1476 Eaton JW, Qian M (2002) Interactions of copper with glycated proteins: possible involvement in the etiology of diabetic neuropathy. Mol Cell Biochem 234–235:135–142 Eizirik DL, Flodstro¨m M, Karlsen AE et al (1996) The harmony of the spheres: inducible nitric oxide synthase and related genes in pancreatic beta cells. Diabetologia 39:875–890 Forbes JM, Yee LT, Thallas V et al (2004) Advanced glycation end product interventions reduce diabetes-accelerated atherosclerosis. Diabetes 53:1813–1823 Galhardi CM, Diniz YS, Faine LA et al (2004) Toxicity of copper intake: lipid profile, oxidative stress and susceptibility to renal dysfunction. Food Chem Toxicol 42:2053–2060 Hussein OA, Gefen Y, Zidan JM et al (2007) LDL oxidation is associated with increased blood hemoglobin A1c levels in diabetic patients. Clin Chim Acta 377:114–118 Islam KN, Takahashi M, Higashiyama S et al (1995) Fragmentation of ceruloplasmin following nonenzymatic glycation reaction. J Biochem 118:1054–1060 Lin J (1996) The association between copper ions and peroxidative reaction in diabetic cataract. Nippon Ganka Gakkai Zasshi 100:672–679 Linder MC (1991) Biochemistry of copper. Plenum, New York Miller NJ, Rice-Evans C, Davies MJ et al (1993) A novel method for measuring antioxidant capacity and its

49 application to monitoring the antioxidant status in premature neonates. Clin Sci 84:407–412 Selvaraj N, Bobby Z, Das AK et al (2002) An evaluation of level of oxidative stress and protein glycation in nondiabetic undialyzed chronic renal failure patients. Clin Chim Acta 324:45–50 Selvaraj N, Bobby Z, Koner BC et al (2005) Reassessing the increased glycation of hemoglobin in nondiabetic chronic renal failure patients: a hypothesis on the role of lipid peroxides. Clin Chim Acta 360:108–113 Shimatzu Corp. (1998) Atomic absorption spectrophotometry cookbook, Sect 1–4. Shimatzu Corp., Kyoto, p 10 Sitasawad S, Deshpande M, Katdare M et al (2001) Beneficial effect of supplementation with copper sulfate on STZdiabetic mice (IDDM). Diabetes Res Clin Pract 52:77–84 Wrobel K, Wrobel K, Garay-Sevilla ME et al (1997) Novel analytical approach to monitoring advanced glycosylation end products in human serum with on-line spectrophotometric and spectrofluorometric detection in a flow system. Clin Chem 43:1563–1569 Yoshida K, Hirokawa J, Tagami S et al (1995) Weakened cellular scavenging activity against oxidative stress in diabetes mellitus: regulation of glutathione synthesis and efflux. Diabetologia 38:201–210

123

Biometals (2010) 23:51–58 DOI 10.1007/s10534-009-9266-8

Zinc transporter expression profiles in the rat prostate following alterations in dietary zinc Yang Song Æ Valerie Elias Æ Carmen P. Wong Æ Angus G. Scrimgeour Æ Emily Ho

Received: 15 June 2009 / Accepted: 2 September 2009 / Published online: 17 September 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Zinc plays important roles in numerous cellular activities and physiological functions. Intracellular zinc levels are strictly maintained by zinc homeostatic mechanisms. Zinc concentrations in the prostate are the highest of all soft tissues and could be important for prostate health. However, the mechanisms by which the prostate maintains high zinc levels are still unclear. In addition, the response of the prostate to alterations in dietary zinc is unknown. The current study explored cellular zinc levels and zinc transporter expression profiles in the lobes of the prostate during dietary marginal zinc depletion. Rats were given either zinc-adequate (ZA, 30 mg Zn/kg) or marginal zinc-deficient (MZD, 5 mg Zn/kg) diet for 9 weeks. In addition, a subgroup of the MZD rats was supplemented with phytase (1,500 unit/kg diet) to improve zinc bioavailability. We found that both zinc concentrations and ZnT2 expression in the prostate Y. Song ! V. Elias ! C. P. Wong ! E. Ho (&) Department of Nutrition and Exercise Sciences, Oregon State University, 103 Milam Hall, Corvallis, OR 97331, USA e-mail: [email protected] A. G. Scrimgeour Military Nutrition Division, US Army Research Institute of Environmental Medicine, Kansas St., Natick, MA 01760, USA E. Ho Linus Pauling Institute, Oregon State University, Corvallis, OR 97331, USA

dorsolateral lobes were substantially higher than in the ventral lobes (P \ 0.05). Marginal zinc depletion significantly decreased ZnT2 expression in the dorsolateral lobes (P \ 0.05), and phytase supplementation had a trend to increase ZnT2 expression. In addition, of all measured zinc transporters, only ZnT2 mRNA abundance was significantly correlated to the zinc concentrations in the dorsolateral lobe. No correlations were found between zinc transporter expression and zinc concentrations in the ventral lobes. These results indicate that ZnT2 may play a significant role in the maintenance of zinc homeostasis in the prostate. Keywords Zinc transporter ! ZnT2 ! Prostate ! Marginal zinc deficiency Introduction Zinc is an essential trace mineral and is ubiquitously distributed in hundreds of proteins in mammalian cells. Since zinc is widely involved in the normal functions of many proteins, zinc is required for a variety of biological activities such as growth and development, immune response, wound healing, neurological function and reproduction. Intracellular zinc levels are strictly controlled by zinc homeostatic mechanisms that maintain stable zinc supply and appropriate zinc distribution in cells. The activities of zinc uptake, efflux and cellular compartmentalization rely on the functions of zinc transporters. Two zinc

123

52

transporter gene families have been identified in mammals: the solute-linked carrier 30A (SLC30A, ZnT) family and the SLC39A (Zip) family of metal ion transporters. The ZnT family of transporters functions in zinc efflux from the cytoplasm to either the extracellular space and/or intracellular organelles. The ZIP family of protein functions in zinc uptake from the extracellular matrix and/or intracellular organelles into the cytoplasm (Lichten and Cousins 2009). These zinc transporters are expressed in a tissue-specific manner, and respond differentially to dietary zinc levels and physiological conditions. Therefore, a loss of function or dysregulation of certain zinc transporters would result in an impairment of zinc homeostasis and predispose the body to zinc-imbalance-related diseases, such as cancer, asthma, diabetes, and Alzheimer’s disease (Devirgiliis et al. 2007). For example, mutations of Zip4 gene have been identified as the cause of human acrodermatitis enteropathica, an autosomal recessively inherited disease (Kury et al. 2002), and polymorphisms in ZnT8 have been associated with type 2 diabetes (Sladek et al. 2007). The maintenance of zinc homeostasis in the prostate may be even more critical than the other organs. The prostate contains the highest zinc concentration of any other soft tissues in the body. The prostate epithelial cells have a characteristic high aerobic glycolytic activity, low respiration (Muntzing et al. 1975; Nyden and Williams-Ashman 1953) and high citrate secretion. Zinc may be required for maintaining these properties by reducing the activity of mitochondrial aconitase and inhibiting the terminal oxidation through the electron transport chain (Costello et al. 1997, 2004). Moreover, as the prostate becomes malignant, prostate zinc concentration decreases by 75–90% (Costello and Franklin 2006). Therefore, it has been proposed that maintaining the high zinc content is essential for prostate health, and loss of ability to accumulate high zinc levels may contribute to the prostate malignancies (Costello et al. 1999; Franklin et al. 2005; Huang et al. 2006; Iguchi et al. 2004; Rishi et al. 2003). However, little is known regarding mechanisms by which the normal prostate maintains high levels of zinc. Therefore, the objectives of the current study were to examine the mechanisms by which the prostate modulates zinc concentrations and profile zinc transporter expression during dietary marginal zinc depletion.

123

Biometals (2010) 23:51–58

In addition, since the prostate lobes differ markedly in zinc concentration, function and embryological origin (Costello and Franklin 1998; Iguchi et al. 2002), we compared the zinc transporter expression between dorsolateral and ventral lobes. Finally, since phytase supplement may improve overall zinc status in rats (McClung et al. 2006; Rimbach and Pallauf 1993), we added phytase to the marginally zincdeficient diet to examine whether phytase supplementation to a low-zinc diet could increase zinc levels and upregulate zinc transporter expression in the prostate. The current study is one of the first to quantitatively evaluate the correlations between zinc transporter expressions and zinc concentration in the prostate with dietary zinc depletion. The results from this study provide insights into the mechanisms by which the prostate regulates cellular zinc levels and provide directions for future studies establishing connections between defects in zinc transporter regulation and the development of prostate diseases.

Materials and methods Animals Male Sprague-Dawley rats (n = 24, 4 weeks old, 125–150 g) from Charles River Laboratories, Inc. (Wilmington, MA), were housed individually in polycarbonate cages and acclimated for 2 weeks to the temperature- and humidity-controlled environment with a 12-h-dark: light cycle. Rats were fed a zinc-adequate (ZA, 30 mg Zn/kg) or marginal zincdeficient (MZD, 5–6 mg Zn/kg) diet for 9 weeks. To further examine the effects of phytase on zinc status and DNA integrity in the prostate, 1,500 phytase units/kg was added to the MZD diets and fed to the rats (MZD ? P). Diets were based on modified AIN93 M diets (Reeves 1997) formulated with egg white and with zinc provided as zinc carbonate (Research Diets Inc). All diet also contained 0.3% phytic acid (Naphytate, Sigma–Aldrich). Deionized water was provided as drinking water. Rats were killed following anesthesia with isoflurane overdose (1–5%; Henry Schein). 24-h dietary intakes and body weights were measured weekly. This study was approved by the Institutional Animal Care and Use Committee (IACUC) at USARIEM and Oregon State University,

Biometals (2010) 23:51–58

and animals were maintained in accordance with IACUC’s guidelines for the care and use of laboratory animals. Tissue and blood collection Blood samples were collected by cardiac puncture into trace element-free vials containing EDTA. Plasma was separated immediately and frozen at -80"C until analysis. For the dissection of rat prostates, the genitourinary complex including the prostate, bladder, seminal vesicles and coagulant glands were removed as a unit. Then the ventral and dorsolateral prostate lobes were detached from the urinary bladder. The urinary bladder and seminal vesicles with coagulation glands were removed. The two ventral lobes were separated from each other and removed from the dorsolateral section. Samples of rat prostate dorsolateral and ventral lobes were immediately either snap frozen at -80"C or stored in RNA stabilization solution (RNAlater, Ambion) until further analysis. Zinc analysis Plasma (n = 16), ventral lobe (n = 12) and dorsolateral lobe (n = 7) zinc concentrations were determined by Inductively Coupled Plasma-Optical Emission Spectroscopy (ICP-OES; Teledyne Leeman Labs) with small modification of a previous described method (Verbanac et al. 1997). Samples were digested in 69–70% OmniTrace nitric acid (VWR) overnight. Following digestion, samples were diluted 10 times with water treated with chelex 100 resin (Bio-Rad Laboratories) and analyzed by ICP-OES against known standards (Bruno et al. 2007). Quantitative real-time PCR analysis (qRT-PCR) The mRNA abundance of zinc transporters in rat prostates (ZnT1-4 and Zip1-4) were measured by qRT-PCR. RNA was extracted from prostates using an RNeasy Mini Kit according to the manufacturer’s instructions (Qiagen). First-strand cDNA was reverse transcribed from the isolated RNA using Superscript First-Strand Synthesis System according to the manufacturer’s instructions (Invitrogen Corporation). Primers and annealing temperatures of each transporter gene are listed in Table 1. Primers were

53

designed by online software Primer3 (v.0.4.0), and the specificity was verified by melting curve and DNA gel. Real time PCR reactions were performed using DyNAmo HS SYBR Green qPCR kit (New England Biolabs). Gene copies were determined using the standard curve which was generated from serial dilutions of purified plasmid DNA that encoded for the gene of interest. Data represent averaged copy number normalized to the 18s housekeeping gene. Western analysis of ZnT2 protein The frozen portions of prostate were placed in the standard immunopreciptation assay lysis buffer, homogenized, centrifuged (15,000 rpm, 5 min, 4"C), and the supernatant was collected for analysis. Protein concentrations were determined using DC Protein Assay (Bio-Rad Laboratories). Proteins (30 lg/lane) were separated by SDS–PAGE on a 4–12% bis–Tris gel (Invitrogen Corporation) and transferred to nitrocellulose membranes (Bio-Rad Laboratories). Equal protein loading were confirmed with b-actin levels. After blocking the membrane, antigens were probed using rabbit anti-ZnT2 (1:1000 dilution with 5% milk in phosphate buffered saline/0.05% Tween 20 (PBST), provided by Dr. Kelleher, Penn State University) Bound antibodies were detected using goat anti-rabbit IgG-HRP (1:30,000 dilution with 5% milk in PBST Santa Cruz Biotechnology), and developed with SuperSignal West Femto chemiluminescent substrate (Pierce, Rockford, IL). Images were acquired using an Alpha Innotech photodocumentation system (Alpha Innotech, Hayward, CA) and analyzed using Image J 1.37v software (NIH, Bethesda, MD). Statistical analysis Statistical analysis was performed with the use of PRISM (version 4.0; GraphPad Software). Significantly differences between means were analyzed by one-way ANOVA followed by Bonferroni post hoc test when appropriate. Pearson correlation coefficients were calculated between zinc transporter expression and zinc concentrations. Logarithm data transformations were taken when uneven variations were detected. Differences were considered statistically significant at P \ 0.05. All data are reported as means ± SEM (standard error of the mean) unless otherwise indicated.

123

54

Biometals (2010) 23:51–58

Table 1 Primers of genes analyzed by qRT-PCR Gene name

Primers

Sequence (50 ? 30 )

Annealing temperature

Amplicon size (bp)

ZnT1

Forward

CACGCTAGTGGCTAACACCA

60

296

Reverse

AGGAAAACACGGGTTCACAC

ZnT2

Forward

TGCTCGTGTACCTGGCTGTA

60

138

Reverse

TCCATGTCCAGACTGATGGA

Forward

GCAGAGTATGCACCACTGGA

60

202

Reverse

CAAGGGCGCAGATAGAGAAG

Forward

CCTTTGGATTTCATCGCCTA

60

144

Reverse

GTTCTCTGCACAGCCTCGTA

Forward

AAGCCTAGTGAGCTGCTTCG

58

148

Reverse

ATGGCCAGGATGAACTCTTG

Zip2

Forward

TTCAGAAATTCGTGGTGCAG

58

140

Reverse

GCGACTCCAAAAGGAAGACA

Zip3

Forward

CGTCTTCCTGGCTACATGCT

58

148

Reverse

TCCACGAACACAGTGAGGAA

Zip4

Forward Reverse

ATGAGCTGCCTCACGAACTT CTGCTAGAGCCACGTAGAGG

58

130

18s

Forward

GGACCAGAGCGAAAGCATTTGC

60

115

Reverse

CGCCAGTCGGCATCGTTTATG

ZnT3 ZnT4 Zip1

Results There was no change in food intake among dietary groups (data not shown, P [ 0.05). At the end of the study, the body weights in the MZD group (312.8 ± 5.3 g) were significantly lower than in the ZA group (368.7 ± 6.8 g, P \ 0.001). Phytase supplementation significantly increased body weights in rats fed the MZD diet (346.2 ± 5.5 g, P \ 0.05). Zinc concentrations in the MZD group decreased 44% in plasma and 68% in the prostate dorsolateral lobes compared to the ZA rats (Table 2, P \ 0.05). In contrast, zinc concentrations in prostate ventral lobes were not affected by marginal zinc depletion,

indicating that prostate dorsolateral lobes were more responsive to marginal zinc depletion. In addition, phytase supplementation significantly increased plasma and dorsolateral lobe zinc concentrations (Table 2, P \ 0.05), indicating that phytase facilitated improved zinc status in the rats fed the MZD diet. Prostate dorsolateral lobes contain higher zinc concentrations than the ventral lobes, which were also observed in the current study. Zinc transporter mRNA expression profiles of the ZA rats were compared between the dorsolateral and ventral lobes. The mRNA levels of ZnT3, Zip2 and Zip4 in both lobes were very low in comparison with the other

Table 2 Zinc concentrations in the plasma and prostates of the rats fed the MZD, MZD ?P or ZA diet MZD Plasma (mg/l)

MZD ? P

ZA

P-value

0.56 ± 0.03a

0.90 ± 0.06b

1.15 ± 0.05c

11.92 ± 0.80a

14.39 ± 0.91a

12.49 ± 0.70a

0.09

a

b

204.17 ± 1.26b

\0.0001

\0.0001

Prostate Ventral lobe (mg/kg) Dorsolateral lobe (mg/kg)

66.06 ± 1.48

169.82 ± 1.58

Values are means ± SEM. Main effects were determined by one-way ANOVA with Bonferroni’s post hoc test. Means without a common letter differ, P \ 0.05

123

Biometals (2010) 23:51–58

55

transporters (Fig. 1). No significant differences in ZnT1, ZnT4, Zip1 and Zip3 mRNA levels were detected between the dorsolateral and ventral lobes. However, ZnT2 gene expression levels were markedly different between the dorsolateral and ventral lobes. The mRNA abundance of ZnT2 in the dorsolateral lobes was about 1,000 times higher than that in the ventral lobes (P \ 0.05), indicating that ZnT2 may play an important role in accumulating very high levels of zinc in rat prostate dorsolateral lobes. Correlations between zinc concentrations and zinc transporter mRNA levels in the dorsolateral lobes of all rats in all dietary groups were analyzed by Pearson analysis. We found that only ZnT2 mRNA levels were significantly correlated to the alterations of zinc concentrations in the dorsolateral lobes (P = 0.034, Table 3). We evaluated the effects of variable dietary zinc intake on ZnT2 expression, and found that marginal zinc depletion significantly decreased ZnT2 mRNA levels specifically in the prostate dorsolateral

0.10 0.08 0.06 0.04 0.02

T1

T2

Zn

T3

Zn

T4

Zn

p1

Zi

p2

p3

Zi

Zi

p4

Zi

Prostate ventral lobe 0.10 0.08 0.06 0.04 0.02

p4 Zi

p3

p2

Zi

Zi

p1 Zi

T4

T3

T2

Zn

Zn

T1

0.00 Zn

Zinc transporter mRNA expression (normalized to 18s)

ZnT1 ZnT2

P-value

0.04

0.81

0.38*

0.034

ZnT3

-0.20

ZnT4

-0.18

0.28 0.32

Zip1

0.24

0.18

Zip2

0.35

0.053

Zip3

-0.12

0.50

Zip4

-0.14

0.45

Sprague–Dawley rats were fed a MZD, MZD ? P or ZA diet for 9 weeks. Zinc concentrations were measured by ICP-OES and ZnT2 mRNA levels were measured by qRT-PCR as described in ‘‘Material and methods’’ Pearson analysis was performed to analyze the correlation between dorsolateral prostate zinc concentrations and zinc transporter mRNA transcript levels, n = 32 * P \ 0.05

0.00

Zn

B

Correlation coefficient

lobes (Fig. 2, P \ 0.05) and phytase supplementation partially restored ZnT2 mRNA levels. However, ZnT2 protein levels in the lysate of prostate dorsolateral lobes were not significantly altered by diet treatments (Fig. 3a, b). No effects on ZnT2 or other zinc transporters were detected in the ventral lobes. Altogether, these results indicate that ZnT2 may play an important role in maintaining dorsolateral lobe zinc homeostasis during dietary zinc depletion.

Prostate dorsolateral lobe

Zn

Zinc transporter mRNA expression (normalized to 18s)

A

Table 3 Correlations between zinc transporter mRNA levels and zinc concentrations in the dorsolateral lobes

Fig. 1 Zinc transporter mRNA abundance profiles in the a prostate dorsolateral and b ventral lobes. Sprague-Dawley rats were fed a ZA diet for 9 weeks. mRNA levels were measured as described in ‘‘Material and methods’’. Results are transcripts copy number normalized to 18s transcripts. Values are means ± SEM (n = 12)

Discussion The regulation of ZnT2 may be particularly important in tissues with high zinc requirements such as the prostate glands. The current study shows that the dorsolateral lobes had higher ZnT2 mRNA levels as well as higher zinc concentrations than the ventral lobes of the prostate. ZnT2 mRNA levels in the dorsolateral lobes were also significantly correlated to dorsolateral zinc concentrations, and ZnT2 decreased with marginal zinc deficiency. These results indicate that ZnT2 may play an essential role in modulating prostate zinc homeostasis. Altogether, the current study gives insights for understanding the mechanisms in place that maintain prostate zinc homeostasis, and helps identify zinc transporters that may play roles in zinc regulation.

123

56

Biometals (2010) 23:51–58 b

ZnT2 mRNA expression (normalized to 18s)

0.10 0.08

a,b

0.06

a

0.04 0.02 0.00 MZD

MZD+P

ZA

ZA

ZA

MZD+P

MZD

MZD+P

MZD

A

NZD

Fig. 2 Effects of dietary marginal zinc depletion on ZnT2 mRNA abundance in the prostate dorsolateral lobes. SpragueDawley rats were fed a MZD, ZA or MZD ? P diet for 9 weeks. mRNA levels were measured as described in ‘‘Material and methods’’. Results are transcripts copy numbers normalized to 18s transcripts. Values are means ± SEM (n = 12). Difference between means is determined by oneway ANOVA followed by Bonferroni’s post hoc test. Means without a common letter differ (P \ 0.05)

ZnT2

~42KD

ZnT2

~35KD

ZnT2 ~42KDa Relative densitometric value

B

ZnT2 ~ 35KDa Relative densitometric value

β-actin

2.5 2.0 1.5 1.0 0.5 0.0 MZD MZD+P ZA

1.5 1.0 0.5 0.0 MZD MZD+P ZA

Fig. 3 Effects of dietary marginal zinc depletion on ZnT2 protein levels in the whole tissue lysate of prostate dorsolateral lobes. Sprague-Dawley rats were fed a MZD, ZA or MZD ? P diet for 9 weeks. a ZnT2 protein levels are shown in 3 representative samples from each dietary group. ZnT2 isoforms with sizes of *42 and *35 kDa are shown in the inserts. b Relative abundance of each protein was determined by densitometry analysis

The prostate contains high levels of zinc compared to many other soft tissues, although the precise function of high cellular zinc in this tissue remains unclear. Zinc may be required for inhibition of terminal oxidation and the activity of mitochondria aconitase in the prostate. (Costello et al. 2004; Ho

123

2004; Muntzing et al. 1975). Therefore, a loss of zinc in the prostate may remove the inhibitory effects of zinc on mitochondrial terminal oxidation, and increase respiration rates and possibly increasing the production of free radicals by the electron transport chain. (Franklin et al. 2005). In our laboratory, we have also postulated an important function of zinc in the prostate may be maintaining DNA integrity by reducing oxidative stress and preserving DNA repair functions (Yan et al. 2008). We found that loss of cellular zinc levels in the prostate epithelial cells resulted in oxidative stress and increased DNA damage. Since high zinc concentrations may be essential for prostate health, a failure to maintain zinc homeostasis may increase the risk of prostate cancer. Dysregulation of zinc transporters including ZnT1, ZnT3, ZnT4, Zip1, Zip2 and Zip3 have been found to be associated with the low intracellular zinc content and tumorgenicity in human prostate cancer tissues or prostate epithelial cancer cell lines (Franklin et al. 2005; Iguchi 2004; Beck et al. 2004). To date, no mutations in ZnT2 have been identified in the prostate, however, ZnT2 mutations have been identified in mammary tissues, a tissue that has similar secretory functions and high zinc requirement (Ryu et al. 2008). These previous studies provide important preliminary evidence for the potential role of specific zinc transporters in prostate cancer progression. The primary function of ZnT2 is to transport zinc from the cytoplasm into vesicles such as endosomes or lysosomes (Jou et al. 2009; Liuzzi et al. 2003). In general, ZnT2 is not ubiquitously expressed among all tissues. Its expression is restricted to tissues with unique zinc requirements such as small intestine, kidney, retina, placenta, pancreas, mammary gland, testis, seminal vesicles, and prostate (Lichten and Cousins 2009). ZnT2 is upregulated in the small intestine during high dietary zinc intake, and during late-stage gestation and early lactation in both maternal and fetal tissues (Liuzzi et al. 2003). In mammary and prostate tissue, hormones such as prolactin also increases ZnT2 expression (Costello et al. 1999; Qian et al. 2009). Zinc transporters such as ZnT5 have alternative isoforms as a result of alternative splicing events in response to zinc and the proteins are differentially localized (Jackson et al. 2007). Recently, using in silico analysis, two distinct isoforms of ZnT2 have been identified, a *42 kDa

Biometals (2010) 23:51–58

protein (NM_032513) and a shorter *35 kDa protein (NM_001004434) that result from alternative splicing of exon 3. Both isoforms appear to function as zinc transporters, but have differing subcellular localization patterns (Lopez and Kelleher 2009). In mammary tissue, the larger 42 kDa isoform localizes to secretory vesicles and predominates in expression level over the 35 kDa isoform that localizes to plasma membrane (Gyorkey et al. 1967). Thus, the long 42 kDa isoform appears to function to transport zinc into the secretory compartment for zinc efflux in a hormone-dependent manner. In the current study, we found that similar to mammary tissue, the larger isoform appears to predominate in the prostate. Thus, it is possible that a decrease in ZnT2 expression with marginal zinc deficiency in the prostate may reduce the amount of zinc transported into endosomes or secretory vesicles. In that case, zinc may be preserved for other cell compartments, such as the mitochondria and nucleus, and may be more available for activities more essential for prostate cell function and survival. Although we detected alterations in RNA expression in the prostate with zinc deficiency, we surprisingly did not see corresponding decreases in protein expression of ZnT2. However, a major limitation of this analysis was that we were restricted to the evaluation of ZnT2 in whole tissue lysates, rather than membrane or subcellular fractions. Given the importance of ZnT2 localization, further studies to examine alterations in specific subcellular fractions or use of in situ immunohistochemistry methods are necessary to confirm changes protein alterations in specific cellular locations are apparent. For example, in the mammary gland, ZnT2 expression remains constant at the basolateral membrane, and only changes at the apical membrane are detectable during lactation (Kelleher and Lonnerdal 2003). Further, it is possible that other alternative splice variants are present in the prostate that have not been identified. In the rat small intestine, ZnT2 has a lower molecular mass protein (*28 kDa) that is localized to the apical membrane. Thus, an important direction of future research would be to identify the ZnT2 localization and function in the prostate. To understand zinc homeostatic mechanisms in the prostate, studies should focus on the redistribution of subcellular zinc levels during zinc depletion and identify cellular compartments which are most resistant to zinc depletion.

57

Although zinc concentrations are high in the whole prostate, zinc is not uniformly distributed among all prostate lobes. The human prostates are composed of the peripheral zone (70%), the central zone (25%) and the transition zone (5%). The peripheral zone contains much higher zinc and citrate concentrations than the other zones, and 80% of prostate malignancies develop in the peripheral zone (Costello and Franklin 1998). Therefore, the differential functional and metabolic properties of prostate epithelial cells in the peripheral zone may determine their high potential for malignant transformation. It has been reported that the dorsolateral lobe of the rat prostate is embryologically homologous to the peripheral zone of the human prostate (Iguchi et al. 2002). The dorsolateral lobe also retains higher levels of zinc compared to the ventral lobe (Iguchi et al. 2002). However, the mechanisms for the uneven distribution of zinc within the prostate are unknown. A previous study done by Iguchi et al. detected higher expression of ZnT2 in the dorsal and lateral lobes of rat prostates than in ventral lobes by using semiquantitative RTPCR. The current study quantitatively assessed that ZnT2 transporter expression was about 1,000 times higher in the dorsolateral lobes than in the ventral lobes where ZnT2 mRNA levels were very low. These findings suggest that ZnT2 may play a role in accumulating high concentration of zinc in prostate dorsolateral lobes and likely important in secretory functions. However, more studies are needed to address the mechanism and significance of this lobespecific expression of ZnT2. In summary, the current study suggests that ZnT2 may play an important role in regulating zinc homeostasis and maintaining high zinc levels in the prostate dorsolateral lobes. The current study also provides evidence and directions for future research to explore the possible interactions among prostate cancer, zinc status, and defects in zinc transporter families. Acknowledgments We thank Dr. Shannon Kelleher for the generous gift of ZnT2 antibodies. We gratefully acknowledge the WM Keck Collaboratory at Oregon State University for their assistance in conducting these studies. This study was funded by Oregon AES (OR00735), and the Environmental Health Science Center at Oregon State University (NIEHS P30 ES00210) and by the US Army MRMC. The opinions or assertions contained herein are the private views of the authors and are not to be construed as official or as reflecting the views of the Army or the Department of Defense.

123

58

References Beck FW, Prasad AS, Butler CE, Sakr WA, Kucuk O, Sarkar FH (2004) Differential expression of hZnT-4 in human prostate tissues. The Prostate 58:374–381 Bruno RS, Song Y, Leonard SW, Mustacich DJ, Taylor AW, Traber MG, Ho E (2007) Dietary zinc restriction in rats alters antioxidant status and increases plasma F2 isoprostanes. J Nutr Biochem 18:509–518 Costello LC, Franklin RB (1998) Novel role of zinc in the regulation of prostate citrate metabolism and its implications in prostate cancer. The Prostate 35:285–296 Costello LC, Franklin RB (2006) The clinical relevance of the metabolism of prostate cancer; zinc and tumor suppression: connecting the dots. Mol Cancer 5:17 Costello LC, Liu Y, Franklin RB, Kennedy MC (1997) Zinc inhibition of mitochondrial aconitase and its importance in citrate metabolism of prostate epithelial cells. J Biol Chem 272:28875–28881 Costello LC, Liu Y, Zou J, Franklin RB (1999) Evidence for a zinc uptake transporter in human prostate cancer cells which is regulated by prolactin and testosterone. J Biol Chem 274:17499–17504 Costello LC, Guan Z, Kukoyi B, Feng P, Franklin RB (2004) Terminal oxidation and the effects of zinc in prostate versus liver mitochondria. Mitochondrion 4:331–338 Devirgiliis C, Zalewski PD, Perozzi G, Murgia C (2007) Zinc fluxes and zinc transporter genes in chronic diseases. Mutat Res 622:84–93 Franklin RB, Feng P, Milon B, Desouki MM, Singh KK, Kajdacsy-Balla A, Bagasra O, Costello LC (2005) hZIP1 zinc uptake transporter down regulation and zinc depletion in prostate cancer. Mol Cancer 4:32 Gyorkey F, Min KW, Huff JA, Gyorkey P (1967) Zinc and magnesium in human prostate gland: normal, hyperplastic, and neoplastic. Cancer Res 27:1348–1353 Ho E (2004) Zinc deficiency, DNA damage and cancer risk. J Nutr Biochem 15:572–578 Huang L, Kirschke CP, Zhang Y (2006) Decreased intracellular zinc in human tumorigenic prostate epithelial cells: a possible role in prostate cancer progression. Cancer Cell Int 6:10 Iguchi K, Usui S, Inoue T, Sugimura Y, Tatematsu M, Hirano K (2002) High-level expression of zinc transporter-2 in the rat lateral and dorsal prostate. J Androl 23:819–824 Iguchi K, Otsuka T, Usui S, Ishii K, Onishi T, Sugimura Y, Hirano K (2004) Zinc and metallothionein levels and expression of zinc transporters in androgen-independent subline of LNCaP cells. J Androl 25:154–161 Jackson KA, Helston RM, McKay JA, O’Neill ED, Mathers JC, Ford D (2007) Splice variants of the human zinc transporter ZnT5 (SLC30A5) are differentially localized and regulated by zinc through transcription and mRNA stability. J Biol Chem 282:10423–10431 Jou MY, Hall AG, Philipps AF, Kelleher SL, Lonnerdal B (2009) Tissue-specific alterations in zinc transporter expression in intestine and liver reflect a threshold for homeostatic compensation during dietary zinc deficiency in weanling rats. J Nutr 139:835–841

123

Biometals (2010) 23:51–58 Kelleher SL, Lonnerdal B (2003) Zn transporter levels and localization change throughout lactation in rat mammary gland and are regulated by Zn in mammary cells. J Nutr 133:3378–3385 Kury S, Dreno B, Bezieau S, Giraudet S, Kharfi M, Kamoun R, Moisan JP (2002) Identification of SLC39A4, a gene involved in acrodermatitis enteropathica. Nat Genet 31:239–240 Lichten LA, Cousins RJ (2009) Mammalian zinc transporters: nutritional and physiologic regulation. Annu Rev Nutr 29:153–176 Liuzzi JP, Bobo JA, Cui L, McMahon RJ, Cousins RJ (2003) Zinc transporters 1, 2 and 4 are differentially expressed and localized in rats during pregnancy and lactation. J Nutr 133:342–351 Lopez V, Kelleher SL (2009) Zinc transporter-2 (ZnT2) variants are localized to distinct subcellular compartments and functionally transport zinc. Biochem J 422:43–52 McClung JP, Stahl CH, Marchitelli LJ, Morales-Martinez N, Mackin KM, Young AJ, Scrimgeour AG (2006) Effects of dietary phytase on body weight gain, body composition and bone strength in growing rats fed a low-zinc diet. J Nutr Biochem 17:190–196 Muntzing J, Varkarakis MJ, Saroff J, Murphy GP (1975) Comparison and significance of respiration and glycolysis of prostatic tissue from various species. J Med Primatol 4:245–251 Nyden SJ, Williams-Ashman HG (1953) Influence of androgens on synthetic reactions in ventral prostate tissue. Am J Physiol 172:588–600 Qian L, Lopez V, Seo YA, Kelleher SL (2009) Prolactin regulates ZnT2 expression through the JAK2/STAT5 signaling pathway in mammary cells. Am J Physiol 297:C369–C377 Reeves PG (1997) Components of the AIN-93 diets as improvements in the AIN-76A diet. J Nutr 127:838S–841S Rimbach G, Pallauf J (1993) Enhancement of zinc utilization from phytate-rich soy protein isolate by microbial phytase. Zeitschrift fur Ernahrungswissenschaft 32:308–315 Rishi I, Baidouri H, Abbasi JA, Bullard-Dillard R, KajdacsyBalla A, Pestaner JP, Skacel M, Tubbs R, Bagasra O (2003) Prostate cancer in African American men is associated with downregulation of zinc transporters. Appl Immunohistochem Mol Morphol 11:253–260 Ryu MS, Lichten LA, Liuzzi JP, Cousins RJ (2008) Zinc transporters ZnT1 (Slc30a1), Zip8 (Slc39a8), and Zip10 (Slc39a10) in mouse red blood cells are differentially regulated during erythroid development and by dietary zinc deficiency. J Nutr 138:2076–2083 Sladek R, Rocheleau G, Rung J, Dina C, Shen L, Serre D, Boutin P, Vincent D, Belisle A, Hadjadj S et al (2007) A genome-wide association study identifies novel risk loci for type 2 diabetes. Nature 445:881–885 Verbanac D, Milin C, Domitrovic R, Giacometti J, Pantovic R, Ciganj Z (1997) Determination of standard zinc values in the intact tissues of mice by ICP spectrometry. Biol Trace Elem Res 57:91–96 Yan M, Song Y, Wong CP, Hardin K, Ho E (2008) Zinc deficiency alters DNA damage response genes in normal human prostate epithelial cells. J Nutr 138:667–673

Biometals (2010) 23:59–70 DOI 10.1007/s10534-009-9269-5

First solid state alkaline-earth complexes of monensic acid A (MonH): crystal structure of [M(Mon)2(H2O)2] (M 5 Mg, Ca), spectral properties and cytotoxicity against aerobic Gram-positive bacteria Ivayla N. Pantcheva Æ Rumyana Zhorova Æ Mariana Mitewa Æ Svetlana Simova Æ Heike Mayer-Figge Æ William S. Sheldrick Received: 7 July 2009 / Accepted: 3 September 2009 / Published online: 21 September 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Alkaline-earth metal complexes of the monoanionic form of the polyether ionophore monensin A were isolated for the first time in solid state and were structurally characterized using various spectroscopic methods (IR, NMR, FAB-MS). The stoichiometric reaction of monensic acid (MonH) with M2? (M = Mg, Ca) in the presence of an organic base leads to the formation of mononuclear complexes of composition [M(Mon)2(H2O)2]. The structures of magnesium (1) and calcium (2) monensin complexes in the solid state were established by single crystal X-ray crystallography. The complexes crystallize as [Mg(Mon)2(H2O)2]!5MeCN (1) and [Ca(Mon)2(H2O)2]!H2O!5MeCN (2) in the monoclinic P21 space group. The alkaline-earth metal ion

is placed in a distorted octahedral environment, defined by two monensin anions acting as bidentate ligands in the equatorial plane of the complex as well as by two water molecules occupying the axial positions of the inner coordination sphere. The bactericidal activity of 1 and 2 was evaluated against aerobic Gram-positive microorganisms applying the double layer agar hole diffusion method. Keywords Monovalent carboxylic ionophore ! Alkaline-earth monensin complexes ! Crystal structure ! IR ! NMR ! FAB-MS ! Bactericidal activity

Introduction I. N. Pantcheva (&) ! R. Zhorova ! M. Mitewa Laboratory on Biocoordination and Bioanalytical Chemistry, Department of Analytical Chemistry, Faculty of Chemistry, Sofia University, 1, J. Bourchier Blvd., 1164 Sofia, Bulgaria e-mail: [email protected] [email protected] S. Simova Institute of Organic Chemistry with Center of Phytochemistry, Bulgarian Academy of Sciences, Acad. G. Bontchev Str., Bl. 9, 1113 Sofia, Bulgaria H. Mayer-Figge ! W. S. Sheldrick Lehrstuhl fu¨r Analytische Chemie, Ruhr-Universita¨t Bochum, 44780 Bochum, Germany

Recently the most powerful drugs in veterinary medicine effective against coccidiosis and infections induced by Gram-positive organisms represent the group of naturally occurring polyether ionophorous antibiotics (Agtarap et al. 1967; Stern 1977; Berg and Hamill 1978; Liu et al. 1978; Chappe 1979; Long and Jeffers 1982; Westley et al. 1983; Augustine et al. 1987; Koinarski and Sherkov 1987; Folz et al. 1988; Augustine et al. 1992; Varga and Sreter 1996; Wang et al. 2006; Kevin et al. 2009). Their main representative—monensin—is well known and its ability of binding monovalent metal ions is extensively studied.

123

60

The neutral ionophore complexes formed are able to penetrate the cell membrane of the microorganisms and parasites and to disturb a series of homeostatic processes after dissociation in the intracellular space causing a death of the corresponding target (Riddell 2002). Due to the high affinity of monensin to complex alkaline metal ions, it is known for a very long time to be a monovalent polyether ionophore (Lutz et al. 1971; Briggs and Hinton 1978; Duax et al. 1980; Garcla-Rosas et al. 1983; Cox et al. 1984; Walba et al. 1986; Pangborn et al. 1987; Rzeszotarska et al. 1994; Wagner-Czauderna et al. 1997; Paz et al. 2003; Huczynski et al. 2007a, b, c, 2008a, b, c, d; Yildirim et al. 2007). From the 1990s up to the present several research groups have drawn attention to the possible complexation of monensin with divalent metal ions (Hebrant et al. 1992; Mimouni et al. 1994; Dassie and Baruzzi 2002; Hamidinia et al. 2002; Huczynski et al. 2006a, b, c, d, 2007a, b, c, 2008a, b, c, d). Although there was only indirect evidence concerning the unusual coordination behaviour of monensin, it was suggested that the complexation chemistry of the ligand (and of other representatives of the monovalent polyether ionophores group) is much broader than we were previously acquainted with (Stiles et al. 1991; Hamidinia et al. 2002, 2004). The hypothesis that monensin possesses previously unknown reactivity prompted our group to start an extensive study on the coordination ability of the ligand towards di- and three-valent metal ions. In our previous publications we demonstrated that monensin could form two types of divalent transition metal complexes depending on the chemical form used in the reactions (Dorkov et al. 2008; Pantcheva et al. 2008, 2009). The compounds obtained possess enhanced antimicrobial activity towards Gram(?)-bacteria that is most likely due to the unusual coordination mode of the ligand. In order to confirm the ability of monensin to bind divalent metal ions, we have now studied its behaviour towards alkaline-earth metals, in particularly magnesium and calcium ions. In the present paper we describe the structure elucidation of Mg2? and Ca2? complexes of the monoanionic form of monensic acid (MonH, Scheme 1) in the solid state by single crystal X-ray crystallography, report on their spectroscopic characterization and on the evaluation of their bactericidal properties against aerobic Gram-positive microorganisms.

123

Biometals (2010) 23:59–70 33

14 11 31

10 O4 O

29

28

9

5 4 3

O O3

2 27

8

6 30

13

12 O O6

15 O O7

34 32

16

18 17 O O8 O9 O

7 OH O5

O 1 O2

HO O11

25 26

OH O10

19 20 21 35

22 24

23

36

HO O1

Scheme 1 The chemical structure and numbering sequence of monensic acid

Materials and methods Chemicals All chemicals were of reagent grade and were used as received. The commercially available sodium monensin was obtained from BIOVET, Ltd. (Bulgaria). Solvents (MeCN, MeOH, DMSO), organic base (Et4NOH) and metal salts (MgCl2!6H2O, CaCl2) were purchased from Merck. Synthesis of monensic acid The acidic form of monensin A monohydrate (monensic acid, MonH!H2O) was prepared from sodium monensin as previously reported (Gertenbach and Popov 1975). IR: mCOOH = 1700 cm-1. 1H-NMR (600 MHz, d (multiplicity, intensity, J-coupling(s), assignment), CDCl3): 6.25 (br, 1-OH, 10-OH (sharp), 11-OH, H2O), 4.50 (br d, 1H, 7.9, 5-OH), 4.33 (ddd, 1H, 10.8, 5.9, 2.9, 20CH), 4.07 (dd, 1H, 11.6, 2.1, 5CH), 4.03 (d, 1H, 4.0, 17CH), 3.94 (dd, 1H, 10.5, 2.7, 21CH), 3.86 (br s, 1H, 7CH), 3.69 (d, 1H, 11.2, 26CH20 ), 3.50 (d, 1H, 11.2, 26CH200 ), 3.44 (dd, 1H, 10.7, 4.6, 13CH), 3.37 (s, 3H, 28OCH3), 3.22 (dd, 1H, 10.2, 2.1, 3CH), 2.62 (dq, 1H, 10.2, 6.7, 2CH), 2.25–2.13 (4H, 18CH, 15CH20 , 4CH, 19CH20 ), 2.10 (m, 1H, 6CH), 1.98 (dd, 1H, 14.2, 3.5, 8CH20 ), 1.97 (dd, 1H, 12.3, 8.4, 10CH20 ), 1.89 (dt, 1H, 11.9, 8.7, 11CH20 ), 1.74–1.52 (m, 5H, 8CH200 , 11CH200 , 10CH200 , 14CH2), 1.55 (m, 2H, 32CH2), 1.52–1.33 (m, 5H, 23CH20 , 24CH, 15CH200 , 19CH200 , 23CH200 ), 1.48 (s, 3H, 31CH3), 1.35 (m, 1H, 22CH), 1.27 (d,

Biometals (2010) 23:59–70

3H, 6.7, 27CH3), 1.10 (d, 3H, 6.9, 29CH3), 0.95 (t, 3H, 7.4, 33CH3), 0.92 (d, 3H, 6.9, 34CH3), 0.88 (d, 3H, 7.1, 30CH3), 0.87 (d, 3H, 6.4, 36CH3), 0.85 (d, 3H, 6.5, 35CH3). Synthesis of magnesium complex, [Mg(Mon)2(H2O)2], 1 The consecutive addition of Et4NOH (0.5 mmol, 180 ll, 40% in H2O) and of freshly prepared solution of MgCl2.6H2O (0.5 mmol, 100 mg in 5 ml MeCN/ MeOH, 10:1) to a solution of MonH (0.5 mmol, 336 mg in 20 ml MeCN/MeOH, 10:1) afforded the precipitation of white solids with a composition of [Mg(Mon)2(H2O)2], 1, which are insoluble in MeCN (228 mg, 65% yield). The complex was filtered off, washed with MeCN and dried over P2O5 at room temperature. Anal. Calcd for MgC72H126O24 (MW = 1400.08): H, 9.07, C, 61.77, Mg, 1.74; Found: H, 8.76, C, 60.17, Mg, 2.14%. Slow concentration of diluted reaction mixture affords the formation of colourless crystals of composition [Mg(Mon)2(H2O)2]!5MeCN. IR: mCOOasym = 1550 cm-1, mCOOsym = 1400 cm-1. 1 H-NMR (600 MHz, d (assignment), CDCl3): 10.98 (11-OH), 6.60 (10-OH), 4.98 (H2O), 4.85 (5-OH), 4.30 (20CH), 4.09 (21CH), 4.04 (17CH, 5CH), 3.73 (7CH), 3.78 (26CH20 ), 3.68 (26CH200 ), 3.52 (13CH), 3.33 (28OCH3), 3.24 (3CH), 2.46 (2CH), 2.33 (6CH), 2.23 (18CH), 2.17-2.04 (15CH20 , 19CH20 , 4CH), 2.00-1.94 (8CH20 , 10CH20 ), 1.85 (11CH20 ), 1.75–1.68 (14CH20 ), 1.70–1.50 (8CH200 , 11CH200 , 10CH200 , 14CH200 , 32CH20 , 23CH20 ), 1.54 (31CH3), 1.50–1.40 (19CH200 , 32CH200 , 15CH200 ), 1.37 (24CH), 1.29 (23CH200 , 22CH), 1.18 (27CH3), 1.08 (29CH3), 0.98–0.82 (33CH3, 34CH3, 30CH3, 36CH3, 35CH3). Synthesis of calcium complex, [Ca(Mon)2(H2O)2], 2 To a reaction mixture containing MonH (0.5 mmol, 336 mg in 15 ml MeCN/MeOH (10:1)) and Et4NOH (0.5 mmol, 180 ll, 40% in H2O) the addition of CaCl2 (0.5 mmol, 56 mg in 5 ml MeCN/MeOH, 10:1) led to the formation of colourless solution that slowly precipitates within 24 h (240 mg, 68% yield). The solid was filtered off, washed with MeCN and dried over P2O5 at room temperature. The elemental analysis data are in agreement with the general composition of the complex, [Ca(Mon)2(H2O)2], 2.

61

Anal. Calcd. for CaC72H126O24 (MW = 1415.86): H, 8.97, C, 61.08, Ca, 2.83; Found: H, 8.56, C, 58.12, Ca, 3.20%. Complex 2 is soluble in MeOH, CHCl3 and octanol, and possesses very low solubility in MeCN and DMSO. IR: mCOOasym = 1560 cm-1, mCOOsym = 1400 cm-1. 1H-NMR (600 MHz, d (assignment), CDCl3): 4.95 (5-OH), 4.32 (20CH), 4.23 (17CH), 4.04 (5CH, 21CH), 3.86–3.68 (7CH, 26CH20 ), 3.56 (26CH200 ), 3.50 (13CH), 3.37 (28OCH3), 3.24 (3CH), 2.48 (2CH), 2.37 (6CH), 2.30 (18CH), 2.22–2.11 (15CH20 , 19CH20 ), 2.09 (4CH), 2.00–1.88 (8CH20 , 10CH20 , 11CH20 ), 1.76–1.58 (8CH200 , 11CH200 , 10CH200 , 14CH2), 1.58–1.40 (32CH2, 23CH20 , 24CH, 31CH3, 15CH200 , 19CH200 ), 1.40–1.26 (23CH200 , 22CH), 1.19 (27CH3), 1.12 (29CH3), 0.98–0.83 (33CH3, 34CH3, 30CH3, 36CH3, 35CH3). Slow concentration of diluted reaction mixture (2–3 days at ambient temperature) affords the precipitation of 2 as colorless crystals. The X-ray analysis showed that 2 crystallizes as [Ca(Mon)2(H2O)2]!H2O!5MeCN. Physical measurements Infrared spectra (4000–400 cm-1) were recorded on a Specord 75-IR (Carl-Zeiss, Germany) in a nujol mull. FAB-MS spectra were performed using Fisons VG Autospec (Micromass Instruments, UK). 1 H (600.13 MHz) and 13C (150.92 MHz) spectra were acquired on an AVANCE AV600 II? NMR spectrometer (Bruker, Germany). All spectra were recorded in CDCl3 at room temperature. TMS was used as an internal standard for the 1H and 13C spectra. Unambiguous assignment of the signals was made on the basis of the gradient enhanced versions of COSY, TOCSY, HSQC, HMBC and ROESY experiments (Bruker pulse library programs: cosygpmfqf, dipsi2etgpsi, hsqcedetgpsisp2.2, hmbcgplpndqf, roesyph.2, 2007). The chemical shift values of the individual protons in the compounds have been determined from the HSQC spectra. Elemental analysis data (C, H, O) were obtained with a VarioEL V5.18.0 Elemental Analyzer (Elementar Analysen Systeme GmbH, Germany). The metal content of complexes was determined by AAS on a Perkin Elmer 1100 B (Waltham, USA) after decomposition of samples with conc. HNO3 and using a stock standard solution (Merck, 1000 lg/ml); the working reference solutions were prepared after suitable dilution.

123

62

Biometals (2010) 23:59–70

X-ray crystallography Details concerning data collection, structure solution and refinement of complexes 1 and 2 are given in Table 1. X-ray diffraction measurements were performed on an Oxford Diffraction Xcalibur 2 diffractometer at 112 K, operating with Mo-Ka (k = ˚ ) radiation and equipped with a graphite 0.71073 A monochromator. The structures were solved by direct methods and were refined by full-matrix least-square procedures on F2 (Sheldrick 1990; Sheldrick 1997). All non-H atoms were refined isotropically with a riding model. Cytotoxicity assay (determination of MIC) Three aerobic Gram-positive microorganisms were used as test strains to evaluate the cytotoxic properties of the alkaline-earth complexes, MgCl2.6H2O and CaCl2. The bacteria Bacilus subtillis (ATCC 6633), Bacilus mycoides spp. and Sarcina lutea FDA strain PCI 1000 (ATCC 10054) were purchased from the

Table 1 Crystal data and structure refinement for complexes 1, [Mg(Mon)2(H2O)2]! 5MeCN, and 2, [Ca(Mon)2(H2O)2]! H2O!5MeCN

123

National Bank for Industrial Microorganisms and Cell Cultures (Bulgaria). The activity of compounds is determined as their minimum inhibitory concentration [MIC, (lM)], which is the lowest concentration causing the visible inhibition of the bacteria growth. Details concerning the experimental procedures using the double layer agar hole diffusion method were carried in accordance with the literature (Andrews 2001) and were similar to those reported previously (Dorkov et al. 2008; Pantcheva et al. 2008, 2009).

Results and discussion The reaction of monensic acid with MgCl2 or CaCl2 in the presence of an organic base leads to the formation of unique alkaline-earth metal complexes of composition [M(Mon)2(H2O)2] (M = Mg (1), Ca (2)). The reaction proceeds in a mixed solvent system (MeCN/MeOH) and at metal-to-ligand-to-base molar ratio of 1:1:1. The addition of Et4NOH is essential for the coordination of the ligand to the divalent metal

Compound

Complex 1

Complex 2

Formula

C82H141O24N5Mg

C82H143O25N5Ca

M

1605.31

1639.09

Crystal system

Monoclinic

Monoclinic

Space group ˚) a (A

P 21

P 21

12.3337(5)

12.1855(4)

˚) b (A ˚ c (A)

25.1619(9)

25.0185(11)

14.3112(6)

14.6551(5)

b (") ˚ 3) V (A

91.101(4) 4440.5(3)

90.292(3) 4467.7(3)

Z

2

2

Dc (Mg/m3)

1.201

1.218

F(000)

1728

1780

l (mm-1)

0.093

0.145

Crystal size (mm)

0.10 9 0.13 9 0.21

0.38 9 0.35 9 0.17

hmin - hmax (")

3.25–27.66

3.22–27.61

Dataset (h, k, l)

-16/16, -31/32, -18/18

-15/15, -18/31, -18/18

Total Refl./Unique Refl.

57624/20116

33530/14670

Obs. Refl. [I [ 2r(I)]

9019

8758

Data/restraints/parameters

20116/8/984

14670/6/1020

R1, wR2 [I [ 2s(I)] ˚ -3 Residuals/eA

0.0605, 0.1398

0.0490, 0.1052

1.290/-0.363

0.865/-0.439

GOF

0.807

0.850

Biometals (2010) 23:59–70

ions since it facilitates deprotonation of the carboxylic function of monensic acid during the complexation. In the absence of organic base the reaction does not take place, and the use of inorganic bases such as NaOH or KOH exclusively forms the monovalent metal complexes of monensin, MonNa or MonK, respectively. Crystal structures of [Mg(Mon)2(H2O)2], 1 and [Ca(Mon)2(H2O)2], 2 Generally, the magnesium and calcium complexes of monoanionic form of monensic acid consist of a discrete electrically neutral unit [M(Mon)2(H2O)2]. Both compounds crystalize in the monoclinic space group P21. The crystals analyzed by X-ray crystallography additionally contain solvents molecules (MeCN and/or H2O), which do not affect the coordination mode of the ligand and do not participate in the formation of intramolecular H-bonds with the main unit. Such a solvent insertion was already observed in the cases of Mn2?/Co2? complexes of deprotonated monensic acid (Pantcheva et al. 2008) and of Ba2? complex of lasalocid (Johnson et al. 1970a, b). In compounds 1 and 2, two monensic anions (Mon) act as bidentate ligands occupying four places in the inner coordination sphere of the alkaline-earth metal ion. Two of the positions in the equatorial plane of the complexes are filled by deprotonated monodentate carboxylic functions of two monensic anions (COO– M bonds), and other two by methoxy groups of Mon located at the opposite end of the ligand molecule forming two dative HO ? M bonds, respectively.

63

The folding of the ligand due to its bidentate coordination mode affords its pseudo-cyclization referred to as ‘‘head-to-tail’’ cyclization, observed even for the free ligand in the absence of metal ions (Lutz et al. 1971). Similarly to the transition metal complexes of Mon (Pantcheva et al. 2008) and barium complex of lasalocid (Johnson et al. 1970a, b), two water molecules are also included in the structures of 1 and 2, linked by dative H2O ? M bonds in axial positions with respect to the divalent metal ion and completing the octahedral environment of Mg2?/Ca2? (Fig. 1). The data confirm that water molecules in the new monensin complexes play a dual role: first, they occupy the inner coordination sphere of the metal ion, and in the second place they stabilize the strongly folded ligand by various intramolecular H-bonds. Selected bond distances and bond angles of 1 and 2 are presented in Table 2. Intramolecular H-bonds observed are shown in Fig. 2 and Table 3, respectively. No intermolecular H-bonds were detected in the structures. The crystal packing of complexes is depicted in Fig. 3. The comparison of crystallographic data for the Mn2?/Co2? (Pantcheva et al. 2008) and Ca2?/Mg2? complexes of monoanionic monensic acid shows that the divalent metal center reacts in a similar manner in each case both with monensin ligands and with water molecules. The M–O bond lengths decrease in the order of Ca2? [ Mn2? [ Co2? [ Mg2? in accordance with the decrease of the metal ionic radii. The M–O bond angles of metal ion with equatorial monensin ligands forming the xy-plane of complexes deviate from the regular ones (180") by ca. 10" and

Fig. 1 ORTEP of [Mg(Mon)2(H2O)2] (1) and [Ca(Mon)2(H2O)2] (2) at the 30% probability level (protons and solvent molecules are omitted for clarity)

123

64

Biometals (2010) 23:59–70

˚ ) and bond angle (") of Table 2 Selected bond distances (A complexes 1 and 2 Complex 1

M–O1

2.029(3)

2.266(3)

M–O101

2.029(3)

2.253(3)

M–O11

2.130(3)

2.358(3)

M–O111

2.136(3)

2.370(3)

M–O12

2.107(3)

2.341(2)

M–O13

2.102(3)

2.340(3)

86.17(12)

82.44(9)

Bond angles O101–M–O1

88.84(12)

O1–M–O111

171.29(13)

94.63(10) 172.17(9)

O101–M–O111

85.89(12)

O111–M–O11

99.81(12)

101.03(9)

O101–M–O11

172.00(13)

173.94(9)

O12–M–O13

160.41(12)

151.22(9)

82.54(10)

Symmetry position: -x, y ? 1/2, -z

Fig. 2 Intramolecular bonds (in dotted line) observed in the structure of alkaline-earth complexes on the basis of complex 1 (the coordination of Mg2? with one of the ligands is shown)

no significant difference is observed between them in dependence on the divalent metal center. In contrast, the metal-aqueous oxygen bond angles increase with decreasing metal ionic radii as follows: Ca2? (151.2") \ Mn2? (154.4") \ Co2? (159.1") \ Mg2? (160.4"). From the data collected up to now it can be concluded that the nature of the divalent metal ion (i.e. its ionic radius) does not affect significantly the equatorial planarity of complexes, but influences the

123

Complex 1

Complex 2

O2–O11

2.575

2.612

O102–O111

2.587

2.623

O5–O6

2.763

2.808

O105–O106

2.771

2.794

O5–O10

2.676

2.668

O105–O110

2.689

2.650

O5–O12

3.006

2.930

O105–O13

2.909

2.873

O6–O12 O106–O13

3.081 3.024

3.027 2.974

O7–O12

2.778

2.730

O107–O13

2.772

2.720

O8–O12

2.970

2.885

O108–O13

2.968

2.880

Complex 2

Bond length

O1–M–O11

Table 3 Intramolecular H-bonds of complexes 1 and 2

Symmetry position: -x, y ? 1/2, -z

bonding with axial ligands thus leading to different degrees of deformation of the octahedral environment around the divalent cationic center. The structures of 1 and 2 have clearly been established in the solid state by single crystal X-ray diffraction, nevertheless questions concerning the coordination mode of deprotonated monensic acid especially towards Ca2? still remain. These queries arise since calcium and sodium ions are hard acids and their ionic radii are equivalent at coordination number ˚ (Na?) vs. 1.00 A ˚ (Ca2?)], but at the same of 6 [1.02 A 2? time Ca does not ‘‘enter’’ the hydrophilic cavity of ligand at the selected reaction conditions. Although some authors suggest the formation of shell-like alkaline-earth complexes with monovalent ionophores of composition metal-to-ligand ratio = 1:1 (Huczynski et al. 2007a, b, c, 2008a, b, c, d) their isolation as solid phases was not observed in the present research. Despite these hypothesis, the magnesium (1) and calcium (2) complexes of monoanionic monensic acid of composition of M:Mon = 1:2 clearly represent the first example of alkaline-earth monensin complexes to be isolated and fully characterized in solid state. IR spectral properties of complexes 1 and 2 The IR spectra of 1 and 2 obtained in a nujol mull are very similar to those observed for the transition metal

Biometals (2010) 23:59–70

65

Fig. 3 Crystal packing of complexes 1 (a) and 2 (b)

complexes of Mon (Pantcheva et al. 2008) and the results are in agreement with the crystallographic data of new compounds. The main evidence that complexation takes place is found comparing the positions of stretching vibrations of the carboxyl function of MonH and of the carboxylate group of 1 and 2, respectively. The peak due to mCOOH of MonH (1700 cm-1) disappears in the IR spectra of 1 and 2 thus demonstrating that deprotonation of carboxyl moiety occurs during the complexation. This fact was also confirmed by the appearance of two new peaks in the IR spectra of 1 and 2, assigned to the stretching vibrations of the deprotonated carboxylic function, -1 absorbing at 1550 cm-1 (masym COO) and 1400 cm sym (mCOO), respectively. The IR spectral data confirming the coordination both of monensin hydroxyl groups and of water ligands to Mg2? and Ca2? are also in accordance with the data previously reported (Pantcheva et al. 2008). The crystallization water and hydroxyl groups of monensic acid absorb at 3520 and 3320 cm-1, respectively, while in the IR spectra of 1 and 2 the next bands were found and were assigned as follows: mOHwater (3490 cm-1) and mOHOH-groups [3360, 3280 cm21 (1); 3280 cm-1 (2)]. NMR spectra of MonH, 1 and 2 To the best of our knowledge, several research teams solved 1H- and 13C{1H}-NMR spectra of the monovalent metal complexes of Mon (Ajaz et al. 1987; Mimouni et al. 1996; Martinek et al. 2000) or its ester derivatives and their alkali complexes (Huczynski et al. 2006a, b, c, d, 2007a, b, c, 2008a, b, c, d), respectively. The presented study for a first time is

dealing in details with the NMR spectra of monensic acid and its diamagnetic divalent metal derivatives. The 1H-NMR data of MonH, 1 and 2 are presented in ‘‘Materials and methods’’ section. 13C{1H}-NMR resonances are summarized in Table 4, following the numbering sequence of the ligand, shown in Scheme 1. Due to the low solubility of metal complexes in MeCN, the NMR spectra were recorded in CDCl3 where OH-exchange is taking place thus significantly affecting the position of OH-groups. The 1-OH (–COOH), 10-OH and 11-OH resonances in monensic acid appear as a broad signal at 6.25 ppm and 5-OH is observed at 4.50 ppm. The major evidence that the deprotonation of carboxylic function of MonH occurs during the complexation is the disappearance of 1-OH resonance in 1H-NMR spectra of 1 and 2. At the same time a significant positive deviation in the position of 5-OH is observed whose resonance shifts from 4.50 ppm (MonH) to 4.85 ppm (1) and 4.95 ppm (2), respectively. The results obtained suggest that in solution this group is more strongly engaged in intramolecular H-bonding in the complexes than in the free acid and this was confirmed by the solid state structure of metal(II) compounds. As can be seen from the crystallographic data (Table 3; Fig. 3), 5-OH participates in three Hbonds by interacting with the aqua ligand (H2O-12), the ether oxygen O6 and the hydroxyl group 10-OH. The main point of emphasis when discussing the 13 C{1H}-NMR spectra of MonH, 1 and 2 is focused on the positions of those carbon atoms, that are closely attached to the coordination sites of the ligand and whose resonances deviate significantly in the spectra on moving from MonH to complexes 1 and 2. As can

123

66

Biometals (2010) 23:59–70

Table 4 13C{1H}-NMR (150 MHz, CDCl3) resonances of MonH and complexes 1–2 C-atom

d (ppm)

D (ppm) D1

2

D2

MonH

1

1

177.09

181.94

181.81

4.85

4.72

2

41.94

43.70

44.29

1.76

2.35

3

81.56

82.28

82.49

0.72

0.93

4

36.70

37.08

37.40

0.38

0.70

5

67.01

65.66

68.21

-1.35

1.20

6

34.54

34.31

34.23

-0.23

-0.31

7

70.74

70.61

70.71

-0.13

-0.03

8

34.03

34.36

34.33

0.33

0.30

9

107.79

107.65

107.55

-0.14

-0.24

10

38.36

38.51

38.75

0.15

0.39

11 12

33.73 85.14

34.12 85.11

33.83 85.29

0.39 -0.03

0.10 0.15

13

83.42

85.06

83.91

1.64

0.49

14

27.88

27.60

27.78

-0.28

-0.10

15

31.49

29.26

32.83

-2.23

1.34

16

86.18

87.91

87.12

1.73

0.94

17

85.11

85.44

84.35

0.33

-0.76

18

34.45

34.31

34.23

-0.14

-0.22

19

32.58

32.75

31.25

0.17

-1.33

20

77.01

77.58

77.46

0.57

0.45

21

73.83

72.94

73.56

-0.89

-0.27

22

32.80

33.40

33.34

0.60

0.54

23

36.59

36.50

36.73

-0.09

0.14

24

35.68

36.30

35.90

0.62

0.22

25

96.99

98.38

98.63

1.39

1.64

26 27

67.98 15.66

67.85 16.94

66.35 16.81

-0.13 1.28

-1.63 1.15

28

58.03

57.75

57.94

-0.28

-0.09

29

10.37

11.23

11.36

0.86

0.99

30

10.75

10.67

10.76

-0.08

0.01

31

27.69

27.93

27.43

0.24

-0.26

32

31.19

30.66

30.79

-0.53

-0.40

33

8.61

8.84

8.73

0.23

0.12

34

15.75

15.84

15.74

0.09

-0.01

35

17.54

17.39

17.63

-0.15

0.09

36

16.32

16.88

16.97

0.56

0.65

D1 = d1 - dMonH; D2 = d2 - dMonH

be seen (Table 4), the position of 1C shows a very significant downfield shift in the spectra of 1 and 2 comparing to MonH (D = 4.85 ppm (1), D = 4.72 ppm (2), D = dcomplex - dMonH). Such behaviour is in agreement with the presence of monensin

123

deprotonated carboxylic function and reveals that both complexes retain their coordination in solution. A downfield shift in the spectra of 1 and 2 is also observed for the carbons 2, 3, 25, 27 and 29 (D = 0.72.5 ppm), which are in close vicinity of atoms O1 and O11 directly coordinated to the divalent metal ions. The formation of H-bonds between the water ligands (H2O-12 and H2O-13) and ether oxygens O5–O8 also shifts some of the carbon-13 resonances of 1 and 2 significantly. The experimental data obtained show that positive as well as negative shifts are observed depending on the extent of deformation, that the ligand endures through the complexation. The NMR data obtained for Mg- and Ca-complexes of Mon correspond closely and confirm that (i) the coordination mode of monensin is analogous in 1 and 2; (ii) the metal ions retain their linkage with bidentate monensic anions both in solid state and in solution. FAB-MS spectra of complexes 1 and 2 The major species found in the FAB-MS spectra of complexes 1 and 2 are presented in Scheme 2. The spectra consist of a great number of signals some of which are assigned to the molecular ions of complexes after loss of water ligands and association with sodium ions, [M(C36H61O11)Na]? (1a: M = Mg; 2a: M = Ca), as well as to the ions generated from association/dissociation processes occurring with the complex species in the gas phase (1b, 2c–f). It should be mentioned that FAB-MS spectra of monensin complexes contain peaks of [MonH?Na]? due to sodium traces from the matrix used (3-nitrobenzylalcohol), an observation that is in accordance with the high affinity of monensin to bind sodium ions and with data reported previously (Chamberlin and Agtarap 1970; Volmer and Lock 1998). Cytotoxicity assay The aerobic Gram-positive microorganisms B. subtillis, S. lutea and B. mycoides were used as test strains to evaluate the cytotoxicity of 1, 2, MgCl2.6H2O and CaCl2. The bactericidal properties of MonH were also confirmed in the present study and its determined activity is in agreement with the data previously reported (Pantcheva et al. 2008). The alkaline-earth chlorides, similarly to MnCl2 and CoCl2 (Dorkov et al. 2008; Pantcheva et al. 2008),

Biometals (2010) 23:59–70

67 - H+ + Na+

[(MC36H61O11)(MC36H60O11)]+ 2d: C72H121Ca2O22; m/e: 1417.3 (30 %)

[(MC36H60O11)2Na]+ 2e: C72H120Ca2NaO22; m/e: 1439.4 (3 %),

- H+, - Na+ + MC36H60O11

+ M2+ [(MC36H60O11)(MC36H59O11)M]+

[MC36H61O11]+

2f: C72H119Ca3O22; m/e: 1455.5 (3 %),

2c: C36H61CaO11; m/e: 709.2 (100 %)

- C36H61O11Na [M(C36H61O11)2(H2O)2]

- 2 H2O + Na+

- H+ + Na+

[M(C36H61O11)2Na]+

1a: C72H122MgNaO22; m/e: 1385.2 (47 %) 2a: C72H122CaNaO22; m/e: 1401.3 (12 %)

1: M = Mg; 2: M = Ca

[M(C36H61O11)(C36H60O11)Na2]+ 1b: C72H121MgNa2O22; m/e: 1407.32 (35 %)

- M(C36H61O11) + H+, + Na+ [C36H62O11)Na]+ C36H62NaO11; m/e: 693.2 (1g, 100 %; 2g, 27%)

Scheme 2

Major ions observed in the FAB-MS spectra of monensin alkaline-earth complexes 1 and 2

cannot be defined as bactericidal agents because their minimum inhibitory concentrations fall in the millimolar concentration range (Table 5). Thus the effect of metal salts is uninfluential on the visible growth of bacteria strains and can be disregarded in comparison with the corresponding metal complexes studied. The alkaline-earth complexes of monoanionic form of monensic acid possess strongly enhanced cytotoxicity against selected strains in comparison to the free ligand (Table 5) and furthermore, the antimicrobial activity of 1 and 2 cannot be assigned to the simple additive effect of partners in the complexes. Instead, it may probably be attributed to increased penetration of the new compounds through the bacteria’s cell membrane. Previously we suggested that the increased activity of the Co2? complex of

Mon (Pantcheva et al. 2008) could be explained in the terms of an unusual coordination mode of the monovalent polyether ionophorous antibiotic. The current results manifest that the role of divalent metal ion in mononuclear complexes of deprotonated monensic acid should be reconsidered, since the coordination mode of the antibiotic remains unchanged both in transition and in alkaline-earth metal complexes, respectively, but a difference (2–7 multiple) is observed in their cytotoxic properties. It is still early to predict the intimate antibacterial mechanism of monensin divalent metal complexes, although it seems to be closely linked to the ability of the ligand to bind metal(II) ions and to transfer them across the cell membrane as neutral complexes, followed by further dissociation of the compounds

Table 5 Bactericidal activity of MonH and complexes 1–2 expressed as MIC (lM) Compound

B. mycoides

B. subtillis

S. lutea

References

MonH

11.9

23.9

23.9

Pantcheva et al. (2008)

[Ca(Mon)2(H2O)2], 1

0.7

1.4

1.4

This work

[Mg(Mon)2(H2O)2], 2

0.7

1.4

1.4

This work

[Co(Mon)2(H2O)2]

1.4

2.8

2.8

Pantcheva et al. (2008)

[Mn(Mon)2(H2O)2]

5.1

10.3

10.3

Pantcheva et al. (2008)

CaCl2

1 9 103

5 9 103

5 9 103

This work

MgCl2.6H2O

1 9 103

5 9 103

5 9 103

This work

MnCl2!4H2O

3

3

5 9 10

5 9 103

Dorkov et al. (2008) and Pantcheva et al. (2008)

2 9 103

2 9 103

Dorkov et al. (2008) and Pantcheva et al. (2008)

CoCl2!6H2O

5 9 10

2 9 103

123

68

and by subsequent disturbance of homeostatic processes thus causing inhibition of bacteria growth. Conclusion Alkaline-earth complexes of monoanionic form of monensic acid with Mg2? and Ca2? were isolated for the first time in solid state. The complexes are of general composition [M(Mon)2(H2O)2] (M = Mg, Ca) and consist of an alkaline-earth metal ion placed in distorted octahedral environment. Monensin ligands act in a bidentate coordination mode via their monodentately bound carboxylate- and methoxy functions positioned at the both opposite sites of monensic anions. Additionally, two water molecules form two dative bonds with the alkaline-earth metal ion completing the sixfold geometry around the metal center and stabilizing the ‘‘head-to-tail’’ cyclization of the ligand molecule. The cytotoxicity assay against aerobic Gram-positive bacteria shows strongly enhanced activity of alkaline-earth monensin complexes in comparison to monensic acid that is most likely due to the unusual coordination mode of the ligand although the influence of the divalent metal ion should be also taken into account. Supplementary data CCDC 734913 (1) and 734912 (2) contain the supplementary crystallographic data for this paper. These data can be obtained free of charge via http://www.ccdc.cam.ac.uk (or an application from Cambridge Crystallographic Data Centre, 12 Union Road, Cambridge CB2 1EZ, UK; Fax: ?44 01223 336033; or e-mail: [email protected]. Acknowledgements The present research is financially supported from the National Science Fund (NSF), DO-02-84/ 2009. SS is grateful to NSF (UNA-17/2005) for the purchase of Bruker Avance AVII? 600 NMR spectrometer. The authors are thankful to Assoc. Prof. A. Nakov and MSci P. Dorkov (BIOVET Ltd.) for supplying sodium monensin.

References Agtarap A, Chamberlin JW, Pinkerton M, Steinrauf LK (1967) The structure of monensic acid, a new biologically active compound. J Am Chem Soc 89:5737–5739 Ajaz AA, Robinson JA, Turner DL (1987) Biosynthesis of the polyether ionophore antibiotic monensin A: assignment of

123

Biometals (2010) 23:59–70 the carbon-13 and proton n. m. r. spectra of monensin A by two-dimensional spectroscopy. Incorporation of oxygen-18 labeled molecular oxygen. J Chem Soc Perkin Trans 1:27–36 Andrews JM (2001) Determination of minimum inhibitory concentrations. J Antimicrob Chemother 48:5–16 Augustine PC, Smith CK, Danforth HD, Ruff MD (1987) Effect of ionophorous anticoccidials on invasion and development of Eimeria: comparison of sensitive and resistant isolates and correlation with drug uptake. Poultry Sci 66:960–965 Augustine PC, Watkins KL, Danforth HD (1992) Effect of monensin on ultrastructure and cellular invasion by the turkey coccidia Eimeria adenoeides and Eimeria meleagrimitis. Poultry Sci 71:970–978 Berg HH, Hamill RL (1978) The isolation and characterization of narazin, a new polyether antibiotic. J Antibiot 31:1–6 Briggs RW, Hinton JF (1978) Thallium-205 and proton nuclear magnetic resonance investigation of the complexation of thallium by the ionophores monensin and nigericin. Biochemistry 17:5576–5578 Chamberlin JW, Agtarap A (1970) Observations on the mass spectrometry of monensin and related compounds. Org Mass Spectrom 3:271–285 Chappe LR (1979) The site of action of the anticoccidial salinomycin (Coxistac). J Parasitol 65:137–143 Cox BG, Vantruong N, Rzeszotarska J, Schneider H (1984) Rates and equilibria of alkali metal and silver ion complex formation with monensin in ethanol. J Am Chem Soc 106:5965–5969 Dassie SA, Baruzzi AM (2002) Alkaline-earth cation transfer assisted by monensin across the water vertical bar 1,2dichloroethane interface in the presence of alkali cations. J Electroanal Chem 522:158–166 Dorkov P, Pantcheva IN, Sheldrick WS, Mayer-Figge H, Petrova R, Mitewa M (2008) Synthesis, structure and antimicrobial activity of manganese(II) and cobalt(II) complexes of the polyether ionophore antibiotic sodium monensin A. J Inorg Biochem 102:26–32 Duax WL, Smith GD, Strong PD (1980) Complexation of metal ions by monensin—crystal and molecular structure of hydrated and anhydrous crystal forms of sodium monensin. J Am Chem Soc 102:6725–6729 Folz SD, Lee BL, Nowakowski LH, Conder GA (1988) Anticoccidial evaluation of halofuginone, lasalocid, maduramicin, monensin and salinomycin. Vet Parasitol 28:1–9 Garcla-Rosas J, Schneider H, Cox BG (1983) Silver complexation by the ionophorous antibiotic monensin in nonaqueous solvents. J Phys Chem 87:5467–5472 Gertenbach PG, Popov AI (1975) Solution chemistry of monensin and its alkali-metal ion complexes—potentiometric and spectroscopic studies. J Am Chem Soc 97:4738–4744 Hamidinia SA, Shimelis OI, Tan B, Erdahl WL, Chapman CJ, Renkes GD, Taylor RW, Pfeiffer DR (2002) Monensin mediates a rapid and selective transport of Pb2?—possible application of monensin for the treatment of Pb2? intoxication. J Biol Chem 277:38111–38120 Hamidinia SA, Tan B, Erdahl WL, Chapman CJ, Taylor RW, Pfeiffer DR (2004) The ionophore nigericin transports

Biometals (2010) 23:59–70 Pb2? with high activity and selectivity: a comparison to monensin and ionomycin. Biochemistry 43:15956–15965 Hebrant M, Mimouni M, Tissier M, Pointud Y, Juillard J, Dauphin G (1992) Complexing ability of ionophore monensin for divalent cations. New J Chem 16:999–1008 Huczynski A, Michalak D, Przybylski P, Brzezinski B, Bartl F (2006a) Monensin A benzyl ester and its complexes with monovalent metal cations studied by spectroscopic, mass spectrometry and semiempirical methods. J Mol Struct 797:99–110 Huczynski A, Przybylski P, Brzezinski B (2006b) Complexes of monensin A methyl ester with Mg2?, Ca2?, Sr2?, Ba2? cations studied by electrospray ionization mass spectrometry and PM5 semiempirical method. J Mol Struct 788:176–183 Huczynski A, Przybylski P, Brzezinski B, Bartl F (2006c) Monensin A methyl ester complexes with Li?, Na? and K? cations studied by ESI–MS, 1H- and 13C-NMR, FTIR, as well as PM5 semiempirical method. Biopolymers 81:282–294 Huczynski A, Przybylski P, Brzezinski B, Bartl F (2006d) Spectroscopic, mass spectrometry, and semiempirical investigation of a new ester of monensin A with ethylene glycol and its complexes with monovalent metal cations. Biopolymers 82:491–503 Huczynski A, Przybylski P, Brzezinski B (2007a) NMR, FTIR, ESI–MS and semiempirical study of a new 2-(2-hydroxyethoxy)ethyl ester of monensin A and its complexes with alkali metal cations. Tetrahedron 63:8831–8839 Huczynski A, Przybylski P, Schroeder G, Brzezinski B (2007b) Investigation of complex structures of a new 2-hydroxyethyl ester of monensin A with Mg2?, Ca2?, Sr2?, Ba2? cations using electrospray ionization mass spectrometry and semiempirical PM5 methods. J Mol Struct 829: 111–119 Huczynski A, Ratajczak-Sitarz M, Katrusiak A, Brzezinski B (2007c) Molecular structure of the 1:1 inclusion complex of monensin A lithium salt with acetonitrile. J Mol Struct 871:92–97 Huczynski A, Brzezinski B, Bartl F (2008a) Structures of complexes of benzyl and allyl esters of monensin A with Mg2?, Ca2?, Sr2?, Ba2? cations studied by ESI–MS and PM5 methods. J Mol Struct 886:9–16 Huczynski A, Lowicki D, Brzezinski B, Bartl F (2008b) Spectroscopic, mass spectrometry and semiempirical investigation of a new 2-methoxyethyl ester of monensin A and its complexes with Li?, Na? and K? cations. J Mol Struct 874:89–100 Huczynski A, Lowicki D, Brzezinski B, Bartl F (2008c) Spectroscopic, mass spectrometry, and semiempirical investigations of a new 2-(2-methoxyethoxy)ethyl ester of monensin A and its complexes with monovalent cations. J Mol Struct 879:14–24 Huczynski A, Ratajczak-Sitarz M, Katrusiak A, Brzezinski B (2008d) Molecular structure of rubidium six-coordinated dihydrate complex with monensin A. J Mol Struct 888:224–229 Johnson SM, Herrin J, Liu SJ, Paul IC (1970a) Crystal structure of a barium complex of antibiotic X-537A, Ba(C34 H53O8)2!H2O. J Chem Soc D Chem Commun 2:72–73

69 Johnson SM, Herrin J, Liu SJ, Paul IC (1970b) Crystal and molecular structure of the barium salt of an antibiotic containing a high proportion of oxygen. J Am Chem Soc 92:4428–4435 Kevin DA II, Meujo DAF, Hamann MT (2009) Polyether ionophores: broad-spectrum and promising biologically active molecules for the control of drug resistant bacteria and parasites. Expert Opin Drug Discov 4:109–146 Koinarski V, Sherkov SN (1987) Effect of anticoccidial preparations in the prevention of coccidiosis in turkeys caused by Eimeria adenoides. Vet Med Nauki 24:81–85 Liu WC, Slusarchyk DS, Astle G, Trejo WH, Brown NE, Meyers E (1978) Ionomycin, a new polyether antibiotic. J Antibiot 9:815–819 Long PL, Jeffers TK (1982) Studies on the stage of action of ionophorous antibiotics against Eimeria. J Parasitol 68:363–371 Lutz WK, Winkler FK, Dunitz JD (1971) Crystal structure of the antibiotic monensin: similarities and differences between free acid and metal complex. Helv Chim Acta 54:1103–1108 Martinek T, Riddell FG, Wilson C, Weller CT (2000) The conformations of monensin A metal complexes in solution determined by NMR spectroscopy. J Chem Soc Perkin Trans 2:35–41 Mimouni M, Pointud Y, Juillard J (1994) Interactions in methanol of divalent metal cations with bacterial ionophores, lasalocid and monensin—thermodynamical aspects. Bull Soc Chim Fr 131:58–65 Mimouni M, Hebrant M, Dauphin G, Juillard J (1996) Monovalent cation salts of the bacterial ionophore monensin in methanol. Structural aspects from NMR experiments. J Chem Res 6:278–279 Pangborn W, Duax WL, Langs D (1987) The hydrated potassium complex of the ionophore monensin A. J Am Chem Soc 109:2163–2165 Pantcheva IN, Mitewa M, Sheldrick WS, Oppel IM, Zhorova R, Dorkov P (2008) First divalent metal complexes of the polyether ionophore monensin A: X-ray structures of [Co(Mon)2(H2O)2] and [Mn(Mon)2(H2O)2] and their bactericidal properties. Curr Drug Discov Technol 5:154–161 Pantcheva IN, Dorkov P, Atanasov VN, Mitewa M, Shivachev BL, Nikolova RP, Mayer-Figge H, Sheldrick WS (2009) Crystal structure and properties of the copper(II) complex of sodium monensin A. J Inorg Biochem. doi: 10.1016/ j.jinorgbio.2009.08.007 Paz FAA, Gates PJ, Fowler S, Gallimore A, Harvey B, Lopes NP, Stark CBW, Staunton J, Klinowski J, Spencer JB (2003) Sodium monensin dihydrate. Acta Cryst E59: m1050–m1052 Riddell FG (2002) Structure, conformation, and mechanism in the membrane transport of alkali metal ions by ionophoric antibiotics. Chirality 14:121–125 Rzeszotarska J, Wagner-Czauderna E, Kalinowski MK (1994) Complexation of Tl? ions by monensin anion in binary mixtures of dipolar aprotic solvents. J Chem Res 10: 400–401 Sheldrick G (1990) SHELXS-97. Program for crystal structure solution. Institut fu¨r Anorganische Chemie der Universita¨t, Go¨ttingen, Germany

123

70 Sheldrick G (1997) SHELXL-97. Program for crystal structure refinement. Institut fu¨r Anorganische Chemie der Universita¨t, Go¨ttingen, Germany Stern PH (1977) Ionophores: chemistry, physiology and potential applications to bone biology. Clin Orthop Relat Res 122:273–298 Stiles MK, Craig ME, Gunnel SL, Pfeiffer DR, Taylor DR (1991) The formation constants of ionomycin with divalent cations in 80% methanol/water. J Biol Chem 266:8336–8342 Varga I, Sreter T (1996) Efficacy of a monensin-duokvin combination against Eimeria acervulina in chickens. Folia Parasitol (Praha) 43:153–155 Volmer DA, Lock CM (1998) Electrospray ionization and collision-induced dissociation of antibiotic polyether ionophores. Rapid Commun Mass Spectrom 12:157–164 Wagner-Czauderna E, Rzeszotarska J, Orlowska E, Kalinowski MK (1997) Complexing ability of monensin anion for

123

Biometals (2010) 23:59–70 alkali metal cations in binary mixtures of dipolar aprotic solvents. Phys Chem Chem Phys 101:1154–1157 Walba DM, Hermsmeier M, Haltiwanger RC, Noordik JH (1986) Crystal structures of monensin B lithium and silver salts. J Org Chem 51:245–247 Wang Z, Suo X, Xia X, Shen J (2006) Influence of monensin on cation influx and Na? -K? -ATPase activity of Eimeria tenella sporozoites in vitro. J Parasitol 92:1092–1096 Westley JW, Liu CM, Evans RHJr, Sello LH, Troupe N, Hermann T (1983) Preparation, properties and biological activity of natural and semisynthetic urethanes of monensin. J Antibiot 36:1195–1200 Yildirim SO, McKee V, Khardli FZ, Mimouni M, Hadda TB (2007) Rubidium(I) monensinate dihydrate. Acta Cryst E64:m154–m155

Biometals (2010) 23:71–81 DOI 10.1007/s10534-009-9267-7

Quantitative analysis and functional evaluation of zinc ion in the D-hydantoinase from Pseudomonas putida YZ-26 Xueyao Zhang • Jingming Yuan • Lixi Niu Aihua Liang

•

Received: 23 November 2008 / Accepted: 9 September 2009 / Published online: 5 November 2009 ! Springer Science+Business Media, LLC. 2009

Abstract D-Hydantoinase (HDT) is a metal-dependent enzyme that is widely used in industrial bioconversion to D-amino acids as valuable intermediates in the fields of food, pharmaceutical industry and agriculture. In this report, we prepared apo-HDT (metal-removed HDT) and Zn2?-HDT (Zn2?-added HDT) in vitro from a recombinant HDT (re-HDT) expressed in E. coli. The Zn2?-HDT and re-HDT contain 2.17 and 0.95 mol Zn2? per mol subunit, respectively, and they have comparable enzymatic activities. In contrast, the apo-HDT only retains 0.04 mol Zn2? per mol subunit with less than 10% activity, compared with the re-HDT. When the apoHDT was reconstituted with ZnCl2, the enzymatic activity recovery was about 75%. Moreover, the fluorescence intensity, circular dichroism spectra and thermo-stability of the apo-HDT and Zn2?-HDT are quite different from those of the re-HDT. These data suggest that the re-HDT may have two Zn2?-binding sites, one is an intrinsic or tight-binding site (zinc-a) essential for its activity and the other is a vacant or

X. Zhang ! J. Yuan (&) ! L. Niu ! A. Liang Key Laboratory of Chemical Biology and Molecular Engineering of National Ministry of Education, Institute of Biotechnology, Shanxi University, 92 Wu-cheng Road, 030006 Taiyuan, People’s Republic of China e-mail: [email protected] X. Zhang e-mail: [email protected]

loose-binding site (zinc-b) possibly non-essential for the activity. Keywords D-Hydantoinase ! Zn2? analysis ! Functional evaluation

Introduction D-Hydantoinase (HDT, EC 3.5.2.2) catalyses the substrate 50 -monosubstituted hydantoin to enantiomerical N-carbamoyl-amino acids which, in turn, can be chemically or enzymatically converted into the corresponding optically active amino acids (Altenbuchner et al. 2001). Hydantoinase is ubiquitously found in microorganisms, plants and animals (Pozo et al. 2002). The enzyme is also well known as dihydropyrimidinase in higher organisms and is responsible for dihydropyrimidine hydrolysis as the second step in the reductive catabolism of pyrimidine. Based on its chiral specificity for the substrate and product, HDT can be divided into three types: L-, D- and DL-configuration. A number of bacterial D-hydantoinases with different enantioselectivities and substrate specificities have been used in industrial bioconversion to optically active D-amino acids. As unnatural chiral products, D-amino acids are important intermediates in the synthesis of various b-lactam semisynthetic antibiotics, such as

123

72

ampicillin, amoxicillin, aspoxicillin and cefbuperazone, as well as of other products, such as antiviral agents, artificial sweeteners, pesticides, peptide hormones and pyrethroids etc. (Altenbuchner et al. 2001). HDT, similar to other amidohydrolases, has been characterized as a typical metal-dependent enzyme, either in the fundamental research or in the industrial application (May et al. 1998a, b). It is demonstrated that divalent metal ions, especially Zn2?, play an important role in the catalytic process of the enzyme (May et al. 1998a, b). In the last decades, some reports regarding the metal dependence of HDT have been mainly focused on the function of Zn2? and its quantitative determination (Gojkovic et al. 2003; Cheon et al. 2003; Kikugawa et al. 1994; Brooks et al. 1983). Thereinto, most HDTs contain two Zn2? ions per subunit (Gojkovic et al. 2003; Cheon et al. 2003). The first Zn2? may bind to the carbonyl oxygen of hydantoin and subsequently polarize the carbonyl bond, while the second Zn2? only activates the bridge water and does not bind to the substrate. In contrast, a few HDTs only contain one catalytic Zn2? per subunit, such as the HDTs from bovine liver and rat liver (Kikugawa et al. 1994; Brooks et al. 1983). No matter how many Zn2? per subunit HDT contains, they are all essential for the catalytic reaction. However, the potential structural and functional roles for Zn2? have not been well established in hydantoinase family, although the role of Zn2? has been well established in other amidohydrolases. Our previous work indicated that the D-hydantoinase from Pseudomonas putida YZ-26 was dissociated into monomer subunit from its dimer in the presence of 1 mM Zn2? (Shi et al. 2006). To further explore the function of Zn2? in the HDT, we prepared re-HDT, apo-HDT and Zn-HDT to study the relationship between its zinc content and catalytic activity. This report preliminarily demonstrates that the re-HDT has two different Zn2?-binding sites, a tight one linked to its activity is filled with Zn2? and a loose one related to its structure is vacant.

Materials and methods Strain, plasmid, reagents and equipments The host cell, Escherichia coli BL21 (DE3) and a recombinant plasmid pE-p479 used in this study were

123

Biometals (2010) 23:71–81

stored at -80"C in this laboratory. Hydantoin, 4-(2-hydroxyerhyl) piperazine-1-ethanesulfonic acid (HEPES, ultra pure grade) and Tris (Hydroxymethyl) aminomethane (Tris, ultra pure grade) were obtained from Sigma-Aldrich (St. Louis, MO, USA). Pyridine2, 6-dicarboxylic acid (DPA) and EDTA were purchased from Alfa Aesar (Ward Hill, MA, USA). The protein purification equipment and separation materials were from Amersham Pharmacia Biotech. All reagents and buffer solutions used here were prepared using ultra-pure water with more than 18.2 MX m from a Milli-Q water purification system (Millipore Corporation, France). All other chemicals used were of the highest purity commercially available, unless otherwise indicated. Expression and purification of the recombinant D-hydantoinase Recombinant plasmid pE-p479 was introduced into E. coli BL21 and expressed in 1 l Luria-Bertani (LB) culture supplemented with ampicillin (100 lg/ml) at 30"C for 12–14 h without adding any inducers. The culture was harvested by centrifugation at 6,000g for 10 min at 4"C. Then pellets were suspended in chilled 50 mM Tris–HCl buffer, pH 8.0 (TB8) and sonicated. The resulting supernatant was purified by a two-step purification procedure to obtain the purified D-hydantoinase, as described previously (Zhang et al. 2008). The protein concentration was performed by the Bradford or Folin-phenol methods with bovine serum albumin as the assay standard. Enzymatic assay D-Hydantoinase activity was measured by a colorimetric method (Niu et al. 2007). An aliquot of the enzyme was added into the reaction mixture in a total volume of 1.5 ml, contained 100 mM hydantoin and 50 mM TB8. After being incubated at 37"C for 30 min, the reaction mixture was terminated by adding 0.25 ml trichloro-acetic acid (10% w/v), then 0.25 ml dimethylaminobenzaldehyde (DMBA) solution (10% w/v in 6 M HCl) and finally diluted with distilled water to 3 ml. After centrifugation, the product, N-carbamoylglycine, in the supernatant was measured at 430 nm wavelength and its amount was calculated from a standard calibration plot. One D-hydantoinase unit is equivalent to the formation of

Biometals (2010) 23:71–81

1 lmol of N-carbamoylglycine per min under the above assay condition. Apo-HDT and Zn2?-HDT preparation in vitro Apo-HDT was prepared by mixing re-HDT and 100 mM DPA to remove the intrinsic Zn2? at 25"C for 8 h. Then the reaction mixture was thoroughly dialyzed against 10 mM TB8 at 4"C with buffer changes for four times to remove trace metal ions. Zn2?-HDT was prepared with the re-HDT by addition of ten fold (ca. 0.3 mM) ZnCl2. The reaction mixture was dialyzed as described above. Finally, the enzymatic activity, protein concentration and Zn2? content of each sample were examined by DMBA, Folin-phenol and ICP-AES methods, respectively. Determination of divalent metal ions Divalent metal ions in re-HDT, apo-HDT and Zn2?HDT were determined by ICP-AES (inductively coupled plasma-atomic emission spectrometry, an ICP-AtomScan 16 apparatus from Thermo Jarrell Ash Co., USA) with a direct injection. All samples were prepared to be SDS-PAGE pure. Metals were analyzed at the following wavelengths: Zn2?: 213.856 nm; Co2?: 236.379 nm; Mn2?: 257.690 nm; Ni2?: 231.604 nm and Fe2?: 259.640 nm. Data were calibrated against the standard of Zn2?, Co2?, Mn2?, Fe2? and Ni2?, respectively. Metal ion content and protein concentration were simultaneously performed each time to evaluate the reliability of metal: protein ratio. The last external dialyzed buffer was used as a blank in ICP-AES, and the equivalent amount of BSA was used as a control in the protein concentration assay. Thermo-stability The thermo-stability of re-HDT and Zn2?-HDT was determined by pre-incubation in 50 mM TB8 at various temperatures (from 35 to 60"C) for 60 min. Samples were then chilled on ice for at least 5 min, and then the residual activity was performed under the standard assay condition.

73

a colorimetric Zn2?-chelator, 4-(2-pyridylazo) resorcinol (PAR). Re-HDT (1 lM) and Zn2?-HDT (1 lM) in 10 mM HEPES buffer, pH 7.5 were used as the control and sample, respectively. Buffer alone was used as a blank. During the titration with PAR (1– 35 lM), the data were collected at 500 nm (Shi et al. 2008), and then the optical absorbance was corrected by subtracting the trace from buffer blank. The apparent binding constant of the vacant zinc-b site in re-HDT was estimated by a competition assay with a colorimetric Zn2?-chelator, 2-carboxy-2hydroxy-5-(sulfoformazyl) benzene (Zinco) (Armas et al. 2006). A typical assay is performed as follows: an amount of 20 lM Zinco and 10 lM ZnCl2 in 10 mM HEPES buffer was added into a cuvette, and the spectrophotometer was blanked against this solution. Then the re-HDT was added to the cuvette step by step, and the absorbance value was acquired at 620 nm after sufficiently mixing. Circular dichroism and fluorescence emission spectra Circular dichroism (CD) spectra were carried out with a recording spectropolarimeter (Jasco 810) at 25"C under a nitrogen atmosphere. CD spectrum was conducted at an enzyme concentration of 0.2 mg/ml in 20 mM HEPES (pH 7.4) with a 1 mm path-length cell. The spectrum was recorded from 190 to 250 nm at a scan rate of 50 nm min-1. A blank was also recorded in the absence of the enzyme using the same buffer as a control. The CD spectrum of each sample or control was measured at least three times. Fluorescence emission spectra were recorded at 25"C using a spectrofluorometer (HITACHI, F-2500) with an excitation wavelength of 295 nm. The spectrum was scanned from 290 to 400 nm at a scan rate of 60 nm min-1. Samples with an 8 lM enzyme concentration were measured in a 1 cm path-length fluorescence cuvette.

Results Preparation of re-HDT, apo-HDT and Zn2?-HDT

Apparent binding constant of zinc-b site The apparent binding constant of the zinc-b site in Zn2?-HDT was estimated by a competition test with

The re-HDT was purified by a two-step purification procedure from E. coli as described previously (Zhang et al. 2008). Zn2?-HDT and apo-HDT was

123

74

Biometals (2010) 23:71–81

prepared as described in ‘‘Materials and methods’’. To avoid the inactivation of the enzyme during the dialysis and ensure the reliability of the subsequent metal analysis, three samples (re-HDT, apo-HDT and Zn2?-HDT) must be treated simultaneously for each test. All three species of HDTs show high purity and exhibit the same molecular weight on SDS-PAGE (Fig. 1). Moreover, the Zn2?-HDT activity reaches a similar level as the re-HDT (9.5 U/mg), while the apo-enzyme has little activity compared with reHDT. Inactivation of re-HDT by metal chelators The chelator such as EDTA or pyridine-2,6-dicarboxylate (DPA) is generally used as a reagent to remove metal ions in a protein, accompanied by losing the activity or changing the conformation. However, when the re-HDT was incubated with EDTA or DPA, its inactivation profile was quite different as shown in Fig. 2. In the presence of 100 mM EDTA, the re-HDT is very stable, and its activity retains more than 90% after 8 h incubation. The effect of other chelators, such as 1,10-phenanthroline or 8-HQSA on the re-HDT is roughly the same as that of EDTA (data not shown). This is likely due to that the intrinsic Zn2? in the re-HDT is too tight to be removed by above chelators. However, the inactivation of the re-HDT obviously occurred in the presence of 100 mM DPA. The enzymatic activity gradually decreased to less than 10% after 8 h

Fig. 1 SDS-PAGE analysis of re-HDT, apo-HDT and Zn2?HDT. Lane M: Molecular mass marker (phosphorylase 97 kDa, bovine serum albumin 66 kDa, ovalbumin, 45 kDa, carbonic anhydrase, 30 kDa); Lane 1: Re-HDT; Lane 2: Apo-HDT; Lane 3: Zn2?-HDT

123

Fig. 2 Inactivation of re-HDT in the presence of chelator, EDTA or DPA. (d) Control, (s) EDTA, (!) DPA. The enzyme was incubated with 100 mM DPA or 100 mM EDTA at 25"C. At time intervals, aliquots were removed to measure the residual activity

incubation, indicating that the inactivation was related to some metal ions. This result is similar to that of the hamster dihydroorotase domain, a member of the hydantoinase family, in which the metal chelating ability of EDTA is weaker than that of DPA (Huang et al. 1999). Quantitative determination of divalent metal ions in the re-HDT Based on our experiences, a repeated dialysis procedure was quite efficient to thoroughly remove free trace metal ions. Three samples of pure HDTs (re-HDT, apo-HDT and Zn2?-HDT) were dialyzed simultaneously and extensively with 10 mM TB8 prepared by Milli-Q ultra-pure water and ultra-pure reagents as described in ‘‘Materials and methods’’. In order to confirm there is no metal ion contamination in samples, equal amounts of BSA as a control and the final external dialysate as a blank were measured by same procedures. ICP-AES analysis shows in Table 1 that the re-HDT contains 0.95 mol of Zn2? per subunit, equivalent to a protein: Zn2? ratio of 1:1. However, the apo-HDT treated with DPA only has 0.04 mol of Zn2? per subunit, indicating that the intrinsic Zn2? (so called zinc-a) was thoroughly removed by this dialysis procedure. On the contrary,

Biometals (2010) 23:71–81

75

Table 1 Divalent metal ion content in various types of hydantoinasesa

D-

Enzyme or control Metal ion (mol)/monomer enzyme(mol) Mn2?

Co2?

Ni2?

Zn2?

Fe2?

Re-HDT

0.09

0.06

0.01

0.95

0.08

Zn-HDT

0.03

0.03

0.02

2.17

0.02

Apo-HDTb

\0.01 \0.01 \0.01

BSAc

\0.01 \0.01 \0.01 \0.01 \0.01

0.04 \0.01

External dialysatec \0.01 \0.01 \0.01 \0.01 \0.01 a

The above data were carried out in triplicate by ICP-AES

b

Apo-HDT is the re-HDT incubated with 100 mM DPA at 25"C for 8 h

c

Blanks are the equal amount of BSA and the final external dialysate of different samples

the Zn2? content of Zn2?-HDT is up to 2.17 mol per monomer enzyme with no change on its activity. The result shows that Zn2? may occupy other binding site (so called zinc-b), which may be nonessential for enzymatic activity. Moreover, the quantity of other metal ions, such as Co2?, Ni2?, Mn2? and Fe2? are negligible in comparison with Zn2? as indicated in Table 1.

Fig. 3 Reactivation of apo-HDT in the presence of different metal ions. Apo-HDT was mixed with various molar ratios of Zn2?, Ni2?, Co2? and Mn2?, respectively, at 4"C for 2 h, and

Reactivation of apo-HDT by divalent metal ion To further explore the effect of Zn2? on the activity of the apo-HDT it was titrated with ZnCl2. As shown in Fig. 3, the activity of the apo-HDT is gradually increased until the ratio of Zn2? to enzyme is 1:1. The recovery of enzyme activity is about 75% of the re-HDT. Beyond 1:1 ratio, the enzymatic activity no longer increases, even in the presence of excess Zn2?. In order to investigate reactivation of the apo-HDT, the above metal ions were added individually. As shown in Fig. 3, the reactivation capability of the apoHDT seems in the sequence of Co2? [ Mn2? [ Ni2?, implying that these three metal ions are different from Zn2? not only on the activation level but also on the binding characteristics. Thermo-stability of Zn2?-HDT The thermo-stability of Zn2?-HDT (Fig. 4) is higher than that of the re-HDT under the identical condition. A possible explanation is that the zinc-b site filled with Zn2? results in the conformational change of the protein to enhance its thermo-stability. In fact, it is not

then 20 ll each was added into 1.5 ml reaction system for the activity assay. The activity of re-HDT was normalized to 100%

123

76

Biometals (2010) 23:71–81

re-HDT can be calculated by resolving Eq. 1 for KappðZn"2þ HDTÞ . ! " KappðZn"2þ HDTÞ Zn"2þ HDT ½Zinco( ð1Þ ¼ ½re-HDT(½Zn-Zinco( KappðZn"ZincoÞ It is shown in Fig. 5a that the optical absorption at 620 nm is gradually decreased with increased concentration of the re-HDT. The absorption change (D620 nm) reflects the transfer of Zn2? from the Zn2?-Zinco complex to the loose zinc-b site in the re-HDT, therefore, the following Eqs. 2–7 would be produced. ! " ½re-HDT( ¼ ½re-HDT(add " Zn2þ -HDT ð2Þ ! 2þ " Zn -HDT ¼ D½Zn-Zinco( ¼ A620 =e620 ð3Þ Fig. 4 Comparison of thermo-stability between re-HDT and Zn2?-HDT. (d) Re-HDT, (s) Zn2?-HDT. The enzyme was pre-incubated at different temperatures in a 50 mM Tris–HCl buffer, pH 8.0. An aliquot of the pre-incubated enzyme was removed and chilled on ice for 5 min. Then the residual activity was assayed as described in ‘‘Materials and methods’’

unusual that the addition of metal ions to an enzyme solution results in changes of the protein conformation and thermo-stability. For example, the thermo-stability of the PhoACY from Pyrococcus horikoshii was improved when it was incubated with Zn2?, Mn2? or Ni2? and the presence of Mn2? or Co2? can increase the thermo-stability of the Burkholderia pickettii D-hydantoinase (Xu et al. 2003; Vieille and Zeikus 2001). Therefore, the enhancement of the Zn2?-HDT thermo-stability may be dependent on the binding feature of zinc-b site. Apparent binding constant of zinc-b site The apparent binding constant between Zn2? and a protein can be estimated by a competition test with a Zn2? transferring reagent. The apparent Zn2?-binding constant of the loose zinc-b site in re-HDT was estimated by the colorimetric Zn2?-chelator, Zinco. The reagent, Zinco can form 1:1 complex with Zn2?, which has a distinct absorption at 620 nm (e = 23,500 M-1 cm-1) with a binding constant (Kapp) of 7.9 9 104 M-1 (Armas et al. 2006). Therefore, the binding constant of the loose zinc-b site in the

123

½Zn-Zinco(original ¼ 10 lM

ð4Þ

½Zinco(total ¼ 20 lM

ð5Þ

½Zinco( ¼ ½Zinco(total "½Zn-Zinco(original þD½Zn-Zinco(

ð6Þ

½Zn-Zinco( ¼ ½Zn-Zinco(original "D½Zn-Zinco(

ð7Þ

Finally, by the known binding constant of Zn-Zinco, the apparent zinc-b binding constant of Zn2?-HDT can be calculated at the level of 5 9 104 M-1. The result shows that Zn2? in Zn-Zinco can be transferred into the vacant zinc-b site of the reHDT, but its binding constant is not very high compared to the one for zinc-a site. Similarly, the zinc-b binding constant of the Zn2?HDT was measured with the colorimetric Zn2?-chelator, 4-(2-pyridylazo) resorcinol (PAR). The titration experiment (Fig. 5b) shows that the reagent, PAR only interacts with zinc-b site of the Zn2?-HDT, but not with the zinc-a site of the re-HDT at the same concentration. It was reported that an excess PAR mainly became a complex with Zn2? in a 2 to 1 stoichiometry (Zn(PAR)2), which produces a distinctive absorption at 500 nm (e = 66,000 M-1 cm-1) and has an apparent binding constant of 2 9 1012 M-1(Shaw et al. 1991). Therefore, the apparent binding constant of the Zn2?HDT can be calculated by resolving the Eq. 8 for KappðZn2þ "HDTÞ , just as in the case of Zinco. " Zn"2þ HDT ½PAR(2 ! " ¼ KappðZnðPARÞ Þ ½re-HDT( ZnðPARÞ2 2

KappðZn"2þ HDTÞ

!

ð8Þ

Biometals (2010) 23:71–81

77

! " ð9Þ ½re-HDT( ¼ ZnðPARÞ2 ¼ A500 =e500 ! " ð10Þ ½PAR( ¼ ½PAR(add "2 ZnðPARÞ2 ! 2þ " Zn -HDT original ¼ 1 lM ð11Þ ! 2þ " ! " ! " Zn -HDT ¼ Zn2þ -HDT original " ZnðPARÞ2 ð12Þ

Finally, according to the known binding constant of Zn(PAR)2, the apparent binding constant of zinc-b site in Zn2?-HDT should be around 5 9 1012 M-1. This experiment demonstrates that the zinc-b in the Zn2?-HDT is very hard to be transferred into PAR. In other words, as soon as the vacant zinc-b site is filled with Zn2?, the interaction strength between Zn2? and the protein is too tight to be removed. Circular dichroism and fluorescence spectra

Fig. 5 a Determination of the binding constant at the vacant zinc-b site in re-HDT by Zinco. Zn-Zinco complex (20 lM Zinco, 10 lM ZnCl2) was titrated with re-HDT (1–21 lM) in 10 mM HEPES, pH 7.5. The absorbent change at 620 nm is used as an index for Zn2? transfer from Zn-Zinco to re-HDT. b Determination of the binding constant of the zinc-b site in Zn2?-HDT by PAR. (d) Zn2?-HDT, (!) Re-HDT. 1 lM Zn2?-HDT or 1 lM re-HDT was titrated with PAR (1–35 lM) in 10 mM HEPES, pH 7.5, respectively. The increase of the absorbance at 500 nm was regarded as the formation of Zn(PAR)2 complex

Figure 5b shows that the optical absorption at 500 nm is gradually increased with the addition of PAR due to the formation of Zn(PAR)2 complex. The absorbance increment at 500 nm implies the transfer of Zn2? at zinc-b site from the Zn2?-HDT to PAR. The same equation can be obtained as follows:

Circular dichroism (CD) is often used to evaluate whether the secondary and tertiary structures of a protein are changed under various conditions. Figure 6a shows the far-UV CD spectra of the re-HDT in the absence and presence of Zn2?. They display the characteristic spectra of a mainly b-sheet structure with a negative peak at 215 nm (Mishima et al. 2006). The data is consistent with our previous work that the three dimensional structure of the reHDT is rich in b-sheet (Zhang et al. 2008). The negative peak is diminished by gradually adding Zn2? ion, indicating that binding of Zn2? to zinc-b site induces a modification of the re-HDT secondary structure, resulting in the decrease of b-sheet content in the enzyme. Fluorescence spectra reflect the state of intrinsic fluorescent residues as a reliable indicator of protein conformation changes. Figure 6b shows that the fluorescence spectra of the re-HDT exhibit a maximum emission at about 337 nm, which is a characteristic of tryptophan residues buried inside a protein (Vlasova and Ugarova 2007; Zhao et al. 2004). Although there is no obvious shift (\5 nm) in maximum emission wavelength, significant differences in fluorescent intensity are observed among these three different species of HDTs. Fluorescence intensity of the Zn2? -HDT is increased by 27%, while that of the apo-HDT is quenched by 28%, compared with the fluorescence intensity of the re-HDT. A possible explanation is that Zn2?-binding on the re-HDT affects the structure of the

123

78

A

Biometals (2010) 23:71–81

However, the environment polarity of tryptophan residues may not be changed; therefore there is no obvious shift of the maximum emission wavelength. Homology modeling

B

Fig. 6 a Far-UV circular dichroism spectra of re-HDT in the presence of Zn2?. CD spectra of re-HDT (4 lM) in the presence of Zn2? were scanned in 1 mm path-length cuvette at 25"C by a Jasco spectropolarimeter J-810 under a nitrogen atmosphere. The data were recorded from 190 to 250 nm at a scan rate of 50 nm min-1. The final concentrations of Zn2? are 0 mM (1:0), 0.01 mM (1:1.5), 0.05 mM (1:7.5) and 0.1 mM (1:15), respectively. b Fluorescent spectra of re-HDT, apo-HDT and Zn2?-HDT. The concentration of all samples was 8 lM in 10 mM Tris–HCl, pH 8.0. The spectra were recorded at the excitation wavelength of 295 nm with 1 cm path-length cuvette and scanned from 290 to 400 nm at 60 nm min-1. 1, Zn2?-HDT; 2, Re-HDT; 3, Apo-HDT

enzyme molecule, which may slightly alter the microenvironment surrounding tryptophan residues, resulting in the change of fluorescence quantum efficiency.

123

SWISS-MODEL server was used to construct the three-dimensional structure model of the re-HDT via the following steps. Human dihydropyrimidinase (PDB ID: 2VR2) was selected as the template by Swissmodel and Modeller programs from templates library. The primary sequence identity between the template protein and the re-HDT from P. putida YZ26, is 52.1%, which is much higher than 30% limit generally considered to be the threshold limit for an accurate homology modeling (Marti-Renom et al. 2000). Then, the sequence of the re-HDT was aligned against the template structure, and the project file was submitted to SWISS-MODEL server. After the calculation, the resulting homology structure was evaluated employing the PyMOL program. It is found that the homology structure of the re-HDT is not only extremely similar to its template structure as expected, but also quite similar to the dihydropyrimidinase from yeast Saccharomyces kluyveri ˚ ), which has one tight zinc-a (five(r.m.s.d. = 1.3 A coordinate) and one loose zinc-b (five-coordinate). The superposition (Fig. 7b) and the sequence alignment (Fig. 7a) demonstrate that the location of Zn2?-binding residues in the dihydropyrimidinase is conserved in the re-HDT. Overlap of Zn2? binding residues (H62, H64, H255, H199, D358 and K167) of the dihydropyrimidinase with the equivalent residues of the re-HDT (H59, H61, H239, H183, D316 and K150) yielded a r.m.s.d. value on the six Ca atoms of ˚ . That suggests that the six equivalent only 0.1 A histidine residues in the re-HDT may also participate in Zn2? binding.

Discussion Microbial D-hydantoinase is one of the important enzyme sources in industrial bioconversion to D-amino acids and their derivatives (Altenbuchner et al. 2001). Although biochemists and chemists have contributed to the work on mechanisms and applications of this enzyme for several decades, some new features have being discovered from a variety of

Biometals (2010) 23:71–81

79

Fig. 7 Structural comparison between yeast dihydropyrimidinase and the re-DHT. a The sequence alignment of the dihydropyrimidinase from yeast S. kluyveri (2FTY) and the hydantoinase from P. putida YZ-26(II6). The Zn2?-binding residues are indicated by green circular shapes. b Superposition at the active sites of yeast dihydropyrimidinase (red) and

P. putida YZ-26 D-hydantoinase (green). The zinc atoms at zinc-a site and at zinc-b sites for the dihydropyrimidinase are shown as red and raspberry spheres, respectively. The putative zinc atom at zinc-a and zinc-b sites for the D-hydantoinase are show as green and lime green spheres, respectively. Water molecules are shown as blue spheres (colour online)

organisms, especially from microorganisms. Generally speaking, D-hydantoinase is thought to be a metal-dependent enzyme, which can be inhibited by addition of metal chelating reagents, for example DPA, to produce apo-enzyme. Similarly, it can also be re-activated by the addition of divalent metal ions to the apo-enzyme, such as Co2?, Mg2?, Mn2? and Zn2? (May et al. 1998a, b). It is noteworthy that Zn2? is the second most abundant transition metal in living organisms after iron, responsible for maintaining protein structure, regulating protein function and participating in catalysis. Approximately 9% structures in

Protein Data Bank (PDB) belong to Zn2?-containing enzymes. Previous reports have substantiated that divalent metal ions, especially Zn2?, play an important role in the catalytic process of D-hydantoinase, and in fact most HDTs are Zn2?-enzyme or Zn2?dependent enzyme (Jahnke et al. 1993; Abendroth et al. 2002). However, the data reported regarding Zn2? content of D-hydantoinase were quite inconsistent. For example, the hydantoinase from bovine liver or rat liver contains only one Zn2? per subunit, while the hydantoinase from Bacillus stearothermophilus or Arthrobacter aurescens has two Zn2? ions per

123

80

subunit (May et al. 1998a, b; Cheon et al. 2002). The result herein from the quantitative analysis of Zn2? content and the functional evaluation of the hydantoinase from Pseudomonas putida YZ-26 proves that this enzyme differs from those as described above. Based on our experimental data, one tight Zn2? (zinca) per subunit is mostly responsible for the substrate catalysis and the other loose Zn2? (zinc-b) per the same subunit is only essential for maintaining the protein conformation. It is shown from the Zn2? quantitative determination of the re-HDT and apo-HDT that the Zn2? at the tight site is directly proportional to the enzymatic activity, while apo-HDT has little activity, indicating that the zinc-a site plays an important role in the catalytic process. Subsequently, being confirmed by a Zn2? titration experiment of the apo-HDT, the activity recovery is related to Zn2? amount and reaches a plateau when one Zn2? is saturated for each subunit. This result demonstrated once again that only one Zn2? in the re-HDT, so called the zinc-a, participates in the enzymatic catalysis. Obviously, the apo-HDT activity was not completely recovered to the level of the re-HDT (approximately 75%) by Zn2? titration, suggesting that the removal of Zn2? results in the conformational change or partly enzymatic inactivation. In addition to the zinc-a site, the re-HDT has another loose Zn2?-binding site (zinc-b), which is different from the tight Zn2? binding site. ICP-AES analysis shows if external Zn2? is added to the re-HDT, the product, Zn2?-HDT has two Zn2? ions per subunit, which is different from the re-HDT carrying one Zn2? per subunit. Moreover, the identical activity of the reHDT and Zn2?-HDT indicates that Zn2? at zinc-b site is not essential for the enzymatic activity. In addition, the presence or absence of Zn2? for a protein is often accompanied by the protein conformational change (Erk et al. 2003). Golynskiy et al. (2005) reported that the addition of Mn2? resulted in not only a significant stabilization of MntR, but also fluorescent quenching. This structural transformation can be manifested by obvious changes in the emission fluorescence intensity and by the special adsorption of circular dichroism (CD) spectrum. In our study, Zn2?-HDT quenches the fluorescence intensity by 28% and apo-HDT increases the intensity by 27%, compared with that of re-HDT, indicating that there exists the corresponding protein structural change with respect to different Zn2? content in enzymes.

123

Biometals (2010) 23:71–81

The result is consistent with CD spectrum that zinc-b site can influence the secondary structure of the reHDT. These findings show that both zinc-a and zincb sites are all required to maintain the structure of the enzyme. Interestingly, a phenomenon has been observed that during the titration of the apo-HDT with ZnCl2, the enzyme activity was proportionally increased until Zn2? to subunit ratio reached 1:1, and after that, the enzymatic activity was no longer enhanced (Fig. 3). The result indicates that when both zinc-a and zinc-b sites are vacant, the Zn2? preferentially binds to zinc-a site and as soon as the zinc-a site is bound to Zn2?, excess Zn2? ions gradually bind to the zinc-b site. Obviously, the apparent binding constant of zinc-a site should be much higher than that of zinc-b site. Lohkamp et al. (2006) also found that at least one Zn2? is loosely bound to the HDT from S. kluyveri, based on metal exchange experiments. The larger Zn2?-binding capacity of the reHDT may be from a longer time adaptation and evolution, as well as to ensure the preferential supply of Zn2? for zinc-a site in Zn2? deficient environment. Lohkamp et al. (2006) suggested that one tight zinc-a and one loose zinc-b sites might be a general feature of HDT, which is consistent with our conclusion. Moreover, the homology comparison of the D-hydantoinase is not only similar to the gross structure of these two crystal structures as described above but also identical in their Zn2? binding sites. It shows that the Zn2? binding characteristics of this enzyme should be similar to that of these two known structures, which indicates that the binding affinity of the five-coordinate zinc-a site should be higher than that of the four-coordinate zinc-b site. In conclusion, our present work predicts that the D-hydantoinase from the strain P. putida YZ-26, which is classified and identified by this laboratory, is a new-type metal-dependent or metalloenzyme involving one mole Zn2? per one mole subunit, but it has two Zn2? binding sites, a zinc-a and a zinc-b. The zinc-a site is essential for both activity and conformation, and the zinc-b site only contributes to the protein conformation. Acknowledgment We acknowledge that this project is supported by the Natural Science Foundation of Shanxi province in China (No. 031042).

Biometals (2010) 23:71–81

References Abendroth J, Niefind K, May O, Siemann M, Syldatk C, Schomburg D (2002) The structure of L-hydantoinase from Arthobacter aurescens leads to an understanding of dihydropyrimidinase substrate and enantio specificity. Biochemistry 41:8589–8597 Altenbuchner J, Siemann-Herzberg M, Syldatk C (2001) Hydantoinases and related enzymes as biocatalysts for the synthesis of unnatural chiral amino acids. Curr Opin Biotechnol 12:559–563 Armas A, Sonois V, Mothes E, Mazarguil H, Faller P (2006) Zinc(II) binds to the neuroprotective peptide humanin. J Inorg Biochem 100:1672–1678 Brooks KP, Jones EA, Kim BD, Sander EG (1983) Bovine liver dihydropyrimidine amidohydrolase: purification, properties, and characterization as a zinc metalloenzyme. Arch Biochem Biophys 226:469–483 Cheon YH, Kim HS, Han KH, Abendroth J, Niefind K, Schomburg D, Wang J, Kim Y (2002) Crystal structure of D-hydantoinase from Bacillus stearothermophilus: insight into the stereochemistry of enantioselectivity. Biochemistry 41:9410–9417 Cheon YH, Park HS, Lee SC, Lee DE, Kim HS (2003) Structure-based mutational analysis of the active site residues of D-hydantoinase. J Mol Catal B 26:217–222 Erk I, Huet JC, Duarte M, Duquerroy S, Rey F, Cohen J, Lepault J (2003) A zinc ion controls assembly and stability of the major capsid protein of rotavirus. Virol J 77:3595–3601 Gojkovic Z, Rislund L, Andersen B, Sandrini MPB, Cook PF, Schnackerz KD, Pisˇkur J (2003) Dihydropyrimidine amidohydrolases and dihydroorotases share the same origin and several enzymatic properties. Nucleic Acids Res 31:1683–1692 Golynskiy MV, Davis TC, Helmann JD, Cohen SM (2005) Metal-induced structural organization and stabilization of the metalloregulatory protein MntR. Biochemistry 44: 3380–3389 Huang DTC, Thomas MAW, Christopherson RI (1999) Divalent metal derivatives of the hamster dihydroorotase domain. Biochemistry 38:9964–9970 Jahnke K, Podschun B, Schnackerz KD, Kautz J, Cook PF (1993) Acid–base catalytic mechanism of dihydropyrimidinase from pH studies. Biochemistry 32:5160–5166 Kikugawa M, Kaneko M, Fujimoto-Sakata S, Maeda M, Kawasaki K, Takagi T, Tamaki N (1994) Purification, characterization and inhibition of dihydropyrimidinase from rat liver. Eur J Biochem 219:393–399 Lohkamp B, Andersen B, Pisˇkur J, Dobritzsch D (2006) The crystal structures of dihydropyrimidinases reaffirm the close relationship between cyclic amidohydrolases and explain their substrate specificity. J Biol Chem 281: 13762–13776

81 Marti-Renom MA, Stuart AC, Fiser A, Sanchez R, Melo F, Sali A (2000) Comparative protein structure modeling of genes and genomes. Annu Rev Biophys Biomol Struct 29:291–325 May O, Siemann M, Siemann MG, Syldatk C (1998a) The hydantoin amidohydrolase from Arthrobacter aurescens DSM 3745 is a zinc metalloenzyme. J Mol Catal B 5:367– 370 May O, Siemann M, Siemann MG, Syldatk C (1998b) Catalytic and structural function of zinc for the hydantoinase from Arthrobacter aurescens DSM 3745. J Mol Catal B 4:211–218 Mishima T, Ohkuri T, Monji A, Imoto T, Ueda T (2006) Amyloid formation in denatured single-mutant lysozymes where residual structures are modulated. Protein Sci 15:2448–2452 Niu LX, Zhang XY, Shi YW, Yuan JM (2007) Subunit dissociation and stability alteration of D-hydantoinase deleted at the terminal amino acid residue. Biotechnol Lett 29: 303–308 Pozo C, Rodelas B, de la Escalera S, Gonza´lez-Lo´pez J (2002) D, L-Hydantoinase activity of an Ochrobactrum anthropi strain. J Appl Microbiol 92:1028–1034 Shaw CF III, Savas MM, Petering DH (1991) Ligand substitution and sulfhydryl reactivity of metallothionein. Methods Enzymol 205:401–414 Shi YW, Niu LX, Feng X, Yuan JM (2006) Purification, enzymatic properties of a recombinant D-hydantoinase and its dissociation by zinc ion. World J Microbiol Biotechnol 22:675–680 Shi YW, Zhang L, Yuan JM, Xiao H, Yang XQ, Niu LX (2008) Zinc binding site in PICK1 is dominantly located at the CPC motif of its PDZ domain. J Neurochem 106:1027– 1034 Vieille C, Zeikus GJ (2001) Hyperthermophilic enzymes: sources, uses, and molecular mechanisms for thermostability. Microbiol Mol Biol Rev 65:1–43 Vlasova TN, Ugarova NN (2007) Quenching of the fluorescence of Tyr and Trp residues of firefly luciferase from Luciola mingrelica by the substrates. Biochemistry (Moscow) 72:962–967 Xu Z, Liu Y, Yang Y, Jiang W, Arnold E, Ding J (2003) Crystal structure of D-hydantoinase from Burkholderia pickettii at a resolution of 2.7 Angstroms: insights into the molecular basis of enzyme thermostability. J Bacteriol 185:4038–4049 Zhang XY, Niu LX, Shi YW, Yuan JM (2008) The flexibility of the non-conservative region at the C terminus of Dhydantoinase from Pseudomonas putida YZ-26 is extremely limited. Appl Biochem Biotechnol 144:237–247 Zhao GH, Pu P, Hu XS, Zhao L (2004) Effect of Zn(II) on the structure and biological activity of natural b-NGF. Acta Biochim Biophys Sin 36:99–104

123

Biometals (2010) 23:83–92 DOI 10.1007/s10534-009-9268-6

Cadmium effects on p38/MAPK isoforms in MDA-MB231 breast cancer cells Caterina Casano Æ Maria Agnello Æ Rosalia Sirchia Æ Claudio Luparello

Received: 18 June 2009 / Accepted: 9 September 2009 / Published online: 15 September 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Emerging evidence seems to indicate that the heavy metal cadmium (Cd) is able to regulate gene expression, drastically affecting the pattern of transcriptional activity in normal and pathological eukaryotic cells, also affecting intracellular signalization events. Human p38 is a family of mitogenactivated protein kinases consisting of four isoforms (a, b, c and d) which mediate signal transduction cascades controlling several aspects of cell physiology. In this study we examined whether exposure of MDA-MB231 tumor cells from the human breast to Cd may exert some effect on p38 isoform expression and accumulation, as well as on p38 activation. Employing a combination of proliferation tests, conventional and semiquantitative multiplex (SM)polymerase chain reaction (PCR) and Western blot assays, we report that the treatment of breast cancer cells with 5 lM CdCl2 induces a diversified modulation of the transcription patterns of p38 isoform genes and of the accumulation of the related protein products, which are, on the other hand, also affected by a and b isoform functional inactivation induced by SB203580. Our findings suggest the existence of so far unexplored mechanisms of gene regulation in our model system and validate that MDA-MB231 cell line is a suitable in vitro model for further and more C. Casano ! M. Agnello ! R. Sirchia ! C. Luparello (&) Dipartimento di Biologia Cellulare e dello Sviluppo, Universita`, Viale delle Scienze, 90128 Palermo, Italy e-mail: [email protected]

detailed studies on the intracellular mechanisms underlying the control of p38 expression, synthesis and activation in mammary tumor cells exposed to different stresses. Keywords Cadmium ! SB203580 ! p38 isoforms ! p38 activation ! Gene expression

Introduction The heavy metal cadmium (Cd) is an industrial and environmental pollutant mostly released as an air contaminant from fertilisers and in the form of wastewater. It is not essential for the human body and has no known useful biological functions; its uptake appears to be mediated by the voltage-sensitive Ca?? channels of the plasma membrane and, once accumulated within eukaryotic cells, due to its chemical similarity to zinc (Zn) it binds with high affinity to the Zn-binding domains of several metalloproteins, interfering with or preventing Zn-dependent cellular functions from being completed (Le´vesque et al. 2008; Beyersmann and Hartwig 2008). The most common targets of Cd toxicity are known to be the renal, skeletal, vascular, nervous and respiratory systems; in addition, it is classified within group I of carcinogens by the International Agency of Research on Cancer (IARC 1993), playing a role in both the initiation of cancer, by activating oncogenes,

123

84

and in the progression of cancer. On the other hand, a number of data has demonstrated its ability to promote apoptosis not only in normal cells but also in some tumoral cytotypes (Rana 2008). Recently, emerging evidence seems to indicate that Cd is capable of regulating gene expression, drastically affecting the pattern of transcriptional activity in both prokaryotic and lower/upper eukaryotic cells, under normal and pathologic conditions (e.g., Bertin and Averbeck 2006, for review). Some of us have recently demonstrated that Cd is able to affect to a different extent the pattern of transcriptional activity, as well as the mitochondria-related activities, of MDA-MB231 adenocarcinoma cells and HB2 immortalized epithelial cells derived from the human breast (Sirchia et al. 2006, 2008; Luparello et al. 2007; Cannino et al. 2008, 2009). In particular, concerning estrogen-receptor-negative and p53-defective MDAMB231 cells, when exposed to 5 lM CdCl2, corresponding to the median inhibition concentration (IC50) after long-term incubation (96 h) and also to levels encountered in occupational exposure, various prominent changes were found in the expression levels of stress response genes, such as those coding for some heat shock proteins (hsp) and metallothionein isoforms, and of some other genes coding for factors and enzymes involved in the onset of apoptosis. Human p38 is a family of mitogen-activated protein kinases (MAPK) that, once activated via double phosphorylation of Y and T amino acids present in the T 9 Y motif of their activation loop in the catalytic domain, mediate signal transduction cascades that are mostly triggered by different stimuli of cellular stress (Torres and Forman 2003). p38/MAPKs are known to be involved in normal cell physiology, controlling chromatin remodelling, DNA methylation and cell transcriptional pattern, as well as regulating cell cycle, its checkpoints and life/death cell decisions; on the other hand, different pathologies are to be ascribed to MAPK dysregulation, such as gastric and colorectal cancer, rheumatoid arthritis, amyotrophic lateral sclerosis and defective myogenesis (Bendotti et al. 2005; Westra and Limburg 2006; Perdiguero et al. 2007; Wang and Fang 2007). Four isoforms of human p38/MAPKs, i.e., a, b, c and d, have been described. Among them, the first two have been proven to be expressed in an ubiquitous way, whilst the c and d isoforms display tissue-specific expression, the former being most abundant in skeletal muscle

123

Biometals (2010) 23:83–92

whereas the latter in testes, pancreas, kidney and small intestine (Thornton and Rincon 2009). It is also acknowledged that the diverse p38 isoforms show a different affinity for upstream activators and downstream effectors. As far as breast cancer cells are concerned, the only literature data available on p38 isoform functions refers to their differential ability to activate the activator protein-1 (AP-1)-mediated processes, to regulate the production of extracellular enzymes and cell motility, as well as to exert antagonistic effects on Ras transformation and stress response and to control serum withdrawal-induced cyclooxygenase-2 mRNA levels (Jang et al. 2000; Pramanik et al. 2003; Suarez-Cuervo et al. 2004; Qi et al. 2007). Thus, although fragmentary data has appeared in the literature suggesting a complexity of p38 isoform activities, still much remains to be determined in order to have a complete understanding of their specific roles. The cytokine-suppressive anti-inflammatory drugs (CSAID), such as SB203580, are pyridinylimidazole compounds which selectively inhibit p38/MAPK by competitive binding in the ATP pocket. Noteworthy, a diversified effect was reported for SB203580 on the different p38 isoforms, being equipotent against p38a and p38b whilst ineffective or weakly effective against p38c, p38d as well as JNK (with the possible exception of 2b1 isoform) and Erk2 (Lee et al. 2000), thereby constituting a helpful tool for the investigation of the specific involvement of p38 isoforms in biological events. Increasing evidence has highlighted the ability of Cd to rapidly activate p38/MAPK (e.g., Miguel et al. 2005; Kim et al. 2008); on the other hand, concerning isoform involvement the only literature reports available are about a differential regulation on Cdinduced hsp70 and heme oxygenase-1 expression by mouse embryo stem cells and MCF-7 human breast cancer cells, respectively (Nishitai and Matsuoka 2008; Alam et al. 2000). In light of both the literature data and the results obtained suggesting an active role played by Cd on MDA-MB231 cells, in this study we extended our investigation to examine whether exposure of this cell line to the heavy metal could also exert some effect on p38 isoform expression and accumulation, as well as on p38 activation. Employing a combination of proliferation tests, conventional and semiquantitative multiplex (SM)-polymerase chain reaction (PCR) and

Biometals (2010) 23:83–92

85

Western blot assays, we report that the treatment of breast cancer cells with 5 lM CdCl2 induces a diversified modulation of the transcription patterns of p38 isoform genes and of the accumulation of the related protein products, which are, on the other hand, also affected by a and b isoform functional inactivation induced by SB203580, thereby suggesting the existence of so far unexplored mechanisms of gene regulation in our model system.

Viability and proliferation assays

Materials and methods

For the evaluation of cell viability/growth behaviour we submitted trypsinized control and treated MDAMB231 cells to counting using a Bu¨rker chamber. In parallel, cells were also seeded in 96-well tissue culture plates and submitted to CellTiter 96# AQueous NonRadioactive Cell Proliferation assay (Promega, Madison, WI, USA); the absorbance of formazan produced by reduction of MTS [3-(4,5-dimethylthiazol-2-yl)-5(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] compound was recorded at 490 nm.

Cell cultures and treatments

RNA extraction and reverse transcription

The MDA-MB231 breast cancer cell line was routinely grown in RPMI 1640 medium plus 10% foetal calf serum, 100 U/ml penicillin, 100 lg/ml streptomycin, and 2.5 mg/l amphotericin B (Invitrogen, Carlsbad, CA, USA), at 37"C in a 5% CO2 atmosphere. For Cd treatment, MDA-MB231 cells were plated in the presence of 5 lM CdCl2 and grown for different time lapses between 24 and 96 h, as reported by Luparello et al. (2007). For SB203580 treatment, MDA-MB231 cells were pre-treated with the p38 inhibitor (Sigma, St. Louis, MO, USA) at 20 lM concentration for either 4 h or 30 min before plating in inhibitor-free culture medium as reported by Bobrovskaya et al. (2001) and Birukova et al. (2005), or seeded in SB203580containing culture medium which was maintained for the whole duration of the experiment, as reported by Zechner et al. (1997). Co-treatment was performed by seeding cells in 5 lM Cd- and 20 lM inhibitor-containing medium.

Isolation of total RNA from trypsinized control and treated MDA-MB231 cells was carried out with the RNAspin Mini RNA isolation kit (GE Healthcare, Little Chalfont, UK), following manufacturer’s instructions. The cDNAs were synthesized using SuperScript II reverse transcriptase (Invitrogen) in the presence of 100 ng random 6-mer primers (Sigma), 50 U RNase inhibitor (Promega) and 0.5 mM each of dNTPs; reverse transcription was carried out for 60 min at 42"C, followed by being treated with 2 U RNase H (USB, Cleveland, OH, USA) for 20 min at 37"C.

Table 1 Sequence of primers used for PCR amplification

Transcript detected p38a

Conventional and semi-quantitative ‘‘multiplex’’ polymerase chain reaction Conventional PCR analysis was performed using 2.5 lM of appropriate sense and antisense primers (see Table 1) obtained from Invitrogen, 1 U RedTaq DNA polymerase (Sigma)/ll, 200 lM each of dNTPs,

Oligonucleotides (50 ?30 )

References

AACCTGTCTCCAGTGGGCTCT

Hale et al. (1999)

CGTAACCCCGTTTTTGTGTCA p38b

CACCCAGCCCTGAGGTTCT

Hale et al. (1999)

AGATGCTGCTCAGGTCCTTCT p38c

ACATGAAGGGCCTCCCCG

Uddin et al. (2004)

TCTCCTTGGAGACCCTGG p38d

TGCTCGGCCATCGACAA

Hale et al. (1999)

18S

TGGCGAAGATCTCGGACTGA GGACCAGAGGCAAAGCATTTGCC

Luparello and Sirchia (2005)

TCAATCTCGGGTGGCTGAACGC

123

86

and 1 ll of the cDNA template obtained from total RNA. The thermal cycle used was a denaturation step of 94"C for 3 min, followed by 45 cycles of 94"C for 30 s, the appropriate annealing temperature for 30 s, and 72"C for 30 s. A final extension of the product was performed for 5 min at 72"C. PCR products were analysed by 2% agarose gel electrophoresis and visualized by ethidium bromide staining under UV light. For SM-PCR we followed a published protocol (e.g., Luparello and Sirchia 2005; Sirchia et al. 2008; Luparello et al. 2007) in which the species of interest is co-amplified with 18S cDNA. The intensities of the band of interest, normalized for those of 18S, were plotted as a function of cycle number and exponential regression equations fitted to the curves and were used to calculate the number of cycles necessary to reach a normalized intensity threshold value = 1 for each sample. The relative difference in abundance between two samples was taken as 2n where n is the difference between the numbers of cycles required by the samples to reach the threshold. PCR products from triplicate experiments were visualized by 2% agarose electrophoresis in the presence of ethidium bromide and, when required, band intensity evaluated with SigmaScan software (SPSS). Protein extraction, electrophoresis and immunoblot Trypsinized control and treated cells were homogenized in a lysis buffer (7 M urea, 2% Chaps, 1% immobilized pH gradient (IPG) buffer, and 10 mM DTT) containing protease inhibitors (complete, Mini, EDTA-free protease inhibition cocktail, Roche). Protein concentrations were evaluated using Bradford method, and 30 lg of samples analyzed by 10% acrylamide SDS–PAGE. The molecular masses were evaluated by comparison with a set of standard proteins (PageRulerTM Prestained Protein Ladder, Fermentas). The electrophoretic separation was performed for 1.5 h at 100 V. After the run, the proteins were transferred to Hybond-ECL nitrocellulose membranes (Amersham) using miniVE Blotter apparatus (Amersham Pharmacia Biotech), in blotting buffer (24 mM Tris, 1 M glycine, 20% methanol), at 100 mA for 12 h. Filters were pre-incubated for 2 h in a blocking solution made of TBS-T (Tris-buffered saline, 0.05% Tween 20) plus 5% non-fat dried milk, washed once in TBS-T, and then incubated for 1 h

123

Biometals (2010) 23:83–92

with anti-actin, rabbit polyclonal antibody (1:250 final dilution, Sigma) and overnight with the following antibodies diluted 1:600 in TBS-T: anti p38 MAPK (pT180/pY182) phospho-specific mouse monoclonal antibody (BD Bioscience, Franklin Lakes, NJ, USA), anti-p38a MAP kinase rabbit polyclonal antibody, anti-p38b MAP kinase rabbit monoclonal antibody, anti-p38c MAP kinase rabbit polyclonal antibody, and anti-p38d MAP kinase rabbit polyclonal antibody (all from Cell Signaling Inc., Danvers, MA, USA). After removal of non-specific complexes by three washes in TBS-T and two washes in TBS, the filters were incubated for 1 h with the alkaline phosphataseconjugated secondary antibody, diluted 1:7,500 in TBS. After removal of unspecific complexes by several washings with TBS, the filters were stained with BCIP/NBT (Sigma). The colorimetric signals were analyzed by ImageJ software, and then normalized with respect to the correspondent values obtained with anti-actin antibody reaction. Statistics Data is presented as mean ± s.e.m. of triplicate experiments; a software-assisted one-way ANOVA was performed (SigmaStat v.2.0, SPSS, Chicago, IL, USA) and P \ 0.05 was taken as the minimal level of statistical significance between treated and control samples.

Results CdCl2/SB203580 co-treatment reverses the decrease in the number of MDA-MB231 cells promoted by single treatments Preliminarily to the evaluation of p38 expression and accumulation/activation of the protein product, in a first set of experiments we checked whether treatment with the p38 inhibitor SB203580, either alone or in combination with 5 lM CdCl2, could somehow affect the biological behaviour of MDA-MB231 cells, by checking cell viability and proliferative behaviour. In particular, we tested the effect of different durations of exposure to SB203580, i.e., a pre-treatment for a limited time lapse, or the continuous presence of the inhibitor for the whole duration of the experiment, by performing parallel cell counting and MTS

Biometals (2010) 23:83–92

colorimetric test on control and treated cells, the latter evaluating the activity of mitochondrial dehydrogenases thereby providing information deriving from the state of cell metabolic activity. No statistically significant difference was recorded in our model system when SB203580 exposure was limited to pretreatment (data not shown), whilst the continuous presence of SB203580 in the culture medium produced effects in some single and combined treatments; thus, for all the subsequent analyses we chose to maintain cells in the presence of the inhibitor until the end of the assays. Specifically, as shown in Fig. 1, cumulative results from cell number evaluation indicated that no treatment exhibited significant difference with respect to control when observed within 72 h of incubation. Conversely, after 96 h CdCl2 promoted a decrement of the number of cells down to about 60%, as expected from previous data (Luparello et al. 2007; Sirchia et al. 2008), but, although single SB203580 treatment resulted ineffective in producing any change, to our surprise, CdCl2/SB203580 cotreatment induced a consistent increase of cell number (approx. ?50% and ?100% vs. untreated and Cdtreated cells, respectively). Interestingly, despite the absence of difference the quantity of cells obtained after direct counting of the control and SB203580treated cells, when cell metabolism was monitored by

87

MTS assay, i.e., monitoring formazan accumulation, an increase of absorbance could be detected at 96 h of incubation with SB203580 (approx. ?22% vs. untreated cells; not shown), thereby suggesting that inactivation of p38 a/b, although producing no significant effect on MDA-MB231 cell viability and growth, could in some way ameliorate their rate of mitochondrial metabolism, as also reported in other model systems (e.g., Sumida et al. 2005; Dey and Cederbaum 2007). On the other hand, by analogy with cell count data, the amount of formazan generated decreased in Cdtreated and increased in co-treated MDA-MB231 cells when compared to control cells (approx. -15% and ?15%, respectively; not shown). Only SB203580 treatment and co-treatment induce an increased activation of p38/MAPK In order to reveal the extent of p38/MAPK activation in either control, SB203580-, Cd- or co-treated MDA-MB231 cells, Western blot assays were performed in the presence of anti-bi-phosphorylated p38 antibodies. As shown in the histograms in Fig. 2, we found a statistically significant increase of p38/ MAPK activation with respect to controls only when cells were either treated with SB203580 (approx. ?0.8-folds) or co-treated (approx. ?1.5-folds). Expression of p38a, b, c and d by MDA-MB231 cells is switched-on under all the experimental conditions but to different levels

Fig. 1 Histogram showing the number of MDA-MB231 cells in the control and treated conditions, evaluated at different times of culture. Cells were plated in 24-well plates at the concentration of 2.5 9 104 cells/well in culture medium, either un-supplemented or supplemented with 5 lM CdCl2, 20 lM SB203580, or both, and grown for 24, 48, 72 or 96 h. At the end of the incubation, cells were trypsinized and counted in a Bu¨rker chamber. Data is presented as mean ± s.e.m. of triplicate experiments (n = 3). * P \ 0.05 (treated vs. control cells)

In light of both previously published (Luparello et al. 2007; Cannino et al. 2008; Sirchia et al. 2008) and present data demonstrating that treatment with 5 lM CdCl2 for 96 h actually induced transcriptional alterations in MDA-MB231 cells and that SB203580 was in some way effective in modifying cell proliferative/ metabolic behaviour, in a subsequent set of experiments we wanted to test whether modifications in the expression levels of genes coding for the isoforms of p38 MAPK could occur following the different cell treatments. To this purpose, cDNA preparations from either Cd-, SB203580- or co-treated MDA-MB231 cells and from the untreated counterpart were submitted to conventional- and SM-PCR in the presence of primers specific for the cDNAs of p38a, b, c and d. The panel in Fig. 3 representatives three independent

123

88

Fig. 2 a Representative Western immunodetection of the activated form of p38 in lysates of control (1), Cd-treated (2), SB203580-treated (3) and co-treated MDA-MB231 cells (4). Immunoreaction with anti-actin antibody was performed to check protein loading. b Histogram showing the changes of the activation levels of p38/MAPK in MDA-MB231 submitted to the different treatments, as resulted from immunoblot assays. Cell lysates were submitted to 10% acrylamide SDS–PAGE, blotted onto nitrocellulose membranes and the bands visualized by immunoreaction with the primary and secondary antibodies and staining with BCIP/NBT. Data in the histogram is presented as mean ± s.e.m. of triplicate experiments (n = 3). * P \ 0.05

experiments, and shows that in non-quantitative conventional PCR assays a positive signal was found for all the isoforms tested, indicating that such gene expressions are switched-on in all the experimental conditions under study. The cDNA preparations were then submitted to triplicate SM-PCR for semi-quantitative evaluation of the expression levels of p38/MAPKs. As shown in Fig. 4, we found that incubation of MDA-MB231 cells with CdCl2 induced the up-regulation of p38c (approx. ?7-folds), and the down-regulation of p38a and b (approx. -8 and -4-folds, respectively) with respect to the control; the treatment with SB203580, on the other hand, was active in decreasing the expression levels of p38c (approx. -2.5-folds) and, more prominently, p38b (approx. -16-folds). Co-treatment reduced the level of down-regulation of p38a and -b

123

Biometals (2010) 23:83–92

Fig. 3 PCR analysis of expression of genes coding for p38 isoforms by control (a), Cd-treated (b), SB203580-treated (c) or co-treated MDA-MB231 cells (d). Total RNA was extracted from monolayers of cells grown for 96 h, reverse transcribed and amplified in the presence of the specific primers. The amplification products were analyzed by 2% agarose electrophoresis and ethidium bromide stain

down to approx. -2- and -3.5-folds vs. the control, respectively, being the only condition capable to exert an effect, in particular up-regulatory, on p38d gene expression (approx. ?3-folds). Accumulation of p38b and c protein products in MDA-MB231 cells is differently regulated by the diverse treatments In light of the observed changes induced on p38/ MAPK isoform at a transcriptional levels, in a following set of experiments we examined whether Cd-, SB203580- and co-treatment-induced any change in p38/MAPK isoforms at protein accumulation levels in tumor cells by Western blot analysis with the specific antibodies. As shown in the panels in Fig. 5, in opposition to what we found for the corresponding mRNA, the amount of p38b protein product increased after exposure to Cd and, more prominently, SB203580 (approx. ?1.6- and ?2.2-folds, respectively); on the other hand, after co-treatment no significant difference to the control was found. Again in contrast to mRNA data, incubation with Cd resulted also in a slight but reproducible decrease of the accumulation of the protein product of p38c isoform (approx. -0.4-folds). No treatment, at least under the conditions used in our study, was able to induce any change in the accumulation of the p38a and d protein

Biometals (2010) 23:83–92

89

Fig. 4 Histograms showing changes of the expression levels of p38 isoform genes in MDA-MB231 submitted to the different treatments, as resulted from SM-PCR assays. Total RNA was extracted from monolayers of cells grown for 96 h, reverse transcribed, and the cDNAs of interest were coamplified with cDNA from 18S rRNA over a range of cycles followed by 2% agarose electrophoresis and ethidium bromide stain. The intensities of the bands of interest, evaluated with SigmaScan software, were normalized for those of 18S and

plotted as a function of cycle number, and exponential regression equations fitted to the curves, and were used to calculate the number of cycles necessary to reach a normalized intensity threshold value of 1 for each sample. The relative difference in abundance between two samples was taken as 2n where n is the difference between the numbers of cycles required by the samples to reach the threshold. Data are presented as mean of triplicate experiments with no significant variation between each assay. * P \ 0.05

product, although the co-treatment (for both isoforms) and, more prominently, the exposure to Cd (for a isoform) were previously found to exert a restraining effect at gene expression level.

systems exposed to Cd. Concerning breast cancer cells, it is acknowledged that in estrogen-receptor positive cells, such as MCF-7, the metal acts as an estrogen-mimetic compound, thereby promoting cell proliferation and inducing the expression of hormonedependent genes (e.g., Garcia-Morales et al. 1994). On the other hand, we have already demonstrated that exposure of p53- and estrogen-receptor-negative MDA-MB231 tumor cells to CdCl2 also causes a number of biological consequences, such as drastic changes in the expression level of several genes and in some mitochondrial activities including mitochondrial protein import (Sirchia et al. 2006, 2008; Luparello et al. 2007; Cannino et al. 2008). To extend our knowledge on the effects of Cdbreast tumor cell interactions, here we have submitted MDA-MB231 cells to exposure to CdCl2 at a concentration corresponding to the IC50 at 96 h with and without the addition of a p38a/b inhibitor and analysed the activation rate via quantitation of the

Discussion It is now widely accepted that Cd intervenes in the biological behaviour of numerous cytotypes by stimulating the stress response and/or the switching-on of apoptotic mechanisms, and also being a powerful promoter of neoplastic transformation. The complexity and diversity of the molecular events underlying cell-metal interactions are responsible for the data fragmentation and poor knowledge of the intracellular pathways involved in each experimental situation; nevertheless, significant indications are surely emerging from the evaluation of gene expression and protein accumulation patterns in the different cell model

123

90

Fig. 5 a Representative Western immunodetection of the different p38 isoforms in lysates of control (1), Cd-treated (2), SB203580-treated (3) and co-treated MDA-MB231 cells (4). Immunoreaction with anti-actin antibody was performed to check protein loading. b Histogram showing the changes of the accumulation levels of the different p38 isoforms in MDAMB231 submitted to the different treatments, as a result of immunoblot assays. Cell lysates were submitted to 10% acrylamide SDS–PAGE, blotted onto nitrocellulose membrane and the bands visualized by immunoreaction with the primary and secondary antibodies and staining with BCIP/NBT. Data in the histogram are presented as mean ± s.e.m. of triplicate experiments (n = 3). * P \ 0.05

phosphorylated form of p38/MAPK as well as the expression levels of the four p38 isoforms and the accumulation of the related protein products. The data obtained indicates that only incubations with SB203580 or SB203580/CdCl2 are able to augment the extent of activation of the intracellular pool of p38/MAPK, indicating that the absence of active a and/or b isoforms is a positive signal to increase the extent of phosphorylation of the isoforms. On the other hand, all the treatments performed in the present study affected the expression/ accumulation of the isoforms, although in diversified ways; moreover, in some cases the regulation at gene expression and protein production levels appeared opposite, thereby suggesting the occurrence of control feedbacks which still have to be determined.

123

Biometals (2010) 23:83–92

Further studies will be required to assess which isoforms are phosphorylated in response to each specific treatment and to define a precise model for the specific molecular mechanisms involving p38/ MAPKs through which Cd accomplishes its cellular effects; however, the data we present allows the following comments. The incubation with only SB203580 was found to induce an increase of dehydrogenase activity and the down-regulation of one of the two inactivated p38 isoforms, i.e., p38b, which, on the other hand underwent higher accumulation at protein level, whereas no effect was exerted on the other inhibited isoform, i.e., p38a. This suggests the existence of a positive transcriptional regulatory mechanism requiring the presence of active a and/or b isoform and adds a new example to the list of the effects which have been reported as a consequence to p38a/b inactivation by SB203580 treatment. The inhibitor, in fact, was already proven to stabilize cyclooxygenase-2 mRNA, up-regulate endoplasmic reticulum protein 29 (ERp29) and VEGF, down-regulate urokinase, and decrease both basal and TGFb1-triggered metalloprotease-9 activity by this cell line, and to negatively affect its in vivo invasiveness in a mouse model of bone metastasis (Jang et al. 2000; Suarez-Cuervo et al. 2004; Liu and Mueller 2006; Bambang et al. 2009). Interestingly, Cd treatment was active in modifying the expression levels of p38a, b and c whilst only for the last isoform a variation in the extent of protein accumulation was recorded. To our knowledge, this is the first reported evidence that Cd affects the levels of transcription and of protein synthesis in some p38 isoforms. It is known that expression of p38c in MDAMB231 cells is switched-on by Ras, and that p38c protein is one of the effectors of Ras which is known to play a critical role relating to breast cancer malignancy, i.e., stimulating Matrigel cell invasion by the same cell line (Qi et al. 2006). Preliminary results obtained by some of us (Luparello et al., in press) have demonstrated that Cd-treated MDAMB231 cells display a massive decrease of their invasive potential in Matrigel; thus, a hypothesis which requires further validation could be that Cd realizes the observed anti-invasive role via p38c depletion. On the other hand, in light of the massive changes in gene expression levels and mitochondrial activities triggered in these cells by the concentration of the metal and the duration of the incubation chosen

Biometals (2010) 23:83–92

(Sirchia et al. 2006, 2008; Luparello et al. 2007; Cannino et al. 2008), an involvement, at least partial, in the under-production of p38c in such cellular events, although still unproven, cannot be excluded. When the SB203580/CdCl2 co-treatment was performed, the presence of the inhibitor was capable of reversing the anti-proliferative effect of the metal on MDA-MB231 cells, also determining an increase of cell number with respect to untreated controls. This is a clear indication that Cd-triggered inhibitory effects on cell growth, and conceivably other intracellular changes related to Cd toxicity, require that p38a and/or b are in the activated state and capable to interact, in turn, with their downstream targets. Interestingly, in line with our results, SB203580 was demonstrated to function as a pro-survival factor counteracting the lethal effect exerted by both aplidin and asiatic acid on MDA-MB231 cells (Cuadrado et al. 2003; Hsu et al. 2005). Concerning p38 isoforms, in the case of co-treatment the amount of p38b returned to control levels and this was coupled to the transcriptional switching-on of p38d gene. Noticeably, MDA-MB468 and MCF-7 breast cancer cells p38b and -d were shown to, respectively, promote and inhibit AP-1 transcription factor, whose activity is linked to the regulation of many target genes implicated in cell proliferation and cell cycle progression (Pramanik et al. 2003). On the basis that the net response in cells expressing all p38 isoforms is ruled by integrations of the positive (p38b) and the negative (p38d) AP-1 regulatory signalling, co-treatment could therefore interfere with the latter one via unbalancing this ratio towards activation of AP-1dependent pathways. In conclusion, we have presented an analysis in the gene and protein expression levels of the effect of Cd exposure on p38/MAPKs in a human breast cancer cell line, with the presence of, or not, inactivation of a and b isoforms. Although much remains to be determined at isoform transcriptional and activation levels, the diverse responses to the different treatments reported here strongly suggest that the various isoforms of p38 are subjected to complex molecular mechanisms of gene regulation and validate that the MDA-MB231 cell line is a suitable in vitro model for further and more detailed studies on the intracellular mechanisms underlying the control of p38 expression, synthesis and activation in mammary tumor cells exposed to different stresses.

91 Acknowledgements This work has been supported by grants from MIUR (Cofin 2004) and the University of Palermo (ex60%).

References Alam J, Wicks C, Stewart D et al (2000) Mechanism of heme oxygenase-1 gene activation by cadmium in MCF-7 mammary epithelial cells. Role of p38 kinase and Nrf2 transcription factor. J Biol Chem 275:27694–27702 Bambang IF, Lu D, Li H, Chiu LL, Lau QC, Koay E, Zhang D (2009) Cytokeratin 19 regulates endoplasmic reticulum stress and inhibits ERp29 expression via p38 MAPK/ XBP-1 signaling in breast cancer cells. Exp Cell Res 315:1964–1974 Bendotti C, Bao Cutrona M, Cheroni C et al (2005) Inter- and intracellular signaling in amyotrophic lateral sclerosis: role of p38 mitogen-activated protein kinase. Neurodegener Dis 2:128–134 Bertin G, Averbeck D (2006) Cadmium: cellular effects, modifications of biomolecules, modulation of DNA repair and genotoxic consequences. Biochimie 88:1549–1559 Beyersmann D, Hartwig A (2008) Carcinogenic metal compounds: recent insight into molecular and cellular mechanisms. Arch Toxicol 82:493–512 Birukova AA, Birukov KG, Gorshkov B, Liu F, Garcia JG, Verin AD (2005) MAP kinases in lung endothelial permeability induced by microtubule disassembly. Am J Physiol Lung Cell Mol Physiol 289:L75–L84 Bobrovskaya L, Odell A, Leal RB, Dunkley PR (2001) Tyrosine hydroxylase phosphorylation in bovine adrenal chromaffin cells: the role of MAPKs after angiotensin II stimulation. J Neurochem 78:490–498 Cannino G, Ferruggia E, Luparello C, Rinaldi AM (2008) Effects of cadmium chloride on some mitochondria-related activity and gene expression of human MDA-MB231 breast tumor cells. J Inorg Biochem 102:1668–1676 Cannino G, Ferruggia E, Luparello C, Rinaldi AM (2009) Mitochondrial compartment: a possible target of cadmium effects on breast epithelial cells. Mol Cell Biochem. doi 10.1007/s11010-009-0034-4 Cuadrado A, Garcia-Fernandez LF, Gonzalez L et al (2003) Aplidin induces apoptosis in human cancer cells via glutathione depletion and sustained activation of the epidermal growth factor receptor, Src, JNK, and p38 MAPK. J Biol Chem 278:241–250 Dey A, Cederbaum AI (2007) Geldanamycin, an inhibitor of Hsp90 increases cytochrome P450 2E1 mediated toxicity in HepG2 cells through sustained activation of the p38MAPK pathway. Arch Biochem Biophys 461:275–286 Garcia-Morales P, Saceda M, Kenney N et al (1994) Effect of cadmium on estrogen receptor levels and estrogeninduced responses in human breast cancer cells. J Biol Chem 269:16896–16901 Hale KK, Trollinger D, Rihanek M, Manthey CL (1999) Differential expression and activation of p38 mitogen-activated protein kinase alpha, beta, gamma, and delta in inflammatory cell lineages. J Immunol 162:4246–4252

123

92 Hsu YL, Kuo PL, Lin LT, Lin CC (2005) Asiatic acid, a triterpene, induces apoptosis and cell cycle arrest through activation of extracellular signal-regulated kinase and p38 mitogen-activated protein kinase pathways in human breast cancer cells. J Pharmacol Exp Ther 313:333–344 IARC (1993) Chemicals, groups of chemicals, complex mixtures, physical and biological agents and exposure circumstances to be evaluated in future. IARC Monographs, Report of an ad-hoc Working Group, Lyon, France Jang BC, Sanchez T, Schaefers HJ et al (2000) Serum withdrawal-induced post-transcriptional stabilization of cyclooxygenase-2 mRNA in MDA-MB-231 mammary carcinoma cells requires the activity of the p38 stressactivated protein kinase. J Biol Chem 275:39507–39515 Kim SM, Park JG, Baek WK et al (2008) Cadmium specifically induces MKP-1 expression via the glutathione depletionmediated p38 MAPK activation in C6 glioma cells. Neurosci Lett 440:289–293 Lee JC, Kumar S, Griswold DE, Underwood DC, Votta BJ, Adams JL (2000) Inhibition of p38 MAP kinase as a therapeutic strategy. Immunopharmacology 47:185–201 Le´vesque M, Martineau C, Jumarie C, Moreau R (2008) Characterization of cadmium uptake and cytotoxicity in human osteoblast-like MG-63 cells. Toxicol Appl Pharmacol 231:308–317 Liu Y, Mueller BM (2006) Protease-activated receptor-2 regulates vascular endothelial growth factor expression in MDA-MB-231 cells via MAPK pathways. Biochem Biophys Res Commun 344:1263–1270 Luparello C, Sirchia R (2005) Type V collagen regulates the expression of apoptotic and stress response genes by breast cancer cells. J Cell Physiol 202:411–421 Luparello C, Sirchia R, Paci L (2007) Response to cadmium stress by neoplastic and immortalized human breast cells: evidence for different modulation of gene expression. In: Corvin AJ et al (eds) New developments in cell apoptosis research. Nova Science Publishers, Hauppauge, NY, USA, pp 213–239 Miguel BG, Rodriguez ME, Aller P, Martinez AM, Mata F (2005) Regulation of cadmium-induced apoptosis by PKC delta in U937 human promonocytic cells. Biochim Biophys Acta 1743:215–222 Nishitai G, Matsuoka M (2008) Differential regulation of HSP70 expression by the JNK kinases SEK1 and MKK7 in mouse embryonic stem cells treated with cadmium. J Cell Biochem 104:1771–1780 Perdiguero E, Ruiz-Bonilla V, Serrano AL, Mun˜oz-Ca´noves P (2007) Genetic deficiency of p38alpha reveals its critical role in myoblast cell cycle exit: the p38alpha-JNK connection. Cell Cycle 6:1298–1303 Pramanik R, Qi X, Borowicz S et al (2003) p38 isoforms have opposite effects on AP-1-dependent transcription through regulation of c-Jun. The determinant roles of the isoforms

123

Biometals (2010) 23:83–92 in the p38 MAPK signal specificity. J Biol Chem 278:4831–4839 Qi X, Tang J, Loesch M, Pohl N, Alkan S, Chen G (2006) p38gamma mitogen-activated protein kinase integrates signaling crosstalk between Ras and estrogen receptor to increase breast cancer invasion. Cancer Res 66:7540– 7547 Qi X, Pohl NM, Loesch M et al (2007) p38alpha antagonizes p38gamma activity through c-Jun-dependent ubiquitin– proteasome pathways in regulating Ras transformation and stress response. J Biol Chem 282:31398–31408 Rana SV (2008) Metals and apoptosis: recent developments. J Trace Elem Med Biol 22:262–284 Sirchia R, Re S, Muratore G, Savona R, Casano C, Luparello C (2006) Cadmium effect on gene expression by MDAMB231 breast cancer cells: evidence for down-regulation of AEG-1. Cell Biol Int 30:e16 Sirchia R, Longo A, Luparello C (2008) Cadmium regulation of apoptotic and stress response genes in tumoral and immortalized epithelial cells of the human breast. Biochimie 90:1578–1590 Suarez-Cuervo C, Merrell MA, Watson L et al (2004) Breast cancer cells with inhibition of p38alpha have decreased MMP-9 activity and exhibit decreased bone metastasis in mice. Clin Exp Metastasis 21:525–533 Sumida T, Otani H, Kyoi S et al (2005) Temporary blockade of contractility during reperfusion elicits a cardioprotective effect of the p38 MAP kinase inhibitor SB-203580. Am J Physiol Heart Circ Physiol 288:H2726–H2734 Thornton TM, Rincon M (2009) Non-classical p38 map kinase functions: cell cycle checkpoints and survival. Int J Biol Sci 5:44–52 Torres M, Forman HJ (2003) Redox signaling and the MAP kinase pathways. Biofactors 17:287–296 Uddin S, Ah-Kang J, Ulaszek J, Mahmud D, Wickrema A (2004) Differentiation stage-specific activation of p38 mitogen-activated protein kinase isoforms in primary human erythroid cells. Proc Natl Acad Sci USA 101:147– 152 Wang X, Fang JY (2007) MAPK signalling pathways as targets for gastrointestinal cancer therapy: from laboratory to clinical trials. In: Meyers JN (ed) Trends in signal transduction research. Nova Science Publishers, Hauppauge, NY, USA, pp 115–143 Westra J, Limburg PC (2006) p38 mitogen-activated protein kinase (MAPK) in rheumatoid arthritis. Mini Rev Med Chem 6:867–874 Zechner D, Thuerauf DJ, Hanford DS, McDonough PM, Glembotski CC (1997) A role for the p38 mitogen-activated protein kinase pathway in myocardial cell growth, sarcomeric organization, and cardiac-specific gene expression. J Cell Biol 139:115–127

Biometals (2010) 23:93–98 DOI 10.1007/s10534-009-9270-z

Effect of copper on the activation of the acid phosphatase from the green algae Pseudokirchneriella subcapitata Claudio Martı´n Jonsson Æ Hiroshi Aoyama

Received: 13 March 2009 / Accepted: 9 September 2009 / Published online: 19 September 2009 ! Springer Science+Business Media, LLC. 2009

Abstract The presence of copper in water environment may have detrimental effects on aquatic organisms, including algae, where different enzymatic systems can be affected. Algae acid phosphatase plays important roles in metabolic processes such as decomposition of organic phosphate, autophagic digestive process, recycling cellular materials and zygote formation during reproduction. This work describes an in vitro activation effect of copper on the acid phosphatase of the green algae Pseudokirchneriella subcapitata (formely Selenastrum capricornutum) under preincubation condition. Apparent Michaelis constant values of 1.21 and 0.37 mM, and activation energy values of 26.8 and 13.6 kJ mol-1 were determined in the absence and in the presence of 0.2 mM Cu2?, respectively. The dissociation constant value for Cu2? binding to the enzyme was determined to be 22.04 lM. The decrease of the apparent Michaelis constant (Km) and activation energy values in the presence of Cu2? correlates well with its activating effect on the acid phosphatase activity. This propriety could be used as C. M. Jonsson (&) Embrapa Meio Ambiente, CP 69, Rod. SP 340, Km 127,5, 13820-000 Jaguariu´na, Sa˜o Paulo, Brazil e-mail: [email protected] H. Aoyama Departamento de Bioquı´mica, Instituto de Biologia, Universidade Estadual de Campinas, 13083-970 Campinas, Sa˜o Paulo, Brazil

a sensitive bioindicator for copper in environmental samples. Keywords Enzyme ! Phytoplankton ! Toxicity ! Fungicide ! Metal ! Selenastrum capricornutum

Introduction There has been an increasing interest in studying the action of metal on enzyme activity and in using their biochemical changes in the aquatic biota as an index of metal toxicity (Lan et al. 1995). In this context, copper, an essential metal ion, has been intensively studied as a potential toxic compound (Gill et al. 1992, Guasch et al. 2002). This element is widely used in agriculture to control fungal diseases and its increasing concentration in the environment has been attributed to mining operations, sewage sludge disposal and industrial discharges (WHO 1998). Copper sulphate has also been used in the control of natural phytoplanktonic communities (Larsen et al. 2003; Le Jeune et al. 2006). The increase of availability and potential toxicity of copper in water may have detrimental effects on aquatic organisms including algae, an important component of primary production and thus the entire aquatic food chain. Algae are able to bioconcentrate and to metabolize

123

94

several aquatic pollutants like insecticides and polycyclic aromatic hydrocarbons (Warshawsky et al. 1995; Jonsson et al. 2001). Pseudokirchneriella subcapitata (formely Selenastrum capricornutum), an unicellular Chlorophyceae (green) algae present in the freshwater aquatic and terrestrial compartments (Keddy et al. 1995), has been widely used in studies of pollutants effects (Jonsson et al. 1998; Okamura et al. 2002) and is recommended by regulatory national (Gherardi-Goldstein et al. 1990; Jonsson and Maia 1999) and international (OECD 1984) agencies as a test organism. Acid phosphatase (EC 3.1.3.2) plays important roles in the metabolism such as decomposing organic phosphates into free phosphates and organic compounds. Several functions have been attributed to algae acid phosphatases, such as autophagic digestive processes, hydrolysis of phospholipid materials (Cooper et al. 1974), fertilization (breakdown of plasmalemma and absorption of flagella) (Braten 1975), availability of inorganic phosphate from the extracellular medium (Sommer and Blum 1965), recycling of inorganic phosphate for its reassimilation (Theodorou et al. 1991), endomembrane recycling (Domozych 1989) and spore differentiation (Tsekos and Schnepf 1991). In the freshwater algae S. tenue, the enzyme was found in the cell wall, plasmalemma and vacuole (Michetti et al. 2006). The induction of acid phosphatase activity in unicellular green algae at low N and P concentrations has been observed by Kruskopf and Du Plessis (2004). It has been reported that copper or other metal ion are needed for the catalytic action of different acid phosphatases. Vincent and Averill (1990) have observed that the oxidized form of some mammalian acid phosphatases exhibited a iron–phosphorus interaction indicating that phosphate, and presumably the phosphate esters, bound to one of both irons present in the protein. Reilly et al. (1999) demonstrated that the addition of copper restored nearly all the enzymatic activity of an acid phosphatase from Haemophilus influenzae. The acid phosphatases from the microorganisms Mycoplasma fermentans, Pseudomonas aeruginosa and Yarrowia lipolytica are enhanced in the presence of copper (Domenich et al. 1992; Noda et al. 1994; Ito et al. 2007). This last effect was also observed by Bounias et al. (1996) in the kinetic studies for alkaline and acid phosphatases present in a gut crude extract obtained from honeybees .

123

Biometals (2010) 23:93–98

The activities of algal enzymes like esterase (Franklin et al. 2001), b-D-galactosidase (Peterson and Stauber 1996), nitrate redutase, urease, ATPase (Rai and Rai 1997) and antioxidants enzymes (Li et al. 2006) were affected in presence of the metal. Previously, we reported the activator effect of copper on the activity of acid phosphatase from P. subcapitata. Also, we demonstrated that the metal behaved as a slight antagonist for the inhibitor effect of mercury on the enzyme activity (Jonsson and Aoyama 2007). In the present work, we studied the effect of copper ions on the enzyme activity from the algae. We analyzed the stability and determined dose effects and kinetic parameters in order to understand the magnitude and mechanism of metal ion–phosphatase interaction.

Materials and methods Materials p-Nitrophenylphosphate (pNPP) was obtained from Sigma Chemical Co. Stock solutions of CuSO45H2O (Merck) were prepared in Milli-Q water or in liquid medium (OECD 1984). All the other reagents were AR grade. Organisms and growth conditions Unicellular green algae Pseudokirchneriella subcapitata was maintained and subcultured in an inorganic liquid medium prepared as recommended by OECD (OECD 1984). Cultures were grown in 250 ml flasks sealed with cotton bungs and containing 200 ml of sterilized medium. The flasks were incubated in a controlled temperature chamber (20 ± 2"C) under a continuous white fluorescent light of 3,000–4,000 lux and manually shaken twice a day. Every 40–60 days, a new stock culture maintained at 4"C (in dark) was prepared by inoculating approximately 5 9 104 cells ml-1 (Jonsson and Aoyama 2007). Harvesting and preparation of extracts All centrifugation procedures were carried out at 4"C. Exponential phase organisms were harvested by centrifugation at 4,000 r.p.m. for 5 min in a Beckman J2-21 refrigerated centrifuge (rotor SER# 7644,

Biometals (2010) 23:93–98

JA-20) and washed twice with 0.1 M sodium acetate buffer, pH 5.0. The algae pellet was suspended in 0.1 M sodium acetate buffer (1:4 w/v) and the cell suspension was submitted to the cell disruption procedure for phosphatase extraction as described previously (Jonsson and Aoyama 2007): The sample was frozen at -20"C, thawed at room temperature and submitted to a probe sonication at 0"C (ice bath) for 50 s followed by 20 s interval (1 cycle) with an amplitude of 70 (Vibra Cell, Sonics Materials Inc., 45 mm tipped probe). This procedure was repetead twice. The resultant cell disrupted suspension was centrifuged at 10,000 r.p.m. for 20 min and the supernatant fluid (extract) was used for acid phosphatase activity determination. Assay of phosphatase activity Acid phosphatase activity was routinely assayed at least in duplicate by incubating the enzyme with pNPP as substrate and measuring the p-nitrophenol (pNP) produced as previously described (Prazeres et al. 2004). The enzyme activity was determined in a final volume of 1 ml containing 0.1 M sodium acetate buffer (pH 5.0) and 10 mM substrate. After incubation for 40 min at 37"C, the reaction was terminated by the addition of 1 ml of 1 M NaOH. The pNP released was measured at 405 nm in a UNICAM 8625 UV/VIS spectrophotometer. For the initial velocity (V) determination, the amount of pNP produced was calculated using a molar extintion coefficient of 18,300 M-1cm-1 (Chaimovich and Nome 1970). Units (U) of enzymatic activity are defined as lmoles of pNP released per min. Effect of Cu2?concentration The enzyme activity was determined in the absence (control) or in the presence of several copper concentrations in a range of 0.1–200 lM Cu2?. Lineweaver– Burk plot was used to determine the Cu2?-enzyme dissociation constant by plotting the velocity change (delta V) versus the reciprocal of copper concentration (1/[Cu2?]), as described by Dixon and Webb (1979).

95

Apparent Michaelis constant (Km) and maximum velocity (Vmax) determination The enzyme was preincubated in the absence or in the presence of 0.2 mM Cu2?, and after that the enzyme activity was determined, using pNPP as substrate, in a concentration range of 0.1–10.0 mM. The apparent Km and Vmax values were calculated from Lineweaver–Burk plot. Activation energy determination The enzyme activity was determined after preincubation at different temperatures (27, 32, 37, 42 and 47"C) in the absence or in the presence of 0.2 mM Cu2?. The activation energy values were determined from the slopes of the Arrhenius plots (log V versus 1/T (Kelvin)), according to Dixon and Webb (1979). Data analysis The results were analyzed by a Simples Regression program with a Statgraphics# Plus Version 2 software package.

Results In vitro effect of copper on P. subcapitata acid phosphatase activity A remarkable increase in pNPP dephosphorylation was observed in the presence of Cu2? up to a concentration of 0.05 mM, when this metal was previously incubated with the enzyme (Fig. 1). The dissociation constant (KdCu2?), for the complex Cu2?-enzyme was calculated from the double reciprocal plot to be 22.04 lM (Fig. 1, inset). In contrast to the results described in the Fig. 1, no significant enzyme activity changes were observed in the presence of Cu2? without preincubation (results not shown).

Enzyme stability

Stability of acid phosphatase in the presence of copper

The enzyme activity was determined after preincubation at 37"C for 0, 20, 40 and 60 min in the absence or in the presence of 0.2 mM Cu2?.

The enzyme was stable for at least 60 min at 37"C when preincubated in the presence of 0.2 mM Cu2?. In contrast, a loss of acid phosphatase activity of

123

96

Biometals (2010) 23:93–98 0.8

300

0.7

Absorbance (405 nm)

250

200

1/delta V (mU.mL-1)-1

Relative activity

10

150

100

8 6 4 2 0 -100

50

0

-50

0 50 100 1/ [Cu2+] (mM-1)

0.1

0.15

150

200

0.6 0.5 0.4 0.3 0.2 0.1 0

0

0.05

0.2

0.25

0

[Cu ] (mM)

Fig. 1 Effect of copper concentration on acid phosphatase activity. The preincubation of the enzyme and Cu2?(at different concentrations) was performed for 20 min at 37"C. At the end of this period, the reaction was initiated by the addition of pNPP 10 mM as substrate, as described in Methods. The activity in the absence of Cu2? was considered as 100% (control) and the other values were determined as percentages of this value. Determination of dissociation constant for the interaction Cu2?-acid phosphatase (inset). Bars represent the standard deviations of the averages of two replicates

20

40

Fig. 2 Preincubation time course of acid phosphatase activity. The enzyme activity was determined at the indicated times by preincubation at 37"C in the absence (d) or in the presence (j) of 0.2 mM Cu2?. Bars represent the standard deviations of the averages of two replicates Table 1 Effect of Cu2?on the kinetic parameters for P. subcapitata acid phosphatasea Parameter

[Cu2?] (mM)

Km (mM)

1.21 ± 0.42

0.37 ± 0.05

Vmax (mU ml-1)

0.55 ± 0.16

0.75 ± 0.06

Activation energy (kJ mol-1)

26.8 ± 1.5

13.6 ± 3.9

0.0

about 60% was observed when the enzyme was preincubated in the absence of the metal ion (Fig. 2). Effect of Cu2?on the acid phosphatase kinetic parameters The values of apparent Km and Vmax were determined from the double reciprocal plot of Lineweaver–Burk, and the activation energy from the Arrhenius plot (not shown). These results are shown in the Table 1. In the presence of 0.2 mM Cu2?, the apparent Km value decreased from 1.21 to 0.37 mM and the activation energy from 26.8 to 13.6 kJ mol-1; no significant difference was observed for the Vmax values (0.55 and 0.75 mU ml-1).

Discussion The metallic ion Cu2? has been generally used in enzymatic systems in order to inactivate the reactions by binding to essential sulfhydryl groups located at or near the active site. In the case of acid phosphatases, we have previously reported that the enzyme purified from bovine kidney (Granjeiro et al. 1997) and from

123

60

Time (min)

2+

0.2

a

The Km and Vmax values were determined from Lineweaver–Burk plot and the activation energy from the Arrhenius plot. The standard deviations (±) represent the averages of two replicates

castor bean seed (Granjeiro et al. 1999) were inhibited 97 and 93% in the presence of 10 mM and 1 mM Cu2?, respectively. In the present work we demonstrated that Cu2? when preincubated with P. subcapitata acid phosphatase activated the pNPP-directed reaction. Lineweaver–Burk plot was used to determine the dissociation constant value for Cu2? binding to the enzyme (KdCu2?), as described by Dixon and Webb (1979) (Fig. 1, inset). Youngs et al. (2000) have also applied this method to determine the dissociation constant for the Cd-Mn-peroxidase complex. The low magnitude of the KdCu2? value (22.04 lM) obtained for the complex Cu2?-acid phosphatase indicated a strong binding capacity of this metal to the enzyme. Even after preincubation of Cu2?, and enzyme, no activation effect was observed for the acid

Biometals (2010) 23:93–98

phosphatase obtained from the algae Ochromonas danica (Patni and Aaronson 1974). However, others in vitro studies showed that acid phosphatases from crude extracts of Rizopus delemar (Tsekova and Galabova 2003) and honeybee guts (Bounias et al. 1996) were activated by Cu2?. In order to explain the reasons for the activation of the P. subcapitata acid phosphatase by Cu2?, we performed three different experiments: enzyme stability study, determination of apparent Km, and determination of activation energy, in the absence and in the presence of the metal. The presence of Cu2?promoted a protection of the P. subcapitata acid phosphatase from thermal inactivation at 37"C for at least 1 h (Fig. 2), which supports an enzyme–Cu2? interaction. Protection of enzymes by metal ions in stability studies was also described for fungal laccase by Cu2? (Baldrian and Gabriel 2002), fungal peroxidase by Cd2?and Mn2? (Youngs et al. 2000), and E. coli alkaline phosphatase by Cu2?and other metals (Trotman and Greenwood 1971). The kinetic parameter apparent Km for pNPP decreased (3.3 fold) in the presence of Cu2? (Table 1), suggesting an enhancement on the affinity enzyme-substrate by copper. Bounias et al. (1996) also described a decrease of the Km value for honeybee gut acid phosphatase contained in the crude extract in the presence of copper. The apparent Km value of 0.37 mM, obtained in the presence of Cu2?is similar to those reported for other algae species when the enzyme was assayed in a non-preincubated system and in the absence of the metal (Bennum and Blum 1966; Patni and Aaronson 1974). The decrease of the activation energy value from 26.8 to 13.6 kJ mol-1 in the presence of Cu2? (Table 1), also contributed to the activating effect of Cu2?on the P. subcapitata acid phosphatase activity. Summarizing, different factors contributed to the increase in the acid phosphatase activity in the presence of Cu2?: protection of the enzyme against thermal inactivation, increase in the enzyme-substrate affinity, and reduction of the activation energy. The high sensitivity of the enzyme crude extract to copper may be useful as a tool to detect this metal in natural waters and other environmental samples. We hope that the results presented in this work can improve the understanding of the basic events of the impact of copper at biochemical levels in primary producer organisms. Moreover, they could provide a

97

sound basis for comparison with enzymatic processes affected by other pollutants. Acknowledgements This work was supported by grants from Fundac¸a˜o de Amparo a` Pesquisa do Estado de Sa˜o Paulo (FAPESP), Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico (CNPq) and Empresa Brasileira de Pesquisa Agropecua´ria (Embrapa). The authors are grateful to Dr. Fred Y. Fujiwara (Instituto de Quı´mica, UNICAMP) for critically reading the manuscript.

References Baldrian P, Gabriel J (2002) Copper and cadmium increase laccase activity in Pleurotus ostreatus. FEMS Microbiol Lett 206:69–74. doi:10.1111/j.1574-6968.2002.tb10988.x Bennum A, Blum JJ (1966) Properties of the induced acid phosphatase and of the constitutive acid phosphatase of Euglena. Biochim Biophys Acta 128:106–123 Bounias M, Kruk I, Nectoux M, Popeskovic D (1996) Toxicology of cupric salts on honeybees. V. Gluconate and sulfate action on gut alkaline and acid phosphatases. Ecotoxicol Environ Saf 35:67–76. doi:10.1006/eesa.1996.0082 Braten T (1975) Ultrastructural localization of phosphohydrolases in gametes, zygotes and zoospores of Ulva mutabilis FØYN. J Cell Sci 17:647–653 Chaimovich H, Nome F (1970) Purification and properties of an acid phosphatase from bovine brain. Arch Biochem Biophys 139:9–16. doi:10.1016/0003-9861(70)90039-1 Cooper A, Bowen ID, Lloyd D (1974) The properties and subcellular localization of acid phosphatases in the colourless alga Polytomella caeca. J Cell Sci 15:605–618 Dixon M, Webb EC (1979) Enzymes, 3rd edn. Longmans Green and Co Ltd., London Domenich CEA, Teresita AL, Salvano MA et al (1992) Pseudomonas aeruginosa acid phosphatase: activation by divalent cations and inhibition by aluminium ions. FEBS Lett 299:96–98. doi:10.1016/0014-5793(92)80108-S Domozych DS (1989) The endomembrane system and mechanism of membrane flow in the green alga, Gloeomonas kupfferi (Volvocales, Chlorophyta) II. A cytochemical analysis. Protoplasma 149:108–119. doi:10.1007/BF0132 2983 Franklin NM, Stauber JL, Lim RP (2001) Development of flow cytometry—based algal bioassays for assessing toxicity of copper in natural waters. Environ Toxicol Chem 20:160– 170. doi:10.1897/1551-5028(2001)020\0160:DOFCBA[ 2.0.CO;2 Gherardi-Goldstein E, Bertoletti E, Zagatto PA et al (1990) Procedimentos para a utilizac¸a˜o de testes de toxicidade no controle de efluentes lı´quidos, Serie Manuais. CETESB, Sa˜o Paulo Gill TS, Tewari H, Pande J (1992) Short and long term effects of copper on the rosby barb (Puntius conchonius Ham). Ecotoxicol Environ Saf 23:294–306. doi:10.1016/01476513(92)90079-I Granjeiro JM, Ferreira CV, Juca MB et al (1997) Bovine kidney low molecular weight acid phosphatase: FMNdependent kinetics. Biochem Mol Biol Int 41:1201–1208

123

98 Granjeiro PA, Ferreira CV, Granjeiro JM et al (1999) Purification and kinetic properties of a castor bean seed acid phosphatase. Physiol Plant 107:151–158. doi:10.1034/ j.1399-3054.1999.100201.x Guasch H, Paulsson M, Sabater S (2002) Effect of copper on algal communities from oligotrophic calcareous streams. J Phycol 38:241–248. doi:10.1046/j.1529-8817.2002.01114.x Ito H, Inouhe M, Tohoyama H, Joho M (2007) Effect of copper on acid phosphatase activity in yeast Yarrowia lipolytica. Z Naturforsch [C] 62:70–76 Jonsson CM, Aoyama H (2007) In vitro effect of agriculture pollutants and their joint action on Pseudokirchneriella subcapitata acid phosphatase. Chemosphere 69:849–855. doi:10.1016/j.chemosphere.2007.06.024 Jonsson CM, Maia AHN (1999) Protocolo de avaliac¸a˜o de agentes microbianos de controle biolo´gico de pragas para registro como biopesticidas. III. Testes em organismos na˜o alvo do ambiente aqua´tico. Serie Documentos. Embrapa Meio Ambiente, Jaguariu´na Jonsson CM, Maia AHN, Ferreira CJA et al (1998) Risk assessment of the herbicide clomazone in the aquatic life. Verh Int Verein Limnol 26:1724–1726 Jonsson CM, Paraiba LC, Mendoza MT et al (2001) Bioconcentration of the insecticide pyridaphenthion by the green algae Chlorella saccharophila. Chemosphere 43:321–325. doi:10.1016/S0045-6535(00)00145-4 Keddy CJ, Greene JC, Bonnel MA (1995) Review of wholeorganism bioassay: soil, freshwater, sediment, and freshwater assessment in Canada. Ecotoxicol Environ Saf 30:221–251. doi:10.1006/eesa.1995.1027 Kruskopf MM, Du Plessis S (2004) Induction of both acid and alkaline phosphatase activity in two green-algae (Chlorophyceae) in low N and P concentrations. Hydrobiologia 513:59–70. doi:10.1023/B:hydr.0000018166. 15764.b0 Lan WG, Wong MK, Chen N et al (1995) Effect of combined copper, zinc, chromium and selenium by orthogonal array design on alkaline phosphatase activity in liver of the red sea bream, Chrysophrys major. Aquaculture 131:219– 230. doi:10.1016/0044-8486(94)00326-J Larsen DK, Wagner I, Gustavson K et al (2003) Long-term effect of sea-nine on natural coastal phytoplanktonic communities assessed by pollution induced community tolerance. Aquat Toxicol 62:35–44. doi:10.1016/S0166445X(02)00065-6 Le Jeune AH, Charpin M, Deluchat V et al (2006) Effect of copper sulphate treatment on natural phytoplanktonic communities. Aquat Toxicol 80:267–280. doi:10.1016/ j.aquatox.2006.09.004 Li M, Hu C, Zhu Q, Chen L et al (2006) Copper and zinc induction of lipid peroxidation and effects on antioxidant enzyme activities in the microalga Pavlova viridis (Prymnesiophyceae). Chemosphere 62:565–572. doi: 10.1016/j.chemosphere.2005.06.029 Michetti KM, Leonardi PI, Ca´ceres EJ (2006) Cytochemical localization of acid phosphatase in Stigeoclonium tenue (Chaetophorales, Chlorophyceae). Biocell 30:491–496 Noda M, Shibata K, Sawa Y et al (1994) Purification and characterization of an acid phosphatase from Mycoplasma fermentans. Microbiol Immunol 38:103–107

123

Biometals (2010) 23:93–98 OECD (1984) Guidelines for Testing of Chemicals. Alga, Growth Inhibition Test. Organization for Economic Cooperation and Development. OECD, Paris Okamura H, Mingyu P, Aoyama I et al (2002) Algal growth inhibition by river water pollutants in the agricultural area around lake Biwa, Japan. Environ Pollut 117:411–419. doi:10.1016/S0269-7491(01)00196-8 Patni NJ, Aaronson S (1974) Partial characterization of the intra- and extracellular acid phosphatase of an alga, Ochromonas danica. J Gen Microbiol 83:9–20 Peterson SM, Stauber JL (1996) New algal enzyme bioassay for the rapid assessment of aquatic toxicity. Bull Environ Contam Toxicol 56:750–757. doi:10.1007/s001289900110 Prazeres JN, Ferreira CV, Aoyama H (2004) Acid phosphatase activities during the germination of Glycine max seeds. Plant Physiol Biochem 42:15–20. doi:10.1016/j.plaphy. 2003.10.009 Rai PK, Rai LC (1997) Interactive effects of UV-B and Cu on photosynthesis, uptake and metabolism of nutrients in a green alga Chlorella vulgaris under simulated ozone column. J Gen Appl Microbiol 43:281–288. doi:10.2323/ jgam.43.281 Reilly TJ, Chance DL, Smith AL (1999) Outer membrane lipoprotein e (P4) of Haemophilus influenzae is a novel phosphomonoesterase. J Bacteriol 181:6797–6805 Sommer JR, Blum JJ (1965) Cytochemical localization of acid phosphatase in Euglena gracilis. J Cell Biol 24:235–251. doi:10.1083/jcb.24.2.235 Theodorou ME, Elrifi IR, Turpin DH et al (1991) Effect of phosphorus limitation on respiratory metabolism in the green algae Selenastrum minutum. Plant Physiol 95:1089– 1095. doi:10.1104/pp.95.4.1089 Trotman NA, Greenwood C (1971) Effects of zinc and other metal ions on the stability and activity of Escherichia coli alkaline phosphatase. Biochem J 124:25–30 Tsekos I, Schnepf E (1991) Acid phosphatase activity during spore differentiation of the red algae Gigartina teedii and Chondria tenuissima. Plant Syst Evol 176:35–51. doi: 10.1007/BF00937944 Tsekova K, Galabova D (2003) Phosphatase production and activity in copper (II) accumulating Rizopus delemar. Enzyme Microb Technol 33:926–931. doi:10.1016/ j.enzmictec.2003.06.001 Vincent JB, Averill BA (1990) An enzyme with double identity: purple acid phosphatase and tartrate-resistant acid phosphatase. FASEB J 4:3009–3013 Warshawsky D, Cody T, Radike M et al (1995) Biotransformation of benzo[a]pyrene and other polycyclic aromatic hydrocarbons and heterocyclic analogs by several green algae and other algal species under gold and white light. Chem Biol Interact 97:131–148. doi:10.1016/0009-2797 (95)03610-X WHO (1998) Copper. Environmental health criteria 200. International Programme on chemical safety. World Health Organization, Geneva Youngs HL, Sundaramoorthy M, Gold MH (2000) Effects of cadmium on manganese peroxidase. Competitive inhibition of MnII oxidation and thermal stabilization of the enzyme. Eur J Biochem 27:1761–1769. doi:10.1046/ j.1432-1327.2000.01173.x

Biometals (2010) 23:99–118 DOI 10.1007/s10534-009-9271-y

Crystal structure, DNA binding studies, nucleolytic property and topoisomerase I inhibition of zinc complex with 1,10-phenanthroline and 3-methyl-picolinic acid Hoi-Ling Seng • Sze-Tin Von • Kong-Wai Tan • Mohd Jamil Maah Seik-Weng Ng • Raja Noor Zaliha Raja Abd Rahman • Ignez Caracelli • Chew-Hee Ng

•

Received: 21 June 2009 / Accepted: 11 September 2009 / Published online: 29 September 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Crystal structure analysis of the zinc complex establishes it as a distorted octahedral complex, bis(3-methylpicolinato-j2N,O)2(1,10-phenanthroline-j2N,N)-zinc(II) pentahydrate, [Zn(3-Me-pic)2 (phen)]!5H2O. The trans-configuration of carbonyl oxygen atoms of the carboxylate moieties and orientation of the two planar picolinate ligands above and before the phen ligand plane seems to confer DNA sequence recognition to the complex. It cannot cleave DNA under hydrolytic condition but can slightly be activated by hydrogen peroxide or sodium ascorbate. Circular Dichroism and Fluorescence spectroscopic analysis of its interaction with various duplex polynucleotides reveals its binding mode as mainly intercalation. It shows distinct DNA sequence binding selectivity and the order of decreasing selectivity is

ATAT [ AATT [ CGCG. Docking studies lead to the same conclusion on this sequence selectivity. It binds strongly with G-quadruplex with human tolemeric sequence 50 -AG3(T2AG3)3-30 , can inhibit topoisomerase I efficiently and is cytotoxic against MCF-7 cell line.

H.-L. Seng ! S.-T. Von ! C.-H. Ng (&) Faculty of Engineering and Science, Universiti Tunku Abdul Rahman, 53300 Kuala Lumpur, Malaysia e-mail: [email protected]

Among the over 300 zinc metalloenzymes involve in cell functions and metabolism, zinc-finger topors have become prominent due their recently discovered role in tumour suppression (Stehbens 2003; Lin et al. 2005). Besides topoisomerase I, they can also bind to p53, AAV-2 Rep78/68 proteins and map to tumour suppressor genes on the human chromosome 9p21. Zinc-dependent endonucleases have been identified as one type of duplex DNA cleaving enzymes in plants (Jiang et al. 2008). Among enzymes which can cleave single stranded DNA are those which are zinc metalloenzymes or those which require zinc(II) for this property (Desai and Shankar 2003; Waterborg and Kuyper 1982). Consequently, the synthesis and

K.-W. Tan ! M. J. Maah ! S.-W. Ng Chemistry Department, University of Malaya, 50603 Kuala Lumpur, Malaysia R. N. Z. R. A. Rahman Faculty of Biotechnology and Molecular Biology, Universiti Putra Malaysia, 43400 Serdang, Malaysia I. Caracelli BioMat—Departamento de Fı´sica, Faculdade de Cieˆncias, Sa˜o Paulo State University, UNESP, Bauru 17015-970, Brazil

Keywords Zinc(II) ternary complex ! Duplex and quadruplex DNA binding ! Nucleolytic ! Topo I inhibition ! Molecular modeling ! Docking

Introduction

123

100

study of zinc(II) complexes have been regularly reported. An area of active research is the design and application of artificial, DNA-binding zinc finger proteins for recognition of diverse set of DNA sequences in a sequence-specific manner (Papworth et al. 2006; Nagaoka and Sugiura 2000). However, simple zinc(II) complexes with simple organic ligands having similar DNA sequence binding recognition are rare. Numerous zinc complexes are reported to be able to hydrolytically cleave DNA and RNA (Li et al. 2009; Bazzicalupi et al. 2008; Mancin and Tecilla 2007; Qian et al. 2007; Boseggia et al. 2004). However, some zinc complexes need activation by exogenous agent or a change in chemical environment or reaction condition for DNA cleavage (Ramakrishnan and Palaniandavar 2008; Seng et al. 2008). DNA topoisomerases are important enzymes in the nucleus that modify the topological state of DNA through the introduction of transient breaks in the phosphodiester backbone of the DNA (Wang et al. 1998). They play essential roles in mitosis, particularly in DNA transcription and replication. These enzymes have been identified as important targets in cancer chemotherapy and microbial infections (Kumar Singh et al. 2007). In fact, topoisomerase I inhibitors are quoted as having a wide range of antitumor activities and are among the most widely used anticancer drugs clinically (Sunami et al. 2009; Rothenberg 1997; Beretta et al. 2008; Teicher 2008; Pommier 2008). However, not many metal complexes have been reported to inhibit topoisomerases. Very few zinc compounds have been reported to inhibit topoisomerase I and II (Kikuta et al. 2000; Chuang et al. 1996). A ternary zinc(II) complex of 1,10-phenanthroline and edda binds to duplex oligonucleotide ds(AT)6 more selectively than ds(CG)6, and efficiently kills MCF-7 breast cancer cells by inducing cell cycle arrest (Ng et al. 2008). Beside the above zinc ternary complex, other transition metal complexes are now been investigated as DNA binding agents and are now recognized to have both binding and DNA molecular recognition capabilities (Seng et al. 2008, 2009, unpublished data; Zeglis et al. 2007). Among them, octahedral metal complexes have been found to be able to differentiate different DNA conformations (B-, Aand Z-forms), to have binding site selectivity (minor or major groove; mismatched nucleobase sites) and to

123

Biometals (2010) 23:99–118

have nucleobase sequence recognition (Zeglis et al. 2007). We are particularly interested in elucidating the nature of DNA molecular recognition of simple, varied geometrical metal complexes for different DNA structures and conformations, and nucleobase sequence recognition. For mononuclear metallointercalators, the intercalating ligand can anchor the metal complex between adjacent bases in differing intercalating mode and consequently orientate the other ligand(s) to interact with nucleobases in their vicinity. One particular aim of our work was to find out (1) whether both the main ligand and the auxiliary ligand(s) contribute to the DNA recognition and (2) type of interactive forces (p!!!p, H-bonding, van der Waals, covalent) contributing towards the sequence recognition. Here, we report the crystal structure of a new zinc ternary complex, its nucleolytic property and its interaction with duplex DNA, various duplex oligonucleotides, G-quadruplex and topoisomerase I. Molecular modeling was carried out to further explore the binding selectivity among various duplex oligonucleotides.

Materials and methods Materials Most of the reagents were of analytical grade and were used as supplied. The pBR322, gene ruler 1 kb DNA ladder, 69 loading buffer, were bought from BioSyn Tech (Fermentas). Analytical grade agarose powder was purchased from Promega. CD3OD, Salmon testes DNA, calf-thymus DNA, sodium chloride (NaCl), human DNA topoisomerase I and ethidium bromide were purchased from Sigma Chemical Co. (USA). All solutions for DNA experiments were prepared with ultra-pure water from a Elga PURELAB ULTRA Bioscience water purification system with UV light accessory. The Tris–NaCl (TN) buffer was prepared from the combination of Tris base and NaCl dissolved in aqueous solution in which the pH was adjusted with hydrochloric acid (HCl) solution till pH 7.5. The Tris–NaCl buffer pH 7.5 contains Tris at 5 mM and NaCl at 50 mM unless otherwise stated. All stock solutions of H2O2 and sodium ascorbate in deionized water and test compounds in Tris–NaCl buffer were freshly prepared daily.

Biometals (2010) 23:99–118

Methods Elemental analysis of C, N and H was carried out on a Perkin Elmer 2400 CHN analyzer. The FTIR spectra of the complex were recorded as KBr disc in the range 4,000–400 cm-1 on a Perkin Elmer FT-IR spectrometer. 1H NMR spectrum was recorded in deuterated methanol-D4 on a JEOL ECA 400 MHz instrument. UV–visible spectroscopic measurement was carried out on a Perkin Elmer Lambda 40. Fluorescence measurements were performed using a Perkin-Elmer LS55 photoluminescence spectrometer. Circular Dichroism (CD) study of the interaction of zinc complex with CT-DNA or ds(oligonucleotide) or G-quadruplex was carried out with a 1.0 cm or 1.0 mm quartz cells, respectively, using a Jasco J-810 spectropolarimeter. Synthesis of bis(3-methyl-picolinatoj2N,O)(1,10-phenanthroline)zinc(II) tetrahydrate Zinc acetate monohydrate (0.22 g, 1 mmol) and 1, 10-phenanthroline (0.20 g, 1 mmol) were heated in ethanol (20 ml) for 1 h followed by addition of 3-methylpicolinic acid (0.274 g, 2 mmol). The mixture was stirred for 24 h at room temperature. The white precipitate formed from slow evaporation of the solvent was filtered off, wash with cold water and chloroform. IR (KBr): 3,403, 1,622, 15,798, 1,518, 1,450, 1,424, 1,364, 1,277, 1,242, 1,200, 1,143, 1,143, 1,123, 1,104, 867, 849, 804, 727, 707, 679, 639, 575, 421 cm-1. 1H NMR(CD3OD) (a) phen: 8.67 (d, J = 8 Hz, 2H), 8.52 (s, 2H), 8.31 (s, 2H), 8.02 (s, 2H); (b) 3-methyl-picolinate: 7.92 (d, J = 8 Hz, 2H), 7.87 (m, J = 8 Hz, 2H), 7.52 (s, broad, 2H), 2.75 (s, 3-CH3, 6H). Anal. calcd. for Zn(C12 H8N2)(C7H6NO2)2!4H2O: C 52.94; H 4.78; N 9.50 found: C 53.28, H 4.61, N 10.05. Recrystallizing the white solid from water/methanol mixture (1:1) yielded crystals suitable for X-ray crystal structure analysis. Determination of crystal structure The unit cell parameters and the intensity data were collected on a Bruker SMART APEX CCD diffractometer, equipped with a graphite monochromated ˚ ). The APEX2 MoKa X-ray source (k = 0.71073 A software was used for data acquisition and the SAINT

101

software for cell refinement and data reduction (Bruker 2007). Absorptions corrections on the data were made using SADABS (Sheldrick 1996). SHELXL97 was used for solving and refinement of the structure (Sheldrick 2008). The structure was solved by direct-methods and refined by a full-matrix leastsquares procedure on F2 with anisotropic displacement parameters for non-hydrogen atoms. Hydrogen atoms in their calculated positions were refined using a riding model. The crystal data details are summarised in Table 1 while selected bond lengths and angles are given in Table 2. DNA cleavage experiments Agarose gel electrophoresis experiments were carried out on supercoiled plasmid DNA pBR322 (4.4 kb) using a horizontal gel system. For the cleavage studies, each 20 ll sample consisted of the complex dissolved in buffer, DNA, and the required volume of additional buffer. All samples were incubated in the dark in an incubator at a temperature of 37"C. The reaction mixtures were prepared as follows: 1 ll of 50 lM compound or salt were added to the mixture of 0.5 ll of supercoiled plasmid DNA pBR322 (0.25 lg/ll) and Tris–NaCl buffer pH 7.5 was added to give a total volume of 20 ll. The reactions were performed after incubating the reaction mixtures at 37"C for 24, 48 or 72 h. Three microliter of 69 loading buffer was added to 20 ll of the reaction mixtures and electrophoresis was performed at 80 V for 90 min in Tris–acetate-EDTA (TAE) buffer, pH 8.1, using 1.5% agarose gel. After electrophoresis, the agarose gel was stained with ethidium bromide solution (0.5 lg/ml). For the oxidative or reductive cleavage studies, incubation of the samples was similarly carried out. The DNA cleavage profile was analyzed using 1.5% agarose gel in a horizontal gel tank set with a running time of 2 h, at a constant voltage of 80 V. Each reaction mixture consisted of 0.5 lg/ll DNA and Tris–NaCl buffer pH 7.5 unless otherwise mentioned. The resultant DNA bands after the electrophoresis step for each set of experiments were stained with ethidium bromide before being photographed under UV light using a Syngene Bio Imaging system and the digital image was viewed with Gene Flash software. For the DNA cleavage by compound in the absence of exogenous agent, mechanistic experiments were

123

102

Biometals (2010) 23:99–118

Table 1 Crystal data and structure refinement of zinc(II) complex CCDC deposition number

731838

˚ 3) V (A

Chemical formula

C26H30N4O9Zn

D (calc) (g cm-3)

2,708.67(12) -1

1.491

Formula weight

607.91

l (mm )

Crystal colour

Colourless

F(000)

1,264

Crystal size (mm)

0.100 9 0.150 9 0.200

hmin/max(")

1.76–27.50

T(K)

100(2)

Index ranges

12 B h B 12, -21 B k B 23, -18 B l B 20

˚) Wavelength (A

0.71073

Reflections collected

6,163

Radiation

MoKa

Independent reflections

4,324

Crystal system

Monoclinic

Refinement method

Full-matrix least-squares on F2

Space group

P21/c

Data/restraints/parameters

6163/12/363

Z

4

Goodness-of-fit on F2

1.031

˚) a (A ˚ b (A)

9.8979(2)

Final R indices [I [ 2r(I)]

R1 = 0.0507, wR2 = 0.1325

18.3407(5)

˚) c (A

15.4779(4)

R indices (all data) ˚ 3) qmin/max (e A

0.749 and -0.805

a (") b (")

90.00 105.417(2)

c

90.00

Table 2 Selected bond lengths and angles of zinc(II) complex ˚) Bond lengths (A Zn1–O1

2.058(2)

C1–O1

1.273(4)

Zn1–O3

2.102(2)

C1–O2

1.242(4)

Zn1–N1

2.133(3)

C8–O3

1.263(4)

Zn1–N2 Zn1–N3

2.136(3) 2.157(3)

C8–O4

1.220(4)

Zn1–N4

2.178(3)

Bond angles (") O1–Zn1–O3

N2–Zn1–N3

94.68(11)

O1–Zn1–N1 O3–Zn1–N1

166.62(9) 77.49(10) 92.41(10)

O1–Zn1–N4 O3–Zn1–N4

100.78(10) 88.53(9)

O1–Zn1–N2

95.06(10)

N1–Zn1–N4

94.03(10)

O3–Zn1–N2

77.11(10)

N2–Zn1–N4

162.74(10)

N1–Zn1–N2

96.08(11)

N3–Zn1–N4

77.12(10)

O1–Zn1–N3

95.50(10)

C1–O1–Zn1

117.8(2)

O3–Zn1–N3

95.93(10)

C8–O3–Zn1

117.4(2)

N1–Zn1–N3

167.63(10)

similarly carried out to test the effect of radical scavengers, viz. sodium azide (NaN3), thiourea, and tiron, on the DNA cleavage was also used to test any cleavage inhibition. All final reaction mixtures were obtained by topping up with Tris–NaCl buffer pH 7.5.

123

0.967

R1 = 0.0812, wR2 = 0.1493

DNA binding studies Stock solutions of calf thymus DNA (CT-DNA) was prepared by dissolving the DNA in buffer solution at 4"C, and the resultant homogeneous solutions were used within 2 days. The concentration of CT-DNA per nucleotide phosphate was calculated from the absorbance at 260 nm by using e = 6,400 M-1 cm-1. The purity of the DNA was checked by monitoring the absorbance at 260 and 280 nm. PAGE grade selfcomplimentary 12-mer oligonucleotides (CG)6, (AT)6, (CGCGAATTCGCG), (CGCGATATCGCG), HPLC grade G-quadruplex 22-mer oligonucleotide 50 -AG GGTTAGGGTTAGGGTTAGGG-30 , and 17-mer complementary oligonucleotides 50 -CCAGTTCG TAGTAACCC-30 , 30 -GGTCAAGCATCATTGGG-50 were annealed, to give the respective duplex, as specified by the supplier, 1st BASE and Eurogentec Ait. The circular dichroism spectra were obtained by scanning Tris–NaCl buffered solutions of the DNA without and with [Zn(3-methyl-pic)2(phen)]. Fluorescence (FL) emission spectra were recorded in the wavelength range 270–420 nm by exciting the respectively solutions with light at 226 nm. Excitation and emission slits were set at 10 nm. Solutions of DNA, and a series of [Zn(3-methyl-pic)2(phen)] was prepared in TN buffer (5 mM Tris, 50 mM NaCl) at pH 7.5 unless specifically stated. All the CD spectral bands

Biometals (2010) 23:99–118

of the DNA alone and with the zinc complex are tabulated in Table 3. Ethidium bromide displacement assay Ethidium bromide displacement assay were performed by measuring the emission of ethidium bromide bound to DNA which shows the enhanced emission intensity due to its intercalative binding to DNA. The competitive binding of the metal complex to the DNA reduces the emission intensity of ethidium bromide (EB) with either the bound complex quenching the emission or a displacement of the bound ethidium bromide from the bound to the free state. Fluorescence measurements were performed using a Perkin-Elmer LS55 photoluminescence spectrometer. All the fluorescence measurements were taken at kex of 545 nm and kem of 600 nm at room temperature. For determination of binding constant of zinc complex with CT-DNA, a TN buffer (5 mM Tris, 50 mM NaCl) at pH 7.5 was used. Prior to titration with the zinc complex, each 3 ml mixture of ethidium bromide, EB (0.32 lM) and CT-DNA (10 lM) is incubated for 24 h to allow saturation of DNA with EB. The detail of the procedure has previously been reported (Seng et al. 2009, unpublished data). For the corresponding determination of binding constant with

103

duplex deoxyoligonucleotides, the optimized conditions were based on previously reported procedure for high-throughput screening of DNA of short nucleotide sequences (Boger et al. 2001). The ratio of duplex:EB is 1:2 and the TN buffer (pH 7.5) composition is 100 mM Tris and 100 mM NaCl. Prior to titration with zinc complex, each 3 ml mixture of EB (2 lM) and duplex oligo (1 lM) was incubated for 24 h to attain saturation. For both cases, the serial titration was completed by adding 1 ll of increasing concentration of zinc complex from appropriate stock solutions to the series of 3 ml EB-DNA mixtures until the quenching of DNAbound EtBr fluorescence exceeds 50%. The final reaction mixtures were incubated for 2 h before measurement of their fluorescence intensity. The fluorescence intensities were plotted against the complex concentration to yield a curve that showed the relative extent of quenching of DNA-bound EB (data not shown). The values of the apparent binding constant, Kapp, of the [Zn(3-Me-pic)2(phen)] complex were calculated from the equation Kapp,complex[complex] = Kapp,EB[EB] where Kapp,EB is the apparent binding constant of EB assumed to be 107 M-1, Kapp,complex is the apparent binding constant of complex, [EB] is the concentration of EB used and [complex] is the concentration of the complex at 50% quenching (Rajendran and Nair

Table 3 CD spectral bands of duplex oligos alone and with zinc complex (ZC): wavelength, k (degree of ellipcity, A) k/nm (A/") (-) band

(?) band

15 lM ds(AT)6

252(-1.93)

272(2.19)

15 lM ds(AT)6 ? 120 lM ZC

252(-1.98)

277(4.67); 297(1.89)

15 lM ds(CG)6

253(-6.18)

279(3.32)

15 lM ds(CG)6 ? 120 lM ZC

253(-5.97)

283(2.47)

10 lM ds(CGCGAATTCGCG)2

252(-3.82)

280(2.75)

10 lM ds(CGCGAATTCGCG)2 ? 120 lM ZC

252(-3.54)

278(3.24); 298(1.18)

10 lM ds(CGCGATATCGCG)2

253(-2.72)

277(1.90)

10 lM ds(CGCGATATCGCG)2 ? 120 lM ZC

250(-2.58)

279(3.27); 297(1.37)

20 lM (50 -CCAGTTCGTAGTAGTAACCC-30 ) (30 GGTCAAGCATCATCATTGGG-50 )

249(-1.70)

279(5.71)

20 lM (50 -CCAGTTCGTAGTAGTAACCC-30 ) (30 GGTCAAGCATCATCATTGGG-50 ) ? 120 lM ZC

252(-3.13)

239(-0.91); 280(10.82)

20 lM G-quadruplex

233(0.35); 267(-2.41) 2.46(2.21); 295(3.64)

20 lM G-quadruplex ? 60 lM ZC

234(0.70); 262(-2.93) 246(1.94); 280(4.08); 296(5.26)

20 lM G-quadruplex ? 120 lM ZC

228(0.53); 262(-3.40) 246(1.49); 279(5.67); 296(5.82)

123

104

Biometals (2010) 23:99–118

2006). The binding and quenching constants are given in Table 4. Human DNA topoisomerase I inhibition assay The human DNA topoisomerase I inhibitory activity was determined by measuring the relaxation of supercoiled plasmid DNA pBR322. Each reaction mixture contained 10 mM Tris–HCl, pH 7.5, 100 mM NaCl, 1 mM Phenylmethylsulfonyl fluoride, a-Toluenesulfonyl fluoride, PMSF, and 1 mM 2mercaptoethanol, 0.25 lg plasmid DNA pBR322, 1 unit of human DNA topoisomerase I, and the test compound or zinc complex at a specified concentration. Total volume of each reaction mixture was 20 ll and these mixtures were prepared on ice. Upon enzyme addition, reaction mixtures were incubated at 37"C for 30 min. The reactions were terminated by the addition of 2 ll of 10% SDS, and then followed by 3 ll of dye solution comprising 0.02% bromophenol blue and 50% glycerol. SDS is required to denature topoisomerase I, preventing further functional enzymatic activity. The mixtures was applied

Table 4 Binding and quenching constant of zinc complex with duplex oligonucleotides

to 1.2% agarose gel and electrophoresed for 5 h at 33 V with running buffer of Tris–acetate EDTA, TAE. The gel was stained, destained, and photographed under UV light using a Syngene Bio Imaging system and the digital image was viewed with Gene Flash software. Same protocol was applied in the Human DNA topoisomerase I inhibition condition study. The only variation is the sequence in adding the main components (human DNA topoisomerase I, plasmid DNA pBR322, and zinc complex). Two conditions were studied in this assay. In the first condition, human DNA topoisomerase I was incubated with zinc complex at 37"C for 30 min and then DNA was added and the reaction mixture was incubated for another 30 min at the same temperature. In the second condition, zinc complex and DNA were incubated for 30 min at 37"C first before the addition of topoisomerase I. Then, the resultant reaction mixture was incubated for another 30 min at the same temperature. This is a preliminary result of an investigation into the mode of action of zinc complex on the Human DNA topoisomerase I.

Binding constant (M-1)

Quenching constant

927

2.157 9 104

0.012

923 928

2.166 9 104 2.155 9 104

0.012 0.011

1,112

1.798 9 104

0.010

1,100

1.818 9 104

0.010

1,112

1.798 9 104

0.010

1,270

1.574 9 104

0.007

1,270

1.574 9 104

0.007

1,278

1.564 9 104

0.007

1,121

1.784 9 104

0.009

1,126

1.776 9 104

0.008

1,121

1.784 9 104

0.009

603

5.306 9 103

0.018

606 606

5.280 9 103 5.280 9 103

0.018 0.018

Complex concentration (lM) at 50% quenching ds(AT)6

ds(CG)6

ds(CGCGAATTCGCG)2

ds(CGCGATATCGCG)2

CT-DNA

123

Biometals (2010) 23:99–118

105

Docking simulations

The function fitted was GoldScore:

The 3-D structures of DNA used for the docking simulations were obtained from the PDB (http://www. rcsb.org/pdb/home/home.do) and PDBSum (http:// www.ebi.ac.uk/pdbsum/) data banks, and are double helices associated with ligands. The specific DNA structures used in the calculations are summarized in Table 5. The DNA structures were chosen as to allow an evaluation of the binding preference for AT and CG sequences. The H atoms for each of 2da8 and 1g3x (Malinina et al. 2002) were added using the VegaZZ 2.0.8 programme (Pedretti et al. 2002, 2003, 2004), in all other cases H atoms were included in the deposited data. Docking simulations were carried out using the 4.01 GOLD (Genetic Optimization for Ligand Docking) program (Jones et al. 1995, 1997), which is based on Genetic Algorithms. This method allows partial flexibility of the hydroxyl groups of the respective DNA molecule and full flexibility of the ligand. In order to evaluate the GOLD scoring function, all water molecules were removed from the DNA molecules. The two last columns of Table 5 list the atom used as centre of the calculations and the radius of the sphere searched, respectively. For 1g3x and 2rou, a smaller sequence was evaluated in order to obtain a better comparison with the experimental results, these are designated 1g3xM and 2rouM, respectively.

Fitness ¼ Sðhb extÞ þ 1:3750 & Sðvdw extÞ þ Sint where S(hb_ext) is the DNA-ligand hydrogen bond score, S(vdw_ext) is the DNA-ligand van der Waals score, Sint is the score from intramolecular ligand interactions. MTT assay All tissue culture reagents were obtained from Sigma and Life Technologies Inc., Gaitherburg, MD. The oestrogen receptor positive human breast adenocarcinoma cell line MCF-7 cells were grown in RPMI 1640 supplemented with 10% FBS, 0.025 M Hepes, 0.024 M sodium bicarbonate, 50 units/ml penicillin G/streptomycin sulfate at 37"C in 5% CO2. MTT assay was used to test the cytotoxicity of zinc(II) complex which was incubated with cells for 72 h and it was carried out as previously described (Ng et al. 2008).

Results and discussion Crystal structure of complex Recrystalising the white product [Zn(3-Me-pic)2 (phen)]!4H2O yielded the complex [Zn(3-Me-pic)2 (phen)]!5H2O with formula C26H30N4O9Zn, which

Table 5 Parameters for the docking studies Binding site

PDB code*

Sequences

Centre of calculation sphere

˚) Radius (A

TA

1g3x

(CGCGAATTCGCG)2

O2; T19

20

AT TA

2da8

(GATATC)2

O2; T3

20

TA

1g3xM

Modified: (GAATTC)2

O2; T19

20

(ATCGCGCGGCATG)

O2; C21

20

O2; C21

20

O2; G16

20

TA

TA GC

2rou

CG GC

(TAGCGCGCCGTAC) 2rouM

CG GC

Modified: (GCGCGG) (CGCGCC)

1y9h

(CCATGCTACC)2

CG *1g3x (Malinina et al. 2002); 2da8 (Addess et al. 1993); 2rou (Wang et al. 2008); 1y9h (Zhang et al. 2005)

123

106

crystallizes as a colourless block crystal with a dimension of 0.100 9 0.150 9 0.200 mm with Monoclinic crystal system in space group P21/c, lattice ˚ , b = 18.3407(5) A ˚, c = parameters a = 9.8979(2) A ˚ 15.4779(4) A, a = 90.00", b = 105.417(2)", c = 90.00", F(000) = 1264, GOF = 1.031, R1 = 0.0507, wR2 = 0.1325, Z = 4. Dcalc = 1.491 g cm-3, V = ˚ 3. The crystal structure is shown as an 2,708.67(12) A ORTEP plot (50% probability ellipsoids) in Fig. 1 (lattice water molecules are not shown). Each of the two bidentate 3-methylpicolinate ligand coordinates via its carboxylate oxygen atom and the adjacent pyridine nitrogen atom while the 1,10-phenanthroline binds via its two nitrogen atoms. The two picolinate ligands are positioned on the other side of the N–N atoms of the coordinated phen ligand and each picolinate moiety is orientated such that its plane is approximately directed along the Zn–N bond of the coordinated phen. As a result, the four ligating nitrogen atoms occupy the equatorial positions. The coordination geometry is a severely distorted octahedron. Consequently, the Zn–N bond length (mean ˚ ) is longer than the Zn–O bond length value = 2.151 A ˚ ). In contrasts, the correspond(mean value = 2.081 A ing Zn–N and Zn–O bond lengths of the Zn-picolinate moieties are reverse in bis(pyridine-2,6-carboxylatoj3N,O,O0 )zinc(II) trihydrate (Okabe and Oya 2000) and in trans-diaquabis(3-hydroxypicolinato-j2N,O) zinc(II) dihydrate (Di Marco et al. 2004), i.e., the Zn–N bonds is shorter than the Zn–O bonds in these complexes. The carboxylate oxygen and carbonyl atoms of the 3-methyl-picolinate ligands form hydrogen bonds with the lattice water molecules. So, the 3-methyl picolinate ligand in this zinc complex can act as a H-bond acceptor while interacting with DNA unlike the coordinated ethylenediamine-N,N0 -diacetate (edda) in M(phen)(edda) which has both H-bond donor and acceptor sites (Ng et al. 2008). DNA binding study The interaction of the [Zn(3-Me-pic)2(phen)] with (1) duplex oligonucleotides of various specified nucleotide sequences, and (2) quadruplex DNA of the 23-mer oligonucleotide 50 -AG3(T2AG3)3-30 and its corresponding duplex were investigated with CD and FL spectroscopy. CD spectroscopy is a useful technique in diagnosing changes in DNA morphology during drug–DNA interactions, as the band due to

123

Biometals (2010) 23:99–118

Fig. 1 Ortep plot of bis(3-methylpyridine-2-carboxylato-j2O,N) (1,10-phenanthroline-j2N,N)zinc(II) pentahydrate (50% probability ellipsoids). Water molecules are not shown

base stacking (275 nm) and that due to right-handed helicity (248 nm) are quite sensitive to the mode of DNA interactions with small molecules (Ivanow et al. 1973). The CD spectra of all the duplex oligonucleotides show a negative band at *250 nm due to DNA helicity and a positive band at *270 nm due to basepair stacking interaction, confirming the B-form conformation of these duplexes (Table 3). The first investigation was to find out any DNA binding preference for CG or AT sequences by the zinc complex. The zinc complex at a complex:duplex ratio of 1:8 greatly enhanced the positive band of the ds(AT)6, and this suggests the binding mode as intercalation (Fig. 2a; Seng et al. 2008). There is also a shift of the kmax of the positive band from 272 to 277 nm and formation of an induced positive band at 297 nm. At the same mole ratio, the zinc complex does not induce a significant change in the CD spectrum of the ds(CG)6, suggesting binding with total retention of the B-form conformation (Fig. 2b). In terms of intensity enhancement DU at positive bands, the zinc complex induced a greater value (2.49 unit) for the ds(AT)6 than that (0.85 unit) for the ds(CG)6. These results indicate stronger intercalation

Biometals (2010) 23:99–118

107

Fig. 2 a CD spectrum of 15 lM of ds(AT)6 alone (I) and with 120 lM of Zn(phen)(3-methyl-pic)2] (II) and b CD spectrum of 15 lM of ds(CG)6 alone (III) and with 120 lM of the zinc complex (IV)

Fig. 3 a CD spectrum of 10 lM of ds(CGCGAATTCGCG)2 alone (I) and with 110 lM of [Zn (3-methylpic)2(phen)] (II) and b CD spectrum of 10 lM of ds(CGCGATATCGCG)2 alone (III) and with 110 lM of the zinc complex (IV)

and binding selectivity of the zinc complex for the AT sequences. Similar results have been obtained for the (ethylenediamine-N,N0 -dicarboxylato-j4N,N0 ,O,O0 ) (1,10-phenanthroline-j2N,N0 )zinc(II), Zn(phen)(edda) (Seng et al. 2008). Similar preferential binding to AT-rich DNA is also shown by one of the optical enantiomers of octahedral Ru(II) mononuclear or dinuclear polypyridine complexes (Nordell et al. 2007). The following enantiomers bind more selectively to AT-sites: K-[Ru(phen)3]2?, D-[Ru(phen)2dppz]2?, and DD-P (where P is a dimmer of [Ru(phen)2dppz]2? joined by a single bond). Zinc(II)-cyclen and zinc(II)derivatized cyclen complexes (cyclen = 1,4,7,10-tetraazacyclododecane) were found to selectively bind to thymidine (dT) and uridine (U) in nucleosides and polynucleotides (Kikuta et al. 2000). Interestingly, the zinc(II) complexes of cyclen derivatives appended with one or two alkyl or aryl groups have been proven to selectively bind to an AT-rich TATA box of the promoter region of SV40 early gene. We next investigated the interaction with ds(CGC GAATTCGCG)2 and ds(CGCGATATCGCG)2 oligonucleotides. For the first duplex, there is not much

change in CD spectrum due to binding of the zinc complex except for a slight enhancement of the positive band at *278 nm and a small induced band at 300 nm (Fig. 3a). The zinc complex induced a greater enhancement of the positive band (at *277 nm) of the CD spectrum of the ds(CGCGATATCGCG)2 at the same complex: duplex mole ratio (1:8) and a broadening of the negative band (Fig. 3b). As for the ds(AT)6 duplex, the zinc complex has induced a new positive band for the ds(CGCGATATCGCG)2 at 297 nm. Comparing the CD results of these four ds(oligos)2, we infer that the chelated 1,10-phenanthroline of the zinc complex binds more selectively to ATAT sequence than to AATT sequence, and the resultant binding mode involving this ligand is intercalative. At the moment, we are unsure of the cause of the induced positive bands at *300 nm. To investigate further the above nucleobase sequence selectivity, we used a EB displacement assay to obtain the apparent binding and quenching constants of the zinc complex with the four duplex oligonucleotides (Table 4). The apparent binding constants of the zinc complex for the ds(AT)6 and ds(CG)6 are

123

108

2.159 9 104 and 1.805 9 104 M-1, respectively. Thus, the complex binds more strongly with ds(AT)6 and this correlates with greater enhancement of the positive band of the CD spectrum of ds(AT)6 compared to that with the ds(CG)6. Similarly, the binding constants of the zinc complex for the ds(CGCGA TATCGCG)2 and ds(CGCGAATTCGCG)2 are 1.781 9 104 and 1.571 9 104 M-1, respectively. The results of this assay is in agreement with the CD results, i.e., both data support the conclusion that the zinc complex has DNA binding selectivity for AT-repeat and ATAT sequences. The AT selectivity observed for the neutral [Zn(3Me-pic)2(phen)] complex may be different from that of cationic, square pyramidal [Cu(phen)(L-arg)Cl]? which has higher binding constant Kapp (1.11 9 106 M-1) for poly(dA)!poly(dT) than that (4.9 9 105 M-1) for poly(dC)!poly(dG) obtained from EB displacement assay (Patra et al. 2007). Computer simulation study of this copper complex using ds(CGCGAATTCGCG)2 shows favourable stacking interaction by the phen moiety and H-bonding interactions with the AT base pair sequences of this duplex and the positively charged guanidinium end group. However, an optically active ternary octahedral ruthenium complex, D-cis-a-[Ru(RR-picchxnMe2)(phen)]2?(picchxnMe2 = N,N0 -dimethyl-N, N0 -di(2-picolyl)-1,2-diaminocyclohexane), was shown via NMR study to bind with AT selectivity in the minor groove of d(CGCGATCGCG)2 and d(ATATCGA TAT)2 duplexes without intercalation of the phen ligand (Proudfoot et al. 1997). On the other hand, recognition of zinc(II)-cyclen derivatives for AT-rich regions involve the zinc atom covalently bonding to N(3)-deprotonated anionic form of the thymine and the stacking interaction of the aromatic substituent group(s) at the cyclen with aromatic ring of proximal nucleobase (Kikuta et al. 2000). Distamycin, a clinically useful non-metal drug, apparently recognise ATrich regions of DNA mainly by hydrogen bonding to adenine N(3) and thymine O(2) (Kikuta et al. 2000; and references quoted therein). It is not self evident how these diverse set of compounds exhibit AT-selectivity and the factors responsible for such recognition or the basis of such recognition have not been properly analyzed and compared. However, the DNA binding selectivity of [Zn(3-Me-pic)2(phen)] may account for

123

Biometals (2010) 23:99–118

the much lower binding constant of this complex for CT-DNA which has 50% CG and 50% AT (Table 4). Docking To explore further the nature of the DNA binding selectivity by the [Zn(3-Me-pic)2(phen)], a molecular modelling study using the Gold Program was undertaken. The chosen duplexes were (1) AT-rich duplexes ds(GATATC)2 (2da8) and d(GAATTC)2 (1g3xM), and (2) GC-rich duplexes ds(CCATGC TACC)(GGTAGCGATGA) (1y9h) and ds(GCGC GC)(CGCGCG) (2rouM) for docking simulation with the zinc complex (Table 5). The aim was to study the nucleobase sequence selectivity by computer simulation. The relative orientation and the interaction determined from the results of the docking study were analyzed using the graphical program: Discovery Studio Visualizer 2.0. The views in Fig. 4 show the different modes how the ‘‘ligand’’ [Zn(3-Me-pic)2 (phen)] intercalated in the different DNA sequences. The different number of observed stacking p!!!p, H-bonding, C–H!!!p and C=O!!!p interactions suggests that they are related to the strength of the ligand binding mode and is in accord with the obtained scores. The decreasing order of the scores for the duplexes with binding energy E (kcal/mol) is 2da8 (-70.38) [ 1g3xM (-68.77) [ 1y9h (-57.16) [ 2rou (-54.62) (Table 6). An analysis of the interactions and the results of the score (Fig. 5; Tables 6, 7) suggest the order of nucleotide sequence binding selectivity as ATAT [ AATT [ GC. This order is in accord with the results of the earlier CD and FL binding studies. Thus, the docking results are reliable and warrant further analysis and discussion of the nature of the sequence recognition. Preliminary assessment leads us to believe (1) that both the intercalating ligand (phen) and 3-methyl-picolinate ligands with only H-bonding acceptor atoms (Fig. 1: O1, O3, N1, N2) contribute to this recognition, and (2) that the orientations of the two 3-methyl-picolinate ligands with respect to the planar phen ligand is important. Intercalation of phen in a given site and mode anchor it to the DNA and direct the orientation of the two 3-Me-pic ligands for interaction with nucleobases in their vicinity. Here, we focus on the contribution from intercalation of the phen.

Biometals (2010) 23:99–118

109

Fig. 4 Views of the intercalation of [Zn(3-Me-pic)2(phen)] in the DNA molecules studied herein. In all diagrams the O2 atom of the ligand is positioned upwards. a 2da8 (ATAT) where four interactions involving p systems are seen: three rings of the ligand form p!!!p interactions with the bases A2, A4 and T3, and a C–H!!!p interaction is also formed between the ligand

and the T5 base. b 1g3xM (AATT): two rings of the central part of the ligand interact with four bases (A5, A6, T19 and T20). c 1y9h (GGCC) two rings of the central part of the ligand form p!!!p interactions with the C5 and G17 bases. d 2rouM, where the ligand is found to be the most weakly attached of the series, shows only one p!!!p interaction, with the G20 base

(1)

(2)

2da8 = ds(GATATC)2

Binding energy, E = -70.3 kcal/mol Phen moiety intercalates between A2/A4 diagonal base steps of different DNA strands, with central phen aromatic ring-nucleobase contact of ˚ and adjacent phen aromatic ring-nucleobase 3.36 A ˚ , i.e., there are two p–p, contact distance of 3.13 A aromatic ring-aromatic ring interaction (i.e., stacking interaction). In contrast, the phen moiety of [Zn(phen)(edda)] intercalate between the A/A adjacent base steps of the same DNA strand (Seng et al. 2008).

1g3xM = ds(GAATTC)2

Binding energy, E = -68.77 kcal/mol Phen moiety intercalates between T19!!!A6/ T20!!!A5 base-pairs, with each of the two side aromatic rings of the phen ligand making p–p stacking interaction with base-pair above and that below the phen. The centroid–centroid distances for the T19-phen-T20 stacking interaction are 3.69 and ˚ , respectively (Fig. 4b) and those for the 3.41 A A6–phen–A5 stacking interaction are 3.45 and ˚ , respectively. These four p–p, aromatic 3.69 A ring-aromatic ring interactions are weaker than

123

110

Biometals (2010) 23:99–118

Table 6 The scores for binding of zinc complex to various duplex oligonucleotides using docking calculations

Fig. 5 a CD spectrum of 20 lM of G-quadruplex 50 -AG3(T2AG3)3-30 alone (I) and with 60 lM (II) and 120 lM (III) of [Zn (3-methyl-pic)2(phen)] and b CD spectrum of 20 lM of G-sequence duplex oligo alone (IV) and with 120 lM of the zinc complex (V)

those for the zinc complex interaction with ds(GATATC)2. (3)

1y9h = (CCATGCTACC)(GGTAGCGATGA)

Binding energy, E = -57.16 kcal/mol Phen moiety intercalates between G17/C5 diagonal base steps of different DNA strands, with central ˚ and phen aromatic ring-nucleobase contact of 3.16 A adjacent phen aromatic ring-nucleobase contact dis˚ . These two p–p, aromatic ringtance of 3.39 A aromatic ring interactions are comparative strong, compared to those found for the interaction of zinc complex with ds(GATATC)2. (4)

2rouM = (GCGCGC)(CGCGCG)

Binding energy, E = -54.62 kcal/mol Here, there is only one weak p–p, aromatic ringaromatic ring interaction between the phen moiety

123

and G20, with the centroid–centroid distance between ˚. phen-G20 of 3.76 A From the above comparison of p–p interactions and analysis of other types of interaction between the zinc complex and the respective duplexes, the higher selectivity of the zinc complex for the ATAT sequence of 2da8 duplex can be ascribed to the greater number of the types of interaction (Table 7) and their combined total binding energy, E (Table 6). The 2da8 has multiple H-bonding, involving nucleobases A2, T5, A4 and C6, with the zinc complex and has p!!!p (nucleobase!!!phen), p!!!p (thymine C=O!!!phen) and C–H!!!p (picolinate!!!T5). All these contribute to making the zinc complex having the highest binding energy for 2da8. Thus, it seems reasonable to ascribe the recognition of the ATAT sequence by the zinc complex to these interactions. In contrast, the DNA recognition of zinc(II)-cyclen

Biometals (2010) 23:99–118

111

Table 7 Interactions between the DNA and Zn(3-Me-pic)2(phen)M ligand 2da8 Atom

Zn(3-Me-pic)2(phen)M atom

˚) Distance (A

A2:H2

O2

2.691

T5:O2

H13

2.964

T5:H1b

O2

3.247

A4:H2

O4

2.889

C6:H1b

O2

2.463

T3:O2

Ct (C22–C23–N4–C26–C25–C24)

3.008

A2:Ct (N1–C2–N3–C4–C5–C6)

Ct (C18–C19–C20–C21–C22–C23)

3.359

A4:Ct (N1–C2–N3–C4–C5–C6)

Ct (N3–C15–C16–C17–C18–C19)

3.262

T5:Ct (N1–C2–N3–C4–C5–C6)

H13–C13

3.220

1g3xM atom

Zn(3-Me-pic)2(phen)M

˚) Distance (A

T20:O4a

H6

2.955

T20:O4a

H25A

2.906

T20:O4a

H26A

2.026

T20:O3a

H5

3.271

T20:O2

O4

3.252

T20:H1a

O4

3.351

C21:O2

O4

3.325

C21:H5a1

O4

3.396

T19:O2

O2

2.511

T19:H1a

O2

3.317

A6:H2

O2

3.159

A5:Ct (N1–C2–N3–C4–C5–C6)

Ct (N3–C15–C16–C17–C18–C19)

3.693

A6:Ct (N1–C2–N3–C4–C5–C6)

Ct (N3–C15–C16–C17–C18–C19)

3.453

T19:Ct (N1–C2–N3–C4–C5–C6)

Ct (C22–C23–N4–C26–C25–C24)

3.694

T20:Ct (N1–C2–N3–C4–C5–C6)

Ct (C22–C23–N4–C26–C25–C24)

3.415

1y9h atom

Zn(3-Me-pic)2(phen)M atom

˚) Distance (A

C7:H41

O4

3.243

G16:O6

O4

2.648

C5:Ct (N1–C2–N3–C4–C5–C6)

Ct (N3–C15–C16–C17–C18–C19)

3.393

G16:Ct (N1–C2–N3–C4–C5–C6)

Ct (C22–C23–N4–C26–C25–C24)

3.160

2rouM atom

Zn(3-Me-pic)2(phen)M atom

˚) Distance (A

G8:H4b

O2

3.088

G8:H1b

O2

2.488

G9:H5b

O2

3.164

G20:H21

O2

2.852

G20:H22

O2

2.371

C7:O4b

H13

2.658

C7:O4b

H15A

2.180

C7:O4b

H16A

3.377

G20:Ct (N1–C2–N3–C4–C5–C6)

Ct (C22–C23–N4–C26–C25–C24)

3.763

Ct, centroid a

Atom of nucleobase thymine T19 or T20

b

Atom of nucleobases cystine C7 or guanine G8

123

112

derivatives seems to be that it selectively binds to thymine by covalent bonding (Kikuta et al. 2000). In optically-active ruthenium complexes, chirality seems to confer only one of the enantiomers with binding selectivity for AT-sequences, e.g., both D-[Ru(phen)2dppz]2? and h-[Ru(phen)3]2? prefer AT-binding sites than GC- or mixed-sequence binding sites (Nordell et al. 2007). Some [Ru(Hdpa)2 (diimine)](ClO4)2 (Hdpa = 2,20 -dipyridylamine; diimine = 1,10-phenanthroline derivatives) complexes shows preferential binding to AT than to GC or mixed sequences but the origin of this selectivity was not explained (Rajendiran et al. 2008). Copper(II) bis-arginate [Cu(L-arg)2](NO3)2 and [Cu(L-arg)(phen)Cl]Cl as mimics of the minor-groove-binding natural antibiotic netropsin show preferential binding to the AT-rich region of double stranded DNA (Patra et al. 2007). It seems that the matching of the crescent shape of the copper complexes to the DNA minor groove, electrostatic interaction, multiple H-bonding between the positively charged guanidinium end group of L-arginate ligand with A and T bases, and stacking interaction of the phen ligand are contributing factors towards AT-recognition. G-quadruplex Next, we use CD spectroscopy to investigate the interaction of the zinc complex with the single strand G-quadruplex DNA annealed from 50 -AG3(T2 AG3)3-30 and with the duplex DNA annealed from two complementary 17 nucleotide primers, 50 -CCA GTTCGTAGTAACCC-30 and 30 -GGTCAAGCATC ATTGGG-50 . Single strand quadruplexes can assume parallel structure, antiparallel structure or a mixture of both (Kypr et al. 2009; Zhang et al. 2007; Baker et al. 2006). The CD spectrum of our G-quadruplex alone shows two maxima at 295 nm (degree of ellipcity, U = 3.64 units) and 246 nm (U = 2.20 arbitary units), and a minimum at 267 nm (U = -2.41 units) (Fig. 5, spectrum I). This spectrum is typical of other reported anti-parallel quadruplexes, viz. d(T2AG3)4, d(T2AG3)6 and dAG3(T2AG3)3 (Baker et al. 2006; Galezowska et al. 2007). Single strand, antiparallel G-quadruplexes can have two different strand orientations, viz. chair and basket (Baker et al. 2006). Oligonucleotides with human telomeric sequence, in the presence of Na? ion, form G-quadruplexes with antiparallel-stranded structures

123

Biometals (2010) 23:99–118

with their guanines having alternating syn-anti glycosidic conformations and give a characteristic positive peak at 295 nm and two small peaks: a negative at 265 nm and a positive at 240 nm (Galezowska et al. 2007). CD data shows human telomeric sequence d[G3(T2AG3)3] formed antiparallel quadruplex in the presence of Na? but formed a hybrid mixture of parallel and antiparallel structures in the presence of K? (Lu et al. 2008). Based on CD data, this hybrid mixture was shown to be converted to wholly antiparallel structure by the addition of a 5-methylated quinoline derivative, N0 -(5-N-Methyl10H-indolo[3,2-b]quinolin-5-ium)-N,N-dimethyl-propane-1,3-diamine iodide. A previously reported human telomeric sequence d[AG3(T2AG3)3] in the presence of 100 mM Na? ions forms an antiparallel G-quadruplex structure, as evidenced (1) by its CD having a 295 nm positive band and 265 nm negative band and (2) by NMR studies (Xu et al. 2006). Thus, our G-quadruplex annealed from 50 -AG3(T2AG3)3-30 oligonucleotides with human tolemeric sequence in the presence of Na? ions has an antiparallel structure with a basket strand orientation. The CD positive band at 297 nm is due to G–G base stacking (Kypr et al. 2009; Wei et al. 2008). The CD spectrum of the 20 lM of the antiparallel G-quadruplex 50 -AG3(T2AG3)3-30 was monitored as it was titrated with increasing concentration of the [Zn(3-Me-pic)2(phen)] complex (from 60 to 120 lM). The intensity of both the positive band at 296 nm and the negative band at 267 nm of the CD spectrum is enhanced by the addition of the zinc complex (Fig. 5, spectrum II). The enhancement of the positive band at 296 nm due to G–G base stacking suggests partial intercalation between G-tetrads by the zinc complex, reminiscence of enhancement of positive, base–base stacking band at *270 nm attributed to intercalation of B-form duplex DNA by metallointercalators. The enhancement of the positive band at 295 nm of the G-quadruplex CD spectrum by the zinc complex is the opposite to that observed for the interaction of acridine and bis-acridine with G-quadruplex where the decrease in the intensity of the positive band at 293 nm was interpreted as destabilization of the quadruplex structure (Nagesh and Krishnaiah 2003). Thus, enhancement of the positive band of the CD spectrum of the present quadruplex suggests stabilization of the antiparallel quadruplex structure by the zinc complex. When the mole ratio of the

Biometals (2010) 23:99–118

quadruplex:zinc complex increases from 1:3 to 1:4, an induced positive band at 279 nm is completely formed (Fig. 5, spectrum III). This intense induced positive band is similar to those which resulted from zinc complex binding to the B-form duplexes used in this study (Figs. 2, 3, 5b). We are, as yet, unable to interpret the formation of this induced band. Except for this induced band, the overall shape of G-quadruplex remains unchanged, suggesting retention of the antiparallel structure. In contrast, CD spectral titration of ruthenium(II) complexes with known intercalating ligands, viz. [Ru(phen)2(dpqC)]2?, [Ru(phen)2(dpq)]2?, [Ru(phen)2(dppz)]2? and [Ru(phen)3]2?, with four stranded G-quadruplex (TTGGGGGT)4 shows significant decrease in ellipticity of both CD positive and negative bands with increasing Ru(II)-complex: G-quadruplex ratio (Talib et al. 2008). The positive CD band at 265 nm was found to be split into two distinct bands at higher concentration of Ru(II)complex. In contrast, the positive band at 296 nm of the CD spectrum of the single strand G-quadruplex 50 AG3 (T2AG3)3-30 seems to be split into two distinct bands with higher [Zn(3-Me-pic)2(phen):G-quadruplex ratio (Fig. 5a). Whether this higher mole ratio results in this splitting or merely in an additional induced band is merely interpretative. A comparison of the interaction the zinc complex with the 24-nucleotide G-quadruplex with the complimentary 17-bp duplex by means of CD spectroscopy was undertaken. The annealed duplex has a B-form conformation as confirmed by the presence of a positive band at 279 nm due to base– stacking interaction and a negative band at 249 nm due to DNA helicity. Incubating this duplex (20 lM) with the zinc complex (120 lM) greatly enhances the positive band at 279 nm without any shift in wavelength, indicating intercalation mode of binding by the zinc complex. The negative band intensity at 249 nm becomes more enhanced and there is a red shift of this band from 249 to 253 nm. Additionally, an induced positive band at 239 nm is formed.

Nucleolytic property Zinc(II) is a non-redox active transition metal cation. Although many mononuclear and multinuclear zinc(II) complexes can bind to DNA and induce

113

hydrolytic cleavage of DNA or model substrate, some are inactive because of the requirement of coordination unsaturation and presence of labile bonded nucleophile or nucleophilic pendant (Liu et al. 2004; Mancin and Tecilla 2007; He et al. 2009). In this study, we examine the ability of co-ordinately saturated [Zn (3-Me-pic)2(phen)] to cleave pBR322 under hydrolytic conditions and in the presence of exogenous agents, sodium ascorbate (NaAsc) and hydrogen peroxide (H2O2), using gel electrophoresis. Incubating the [Zn(3-Me-pic)2(phen)] with pBR322 at varying concentrations of the zinc complex (10–1,000 lM) for 24 h at 37"C, no DNA cleavage was observed (Fig. 6). When the DNA was incubated with 30 lM NaAsc or 30 lM H2O2, there is no DNA cleavage as the gel pattern is the same as that for DNA alone (Fig. 7, lanes L1–L3). Similarly, there was no significant DNA cleavage observed when the DNA was incubated with 50 lM ZnCl2 or 50 lM zinc complex (Fig. 7, lanes L6–L7). However, when the DNA was incubated with 50 lM ZnCl2 or 50 lM zinc complex in the presence of 30 lM NaAsc or 30 lM H2O2, there was noticeable increase in the intensity of the nicked band. The activation of zinc complex towards single strand DNA cleavage by sodium ascorbate is greater than that for the ZnCl2, suggesting coordination of the ligands results in slight increase in nucleolytic efficiency of the zinc(II) ion. Nucleolytic activation of [Zn(3-Me-pic)2(phen)] by ascorbate is greater than that by H2O2 as evidenced by the thicker nicked band (Fig. 7, L10 & L13). A previous study reported that 100 lM of two zinc(II) complexes containing modified bipyridyl ligand with L1

L2

L3

L4

L5

L6

L7

L8

L9

Fig. 6 Electrophoresis results of incubating pBR322 (0.5 lg/ll) in the presence of [Zn(3-Me-pic)2(phen)] in TN buffer (5 mM Tris, 50 mM NaCl) pH 7.5 at 37"C for 24 h. L1 & L4, gene ruler 1 Kb DNA ladder; L2, DNA alone; L3, DNA ? 1,000 lM ZnCl2; DNA ? various complex concentrations L5–L9: L5, 10 lM; L6, 50 lM; L7, 250 lM; L8, 500 lM; L9, 1,000 lM

123

114

Biometals (2010) 23:99–118

NaAsc L1

L2

L3

L4

L5

L6

L7

L8

L9

L10

H2O2

L11

L12 L13

Fig. 7 Electrophoresis results of incubating pBR322 (0.5 lg/ll) with ZnCl2 or [Zn(3-Me-pic)2(phen)] in TN buffer (5 mM Tris, 50 mM NaC) pH 7.5 at 37"C for 2 h in the absence and presence of exogenous agents. L1, L5, L8, L11: gene ruler 1 Kb DNA ladder; L2, DNA alone; L3,

DNA ? 30 lM NaAsc; L4, DNA ? 30 lM H2O2; L6, DNA ? 50 lM ZnCl2; L7, DNA ? 50 lM Zn complex. Lanes 9–10 DNA ? 50 lM compound ? 30 lM NaAsc: L9, ZnCl2; L10, Zn complex. Lanes 12–13 DNA ? 50 lM compound ? 30 lM H2O2: L2, ZnCl2; L13, Zn complex

guanidinium groups cannot cleave pBR322 but can do so efficiently in the presence of 0.10 mM H2O2 (He et al. 2009). Similar activation of some zinc(II) of 1,4,7,10-tetraazacyclododecane ligand with an imidazolium side chain by ascorbate has been reported (Li et al. 2006). To investigate further the role of ascorbate and H2O2 in activating the [Zn(3-Mepic)2(phen)], free radical scavengers, viz. sodium azide (singlet oxygen radical scavenger), tiron (superoxide anion radical scavenger) and thiourea (hydroxyl radical scavenger), were used. DNA nicking by the zinc complex in the presence of ascorbate was not inhibited by these scavengers while that in the presence of H2O2 could only be inhibited by thiourea (data not shown). Thus, DNA cleavage by the zinc complex in the presence of H2O2 involves !OH radical as active species and the catalytic role of the zinc complex is indicated. The cleavage mechanism involving activating the zinc complex by the ascorbate is as yet unknown and unreported.

Topo I inhibition

ZnCl2 1 2 3 4 5 6 7 8 9

1 2

3

phen 4 5 6

DNA topoisomerases are proteins that solve topological problems accompanying key nuclear processes such as DNA replication, transcription, repair, and chromatin assembly by introducing temporary singleor double-strand breaks in the DNA (Carey et al. 2003). Topoisomerase I (topo I) manipulate coiling by unwinding duplex DNA, resulting in a more relaxed structure. It binds to the duplex DNA, cleaves a phosphodiester bond of one strand, passes the other strand through the nick and then relegates the nick. Human topo I can relax both positive and negative supercoils. Supercoiled plasmid DNA pBR322 is suitable substrate for study with topoisomerase I, which is one strand DNA cutter. The supercoiled pBR322 (Form I) is very compact and moves faster in the gel during electrophoresis. When one strand of the supercoiled DNA is cut, the resultant unwinded, more relaxed

7

8

9

1

[Zn(3-Me-pic)2(phen)]

2 3

4 5

6

7 8

9

II I III

(a) Fig. 8 Human topoisomerase I inhibition assay by gel electrophoresis. Electrophoresis results of incubating human topoisomerase I (1 unit/21 ll) with pBR322 in the absence or presence of varying concentration of a ZnCl2, b phen, c [Zn(3Me-pic)2(phen)]. L1, L5: 1 kb DNA ladder; L2, plasmid

123

RN

(b)

(c)

pBR322; L3, DNA ? 40 lM compound; L4, DNA ? 1 unit topo I. Lanes 6–9 DNA ? 1 unit topo I ? varying concentration of compound: L6, 5 lM; L7, 10 lM; L8, 20 lM; L9, 40 lM

Biometals (2010) 23:99–118

open circular pBR322 (Form II) is formed and this nicked DNA moves slower. When two strands of the supercoiled DNA are cut, the linear DNA (Form III) is formed and it moves at intermediate speed. The commercial pBR322 (4.4 kb) has a small amount of both more relaxed Form II and Form III DNA (Fig. 8a–c: lanes 1). Under electrophoresis conditions it was possible to fully separate nicked plasmid pGEM-9Zf(-) (2.9 kb) (uppermost band, labeled Form II) from topoisomers that are relaxed to different degrees by topo I (intermediate bands, labeled ‘RN’) (Webb and Ebeler 2008). In our DNA relaxation assay, one unit of human topo I can completely convert all the supercoiled plasmid pBR322 (4.4 kb) to fully relaxed topoisomer, which is the completely unwound covalently bonded closed circular DNA (Fig. 8, lane 4). This is found in the slowest moving DNA band (labelled Form II) which contains the fully relaxed closed circular pBR322 and the originally present, small amount of nicked DNA (Diana et al. 2008). The difference in plasmid size (compared with the one used by Webb) may account for the inability to separate the fully relaxed pBR322 from the nicked pBR322. Incubating the pBR322 with the highest concentration of test compound (ZnCl2, phen, zinc complex) from 4 to 40 lM, no cleavage or unwinding of the DNA was observed as the banding pattern is the same as the control without any added test compound (Fig. 8, lane 3). As can be seen from Fig. 8a and b (lanes 6–9), the ZnCl2 and phen do not inhibit the activity of the topo I as the DNA bands are the same as those observed for DNA incubated with topo I alone. The present negative results for the ZnCl2 is in agreement with previous findings which found that its concentration needed to be above 80 lM to significantly inhibit topo I and presence of high excess of MgCl2 was needed (Douvas et al. 1991). Very high concentration of ZnCl2 (mM levels) was also reportedly needed to inhibit topo I isolated from shrimp Penaeus japonicas (Chuang et al. 1996). However, incubating the pBR322 with human topo I and increasing concentration of the [Zn(3-Me-pic)2(phen)] complex gives rise to reduction of the nicked band (containing nicked and fully relaxed DNA) and formation of various faster moving bands of topoisomers with different degree of relaxation (RN). At 10 lM of the zinc complex, unchanged supercoiled DNA band starts to appear (Fig. 8c, lane 7). The appearance of

115

slower moving bands of less relaxed topoisomers is observed with increasing concentration of the zinc complex (Fig. 8c, lanes 6–9). These results show that the zinc complex can inhibit the function of topo I in relaxing the supercoiled pBR322, and also show that the degree of inhibition is concentration dependent. This zinc complex is a topo I inhibitor and not a topo I poison (which prevents the nicked DNA from relegation). As a preliminary investigation into the mechanism of action of the above topo I inhibition, we used three variations of mixing the DNA, topo I and the zinc complex (at 50 lM) for the topo I inhibition assay. When the three components are mixed simultaneously, there is extensive inhibition as a fastest wide band appears and this consists of supercoiled DNA and poorly relaxed DNA (Fig. 9, lane 5). The light bands of topoisomers with different degree of relaxation can be seen. When the DNA is first incubated with zinc complex for 30 min before adding the topo I, the fastest moving band is wider, thereby appearing to be nearer to the slowest moving band (Form II). Incubating the topo I with zinc complex first before adding the DNA results in the fastest moving band (Fig. 9, lane 7) which is widest and which is positioned intermediate between those in lane 5 and lane 8. These observed differences in inhibition of topo I suggest initial binding of the zinc complex to either the topo

1

2

3

4

5

6

7

8

Fig. 9 Effect of sequence of mixing for the human topoisomerase I inhibition assay. Electrophoresis results of incubating human topoisomerase I (1 unit/21 ll) with pBR322 (0.5 lg/ll) and 50 lM Zn(3-Me-pic)2(phen). Lanes 1 & 6: 1 kb DNA ladder; L2: DNA alone; L3: DNA ? zinc complex alone; L4: DNA ? 1 unit topo I; L5: simultaneous mixing DNA ? topo I ? zinc complex; L7: incubated topo I ? zinc complex for 30 min, then added DNA with further incubation for another 30 min; L8: incubated DNA ? zinc complex for 30 min, then added topo I and further incubation for another 30 min

123

116

I or the DNA give rise to differences in mode of action. Further investigation is underway. In addition, it is noted that 50 lM this zinc complex is highly efficient topo I inhibitor compared to ZnCl2 which was reported to inhibit less than 10% of topo I activity at 50 lM and which could totally inhibit topo I at 300 lM (Douvas et al. 1991).

Conclusion The [Zn(3-Me-pic)2(phen)] complex shows nucleobase sequence binding selectivity with the following order: ATAT [ AATT [ CG. We postulate that the nature of the 3-methyl-picolinate ligand (as hydrogen bonding capability and C–H!!!p) and the relative orientation of picolinate ligands with respect to the phen ligand predisposes the zinc complex towards the observed DNA recognition. Intercalation of the phen moiety between diagonal nucleobases on opposite DNA strands or adjacent bases on the same DNA strand fixed the orientation of the chelated 3-methylpicolinate ligands for favourable or less favourable interaction with the type of adjacent nucleobases. Besides this DNA binding selectivity, the zinc complex appears to stabilize the G-quadruplex. It can also efficiently inhibit the function of topo I. These two latter properties indicate the potential of this zinc complex as a new targeting anticancer drug. Preliminary investigation shows that it is antiproliferative against MCF-7 breast cancer cells with an IC50 value of 4.8 lM for 72 h incubation (S. T. Von and C. H. Ng (2009) unpublished data).

Supplementary data Supplementary data associated with this article can be found in the online version. CCDC No. 731838 contains the supplementary crystallographic data for this paper. It can be obtained free of charge from The Cambridge Crystallographic Data Centre via www.ccdc.cam.ac. uk/data_request/cif. Acknowledgments The authors like to thank MOSTI of Malaysia for an Science grant (02-02-11-SF0033). IC thanks CNPq (Proc. 472237/2008-0) and Fundunesp (Proc. 00525/08DFP).

123

Biometals (2010) 23:99–118

References Addess KJ, Sinsheimer JS, Feigon J (1993) Solution structure of a complex between [N-MeCys3, N-MeCys7]TANDEM and [d(GATATC)]2. Biochemistry 32:2498–2508 Baker ES, Bernstein SL, Gabelica V, De Pauw E, Bowers MT (2006) G-quadruplexes in telomeric repeats are conserved in a solvent-free environment. Int J Mass Spectrom 253: 225–237 Bazzicalupi C, Bencini A, Bonaccini C, Giorgi C, Gratteri P, Moro S, Palumbo A, Simionato A, Sgrignani J, Sissi C, Valtancoli B (2008) Tuning the activity of Zn(II) complexes in DNA cleavage: clues for design of new efficient metallo-hydrolases. Inorg Chem 47:5473–5484 Beretta GL, Perego P, Zunino F (2008) Targeting topoisomerase I: molecular mechanisms and cellular determinants of response to topoisomerase I inhibitors. Expert Opin Ther Targets 12:1243–1256 Boger DL, Fink BE, Brunette SR, Tse WC, Hedrick MP (2001) A simple, high-resolution method for establishing DNA binding affinity and sequence selectivity. J Am Chem Soc 123:5878–5891 Boseggia E, Gatos M, Lucatello L, Mancin F, Moro S, Palumbo M, Sissi C, Tecilla P, Tonellato U, Zagotto G (2004) Toward efficient Zn(II)-based artificial nucleases. J Am Chem Soc 126:4543–4549 Bruker (2007) APEX2 and SAINT. Bruker AXS Inc, Madison Carey JF, Schultz SJ, Sisson L, Fazzio TG, Champoux JJ (2003) DNA relaxation by human topoisomerase I occurs in the closed clamp conformation of the protein. Proc Nat Acad Sci 100:5640–5645 Chuang N–N, Lin C-L, Chen H–K (1996) Modification of DNA topoisomerase I enzymatic activity with phosphotyrosyl protein phosphatase and alkaline phosphatase from the hepatopancreas of the shrimp Penaeus japonicus (Crustacea: Decapoda). Comp Biochem Physiol l14B: 145–151 Desai AN, Shankar V (2003) Single-strand-specific nucleases. FEMS Microbiol Rev 26:457–491 Diana P, Martorana A, Barraja P, Montalbano A, Dattolo G, Cirrincione G, Dall’ Acqua F, Salvador A, Vedaldi D, Basso Giuseppe, Viola G (2008) Isoindolo[2,1-a]quinoxaline derivatives, novel potent antitumour agents with dual inhibition of tubulin polymerization and topoisomerase I. J Med Chem 51:2387–2399 Di Marco VB, Tapparo A, Dolmella A, Bombi GG (2004) Complexation of 2-hydroxynicotinic and 3-hydroxypicolinic acids with zinc(II). Solution state study and crystal structure of trans-diaaqua-bis-(3-hdyroxypicolinato)zinc(II). Inorg Chim Acta 357:135–142 Douvas A, Lambie PB, Turman MA, Nitahara KS, Hammond L (1991) Negative regulation of Sc1-70/topoisomerase I by zinc and an endogenous macromolecule. Biochem Biophy Res Commun 178:414–421 DS VISUALIZERTM—Accelrys Software Inc. Discovery Studio Visualizer 2.0 Galezowska E, Masternak A, Rubis B, Czyrski A, Rybxzyn´ska, Hermann TW, Juskowia B (2007) Spectroscopic study and G-quadruplex DNA bindinging affinity of two

Biometals (2010) 23:99–118 bioactive papaverine-derived ligands. Int J Biol Macro 41: 558–563 He J, Sun J, Mao Z-W, Ji L-N, Sun H (2009) Phosphodieste hydrolysis and specific DNA binding and cleavage promoted by guanidinium-functionalized zinc complexes. J Inorg Biochem 103:851–858 Ivanow VI, Minchenkova LE, Schyolkina AK, Poletayer AI (1973) Different conformations of double-stranded nucleic acid in solution as revealed by circular dichroism. Biopolymers 12:89–110 Jiang A-L, Cheng Y, Li J, Zhang W (2008) A zinc-dependent endonuclease is responsible for DNA laddering during nuclear salt-induced programmed cell death in root tip cells of rice. J Plant Physiol 165:1134–1141 Jones G, Willet P, Glen RC (1995) Molecular recognition of receptor sites using a genetic algorithm with a description of desolvation. J Mol Biol 245:43–53 Jones G, Willet P, Glen RC, Leach AR, Taylor R (1997) Development and validation of a genetic algorithm for flexible docking. J Mol Biol 267:727–748 Kikuta E, Koike T, Kimura E (2000) Controlling gene expression by zinc(II)–macrocyclic tetraamine complexes. J Inorg Biochem 79:253–259 Kumar Singh S, Joshi S, Ranjan Singh A, Saxena JK, Pandey DS (2007) DNA binding and topoisomerase II inhibitory activity of water-soluble ruthenium(II) and rhodium(III) complexes. Inorg Chem 46:10869–10876 Kypr J, Kejnovska´ I, Rencˇiuk D, Vorlicˇkova´ M (2009) Circular dichroism and conformational polymorphism of DNA. Nucleic Acids Res 37:1713–1725 Li Q-L, Huang J, Wang Q, Jiang N, Xia C-Q, Lin H–H, Wu J, Yu X-Q (2006) Monometallic complexes of 1, 4, 7, 10tetraazacyclododecane containing an imidazolium side: synthesis, characterization, and their interaction with plasmid DNA. Bioorg Med Chem 14:4151–4157 Li J-H, Wang J-T, Zhang L-Y, Chen Z-N, Mao Z-W (2009) Structure, speciation, DNA binding and nuclease activity of two bipyridyl-zinc complexes bearing trimethylaminomethyl groups. Inorg Chim Acta 362:1918–1924 Lin L, Ozaki T, Takada Y, Kageyama H, Nakamura Y, Hata A, Zhang J-H, Simonds WF, Nakagawara A, Koseki H (2005) Topors, a p53 and topoisomerase I-binding RING finger protein, is a coactivator of p53 in growth suppression induced by DNA damage. Oncogene 24:3385–3396 Liu C-L, Wang M, Zhang T-L, Sun H-Z (2004) DNA hydrolysis promoted by di- and multi-nuclear metal complexes. Coord Chem Rev 248:147–168 Lu Y-J, Ou T-M, Tan J-H, Hou J-Q, Shao W-Y, Peng D, Sun N, Wang X-D, Wu W-B, Bu X-Z, Huang Z-S, Ma D-L, Wong K-Y, Gu L-Q (2008) 5-N-methyalated quinoline derivatives as telomeric G-quadruplex stabilising ligands: effects of 5-N positive charge on quadruplex binding affinity and cell proliferation. J Med Chem 51:6381–6392 Malinina L, Soler-Lo´pez M, Aymamı´ J, Subirana JA (2002) Intercalation of an acridine-peptide drug in an AA/TT base step in the crystal structure of [d(CGCGAATT CGCG)](2) with six duplexes and seven Mg(2?) ions in the asymmetric unit. Biochemistry 41:9341–9348 Mancin F, Tecilla P (2007) Zinc(II) complexes as hydrolytic catalysts of phosphate diester cleavage: from model substrates to nucleic acids. New J Chem 31:800–817

117 Nagaoka M, Sugiura Y (2000) Artificial zinc finger peptides: creation, DNA recognition, and gene regulation. J Inorg Biochem 82:57–63 Nagesh N, Krishnaiah A (2003) A comparative study on the interaction of acridine and synthetic bis-acridine with G-quadruplex structure. J Biochem Biophys Methods 57: 65–74 Ng CH, Kong KC, Von ST, Balraj P, Jensen P, Thirthagiri E, Hamad H, Chikira M (2008) Synthesis, characterization, DNA-binding study and anticancer property of ternary metal(II) complexes of EDDA and an intercalating ligand. Dalton Trans (4):447–454 Nordell P, Westerlund F, Wilhelmsson M, Norde´n B, Lincoln P (2007) Kinetic recognition of AT-rich DNA by ruthenium complexes. Angew Chem Int Ed 46:2203–2206. Also references quoted therein Okabe N, Oya N (2000) Copper(II) and zinc(II) complexes of pyridine-2, 6-dicarboxylic acid. Acta Crystallogr C 56: 305–307 Papworth M, Kolasinska P, Minczuk M (2006) Designer zincfinger proteins and their applications. Gene 366:27–38 Patra AK, Bhowmick T, Ramakumar S, Chakravarty AR (2007) Metal-based netropsin mimics showing AT-selective DNA binding and DNA cleavage activity at red light. Inorg Chem 46:9030–9032 Pedretti A, Villa L, Vistoli G (2002) Vega: a versatile program to convert, handle and visualize molecular structure on windows-based PCs. J Mol Graph 21:47–49 Pedretti A, Villa L, Vistoli G (2003) Atom-type description language: a universal language to recognize atom types implemented in the vega program. Theor Chem Acta 109:229–232 Pedretti A, Villa L, Vistoli G (2004) Vega—an open platform to develop chemo-bio-informatics applications, using plug-in architecture and script programming. J Comput Aided Mol Des 18:167–173 Pommier Y (2008) Topoisomerase I inhibitors: camptothecins and beyond. Nat Rev Cancer 6:789–802 Proudfoot EM, Mackay JP, Vagg RS, Vickery KA, Williams PA, Karuso P (1997) D-cis-a-[Ru(RR-picchxnMe2)(phen)]2? shows minor groove AT selectivity with oligonucleotides. Chem Comm (17):1623–1624 Qian J, Gu W, Liu H, Gao F, Feng L, Yan S, Liao D, Cheng P (2007) The first dinuclear copper(II) and zinc(II) complexes containing novel bis-TACN: syntheses, structures, and DNA cleavage activities. Dalton Trans (10):1060–1066 Rajendiran V, Murali M, Suresh E, Palaniandavar M, Periasamy VS, Akbarsha MA (2008) Non-covalent DNA binding and cytotoxicity of certain mixed-ligand ruthenium(II) complexes of 2,20 -dipyridylamine and diimines. Dalton Trans (16):2157–2170 Rajendran A, Nair BU (2006) Unprecedented binding behaviour of acridine group of dye: a combined experimental and theoretical investigation for the development of anticancer chemotherapeutic agents. Biochim Biophys Acta (1760):1794–1801 Ramakrishnan S, Palaniandavar M (2008) Interaction of rac[Cu(diimine)3]2? and rac-[Zn(diimine)3]2? complexes with CT DNA: effect of fluxional Cu(II) geometry on DNA binding, ligand–promoted exciton coupling and prominent DNA cleavage. Dalton Trans (29):3866–3878

123

118 Rothenberg ML (1997) Topoisomerase I inhibitors: review and update. Ann Oncol 8:837–855 Seng HL, Alan Ong HK, Raja Noor ZRAR, Bohari MY, Tiekink ERT, Tan KW, Mohd Jamil M, Caracelli I, Ng CH (2008) Factors affecting nucleolytic efficiency of some ternary metal complexes with DNA binding and recognition domains. Crystal and molecular structure of Zn(phen)(edda). J Inorg Biochem 102:1997–2011 Seng HL, Tan KW, Mohd Jamil M, Tan WT, Hamada H, Chikira M, Ng CH (2009) Copper(II) complexes of methylated glycine derivatives: effect of methyl substituent on their DNA binding and nucleolytic property. Polyhedron 28:2219–2227 Sheldrick GM (1996) SADABS. University of Go¨ttingen, Germany Sheldrick GM (2008) A short history of SHELX. Acta Crystallogr A 64:112–122 Stehbens WE (2003) Oxidative stress, toxic hepatitis, and antioxidants with particular emphasis on zinc. Exp Mol Pathol 75:265–276 Sunami S, Nishimura T, Nishimura I, Ito S, Arakawa H, Ohkubo M (2009) Synthesis and biological activities of topoisomerase I inhibitors, 6-arylmethylamino analogues of edotecarin. J Med Chem 52:3225–3237 Talib J, Green C, Davis KJ, Urathamakul T, Beck JL, AldrichWright JR, Ralph SF (2008) A comparison of the binding of metal complexes to duplex and quadruplex DNA. Dalton Trans 1018–1026 Teicher BA (2008) Next generation topoisomerase I inhibitors: rationale and biomarker strategies. Biochem Pharmacol 75:1262–1271 Wang X, Wang L-K, Kingsbury WD, Johnson RK, Hecht SM (1998) Differential effects of camptothecin derivatives on

123

Biometals (2010) 23:99–118 topoisomerase I-mediated DNA structure modifications. Biochemistry 37:9399–9408 Wang Y, Schnetz-Boutaud NC, Kroth H, Yagi H, Sayer JM, Kumar S, Jerina DM, Stone MP (2008) 30 -Intercalation of a N2-dG 1R-trans-anti-benzo[c]phenanthrene DNA adduct in an iterated (CG)3 repeat. Chem Res Toxicol 21:1348–1358 Waterborg JH, Kuyper CMA (1982) Substrate specificity and mode of action of the zinc-metallo nuclease from Physarum polycephalum. J Biochem 92:1655–1661 Webb MR, Ebeler SE (2008) Comparative analysis of topoisomerase IB inhibition and DNA intercalation by flavonoids and similar compounds: structural determinates of activity. J Food Biochem 32:576–596 Wei C, Tang Q, Li C (2008) Structural transition from the random coil to quadruplex of AG3(T2AG3)3 induced by Zn2?. Biophys Chem 132:110–113 Xu Y, Noguchi Y, Sugiyama H (2006) The new models of the human telomere d[AGGG(TTAGGG)3] in K? solution. Bioorg Med Chem 14:5584–5591 Zeglis BM, Pierre VC, Barton JK (2007) Metallo-intercalators and metallo-insertors. Chem Commun (45):4565–4579 Zhang N, Lin C, Huang X, Kolbanovskiy A, Hingerty BE, Amin S, Broyde S, Geacintov NE, Patel DJ (2005) Methylation of cytosine at C5 in a CpG sequence context causes a conformational switch of a benzo[a]pyrene diol epoxide-N2-guanine adduct in DNA from a minor groove alignment to intercalation with base displacement. J Mol Biol 346:951–965 Zhang W-J, Ou T-M, Lu Y-J, Huang Y-Y, Wu W-B, Huang Z-S, Zhou J-L, Wong K-Y, Gu L-Q (2007) 9-Substituted derivatives as G-quadruplex stabilising ligands in telomeric DNA. Bioorg Med Chem 15:5493–5501

Biometals (2010) 23:119–127 DOI 10.1007/s10534-009-9273-9

Pentavalent methylated arsenicals are substrates of human AQP9 Joseph R. McDermott • Xuan Jiang • Lauren C. Beene • Barry P. Rosen • Zijuan Liu

Received: 22 July 2009 / Accepted: 22 September 2009 / Published online: 4 October 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Liver aquaglyceroporin AQP9 facilitates movement of trivalent inorganic arsenite (AsIII) and organic monomethylarsonous acid (MAsIII). However, the transport pathway for the two major pentavalent arsenic cellular metabolites, MAsV and DMAsV, remains unknown in mammals. These products of arsenic metabolism, in particular DMAsV, are the major arsenicals excreted in the urine of mammals. In this study, we examined the uptake of the two pentavalent organic arsenicals by human AQP9 in Xenopus laevis oocytes. Xenopus laevis oocytes microinjected with AQP9 cRNA exhibited uptake of both MAsV and DMAsV in a pH-dependent manner. The rate of transport was much higher at acidic pH (pH5.5) than at neutral pH. Hg(II), an aquaporin inhibitor, inhibited transport of AsIII, MAsIII, MAsV and DMAsV via AQP9. However, phloretin, which inhibits water and glycerol permeation via AQP9, can J. R. McDermott ! L. C. Beene ! Z. Liu (&) Department of Biological Sciences, Oakland University, Dodge Hall 325, 2200 N. Squirrel Rd, Rochester, MI 48309, USA e-mail: [email protected] X. Jiang ! B. P. Rosen Departments of Biochemistry and Molecular Biology, School of Medicine, Wayne State University, 540 E. Canfield Ave, Detroit, MI 48201, USA B. P. Rosen Florida International University, College of Medicine, 11200 SW 8th Street, HLS II 693, Miami, FL 33199, USA

only inhibit transport of pentavalent MAsV and DMAsV but not trivalent AsIII and MAsIII, indicating the translocation mechanisms of these arsenic species are not exactly the same. Reagents such as FCCP, valinomycin and nigericin that dissipate transmembrane proton potential or change the transmemebrane pH gradient did not significantly inhibit all arsenic transport via AQP9, suggesting the transport of pentavalent arsenic is not proton coupled. The results suggest that in addition to the initial uptake of trivalent inorganic AsIII inside cells, AQP9 plays a dual role in the detoxification of arsenic metabolites by facilitating efflux from cells. Keywords AQP9 ! Liver ! Urine ! Methylation ! Arsenite ! Arsenate ! Monomethylarsonous acid ! Monomethylarsonate ! Dimethylarsinate

Introduction Arsenic is an environmental pollutant and a human carcinogen. It is bioavailable in either of two oxidation states, AsV (arsenate) or AsIII (arsenite). In hepatocytes AsIII is methylated into a variety of species by a multistep pathway, producing organic trivalent and pentavalent mono-, di- and trimethylated arsenic species, including MAsIII (monomethylarsonous acid), MAsV (monomethylarsonic acid), DMAsIII

123

120

Biometals (2010) 23:119–127

(dimethylarsonous acid), DMAsV (dimethylarsinic acid), TMAsVO (trimethylarsine oxide) and TMAsIII (Fig. 1) (Drobna et al. 2006; Lin et al. 2002; Thomas et al. 2007). Humans and most other mammals methylate inorganic arsenic and excrete the methylated species in urine, predominantly DMAsV followed by MAsV (Alauddin et al. 2003). Other species such as the trivalent organic species MAsIII and DMAsIII were not detected previously, possibly due to oxidation, either in vivo or during isolation (Xie et al. 2006). However, recently the detection of these trivalent species (MAsIII and DMAsIII) in urine from rodents and human has been reported (Aposhian et al. 2004; Kenyon et al. 2008). Different arsenicals have different rates of uptake, which, as a rate limiting metabolic step, is related to their overall toxicity. For example, AsIII is taken into cells much faster than AsV, which is a major reason why AsIII is more toxic. The in vivo toxicity of inorganic and organic arsenicals is DMAIII & MAsIII [ AsIII [ AsV [ DMAsV & MAsV [ TMAsVO (SchuhmacherWolz et al. 2009), with trivalent MAsIII and DMAsIII being the most toxic (Drobna et al. 2005; Petrick et al. 2000). Pentavalent DMAsV and TMAsVO are one hundred- and one thousand-fold less toxic than AsIII, respectively (Hirano et al. 2004). Therefore intracelluar transformation of organic pentavalent arsenicals such as MAsV, DMAsV and TMAO is believed to be a detoxification process. In spite of the lower toxicity, O As

HO

OH

2eHO

OH

O Arsenate AsV As

OH

CH3

CH3 DMAIII CH3+ O CH3

As

CH3

OH

As

OH

CH3 DMAsV

2e-

CH3

..

As

CH3

CH3

TMAO

TMAIII

CH3+

O CH

As

OH

OH MAsV

Arsenite AsIII O

2eCH3

As

CH3+

2eCH3

As

OH

OH MAsIII

CH3

Fig. 1 Pathway of arsenic methylation. The arsenic step-bystep menthylation pathway is shown with intermediates indicated. DMAsV is the dominant arsenic product that is detected in human urine of many endemic areas. MAsV and TMAO are always found in human urine. MAsIII and DMAsIII are also found in urine of human and rodents with relatively fewer amounts

123

DMAsV has been shown to be a carcinogen in rodents (Cohen et al. 2006). It was also found that DMAsV is carcinogenic at high doses to the rat urinary bladder, but not in mice (Cohen et al. 2007). However, it is still in debate as to whether arsenic methylation is a detoxification process since it produces the more toxic trivalent species as intermediates (Thomas et al. 2007). Individuals with genetic polymorphisms of the gene for the methylating enzyme, AS3MT, have a different profile of methylated species in their urine (Hernandez et al. 2008), indicating they have different arsenic methylation activities. These inter-individual variations may lead to differential arsenic toxicity and/or carcinogenesis. In addition to in vivo synthesis from inorganic arsenic, humans are directly exposed to organic arsenicals in their food and water. MAsV and DMAsV are widely used as herbicides and pesticides. Inorganic arsenic and DMAsV are also found in rice, which two-thirds of the world’s population consumes as a staple food (Meharg et al. 2008). Therefore, identification of the transport pathways for these species is of importance in elucidation of the health hazards of methylated arsenicals and in evaluation of their overall toxicity and carcinogenesis. Uptake routes for trivalent inorganic arsenite have been identified in recent years. Arsenite uptake is mediated by aquaglyceroporins (AQPs), which is neutral solute channel in both prokaryotes and eukaryotes. In Escherichia coli, GlpF, a bacterial member of the AQP superfamily, conducts arsenite as As(OH)3 (Meng et al. 2004; Sanders et al. 1997). AQPs are membrane channels that include waterselective pores (orthodox aquaporins) and multifunctional channels (aquaglyceroporins) (Agre et al. 1999, 2002). Recently the human aquaglyceroporins AQP7 and AQP9 were shown to conduct As(OH)3 in Xenopus oocytes, with AQP9 catalyzing the highest rate (Liu et al. 2004). AQP9 is expressed predominately in the hepatocytes of the liver, the organ of arsenic detoxification (Tsukaguchi et al. 1998). Therefore, we have proposed that AQP9 is responsible for accumulation of inorganic arsenic in liver (Liu et al. 2002). On the other hand, arsenate, with pKa values of 2.19, 6.94 and 11.5, is taken up via phosphate transporters in prokaryotes and eukaryotes (Bun-ya et al. 1996; Rosenberg et al. 1977; Yompakdee et al. 1996). In mammals, the type II Na?/Pi co-transporter,

Biometals (2010) 23:119–127

121

E. coli strain JM109 [recA1 supE44 endA1 hsdR17 gyrA96 relA1 thi D(lac-proAB) F0 (traD36 proAB ? lacI q lacZDM15] and JM110 [rps (Strr) thr leu thi-1 lacY galK galT ara tonA tsx dam dcm supE44 D(lacproAB) [F0 traD36 proAB lacIqZDM15] was used for molecular cloning. E. coli cells were grown in LB medium supplemented when necessary with 125 lg/ ml ampicillin.

SCL34a2a, has been shown to transport arsenate into renal cells (Hartmann et al. 1995; Xu et al. 2002), so it is reasonable to consider that phosphate transporters mediate uptake of AsV into liver as well. However, it is well know that AsV uptake in a varieties of prokaryotic and eukayotic cells are much slower than AsIII, which explains its lesser toxicity. We recently reported that the trivalent organic arsenical MAsIII is also transported by rat AQP9 three times faster than AsIII (Liu et al. 2006b). Since AQP9 is a bi-directional channel, intracellular MAsIII would flow out of hepatocytes into the blood stream down its concentration gradient. In this study, we demonstrated that human AQP9 also transports MAsIII at a rate 5-times higher than AsIII. In addition to AQP9, here we reported that despite their high sequence similarity (77%), mouse but not human AQP7 can transport MAsIII, which is similar to AQP9 in the rate of transport of MAsIII. Humans and rodents have different metabolism of arsenic and thus have different levels of methylated species such as MAsIII (Wang et al. 2002). Together the different methylation pattern and transport profile of these arsenicals constitute a large difference between human and mouse. However, the identification of the transporters for the major arsenic metabolites in liver, MAsV and DMAsV, the species found in urine, remains unknown in mammals (Alauddin et al. 2003). Recently it was reported that a AQP9 homologue, Lsi1 in Oryza sativa can transport MAsV and DMAsV in a pH dependent manner (Li et al. 2009). Here we report that AQP9 mediates transport of MAsV and DMAsV. This finding not only explains how arsenic metabolites can go from liver to other tissues but also highlights the multiple roles of AQP9 in both influx of inorganic arsenic and efflux of organic products. In addition, identification of the uptake pathway for pentavalent organoarsenicals indicates how environmental pollutants such as MAsV and DMAsV may be taken into the human body.

Transport assays

Materials and methods

Statistical analysis

Strains and plasmids

All experiments contain at least two batches of oocytes from two animals; at least 3 replicates are used each time. One batch of experiments is used to present in this paper.

Mouse and human AQP7 and AQP9 were cloned into pXbG-ev1, as described previously (Liu et al. 2002).

Expression of AQP7/AQP9 in Xenopus oocytes Capped cRNAs were synthesized in an in vitro reaction using mMessage mMachine T3 ultra kit (Applied Biosystem) with pXbG-ev1 plasmids linearized with NotI (Liu et al. 2006a). Oocytes from Xenopus laevis were defolliculated and injected with 25 ng of cRNA or with 50 nl of water. They were then incubated in complete ND96 buffer for 3 days at 16"C and used for uptake assays.

For assay of metalloid accumulation in oocytes, oocytes were incubated in 1 mM each of sodium arsenite (AsIII, Sigma), sodium monomethylarsenite (MAsIII, a gift from Miroslav Styblo in University of North Carolina at Chapel Hill), monosodium acid methanearsonate (MAsV, Chem Service) or cacodylic acid (DMAsV, Sigma) at room temperature for 60 min. When necessary, oocytes were pretreated by 20 lM carbonyl cyanide 4-trifluoromethoxyphenylhydrazone (FCCP, Sigma), 10 lM phloretin (Sigma), 100 lM valinomycin (Sigma) or 100 lM nigericin (Sigma) for 30 min or 200 lM Hg(II) (mercury chloride, Sigma) for 5 min before arsenic transport assay. The oocytes were then collected and washed in ND96 buffer three times (Liu et al. 2006a). Oocytes were completely digested using 70% (vol/vol) HNO3 for at least 2 h. The samples were then diluted with HPLC grade water, and total arsenic was determined by inductively coupled plasma mass spectroscopy (ICP-MS) (ELAN 9000, PerkinElmer, Norwalk, CT).

123

MAsIII is differentially transported by mouse and human AQP7 in Xenopus oocytes The ability of human and mouse AQP7 to conduct AsIII, MAsIII, MAsV or DMAsV at different pH levels in oocytes was examined. Mouse AQP7 transports both AsIII and MAsIII, but not MAsV and DMAsV at pH5.5, 6.5 and 7.5 (Fig. 2). MAsIII was transported at a five-fold higher rate than that of AsIII. However, human AQP7 transports only inorganic AsIII (Fig. 2c). It is striking that the transport profile of arsenic is different in human and mouse, considering that mouse is often used as a model for arsenicassociated carcinogenesis (Wang et al. 2002). MAsV and DMAsV are transported by human AQP9 The ability of human AQP9 to increase AsIII, MAsIII, MAsV and DMAsV permeability at different pH levels in oocytes was examined. Transport of five different trivalent and pentavalent arsenicals, including AsIII, MAsIII, AsV, MAsV and DMAsV, at pH5.5, 6.5 and 7.5, respectively was assayed (Fig. 3a, b). The results show that human AQP9 facilitates uptake of trivalent arsenicals (AsIII and MAsIII) and organic pentavalent arsenicals (MAsV and DMAsV). However, under these conditions, hAQP9 did not conduct AsV (data not shown). We previously reported that rat AQP9 facilitates MAsIII uptake more efficiently than inorganic AsIII. Here we show that human AQP9 also transports MAsIII more efficiently than AsIII, with a rate five-fold higher than that of AsIII. Within the pH range from 5.5 to 7.5, uptake of AsIII and MAsIII were equivalent. Inorganic AsV is not transported in any of the pH conditions tested, which is consistent with our previous observation using rat AQP9 (Liu et al. 2002). However, MAsV and DMAsV are conducted in a pH-dependent manner (Fig. 3c, d). Transport of DMAsV at pH 5.5 is more efficient than AsIII and comparable to the efficiency of glycerol transport

123

MAsIII uptake by mAQP7 (pmol/min/oocyte)

Results

AsIII uptake by hAQP7 (pmol/min/oocyte)

Quantitative results are shown as means ± standard deviations. The statistical analysis was performed by ANOVA. P \ 0.05 were considered significant, and all figures represent at least P \ 0.01.

Biometals (2010) 23:119–127 AsIII uptake by mAQP7 (pmol/min/oocyte)

122 10

A

H2O injected mAQP7 injected

8

6

4

2

0

40

pH5.5

pH6.5

B

pH7.5

H2O injected mAQP7 injected

30

20

10

0

12

pH5.5

pH6.5

C

pH7.5

H2O injected hAQP7 injected

10 8 6 4 2 0

pH5.5

pH6.5

pH7.5

Fig. 2 Arsenical transport by mouse and human AQP7. Transport of trivalent species by human and mouse AQP7 was examined under different pH conditions. a: AsIII uptake via mouse AQP7. b. MAsIII uptake via mouse AQP7. c: AsIII uptake via human AQP7. The open bars represents arsenic uptake via AQP7, and the solid bars are the water injected controls

(data not shown). Transport of MAsV is less efficient at physiological pH (Fig. 3c) and is observed mostly under acidic conditions. Both MAsV and DMAsV

5

A

H2O injected hAQP9 injected

4 3 2 1 0

1.4 1.2

pH5.5

pH6.5

C

pH7.5

H2O injected hAQP9 injected

1.0 0.8 0.6 0.4 0.2 0.0

pH5.5

pH6.5

pH7.5

MAsIII uptake (pmol/min/oocyte)

6

123

DMAsV uptake (pmol/min/oocyte)

MAsV uptake (pmol/min/oocyte)

AsIII uptake (pmol/min/oocyte)

Biometals (2010) 23:119–127

30

B

H2O injected hAQP9 injected

20

10

0

10

pH5.5

pH6.5

D

pH7.5

H2O injected hAQP9 injected

8 6 4 2 0

pH5.5

pH6.5

pH7.5

open bars represents arsenic uptake via hAQP9, and the solid bars are the water injected controls

exhibit much lower transport at higher pH, indicating the neutral forms of these compounds are substrates for AQP9, as discussed below.

blocking the water permeable channel (Savage and Stroud 2007), To examine whether Hg(II) inhibits transport of all arsenicals, mercury chloride was added to the transport buffer at a final concentration of 200 lM (Fig. 4a). Transport of all tested trivalent and pentavalent arsenicals was inhibited significantly by Hg(II), indicating that binding of mercury blocks a common permeation pathway for both trivalent and pentavalent arsenicals. Phloretin, another inhibitor of

Effect of mercury and phloretin on arsenic transport by AQP9

Arsenical uptake (pmol/min/oocyte)

Hg(II) is an inhibitor of aquaporins that inhibits water permeation by binding to a cysteine thiol group,

25

A

Without Hg(II) With Hg(II)

20 15 10 5 0

AsIII

MAsIII

MAsV

DMAsV

Fig. 4 Effect of Hg(II) and phloretin on arsenic transport by hAQP9. a: Arsenic uptake inhibited by mercury. b. Arsenic uptake inhibited by phloretin. Oocytes were pretreated with HgCl2 (200 lM) for 5 min or phloretin (100 lM) for 60 min at pH 5.5. To initiate transport, the indicated arsenicals were

Arsenical uptake (pmol/min/oocyte)

Fig. 3 Arsenic transport by AQP9. Transport of arsenicals by hAQP9 was examined under different pH conditions. a: AsIII uptake. b. MAsIII uptake. c: MAsV uptake. d. DMAsV. The

30

B

Without Phloretin With Phloretin

25 20 15 10 5 0

AsIII

MAsIII

MAsV

DMAsV

added to a final concentration of 1 mM. The oocytes were washed three times using the same buffer and digested for metalloid quantification. The solid bars represents arsenic uptake via hAQP9 without treatment, while the open bars are treated by either mercury or phloretin

123

124

Biometals (2010) 23:119–127 30

AQP9 that inhibits both water and glycerol permeation (Ishibashi et al. 1998; Tsukaguchi et al. 1999), completely inhibited transport of pentavalent arsenicals but not transport for trivalent AsIII and MAsIII (Fig. 4b). These results suggest that, although those substrates likely share a single translocation pathway, their mechanisms of transport are not entirely identical.

To examine whether transport of pentavalent arsenic via AQP9 is coupled to the proton motive force, the effect of valinomycin, nigericin, and FCCP (Collins and Larson, 2005; Hagos et al. 2007; Sweet and Pritchard 1999), which dissipate the transmembrane potential, or changes the transmembrane pH gradient, or both, was examined. After 30 min of incubation, arsenicals were added each at a final concentration of 1 mM. Valinomycin, nigericin or FCCP did not significantly inhibit the trivalent or pentavalent arsenic transport (Fig. 5a–c), indicating transport of none of the tested arsenicals occurs in a protoncoupled manner.

Without FCCP With FCCP

20 15 10 5 0

Arsenical uptake (pmol/min/oocyte)

Effect of carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP), valinomycin and nigericin on arsenic transport via AQP9

A

25

40

AsIII

MAsIII

B

MAsV

DMAsV

Without valinomycin With valinomycin

30

20

10

0

AsIII

25

MAsIII

MAsV

C

DMAsV Without Nigericin With Nigericin

20

Discussion 15

Arsenic is a major environmental toxin, mostly due to the combination of its ubiquitous environmental presence and toxicity. Inorganic AsIII is taken into most organisms adventitiously by aquaglyceroporin channels and is subsequently methylated to more toxic trivalent forms and to less toxic pentavalent forms (Fig. 1). In this study, we demonstrated that human AQP9 facilitates transport of pentavalent products MAsV and DMAsV. How are these predominantly anionic pentavalent species recognized by neutral solute channels? AQP1 and GlpF have been demonstrated to transport only neutral species but not proton and ions (Fu and Lu 2007; Saparov et al. 2005). Since AQP9 has corresponding NPA (Asp-Pro-Ala) and Arginine ring regions that have been identified as proton filters (Fu and Lu 2007), it is likely that AQP9 also conducts only neutral species. Trivalent arsenite, with a pKa value of 9.1, exists primarily as As(OH)3 at

123

10 5 0

AsIII

MAsIII

MAsV

DMAsV

Fig. 5 Effect of FCCP, valinomycin and nigericin on arsenical transport by hAQP9. a Arsenic uptake inhibited by FCCP. b Arsenic uptake inhibited by valinomycin. c Arsenic uptake inhibited by nigericin. Oocytes were pretreated with FCCP (20 lM), valinomycin (100 lM), or nigericin (10 lM) for 60 min at pH 5.5. To initiate transport, the indicated arsenicals were added to a final concentration of 1 mM. The oocytes were washed 3 times using the same buffer and digested for metalloid quantification. The solid bars represents arsenic uptake via AQP9 without treatment, while the open bars are treated

physiological pH (Ramirez-Solis et al. 2004). In contrast, at physiological pH, arsenate, with pKa values of 2.2, 7 and 11.6, is a mixture of the anions

Biometals (2010) 23:119–127

125

H2AsO4- and HAsO-2 4 , and these are not transported by hAQP9 (data not shown). The organic pentavalent arsenical MAsV has two pKa values, 3.6 and 8.2, and DMAsV has a single pKa of 6.5. Therefore, MAsV and DMAsV exist in equilibrium between the neutral undissociated and anionic species at physiological pH and below. Both MAsV and DMAsV were transported at pH 7.5, and the rates were higher at pH 5.5. The lower pH would alter the transmembrane gradient and membrane potential, but the dissipation of these gradients by FCCP, nigericin, and valinomycin did not affect transport (Fig. 5a–c). Thus we reason that both pentavalent methylated species are substrates of AQP9 as uncharged molecules. At pH 6.5, transport of both MAsV and DMAsV was 50% slower than at pH 5.5. At pH 7.5, which is close to physiological pH, transport of MAsV was limited, presumably because most of the molecules were dissociated to anionic species. At pH 7.5, where 10% of the DMAsV can be calculated to be undissociated, significant uptake by AQP9 remained.

What is the physiological relevance of transport of AsIII and its products MAsIII, MAsV and DMAsV by hAQP9? Arsenic accumulates in multiple tissues including liver, and methylation of arsenic is to found to be mainly in liver, whereas other organs are not excluded (Lin et al. 2002). AsIII can enter the hepatocyte through AQP9 and following methylation flows out of liver via AQP9 down its concentration gradient into the blood stream via AQP9 and ends up in urine (Fig. 6). Even though the rate of transport of the pentavalent arsenicals is not as high at physiological pH as at pH 5.5, the equilibrium between the undissociated and anionic species ensures that, by mass action, the pentavalent species will continuously flow downhill from the hepatocyte into the blood stream. These findings addressed the multiple roles of AQP9 in the uptake of more toxic trivalent inorganic species and efflux of much less toxic organic pentavalent species and are consistent with the unique role of hAQP9 in liver arsenic detoxification.

AsV

AsIII

Pho 2GSH

AQP9 GSSG

AsV

SAM

AsIII 3GSH

SAH 2GSH

As(GS)3

MAsV

AsIII SAM GSH

SAH

GSSG GSH

DMAsV

MAs(GS)2 DMA(GS)

MRP

Bile flow Fig. 6 Hypothetical pathway of arsenical transport and cellular metabolism in heptocytes. AsIII enters the hepatocyte down its concentration gradient via hAQP9, and it can also be generated by reduction of AsV, which enters through phosphate transporters. Methylation of AsIII produces MAsV and DMAsV, as well as other species not shown. Both inorganic and organic

AQP9

Blood flow trivalent species can be glutathionated, and are pumped into the bile by MRP2 (multiple-drug resistant protein 2) (Kala et al., 2000). MAsV and DMAsV flow into the blood stream down their concentration gradients via AQP9. GSH, glutathione; SAM, s-adenosylmethionine; SAH, s-adenosylhomocysteine; GSSG, glutathione-disulfide

123

126 Acknowledgments We thank Dr. Fangjie Zhao for his suggestions. This work was supported by NIH GM55425 to B.P.R. and NIH ES016856 to Z.L.

References Agre P, Mathai JC, Smith BL, Preston GM (1999) Functional analyses of aquaporin water channel proteins. Methods Enzymol 294:550–572 Agre P, King LS, Yasui M, Guggino WB, Ottersen OP, Fujiyoshi Y, Engel A, Nielsen S (2002) Aquaporin water channels—from atomic structure to clinical medicine. J Physiol 542:3–16 Alauddin M, Alauddin ST, Bhattacharjee M, Sultana S, Chowdhury D, Bibi H, Rabbani GH (2003) Speciation of arsenic metabolite intermediates in human urine by ion-exchange chromatography and flow injection hydride generation atomic absorption spectrometry. J Environ Sci Health A Tox Hazard Subst Environ Eng 38: 115–128 Aposhian HV, Zakharyan RA, Avram MD, Sampayo-Reyes A, Wollenberg ML (2004) A review of the enzymology of arsenic metabolism and a new potential role of hydrogen peroxide in the detoxication of the trivalent arsenic species. Toxicol Appl Pharmacol 198:327–335 Bun-ya M, Shikata K, Nakade S, Yompakdee C, Harashima S, Oshima Y (1996) Two new genes, PHO86 and PHO87, involved in inorganic phosphate uptake in Saccharomyces cerevisiae. Curr Genet 29:344–351 Cohen SM, Arnold LL, Eldan M, Lewis AS, Beck BD (2006) Methylated arsenicals: the implications of metabolism and carcinogenicity studies in rodents to human risk assessment. Crit Rev Toxicol 36(2):99–133 Cohen SM, Ohnishi T, Arnold LL, Le XC (2007) Arsenicinduced bladder cancer in an animal model. Toxicol Appl Pharmacol 222:258–263 Collins A, Larson M (2005) Regulation of inward rectifier K ? channels by shift of intracellular pH dependence. J Cell Physiol 202:76–86 Drobna Z, Waters SB, Devesa V, Harmon AW, Thomas DJ, Styblo M (2005) Metabolism and toxicity of arsenic in human urothelial cells expressing rat arsenic (?3 oxidation state)-methyltransferase. Toxicol Appl Pharmacol 207:147–159 Drobna Z, Xing W, Thomas DJ, Styblo M (2006) shRNA silencing of AS3MT expression minimizes arsenic methylation capacity of HepG2 cells. Chem Res Toxicol 19:894–898 Fu D, Lu M (2007) The structural basis of water permeation and proton exclusion in aquaporins. Mol Membr Biol 24:366–374 Hagos Y, Stein D, Ugele B, Burckhardt G, Bahn A (2007) Human renal organic anion transporter 4 operates as an asymmetric urate transporter. J Am Soc Nephrol 18:430– 439 Hartmann CM, Wagner CA, Busch AE, Markovich D, Biber J, Lang F, Murer H (1995) Transport characteristics of a murine renal Na/Pi-cotransporter. Pflugers Arch 430:830– 836

123

Biometals (2010) 23:119–127 Hernandez A, Xamena N, Sekaran C, Tokunaga H, SampayoReyes A, Quinteros D, Creus A, Marcos R (2008) High arsenic metabolic efficiency in AS3MT287Thr allele carriers. Pharmacogenet Genomics 18:349–355 Hirano S, Kobayashi Y, Cui X, Kanno S, Hayakawa T, Shraim A (2004) The accumulation and toxicity of methylated arsenicals in endothelial cells: important roles of thiol compounds. Toxicol Appl Pharmacol 198:458–467 Ishibashi K, Kuwahara M, Gu Y, Tanaka Y, Marumo F, Sasaki S (1998) Cloning and functional expression of a new aquaporin (AQP9) abundantly expressed in the peripheral leukocytes permeable to water and urea, but not to glycerol. Biochem Biophys Res Commun 244:268–274 Kala SV, Neely MW, Kala G, Prater CI, Atwood DW, Rice JS, Lieberman MW (2000) The MRP2/cMOAT transporter and arsenic-glutathione complex formation are required for biliary excretion of arsenic. J Biol Chem 275:33404– 33408 Kenyon EM, Hughes MF, Adair BM, Highfill JH, Crecelius EA, Clewell HJ, Yager JW (2008) Tissue distribution and urinary excretion of inorganic arsenic and its methylated metabolites in C57BL6 mice following subchronic exposure to arsenate in drinking water. Toxicol Appl Pharmacol 232:448–455 Li RY, Ago Y, Liu WJ, Mitani N, Feldmann J, McGrath SP, Ma JF, and Zhao FJ (2009) The rice aquaporin Lsi1 mediates uptake of methylated arsenic species. Plant Physiol 150(4):2071–2080 Lin S, Shi Q, Nix FB, Styblo M, Beck MA, Herbin-Davis KM, Hall LL, Simeonsson JB, Thomas DJ (2002) A novel Sadenosyl-L-methionine:arsenic(III) methyltransferase from rat liver cytosol. J Biol Chem 277:10795–10803 Liu Z, Shen J, Carbrey JM, Mukhopadhyay R, Agre P, Rosen BP (2002) Arsenite transport by mammalian aquaglyceroporins AQP7 and AQP9. Proc Natl Acad Sci U S A 99:6053–6058 Liu Z, Carbrey JM, Agre P, Rosen BP (2004) Arsenic trioxide uptake by human and rat aquaglyceroporins. Biochem Biophys Res Commun 316:1178–1185 Liu Z, Sanchez MA, Jiang X, Boles E, Landfear SM, Rosen BP (2006a) Mammalian glucose permease GLUT1 facilitates transport of arsenic trioxide and methylarsonous acid. Biochem Biophys Res Commun 351:424–430 Liu Z, Styblo M, Rosen BP (2006b) Methylarsonous acid transport by aquaglyceroporins. Environ Health Perspect 114:527–531 Meharg AA, Lombi E, Williams PN, Scheckel KG, Feldmann J, Raab A, Zhu Y, Islam R (2008) Speciation and localization of arsenic in white and brown rice grains. Environ Sci Technol 42:1051–1057 Meng YL, Liu Z, Rosen BP (2004) As(III) and Sb(III) uptake by GlpF and efflux by ArsB in Escherichia coli. J Biol Chem 279:18334–18341 Petrick JS, Ayala-Fierro F, Cullen WR, Carter DE, Vasken Aposhian H (2000) Monomethylarsonous acid (MMA(III)) is more toxic than arsenite in Chang human hepatocytes. Toxicol Appl Pharmacol 163:203–207 Ramirez-Solis A, Mukopadhyay R, Rosen BP, Stemmler TL (2004) Experimental and theoretical characterization of arsenite in water: insights into the coordination environment of As–O. Inorg Chem 43:2954–2959

Biometals (2010) 23:119–127 Rosenberg H, Gerdes RG, Chegwidden K (1977) Two systems for the uptake of phosphate in Escherichia coli. J Bacteriol 131:505–511 Sanders OI, Rensing C, Kuroda M, Mitra B, Rosen BP (1997) Antimonite is accumulated by the glycerol facilitator GlpF in Escherichia coli. J Bacteriol 179: 3365–3367 Saparov SM, Tsunoda SP, Pohl P (2005) Proton exclusion by an aquaglyceroprotein: a voltage clamp study. Biol Cell 97:545–550 Savage DF, Stroud RM (2007) Structural basis of aquaporin inhibition by mercury. J Mol Biol 368:607–617 Schuhmacher-Wolz U, Dieter HH, Klein D, Schneider K (2009) Oral exposure to inorganic arsenic: evaluation of its carcinogenic and non-carcinogenic effects. Crit Rev Toxicol 39:271–298 Sweet DH, Pritchard JB (1999) rOCT2 is a basolateral potential-driven carrier, not an organic cation/proton exchanger. Am J Physiol 277:F890–898 Thomas DJ, Li J, Waters SB, Xing W, Adair BM, Drobna Z, Devesa V, Styblo M (2007) Arsenic (?3 oxidation state) methyltransferase and the methylation of arsenicals. Exp Biol Med (Maywood) 232:3–13

127 Tsukaguchi H, Shayakul C, Berger UV, Mackenzie B, Devidas S, Guggino WB, van Hoek AN, Hediger MA (1998) Molecular characterization of a broad selectivity neutral solute channel. J Biol Chem 273:24737–24743 Tsukaguchi H, Weremowicz S, Morton CC, Hediger MA (1999) Functional and molecular characterization of the human neutral solute channel aquaporin-9. Am J Physiol 277:F685–696 Wang JP, Qi L, Moore MR, Ng JC (2002) A review of animal models for the study of arsenic carcinogenesis. Toxicol Lett 133:17–31 Xie R, Johnson W, Spayd S, Hall GS, Buckley B (2006) Arsenic speciation analysis of human urine using ion exchange chromatography coupled to inductively coupled plasma mass spectrometry. Anal Chim Acta 578:186–194 Xu H, Inouye M, Missey T, Collins JF, Ghishan FK (2002) Functional characterization of the human intestinal NaPiIIb cotransporter in hamster fibroblasts and Xenopus oocytes. Biochim Biophys Acta 1567:97–105 Yompakdee C, Bun-ya M, Shikata K, Ogawa N, Harashima S, Oshima Y (1996) A putative new membrane protein, Pho86p, in the inorganic phosphate uptake system of Saccharomyces cerevisiae. Gene 171:41–47

123

Biometals (2010) 23:129–134 DOI 10.1007/s10534-009-9272-x

Temporal production of the two Bacillus anthracis siderophores, petrobactin and bacillibactin Melissa K. Wilson • Rebecca J. Abergel • Jean E. L. Arceneaux • Kenneth N. Raymond B. Rowe Byers

•

Received: 1 September 2009 / Accepted: 23 September 2009 / Published online: 9 October 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Bacillus anthracis secretes two siderophores, petrobactin (PB) and bacillibactin (BB). These siderophores were temporally produced during germination and outgrowth of spores (the usual infectious form of B. anthracis) in low-iron medium. The siderophore PB was made first while BB secretion began several hours later. Spore outgrowth early in an infection may require PB, whereas delayed BB production suggests a role for BB in the later stages of the infection. Incubation of cultures (inoculated as vegetative cells) at 37"C, as compared to 2"C, increased PB production and decreased secretion of BB, suggesting that the production of PB and BB responded to the host temperature signal. The dual

M. K. Wilson ! J. E. L. Arceneaux ! B. R. Byers (&) Department of Microbiology, University of Mississippi Medical Center, Jackson, MS 39216, USA e-mail: [email protected] R. J. Abergel ! K. N. Raymond Department of Chemistry, University of California, Berkeley, CA 94720, USA Present Address: M. K. Wilson Department of Microbiology and Immunology, Uniformed Services University of the Health Sciences, Bethesda, MD 20714, USA R. J. Abergel Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA

siderophores of B. anthracis may fulfill independent roles in the life cycle of B. anthracis. Keywords Siderophores ! Petrobactin ! Bacillibactin ! Iron ! Anthrax Introduction To successfully establish an infection in the iron restricted environment of a normal mammalian host, a pathogenic microorganism must acquire iron from the host iron sources (Byers and Arceneaux 1998). Notable among the microbial iron uptake mechanisms, siderophores are low molecular mass iron chelating agents synthesized by microbes to gather iron and deliver it to the microbe. The concept that some siderophores are virulence factors was strengthened by the discovery that the mammalian protein siderocalin is a component of the host innate iron-depletion defenses that attacks siderophore-mediated iron uptake by binding siderophores (Goetz et al. 2002; Flo et al. 2004; Abergel et al. 2006). Bacillus anthracis, the etiologic agent of the disease anthrax, evades siderocalin by producing the virulence-associated siderophore petrobactin (PB) (Garner et al. 2004; Koppisch et al. 2005; Wilson et al. 2006). PB is constructed on a citrate bisspermidine scaffold with two 3,4-dihydroxybenzoate (3,4-DHB) caps linked to the spermidinyl arms (Bergeron et al. 2004). The 3,4 hydroxylation pattern of the iron binding moieties is unusual in catecholate

123

130

siderophores and precludes insertion of PB within the binding pocket of siderocalin (Abergel et al. 2006)). B. anthracis DasbA, a mutant strain unable to produce PB, is both attenuated for growth in macrophages and significantly less virulent than its parent strain in a mouse infection assay (Cendrowski et al. 2004). B. anthracis also produces a second siderophore, bacillibactin (BB), that incorporates catecholate groups of the more commonly found 2,3 hydroxylation pattern (Koppisch et al. 2005) and which is found in several species of the genus Bacillus, including Bacillus subtilis (May et al. 2001). Siderocalin binds BB (Abergel et al. 2006), probably rendering BB unable to deliver iron to B. anthracis and loss of BB production does not alter the virulence of B. anthracis in a mouse model (Cendrowski et al. 2004). Although BB is a major iron deficiency rescue system in B. subtilis (Miethke et al. 2006), in iron depleted culture medium the capacity to produce BB does not support normal growth of B. anthracis asb mutant strains that fail to synthesize PB (Cendrowski et al. 2004; Lee et al. 2007) and outgrowth of spores of B. anthracis under iron restriction requires PB (Lee et al. 2007). The usual infectious form of B. anthracis is the spore and spore germination in the herbivore host produces vegetative cells that multiply as the infection progresses (Mock and Fouet 2001). Both PB and BB are produced by pathogenic strains of B. anthracis (Koppisch et al. 2008b) but it is unknown if the two siderophores are produced simultaneously during spore germination and outgrowth in the iron restricted environment of the host (Byers and Arceneaux 1998) and if syntheses of the siderophores are responsive to host signals. Timed or temporal production of the siderophores might suggest independent roles for PB and BB during the B. anthracis life cycle from spore germination, vegetative cell replication, and final resporulation. A hierarchy of controls may adjust siderophore production to the life cycle of B. anthracis.

Materials and methods Bacterial strains, culture media cultivation procedures, spore preparation, siderophore purification The Sterne strain B. anthracis USAMRIID (Garner et al. 2004; Wilson et al. 2006) that lacks plasmid

123

Biometals (2010) 23:129–134

pXO2 of the two virulence plasmids pXO1 and pXO2 was obtained from P. Worsham. Bacteria were kept in long-term storage as spores. The Controlled Trace Metal (CTM) medium for growth and siderophore production studies was prepared as previously described (Garner et al. 2004), either with a high iron (Fe = 36 lM) or low iron (Fe = 0.1 lM) supplement. Spores used to inoculate cultures for determination of siderophore production during germination and outgrowth were prepared as follows. After incubation for 12–14 days at 30"C on sporulation agar (composed of, per l, 23 g nutrient agar, 0.5 g yeast extract, 0.006 g MnCl2, and 0.078 g CaCl2) the bacterial growth was removed from the agar and diluted in sterile water. The suspensions were incubated for 30 min in a 65"C water bath to kill vegetative cells (Turnbull et al. 2007). The spores then were washed four times by centrifugation and suspension of the pellets in sterile water. To remove the dead vegetative cells, the final spore suspension was filtered through a sterile glass microfiber 3.1 lm filter (Russell et al. 2007). Spores were enumerated as colony forming units (CFU) per ml by dilution plate counting on Brain–Heart Infusion (BHI) agar plates. For germination and outgrowth experiments, high- and low-iron CTM media (also supplemented with the germinant L-alanine at 50 mM concentration) were inoculated with spores at an initial A600 of 0.09. The cultures were incubated at 37"C or kept at 0"C (controls) and germination and outgrowth were followed by turbidity measurements (A600). Culture samples were collected at timed intervals for analyses by reverse phase HPLC for amount and type of siderophore produced. For cultures inoculated with vegetative cells, bacteria were transferred from BHI agar slants to 25 ml of high-iron CTM medium that was incubated at 37"C with shaking at 300 rpm for 16–17 h. This culture was centrifuged and the cell pellet washed once by suspension in CTM medium (without an iron supplement) and re-centrifugation. The final washed cell pellet was suspended and diluted appropriately in CTM medium (without an iron supplement) for inoculation of high- and low-iron CTM medium, usually at 104 CFU per ml. Cultures were incubated in air at the desired temperature with shaking at 300 rpm. Growth was followed by turbidity measurements (A600).

Biometals (2010) 23:129–134

131

Detection and quantification of siderophore secretion The culture samples were filtered through 0.22 lm pore diameter filters to remove cells and the filtrates were then analyzed using high pressure liquid chro˚ 5 lm porous matography on Zorbax Rx-SIL C18 80 A silica support (reverse phase) with gradient mixtures of acetonitrile, water (purified through a Millipore Milli-Q cartridge system), and trifluoroacetic acid. Samples were injected as 20 ll aliquots onto an analytical Eclipse XDB-C18 column (Agilent). A gradient from 5% CH3CN to 30% CH3CN in ddH2O/ 0.1% TFA over 20 min at 1 ml/min was used to elute 3,4-DHB (tR = 5.3–5.4 min), PB (tR = 6.6–6.7 min) and BB (tR = 14.6–14.7 min) as discrete peaks (detection by UV–vis absorption at 254, 280 and 316 nm). Concentrations were determined against 0.1 mM standard ligand solutions using the liquid chromatography Agilent Chemstation. The siderophores PB and BB were purified from culture filtrates of B. anthracis USAMRIID (Wilson et al. 2006) and Bacillus thuringiensis ATCC 33679 (Dertz et al. 2006), respectively, following protocols described in the designated references; 3,4-DHB was obtained from Sigma Chemical Co. Due to the relative extinction coefficients of the siderophores at the detection wavelengths, the minimum detectable concentrations of 3,4-DHB, PB and BB in each 20 ll sample were 1.5, 1 and 1 lM, respectively.

Results and discussion Temporal siderophore secretion; early production of PB during outgrowth from spores Because the disease anthrax begins with spore germination in the host, we followed siderophore secretion during the early hours of germination and outgrowth in cultures inoculated with spores. When spores of B. anthracis were inoculated into either lowand high-iron CTM medium supplemented with the germinant L-alanine (50 mM) and incubated at 37"C, there was an initial decrease in culture turbidity due to germination of spores; subsequent spore outgrowth then was evidenced by an increase in turbidity (Fig. 1a). Similarly inoculated control cultures kept on ice did not show turbidity changes indicative of

Fig. 1 Temporal secretion of PB and BB during germination and outgrowth of B. anthracis USAMRIID spores. Spores were inoculated in low- and high-iron CTM medium and germination and outgrowth of vegetative cells was followed by turbidity measurements (Panel A). Cell free culture samples were analyzed at the times indicated by reverse phase HPLC for PB (Panel B) and BB (Panel C). Asterisks indicate no siderophore was detected. Data presented is from a typical experiment

germination and outgrowth. The amounts of PB and BB present in the culture filtrates prepared at timed intervals were determined. Neither PB nor BB were detected at 0.5, 1, and 3 h, but at 5.5 h PB only was detected at concentrations of 3 and 2 lM in the filtrates from low-iron and high-iron cultures, respectively, (Fig. 1b). BB at a concentration of 2 lM was first detected later at 10 h and then only in the lowiron culture (Fig. 1c). At the time that BB was first detected, the PB concentrations had increased to 22 and 8 lM in low-iron and high-iron cultures, respectively. The initial and sole production of siderocalin resistant PB during outgrowth from spores may illustrate an early event in infection when PB is the

123

132

only useful siderophore in the presence of an intact host siderocalin defense that would inactivate BB. These data also reveal the stringent control over BB secretion exerted by the level of iron in the environment whereas PB is made at iron levels that abrogate BB production. These results confirm those of Lee et al. (2007) who found that spores of a B. anthracis mutant strain unable to produce PB did not outgrow on iron depleted agar unless supplied with PB or another utilizable iron source. These results also resemble the temporal production of the siderophores achromobactin and chrysobactin noted in the phytopathogen Erwinia chrysanthemi, a property that may allow the microorganism to cope with changing conditions in its plant host during an infection (Franza et al. 2004). In the pathogenic Bordetella species, multiple iron acquisition pathways also are differentially expressed, possibly to exploit early and late events of infection (Brickman and Armstrong 2009). Host temperature and bicarbonate level increased PB secretion and decreased BB production Host signals often trigger expression of bacterial virulence traits. Optimal expression of the toxins and capsule virulence factors of B. anthracis occurs during cultivation at 37"C in the presence of bicarbonate/CO2 which are considered signals of the host environment (Sirard et al. 1994). Moreover, deletion of the genes for the bicarbonate transporter abolished toxin production, producing a strain that was avirulent the mouse model (Wilson et al. 2008). Syntheses of the two siderophores PB and BB in B. anthracis is regulated by iron level and by temperature (Garner et al. 2004; Koppisch et al. 2005). When cultures of B. anthracis (inoculated as vegetative cells into low-iron CTM medium) were incubated at 37"C, as compared to 23"C, secretion of the PB was increased from 40 lM to 60 lM, while total BB secretion was decreased from 20 lM to about 10 lM (Fig. 2). Growth at 37"C also increased secretion of the PB constituent 3,4-DHB. Koppisch et al. (2005) were unable to detect BB in culture filtrates of B. anthracis grown at 37"C in an atmosphere of 5% CO2 and we did not observe BB on thin layer chromatograms of filtrates from B. anthracis USAMRIID cultures grown with added 0.4–0.8% bicarbonate in low-iron CTM medium at 37"C, although both PB and 3,4-DHB were identified on these chromatograms (data not shown).

123

Biometals (2010) 23:129–134

Fig. 2 Effect of incubation temperature on B. anthracis USAMRIID siderophore secretion determined at the maximum stationary phase of growth in low-iron CTM medium at 37"C. Concentrations of secreted products were normalized as lM per OD600 unit of culture turbidity

In addition to the host cue of iron restriction, the host temperature and the presence of CO2/bicarbonate also altered syntheses of the dual siderophores of this microorganism. The combination of 37"C and CO2/ bicarbonate appeared to disable BB production, suggesting that BB synthesis might occur late in the infectious process when host conditions have been significantly changed.

Conclusions B. anthracis physiology presents a complex pattern of temporal production of the two B. anthracis siderophores, PB and BB. In the herbivore host, siderocalin blocks utilization of BB; B. anthracis evades siderocalin with PB, yet BB production is preserved. PB was the first detectable siderophore secreted during outgrowth from spores while BB production began several hours later in the growth cycle. The initial outgrowth from spores in the infected host requires iron, which could be satisfied by PB mediated removal of iron from sources such as Fe-transferrin (Abergel et al. 2008). B. anthracis siderophore production also responded to cues of the host environment. A temperature of 37"C, compared to 23"C, and the presence of CO2/bicarbonate increased production of the virulence siderophore PB and curtailed synthesis of BB. The role of BB in B. anthracis metabolism is

Biometals (2010) 23:129–134

uncertain, although BB could be a participant at the last stages of the anthrax infection when the organism transitions from rapid vegetative growth to the sporulation phase. Production of PB may be essential for outgrowth from spores and onset of rapid cell division in the early stages of the infection. Preservation of BB production by B. anthracis suggests that the dual siderophores of B. anthracis fulfill unique and independent functions in the life cycle of B. anthracis. The rare occurrence in catecholate siderophores of the 3,4-DHB unit that is found in PB may offer a point of vulnerability for rational anti-anthrax drug design. The 3,4 isomer of DHB is crucial to the capacity of PB to acquire iron in the presence of innate host defenses early in an infection. A specific block in B. anthracis 3,4-DHB synthesis (Koppisch et al. 2008a; Pfleger et al. 2008; Fox et al. 2008) might impede outgrowth of the vegetative cell stage from germinating spores and could, therefore, be an anthrax-preventive strategy. Administration of a drug that blocks PB production to livestock during an anthrax outbreak or to persons about to enter areas contaminated with B. anthracis spores, either accidentally or purposefully, could offer a significant adjunct to other means of protection from infection. Acknowledgments This research was supported by the Intramural Research Grant Program at the University of Mississippi Medical Center (BRB and JELA) and by National Institutes of Health Grant AI11744 (KNR). We thank P. Worsham for B. anthracis USAMRIID.

References Abergel RJ, Wilson MK, Arceneaux JEL, Hoette TM, Strong RK, Byers BR, Raymond KN (2006) The anthrax pathogen evades the mammalian immune system through stealth siderophore production. Proc Nat Acad Sci USA 103: 18499–185033 Abergel RJ, Zawadzka AM, Raymond KN (2008) Petrobactinmediated iron transport in pathogenic bacteria. J Am Chem Soc 130:2124–2125 Bergeron RJ, Huang GF, Smith RE, Bharti N, McManis JS, Butler A (2004) A total synthesis and structure revision of petrobactin. Tetrahedron 59:2007–2014 Brickman TJ, Armstrong SK (2009) Temporal signaling and differential expression of Bordetella iron transport systems: the role of ferrimones and positive regulators. BioMetals 22:33–41 Byers BR, Arceneaux JEL (1998) Microbial iron transport: iron acquisition by in microorganisms, plants, and animals, vol. 35 metal ions in biological systems. M Dekker, New York, pp 37–66

133 Cendrowski S, MacArthur W, Hanna P (2004) Bacillus anthracis requires siderophore biosynthesis for growth in macrophages and mouse virulence. Mol Microbiol 51: 407–417 Dertz EA, Xu J, Stintzi A, Raymond KN (2006) Bacillibactinmediated iron transport in Bacillus subtilis. J Am Chem Soc 128:22–23 Flo TH, Smith KD, Sato S, Rodriguez DJ, Holmes MA, Strong RK, Akira S, Aderem A (2004) Lipocalin 2 mediates an innate immune response to bacterial infection by sequestering iron. Nature 432:917–921 Fox DT, Hotta K, Kim CY, Kippisch AT (2008) The missing link in petrobactin biosynthesis: asbF encodes a (-)-3dehydroshikimate dehydratase. Biochemistry 47:12251– 12253 Franza T, Mahe B, Expert D (2004) Erwinia chrysanthemi requires a second iron transport route dependent of the siderophore achromobactin for extracellular growth and plant infection. Mol Microbiol 55:261–275 Garner BL, Arceneaux JEL, Byers BR (2004) Temperature control of a 3,4-dihydroxybenzoate (protocatechuate)based siderophore in Bacillus anthracis. Curr Microbiol 49:89–94 Goetz DH, Holmes MA, Borregaard NM, Blum E, Raymond KN, Strong RK (2002) The neutrophil lipocalin NGAL is a bacteriostatic agent that interferes with siderophoremediated iron acquisition. Mol Cell 10:1033–1043 Koppisch AT, Browder CC, Moe AL, Shelley JT, Kinkel BA, Hersman LE, Iyer S, Ruggiero CE (2005) Petrobactin is the primary siderophore synthesized by Bacillus anthracis str. Sterne under conditions of iron starvation. BioMetals 18:577–585 Koppisch AT, Hotta K, Fox DT, Ruggiero CE, Kim CY, Sanchez T, Iyer S, Browder CC, Unkefer PJ, Unkefer CJ (2008a) Biosynthesis of the 3,4-dihydroxybenzoate moieties of petrobactin by Bacillus anthracis. J Org Chem 73:5759–5765 Koppisch AT, Dhungana S, Hill KK, Boukhalfa H, Heine HS, Colip LA, Romero RB, Shou Y, Ticknor LO, Marrone BL, Hersman LE, Iyer S, Ruggiero CE (2008b) Petrobactin is produced by both pathogenic and non-pathogenic isolates of the Bacillus cereus group of bacteria. BioMetals 21:581–589 Lee JY, Janes BK, Passalacqua KD, Pfleger BF, Bergman NH, Lui H, Hakasson K, Somu RV, Aldrich CC, Cendrowski S, Hanna PC, Sherman DH (2007) Biosynthetic analysis of the petrobactin siderophore pathway from Bacillus anthracis. J Bacteriol 189:1698–1710 May JJ, Wendrich TM, Marahiel MA (2001) The dhb operon of Bacillus subtilis encodes the biosynthetic template for the catecholic siderophore 2,3-dihydroxybenzoate-glycinethreonine trimeric ester bacillibactin. J Biol Chem 276: 7209–7217 Miethke M, Klotz O, Linne U, May JJ, Beckering CL, Marahiel MA (2006) Ferri-bacillibactin uptake and hydrolysis in Bacillus subtilis. Mol Microbiol 61:1413–1427 Mock M, Fouet A (2001) Anthrax. Annu Rev Microbiol 55:647–671 Pfleger BF, Kim Y, Nusca TD, Maltseva N, Lee JY, Rath CM, Scaglione JB, Janes BK, Anderson EC, Bergman NH, Hanna PC, Joachimiak A, Sherman DH (2008) (200*

123

134 Structural, functional analysis of AsbF: origin of the stealth 3, 4-dihydroxybenzoic acid subunit for petrobactin biosynthesis. Proc Nat Acad Sci USA 105:17133–17138 Russell BH, Rango V, Keene DR, Xu Y (2007) Bacillus anthracis internalization by human fibroblasts and epithelial cells. Cell Microbiol 9:1262–1274 Sirard JC, Mock M, Fouet A (1994) The three Bacillus anthracis toxin genes are coordinately regulated by bicarbonate and temperature. J Bacteriol 176:5188–5192 Turnbull PCB, Frawley DA, Bull RL (2007) Heat activation/ shock temperatures for Bacillus anthracis spores and the

123

Biometals (2010) 23:129–134 issue of spore plate counts versus true numbers of spores. J Microbiol Methods 68:353–357 Wilson MK, Abergel RJ, Raymond KN, Arceneaux JEL, Byers BR (2006) Siderophores of Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis. Biochem Biophys Res Commun 348:320–325 Wilson AC, Soyer M, Hoch JA, Perego M (2008) The bicarbonate transporter is essential for Bacillus anthracis lethality. Plos Pathogens 4:1–10

Biometals (2010) 23:135–143 DOI 10.1007/s10534-009-9274-8

Cadmium exposure modifies lactotrophs activity associated to genomic and morphological changes in rat pituitary anterior lobe Ana Marı´a Calderoni • Vero´nica Biaggio • Mariano Acosta • Liliana Oliveros • Fabian Mohamed Marı´a Sofı´a Gime´nez

•

Received: 13 September 2009 / Accepted: 23 October 2009 / Published online: 6 November 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Cadmium (Cd) is widely used in industrial applications and is an important contaminant of agricultural products. As an endocrine disruptor, Cd modifies the hormone release of pituitary anterior lobe (PAL). This work was undertaken to evaluate a possible association between phospholipase D (PLD) and prolactin mRNA expressions and the activity of lactotrophs and folliculostellate cells (FSC) in PAL of Cd exposed adult male Wistar rats (Cd, 0.133 mM per liter for 2 months). The PALs were submitted to immunohistochemical and morphometric analysis to determine the percentage of lactotrophs (PRL-ir) and FSC (S-100-ir). Cultured PAL cells were stained with Hoechst 33258 to determine the presence of

Marı´a Sofı´a Gime´nez is member of National Investigations Council of Science and Technology (CONICET), Argentina. A. M. Calderoni ! V. Biaggio ! L. Oliveros ! M. S. Gime´nez (&) Laboratorio de Quı´mica Biolo´gica, Facultad de Quı´mica, Bioquı´mica y Farmacia, Universidad Nacional de San Luis, IMIBIO-SL (CONICET), Avenida Eje´rcito de los Andes 950, D5700HHW San Luis, Argentina e-mail: [email protected] M. Acosta ! F. Mohamed Laboratorio de Histologı´a, Departamento de Bioquı´mica y Ciencias Biolo´gicas, Facultad de Quı´mica, Bioquı´mica y Farmacia, Universidad Nacional de San Luis, IMIBIO-SL (CONICET), Avenida Eje´rcito de los Andes 950, D5700HHW San Luis, Argentina e-mail: [email protected]

alterations in nuclear morphology consistent with apoptosis. The expressions of PLD and prolactin mRNA were assessed by RT-PCR. Cd treated rats showed a decrease of PLD mRNA levels that can be associated to both high number of apoptotic cells and increase of S-100 protein expression in FSC. Cd decreased prolactin mRNA expression, number of lactotrophs and percentage of PRL-ir suggesting a low availability of prolactin to be secreted from PAL. Cd modifies the lactotrophs activity of pituitary gland through biochemical, genomic and morphological changes and contributes directly or indirectly to the levels of serum prolactin. Keywords Cadmium ! Pituitary anterior lobe ! Prolactin ! Phospholipase D ! Lactotrophs ! Folliculostellate cells

Introduction Cadmium (Cd) has been shown to accumulate in various tissues such as kidney and liver (Kanwar et al. 1980) and more recently in hypothalamus, pituitary gland and gonads (Clark et al. 1985). The risk of Cd exposure comes from its high persistence in the tissues. The mean half-life of this metal is over 15 years in humans and over 200 days in rats (Kjellstro¨m and Nordberg 1978). Cadmium exposure affects the pituitary gland and the reproductive function (Waalkes 2003), and is

123

136

considered an environmental endocrine disruptor that may play a role in the etiology of the pathology that involves the hypothalamic pituitary testicular axis (Lafuente and Esquifino 1999). In rats subchronically exposed to Cd during adulthood, an inhibitory effect of the metal on the pulsatile secretory pattern of prolactin from the pituitary gland has been observed, independently of the route of metal administration (Lafuente et al. 1997). Also, it has been reported that the acute, subchronic or chronic in vivo Cd administration reduces the plasma prolactin levels (Lafuente et al. 1997; Calderoni et al. 2005). In mammalian cells, phospholipase D (PLD) is activated by various extracellular stimuli and is known to play an important part in signal transduction (Liscovitch et al. 2000; Morris 2007). The receptor-mediated PLD activation is considered to be implicated in a variety of cellular responses, including rapid responses such as secretion and cytoskeleton rearrangement, and long-term responses such as proliferation, differentiation, apoptosis and survival (Liscovitch et al. 2000; Lee et al. 2006; Jang et al. 2008). The PLD is involved in the regulation of the hormone secretion in endocrine cells (Chen et al. 1997). It has been found that the activity of PLD decreases in pituitary anterior lobe (PAL) of Cd exposed rats (Calderoni et al. 2005), which present low serum prolactin and growth hormone levels. In addition to the secretory cells, the folliculostellate cells (FSC) have been reported in the pituitary of several mammalian species (Allaerts and Vankelecom 2005; Acosta and Mohamed 2009). They are star-shaped and follicle-forming cells in the anterior pituitary gland (Devnath and Inoue 2008) and are known to work as scavenger cells (Drewett et al. 1993). In particular, apoptotic endocrine cells are phagocytosed by FSC and digested by their lysosomal enzymes (Luziga et al. 2006; Devnath and Inoue 2008). It is known that Cd can bind to S-100 protein (Donato et al. 1991; Inoue et al. 2002), the main marker protein of FSC (FSC-S-100-ir) in the PAL (Itakura et al. 2007). However, the interaction between Cd and pituitary hormone is not well known. To our knowledge there is not information about Cd toxicity on the mRNA expression of prolactin and PLD in PAL. The aim of this study was to determine a possible association of PLD and prolactin mRNA expressions with the activity of lactotrophs and FSC in PAL of Cd exposed rats, in order to explain part of

123

Biometals (2010) 23:135–143

the toxicity mechanisms of Cd in this pituitary lobe. Cd intoxication was induced in rats by administration (as CdCl2) in the drinking water for 2 months.

Materials and methods Chemicals Cadmium chloride (as CdCl2 2.1/2 H2O) of 99.5% purity and organic solvents were obtained from Merck (Darmstadt, Germany). All the other chemicals were of reagent grade and were obtained from Sigma Chemical Co. (St. Louis, MO, USA) and Merck Laboratory (Buenos Aires, Argentina). Animals and experimental model Adult male Wistar rats of 300–350 g of body weight were maintained under standard laboratory conditions with ad libitum access to food (Cargill, Buenos Aires, Argentina) and water. They were housed and killed in accord to The Guiding Principles in the Use of Animals in Toxicology (Society of Toxicology 1999). All experiments were in compliance with the ANMAT No 6344/96 for Animal Care Guidelines, Argentina. Animals were kept in individual cages in a 22–25"C controlled environment with a light–dark cycle of 12 h each. Cadmium intoxication was induced in 32 rats by administration in the drinking water of 0.133 mM per liter of Cd (as CdCl2) for 2 months. Cadmium in drinking water and food of 32 control rats was not detectable (Calderoni et al. 2005). The rats were sacrificed by decapitation under light anesthesia with diethyl ether to prevent changes in the histophysiology of the hormone producing cells which occurs with profound anesthesia. The pituitary gland was dissected, washed in a cold saline solution and the anterior lobe was removed. The samples were stored at -70"C until it was used for RNA extraction. RNA isolation and reverse transcriptase polymerase chain reaction analysis for prolactin, phospholipase D2 and b-actin Total RNA was isolated from anterior lobe of five pituitary glands in each case using TRIzol reagent

Biometals (2010) 23:135–143

(Invitrogen, Carlsbad, CA, USA) within 1–2 week of obtaining the samples. All RNA isolations were performed as directed by the manufacturers. Electrophoresis on a 1% agarose gel and ethidium bromide staining confirmed the integrity of the RNA samples. Quantification of RNA was based on spectrophotometric analysis at 260/280 nm. Ten lg of total RNA were reverse-transcribed with 200 units of MMLV Reverse Transcriptase (Promega Inc.) using random hexamers as primers in a 20 ll reaction mixture, following the manufacturer’s instructions. RT-generated fragments code for prolactin, phospholipase (PLD2) and b-actin (Gen Bank accession no. NM012629, D88672 and M19533, respectively). Fragments coding for prolactin, PLD2 and b-actin were obtained by polymerase chain reaction (PCR) using the following primers: prolactin: (50 -CTTCTG TTCTGCCAAAATGTGC-30 sense, and 50 -CGTTAG CAGTTGTTTTTATGGAC-30 antisense); PLD2: (50 CTATGGGGACCTGAACTC-30 sense, and 50 -GAC TTTGTGTCTCTGGAGGTC-30 antisense); and bactin: (50 CGTGGGCCGCCCAGGCACCA-30 sense, and 50 TTGGCCTTAGGGTTCAGAGGG-30 antisense). PCR was performed in 35 ll of reaction solution containing 0.2 mmol/l of dNTPs, 1.5 mmol/l of MgCl2, 1.25 U of Taq polymerase, 50 pmol of each rat-specific oligonucleotide primer, and RTgenerated cDNA (1/5 of RT reaction). The predicted sizes of the PCR-amplified products were 623 bp for prolactin, 338 bp for PLD2 and 243 bp for b-actin. The samples were heated to 94"C for 2 min, followed by 38 temperature cycles. Each cycle consisted of three periods: (1) denaturation, 94"C for 1 min; (2) annealing, 60"C for prolactin, PLD2 and b-actin for 1 min; (3) extension, 72"C for 1 min. After 38 reaction cycles, the extension reaction continued for another 5 min (Thermal Cycler 2400, Perkin-Elmer, Shelton, CT, USA). Given that the number of cycles used was within the exponential phase of the PCR reaction, these conditions allowed detection of both cDNAs in the linear range of the assay. In all cases, aliquots of PCR products (5 ll) were run in triplicate on 1% (w/v) agarose gel with 0.01% (w/v) ethidium bromide. The amplified fragments were visualized under ultraviolet transillumination. Digitized images of the gels, which are presented in the negative form, were obtained with a Kodak EDAS 120 system. The intensity of each band was measured using the NIH

137

Image software and reported as the values of band intensity units. The relative abundance of each band was normalized according to the housekeeping b-actin gene, calculated as the ratio of the mean of gray value of each product to that of b-actin. Immunohistochemistry The brain was rapidly exposed and the pituitary gland was excised, sagittally sectioned, fixed in Buin’s fluid, processed for light microscopy, embedded in paraffin and serially sectioned in the horizontal plane. The immunohistochemistry technique was carried out as follows: serial sagittal sections (5 lm thick) were cut and carried through xylene and graded alcohols to water. Slides were incubated for 20 min in a solution of 3% H2O2 in water to inhibit endogenous peroxidase activity. Then, they were rinsed with distilled water and phosphate buffered saline (PBS; 0.01 M, pH 7.4). Non-specific binding sites for immunoglobulins were blocked by incubation for 15 min with 0.25% casein in PBS and rinsed with distilled water and PBS. Sections were then incubated overnight in a moist chamber at 4"C with the following primary antisera: monoclonal anti-prolactin hormone (DAKO, California, USA) and polyclonal anti-S-100 protein (BioGenex, San Ramon, California, USA). After the slides were rinsed with PBS for 10 min, the immunohistochemical visualization was carried out using the Super Sensitive Ready-to-Use Immunostaining Kit (BioGenex) at 20"C. The biotin-streptavidin amplified system was used as follows: sections were incubated for 30 min with diluted biotinylated antimouse IgG and, after being washed in PBS, they were incubated for 30 min with horseradish peroxidaseconjugated streptavidin, and finally washed in PBS. The reaction site was revealed by 100 ll of a 3.30 diaminobenzidine-tetrahydrochloride chromogen solution in 2.5 ml PBS and 50 ll of an H2O2 substrate solution. The sections were counterstained with hematoxylin for 1 min, dehydrated and mounted. In order to confirm the specificity of the immunoreactive procedures, adjacent sections were stained according to the above described protocol, but incubation in the primary antiserum was omitted. In addition, normal rabbit serum was used instead of primary antiserum. No positive structures or cells were found in these sections (Fig. 1).

123

138

Biometals (2010) 23:135–143

Fig. 1 a Pituitary gland of control rat immunostained with anti-Prl. PN pars nervosa; PI pars intermedia; PD pars distalis. Scale bar: 250 lm. b Positive control of immunostaining for

S-100 protein in PN. Scale bar: 50 lm. Right inset: Pituicytes immunostained with anti-S-100. Scale bar: 12.5 lm. c Negative control of immunoperoxidase staining. Scale bar: 25 lm

Morphometric analysis

RRA 9 100, where RAc was the sum of the area of immunolabelled cells for anti-Prolactin and RRA was the sum of the PAL area of every microscopic field. The number of immunostained lactotrophs with a visible nucleus was counted in ten microscopic fields per section. The result was expressed as number of lactotrophs per reference area.

Computer-assisted image analysis system was used to measure the different morphometric parameters. The system consisted of an Olympus BX-40 binocular microscope, interfaced with a host computer, image processing and recording system. The images were captured by a Sony SSC-DC5OA camera and processed with Image Pro Plus 5.0 software under control of a Pentium IV computer. The software allowed the following processes: images acquisition, automatic analogous adjust, thresholding, background subtraction, distance calibration, area and diameter measuring, and diskette data logging. The images were displayed on a colour monitor, and the parameters were measured with the image analysis system. Before counting, a reference area (RA) of 18,141.82 lm2 (940 objective) was defined on the monitor, and distance calibrations were performed using a slide with a micrometric scale for microscopy (Reichert, Austria). The lactotrophs and folliculostellate cells morphometric study was carried out as follows: six tissue sections from a pituitary gland were used, and all the microscopic fields captured with 940 objective were analyzed in every section (70 microscopic fields according to the section). Therefore, 420 microscopic fields were analyzed in each gland, and 4 pituitary glands were studied in each group of animals. Finally, 1,680 microscopic fields or measures were carried out per group. The following morphometric parameters were determined. Lactotrophs Percentage of Prl-positive area (%IA-Prl) was calculated using the formula %IA-Prl = RAc/

123

Folliculostellate cells Percentage of S-100-positive area (%IA-S-100) was calculated using the formula %IA = RAi/RRA 9 100, where RAi was the sum of the area of immunopositive cells for anti-S-100 and RRA was the sum of the PAL area of every microscopic field. Apoptosis determination In the present study fluorescence microscopy for confirming apoptotic bodies as a result of morphological change in the nucleus was employed. The cells were obtained from PALs by enzymatic (trypsin/DNase) and mechanical dispersion (extrusion through a Pasteur pipette) as described previously (Velardez et al. 2003). In all cases the cells were cultured for 3 h (37"C, 5% CO2 in air) in DMEM supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 50 lg/ml gentamicin and 50 lg/ml penicillin (DMEM-S-10% FBS). Cultured cells were stripped off from plastic plates by cell remover (Costar, Cambridge, MA) and fixed with 4% (wt/vol) of neutral buffered formalin for 30 min. After fixation, they were washed by PBS twice, stained with 0.6 mg/ml Hoechst 33258 (Wako Chemical Co.), and placed on glass slides. The

Biometals (2010) 23:135–143

images were taken, at 4009 magnification under a fluorescence microscope (NIKON Eclipse 50i) of 500 nuclei from control and experimental cells respectively, determining the percentage of apoptotic bodies (fragmented and condensed nuclei) in both cellular groups.

Statistical analysis The results were expressed as mean ± standard error of the mean for all data sets. Differences between groups were evaluated using Student’s t-test, P \ 0.05 was assumed to be significant. The software GraphPad Prism (v. 3.02) was used for the statistical analysis of morphometric measurements.

Results Effects of Cd exposure on the prolactin and phospholipase D mRNA expression

139

Immunohistochemical and morphometric analysis The percentage and the number of lactotrophs (Prl-ir) per reference area decreased significantly (P \ 0.01 and P \ 0.001; respectively) in the Cd treated group (Table 1; Fig. 3). Moreover, the percentage area FSC-S-100-ir increased significantly (P \ 0.01) in Cd treated rats in relation to the controls (Table 1; Fig. 3). The distributions of values for the morphometric parameters (percentage of Prl-positive area, number of lactotrophs per reference area and percentage of FSC-S-100-positive area) in the control and cadmium groups are shown in the box plots of the Fig. 4. Effects of Cd on the amount of apoptotic nuclei The percentage of apoptotic cells (fragmented and condensed nuclei) of PAL was increased significantly (P \ 0.001) in Cd exposed rats in relation to the controls (Table 1; Fig. 3). Discussion

The expression of prolactin and PLD mRNA decreased in the PAL of Cd treated rats in relation to the controls (Fig. 2), suggesting that prolactin and PLD synthesis might be decreased.

Fig. 2 Effect of Cd treatment on the mRNA expression of prolactin and phospholipase D2 in PAL. RT-PCR analysis for I prolactin; II phospholipase D2 and III b-actin, used as internal control. M molecular weight marker; Co control rats; Cd cadmium-treated rats. On the side, the quantification of the

We have measured different endocrine parameters in PAL after administration of Cd in the drinking water to understand the interaction between this metal and

intensity of the fragment bands in relation to the intensity of the b-actin, is shown. Values are means with their standard errors depicted by vertical bars for three determinations using a pool of five PAL each. *P \ 0.001 versus control

123

140

Biometals (2010) 23:135–143

Table 1 Morphometric parameters of lactotrophs, folliculostellate cells (FSC) and percentage of apoptotic cells (fragmented and condensed nuclei; Hoechst 33258) Parameters

Control

Cadmium

Lactotrophs

%IA-Prl

16.17 ± 0.17

10.13 ± 0.13**

n" cells/RA

18.29 ± 0.21

9.90 ± 0.10*

FSC

%IA-S-100

4.73 ± 0.13

Hoechst 33258 (%AC)

3.15 ± 0.03

8.29 ± 0.10** 15.20 ± 0.10*

The values are expressed as mean ± SEM. %IA-Prl: percentage of Prl-positive area. n" cells/RA: number of lactotrophs per reference area. %IA-S-100: percentage of FSC-S-100-positive area. %AC: percentage of apoptotic cells. Significant differences were determined by Student’s t-test * P \ 0.001 and ** P \ 0.01 versus control

the endocrine function of pituitary gland. Our results show that Cd modifies the mRNA expression of PLD and prolactin, and the number of lactotrophs and FSC cells in the PAL. The relation between them can explain part of the toxicity mechanisms of Cd, such as reduction of prolactin secretion and apoptosis induction. Fig. 3 a, b Pituitary pars distalis immunostained with anti-Prl. The percentage of Prl-positive area and number of lactotrophs (arrows) in the cadmiumtreated group (b) are lower than control rats (a). c, d The cadmium treatment increases the S-100 protein expression (arrowheads) in the folliculostellate cells of the pituitary pars distalis. e, f Alterations in nuclear morphology consistent with apoptosis were observed under fluorescence microscope after staining with Hoechst 33258. The percentage of fragmented and condensed nuclei (white arrows) is higher in cadmium-treated (f) than control (e) rats. Scale bars: 25 lm

123

Several researchers have done experiments using in vitro models with endocrine cultured cells exposed to Cd for different times (Yang et al. 2005; Poliandri et al. 2006). In the present work we used an in vivo model of Cd intoxication induced by administration in the drinking water of 15 ppm of Cd as CdCl2 for 8 weeks. Under this condition we have previously

Biometals (2010) 23:135–143

141

Fig. 4 Box Plots of the values for the morphometric parameters in the control and cadmium groups. a The percentage of Prl-positive area (%IA-Prl). b Number of lactotrophs per reference area (n" cells/RA). c Percentage of FSC-S-100-positive area (%IA-S-100)

informed that the level of Cd in plasma (Larregle et al. 2008) is similar to that observed in plasma of alkaline battery assemblers (Jakubowski et al. 1987). With the same experimental model we have observed an accumulation of the metal in PAL of 6.06 ± 0.02 lg/g of tissue while Cd is not detected in the control (Calderoni et al. 2005). The decrease in the expression of PLD mRNA in PAL of Cd treated rats was coincident with a decreased of PLD activity previously reported both in PALs from Cd exposed rats and in PAL dispersed cells treated with Cd (Calderoni et al. 2005), suggesting that Cd could modify PLD at genomic and no genomic levels. It is known that PLD is involved in the regulation of hormone secretion in endocrine cells (Chen et al. 1997). In mammalian cells, activation of a Golgiassociated PLD by ADP-ribosylation factor results in the hydrolysis of phosphatidylcholine to form phosphatidic acid. This reaction stimulates the release of nascent secretory vesicles from the trans-Golgi network of endocrine cells (Siddhanta et al. 2000; Riebeling et al. 2009). Furthermore, prolactin is synthesized in PAL and Cd decreases the percentage of Prl-ir, the number of lactotrophs and the expression of mRNA of prolactin, suggesting a reduced cellular activity. Considering all the above information and our previous results showing a decrease of serum prolactin in Cd treated rats (Calderoni et al.

2005) it is possible to associate the genomic effects of Cd with a reduced prolactin secretion from PALs. Thus, the activation of PLD could be one of the factors needed for secretion of prolactin. We have previously determined an alteration of cholesterol/ phospholipids ratio in PALs of Cd treated rats compared with controls (Calderoni et al. 2005). Thus, we can not discard that changes in membrane fluidity of pituitary gland may directly or indirectly alter the hormone secretions in Cd exposed rats. Moreover, we found that administration of Cd in the drinking water increased the number of apoptotic nuclei, as have been found by other authors in cell culture (Poliandri et al. 2006), and also the expression of S-100 protein in PAL. It is known that apoptotic endocrine cells are phagocytosed by FSC and digested by their lysosomal enzymes (Luziga et al. 2006; Devnath and Inoue 2008). Thus, we can suggest that the increment observed in the expression of S-100 protein is a response to the increment of apoptotic cells that are scavenger by FSC cells in the Cd treated animals. Probably, the increased apoptosis is related to the low mRNA expression/activity of PLD found in PAL of Cd intoxicated rats since in addition to the hormone secretion PLD has been reported to have an anti-apoptotic role in different cells (Lee et al. 2006; Jang et al. 2008). To our knowledge this is the first time that chronic in vivo Cd administration is shown to affect the

123

142

mRNA expressions of PLD and prolactin in PAL. The results suggest that the decrease of the mRNA expression of PLD, and the decrease of PLD activity previously showed (Calderoni et al. 2005), could explain, at least in part, the apoptosis induced by Cd toxicity in PAL. Furthermore, Cd affects the pituitary gland by altering prolactin expression and number of lactotrophs suggesting a low availability of prolactin to be secreted from PAL. This could also be associated to the PLD changes induced by Cd. Finally, our results suggest that Cd modifies the lactotrophs activity of pituitary gland through biochemical, genomic and morphological changes, contributing directly or indirectly to the levels of serum prolactin. Acknowledgments This research was supported by grants from National Investigations Council of Science and Technology (PIP 4931) and from Secretary of Science and Technology of San Luis University (Projects 8104 and 22/ Q603), Argentina. We wish to thank Dra. Vero´nica Filippa and Mrs. Angelina Bernardi for their technical participation.

References Acosta M, Mohamed F (2009) Pituitary pars intermedia of male viscacha (Lagostomus maximus maximus): a morphometric study of seasonal and age-related changes in immunohistochemistry. Cells Tissues Organs 190:219– 229 Allaerts W, Vankelecom H (2005) History and perspectives of pituitary folliculo-stellate cells research. Eur J Endocrinol 153:1–12 Calderoni AM, Oliveros LB, Jahn GA, Anton R, Luco J, Gimenez MS (2005) Alterations in the lipid content of pituitary gland and serum prolactin and growth hormone in cadmium treated rats. Biometals 18:213–220 Chen YG, Siddhanta A, Austin CD, Hammond SM, Sung TC, Frohman MA, Morris AJ, Shields D (1997) Phospholipase D stimulates release of nascent secretory vesicles from the trans-Golgi network. J Cell Biol 138:495–504 Clark DE, Nation JC, Bourgeois AJ, Hare MF, Baker DM, Hinderberger EJ (1985) The regional distribution of cadmium in the brain of orally exposed adult rats. Neurotoxicology 6:109–114 Devnath S, Inoue K (2008) An insight to pituitary folliculostellate cells. J Neuroendocrinol 20:687–691 Donato H Jr, Mani RS, Kay CM (1991) Spectral studies on the cadmium-ion-binding properties of bovine brain S-100b protein. Biochem J 276:13–18 Drewett N, Jacobi JM, Willgoss DA, Lloyd HM (1993) Apoptosis in the anterior pituitary gland of the rat: studies with estrogen and bromocriptine. Neuroendocrinology 57:89–95

123

Biometals (2010) 23:135–143 Inoue K, Mogi C, Ogawa S, Tomida M, Miyai S (2002) Are folliculo-stellate cells in the anterior pituitary gland supportive cells. Arch Physiol Biochem 110:50–53 Itakura E, Odaira K, Yokoyama K, Osuna M, Hara T, Inoue K (2007) Generation of transgenic rats expressing green fluorescent protein in S-100beta-producing pituitary folliculostellate cells and brain astrocytes. Endocrinology 148:1518–1523 Jakubowski M, Trojanowska B, Kowalska G, Gendek E, Starzynski Z, Krajewska B, Jajte J (1987) Occupational exposure to cadmium and kidney dysfunction. Int Arch Occup Environ Health 59:567–577 Jang YH, Ahn BH, Namkoong S, Kim YM, Jin JK, Kim YS, Min do S (2008) Differential regulation of apoptosis by caspase-mediated cleavage of phospholipase D isozymes. Cell Signal 20:2198–2207 Kanwar KC, Kaushal SC, Mehra RK (1980) Temporal distribution of orally administered 115mCd in subcellular fractions of liver & kidney of rat. Indian J Exp Biol 18:644 Kjellstro¨m T, Nordberg GF (1978) A kinetic model of cadmium metabolism in the human being. Environ Res 16:248–269 Lafuente A, Esquifino AI (1999) Cadmium effects on hypothalamic activity and pituitary hormone secretion in the male. Toxicol Lett 110:209–218 Lafuente A, Blanco A, Marquez N, Alvarez-Demanuel E, Esquifino AI (1997) Effects of acute and subchronic cadmium administration on pituitary hormone secretion in rat. J Physiol Biochem 53:265–270 Larregle EV, Varas SM, Oliveros LB, Martinez LD, Anto´n R, Marchevsky E, Gime´nez MS (2008) Lipid metabolism in liver of rat exposed to cadmium. Food Chem Toxicol 46:1786–1792 Lee SY, Kim JW, Jin JO, Song MG, Park JI, Min do S, Kwak JY (2006) Delayed apoptosis and modulation of phospholipase D activity by plasmid containing mammalian cDNA in human neutrophils. Biochem Biophys Res Commun 347:1039–1047 Liscovitch M, Czany M, Fucci G, Tang X (2000) PhospholipaseD: molecular and cell biology of a novel gen family. Biochem J 345:401–415 Luziga C, Yamamoto Y, Horii Y, Mbassa G, Mamba K (2006) Phagocytotic renoval of apoptotic endocrine cells by folliculostellate cells and its functional implications in clusterin accumulation in pituitary colloids in helmeted guinea fowl (Numida meleagris). Acta Histochem 108:69–80 Morris AJ (2007) Regulation of phospholipase D activity, membrane targeting and intracellular trafficking by phosphoinositides. Biochem Soc Symp 74:247–257 Poliandri AH, Machiavelli LI, Quinteros AF, Cabilla JP, Duvilanski BH (2006) Nitric oxide protects the mitochondria of anterior pituitary cells and prevents cadmiuminduced cell death by reducing oxidative stress. Free Radic Biol Med 40:679–688 Riebeling C, Morris AJ, Shields D (2009) Phospholipase D in the Golgi apparatus. Biochim Biophys Acta 1791:876– 880 Siddhanta A, Backer JM, Shields D (2000) Inhibition of phosphatidic acid synthesis alters the structure of the

Biometals (2010) 23:135–143 Golgi apparatus and inhibits secretion in endocrine cells. J Biol Chem 275:12023–12031 Velardez MO, Benitez AH, Cabilla JP, Bodo CC, Duvilanski BH (2003) Nitric oxide decreases the production of inositol phosphates stimulated by angiotensin II and thyrotropin-releasing hormone in anterior pituitary cells. Eur J Endocrinol 148:89–97

143 Waalkes MP (2003) Cadmium carcinogenesis. Mutat Res 533:107–120 Yang XF, Zhu W, Wei Q, Lin ZN (2005) Effect on apoptosis of anterior pituitary induced by cadmium chloride and its relation with p38 MAPK&ERK1/2 passway. Wei Sheng Yan Jiu 34:681–684

123

Biometals (2010) 23:135–143 DOI 10.1007/s10534-009-9274-8

Cadmium exposure modifies lactotrophs activity associated to genomic and morphological changes in rat pituitary anterior lobe Ana Marı´a Calderoni • Vero´nica Biaggio • Mariano Acosta • Liliana Oliveros • Fabian Mohamed Marı´a Sofı´a Gime´nez

•

Received: 13 September 2009 / Accepted: 23 October 2009 / Published online: 6 November 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Cadmium (Cd) is widely used in industrial applications and is an important contaminant of agricultural products. As an endocrine disruptor, Cd modifies the hormone release of pituitary anterior lobe (PAL). This work was undertaken to evaluate a possible association between phospholipase D (PLD) and prolactin mRNA expressions and the activity of lactotrophs and folliculostellate cells (FSC) in PAL of Cd exposed adult male Wistar rats (Cd, 0.133 mM per liter for 2 months). The PALs were submitted to immunohistochemical and morphometric analysis to determine the percentage of lactotrophs (PRL-ir) and FSC (S-100-ir). Cultured PAL cells were stained with Hoechst 33258 to determine the presence of

Marı´a Sofı´a Gime´nez is member of National Investigations Council of Science and Technology (CONICET), Argentina. A. M. Calderoni ! V. Biaggio ! L. Oliveros ! M. S. Gime´nez (&) Laboratorio de Quı´mica Biolo´gica, Facultad de Quı´mica, Bioquı´mica y Farmacia, Universidad Nacional de San Luis, IMIBIO-SL (CONICET), Avenida Eje´rcito de los Andes 950, D5700HHW San Luis, Argentina e-mail: [email protected] M. Acosta ! F. Mohamed Laboratorio de Histologı´a, Departamento de Bioquı´mica y Ciencias Biolo´gicas, Facultad de Quı´mica, Bioquı´mica y Farmacia, Universidad Nacional de San Luis, IMIBIO-SL (CONICET), Avenida Eje´rcito de los Andes 950, D5700HHW San Luis, Argentina e-mail: [email protected]

alterations in nuclear morphology consistent with apoptosis. The expressions of PLD and prolactin mRNA were assessed by RT-PCR. Cd treated rats showed a decrease of PLD mRNA levels that can be associated to both high number of apoptotic cells and increase of S-100 protein expression in FSC. Cd decreased prolactin mRNA expression, number of lactotrophs and percentage of PRL-ir suggesting a low availability of prolactin to be secreted from PAL. Cd modifies the lactotrophs activity of pituitary gland through biochemical, genomic and morphological changes and contributes directly or indirectly to the levels of serum prolactin. Keywords Cadmium ! Pituitary anterior lobe ! Prolactin ! Phospholipase D ! Lactotrophs ! Folliculostellate cells

Introduction Cadmium (Cd) has been shown to accumulate in various tissues such as kidney and liver (Kanwar et al. 1980) and more recently in hypothalamus, pituitary gland and gonads (Clark et al. 1985). The risk of Cd exposure comes from its high persistence in the tissues. The mean half-life of this metal is over 15 years in humans and over 200 days in rats (Kjellstro¨m and Nordberg 1978). Cadmium exposure affects the pituitary gland and the reproductive function (Waalkes 2003), and is

123

136

considered an environmental endocrine disruptor that may play a role in the etiology of the pathology that involves the hypothalamic pituitary testicular axis (Lafuente and Esquifino 1999). In rats subchronically exposed to Cd during adulthood, an inhibitory effect of the metal on the pulsatile secretory pattern of prolactin from the pituitary gland has been observed, independently of the route of metal administration (Lafuente et al. 1997). Also, it has been reported that the acute, subchronic or chronic in vivo Cd administration reduces the plasma prolactin levels (Lafuente et al. 1997; Calderoni et al. 2005). In mammalian cells, phospholipase D (PLD) is activated by various extracellular stimuli and is known to play an important part in signal transduction (Liscovitch et al. 2000; Morris 2007). The receptor-mediated PLD activation is considered to be implicated in a variety of cellular responses, including rapid responses such as secretion and cytoskeleton rearrangement, and long-term responses such as proliferation, differentiation, apoptosis and survival (Liscovitch et al. 2000; Lee et al. 2006; Jang et al. 2008). The PLD is involved in the regulation of the hormone secretion in endocrine cells (Chen et al. 1997). It has been found that the activity of PLD decreases in pituitary anterior lobe (PAL) of Cd exposed rats (Calderoni et al. 2005), which present low serum prolactin and growth hormone levels. In addition to the secretory cells, the folliculostellate cells (FSC) have been reported in the pituitary of several mammalian species (Allaerts and Vankelecom 2005; Acosta and Mohamed 2009). They are star-shaped and follicle-forming cells in the anterior pituitary gland (Devnath and Inoue 2008) and are known to work as scavenger cells (Drewett et al. 1993). In particular, apoptotic endocrine cells are phagocytosed by FSC and digested by their lysosomal enzymes (Luziga et al. 2006; Devnath and Inoue 2008). It is known that Cd can bind to S-100 protein (Donato et al. 1991; Inoue et al. 2002), the main marker protein of FSC (FSC-S-100-ir) in the PAL (Itakura et al. 2007). However, the interaction between Cd and pituitary hormone is not well known. To our knowledge there is not information about Cd toxicity on the mRNA expression of prolactin and PLD in PAL. The aim of this study was to determine a possible association of PLD and prolactin mRNA expressions with the activity of lactotrophs and FSC in PAL of Cd exposed rats, in order to explain part of

123

Biometals (2010) 23:135–143

the toxicity mechanisms of Cd in this pituitary lobe. Cd intoxication was induced in rats by administration (as CdCl2) in the drinking water for 2 months.

Materials and methods Chemicals Cadmium chloride (as CdCl2 2.1/2 H2O) of 99.5% purity and organic solvents were obtained from Merck (Darmstadt, Germany). All the other chemicals were of reagent grade and were obtained from Sigma Chemical Co. (St. Louis, MO, USA) and Merck Laboratory (Buenos Aires, Argentina). Animals and experimental model Adult male Wistar rats of 300–350 g of body weight were maintained under standard laboratory conditions with ad libitum access to food (Cargill, Buenos Aires, Argentina) and water. They were housed and killed in accord to The Guiding Principles in the Use of Animals in Toxicology (Society of Toxicology 1999). All experiments were in compliance with the ANMAT No 6344/96 for Animal Care Guidelines, Argentina. Animals were kept in individual cages in a 22–25"C controlled environment with a light–dark cycle of 12 h each. Cadmium intoxication was induced in 32 rats by administration in the drinking water of 0.133 mM per liter of Cd (as CdCl2) for 2 months. Cadmium in drinking water and food of 32 control rats was not detectable (Calderoni et al. 2005). The rats were sacrificed by decapitation under light anesthesia with diethyl ether to prevent changes in the histophysiology of the hormone producing cells which occurs with profound anesthesia. The pituitary gland was dissected, washed in a cold saline solution and the anterior lobe was removed. The samples were stored at -70"C until it was used for RNA extraction. RNA isolation and reverse transcriptase polymerase chain reaction analysis for prolactin, phospholipase D2 and b-actin Total RNA was isolated from anterior lobe of five pituitary glands in each case using TRIzol reagent

Biometals (2010) 23:135–143

(Invitrogen, Carlsbad, CA, USA) within 1–2 week of obtaining the samples. All RNA isolations were performed as directed by the manufacturers. Electrophoresis on a 1% agarose gel and ethidium bromide staining confirmed the integrity of the RNA samples. Quantification of RNA was based on spectrophotometric analysis at 260/280 nm. Ten lg of total RNA were reverse-transcribed with 200 units of MMLV Reverse Transcriptase (Promega Inc.) using random hexamers as primers in a 20 ll reaction mixture, following the manufacturer’s instructions. RT-generated fragments code for prolactin, phospholipase (PLD2) and b-actin (Gen Bank accession no. NM012629, D88672 and M19533, respectively). Fragments coding for prolactin, PLD2 and b-actin were obtained by polymerase chain reaction (PCR) using the following primers: prolactin: (50 -CTTCTG TTCTGCCAAAATGTGC-30 sense, and 50 -CGTTAG CAGTTGTTTTTATGGAC-30 antisense); PLD2: (50 CTATGGGGACCTGAACTC-30 sense, and 50 -GAC TTTGTGTCTCTGGAGGTC-30 antisense); and bactin: (50 CGTGGGCCGCCCAGGCACCA-30 sense, and 50 TTGGCCTTAGGGTTCAGAGGG-30 antisense). PCR was performed in 35 ll of reaction solution containing 0.2 mmol/l of dNTPs, 1.5 mmol/l of MgCl2, 1.25 U of Taq polymerase, 50 pmol of each rat-specific oligonucleotide primer, and RTgenerated cDNA (1/5 of RT reaction). The predicted sizes of the PCR-amplified products were 623 bp for prolactin, 338 bp for PLD2 and 243 bp for b-actin. The samples were heated to 94"C for 2 min, followed by 38 temperature cycles. Each cycle consisted of three periods: (1) denaturation, 94"C for 1 min; (2) annealing, 60"C for prolactin, PLD2 and b-actin for 1 min; (3) extension, 72"C for 1 min. After 38 reaction cycles, the extension reaction continued for another 5 min (Thermal Cycler 2400, Perkin-Elmer, Shelton, CT, USA). Given that the number of cycles used was within the exponential phase of the PCR reaction, these conditions allowed detection of both cDNAs in the linear range of the assay. In all cases, aliquots of PCR products (5 ll) were run in triplicate on 1% (w/v) agarose gel with 0.01% (w/v) ethidium bromide. The amplified fragments were visualized under ultraviolet transillumination. Digitized images of the gels, which are presented in the negative form, were obtained with a Kodak EDAS 120 system. The intensity of each band was measured using the NIH

137

Image software and reported as the values of band intensity units. The relative abundance of each band was normalized according to the housekeeping b-actin gene, calculated as the ratio of the mean of gray value of each product to that of b-actin. Immunohistochemistry The brain was rapidly exposed and the pituitary gland was excised, sagittally sectioned, fixed in Buin’s fluid, processed for light microscopy, embedded in paraffin and serially sectioned in the horizontal plane. The immunohistochemistry technique was carried out as follows: serial sagittal sections (5 lm thick) were cut and carried through xylene and graded alcohols to water. Slides were incubated for 20 min in a solution of 3% H2O2 in water to inhibit endogenous peroxidase activity. Then, they were rinsed with distilled water and phosphate buffered saline (PBS; 0.01 M, pH 7.4). Non-specific binding sites for immunoglobulins were blocked by incubation for 15 min with 0.25% casein in PBS and rinsed with distilled water and PBS. Sections were then incubated overnight in a moist chamber at 4"C with the following primary antisera: monoclonal anti-prolactin hormone (DAKO, California, USA) and polyclonal anti-S-100 protein (BioGenex, San Ramon, California, USA). After the slides were rinsed with PBS for 10 min, the immunohistochemical visualization was carried out using the Super Sensitive Ready-to-Use Immunostaining Kit (BioGenex) at 20"C. The biotin-streptavidin amplified system was used as follows: sections were incubated for 30 min with diluted biotinylated antimouse IgG and, after being washed in PBS, they were incubated for 30 min with horseradish peroxidaseconjugated streptavidin, and finally washed in PBS. The reaction site was revealed by 100 ll of a 3.30 diaminobenzidine-tetrahydrochloride chromogen solution in 2.5 ml PBS and 50 ll of an H2O2 substrate solution. The sections were counterstained with hematoxylin for 1 min, dehydrated and mounted. In order to confirm the specificity of the immunoreactive procedures, adjacent sections were stained according to the above described protocol, but incubation in the primary antiserum was omitted. In addition, normal rabbit serum was used instead of primary antiserum. No positive structures or cells were found in these sections (Fig. 1).

123

138

Biometals (2010) 23:135–143

Fig. 1 a Pituitary gland of control rat immunostained with anti-Prl. PN pars nervosa; PI pars intermedia; PD pars distalis. Scale bar: 250 lm. b Positive control of immunostaining for

S-100 protein in PN. Scale bar: 50 lm. Right inset: Pituicytes immunostained with anti-S-100. Scale bar: 12.5 lm. c Negative control of immunoperoxidase staining. Scale bar: 25 lm

Morphometric analysis

RRA 9 100, where RAc was the sum of the area of immunolabelled cells for anti-Prolactin and RRA was the sum of the PAL area of every microscopic field. The number of immunostained lactotrophs with a visible nucleus was counted in ten microscopic fields per section. The result was expressed as number of lactotrophs per reference area.

Computer-assisted image analysis system was used to measure the different morphometric parameters. The system consisted of an Olympus BX-40 binocular microscope, interfaced with a host computer, image processing and recording system. The images were captured by a Sony SSC-DC5OA camera and processed with Image Pro Plus 5.0 software under control of a Pentium IV computer. The software allowed the following processes: images acquisition, automatic analogous adjust, thresholding, background subtraction, distance calibration, area and diameter measuring, and diskette data logging. The images were displayed on a colour monitor, and the parameters were measured with the image analysis system. Before counting, a reference area (RA) of 18,141.82 lm2 (940 objective) was defined on the monitor, and distance calibrations were performed using a slide with a micrometric scale for microscopy (Reichert, Austria). The lactotrophs and folliculostellate cells morphometric study was carried out as follows: six tissue sections from a pituitary gland were used, and all the microscopic fields captured with 940 objective were analyzed in every section (70 microscopic fields according to the section). Therefore, 420 microscopic fields were analyzed in each gland, and 4 pituitary glands were studied in each group of animals. Finally, 1,680 microscopic fields or measures were carried out per group. The following morphometric parameters were determined. Lactotrophs Percentage of Prl-positive area (%IA-Prl) was calculated using the formula %IA-Prl = RAc/

123

Folliculostellate cells Percentage of S-100-positive area (%IA-S-100) was calculated using the formula %IA = RAi/RRA 9 100, where RAi was the sum of the area of immunopositive cells for anti-S-100 and RRA was the sum of the PAL area of every microscopic field. Apoptosis determination In the present study fluorescence microscopy for confirming apoptotic bodies as a result of morphological change in the nucleus was employed. The cells were obtained from PALs by enzymatic (trypsin/DNase) and mechanical dispersion (extrusion through a Pasteur pipette) as described previously (Velardez et al. 2003). In all cases the cells were cultured for 3 h (37"C, 5% CO2 in air) in DMEM supplemented with 10% fetal bovine serum (FBS), 2 mM glutamine, 50 lg/ml gentamicin and 50 lg/ml penicillin (DMEM-S-10% FBS). Cultured cells were stripped off from plastic plates by cell remover (Costar, Cambridge, MA) and fixed with 4% (wt/vol) of neutral buffered formalin for 30 min. After fixation, they were washed by PBS twice, stained with 0.6 mg/ml Hoechst 33258 (Wako Chemical Co.), and placed on glass slides. The

Biometals (2010) 23:135–143

images were taken, at 4009 magnification under a fluorescence microscope (NIKON Eclipse 50i) of 500 nuclei from control and experimental cells respectively, determining the percentage of apoptotic bodies (fragmented and condensed nuclei) in both cellular groups.

Statistical analysis The results were expressed as mean ± standard error of the mean for all data sets. Differences between groups were evaluated using Student’s t-test, P \ 0.05 was assumed to be significant. The software GraphPad Prism (v. 3.02) was used for the statistical analysis of morphometric measurements.

Results Effects of Cd exposure on the prolactin and phospholipase D mRNA expression

139

Immunohistochemical and morphometric analysis The percentage and the number of lactotrophs (Prl-ir) per reference area decreased significantly (P \ 0.01 and P \ 0.001; respectively) in the Cd treated group (Table 1; Fig. 3). Moreover, the percentage area FSC-S-100-ir increased significantly (P \ 0.01) in Cd treated rats in relation to the controls (Table 1; Fig. 3). The distributions of values for the morphometric parameters (percentage of Prl-positive area, number of lactotrophs per reference area and percentage of FSC-S-100-positive area) in the control and cadmium groups are shown in the box plots of the Fig. 4. Effects of Cd on the amount of apoptotic nuclei The percentage of apoptotic cells (fragmented and condensed nuclei) of PAL was increased significantly (P \ 0.001) in Cd exposed rats in relation to the controls (Table 1; Fig. 3). Discussion

The expression of prolactin and PLD mRNA decreased in the PAL of Cd treated rats in relation to the controls (Fig. 2), suggesting that prolactin and PLD synthesis might be decreased.

Fig. 2 Effect of Cd treatment on the mRNA expression of prolactin and phospholipase D2 in PAL. RT-PCR analysis for I prolactin; II phospholipase D2 and III b-actin, used as internal control. M molecular weight marker; Co control rats; Cd cadmium-treated rats. On the side, the quantification of the

We have measured different endocrine parameters in PAL after administration of Cd in the drinking water to understand the interaction between this metal and

intensity of the fragment bands in relation to the intensity of the b-actin, is shown. Values are means with their standard errors depicted by vertical bars for three determinations using a pool of five PAL each. *P \ 0.001 versus control

123

140

Biometals (2010) 23:135–143

Table 1 Morphometric parameters of lactotrophs, folliculostellate cells (FSC) and percentage of apoptotic cells (fragmented and condensed nuclei; Hoechst 33258) Parameters

Control

Cadmium

Lactotrophs

%IA-Prl

16.17 ± 0.17

10.13 ± 0.13**

n" cells/RA

18.29 ± 0.21

9.90 ± 0.10*

FSC

%IA-S-100

4.73 ± 0.13

Hoechst 33258 (%AC)

3.15 ± 0.03

8.29 ± 0.10** 15.20 ± 0.10*

The values are expressed as mean ± SEM. %IA-Prl: percentage of Prl-positive area. n" cells/RA: number of lactotrophs per reference area. %IA-S-100: percentage of FSC-S-100-positive area. %AC: percentage of apoptotic cells. Significant differences were determined by Student’s t-test * P \ 0.001 and ** P \ 0.01 versus control

the endocrine function of pituitary gland. Our results show that Cd modifies the mRNA expression of PLD and prolactin, and the number of lactotrophs and FSC cells in the PAL. The relation between them can explain part of the toxicity mechanisms of Cd, such as reduction of prolactin secretion and apoptosis induction. Fig. 3 a, b Pituitary pars distalis immunostained with anti-Prl. The percentage of Prl-positive area and number of lactotrophs (arrows) in the cadmiumtreated group (b) are lower than control rats (a). c, d The cadmium treatment increases the S-100 protein expression (arrowheads) in the folliculostellate cells of the pituitary pars distalis. e, f Alterations in nuclear morphology consistent with apoptosis were observed under fluorescence microscope after staining with Hoechst 33258. The percentage of fragmented and condensed nuclei (white arrows) is higher in cadmium-treated (f) than control (e) rats. Scale bars: 25 lm

123

Several researchers have done experiments using in vitro models with endocrine cultured cells exposed to Cd for different times (Yang et al. 2005; Poliandri et al. 2006). In the present work we used an in vivo model of Cd intoxication induced by administration in the drinking water of 15 ppm of Cd as CdCl2 for 8 weeks. Under this condition we have previously

Biometals (2010) 23:135–143

141

Fig. 4 Box Plots of the values for the morphometric parameters in the control and cadmium groups. a The percentage of Prl-positive area (%IA-Prl). b Number of lactotrophs per reference area (n" cells/RA). c Percentage of FSC-S-100-positive area (%IA-S-100)

informed that the level of Cd in plasma (Larregle et al. 2008) is similar to that observed in plasma of alkaline battery assemblers (Jakubowski et al. 1987). With the same experimental model we have observed an accumulation of the metal in PAL of 6.06 ± 0.02 lg/g of tissue while Cd is not detected in the control (Calderoni et al. 2005). The decrease in the expression of PLD mRNA in PAL of Cd treated rats was coincident with a decreased of PLD activity previously reported both in PALs from Cd exposed rats and in PAL dispersed cells treated with Cd (Calderoni et al. 2005), suggesting that Cd could modify PLD at genomic and no genomic levels. It is known that PLD is involved in the regulation of hormone secretion in endocrine cells (Chen et al. 1997). In mammalian cells, activation of a Golgiassociated PLD by ADP-ribosylation factor results in the hydrolysis of phosphatidylcholine to form phosphatidic acid. This reaction stimulates the release of nascent secretory vesicles from the trans-Golgi network of endocrine cells (Siddhanta et al. 2000; Riebeling et al. 2009). Furthermore, prolactin is synthesized in PAL and Cd decreases the percentage of Prl-ir, the number of lactotrophs and the expression of mRNA of prolactin, suggesting a reduced cellular activity. Considering all the above information and our previous results showing a decrease of serum prolactin in Cd treated rats (Calderoni et al.

2005) it is possible to associate the genomic effects of Cd with a reduced prolactin secretion from PALs. Thus, the activation of PLD could be one of the factors needed for secretion of prolactin. We have previously determined an alteration of cholesterol/ phospholipids ratio in PALs of Cd treated rats compared with controls (Calderoni et al. 2005). Thus, we can not discard that changes in membrane fluidity of pituitary gland may directly or indirectly alter the hormone secretions in Cd exposed rats. Moreover, we found that administration of Cd in the drinking water increased the number of apoptotic nuclei, as have been found by other authors in cell culture (Poliandri et al. 2006), and also the expression of S-100 protein in PAL. It is known that apoptotic endocrine cells are phagocytosed by FSC and digested by their lysosomal enzymes (Luziga et al. 2006; Devnath and Inoue 2008). Thus, we can suggest that the increment observed in the expression of S-100 protein is a response to the increment of apoptotic cells that are scavenger by FSC cells in the Cd treated animals. Probably, the increased apoptosis is related to the low mRNA expression/activity of PLD found in PAL of Cd intoxicated rats since in addition to the hormone secretion PLD has been reported to have an anti-apoptotic role in different cells (Lee et al. 2006; Jang et al. 2008). To our knowledge this is the first time that chronic in vivo Cd administration is shown to affect the

123

142

mRNA expressions of PLD and prolactin in PAL. The results suggest that the decrease of the mRNA expression of PLD, and the decrease of PLD activity previously showed (Calderoni et al. 2005), could explain, at least in part, the apoptosis induced by Cd toxicity in PAL. Furthermore, Cd affects the pituitary gland by altering prolactin expression and number of lactotrophs suggesting a low availability of prolactin to be secreted from PAL. This could also be associated to the PLD changes induced by Cd. Finally, our results suggest that Cd modifies the lactotrophs activity of pituitary gland through biochemical, genomic and morphological changes, contributing directly or indirectly to the levels of serum prolactin. Acknowledgments This research was supported by grants from National Investigations Council of Science and Technology (PIP 4931) and from Secretary of Science and Technology of San Luis University (Projects 8104 and 22/ Q603), Argentina. We wish to thank Dra. Vero´nica Filippa and Mrs. Angelina Bernardi for their technical participation.

References Acosta M, Mohamed F (2009) Pituitary pars intermedia of male viscacha (Lagostomus maximus maximus): a morphometric study of seasonal and age-related changes in immunohistochemistry. Cells Tissues Organs 190:219– 229 Allaerts W, Vankelecom H (2005) History and perspectives of pituitary folliculo-stellate cells research. Eur J Endocrinol 153:1–12 Calderoni AM, Oliveros LB, Jahn GA, Anton R, Luco J, Gimenez MS (2005) Alterations in the lipid content of pituitary gland and serum prolactin and growth hormone in cadmium treated rats. Biometals 18:213–220 Chen YG, Siddhanta A, Austin CD, Hammond SM, Sung TC, Frohman MA, Morris AJ, Shields D (1997) Phospholipase D stimulates release of nascent secretory vesicles from the trans-Golgi network. J Cell Biol 138:495–504 Clark DE, Nation JC, Bourgeois AJ, Hare MF, Baker DM, Hinderberger EJ (1985) The regional distribution of cadmium in the brain of orally exposed adult rats. Neurotoxicology 6:109–114 Devnath S, Inoue K (2008) An insight to pituitary folliculostellate cells. J Neuroendocrinol 20:687–691 Donato H Jr, Mani RS, Kay CM (1991) Spectral studies on the cadmium-ion-binding properties of bovine brain S-100b protein. Biochem J 276:13–18 Drewett N, Jacobi JM, Willgoss DA, Lloyd HM (1993) Apoptosis in the anterior pituitary gland of the rat: studies with estrogen and bromocriptine. Neuroendocrinology 57:89–95

123

Biometals (2010) 23:135–143 Inoue K, Mogi C, Ogawa S, Tomida M, Miyai S (2002) Are folliculo-stellate cells in the anterior pituitary gland supportive cells. Arch Physiol Biochem 110:50–53 Itakura E, Odaira K, Yokoyama K, Osuna M, Hara T, Inoue K (2007) Generation of transgenic rats expressing green fluorescent protein in S-100beta-producing pituitary folliculostellate cells and brain astrocytes. Endocrinology 148:1518–1523 Jakubowski M, Trojanowska B, Kowalska G, Gendek E, Starzynski Z, Krajewska B, Jajte J (1987) Occupational exposure to cadmium and kidney dysfunction. Int Arch Occup Environ Health 59:567–577 Jang YH, Ahn BH, Namkoong S, Kim YM, Jin JK, Kim YS, Min do S (2008) Differential regulation of apoptosis by caspase-mediated cleavage of phospholipase D isozymes. Cell Signal 20:2198–2207 Kanwar KC, Kaushal SC, Mehra RK (1980) Temporal distribution of orally administered 115mCd in subcellular fractions of liver & kidney of rat. Indian J Exp Biol 18:644 Kjellstro¨m T, Nordberg GF (1978) A kinetic model of cadmium metabolism in the human being. Environ Res 16:248–269 Lafuente A, Esquifino AI (1999) Cadmium effects on hypothalamic activity and pituitary hormone secretion in the male. Toxicol Lett 110:209–218 Lafuente A, Blanco A, Marquez N, Alvarez-Demanuel E, Esquifino AI (1997) Effects of acute and subchronic cadmium administration on pituitary hormone secretion in rat. J Physiol Biochem 53:265–270 Larregle EV, Varas SM, Oliveros LB, Martinez LD, Anto´n R, Marchevsky E, Gime´nez MS (2008) Lipid metabolism in liver of rat exposed to cadmium. Food Chem Toxicol 46:1786–1792 Lee SY, Kim JW, Jin JO, Song MG, Park JI, Min do S, Kwak JY (2006) Delayed apoptosis and modulation of phospholipase D activity by plasmid containing mammalian cDNA in human neutrophils. Biochem Biophys Res Commun 347:1039–1047 Liscovitch M, Czany M, Fucci G, Tang X (2000) PhospholipaseD: molecular and cell biology of a novel gen family. Biochem J 345:401–415 Luziga C, Yamamoto Y, Horii Y, Mbassa G, Mamba K (2006) Phagocytotic renoval of apoptotic endocrine cells by folliculostellate cells and its functional implications in clusterin accumulation in pituitary colloids in helmeted guinea fowl (Numida meleagris). Acta Histochem 108:69–80 Morris AJ (2007) Regulation of phospholipase D activity, membrane targeting and intracellular trafficking by phosphoinositides. Biochem Soc Symp 74:247–257 Poliandri AH, Machiavelli LI, Quinteros AF, Cabilla JP, Duvilanski BH (2006) Nitric oxide protects the mitochondria of anterior pituitary cells and prevents cadmiuminduced cell death by reducing oxidative stress. Free Radic Biol Med 40:679–688 Riebeling C, Morris AJ, Shields D (2009) Phospholipase D in the Golgi apparatus. Biochim Biophys Acta 1791:876– 880 Siddhanta A, Backer JM, Shields D (2000) Inhibition of phosphatidic acid synthesis alters the structure of the

Biometals (2010) 23:135–143 Golgi apparatus and inhibits secretion in endocrine cells. J Biol Chem 275:12023–12031 Velardez MO, Benitez AH, Cabilla JP, Bodo CC, Duvilanski BH (2003) Nitric oxide decreases the production of inositol phosphates stimulated by angiotensin II and thyrotropin-releasing hormone in anterior pituitary cells. Eur J Endocrinol 148:89–97

143 Waalkes MP (2003) Cadmium carcinogenesis. Mutat Res 533:107–120 Yang XF, Zhu W, Wei Q, Lin ZN (2005) Effect on apoptosis of anterior pituitary induced by cadmium chloride and its relation with p38 MAPK&ERK1/2 passway. Wei Sheng Yan Jiu 34:681–684

123

Biometals (2010) 23:145–159 DOI 10.1007/s10534-009-9275-7

Characterization of NikR-responsive promoters of urease and metal transport genes of Helicobacter mustelae Jeroen Stoof • Ernst J. Kuipers Arnoud H. M. van Vliet

•

Received: 22 September 2009 / Accepted: 23 October 2009 / Published online: 6 November 2009 ! Springer Science+Business Media, LLC. 2009

Abstract The NikR protein is a nickel-responsive regulator, which in the gastric pathogen Helicobacter pylori controls expression of nickel-transporters and the nickel-cofactored urease acid resistance determinant. Although NikR-DNA interaction has been well studied, the Helicobacter NikR operator site remains poorly defined. In this study we have identified the NikR operators in the promoters of two inversely nickel-regulated urease operons (ureAB and ureA2B2) in the ferret pathogen Helicobacter mustelae, and have used bioinformatic approaches for the prediction of putative NikR operators in the genomes of four ureasepositive Helicobacter species. Helicobacter mustelae NikR bound to the ureA2 promoter to a sequence

J. Stoof ! E. J. Kuipers ! A. H. M. van Vliet Department of Gastroenterology and Hepatology, Erasmus MC, University Medical Center, ‘s Gravendijkwal 230, 3015 CE Rotterdam, The Netherlands E. J. Kuipers Department of Internal Medicine, Erasmus MC, University Medical Center, ‘s Gravendijkwal 230, 3015 CE Rotterdam, The Netherlands A. H. M. van Vliet (&) Institute of Food Research, Colney Lane, Norwich NR4 7UA, UK e-mail: [email protected]

overlapping with the -35 promoter region, leading to repression. In contrast, NikR binding to a site far upstream of the canonical r80 promoter in the H. mustelae ureA promoter resulted in transcriptional induction, similar to the situation in H. pylori. Using H. pylori NikR operators and the newly identified H. mustelae NikR operators a new consensus sequence was generated (TRWYA-N15-TRWYA), which was used to screen the genomes of four urease-positive Helicobacter species (H. mustelae, H. pylori, H. acinonychis and H. hepaticus) for putative NikRregulated promoters. One of these novel putative NikR-regulated promoters in H. mustelae is located upstream of a putative TonB-dependent outer membrane protein designated NikH, which displayed nickel-responsive expression. Insertional inactivation of the nikH gene in H. mustelae resulted in a significant decrease in urease activity, and this phenotype was complemented by nickel-supplementation of the growth medium, suggesting a function for NikH in nickel transport accross the outer membrane. In conclusion, the H. mustelae NikR regulator directly controls nickel-responsive regulation of ureases and metal transporters. The improved consensus NikR operator sequence allows the prediction of additional NikR targets in Helicobacter genomes, as demonstrated by the identification of a new nickel-repressed outer membrane protein in H. mustelae. Keywords Nickel-responsive gene regulation ! Nickel uptake ! NikR repressor ! Helicobacter

123

146

Introduction The mammalian stomach is an inhospitable environment for bacteria, and therefore was long thought to be sterile, but this dogma was refuted by the discovery of the human pathogen Helicobacter pylori (Marshall and Warren 1984). This bacterium is able to colonize the environment of the mucus layer overlaying the gastric epithelial cells, and the resulting gastritis predisposes to peptic ulceration and gastric cancer (Kusters et al. 2006). Since the discovery of H. pylori, many other Helicobacter species have been identified, and it is now generally acknowledged that the gastric mucosa of most, if not all, mammals can be colonized by gastric Helicobacter species (Solnick and Schauer 2001). These non-pylori Helicobacter species may provide good animal models to study Helicobacter infection in their natural hosts (O’Rourke and Lee 2003) and comparative genomics may contribute in our understanding of host specificity (Eppinger et al. 2006). The divalent metal nickel plays a central part in the gastric lifestyle of Helicobacter species. Nickel is the cofactor of the urease enzyme (Burne and Chen 2000), which is the key component that enables gastric Helicobacter species to survive the stressful acidic conditions in the gastric mucosa. Urease converts urea into ammonia and carbon dioxide, which results in a net increase in the local pH (Burne and Chen 2000), and urease-negative mutants of different Helicobacter species are unable to colonize the gastric environment (Tsuda et al. 1994; Andrutis et al. 1995; Stingl et al. 2002). Metal ions like nickel pose a problem for bacteria. While they are essential for metabolism, they are also capable of generating toxic compounds like reactive oxygen species, and hence bacteria have developed finely tuned systems to control intracellular availability of metals (Mulrooney and Hausinger 2003). For nickel, a nickel-responsive regulatory protein represents the common mechanism of control in bacteria. This nickel-responsive regulatory protein is capable of repressing nickel import mechanisms once cytoplasmic nickel concentrations exceed a certain threshold. The most common nickel-responsive regulator in bacteria is the ribbon-helix-helix regulatory protein NikR (Chivers and Sauer 2000). The NikR protein was previously identified as a key regulator of urease expression in H. pylori (van Vliet et al. 2002).

123

Biometals (2010) 23:145–159

In addition to urease, NikR regulates expression of other genes involved in nickel homeostasis by binding to NikR operators in, or upstream of, the promoter regions (Delany et al. 2005; Ernst et al. 2005b, 2006; Davis et al. 2006; Danielli et al. 2009). H. pylori NikR binds with different affinities to NikR operators in vitro (Abraham et al. 2006; Benanti and Chivers 2007; Dosanjh et al. 2009), and the sequence variation in the NikR operators has made it difficult to define a consensus sequence which correctly predicts NikR-regulated genes. Recently we described the presence (Pot et al. 2007) and characterization (Stoof et al. 2008) of two urease gene clusters (ureABIEFGH and ureA2B2) in three Helicobacter species (H. mustelae, H. acinonychis and H. felis) colonizing obligate carnivores (ferrets, big cats and cats, respectively). As with the H. pylori urease gene cluster, H. mustelae UreAB is positively regulated by the availability of nickel (van Vliet et al. 2001, 2002). In sharp contrast to the UreAB urease system, the expression of the H. mustelae UreA2B2 urease system is repressed upon nickel supplementation, but induced upon iron supplementation. Due to the regulatory pattern, independency of accessory proteins and the inactivation of the enzyme upon lyses, we speculated that this gene cluster may encode an iron cofactored urease. UreA2B2 may therefore be an evolutionary adaptation of carnivore colonizing Helicobacter species to the nickel-limited but iron-rich diet of their host (Stoof et al. 2008). Although nickeldependent regulation of both ureases was absent in an H. mustelae nikR mutant, direct interaction of NikR with the ureA and ureA2 promoters was not tested. In this study we have investigated the role of NikR in nickel-responsive regulation of the UreAB and UreA2B2 urease systems of H. mustelae. We demonstrate that NikR directly interacts with both urease promoters of H. mustelae. Using the newly identified NikR binding sites of the H. mustelae ureA and ureA2 promoters, a new NikR operator consensus sequence has been proposed, and this new consensus sequence has been used for the prediction of new NikR operators in complete genome sequences of Helicobacter species. All previously confirmed high-affinity NikR operators in H. pylori were recognized, and searching of the H. mustelae genome sequence allowed the identification of a new nickel-regulated outer membrane protein in H. mustelae, which contributes to urease activity.

Biometals (2010) 23:145–159

Materials and methods Bacterial strains and growth conditions Helicobacter mustelae strain NCTC 12198 (ATCC 43772) was used for all experiments in this study and was cultured at 37"C in a microaerobic atmosphere of 5% O2, 7.5% CO2, 7.5% H2 and 80% N2. Dent agar plates consisting of Columbia agar (Oxoid) supplemented with 7% saponin-lysed defibrinated horse blood (BioTrading), 0.004% triphenyltetrazolium chloride (Sigma) and Dent Selective Supplement (Oxoid) were used for routine growth. Broth cultures of H. mustelae were grown in Ham’s F-12 tissue culture medium (Kaighn’s modification, Invitrogen) supplemented with 0.2% ß-cyclodextrin (Fluka) and Dent supplement. Since this medium may not contain ligands needed for nickel transport across the outer membrane, the urease assay was performed with H. mustelae grown in Brucella broth supplemented with 3% heat inactivated Newborn Calf Serum (Difco) and Dent supplement. Broth cultures were shaken at 70 rpm and incubated at 37"C for a maximum of 24 h. Iron-restriction of Ham’s F-12 medium (Kaighn’s modification) was achieved by addition of deferoxamine (Sigma) to a final concentration of 4 lM, whereas iron-replete medium was obtained by supplementing ironrestricted Ham’s F-12 medium (Kaighn’s modification) with FeCl3 to a final concentration of 10 lM (Stoof et al. 2008). Escherichia coli strains DH5a and M147 were cultured in Luria-Bertani media (Biotrading) (Sambrook et al. 1989). When appropriate, growth media were supplemented with ampicillin (100 lg ml-1), chloramphenicol (20 lg ml-1), kanamycin (20 lg ml-1) or erythromycin (250 lg ml-1) for selection of E. coli transformants. H. mustelae mutants were selected on media containing chloramphenicol (10 lg ml-1), kanamycin (10 lg ml-1) or erythromycin (10 lg ml-1). Concentrations of antibiotics given represent their final concentration in the growth medium. Construction of H. mustelae fur, hm0418-1, hm0418-2 and hm0418-3 mutants Construction of the H. mustelae nikR mutant was described previously (Stoof et al. 2008). The fur,

147

hm0418-1, hm0418-2 and hm0418-3 genes of H. mustelae strain NCTC 12198 were PCR amplified using the KO primers described (Table 1), and the amplicons were cloned in pGEM-Teasy vector (Promega). The sources of the chloramphenicol, kanamycin and erythromycin resistance cassettes were plasmids pAV35 (van Vliet et al. 1998), pJMK30 (van Vliet et al. 1998) and pDH20 (Haas et al. 1993), and these were inserted in the unique restriction sites BclI (fur), BamHI (hm0418-1), Eco47III (hm0418-2) and Eco47III (hm0418-3) of the corresponding genes, in the same transcriptional orientation. The interrupted genes were subsequently introduced into H. mustelae strain NCTC 12198 by natural transformation (Croinin et al. 2007; Stoof et al. 2008) and correct replacement by homologous recombination of the genes with the interrupted version was confirmed by PCR using ORS primers described (Table 1) which are located outside of the recombination region. Protein analysis Liquid cultures were centrifuged for 10 min at 4,0009g and resuspended in phosphate-buffered saline to a final OD600 of 10. Bacteria were lysed by sonication for 15 s with an MSE Soniprep 150 set at amplitude 6. Whole-cell proteins (OD10) were separated on 6% (Hm0418 detection) or 8% (UreB detection) sodium dodecyl sulfate polyacrylamide gels (SDS–PAGE) (Sambrook et al. 1989). For Western immunoblot, proteins were subsequently transferred to a nitrocellulose membrane. Expression of urease subunits was monitored on immunoblots by using a 1:10,000 dilution of antibodies raised against H. felis urease (Belzer et al. 2005; Pot et al. 2007). Urease assay The enzymatic activity of urease was determined by measuring ammonia production from hydrolysis of urea, by using the Berthelot reaction as described previously (van Vliet et al. 2001). Briefly, cells lysed by sonication were incubated for 30 min at 37"C in buffer consisting of 100 mM sodium phosphate pH 7.5, 10 mM EDTA and 50 mM urea, and the ammonia produced was measured after addition of phenol nitroprusside and alkaline hypochlorite (Sigma Diagnostics).

123

148 Table 1 Oligonucleotide primers used in this study

Biometals (2010) 23:145–159

Primer

Sequence (50 ? 30 )

Hmus_fur_KO_F

AGGCCATCTCCCTGTATTGC

Hmus_fur_KO_R

TGCACGCAGTCTCTTTGTG

Hmus_fur_ORS_F

GCAAAAGCACAATCCCCTCTG

Hmus_fur_ORS_R

AGAATTGAGGGGAAAACGTG

Hmus_0418-1_KO_F

GAGGACGTGGATGGAGTTTG

Hmus_0418-1_KO_R

TGATAAGGAAGCGCGATGTG

Hmus_0418-1_ORS_F

GCAGAGCAAGGGCGAAATTC

Hmus_0418-1_ORS_R Hmus_0418-2_KO_F

TATGCCCACCACCTTATCCC GGATTTCAGGGCTGCATGTG

Hmus_0418-2_KO_R

CCCAGTGGCTCACCAAATTC

Hmus_0418-2_ORS_F

GGCGTGCCCACACCTATAAG

Hmus_0418-2_ORS_R

GAATGCCGCCAGCGTATAGG

Hmus_0418-3_KO_F

CCAAGAAGGCGATTCTTTGC

Hmus_0418-3_KO_R

CCCACTGGCTATTTAGAGTC

Hmus_0418-3_ORS_F

GCGCAATTCATGACGAATCC

Hmus_0418-3_ORS_R

TTATCCTGCCCATCACAACC

Hmus_NikR_BamHI_F

GGATCCATGCGGACTATGGAAAAGGA

Hmus_NikR_PvuII_R

CAGCTGTCAAAGATCTTTGGGGAAATGAC

Hmus_ureA1_prom_F

CAATCCAAGCGCGTTTTTCAT

Hmus_ureA1_prom_R-dig

CGGCATAATGCAACATCATC

Hmus_ureA2_prom_F

AGTTAAGACTTTTGCCGTGTAG

Hmus_ureA2_prom_R-dig

CTCTCCTGCATAATACAACAAGAAT

ureA2_GS_NikRa

AATTATTACTAAATAATACTTTTTTAAAAAAGTTAATAC AAAGTATCAAGA

ureA2_GS_NikRca

CTTGATACTTTGTATTAACTTTTTTAAAAAAGTATTATTTA GTAATAATTA

ureA2_GS_NikR_pal12a

AATTATTACTAAACCCCCCCTTTTTAAAAAACCCCCCCCA AAGTATCAAGA

ureA2_GS_NikR_pal12_ca

CTTGATACTTTGGGGGGGGTTTTTTAAAAAGGGGGGGTT TAGTAATAATTA

pGEM_F

ACGCCAAGCTATTTAGGTGAC

pGEM_R-Dig

AAACGACGGCCAGTGAATTG

a

Primer contains an additional 30 A residue to facilitate cloning into the pGEM-Teasy plasmid

The absorbance of the samples was determined at 570 nm, and compared with a standard NH4Cl concentration curve. Protein concentrations were determined with the bicinchoninic acid method (Pierce) using bovine serum albumin as standard. Urease enzyme activity was expressed as units representing lmol of urea hydrolysed per min, and is expressed as U mg-1 of total protein. Electrophoretic mobility shift assay Recombinant H. mustelae NikR protein was produced in E. coli using the StrepTag system, essentially as described for H. pylori NikR (Ernst et al. 2005b).

123

Briefly, the H. mustelae nikR gene was amplified using primers HmusNikR_BamHI F and HmusNikR_PvuII R (Table 1), cloned into the pASK-IBA7 vector (IBA, Gottingen, Germany), and recombinant NikR protein was purified as previously described (Ernst et al. 2005b). The promoter regions of the ureA and ureA2 genes were PCR amplified with primers Hmus_ureA1_ prom_F, Hmus_ureA2_prom_F, and DIG-labeled primers Hmus_ureA1_prom_R-dig and Hmus_ureA2_ prom_R-dig, respectively (Table 1). Two complementary 50 nt oligonucleotides (ureA2_GS_NikR and ureA2_GS_NikR_c, Table 1), containing the putative NikR binding sites of the ureA2 promoter, were mixed in equimolar ratio and heated to 80"C, and were slowly

Biometals (2010) 23:145–159

cooled to room temperature. As negative control the same oligonucleotides were synthesized with replacement of both halves of the NikR bindingsite by a stretch of C-residues (ureA2_GS_NikR_pal12 and ureA2_GS_ NikR_pal12_c, Table 1). Subsequently the double stranded products were cloned into pGEM-Teasy (Promega) and checked for sequence integrity. A 250 bp fragment was amplified from these pGEMTeasy clones using the primers pGEM_F and pGEM_Rdig (Table 1). Electrophoretic mobility shift assays were performed with recombinant NikR protein as described previously (Ernst et al. 2005b). Briefly, 32.5 pM of digoxygenin-labeled ureA of ureA2 promoter fragment was mixed with recombinant NikR protein at concentrations ranging from 0 to 122 pM. Protein and DNA were mixed in binding buffer (24% glycerol, 40 mM Tris–Cl, pH 8.0, 150 mM KCl, 2 mM DTT, 600 lg/ml bovine serum albumin, 2.5 ng/ll herring sperm DNA, 200 lM NiCl2) in a 20 ll (final volume) mixture and incubated at 37"C for 30 min. Samples were subsequently separated on a 5% polyacrylamide gel in running buffer (25 mM Tris, 190 mM glycine) for 30 min at 200 V. The gel was then blotted onto a nylon membrane (Roche Molecular Biochemicals), and this was followed by chemiluminescent detection of DIG-labeled DNA. Purification and analysis of RNA Total RNA was isolated using Trizol (Gibco) according to the manufacturer’s instructions. The amount of RNA was determined spectrophotometrically using the Qubit Quantitation platform according to the manufacturers’ instructions (Invitrogen). The transcription start site of both the ureA and the ureA2 gene of H. mustelae strain NCTC12198 ware determined by primer extension analysis (Ernst et al. 2005a). Briefly, approximately 5–7 lg of total RNA isolated from H. mustelae NCTC 12198 was incubated with 50 pmol of 50 -DIG-labeled primer UreA_R1_dig and UreA2_R1_dig (Table 1) and avian myeloblastosis virus reverse transcriptase (Promega). The sequence reactions were performed using the fmol sequencing kit (Promega) with 50 -DIG-labeled primer UreA2_ R2_dig. Primer extension products and sequence reactions were separated on an 8% polyacrylamide8 M urea gel and blotted onto a nylon membrane (Roche), and this was followed by chemiluminescent DIG detection (van Vliet et al. 2001).

149

Quantitative reverse transcriptase-PCR (qRT-PCR) was essentially performed as described previously (Stoof et al. 2008), using primer combinations Hmus_ureB1_qpcr_F/Hmus_ureB1_qpcr_R, Hmus_ ureB2_qpcr-F/Hmus_ureB2_qpcr_R and Hmus_16S_ qpcr_F/Hmus_16S_qpcr_R (Table 1), with the IQ5 system (Bio-Rad) and SYBR-green. qRT-PCR assays were performed using RNA isolated from at least three independent growth experiments. Transcript levels were normalized against the levels of 16S rRNA in each sample [2(DDC(T)) analysis] (Livak and Schmittgen 2001), and expressed as ratio to the mRNA level in cells grown in nickel- and iron-restricted Ham’s F-12 medium (Kaighn’s modification). Bioinformatic prediction of NikR operators in Helicobacter genome sequences The intergenic regions from -198 to ?2 (relative to the first nucleotide of the annotated translation initiation codon, excluding overlaps with upstream coding sequences) of H. pylori, H. acinonychis and H. hepaticus were extracted using the regulatory sequence analysis tools (RSAT) website (http:// rsat.ulb.ac.be/rsat/) (Thomas-Chollier et al. 2008). The H. mustelae genome sequence was obtained from the Wellcome Trust Sanger Institute (http://www.sanger. ac.uk/Projects/H_mustelae/) and first interrogated using H. pylori protein sequences from metal metabolism genes. Subsequently the upstream sequences of the corresponding coding sequences were extracted. The DNA-pattern module of the RSAT website was used to search for NikR operators using the TRWYA-N15TRWYA consensus sequence, after extraction of the -198 to ?2 sequences of intergenic regions relative to the first nucleotide of the translation initiation codon. The Weblogo algorithm (Crooks et al. 2004) was used to represent sequence conservation in predicted NikR operators.

Results Role of Fur and NikR in nickel-responsive expression of H. mustelae urease genes We previously demonstrated that inactivation of the H. mustelae nikR gene results in nickel-independent expression of both ureases of H. mustelae, but did not

123

150

Biometals (2010) 23:145–159

Identification of the ureAB and ureA2B2 promoters

further investigate the mechanism governing ironresponsive induction of ureA2B2 transcription (Stoof et al. 2008). The H. mustelae genome sequence contains a gene encoding an ortholog of the ironresponsive regulatory protein Fur (Bereswill et al. 1998), and to further define the role of the NikR and Fur metal-responsive regulators in nickel- and ironresponsive expression of ureA2B2 transcription, an H. mustelae fur mutant was created using insertional mutagenesis. UreB2 expression and ureB2 transcription were very high in the nikR mutant (Stoof et al. 2008), and independent of the iron and nickel concentration, whereas mutation of fur did not significantly affect the nickel-responsive pattern of UreB2 expression and ureB2 transcription (Fig. 1a, b). The expression pattern of the UreB protein and ureB gene was similar to that of H. pylori (van Vliet et al. 2001, 2002), as mutation of nikR resulted in absence of nickel-responsive induction, whereas mutation of fur did not affect UreB expression or ureB transcription. wild-type

A -

+ -

The transcription start site of both urease gene clusters of H. mustelae was identified using primer extension analysis (Fig. 2a). Primers specific for ureA and ureA2 were used in equimolar concentrations or added separately (identical results, data not shown) for primer extension analysis with RNA isolated from H. mustelae NCTC12198 grown in media with either nickel- and iron-restricted or -replete conditions. The transcription start site of ureA is located at the G residue 52 nt upstream of the ureA ATG start codon. The transcription start site of ureA2 is located at the G residue 52 nt upstream of the ureA2 ATG start codon. Both transcription start sites are preceded by a r80 -10 sequence (Fig. 2b) at the correct distance from the transcription initiation site (Petersen et al. 2003), similar to what has been observed for the H. pylori urease promoter (Davies et al. 2002; van Vliet et al. 2002). Nickel- and iron-responsive nikR mutant

fur mutant

+

+ +

-

+ -

+

+ +

-

+

+ -

+ +

Ni Fe UreB2

67 kDa

UreB UreB2

67 kDa wild-type

fur

nikR

10

1

0.1 -Ni / -Fe

0.01

+Ni / -Fe -Ni / +Fe

0.001

ureB

+Ni / +Fe

Fig. 1 NikR but not Fur controls nickel-responsive expression of the UreAB and UreA2B2 ureases of Helicobacter mustelae. a Regulation of the UreB and UreB2 protein in the H. mustelae wild-type strain and its isogenic fur and nikR mutants, grown in different combinations of nickel-restricted, nickel-replete, ironrestricted and iron-replete conditions (see top panel), as demonstrated by SDS–PAGE (top panel) and immunoblot using an antibody recognizing both the UreB and UreB2 subunits (bottom panel). The relevant marker size is indicated on the left, the position of the UreB and UreB2 proteins on the right. b Regulation of ureB and ureB2 mRNA levels in the H.

123

mRNA levels relative to -Ni/-Fe

mRNA levels relative to -Ni/-Fe

B

UreB wild-type

fur

nikR

100 10 1 0.1 -Ni / -Fe

0.01

+Ni / -Fe -Ni / +Fe

0.001

ureB2

+Ni / +Fe

mustelae wild-type strain and its isogenic fur and nikR mutants, grown in the same combinations of nickel- and iron-conditions as shown in panel A, as determined using quantitative reverse transcriptase PCR. The levels of mRNA observed in the qRTPCR were normalized (Livak and Schmittgen 2001) to the levels of 16S rRNA, and the -Ni/-Fe condition in the wild-type strain was set to 1. Normalization to the ppk gene gave similar results (data not shown) All other mRNA levels are expressed as compared to the -Ni/-Fe condition in the wild-type strain. Error bars represent standard deviation. Results shown are the average of three independent experiments

Biometals (2010) 23:145–159

151

A

B

sequence ureA2 A

T

G

C

primer extension -/-

+/-

-/+ +/+ Ni/Fe

ureA2 ureA

C

N15

consensus Hp frpB4 Hp fecA3 Hp nixA Hp ureA Hm ureA Hm ureA2

TATWA TATTA TATTA TATTA TAacA TATTA TAaTA

ttnnnnnnnnnnnaa ttaaatagaataatg agttttttttgtttt caattaccaaaaaag ctaattcattttaaa tttataaatttttct cttttttaaaaaagt

TWATA TAATA TAtTA TAtTA TAATA TgATA TAATA

ureAB -109

-85

-35

-10

+1

RBS

ureA

ATTCAT

TACACT

G

AGGAG

ATG

-33

-10

+1

RBS

ureA2

ATACAA

TATAAT

G

AGGAA

ATG

TATTATTTATAAATTTTTCTTGATA

ureA2B2 -57

TAATACTTTTTTAAAAAAGTTAATA

Fig. 2 Characterization of the H. mustelae ureA and ureA2 promoter regions. a Determination of the transcriptional start site (TSS) of the ureA and ureA2 genes by semi-quantitative primer extension analysis, with RNA from H. mustelae NCTC 12198 wild-type cells grown in different combinations of nickel-restricted, nickel-replete, iron-restricted and iron-replete conditions. The primer extension products representing the ureA and ureA2 TSS are indicated on the right. The position of the TSS was determined using a sequencing reaction of the ureA2 promoter as displayed on the left (with lanes A, T, G, C).

b Prediction of the NikR operator sequence in the H. mustelae (Hm), based on the previously described consensus sequence (TATWA-N15-TWATA) of H. pylori NikR (Delany et al. 2005; Ernst et al. 2006; Dosanjh et al. 2009). c Graphical representation of the H. mustelae ureA and ureA2 promoter regions with the TSS, -10 and -35 regions, ribosomal binding site and ATG start codon of the ureA and ureA2 genes. The predicted location and sequence of the NikR operators are indicated with a black bar and the sequence underneath

regulation of the transcript start site cDNA of both urease clusters is in accordance with the immunoblot and qRT-PCR data (Fig. 1a, b). In H. pylori, NikR binds to palindromic sequence with as consensus sequence 50 -TATWATT-N11AATWATA, with one of the two half sites usually being less conserved (Delany et al. 2005; Ernst et al. 2006; Dosanjh et al. 2009). The ureA and ureA2 promoters of H. mustelae and H. acinonychis were searched for such putative binding sites (adapted to 50 -TATWA-N15-TWATA, Fig. 2b). A putative NikR box was detected from 140 to 164 nt upstream of the ATG start codon of H. mustelae ureA (Fig. 2c). Similar searches in the ureA2 promoter region of H. mustelae allowed the identification of a putative NikR-binding site 88–112 nt (Fig. 2b) upstream of the ATG start codon of ureA2. In H. mustelae this binding sequence overlaps with the -35 region of the

r80 promoter upstream of the ureA2 gene, whereas the binding sequence upstream of the ureA gene is located from -112 to -88, upstream of the canonical r80 promoter (Fig. 2c). NikR binds with different affinities to the ureA and ureA2 promoter To investigate whether the nickel-responsive regulation of ureAB and ureA2B2 transcription is mediated by NikR binding to the ureA and ureA2 promoters, an electrophoretic mobility shift assay was performed using both the ureA and ureA2 promoter regions and recombinant H. mustelae NikR protein. In the absence of nickel, NikR neither bound the ureA promoter nor the ureA2 promoter (data not shown). In the presence of nickel, NikR was able to bind to both promoters (Fig. 3a) albeit with different affinities.

123

152

Biometals (2010) 23:145–159

Incubation of NikR with the ureA2 promoter region led to two bands in the electrophoretic mobility shift assay (Fig. 3a), which is suggestive for the presence of multiple NikR binding sites. When the ureA and ureA2 promoters were mixed in equimolar concentrations, NikR first shifted the ureA2 promoter and subsequently the ureA promoter (Fig. 3a), which is consistent with the regulatory patterns of ureAB and ureA2B2 transcription, where ureA2B2 transcription is repressed at lower nickel concentrations than those where ureAB transcription is induced (Stoof et al. 2008). To confirm the predicted NikR-binding site in the H. mustelae ureA2 promoter (Fig. 2b, c), we performed electrophoretic mobility shift assays with cloned 50 nt fragments of the H. mustelae ureA2 promoter region, one version representing the wildtype promoter including the putative NikR binding sequence, and one version where the putative NikR binding was replaced with a C stretch, as described previously (Dosanjh et al. 2009). Recombinant NikR did bind when the ureA2 promoter with the putative NikR-binding site was present (Fig. 3b, first and

A

31

61

pM NikR

NikR-PureA

The previously suggested consensus sequence for NikR operators (TATWA-N15-TWATA) does not allow identification of several of the confirmed highaffinity NikR operators in H. pylori, due to mismatches with C or G residues. Using the previously described H. pylori high affinity NikR binding sites (Delany et al. 2005; Ernst et al. 2006; Dosanjh et al. 2009) and the H. mustelae NikR operators in the ureA and ureA2 promoters, we redefined the consensus sequence to TRWYA-N15-TRWYA. This consensus sequence was used to search the intergenic regions from -198 to ?2 (relative to the first nucleotide of the annotated translational startcodon) of the H. pylori, H. acinonychis and H. hepaticus genome sequences (Tomb et al. 1997; Suerbaum et al. 2003; Eppinger et al. 2006). We also searched the

NikR 0

1.0 4.8

24

122

pM NikR

NikR-PureA2

PureA

PureA2

NikR-PureA2

NikR-PureA2-50nt

PureA2

PureA2-50nt

NikR-PureA/ureA2 NikR-PureA2 PureA2 PureA

PureA2-50nt operator

Fig. 3 NikR controls ureAB and ureA2B2 transcription by sequence-specific direct binding to the H. mustelae ureA and ureA2 promoter regions. a Electrophoretic mobility shift assays with recombinant H. mustelae NikR protein and the ureA (PureA) and ureA2 promoters (PureA2) in the presence of NiCl2. The NikR-complexed ureA and ureA2 promoters are indicated as NikR-PureA and NikR-PureA2. The first panel shows NikR binding to the ureA promoter, the second panel to the ureA2 promoter. The third panel shows that when the ureA and ureA2 promoters are mixed at equimolar ratios, the ureA2 promoter is shifted at lower concentrations of NikR and hence has a higher affinity for NikR. b NikR binds to the predicted operator in the

123

Prediction of NikR operators in Helicobacter complete genome sequences

B

NikR

0 1.0 1.9 3.8 7.6 15

second panel), but replacement of the NikR-binding site by a C-stretch resulted in absence of binding (Fig. 3b, third panel).

ureA2 promoter. The predicted operator in the ureA2 promoter was reconstructed as a 50 nt fragment (PureA2-50nt) with the TAATACT-N11-GTTAATA operator replaced by CCCCCCCN11-CCCCCCC (PureA2-50ntDoperator). The three panels show electrophoretic mobility shift assays with recombinant H. mustelae NikR protein in the presence of NiCl2. Top panel: full length ureA2 promoter, middle panel: PureA2-50nt, bottom panel: PureA2-50ntDoperator. The unbound and NikR-complexed versions are indicated on the right. NikR concentrations used (in pM) are indicated above the lanes; the DNA concentration was 32.5 pM of each promoter region

Biometals (2010) 23:145–159

153

unannotated H. mustelae genome sequence for orthologs of metal transport and metal-regulatory genes, and included their predicted promoters in the search. Table 2 shows genes of all four Helicobacter species, which fulfilled two criteria: (1) a putative

NikR operator in predicted promoter region (2) either a predicted function in metal homeostasis or previously shown to be controlled by NikR (Contreras et al. 2003; Delany et al. 2005; Ernst et al. 2005b, 2006; Abraham et al. 2006; Benanti and Chivers

Table 2 Prediction of NikR-operators within intergenic regions of Helicobacter genomes, upstream of genes putatively involved in metal homeostasis

a

Gene

Positiona

Box sequenceb

H.pylori ureA (hp0073) nixA (hp1077) fecA3 (hp1400) frpB4 (hp1512) frpB4 (hp1512) frpB2 (hp0916) fecDE (hp0890) omp31 (hp1469) omp32 (hp1501) copAP (hp1067) copA2 (hp1502)

26695 -143 -119 -48 -24 -112 -88 -91 -67 -88 -64 -75 -51 -125 -101 -49 -25 -99 -75 -99 -75 -160 -136

ataTAACActaattcattttaaaTAATAatt ataTATTAcaattaccaaaaaagTATTAttt catTATTAagttttttttgttttTATTActt aggTATTAttaaatagaataatgTAATAata tatTATTAaatagaataatgtaaTAATAacc aaaTAATActtttttagttataaTAACAatt gaaTATTAgaggaattttaaaaaTAATAaga ataTATTAttatttctttataagTAATActt ctaTAATAaaataattaaaaaagTAACActt tgcTATTAtttggaacgatttatTATTAtaa aagTGTTActtttttaattatttTATTAtag

H.acinonychis ureA (Hac_1532) ureA2 (Hac_0448) frpB (Hac_0072) frpB (Hac_0072) fecA (Hac_0865) omp31 (Hac_0095) omp32 (Hac_1718)

Sheeba -140 -116 -81 -57 -89 -65 -86 -62 -112 -88 -54 -30 -77 -53

agaTAACActaatttgttacaaaTAACAttc aagTATTActttcttaaaaaagtTAATAaca aggTATTAttaaatagaatagtgTAATAata tatTATTAaatagaatagtgtaaTAATAatc cgtTATTAaatttctttagttttTATTAcct ttaTAATAaaataattcagaaagTAATActg ataTATTAttattccactataagTAATActt

H.hepaticus nikA (hh0417) hh0418 arsRS (hh1608)

ATCC 51449 -145 -121 -28 -4 -77 -53

catTATTActctttaatattttaTGTTAtta taaTAACAtaaaatattaaagagTAATAatg tttTATTAtacaatcctcattttTAATAcct

H. mustelae ureA ureA2 ureA2 ureA2 0418-1 (nikH)

NCTC 12198 -164 -140 -142 -118 -132 -108 -112 -88 -73 -49

tttTATTAtttataaatttttctTGATAaat atcTAATAatttttgatataaatTATTAgtt ttcTGATAtaaattattactaaaTAATAttt aaaTAATActtttttaaaaaagtTAATAcaa tagTAATAttgcatcgcaaaaaaTATTAcat

No te s

c c

d d e

Position of the TRWYA-N15-TRWYA sequence relative to annotated or predicted translation start codon

b

Residues in gray background are mismatches to the previously suggested TATWA-N15-TWATA consensus sequence (Delany et al. 2005; Ernst et al. 2006; Dosanjh et al. 2009)

c

Predicted to be in an operon. The predicted operator is present in the intergenic region upstream of the first gene of the predicted operon

d

Overlaps with startcodon of hh0418 gene, shared NikR operator in divergent nikA-hh0418 promoter region

e

The hh1608-1607 genes encode a two-component regulatory system homologous to the H. pylori ArsRS acid-responsive regulatory system (Pflock et al. 2006)

123

154

Biometals (2010) 23:145–159

A

b Fig. 4 Nickel-responsive expression of the H. mustelae

ceuE

hm0418-1

hm0418-2

hm0418-3

nikH 1 kb

B

nikH 0418-1

WT -Ni

+Ni

-Ni

+Ni

0418-2 -Ni

+Ni

0418-3 -Ni

+Ni

94

urease activity (U/mg protein)

C 80 70 60 50

*

*

40 30 20 10 0

wild-type

0418-1

0418-2

0418-3

0418-1/2/3

H. mustelae strain/mutants urease activity (U/mg protein)

D

90 80 70 60 50 40

*

30 20 10 0

Brucella broth

+10 µM Ni

+100 µM Ni

Growth medium

2007; Dosanjh et al. 2009). Interestingly, many genes previously suggested to be NikR-regulated in H. pylori (Contreras et al. 2003; Ernst et al. 2005b, 2006; Abraham et al. 2006; Danielli et al. 2009) were independently identified in our predictive search (Table 2). The absence of a NikR operator in the urease promoter region of H. hepaticus is consistent with the lack of nickel-responsive regulation of urease transcription (Belzer et al. 2005). Identification of a nickel-regulated outer membrane protein of H. mustelae One of the potential NikR operators in H. mustelae is located upstream of a gene encoding a putative

123

Hm0418-1 (NikH) protein and contribution of NikH to urease activity. a Schematic representation of the H. mustelae genomic region containing the hm0418-1 (nikH), hm0418-2, hm0418-3 and ceuE genes. b SDS–PAGE analysis of protein profiles of wild-type H. mustelae NCTC 12198 and its isogenic hm0418-1, hm0418-2 and hm0418-3 mutants, grown under either nickel-restricted (-Ni) or nickel-replete (?Ni) conditions. The wild-type strain shows one protein of approximately 92 kDa which displays expression under nickel-restricted conditions only, and is absent in the hm0418-1 mutant but not in the hm0418-2 and hm0418-3 mutants. The arrow on the left indicates the Hm0418-1 (NikH) protein, the closest marker size (in kDa) is indicated on the right. c Urease activity of H. mustelae wild-type and isogenic hm0418 mutants. Insertional mutagenesis of the nickel regulated hm0418-1 (nikH) gene resulted in a significant decreased urease activity. Insertional mutagenesis of the hm0418-2 and hm0418-3 genes did not affect urease activity, whereas a triple mutant lacking all three hm0418 genes gave the same phenotype as the hm0418-1 mutant. d Supplementation of Brucella media with nickel restores urease activity in the H. mustelae hm0418-1 mutant to levels comparable to the wild-type strain. Black bars represent the wild-type strain, white bars the hm0418-1 (nikH) mutant strain. Results shown are the average of three independent growth experiments. Error bars represent standard deviation, an asterisk represents a significant difference in urease activity (P B 0.05, Mann–Whitney U test) when compared to the wild-type strain (Panel C) or unsupplemented Brucella media (Panel D)

TonB-dependent outer membrane protein homologous to the HH0418 protein of H. hepaticus (Suerbaum et al. 2003; Belzer et al. 2007). In H. hepaticus the hh0418 gene is located divergently to the nikABDE nickel-specific ABC transporter sytem (Beckwith et al. 2001; Suerbaum et al. 2003). In the unpublished H. mustelae genome, the hm0418-1 gene is preceded upstream by two paralogs tentatively named hm0418-2 and hm0418-3, and the three Hm0418 paralogs are 64% identical over the whole length of the proteins, with the Hm0418-2 and Hm0418-3 proteins showing higher identity. The hm0418-1 gene is followed downstream by a ceuE gene encoding a putative periplasmic iron-binding protein (Fig. 4a). The H. hepaticus HH0418 protein was previously suggested to be involved in nickeltransport (Belzer et al. 2007), similar to the H. pylori FecA3 and FrpB4 proteins (Davis et al. 2006; Ernst et al. 2006; Schauer et al. 2007). To test whether the presence of a NikR operator upstream of the hm04181 gene was indicative of NikR- and nickel-responsive regulation, we compared protein profiles of H. mustelae grown in nickel-restricted and nickel-replete conditions. One band corresponding to the predicted

Biometals (2010) 23:145–159

molecular weight (92 kDa) of the Hm0418 proteins was repressed in nickel-replete conditions, but present in nickel-restricted conditions (Fig. 4b). The protein was absent in a hm0418-1 negative mutant, but was present in hm0418-2 and hm0418-3 mutants of H. mustelae. This confirmed that hm0418-1 is nickel-regulated. To test whether Hm0418-1 could be contributing to nickel transport, analogous to the H. pylori FrpB4 protein (Schauer et al. 2007), we assessed the effect of the hm0418 mutations on activity of the UreAB nickel-cofactored urease, since reduced nickel import will reduce urease activity (Schauer et al. 2007). To exclude any contribution of the UreA2B2 urease, cells were lysed by sonication which abolishes all UreA2B2 activity (Stoof et al. 2008). Inactivation of the hm0418-1 gene significantly reduced urease activity, while inactivation of the hm0418-2 and hm0418-3 genes did not affect urease activity (Fig. 4c). Supplementation of Brucella media with nickel, which may enter the periplasm via outer membrane porins, restored urease activity of the hm0418-1 mutant to wild-type levels (Fig. 4d), suggesting that the reduced urease activity in the hm0418-1 mutant is caused by reduced nickel transport accross the outer membrane. Since the presence of the NikR operator, nickelresponsive regulatory pattern and the effect on urease activity all suggest a function of hm0418-1 in nickel uptake by H. mustelae, and we propose the name of NikH for Hm0418-1.

Discussion The nickel-cofactored urease enzyme is widespread among bacterial species, where it often has a role in the production of ammonia for cellular nitrogen metabolism. However, in several bacterial pathogens urease also contributes to resistance to low pH and pathogenesis of infection (Burne and Chen 2000). This is especially apparent in Helicobacter species colonizing the gastric mucosa of many mammals, as all gastric Helicobacter species display high-level expression of either one or two urease enzymes (Solnick and Schauer 2001; Kusters et al. 2006; Stoof et al. 2008). This high level of urease expression in gastric Helicobacter species has not only necessitated the development of high-affinity acquisition systems of the nickel cofactor

155

(Eitinger and Mandrand-Berthelot 2000; Schauer et al. 2007), but handling of such potentially toxic metals also requires mechanisms controlling all aspects of nickel metabolism (Mulrooney and Hausinger 2003; Belzer et al. 2007; Maier et al. 2007). We recently demonstrated that the three carnivorecolonizing Helicobacter species, H. mustelae, H. acinonychis and H. felis have a second, independent urease system designated UreA2B2 (Pot et al. 2007; Stoof et al. 2008), which in H. mustelae allows survival of acid shocks at pH 1.5 (Stoof et al. 2008). Expression of UreA2B2 and UreAB was inversely regulated in response to nickel, with UreA2B2 being nickelrepressed, and UreAB being nickel-induced (Stoof et al. 2008). Although nickel dependent regulation was absent in a nikR mutant, direct interaction of NikR with the urease promoters was not demonstrated. In this study we have further characterized this regulatory mechanism, by studying the role of NikR and Fur in nickelresponsive regulation of H. mustelae urease expression. From the studies with the H. mustelae nikR and fur mutants (Fig. 1), it was apparent that the NikR regulator has a dominant phenotype, as inactivation of the nikR gene resulted in constitutive, nickel- and iron-independent expression of both the UreAB and UreA2B2 ureases, whereas mutation of fur had no effect on nickel dependent regulation of the ureases (Fig. 1). Further characterization of the promoters driving transcription of the ureAB and ureA2B2 genes by primer extension showed that both promoters are transcribed from promoters recognised by the r80cofactored RNA polymerase (Petersen et al. 2003), upstream of the ureA and ureA2 genes. Bioinformatic searches for potential NikR-binding sites were based on those identified in H. pylori (van Vliet et al. 2001; Delany et al. 2005; Ernst et al. 2005b; Benanti and Chivers 2007; Zambelli et al. 2008; Dosanjh et al. 2009), and allowed the prediction of a binding sites in both the H. mustelae ureA and ureA2 promoters, albeit in different locations. The H. mustelae ureA promoter was similar to the H. pylori ureA promoter (Delany et al. 2005; Ernst et al. 2005b), having a NikR-binding site far upstream of the canonical r80 promoter, and shows the same nickel-induced expression pattern (van Vliet et al. 2001). The ureA2 promoter was more similar to the H. pylori nixA promoter (Ernst et al. 2005b), although one of the predicted binding sites overlaps with the -35

123

156

sequence of the promoter (Fig. 2c). A secondary ureA2 NikR operator is located directly upstream of the tested NikR operator (Table 2), and could also be involved in regulation, through multimerisation at the promoter analogous to what has been described for Fur in E. coli (Escolar et al. 1998). In fact the second shift at higher nickel concentrations (middle panel Fig. 3a) may represent NikR binding to a second (lower affinity) NikR binding site. Direct binding of NikR to the ureA and ureA2 promoters was confirmed by gel-shift assays (Fig. 3a), and using site-directed mutagenesis we showed that the initial prediction of a NikR binding site in the ureA2 promoter was correct, as replacement of these residues with a stretch of C residues abolished binding of NikR to this binding site (Fig. 3b). When the ureA and ureA2 promoters were mixed at equimolar concentrations, NikR first shifted the ureA2 promoter (Fig. 3a). This suggests that NikR has a higher affinity for the ureA2 promoter, and is consistent with the observed regulatory pattern of UreAB and UreA2B2 expression. In nickel-restricted conditions, UreA2B2 expression is high, and UreAB expression relatively low (Fig. 1; Stoof et al. 2008). At increasing nickel concentrations, UreA2B2 expression is first switched off, allowing pre-produced UreAB enzyme to be activated (van Vliet et al. 2002). When nickel concentrations increase further, preproduced UreAB is saturated with nickel, and de novo expression of the UreAB urease is increased (van Vliet et al. 2002, 2004; Stingl and De Reuse 2005; Dosanjh et al. 2009). These results suggest that the different promoters compete for available NikR protein, and that promoter affinity determines the order of regulation at increasing nickel concentrations. Interestingly, comparison of the NikR operators in the ureA and ureA2 promoters did suggest differences in binding sequence (Fig. 2b) which may lead to differences in affinity. The ureA2 promoter does contain a perfect palindromic repeat of the left and right arms of the operator sequence whereas the ureA promoter is an imperfect repeat which may lead to reduced binding affinity (Table 2). This ureA/ureA2 promoter configuration is mirrored in H. acinonychis (Table 2). However, the exact role of these differences in binding sites remains to be elucidated, since also the presence of multiple binding sites and the sequences surrounding the binding site, may play a role in determining affinity of NikR for its operator sequences (Benanti

123

Biometals (2010) 23:145–159

and Chivers 2007; Zambelli et al. 2008; Dosanjh et al. 2009). The NikR binding sites found in the ureA and ureA2 promoter of H. mustelae were used to define a new consensus sequence (TRWYA-N15-TRWYA) which was able to identify all confirmed high affinity binding sites in H. pylori (Dosanjh et al. 2009). Next to all the confirmed high affinity operators in the promoters of the H. pylori fecA3, frpB4, ureA and nixA genes, we also identified novel putative NikR operators (Table 2). Amongst these were the genes encoding the H. pylori outer membrane porins HopV (Omp31) and HopW (Omp32) which were previously reported as NikR-regulated by microarray analysis (Contreras et al. 2003). Surprisingly a perfect NikR operator was also found before an operon starting with the hp0890 gene, which includes the genes encoding for the putative ferric citrate ABC transporter system (Tomb et al. 1997; Velayudhan et al. 2000). As for frpB4 and fecA3, the fecDE genes were reported to be iron-independent (van Vliet et al. 2002), and inactivation of fecD gene did not affect iron transport in H. pylori (Velayudhan et al. 2000). The fecDE and upstream hp0890 gene of H. pylori are acid-regulated by the ArsRS two-component regulatory system (Pflock et al. 2006), supporting a role of fecDE in acid-resistance of H. pylori, and a putative role for the fecDE genes in nickel metabolism of H. mustelae is currently under investigation. Screening the genome sequences of other nonpylori Helicobacter species with the revised consensus sequence confirmed the presence of putative NikR operators in front of the nickel-responsive urease systems in H. acinonychis (Stoof et al. 2008), while such an operator is absent in the H. hepaticus urease promoter (Belzer et al. 2005). Similar to H. pylori, its close relative H. acinonychis also encodes homologs of fecA3, frpB4, hopV and hopW which all contain putative NikR boxes in their putative promoter region (Table 2). The H. mustelae and H. hepaticus genomes do not contain orthologs of the H. pylori frpB4 gene, which mediates TonBdependent nickel transport (Davis et al. 2006; Ernst et al. 2006; Schauer et al. 2007). However, both genomes do encode a different TonB-dependent outer membrane ortholog with no known homologs in other bacterial genera [HH0418 in H. hepaticus (Suerbaum et al. 2003; Belzer et al. 2007)]. In H. mustelae there are three orthologs of hh0418, arranged in tandem

Biometals (2010) 23:145–159

157

(Fig. 4a). The hh0418 and hm0418-1 genes contain a putative NikR operator in their promoter sequence, whereas the hm0418-2 and hm0418-3 gene do not. In Helicobacter hepaticus this gene could potentially be involved in nickel transport since the location of the gene is divergent to NikABDE, the periplasmic and inner membrane transporters for nickel (Beckwith et al. 2001; Belzer et al. 2007). In H. mustelae, expression of Hm0418 is nickel-repressed (Fig. 4b), and inactivation of the hm0418-1 gene but not hm0418-2 or hm0418-3 results in reduced urease activity (Fig. 4c). The decreased urease activity in the hm0418-1 mutant could be restored to wild-type levels by nickel-supplementation of the growth medium (Fig. 4d). Taken together, this strongly suggests that Hm0418-1 functions as an outer membrane transporter for nickel, although further experiments are required to confirm this. Comparison of all predicted NikR operators in promoters of Helicobacter metal metabolism genes using the Weblogo program suggests that the NikR operator in Helicobacter is surprisingly well conserved (Fig. 5). To reduce the number of falsepositive hits in genomes it may be sufficient to use TRWTA-N15-TRWTA as consensus sequence if both DNA strands are included in the search. The binding site TRWYA-N15-TRWYA is quite similar to the E. coli NikR binding site GTATGA-N16-TCATAG and the predicted pseudo-NikR box TATTAC-N14GTAATA, present in front of urea carboxylase genes in a- and b-proteobacteria, where these represent an alternative, nickel independent urea degradation pathway (Rodionov et al. 2006). This supports our

approach for the prediction of NikR operators in Helicobacter species, and this can potentially be extended to NikR regulators from other bacterial species. When the genome sequences of the first Helicobacter species were originally published (Berg et al. 1997; Tomb et al. 1997; Suerbaum et al. 2003), it was suggested that these bacterial species have a relatively limited capacity for gene regulation, which is consistent with their restricted ecological niches. However, ongoing studies on the nickel-regulatory protein NikR revealed more and more genes regulated by this protein, but lack of apparent sequence homology in the NikR operator, made it difficult to predict new targets. Here we present a study which demonstrates that the ureA and ureA2 promoters of H. mustelae are directly regulated by NikR and using previously and newly identified NikR operators, we have been able to refine the NikR consensus sequence to one predicting new NikR targets in different Helicobacter species. Our prediction was validated by the identification of the H. mustelae nikH (hm0418-1) gene, a nickel-regulated outer membrane protein contributing to urease activity. Acknowledgments The complete genome sequence of H. mustelae was determined at the Wellcome Trust Sanger Institute, Hinxton, UK, with funding of the Wellcome Trust. Urease antibodies were donated by the Department of Bacteriological R&D of Intervet International BV (Boxmeer, The Netherlands). AHMvV is supported in part by the BBSRC Institute Strategic Programme Grant to the Institute of Food Research.

References

TRWYA

N15

TRWYA

Fig. 5 Weblogo representation of Helicobacter NikR operators identified in the H. pylori, H. mustelae, H. acinonychis and H. hepaticus genomes. The Weblogo algorithm [http://weblogo. berkeley.edu/logo.cgi (Crooks et al. 2004)] was used to represent nucleotide conservation within the Helicobacter NikR operator sequences identified in the upstream regions of Helicobacter genes predicted to be involved in metal metabolism (Table 2), using the TRWYA-N15-TRWYA consensus sequence

Abraham LO, Li Y, Zamble DB (2006) The metal- and DNAbinding activities of Helicobacter pylori NikR. J Inorg Biochem 100:1005–1014 Andrutis KA, Fox JG, Schauer DB, Marini RP, Murphy JC, Yan L, Solnick JV (1995) Inability of an isogenic ureasenegative mutant stain of Helicobacter mustelae to colonize the ferret stomach. Infect Immun 63:3722–3725 Beckwith CS, McGee DJ, Mobley HL, Riley LK (2001) Cloning, expression, and catalytic activity of Helicobacter hepaticus urease. Infect Immun 69:5914–5920 Belzer C, Stoof J, Beckwith CS, Kuipers EJ, Kusters JG, van Vliet AHM (2005) Differential regulation of urease activity in Helicobacter hepaticus and Helicobacter pylori. Microbiology 151:3989–3995 Belzer C, Stoof J, van Vliet AHM (2007) Metal-responsive gene regulation and metal transport in Helicobacter species. Biometals 20:417–429

123

158 Benanti EL, Chivers PT (2007) The N-terminal arm of the Helicobacter pylori Ni2?-dependent transcription factor NikR is required for specific DNA binding. J Biol Chem 282:20365–20375 Bereswill S, Lichte F, Vey T, Fassbinder F, Kist M (1998) Cloning and characterization of the fur gene from Helicobacter pylori. FEMS Microbiol Lett 159:193–200 Berg DE, Hoffman PS, Appelmelk BJ, Kusters JG (1997) The Helicobacter pylori genome sequence: genetic factors for long life in the gastric mucosa. Trends Microbiol 5:468–474 Burne RA, Chen YY (2000) Bacterial ureases in infectious diseases. Microbes Infect 2:533–542 Chivers PT, Sauer RT (2000) Regulation of high affinity nickel uptake in bacteria. Ni2?-dependent interaction of NikR with wild-type and mutant operator sites. J Biol Chem 275:19735–19741 Contreras M, Thiberge JM, Mandrand-Berthelot MA, Labigne A (2003) Characterization of the roles of NikR, a nickelresponsive pleiotropic autoregulator of Helicobacter pylori. Mol Microbiol 49:947–963 Croinin TO, McCormack A, van Vliet AHM, Kusters JG, Bourke B (2007) Random mutagenesis to identify novel Helicobacter mustelae virulence factors. FEMS Immunol Med Microbiol 50:257–263 Crooks GE, Hon G, Chandonia JM, Brenner SE (2004) WebLogo: a sequence logo generator. Genome Res 14:1188– 1190 Danielli A, Romagnoli S, Roncarati D, Costantino L, Delany I, Scarlato V (2009) Growth phase and metal-dependent transcriptional regulation of the fecA genes in Helicobacter pylori. J Bacteriol 191:3717–3725 Davies BJ, de Vries N, Rijpkema SG, van Vliet AHM, Penn CW (2002) Transcriptional and mutational analysis of the Helicobacter pylori urease promoter. FEMS Microbiol Lett 213:27–32 Davis GS, Flannery EL, Mobley HL (2006) Helicobacter pylori HP1512 is a nickel-responsive NikR-regulated outer membrane protein. Infect Immun 74:6811–6820 Delany I, Ieva R, Soragni A, Hilleringmann M, Rappuoli R, Scarlato V (2005) In vitro analysis of protein-operator interactions of the NikR and fur metal-responsive regulators of coregulated genes in Helicobacter pylori. J Bacteriol 187:7703–7715 Dosanjh NS, West AL, Michel SL (2009) Helicobacter pylori NikR’s interaction with DNA: a two-tiered mode of recognition. Biochemistry 48:527–536 Eitinger T, Mandrand-Berthelot MA (2000) Nickel transport systems in microorganisms. Arch Microbiol 173:1–9 Eppinger M, Baar C, Linz B, Raddatz G, Lanz C, Keller H, Morelli G, Gressmann H, Achtman M, Schuster SC (2006) Who ate whom? Adaptive Helicobacter genomic changes that accompanied a host jump from early humans to large felines. PLoS Genet 2:e120 Ernst FD, Homuth G, Stoof J, Ma¨der U, Waidner B, Kuipers EJ, Kist M, Kusters JG, Bereswill S, van Vliet AHM (2005a) Iron-responsive regulation of the Helicobacter pylori iron-cofactored superoxide dismutase SodB is mediated by Fur. J Bacteriol 187:3687–3692 Ernst FD, Kuipers EJ, Heijens A, Sarwari R, Stoof J, Penn CW, Kusters JG, van Vliet AHM (2005b) The nickel-responsive regulator NikR controls activation and repression of

123

Biometals (2010) 23:145–159 gene transcription in Helicobacter pylori. Infect Immun 73:7252–7258 Ernst FD, Stoof J, Horrevoets WM, Kuipers EJ, Kusters JG, van Vliet AHM (2006) NikR mediates nickel-responsive transcriptional repression of the Helicobacter pylori outer membrane proteins FecA3 (HP1400) and FrpB4 (HP1512). Infect Immun 74:6821–6828 Escolar L, Perez-Martin J, de Lorenzo V (1998) Binding of the fur (ferric uptake regulator) repressor of Escherichia coli to arrays of the GATAAT sequence. J Mol Biol 283:537– 547 Haas R, Kahrs AF, Facius D, Allmeier H, Schmitt R, Meyer TF (1993) TnMax -a versatile mini-transposon for the analysis of cloned genes and shuttle mutagenesis. Gene 130:23–31 Kusters JG, van Vliet AHM, Kuipers EJ (2006) Pathogenesis of Helicobacter pylori infection. Clin Microbiol Rev 19:449– 490 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25:402–408 Maier RJ, Benoit SL, Seshadri S (2007) Nickel-binding and accessory proteins facilitating Ni-enzyme maturation in Helicobacter pylori. Biometals 20:655–664 Marshall BJ, Warren JR (1984) Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet i:1311–1315 Mulrooney SB, Hausinger RP (2003) Nickel uptake and utilization by microorganisms. FEMS Microbiol Rev 27:239– 261 O’Rourke JL, Lee A (2003) Animal models of Helicobacter pylori infection and disease. Microbes Infect 5:741–748 Petersen L, Larsen TS, Ussery DW, On SL, Krogh A (2003) RpoD promoters in Campylobacter jejuni exhibit a strong periodic signal instead of a -35 box. J Mol Biol 326:1361– 1372 Pflock M, Finsterer N, Joseph B, Mollenkopf H, Meyer TF, Beier D (2006) Characterization of the ArsRS regulon of Helicobacter pylori, involved in acid adaptation. J Bacteriol 188:3449–3462 Pot RG, Stoof J, Nuijten PJ, de Haan LA, Loeffen P, Kuipers EJ, van Vliet AHM, Kusters JG (2007) UreA2B2: a second urease system in the gastric pathogen Helicobacter felis. FEMS Immunol Med Microbiol 50:273–279 Rodionov DA, Hebbeln P, Gelfand MS, Eitinger T (2006) Comparative and functional genomic analysis of prokaryotic nickel and cobalt uptake transporters: evidence for a novel group of ATP-binding cassette transporters. J Bacteriol 188:317–327 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory Press, New York Schauer K, Gouget B, Carriere M, Labigne A, de Reuse H (2007) Novel nickel transport mechanism across the bacterial outer membrane energized by the TonB/ExbB/ ExbD machinery. Mol Microbiol 63:1054–1068 Solnick JV, Schauer DB (2001) Emergence of diverse Helicobacter species in the pathogenesis of gastric and enterohepatic diseases. Clin Microbiol Rev 14:59–97 Stingl K, De Reuse H (2005) Staying alive overdosed: how does Helicobacter pylori control urease activity? Int J Med Microbiol 295:307–315

Biometals (2010) 23:145–159 Stingl K, Uhlemann EM, Schmid R, Altendorf K, Bakker EP (2002) Energetics of Helicobacter pylori and its implications for the mechanism of urease-dependent acid tolerance at pH 1. J Bacteriol 184:3053–3060 Stoof J, Breijer S, Pot RG, van der Neut D, Kuipers EJ, Kusters JG, van Vliet AHM (2008) Inverse nickel-responsive regulation of two urease enzymes in the gastric pathogen Helicobacter mustelae. Environ Microbiol 10:2586–2597 Suerbaum S, Josenhans C, Sterzenbach T, Drescher B, Brandt P, Bell M, Droge M, Fartmann B, Fischer HP, Ge Z, Horster A, Holland R, Klein K, Konig J, Macko L, Mendz GL, Nyakatura G, Schauer DB, Shen Z, Weber J, Frosch M, Fox JG (2003) The complete genome sequence of the carcinogenic bacterium Helicobacter hepaticus. Proc Natl Acad Sci USA 100:7901–7906 Thomas-Chollier M, Sand O, Turatsinze JV, Janky R, Defrance M, Vervisch E, Brohee S, van Helden J (2008) RSAT: regulatory sequence analysis tools. Nucleic Acids Res 36:W119–W127 Tomb JF, White O, Kerlavage AR, Clayton RA, Sutton GG, Fleischmann RD, Ketchum KA, Klenk HP, Gill S, Dougherty BA, Nelson K, Quackenbush J, Zhou L, Kirkness EF, Peterson S, Loftus B, Richardson D, Dodson R, Khalak HG, Glodek A, McKenney K, Fitzegerald LM, Lee N, Adams MD, Hickey EK, Berg DE, Gocayne JD, Utterback TR, Peterson JD, Kelley JM, Cotton MD, Weidman JM, Fujii C, Bowman C, Watthey L, Wallin E, Hayes WS, Borodovsky M, Karp PD, Smith HO, Fraser CM, Venter JC (1997) The complete genome sequence of the gastric pathogen Helicobacter pylori. Nature 388:539– 547

159 Tsuda M, Karita M, Mizote T, Morshed MG, Okita K, Nakazawa T (1994) Essential role of Helicobacter pylori urease in gastric colonization: definite proof using a urease-negative mutant constructed by gene replacement. Eur J Gastroenterol Hepatol 6(Suppl 1):S49–S52 van Vliet AHM, Wooldridge KG, Ketley JM (1998) Ironresponsive gene regulation in a Campylobacter jejuni fur mutant. J Bacteriol 180:5291–5298 van Vliet AHM, Kuipers EJ, Waidner B, Davies BJ, de Vries N, Penn CW, Vandenbroucke-Grauls CM, Kist M, Bereswill S, Kusters JG (2001) Nickel-responsive induction of urease expression in Helicobacter pylori is mediated at the transcriptional level. Infect Immun 69:4891–4897 van Vliet AHM, Poppelaars SW, Davies BJ, Stoof J, Bereswill S, Kist M, Penn CW, Kuipers EJ, Kusters JG (2002) NikR mediates nickel-responsive transcriptional induction of urease expression in Helicobacter pylori. Infect Immun 70:2846–2852 van Vliet AHM, Ernst FD, Kusters JG (2004) NikR-mediated regulation of Helicobacter pylori acid-adaptation. Trends Microbiol 12:489–494 Velayudhan J, Hughes NJ, McColm AA, Bagshaw J, Clayton CL, Andrews SC, Kelly DJ (2000) Iron acquisition and virulence in Helicobacter pylori: a major role for FeoB, a high-affinity ferrous iron transporter. Mol Microbiol 37:274–286 Zambelli B, Danielli A, Romagnoli S, Neyroz P, Ciurli S, Scarlato V (2008) High-affinity Ni2? binding selectively promotes binding of Helicobacter pylori NikR to its target urease promoter. J Mol Biol 383:1129–1143

123

Biometals (2010) 23:161–172 DOI 10.1007/s10534-009-9276-6

Response of antioxidant defense system to chromium (VI)-induced cytotoxicity in human diploid cells Nino Asatiani • Marina Abuladze • Tamar Kartvelishvili Nina Kulikova • Lali Asanishvili • Hoi-Ying Holman • Nelly Sapojnikova

•

Received: 1 June 2009 / Accepted: 30 October 2009 / Published online: 15 November 2009 ! Springer Science+Business Media, LLC. 2009

Abstract The aim of this study is to establish antioxidant indicators of chromium toxicity in fetal human lung fibroblasts (HLF). The results obtained corroborate and develop our earlier observation of low-dose and long-term action of Cr(VI) on human cells in culture. In the case of a nontoxic chromium dose, temporary oxidative stress is overcome by increased activity of the antioxidant system with correlation to cell cycle re-entry. The toxic concentrations misbalance the cell antioxidant defense systems and cause irreversible growth arrest and massive cell death by apoptosis. Sub-toxicity is defined as toxicity stretched in time. The activity of GPx (glutathione peroxidase) is proposed as a biomarker of oxidative stress caused by Cr(VI), and the GR (glutathione reductase) inhibition is considered as a

N. Asatiani ! M. Abuladze ! T. Kartvelishvili ! L. Asanishvili ! N. Sapojnikova (&) Andronikashvili Institute of Physics, 6 Tamarashvili St., 0177 Tbilisi, Georgia e-mail: [email protected]; [email protected] N. Kulikova I. Javakhishvili Tbilisi State University, 2 University St., 0143 Tbilisi, Georgia H.-Y. Holman E.O. Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720, USA

marker of the toxicity developed under the complex Cr(VI) action. In HLF cells the glutathione dependent defense system is the first system destroyed in response to toxic chromium action. Only the balance between SOD (superoxide dismutase) and H2O2 degrading enzymes (catalase and GPx), should play an important role in the fate of a cell, not individual enzymes. Keywords Chromium (VI) ! Antioxidant enzymes ! Cell cycle ! ROS ! Apoptosis

Introduction The exposure of cells to environmental oxidants such as UV and ionizing radiation, heavy metals, redox active chemicals, hypoxia and hyperoxia increases reactive oxygen species (ROS) production which shifts cell redox status to a more oxidized state known as an oxidative stress. ROS are capable of causing direct damage effect or acting as critical intermediate signaling molecules leading to diverse biological consequences (Costa and Klein 2006; Dewhirst et al. 2008; Leonard et al. 2004). Toxic stress resistance or adaptation of cells to shift in cell redox status could be characterized by the response of the intracellular antioxidant defense system (Mates et al. 2008). The modulation of antioxidant enzymes

123

162

in cultured cells in response to the action of Cr(VI)mediated toxic effect could be used as a model to establish crucial biomarkers of cell adaptation or resistance to toxicants. Toxicity of Cr(VI) has been demonstrated for various human cells, such as gastric mucosa cells, peripheral blood lymphocytes (Trzeciak et al. 2000), human lymphoblast cell line (Jurcat cells) (Shi et al. 1999), and human peripheral blood mononuclear cells (Bagchi et al. 2001). The major cellular targets of Cr(VI) toxicity are lung epithelial cells and lung fibroblasts, however human Cr(VI) intoxication is also associated with hepatotoxicity, nephrotoxicity, cardiotoxicity and immunotoxicity (Pourahmad and O’Brien 2001). Many in vitro studies indicate that when Cr(VI) has contact with biological fluids and tissues, reduction to Cr(III) occurs rapidly due to the presence of reducing agents that keep the body in homeostasis. But in spite of the high reduction capacity of blood plasma, the toxic effect of Cr(VI) still takes place, i.e. the elevated concentration of chromium is observed in peripheral lymphocytes of chrome-plating workers, which correlates with increased DNA strand breaks (Gambelunghe et al. 2003). During the Cr(VI) reduction within a cell, a wide spectra of ROS, such as superoxide, hydrogen peroxide and hydroxyl radicals, are produced (Ye et al. 1999). The cellular toxicity of Cr(VI) is initiated by oxidative stress, resulting in the excess formation of ROS. Cr(VI) inside a cell acts as a multipotent agent, and any biomacromolecules can be its targets. Cr(VI) can produce DNA damage from either an oxidative pathway or a metal-binding pathway that results in a wide variety of DNA lesions. Cr(VI) can inhibit DNA replication and repair (Holmes et al. 2008), alter gene expression (Dubrovskaya and Wetterhahn 1998), activate stress-response pathways (Chuang et al. 2000; Kim and Yurkow 1996; Leonard et al. 2004; Ye et al. 1999), trigger transient or terminal growth arrest and apoptosis (Carlisle et al. 2000; Pritchard et al. 2001a; Rana 2008; Ye et al. 1999). Cells treated with Cr(VI) exhibit apoptotic features, depending on cell line, dose and exposure time: 300 lM Cr(VI) after 3 h of exposure causes apoptosis in 24 h in human lung tumor A549 cells (Ye et al. 1999), a 24 h exposure to 12.5 lM Cr(VI) is apoptogenic for chronic myelogenous leukemic K562 cells, and for

123

Biometals (2010) 23:161–172

cultured J774A.1 murine macrophage cells 0.6 lM Cr(VI) is toxic after 48 h (Bagchi et al. 2001). In cells, the toxic capacity of Cr(VI) can be decreased by antioxidant defense systems, poised against the oxidative assault, which can neutralize the ROS generated by Cr(VI) action. The cellular protective mechanisms against ROS consist of multiple enzymatic [catalase, superoxide dismutase (SOD), glutathione peroxidase (GPx)] and non-enzymatic [a-tocopherol, ascorbic acid (AA), beta-carotene, cysteine and glutathione (GSH)] antioxidants. Superoxide generated by the mitochondria and other sources is converted to H2O2 and O2 by SOD. Abundant catalase enzyme and peroxidases then convert H2O2 to H2O and O2. The antioxidant enzymes can be divided into two types: one that reacts with ROS and diminishes their level (SOD, catalase and peroxidases) and one [glutathione reductase (GR)] that restores reduced forms of nonenzymatic antioxidants (GSH). The disorder of cell redox status causes metabolic and cell proliferation dysfunction and/or cell death. We have reported (Asatiani et al. 2004) that Cr(VI)-treated human epithelial-like L-41 cells died by apoptosis. The dose-dependent involvement of defense mechanisms in response to low level and long-term Cr(VI) treatment was analyzed in dynamic. The nontoxic chromium dose (2 lM) caused transient cell cycle and growth arrest that correlated with the increased activity of glutathione peroxidase—glutathione reductase antioxidant system. The toxic apoptogenic concentration (20 lM) destroyed the cell antioxidant defense systems, and caused irreversibly growth arrest and massive cell death via apoptosis. The particular marker of the toxic Cr(VI) action was the depletion of glutathione-dependent antioxidant defense system. Inhibition of GR was an important aspect of the Cr(VI) toxicity in the L-41 cells. In the present study we continue to consider the cell antioxidant responses to Cr(VI) using fetal human lung fibroblasts (HLF) in culture. We performed a time course study of oxidative stress, cell cycle distortion and the behavior of the antioxidant enzymes in Cr(VI)-induced toxicity to determine if there is an association between oxidative stress, cell cycle distortion, and antioxidant enzymes, and if antioxidant enzymes Cu,Zn-SOD, Mn-SOD, GR, GPx and catalase respond in a coordinated way.

Biometals (2010) 23:161–172

Materials and methods Cell culture The HLF cells (fetal human lung fibroblasts) were maintained as adherent cells in Dulbecco’s modified Eagle’s culture supplemented with 15% fetal bovine serum, 2 mM L-glutamine, 100 units of penicillin/ml, and 100 lg of streptomycin/ml at 37"C in a 5% CO2 incubator. Cells were harvested with trypsin (0.25%)/ EDTA solution. In all experiments HLF cells were used in the range of 25–30 cell passages in culture. Chromium treatment and viability assay HLF cells were seeded at 3 9 104 cells per well in 200 ll culture medium in 96-well microtiter plates and cultured to 80% of confluence. Cr(VI) at 2, 5, 10, 15, 20, 25 and 30 lM was added as potassium chromate at 48 h of growth and the cells continued to grow for 24 and 48 h. Viability of chromium-exposed HLF cells was assessed by the ability of viable cells to convert the tetrazolium dye MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazoliumbromide) to a water-insoluble formazan dye, which is based on the activation of succinate dehydrogenase (Carmichael et al. 1987). The culture medium was removed and the colored precipitate was solubilized with DMSO (dimethyl sulfoxide). After 30 min, cell survival and background was determined by absorbance at 570 and 660 nm, respectively. For detecting cell viability after 2 and 24 h of transient chromium action, the exposed cells were rinsed with phosphate-buffered saline and replaced in fresh medium without Cr(VI) up to 48 h prior to determining cell survival by MTT assay. In these assays, four wells were usually examined for each concentration and time point.

163

cell cycle distribution of the viable cells. The apoptotic cells should be observed as a distinct subG1 peak of the hypodiploid DNA. All results are expressed as the mean percent cells from each cell cycle compartment of three experiments. Measurement of ROS The detection of ROS in living cells was carried out by the flow cytometry method using 20 -70 -dichlorofluorescein diacetate (DCFH-DA, Sigma). Cell-permeable DCFH-DA is oxidized in live cells to its fluorescent derivative 20 -70 -dichlorofluorescein (DCF) in the presence of ROS (predominantly hydrogen peroxide and partially •OH and •NO radicals). Accumulation of DCF was measured by an increase of fluorescence at 530 nm and the mean fluorescent intensity (MFI) was used for the estimation of intracellular ROS level. DCFH-DA was added (10 lM final concentration) to HLF cells (about 1 9 106 cells) and the mixture was incubated for 30 min at 37"C. Hydrogen peroxide (10 mM) was used as a positive control. After the incubation cells were subjected to flow cytometry analysis (FACScan, Becton–Dickinson). The elevated ROS level is proportional to an increase of the basal level of the probe (Curtin et al. 2002; Esposti 2002). A flow cytometry method was used for quantitative measurement of superoxide anions with the fluorescent probe dihydroethidium (DHE). DHE is taken up by cells and in the presence of superoxide anion converted to ethidine, which intercalates into nuclear DNA. The degree of fluorescence is proportional to the superoxide anion amount (Carter et al. 1994; Pritchard et al. 2001b). 10 lM DHE was added per 0.5 9 106 cells in 1 ml PBS for 15 min at 37"C and analyzed by FACScan instrument (Becton– Dickinson, USA). Excitation of DHE was at 490 nm, emission was measured at 610 nm.

Measurement of DNA content for cell cycle analysis

Glutathione-dependent antioxidant system

DNA content of propidium iodide (PI) stained cells was measured by flow cytometry using FACScan (Becton–Dickinson, USA) and the separation into phases of the cell cycle was based on the PI fluorescence according to the accepted method (Ormerod 2002). The DNA histogram showed the

Glutathione reductase (GR) activity was measured by TM using the BIOXYTECH GR-340 Assay (Oxis, USA), and glutathione peroxidase (GPx) activity was determined by using BIOXYTECH GPx-340 colorimetric assay for cellular GPx (Oxis, USA) according to the manufacturer instructions.

123

164

Biometals (2010) 23:161–172

Cellular superoxide dismutase

Results and discussion

The technique of SOD assay involves photoreduction of nitro blue tetrazolium (NBT) for the determination of activity of superoxide dismutase following native polyacrylamide gel electrophoresis. The protein corresponding to SOD can be then visualized as achromatic zones through the inhibition of NBT (Sigma) reduction via SOD (Steinman 1985). Achromatic bands were visualized for 50 lg protein equivalent. The positions of the two isozymes of SOD, Cu, Zn-SOD and Mn-SOD were identified by incubation of the cell lysate at 378 C with 2% (w/v) sodium dodecyl sulfate (SDS) for selective inactivation of Mn-SOD (Geller and Winge 1982).

Inhibition of cell growth by Cr(VI)

Catalase activity in the cell crude extract was determined by measuring the rate of H2O2 (10 mM) decomposition in 50 mM potassium phosphate buffer (pH 7.0), in the presence of the cell crude extract at 240 nm and 25"C, eH2 O2 ¼ 43:6 M#1 cm#1 (Beers and Sizer 1952). Preparation of crude cell extract The catalase and SOD activities were investigated in cell crude extracts. Cells (*107) were harvested by centrifugation (3,000 rpm, 5 min, 4"C), rinsed twice in 50 mM phosphate buffer, pH 7.8. The rinsed cells were resuspended in a definite volume of abovementioned buffer 1:4 (w/v), sonicated five times for 10 s bursts (44 kHz), centrifuged (14,000 rpm, 20 min, 4"C), and the soluble extract was used as a sample. The cell crude extracts were standardized per microgram of total protein. Protein concentrations in the cell extract were determined using BCA (bicinchoninic acid) protein assay reagent (Pierce, USA). Statistical analysis Experiments were carried out at least in triplicate unless otherwise stated. All values were expressed as the mean ± SD and analyzed using one-way ANOVA with Scheffe’s test. A P-value less than 0.05 were considered statistically significant.

123

Growth Inhibition (% of control)

Catalase activity

Cell viability following chromium treatment depends on cell line, dose and exposure time, the degree of cell confluency and the number of cell passages in culture. The percentage of apoptotic cells in cultured human normal fibroblasts affected by the same chromium concentration was enhanced in the early passage fibroblasts (Pritchard et al. 2001a). The late passage fibroblasts are characterized by gradually increasing cell death, DNA fragmentation, mitochondrial dysfunction and appearance of apoptotic markers (caspase-3, cytochrome c) (Mammone et al. 2006). We have limited the passage number range of the studied cells to 25–30 cell passages. The dose-dependent response of sub-confluent HLF cells to chromium action has been observed using MTT cytotoxicity assay. Cells were exposed to Cr(VI) in the concentration range from 2 to 30 lM for 24 and 48 h without medium replenishment. The character of Cr(VI) toxicity can be described by the exponential decay (first rate) (Fig. 1), and is doseand time-dependent. 2 lM of Cr(VI) does not induce cytotoxicity during 24 h and decreases cell viability by 10% after 48 h. The cell culture exposed to 5 lM for 24 h and 48 h loses subsequently 10 and 15% of

2 h Cr(VI)+46 h

24 h Cr(VI) 48 h Cr(VI) 24 h Cr(VI) +24 h

Concentration of Cr(VI) ( M)

Fig. 1 Time- and dose-dependent Cr(VI)-induced cytotoxicity by MTT assessment. HLF cells were grown up to 80% of confluence prior to chromium treatment at the concentration range of 2–30 lM for 24 and 48 h (solid lines). To estimate the range and time of Cr(VI) reversible action HLF cells were treated by Cr(VI) for 2 and 24 h (dash lines), then the cultures were rinsed with PBS and replaced in fresh medium up to 48 h prior to determining cell survival. Controls consisted of untreated cells and were assigned as 100%

Biometals (2010) 23:161–172

165

to support cell growth, and promote attachment of cells to the substrate. The question arises whether the concentration of AA in culture media supplemented with serum could contribute to the extracellular reduction of the complemented Cr(VI) and the way it could affect intracellular ROS level and activities of antioxidant defense system. As AA is highly permeable, one can suppose that the extracellular quantity of AA decreases during the experimental conditions and this results in a negligible participation of AA in the extracellular Cr(VI) reduction. But if we follow the consideration concerning the influence of AA/Cr(VI) ratio on the AA pro-oxidant versus antioxidant properties (Poljsak et al. 2005), we can suppose that in our case (low AA to Cr(VI) concentrations) the partial extracellular Cr(VI) reduction to Cr(V) with the appearance of ROS can not be excluded. However, it is difficult to separate inputs of intracellular Cr(VI), Cr(V) from penetrated Cr(V) reduction, and, likewise differentiating intracellularly generated or penetrated ROS because Cr(V) as well as Cr(VI), H2O2 and O2.are highly permeable, and once in a cell they can affect the antioxidant defense system and ROS level.

viable cell population. Incubation of the cells with 10 and 15 lM Cr(VI) decreases cell population by 20– 35% after 24 h of chromium action and by 60–70% after 48 h. Cr(VI) above 20 lM causes significant decrease of the cell viability by 50 and 80% after 24 and 48 h, respectively. To estimate the concentration range and time of reversible Cr(VI) action the treatment of HLF cells with Cr(VI) 2–30 lM Cr(VI) for 2 and 24 h was followed by cell growth in complete medium without chromium up to 48 h. The cell viability was not decreased at the early stage (2 h) of Cr(VI) action even for 30 lM Cr(VI). The effect of 5 lM Cr(VI) at 24 h was entirely reversed in 24 h after replacing the cultured cells in complete medium without chromium. Under these experimental conditions 10 and 15 lM Cr(VI) decreased in toxic effect by 15 and 20%. The cell exposure with toxic concentrations (above 20 lM) resulted in progressive cell death, indicating irreversible chromium action in 24 h. The results show that chromium action on HLF cell culture could be separated into groups: nontoxic—2 and 5 lM Cr(VI), sub-toxic—10 and 15 lM Cr(VI) and toxic—above 20 lM Cr(VI). While entering a cell low concentration of Cr(VI) has no threshold (Liu et al. 2001). The cell culture system models all possibilities of Cr(VI) reduction, which exist under the physiological conditions, including the presence of extracellular reductants in the serum complemented media. The typical natural concentration of chromium reductant such as ascorbic acid (AA) in bovine serum is quite high—about 50–70 lM (Kleczkowski et al. 2005) and comparable with ascorbic acid in blood plasma (Carty et al. 2000). Generally, serum does not exceed 15% of a complete culture media, and the concentration of ascorbic acid comprises about 10 lM. On the other hand, serum could not be omitted from the media as it is a necessary component

A % of Cell Fraction

Fig. 2 Time- and dosedependent effect of Cr(VI) exposure on cell cycle progression

Cr(VI) affects the cell cycle distribution and induces apoptosis The cell cycle analysis for a single time-point gives basically static information detecting only disorders in the cell cycle phase distribution at stress conditions. The applied dynamic flow cytometry analysis provides the ability to follow the changes of the cell cycle phase distribution along with chromium exposure. The studied cell line was affected differently by the nontoxic (5 lM), sub-toxic (15 lM) and toxic (30 lM) doses of chromium, respectively, over 24 h (Fig. 2).

5 µM Cr(VI) Control

4h

17 h

100 90 80 70 60 50 40 30 20 10 0 sub-G 1

G1

S

24 h

G 2 +M

B 100 90 80 70 60 50 40 30 20 10 0

15 µM Cr(VI) Control

sub -G 1

G1

4h

17 h

24 h

S

G 2 +M

C 100 90 80 70 60 50 40 30 20 10 0

30 µM Cr(VI) Control

sub-G 1

G1

4h

17 h

S

24 h

G 2 +M

123

166

123

Apoptotic cells

100

Necrotic cells

Viable cells

90 80

% of Cell Number

Between 48 and 72 h of growth the control HLF cell population predominately consists of G1 phase cells (*70%). The nontoxic 5 lM Cr(VI) had no influence on DNA histogram up to 17 h and caused the cell cycle re-entry at 24 h of Cr(VI) action, lowering the cell fraction in G1 phase to 50% and increasing the cell fraction in S and G2 ? M phase (Fig. 2a). Microscope analysis of cells grown on coverslips demonstrated that the mitotic index did not decrease by comparison with the control and was *12–15% Mi (data not shown). The sub-toxic concentrations of chromium (15 lM) caused the cell cycle re-entry earlier (at 4 h) compared to the nontoxic concentration (Fig. 2b). The increase of the G2 ? M cell fraction with the simultaneous decrease of the G1 cell fraction at 4 h was followed by growth arrest predominantly in G1 phase at 17 h, not affecting S and G2 ? M phases. The growth arrest was also confirmed by the absence of the mitotic cells in the cell population as was demonstrated by microscope analysis (data not shown). The apoptotic sub-G1 fraction increased insignificantly (not more 20%). The growth inhibition observed by the MTT assay at 24 h of chromium treatment (Fig. 1) may partly contribute to the detected growth arrest. The toxic 30 lM Cr(VI) did not affect cell cycle distribution during 17 h of permanent chromium treatment and sharply increased the apoptotic sub-G1 fraction (about 35%) and lowered the cell number in G1 phase to 40% only at 24 h. The resultant decrease of G1 cell fraction is the consequence of the massive cell apoptosis developed at 24 h of chromium exposure (Fig. 2c). Cell population was analyzed by fluorescent microscopy after staining with DNA-specific fluorescent dyes [acridine orange (AO) and ethidium bromide (EB)] for the detection of apoptotic cells (Diaz et al. 1999). Apoptotic nuclei are characterized by highly condensed chromatin. The data of the morphological analysis of Cr(VI) on HLF cells in the range from 5 to 30 lM Cr(VI) action at 24 h are presented in Fig. 3. The results show, that a narrow range of chromium concentrations initiated diverse effects in HLF cell culture such as, induction of the cell cycle re-entry (nontoxic concentration of 5 lM), growth arrest (subtoxic concentration of 15 lM) and apoptosis (toxic concentration of 30 lM).

Biometals (2010) 23:161–172

70 60 50 40 30 20 10 0

C

5

10

15

20

30

Concentration of Cr(VI) (µM)

Fig. 3 Effect of Cr(VI) on cell survival after treatment of HLF cells with various chromium concentrations for 24 h determined by morphological analysis

ROS in HLF cells during Cr(VI) action The intracellular redox environment may influence cell cycle progression (Conour et al. 2004; Noda et al. 2001). It was hypothesized that ROS could contribute to cell cycle progression, and a late-G1 phase checkpoint was proposed after transition across the growthfactor-dependent G1 restriction point that was coordinating cellular ROS production with cell population transition from G1 to S phase (Havens et al. 2006). There is evidence that fluctuation in the cellular redox state contributes in the cell cycle regulatory pathways (Mennon and Goswami 2007; Sarsour et al. 2008). The nontoxic, sub-toxic and toxic doses of Cr(VI) initially increased ROS production to a comparable level (above twofold) at 2 h of chromium action (Fig. 4a). The nontoxic concentration caused the reestablishment of ROS level to the control value at 24 h. The ROS level had decreased at 24 h under sub-toxic and toxic concentrations. The decrease of ROS level under these concentrations correlated with the greater loss of cell viability and apoptosis. The decrease of the ROS level at the late stages of apoptosis was also observed in the case of Fasinduced apoptosis (Aronis et al. 2003; Shen and Pervaiz 2006). Superoxide anion production detected by DHE (Fig. 4b) was enhanced at 2 h of chromium action. The extent of the increase was more pronounced for

Biometals (2010) 23:161–172 Fig. 4 ROS level in control untreated and Cr(VI)treated HLF cells

167 ROS (DCFH-DA)

A

Control

5 uM Cr(VI)

15 uM Cr(VI)

30 uM Cr(VI)

200

400

5 uM Cr(VI)

15 uM Cr(VI)

30 uM Cr(VI)

160

% of Control

300

% of Control

Control

180

350

250 200 150 100

140 120 100 80 60 40

50 0

ROS (DHE)

B

20 2h

the toxic concentration. The nontoxic and sub-toxic concentrations restored superoxide anion level to control value at 24 h. Only toxic concentration lowered superoxide anion production. Cr(VI) induces the oxidative stress initially during the first hours of cell treatment. Later intracellular ROS scavengers are able to overcome it. The nature of the functioning of antioxidants should determine the cell susceptibility to oxidative stress and chromium toxicity. Glutathione-dependent antioxidant system in HLF cells during Cr(VI) action The glutathione peroxidase—glutathione reductase system is generally accepted as crucial in modulating ROS level. Changes in the glutathione-dependent system may work as a primary defense against cellular redox imbalance (Haddad et al. 2000; Harlan et al. 1984). Figure 5a, b represents the activity of glutathione-dependent antioxidant enzymes under 5, 15 and 30 lM of Cr(VI) action. The nontoxic 5 lM Cr(VI) caused gradual increase of GPx activity to the maximal level at 24 h. Further GPx activity decreased to the control value at 48 h (Fig. 5a). For the considered timepoints (2–48 h) the GR activity (Fig. 5b) decreased, then increased and even surpassed the corresponding control value at 24 and 48 h. The simultaneous increase of both GPx and GR activities (5 lM, 24 h) could be an indication of the intensification of oxidative stress and successful functioning of the glutathione cycle enzymes, which resulted in the normalization of ROS level. It seems that the intracellular antioxidant defense system overcomes the initial oxidative stress connected with the action

24 h

0

2h

24 h

of the nontoxic (5 lM) chromium concentration as it recovers over 48 h. The cell treatment with the sub-toxic chromium concentration [15 lM Cr(VI)] revealed the coordinated character of GPx and GR changes at 2 and 4 h. These alterations pointed to the coordinated functioning of the glutathione defense antioxidant cycle during the first hours of chromium treatment. As the action of 15 lM Cr(VI) proceeds to 24 h GPx activity continues to increase, but the GR activity falls sharply. The absence of GR activity could reflect the irreversible disruption of the glutathione cycle that was paralleled with the decreased cell viability and growth arrest at the whole cell population level. Therefore the toxic effect of 15 lM Cr(VI) was time-dependent and developed at 24 h. This time-dependent enhanced toxicity of 15 lM Cr(VI) could be associated with the involvement of GR in the intracellular chromium reduction that affected the glutathione cycle and irreversibly inhibited it. The transient increase of oxidative stress with simultaneous appropriate function of glutathionecycle enzymes in the cases of nontoxic concentration (24 h) and the early effect of sub-toxic concentration (4 h) correspond to the cell cycle re-entry (Fig. 2). Regarding 24 h as the critical point for the subtoxic 15 lM Cr(VI) concentration, we additionally examined the glutathione-dependent enzyme system at 10 lM Cr(VI). This concentration is also defined as sub-toxic for the studied system, as it causes irreversible inhibition of cell viability (Fig. 1) during prolonged exposure. At this concentration the GPx activity is also increased as compared to the control (Insert to Fig. 5a), but GR activity is characterized by its high level (Insert to Fig. 5b). Later, at 36 h, GR is

123

168

A

Control

5 uM Cr(VI)

15 uM Cr(VI)

30 uM Cr(VI)

160 140

160

120 140

GPx activity (mU/ml)

Fig. 5 Glutathionedependent antioxidant system in control untreated and Cr(VI)-treated HLF cells. Inserts are GPx and GR activity at 24 h of subtoxic 10 and 15 lM Cr(VI) action

Biometals (2010) 23:161–172

100 80

120

60

100

40 20

80

0

60

10 uM Cr(VI)

15 uM Cr(VI)

Control

10 uM Cr(VI)

15 uM Cr(VI)

20 0

B

2h

4h

24 h

48 h

Control

5 uM Cr(VI)

80

15 uM Cr(VI)

30 uM Cr(VI)

70

80

60 50

70

GR activity (mU/ml)

Control

40

40

60

30 20

50

10

40

0

30 20 10 0

2h

4h

inhibited and as a result collapse of glutathione cycle occurs (data not shown). The changes of GPx and GR activities under the toxic 30 lM Cr(VI) are similar to the sub-toxic concentration effect at 2 and 4 h. The prolonged action of 30 lM Cr(VI) to 24 h inhibits entirely both GPx and GR activities, thus the disruption of the glutathione-dependent antioxidant defense system takes place. Consideration of GR as the marker of Cr(VI) toxicity in the studied system expands the number of the cell types, for which the accompaniment of Cr(VI) toxicity with GR inhibition has been reported. The chromate-caused inhibition of GR has been observed in erythrocytes (Koutras et al. 1965), fibroblasts (Sugiyama et al. 1991), osteoblasts (Ning and Grant 2000) and hepatocytes (Gunarantnam and Grant 2004). Recently the complete inhibition of GR activity by 10 lM Cr(VI) action has been shown in the J744.1 murine macrophage cell line (Lalaouni et al. 2007). The mechanism of the toxic action of

123

24 h

48 h

Cr(VI) on GR is proposed as arising from its participation in one- and/or two-electron transference and reduction of Cr(V) to Cr(IV) and/or Cr(III) (Bal and Kasparzak 2002). Generated toxic metabolites irreversibly inhibit GR activity. Thus GR under chromium action has a dual function as an antioxidant, restoring the GSH pool, and as a pro-oxidant, reducing intracellular chromium, and as a result participating in ROS generation. The complicated character of the alteration in the glutathione-dependent defense enzyme activities in the studied system testifies to their involvement both in oxidative stress and in chromium toxicity. The nontoxic concentration initiates the general antioxidant reactions, revealed by the progressive coordinated increase of GPx and GR at the early stage of Cr(VI) action and reaching the control level at 48 h of Cr(VI) action. The toxic concentration also causes the coordinated response of GPx and GR followed by total inhibition at 24 h. The time-dependent behavior of GPx at sub-toxic concentration is very much the

Biometals (2010) 23:161–172

169

same as the activity of GPx at nontoxic Cr(VI) concentration when the oxidative stress takes place. The time-dependent changes of GR activity at subtoxic Cr(VI) concentration is similar to the GR behavior when the toxic conditions are developing under 30 lM of Cr(VI). The glutathione-dependent defense system at the sub-toxic concentration reveals general antioxidant activity at 2 and 4 h of Cr(VI) action and pro-oxidant activities at 24 h, expressed in the GPx/GR imbalance. Thus the GR depletion can be considered as one of the markers of toxicity and GPx as a marker of oxidative stress caused by Cr(VI). ROS and antioxidant enzymes Antioxidant enzymes predominate in the antioxidant defenses to protect against ROS. The antioxidant enzymes in the enzymatic antioxidant pathway influence each other and their ratio can define a cell physiology. Overexpression of Cu, Zn-SOD in human glioma cells changes endogenous GPx and catalase activities. Depending on the Cu, Zn-SOD/GPx value the cell clones could more or less suppress the malignant phenotype (Zhang et al. 2002). The

SOD catalyzes O2 5 µM Cr(VI)

A

complex relation between the two antioxidant enzymes Mn-SOD and catalase and cell death by apoptosis is summarized in (Kahl et al. 2004). In the studied system the rise in the O2.- radical level (Fig. 4b) correlates with the increase of activity of both SODs under action of all examined Cr(VI) concentrations at the early stage (Fig. 6). After 24 h of Cr(VI) action the tendency of O2.- radical reduction also correlates with the changes in SOD activities. The reaction product of O2.- dismutation via SOD action is H2O2, therefore were expected simultaneous changes of H2O2 level under examined Cr(VI) concentrations. Indeed, the rise in O2.- radical level at 2 h contributes in the increase of H2O2 level (Fig. 4), although the changes of H2O2 quantity are pronounced strongly. Catalase shares H2O2 as the substrate with GPx, although GPx alone can react with lipids and other organic peroxides. That is why GPx is a major source of protection against low level oxidative stress (low level of H2O2), whereas catalase becomes more significant in severe oxidative stress (Halliwell and Gutteridge 1999). At the early stage (2 h) of Cr(VI) action (with a sharp increase in H2O2 level) nontoxic concentration

dismutation to H 2O2

15 µM Cr(VI)

30 µM Cr(VI)

Mn -SOD

Cu,Zn-SOD

C

Peak D ensity (% of Control)

B

2h Control

200 180

C

24 h

C

C

2h

Cr(VI)

24 h

Control

Cr(VI)

200

Mn-SOD Cu,Zn-SOD

180

Mn-SOD Cu,Zn-SOD

160

160 140 120

24 h

24 h

140

C

200 180

24 h

24 h

140 120

120 100

100

80

80

60

60

40

40

20 0

20

20 0

0 Mn-SOD Cu,Zn -SOD

C

Control Cr(VI) Mn-SOD Cu,Zn-SOD

160

100 80 60 40

2h

2h

2h

Mn-SOD Cu,Zn -SOD

Fig. 6 SODs activity in control untreated (C) and Cr(VI)treated HLF cells. The photochemical NBT method of SOD detection in 12.5% native gel. The achromatic zones of SOD

2h

Mn-SOD Cu,Zn -SOD

positions in a gel are presented in the invert images (a). Quantification of the gel bands measuring the peak density (b)

123

170

Biometals (2010) 23:161–172

160

Control

5 uM Cr(VI)

15 uM Cr(VI)

30 uM Cr(VI)

Catalase activity (U/ml)

140 120 100 80 60 40 20 0

2h

4h

24 h

48 h

Fig. 7 Catalase activity in control untreated and Cr(VI)treated HLF cells

did not cause an appreciable increase of catalase and GPx activities compared with corresponding controls, whereas under sub-toxic concentration increase of catalase activity corresponds to the sharp reduction of GPx activity, which becomes stronger at toxic concentration (30 lM Cr(VI), 4 h, Figs. 7, 5a). Under long-term action (24 h) of nontoxic 5 lM Cr(VI) the activities of catalase and GPx rise sharply, that is a probable cause of H2O2 level diminution up to the corresponding control level (Fig. 4a). The action of Cr(VI) toxic concentration at 24 h causes complete exhaustion of GPx, while catalase still functions. The subsequent examination of catalase and GPx activities under sub-toxic and toxic concentrations of Cr(VI) points to the interchangeable role of these enzymes. The correlation between the activities of ROS– catalase–GPx–SOD, suggests that a balance between SOD and H2O2 degrading enzymes, but not individual enzymes, should play an important role in the fate of a cell.

Concluding remarks Chromium affects all antioxidants in the enzymatic antioxidant pathways depending on the concentration range. The nontoxic Cr(VI) concentration (5 lM) activates glutathione-dependent antioxidant enzymes and SODs from the early beginning of its action in response to the increased ROS level, and when the

123

oxidative stress is gradually overcome the activities are normalized to their control values. Sub-toxic concentrations (10 and 15 lM) separate the activity of glutathione-cycle enzymes in a time-dependent manner, revealing their antioxidant activities at the early stage of Cr(VI) action in response to the oxidative stress observed under these conditions. The imbalance of GPx/GR at the sub-toxic concentrations developed later points to the toxic pro-oxidant effect of Cr(VI) reduction, leading to Cr(III) formation and destruction of macromolecules. At the toxic concentration (30 lM) the glutathione-cycle enzymes are inhibited, as compared to the control enzyme activities, from the beginning of Cr(VI) action, then the system activates to an insignificant degree and after the prolonged Cr(VI) action becomes fully inhibited with the cells dying by means of apoptosis. By the time the SODs activity is decreased, the catalase activity is still high, however the remaining activity of the enzymes can not reverse the cell fate. Cell reentry in the proliferative cycle at transient oxidative stress takes place only at the coordinated function of antioxidant enzymes. Acknowledgments The authors would like to thank Professor Len W. Poulter (Department of Immunology, UCL, London) for his kind gift of HLF cell line and Lia Lezhava for technical assistance. We are grateful to the ISTC for Project G349 Grant research funding.

References Aronis A, Melendez JA, Golan O, Shilo S, Dicter N, Tirosh O (2003) Potentiation of Fas-mediated apoptosis by attenuated production of mitochondria-derived reactive oxygen species. Cell Death Differ 10:335–344 Asatiani N, Sapojnikova N, Abuladze M, Kartvelishvili T, Kulikova N, Kiziria E, Namchevadze E, Holman H-Y (2004) Effects of Cr(VI) long-term and low-dose action on mammalian antioxidant enzymes (an in vitro study). J Inorg Biochem 98:490–496 Bagchi D, Bagchi M, Stohs SJ (2001) Chromium (VI)-induced oxidative stress, apoptotic cell death and modulation of p53 tumor suppressor gene. Mol Cell Biochem 222:149–158 Bal W, Kasparzak KS (2002) Induction of oxidative DNA damage by carcinogenic metals. Toxicol Lett 127:55–62 Beers RF, Sizer IW (1952) A spectrophotometric method for measuring the breakdown of hydrogen peroxide by catalase. J Biol Chem 195:133–140 Carlisle DL, Pritchard DL, Singh J, Patierno SR (2000) Chromium(VI) induces p53-dependent apoptosis in diploid human lung mouse dermal fibroblasts. Mol Carcinog 28:111–118

Biometals (2010) 23:161–172 Carmichael J, DeGraff W, Gazdar AF, Minna JD, Mitchell JB (1987) Evaluation of a tetrazolium-based semiautomated colorimetric assay: assessment of radiosensitivity. Cancer Res 47:936–942 Carter WO, Narayanan PK, Robinson JP (1994) Intracellular hydrogen peroxide and superoxide anion detection in endothelial cells. J Leukoc Biol 55:253–258 Carty JL, Bevan R, Waller H, Mistry N, Cooke M, Lunec J, Griffiths HR (2000) The effects of vitamin C supplementation on protein oxidation in healthy volunteers. Biochem Biophys Res Commun 273:729–735 Chuang S-M, Liou G-Y, Yang J (2000) Activation of JNK, p38 and ERK mitogen-activated protein kinases by chromium (VI) is mediated through oxidative stress but does not affect cytotoxicity. Carcinogenesis 21:1491–1500 Conour JE, Graham WV, Gaskins HR (2004) A combined in vitro/bioinformatic investigation of redox regulatory mechanisms governing cell cycle progression. Physiol Genomics 18:196–205 Costa M, Klein CB (2006) Toxicity and carcinogenicity of chromium compounds in humans. Crit Rev Toxicol 36:155–163 Curtin JF, Donovan M, Cotter TG (2002) Regulation and measurement of oxidative stress in apoptosis. J Immunol Methods 265:49–72 Dewhirst M, Cao Y, Moeller B (2008) Cycling hypoxia and free radicals regulate angiogenesis and radiotherapy response. Nat Rev Cancer 8:425–437 Diaz G, Setzu MD, Zucca A, Isola R, Diana A, Murru R, Sogos V, Gremo F (1999) Subcellular heterogeneity of mitochondrial membrane potential: relationship with organelle distribution and intercellular contacts in normal, hypoxic and apoptotic cells. J Cell Sci 112:1077–1084 Dubrovskaya VA, Wetterhahn K (1998) Effects of Cr(VI) on the expression of the oxidative stress genes in human lung cells. Carcinogenesis 19:1401–1407 Esposti MD (2002) Measuring mitochondrial reactive oxygen species. Methods 26:335–340 Gambelunghe A, Piccinini R, Ambrogi M, Villarini M, Moretti M, Marchetti C, Abbritti G, Muzi G (2003) Primary DNA damage in chrome-plating workers. Toxicology 188:187– 195 Geller BL, Winge DR (1982) Rat liver Cu, Zn-superoxide dismutase. Subcellular location in lysosomes. J Biol Chem 257:8945–8952 Gunarantnam M, Grant MH (2004) Damage to F-actin and cell death induced by chromium VI and nickel in primary monolayer cultures of rat hepatocytes. Toxicol In Vitro 18:245–253 Haddad JJE, Oliver RE, Land SC (2000) Antioxidant/Prooxidant equilibrium regulates HIF-1a and NF-kB redox sensitivity. Evidence for inhibition by glutathione oxidation in alveolar epithelial cells. J Biol Chem 275:21130– 21139 Halliwell B, Gutteridge JMC (1999) Free radicals in biology and medicine. Oxford Science Publication, Oxford University Press, Oxford Harlan J, Levine JD, Callahan RS, Schwartz BR, Harker LA (1984) Glutathione redox cycle protects cultured endothelial cells against lysis by extracellularly generated hydrogen peroxide. J Clin Invest 73:706–713

171 Havens CG, Ho A, Yoshika N, Dowdy SF (2006) Regulation of late G1/S phase transition and APCCdh1 by reactive oxygen species. Mol Cell Biol 26:4701–4711 Holmes AL, Wise SS, Wise JP Sr (2008) Carcinogenicity of hexavalent chromium. Indian J Med Res 128:353–372 Kahl R, Kampko¨tter A, Wa¨tjen W, Chovolou Y (2004) Antioxidant enzymes and apoptosis. Drug Metab Rev 36:747– 762 Kim J, Yurkow EJ (1996) Chromium induces a persistent activation of mitogen-activated protein kinases by a redox-sensitive mechanism in H4 rat hepatoma cells. Cancer Res 56:2045–2051 Kleczkowski M, Klucin´ski W, Shaktur A, Sikora J (2005) Concentration of ascorbic acid in the blood of cows affected with mastitis. Bull Vet Inst Pulawy 49:203–207 Koutras GA, Scheider AS, Hattori M, Valentine WN (1965) Studies on chromated erythrocytes. Mechanisms of chromate inhibition of glutathione reductase. Brit J Haematol 11:360–369 Lalaouni A, Henderson C, Kupper C, Grant MH (2007) The interaction of chromium (VI) with macrophages: depletion of glutathione and inhibition of glutathione reductase. Toxicology 236:76–81 Leonard SS, Harris GK, Shi X (2004) Metal-induced oxidative stress and signal transduction. Free Rad Biol Med 37:1921–1942 Liu K, HuslerSurname J, Ye J, Leonard SS, Cutler D, Chen F, Wang S, Zhang Z, Ding M, Wang L, Shi X (2001) On the mechanism of Cr(VI)-induced carcinogenesis: dose dependence of uptake and cellular responses. Mol Cell Biochem 222:221–229 Mammone T, Gan D, Foyouzi-Youssefi R (2006) Apoptotic cell death increases with senescence in normal human dermal fibroblast cultures. Cell Biol Int 30:903–909 Mates JM, Segura JA, Alonso FJ, Marquez J (2008) Intracellular redox status and oxidative stress: implications for cell proliferative, apoptosis, and carcinogenesis. Arch Toxicol 82:273–299 Mennon SG, Goswami PC (2007) A redox cycle within the cell cycle: ring in the old with the new. Oncogene 26:1101– 1109 Ning J, Grant MH (2000) The role of reduced glutathione and glutathione reductase in the cytotoxicity of chromium(VI) in osteoblasts. Toxicol In Vitro 14:329–335 Noda T, Iwakiri R, Fujimoto K, Aw TY (2001) Induction of mild intracellular redox imbalance inhibits proliferation of CaCo-2 cells. FASEB J 15:2131–2139 Ormerod MG (2002) Investigating the relationship between the cell cycle and apoptosis using flow cytometry. J Immun Methods 265:73–80 Poljsak B, Gazdag Z, Jenko-Brinovec S, Fujs S, Pesti M, Belagyi J, Plesnicar S, Raspor P (2005) Pro-oxidative vs antioxidative properties of ascorbic acid in chromium(VI)-induced damage: an in vivo and in vitro approach. J Appl Toxicol 25:535–548 Pourahmad J, O’Brien TJ (2001) Biological reactive intermediates that mediate Chromium (VI) toxicity. In: Dansette PM (ed) Biological reactive intermediates VI: chemical and biological mechanisms in susceptibility to and prevention of environmental diseases: advances in experimental medicine and biology. Springer, Berlin, p 203

123

172 Pritchard DE, Ceryak S, Ha I, Fornsaglio JL, Hartman SK, O’Brien TJ, Patierno SR (2001a) Mechanism of apoptosis and determination of cellular fate in Chromium(VI)exposed population of telomerase-immortalized human fibroblasts. Cell Growth Differ 12:487–496 Pritchard KA Jr, Ackerman AW, Gross ER, Stepp DW, Shi Y, Fontana ST, Baker JE, Sessa WC (2001b) Heat shock protein 90 mediates the balance of nitric oxide and superoxide anion from endothelial nitric-oxide synthase. J Biol Chem 276:17621–17624 Rana SVS (2008) Metals and apoptosis: recent development. J Trace Elem Med Biol 22:262–284 Sarsour EH, Venkatraman S, Kalen AL, Oberley LW, Goswami PC (2008) Manganese superoxide dismutase activity regulates transitions between quiescent and proliferative growth. Aging Cell 7:405–417 Shen H-M, Pervaiz Sh (2006) TNF receptor superfamilyinduced cell death: redox-dependent execution. FASEB J 20:1589–1598 Shi X, Ding M, Ye J, Wang S, Leonard SS, Zang L, Castranova V, Vallyathan V, Chiu A, Dala N, Liu K (1999) Cr(VI) causes activation of nuclear transcription factor kB, DNA strand breaks and dG hydroxylation via free radical reactions. J Inorg Biochem 75:37–44

123

Biometals (2010) 23:161–172 Steinman HM (1985) Bacteriocuprein superoxide dismutases in pseudomonads. J Bacteriol 162:1255–1260 Sugiyama M, Tsuzuki K, Ogura R (1991) Effect of ascorbic acid on DNA damage, cytotoxicity, glutathione reductase, and formation of paramagnetic chromium in Chinese hamster V-79 cells treated with sodium chromate(VI). J Biol Chem 266:3383–3386 Trzeciak A, Kowalik J, Malecka-Panas E, Drzewoski J, Wojewodzka M, Iwanenko T, Blasiak J (2000) Genotoxicity of chromium in human gastric mucosa cells and peripheral blood lymphocytes evaluated by single cell gel electrophoresis (comet assay). Med Sci Monit 6:24–29 Ye J, Wang S, Leonard SS, Yi S, Butterworth L, Antonini J, Ding M, Yo R, Vallyathan V, Castranov V, Shi X (1999) Role of reactive oxygen species and p53 in chromium(VI)-induced apoptosis. J Biol Chem 274:34974– 34980 Zhang Y, Zhao W, Zhang HJ, Domann FE, Oberley LW (2002) Overexpression of copper zinc superoxide dismutase suppresses human glioma cell growth. Cancer Res 62:1205–1212

Biometals (2010) 23:173–179 DOI 10.1007/s10534-009-9277-5

Serum zinc is decreased in Alzheimer’s disease and serum arsenic correlates positively with cognitive ability Larry Baum • Iris Hiu Shuen Chan • Stanley Kwok-Kuen Cheung • William B. Goggins Vincent Mok • Linda Lam • Vivian Leung • Elsie Hui • Chelsia Ng • Jean Woo • Helen Fung Kum Chiu • Benny Chung-Ying Zee • William Cheng • Ming-Houng Chan • Samuel Szeto • Victor Lui • Joshua Tsoh • Ashley I. Bush • Christopher Wai Kei Lam • Timothy Kwok

•

Received: 15 October 2009 / Accepted: 30 October 2009 / Published online: 13 November 2009 ! Springer Science+Business Media, LLC. 2009

Abstract Zinc, copper, and iron aggregate Ab and accumulate in Alzheimer’s disease (AD) plaques. Some metals are increased in AD vs. control serum. The authors examined levels of 12 metals in serum of 44 AD and 41 control subjects. Zinc decreased from 12.3 to 10.9 lmol/L (means, p = 0.0007). Arsenic positively correlated with Mini-Mental State Examination score (p \ 0.0001). Zinc deposition in brain amyloid might deplete zinc from other body compartments, such as serum. The arsenic correlation might be caused by the major contribution of seafood

L. Baum (&) School of Pharmacy, The Chinese University of Hong Kong, Shatin, Hong Kong e-mail: [email protected] I. H. S. Chan ! C. W. K. Lam Department of Chemical Pathology, The Chinese University of Hong Kong, Shatin, Hong Kong S. K.-K. Cheung ! V. Mok ! E. Hui ! C. Ng ! J. Woo ! T. Kwok Department of Medicine and Therapeutics, The Chinese University of Hong Kong, Shatin, Hong Kong W. B. Goggins School of Public Health, The Chinese University of Hong Kong, Shatin, Hong Kong L. Lam ! V. Leung ! H. F. K. Chiu ! V. Lui ! J. Tsoh Department of Psychiatry, The Chinese University of Hong Kong, Shatin, Hong Kong

consumption to intake of both arsenic and docosahexaenoic acid, of which the latter may delay AD. Keywords Alzheimer’s disease ! Aluminum ! Arsenic ! Metals ! MMSE ! Serum ! Zinc Introduction Metals may play an important role in Alzheimer’s disease (AD). Amyloid plaques in AD brain contain

B. C.-Y. Zee Centre For Clinical Trials, The Chinese University of Hong Kong, Shatin, Hong Kong W. Cheng Clinical Trials Section, Institute of Chinese Medicine, The Chinese University of Hong Kong, Shatin, Hong Kong M.-H. Chan ! S. Szeto Department of Medicine and Geriatrics, Kwong Wah Hospital, Kowloon, Hong Kong A. I. Bush Oxidation Disorders Laboratory, Mental Health Research Institute of Victoria, and Department of Pathology, University of Melbourne, Parkville 3052, VIC, Australia A. I. Bush Genetics and Aging Research Unit, Massachusetts General Hospital, Harvard Medical School, Charlestown, MA 02129, USA

123

174

Ab and metals, including zinc, copper, and iron (Bush and Tanzi 2002; Deibel et al. 1996; Religa et al. 2006; Smith et al. 1997). Ions of zinc, copper, and iron can induce Ab peptide aggregation (Bush and Tanzi 2002). However, it is not yet clear what role these metals play in the chain of cause and effect in AD; i.e., whether they cause changes, either harmful or beneficial, in Ab peptide aggregation or biochemical properties in vivo, or whether these ions accumulate after plaques have already been deposited. Except for one recent, very large study (Gerhardsson et al. 2008), previous studies have measured metal concentrations in small numbers (10 or fewer) of AD brains (Deibel et al. 1996; Religa et al. 2006). To obtain more insight into metal alterations in AD, larger sample numbers would be desirable. Advantages of serum samples, as compared to brain specimens, are that serum can be taken from a greater number of patients, and from patients at various stages of AD. A disadvantage of serum is that it does not provide direct information on the metal status of the brain. However, AD serum has been reported to contain altered concentrations of some metals. Manganese concentration was greater in plasma of AD than of controls, but the reverse was true in cerebrospinal fluid, suggesting a relation between the brain and blood levels of at least some metals (Gerhardsson et al. 2008). Higher serum levels of copper (Gonzalez et al. 1999; Smorgon et al. 2004; Squitti et al. 2006) were reported in AD than controls, and were associated with faster progression of dementia (Squitti et al. 2009). Studies have also found increased serum aluminum concentration in AD (Roberts et al. 1998; Zapatero et al. 1995), which might be due to greater absorption of dietary aluminum (Taylor et al. 1992). To examine the relation of metals to AD, we measured serum total levels of 12 elements in 44 AD and 41 control subjects.

Materials and methods Subjects were ethnic Chinese (as determined by the investigators) living in Hong Kong. Alzheimer’s disease (AD) patients (n = 44) had NINCDS-ADRDA (National Institute of Neurological and Communicative

123

Biometals (2010) 23:173–179

Disorders and Stroke-Alzheimer’s Disease and Related Disorders Association) diagnosis of probable or possible AD (McKhann et al. 1984), and were recruited from geriatric outpatient clinics (n = 35) and old age homes (N = 9). Control subjects (n = 41) lacked neurological disease. The Cantonese MiniMental Status Examination (MMSE, maximum score 30; Chiu et al. 1994) was administered to 43 AD and one control subject. The local Clinical Research Ethics Committees approved study of these subjects. All subjects gave written informed consent, except that in AD patients who could not give consent, surrogate consent was obtained from their guardians. Serum was collected from all subjects. Metallic and non-metallic trace elements (aluminum, arsenic, beryllium, chromium, cobalt, copper, iodine, iron, manganese, nickel, selenium, and zinc) in serum samples were simultaneously assayed by inductively coupled plasma-mass spectrometry (ICPMS 7500c, Agilent Technologies Inc, Palo Alto, CA, USA). Samples were pre-treated with a diluent containing 0.05% tetra-methyl ammonium hydroxide and a mixture of internal standards containing rhodium, yttrium and iridium before analysis. An on-line reaction cell filled with helium was used to eliminate polyatomic interference due to compounds with similar mass-charge ratio. The inter-assay coefficients of variation were generally \9%. The detection limit of aluminum, arsenic, beryllium, chromium, cobalt, copper, iodine, iron, manganese, nickel, selenium, and zinc were 0.025 lmol/L, 2 nmol/L, 0.5 nmol/L, 3 nmol/L, 0.24 nmol/L, 6 nmol/L, 0.03 lmol/L, 4.1 nmol/L, 2.4 nmol/L, 2.3 nmol/L, 0.08 lmol/L and 0.01 lmol/L, respectively. Beryllium and nickel concentrations for many samples were below the detection limits, thus we did not analyze these metals. Statistical calculations were performed using SPSS 14.0 software (SPSS, Chicago, Illinois, USA). Significance of differences in continuous variables between AD and controls was determined by testing for normality of distributions using the Kolmogorov– Smirnov test with Lilliefors significance level, and then using 2-sided independent sample t tests for normal distributions and Mann–Whitney tests otherwise. Of the metals, only zinc was normally distributed. All other metals were compared using the Mann–Whitney test and natural log transformed for the logistic regression models.

Biometals (2010) 23:173–179

175

Results

Discussion

Table 1 shows descriptive statistics and unadjusted and adjusted p-values comparing metal concentrations for AD and control groups. Figure 1 displays metal concentrations for AD and control groups. In the unadjusted comparisons, the AD patients had significantly lower levels of iron, zinc, iodine, and chromium, and significantly higher levels of aluminum. If a Bonferroni adjusted significance level of 0.05/10 = 0.005 was used, then only zinc was significantly different. After adjustment for age and sex (model 1), iron, zinc, and aluminum significantly differed, with zinc and aluminum still differing after Bonferroni adjustment. After adjustment for all metals simultaneously (model 2), zinc, selenium, and chromium significantly differed, with zinc and selenium differing after Bonferroni adjustment. Of five metals in the forward stepwise regression (model 3), zinc was significant at p \ 0.005. Zinc significantly differed in all models. MMSE scores were significantly correlated with aluminum (Pearson’s correlation coefficient: -0.33, p = 0.03) and arsenic (Fig. 2). Arsenic remained significant after Bonferroni adjustment.

In most carefully designed studies, zinc concentration increased in brain tissue or cerebrospinal fluid of AD compared to controls (Capasso et al. 2005; Cornett et al. 1998; Deibel et al. 1996; Religa et al. 2006). In serum by contrast, the literature generally reported either no change (Dong et al. 2008; Gerhardsson et al. 2008; Gonzalez et al. 1999; Ozcankaya and Delibas 2002) or a decrease (this study) in AD compared to controls. This contrast was supported by a report of a significant negative correlation between amyloid plaque numbers and serum zinc concentration in AD (Tully et al. 1995). Brain zinc levels positively correlated with levels of Ab peptide (which forms amyloid plaques), plaque numbers, and dementia severity in AD (Religa et al. 2006). Zinc is a potent inducer of Ab aggregation (Bush and Tanzi 2002), thus the decrease we observed in serum zinc level in AD might be due to deposition and sequestration of zinc in brain amyloid, perhaps depleting zinc in other body compartments. Zinc released from the neocortical glutamatergic synapse is in communication with the plasma (Friedlich et al. 2004). Therefore, levels of plasma zinc may partly reflect circulation from

Table 1 Differences between AD and control subjects Controls (n = 41)

AD (n = 44)

Unadj. (p)

Model 1 (p)

Model 2 (p)

Model 3 (p)

Age (year)a

79.1 ± 6.0

74.3 ± 8.7

.0041

.027

.0056

Women/men (n)b

20/21

29/15

.13

.0030

.0006

Metals (nmol/L) Iron

23,800 ± 11,000

17,700 ± 8,200

.017

.037

.18

Copper

15,300 ± 2,700

16,200 ± 3,500

.23

.37

.72

Zinca Selenium

12,300 ± 1,600 1,390 ± 240

10,900 ± 1,600 1,420 ± 230

.0001 .56

.0007 .29

.0015 .0020

\.0001 .0078

Iodine

610 ± 170

560 ± 140

.038

.069

.058

.032 .0077

Aluminum

580 ± 620

905 ± 630

.0055

.0023

.12

Arsenic

38.7 ± 37

35.7 ± 40

.57

.61

.096

Cobalt

23.5 ± 28

9.1 ± 12

.27

.55

.64

Chromium

17.2 ± 12

22.7 ± 21

.032

.093

.025

Manganese

13.3 ± 9.2

21.4 ± 21

.065

.26

.48

.020

Results are presented as median ± interquartile range and unadjusted (Unadj.) p value for Mann–Whitney test, except where indicated by, a which indicates mean ± SD and unadjusted p value for t-test, or by, b which indicates Fisher’s exact test. Adjusted p-values were calculated using logistic regression with case–control status as the outcome variable. Three types of models were fit: (1) one metal at a time with age and sex as additional control covariates; (2) all metals in one model along with age and sex; and (3) a model with variables selected from model (2) by forward stepwise selection (p = .05, likelihood ratio test)

123

176

Biometals (2010) 23:173–179

Fig. 1 Scatterplot of serum metal concentrations for control or AD subjects (lmol/L, except for arsenic, cobalt, chromium, and manganese, which are in nmol/L). Bars indicate medians (except for zinc, which are means)

synapses, where accumulated Ab traps zinc, decreasing plasma zinc. This notion was supported by a study in which plasma zinc level in AD was less than

123

the level in controls but rose significantly and into the normal range after treatment with the zinc-binding compound clioquinol, suggesting that the treatment

Biometals (2010) 23:173–179

Fig. 2 Two-way scatterplot of MMSE score vs. logarithm of arsenic concentration (nmol/L). Pearson’s correlation coefficient for the association is 0.55 (p \ 0.0001)

broke down amyloid in the synapse, allowing the synaptic zinc to resume its contribution to plasma (Ritchie et al. 2003). The lack of difference in zinc level between AD and control serum in two other studies (Gonzalez et al. 1999; Ozcankaya and Delibas 2002), in contrast to our very significant difference, remains unexplained. Another possible cause of decreased serum zinc in AD may be diet. A study of nutrient intake found that severe AD patients (institutionalized, with a mean MMSE score of 3) consumed less zinc than controls, probably due to a generally poor diet (Tabet et al. 2001). But zinc intake of mild/moderate AD patients living at home did not differ from controls (Tabet et al. 2001). The unadjusted difference in serum zinc between our AD and control subjects remained significant when we excluded from analysis either institutionalized AD patients (p = 0.001) or subjects with an MMSE score \ 10 (p = 0.002), suggesting that deficient zinc intake in severe AD may not be the cause of our observed difference in serum zinc between AD and controls. In contrast to zinc, aluminum concentration tended to decrease or remain unchanged in the brains of AD patients compared to those of control subjects (Bjertness et al. 1996; Religa et al. 2006), but to increase in AD serum (Roberts et al. 1998; Zapatero et al. 1995), as we found. The increase in serum level may be due to more efficient uptake of dietary aluminum in AD, but the cause of this change in uptake is unknown (Miu et al. 2004; Roberts et al. 1998). An involvement of arsenic in AD has been hypothesized (Gharibzadeh and Hoseini 2008). However, our

177

results show no significant association of serum arsenic level with AD. We did find a strong positive correlation of serum arsenic concentration with MMSE score. There are several possible explanations for this finding. As with zinc, arsenic might be absorbed by amyloid plaques, depleting arsenic from other body compartments, such as blood. Thus, more severe AD with more plaques may show less serum arsenic. However, no studies have yet been published on arsenic binding to Ab or associating with amyloid plaques. Polymorphisms in glutathione S-transferase omega genes GSTO1 and GSTO2 were associated with the age of onset of AD (Li et al. 2003). These polymorphisms might exert their effects through changes in expression or function of the GSTO1 or GSTO2 enzymes. For example, GSTO1 expression differed between hippocampus of AD and controls (Li et al. 2003), and the delE155 form of GSTO1 exhibited specific monomethylarsonate activity double that of wild-type GSTO1 (Schmuck et al. 2005). The arsenic metabolic activity of GSTO1 suggests that polymorphisms may affect both AD onset age and arsenic metabolism. This might explain the correlation of MMSE scores with arsenic levels. However, age at testing (we do not have age of onset data) did not correlate with either arsenic level (p = 0.49) or MMSE score (p = 0.36) in the 44 subjects shown in Fig. 2. In addition, arsenic levels did not significantly differ between AD and control subjects. Besides arsenic compounds, GSTO1 and GSTO2 act on many substrates relevant in AD, including interleukin-1b and ascorbate, and the polymorphisms may affect AD age of onset via actions on any of these other substrates rather than on arsenic compounds (Schmuck et al. 2005). Finally, most arsenic enters the human body through eating seafood (except in areas with very low seafood consumption or unusually high concentrations of arsenic in drinking water), thus serum arsenic concentration may often be an indirect measure of seafood consumption (Tao and Bolger 1999). High intake of inorganic arsenic, such as from drinking water, can impair cognition, but seafood arsenic is generally in organic, non-toxic forms (Tao and Bolger 1999). Eating fish is associated with reduced AD risk, and the association of high serum arsenic with high MMSE score may be due to seafood consumption (Morris et al. 2003). High n -3 fatty acid consumption, particularly of docosahexaenoic acid,

123

178

of which seafood is a rich source, is associated with reduced AD risk and might be responsible for the association of seafood and AD (Morris et al. 2003). Curiously, although arsenic was strongly associated with MMSE score, we saw no decrease in arsenic in AD as compared to controls. Dietary n -3 fatty acid consumption increased learning and memory in animal and human studies (Chen et al. 2006; Chiu et al. 2008; Morris et al. 2003), therefore it might be that docosahexaenoic acid improves cognition in humans who are developing AD but whose cognition has not yet deteriorated enough to be diagnosed, thus delaying the age of onset of AD and reducing the incidence of AD in prospective studies (Morris et al. 2003) but not affecting the risk of eventually developing AD in case–control studies such as ours. Acknowledgments Supported by a grant from The Chinese University of Hong Kong Institute of Chinese Medicine, by a Chinese University of Hong Kong Direct Grant for Research, and by a BUPA Foundation medical research grant.

References Bjertness E, Candy JM, Torvik A, Ince P, McArthur F, Taylor GA, Johansen SW, Alexander J, Gronnesby JK, Bakketeig LS, Edwardson JA (1996) Content of brain aluminum is not elevated in Alzheimer disease. Alzheimer Dis Assoc Disord 10:171–174 Bush AI, Tanzi RE (2002) The galvanization of beta-amyloid in Alzheimer’s disease. Proc Natl Acad Sci U S A 99: 7317–7319 Capasso M, Jeng JM, Malavolta M, Mocchegiani E, Sensi SL (2005) Zinc dyshomeostasis: a key modulator of neuronal injury. J Alzheimers Dis 8:93–108 Chen CC, Chaung HC, Chung MY, Huang LT (2006) Menhaden fish oil improves spatial memory in rat pups following recurrent pentylenetetrazole-induced seizures. Epilepsy Behav 8:516–521 Chiu HFK, Lee HC, Chung WS, Kwong PK (1994) Reliability and validity of the Cantonese version of the mini-mental state examination—a preliminary study. J Hong Kong Coll Psychiatrists 4(Suppl. 2):25–28 Chiu CC, Su KP, Cheng TC, Liu HC, Chang CJ, Dewey ME, Stewart R, Huang SY (2008) The effects of omega-3 fatty acids monotherapy in Alzheimer’s disease and mild cognitive impairment: a preliminary randomized double-blind placebo-controlled study. Prog Neuropsychopharmacol Biol Psychiatry 32:1538–1544 Cornett CR, Markesbery WR, Ehmann WD (1998) Imbalances of trace elements related to oxidative damage in Alzheimer’s disease brain. Neurotoxicology 19:339–345 Deibel MA, Ehmann WD, Markesbery WR (1996) Copper, iron, and zinc imbalances in severely degenerated brain

123

Biometals (2010) 23:173–179 regions in Alzheimer’s disease: possible relation to oxidative stress. J Neurol Sci 143:137–142 Dong J, Robertson JD, Markesbery WR, Lovell MA (2008) Serum zinc in the progression of Alzheimer’s disease. J Alzheimers Dis 15:443–450 Friedlich AL, Lee JY, van GT, Cherny RA, Volitakis I, Cole TB, Palmiter RD, Koh JY, Bush AI (2004) Neuronal zinc exchange with the blood vessel wall promotes cerebral amyloid angiopathy in an animal model of Alzheimer’s disease. J Neurosci 24:3453–3459 Gerhardsson L, Lundh T, Minthon L, Londos E (2008) Metal concentrations in plasma and cerebrospinal fluid in patients with Alzheimer’s disease. Dement Geriatr Cogn Disord 25:508–515 Gharibzadeh S, Hoseini SS (2008) Arsenic exposure may be a risk factor for Alzheimer’s disease. J Neuropsychiatry Clin Neurosci 20:501 Gonzalez C, Martin T, Cacho J, Brenas MT, Arroyo T, GarciaBerrocal B, Navajo JA, Gonzalez-Buitrago JM (1999) Serum zinc, copper, insulin and lipids in Alzheimer’s disease epsilon 4 apolipoprotein E allele carriers. Eur J Clin Invest 29:637–642 Li YJ, Oliveira SA, Xu P, Martin ER, Stenger JE, Scherzer CR, Hauser MA, Scott WK, Small GW, Nance MA, Watts RL, Hubble JP, Koller WC, Pahwa R, Stern MB, Hiner BC, Jankovic J, Goetz CG, Mastaglia F, Middleton LT, Roses AD, Saunders AM, Schmechel DE, Gullans SR, Haines JL, Gilbert JR, Vance JM, Pericak-Vance MA, Hulette C, Welsh-Bohmer KA (2003) Glutathione S-transferase omega-1 modifies age-at-onset of Alzheimer disease and Parkinson disease. Hum Mol Genet 12:3259–3267 McKhann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM (1984) Clinical diagnosis of Alzheimer’s disease: report of the NINCDS-ADRDA work group under the auspices of department of health and human services task force on Alzheimer’s disease. Neurology 34:939–944 Miu AC, Olteanu AI, Miclea M (2004) A behavioral and ultrastructural dissection of the interference of aluminum with aging. J Alzheimers Dis 6:315–328 Morris MC, Evans DA, Bienias JL, Tangney CC, Bennett DA, Wilson RS, Aggarwal N, Schneider J (2003) Consumption of fish and n -3 fatty acids and risk of incident Alzheimer disease. Arch Neurol 60:940–946 Ozcankaya R, Delibas N (2002) Malondialdehyde, superoxide dismutase, melatonin, iron, copper, and zinc blood concentrations in patients with Alzheimer disease: crosssectional study. Croat Med J 43:28–32 Religa D, Strozyk D, Cherny RA, Volitakis I, Haroutunian V, Winblad B, Naslund J, Bush AI (2006) Elevated cortical zinc in Alzheimer disease. Neurology 67:69–75 Ritchie CW, Bush AI, Mackinnon A, Macfarlane S, Mastwyk M, MacGregor L, Kiers L, Cherny R, Li QX, Tammer A, Carrington D, Mavros C, Volitakis I, Xilinas M, Ames D, Davis S, Beyreuther K, Tanzi RE, Masters CL (2003) Metal-protein attenuation with iodochlorhydroxyquin (clioquinol) targeting Abeta amyloid deposition and toxicity in Alzheimer disease: a pilot phase 2 clinical trial. Arch Neurol 60:1685–1691 Roberts NB, Clough A, Bellia JP, Kim JY (1998) Increased absorption of aluminium from a normal dietary intake in dementia. J Inorg Biochem 69:171–176

Biometals (2010) 23:173–179 Schmuck EM, Board PG, Whitbread AK, Tetlow N, Cavanaugh JA, Blackburn AC, Masoumi A (2005) Characterization of the monomethylarsonate reductase and dehydroascorbate reductase activities of Omega class glutathione transferase variants: implications for arsenic metabolism and the ageat-onset of Alzheimer’s and Parkinson’s diseases. Pharmacogenet Genomics 15:493–501 Smith MA, Harris PL, Sayre LM, Perry G (1997) Iron accumulation in Alzheimer disease is a source of redox-generated free radicals. Proc Natl Acad Sci U S A 94:9866–9868 Smorgon C, Mari E, Atti AR, Dalla NE, Zamboni PF, Calzoni F, Passaro A, Fellin R (2004) Trace elements and cognitive impairment: an elderly cohort study. Arch Gerontol Geriatr Suppl 9:393–402 Squitti R, Barbati G, Rossi L, Ventriglia M, Dal FG, Cesaretti S, Moffa F, Caridi I, Cassetta E, Pasqualetti P, Calabrese L, Lupoi D, Rossini PM (2006) Excess of nonceruloplasmin serum copper in AD correlates with MMSE, CSF [beta]-amyloid, and h-tau. Neurology 67:76–82 Squitti R, Bressi F, Pasqualetti P, Bonomini C, Ghidoni R, Binetti G, Cassetta E, Moffa F, Ventriglia M, Vernieri F,

179 Rossini PM (2009) Longitudinal prognostic value of serum ‘‘free’’ copper in patients with Alzheimer disease. Neurology 72:50–55 Tabet N, Mantle D, Walker Z, Orrell M (2001) Vitamins, trace elements, and antioxidant status in dementia disorders. Int Psychogeriatr 13:265–275 Tao SS, Bolger PM (1999) Dietary arsenic intakes in the United States: FDA Total Diet Study, September 1991– December 1996. Food Addit Contam 16:465–472 Taylor GA, Ferrier IN, McLoughlin IJ, Fairbairn AF, McKeith IG, Lett D, Edwardson JA (1992) Gastrointestinal absorption of aluminium in Alzheimer’s disease: response to aluminium citrate. Age Ageing 21:81–90 Tully CL, Snowdon DA, Markesbery WR (1995) Serum zinc, senile plaques, and neurofibrillary tangles: findings from the Nun Study. Neuroreport 6:2105–2108 Zapatero MD, Garcia de JA, Pascual F, Calvo ML, Escanero J, Marro A (1995) Serum aluminum levels in Alzheimer’s disease and other senile dementias. Biol Trace Elem Res 47:235–240

123